complete issue - IMA Fungus

Volume 3 · No. 1 · June 2012 

The Global MycoloGical Journal 

NEWS · REPORTS · AWARDS AND PERSONALIA · RESEARCH NEWS 

BOOK NEWS · fORTHCOmINg mEETINgS · ARTICLES

Colofon 

IMA Fungus 

Compiled by the International 

Mycological Association for the 

world’s mycologists. 

Scope: All aspects of pure and 

applied mycological research and 

news. 

Aims: To be the flagship journal 

of the International Mycological 

Association. IMA FUNGUS is 

an international, peer-reviewed, 

open-access, full colour, fast-track 

journal. 

Frequency: Published twice per year 

(June and December). Articles are 

published online with final pagination 

as soon as they have been 

accepted and edited. 

ISSN 2210-6340 (print) 

E-ISSN 2210-6359 (online) 

Websites: www. imafungus.org 

www.ima-mycology.org 

E-mail: d.hawksworth@nhm.ac.uk 

Volume 3 · No. 1 · June 2012 

Cover: Afrocantharellus symoensii 

Photo taken in Tanzania by Donatha 

D. Tibuhwa. See also p. 35 of 

this issue. 

EDITORIAL BOARD 

Editor-in-Chief 

Prof. dr D.L. Hawksworth CBE, Departamento de Biología Vegetal II, Facultad de Farmacia, Universidad Complutense 

de Madrid, Plaza Ramón y Cajal, 28040 Madrid, Spain; and Department of Life Sciences, Natural History Museum, 

Cromwell Road, London SW7 5BD, UK; E-mail: d.hawksworth@nhm.ac.uk 

Layout Editors 

M.J. van den Hoeven-Verweij & M. Vermaas, CBS-KNAW Fungal Biodiversity Centre, P.O. Box 85167, 3508 AD 

Utrecht, The Netherlands; E-mail: m.verweij@cbs.knaw.nl 

Associate Editors 

Dr T.V. Andrianova, M.G. Kholodny Institute of Botany, Tereshchenkivska Street 2, Kiev, MSP-1, 01601, Ukraine; 

E-mail: tand@darwin.relc.com 

Prof. dr D. Begerow, Lehrstuhl für Evolution und Biodiversität der Pflanzen, Ruhr-Universität Bochum, Universitätsstr. 

150, Gebäude ND 03/174, 44780, Bochum, Germany; E-mail: dominik.begerow@rub.de 

Dr S. Cantrell, Department of Plant Pathology and Crop Physiology, Louisiana State University, Agricultural Centre, 455 Life 

Sciences Bldg., Baton Rouge, LA 70803, USA; E-mail: scantrel@suagm.edu 

Prof. dr D. Carter, Discipline of Microbiology, School of Molecular Biosciences, Building G08, University of Sydney, 

NSW 2006, Australia; E-mail: d.carter@mmb.usyd.edu.au 

Prof. dr P.W. Crous, CBS-KNAW Fungal Biodiversity Centre, P.O. Box 85167, 3508 AD Utrecht, The Netherlands; 

E-mail: p.crous@cbs.knaw.nl 

Prof. dr J. Dianese, Departamento de Fitopatologia, Universidade de Brasília, 70910-900 Brasília, D.F., Brasil; E-mail: 

jcarmine@unb.br 

Dr P.S. Dyer, School of Biology, Institute of Genetics, University of Nottingham, University Park, Nottingham NG7 

2RD, UK; E-mail: paul.dyer@nottingham.ac.uk 

Dr M. Gryzenhout, Dept. of Plant Sciences, University of the Free State, P.O. Box 339, Bloemfontein 9300, South 

Africa; E-mail: Gryzenhoutm@ufs.ac.za 

Prof. dr L. Guzman-Davalos, Instituto de Botánica, Departamento de Botánica y Zoología, Universidad de Guadalajara, 

A.P. 1-139 Zapopan, 45101, México; E-mail: lguzman@cucba.udg.mx 

Dr K. Hansen, Kryptogambotanik Naturhistoriska Riksmuseet, Box 50007, 104 05 Stockholm, Sweden; E-mail: karen. 

hansen@nrm.se 

Prof. dr K.D. Hyde, School of Science, Mae Fah Luang University, Tasud, Chiang Rai, Thailand; E-mail: kdhyde3@ 

gmail.com 

Prof. dr L. Lange, Vice Dean, The Faculties of Engineering, Science and Medicine, Aalborg University; Director of 

Campus, Copenhagen Institute of Technology (CIT), Lautrupvang 15, DK-2750 Ballerup, Denmark; E-mail: lla@ 

adm.aau.dk 

Prof. dr L. Manoch, Department of Plant Pathology, Faculty of Agriculture, Kasetsart University, Bangkok 10900, 

Thailand; E-mail: agrlkm@ku.ac.th 

Prof. dr W. Meyer, Molecular Mycology Research Laboratory, CIDM, ICPMR, Level 3, Room 3114A, Westmead 

Hospital, Darcy Road, Westmead, NSW, 2145, Australia; E-mail: w.meyer@usyd.edu.au 

Dr D. Minter, CABI Bioservices, Bakeham Lane, Egham, Surrey, TW20 9TY, UK; E-mail: d.minter@cabi.org 

Dr L. Norvell, Pacific Northwest Mycology Service, LLC, 6720 NW Skyline Boulevard, Portland, Oregon 97229-1309, 

USA; E-mail: llnorvell@pnw-ms.com 

Dr G. Okada, Microbe Division / Japan Collection of Microorganisms, RIKEN BioResource Center, 2-1 Hirosawa, 

Wako, Saitama 351-0198, Japan; E-mail: okada@jcm.riken.jp 

Prof. dr N. Read, Fungal Cell Biology Group, Institute of Cell and Molecular Biology, Rutherford Building, University 

of Edinburgh, Edinburgh EH9 3JH, UK; E-mail: nick@fungalcell.org 

Prof. dr K.A. Seifert, Research Scientist / Biodiversity (Mycology and Botany), Agriculture & Agri-Food Canada, K.W. 

Neatby Bldg, 960 Carling Avenue, Ottawa, ON, K1A OC6, Canada; E-mail: seifertk@agr.gc.ca 

Prof. dr J.W. Taylor, Department of Plant and Microbial Biology, University of California, 111 Koshland Hall, Berkeley, 

CA 94720, USA; E-mail: jtaylor@berkeley.edu 

Prof. dr M.J. Wingfield, Forestry and Agricultural Research Institute (FABI), University of Pretoria, Pretoria 0002, 

South Africa; E-mail: mike.wingfield@fabi.up.ac.za 

Prof. dr W.-Y. Zhuang, Systematic Mycology and Lichenology Laboratory, Institute of Microbiology, Chinese Academy 

of Sciences, Beijing 100080, China; E-mail: zhuangwy@sun.im.ac.cn 

ima fUNGUS

HOLIsTIc mycOLOgy – bAck TO bIOLOgy! 

The fungal world is enchanting for its biodiversity, complexity, and beauty! A long career has taught me that Mycology 

breaks easily into segments of specialization. But it makes sense and adds overall value to keep it connected and to keep a 

stable eye on biology as a whole. 

My mycological career started 

early. I was inspired by my father, 

Morten Lange (1919–2003), to 

hunt for edible or rare fungi from kindergarden 

age. I was treading in the steps of my 

grandfather ( Jakob E. Lange, 1864–1941), 

looking for plants and “sporeplants”. Even 

before school age, I told my parents that the 

first thing I would rescue from our house 

if it caught fire was the cabinet with the 

original Flora Agaricina Danica drawings. 

Mycological teaching and the training of 

youngsters to see, distinguish, and name are 

the basis of cognitive learning, and art is one 

of its powerful instruments. 

During my doctoral studies, I had the 

privilege of working with some of the grand 

personalities of mycology: I was an assistant 

to Frederick K. Sparrow (1903–1977), who 

taught me the wonders of chytrids and other 

zoosporic fungi in the inspiring surroundings 

of Ann Arbor and Douglas Lake in 

Michigan State. Observations not only of 

static morphological characters, but also 

dynamic ones such as motility patterns, are 

needed to determine the genus and species; 

even major groupings can be distinguished 

just by looking at the zoospores. This way 

of thinking, merged with Ralf Emerson´s 

heritage, brought to me through my wise 

colleague and close friend Lee Olson, provided 

the conceptual precursor to bioimaging, 

experimental physiology, and new fungal 

genetics. 

In Thomas A. Shalla´s (1933–1983) 

laboratory at the University of California in 

Davis 1 . I learned immunological and ultrastructural 

techniques, helping to visualize 

and understand interactions between plant 

viruses and fungi. Mycology can be developed 

by transferring technologies from other scientific 

areas and most importantly by studying 

the interactions between fungi and other parts 

of the biological world (viruses, archaea and 

bacteria, plants, and animals). 

My first boss was Paul de Neergaard 

(1907–1987), a specialist on Alternaria and 

1Undertaking a part of my PhD studies in Davis 

brought another fortunate inspiration to my onward 

mycological life, having John W. Taylor as a PhD 

colleague. 

volume 3 · no. 1 

head of the Seed Pathology Institute of the 

Danish Ministry of Foreign Affairs in Copenhagen. 

He dedicated his life to collaborations 

with the developing world, meticulously 

and strategically working to spread 

knowledge globally – thereby empowering 

all to control the spread of seed-borne plant 

pathogens through knowledge of their lifecycles 

and biology: “you must understand 

the strategy of the enemy to fight it”! Paul 

entitled one of his books on seed pathology 

Seed: A Horse of Hunger or a Source of Hope 

(1986), with the message that: we by solid research 

efforts carefully disseminated, can avoid 

detrimental attacks of fungal pathogens. But 

for this, global collaboration is a requisite! 

Working in the Institute for eight years 

with scientists from Asia, Africa and South 

America, in the aftermath of the green revolution, 

I realized that we had the knowledge 

but not the products to use it at the field 

scale. K.M. Safeeula of Mysore University, 

India, was my main role model in how to 

combine laboratory and field studies. I saw 

a need to develop biocontrol measures, as 

all could not be achieved by agrochemicals 

alone. I also saw the need for state-of-the-art 

equipment for quality mycological research. 

Novo industries made that possible. They 

were already a world leader in the biological 

production of enzymes from fungi and 

bacteria. Further, they had large solutionfocused 

and interdisciplinary R&D groups. 

I was part of a team being established to 

initiate work on biocontrol agents to control 

plant pathogens and insect pests. Biological 

processes and products are complex, but when 

mastered, evidence-based, and with suitable 

equipment, can lead to more sustainable 

biological solutions worldwide – unlocking the 

magic of Nature! 

My 20 years with Novo, Novo Nordisk, 

and Novozymes A/S, provided a platform 

for productive international collaborations. 

Japanese mycologists and natural product 

chemists provided a new dimension to the 

study of antifungal compounds from fungi, 

later strengthened by inspiring collaboration 

with Danish, Dutch, and not least, Australian 

mycologists. The development of new biological 

production methods using filamentous 

fungi brought me into contact with talented 

research groups in South America, China, 

the USA, and Europe. Mycology united! And 

respect mycological expertise wherever you meet 

it, as it transcends geographical and cultural 

borders, and seamless collaboration is possible 

between academic and industrial researchers. 

Fashion and technological trends are 

also a factor in science. I have lived through 

periods in which different techniques have 

been seen as overarching. Electron microscopy 

and ultrastructure gave their names 

to entire institutes and funding schemes. 

Likewise for protein engineering; all proteins 

could be developed in the laboratory. 

Genome sequencing subsequently took 

the scene and the funding, threatening to 

submerge biology in data. Now synthetic 

biology is starting to attract funding and 

fame. Let us help each other to see technologies 

as tools and new and inspiring ways of gaining 

even more and deeper insight. But do not 

forget that the main discipline is biology, and 

the main questions to answer are biological. 

Genomics is not just a tool for evolution, 

phylogenetic systematics, and identification. 

It is not just what fungi are, how 

they are related, and where they came from. 

Genomics can also be used to elucidate what 

fungi do and how they interact in nature. 

But here the focus must be not just genomics, 

but transcriptomics and secretomics, 

focusing on interactions both within populations 

and with other kinds of organisms. 

Now back in academia, the fungal secretome 

EDITORIAL (1)

EDITORIAL 

is a focus in my new research group – the 

filamentous fungi´s way of interacting with 

the rest of the world. Contributing to new 

insights which may in turn contribute to new 

and more sustainable solutions to important 

global problems. 

Today, we are in the most fantastic era 

of biology. We have an entire new tool box 

filled with marvelous, powerful techniques, 

many of which can be used remotely 

through international collaboration, virtual 

thinking, and decentralized sharing – all 

leading to empowerment. Let us use this 

fantastic time to develop mycology in an integrated, 

biological, social and environmental 

context. 

sTOP PREss! 

Registries of names and the 

new Code 

The International Code of Nomenclature 

for algae, fungi, and plants, ratified by the 

18 th International Botanical Congress in 

Melbourne last July, dictated that, as of 1 

January 2013, each new fungal name must 

be registered in a recognized registry prior to 

publication. The Code leaves to the permanent 

Nomenclature Committee for Fungi (NCF), 

established by the Congress, the task of which 

registries to approve. 

With the year during which we 

must decide how to implement efficient 

nomenclatural registration almost half over, 

NCF deliberations are deceptively muted. 

‘Muted,’ because formal committee discussion 

over the mechanics of name registration and 

registries is only beginning, but ‘deceptive,’ 

because behind the scenes it appears we are on 

the cusp of an impressive international accord. 

The International Mycological Association 

(IMA) Executive Committee members who 

met in Utrecht after the 1F = ?N symposium 

in April agreed that registration of new fungal 

names must be handled as efficiently and 

accurately as possible. The majority agreed that 

MycoBank (MB), the fungal name registry 

initiated in 2004–2005 at the Centraalbureau 

voor Schimmelcultures (CBS) and transferred 

to IMA jurisdiction in 2010, was the logical 

choice to serve as either sole or central 

nomenclatural registry for fungi. Many felt 

that multiple registries would be less reliable, 

less synchronous, and possibly proliferate 

illegitimate homonyms. That MycoBank (MB) 

was the first registry to assign identifiers for 

fungal names with MB registration already 

Mycologists all over the world have 

important work to do. One of the most 

important tasks is to contribute, with a true 

sense of urgency, to the feeding of the world, 

and to develop new biological processes, 

products, and also to facilitate the shift from 

being a fossil based world to a sustainable, 

biobased and globalized society. Fungi have 

a major role to play, and some aspects are 

unfolded in the article on pp. 87–92 in this 

issue. However, to realize this vision, we 

need to work together. Across all parts of 

the mycological specializations, and on a 

globally embracing scale of collaboration 

(see pp. (6)–(7) in this issue). Much of the 

new talent and investment in mycology 

required by most major mycological journals 

was also persuasive. Some, particularly those 

whose first language and alphabet is not 

English, spoke passionately for multiple 

registries. Recognizing that multi-language 

portals to a central registry that would track 

all identifiers simultaneously are also desirable, 

the Executive asked IMA President John W. 

Taylor to recommend that the NCF approve 

MycoBank as either a sole or central registry. 

After polling all IMA executive members, 

President Taylor sent the approved letter to the 

NCF Secretary on 20 May 2012. 

Before the Amsterdam and Utrecht 

meetings, most were unaware that other 

fungal registries were already in operation. 

While virtually every mycological author 

has consulted the formidable resource that 

is Index Fungorum (IF), relatively few know 

that it has issued fungal name identifiers since 

2009. Index Fungorum and MycoBank have 

coordinated their identifiers so that there is no 

numerical overlap and each number remains 

unique, even without the MB or IF prefix. 

Fewer are aware that a third fungal name 

registry — Fungal Name (FN)— has been 

established in China and has issued identifiers 

since mid-2011 that are also coordinated by IF 

to prevent numerical overlap with IF and MB. 

As noted in Taylor’s letter: “At the time of 1F 

= ?N, neither of these new registries [IF, FN) 

was effectively synchronized with MycoBank, 

such that all three sites had to be searched 

to learn about novel taxa, thereby increasing 

the likelihood of simultaneous publication of 

different fungi with the same name.” 

The recognition of the existence of 

three independent registries in Amsterdam 

prompted a desire to see whether they could 

is right now in South America, Asia, and 

southern Africa; a movement already making 

a very positive and encouraging impact 

on the development of world mycology – 

adding expertise and new thinking to that 

available in North America and Europe. I 

believe we can do even more to collaborate 

across continents, cultures and traditions. 

And also that we still have much to learn 

from what former generations used fungi 

for. 

Lene Lange 

IMA Executive Committee 

(lla@adm.aau.dk) 

work together. Communication channels have 

been opened while their developers collaborate 

on how best to facilitate synchronization 

among the registries and present the best userfriendly 

multi-language interface(s). After two 

months, we now believe that coordination 

among the three main registries is not only 

possible, but probable if logistical hurtles 

between software can be overcome. At this 

time, it appears that MycoBank could serve 

as the central repository recognizing that 

it is more commonly used by mycologists 

worldwide, and that it, Index Fungorum, 

and Fungal Name will collaborate to launch 

mandatory registration on January 1 with 

relatively few problems. A vote on the registries 

by the NCF will take place by the end of 

August following meetings in the USA and 

China. 

We ask all mycologists, including 

lichenologists, to log onto the three sites to see 

what each offers and urge all of you who are 

not already doing so to register all new names 

now, whether or not a journal editor requires 

it. The more who learn how to register their 

names now, the easier it will be for everyone 

when name registration is required in 2013. 

MycoBank — www.mycobank.org 

[now available in English, Chinese, German, 

Arabic, French] 

Index Fungorum — http://www.indexfungorum. 

org/names/IndexFungorumRegister.htm 

Fungal Name — http://www.fungalinfo.net/ 

fungalname/fungalname.html 

Lorelei L. Norvell (NCF Secretary) and 

Scott A. Redhead (NCF Chair) 

(llnorvell@pnw-ms.com) 

(2) ima funGuS

Volume 2 · No. 2 · December 2011 

IMA Fungus full content available in Pubmed 

(2010 onwards) 

Since June this year, IMA Fungus: the 

global mycological journal is searchable 

on PubMed (http://www.ncbi.nlm.nih. 

gov/pmc/journals/1750/). We trust that 

Fear of Fungi 

The global significance of the threats to 

human well-being and the maintenance 

of ecosystems posed by fungi are rarely 

appreciated by policy makers, scientists in 

general, or the public at large. Now, Fisher 

et al. (2012) have spelled out the threats in 

a well-researched and extensively referenced 

review article which made the cover of 

the 12 April 2012 issue of Nature. Seven 

fungi are highlighted: Batrachochytrium 

dendrobatidis (amphibian decline), 

Magnaporthe oryzae (rice blast), Geomyces 

destructans (white-nose syndrome of 

bats; see also pp. (3)–(4) below), Puccinia 

graminis (wheat stem rust), Aspergillus 

sydowii (sea-fan aspergillosis of corals), 

Nosema species (colony collapse in bees), 

and Fusarium solani (hatch failure in 

loggerhead turtle nests). That list is 

necessarily eclectic, and designed to indicate 

a range of situations, and some would have 

included Phytophthora ramorum (sudden 

death of oak) – and a correspondent was 

quick to add fungal infections of fish to the 

slate (Gozlan 2012). 

The review notes that reports of fungal 

Emerging Infectious Diseases (EIDs) are 

increasing worldwide as a proportion of all 


Volume 2 · No. 2 · December 2011 

this will further enhance the visibility 

and accessibility of the journal. PubMed 

comprises more than 21 million citations 

for biomedical literature from MEDLINE, 

EID reports, considers dynamics that can 

lead to host extinctions, the evolution of 

virulence, and environmental change as a 

driver. Among other points it also draws 

attention to the role or trade and transport 

in the globalization of fungi, and stresses the 

risk fungi prose to both food security and 

ecosystem health. 

In order to mitigate the threats, there 

needs to be much more attention paid 

to monitoring fungal inocula in wild 

populations, tighter control of trade, 

and understanding of the interactions 

between a host, its pathogens, and the 

environment. The authors conclude 

with a call for scientists in disparate 

research fields to be involved in global 

discussions to work towards strategies 

for the prevention and timely control 

of fungal diseases. It is a call-to-arms, 

and the issues raised must start to be 

addressed by appropriate agencies at the 

intergovernmental and governmental 

levels. At least no-one will now be able to 

claim that they was no alert as to the risks 

and global impacts of fungal diseases. 

Anyone in doubt as to the importance 

of fungi in world affairs today, should be 

life-science journals, and 

online books. Citations 

may include links to fulltext 

content from PubMed 

Central and publisher web 

sites. 

IMA Fungus 

continues to also be 

available on its own 

website (www.imafungus. 

org) and via Ingenta Connect (http:// 

www.ingentaconnect.com/content/ima/ 

imafung). 

immediately directed to this important 

review. 

Fisher MC, Henk DA, Briggs CL, Brownstein 

JS, Madoff LC, McCraw SL, Gurr SJ (2012) 

Emerging fungal threats to animal, plant and 

ecosystem health. Nature 484: 186–194. 

Gozlan R (2012) Monitoring fungal infections in 

fish. Nature 485: 446. 

White-nose fungus kills around six million bats 

The US Fish and Wildlife Agency issued 

a press release on 17 January 2012 1 stating 

that there was a growing trend in the 

numbers of bats across the USA which were 

The Global MycoloG ical Journal 

NEWS · REPORTS · AWARDS AND PERSONALIA · RESEARCH NEWS 

BOOK NEWS · f ORTHCOm INg m EETINg S · ARTICLES 

being killed by the white-nose syndrome 

fungus, Geomyces destructans. The mortality 

rates in colonies ranged from 70–90 %, and 

have been reported to be as much as 100 % 

1 http://us.vocuspr.com/Newsroom/Query.aspx?S 

iteName=FWS&Entity=PRAsset&SF_PRAsset_ 

PRAssetID_EQ=129322&XSL=PressRelease&C 

ache=True 

NEWs (3)

NEWs 

(4) 

and between 5.5 and 6.7 million bats were 

estimated to have been killed since 2006, 

when the first cases were recognized in a 

cave in New York State. The disease has 

now spread to 16 states in the US and four 

Canadian provinces. 

Conclusive experimental proof that 

Geomyces destructans was the causal 

agent was published on 15 December 

2011 (Lorch et al. 2011). That study 

established that direct exposure of bats 

to the fungus caused the disease, and the 

fungus was recovered from diseased bats, 

so fulfilling Koch’s Postulates. The authors 

also demonstrated that the disease could 

be transferred directly from infected to 

healthy bats. Previous uncertainty as to 

whether the fungus was the primary cause 

of the disease had arisen as the fungus 

occurs on the skin of European bats but is 

not associated with mortality in the region. 

It now seems probable that the fungus 

was transported into North America from 

Europe, where the bats are resistant to 

the disease, into North America where 

the native bats had no such resistance 

to a fungus they had never previously 

encountered. 

For further information and to follow 

this developing situation, which poses a 

huge threat to the continuance of many bat 

species in North America, consult postings 

on the Bat Conservation International 

website (http://batcon.org/). 

Lorch JM, Meteyer CU, Behr M, Boyles JG, Cryan 

PM, Hicks AC, Ballmann AE, Coleman JTH, 

Redell DN, Reder DM, Blehert DS (2011) 

Experimental infection of bats with Geomyces 

destructans causes white-nose syndrome. Nature 

480: 376–378. 

The Top 10 fungal pathogens in molecular plant 

pathology 

Ascomata of Zymoseptoria tricti (syn. Mycosphaerella 

graminicola) on infected wheat leaves. 

The journal Molecular Plant Pathology 

conducted a poll amongst fungal 

pathologists associated with the journal to 

determine which species were of the most 

scientific or economic importance. The 

species selected, in rank order, on the basis 

of 495 votes, were: 

1 Magnaporthe oryzae 

2 Botrytis cinerea 

3 Puccinia spp. 

4 Fusarium graminearum 

5 Fusarium oxysporum 

6 Blumeria graminis 

7 Mycosphaerella graminicola 

8 Colletotrichum spp. 

9 Ustilago maydis 

10 Melampsora lini 

Phakopsora pachyrhizi and Rhizoctonia solani 

were the runners-up. The announcement 

of this result includes observations on each 

species and its significance (Dean et al. 

2012) and os intended to stimulate debate 

Fungus makes the Top 10 species 2012 

On 23 May 2012, the Spongebob 

Squarepants Mushroom, Spongiforma 

squarepantsii, a gasteroid bolete discovered 

in the Lambir Hills National Park in 

Sarawak, and described by Desjardin et 

al. (2011) was announced as one of the 

amongst the plant mycology community. 

Dean R, van Khan JAL, Pretorius ZA, Hammond- 

Kosack KE, Di Pietro A, Spanu PD, Judd JJ, 

Dickman M, Kahmann R, Ellis J, Foster GD 

(2012)The top ten pathogens in molecular 

pathology. Molecular Plant Pathology 13: 

414–430. 

Botrytis cinerea on Leucadendron flower head. 

Spongiforma squarepantsii: Surface view and section 

of basidiome. Scale in mm. Photo courtesy Tom D. 

Bruns. 

ten top species to be described in 2011. 

The selection is made by an international 

committee established by the International 

Institute for Endangered Species based at 

Arizona State University. The species are 

selected because they attract the attention 

of the committee for a variety of reasons, 

though perhaps the common and scientific 

names selected played a role in this case. 

The name recalls a resemblance to a North 

American Cartoon character, Spongebob 

Squarepants, who lives in a pineapple – 

ima funGuS

and the basidiome apparently has a fruity 

smell. Other organisms on the 2012 list 

include a monkey, jellyfish, nematode, 

orchid, wasp, poppy, millipede, cactus, and 

tarantula; all are figured on the Institute’s 

website (http://species.ascu.edu/top10). 


Two agarics made it into the 2011 list, as 

reported in IMA Fungus 2: (2), 2011. 

Perhaps IMA Fungus should run a 

parallel annual competition? If you would 

like to do that for the Association, please 

contact the Editor-in-Chief. 

Desjardin DE, Peay KG, Bruns TD (2011) 

Spongiforma squarepantsii, a new species of 

gasteroid bolete from Borneo. Mycologia 103: 

1119–1123. 

2013 cbs spring symposium – One Fungus : Which 

gene(s) (1F = ?g) 

The two important and successful CBS 

Spring Symposia, One Fungus = One Name 

(2011), and One Fungus = Which Name 

(2012) had great impacts on the mycological 

community. The CBS-KNAW Fungal 

Biodiversity Centre is now planning the 2013 

Spring Symposium, One Fungus = Which 

Gene(s), now fixed for Wednesday-Thursday 

10-11 April 2013. The main topic of the 

symposium will be to extend the concept of 

DNA barcoding to define how best to classify 

and identify fungi. Although a general 

consensus on the ITS barcode region has 

now been reached, it is important to clarify 

special issues of journals 

Hyphal networks 

The hyphal systems of fungi never cease to 

amaze in their complexity and adaptability. 

Fungal Biology Reviews 26(1), April 2012, 

includes four review articles under the title 

“Hyphal networks: mechanisms, modeling 

and ecology”. These address the self-fusion 

between conidial anastomosis tubes, analysis 

of fungal networks developed from block 

inocula, modeling of hyphal networks, and 

Phanerochaete velutina mycelium digitized and 

colour-coded to represent thicknesses of the major 

cords. From Boddy et al. (Fungal Genetics and 

Biology 47: 522–530, 2010). Photo courtesy Mark 

Fricker. 

what additional gene(s) need to be targeted 

for specific fungal groups. Furthermore, 

best practices for obtaining and designating 

ex-type or ex-epitype isolates for whole 

genome analysis need to be addressed. The 

impact of fungal genome projects on fungal 

taxonomy and their utility for discovering 

new barcoding genes will be a focus, and 

the possible application of phylogenomic 

information to inform functional genomic 

annotation will also be discussed. 

Contributed papers are welcome, and 

they will be selected for either oral or poster 

presentations. 

mycorrhizal networks. All contributions 

are by leading research groups in the field, 

and superbly illustrated. I also found the 

tabulation of the diverse mechanisms by 

which mycorrhizal networks may affect 

plant communities of value, and can see that 

being adapted for various taught courses. 

There is much to fascinate in the remarkable 

way these networks develop and function, 

and this read is a way of getting up-to-speed 

on this cutting edge research area in fungal 

biology,. 

Tropical fungi 

The tropics are an immense store of unusual 

and undiscovered fungi, but our knowledge 

of them remains fragmentary. M. Catherine 

Aime and Francis Brearley have now put 

together a special issue of Biodiversity and 

Conservation, scheduled to appear as 21 

(9) this August. It is anticipated that the 

issue will contain 12 original papers dealing 

with a range of groups of fungi, including 

aquatic fungi, lichen-fungi, mycorrhizal 

fungi, polypores, rusts, and trichomycetes, 

and also approaches to inventorying. Two 

previous special issues of the journal have 

been devoted to fungal diversity (6(5), 

1997; and 16(1), 2007) and these attracted 

The venue, as for the previous two 

symposia, will be Trippenhuis, home of the 

Royal Netherlands Academy of Arts and 

Sciences, Amsterdam, and the registration fee 

is € 250 (which includes includes coffee/tea, 

lunches and a cocktail party). It is anticipated 

that on Friday 12 April meetings of the IMA 

Executive Committee, and of several ICTF 

and IUMS commissions and working groups 

will be held at the CBS in Utrecht, which will 

be concluded with a fungal barbeque. 

Pedro Crous 

(p.crous@cbs.knaw.nl) 

considerable interest, and it is anticipated 

that this will also be the case with this 

number. Most papers are already available 

online-first via SpringerLink (www. 

Favoleschia sp. nov. One of about 750 species of 

fungi new to science discovered in the Pakaraima 

Mountains of Guyana in 2010, and being featured 

on the cover of all 14 of the 2012 issues of 

Biodiversity and Conservation. Photo M. Catherine 

Aime. 

NEWs (5)

NEWs 

(6) 

springerlink.com/), and the possibility of 

making all open-access and free to download 

is under discussion at the time of going to 

press. 

Endophytes 

Two journals have recently issued special 

issues on endophytic fungi: Fungal Diversity 

54, May 2012, and Fungal Ecology 5 (3), 

June 2012. The Fungal Diversity issue 

has three review articles which concern 

the mediation of reactive oxygen species 

and antioxidants, the role of fungi in 

phytoremediation, and their value as a 

source of biocatalysts. Nine papers follow, 

on a wide range of aspects including cold 

adaptation, studies of particular species 

and endophytes of particular plants, and 

systematics. The Fungal Ecology issue, “The 

secret world of endophytes”, has ten articles 

which range considerably in scope, but 

with an emphasis on the endophytic fungi 

of grasses in different regions, effects on 

the host plants, and also the production of 

alkaloids. The two issues are complementary 

rather than duplicatory, and are timely 

in view of the COST initiative recently 

launched on endophytes (see p. (7)). 

Entomopathogenic fungi 

Mycosystema 31 (3), May 2012 is devoted 

entirely to entomopathogenic fungi. It 

comprises 17 articles, almost all by Chinese 

authors, with the emphasis on species 

exploited for medicinal uses (particularly 

Cordyceps s. str. species) and of actual or 

of potential applications in biocontrol. 

The fungi considered in the latter category 

include species of Beauveria, Metarhizium, 

Nomuraea, Paecilomyces, and Zoophthora. 

Aspects covered include pathogenicity 

testing, marker genes for released strains, 

gene cloning, screening, optimization of 

culture methods, and volatile products. 

mycophily, mycophilogy, and insect conservation 

The grass Festuca rubra (red fescue) probably 

provides toxicity against predators to the butterfly 

Melanargia galathea (marbled white) by larval 

ingestion of pyrrolizidine alkaloids produced by the 

endophytic Neotyphoidium sp. Photos Roger Kemp. 

The terms “mycophily” and “mycophilogy” 

have been proposed by Kemp (2010, 

2011) for the association of fungi with 

living plants and animals, and the study of 

those associations, respectively. The author 

postulates that the chemicals produced by 

fungal endophytes in plants are required by 

or at least beneficial to the larvae of some 

insects, particularly butterflies and moths, 

for optimal growth. He then speculates that 

the declines in butterflies seen in the UK 

could be due to the loss of endophytic fungi 

in the host plants. There is clearly scope 

global mycology Initiatives 

for the experimental testing of these novel 

cross-disciplinary ideas, and this could also 

encourage more entomologists and plant 

ecologists to take an active interest in the 

roles of fungi in the systems they investigate. 

It should, however, be noted that in 

introducing the term “mycophily”, Roger 

Kemp was not aware of the two previous 

uses of “mycophilic” for either a fondness 

for fungi (usually for food), or organisms 

growing on fungi. 

Kemp RJ (2010) Mycophily – a new science for 

insect conservation. Antenna 34: 13–15. 

Kemp RJ (2011) Mycophily and its possible role 

in plant micro-distribution within habitats. 

Botanical Society of the British Isles News 118: 

23. 

If you are interested in participating in the following project initiatives, please let us know at your earliest convenience. We do not have 

funding specifically for this, but want to get started anyhow. We have then two years to gather information before we hopefully can meet at 

IMC10 meeting in Bangkok! 

Global Mycology Initiative I: 

Traditions, Technologies and 

Science 

Topic: Fungal consortia used in food 

production (e.g. for production of soy sauce, 

fermented meat etc). 

Objectives, Investigations and results: The 

basics: Description of production process 

(Starter culture? Enrichment culture? 

Process conditions? The experimental: 

characterization of microbial biodiversity, 

population dynamics, consortium signaling, 

secretome and transcriptome composition. 

Right now industrial biotechnology 

is basically one gene, expressed in one 

production host to produce one protein 

ima funGuS

which are sold as one product for one 

specific purpose. In future we will also 

be able to handle complex consortia to 

provide solutions for complex problems, 

e.g. conversion of biowaste materials. Here a 

comprehensive understanding of consortia 

would be very beneficial. Let us together 

move ahead of the business and share 

the interesting new knowledge, built on 

traditional cultural practices. 

Join the initiative! Describe which system 

you are working on and what you can 

contribute with. 


Global Mycology Initiative II: 

Enzymes from edible fungi 

Topic: Enzymes, and enzyme expression and 

secretion, of cultivated, edible or medicinal 

fungi. 

Objectives, Investigations and results: to 

obtain a more comprehensive understanding 

of the secreted enzymes from fungi, which 

can easily be grown on inexpensive substrates 

(e.g. old newspapers or straw). Edible and 

easily cultivated fungi with a rich enzyme 

profile and an efficient secretion systems 

may locally (in rural or other decentralized 

localities) be used for on-site production of 

enzymes for biomass conversion; allowing for 

low tech production of both feed, fuel, and 

fertilizer from biological waste or agricultural 

crop residues. 

Join the initiative! Describe which fungal 

species and substrate you work on and 

which research technology you use and/or 

you are interested in using in the future. 

Contact me or my science coordinator, Pia 

Haugaard Nord-Larsen (pnl@bio.aau.dk). 

with “Global Mycology Initiative” in the 

subject field of the message, to enabling us 

to search our mail box specifically for mails 

on this. 

Lene Lange 

(LLa@adm.aau.dk) 

A network of European scientists investigating 

endophytic microorganisms: a new cOsT 

programme 

Plants are associated with micro– and 

nano-organisms: endophytic bacteria 

and fungi, which live inter- and intracellularly 

in plants without inducing 

pathogenic symptoms, while interacting 

with the host biochemically and genetically. 

Endophytic microorganisms may function 

as plant growth and defence promoters by 

synthesising phytohormones, producing 

biosurfactants, enzymes or precursors 

for secondary plant metabolites, fixing 

atmospheric nitrogen and CO 2 , or 

controlling plant diseases, as well as 

providing a source for new bioactive natural 

products with utility in pharmaceutical, 

agrochemical and other LifeScience 

applications. The use of these endophytic 

microorganisms to control plant-pathogenic 

bacteria and fungi is receiving increased 

attention as a sustainable alternative 

to synthetic pesticides and antibiotics. 

Furthermore, endophytes may be adapted 

to the presence and metabolism of complex 

organic molecules and therefore can 

show useful biodegradation properties. In 

order to reduce inputs of pesticides and 

fertilizers and add value to eco-friendly 

agriculture in Europe, it will be important 

to develop inocula of biofertilizers, stress 

protection and biocontrol agents. But 

there are currently bottlenecks limiting 

the development of endophytes for use in 

biotechnology and agriculture. 

To increase understanding about these 

hidden associations between plants, bacteria 

and fungi, and to identify bottlenecks in 

the development and implementation of 

technologies using endophytes, a network of 

scientists was recently formed. This COST 

Action: “Endophytes in biotechnology 

and agriculture” will operate all over 

Europe during the next four years. COST 

(European Cooperation in Science and 

Technology) was founded in 1971 and 

is one of the longest-running European 

instruments supporting cooperation among 

scientists and researchers across Europe. 

The support of young researchers, scientific 

conferences and book publications are 

some of the activities which are organized 

by COST and paid for by the European 

Science Foundation. “My stay in Prague, 

Czech Republic, which was funded by 

COST, supported my trials very much. I 

was able to learn methods which I can now 

implement in my work at home”, says Beate 

Ceipek, a young German researcher about 

her Short Term Scientific Mission at Czech 

Academy of Sciences. 

This new COST Action will 

provide a forum for the identification of 

bottlenecks limiting the use of endophytes 

in biotechnology and agriculture and 

ultimately provide solutions for the 

economically and ecologically compatible 

exploitation of these organisms within 

Europe and beyond. 

For more information on this Action 

and how you can become involved, visit the 

network’s website (www.endophytes.eu). 

New funding for Australian medical mycology 

The Molecular Mycology Research 

Laboratory at the Sydney Medical School, 

Westmead Hospital, University of Sydney, 

lead by Wieland Meyer has recently 

received two Australian National Health & 

Medical Research Council project grants 

to investigate two fundamental questions 

in modern mycology: (1) Which DNA 

region is the most appropriate one for DNA 

barcoding of human/animal pathogenic 

fungi, taking into account that there are 

serious limitations with the currently 

Mark Stadler 

(Marc.Stadler@t-online.de) 

accepted barcode for fungi the ITS region; 

and the (2) What is the genetic basis of 

fungal virulence? The obtained funding, 

totalling 1 million dollars for three years, 

funds several postdoctoral and research 

assistant positions 

NEWs (7)

NEWs 

(8) 

The first grant is for collaboration 

between Wieland Meyer’s laboratory, 

Vincent Robert (Bioinformatics Unit, CBS, 

Utrecht), and David Ellis (Mycology Unit, 

University of Adelaide). This project aims 

to identify the most appropriate loci for 

DNA barcoding by applying comparative 

bioinformatic genome analyses against all 

currently available fungal genomes. It will 

design loci-specific primers and test them 

against a broad range of fungi. The most 

informative loci will then be: selected and 

used to generate DNA barcodes; used to 

establish a reference barcode database; and 

applied as a tool in a diagnostic setting. 

The project’s innovation lies in its use of 

comparative bioinformatics/genomics to 

determine novel universally applicable 

barcode regions and the build up of a 

barcode library, the first of its kind for 

human/animal pathogenic fungi, as a tool 

for fungal diagnosis. This has the promise 

of revolutionising fungal identification 

in medical diagnostic units, and reducing 

turn-around-time for species identification. 

This will allow earlier initiations of targeted 

antifungal therapy with improved patient 

outcomes. The barcodes will also be a key in 

providing border security with a novel tool 

to safeguard against fungal disease threats. 

The second project is for collaboration 

between Wieland Meyer’s laboratory, Gavin 

Huttley’s laboratory working on genome 

analysis (Australian National University, 

Canberra), Helena Nevalainen’s laboratory 

for fungal genetics (Macquarie University, 

Sydney), and June Kwon-Chung’s laboratory 

for Medical Mycology (National Institutes 

of Health, Bethesda, USA). This project 

will compare the whole genomes of 16 

high and low virulent cryptococcal strains, 

based on previously identified expression 

differences, to identify general virulenceassociated 

genes. Knockout and animal 

virulence studies on a selection of the 

identified genetic candidate loci to establish 

the genetic basis of fungal virulence will 

be conducted, and used to generalise the 

cryptococcal findings by extending the 

whole genome comparison to other human/ 

animal pathogenic fungi to establish 

fungal virulence-associated gene maps. The 

key knowledge generated in this project 

will provide the foundation of a greatly 

improved evidence base for the development 

of effective management guidelines for 

better patient outcomes, develop genetic 

markers to track the spread of fungal agents, 

and provide new targets for antifungal 

development. 

Wieland Meyer 

(w.meyer@usyd.edu.au) 

china establishes state key Laboratory of mycology 

October 2011 represented an important 

milestone in the history of research and 

development of Mycology in China. 

After a rigorous review by the Ministry of 

Science and Technology, the Institute of 

Microbiology, Chinese Academy of Sciences 

(IMCAS), has successfully obtained the 

final approval as the State Key Laboratory 

of Mycology (SKLM). The “state key 

laboratory” programme, which began in 

1984, is an essential part of the national 

science and technology innovation system. 

It covers the major disciplines and has a 

high entry bar. Establishing this state key 

laboratory in China means a great deal 

for mycological studies because it brings 

with it sustainable funding from central 

government. This action will significantly 

increase the quality and quantity of the 

output of mycological research in China. 

The history of the key laboratory can 

be traced back to the pioneer mycologists 

Fang-Lan Dai and Shu-Qun Tang, who 

established the first mycological research 

group in the Chinese Academy of Sciences 

(CAS) and trained generations of young 

scientists dedicated to fungal study. 

The CAS Key Laboratory of Systematic 

Mycology & Lichenology was established in 

1985. Through 26 years’ of development and 

extension in fields such as fungal systematics, 

ecology, genetics, metabolites, and other 

aspects, the CAS Key Laboratory has 

now been upgraded to the state level. The 

SKLM currently has 70 scientists including 

three CAS academicians and 18 principal 

investigators, and it will be further expanded 

to host 25 principal investigators in the 

next few years. The new Key Laboratory 

will highlight the following research areas: 

(1) fungal systematics and biodiversity; 

(2) fungal community and interaction; (3) 

fungal genetics and morphogenesis; and (4) 

the discovery, biosynthesis, and regulation 

of fungal secondary metabolites. 

Lei Cai 

(mrcailei@gmail.com) 

ima funGuS

FungalDc: a database on fungal diversity in genetic 

resource collections 

FungalDC (Fungal Diversity in Culture 

Collections) assembles data on fungal 

diversity held in 264 collections of fungal 

cultures registered in the World Data Center 

of Microorganisms (WDCM) as well as 

ones held in individual laboratories around 

the world where catalogues are available. 

The database is open access through the All 

Russian Collection for Microorganisms 

(VKM) website (www.vkm.ru/fungalDC. 

htm), and provides current information on 

species by linking to the particular species/ 

strain pages in sources such as: Index 

Fungorum (http://www.indexfungorum. 

org), MycoBank (http://www.mycobank. 

org), GenBank (http://www.straininfo.net), 

and StrainInfo (http://www.straininfo.net) 

The integration of these resources 

mobilizes data from different databases, 

enabling their simultaneous use. FungalDC 

provides an opportunity to readily compare 

the diversity of fungal species available 

from collections and GenBank, to locate 

collections holding representatives of 

particular species and/or particular strains 

Table 1. Data in FungalDC 


(including ex-type and authentic samples), 

and reveal species either omitted from the 

aforementioned information sources or not 

preserved in a collection as a living culture. 

The ready availability of this 

information facilitates the location of 

living biomaterial for genetic studies. The 

data analysis shows that the fungal species 

diversity held in culture collections is 

represented only to a limited extent in 

GenBank (Table 1), thus indicating taxa 

where molecular studies could be rewarding 

As the underlying data sources are 

constantly updated, the database also 

remains under constant change. A special 

format was developed to make it possible 

to perform real-time tracking to determine 

to what extent diverse fungal groups have 

been studied by molecular methods, and 

to identify type material of a particular 

species among the specimens studied. Each 

species name in the database is listed using 

the orthography of Index Fungorum and 

has the corresponding higher rank taxa 

indicated according to data from Ainsworth 

Index Fungorum* Collections of fungal cultures GenBank 

Number of genera 19 705 3 728 4 087** 

Number of species 469 776 24 897 26 035 

*www.indexfungorum.org 

**2 364 genera are common to the collections and GenBank 

& Bisby’s Dictionary of the Fungi (10 th edn; 

Kirk PM et al., 2008, Wallingford: CAB 

International). Further information is 

included in Inoculum 61 (3): 1–5 (2010). 

We appreciated valuable comments from 

Bert Verslyppe and Peter Dawyndt (Ghent 

University, Belgium ), P. Conrad Schoch 

(GenBank, National Institutes of Health/ 

NLM/NCBI, Bethesda, MD, USA), Paul 

M. Kirk (CABI Bioscience, Egham, UK) 

and Vincent Robert (Centraalbureau 

voor Schimmelcultures, Utrecht, The 

Netherlands). The work is supported by 

the Ministry of Education and Science 

of the Russian Federation (contract № 

16.518.11.7035) and the programme 

“Molecular and cell biology” of the Russian 

Academy of Sciences. 

S. M. Ozerskaya, N. P. Kirillova, and A. N. 

Vasilenko 

(smo@dol.ru) 

NEWs (9)

REPORTS 

ONE FUNGUS = WHICH NAME ? 

The special provisions that permitted 

asexual morphs of the same species of 

pleomorphic non-lichenized ascomycete 

and basidiomycete fungi to have separate 

names from that of the whole fungus, 

which was typified by a sexual morph, 

were ended at the International Botanical 

Congress in Melbourne in July 2011. 

These changes, that are embodied in 

the forthcoming International Code of 

Nomenclature for algae, fungi, and plants 1 , 

followed after extensive debates and 

consideration by different committees, 

and in particular The Amsterdam 

Declaration 2 . The Declaration resulted 

from the “One Fungus = One Name” 

symposium organized by the CBS-KNAW 

Fungal Biodiversity Centre (CBS) 

under the auspices of the International 

Commission on the Taxonomy of Fungi 

(ICTF) and held in Amsterdam on 19–20 

April 2011 (see IMA Fungus 2: (7), 

2011). Summaries of the changes which 

were introduced have been presented 

elsewhere 3, 4 and are not repeated here, but 

it is important that the published version 

of the Code is consulted for the final 

wordings. 

Mycologists now have the tasks of 

implementing the changes in their own 

publications, and also contributing to the 

production of Accepted and Rejected Lists 

of names. Recognizing the uncertainties 

some mycologists expressed as how to 

proceed, and also the need to progress 

work on the Lists, CBS organized a 

follow-up symposium on “One Fungus = 

Which Name?” in the rooms of the Royal 

Netherlands Academy of Arts and Sciences 

in Amsterdam on Thursday and Friday 12– 

13 April 2012. The meeting was attended 

by 155 mycologists from 29 countries, 

almost all of whom were thrilled at the 

ending of the dual nomenclatural system 

and enthusiastic at the prospect of Accepted 

Lists which would place mycology at the 

cutting edge of biological nomenclature as 

a whole. 

Each day of the symposium was 

organized in the form of a series of 

presentations in the morning, and discussion 

groups or debates in the afternoon. In a new 

venture aimed at making the presentations 

as widely available as possible, the talks 

were also videoed and made available via 

the Internet in real-time. Subsequently, a 

video-archive of the talks was compiled with 

a link to this through the CBS home-page 

to Youtube (http://www.youtube.com/pl 

aylist?list=PLF8BF8F71D5A3AEDC). It 

was gratifying that 220 mycologists watched 

the proceedings via the videolink while they 

were in progress, and that since the meeting 

there had been hundreds of downloads of 

presentations at the time this issue went to 

press. This means that hundreds of individual 

mycologists have so far been able to benefit 

from the full talks of the symposium and 

others still can do so. 

There were 12 presentations in total, all 

of which are freely available in the videoarchive: 

One fungus which name: how do we proceed? 

(David L. Hawksworth, Spain/UK) 5 . 

Post-Melbourne fungal nomenclature: an 

overview (Lorelei Norvell,USA; Scott A. 

Redhead, Canada). 

Why hyphomycete taxonomy is now more 

important than ever (Keith A. Seifert, 

Canada). 

The nomenclature side of fungal databases, 

registration, etc ( Joost A. Stalpers, The 

Netherlands; Paul M. Kirk, UK). 

Single names in Hypocreales and 

Diaporthales (Amy Y. Rossman, USA). 

Applications of old anamorph-typified names 

of genera and species (Uwe Braun) 6 . 

A strategy for fungal names with teleomorphanamorph 

connections (Xing-Zhang Liu, 

China). 

The future of fungal biodiversity research 

(Pedro W. Crous, The Netherlands). 

Naming environmental nucleic acid species 

(ENAS) ( John W. Taylor, USA). 

The value of epitypification (Kevin D. Hyde, 

China/Thailand). 

An official DNA barcode for fungi (Conrad 

Schoch, USA). 

1000 fungal genomes and beyond ( Joey 

Spatafora, USA). 

A series of break-out group discussions, 

primarily focused on different fungal taxa, 

was held on the Thursday afternoon, and 

those groups were charged with reporting 

at the end of the next day. Prior to the 

presentation of these reports, which are 

reproduced below, an open discussion was 

held to clarify aspects of the new provisions 

or other matters that some present had 

found unclear, and further to ascertain the 

views of those present on various issues that 

needed to be addressed by those developing 

Lists and the Nomenclature Committee for 

Fungi (NCF) or ICTF; those discussions 

are also summarized below. 

In addition to the formal parts of the 

symposium, two new books were formally 

launched at a cocktail party on the first 

evening. John W. Taylor (IMA President) 

was presented with copies of the Taxonomic 

Manual of the Erysiphales (Powdery Mildews) 

by Uwe Braun and Roger A. Cook, and the 

Atlas of Soil Ascomycetes by Josep Guarro, 

Josepa Gené, Alberto M. Stchigel, and M. 

José Figueras. Further information about 

these works is presented in the Book News 

section of this issue (pp. (35)–(36)). 

1McNeill JM, Barrie FR. Buck WR, Demoulin V, 

Greuter W, Hawksworth DL, Herendeen PS, 

Knapp S, Marhold K, Prado J, Pru’homme 

van Reine WF, Smith GE, Wiersema JH, 

Turland NJ (eds) (2012a) International Code 

of Nomenclature for algae, fungi, and plants 

(Melbourne Code) adopted by the Eighteenth 

International Botanical Congress Melbourne, 

Australia, July 2011. [Regnum Vegetabile, in 

press.] Ruggell: A.R.G. Ganter Verlag. 

2Hawksworth DL Crous PW, Redhead SA, 

Reynolds DR, Samson RA, Seifert KA, Taylor 

JW, Wingfield MJ [& 69 signatories] (2011) 

The Amsterdam Declaration on Fungal 

Nomenclature. IMA Fungus 2: 105–112; 

Mycotaxon 116: 91–500 

3Hawksworth DL (2011) A new dawn for the 

naming of fungi: impacts of decisions made 

in Melbourne in July 2011 on the future 

publication and regulation of fungal names. 

MycoKeys 1: 7–20; IMA Fungus 2: 155–162. 

4Norvell LL (2011) Fungal nomenclature. 1. 

Melbourne approves a new Code. Mycotaxon 

116: 481–490. 

5Hawksworth DL (2012) Managing and coping 

with names of pleomorphic fungi in a period 

of transition. Mycosphere 3 (2): 52–64; IMA 

Fungus 3: 15–24. 

6Braun U (2012) The impacts of the discontinuation 

of dual nomenclature of pleomorphic fungi: 

the trivial facts, problems, and strategies. IMA 


The One Fungus = Which 

Name ? debate 

Chair: David L Hawksworth 

Rapporteur: John W. Taylor 

Issues considered in this part of the meeting 

fell into two categories, a clarification of 

(10) ima fUNGUS

concepts and possibilities, and view on 

topics where the ICTF and NCF would 

appreciate guidance. 

Clarification of concepts and 

possibilities 

(1) Names on an Accepted List are NOT 

conserved, BUT treated as if conserved 

Some speakers had used the term 

“conserved” for names that would be 

included on the Accepted Lists of names, 

but their status will not be identical to that 

of formally conserved names as, under the 

new Code, names included in the Lists of 

Conserved Names would have precedence 

over those on the Accepted Lists. Further, 

names that are formally conserved cannot be 

deleted, whereas there is no such restriction 

for names on the Accepted Lists. The 

meeting found this confusing, and felt that 

a different term should be found to replace 

“treated as if conserved.” One possibility 

could be refer to names as “White-“ or 

“Black-listed. It had also been suggested by 

Gams et al. 7 , that the terms “prioritization” 

and “suppression” were preferable to help 

minimize possibilities of confusion, and that 

option should be referred to the NCF for 

consideration. 

(2) What names can be included in the 

Accepted and Rejected Lists? 

There was uncertainty over the need to 

include names on Lists where there was no 

controversy or ambiguity. The Accepted 

Lists could include all names in use, 

including those where there was currently 

no dispute, as that would safeguard them 

from any earlier names that subsequently 

came to light. Alternatively, the Lists, 

could be restricted to cases where dual 

nomenclature had previously applied and 

which now had just one name. 

It was felt that the Lists should be 

large enough to justify the time that would 

be spent on their preparation. The ideal 

would be a global checklist, though it was 

recognized that would not be realizable in 

the immediate future. However, there is 

no restriction on the ranks of names nor 

of taxonomic groupings. A List could be 

confined to all names in a particular rank, 

such as orders, families, genera or species, 

within a particular taxon. Alternatively, 

it could cover names at all ranks in use 

in a particular taxon. Thus, a List could 

deal with all accepted generic names of 

volUme 3 · No. 1 

fungi, or just those in a particular order or 

family. It is really a matter for mycologists 

concerned with different groups of fungi 

to decide what protected Lists would be 

of most value to them and which should 

be prepared first. As there is evidently no 

obstacle to Lists being revised or replaced, 

unlike the situation with the already existing 

lists of conserved and rejected names, there 

could be some advantage in concentrating 

on generic names first, and adding species 

names at a later date. 

There was almost unanimous and 

enthusiastic support for first producing a 

List covering all accepted generic names 

(including those of lichen-forming fungi, 

see below), whether or not they exhibited 

pleomorphism. 

There was a strong feeling at the 

meeting that provisional Lists should be 

open for consideration by the community 

as a whole before submission, in order to 

iron out any controversy. It was suggested 

that draft Lists be put on the IMA website, 

with options for comment so as to work 

towards a consensus. 

(3) Typification of names in Lists 

It is already possible to change the namebearing 

type of a name by conservation, 

and there appears to be no obstacle to 

this in the new Lists. The new Lists can 

therefore include replacement types to deal 

with cases where well-known names have 

been misapplied, that bear both sexual and 

asexual morphs of the species when the 

previously designated type did not, or one 

has been sequenced and is widely available 

(for example as ex-type cultures). 

(4) Terminology of specimens and cultures 

There had been some confusion over the 

terminology used for specimens and cultures 

other than name-bearing types by different 

workers. General usage is as follows: 

Authentic: One named by the author of 

the name, generally after it was published, 

or, if the name is a combination, the author 

of the basionym. 

Voucher: One used in a particular study, 

either for experimentation or to support an 

identification, enabling the same material to 

be used by or verified by later researchers. 

Representative: One or more from a 

large set or specimens or cultures considered 

to serve as vouchers where it is impractical 

to preserve all those used or cited in a 

particular study. 

(5) Continued use of binomials in 

synonymized genera 

There will be many cases in moving to one 

name per species in pleomorphic fungi, where 

it is uncertain whether all species currently 

under a particular name are congeneric with 

the type species of the generic name to be 

adopted. This situation is no different from 

that already occurring in non-pleomorphic 

genera where it has not been possible to 

ascertain the positions of all taxa previously 

referred to them. The Code does not rule 

on taxonomy, and, if there are no certain 

grounds to transfer a species from on genus to 

another, there is no nomenclatural obstacle to 

the continued use of the current name until 

the matter is resolved. This matter is discussed 

further elsewhere in this issue 8 . This situation 

is pragmatic not ideal, and one option used 

by some mycologists is to indicate in an 

informal way that a generic name is being 

retained in a wide sense, for example by the 

use of inverted commas, e.g. ´Mycosphaerella´ 

where it is unclear if the fungus is truly a 

Cladosporium (syn. Davidiella) in the new 

system. Wholesale uncritical transfer of 

names is to be discouraged. 

(6) Who can prepare and submit Lists? 

There is no restriction on who can produce 

a draft List, and it could be an individual 

as well as formal or informal groups of 

mycologists. In view of the scale of the 

problem, the input of as many individuals 

as possible can only be welcomed. If you 

have information on particular families, 

genera, etc, prepare the first draft rather 

than wait and be angered by the content 

and quality of one someone else produces. 

However, be sure to inform the ICTF and 

NCF if you are willing to prepare a draft 

or contribute to a draft for a particular 

taxon so that duplication of effort can be 

avoided wherever possible. List preparation 

needs to be initiated quickly now to keep 

to the timetable necessary to achieve formal 

adoption at the 2017 congress 9 . 

7Gams W, Humber RA, Jaklitsch W, Kirschner 

R, Stadler M (2012) Minimizing the chaos 

following the loss of Article 59: suggestions for 

a discussion. Mycotaxon 119: 495–507. 

8Braun U (2012) The impacts of the discontinuation 

of dual nomenclature of pleomorphic fungi: 

the trivial facts, problems, and strategies. IMA 


REPORTS (11)

REPORTs 

(7) Operational dates 

There had been some confusion about 

when the one name for one fungus species 

system became effective, and in particular 

whether this was 30 July 2011 or 1 January 

2013. The Preface to each edition of the 

Code now explains that all changes are 

immediately effective unless another date 

is indicated. This means that the special 

provisions ended on 30 July 2011, after 

which date all names of fungi compete 

on an equal footing, whether they are 

typified by material with the teleomorph 

or of the anamorph. The 1 January 2013 

date in the new Code is there only to 

provide immunity to names published 

prior to that date that otherwise might be 

declared invalid or illegitimate. The use of 

a later date allows time for the change to 

be disseminated amongst researchers, and 

avoids works in press being contrary to the 

Code, i.e. introducing names that otherwise 

would be contrary to the Code and not 

available for use. 

Issues requiring action or 

guidance 

(1) Epitypes, teleotypes, and anatypes 

Epitypes are specimens selected to 

supplement a name-bearing type where 

that types does exist, but does not show 

the characters necessary to determine the 

species. An epitype is a formal category 

recognized in the Code, and once selected 

an epitype cannot readily be displaced. An 

increasingly common practice amongst 

mycologists is to designated as epitypes 

material that has been sequenced when no 

DNA could be recovered from the namebearing 

type. 

Redhead 10 had previously proposed the 

use of the term “teleotype” type as a special 

category of epitype selected to show the 

teleomorph when that was missing from 

the name-bearing type, but the proposal 

was withdrawn and not adopted at the 

Melbourne congress. Although Redhead did 

not propose it, logically the term “anatype” 

could also have been proposed for material 

selected to show the anamorph where that 

was not represented on the name-bearing 

type. As these two categories would not 

be epitypes, they could still be designated 

where there was already an epitype, and 

their existence would not preclude an 

epitype being selected subsequently where 

there was not. 

The meeting rejected the idea of separate 

“teleotype” or “anatype” designations and 

considered that the type need not exhibit 

any particular morphology. 

(2) The terms anamorph and teleomorph 

The issue of whether it was desirable or 

useful, when describing fungi, to continue 

to use the terms anamorph and teleomorph 

was also raised. These had been introduced 

into the Code at the Sydney congress in 

1981 specifically for fungi that exhibited 

pleomorphism. The meeting felt that these 

terms were an unnecessary complexity, 

especially in teaching, and that they would 

be better dropped in favour of the familiar 

terms asexual and sexual, respectively. 

(3) Defining widely used 

This issue was recognized as difficult, 

and the potential pitfalls in the use of 

the Google search engine in particular as 

an estimator of usage made it unreliable. 

Matches may not be exact for a variety of 

reasons. Google Scholar was considered 

probably better, if used critically. However, 

it was felt that experts in particular groups 

would have the best ideas of what was in 

the interests of mycologists as a whole. 

Those who disagreed, could make their own 

List for consideration, or comment on any 

posted. There was a strong view that applied 

usages and taxonomic usages were both 

important and neither should dictate. 

(4) Evidence of holomorphy 

This was a matter considered too complex 

to debate in the session, but one on which 

guidance would be welcome. It was 

suggested that the ICTF should consider 

providing guidance on this matter. 

(5) Using the conserved/rejected 

mechanism while Lists are in preparation 

The existing mechanisms for the 

conservation and rejection of names in the 

ranks of family, genus, and species would 

continue to operate while Lists were in 

preparation, revision, and proceeding 

towards formal adoption. There was 

therefore the possibility that decisions made 

on conservation or rejection might not be in 

accord with the Lists themselves. The NCF 

made clear that it would nevertheless still 

entertain conservation proposals, but that it 

would prefer to see lists with lots of names 

rather than proposals dealing with a single 

taxon. 

(6) Inclusion of lichen-forming fungi 

Under the proposals adopted at the 

Melbourne congress, lichen-forming and 

allied fungi were excluded from the Lists. 

However, many considered this illogical, 

and the meeting voted unanimously for the 

deletion of this anomaly. It is clear that a 

formal proposal should be made to rectify 

this in the near future so that it can be 

considered by the NCF and approved by the 

General Committee in a timely manner so 

that lichenized taxa can be included where 

appropriate in the Lists. 

(7) Use of subgeneric names 

The issue of whether mycologists should 

use the rank of subgenus more frequently, 

especially in large monophyletic genera, 

proved very controversial. Some were 

completely against any subtaxa, whereas 

others saw good grounds for the use of 

subgenera in particular cases. The use of 

subgeneric names was a way of maintaining 

name stability as the generic and specific 

names would not be changed. On the other 

hand, some felt this meant that users might 

have to learn three names rather than two, 

were subgeneric names regularly to be 

inserted in parentheses between a generic 

name and a species epithet. No consensus 

emerged, and this may be a situation where 

the matter is best addressed on a case-bycase 

basis. 

(8) Registration of typifications and First 

Revisers 

There was a unanimous view that details 

of types designated after the original 

introduction of a new taxon should be 

deposited in the registering database at 

the time of typification. At present it was 

very difficult to locate later epi-, lecto-, or 

neotypifications. It was considered that 

9Hawksworth DL (2012) Managing and coping 

with names of pleomorphic fungi in a perioid 

of transition. Mycosphere 3 (2): 52–64; IMA 


10Redhead SA (2010b) Proposals to define the new 

term ‘teleotype’, to rename Chapter VI, and to 

modify Article 59 to limit dual nomenclature 

and to remove conflicting examples and 

recommendations. Taxon 59: 1927–1929. 

(12) ima funGuS

this was an issue that the NCF should 

consider, with a view to requiring accredited 

repositories to record such information. 

The Amsterdam Declaration had 

included the proposal that the first authors 

to make a choice of names when uniting 

anamorph- and teleomorph-typified genera 

should be registered and accepted, unless 

that was subsequently challenged – in which 

case it would have to be considered by the 

appropriate mandated body, i.e. the NCF. 

This concept is similar to the principle of 

the first-reviser in zoological nomenclature, 

but has not been used outside zoology. 

This provision was not part of the package 

adopted at the Melbourne Congress, but 

some of those present at the meeting did 

consider the matter nevertheless merited 

careful consideration, and perhaps could 

be discussed during IMC10 in Thailand in 

2014. 

There was also a lengthy discussion 

and interchanges between representatives 

of MycoBank and Index Fungorum on 

the issue of accreditation of repositories 

of nomenclatural data, which is required 

for the valid publication of new fungal 

taxa from 1 January 2013. In particular, 

there was a debate as to whether more than 

one repository should be recognized by 

the NCF. The meeting saw MycoBank as 

the logical immediate choice, but it also 

recognized the value of several centres, 

especially ones operating systems in 

different languages, such as Chinese. It also 

recognized the depth of nomenclatural 

detail in Index Fungorum and the key 

role that had in underpinning all fungal 

nomenclatural databases. If a distributed 

system were eventually developed, the 

meeting felt it was absolutely essential that 

there was data-sharing in a timely manner, 

and ideally in real-time, but at least on a 

daily basis. 

(9) Proposal by Walter Gams 

Gams and colleagues had recently published 

a proposal that when a binomial in a 

prioritized genus had a younger epithet than 

the corresponding name in the suppressed 

genus, priority should be granted to 

existing names in the prioritized genus 11 . 

This principle already applies in zoological 

nomenclature, and had been adopted by 

some botanists in the past where it became 

known as the “Kew Rule” 12 – but this 

practice has not been permitted under the 

various editions of the botanical Code. Some 

of those present saw some advantages in this 


suggestion as a further means of minimizing 

name changes, but it was recognized that a 

formal proposal on this matter would have 

to be prepared for consideration by the 

NCF and a future congress. Gams indicated 

that he was encouraged by the comments 

and would explore this possibility further. 

(10) Desirability of a joint NCF/ICTF/ 

IMA dedicated Lists committee 

The officers of the NCF, ICTF, and IMA 

present at the symposium did not see the 

need or value of establishing a dedicated 

Lists committee. There was a strong 

dialogue between the parties, and some 

mycologists were members of more than 

one of these bodies. It was recognized that 

the NCF was the body with mandatory 

responsibility for making recommendations 

on any Lists prepared, while the ICTF had a 

role in List preparation, through its various 

subcommissions. 

(11) Environmental sequences 

The increasingly urgent need to address 

the issue of the naming of fungal taxa only 

known from environmental DNA sequences 

had been considered at the One Fungus = 

One Name symposium in 2011, and some 

suggestions were made in the report of that 

meeting 13 . After some discussion, the ICTF 

agreed to establish a working group on 

naming environmental strains. 

Working group reports 

Basidiomycota 

Rapporteurs: Scott A. Redhead and 

Dominik Bergerow 

Participants: 19 

The group split into one dealing with 

heterobasidiomycetes, and the other with 

homobasidiomycetes (Agaricomycetes s.str.). 

For the heterobasidiomycetes, a web page 

in which it would be possible to comment 

on each name separately should be set up, if 

possible with a voting option. Most of the 

problems in these fungi were considered to 

be taxonomic rather than nomenclatural. 

The real need was for more people writing 

papers. For example, it is general knowledge 

that Cryptococcus is paraphyletic, but no 

one was resolving the problem, which in 

any case should be addressed together with 

the yeast commission and the group on 

medicinal fungi. In the rusts, the solution 

should be close to current practice. I.e. to 

maintain the use of Uredo for species only 

known from the uredinial stage and without 

any current possibility of assigning them 

to a monophyletic genus. If Uredo was to 

be restricted to it’s type species, there was a 

possibility that some would propose names 

that prove superfluous in an intermediate 

time-frame; this was not ideal, but an ad 

interim alternative. 

In the case of the homobasidiomycetes 

(agaricomycetes), a working list could be 

generated shortly. When that was available, 

invitations to assist in the evaluation should 

be sent worldwide to all who had expressed 

interest in helping and an invitation will be 

sent to them to participate in the decision 

making process. Initial tables had been 

provided for the Amsterdam meeting by 

CBS, but it was recognized these were 

not complete. Further it was evident that 

while there were issues, many would be 

easy to decide on. Taking the first four 

generic names: one required research 

(Abortiporus vs. Fibrilklaria), one had an 

obvious solution (Abortiporus biennis vs. 

Sporotrichopsis terrestris), one no obvious 

solution (Aleurodiscus habgallae vs. Matula 

poroniforme), and one conservation 

(Armillaria vs. Rhizomorpha). As such cases 

could be resolved during the meeting, the 

group opted to start an online working 

group as soon as the logistics could be 

worked out. In each case the types for each 

of the generic or species names would need 

to be confirmed, and the links between 

the names needed to be questioned or 

confirmed. It was planned to have a first List 

available for comment by the end of 2012. 

Dothideomycetes 

Rapporteur: Kevin D. Hyde 


It was agreed that a web page for 

Dothideomycetes should be set up within a 

few months, and all proposed committee 

members would be contacted by email or 

other social media (e.g. connect website). 

Of key importance was the type species of 

11Gams W, Humber RA, Jaklitsch W, Kirschner R, 

Stadler M (2012) Minimizing the chaos following 

the loss of Article 59: suggestions for a discussion. 

Mycotaxon 119: 495–507. 

12Stevens PF (1991) George Bentham and the “Kew 

Rule”. Regnum Vegetabile 123: 157–168. 

13Hawksworth DL Crous PW, Redhead SA, 

Reynolds DR, Samson RA, Seifert KA, Taylor 

JW, Wingfield MJ [& 69 signatories] (2011) The 

Amsterdam Declaration on Fungal Nomenclature. 

IMA Fungus 2: 105–112; Mycotaxon 116: 91–500. 

REPORTs (13)

REPORTs 

generic names, and it is with those than links 

should be substantiated; if correlations were 

with species other than the type, this needed 

to be made clear in a note on any List or 

in a supporting paper. Linkages should be 

based on sexuality/phylogeny, and if not the 

case needed to be well- argued. In general, 

the group considered that the oldest names 

should be given priority, regardless of the 

nature of their types. In cases where a younger 

name was prepared, the logic in support of 

the retention needed to be provided. The 

group considered that initial Lists could be 

published by September 2012, with a view to 

submission by January 2013. 

Eurotiomycetes 

Rapporteur: Robert A. Samson 


The group recognized that many genera 

in the class were important for applied 

mycology, so the nomenclature should be 

simple, stable and not confusing. It was also 

noted that applied researchers are likely 

to ignore nomenclatorial changes. The 

phylogeny of Trichocomaceae was now wellestablished, 

and the IUMS International 

Commission on Penicillium and Aspergillus 

(ICPA) planned to tackle other genera 

in the family as well. However, in the 

case of Onygenaceae collaboration with 

medical mycologists would be sought. It 

was anticipated that ICPA would produce 

a list of accepted names in Penicillium 

within a short time, but it was recognized 

the case of Aspergillus would require more 

discussion with users. In Aspergillus, there 

were several options: retaining the name 

for all aspergillae, splitting the genus and 

re-naming the groupings according to 

their teleomorph names, changing the type 

of the genus to A. niger so that did not 

change in a splitting, or to use Aspergillus 

with an optional descriptor. It was also 

pointed out in open discussion that there 

was in addition the possibility of using 

subgeneric names, which could be those of 

the teleomorph-typified names if adopted 

in the Accepted List; it while names at the 

rank of subgenus or section could not be 

conserved under the Code, the Lists had no 

such rank restriction.sa noted that names in 

indicator. These matters would be discussed 

at a meeting of ICPA scheduled for the 

Saturday after the symposium, and open o 

all through the commission’s website (www. 

aspergilluspenicillium.org). 

Medical mycology 

Rapporteurs: Sybren de Hoog and Vishnu 

Chaturvedi 


It was considered that the International 

Society for Human and Animal Mycology 

(ISHAM) should implement a democratic 

procedure to achieve a stable result, which 

would be adopted quickly by the entire 

community. There was a consensus for 

a practical approach, taking the needs 

of the user as the starting point. The 

community of medical mycologists must 

first decide which names we without 

doubt want to keep: for example, Candida 

albicans and Aspergillus fumigatus should 

be maintained, and Trichophyton used 

rather than Arthroderma. There could 

also be many other classical pathogens 

and opportunists that we wish to keep the 

current names for and which should be 

proposed for inclusion on an Accepted 

List. An important criterion over the 

choice of a name will be how frequently 

it has been used. However, “widely used” 

is an unclear criterion. How does one 

establish whether Scedosporium is more 

current than Pseudallescheria? For each 

name put forward, the reasons for the 

proposed retention should be specified. In 

cases where no single name was strongly 

favoured, the oldest name (whether 

anamorph- or teleomorph-typified) should 

have priority. For example: Aspergillus 

is older than Neosartorya, and therefore 

the Neosartorya species should be termed 

Aspergillus in the future. 

Reclassifications can be phenotypic 

or molecular phylogenetic, but the key 

criterion of a group is the monophyly. The 

clade determines the group meriting a 

genus name, preferably the oldest available 

for that group is used, as for Aspergillus. 

Molecular taxonomy may reveal groups 

where all experts agree that they are clearly 

monophyletic, and also share essential 

characteristics such as pathogenicity or 

antifungal susceptibility, as in the yeasts. 

However, there are also groups where so 

many new data – often of environmental 

relatives – are being added, that the 

phylogeny is highly unstable, as in the 

rapidly developing black yeast taxonomy. 

The group felt it could be prudent to 

propose that for the time being we leave 

names as they are, even if some “genera” 

are polyphyletic. In the case of established 

but poorly differentiated genera, such 

as Acremonium, some may be highly 

polyphyletic and thus phylogenetically 

ambiguous. There was a proposal to 

abandon such generic names, but an 

alternative would be to redefine them in a 

modern sense on the basis of accessible type 

material. 

The community of medical mycologists, 

including the ISHAM membership, is 

requested to propose Lists of preferred 

names on the basis of the above criteria. The 

names of many fungal pathogens have an 

ancient history and have become a source of 

confusion over the years. We therefore urge 

taxonomists, if necessary, to (re)define the 

groups of fungi they are working with by 

the deposition of (new) type material that 

can be protected in the Lists. As a first step, 

an ad hoc group has decided to provide a 

list of fungal names in current use based on 

the Atlas of Clinical Fungi 14 for the ISHAM 

membership to comment on (comments to 

be sent to: s.hoog@cbs.knaw.nl). The group 

hoped to have active involvement of as many 

medical mycologists as possible. 

Sordariomycetes 

Rapporteur: Joey Spatafora 

Participants: ca 30 

In discussing the criteria to be used to 

choose between two generic name options, 

considerations should include: taxonomic 

clarity (i.e. the genus name should be well 

circumscribed), the morphology most 

commonly encountered, names used 

in plant pathology and industry (etc), 

quarantine issues, stability, and relevance. 

The credentials of a particular taxonomist 

needed to be made clear when making a 

decision on a particular group. The strength 

of an argument should consider the number 

of name changes, monophyly, that names 

represented clades not morphologies, 

distinguish taxonomic and nomenclatural 

issues, consilience, and historical uses, 

and the possibility of retaining genera 

but with a different type species. Should 

there be a preference for names that 

commemorated the history of a taxon 

(e.g. Cordyceps) or ones that were history 

(e.g. Tolpocladium). It was felt that several 

subgroups would be needed: Xylariales; 

Magnaporthales/Diaporthales; Fusarium; 

Hypocreales I (Bionectriaceae, Nectriaceae, 

Hypocreaceae, and Niessliaceae; Hypocreales 

II (Cordycipitaceae, Clavicipitaceae, and 

Ophiocordycipitaceae); Sordariales and allies; 

and Colletotrichum. 

14de Hoog G S, Guarro J, Gené J & Figueras 

M J (2000) Atlas of Clinical Mycology. 

2nd edn. Utrecht: Centraalbureau voor 

Schimmelcultures. 

(14) ima funGuS

Scenes from the One Fungus = Which Name symposium held in the Trippenhuis, headquarters of the Royal Netherlands Academy of Arts and Sciences, Amsterdam, 

on 12–13 April 2012. 


REPORTs (15)

REPORTs 

Scenes from the One Fungus = Which Name symposium held in the Trippenhuis, headquarters of the Royal Netherlands Academy of Arts and Sciences, Amsterdam, 

on 12–13 April 2012; the launch and presentation of the Atlas of Soil Ascomycetes and Taxonomic Manual of the Erysiphales (Powdery Mildews) to John W. Taylor (IMA 

President); and the sun drenched Fungal BBQ at the CBS, following committee meetings on Saturday 14 April 2012. 

(16) ima funGuS

ImA Executive committee meeting 

In mid-April 2012, The Netherlands 

again turned into an international 

centre for mycology and the IMA 

Executive Committee met on 14 April 

2012 in Utrecht parallel to meetings of 

the International Commission on the 

Taxonomy of Fungi (ICTF) and the 

International Commission on Penicillium 

and Aspergillus (ICPA). This was the largest 

Executive Committee meeting ever held 

between IMC congresses, and illustrated 

the amount and importance of activities 

organized by the Association, under the 

presidency of John Taylor. The meeting 

covered all aspects of advancing mycology 

on a global scale, and here I just wish to 

highlight a few of the points, which were 

discussed and decided. 

First, the Executive Committee 

congratulates the winners of our young 

mycologist awards, which were finally 

completed with announcements on the two 

outstanding. The Elias Magnus Fries Medal 

was awarded to Cécile Gueidan (nominated 

by the European Regional Mycological 

Member Organization) and the Carlos 

Luis Spegazzini Medal to Luís Fernando 

Pascholati Gusmão (nominated by the Latin 

American Regional Mycological Member 

Organization; for further information 

see p. (25) in this issue. While the young 

(dominik.begerow@rub.de) 

The International Commission on the 


mycologist awards are designated to 

the early years of a career and honours 

outstanding mycological research by 

young scientists from our regional member 

organizations, the Executive Committee 

also searches for ways of acknowledging 

substantial support of mycology by others. 

The introduction of a category of IMA 

Fellows as a midcareer award received great 

support from the Executive Committee, and 

guidelines will be available soon, so that a 

first round of mycologists can be recognized 

in this way during IMC10 in Bangkok. 

Although the finances of the IMA are 

robust, we seek further external funding 

to increase our capabilities. While there 

is quite substantial support from external 

funding during our congresses, the IMA 

would like to attract companies and 

institutions to become patrons of the 

IMA for a yearly fee. The profits of several 

large international companies are based 

on fungi or fungal products, and the IMA 

supports the development of a closer link 

between research and economy. Mycology 

will become a big business in the future, 

and financial support to our work is highly 

appreciated. 

To increase visibility and to provide 

better support for mycology worldwide, 

the Executive Committee agreed on the 

further development of our IMA Newsletter 

Taxonomy of Fungi (ICTF) held a 

general meeting at the CBS-KNAW 

and the redesign of our webpage. IMA 

should reach all mycologists, worldwide, 

on a regular basis and information should 

be widely distributed in the age of the 

internet and free information exchange. 

Beside the issues of IMA Fungus volumes, 

the Executive wishes to enhance the 

Newsletter, and the option to subscribe will 

be highlighted much more often than has 

been the case before. In addition, we ask all 

members to contribute to the content of the 

IMA Newsletter and also to IMA Fungus to 

further increase the international visibility 

of global mycology. 

Finally, the Executive Committee 

acknowledged the progress being made 

in the organization of IMC 10, which is 

to take place in Bangkok in 2014. Leka 

Manoch reported on progress made during 

the last year. Most exciting was the change 

of venue to the Queen Sirikrit National 

Convention Center, which will allows a 

great congress in Thai style. The Organizing 

Committee is already hard at work, with 

Leka Manoch and Morakot Tantichareon 

as co-chairs. The call for symposia will be 

made soon, and the Executive Committee 

suggested that there should be seven 

concurrent sessions per day, two for fungal 

diversity, and one for each of the following 

themes: fungal cells, fungal genomes, fungal 

ecology, fungal pathogenesis and fungal 

biological technology. In addition there 

would be nomenclature sessions held on 

three days, as at IMC9. The congress aims 

to reflect the best of international mycology, 

and the needs of our communities. 

During the intensive discussions by the 

Executive Committee, a Skype conference 

was arranged to facilitate the participation 

of members who could not attend in person, 

so broadening the basis for discussions 

and decisions. Mycology is global, and the 

Executive Committee would like to get all 

of you who read this involved in discovering 

the future. 

Dominik Begerow 

(Secretary-General, IMA) 

International commission on the Taxonomy of Fungi 

(IcTF). 2012 general meeting 

Fungal Biodiversity Centre, Utrecht, 

The Netherlands on Saturday, 14 April 

REPORTs (17)

REPORTs 

2012 following the “One Fungus : Which 

Name?” symposium held in the Royal 

Dutch Academy of Arts and Sciences 

in Amsterdam. Eleven members of the 

Commission attended the meeting, an 

unusually high turnout for this group at a 

meeting outside an IMC. Approximately 

20 observers also attended, some of them 

taking an active role. With an ambitious 

programme of work already in front of it, 

the added expectation that the ICTF and 

its subcommissions will play active roles 

in the nomenclatural exercises currently 

developing made this meeting particularly 

relevant. 

The ICTF website (www. 

fungaltaxonomy.org), has been hosted at 

the Technical University of Vienna by Irina 

Druzhinina and her colleagues since IMC7 

in Oslo in 2002. Andrew Miller offered 

to host the website at the Illinois Natural 

History Survey (INHS) at the University of 

Illinois, and this transition is now complete. 

The ICTF plans to extend the contents of 

the website considerably, with a view to 

making it more attractive. The mandate 

of the ICTF is both to support fungal 

taxonomists and to provide information and 

tools that will be useful to those wishing to 

learn more about this subject. Until now, 

the website has 

primarily been 

a repository for 

the minutes of 

the Commission, 

links to the 

websites of 

subcommissions, 

and a small 

amount of other 

information. 

Plans are 

now being 

implemented 

to enhance the 

website with 

more visual 

information, 

to develop and 

make available 

information on 

good taxonomic 

practices (such as 

the article “How 

to describe a 

fung us”, IMA 

Fungus 1(2): 

109–111, 2010), 

news items of 

general interest 

to fungal taxonomists, and other similar 

content. 

The need to coordinate information on 

nomenclatural working groups addressing 

the changes in the International Code of 

Nomenclature (ICN) is discussed elsewhere 

in this issue of IMA Fungus. Some of 

these working groups will conduct their 

operations and post their draft lists of 

protected or rejected names on the ICTF 

website. Our intention is that links to all 

such working groups who develop their 

own websites, or those operating from the 

MycoBank website, will be listed on an 

ICTF webpage, allowing it to function as 

a starting point for taxonomists wishing to 

participate in these exercises. 

The relationship between the ICTF, 

with its focus on promoting fungal 

taxonomy, and the Nomenclature 

Committee for Fungi (NCF), with its 

focus on nomenclature, was the topic of 

much discussion in Amsterdam and still 

seems to be a source of some confusion. 

For the nomenclatural exercises, the two 

bodies are cooperating as much as possible. 

While the ICTF envisions assisting in the 

coordination of the nomenclatural working 

groups in their preparation of lists, the 

NCF is the ultimate authority who will 

Keith Seifert (standing) and Andrew Miller (seated) at the ICTF meeting in Utrecht. 

be making the final recommendations 

on the acceptance of these lists to the 

General Nomenclature Committee, a body 

appointed by the Melbourne International 

Botanical Congress in 2011. The existing 

subcommissions of the ICTF on Penicillium 

and Aspergillus, Fusarium, and Trichoderma 

and Hypocrea, are already actively leading 

the nomenclatural activities on these genera. 

We are particularly excited at the formation 

of new subcommissions on Colletotrichum 

(initiated by Cai Lei and Bevan Weir), and 

on rusts (initiated by Cathy Aime and José 

Dianese). Other nomenclatural working 

groups being formed will interact with the 

ICTF and the NCF as appropriate during 

their work. 

One of the duties of the ICTF is 

to organize symposia and sessions at 

international meetings that will promote 

advances in fungal taxonomy to a broader 

scientific audience, as well as promote 

standards within the fungal community. 

For the 2014 IUMS congress in Montreal, 

Canada, we intend to organize a session 

addressing the changes to the names of 

economically important fungi resulting 

from the application of the new ICN. 

Further, we will propose a symposium on 

the interaction of genomics and taxonomy, 

which we hope will include presentations 

by bacteriologists, and virologists, as well 

as mycologists. The IMC10 in Bangkok, 

Thailand, will be held only a few days after 

the IUMS meeting, but will undoubtedly 

attract a larger but different crowd of 

mycologists. For IMC10, more detailed 

presentation and discussion of the 

nomenclatural lists will be organized by 

the ICTF, in collaboration with the NCF 

as appropriate. The ICTF will also offer a 

series of after lunch workshops on “Good 

Practice in Fungal Taxonomy”, presenting 

information on microscopy, culturing, 

molecular methods, data analysis and other 

aspects of fungal taxonomy that would lead 

to a useful set of publications or exercises on 

the ICTF website. 

Acknowledgement: We appreciate financial 

support from the IUMS Executive Board, 

which enabled Andrew Miller to attend the 

2012 meetings in The Netherlands. 

Seifert KA, Rossman AY (2010) How to describe a 

fungal species. IMA Fungus 1(2): 109–116. 

Keith A. Seifert (Chair ICTF), 

Andrew N. Miller (Secretary ICTF) 

(amiller@inhs.illinois.edu) 

(18) ima funGuS

cbs course medical mycology – chinese edition 

An international CBS Course on “Medical 

Mycology” was organized in Nanjing, 

China, on 19–27 November 2011. The 

course was a joint effort of the Chinese 

Society for Microbiology (CSM), the 

A very successful meeting of the ISHAMaffiliated 

Working Group on Black Yeasts 

was held in Curitiba, Brazil, on 1–4 

December 2011. Themes included new 

concepts on symbiotic interactions of black 

yeasts, bioremediation, extremophiles, and 

current overviews of diseases in humans and 

animals. There was much time for debate 

among scientists and clinicians, particularly 

on human diseases with significant impact 

such as chromoblastomycosis, a disease with 

impressive records in Brazil and China. 

Novel data on the lethargic crab disease in 


Chinese Society of Dermatology, and the 

CBS-KNAW Fungal Biodiversity Centre. 

The Atlas of Clinical Fungi 15 was used as 

the laboratory manual. This book is now 

also available in the Chinese language on a 

the Uca crab population at the northeastern 

Brazilian coast were also presented. A 

Brazilian Black Yeast Network was also 

introduced. 

The presentations were organized in 

themes. The opening speech was by Sybren de 

Hoog with an overview of the latest achievements 

and future questions, followed by 

Flávio Queiroz-Telles who introduced the 

Brazilian Network. Sanjay Revankar reported 

on his recent experience on the MSG Phaeohyphomycoses 

Network, in cooperation with 

the ISHAM Working Group Fungiscope. 

CD-ROM. A dedicated practical software 

was developed on fungal terminology, 

in order to assist Chinese participants in 

learning how to pronounce English and 

Latin names correctly. Eight specialist 

speakers from all over China were invited, 

while Sybren de Hoog gave presentations 

on biodiversity. The 70 participants that 

attended the course came from many 

parts of China, Taiwan, Hong Kong, 

and Indonesia. Their current positions 

were in hospital laboratories as clinicians, 

medical microbiologists, and medical 

technicians. The course was devoted 

to the identification of pathogenic and 

opportunistic moulds and yeasts. A large 

and representative set of organisms was 

offered for practical work and to introduce 

the participants to fungal diversity. 

Sybren de Hoog 

(s.hoog@cbs.knaw.nl) 

Hidden Danger, bright Promise: 4 th meeting of the 

IsHAm Working group on black yeasts 

Other themes, such as the biotechnological 

potential and biodiversity of melanized fungi, 

recent progress in melanin research, and the 

development of compounds with antifungal 

activity were debated. The workshop updated 

knowledge on treatment of diseases caused by 

black yeast infections. 

A visit to the hospital of the Paraná 

State Federal University was part of the 

programme. Live patients with chromoblastomycosis 

and mycetoma were shown 

and discussed. On the last day a visit to a 

mangrove area was organized in order to 

draw the participants’ attention to the natural 

habitat of edible crabs where currently a 

black yeast epizootic is taking place. 

The meeting had 73 full participants 

from 11 countries, and comprised 43 

speeches and 18 posters, with a broad diversity 

of topics showing recent results in taxonomy, 

molecular techniques, identification 

and diagnosis of clinical and environmental 

agents, besides genome analysis data. Elec- 

15de Hoog G S, Guarro J, Gené J & Figueras 

M J (2000) Atlas of Clinical Mycology. 

2nd edn. Utrecht: Centraalbureau voor 

Schimmelcultures. 

REPORTs (19)

REPORTs 

tronic abstracts and lectures in PDF format 

are available on the website (http://www. 

blackyeast.org/Curitiba/report.html) and a 

film of the entire meeting can be viewed on 

YouTube. 

From this event, new doors were opened 

for international and intercontinental cooperation 

involving both clinicians and scien- 

Following the great success of the meeting 

of the ECMM-ISHAM Working Group 

Zygomycoses in Athens, Greece, in May 

2010, a Special Interest Group meeting 

was organized in conjunction with IMC9 

in Edinburgh in August 2010. Kerstin 

Voigt and Sybren de Hoog were privileged 

to organize this pre-conference meeting 

that was attended by 20 mycologists from 

seven countries (Egypt, Germany, Japan, 

Poland, Taiwan, The Netherlands, and the 

United Kingdom). The aim of the meeting 

was to bring together mycologists working 

in various areas of the zygomycetes, to 

share recent discoveries, to establish an 

international network for discussion, and 

to exchange materials and sequences. The 

plan is to build up a database allowing rapid 

and reliable identification of species, leading 

to understanding of ecology, routes of 

infection, and food safety. 

Five presentations demonstrated 

divergent themes in research on 

morphology, systematics, phylogeny, 

physiology, and etiology of zygomycetes, 

and underlined their growing importance 

as agents of disease. An alarming rise in 

the incidence of zygomycosis was noted 

worldwide, especially in Asia and South 

America. Tropical climates seem to 

favour the manifestation of mucoralean 

infections. The percentage of cases of 

zygomycoses increased over the past 

seven decades from 0 % to above 70 % , 

as documented by cultures (Roden et al. 

2005). However, during the same period 

mortality decreased from almost 100 % to 

below 40 % due to improved diagnostics 

(Roden et al. 2005). Therefore, correct 

identification and reliable diagnostics 

were major themes in the SIG meeting. 

It became evident that the taxonomy 

and phylogenetic reconstruction of the 

zygomycetes is changing fundamentally 

with the application of molecular methods, 

particularly ones involving the ITS and the 

D1/D2 domain of the large subunit (LSU) 

nuclear ribosomal DNA as barcoding and 

tists. At the end of the workshop a list was 

presented with all (about 20) full genomes 

that are currently being sequenced and annotated 

by different consortia, and plans 

were made for experimental reproduction 

and detection of agents of chromoblastomycosis 

in environmental sources. 

The next meeting of the Black Yeast 

phylogenetic markers. The ITS domain is 

the preferred region for species distinction. 

In the first presentation, Sybren de 

Hoog (CBS-KNAW Fungal Biodiversity 

Centre, Utrecht, The Netherlands) pointed 

out that ITS and LSU sequences do not 

fully determine the species level, because 

significant intraspecific variability is 

observed. Generic circumscription is also 

difficult, with ITS dissimilarities of up to 

30 % observed between species of the same 

genus. Mucorales, the most prominent 

order of zygomycetes, was recently raised 

to the rank of subphylum, underlining the 

molecular divergence of these organisms. 

De Hoog advocated a multigene approach 

which also utilizes protein-coding genes 

and their diagnostic power hidden in the 

introns, supplemented with classical mating 

experiments. Members of Mucorales are 

ubiquitous in homes, bath- and bedrooms, 

as well as in refrigerators and pantries. 

They are known to have an ecological “hitand-run-strategy”, 

which means that they 

arrive on virgin food sources prior to most 

other microbes, eat fast, grow fast, and get 

away before competing microorganisms 

arrive. This strategy leads to rapid spoilage 

of unattended food batches by abundant 

production of extracellular enzymes. Within 

hours, they form a disgusting hairy felt 

on fruits, vegetables, and cereal products 

alike. Humans have learnt to manipulate 

the decomposition process. Especially in 

Asia a wide variety of mucoralean fungi 

is applied for pre-digestion of fermented 

foods, such as soy sauce or Indonesian 

tempeh. However, de Hoog drew the 

attention to a possible downside to the use 

of Mucorales in food preparation, since the 

order also harbours confirmed causative 

agents of mycoses. Human infections tend 

to produce severely disfiguring and often 

fatal symptomatologies. These infections 

have been encountered particularly in 

patients with severe underlying disease, such 

as ketoacidotic diabetes or leukemia, but 

recently a species was found consistently 

Working Group will be a symposium at 

the ISHAM Congress in Berlin on 12 June 

2012, and a full meeting is planned in 2013 

in Guangzhou, China. 

Vania Vicente, Sybren de Hoog, Derlene 

Attili de Angelis, and Flávio Queiros Telles 

(s.hoog@cbs.knaw.nl) 

International cooperation in zygomycete research 

Fig. 1. Syncephalis parvula (Piptocephalidaceae, 

Zoopagales), SEM micrograph. Photo courtesy 

Hsiao-Man Ho. 

causing chronic skin infections in 

otherwise healthy patients in East Asia. 

Inappropriate therapy of such lesions due 

to poor diagnostics of the causative agent 

of the infection may lead to fulminant 

growth and severe mutilation. Agents of 

these destructive infections in part belong 

to the same species that are used for food 

preparation. An example is Rhizopus 

microsporus, where the varieties classically 

maintained for food preparation and those 

responsible as agents of severe disease appear 

to be identical. Further research is needed to 

establish whether pathogens are consistently 

being used to prepare food. 

The status of zygomycete research 

in Taiwan outlined from historical and 

contemporary points of view was presented 

by Hsiao-Man Ho (National Taipei 

University of Education, Taiwan). Special 

emphasis was placed on thermotolerant 

species in Mucorales with a potential to 

(20) ima funGuS

cause human infections. The study of 

zygomycetous fungi in Taiwan started in 

the 1920s, and since that period a number 

of local mycologists recorded 38 genera 

with 123 species. The fungi comprise the 

following nine families, with their most 

prominent genera between parentheses: 

Chaetocladiaceae (Chaetocladium), 

Dimargaritaceae (Dispira), Kickxellaceae 

(Coemansia, Linderina, Ramicandelaber), 

Lichtheimiaceae (Lichtheimia), 

Mortierellaceae (Mortierella), Mucoraceae 

(Absidia, Gongronella, Cunninghamella), 

Pilobolaceae (Pilobolus, Utharomyces), 

Piptocephalidaceae (Piptocephalis, 

Syncephalis), and Thamnidiaceae 

(Thamnidium, Thamnostylum). The 

morphological beauty of the zygomycetes 

is demonstrated exemplarily for Syncephalis 

parvula (Fig. 1) and Zygorhynchus moelleri 

(Fig. 2). At present, most of the zygomycete 

research is carried out in the mycology 

laboratory of Hsiao-Man at the National 

Taipei University of Education. Species 

identification is based on morphological 

characters combined with ITS, LSU-D1/ 

D2, SSU data for most of the taxa. 

Kerstin Hoffmann ( Jena Microbial 

Resource Collection, Department of 

Microbiology and Molecular Biology, 

Institute of Microbiology, Jena, Germany) 

gave an overview of the zygomycetes 

as emerging pathogens in recent years. 

Traditionally, the phylum Zygomycota has 

been divided into two classes, Zygomycetes 

and the Trichomycetes (Alexopolous et al. 

1996). However, since the Zygomycota 

appeared to be polyphyletic, multigene 

based phylogenies suggested the 

elimination of the classical Zygomycota as 

a separate phylum and its subdivision into 

five distinct subphyla: Mucoromycotina, 

Entomophthoromycotina, Kickxellomycotina, 

Zoopagomycotina (Hibbett et al. 2007) and 

the newly described Mortierellomycotina 

(Hoffmann et al. 2010). Members of 

Entomophthoromycotina produce indolent 

subcutaneous and mucocutaneous 

infections in immunocompetent hosts, 

whereas the Mucoromycotina mostly cause 

rapidly progressing, fatal and often systemic 

infections in immunocompromised or 

severely debilitated hosts (Voigt et al. 

1999, Ribes et al. 2000). Members of 

Mucorales are very significant in hospital 

settings. Of a total of 205 known species 

in the order, 25 species, belonging to the 

genera Apophysomyces, Cunninghamella, 

Lichtheimia, Mucor, Rhizomucor, Rhizopu,s 

and Saksenaea have been reported to 


be pathogenic, whereas only 4 four out 

of a total of 277 species described in 

Entomophthorales are reported as causing 

infection. Within Mortierellales, only a 

single species was found to be clinically 

relevant, Mortierella wolfii, causing 

abortion in cattle. Infection routes are 

variable, including inhalation, ingestion 

or direct inoculation into pre-damaged 

tissue. Ketoacidotic diabetes, burns, 

major surgery, severe trauma and immune 

disorders trigger the establishment of 

mucoralomycoses. Roden et al. (2005) 

listed malignancy, organ transplantation, 

desferoxamine therapy, injection drug 

use, bone marrow transplantation, renal 

failure, and malnutrition as additional risk 

factors, in order of decreasing significance. 

A relationship between predisposing 

factors and type of infection was reported, 

demonstrating that diabetes, malignancy, 

and desferoxamine therapy predispose for 

rhinocerebral, pulmonary, and disseminated 

infections, respectively. Differences between 

entomophthoromycoses and mucormycoses 

can be shown in virulence tests using a hen 

egg model (Fig. 3). While the mucoralean 

fungus Rhizopus oryzae produces a 40 % 

mortality at day six in hen egg embryos, 

infection with the entomophthoralean 

fungus Conidiobolus coronatus resulted in 60 

% mortality of the embryos within one day, 

using comparable spore concentrations. 

The hen egg model for testing virulence 

appears to be particularly suitable for 

large scale assessments of the pathogenic 

potential of zygomycetes. Ilse D. Jacobsen 

(Department of Microbial Pathogenicity 

Mechanisms, Leibniz Institute for Natural 

Product Research and Infection Biology 

- Hans-Knöll-Institute, Jena, Germany) 

gave a summary of embryonated eggs 

as an alternative infection model to 

study virulence. She emphasized that 

zygomycetes are increasingly recognized 

as pathogens in both humans and animals. 

However, relatively little is known of their 

pathogenesis and virulence. Infection 

models for zygomycetes have only been 

described in a very few species. Based on 

her experience with embryonated eggs as 

alternative infection model for Candida 

albicans and Aspergillus fumigatus ( Jacobsen 

et al. 2010, Olias et al. 2010), Jacobsen 

elucidated the suitability of this model for 

species of Lichtheimia (formerly Absidia; 

Hoffmann et al. 2009, Alastruey-Izquierdo 

et al. 2010), using L. corymbifera as the 

reference species. Eggs were infected on 

developmental day 10 on the chorioallantoic 

membrane (CAM) with 10 6 to 10 2 spores (n 

= 20 per dose and experiment). Survival was 

determined daily by candling, a standard 

method which allows visualization of 

embryonic structures and movement by 

applying a strong light source to the surface 

of eggs. Mortality upon infection with the 

reference strain was dose-dependent, with 

infectious doses of 10 6 to 10 4 spores per egg 

resulting in 95−100 % mortality within 

two days. 10 3 spores per egg killed 70−80 

% of infected eggs, and the LD 50 was found 

Fig 2. Zygorhynchus moelleri (Mucoraceae, Mucorales), SEM micrograph. Photo Martin Eckart and Kerstin 

Hoffmann. 

REPORTs (21)

REPORTs 

A B 

Fig. 3. Virulence tests in the hen egg model. Survival of embryos by application of Conidiobolus coronatus (A) 

and Rhizopus arrhizus (syn. R. oryzae) (B). Courtesy Ilse Jacobsen and Volker Schwartze. 

to be 10 2 spores per egg. These results were 

highly reproducible (2–4 experiments per 

infectious dose). Lichtheimia corymbifera 

could readily be re-isolated from the CAM 

of infected eggs, while the CAM of PBSmock 

infected controls remained sterile. 

The three clinically relevant Lichtheimia 

species complexes, L. ramosa, L. corymbifera, 

and L. ornate, displayed a comparable 

virulence potential in embryonated eggs. 

In contrast, the L. sphaerocystis and L. 

hyalospora complexes were significantly 

attenuated in comparison to L. corymbifera. 

The embryonated egg model is reproducible, 

inexpensive, easy to handle and does not 

require specialized facilities. It could 

serve as alternative model to analyse the 

virulence potential of different zygomycetes 

and to directly compare the virulence 

potential between species, strains and 

isolates. As the model allows determination 

of fungal burden, histological analyses 

and measurement of the host’s cytokine 

response, it can also be used to assess 

potential pathogenicity mechanisms. 

Guido Fischer (Arbeitsmedizin, 

Umweltbezogener Gesundheitsschutz, 

Landesgesundheitsamt Baden- 

Württemberg, Stuttgart, Germany) 

introduced “Fungiscope - a Global Rare 

Fungal Infection Registry” and its services 

for the scientific community. The registry is 

supported by the pharmaceutical industry 

as well as by scientific communities (as an 

ISHAM working group) and is hosted 

at the University of Cologne (www. 

fungiscope.net). While the registry focuses 

on the detailed documentation of cases of 

rare infectious fungi from different taxa, 

a number of zygomycete infections have 

been included. Of 41 recently published 

cases of zygomycote infections (Rüping 

et al. 2009), 63.4 % occurred in patients 

with malignancies, 17.1 % in patients 

with diabetes mellitus, and 9.8 % in 

patients having undergone transplantation. 

Diagnosis of zygomycete infection was 

made by culture in 68.3 % and/or histology 

in 63.4 % of the cases. The sites of infection 

were: lung (58.5 %), soft tissue (19.5 %), 

rhino-sinuorbital region (19.5 %), and brain 

(14.6 %). In 82.9 %, a targeted treatment 

against zygomycetes was applied and the 

overall survival rate of patients was 51.2 % 

(Rüping et al. 2009). All strains collected 

within Fungiscope are stored in the 

collection of the mycology laboratory of the 

State Health Office Baden-Württemberg 

(LGA-BW, Germany) and were reidentified 

by morphology-based methods 

to cross-check the initial identification in 

the hospital. In addition, all strains were 

sequenced at CBS. 29 % (4 of 14) of the 

identifications carried out in the respective 

centers were incorrect at the genus level; 

50 % of the strains had only been identified 

to that level. Lichtheimia corymbifera was 

the most frequent infectious agent (6 of 

14) with a preference for lung infection, 

followed by Rhizopus microsporus and R. 

oryzae (each 3 of 14), and two single isolates 

of Mucor racemosus and M. circinelloides. 

From these findings, two questions could 

be raised: (1) how reliable is the statistics 

on clinical cases reported in the literature 

for different fungal taxa?; and (2) does the 

correct identification have any implication 

for therapy? For the cases reported here, 

application of liposomal amphothercin 

B was associated with a higher survival 

rate (cfr Rüping et al. 2009). For Rhizopus 

microsporus/oryzae infections, the ratio of 

fatal outcomes tended to be higher than that 

of Lichtheimia corymbifera infections. In 

general, antimycotic therapy of zygomycetes 

is difficult because: (a) clinical and 

microbiological diagnosis of zygomycete 

infections is difficult in practice, while 

species may have different susceptibility 

profiles; (b) zygomycetes grow very quickly 

causing fulminant infections; and (c) 

zygomycetes are resistant to some azoles, 

except posaconazole, and may show reduced 

susceptibility to amphotericin-B. Exposure 

prophylaxis may be relevant to high-risk 

patients, as infectious zygomycetes occur 

ubiquitously in the environment. Effective 

risk assessment is based on knowledge of 

fungal concentrations in the environment 

and of possible sources of infection. 

Quantitative data were presented at the 

SIG meeting from Fischer’s preliminary 

studies. The concentration of Rhizopus 

species lies below 1 cfu m -3 air in natural 

environments, and is thus one order of 

magnitude lower compared to Aspergillus 

fumigatus. Concentrations can be higher 

due to human activities, such as wastehandling. 

Lichtheimia species are associated 

with composting facilities (up to 4 × 10 2 

cfu m -3 ), and are rarely encountered in air 

in natural habitats. A study in a suburban 

area showed that R. pusillus was the most 

frequently encountered species, followed by 

R. oryzae and R. microsporus; L. corymbifera 

was encountered infrequently. It was 

concluded that knowledge on distribution 

and habitats of potentially infectious 

zygomycetes may help to improve risk 

assessment and infection prophylaxis for 

immuno-compromised patients. 

All participants came to the conclusion 

that networking of scientists with research 

interests in zygomycetes on a global basis 

is necessary to exchange and calibrate 

materials and data. A platform for future 

collaboration was created with an expansion 

of the clinically oriented ECMM-ISHAM 

Working Group of Zygomycetes by a section 

on biodiversity and ecology. A follow-up 

meeting, on “The dynamics of zygomycete 

research in a changing world”, was held 

at the CBS-KNAW Fungal Biodiversity 

Centre in Utrecht, The Netherlands, on 3−5 

March, 2011. That workshop was organized 

by Kerstin Voigt ( Jena, Germany), Anna 

Skiada (Athens, Greece), and Sybren 

de Hoog (Utrecht, The Netherlands). 

The keynote speakers were Mary Berbee 

(University of British Columbia, Canada), 

Hsiao-man Ho (National University of 

Taipei, Taiwan), Ashraf Ibrahim (Los 

Angeles Biomedical Research Institute at 

Harbor-UCLA Medical Center, Torrance 

and David Geffen School of Medicine at 

UCLA, Los Angeles, USA), Ilse D. Jacobsen 

(HKI, Jena, Germany), and Paul M. Kirk 

(CAB International, Egham, UK).Topics 

covered all areas of zygomycete biodiversity, 

including genomic, phylogenetic, 

morphological, physiological and ecological 

aspects. Participants were able to present 

(22) ima funGuS

their latest research data on the many 

beautiful and bizarre members of these 

fungi. The meeting will culminate soon in a 

special issue on zygomycete phylogeny in the 

journal Persoonia, scheduled for publication 

in December 2012. 

Mycologists, food and nutrition 

scientists, medical microbiologists, infection 

and immune biologists, molecular biologists, 

and bioinformaticians, are welcome to join 

the Working Group in any of its upcoming 

initiatives. For more information please 

consult the Group’s web page (www. 

zygomycota.eu). 

Alastruey-Izquierdo A, Hoffmann K, Hoog 

GS de, Rodriguez-Tudela J-L et al. (2010) 

Species recognition and clinical relevance of 


the zygomycetous genus Lichtheimia (syn. 

Absidia p.p., Mycocladus). Journal of Clinical 

Microbiology 48: 2154−2170. 

Alexopoulous CJ, Mims CW, Blackwell M (1996) 

Introductory Mycology. 4th edn. New York: John 

Wiley & Sons. 

Hibbett DS, Binder M, Bischoff JF, Blackwell 

M et al. (2007) A higher-level phylogenetic 

classification of the Fungi. Mycological Research 

111: 509−447. 

Hoffmann K, Walther G, Voigt K (2009) Mycocladus 

vs. Lichtheimia, a correction (Lichtheimiaceae 

fam. nov., Mucorales, Mucoromycotina). 

Mycological Research 113: 277−278. 

Ribes JA, Vanover-Sams CL, Baker DJ (2000) 

Zygomycetes in human disease. Clinical 

Microbiological Reviews 13: 236−301. 

Roden MM, Zaoutis TE, Buchanan WL, Knudsen 

TA et al. (2005) Epidemiology and outcome 

of zygomycosis: a review of 929 reported cases. 

Clinical Infectious Diseases 41: 634−653. 

Rüping MJGT, Heinz WJ, Kindo AJ, Rickerts V 

et al. (2010) Forty-one recent cases of invasive 

zygomycosis from a global clinical registry. 

Journal of Antimicrobrobial Chemotherapy. 65: 

296−302. 

Voigt K, Cigelnik E & O´Donnell K (1999) 

Phylogeny and PCR identification of clinically 

important zygomycetes based on nuclear 

ribosomal-DNA sequence data. Journal of 

Clinical Microbiology 37: 3957−3964. 

Kerstin Voigt, Sybren de Hoog, 

Hsiao-Man Ho, Kerstin Hoffmann, 

Ilse D. Jacobsen, and Guido Fischer 

(kerstin.voigt@uni-jena.de) 

REPORTs (23)

AWARDs AND PERsONALIA 

AWARDs 

cbs-kNAW Fungal biodiversity centre Awards 

The CBS-KNAW Fungal Biodiversity Centre presented its two prestigious awards at the start of the second day of the “One Fungus = Which 

Name” symposium in Amsterdam on Friday 13 April 2012. The awards are made at irregular intervals by the institute following discussions by 

its senior staff. This is the third time these awards have been made, and the citations were read, and the presentation of certificates made, by the 

Centre’s Director, Pedro W. Crous. 

Johanna Westerdijk Award: 

michael J. Wingfield 

Awarded on special occasions to an individual 

who has made an outstanding contribution 

to the culture collection of the CBS Fungal 

Biodiversity Centre, marking a distinguished 

career in mycology. Nominees for the award 

will be evaluated on the basis of quality, originality, 

and quantity of their contributions to 

the collection, and on the basis of associated 

mycological research in general. 

“Mike” Wingfield is Professor and Director 

of the Forestry and Agricultural Biotechnology 

Institute (FABI), University of Pretoria, 

Josef Adolf von Arx Award: 

John W. Taylor 

Awarded on special occasions to an individual 

who has made an outstanding contribution 

to taxonomic research of fungal biodiversity, 

marking a distinguished career in mycology. 

Nominees for the award will be evaluated on 

the basis of quality, originality, and quantity 

of their contributions in the field of fungal 

taxonomy. 

It is no exaggeration to state that John’s 

name is universally known within our field. 

His research focuses in two main areas: 

one concerns barriers to reproduction that 

are essential to the persistence of species, 

South Africa. The nomination clearly outlines 

the extraordinary high level of achievement 

he has attained. His scientific output is truly 

remarkable, as evidenced by nine books and 

585 scientific publications that have attracted 

more than 7000 citations in the scientific 

literature; this makes Mike one of the highest 

cited scientists in his field. He has received 

numerous awards from societies worldwide, 

including The Hendrik Christiaan Persoon 

gold medal, from the Southern African 

Society for Plant Pathology, Honorary 

Membership from the Mycological Society 

of America, Fellowship of the American Phytopathological 

Society, an A-rated scientist 

in the National Foundation for Research 

Development in South Africa, and later this 

year he is to be awarded an Honorary Doctor 

of Science degree by the University of British 

Colombia (Vancouver, Canada). 

Mike studied at the University of Natal 

in South Africa, where he majored in botany 

and plant pathology, did an MSc on tree 

diseases at the University of Stellenbosch in 

South Africa, and then a PhD on the pine 

wood nematode at the University of Minnesota 

in the USA. He is a remarkable mentor, 

and has supervised over 100 MSc and PhD 

students. His counsel is not only continuously 

sought by students but by academics, 

and the other is comparative genomics that 

takes into account variation within species. 

Furthermore, he is also working to make 

Neurospora a model evolutionary organism 

to study the timing of deep divergences 

in fungal evolution and the application of 

molecular evolution to socially important 

problems involving fungi. Arguably, some 

of his biggest contributions include the 

papers on genealogical concordance species 

recognition, and the use of the ITS (Internal 

Transcribed Spacer) region as a gene for species 

recognition. 

Of the peer-reviewed works that John 

has produced, many have appeared in Proceedings 

of the National Academy of Sciences 

(USA), Science, and Nature, giving him an 

foresters, and leading forestry companies 

worldwide. He has the exceptional ability 

to motivate others and to bring out the best 

in everyone. Mike has provided a home for 

a generation of biologists to study and work 

in Africa at the cutting edge of science. One 

of the biggest gifts he ever gave his students, 

was to teach them how to culture fungi. The 

remarkable aspect of Mike Wingfield’s cv, 

is that his papers are backed up by cultures 

and DNA evidence to test and retest his 

hypotheses. A further remarkable aspect is 

that the majority of his designated ex-type 

strains have over the years been deposited 

in the CBS collection. So one day, when we 

have moved on, the students of the future 

will still be able to retest his hypotheses with 

the latest techniques available. 

Mike’s passion for collecting and culturing 

fungal biodiversity make him an excellent 

recipient for the Johanna Westerdijk 

award. Westerdijk had 56 PhD students in 

her career, and one of them, Susara Truter, 

returned to South Africa, and became a 

professor in plant pathology, and the first 

female dean in Agriculture. She also taught 

classes to a young Mike Wingfield. By handing 

Mike the prestigious Westerdijk award 

today, the circle is complete. 

(24) ima funGuS

H-index above 50. One paper in particular 

has been outstandingly influential, namely 

that introducing the ITS primers which 

became widely used in fungi, and which has 

received more than 4000 citations. 

John has received many awards, including 

the Rhoda Behnam Medal for Research 

from the Medical Mycological Association 

of the Americas, the Lucille Georg Medal 


for Research from the International Society 

for Human and Animal Mycology, and the 

Alexopoulos Award for Research from the 

Mycological Society of America. He is a fellow 

of the Mycological Society of America, 

the American Academy of Microbiolog, and 

the California Academy of Sciences. John 

is also the current President of the International 

Mycological Association, and a 

ImA young mycologist Awards 2011 

former President of the Mycological Society 

of America. 

We are extremely proud today to be 

able to honour John with the Josef von 

Arx award. I think that, similar to von Arx, 

John is also seen as a trailblazer in fungal 

taxonomic research. 

The recipients of the IMA Young Mycologist Awards for 2011 for Africa, Asia. Australasia, and North America were announced in IMA 

Fungus 2 (2): (52)–(53), 2011. At that time, the IMA regional mycological member organizations for Europe and Latin America had not 

finalized their selections, so they are announced here. The recipients will receive their awards, which include a cheque for 500 €, at IMC10 in 

Thailand in 2014. 

Elias magnus Fries medal 

Cecile Gueidan is unusual in that her broad 

mycological interests started in fieldwork 

with one of Europe’s most experienced 

lichenologists, Claude Roux. She went on 

to learn molecular phylogenetic methods at 

Duke University (NC, USA) and tackled 

some of the most difficult pyrenocarpous 

lichens that grow on rocks in terrestrial as 

well as marine and freshwater habitats. Her 

studies demonstrated enormous polyphyly 

and convergence in some thallus characters 

in the verrucarioid lichens (especially those 

with simple spores), and by combining her 

molecular work with careful observations of 

ascomatal features, she laid the foundations 

for a modern taxonomy of this huge group 

of lichenized fungi. 

During a post-doctoral period at CBS, 

Cecile applied her talents to other groups of 

non-lichenized fungi, including the fascinating 

rock-inhabiting taxa, some lichenicolous 

species, and also certain moulds. This led 

her to become interested in and to make 

contributions to the discussion of the overall 

system for ascomycete classification, and the 

origins of rock-inhabiting fungi. 

It is also of note that Cecile co-operates 

with a wide range of lichenologists and 

other mycologists, and as Elias Magnus Fries 

worked and published on lichen-fungi as 

well as other fungi, this makes her a particularly 

fitting recipient of this award. 

Cecile is now employed as a research 

scientist in the Department of Life Sciences 

of the Natural History Museum in London, 

where she continues her research on the 

molecular systematics of verrucarioid lichenforming 

and also other ascomycetes. 

carlos Luis spegazzini 

medal 

Luis Fernando Gusmao has been a very 

productive mycologist since he obtained 

his PhD at the Universidade de São Paulo, 

Brazil, in 2004. This concerned the microfungi 

on decaying leaves of native plants. 

He has already published 50 papers, most in 

peer reviewed journals. His main research 

has continued to be on the taxonomy of 

mitosporic fungi from Brazil, contributing 

to the knowledge of this important and 

little-known group in South America and 

also worldwide. He has coordinated the 

research activities of several laboratories, 

and has conducted several research projects 

himself. 

Luis is now at the Universidade Estadual 

de Feira de Santana (Feira de Santa,Bahia 

State, Brazil) where, in addition to his own 

research, he has become very committed 

to the training of both undergraduate and 

graduate students interested in mycology. 

Indeed, to date he has been the advisor of 

14 undergraduate and graduate Brazilian 

students. 

Luis has also participated in national 

and international congresses, workshops, 

and other activities, at which he has given 

talks related to his research activities. 

The Committee considered that he has 

all the attributes to making him a deserving 

recipient of the Spegazzini Medal: dedication, 

enthusiasm, national and international 

visibility, and a strong commitment to the 

study of mycology in Latin America. 

AWARDs AND PERsONALIA (25)


(26) 

Anton de bary medaille: Walter gams 

Walter Gams is to be honoured with the 

Anton de Bary Medaille of the Deutschen 

Phytomedizinischen Gesellschaft (DPG) 

at a ceremony in Braunschweig on 11 

September 2012. The award is named after 

Anton Heinrich de Bary (1831–1888) who 

had enormous influence on mycology in the 

mid- to late nineteenth century. The medal 

was initiated in 1989, and is now generally 

awarded in alternate years to persons who 

have made outstanding contributions to 

mycology and phytopathology. Walter, for 

many years a mycologist at the KNAW-CBS 

Fungal Biodiversity Centre in Baarn and 

later Utrecht, developed an international 

reputation for his thorough systematic 

revisionary work on critical and difficult 

groups of hyphomycetes, especially in the 

genera Acremonium, Fusarium, Trichoderma 

and Verticillium, but further on soil fungi 

and hyphomycetes in general. His books 

include Cephalosporium-Artige Schimmelpilze 

(1971), CBS Course of Mycology (1975, 

1980, 1983, 1998; with various other CBS 

staff ), Compendium of Soil Fungi (1980, 

2007; with K. H. Domsch and T.-H. Anderson), 

and most recently the stupendous Genera 

of Hyphomycetes (2011; with K.Seifert, 

G. Morgan-Jones and W. B. Kendrick). 

He collaborates with and assists mycologists 

world-wide, and played a major role in 

training courses and supervising students 

and visiting researchers at CBS, and also at 

the University of Aachen. For many years he 

served as Secretary of what is now the Nomenclature 

Committee for Fungi (NCF), 

and willingly shares his deep knowledge of 

the intricacies of fungal nomenclature. 

Queen’s Award for Forestry: Jolanda Roux meets the 

Queen of England 

Jolanda Roux of the University of Pretoria’s Forestry and Agricultural 

Biotechnology Institute (FABI), as the recipient of the Queens 

Award for Forestry of the Commonwealth Forestry Association 

(CFA), was invited to Buckingham Palace and able to spend ten minutes 

in private conversation with Her Royal Highness Queen Eliza- 

beth II on 13 December 2011. The Queen has been a 

patron of the CFA since 1987, and this award aims to 

recognise outstanding international contributions to 

forestry and recognizes the achievements of outstanding 

mid-career foresters, based on a combination of 

exceptional contributions to forestry and an innovative 

approach to his or her work. Since its inception, 

the award has been made only nine times and Jolanda 

is the first woman to receive this honour. She was accompanied 

to the Palace by Jim Ball, the current Chair 

of the CFA. 

Jolanda is a forest pathologist and mycologist and 

one of the team of academics that lead FABI and also 

has an appointment in the Departments of Microbiology 

and Plant Pathology at the University of Pretoria. 

Her research focuses on tree diseases, and she 

is particularly passionate about tree health in general 

and fungi that cause diseases of trees on the African 

continent. She collaborates with researchers on many 

other parts of the world and has travelled widely to 

undertake her research. She has already published 

close to 100 papers in international respected journals 

and has supervised numerous post-graduate students at the University 

of Pretoria. In addition to the Queen’s Award, she has received 

many other forms of recognition for her work, notably in 2011, the 

“Distinguished Young Women in Science” award of the South African 

Department of Science and Technology. 

ima funGuS

IN mEmORIAm 

Vernon Ahmadjian (1930–2012) 

Vernon Ahmadjian, pioneer in the culture 

of the fungal and algal partners of lichens, 

and explorer of the lichen symbiosis, died 

on 13 March 2012. The son of Armenian 

immigrants, Vernon graduated from Clark 

University, Worcester (MA, USA) in 

1952, and received a PhD from Harvard 

University in 1960 where he worked 

with the lichenologist Ivan Mackenzie 

Lamb (1911–1990). For almost all his 

life he was based at Clark University 

where he experimented with the culture 

of the isolated components from lichens, 

and strove to resynthesize lichen thalli 

and understand the nature of the lichen 

symbiosis. His early work is drawn 

together in The Lichen Symbiosis (1967). 

His scanning electron micrograph of an 

algal cell being clasped by a fungal hypha 

featured in Nature in 1981 captivated 


numerous biologists. He took a particular 

interest in the taxonomy of the green 

trebouxioid algae, and in collaboration 

with Chicita F. and William L. Culberson 

showed that “lichen products” much used 

in chemotaxonomy were manufactured by 

the fungal partner alone. He extended his 

interests to symbiotic systems in general, 

producing an influential textbook on the 

subject with Surindar Paracer (Symbiosis: an 

introduction to biological associations, 1986). 

He was the first editor of the International 

Association for Lichenology’s Newsletter, 

and was awarded the Association’s Acharius 

Medal in 1986. He presented his personal 

lichen collections with supporting literature 

and documents to the Farlow Herbarium in 

Cambridge (MA) in 2007. Lichen biology 

has lost one of its foremost and much 

respected pioneers. 

Ovidiu constantinescu (1933–2012) 

On 23 January 2012 our dear friend Ovidiu 

Constantinescu passed away at the age of 

79. He was a passionate mycologist already 

in his Romanian years, specializing in fungi 

growing on plant leaves. In spite of the difficult 

situation under the communist regime 

in Romania, he managed to acquire the 

relevant literature in exchange for herbarium 

specimens, and his papers were always 

perfectly documented. He was always keen 

to improve standards in mycology, and to 

that end published a book Metode si Technici 

în Micólogie (1974), which sadly was not 

translated into English. In a second effort 

he succeeded to leave his country and came 

to The Netherlands, moving from there to 

Sweden in 1982. Using his technical skills, 

he built up a culture collection, Mycoteket, 

in Uppsala. His most prominent expertise 

was the taxonomy of biotrophic Peronosporaceae, 

about which he published several 

relevant papers, including a compilation of 

names in Peronospora (1991). More recently 

he collaborated with Jamshid Fatehi and 

others, in order to unertake molecular work 

with his favourite group of fungi. 

Developed from a draft provided by Walter Gams. 

Walter Friederich Otto marasas (1941–2012) 

It is with great sadness that we must share 

the news of the passing of our dear friend 

and colleague Walter (“Wally”) Marasas 

on 6 June 2012. Wally, famous for his 

ground-breaking research on mycotoxins, 

especially those associated with Fusarium 

species, had friends and admirers in many 

parts of the world. He was a larger than life 

character who inspired people around him, 

and he will be deeply missed by his many 

friends and colleagues. Wally’s passion for 

biology, and mycology in particular, was 

infectious and he shared his experience and 

skills with great numbers of people. He 

mentored students (ourselves included) and 

encouraged many to pursue their mycologi- 

Photo Hannes Hertel 

cal dreams. Those who knew Wally only as 

a mycologist/mycotoxicologist probably 

did not know that he was an accomplished 

botanist with a deep love for the flora of 

South Africa, spending long hours with 

his wife Rika identifying and photographing 

flowering plants. He was also an avid 

philatelist, and post his formal retirement 

AWARDs AND PERsONALIA (27)


five years ago, he worked furiously to 

complete a book illustrating most of the 

world’s fungal stamps – which he classified 

taxonomically. During an illustrious career, 

Wally published in excess of 300 scientific 

papers, numerous books, and was amongst 

the worlds’ most highly cited mycologists. 

He was a founder member (fellow and 

honorary member) of the Southern African 

Society for Plant Pathology, Fellow of the 

American Phytopathological Society, Fellow 

of the South African Veterinary Association, 

and Foreign Associate member of the US 

National Academy of Science. He was the 

recipient of many international awards, and 

held honorary doctorates from the University 

of the Free State and the University of 

Pretoria. Wally’s death leaves a great void, 

perhaps most so in the tremendous support, 

guidance and mentorship that he provided 

A leading and much respected expert in the 

taxonomy, nomenclature, and phylogeny of 

fungi, Erast died on 24 April 2012 at the age 

of 83. He graduated from Tartu State University 

in 1952, and studied at the Institute 

of Biology of the Estonian Academy of Sci- 

to friends and colleagues, both young and 

old. He had a special knack of being able to 

focus on the real issues and to provide wise 

council. Many mycologists will know that he 

held very strong views regarding mycological 

issues and principles and he was not shy to 

share these openly. This firm commitment 

to what he believed to be “good practice” 

and the courage to express his feelings is 

what many of us relied on most. His loss 

will be felt for many years to come. Wally is 

survived by his wife Henrika (Rika) Marasas 

and two children Carissa and Walter jr and 

two grandsons. He was not only a wonderful 

friend to many, but also a loving family 

man, and a great biologist that will be fondly 

remembered by all who knew him. 

Michael J. Wingfield and Pedro W. Crous 

(mike.wingfield@fabi.up.ac.za) 

Erast Parmasto (1928–2012) 

Erast Parmasto at IMCV in 1994. Photo 

Karen Nakasone. 

ences in Tartu, supervised by the renowned 

polypore specialist Apollinari Bondarzew, 

gaining a PhD in 1955 and a DSc in 1969. 

He was based from 1950 until his death at 

the Institute of Biology of the Estonian Academy 

of Sciences (now part of the Institute 

of Agricultural and Environmental Sciences 

of the Estonian University of Life Sciences) 

with roles from senior gardener to director – 

and after retirement as a senior researcher. 

From 1951–1977 he also taught part-time 

at the Department of Botany, University 

of Tartu, on mycology, methodology of 

science, cladistics, cladistic biogeography, 

computer applications, and principles of 

biosystematics. He was awarded the title of 

Emeritus Professor of Mycology in 1980, 

and later worked as a part-time professor in 

the department from 1987–1995. 

His main reserch interest was in the 

corticioid fungi, especially Hymenochaetales, 

on which he published extensively with 

particular care being paid to nomenclature. 

In total, he published more than 400 

scientific or popular scientific studies, and 

described more than 200 new taxa. He was 

an early devotee of e-mail, and initiated 

and for many years ran Mycologists Online, 

which compiled the electronic addresses 

of mycologists world-wide. He was always 

passionate about new approaches, and he 

was one of the first mycologists to embrace 

cladistics. He jumped also at the potential of 

databases, initiating Cortbase, a continuing 

nomenclator of the corticiod fungi which 

swelled to over 8000 species names. But 

he was also philosphical on issues such as 

generic and species concepts, on which he 

edited a book (Problems of Species and Genus 

in Fungi, 1986). 

In addition to his scientific work, Erast 

was one of the academician-secretaries of the 

Estonian Academy of Sciences in 1973– 

1981, established the series Scripta Mycologica 

in 1970, and served as editor of Eesti Loodus 

(Estonian Nature) in 1957–1960. He 

organized the Tenth Congress of European 

Mycologists (CEMX) in Tallin in 1989, and 

was a major contributor to nomenclatural 

discussions at congresses, and also for many 

years an astute and much-valued member of 

what is now the Nomenclature Committee 

for Fungi (NCF). His bright eyes, wry smile, 

and sharp intellect will be missed by all mycologists 

who came to know him, not least 

his many close colleagues in Estonia. 

Urmas Kõljalg kindly provided key biographical 

information on Erast‘s career. 

(28) ima funGuS

Archaeorhizomycetes: a new class for a major clade 

of soil fungi 

The pioneering molecular study on Alaskan 

soils by Schadt et al. (2003) was a huge 

surprise to mycologists in claiming that 

there were even major fungal lineages in 

soils that did not correspond to known 

fungal groups. Subsequent work by many 

researches has shown just how right their 

seemingly brash claims were. Two major 

clades of unnamed soil ascomycetes 

repeatedly emerge, that have come to be 

termed Soil Clone Groups 1 and 2. Group 1 

is the most ubiquitous, especially in boreal 

and tundra soils, and data from 52 studies 

with 162 environmental sequences have 

been analyzed by Rosling et al. (2011). In 

addition, the authors obtained cultures 

of one species from soil in Sweden, and 

studied its behaviour on Pinus roots in the 

laboratory. It forms pale colonies and occurs 


on root surfaces, often mixed with other 

fungi, but is not mycorrhizal. No sexual 

spores or undeniable conidia were found, 

but chlamydospore-like structures were 

noted. The fungus seems to have seasonal 

tendencies which the authors suggest may 

be indicative of a saprobic habit in which it 

depends on carbon compounds released by 

roots in the summer. 

The new genus Archaeorhizomyces 

is introduced for A. finlayi and 

another unnamed species. The new 

class Archaeorhizomycetes, order 

Archaeorhizomycetales, and family 

Archaeorhizomycetaeae are introduced to 

accommodate these. The class is diagnosible 

by rRNA sequences, and is clearly extremely 

ancient as it belongs to the subphylum 

Taphrinomycotina, which includes Neolecta, 

Consensus phylogeny showing the position of Archaeorhizomyces species in the phylum Ascomycota. Modified 

from Rosling et al. (2011). 

Inter-specific sex in grass smuts 

Mating is of key importance to grass 

smut fungi (Ustilaginaceae) as it initiates 

parasitism by switching from a yeast phase 

to a filamentous one with hyphae able to 

invade the plant tissues. The sexual identity 

is due to particular genomic alleles that 

Archaeorhizomyces finlayi. Culture (A), SEM 

micrograph (B), chlamydospore-like structures (C), 

and growth on a Pinus root (D). Photos courtesy 

Anna Rosling. 

Pneumocystis and Schizosaccharomyces. It is 

notable that the new genus is filamentous 

as previously Neolecta seemed somewhat 

anomalous in the subphylum. 

The choice of class name is perhaps 

somewhat unfortunate, however, in view of 

the class name Archiascomycetes Nishida & 

Sugiyama 1994. Although that name was 

not validly published, it has also been used 

by other authors and is essentially a synonym 

of Taphrinomycotina in circumscription. 

It is to be anticipated that the numerous 

other taxa that appear in the class will 

eventually be named as they are obtained in 

culture or when procedures for naming taxa 

only known environmental sequences have 

been agreed. And Soil Clone Group 2 yet 

has to receive formal recognition. 

Rosling A, Cox F, Cruz-Martinez K, Ihrmark K, 

Grelet G-A, Lindahl BD, Menkis A, James TY 

(2011) Archaeorhizomycetes: unearthing an 

ancient class of ubiquitous soil fungi. Science 

333: 876–879. 

Schadt CW, Martin AP, Lipson DA, Schmidt 

SK (2003) Seasonal dynamics of previously 

unknown fungal lineages in tundra soils. Science 

301: 1359–1361. 

code for variants of a pheromone-receptor 

(PR) system and the transcription factors, 

operating in a bisphasic mating process; 

REsEARcH NEWs (29)

REsEARcH NEWs 

(30) 

this involves recognition, directed hyphal 

growth leading to conjugation, and then 

plasmogamy of compatible mating partners. 

In order to investigate this complex and 

fascinating system, last December Kellner et 

support values 

MrBayes RAxML 

< 90 < 50 

90-95 50-80 

> 95 > 80 

0.1 

Ustilaginaceae 

host age: 83-89 mya 

Ustilaginales 

host age: 113-117 mya 

hybrid filament 

pheromone response 

1 a1 allele 

2 a2 allele 

3 a3 allele 

* ** U. maydis 

S. reilianum 

S. walkeri 80 

Me. pennsylvanium 63 

U. hordei * 

U. xerochloae 

U. cynodontis 

Us. gigantosporum 

* 

A 

: bt > 91 

0.5 

pra1 

Malassezia pachydermatis 

100 

100 

100 

Cintractia limitata 

al. (2011) reported on elegant investigations 

designed to illuminate our understanding of 

the evolution of the PR system. Ten species 

spanning 100 Myr of evolution of the system 

were selected for genomic and biological 

S. walkeri 

S. scitamineum 

Me. pennsylvanicum 

Us. standleyanum 

S. anthracoideisporum 

S. mishrae 

S. andropogonis 

S. reilianum 

U. vetiveriae 

U. maydis 

U. cynodontis 

U. filiformis 

Ma. eriachnes 

U. xerochloae 

U. striiformis 

U. spermophora 


Schizonella melanogramma 

Malassezia globosa 

S. exsertum 

S. bursum 

U. hordei 

U. williamsii 

U. maydis 

S. reilianum 

pra2 Ma. eriachnes 

61* 

U. hordei 

82 


71 

pra3 

S. reilianum 

* S. walkeri 

U. xerochloae 


--------------------------------- 

1 2 3 3 2 3 

--------------------------- 

2 1 1 

2 2 

2 2 

------------------------ 1 1 1 

-------------------- 

1 1 3 3 3 1 

---------------------------- 

3 1 

1 3 3 

---------------------------- 

2 

1 

S. consanguineum 

Tranzscheliella hypodytes 

1 3 

--------------------------------- 

1 2 3 3 

Melanotaenium euphorbiae 

B c 

Urocystis eranthidis 

Figure xxx. Interspecific sex in grass smuts - modified from Kellner et al. 2011 (Plos genetics) 

(A) Multi-gene phylogeny and interspecific sexual compatibility of Ustilaginales. Concatenated Maximum 

Likelihood (ML) analysis of 2571 bp of ssu, ITS, lsu rDNA, ef1-α and rpb1. Circles next to branches indicate 

bootstrap support values and a posteriori probabilities of Bayesian and ML analyses, respectively. Branch lengths 

correspond to substitutions per site and abbreviated branches indicate longer branches. Connected squares 

illustrate It has previously hybrid filament been formation recognized (bold lines) that self- or pheromone Sup35 response that (thin is not lines). essential Numbers to in the squares function represent 

respective a mating types. Coloured boxes depict different phylogenetic clades (see text). Host ages refer to 

Prasad perpetuating et al., 2005 changes (PNAS). in protein (B) Phylogeny structure of mating type-specific of the protein pheromone and can receptors. adopt Maximum an amyloid Likelihood 

analysis can be heritable of complete elements pheromone in receptor-coding yeasts separate sequences. configuration Numbers and which asterisks self-perpetuates next to branches and indicate 

bootstrap (bt) support values and branch lengths correspond to substitutions per site. (C) Interspecific mating of 

from and preceding genetic change (True 

haploid sporidia of Sporisorium reilianum (Sr) and Sporisorium scitamineum (Ss). 

& Lindquist 2000); such self-perpetuating 

epigenetic structures are termed prions. 

Halfmann et al. (2012) investigated the 

yeast translation-termination factor prion 

Sr 

Ss 

1 

study. In addition to detailed comparative 

information on the alleles, they performed 

interspecific sex tests which revealed a high 

potential for hybridization between species 

linked to pheromone signalling. While the 

system is optimized for within-species sex, it 

reveals that there are possibilities for hybrid 

generation which could lead to smuts with 

new host specificities. This possibility was 

confirmed by the demonstration of actual 

fusions between not only species of the 

same genus, but ones in different genera, 

as illustrated in the accompanying figure. 

The authors comment that the system now 

revealed may serve as a valuable model for 

the study of the hybrid-based genesis of 

novel genotypes. 

Kellner R, Vollmeister E, Feldbrügge M, Begerow D 

(2011) Interspecific sex in grass smuts and the 

genetic diversity of their pheromone-receptor 

system. PLoS Genetics 7: e1002436. 

Interspecific sex in grass smuts (modified from 

Kellner et al. 2011). A, Multi-gene phylogeny and 

interspecific sexual compatibility of Ustilaginales. 

Concatenated Maximum Likelihood (ML) analysis 

of 2571 bp of ssu, ITS, lsu rDNA, ef1-a and rpb1. 

Circles next to branches indicate bootstrap support 

values and a posteriori probabilities of Bayesian and 

ML analyses, respectively. Branch lengths correspond 

to substitutions per site and abbreviated branches 

indicate longer branches. Connected squares 

illustrate hybrid filament formation (bold lines) 

or pheromone response (thin lines). Numbers in 

squares represent respective a mating types. Coloured 

boxes depict different phylogenetic clades (see text). 

Host ages refer to Prasad et al. (Science 310:1177– 

1180, 2005. B, Phylogeny of mating type-specific 

pheromone receptors. Maximum Likelihood analysis 

of complete pheromone receptor-coding sequences. 

Numbers and asterisks next to branches indicate 

bootstrap (bt) support values and branch lengths 

correspond to substitutions per site. C, Interspecific 

mating of haploid sporidia of Sporisorium reilianum 

(Sr) and S. scitamineum (Ss); SEM micrograph. 

Prions and phenotypic inheritance in wild yeasts 

leads to increased stops in codon read- 

through; that leads to a variety of new traits. 

The prions had been considered an artefact 

of strains kept in culture, but these authors 

examined occurrences and screened for new 

prions in around 700 wild Saccharomyces 

strains. Prions proved to occur in about 

one third of the wild strains examined. 

Modifications of the Sip35 prion were 

demonstrated to confer characters likely to 

be beneficial to the yeasts under selective 

pressures, that is to develop beneficial 

phenotypes. Indeed, 40 % of the prions in 

ima funGuS

the wild yeasts were beneficial to growth 

under 12 sets of conditions tested. In yeasts, 

it has consequently now been established 

that prions are a naturally present 

supplementary source of inheritable material 

of adaptive value. The extent of prions in 

filamentous fungi as a whole has yet to be 

assessed, but they clearly have the potential 

to contribute to adaptability and fitness. 


Halfmann R, Jarosz DF, Jones SK, Change A, 

Lancaster AK, Lindquist S (2012) Prions 

are a common mehcnisms for phenotypic 

inheritance in wild yeasts. Nature 282: 

363–368. 

True HL, Lindquist SL (2000) A yeast prion 

provides a mechanism for genetic variation 

and phenotypic diversity. Nature 407: 

477–478. 

Different fungal and algal genotypes demonstrated 

within one lichen specimen 

Observations on the development of lichens 

in the field reveal that multiple propagules 

of a species developing on a surface often 

116 

P4T7e 

104 

P3T4c 

108 

P4T7 

102 

P3T4 

113 

P1T8 

103 

P5T3 

106 

P5T3c 

123 

P4T7d 

A single specimen of Parmotrema tinctorum showing the different fungal 

and algal genotypes determined with PCR of SSR markers. Codes prefixed 

by P are of the fungal partner, and those by T are of the algal partner; five 

fungal genotypes and one algal genotype were detected within this particular 

98 

specimen. P3T6 Adapted from Mansournia et al. (2012). 

Yeast colonies, light and tramsmission electron 

micrograph photos of Saccharomyces cerevisiae. 

coalesce to form a single structure. This is 

frequently observed where the propagules 

are asexual soredia or isidia, which may 

or may not have 

come from the same 

parent, and is welldocumented. 

However, 

whether all had to be 

of a single genotype 

for this to occur was 

uncertain. The first 

study to suggest that a 

single lichen specimen 

might not just have a 

single fungal partner 

experimentally was 

the study of Larson 

& Carey (1986) who 

found that single 

115 

P6 

Tabcde 

120 

P6 

Tabcde 

124 

P6 

Tabcde 

specimens of two 

Umbilicaria species 

showed variations 

in physiological 

parameters and 

isoenzyme profiles. 

With the advent 

of DNA PCR 

technology, and 

especially the use of 

microsatellite (SSR) 

markers, it has become 

possible to explore the 

issue of the degree of 

individuality of single 

lichen specimens 

with respect to both 

the fungal and the 

algal populations that 

comprise them. 

Parmotrema tinctorum is a rather 

common tropical lichen that reproduces 

mainly by asexual isidia. Mansornia et 

al. (2012) studied populations growing 

on Pinus thunbergii in Japan, and used 

microsatellite markers to characterize the 

partners at different levels: within single 

specimens, on single trees, and within 10 x 

10 cm quadrats. Of particular interest were 

the results from single specimens in which 

they studied numerous small pieces of tissue. 

They found that a single specimen could be 

formed from a single fungal partner with 

or without changes in the algal partner, 

or fusion of several independent partners. 

In total 12 fungal genotypes and 37 algal 

genotypes were recognized. An example in 

which there were five fungal genotypes and 

a single algal genotype is illustrated here. 

Further, specimens from individual trees 

or which were close together tended to 

have similar genotypes, suggesting limited 

dispersal in the site. 

This study provides evidence to support 

what has long been suspected, that one 

cannot presume that what looks like a single 

individual lichen specimen represents a 

single fungal genotype. 

Larson DW, Carey CK (1986) Phenotypic variation 

within “individual” lichen thalli. American 

Journal of Botany 73: 214–223. 

Mansournia MR, Wu B, Matsushita N, Hogetsu T 

(2012) Genotypic analysis of the foliose lichen 

Parmotrema tinctorum using microsatellite 

markers: association of mycobiont and 

photobiont, and their reproductive modes. 

Lichenologist 44: 419–440. 

REsEARcH NEWs (31)

REsEARcH NEWs 

Fungi that can transform lead 

Soil and rock-inhabiting fungi, especially 

lichen-forming fungi, are well known to be 

able to convert different minerals to oxalates 

through the extracellular secretion of oxalic 

acid. Now, Rhee et al. 92012) have found 

that two fungi, Metarhizium anisopliae and 

Paecilomyces javanicus, are able to act directly 

on lead metal to form chloropyromorphite, 

the most stable lead mineral known. The 

strains were isolated from a former lead- 

mining area in Scotland, and their activity 

was demonstrated using incubated lead 

shot, and examination by two methods 

of X-ray analysis; it should be noted that 

in controls without the fungi, different 

compounds were formed. The lead shot was 

visibly corroded after one month, and minor 

amounts of some other lead compounds 

were also noted. The paper includes superb 

environmental scanning electron (ESEM) 

Schematic representation of the processes involved in lead transformation by fungi. Courtesy 

Geoffrey M. Gadd. 

Nutritional value of fungi in animal diets 

Humans along with many other animals, 

including a wide range of terrestrial 

mammals, eat fungi as components of 

their diets to various degrees. The actual 

nutritional value of fungi has, however, been 

unclear and much-debated. This is as while 

chemical analyses can give very positive 

indications, the extent to which they are 

digestible is unclear. In order to ascertain the 

extent of digestibility, Wallis et al. (2012) 

analyzed the fibre, amino acid composition, 

and both total and available nitrogen in a 

about 60 samples of sporocarps of diverse 

epigeous and hypogeous macrofungi from 

Australia and the USA; they then examined 

the digestibility in vitro. Amongst the 

genera of fungi studied, were species of 

Agaricus, Boletus, Cantharellus, Gauteria, 

Hysterangium, Morchella, Rhizopogon, and 

Tricholoma. The results showed that while 

in general the mushrooms and truffles tested 

A northern flying squirrel (Glaucomys sabrinus) 

holding a truffle in its paws, evidently devouring the 

white flesh. Photo Jim Grace. 

micrographs, and amazingly shows that the 

pyromorphite develops as minute spherules 

even inside the fungal hyphae. This finding 

is not only of interest in demonstrating 

a previously unknown biogenic step 

in the corrosion of lead metal and as a 

contribution to lead biogeochemistry, but 

could have applications. Soils can become 

lead-contaminated through, for example, 

the deposition of industrial wastes, battery 

casings, pipes, paints, inks, and shot, and 

lead has dangerous toxic effects on humans. 

The potential of using the tested strains, 

and other isolates of those and additional 

species of fungi, in the bioremediation of 

actual lead-contaminated soils clearly merits 

further exploration and assessment. 

Rhee YJ, Hillier S, Gadd GM (2012) Lead 

transformation to pyromorphite by fungi. 

Current Biology 22: 1–5. 

Secondary mineral formation on the surface of metallic lead resulting 

Rhee3.pdf 

from the activities of Metarhizium anisopliae. Photo courtesy Geoffrey 

Secondary M. Gadd. mineral formation on the surface of metallic lead resulting 

from the activities of the fungus Metarhizium anisopliae after incubation 

for 1 month. 

(32) ima funGuS

were a reasonable source of amino acids 

and digestible nitrogen, there were large 

differences between species, and the protein 

had a poor balance of digestible amino acids. 

The authors consider that this explains why 

mammals that are primarily mycophagous 

tend to eat a wide range of sporocarps, 

and in some cases have developed foregutfermentation 

to maximise the available 

nutritional value. In addition, they note that 

many mycophagous mammals supplement 

their diets with insects which are a source 

A novel application of lichens has just been 

developed by lichenologists at the Royal 

Botanic Garden Edinburgh. These are 

being used to reconstruct species’ regional 

distributions, and so indicate habitat types, 

for the historic period prior to the industrial 

revolution that started in the mid-18 th 

century. The rationale is that epiphytic lichens 

grow on the outer-bark surface of trees, and 

trees harvested and used as the frame for preindustrial 

buildings were not likely to have 

been transported far from where they were 

used. Consequently, where bark occurs on the 

timber structures of pre-industrial buildings, 

it might be possible to find preserved lichens 

which may suggest something of both past 

distributions and local ecologies. 

This proved to be the case, and Yahr et 

al. (2011) discovered 87 epiphytic lichen 

species in a survey of 78 buildings dating 

from the period 1300-1750 across southern 

England. The best-preserved material tended 

to be found in the roof-spaces of lowstatus 

homes with continuous occupancy, 

where conditions are not so dissimilar to 

those of many herbaria today. Many of the 

pre-industrial records are from outside 

the species’ current range, and estimates 


of high-quality protein. In Australia, 

the combination of mycophagy, foregut 

fermentation, and coevolution may explain 

the potororine marsupials which are obligate 

or preferential mycophagists. It is suggested 

that their use of hypogeous fungi enables 

them to survive the destructive effects of 

devastating fires as the hypogeous fungi tend 

to remain in the aftermath. The authors, 

perhaps tactfully, largely avoid the issue of 

the dietary value of fungal sporocarps in the 

human diet . . . . A single experience can 

Archaeolichenology: a novel use of lichens 

suggest an 80 % loss of epiphyte diversity 

from areas such as south-east England (Ellis 

et al. 2011). This study has demonstrated 

an intriguing new tool for environmental 

reconstruction, with the potential of reevaluating 

environmental and conservation 

base-lines. This is of particular interest as 

current knowledge from the literature and 

preserved specimens is necessarily biased 

towards the mid-18 th century onwards, a 

period where industrialization was already 

starting to become widespread in much of 

lowland Britain. 

Information related to changes over 

time can be accrued, but to ensure accuracy, 

it was necessary to consider the accurate 

dating of the timbers (based on styles of 

carpentry), possible timber re-use within 

buildings, and the local transport networks. 

The group plans to focus on increasing the 

resolution of the data, using data available 

from wattles, and also dendrochronology. 

The work is being undertaken in 

collaboration with archaeologists at 

University College London. 

Based on material kindly supplied by Christopher 

J. Ellis. 

hardly be taken as representative but, after 

repeatedly consuming meals with different 

mushrooms as the major component over 

several weeks about 15 years ago, I found I 

had shed quite a few pounds. 

Wallis IR, Claridge AW, Trappe JM (2012) 

Nitrogen content, amino acid composition 

and digestibility of fungi from a nutritional 

perspective in animal mycophagy. Fungal 

Biology 116: 590–602. 

Ellis CJ, Yahr R, Coppins BJ (2011) 

Archaeobotanical evidence for a massive 

loss of epiphyte species richness during 

industrialisation in southern England. 

Proceedings of the Royal Societyof London, 

Biological Science, B, 278: 3482–3489. 

Yahr R, Coppins BJ, Ellis CJ (2011) Preserved 

epiphytes as an archaeological resource in 

post-medieval vernacular buildings. Journal of 

Archaeological Science 38: 1191–1198. 

A specimen of a Physconia species preserved on 

the bark of a 400 year-old timber. Photo courtesy 

Christopher J. Ellis. 

REsEARcH NEWs (33)

OOk NEWs 

smut Fungi of the World. by kálmán Vánky. 2012. IsbN 978-0-89054-398-6. Pp. xvii 

+1458, figs 650, micrographs 2800. st Paul, mN: APs Press. Price Us$ 499.00. 

The doyen of smut fungi, Kálmán Vánky, 

building on a succession of substantial and 

well-illustrated regional monographs, has 

now brought together his immense knowledge 

accumulated over almost half a century 

into this major crowning world treatment. 

There has been no similar attempt to draw 

all the data on the world’s smut fungi into a 

single volume since that of Zundel (1953). 

However, unlike Zundel, whose work was 

largely a compilation of previously published 

descriptions, Vánky’s monograph is 

based almost entirely on his personal examination 

of material; his own herbarium is 

said to contain some 21 500 specimens and 

6 500 slide preparations. 

The number of species accepted in the 

main body of the work is 1650, and these 

are dispersed through 93 genera. The genera 

are pragmatically treated alphabetically, 

which greatly facilitates use of the work, 

but an outline classification placing these 

in higher taxa is provided at the start (pp. 

ix–x), although without a simplified phylogenetic 

tree. Each species entry has full 

bibliographic details of both accepted names 

and synonyms, along with information on 

the name-bearing types and a “!” indicating 

collections he studied. Detailed descriptions 

of symptoms, anatomy, and morphology are 

supplemented by line drawings of infected 

plants, and in almost all cases by light by 

photomicrographs and SEM micrographs of 

the spores – showing the details of surface 

ornamentation and sculpturing so critical in 

the identification of these fungi. Host plants 

are listed by family and genus, followed by a 

perhaps too brief note on distribution, surprisingly 

in most cases only indicating the 

continents in which a species is known or 

using words such as “cosmopolitan”. As the 

author surely has so much more information 

on rarity and distributions at his fingertips, 

it was unfortunate that the opportunity to 

cite the actual countries for all but the commonest 

species was passed by; elimination 

of the superfluous author citations after the 

names of the host plants (this is not a taxonomic 

work on plants!) could have helped 

the generate extra space required. The entries 

on both genera and species sometimes 

include comments, but in general these are 

terse notes on separations from other taxa, 

especially ones on the same or allied plants. 

Many species are evidently rare, or at 

least rarely collected, 25 % of those treated 

having been found only once. Further, 

Vánky estimates the true number of smut 

fungi on Earth as 4500, implying that only 

about one third have so far been recognized. 

That there are many new taxa to be discovered 

is substantiated by 37 additions made 

after the work was completed; these taxa 

are treated more briefly in an Addendum, 

which also includes one new combination 

– the only nomenclatural novelty in the 

whole work to catch my eye. I was pleased 

to see that there was a substantial section on 

doubtful, excluded or invalidly published 

smut taxa which included full explanations 

on the reasons for non-acceptance. There is 

also a most helpful alphabetical list of plant 

genera with the smuts known from them, 

and an epithet-based index to fungal names. 

There is a 44-page “Selected smut fungi 

literature”, but no glossary nor any introductory 

material describing either life-cycles or 

spore-germination types which would have 

been an asset for non-specialists. It will be 

necessary to use this in conjunction with his 

superbly presented earlier account of smut 

genera which includes extensive introductory 

material and illustrations of germinating 

spores and a glossary (Vánky 2002). For 

mycologists and plant pathologists not used 

to working with smut fungi, the information 

on methods of examination he used (cfr 

Vánky 1994: 8–9) could also have proved 

helpful. However, weighing in at 4.21 kg, 

topping The Genera of Hyphomycetes (Seifert 

et al. 2011) at a “mere” 3.3 kg, it is unlikely 

to be used far from a library where his complementary 

texts may also be kept to hand. 

Identifications are facilitated first by a 

key which takes each family alphabetically 

and has a key to the genera represented on it 

based on the characters of the fungi. Then, 

under each generic entry, there is a key to 

all known species of that genus, based on a 

combination of host plant names and morphological 

features of the fungi. While this 

may be pragmatic for the identification of 

known species, I would have also expected 

that to be complemented by a key to genera 

with no mention of the hosts, perhaps developed 

from that he previously published for 

European smuts (Vánky 1994) or his later 

world keys (Vánky 2002, 2008) with the 

host-based dichotomies in that also eliminated. 

If one of the expected 3000 or so yet 

undiscovered smuts is found, it will be difficult 

to place it in a genus in the absence of 

such a fungus-character-based key. 

That Vánky has been able to generate 

such an extraordinarily full monograph, 

published in his 82 nd year, is both a major 

service to mycologists and plant pathologists 

worldwide, and at the same time a tremendous 

and extraordinary personal achievement. 

This is especially so as he trained and 

practiced as a physician, developing an interest 

in smuts as an amateur in his home country 

of Romania, obtaining a PhD in Uppsala 

in 1985 (Vánky 1985) while still working as 

a physician, but then devoting himself fully 

to them on moving to Germany in 1986. 

This is a landmark publication, destined to 

be the major reference work on smut fungi 

for decades to come, and a must-have for all 

key mycological and plant pathological libraries 

– despite the unavoidably high price. 

Seifert KA, Morgan-Jones G, Gams W, Kendrick B 

(2011) The Genera of Hyphomycetes. Utrecht: 

CBS-KNAW Fungal Biodiversity Centre. 

Vánky K (1985) Carpathian Ustilaginales. Symbolae 

Botanicae Upsalienses 24 (2): 1–309. 

Vánky K (1994) European Smut Fungi. Stuttgart: 

Gustav Fischer Verlag. 

Vánky K (2002) Ilustrated Genera of Smut Fungi. 2nd edn. St Paul, MN: APS Press. 

Vánky K (2008) Taxonomic studies on Ustilaginomycetes 

– 28. Mycotaxon 106: 133–178. 

Zundel GL (1953) Ustilaginales of the World. 

[Contribution no. 176.] University Park, PA: 

Department of Botany, Pennsylvania State 

University. 

(34) ima funGuS

Atlas of soil Ascomycetes. by Josep guarro, Josepa gené, Alberto m. stchigel, and 

m. José Figueras. 2012. IsbN 978-90-70351-88-5. Pp. iv + 486, numerous figs. Utrecht: 

cbs-kNAW Fungal biodiversity centre. [cbs biodiversity series no. 10.]. Price: 70 €. 

The scarcity of authoritative well-illustrated 

and comprehensive texts poses a major 

problem for anyone wishing to identify 

fungi that are isolated from soil. Previous 

works dealing with soil fungi have 

either been selective and concentrated 

on the most commonly isolated species 

(Domsch et al. 2007), or regional in scope 

(Moubasher 1993, Subramanian & Wasser 

2001), or concerned those found by 

one group of workers (Watanabe 2010; 

see IMA Fungus 2: (33), 2011). This new 

work stands apart in worldwide scope and 

comprehensiveness, though it has to be 

remembered that it embraces only fungi 

in which ascomata are known and form 

in pure culture, and neither yeasts, nor 

truffles, nor ascomycetes only known as 

conidial fungi. However, where anamorphs 

are known in ascoma-forming species, these 

are embraced. In total, 146 genera and 698 

species are treated in detail, and helpfully, 

notes are added on other species known in 

the genera so far not known from soil. 

Following a key to the treated genera, 

the generic accounts are alphabetically arranged. 

Key bibliographic information 

is provided on both accepted names and 

synonyms, followed by descriptions of 

colonies and microscopic features, notes on 

the known distribution, and pertinent references 

to sources of further information. The 

authors are well-known for the high quality 

of their line-drawings, and the volume does 


not disappoint, but rather excels, in that 

regard. There are also numerous half-tones, 

often including scanning electron micrographs 

which are so helpful in visualizing 

the nature of ascospore ornamentation. The 

line-drawings including spores of different 

species of a genus are of especial value in 

making comparisons. 

The taxonomic treatment is generally 

up-to-date, but in some cases follows that 

adopted in previous papers by members 

of the group that are not all accepted by 

mycologists, such as the inclusion of Gelasinospora 

in Neurospora. It is also somewhat 

unfortunate that the changes in the nomenclature 

of pleomorphic fungi made in 2011 

were not accommodated. In consequence, 

ascoma-forming species of Aspergillus and 

Penicillium, for example, are treated under 

the names of the teleomorph-typified genera, 

such as Neosartorya and Eupenicillium, 

rather than the anamorph-typified generic 

names. 

The authors, all at the Universitat Rovira 

I Virgili in Reus, Spain, are to be congratulated 

on producing a work which will 

be of lasting value and also a major impetus 

to those struggling to identify ascomycetes 

not only from soil, but also from other substrates 

as well, such as decaying plant materials 

and dung. The realization of this work 

was facilitated by grants from the Ministerio 

de Educacion y Ciencia in Spain; a model 

not uncommon in Spain, but which is too 

rarely emulated elsewhere. All mycological 

centres should purchase a copy! 

Domsch KH, Gams W, Anderson T-H (2007) 

Compendium of Soil Fungi. 2nd edn. Eching: 

IHW Verlag. 

Moubasher AH (1993) Soil Fungi in Qatar and other 

Arab Countries. Doha: University of Qatar. 

Subramanian CV, Wasser SP (2001) Soil Microfungi 

of Israel. Ruggell: A. R.A. Gantner Verlag. 

Watanabe T (2010) Pictorial Atlas of Soil and Seed 

Fungi: morphologies of cultured fungi and key to 

species. Boca Raton: CRC Press. 

Taxonomic manual of the Erysiphales (Powdery mildews). by Uwe braun and Roger 

T. A. cook. 2012. IsbN 978-90-70351-89-2. Pp. vi + 707, figs 860 (7 col.). Utrecht: 

cbs-kNAW Fungal biodiversity centre. [cbs biodiversity series no. 11.] IsbN 978-90- 

70351-89-2. Price: 80 €. 

It is 25 years since Uwe Braun’s world monograph 

of Erysiphales appeared (Braun 1987). 

It was immediately sought after by mycologists 

ranging from plant pathologists to 

what are now termed citizen scientists. That 

work accepted 516 species, and clearly stimulated 

fresh interest in these fungi as this 

new book, prepared with plant pathologist 

Roger Cook, has 873 species, no less than 

55 of which are described as new to science 

here. The addition of 357 species represents 

an increase in the number of known species 

of the order of 69 %, indicating just how 

much remains unknown even within a relatively 

well-studied order of ascomycetes. I 

anticipate that the number will swell further 

now the field has this new very moderately 

priced monograph as a stimulus. 

The monograph starts with an overview 

of the powdery mildews and the characters 

used in their taxonomy and identification; 

all well-illustaretd by line-drawings or photographs, 

and embracing haustorium and 

conidium germination types. A most helpful 

table (pp. 31–32) summarizes the conidium 

germination types and ornamentation of the 

conidia as seen in scanning electron micrographs. 

Amongst other aspects covered are 

accounts of ascoma development, fungicolous 

fungi, and fossil representatives. 

bOOk NEWs (35)

OOk NEWs 

The phylogenetic systematics of the 

order is now much clearer than it was in 

the pre-molecular age in which the 1987 

monograph was produced. A series of papers 

giving an overview of the current systematics 

and evolution of these fungi was published 

separately in Mycoscience 52 (3) last year (see 

IMA Fungus 2: (60)–(61), 2011). 

Four tribes are now accepted within 

Erysiphales. Thirteen genera are recognized, 

which can be distinguished morphologically 

by the teleomorphs, but not always so readily 

by the anamorphs. A fourteenth “genus”, 

Microidium comb. stat. nov., is pragmatically 

used for three species only known from the 

anamorph which appear to form a distinct 

taxon, while 27 of uncertain affinity are left 

in “Oidium”. Keys to the genera and sections 

are presented based on teleomorph and 

anamorph features, with a separate key to 

species based on the host families. Within 

each genus or section account, however, I 

was pleased to see that the characters used 

in making separations in the couplets were 

almost exclusively of the fungi rather than 

the hosts. 

The species accounts are meticulously 

prepared, with full synonymies, information 

not only on types, but exsiccatae, illustrations, 

and literature reports; details not generally 

seen in many modern monographs. 

Comprehensive descriptions and informa- 

tion on host species and distribution are 

followed by often full and informative notes 

about the species, including doubtful or erroneous 

reports. Careful line drawings illustrate 

both teleomorph and anamorph where 

known. In such cases, the names of named 

anamorphs are presented with separately 

grouped synonyms under that of the teleomorph. 

The changes in the Code, effective 

from 30 July 2011, under which one fungus 

species can have only one correct name came 

too late to enable the new provisions to be 

accommodated in the nomenclatural presentations. 

Very few names, a mere 

2 %, need any change as a result, and Braun 

(2012) has helpfully provided details of 18 

cases where there is an earlier anamorphtypified 

name for inclusion in a future approved 

List of accepted names. In reality, 

the full slate of 873 accepted names could be 

included in such as List to stabilize the nomenclature 

of this order for posterity. 

The use of “Taxonomic” in the title 

should not put off the non-specialist, and 

might have been expanded to “Taxonomic 

and Identification” as there is so much information 

here that it can be utilized by the 

neoerysiphalean with little or no previous 

knowledge of these fungi. This work is the 

pinnacle in the careers of two exceptional 

and dedicated mycologists, and is destined 

to be of everlasting value. Individual my- 

cologists and plant pathologists, as well as 

institutions, are urged to secure a copy of 

this superb work while they can. 

Braun U (1987) A monograph of the Erysiphales 

(powdery mildews). Beihefte zur Nova Hedwigia 

89: 1–700. 

Braun U (2012) The impacts of the discontinuation 

of dual nomenclature of pleomorphic fungi: the 

trivial facts, problems, and strategies. IMA Fungus 

3: 81–86. 

conspectus of World Ethnomycology: fungi in ceremonies, crafts, diets, medicines, 

and myths. by Frank m. Dugan. 2011. IsbN 978-0-89054-395-5. Pp. viii + 151, figs 27 

(18 col.), tables 6, Appendices 2. st Paul, mN: APs Press (American Phytopathological 

society Press). Price Us$ 69.95. 

Frank Dugan has already addressed the role 

of fungi in ancient civilizations (Dugan 

2008), but now goes global. APS Press), but 

is much broader in scope and has a wealth of 

vignettes that have the potential to liven-up 

mycology classes. 

There is perhaps almost no end to what 

might be encompassed in such a title, especially 

as Dugan adopts a particularly broad 

definition of “ethnomycology”, as the study 

of the multifarious uses of fungi by humans 

since pre-historic times. The first chapter of 

the book provides a well-referenced global 

overview, while the second has an interesting 

take on the role of women, specially 

market women, as sources of information 

for herbalists since at least the sixteenth century 

– and accompanied by several pertinent 

early illustrations. The bulk of the volume, 

however, is organized by regional chapters: 

Europe and the Mediterranean; Asia and the 

Pacific; Sub-Saharan Africa; Latin America 

and the Caribbean; and North America. He 

aims to list the exploited fungi in each of 

these regions, which conclude with a table 

of those “commonly documented as ethnomycologically 

important”. This is an almost 

impossible task, and the author makes a 

laudable effort, but mycologists who have 

visited rural markets and traditional medicine 

shops in Africa and China in particular 

will note numerous species they encountered 

remain uncited. A final chapter looks 

at the nature of “folklore”, and touches on 

the issue of the exploitation and conservation 

of wild mushrooms. The literature cited 

covers over 25 pages, and this compilation 

is of considerable value in its own right as 

some sources are little-known, but again is 

inevitably incomplete, and I missed Findlay’s 

(1982) book in particular. The whole 

concludes with lists of utilized fungi available 

from selected fungal genetic resource 

collections, and some 20 recipes compiled 

(36) ima funGuS

from various sources around the world. 

Overall, I found the book, while necessarily 

eclectic, rather absorbing and with 

many often fascinating footnotes and asides, 

and I especially enjoyed some of illustrations. 

I am sure both professional and other 

mycologists would similarly enjoy it, but fear 


that the price might be seen as prohibitive – 

especially for a small-format slim paperback 

as compared to, for example, the Atlas of Soil 

Ascomycetes reviewed above in this column. 

Dugan FM (2008) Fungi of the Ancient World: how 

mushrooms, mildews, molds, and yeast shaped the 

early civilizations of Europe, the Mediterranean, 

and the Near East. St Paul, MN: APS Press. 

Findlay WP (1982) Fungi, Folklore, Fiction & Fact. 

Richmond, Surrey: Richmond Publishing. 

systematics and Evolution of Fungi. Edited by J. k. misra, J. P. Tewari, and s. k. Deshmukh. 

2012. IsbN 978-1-57808-723-5. Pp. xii + 412, illustr. (2 col. plates). Enfield, NH: 

science Publishers. Price: £ 76.99. 

This book, according to the Preface, is “intended 

to present the progress and shifts 

that have taken place towards the understanding 

of systematics and evolution of 

fungi in recent years”. Indeed, the impact of 

molecular phylogenetics on fungal systematics 

at all levels, from kingdom to population, 

can only be viewed as traumatic. The capturing 

of the excitement as new relationships 

emerge and long-cherished hypotheses fall 

was always going to be difficult one to capture 

in a single volume. The editors of this 

work approached this challenge by inviting 

13 papers concerned with different aspects 

and levels of fungal systematics today. Three 

of those papers are broad in scope, dealing 

with the integration of morphological and 

molecular data (Hawksworth), perspectives 

from the fossil record (Tripathi), and an 

overview of comparative methods (Nagy 

et al.). The remainder concern particular 

groups of fungi: Chytridiomycota (Powell & 

Letcher); Zygomycota (Benny, including a 

detailed synopsis down to and including all 

generic names proposed); Trichomycetes (Lichtwardt); 

Stachylina and Smittium (Misra); 

Morchella and Macrolepiota (Barseghyan 

et al.); mushroom-formers (Zmitrovich & 

Wasser); Phellinus and Inonotus (Tura et al.); 

toxigenic Fusarium species (Yli-Mattila); 

alternarioid hyphomycetes (Gannibal); and 

rapid diagnostic methods for candidiasis 

(Nagy et al.). These studies give a flavour of 

the current situation, rather than a comprehensive 

overview, which would have been a 

much larger task, but mycologists working 

on the selected topics will wish to access a 

copy. The title is also available in a kindle 

version. 

Fundamentals of mold growth in Indoor Environments and strategies for Healthy Living. 

Edited by Olaf c. g. Adan and Robert A. samson. 2011. IsbN 978-90-8686-135-4. 

Pp. 523, illustr. Wageningen: Wageningen Academic Publishers. Price 97.00 €. 

Indoor fungi continue to be a matter of 

considerable concern, to the extent that the 

World Health Organization (WHO) issued 

“Guidelines on Air Quality: dampness and 

mould” in 2009. There are already numerous 

publications on the matter, including several 

recent books, for example on identification 

(e.g. Samson et al. 2010) and sampling and 

analysis methods (e.g. Yang & Heinsohn 

2007). However, this new work, which is 

also available as an e-book, has a somewhat 

different aim, to describe the fundamentals 

of indoor mould growth as a perquisite to 

tackling the problem in buildings that exist 

and ones yet to be designed and built. 

In order to do this, it brings together 23 

specialists from diverse pertinent disciplines, 

including materials science, physics, 

and public health as well as mycologists. 

The result is a book which has three main 

threads that the editors consider set it apart: 

(1) the response of moulds to indoor climate 

dynamics; (2) the crucial role of materials 

in control strategies for indoor mould; and 

(3) the newest insights into adverse health 

effects. 

As many who consult the work will 

not have a mycological or microbiological 

background, it starts with five chapters 

which together present fundamental information 

on water relations, growth and humidity 

fluctuations, the fungal cell, ecology 

and general characteristics of indoor fungi, 

and the characteristics and identification 

of indoor wood-decaying basidiomycetes. 

This is followed by a section on health 

implications, including epidemiological 

studies, aerosolization of fungal fragments, 

bOOk NEWs (37)

OOk NEWs 

mycotoxins in building materials, and a detailed 

discussion of the WHO Guidelines 

mentioned above. Strategies for measuring 

moisture content, the fungal resistance of 

interior finishing materials, and for the 

detection of indoor fungal aerosols follow. 

Strategies for remediation discuss the situation 

from experience in North America 

and western European buildings, the protection 

of wood, and coating and surface 

treatments of wood. 

Of particular interest to practicioners is 

a series of recommendations prepared by the 

editors (pp. 491–498) and based on those of 

the Second International Workshop on Fun- 

gi in Indoor Environments” held in Utrecht 

in March 2005. In addition to aspects of 

inspection and detection, three “pillars” are 

recognized as important for building and 

construction: thermal performance, ventilation, 

and finishing materials. Five statements 

and recommendations on matters of policy 

conclude the chapter. 

Many of the contributions inevitably 

have a “western” focus, as that is the region 

where most research on indoor fungi has 

been conducted. Nevertheless, this welledited 

and thoughtfully constructed book, 

together with its recommendations merits 

wide dissemination in the public health sec- 

tors of all countries, including those of the 

tropics. Only in that way will the risks to 

human health posed by indoor fungi come 

to be more widely recognized and appropriate 

prophylactic actions taken. 

Samson RA, Houbraken J, Thrane U, Frisvad JC, 

Anderson B (2010) Food and Indoor Fungi. 

Utrecht: CBS-KNAW Fungal Biodiversity 

Centre. 

Yang CS, Heinsohn P (eds) (2007) Sampling and 

Analysis of Indoor Microorganisms. Hoboken, 

NJ: Wiley-Interscience. 

mycofactories. Edited by Ana Lúcia monteiro Durão Leitão. 2011. eIsbN 978-1-60805- 

223-3. Pp. v + 147, illustr. bentham e-books. Price: Us $ 59.00. 

The term “mycofactory” was new to me, 

and is used here in the sense of the use of 

fungi, and particularly fungal enzymes, in 

industrial processes, especially those conducted 

within a factory. This e-book focuses 

on recent developments, future trends, and 

realizable potentials in the exploitation of 

fungi as a main source for the production of 

enzymes and for the manufacturing of food 

“Microbiology” is used here in what is increasingly 

the usual sense of being almost 

synonymous with prokaryotology. Nevertheless, 

it does have some content of interest 

to mycologists. Thomas D. Brock poignantly 

notes in a Foreword (p. ix) that the term 

“extremophile” is essentially anthropocentric 

and that it could be more aptly defined 

taxonomically on the basis of environments 

derivatives, applications in bioremediation, 

and the production of pigments and other 

food additives. This is such an enormous 

field that a selection of topics had to be 

made, and seven are chosen. These concern: 

(1) Hydrolases, especially thermotolerant 

amylases in starch utilization for the baking, 

sugar, sweetener, textile, brewing and paper 

manufacturing industries; pectinases in fruit 

juice extraction and coffee and tea fermentation; 

and phytases in animal and fish feed. 

(2) Lignocellulose biodegradation, and 

applications of lignocellulolytic fungi or 

their enzymes in the biotransformation and 

biodegradation of wastes, and the conversion 

of biomass into useable products. (3) 

The emerging potential of the fungal secrotome 

in biomass degradation as revealed 

from genomic and proteomic analyses. (4) 

Multicopper oxidases, especially laccases and 

tyrosinases, and their potential applications 

in the oxidation of aromatic compounds. 

(5) The use of Penicillium species as ripening 

agents in cheese and meat products, 

including rarely compiled information on 

P. nalgiovense on the surface of certain meat 

Extremophiles: microbiology and biotechnology. Edited by Roberto Paul Anitori. 2012. 

IsbN 978-1-9904455-98-1. Pp. xii + 299. caister, Norfolk, Uk: caister Academic Publishing. 

Price Us$ 319.00, £ 159. 

where particular organisms can grow but 

others cannot. There is a helpful table (p. 4) 

with definitions of eight categories of extremophiles 

with commercial applications, 

ranging from hyperthermophiles (optimal 

growth > 70 o C) to piezophiles (growth at 

> 38 MPa). The 11 individual chapters are 

either reviews of a particular extremophile 

niche (e.g. acidophiles, deep sea environ- 

products. (6) Monascus pigments used in 

food colouring and flavouring, and further 

dietary supplements to ameliorate hyperlipidemia, 

hypercholesterolemia, and hypertension. 

And (7) the development of biofilters 

to purify or deodorize waste gases by passing 

them though fungal. 

I found this an exciting and stimulating 

book, with numerous fine colour diagrams 

explaining the processes, and with extensive 

reference lists for each chapter. In addition 

to clear and full explanations of current 

applications, it gives a topical overview of 

cutting-edge research and glimpses as to the 

potential fungi have to play an increasingly 

important role in industry – and at a time 

where it endeavours to develop novel strategies 

to meet current and emerging human 

needs and challenges. The editor, from the 

Universidade Nova de Lisboa in Portugal, 

is to be congratulated on marshalling her 

authors to prepare such a fine prospectus 

for, and glimpses of, future directions in 

industrial mycology. 

ments, ionizing radiation resistant, psychrophiles, 

or a particular exploited thermophile 

(e.g. a cold-loving archaeon). Fungi are 

almost entirely ignored except for a chapter 

by Helena Nevalainen and co-workers (pp. 

89–108) devoted to psychrophilic microfungi; 

this provides a valuable overview 

(though omitting to mention lichens) and 

also detailed information on a cold-active li- 

(38) ima funGuS


pase from an Antarctic strain of Penicillium 

expansum -- which has potential application 

in the degradation of crude oil and has been 

tested on a range of islands. Nevertheless, 

this book will be of some value to mycologists 

wishing to categorize extremophile 

fungi, or wishing to learn of possible novel 

commercial applications for particular enzymes. 

Unfortunately, the opportunity was 

missed to treat or critically review what is 

known of the numerous fungi of extreme 

environments alongside the archaea and 

bacteria; that would have enhanced its value 

to mycologists considerably. 

bOOk NEWs (39)

FORTHcOmINg mEETINgs 

International and regional meetings which are entirely mycological or have a major mycological component. 

2012 

2 nd Annual International symposium on mycology (Ism-2012) 

30 July–1 August 2012 

Guangzhou, China 

Contact: Maya Chen, East Area F11 Building 1, Dalian Ascendas IT Park, 1 Hui Xian Yuan, Dalian Hi-Tech Industrial Zone, LN 116025, 

China; maya@bitconferences.com 

 

New Era in Fungal Nomenclature. state key Laboratory for Lichenology and mycology (skLm) and mycological society of 

china (msc) 

8–10 August 2012 

Institute of Microbiology, Chinese Academy of Science, Beijing, China 

Contact: Lei Cai; mrcailei@gmail.com 

 

13 th International congress on yeasts (Icy): yeasts for a sustainable Future 

26–30 August 2012 

Monona Terrace Community and Convention Center Madison, WI, USA 

Contact: Thomas Jeffries, Forest Products Laboratory, One Gifford Pinchot Drive, Madison, WI 53705, USA; twjeffri@wisc.edu 

 

Fungal Interactions [british mycological society Annual meeting] 

3–6 September 2012 

Universidad de Alicante, Alicante University, Spain 

Contact: imem@ua.es 

 

2 nd Annual World congress on marine biotechnology (Wcmb-2012) 


World Expo Center, Dalian, China 

Contact: Doris Han, East Area F11 Building 1, Dalian Ascendas IT Park, 1 Hui Xian Yuan, Dalian Hi-Tech Industrial Zone, LN 116025, 

China; doris@bit-ibio.com 

 

Australasian mycological society conference 


Flecker Botanical Gardens Vistior Centre, Cairns, QLD, Australia 

Contact: Sandra Abell; sandra.abell@jcu.edu.au 

 

International mycological conference 2012 

[German Society of Mycology (DGfM) and the Mycology and Lichenology section of the German Botanical Society (GML)] 

1–3 October 2012 

Drübeck, Germany 

 

Integrated soil Fertility management in Africa: from microbes to markets. 

Tropical Soil Biology and Fertility Institute of CIAT (CIAT-TSBF) and the Faculty of Agriculture of the University of Nairobi 

22–28 October 2012 

Safari Park Hotel, Nairobi, Kenya 

Contact: Ken Dashiell; k.dashiell@cgiar.org 

 

2013 

One Fungus = Which gene(s)? 

10–11 April 2013 

(40) ima funGuS

Royal Dutch Academy of Arts and Sciences, Amsterdam, The Netherlands. 

Contact: Pedro Crous; p.crous@cbs.knaw.nl 

 

23 rd European congress of clinical microbiology and Infectious Diseases (EccmID) 

27–30 April 2013 

Berlin, Germany 

Contact: ECCMID 2013, c/o Congrex Switzerland Ltd, Peter Merian-Strasse 80, 4002 Basel, Switzerland; basel@congrex.com 

 

Asian mycological congress and 13th International marine and Freshwater mycology symposium 

14–19 August 2013 

Beijing International Convention Center, Beijing, China 

Contact: Na Jiang; AMC2013@163.com 

 

bio-security, Food safety and Plant Pathology: The Role of Plant Pathology in a globalized Economy 10 th International congress 

of Plant Pathology 

25–31 August 2013 

Beijing International Convention Center, Beijing, China 

and 

6 th Trends in medical mycology (TImm) 

11–14 October 2013 

Tivoli Hotel and Conference Center, Copenhagen, Denmark 

Contact: Congress Care, P.O. Box 440, 5201 AK ’s-Hertogenbosch, The Netherlands; info@congresscare.com 

 

2014 

IUms XIV International congress of mycology 

[with the Congresses of Bacteriology and Applied Microbiology, and also Virology] 

27 July–1 August 2014 

Montreal, Canada 

Contact: e-mail: iums3014@nrc-cnrc.gc.ca 

 

10 th International mycological congress (Imc10) 

3–8 August 2014 

Queen Sirikit National Convention Center, Bangkok, Thailand 

Contact: Lekha Manoch; agrlkm@ku.ac.th 

NOTIcE 

ImA Fungus is compiled by David L. Hawksworth (Facultad de Farmacia, Universidad complutense de madrid) on behalf of 

the Executive committee of the International mycological Association. All unsigned items in the journal are by, and may be 

attributed to, him. 

Items for consideration for inclusion in all sections of the journal should be submitted to him at d.hawksworth@nhm.ac.uk. 

books for possible coverage in the book News section should be mailed to: ImA Fungus, milford House, The mead, Ashtead, 

surrey kT21 2LZ, Uk. 


FORTHcOmINg mEETINgs (41)

ARTIcLE 

ima funGuS

doi:10.5598/imafungus.2012.03.01.01 

INtroductIoN 

Tibouchina granulosa (Melastomataceae), the Brazilian 

glorytree, is a fast growing tree native that occurs in the Atlantic 

Forest of Brazil. It is a common and important component of 

the native flora, particularly in secondary forests. It is also a 

highly prized ornamental, which is widely used in gardens 

and parks because of its spectacular violet or pink blossoms 

that each year appear prior and during Easter. The period 

of lent (quaresma, in Portuguese) is an important period 

in the catholic tradition, from which the Brazilian common 

name for this tree, “quaresmeira” is derived (Lorenzi 2002). 

Usually there is a high demand for young T. granulosa plants 

in the garden nursery market in Brazil, particularly for the 

variety that produces pink flowers. Nevertheless, diseases 

are known to be a limiting factor in nursery production of T. 

granulosa. However, very little is known about the diseases 

affecting this tree. The record of Chrysoporthe cubensis 

(syn.: Cryphonectria cubensis) on T. granulosa in Brazil by 

Seixas et al. (2004) is the sole record of a fungal pathogen on 

this host in the Brazilian database (http://pragawall.cenargen. 

embrapa.br/aiqweb/michtml/fichahp.asp?id=1912)–and 

there are only three records of fungi on this host in the USDA 

fungal database (Farr & Rossman 2010). This is somewhat 

surprising for such a common plant in the neotropics, and 

possibly reflects the limited existing knowledge about plant 

pathogenic fungi occurring on wild plants in this region. 

Here we clarify the identity of the fungus associated with 

a severe foliage blight (often evolving into a form of dieback) 

of quaresmeira. This is one of the most widespread 

© 2012 International Mycological Association 

You are free to share - to copy, distribute and transmit the work, under the following conditions: 

Attribution: You must attribute the work in the manner specified by the author or licensor (but not in any way that suggests that they endorse you or your use of the work). 

Non-commercial: You may not use this work for commercial purposes. 

No derivative works: You may not alter, transform, or build upon this work. 

For any reuse or distribution, you must make clear to others the license terms of this work, which can be found at http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode. Any of the above conditions can be waived if you get 

permission from the copyright holder. Nothing in this license impairs or restricts the author’s moral rights. 


and damaging diseases affecting T. granulosa in the field, in 

gardens, and also in nurseries. 

MAterIAl ANd Methods 

IMA FuNgus · voluMe 3 · No 1: 1–7 

Pilidiella tibouchinae sp. nov. associated with foliage blight of Tibouchina 

granulosa (quaresmeira) in Brazil 

Bruno E.C. Miranda 1 , Robert W. Barreto 1 , Pedro W. Crous 2 , and Johannes Z. Groenewald 2 

1Universidade Federal de Viçosa, Departamento de Fitopatologia, 36570-000, Viçosa, MG, Brazil; corresponding author e-mail: Robert W. 

Barreto, rbarreto@ufv.br 

2CBS-KNAW Fungal Biodiversity Centre, P.O. Box 85167, 3508 AD, Utrecht, The Netherlands 

Abstract: Tibouchina granulosa (Melastomataceae), Brazilian glorytree (Brazilian common name – 

quaresmeira), a common tree of the Atlantic Forest of Brazil, is widely used as an ornamental for its violet or 

pink blossoms. Little is known about fungal diseases affecting this species, although these represent a known 

limitation for its cultivation in nurseries. Among these there is a foliage blight that occurs in combination with 

distortion of branch apices and die-back. A consistent association of a species of Pilidiella with the diseased 

tissues was observed. The fungus was isolated in pure culture and based on its morphology and DNA phylogeny, 

we conclude that it represents a new species, for which the name Pilidiella tibouchinae is introduced. 

Article info: Submitted: 9 January 2012; Accepted: 29 February 2012; Published: 5 April 2012. 

Key words: 

Coniella 

Diaporthales 

ITS 

LSU 

Sordariomycetes 

systematics 

Isolates 

Samples of young abnormal branches of Tibouchina 

granulosa bearing diseased leaves were collected at two 

localities in Brazil (states of Rio de Janeiro and Minas 

Gerais), dried in a plant press and brought to the laboratory 

for further examination. Representative specimens of the 

fungus were deposited in the herbarium at the Universidade 

Federal de Viçosa (VIC). Pure cultures were obtained by 

transfer of conidia, using a sterile fine-pointed needle, from 

lesions onto plates containing VBA (vegetable broth-agar) as 

described in Pereira et al. (2003). Pure cultures are deposited 

in the fungal culture collection at the Universidade Federal 

de Viçosa and also at the CBS-KNAW Fungal Biodiversity 

Centre (CBS) in Utrecht, The Netherlands. Representative 

voucher specimens are deposited in VIC and at CBS. 

DNA isolation, amplification and analyses 

Genomic DNA was isolated from fungal mycelium grown 

on MEA, using the UltraCleanTM Microbial DNA Isolation 

Kit (MoBio Laboratories, Inc., Solana Beach, CA, USA) 

according to the manufacturer’s protocols. The primers 

V9G (de Hoog & Gerrits van den Ende 1998) and LR5 

(Vilgalys & Hester 1990) were used to amplify part of the 

nuclear rDNA operon spanning the 3’ end of the 18S rRNA 

ARTIcLE 

1

ARTIcLE 

2 

gene (SSU), the internal transcribed spacer 1, the 5.8S 

rRNA gene, the internal transcribed spacer 2 (ITS) and the 

first 900 bases at the 5’ end of the 28S rRNA gene (LSU). 

The primers ITS4 (White et al. 1990) and LSU1Fd (Crous 

et al. 2009a) were used as internal sequence primers to 

ensure good quality sequences over the entire length of the 

amplicon. The PCR conditions, sequence alignment, and 

subsequent phylogenetic analysis followed the methods of 

Crous et al. (2006, 2009b). Additionally, partial translation 

elongation factor 1-alpha (TEF) sequences were determined 

as described by Bensch et al. (2010). Sequences were 

compared with the sequences available in NCBI’s GenBank 

nucleotide (nr) database using a megablast search and 

alignments were constructed based on these results for ITS. 

For LSU, the novel sequence were added to an alignment 

modified from Lamprecht et al. 2011 (TreeBASE study 

S11805). Sequences derived in this study were lodged at 

GenBank, the alignment in TreeBASE (www.treebase.org/ 

treebase/index.html), and taxonomic novelties in MycoBank 

(www.MycoBank.org; Crous et al. 2004). 

Harknessia eucalypti AY720745 

98 

30 changes 

100 

85 

72 

90 

AY339313 

AY339320 

75 

AY339319 

AY339317 

AY339316 

100 

EU301037 

AY339338 

51 

Miranda et al. 

AY339343 

100 

94 

65 

HQ264189 

BECM2 

BECM1 

HQ166057 

AY339342 

GU062317 

AY339346 

AY339344 

DQ914688 

AY339348 

EU301051 

AY339324 

AY339323 

AY339333 

AY339334 

AY339332 

Morphology 

Slides containing fungal structures were mounted in 

lactophenol or lactofuchsin, with 30 measurements 

determined per structure. Sections were prepared with the 

help of a freezing microtome (Microm HM 520). Observations 

of fungal structures and measurements, as well as preparation 

of photographs, were performed with an Olympus BX 51 light 

microscope fitted with an Olympus E330 camera. Colony 

characters and pigment production were noted after 6 d of 

growth on 2 % malt extract agar (MEA) and potato carrot agar 

(PCA) (Crous et al. 2009c) plates incubated at 25 ºC. Colony 

colours (surface and reverse) were rated according to the 

colour charts of Rayner (1970). 

results 

Phylogeny 

Approximately 1700 bases, spanning the ITS and LSU 

regions, were obtained from the sequenced culture. 

Coniella australiensis 

Coniella fragariae 

Pilidiella eucalyptorum 

Pilidiella macrospora 

Pilidiella crousii 

Pilidiella tibouchinae 

Pilidiella granati 

Pilidiella sp. 

Pilidiella quercicola 

Schizoparme straminea 

Pilidiella diplodiella 

Pilidiella diplodiopsis 

Fig. 1. The first of 24 equally most parsimonious trees obtained from a heuristic search with 50 random taxon additions of the ITS sequence 

alignment (Tree length = 229, CI = 0.834, RI = 0.904, RC = 0.754). The scale bar shows 30 changes, and bootstrap support values from 1000 

replicates are shown at the nodes. Accession numbers of ex-type strains are shown in bold and the novel species in this study in red. Branches 

present in the strict consensus tree are thickened and the tree was rooted to a sequence of Harknessia eucalypti (GenBank accession no. 

AY720745). 

ima funGuS

The ITS region was used in the phylogenetic analysis to 

determine species-rank relationships (Fig. 1) and the LSU 

region for the generic placement (Fig. 2). The manually 

adjusted ITS alignment contained 25 taxa including the 

outgroup sequence and, of the 501 characters used in the 

phylogenetic analysis, 86 were parsimony-informative, 49 

were variable and parsimony-uninformative, and 366 were 


Pilidiella tibouchinae sp. nov. 

Magnaporthe grisea AB026819 

Gaeumannomyces graminis var. avenae AF362556 

100 Coniochaetidium savoryi AY346276 

Coniochaeta velutina EU999180 

Calosphaeria pulchella AY761075 

100 Togninia novae-zealandiae AY761081 

100 

Phaeoacremonium sphinctrophorum DQ173151 

100 Asterosporium asterospermum AB553745 

97 

Asterosporium asterospermum AB553741 

Mazzantia napelli AF408368 

88 

60 

88 

70 

Diaporthe perjuncta AF408356 

Diaporthe pustulata AF408358 

Diaporthe padi AF408354 

Diaporthe angelicae AY196781 

Phaeocytostroma ambiguum FR748102 

61 

60 Stenocarpella macrospora DQ377934 

Stenocarpella maydis DQ377936 

98 

Phaeocytostroma sacchari FR748105 

Diaporthe detrusa AF408349 

Phaeocytostroma plurivorum FR748104 

10 changes 

73 Phaeocytostroma megalosporum FR748103 

100 

Valsa ceratosperma AF408386 

Valsella adhaerens AF408388 

80 

78 Leucostoma niveum AF408367 

Greeneria uvicola AF362570 

Melanconiella spodiaea AF408370 

Endothiella gyrosa AF362555 

89 

Cryphonectria macrospora AF408340 

Cryphonectria nitschkei AF408341 

Ophiovalsa betulae AF408375 

Key to families: 

Ca: Calosphaeriaceae 

Cr: Cryphonectriaceae 

D: Diaporthaceae 

G: Gnomoniaceae 

M: Melanconidiaceae 

T: Togniniaceae 

V: Valsaceae 

63 

96 

100 58 

Phragmoporthe conformis AF408377 

Gnomonia setacea AF362563 

100 Melanconis stilbostoma AF408374 

Melanconis marginalis AF408373 

62 Melanconis alni AF362566 

Wuestneia molokaiensis AF408390 

93 

Harknessia eucalypti AF408363 

Harknessia gibbosa EF110615 

100 

Pilidiella eucalyptorum EU754150 

Coniella australiensis AF408336 

82 Coniella fragariae AF362553 

98 59 BECM2 Pilidiella tibouchinae 

BECM1 Pilidiella tibouchinae 

79 92 Schizoparme botrytidis AF408383 

Pilidiella macrospora AY339292 

Coniella musaiaensis AF408337 

Schizoparme straminea AY339296 

57 Pilidiella granati AF408379 

53 Pilidiella quercicola AY339293 

Pilidiella diplodiopsis AY339287 

Pilidiella diplodiella AY339286 

Pilidiella diplodiopsis AY339288 

57 

Pilidiella sp. AY339295 

Pilidiella castaneicola AF408378 

Fig. 2. The first of 180 equally most parsimonious trees obtained from a heuristic search with 100 random taxon additions of the LSU sequence 

alignment (Tree length = 594, CI = 0.515, RI = 0.817, RC = 0.421). The scale bar shows 10 changes, and bootstrap support values from 1000 

replicates are shown at the nodes. The novel species in this study is indicated in red and families are indicated to the right of the tree according 

to the key on the figure. Branches present in the strict consensus tree are thickened and the tree was rooted to sequences of Magnaporthe grisea 

and Gaeumannomyces graminis var. avenae (GenBank accession nos AB026819 and AF362556, respectively). 

Family 

Ca 

T 

constant. Twenty-four equally most parsimonious trees 

were retained from the heuristic search, the first of which 

is shown in Fig. 1. The phylogenetic tree of the ITS region 

(Fig. 1) shows that the obtained sequences cluster between 

Pilidiella crousii and Pilidiella granati. The manually 

adjusted LSU alignment contained 54 taxa including the 

two outgroup sequences and, of the 840 characters used in 

D 

V 

M1 

Cr 

G 

M2 

M3 

ARTIcLE 

3

ARTIcLE 

4 

the phylogenetic analysis, 190 were parsimony-informative, 

54 were variable and parsimony-uninformative, and 596 

were constant. From this heuristic search, 180 equally most 

parsimonious trees were retained, the first of which is shown 

in Fig. 2. Phylogenetic analysis of the LSU region (Fig. 1) 

confirms the placement of the novel sequences in Pilidiella. 

The partial TEF sequences did not have any high identity to 

those sequences available in GenBank (data not shown). 

Taxonomy 

A pycnidial coelomycete was regularly associated with 

diseased tissues on the samples collected at the two 

separate localities. Its morphology conformed to that of 

species in the genus Pilidiella (Nag Raj 1993, van Niekerk et 

al. 2004), although it appeared to represent a distinct taxon. 

Accordingly, a new species name is introduced below to 

accommodate the fungus occurring on T. granulosa. 

Pilidiella tibouchinae B.E.C. Miranda, R.W. Barreto & 

Crous, sp. nov. 

MycoBank MB563992 

(Fig. 3) 


Fig. 3. Pilidiella tibouchinae. A–d. Leaf spots and curling on Tibouchina granulosa. e. Colony on oatmeal agar. F, g. Vertical section through 

pycnidia. h, I. Conidiogenous cells. J, K. Conidia. Bars = 10 µm. 

Etymology: Named after the host genus on which it occurs, 

Tibouchina. 

Diagnosis: Similar to Pilidiella eucalyptorum but lacking 

conidial germ slits, and similar to P. petrakioidea but lacking 

mucoid appendages on conidia. 

Type: Brazil: Minas Gerais: Viçosa, campus of the 

Universidade Federal de Viçosa, on leaves of Tibouchina 

granulosa, 8 March 2010, B. C. Miranda (VIC 31443 – 

holotype; CBS H-20827 – isotype; cultures ex-holotype CPC 

18511, CPC 18512 = CBS 131595). 

(GenBank accession numbers for VIC 31443 and VIC 31444: 

ITS = JQ281774, JQ281775; LSU = JQ281776, JQ281777; 

TEF = JQ281778, JQ281779) 

Other specimen examined: Brazil: Minas Gerais: Viçosa, campus of 

the Universidade Federal de Viçosa, on leaves of T. granulosa, 17 

May 2010, B. C. Miranda (VIC 31444). 

ima funGuS

Description: Lesions on living leaves and young stems, firstly 

as adaxial straw-coloured necrotic spots, mostly appearing 

near the leaf veins, becoming yellowish to greyish with a dark 

brown to dark purple border, irregularly shaped, coalescing 

and leading to necrosis and distortion of large parts of 

the leaf lamina; loss of necrotic leaf parts usually creating 

the impression of insect damage. In conjunction to these 

symptoms, a shortening of branch internodes, leaf distortion, 

bud death, necrosis and die-back of young stems are also 

observed. Stunting and decline of severely affected plants 

are observed even for adult plants. Conidiomata pycnidial, 

adaxial, subcuticular, solitary, globose to depressed globose, 

42.5–75 × 75–112.5 μm, wall composed of dark greyish 

brown textura angularis of 1–3 cell layers, 7–12 μm thick, 

dark brown; dehiscence ostiolate, central; conidiophores 

formed on a dense, basal, cushion-like aggregation of 

hyaline cells, mostly reduced to conidiogenous cells, 

subcylindrical, branched below, 8–15 × 3–4 μm, smooth, 

hyaline, 1–2-septate. Conidiogenous cells enteroblastic, 

phialidic with apical periclinal thickening, 5–10 × 2–3 μm, 

smooth, hyaline, with minute collarette, and covered in 

mucilage. Conidia mostly broadly ellipsoidal, often somewhat 

flattened on one side, oblong, subreniform, ovoid to subovoid, 

10–13 × 6–8 μm (l:b = 1.7), apex rounded, subtruncate at 

base, hilum sometimes slightly protuberant, aseptate, hyaline 

when immature, becoming smoky-brown at maturity, smooth, 

guttulate (usually with one large guttule but sometimes 

biguttulate or eguttulate). 

Culture characteristics: (MEA or PCA either under a 12 h 

light regime or in the dark): Colonies fast-growing (up to 86 

mm diam after 6 d); flat, occasionally slightly raised centrally; 

mostly composed of immersed mycelium, aerial mycelium 

mostly sparse (but very dense cottony to woolly aerial 

mycelium on MEA in the dark); cottony to woolly to spider 

web-like white to grey olivaceous, sometimes with some small 

cinnamon areas centrally, occasionally becoming powdery 

towards the periphery, abundant olivaceous black fruit bodies 

crowded in zone rings on MEA/light. On PCA greyish black to 

greenish black centrally, with saffron margin in reverse; black 

fruit bodies less abundant, and in more distinct rings on PCA/ 

light. 

dIscussIoN 

The fungus on Tibouchina granulosa clearly belongs to 

the Coniella/Pilidiella-complex that has Schizoparme 

teleomorphs (Schizoparmaceae, Diaporthales; Rossman 

et al. 2007). Fungi in Schizoparmaceae include several 

species associated with foliar diseases, sometimes 

occurring as secondary invaders of plant tissues infected 

by other organisms or injured by other causes (Ferreira et 

al. 1997). There is no record of any teleomorphic species of 

Schizoparmaceae in association with members of the genus 

Tibouchina, and a single doubtful record of a Coniella on 

another member of the Melastomataceae, Miconia serrulata 



(Farr & Rossman 2010). Several members of Myrtales, 

which according to Bremer et al. (2003) includes up to 14 

families, are known hosts of Schizoparmaceae (Farr & 

Rossman 2010). For instance, several species are known 

from Myrtaceae (Acca, Blepharocalyx, Eucalyptus, Eugenia, 

Heteropyxis, Myrcia, Syzygium), Lythraceae (Lythrum, 

Punica), and Combretaceae (Anogeissus, Anogeissus, 

Terminalia) (van Niekerk et al. 2004, Farr & Rossman 2010) 

Sutton (1980) and Nag Raj (1993) treated Pilidiella as a 

synonym of Coniella. However, based on analyses of large 

subunit (LSU) nuclear ribosomal DNA (nrDNA) sequences, 

Castlebury et al. (2002) concluded that Pilidiella is distinct 

from Coniella. Pilidiella has two main morphological criteria 

separating it from Coniella: the presence of conidia that 

are hyaline when young becoming pale brown with age 

(consistently brown in Coniella) (Castlebury et al. 2002) and 

having a length to breadth ratio larger than 1.5 (equal to 

or smaller than 1.5 for Coniella) (van Niekerk et al. 2004). 

Pigmentation alone is difficult to interpret (Table 1), although 

P. tibouchinae has hyaline conidia that become smoky brown 

at maturity and a l:b ratio of 1.7. Additionally the results of 

the phylogenetic analysis place P. tibouchinae in the Pilidiella 

clade, distinct from Coniella (Figs 1–2). Considering the 

combination of morphological and molecular data, we prefer 

to place this fungus in the genus Pilidiella. Nevertheless, 

several species in the group still need to be re-examined, as 

is evident from Fig. 2, where Pilidiella eucalyptorum clusters 

in the Coniella clade, and C. musariensis clusters in the 

Pilidiella clade. 

Pycnidia in P. tibouchinae are small when compared 

to the species of Schizoparmaceae treated by Sutton 

(1980), Nag Raj (1993), and van Niekerk et al. (2004). 

Morphologically, conidia of P. tibouchinae show some 

similarity to that of P. eucalyptorum and P. petrakioidea. 

However, conidia of P. tibouchinae lack conidial germ slits 

(present in P. eucalyptorum) and mucoid appendages 

(present in P. petrakioidea). It also has thinner pycnidial walls 

(7–12 μm), than those in P. eucalyptorum (to 25 µm thick), 

and has hyaline to pale smoky-brown conidia, whereas 

those of P. eucalyptorum are medium to dark reddish brown. 

Furthermore, P. tibouchinae also differs from P. petrakioidea 

in conidial morphology (narrowly ellipsoidal with acutely 

rounded apices in P. petrakioidea) and a l:b ratio larger 

than 1.9. Five species of Coniella have been described in 

association with members of the Myrtaceae: C. australiensis, 

C. castaneicola, C. costae, C. fragariae, and C. minima. 

Considering the close morphological similarity of Pilidiella 

and Coniella, the conidial morphology of these species is 

also provided here for comparison with that of P. tibouchinae 

(Table 1). 

Pilidiella tibouchinae is the first species of the genus to be 

described on a host belonging to Melastomataceae, on which 

it appears to be associated with a rather serious foliar and 

dieback disease. Further investigations aimed at clarifying the 

pathological status of the fungus on Tibouchina granulosa, 

and evaluating potential disease control measures are now 

urgently required, and will be reported elsewhere. 

ARTIcLE 

5

ARTIcLE 

6 

table 1. Conidial morphology of selected Coniella and Pilidiella species recorded from members of Myrtales. 

species size l:b rate shape Appendage germ slit reference 

Coniella australiensis (9–)10–11(–14) × (6–)7–8(–10) μm 1.4 Broadly ellipsoidal + - van Niekerk et al. (2004) 

C. castanaeicola 13–29 × 2.5–3.5 μm 7.3 Fusoid to falcate + - Nag Raj (1993) 

C. costae 19–28 × 7–7.5 μm 3.2 Fusoid to ellipsoid - - Dianese et al. (1993) 

C. delicata 7–9 × 2.5–3 μm 2.9 Ellipsoid - - Sutton (1980) 

C. fragariae (8–)9–10(–12.5) × (5–)6–7(–8) μm 1.5 Ellipsoid + + van Niekerk et al. (2004) 

in older conidia 

C. macrospora (18.3–)25–29(–32.5) × (13–)16–20(–21.5) µm 1.5 Ovoid, ellipsoid, pyriform, globoid + - van der Aa (1983) 

C. minima 6.5–7.5 × 3.5–4.5 μm 1.5 Globoid to subgloboid - - Sutton (1969) 

C. terminaliae 2–8 × 2–3.5 µm 2:01 Globose to subglobose - - Firdousi et al. (1994) 

Pilidiella crousii (6–)7–12(–13.5) × (2.5–)3–5 μm 2.2 Narrowly ellipsoid to ellipsoid - - Rajeshkumar et al. (2011) 

P. diplodiella (10–)12–15(–19) × (4–)5–6 μm 2.3 Narrowly ellipsoid + - van Niekerk et al. (2004) 

P.eucalyptorum (9–)10–12(–14) × (6–)7–8 μm 1.6 Broadly ellipsoid or limoniform uncommon + van Niekerk et al. (2004) 

P. granati 9–16 × 3–4.5 μm 2.8 Ellipsoid + - Nag Raj (1993) 

P. jambolana 19–22 × 3.5–4 µm 5.7 Elongate-fusoid - - Ahmad (1967) 


P. petrakioidea 12–14.5 × 6.5–8 μm 1.9 Narrowly ellipsoid + - Nag Raj (1993) 

P. tibouchinae 10–13 × 6–8 μm 1.7 Broadly ellipsoid - - This publication 

AcKNowledgeMeNts 

We thank the technical staff of CBS, Arien van Iperen (cultures), 

Marjan Vermaas (photographic plates), and Mieke Starink-Willemse 

(DNA isolation, amplification and sequencing) for their invaluable 

assistance. 

reFereNces 

Aa HA van der (1983) A new species of Coniella. Proceedings of the 

Koninklijke Nederlandse Akademie van Wetenschappen, C 86: 

121–125. 

Ahmad S (1967) Contributions to the fungi of West Pakistan–VI. 

Biologica 13: 15–42. 

Bensch K, Groenewald JZ, Dijksterhuis J, Starink-Willemse M, 

Andersen B, Summerell BA, Shin H-D, Dugan FM, Schroers H-J, 

Braun U, Crous PW (2010) Species and ecological diversity within 

the Cladosporium cladosporioides complex (Davidiellaceae, 

Capnodiales). Studies in Mycology 67: 1–94. 

Bremer B, Bremer K, Chase MW, Reveal JL, Soltis DE, et al. (2003) 

An update of the angiosperm phylogeny group classification for 

the orders and families of flowering plants: APG II. Botanical 

Journal of the Linnean Society 141: 399–436. 

Crous PW, Gams W, Stalpers JA, Robert V, Stegehuis G (2004) 

MycoBank: an online initiative to launch mycology into the 21st 

century. Studies in Mycology 50: 19–22. 

Crous PW, Groenewald JZ, Risède J-M, Simoneau P, Hyde KD (2006) 

Calonectria species and their Cylindrocladium anamorphs: 

species with clavate vesicles. Studies in Mycology 55: 213–226. 

Crous PW, Groenewald JZ, Summerell BA, Wingfield BD, Wingfield 

MJ (2009b) Co-occurring species of Teratosphaeria on 

Eucalyptus. Persoonia 22: 38–48. 

Crous PW, Schoch CL, Hyde KD, Wood AR, Gueidan C, Hoog 

GS De, Groenewald JZ (2009a) Phylogenetic lineages in the 

Capnodiales. Studies in Mycology 64: 17–47. 

Crous PW, Verkley GJM, Groenewald JZ, Samson RA (eds) 

(2009c) Fungal Biodiversity. [CBS Laboratory Manual Series 1.] 

Centraalbureau voor Schimmelcultures, Utrecht. 

Castlebury LA, Rossman AY, Jaklitsch WJ, Vasilyeva LN (2002) A 

preliminary overview of the Diaporthales based on large subunit 

nuclear ribosomal DNA sequences. Mycologia 94: 1017–1031. 

Dianese JC, Medeiros RB, Santos LTP, Sutton BC (1993) Coniella 

costae sp. nov. on leaves of Myrcia tomentosa from Brazilian 

cerrado. Mycological Research 97: 1234–1236. 

FAO (1996) International Standard for Phytosanitary Measures. 

Rome: Secretariat of the International Plant Protection 

Convention. 

Farr DF, Rossman AY (2010) Fungal databases. Beltsville, MD: 

Systematic Mycology and Microbiology Laboratory, ARS, USDA; 

http://nt.ars-grin.gov/fungaldatabasews/. 

Ferreira FA, Alfenas AC, Coelho L (1997) Portas-de-entrada para 

Coniella fragariae em folhas de eucalipto. Revista Árvore 21: 

307–311. 

Firdousi SA, Sharma CD, Vyas KM (1994) A new species of Coniella 

from India. Acta Botanica Indica 22: 134–135. 

Hoog GS de, Gerrits van den Ende AHG (1998) Molecular diagnostics 

of clinical strains of filamentous basidiomycetes. Mycoses 41: 

183–189. 

Lamprecht SC, Crous PW, Groenewald JZ, Tewoldemedhin YT, 

ima funGuS

Marasas WFO (2011) Diaporthaceae associated with root and 

crown rot of maize. IMA Fungus 2: 13–24. 

Lorenzi H (2002) Árvores brasileiras: manual de identificação e 

cultivo de plantas arbóreas do Brasil. Vol. 1. 4a edição. Nova 

Odessa, SP: Instituto Plantarum. 

Nag Raj TR (1993) Coelomycetous Anamorphs with Appendagebearing 

Conidia. Waterloo: Mycologue Publications. 

Niekerk JM van, Groenewald JZ, Verkley GJM, Fourie PH, Wingfield 

MJ, Crous PW (2004) Systematic reappraisal of Coniella 

and Pilidiella, with specific reference to species occurring on 

Eucalyptus and Vitis in South Africa. Mycological Research 108: 

283–303. 

Rayner RW (1970) A Mycological Colour Chart. Kew: Commonwealth 

Mycological Institute. 

Rossman AY, Farr DF, Castlebury LA (2007) A review of the phylogeny 

and biology of the Diaporthales. Mycoscience 48: 135–144. 

Sutton BC (1969) Type studies of Coniella, Anthasthoopa, and 



Cyclodomella. Canadian Journal of Botany 47: 603–608. 

Sutton BC (1980) The Coelomycetes: fungi imperfecti with pycnidia, 

acervuli and stromata. Kew: Commonwealth Mycological 

Institute. 

USDA/Fungal Database. Available at http://nt.ars-grin.gov/ 

fungaldatabases/index.cfm. (accessed 20 March 2010). 

Vilgalys R, Hester M (1990) Rapid genetic identification and 

mapping of enzymatically amplified ribosomal DNA from several 

Cryptococcus species. Journal of Bacteriology 172: 4238–4246. 

White TJ, Bruns T, Lee J, Taylor J (1990) Amplification and direct 

sequencing of fungal ribosomal RNA genes for phylogenetics. 

In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds), PCR 

Protocols: a guide to methods and applications: 315–322. San 

Diego: Academic Press. 

ARTIcLE 

7

ARTIcLE 

ima funGuS

doi:10.5598/imafungus.2012.03.01.02 

Reappraisal and neotypification of Phyllachora feijoae 

Lilian C. Costa, Davi M. Macedo, and Robert W. Barreto 

Universidade Federal de Viçosa, Departamento de Fitopatologia, 36570-000, Viçosa, MG, Brazil; corresponding author e-mail: Davi M. Macedo, 

dmmesk@yahoo.com.br 

Abstract: Acca sellowiana (Myrtaceae), feijoa (in Brazil, goiaba da serra), is a native southern South America tree that 

produces edible fruits which, although only occasionally cultivated in South America, became a significant fruit crop 

in New Zealand. Recently, during surveys for fungal pathogens of feijoa in southern Brazil, several plants were found 

bearing tar-spot symptoms caused by a species of Phyllachora. A literature search enabled us to identify the fungus 

as Phyllachora feijoae, a little-known species originally described in the 19th century by H. Rehm and later transferred 

to the genus Catacauma. The name Catacauma feijoae, although now regarded as a later synonym of P. feijoae is 

still mistakenly in use (as, for instance, in the Brazilian list of fungi on plants). The type specimen was most probably 

deposited in the Botanisches Garten und Museum Berlin-Dahlem (B) and lost or destroyed during World War II, and 

could not be located. The recent recollection of abundant material of this fungus in the vicinity of Pelotas (Rio Grande 

do Sul, Brazil) allowed its re-examination and neotypification. Phyllachora feijoae is also illustrated here for the first 

time. 

Article info: Submitted: 6 November 2011; Accepted: 13 March 2012; Published: 5 April 2012. 

INtroductIoN 

The plant family Myrtaceae includes approximately 150 genera 

with over 5 500 species (Heywood et al. 2007), amongst which 

are some important forestry species (e.g. Eucalyptus spp.) 

and several fruit crops such as guava (Psidium guajava). 

Some, such as Acca sellowiana (common name feijoa; in 

Brazil, goiabeira da serra) are only minor fruit crops. Acca 

sellowiana is a shrub or small tree native to southern South 

America (southern Argentina, Brazil, Paraguay, and Uruguay) 

and, although only occasionally cultivated in South America, 

it has become more significant as a fruit crop in New Zealand 

(Al-Harthy 2010). There are few published records of fungal 

pathogens associated with feijoa (Farr & Rossman 2011, 

Mendes & Urben 2011). However, during a recent search for 

pathogens of feijoa in the southern Brazilian state of Rio Grande 

do Sul, individuals of A. sellowiana in rural areas in the vicinity 

of Pelotas had foliage with intense tar-spot symptoms. Such 

symptoms were typical of those caused by fungi belonging to 

the genus Phyllachora. Examination of specimens collected 

and a literature and herbarium search were performed in order 

to clarify the identity of the fungus on feijoa, and the results of 

these investigations are presented here. 

MAterIAl ANd Methods 

Samples of diseased foliage of Acca sellowiana were collected 

in two localities. These were dried in a plant press and taken 

to the laboratory for further examination. Representative 

specimens were deposited in the local herbarium (Herbarium 

Universidade Federal de Viçosa, VIC). Examination of 









selected leaves bearing tar-spot symptoms with the help of an 

Olympus SXZ7 stereoscopic microscope revealed that fungal 

structures were immersed in the leaf tissue and sections 

were prepared and mounted in lactophenol and lactofucsin 

for further examination. Additionally, sections were also 

prepared with a freezing microtome (Cryostat Microm ® HM 

520). Observations, photographs, and line drawings were 

prepared with a light microscope Olympus BX51, fitted with 

a digital camera (Olympus E-volt 330) and a drawing tube. 

tAxoNoMy 


Key words: 

Ascomycota 

Brazil 

fruit crop 

Myrtaceae 

Neotropics 

nomenclature 

Phyllachoraceae 

Phyllachora feijoae Rehm, Hedwigia 36: 370 (1897). 

Synonym: Catacauma feijoae (Rehm) Theiss & Syd., 

Ann. Mycol. 13: 397 (1915). 

(Fig. 1) 

Type: Brazil: Rio Grande do Sul: Pelotas, Chácara da 

Brigada, Cerro da Buena, on leaves of Acca sellowiana 

(Myrtaceae), 18 Aug. 2010, R. W. Barreto (VIC 31476 – 

neotype designated here; B 70 0015054 – isoneotype). 

Other specimen examined: Brazil: Rio Grande do Sul: Pelotas, 

Capão do Leão, on leaves of Acca sellowiana (Myrtaceae), 18 Aug. 

2010, R. W. Barreto (VIC 31766). 

Lesions on living leaves, adaxially on all leaves at various 

developmental stages, initially punctiform, becoming irregular 

tar-spots, raised, with age surrounded by yellowish to reddish 

peripheral necrotic haloes, widely distributed and leading 

to foliage distortions, 0.2–0.3 × 2.1–3.0 mm diam, indistinct 

ARTIcLE 

9

ARTIcLE 

costa, Macedo & Barreto 

Fig. 1. Phyllachora feijoae (VIC 31766). A. Tar-spots on leaves of Acca sellowiana. B. Perithecium and clypeus. c. Ascospores. d. Paraphyses 

and asci with ascospores. e. Ascomata (left) and conidioma (right) and close up part of the conidioma. F–g. Conidiogenous cell and conidia. 

Bars: B = 80 µm, C = 20 µm, D = 20 µm, E = 275 µm, F–G = 10 µm. 

10 ima funGuS

abaxially. Internal mycelium intra- and intercellular, hyphae 

2.0–3.0 μm diam, branched, septate, hyaline to pale brown. 

External mycelium absent. Stromata adaxial, clypeate, shieldlike, 

merged with the upper wall of the ascoma. Conidia formed 

within stromata externally indistinguishable from teleomorph 

stomata; flattened, lenticular to irregular (in section), epigenous, 

subepidermal, single or in combination with ascomata, 

sometimes very broad occupying nearly the whole breadth of 

the stroma, 615–1729 x 100–184 µm walls of dark brown textura 

angularis, 38.5–69 µm thick, smooth; conidiogenous cells 

subcylindrical, straight, 15–25(–40) x 2–3 µm, 0–1-septate, pale 

brown; conidia mucilaginous, enteroblastic, acicular, curved, 

lunate or sigmoid, 13–19 x 1.5 µm, aseptate, thin-walled, hyaline, 

smooth. Ascomata perithecial, epigenous, immersed, solitary, 

spherical to subsphaerical, somewhat to strongly depressed, 

short papillate, 41–218 μm diam, inconspicuously ostiolate, 

composed of thin-walled brown textura angularis, walls 6.5–44 

µm, 7–11 cells thick, outer layers dark brown, inner layers pale 

brown to subhyaline. Interascal tissue of paraphyses, 2.5–3 

μm diam, longer than the asci, filiform, septate, hyaline, thinwalled, 

constricted at the septae; periphyses well-developed, 

filiform, hyaline, thin-walled. Asci unitunicate, cylindrical to 

clavate, short-stalked, 70.5–104 x 13–27 μm, apex broadly 

rounded to nearly flat, thin-walled, 8-spored. Ascospores at first 

uniseriate but sometimes partially biseriate, 15.5–22 x 8–14 µm, 

ellipsoidal to cylindric-ellipsoidal, rounded at the ends, walls 2–3 

μm thick, aseptate, hyaline, smooth, without a mucous sheath 

or appendages. 

Notes: Very little information is available on Phyllachora 

feijoae. Only a very brief description is given in the original 

publication of Rehm (1897). Later, Theissen & Sydow (1915) 

prepared a more complete description of the fungus when 

combining it into Catacauma. This is, nevertheless, somewhat 

incomplete and no illustrations were provided. Furthermore, 

the description was apparently based on Rehm’s material 

collected in “Serra Geral, Minas Gerais – Brazil”. The last 

publication dealing with this fungus was that of Jimenez & 

Hanlin (1992), where names of fungi described in Catacauma 

were listed. Although the authors acknowledged that after 

Petrak’s (1924) work it became widely accepted that the 

distinction of Catacauma from Phyllachora was artificial, they 

prudently did not propose that names in Catacauma should be 

immediately rejected or recombined into Phyllachora without 

a careful re-examination of types. Since that publication, 

mycologists have shown little interest in the names of fungi 

referred to Catacauma, but some earlier fungal names in 

Phyllachora have been reinstated. That is the case of the 

name C. feijoae, presently listed in MycoBank and Index 

Fungorum as a later synonym of P. feijoae. Nevertheless, this 

name is still being used in other instances (e.g. the Brazilian 

list of fungi on plants; Mendes & Urben 2011). 

An expanded description based on the material recently 

collected in Brazil is provided above. This is also the first 

time illustrations of P. feijoae have been published. The 

original material of the species studied by Rehm would 

almost certainly have been deposited in the collections of the 

Botanisches Garten und Museum Berlin-Dahlem (B), but if so 

it appears to have been lost or destroyed during World War II 

as it could not now be found (H.J.M. Sipman, pers. comm.). 



We therefore designate one of the recent collections as a 

neotype to fix the application of the name. 

dIscussIoN 

The fungus on Acca sellowiana exhibits all the typical 

features, both in terms of symptoms produced on the host 

and in its morphology, to members of the genus Phyllachora 

(Phyllachoraceae, Phyllachorales). Phyllachora is a large 

genus including approx. 1000 named species (Kirk et 

al. 2008). All species of Phyllachora are biotrophic plant 

pathogens, causing tar-spots on members of numerous plant 

families, but are particularly common on Fabaceae (Cannon 

1991) and Poaceae (Parbery 1971). Besides the presence of 

a well-developed, dark brown to black clypeus, other features 

such as the formation of the perithecia within the plant tissues, 

and hyaline, thin-walled, smooth and aseptate ascospores, 

are typical for the genus (Cannon 1991). Around 70 species of 

Phyllachora have been described on members of Myrtaceae 

worldwide (Farr & Rossman 2011), with 21 species recorded 

on this host-family in Brazil (Mendes & Urben 2011). Species 

of Phyllachora associated with Myrtaceae have never been 

monographed. 

Some of the older records of Phyllachora on Myrtaceae 

were later recognized as mistakenly placed in that genus. 

Some were found to belong to other genera, - such as P. 

pululahuensis (now regarded as a synonym of Vestegrenia 

multipunctata; von Arx & Müller 1954), and P. eucalypti (now 

recognized as a synonym of Clypeophysalospora latitans; 

Crous et al. 1990). Other species were recombined into 

genera such as P. peribebuyensis which is now treated as 

Coccodiella peribebuyensis (Katumoto 1968). Several names 

in Phyllachora that are listed on members of Myrtaceae 

were found to be later synonyms of already known species 

names: P. conspurcata (syn. P. tropicalis; Saccardo 1883), 

P. phylloplaca (syn. P ipirangae; Theissen & Sydow 1915b), 

P. pseudostromatica (syn. P. melaleuca; Sydow & Sydow 

1904), and P. semillunata (syn. P. selenospora; Petrak & 

Ciferri 1930). Additionally, P. langdonii is now treated as 

a subspecies of P. callistemonis, P. callistemonis subsp. 

langdonii (Pearce & Hyde 1994). 

In the case of species of Phyllachora recorded from Brazil, 

an issue to be taken into consideration is that numerous 

species names are included in Mendes et al. (1998), and have 

also been kept in the database of fungi on plants in Brazil 

(Mendes & Urben 2011) but quoted as being “in press”. These 

names, for which Medeiros & Dianese are given as authors, 

have never been validly published and include the following 

species designations associated with members of Myrtaceae: 

P. eugenii-complicatae, P. eugenii-punctifolie, P. myrciaedecrescentis, 

P. myrciae-guianensis, P. myrciae-multiflorae, 

P. myrciae-multiflorae, P. myrciae-pallescentis, P. myrciaetematae, 

P. myrciae-tortae, and P. pampulhae. Although all 

these designations are not validly published, most may well 

represent good taxonomic species which are still awaiting 

formal description. Most were collected in the Brazilian cerrado, 

an area rich in endemic organisms of all kinds. 

A study of the 48 published descriptions of taxa (including 

three varieties) of Phyllachora described from hosts belonging 

ARTIcLE 11

ARTIcLE 


table 1. Data on Phyllachora spp. described on hosts belonging to Myrtaceae. 

species Asci (µm) Ascospores (µm) host plants references 

P. ambígua 50–60 x 8–12 9–11 x 6 Syzygium cumini (syn. Eugenia 

jambolana) 

Theissen & Sydow (1915b) 

P. angustispora 80–90 x 12–14 30 x 8–9 Eugenia sp. Saccardo (1916) 

P. bella 60–70 x 5–7 7.5–9 x 3–4 Syzygium australe (syn. E. australis) Sydow (1937) 

P. biareolata 90–95 x 6–9 12 x 5 Eugenia rhombea Saccardo (1891) 

P. biguttulata 50–65 x 8–10 10–12 x 5–5.5 Campomanesia rhombea Saccardo (1913) 

P. brenesii 70–80 x 10–15 12–17 x 8–10 Eugenia guayaquilensis Sydow & Petrak (1929) 

P. callistemonis 115–210 x 12.5–16 18–27.5 x 7.5–10 Callistemon pallidus Pearce & Hyde (1994) 

P. callistemonis subsp. Langdonii 100–154 x 12–20 18–25 x 6–9 Callistemon sp. Pearce & Hyde (1994) 

P. callistemonis subsp. Similis 117–173 x 18–27.5 18–29 x 7.5–12.5 Callistemon viminalis Pearce & Hyde (1994) 

P. capensis 100–120 x 13–14 60–70 x 5–6 Eugenia zuluensis Doidge (1942) 

P. cayennensis 68–75 x 12–14 20–24 x 7–8 Psidium sp. Theissen & Sydow (1915b) 

P. clavata 110–140 x 15–18 39–45 x 3–6 Myrcia sp. Garces Orejuela (1944) 

P. curvulispora 60–80 x 10–20 17–20 x 5–7 Myrtaceae sp. Saccardo (1925–1928) 

P. distinguenda 60–70 x 18 18–20 x 4.5 Myrtaceae sp. Saccardo (1899) 

P. egenula 70–85 x 7–8 10–13 x 5-6 Leptospermum lanigerum Sydow (1938) 

P. emarginata 80–130 x 18–28 16–20 x 10–12 Eugenia sp. Petrak (1948) 

P. eugeniae 60–75 x 7–9 8–10 x 4–4.5 Eugenia rhombea Chardón (1927) 

P. feijoae 60 x 25 18 x 10 Acca sellowiana Rehm (1915) 

P. gentilis 120 x 4–12 18–20 x 8–9 Eugenia sp. Saccardo (1895) 

P. goyazensis 70–90 x 17–18 12–14 x 8–12 Myrtaceae sp. Hennings (1895) 

P. guavira 100–110 x 6–8 12 x 5 Psidium sp. Theissen & Sydow (1915b) 

P. ipirangae 30–90 x 10–12 15–16 x 8 Eugenia sp. Theissen & Sydow (1915b) 

P. lindmanii 80–90 x 13–16 16–24 x 13–16 Myrtaceae sp. Theissen & Sydow (1915a) 

P. maculata * 22–25 Eucalyptus sp. Cooke (1891) 

P. manuka 10.5–13 × 6.5–8 Leptospermum scoparium Johnston & Cannon (2004) 

P. melaleucae 66–84 x 8–11 Melaleuca spinosa Theissen & Sydow (1915a) 

P. myrciae * Eugenia bimarginata Saccardo (1883) 

P. myrciae-rostratae 100–120 x 6–8 14–17 x 5–6 Myrcia splendens (syn. M. rostrata) Viégas (1944) 

P. muelleri 95–120 x 13–15 28–32 x 6–7 Eugenia dodonaeifolia Chardón et al. (1940) 

P. myrrhinii 50–72 x 12–16 14–16 x 5 Myrrhinium atropurpureum var. 

octandrum 

P. nigerrimum 100–130 x 9 10–16 x 5 Campomanesea adamantium (syn. 

C. caerulea) 

Theissen & Sydow (1915a) 

Viégas (1944) 

P. opaca 80–85 x 6–8 10 x 4–4.5 Myrtaceae sp. Berlese & Voglino (1886) 

P. peglerae 120–140 x 17–20 20–23 x 12–13 Eugenia capensis Doidge (1942) 

P. pettimenginii 85–105 x 14–18 2–8-32 x 8.5–11 Myrtaceae sp. Maire (1908) 

P. rhytismoides 14–19.5 × 12–15.5 Melaleuca cajuputi Cannon (1991) 

P. rickiana 68–78 x 14–15 10–13 x 6 Myrtaceae sp. Theissen (1918) 

P. rimulosa 85–100 x 10 14 x 8 Eugenia sp. Saccardo (1925–1928) 

P. samanensis 70–83 x 13–16.5 32–40 x 6–7.5 Eugenia sp. Petrak & Ciferri (1932) 

P. shivasii 136–225 x 10–15 15–22 x 6–8.5 Melaleuca viridiflora Pearce & Hyde (1995) 

P. subcircinans 80–90 x 10–16 14–16 x 8–10 Psidium grandifolium Viégas (1944) 

P. subopaca 75 x 10–15 12–14 x 7 Myrtaceae sp. Saccardo (1899) 

P. tachirensis 109–166 x 9.5–12 13–17 x 7–8 Eugenia sp. Chardón & Toro (1934) 

P. tropicalis 70–75 x 10–14 15–18 x 7–8 Psidium grandifolium Saccardo (1883) 

P. truncatispora 70–90 x 16–24 22–26 x 7–8 Myrtaceae sp. Viégas (1944) 

P. urbaniana 70–90 x 16–18 14–15 x 6–8 Myrtaceae sp. Saccardo (1899) 

P. verrucosa 78–105 x 15–19 14–20 x 9–13 Melaleuca leucadendra Arx & Müller (1954) 

12 ima funGuS

table 1. (Continued). 



species Asci (µm) Ascospores (µm) host plants references 

P. whetzelii 87–109 x 8–10.5 11.5–13 x 3–4 Eugenia sp. Chardón (1921) 

P. woodiana 80–100 x 6–7.5 12.5–15.0 x 5–6 Eugenia capensis Doidge (1942) 

to Myrtaceae, is summarized in Table 1. This shows that there 

are three species of Phyllachora with close morphological 

similarity to P. feijoae on A. sellowiana: P. brenesii, P. emarginata, 

and P. subcircinans. Each of those species was found to 

have morphological differences from P. feijoae. Phyllachora. 

brenesii has perithecia with narrower walls (5 µm thick), and 

asci which are also narrower (10–15 µm wide). Phyllachora 

emarginata has thinner ascospore walls (2 µm). And P. 

subcircinans has much wider perithecia (250–500 µm diam). 

Additionally, P. feijoae can be recognized as distinct from the 

other species known on Myrtaceae (Table 1) by a combination 

of morphometric features; differences in perithecial diameter, 

ascus width, and the absence of a mucilaginous sheath on 

the ascospores. Although no comparison of the morphology of 

P. feijoae with other species on Myrtaceae was attempted in 

previous publications, our results indicate that this species is 

distinct from other Phyllachora species on this host-family, and 

so deserves recognition as a separate species. No significant 

discrepancies were found between the morphology of the 

neotype and the description provided in Theissen & Sydow 

(1915). 


We acknowledge financial support from the Fundação de Amparo a 

Pesquisa de Minas Gerais (FAPEMIG) and Conselho Nacional de 

Desenvolvimento Científico e Tecnológico (CNPq) and also would 

like to thank Harrie J. M. Sipman for providing information on material 

now held in the herbarium Botanisches Garten und Museum Berlin- 

Dahlem. 

reFereNces 

Al-Harthy AS (2010) Postharvest treatments to stend storage life of 

feijoa (Acca sellowiana). PhD thesis, Massey University, New 

Zealand. 

Arx JA von, Müller E (1954) Die Gattungen der amerosporen 

Pyrenomuceten. Beitrage zur Kryptogamenflora der Schweiz 

11(1): 1–434. 

Berlese AN, Voglino P (1886) Sylloge Fungorum. Additamenta ad 

Volumina I-IV. Patavia: P. A. Saccardo. 

Cannon PF (1991) A revision of Phyllachora and some similar 

genera on the host family Leguminosae. Mycological Paper 

163: 1–302. 

Chardón CE (1921) A contribution to our knowledge of the 

pyrenomycetes of Porto Rico. Mycologia 13: 279–300. 

Chardón CE Toro RA (1934) Mycological Explorations of Venezuela. 

Monographs of the University of Puerto Rico. Physical and 

Biological Sciences 2: 1–353. 

Chardón CE, Miller JH, Muller AS (1940) Ascomycetes from the 

State of Minas Gerais (Brazil). Mycologia 32: 172–204. 

Cooke MC (1891) Australian fungi. Grevillea 20: 4–7. 

Crous PW, Wingfield MJ, Koch SH (1990) New and interesting 

records of South African fungi. X. New records of Eucalyptus leaf 

fungi. South African Journal of Botany 56: 583–586. 

Cooke MC (1891) Australian fungi. Grevillea 20: 4–7. 

Doidge EM (1942) Revised descriptions of South African species of 

Phyllachora and related genera. Bothalia 4: 421–463. 

Farr DF, Rossman AY (2011) Fungal Databases. Beltsville, MD: 

Systematic Mycology and Microbiology Laboratory, ARS, USDA; 

http://nt.ars-grin.gov/fungaldatabases/ 

Garces Orejuela CG (1944) New or heretofore unreported species 

of the higher ascomycetes from Colombia and Venezuela. 

Mycologia 36: 429–459. 

Hennings P (1895) Fungi Goyazensis. Hedwigia 34: 88–112. 

Heywood VH, Brummitt RK, Culham A, Seberg O (2007) Flowering 

Plant Families of the World. Revd edn. Richmond Hill, ON: Firefly 

Books. 

Jimenez B, Hanlin RT (1992) A list of species names assigned to the 

genus Catacauma. Mycotaxon 49: 219–233. 

Johnston PR, Cannon PF (2004) New Phyllachora species from 

Myrsine and Rostkovia from New Zealand. New Zealand Journal 

of Botany 42: 921–933. 

Katumoto K (1968) On the genus Coccodiella Hara. Journal of 

Japanese Botany 43: 277–283. 

Kirk PM, Cannon PF, Minter JA, Stalpers JA (2008) Ainsworth & 

Bisby’s Dictionary of the Fungi. 10th edn. Wallingford: CAB 

International. 

Maire R (1908) Champignons de São Paulo. Annales Micologici 6: 

144–153. 

Mendes MAS, Silva, VL, Dianese, JC, Ferreira MASV, Santos CEN, 

Neto EG, Urben, AF, Castro C (1998) Fungos em plantas no 

Brasil. Embrapa/Cenargem. Brasilia. 

Mendes MAS, Urben AF (2011) Fungos relatados em plantas no 

Brasil. Brasilia: Laboratório de Quarentena Vegetal, Embrapa 

Recursos Genéticos e Biotecnologia; http://pragawall.cenargen. 

embrapa.br/aiqweb/michtml/fgbanco01.asp 

Parbery DG (1971) Studies on graminicolous species of Phyllachora 

Nke. in Fckl. Australian Journal of Botany 19: 207–235. 

Pearce CA, Hyde KD (1994) The genus Phyllachora from Australia: 

observations on taxa from Callistemon species. Mycological 

Research 98: 1393–1401. 

Pearce CA, Hyde KV (1995) Phyllachora from Australia. Observations 

on P. pseudostromatica, P. melaleucae and new species. 

Mycological Research 99: 1253–1260. 

Petrak F (1924) Mykologische notizen No. 301. Über die 

phylogeneteischen beziehungen der gattung Phyllachora und 

ihre bedeutung für das System der dothidealean Pilze. Annales 

Mycologici 22: 1–10. 

Petrak F (1948) Pilze aus Ekuador. Sydowia 2: 317–386. 

Petrak F, Ciferri R (1930) Fungi Dominicani. Annales Mycoligici 28: 

377–420. 

Petrak F, Ciferri R (1932) Fungi Dominicani II. Annales Mycologici 

30: 149–356. 

ARTIcLE 13

ARTIcLE 

14 

Rehm H (1897) Beiträge zur Pilzflora von Südamerika III. 

Dothideaceae Gesammelt von Herrn E. Ule in Brasilien. Hedwgia 

36: 366–380. 

Saccardo PA (1883) Sylloge fungorum ominium hucusque 

cognitorum. Vol 2. Padova: P. A. Saccardo. 









Saccardo PA (1916) Sylloge fungorum – Ominium hucusque 



Sydow H (1937) Neue oder bemerkenswerte Australische 

Micromyceten – I. Annales Micologici 35: 22–49. 

Sydow H (1938) Neue oder bemerkenswerte Australische 

Micromyceten - III. Annales Mycologici 36: 295–313. 

Sydow H, Petrak F (1929) Fungi Costaricenses a cl. Prof. Alberto M. 

Brenes collecti. Annales Mycologici 27: 1–86. 

Sydow H, Sydow P (1904) Novae fungorum species. Annales 

Micologici 2: 162–174. 

Theissen F, Sydow H (1915) Die Dothideales. Annales Mycologici 

13: 149–746. 

Theissen F (1918) Mycologische Mitteilungen. Annales Mycologici 

16: 175–188. 

Viégas AP (1944) Alguns fungos do Brasil II - Ascomicetos. Bragantia 

4: 5–391. 

ima funGuS

doi:10.5598/imafungus.2012.03.01.03 

INtroductIoN 

On 30 July 2011, the long-established practice of allowing 

separate names to be used for different morphs of the 

same fungus, dual nomenclature, was ended. On that day, 

the XVIII th International Botanical Congress, meeting in 

Melbourne, Australia, adopted a resolution accepting the 

decisions of the Nomenclature Section of the Congress that 

had been reached on 18–22 July 2011 (McNeill et al. 2011). 

Decisions became immediately effective from the date the 

resolution was adopted, unless a date on which particular 

provisions become effective was included in the decisions 

of the Nomenclature Section. These are the effective dates, 

and not the date of publication of the International Code of 

Nomenclature for algae, fungi, and plants (ICN); the final 

edited version of the new Code is expected in mid-2012 

(McNeill et al. 2012a). Summaries of the changes relevant 

to mycologists have, however, been provided elsewhere 

(Hawksworth 2011, Lendemer 2011, Norvell 2011). 

The issue of permitting dual nomenclature for nonlichenized 

ascomycete and basidiomycete fungi has been 

a source of continuing controversy, especially since the 

1950s. As a consequence, changes in the system have been 

made at several of the subsequent International Botanical 

Congresses, the most dramatic being at the Sydney 

Congress in 1981. However, it was in the early 1990s, when 










Managing and coping with names of pleomorphic fungi in a period of 

1, 2 

transition 

David L. Hawksworth 

Departamento de Biología Vegetal II, Facultad de Farmacia, Universidad Complutense de Madrid, Plaza Ramón y Cajal, E-28040 Madrid, 

Spain; and Department of Life Sciences, Natural History Museum, Cromwell Road, London SW7 5BD, UK; corresponding author e-mail: 

d.hawksworth@nhm.ac.uk 

Abstract: An explanation is provided of the recent changes in the International Code of 

Nomenclature for algae, fungi and plants relating to the ending of the separate naming of different 

states of fungi with a pleomorphic life-cycle. Issues relating to their implementation are discussed, 

including problems of defining “widely used”, author citations, proofs of holomorphy, typification, the 

preparation of “Lists of accepted and rejected names” (with a possible timetable), relationship to 

the existing processes of sanctioning and conservation or rejection, and steps to be considered for 

the future. This material is presented here to stimulate debate on the actions that should be taken 

by individuals, and responsible committees, in the current period of transition to a system of fungal 

nomenclature fit for the 21st century. 

Article info: Submitted: 27 March 2012; Accepted: 5 April 2012; Published: 10 April 2012. 

Key words: 

anamorph 

Ascomycota 

Basidiomycota 

conidial fungi 

coelomycetes 

hyphomycetes 

International Code of Nomenclature 

nomenclature 

Sneath 

teleomorph 

"The whole process is evolving, slower than some would like, and too fast for others (Scott A. Redhead, 26 January 2012)" 

molecular methods were just becoming available, that some 

mycologists realized that molecular phylogenetic methods 

could render the dual system redundant. A fungus could be 

placed in its appropriate phylogenetic position, regardless 

of the kind of spore-producing structure expressed – even 

if it were sterile with no spores of any kind being produced. 

The desirability, and inevitability, of reaching a position of 

“one name for one fungus” became increasingly recognized 

amongst mycologists, and the way in which that might be 

achieved with a minimum of pain started to be discussed. 

At the same time some mycologists, impatient with a lack of 

common assent as to what should be done, started to adopt 

different practices. Debates and discussions ensued during 

1This article was first published in Mycosphere 3(2): 52–64 (2012), 

DOI 10.5943/mycosphere/3/2/4/ and is reproduced here with the 

permission of the publishers and with minor changes, especially in 

Table 1. 

2Dedicated to the memory of the numerical taxonomist and 

bacteriologist Peter H A Sneath (1923–2011), one of my mentors 

while a student at the University of Leicester in 1964–69, who already 

tried to convince me in the 1980s that the “approved lists” model was 

that to follow for fungal and plant names; he died on 9 September 

2011, but probably unaware that the first steps along that route had 

just been approved. 

ARTIcLE 

15

ARTIcLE 

recent International Mycological Congresses (e.g. Seifert 

2003, Norvell et al. 2010). The matter was also considered by 

various committees (e.g. Redhead 2010a). Now, stimulated 

by a special meeting, held under the auspices of the 

International Commission on the Taxonomy of Fungi (ICTF) 

in Amsterdam in April 2011 (Hawksworth et al. 2011), decisive 

action was taken at the Melbourne Congress. 

As a result of the Melbourne decision, the nomenclature 

of non-lichenized, pleomorphic fungi has entered a phase of 

transition. We are now in a period when the actual name to 

be used, in each case, needs to be unequivocally resolved. 

Furthermore, when made, the decisions on those names need 

to be promulgated throughout the mycological community, 

and indeed to all who use fungal names. 

The issue has moved on from “One Name = One Fungus”, 

to “One Fungus = Which Name?” 

The number of generic and species names that might 

be affected is unclear. However, I suspect it may prove 

necessary to reassess around 2,000–3,000 names of genera, 

and 10,000–12,000 names of species. In many cases, 

and probably most, the reassessments will not necessitate 

changes to familiar well-established names. Recognizing the 

need to minimize the potential disruption that could ensue, 

the Congress made some special provisions to mitigate 

the possible effects of the changes. However, the agreed 

procedures will take some years to implement fully as, in 

some cases, deciding on which names to adopt is likely to 

require protracted discussions. The issue then arises as 

to what mycologists should do in this period of transition? 

The aim of this note is to: (1) explain what can be done 

immediately; (2) detail the changes that come into effect on 

1 January 2013; (3) discuss the proposed mechanism to 

move towards “Lists of accepted and rejected names”; and 

(4) suggest some options on how to proceed. 

the New sItuAtIoN 

The separate nomenclatural status afforded to anamorphtypified 

and teleomorph-typified names ended on 30 July 

2011. Regardless of the life-history state represented by their 

types, all legitimate fungal names are now treated equally for 

the purposes of establishing priority. The special rules permiting 

dual nomenclature no longer apply. This has two major 

consequences: 

(1) The correct name is now the earliest published legitimate 

name; i.e. the principle of priority applies regardless 

of the sexual stage represented by the name-bearing 

type (but see also below). 

(2) The removal of the special provision for dual nomenclature 

means that, where names had been introduced for 

different morphs of a single taxon, those names would 

strictly be either (a) alternative names (and so not validly 

published, if proposed at the same time), or (b) nomenclaturally 

superfluous and illegitimate (if proposed for a 

taxon where one morph already had a legitimate name). 

In view of the potential disruption this would cause, 

names in those two categories are ruled as validly published 

and legitimate – provided they were published 

before 1 January 2013 (Art. 59.1). 

hawksworth 

In some instances, generic names with type species 

typified by an anamorphic state, and names of genera, 

species, and infraspecific taxa with anamorphic name-bearing 

types, will have priority over currently used teleomorphtypified 

names. There will be cases where anamorph-typified 

names will have priority of publication, but be little used, so 

adopting them could be disruptive. Consequently, mycologists 

are instructed under Art. 57.2 not to adopt anamorph-typified 

names in cases where either name was “widely used for a 

taxon . . . . until retention of the teleomorph-typified name has 

been considered by the General Committee and rejected” 

(see below). This is necessarily a lengthy procedure and, 

in instances where both names are not widely used, 

mycologists are not constrained from immediately adopting 

older anamorph-typified names. Even in cases of widespread 

usage of dual nomenclature, where the anamorph name 

is much used, some mycologists are already adopting 

anamorph-typified names as the correct ones for taxa. While 

that may not be considered good practice under the Code, in 

some cases it may be pragmatic; there are no nomenclatural 

penalties proscribed for such actions. 

The converse situation, is not mentioned as requiring 

consideration by the General Committee (GCN). This case is 

where a little used teleomorph-typified name has priority over 

a more widely used anamorph-typified name of later date. 

This should not be interpreted as a general approval of taking 

such actions. Indeed, the responsible approach in such cases 

would be to propose either the less used teleomorph name 

for rejection in favour of the anamorph-typified name, or the 

anamorph name to be included on the “Lists of accepted 

names” (see below). Any decision involving the General 

Committee is likely to take a considerable time. 

For submitted cases, the key guidance is to maintain 

“existing usage as far as possible”, pending the decision 

(Rec. 56A.1). However, when a recommendation for either 

conservation or rejection has been announced by the 

Committee, that should be followed – even though formal 

ratification would not occur until the Committee’s report was 

accepted at the next International Botanical Congress (Arts. 

14.6 and 56.4), due to be held in China in 2017. 

Some publications, introducing separate new names for 

different states of the same fungus, may already have been in 

advanced stages of preparation, or in press, when the decision 

to end the dual nomenclatural system was taken. Art. 59.1 

protects those appearing before 1 January 2013 from either 

being ruled as not validly published (as alternative names), or 

illegitimate (as superfluous names). Without that safeguard, 

application of the rules that apply to all other fungal names 

would mean that such names would not be available for use 

(without special proposals for their conservation; see below). 

After 1 January 2013, different names proposed for morphs of 

a single species no longer have such protection but, until that 

date, names introduced for different morphs will not be ruled 

as nomenclaturally invalid or illegitimate on that basis. 

In summary: (1) Scientific names of pleomorphic 

ascomycetes and basidiomycetes published on or after 

1 May 1753, whether anamorph-typified or teleomorphtypified, 

compete on an equal footing in determining the 

nomenclaturally correct name for a fungus; and (2) Names 

proposed for different states, prior to 1 January 2013, 

16 ima funGuS


Managing and coping with names of pleomorphic fungi in a period of transition 

which would otherwise be ruled as invalid or illegitimate by 

the application of the general provisions for fungal names, 

continue to be available for use. 

deFININg “wIdely used” 

Whether cases where a single taxon has both anamorphtypified 

and teleomorph-typified names should be submitted 

for consideration through the mandated Committees, under 

Art. 57.2 (see above), relies on the phrase “widely used”. 

There is currently no formal guidance on how “widely used” 

should be defined or interpreted, although two examples 

of what the Editorial Committee for the Melbourne Code 

considered to be good practice, are being incorporated into 

the body of the Code itself3 : 

Ex. 2. The teleomorph-typified generic name Eupenicillium 

F. Ludw. (1892) and five other teleomorph-typified generic names 

were treated as synonyms of the anamorph-typified generic name 

Penicillium Link (1809) by Houbraken & Samson (in Stud. Mycol. 

70: 24. 2011), Penicillium being the oldest and the most widely 

used generic name. However, in order to remove any controversy 

and stabilize this nomenclature, it could be appropriate to propose 

the rejection of the five teleomorph-typified generic names to the 

General Committee. 

Ex. 3. The anamorph-typified generic name Polychaeton (Pers.) 

Lév. (1846) was not taken up by Chommnunti & al. (in Fungal Div. 

51: 116. 2011) in preference to the later teleomorph-typified generic 

name Capnodium Mont. (1849) as the latter is in widespread use, 

and the authors suggest that the teleomorphic name be considered 

for inclusion in the planned lists of accepted names to be approved 

by the General Committee under Art. 14.13. 

It would be helpful if mycologists involved in making the 

changes were provided with further guidance on this matter. 

This would expedite the necessary changes being made, 

and would need to be borne in mind when preparing draft 

lists of accepted or rejected names. This is an issue which 

the Nomenclature Committee for Fungi (NCF) appointed by 

the International Botanical Congress, and the IUBS/IUMS 

International Commission on the Taxonomy of Fungi (ICTF), 

may wish to address. 

In reaching a decision as to whether each of a competing 

pair of state names is “widely used” or not, it will be important 

to consider the wider community of biologists who use fungal 

names, and not only fungal taxonomists. In this connection, 

it is fortunate that web-based search engines are available. 

A simple Google search on a word, such as a generic name, 

will give the largest number of “hits”, but these may contain 

duplicates. Google Scholar is more restrictive in being 

confined to scholarly publications, rather than usages in 

general, but both these will not weed-out non-fungal usages 

of the same word, or its use at a different rank. For example, 

a search of Coryne resulted in 671,000 hits in Google and 

13,700 in Google Scholar due to the inclusion of coryneform 

bacteria and coryne-bacteria, whereas Ascocoryne yielded 

133,000 and 1,070 respectively; Sphaerellopsis, without the 

3This wording may still be subject to some final editorial changes 

before the new edition of the Code is released. 

additional search word “rust”, had 70,500 hits in Google but 

only 4,800 with “rust” due to problems of an orthographically 

identical algal genus; and for an unqualified Polymorphum, 

there were 126,000 hits in Google and 3,380 in Google 

Scholar, mainly from the use of “polymorphum” as a species 

epithet in diverse organisms. These are very rough and, 

in some cases, potentially misleading bibliometrics, but 

they have merit in being broader in their coverage than 

databases such as Web of Science or Scopus which catch 

only a subset of the scientific output, and so are starting 

to attract more attention as tools in the biblioinformatics 

community (e.g. Alcaraz & Morais 2012, Krell 2012). In 

principle, a better guide for usage in fungal taxonomy would 

be the Bibliography of Systematic Mycology, but in that the 

detailed indexing of genera only started in 1986. Examples 

of numbers of hits obtained for 25 genera in three datasets 

are included in Table 1. 

Whatever search is conducted, three problems appear 

to be impracticable to address: (1) usages of names prior 

to the advent of widespread computerization of bibliographic 

databases in the mid-1970s and 1980s will only be 

picked-up occasionally, but could be very numerous; (2) 

the commonplace situation where both state names of 

a pleomorphic fungus are cited in a single work (either as 

accepted names for the different states, or where one is 

mentioned as a synonym); and (3) the levels of indexing in 

the databases themselves, for example, if they are based on 

a search of the entire text, as words in an abstract, or only 

as keywords. 

While some of the caveats discussed in the previous 

two paragraphs might be overcome with the help of 

biblioinformatics specialists, others are unlikely to be 

surmountable in the foreseeable future. Even if the 

Biodiversity Heritage Library and CyberLiber were eventually 

to cover all the systematic mycology publications since 1753, 

there would be the so-pertinent usage in applied biological 

journals, patents, and semi-popular magazines, to address. 

Nevertheless, the numbers of mentions of generic names 

recovered by search engines or bibliographic databases may 

serve as a rough-and-ready indication as to what is “widely 

used”, but only with an awareness of the caveats noted 

above, and a familiarity with current practices in the group of 

fungi concerned. 

If in doubt whether one or both names of a pleomorphic 

fungus fall into the “widely used” category, it would be prudent 

to follow the committee route (see below) before committing 

to a decision in print. If that is not done, an author may face 

the prospect of embarrassment if the decision is reversed in 

one of the protected lists of accepted names, not to mention 

being responsible for additional confusion in the literature, 

and for perplexing and frustrating all users of the name(s). 

Author cItAtIoN correctIoNs 

The pre-Melbourne editions of the Code included a special 

provision that meant, if a teleomorph of an anamorph-typified 

taxon were discovered, and the anamorph-typified name 

were transferred to a teleomorph-typified generic name, the 

combination was to be treated as the name of a new species, 

ARTIcLE 17

ARTIcLE 

table 1. Results of searches on 25 pairs of potentially competing generic names in Google, Google Scholar, and the Bibliography of Systematic Mycology (BSM, 1986 on) on 21 February 2012, and possible 

actions. Generic names in: bold = names suggested to be used, italic = names suggested for treatment as synonyms, and normal = names suggested for consideration by committees; v. = versus. 

Anamorph-typified search results Teleomorph-typified search results 

google google BsM google google BsM 

scholar scholar 

(1) AccePt PrIorIty ? 

Basipetospora G.T. Cole & W.B. Kendr. 1968 4,170 184 12 v. Monascus Tiegh. 1884 1,670,000 10,500 72 

cladosporium Link 1816 586,000 30,900 555 v. Davidiella Crous & U. Braun 2003 31,300 258 37 

Cryptococcus Vuill. 1901 nom. cons. 4,950,000 72,800 815 v. Filobasidiella Kwon-Chung 1976 151,000 2,000 156 

Chrysonilia Arx 1981 89,200 433 24 v. Neurospora Shear & B.O. Dodge 1927 1,100,000 107,000 323 

Endothiella Sacc. 1906 5,100 139 16 v. Cryphonectria (Sacc.) Sacc. & D. Sacc. 1905 172,000 7,070 194 

Dendryphiopsis S. Hughes 1953 13,200 74 21 v. Kirschsteiniothelia D. Hawksw. 1985 482 155 45 

hawksworth 

histoplasma Darling 1906 1,910,000 28,200 226 v. Ajellomyces McDonough & A.L. Lewis 1968 216,000 1,010 66 

18 ima funGuS 

Monocillium S.B. Saksena 1955 4,480 691 15 v. Niesslia Auersw. 1869 28,700 145 41 

Pseudoidium Y.S. Paul & J. N. Kapoor 1986 6,060 182 11 v. Erysiphe R. Hedw. ex DC. 1805 1,080,000 32,600 505 

Penicillium Link 1809 682,000 210,000 940 v. Eupenicillium F. Ludw. 1892 64,500 3,160 121 

sepedonium Link 1809 40,200 1,440 55 v. Apiocrea Syd. & P. Syd. 1921 10,700 125 9 

trichoderma Pers. 1794 1,500,000 129,000 486 v. Hypocrea Fr. 1825 362,000 4,640 262 

Uredo Pers. 1801 146,000 5,020 212 v. Puccinia Pers. 1794 819,000 54,400 1,067 

(2) AccePt lAter NAMe ? 

Cladobotryum Nees 1816 12,100 549 63 v. Hypomyces (Fr.) Tul. & C. Tul. 1860 189,000 2,330 142 

hansfordiellopsis Deighton 1960 8,460 13 4 v. Koordersiella Höhn. 1909 410 8 5 

Phomopsis (Sacc.) Bubák 1905 nom. cons. 585,000 16,200 376 v. Diaporthe Nitschke 1870 269,000 7,300 256 

Polychaeton (Pers.) Lév. 1846 3,300 70 14 v. capnodium Mont. 1849 26,300 1,340 53 

scopulariopsis Bainier 1907 215,000 6,130 127 v. Microascus Zukal 1885 9,640 898 79 

Sphaerellopsis Cooke 1883 4820 1 260 1 22 v. eudarluca Speg. 1908 14,300 190 21 

Ugola Adans. 1763 57,000 2 36 1 v. Asterophora Ditmar 1809 95,200 868 72


Anamorph-typified search results Teleomorph-typified search results 

google google BsM google google 

scholar scholar BsM 



(3) reFer to coMMIttee ? 

Cylindrocladium Morgan 1892 93,100 3,890 195 v. Calonectria De Not. 1867 89,400 2,220 137 

Hormoconis Arx & G.A. de Vries 1973 26,900 533 10 v. Amorphotheca Parbery 1969 29,300 233 12 

Hypocrella Sacc. 1878 31,200 842 53 v. Aschersonia Mont. 1848 24,800 1,450 60 

Stemphylium Wallr. 1833 89,400 9,500 176 v. Pleospora Rabenh. ex Ces. & De Not. 1863 168,000 4,630 276 

Polymorphum Chevall. 1822 44,700 549 3 v. Ascodichaena Butin 1977 31,200 93 7 

1 Due to confusion with the algal genus Sphaerellopsis Koschikov 1925, searches were for Sphaerellopsis + rust; acceptance of Eudarluca would facilitate conservation of the algal generic name. 

2 Figure inflated due to use of the same term in human anatomy, even with " + fungus" in the search. 

and not as a new combination, if, and only if, a valid diagnosis 

or description were provided. It was then to be attributed to 

the author making the connection. If no valid diagnosis of the 

teleomorph were provided, the binomial would remain as a 

validly published combination, typified by the anamorphic 

type of the basionym4 . 

This situation did not arise very often but, in those cases 

where it did, the combinations are now again to be treated 

as just that, and the author citations changed accordingly. An 

example of this situation is included in the Melbourne Code: 

Ex. 3. Mycosphaerella aleuritidis (Miyake) S. H. Ou (1940), 

when published as a new combination, was accompanied by a 

Latin diagnosis of the newly discovered teleomorph corresponding 

to the anamorph on which the basionym Cercospora aleuritidis 

Miyake (1912) was typified. Under previous editions of this Code, 

M. aleuritidis was considered to be the name of a new species with 

a teleomorph type, dating from 1940, and with authorship attributed 

solely to Ou. Under the current Code, the correct citation is as 

originally published, i.e. as M. aleuritidis (Miyake) S. H. Ou, typified 

by the type of the basionym. 

In cases of this type, the correction can simply be made 

without any formal actions or even a publication though, 

when encountered, it would be helpful to inform the compilers 

of Index Fungorum that a correction should be made in the 

database. 

ProoFs oF holoMorPhy 

One of the key drivers for the end of the dual nomenclatural 

system for pleomorphic fungi was the realization that, on the 

basis of sequence data alone, even a fungus not forming any 

spores could be placed with confidence in the sexual system 

(Reynolds & Taylor 1992). The kind of spores produced by 

a fungal specimen or culture are irrelevant to its placement 

in the phylogenetic system for the fungi as a whole. While 

molecular results can be expected to be definitive in this 

regard, and have enabled even fungi known only in a nonsporing 

state to be incorporated into the sexual system, many 

of the connections reported in the literature have, as yet, not 

been examined by molecular methods. 

An enormous number of connections between anamorphs 

and teleomorphs were made in the pre-molecular era, and 

these were painstakingly compiled in Kendrick (1979); this 

work remains a remarkable resource today. From the mid-19 th 

century, these connections were largely based on detailed 

observations of the fungi in nature and, most spectacularly, 

by Tulasne & Tulasne (1861-65). Later, connections seen in 

culture, the development of sporocarps in or from one only 

with conidial states, were used as evidence (e.g. de Bary 

1887). During the 20 th century, increased rigour was used, with 

the emphasis on establishing connections by examination of 

the anamorphic fungi developed from single ascospores. 

Notwithstanding such careful approaches, a considerable 

4In several editions of the Code prior to that adopted by the Sydney 

Congress in 1981, the epithet in a binomial placed in a teleomorphtypified 

genus was also ruled as illegitimate if the type did not 

represent the teleomorphic state. 

ARTIcLE 19

ARTIcLE 

number of the reported connections in the literature remain 

based only on co-occurrences in nature. 

When uniting names, typified by different states under 

the new rules to provide the correct name for a species, 

particular care should be taken to ensure that the evidence 

is sound. That is especially so when basing decisions on 

co-occurrences, particularly as fungicolous fungi have 

sometimes been misinterpreted as anamorphs of their 

hosts. The Code itself provides no guidance as to proofs of 

holomorphy, and this remains a taxonomic decision parallel 

to that of treating any two names as synonyms. Similarly, it is 

a taxonomic decision whether to describe a conidial fungus 

in the same genus as one in which a teleomorph is known; 

in that case, the judgment has to be based on the similarity 

of that conidial fungus to ones already established as being 

members of the same genus. 

In discussion, I have heard it suggested that molecular 

evidence should be required for proof of holomorphy. I would 

concur that either molecular sequence data or evidence 

from single ascospore cultures must be the “gold standard”. 

However, in reality this is not going to be achievable in 

any conceivable time-frame for the majority of fungi. While 

desirable, I would also question if that were necessary at 

all in certain cases, for instance, when there was evidence 

from physical connections seen in nature (e.g. in many sootymoulds), 

or regular co-occurrences (e.g. Vouauxiomyces 

anamorphs of Abrothallus species). The burden of presenting 

cases “beyond reasonable doubt” will remain that of authors 

who have to satisfy their peer reviewers, editors, and 

ultimately the mycological community at large; a situation 

no different from that which already exists when taxonomic 

novelties are proposed. 

There will be many instances where it is uncertain if a 

particular species should be transferred to a particular 

anamorph-typified or teleomorph-typified genus, and I would 

caution against wholesale uncritical transfers in such cases – 

especially as it is becoming clear that so many fungal genera 

are polyphyletic. This will also have to remain an issue for 

taxonomic judgement, either by individuals or committees, 

but it is to be expected that there will be numerous 

“orphaned” species names, i.e. ones under generic names 

now synonymized with others. While this is an undesirable 

situation, it is no different from numerous names already in 

the literature under generic names such as Mycosphaerella, 

Phoma, Sphaeria, and Sporidesmium. 

While not ideal, it must not be forgotten that the placement 

of a taxon under a particular generic name is no impediment 

to the use of the name in identification or inclusion in 

artificial diagnostic keys, other identification aids, or use in 

publications. When using a generic name I recognize as 

probably being wrong for a species, but not having enough 

evidence to make a transfer, or introduce a new generic 

name, my personal practice is to place the generic name in 

quotation marks (e.g. “Sporidesmium” lichenicola). The late 

Martin B. Ellis drilled into me, when a neophyte mycologist in 

the early 1970s, that the important thing was to give the taxon 

a label with a good description so that it could be recognized 

by others and discussed. 

hawksworth 

tyPIFIcAtIoN 

An epitype is essentially an interpretative type; a specimen 

or illustration designated to fix the precise application of 

a name where the name-bearing type lacks characters 

necessary for its identification. For example, molecularlysequenced 

epitypes are increasingly being designated to fix 

the application of names where DNA cannot be recovered 

from the name-bearing types. As an interim step towards 

the ending of dual nomenclature, the Vienna Congress of 

2005 extended the original concept further, and authorized 

the designation of teleomorph-types as “epitypes” for 

names already typified by anamorphic material (McNeill et 

al. 2006). This particular extension of the epitype concept 

was introduced in order to avoid having to introduce a new 

scientific name when the teleomorph of a species, previously 

known only in the anamorphic state, was discovered. The term 

“teleotype” was proposed for this special category of epitypes 

by Redhead (2010b), but the special terminology was not 

adopted by the Melbourne Congress in 2011. Nevertheless, 

with the changes effected at that Congress, there are likely to 

be numerous instances where it will be desirable to designate 

epitypes exhibiting a state not evident on the name-bearing 

type of a name. Epitypes designated for this purpose can 

represent the anamorph or the teleomorph; there is no longer 

any restriction of such actions to teleomorphic material. 

NAMes oF FAMIlIes ANd orders 

Some mycologists have expressed concern that by 

allowing anamorph-typified and teleomorph-typified names 

to compete on an equal basis, this will lead to the loss of 

some very familiar and long-established suprageneric 

names, particularly those of families and orders. However, 

while family names must be based on a legitimate generic 

name (Art. 18.3), that generic name does not have to be 

that currently accepted as the correct name for a genus. 

For example, the treatment of Eurotium as a synonym of 

Aspergillus does not in itself prevent the use of Eurotiaceae 

and Eurotiales, nor would the adoption of Trichoderma as 

the correct name for Hypocrea preclude the continued use 

of either Hypocreaceae or Hypocreales. However, while 

the principle of priority does not apply to higher categories 

such as order, class, or subphylum, it does to that of family. 

Consequently, Cladosporiaceae (Sacc.) Nann. 1934 would 

have priority over Davidiellacae C.L. Schoch et al. 2007 and, 

in order to retain Hypocreaceae de Not. 1844, that name 

would have to be conserved (see below) against the earlier 

Trichodermataceae Fr. 1825 to remain in use. 

INForMAl desIgNAtIoNs 

Some mycologists have expressed concern over the loss 

of data that can be of practical importance, for example, in 

referring to a particular state that is the causal agent of a 

plant disease. This was already recognized by Seifert et al. 

(2000) who proposed the adoption of lower-case non-italic 

names, such as “acremonium-anamorph” and “trichoderma- 

20 ima funGuS


anamorph”. I can see no objection to these or similar phrases 

being included in the titles of publications or associated with 

species names, either outside or inside brackets, where it is 

appropriate to refer to a particular state. However, in such 

expressions, it might be simpler to use “morph” rather than 

“anamorph” or “teleomorph” as the last two terms are not 

familiar to non-mycologists. In due time, I would like to see 

a recommendation to encourage this practice included in 

a future edition of the Code, even though such a proposal 

made to the Vienna Congress in 2005 (Hawksworth 2004) 

was not accepted. 

lIsts oF AccePted ANd reJected NAMes 

The Code has various appendices dealing with lists of 

conserved and rejected names and suppressed publications, 

and also accords special protection to names adopted in 

certain mycological works that are deemed to be “sanctioned” 

(see below). Prior to the Melbourne Congress, there was 

no mechanism whereby additional lists of names might be 

adopted for protection or rejection en bloc. This changed for 

all non-lichenized fungi on 30 July 2011 when procedures 

for the adoption of lists of accepted (Art. 14.13) or rejected 

names (Art. 56.3) were approved. In the case of names 

on the new Accepted Lists, the competing synonyms over 

which another is preferred would remain available for use in 

a different taxonomy (Art. 14.6), provided that they do not 

compete with the accepted name. However, in the case of the 

Rejected Lists, the names cannot be resurrected except by 

conservation (Art. 56.3; see below). For this reason, I suspect 

that many mycologists will embrace the concept of Accepted 

Lists more favourably than that of the Rejected Lists. 

It is important to be aware that while the motivation of 

the concept of these Lists was the changes in the former 

special rules relating to the names of pleomorphic fungi, the 

Lists can cover any fungal names except those of “lichenforming 

fungi and those fungi traditionally associated with 

them taxonomically, e.g. Mycocaliciaceae”. Reasons for 

this exception, which I personally find unconvincing, are 

addressed by Lendemer (2011). 

There is no restriction on who might produce a List, its 

taxonomic scope, or the ranks that can be covered. Initial 

Lists for consideration can be prepared by individuals or 

small groups, as well as formally constituted committees 

or subcommittees of international or national mycological 

organizations. However, when a List has been produced, 

the Code requires it to be submitted to the General 

Committee on Nomenclature (GCN). The GCN will pass it 

to the Nomenclature Committee for Fungi (NCF), who in 

turn will refer it to a subcommittee, which it has established 

in consultation with the GCN “and appropriate international 

bodies”. It is anticipated that the “appropriate international 

bodies” will include the International Commission on the 

Taxonomy of Fungi (ICTF) as well as similar bodies, such 

as the International Commission on Yeasts (ICY), and their 

subcommittees. Where possible, the subcommittees should 

include users of names other than taxonomists for reasons 

noted below. 

Following review and refinement of a List by the 


subcommittee tasked with this work, it is then to be submitted 

to the NCF. After a period of discussion within the NCF, a 

vote would be taken; a 60 % majority is adopted by the NCF 

when considering individual name conservation and rejection 

proposals but, the NCF would have to consider whether it 

wished to follow that system for these special Lists. When 

approved by the NCF, the List will in turn pass to the GCN. 

Following approval by the GCN, the List would await formal 

adoption by the following International Botanical Congress. 

The Melbourne Code does not require a period of open 

consultation, but it is anticipated that a procedure, parallel to 

that already well established for the conservation and rejection 

of particular names (see below), would be followed, i.e., the 

Lists would be published and open for comment prior to any 

voting by the NCF. The Lists would ideally be made available 

through a particular website, with a commenting facility, as 

that would maximize the involvement of mycologists at large. 

It is imperative that the process is transparent, and open 

to inputs from those working in applied and non-taxonomic 

aspects of mycology, as well as to taxonomists. This is 

necessary in order to avoid the mycological community as a 

whole feeling Lists have been imposed upon them, for if they 

are not seen to be to the benefit of the entire subject, there 

will be those who decide not to follow what they consider the 

dictates of some clique. 

It is imperative that Lists are meticulously prepared, and 

the bibliographic details and type information are verified. 

Names on the Accepted Lists “are to be listed with their 

types together with those competing synonyms (including 

sanctioned names) against which they are to be treated as 

conserved” (Art. 14.13). While every effort should be made 

to make even the earliest drafts as accurate as possible, this 

is not critical. When preparing the Lists of Names in Current 

Use for genera of all groups of organisms covered by the 

Code, experience was that if “quick and dirty” drafts were 

first drawn up and widely circulated, numerous mycologists 

would critically assess and correct entries for groups in which 

they had a particular interest. That procedure took five years 

(Greuter et al. 1993), but does mean that a considerable 

amount of checking has already been done for fungal 

names at the rank of genus. In addition, there is a variety 

of other substantial data sets that also are available for use 

in compiling entries for Lists. These include the Outline of 

Ascomycota (Lumbsch & Huhndorf 2010), Ainsworth & 

Bisby’s Dictionary of the Fungi (Kirk et al. 2008), the Species 

Fungorum database (www.speciesfungorum.org/Names/ 

Names.asp), The Genera of Hyphomycetes (Seifert et 

al. 2011), compilations of reported anamorph-teleomorph 

connections in Kendrick (1979) and, most significantly, the 

listing of 739 non-teleomorph-typified generic names linked 

to teleomorph genera by Hyde et al. (2011). 

Allowing an adequate period of consultation will be 

imperative, as the Lists will become a cornerstone of fungal 

nomenclature for the future. One possible time-line that could 

be achievable, at least for generic names, would be to: 

(1) Release “quick and dirty” (hopefully not too dirty!) drafts 

for comment on the internet by the end of 2012. 

(2) Invite mycologists to express interest in either serving 

on or helping committees or subcommittees mandated 

by the NCF, with preparing Lists by the end of 2012. 

ARTIcLE 21

ARTIcLE 

(3) Encourage comments and corrections on the Lists by 

the end of June 2013, and have the NCF mandated 

committees and subcommittees consider inputs received, 

and prepare a revision of the Lists. 

(4) Issue revised versions of the Lists by the end of December 

2013, after consideration by committees or subcommittees 

mandated by the NCF to perform that task. 

(5) Debate and conduct a poll on acceptance of the Lists 

open to all participants during the 10 th International Mycological 

Congress (IMC10) in August 2014. 

(6) Have the NCF mandated committees and subcommittees 

make further revisions and corrections by December 

2014, place the updated versions on the internet, 

and submit them to the NCF for approval. 

(7) Discuss and approve the Lists within the NCF by December 

2015 and submit them to the GCN. 

(8) Have the GCN consider and approve the Lists by January 

2016. 

(9) Present the Lists for formal adoption at the International 

Botanical Congress in 2017. 

(10) Include the Lists as Appendices in the 2018 edition of 

the International Code of Nomenclature for algae, fungi, 

and plants. 

What is imperative is that the NCF, in consultation with 

the ICTF and other international bodies, determines and 

publicizes the schedules. Species lists for some families or 

genera (e.g. Saccharomycetaceae, Trichocomaceae), where 

much work has already been done, could well be integrated 

into this time-scale, but others would undoubtedly take much 

longer. Particular time-lines would need to be developed and 

advertised on an ordinal, familial, or generic basis for species 

names, depending on how mandated infrastructure is developed 

by the NCF. I suspect that it will be difficult to have all 

in a sufficiently mature state for adoption by 2017 Congress. 

The Lists are not restricted to names affected by the 

changes in the rules relating to pleomorphic fungi. The 

preparation of these Lists will consequently also provide an 

opportunity for larger scale protection of currently accepted 

non-lichenized fungal names whether pleomorphism is 

known or not. Lists could, therefore, cover all accepted 

taxa within particular orders, families, or genera. This is an 

issue for consideration by those involved in the preparation 

and revisions of particular Lists, and the matter merits 

serious consideration at the “One Fungus = Which Name?” 

symposium to be held under the auspices of the ICTF in 

Amsterdam on 12–13 April 2012. 

That the process will inevitably be lengthy will be found 

frustrating by some but, as the consequences will have to be 

embraced by future generations of mycologists, this seems 

unavoidable. In the case of the preparation of the Approved 

Lists of Bacterial Names, which includes around 300 generic 

and 1,800 specific names, the first draft was made available 

in 1976, the revised List was published in 1980, and this 

was formally accepted at the 1982 International Congress 

of Bacteriology (Sneath 1986). That process took six years, 

which is similar to the time-line suggested above. However, 

in mycology, there are many more names to be handled, 

although the precise numbers on which decisions will be 

necessary are unknown. Fortunately, today, we have the 

huge advantage of the internet and nomenclatural databases 

hawksworth 

which were not available to the bacteriologists of the 1970s. 

The actual format of entries in the Lists will need to 

follow that used in the current Appendices of the Code which 

list conserved and rejected names. In the case of species 

names, it will also be advantageous, wherever possible, to 

cite references to deposited molecular sequence data when 

available for the name-bearing type; in some cases, it could 

be helpful to designate a sequenced epitype in the List. 

Once approved by the GCN and the subsequent 

International Botanical Congress, the extent to which a 

List may be added to or revised is not made explicit in 

the Melbourne Code. Indeed, it seems to be somewhat 

ambiguous on this point. While listed names are to be “treated 

as conserved” (Art. 14.13) and “entries of conserved names 

may not be deleted” (Art. 14.14.), the accepted names on the 

Lists are not in the same category as conserved names. This 

matter will need to be considered by the NCF, but it would 

clearly be advantageous to have the Lists open. This would 

enable them to be added to as detailed treatments of families 

and genera become available. 

The issue of how to prepare approved lists of names, 

which have specially protected status, is currently a matter 

undergoing discussion in the zoological community, and it is 

anticipated that proposals from the International Commission 

on Zoological Nomenclature (ICZN) will be released for 

general discussion shortly. It will be important for mycologists 

to monitor those discussions as they may be helpful in 

suggesting how best to develop and seek approval for fungal 

Lists. 

sANctIoNed NAMes 

The inclusion of a fungal name on an Accepted List over-rides 

the specially protected status of the sanctioned names of 

ascomycetes and basidiomycetes (Art. 15). This is evident as 

sanctioned names are mentioned as “competing synonyms” 

to be included in the Lists in Art. 14.13. However, a sanctioned 

status should be one issue for those preparing lists to take 

into account when deciding which of two competing names 

should be commended for acceptance. 

coNservAtIoN ANd reJectIoN 

The long established system for the conservation and rejection 

of names of families, genera, and species is independent 

from that of the new Lists. The system provides a mechanism 

for avoiding the displacement of well-established names for 

purely nomenclatural reasons, such as priority of publication, 

and also permits typification with a type other than that 

previously designated. Guidance on preparing proposals 

under these provisions is provided by McNeill et al. (2012b). 

In the new Lists, the names are “treated as conserved” 

Art. 14.13) or “treated as rejected” (Art. 56.3), but are 

not formally conserved or rejected. This is an important 

distinction as conservation and rejection procedures grant a 

more final solution, since names once ruled upon cannot be 

deleted and, in the case of rejected names, are not to be 

used (Art. 56.1). Names listed as not to be used in favour 

22 ima funGuS



of conserved names, however, are still available for use in 

a different taxonomy provided they do not compete with a 

conserved name. 

Conservation and rejection over-ride inclusion in the 

new Lists but, at the same time, some names that now 

compete are already conserved, for example Cryptococcus 

and Phomopsis (Table 1). Were such already conserved 

names not to be those preferred in the Accepted Lists, formal 

proposals for the conservation of the preferred name, over 

that which had been previously conserved, would have to be 

made. 

Where the adoption of the earliest legitimate generic 

name or species name for a pleomorphic fungus would result 

in the change of long-established and widely used names, 

the mechanisms for the conservation and rejection of names 

are available for use now. Such proposals would strictly be 

independent from the planned Lists of accepted and rejected 

names (see above). However, whether the NCF, established 

by the Melbourne Congress, would wish to vote on them 

separately, and pre-empt any treatment in an adopted List, 

is uncertain. It would be helpful if the NCF could provide 

guidance on its approach to such proposals. However, 

for particularly controversial cases, as the Lists will take a 

considerable time to prepare and be approved, use of these 

procedures may be the most expedient course of action to 

remove uncertainties in a timely manner, especially for fungi 

of particular economic or medical importance. 

Next stePs 

Here, to provide some background for the discussions 

now commencing regarding their implementation, I 

have endeavored to explain what is involved in the new 

arrangements for the naming of pleomorphic fungi adopted 

at the Melbourne Congress in 2011. I have also suggested a 

possible timetable of actions as a basis for wider discussion 

– and without prejudice to the result of the decisions of the 

NCF. 

The new provisions are already in force, and mycologists 

preparing their work for publication will need to make 

decisions on what names to use while the preparation of 

Accepted and Rejected Lists of names progresses. This is 

already recognized in the Code through the examples given 

in Art. 14.13 (see above) and not only is, but was, already 

happening prior to the Melbourne Congress. To make a 

decision now over competing names is not contrary to the 

Code, provided its general provisions for all names are 

met – except that where an anamorph-typified name has 

priority by date over a widely used teleomorph-typified name. 

However, it would be unwise to rush into making any formal 

nomenclatural changes that may prove controversial until at 

least draft Lists have been made available. In Table 1, I have 

indicated some examples of different situations and actions 

that might be taken in those cases as a basis for discussion. 

The problem over the large numbers of cases that would 

need to be addressed in mycology, and the appreciation 

that many would not be controversial, led to the inclusion 

in the Amsterdam Declaration on Fungal Nomenclature 

(Hawksworth et al. 2011: para 5) of the Principle of the First 

Reviser, a concept borrowed from the International Code 

of Zoological Nomenclature (ICZN 1999: Art. 24.2). This is 

essentially that the author(s) first making a choice between 

generic names should be followed, and that those choices 

should be registered in a nomenclatural depositary (e.g. 

MycoBank, Index Fungorum). It was suggested that such 

cases only needed referral to an internationally mandated 

committee if a case to overturn the choice of the first reviser 

was prepared. This provision was not, however, amongst 

the proposals presented to the Melbourne Congress, but 

may merit consideration as a way of expediting decisions on 

numerous cases. This is a topic which could merit discussion 

at the upcoming “One Fungus = Which Name?” symposium. 

Transition can be a painful process, but this new dawn 

of fungal nomenclature promises to deliver a system truly fitfor-purpose 

for mycology in the 21 st century. I trust that all 

mycologists will work constructively towards the realization 

of that goal. 

cAveAts 

The interpretations and views presented here are personal, 

and those involved in fungal nomenclature should consult 

the International Code of Nomenclature for algae, fungi and 

plants (McNeill et al. 2012a) when it becomes available. 

Information on the procedures to be used for the development 

of Lists of accepted and rejected names, or other guidance, 

prepared by the Nomenclature Committee for Fungi, or the 

International Commission on the Taxonomy of Fungi, should 

also be consulted as they become available. The suggestions 

made as to actions that might be considered appropriate in 

the particular cases included in Table 1 are presented here 

merely as a basis for discussion, and are without prejudice to 

final decisions on those cases. 


This contribution would not have been prepared without the 

persistence of Kevin D. Hyde, and was completed while I was in 

receipt of funding from project CGL2011-25003 of the Ministerio 

de Economía y Competitividad (MECC) of Spain. I am grateful to 

my wife, Dr Patricia E.J. Hawksworth for striving to make the text 

intelligible to non-nomenclaturalists. 

references 

Alcaraz C, Morais S (2012) Citations: results differ by databases. 

Nature 483: 36. 

de Bary A (1887) Comparative Morphology and Biology of the Fungi, 

Mycetozoa and Bacteria. Oxford: Clarendon Press. 

Greuter W, Brummitt RK, Farr E, Killian N, Kirk PM, Silva PC (1993) 

NCU–3: names in current use for extant plant genera. [Regnum 

Vegetabile no. 129.] Königstein: Koeltz Scientific Books. 

Hawksworth DL (2004) Limitation of dual nomenclature for 

pleomorphic fungi. Taxon 53: 596–598. 

Hawksworth DL (2011) A new dawn for the naming of fungi: impacts 

of decisions made in Melbourne in July 2011 on the future 

ARTIcLE 23

ARTIcLE 

24 

publication and regulation of fungal names. MycoKeys 1: 7–20; 

IMA Fungus 2: 155–162. 

Hawksworth DL, Crous PW, Redhead SA, Reynolds DR, Samson 

RA, Seifert KA, Taylor JW, Wingfield MJ [& 69 signatories] (2011) 

The Amsterdam Declaration on Fungal Nomenclature. IMA 

Fungus 2: 105–112; Mycotaxon 116: 91–500. 

Hyde KD, McKenzie EHC, KoKo TW (2011) Towards incorporating 

anamorphic fungi in a natural classification – checklist and notes 

for 2010. Mycosphere 2:1–88. 

International Commission on Zoological Nomenclature (ICZN) (1999) 

International Code of Zoological Nomenclature. 4th edn. London: 

International Trust for Zoological Nomenclature. 

Kendrick B (ed.) (1979) The Whole Fungus: the sexual-asexual 

system. 2 vols. Ottawa: National Museums of Canada. 

Kirk PM, Cannon PF, Minter DW, Stalpers JA (2008) Ainsworth & 

Bisby’s Dictionary of the Fungi. 10th edn. Wallingford: CAB 


Krell F-T (2012) The journal impact factor as a performance indicator. 

European Science Editing 38: 3–5. 

Lendemer JC (2011) Changes to the International Code for Botanical 

Nomenclature passed in Melbourne: a lichenological perspective. 

Opuscula Philolichenum 10: 6–13. 

Lumbsch HT, Huhndorf SM (2010) Outline of Ascomycota – 2009. 

Fieldiana, Life and Earth Sciences 1: 1–42. 

McNeill J, Barrie FR, Burdet HM, Demoulin V, Hawksworth DL, 

Marhold K, Nicolson DH, Prado J Silva PC, Skog JE, Wiersema 

JH, Turland NJ (eds) (2006) International Code of Botanical 

Nomenclature (Vienna Code) adopted by the Seventeenth 

International Botanical Congress Vienna, Austria, July 2005. 

[Regnum Vegetabile no. 146.] Ruggell: R.G. Ganter Verlag. 

McNeill J, Turland NJ, Monro A, Lepschi BJ (2011) XVIII International 

Botanical Congress: preliminary mail vote and report of Congress 

action on nomenclature proposals. Taxon 60: 1507–1520. 

McNeill J, Barrie FR, Buck WR, Demoulin V, Greuter W, Hawksworth 

DL, Herendeen PS, Knapp S, Marhold K, Prado J, Prud’homme 

van Reine WF, Smith GE, Wiersema JH, Turland NJ (eds) 

(2012a) International Code of Nomenclature for algae, fungi, and 

hawksworth 

plants (Melbourne Code) adopted by the Eighteenth International 

Botanical Congress Melbourne, Australia, July 2011. [Regnum 

Vegetabile, in press.] Ruggell: A.R.G. Ganter Verlag. 

McNeill J, Redhead SA, Wiersma JH (2012b) Guidelines for 

proposals to conserve or reject names. Taxon 61: 248–251. 

Norvell LL (2011) Fungal nomenclature. 1. Melbourne approves a 

new Code. Mycotaxon 116: 481–490. 

Norvell LL, Hawksworth DL, Petersen RH, Redhead SA (2010) IMC9 

Edinburgh Nomenclature Sessions. Mycotaxon 113: 503–511; 

IMA Fungus 1: 143–147; Taxon 59: 1867–1868. 

Redhead SA (2010a) Report on the Special Committee on the 

Nomenclature of Fungi with a Pleomorphic Life Cycle. Taxon 59: 

1863–1866. 

Redhead SA (2010b) Proposals to define the new term ‘teleotype’, 

to rename Chapter VI, and to modify Article 59 to limit dual 

nomenclature and to remove conflicting examples and 

recommendations. Taxon 59: 1927–1929. 

Reynolds DR, Taylor JW (1992) Article 59: reinterpretation or 

revision? Taxon 41: 91–98. 

Seifert KA (ed.) (2003) Has dual nomenclature for fungi run its 

course? The Article 59 debate. Mycotaxon 88: 493–508. 

Seifert KA, Gams W, Crous PW, Samuels GJ (eds) (2000) Molecules, 

morphology and classification: towards monophy-letic genera in 

the ascomycetes. Studies in Mycology 45: 1–230. 

Seifert KA, Morgan-Jones G, Gams W, Kendrick B (2011) The Genera 

of Hyphomycetes. [CBS Biodiversity Series no. 2.] Utrecht: CBS- 

KNAW Fungal Biodiversity Centre. 

Sneath PHA (1986) Nomenclature of bacteria. In: Biological 

Nomenclature Today (eds WDL Ride, T Younés): 36–48. [IUBS 

Monograph no. 2.] Eynsham, Oxford: IRL Press. 

Tulasne LR, Tulasne C (1861–65) Selecta Fungorum Carpologia. 3 

vols. Paris: Imperial Press. 

ima funGuS

doi:10.5598/imafungus.2012.03.01.04 










Afrocantharellus gen. stat. nov. is part of a rich diversity of African 

Cantharellaceae 

Donatha D. Tibuhwa 1,2* , Sanja Savić 2 , Leif Tibell 2 , and Amelia K. Kivaisi 1 

1Department of Molecular Biology and Biotechnology, University of Dar es Salaam, P.O. Box 35179, Dar es Salaam, Tanzania (Permanent 

address); corresponding author e-mail: dtibuhwa@yahoo.co.uk 

2Department of Systematic Biology, Institute for Organismal Biology, Uppsala University, Norbyvägen 18D, 75236 Uppsala, Sweden 

Abstract: A new genus in the Cantharellaceae, Afrocantharellus, is recognized based on results from phylogenetic 

analyses of rDNA LSU and concatenated LSU/5.8-ITS2/ATP6 data. It was previously recognized as a subgenus, 

but comprehensive fieldwork and the acquisition of numerous sequences for previously neglected African 

Cantharellus species formed the basis for a reappraisal of generic and species delimitations. Afrocantharellus is 

characterized morphologically by the basidiomes having thick, distantly spaced diverging folds of variegated colour. 

In contrast to most of Cantharellus, Afrocantharellus mostly lacks clamp connections. Phylogenies of Cantharellus 

and Afrocantharellus based on LSU and a concatenated data set are provided, along with descriptions of and a 

key to the four species and one form of Afrocantharellus recognized. Six new combinations are made. 

Article info: Submitted: 25 February 2012; Accepted: 16 May 2012; Published: 21 June 2012. 

INtroductIoN 

Cantharellaceae comprise mycorrhizal and saprobic fungi, 

which in most cases have a vase-shaped or funnel-shaped 

basidiome and a spore-bearing smooth, wrinkled, veined 

or folded lower side. Cantharellus, as presently delineated, 

includes about 23 species in North America, seven in South 

America, seven in Australia, nine in Europe, three in New 

Zealand, 46 in Africa, and 19 in Asia (Eyssartier 2003, 

Tibuhwa et al. 2008, Buyck & Hofstetter 2011, Buyck et al. 

2011, Eyssartier et al. 2009, Shao et al. 2011). Cantharellus 

includes several well-known and highly esteemed edible 

species. In Africa, Cantharellus species are widely collected 

and sold on local markets. A revision of African Cantharellus 

from the Belgian Congo was given by Heinemann (1958), 

who later (Heinemann 1966) also treated species from 

Katanga, describing C. platyphyllus and C. symoensii as 

new. In a review of edible mushrooms from Burundi (Buyck 

1994), a further species, C. splendens, was described, and 

others are mentioned in a list of Cantharellus species from the 

same country (Buyck & Nzigidahera 1995). Further notes on 

Cantharellus from Africa, including detailed investigations of 

some type specimens, were published by Eyssartier & Buyck 

(1998). A list of and key to Cantharellus species known from 

Tanzania was provided by Buyck et al. (2000). Nomenclatural 

notes and descriptions of new subgenera and sections in 

Cantharellus were published by Eyssartier & Buyck (2001). 

Molecular studies of the ‘cantharelloid clade’ 

The phylogeny of the ‘cantharelloid clade’, including 

Key words: 

Africa 

ATP6 

Cantharellus 

ITS 

LSU 

Molecular phylogeny 

Tanzania 

Cantharellus and the closely related Craterellus, has recently 

been investigated using molecular data, and reviewed by 

Moncalvo et al. (2006). Incongruence was noted between 

relationships as reconstructed from different genes, particularly 

with respect to the placement of Tulasnella. Cantharellus 

and Craterellus consistently were monophyletic and sistergroups 

in analyses based on LSU, SSU, mtSSU, and RPB2 

sequences. Large subunit nuclear encoded rDNA (LSU) and or 

ITS sequences have been used for elucidating the phylogeny 

of or in Cantharellales in several papers (Feibelman et al. 

1994, Feibelman et al. 1997, Hibbett et al. 1997, Pine et al. 

1999, Li et al. 1999, Dahlman et al. 2000, Hibbett et al. 2000, 

Binder & Hibbett 2002, Moncalvo et al. 2006, Olariaga et 

al. 2009). In Cantharellaceae, according to Feibelman et al. 

(1994), the ITS region is unusually long and highly variable 

in length, especially in the chanterelles (see also Dunham 

et al. 2003). Additionally, significant length variability in ITS 

and morphology of North America Cantharellus cibarius-like 

chanterelles has been demonstrated, suggesting a species 

complex masked by a common morphology (Feibelman et 

al. 1994, Dunham et al. 2003, Pilz et al. 2003). Moncalvo 

et al. (2006) recommended the use of protein-coding 

genes such as RPB2 for the reconstruction of evolutionary 

relationships in the cantharelloid clade. This, however, 

primarily had a background in incongruent placement of 

Tulasnella with different datasets, whereas LSU still seems to 

efficiently resolve relationships, also in Botryobasidium and 

Tulasnella. Problems in using LSU datasets include longbranch 

attraction in some types of analyses, particularly in 

distance and parsimony-based analyses (Moncalvo et al. 

ARTIcLE 

25

ARTIcLE 

2006). Alignment problems are also sometimes encountered. 

These, however, are much more pronounced at the order or 

family level, but are manageable and cause much less data 

loss within the genera (Moncalvo et al. 2006). 

Although LSU- and mtSSU-based analyses previously 

have been shown to efficiently resolve phylogenetic 

relationships in Cantharellaceae (Moncalvo et al. 2006), 

here data from additional regions was utilized. ATP6 (which 

codes for ATP-ase subunit 6) has so far not been used for 

phylogenetic inference in Cantharellaceae, but Kretzer & 

Bruns (1999) successfully resolved phylogenetic relationships 

in Boletales using this protein-coding gene. Recently, a 

maximum likelihood analysis was employed on a dataset 

for the protein coding gene tef-1, leading to the recognition 

of a new North American Cantharellus species (Buyck et 

al. 2011) and including discussions of species delimitation 

in the Cantharellus cibarius complex in the southeastern 

USA (Buyck & Hofstetter 2011). Buyck & Hofstetter (2008) 

presented preliminary results of a four gene phylogeny for 

Cantharellus, employing mtSSU, LSU, and two proteincoding 

loci, tef-1 and RPB2, where ca. 45 species from four 

continents were sampled suggesting the recognition of at least 

six different clades. However, in conclusion those authors 

stated that more studies on a larger data set were needed 

for the recognition of further taxa. Although several molecular 

studies have investigated relationships of the ‘cantharelloid 

clade’ (Hibbett et al. 1997, 2000, Pine et al. 1999, Hibbett & 

Donoghue 2001, Binder & Hibbett 2002, Larsson et al. 2004, 

Binder et al. 2005, Mathney 2005, Moncalvo et al. 2006) and 

Cantharellus (Feibelman et al. 1997, Dahlman et al. 2000, 

Dunham et al. 2003, Thacker & Henkel 2004, Henkel et al. 

2005), to our knowledge just a few sequences from African 

species have been published. Considering the high diversity 

of the genus in Africa, this might well have hampered our 

understanding of the phylogeny of Cantharellus and the 

‘cantharelloid clade’ as a whole. 

Thus, the main criticism that can be levelled against 

the molecular analyses so far published of phylogenetic 

relationships of Cantharellus s. lat. is that the taxon sampling 

has been quite limited. The species sampled have been 

almost exclusively from the Northern Hemisphere, despite the 

rich diversity of Cantharellus in other parts of the world. The 

diversity of Cantharellus in Africa is particularly exceptional, 

and the inclusion of data on African Cantharellus may thus 

be expected to contribute substantially to alleviate the lack 

in comprehensiveness and phylogenetic relationships in 

current analyses. 

current species recognition in Cantharellus 

In Cantharellus, as currently circumscribed, the distinction 

between the species still often remains extremely subtle 

given the few and variable morphological characters 

available for species recognition (Buyck & Hofstetter 2011). 

For example the name C. cibarius (or ‘C. cf. cibarius’) often 

refers to any yellowish chanterelle, and C. cibarius is no 

doubt the most commonly misapplied name for a chanterelle. 

When the status of nominal species and morphological 

variability within the species was not clear, sometimes these 

‘ambiguous species’ were included in species groups or 

Tibuhwa, Savić, Tibell & Kivaisi 

species complexes. Cantharellus cibarius, considered to 

contain ‘several cryptic geographic species’ by Moncalvo et 

al. (2006), is the type of Cantharellus and this complicates 

the circumscription of Cantharellus s. str. Additionally, Buyck 

& Hofstetter (2011) stated that many morphologically similar 

species and infraspecific taxa had been included under C. 

cibarius. 

However, with the use of molecular information, there is 

evidence that a substantial number of unrecognized fungal 

species are hidden under traditional phenotype-based species 

names (e.g. Carriconde et al. 2008). However, the outcome 

of recent studies of basidiomycetes based on molecular data 

varies. In some cases the recognition of morphologically 

circumscribed species and infrageneric taxa, as monophyletic 

groups, is not supported (e.g. Geml et al. 2006, Frøslev et 

al. 2007, Nagy et al. 2012). Thus, species recognition based 

on molecular data should be adopted when a morphological 

species concept is inapplicable in the sense that it is not 

consistent with the genetic information. Not wanting to 

argue a general, criterion-based ‘species concept’ (see also 

Hey 2006), we have for this study searched for congruence 

between molecular phylogenies and morphological features 

evaluated a posteriori in recognizing taxa. 

The aim of this study is to contribute to a better 

understanding and reassessment of the phylogeny of 

Cantharellus based on the inclusion of molecular data derived 

from the rich diversity of African Cantharellus species based 

on partial LSU, 5.8-ITS2, and ATP6 sequences. 

MAterIAls ANd Methods 

taxon and sequence sampling 

All Cantharellus samples were collected by the first author 

both in the northern and southern parts of Tanzanian miombo 

woodlands (Fig. 1) in April–June and September–December 

during four consecutive years (2004–2007). Specimens were 

preserved either by immediate freezing in saturated brine 

solution, in CTAB until investigated, or dried overnight at 60 

°C for herbarium deposition and further analysis. Microscopic 

characters were examined as in Tibuhwa et al. (2008). This 

involved recording 40 measurements of each feature from 

both fresh specimen preserved in CTAB, and dry specimens 

observed in 10 % ammonium solution in an aqueous solution 

of Congo red. The estimated size of the measured feature was 

obtained statistically and presented as: (min) min-SD – AV – 

max-SD (max) Q, in which min = lowest value recorded for 

the measured feature, max = highest value, AV = arithmetic 

mean and SD standard deviation; Q the ratio length/width 

(Eyssartier et al. 2001, Tibuhwa et al. 2008). Spore shapes 

were described according to Bas (1969). 

For molecular characterization 5.8S–ITS2 and ATP6 

were sequenced for 21 and 20 specimens of Cantharellus 

respectively, and LSU for 36 specimens, including three 

Craterellus species. In total, 77 new sequences were 

produced. GenBank numbers and voucher specimen 

information for sequences we generated are listed in Table 1, 

together with sequences obtained from GenBank. To estimate 

the phylogenetic position of African Cantharellus species as 

represented by the Tanzanian material, we worked with two 

26 ima funGuS

datasets: (1) a large LSU dataset; and (2) a more restricted 

dataset of concatenated LSU/5.8-ITS2/ATP6. 

The first dataset: The larger dataset LSU comprised 92 

taxa of Cantharellus and related genera selected for this 

study. Sequences from GenBank were selected so that if 

possible at least two sequences representing each species 

were included. In the selection of representatives of the 

‘cantharelloid clade’ and choice of outgroup we were guided 

by the results presented by Moncalvo et al. (2006). In the large 

LSU sampling, representatives of Craterellus, Hydnum, and 

Multiclavula were included representing more remote relatives 

of Cantharellus. Multiclavula mucida was used as outgroup. 

The second dataset: A concatenated data set included 

LSU/5.8-ITS2/ATP6, forming 28 sets of sequences 

representing 17 species. We tried to include the same 

representatives for all three regions; however, the 

concatenated matrix was not entirely complete, missing 

three sequences for 5.8-ITS2 and four for ATP6. The ATP6 

sampling was limiting this selection. In the ATP6 partition, 

however, no Craterellus sequence was available, and of 

Northern Hemisphere Cantharellus species only two, viz. C. 

cibarius, and C. cinnabarinus were included. Considering that 

C. cibarius is a frequently misapplied name, it is problematic to 

combine different sequences available from GenBank under 

this name. Thus we decided not to include it in our second data 

set. Moreover, we failed to obtain additional ATP6 sequences 

from twelve Northern Hemisphere Cantharellus species and 

two Craterellus species because of amplification problems 

and the potential occurrence of paralogs. Interestingly, the 


X 

Afrocantharellus gen. nov. 

X 

same issue did not arise during the amplification of ATP6 

from African species. In addition, we used an amalgamated 

set for Clavulina sequences, combining from GenBank for 

LSU and 5.8-ITS2 from Cl. cinerea with Clavulina sp. for 

ATP6; Dacrymyces chrysospermus served as outgroup. 

The alignments, together with the trees from the Bayesian 

analyses (Figs 2–3), have been deposited in TreeBASE 

(http://purl.org/phylo/treebase/phylows/study/TB2:S12709). 

Molecular study 

Fig. 1. Map showing the distribution 

of Miombo-woodlands in Tanzania. 

Approximate positions of collecting sites 

are marked with ‘X’. 

DNA extraction, amplification, and sequencing 

Total DNA was extracted from the inner part of the basidiomes, 

preferentially from the hymenium to avoid contamination, 

following the protocol of the Plant Genomic DNA extraction 

Kit (VIOGEN). Diluted (10 -1 – 10 -3 ) or undiluted DNA was 

used for PCR amplifications. The 5’ end of the LSU, and 5.8- 

ITS2 and ATP6 were amplified. Primers used were: (a) for 

the 5’ part of LSU: LR3 and LR5 (Vilgalys & Hester 1990), 

and forward primer LROR (http://www.biology.duke.edu/ 

fungi/mycolab/primers.htm#Large subunit RNA (25-28S) 

primer sequences) or LCa1 (primer designed for this study: 

5’–GTCCGAGTTGTAGATGAG–3’); (b) for amplification of 

5.8S-ITS2 part of ITS region see Table 2; (c) for the ATP6: 

ATP6-2 and ATP6-3 (Kretzer & Bruns 1999). 

For PCR amplification of all three regions (LSU, 5.8-ITS2, 

and ATP6) we used the AccuPower ® PCR PreMix (Bioneer, 

Daejeon, Korea), adding 3 µL diluted or undiluted DNA, 

1.5 µL of each primer (10 µM), and water to a total volume 

ARTIcLE 27

ARTIcLE 


table 1. Specimens and sequences used in this study, with their respective voucher information. GenBank accession numbers in bold 

represent sequences published here for the first time; corresponding voucher and collector numbers are provided. Other GenBank ID numbers 

represent sequences already published. 

No species voucher Locality collection no. (uPs) lsu-gB 5.8-Its2 gB AtP6-gB 

1 Afrocantharellus fistulosus DDT31 TANZANIA: Kisarawe Tibuhwa 31.2006 JQ976959 — — 

2 A. fistulosus DDT43 TANZANIA: Kisarawe Tibuhwa 43.2007 JQ976965 — — 

3 A. platyphyllus 

f. cyanescens 

DDT63 TANZANIA: Morogoro Tibuhwa 1063.2007 JQ976970 — — 


f. platyphyllus 

DDT78 TANZANIA: Iringa Tibuhwa 1078.2007 JQ976978 JQ976947 JQ976926 



DDT03 TANZANIA: Morogoro Tibuhwa 1003.2004 JQ976950 JQ976929 — 



DDT41 TANZANIA: Kisarawe Tibuhwa 1041.2006 JQ976964 — — 

7 A. splendens DDT57 TANZANIA: Morogoro Tibuhwa 1057.2007 JQ976967 JQ976937 JQ976916 

8 A. splendens DDT17 TANZANIA: Geita Tibuhwa 1017.2005 JQ976956 JQ976932 JQ976911 

9 A. symoensii DDT36 TANZANIA: Kisarawe Tibuhwa 1036.2005 JQ976961 JQ976934 JQ976914 

10 A. symoensii DDT04 TANZANIA: Morogoro Tibuhwa 1004.2005 JQ976951 — — 

11 A. symoensii DDT66 TANZANIA: Iringa Tibuhwa 1066.2007 JQ976971 JQ976940 JQ976919 

12 A. symoensii DDT11 TANZANIA: Morogoro Tibuhwa 1011.2005 JQ976953 — — 

13 A. symoensii DDT67 TANZANIA: Iringa Tibuhwa 1067.2007 JQ976972 JQ976941 JQ976920 

14 A. symoensii DDT14 TANZANIA: Geita Tibuhwa 1014.2004 JQ976955 — — 

15 Botryobasidium isabellinum AF393047 — DQ534597.1 

16 C. appalachiensis DQ898690 — — 

17 C. appalachiensis HM750916 — — 

18 C. cascadensis AY041159 — — 




22 C. cibarius var. cibarius AY041156 — — 



25 C. cibarius var. roseocanus AY041152 — — 




29 C. cibarius var. multiramis HM750920 — — 

30 C. cibarius SS574 SWEDEN: Uppland Olariaga & Felipe 

2005/503752 

JQ976981 — — 

31 C. cibarius EU522825 — — 

32 C. cibarius AJ406428 — — 

33 C. cibarius HM750927 — — 

34 C. cibarius AY745708 

35 C. cibarius DQ898693 — — 

36 C. cibarius var. longipes HM750924 — — 

37 C. cinnabarinus AY041168 — — 

38 C. cinnabarinus DQ898692 — — 

— — DQ120944 

— DQ898649 — 

39 C. congolensis DDT77 TANZANIA: Morogoro Tibuhwa 1077.2007 JQ976977 JQ976946 JQ976925 

40 C. congolensis DDT76 TANZANIA: Iringa Tibuhwa 1076.2007 JQ976976 JQ976945 JQ976924 

28 ima funGuS





41 C. densifolius DDT40 TANZANIA: Kisarawe Tibuhwa 1040.2006 JQ976963 JQ976935 JQ976915 

42 C. densifolius DDT58 TANZANIA: Morogoro Tibuhwa 1058.2006 JQ976968 JQ976938 JQ976917 

43 C. floridulus DDT33 TANZANIA: Morogoro Tibuhwa 1033.2006 JQ976960 — JQ976913 

44 C. floridulus DDT38 TANZANIA: Morogoro Tibuhwa 1038.2005 JQ976962 — — 

45 C. formosus AY041166 — — 

46 C. formosus AY041164 — — 

47 C. formosus AY041165 — — 

48 C. garnierii AY392767 — — 

49 C. garnierii AY392768 — — 

50 C. isabellinus HM750931 — — 

51 C. isabellinus DDT30 TANZANIA: Morogoro Tibuhwa 1030.2006 JQ976958 — — 

52 C. isabellinus var. parvisporus DDT12 TANZANIA: Morogoro Tibuhwa 1012.2004 JQ976954 JQ976931 JQ976910 

53 C. isabellinus var. parvisporus DDT22 TANZANIA: Geita Tibuhwa 1022.2005 JQ976957 JQ976933 JQ976912 

54 C. lateritius DQ898694 — — 

55 C. minor DQ898691 

56 C. minor HM750923 — — 

57 C. pallens SS577 SWEDEN: Uppland Danell & Olariaga 2005 JQ976984 

(503727) 

— — 

58 C. persicinus AY041169 — — 

59 C. pseudocibarius DDT02 TANZANIA: Morogoro Tibuhwa 1002.2004 JQ976949 JQ976928 JQ976908 

60 C. pseudocibarius DDT05 TANZANIA: Geita Tibuhwa 1005.2004 JQ976952 JQ976929 JQ976909 

61 C. pseudoformosus GU237071 — — 

62 C. rhodophyllus HM750925 — — 

63 C. ruber DDT60 TANZANIA: Iringa Tibuhwa 1060.2007 JQ976969 JQ976939 JQ976918 

64 C. ruber DDT45 TANZANIA: Kisarawe Tibuhwa 1045.2007 JQ976966 JQ976936 — 

65 C. subalbidus AY041148 — — 





70 C. tomentosus DDT68 TANZANIA: Morogoro Tibuhwa 1068.2007 JQ976973 JQ976942 JQ976921 

71 C. tomentosus DDT69 TANZANIA: Morogoro Tibuhwa 1069.2007 JQ976974 JQ976943 JQ976922 

72 Cantharellus sp. HM750917 — — 







79 Cantharellus sp. AJ271192 — — 

80 Cantharellus sp. AY041167 — — 


82 Cantharellus sp. 2 DDT70 TANZANIA: Morogoro Tibuhwa 1070.2007 JQ976975 JQ976944 JQ976923 

83 Cantharellus sp. 2 DDT79 TANZANIA: Morogoro Tibuhwa 1079.2007 JQ976979 JQ976948 JQ976927 

84 Clavulina cinerea AM259211 AF185974 — 

Clavulina sp. DQ120947 

85 Craterellus chantarellus. var. 

intermedius 

HM750919 — — 

ARTIcLE 29

ARTIcLE 




86 Craterellus cornucopioides AY700188 — — 

JF907967 

87 C. cornucopioides AJ279572 — — 

88 C. lutescens SS575 SWEDEN: Uppland Olariaga 2005 

(503703) 

JQ976982 — — 

89 C. lutescens EU522746 — — 

90 C. melanoxeros SS576 SWEDEN: Uppland Aronsson 2008 

(441865) 

JQ976983 — — 

91 C. sp. HM113529 — — 

92 C. tubaeformis AF287851 — 

AF385632 

— 

93 C. tubaeformis SS572 SWEDEN: Uppland Lindau 2010 JQ976980 — — 

94 C. tubaeformis DQ898741 — — 

95 Dacrymyces chrysospermus AF287855 — EU339249 

96 Hydnum rufescens AY293187 — — 

97 Multiclavula mucida AF287875 — — 

of 20 µL. For LSU, and 5.8-ITS2 the PCR thermal cycling 

parameters were as described in Savić & Tibell (2009) for 

LSU. Amplification and thermal cycling parameters for PCR 

of the ATP6 followed, with the modifications, the protocol of 

Kretzer & Bruns (1999): five cycles of 35 s at 94 °C, 55 s at 

37 °C, 1 min at 72 °C, followed by 30 cycles of 35 s at 94°C, 

55 s at 45 °C, and 1 min at 72 °C, and final elongation for 10 

min at 72 °C. Amplification products were visualized on 0.5 

% agarose gels stained with ethidium bromide and the PCR 

product was purified using Millipore plates (MultiScreen 

PCR, Danvers, MA). Sequencing, automated reaction clean 

up, and visualization were carried out as described by 

Macrogen (www.macrogen.com). 

Alignments and phylogenetic analyses 

To evaluate the phylogenetic relationship in a sample of African 

taxa, all four data sets (larger dataset of LSU, smaller dataset 

of LSU, 5.8S-ITS2, and ATP6) were aligned separately using 

MAFFT (Katoh et al. 2002, 2005) on the online server (v. 6), 

which was used to create alignments that utilized the L-INS-i 

(for LSU and ATP6) and E-INS-i (5.8-ITS2) MAFFT algorithm. 

All four alignments were generated using the default settings 

(gap opening penalty = 1.53 and offset value = 0.00). 

The first LSU dataset was submitted to the 

Cyberinfrastructure for Phylogenetic Research (CIPRES 

Science Gateway: http://www.phylo.org/) for preliminary 

analysis with RAxML v. 7.2.8 (Stamatakis 2006, Stamatakis 

table 2. Primers used for amplification of the 5.8S-ITS2 part of ITS region. 

Primer sequence 

forward ITS3C 5’–GCATCGATGAAGAACGCAGT–3’ 

reverse Lcan 5’–GTCCGAGTTGTAGATGAG–3’ 

forward 5.8Scanf 5’– CGATGAAGAACGCAGCG–3’ 

forward 5canf 5’–CATCGAGTCTTTGAACGCAAAC–3’ 

reverse LcanR 5’– ATCGAGTCTTTGAACGCAAAC–3’ 

et al. 2008). Before the final alignment, regions where 

positional homology was doubtful were excluded from the 

final alignment. 

Using the AIC implemented in JModeltest v. 0.1.1 

(Guindon & Gascuel 2003, Posada 2008), the Bayesian 

analysis employed the GTR+G model for the first dataset 

(larger LSU matrix), 5.8-ITS2 and ATP6; GTR+G+I was 

employed for smaller LSU partition (however its likelihood 

score was also very close to that of the GTR+G model). 

Before concatenation of the sequences for the second dataset 

(LSU/5.8-ITS2/ATP6), single-gene analyses were performed 

to detect significant conflicts among datasets and partitions. 

A conflict was considered significant if a well-supported 

monophyletic group, for example MLb ≥ 70 % (Mason- 

Gamer & Kellogg 1996), was found not to be well supported 

as non-monophyletic when different loci were used. Each 

single-locus alignment was analyzed separately employing 

rapid bootstrap heuristics in RAxML v. 7.2.8 (Stamatakis et al. 

2008) via a Web server available at the Vital-IT Unit at Swiss 

Institute of Bioinformatics (http://phylobench.vital-it.ch/raxmlbb/index.php), 

executing 100 rapid bootstrap replicates 

employing a GTRMIX model (switching from GAMMA to CAT 

for rapid bootstrapping); thereafter a thorough ML search 

was conducted under the GAMMA model. No significant 

incongruence among datasets was detected (data not 

shown), hence the three matrices were concatenated. After 

the exclusion of ambiguously aligned regions and introns, 

30 ima funGuS



Afrocantharellus 

AF287875 Multiclavula mucida 

AY293187 Hydnum rufescens 

DDT63 A. platyphyllus f. cyanescens 

DDT41 A. platyphyllus f. platyphyllus 



DDT17 A. splendens 


1/100/98 DDT31 A. fistulosus 

DDT43 A. fistulosus 

DDT14 A. symoensii 






AY041169 C. persicinus 

AY041167 C. sp. 

H M 750924 C. cibarius var. longipes 

D Q 898693 C. cibarius 

AJ406428 C. cibarius 

SS577 C . pallens 

AY041159 C. cascadensis 




AY041152 C. cibarius var. roseocanus 



EU 522825 C. cibarius 

AY745708 C. cibarius 


AY041150 C. subalbidus 



* A 



H M 750926 C. sp. 

H M 750918 C. sp. 

H M 750927 C. cibarius 

H M 750931 C. isabellinus 

H M 750929 C. sp. 

AY041156 C. cibarius var. cibarius 


SS574 C . cibarius 


AY041166 C. formosus 



D Q 898694 C. lateritius 

H M 750919 Cr. cantharellus var. intermedius 

H M 750930 C. sp. 

AJ271192 C. sp. 

H M 750921 C. sp. 

G U 237071 C. pseudoformosus 

H M 750916 C. appalachiensis 

DDT76 C. congolensis 


D Q 898690 C. appalachiensis 

1/80/93 

H M 750920 C. cibarius var. multiramis 

H M 750917 C. sp. 

* 

0.96/99/89 

H M 750922 C. sp. 

H M 750925 C. rhodophyllus 

D Q 898691 C. minor 

H M 750928 C. sp. 

AY041168 C. cinnabarinus 

D Q 898692 C. cinnabarinus 

H M 750923 C. minor 

AY392767 C. garnierii 

AY392768 C. garnierii 

DDT30 C. isabellinus 

DDT40 C. densifolius 

DDT58 C. densifolius 

D DT12 C. isabellinus var. parvisporus 

D DT22 C. isabellinus var. parvisporus 

DDT68 C. tomentosus 


DDT02 C. pseudocibarius 


DDT33 C. floridulus 


DDT45 C. ruber 


SS572 C . tubaeformis 

AF287851 C . tubaeformis 

D Q 898741 C . tubaeformis 

1/100/96 SS576 C . melanoxeros 

EU 522746 C. lutescens 

SS575 C. lutescens 

H M 113529 C. sp. 

AY700188 C. cornucopioides 

AJ279572 C. cornucopioides Craterellus 

0.1 

Fig. 2. Phylogenetic relationships among 92 specimens (Table 1) representing 54 taxa of cantharelloid fungi based on a Bayesian analysis of the 

large LSU dataset. The tree was rooted using Multiclavula mucida. The three support values associated with each internal branch correspond 

to PP, MPbs and MLb proportions, respectively. Branches in bold indicate a support of PP ≥ 95 % and MPbs, MLb ≥ 70 %. An asterisk on a bold 

branch indicates that this node has a support of 100 % for all support estimates. 

Cantharellus s.str. 

ARTIcLE 31

ARTIcLE 

1/90/100 

0.1 

1/94/100 

the concatenated data matrix contained 1906 unambiguously 

aligned sites. 

Phylogenetic relationships were inferred separately 

for both data sets, the first larger LSU dataset and the 

second concatenated LSU/5.8-ITS2/ATP6 dataset, based 

on Bayesian analysis. Using MrBayes v. 3.2.1 (Ronquist & 

Huelsenbeck 2005) for each analysis two parallel runs were 

carried out for two million generations. Each run included four 

chains, and trees were sampled every 100 generations; we 

stopped the runs when the average standard deviation of split 

frequencies (across different runs) was ≤ 0.01. Using relative 

burn-in the first 25 % of sampled trees were discarded. 

In order to obtain additional support values, Maximum 

parsimony (MP) analyses as well as MP bootstrapping 

(MPbs) of both data were conducted with PAUP* v. 4.0b10 

for Windows (Swofford 2002). The most parsimonious trees 

from analyses applied a heuristic search using 1000 random 

addition sequences (RAS), TBR branch swapping algorithm, 

save multiple trees, collapse zero length branches when 

maximum length is zero, gaps treated as a fifth character 

state, characters given equal weight. A bootstrap analysis 


Dacrymyces chrysospermus 

Botryobasidium isabellinum 

Clavulina sp. 

* 

* A 

Craterellus tubaeformis 

C. cornucopioides 

1/92 

1/100/93 

of 1000 replicates with five RAS per replicate, TBR branch 

swapping was then conducted. Additional support values 

for first and second data set were further estimated with 

maximum likelihood rapid bootstraping (MLb), employing 

rapid bootstrap heuristics in RAxML v. 7.2.8 as described 

above (Stamatakis et al. 2008). 

Bayesian posterior probabilities (PP) ≥ 95 %, and MPbs 

and ML bootstrapping (MLb) ≥ 70 % were considered to be 

significant. 

results 

DDT36 Afrocantharellus symoensii 

* DDT66 A. symoensii 



DDT 17 A. splendens 



DDT40 Cantharellus densifolius 

1/91 DDT58 C. densifolius 

DDT 22 C. isabellinus var. parvisporus 

1/87 DDT 12 C. isabellinus var. parvisporus 

1 DDT68 C. tomentosus 


1 1 1 DDT02 C. pseudocibarius 



* DDT70 C. sp. 2 

DDT79 C. sp. 2 

* DDT45 C. ruber 


* DDT76 C. congolensis 


C. cinnabarinus 

The LSU phylogeny 

The LSU alignment (the first data set) contained 92 sequences 

with 853 total and 269 conserved sites. A Bayesian analysis 

yielded the phylogeny presented in Fig. 2. 

Cantharellus s. lat. (clade A) is strongly supported on a 

long branch (PP=1.0; MPbs=100; MLb=100), and Craterellus 

is the sister-group of clade A (PP=1.0; MPbs=100; 

MLb=96). In clade A there are two distinct and strongly 

32 ima funGuS 

1/97 

0.85/- 

1/97/96 

0.81/- 

Craterellus 

Fig. 3. Phylogenetic relationships among 28 concatenated sequences (Table 1) representing 17 taxa of cantharelloid fungi based on a Bayesian 

analysis of a LSU/5.8-ITS2/ATP6 dataset. The tree was rooted using Dacrymyces chrysospermus. The support values associated with each 

internal branch correspond to PP, MPbs and MLb proportions, respectively. Branches in bold indicate a support of PP ≥ 95 % and MPbs, MLb ≥ 

70 %. An asterisk on a bold branch indicates that this node has a support of 100 % for all support estimates. 

Afrocantharellus 

Cantharellus s.str.

Key to the species of Afrocantharellus 



table 3. Morphological features of Afrocantharellus and Cantharellus. 

Afrocantharellus Cantharellus 

Basidiome colour always variegated Mostly uniformly coloured 

Hymenophore well-developed with thick diverging folds Poorly-developed, without folds or with thin folds but never with 

thick diverging folds 

Folds thick, blunt, always decurrent and distantly spaced Relatively thin, sharp, subdecurrent or decurrent and not distantly 

spaced 

Clamp connections Mostly absent Mostly present 

supported branches, one containing only African species 

(Afrocantharellus; PP=1.0; MPbs=100; MLb=98) and another 

with both Northern Hemisphere, African, and one New 

Caledonian species, Cantharellus s. str. (PP=0.96; MPbs=99; 

MLb=89). Species relationships within Cantharellus s. str. 

and Afrocantharellus were mostly resolved, although with 

very low support. 

The combined data set phylogeny 

The three-locus Bayesian phylogeny is presented in Fig. 3. 

Craterellus, despite missing ATP6 (the third data set) in 

the concatenated matrix, was again strongly supported 

(PP=1.0; MPbs=100; MLb=100) as the sister-group of clade 

A, Cantharellus s. lat. (PP=1.0; MPbs=100; MLb=100). All 

species in our sampling traditionally placed in Cantharellus 

(Cantharellus s. lat.) were recovered as two sister clades, 

Cantharellus s. str. and Afrocantharellus, with high support 

values (PP=1.00, MPbs=97; MLb=96 and PP=1.00, 

MPbs=100; MLb=93 respectively). 

In the phylogenies based on the first and second 

datasets (large LSU and concatenated LSU/5.8-ITS2/ 

ATP6) Cantharellus s. lat. includes two strongly supported 

subclades, Cantharellus s. str. and Afrocantharellus for all 

three support estimates (Figs 2– 3). 

Afrocantharellus, the sister-clade of Cantharellus s. 

str. in both phylogenies obtained high support, and this, 

in conjunction with the rather distinctive morphological 

characteristics of having a well-differentiated hymenophore 

with diverging folds, the variegated colour of the basidiomes 

and sometime also the stipe (Table 3, Fig. 4) support the 

recognition of Afrocantharellus at generic level. Based on 

molecular evidence and morphological features, we suggest 

emendation revised circumscription of Cantharellus to 

exclude the species closely related to C. symoensii, and the 

elevation of Cantharellus subgen. Afrocantharellus to generic 

level. 

TAXONOMY 

Afrocantharellus (Eyssart. & Buyck) Tibuhwa, gen. 

stat. nov. 


Basionym: Cantharellus subgen. Afrocantharellus Essyart. & 

Buyck, Docums Mycol. 121: 55 (2001). 

Type: Cantharellus symoensii Heinem., Bull. Jard. bot. État 

Brux. 36: 343 (1966). 

Basidiomata fleshy, variegated, vividly coloured, red to orange 

or yellowish, rarely pale; cap 3.5–18 cm diam, hymenophore 

with very well-differentiated, thick, blunt, distantly spaced and 

diverging folds, clamp connections mostly absent. 

1 Basidiomata small to large, cap 3.5–18 cm diam, stipe not compressed laterally, stuffed or solid, clamps absent ......... 2 

Basidiomata small, cap 1.5–2.5 cm diam, stipe laterally compressed and hollow, clamps present .......... 1. A. fistulosus 

2 (1) Basidiomata large and robust, cap 6–18 cm diam; uniformly orange-red; staining hands upon handling; folds yellowish 

orange; pileipellis a trichoderm ...................................................................................................... 4. A. splendens 

Basidiomata medium-sized to large; cap 3.5–12 cm diam; orange-red, but irregularly speckled with other tinges, never 

staining the hands when handled; folds bright yellow or pale yellow; pileipellis a cutis ........................................ 3 

3 (2) Basidiospores ellipsoid (Q = 1.6–2.3); folds bright yellow; cap orange-red, disrupted by pinkish tinges towards the 

margin ........................................................................................................................................... 5. A. symoensii 

Basidiospores subglobose (Q = 1.2–1.5); folds pale yellowish, no pinkish tinges towards the margin ........................... 4 

4 (3) Stipe, cap margin, and folds with glaucous or bluish tinges ......................................... 3. A. platyphyllus f. cyanescens 

Stipe, cap margin and folds without glaucous or bluish tinges ..................................... 2. A. platyphyllus f. platyphyllus 

ARTIcLE 33

ARTIcLE 

species of Afrocantharellus 

1. Afrocantharellus fistulosus (Tibuhwa & Buyck) 

Tibuhwa, comb. nov. 


(Fig. 4B) 

Basionym: Cantharellus fistulosus Tibuhwa & Buyck, 

Cryptogamie, Mycol. 29: 133 (2008). 

Type: tanzania: Coast region, Kazimzumbwi forest reserve, 

Kisarawe, 06°04’32’’ S, 039°15’56’’ E, miombo dominated 

by Brachystegia, Combretum and Julbernardia, April 2007, 

Tibuhwa D 43.2007 (UPS – holotype; isotypes: PC, UDSM 

– isotypes). 

Description: Tibuhwa et al. (2008). 

Distribution: Known only from Tanzania. 

Comments: This species is easily recognized in the field by 

its small size, yellow colour, cap with clearly brown matted 

centre, pink hymenophore composed of widely spaced folds, 

and by the smooth hollow stipe, which is slightly twisted or 

compressed. 

Other material examined: tanzania: Coast region: Kazimzumbwi 

forest reserve, Kisarawe, 06°04’32’’ S, 039°15’56’’ E, Tibuhwa D 

31.2006 (UPS, UDSM). Iringa region: Madibira forest,08°15’08’’ 

S and 35°17’21’’ E, alt. 1847 m, in Uapaca woodland, May 2007, 

Tibuhwa D 59.2007 (UPS, UDSM). 

2. Afrocantharellus platyphyllus (Heinem.) Tibuhwa, 

comb. nov. f. platyphyllus 


Basionym: Cantharellus platyphyllus Heinem., Bull. Jard. bot. 

État Brux. 36: 342 (1966). 

Type: democratic republic of congo: Elisabethville, 1932, 

De Loose 31 (BR – holotype). 

Vernacular names: Tanzania (Bena dialect): Bunyamalagata, 

Wifindi (Hehe dialect): Wisogolo. 

Basidiomata medium-sized to large. Cap 3.5–9.5 cm wide, 

deep orange crimson towards the cap centre. Folds welldeveloped, 

yellow, thick and distantly spaced, forking or 

with numerous cross–veins. Stipe 1.5–6.5 × 1–1.5 cm, solid, 

slightly attenuated toward the base and pale yellow in colour. 

Basidia clavate (44.1–)55.4(–70.0) × (5.2–)7.2(–9.2) µm (Q = 

6.6–9.2). Basidiospores subglobose, (6.3–)7.5(–8.6) × (5.0–) 

6.2(–7.1) µm (Q = 1.1–1.5). Suprapellis a cutis of 10–12 µm 

wide hyphae. Clamps none. 

Distribution: Reported from Burundi (Buyck 1994), the 

Democratic Republic of Congo (Heineman 1966), Tanzania 

(Härkönen et al. 1995, Buyck et al. 2000), and Zimbabwe 

(Sharpe & Wursten, http://www.vumba-nature.com). 

Comments: This species is quite distinct in the deep orange 

to crimson colour, especially towards the cap centre, which 


clearly contrasts with the pale bright yellow folds. In the 

field it resembles A. symoensii but lacks the pink tinge on 

the basidiomes of A. symoensii; it also differs in subglobose 

basidiospores, rather than the ellipsoid ones of A. symoensii. 

Descriptions and illustrations:Heinemann (1966) and 

Härkönen et al. (1995, 2003). 

Other material examined: tanzania: Coast region: Kisarawe, 

06°04’32’’ S, 039°15’48’’ E, Tibuhwa 1041.2006 (UPS, UDSM); 

Morogoro region: SUA forest reserve, 06°52’34’’ S, 37°67’29’ E, 

Tibuhwa 1003.2004 (UPS, PC, UDSM); Iringa region: Madibira 

forest, 08°15’08’’ S, 35°17’21’’ E, Tibuhwa 1078.2007 (UPS, UDSM); 

Vigama village, Buyck 98.126 (PC), Buyck 98.127 (PC), Buyck 

98.130 (PC). 

3. Afrocantharellus platyphyllus f. cyanescens 

(Buyck) Tibuhwa, comb. nov. 


(Fig. 4D) 

Basionym: Cantharellus cyanescens Buyck, Ubwoba: 

Champ. Comest. l’Ouest Burundi [Publ. Agricole no. 34]: 

112 (1994). 

Type: Burundi: Nyamirambo, 1994, Buyck (BR – holotype). 

Vernacular names: Tanzania (Hehe dialect): Wisogolo; (Bena 

dialect): Wifindi, Bunyamalagata. Burundi (Kirundi dialect): 

Peri Itukura. 

Basidiomata medium-sized to large. Cap 5–10 cm wide, 

in the field with conspicuous glaucous or bluish tinges on 

the orange-red cap, margin and folds especially in young 

stages, but later fading. Folds deeply decurrent, thick, blunt, 

diverging, distantly spaced, strongly meshed, bright yellow 

speckled with bluish grey tinges. Stipe 3–6 × 0.9–1.3 cm, 

smooth, solid, cylindrical, the same colour as the folds in 

the upper half while fading to grey-cream towards the base. 

Basidia clavate (45.0–)55.0(–75.0) × (5.0–)7.0(–7.5) µm (Q = 

6.3–9.8), with 2–4 spores. Basidiospores (7.5–)10.0(–10.6) × 

(5.2–)6.1(–6.5) µm (Q = 1.3–1.5), smooth, broadly ellipsoid to 

subglobulose. Suprapellis a cutis of 8.0–15 µm wide hyphae. 

Clamps none. 

Distribution: Burundi (Buyck 1994) and Tanzania (newly 

reported here). 

Comments: This taxon is recognized in the field by its fleshy 

deep orange cap interrupted by blue or glaucous tinges and 

folds which are strongly meshed and not purely yellow but 

with orange–grey tinges. These unique tinges on the cap, 

stipe and folds distinguish it from the otherwise very similar 

A. platyphyllus f. platyphyllus. 

Description: Buyck (1994). 

Other material examined: tanzania: Morogoro region: Ubenazomosi 

woodland, 06°55’11’’ S, 037°35’20’’ E, Tibuhwa 1063.2007 (UPS, 

UDSM), Tibuhwa 1056.2007 (UPS, UDSM); Coast region: Kisarawe, 

06°04’32’’ S, 039°15’56’’ E, Tibuhwa 1034.2006 (UPS, UDSM). 

34 ima funGuS

4. Afrocantharellus splendens (Buyck) Tibuhwa, 

comb. nov. 


(Fig. 4C) 

Basionym: Cantharellus splendens Buyck, Ubwoba: Champ. 

Comest. l’Ouest Burundi [Publ. Agricole no. 34]: 112 (1994). 



A B 

3 C 3 cm 

C D 

3 cm 

E F 

3 cm 2 cm 

Fig. 4. Basidiomes of Afrocantharellus and Cantharellus species showing morphological differences of the hymenophores: A. Afrocantharellus 

symoensii (Tibuhwa 1011.2005; UPS). B. A. fistulosus (holotype). c. A. splendens (DDT 1053.2011; UDSM). d. A. platyphyllus f. cyanescens 

(Tibuhwa 1063.2007; UPS). e. Cantharellus congolensis (Tibuhwa 1076.2007; UDSM). F. C. rufopunctatus (Tibuhwa 1010.2004; UDSM). All 

photos taken in Tanzania by Donatha D. Tibuhwa. 

3 cm 

2 cm 

Type: Burundi: under Brachystegia, Buyck 5518 (BR – 

holotype). 

Vernacular names: Tanzania (Nyambo dialect): Binyantuku. 

Burundi (Kirundi dialect): Peri magufa. 

ARTIcLE 35

ARTIcLE 

Basidiomata large. Cap 8–18 cm wide, bright orange-red. 

Folds thick, blunt diverging, distantly spaced, pale yellow 

with orange tinges. Stipe 2.5–7 × 1.2–3.5 cm, smooth, 

solid, subcylindrical, slightly attenuated toward the base, of 

the same colour as the cap but paling to white toward the 

base. Basidia narrowly cylindrical–clavate, (40.0–)49.7(– 

57.4) × (5.4–)6.6(–7.7) µm (Q = 6.7–9.1). Basidiospores 

ellipsoid (8.1–)9.9(–12.0) × (3.7–)4.2(–4.7) µm (Q = 2.0–2.7). 

Suprapellis a trichoderm of more or less ramified, hyphae 

5.5–8.0 µm wide. Clamps none. 

Distribution: Burundi (Buyck 1994), and Tanzania (Buyck et 

al. 2000). 

Comments: This species is easily recognized in the field 

by the large, fleshy and bright orange-red basidiomes, 

which recall those of A. symoensii and A. platyphyllus. The 

pigmentation of the cap stains the hands upon handling, and 

microscopically a trichoderm pileipellis distinguishes it from 

these other two species. 

Description: Buyck (1994). 

Other material examined: tanzania: Morogoro region: Ubenazomosi 

woodland, 06°55’11’’ S, 037°34’20’’ E, Tibuhwa 1057.2007 (UPS, 

UDSM); Mwanza region: Geita-Rwamgasa forest reserve, 03°09’50’’ 

S, 32°04’52’’ E, Tibuhwa 1017.2005 (UPS, UDSM). 

5. Afrocantharellus symoensii (Heinem.) Tibuhwa, 

comb. nov. 


(Fig. 4A) 

Basionym: Cantharellus symoensii Heinem., Bull. Jard. bot. 

État. Brux. 36: 343 (1966). 

Type: democratic republic of congo: Kasumbalesa, 1958, 

Symoens 6037 (BR – holotype). 

Vernacular names: Tanzania (Nyamwezi dialect): Mkukwe. 

(Bena dialect): Wifindi, (Hehe dialect): Wisogolo. Burundi 

(Kirundi dialect): Peri nyakeke, Peri itukura. 

Basidiomata medium-sized to large. Cap 3.5–8 cm wide, 

smooth, orange-red disrupted with pale pink and yellow 

patches especially towards the margin. Folds thick, blunt, 

diverging, distantly spaced, yellow or slightly pale. Stipe 

2.5–4 × 0.9–2 cm, smooth, solid or rarely somewhat lax at 

maturity, cylindrical but slightly wider towards the cap, of the 

same colour as the folds. Basidia clavate (38.2–)48.7(–59.3) 

× (5.0–)6.5(–8) µm (Q = 6.3–10.0). Basidiospores (7.4–) 

9.0(–10.6) × (4.5–)4.9(–5.2) µm (Q = 1.6–2.3), ellipsoid. 

Suprapellis a cutis of 7.5–10 µm wide hyphae. Clamps none. 

Distribution: Reported from Burundi (Buyck 1994), the 

Democratic Republic of Congo (Heineman 1966), Tanzania 

(Buyck et al. 2000, Härkönen et al. 1995), and Zambia 

(Eyssartier & Buyck 1998). 

Comments: This is one of the most common Afrocantharellus 

species in tropical Africa. It is easily recognized in the field 


by the fleshy orange-red cap with yellow and pink patches 

towards the margin, and the bright yellow, distantly spaced, 

thick folds. It has often been confounded with C. longisporus, 

but differs in the differently shaped spores, and in lacking 

clamp connections (Eyssartier & Buyck 1998, Buyck et al. 

2000). 

Descriptions and illustrations: Eyssartier & Buyck (1998) give 

a detailed description of the holotype, and more descriptions 

and/or illustration are found in Buyck (1994), Heinemann 

(1966), and Härkönen et al. (1995, 2003). 

Other material examined: tanzania: Morogoro region: SUA forest 

reserve, 06°51’22’’ S, 37°39’23’’ E, Tibuhwa 1004.2005 (UPS, PC, 

UDSM); Ubenazomosi woodland, 06°55’11’’ S, 37°34’20’’ E, Tibuhwa 

1011.2005 (UPS, PC, UDSM); Coast region: Kazimzumbwi forest 

reserve, S 06°04’32’’ S, 039°15’56’’ E, Tibuhwa 1007.2005 (UPS, 

PC, UDSM), Tibuhwa 1036.2005 (UPS, UDSM), Tibuhwa 1037.2006 

(UPS, UDSM); Mwanza region: Geita-Polepole forest reserve, 

02°52’29’’ S, 32°07’27’’ E, Tibuhwa 1014.2004 (UPS, PC, UDSM); 

Tabora region: Masange forest reserve, 04°59’22’’ S, 032°40’20’’ E, 

Tibuhwa 1021.2005 (UPS, UDSM); Iringa region: Madibira forest, 

Tibuhwa 1067.2007 (UPS, UDSM), Tibuhwa 1066.2007 (UPS, 

UDSM); Dar e Salaam District: bought in a market, Buyck 98.113 

(PC, UDSM); Coast region: Msanga area, near Chanika village, 

Buyck 98.011 (PC, UDSM). 

dIscussIoN 

There are no major strongly supported species group 

subclades in the LSU- phylogeny of Cantharellus s. str., 

except for a well-supported clade containing Cantharellus 

congolensis (PP=1.00; MPbs=80; MLb=93) that almost 

exclusively (apart from C. congolensis and C. garnierii) 

contains Northern Hemisphere species. Cantharellus 

congolensis (Fig. 4E) was placed in subgen. Afrogomphus 

by Eyssartier & Buyck (2001), and C. floridulus, which was 

placed in subgen. Rubrinus (Eyssartier & Buyck 2001), have 

relatively long branch-lengths, but with low support. That the 

name of the generic type species, C. cibarius, is present on 

several subclades in the LSU analysis of Cantharellus s. 

str. supports the opinion that this name may either embrace 

several cryptic species, or that many morphologically similar 

species and infraspecific taxa have been included under 

that name. Only by combining extensive molecular data 

with critical morphological studies will further elucidate the 

taxonomy and systematics of this group. 

Afrocantharellus was a strongly supported clade in the 

LSU phylogeny (Fig. 2) with only a limited variation among 

the species in the LSU region investigated. Afrocantharellus 

is, however, strongly supported in the three-gene phylogeny 

(Fig. 3) and species are reasonably well resolved, the only 

exception being A. splendens. For both specimens of A. 

splendens (DDT17 and DDT57) we managed to obtain all 

three regions (LSU/5.8-ITS2/ATP6), with ATP6 being slightly 

shorter in one, however, A. splendens is monophyletic in the 

large LSU phylogeny (Fig. 2). 

Afrocantharellus, as represented recently by C. 

platyphyllus and C. symoensii in a one-gene phylogeny (tef- 

36 ima funGuS

1) by Buyck & Hofstetter (2011) and Buyck et al. (2011), the 

clade was also distinct. In this phylogeny, which was basically 

the same in both papers, the systematic arrangement follows 

Eyssartier & Buyck (2001) although there was no support in 

the phylogeny for the lower branches. This might be due to 

the tef-1 seeming to be a slow-evolving gene, for example 

in comparison to RPB2 (Matheney et al. 2007). In our LSU 

phylogeny (Fig. 2), C. fistulosus is within Afrocantharellus. 

Although recently described from Tanzania as Cantharellus 

fistulosus (Tibuhwa et al. 2008), and also morphologically 

reported as best fitting in subgenus Parvocantharellus as 

defined by Eyssertier & Buyck (2001) and based on characters 

such as the abundance of clamp connections. However, 

molecular data place this species in Afrocantharellus, and 

thus the absence of clamp connection is not a synapomorphy 

for Afrocantharellus. The species of Afrocantharellus are 

morphologically reasonably well-characterized (Table 3), and 

a short description of the species is given in the taxonomic 

part above. It consists of species closely related to A. 

symoensii, e.g. A. platyphyllus f. platyphyllus, which in the 

field is difficult to distinguish from A. symoensii. Other taxa 

included are A. platyphyllus f. cyanescens, A. splendens, 

and A. fistulosus. Eyssartier & Buyck (2001) referred these 

species to Cantharellus subgen. Afrocantharellus, except 

for A. fistulosus. However, Afrocantharellus is characterized 

by having a well-differentiated hymenophore with diverging 

folds, and all species apart from A. fistulosus lack clamp 

connections. 

Relying only on morphological characters may be 

misleading in the study of these difficult taxa (Buyck & 

Hofstetter 2011, Buyck et al. 2011). It was obvious in our 

analyses that some species names used for sequences in 

GenBank had been misapplied, such as Cantharellus cibarius 

and C. minor. Combining morphological and molecular data, 

is clearly the best approach to make progress in the study 

of genera with a rather uniform morphology where few 

characters are available for morphological study. Moreover, 

that we do not have clear morphological synapomorphies for 

all monophylethic groups within former Cantharellus s. lat. 

should not discourage the recognition of further taxa in the 

future. 


We are grateful to Sida-SAREC, through the International Science 

Programme at Uppsala University and the Molecular Biology project 

of the University of Dar es Salaam, for financial support. We are also 

indebted to the curators of BR, PC, and UPS for placing material 

at our disposal. We are further grateful to Bart Buyck for some 

specimen identifications, and also wish to express our gratitude to 

two anonymous reviewers, and the helpful work of the editors. 

reFereNces 

Bas C (1969) Morphology and subdivision of Amanita and 

amonograph on its section Lepidella. Persoonia 5: 285–579. 

Binder M, Hibbett DS (2002) Higher-level phylogenetic relationships 

of Homobasidiomycetes (mushroom-forming fungi) inferred from 



four rDNA regions. Molecular Phylogenetics and Evolution 22: 

76–90. 

Binder M, Hibbett DS, Larsson KH, Larsson E, Langer E, Langer G 

(2005) The phylogenetic distribution of resupinate forms across the 

major clades of mushroom-forming fungi (Homobasidiomycetes). 

Systematics and Biodiversity 3: 113–157. 

Buyck B (1994) Ubwoba: Les Champignons Comestibles de 

l’Ouest du Burundi. [Publicacion Agricole no. 34.] Bruxelles: 

Administration Generale de la Cooperation au Developpement. 

Buyck B, Nzigidahera B (1995) Ethnomycological notes from western 

Burundi. Belgian Journal of Botany 128: 131–138. 

Buyck B, Hofstetter V (2008) A multigene phylogeny for worldwide 

Cantharellus. Inoculum 59: 22. 

Buyck B, Hofstetter V (2011) The contribution of tef-1 sequences 

to species delimitation in the Cantharellus cibarius complex in 

southeastern USA. Fungal Diversity 49: 35–46. 

Buyck B, Cruaud C, Couloux A, Hofstetter V (2011) Cantharellus 

texensis sp. nov. from Texas, a southern lookalike of C. 

cinnabarinus revealed by tef-1 sequence data. Mycologia 103: 

1037–1046. 

Buyck B, Eyssartier G, Kivaisi A (2000) Addition to the inventory of 

the genus Cantharellus (Basidiomycota, Cantharellaceae) in 

Tanzania. Nova Hedwigia 71: 3–4. 

Carriconde F, Gardes M, Jargeat P, Heilmann-Clausen J, 

Mouhamadou B, Gryta H (2008) Population evidence of 

cryptic species and geographical structure in the cosmopolitan 

ectomycorrhizal fungus, Tricholoma scalpturatum. Microbial 

Ecology 56: 513–524. 

Dahlman M, Danell E, Spatafora JW (2000) Molecular systematics 

of Craterellus: cladistic analyses of nuclear LSU rDNA sequence 

data. Mycological Research 104: 388–394. 

Dunham SM, Kretzer A, Pfrender ME (2003) Characterization of 

Pacific golden chanterelle (Cantharellus formosus) genet size 

using co-dominant microsatellite markers. Molecular Ecology 12: 

1607–1618. 

Eyssartier G (2003) The genus Cantharellus. PhD thesis, Muséum 

National d’Histoire Naturelle Paris. 

Eyssartier G, Buyck B (1998) Contribution à la systématique du 

genre Cantharellus en Afrique tropicale: étude de quelques 

espèces rouges. Belgian Journal of Botany 131: 139–149. 

Eyssartier G, Buyck B (2001) Nomenclatural and systematic note on 

the genus Cantharellus. Documents Mycologiques 121: 55–56. 

Eyssartier G, Buyck B, Courtecuisse R (2001) New species 

and combinations in cuboid-spored Entoloma species from 

Madagascar. Mycological Research 105: 1144–1148. 

Eyssartier G, Stubbe D, Walleyn R, Verbeken A (2009) New records 

of Cantharellus species (Basidiomycota, Cantharellaceae) from 

Malaysian dipterocarp rainforest. Fungal Diversity 36: 57–67. 

Feibelman, TP, Bayman P, Cibula WG (1994) Length variation in the 

internal transcribed spacer of ribosomal DNA in chanterelles. 


Feibelman TP, Doudrick RL, Cibula WG, Bennett JW (1997) 

Phylogenetic relationships within the Cantharellaceae inferred 

from sequence analysis of the nuclear large subunit rDNA. 


Frøslev TG, Jeppesen TS, Læssøe T, Kjøller-R (2007) Molecular 

phylogenetics and delimitation of species in Cortinarius section 

Calochroi (Basidiomycota, Agaricales) in Europe. Molecular 

Phylogenetics and Evolution 44: 217–227. 

Geml J, Laursen GA, O’Neill K, Nusbaum HC, Taylor DL (2006) 

ARTIcLE 37

ARTIcLE 

Beringian origins and cryptic speciation events in the Fly Agaric 

(Amanita muscaria). Molecular Ecology 15: 225–239. 

Guindon S, Gascuel O (2003) A simple, fast, and accurate algorithm 

to estimate large phylogenies by maximum likelihood. Systematic 

Biology 52: 696–704. 

Härkönen M, Niemelä T, Mwasumbi L (1995) Edible mushrooms of 

Tanzania. Karstenia 35 (Suppl.): 1–92. 

Härkönen M, Niemelä T, Mwasumbi L (2003) Tanzanian mushrooms: 

edible, harmful and other fungi. Norrlinia 10: 1–200. 

Heinemann P (1958) Champignons récoltes au Congo Belge par 

Madame Gossens-Fontana III. Cantharellineae. Bulletin du 

Jardin Botanique de l’Etat Bruxelles 28: 385–438. 

Heinemann P (1966) Cantharellineae du Katanga. Bulletin du Jardin 

Botanique de l’Etat Bruxelles 36: 335–352. 

Henkel TW, Meszaros R, Catherine AM, Kennedy A (2005) New 

Clavulina species from the Pakaraima Mountains of Guyana. 

Mycolological Progress 4: 343–350. 

Hey J (2006) On the failure of modern species concepts. Trends in 

Ecology & Evolution 21: 447–450. 

Hibbett DS, Donoghue MJ (2001) Analysis of character correlations 

among wood decay mechanisms, mating systems, and substrate 

ranges in homobasidiomycetes. Systematic Biology 50: 215– 

242. 

Hibbett DS, Gilbert LB, Donoghue MJ (2000) Evolutionary instability 

of ectomycorrhizal symbioses in basidiomycetes. Nature 407: 

506–508. 

Hibbett DS, Pine EM, Langer E, Langer G, Donoghue MJ (1997) 

Evolution of gilled mushrooms and puffballs inferred from 

ribosomal DNA sequences. Proceedings of the National 

Academy of Sciences, USA 94: 12002–12006. 

Katoh K, Kuma K, Toh H, Miyata T (2005) MAFFT version 5: 

improvement in accuracy of multiple sequence alignment. 

Nucleic Acids Research 33: 511–518. 

Katoh K, Misawa K, Kuma K, Miyata T (2002) MAFFT: a novel 

method for rapid multiple sequence alignment based on fast 

Fourier transform. Nucleic Acids Research 30: 3059–3066. 

Kretzer AM, Bruns TD (1999) Use of atp6 in fungal phylogenetics: 

an example from the Boletales. Molecular Phylogenetics and 

Evolution 13: 483–492. 

Larsson KH, Larsson E, Köljalg U (2004) High phylogenetic diversity 

among corticioid homobasidiomycetes. Mycological Research 

108: 983–1002. 

Mason-Gamer R, Kellogg E (1996) Testing for phylogenetic conflict 

among molecular data sets in the tribe Triticeae (Graminae). 

Systematic Biology 45: 524–545. 

Matheny PB (2005) Improving phylogenetic inference of mushrooms 

with RPB1 and RPB2 nucleotide sequences (Inocybe, 

Agaricales). Molecular Phylogenetics and Evolution 35: 1–20. 

Matheny PB, Wang Z, Binder M, Curtis JM, Lim YW, Nilsson RH, 

Hughes KW, Hofstetter V, Ammirati JF, Schoch CL, Langer GE, 

McLaughlin DJ, Wilson AW, Frøslev T, Ge ZW, Kerrigan RW, 

Slot JC, Vellinga EC, Liang ZL, Baroni TJ, Fischer M, Hosaka K, 

Matsuura K, Seidl MT, Vaura J, Hibbett DS (2007) Contributions 


of rpb2 and tef1 to the phylogeny of mushrooms and allies 

(Basidiomycota, Fungi). Molecular Phylogenetics and Evolution 

43: 430–51. 

Moncalvo JM, Nilsson RH, Koster B, Dunham SM, Bernauer T, 

Matheny PB, McLenon T, Margaritescu S, Weiß M, Garnica S, 

Danell E, Langer G, Langer E, Larsson E, Larsson KH, Vilgalys 

R (2006) The cantharelloid clade: dealing with incongruent gene 

trees and phylogenetic reconstruction methods. Mycologia 98: 

937–948. 

Nagy LG, Házi J, Vágvölgyi C, Papp T (2012) Phylogeny and species 

delimitation in the genus Coprinellus with special emphasis on 

the haired species. Mycologia 104: 254–275. 

Olariaga I, Jugo BM, García-Etxebarria K, Salcedo I (2009) Species 

delimitation in the European species of Clavulina (Cantharellales, 

Basidiomycota) inferred from phylogenetic analyses of ITS region 

and morphological data. Mycological Research 113: 1261–1270. 

Pilz D, Norvell L, Danell E, Molina R (2003) Ecology and Management 

of Commercially Harvested Chanterelle Mushrooms. [USDA 

Forest Service Technical Report no. PNW-GTR-576.] Portland, 

OR: Pacific Northwest Research Station, USDA Forest Service. 

Pine EM, Hibbett DS, Donoghue MJ (1999) Phylogenetic relationship 

of cantharelloid and clavarioid homobasidiomycetes based 

on mitochondrial and nuclear rDNA sequences. Mycologia 91: 

944–963. 

Posada D (2008) jModelTest: Phylogenetic Model Averaging. 

Molecular Biology and Evolution 25: 1253–1256. 

Ronquist F, Huelsenbeck JP (2005) MrBayes. Version 3.1 (Bayesian 

analysis of phylogeny); www.mrbayes.net 

Savić S, Tibell L (2009) Taxonomy and species delimitation in 

Sporodictyon (Verrucariaceae) in Northern Europe and the 

adjacent Arctic—reconciling molecular and morphological data. 

Taxon 58: 585–605. 

Shao S-C, Tian X-F, Liu P-G (2011) Cantharellus in southwestern 

China: a new species and a new record. Mycotaxon 116: 437– 

446. 

Sharpe C, Wursten B (2009) A preliminary list of the macrofungi 

recorded in the Vumba.www.vumba-nature.com. 

Stamatakis A (2006) RAxML-VI-HPC: maximum likelihood-based 

phylogenetic analyses with thousands of taxa and mixed models. 

Bioinformatics 22: 2688–2690. 

Stamatakis A, Hoover P, Rougemont J (2008) A Rapid Bootstrap 

algorithm for the RAxML Web-Servers. Systematic Biology 75: 

758–771. 

Swofford DL (2002) PAUP: phylogenetic analysis using parsimony 

(and other methods). Version 4.0b10. Sunderland, MA: Sinuaer 

Associates. 

Thacker JR, Henkel TW (2004) New species of Clavulina from 

Guyana. Mycologia 96: 650–657. 

Tibuhwa D, Buyck B, Kivaisi A, Tibell L (2008) Cantharellus fistulosus 

sp. nov. from Tanzania. Cryptogamie Mycologie 29: 129–135. 

Vilgalys R, Hester M (1990) Rapid genetic identification and 

mapping of enzymatically amplified ribosomal DNA from several 

Cryptococcus species. Journal of Bacteriology 172: 4238–4246. 

38 ima funGuS

doi:10.5598/imafungus.2012.03.01.05 










The identity of Cintractia disciformis: reclassification and synonymy of a 

southern Asian smut parasitic on Carex sect. Aulocystis 

Marcin Piątek 

Department of Mycology, W. Szafer Institute of Botany, Polish Academy of Sciences, Lubicz 46, PL-31-512 Kraków, Poland; corresponding 

author e-mail: m.piatek@botany.pl 

Abstract: The identity of a neglected smut fungus, Cintractia disciformis, described from Carex hirtella in the 

Western Himalaya, India is reassessed. The species is excluded from Cintractia and is confirmed as a distinct 

species of Anthracoidea. Two smuts, A. nepalensis on Carex nakaoana in Nepal, and A. haematostomae on Carex 

haematostoma in China, are similar morphologically and considered to be later heterotypic synonyms of Cintractia 

disciformis. The appropriate nomenclatural combination for this species, Anthracoidea disciformis comb. nov., is 

validated. 

Article info: Submitted: 16 March 2012; Accepted: 29 May 2012; Published: 21 June 2012. 

INtroductIoN 

The smut fungus Cintractia disciformis was originally described 

from a plant identified as Carex hirtella (sect. Aulocystis) 

collected at Nipchang in Western Himalaya, India. Cintractia 

disciformis was first invalidly introduced without the mandatory 

Latin description that was required from 1 January 1935 

until 31 December 2011 (Liro 1935). A few years later Liro 

(1939) provided the missing Latin diagnosis. The species 

has only occasionally been reported in the literature, for 

instance in connection with a second finding on Mt. Sawi in 

Indian Kashmir on a new host, Carex haematostoma (Ling 

1949), or in monographic studies on smut fungi (Zundel 1953, 

Zambettakis 1978, Piepenbring 2000, Vánky 2007a, 2012, 

Gandhe 2011). Ling (1949) and Zambettakis (1978) prepared 

descriptions of the Kashmiri specimen of Cintractia disciformis. 

Other authors have either repeated the description from the 

protologue (Zundel 1953, Gandhe 2011), or not included one 

(Piepenbring 2000, Vánky 2007a, 2012). In a monograph of 

Anthracoidea, Zambettakis (1978) proposed a new combination 

“Anthracoidea disciformis (Liro) Zambett.”, but without giving 

any indication of the basionym or any reference to the place 

of its valid publication, rendering the combination invalid (ICN, 

Art. 33.4), like all new combinations introduced in that work. 

Vánky (2012) examined the type material of Cintractia 

disciformis in H, and concluded that it was an Anthracoidea. 

However, he did not accept the species or make any transfer 

to that genus as he noted that the host Carex was not C. 

hirtella according to an annotation by I. Kukkonen on the 

specimen. Vánky commented that “without the correct name 

of the host plant it cannot be identified”. 

Two smuts with similar phenotypic characteristics 

on related hosts in Carex sect. Aulocystis in the same 

Key words: 

Anthracoidea 

Carex 

Cintractia 

Historical Collections 

Smut Fungi 

Taxonomy 

geographical area of southern Asia (Himalaya Mts) were 

described several decades later, Anthracoidea nepalensis 

on Carex nakaoana in Nepal (Kakishima & Ono 1988) and 

Anthracoidea haematostomae on Carex haematostoma 

in China (Guo 2006). These two smuts were found to 

be conspecific by Vánky & Piątek (in Vánky 2007b) and 

that treatment is followed in the monograph of Vánky 

(2012). This work aims to clarify the taxonomic status of 

Cintractia disciformis and ascertain whether it is distinct 

from or conspecific with Anthracoidea nepalensis (incl. A. 

haematostomae). 


Sori and spore characteristics were studied using dried 

herbarium material deposited in H, IBAR and “H.U.V.” 1 . The 

specimens were examined either by light microscopy (LM) 

and scanning electron microscopy (SEM) or only by light 

microscopy (LM). 

For light microscopy (LM), small pieces of sori were 

mounted in lactic acid, heated to boiling point and cooled, and 

then examined under a Nikon Eclipse 80i light microscope. 

LM micrographs were taken with a Nikon DS-Fi1 camera. 

Fifty spores were measured from each collection, using NIS- 

Elements BR 3.0 imaging software. Spore size ranges were 

assigned to one of the three groups distinguished by Savile 

(1952): (1) small-sized spores – 13–21(–23) × 9–17(–20) µm; 

1The personal collection of Kálmán Vánky, “Herbarium Ustilaginales 

Vánky” currently held at his home (Gabriel-Biel-Straße 5, D-72076 

Tübingen, Germany). 

ARTIcLE 

39

ARTIcLE 

(2) medium-sized spores – 15–25(–27) × 10–21 µm; (3) largesized 

spores – 18–33 × 13–28 µm. Unless otherwise stated, 

the spores were measured in plane view and measurements 

are adjusted to the nearest 0.5 µm. 

For scanning electron microscopy (SEM), spores taken 

directly from dried herbarium samples were dusted onto 

carbon tabs and fixed to an aluminium stub with double-sided 

transparent tape. The stubs were sputter-coated with carbon 

using a Cressington sputter-coater and viewed under a 

Hitachi S-4700 scanning electron microscope, with a working 

distance of ca. 12 mm. SEM micrographs were taken in the 

Laboratory of Field Emission Scanning Electron Microscopy 

and Microanalysis at the Institute of Geological Sciences of 

Jagiellonian University (Kraków). 

results 

Anthracoidea disciformis (Liro) M. Piątek, comb. 

nov. 


(Fig. 1) 

Basionym: Cintractia disciformis Liro, Myc. Fenn. fasc. 16, 

no. 110 (1939). 

Synonyms: Cintractia disciformis Liro, Ann. Bot. Soc. zool.bot. 

Fenn. “Vanamo” 6: 6 (1935); nom. inval. (Art. 36.1). 

Anthracoidea disciformis (Liro) Zambett., Bull. Soc. mycol. 

France 94: 166 (1978); nom. inval. (Art. 33.4). 

Anthracoidea nepalensis Kakish. & Y. Ono, in Watanabe & 

Malla, Crypt. Himal. 1: 128 (1988). 

Anthracoidea haematostomae L. Guo, Fungal Diversity 21: 

83 (2006). 

Sorus in one ovary of the inflorescence, black, ovoid, 

presumably around the achene, about 4 × 2.5 mm diam, 

composed of agglutinated spores, powdery on the surface, 

partly hidden by the perigynium and scales. Spores smallsized, 

flattened, disc-shaped, chestnut-brown to reddish 

brown, regular in shape and size, in plane view globose, 

subglobose or broadly ellipsoidal, 16.5–18.5(–19.0) × 

(13.5–)14.0–18.0 µm [av. ± SD, 17.6 ± 0.6 × 15.7 ± 1.2 µm, 

n = 50], in side view broadly ellipsoidal (8.5–)10.0–12.0 µm 

(measurements without hyaline caps), usually enclosed by 

prominent mucilaginous sheath visible as hyaline caps on 

the flattened sides, up to 1.5 µm wide; wall even, 1.5–2.0 

µm, darker than the rest of spore; surface finely papillate in 

LM, spore profile finely serrulate, surface sparsely papillate 

in SEM, papillae up to 0.3 µm high (from SEM micrographs), 

interspaces smooth. 

Specimens examined: china: Yunnan Province: Deqen, elev. 

2700 m, on Carex haematostoma, Sept. 1935, C.W. Wang 70101 

(“H.U.V.” 20090, isotype of Anthracoidea haematostomae). – India: 

Darma, Nipchang, on Carex plectobasis (as “C. hirtella”), 31 Aug. 

1884, J. F. Duthie (H s.n. – holotype of Cintractia disciformis). – 

Nepal: Bagmati Zone: Langtang, Kyangjin–Langshisa, elev. 3900 

m, on Carex haematostoma (syn. C. nakaoana), 3 Sept. 1986, Y. 

Ono 86NE-223 (IBAR 0628 – isotype of Anthracoidea nepalensis); 

elev. 3800 m, on Carex haematostoma (syn. C. nakaoana), 3 Sept. 

Piątek 

1986, Y. Ono 86NE-214 (IBAR 0619, paratype of Anthracoidea 

nepalensis); Kyangjin, elev. 3800 m, on Carex haematostoma 

(syn. C. nakaoana), 4 Sept. 1986, Y. Ono 86NE-234 (IBAR 0639 – 

paratype of Anthracoidea nepalensis). 

Hosts and distribution: On members of Carex sect. Aulocystis: 

Carex digyna, C. haematostoma (syn. C. nakaoana), and C. 

plectobasis (syn. C. hirtella). Known from China, India, and 

Nepal. 

Observations: While the host of Cintractia disciformis is 

uncertain according to the annotation by Ilkka Kukkonen 

on the holotype; re-identification of the specimen based on 

one inflorescence is difficult. However, the sedge definitely 

belongs to the section Aulocystis, and the length of perigynia 

(5.0–6.5 mm) indicates an affinity with Carex plectobasis (syn. 

C. hirtella) according to the available keys and descriptions in 

the Flora of Pakistan and Flora of China (eFloras, http://www. 

efloras.org). Guo (1994) has also reported Anthracoidea 

nepalensis on this host (as Carex hirtella). 

The host of Anthracoidea nepalensis was reported as Carex 

nakaoana, but this species is now considered synonymous 

with C. haematostoma (Chlebicki 2002). Yet another host of 

this smut is C. digyna listed in Chinese reports of A. nepalensis 

(Guo 1994, as “digyne”). The host of A. haematostomae is C. 

haematostoma. Vánky (2007b) included the European sedge 

C. sempervirens in the list of hosts of A. nepalensis; this was 

evidently a mistake, and the species was not cited as a host in 

his subsequent monograph (Vánky 2012). Carex sempervirens 

has to be excluded from the host range of A. disciformis. 

dIscussIoN 

The internal structure of the sori is one of the main 

differentiating characteristics between Anthracoidea and 

Cintractia (Kukkonen 1963, Piepenbring 2000). Unfortunately 

this feature could not be examined in the holotype of Cintractia 

disciformis without destroying the specimen. However, the 

hyaline caps on the spores preclude a placement in Cintractia 

and support an affinity to Anthracoidea. Further, species of 

Cintractia are not known to occur on Carex, nor even members 

of the Cariceae (Piątek & Vánky 2007). The internal sorus 

structure of Anthracoidea nepalensis (Fig. 2), regarded here 

as a synonym, is typical of Anthracoidea species in that the 

spores are formed on the outer surface of the achene, and not 

within the U-shaped pockets embedded in the sterile stroma, a 

character of the genus Cintractia (Kukkonen 1963, Piepenbring 

2000). This provides additional indirect evidence that Cintractia 

disciformis is a member of the genus Anthracoidea as indicated 

by Zambettakis (1978) and Vánky (2012). 

The characteristics of the holotype of Cintractia disciformis 

are included in the species description presented above and 

shown in the illustrations (Fig. 1). The morphological details 

of specimens of Anthracoidea nepalensis I examined were: 

sori globose or ovoid surrounding the achenes, about 1.5–3.0 

long and 1.5–2.5 mm wide, spores disc-shaped, chestnutbrown 

to reddish brown, globose, subglobose, rarely 

broadly ellipsoidal or somewhat subangulate, (15.0–)15.5– 

19.5(–20.5) × (12.5–)14.0–18.0(–19.0) µm, the flattened 

40 ima funGuS

sides of spores rarely enclosed by a hyaline mucilaginous 

sheath, spore wall even, 1.0–1.5(–2.0) µm, spore surface 

finely papillate, spore profile finely serrulate. The SEM 


Cintractia disciformis reassessed 

Fig. 1. Anthracoidea disciformis (H s.n. – holotype). A. The holotype material. B–c. Enlarged sorus visible from both sides of inflorescence 

respectively. d–e. Spores in LM, median and superficial views respectively. F–I. Spores with prominent hyaline mucilaginous sheath on the 

flattened sides. Note small papillae on spore surface indicated by arrows on picture F. J–K. Spores in SEM. Note remnants of mucilaginous 

sheath on surface of spores illustrated on picture J and in central part of spore illustrated on picture K. l. Ornamentation of spore in SEM. Bars: 

A–C = 5 mm, D–J = 10 µm, K = 5 µm, L = 3 µm. 

characteristics of spores of A. nepalensis (Kakishima & Ono 

1988, Chlebicki 2002) agree well with those of Cintractia 

disciformis. 

ARTIcLE 41

ARTIcLE 

The morphology of Anthracoidea haematostomae was 

investigated by Vánky & Piątek (in Vánky 2007b) to establish 

the synonymy between this species and A. nepalensis, 

although only the morphology of A. nepalensis was presented 

in the published results. However, the key morphological 

features of the material of A. haematostomae studied are: 

spores dark reddish brown, 17.5–22 × 15–20 µm; spore wall 

even, 1.5–2.5 µm thick, with hyaline caps, spore surface finely 

papillate, spore profile finely wavy. The spore ornamentation 

observed in SEM (Guo 2006) also agrees well with that of 

Cintractia disciformis. 

The morphology of Cintractia disciformis, Anthracoidea 

nepalensis and A. haematostomae is very similar, and 

the only differences concern the hyaline mucilaginous 

sheath. This sheath was less developed in the material of 

A. nepalensis, and the spores are somewhat larger and the 

spore wall slightly thicker in A. haematostomae compared 

to Cintractia disciformis. However, these minor differences 

lie within the normal variability of a single Anthracoidea 

species (Kukkonen 1963, Denchev 1991, Piątek & Mułenko 

2010, Savchenko et al. in press). Consequently, these three 

species names are considered as synonymous and the oldest 

available name, Cintractia disciformis, is therefore taken up 

as a new combination, that proposed by Zambettakis (1978) 

being invalid. 

The disc-shaped, papillate spores of Anthracoidea 

disciformis are distinctive and rarely observed in other 

Anthracoidea species that have verruculose or rarely smooth 

spores. This feature readily differentiates this smut from four 

other Anthracoidea species infecting members of Carex 

sect. Aulocystis which all have verruculose spores (viz. A. 

altera, A. misandrae, A. sempervirentis, and A. stenocarpae). 

In the entire genus, only a few other Anthracoidea species 

have disc-shaped and papillate spores, for example A. 

bistaminatae (Guo 2006), A. lindebergiae (Vánky 1994), 

A. mulenkoi (Piątek 2006), A. pygmaea (Guo 2002), A. 

royleanae (Guo 2006), A. setschwanensis (Guo 2007), 

A. smithii (Vánky 2007a), and A. xizangensis (Guo 2005), 

all of which infect Kobresia. Interestingly, most of these 

Piątek 

Fig. 2. Internal sorus structure of Anthracoidea nepalensis (IBAR 0619). A. Transverse section through the sorus. B. Enlarged area close to 

the achene surface. Abbreviations: n – rudimentary achene, e – dark layer of the remnants of the achene epidermis, h – layer of sporogeneous 

hyphae, s – layer of young hyaline spores, m – layer of gradually maturing dark spores. Bars: A = 20 µm, B = 10 µm. 

Anthracoidea species occur in eastern and southern Asia. 

An exception is A. lindebergiae, which is widely distributed 

in arctic and alpine ecosystems of the Northern Hemisphere. 

Whether these Anthracoidea species are closely related and 

have evolved from a common ancestor is unclear and open 

to future studies. 

This study demonstrates that a critical evaluation of 

historical names could prevent an unnecessary proliferation 

of names proposed for the same organism. Such taxonomical 

expertise appears even more urgent in the light of molecular 

initiatives, especially DNA Barcoding (Seifert 2008, Begerow 

et al. 2010, Schoch et al. 2012). In order to be most effective 

the molecular studies should be accompanied by a critical 

reassessment of as many historical names of fungal species 

as possible that can be linked to freshly collected specimens 

for use in molecular analyses (Lücking 2008, Hyde et al. 

2010). 


I thank the curators of H, “H.U.V.” and IBAR for the loan of 

specimens, Anna Łatkiewicz (Kraków, Poland) for her help with 

the SEM micrographs, and David L. Hawksworth (Madrid, Spain 

/ London, UK) and Roger G. Shivas (Dutton Park, Australia) for 

helpful comments on the manuscript. This study was supported by 

the Polish Ministry of Science and Higher Education (grant no. 2 

P04G 019 28). 

reFereNces 

Begerow D, Nilsson H, Unterseher M, Maier W (2010) Current state 

and perspectives of fungal DNA barcoding and rapid identification 

procedures. Applied Microbiology and Biotechnology 87: 99– 

108. 

Chlebicki A (2002) Two cypericolous smut fungi (Ustilaginomycetes) 

from the Thian Shan and their biogeographic implications. 

Mycotaxon 83: 279–286. 

42 ima funGuS

Denchev CM (1991) Genus Anthracoidea Bref. (Ustilaginales) in 

Bulgaria – species and morphometric variability of the teliospores. 

Fitologija 41: 51–60. 

Gandhe RV (2011) Ustilaginales of India. Dehra Dun: Bishen Singh 

Mahendra Pal Singh. 

Guo L (1994) Anthracoidea and allied genera in China (Ustilaginales). 

Mycosystema 7: 89–104. 

Guo L (2002) Two new species of Ustilaginomycetes and a species 

new to China. Mycotaxon 82: 147–150. 

Guo L (2005) Two new species of Anthracoidea (Ustilaginales) from 

China. Mycotaxon 94: 47–50. 

Guo L (2006) Six new species of Anthracoidea (Ustilaginales) from 

China. Fungal Diversity 21: 81–92. 

Guo L (2007) Anthracoidea setschwanensis sp. nov. (Ustilaginales) 

and a new record of Anthracoidea from China. Mycotaxon 99: 

227–230. 

Hyde KD, Abd-Elsalam K, Cai L (2010) Morphology: still essential in 

a molecular world. Mycotaxon 114: 439–451. 

Kakishima M, Ono Y (1988) Three species of smut fungi 

(Ustilaginales) from Nepal. In: Cryptogams of the Himalayas. 

Vol. 1. The Kathmandu Valley (M Watanabe, SB Malla, eds): 

127–132. Tsukuba: National Science Museum. 

Kukkonen I (1963) Taxonomic studies on the genus Anthracoidea 

(Ustilaginales). Annales Botanici Societatis Zoologicae Botanicae 

Fennicae ‘Vanamo’ 34(3): 1–122. 

Ling L (1949) Taxonomic notes on Asiatic smuts. – I. Sydowia 3: 

123–134. 

Liro JI (1935) Über neue, seltene und vermeinte Ustilagineen. 

Annales Botanici Societatis Zoologicae Botanicae Fennicae 

‘Vanamo’ 6(1): 1–18. 

Liro JI (1939) Mycotheca fennica. Die Etiketten. No. 301–600. 

Helsinki. 

Lücking R (2008) Taxonomy: a discipline on the brink of extinction. 

Are DNA barcode scanners the future of biodiversity research? 

Archives des Sciences 61(2): 75–88. 

Piątek M (2006) Anthracoidea mulenkoi (Ustilaginomycetes), a new 

cypericolous smut fungus from Pakistan. Nova Hedwigia 83: 

109–116. 


Cintractia disciformis reassessed 

Piątek M, Mułenko W (2010) The calcareous mires in South-East 

Poland are home to two rare Anthracoidea species. Acta 

Mycologica 45: 175–184. 

Piątek M, Vánky K (2007) Cintractia bulbostylidicola sp. nov. 

(Ustilaginomycotina) from North America. Nova Hedwigia 85: 

187–194. 

Piepenbring M (2000) The species of Cintractia s.l. (Ustilaginales, 

Basidiomycota). Nova Hedwigia 70: 289–372. 

Savchenko KG, Lutz M, Piątek M, Heluta VP, Nevo E. (in press) 

Anthracoidea caricis-meadii is a new North American smut 

fungus on Carex sect. Paniceae. Mycologia. 

Savile DBO (1952) A study of the species of Cintractia on Carex, 

Kobresia, and Scirpus in North America. Canadian Journal of 

Botany 30: 410–435. 

Seifert KA (2008) Integrating DNA Barcoding into the Mycological 

Sciences. Persoonia 21: 162–166. 

Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque 

CA, Chen W, Fungal Barcoding Consortium (2012) Nuclear 

ribosomal internal transcribed spacer (ITS) region as a universal 

DNA barcode marker for Fungi. Proceedings of the National 


Vánky K (1994) European Smut Fungi. Stuttgart: G. Fischer Verlag. 

Vánky K (2007a) Smut fungi of the Indian Subcontinent. Polish 

Botanical Studies 26: 1–265. 

Vánky K (2007b) Taxonomic studies on Ustilaginomycetes – 27. 

Mycotaxon 99: 1–70. 

Vánky K (2012) Smut Fungi of the World. St Paul, MN: American 

Phytopathological Society Press. 

Zambettakis C (1978) Les Anthracoidea des Carex et les Ustilaginées 

aberrantes. Bulletin de la Société Mycologique de France 94: 

109–260. 

Zundel GL (1953) The Ustilaginales of the world. Pennsylvania State 

College School of Agriculture Department of Botany Contribution 

176: xi+1–410. 

ARTIcLE 43

ARTIcLE 

ima funGuS

doi:10.5598/imafungus.2012.03.01.06 

INtroductIoN 

Eucalyptus species are mostly native to Australia, but have 

been widely planted in the tropics and Southern Hemisphere. 

This is because they are adapted to a wide range of different 

environments and are typically fast growing. It has further 

been suggested that the success of these trees as non– 

natives is due to the separation from their natural enemies 

(Wingfield et al. 2008, Roux & Wingfield 2009). The potential 

threat of pests and pathogens to the sustainability of eucalypt 

plantations in areas where they are not native is consequently 

great and of substantial concern to forestry industries globally 

(Old et al. 2003, Wingfield et al. 2008). 

In order to understand and manage the threat of pests and 

pathogens to Eucalyptus species grown as non-natives and 

in plantations, tree health surveys are undertaken regularly. 

Amongst the pathogens that have been found on these trees, 

a Ceratocystis sp. in the C. fimbriata s. lat. complex causes 

serious disease problems in Brazil, the Republic of Congo, 

Uganda, and Uruguay (Laia et al. 1999, Roux et al. 2000, 

2001, 2004, Barnes et al. 2003a). Various other Ceratocystis 

species in the C. fimbriata s. lat. complex have also been 

found on naturally occurring or artificially induced wounds on 

the stems of trees, in various parts of the world. Some of 

these have been shown to be cryptic taxa that have been 

provided with names (van Wyk et al. 2007, 2008, 2010a, 

Rodas et al. 2007, Heath et al. 2009, Kamgan Nkuekam et 

al. 2012). Several species are thought to be pathogens, while 









the role of others in tree health is not known. 

The genus Ceratocystis comprises a diverse group of 

fungi, including saprophytes causing blue-stain of lumber and 

serious pathogens that cause mortality (Kile 1993). The genus 

is typified by C. fimbriata s. str. that is a pathogen restricted to 

root crops, specifically sweet potato (Engelbrecht & Harrington 

2005). Ceratocystis fimbriata s. lat. represents a diverse 

assemblage of isolates, some of which have been treated 

as distinct taxa defined based on phylogenetic inference, 

morphological differences, and mating behaviour (Barnes 

et al. 2001, Engelbrecht & Harrington 2005, Johnson et al. 

2005, van Wyk et al. 2007, 2008, Heath et al. 2009). However, 

Ferreira et al. (2010) treated some isolates of the C. fimbriata s. 

lat. complex from Brazil as representing a particular population 

of C. fimbriata s. str., rather than as discrete taxa. 

Global surveys of the health of Eucalyptus species in 

plantations have yielded a large collection of isolates that can 

loosely be accommodated in the C. fimbriata s. lat. complex. 

The aim of this study was to characterise these isolates 

and to consider patterns in their distribution on Eucalyptus 

species worldwide. 



Ceratocystis eucalypticola sp. nov. from Eucalyptus in south Africa and 

comparison to global isolates from this tree 

Marelize van Wyk 1 , Jolanda Roux 2 , Gilbert Kamgan Nkuekam 2 , Brenda D. Wingfield 1 , and Michael J. Wingfield 1 

1Department of Genetics, Tree Protection Co-operative Programme (TPCP), Forestry and Agricultural Biotechnology Institute (FABI), University 

of Pretoria, Private Bag X20, Hatfield, Pretoria 0028, Pretoria, South Africa 

2Department of Microbiology and Plant Pathology, DST/NRF Centre of Excellence in Tree Health Biotechnology, Forestry and Agricultural 

Biotechnology Institute (FABI), University of Pretoria, Private Bag X20 Hatfield, Pretoria 0028, Pretoria, South Africa; corresponding author 

e-mail: Jolanda.roux@fabi.up.ac.za 

Abstract: Eucalyptus trees, mostly native to Australia, are widely planted in the tropics and Southern Hemisphere 

for the production of wood and pulp. Worldwide surveys of diseases on these trees have yielded a large collection 

of Ceratocystis isolates from dying trees or from wounds on their stems. The aim of this study was to characterise 

these isolates and to consider their relatedness to each other. Culture appearance, morphological features and 

a distinctive fruity odour in all cultures were typical of species in the Ceratocystis fimbriata sensu lato (s. lat.) 

complex. Phylogenetic analyses of sequences for the combined ITS, βt-1 and TEF1-α gene regions revealed a 

genetically diverse group of isolates residing in a single large clade, that were distinct from all other species in 

the C. fimbriata s. lat. complex. Based on morphology and phylogenetic inference, the Eucalyptus isolates are 

recognised as closely related. The South African isolates are described here as a new species, C. eucalypticola. 

Article info: Submitted: 20 March 2012; Accepted: 1 May 2012; Published: 21 June 2012. 

Key words: 

canker stain diseases 

Microascales 

tree pathogens 

wounds 

Isolates 

Isolates used in this study were obtained from: (1) artificially 

induced wounds on the stems of Eucalyptus trees in South 

ARTIcLE 

45

ARTIcLE 

Africa, Thailand, and Indonesia (Table 1). The isolates were 

obtained by directly transferring spore masses from the 

apices of ascomata produced on the wounded inner bark 

and wood to agar plates. When sporulating structures were 

absent, the wood samples were placed in moist chambers 

to enhance sporulation. Spore masses were transferred to 

2 % Malt Extract Agar (MEA) in Petri dishes and incubated at 

room temperature. Additionally, the carrot baiting technique 

was used to obtain isolates (Moller & DeVay 1968). (2) 

cultures were sourced from the culture collection (CMW) of 

the Forestry and Agricultural Biotechnology Institute (FABI) 

at the University of Pretoria, South Africa. These isolates had 

previously been identified as representing the C. fimbriata 

s. lat. complex and were from diseased Eucalyptus trees in 

various parts of the world including Brazil, Uganda, Congo, 

and Uruguay (Table 1). 

Pcr and sequencing reactions 

DNA was extracted from all isolates as described by van Wyk 

et al. (2006a). Three gene regions were selected for PCR 

amplification, including ITS1 and ITS2, including the 5.8S 

rDNA operon, part of the beta-tubulin (βt-1) gene, and part of 

the Transcription Elongation Factor-1 alpha (TEF1-α) gene 

region. The reactions and programme for amplification were 

as described by van Wyk et al. (2006b). The primers utilized 

were ITS1 and ITS4 (White et al. 1990), βt1a and βt1b (Glass 

& Donaldson 1995), and EF1F and EF1R (Jacobs et al. 2004). 

Sequencing reactions were set up and run as described 

by van Wyk et al. (2006a). Sequences of the isolates from 

Eucalyptus were analysed with Chromas Lite 2.01 (http:// 

www.technelysium.com.au). These sequences as well as 

those for all species in the C. fimbriata s. lat. species complex 

(Table 1) were aligned using MAFFT (http://timpani.genome. 

ad.jp/%7emafft/server/) (Katoh et al. 2002). All sequences 

derived from this study have been deposited in GenBank 

(Table 1). 

combined gene tree for all described species 

in the C. fimbriata s. lat. complex 

Representative isolates of all described species in the C. 

fimbriata s. lat. complex were included in this dataset, including 

those obtained for this study from CMW. The sequences of 

three gene regions (ITS, βt-1 and TEF1-α) were combined 

and a partition homogeneity test (PHT) was used to determine 

if the data from the three regions could be combined, using 

the software programme PAUP v. 4.0b10 (Swofford 2002). 

Settings in PAUP were as described in van Wyk et al. (2010a). 

Ceratocystis virescens was selected as the outgroup taxon. 

MrModeltest2 (Nylander 2004) was used to determine the 

most appropriate model of nucleotide substitution for each of 

the three gene regions, respectively. These models were then 

included in the Bayesian analyses using MrBayes (Ronquist 

& Huelsenbeck 2003). The Bayesian analyses were run as 

described in van Wyk et al. (2010a). 

combined and separate gene trees of unnamed 

Ceratocystis fimbriata s. lat. isolates 

obtained from Eucalyptus 

This dataset consisted only of Ceratocystis fimbriata s. 

lat. isolates from Eucalyptus trees and that have not yet 

van Wyk et al. 

been described as separate species. A closely related and 

previously described species, C. colombiana, also obtained 

from Eucalyptus, was included as an outgroup. This was 

done to determine whether these isolates represent one 

group with no separate grouping or whether geographical 

grouping exists, as has been documented in C. fimbriata s. 

lat. (Engelbrecht & Harrington 2005, Ferreira et al. 2010). 

Models were obtained for each of the ITS, βt-1 and TEF1-α 

gene regions with the use of MrModeltest2 (Nylander 2004). 

Consistent with both the first datasets, these models were 

incorporated into MrBayes (Ronquist & Huelsenbeck 2003) 

in order to run Bayesian analyses. 

Utilising the C. fimbriata s. lat. isolates from Eucalyptus 

trees obtained from the CMW culture collection, the Molecular 

Evolutionary Genetics Analysis software (MEGA) 4 (Tamura 

et al. 2007) was used to determine the amount of variation 

for each gene region. The three gene regions were inspected 

to determine the number of fixed alleles between them. Allele 

trees were drawn using the software TCS (Clement et al. 

2000) from the combined dataset for the Eucalyptus isolates, 

including the closely related species C. colombiana, known 

only from Eucalyptus. 

Culture characteristics and morphology 

Two isolates of Ceratocystis fimbriata s. lat. from Eucalyptus 

were selected from each country, other than Brazil, for which 

only one Eucalyptus isolate was available. These were used 

to describe morphological characteristics. Isolates were 

transferred to each of five 2 % Malt Extract Agar (MEA) plates 

and incubated in the dark. The isolates were incubated at 

30 ºC for 7 d, after which the growth was assessed. 

Microscopic examinations were made of isolates from 

Indonesia, Uruguay, Thailand, and South Africa. Isolates from 

other countries were excluded because the cultures did not 

produce ascomata. All taxonomically informative structures 

were measured from 10 d old cultures on 2 % MEA, mounted 

in lactic acid. Ten measurements were made for each of the 

two isolates from Indonesia, Uruguay, Thailand, and South 

Africa. 

A preliminary study of isolates representing the larger 

collection of C. fimbriata s. lat. isolates from Eucalyptus, and 

nested together in the same phylogenetic clade, showed 

that they are morphologically very similar. Consequently, 

four isolates (CMW 9998, CMW 15054, CMW 10000 and 

CMW 11536) from Eucalyptus in South Africa were selected 

for more detailed study. These South African isolates were 

transferred to five 2 % MEA plates each and incubated at 

seven different temperatures. These temperatures included 

4 ºC and six temperatures between 10 ºC and 35 ºC at 5 ºC 

intervals. Growth was assessed after 7 d of incubation in the 

dark. Colony colour was assessed for the same isolates used 

as in the growth studies, grown on 2 % MEA for seven to 10 

d at room temperature (25 ºC). The colour charts of Rayner 

(1970) were used for descriptions of colony colour. 

Fifty measurements were made of all taxonomically 

informative characters for isolate CMW 11536 from 

Eucalyptus in South Africa. An additional ten measurements 

were made of these structures for isolates CMW 9998 and 

CMW 10000 and CMW 15054. The minimum, maximum, 

average and standard deviation (stdv) was calculated for the 

46 ima funGuS

table 1. Isolates of Ceratocystis fimbriata s. lat. spp. used in this study. 


Ceratocystis eucalypticola sp. nov. 

species Isolate no. genBank accession no. host Area 

C. albifundus CMW4068 DQ520638, EF070429, EF070400 Acacia mearnsii South Africa 

C. albifundus CMW5329 AF388947, DQ371649, EF070401 Acacia mearnsii Uganda 

C. atrox CMW19383, CBS120517 EF070414, EF070430, EF070402 Eucalyptus grandis Australia 

C. atrox CMW19385, CBS120518 EF070415, EF070431, EF070403 Eucalyptus grandis Australia 

C. cacaofunesta CMW15051, CBS152.62 DQ520636, EF070427, EF070398 Theobroma cacao Costa Rica 

C. cacaofunesta CMW14809, CBS115169 DQ520637, EF070428, EF070399 Theobroma cacao Ecuador 

C. caraye CMW14793, CBS114716 EF070424, EF070439, EF070412 Carya cordiformis USA 

C. caraye CMW14808, CBS115168 EF070423, EF070440, EF070411 Carya ovata USA 

C. colombiana CMW9565, CBS121790 AY233864, AY233870, EU241487 Soil Colombia 

C. colombiana CMW5751, CBS121792 AY177233, AY177225, EU241493 Coffea arabica Colombia 

C. colombiana CMW9572 AY233863, AY233871, EU241488 Mandarin Colombia 

C. eucalypticola cMw9998, cBs124017 FJ236721, FJ236781, FJ236751 Eucalyptus sp. south Africa 



C. eucalypticola cMw12663 FJ236724, FJ236784, FJ236754 Eucalyptus sp. south Africa 


C. fimbriata s. str. CMW15049, CBS141.37 DQ520629, EF070442, EF070394 Ipomaea batatas USA 

C. fimbriata s. str. CMW1547 AF264904, EF070443, EF070395 Ipomaea batatas Papua New Guinea 

C. fimbriatomima CMW24174, CBS121786 EF190963, EF190951, EF190957 Eucalyptus sp. Venezuela 

C. fimbriatomima CMW24176, CBS121787 EF190964, EF190952, EF190958 Eucalyptus sp. Venezuela 

C. larium CMW25434, CBS122512 EU881906, EU881894, EU881900 Styrax benzoin Indonesia 

C. larium CMW25435, CBS122606 EU881907, EU881895, EU881901 Styrax benzoin Indonesia 

C. manginecans CMW13851, CBS121659 AY953383, EF433308, EF433317 Mangifera indica Oman 

C. manginecans CMW13852, CBS121660 AY953384, EF433309, EF433318 Hypocryphalus mangifera Oman 

C. neglecta CMW17808, CBS121789 EF127990, EU881898, EU881904 Eucalyptus sp. Colombia 

C. neglecta CMW18194, CBS121017 EF127991, EU881899, EU881905 Eucalyptus sp. Colombia 

C. obpyriformis CMW23807, CBS122608 EU245004, EU244976, EU244936 Acacia mearnsii South Africa 

C. obpyriformis CMW23808, CBS122511 EU245003, EU244975, EU244935 Acacia mearnsii South Africa 

C. papillata CMW8857 AY233868, AY233878, EU241483 Annona muricata Colombia 

C. papillata CMW8856, CBS121793 AY233867, AY233874, EU241484 Citrus lemon Colombia 

C. papillata CMW10844 AY177238, AY177229, EU241481 Coffea arabica Colombia 

C. pirilliformis CMW6569 AF427104, DQ371652, AY528982 Eucalyptus nitens Australia 

C. pirilliformis CMW6579, CBS118128 AF427105, DQ371653, AY528983 Eucalyptus nitens Australia 

C. platani CMW14802, CBS115162 DQ520630, EF070425, EF070396 Platanus occidentalis USA 

C. platani CMW23918 EF070426, EF070397, EU426554 Platanus sp. Greece 

C. polychroma CMW11424, CBS115778 AY528970, AY528966, AY528978 Syzygium aromaticum Indonesia 

C. polychroma CMW11436, CBS115777 AY528971, AY528967, AY528979 Syzygium aromaticum Indonesia 

C. polyconidia CMW23809, CBS122289 EU245006, EU244978, EU244938 Acacia mearnsii South Africa 

C. polyconidia CMW23818, CBS122290 EU245007, EU244979, EU244939 Acacia mearnsii South Africa 

C. populicola CMW14789, CBS119.78 EF070418, EF070434, EF070406 Populus sp. Poland 

C. populicola CMW14819, CBS114725 EF070419, EF070435, EF070407 Populus sp. USA 

C. smalleyi CMW14800, CBS114724 EF070420, EF070436, EF070408 Carya cordiformis USA 

C. smalleyi CMW26383, CBS114724 EU426553, EU426555, EU426556 Carya cordiformis USA 

C. tanganyicensis CMW15991, CBS122295 EU244997, EU244969, EU244929 Acacia mearnsii Tanzania 

C. tanganyicensis CMW15999, CBS122294 EU244998, EU244970, EU244939 Acacia mearnsii Tanzania 

C. tsitsikammensis CMW14276, CBS121018 EF408555, EF408569, EF408576 Rapanea melanophloeos South Africa 

C. tsitsikammensis CMW14278, CBS121019 EF408556, EF408570, EF408577 Rapanea melanophloeos South Africa 

C. variospora CMW20935, CBS114715 EF070421, EF070437, EF070409 Quercus alba USA 

C. variospora CMW20936, CBS114714 EF070422, EF070438, EF070410 Quercus robur USA 

C. virescens CMW11164 DQ520639, EF070441, EF070413 Fagus americanum USA 

ARTIcLE 47

ARTIcLE 



species Isolate no. genBank accession no. host Area 

C. virescens CMW3276 AY528984, AY528990, AY529011 Quercus robur USA 

C. zombamontana CMW15235 EU245002, EU244974, EU244934 Eucalyptus sp. Malawi 

C. zombamontana CMW15236 EU245000, EU244972, EU244932 Eucalyptus sp. Malawi 

Ceratocystis sp. cMw4797 FJ236733, FJ236793, FJ236763 Eucalyptus sp. congo 

Ceratocystis sp. cMw4799 FJ236734, FJ236794, FJ236764 Eucalyptus sp. congo 

Ceratocystis sp. cMw4902 FJ236715, FJ236775, FJ236745 Eucalyptus sp. Brazil 

Ceratocystis sp. cMw5312 FJ236731, FJ236791, FJ236761 Eucalyptus sp. uganda 

Ceratocystis sp. cMw5313 FJ236732, FJ236792, FJ236762 Eucalyptus sp. uganda 

Ceratocystis sp. cMw7764 FJ236726, FJ236786, FJ236756 Eucalyptus sp. Uruguay 





Ceratocystis sp. cMw14631 FJ236744, FJ236804, FJ236774 Eucalyptus sp. Indonesia 


Ceratocystis sp. cMw16008 FJ236735, FJ236795, FJ236765 Eucalyptus sp. thailand 








table 2. The number of differences observed between the sequences of the isolates from Eucalyptus (C. fimbriata s. lat.) from Brazil, South 

Africa, Uruguay, Uganda, Congo, Thailand, Indonesia, and C. colombiana. 

Country Brazil south Africa Uruguay uganda congo thailand Indonesia C. colombiana 

gene region 

Its 

Brazil – 9 0 6 13 0 0 23 

South Africa 9 8 6 6 0 4 9 21 

Uruguay 0 6 4 7 9 0 0 21 

Uganda 6 6 7 0 9 0 7 28 

Congo 13 0 9 9 0 6 11 25 

Thailand 0 4 0 0 6 7 0 20 

Indonesia 0 9 0 7 11 0 1 22 

C. colombiana 

βt 

23 21 21 28 25 20 22 1 

Brazil – 0 0 0 0 0 0 3 

South Africa 0 1 0 0 0 0 0 3 

Uruguay 0 0 0 0 0 0 0 3 

Uganda 0 0 0 0 0 0 0 3 

Congo 0 0 0 0 0 0 0 3 

Thailand 0 0 0 0 0 0 0 3 

Indonesia 0 0 0 0 0 0 0 3 

C. colombiana 

teF 

3 3 3 3 3 3 3 0 

Brazil – 13 9 12 12 12 12 21 

48 ima funGuS

measurements of each structure and these are presented in 

this study as; (minimum-) stdv minus the mean – stdv plus 

the mean (-maximum). 

results 

Isolates 

Twenty-five isolates obtained from CMW that had been 

isolated from Eucalyptus trees were included in this study 

(Table 1). Fifteen of these originated from natural or artificially 

induced wounds on trees in three countries, South Africa, 

Thailand, and Indonesia. In addition, ten of the isolates were 

from trees that are believed to have been killed by the fungus. 

The latter isolates were from Brazil, Congo, Uganda, and 

Uruguay. 

Pcr and sequencing reactions 

Results were obtained for three separate datasets. The 

first provided a broad phylogenetic placement (i.e. Latin 

American or North American, Asian, and African clade) of the 

C. fimbriata s. lat. isolates from Eucalyptus. A more focussed 

analysis determined whether these isolates could be linked to 

any of the previously described species in the C. fimbriata s. 

lat. complex that were obtained from Eucalyptus. Thereafter, 

the isolates from Eucalyptus apparently representing 

undescribed species were considered in combined as well 

as single gene trees generated from the sequence data for 

these isolates. This was to determine whether they could be 

grouped based on geographical origin. 

combined gene tree for all described species 

in the Ceratocystis fimbriata s. lat. complex 

Amplicons for the three gene regions were on average 500 

bp for the ITS and βt-1 gene regions and 800 bp for the 

TEF1-α region (Table 1). The PHT for the data set including 

all described species in the C. fimbriata s. lat. complex, had 

a low value (P=0.01), but could be combined (Cunningham 

1997). 

Of the 1 989 characters in this dataset, 1 102 were 

constant, 45 were parsimony uninformative while 842 were 

parsimony informative. One hundred and forty two most 

parsimonious trees were obtained, of which one was selected 

for presentation (Fig. 1). The tree topology was as follows: 

Tree length (TL) = 2054 steps, Consistency Index (CI) = 0.7, 

Retention Index (RI) = 0.9 and Rescaled Consistency (RC) = 




Country Brazil south Africa Uruguay uganda congo thailand Indonesia C. colombiana 

gene region 

South Africa 13 7 0 0 0 0 0 8 

Uruguay 9 9 9 0 0 0 0 7 

Uganda 12 0 0 7 0 0 0 6 

Congo 12 0 0 0 0 0 0 8 

Thailand 12 0 0 0 0 1 0 8 

Indonesia 12 0 0 0 0 0 5 8 

C. colombiana 21 8 7 6 8 8 8 0 

0.6. Phylogenetic analyses revealed a clade specific for the 

isolates from Eucalyptus (Fig. 1). Isolates in this large clade 

had high bootstrap (88 %) and Bayesian (88 %) support and 

included some substructure (Fig. 1). The substructure in the 

large clade for the isolates from Eucalyptus was not strongly 

supported and these isolates were treated as reflecting a 

single group of genetically related, but not identical isolates. 

The closest phylogenetic relative of the isolates in the 

Eucalyptus clade was C. colombiana (van Wyk et al. 2010a). 

The models obtained using MrModeltest2 were the 

HKY+I+G model for both the ITS and the TEF1-α genes and 

the GTR+G model for the βt-1 gene region. Including these 

models in the Bayesian analyses resulted in a burnin of 7000. 

These 7000 trees were discarded from the final analyses. The 

posterior probabilities obtained with the Bayesian analyses 

supported the bootstrap values obtained in PAUP (Fig. 1). 

combined and separate gene trees for 

undescribed Ceratocystis fimbriata s. lat. 

isolates from Eucalyptus 

In the dataset for the combined gene regions, there were 1 765 

characters of which 1 680 were constant, 31 were parsimony 

uninformative while 54 were parsimony informative. Twentyfour 

most parsimonious trees were obtained, one of which 

was selected for presentation (Fig. 2). The tree topology was 

as follows: TL = 107 steps, CI = 0.8, RI = 0.9 and RC = 0.7. 

One well-supported clade (100 % bootstrap, 100 % Bayesian) 

was observed with high variation. Three clades that were 

supported within this large clade were also observed (Fig. 2). 

The models obtained for this dataset were the HKY model for 

the ITS gene, the F81 model for the βt-1 gene region and the 

HKY+I model for the TEF1-α gene region. A burn-in of 1000 

was obtained and these 1000 trees were discarded from the 

final analyses. The posterior probabilities obtained with the 

Bayesian analyses supported the bootstrap values obtained 

with PAUP (Fig. 2). 

Three well-supported clades were observed; the first 

included Asian (Indonesia and Thailand) and South American 

(Brazil and Uruguay) isolates; the second clade included 

African (Republic of Congo and South Africa) isolates while 

the third clade included African (Uganda) and Asian (Thailand) 

isolates. The previously described species, C. colombiana, 

grouped apart from these three clades (Fig. 2). 

Where the data were treated separately, the trees for the 

ITS, βT and TEF1-α gene regions had a different topology 

when compared with those for the combined gene regions 

ARTIcLE 49

ARTIcLE 

CMW11164 C. virescens 

CMW3276 C. virescens 

50 


100(100) CMW15049 C. fimbriata s. str. 

CMW1547 C. fimbriata s. str. 

100(100) CMW9565 C. colombiana 

CMW9572 C. colombiana 


CMW4902 Eucalyptus Brazil 

CMW7764 Eucalyptus Uruguay 




CMW9998 Eucalyptus South Africa 



88(86) 



CMW4797 Eucalyptus Congo 


CMW5312 Eucalyptus Uganda 

(99) 


100(100) 

93(92) 

CMW16010 Eucalyptus Thailand 



CMW18577 Eucalyptus Indonesia 






(87) CMW14632 Eucalyptus Indonesia 

100(100) CMW14631 Eucalyptus Indonesia 

100(100) 

CMW24174 C. fimbriatomima 

CMW24176 C. fimbriatomima 

98(99) 

CMW13851 C. manginecans 

CMW13852 C. manginecans 

98(97) 

CMW22562 C. acaciivora 

CMW22563 C. acaciivora 

100 (100) CMW22442 C. curvata 

CMW22432 C. curvata 

100(100) CMW15051 C. cacaofunesta 

CMW14809 C. cacaofunesta 

100(100) 

CMW22092 C. ecuadoriana 

CMW22093 C. ecuadoriana 

72(100) 

CMW17808 C. neglecta 

CMW18194 C. neglecta 

CMW10844 C. papillata 

100(100) CMW8857 C. papillata 

CMW8856 C. papillata 

100(100) CMW14802 C. platani 

CMW23918 C. platani 

100(100) CMW14276 C. tsitsikammensis 

100(100) 

CMW14278 C. tsitsikammensis 

100(100) CMW22445 C. diversiconidia 

CMW22446 C. diversiconidia 

100(100) CMW15991 C. tanganyicensis 

CMW15999 C. tanganyicensis 

66 CMW6569 C. pirilliformis 

81(100) 

71(84) CMW6579 C. pirilliformis 

CMW15236 C. zombamontana 

100 

CMW15242 C. zombamontana 

100(100) CMW23808 C. obpyriformis 

CMW23807 C. obpyriformis 

CMW23809 C. polyconidia 

100(100) 100 

CMW23818 C. polyconidia 

100(100) CMW11424 C. polychroma 

CMW11436 C. polychroma 

95(86) CMW19383 C. atrox 

100(100) CMW19385 C. atrox 

100(100) CMW4068 C. albifundus 

CMW5329 C. albifundus 

100(100) CMW25434 C. larium 

CMW25435 C. larium 

100(100) CMW20935 C. variospora 

CMW20936 C. variospora 

100(100) CMW14789 C. populicola 

CMW14819 C. populicola 

100(100) CMW14800 C. smalleyi 

100(100) CMW26383 C. smalleyi 

CMW14793 C. caryae 

CMW14808 C. caryae 

C. eucalypticola 

Eucalyptus isolates 

Fig. 1. Phylogenetic tree based on the combined sequences of the ITS, βt and TEF1-α gene regions for isolates from Eucalyptus including those 

provided the name C. eucalypticola and other described species in the C. fimbriata s. lat. complex. Ceratocystis virescens represents the out- 

group taxon. Bootstrap values are indicated at the branch nodes and Bayesian values in brackets. 

50 ima funGuS

100(100) 

82(86) 

(Fig. 3). For the ITS gene tree, the same three clades 

emerged as in the combined dataset and included those for 

Asian and South American isolates, the African isolates and 

the African together with Asian isolates. However, only the 

African and Asian clade had strong support (97 %), the other 

two clades, African (63 %) and the Asian/ South American 

(55 %) clades had weak support (Fig. 3). In the case of 

the βt-1 gene tree, there was no support and all branches 

collapsed (Fig. 3). For the TEF1-α gene tree, there were two 

small clades encompassing the South African isolates that 

had high and medium support (85 % and 65 % respectively), 

while the rest of the isolates grouped in a single clade with 

strong (85 %) support (Fig. 3). 

Where data for the C. fimbriata s. lat. isolates were 

analysed in MEGA, the results showed that in the ITS 

gene region, the C. fimbriata s. lat. isolates obtained from 




96(92) 














91 (100) 











(79) 


2 

95(99) 



Fig. 2. A phylogenetic tree for the combined 

sequences of the ITS, βt and EF1-α gene regions, 

including only the undescribed C. fimbriata s. lat. 

isolates with Eucalyptus as their host. The closely 

related species, C. colombiana, is included as 

outgroup. Bootstrap support is indicated at the 

branch nodes while Bayesian support is indicated 

in brackets. 

Eucalyptus were separated from C. colombiana by an average 

of 23 nucleotide differences (Table 2). Where isolates from 

different countries were compared, there was also variation 

in the ITS with a maximum of 13 bp and average of 5 bp 

differences (Table 2). 

Where isolates of C. fimbriata s. lat. from Eucalyptus 

were compared with C. colombiana in the βt-1 gene region, 

there were only 3bp differences between them (Table 2). 

Within the clade representing the C. fimbriata s. lat. group 

from Eucalyptus, there was only one base pair difference 

observed in the South African group and no differences 

between isolates from different countries (Table 2). 

For the TEF1-α gene region, there were 21bp differences 

between the isolate from Brazil and C. colombiana and an 

average of 8 bp differences between C. colombiana and the 

other isolates from Eucalyptus. Only the single isolate from 

ARTIcLE 51

ARTIcLE 

90 








90 CMW4799 Eucalyptus Congo 


85 



97 CMW5313 Eucalyptus Uganda 

62 












100 CMW16009 Eucalyptus Thailand 





99 

0.5 




























0.2 



84 


























0.5 

Fig. 3. Three phylograms each representing a single gene region (ITS, βt and TEF-1α, top to bottom) for the undescribed isolates from Eucalyptus 

representing C. fimbriata s. lat. showing low variation in the three separate gene regions as well as no support for the sub-clades observed in 

the combined gene trees. No outgroup was assigned to this dataset. 

52 ima funGuS

9572, 5751 7768, 16008, 18572, 18591 

7764 

10000 

7767 

9998 

Brazil differed from the other isolates while no differences 

were observed between the isolates from the other countries. 

The allele networks drawn from the combined gene regions 

(ITS, βt-1 and TEF1-α) for the C. fimbriata s. lat. obtained from 

Eucalyptus revealed a single tree with high variation (Fig. 4). 

There was no obvious geographic structure with regards to 

the origin of the eucalypt isolates. The previously described 

species, C. colombiana, formed a separate allele tree (Fig. 4). 

Culture characteristics and morphology 

All isolates from Eucalyptus had a similar greenish olivaceous 

(33’’’f) (Rayner 1970) colony colour. The cultures had a 

banana odour similar to that of many Ceratocystis species. 

The cultures all grew optimally at 30 ºC. No clear 

morphological differences could be observed between 

isolates from different countries (Table 3). 

Isolate CMW 11536 from Eucalyptus in South Africa was 

chosen to represent the global collection of isolates obtained 

from Eucalyptus. Three additional isolates (CMW 9998, 

CMW 10000 and CMW 15054), also from South Africa, were 

chosen as additional specimens for description. Cultures of 

these isolates were grown on 2 % MEA, dried down and have 

been deposited with the National Collection of Fungi (PREM), 

Pretoria, South Africa. Living cultures are maintained in the 


11536 

12663 

18577 

44797 

5313, 16010, 

16034, 16035 

15054 

5312 

7766 


4902 

16009 

14631 

4902 Brazil 

9998, 10000, 11536, 12663, 15054 South Africa 

7764, 7765, 7766, 7767, 7768 Uruguay 

5312, 5313 Uganda 

4797, 4799 Congo 

16008, 16009, 16010, 16034, 16035 Thailand 

18572, 18591, 18577, 14632, 14631 Indonesia 

9572, 5751 C. colombiana 

culture collection (CMW) of the Forestry and Agricultural 

Biotechnology Institute (FABI) at the University of Pretoria, 

South Africa and the Centraalbureau voor Schimmelcultures 

(CBS) in Utrecht, The Netherlands. 

Where growth in culture was characterised based on the 

average colony diameter (from the five inoculated plates) for 

the four selected Eucalyptus isolates from South Africa, after 7 

d, limited growth was observed at 4 °C (8 mm), 10 °C (7 mm), 

15 °C (19 mm) and 35 °C (10 mm). Intermediate growth was 

observed after 7 d at 20 °C (34 mm) and 25 °C (35 mm), while 

the optimum temperature for growth in culture was 30 °C at 

which isolates reached an average of 39 mm diam after 7 d. 

tAxoNoMy 

Fig. 4. Allele networks obtained from the 

three combined gene regions (ITS, βt and 

TEF1-α for all isolates from Eucalyptus 

as well as C. colombiana. The species 

C. colombiana is represented as highly 

different to the Eucalyptus isolates due 

to the fact that it formed a separate allele 

tree. The C. fimbriata s.lat. isolates from 

Eucalyptus all formed one allele tree with 

high variation observed within the tree. 

Isolates of the Ceratocystis from Eucalyptus, originating from 

many different countries, were phylogenetically distinct from 

all other Ceratocystis species residing in the C. fimbriata s. 

lat. clade. They also formed distinct phylogenetic groups 

based on geographic origin and might be found to represent 

distinct taxa in the future. For the present, those isolates from 

South Africa, which also had a morphology different to all 

described species from Eucalyptus (Table 4) are described 

as representing a novel taxon. 

ARTIcLE 53

ARTIcLE 

ceratocystis eucalypticola M. van Wyk & M.J. Wingf., 

sp. nov. 


(Fig. 5) 

Etymology: The name refers to Eucalyptus on which the 

fungus occurs. 

All species of Ceratocystis from Eucalyptus are 

phylogenetically distinct. Colonies of C. eucalypticola are 

typically green colonies, relatively slow growing, and have a 

fruity banana odour. 


table 3. Morphological comparison of two representative isolates from Indonesia, South Africa, Thailand, and Uruguay. Ten measurements 

were taken of each structure and the (minimum-) average minus standard deviation – average plus standard deviation and (-maximum) given 

below. 

Characteristic / Country 

Ascomatal bases 

Indonesia south Africa thailand Uruguay 

Shape Globose Globose Globose Globose 

Length (125–)162–199(–200) (120–)142–190(–202) (188–)190–197(–200) (144–)170–197(–200) 

Width 

Ascomatal necks 

(143–)173–193(–200) (132–)143–193(–216) (154–)177–199(–212) (141–)164–184(–197) 

Length (390–)400–450(–470) (372–)392–460(–486) (354–)370–400(–424) (354–)368–386(–409) 

Width (bases) (24–)25–35(–40) (24–)25–35(–42) (24–)25–35(–39) (23–)26–32(–38) 

Width (apices) 

Ostiolar hyphae 

(15–)16–18(–20) (15–)16–20(–22) (16–)17–19(–20) (15–)16–22(–25) 

Shape Divergent Divergent Divergent Divergent 

Length 

Ascospores 

(36–)43–53(–63) (39–)40–52(–62) (33–)35–39(–41) (38–)41–51(–53) 

Length 3–5 3–5 3–4 3–4 

Width (excluding sheath) 4–6 4–6 4–6 4–6 

Width (including sheath) 

Primary phialides 

5–8 5–7(–8) 5–7 6–7 

Length (69–)70–100(–134) (73–)76–114(–131) (67–)76–96(–100) (73–)75–83(–88) 

Width (bases) 4–6 4–6 4–6 2–4 

Width (broadest point) 4–6 4–6 6–8 4–5 


Secondary phialides 

3–5 3–5 3–5 3–4 

Length (60–)70–100(–143) (64–)69–109(–143) (63–)68–77(–99) (69–)72–96(–109) 

Width (bases) 3–6 3–6 5–6 3–6 


Primary conidia 

5–7 5–7 4–8 6–8 

Length (13–)19–20(–24) (15–)18–24(–25) (10–)13–17(–18) (10–)11–15(–18) 

Width 

Secondary conidia 

4–5 4–5 3–4 2–3 

Length 6–8 6–8 6–8 (7–)9–11 

Width 

Chlamydospores 

5–8 5–7 5–8 6–8 

Shape Globose/Subglobose Globose/Subglobose Globose/Subglobose Globose/Subglobose 

Length 10–15 10–13 12–15 (6–)7–11(–13) 

Width 8–13 8–10 10–13 (5–)7–11(–12) 

Type: south Africa: Kwa-Zulu Natal: KwaMbonambi, 

isolated from artificially wounded Eucalyptus, 15 Dec. 2002, 

M. van Wyk & J. Roux (PREM 60168 – holotype; cultures exholotype 

CMW 11536 = CBS 124016) 

Description: Ascomatal bases dark brown to black, globose, 

un-ornamented (105–)140–186(–222) μm wide, (118–)146– 

184(–216) μm high. Ascomatal necks dark brown to black 

at bases becoming lighter towards the apices, (274–)376– 

464(–499) μm long, apices (14–)16–20(–22) μm wide, 

bases (19–)25–33(–42) μm wide. Ostiolar hyphae divergent, 

(39–)45–59(–66) μm long. Ascospores hyaline, hat-shaped 

in side view, invested in sheath, 3–5 μm long, 4–6 μm wide 

54 ima funGuS


Fig. 5. Morphological characteristics of Ceratocystis eucalypticola. a. Ascomata with globose base. b. Hat-shaped (in side view) and cucullate 

(in top view) ascospores. c. Divergent ostiolar hyphae d. Dark, globose to sub-globose chlamydospore. e. Primary conidiophore, flask-shaped 

phialide, producing cylindrical conidia. f. Tubular shaped secondary conidiophore, producing a chain of barrel-shaped conidia. g. Chain of 

cylindrical conidia. h. Chain of barrel-shaped conidia. i. A chain of barrel-shaped conidia, two hat-shaped ascospores and a cylindrical conidium. 

Bars: a. = 100 μm, b, f–i = 5 μm, c–e = 10 μm. 


ARTIcLE 55

ARTIcLE 

without sheath, 5–7(–8) μm wide including sheath. Anamorph 

thielaviopsis-like, conidiophores of two types: Primary 

conidiophores phialidic, flask-shaped, (58–)77–113(–131) 

μm long, (3–)4–6 μm wide at the bases, 4–6(–7) μm wide 

at broadest points and 3–5 μm wide at apices. Secondary 

conidiophores flaring or wide mouthed, (43–)60–100(–143) 

μm long, (3–)4–6(–7) μm wide at bases and (4–)5–7(–8) μm 


table 4. Morphological comparison of previously described species in the C. fimbriata s. lat. species complex obtained from Eucalyptus trees 

compared to C. eucalypticola. 

character / species 

Ascomatal bases 

C. atrox C. eucalypticola C. fimbriatomima C. neglecta C. colombiana C. pirilliformis 

Shape Globose Globose Globose Globose Globose Obpyriform 

Length (120–)140–180 

(–222) 

Width (120–)150–178 

(–200) 

Ascomatal necks 

Length (270–)310–400 

(–460) 

(105–)140–186 

(–222) 

(118–)146–184 

(–216) 

(274–)376–464 

(–499) 

(142–)173–215 

(–234) 

(145–)178–225 

(–255) 

(446–)660–890 

(–1070) 

(173–)202–244 

(–281) 

(153–)178–228 

(–250) 

(691–)745–840 

(–889) 

(140–)177–237 

(–294) 

(140–)177–237 

(–294) 

(375–)448–560 

(–676) 

wide at apices. Primary conidia cylindrical in shape (14–)16– 

22(–25) μm long, 3–5 μm wide. Secondary conidia, barrelshaped, 

abundant, (6–)7–9(–12) μm long, 4–6(–7) μm wide. 

Chlamydospores, scarce, hair brown (17’’’’i), globose to subglobose 

(10–)11–13(–15) μm long, 8–10(–11) μm wide. 

Habitat: Wounded and diseased Eucalyptus. 

145–216(–279) 

115–186(–206) 

372–683(–778) 

Width (bases) (21–)26–34(–40) (19–)25–33(–42) (28–)32–42(–47) (27–)31–39(–46) (24–)27–35(–43) 18–33(–40) 


Ostiolar hyphae 

(13–)14–16(–19) (14–)16–20(–22) (16–)18–24(–28) (14–)16–20(–22) (12–)14–18(–19) 12–21(–25) 

Shape Divergent Divergent Divergent Divergent Divergent Convergent 

Length 

Ascospores 

(18–)20–26(–28) (39–)45–59(–66) (40–)49–61(–68) (35–)41–49(–54) (28–)38–46(–52) N/A 

Length 3–4 3–5 2–4 3–6 3–4 4–6 

Width (excluding 

sheath) 

3–4 4–6 4–6 4–7 (3–)4–6(–7) 3–5 

Width (including 

sheath) 

Primary phialides 

4–6 5–7(–)8 5–7 5–8 6–8(–11) 3–5 

Length (78–)87–151(–218) (58–)77–113(–131) (49–)60–94(–122) (75–)80–114(–152) (58–)65–83(–106) 62–147(–216) 

Width (bases) 5–7(–13) (3–)4–6(–7) 4–7 (4–)5–7(–8) 4–6(–8) N/A 

Width (broadest point) 4–7 4–6(–7) 5–9 5–9 (3–)6–8(–9) N/A 


Secondary phialides 

4–9 3–5 3–5 (3–)4–6(–7) 3–5(–6) N/A 

Length (39–)43–57(–66) (43–)60–100(–143) Absent (38–)48–76(–89) (42–)49–71(–85) N/A 

Width (bases) 5–7(–9) (3–)4–6(–7) Absent (3–)5–7(–8) (4–)5–7 N/A 


Primary conidia 

4–6)–7) (4–)5–7(–8) Absent (3–)5–7(–8) (5–)6–8 N/A 

Length (9–)11–15(–17) (14–)16–22(–25) (14–)20–28(–31) (11–)15–27(–30) (12–)16–24(–29) 12–25(–33) 

Width 

Secondary conidia 

3–5 3–5 3–5 (3–)5–6 4–6 2–5 

Length (7–)8–12(–14) (6–)7–9(–12) Absent (6–)10–11 9–14 4–6 

Width 

Chlamydospores 

(5–)6–8(–9) 4–6(–7) Absent (4–)5–7(–9) 6–8(–11) 3–5 

Shape Absent Globose/ 

Subglobose 

Subglobose Globose Globose Oval 

Length Absent (10–)11–13(–15) (6–)10–14(–15) (8–)10–12(–13) 11–14 8–12(–13) 

Width Absent 8–10(–11) (6–)7–11(–12) (9–)10–14(–16) 11–15(–17) 5–8(–10) 

reference Van Wyk et. al. This study Van Wyk et. al. 2008 Rodas et. al. 2008 Van Wyk et. al. Barnes et. al. 

2007 

2010a 

2003 

56 ima funGuS

Known distribution: South Africa. 

Other material examined: south Africa: Mpumalanga, Sabie, 

isolated from artificially wounded Eucalyptus trees, 14 July 2002, M. 

van Wyk & J. Roux (PREM 60169; living cultures CMW 9998 = CBS 

124017); loc. cit., isolated from artificially wounded Eucalyptus trees, 

14 July 2002, M. van Wyk & J. Roux (PREM 60170; living cultures 

CMW 10000 = CBS 124019). 

dIscussIoN 

Isolates of Ceratocystis fimbriata s. lat. collected from 

Eucalyptus in Brazil, Indonesia, Republic of Congo, South 

Africa, Thailand, Uganda, and Uruguay were shown to be 

phylogenetically related. These included isolates taken from 

wounds on trees and also those that were associated with 

trees dying as result of infection by the fungus. Although all 

isolates from Eucalyptus resided in a single large clade, there 

was a high degree of diversity among them. It is thus possible 

that they represent a number of different cryptic species that 

cannot be resolved. For the present, those isolates from South 

Africa are provided with the name C. eucalypticola here. 

Future studies should seek to include additional isolates from 

Eucalyptus as well as to include sequences for gene regions 

not considered in this study, and that might discriminate more 

clearly between species in the C. fimbriata s. lat. complex. 

Currently, the group is unified based on a specific host and 

relatively strong phylogenetic similarity. In this respect, it also 

provides the foundation for further studies including a suite of 

isolates that would be difficult to obtain. 

The species of Ceratocystis most closely related to C. 

eucalypticola is C. colombiana. Ceratocystis colombiana 

is a pathogen of coffee trees (Marin et al. 2003) as well 

as numerous other hosts including indigenous crops in 

Colombia. Although the two species are phylogenetically 

related, they are ecologically distinct and are not likely to be 

confused. 

Ceratocystis eucalypticola is one of a number of species 

in the C. fimbriata s. lat. complex to be described from 

Eucalyptus trees. Other species from this host include; C. 

atrox (van Wyk et al. 2007) and C. corymbiicola (Kamgan 

Nkuekam et al. 2012) from Australia, C. pirilliformis (Barnes 

et al. 2003b) from Australia and South Africa, C. neglecta 

(Rodas et al. 2007) from Colombia, C. fimbriatomima (van 

Wyk et al. 2008) from Venezuela, and C. zombamontana 

(Heath et al. 2009) from Malawi. All of these species from 

Eucalyptus can be distinguished from each other based on 

phylogenetic inference and they have some morphological 

features that can be used to recognise them. 

Morphologically, the specimens of C. eucalypticola cited 

here resemble species in the C. fimbriata s. lat. complex. 

The fungus has the typical green colony colour, is relatively 

slow growing, and has a fruity banana odour. Ceratocystis 

eucalypticola can be distinguished from other species in the 

C. fimbriata s. lat. complex in that they occur on Eucalyptus 

and based on differences in size of some diagnostic 

characters for this group of fungi. 

Ceratocystis eucalypticola includes isolates only from 

wounds on trees in South Africa in the absence of disease, 



but is very closely related to isolates that originated from 

dying trees and that have been shown to be pathogenic 

(Laia et al. 1999; Roux et al. 2000, 2001, 2004). The species 

is also closely related to isolates that were collected from 

wounds on trees in countries other than South Africa where 

a Ceratocystis disease on Eucalyptus has not been seen. 

Eucalyptus death associated with C. eucalypticola has never 

been found in South Africa although trees dying of unknown 

causes are thought to have died due to infection by this 

fungus, which can be difficult to isolate. The fungus collected 

from wounds on trees has also been shown to be pathogenic 

in greenhouse inoculation trials (Roux et al. 2004, van Wyk 

et al. 2010b). 

Isolates of C. eucalypticola from South Africa represent 

a clonal population (van Wyk et al. 2006b) and it was most 

likely introduced into the country. It is thus intriguing that 

Eucalyptus death associated with this fungus has not been 

seen. This might be due to planting stock susceptible to 

C. eucalypticola not having occurred in the country, or that 

conditions for infection were not suitable. Alternatively, it is 

possible that trees dying of unexplained causes might have 

been killed by C. eucalypticola, even though the fungus was 

not isolated from them. This is a question that is currently 

being pursued, particularly linked to unexplained Eucalyptus 

death in South Africa and where Ceratocystis cultures emerge 

from isolations. 


We thank the National Research Foundation (NRF), members of 

the Tree Protection Co-operative Programme (TPCP), the THRIP 

initiative of the Department of Trade and Industry and the Department 

of Science and Technology (DST)/NRF Centre of Excellence in Tree 

Health Biotechnology (CTHB) for funding. 

reFereNces 

Barnes I, Gaur A, Burgess T, Roux J, Wingfield BD, Wingfield MJ 

(2001) Microsatellite markers reflect intra-specific relationships 

between isolates of the vascular wilt pathogen, Ceratocystis 

fimbriata. Molecular Plant Pathology 2: 319–325. DOI. 

org/10.1046/j.1464-6722.2001.00080.x 

Barnes I, Roux J, Wingfield BD, O’Neil M, Wingfield MJ (2003a) 

Ceratocystis fimbriata infecting Eucalyptus grandis in Uruguay. 

Australasian Plant Pathology 32: 361–355. DOI.org/10.1071/ 

AP03032 

Barnes I, Roux J, Wingfield MJ, Old KM, Dudzinski M (2003b) 

Ceratocystis pirilliformis, a new species from Eucalyptus nitens 

in Australia. Mycologia 95: 865–871. DOI org/10.2307/3762015 

Clement M, Posada D, Crandall K (2000) TCS: a computer program 

to estimate gene genealogies. Molecular Ecology 9: 1657–1660. 

DOI.org/10.1046/j.1365-294x.2000.01020.x 

Cunningham CW (1997) Can three incongruence tests predict when 

data should be combined? Molecular Biology and Evolution 14: 

733-740. 

Engelbrecht CJB, Harrington TC (2005) Intersterility, morphology 

and taxonomy of Ceratocystis fimbriata on sweet potato, 

cacao and sycamore. Mycologia 97: 57–69. DOI.org/10.3852/ 

ARTIcLE 57

ARTIcLE 

mycologia.97.1.57 

Feirreira EM, Harrington TC, Thorpe DJ, Alfenas AC (2010) Genetic 

diversity and interfertility among highly differentiated populations 

of Ceratocystis fimbriata in Brazil. Plant Pathology 59: 721–735. 

DOI.org/10.1111/j.1365-3059.2010.02275.x 

Glass NL, Donaldson GC (1995) Development of primer sets 

designed for use with the PCR to amplify conserved genes 

from filamentous Ascomycetes. Applied and Environmental 

Microbiology 61: 1323–1330. 

Heath RN, Wingfield BD, Wingfield MJ, Meke G, Mbaga A, Roux J 

(2009) Ceratocystis species on Acacia mearnsii and Eucalyptus 

spp. in eastern and southern Africa including six new species. 

Fungal Diversity 34: 41–67. 

Jacobs K, Bergdahl DR, Wingfield MJ, Halik S, Seifert KA, Bright 

DE, Wingfield BD (2004) Leptographium wingfieldii introduced 

into North America and found associated with exotic Tomicus 

piniperda and native bark beetles. Mycological Research 108: 

411–418. DOI.org/10.1017/S0953756204009748 

Johnson JA, Harrington TC, Engelbrecht CJB (2005) Phylogeny 

and taxonomy of the North American clade of the Ceratocystis 

fimbriata complex. Mycologia 97: 1067–1092. DOI.org/10.3852/ 

mycologia.97.5.1067 

Kamgan Nkuekam G, Wingfield MJ, Mohammed C, Carnegie AJ, 

Pegg GS, Roux J (2012) Ceratocystis species, including two 

new species associated with nitidulid beetles on Eucalyptus 

in Australia. Antonie van Leeuwenhoek 101: 217–241. DOI 

10.1007/s10482-011-9625-7. 

Katoh K, Misawa K, Kuma K, Miyata T (2002) MAFFT: a novel 

method for rapid multiple sequence alignment based on fast 

Fourier transform. Nucleic Acids Research 30: 3059–3066. DOI. 

org/10.1093/nar/gkf436 

Kile GA (1993) Plant diseases caused by species of Ceratocystis 

sensu stricto and Chalara. In: Ceratocystis and Ophiostoma: 

taxonomy, ecology and pathogenicity (MJ Wingfield, KA 

Seifert, JA Webber, eds): 173–183. St Paul, MN: American 

Phytopathological Society Press. 

Laia ML, Alfenas AC, Harrington TC (1999) Isolation, detection in soil, 

and inoculation of Ceratocystis fimbriata, causal agent of wilting, 

dieback and canker in Eucalyptus. In: Proceedings of the 12th Biennial Conference of the Australasian Plant Pathology Society, 

27–30 September (L Morin, ed): 77. Canberra: Australasian 

Plant Pathology Society. 

Marin M, Castro B, Gaitan A, Preisig O, Wingfield BD, Wingfield 

MJ (2003) Relationships of Ceratocystis fimbriata isolates from 

Colombian coffee-growing regions based on molecular data and 

pathogenicity. Journal of Phytopathology 151: 395–400. DOI 

org/10.1046/j.1439-0434.2003.00738.x 

Moller WJ, DeVay JE (1968) Carrot as a species-selective isolation 

medium for Ceratocystis fimbriata. Phytopathology 58: 123–124. 

Nylander JAA (2004) MrModeltest v2. [Program distributed by the 

author.] Uppsala: Evolutionary Biology Centre, Uppsala University. 

Old KM, Wingfield MJ, Yuan ZQ (2003) A manual of diseases of 

Eucalypts in South-East Asia. Jakarta: Centre for International 

Forestry Research. 

Rayner RW (1970) A Mycological Colour Chart. Kew: Commonwealth 

Mycological Institute. 

Rodas C, Roux J, van Wyk M, Wingfield BD, Wingfield MJ (2007) 

Ceratocystis neglecta sp. nov., infecting Eucalyptus trees in 

Colombia. Fungal Diversity 28: 73–84. 


Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian 

phylogenetic inference under mixed models. Bioinformatics 19: 

1572–1574. DOI.org/10.1093/bioinformatics/btg180 

Roux J, Coutinho TA, Munjuni Byabashaija D, Wingfield MJ (2001) 

Diseases of plantation Eucalyptus in Uganda. South African 

Journal of Science 97: 16–18. 

Roux J, van Wyk M, Hatting H, Wingfield MJ (2004) Ceratocystis 

species infecting stem wounds on Eucalyptus grandis in South 

Africa. Plant Pathology 53: 414–421. DOI.org/10.1111/j.0032- 

0862.2004.01014.x 

Roux J, Wingfield MJ (2009) Ceratocystis species: emerging 

pathogens of non-native plantation Eucalyptus and Acacia 

species. Southern Forests 71: 115–120. DOI org/10.2989/ 

SF.2009.71.2.5.820 

Roux J, Wingfield MJ, Wingfield BD, Bouillett JP, Alfenas AC (2000) 

A serious new disease of Eucalyptus caused by Ceratocystis 

fimbriata in Central Africa. Forest Pathology 30: 175–184. DOI. 

org/10.1046/j.1439-0329.2000.00202.x 

Swofford DL (2002) PAUP*: phylogenetic analysis using parsimony 

(*and other methods). Version 4. Sunderland, MA:Sinauer 

Associates. 

Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular 

Evolutionary Genetics Analysis (MEGA) software version 

4.0. Molecular Biology and Evolution 24: 1596–1599. DOI. 

org/10.1093/molbev/msm092 

van Wyk M, Pegg G, Lawson S, Wingfield MJ (2007) Ceratocystis 

atrox sp. nov. associated with Phoracanthta acanthocera 

infestations on Eucalyptus in Australia. Australian Journal of 

Plant Pathology 36: 407–414. DOI.org/10.1071/AP07042 

van Wyk M, Roux J, Barnes I, Wingfield BD, Wingfield MJ (2006a) 

Molecular phylogeny of the Ceratocystis moniliformis complex 

and description of C. tribilliformis sp. nov. Fungal Diversity 21: 

181–201. 

van Wyk M, Van der Merwe NA, Roux J, Wingfield BD, Kamgan 

GN, Wingfield MJ (2006b) Population biology of Ceratocystis 

fimbriata from Eucalyptus trees in South Africa. South African 

Journal of Science 102: 259–263. 

van Wyk M, Wingfield BD, Marin M, Wingfield MJ (2010a) Two 

new Ceratocystis species infecting coffee, cacao, citrus and 

native trees in Colombia. Fungal Diversity 40: 103–117. DOI. 

org/10.1007/s13225-009-0005-9 

van Wyk M, Wingfield BD, Wingfield MJ (2010b) Comparison of 

procedures to evaluate the virulence of Ceratocystis fimbriata 

sensu lato isolates from Eucalyptus in South Africa. Southern 

Forests 72(2): 57–62. DOI.org/10.2989/20702620.2010.507011 

van Wyk M, Wingfield BD, Mohali S, Wingfield MJ (2008) Ceratocystis 

fimbriatomima, a new species in the C. fimbriata sensu lato 

complex isolated from Eucalyptus trees in Venezuela. Fungal 

Diversity 34: 173–183. 

White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct 

sequencing of fungal ribosomal RNA genes for phylogenetics. In: 

PCR Protocols: a sequencing guide to methods and applications 

(MA Innis, DH Gelfand, JJ Sninsky, TJ White, eds): 315–322. 

San Diego: Academic Press. 

Wingfield MJ, Slippers B, Hurley BP, Coutinho TA, Wingfield BD, 

Roux J (2008) Eucalypt pests and diseases: growing threats 

to plantation productivity. Southern Forests 70: 139–144.DOI. 

org/10.2989/SOUTH.FOR.2008.70.2.9.537 

58 ima funGuS

doi:10.5598/imafungus.2012.03.01.07 

INtroductIoN 

Aspergillus section Versicolores was originally erected as the 

Aspergillus versicolor group by Thom & Church (1926) and 

was subsequently revised by Thom & Raper (1945) to contain 

four species. Raper & Fennell (1965) revised the genus 

Aspergillus and accepted 18 species in the A. versicolor 

group. Gams et al. (1985) formalized the sectional taxonomy 

of Raper & Fennell’s (1965) groups. Using scanning electron 

microscopy (SEM), Kozakiewicz (1989) examined conidial 

surface ornamentation of most species of the section and 

removed seven species from section Versicolores. Klich 

(1993) revised the section based on morphological and other 

characteristics and accepted the seven species previously 

removed by Kozakiewicz (1989) from section Versicolores. 

Peterson (2008) accepted four phylogenetically distinct 

species in the section based on multilocus DNA sequence 

analysis, placing the other 14 species in different clades of 

Aspergillus. 










Aspergillus section Versicolores: nine new species and multilocus dNA 

sequence based phylogeny 

Zeljko Jurjevic 1 , Stephen W. Peterson 2 , and Bruce W. Horn 3 

1EMSL Analytical, Inc., 200 Route 130 North, Cinnaminson, NJ 08077 

2Bacterial Foodborne Pathogens and Mycology Research Unit, National Center for Agricultural Utilization Research, Agricultural Research 

Service, U.S. Department of Agriculture, 1815 North University Street, Peoria, Illinois 61604 USA; corresponding author email: Stephen. 

peterson@ars.usda.gov 

3National Peanut Research Laboratory, Agricultural Research Service, U.S. Department of Agriculture, P.O. Box 509, Dawson, GA 39842-0509 

Abstract: β-tubulin, calmodulin, internal transcribed spacer and partial lsu-rDNA, RNA polymerase 2, DNA 

replication licensing factor Mcm7, and pre-rRNA processing protein Tsr1 were amplified and sequenced from 

numerous isolates belonging to Aspergillus sect. versicolor. The isolates were analyzed phylogenetically 

using the concordance model to establish species boundaries. Aspergillus austroafricanus, A. creber, A. 

cvjetkovicii, A. fructus, A. jensenii, A. puulaauensis, A. subversicolor, A. tennesseensis and A. venenatus 

are described as new species and A. amoenus, A. protuberus, A. sydowii, A. tabacinus and A. versicolor 

are accepted as distinct species on the basis of molecular and phenotypic differences. PCR primer pairs 

used to detect A. versicolor in sick building syndrome studies have a positive reaction for all of the newly 

described species except A. subversicolor. 

Article info: Submitted: 17 January 2012; Accepted: 7 June 2012; Published: 21 June 2012. 

Key words: 

Aspergillus amoenus 

Aspergillus austroafricanus 

Aspergillus creber 

Aspergillus cvjetkovicii 

Aspergillus fructus 

Aspergillus jensenii 

Aspergillus protuberus 

Aspergillus puulaauensis 

Aspergillus subversicolor 

Aspergillus sydowii 

Aspergillus tabacinus 

Aspergillus tennesseensis 

Aspergillus venenatus 

Aspergillus versicolor 

concordance analysis 

phylogeny 

systematics 

Aspergillus versicolor is the most widely reported and 

studied species in section Versicolores. It has been isolated 

from soil (Domsch et al. 1980), indoor environments (Samson 

et al. 2001, Shelton et al. 2002, Engelhart et al. 2002, Amend 

et al. 2010, Anderson et al. 2011), various foods and feeds 

(Pitt & Hocking 2009) and hypersaline water (Kis-Papo et 

al. 2003, Mbata 2008), and is associated with many health 

issues of humans and animals (Jussila 2003, Perri et al. 

2005, Baddley et al. 2009, Edmondson et al. 2009, Pitt & 

Hocking 2009, Moreno & Arenas 2010). It is a producer of 

the mycotoxin sterigmatocystin that is a precursor of aflatoxin 

B 1 (Mills & Abramson 1986, Tuomi et al. 2000, Nielsen 2003, 

Veršilovskis & Saeger 2010). 

Environmental isolates of section Versicolores species 

exhibit great variation in macro-phenotypic ones but few 

differences in micro-phenotypic characters (Domsch et al. 

1980, Klich 2002, Raper & Fennell 1965, Thom & Church 

1926, Vesonder & Horn 1985), leading us to conduct a 

DNA-based phylogenetic study. to determine the limits of 

ARTIcLE 

59

ARTIcLE 

variation within species, we amplified and sequenced DNA 

from 6 loci and used concordance analysis to identify species 

boundaries (Dettman et al. 2003) within section Versicolores. 

The species described and accepted are monophyletic. 


Fungal isolates 

The provenance of fungal isolates examined in this study is 

detailed in Table 1 and these cultures are available from the 

Agricultural Research Service Culture Collection (NRRL), 

Peoria, Illinois (http://nrrl.ncaur.usda.gov). 

culture methods 

Cultures were grown on Czapek yeast extract agar (CYA) at 5 

°C, 25 °C, and 37 °C and on malt extract agar (MEA), CY20S, 

M40Y and M60Y, all at 25 °C for 10 d in darkness (Pitt 1980, 

Klich 2002). M40Y contained 2 % malt extract, 0.5 % yeast 

extract and 40 % sucrose; M60Y contained 2 % malt extract, 

0.5 % yeast extract and 60 % sucrose. Colony diameters 

and appearance were recorded and photographs were made 

from 10-d culture plates incubated at 25 °C. Color names are 

from Ridgway (1912) and are referred to with plate number, 

e.g. R45. 

Microscopy 

Microscopic examination was performed by teasing apart a 

small amount of mycelium in a drop of 0.1 % Triton X-100 

and examining the preparation under bright field or DIF 

illumination. Additional microscopic samples were made by 

gently pressing a ca 20 × 5 mm piece of transparent tape 

onto a colony, rinsing the tape with one or two drops of 70 % 

ethanol and mounting the tape in lactic acid with fuchsin dye. 

A Leica DM 2500 microscope with bright field, phase contrast 

and DIF contrast optics was used to view the slides. The 

Spot camera with spot imaging software was mounted on the 

microscope and used for photomicrography. A Nikon digital 

SLR camera with D70 lens was used for colony photography. 

Photographs were resized and fitted into plates with Microsoft 

PowerPoint 2003 or Adobe Photoshop. 

dNA methods 

Conidia from agar slant cultures were used to inoculate 125mL 

Erlenmeyer flasks containing 25 mL of malt extract broth. 

Cultures were grown on a rotary platform (200 rpm) for 2–3 d 

at 25 °C. Biomass was collected by vacuum filtration, and then 

frozen and freeze-dried in microfuge tubes. Dry mycelium 

was ground to a powder, rehydrated with CTAB buffer and 

extracted with chloroform; the phases were separated by 

centrifugation and DNA was precipitated from the aqueous 

phase with an equal volume of isopropanol. Total nucleic 

acids were collected by centrifugation, the pellet was rinsed 

with 70 % ethanol, and the nucleic acids were dissolved in 

100 μL sterile deionized water. 

DNA was diluted ca 1:100 with sterile deionized water 

for use in amplifications. β-tubulin (BT2), calmodulin (CF), 

ITS and partial lsu-rDNA (ID), RNA polymerase 2 (RPB2), 

DNA replication licensing factor (Mcm7), and pre-rRNA 

processing protein (Tsr1) were amplified with primers used 

Jurjevic, Peterson & Horn 

by Peterson et al. (2010). Standard buffer and conditions 

were used with a thermal profile of 95 °C for 2 min followed 

by 35 cycles of 96 °C for 30 sec; 51 °C for 60 sec; 72 °C 

for 60 sec; and a final extension phase of 72 °C for 5 min. 

Occasionally, multiple amplification bands were obtained and 

a higher annealing temperature was used to obtain single 

amplification bands. DNA sequencing was performed on 

both template strands using dye terminator technology (v3.1) 

and an ABI 3730 sequencer, both from Applied Biosystems 

(http://www.appliedbiosystems.com/). Raw sequences (bidirectional) 

were corrected using Sequencher (http://www. 

genecodes.com/). Corrected sequences were aligned for 

phylogenetic analysis using CLUSTALW (Thompson et al. 

1994). Sequences were deposited in GenBank as accessions 

JN853798–JN854131, EF652176, EF652178, EF652185– 

EF652187, EF652196, EF652203, EF652209–EF652211, 

EF652214–EF652216, EF652226, EF652264, EF652266, 

EF652273–EF652275, EF652284, EF652291, EF652297– 

EF652299, EF652302–EF652304, EF652314, EF652352, 

EF652354, EF652361–EF652363, EF652372, EF652379, 

EF652385–EF652387, EF652390–EF652392, EF652402, 

EF652440, EF652442, EF652449–EF652451, EF652460, 

EF652467, EF652473–EF652475, EF652478–EF652480, 

EF652490 and JQ301889–JQ301896. 

Parsimony analysis was conducted using PAUP* 4.0b10 

(Swofford 2003). For single-locus data sets, the criterion was 

parsimony, addition order was random (5000 replications), 

branch swapping was NNI (nearest neighbor interchange) 

and max trees was set at 5000. The set of trees generated 

was used as the starting point for parsimony analysis with 

addition order “as is” and TBR branch swapping. Bootstrap 

analysis was conducted with “as is” addition order and TBR 

branch swapping for 1000 replications. 

Bayesian posterior probabilities were calculated using 

MrBayes 3.12 (Huelsenbeck & Ronquist 2001, Ronquist & 

Huelsenbeck 2003). The Mcm7, Tsr1 and RPB2 data sets 

included only protein-coding sequences and each data set was 

partitioned into codon positions 1, 2, and 3. The BT2 and CF 

loci included protein-coding and intron regions and the data 

were partitioned into intron and exon data. A GTR (general 

time-reversible) model was used with a proportion of invariant 

sites and a gamma-shaped distribution of rates across the sites. 

Markov chain Monte Carlo (MCMC) analysis was conducted for 

up to 5 × 10 6 generations until the chains converged. 

Concordance analysis was based on the exclusionary 

principle of Baum & Shaw (1995) and the genealogical 

concordance phylogenetic species recognition concepts of 

Taylor et al. (2000). Clades were recognized as independent 

evolutionary lineages if 1) the clade was present in the 

majority of single-locus genealogies (majority rule consensus) 

or 2) if a clade was strongly supported by both parsimony 

and Bayesian analysis in at least one locus, and was not 

contradicted by another strongly supported locus (Dettman et 

al. 2003). Strong support was assessed as >70 % bootstrap 

and >0.95 posterior probability (Dettman et al. 2003). 

The primers used for identification of A. versicolor in a PCR 

amplification (Dean et al. 2005) were tested using the primer 

sequences and amplification thermal profile recommended, 

but in a uniplex rather than multiplex amplification system 

(Dean et al. 2005). 

60 ima funGuS

table 1. Provenance of fungal isolates used. 

Nrrl number Provenance 

Aspergillus amoenus MycoBank MB250654 


226 USA: isol. ex mammary gland, 1913. 

Aspergillus section Versicolores 

236 Germany: Munster, isol. ex a Berberis sp. fruit, 1930, M. Roberg. 

658 UK: isol. ex brined meat, 1929, G. A. Ledingham. 

4838 Equivalent to NRRL 236, received from Centraalbureau voor Schimmelcultures, 1962, ex-type. 

35600 USA: Hawaii, Kapuka Pauula, isol. ex the basidiomata of Gandoderma australe, 2005, D.T. Wicklow. 

A-23228 India: Karnataka, isol. ex coffee berry, 1978, B. Muthappa. 

Aspergillus asperescens Stolk MycoBank MB292835 

4770 Ex-type, out-group species. 

Aspergillus austroafricanus sp. nov., MycoBank MB800597 

233 South Africa: Capetown, unknown, 1922, sent by V. A. Putterill, ex-type. 

Aspergillus creber sp. nov., MycoBank MB800598 

231 South Africa: Capetown, unknown, 1922, sent by V. A. Putterill. 

6544 Atlantic Ocean: isol. ex a floating tar ball, 1979, A. Wellman. 

25627 Japan: Ibaraki, isol. ex tea field soil, 1996, T. Goto. 

58583 USA: Pennsylvania, isol. ex indoor air sampler, 2008, Z. Jurjevic. 

58584 USA: California, isol. ex indoor air sample, 2008, Z. Jurjevic. 


58592 USA: California, isol. ex indoor air sample, 2008, Z. Jurjevic, ex-type. 

58597 USA: New Jersey, isol. ex indoor air sample, 2008, Z. Jurjevic. 

58601 USA: New Jersey: isolated from indoor air sample, 2009, Z. Jurjevic. 

58606 USA: Pennsylvania, isol. ex indoor air sample, 2009, Z. Jurjevic. 




58672 USA: Georgia, isol. ex indoor air sample, 2009, Z. Jurjevic. 

58673 USA: Georgia, isol. ex indoor air sample, 2009, Z. Jurjevic. 

58675 USA: Ohio, isol. ex indoor air sample, 2009, Z. Jurjevic. 

Aspergillus cvjetkovicii sp. nov., MycoBank MB800599 

227 USA: New Jersey, isol. ex soil, 1915, G.W. Wilson, ex-type. 

230 China: isol. ex soy sauce, 1917, Round. 

4642 Unknown: sent to NRRL, 1969, D. I. Fennell as WB4642. 


Aspergillus fructus sp. nov., MycoBank MB800600 

239 USA: California, isol. ex date fruit, 1939, Bliss, ex-type. 

241 Unknown: isol. ex pomegranate fruit, 1916, L. McCulloch. 

Aspergillus jensenii sp. nov., MycoBank MB800601 

225 UK: unknown, 1913, sent to C. Thom by Dade. 

235 UK: London, isol. ex paraffin, 1930, H. Raistrick. 

240 USA: New York, Ithaca, isol. ex the rhizosphere of pepper plants, 1911, C. N. Jensen, sent to C. Thom by Whetzel as 

type strain of A. globosus. 

58582 USA: Montana, isol. ex indoor air sample, 2008, Z. Jurjevic. 

58600 USA: Montana, isol. ex indoor air sample, 2008, Z. Jurjevic, ex-type. 


58674 USA: Ohio, isol. ex indoor air sample, 2009, Z. Jurjevic. 

Aspergillus multicolor Sappa MycoBank MB292849 

4775 Ex-type, out-group species. 

ARTIcLE 61

ARTIcLE 


Nrrl number Provenance 

Aspergillus protuberus MycoBank MB326650 



3505 Yugoslavia, isol. ex rubber coated electrical cables, ca 1968, ex-type. 




58990 USA: Connecticut, isol. ex indoor air sample, 2009, Z. Jurjevic. 

58991 USA: Connecticut, isol. ex indoor air sample, 2009, Z. Jurjevic. 

Aspergillus puulaauensis sp. nov., MycoBank MB800602 

35641 USA: Hawaii, Pu’u la’au Highway 200, isol. ex dead hardwood branch, 2003, D. T. Wicklow, ex-type. 

58602 USA: West Virginia, isol. ex indoor air sample, 2009, Z. Jurjevic. 

62124 USA: Hawaii, mesic mountain forest, isol. ex basidiomata of Inonotus sp., 2003, D. T. Wicklow. 

62516 Canada: Alberta, isol. ex air sample in bee house, ca 1990, S. P. Abbot, equivalent to UAMH 7651. 

Aspergillus subversicolor sp. nov., MycoBank MB800603 

58999 India: Karnataka, isol. ex coffee berry, 1970, B. Muthappa, ex-type. 

Aspergillus sydowii MycoBank MB279636 

250 Unknown: prior to 1930, sent to C. Thom by M. Swift. 

254 USA: Georgia, Waycross, clinical isolate, 1940, M. M. Harris. 

4768 USA: California, isol. ex soil, 1969. 

62450 Thailand: isol. ex dead plant stem, 1977, E. G. Simmons. 

Aspergillus tabacinus MycoBank MB539544 


4791 Unknown: isol. ex tobacco, 1934, Y. Nakazawa, ex-type. 

5031 Unknown: type isolate of A. versicolor var. magnus Sasaki, received from IFO, 1962. 

62481 Nepal: Kathmandu, isol. ex maize, 1977. 

Aspergillus tennesseensis sp. nov., MycoBank MB800604 

229 Unknown: sent to C. Thom, 1917, by R. Thaxter. 

234 USA: Maryland, Beltsville, isol. ex chestnut seed, 1927, C. Thom. 

13150 USA: Tennessee, isol. ex toxic dairy feed, 1984, B. W. Horn, ex-type. 

13152 USA: Tennessee, isol. ex toxic dairy feed, 1984, B. W. Horn. 

Aspergillus venenatus sp. nov., MycoBank MB800605 

13147 USA: Tennessee: isolated from toxic dairy feed, 1984, B. W. Horn, ex-type. 



62457 USA: Missouri, isol. ex corn, 1989, D. T. Wicklow. 

Aspergillus versicolor MycoBank MB172159 

238 USA: isol. ex unrecorded substrate, 1935, V. K. Charles, ex-type. 

5219 South Africa: Pretoria, received 1970, from J. P. van der Walt. 




Aspergillus species, undescribed 

results 

530 East Indies: isol. ex natural rubber, 1938, Shumard. 

13151 USA: Tennessee: isol. ex toxic dairy feed, 1984, B. W. Horn. 

Phylogenic analysis of sequence data 

Sixteen independent evolutionary lineages were detected 

using both criteria for concordance (Dettman et al. 2003). 

The accepted species (Peterson 2008) A. versicolor, A. 

tabacinus, A. amoenus, A. protuberus and A. sydowii each 

were identified as independent lineages (Fig. 1). Four 

62 ima funGuS


Fig. 1. Phylogenetic tree calculated from DNA sequence data from four concatenated loci. The section Versicolores contains three subclades, 

the A. versicolor subclade, the A. sydowii subclade and the A. subversicolor subclade. Thick branches indicate >90 % bootstrap and >0.90 

Bayesian posterior probability for the node. Isolate NRRL 13151 is similar in colony appearance to A. tennesseensis but may represent a distinct 

species. Isolate NRRL 530 is similar in colony appearance to A. amoenus but also may represent a distinct species. 

lineages contained a single isolate. Two of these singleisolate 

lineages, A. subversicolor and A. austroafricanus, 

were sufficiently distinct phenotypically from other species 

in the section and are described as new. The other two 

single-isolate lineages (NRRL 13151 and NRRL 530) were 


phenotypically difficult to distinguish from their siblings, and 

species descriptions were not accorded them. 

The section Versicolores clade contained three 

subclades (Fig. 1): the A. sydowii subclade containing 

A. sydowii, A. creber, A. venenatus, A. tennesseensis, A. 

ARTIcLE 63

ARTIcLE 

cvjetkovicii, A. jensenii and A. puulaauensis; the A. versicolor 

subclade containing A. versicolor, A. tabacinus, A. fructus, 

A. protuberus, A. amoenus and A. austroafricanus; and the 

A. subversicolor subclade containing the single species 

A. subversicolor. Single-locus trees placed A. sydowii in 

the A. sydowii subclade, in the A. versicolor subclade or 

in a distinct clade containing only A. sydowii (Figs S1–S5, 

Supplementary Information, online only) with low confidence 

levels. The Mcm7 locus from A. sydowii was not amplified 

despite numerous attempts and thus A. sydowii does not 

appear in Fig. S3 (Supplementary Information, online only). 

The combined data tree (Fig. 1) depicts A. sydowii as a 

member of the A. sydowii subclade with strong statistical 

support. In the combined data tree, each species’ group of 

isolates resides on a branch with >90 % bootstrap proportion 

and >0.90 Bayesian posterior probability. 

tAxoNoMy 

Previously described species 

Aspergillus amoenus M. Roberg, Hedwigia 70:138 

(1931). 


(Fig. 2a–f) 

Type: Germany: Munster, isol. ex Berberis sp. fruit, 1930. M. 

Roberg (NRRL 4838—ex holotype culture). 

Description: Colonies grown 10 d on CYA at 25 °C (Fig. 2a– 

b) attained 25–40 mm diam, radially sulcate, centrally raised 

or sunken 3–4 mm, one older isolate (NRRL 226) plane, 

sporulating moderately to well, conidial heads in grayish green 


Fig. 2. Aspergillus amoenus (NRRL 4838), culture plates are 9 cm diam, colonies grown at 25 °C for 10 d. a. CYA colonies. b. CYA colony 

reverse. c. MEA colonies. d. MEA colony reverse. e. Smooth stipe, subglobose vesicle, and conidia, bar=10 µm. f. Globose, smooth-walled 

conidia, bar=10 µm. 

shades near tea green (R47), clear to pale orange exudate 

present in some isolates, faint reddish soluble pigment present 

in some isolates, reverse mostly reddish brown hues, with some 

isolates uncolored. Colonies grown 10 d on MEA at 25 °C (Fig. 

2c–d) attained 23–33 mm diam, low, velutinous, some isolates 

with shallow sulcations, colony center often with funicular hyphal 

aggregates, sporulation in blue-green to gray-green shades, no 

soluble pigment except NRRL 226 with pale brown pigment, 

no exudate, reverse colored light orange yellow to pale yellow 

red. Incubation for 7 d on CYA at 5 °C produced no growth 

or germination of conidia. Incubation for 7 d on CYA at 37 °C 

commonly produced growth up to 6 mm diam. 

Stipes (Fig. 2e) smooth walled, hyaline to yellow with 

brownish shades, (35–)100–600(–1100) × (2.5–)4–7(–8) 

μm, vesicles pyriform to spatulate, (4–)7–17(–21) μm diam, 

conidial heads biseriate, metulae covering 1/3 to entire 

vesicle, 3–6(–8) × 2.5–4.0(–5.5) μm, phialides (5–)6–8(– 

11) × 2–3 μm, fragmentary heads resembling penicillate 

fructifications abundant, conidia (Fig. 2f) spherical to 

subspherical, occasionally ellipsoidal, 2.5–3.5(–5) μm, 

smooth walled, NRRL 35600 produced globose hülle cells 

12–22 µm diam when grown on M40Y medium, other 

isolates did not. 

Aspergillus protuberus Muntañola-Cvetković, 

Mikrobiologija 5: 119 (1968). 


(Fig. 3a–h) 

Synonym: Aspergillus versicolor var. protuberus (Muntañola- 

Cvetković) Kozak., Mycol. Pap. 161: 139 (1989). 

Type: yugoslavia: isol. ex rubber coated electrical cables, ca 

1968 (NRRL 3505—ex holotype culture). 

64 ima funGuS

Description: Colonies grown 10 d on CYA at 25 °C (Fig. 

3a–b) attained 28–34 mm diam, radially and concentrically 

sulcate, wrinkled, centrally raised 2–4 mm, clumped aerial 

hyphae give a mealy appearance in some areas of some 

isolates, sporulation moderate with conidial heads often 

creamy white but sometimes patches of yellow-green conidia 

(celandine green R47) are present, scarlet red (R1) exudate 

moderately abundant, vinaceous-fawn (R40) to pale yellow 

soluble pigment present, reverse brownish red or orange 

cinnamon (R20), one isolate brazil red (R1). Colonies grown 

10 d on MEA at 25 °C (Fig. 3c–d) attained 27–32 mm diam, 

floccose, mounded 4–5 mm centrally, radially sulcate, no 

exudate, no soluble pigment, reverse light pinkish yellow to 

pinkish yellow. Incubation for 7 d on CYA at 5 °C or 37 °C 

produced no growth or germination of conidia. 

Stipes (Fig. 3e–f) smooth to tuberose, hyaline to 

yellow or occasionally with brownish shades, (120–)300– 

800(–1250) × 4–10 μm, occasionally terminating with two 

vesicles, vesicles pyriform to spatulate, rarely subspherical, 

(6–)10–24(–27) μm diam, conidial heads biseriate, metulae 

covering half to entire vesicle, (3–)4–7(–8) × 2.5–4.5(–5.5) 

μm, phialides (4–)5–8(–11) × 2–3(–3.5) μm, fragmentary 

heads resembling penicillate fructifications occasionally 

present, conidia (Fig. 3h) spherical to subspherical or 

occasionally ellipsoidal to pyriform, (2.0–)2.5–3.5(–5) 

μm, finely roughened wall, hülle cells (Fig. 3g) globose 

sometimes present. 

Aspergillus sydowii (Bain. & Sart.) Thom & Church 

Aspergilli:147 (1926). 


(Fig. 4a–g) 

Basionym: Sterigmatocystis sydowi Bainer & Sartory, Ann. 

Mycol. 11: 25 (1913). 



Fig. 3. Aspergillus protuberus (NRRL 3505), culture plates are 9 cm diam, colonies grown at 25 °C for 10 d. a. CYA colonies. b. CYA colony 

reverse. c. MEA colonies. d. MEA colony reverse. e. Stipe, subglobose to clavate vesicle, and conidia, bar=10 µm. f. Roughened surface of stipe, 

bar=10 µm. g. Globose hülle cell, bar=10 µm. h. Globose, finely roughened conidia, bar=10 µm. 

Type: Sine loc.: sent to C. Thom, prior to 1930, M. Swift 

(NRRL 250—culture ex neotype). 


4a–b) attained 27–37 mm diam, velutinous, radially sulcate, 

sporulating well, conidial heads deep bluish gray-green 

(R42), exudate moderate to abundant, clear to yellowish 

to reddish brown, reddish-brown soluble pigment, reverse 

tawny olive (R39) to orange cinnamon (R29) on the 

periphery. Colonies grown 10 d on MEA at 25 °C (Fig. 4c– 

d) attained 37–48 mm diam, velutinous, some isolates with 

shallow sulcations, sporulating in dark grayish blue-green 

color, funicular hyphal aggregates often seen centrally, 

no exudate, no soluble pigment, reverse unpigmented to 

brownish pink in NRRL 4768. Incubation for 7 d on CYA at 

5 °C produced no growth or germination of conidia. Incubation 

at 37 °C produced colonies 10–17 mm diam in 10 d. 

Stipes (Fig. 4e) smooth, colorless, 100–500 µm × 4–7 

µm, vesicles subglobose, 5–10 (–15) µm diam, conidial 

heads biseriate, metulae covering most of the vesicle, 6–7 

× 2–3 µm, phialides 7–10 × 2.0–2.5 µm, fragmentary heads 

(Fig. 4f) resembling penicillate fructifications abundant, 

conidia (Fig. 4g) globose to subglobose, 2.5–3.0 (–5) µm, 

spinulose. 

Aspergillus tabacinus Nakaz et al., J. Agr. Chem. 

Soc. Japan 10: 177 (1934). 


(Fig. 5a–f) 

Synonym: Aspergillus versicolor var. magnus Sasaki, J. Fac. 

Agric. Hokkaido Univ. 49: 144 (1950). 

Type: Sine loc.: isol. ex tobacco, 1934, Y. Nakazawa (NRRL 

4791—culture ex neotype). 

ARTIcLE 65

ARTIcLE 


5a–b) attained 30–32 mm diam, sulcate, centrally raised 

2–3 mm, often sporulating heavily throughout but sometimes 

sporulation is delayed, conidial heads artemisia green (R47), 

sporulation from aerial branches pronounced, exudate clear 

when present, no soluble pigment, reverse uncolored in 

NRRL 5031, or brown in other isolates. Colonies grown 10 


Fig. 4. Aspergillus sydowi (NRRL 250), culture plates are 9 cm diam, colonies grown at 25 °C for 10 d. a. CYA colonies. b. CYA colony reverse. 

c. MEA colonies. d. MEA colony reverse. e. Smooth stipe, subglobose vesicle, and conidia, bar=10 µm. f. Penicillate conidiophore from aerial 

hyphae, bar=10 µm. g. Subglobose, spinulose conidia, bar=10 µm. 

Fig. 5. Aspergillus tabacinus (NRRL 4791), culture plates are 9 cm diam, colonies grown at 25 °C for 10 d. a. CYA colonies. b. CYA colony 

reverse. c. MEA colonies. d. MEA colony reverse. e. Smooth stipe, with clavate vesicle, and conidia, bar=10 µm. f. Globose, smooth-walled 


d on MEA at 25 °C (Fig. 5c–d) attained 17–30 mm diam, 

NRRL 4791 is velutinous and covered with funicular hyphal 

aggregates, NRRL 5031 and NRRL 62481 are floccose, 

sporulation in bluish-green shades, no exudate, no soluble 

pigment, reverse uncolored to cream or very pale yellow. 

Incubation for 7 d on CYA at 5 °C or 37 °C produced no 

growth or germination of conidia. 

66 ima funGuS

Stipes smooth walled (Fig. 5e), septate, hyaline to 

yellow with brownish tint, (70–)300–700(–900) × 4–8(–9) 

μm, vesicles pyriform to spatulate, (5–)8–15(–22) μm diam, 

conidial heads biseriate, metulae covering half to entire 

vesicle, 3–8(–9)um × 2.5–4.5(–5.5) μm, phialides 5–8(–11) 

× 2–3(–3.5) μm, fragmentary heads resembling penicillate 

fructifications abundant, conidia (Fig. 5f) spherical to 

subspherical, occasionally ellipsoidal, (2.5–)3–4(–7) μm, 

smooth walled. 

Aspergillus versicolor (Vuill.) Tirab., Annali Bot. 7: 9 

(1908). 


(Fig. 6a–g) 

Basionym: Sterigmatocystis versicolor Vuill., in Mirsky, Thèse 

de médicine (Nancy) 27:15 (1903). 

Type: Sine loc.: 1935, V. K. Charles (NRRL 238—culture ex 

neotype). 

Description: Colonies grown 10 d on CYA at 25 °C (Fig. 6a–b) 

attained 28–36 mm diam, sulcate, centrally raised 4–5 mm, 

sporulating well, conidial heads pale grayish green near 

tea green (R47), central area mealy from aggregated aerial 

hyphae, exudate present in mostly clear to pale pink shades 

(brownish red in one isolate), faint to very obvious pinkish 

soluble pigment, reverse vinaceous or brown or scarlet 

(NRRL 238). Colonies grown 10 d on MEA at 25 °C (Fig. 

6c–d) attained 21–31 mm diam, low, with funicular hyphal 

aggregates, sometimes dominating colony appearance, 

sporulating in pale to dark bluish green to gray green color, 

no exudate seen, soluble pigment yellow in some isolates, 

not present in others, reverse pale yellow, yellow orange 



Fig. 6. Aspergillus versicolor (NRRL 238), culture plates are 9 cm diam, colonies grown at 25 °C for 10 d. a. CYA colonies. b. CYA colony reverse. 

c. MEA colonies. d. MEA colony reverse. e. Bifurcating stipe producing two conidiophores, bar=50 µm. f. Smooth stipe, subglobose vesicle, and 

conidia, bar=10 µm. g. Globose conidia with roughened walls, bar=10 µm. 

or orange. Incubation for 7 d on CYA at 5 °C produced no 

growth or germination of conidia. Incubation for 7 d on CYA at 

37 °C produced growth up to 8 mm diam. 

Stipes (Fig. 6e–f) smooth, occasionally lightly tuberose, 

hyaline to yellow with brownish shades, (45–)200–750(– 

1050) × (4–)5–8(–12) μm, vesicles pyriform to spatulate, 

(6–)9–17(–20) μm in diam, conidial heads biseriate, metulae 

covering half to entire vesicle, 3–6(–9) × 2.5–4.5 μm, phialides 

(4–)5–7(–11) × 2–3 μm, fragmentary heads resembling 

penicillate fructifications occasionally present, conidia (Fig. 

6g) spherical to subspherical, occasionally ellipsoidal, (2–) 

2.5–3.5(–6.5) μm, finely roughened wall, hülle cells globose, 

produced by NRRL 5219 when grown on M40Y medium, but 

not other isolates. 

Observations: The ex-neotype culture NRRL 238 (isolated in 

1935) is quite different in appearance, particularly in production 

of dark red soluble pigment and scarlet colony reverse on 

CYA, from the more recent isolates that were placed in the 

ARS Culture Collection between 1970 and 1984. The more 

recent isolates (NRRL 5219, NRRL 13144, NRRL 13145 and 

NRRL 13146) are quite similar in appearance and are the 

primary basis of the phenotypic description. Although there is 

phenotypic distinction, all five isolates are A. versicolor based 

on DNA sequence analysis. 

New species 

Aspergillus austroafricanus Jurjevic, S. W. Peterson 

& B. W. Horn, sp. nov. 


(Fig. 7a–f) 

Etymology: Isolated from soil in South Africa. 

ARTIcLE 67

ARTIcLE 

Type: south Africa: Capetown, sent to C. Thom, 1922, V. 

A. Putterill ( BPI 880914 – holotype [from dried colonies of 

NRRL 233 grown 7 d at 25 °C on CYA and MEA]). 

Diagnosis: Conidia smooth-walled, no growth at 37 °C, 

produces reddish brown soluble pigment when grown on CYA. 


b) attained 23–24 mm diam, mounded, shallowly sulcate, 


Fig. 7. Aspergillus austroafricanus (NRRL 233), culture plates are 9 cm diam, colonies grown at 25 °C for 10 d. a. CYA colonies. b. CYA colony 

reverse. c. MEA colonies. d. MEA colony reverse. e. Smooth stipe, subglobose vesicle and conidia, bar=10 µm. f. Globose, smooth-walled 


Fig. 8. Aspergillus creber (NRRL 58583), culture plates are 9 cm diam, colonies grown at 25 °C for 10 d. a. CYA colonies. b. CYA colony reverse. 

c. MEA colonies. d. MEA colony reverse. e. Smooth stipe, subglobose vesicle, and conidia, bar=10 µm. f. Globose, finely roughened conidia, 

bar=10 µm. 

overgrowth by clumped hyphae making surface appear 

mealy, sporulating well, conidial heads near sage green 

(R47), sparse clear exudate, soluble pigment reddish brown, 

reverse dull brown. Colonies grown 10 d on MEA at 25 °C 

(Fig. 7c–d) attained 27 mm diam, velutinous, sporulation 

pale blue green, central hyphal tufts, no exudate, no soluble 

pigment, reverse yellowish orange. Incubation for 7 d on 

CYA at 5 °C or 37 °C produced no growth or germination 

of conidia. 

68 ima funGuS

Stipes (Fig. 7e) smooth walled, hyaline to yellowish, 

(40–)100–350(–500) µm × 3–5(–6) μm, vesicles pyriform to 

spatulate, (4–)6–12(–15) μm diam, conidial heads biseriate, 

metulae covering 1/3 to entire vesicle, 3–7(–9)um × 2.5–4.5 

μm, phialides (4–)5–7(–9) × (2–)2.5–3(–4) μm, fragmentary 


present, conidia (Fig. 7f) spherical to subspherical, 2.5–3.5 

(–4.5) μm, smooth walled. 

Aspergillus creber Jurjevic, S. W. Peterson & B. W. 

Horn, sp. nov. 


(Fig. 8a–f) 

Etymology: From the Latin word creber meaning numerous 

or frequent. 

Type: usA: California: isol. ex air sample, Nov. 2008, Z. 

Jurjevic (BPI 800912 – holotype; [from dried colonies of 


Diagnosis: Produces rough-walled conidia, no growth at 37 

°C, no soluble pigments formed on CYA or MEA, conidial 

color pea green or sage green on CYA and MEA. 


8a–b) attained 18–26 mm diam, radially sulcate, raised 3–5 

mm centrally, peripheral areas white or yellow, central area 

sporulating well, conidial heads pea green to artemisia green 

(R47), exudate when present yellowish to reddish, no soluble 

pigment, reverse clay colored to cinnamon or reddish brown 

(R29). Colonies grown 10 d on MEA at 25 °C (Fig. 8c–d) 

attained 18–22 mm diam, low to 1–2 mm mounded, often 

overgrown centrally with hyphae aggregated into funicles, 

sporulation in yellow-green shades (pea green to sage green 



Fig. 9. Aspergillus cvjetkovicii (NRRL 4642), culture plates are 9 cm diam, colonies grown at 25 °C for 10 d. a. CYA colonies. b. CYA colony 

reverse. c. MEA colonies. d. MEA colony reverse. e. Numerous conidiophores arising from the basal colony, bar=50 µm. f. Stipe, subglobose 

vesicle, and conidia, bar=10 µm. g. Globose, spinulose conidia, bar=10 µm. h. Globose hülle cell, bar=10 µm. 

R47), with ca 1 mm white border, one isolate (NRRL 231) 

with vivid brown soluble pigment, other isolates no soluble 

pigment, no exudate, reverse pale yellow orange or olive 

drab or orange brown. Incubation for 7 d on CYA at 5 °C or 

37 °C produced no growth or germination of conidia. 

Stipes (Fig. 8e) smooth walled, (10–)70–450(–650) x (3–) 

4–7(–8) μm, vesicles pyriform to spatulate and occasionally 

subglobose, (4–)7–17(–25) μm diam, conidial heads biseriate, 

metulae (3–)4–6(–8) x 2.5–4.5(–5) μm, phialides (4–)5–8(– 

10) x 2–3(–4) μm, conidia (Fig. 8f) spherical to subspherical, 

occasionally ellipsoidal to pyriform, (2.5–)3–4(–9) μm, finely 

roughened wall. 

Aspergillus cvjetkovicii Jurjevic, S. W. Peterson & B. 

W. Horn, sp. nov. 


(Fig. 9a–h) 

Etymology: Named in honor of Bogdan Cvjetković (University 

of Zagreb); pronunciation \`chet-kO-``vi-chi\. 

Type: usA: New Jersey: isol. ex soil, 1915, W. Wilson (BPI 

880909 – holotype [from dried colonies of NRRL 227 grown 7 

d at 25 °C on CYA and MEA]). 

Diagnosis: Produces spinulose conidia, no growth at 37 °C, 

colonies producing red exudate and red soluble pigment on 

CYA. 


b) attained 24–29 mm diam, radially sulcate, either centrally 

sunken or raised (2–3 mm), sporulating well, conidial heads 

white to cream in most isolates, pea green (R47) in NRRL 

58593, exudate generally abundant, reddish brown to orange 

cinnamon, reddish brown soluble pigment, reverse yellowish 

ARTIcLE 69

ARTIcLE 

red shades near orange cinnamon (R29) or tawny olive 


attained 17–36 mm diam, low, slightly sulcate, sporulating 

throughout in creamy yellow shades, NRRL 58593 conidia 

are yellowish green, NRRL 227 and NRRL 230 produce 

brown soluble pigment while NRRL 4642 and 58593 do not 

produce soluble pigment, reverse brownish orange or pale 

creamy yellow. Incubation for 7 d on CYA at 5 °C or 37 °C 


Stipes (Fig. 9e–f) smooth walled, hyaline to yellow, 

(40–)200–700(–850) × (3–)4–7(–8) μm, vesicles pyriform 

to spatulate, rarely subspherical, (5–)9–18(–23) μm diam, 

conidial heads biseriate, metulae covering half to entire 

vesicle, 3–6(–8) × 2.5–4.5 μm, phialides 5–8(–10) × 2–3(– 

4) μm, occasionally solitary phialides present up to 32 μm 

long, fragmentary heads resembling penicillate fructifications 

occasionally present, conidia (Fig. 9g) spherical to 

subspherical, occasionally ellipsoidal, (2–)2.5–3.5(–5) μm, 

spinulose, hülle cells (Fig. 9h) globose, sometimes present. 

Aspergillus fructus Jurjevic, S. W. Peterson & B. W. 



(Fig. 10a–g) 

Etymology: From fruit. 

Type: usA: California: isol. ex date fruit, 1939, Bliss (BPI 

880915 – holotype [from dried colonies of NRRL 239 grown 7 

d at 25 °C on CYA and MEA]). 

Diagnosis: Resembling A. versicolor growth at 37 °C, but 

forming shorter conidiophores 150–400 µm versus 200–750 

µm conidiophores in A. versicolor. 


Fig. 10. Aspergillus fructus (NRRL 239), culture plates are 9 cm diam, colonies grown at 25 °C for 10 d. a. CYA colonies. b. CYA colony reverse. 

c. MEA colonies. d. MEA colony reverse. e. Smooth stipe, spathulate vesicle, and conidia, bar=10 µm. f. Globose, finely roughened conidia, 

bar=10 µm. g. Globose hülle cell, bar=10 µm. 


10a–b) attained 29–39 mm diam, sulcate, centrally raised 

4–5 mm, funicular clumps of aerial hyphae abundant, 

sporulating well, conidial heads celandine green (R47), 

exudate clear to yellow, moderately abundant, soluble 

pigment clear, orange red in NRRL 239, reverse uncolored 

or mahogany red to orange-rufous (R2). Colonies grown 

10 d on MEA at 25 °C (Fig. 10c–d) attained 22–32 mm 

diam, slightly sulcate, centrally covered by hyphal tufts, 

sporulation in yellow-green hues near artemisia green 

(R47), no exudate, no soluble pigment, reverse uncolored 

or drab orange. NRRL 241 was floccose on MEA. Incubation 

for 7 d on CYA at 5 °C produced no growth or germination 

of conidia. Incubation for 7 d on CYA at 37 °C produced 

growth up to 4 mm diam. 

Stipes (Fig. 10e) smooth walled, hyaline to yellow, (50–) 

150–400(–500) × 4–7 µm, vesicles pyriform to spatulate, 

(6–)9–17(–21) μm diam, conidial heads biseriate, metulae 

covering half to entire vesicle, (2–)3–7(–9) × 2.5–4.5(–7) μm, 

phialides (5–)6–8(–11) × 2–3(–4) μm, fragmentary heads 

resembling penicillate fructifications abundant, conidia (Fig. 

10f) spherical to subspherical, occasionally ellipsoidal, (2–) 

2.5–3.5(–4.5) μm, finely roughened wall, hülle cells (Fig. 10g) 

globose, sometimes present. 

Aspergillus jensenii Jurjevic, S. W. Peterson & B. W. 



(Fig. 11a–g) 

Etymology: Named in honor of C. N. Jensen who first 

reported this species as Aspergillus globosus Jensen, a later 

homonym of A. globosus Link. 

70 ima funGuS

Type: usA: Montana: isol. ex air sample, Oct. 2008, Z. 

Jurjevic (BPI 880910 – holotype [from dried colonies of NRRL 

58600 grown 7 d at 25 °C on CYA and MEA]). 

Synonym: Aspergillus globosus Jensen, Cornell University 

Agricultural Experiment Station Bulletin 315: 482 (1912); non 

Link 1809. 

Diagnosis: Conidial walls roughened, no growth at 37 °C, 

conidial color near celandine, tawny olive to dark umber 

colony reverse on CYA. 


11a–b) attained 20–27 mm diam, radially sulcate, centrally 

raised or sunken, with clumped hyphal aggregates common 

in some isolates, sporulating moderately well, conidial heads 

celandine (R47) centrally and often white peripherally, 

exudate when present reddish brown or yellow brown, 

soluble pigment faint or intense yellow brown, in one case 

reddish brown, reverse tawny olive (R39) to dark brown near 

dark umber (R3). Colonies grown 10 d on MEA at 25 °C (Fig. 

11c–d) attained 17–30 mm diam, low, plane, most isolates 

have funicular tufts of aerial hyphae centrally, sporulating well 

in yellowish blue-green shades, no exudate seen, soluble 

pigment either light brown or reddish brown, brownish orange 

in one isolate, reverse pale yellow or orange or brownish 

red. Incubation for 7 d on CYA at 5 °C or 37 °C produced no 

growth or germination of conidia. 

Stipes (Fig. 11e) smooth walled, hyaline to yellow, 

occasionally with brownish shades, (45–)200–700(–1000) 

× (–3)4–7(–8) μm, vesicles pyriform to spatulate, rarely 

subspherical, (5–)7–16(–22) μm diam, conidial heads 

biseriate, metulae covering 1/3 to entire vesicle, 3–8 × 2.5– 

4(–5) μm, phialides (4–)5–8(–11) × 2–3 μm, rarely solitary 



Fig. 11. Aspergillus jensenii (NRRL 58671), culture plates are 9 cm diam, colonies grown at 25 °C for 10 d. a. CYA colonies. b. CYA colony reverse. 

c. MEA colonies. d. MEA colony reverse. e. Smooth stipe, subglobose vesicle, metulae and phialides, bar=10 µm. f. Penicillate conidiogenous 

cells from aerial hyphae, bar=10 µm. g. Globose, finely roughened conidia, bar=10 µm. 

phialides present up to 32 μm long and up to 4.5 μm diam, 

fragmentary heads resembling penicillate fructifications 

(Fig. 11f) commonly present, conidia (Fig. 11g) spherical to 

subspherical, occasionally ellipsoidal to pyriform, (2.5–)3– 

4.5(–7) μm, finely roughened wall, globose hülle cells 15–20 

µm diam produced by NRRL 58582 but not other isolates. 

Aspergillus puulaauensis Jurjevic, S. W. Peterson & 

B. W. Horn, sp. nov. 


(Fig. 12a–h) 

Etymology. Isolated near the Pu’u la’au Highway on Hawaii; 

pronunciation \pU-U-la-U-en-sis\ 

Type: usA: Hawaii: isol. ex dead hardwood branch, 2003, 

D.T. Wicklow (BPI 880911 – holotype [from dried colonies of 


Diagnosis: Isolates produce abundant hülle cells when grown 

on M40Y agar, no growth at 37 °C,. 


b) attained 22–25 mm diam, sulcate, centrally raised 5–6 mm 

with funicular hyphal clumps, sporulation light, conidial heads 

artemisia green (R47), exudate when present clear or reddish, 

soluble pigment when present brown, reverse yellowish to clay 

color (R39) or cinnamon (R29). Colonies grown 10 d on MEA at 

25 °C (Fig. 12c–d) attained 21–25 mm diam, sulcate or plane, 

low, velutinous, deep green (artemisia to lily green R47), no 

exudate seen, no soluble pigment, reverse pale yellow near 

chamois or pale orange. Incubation for 7 d on CYA at 5 °C and 

37 °C produced no growth or germination of conidia. 

Stipes (Fig. 12e) smooth walled, hyaline to yellow, (35–) 

100–500(–700) × (3–)4–7 μm, vesicles pyriform to spatulate, 

ARTIcLE 71

ARTIcLE 

occasionally subspherical, (5–)8–18(–21) μm diam, conidial 

heads biseriate, metulae covering half to entire vesicle, (3–)4– 

7(–9) × 2.5–4 μm, phialides 5–7(–10) × 2–3 μm, fragmentary 


present, conidia (Fig. 12h) spherical to ellipsoidal, (2.5–)3– 

4(–5.5) μm, finely roughened wall, hülle cells (Fig. 12f–g) 

spherical 11–19 µm diam seen in all isolates when grown on 

M40Y medium. 


Fig. 12. Aspergillus puulaauensis (NRRL 35641), culture plates are 9 cm diam, colonies grown at 25 °C for 10 d. a. CYA colonies. b. CYA colony 

reverse. c. MEA colonies. d. MEA colony reverse. e. Smooth stipe, vesicle, and conidia, bar=10 µm. f. Mass of hülle cells, bar=50 µm. g. Hülle 

cell, bar=10 µm. h. Globose conidia with finely roughened walls, bar=10 µm. 

Aspergillus subversicolor Jurjevic, S. W. Peterson & 

B. W. Horn, sp. nov. 


(Fig. 13a–f) 

Etymology: Beneath or at the foot of Aspergillus versicolor. 

Type: India: Karnataka: isol. ex green coffee berries, 1970, 

B. Muthappa (BPI 880918 – holotype [from dried colonies of 


Fig. 13. Aspergillus subversicolor (NRRL 58999), culture plates are 9 cm diam, colonies grown at 25 °C for 10 d. a. CYA colonies. b. CYA colony 

reverse. c. MEA colonies. d. MEA colony reverse. e. Smooth stipe, subglobose vesicle, and conidia, bar=10 µm. f. Subglobose, finely roughened 


72 ima funGuS

Diagnosis: Conidia rough-walled, no growth at 37 °C, growing 

slowly on all media, producing yellow soluble pigment on 

CYA but no exudate. 


13a–b) attained 18–20 mm diam, sulcate, raised 5–6 mm 

centrally, wrinkled, sporulating sparsely, conidial heads 

artemisia green (R47), no exudate, soluble pigment faint 

yellow, reverse tawny (R15) to ochraceous orange. Colonies 

grown 10 d on MEA at 25 °C (Fig. 13c–d) attained 12–14 mm 

diam, low, plane, velutinous, sporulating in bluish green color 

(artemisia R47), no exudate, no soluble pigment, reverse 

brownish orange. Incubation for 7 d on CYA at 5 °C or 37 °C 


Stipes (Fig. 13e) smooth walled, hyaline to slightly 

brownish, (60–) 250–450 (–550) × 4–7(–10) μm, vesicles 

pyriform to subglobose (6–)10–17(–22) μm diam, conidial 

heads biseriate, metulae covering half to entire or rarely 1/3 of 

vesicle, (3–)4–7(–9) × (2–)2.5–4 μm, bearing 2–3 ampuliform 

phialides, 5–8(–10) × 2–3 μm, fragmentary heads resembling 


13f) spherical to subspherical, occasionally ellipsoidal to 

pyriform, (2.5–)3–4(–7) μm, finely roughened wall. 

Aspergillus tennesseensis Jurjevic, S. W. Peterson 

& B. W. Horn, sp. nov. 


(Fig. 14a–f) 

Etymology: Isolated in Tennessee. 

Type: usA: Tennessee: isol. ex toxic dairy feed, 1984, B.W. 

Horn (BPI 880917 – holotype [from dried colonies of NRRL 




Fig. 14. Aspergillus tennesseensis (NRRL 13150), culture plates are 9 cm diam, colonies grown at 25 °C for 10 d. a. CYA colonies. b. CYA 

colony reverse. c. MEA colonies. d. MEA colony reverse. e. Smooth stipe, pyriform vesicle, and conidia, bar=10 µm. f. Globose, finely roughened 


Diagnosis: Producing rough-walled conidia, no growth at 37 

°C, conidial color slate green when grown on MEA. 


b) attained 22–30 mm diam, composed of a loose hyphal 

mat, radially sulcate, centrally raised or sunken, overgrown 

by clumps of aerial hyphae in some isolates, sporulating well 

centrally, pea green to artemisia green (R47), scant clear 

exudate usually present, soluble pigment absent, reverse 

in brownish orange shades near honey yellow or chamois 


attained 20–46 mm diam, low, plane, velutinous, sporulating 

in dark green color near slate green (R47), no exudate, 

no soluble pigment, reverse uncolored, pale lemon yellow, 

or pale brown. Incubation for 7 d on CYA at 5 °C or 37 °C 


Stipes (Fig. 14e) smooth walled, hyaline to yellowish with 

brownish shades, (35–)100–300(–400) × 4–7 μm, vesicles 

pyriform, (7–)10–16(–18) μm diam, conidial heads biseriate, 

metulae covering half to entire vesicle, 4–6(–8) × 2.5–4 μm, 

phialides 5–8(–11) × 2–3 μm, fragmentary heads resembling 


14f) spherical to subspherical, occasionally ellipsoidal to 

pyriform, (2.5–)3–4(–8) μm, finely roughened wall. 

Aspergillus venenatus Jurjevic, S. W. Peterson & B. 

W. Horn, sp. nov. 


(Fig. 15a–h) 

Etymology: Producing toxins. 

Type: usA: Tennessee: isol. ex toxic dairy feed, 1984, B.W. 

Horn (BPI 880916 – holotype [from dried colonies of NRRL 


ARTIcLE 73

ARTIcLE 

Diagnosis: Producing spinulose conidia, no growth at 37 °C, 

producing no exudate or soluble pigments on CYA or MEA. 


15a–b) attained 22–31 mm diam, radially sulcate, sporulating 

centrally in artemisia green (R47) to deep bluish gray-green 

(R42) in one isolate, no exudate, no soluble pigment, reverse 

deep olive buff to tawny or brown (R15). Colonies grown 10 

d on MEA at 25 °C (Fig. 15c–d) attained 17–24 mm diam, 

lightly sulcate, low, central tufted funicular aggregates of 

aerial hyphae, sporulating well in deep green color near slate 

green (R47), no exudate, no soluble pigment, reverse pale 

lemon yellow, chamois, or light olive drab. Incubation for 7 d 

on CYA at 5 °C or 37 °C produced no growth or germination 

of conidia. 

Stipes (Fig. 15e) smooth walled, hyaline to yellow with 

brownish shades, (20–)100–400(–500) × 4–7 µm, vesicles 

pyriform to spatulate, (6–)9–17(–21) μm diam, conidial 

heads biseriate, metulae covering half to entire vesicle, (3–) 

4–7(–9) × 2.5–4(–5) μm, phialides (5–)6–8(–11) × 2–3(3.5) 

μm, fragmentary heads resembling penicillate fructifications 

(Fig. 15f) commonly present, hülle cells (Fig. 15g) spherical, 

present in some isolates, conidia (Fig. 15h) spherical to 

subspherical, occasionally ellipsoidal to pyriform, 3–4(–6) μm 

diam, spinulose. 

Phenotypic species recognition. 

Growth rates of species on different media are presented in 

Table 2. 

Phenotypic recognition of species in section Versicolores 

is based on smooth, roughened or spinulose conidia, conidial 

color, exudate and soluble pigment colors on CYA and MEA, 

growth rates and ability to grow at 37 °C, and on the uniform 

presence of hülle cells in one species. 


Fig. 15. Aspergillus venenatus (NRRL 13147), culture plates are 9 cm diam, colonies grown at 25 °C for 10 d. a. CYA colonies. b. CYA colony 

reverse. c. MEA colonies. d. MEA colony reverse. e. Smooth stipe, spathulate vesicle, and conidia, bar=10 µm. f. Penicillate conidiogenous cells 

on aerial hyphae, bar=10 µm. g. Globose hülle cells, bar=10 µm. h. Globose, spinulose conidia, bar=10 µm. 

Aspergillus cvjetkovicii, A. sydowii and A. venenatus 

isolates produce spinulose conidia. A. sydowii isolates grow 

at 37 °C, while A. cvjetkovicii and A. venenatus isolates do 

not. A. cvjetkovicii isolates produce reddish exudate and 

soluble pigment on CYA, while A. venenatus isolates produce 

no exudate or soluble pigment. 

Aspergillus amoenus, A. austroafricanus and A. tabacinus 

produce smooth-walled conidia. Of these only A. amoenus 

isolates grow at 37 °C. A. tabacinus isolates produce no 

soluble pigment and A. austroafricanus produces reddish 

brown soluble pigment when grown on CYA. 

The remaining eight species produce conidia with 

noticeably roughened walls, but the ornamentation is not 

pronounced enough to be considered spinulose. Two of the 

eight species, A. versicolor and A. fructus, have roughened 

conidial walls and grow at 37 °C. These two species are very 

similar but have somewhat distinct stipe lengths of 150–400 

µm in A. fructus versus 200–750 µm in A. versicolor. We 

examined only two A. fructus isolates and five A. versicolor 

isolates and while separation of these species using 

phenotype on standard media appears possible, until more 

isolates are seen, it is recommended that strains be identified 

from gene sequences such as beta tubulin or calmodulin. 

Genealogical concordance species recognition clearly 

distinguishes these sibling species (Fig. 1). 

Species with roughened conidia that do not grow at 37 °C 

are A. protuberus, A. creber, A. jensenii, A. puulaauensis, A. 

subversicolor and A. tennesseensis. Aspergillus protuberus 

isolates on CYA produce a red exudate (near scarlet 

R1) and a vinaceous or yellow soluble pigment, and MEA 

cultures are floccose. A. jensenii isolates produce brown 

CYA colony reverse colors from tawny olive to dark umber, 

and conidial color is near celandine green (R47). All A. 

puulaauensis isolates produce spherical hülle cells when 

74 ima funGuS

grown on M40Y medium and the species is distinguished by 

this consistent character. One isolate each of A. versicolor 

and A. amoenus (both grow at 37 °C) and one isolate of A. 

jensenii also produced hülle cells on M40Y. A. subversicolor 

isolates are relatively slow growing on MEA and M40Y 

(Table 2) and produce faint yellow soluble pigment on CYA. 

A. tennesseensis, when grown on MEA produce very dark 

green conidial areas (near slate green R47) not produced by 

other rough-spored species in the section. Aspergillus creber 

isolates produce no soluble pigment on either CYA or MEA, 

and conidial color on either medium is pea green to sage 

green (R47). 

There is considerable variation in colony appearance 

within species and considerable overlap in colony appearance 

between species, making species separation within section 

Versicolores challenging. In addition, some of the isolates 

included in this study were propogated in vitro for several 



table 2. Colony diameters (mm) of section Versicolores species on various media after 7d. Incubation at 25 °C except where noted. 

species cyA MeA cy20 M40y M60y cyA at 37 °c 

A. amoenus 20–29 11–15 11–20 14–22 15–24 6 

A. austroafricanus 18–19 16–17 24–25 18–19 17–18 - 

A. creber 17–23 11–15 15–22 18–23 19–24 - 

A. cvjetkovicii 15–21 14–17 17–20 16–24 15–25 - 

A. fructus 13–20 10–16 9–17 10–23 10–20 4 

A. jensenii 16–20 9–13 15–20 21–26 22–28 - 

A. protuberus 17–25 11–18 14–22 21–24 20–24 - 

A. puulaauensis 18–21 11–12 17–19 19–22 18–21 - 

A. subversicolor 13–14 6–7 10–11 15–16 16–18 - 

A. sydowii 20–25 20–25 21–26 23–26 23–27 8 

A. tabacinus 21–26 12–16 21–26 8–23 8–23 - 

A. tennesseensis 20–22 12–14 17–19 19–22 19–22 - 

A. venenatus 14–17 8–10 15–16 19–23 17–21 - 

A. versicolor 20–26 10–18 19–22 21–26 22–25 8 

table 3. Predicted species identity based on ITS genotype and correlation of ITS genotypes and species in section Versicolores. ITS geneotypes 

were assigned arbitrary letter designations and species are determined by genealogical concordance. 

ITS genotype Predicted species 

A A. amoenus, A. fructus, A. protuberus, A. tabacinus, A. versicolor 

B A. subversicolor 

C A. austroafricanus 

D A. cvjetkovicii, A. jensenii, A. tennesseensis, A. venenatus 

E A. sydowii 

F A. sydowii 

G A. amoenus 

H A. tabacinus 

I A. creber, A. versicolor 

J A. puulaauensis 

K A. creber 

L A. creber 

M A. jensenii 

N A. creber 

decades prior to preservation by lyophilization. Among those 

isolates, several appear to have mutated and consequently 

produce colonies that have a wet appearance when grown on 

CYA or produce only moist aerial aggregates of hyphae with 

little sporulation. Identification of these degenerate strains 

relies on DNA sequence analysis. DNA sequence analysis 

is the most reliable means for identifying species within this 

section. 

ITS region genotypes from species in section Versicolores 

are presented in Table 3. Some genotypes are shared by two 

or more species. Genotype A is present in isolates of five 

different species and genotype D is present in four different 

species of the section. Isolates of some species, such as A. 

creber (genotypes I, K, L N), display two to four ITS genotypes 

within species. 

ARTIcLE 75

ARTIcLE 

dIscussIoN 

Initial phenotypic examination of Aspergillus section 

Versicolores isolates was made using CYA cultures grown for 

7 d at 25 °C (Klich & Pitt 1988). Those cultures did not provide 

sufficient data to reliably identify the species. Subsequently 

we tried culturing the isolates for 10 d at 25 °C on CYA to 

allow for further development of exudate, soluble pigment and 

conidial color. Raper & Fennell (1965) used incubation times 

of generally 10–14 d. We found that incubation for 10 d is 

necessary for characterizing isolates of section Versicolores. 

Only four of the available genetic loci were used in 

preparing the combined data tree (Fig. 1). The ITS region 

was not included because it contained few informative 

nucleotides and because its veracity as a phylogenetic 

indicator is questionable (Galagan et al. 2005). The ITS data 

themselves however may be of interest for bar-coding studies 

(discussed later). The beta tubulin sequences from section 

Versicolores are of the “two intron” type and probably have 

a different evolutionary origin than the “three intron” type of 

beta tubulin found in the out-group species (Peterson 2008). 

Because of the suspected paralogy of this molecule, it was 

not included in the combined data tree. It was included as 

a possible target for DNA sequence-based identification of 

isolates. 

Henig (1966) in his work on systematics required that 

all taxa be monophyletic. When working with phenotypic 

characters in section Versicolores, it was difficult to identify 

the informative characters that could satisfy Henig’s 

requirement. Analysis of DNA sequences from unlinked 

loci using concordance (Taylor et al. 2000, Dettman et al. 

2003) makes it possible to define monophyletic groups. 

Phylogenetic recognition of species occasionally makes it 

necessary to accept cryptic species (Perrone et al. 2011) 

because the phenotypic characters of the species overlap 

with their siblings to such an extent that the species cannot 

be reliably identified without molecular tools. For NRRL 530 

and NRRL 13151 that form single isolate lineages, reliable 

characters to define the species have not been found, but 

with the identification of additional isolates it may be possible 

to phenotypically characterize and subsequently name these 

species. For A. versicolor and A. fructus the limited number 

of isolates and the observed intraspecific variation reduce 

confidence in the current phenotypic recognition of the 

species, but the phylogenetic data are unequivocal and so A. 

fructus was described as new. 

Prior to this publication A. versicolor was a species with 

documented genetic and phenotypic variation that did not 

resolve into clearly recognizable species. Fourteen species 

are now known in section Versicolores and the ITS region 

variation is ca. 3 % as calculated from the data herein. By 

comparison ca. 4 % variation is found in the Petromyces 

clade (Aspergillus sect. Flavi) between P. flavus and P. 

nomius and 14 species have been named (Varga et al. 

2009). In the Petromyces clade, one species may possess 

a phenotype very similar to another species (Kurtzman et 

al. 1987, Peterson et al. 2001, Soares et al., 2012). While 

the validity of some species in the Petromyces clade have 

been questioned (Varga et al. 2009), phylogenetic distinction 

has served to validate species (Peterson 2008, Varga 


et al. 2009) regardless of the phenotypic similarities or 

overlapping character states of the species. Peterson (2008) 

suggested that sect. Versicolores could easily be dropped 

from Aspergillus taxonomy. This much broader study of 

A. versicolor sensu lato isolates suggests that section 

Versicolores should be retained as a monophyletic and useful 

subgeneric designation. 

Aspergillus versicolor is the most reported fungal species 

in section Versicolores from damp indoor environments 

(Jussila 2003, Rydjord et al. 2005) and its presence is used 

as an indicator of Sick Building Syndrome (SBS) (Schwab & 

Straus 2004). We amplified each newly described species 

using A. versicolor-specific primers (Dean et al. 2005; data 

not shown) and obtained a positive signal in all cases except 

for A. subversicolor and A. sydowii; therefore the primer set 

retains its usefulness. In A. creber and A. jensenii some 

isolates did not amplify even though the genotypes were 

identical with isolates that did amplify, suggesting degradation 

or incorrect quantitation of the genomic DNA. 

Twenty-four sect. Versicolores isolates in this study were 

obtained by one of us (ZJ) from air samples in buildings, but 

none comprised A. versicolor sensu stricto (Table 1). Of the 

five A. versicolor isolates examined, three were isolated from 

a single lot of toxic cattle feed in the USA and the substrate for 

the other two isolates, one from the USA and the other from 

South Africa, was not recorded. The species is widespread 

geographically, but was not commonly encountered among 

the isolates used in this study. Aspergillus creber was the 

most frequently isolated species from indoor air samples in 

the USA (13 strains from six states), followed by A. protuberus 

(five strains from two states) and A. jensenii (four strains from 

three states). Aspergillus versicolor sensu stricto may not be 

common in buildings. Two other species, A. cvjetkovicii and 

A. puulaauensis, were each isolated once from indoor air. The 

other newly described species, A. fructus, A. austroafricanus, 

A. subversicolor, A. tennesseensis and A. venenatus, were 

isolated from plant material or had unknown sources (Table 

1). Amend et al. (2010) reported that fungi isolated from 

indoor air sources (e.g., dust, carpet) are highly diverse in 

the temperate regions of the world and are much less diverse 

in tropical regions. Therefore, our strains from indoor air 

samples from the USA in addition to culture collection strains 

from many regions of the world may represent much of the 

diversity present in section Versicolores. 

There is considerable interest in using ITS sequences 

for bar-coding identification of fungi, particularly for largescale 

ecological studies (Begerow et al. 2010, Schoch et al. 

2012). In section Versicolores species, one particular ITS 

genotype is present in isolates of five different species and 

another genotype is found in four different species (Table 3). 

Because ITS genotypes do not uniquely identify species in 

this section, use of multiple loci is the most reliable means 

of DNA sequence-based identification in section Versicolores 

(Peterson 2012). 

Viable propagules of A. versicolor have been recovered 

from the highly saline Dead Sea (Kis-Papo et al. 2003), 

showing an ability to survive conditions of salinity or drying. 

The ARS Culture Collection contains a few putative A. 

versicolor isolates obtained from brined meats in the UK. 

Upon sequence and phenotypic analysis, these isolates were 

76 ima funGuS

identified as three species, A. amoenus, A. tabacinus and A. 

protuberus, all of which occur in the A. versicolor subclade 

(Fig. 1). Additionally, A. creber NRRL 6544, from the A. 

sydowii subclade, was isolated from a tar ball floating in the 

Atlantic Ocean. High tolerance to salinity may extend to other 

species in section Versicolores. Aspergillus versicolor has 

also been identified from dust collected in the International 

Space Station (Vesper et al. 2008). In addition to CYA and 

MEA we used high sugar content media (CY20S, M40Y 

and M60Y) containing 20, 40 or 60 % sucrose, respectively. 

All isolates grew well on all of the media (Table 2), with no 

noticable reduction in growth rates even on M60Y medium. 

Species from section Versicolores have a remarkably broad 

tolerance for a wide range of water activity of their substrates. 

Aspergillus versicolor isolates produce the aflatoxin 

precursor sterigmatocystin, a compound that is mutagenic 

and tumorigenic (Veršilovskis & Saeger 2010). Animal feed 

infested with three morphotypes of A. versicolor, all of which 

produce sterigmatocystin, have been implicated in dairy 

animal toxicosis, but it is unknown whether sterigmatocystin 

caused the toxicosis (Vesonder & Horn 1985). Those 

three morphotypes are now identified as A. versicolor, A. 

tennesseensis and A. venenatus, and as these species 

occur in the two main subclades of section Versicolores 

(Fig. 1), sterigmatocystin production may be present in 

additional species. The distribution of section Versicolores 

species in agricultural commodities and their role in 

stigmatocystin toxicoses require additional study. In addition 

to sterigmatocystin, recent studies have revealed numerous 

metabolites with biological activities (Finefield et al. 2011, Lee 

et al. 2011) from A. versicolor sensu lato Jaio et al. (2007) 

discovered novel nucleotide analogs from A. puulaauensis 

which was reported under the name A. versicolor. 

Aspergillus versicolor has been implicated as the 

causitive agent of disseminated aspergillosis in dogs (Zhang 

et al. 2012), has probably caused aspergillosis in transplant 

recipients (Baddley et al. 2009), and has been isolated 

from the infected eye of a patient suffering from HIV (Perri 

et al. 2005). We included two section Versicolores clinical 

isolates in our study. NRRL 254 was identified as A. sydowii 

and NRRL 226, originally identified as A. versicolor, is here 

identified as A. amoenus. Because of different sensitivities 

of fungal species to fungal antibiotics, a more detailed study 

of A. versicolor clinical isolates might be of value to guide 

appropriate therapeutic regimens (Pfaller et al. 2011). 


We thank Amy E. McGovern for valuable technical support. Patricia 

Eckel kindly advised us on Latin usage. David L. Hawksworth 

advised us on some nomenclatural issues. The authors thank 

Donald T. Wicklow (USDA, Peoria, IL) and Lynne Sigler (University 

of Alberta, Edmonton, Alberta) for the gift of Hawaiian and Canadian 

isolates. Mention of a trade name, proprietary product, or specific 

equipment does not constitute a guarantee or warranty by the United 

States Department of Agriculture and does not imply its approval to 

the exclusion of other products that may be suitable. USDA is an 

equal opportunity provider and employer. 



reFereNces 

Amend AS, Seifert KA, Samson R, Bruns TD (2010) Indoor fungal 

composition is geographically patterned and more diverse in 

temperate zones than in the tropics. Proceedings of the National 


Anderson B, Frisvad JC, Sondergaard I, Rasmussen IB, Larsen LS 

(2011) Associations between fungal species and water-damaged 

building materials. Applied and Environmental Microbiology 77: 

4180–4188. 

Baddley JW, Marr KA, Andes DR, Walsh TJ, Kauffman CA, 

Kontoyiannis DP, Ito JI, Balajee SA, Pappas PG, Moser SA (2009) 

Patterns of susceptibility of Aspergillus isolates recovered from 

patients enrolled in the transplant-associated infection surveillance 

network. Journal of Clinical Microbiology 47: 3271–3275. 

Baum DA, Shaw KL (1995) Genealogical perspectives on the species 

problem. In: Experimental and Molecular Approaches to Plant 

Biosystematics (PC Hoch & AG Stephenson, eds): 289–303. St 

Louis. Mo: Missouri Botanical Garden. 

Begerow D, Nilsson H, Unterseher M, Maier W. (2010) Current state 

and perspectives of fungal DNA barcoding and rapid identification 

procedures. Applied Microbiology and Biotechnology 87: 99– 

108. 

Dean TR, Roop B, Betancourt D, Menetrez MY (2005) A simple 

multiplex polymerase chain reaction assay for the identification 

of four environmentally relevant fungal contaminants. Journal of 

Microbiological Methods 61: 9–16. 

Dettman JR Jacobson DJ, Turner E, Pringle A, Taylor JW (2003) 

Reproductive isolation and phylogenetic divergence in 

Neurospora: comparing methods of species recognition in a 

model eukaryote. Evolution 57: 2721–2741. 

Domsch KH, Gams W, Anderson TH (1980) Compendium of Soil 

Fungi Vol. 1. Academic Press, UK. 

Edmondson DA, Barrios CS, Brasel TL, Straus DC, Kurup VP, Fink 

JN (2009) Immune response among patients exposed to molds. 

International Journal of Molecular Sciences 10: 5471-5484. 

Engelhart S, Loock A, Skutlarek D, Sagunski H, Lommel A, Farber 

H, Exner M (2002) Occurrence of toxigenic Aspergillus versicolor 

isolates and sterigmatocystin in carpet dust from damp indoor 

environments. Applied and Environmental Microbiology 68: 

3886–3890. 

Finefield JM, Sherman DH, Tsukamoto S, Williams RM (2011) 

Studies on the biosynthesis of the notoamides: synthesis of an 

isotopomer of 6-hydroxydeoxybrevianamide E and biosynthetic 

incorporation into notoamide J. Journal of Organic Chemistry 76: 

5954–5958. 

Galagan JE, Calvo SE, Cuomo C, Ma L-J, Wortman JR, Batzoglou 

S, Lee S-I, Batürkmen M, Spevak CC, Clutterbuck J, Kapitonov 

V, Jurka J, Scazzocchio C, Farman M, Butler J, Purcell S, 

Harris S, Braus GH, Draht O, Busch S, D’Enfert C, Bouchier 

C, Goldman GH, Bell-Pedersen D, Griffiths-Jones S, Doonan 

JH, Yu J, Vienken K, Pain A, Freitag M, Selker EU, Archer DB, 

Peñalva MA, Oakley BR, Momany M, Tanaka T, Kumagai T, Asai 

K, Machida M, Nierman WC, Denning DW, Caddick M, Hynes 

M, Paoletti M, Fischer R, Miller B, Dyer P, Sachs MS, Osmani 

SA, Birren BW (2005) Sequencing of Aspergillus nidulans and 

comparative analysis with A. fumigatus and A. oryzae. Nature 

438: 1105–1115. 

Gams W, Christensen M, Onions AHS, Pitt JI, Samson RA (1985) 

Infrageneric taxa of Aspergillus. In: Advances in Penicillium and 

ARTIcLE 77

ARTIcLE 

Aspergillus Systematics (RA Samson & JI Pitt, eds): 55–64. New 

York: Plenum Press. 

Hennig W (1966) Phylogenetic Systematics. [English translation.] 

Urbana, IL: University of Illinois Press. 

Huelsenbeck JP, Ronquist F (2001) MRBAYES: Bayesian inference 

of phylogenetic trees. Bioinformatics 17: 754–755. 

Jiao P, Murdur SV, Gloer JB, Wicklow DT (2007) Kipukasins, 

nucleoside derivatives from Aspergillus versicolor. Journal of 

Natural Products 70: 1308–1311. 

Jussila J (2003) Inflammatory Responses in Mice after Intratracheal 

Instillation of Microbes Isolated from Moldy Buildings. Helsinki, 

Finland: National Public Health Institute. 

Kis-Papo T, Kirzhner V, Wasser SP, Nevo, E (2003) Evolution of 

genomic diversity and sex at extreme environments: fungal life 

under hypersaline Dead Sea stress. Proceedings of the National 


Klich MA (1993) Morphological studies of Aspergillus section 

Versicolor and related species. Mycologia 85: 100–107. 

Klich MA (2002) Identification of Common Aspergillus Species. 

Utrecht: Centraalbureau voor Schimmelcultures. 

Klich MA, Pitt JI (1988) A Laboratory Guide to Common Aspergillus 

Species and Their Teleomorphs. North Ryde, NSW: CSIRO. 

Kozakiewicz Z (1989) Aspergillus species on stored products. 

Mycological Papers 161: 1–188. 

Kurtzman CP, Horn BW, Hesseltine CW (1987) Aspergillus nomius, 

a new aflatoxin-producing species related to Aspergillus flavus 

and Aspergillus tamarii. Antonie van Leeuwenhoek 53: 147– 

158. 

Lee YM, Dang HT, Li J, Zhang P, Hong J, Lee CO, Jung JH (2011) A 

cytotoxic fellutamide analogue from the sponge-derived fungus 

Aspergillus versicolor. Bulletin of the Korean Chemical Society 

32: 3817–3820. 

Mbata TI (2008) Isolation of fungi in hyper saline Dead Sea water. 

Sudanese Journal of Public Health 3: 170–172. 

Mills JT, Abramson D (1986) Production of sterigmatocystin by 

isolates of Aspergillus versicolor from western Canadian 

stored barley and rapeseed/canola. Canadian Journal of Plant 

Pathology 82: 151–153. 

Moreno G, Arenas R. (2010) Other fungi causing onychomycosis. 

Clinics in Dermatology 28: 160–163. 

Nielsen KF (2003) Mycotoxin production by indoor molds. Fungal 

Genetics and Biology 39: 103–117. 

Perri P, Campa C, Incorvaia C, Parmeggiani F, Lamberti G, 

Costagliola C, Sebastian A (2005) Endogenous Aspergillus 

versicolor endophthalmitis in an immuno-competent HIV-positive 

patient. Mycopathologia 160: 259–261. 

Perrone G, Stea G, Epifani F, Varga J, Frisvad JC, Samson RA (2011) 

Aspergillus niger contains the cryptic phylogenetic species A. 

awamori. Fungal Biology 115: 1138–1150. 

Peterson SW (2008) Phylogenetic analysis of Aspergillus species 

using DNA sequences from four loci. Mycologia 100: 205–226. 

Peterson SW (2012) Aspergillus and Penicillium identification using 

DNA sequences: barcode or MLST? Applied Microbiology and 

Biotechnology DOI 10.1007/s00253-012-4165-2. 

Peterson SW, Ito Y, Horn BW, Goto T. (2001) Aspergillus bombycis, 

a new aflatoxigenic species and genetic variation in its sibling 

species, A. nomius. Mycologia 93: 689–703. 

Peterson SW, Jurjevic Z, Bills GF, Stchigel AM, Guarro J, Vega FE 

(2010) The genus Hamigera, six new species and multilocus 

DNA sequence based phylogeny. Mycologia 102: 847–864. 


Pfaller MA, Castanheira M, Diekema DJ, Messer SA, Jones RN (2011) 

Triazole and echinocandin MIC distributions with epidemiological 

cutoff values for differentiation of wild-type strains from non-wildtype 

strains of six uncommon species of Candida. Journal of 

Clinical Microbiology 49: 3800–3804. 

Pitt JI (1980) [“1979”] The Genus Penicillium and Its Teleomorph 

States Eupenicillium and Talaromyces. London: Academic Press. 

Pitt JI, Hocking AD (2009) Fungi and Food Spoilage. 3rd edn. London: 

Springer Verlag. 

Raper KB, Fennell DI (1965) The Genus Aspergillus. Baltimore, MD: 

Williams & Wilkins. 

Ridgway R (1912) Color Standards and Color Nomenclature. 

Washington, DC: Ridgway. 

Ronquist F, Huelsenbeck JP (2003) MrBayes3: Bayesian phylogenetic 

inference under mixed models. Bioinformatics 19:1572–1574. 

Rydjord B, Hetlandy G, Wikerz HG (2005) Immunoglobulin G 

antibodies against environmental moulds in a Norwegian healthy 

population shows a bimodal distribution for Aspergillus versicolor. 

Scandinavian Journal of Immunology 62: 281–288. 

Samson RA, Houbraken J, Summerbell RC, Flannigan B, Miller 

JD (2001) Common and important species of fungi and 

actinomycetes in indoor environments. In: Microorganisms in 

Home and Indoor Work Environments (B. Flannigan, RA Samson 

& JD Miller, eds): 287–292. London: Taylor and Francis. 

Schoch CL, Seifert KA, Huhndorf S, Robert V, Souge JL, Levesque 

CA, Chen W, Fungal Barcoding Consortium (2012) Nuclear 

ribosomal internal transcribed spacer (ITS) region as a universal 

DNA barcode marker for Fungi. Proceedings of the National 


Schwab CJ, Straus DC (2004) The roles of Penicillium and Aspergillus 

in sick building syndrome. Advances in Applied Microbiology 55: 

215–238. 

Shelton BG, Kirkland KH, Dana W (2002) Profiles of airborne fungi in 

buildings and outdoor environments in the United States. Applied 

and Environmental Microbiology 68: 1743–1753. 

Soares C, Rodrigues P, Peterson SW, Lima N, Venâncio A (2012) 

Three new species of Aspergillus section Flavi isolated from 

almonds and maize in Portugal. Mycologia: doi:10.3852/11-088. 

Swofford DL (2003) PAUP*: Phylogenetic Analysis Using Parsimony 

(*and Other Methods). Version 4. Sunderland, MA: Sinauer 

Associates. 

Taylor JW, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, Hibbett 

DS, Fisher MC (2000) Phylogenetic species recognition and 

species concepts in fungi. Fungal Genetics and Biology 31: 

21–32. 

Thom C, Church MB (1926) The Aspergilli. Baltimore, MD: Williams 

& Wilkins. 

Thom C, Raper KB (1945) Manual of the Aspergilli. Baltimore, MD: 

Williams & Wilkins. 

Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTALW: improving 

the sensitivity of progressive multiple sequence alignments 

through sequence weighting, position-specific gap penalties and 

weight matrix choice. Nucleic Acids Research 22: 4673–4680. 

Tuomi T, Reijula K, Johnsson T, Hemminki K, Hintikka EL, Llindroos 

O, Kalso S, Koukila-Kähkölä P, Mussalo-Rauhamaa H, Haahtela 

T (2000) Mycotoxins in crude building materials from waterdamaged 

buildings. Applied and Environmental Microbiology 66: 

1899–1904. 

Varga J, Frisvad JC, Samson RA. (2009) A reappraisal of fungi 

producing aflatoxins. World Mycotoxin Journal 2: 263−277 

78 ima funGuS

Veršilovskis A, Saeger SD (2010) Sterigmatocystin: occurrence 

in foodstuffs and analytical methods – an overview. Molecular 

Nutrition and Food Research 54: 136–147. 

Vesonder RF, Horn BW (1985) Sterigmatocystin in dairy cattle 

feed contaminated with Aspergillus versicolor. Applied and 

Environmental Microbiology 49: 234–235. 

Vesper SJ, Wong W, Kuo CM, Pierson DL (2008) Mold species in dust 

from the International Space Station identified and quantified by 



mold-specific quantitative PCR. Research in Microbiology 159: 

32–435. 

Zhang S, Corapi W, Quist E, Griffin S, Zhang M (2012) Aspergillus 

versicolor, a new causative agent of canine disseminated 

aspergillosis. Journal of Clinical Microbiology 50: 187–191. 

ARTIcLE 79

ARTICLE 

79-S1 

Supplementary InformatIon 

BT2 locus, 643 characters: 534 are constant 

45 are variable but parsimony-uninformative 

64 are parsimony-informative;


1 


Supplemental Fig. 2 


Calmodulin locus, 694 characters: 510 are constant 

86 are variable but parsimony-uninformative 

98 are parsimony-informative; 18 mp trees 

CI=0.8617, RC=0.8337 

80 

- 

NRRL 4770 T A. asperescens 

100 

1.0 

87 

1.0 

100 

1.0 

100 

1.0 

NRRL 58984 

NRRL 58673 

NRRL 58607 

NRRL 58606 

NRRL 58601 

NRRL 58597 

NRRL 58592 

NRRL 6544 

T 

NRRL 231 

NRRL 58675 

NRRL 58672 

NRRL 58612 

A. creber 

NRRL 58587 

NRRL 58584 

NRRL 58583 

NRRL 25627 

NRRL 35641 T 

NRRL 227 

NRRL 58602 A. puulaauensis 

T 

NRRL 58593 

NRRL 4642 

NRRL 230 

A. cvjetkovicii 

NRRL 13147 T 

NRRL 229 

NRRL 13150 

NRRL 13152 

NRRL 13151 Aspergillus sp. 

NRRL 13148 

NRRL 13149 

A. venenatus 

T 

NRRL 234 

A. tennesseensis 

NRRL 58600 T 

NRRL 225 

NRRL 240 

NRRL 235 

NRRL 58671 

NRRL 237 

NRRL 58674 

A. jensenii 

NRRL 4791 T 

NRRL 226 

NRRL 236 

NRRL 4838 


NRRL 35600 

NRRL 5031 

NRRL A-23173 

T 

84 

1.0 

84 

1.0 

100 

1.0 

86 

1.0 

A. amoenus 

A. tabacinus 

NRRL 238 T 

NRRL 13146 

NRRL 13145 

NRRL 13144 

NRRL 5219 

NRRL 239 T 

NRRL 241 

NRRL 3505 

NRRL 58748 

NRRL 58747 

NRRL 58613 

T 

A. versicolor 

A. fructus 

NRRL 58990 

NRRL 58991 

NRRL 58942 

T 

NRRL 233 A. austroafricanus 

NRRL 250 T 

A. protuberus 

NRRL 5585 

NRRL 4768 

NRRL 254 

A. sydowii 

NRRL 58999 T 

100 

1.0 

97 

1.0 

93 

- 

A. subversicolor 

Fig. S2. Phylogenetic tree based on calmodulin sequences; Bayesian posterior probabilities and bootstrap values based on 1000 replicates are 

placed on the internodes where values are significant. 

ARTICLE 

79-S2

ARTICLE 

79-S3 


1 



Mcm7 locus, 616 characters: 476 are constant, 

72 are variable but parsimony-uninformative, 68 

are parsimony-informative; 2 mp trees, 

CI=0.8324, RC=0.8074 

100 

1.0 

NRRL 238 T 

NRRL 5219 

93 

NRRL 13146 

1.0 

NRRL 13145 

NRRL 13144 

94 

.93 

85 

.99 

NRRL 58600 T 

NRRL 225 

NRRL 58674 

NRRL 58671 

NRRL 240 

NRRL 237 

NRRL 235 

NRRL 6544 

NRRL 58592 

NRRL 58597 

NRRL 58607 

NRRL 58601 

NRRL 58673 

NRRL 58984 

T 

NRRL 58675 

NRRL 231 

NRRL 58584 

NRRL 58583 

NRRL 25627 

NRRL 58587 

NRRL 58612 

NRRL 58672 

NRRL 35641 T 

NRRL 58606 

NRRL 58602 

NRRL 227 T 

NRRL 58593 

NRRL 4642 

NRRL 230 

NRRL 4791 T 

NRRL 5031 

NRRL A-23173 

NRRL 239 T 

NRRL 241 

NRRL 3505 

NRRL 58748 

NRRL 58747 

NRRL 58613 

T 

NRRL 226 

NRRL 35600 A. amoenus 

NRRL 236 


A. tabacinus 

T 


NRRL 58991 

A. fructus 

NRRL 58990 

NRRL 58942 A. protuberus 

NRRL 4770 T 

NRRL 4838 

A. asperescens 

T 

95 

1.0 

87 

86 1.0 

1.0 

99 

1.0 

100 

1.0 

A. creber 


A. jensenii 

A. puulaauensis 

NRRL 229 

NRRL 13152 

NRRL 13150 


T 

87 

1.0 

NRRL 234 


NRRL 13147 T 

NRRL 13148 

NRRL 13149 

A. venenatus 

NRRL 58999 T 

100 

1.0 


A. versicolor 

Fig. S3. Phylogenetic tree based on Mcm7 locus sequences; Bayesian posterior probabilities and bootstrap values based on 1000 replicates are 


ima fUNGUS


10 



RPB2 locus, 1011 characters: 801 are constant, 


are parsimony-informative; 6 mp trees, 

CI=0.7935, RC=0.7585. 


89 

- 

94 

1.0 

100 

1.0 

100 

1.0 

89 

.96 

NRRL 3505 T 

NRRL 58999 T A. subversicolor 

NRRL 4770 T A. asperescens 

NRRL 58600 T 

NRRL 225 

NRRL 58674 

NRRL 58671 

NRRL 240 

NRRL 237 

NRRL 235 

A. jensenii 

NRRL 35641 T 

NRRL 227 

NRRL 58602 


T 

NRRL 13147 

NRRL 4642 

NRRL 230 

NRRL 58593 


T 

NRRL 13149 

NRRL 13148 

A. venenatus 

NRRL 229 

NRRL 13150 

NRRL 13152 


T 

NRRL 58606 

NRRL 58592 

NRRL 58673 

NRRL 58601 

NRRL 58597 

NRRL 6544 

NRRL 58984 

NRRL 58607 


NRRL 234 

T 

NRRL 58587 

NRRL 58672 

NRRL 58675 

NRRL 58612 

NRRL 58584 

NRRL 58583 

NRRL 231 

A. creber 

NRRL 25627 

NRRL 238 T 

NRRL 13146 

NRRL 13145 

NRRL 13144 

NRRL 5219 

NRRL 4791 T 

NRRL 239 

NRRL A-23173 

NRRL 5031 

T 

NRRL 241 

NRRL 226 

NRRL 35600 

NRRL 4838 

NRRL 236 


NRRL 58613 

NRRL 58991 

NRRL 58990 

NRRL 58942 

NRRL 58748 

NRRL 58747 

T 

NRRL 250 

A. versicolor 

A. fructus 

A. tabacinus 

A. amoenus 

T 


T 

100 

1.0 

95 

1.0 

100 

1.0 

100 

1.0 

99 

1.0 

NRRL 254 

100 

1.0 

NRRL 4768 

NRRL 5585 

A. sydowii 

100 

1.0 

97 

1.0 

82 

1.0 

98 

1.0 

100 

1.0 

94 

A. protuberus 

1.0 

100 

1.0 

Fig. S4. Phylogenetic tree based on RPB2 locus sequences; Bayesian posterior probabilities and bootstrap values based on 1000 replicates are 


ARTICLE 

79-S4

ARTICLE 

79-S5 


1 


NRRL 58600 T 

NRRL 35641 

NRRL 225 

NRRL 237 

NRRL 235 

NRRL 58671 

NRRL 240 

NRRL 58674 

A. jensenii 

T 


NRRL 58602 

NRRL 227 T 

NRRL 13147 

NRRL 58593 

NRRL 4642 

NRRL 230 


T 

NRRL 13149 

NRRL 13148 

NRRL 229 

A. venenatus 

NRRL 13150 

NRRL 13152 


T 

NRRL 58597 

NRRL 58673 

NRRL 58592 

NRRL 58606 

NRRL 6544 

NRRL 58601 

NRRL 58984 

NRRL 58607 

NRRL 234 


T 

NRRL 58587 

NRRL 58672 

NRRL 58675 

NRRL 231 

NRRL 25627 

NRRL 58583 

A. creber 

NRRL 58612 

NRRL 58584 

NRRL 238 T 

NRRL 13144 

NRRL 13146 

NRRL 13145 

NRRL 5219 

NRRL 4791 T 

NRRL A-23173 

NRRL 5031 

NRRL 239 T 

NRRL 241 

NRRL 3505 

NRRL 58613 

NRRL 58748 

NRRL 58747 

T 

NRRL 226 

NRRL 35600 

NRRL 4838 

NRRL 236 


NRRL 58942 

NRRL 58991 

NRRL 58990 

T 

NRRL 250 

A. amoenus 

A. versicolor 

A. tabacinus 

A. fructus 

T 


T 

NRRL 254 

NRRL 4768 

NRRL 5585 

A. sydowii 

A. protuberus 

NRRL 58999 T 


NRRL 4770 T 


Tsr1 locus, 841 characters: 638 are constant, 


are parsimony-informative; >100 mp trees, 

CI=0.7882, RC=0.7523 

98 

1.0 

95 

1.0 

98 

1.0 

94 

1.0 

96 

1.0 

93 

1.0 

99 

1.0 

71 

.98 

78 

.99 

100 

1.0 

97 

1.0 

93 

1.0 

99 

1.0 

99 

1.0 

100 

1.0 

96 

1.0 

97 

.90 

A. asperescens 

Fig. S5. Phylogenetic tree based on Tsr1 locus sequences; Bayesian posterior probabilities and bootstrap values based on 1000 replicates are 


ima fUNGUS

ARTIcLE 

ima funGuS

doi:10.5598/imafungus.2012.03.01.08 










the impacts of the discontinuation of dual nomenclature of pleomorphic 

fungi: the trivial facts, problems, and strategies 

Uwe Braun 

Martin-Luther-Universität, Institut für Biologie, Bereich Geobotanik und Botanischer Garten, Herbarium, Neuwerk 21, 06099 Halle (Saale), 

Germany; corresponding author’s e-mail: uwe.braun@botanik.uni-halle.de 

Abstract: The symposium “One fungus = Which name” held in Amsterdam 12–13 April 

2012, addressed the drastic changes in the naming of pleomorphic fungi adopted by the 18th International Botanical Congress in Melbourne in 2011. Possible solutions and ways to face 

resulting problems were suggested. The fundamental change is that under the new rules 

fungi in future will be treated nomenclaturally like plants and all other groups of organisms 

ruled by the ICN, i.e. with one correct name for each species. Numerous discussions and 

statements during the Symposium reflected widespread anxieties that these rules could 

negatively influence taxonomic work on pleomorphic fungi. However, they are groundless, 

being based on misunderstandings and confusion of nomenclature and taxonomy. With 

pleomorphic fungi, taxonomists will in future have to answer the question whether different 

morphs can represent one fungus (taxon), but this remains a taxonomic decision and has 

nothing to do with nomenclature. Furthermore, the ICN does not and cannot rule on how 

this decision is made. Thus it cannot provide rules based solely on methods involving 

morphology in vivo or in vitro, molecular analyses, physiological and biochemical data, 

inoculation experiments in pathogenic groups or any other methods or combinations of 

them. It is up to the taxonomist to select appropriate methods and to decide which data 

are sufficient to introduce new taxa. Some future problems and strategies around the 

application of anamorph- and teleomoph-typified taxon names (genera and species), are 

discussed here, using the recently monographed powdery mildews (Erysiphales) as an 

example. 

Article info: Submitted: 21 May 2012; Accepted: 1 June 2012; Published: 21 June 2012. 

INtroductIoN 

During the KNAW-CBS Fungal Diversity Centre-organized 

symposium “One fungus = One name” held in Amsterdam 

in April 2011 ways to overcome dual nomenclature in 

pleomorphic fungi were discussed culminating in the 

“Amsterdam declaration” (Hawksworth et al. 2011) with 

recommendations on how to deal with such fungi in future. 

However, all aspects of this declaration did not receive 

general acceptance, and opposing arguments were also 

presented and published (Gams et al. 2011). A few months 

later, the sweeping decisions of the 18 th International 

Botanical Congress in Melbourne, Australia, in July 2011 

nullified the opposing viewpoints, discussions and proposals 

of the first Amsterdam Symposium, rendering the Amsterdam 

Declaration a ‘fait accompli’. 

Various proposals to emend the International Code 

of Botanical Nomenclature adopted by the Melbourne 

Congress caused worldwide surprise to most mycologists 

and can be considered revolutionary. The possibility to 

Key words: 

anamorph 

Article 59 

Erysiphales 

fungi 

International Code of Nomenclature for algae 

fungi, and plants 

teleomorph 

publish valid diagnoses or descriptions of new taxa in English 

besides Latin in future, the recognition of effective electronic 

publications of new taxa under certain, defined conditions, 

the mandatory requirement to deposit new fungal names in 

a recognized repository, the renaming of the Code (now the 

“International Code of Nomenclature for algae, fungi, and 

plants”), and some other changes have been accepted by 

the overwhelming majority of mycologists and are welcome. 

Detailed discussions and explanations of the Melbourne 

decisions have been published by Hawksworth (2011), Knapp 

et al. (2011), and Norvell (2011). However, the abolition of the 

special provisions of the previous Art. 59 of the ICN, allowing 

the separate naming of morphs of pleomorphic fungi, which 

was based on the most drastic ‘floor’ proposal concerning 

this Article made by Scott A. Redhead (the Secretary of a 

Committee appointed by the Vienna Congress in 2005 to 

address this matter) among two other less drastic ones (Norvell 

2011), was unexpected and a shock to most mycologists. After 

the first shock, followed by deeper objective considerations 

of the consequences, advantages and disadvantages of the 

ARTIcLE 

81

ARTIcLE 

new rules for fungi I came to the conclusion that these drastic 

changes are probably the best solution, since they provide 

a good prospect of more stability and flexibility in future 

and should prevent endless discussions and attempts to 

modify the old Art. 59. However, reactions and comments by 

numerous mycologists worldwide after the first symposium 

held in Amsterdam in 2011 (“One fungus = One name”) and 

the Melbourne decisions, as well as various discussions 

during the second Amsterdam conference in 2012 (“One 

fungus = Which name?”) revealed widespread anxieties that 

the new rules could negatively influence future taxonomic 

work with pleomorphic fungi. Viewed objectively, however, 

most of the discussed problems and obvious reservations are 

mainly based on a confusion of nomenclature and taxonomy, 

i.e. they have nothing to do with the changed rules and reflect 

a widespread misunderstanding concerning the function of 

the Code. 

Various problems and open questions have already been 

addressed by Gams et al. (2012), and the present paper 

adds to the debate by addressing some further more minor 

points. Strategies to overcome problems and to prepare the 

mycological community for the enormous load of work caused 

by the new rules are also discussed using powdery mildews 

(Erysiphales) as an example. Comments, explanations and 

proposals summarized in this paper are based on a lecture 

given during the second Amsterdam symposium, discussions 

during this meeting, and other critical notes, enquiries and 

discussion between the first and second Amsterdam symposia. 

geNerAl Notes, ProBleMs, ANd 

strAtegIes 

special problems at the generic level 

At the generic level, the new rules provide obvious advantages 

and more freedom for the application of anamorph-typified 

genus names, which are now treated equally for priority 

purposes, so that they may now be used as holomorph 

names, i.e. for all morphs belonging to one fungus. Names of 

an anamorph-typified genus and a teleomorph-typified genus 

now compete nomenclaturally, if they belong to one taxon (“one 

fungus”). If in this case the anamorph genus represents the 

oldest valid and legitimate name, and it is the most widely used 

and preferred, (e.g. Aspergillus, Cladosporium, Penicillium), 

this name has priority over any younger meiosporic genus 

and can be applied and used immediately as the name for 

all morphs involved (holomorph). This applies, for instance, 

in the case of Cladosporium Link 1816, v. Davidiella Crous & 

U. Braun 2003. If anamorph-typified genera are younger but 

nevertheless preferred, proposals may be made in future to 

accept these genus names. If a teleomorph-typified genus 

name is younger, it may also be proposed as the name for 

all morphs. The procedures for such proposals, which can be 

submitted as Lists of entire fungal groups, are outlined in Art. 

4.13 and Art. 56.3 of the new version of the Code. Hence, in 

future we have a high degree of flexibility in the application of 

competing names at generic rank. 

However, problems in the application of genus names 

are usually connected with their typification and taxonomic 

implications. Anamorph as well as teleomorph genera are 

Braun 

ruled by typification, i.e. by their type species. In cases where 

we indeed have “one fungus” that deserves “one name”, 

decisions regarding synonymy can be made on the basis of 

molecular examinations (preferred), associated development 

of anamorphs and teleomorphs in culture or any other 

methods. This is not under the jurisdiction of the Code. As 

the application of all fungal names is ruled by their types, it 

is necessary to have convincing data for the type species 

of both, the anamorph-typified genus and the teleomorphtypified 

genus, showing that the taxa concerned are, indeed, 

congeneric. However, we have often only molecular or other 

indications that certain anamorph and teleomorph genera are 

probably congeneric merely based on data derived from nontype 

species. Fortunately in such cases, the synonymy of 

these generic names can also be proposed. This is then just 

a taxonomic decision leading to a proposal which in any case 

is allowed and is not under the jurisdiction of the Code. The 

Code only rules which name has to be adopted in this case of 

facultative synonymy. Any treatments and concepts of genera 

are possible, e.g. widening or reducing the circumscriptions, 

and in an extreme case reducing them to a monotypic genus 

only containing the type species, and these modifications are 

only nomenclaturally, not taxonomically, ruled by the Code. 

Other problems, also discussed during the Amsterdam 

Symposium in April this year, concern the naming of often 

numerous phylogenetically unproven species previously 

assigned to a certain anamorph genus whose name, based on 

its type species, is now considered synonymous with (part of) 

a holomorph name. Allocations of species to certain genera 

are taxonomic decisions, not ruled by the Code, and can be 

done on the basis of any method, ranging from morphology to 

molecular sequence analysis. If an anamorph-typified generic 

name is reduced to synonymy with a teleomorph-typified 

generic name, based on molecular data referring to their two 

type species, it would be theoretically possible, but not in all 

cases advisable, to re-allocate all species names previously 

assigned to the anamorph genus to the teleomorph genus 

name that now has priority. The phylogenetically unproven 

species can be retained in the anamorph genus, which is 

then only a facultative (heterotypic) synonym. 

According to the new Art. 59, names published prior to 

1 January 2013 for the same taxon, but based on different 

morphs, are neither considered to be alternative names 

according to Art. 34.2 nor superfluous names according to 

Art. 52.1, i.e. they are legitimate if not illegitimate due to other 

reasons. Such synonyms are valid names, and valid names 

remain available for use. Therefore, such anamorph generic 

names may be retained and used for morphologically similar 

species with unproven phylogenetic affinity. Another case 

concerns the names of anamorph-typified genera having 

priority over competing names of teleomorph-typified genera 

or younger names being given priority following a proposal to 

use them in future for all morphs. In these cases, all species 

with unproven affinity may remain alongside type species 

with proven phylogenetic affinity and other phylogenetically 

proven species awaiting future clarification of their status 

and affinity. This is possible and may be advisable since 

any assignment of species to a genus is just a taxonomic 

decision, as explained above. The only alternative would be 

to re-allocate such unproven species to another genus, if 

82 ima funGuS

available, or even to introduce a new genus for them, which 

would result in numerous new genera and new combinations. 

That is not quite what was intended by the new rules. In 

such cases, the genera concerned remain paraphyletic or 

even polyphyletic for a certain time until the phylogenetic 

positions of all species assigned to these genera are known 

and confirmed. This is acceptable and possible in the interim. 

Monophyletic genera are the goal, but it will be a long time 

before all fungal genera can be correctly assigned in this way. 

For a considerable period of time we will need paraphyletic 

and even polyphyletic genera. These must be recognized as 

recently emphasized by Gams et al. (2012) with whom I fully 

agree. 

As already mentioned, concepts and circumscriptions 

of genera, including phylogenetic aspects (monophyly, 

paraphyly, polyphyly) are taxonomic decisions not under the 

jurisdiction of the Code. First priority should be given to the 

biodiversity at species level. All newly encountered species 

have to be named so that they are determinable for all 

users, ranging from ecologists, phytopathologists, physicians 

engaged in human pathogenic fungi to researchers in 

fungal genetics and physiology. The correct allocation to 

an appropriate, whenever possible monophyletic, genus is 

important, but has only secondary priority. 

Facts and problems at the species level and 

below 

Changes in the Code become immediately effective when 

ratified by the final Plenary Sesssion of an International 

Botanical Congress, unless another date is specified. In 

the case of dual nomenclature, this ended on 30 July 2012, 

from which date anamorph-typified and teleomnorph-typified 

names compete on an equal nomenclatural footing. However, 

a period of immunity to the end of 2012 was allowed so as 

not to disrupt works in press which introduced new names for 

different states of the same species. Thus, as Hawksworth 

(2011: 158) stressed, “After 1 January 2013, one fungus 

can only have one name, the system of permitting separate 

names to be used for anamorphs then ends”. This statement 

is not wrong, but needs to be clarified as it can cause 

misunderstandings and confusion since it only refers to new 

names introduced after 1 January 2013. As already mentioned 

above, names based on different morphs for the same taxon 

published before 1 January 2013, are to be considered 

neither as alternative nor nomenclaturally superfluous names 

(according to Art. 59 of the Melbourne Code). Hence, such 

names, including those of anamorphs, remain legitimate but 

compete with teleomorph-typified names. 

Another question concerns the conditions applying when 

one fungus can only have one name in future. The future 

introduction of alternative names for different morphs is 

only forbidden if an author definitely states that the morphs 

concerned belong to one fungus (taxon), independent of 

the scientific methods that led to this conclusion. If such a 

statement (or taxonomic treatment) is lacking, possibly due 

to uncertainty on the part of an author, it will still be possible 

in future to give two names. Furthermore, other authors could 

come to a more definite conclusion. They might, for instance, 

state that the merging of the two morphs in one fungus is 

incorrect and not justified, e.g. due to different cryptic taxa 


Impacts of the discontinuation of dual nomenclature 

being involved and confused. Then the statement that only 

one fungus is present cannot be upheld and the two morphs 

must be given separate names. This is again solely a 

taxonomic decision. 

Another possible scenario concerns two different morphs 

independently and validly described by different authors as 

new species after 1 January 2013. When the two morphs 

(species) later prove to be conspecific, they have to be 

merged under application of the priority rule, i.e. the younger 

name just becomes a heterotypic synonym of the older one 

but remains legitimate and valid. This is another example 

where in future, after 1 January 2013, one fungus may have 

two legitimate and valid names. 

Implication of nomenclature and taxonomy 

“One fungus = One name” is the premise of the changed Article 

59 of the Melbourne Code, but the basic question is which 

criteria should be used to decide whether different morphs 

actually belong together as one fungus (taxon). It is solely up 

to the taxonomist to determine these criteria and the methods 

to answer this question (in this respect previous practices are 

not different). This question cannot be answered by the Code, 

and it is not the role of the Code to define criteria for “one 

fungus”. These criteria are tightly connected with technical 

possibilities and methods of taxonomic work that develop 

continuously and often rapidly. The Code simply rules the 

nomenclature and was not created to interfere in taxonomic 

questions and decisions. Any method is just a method and 

not sacrosanct; even molecular results are often debatable 

and open to interpretation. There are still many unanswered 

questions, many of which may never be finally answered as 

they depend on scientific (technical) progress. For instance: 

is a certain difference in the ITS sequences sufficient? Do 

we need several markers? If so, which markers and how 

many at different taxonomic levels? What percentage of 

genetic similarity of samples (populations) is sufficient to 

classify them as a single species? Do connections between 

anamorphs and teleomorphs have to be sufficiently proven by 

molecular analyses? Etc. Different authors will have different 

opinions and answers to these questions, and we cannot 

expect to reach any kind of general agreement on them. 

Authors will be influenced by differences in circumscriptions 

of taxa, e.g. whether they are sensu lato or sensu stricto, 

the presence of different evaluations of certain characters, 

the discovery of cryptic species, etc. Taxonomy is always a 

combination of objective facts and subjective interpretations 

of results. Hence, even uniform data may result in different 

taxonomic conclusions by different authors. There are no 

objective, universal criteria for, and definitions of, taxonomic 

ranks like order, family or genus, and the most difficult 

lasting problem concerns the question “what is a species?” 

Indeed, it is often quoted that a ‘species’ is in the eye of the 

beholder! There is no general answer, but careful individual 

taxonomic interpretations are necessary for any particular 

taxon. Different taxonomic concepts and interpretations are 

always in competition with each other, and the best solutions 

prevail, following their eventual adoption by applicants and 

users of names. We had good and bad taxonomy in previous 

times and will have it in future, but whether it is good or bad 

does not depend on the methods applied, and taxonomy 

ARTIcLE 83

ARTIcLE 

Braun 

table 1. Current names in Erysiphales proposed for inclusion in a List of accepted names where there is an earlier anamorph-typified name 

available (placed in bold type and listed as a synonym). 

Erysiphe arcuata U. Braun, S. Takam. & Heluta, Schlechtendalia 16: 99 (2007). 

Synonym: oidium carpini Foitzik, in Braun, Powdery Mildews Eur.: 222 (1995). 

Erysiphe azaleae (U. Braun) U. Braun & S. Takam., Schlechtendalia 4: 5 (2000). 

Basionym: Microsphaera azaleae U. Braun, Mycotaxon 14: 370 (1982). 

Synonym: oidium ericinum Erikss., Meddn Kungl. Landtbr.-Akad. Exper. 1: 47 (1885). 

Erysiphe buhrii U. Braun, Česka Mykol. 32: 80 (1978). 

Synonyms: Erysiphe pisi var. buhrii (U. Braun) Ialongo, Mycotaxon 44: 255(1992). 

oidium dianthi Jacz., Karm. Opred. Gribov 2 (Muchnisto-rosyanye griby): 461 (1927). 

Erysiphe caricae U. Braun & Bolay, in Bolay, Cryptog. Helv. 20: 46 (2005). 

Synonyms: Oidium caricae F. Noack, Bol. Inst. Agron. Estado São Paulo 9: 81 (1898). 

Acrosporum caricae (F. Noack) Subram., Hyphomycetes: 835 (1971). 

Oidium papayae Marta Sequ., Garcia de Orta, sér. Est. Agron. 18: 24 (1992). 

Erysiphe catalpae S. Simonyan, Mikol. Fitopatol. 18: 463 (1984). 

Synonym: oidium bignoniae Jacz., Ezhegodnik 5: 247 (1909). 

Erysiphe celosiae Tanda, Mycoscience 41: 15 (2000). 

Synonym: oidium amaranthi R. Mathur et al., Indian Phytopath. 24: 64 (1971). 

Erysiphe cruciferarum Opiz ex L. Junell, Svensk. Bot. Tidskr. 61: 217 (1967). 

Synonyms: Erysiphe cruciferarum Opiz, Lotos 5: 42 (1855), nom. inval. (Art. 32). 

E. pisi var. cruciferarum (Opiz ex L. Junell) Ialongo, Mycotaxon 44: 255 (1992). 

oidium matthiolae Rayss, Palestine J. Bot., Jerusalem ser. 1: 325 (1940) [“1938–1939”]. 

Erysiphe oehrensii (Havryl.) U. Braun & S. Takam., Schlechtendalia 4: 11 (2000). 

Basionym: Microsphaera oehrensii Havryl., Mycotaxon 49: 259 (1993). 

Synonym: oidium robustum U. Braun & Oehrens, Mycotaxon 25: 268 (1986). 

Erysiphe quercicola S. Takam. & U. Braun, Mycol. Res. 111: 819 (2007). 

Synonym: Oidium anacardii Noack, Bol. Inst. Estado São Paulo 9: 77 (1898). 

Golovinomyces biocellatus (Ehrenb.) Heluta, Ukr. bot. Zh. 45(5): 62 (1988). 

Basionym: Erysiphe biocellata Ehrenb., Nova Acta Phys.-Med. Acad. Caes. Leop.-Carol. Nat. Cur. 10: 211 (1821). 

Synonyms: Erysibe biocellata (Ehrenb.) Link, Sp. Pl., edn 4, 6(1): 109, 1824) [as ‘biocellaris’]. 

Oidium erysiphoides Fr., Syst. mycol. 3: 432 (1832). 

Golovinomyces magnicellulatus (U. Braun) Heluta, Ukr. bot. Zh. 45(5): 63 (1988). 

Basionym: Erysiphe magnicellulata U. Braun, Feddes Repert. 88: 656 (1978). 

Synonyms: E. cichoracearum var. magnicellulata (U. Braun) U. Braun, Nova Hedwigia 34: 695 (1981). 

oidium drummondii Thüm., Mycoth. Univ 12: no. 1177 (1878). 

Golovinomyces sonchicola U. Braun & R.T.A. Cook, in Cook & Braun, Mycol. Res. 113: 629 (2009). 

Synonym: oidium sonchi-arvensis Sawada, Bull. Dept. Agric. Gov. Res. Inst. Formosa 24: 34 (1927). 

Golovinomyces verbasci (Jacz.) Heluta, Ukr. bot. Zh. 45(5): 63 (1988). 

Basionym: Erysiphe cichoracearum f. verbasci Jacz., Karm. Opred. Gribov 2 (Muchnisto-rosyanye griby): 224 (1927). 

Synonyms: E. verbasci (Jacz.) S. Blumer, Beitr. Krypt.-Fl. Schweiz 7(1): 284 (1933). 

oidium balsamii Mont., Ann. Mag. Nat. Hist., sér. 2, 13: 463 (1854). 

leveillula rutae (Jacz.) U. Braun, in Braun & Cook, CBS Biodiversity Series 11: 205 (2012). 

Basionym: Leveillula taurica f. rutae Jacz., Karm. Opred. Gribov 2 (Muchnisto-rosyanye griby): 417 (1927). 

Synonyms: L. rutae (Jacz.) Durrieu & Rostam, Cryptog. Mycol. 5: 291 (1985) [“1984”]; comb. inval. (Art. 33.3). 

Oidium haplophylli Magnus, Verh. zool.-bot. Ges. Wien 50: 444 (1900). 

Ovulariopsis haplophylli (Magnus) Trav., Atti Accad. Sci. Veneto-Trentino-Istriana 6: 1 (1913). 

84 ima funGuS


based on molecular approaches is not per se superior over 

morphotaxonomy. 

Opinions and proposals to restrict descriptions of new 

taxa, above all species, in future to those accompanied by data 

of molecular sequence analyses have been discussed, but 

they are unrealistic and must be refused. Molecular support 

of new taxa is advisable, very useful and should be included 

whenever possible, but its inclusion cannot and should not be 

mandatory. This would be a kind of unacceptable “molecular 

censorship” that would inhibit taxonomic work in several parts 

of the world or would even force certain mycologists to give 

up taxonomic work. Also, fungi of certain groups cannot be 

cultivated at all; in other cases it may be very difficult to get 

cultures or to extract DNA, and further to be confident that 

the DNA is from the target fungus and not a contaminant. 

Furthermore, there would be a drastic cut in taxonomic input 

from amateur mycologists, who study various important 

fungal groups in, for instance, agaricology, and lichenology. 

Indeed, we need all available resources for the inventory of 

worldwide fungal diversity. Demands to insert a particular 

method like molecular sequence analysis in the Code as 

being essential for valid publication would undoubtedly not 

gain general acceptance. Such a requirement could only be 

indirectly applied, outside the Code, by particular journals 

making this a requirement for the acceptance of new species 

descriptions. However, it is unrealistic to believe that such 

policies could ever be a way of preventing publication of new 

taxa not following such a dictat. Editors of other journals will 

disagree, and publications of new taxa in books would not 

follow the rule. 

Concepts for names in powdery mildews 

(Erysiphales) – an example 

A new updated taxonomic monograph of the powdery mildews 

has recently been published (Braun & Cook 2012). Within this 

group of obligate plant pathogens, clear connections between 

anamorph and teleomorph genera (e.g. Blumeria with Oidium 

s. str., Erysiphe with Pseudoidium, Golovinomyces with 


Impacts of the discontinuation of dual nomenclature 

Oidiopsis haplophylli (Magnus) Rulamort, Bull. Soc. Bot. Centre-Ouest 17: 191 (1986). 

Phyllactinia ampelopsidis Y.N. Yu & Y.Q. Lai, Acta Microbiol. Sin. 19: 14 (1979). 

Synonym: Ovulariopsis ampelopsidis-heterophyllae Sawada, Bull. Dept. Agric. Gov. Res. Inst. Formosa 61: 8 (1933). 

Phyllactinia chubutiana Havryl. et al. Mycoscience 47: 238 (2006). 

Synonyms: oidium insolitum U. Braun et al., Sydowia 53: 35 (2001). 

Ovulariopsis insolita (U. Braun et al.) Havryl. et al., Mycoscience 47: 238 ( 2006). 

Phyllactinia gmelinae U. Braun & Bagyan., Sydowia 51: 1 (1999). 

Synonyms: Phyllactinia suffulta var. gmelinae Patil, Curr. Sci. 30: 156 (1961); nom. inval. (Art. 36). 

P. gmelinae Hosag. et al., Indian J. Trop. Biol. 1: 318 (1993); nom. inval. (Art. 37.6). 

ovulariopsis gmelinae-arboreae Hosag. et al., Indian J. Trop. Biol. 1: 316 (1993). 

Phyllactinia populi (Jacz.) Y.N. Yu, in Yu & Lai, Acta Microbiol. Sin. 19: 18 (1979). 

Basionym: Phyllactinia suffulta f. populi Jacz., Karm. Opred. Gribov 2 (Muchnisto-rosyanye griby): 439 (1927). 

Synonym: Ovulariopsis salicis-warburgii Sawada, Bull. Dept. Agric. Gov. Res. Inst. Formosa 61: 89 (1933). 

Euoidium) are evident and proven by means of morphology 

and molecular sequence analyses. All anamorph-typified 

genera are younger than the corresponding teleomorphtypified 

genera (except for Oidium) and hence will be 

younger facultative synonyms in future, but nevertheless 

they will remain legitimate and valid. Anamorph genera play 

an important role in the taxonomy of powdery mildews and 

reflect phylogenetic relations within this fungal group. Indeed 

they provided crucial evidence for the recent re-classification 

of all the holomorph genera. On the other hand, at species 

level anamorph species (unlike the anamorph genera) and 

particularly the conidial stages of powdery mildew species 

are morphologically often poorly differentiated and of little 

diagnostic value. Therefore, teleomorphs traditionally prevail 

in the taxonomy at species level. Hence, in all cases it is 

proposed to give preference to teleomorph-typified names 

when they are threatened by anamorph names. 

There is only a single generic problem in powdery 

mildews, viz. the anamorph genus Oidium Link 1824, with its 

type species Oidium monilioides, which is the anamorph of 

Blumeria graminis, the type species of the teleomorph genus 

Blumeria Golovin ex Speer 1974. Hence, Oidium would be an 

older name for Blumeria, and “Oidium graminis” would be the 

correct name for the powdery mildew of grasses and cereals 

in future; this is, of course, unacceptable, and Blumeria will 

be proposed as the accepted generic name for this taxon. 

Most powdery mildew anamorphs are morphologically 

poorly differentiated at species level, and it is often difficult 

to truly distinguish separate species in the absence of 

the teleomorph. However, their relations to teleomorphic 

genera are almost always clear. Host switches often occur 

in glass houses, and also in nature, usually connected with 

anamorph growth but lacking the teleomorph. Even results 

of molecular sequence analyses are often not helpful here 

due to a lack of data from other specimens for comparision 

or other problems. Hence descriptions of anamorph-typified 

taxa should be avoided, also in future, but when new 

descriptions are intended, they should only be based on 

ARTIcLE 85

ARTIcLE 

86 

striking morphological differences combined, if possible, with 

molecular data, and the taxa concerned should preferably be 

assigned to the existing anamorph genera, which can also be 

used in future as they remain legitimate, valid, and available, 

as already explained. Descriptions of anamorph-typified new 

species in Erysiphe, Golovinomyces, Neoërysiphe and other 

teleomorph-typified genera are in future of course also valid 

and in accordance with the Code, but they should only be 

proposed in absolutely clear, molecularly proven cases. 

A recently found powdery mildew anamorph on Solanum 

betaceum (tamarillo or tree tomato) in India is a striking 

example. This host is phylogenetically closely related to S. 

lycopersicum (tomato), and the anamorph found on tree 

tomato is morphologically indistinguishable from Pseudoidium 

neolycopersici (syn. Oidium neolycopersici) on tomato (Baiswar 

et al. 2009). Nevertheless, this powdery mildew disease was 

only recorded as Oidium sp. and not as O. neolycopersici 

because reviewers refused the latter denomination without 

inoculation results and/or molecular analyses. Therefore, cross 

inoculation tests were later carried out and the tree tomato 

powdery mildew was subjected to molecular examinations 

based on amplification of the rDNA ITS region, including the 

5.8S rDNA, but, unfortunately, these new results also failed to 

elucidate its taxonomy. The powdery mildew on S. betaceum 

was unable to infect tomato and several other species of 

Solanum, but the sequence derived from this powdery mildew 

differed only in one base pair from that of Pseudoidium 

neolycopersici. Is the tree tomato powdery mildew conspecific 

with the latter species and only a special form? Or is it a 

separate species, morphologically indistinguishable from P. 

neolycopersici, but biologically distinguished and genetically 

distinct in one base pair in rDNA ITS sequence data? A final 

answer cannot yet be given. Incidently, in this case a study 

of the morphology of this pathogen would now allow it to be 

referred to the morphospecies Pseudoidium lycopersici as 

listed in the updated monograph (Braun & Cook 2012). As 

made apparent above, the anamorphic genus Oidum s. str. 

belongs solely to Blumeria. 

The Erysiphales in its current circumscription comprises 

873 known species. The number of teleomorph-typified species 

Braun 

names threatened by anamorph names is rather limited. Table 

1 details the names that come into this category (all of them 

will be put on a proposed List of accepted names according to 

the new provisions of the Melbourne Code (Art. 14). 


I am much obliged to Roger T.A. Cook, who critically checked the 

whole text. 

reFereNces 

Baiswar P, Braun U, Chandra S, Ngachan SV (2009) First report of 

an Oidium sp. [neolycopersici] on Solanum betaceum in India. 

Australasian Plant Disease Notes 4: 32–33. 

Baiswar P, Chandra S, Ngachan SV, Braun U, Takamatsu S, Harada 

M (2012) Molecular Characterization of Oidium sp. on Solanum 

betaceum in India. The Plant Pathology Journal (Korea): in press. 

Braun U, Cook RTA (2012) Taxonomic Manual of the Erysiphales 

(Powdery Mildews). [CBS Biodiversity Series no. 11.] Utrecht: 

CBS-KNAW Fungal Diversity Centre. 

Gams W, Humber RA, Jaklitsch W, Kirschner R, Stadler M (2012) 

Minimizing the chaos following the loss of Article 59: Suggestions 

for a discussion. Mycotaxon 119: 495–507. 

Gams W, Jaklitsch W et al. (2011). A critical response to the 

‘Amsterdam Declaration’. Mycotaxon 116: 501–512. 

Hawksworth DL (2011) A new dawn for the naming of fungi: impacts 

of decisions made in Melbourne in July 1011 on the future 

publication and regulation of fungal names. IMA Fungus 2: 155– 

162. 

Hawksworth DL, Crous PW, Redhead SA, Reynolds DR, Samson RA, 

Seifert KA, Taylor JW, Wingfield MJ et al. (2011) The Amsterdam 

Declaration on fungal nomenclature. IMA Fungus 2: 105–112. 

Knapp S, McNeill J, Turland NJ (2011) Changes to publication 

requirements made at the XVIII International Botanical Congress 

in Melbourne – what does e-publication mean for you? Mycotaxon 

117: 509–515. 

Norvell LL (2011) Melbourne approves a new Code. Mycotaxon 116: 

481–490. 

ima funGuS

doi:10.5598/imafungus.2012.03.01.09 










The importance of fungi and of mycology for a global development of the 

bioeconomy 

Lene Lange*, Lasse Bech, Peter K. Busk, Morten N. Grell, Yuhong Huang, Mette Lange, Tore Linde, Bo Pilgaard, Doris Roth, 

and Xiaoxue Tong 

Institute of Biotechnology and Chemistry, Faculty of Science and Technology, Aalborg University, Denmark; *corresponding author e-mail: lla@ 

adm.aau.dk 

Abstract: The vision of the European common research programme for 2014–2020, called Horizon 2020, is 

to create a smarter, more sustainable and more inclusive society. However, this is a global endeavor, which is 

important for mycologists all over the world because it includes a special role for fungi and fungal products. After 

ten years of research on industrial scale conversion of biowaste, the conclusion is that the most efficient and 

gentle way of converting recalcitrant lignocellulosic materials into high value products for industrial purposes, 

is through the use of fungal enzymes. Moreover, fungi and fungal products are also instrumental in producing 

fermented foods, to give storage stability and improved health. Climate change will lead to increasingly severe 

stress on agricultural production and productivity, and here the solution may very well be that fungi will be 

brought into use as a new generation of agricultural inoculants to provide more robust, more nutrient efficient, 

and more drought tolerant crop plants. However, much more knowledge is required in order to be able to fully 

exploit the potentials of fungi, to deliver what is needed and to address the major global challenges through 

new biological processes, products, and solutions. This knowledge can be obtained by studying the fungal 

proteome and metabolome; the biology of fungal RNA and epigenetics; protein expression, homologous as well 

as heterologous; fungal host/substrate relations; physiology, especially of extremophiles; and, not the least, 

the extent of global fungal biodiversity. We also need much more knowledge and understanding of how fungi 

degrade biomass in nature. 

The projects in our group in Aalborg University are examples of the basic and applied research going on 

to increase the understanding of the biology of the fungal secretome and to discover new enzymes and new 

molecular/bioinformatics tools. 

However, we need to put Mycology higher up on global agendas, e.g. by positioning Mycology as a 

candidate for an OECD Excellency Program. This could pave the way for increased funding of international 

collaboration, increased global visibility, and higher priority among decision makers all over the world. 


INtroductIoN 

Horizon 2020 is a visionary document for the European 

common research programme 2014–2020 (http://ec.europa. 

eu/research/horizon2020). The vision is to create a smarter, 

more sustainable and more inclusive society. However, such 

endeavor is not only European. It is global. Most importantly, 

for the members of the International Mycological Association 

(IMA), it includes a special role for fungi and fungal products. 

Therefore, it is an agenda of special relevance for mycologists 

all over the world. 

The Horizon 2020 document emphasizes that the 

most important goals and objectives for common research 

programmes are to address the major global challenges. 

Among the challenges of priority is climate change, the 

need for increased efficiency in resource utilization, and the 

urgency of developing renewable substitutes for fossils; and 

Key words: 

biodiversity 

biomass conversion 

fungal enzymes 

global challenges 

new biological solutions 

secretomics 

teaching 

training 

not least to provide for improved human health – combating 

life- style diseases and ensuring food security for a rapidly 

growing population. Essential for overcoming much of these 

challenges is improved use of natural resources; especially 

biological resources, plant nutrients and water. Regarding the 

efficient use of bioresources, we can do much better: After 

harvesting the food and feed, crop residues beyond what is 

needed to sustain a productive and healthy soil, are left to rot 

or burned. Further, the potentials of side streams and waste 

streams from agroindustries often remain unexploited. Also, 

the organic part of municipality waste is deposited in landfills, 

burned, or used as combustion feed stock in power plants. 

However, biomaterials are much too precious for such low 

value uses. We need more upgraded use of bioresources to 

both feed the growing population and as a substitute for what 

we now get from fossil resources. 

ARTIcLE 

87

ARTIcLE 

88 

the PoteNtIAl role oF FuNgI 

In nature, the breakdown of plant materials is primarily by 

fungi, by the means of secreted fungal enzymes. Driven 

by the urge for non-food based bioenergy, industrial scale 

conversion of biowaste has been researched and developed 

over the last ten years. After all this research, the conclusion 

is that the most efficient and gentle way of converting 

recalcitrant lignocellulosic materials for industrial purposes, 

is through the use of fungal enzymes (Lange 2010). Through 

such conversions, the building blocks of the organic materials 

are kept intact, ready to use in the value cascade (Fig. 1). 

The enzymatic conversion of biowaste and -sidestreams 

will provide the basis for an entirely new way for the more 

efficient use of natural resources, paving the way for a larger 

bioeconomy sector in a more biobased society: 

Plant materials, obtained as crop residues, municipality 

waste, or from agroindustrial waste streams, will increasingly 

substitute for fossil carbon from crude oil. Not just substituting 

fossil energy with bioenergy, but more importantly also 

substituting the higher value fossil-based materials, such as 

plastics and chemical building blocks, with biomaterials made 

from the sugar molecules of the plant cell wall polymers. Thus, 

the conversion of biowaste is primarily the conversion of 

plant cell wall materials into higher value products; achieved 

primarily by a process based on the refined use of fungi and 

fungal enzymes. 

But fungi are providing even more of the solutions for 

meeting and addressing the various global challenges: 

Fungi and fungal products are also instrumental in producing 

fermented foods, to give storage stability and improved 

lange et al. 

Fig. 1. The Biomass Value Pyramid shows the entire cascade of value adding products which can be produced from agricultural crop residues 

and other left over bio materials. The lowest value is achieved by burning the biomass and converting it into heat and electricity. Higher value 

products can be achieved by converting the biomass through treatment with fungal enzymes! 

health; and it is a fungus (baker’s yeast) that is the production 

organism of choice for producing insulin for the global 

population of diabetics. Also, cholesterol lowering drugs (the 

statins), major immunosuppressant drugs (cyclosporins), the 

cancer drug Taxol, and penicillins are fungal products. 

Climate change will lead to increasingly severe stress 

on agricultural production and productivity, and here the 

solution may very well be that fungi will be brought in use as 

a new generation of agricultural inoculants (e.g. mycorrhizas, 

endophytes, biocontrol agents) to provide more robust, more 

nutrient efficient, and more drought-tolerant crop plants. 

PosItIoNINg Mycology IN the world 

Mycologists have over time delivered so much knowledge 

about fungi (taxonomy, physiology, genetics, host/substrate 

relations (including plant pathology and studies of biotrophic 

interactions), molecular biology, metabolites, enzymes 

and protein expression) that biological products, biological 

processes, and biological solutions to important problems are 

already widespread within many industrial sectors. To mention 

a few: fungal enzymes are instrumental in laundry detergents 

at lower temperature and in the less polluting production of 

both paper and textiles, by replacing chemical processing. 

Thus, our knowledge and insight into fungal growth and 

fungal products (proteins as well as metabolites) have made 

biological processes competitive against chemical processes 

because they have been developed to be both highly efficient 

and safe. However, much more knowledge is required in order 

to be able to fully exploit the potentials of fungi, to deliver 

ima funGuS

what is needed, and to address the major global challenges 

through new biological processes, products, and solutions. 

Additional basic knowledge about fungi is required across 

an entire spectrum of research fields: The fungal proteome 

and metabolome; the biology of fungal RNA and epigenetics; 

protein expression, homologous as well as heterologous; 

fungal host/substrate relations; physiology, especially of 

extremophiles; and not least the extent of global fungal 

biodiversity. Indeed, many of the new applications of fungi 

and fungal products will be made possible through “unlocking 

the magic” of fungi we have not yet discovered – let alone 

described, characterized, or classified. 

We also need much more knowledge and understanding 

of how fungi degrade biomass in nature, and especially on 

how they interact with each other and with microorganisms, 

especially bacteria. In order to achieve all this, we need to train 

next generation of mycologists to be experts in their fields, 

mastering both the new and the classical methods. Besides 

researchers, we also need to train the skilled workers in how 

to handle biological production at the industrial scale. Last but 

not least, we need skilled and enthusiastic teachers at all levels 

who can teach about the fascinating world of the fungi, both the 

friends and the foes, from kindergartens to graduate schools. 

the wAy ForwArd 

As a first step forward, we propose a specific global learning 

loop for knowledge sharing of relevance to speeding up 

the application of mycology in addressing issues of global 

concern. 

Most importantly, we see that we need to start to change 

our mindset as mycologists, taking the importance of fungi and 

fungal products seriously in our personal research agendas. 

Not with the objective of making all of us to work in applied 

mycological research in a traditional sense, but recognizing 

that we also need blue-sky, curiosity-, biodiversity- and 

exploration- driven research within mycology – perhaps more 

than ever before, in order to realize the huge potential. 

To this end, mycologists in our research group in Aalborg 

University, Denmark, located on the AAU Copenhagen 

Campus, now orient our research projects to have a double 

focus, to: (1) forward the scientific field in which we are 

working, by increased understanding of the biology of the 

fungal secretome (regulation, composition and function); and 

(2) discover new enzymes and new molecular/bioinformatics 

tools, thereby contributing to the development of new 

biological products, biological processes, and biological 

solutions to important problems. Examples of activities with 

such a double focus, both basic and applied are: 

The phylogeny of a fungal cellulase 

A comparative study of an endoglucanase belonging to 

protein family GH45, gave surprising results, which lead to 

a new enzyme discovery approach: A phylogenetic analysis 

of the GH45 proteins, from all parts of the fungal kingdom, 

asco-, basidio-, zygo-, and chytridiomycetes (Kauppinen et 

al. 1999), indicated that distantly related fungi, such as the 

basidiomycete Fomes fomentarius and the ascomycete 

Xylaria hypoxylon, had GH45 cellulases in their secretome 


Fungi and the global bioeconomy 

with an extremely high similarity in the amino acid 

composition of their active site. Strikingly, both these fungi 

inhabit and decompose very similar substrates (hard wood). 

A similar pattern can be seen amongst straw decomposing 

fungi, for example the basidiomycete Crinipellis scabella 

and the chytrid Rhizophlyctis rosea. These two fungi are 

from two very different parts of the fungal kingdom. Anyway, 

their GH45 cellulase proteins have an almost identical amino 

acid composition of their active sites. These observations 

can tentatively be explained by the following molecular 

mechanism: Evolution of the fungal GH45 is impacted by 

gene copying and subsequent gene loss, maintaining the 

version of the gene which is most suitable for breaking down 

the cellulose of the substrate of the fungus. This conclusion 

provided the basis for a new screening approach: select a 

relevant ecological niche in nature with regard to type of 

substrate, temperature, and pH; construct a meta-library of 

the entire microbial (fungal and bacterial) community at such 

a site; and screen this library for the best enzyme candidates 

for industrial applications. It also inspired the following 

hypothesis: evolution of the fungal secretome composition 

may be interpreted as taking place at the molecular level 

rather than at the organismal level. 

Peptide pattern recognition (PPr) 

A new method has been invented for the improved prediction 

of protein function from protein sequences. It is unique in 

being non-alignment-based, and permits the comparison of 

a vast number of sequences with even very low sequence 

identities. PPR analysis is potent for revealing new protein 

subfamily groupings, where the subgrouping is correlated 

with a specific function (Fig. 2). Such new understanding 

can again be used to understand the biological role of the 

secreted proteins, interactions between organisms, and 

interactions between the organism and the substrate. A 

new subfamily can be described by a list of peptides that is 

specific to just that subfamily. PPR analysis, moreover, opens 

the possibility of finding more of a given type of functional 

proteins belonging to a single subfamily. This can be done by 

using the conserved peptides for discovering new subfamily 

members, either by following a bioinformatics approach or 

by screening biological materials with degenerated primers, 

constructed based on the list of the identified most conserved 

peptides (Busk & Lange 2011, 2012). 

We analyzed 8138 GH13 proteins represented in the B. 

Henrissat CAZy database with PPR to generate subfamilies. 

The subfamily-specific peptide lists were used to predict the 

function of 541 functionally characterized GH13 proteins. 

Overall, the function of 85 % of the proteins was correctly 

predicted (Fig. 2). The figure shows the percentage correct 

prediction of the enzymatic functions for each of the enzyme 

classes (new data; P.K. Busk & L. Lange, unpubl.). 

Fungal decomposition of specific substrates 

Understanding enzymatic degradation of plant cell wall 

materials is improved by studying in parallel both the plant cell 

wall composition (by the CoMPP technology, Moller et al. 2007) 

and the fungal secretome enzymes of the fungus responsible 

for the degradation. The materials under study in a Chinese/ 

Danish research project are duckweed (Cheng & Stomp 2009; 

ARTIcLE 89

ARTIcLE 

90 

Fig. 3) and industrial pulp of non-food uses of basic rhizomes 

such as sweet potato (Zhang et al. 2011), cassava, and Canna 

edulis. Using next generation sequencing, the transcriptomes 

of tropical fungal species, isolated from relevant substrates, 

are analyzed and novel enzymes are expected to be identified. 

The secretomes will be further characterized to compare 

the phylogenetic relationships of the secretome proteins as 

compared to the phylogenetic relationships of the organisms 

(L. Bech, Y. Huang, Z. Hai, P.K. Busk, W.G.T. Willats, M.N. 

Grell, and L. Lange, unpubl.). 

Accessory proteins 

In 2011 it was discovered that proteins of family GH61 act 

directly on crystalline cellulose, partially degrading and 

loosening the structure of the microfibrils, thereby increasing 

the substrate accessibility for other types of cellulases 

(Beeson et al. 2012, Langston et al. 2011, Quinlan et al. 

2011, Westereng et al. 2011). The PPR analysis of all 

publicly available GH61 sequences resulted in a tentative 

subgrouping in 16 new subfamilies. We are now studying 

lange et al. 

Fig. 2. The Peptide Pattern 

Recognition, (PPR), generated 

GH13 protein subfamilies which 

predicted the enzyme function 

correctly with 78–100 % accuracy; 

except for one enzyme class 

(3.2.1.133) where for so far unknown 

reasons the PPR subgrouping did 

not match the function annotations 

found in the CAZy database. 

the possible correlation of such subfamily groupings with the 

function of the given GH61 proteins, attempting to answer the 

following biological questions: What is the function and role 

of the high number of very different GH61 genes, as is so 

commonly seen among plant cell wall degrading fungi? We 

wish to increase understanding of the biological role of these 

non-hydrolytic accessory proteins in nature; and to provide 

a basis for choosing which GH61 subfamily proteins should 

be incorporated into new and improved industrial enzyme 

blends for conversion of lignocellulosic biomasses into free 

sugars (M. Lange, P.K. Busk, and L. Lange, unpubl.). 

Enzymes from thermophilic fungi 

Are the enzymes of thermophilic fungi more thermotolerant 

than those of mesophilic fungi? We are attempting to answer 

this fundamental physiological question, and at the same 

time provide a basis for developing a new type of biomass 

conversion process which can function at high temperatures, 

in order to improve the efficiency of the added enzymes and 

to speed up the biomass conversion (Busk & Lange 2011). 

Fig. 3. When grown in swine wastewater, some 

duckweed species such as the Spirodela polyrhizza 

contains up to 40 % protein, which makes it a 

valuable animal feed source. Picture by courtesy of 

Armando Asuncion Salmean. 

ima funGuS

A molecular analysis of biomass conversion 

in the leaf-cutter ant fungal garden 

The fungal garden of leaf-cutter ants constitutes a natural 

biomass conversion system (Fig. 4). Mediated by fungal 

secreted enzymes, leaf fragments brought into the nest by 

the ants are converted to food for the ant larvae as well 

as serve as substrate for fungal growth. In this study, we 

investigated which enzymes are produced and their relative 

expression level along the decomposition gradient of the 

garden structure (Fig. 4), using the DeepSAGE method. 

DeepSAGE is a global digital transcript-profiling technology, 

facilitating measurement of rare transcripts (Nielsen et al. 

2006). The results of the study have given us interesting new 

molecular insights into a social insect-fungus symbiosis that 

relies on conversion of a fresh leaves biomass, recalcitrant 

to degradation (M.N. Grell, K.L. Nielsen, T. Linde, J.J. 

Boomsma, and L. Lange, unpubl.). Now the question arises: 

what can we learn from the type of biomass degradation 

that the fungus growing leaf cutter ants have developed so 

successfully? 

the subgrouping of esterases and their 

possible function in biomass conversion in 

nature 

At present we focus on a study of additional and so far 

almost neglected types of enzymes needed for full biomass 

conversion, more specifically, on the esterases, especially the 

ferulic acid esterases (X. Tong, P.K. Busk, M.N. Grell, and L. 

Lange, unpubl.). A feature of plant cell wall polysaccharides is 

that they are able to cross-link, and that such cross-links can 

include phenolic groups represented by ferulic acid (feruloyl). 

The ferulic acid units can be oxidatively cross-linked by 

cell wall peroxidases into other polysaccharides, proteins 

and lignin. This cross-linking increases plant resistance to 

microbial degradation. The enzymes responsible for cleaving 

the ester-link between the polysaccharide main chain of xylans 

and either monomeric or dimeric feruloyl are the ferulic acid 


Fungi and the global bioeconomy 

Fig. 4. Leaf-cutter ant colony established in 

the laboratory of JJ Boomsma (University 

of Copenhagen). The ants have built three 

fungal gardens under plastic beakers. 

The beaker has been removed from the 

garden to the upper right. The gradient of 

biomass decomposition, from top to bottom, 

is indicated by the green arrow. The dark 

material on the surface of the garden is 

newly incorporated leaf fragments. Nondegraded 

material is removed by the ants 

from the bottom of the garden and placed in 

the refuse dump (upright beaker to the lower 

right) (photo, Morten N. Grell). 

esterases (EC 3.1.1.73). The breakage of one or both ester 

bonds from dehydrodimer cross-links between plant cell wall 

polymers is essential for optimal action of carbohydrases on 

substrates such as cellulosic biomass. Subfamily groupings 

within the field of lipases and esterases are still disputed and 

unresolved. We attempt to use the PPR method also within 

these types of enzymes, to provide increased insight in the 

fungal secretome by achieving function-related subgroupings 

also of this class of enzymes; and to elucidate further the role 

also of esterases in biomass conversion. 

Studies of secreted enzymes from edible 

wood-decaying fungi 

These studies aim at providing a basis for onsite production of 

enzyme blends for biomass conversion. Edible basidiomycetes, 

such as Pleurotus ostreatus, are chosen because they do 

not produce mycotoxins which would prohibit their use as 

production organisms; and because they have been shown 

to have the potential to secrete sufficient biomass degrading 

enzymes, to significantly lower the need for commercial 

enzyme blends in the production of second generation biofuels. 

Some even produces secondary metabolites with potential for 

use in other industries. The combination of these attributes can 

provide a significant cost reduction of the final products and, 

most importantly, open for decentralized low-investment use 

of biorefinery technologies for the production of animal feed, 

fertilizer, and fuel from crop residues (B. Pilgaard, L. Bech, M. 

Lange, and L. Lange, unpubl.). 

the evolution of obligate insect pathogens, 

elucidated by studies of their secreted 

enzymes 

In an earlier secretome study of field-collected grain 

aphids (Sitobion avenae) infected with fungi of the order 

Entomophthorales (subphylum Entomophthoromycotina), 

we identified a number of pathogenesis-related, secreted 

enzymes (Grell et al. 2011). Among these were cuticle 

ARTIcLE 91

ARTIcLE 

92 

degrading serine proteases and chitinases, involved in fungal 

penetration of the aphid cuticle, and a number of lipases most 

likely involved in nutrient acquisition. In a continuation of 

this study, we are investigating the distribution and variation 

of selected enzyme-encoding genes within the genera 

Entomophthora and Pandora, using fungal genomic DNA 

originating from field-collected, infected insect host species 

of dipteran (flies, mosquitoes) or hemipteran (aphid) origin. 

We anticipate that this study will shed new light on this highly 

specialized group of enthomophthoralean insect pathogenic 

fungi and their secreted enzymes (M.N. Grell, A.B. Jensen, J. 

Eilenberg, and L. Lange, unpubl.). 

evidence for a new biomass conversion role 

of ectomycorrhizal fungi and their use of a 

chemical mechanism for biomass conversion 

The ectomycorrhizal fungus Paxillus involutus converts organic 

matter in plant litter using a trimmed brown-rot mechanism 

involving both enzymatic activities and Fenton chemistry 

(Rineau et al. 2012). These results could serve as a model for 

future industrial biomass conversion, combining chemistry and 

biology to achieve more efficient biomass conversion. 

studies of the cellulases of the aerobic soil 

chytrids 

Pilgaard et al. (2011) have provided insight in the roots and 

origin of the fungal cellulases by studying the cellulases of 

aerobic soil inhabiting chytrids; and we are also attempting 

to further elucidate the aerobic chytrid secretome potentials 

for industrial exploitation of this unique group of fungi, so far 

almost totally neglected. 

coNclusIoN 

In order to achieve the goal of more mycological knowledge 

brought into use, for a more sustainable world of tomorrow, 

where the bioeconomy becomes an important pillar for 

our global society, we need fungi to be recognized with 

heightened visibility. They need to be higher up on global 

agendas. One way towards that goal could be to position 

Mycology as a candidate for an OECD Excellency Program. 

This could pave the way both for increased (national and 

international) funding of international collaboration, increased 

global visibility, and hopefully higher priority among decision 

makers all over the world. We hope you as mycologists, and 

the IMA as a global institution, will work together towards 

realizing this vision. 


Funding for the above mentioned projects have been supplied 

by: The Danish Council for Strategic Research (BioRef, Bio4Bio; 

FunSecProt) and Novozymes. We further thank Peter Westermann, 

Associate Professor at Aalborg University, for letting us use his figure 

on the biomass cascade, and Armando Asuncion Salmean Ph. D. 

student at University of Copenhagen, for his picture of duckweed. 

lange et al. 

reFereNces 

Beeson WT, Phillips CM, Cate JH, Marletta MA (2012) Oxidative 

cleavage of cellulose by fungal copper-dependent polysaccharide 

monooxygenases. Journal of the American Chemical Society 

134: 890–892. 

Busk PK, Lange L (2011) A novel method of providing a library of 

n-mers or biopolymers. Patent application EP11152232.2 

Busk PK, Lange L (2011) Novel glycoside hydrolases from 

thermophilic fungi. Patent Application EP11152252.0. 

Cheng JJ, Stomp A-M (2009) Growing duckweed to recover nutrients 

from wastewaters and for production of fuel ethanol and animal 

feed. CLEAN - Soil, Air, Water 37: 17–26. 

Grell MN, Jensen AB, Olsen PB, Eilenberg J, Lange L (2011) 

Secretome of fungus-infected aphids documents high pathogen 

activity and weak host response. Fungal Genetics and Biology 

48: 343–352. 

Kauppinen S, Schülein M, Schnorr K, Lassen S.F, Andersen KV, Urs 

SK, Katila P, Lange L (1999) Comparative analysis of a cellulase 

gene (Cel45) found in all major fungal groups. 22nd Fungal 

Genetics Conference at Asilomar: Abstract. 

Lange L (2010) The importance of fungi for a more sustainable future 

on our planet. Fungal Biology Reviews 24: 90–92 

Langston JA, Shaghasi T, Abbate E, Xu F, Vlasenko E, Sweeney 

MD (2011) Oxidoreductive cellulose depolymerization by the 

enzymes cellobiose dehydrogenase and glycoside hydrolase 61. 

Applied and Environmental Microbiology 77: 7007–7015. 

Moller I, Sørensen I, Bernal AJ, Blaukopf C, Lee K, Øbro J, Pettolino 

F, Roberts A, Mikkelsen JD, Knox JP, Bacic A, Willats WGT 

(2007) High-throughput mapping of cell-wall polymers within and 

between plants using novel microarrays. The Plant Journal : for 

cell and molecular biology 50: 1118–1128. 

Nielsen KL, Hogh AL, Emmersen J (2006) DeepSAGE - digital 

transcriptomics with high sensitivity, simple experimental protocol 

and multiplexing of samples. Nucleic Acids Research 34: e133. 

Pilgaard B, Gleason F, Lilje O, Lange L (2011) Lignocellulosic 

enzymes in three species of zoosporic fungi from NSW soils. 

2011 Annual Conference of the Ecological Society of Australia: 

Abstract. 

Quinlan RJ, Sweeney MD, Leggio LL, Otten H, Poulsen J-CN, 

Johansen KS, Krogh KBRM, Jørgensen CI, Tovborg M, 

Anthonsen A, Tryfona T, Walter CP, Dupree P, Xu F, Davies 

GJ, Walton PH (2011) Insights into the oxidative degradation 

of cellulose by a copper metalloenzyme that exploits biomass 

components. Proceedings of the National Academy of Sciences, 

USA 108: 15079–15084. 

Westereng B, Ishida T, Vaaje-Kolstad G, Wu M, Eijsink VGH, Igarashi 

K, Samejima M, Ståhlberg J, Horn SJ, Sandgren M (2011) 

The putative endoglucanase PcGH61D from Phanerochaete 

chrysosporium is a metal-dependent oxidative enzyme that 

cleaves cellulose. PLoS ONE 6: e27807. 

Zhang L, Zhao H, Gan MZ, Jin YL, Gao XF, Chen Q, Guan JF, Wang 

ZY (2011) Application of simultaneous saccharification and 

fermentation (SSF) from viscosity reducing of raw sweet potato 

for bioethanol production at laboratory, pilot and industrial scales. 

Bioresource Technology 102: 4573–4579. 

ima funGuS

doi:10.5598/imafungus.2012.03.01.10 










Variation in mitochondrial genome primary sequence among whole-genomesequenced 

strains of Neurospora crassa 

Kevin McCluskey 

Fungal Genetics Stock Center, University of Missouri-Kansas City, Kansas City, MO 64110, USA; e-mail: mccluskeyk@umkc.edu 

Abstract: Eighteen classical mutant strains of Neurospora crassa were subject to whole genome sequence 

analysis and the mitochondrial genome is analyzed. Overall, the mitochondrial genomes of the classical mutant 

strains are 99.45 to 99.98 % identical to the reference genome. Two-thirds of the SNPs and three-fourths 

of indels identified in this analysis are shared among more than one strain. Most of the limited variability in 

mitochondrial genome sequence is neutral with regard to protein structure. Despite the fact that the mitochondrial 

genome is present in multiple copies per cell, many of the polymorphisms were homozygous within each 

strain. Conversely, some polymorphisms, especially those associated with large scale rearrangements are 

only present in a fraction of the reads covering each region. The impact of this variation is unknown and further 

studies will be necessary to ascertain if this level of polymorphism is common among fungi and whether it 

reflects the impact of ageing cultures. 

Article info: Submitted: 26 April 2012; Accepted: 6 June 2012; Published: 21 June 2012. 

INtroductIoN 

Widely regarded as being an endosymbiont of ancient 

protobacterial origin, mitochondria are a defining 

characteristic of eukaryotic organisms (Gray et al. 1999). The 

availability of Neurospora strains carrying mutations in the 

mitochondrial genome enabled the first studies of maternal 

inheritance in Neurospora (Mitchell & Mitchell 1952), and 

mitochondrial inheritance has been shown to be primarily 

maternal for Neurospora (Mannella et al. 1979) as well as 

for other filamentous fungi (Griffiths 1996). In rare cases 

mitochondrial genome markers are transmitted by the 

fertilizing cytoplasm or in unstable heterokaryons (Collins and 

Saville 1990). Mitochondrial genome analysis has been used 

both to understand fundamental aspects of evolution (Gray 

et al. 1999) and as a source of markers for population and 

species delimitation (Moore 1995). Some recent analysis of a 

rapidly expanding pool of information has led to re-evaluation 

of some of the assumptions of early studies of mitochondrial 

genetics (Galtier et al. 2009). Moreover, mitochondrial biology 

has seen a resurgence of interest as degraded mitochondria 

were reported in brain tissue from Alzheimer’s (Sultana & 

Butterfield 2009), and Huntington’s (Damiano et al. 2010) 

patients. 

Filamentous fungi have been described as providing a 

good model for the study of mitochondrial inheritance and 

biology (Griffiths 1996). In one instance a fungal mitochondrial 

genome project emphasized high level comparisons and 

used one representative of each major phylogenetic lineage 

(Paquin et al. 1997). More recent pan-fungal phylogenetic 

analysis, however, did not include mitochondrial markers 

Key words: 

SNP 

Indel 

sequence polymorphism 

organelle genome 

classical mutant 

(James et al. 2006) and recent fungal genome analysis 

does not emphasize mitochondrial biology (Martin et al. 

2011), although some authors have described mitochondrial 

genomes as part of their whole genome sequence projects 

(Torriani et al. 2008). The N. crassa mitochondrial genome 

is 64,800 bases and it encodes twenty-eight protein coding 

genes, as well as two rRNAs and twenty-eight tRNA genes 

(Borkovich et al. 2004). Among these are genes for the electron 

transport chain, subunits of the mitochondrial ATPase, 

protein synthesis, and genes of unknown function. Compared 

to other mitochondrial genomes, the N. crassa mitochondrial 

genome is larger than many, but still near the middle of the 

19 to 109 Kb range for fungi as well as for the overall range of 

16 to 366 Kb from human to Arabidopsis (Bullerwell & Lang 

2005). The Neurospora mitochondrial genome is a circular 

molecule and it varies somewhat in size depending on the 

presence or absence of optional intron sequences (Griffiths 

1996; Collins & Lambowitz 1983). Additionally, an aberrant 

version of the NADH dehydrogenase was characterized in 

the Neurospora mitochondrial genome (de Vries et al. 1986) 

and this was ultimately associated with a duplication that 

includes two tRNA genes as well as the mutant version of 

the NADH dehydrogenase subunit 2 (Agsteribbe et al. 1989). 

Mitochondrial genome rearrangements were associated 

with the intermittent cessation of growth phenotype known 

as ‘stopper’ and these rearrangements involved the NADH 

dehydrogenase gene fragment (de Vries et al. 1986). 

Additionally, while the Neurospora mitochondria has been 

known to harbor various plasmids, the Varkud satellite 

plasmids were recently shown to be phenotypically neutral 

(Keeping & Collins 2011). Other mitochondrial plasmids 

ARTIcLE 

93

ARTIcLE 

table 1. Strains employed in the current analysis. 

are known to induce senescence, presumably through 

recombination with the mitochondrial genome (Court et 

al. 1991). Self-splicing introns of the 25S rRNA gene were 

identified in Neurospora mitochondria (Garriga & Lambowitz 

1983) and led to the characterization of the mechanism of 

self splicing of the group I introns in Neurospora (Garriga 

et al. 1986). Whole genome resequencing has been used 

to analyze the nuclear genome of numerous N. crassa 

classical mutant strains (McCluskey et al. 2011) and that 

dataset provides unprecedented insight into Neurospora 

mitochondrial genetics and biology. Because most whole 

genome data includes mitochondrial sequence it is likely that 

analysis of mitochondrial genomes will be available for many 

fungal taxa and this suggests a renaissance of interest in 

mitochondrial genetics in fungi. 


Total DNA from Neurospora strains (Table 1) was prepared 

as described (McCluskey et al. 2011). Most strains were 

preserved on anhydrous silica gel (Perkins 1962a) since their 

original deposit into the FGSC collection without multiple 

passages. For example, strain FGSC 1303 was preserved in 

1966 and strain FGSC 1363 was preserved in 1967. Some of 

these strains have morphological abnormalities and for these 

strains, the cultures were macerated with sterile glass tissue 

grinder and resuspended in fresh culture medium to allow 

production of enough tissue for DNA extraction. Genome 

McCluskey 

Fgsc # gene* Mutagen genetic backgroundǂ reference 

106 com UV SL3 (Perkins & Ishitani 1959) 

305 amyc ? SL3 (Atwood & Mukai 1954) 

309 ti X-rays SL3 (Perkins 1959) 

322 ty-1 spontaneous M (Horowitz et al. 1961) 

821 ts spontaneous M (Nakamura & Egashira 1961) 

1211 dot spontaneous SL3 (Perkins 1962b) 

1303 fi spontaneous M (Perkins 1962b) 

1363 smco-1 Mustard L (Garnjobst & Tatum 1967) 

2261 do UV SL2 (Perkins 1962b) 

3114 Sk-2 Introgression SL (Turner & Perkins 1979) 

3246 fs-n spontaneous M (Mylyk & Threlkeld 1974) 

3562 mb-1 UV M (Weijer & Vigfusson 1972) 



3831 ff-1 spontaneous M (Tan & Ho 1970) 

3921 tng spontaneous SL2 (Springer & Yanofsky 1989) 

7022 fld spontaneous M (Perkins 1962b) 

7035 per-1 UV SL3 (Howe & Benson 1974) 

*Gene refers to the genetically characterized locus that was putatively identified by whole genome analysis in McCluskey et al. (2011) 

ǂ In the genetic background field, SL is used to indicate the reference genome background (St Lawrence) and the following number indicates 

how many generations of backcrosses to a reference strain were carried out. L indicates the Lindegren background while M is used when the 

background is mixed or not documented. 

sequencing was carried out at the US DOE JGI using the 

Illumina platform as described (McCluskey et al. 2011). 

SNP and indel analysis was carried out using the MAQ 

software platform, version 0.7.1 (Li et al. 2008) . Larger indels 

and rearrangements were assessed using Breakdancer (Chen 

et al. 2009b). Comparative analysis of polymorphisms was 

carried out as previously described (McCluskey et al. 2011). 

results 

Among all the resequenced strains 129 single nucleotide 

variants (SNV) occurring at 67 different positions in the 

mitochondrial genome were detected. Of these, 48 were found 

in only one strain each while nineteen were found in two or 

more strains (Table 2). Two variants were present in fourteen 

and seventeen strains respectively. The SNV found in fourteen 

strains is a C to G at position 2,246 in non-coding sequence. 

The SNV found in seventeen strains occurs at position 17,478 

just downstream from the mitochondrial ribosomal protein 

S5 (S3). All of the SNVs are non-coding except one that 

encodes a synonymous substitution in NCU16015 in strain 

FGSC 821 (Table 3). One strain, FGSC 3566, had the most 

SNVs in its mitochondrial genome, with 36 SNVs, of which 23 

are unique to this strain. With the exception of the C to G at 

position 17,478 all of the SNVs in this strain are ambiguous 

with alternate bases making up 2 to 49 % of reads. In every 

case, among these variants in strain 3566 the primary call at 

each variant site was identical with the reference genome. At 

94 ima funGuS

the other extreme, several strains had fewer than three or four 

SNVs and all of these strains included the C to G mutation 

at position 17,478. Strains FGSC 106 and FGSC 2261 each 

had only two SNVs and these were both shared and had no 

significant alternate base calls. 

A total of 1,250 insertions and deletions were identified 

among the strains. These occur as 553 different unique 

changes relative to the reference genome. These occur at 

475 positions and of all of the independent iterations of all 

indels, 1,080 were annotated as being homo-allelic while 

170 were identified as multi allelic (that is, different reads 

were recovered for the same location in one strain). In total, 

662 deletions and 588 insertions were characterized. Three 

hundred and twenty-five indels occur only once in the dataset 

while 228 indels occur among two to eighteen strains. Sixtysix 

sites have two different variants (insertions or deletions of 

a different base, or of a different number of bases) and 4 sites 

have 3 variants. 

One position with an indel in all eighteen strains occurs 

at position 12,228. This position, falling in intergenic space 

between the full-length NADH Dehydrogenase (NCU16004) 

and the mitochondrial ribosomal protein S5 (NCU16005), has 

sixteen deletions of one T and two insertions of one T and 

these all occur adjacent to a stretch of nine Ts. Most of the 

indels that are found in multiple strains occur among stretches 

of five or more repeats of the same base as the specific indel. 

Among indels occurring in gene coding sequence the 

indel at 1,532 (NCU16002), is seen in fourteen strains. The 

deletion of one A from this position is homoallelic and strongly 

supported in thirteen strains, while the addition of one A is 

less well supported in strain FGSC 3246. Four strains 

are identical with the reference genome at this position. 

The deletion at 1,532 causes numerous stop codons in 


Mitochondrial genome variation in Neurospora crassa 

table 2. Number of mitochondrial polymorphisms in each of 18 strains of Neurospora crassa. 

strain sNP Indel cds indel 

106 2 14 0 

305 4 65 5 

309 3 23 0 

322 7 83 5 

821 6 133 8 

1211 4 69 4 

1303 4 53 4 

1363 6 11 0 

2261 2 10 0 

3114 4 51 2 

3246 3 28 1 

3562 6 27 1 

3564 3 70 4 

3566 36 322 21 

3831 16 153 10 

3921 3 18 2 

7022 11 92 3 

7035 9 29 1 

CDS indels occur within the coding sequence of an ORF and are also included among the total count of indels. 

the NCU16002 ORF, beginning with a TAG at amino acid 

residue 203, which removes 121 residues from the full length 

conserved hypothetical protein encoded at NCU16002. In 

strains FGSC 3566 and 3831 this ORF has additional indels 

including the insertion of GG at position 1356. Position 1481 

has an insertion of one G in strain 3566 and one C in strain 

3831. 

NCU16001 encodes a truncated version of NADH 

dehydrogenase subunit 2, with the full-length version 

encoded by NCU16006. The truncated NCU16001 ORF 

is 705 nucleotides in length and has multiple indels in five 

strains and all of these indels induce frameshift errors. The 

deletion of the C at position 616 is found in strains FGSC 

3114 and FGSC 3566 and is homoallelic in both strains. 

This deletion causes a frameshift and introduces multiple 

stop codons, the first being a TAG codon at triplet 120 of the 

235 amino acid protein. Similarly, the deletion of one G at 

position 630 in strains 322 and 3921 causes a frameshift that 

introduces a stop codon at position 121, as well as multiple 

stops after that position. There are no indels in the full-length 

version of NADH Dehydrogenase subunit 2 (NCU16006) in 

any of the strains sequenced in this program. 

In all, twenty mitochondrial ORFs have indels (Table 3) 

and of these, nine ORFs have indels within the protein coding 

region of the gene. Eleven ORFs have insertions or deletions 

in an intron and four have indels directly adjacent (3’ or 

5’) to the ORF. Five ORFs have no insertions or deletions 

and these include the full-length version of the NADH 

dehydrogenase subunit 2 (NCU16006), two hypothetical 

proteins (NCU16011, NCU16023), and two endonucleases 

(NCU16014 and NCU16021). 

Seventy-two larger rearrangements with both endpoints 

within the mitochondrial genome were detected among 

ARTIcLE 95

ARTIcLE 

these 18 strains using Breakdancer (Chen et al. 2009a). An 

additional 37 rearrangements have one endpoint on a 

chromosome in the nuclear genome. All of the polymorphisms 

detected with Breakdancer are unique although nineteen 

have shared endpoints with another variant. Of these, all 

consisted of different variants within one strain with one 

shared endpoint. Twenty-five of the polymorphisms detected 

with Breakdancer were deletions while twelve were insertions. 

The average deletion was 2,925 bases, although three 

putative deletions of over 20 Kb were identified in different 

stains. The average insertion was 123 bases with a range of 

96 to 159 bases. 

dIscussIoN 

Overall there is a very low level of SNVs in the mitochondrial 

genomes of the eighteen strains characterized by whole genome 

sequence analysis. Even the strain with the most SNVs, FGSC 

3566, had only 36 SNVs and most of these were at positions 

where both the reference genome base and an alternate base 

were detected. Interestingly, several of the strains characterized 

in the present study are related to those used in the pioneering 

McCluskey 

table 3. Mitochondrial open reading frames (ORF) with polymorphisms relative to the reference genome. 

orF Name Type 

sNPs 

NCU16007 NADH dehydrogenase subunit 3 Intron SNPs 

NCU16008 NADH dehydrogenase subunit 4L Intron SNPs 

NCU16009 hypothetical protein Intron SNPs 

NCU16012 NADH dehydrogenase subunit 5 Intron SNPs 

NCU16015 

INdels 

laglidadg endonuclease 5’ and CDS SNPs 

NCU16001 NADH dehydrogenase subunit 2 FS 

NCU16002 conserved hypothetical protein FS 

NCU16003 cytochrome c oxidase subunit 3 FS 

NCU16004 NADH dehydrogenase subunit 6 FS 

NCU16005 mitochondrial ribosomal protein S5 (S3) FS 

NCU16007 NADH dehydrogenase subunit 3 int, 5’, 3’ 

NCU16008 NADH dehydrogenase subunit 4L int, 5’ 

NCU16009 hypothetical protein int 

NCU16010 laglidadg endonuclease int 

NCU16012 NADH dehydrogenase subunit 5 int 

NCU16013 cytochrome b int 

NCU16015 laglidadg endonuclease FS 

NCU16016 cytochrome c oxidase subunit 1 5’, 3’ 

NCU16017 hypothetical protein FS 


NCU16019 group I intron endonuclease FS 


NCU16022 hypothetical protein FS 

NCU16024 ATPase subunit 8 int 

NCU16025 ATPase subunit 6 int 

*FS = frameshift inducing indel, int = intron indel 

work clearly showing uniparental inheritance of Neurospora 

mitochondria (Mannella et al. 1979). Strain FGSC 821 was 

deposited as a spontaneous mutant arising in strain 4A, which 

is the designation used for the Abbott strain in Mannella et al. 

(1979). In this earlier work, Abbott strains were described as 

mitochondrial genome type I. Similarly, strains in the Lindegren 

and St Lawrence backgrounds are described as having type 

II mitochondria. On the deposit form submitted with the strain, 

FGSC 1363 was explicitly listed as being in a Lindegren 

background. Other strains in the current analysis were 

backcrossed into the St Lawrence background (for example, 

FGSC 7035). The possibility that the strains in the current study 

contain the same mitochondrial genome as those described in 

Mannella et al (1979) is supported by the presence of the G 

for C SNP at position 2,246 in both St Lawrence type genome 

(FGSC 7035) and the Lindegren derived strain (FGSC 1363) 

as well as thirteen additional strains, but not in strain FGSC 821 

(the Abbott strain). 

Two of the indels in NCU16001 (the truncated NADH 

dehydrogenase subunit 2) occur in multiple strains and are 

well supported although both of these indels occur in short 

strings of the same base. NCU16002 encodes a conserved 

hypothetical protein and has multiple unique and shared indels 

96 ima funGuS

including the second most common indel in the mitochondrial 

genome among these strains. The deletion of one A from 

position 1,532 in this ORF removes 121 amino acids from the 

final putative protein product. This ORF, also known as uflLM 

(D’Souza et al. 2005), has little orthology to other proteins in 

the PUBMED NR protein database, and has no conserved 

protein domains. The finding of these frameshift inducing 

indels suggests that these two genes are both pseudogenes 

resulting from an ancestral partial duplication within the 

mitochondrial genome (Agsteribbe et al. 1989). While many 

mitochondrial ORFs have indels, these do not follow the same 

pattern of bias towards indels that do not disrupt the reading 

frame as was seen for indels in nuclear genes (McCluskey 

et al. 2011). Although the observation of the same indel in 

multiple strains lends credence to the fact that they are an 

accurate representation of the underlying sequence, indels 

are commonly seen occurring in runs of the same base and 

it cannot be determined from these data whether these are 

changes in the mitochondrial genome or systematic errors 

in the sequencing process. Although intrachromosomal 

rearrangements have been previously implicated as being 

responsible for the start-stop growth phenotype of so called 

stopper mutants, the rearrangements found in the present 

study do not correspond to those described for the stopper 

E35 mutant (de Vries et al. 1986). Indeed, the rearrangements 

typically only comprise a fraction of the reads for a given 

region. The anomalous characterization of interchromosomal 

recombination between nuclear and mitochondrial genomes 

by the Breakdancer program suggests either artifacts from 

library construction or in silica in the subsequent analysis. 

The possibility that mitochondrial sequences are found in 

the nuclear genome or that nuclear sequence is present in 

the mitochondrial genome is impossible to assess without 

additional investigation. 

While a traditional view of the mitochondria is that of 

individual cell-like organelles (Luck 1963), recent study 

suggests more of a filamentous or syncytial structure 

(Bowman et al. 2009) with the mitochondrial DNA organized 

into nucleoids (Gilkerson et al. 2008, Basse 2010). Moreover, 

recent analysis of the mitochondrial proteome is adding to 

the understanding of the role of nuclear and mitochondrial 

encoded genes (Keeping et al. 2011). While it may be 

attractive to suggest that the deleterious mutations detected 

in a fraction of the reads in the whole genome sequencing 

of Neurospora strains represent defective mitochondrial 

genomes present in an otherwise healthy background, the 

present level of analysis does not allow this conclusion. The 

fact that most of the indels were homoallelic contrasts markedly 

with the observation that most of the SNVs were multiallelic. 

By way of contrast, larger scale rearrangements detected by 

the Breakdancer algorithm were mostly multiallelic. Whether 

these observations provide insight into fundamental aspects 

of mitochondrial genome maintenance cannot be determined 

with the present dataset. Additional experiments, for example 

comparing sequence from freshly germinated conidia to that 

generated from stationary-phase cultures, may allow insight 

into the nature of these polymorphisms. Future studies may 

take advantage of the information presented here to, for 

example, amplify unique DNA fragments only generated by 

deletions or large-scale rearrangements. Recent advances in 


Mitochondrial genome variation in Neurospora crassa 

whole genome sequencing may enable experimental analysis 

of mutation and rearrangements of mitochondrial genome in 

Neurospora, other fungi, and indeed all organisms. 


The FGSC is supported by grant 0742713 from the US National 

Science Foundation. 

reFereNces 

Agsteribbe E, Hartog M, de Vries H (1989) Duplication of the 

tRNA(MMet) and tRNA(Cys) genes and of fragments of a gene 

encoding a subunit of the NADH dehydrogenase complex in 

Neurospora crassa mitochondrial DNA. Current Genetics 15: 

57–62. 

Atwood KC, Mukai F (1954) Survival and mutation in Neurospora 

exposed at nuclear detonations. American Naturalist 88: 295– 

314 

Basse CW (2010) Mitochondrial inheritance in fungi. Current Opinion 

in Microbiology 13: 712–719. 

Borkovich KA, Alex LA, Yarden O, Freitag M, Turner GE, Read ND, 

Seiler S, Bell-Pedersen D, Paietta J, Plesofsky N, Plamann M, 

Goodrich-Tanrikulu M, Schulte U, Mannhaupt G, Nargang FE, 

Radford A, Selitrennikoff C, Galagan JE, Dunlap JC, Loros JJ, 

Catcheside D, Inoue H, Aramayo R, Polymenis M, Selker EU, 

Sachs MS, Marzluf GA, Paulsen I, Davis R, Ebbole DJ, Zelter A, 

Kalkman ER, O’Rourke R, Bowring F, Yeadon J, Ishii C, Suzuki 

K, Sakai W, Pratt R (2004) Lessons from the genome sequence 

of Neurospora crassa: tracing the path from genomic blueprint to 

multicellular organism. Microbiology, Molecular Biology Reviews 

68: 1–108. 

Bowman BJ, Draskovic M, Freitag M, Bowman EJ (2009) Structure 

and distribution of organelles and cellular location of calcium 

transporters in Neurospora crassa. Eukaryotic Cell 8: 1845– 

1855. 

Bullerwell CE, Lang BF (2005) Fungal evolution: the case of the 

vanishing mitochondrion. Current Opinion in Microbiology 8: 

362–369. 

Chen CH, Ringelberg CS, Gross RH, Dunlap JC, Loros JJ (2009a) 

Genome-wide analysis of light-inducible responses reveals 

hierarchical light signalling in Neurospora. EMBO Journal 28: 

1029–1042. 

Chen K, Wallis JW, McLellan MD, Larson DE, Kalicki JM, Pohl CS, 

McGrath SD, Wendl MC, Zhang Q, Locke DP, Shi X, Fulton RS, 

Ley TJ, Wilson RK, Ding L, Mardis ER (2009b) BreakDancer: 

an algorithm for high-resolution mapping of genomic structural 

variation. Nature Methods 6: 677–681. 

Collins RA, Lambowitz AM (1983) Structural variations and optional 

introns in the mitochondrial DNAs of Neurospora strains isolated 

from nature. Plasmid 9: 53–70. 

Collins RA, Saville BJ (1990) Independent transfer of mitochondrial 

chromosomes and plasmids during unstable vegetative fusion in 

Neurospora. Nature 345: 177–179. 

Court DA, Griffiths AJ, Kraus SR, Russell PJ, Bertrand H (1991) A 

new senescence-inducing mitochondrial linear plasmid in fieldisolated 

Neurospora crassa strains from India. Current Genetics 

19: 129–137. 

ARTIcLE 97

ARTIcLE 

D’Souza AD, Sultana S, Maheshwari R (2005) Characterization and 

prevalence of a circular mitochondrial plasmid in senescenceprone 

isolates of Neurospora intermedia. Current Genetics 47: 

182–193. 

Damiano M, Galvan L, Deglon N, Brouillet E (2010) Mitochondria 

in Huntington’s disease. Biochimica et Biophysica Acta 1802: 

52–61. 

de Vries H, Alzner-DeWeerd B, Breitenberger CA, Chang DD, de 

Jonge JC, RajBhandary UL (1986) The E35 stopper mutant of 

Neurospora crassa: precise localization of deletion endpoints in 

mitochondrial DNA and evidence that the deleted DNA codes for 

a subunit of NADH dehydrogenase. EMBO Journal 5: 779–785. 

Galtier N, Nabholz B, Glemin S, Hurst GD (2009) Mitochondrial DNA 

as a marker of molecular diversity: a reappraisal. Molecular 

Ecology 18: 4541–4550. 

Garnjobst L, Tatum EL (1967) A survey of new morphological mutants 

in Neurospora crassa. Genetics 57: 579–604. 

Garriga G, Lambowitz AM (1983) RNA splicing in Neurospora 

mitochondria. The large rRNA intron contains a noncoded, 

5’-terminal guanosine residue. Journal of Biological Chemistry 

258: 14745–14748. 

Garriga G, Lambowitz AM, Inoue T, Cech TR (1986) Mechanism of 

recognition of the 5’ splice site in self-splicing group I introns. 

Nature 322: 86–89. 

Gilkerson RW, Schon EA, Hernandez E, Davidson MM (2008) 

Mitochondrial nucleoids maintain genetic autonomy but allow for 

functional complementation. Journal of Cell Biology 181: 1117– 

1128. 

Gray MW, Burger G, Lang BF (1999) Mitochondrial evolution. 

Science 283: 1476–1481. 

Griffiths AJF (1996) Mitochondrial Inheritance in filamentous fungi. 

Journal of Genetics 75: 403–414. 

Horowitz NH, Fling M, Macleod H, Sueoka N (1961) A genetic study 

of two new structural forms of tyrosinase in Neurospora. Genetics 

46: 1015–1024. 

Howe HB jr, Benson EW (1974) A perithecial color mutant of 

Neurospora crassa. Molecular and General Genetics 131: 79– 

83. 

James TY, Kauff F, Schoch CL, Matheny PB, Hofstetter V, Cox CJ, 

Celio G, Gueidan C, Fraker E, Miadlikowska J, Lumbsch HT, 

Rauhut A, Reeb V, Arnold AE, Amtoft A, Stajich JE, Hosaka K, 

Sung GH, Johnson D, O’Rourke B, Crockett M, Binder M, Curtis 

JM, Slot JC, Wang Z, Wilson AW, Schussler A, Longcore JE, 

O’Donnell K, Mozley-Standridge S, Porter D, Letcher PM, Powell 

MJ, Taylor JW, White MM, Griffith GW, Davies DR, Humber RA, 

Morton JB, Sugiyama J, Rossman AY, Rogers JD, Pfister DH, 

Hewitt D, Hansen K, Hambleton S, Shoemaker RA, Kohlmeyer 

J, Volkmann-Kohlmeyer B, Spotts RA, Serdani M, Crous PW, 

Hughes KW, Matsuura K, Langer E, Langer G, Untereiner WA, 

Lucking R, Budel B, Geiser DM, Aptroot A, Diederich P, Schmitt 

I, Schultz M, Yahr R, Hibbett DS, Lutzoni F, McLaughlin DJ, 

Spatafora JW, Vilgalys R (2006) Reconstructing the early evolution 

of Fungi using a six-gene phylogeny. Nature 443: 818–822. 

Keeping A, Deabreu D, Dibernardo M, Collins RA (2011) Gel-based 

mass spectrometric and computational approaches to the 

mitochondrial proteome of Neurospora. Fungal Genetics and 

Biology 48: 526–536. 

Keeping AJ, Collins RA (2011) Evidence for the phenotypic neutrality 

of the Neurospora Varkud (V) and Varkud satellite (VS) plasmids. 

Fungal Genetics and Biology 48: 741–746. 

McCluskey 

Li H, Ruan J, Durbin R (2008) Mapping short DNA sequencing reads 

and calling variants using mapping quality scores. Genome 

Research 18: 1851–1858. 

Luck DJ (1963) Genesis of mitochondria in Neurospora crassa. 

Proceedings of the National Academy of Sciences, USA 49: 

233–240. 

Mannella CA, Pittenger TH, Lambowitz AM (1979) Transmission 

of mitochondrial deoxyribonucleic acid in Neurospora crassa 

sexual crosses. Journal of Bacteriology 137: 1449–1451. 

Martin F, Cullen D, Hibbett D, Pisabarro A, Spatafora JW, Baker 

SE, Grigoriev IV (2011) Sequencing the fungal tree of life. New 

Phytologist 190: 818–821. 

McCluskey K, Wiest A, Grigoriev IV, Lipzen A, Martin J, Schackwitz 

W, Baker SE (2011) Rediscovery by whole genome sequencing: 

classical mutations and genome polymorphisms in Neurospora 

crassa. G3, Genes, Genomes, Genetics 1: 303–316. 

Mitchell MB, Mitchell HK (1952) A Case of “Maternal” Inheritance in 

Neurospora crassa. Proceedings of the National Academy of 

Sciences, USA 38: 442–449. 

Moore WS (1995) Inferring phylogenies from mtDNA Variation: 

mitochondrial-gene trees versus nuclear-gene trees. Evolution 

49: 718–726. 

Mylyk OM, Threlkeld SF (1974) A genetic study of female sterility in 

Neurospora crassa. Genetics Research 24: 91–102. 

Nakamura K, Egashira T (1961) Genetically mixed perithecia in 

Neurospora. Nature 190: 1129–1130. 

Paquin B, Laforest MJ, Forget L, Roewer I, Wang Z, Longcore J, Lang 

BF (1997) The fungal mitochondrial genome project: evolution 

of fungal mitochondrial genomes and their gene expression. 

Current Genetics 31:380-395. 

Perkins DD (1959) New markers and multiple point linkage data in 

Neurospora. Genetics 44: 1185–1208. 

Perkins DD (1962a) Preservation of Neurospora stock cultures with 

anhydrous silica gel. Canadian Journal of Microbiology 8: 591– 

594. 

Perkins DD, Ishitani C (1959) Linkage data for Group III markers in 

Neurospora. Genetics 44: 1209–1213. 

Perkins DD, Glassey M, Bloom BA (1962) New data on markers and 

rearrangements in Neurospora. Canadian Journal of Genetics 

and Cytology 4: 187–205. 

Springer ML, Yanofsky C (1989) A morphological and genetic analysis 

of conidiophore development in Neurospora crassa. Genes and 

Development 3: 559–571. 

Sultana R, Butterfield DA (2009) Oxidatively modified, mitochondriarelevant 

brain proteins in subjects with Alzheimer disease 

and mild cognitive impairment. Journal of Bioenergetics and 

Biomembranes 41: 441–446. 

Tan ST, Ho CC (1970) A gene controlling the early development of 

protoperithecium in Neurospora crassa. Molecular and General 

Genetics 107: 158–161. 

Torriani SF, Goodwin SB, Kema GH, Pangilinan JL, McDonald BA 

(2008) Intraspecific comparison and annotation of two complete 

mitochondrial genome sequences from the plant pathogenic 

fungus Mycosphaerella graminicola. Fungal Genetics and 

Biology 45: 628–637. 

Turner BC, Perkins DD (1979) Spore killer, a chromosomal factor in 

Neurospora that kills meiotic products not containing it. Genetics 

93: 587–606. 

Weijer J, Vigfusson NV (1972) Sexuality in Neurospora crassa. I. 

Mutations to male sterility. Genetics Research 19: 191–204. 

98 ima funGuS

doi:10.5598/imafungus.2012.03.01.11 










The status of mycology in Africa: A document to promote awareness 

Marieka Gryzenhout 1* , Joyce M. Jefwa 2 , and Nourou S. Yorou 3 

1Department of Plant Sciences, University of the Free State, Bloemfontein, South Africa, 9301; Corresponding author email: Gryzenhoutm@ufs. 

ac.za 

2International Centre for Tropical Agriculture (CIAT), P.O. Box 823-00621, Nairobi, Kenya 

3Faculty of Agronomy, University of Parakou, BP 123, Parakou, Benin 

Abstract: The African Mycological Association (AMA) promotes mycology amongst members in Africa and globally. The 

AMA has about 200 members, mostly from African states but also with strong representation from Europe and USA, 

amongst others. Recent efforts by members of the AMA focused on reviving and developing mycological research and 

networking in Africa. A great deal must, however, still be done to promote the AMA under African mycologists, and those 

elsewhere with interests in Africa. African mycologists also experience challenges typical of the developing world and a 

great deal of fungi still needs to be discovered. This can also be seen as representing great opportunities for research 

and collaboration. Several issues pertinent to mycology in Africa were discussed during Special Interest Group sessions 

of the 9th International Mycological Congress in 2010, and through several opinion pieces contributed by AMA members 

in the AMA newsletter, MycoAfrica. This contribution serves as a document to summarise these in a form that can be 

presented to fellow mycologists, biologists and other scientists, relevant government departments, funding bodies and 

Non-Governmental Organizations and that pins down the importance of mycology, the status thereof in Africa and the need 

to promote it more. 


the IMPortANce oF FuNgI coNtrAsted 

to the lIMIted cAPAcIty to study theM 

In the wide and diverse field of biology, it is necessary to 

study fungi. Fungi are an incredibly speciose, and biologically 

and morphologically diverse group, with estimates indicating 

at least a predicted 1.5 million species on Earth. Some of 

these fungi are visible to humans as larger fungi, such as 

mushrooms, but others are microbial with incredibly high 

numbers of species and individuals present in any substrate 

on earth, for instance soil, water, air, or in dead or living plants. 

They exist as saprotrophs that break down organic material, 

parasites causing diseases, and various types of symbionts 

of all types of larger organisms. It is evident that fungi play 

an irreplaceable role in the ecology and micro-ecology of any 

ecosystem, and contribute to the health of living organisms 

in either a positive or negative way. More directly in the lives 

of humans, fungi play an incredibly important role as sources 

of food or in processing food, novel sources of industrially 

important enzymes and compounds, human, animal and plant 

pathogens, spoiling or contaminating food with mycotoxins, 

agents for biological control, and ecological indicators. 

In Africa that is endowed with high biodiversity and unique 

but vulnerable ecosystems, mycology is an endangered 

discipline. Fungal components of any ecosystem are seldom 

characterised and almost never included in biodiversity data. 

Proper fungal inventories and databases are largely nonexistent, 

while those that exist contain only scanty and basic 

Key words: 

Africa 

challenges 

mycology 

opportunities 

threats 

uses 

information. Due to the lack of human capacities, national 

monographs of biodiversity in many African countries rarely 

encompass fungi. This not only leads to an unfortunate bias 

in the complete assessment of biodiversity, but also pertains 

to the unawareness of public and decision makers of fungi 

as important organisms. Needless to say fungal biodiversity 

does not feature in biological checklists and red data listings 

of countries. 

The problem is worsened due to large numbers of new 

taxa still awaiting description and numerous areas and 

niches that are unexplored. In South Africa alone, over 

171 000 fungal species are estimated to exist based only 

on the modest assumption that an average of seven new 

fungal species are associated with each of the plant species 

known (Crous et al. 2006). Of these, only 780 represented 

new species (Crous et al. 2006). In Egypt, only 4.6% of the 

recorded fungi were newly described (Abdel-Azeem 2011). 

This dilemma is largely compounded by an enormous lack of 

human capacity and resources. 

Africa is third-world with numerous typical problems such 

as poverty and overpopulation. These have put excessive 

pressures on the environment and also on already limited 

food sources, compounded by threats of plant pathogens 

and pests. Livestock and humans are equally threatened 

by fungal diseases or fungal toxins. Even for quarantine 

purposes against plant pathogens, comprehensive lists of 

pathogens do not exist for most African countries. Despite 

these threats, the study of pathogenic fungi is also generally 

ARTIcLE 

99

ARTIcLE 

neglected despite their importance, and again limited and 

pressured human and resource capacity exist to address this. 

Mycology presents vast opportunities to address the 

various challenges in Africa. Sustainable ethnomycology 

provides valuable food and medicines and conserves such 

knowledge (e.g. Lowore & Boa 2001, Bloesch & Mbago 

2008). The cultivation of mushrooms on waste products such 

as straw is practised in numerous rural communities and 

provides valuable sources of protein and income. Africa’s 

fungal biodiversity represents potential opportunities to 

develop valuable products or by-products to address third 

world environmental and food security related problems, or 

to discover biological control methods to combat diseases. 

cAPAcIty - whAt Are the Needs ANd 

resources For Mycology 

Mycology is a diverse biological field. It can be broadly divided 

into medical mycology, food mycology, industrial mycology, 

aspects of plant pathology, symbioses, ecology, biodiversity, 

and systematics, with numerous overlaps between fields and 

expertise. Specific needs and processes for each of these 

fields may differ. However, the following broad activities 

underlie each. 

Specific fungi need to be collected and isolated using the 

specialised techniques known for the different groups of fungi 

and for different fields of mycology, unless these are obligate 

parasites that cannot be cultured. Collecting trips largely 

involve the same procedures as those for other organisms, 

but for many groups of fungi, a great deal of additional effort 

is necessary to first isolate and purify these fungi in culture 

before identification can be attempted. Whereas the larger 

fungi, such as mushrooms, are more tangible and countable, 

it is especially these cultured fungi that are more numerous 

but difficult to comprehend by non-mycologists. Furthermore, 

even with the larger fungi, the absence of fruiting bodies 

does not necessarily imply the absence of the fungus, but 

are merely tied to the absence of special environmental 

conditions conducive to the production of fruiting bodies. 

Ideally, living isolates and biologically inactive herbarium 

specimens of fungi should be preserved in culture collections 

and herbaria, respectively, where these will continue to 

be available for study by other mycologists. The needs to 

do this are quite different from those of preserving various 

types of animals and plants, and in general are more costly, 

labour and time intensive, and specialised. Sadly, very few 

such official collections exist, while large numbers of these 

fungi are kept in private research collections under immense 

financial pressure and largely linked to the presence of the 

particular researcher or the particular research project. 

Various steps of identification and special expertise are 

necessary to either identify known fungi, for instance in the 

case of pathogens where the correct identity is vital, or to be 

able to obtain a sensible designation for unknown fungi. Such 

identifications are often very difficult due to the large degree 

of variation in the fungal kingdom, the specialization and 

techniques required to identify different groups, and limited 

human expertise. Even internationally, fewer mycologists and 

funding are available to actually identify and describe new fungi. 

Gryzenhout, Jefwa & Yorou 

Several specific needs and resources have been 

identified for mycology in Africa, although these may by no 

means be unique to this continent. Physical needs such 

as funding and infrastructure are quite delimiting, and both 

are usually necessary for sustainable research. Even with 

increasing interest from global funding organizations in Africa, 

mycologists usually have to compete with other biologists 

working with more understandable and visible organisms. 

Resources such as checklists are lacking. Whereas physical 

needs can be met, human needs such as support by experts 

and mentors to provide guidance and training, and available 

students interested and funded to do projects, are more 

difficult to meet. Experts willing to assist in identifications and 

coaching are difficult to find, usually overloaded themselves, 

and are often not on the African continent. 

threAts to FuNgI IN AFrIcA 

The same problems existing in Africa affecting diversity 

and numbers of animals and plants, apply to fungi. These 

problems include slash and burn, overgrazing, alien 

plant invasions, reforestations with non-native trees, 

encroachment, fragmentation, poor land management, 

degradation, and transformation (Gryzenhout et al. 2010, 

Ngala & Gryzenhout 2010). However, the difference is that 

fungi are not at all included in any such assessments, nor 

are the effects and impact on these fungi known. Their 

diversity and functionality are understudied, and hence the 

impact of anthropogenic activities is unknown and the need 

for conservation overlooked. The invasiveness of non-native 

fungi is seldom studied, except for plant pathogens proven 

to be introduced, and the displacements of native fungi are 

thus unknown. 

Numbers of microfungi and larger, visible fungi are 

disappearing without being noticed. Due to pressures to 

produce food, indiscriminate spraying of especially nonselective 

fungicides by farmers is detrimental to fungi 

occurring on non-agricultural crops. Africa prizes a number 

of local edible mushrooms, such as species of the truffle 

genus Terfezia and chanterelles (Cantharellus), but these 

are occasionally overharvested or traded illegally. The loss of 

habitat due to deforestation for settlement and cultivation in 

Africa is alarming and associated with the loss of local fungi. 

Furthermore, trees are destroyed for firewood, the making of 

charcoal, timber, and tourist ornaments, and thus the fungi 

occurring with them as natural pathogens or endophytes 

inside plant tissues, also disappear. Numerous fungal taxa 

are thus undergoing threats of extinction, along with their 

symbiotically associated plant species and generally in small 

sized hotspots. A recent Red List of threatened larger fungi 

of Benin totaling 30 species within two hotspots (Yorou & De 

Kesel 2011), gives evidence of the impact of human activities 

on fungal biodiversity and the need to elaborate ecosystemsbased 

conservation strategies. 

Africa has a rich tradition of ethnomycology that has 

not yet been documented in most parts. The traditional 

knowledge and practices are, however, declining from one 

generation to another, with older generations often still 

remaining the sole custodians. Simultaneously, a number 

100 ima funGuS

of negative or ignorant perceptions also exist, often among 

the public, other biologists or in government circles. These 

factors are compounded by poverty, land allocation, and land 

use practices, which usually take preference above the need 

to also study fungi. 

The lack of capacity in mycology is due to several 

challenges. While funding is already difficult to obtain, 

funding for basic mycology is even scarcer, and can 

usually only be obtained for applied projects in fields where 

fungi play an important role, such as plant pathology, food 

microbiology, bioactive compounds, and/or applications in 

forest regeneration. Herbaria and living culture collections 

are battling to maintain high standards or even to survive, 

due to lack of interest for investment and scarcity of funds. 

The large numbers of cultures also housed in private culture 

collections and that are carried by research funds and the 

dedication of the particular researchers, are also under threat. 

These collections are in danger of being lost when these 

funds become unavailable or the researchers discontinue 

their work. Such private collections are not sponsored by 

government or other funding bodies. 

Whereas institutes and research programmes with stateof-the-art 

infrastructure, capacity and excellence do exist in 

some African countries, these are usually absent. Training 

of new or practising mycologists is thus difficult. All of these 

issues are usually the reasons for the “brain drain” of talented 

mycologists to other continents, from which some never 

return. 

There is a general consensus that there should be more 

scientific input by mycologists in political issues. This is 

difficult due to a lack of interest and ignorance in government, 

biodiversity, conservation, and public circles. Legislation and 

permits are often very difficult for fungi due to ignorance of 

the special needs of mycologists and the lack of general 

checklists, and these processes are also often coupled with 

corruption by officials. Political upheaval is a reality in many 

African countries, making the practice of any science difficult. 

Moreover, inner politics within scientific communities are also 

debilitating for significant progress and large scale projects. 

Often there is also a lack of collaboration and communication 

with other mycologists. 

MANy oPPortuNItIes IN AFrIcA 

The rich and unique biodiversity of Africa and indigenous 

knowledge systems present numerous opportunities for 

fungal bio-exploration, characterization of species, bioprospecting, 

and potential downstream applications paired 

with capacity building. For fungi, this biodiversity is virtually 

untapped. Unlike the more developed, Northern Hemisphere 

countries with their extensive histories of mycology, Africa 

in a sense can start with a clean slate with not too many 

problems, such as taxonomical ambiguities, to first resolve. 

The majority of biodiversity data can also immediately be fed 

to the current global biodiversity initiatives and need not be 

harvested first from previous and extensive lists. Metagenetic 

approaches such as direct environmental sequencing or the 

use of other biochemical or molecular typing techniques of 

microbial communities, also present novel techniques to 


The status of mycology in Africa 

investigate these communities, albeit these are usually costly. 

Although numerous challenges exist, incredibly talented, 

passionate and diverse mycologists are practising their 

science with few resources, and often at an international 

level. A number of international centres of expertise already 

exist within some African countries. Much of this is achieved 

through a system of African and global connections and 

collaborations. Such expertise is actually playing a pioneering 

role to perpetuate mycological research and teaching 

locally. One most important but discrete opportunity is that 

numerous local students can be motivated and engaged to 

make a career in mycology, as fungal science is perceived to 

be a new and promising biological field for them. Numerous 

students also do their pre- and postgraduate studies at 

African centres or abroad, and often at acclaimed research 

groups where they actually act to promote mycology (brain 

gain) and, if they return, the expertise they gained is brought 

back (brain circulation). In some African countries, emerging 

good will towards biological sciences also may include more 

opportunities for mycology. 

Several initiatives already exist in Africa to promote 

awareness of fungi. The use of ethnomycology is promoted 

under communities in attempts not to lose those skills and 

knowledge, and these are useful initiatives to show the value 

of mycology for government officials and funders. A number of 

groups for communities and amateur mycologists are driven 

by individuals or groups of mycologists, who are usually 

already pressured. These are essential to nurture interest in 

this poorly represented field or to promote awareness of the 

importance of including fungi in biodiversity and conservation 

initiatives. These groups often include biologists from other 

disciplines, non-governmental organizations (NGO’s), nature 

conservationists, and from government, and thus play the 

important role of promoting mycology in the broader scientific 

community and disseminating interesting, useful or essential 

data. 

coNclusIoN 

When building a discipline on a continental scale, several things 

are essential. These include leading research, to promote 

the particular field of science across general scientific fields, 

to attract students with pertinent and stimulating teaching 

and research projects, and to build capacity through postgraduate 

training. Due to relatively limited capacity in Africa, 

strong ties must be sought and fostered with international 

collaborators, institutions and societies. 

A choice must be made if mycology in Africa is to grow 

stronger and become more prominent, or if it will merely 

continue to exist. Strong and continued action with clear goals 

will be necessary to build mycology in Africa, and these must 

not be from a few individuals, but from numerous people and 

teams. Common goals for groups of mycologists from several 

countries may be a way to stimulate this. 

In the open world we live in today, numerous ways of 

communicating, networking and collaborating is possible. 

Novel, different ways of doing things must be sought if current 

systems are not working. Ways must be found to reward 

passion and energy. This is especially true to retain young 

ARTIcLE 101

ARTIcLE 

talent and to enable it to become able mycologists. Ways 

must be sought to solve the challenges. These are difficult, 

but if even one of these challenges can be addressed and a 

solution established, it will make it possible to solve the next 

challenge and do more in future. For these, continuous advice 

is needed from fellow mycological societies, experienced 

mycologists, and those outside the field of mycology. 

AcKNowledgMeNts 

We thank the various contributors to the “Opinion” features of the 

official newsletter of the AMA, MycoAfrica [vol 2(4), vol. 3 (1, 2, 4), 

vol. 4 (1, 2); www.africanmycology.org], for their views and stimulating 

further discussions. These include Levi Yafetto, Rosemary Tonjock 

(University of Buea, Cameroon), George Ngala (Bamenda University 

of Science and Technology, Cameroon), Jo Taylor (National Botanical 

Garden of Edinburgh) and Jonathan Jansen (Rector, University of the 

Free State, South Africa). Features published in the various issues 

of MycoAfrica also contributed to the content of this commentary and 

include various useful references. Referencing for this commentary 

was thus deliberately not comprehensive. We are also thankful to the 

Organising Committee of the 9th International Mycological Congress 

for presenting the AMA with an opportunity to have a stimulating 

session on mycology in Africa. 

Gryzenhout, Jefwa & Yorou 

reFereNces 

Abdel-Azeem AM (2011) The history, fungal biodiversity, conservation, 

and future perspectives for mycology in Egypt. IMA Fungus 1: 

123–142. 

Bloesch U, Mbago F (2008) The potential of wild edible mushrooms 

in the miombo woodlands of the Selous-Niassa Wildlife 

Corridor for the livelihood improvement of the local population. 

Commissioned by the Deutsche Gesellschaft fur Technische 

Zusammenarbeit and the Association for the Development of 

Protected Areas. 

Crous PW, Rong IH, Wood A, Lee S, Glen HF, Botha W, Slippers B, 

De Beer ZW, Wingfield MJ, Hawksworth DL (2006) How many 

species of fungi are there at the tip of Africa? Studies in Mycology 

55: 13–33. 

Gryzenhout M, Roets F, de Villiers R (2010) Fungal conservation in 

Africa. Mycologica Balcanica 7: 53–58. 

Lowore J, Boa E (2001) Bowa markets in Malawi: Local practices 

and indigenous knowledge of wild edible fungi. Egham, UK: CAB 


Ngala GN, Gryzenhout M (2010) Biodiversity and conservation in 

Cameroon. Mycologica Balcanica 7: 65–72. 

Yorou NS, De Kesel (2011) Larger fungi. In: Nature Conservation in 

West Africa: Red List for Benin (P Neuenschwander, B Sinsin 

& G Goergen, eds): 47–60. Ibadan: International Institute of 

Tropical Agriculture. 

102 ima funGuS

All submitted materials must be digitized and submitted electronically to d.hawksworth@nhm.ac.uk and p.crous@cbs.knaw.nl, with the 

manuscript ideally in Microsoft Word. Illustrations (Line drawings (600 dpi or higher) and half tone pictures (300 dpi or higher) should be 

submitted separately, never embedded in Word files. Phylogenetic trees will only be accepted when submitted as Powerpoint files, or in Adobe 

(never as pictures). 

The corresponding author should confirm that: (a) all named authors have agreed to publication of the work; and (b) the manuscript does not 

infringe any personal or other copyright or property rights. 

Papers cited as “in press” should be provided for the benefit of the referees. 

The content should be structured as follows: ABSTRACT, INTRODUCTION, MATERIALS AND METHODS, RESULTS, TAXON- 

OMY, DISCUSSION, ACKNOWLEDGEMENTS and REFERENCES. Key words and a Running Head should also be provided. 

English-English is preferred, and used for all non-article material. Authors of articles can use American-English, provided that it is consistent 

within their contributions. Words of non-English origin, like bona fide, prima facie, in vitro, in situ, should be placed in italic, together with 

scientific names of any rank (e.g. Ascomycota, Dothideales, Mycosphaerellaceae, Mycosphaerella nubilosa). 

Common abbreviations are as follows: h, min, s, mL, µL, mg/L, °C, Fig., d, wk, but also ITS, RPD, RFLP, rDNA, 18S etc. 

Authorities of fungal taxa should be omitted from the general text, unless novelties and synonymies are listed, or nomenclatural issues 

discussed. In these cases, authorities for taxa should follow the list of authors’ names, see http://www.speciesfungorum.org/AuthorsOf- 

FungalNames.htm, followed by the year of publication of the name. Journal abbreviations in the text (species synonymies, descriptions, 

etc.) should follow the International Plant Name Index (see http://www.ipni.org/index.html). 

Experimental procedures must be reproducible and must follow Good Cultural Practice (Mycological Research 106: 1378–1379), with 

sequences lodged at GenBank, alignments in TreeBASE, voucher specimens in a public reference collection recognized in Index, or another 

recognized in Index Herbariorum (online) or the World Directory of Collections and Cultures of Microorganisms (online), with acronym and accession 

numbers (where allocated), and ex-type and other representative cultures in long-term genetic resource depositaries or collections. For 

new scientific names a MycoBank number is required (see www.MycoBank.org), and should be obtained on acceptance for publication. 

Collections must be cited as: 

Specimens examined. Country: State/Province/County: location, substratum, date (e.g. 10 Dec. 1993), collector (e.g. S. Uper & F. Ungus) 

(COLLECTION ACRONYM and ACCESSION NUMBER -- holotypus; cultures ex-holotype COLLECTION ACRONYM(S) and 

ACCESSION NUMBER(S)). 

Reference citation in text: References in the text should be chronological, and given in the following form: “Smith & Jones (1965) have 

shown ...”, or, “some authors (Zabetta 1928, Taylor & Palmer 1970, Zabetta 1970) consider that ...”. The names of collaborating authors are 

joined by an ampersand (&). Where there are three or more authors, names should be cited by the first name only, adding “et al.”, e.g. “Bowie, 

Black & White (1964)” are given as “Bowie et al. (1964)” or “(Bowie et al. 1964)”. Where authors have published more than one work in a 

year, to which reference is made, they should be distinguished by placing a, b, etc. immediately after the date, e.g. “Dylan (1965a, b)”. Reference 

citations in text should be in ascending order of year first, followed by authors’ names. Each reference should include the full title of the 

paper and journal, volume number, and the final as well as the first page number. In the case of chapters in books, the names of editors, first 

and last page numbers of the articles, publisher and place of publication are needed. 

Examples: 

Black JA, Taylor JE (1999a) Article title. Studies in Mycology 13: 1–10. 

Black JA, Taylor JE (In press) Article title. Fungal Biology. 

Black JA, Taylor JE, White DA (1981) Article title. In: Book Title (KA Seifert, W Jones & P. Jones, eds): 11–30. Town (and country if not 

well-known): Press. 

Simpson H, Seifert KA (2000) Book Title. 2nd edn. Town (and country if not well-known): Press. 

White DA (2001) Dissertation Title. PhD thesis, Department, University, Country. 

Copyright / Proprietary Rights Notice: 

Unless otherwise noted, the IMA holds the copyright on all materials published in IMA Fungus, whether in print or electronic form, both as 

a compilation and as individual articles. All Journal content is subject to ‘fair use’ provisions of U.S. or applicable international copyright laws 

(see http://www.copyright.gov/title17/92chap1.html). The following guidelines apply to individual users: 

A. Individuals may view, download, print, or save Journal content for the purposes of research, teaching, and/or private study. Systematic 

downloading (by robots or other automatic processes) is prohibited without explicit Publisher approval. 

B. Individuals may not reproduce, post, redistribute, sell, modify or create a derivative work of any Journal content, without prior, express 

written permission of the Publisher. Permission is granted, however, to provide a limited amount of print or electronic Journal content for 

purposes of regulatory approval, patent and/or trademark applications or other legal or regulatory purposes. 

C. Any use and/or copies of this Journal in whole or in part, must include the customary bibliographic citation, including author attribution, 

date, article title, the Journal name and its URL (web site address) and MUST include the copyright notice. Individuals may not 

remove, cover, overlay, obscure, block, or change any copyright notices, legends, or terms of use. 

D. For permissions to reprint or copy Journal content beyond that permitted by Section 107 or 108 of the U.S. Copyright Law, contact 

the Copyright Clearance Center. The fee code for users of the Transactional Reporting Service appears in each abstract and full text 

article. 

INSTRUCTIONS TO AUTHORS 

EDITORIAL BOARD

Editorial 

Holistic mycology – back to biology! (1) 

“Stop press -- Registries of names and the new Code” by Lorelei Norvell (2) 

News 

IMA Fungus full content available in PubMed (2010 onwards) – Fear of Fungi – White-nose fungus kills around six 

million bats – The Top 10 fungal pathogens in molecular plant pathology – Fungus makes the Top 10 species 2012 

– 2013 CBS Spring Symposium – One Fungus : Which Gene(s) (1F = ?G) – Special issues of journals – Mycophily, 

mycophilogy, and insect conservation – Global Mycology Initiatives – A network of European scientists investigating 

endophytic microorganisms: a new COST programme – New funding for Australian medical mycology – China 

establishes State Key Laboratory of Mycology – FungalDC: a database on fungal diversity in genetic resource 

collections 

Reports 

ONE FUNGUS = WHICH NAME ? – IMA Executive Committee Meeting – International Commission on the 

Taxonomy of Fungi (ICTF): 2012 General Meeting – CBS Course Medical Mycology: Chinese edition – Hidden 

Danger, Bright Promise: 4th Meeting of the ISHAM Working Group on Black Yeasts – International cooperation in 

zygomycete research 

Awards and Personalia 

CBS-KNAW Fungal Biodiversity Centre Awards ( Johanna Westerdijk Award; Josef Adolf von Arx Award) (24) 

IMA Young Mycologist Awards 2011 (Elias Magnus Fries Medal; Carlos Luis Spegazzini Medal) (25) 

Anton de Bary Medaille: Walter Gams (26) 

Queen’s Award for Forestry: Jolanda Roux meets the Queen of England (26) 

In Memoriam: Vernon Ahmadjian (1930–2012); Ovidiu Constantinescu (1933–2012); Walter Friederich Otto 

Marasas (1941–2012); Erast Parmasto (1928–2012) 

(27) 

Research News 

Archaeorhizomycetes: a new class for a major clade of soil fungi – Inter-specific sex in grass smuts – Prions and phenotypic 

inheritance in wild yeasts – Different fungal and algal genotypes demonstrated within one lichen specimen – Fungi that 

can transform lead – Nutritional value of fungi in animal diets – Archaeolichenology: a novel use of lichens 

Book News (34) 

Forthcoming Meetings (40) 

Articles 

“Pilidiella tibouchinae sp. nov. associated with foliage blight of Tibouchina granulosa (quaresmeira) in Brazil” by 

1 

Bruno E.C. Miranda, Robert W. Barreto, Pedro W. Crous, and Johannes Z. Groenewald 

“Reappraisal and neotypification of Phyllachora feijoae” by Lilian C. Costa, Davi M. Macedo, and Robert W. Barreto 9 

“Managing and coping with names of pleomorphic fungi in a period of transition” by David L. Hawksworth 15 

“Afrocantharellus gen. stat. nov. is part of a rich diversity of African Cantharellaceae” by Donatha D. Tibuhwa, Sanja 25 

Savić, Leif Tibell, and Amelia K. Kivaisi 

“The identity of Cintractia disciformis: reclassification and synonymy of a southern Asian smut parasitic on Carex sect. 39 

Aulocystis” by Marcin Piątek 

“Ceratocystis eucalypticola sp. nov. from Eucalyptus in South Africa and comparison to global isolates from this tree” by 45 

Marelize van Wyk, Jolanda Roux, Gilbert Kamgan Nkuekam, Brenda D. Wingfield, and Michael J. Wingfield 

“Aspergillus section Versicolores: nine new species and multilocus DNA sequence based phylogeny” by Zeljko Jurjevic, 59 

Stephen W. Peterson, and Bruce W. Horn 

“The impacts of the discontinuation of dual nomenclature of pleomorphic fungi: the trivial facts, problems, and strat- 81 

egies” by Uwe Braun 

“The importance of fungi and of mycology for a global development of the bioeconomy” by Lene Lange, Lasse Bech, 87 

Peter K. Busk, Morten N. Grell, Yuhong Huang, Mette Lange, Tore Linde, Bo Pilgaard, Doris Roth, and Xiaoxue 

Tong 

“Variation in mitochondrial genome primary sequence among whole-genome-sequenced strains of Neurospora crassa” 93 

by Kevin McCluskey 

“The status of mycology in Africa: A document to promote awareness” by Marieka Gryzenhout, Joyce M. Jefwa, and 99 

Nourou S. Yorou 

(3) 

(10) 

(29)

complete issue - IMA Fungus

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?