Phytopathogenic Dothideomycetes - CBS - KNAW

Studies in Mycology 75 (June 2013) 

Phytopathogenic Dothideomycetes 

Pedro W. Crous, Gerard J.M. Verkley and Johannes Z. Groenewald, editors 

CBS-KNAW Fungal Biodiversity Centre, 

Utrecht, The Netherlands 

An institute of the Royal Netherlands Academy of Arts and Sciences


Studies in Mycology 75, 2013

Studies in Mycology 

The Studies in Mycology is an international journal which publishes systematic monographs of filamentous fungi and yeasts, and in rare occasions the proceedings of special 

meetings related to all fields of mycology, biotechnology, ecology, molecular biology, pathology and systematics. For instructions for authors see www.cbs.knaw.nl. 

Executive Editor 

Prof. dr dr hc Robert A. Samson, CBS-KNAW Fungal Biodiversity Centre, P.O. Box 85167, 3508 AD Utrecht, The Netherlands. 

E-mail: r.samson@cbs.knaw.nl 

Managing Editor 

Prof. dr P.W. Crous, CBS-KNAW Fungal Biodiversity Centre, P.O. Box 85167, 3508 AD Utrecht, The Netherlands. 

E-mail: p.crous@cbs.knaw.nl 

Layout Editors 

Manon van den Hoeven-Verweij, CBS-KNAW Fungal Biodiversity Centre, P.O. Box 85167, 3508 AD Utrecht, The Netherlands. 

E-mail: m.verweij@cbs.knaw.nl 

Marjan Vermaas, CBS-KNAW Fungal Biodiversity Centre, P.O. Box 85167, 3508 AD Utrecht, The Netherlands. 

E-mail: m.vermaas@cbs.knaw.nl 

Scientific Editors 

Prof. dr Dominik Begerow, Lehrstuhl für Evolution und Biodiversität der Pflanzen, Ruhr-Universität Bochum, Universitätsstr. 150, Gebäude ND 44780, Bochum, Germany. 

E-mail: dominik.begerow@rub.de 

Prof. dr Uwe Braun, Martin-Luther-Universität, Institut für Biologie, Geobotanik und Botanischer Garten, Herbarium, Neuwerk 21, D-06099 Halle, Germany. 

E-mail: uwe.braun@botanik.uni-halle.de 

Dr Paul Cannon, CABI and Royal Botanic Gardens, Kew, Jodrell Laboratory, Royal Botanic Gardens, Kew, Richmond, Surrey TW9 3AB, U.K. 

E-mail: p.cannon@kew.org 

Prof. dr Lori Carris, Associate Professor, Department of Plant Pathology, Washington State University, Pullman, WA 99164-6340, U.S.A. 

E-mail: carris@mail.wsu.edu 

Prof. dr David M. Geiser, Department of Plant Pathology, 121 Buckhout Laboratory, Pennsylvania State University, University Park, PA, U.S.A. 16802. 

E-mail: dgeiser@psu.edu 

Dr Johannes Z. Groenewald, CBS-KNAW Fungal Biodiversity Centre, P.O. Box 85167, 3508 AD Utrecht, The Netherlands. 

E-mail: e.groenewald@cbs.knaw.nl 

Prof. dr David S. Hibbett, Department of Biology, Clark University, 950 Main Street, Worcester, Massachusetts, 01610-1477, U.S.A. 

E-mail: dhibbett@clarku.edu 

Dr Lorelei L. Norvell, Pacific Northwest Mycology Service, 6720 NW Skyline Blvd, Portland, OR, U.S.A. 97229-1309. 

E-mail: llnorvell@pnw-ms.com 

Prof. dr Alan J.L. Phillips, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, Quinta de Torre, 2829-516 Caparica, Portugal. 

E-mail: alp@mail.fct.unl.pt 

Dr Amy Y. Rossman, Rm 304, Bldg 011A, Systematic Botany & Mycology Laboratory, Beltsville, MD, U.S.A. 20705. 

E-mail: amy@nt.ars-grin.gov 

Dr Keith A. Seifert, Research Scientist / Biodiversity (Mycology and Botany), Agriculture & Agri-Food Canada, KW Neatby Bldg, 960 Carling Avenue, Ottawa, ON, Canada 

K1A OC6. 

E-mail: seifertk@agr.gc.ca 

Prof. dr Hyeon-Dong Shin, Division of Environmental Science & Ecological Engineering, Korea University, Seoul 136-701, Korea. 

E-mail: hdshin@korea.ac.kr 

Dr Roger Shivas, Manager, Plant Biosecurity Science, Biosecurity Queensland, Department of Employment, Economic Development and Innovation, DEEDI, GPO Box 267, 

Brisbane, Qld 4001, Dutton Park 4102, Queensland, Australia. 

E-mail: roger.shivas@deedi.qld.gov.au 

Dr Marc Stadler, InterMed Discovery GmbH, Otto-Hahn-Straße 15, D-44227 Dortmund, Germany. 

E-mail: Marc.Stadler@t-online.de 

Prof. dr Jeffrey K. Stone, Department of Botany & Plant Pathology, Cordley 2082, Oregon State University, Corvallis, OR, U.S.A. 97331-2902. 

E-mail: stonej@bcc.orst.edu 

Dr Richard C. Summerbell, 27 Hillcrest Park, Toronto, Ont. M4X 1E8, Canada. 

E-mail: summerbell@aol.com 

Prof. dr Brett Summerell, Royal Botanic Gardens and Domain Trust, Mrs. Macquaries Road, Sydney, NSW 2000, Australia. 

E-mail: brett.summerell@rbgsyd.nsw.gov.au 

Prof. dr Ulf Thrane, Department of Systems Biology, Center for Microbial Biotechnology, Technical University of Denmark, Søltofts Plads 221, DK-2800 Kgs. Lyngby, Denmark. 

E-mail: ut@bio.dtu.dk 

Copyright 2013 CBS-KNAW Fungal Biodiversity Centre, P.O. Box 85167, 3508 AD Utrecht, The Netherlands. 

You are free to share — to copy, distribute and transmit the work, under the following conditions: 

Attribution: 

Non-commercial: 

No derivative works: 

You must attribute the work in the manner specified by the author or licensor (but not in any way that suggests that they endorse you or your use of the work). 

You may not use this work for commercial purposes. 

You may not alter, transform, or build upon this work. 

For any reuse or distribution, you must make clear to others the license terms of this work, which can be found at http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode. Any of the above conditions 

can be waived if you get permission from the copyright holder. Nothing in this license impairs or restricts the author"s moral rights. 

Publication date: 30 June 2013 

Published and distributed by CBS-KNAW Fungal Biodiversity Centre, P.O. Box 85167, 3508 AD Utrecht, The Netherlands. Internet: www.cbs.knaw.nl. 

E-mail: info@cbs.knaw.nl. 

ISBN/EAN : 978-90-70351-96-0 

Online ISSN : 1872-9797 

Print ISSN : 0166-0616 

Cover: Top from left to right: Conidia of Alternaria septospora, leaf symptoms induced by Pseudocercospora fijiensis, and conidia of Stagonospora paludosa. Bottom from left to right: Asci of Stagonospora perfecta, leaf symptoms 

induced by Cercospora coniogrammes, and conidiophores of a Cercospora sp.


edited by 

Pedro W. Crous 

CBS-KNAW Fungal Biodiversity Centre, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands 

Microbiology, Department of Biology, Utrecht University, Padualaan 8, 3584 CH Utrecht, The Netherlands 

Wageningen University and Research Centre (WUR), Laboratory of Phytopathology, Droevendaalsesteeg 1, 6708 PB Wageningen, The Netherlands 

Gerard J.M. Verkley 


and 

Johannes Z. Groenewald 




An institute of the Royal Netherlands Academy of Arts and Sciences

INTRODUCTION 

The present issue of Studies in Mycology focuses on plant 

pathogenic Dothideomycetes. The Dothideomycetes represents 

the largest class of Ascomycota, with more than 100 families and 

19 000 species. Of interest, however, is the fact that this class 

also contains the most genera of plant pathogenic fungi, many of 

which are frequently encountered by plant health officers at various 

ports of entry around the world. These officers are subsequently 

confronted by the fact that the fungus may be expressing its sexual 

or asexual morph, or worse, maybe sterile mycelium. Traditionally 

these mycologists have had a range of books with which they could 

try to identify these organisms based on the phenotype. In recent 

years however, most of these taxa have been shown to represent 

species complexes, with some specific to certain regions or hosts. 

Integrating asexual and sexual names, dealing with species that are 

cryptic, and genera that are poly- and paraphyletic, and a general 

lack of DNA data authentic for these species, is a constant stress 

to which these mycologists are exposed. Identifications made by 

these mycologists could result in losses of millions of “dollars” to 

farmers and producers, while wrongful introductions could again 

destroy local industries and markets. 

The present issue focuses on five main groups of fungi that 

plant health officers deal with on a weekly, or daily basis, namely 

Alternaria, Cercospora, Phoma, Pseudocercospora, and Septoria. 

DEDICATION: To the plant health officers of the 

world 

This special issue is dedicated to three exceptional colleagues, 

who dedicated their lives and careers to be plant health officers, 

striving to enhance trade, but also to protect borders from wrongful 

incursions. To these colleagues we owe a great deal of thanks for 

their unselfish dedication and commitment. Without their published 

works, databases, specimens and cultures, we would not have 

been able to produce the papers reported in this special issue. 

Gerhard H. Boerema (1925–2008) 

Gerhard Boerema accepted a position as mycologist at the Dutch 

Plant Protection Service (Plantenziektenkundige Dienst, PD) in 

1956. Gerhard became head of the Mycology Department in 1959 

and fulfilled this position until his early retirement in 1988. The main 

tasks of the Mycology Department at that time was the diagnosis 

on symptomatic plant material submitted by inspectors, advisory 

services, companies, research stations, etc. It covered all fields 

such as agriculture, horticulture, greenhouse products as well as 

natural environment. Interesting findings were published annually 

in the Dutch Tijdschrift over Plantenziekten, continued later as 

Mededelingen van de Plantenziektenkundige Dienst in Wageningen 

(Yearbook PD). The diversity of topics is demonstrated in his first 

reports that included bark canker of apple and pear, caused by 

Pezicula corticola (1959), a new species of Sclerotinia as the cause 

of black leg in tulip (1960), and Chalaropsis thielavioides on carrots 

pre-packed in perforated polythene bags (1960). Another important 

task was to give internal advice concerning quarantine issues. 

Shortly after he became head of the Mycology department, a 

new disease was found on potatoes, caused by Phoma foveata, 

a quarantine organism at that time in Europe. The taxonomy of 

phoma-like species on potatoes was confusing, and he started his 

fundamental study on Phoma. A second important problem, Phoma 

lingam on seeds of Brassicaceae arose, and studies on many other 

Phoma species associated with plant material followed. 

Gerhard described many synonyms of the Phoma species after 

detailed studies of herbarium material. He recognised sections in 

Phoma and published his findings in numerous papers in the period 

1960–1988. He became the expert on Phoma worldwide. Isolates 

and herbarium material were weekly received for identification and 

the extensive correspondence in English, French and German 

language is still preserved at the Dutch Plant Protection Service. 

Gerhard established with his team a culture collection and 

herbarium at PD, and most of the strains were also deposited at 

the culture collection of CBS. During his career, Phoma was his 

main topic, but he worked on the nomenclature of many important 

plant pathogens, published as "Check-list for scientific names of 

common parasitic fungi" in 12 supplement series in the Netherlands 

Journal of Plant Pathology. 

Gerhard collaborated in a new Phoma project started at the PD 

to provide standardised in vitro descriptions of Phoma species. He 

established the morphological genus concept with a classification 

of Phoma in nine sections. In collaboration with his successor Chiel 

Noordeloos, Hans de Gruyter and Marielle Hamers, “Contributions 

towards a monograph of Phoma” were published in Persoonia 

during the period 1992–2003. These papers formed the base 

for the “Phoma Identification Manual” published in 2004 (CABI 

Publishing, Wallingford, UK). The cultures deposited at the PD and 

the CBS, however, laid the foundation for the next phase, which 

was a phylogenetic study of the sections and species in the Phoma 

complex by two PhD students, Aveskamp and de Gruyter, of which 

one final paper is published in this issue. 

C.F. (Frank) Hill (1941–2009) 

Caleb Francis (Frank) Hill was a mycologist at the Ministry of 

Agriculture and Forestry (MAF) in Auckland, New Zealand. 

Frank always had a strong focus on diagnostics, and in the 

process isolated numerous interesting plant pathogenic fungi. 

For instance, Calonectria pseudonaviculata (= Cylindrocladium 

buxicola), which is now a major quarantine problem on Buxus 

in Europe and the USA, was originally described from material 

Frank collected in New Zealand in 1998, and sent to CBS for 

a collaborative publication on Calonectria, a pathogen that he 

frequently intercepted at ports of entry into New Zealand. During 

his career Frank published descriptions of more than 70 novel 

taxa, contributed to more than 3 000 pest records in the Ministry 

of Agriculture and Forestry Plant Pest database, and deposited 

more than 1 500 specimens and cultures. To address the severe 

shortage of cultures and lack of DNA data in the cercosporoid 

complex, the CBS started to purposefully cultivate all cercosporoid 

fungi encountered. One of the best collectors was Frank Hill, who 

in his function as plant health diagnostician, encountered many 

pathogens both indigenous and exotic to New Zealand. Frank 

collected a great many of the specimens treated in the papers 

published in this issue (ranging from Alternaria to Phoma, and 

cercosporoid). It is interesting to note that the collection dates 

largely correspond with weekends, which gave us the impression 

that Frank was always roaming the countryside, botanical gardens 

and arboretums, looking for interesting diseases. Without Frank’s

collections, these studies would not have been possible. It is only 

fitting then, that we also dedicate this work to him for his keen 

eye, and never ending enthusiasm for the subject. Frank may 

have passed on, but his collection of plant pathogenic fungal 

cultures will forever remain a living legacy for future generations 

to study. 

Flora G. Pollack (1919–1997) 

Gerhard H. Boerema 

C.F. (Frank) Hill 

Flora G. Pollack 

As the United States’ only plant quarantine mycologist for 12 

years, Flora Pollack had the privilege of examining specimens 

of interesting and unusual fungi from around the world that had 

been intercepted at various ports of entry. Flora began working 

for the Bureau of Plant Quarantine in the early 1940’s when it 

was located in the U.S. Department of Agriculture building in 

downtown Washington. She resigned from her job to raise her 

children, and 15 years later went to work again as a mycologist at 

the American Type Culture Collection (ATCC), then in Rockville, 

MD. During her six and one-half years of employment there, she 

improved a technique for the preservation of cultures in their 

original condition as received by ATCC that is still widely used 

for this purpose. When the opportunity arose, she returned to the 

U.S. Department of Agriculture in 1967. During her professional 

years she published many scientific articles in Mycologia and 

other journals often authored in collaboration with others. She 

described numerous new species in a wide range of fungal 

groups but had a particular fondness for coelomycetous fungi, 

a group that still evades accurate classification. At least one 

unusual species, aptly named Monosporascus cannonballus was 

described by Pollack with F.A. Uecker. Originally encountered as 

a harmless oddity associated with the roots of cantaloupes, many 

years later this fungus gained prominence as a virulent pathogen 

limiting the production of melons in dry areas of the world. 

While working for APHIS, Flora was associated with the 

Mycology Laboratory, now Systematic Mycology & Microbiology 

Laboratory. As the plant quarantine mycologist she encountered 

on a daily basis fungi from around the world, many of which she 

deposited in the U.S. National Fungus Collections. A search of 

herbarium database yields over 5 000 specimens identified by 

Flora that remain an important resource for the identification of 

plant quarantine fungi as well as fodder for taxonomists tackling 

these difficult species. Following the tradition established by her 

predecessor, Alice Watson, she maintained a card file of important 

literature for the identification of plant-associated fungi. This 

file became the basis for a publication (Rossman AY, Palm ME, 

Spielman LJ. 1987. A Literature Guide for the Identification of Plant 

Pathogenic Fungi. St. Paul, Minnesota: American Phytopathological 

Society), and later the database of literature available on the 

Internet . After retiring in 1979, Flora was asked to publish a project 

she had started in her spare time while working in Beltsville. She 

spent many hours pulling together her “Annotated Compilation 

of Cercospora Names”. Published in 1987, it served as the most 

comprehensive reference on this genus, and provided the basis for 

a later update by Crous & Braun (2003) on “Mycosphaerella and 

its anamorphs: 1. Names published in Cercospora and Passalora” 

(CBS Biodiversity Series 1, CBS-KNAW Fungal Biodiversity 

Centre, Utrecht, Netherlands), which in turn set the stage for the 

molecular phylogenetic papers published on this complex in this 

issue of Studies in Mycology.

Johannes (Hans) de Gruyter 

National Reference Centre, National Plant Protection Organization, 

P.O. Box 9102, 6700 HC Wageningen, the Netherlands 

Brett J.R. Alexander 

Mycology and Bacteriology, Plant Health and Environment 

Laboratory, Ministry for Primary Industries, PO Box 2095, Auckland 

1140, New Zealand 

Amy Y. Rossman 

Mary E. Palm 

Systematic Mycology & Microbiology Laboratory, Agricultural 

Research Service, & Animal and Plant Health Inspection Service, 

USDA, Beltsville, Maryland 20705, USA 

Pedro W. Crous 

CBS-KNAW Fungal Biodiversity Centre, Upssalalaan 8, 3584 CT, 

Utrecht, the Netherlands

CONTENTS 

J. de Gruyter, J.H.C. Woudenberg, M.M. Aveskamp, G.J.M. Verkley, J.Z. Groenewald and P.W. Crous. Redisposition of phoma-like anamorphs 

in Pleosporales ................................................................................................................................................................................................. 1 

P.W. Crous, U. Braun, G.C. Hunter, M.J. Wingfield, G.J.M. Verkley, H.-D. Shin, C. Nakashima and J.Z. Groenewald. Phylogenetic lineages in 

Pseudocercospora .......................................................................................................................................................................................... 37 

J.Z. Groenewald, C. Nakashima, J. Nishikawa, H.-D. Shin, J.-H. Park, A.N. Jama, M. Groenewald, U. Braun and P.W. Crous. Species 

concepts in Cercospora: spotting the weeds among the roses .................................................................................................................... 115 

J.H.C. Woudenberg, J.Z. Groenewald, M. Binder and P.W. Crous. Alternaria redefined ............................................................................. 171 

G.J.M. Verkley, W. Quaedvlieg, H.-D. Shin and P.W. Crous. A new approach to species delimitation in Septoria ...................................... 213 

W. Quaedvlieg, G.J.M. Verkley, H.-D. Shin, R.W. Barreto, A.C. Alfenas, W.J. Swart, J.Z. Groenewald and P.W. Crous. Sizing up 

Septoria ........................................................................................................................................................................................................ 307 

Index of Fungal Names ................................................................................................................................................................................ 391

available online at www.studiesinmycology.org 

Studies in Mycology 75: 1–36. 

Redisposition of phoma-like anamorphs in Pleosporales 

J. de Gruyter 1–3* , J.H.C. Woudenberg 1 , M.M. Aveskamp 1 , G.J.M. Verkley 1 , J.Z. Groenewald 1 , and P.W. Crous 1,3,4 

1 

CBS-KNAW Fungal Biodiversity Centre, P.O. Box 85167, 3508 AD Utrecht, The Netherlands; 2 National Reference Centre, National Plant Protection Organization, P.O. Box 9102, 

6700 HC Wageningen, The Netherlands; 3 Wageningen University and Research Centre (WUR), Laboratory of Phytopathology, Droevendaalsesteeg 1, 6708 PB Wageningen, 

The Netherlands; 4 Microbiology, Department of Biology, Utrecht University, Padualaan 8, 3584 CH Utrecht, The Netherlands 

*Correspondence: Hans de Gruyter, j.de.gruyter@minlnv.nl 

Abstract: The anamorphic genus Phoma was subdivided into nine sections based on morphological characters, and included teleomorphs in Didymella, Leptosphaeria, 

Pleospora and Mycosphaerella, suggesting the polyphyly of the genus. Recent molecular, phylogenetic studies led to the conclusion that Phoma should be restricted to 

Didymellaceae. The present study focuses on the taxonomy of excluded Phoma species, currently classified in Phoma sections Plenodomus, Heterospora and Pilosa. Species 

of Leptosphaeria and Phoma section Plenodomus are reclassified in Plenodomus, Subplenodomus gen. nov., Leptosphaeria and Paraleptosphaeria gen. nov., based on the 

phylogeny determined by analysis of sequence data of the large subunit 28S nrDNA (LSU) and Internal Transcribed Spacer regions 1 & 2 and 5.8S nrDNA (ITS). Phoma 

heteromorphospora, type species of Phoma section Heterospora, and its allied species Phoma dimorphospora, are transferred to the genus Heterospora stat. nov. The Phoma 

acuta complex (teleomorph Leptosphaeria doliolum), is revised based on a multilocus sequence analysis of the LSU, ITS, small subunit 18S nrDNA (SSU), β-tubulin (TUB), and 

chitin synthase 1 (CHS-1) regions. Species of Phoma section Pilosa and allied Ascochyta species were determined to belong to Pleosporaceae based on analysis of actin (ACT) 

sequence data. Anamorphs that are similar morphologically to Phoma and described in Ascochyta, Asteromella, Coniothyrium, Plectophomella, Pleurophoma and Pyrenochaeta 

are included in this study. Phoma-like species, which grouped outside the Pleosporineae based on a LSU sequence analysis, are transferred to the genera Aposphaeria, 

Paraconiothyrium and Westerdykella. The genera Medicopsis gen. nov. and Nigrograna gen. nov. are introduced to accommodate the medically important species formerly 

known as Pyrenochaeta romeroi and Pyrenochaeta mackinnonii, respectively. 


Key words: coelomycetes, Coniothyriaceae, Cucurbitariaceae, Leptosphaeriaceae, Melanommataceae, molecular phylogeny, Montagnulaceae, Phaeosphaeriaceae, 

Pleosporaceae, Sporormiaceae, taxonomy, Trematosphaeriaceae. 

Taxonomic novelties: New genera: Medicopsis Gruyter, Verkley & Crous, Nigrograna Gruyter, Verkley & Crous, Paraleptosphaeria Gruyter, Verkley & Crous, 

Subplenodomus Gruyter, Verkley & Crous. New species: Aposphaeria corallinolutea Gruyter, Aveskamp & Verkley, Paraconiothyrium maculicutis Verkley & Gruyter. 

New combinations: Coniothyrium carteri (Gruyter & Boerema) Verkley & Gruyter, C. dolichi (Mohanty) Verkley & Gruyter, C. glycines (R.B. Stewart) Verkley & Gruyter, C. 

multiporum (V.H. Pawar, P.N. Mathur & Thirum.) Verkley & Gruyter, C. telephii (Allesch.) Verkley & Gruyter, Heterospora (Boerema, Gruyter & Noordel.) Gruyter, Verkley & 

Crous, H. chenopodii (Westend.) Gruyter, Aveskamp & Verkley, H. dimorphospora (Speg.) Gruyter, Aveskamp & Verkley, Leptosphaeria errabunda (Desm.) Gruyter, Aveskamp 

& Verkley, L. etheridgei (L.J. Hutchison & Y. Hirats.) Gruyter, Aveskamp & Verkley, L. macrocapsa (Trail) Gruyter, Aveskamp & Verkley, L. pedicularis (Fuckel) Gruyter, Aveskamp 

& Verkley, L. rubefaciens (Togliani) Gruyter, Aveskamp & Verkley, L. sclerotioides (Sacc.) Gruyter, Aveskamp & Verkley, L. sydowii (Boerema, Kesteren & Loer.) Gruyter, 

Aveskamp & Verkley, L. veronicae (Hollós) Gruyter, Aveskamp & Verkley, Medicopsis romeroi (Borelli) Gruyter, Verkley & Crous, Nigrograna mackinnonii (Borelli) Gruyter, 

Verkley & Crous, Paraconiothyrium flavescens (Gruyter, Noordel. & Boerema) Verkley & Gruyter, Paracon. fuckelii (Sacc.) Verkley & Gruyter, Paracon. fusco-maculans (Sacc.) 

Verkley & Gruyter, Paracon. lini (Pass.) Verkley & Gruyter, Paracon. tiliae (F. Rudolphi) Verkley & Gruyter, Paraleptosphaeria dryadis (Johanson) Gruyter, Aveskamp & Verkley, 

Paralept. macrospora (Thüm.) Gruyter, Aveskamp & Verkley, Paralept. nitschkei (Rehm ex G. Winter) Gruyter, Aveskamp & Verkley, Paralept. orobanches (Schweinitz : Fr.) 

Gruyter, Aveskamp & Verkley, Paralept. praetermissa (P. Karst.) Gruyter, Aveskamp & Verkley, Plenodomus agnitus (Desm.) Gruyter, Aveskamp & Verkley, Plen. biglobosus 

(Shoemaker & H. Brun) Gruyter, Aveskamp & Verkley, Plen. chrysanthemi (Zachos, Constantinou & Panag.) Gruyter, Aveskamp & Verkley, Plen. collinsoniae (Dearn. & House) 

Gruyter, Aveskamp & Verkley, Plen. confertus (Niessl ex Sacc.) Gruyter, Aveskamp & Verkley, Plen. congestus (M.T. Lucas) Gruyter, Aveskamp & Verkley, Plen. enteroleucus 

(Sacc.) Gruyter, Aveskamp & Verkley, Plen. fallaciosus (Berl.) Gruyter, Aveskamp & Verkley, Plen. hendersoniae (Fuckel) Gruyter, Aveskamp & Verkley, Plen. influorescens 

(Boerema & Loer.) Gruyter, Aveskamp & Verkley, Plen. libanotidis (Fuckel) Gruyter, Aveskamp & Verkley, Plen. lindquistii (Frezzi) Gruyter, Aveskamp & Verkley, Plen. lupini (Ellis 

& Everh.) Gruyter, Aveskamp & Verkley, Plen. pimpinellae (Lowen & Sivan.) Gruyter, Aveskamp & Verkley, Plen. tracheiphilus (Petri) Gruyter, Aveskamp & Verkley, Plen. visci 

(Moesz) Gruyter, Aveskamp & Verkley, Pleospora fallens (Sacc.) Gruyter & Verkley, Pleo. flavigena (Constantinou & Aa) Gruyter & Verkley, Pleo. incompta (Sacc. & Martelli) 

Gruyter & Verkley, Pyrenochaetopsis pratorum (P.R. Johnst. & Boerema) Gruyter, Aveskamp & Verkley, Subplenodomus apiicola (Kleb.) Gruyter, Aveskamp & Verkley, 

Subplen. drobnjacensis (Bubák) Gruyter, Aveskamp & Verkley, Subplen. valerianae (Henn.) Gruyter, Aveskamp & Verkley, Subplen. violicola (P. Syd.) Gruyter, Aveskamp & 

Verkley, Westerdykella capitulum (V.H. Pawar, P.N. Mathur & Thirum.) de Gruyter, Aveskamp & Verkley, W. minutispora (P.N. Mathur ex Gruyter & Noordel.) Gruyter, Aveskamp 

& Verkley. New names: Pleospora angustis Gruyter & Verkley, Pleospora halimiones Gruyter & Verkley. 

Published online: 15 May 2012; doi:10.3114/sim0004. Hard copy: June 2013. 

Introduction 

The anamorphic genus Phoma includes many important plant 

pathogens. The taxonomy of Phoma has been studied intensively 

in the Netherlands for more than 40 years resulting in the 

development of a generic concept as an outline for identification 

of Phoma species (Boerema 1997). In this concept species of 

the genus Phoma are classified based on their morphological 

Copyright CBS-KNAW Fungal Biodiversity Centre, P.O. Box 85167, 3508 AD Utrecht, The Netherlands. 

characters into nine sections: Phoma, Heterospora, Macrospora, 

Paraphoma, Peyronellaea, Phyllostictoides, Pilosa, Plenodomus 

and Sclerophomella (Boerema 1997). The species placed in each 

of the sections were systematically described culminating in the 

publication of the “Phoma Identification Manual” (Boerema et al. 

2004), which contained the descriptions of 223 specific and infraspecific 

taxa of Phoma, and more than 1000 synonyms in other 

coelomycetous genera. The classification of the Phoma species in 

You are free to share - to copy, distribute and transmit the work, under the following conditions: 

Attribution: 


Non-commercial: You may not use this work for commercial purposes. 

No derivative works: You may not alter, transform, or build upon this work. 

For any reuse or distribution, you must make clear to others the license terms of this work, which can be found at http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode. Any of the above conditions can be waived if you get 

permission from the copyright holder. Nothing in this license impairs or restricts the author’s moral rights. 

1

De Gruyter et al. 

sections based on morphology is artificial (Boerema et al. 2004), 

and several species can be classified in more than one section as 

they reveal multiple “section-specific” characters. 

A large, well-studied Phoma culture collection that includes 

more than 1100 strains of Phoma resulted from the extensive 

morphological studies conducted on Phoma in The Netherlands. 

That culture collection is the basis of an intensive molecular 

phylogenetic study of the genus Phoma, which commenced in 

2006. Molecular studies of species of Phoma prior to the onset of 

this project concentrated on the development of molecular detection 

methods for specific, important plant pathogenic Phoma species, 

such as Ph. macdonaldii, Ph. tracheiphila, Stagonosporopsis 

cucurbitacearum (as Ph. cucurbitacearum) and Boeremia foveata 

(as Ph. foveata) (Aveskamp et al. 2008). The phylogeny of the 

type species of the nine Phoma sections and morphologically 

similar coelomycetes was determined utilising the sequence data 

of the large subunit 28S nrDNA (LSU) and the small subunit 18S 

nrDNA (SSU) regions (de Gruyter et al. 2009). Results of that study 

demonstrated that the type species of the nine Phoma sections 

all grouped in Pleosporales. The type species of five Phoma 

sections, Phoma, Phyllostictoides, Sclerophomella, Macrospora 

and Peyronellaea and similar genera, grouped in a distinct clade 

in Didymellaceae. The type species of the remaining four Phoma 

sections, Heterospora, Paraphoma, Pilosa and Plenodomus, 

clustered in several clades outside Didymellaceae based on the 

LSU and SSU sequence analysis leading to the conclusion that 

these species should be excluded from Phoma (de Gruyter et al. 

2009, Aveskamp et al. 2010). 

The molecular phylogeny of the Phoma species in Didymellaceae 

was determined in a subsequent study (Aveskamp et al. 2010) 

and, as the phylogenetic placement of the sectional type species 

already suggested, included species mainly from sections Phoma, 

Phyllostictoides, Sclerophomella, Macrospora and Peyronellaea. 

The molecular phylogeny of 11 Phoma species classified in Phoma 

section Paraphoma based on their setose pycnidia was investigated 

using LSU and SSU sequences (de Gruyter et al. 2010) and this 

section was highly polyphyletic, with species clustering mainly in 

Phaeosphaeriaceae and Cucurbitariaceae. 

The purpose of the present study was to clarify the molecular 

phylogeny of the Phoma species currently classified in sections 

Plenodomus and Pilosa, along with Phoma species which were 

determined to be distantly related to the generic type species 

Ph. herbarum in previous molecular studies. Additionally, phomalike 

isolates of coelomycetes currently classified in Ascochyta 

and Coniothyrium and clustering outside the Didymellaceae (de 

Gruyter et al. 2009, Aveskamp et al. 2010) are included in this study 

along with a number of phoma-like species that do not belong to 

Pleosporineae. 

In the present study, the initial focus was to determine the 

molecular phylogeny of Phoma betae (teleom. Pleospora betae) 

and Ph. lingam (teleom. Leptosphaeria maculans), type species of 

the Phoma sections Pilosa and Plenodomus, respectively, at the 

generic rank based on the sequence data of the LSU and the SSU 

regions. In a subsequent study, the sequence data of both the LSU 

and the ITS regions were used for a revised classification of the 

Phoma species currently classified in Phoma section Plenodomus. 

Only a limited number of the species currently classified in this 

section have a confirmed Leptosphaeria teleomorph. 

The Phoma acuta species complex was subject of a more 

detailed study. The teleomorph of Ph. acuta is Leptosphaeria 

doliolum, type species of the genus Leptosphaeria. A multilocus 

analysis of sequence data of the SSU, LSU, ITS, β-tubulin (TUB), 

and chitin synthase 1 (CHS-1) regions was performed. The 

phylogeny of Phoma species of section Pilosa, with a Pleospora 

teleomorph (Pleosporaceae) was studied utilising actin (ACT) 

sequence data. 

Phoma-like species currently attributed to the genera 

Aposphaeria, Asteromella, Coniothyrium, Phoma, Plenodomus, 

Pleurophoma and Pyrenochaeta, which could not be classified in the 

Pleosporineae based on their molecular phylogeny, were included 

in a LSU sequence analysis. All Phoma taxa that are unrelated to 

Didymellaceae and treated in this paper are redisposed to other 

genera. 

A further aim of this study was to establish a single nomenclature 

for well-resolved anamorph–teleomorph relationships as discussed 

by Hawksworth et al. (2011). In cases where one anamorphteleomorph 

generic relation is involved in a monophyletic lineage, 

one generic name was chosen based on priority and the other 

named teleomorph or anamorph state is treated as a synonym. 

Similar approaches towards single nomenclature have been 

employed in Botryosphaeriales (Crous et al. 2006, 2009a, b, Phillips 

et al. 2008), Pleosporales (Aveskamp et al. 2010), and Hypocreales 

(Lombard et al. 2010a–c, Chaverri et al. 2011, Gräfenhan et al. 

2011, Schroers et al. 2011). 

MATERIALS AND METHODS 

Isolate selection, culture studies and DNA extraction 

The generic abbreviations used in this study are: Ascochyta 

(A.), Coniothyrium (C.), Heterospora (H.), Leptosphaeria (L.), 

Paraconiothyrium (Paracon.), Paraleptosphaeria (Paralep.), Phoma 

(Ph.), Plenodomus (Plen.), Pleospora (Pleo.), Pyrenochaeta (Py.), 

Subplenodomus (Subplen.) and Westerdykella (W.). The isolates 

included in this study were obtained from the culture collections 

of the Centraalbureau voor Schimmelcultures, Utrecht, The 

Netherlands (CBS-KNAW) and the Dutch National Plant Protection 

Organization, Wageningen, The Netherlands (PD) (Table 1). 

The freeze-dried isolates were revived overnight in 2 mL malt/ 

peptone (50 % / 50 %) liquid medium and subsequently transferred 

and maintained on oatmeal agar (OA) (Crous et al. 2009c). The 

isolates, which were stored at -196 °C, were directly transferred 

to OA. Cultures growing on OA and malt extract agar (MEA) 

(Crous et al. 2009c) were studied morphologically as described in 

detail by Boerema et al. (2004). The genomic DNA isolation was 

performed using the Ultraclean Microbial DNA isolation kit (Mo Bio 

Laboratories, Carlsbad, California) according to the instructions of 

the manufacturer. All DNA extracts were diluted 10 × in milliQ water 

and stored at 4 °C before use. 

PCR and sequencing 

For nucleotide sequence comparisons, partial regions of SSU, LSU 

and ITS, as well as part of the ACT, TUB and CHS-1 genes were 

amplified. The SSU region was amplified with the primers NS1 and 

NS4 (White et al. 1990) and the LSU region was amplified with 

the primers LR0R (Rehner & Samuels 1994) and LR7 (Vilgalys 

& Hester 1990). The ITS and TUB regions were amplified as 

described by Aveskamp et al. (2009) using the primer pair V9G (de 

Hoog & Gerrits van den Ende 1998) and ITS4 (White et al. 1990) 

for the ITS and the BT2Fw and BT4Rd primer pair (Woudenberg 

et al. 2009) for the TUB locus. The ACT and CHS-1 regions 

2

Phoma sections Plenodomus, Pilosa 

were amplified using the primer pairs ACT-512F / ACT-783R and 

CHS-354R / CHS-79F (Carbone & Kohn 1999). The amplification 

reactions were performed and analysed as described by de Gruyter 

et al. (2009). 

Sequencing of the PCR amplicons was conducted using the 

same primer combinations, although the primer LR5 (Vilgalys & 

Hester 1990) was used as an additional internal sequencing primer 

for LSU. The sequence products were purified using Sephadex 

columns (Sephadex G-50 Superfine, Amersham Biosciences, 

Roosendaal, Netherlands) and analysed with an ABI Prism 3730XL 

Sequencer (Applied Biosystems) according to the manufacturer’s 

instructions. Consensus sequences were computed from both 

forward and reverse sequences using the Bionumerics v. 4.61 

software package (Applied Maths, Sint-Martens-Latem, Belgium) 

and were lodged with GenBank. All sequences of reference isolates 

included in this study were obtained from GenBank (Table 1). 

Phylogenetic analyses 

To determine the phylogeny of Phoma betae and Ph. lingam at 

rank, the SSU and LSU sequence data of two isolates were aligned 

with the sequences of 46 reference isolates in the Pleosporales that 

were obtained from GenBank (Table 1), 14 of which were classified 

in the Pleosporaceae or Leptosphaeriaceae. The phylogeny of 

Phoma section Plenodomus was determined with the combined 

data set of LSU and ITS sequences of 87 isolates, including 

53 isolates currently classified in Leptosphaeria and Phoma 

section Plenodomus. Phoma apiicola, Ph. dimorphospora, Ph. 

heteromorphospora, Ph. lupini, Ph. valerianae, Ph. vasinfecta and 

Ph. violicola classified in Phoma sections Phoma or Heterospora 

(Boerema et al. 2004) grouped in previous molecular phylogenetic 

studies outside Didymellaceae (de Gruyter et al. 2009, Aveskamp 

et al. 2010), and are therefore treated here. 

In the study of the Leptosphaeria doliolum complex, that includes 

the subspecies of Ph. acuta, viz. subsp. acuta, errabunda and also 

Ph. acuta subsp. acuta f. sp. phlogis, a phylogenetic analysis was 

performed utilising the ITS, ACT, TUB, CHS-1 sequences of 18 

isolates. Phoma macrocapsa, Ph. sydowii and Ph. veronicicola 

being closely related to this species complex were included. 

The species concept of phoma-like anamorphs in Pleosporaceae 

was determined by alignments of the ACT sequences of 15 isolates 

and five reference isolates. Phoma fallens, Ph. glaucispora and 

Ph. flavigena were also included. These species were originally 

classified in Phoma sect. Phoma (de Gruyter & Noordeloos 1992, 

de Gruyter et al. 1998). However, a molecular phylogenetic study 

demonstrated that these species grouped in a clade representing 

Leptosphaeriaceae and Pleosporaceae (Aveskamp et al. 2010). 

Sequence data were compared with those of isolates currently 

classified in the genera Phoma, Ascochyta and Coniothyrium, as 

well as isolates of Leptosphaeria clavata and the generic type 

species Pleospora herbarum. Phoma incompta is the only species 

classified in Phoma section Sclerophomella, which proved to be 

unrelated to Didymellaceae (Aveskamp et al. 2010). 

The phoma-like species that could not be attributed to 

Pleosporineae (Zhang et al. 2009) were studied with the LSU 

sequences of 40 isolates, including 20 reference isolates 

representing the anamorph genera Beverwykella, Neottiosporina, 

Paraconiothyrium, as well as the teleomorph genera Byssothecium, 

Falciformispora, Herpotrichia, Melanomma, Paraphaeosphaeria, 

Pleomassaria, Preussia, Roussoella, Splanchnonema, 

Sporormiella, Thyridaria, Trematosphaeria and Westerdykella. 

Four Phoma species were included which are currently described in 

Phoma section Phoma, viz. Ph. capitulum, Ph. flavescens, Ph. lini, 

and Ph. minutispora (de Gruyter & Noordeloos 1992, de Gruyter et 

al. 1993). In addition, the human pathogens Pyrenochaeta romeroi 

and Py. mackinnonii, which could not be classified in a recent study 

dealing with phoma-like species with setose pycnidia (de Gruyter 

et al. 2010), were included. 

The multiple alignments were automatically calculated by 

the BioNumerics software package, but manual adjustments for 

improvement were made by eye where necessary. For multilocus 

alignments, the phylogenetic analyses were done for each dataset 

individually, and where similar tree topologies were obtained, an 

analysis was performed on the combined alignment of all the 

gene regions in the multilocus alignment. Neighbour-Joining (NJ) 

distance analyses were conducted using PAUP (Phylogenetic 

Analysis Using Parsimony) v. 4.0b10 (Swofford 2003) with 

the uncorrected “p”, Jukes-Cantor and Kimura 2-parameter 

substitution models. The robustness of the trees obtained was 

evaluated by 1000 bootstrap replications. A Bayesian analysis was 

conducted with MrBayes v. 3.1.2 (Huelsenbeck & Ronqvist 2001) 

in two parallel runs, using the default settings but with the following 

adjustments: the GTR model (trees 1–3, 5) with gamma-distributed 

rate and the HKY+ γ-model (tree 4) were selected for the partitions 

using the Findmodel freeware (http://hcv.lanl.gov/content/hcv-db/ 

findmodel/findmodel.html), and a MCMC heated chain was set 

with a “temperature” value of 0.05. The number of generations and 

sample frequencies were set at 5 million and 10 (trees 3–5) or 100 

(trees 1, 2) respectively and the run was automatically stopped 

as soon as the average standard deviation of split frequencies 

reached below 0.01. The resulting trees were printed with TreeView 

v. 1.6.6 (Page 1996) and alignments and trees were deposited into 

TreeBASE (www.treebase.org). 

RESULTS 

The data for the aligned sequence matrices for the trees obtained in 

the different studies are provided below. In the case that alignments 

of multiple loci are involved, the topologies of the obtained trees 

for each locus were compared by eye to confirm that the overall 

tree topology of the individual datasets were similar to each other 

and to that of the tree obtained from the combined alignment. The 

NJ analyses with the three substitution models showed similar tree 

topologies and were congruent to those obtained in the Bayesian 

analyses. The results of the molecular phylogenetic analyses are 

supplied below; the summarised additional ecology and distribution 

data of the taxa involved were adopted from Boerema et al. (2004), 

where the references to original literature are provided. 

Phylogeny of Phoma lingam and Ph. betae, the type 

species of Phoma sections Plenodomus and Pilosa 

(Pleosporineae) 

The aligned sequence matrix obtained for the SSU and LSU 

regions had a total length of 2 671 nucleotide characters, 1 367 and 

1 304 respectively. In the alignment, an insertion in the SSU at the 

positions 478–832 was observed for the cultures CBS 216.75, CBS 

165.78, CBS 138.96, CBS 331.37 and CBS 674.75. This insertion 

was excluded from further phylogenetic analyses. The combined 

dataset used in the analyses included 48 taxa and contained 2 316 

characters with 101 and 213 unique site patterns for SSU and LSU, 

www.studiesinmycology.org 

3


Table 1. Isolates used in this study and their GenBank accession numbers. Name changes and newly generated sequences are indicated in bold. 

Species name, final identification Former identification CBS no. Other no. ITS SSU LSU ACT TUB CHS-1 Host, substrate Country 

Aposphaeria corallinolutea sp. nov. Pleurophoma sp. CBS 131286 PD 83/367 JF740329 Kerria japonica (Rosaceae) Netherlands 

Pleurophoma sp. CBS 131287 PD 83/831 JF740330 Fraxinus excelsior 

(Oleaceae) 

Aposphaeria populina CBS 543.70 EU754130 Populus canadensis 

(Salicaceae) 

Pyrenochaeta sp. CBS 350.82 JF740265 Picea abies (Pinaceae) Germany 

Netherlands 

Netherlands 

Pleurophoma sp. CBS 130330 PD 84/221 JF740328 Cornus mas (Cornaceae) Netherlands 

Beverwykella pulmonaria CBS 283.53 ATCC 32983, IFO 6800 GU301804 Fagus sylvatica (Fagaceae) Netherlands 

Byssothecium circinans CBS 675.92 ATCC 52767, ATCC 52678, 

IMI 266220 

AY016357 Medicago sativa 

(Fabaceae) 

Chaetodiplodia sp. Chaetodiplodia sp. CBS 453.68 JF740115 Halimione portulacoides 

(Chenopodiaceae) 

Chaetosphaeronema hispidulum CBS 216.75 EU754045 EU754144 Anthyllis vulneraria 

(Fabaceae) 

Cochliobolus sativus DAOM 226212 DQ677995 DQ678045 (Poaceae) Unknown 

USA 

Netherlands 

Germany 

Coniothyrium carteri comb. nov. Phoma carteri CBS 101633 PD 84/74 JF740180 GQ387593 Quercus sp. Fagaceae) Netherlands 

Phoma carteri CBS 105.91 JF740181 GQ387533 GQ387594 Quercus robur (Fagaceae) Germany 

Coniothyrium dolichi comb. nov. Pyrenochaeta dolichi CBS 124143 IMI 217261 JF740182 GQ387610 Dolichos biforus 

(Fabaceae) 

Pyrenochaeta dolichi CBS 124140 IMI 217262 JF740183 GQ387550 GQ387611 Dolichos biforus 

(Fabaceae) 

Coniothyrium glycines comb. nov. Phoma glycinicola CBS 124455 IMI 294986 JF740184 GQ387536 GQ387597 Glycine max (Fabaceae) Zambia 

India 

India 

Phoma glycinicola CBS 124141 PG-1 JF740185 GQ387598 Glycine max (Fabaceae) Zimbabwe 

Coniothyrium multiporum comb. nov. Phoma multipora CBS 501.91 PD 83/888 JF740186 GU238109 Unknown Egypt 

Phoma multipora CBS 353.65 IMI 113689, ATCC 16207, 

HACC 164 

JF740187 JF740268 Saline soil India 

Coniothyrium palmarum CBS 400.71 AY720708 EU754054 EU754153 Chamaerops humilis 

(Arecaceae) 

Coniothyrium telephii comb. nov. Phoma septicidalis CBS 188.71 JF740188 GQ387538 GQ387599 Air Finland 

Italy 

Phoma septicidalis CBS 856.97 JF740189 GQ387539 GQ387600 Mineral wool Finland 

Phoma septicidalis CBS 101636 PD 86/1186 JF740190 GQ387540 GQ387601 Glycine max (Fabaceae) Zimbabwe 

Cucurbitaria berberidis, anam. 

Pyrenochaeta berberidis 

CBS 363.93 JF740191 GQ387545 GQ387606 Berberis vulgaris 

(Berberidaceae) 

Didymella exigua CBS 183.55 EU754056 EU754155 Rumex arifolius 

(Polygonaceae) 

Netherlands 

France 

4


Table 1. (Continued). 


Netherlands 

Didymella lycopersici, anam. Boeremia 

lycopersici 

CBS 378.67 JF740097 GU237950 Lycopersicon esculentum 

(Solanaceae) 

Falcisormispora lignatilis BCC 21118 GU371827 Elaeis guineensis 

(Arecaceae) 

Herpotrichia juniperi CBS 200.31 DQ678080 Juniperus nana 

(Cupressaceae) 

Heterospora chenopodii comb. nov. Phoma heteromorphospora CBS 448.68 FJ427023 EU754088 EU754187 Chenopodium album 


Phoma heteromorphospora CBS 115.96 PD 94/1576 JF740227 EU754188 Chenopodium album 


Heterospora dimorphospora comb. nov. Phoma dimorphospora CBS 345.78 PD 76/1015 JF740203 GU238069 Chenopodium quinoa 


Leptosphaeria conoidea Leptosphaeria conoidea, 

anam. Phoma doliolum 

Phoma dimorphospora CBS 165.78 PD 77/884 JF740204 JF740098 JF740281 Chenopodium quinoa 


Leptosphaeria conoidea, 

anam. Phoma doliolum 

Leptosphaeria doliolum Leptosphaeria doliolum 

subsp. doliolum var. 

doliolum, anam. Phoma 

acuta subsp. acuta 

Leptosphaeria doliolum 

subsp. errabunda, anam. 

Phoma acuta subsp. 

errabunda 

Phoma acuta subsp. acuta 

f.sp. phloxis 

Phoma acuta subsp. acuta 

f.sp. phloxis 









Leptosphaeria errabunda comb. nov. Leptosphaeria doliolum 



errabunda 

CBS 616.75 ATCC 32813, IMI 199777, 

PD 74/56 

JF740201 JF740099 JF740279 Lunaria annua 

(Brassicaceae) 

Thailand 

Switzerland 

Netherlands 

Netherlands 

Peru 

Peru 

Netherlands 

CBS 125977 PD 82/888 JF740202 JF740280 Senecio sp. (Asteraceae) Netherlands 

CBS 505.75 PD 75/141 JF740205 GQ387515 GQ387576 JF740126 JF740144 JF740162 Urtica dioica (Urticaceae) Netherlands 

CBS 541.66 PD 66/221 JF740206 JF740284 JF740127 JF740145 JF740163 Rudbeckia sp. (Asteraceae) Netherlands 

CBS 155.94 PD 77/80 JF740207 JF740282 JF740128 JF740146 JF740164 Phlox paniculata 

(Polemoniaceae) 

CBS 125979 PD 78/37 JF740208 JF740283 JF740129 JF740147 JF740165 Phlox paniculata 


Netherlands 

Netherlands 

CBS 504.75 PD 74/55 JF740209 JF740130 JF740148 JF740166 Urtica dioica (Urticaceae) Netherlands 

CBS 130000 PD 82/701 JF740210 JF740131 JF740149 JF740167 Urtica dioica (Urticaceae) Netherlands 

CBS 617.75 ATCC 32814, IMI 199775, 

PD 74/201 

JF740216 JF740289 JF740132 JF740150 JF740168 Solidago sp. (hybrid) 

(Asteraceae) 

Netherlands 


5




Netherlands 




errabunda 




errabunda 




errabunda 




errabunda 

CBS 125978 PD 74/61 JF740217 JF740290 JF740133 JF740151 JF740169 Delphinium sp. 

(Ranunculaceae) 

CBS 129999 PD 78/569 JF740218 JF740134 JF740152 JF740170 Aconitum sp. 


Netherlands 

CBS 129998 PD 84/462 JF740219 JF740135 JF740153 JF740171 Gailardia (Asteraceae) Netherlands 

CBS 129997 PD 78/631 JF740220 JF740136 JF740154 JF740172 Achillea millefolium 

(Apiaceae) 

Leptosphaeria etheridgei comb. nov. Phoma etheridgei CBS 125980 DAOM 216539, PD 95/1483 JF740221 JF740291 Populus tremuloides 

(Salicaceae) 

Leptosphaeria macrocapsa comb. nov. Phoma macrocapsa CBS 640.93 PD 78/139 JF740237 JF740304 JF740138 JF740156 JF740174 Mercurialis perennis 

(Euphorbiaceae) 

Leptosphaeria pedicularis comb. nov. Phoma pedicularis CBS 126582 PD 77/710 JF740223 JF740293 Gentiana punctata 

(Gentianaceae) 

Phoma pedicularis CBS 390.80 PD 77/711 JF740224 JF740294 JF740137 JF740155 JF740173 Pedicularis sp. 

(Scrophulariaceae) 

Netherlands 

Canada 

Netherlands 

Switzerland 

Switzerland 

Leptosphaeria rubefaciens comb. nov. Phoma rubefaciens CBS 387.80 IMI 248432, ATCC 42533, 

PD 78/809 

JF740242 JF740311 Tilia (x) europea 

(Malvaceae) 

Netherlands 

Phoma rubefaciens CBS 223.77 JF740243 JF740312 Quercus sp. (Fagaceae) Switzerland 

Leptosphaeria sclerotioides comb. nov. Phoma sclerotioides CBS 144.84 CECT 20025, PD 82/1061 JF740192 JF740269 Medicago sativa 

(Fabaceae) 

Leptosphaeria slovacica Leptosphaeria slovacica, 

anam. Phoma leonuri 

Phoma sclerotioides CBS 148.84 PD 80/1242 JF740193 JF740270 Medicago sativa 

(Fabaceae) 

Leptosphaeria slovacica, 

anam. Phoma leonuri 

CBS 389.80 PD 79/171 JF740247 JF740101 JF740315 Balota nigra (Lamiaceae) Netherlands 

CBS 125975 PD 77/1161 JF740248 JF740316 Balota nigra (Lamiaceae) Netherlands 

Leptosphaeria sydowii comb. nov. Phoma sydowii CBS 385.80 PD 74/477 JF740244 JF740313 JF740139 JF740157 JF740175 Senecio jacobaea 

(Asteraceae) 

Canada 

Canada 

UK 

Phoma sydowii CBS 125976 PD 84/472 JF740245 JF740314 JF740140 JF740158 JF740176 Senecio jacobaea 

(Asteraceae) 

Netherlands 

6




Phoma sydowii CBS 297.51 JF740246 JF740141 JF740159 JF740177 Papaver rhoeas 

Switzerland 

(Papaveraceae) 

Leptosphaeria veronicae comb. nov. Phoma veronicicola CBS 145.84 CECT 20059, PD 78/273 JF740254 JF740320 JF740142 JF740160 JF740178 Veronica chamaedryoides Netherlands 


Phoma veronicicola CBS 126583 PD 74/227 JF740255 JF740321 JF740143 JF740161 JF740179 Veronica ‘Shirley Blue’ Netherlands 


Massarina eburnea H 3953, HHUF 26621, JCM 

AB521718 AB521735 Fagus sylvatica (Fagaceae) UK 

14422 

Massarina eburnea CBS 473.64 ETH 2945 GU296170 GU301840 Fagus sylvatica (Fagaceae) Switzerland 

Medicopsis romeroi comb. nov. Pyrenochaeta romeroi CBS 252.60 ATCC 13735, FMC 151, 

UAMH 10841 

EU754108 EU754207 Human, maduromycosis Venezuela 

Pyrenochaeta romeroi CBS 122784 PD 84/1022 EU754208 Hordeum vulgare 

(Gramineae) 

Melanomma pulvis-pyrius CBS 371.75 GU301845 Wood France 

Unknown 

CBS 400.97 DQ678020 DQ678072 Fagus sp. (Fagaceae) Belgium 

Neophaeosphaeria filamentosa CBS 102202 BPI 802755 JF740259 GQ387516 GQ387577 Yucca rostrata (Agavaceae) Mexico 

Neosetophoma samarorum CBS 138.96 PD 82/653 GQ387517 GQ387578 Phlox paniculata 


Neottiosporina paspali CBS 331.37 EU754073 EU754172 Paspalum notatum 

(Poaceae) 

Nigrogana mackinnonii comb. nov. Pyrenochaeta mackinnonii CBS 674.75 FMC 270 

GQ387613 Human, black grain 

Venezuela 

GQ387552 

mycetoma 

Pyrenochaeta mackinnonii CBS 110022 GQ387614 Human, mycetoma Mexico 

Netherlands 

USA 

Paraconiothyrium flavescens comb. nov. Phoma flavescens CBS 178.93 PD 82/1062 GU238075 Soil Netherlands 

Paraconiothyrium fuckelii comb. nov. Coniothyrium fuckelii CBS 797.95 GU238204 GU237960 Rubus sp. (Rosaceae) Denmark 

Paraconiothyrium fusco-maculans comb. 

nov. 

Plenodomus fuscomaculans 

CBS 116.16 EU754197 Malus sp. (Rosaceae) USA 

Paraconiothyrium lini comb. nov. Phoma lini CBS 253.92 PD 70/998 EU238093 Wisconsin tank Netherlands 

Paraconiothyrium maculicutis sp. nov. Pleurophoma pleurospora CBS 101461 IMI 320754, UTHSC 87-144 EU754200 Human, cutaneous lesions USA 

Paraconiothyrium minitans CBS 122788 PD 07/03486739 EU754074 EU754173 Unknown UK 

CBS 122786 PD 99/1064-1 EU754174 Clematis sp. 


Netherlands 

Paraconiothyrium tiliae comb. nov. Asteromella tiliae CBS 265.94 EU754139 Tilia platyphyllos (Tiliaceae) Austria 

Paraleptosphaeria dryadis comb. nov. Leptosphaeria dryadis CBS 643.86 JF740213 GU301828 Dryas octopetala 

(Rosaceae) 

Switzerland 


7




Norway 

Paraleptosphaeria macrospora comb. 

nov. 

Phoma macrospora CBS 114198 UPSC 2686 JF740238 JF740305 Rumex domesticus 


Paraleptosphaeria nitschkei comb. nov. Leptosphaeria nitschkei CBS 306.51 JF740239 JF740308 Cirsium spinosissimum 

(Asteraceae) 

Paraleptosphaeria orobanches comb. 

nov. 

Paraleptosphaeria praetermissa comb. 

nov. 

Phoma korfii CBS 101638 PD 97/12070 JF400230 JF740299 Epifagus virginiana 

(Orobanchaceae) 

Leptosphaeria praetermissa CBS 114591 JF740241 JF740310 Rubus idaeus (Rosaceae) Sweden 

Paraphaeosphaeria michoti CBS 652.86 ETH 9483 GQ387520 GQ387581 Typha latifolia (Typhaceae) Switzerland 

Switzerland 

USA 

Paraphoma radicina CBS 111.79 IMI 386094, PD 76/437 EU754092 EU754191 Malus sylvestris 

(Rosaceae) 

Phaeosphaeria nodorum CBS 110109 EU754076 EU754175 Lolium perenne 

(Gramineae) 

Phoma herbarum CBS 615.75 FJ427022 EU754087 EU754186 Rosa multiflora (Rosaceae) Netherlands 

Netherlands 

Denmark 

Phoma paspali CBS 560.81 PD 92/1569 GU238227 G238124 Paspalum dilatum 

(Poaceae) 

Plenodomus agnitus comb. nov. Leptosphaeria agnita, 

anam. Phoma agnita 

Leptosphaeria agnita, 

anam. Phoma agnita 

CBS 121.89 PD 82/903 JF740194 JF740271 Eupatorium cannabinum 

(Asteraceae) 

CBS 126584 PD 82/561 JF740195 JF740272 Eupatorium cannabinum 

(Asteraceae) 

Plenodomus biglobosus comb. nov. Leptosphaeria biglobosa CBS 119951 JF740198 JF740102 JF740274 Brassica rapa 


Plenodomus chrysanthemi comb. nov. Phoma vasinfecta, 

synanam. Phialophora 

chrysanthemi 

CBS 127249 DAOM 229269 JF740199 JF740275 Brassica juncea 


CBS 539.63 JF740253 GU238230 GU238151 Chrysanthemum sp. 

(Asteraceae) 

Plenodomus collinsoniae comb. nov. Leptosphaeria collinsoniae CBS 120227 JCM 13073, MAFF 239583 JF740200 JF740276 Vitis coignetiae (Vitaceae) Japan 

New 

Zealand 

Netherlands 

Netherlands 

Netherlands 

France 

Greece 

Plenodomus confertus comb. nov. Leptosphaeria conferta, 

anam. Phoma conferta 

Plenodomus congestus comb. nov. Leptosphaeria congesta, 

anam. Phoma congesta 

Plenodomus enteroleucus comb. nov. Phoma enteroleuca var. 

enteroleuca 

Phoma enteroleuca var. 

enteroleuca 

CBS 375.64 AF439459 JF740277 Anacyclus radiatus 

(Asteraceae) 

CBS 244.64 AF439460 JF740278 Erigeron canadensis 

(Asteraceae) 

CBS 142.84 PD 81/654, CECT20063 JF740214 JF740287 Catalpa bignonioides 

(Bignoniaceae) 

CBS 831.84 JF740215 JF740288 Triticum aestivum 

(Poaceae) 

Plenodomus fallaciosus comb. nov. Leptosphaeria fallaciosa CBS 414.62 ETH 2961 JF740222 JF740292 Satureia montana 

(Lamiaceae) 

Spain 

Spain 

Netherlands 

Germany 

France 

8




Plenodomus hendersoniae comb. nov. Phoma intricans CBS 113702 UPSC 1843 JF740225 JF740295 Salix cinerea (Salicaceae) Sweden 

Phoma intricans CBS 139.78 JF740226 JF740296 Pyrus malus (Rosaceae) Netherlands 

Plenodomus influorescens comb. nov. Phoma enteroleuca var. 

influorescens 

Phoma enteroleuca var. 

influorescens 

CBS 143.84 PD 78/883, CECT 20064 JF400228 JF740297 Fraxinus excelsior 

(Oleaceae) 

Netherlands 

PD 73/1382 JF400229 JF740298 Lilium sp. (Liliaceae) Netherlands 

Plenodomus libanotidis comb. nov. Leptosphaeria libanotis CBS 113795 UPSC 2219 JF400231 JF740300 Seseli libanotis (Apiaceae) Sweden 

Plenodomus lindquistii comb. nov. Leptosphaeria lindquistii, 

anam. Phoma macdonaldii 

Leptosphaeria lindquistii, 

anam. Phoma macdonaldii 

Plenodomus lingam Leptosphaeria maculans, 

anam. Phoma lingam 

CBS 386.80 PD 77/336 JF400232 JF740301 Helianthus annuus 

(Asteraceae) 

CBS 381.67 JF400233 JF740302 Helianthus annuus 

(Asteraceae) 

CBS 275.63 MUCL 9901, UPSC 1025 JF400234 JF740103 JF740306 Brassica sp. (Brassicaceae) UK 

former 

Yugoslavia 

Canada 

Leptosphaeria maculans, 


CBS 260.94 PD 78/989 JF400235 JF740307 JF740116 Brassica oleracea 


Netherlands 

Leptosphaeria maculans, 


CBS 147.24 JF740117 Unknown Unknown 

Plenodomus lupini comb. nov. Phoma lupini CBS 248.92 PD 79/141 JF740236 JF740303 Lupinus mutabilis 

(Fabaceae) 

Plenodomus pimpinellae comb. nov. Leptosphaeria pimpinellae, 

anam. Phoma pimpinellae 

CBS 101637 PD 92/41 JF740240 JF740309 Pimpinella anisum 

(Apiaceae) 

Plenodomus tracheiphilus comb. nov. Phoma tracheiphila CBS 551.93 PD 81/782 JF740249 JF740104 JF740317 Citrus limonium (Rutaceae) Israel 

Peru 

Israel 

Phoma tracheiphila CBS 127250 PD 09/04597141 JF740250 JF740318 Citrus sp. (Rutaceae) Italy 

Plenodomus visci comb. nov. Plectophomella visci CBS 122783 PD 74/1021 JF740256 EU754096 EU754195 Viscum album (Viscaceae) France 

Plenodomus wasabiae Phoma wasabiae CBS 120119 FAU 559 JF740257 JF740323 Wasabia japonica 


Phoma wasabiae CBS 120120 FAU 561 JF740258 JF740324 Wasabia japonica 


Pleomassaria siparia CBS 279.74 AY004341 Betula verrucosa 

(Betulaceae) 

Pleospora angustis nom. nov. Leptosphaeria clavata CBS 296.51 JF740122 Unknown Switzerland 

Taiwan 

Taiwan 

Netherlands 

Pleospora betae Pleospora betae, anam. 

Phoma betae 

CBS 523.66 PD 66/270, IHEM 3915 EU754080 EU754179 JF740118 Beta vulgaris 


Netherlands 

Pleospora betae, anam. 

Phoma betae 

Pleospora calvescens Pleospora calvescens, 

anam. Ascochyta caulina 

CBS 109410 PD 77/113 EU754178 JF740119 Beta vulgaris 


CBS 246.79 PD 77/655 EU754032 EU754131 JF740120 Atriplex hastata 


Netherlands 

Germany 


9




Netherlands 

Pleospora calvescens, 


CBS 343.78 JF740121 Atriplex hastata 


Pleospora chenopodii Ascochyta hyalospora CBS 206.80 PD 74/1022 JF740095 JF740266 JF740109 Chenopodium quinoa 


Pleospora calvescens, 


CBS 344.78 PD 68/682 JF740110 Atriplex hastata 


Bolivia 

Netherlands 

Pleospora fallens comb. nov. Phoma fallens CBS 161.78 LEV 1131 JF740106 Olea europaea 

(Oleaeceae) 

Phoma glaucispora CBS 284.70 PD 97/2400 JF740107 Nerium oleander 

(Apocynaceae) 

Pleospora flavigena comb. nov. Phoma flavigena CBS 314.80 PD 91/1613 JF740108 Water Romania 

New 

Zealand 

Italy 

Pleospora halimiones nom. nov. Ascochyta obiones CBS 432.77 IMI 282137 JF740096 JF740267 JF740113 Halimione portulacoides 


Ascochyta obiones CBS 786.68 JF740114 Halimione portulacoides 


Pleospora herbarum CBS 191.86 IMI 276975 GU238232 GU238160 JF740123 Medicago sativa 

(Fabaceae) 

Pleospora incompta comb. nov. Phoma incompta CBS 467.76 JF740111 Olea europaea 

(Oleaeceae) 

Pleospora typhicola Pleospora typhicola, anam. 

Phoma typharum 

Phoma incompta CBS 526.82 JF740112 Olea europaea 

(Oleaeceae) 

Pleospora typhicola, anam. 

Phoma typharum 

CBS 132.69 JF740105 JF740325 JF740124 Typha angustifolia 

(Typhaceae) 

Netherlands 

Netherlands 

India 

Greece 

Italy 

Netherlands 

CBS 602.72 JF740125 Typha sp. (Typhaceae) Netherlands 

Pleurophoma pleurospora Pleurophoma sp. CBS 116668 JF740326 Citysus scoparius 

(Fabaceae) 

Pleurophoma sp. CBS 130329 PD 82/371 JF740327 Lonicera sp. 

(Caprifoliaceae) 

Preussia funiculata CBS 659.74 GU296187 GU301864 Soil Senegal 

Netherlands 

Netherlands 

Pseudorobillarda phragmitis CBS 398.61 IMI 070678 EU754203 Phragmitis australis 

(Poaceae) 

Pyrenochaeta cava CBS 257.68 IMI 331911 JF740260 EU754100 EU754199 Wheat field soil Germany 

UK 

Pyrenochaeta lycopersici CBS 267.59 JF740261 GQ387551 GQ387612 Lycopersicon esculentum 

(Solanaceae) 

Pyrenochaeta nobilis CBS 407.76 EU930011 EU754107/ 

DQ898287 

EU754206 Laurus nobilis (Lauraceae) Italy 

Pyrenochaetopsis leptospora CBS 101635 PD 71/1027 JF740262 GQ387566 GQ387627 Secale cereale (Poaceae) Europe 

Netherlands 

10




Pyrenochaetopsis pratorum comb. nov. Phoma pratorum CBS 445.81 PDDCC 7049, PD 80/1254 JF740263 GU238136 Lolium perenne, leaf 

(Poaceae) 

CBS 286.93 PD 80/1252 JF740264 JF740331 Dactylis glomerata 

(Poaceae) 

Pyrenophora tritici-repentis OSC 100066 AY544716 AY544672 (Poaceae) Italy 

New 

Zealand 

New 

Zealand 

Roussoella hysterioides CBS 125434 HH 26988 AB524622 Sasa kurilensis (Poaceae) Japan 

Setomelanomma holmii CBS 110217 GQ387572 GQ387633 Picea pungens (Pinaceae) USA 

Setophoma terrestris CBS 335.29 GQ387526 GQ387587 Allium sativum (Alliaceae) USA 

Splanchnonema platani CBS 221.37 DQ678013 DQ678065 Platanus occidentalis 

(Platanaceae) 

Sporormiella minima CBS 524.50 DQ678003 DQ678056 Dung of goat Panama 

USA 

Stagonosporopsis cucurbitacearum CBS 133.96 GU238234 GU238181 Cucurbita sp. 

(Cucurbitaceae) 

New 

Zealand 

Subplenodomus apiicola comb. nov. Phoma apiicola CBS 285.72 JF740196 GU238040 Apium graveolens var. 

rapaceum (Umbelliferae) 

Subplenodomus drobnjacensis comb. 

nov. 

Phoma apiicola CBS 504.91 PD 78/1073 JF740197 JF740273 Apium graveolens 

(Umbelliferae) 

Phoma drobnjacensis CBS 269.92 PD 88/896 JF740211 JF740100 JF740285 Eustoma exaltatum 

(Gentianaceae) 

Phoma drobnjacensis CBS 270.92 PD 83/650 JF740212 JF740286 Gentiana makinoi ‘Royal 

Blue’ (Gentianaceae) 

Subplenodomus valerianae comb. nov. Phoma valerianae CBS 630.68 PD 68/141 JF740251 GU238150 Valeriana phu 

(Valerianaceae) 

Phoma valerianae CBS 499.91 PD 73/672 JF740252 JF740319 Valeriana officinalis 

(Valerianaceae) 

Subplenodomus violicola comb. nov. Phoma violicola CBS 306.68 FJ427054 GU238231 GU238156 Viola tricolor (Violaceae) Netherlands 

Germany 

Netherlands 

Netherlands 

Netherlands 

Netherlands 

Netherlands 

Phoma violicola CBS 100272 FJ427055 JF740322 Viola tricolor (Violaceae) New 

Zealand 

Thyridaria rubronotata CBS 419.85 GU301875 Acer pseudoplatanus 

(Aceraceae) 

Netherlands 

Trematosphaeria pertusa CBS 122368 FJ201990 Fraxinus excelsior 

(Oleaceae) 

France 

Westerdykella capitulum comb. nov. Phoma capitulum CBS 337.65 PD 91/1614, ATCC 16195, 

HACC 167, IMI 113693 

GU238054 Saline soil India 

Westerdykella minutispora comb. nov. Phoma minutispora CBS 509.91 PD 77/920 GU238108 Saline soil India 

Westerdykella ornata CBS 379.55 GU301880 Mangrove mud Mozambique 


11


CBS 246.79 Pleospora calvescens 

100 

CBS 432.77 Ascochyta obiones 

99 

CBS 206.80 Ascochyta hyalospora 

CBS 523.66 Pleospora betae, anam. Phoma betae 

Pleosporaceae (A) 

100 

100 DAOM 226212 Cocliobolus sativus 

100 CBS 191.86 Pleospora herbarum 

100 

OSC100066 Pyrenophora tritici-repentis 

CBS 132.69 Pleospora typhicola 

100 

64 

CBS 165.78 Phoma dimorphospora 

CBS 448.68 Phoma heteromorphospora 

56 

CBS 269.92 Phoma drobnjacensis 

100 

60 

CBS 275.63 Leptosphaeria maculans, anam. Phoma lingam 

CBS 119951 Leptosphaeria biglobosa 

Leptosphaeriaceae (B) 

57 CBS 551.93 Phoma tracheiphila 

CBS 539.63 Phoma vasinfecta 

CBS 122783 Plectophomella visci 

68 

99 

CBS 363.93 Cucurbitaria berberidis 

CBS 257.68 Pyrenochaeta cava 

CBS 407.76 Pyrenochaeta nobilis 

100 

Cucurbitariaceae (C) 

81 81 CBS 101635 Pyrenochaetopsis leptospora 

CBS 267.59 Pyrenochaeta lycopersici 

54 

89 CBS 389.80 Leptosphaeria slovacica 

100 CBS 505.75 Leptosphaeria doliolum subsp. doliolum Leptosphaeriaceae (D) 

CBS 616.75 Leptosphaeria conoidea 

88 

100 

CBS 216.75 Chaetosphaeronema hispidulum 

CBS 335.29 Setophoma terrestris 

CBS 110109 Phaeosphaeria nodorum 

CBS 138.96 Neosetophoma samarorum 

Phaeosphaeriaceae (E) 

99 80 

CBS 111.79 Paraphoma radicina 

CBS 110217 Setomelanomma holmii 

100 CBS 124455 Phoma glycinicola 

93 CBS 124140 Pyrenochaeta dolichi 

77 CBS 105.91 Phoma carteri 

Clade F 

CBS 101636 Phoma septicidalis 

CBS 400.71 Coniothyrium palmarum 

CBS 102202 Neophaeosphaeria filamentosa 

100 CBS 133.96 Stagonosporopsis bryoniae 

CBS 378.67 Didymella lycopersici 

100 

CBS 183.55 Didymella exigua 

100 

CBS 615.75 Phoma herbarum 

Didymellaceae (G) 

CBS 560.81 Phoma paspali 

100 CBS 122788 Paraconiothyrium minitans 

100 CBS 652.86 Paraphaeosphaeria michotii 

Montagnulaceae 

100 

CBS 797.95 Coniothyrium fuckelii 

97 

CBS 331.37 Neottiosporina paspali 

Massarinaceae 

CBS 252.60 Pyrenochaeta romeroi 

CBS 674.75 Pyrenochaeta mackinnonii 

CBS 524.50 Sporormiella minima 

Sporormiaceae 

100 

0.1 

Fig. 1. The phylogeny of Phoma lingam and Phoma betae, the type species of Phoma sections Plenodomus and Pilosa, based on the strict consensus tree from a Bayesian 

analysis of 48 LSU/SSU sequences. The Bayesian posterior probabilities are given at the nodes. The tree was rooted to Sporormiella minima (CBS 524.50). 

respectively. The tree (Fig. 1) was rooted to Sporormiella minima 

(CBS 524.50). The Bayesian analysis resulted in 6 5442 trees after 

3 272 000 generations, from which the burn-in was discarded and 

the consensus tree and posterior probabilities were calculated 

based on 56 028 trees (Fig. 1). 

The families that belong to Pleosporineae, represented by the 

species grouping in clades A–G, clustered in a strongly supported 

clade (99 % posterior probability). Clade A, representing those 

species classified in Pleosporaceae, was strongly supported 

(100 %) and included two subclades. Pleospora betae (anam. Ph. 

betae), clustered with Pleospora calvescens (anam. Ascochyta 

caulina), A. obiones and A. hyalospora; all recorded as pathogens 

on Chenopodiaceae. The generic type species Pleospora 

herbarum, a plurivorous species, grouped with Cochliobolus 

sativus, Pyrenophora tritici-repentis and Pleospora typhicola 

(anam. Ph. typhina), all recorded from Poaceae. Clade B includes 

Leptosphaeria maculans (anam. Ph. lingam) and clustered with 

Leptosphaeria biglobosa. In clade B also other important plant 

pathogens of Phoma section Plenodomus can be found, such as Ph. 

tracheiphila, Ph. vasinfecta, Ph. drobnjacensis, and Plectophomella 

12


visci. Phoma heteromorphospora, type species of Phoma section 

Heterospora (Boerema et al. 1997) and Ph. dimorphospora also 

grouped in this Leptosphaeria clade, in congruence with previous 

findings (de Gruyter et al. 2009, Aveskamp et al. 2010). 

Leptosphaeria doliolum (anam. Ph. acuta), type species of 

the genus Leptosphaeria, is found in Clade D, clustering with 

L. conoidea and L. slovacica. Leptosphaeria doliolum and its 

relatives comprise a sister clade C with species classified in 

Cucurbitariaceae, including Cucurbitaria berberidis, the three 

Pyrenochaeta species, Py. cava, Py. lycopersici and Py. nobilis, 

and Pyrenochaetopsis leptospora. 

Phaeosphaeria nodorum and its relatives Neosetophoma 

samarorum, Setophoma terrestris, Chaetosphaeronema 

hispidulum, Paraphoma radicina and Setomelanomma holmii, 

represent Phaeosphaeriaceae in clade E as has previously been 

found (de Gruyter et al. 2009, 2010). 

A distinct clade F includes Ph. glycinicola, Ph. carteri, Ph. 

septicidalis, and the taxonomic confusing species Pyrenochaeta 

dolichi (Grondona et al. 1997). The position of Coniothyrium 

palmarum and Neophaeosphaeria filamentosa could not be 

clarified, but both species are also treated below in a phylogeny 

including close relatives based on ITS and LSU regions (Fig. 

2). Didymella exigua, type species of the genus Didymella, and 

Ph. herbarum represent Didymellaceae, and clustered in a wellsupported 

clade (G) in congruence with previous studies (de Gruyter 

et al. 2009, 2010, Aveskamp et al. 2010). The molecular phylogeny 

of species which group in this analysis outside of Pleosporineae in 

Montagnulaceae, Massarinaceae and Sporormiaceae were further 

analysed utilising LSU sequence data of a broader range of taxa 

(Fig. 5). 

Phoma section Plenodomus and close allies 

The aligned sequence matrix obtained for the LSU and ITS regions 

had a total length of 1 921 nucleotide characters, 1 332 and 589 

respectively. The combined dataset used in the analyses included 

87 taxa and contained 1921 characters with 298 and 118 unique site 

patterns for LSU and ITS respectively. The tree (Fig. 2) was rooted 

to Ph. herbarum (CBS 615.75), the representative isolate of the type 

species of Phoma (Boerema et al. 2004). The Bayesian analysis 

resulted in 100 002 trees after 5 000 000 generations, from which 

the burn-in was discarded and the consensus tree and posterior 

probabilities were calculated based on 90 930 trees (Fig. 2). 

The species currently classified in Leptosphaeria and Phoma 

section Plenodomus grouped in clades A and B representing 

Leptosphaeriaceae, including the type species Ph. lingam and 

Leptosphaeria doliolum, respectively. Isolates of the taxa that 

represent Cucurbitariaceae, Cucurbitaria berberidis and its related 

species Pyrenochaeta cava, Py. nobilis, Py. lycopersici and 

Pyrenochaetopsis leptospora, clustered in a distinct clade D only 

distantly related to Leptosphaeriaceae. This finding agrees with a 

recent study (de Gruyter et al. 2010). Phoma pratorum clustered 

with Pyrenochaetopsis leptospora. 

Leptosphaeria biglobosa grouped in a subclade A1 with Ph. 

wasabiae, the cause of black rot disease on Wasabia japonica 

(Brassicaceae) and Ph. pimpinellae, a necrotroph on Pimpinella 

anisum (Apiaceae). Leptosphaeria maculans, considered as 

closely related to the L. biglobosa complex, proved to be more 

distantly related in clade A1. In this subclade, other important 

pathogens can be found, such as Ph. tracheiphila, a quarantine 

organism on Citrus spp. (Rutaceae), Ph. vasinfecta, a pathogen 

on Chrysanthemum spp. (Asteraceae), L. lindquistii (anam. 

Ph. macdonaldii), a worldwide pathogen on Helianthus annuus 

(Asteraceae) and Ph. lupini, a seed borne pathogen known from 

Lupinus spp. (Fabaceae). Subclade A1 also comprises both 

varieties of Ph. enteroleuca, opportunistic pathogens on deciduous 

trees and shrubs, and the necrotrophic species L. agnita (anam. Ph. 

agnita), Ph. congesta (both recorded on Asteraceae), Ph. conferta 

(mainly on Brassicaceae), L. hendersoniae (on Salicaceae), L. 

fallaciosa, L. collinsoniae (mainly on Lamiaceae) and L. libanotis (on 

Apiaceae). Plectophomella visci, recorded from leaves of Viscum 

album (Viscaceae), also clustered in the Leptosphaeriaceae. The 

genus Plenodomus is re-introduced here to accommodate the 

species in subclade A1, which are allied to Ph. lingam. 

Subclade A2 comprises pathogenic species often causing leaf 

spots such as Ph. apiicola on Apium graveolens (Apiaceae), Ph. 

drobnjacensis (on Gentianaceae), Ph. violicola (on Violaceae) as 

well as the necrotrophic species Ph. valerianae, on Valeriana spp. 

(Valerianaceae). Phoma apiicola and Ph. valerianae were classified 

in Phoma section Phoma, and Ph. violicola was classified in Phoma 

sect. Peyronellaea; however, the relationship of these species in 

Leptosphaeriaceae is clearly demonstrated (Fig. 2), and therefore 

the species are transferred to the new genus Subplenodomus. 

These results are in congruence with a recent study where Ph. 

violicola, Ph. apiicola and Ph. valerianae clustered in a clade 

representing both Leptosphaeriaceae and Pleosporaceae 

(Aveskamp et al. 2010). 

Four Leptosphaeria species, L. macrospora (soil) and 

the necrotrophic species L. nitschkei (on Asteraceae), L. 

praetermissa, on Rubus idaeus (Rosaceae) and L. dryadis, 

on Dryas spp. (Rosaceae) grouped in a subclade A3 and are 

transferred here to a new genus Paraleptosphaeria. Phoma 

korfii also clustered in this subclade. The European species Ph. 

heteromorphospora, type species of Phoma section Heterospora, 

and the American counterpart Ph. dimorphospora, both pathogens 

on Chenopodiaceae, grouped in a distinct subclade A4. Phoma 

sect. Heterospora is raised to generic rank to accommodate both 

species in Leptosphaeriaceae. 

Clade B comprises necrotrophic species related to the type 

species L. doliolum (anam. Ph. acuta). The phylogeny of this 

species complex, and the closely related species Ph. veronicicola, 

Ph. macrocapsa and Ph. sydowii, is treated below. The necrotrophic 

species Ph. sclerotioides, L. conoidea (anam. Ph. doliolum), L. 

slovacica (anam. Ph. leonuri) and Ph. pedicularis also proved to 

be related. The species Ph. rubefaciens and Ph. etheridgei also 

belong to clade B, but these species, both recorded on trees, are 

more distantly related. 

The Phoma species in clades A and B are in majority currently 

described as anamorphs of the genus Leptosphaeria, or belong to 

Phoma section Plenodomus. These Phoma anamorphs are only 

distantly related to the type species Ph. herbarum and its relatives 

in Didymellaceae, and therefore these species described in section 

Plenodomus are excluded from the genus Phoma. Clade C is more 

distantly related to Leptosphaeriaceae and comprises species that 

are related to Coniothyrium palmarum in Coniothyriaceae. Two 

subclades are recognised in clade C: Ph. glycinicola, Py. dolichi 

and Ph. carteri group with the generic type species C. palmarum, 

whereas two isolates of Ph. septicidalis group with Ph. multipora. The 

teleomorph Neophaeosphaeria filamentosa clustered basal to this 

clade. Clade D includes the genera Cucurbitaria, Pyrenochaetopsis 

and Pyrenochaeta, which represent Cucurbitariaceae. This finding 

is in congruence with previous studies (de Gruyter et al. 2010). 


13

Fig 2 


A1 

A2 

A3 

A4 

53 

70 

51 

0.1 

100 CBS 121.89 Plenodomus agnitus comb. nov. Leptosphaeria agnita 

100 CBS 126584 Plenodomus agnitus comb. nov. Leptosphaeria agnita 

100 

CBS 414.62 Plenodomus fallaciosus comb. nov. Leptosphaeria fallaciosa 

99 

CBS 248.92 Plenodomus lupini comb. nov. Phoma lupini 

CBS 122783 Plenodomus visci comb. nov. Plectophomella visci 

83 

100 CBS 143.84 Plenodomus influorescens comb. nov. Phoma enteroleuca var. influorescens 

100 PD73.1382 Plenodomus influorescens comb. nov. Phoma enteroleuca var. influorescens 

100 CBS 381.67 Plenodomus lindquistii comb. nov. Leptosphaeria lindquistii 

CBS 386.80 Plenodomus lindquistii comb. nov. Leptosphaeria lindquistii 

CBS 120227 Plenodomus collinsoniae comb. nov. Leptosphaeria collinsoniae 

100 CBS 119951 Plenodomus biglobosus comb. nov. Leptosphaeria biglobosa 

CBS 127249 Plenodomus biglobosus comb. nov. Leptopshaeria biglobosa 

100 CBS 120119 Plenodomus wasabiae 

94 CBS 120120 Plenodomus wasabiae 

67 

CBS 101637 Plenodomus pimpinellae comb. nov. Leptosphaeria pimpinellae 

100 

CBS 539.63 Plenodomus chrysanthemi comb. nov. Phoma vasinfecta 

CBS 127250 Plenodomus tracheiphilus comb. nov. Phoma tracheiphila 

98 

CBS 551.93 Plenodomus tracheiphilus comb. nov. Phoma tracheiphila 

CBS 244.64 Plenodomus congestus comb. nov.Leptopshaeria congesta 

CBS 113795 Plenodomus libanotidis comb. nov. Leptosphaeria libanotis 

100 

100 CBS 260.94 Plenodomus lingam Leptosphaeria maculans, Phoma lingam 

CBS 275.63 Plenodomus lingam Leptosphaeria maculans, Phoma lingam 

94 

CBS 113702 Plenodomus hendersoniae comb. nov. Leptosphaeria hendersoniae 

CBS 139.78 Plenodomus hendersoniae comb. nov. Leptosphaeria hendersoniae 

CBS 375.64 Plenodomus confertus comb. nov. Leptosphaeria conferta 

100 CBS142.84 Plenodomus enteroleucus comb. nov. Phoma enteroleuca var. enteroleuca 

CBS 831.84 Plenodomus enteroleucus comb. nov. Phoma enteroleuca var. enteroleuca 

100 CBS 285.72 Subplenodomus apiicola comb. nov. Phoma apiicola 

CBS 504.91 Subplenodomus apiicola comb. nov. Phoma apiicola 

100 CBS 499.91 Subplenodomus valerianae comb. nov. Phoma valerianae 

CBS 630.68 Subplenodomus valerianae comb. nov. Phoma valerianae 

CBS 269.92 Subplenodomus drobnjacensis comb. nov. Phoma drobnjacensis 

CBS 270.92 Subplenodomus drobnjacensis comb. nov. Phoma drobnjacensis 

CBS 100272 Subplenodomus violicola comb. nov. Phoma violicola 

CBS 306.68 Subplenodomus violicola comb. nov. Phoma violicola 

CBS 114198 Paraleptosphaeria macrospora comb. nov. Leptosphaeria macrospora 

CBS 306.51 Paraleptosphaeria nitschkei comb. nov. Leptosphaeria nitschkei 

CBS 114591 Paraleptosphaeria praetermissa comb. nov. Leptosphaeria praetermissa 

CBS 643.86 Paraleptosphaeria dryadis comb. nov. Leptosphaeria dryadis 

CBS 101638 Paraleptosphaeria orobanches comb. nov. Phoma korfii 

100 CBS 115.96 Heterospora chenopodii comb. nov. Phoma heteromorphospora 

100 CBS 448.68 Heterospora chenopodii comb. nov. Phoma heteromorphospora 

CBS 165.78 Heterospora dimorphospora comb. nov. Phoma dimorphospora 

100 CBS 345.78 Heterospora dimorphospora comb. nov. Phoma dimorphospora 

91 CBS 145.84 Leptosphaeria veronicae comb. nov. Phoma veronicicola 

CBS 126583 Leptosphaeria veronicae comb. nov. Phoma veronicicola 

98 

CBS 505.75 Leptosphaeria doliolum 

82 CBS 125979 Leptosphaeria doliolum 


100 CBS 155.94 Leptosphaeria doliolum 

CBS 617.75 Leptosphaeria errabunda comb. nov. 

100 

CBS 125978 Leptosphaeria errabunda comb. nov. 

CBS 640.93 Leptosphaeria macrocapsa comb. nov. Phoma macrocapsa 

62 100 

CBS 385.80 Leptosphaeria sydowii comb. nov. Phoma sydowii 

100 CBS 125976 Leptosphaeria sydowii comb. nov. Phoma sydowii 

100 CBS 144.84 Leptosphaeria sclerotioides comb. nov. Phoma sclerotioides 

92 CBS 148.84 Leptosphaeria sclerotioides comb. nov. Phoma sclerotioides 

98 CBS 616.75 Leptosphaeria conoidea 

100 

100 CBS 125977 Leptosphaeria conoidea 

100 CBS 389.80 Leptosphaeria slovacica 

CBS 125975 Leptosphaeria slovacica 

100 CBS 390.80 Leptosphaeria pedicularis comb. nov. Phoma pedicularis 

CBS 126582 Leptosphaeria pedicularis comb. nov. Phoma pedicularis 

100 CBS 223.77 Leptosphaeria rubefaciens comb. nov. Phoma rubefaciens 

CBS 387.80 Leptosphaeria rubefaciens comb. nov. Phoma rubefaciens 

CBS 125980 Leptosphaeria etheridgei comb. nov. Phoma etheridgei 

92 IMI 217261 Coniothyrium dolichi comb. nov. Pyrenochaeta dolichi 

100 IMI 217262 Coniothyrium dolichi comb. nov. Pyrenochaeta dolichi 

IMI294986 Coniothyrium glycines comb. nov. Phoma glycinicola 

100 IMI 124141 Coniothyrium glycines comb. nov. Phoma glycinicola 

100 IMI 101633 Coniothyrium carteri comb. nov. Phoma carteri 

CBS 105.91 Coniothyrium carteri comb. nov. Phoma carteri 

CBS 400.71 Coniothyrium palmarum 

Coniothyriaceae (C) 

97 CBS 188.71 Coniothyrium telephii comb. nov. Phoma septicidalis 

100 CBS 856.97 Coniothyrium telephii comb. nov. Phoma septicidalis 

CBS 101636 Coniothyrium telephii comb. nov. Phoma septicidalis 

100 CBS 353.65 Coniothyrium multiporum comb. nov. Phoma multipora 

CBS 501.91 Coniothyrium multiporum comb. nov. Phoma multipora 

CBS 102202 Neophaeosphaeria filamentosa 

CBS 267.59 Pyrenochaeta lycopersici 

100 CBS 286.93 Pyrenochaetopsis pratorum comb. nov. 

100 

CBS 445.81 Pyrenochaetopsis pratorum comb. nov. 

CBS 101635 Pyrenochaetopsis leptospora 

CBS 257.68 Pyrenochaeta cava 

Cucurbitariaceae (D) 

CBS 363.93 Cucurbitaria berberidis 

CBS 407.76 Pyrenochaeta nobilis 

CBS 615.75 Phoma herbarum 

Didymellaceae (E) 

56 

61 

66 

71 

100 

77 

90 

91 

100 

100 

100 

99 

100 

87 

100 

64 

64 

99 

96 

Fig. 2. The phylogeny of Phoma section Plenodomus and Leptosphaeria, based on the strict consensus tree from a Bayesian analysis of 87 LSU/ITS sequences. The Bayesian 

posterior probabilities are given at the nodes. The tree was rooted to Phoma herbarum (CBS 615.75). 

Leptosphaeriaceae (A) 

Leptosphaeriaceae (B) 

14


Phylogeny of the Leptosphaeria doliolum complex 

The aligned sequence matrix obtained for the ITS, ACT, TUB and 

CHS-1 regions had a total length of 1 345 nucleotide characters; 

ITS 522, ACT 240, TUB 332 and CHS-1 251, respectively. The 

combined dataset used in the analyses included 18 taxa and 

contained 1 345 characters with 98 unique site patterns. The 

tree (Fig. 3) was rooted to “Ph. pedicularis” (CBS 390.80). The 

Bayesian analysis resulted in 6 002 trees after 30 000 generations, 

from which the burn-in was discarded and the consensus tree and 

posterior probabilities were calculated based on 3 341 trees. 

The phylogenetic tree revealed two clades with high posterior 

probabilities, 98 and 99 % respectively, clade A with Ph. acuta 

subsp. errabunda and Ph. macrocapsa, and clade B with Ph. 

acuta subsp. acuta (anamorph of Leptosphaeria doliolum) and Ph. 

acuta subsp. acuta f. sp. phlogis. Phoma sydowii, a necrotroph on 

Asteraceae, Senecio spp. in particular, proved to be closely related 

to Ph. acuta subsp. errabunda. The isolate CBS 297.51 preserved 

as Ph. acuta is similar to Ph. sydowii, a synonym of L. sydowii, see 

below. Phoma veronicicola, as a necrotroph specifically occurring 

on Veronica spp. (Scrophulariaceae), also proved to be related to 

Leptosphaeria doliolum. 

Phylogeny of Phoma section Pilosa 

The aligned sequence matrix obtained for the ACT region had a 

total length of 252 nucleotide characters (20 taxa), and contained 

165 unique sites. The tree was rooted to Ph. lingam (CBS 147.24 

and CBS 260.94). The Bayesian analysis resulted in 34 802 trees 

after 174 000 generations, from which the burn-in was discarded, 

and the consensus tree and posterior probabilities were calculated 

based on 11 728 trees (Fig. 4). 

The phylogenetic tree representing the Pleosporaceae includes 

Ph. betae, type species of Phoma section Pilosa. This section is 

characterised by producing pycnidia that are covered by mycelial 

hairs. Phoma betae clearly groups with other pycnidial fungi 

pathogenic on Chenopodiaceae, including Ascochyta obiones, 

A. hyalospora and A. caulina and Chaetodiplodia sp. All species 

produce similar hairy pycnidia, but are classified in Ascochyta or 

Coniothyrium due to conidial septation, or brown pigmentation of 

conidia, respectively. 

A subclade comprises the cosmopolitan Pleospora herbarum 

and related species. The species involved are associated with 

various hosts or substrates. The most closely related Ph. incompta is 

a specific pathogen on Olea europea (Oleaceae). Phoma incompta 

was classified in Phoma section Sclerophomella because of its 

thick-walled pycnidia (de Gruyter & Noordeloos 1992, Boerema 

& de Gruyter 1998). The pycnidial characters of Ph. incompta, 

pycnidia covered with mycelial hairs and with an indistinct ostiole 

visible as a pallid spot (de Gruyter & Noordeloos 1992) however, 

agrees with those of Ph. betae and Ph. typhina. 

Phoma fallens proved to be closely related to Ph. glaucispora in 

keeping with the similar in vitro characters, especially the low growthrate 

and the size and shape of its conidia (Boerema et al. 2004). Both 

species originate from southern Europe, and have been associated 

with spots on fruits and leaves of Olea europea, or leaf spots on 

Nerium oleander, respectively. An isolate preserved as Leptosphaeria 

clavata, CBS 259.51, proved to be closely related. The origin of the 

isolate, deposited by E. Müller, is unknown; however, it is likely that 

the isolate was obtained from Poaceae, Triticum vulgare or Dactylis 

glomerata (Müller 1950). Phoma flavigena, once isolated from water 

and also recorded from southern Europe, proved to be more distantly 

related in Pleosporaceae. 

Phylogeny of phoma-like anamorphs excluded from 

the suborder Pleosporineae 

The aligned sequence matrix obtained for the LSU regions had 

a total length of 808 nucleotide characters, with 208 unique 

site patterns. The phylogenetic tree (Fig. 5) was rooted to 

Pseudorobillarda phragmitis (CBS 398.61). The Bayesian analysis 

resulted in 48 402 trees after 242 000 generations, from which 

the burn-in was discarded and the consensus tree and posterior 

probabilities were calculated based on 24 876 trees. 

Clade A includes the reference isolates of the teleomorph 

Paraphaeosphaeria and the anamorph Paraconiothyrium classified 

in Montagnulaceae. This teleomorph/anamorph relation agrees 

with previous molecular phylogenetic studies (Verkley et al. 2004, 

Damm et al. 2008, de Gruyter et al. 2009). Other phoma-like 

species in this clade are Ph. lini, Plenodomus fusco-maculans, 

Pleurophoma pleurospora (CBS 101461) and Asteromella tilliae. 

Phoma lini, a saprobe frequently recorded on dead stems of 

Linum spp., was described in Phoma section Phoma (de Gruyter 

et al. 1993). Re-examination of the conidia revealed that they are 

hyaline and thin-walled; however, also darker, greenish to yellowish 

coniothyrium-like conidia were observed. The conidiogenous cells 

are phoma-like, doliiform to ampulliform. 

The isolate Asteromella tiliae (CBS 265.94) clearly represents a 

species of Paraconiothyrium, and therefore, the teleomorph name 

Didymosphaeria petrakiana, Didymosphaeriaceae, is probably 

incorrect. It was already mentioned by Butin & Kehr (1995) that 

“considering the taxonomical placement of the teleomorph, the 

authors were informed about forthcoming taxonomic changes”. 

The morphological characters of the isolate CBS 101461, 

considered as representing the generic type species Pleurophoma 

pleurospora, resembles Paraconiothyrium as was previously 

discussed (de Gruyter et al. 2009). The sterile ex-type strain of 

Plenodomus fusco-maculans, CBS 116.16, recorded from Malus 

sp., also grouped with the Paraconiothyrium isolates. 

Coniothyrium fuckelii clustered in the Paraphaeosphaeria/ 

Paraconiothyrium clade, in agreement with previous studies (Damm 

et al. 2008, Aveskamp et al. 2010), and therefore, the species is 

transferred to the genus Paraconiothyrium. Two phoma-like species 

obtained from Citysus scoparius and Lonicera sp. respectively 

(CBS 116668 and CBS 130329), cluster near Montagnulaceae 

and Massarinaceae. The morphological characters of the species 

are typical for Pleurophoma pleurospora. The taxonomic position 

of both isolates at familial rank could not be determined. The 

morphology of Phoma flavescens proved to be most similar to that 

of Paraconiothyrium, it definitely does not belong to Phoma, and 

therefore the species is transferred to Paraconiothyrium. Sequence 

data of additional species clustering nearby are required to resolve 

the current classification of Ph. flavescens. None of the phomalike 

anamorphs included in this study grouped in clade B, which 

represents Massarinaceae. 

Clade C includes the recently assigned ex-epitype strain 

of Trematosphaeria pertusa, isolate CBS 122368 (Zhang et 

al. 2008) and Falcisformispora lignatilis. Both T. perusa and F. 

lignatilis represent Trematosphaeriaceae (Suetrong et al. 2009). 

A second isolate preserved as Trematosphaeria pertusa, CBS 

400.97, proved to be only distantly related, and clustered in clade 

D with Aposphaeria populina and Melanomma pulvis-pyrius in 


15


Fig 3 

CBS 617.75 Leptosphaeria errabunda comb. nov. 


99 




Clade A 

98 

CBS 640.93 Leptosphaeria macrocapsa comb. nov. 

99 

83 

CBS 297.51 Leptosphaeria sydowii comb. nov. 

CBS 125976 Leptosphaeria sydowii comb. nov. 

52 

92 

99 

CBS 385.80 Leptosphaeria sydowii comb. nov. 


CBS 130000 Leptosphaeria doliolum 

99 

97 

CBS 125979 Leptosphaeria doliolum ‘Phoma acuta subsp. acuta f. sp. phlogis’ 

CBS 155.94 Leptosphaeria doliolum ‘Phoma acuta subsp. acuta f. sp. phlogis’ 


Clade B 


99 

CBS 145.84 Leptosphaeria veronicae comb. nov. 

CBS 126583 Leptosphaeria veronicae comb. nov. 

Fig 4 

0.1 

CBS 390.80 Leptosphaeria pedicularis comb. nov. ‘Phoma pedicularis’ 

Fig. 3. The phylogeny of the Leptosphaeria doliolum complex, based on the strict consensus tree from a Bayesian analysis of 18 ITS/ACT/TUB/CHS-1 sequences. The Bayesian 

posterior probabilities are given at the nodes. The tree was rooted to Leptosphaeria pedicularis comb. nov. (CBS 390.80). 

99 CBS 109410 Pleospora betae 

CBS 523.66 Pleospora betae 

70 CBS 786.68 Pleospora halimiones nom. nov. ‘Ascochyta obiones’ 

CBS 432.77 Pleospora halimiones nom. nov. ‘Ascochyta obiones’ 

99 

100 

CBS 206.80 Pleospora chenopodii ‘Ascochyta hyalospora’ 

CBS 344.78 Pleospora chenopodii ‘Ascochyta hyalospora’ 

52 

CBS 246.79 Pleospora calvescens ‘Ascochyta caulina’ 

CBS 343.78 Pleospora calvescens ‘Ascochyta caulina’ 

CBS 453.68 Chaetodiplodia sp. 

75 99 CBS 467.76 Pleospora incompta comb. nov. ‘Phoma incompta’ 

69 

52 

CBS 526.82 Pleospora incompta comb. nov. ‘Phoma incompta’ 

CBS 191.86 Pleospora herbarum 

100 88 

100 CBS 132.69 Pleospora typhicola ‘Phoma typhina’ 

CBS 602.72 Pleospora typhicola ‘Phoma typhina’ 

100 CBS 161.78 Pleospora fallens comb. nov. ‘Phoma fallens’ 

CBS 284.70 Pleospora fallens comb. nov. ‘Phoma glaucispora’ 

79 

CBS 296.51 Pleospora angustis nom. nov. 

CBS 314.80 Pleospora flavigena comb. nov. ‘Phoma flavigena’ 

CBS 260.94 Plenodomus lingam ‘Leptosphaeria maculans’, Phoma lingam’ 

CBS 147.24 Plenodomus lingam ‘Leptosphaeria maculans’, Phoma lingam’ 

0.1 

Fig. 4. The phylogeny of phoma-like anamorphs in the Pleosporaceae based on the strict consensus tree from a Bayesian analysis of 20 ACT sequences. The Bayesian 

posterior probabilities are given at the nodes. The tree was rooted to Plenodomus lingam (CBS 147.24, CBS 260.94). 

16

Fig 5 


57 

97 

82 

CBS 101461 Paraconiothyrium maculicutis sp. nov. ‘Pleurophoma pleurospora’ 

CBS 265.94 Paraconiothyrium tiliae comb. nov. ‘Asteromella tiliae’ 

CBS 797.95 Paraconiothyrium fuckelii comb. nov. ‘Coniothyrium fuckelii’ 

99 

97 

94 

CBS 116.16 Paraconiothyrium fusco-maculans comb. nov. ‘Plenodomus fusco-maculans’ 

Montagnulaceae (A) 

CBS 253.92 Paraconiothyrium lini comb. nov. ‘Phoma.lini’ 

CBS 122788 Paraconiothyrium minitans 

CBS 122786 Paraconiothyrium minitans 

CBS 652.86 Paraphaeosphaeria michotii 

55 94 

99 

CBS 473.64 Massarina eburnea 

H 3953 Massarina eburnea 

CBS 331.37 Neottiosporina paspali 

CBS 675.92 Byssothecium circinans 

Massarinaceae (B) 

83 

62 

91 

99 

99 

100 

CBS 116668 Pleurophoma pleurospora 

PD 82.371 Pleurophoma pleurospora 

CBS 178.93 Paraconiothyrium flavescens comb. nov. ‘Phoma flavescens’ 

CBS 252.60 Medicopsis romeroi comb. nov. ‘Pyrenochaeta romeroi’ 

CBS 122784 Medicopsis romeroi comb. nov. ‘Pyrenochaeta romeroi’ 

Trematosphaeriaceae (C) 

BCC 21118 Falcisormispora lignatilis 

CBS 122368 Trematosphaeria pertusa 

CBS 221.37 Splanchnonema platani 

Lentitheciaceae? 

CBS 419.85 Thyridaria rubronotata 

CBS 350.82 Aposphaeria populina 

99 

PD 84.221 Aposphaeria populina 

98 

CBS 543.70 Aposphaeria populina 

CBS 400.97 Melanomma pulvis-pyrius 

64 

92 

86 

99 

CBS 371.75 Melanomma pulvis-pyrius 

CBS 200.31 Herpotrichia juniperi 

PD 83.367 Aposphaeria corallinolutea sp. nov. 

Melanommataceae (D) 

PD 83.831 Aposphaeria corallinolutea sp. nov. 

CBS 283.53 Beverwykella pulmonaria 

73 

99 

99 

99 

92 

CBS 279.74 Pleomassaria siparia 

CBS 337.65 Westerdykella capitulum comb. nov. ‘Phoma capitulum’ 

CBS 379.55 Westerdykella ornata 

Sporormiaceae (E) 

CBS 509.91 Westerdykella minutispora comb. nov. ‘Phoma minutispora’ 

CBS 524.50 Sporormiella minima 

CBS 659.74 Preussia funiculata 

CBS 125434 Roussoella hysterioides 

Didymosphaeriaceae 

95 

CBS 110022 Nigrograna mackinnonii comb. nov. ‘Pyrenochaeta mackinnonii’ 

CBS 674.75 Nigrograna mackinnonii comb. nov. ‘Pyrenochaeta mackinnonii’ 

CBS 398.61 Pseudorobillarda phragmitis 

0.1 

Fig. 5. LSU The phylogeny of phoma-like isolates excluded from the Pleosporineae, based on the strict consensus tree from a Bayesian analysis of 40 LSU sequences. The 

Bayesian posterior probabilities are given at the nodes. The tree was rooted to Pseudorobillarda phragmitis (CBS 398.61). 


17


Melanommataceae. This isolate is considered as an incorrect 

identification (Mugambi & Huhndorf 2009), and we consider this 

sterile isolate as representative of Melanomma pulvis-pyrius. Clade 

C also comprises the human pathogen Pyrenochaeta romeroi. This 

species certainly does not belong to Pyrenochaeta (de Gruyter et 

al. 2010) and therefore, we describe the new genus Medicopsis in 

Trematosphaeriaceae to accommodate this species. 

A well-supported clade D represents the Melanommataceae 

and includes Melanomma pulvis-pyrius, Herpotrichia juniperi and 

Beverwijkella pulmonaria, in congruence with Zhang et al. (2009). 

There were four phoma-like isolates present in the collections of CBS 

and PD, i.e. CBS 350.82, PD 83/367, PD 83/831 and PD 84/221, 

which could not be identified according to their morphological 

characters. The isolates were preserved as Pleurophoma spp. 

This study demonstrates that two strains represent Aposphaeria 

populina, whereas the other two strains represent the new species 

described here as Aposphaeria corallinolutea. Further studies 

in Melanommataceae are needed to clarify the phylogeny of 

Aposphaeria in Melanommataceae. 

Sporormiaceae (clade E) is represented by Sporormiella 

minima and Preussia funiculata. Phoma capitulum and Ph. 

minutispora, well-defined soil-borne fungi from Asia, group in this 

clade. Both species are related with the anamorph Westerdykella 

ornata, and therefore the species are transferred to Westerdykella 

in Sporormiaceae. 

Pyrenochaeta mackinnonii could not be assigned to familial 

rank. A blast search in GenBank with its LSU sequence suggested 

a relation with Versicolorisporum triseptum. However, the typical 

3-septate conidia of this anamorph are different. Neither could V. 

triseptum be assigned at familial rank in Pleosporales (Tanaka et 

al. 2009). We therefore introduce the new genus Nigrograna to 

accommodate Py. mackinnonii. 

TAXONOMY 

Leptosphaeriaceae M.E. Barr, Mycotaxon 29: 503. 1987. 

Heterospora (Boerema, Gruyter & Noordel.) Gruyter, Verkley 

& Crous, stat. nov. MycoBank MB564701. 

Basionym: Phoma sect. Heterospora Boerema, Gruyter & Noordel., 

Persoonia 16: 336. 1997. 

Type species: Heterospora chenopodii (Westend.) Gruyter, 

Aveskamp & Verkley, see below (= Phoma heteromorphospora Aa 

& Kesteren). 

Heterospora chenopodii (Westend.) Gruyter, Aveskamp & 

Verkley, comb. nov. MycoBank MB564702. 

Basionym: Phyllosticta chenopodii Westend., Bull. Acad. Roy. Sci. 

Belgique Ser. 2, 2: 567. 1857; not Phyllosticta chenopodii Sacc., 

Syll. Fung. 3: 55. 1884 = Phoma exigua Desm. var. exigua; not 

Plenodomus chenopodii (P. Karst. & Har.) Arx, Verh. Kon. Ned. 

Akad. Wetensch., Afd. Natuurk., Sect. 2. 51: 72. 1957 ≡ Phoma 

chenopodiicola Gruyter, Noordel. & Boerema, Persoonia 15: 395. 

1993; not Phoma chenopodii Pavgi & U.P. Singh, Mycopathol. 

Mycol. Appl. 30: 265. 1966. nom. illeg. = Phoma chenopodii S. 

Ahmad, Sydowia 2: 79. 1948. 

≡ Septoria westendorpii G. Winter, Hedwigia 26: 26. 1887. nom. nov.; not 

Phoma westendorpii Tosquinet, Westend., Bull. Acad. Roy. Sci. Belgique 

Ser. 2, 2: 564. 1857. 

≡ Phoma variospora Aa & Kesteren, Persoonia 10: 268. 1979, nom. nov., 

nom. illeg. [not Phoma variospora Shreem., Indian J. Mycol. Pl. Pathol. 8: 

221. 1979 (“1978”)]. 

≡ Phoma heteromorphospora Aa & Kesteren, Persoonia 10: 542. 1980, 

nom. nov. 

Specimens examined: Belgium, Beverloo, from leaves of Chenopodium suecicum 

(album) and Chenopodium urbicum (Chenopodiaceae), no date, G.D. Westendorp, 

Herb. Crypt. (Ed. Beyaert-Feys), No. 959. BR, holotype of Phyllosticta chenopodii 

Westend. ex herb. G.D. Westendorp. Netherlands, Baarn, from leaf spots in 

Chenopodium album, 3 Jul. 1968, H.A. van der Aa, epitype designated here CBS 

H-16386, culture ex-epitype CBS 448.68; Heelsum, from leaf spots in Chenopodium 

album, Sep. 1994, J. de Gruyter, CBS 115.96 = PD 94/1576. 

Notes: Van der Aa & van Kesteren (1979) provided a nom. nov. 

since the epithet “chenopodii” was occupied in Phoma. For more 

details of the taxonomy of the species see van der Aa & van 

Kesteren (1979). Although Leptosphaeria chenopodii-albi was 

described from leaves of Chenopodium album (Crane & Shearer 

1991) no cultures are available for comparison. 

Heterospora dimorphospora (Speg.) Gruyter, Aveskamp & 


Basionym: Phyllosticta dimorphospora Speg., Anales Mus. Nac. 

Buenos Aires 13: 334. 1910. 

≡ Phoma dimorphospora (Speg.) Aa & Kesteren, Persoonia 10: 269. 

1979. 

= Stagonospora chenopodii Peck, Rep. (Annual) New York State Mus. Nat. 

Hist. 40: 60. 1887 (sometimes erroneously listed as Stag. chenopodii “House”). 

Specimens examined: Argentina, La Plata, from leaves of Chenopodium hircinum 

(Chenopodiaceae), 13 Oct. 1906, C. Spegazzini, Colect. micol. Museo Inst. 

Spegazzini, No. 11.353, LPS, holotype of Phyllosticta dimorphospora Speg. 

Lima, from stem of Chenopodium quinoa, 1977, L.J. Turkensteen, CBS 165.78 = 

PD 77/884. Peru, from lesions in stems of Chenopodium quinoa, 1976, V. Otazu, 

epitype designated here CBS H-16203, culture ex-epitype CBS 345.78 = PD 

76/1015. 

Note: For more details of the taxonomy of the species see van der 

Aa & van Kesteren (1979). 

Leptosphaeria Ces. & De Not., Comment. Soc. Crittog. Ital. 

1: 234. 1863. 

= Leptophoma Höhn., Sitzungsber. Kaiserl. Akad. Wiss., Math.-Naturwiss. Cl., 

Abt. 1. 124: 73. 1915. 

Type species: Leptosphaeria doliolum (Pers. : Fr.) Ces. & De Not., 

see below. 

Note: For full synonymy, including the species listed below, see 

Crane & Shearer (1991) and Boerema et al. (2004). 

Leptosphaeria conoidea (De Not.) Sacc., Fungi Venet. Nov. 

Vel. Crit. Ser. 2: 314. 1875. 

Basionym: Leptosphaeria doliolum var. conoidea De Not., Mycoth. 

Veneti, No. 76. 1873. 

= Leptosphaeria doliolum subsp. pinguicula Sacc., Michelia 2: 598. 1882. 

= Phoma acuta subsp. amplior Sacc. & Roum., Rev. Mycol. 6: 30. 1884. 

≡ Phoma hoehnelii subsp. amplior (Sacc. & Roum.) Boerema & Kesteren, 

Trans. Brit. Mycol. Soc. 67: 299. 1976. 

= Phoma doliolum P. Karst., Meddel. Soc. Fauna Fl. Fenn. 16: 9. 1888. 

= Plenodomus microsporus Berl., Bull. Soc. Mycol. France 5: 55. 1889. 

Specimens examined: Netherlands, Zaltbommel, from dead stem of Lunaria annua 

(Brassicaceae), Jan. 1974, G.H. Boerema, CBS 616.75 = ATCC 32813 = IMI 199777 

= PD 74/56; Montfoort, Senecio sp. (Asteraceae), 1982, CBS 125977 = PD 82/888. 

18


Leptosphaeria doliolum (Pers. : Fr.) Ces. & de Not., 

Comment. Soc. Crittog. Ital. 1: 234. 1863. 

Basionym: Sphaeria doliolum Pers. : Fr., Icon. Desc. Fung. Min. 

Cognit. (Leipzig) 2: 39. 1800. 

= Sphaeria acuta Hoffm. : Fr, Veg. cryptog. 1: 22. 1787. Syst. Mycol. 2: 507. 

1823. 

≡ Phoma acuta (Hoffm. : Fr.) Fuckel, Jahrb. Nassauischen Vereins 

Naturk. 23–24: 125. 1870 (as “acutum”). 

≡ Leptophoma acuta (Hoffm. : Fr.) Höhn., Sitzungsber. Kaiserl. Akad. 

Wiss., Math.-Naturwiss. Cl., Abt. 1. 124: 73. 1915. 

≡ Plenodomus acutus (Hoffm. : Fr.) Bubák, Ann. Mycol. 13: 29. 1915 [as 

“(Fuckel)”]. 

= Phoma phlogis Roum., Rev. Mycol. 6: 160. 1884. 

= Phoma hoehnelii var. urticae Boerema & Kesteren, Trans. Brit. Mycol. Soc. 

67: 299. 1976. 

Specimens examined: Netherlands, from stem of Rudbeckia sp. (Asteraceae), 

Sep. 1966, M.M.J. Dorenbosch, CBS 541.66 = PD 66/221; from stem of Urtica 

dioica (Urticaceae), 1974, G.H. Boerema, CBS 504.75 = PD 74/55; Rhenen, from 

Urtica dioica, Feb. 1975, G.H. Boerema, CBS 505.75 = PD 75/141; Wageningen, 

from stem of Phlox paniculata (Polemoniaceae), 1977, G.H. Boerema, CBS 155.94 

= PD 77/80; from stem of Phlox paniculata, 1978, G.H. Boerema, CBS 125979 = PD 

78/37; from stem of Urtica dioica, 1982, G.H. Boerema, CBS 130000 = PD 82/701. 

Notes: Isolate CBS 541.66 was preserved as Phoma acuta subsp. 

errabunda (teleom. Leptosphaeria errabunda, see below); however, 

the isolate clustered with L. doliolum. Both isolates CBS 155.94 

and CBS 125979 were considered as forma specialis “phlogis” 

(Boerema et al. 1994) of the anamorph Ph. acuta subsp. acuta. 

The subspecies acuta was created by the differentiation of Phoma 

acuta subsp amplior Sacc. & Roum., but the latter is a synonym of 

Ph. doliolum, reclassified here as L. conoidea, see above. Sphaeria 

acuta Hoffm. was applied as basionym for different anamorphs an 

a teleomorph of various species of Leptosphaeria leading to a 

confusing nomenclature. The epitet has been unambiguously tied 

to Ph. acuta by Boerema & Gams (1995). 

Leptosphaeria errabunda (Desm.) Gruyter, Aveskamp & 


Basionym: Phoma errabunda Desm., Ann. Sci. Nat., Bot. Ser. 3, 

11: 282. 1849. 

≡ Phoma acuta subsp. errabunda (Desm.) Boerema, Gruyter & Kesteren, 

Persoonia 15: 465. 1994. 

= Leptophoma doliolum Höhn., Sitzungsber. Kaiserl. Akad. Wiss., Math.- 

Naturwiss. Cl., Abt. 1. 124: 75. 1915 [not Phoma doliolum P. Karst. = 

Leptosphaeria conoidea (De Not.) Sacc., see above]. 

≡ Plenodomus doliolum (Höhn.) Höhn., Ber. Deutsch. Bot. Ges. 36: 139. 

1918. 

≡ Phoma hoehnelii Kesteren, Netherlands J. Pl. Pathol. 78: 116. 1972, 

nom. nov. 

= Leptosphaeria doliolum subsp. errabunda Boerema, Gruyter & Kesteren, 

Persoonia 15: 466. 1994. 

Specimens examined: Netherlands, Leeuwarden, from stem of Delphinium sp. 

(Ranunculaceae), 1974, CBS 125978 = PD 74/61; Ferwerderadeel, from Solidago 

sp., hybrid (Asteraceae), Mar. 1974, G.H. Boerema, CBS 617.75 = ATCC 32814 = IMI 

199775 = PD 74/201; from stem of Aconitum sp. (Ranunculaceae), CBS 129999 = PD 

78/569; from stem of Achillea millefolium (Asteraceae), CBS 129997 = PD 78/631; 

from Gailardia sp. (Asteraceae), 1984, G.H. Boerema, CBS 129998 = PD 84/462. 

Notes: The isolate CBS 617.75 = ATTC 32814 was deposited as 

the anamorph Ph. hoehnelii var. hoehnelii, but interpreted as L. 

doliolum subsp. conoidea (Dong et al. 1998). The isolate clustered 

with L. errabunda in this study. 

Leptosphaeria etheridgei (L.J. Hutchison & Y. Hirats.) 

Gruyter, Aveskamp & Verkley, comb. nov. MycoBank 

MB564712. 

Basionym: Phoma etheridgei L.J. Hutchison & Y. Hirats., Canad. J. 

Bot. 72: 1425. 1994. 

Specimen examined: Canada, Alberta, from bark of gall, on trunck of Populus 

tremuloides (Salicaceae), Jul. 1989, P. Crane, holotype DAOM 216539, culture exholotype 

DAOM 216539 = CBS 125980 = PD 95/1483. 

Leptosphaeria macrocapsa (Trail) Gruyter, Aveskamp & 


Basionym: Phoma macrocapsa Trail, Scott. Naturalist (Perth) 8: 

327. 1886. 

≡ Plenodomus macrocapsa (Trail) H. Ruppr., Sydowia 13: 20. 1959. 

Specimen examined: Netherlands, from stem of Mercurialis perennis 

(Euphorbiaceae), 1978, G.H. Boerema, CBS 640.93 = PD 78/139. 

Leptosphaeria pedicularis (Fuckel) Gruyter, Aveskamp & 


Basionym: Phoma pedicularis Fuckel, Reisen Nordpolarmeer 

3: 318. 1874 (as “pedicularidis”); not Phoma pedicularis Wehm., 

Mycologia 38: 319. 1946 (= Phoma herbicola Wehm). 

= Sphaeronaema gentianae Moesz, Bot Közlem. 14: 152. 1915 (as 

“Sphaeronema”). 

≡ Plenodomus gentianae (Moesz) Petr., Ann. Mycol. 23: 54. 1925. 

Specimens examined: Switzerland, Kanton Graubünden, Albulapass, from dead 

stem of Pedicularis sp. (Scrophulariaceae), 1977, CBS 390.80 = PD 77/711 = ATCC 

42535 = IMI 248430; Zürich, from Gentiana punctata (Gentianaceae), 1977, CBS 

126582 = PD 77/710. 

Leptosphaeria rubefaciens (Togliani) Gruyter, Aveskamp & 


Basionym: Phoma rubefaciens Togliani, Ann. Sper. Agr. II, 7: 1626. 

1953. 

Specimens examined: Switzerland, Zürich, Albis, from twig of Quercus sp. 

(Fagaceae), Aug. 1976, W. Gams, CBS 223.77. Netherlands, Oploo, from wood of 

Tilia (×) europaea (Tiliaceae), 1978, G.H. Boerema, CBS 387.80 = ATCC 42533 = 

IMI 248432 = PD 78/809. 

Leptosphaeria sclerotioides (Sacc.) Gruyter, Aveskamp & 


Basionym: Phoma sclerotioides Sacc., Fungi Herb. Bruxelles 21. 

1892; Syll. Fung. 11: 492. 1895. 

= Plenodomus sclerotioides Preuss, Klotzsch. Herb. Vivum Mycol. Sistems 

Fungorum German., No. 1281. 1849, nom. nud. (no description). 

= Plenodomus meliloti Mark.-Let., Bolezni Rast. 16: 195. 1927. 

Specimens examined: Canada, British Columbia, from Medicago sativa 

(Fabaceae), 1980, J. Drew Smith, CBS 148.84 = PD 80/1242; Alberta, from root 

of Medicago sativa, Mar. 1984, G.H. Boerema, CBS 144.84 = CECT 20025 = 

PD 82/1061. 

Note: Seven varieties of this species have been recognised 

(Wunsch et al. 2011) in a phylogenetic analysis using 10 loci. 

Leptosphaeria slovacica Picb., Sborn. Vysoké Skoly. 

Zemed. v Brno 7: 7. 1927. 

= Phoma leonuri Letendre, Revue Mycol. 6: 229. 1884. 

≡ Plenodomus leonuri (Letendre) Moesz & Smarods in Moesz, Magyar 

Bot. Lapok 31: 38. 1932. 

Specimens examined: Netherlands, from dead stem of Ballota nigra (Lamiaceae), 

1977, CBS 125975 = PD 77/1161; Arnhem, from dead stem of Ballota nigra, 1979, 

G.H. Boerema, CBS 389.80 = PD 79/171. 


19


Leptosphaeria sydowii (Boerema, Kesteren & Loer.) 


MB564717. 

Basionym: Phoma sydowii Boerema, Kesteren & Loer., Trans. Brit. 

Mycol. Soc. 77: 71. 1981, nom. nov. 

= Sphaeronaema senecionis Syd. & P. Syd., Ann. Mycol. 3: 185. 1905; not 

Phoma senecionis P. Syd., Beibl. Hedwigia 38: 136. 1899. 

≡ Plenodomus senecionis (Syd. & P. Syd.) Bubák, Ann. Mycol. 13: 29. 

1915. 

≡ Plenodomus senecionis (Syd. & P. Syd.) Petr., Ann. Mycol. 19: 192. 

1921, isonym. 

= Plenodomus rostratus Petr., Ann. Mycol. 21: 199. 1923; not Phoma rostrata 

O’Gara, Mycologia 7: 41. 1915 (not Leptosphaeria rostrata M.L. Far & H.T. 

Horner, Nova Hedwidgia 15: 250. 1968). 

Specimens examined: Switzerland, Kt. Zürich, Zollikon, from Papaver rhoeas 

(Papaveraceae), Oct. 1949, E. Müller, CBS 297.51. Netherlands, from Senecio 

jacobaea (Asteraceae), G.H. Boerema, 1984, CBS 125976 = PD 84/472. UK, 

Scotland, Isle of Lewis, Hebrides, from dead stem of Senecio jacobaea, 1974, 

R.W.G. Dennis, CBS 385.80 = PD 74/477. 

Notes: Leptosphaeria senecionis (Fuckel) G. Winter was suggested 

as the possible teleomorph (Boerema et al. 2004). Because the 

teleomorph connection has not been proven, however, we did not 

include it as a synonym that would have priority as the correct 

name. The isolate CBS 297.51 was originally identified as L. 

doliolum var. doliolum. 

Leptosphaeria veronicae (Hollós) Gruyter, Aveskamp & 


Basionym: Sphaeronaema veronicae Hollós, Ann. Hist.-Nat. Mus. 

Natl. Hung. 4: 341. 1906. 

≡ Phoma veronicicola Boerema & Loer., Trans. Brit. Mycol. Soc. 84: 297. 

1985, nom. nov. (not Phoma veronicae Roum., Revue Mycol. 6: 160. 

1884). 

Specimens examined: Netherlands, from stem of Veronica “Shirley Blue” 

(Scrophulariaceae), 1974, CBS 126583 = PD 74/227; Huis ter Heide, from dead 

stem of Veronica chamaedryoides, Mar. 1978, H.A. van Kesteren, neotype CBS 

H-7632, culture ex-neotype CBS 145.84 = CECT 20059 = PD 78/273. 

Paraleptosphaeria Gruyter, Verkley & Crous, gen. nov. 

MycoBank MB564720. 

Pseudothecia immersed, subglobose, solitary or aggregated, 

thick-walled, pseudoparenchymatous to scleroplectenchymatous, 

ostiolate, unilocular. Asci bitunicate, broadly ellipsoidal, 8-spored, 

interascal filaments pseudoparaphyses, Ascospores biseriate, 

broadly fusiform, transversally 3–5-septate, hyaline to yellowbrownish. 

Conidiomata pycnidial, globose to subglobose, 

scleroplectenchymatous, with papillate pore, unilocular. 

Conidiogenous cells phialidic, ampulliform to doliiform. Conidia 

hyaline, aseptate, oblong to ellipsoidal. Sclerotia sometimes 

produced. 

Type species: Paraleptosphaeria nitschkei (Rehm ex G. Winter) 

Gruyter, Aveskamp & Verkley (see below). 

Notes: Munk (1957) recognised Leptosphaeria section Para- 

Leptosphaeria, an invalid taxon, as a heterogenous group. The 

section was differentiated from Eu-Leptosphaeria, which included 

the generic type species L. doliolum. Leptosphaeria nitschkei was 

considered a typical representative of section Eu-Leptosphaeria 

(Müller & von Arx 1950). However, this molecular phylogeny 

demonstrates that L. nitschkei is only distantly related to L. doliolum. 

We introduce Paraleptosphaeria to accomodate L. nitschkei and its 

relatives. These necrotrophic species are morphologically closely 

allied to Leptosphaeria. The former classification of Leptosphaeria 

in sections Eu-Leptosphaeria and Para-Leptosphaeria cannot be 

upheld from a evolutionary point of view, as two other species 

attributed to section Eu-Leptosphaeria, namely L. agnita and L. 

maculans (Munk 1957), were found to group in Plenodomus. 

Paraleptosphaeria dryadis (Johanson) Gruyter, Aveskamp 

& Verkley, comb. nov. MycoBank MB564721. 

Basionym: Melanomma dryadis Johanson, Hedwigia 29: 160. 

1890. 

≡ Leptosphaeria dryadophila Huhndorf, Bull. Illinois Nat. Hist. Surv. 34: 

484 (1992), nom. illeg. via nom. superfl. 

= Leptosphaeria dryadis Rostr., Bot. Tidsskr. 25: 305. 1903. 

Specimen examined: Switzerland, Kt. Ticino, Leventina, Alpe Campolungo, from 

Dryas octopetala (Rosaceae), 24 July 1980, A. Leuchtmann, CBS 643.86. 

Note: An explanation of the nomenclature of Leptosphaeria dryadis 

has been provided by Chen et al. (2002). 

Paraleptosphaeria macrospora (Thüm.) Gruyter, Aveskamp 


Basionym: Leptosphaeria macrospora Thüm. Mycotheca Univ. 

1359. 1879, nom. nov. 

≡ Metasphaeria macrospora (Fuckel) Sacc., Syll. Fung. 2: 158. 1883. 

Replaced synonym: Pleospora macrospora Fuckel, Jahrb. 

Nassauischen Vereins Naturk. 23–24: 138. 1870, nom. illeg., 

Art. 53.1. [not Pleospora macrospora (De Not.) Ces. & De Not., 

Comment. Soc. Crittog. Ital. 1: 218. 1863]. 

Specimen examined: Norway, Troms, Tromsöya, from Rumex domesticus 

(Polygonaceae), 20 Aug. 1988, K. & L. Holm, CBS 114198 = UPSC 2686. 

Paraleptosphaeria nitschkei (Rehm ex G. Winter) Gruyter, 

Aveskamp & Verkley, comb. nov. MycoBank MB564723. 

Basionym: Leptosphaeria nitschkei Rehm ex G. Winter, 

Ascomyceten, Fascicle 1, No. 15. 1870, nom. nud. (Flora, Jena 

und Regensburg 55: 510. 1872). 

Specimens examined: Austria, Ötscher in Niederösterreich, c. 4500’, from Cacalia 

sp. (= Adenostyles sp, Asteraceae), June 1869, Lojka, holotype of Leptosphaeria 

nitschkei Rehm Ascomyceten 15b, S. Switzerland, Kt. Graubünden, Lü, from 

Cirsium spinosissimum (Asteraceae), 16 July 1948, E. Müller, epitype designated 

here CBS H-20822, culture ex-epitype CBS 306.51. 

Note: The name Leptosphaeria nitschkei was considered a nom. 

nud. by Crane and Shearer (1991) who cited Art. 32.1 but gave no 

further explanation. In Flora, Jena und Regensburg 55: 510. 1872 

Rehm refers to additional notes by G. Winter that include a Latin 

description. Therefore, we consider this name as valid, following 

Müller (1950) who provided a detailed description in vivo. 

Paraleptosphaeria orobanches (Schweinitz : Fr.) Gruyter, 


Basionym: Sclerotium orobanches Schweinitz, Schriften Naturf. 

Ges. Leipzig 1: 57. 1822 : Fr., Syst. Mycol. 2: 257. 1822. 

= Phoma korfii Boerema & Gruyter, Persoonia 17: 275. 1999. 

Specimen examined: USA, Ringwood Swamp, Lloyd-Cornell, from stem of Epifagus 

virginiana (Orobanchaceae), 13 Sep. 1995, T. Uturriaga, R.P. Korf, P. Mullin, 

holotype of Sclerotium orobanches Schweinitz, CUP 63537, culture ex-holotype 

CBS 101638 = PD 97/12070. 

20


Note: A Phoma synanamorph of Sclerotium orobanches was 

reported by Yáňez-Morales et al. (1998) and described as Phoma 

korfii (Boerema & Gruyter 1999). 

Paraleptosphaeria praetermissa (P. Karst.) Gruyter, 


Basionym: Sphaeria praetermissa P. Karst., Bidrag Kannedom 

Finlands Natur Folk 23: 89. 1873. 

≡ Leptosphaeria praetermissa (P. Karst.) Sacc., Syll. Fung. 2: 26. 1883. 

Specimen examined: Sweden, Dalarna, Folkärna, from Rubus idaeus (Rosaceae), 

21 Mar. 1993, K. & L. Holm, CBS 114591. 

Plenodomus Preuss, Linnaea 24: 145. 1851. 

≡ Phoma sect. Plenodomus (Preuss) Boerema, Kesteren & Loer., Trans. 

Brit. Mycol. Soc. 77: 61. 1981. 

= Diploplenodomus Diedicke, Ann. Mycol. 10: 140. 1912. 

= Plectophomella Moesz, Magyar Bot. Lapok 21: 13. 1922. 

= Apocytospora Höhn., Mitt. Bot. Lab. TH Wien 1: 43. 1924. 

= Deuterophoma Petri, Boll. R. Staz. Patalog. Veget. Roma 9: 396. 1929. 

Type species: Plenodomus rabenhorstii Preuss, Linnaea 24: 145. 

1851 (dubious synonym, see below) = Plenodomus lingam (Tode : 

Fr.) Höhn., see below. 

Note: For full synonymy of the anamorph names of the species 

listed below, see Boerema et al. (1994). For additional synonyms 

of the teleomorph names of the species below that have been 

recorded on Asteraceous hosts, see Khashnobish et al. (1995). 

Plenodomus agnitus (Desm.) Gruyter, Aveskamp & Verkley, 

comb. nov. MycoBank MB564726. 

Basionym: Sphaeria agnita Desm., Ann. Sci. Nat., Bot. Ser. 3, 16: 

313. 1851. 

≡ Leptosphaeria agnita (Desm.) Ces. & De Not., Comm. Soc. Crittog. Ital. 

1: 236. 1863. 

= Plenodomus chondrillae Died, Ann. Mycol.. 9: 140. 1911; Krypt.-fl. 

Brandenburg 9: 236. 1912. 

= Phoma agnita Gonz. Frag., Mem. Real Acad. Ci. Barcelona 15: 6. 1920. 

Specimens examined: Netherlands, from stem of Eupatorium cannabinum 

(Asteraceae), 1982, W.M. Loerakker, CBS 126584 = PD 82/561; from stem of 

Eupatorium cannabinum, 1982, W.M. Loerakker, CBS 121.89 = PD 82/903. 

Plenodomus biglobosus (Shoemaker & H. Brun) Gruyter, 


Basionym: Leptosphaeria biglobosa Shoemaker & H. Brun, Canad. 

J. Bot. 79: 413. 2001. 

Specimens examined: France, Le Rheu, from stem of Brassica juncea 

(Brassicaceae), CBS 127249 = DAOM 229269. Netherlands, from Brassica rapa 

(Brassicaceae), 2006, R. Veenstra, CBS 119951. 

Notes: Leptosphaeria biglobosa was originally described as a less 

virulent segregate of L. maculans (Shoemaker & Brun 2001). The 

species, also indicated as Tox 0 isolates, has been described from 

cultivated Brassica species as the cause of upper stem lesions 

and considered as less damaging than L. maculans (West et al. 

2002). However, in Poland L. biglobosa is the predominant cause 

of these symptoms (Jedryczka et al. 1999, Huang et al. 2005). The 

current species concept of L. biglobosa is broadly defined with six 

distinct subclades recognised by multilocus phylogenetic analyses 

of ITS, β-tubulin and actin sequences (Mendes-Pereira et al. 2003, 

Vincenot et al. 2008). These subclades are named after the host or 

geographic origin of the isolates involved. It has been suggested 

that the clades represent distinct subspecies formed over time by 

reproductive isolation (Mendes-Pereira et al. 2003). Alignments of 

the ITS sequences of Ph. wasbiae, Ph. pimpinellae and L. biglobosa 

isolates were compared with those of the representative strains 

of the L. biglobosa subclades obtained from GenBank, and both 

Ph. wasbiae and Ph. pimpinellae grouped in this species complex 

(unpubl. data). Both species are maintained here, awaiting a 

redescription of the taxa representing all clades in the L. biglobosa 

complex. 

Plenodomus chrysanthemi (Zachos, Constantinou & 

Panag.) Gruyter, Aveskamp & Verkley, comb. nov. MycoBank 

MB564728. 

Basionym: Cephalosporium chrysanthemi Zachos, Constantinou & 

Panag., Ann. Inst. Phytopath. Benaki, N.S. 55. 1960. 

≡ Phialophora chrysanthemi (Zachos, Constantinou & Panag.) W. Gams, 

Cephalosporium-artige Schimmelpilze (Stuttgart): 207. 1971. 

= Phoma vasinfecta Boerema, Gruyter & Kesteren, Persoonia 15: 484. 1994. 

Specimen examined: Greece, from Chrysanthemum sp. (Asteraceae), Apr. 1963, 

D.G. Zachos, holotype CBS H-7576, culture ex-holotype CBS 539.63. 

Note: The species was also described as Phoma tracheiphila f. sp. 

chrysanthemi (Baker et al. 1985). 

Plenodomus collinsoniae (Dearn. & House) Gruyter, 


Basionym: Leptosphaeria collinsoniae Dearn. & House, Bull. New 

York State Mus. Nat. Hist. 233–234: 36. 1921. 

Specimen examined: Japan, Osawa river, Komukai, Miyagi, from Vitis coignetiae 

(Vitaceae), 27 Sep. 2003, Y. Takahashi, CBS 120227 = JCM 13073 = MAFF 239583. 

Plenodomus confertus (Niessl ex Sacc.) Gruyter, Aveskamp 


Basionym: Leptosphaeria conferta Niessl ex Sacc., Syll. Fung. 2: 

20. 1883. 

= Phoma conferta P. Syd. ex Died., Krypt.-fl. Brandenburg 9: 142. 1912. 

Specimen examined: Spain, Cais do Tejo, from dead stem of Anacyclus radiatus 

(Asteraceae), Mar. 1961, M.T. Lucas, CBS 375.64. 

Plenodomus congestus (M.T. Lucas) Gruyter, Aveskamp & 


Basionym: Leptosphaeria congesta M.T. Lucas, Trans. Brit. Mycol. 

Soc. 46: 362. 1963. 

= Phoma congesta Boerema, Gruyter & Kesteren, Persoonia 15: 461. 1994. 

Specimen examined: Spain, Póvoa de Santa Iria, Estremadura, from stem 

of Erigeron canadensis (Asteraceae), Mar. 1961, M.T. Lucas, holotype of 

Leptosphaeria congesta M.T. Lucas, dried culture LISE 1638, culture ex-holotype 

CBS 244.64. 

Plenodomus enteroleucus (Sacc.) Gruyter, Aveskamp & 


Basionym: Phoma enteroleuca Sacc. var. enteroleuca, Michelia 1: 

358. 1878. 

Specimens examined: France, Alencon, from Pyrus communis (Rosaceae), 1878, 

C. C. Gillet, holotype of Phoma enteroleuca var. enteroleuca, Herb. Sacc. ’19’, 

PAD. Germany, Monheim, from leaf spots of Triticum aestivum (Poaceae), 15 Aug. 

1984, M. Hossfeld, CBS H-3684, culture CBS 831.84. Netherlands, Bennekom, 

from discoloured wood of Catalpa bignonioides (Bignoniaceae), 1981, G.H. 

Boerema, epitype designated here CBS H-16209, culture ex-epitype CBS 142.84 

= PD 81/654 = CECT 20063. 


21


Plenodomus fallaciosus (Berl.) Gruyter, Aveskamp & 


Basionym: Leptosphaeria fallaciosa Berl., Bull. Soc. Mycol. France. 

5: 43. 1889. 

Specimen examined: France, Var, Ste. Baume, from Satureia montana (Lamiaceae), 

July 1951, E. Müller, CBS 414.62 = ETH 2961. 

Plenodomus hendersoniae (Fuckel) Gruyter, Aveskamp & 


Basionym: Cucurbitaria hendersoniae Fuckel, Symb. Myc. p. 172. 

1870. 

≡ Melanomma hendersoniae (Fuckel) Sacc., Syll. Fung. 2: 109. 1883. 

≡ Chiajaea hendersoniae (Fuckel) Höhn., Sitzungsber. Kaiserl. Akad. 

Wiss., Math.-Naturwiss. Cl., Abt. 1. 129: 152. 1920. 

≡ Leptosphaeria hendersoniae (Fuckel) L. Holm, Symb. Bot. Upsal. 14: 

26. 1957. 

= Phoma intricans M.B. Schwarz, Meded. Phytopath. Lab. Willie Commelin 

Scholten 8: 44. 1922. 

Specimens examined: Sweden, Uppland, Jerusalem, from Salix cinerea 

(Salicaceae), 10 Apr. 1986, K. & L. Holm, CBS 113702 = UPSC 1843. Netherlands, 

Wilhelminadorp, from bark of Pyrus malus (Rosaceae), June 1977, H.A.Th. van der 

Scheer, CBS 139.78. 

Plenodomus influorescens (Boerema & Loer.) Gruyter, 


Basionym: Phoma enteroleuca var. influorescens Boerema & Loer., 


Specimens examined: Netherlands, from Lilium sp. (Liliaceae), 1973, G.H. 

Boerema, PD 73/1382; Emmeloord, from Fraxinus excelsior (Oleaceae), 1978, J.D. 

Janse, holotype of Phoma enteroleuca var. influorescens, CBS H-16208, culture ex 

holotype CBS 143.84 = PD 78/883 = CECT 20064. 

Note: The isolate PD 73/1382 is no longer available for study. 

Plenodomus libanotidis (Fuckel) Gruyter, Aveskamp & 


Basionym: Pleospora libanotidis Fuckel, Jahrb. Nassauischen 

Vereins Naturk. 27–28: 24. 1873 (as “libanotis”). 

≡ Leptosphaeria libanotidis (Fuckel) Sacc., Syll. Fung. 2: 16. 1883 (as 

“libanotis”). 

= Phoma sanguinolenta Rostr., Tidsskr. Landokon. 5(7): 384. 1888 (not 

Phoma sanguinolenta Grove, J. Bot. 23: 164. 1885). 

≡ Phoma rostrupii Sacc., Syll. Fung. 11: 490. 1895, nom. nov. 

Specimen examined: Sweden, Uppland, Gröna strand, from Seseli libanotis 

(Apiaceae), 19 May 1987, K. & L. Holm, CBS 113795 = UPSC 2219. 

Plenodomus lindquistii (Frezzi) Gruyter, Aveskamp & 


Basionym: Leptosphaeria lindquistii Frezzi, Revista Invest. 

Agropec., Sér. 5, 5: 79. 1968. 

= Phoma macdonaldii Boerema, Persoonia 6: 20. 1970. 

Specimens examined: Canada, from Helianthus annuus (Asteraceae), 1967, W.C. 

McDonald, CBS 381.67. Former Yugoslavia, from stem of Helianthus annuus, 

1977, A. Maric, CBS 386.80 = PD 77/336. 

Note: Strain CBS 381.67 is ex-holotype of Phoma macdonaldii 

Boerema, pycnidial state of Leptosphaeria lindquistii Frezzi 

(Boerema 1970). 

Plenodomus lingam (Tode : Fr.) Höhn., Sitzungsber. Kaiserl. 

Akad. Wiss., Math.-Naturwiss. Cl., Abt. 1. 120: 463. 1911. 

Basionym: Sphaeria lingam Tode : Fr., Fungi mecklenb. 2: 51. 

1791. : Fr., Syst. Mycol. 2: 507. 1823. 

≡ Phoma lingam (Tode : Fr.) Desm., Ann. Sci. Nat., Bot. Ser. 3, 11: 281. 

1849. 

= Sphaeria maculans Desm., Ann. Sci. Nat., Bot. Ser. 3, 6: 77. 1846, nom. 

illeg. 

≡ Leptosphaeria maculans (Desm.) Ces. & De Not., Comment. Soc. 

Crittog. Ital. 1: 235. 1863. 

= Plenodomus rabenhorstii Preuss, Linnaea 24: 145. 1851, nom. dub. 

Specimens examined: Netherlands, near Goes, from Brassica oleracea 

(Brassicaceae), 1978, M.M.J. Dorenbosch, CBS 260.94 = PD 78/989. Origin 

unknown, Mar. 1924, A. Weber, CBS 147.24. UK, from Brassica sp. (Brassicaceae), 

1963, B.C. Sutton, CBS 275.63 = MUCL 9901= UPSC 1025. 

Notes: The combination Plen. lingam as published by van Höhnel 

(1911) was preferred over Plen. rabenhorstii Preuss (1851) by 

Boerema & van Kesteren (1964) because the type material of 

Plen. rabenhorstii had been lost during the Second World War. 

Therefore, Plen. rabenhorstii is indicated here as a nomen 

dubium. Leptosphaeria maculans causes a serious stem base 

canker (blackleg) on cultivated Brassica spp. (Brassicaceae) in 

Europe, Australia and North America (West et al. 2001, Fitt et al. 

2006). 

Plenodomus lupini (Ellis & Everh.) Gruyter, Aveskamp & 


Basionym: Phoma lupini Ellis & Everh., Bull. Washburn Lab. Nat. 

Hist. 1: 6. 1884. 

≡ Asteromella lupini (Ellis & Everh.) Petr., Sydowia 9: 495. 1955 (not 

Phoma lupini N.F. Buchw., Møller, Fungi Faeröes 2: 153. 1958, nom. illeg). 

Specimen examined: Peru, Andes region, from stem lesion of Lupinus mutabilis 

(Fabaceae), May 1992, J. de Gruyter, CBS 248.92 = PD 79/141. 

Plenodomus pimpinellae (Lowen & Sivan.) Gruyter, 


Basionym: Leptosphaeria pimpinellae Lowen & Sivan., Mycotaxon 

35: 205. 1989. 

= Phoma pimpinellae Boerema & Gruyter, Persoonia 17: 278. 1999. 

Specimen examined: Israel, Mt Carmel near Kibbutz Oren, from dead stems of 

Pimpinella anisum (Apiaceae), 9 Dec. 1987, R. Rowen, 523-88 NY, holotype of 

Leptosphaeria pimpinellae Lowen & Sivan, culture ex-holotype CBS 101637 = PD 

92/41. 

Plenodomus tracheiphilus (Petri) Gruyter, Aveskamp & 


Basionym: Deuterophoma tracheiphila Petri, Boll. Staz. Patol. Veg. 

Roma 9: 396. 1929. 

≡ Bakerophoma tracheiphila (Petri) Cif., Ist. Bot. Reale Univ. Reale Lab. 

Crittog. Pavia Atti Ser. 5, 5: 307. 1946. 

≡ Phoma tracheiphila (Petri) L.A. Kantsch. & Gikaschvili, Trudy Inst. 

Zasch. Rast. Tibilisi 5: 20. 1948. 

Specimens examined: Israel, from Citrus limonium (Rutaceae), Oct. 1993, J. de 

Gruyter, CBS 551.93 = PD 81/782. Italy, from Citrus sp. (Rutaceae), CBS 127250 

= PD 09/04597141. 

Note: The species produces a phialophora-like synanamorph. 

Plenodomus visci (Moesz) Gruyter, Aveskamp & Verkley, 


Basionym: Plectophomella visci Moesz, Magyar Bot. Lapok 21: 13. 

1922. 

= Apocytospora visci Höhn., Mitt. Bot. Lab. TH Wien 1: 43. 1924. 

22


Specimen examined: Hungary, Tata-Tóváros, from leaves of Viscum album 

(Viscaceae), 22 Oct. 1911, G. von Moesz, BP, holotype of Plectophomella visci 

Moesz. France, from Viscum album, 1974, epitype designated here CBS H-20823, 

culture ex-epitype CBS 122783 = PD 74/1021. 

Notes: Plectophomella visci is the type species of the genus 

Plectophomella. This genus was accepted by Sutton (1980) based 

on the eustromatic conidiomata; branched, septate conidiophores, 

phialidic conidiogenesis and small, hyaline conidia. However, the 

phylogenetic analyses clearly demonstrated the placement of 

Plectophomella grouping in the Plenodomus clade and therefore it 

is treated as a synonym. 

Plenodomus wasabiae (Yokogi) J.F. White & P.V. Reddy, 

Canad. J. Bot. 76: 1920. 1999 (1998). 

Basionym: Phoma wasabiae Yokogi, Ann. Phytopathol. Soc. Japan 

2: 549. 1933. 

Specimens examined: Taiwan, from Wasabia japonica (syn. Eutrema wasabi) 

(Brassicaceae), A. Rossman, CBS 120119 = FAU 559; from Wasabia japonica, A. 

Rossman, CBS 120120 = FAU 561. 

Subplenodomus Gruyter, Verkley & Crous, gen. nov. 


Etymology: Although the genus resembles Plenodomus in the 

production of thick-walled pycnidia, the pycnidial cell wall of 

Subplenodomus often remains pseudoparenchymatous, similar to 

the pycnidial wall of species of Phoma. 

Conidiomata pycnidial, globose to papillate, or with an elongated neck, 

solitary or aggregated, thin-walled pseudoparenchymatous, or thickwalled 

scleroplectenchymatous, ostiolate, unilocular. Conidiogenous 

cells phialidic, ampulliform to doliiform. Conidia hyaline, aseptate, 

ellipsoid to cylindrical. Chlamydospores sometimes produced, 

olivaceous, unicellular in chains, or multicellular, dictyosporousbotryoid 

or forming pseudosclerotioid structures. 

Type species: Subplenodomus violicola (P. Syd.) Gruyter, 

Aveskamp & Verkley (see below) 

Subplenodomus apiicola (Kleb.) Gruyter, Aveskamp & 


Basionym: Phoma apiicola Kleb., Z. Pflanzenkrankh. 20: 22. 1910. 

Specimens examined: Germany, from tuber of Apium graveolens var. rapaceum 

(Apiaceae), Feb. 1972, Diercks, culture CBS 285.72. Netherlands, from stem base 

of Apium graveolens, 1978, J. de Gruyter, CBS 504.91 = PD 78/1073. 

Subplenodomus drobnjacensis (Bubák) Gruyter, 


Basionym: Phoma drobnjacensis Bubák, Bot. Közlem. 14: 63. 1915 

= Pyrenochaeta gentianae Chevassut, Bull. Soc. Mycol. France. 81: 36. 

1965. 

Specimens examined: Netherlands, from stem base of Gentiana makinoi “Royal 

Blue” (Gentianaceae), 1983, M.M.J. Dorenbosch, CBS 270.92 = PD 83/650; 

Naaldwijk, from red-brown root of Eustoma exaltatum (Gentianaceae), 1988, M.M.J. 

Dorenbosch, CBS 269.92 = PD 88/896. 

Subplenodomus valerianae (Henn.) Gruyter, Aveskamp & 


Basionym: Phoma valerianae Henn., Nyt Mag. Naturvidensk. 42: 

29. 1904. 

= Phyllosticta valerianae-tripteris f. minor Unamuno, Mem. Real Soc. Esp. 

Hist. Nat. 15: 348. 1929. 

Specimens examined: Netherlands, Arnhem, from dead stem of Valeriana phu 

(Valerianaceae), Sep. 1968, G.H. Boerema, CBS 630.68 = PD 68/141; Elburg, from 

stem base of Valeriana officinalis, 1973, M.M.J. Dorenbosch, culture CBS 499.91 

= PD 73/672. 

Subplenodomus violicola (P. Syd.) Gruyter, Aveskamp & 


Basionym: Phoma violicola P. Syd., Beibl. Hedwigia 38: 137. 1899. 

= Phyllosticta violae f. violae-hirtae Allesch. Rabenh.-Fl., Ed. 2, Pilze 6: 156. 

1898. 

= Phoma violae-tricoloris Died., Ann. Mycol. 2: 179. 1904. 

= Phyllosticta violae f. violae-sylvaticae Gonz. Frag., Trab. Mus. Nac. Ci. Nat., 

Ser. Bot. 7: 35. 1914. 

Specimens examined: Netherlands, Baarn, from leaf spot in Viola tricolor, 10 Mar. 

1968, H.A. van der Aa, CBS 306.68. New Zealand, Auckland, Henderson, from leaf 

spot in Viola tricolor (Violaceae), 1997, J. Jury, CBS 100272. 

Coniothyriaceae W.B. Cooke. Revista Biol. (Lisbon) 12: 

289. 1983. 

Coniothyrium carteri (Gruyter & Boerema) Verkley & 

Gruyter, comb. nov. MycoBank MB564775. 

Basionym: Phoma carteri Gruyter & Boerema, Persoonia 17(4): 

547. 2002 (“2001”), nom. nov. 

Replaced synonym: Pyrenochaeta minuta J.C. Carter, Bull. 

Illinois Nat. Hist. Surv. 21: 214. 1941 [not Phoma minuta Wehm., 

Mycologia 38: 318. 1946, nor Phoma minuta Alcalde, Anales Inst. 

Bot. Cavanilles 10: 235. 1952; not Coniothyrium minutum (Berl.) 

O. Kuntze, Revis. Gen. Pl. 3: 459. 1898 = Phoma cava, syn. of 

Pyrenochaeta cava; not Coniothyrium minutum (Died) Petr. & Syd., 

Feddes Repert. Spec. Nov. Regni Veg. Beih. 42: 349. 1927]. 

Specimens examined: Germany, isolated from Quercus robur (Fagaceae), 1991, 

CBS 105.91. Netherlands, from shoot of Quercus sp. (Fagaceae), 1984, M.M.J. 

Dorenbosch, CBS 101633 = PD 84/74. 

Coniothyrium dolichi (Mohanty) Verkley & Gruyter, comb. 

nov. MycoBank MB564776. 

Basionym: Pyrenochaeta dolichi Mohanty, Indian Phytopathol. 11: 

85. 1958. 

Specimen examined: India, Nani Tal, Sarichuan, from leafspot of Dolichos biflorus 

(Fabaceae), 20 Oct. 1955, N.N. Mohandy, CBS 124140 = IMI 217262, CBS 124143 

= IMI 217261. 

Notes: A synanamorph was noted and described as a Coniosporium 

state based on the dark brown to black, dictyosporous conidia 

(Mohanty 1958). This synanamorph was considered later as 

monodictys-like (Grodona et al. 1997). 

Coniothyrium glycines (R.B. Stewart) Verkley & Gruyter, 


Basionym: Pyrenochaeta glycines R.B. Stewart, Mycologia 49: 

115. 1957. 

≡ Phoma glycinicola Gruyter & Boerema, Persoonia 17: 554. 2002 

(“2001”), nom. nov., nom. inval. (not Phoma glycines Sawada, Special. 

Publ. Coll. Agric., Natl. Taiwan Univ. 8: 129. 1959, nom. inval). ≡ Phoma 

glycines Sawada ex J.K. Bai & G.Z. Lu, Fl. Fungorum Sin. 15: 33. 2003. 

Specimens examined: Zambia, on Mt. Makulu, from leaf of Glycine max (Fabaceae), 

Mar. 1985, J.M. Waller, CBS 124455 = IMI 294986. Zimbabwe, from a leaf of 

Glycine max (Fabaceae), 2001, C. Lavy, CBS 124141 = PG1. 


23


Coniothyrium multiporum (V.H. Pawar, P.N. Mathur 

& Thirum.) Verkley & Gruyter, comb. nov. MycoBank 

MB564778. 

Basionym: Phoma multipora V.H. Pawar, P.N. Mathur & Thirum., 


≡ Phoma multipora V.H. Pawar & Thirum., Nova Hedwigia 12: 501. 1966, 

nom. nud. 

Specimens examined: Egypt, CBS 501.91 = PD 83/888. India, Bombay, Bandra, 

from saline soil, 15 Jan. 1958, M.J. Thirumalachar, Isotype CBS H-16492, culture 

ex-isotype CBS 353.65 = ATCC 16207 = HACC 164 = IMI 113689. 

Coniothyrium palmarum Corda, Icon. Fungorum. (Corda) 

4: 38. 1840. 

≡ Clisosporium palmarum (Corda) Kuntze, Revis. Gen. Pl. 3: 458. 1898. 

≡ Microdiplodia palmarum (Corda) Died., Ann. Mycol. 11: 47. 1913. 

Specimens examined: Italy, Sardegna, near Dorgali, from a dead petiole of 

Chamaerops humilis (Arecaceae), Aug. 1970, W. Gams, CBS H-10891–10893, 

culture CBS 400.71. 

Coniothyrium telephii (Allesch.) Verkley & Gruyter, comb. 


Basionym: Pyrenochaeta telephii Allesch., Ber. bayer. bot. Ges. 4: 

33. 1896. 

≡ Phoma septicidalis Boerema, Versl. Meded. Plantenziektenk. Dienst 

Wageningen 153 (Jaarb. 1978): 20. 1979, nom. nov. [not Phoma telephii 

(Vestergr.) Kesteren, Netherlands J. Pl. Pathol. 78: 117. 1972]. 

Specimens examined: Finland, Helsinki, Asko Kahanpää, obtained from air, 

Jan. 1971, CBS H-16567, culture CBS 188.71; Oulu, from mineral wool between 

walls, Dec. 1996, K. Poldmaa, CBS 856.97. Zimbabwe, from leaf of Glycine max 

(Fabaceae), CBS 101636 = PD 86/1186. 

Cucurbitariaceae G. Winter, Rabenh, Krypt.-Fl., Ed 2, 308. 

1885. 

Neophaeosphaeria filamentosa (Ellis & Everh.) Câmara, 

M.E. Palm & A.W. Ramaley, Mycol. Res. 107: 519. 2003. 

Basionym: Leptosphaeria filamentosa Ellis & Everh., J. Mycol. 4: 

76. 1888. 

≡ Paraphaeosphaeria filamentosa (Ellis & Everh.) M.E. Barr, Mycotaxon 

43: 392. 1992. 

Specimen examined: Mexico, from Yucca rostrata (Asparagaceae), Stevens, CBS 

102202 = BPI 802755. 

Pyrenochaetopsis pratorum (P.R. Johnst. & Boerema) 


MB564780. 

Basionym: Phoma pratorum P.R. Johnst. & Boerema, New Zealand 

J. Bot. 19: 395. 1981. 

Specimens examined: New Zealand, Rakura, near Hamilton, from a leaf of Lolium 

perenne (Poaceae), 1980, P.R. Johnston, isotype CBS H-7625, CBS H-7626, 

culture CBS 445.81 = PDDCC 7049 = PD 80/1254; Dactylis glomerata (Poaceae), 

1980, CBS 286.93 = PD 80/1252. 

Pleosporaceae Nitschke, Verh. Naturhist. Vereines Preuss. 

Rheinl. 26: 74. 1869. 

Pleospora angustis Gruyter & Verkley, nom. nov. MycoBank 

MB564781. 

≡ Leptosphaeria clavata A.L. Guyot, Revue Mycol. (Paris) 11: 62. 1946. 

≡ Massariosphaeria clavata (A.L. Guyot) Shoemaker & C.E. Babc., 

Canad. J. Bot. 67: 1582.1989; not Pleospora clavata Gucevič (”as 

clavatis”), Novosti Sist. Nizsh. Rast. 7: 168. 1970. 

Specimen examined: Switzerland, 1951, E. Müller, CBS 296.51. 

Notes: The origin of the isolate deposited by E. Müller is unknown; 

however, it is likely that the isolate was obtained from Poaceae, 

Triticum vulgare or Dactylis glomerata (Müller 1950). Pleospora 

clavata Gucevič was obtained from Lonicera alseuosmoides and 

refers to a different species. 

Pleospora betae (Berl.) Nevod., Grib. ross. Exs., No. 247. 

1915. 

Basionym: Pyrenophora echinella var. betae Berl. Nuovo Giorn. 

Bot. Ital. 20: 208. 1888. 

= Pleospora betae Björl., Bot. Not. 1944: 218. 1944. (later homonym), nom. 

illeg. 

≡ Pleospora bjoerlingii Byford, Trans. Brit. Mycol. Soc. 46: 614. 1963, 

nom. nov. 

= Phoma betae A.B. Frank, Z. Rúbenzucker-Ind. 42: 904, tab. 20. 1892. 

= Phyllosticta betae Oudem., Ned. Kruidk. Arch. Ser. 2, 2: 181. 1877. 

= Gloeosporium betae Dearn. & E.T. Barthol., Mycologia 9: 356. 1917. 

Specimens examined: Netherlands, Wageningen, from Beta vulgaris 

(Chenopodiaceae), Sep. 1966, M.M.J. Dorenbosch, CBS H-16156, culture CBS 

523.66 = IHEM 3915 = PD 66/270; from Beta vulgaris, 1977, G.H. Boerema, CBS 

109410 = PD 77/113. 

Note: The name Phoma betae A.B. Frank has been conserved 

against Phyllosticta tabifica and any combination based on that 

name (Shoemaker & Redhead 1999). 

Pleospora calvescens (Fr.) Tul. & C. Tul., Selecta Fung. 

Carpol. (Paris) 2: 266. 1863. 

Basionym: Sphaeria calvescens Fr., Ann. Sci. Nat., Bot. Ser. 2, 19: 

353. 1843. 

≡ Leptosphaeria calvescens (Fr.) Sacc., Syll. fung. 2: 24. 1883. 

≡ Pyrenophora calvescens (Fr.) Sacc., Syll. fung. 2: 279. 1883. 

= Chaetodiplodia caulina P. Karst., Hedwigia 23: 62. 1884. 

≡ Ascochyta caulina (P. Karst.) v.d. Aa & Kesteren, Persoonia 10: 271. 

1979. 

= Microdiplodia henningsii Staritz, Hedwigia 53: 163. 1913. 

Specimens examined: Germany, Munkmarsch, from leaf spots in Atriplex hastata 

(Chenopodiaceae), 20 July 1977, G.H. Boerema, CBS H-8980, culture CBS 246.79 

= PD 77/655. Netherlands, Texel, from dead stem of Atriplex hastata, June 1978, 

H.A. van der Aa, CBS H-8976, culture CBS 343.78. 

Note: For additional synonyms see Boerema et al. (1993). 

Pleospora chenopodii Ellis & Kellerman, J. Mycol. 4: 26. 

1888. 

= Diplodia hyalospora Cooke & Ellis, Grevillea 7: 5. 1878 (not Pleospora 

hyalospora Ellis & Everh., Proc. Acad. Nat. Sci. Philadelphia. 42: 238. 1890). 

≡ Ascochyta hyalospora (Cooke & Ellis) Boerema, S.B. Mathur & Neerg., 

Netherlands J. Pl. Pathol. 83: 156. 1977. 

= Diplodina ellisii Sacc., Syll Fung. 3: 417. 1884 

Specimens examined: Bolivia, isolated from Chenopodium quinoa 

(Chenopodiaceae), 1974, S.B. Mathur, CBS H-9051, CBS H-9052, culture 

CBS 206.80 = PD 74/1022. Netherlands, Zoutelande, from Atriplex hastata 

(Chenopodiaceae), Aug. 1968, H.A. van Kesteren, CBS 344.78 = PD 68/682. 

Note: Isolate CBS 344.78 was originally identified as Ascochyta 

caulina but was identical to Pleospora chenopodii in the present 

study. 

24


Pleospora fallens (Sacc.) Gruyter & Verkley, comb. nov. 


Basionym: Phoma fallens Sacc., Syll. Fung. 10: 146. 1892. 

= Phyllosticta glaucispora Delacr., Bull. Soc. Mycol. France 9: 266. 1893. 

≡ Phoma glaucispora (Delacr.) Noordel. & Boerema, Versl. Meded. 

Plantenziektenk. Dienst Wageningen 166 (Jaarb. 1987): 108. 1989 

(“1988”). 

= Phyllosticta oleandri Gutner, Trudy Bot. Inst. Akad. Nauk S.S.S.R., Ser. 2, 

Sporov. Rast. 1: 306. 1933. 

Specimens examined: Italy, Capri, Villa Jovis, from a leaf spot of Nerium oleander 

(Apogynaceae), CBS H-16639, culture CBS 284.70 = PD 97/2400. New Zealand, 

Levin, from leaf spot of Olea europaea (Oleaceae), 1978, G.F. Laundon, CBS 

161.78 = LEV 1131. 

Pleospora flavigena (Constantinou & Aa) Gruyter & Verkley, 


Basionym: Phoma flavigena Constantinou & Aa, Trans. Brit. Mycol. 

Soc. 79: 343. 1982. 

Specimen examined: Romania, Bucuresti, isolated from water, 1980, K. Fodor, CBS 

H-1418, holotype of Phoma flavigena Constantinou & Aa, culture ex-holotype CBS 

314.80 = PD 91/1613. 

Pleospora halimiones Gruyter & Verkley, nom. nov. 


≡ Diplodina obiones Jaap (as “obionis”), Verh. Bot. Vereins Prov. 

Brandenburg 47: 96. 1905 (not Pleopora obiones P. Crouan & H. Crouan, 

Fl. Finistère: 22. 1867). 

≡ Ascochytula obiones (Jaap) Died., Ann. Mycol. 10: 141. 1912. 

≡ Ascochyta obiones (Jaap) P.K. Buchanan, Mycol. Pap. 156: 28 1987. 

= Coniothyrium obiones Jaap (as “obionis”), Schriften Naturwiss. Vereins 

Schleswig-Holstein 14: 29. 1907. 

Specimens examined: Netherlands, Texel, from leaf spots in Halimione 

portulacoides (Chenopodiaceae), 27 Oct. 1968, H.A. van der Aa, CBS H-9127, CBS 

H-9129, culture CBS 786.68; Texel, De Cocksdorp, from dead stems of Halimione 

portulacoides, 6 July 1977, H.A. van der Aa, CBS H-9126, CBS H-9125, culture CBS 

432.77 = IMI 282137. 

Notes: Isolate CBS 453.68 preserved as Chaetodiplodia sp. and 

also isolated from dying stems and leaf sheaths of Halimione 

portulacoides on Texel, is not the same as Pleo. halimiones and is 

probably a different species. 

Pleospora herbarum (Pers.) Rabenh., Bot. Zeitung (Berlin) 

15: 428. 1857; Klotzschii Herb. Viv. Mycol. 2: no. 547 (1854.) 

Basionym: Sphaeria herbarum Pers., Syn. Meth. Fung. 1: 78. 1801. 

= Stemphylium herbarum E.G. Simmons, Sydowia 38: 291. 1986 (1985). 

Specimen examined: India, Uttar Pradesh, from a leaf of Medicago sativa 

(Fabaceae), 1986 (isolated in 1983), E.G. Simmons, CBS 191.86 = IMI 276975. 

Note: This isolate is the ex-type culture of Stemphylium herbarum. 

Pleospora incompta (Sacc. & Martelli) Gruyter & Verkley, 


Basionym: Phoma incompta Sacc. & Martelli, Syll. Fung. 10: 146. 

1892. 

Specimens examined: Greece, Crete, from branch of Olea europaea (Oleaceae), 

1976, N. Malathrakis, CBS H-16394, culture CBS 467.76. Italy, from branch of Olea 

europaea, Mar. 1982, CBS H-16392, culture CBS 526.82. 

Pleospora typhicola (Cooke) Sacc., Syll. Fung. 2: 264. 

1883. 

Basionym: Sphaeria typhicola Cooke, Grevillea 5: 121. 1877. 

≡ Clathrospora typhicola (Cooke) Höhn., Ann. Mycol. 16: 88. 1918. 

≡ Pyrenophora typhicola (Cooke) E. Müll., Sydowia 5: 256. 1951. 

≡ Macrospora typhicola (Cooke) Shoemaker & C.E. Babc., Canad. J. Bot. 

70: 1644. 1992. 

= Phyllosticta typhina Sacc. & Malbr., Sacc., Michelia 2: 88. 1880. 

≡ Phoma typhina (Sacc. & Malbr.) van der Aa & Vanev, A revision of the 

species described in Phyllosticta: 468. 2002. 

= Phoma typharum Sacc., Syll. Fung. 3: 163. 1884. 

Specimens examined: Netherlands, Texel, from dead leaves of Typha angustifolia 

(Typhaceae), 1969, W. Gams, CBS H-16597, culture CBS 132.69; Staverden, from 

leaf spots of Typha sp., 24 June 1972, G.S. de Hoog, CBS H-16598, culture CBS 

602.72. 

Phoma-like anamorphs excluded from the suborder 

Pleosporineae 

Montagnulaceae M.E. Barr, Mycotaxon 77: 194. 2001. 

Paraconiothyrium Verkley, Stud. Mycol. 50: 327. 2004. 

Type species: Paraconiothyrium estuarinum Verkley & M. da Silva, 

Stud. Mycol. 50: 327. 2004. 

Paraconiothyrium flavescens (Gruyter, Noordel. & 

Boerema) Verkley & Gruyter, comb. nov. MycoBank 

MB564786. 

Basionym: Phoma flavescens Gruyter, Noordel. & Boerema, 

Persoonia 15(3): 375. 1993. 

Specimen examined: Netherlands, Nagele, from soil, rhizosphere of Solanum 

tuberosum (Solanaceae), CBS 178.93 = PD 82/1062. 

Paraconiothyrium fuckelii (Sacc.) Verkley & Gruyter, 


Basionym: Coniothyrium fuckelii Sacc., Nuovo Giorn. Bot. Ital. 8: 

200. 1876; Michelia 1: 207. 1878 

≡ Clisosporium fuckelii (Sacc.) Kuntze, Revis. Gen. Pl. 3: 458. 1898. 

≡ Microsphaeropsis fuckelii (Sacc.) Boerema, 2003, Persoonia 18: 160. 

2003. 

Specimen examined: Denmark, Geelskov, from a dead stem of Rubus sp. 

(Rosaceae), 1995, A.M. Dahl-Jensen, CBS 797.95. 

Notes: Coniothyrium fuckelii var. sporulosum has been redisposed 

as Paraconiothyrium sporulosum (Verkley et al. 2004) and it is 

clearly different from Paraconiothyrium fuckelii (Damm et al. 2008). 

Paraconiothyrium fusco-maculans (Sacc.) Verkley & 

Gruyter, comb. nov. MycoBank MB564788. 

Basionym: Phoma fusco-maculans Sacc., Michelia 2: 275. 1881 

≡ Plenodomus fusco-maculans (Sacc.) Coons, J. Agric. Res. 5: 714. 1916. 

Specimens examined: Italy, Selva, from decorticated wood of Malus pumila 

(Rosaceae), Oct. 1880, PAD, holotype of Phoma fusco-maculans Sacc. USA, from 

wood of Malus sp. (Rosaceae), July 1916, G.H. Coons, epitype designated here 

CBS H-20825, culture ex-epitype CBS 116.16. 

Notes: Plenodomus fusco-maculans was discussed by Boerema & 

Loerakker (1985) and de Gruyter et al. (2010). The holotype of the 

basionym Aposphaeria fusco-maculans was studied and considered 

to be Aposphaeria pulviscula (Boerema et al. 1996). However, the 

description of A. fusco-maculans given by Boerema et al. (1996) 

fits the generic concept of Paraconiothyrium, in congruence with 

the molecular phylogeny of the culture CBS 116.16. 


25


Fig. 6. Paraconiothyrium maculicutis sp. nov. CBS 101461. A–B. Fourteen day old cultures on OA (A) and MA (B). C–D. Pycnidia. E. Phoma-like conidiogenous cells. F–G. 

Conidia, initially hyaline to pale olivaceous (F), then becoming olivaceous (G). Scale bars: C–D = 20 μm; E = 10 μm; F–G = 5 μm. 

Paraconiothyrium lini (Pass.) Verkley & Gruyter, comb. 


Basionym: Phoma lini Pass., Diagn. Funghi Nuovi 4, No. 81. 1890. 

Specimen examined: Netherlands, from Wisconsin tank, 1970, CBS 253.92 = PD 

70/998. 

Paraconiothyrium maculicutis Verkley & Gruyter, sp. nov. 

MycoBank MB564796. Fig. 6. 

Etymology: Latin, cutis = skin; maculae = spots. 

Pycnidia in vitro 50–125 μm diam, globose to subglobose, 

glabrous or with mycelial outgrowth, scattered, non-ostiolate 

or ostiolate, pycnidial wall made up of 5–7 layers of cells. 

Conidiogenous cells 1.5–3 × 0.5–2.5 μm, indeterminate or 

ampulliform to filiform in a later state, up to 10 μm in length. 

Conidia 1.5–2.5 × 0.5–1.5 μm, ellipsoidal, initially hyaline, then 

discolouring to olivaceous. 

Description in vitro: Colonies on OA 50–52 mm diam after 7 d, 

margin entire; colony olivaceous buff to greenish olivaceous/grey 

olivaceous, with greenish olivaceous to pale olivaceous grey, 

finely floccose to woolly aerial mycelium; reverse smoke-grey to 

greenish olivaceous, with olivaceous patches. Colonies on MEA 

43–44 mm diam after 7 d, margin entire; colony pale olivaceous 

grey to greenish olivaceous, with isabelline to cinnamon at centre, 

with compact pale olivaceous grey, finely floccose to woolly aerial 

mycelium; reverse buff to honey, isabelline to olivaceous near 

margin. Pycnidia globose to subglobose, olivaceous to brick, finally 

olivaceous black, scattered, mainly on the agar, 50–125 μm diam, 

glabrous or with mycelial outgrowth, non-ostiolate or ostiolate, 

pycnidial wall made up of 5–7 layers of cells. Conidiogenous cells 

1.5–3 × 0.5–2.5 μm, ampulliform to filiform in a later state, up to 10 

μm in length. Conidia 1.5–2.5 × 0.5–1.5 μm, av. 1 × 2 μm, length/ 

width ratio = 1.5–3.2, av. 2.2, ellipsoidal, initially hyaline, then 

discolouring to olivaceous. Chlamydospores absent. NaOH spot 

test: negative. Crystals absent. 

Specimen examined: USA, Texas; San Antonio, Fort Sam Houston, from human, 

cutaneous lesions, 1989, D.P. Dooley, holotype CBS H-20824, culture ex-holotype 

CBS 101461 = IMI 320754 = UTHSC 87-144. 

Notes: Isolate CBS 101461 was identified as Pleurophoma 

pleurospora (Dooly et al. 1989). However, in vitro data and the 

molecular phylogeny demonstrate that this isolate does not belong 

to Pleurophoma pleurospora, see below, and therefore is described 

as a new species in the genus Paraconiothyrium. 

Paraconiothyrium minitans (W.A. Campb.) Verkley, Stud. 

Mycol. 50: 332. 2004. 

Basionym: Coniothyrium minitans W.A. Campb., Mycologia 39: 

191. 1947. 

Specimens examined: Netherlands, Boskoop, from stem of Clematis sp. 

(Ranunculaceae), 1999, J. de Gruyter, CBS 122786 = PD 99/1064-1. UK, CBS 

122788 = PD 07/03486739. 

Paraconiothyrium tiliae (F. Rudolphi) Verkley & Gruyter, 


Basionym: Asteroma tiliae F. Rudolphi, Linnaea 4: 514. 1829. 

26


Fig. 7. Pleurophoma pleurospora. CBS 130329. A–B. Fourteen day old cultures on OA (A) and MA (B). C. Pycnidia. D–H. Conidiogenous cells, septate conidiophores with 

acropleurogenous conidiogenesis (D–G) or phoma-like (H). I. Conidia. Scale bars: C = 50 μm; D–G, I = 10 μm; H = 5 μm. 

≡ Asteromella tiliae (F. Rudolphi) Butin & Kehr, Mycol. Res. 99: 1193. 

1995, nom. inval., Art. 33.4. 

Specimen examined: Austria, Amlach, from a leaf of Tilia platyphyllos (Tiliaceae), 

10 Sep. 1993, H. Butin, neotype IMI 362854, lectotype designated here CBS 

H-20826, culture ex-lectotype CBS 265.94. 

Pleurophoma pleurospora (Sacc.) Höhn., Sitzungsber. 

Kaiserl. Akad. Wiss., Math.-Naturwiss. Cl., Abt. 1. 123: 117. 

1914. Fig. 7. 

Basionym: Dendrophoma pleurospora Sacc., Michelia 2: 97. 1880. 

Description in vitro: Colonies on OA 14–18 mm diam after 7 d 

(18–28 mm after 14 d), margin entire to undulate; colony greenish 

olivaceous/olivaceous to rosy-buff and sepia, with white, felty 

aerial mycelium; reverse olivaceous grey to greenish olivaceous/ 

olivaceous. Colonies on MEA 11–16 mm diam after 7 d (19–29 

mm after 14 d), colony margin undulate; colony pale olivaceous 

grey/ olivaceous grey to dark mouse-grey with rosy-buff tinges, 

with white, floccose, compact aerial mycelium, reverse umber/ 

brown olivaceous to olivaceous/olivaceous black. Pycnidia globose 

to subglobose,olivaceous to olivaceous black, abundant, scattered, 

mainly on the agar, 30–120 μm diam, solitary or aggregated, 

covered by mycelial outgrowths or setae-like hyphae, up to 50 μm, 

non-papillated, without or with ostiole, walls made up of 2–5 layers 

of cells, outer layer(s) pigmented; conidial exudate not observed. 

Conidiogenous cells of two types; ampulliform to doliiform, 4–6.5 × 

2–5.5 μm, or filiform, septate, branched, acropleurogenous, up to 

60 μm long. Conidia 3.5–5.5 × 1.5–2.5 μm, av. 4.5 × 2 μm, length/ 

width ratio = 1.5–3, av. 2.1, cylindrical to oblong, without or with 

some minute, polar orientated guttules. Chlamydospores absent. 

NaOH spot test: a weak reddish discolouring may occur on MA, not 

specific. Crystals absent. 

Specimens examined: France, Perpignan, from leaf of Laurus nobilis (Lauraceae), 

PAD, holotype of Dendrophoma pleurospora Sacc. Netherlands, from wood of 

Lonicera sp. (Caprifoliaceae), lectotype designated here CBS H-20626, culture 

ex-lectotype CBS 130329 = PD 82/371; Molenhoek, Heumense Schans, from twig 

lesions of Cytisus scoparius (Fabaceae), 23 Aug. 2004, G. Verkley & M. Starink, 

CBS 116668. 

Notes: A specimen derived from isolate CBS 130329 is assigned 

here as lectotype of Pleurophoma pleurospora, the type species of 

the genus (von Höhnel 1914). The species is known from branches 

and bare wood of trees and shrubs (Sutton 1980, Boerema et al. 

1996) and the isolate from Cytisus scoparius demonstrates that the 

species also may occur on green twigs. The isolates showed two 

types of conidiogenesis characteristic for the genus Pleurophoma; 

phoma-like, ampulliform to doliiform conidiogenous cells, as well as 

pyrenochaeta-like branched, filiform, septate, acropleurogenous. 

As a result, species of the genus Pleurophoma can easily be 

confused with taxa classified in the genera Phoma, Paraphoma, 

Pyrenochaeta and Pyrenochaetopsis. 


27


Paraphaeosphaeria michotii (Westend.) O.E. Erikss., Arkiv 

før Botanik 6: 406. 1967. 

Basionym: Sphaeria michotii Westend., Bull. Acad. Roy. Sci. 

Belgique Ser. 2, 7: 87. 1859. 

Specimen examined: Switzerland, Kt. Obwalden, from Typha latifolia (Typhaceae), 

18 May 1980, A. Leuchtmann, CBS 652.86 = ETH 9483. 

Massarinaceae Munk, Friesia 5: 305. 1956. 

Byssothecium circinans Fuckel, Bot. Zeitung (Berlin) 19: 

251. 1861. 

≡ Leptosphaeria circinans (Fuckel) Sacc., Syll. Fung. 2: 88. 1883. 

≡ Passeriniella circinans (Fuckel) Sacc., Syll. Fung. 11: 326. 1895. 

≡ Trematosphaeria circinans (Fuckel) G. Winter, Rabenh. Krypt.-Fl., ed 

1(2): 277. 1887. 

≡ Heptameria circinans (Fuckel) Cooke, Grevillea 18: 30. 1889. 

= Melanomma vindelicorum Rehm, Ber. Nat. Ver. Augsburg: 116. 1881. 

≡ Trematosphaeria vindelicorum (Rehm) Sacc., Syll. Fung. 2: 122. 1883. 

Specimen examined: USA, South Dakota, from rotten crown of Medicago sativa 

(Fabaceae), G. Semeniuk, CBS 675.92 = ATCC 52767 = ATCC 52678 = IMI 266220. 

Massarina eburnea (Tul. & C. Tul.) Sacc., Syll. Fung. 2: 153. 

1883. 

Basionym: Massaria eburnea Tul. & C. Tul., Select. Fung. Carpol. 

(Paris) 2: 239. 1863. 

Specimens examined: Switzerland, Zürich, from Fagus sylvatica (Fagaceae), S.K. 

Bose, CBS 473.64 = ETH 2945. UK, Wales, isolated from dead branch of Fagus 

sylvatica, HHUF 26621, JCM 14422 = H3953. 

Neottiosporina paspali (G.F. Atk.) B. Sutton & Alcorn, 

Austral. J. Bot. 22: 519. 1974. 

Basionym: Stagonospora paspali G.F. Atk., Bull. Cornell Univ. 

(Science) 3: 33. 1897. 

Specimen examined: USA, Florida, from Paspalum notatum (Poaceae), Oct. 1937, 

R.K. Voorhees, CBS 331.37. 

Trematosphaeriaceae Suetrong et al. Cryptogamie Mycol. 

32: 347. 2011. 

Falciformispora lignatilis K.D. Hyde, Mycol. Res. 96: 27. 

1992. 

Specimen examined: Thailand, Pinruan Ban Bang, from Elaeis guineensis 

(Arecaceae), BCC 21118. 

Medicopsis Gruyter, Verkley & Crous, gen. nov. MycoBank 

MB564791. 

Etymology: refers to Medi- medica, Latin, -opsis, refers to, Greek. 

The description of the type species as the cause of a mycetoma 

suggest this is a human pathogen. However, the mycetoma 

described was secondary to a wound produced by a thorn of Palito 

blanco tree, and the species was found later on Hordeum vulgare. 

Pycnidia solitary or confluent, on upper surface of the agar, globose 

to pyriform with elongated neck, setose, ostiolate, olivaceous 

to olivaceous-black, the wall with pseudoparenchymatal cells. 

Conidiogenous cells hyaline, phialidic, ampulliform to doliiform, to 

elongated. Conidia sub-hyaline to yellowish, ellipsoid, aseptate, 

catenulate. 

Type species: Medicopsis romeroi (Borelli) Gruyter, Verkley & 

Crous (see below). 

Medicopsis romeroi (Borelli) Gruyter, Verkley & Crous, 


Basionym: Pyrenochaeta romeroi Borelli, Dermatol. Venez. 1: 326. 

1959. 

Specimens examined: Venezuela, from human, maduromycosis, no date, D. Borelli, 

UAMH 2892, holotype of Pyrenochaeta romeroi Borelli, culture ex-holotype CBS 

252.60 = ATCC 13735 = FMC 151 = UAMH 10841. Country unknown, from Hordeum 

vulgare (Poaceae), 1984, M.M.J. Dorenbosch, CBS 122784 = PD 84/1022. 

Notes: The species was described as a human pathogen of 

tropical origin, and it may cause suppurative subcutaneous 

or deep nonmycetomatous infections, or a subcutaneous 

phaeohyphomycotic cyst (Badali et al. 2010). However, the species 

also occurs in plant material. 

Trematosphaeria pertusa (Pers.) Fuckel, Jahrb. 

Nassauischen Vereins Naturk 23–24: 161. 1870. 

Basionym: Sphaeria pertusa Pers., Syn. Meth. Fung. 1: 83. 1801. 

Specimen examined: France, Deux Sèvres, from bark of a dead stump of Fraxinus 

excelsior (Oleaceae), 25 Apr. 2004, Jacques Fournier, epitype IFRD 2002, culture 

ex-epitype CBS 122368. 

Note: The epitype IFRD 2002 was designated by Zhang et al. 

(2008). 

Lentitheciaceae Yin. Zhang, C.L. Schoch, J. Fourn., Crous 

& K.D. Hyde, Stud. Mycol. 64: 93. 2009. 

Splanchnonema platani (Ces.) M.E. Barr, Mycotaxon 15: 

364. 1982. 

Basionym: Sphaeria (Massaria) platani Ces., in Rabenhorst, 

Klotzschii Herb. Viv. Mycol.: no. 1842. 1854. 

Specimen examined: USA, from Platanus occidentalis (Platanaceae), Jan. 1937, 

C.L. Shear, CBS 221.37. 

Note: This taxon was shown by Zhang et al. (2012) to cluster basal 

to the Lentitheciaceae. 

Melanommataceae G. Winter, Rabenh. Krypt.-Fl., ed 1(2): 

220 (1885) [as “Melanommeae”] 

Aposphaeria corallinolutea Gruyter, Aveskamp & Verkley, 

sp. nov. MycoBank MB564798. Fig. 8. 

Etymology: The name refers to the coral coloured colony on OA, 

and the luteous exudate diffusing into the agar medium. 

Pycnidia in vitro 65–215 μm diam, solitary or aggregated to 

confluent, globose to subglobose, ostiolate or non-ostiolate. 

Conidiogenous cells 7–9 × 2–4 μm, ampuliform to filiform. Conidia 

3–5 × 1–2 μm, ellipsoidal to allantoid, eguttulate or with some small, 

polar guttules. 

Description in vitro: Colonies on OA 13–15 mm diam after 14 d, margin 

entire to somewhat lobated; colony vinaceous to brick, with white at 

centre, ochraceous near margin due to a diffusible pigment, with 

28


Fig. 8. Aposphaeria corallinolutea sp. nov. CBS 131287. A–B. Fourteen day old cultures on OA (A) and MA (B). C–D. Pycnidia. E–H. Conidiogenous cells. I. Conidia. Scale 

bars: C = 50 μm; D = 20 μm; E–I = 10 μm. 

white, felty or poorly developed aerial mycelium; reverse cinnamon to 

brick. Colonies on MEA 15–20 mm diam after 14 d, margin entire to 

somewhat lobated; colony white with dull green and grey olivaceous 

sectors and primrose tinges, with white, felty aerial mycelium; 

reverse sepia to brown olivaceous, greenish grey at centre, white 

near margin. Pycnidia globose to subglobose, olivaceous to brick, 

then olivaceous black, solitary or aggregated, 65–215 μm diam, nonsetose 

or with short setae-like outgrowths up to 25 μm long, with or 

without distinct ostiole, pycnidial wall consisting of 3–5 layers of cells. 

Conidiogenous cells 7–9 × 2–4 μm, ampulliform to filiform. Conidia 

3–5 × 1–2 μm, av. 4 × 1.5 μm, length/width ratio is 1.7–3.3, av. = 2.5, 

ellipsoidal to allantoid, eguttulate or with some small, polar guttules. 

Chlamydospores absent, NaOH test negative. Crystals produced in 

the agar, small, orange coloured. 

Specimens examined: Netherlands, from wood of Fraxinus excelsior (Oleaceae), 

1983, M.M.J. Dorenbosch, holotype CBS H-20625, culture ex-holotype CBS 

131287 = PD 83/831; from wood of Kerria japonica (Rosaceae), 1983, M.M.J. 

Dorenbosch, CBS 131286 = PD 83/367. 

Aposphaeria populina Died., Krypt.-Fl. Brandenburg 9: 

206. 1912 (vol. dated “1915”). Fig. 9. 

Description in vitro: Colonies on OA 21–24 mm diam after 7 d 

(32–37 mm diam after 14 d), margin entire to undulate; colony grey 

olivaceous/olivaceous to pale luteous/luteous, with white to pale 

olivaceous grey, finely felty to woolly aerial mycelium; reverse luteous 

to orange, greenish olivaceous to olivaceous or grey olivaceous/ 

olivaceous grey to iron-grey, a rosy-buff discolouring near margin may 

occur. Colonies on MEA 16–20 mm diam after 7 d (30–37 mm diam 

after 14 d), margin entire to undulate; colony pale olivaceous grey 

with rosy-vinaceous tinges to peach or olivaceous grey, with white, 

woolly aerial mycelium; reverse saffron to pale olivaceous/olivaceous 

grey, sometimes with dark vinaceous tinges, rosy-buff near margin. 

Pycnidia globose to subglobose, olivaceous to olivaceous black, 

scattered, 55–305 μm diam, glabrous or with mycelial outgrowths, 

non-ostiolate or ostiolate, pycnidial wall composed of up to 10 layers 

of cells. Conidiogenous cells 5–11.5 × 1.5–3 μm, ampulliform to 

filiform. Conidia hyaline, subglobose to ellipsoidal, with 1–3 minute 

guttules, 1–2 × 1–1.5 μm, av. 1.5 × 1 μm, length/width ratio is 1.0–2.0, 

av. = 1.4. Chlamydospores and crystals absent, NaOH test negative. 

Specimens examined: Germany, Triglitz, from twigs of Populus canadensis 

(Salicaceae), Mar. 1904. O. Jaap, B, holotype; from branch scars of Picea abies, 

(Pinaceae), Feb. 1982, H. von Aufess, CBS 350.82. Netherlands, Valkenswaard, 

from fallen twig of Populus canadensis (Salicaceae), 23 Mar. 1970, H.A. van der 

Aa, epitype designated here CBS H-9336, culture ex lectotype CBS 543.70; from 

wood of Cornus mas (Cornaceae), 1984, M.M.J. Dorenbosch, CBS 130330 = PD 

84/221. 

Beverwykella pulmonaria (Beverw.) Tubaki, Trans. Mycol. 

Soc. Japan 16: 139. 1975. 

Basionym: Papulaspora pulmonaria Beverw., Antonie van 

Leeuwenhoek 20: 11. 1954. 

Specimen examined: Netherlands, Baarn, from submerged leaf in rain water barrel 

of Fagus sylvatica (Fagaceae), Apr. 1953, A.L. van Beverwijk, culture CBS 283.53 

= ATCC 32983 = IFO 6800. 

Herpotrichia juniperi (Duby) Petr., Ann. Mycol. 23: 43. 

1925. 

Basionym: Sphaeria juniperi Duby, Klotzsch. Herb. Vivum Mycol. 

Sistems Fungorum German., no. 1833. 1854. 


29


Fig. 9. Aposphaeria populina. CBS 543.70. A–B. Fourteen day old cultures on OA (A) and MA (B). C. Pycnidium with mycelial outgrowths (CBS 130330). D–E. Conidiogenous 

cells. F. Conidia. Scale bars: C = 20 μm; D–E = 10 μm; F = 5 μm. 

Specimen examined: Switzerland, Andermatt, from Juniperus nana (Cupressaceae), 

Nov. 1931, E. Gäumann, CBS 200.31. 

Melanomma pulvis-pyrius (Pers.) Fuckel, Jahrb. 

Nassauischen Vereins Naturk. 23–24: 160. 1870. 

Basionym: Sphaeria pulvis-pyrius Pers., Syn. Meth. Fung. 1: 86. 

1801. 

Specimens examined: Belgium, from wood of Fagus sp. (Fagaceae), CBS 400.97. 

France, Vosges, Bot. Garden Le Chitelet, from unidentified decaying wood, CBS 

371.75. 

Notes: Phoma-like anamorphs have been reported by Chesters 

(1938) and Sivanesan (1984), but no anamorphic stage was 

observed in IFRDCC 2044, CBS 109.77 or CBS 371.75 after 

culturing 3 mo on PDA (Zhang et al. 2008). CBS 400.97 was 

preserved as Trematosphaeria pertusa. 

Pleomassaria siparia (Berk. & Broome) Sacc., Syll. Fung. 

2: 239. 1883. 

Basionym: Sphaeria siparia Berk. & Broome, Ann. Mag. Nat. Hist. 

Ser. 2(9): 321. 1852. 

Specimen examined: Netherlands, Uden, from dead branch of Betula verrucosa 

(Betulaceae), 8 Dec. 1973, W.M. Loerakker, CBS H-258, CBS H-260, culture CBS 

279.74. 

Sporormiaceae Munk, Dansk Bot. Ark. 17(1): 450. 1957, 

nom. inval., Art. 36.1. 

Preussia funiculata (Preuss) Fuckel, Jahrb. Nassauischen 

Vereins Naturk. 23–24: 91. 1870 (1869–70). 

Basionym: Perisporium funiculatum Preuss, Linnaea 24(1): 143. 

1851. 

Specimen examined: Senegal, from soil, CBS 659.74. 

Sporormiella minima (Auersw.) S.I. Ahmed & Cain, Canad. 

J. Bot. 50: 449. 1972. 

Basionym: Sporormia minima Auersw., Hedwigia 7: 66. 1868. 

Specimen examined: Panama, from dung of goat, CBS 524.50. 

Westerdykella Stolk, Trans. Brit. Mycol. Soc. 38: 422. 1955. 

Type species: Westerdykella ornata Stolk, see below. 

Westerdykella capitulum (V.H. Pawar, P.N. Mathur & 

Thirum) Gruyter, Aveskamp & Verkley, comb. nov. MycoBank 

MB564801. 

Basionym: Phoma capitulum V.H. Pawar, P.N. Mathur & Thirum., 


≡ Phoma capitulum V.H. Pawar & Thirum., Nova Hedwigia 12: 502. 1966 

(as ”capitula”), nom. nud., nom. inval. 

= Phoma ostiolata V.H. Pawar, P.N. Mathur & Thirum., Trans. Brit. Mycol. Soc. 

50: 262. 1967, var. ostiolata. 

≡ Phoma ostiolata V.H. Pawar & Thirum., Nova Hedwigia 12: 502. 1966, 

nom. nud., nom. inval. 

= Phoma ostiolata var. brunnea V.H. Pawar, P.N. Mathur & Thirum., Trans. Brit. 

Mycol. Soc. 50: 263. 1967. 

≡ Phoma ostiolata var. brunnea V.H. Pawar & Thirum., Nova Hedwigia 

12: 502. 1966, nom. nud., nom. inval. 

30


Specimen examined: India, Bandra, Bombay, from saline soil, 15 Jan. 1958, M.J. 

Thirumalachar, Isotype CBS H-7602, culture ex-isotype CBS 337.65 = ATCC 16195 

= HACC 167 = IMI 113693 = PD 91/1614. 

Westerdykella minutispora (P.N. Mathur ex Gruyter 

& Noordel.) Gruyter, Aveskamp & Verkley, comb. nov. 


Basionym: Phoma minutispora P.N. Mathur ex Gruyter & Noordel., 

Persoonia 15: 75. 1992 (as “collection name” originally also referred 

to Thirumalachar; = depositor). 

Replaced synonym: Phoma oryzae Cooke & Massee, Grevillea 

16: 15. 1887 (not Phoma oryzae Catt., Arch. Triennale Bot. Crittog. 

Pavia 2–3: 118. 1879, nom. illeg). 

≡ Phyllosticta oryzae (Cooke & Massee) I. Miyake. J. Coll. Agric. Imp. 

Univ. Tokyo 2: 252. 1910, nom. illeg. 

Specimen examined: India, from saline soil, 1977, M.J. Thirumalachar, CBS 

H-5941, culture CBS 509.91 = PD 77/920. 

Westerdykella ornata Stolk, Trans. Brit. Mycol. Soc. 38: 

422. 1955. 

Specimen examined: Mozambique, from mangrove mud, CBS 379.55. 

Didymosphaeriaceae Munk, Dansk Bot. Ark. 15(2): 128. 

1953. 

Roussoella hysterioides (Ces.) Höhn., Sitzungsber. Kaiserl. 

Akad. Wiss., Math.-Naturwiss. Cl., Abt. 1. 128: 563. 1919. 

Basionym: Dothidea hysterioides Ces., Atti Accad. Sci. Fis. 8: 24. 

1879. 

Specimen examined: Japan, Aomori, Shimokita Yagen, from culms of Sasa 

kurilensis (Poaceae), Y. Ooki, culture CBS 125434 = HH 26988. 

Family incertae sedis 

Nigrograna Gruyter, Verkley & Crous, gen. nov. MycoBank 

MB564794. 

Etymology: refers to Nigro-, black, Latin, -grana, grains, Latin. The 

description refers to the black grains produced by the type species. 

Pycnidia solitary or rarely confluent, on upper surface or submerged 

in agar, globose to subglobose or pyriform, with dark brown, 

septate mycelial outgrowths, with papillate ostioles, olivaceous 

to olivaceous-black, the wall with pseudoparenchymatous cells. 

Conidiogenous cells hyaline, phialidic, discrete. Conidia subhyaline, 

brown in mass, aseptate, ellipsoidal. 

Type species: Nigrograna mackinnonii (Borelli) Gruyter, Verkley & 

Crous (see below). 

Nigrograna mackinnonii (Borelli) Gruyter, Verkley & Crous, 


Basionym: Pyrenochaeta mackinnonii Borelli, Castellania 4: 230. 

1976. 

Specimens examined: Mexico, from a mycetoma of a human, Feb. 2002, R. Arenas, 

CBS 110022; Venezuela, from a black grain mycetoma of human, Aug. 1975, D. 

Borelli, holotype FMC 270, culture ex-holotype CBS 674.75. 

Thyridaria rubronotata (Berk. & Broome) Sacc., Syll. Fung. 

2: 141. 1883. 

Basionym: Melogramma rubronotatum Berk. & Broome, Ann. Mag. 

Nat. Hist. Ser. 3(3): 20. 1859. 

Specimen examined: Netherlands, Zuidelijk Flevoland, from a dead branch of Acer 

pseudoplatanus (Aceraceae), 13 Apr. 1985, N. Ernste, CBS H-18824, culture CBS 

419.85. 

DISCUSSION 

The genus Phoma has been shown to be highly polyphyletic 

and Phoma is now restricted to taxa in the Didymellaceae (de 

Gruyter et al. 2009, Aveskamp et al. 2010). Phoma anamorphs 

and phoma-like species in Coniothyriaceae, Leptosphaeriaceae, 

Melanommataceae, Montagnulaceae, Pleosporaceae, 

Sporormiaceae and Trematosphaeriaceae are redisposed here as 

a result of this and previous studies. 

The delimitation of Leptosphaeriaceae in Pleosporineae 

from Cucurbitariaceae, Didymellaceae, Phaeosphaeriaceae and 

Pleosporaceae agrees with recent studies of phoma-like species 

in Pleosporales (de Gruyter et al. 2009, Aveskamp et al. 2010, de 

Gruyter et al. 2010). Cucurbitariaceae is recognised as the fifth 

family in Pleosporineae in addition to the four families accepted by 

Zhang et al. (2009), which are Didymellaceae, Leptosphaeriaceae 

Phaeosphaeriaceae and Pleosporaceae. 

The genera Leptosphaeria, Paraleptosphaeria, 

Plenodomus, Subplenodomus and Heterospora 

Plenodomus lingam and L. doliolum, the type species of 

Plenodomus and Leptosphaeria respectively, were found to 

be distant genetically, which agrees with findings of previous 

molecular phylogenetic studies (Jasalavic et al. 1995, Morales 

et al. 1995, Dong et al. 1998, Câmara et al. 2002, Eriksson & 

Hawksworth 2003, Wunsch & Bergstrom 2011). In our study the 

generic type species grouped in sister clades, which represent 

Leptosphaeria and Plenodomus. Species of Leptosphaeria 

produce dark brown, 3-septate ascospores, which have been 

considered the primitive state with more recently evolved 

species producing ascospores that are paler in colour, longer 

and narrower, and more than 3-septate (Wehmeyer 1946). This 

hypothesis is supported by the results obtained in our study. 

Paraleptosphaeria is distinct but seems to be most closely 

related to Leptosphaeria producing 3(–5)-septate, yellow/brown 

or hyaline ascospores. Both genera include only necrotrophic 

species. Plenodomus and Subplenodomus include necrotrophs 

and plant pathogens. Ascospores in Plenodomus are 

3–7-septate, whereas in Subplenodomus no sexual state has 

thus far been recorded. The scleroplectenchymatous pycnidial 

cell wall is typical for Plenodomus, whereas in Subplenodomus 

the pycnidial cell wall is pseudoparenchymatous. Heterospora is 

closely allied to Subplenodomus and no sexual state has been 

recorded for this genus either. The distinctive characterisitics 

of the genera Heterospora, Leptosphaeria, Paraleptosphaeria, 

Plenodomus and Subplenodomus are summerised in Table 

2. A blast search in GenBank using ITS sequences of five 

selected species of the Leptosphaeriaceae, namely L. 

doliolum, L. etheridgei, Plen. lingam, H. dimorphospora and 

Subplen. drobnjacensis, did not reveal close matches to other 


31


Table 2. Characteristics of ascospores, mitosporic state and pathogenicity of Leptosphaeria, Paraleptosphaeria, Plenodomus and 

Subplenodomus in vivo. 

Genus Ascospores Mitosporic state Pathogenicity 

Leptosphaeria Ascospores 3-septate, (dark) brown Mitosporic state common, pycnidial cell wall usually directly 

scleroplectenchymatous, conidia mostly aseptate 

Paraleptosphaeria 

Plenodomus 

Ascospores 3–5-septate, hyaline to 

yellow/brown 

Ascospores 3–7-septate, pale yellow 

to brown 

Mitosporic state rare, pycnidial cell wall directly scleroplectenchymatous, 

conidia aseptate 

Mitosporic state common, pycnidial cell wall initially 

pseudoparenchymatous, later scleroplectenchymatous, conidia aseptate 

Subplenodomus No known sexual state Mitosporic state common, pycnidial cell wall mainly 

pseudoparenchymatous, conidia aseptate 

Heterospora No known sexual state Mitosporic state common, pycnidial cell wall pseudoparenchymatous, 

conidia of two types: small aseptate and large septate 

Necrotrophic 

Necrotrophic 

Necrotrophic or plant pathogenic 

Necrotrophic or plant pathogenic 

Plant pathogenic 

teleomorphic or anamorphic genera. 

Plectophomella visci grouped in Plenodomus in this study 

and in the Leptosphaeriaceae in a previous molecular phylogeny 

of Phoma and allied anamorph genera (de Gruyter et al. 2009). 

Plectophomella visci is the type species of Plectophomella (Moesz 

1922) and three additional species have been described in 

the genus. Two species were described from the bark of Ulmus 

spp., viz. Plectophomella ulmi (basionym Dothiorella ulmi) and 

Plectophomella concentrica (Redfern & Sutton 1981). Dothiorella 

ulmi is considered the appropriate name for Plectophomella ulmi 

(Crous et al. 2004). A third species, Plectophomella nypae, was 

described from Nypa fruticans (Arecaceae) (Hyde & Sutton 1992). 

As a result of the transfer of the type species Plectophomella visci 

to Plenodomus, the taxonomy of both Plectophomella concentrica 

and P. nypae needs to be reconsidered based on the outcome of a 

molecular study. 

Plenodomus chrysanthemi could not be differentiated from 

Plen. tracheiphilus based on comparison of their LSU and ITS 

sequences. Plenodomus vasinfecta was proposed by Boerema et 

al. (1994) for the species originally described as Phoma tracheiphila 

f. sp. chrysanthemi (Baker et al. 1985). Because these are part 

of the Plenodomus clade the name Plenodomus chrysanthemi is 

proposed with P. tracheiphila f. sp. chrysanthemi and P. vasinfecta 

as synonyms. Plenodomus chrysanthemi and Plen. tracheiphilus 

are host specific (Chrysanthemum and Citrus, respectively) and the 

scleroplectenchymatous conidiomatal wall of Plen. tracheiphilus 

differentiates this species from Plen. chrysanthemi, where only 

a parenchymatous wall has been observed (Boerema et al. 

1994). The results of this molecular study and the production of a 

Phialophora synanamorph by both species demonstrate the close 

relationship of both taxa. 

Plenodomus enteroleucus and Plen. influorescens have a 

similar ecological niche as opportunistic pathogens on woody 

plants in Europe. Both taxa were formerly described as varieties 

of Ph. enteroleuca, vars. enteroleuca and influorescens, and could 

be differentiated only by the fluorescence of var. enteroleuca under 

black light. However, the molecular phylogeny demonstrates the 

two varieties are only distantly related and they are raised from 

varietal status to species rank. The close relation of Plen. wasabiae 

with Plen. biglobosus agrees with the results of a previous study on 

the production of Phomalignin A and other yellow pigments, as well 

as ITS sequence analyses (Pedras et al. 1995). 

Subplenodomus apiicola, Subplen. drobnjacensis, Subplen. 

valerianae and Subplen. violicola all produce pycnidia with 

an elongated neck, resembling Plenodomus. The pycnidial 

wall remains usually pseudoparenchymatous. Pycnidia with 

a scleroplectenchymatous wall are only observed in Subplen. 

drobnjacensis. Subplenodomus apiicolus, Subplen. drobnjacensis 

and Subplen. valerianae produce relatively small conidia, up to 

4.5 × 2 μm (de Gruyter & Noordeloos 1992) in congruence with 

many of the Plenodomus species described; however, in contrast 

Subplen. violicola produces relatively large conidia, up to 11 × 3 μm 

(Boerema 1993). 

The grouping of species of Phoma section Plenodomus based 

on the host being either herbaceous plants or wood of trees and 

shrubs (Boerema 1982, Boerema et al. 1994) is not supported 

by the molecular phylogeny. The grouping of the species into two 

categories based on the production of pseudoparenchymatous 

pycnidia that become scleroplectenchymatous pycnidia (type I), 

versus always scleroplectenchymatous pycnidia (type 2) (Boerema 

et al. 1981), is partly supported by the molecular phylogeny. 

In the Leptosphaeria clade most species directly develop 

scleroplectenchymatous pycnidia, whereas in the Plenodomus 

clade the pycnidia generally are pseudoparenchymatous and 

become scleroplectenchymatous. 

Heterospora is established for two species of Phoma sect. 

Heterospora that cluster in the Leptosphaeriaceae, viz H. 

chenopodii and H. dimorphospora. All other species of Phoma sect. 

Heterospora are in the Didymellaceae (Aveskamp et al. 2010). 

The Leptosphaeria doliolum species complex 

The taxonomy of the generic type species Leptosphaeria doliolum 

and Phoma anamorphs is complex with a number of subspecies 

and varieties described in literature. Leptosphaeria doliolum subsp. 

doliolum and L. doliolum subsp. errabunda are morphologically 

very similar, as well as the anamorphs Ph. acuta subsp. errabunda 

and Ph. acuta subsp. acuta. It has been suggested that both 

taxa represent originally American and European counterparts 

(Boerema et al. 1994). Both subspecies of L. doliolum proved to be 

closely related in a phylogenetic analysis utilising LSU and ITS. A 

detailed multilocus phylogenetic study including the ITS, ACT, TUB 

and CHS genes, however, demonstrated that both subspecies 

could be clearly differentiated, and represent two subclades in 

the L. doliolum complex. All species allied with L. doliolum and L. 

errabunda are necrotrophic species. Surprisingly, L. macrocapsa 

grouped with the L. errabunda isolates. Leptosphaeria macrocapsa 

is described as a host-specialised necrotroph on Mercurialis 

perennis (Euphorbiaceae) in Europe (Boerema et al. 1994). The 

species is characterised by large pycnidia (Grove, 1935), with a 

conspicuously broad, long cylindrical neck (Boerema et al. 1994). 

This is different to the sharply delimited papilla or neck of variable 

32


length of the pycnidia of L. errabunda. Leptosphaeria sydowii, a 

necrotroph on Senecio spp. in particular (Asteraceae), proved to 

be closely related to L. errabunda. It can be concluded that the 

Leptosphaeria doliolum complex includes several necrotrophic 

species, with adapted host specificity. 

The genus Coniothyrium 

Coniothyrium palmarum is the type species of the genus 

Coniothyrium. Coniothyrium is characterised by ostiolate pycnidial 

conidiomata, annellidic conidiogenous cells, the absence of 

conidiophores, and brown, thick-walled, 0- or 1-septate, verrucose 

conidia. Coniothyrium is similar morphologically to some species 

in the genus Microsphaeropsis. However, Microsphaeropsis is 

characterised by the production of phialidic conidiogenous cells 

with periclinal thickening, and thin-walled, pale greenish brown 

conidia. 

Coniothyrium, Microsphaeropsis and Paraconiothyrium clearly 

grouped in different clades in a study of the partial SSU nrDNA 

(Verkley et al. 2004). In a subsequent study utilising SSU and LSU 

sequences, the generic type species Microsphaeropsis olivacea 

grouped in Didymellaceae, whereas Coniothyrium palmarum 

clustered with the genus Leptosphaeria in Leptosphaeriaceae 

(de Gruyter et al. 2009). In the present study C. palmarum 

and its relatives grouped in a distinct clade, which represents 

Coniothyriaceae. Phoma carteri, Ph. glycinicola, Ph. septicidalis 

and Pyrenochaeta dolichi grouped in this clade and are transferred 

to the genus Coniothyrium. The inclusion of these species with 

setose pycnidia and conidiogenesis with elongated conidiophores 

expands the morphological circumscription of Coniothyrium. 

Species with those characters are also found in other genera 

treated in this paper in the Cucurbitariaceae, Didymellaceae, 

Phaeosphaeriaceae, Leptosphaeriaceae, Montagnulaceae and 

Sporormiaceae, indicating convergent evolution. 

The Coniothyrium species included here are plurivorous or soilborne, 

such as C. palmarum, C. septicidalis and C. multiporum, or 

are associated with a specific host such as C. carteri on Quercus 

spp. (Fagaceae), C. glycinicola on Glycine max (Fabaceae) and 

C. dolichii on Dolichos biflorus (Fabaceae). The species also are 

diverse geographically. 

Coniothyrium palmarum was frequently found associated 

with leaf spots on Phoenix dactylifera (Arecaceae) in India and 

Cyprus (Sutton 1980). The C. palmarum isolates regularly used 

in phylogenetic studies are CBS 758.73, from leaf spots on 

Phoenix dactylifera in Israel, and CBS 400.71, from a dead petiole 

of Chaemeropsis humulis (Arecaceae) in Italy. The subtropical 

distribution of these species is similar to that of the most closely 

allied C. dolichi and C. glycinicola. Coniothyrium multiporum, 

recorded from marine soil, also is found in warm regions. 

Coniothyium carteri, in contrast, is reported from North America 

and Europe. 

Coniothyrium dolichi produces setose pycnidia with hyaline 

conidia (Mohanty 1958). The conidiogenesis was studied in 

detail later. phoma-like ampulliform conidiogenous cells as well 

as conidiogenous cells on filiform, septate conidiophores were 

found in the same pycnidia leading to confusion regarding the 

classification of this species in Phoma or Pyrenochaeta (Grodona 

et al. 1997). This study clearly supports the classification in 

Coniothyrium. Coniothyrium glycinicola was originally placed 

in the genus Pyrenochaeta as Py. glycines due to its setose 

pycnidia (Stewart 1957). The conidiogenesis and hyaline 

conidia are phoma-like and therefore, it was reclassified as Ph. 

glycinicola in Phoma sect. Paraphoma (de Gruyter & Boerema 

2002). However, in the original description it was noted that the 

conidia were greenish-yellow in mass (Stewart 1957), resembling 

Microsphaeropsis or coniothyrium-like conidia. This study clearly 

supports the classification in Coniothyrium. Coniothyrium carteri 

produces setose pycnidia with hyaline conidia and therefore, the 

species was classified in Phoma section Paraphoma (de Gruyter & 

Boerema 2002). In spite of this similarity, C. carteri was determined 

to be only distantly related to the generic type species Paraphoma 

radicina (de Gruyter et al. 2010). Coniothyrium multiporum was 

described in Phoma section Phoma; however, it proved to be 

unrelated to Phoma in Didymellaceae (Aveskamp et al. 2010). The 

conidiogenesis may comprise elongated conidiophores (Pawar et 

al. 1967). Two isolates originally described as Ph. septicidalis are 

placed here in Coniothyrium telephii. Other strains deposited as 

Ph. septicidalis proved to be Pyrenochaeta unguis-hominis (de 

Gruyter et al. 2010). 

The anamorph of the genus Neophaeosphaeria was described 

as coniothyrium-like, producing pigmented, aseptate conidia 

from holoblastic, percurrently proliferating conidiogenous cells 

with conspicuous annellations (Câmara et al. 2003). Although 

Neophaeosphaeria is related to Coniothyrium based on the 

molecular data, Neophaeosphaeria probably belongs to a separate 

phylogenetic clade. The grouping of N. filamentosa with the 

Coniothyrium species included in this study was poorly supported 

and N. filamentosa proved to be more distantly related in previous 

molecular phylogenetic studies (Verkley et al. 2004, Damm et al. 

2008, de Gruyter et al. 2010). 

Both anamorph genera Cyclothyrium and Cytoplea were 

considered to be related to Coniothyrium and Microsphaeropsis 

(Sutton 1980) based on morphological similarities. Cyclothyrium 

also resembles Paraconiothyrium but produces conidiogenous cells 

that are more elongated than in most species of Paraconiothyrium 

and the conidia are almost truncate at the base, or at least 

they are much less rounded at the base than the conidia of 

Paraconiothyrium (Verkley et al. 2004). The generic type species 

Cyclothyrium juglandis, the anamorph of Thyridaria rubronotata, 

proved to be related to Roussoella hysterioides, teleomorph 

of Cytoplea (Verkley et al. 2004). Based on present results R. 

hysterioides could not be assigned to familial rank. The clustering 

of this species in Massariaceae (Zhang et al. 2009) could not be 

confirmed. Moreover, Roussoella probably is not a monophyletic 

genus (Tanaka et al. 2009). Thyridaria rubronotata, the teleomorph 

of Cyclothyrium juglandis, proved to be related to Massariosphaeria 

phaeospora but was not assigned to familial rank (Schoch et al. 

2009). 

Coniothyrium-like anamorphs also have been linked to 

Mycosphaerella in the past. However, these species were 

subsequently accommodated in Colletogloeopsis (Cortinas et al. 

2006), Readeriella/Kirramyces (Crous et al. 2007) and are now 

known to be species of Teratosphaeria (Crous et al. 2009b). 

The genus Pleospora 

Pleospora is a large genus in Pleosporaceae, Pleosporales, and 

includes important pathogens that occur on both monocotyledons 

and dicotyledons. Anamorphs of Pleospora s. lat. have been 

described in various genera of coelomycetes and hyphomycetes as 

summarised by Zhang et al. (2009, 2012). A delimitation of Pleospora 

into two sections, Pyrenophora and Eu-Pleospora was made based 


33


on the size of fruiting bodies and ascospore septation and colour 

(Munk 1957). The genus Pyrenophora (Drechslera anamorphs) 

is recognised at the generic rank. However, Pleospora remains 

heterogenous (Wehmeyer 1961, Berbee 1996) and molecular 

phylogenetic studies demonstrated that Pleospora is polyphyletic in 

Pleosporaceae (Kodsueb et al. 2006, Wang et al. 2007, Inderbitzin 

et al. 2009). Taxa with a Stemphylium anamorph such as Pleospora 

sedicola and Pleo. tomatonis, as well as Pleo. halophola with no 

known anamorph, are closely related to Cochliobolus, whereas 

Pleo. herbarum and Pleo. ambigua were more distantly related 

in the Pleosporaceae (Kodsueb et al. 2006, Wang et al. 2007). A 

phylogenetic study of the genus Massariosphaeria demonstrated 

the polyphyly in the genera Pleospora, Kirschsteiniothelia, 

Massarina, Melanomma, Trematosphaeria and Massariosphaeria 

in the Loculoascomycetes (Wang et al. 2007) and the paraphyletic 

character of the genus Cochliobolus was demonstrated (Kodsueb 

et al. 2006, Mugambi & Huhndorf 2009). These findings support 

the previous speculation by several authors that ascomatal and 

ascospore morphologies have undergone convergent evolution 

among Pleosporales (Wang et al. 2007). 

Pleospora betae groups ambiguously in Pleosporaceae (Dong 

et al. 1998). SSU nrDNA sequence data supported the affinity of 

P. betae to Leptosphaeriaceae. Partial LSU nrDNA data supported 

the affinity of P. betae to Pleosporaceae (Dong et al. 1998), but 

bootstrap support values in that study were low. In a multigene 

phylogenetic study Pleo. betae was found as being basal to 

Pleosporaceae (Zhang et al. 2009). Our results demonstrate the 

sister group relationship of Pleo. betae and its relatives to the 

generic type species Pleo. herbarum. 

Pleospora betae has been often confused with Pleo. 

calvescens as was discussed by Boerema et al. (1987). 

Both species are pathogens of Chenopodiaceae and are 

morphologically rather similar and therefore, a phylogenetic 

relation of both species was inferred (Boerema 1984). In addition 

Ascochyta hyalospora, originally found on the American continent 

on Chenopodiaceae, also was supposed to be closely related. 

Our results demonstrate that Pleo. betae and Pleo. calvescens 

could be recognised at species rank and confirmed that A. 

hyalospora is related supporting our transfer to Pleospora as 

Pleo. chenopodii. The delimitation of both halophytic species 

Pleo. chenopodii and Pleo. calvescens needs further study; both 

species could not be clearly differentiated based on the ACT 

sequences alone. Additional studies are underway to elucidate 

these species boundaries, in which also the recently described 

halophyte, Ascochyta manawaorae (Verkley et al. 2010), will 

be included. Pleospora fallens and Pleo. incompta, formerly 

described in Phoma sect. Phoma and producing mainly glabrous 

pycnidia, grouped in the Pleo. herbarum clade. Pleospora 

typhicola, producing pilose pycnidia, also grouped in this clade. 

Phoma-like species excluded from the Pleosporineae 

The genus Paraconiothyrium was introduced by Verkley et al. 

(2004) as the anamorph of Paraphaeosphaeria. The morphological 

characters of Paraconiothyrium are variable. The conidiomata can 

be eustromatic to pycnidial, the phialidic conidiogenous cells are 

discrete or integrated, and the thin-walled conidia are aseptate 

or septate, smooth-walled or minutely warted, and hyaline to 

brown in a later stage (Verkley et al. 2004). The morphological 

characters of Ph. lini and Asteromella tilliae, redisposed here in 

Paraconiothyrium, fit this description. 

Paraconiothyrium fuckelii is a serious plant pathogen of 

Rosaceae (Horst & Cloyd 2007), but it also is recorded as an 

opportunistic human pathogen as summarised by de Hoog et 

al. (2000). The teleomorph is currently known as Leptosphaeria 

coniothyrium, but this is not likely considering the phylogeny of 

Leptosphaeriaceae in Pleosporales (Fig 1). The species was also 

described as Melanomma coniothyrium (Holm 1957); however, 

Melanomma is more distantly related in Melanommataceae. 

Neottiosporina paspali proved to be related to Paraconiothyrium. 

However, this species is characterised by conidia with an 

apical appendage (Sutton 1980) and resembles members of 

Massarinaceae. Pyrenochaeta romeroi is redescribed in the new 

genus Medicopsis, and its taxonomic position is most close to 

Trematosphaeriaceae. 

Aposphaeria corallinolutea could be recognised as a 

new species in Melanommataceae. Phoma capitulum and 

Ph. minutispora (Phoma section Phoma) clustered in the 

Sporormiaceae, most closely related to the holotype isolate of 

Westerdykella ornata. Other phoma-like anamorphs have been 

recorded in Sporormiaceae, such as anamorphs of Sporormia 

aemulans (≡ Preussia aemulans) and Westerdykella dispersa 

(≡ Pycnidiophora dispersa) (von Arx & Storm 1967). The in vitro 

characters of W. capitulum and W. oryzae agree with the in vitro 

characters of phoma-like anamorphs in the Sporormiaceae 

summarised by Boerema et al. (2004). The conidia produced are 

small, mostly 2–3 × 1–2 μm, arising from undifferentiated cells, but 

sometimes also elongated conidiogenous cells are observed. The 

colonies, often with a pink-yellow-red discolouration on OA, usually 

produce little aerial mycelium, whereas pycnidia are often produced 

in abundance. No matching sequences were found in a blast search 

in GenBank using the partial LSU sequences of W. capitulum and 

W. minutispora. Westerdykella minutispora from India was most 

similar to a sequence of Westerdykella nigra, isolate CBS 416.72, 

obtained from soil in Pakistan, and W. capitulum was most similar 

to a sequence of W. dispersa, isolate CBS 297.56, obtained from 

a seedling of Phlox drummondii, USA. These blast results support 

the redisposition of both species in the genus Westerdykella. 

ACKNOWLEDGEMENTS 

This project, ”Strengthening the Plant Health Infrastructure”, was supported by The 

Dutch Ministry of Economic Affairs, Agriculture and Innovation. We thank Mrs Trix 

Merkx and Mrs Karin Rosendahl-Peters for providing the strains from the culture 

collection of CBS and PD respectively and for their assistance in the deposit of 

strains. Mrs Arien van Iperen kindly helped us with the deposit of herbarium material. 

Thanks are due to Marjan Vermaas for her assistance in preparing the photoplates. 

We are indebted to Machiel E. Noordeloos and the reviewers for critical reading of 

the manuscript. 

REFERENCES 

Aa HA van der, Kesteren HA van (1979). Some pycnidial fungi occurring on Atriplex 

and Chenopodium. Persoonia 10: 267–276. 

Arx JA von, Storm PK (1967). Über einige aus dem erdboden isolierte, zu Sporormia, 

Preussia und Westerdykella gehörende Ascomyceten. Persoonia 4: 407–415. 

Aveskamp MM, Gruyter J de, Crous PW (2008). Biology and recent developments in 

the systematics of Phoma, a complex genus of major quarantine significance. 

Fungal Diversity 31: 1–18. 

Aveskamp MM, Gruyter J de, Woudenberg JHC, Verkley GJM, Crous PW (2010). 

Highlights of the Didymellaceae: A polyphasic approach to characterise Phoma 

and related pleosporalean genera. Studies in Mycology 65: 1–60. 

Aveskamp MM, Verkley GJM, Gruyter J de, Murace MA, Perelló A, Woudenberg 

JHC, Groenewald JZ, Crous PW (2009). DNA phylogeny reveals polyphyly of 

34


Phoma section Peyronellaea and multiple taxonomic novelties. Mycologia 101: 

359–378. 

Badali H, Chander J, Gulati N, Attri A, Chopra R, Najafzadeh MJ, Chhabra S, Meis 

JFGM, Hoog GS de (2010). Subcutaneous phaeohyphomycotic cyst caused by 

Pyrenochaeta romeroi. Medical Biology 48: 763–768. 

Baker KF, Davis-Clark LH, Wilhelm S, Snyder WC (1985). An aggressive vascularinhabiting 

Phoma (Phoma tracheiphila f.sp. chrysanthemi nov. f. sp.) weakly 

pathogenic to Chrysanthemum. Canadian Journal of Botany 63: 1730–1735. 

Berbee ML (1996). Loculoascomycete origins and evolution of filamentous 

Ascomycete morphology based on 18s rRNA gene sequence data. Molecular 

Biology and Evollution 13: 462–470. 

Boerema GH (1970). Additional notes on Phoma herbarum. Persoonia 6: 15–48. 

Boerema GH (1982). Phoma-soorten van de sectie Plenodomus. Verslagen en 

Mededelingen Plantenziektenkundige Dienst Wageningen 158 (Jaarboek 

1981): 28–30. 

Boerema GH (1984). Mycologisch-taxonomisch onderzoek. Ascochyta’s met 

lichtbruine conidien die pathogen zijn voor Chenopodiaceae. Verslagen en 

Mededelingen Plantenziektenkundige Dienst Wageningen 162 (Jaarboek 

1983): 31–34. 

Boerema GH (1993). Contributions towards a monograph of Phoma (Coelomycetes) 

– II. Section Peyronellaea. Persoonia 15: 197–221. 

Boerema GH (1997). Contributions towards a monograph of Phoma (Coelomycetes) 

– V. Subdivision of the genus in sections. Mycotaxon 64: 321–333. 

Boerema GH and Coworkers (1993). Check-list for scientific names of common 

parasitic fungi. Libri botanici; Vol. 10. IHW-Verlag, Eching. 

Boerema GH, Gams W (1995). What is Sphaeria acuta Hoffm. : Fr.? Mycotaxon 

53: 355–360. 

Boerema GH, Gruyter J de (1998). Contributions towards a monograph of Phoma 

(Coelomycetes) – VII. Section Sclerophomella: Taxa with thick-walled 

pseudoparenchymatous pycnidia. Persoonia 17: 81–95. 

Boerema GH, Gruyter J de (1999). Contributions towards a monograph of Phoma 

(Coelomycetes) – III-Supplement: Additional species of section Plenodomus. 

Persoonia 17: 273–280. 

Boerema GH, Gruyter J de, Kesteren HA van (1994). Contributions towards a 

monograph of Phoma (Coelomycetes) – III-1. Section Plenodomus: Taxa often 

with a Leptosphaeria teleomorph. Persoonia 15: 431–487. 

Boerema GH, Gruyter J de, Noordeloos ME (1997). Contributions towards a 

monograph of Phoma (Coelomycetes) – IV. Section Heterospora: Taxa 

with large sized conidial dimorphs, in vivo sometimes as Stagonosporopsis 

synanamorphs. Persoonia 16: 335–371. 

Boerema GH, Gruyter J de, Noordeloos ME, Hamers MEC (2004). Phoma 

identification manual. Differentiation of specific and infra-specific taxa in 

culture. CABI Publishing, Wallingford, UK. 

Boerema GH, Kesteren HA van (1964). The nomenclature of two fungi parasitizing 

Brassica. Persoonia 3: 17–28. 

Boerema GH, Kesteren HA van, Loerakker WM (1981). Notes on Phoma. 

Transactions of the British Mycological Society 77: 61–74. 

Boerema GH, Loerakker WM (1985). Notes on Phoma 2. Transactions of the British 

Mycological Society 84: 289–302. 

Boerema GH, Loerakker WM, Hamers MEC (1987). Check-list for scientific names 

of common parasitic fungi. Supplement Series 2a (additions and corrections): 

Fungi on field crops: beet and potato; caraway, flax and oilseed poppy. 

Netherlands Journal of Plant Pathology 93, Suppl. 1: 1–20. 

Boerema GH, Loerakker WM, Hamers MEC (1996). Contributions towards a 

monograph of Phoma (Coelomycetes) – III-2. Misapplications of the type 

species-name and the generic synonyms of section Plenodomus (Excluded 

species). Persoonia 16: 141–190. 

Butin H, Kehr R (1995). Leaf blotch of lime associated with Asteromella tiliae comb. 

nov. and the latter’s connection to Didymosphaeria petrakiana. Mycological 

Research 99: 1191–1194. 

Câmara MPS, Palm ME, Berkum P van, O’Neill NR (2002). Molecular phylogeny of 

Leptosphaeria and Phaeosphaeria. Mycologia 94: 630–640. 

Câmara MPS, Ramaley AW, Castlebury LA, Palm ME (2003). Neophaeosphaeria 

and Phaeosphaeriopsis, segregates of Paraphaeosphaeria. Mycological 

Research 107: 516–522. 

Carbone I, Kohn LM (1999). A method for designing primer sets for speciation 

studies in filamentous ascomycetes. Mycologia 91: 553–556. 

Chaverri P, Salgado C, Hirooka Y, Rossman AY, Samuels GJ (2011). Delimitation of 

Neonectria and Cylindrocarpon (Nectriaceae, Hypocreales, Ascomycota) and 

related genera with Cylindrocarpon-like anamorphs. Studies in Mycology 68: 

57–78. 

Chen C-Y, David JC, Hsieh WH (2002). Leptosphaeria dryadis. IMI Descriptions of 

Fungi and Bacteria 154, Sheet 1533. CABI Bioscience, Egham, Surrey, UK. 

Chesters CGC (1938). Studies on British pyrenomycetes II. A comparative study of 

Melanomma pulvis-pyrius (Pers.) Fuckel, Melanomma fuscidulum Sacc. and 

Thyridaria rubro-notata (B. & Br.) Sacc. Transactions of the British Mycological 

Society 22: 116–150. 

Cortinas MN, Burgess T, Dell B, Xu DP, Crous PW, Wingfield BD, Wingfield MJ 

(2006). First record of Colletogloeopsis zuluense comb. nov., causing a stem 

canker of Eucalyptus in China. Mycological Research 110: 229–236. 

Crane, JL, Shearer CA (1991). A nomenclator of Leptosphaeria V. Cesati & G. de 

Notaris (Mycota-Ascomycotina-Loculoascomycetes). Illinois Natural history 

Survey Bulletin 34: 195–355. 

Crous PW, Braun U, Groenewald JZ (2007). Mycosphaerella is polyphyletic. Studies 

in Mycology 58: 1–32. 

Crous PW, Gams W, Stalpers JA, Robert V, Stegehuis G (2004). MycoBank: an 

online initiative to launch mycology into the 21st century. Studies in Mycology 

50: 19–22. 

Crous PW, Schoch CL, Hyde KD, Wood AR, Gueidan C (2009a). Phylogenetic 

lineages in the Capnodiales. Studies in Mycology 64: 17–47. 

Crous PW, Slippers B, Wingfield MJ, Rheeder J, Marasas WOF, Phillips AJL, Alves 

A, Burgess T, Barber P, Groenewald JZ (2006). Phylogenetic lineages in the 

Botryosphaeriaceae. Studies in Mycology 55: 235–253. 

Crous PW, Summerell BA, Carnegie AJ, Wingfield MJ, Hunter GC, Burgess TI, 

Andijc V, Barber PA, Groenewald JZ (2009b). Unravelling Mycosphaerella: do 

you believe in genera? Persoonia 23: 99–118. 

Crous PW, Verkley GJM, Groenewald JZ, Samson RA (2009c). Fungal Biodiversity. 

CBS Laboratory Manual Series. Centraalbureau voor Schimmelcultures, 

Utrecht, Netherlands. 

Damm U, Verkley GJM, Crous PW, Fourie PH, Haegi A, Riccioni L (2008). Novel 

Paraconiothyrium species on stone fruit trees and other woody hosts. 

Persoonia 20: 9–17. 

Dong J, Chen W, Crane JL (1998). Phylogenetic studies of the Leptosphaeriaceae, 

Pleosporaceae and some other Loculoascomycetes based on nuclear 

ribosomal DNA sequences. Mycological Research 102: 151–156. 

Dooly DP, Beckius ML, Jeffery BS, McAllister CK, Radentz WH, Feldman AR, 

Rinaldi MG, Bailey SR, Keeling JH (1989). Phaeohyphomycotic cutaneous 

disease caused by Pleurophoma in a cardiac transplant patient. The Journal of 

Infectious Diseases 159: 503–507. 

Eriksson OE, Hawksworth DL (2003). Saccharicola, a new genus for two 

Leptosphaeria species on sugar cane. Mycologia 95: 426–433. 

Fitt BDL, Brun H, Barbetti MJ, Rimmer SR (2006). World-wide importance of phoma 

stem canker (Leptosphaeria maculans and L. biglobosa) on oilseed rape 

(Brassica napus). European Journal of Plant Pathology 114: 3–15. 

Gräfenhan T, Schroers H-J, Nirenberg HI, Seifert KA (2011). An overview of the 

taxonomy, phylogeny, and typification of nectriaceous fungi in Cosmospora, 

Acremonium, Fusarium, Stilbella, and Volutella. Studies in Mycology 68: 79–113. 

Grondona I, Monte E, Garcia-Acha I, Sutton B (1997). Pyrenochaeta dolichi: an 

example of a confusing species. Mycological Research 101: 1404–1408. 

Grove WB (1935). British stem- and leaf-fungi (Coelomycetes) Vol. 1 

Sphaeropsidales. Cambridge, UK. Cambridge University Press. 

Gruyter J de, Aveskamp MM, Woudenberg JHC, Verkley GJM, Groenewald JZ, 

Crous PW (2009). Molecular phylogeny of Phoma and allied anamorph genera: 

towards a reclassification of the Phoma complex. Mycological Research 113: 

508–519. 

Gruyter J de, Boerema GH (2002). Contributions towards a monograph of Phoma 

(Coelomycetes) – VIII. Section Paraphoma: Taxa with setose pycnidia. 

Persoonia 17 (“2001”): 541–561. 

Gruyter J de, Boerema GH, Aa HA van der (2002). Contributions towards a 

monograph of Phoma (Coelomycetes) – VI-2. Section Phyllostictoides: Outline 

of its taxa. Persoonia 18: 1–53. 

Gruyter J de, Noordeloos ME (1992). Contributions towards a monograph of Phoma 

(Coelomycetes) – I-1. Section Phoma: Taxa with very small conidia in vitro. 


Gruyter J de, Noordeloos ME, Boerema GH (1993). Contributions towards a 

monograph of Phoma (Coelomycetes) – I-2. Section Phoma: Additional taxa 

with very small conidia and taxa with conidia up to 7 mm long. Persoonia 15: 

369–400. 

Gruyter J de, Noordeloos ME, Boerema GH (1998). Contributions towards a 

monograph of Phoma (Coelomycetes) – I-3. Section Phoma: Taxa with conidia 

longer than 7 mm. Persoonia 16: 471–490. 

Gruyter J de, Woudenberg JHC, Aveskamp MM, Verkley GJM, Groenewald JZ, 

Crous PW (2010). Systematic reappraisal of species in Phoma section 

Paraphoma, Pyrenochaeta and Pleurophoma. Mycologia 102: 1066–1081. 

Hawksworth DL, Crous PW, Redhead SA, Reynolds DR, Samson RA,, et al. (2011). 

The Amsterdam declaration on fungal nomenclature. IMA Fungus 2: 105–112. 

Höhnel F von (1911). Fragmente zur Mykologie XIII (713): Über Leptosphaeria 

maculans (Desm.) und Sphaeria lingam Tode. Sitzungsberichte der Kaiserlichen 

Akademie der Wissenschaften in Wien. (Mathematisch-naturwissenschaftliche 

Klasse (Abteilung I) 120: 458–463. 

Höhnel F von (1914). Fragmente zur Mykologie XVI. (XVI. Mitteilung, Nr. 813 

bis 875). Sitzungsberichte der Kaiserlichen Akademie der Wissenschaften 

in Wien. (Mathematisch-naturwissenschaftliche Klasse (Abteilung I) 123: 

49–155. 


35


Holm L (1957). Études taxonomiques sur les Pléosporacées. Symbolae Botanicae 

Upsalienses 14: 5–188. 

Hoog GS de, Gerrits van den Ende AHG (1998). Molecular diagnostics of clinical 

strains of filamentous Basidiomycetes. Mycoses 41: 183–189. 

Hoog GS de, Guarro J, Gené J, Figueras MJ (2000). Atlas of Clinical Fungi. 2nd 

edition. Centraalbureau voor Schimmelcultures, Utrecht, Netherlands. 

Horst RK, Cloyd R (2007). Compendium of rose diseases and pests. 2nd edition. 

APS press, MN, USA. 

Huang YJ, Fitt BDL, Jedryczka M, Dakowska S, West JS, Gladders P, Steed JM, 

Li ZQ (2005). Patterns of ascospore release in relation to phoma stem canker 

epidemiology in England (Leptosphaeria maculans) and Poland (L. biglobosa). 

European Journal of Plant Pathology 111: 263–277. 

Huelsenbeck JP, Ronquist F (2001). MRBAYES: Bayesian inference of phylogenetic 

trees. Bioinformatics 17: 754–755. 

Hyde KD, Sutton BC (1992). Nypaella frondicola gen. et sp. nov., Plectophomella 

nypae sp. nov. and Pleurophomopsis nypae sp. nov. (Coelomycetes) from 

intertidal fronds of Nypa fruticans. Mycological Research 96: 210–214. 

Inderbitzin P, Mehta YR, Berbee ML (2009). Pleospora species with Stemphylium 

anamorphs: a four locus phylogeny resolves new lineages yet does not 

distinguish among species in the Pleospora herbarum clade. Mycologia 101: 

329–339. 

Jasalavic CA, Morales VM, Pelscher LE, Seguin-Swartz G (1995). Comparison 

of nuclear ribosomal DNA sequences from Alternaria species pathogenic to 

crucifers. Mycological Research 99: 604–614. 

Jedryczka M, Fitt BDL, Kachlicki P, Lewartowska E, Balesdent MH, Rouxel T (1999). 

Comparison between Polish and United Kingdom populations of Leptosphaeria 

maculans, cause of stem canker of winter oilseed rape. Zeitschrift für 

Pflanzenkrankheiten und Pflanzenschutz 106: 608–617. 

Khashnobish A, Shearer CA, Crane JL (1995). Reexamination of species of 

Leptosphaeria on asteraceous hosts. Mycotaxon 54: 91–106. 

Kodsueb R, Dhanasekaran V, Aptroot A, Lumyong S, McKenzie EHC, et al. (2006). The 

family Pleosporaceae: intergeneric relationships and phylogenetic perspectives 

based on sequence analyses of partial 28SrDNA. Mycologia 98: 571–583. 

Lombard L, Crous PW, Wingfield BD, Wingfield MJ (2010a). Species concepts in 

Calonectria (Cylindrocladium). Studies in Mycology 66: 1–13. 

Lombard L, Crous PW, Wingfield BD, Wingfield MJ (2010b). Multigene phylogeny and 

mating tests reveal three cryptic species related to Calonectria pauciramosa. 


Lombard L, Crous PW, Wingfield BD, Wingfield MJ (2010c). Phylogeny and 

systematics of the genus Calonectria. Studies in Mycology 66: 31–69. 

Mendes-Pereira E, Balesdent MH, Brun H, Rouxel T (2003). Molecular phylogeny 

of the Leptosphaeria maculans - L. biglobosa species complex. Mycological 

Research 107: 1287–1304. 

Moesz G (1922). Mycologiai közlemények V. (Mykologische Mitteilungen V.). 

Magyar Botanikai Lapok 21: 5–16. 

Mohanty NN (1958). An undescribed species of Pyrenochaeta on Dolichos biflorus 

Linn. Indian Phytopathology 8: 85–87. 

Morales VM, Jasalavich CA, Pelcher LE, Petrie GA, Taylor JL (1995). Phylogenetic 

relationship among several Leptosphaeria species based on their ribosomal 

DNA sequences. Mycological Research 99: 593–603. 

Mugambi GK, Huhndorf SM (2009). Molecular phylogenetics of Pleosporales: 

Melanommataceae and Lophiostomataceae re-circumscribed 

(Pleosporomycetidae, Dothideomycetes, Ascomycota). Studies in Mycology 

64: 103–121. 

Müller E (1950). Die schweizerischen arten der gattung Leptosphaeria und 

ihrer verwandten. Sydowia, Annales Mycologici editi in Notitiam Scientiae 

Mycologicae Universalis. Horn, Austria 4: 185–319. 

Müller E, Arx JA von (1950). Einige aspecte zur systematik pseudosphärialer 

Ascomyceten. Berichte der Schweizerichen Botanischen Gesellschaft 21: 

329–397. 

Munk A (1957). Danish Pyrenomycetes: a preliminary flora. Dansk botanisk Arkiv 17, 

Dansk Botanisk Forening. Ejnar Munksgaard, Copenhagen, Denmark. 

Page RDM (1996). Treeview: An application to display phylogenetic trees on 

personal computers. Computer Applications in the Biosciences 12: 357–358. 

Pawar, VH, Mathur, PN, Thirumalachar MJ (1967). Species of Phoma isolated 

from marine soils in India. Transactions of the British Mycological Society 50: 

259–265. 

Pedras MSC, Taylor JL, Morales VM (1995). Phomaligin A and other yellow pigments 

in Phoma lingam and P. wasabiae. Phytochemistry 38: 1215–1222. 

Phillips AJL, Alves A, Pennycook SR, Johnston PR, Ramaley A, et al. (2008). 

Resolving the phylogenetic and taxonomic status of dark-spored teleomorph 

genera in the Botryosphaeriaceae. Persoonia 21: 29–55. 

Redfern DB, Sutton BC (1981). Canker and dieback of Ulmus glabra caused by 

Plectophomella concentrica, and its relationship to P. ulmi. Transactions of the 

British Mycological Society 77: 381–390. 

Rehner SA, Samuels GJ (1994). Taxonomy and phylogeny of Gliocladium analysed 

from nuclear large subunit ribosomal DNA sequences. Mycological Research 

98: 625–634. 

Schoch CL, Crous PW, Groenewald JZ, Boehm EWA, Burgess TI (2009). A classwide 

phylogenetic assessment of Dothideomycetes. Studies in Mycology 64: 

1–15. 

Schroers H-J, Gräfenhan T, Nirenberg HI, Seifert KA (2011). A revision of 

Cyanonectria and Geejayessia gen. nov., and related species with Fusariumlike 

anamorphs. Studies in Mycology 68: 115–138. 

Shoemaker RA, Brun H (2001). The teleomorph of the weakly aggressive segregate 

of Leptosphaeria maculans. Canadian Journal of Botany 79: 412–419. 

Shoemaker RA, Redhead SA (1999). Proposals to conserve the names of four 

species of fungi (Phoma betae, Helminthosporium avenae, Pyrenophora 

avenae and Pleospora tritici-repentis) against competing earlier synonyms. 

Taxon 48: 381–384. 

Sivanesan A (1984). The Bitunicate Ascomycetes and their Anamorphs. J. Cramer, 

Vaduz, Liechtenstein. 

Stewart RB (1957). An undescribed species of Pyrenochaeta on soybean. Mycologia 

49: 115–117. 

Suetrong S, Schoch CL, Spatafora JW, Kohlmeyer J, Volkmann-Kohlmeyer B 

(2009). Molecular systematics of the marine Dothideomycetes. Studies in 

Mycology 64: 155–173. 

Sutton BC (1980). The Coelomycetes. Fungi Imperfecti with Pycnidia, Acervuli and 

Stromata. CMI, Kew, UK. 

Swofford DL (2003). PAUP*: Phylogenetic analysis using parsimony (*and other 

methods), version 4.0b10. Sinauer Associates, Sunderland, Massachusetts. 

Tanaka K, Hirayama K, Yonezawa H, Hatakeyama S, Harada Y, Sano T, 

Shirouzu T, Hosoya T (2009). Molecular taxonomy of bambusicolous fungi: 

Tetraplosphaeriaceae, a new pleosporalean family with Tetraploa-like 

anamorphs. Studies in Mycology 64: 175–209. 

Verkley GJM, Silva M da, Wicklow DT, Crous PW (2004). Paraconiothyrium, a new 

genus to accommodate the mycoparasite Coniothyrium minitans, anamorphs of 

Paraphaeosphaeria, and four new species. Studies in Mycology 50: 323–335. 

Verkley GJM, Woudenberg JHC, Gruyter J de (2010). Ascochyta manawaorae 

Verkley, Woudenberg & de Gruyter, sp. nov. Persoonia 24: 128–129. 

Vilgalys R, Hester M (1990). Rapid genetic identification and mapping of 

enzymatically amplified ribosomal DNA from several Cryptococcus species. 

Journal of Bacteriology 172: 4238–4246. 

Vincenot L, Balesdent MH, Li H, Barbetti MJ, Sivasithamparam K, Gout L, Rouxel T 

(2008). Occurrence of a new subclade of Leptosphaeria biglobosa in Western 

Australia. Phytopathology 98: 321–329. 

Wang HK, Aptroot A, Crous PW, Hyde KD, Jeewon R (2007). The polyphyletic 

nature of Pleosporales: an example from Massariosphaeria based on rDNA 

and RBP2 gene phylogenies. Mycological Research 111: 1268–1276. 

Wehmeyer LE (1946). Studies on some fungi of northwestern Wyoming. III. 

Pleospora and Leptosphaeria. Lloydia. A quarterly Journal of Biological 

Science, Manasha 9: 203–240. 

Wehmeyer LE (1961). A world monograph of the genus Pleospora and its 

segregates. Univ. Michigan Press, USA. 

West JS, Balesdent MH, Rouxel T, Narcy JP, Huang YJ (2002). Colonization of 

winter oilseed rape tissues by A/Tox+ and B/Tox0 Leptosphaeria maculans 

(phoma stem canker) in France and England. Plant Pathology 51: 311–321. 

West JS, Kharbanda PD, Barbetti MJ, Fitt BDL (2001). Epidemiology and 

management of Leptosphaeria maculans (phoma stem canker) on oilseed rape 

in Australia, Canada and Europe. Plant Pathology 50: 10–27. 

White TJ, Bruns T, Lee S, Taylor J (1990). Amplification and direct sequencing of 

fungal ribosomal RNA genes for phylogenetics. In: PCR protocols: a guide to 

methods and applications. Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. 

Academic press, San Diego, CA, USA: 315–322. 

Woudenberg JHC, Aveskamp MM, Gruyter J de, Spiers AG, Crous PW (2009). 

Multiple Didymella teleomorphs are linked to the Phoma clematidina 

morphotype. Persoonia 22: 56–62. 

Wunsch MJ, Bergstrom GC (2011). Genetic and morphological evidence that 

Phoma sclerotioides, causal agent of brown root rot of alfalfa, is composed of a 

species complex. Phytopathology 101: 594–610. 

Yáňez-Morales M de J, Korf RP, Babcock JF (1998). Fungi on Epifagus 

(Orobanchaceae) – I. On Sclerotium orobanches and its Phoma synanamorph. 

Mycotaxon 67: 275–286. 

Zhang Y, Crous PW, Schoch CL, Hyde KD (2012). Pleosporales. Fungal Diversity 

53: 1–221. 

Zhang Y, Fournier J, Pointing SB, Hyde KD (2008). Are Melanomma pulvis-pyrius 

and Trematosphaeria pertusa congeneric? Fungal Diversity 33: 47–60. 

Zhang Y, Schoch CL, Fournier J, Crous PW, Gruyter J de (2009). Multi-locus 

phylogeny of the Pleosporales: a taxonomic, ecological and evolutionary 

reevaluation. Studies in Mycology 64: 85–102. 

36



Phylogenetic lineages in Pseudocercospora 

P.W. Crous 1,2,3* , U. Braun 4 , G.C. Hunter 1,5,6 , M.J. Wingfield 5 , G.J.M. Verkley 1 , H.-D. Shin 7 , C. Nakashima 8 , and J.Z. Groenewald 1 

1 

CBS-KNAW Fungal Biodiversity Centre, Uppsalalaan 8, 3584 CT, Utrecht, the Netherlands; 2 Microbiology, Department of Biology, Utrecht University, Padualaan 8, 3584 CH 

Utrecht, the Netherlands; 3 Wageningen University and Research Centre (WUR), Laboratory of Phytopathology, Droevendaalsesteeg 1, 6708 PB Wageningen, The Netherlands; 

4 

Martin-Luther-Universität, FB. Biologie, Institut für Geobotanik und Botanischer Garten, Neuwerk 21, D-06099 Halle (Saale), Germany; 

5 

Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, Pretoria 0002, South Africa; 6 Present address: Forest Research, Alice Holt Lodge, Farnham, 

Surrey GU10 4LH, UK; 7 Division of Environmental Science and Ecological Engineering, Korea University, Seoul 136-701, Korea; 8 Laboratory of Plant Pathology, Graduate 

School of Bioresources, Mie University, Kurima-Machiya 1577, Tsu 514-8507, Japan 

*Correspondence: P.W. Crous, p.crous@cbs.knaw.nl 

Abstract: Pseudocercospora is a large cosmopolitan genus of plant pathogenic fungi that are commonly associated with leaf and fruit spots as well as blights on a wide range 

of plant hosts. They occur in arid as well as wet environments and in a wide range of climates including cool temperate, sub-tropical and tropical regions. Pseudocercospora 

is now treated as a genus in its own right, although formerly recognised as either an anamorphic state of Mycosphaerella or having mycosphaerella-like teleomorphs. The aim 

of this study was to sequence the partial 28S nuclear ribosomal RNA gene of a selected set of isolates to resolve phylogenetic generic limits within the Pseudocercospora 

complex. From these data, 14 clades are recognised, six of which cluster in Mycosphaerellaceae. Pseudocercospora s. str. represents a distinct clade, sister to Passalora 

eucalypti, and a clade representing the genera Scolecostigmina, Trochophora and Pallidocercospora gen. nov., taxa formerly accommodated in the Mycosphaerella heimii 

complex and characterised by smooth, pale brown conidia, as well as the formation of red crystals in agar media. Other clades in Mycosphaerellaceae include Sonderhenia, 

Microcyclosporella, and Paracercospora. Pseudocercosporella resides in a large clade along with Phloeospora, Miuraea, Cercospora and Septoria. Additional clades represent 

Dissoconiaceae, Teratosphaeriaceae, Cladosporiaceae, and the genera Xenostigmina, Strelitziana, Cyphellophora and Thedgonia. The genus Phaeomycocentrospora is 

introduced to accommodate Mycocentrospora cantuariensis, primarily distinguished from Pseudocercospora based on its hyaline hyphae, broad conidiogenous loci and hila. 

Host specificity was considered for 146 species of Pseudocercospora occurring on 115 host genera from 33 countries. Partial nucleotide sequence data for three gene loci, ITS, 

EF-1α, and ACT suggest that the majority of these species are host specific. Species identified on the basis of host, symptomatology and general morphology, within the same 

geographic region, frequently differed phylogenetically, indicating that the application of European and American names to Asian taxa, and vice versa, was often not warranted. 


Key words: Capnodiales, Cercospora, cercosporoid, Mycosphaerella, Mycosphaerellaceae, Paracercospora, Pseudocercosporella, Multi-Locus Sequence Typing (MLST), 

systematics. 

Taxonomic novelties: New genera - Pallidocercospora Crous, Phaeomycocentrospora Crous, H.D. Shin & U. Braun; New species - Cercospora eucommiae Crous, U. Braun 

& H.D. Shin, Microcyclospora quercina Crous & Verkley, Pseudocercospora ampelopsis Crous, U. Braun & H.D. Shin, Pseudocercospora cercidicola Crous, U. Braun & C. 

Nakash., Pseudocercospora crispans G.C. Hunter & Crous, Pseudocercospora crocea Crous, U. Braun, G.C. Hunter & H.D. Shin, Pseudocercospora haiweiensis Crous & X. 

Zhou, Pseudocercospora humulicola Crous, U. Braun & H.D. Shin, Pseudocercospora marginalis G.C. Hunter, Crous, U. Braun & H.D. Shin, Pseudocercospora ocimi-basilici 

Crous, M.E. Palm & U. Braun, Pseudocercospora plectranthi G.C. Hunter, Crous, U. Braun & H.D. Shin, Pseudocercospora proteae Crous, Pseudocercospora pseudostigminaplatani 

Crous, U. Braun & H.D. Shin, Pseudocercospora pyracanthigena Crous, U. Braun & H.D. Shin, Pseudocercospora ravenalicola G.C. Hunter & Crous, Pseudocercospora 

rhamnellae G.C. Hunter, H.D. Shin, U. Braun & Crous, Pseudocercospora rhododendri-indici Crous, U. Braun & H.D. Shin, Pseudocercospora tibouchinigena Crous & U. 

Braun, Pseudocercospora xanthocercidis Crous, U. Braun & A. Wood, Pseudocercosporella koreana Crous, U. Braun & H.D. Shin; New combinations - Pallidocercospora 

acaciigena (Crous & M.J. Wingf.) Crous & M.J. Wingf., Pallidocercospora crystallina (Crous & M.J. Wingf.) Crous & M.J. Wingf., Pallidocercospora heimii (Crous) Crous, 

Pallidocercospora heimioides (Crous & M.J. Wingf.) Crous & M.J. Wingf., Pallidocercospora holualoana (Crous, Joanne E. Taylor & M.E. Palm) Crous, Pallidocercospora 

konae (Crous, Joanne E. Taylor & M.E. Palm) Crous, Pallidoocercospora irregulariramosa (Crous & M.J. Wingf.) Crous & M.J. Wingf., Phaeomycocentrospora cantuariensis 

(E.S. Salmon & Wormald) Crous, H.D. Shin & U. Braun, Pseudocercospora hakeae (U. Braun & Crous) U. Braun & Crous, Pseudocercospora leucadendri (Cooke) U. Braun & 

Crous, Pseudocercospora snelliana (Reichert) U. Braun, H.D. Shin, C. Nakash. & Crous, Pseudocercosporella chaenomelis (Y. Suto) C. Nakash., Crous, U. Braun & H.D. Shin; 

Typifications: Epitypifications - Pseudocercospora angolensis (T. Carvalho & O. Mendes) Crous & U. Braun, Pseudocercospora araliae (Henn.) Deighton, Pseudocercospora 

cercidis-chinensis H.D. Shin & U. Braun, Pseudocercospora corylopsidis (Togashi & Katsuki) C. Nakash. & Tak. Kobay., Pseudocercospora dovyalidis (Chupp & Doidge) 

Deighton, Pseudocercospora fukuokaensis (Chupp) X.J. Liu & Y.L. Guo, Pseudocercospora humuli (Hori) Y.L. Guo & X.J. Liu, Pseudocercospora kiggelariae (Syd.) Crous & 

U. Braun, Pseudocercospora lyoniae (Katsuki & Tak. Kobay.) Deighton, Pseudocercospora lythri H.D. Shin & U. Braun, Pseudocercospora sambucigena U. Braun, Crous & 

K. Schub., Pseudocercospora stephanandrae (Tak. Kobay. & H. Horie) C. Nakash. & Tak. Kobay., Pseudocercospora viburnigena U. Braun & Crous, Pseudocercosporella 

chaenomelis (Y. Suto) C. Nakash., Crous, U. Braun & H.D. Shin, Xenostigmina zilleri (A. Funk) Crous; Lectotypification - Pseudocercospora ocimicola (Petr. & Cif.) Deighton; 

Neotypifications - Pseudocercospora kiggelariae (Syd.) Crous & U. Braun, Pseudocercospora lonicericola (W. Yamam.) Deighton, Pseudocercospora zelkovae (Hori) X.J. Liu 

& Y.L. Guo. 


INTRODUCTION 

Until recently, Pseudocercospora was treated as an anamorphic 

genus linked to Mycosphaerella (Mycosphaerellaceae, 

Capnodiales), along with approximately 30 other anamorphic 


genera (Crous 2009). The separation of the Mycosphaerella 

complex into families (Crous et al. 2007a, 2009b) and genera (Crous 

et al. 2009c) based on DNA sequence data and morphology had 

substantial implications for Pseudocercospora. Pseudocercospora 

is now recognised as a holomorphic genus in its own right, several 


Attribution: 






37

Crous et al. 

species of which have mycosphaerella-like teleomorphs, for 

example, Pseudocercospora fijiensis and its mycosphaerella-like 

teleomorph that cause black leaf streak of banana (Arzanlou et 

al. 2008). The name Mycosphaerella is restricted to species with 

Ramularia anamorphs (Verkley et al. 2004, Crous et al. 2009c, 

Koike et al. 2011), with Ramularia being an older name than 

Mycosphaerella. A single generic name is now used for species 

of Pseudocercospora (Hawksworth et al. 2011, Wingfield et al. 

2011), in compliance with the recently accepted changes to the 

International Code of Nomenclature for algae, fungi and plants 

(ICN) adoped during the Botanical Congress in Sydney in 2011, in 

particular, the abolishment of Article 59 dealing with pleomorphic 

fungi. 

Species of Pseudocercospora are well recognised as plant 

pathogens, endophytes or saprobes, with some used as biological 

control agents of weeds (Den Breeÿen et al. 2006). They occur on 

a large number of plants, many of which are important ornamentals 

or food crops including fruits, cereals and commercially propagated 

forest trees (Fig. 1). An early hypothesis was that the majority of 

Pseudocercospora species were strictly host specific. Later studies 

have reported that a few species occur on different hosts belonging 

to a single plant family (Deighton 1976, 1979), although DNA data 

or inoculation studies to support wider host ranges has often been 

lacking. 

The classic monograph of the hyphomycete genus Cercospora 

(Chupp 1954) considered morphological features, including the 

structure of conidiomata as well as conidial pigmentation, septation, 

wall thickness, length, width, and shape as valuable features 

to define species within the genus. Chupp’s circumscription of 

Cercospora was rather broadly defined, and the genus was later 

shown to be extremely heterogenous (Deighton 1976). Deighton 

(1976) distinguished different groups within Cercospora based on 

characters such as superficial mycelium (and the texture thereof), 

conidial scar type, conidiophore and conidium pigmentation, 

septation, and conidial catenulation. These additional features 

resulted in many Cercospora species being transferred to several 

alternative genera such as Cercosporella, Mycocentrospora, 

Mycovellosiella, Phaeoramularia, Paracercospora, Passalora, 

Pseudocercospora, Ramularia, Stenella and Stigmina (Deighton 

1971, 1976, 1979, 1987, Braun 1995, 1998). A subsequent 

morphological treatment of names published in Cercospora (Crous 

& Braun 2003) provided some rationalisation, with the following 

concepts proposed for the taxonomic treatment of cercosporoid 

fungi: structure of conidiogenous loci (scars) and hila, as either 

unthickened (or almost so, but slightly darkened or refractive) or 

unthickened; presence or absence of pigmentation in conidiophores 

and conidia. 

Pseudocercospora was originally introduced by Spegazzini 

(1910) based on the type species Pseudocercospora vitis, a 

foliar pathogen of grapevines. The majority of Pseudocercospora 

species known to date are regarded as pathogens on a wide variety 

of plants, predominantly in tropical and sub-tropical environments 

where they cause leaf spots, blights, fruit spot and fruit rot (Chupp 

1954, Deighton 1976, von Arx 1983, Pons & Sutton 1988). Some 

important plant pathogens include the species associated with 

Sigatoka disease on banana (Arzanlou et al. 2007, 2008, 2010, 

Churchill 2010), angular leaf spot of bean (Crous et al. 2006), 

husk spot of macadamia (Beilharz et al. 2003), Cercospora leaf 

spot of olive (Ávila et al. 2005), cactus (Ayala-Escobar et al. 2005), 

avocado (Deighton 1976), and eucalypts (Braun & Dick 2002). 

The importance of these diseases is also reflected in quarantine 

regulations, e.g. for Pseudocercospora angolensis the cause of 

fruit and leaf spot disease on citrus (Pretorius et al. 2003) (Fig. 

2), and P. pini-densiflorae the cause of brown needle blight of pine 

(Evans 1984, Crous et al. 1990). 

Pseudocercospora was established to accommodate 

synnematal analogues of Cercospora, as well as species that 

produce pigmented conidiogenous structures and conidia with 

neither thickened nor darkened conidial hila (Deighton 1976, Braun 

1995) (Fig. 3). It was proposed that Pseudocercospora be divided 

into several genera (Deighton 1976) based on morphological 

differences, a view later supported by several authors (Pons 

& Sutton 1988, Braun 1995, Crous & Braun 1996). Since the 

first study applied DNA phylogenetic analyisis to species in the 

Mycosphaerella complex (Stewart et al. 1999), Pseudocercospora 

has been shown to be heterogenous, accommodating hundreds of 

species (Crous et al. 2000, 2001, Crous & Braun 2003). 

There are very few morphological features that are informative 

at the generic level within the Pseudocercospora complex. 

Deighton (1983) found it difficult to distinguish Cercoseptoria from 

Pseudocercospora on the basis of conidial shape, with conidia 

in the former genus acicular and those in the latter obclavate to 

cylindrical. In delimiting Pseudocercospora as an anamorph of 

Mycosphaerella, von Arx (1983) considered Pseudocercospora 

together in a group of related genera characterised by hyaline or 

subhyaline conidiogenous structures and unthickened, truncate, 

flat and broad conidiogenous loci. Later, Braun (1992) and Crous 

et al. (2000) argued that the arrangement of the conidiophores 

did not distinguish between sections within Pseudocercospora 

due to transitions from solitary to fasciculate to subsynnematal 

conidiophores. Crous et al. (2001) also regarded the slight 

thickening of conidial scars as a taxonomically uninformative 

generic character. 

DNA sequence data for various gene regions have in recent 

years provided substantial information to support the generic 

circumscription of Pseudocercospora. Several studies have 

employed DNA sequence data from the Internal Transcribed 

Spacer (ITS) region of the rDNA operon for Pseudocercospora 

species from various hosts. Crous et al. (2000) examined 

isolates of Pseudocercospora from Eucalyptus and found that 

they could be separated into two clades within Mycosphaerella. 

Another clade of Pseudocercospora species occurred on banana, 

indicating that Pseudocercospora could be polyphyletic within 

the Mycosphaerella complex. Further evidence supporting 

this view emerged in subsequent studies that included 

many Pseudocercospora isolates (Crous et al. 2001). These 

phylogenetic studies have shown that several other genera are 

congeneric with Pseudocercospora and thus Cercostigmina, 

Paracercospora, Phaeoisariopsis and Pseudophaeoramularia 

were reduced to synonymy with Pseudocercospora (Stewart 

et al. 1999, Crous et al. 2001, Braun & Hill 2002, Crous et al. 

2006). Based on these studies, the necessity arose to conserve 

Pseudocercospora over Stigmina, which represented an older 

generic name (Braun & Crous 2006). 

Extensive DNA-based phylogenetic research has in recent 

years been conducted on Mycosphaerella and many of its 

anamorphic genera. These studies have not provided substantial 

resolution of Pseudocercospora. The aims of this study were to 

define phylogenetic lineages (reflecting genera) within what is 

perceived to be Pseudocercospora. An additional aim was to use 

the molecular data to infer host range and thus to consider the 

importance of host specificity in this important genus. 

38


Fig. 1. Leaf spot symptoms associated with various species from the Pseudocercospora complex. A. P. fatouae on Fatoua villosa. B. P. clematidis on Clematis apiicola. C. P. 

griseola on Phaseolus vulgaris. D. P. rhododendron-indici on Rhododendron indicum. E. P. pyracanthae on Pyracantha angustifolia. F. P. lonicericola on Lonicera japonica. G. 

Scolecostigmina mangiferae on Mangifera indica. H. P. fraxinites on Fraxinus rhynchophylla. I. Pseudocercosporella potentillae on Potentilla kleiniana. J. Pseudocercospora 

udagawana on Hovenia dulcis. 

Fig. 2. Pseudocercospora species of quarantine importance. A. P. fijiensis on Musa (Black Leaf Streak or Black Sigatoka) (Photo G.H.J. Kema). B, C. P. angolensis on Citrus 

(Phaeoramularia Fruit and Leaf Spot). 


39

Crous et al. 

Fig. 3. Morphological structures of Pseudocercospora spp. A. Synnematous conidiophore. B. Densely aggregated fascicle of conidiophores with well-developed brown stroma. 

C, D. Loosely branched fascicles of conidiophores with moderate (C) and poorly (D) developed brown stroma. E. Fascicle reduced to conidiogenous cells. F. Conidiophore 

fascicles arising from stomata. G, H. Solitary conidiogenous cells on superficial hyphae. I. Geniculate conidiophore (arrow) with truncate apical locus. J, K. Conidiophores 

branched below (arrows). L. Conidiogenous cells with percurrent proliferations (arrows). M, N. Conidiophores with sympodial proliferation. O. Conidiophores with conidiogenous 

cells (note minutely thickened scars, arrows). P. Subcylindrical conidium with subacute apex and truncate base. Q. Conidia with constrictions at septa. R. Conidium with guttules. 

S. Cylindrical conidium with obtuse apex, and truncate base. T. Undulate conidia. U. Curved conidium. Aseptate to 1-septate conidia. V. 1-septate conidia. W, X. Obclavate 

conidia with obconical base. Y. Obclavate conidium with short obconical base. Z. Dark brown, muriformly euseptate conidia (thick-walled, not distoseptate). 

40



Isolates 

Direct isolations were made from fascicles of conidiophores on 

leaves. Some leaves were incubated in moist chambers for up to 

1 wk to enhance sporulation before single conidial colonies were 

established on 2 % malt extract agar (MEA) (Crous 2002). Leaf 

spots bearing ascomata were soaked in water for approximately 

2 h, after which they were attached to the inner surface of Petri 

dish lids over plates containing MEA. Ascospore germination 

patterns were examined after 24 h, and single ascospore and 

conidial cultures established as described previously (Crous et 

al. 1991, Crous 1998). Colonies were sub-cultured onto synthetic 

nutrient-poor agar (SNA), potato-dextrose agar (PDA), oatmeal 

agar (OA), and MEA (Crous et al. 2009d), and incubated at 25 °C 

under continuous near-ultraviolet light to promote sporulation. 

Isolates were also sourced from the culture collections of the 

CBS-KNAW Fungal Biodiversity Centre (CBS), the working 

collection of Pedro Crous (CPC), Chiharu Nakashima (CNS) and 

the culture collection of the laboratory of plant pathology, Mie 

University, Japan (MUCC), and the mycological herbarium of Mie 

University (MUMH). Furthermore, isolates representing fungal 

species from genera allied to Pseudocercospora, e.g. Cercospora, 

Cercostigmina, Cyphellophora, Davidiella, Dissoconium, Miuraea, 

Mycocentrospora, Passalora, Phaeoisariopsis, Phleospora, 

Septoria, Strelitziana, Stigmina, Teratosphaeria, Thedgonia, 

Trochophora, and Xenostigmina, were included in this study (Table 

1). 

DNA isolation 

Mycelium from actively growing fungal cultures was scraped from 

the surface of MEA or PDA plates using a sterile scalpel blade. 

Harvested mycelium was ground to a fine powder using liquid 

nitrogen and DNA was isolated using the CTAB extraction protocol 

as outlined by Crous et al. (2009d) or the UltraClean TM Microbial 

DNA Isolation Kit (MoBio Laboratories, Inc., Solana Beach, CA, 

USA) following the manufacturers’ protocols. Isolated DNA was 

visualised by electrophoresis in 1 % agarose gels (w/v) stained 

with ethidium bromide and viewed under near ultra-violet light. DNA 

concentrations were determined by measuring electrophoresed 

DNA samples against a HyperLadder TM I molecular marker 

(BIOLINE) or alternatively by a NanoDrop quantification as outlined 

by the manufacturer. 

PCR amplification 

DNA isolated from fungal isolates was used as template for further 

Polymerase Chain Reaction (PCR) amplifications. Four nuclear 

gene regions were targeted for PCR amplification and subsequent 

sequencing. These regions included the Internal Transcribed 

Spacer regions ITS-1, ITS-2 and the 5.8S nrRNA gene regions 

(ITS), the first 900 bp of the Large Subunit (28S, LSU) (domains 

D1–D3) of the rDNA operon and partial gene regions of the 

translation elongation factor 1-alpha (EF-1α) and the actin (ACT) 

genes. 

The ITS region was amplified using primers ITS-1 or ITS-5 and 

ITS-4 (White et al. 1990) while primers used for amplification of 

the LSU region were LR0R (Rehner & Samuels 1994) or LSU1Fd 

(Crous et al. 2009b) and LR5 or LR7 (Vilgalys & Hester 1990). 

Primers employed for the amplification of EF-1α included EF1- 

728F and EF1-986R (Carbone & Kohn 1999) or EF-2 (O’Donnell et 

al. 1998) while ACT-512F and ACT-783R (Carbone & Kohn 1999) 

were used to amplify a portion of the ACT gene. All PCR reaction 

mixtures and conditions followed those outlined by Hunter et al. 

(2006b). Following PCR amplification, amplicons were visualized 

on 1.5 % agarose gels stained with ethidium bromide and viewed 

under ultra-violet light and sizes of amplicons were determined 

against a HyperLadder TM I molecular marker (BIOLINE). The PCR 

amplicons for the four loci were subsequently diluted 1 to 10 times 

in preparation for further DNA sequencing reactions. 

DNA sequencing and phylogenetic inference 

PCR amplicons of the four gene regions targeted in this study 

served as templates for DNA sequencing reactions with the 

BigDye® Terminator Cycle Sequencing Kit v. 3.1 (Applied 

Biosystems Life Technologies, Carlsbad, CA, USA) following the 

protocol of the manufacturer. DNA sequencing reactions used the 

same primers as those for the PCR reactions. However, additional 

internal primers LR3R (http://www.biology.duke.edu/fungi/mycolab/ 

primers.htm), LR16 (Moncalvo et al. 1993) and LR5 were used to 

sequence the LSU in order to obtain reliable sequences spanning 

the entire D1-D3 region. DNA sequencing amplicons were purified 

through Sephadex® G-50 Superfine columns (Sigma Aldrich, St. 

Louis, MO) in MultiScreen HV plates (Millipore, Billerica, MA). 

Purified sequence reactions were run on an ABI Prism 3730xl DNA 

Sequencer (Life Technologies, Carlsbad, CA, USA). 

Generated DNA sequence electropherograms were analysed 

using MEGA (Molecular Evolutionary Genetics Analysis) v. 4.0 

(Tamura et al. 2007), 4Peaks v. 1.7.2 (http://www.mekentosj.com/) 

and SeqMan v. 8.0.2. from the DNASTAR Lasergene® software 

package. Consensus sequences were generated and imported 

into MEGA for initial alignment and the construction of sequence 

datasets. DNA sequences representing isolates of closely allied 

genera, for which material could not be obtained were downloaded 

from the NCBI GenBank nucleotide database (www.ncbi.nlm.nih. 

gov) and added to the DNA sequence datasets generated in this 

study. Sequence datasets for the four genomic loci were aligned in 

MAFFT (“Multiple alignment program for amino acids or nucleotide 

sequences”) v. 6.0 (Katoh & Toh 2006, Katoh et al. 2005; http:// 

mafft.cbrc.jp/alignment/server/index.html) using the Auto alignment 

strategy with the 200PAM/ K=2 scoring matrix and a gap opening 

penalty of 1.53 with an offset value of 0.0. Resulting sequence 

alignments were manually evaluated and adjusted in MEGA, 

MacClade v.4.08 (Maddison & Maddison 2000) or Sequence 

Alignment Editor v. 2.0a11 (Rambaut 2002). 

A phylogenetic re-construction was conducted for the aligned 

LSU data set to determine generic relationships using MrBayes 

v. 3.1.2 (Ronquist & Huelsenbeck 2003). Subsequently, a species 

level phylogeny was derived from the combined ITS, ACT and EF- 

1α alignment of Pseudocercospora s. str. sequences using PAUP 

v. 4.0b10 (Swofford 2003). For the LSU alignment, MrModeltest 

v. 2.2 (Nylander 2004) was used to determine the best nucleotide 

substitution model settings for MrBayes. Based on the results of the 

MrModeltest, a phylogenetic analysis was performed with MrBayes 

v. 3.1.2 applying a general time-reversible (GTR) substitution 

model with inverse gamma rates and dirichlet base frequencies 

and a heating parameter set at 0.3. The Markov Chain Monte Carlo 

(MCMC) analysis of 4 chains started in parallel from a random tree 

topology and had 8 000 000 generations. Trees were saved each 


41

Crous et al. 

Table 1. Pseudocercospora and pseudocercospora-like isolates included in the morphological and/or phylogenetic analyses. 

Species Culture accession numbers 1 Collector Host Family Country GenBank accession numbers 2 

LSU ITS EF-1α ACT 

Cercospora eucommiae CPC 10047 H.D. Shin Eucommia ulmoides Eucommiaceae South Korea GU253741 GU269702 GU384418 GU320406 

CPC 10802; CBS 131932 H.D. Shin Eucommia ulmoides Eucommiaceae South Korea GU214674 GU269851/ 

GU214674 

GU384563 GU320555 

CPC 11508; CBS 132026 H.D. Shin Eucommia ulmoides Eucommiaceae South Korea GU253742 GU269703 GU384419 GU320407 

Cercospora sojina CPC 12322; CBS 132018 H.D. Shin Glycine soja Fabaceae South Korea GU253861 GU214655 JQ324984 JQ325008 

Cyphellophora eucalypti CBS 124764; CPC 13412 P.W. Crous Eucalyptus sp. Myrtaceae Australia GQ303305 GQ303274 GU384510 JQ325009 

Dissoconium dekkeri CBS 110748; CPC 825; CMW 14906 G. Kemp Eucalyptus grandis Myrtaceae South Africa GU214422 AF173315 JQ324985 DQ147651 

Microcyclospora quercina CPC 10712; CBS 130827 G. Verkley Quercus sp. Fagaceae Netherlands GU214681 GU269789 GU384499 GU320490 

Miuraea persicae CPC 10069; CBS 132307 H.D. Shin Prunus persica Rosaceae South Korea GU253859 GU269843 GU384556 GU320546 

CPC 10828; CBS 131935 H.D. Shin Prunus armeniaca Rosaceae South Korea JQ324939 GU269844 GU384557 GU320547 

“Mycosphaerella” laricina CBS 326.52 E. Müller Larix decidua Pinaceae Switzerland GU253693 GU269643 GU384361 GU320353 

“Mycosphaerella” madeirae CBS 112895; CPC 3745 S. Denman Eucalyptus globulus Myrtaceae Portugal DQ204756 AY725553 DQ211672 DQ147641 

“Mycosphaerella” marksii CBS 110920; CPC 935; CMW 5150 A.J. Carnegie Eucalyptus botryoides Myrtaceae Australia DQ246250/ 

GU253694 

AF309588/ 

GU269644 

DQ235134 DQ147625 

Pallidocercospora acaciigena CBS 112516; CPC 3838 M.J. Wingfield Acacia mangium Fabaceae Venezuela GU214661/ 

GU253697 

GU269648 GU384366 GU320356 

CBS 120740; CPC 13290 B. Summerell Eucalyptus sp. Myrtaceae Australia GU253698 EF394822/ 

GU269649 

GU384367 GU320357 

Pallidocercospora crystallina CBS 681.95; CBS 116158; CPC 802; 

CMW 3033 

M.J. Wingfield Eucalyptus bicostata Myrtaceae South Africa DQ204747 AY490757 DQ147636/ 

DQ211662 

DQ147636 

Pallidocercospora heimii CBS 110682; CPC 760; CMW 4942 P.W. Crous Eucalyptus sp. Myrtaceae Madagascar DQ204751 AF309606 DQ211667 DQ147638 

Pallidocercospora heimioides CBS 111190; CPC 1312; CMW 3046 M.J. Wingfield Eucalyptus sp. Myrtaceae Indonesia DQ204753 AF309609 DQ211669 DQ147633 

Pallidocercospora irregulariramosa CBS 114774; CBS 114777; CPC 1360; 

CMW 4943 

M.J. Wingfield Eucalyptus saligna Myrtaceae South Africa DQ204754 AF309607 DQ211670 DQ147634 

Pallidocercospora konae CBS 120748; CPC 13469 W. Himaman Eucalyptus camaldulensis Myrtaceae Thailand GU253852 EF394842 GU384549 GU320538 

Paracercospora egenula CBS 485.81 N. Ponnapa Solanum melongena Solanaceae India JQ324940 GU269699 GU384415 GU320403 

CPC 12537; CBS 132030 H.D. Shin Solanum melongena Solanaceae South Korea GU253738 GU269698 GU384414 GU320402 

MUCC 883 T. Mikami Solanum melongena Solanaceae Japan GU253739 GU269700 GU384416 GU320404 

Passalora eucalypti CBS 111318; CPC 1457 P.W. Crous Eucalyptus saligna Myrtaceae Brazil GU253860 GU269845 GU384558 GU320548 

Phaeomycocentrospora cantuariensis CPC 10157 H.D. Shin Humulus scandens Cannabaceae South Korea GU253712 GU269664 GU384381 GU320370 

CPC 10762; CBS 131928 H.D. Shin Luffa cylindrica Cucurbitaceae South Korea GU253713 GU269665 GU384382 GU320371 

42





CPC 11646; CBS 132013 H.D. Shin Acalypha australis Euphorbiaceae South Korea GU253715 GU269667 GU384384 GU320373 

CPC 11694; CBS 132014 H.D. Shin Humulus scandens Cannabaceae South Korea GU253716 GU269668 GU384385 GU320374 

Phloeospora ulmi CBS 344.97 W. Gams Ulmus glabra Ulmaceae Austria GU253841 JQ324974 JQ324986 GU320528 

CBS 613.81 H.A. Van der Aa Ulmus sp. Ulmaceae Austria GU253842 GU269825 JQ324987 GU320529 

Pseudocercospora abelmoschi CPC 14478; CBS 132103 H.D. Shin Hibiscus syriacus Malvaceae South Korea GU253696 GU269647 GU384365 GU320355 

Pseudocercospora acericola CBS 122279 R. Kirschner Acer albopurpurascens Aceraceae Taiwan GU253699 GU269650 GU384368 GU320358 

Pseudocercospora ampelopsis CPC 11680; CBS 131583 H.D. Shin Ampelopsis brevipenduncula 

var. heterophylla 

Vitaceae South Korea GU253846 GU269830 GU384542 GU320534 

Pseudocercospora angolensis CBS 112933; CPC 4118 M.C. Pretorius Citrus sp. Rutaceae Zimbabwe GU214470 AY260063/ 

GU269836 

GU384548 JQ325010 

CBS 149.53 T. de Carvalho & O. Mendes Citrus sinensis Rutaceae Angola JQ324941 JQ324975 JQ324988 JQ325011 

Pseudocercospora araliae CPC 10154 H.D. Shin Aralia elata Araliaceae South Korea GU253701 GU269652 GU384370 GU320360 

MUCC 873 T. Kobayashi & C. Nakashima Aralia elata Araliaceae Japan GU253702 GU269653 GU384371 GU320361 

Pseudocercospora arecacearum CBS 118406 C.F. Hill Rhopalostylis sapidis Arecaceae New Zealand GU253704 GU269655 GU384373 GU320363 

CBS 118792 C.F. Hill Howea forsteriana Arecaceae New Zealand GU253703 GU269654 GU384372 GU320362 

Pseudocercospora assamensis CBS 122467 I. Buddenhagen Musa cultivar Musaceae India GU253705 GU269656 GU384374 GU320364 

Pseudocercospora atromarginalis CBS 114640 C.F. Hill Solanum sp. Solanaceae New Zealand GU253706 GU269658 GU384376 GU320365 

CPC 11372; CBS 132010 H.D. Shin Solanum nigrum Solanaceae South Korea GU214671 GU269657 GU384375 — 

Pseudocercospora balsaminae CPC 10044; CBS 131882 H.D. Shin Impatiens textori Balsaminaceae South Korea GU253708 GU269660 GU384379 GU320367 

Pseudocercospora basiramifera CBS 111072; CPC 1266 M.J. Wingfield Eucalyptus pellita Myrtaceae Thailand GU253709 GU269661 DQ211677 GU320368 

CBS 114757; CPC 1267 M.J. Wingfield Eucalyptus pellita Myrtaceae Thailand GU253802 GU269781 GU384492 GU320484 

Pseudocercospora basitruncata CBS 114664; CPC 1202 M.J. Wingfield Eucalyptus grandis Myrtaceae Colombia GU253710/ 

DQ204759 

DQ267600/ 

GU269662 

DQ211675 DQ147622 

Pseudocercospora callicarpae MUCC 888 T. Kobayashi Callicarpa japonica Verbenaceae Japan GU253711 GU269663 GU384380 GU320369 

Pseudocercospora catalpigena MUCC 743 C. Nakashima & I. Araki Catalpa ovata Bignoniaceae Japan GU253731 GU269690 GU384406 GU320395 

Pseudocercospora catappae MUCC 809 C. Nakashima & T. Akashi Terminalia catappa Combretaceae Japan GU253717 GU269669 GU384386 GU320375 

Pseudocercospora cercidicola MUCC 896 T. Kobayashi & Y. Kobayashi Cercis chinensis Fabaceae Japan GU253719 GU269671 GU384388 GU320377 

Pseudocercospora cercidis-chinensis CPC 14481; CBS 132109 H.D. Shin Cercis chinensis Fabaceae South Korea GU253718 GU269670 GU384387 GU320376 

Pseudocercospora cf. cruenta CBS 117232 R. Kirschner Phaseolus vulgaris Fabaceae Taiwan GU253730 GU269689 GU384405 GU320394 

Pseudocercospora cf. kaki CPC 10636; CBS 131921 H.D. Shin Diospyros lotus Ebenaceae South Korea GU214677 GU269728 GU384441 GU320430 


43

Crous et al. 




Pseudocercospora chengtuensis CPC 10696; CBS 131924 H.D. Shin Lycium chinense Solanaceae South Korea JQ324942 GU269673 GU384390 GU320379 

MUCC 828 I. Araki & M. Harada Lycium chinense Solanaceae Japan JQ324943 — — — 

Pseudocercospora chionanthi-retusi CPC 14683; CBS 132110 H.D. Shin Chionanthus retusus Oleaceae South Korea GU253721 GU269674 GU384391 GU320380 

Pseudocercospora chrysanthemicola CPC 10633; CBS 131888 H.D. Shin Chrysanthemum sp. Asteraceae South Korea GU253722 GU269675 GU384392 GU320381 

Pseudocercospora cladosporioides CBS 117482; CPC 10913 P.W. Crous Olea europaea Oleaceae Tunisia JQ324944 GU269678 GU384395 GU320383 

“Pseudocercospora” colombiensis CBS 110969; CPC 1106; CMW 4944 M.J. Wingfield Eucalyptus urophylla Myrtaceae Colombia DQ204744 AY752149 DQ211660 DQ147639 

Pseudocercospora contraria CPC 14714; CBS 132108 H.D. Shin Dioscorea quinqueloba Dioscoreaceae South Korea JQ324945 GU269677 GU384394 GU320385 

Pseudocercospora coprosmae CBS 114639 C. F. Hill Coprosma robusta Rubiaceae New Zealand JQ324946 GU269680 GU384397 GU320386 

Pseudocercospora cordiana CBS 114685; CPC 2552 P.W. Crous & R.L. Benchimol Cordia goeldiana Boraginaceae Brazil GU214472 AF362054/ 

GU269681 

GU384398 GU320387 

Pseudocercospora coriariae MUCC 840 I. Araki & M. Harada Coriaria japonica Coriariaceae Japan GU253725 GU269682 GU384399 GU320388 

Pseudocercospora cornicola MUCC 909 C. Nakashima & E. Imaizumi Cornus alba var. sibirica Cornaceae Japan GU253726 GU269683 GU384400 GU320389 

Pseudocercospora corylopsidis MUCC 874 T. Kobayashi & C. Nakashima Hamamelis japonica Hamamelidaceae Japan GU253757 GU269721 GU384437 GU320425 

MUCC 908 C. Nakashima & E. Imaizumi Corylopsis spicata Hamamelidaceae Japan GU253727 GU269684 GU384401 GU320390 

Pseudocercospora cotoneastri MUCC 876 T. Kobayashi & C. Nakashima Cotoneaster salicifolius Rosaceae Japan GU253728 GU269685 GU384402 GU320391 

Pseudocercospora crispans CPC 14883; CBS 125999 P.W.Crous Eucalyptus sp. Myrtaceae South Africa GU253825 GU269807 GU384518 GU320510 

Pseudocercospora crocea CPC 11668; CBS 126004 H.D. Shin Pilea hamaoi Urticaceae South Korea JQ324947 GU269792 GU384502 GU320493 

Pseudocercospora crousii CBS 119487 C.F. Hill Eucalyptus sp. Myrtaceae New Zealand GU253729 GU269686 GU384403 GU320392 

Pseudocercospora cruenta CPC 10846; CBS 132021 H. Booker Vigna sp. Fabaceae Trinidad GU214673 GU269688 GU384404 JQ325012 

Pseudocercospora cydoniae CPC 10678; CBS 131923 H.D. Shin Chaenomeles speciosa Rosaceae South Korea GU253732 GU269691 GU384407 GU320396 

Pseudocercospora cymbidiicola CBS 115132 C.F. Hill Cymbidium sp. Orchidaceae New Zealand GU253733 GU269692 GU384408 GU320397 

Pseudocercospora davidiicola MUCC 296 C. Nakashima & I. Araki Davidia involucrata Nyssaceae Japan GU253734 GU269693 GU384409 GU320398 

Pseudocercospora dendrobii MUCC 596 C. Nakashima & K. Motohashi Dendrobium sp. Orchidaceae Japan GU253737 GU269696 GU384412 GU320401 

Pseudocercospora destructiva MUCC 870 S. Uematsu & C. Nakashima Euonymus japonicus Celastraceae Japan GU253735 GU269694 GU384410 GU320399 

Pseudocercospora dianellae CBS 117746 C.F. Hill Dianella caerulae Liliaceae New Zealand GU253736 GU269695 GU384411 GU320400 

Pseudocercospora dodonaeae CBS 114647 C.F. Hill Dodonaea viscosa Sapindaceae New Zealand JQ324948 GU269697 GU384413 JQ325013 

Pseudocercospora dovyalidis CPC 13771; CBS 126002 P.W. Crous Dovyalis zeyheri Flacourtiaceae South Africa GU253818 GU269800 GU384513 GU320503 

Pseudocercospora elaeocarpi MUCC 925 C. Nakashima Elaeocarpus sp. Elaeocarpaceae Japan GU253740 GU269701 GU384417 GU320405 

“Pseudocercospora” epispermogonia CBS 110750; CPC 822 G. Kemp Eucalyptus grandis Myrtaceae South Africa DQ204757 DQ267596 DQ211673 DQ147629 

44





Pseudocercospora eucalyptorum CBS 110777; CPC 16; CMW 5228 P.W. Crous Eucalyptus nitens Myrtaceae South Africa DQ204762 AF309598 DQ211678 DQ147614 

CBS 114242; CPC 10390; CMW 14908 J.P. Mansilla Eucalyptus globulus Myrtaceae Spain GU214481 AY725526 DQ211681 DQ147613/ 

GU320465 

CBS 116359; CPC 3751 P.W. Crous Eucalyptus sp. Myrtaceae Madeira GU253829 GU269812 GU384524 GU320514 

CPC 10500; CBS 114243 P.W. Crous Eucalyptus nitens Myrtaceae New Zealand JQ324949 AY725527 GU384474 JQ325014 

CPC 10507; CBS 116371 P.W.Crous Eucalyptus nitens Myrtaceae New Zealand JQ324950 GU269687 JQ324989 GU320393 

CPC 10916 P.W. Crous Eucalyptus sp. Myrtaceae South Africa GU253788 GU269763 GU384475 GU320464 

CPC 11713; CBS 132015 P. Mansilla Eucalyptus globulus Myrtaceae Spain JQ324951 GU269811 GU384523 JQ325015 

CPC 12406; CBS 132029 I. Smith Eucalyptus globulus Myrtaceae Australia GU253811 GU269793 GU384503 GU320494 

CPC 12568; CBS 132309 C. Mohammed Eucalyptus nitens Myrtaceae Australia GU253814 GU269796 GU384506 GU320497 

CPC 12802; CBS 132032 A. Phillips Eucalyptus globulus Myrtaceae Portugal GU253789 JQ324976 JQ324990 GU320466 

CPC 12957; CBS 132033 B. Summerell Eucalyptus deanei Myrtaceae Australia GU253815 GU269797 JQ324991 JQ325016 

CPC 13455; CBS 132034 P.W. Crous Eucalyptus sp. Myrtaceae Portugal GU253816 GU269798 GU384511 GU320501 

CPC 13769; CBS 132035 P.W. Crous Eucalyptus punctata Myrtaceae South Africa GU253707 GU269659 GU384378 GU320366 

CPC 13816; CBS 132114 S. Denman Eucalyptus glaucescens Myrtaceae UK GU253819 GU269801 JQ324992 GU320504 

CPC 13926; CBS 132105 S. Denman Eucalyptus sp. Myrtaceae USA GU253820 GU269802 JQ324993 GU320505 

Pseudocercospora eupatoriella CBS 113372 M.J. Morris Chromolaena odorata Asteraceae Jamaica GU253743 GU269704 GU384420 GU320408 

Pseudocercospora eustomatis CBS 110822 G. Dal Bello Eustroma grandiflorum Gentianaceae Argentina GU253744 GU269705 GU384421 GU320409 

Pseudocercospora exosporioides MUCC 893 T. Kobayashi Sequoia sempervirens Taxodiaceae Japan GU253746 GU269707 GU384423 GU320411 

Pseudocercospora fijiensis CBS 120258; CIRAD 86 J. Carlier Musa sp. Musaceae Cameroon JQ324952 EU514248 Genome 3 Genome 3 

MUCC 792 T. Kobayashi & C. Nakashima Musa sp. Musaceae Japan GU253776 GU269748 JQ324994 GU320450 

Pseudocercospora flavomarginata CBS 118841; CMW 13586 M.J. Wingfield Eucalyptus camaldulensis Myrtaceae Thailand DQ153306 DQ155657 DQ156548 DQ166513 

CBS 124990; CPC 13492 W. Himaman Eucalyptus camaldulensis Myrtaceae Thailand GU253817 GU269799 GU384512 GU320502 

CPC 14142; CBS 126001 X. Zhou Eucalyptus sp. Myrtaceae China GU253822 GU269804 GU384515 GU320507 

Pseudocercospora fori CBS 113285; CMW 9095 G.C. Hunter Eucalyptus grandis Myrtaceae South Africa DQ204748 AF468869 DQ211664 DQ147618 

CPC 14880; CBS 132113 P.W. Crous Eucalyptus sp. Myrtaceae South Africa GU253824 GU269806 GU384517 GU320509 

Pseudocercospora fraxinites CPC 10743; CBS 131927 H.D. Shin Fontanesia phillyraeoides Oleaceae South Korea GU253720 GU269672 GU384389 GU320378 

MUCC 891 T. Kobayashi Fraxinus excelsior Oleaceae Japan GU253748 GU269710 GU384426 GU320414 

Pseudocercospora fukuokaensis CPC 14689; CBS 132111 H.D. Shin Styrax japonicus Styracaceae South Korea GU253750 GU269713 GU384429 GU320417 

MUCC 887 T. Kobayashi Styrax japonicus Styracaceae Japan GU253751 GU269714 GU384430 GU320418 


45

Crous et al. 




Pseudocercospora fuligena CPC 12296; CBS 132017 Z. Mersha Lycopersicon sp. Solanaceae Thailand JQ324953 GU269711 GU384427 GU320415 

MUCC 533 C. Nakashima Lycopersicon esculentum Solanaceae Japan GU253749 GU269712 GU384428 GU320416 

Pseudocercospora glauca CPC 10062; CBS 131884 H.D. Shin Albizzia julibrissin Fabaceae South Korea GU253752 GU269715 GU384431 GU320419 

Pseudocercospora gracilis CBS 243.94; CPC 730 P.W. Crous Eucalyptus urophylla Myrtaceae Indonesia DQ204750 DQ267582 DQ211666 DQ147616 

Pseudocercospora griseola f. griseola CBS 119112; CPC 10460 F.S. Ngulu & C. Mushi Phaseolus vulgaris Fabaceae Tanzania GU253753 GU269717 GU384433 GU320421 

CBS 194.47 — Phaseolus vulgaris Fabaceae Portugal JQ324954 DQ289801 JQ324995 DQ289868 

CBS 880.72 H.A. van Kesteren Phaseolus vulgaris Fabaceae Netherlands GU214476 GU269716 GU384432 GU320420 

CPC 10462 M.M. Liebenberg Phaseolus vulgaris Fabaceae South Africa GU253865 GU269849 GU384562 GU320553 

CPC 10480; CBS 131887 M.M. Liebenberg Phaseolus vulgaris Fabaceae South Africa GU253864 GU269848 GU384561 DQ289882 

CPC 10779; CBS 131929 H.D. Shin Phaseolus vulgaris Fabaceae South Korea GU253862 GU269846 GU384559 DQ289885 

CPC 12239 G. Mahuku Phaseolus vulgaris Fabaceae Colombia GU253863 GU269847 GU384560 DQ289887 

Pseudocercospora guianensis MUCC 855 C. Nakashima & T. Akashi Lantana camara Verbenaceae Japan GU253755 GU269719 GU384435 GU320423 

MUCC 879 C. Nakashima Lantana camara Verbenaceae Japan GU253756 GU269720 GU384436 GU320424 

Pseudocercospora haiweiensis CPC 14084; CBS 131584 X. Zhou Eucalyptus sp. Myrtaceae China GU253821 GU269803 GU384514 GU320506 

Pseudocercospora hakeae CBS 112226; CPC 3145 P.W. Crous & B. Summerell Grevillea sp. Proteaceae Australia GU253805 GU269784 GU384495 JQ325017 

Pseudocercospora humuli MUCC 742 C. Nakashima & I. Araki Humulus lupulus var. lupulus Cannabaceae Japan GU253758 GU269725 GU384439 GU320428 

Pseudocercospora humulicola CPC 10049; CBS 131883 H.D. Shin Humulus scandens Cannabaceae South Korea JQ324955 GU269724 JQ324996 JQ325018 

CPC 11358; CBS 131585 H.D. Shin Humulus scandens Cannabaceae South Korea JQ324956 GU269723 GU384438 GU320427 

Pseudocercospora indonesiana CBS 122473 I.W. Buddenhagen Musa sp. Musaceae Sumatra GU253765 GU269735 GU384448 GU320437/ 

EU514340 

CBS 122474 I.W. Buddenhagen Musa sp. Musaceae Indonesia JQ324957 EU514283 JQ324997 JQ325019 

Pseudocercospora ixorae CBS 118760 R. Kirschner Ixora sp. Rubiaceae Taiwan GU253759 GU269726 GU384440 GU320429 

Pseudocercospora jussiaeae CPC 14625; CBS 132117 H.D. Shin Ludwigia prostrata Onagraceae South Korea JQ324958 JQ324977 JQ324998 JQ325020 

Pseudocercospora kaki MUCC 900 S. Uematsu & C. Nakashima Diospyros kaki Ebenaceae Japan GU253761 GU269729 GU384442 GU320431 

Pseudocercospora kiggelariae CPC 11853; CBS 132016 W. Gams Kiggelaria africana Flacourtiaceae South Africa GU253762 GU269730 GU384443 GU320432 

Pseudocercospora latens MUCC 763 C. Nakashima & T. Akashi Lespedeza wilfordii Fabaceae Japan GU253763 GU269732 GU384445 GU320434 

Pseudocercospora leucadendri CPC 1869 S. Denman & P.W. Crous Leucadendron sp. Proteaceae South Africa GU214480 GU269842 GU384555 GU320545 

Pseudocercospora libertiae CBS 114643 C.F. Hill Libertia ixioides Iridaceae New Zealand JQ324959 GU269733 GU384446 GU320435 

Pseudocercospora lilacis CPC 12767; CBS 132031 C. Hodges Ligustrum japonicum Oleaceae USA GU253767 GU269737 GU384449 GU320439 

46





Pseudocercospora longispora CBS 122470 D.R. Jones Musa sp. Musaceae Malaysia GU253764 GU269734 GU384447 GU320436/ 

EU514342 

Pseudocercospora lonicericola MUCC 889 T. Kobayashi Lonicera gracilipes var. glabra Caprifoliaceae Japan GU253766 GU269736 JQ324999 GU320438 

Pseudocercospora luzardii CPC 2556 A.C. Alfenas Hancornia speciosa Apocynaceae Brazil GU214477 AF362057/ 

GU269738 

GU384450 GU320440 

Pseudocercospora lyoniae MUCC 910 C. Nakashima & E. Imaizumi Lyonia ovalifolia var. elliptica Ericaceae Japan GU253768 GU269739 GU384451 GU320441 

Pseudocercospora lythracearum CPC 10707; CBS 131925 H.D. Shin Lagerstroemia indica Lythraceae South Korea GU253769 GU269740 GU384452 GU320442 

MUCC 890 T. Kobayashi Lagerstroemia indica Lythraceae Japan GU253770 GU269741 GU384453 GU320443 

Pseudocercospora lythri CPC 14588; CBS 132115 H.D. Shin Lythrum salicaria Lythraceae South Korea GU253771 GU269742 GU384454 GU320444 

MUCC 865 I. Araki & M. Harada Lythrum salicaria Lythraceae Japan GU253772 GU269743 GU384455 GU320445 

Pseudocercospora macrospora CBS 114696; CPC 2553 P.W. Crous & R.L. Benchimol Bertholletia excelsa Lecythidaceae Brazil GU214478 AF362055/ 

GU269745 

GU384457 GU320447 

Pseudocercospora mali MUCC 886 T. Kobayashi Malus sieboldii Rosaceae Japan GU253773 GU269744 GU384456 GU320446 

Pseudocercospora marginalis CPC 12497; CBS 131582 H.D. Shin Fraxinus rhynchophylla Oleaceae South Korea GU253812 GU269794 GU384504 GU320495 

Pseudocercospora melicyti CBS 115023 M. Fletcher Melicytus macrophyllus Violaceae New Zealand JQ324968 GU269769 GU384481 GU320472 

Pseudocercospora metrosideri CBS 118795 C.F. Hill Metrosideros collina Myrtaceae New Zealand GU253774 GU269746 GU384458 GU320448 

Pseudocercospora musae CBS 116634 J. Carlier Musa sp. Musaceae Cuba GU253775 GU269747 GU384459 GU320449 

Pseudocercospora myrticola MUCC 632 C. Nakashima & K. Motohashi Myrtus communis Myrtaceae Japan GU253777 GU269749 GU384460 GU320451 

Pseudocercospora nandinae CBS 117745 C.F. Hill Nandina domestica Berberidaceae New Zealand GU253778 GU269750 GU384461 GU320452 

Pseudocercospora natalensis CBS 111069; CPC 1263 T. Coutinho Eucalyptus nitens Myrtaceae South Africa DQ267576 DQ303077 JQ325000 DQ147620 

CBS 111071; CPC 1265 T. Coutinho Eucalyptus nitens Myrtaceae South Africa GU253801 GU269780 GU384491 GU320483 

Pseudocercospora nephrolepidis CBS 119121 R. Kirschner Nephrolepis auriculata Oleandraceae Taiwan GU253779 GU269751 GU384462 GU320453 

Pseudocercospora nogalesii CBS 115022 C.F. Hill Chamaecytisus proliferus Fabaceae New Zealand JQ324960 GU269752 GU384463 GU320454 

Pseudocercospora norchiensis CBS 114641 C.F. Hill Rubus sp. Rosaceae New Zealand GU253794 GU269772 GU384484 GU320475 

CBS 120738; CPC 13049 W. Gams Eucalyptus sp. Myrtaceae Italy GU253780 EF394859/ 

GU269753 

GU384464 GU320455 

Pseudocercospora ocimi-basilici CPC 10283 M.E. Palm Ocimum basilicum Lamiaceae Mexico GU214678 GU269754 GU384465 GU320456 

Pseudocercospora oenotherae CPC 10290; CBS 131885 H.D. Shin Oenothera odorata Onagraceae South Korea JQ324961 GU269856 GU384567 GU320559 

CPC 10630; CBS 131920 H.D. Shin Oenothera odorata Onagraceae South Korea GU253781 GU269755 GU384466 GU320457 

Pseudocercospora paederiae CPC 10007 H.D. Shin Paederia foetida Rubiaceae South Korea GU253783 GU269757 GU384468 — 

Pseudocercospora palleobrunnea CBS 124771; CPC 13387 P.W. Crous Syzygium sp. Myrtaceae Australia GQ303319 GQ303288 GU384509 GU320500 


47

Crous et al. 




Pseudocercospora pallida CPC 10776; CBS 131889 H.D. Shin Campsis grandiflora Bignoniaceae South Korea GU214680 GU269758 GU384469 GU320459 

Pseudocercospora pancratii CBS 137.94 R.F. Castaneda — — Cuba GU253784 GU269759 GU384470 GU320460 

Pseudocercospora paraguayensis CBS 111286; CPC 1459 P.W. Crous Eucalyptus nitens Myrtaceae Brazil GU214479/ 

DQ204764 

DQ267602 DQ211680 DQ147606 

CBS 111317; CPC 1458 P.W. Crous Eucalyptus nitens Myrtaceae Brazil GQ852634 JQ324978 GU384522 JQ325021 

Pseudocercospora pini-densiflorae MUCC 534 Y. Tokushige Pinus thunbergii Pinaceae Japan GU253785 GU269760 GU384471 GU320461 

Pseudocercospora plecthranthi CPC 11462; CBS 131586 H.D. Shin Plectranthus sp. Lamiaceae South Korea JQ324962 GU269791 GU384501 GU320492 

Pseudocercospora pouzolziae CBS 122280 R. Kirschner Gonostegia hirta Urticaceae Taiwan GU253786 GU269761 GU384472 GU320462 

Pseudocercospora profusa CPC 10042 H.D. Shin Acalypha australis Euphorbiaceae South Korea GU253808 GU269787 GU384497 GU320488 

CPC 10055; CBS 132306 H.D. Shin Acalypha australis Euphorbiaceae South Korea GU253787 GU269762 GU384473 GU320463 

Pseudocercospora proteae CPC 15217; CBS 131587 F. Roets Protea mundii Proteaceae South Africa GU253826 GU269808 GU384519 GU320511 

Pseudocercospora prunicula CPC 14511; CBS 132107 H.D. Shin Prunus x yedoensis Rosaceae South Korea GU253723 GU269676 GU384393 GU320382 

Pseudocercospora pseudostigminaplatani 

CPC 11726; CBS 131588 H.D. Shin Platanus occidentalis Platanaceae South Korea JQ324963 GU269857 GU384568 GU320560 

Pseudocercospora puderi MUCC 906 S. Maruyama Rosa sp. Rosaceae Japan GU253790 GU269764 GU384476 GU320467 

Pseudocercospora punctata CPC 14734; CBS 132116 P.W. Crous Syzygium sp. Myrtaceae Madagascar GU253791 GU269765 GU384477 GU320468 

Pseudocercospora purpurea CBS 114163; CPC 1664 P.W. Crous Persea americana Lauraceae Mexico GU253804 GU269783 GU384494 GU320486 

Pseudocercospora pyracanthae MUCC 892 T. Kobayashi & C. Nakashima Pyracantha angustifolia Rosaceae Japan GU253792 GU269767 GU384479 GU320470 

Pseudocercospora pyracanthigena CPC 10808; CBS 131589 H.D. Shin Pyracantha angustifolia Rosaceae South Korea — GU269766 GU384478 GU320469 

Pseudocercospora ranjita CPC 11141; CBS 126005 M.J. Wingfield Gmelina sp. Verbenaceae Indonesia GU253810 GU269790 GU384500 GU320491 

Pseudocercospora ravenalicola CBS 122468 M. Arzanlou & W. Gams Ravenala madagascariensis Strelitziaceae India GU253828 GU269810 GU384521 GU320513 

Pseudocercospora rhabdothamni CBS 114872 M. Fletcher Rhabdothamnus solandri Gesneriaceae New Zealand JQ324964 GU269768 GU384480 GU320471 

Pseudocercospora rhamnellae CPC 12500; CBS 131590 H.D. Shin Rhamnella frangulioides Rhamnaceae South Korea GU253813 GU269795 GU384505 GU320496 

Pseudocercospora rhapisicola CBS 282.66 K. Tubaki Rhapis flabellifornis Arecaceae Japan GU253793 GU269770 GU384482 GU320473 

Pseudocercospora rhododendri-indici CPC 10822; CBS 131591 H.D. Shin Rhododendron indicum Ericaceae South Korea JQ324965 GU269722 — GU320426 

Pseudocercospora rhoina CPC 11464; CBS 131891 H.D. Shin Rhus chinensis Anacardiaceae South Korea JQ324966 GU269771 GU384483 GU320474 

Pseudocercospora robusta CBS 111175; CPC 1269; CMW 5151 M.J. Wingfield Eucalyptus robur Myrtaceae Malaysia DQ204767 AY309597 DQ211683 DQ147617 

Pseudocercospora rubi MUCC 875 T. Kobayashi & C. Nakashima Rubus allegheniensis Rosaceae Japan GU253795 GU269773 GU384485 GU320476 

Pseudocercospora rumohrae CBS 117747 C.F. Hill Marattia salicina Marattiaceae New Zealand GU253796 GU269774 GU384486 GU320477 

Pseudocercospora sambucigena CPC 10292; CBS 131886 H.D. Shin Sambucus williamsii Caprifoliaceae South Korea GU253809 GU269788 GU384498 GU320489 

48





CPC 14397; CBS 126000 P.W. Crous Sambucus nigra Caprifoliaceae Netherlands GU253823 GU269805 GU384516 GU320508 

Pseudocercospora sawadae CBS 115024 C.F. Hill Psidium guajava Myrtaceae New Zealand JQ324967 GU269775 — GU320478 

Pseudocercospora securinegae CPC 10793; CBS 131930 H.D. Shin Flueggea suffruticosa Euphorbiaceae South Korea GU253797 GU269776 GU384487 GU320479 

Pseudocercospora snelliana CPC 11654; CBS 131592 H.D. Shin Morus bombycis Moraceae South Korea — GU269731 GU384444 GU320433 

Pseudocercospora sordida MUCC 913 C. Nakashima & E. Imaizumi Campsis radicans Bignoniaceae Japan GU253798 GU269777 GU384488 GU320480 

Pseudocercospora sp. CBS 110993; CPC 1057 M.J. Wingfield Populus sp. Salicaceae South Africa GU253800 GU269779 GU384490 GU320482 

CBS 110998; CPC 1054 M.J. Wingfield Eucalyptus grandis Myrtaceae South Africa GU253799 GU269778 GU384489 GU320481 

CBS 111373; CPC 1493 M.J. Wingfield Eucalyptus globulus Myrtaceae Uruguay GU253803 GU269782 GU384493 GU320485 

CBS 112725; CPC 3961 K.A. Seifert Melilotus alba Fabaceae Canada GU253806 GU269785 — — 

CBS 113387 A. den Breeyen Lantana camara Verbenaceae Jamaica GU253754 GU269718 GU384434 GU320422 

CPC 10058 H.D. Shin Potentilla kleiniana Rosaceae South Korea — JQ324979 JQ325001 JQ325022 

CPC 10645; CBS 131922 P.W. Crous — — Brazil GU253700 GU269651 GU384369 GU320359 

CPC 14711; CBS 132102 H.D. Shin Pyracantha angustifolia Rosaceae South Korea — JQ324980 JQ325002 JQ325023 

CPC 15116; NC1 37A1a J. Batzer Malus sp. cv. Golden Delicious Rosaceae USA: North 

Carolina 

JQ324969 JQ324981 JQ325003 JQ325024 

Pseudocercospora stahlii CBS 117549 R. Kirschner Passiflora foetida Passifloraceae Taiwan GU253830 GU269813 GU384525 GU320515 

Pseudocercospora stephanandrae MUCC 914 C. Nakashima & E. Imaizumi Stephanandra incisa Rosaceae Japan GU253831 GU269814 GU384526 GU320516 

Pseudocercospora subsessilis CBS 136.94 R.F. Castaneda — — Cuba GU253832 GU269815 GU384527 GU320517 

Pseudocercospora subtorulosa CBS 117230 R. Kirschner Melicope sp. Rutaceae Taiwan GU253833 GU269816 GU384528 GU320518 

Pseudocercospora subulata CBS 118489; CPC 10849 M. Dick Eucalyptus botryoides Myrtaceae New Zealand JQ324970 DQ303090 JQ325004 GU320519 

Pseudocercospora tereticornis CBS 124996; CPC 12960 A.J. Carnegie Eucalyptus nitens Myrtaceae Australia GQ852647 JQ324982 GU384377 JQ325025 

CPC 13299; CBS 125214 P.W. Crous Eucalyptus tereticornis Myrtaceae Australia GQ852649 GQ852770 GU384508 GU320499 

“Pseudocercospora” thailandica CBS 116367; CPC 10547 K. Pongpanich Acacia mangium Fabaceae Thailand GU253837 — DQ835102/ 

GU384533 

GU320523/ 

AY752217 

CPC 10548; CBS 116367 K. Pongpanich Acacia mangium Fabaceae Thailand GU253853 AY752157 AY840477 GU320539 

Pseudocercospora theae CBS 128.30 M. Curzi Camelia sinensis Theaceae Italy GU253838 GU269821 GU384534 GU320524 

“Pseudocercospora” tibouchinigena CBS 116462 C.F. Hill Tibouchina sp. Melastomataceae New Zealand GU253839 GU269822 GU384535 GU320525 

Pseudocercospora timorensis MUCC 819 C. Nakashima & T. Akashi Ipomoea indica Convolvulaceae Japan GU253840 GU269823 GU384536 GU320526 

Pseudocercospora udagawana CPC 10799; CBS 131931 H.D. Shin Hovenia dulcis Rhamnaceae South Korea — GU269824 GU384537 GU320527 


49

Crous et al. 



Pseudocercospora variicolor MUCC 746 C. Nakashima & I. Araki Paeonia lactiflora var. 

trichocarpa 


Paeoniaceae Japan GU253843 GU269826 GU384538 GU320530 

Pseudocercospora viburnigena CPC 15249; CBS 125998 M.L. Crous Viburnum davidii Caprifoliaceae Netherlands GU253827 GU269809 GU384520 GU320512 

Pseudocercospora viticicola MUCC 777 C. Nakashima Vitex trifolia Verbenaceae Japan GU253845 GU269828 GU384540 GU320532 

Pseudocercospora vitis CPC 11595; CBS 132012 H.D. Shin Vitis vinifera Vitaceae South Korea GU214483 DQ289829/ 

GU269829 

GU384541 GU320533 

CPC 14661; CBS 132112 H.D. Shin Vitis vinifera Vitaceae South Korea GU253844 GU269827 GU384539 GU320531 

Pseudocercospora weigelae MUCC 899 T. Kobayashi & Y. Kobayashi Weigela coraeensis Caprifoliaceae Japan GU253847 GU269831 GU384543 GU320535 

Pseudocercospora xanthocercidis CPC 11665; CBS 131593 A.R. Wood Xanthocercis zambesiaca Fabaceae South Africa JQ324971 JQ324983 JQ325005 JQ325026 

Pseudocercospora xanthoxyli CPC 10065 H.D. Shin Xanthoxylum ailanthoides Rutaceae South Korea GU253848 GU269832 GU384544 GU320536 

Pseudocercospora zelkovae CPC 14484; CBS 132106 H.D. Shin Zelkova serrata Ulmaceae South Korea GU253849 GU269833 GU384545 JQ325027 

CPC 14717; CBS 132118 H.D. Shin Zelkova serrata Ulmaceae South Korea GU253850 GU269834 GU384546 JQ325028 

MUCC 872 T. Kobayashi & C. Nakashima Zelkova serrata Ulmaceae Japan GU253851 GU269835 GU384547 GU320537 

Pseudocercosporella arcuata CPC 10050 H.D. Shin Rubus oldhamii Rosaceae South Korea GU214685 GU269850 JQ325006 GU320554 

Pseudocercosporella capsellae CPC 14773; CBS 131896 H.D. Shin Raphanus sativus Brassicaceae South Korea GU253714 GU269666 GU384383 GU320372 

Pseudocercosporella chaenomelis CPC 14795; CBS 131897 H.D. Shin Chaenomeles speciosa Rosaceae South Korea GU253834 GU269817 GU384530 GU320520 

MUCC 1510; CBS 132131 C. Nakashima Chaenomeles sinensis Rosaceae Japan — JQ793663 — JQ793664 

Pseudocercosporella fraxini CPC 11509 H.D. Shin Fraxinus rhynchophylla Oleaceae South Korea GU214682 GU269709 GU384425 GU320413 

Pseudocercosporella koreana CPC 11414 H.D. Shin Vicia amurensis Fabaceae South Korea GU214683 GU269852 GU384564 GU320556 

Pseudocercosporella oxalidis CBS 118758 R. Kirschner Oxalis debilis Oxalidaceae Taiwan GU253782 GU269756 GU384467 GU320458 

Pseudocercosporella sp. CPC 10864; CBS 131890 H.D. Shin Trigonotis peduncularis Boraginaceae South Korea JQ324972 GU269858 GU384569 JQ325029 

Pseudocercosporella zelkovae CPC 11592; CBS 132011 H.D. Shin Zelkova serrata Ulmaceae South Korea GU214482 GU269853 — GU320557 

Scolecostigmina mangiferae CBS 125467; CPC 17351 P.W. Crous Mangifera indica Anacardiaceae Australia GU253877 GU269870 GU384578 GU320566 

CPC 17352; CBS 125467 P.W. Crous Mangifera indica Anacardiaceae Australia GU253878 GU269871 GU384579 GU320567 

Septoria cerastii CPC 12343; CBS 132028 H.D. Shin Cerastium holosteoides var. 

hallasanense 

Caryophyllaceae South Korea GU253869 GU269859 GU384570 JQ325030 

Septoria chelidonii CPC 12337; CBS 132027 H.D. Shin Chelidonium majus var. 

asiaticum 

Papaveraceae South Korea GU253870 GU269860 GU384571 GU320561 

Septoria crepidis CPC 12539; CBS 131895 H.D. Shin Crepis japonica Asteraceae South Korea GU253871 GU269861 GU384572 GU320562 

Septoria dysentericae CPC 12328; CBS 131892 H.D. Shin Inula britannica var. chinensis Asteraceae South Korea GU253866 GU269854 GU384565 GU320558 

Septoria erigerontis CPC 12340; CBS 131893 H.D. Shin Erigeron annuus Asteraceae South Korea GU253872 GU269862 GU384573 JQ325031 

50





Septoria eucalyptorum CPC 11282; CBS 118505 W. Gams Eucalyptus sp. Myrtaceae India GU253873 GU269863 GU384574 GU320563 

Septoria justiciae CPC 12509; CBS 131894 H.D. Shin Justicia procumbens Acanthaceae South Korea GU253874 GU269864 GU384575 GU320564 

Septoria quercicola CBS 663.94 H.A. van der Aa Quercus robur Fagaceae Netherlands GU253867 GU269855 GU384566 JQ325032 

Septoria rubi CPC 12331; CBS 132022 H.D. Shin Rubus crataegifolius Rosaceae South Korea GU253875 GU269865 GU384576 — 

Stigmina platani CBS 336.33 R.M. Nattrass Platanus orientalis Platanaceae India GU253868 — JQ325007 — 

Strelitziana australiensis CBS 124778; CPC 13421 P.W. Crous Eucalyptus sp. Myrtaceae Australia GQ303326 GQ303295 GU384362 — 

CPC 13556; CBS 132310 P.W. Crous Eucalyptus sp. Myrtaceae Australia GU253695 GU269645 GU384363 GU320354 

Teratosphaeria alcornii CBS 313.76; CPC 3632 J.L. Alcorn Eucalyptus tessellaris Myrtaceae Australia GU253876 GU269866 GU384577 GU320565 

Teratosphaeria dimorpha CPC 14132; CBS 124051 B.A. Summerell Eucalyptus caesia Myrtaceae Australia FJ493215 FJ023537 — — 

Teratosphaeria stellenboschiana CBS 124989; CPC 13767 P.W. Crous Eucalyptus punctata Myrtaceae South Africa GQ852715 GQ852823 — — 

Thedgonia ligustrina CPC 10019 H.D. Shin Ligustrum ovalifolium Oleaceae South Korea GU253854 GU269837 GU384550 GU320540 

CPC 10530; CBS 132130 P.W.Crous Ligustrum sp. Oleaceae Netherlands GU253855 GU269838 GU384551 GU320541 

CPC 10861; CBS 132025 H.D. Shin Ligustrum ovalifolium Oleaceae South Korea GU253856 GU269839 GU384552 GU320542 

Trochophora fasciculata CPC 10282 H.D. Shin Daphniphyllum macropodum Daphniphyllaceae South Korea FJ839668 FJ839632 — — 

Trochophora simplex CBS 124744 H.D. Shin Daphniphyllum macropodum Daphniphyllaceae South Korea GU253880 GU269872 GU384580 GU320568 

MUCC 952 C. Nakashima & I. Araki Daphniphyllum teijsmannii Daphniphyllaceae Japan GU253879 — — — 

Xenostigmina zilleri CBS 115685 K.A. Seifert Acer sp. Aceraceae Canada GU253857 GU269840 GU384553 GU320543 

CBS 115686 K.A. Seifert Acer sp. Aceraceae Canada FJ839676/ 

GU253858 

GU269841 GU384554 GU320544 

Zasmidium nabiacense CBS 125010; CPC 12748 A.J. Carnegie Eucalyptus sp. Myrtaceae Australia GQ852734 GQ852841 GU384507 GU320498 

1 CBS: CBS-KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands; CIRAD: Centre de Coopération Internationale en Recherche Agronomique pour le Développement, UMR-BGPI, Montpellier, France; CMW: Culture Collection of the Forestry and 

Agricultural Biotechnology Institute (FABI) of the University of Pretoria, Pretoria, South Africa; CPC: Culture collection of Pedro Crous, housed at CBS; MUCC: Culture Collection, Laboratory of Plant Pathology, Mie University, Tsu, Mie Prefecture, Japan. 

2 LSU: partial 28S nrRNA gene; ITS: internal transcribed spacer regions 1 & 2 including 5.8S nrRNA gene; EF-1α: partial translation elongation factor 1-alpha gene; ACT: partial actin gene. 

3 Sequence for this locus obtained from: http://genome.jgi-psf.org/Mycfi1/Mycfi1.home.html 


51

Crous et al. 

1 000 generations, resulting in 8 001 saved trees in each of the 

two tree files. Burn-in was set at 2 000 000 generations after which 

the likelihood values were stationary. For parsimony analysis of the 

combined ITS, ACT and EF-1α alignment, alignment gaps were 

treated as a fifth character state and all characters were unordered 

and of equal weight. Maximum parsimony analysis was performed 

in PAUP using the heuristic search option with 100 random taxon 

additions and tree bisection and reconnection (TBR) as the branchswapping 

algorithm. Branches of zero length were collapsed 

and all multiple, equally most parsimonious trees were saved. 

The robustness of the trees was evaluated by 1 000 bootstrap 

replicates (Hillis & Bull 1993). Tree length (TL), consistency index 

(CI), retention index (RI) and rescaled consistency index (RC) were 

calculated and the resulting trees were printed with Geneious v. 

5.5.4 (Drummond et al. 2011). Sequences derived in this study 

were deposited in GenBank (Table 1), the alignments in TreeBASE 

(www.treebase.org/treebase/index.html), and taxonomic novelties 

in MycoBank (www.MycoBank.org; Crous et al. 2004b). 

Taxonomy 

All taxonomic descriptions were based on structures on 

herbarium material. Diseased leaf tissue was viewed under a 

Nikon® SMZ1500 stereoscopic zoom microscope and relevant 

morphological structures were lifted from lesions with a sterile 

dissecting needle and mounted on glass slides in clear lactic acid. 

For measurements, 30–50 replicates of all relevant morphological 

features were made at ×1 000 magnification using a Carl Zeiss® 

Axioskop 2 plus light microscope. High-resolution photographic 

images of diseased material, leaf lesions and microscopic fungal 

structures were captured with a Nikon® digital sight DS-fi1 high 

definition colour camera mounted on the light microscope or a 

Nikon® digital sight DS-5M camera mounted on a stereoscopic 

zoom microscope. Images of morphological structures were 

captured, and measurements taken, using the Nikon® software 

NIS-Elements v. 2.34 while Adobe Photoshop was used for the final 

editing of acquired images and photographic preparations. Novel 

Pseudocercospora taxa were plated onto MEA and incubated at 

24 °C for 2–4 wk in the dark in duplicate. The mycological colour 

charts of Rayner (1970) were used to define colours of the fungal 

colonies. 

RESULTS 

DNA sequencing and phylogenetic analyses 

Large Subunit (LSU) phylogeny: The final aligned LSU dataset 

contained 316 ingroup taxa with a total of 1305 characters and 

Saccharomyces cerevisiae (GenBank Accession: Z73326) served 

as the outgroup taxon. From this alignment 827 characters 

were used for the Bayesian analysis; the consensus trees and 

posterior probabilities were calculated (Fig. 4) from the 12 002 

trees left after discarding those used for burn-in. The resulting 

LSU phylogeny resolved several clades (Clades 1–14) grouping 

species of Pseudocercospora and allied genera (Fig. 4). Clade 1 

(Posterior Probability (PP) value of 1.0) including Cyphellophora 

and Strelitziana represented by one of the two basal lineages. 

Thedgonia ligustrina (100 %) represented the second basal clade 

(PP = 1.0). In the Pleosporales, Clade 3 included Xenostigmina 

zilleri (PP = 1.0) and Clade 4 Pseudocercospora cantuariensis (PP 

= 1.0), the latter being described below as Phaeomycocentrospora 

cantuariensis. Clade 5 contained Cladosporium species belonging 

to the teleomorph genus Davidiella (PP = 1.0). Clade 6 (PP = 1.0) 

represented species belonging to Teratosphaeria and including 

the recently established genus Microcyclospora. Clade 7 (PP = 

1.0) accommodated species of Dissoconium. Clade 8 (PP = 1.0) 

including species representing Mycosphaerella, Pseudocercospora 

and Zasmidium, as well as the recently established genus 

Microcyclosporella. Clade 9 (PP = 1.0) included Pseudocercospora 

tibouchinigena, Pseudocercospora egenula described below as 

Paracercospora egenula and the Mycosphaerella ellipsoidea 

complex. Clade 10 (PP = 1.0) accommodated species of other 

genera namely Pseudocercosporella, Mycosphaerella ulmi 

(Phleospora), Muiraea, Cercospora and Septoria. Clade 11 

(PP = 1.0) included Mycosphaerella species with Sonderhenia 

anamorphs. Clade 12 (PP = 1.0) is sister to Clade 11 and included 

species representing taxa of Mycosphaerella and their associated 

pseudocercospora-like anamorphs, appeared to represent a 

novel genus. Other genera in this clade included Scolecostigmina 

and Trochophora. The isolates representing Trochophora are 

accommodated at a basal position in this clade with no PP support. 

The three isolates of Scolecostigmina mangiferae resided in a 

well-supported sub-clade (PP = 1.0) close to isolates regarded 

as part of the Mycosphaerella heimii complex (P. acaciigena, M. 

irregulariramosa, M. colombiensis, P. thailandica, M. heimii, M. 

heimioides, M. konae), described below in Pallidocercospora. 

Clade 13 (PP = 1.0) accommodated Passalora eucalypti. The 

remainder of the phylogeny encompassed Clade 14 (PP = 1.0), 

representing Pseudocercospora s. str., and accommodated the 

majority of Pseudocercospora species from many different hosts. 

The type species of Pseudocercospora, P. vitis was included in 

this clade. Interestingly, P. vitis was basal in this clade with the 

majority of Pseudocercospora species radiating out from the basal 

Pseudocercospora isolates. The LSU phylogeny provided a wellsupported 

sub-clade (PP = 1.0) representing the second half of 

the sensu stricto clade (Clade 14). Several isolates representing 

species from genera morphologically allied to Pseudocercospora 

were also grouped in Clade 14. These included Stigmina platani, 

Cercostigmina protearum var. leucadendri (as Pseudocercospora 

leucadendri, see below), Cercostigmina protearum var. hakeae 

(as Pseudocercospora hakea, see below), Phaeoisariopsis 

griseola f. griseola (as Pseudocercospora griseola f. griseola, 

see Crous et al. 2006) and Pseudophaeoramularia angolensis 

(as Pseudocercospora angolensis, see below), which supports 

previous proposals to include these genera in Pseudocercospora 

s. str. 

Pseudocercospora s. str. phylogeny: A further analysis was 

conducted on Clade 14 (Fig. 4), representing Pseudocercospora 

s. str. For this analysis, DNA sequence data from the ITS, ACT 

and EF-1α gene regions were combined in the parsimony analysis. 

For this dataset, there was a total of 194 taxa, each representing 

1 029 characters. Passalora eucalypti (CBS 111318) served as the 

outgroup taxon for this analysis. From the combined alignment of 

1 029 characters, 414 were constant, 124 were variable and 491 

characters were parsimony uninformative. Only the first 1 000 

equally most parsimonious trees were saved, the first of which is 

shown (Fig. 5) (TL = 4315, CI = 0.312, RI = 0.819, RC = 0.256). 

The phylogeny resulting from the combined sequence data 

was more structured towards the terminal nodes than the LSU 

phylogeny. Similar to the LSU phylogeny, a split was observed 

within Pseudocercospora s. str., with at least two main clades 

being evident. Although present in the strict consensus tree, this 

52


Saccharomyces cerevisiae Z73326 

Cyphellophora eucalypti CBS 124764 

Cyphellophora laciniata FJ358239 

Phialophora europaea FJ358248 

Fonsecaea pedrosoi AF356666 

Capronia peltigerae HQ613813 

Chaetothyriales 

Glyphium elatum AF346420 

Coniosporium perforans FJ358237 

Sarcinomyces petricola FJ358249 

Strelitziana australiensis CPC 13556 

Strelitziana australiensis GQ303326 

Thedgonia ligustrina EU040242 

Thedgonia ligustrina CPC 10019 


Helotiales 


Mycopappus aceris FJ839660 

Pleosporales, 

Xenostigmina zilleri GU253857 

Xenostigmina zilleri FJ839676 

Phaeosphaeriaceae 

Neottiosporina paspali EU754172 

Pleurophoma pleurospora EU754200 

Byssothecium circinans AY016357 

Corynespora olivacea GU301809 

Phoma carteri GQ387594 

Phoma violicola GU238156 

Ascochyta hordei var. hordei EU754134 

Phaeomycocentrospora cantuariensis CPC 10157 

Phaeomycocentrospora cantuariensis CPC 10762 Pleosporales 



Cladosporium cladosporioides EU019262 

Cladosporium herbarum DQ678074 

Cladosporium allicinum EU019263 

Cladosporium allicinum EU019261 

Teratosphaeria molleriana EU167583 

Teratosphaeria dimorpha FJ493215 

Teratosphaeria fibrillosa GU214506 

Teratosphaeria stellenboschiana CPC 13767 

Teratosphaeria alcornii CBS 313.76 

Teratosphaeria nubilosa DQ246228 

Penidiella columbiana EU019274 

Penidiella eucalypti EU882145 

Catenulostroma eucalyptorum JF951174 

Phaeothecoidea eucalypti EU019280 Capnodiales, 

Readeriella nontingens FJ493201 

Readeriella mirabilis EU019291 Teratosphaeriaceae 

Readeriella novaezelandiae DQ246239 

Teratosphaeria flexuosa FJ493216 

Teratosphaeria ohnowa EU019305 

Catenulostroma abietis EU019249 

Catenulostroma germanicum EU019253 

Pseudocercosporella fraxini GU214682 

Microcyclospora tardicrescens GU570552 

“Pseudocercospora” sp. GU214681 

Microcyclospora pomicola GU570551 

Microcyclospora malicola GU570549 

Microcyclospora malicola GU570550 

Dissoconium aciculare EU019266 

Dissoconium dekkeri GU214422 

Dissoconium dekkeri DQ204768 

Dissoconium commune DQ246262 

Dissoconium commune EU019267 

Posterior probability values 

= 1.0 

= 0.95 to 0.99 

= 0.90 to 0.94 

= 0.80 to 0.89 

= 0.70 to 0.79 

Capnodiales, 

Cladosporiaceae 

Capnodiales, 

Dissoconiaceae 

1 

2 

3 

4 

5 

6 

7 

0.5 

Fig. 4. Consensus phylogram (50 % majority rule) of 12 002 trees resulting from a Bayesian analysis of the LSU sequence alignment using MrBayes v. 3.1.2. Bayesian posterior 

probabilities are indicated with colour-coded branches (see legend) and the scale bar represents the expected changes per site. Important clades are indicated in coloured 

blocks and numbered. The tree was rooted to Saccharomyces cerevisiae (GenBank Z73326). 


53

Crous et al. 

Capnodiales, Mycosphaerellaceae 

Zasmidium nabiacense GQ852734 

Mycosphaerella marksii DQ246250 

Pseudocercospora epispermogonia DQ204757 

Mycosphaerella madeirae DQ204756 

Microcyclosporella mali GU570545 

Microcyclosporella mali GU570548 

Mycosphaerella laricina CBS 326.52 

Paracercospora egenula CPC 12537 

Paracercospora egenula MUCC 883 

Paracercospora egenula CBS 485.81 

Passalora brachycarpa GU214664 

“Pseudocercospora” tibouchinigena CBS 116462 

Mycosphaerella ellipsoidea GU214434 

Mycosphaerella africana DQ246257 

Mycosphaerella aurantia DQ246256 

Cercospora sojina CPC 12322 

Pseudocercosporella oxalidis CBS 118758 

Cercospora zebrinae GU214657 

Cercospora capsici GU214654 

Cercospora apii GU214653 

Cercospora rodmanii GQ884186 

Pseudocercosporella arcuata GU214685 

Pseudocercosporella sp. CPC 10864 

Septoria eucalyptorum CPC 11282 

Septoria justiciae CPC 12509 

Cercospora eucommiae CPC 10047 



Septoria cerastii CPC 12343 

Septoria chelidonii CPC 12337 

Septoria crepidis CPC 12539 

Septoria dysentericae CPC 12328 

Septoria erigerontis CPC 12340 

Septoria rubi CPC 12331 

Pseudocercosporella zelkovae GU214482 

Pseudocercosporella capsellae CPC 14773 

Phloeospora ulmi CBS 344.97 


Pseudocercosporella koreana GU214683 

Septoria quercicola CBS 663.94 

Pseudocercosporella cydoniae CPC 14795 

Miuraea persicae CPC 10069 

Miuraea persicae CPC 10828 

Mycosphaerella swartii DQ923536 

Mycosphaerella walkeri DQ267574 

Trochophora fasciculata FJ839668 

Trochophora simplex MUCC 952 

Trochophora simplex CBS 124744 

Pallidocercospora holualoana GU214440 

Pallidocercospora holualoana JF770467 

Pallidocercospora acaciigena GU214661 

Pallidocercospora acaciigena CBS 120740 

Pallidocercospora crystallina DQ204747 

Pallidocercospora irregulariramosa DQ204754 

“Pseudocercospora” colombiensis DQ204744 

“Pseudocercospora” thailandica CPC 10548 

“Pseudocercospora” thailandica CBS 116367 

Pallidocercospora konae CBS 120748 

Pallidocercospora heimii DQ204751 

Pallidocercospora heimioides DQ204753 

Scolecostigmina mangiferae strain 3 

Scolecostigmina mangiferae CPC 17352 

Scolecostigmina mangiferae CBS 125467 

8 

9 

10 

11 

12 


= 1.0 

= 0.95 to 0.99 

= 0.90 to 0.94 

= 0.80 to 0.89 

= 0.70 to 0.79 

0.5 

Fig. 4. (Continued). 

54



Passalora eucalypti CBS 111318 

Passalora eucalypti DQ246244 

Pseudocercospora vitis CPC 14661 

Pseudocercospora vitis CPC 11595 

Pseudocercospora dianellae CBS 117746 

Pseudocercospora lyoniae MUCC 910 

Pseudocercospora metrosideri CBS 118795 

Pseudocercospora myrticola MUCC 632 

Pseudocercospora pouzolziae CBS 122280 

Pseudocercospora rumohrae CBS 117747 

Pseudocercospora luzardii CPC 2556 

Pseudocercospora nephrolepidis CBS 119121 

Pseudocercospora profusa CPC 10055 

Pseudocercospora proteae CPC 15217 

Pseudocercospora balsaminae CPC 10044 

Pseudocercospora crousii CBS 119487 

Pseudocercospora cymbidiicola CBS 115132 

Pseudocercospora viburnigena CPC 15249 

Pseudocercospora fori CBS 113285 

Pseudocercospora natalensis CBS 111069 

Pseudocercospora gracilis CBS 243.94 

Pseudocercospora robusta CBS 111175 

Pseudocercospora eucalyptorum CBS 110777 

Pseudocercospora eucalyptorum CPC 12406 










Pseudocercospora humulicola CPC 11358 

Pseudocercospora ixorae CBS 118760 



Pseudocercospora plecthranthi CPC 11462 

Pseudocercospora crocinus CPC 11668 


Pseudocercospora humulicola CPC 10049 

Pseudocercospora cladosporioides CBS 117482 

Pseudocercospora rhabdothamni CBS 114872 

Pseudocercospora sawadae CBS 115024 



Pseudocercospora angolensis CBS 112933 

Pseudocercospora angolensis CBS 149.53 

Pseudocercospora cf. kaki CPC 10636 

Pseudocercospora palleobrunnea CBS 124771 

Pseudocercospora sambucigena CPC 10292 

Pseudocercospora sambucigena CPC 14397 

Stigmina platani CBS 336.33 

Pseudocercospora pseudostigmina-platani CPC 11726 

Pseudocercospora arecacearum CBS 118406 

Pseudocercospora arecacearum CBS 118792 

Pseudocercospora sp. CBS 113387 

Pseudocercospora coprosmae CBS 114639 

Pseudocercospora griseola f. griseola CBS 194.47 

Pseudocercospora griseola f. griseola CPC 12239 

Pseudocercospora griseola f. griseola CBS 119112 




Pseudocercospora griseola f. griseola CBS 880.72 

13 

14 


= 1.0 

= 0.95 to 0.99 

= 0.90 to 0.94 

= 0.80 to 0.89 

= 0.70 to 0.79 

0.5 


55

Crous et al. 

Ps. macrospora CBS 114696 

Ps. norchiensis CBS 120738 

Ps. norchiensis CBS 114641 

Ps. sordida MUCC 913 


Ps. purpurea CBS 114163 

Ps. nogalesii CBS 115022 

Ps. ocimi-basilici CPC 10283 

Ps. rhododendri-indici CPC 10822 

Ps. punctata CPC 14734 

Ps. leucadendri CPC 1869 

Ps. fori CPC 14880 

Ps. theae CBS 128.30 

Ps. basitruncata CBS 114664 

Ps. subulata CBS 118489 

Ps. libertiae CBS 114643 

Ps. melicyti CBS 115023 

Ps. dendrobii MUCC 596 

Ps. jussiaeae CPC 14625 

Ps. lythri CPC 14588 

Ps. lythri MUCC 865 

Ps. araliae CPC 10154 

Ps. araliae MUCC 873 

Pseudocercospora sp. CPC 15116 

Ps. abelmoschi CPC 14478 


Ps. assamensis CBS 122467 

Ps. basiramifera CBS 111072 

Ps. callicarpae MUCC 888 

Ps. catappae MUCC 809 

Ps. cercidicola MUCC 896 

Ps. cercidis-chinensis CPC 14481 


Ps. chengtuensis MUCC 828 

Ps. chionanthi-retusi CPC 14683 

Ps. chrysanthemicola CPC 10633 

Ps. contraria CPC 14714 

Ps. coriariae MUCC 840 

Ps. cornicola MUCC 909 

Ps. corylopsidis MUCC 908 

Ps. cotoneastri MUCC 876 

Ps. cf. cruenta CBS 117232 

Ps. catalpigena MUCC 743 

Ps. davidiicola MUCC 296 

Ps. destructiva MUCC 870 

Ps. elaeocarpi MUCC 925 

Ps. eupatoriella CBS 113372 

Ps. exosporioides MUCC 893 

Ps. fraxinites CPC 10743 

Ps. fukuokaensis MUCC 887 

Ps. fuligena MUCC 533 

Ps. fukuokaensis CPC 14689 

Ps. glauca CPC 10062 

Ps. guianensis MUCC 855 

Ps. guianensis MUCC 879 

Ps. corylopsidis MUCC 874 

Ps. humuli MUCC 742 

Ps. kaki MUCC 900 

Ps. latens MUCC 763 

Ps. lilacis CPC 12767 

Ps. indonesiana CBS 122473 

Ps. lonicericola MUCC 889 

Ps. lythracearum CPC 10707 

Ps. lythracearum MUCC 890 


= 1.0 

= 0.95 to 0.99 

= 0.90 to 0.94 

= 0.80 to 0.89 

= 0.70 to 0.79 

Ps. = Pseudocercospora 

14 

cont. 

Ps. mali MUCC 886 

Ps. nandinae CBS 117745 

Ps. oenotherae CPC 10630 

Ps. pancratii CBS 137.94 

Ps. paraguayensis CBS 111317 

Ps. pini-densiflorae MUCC 534 

Ps. puderi MUCC 906 

Ps. pyracanthae MUCC 892 

Ps. rhapisicola CBS 282.66 

Ps. securinegae CPC 10793 



Ps. basiramifera CBS 114757 

Ps. ranjita CPC 11141 

Ps. dovyalidis CPC 13771 

Ps. haiweiensis CPC 14084 

Ps. stahlii CBS 117549 

Ps. stephanandrae MUCC 914 

Ps. timorensis MUCC 819 

Ps. variicolor MUCC 746 

Ps. viticicola MUCC 777 

Ps. weigelae MUCC 899 

Ps. zelkovae CPC 14484 

Ps. zelkovae CPC 14717 

Ps. acericola CBS 122279 

Ps. cydoniae CPC 10678 

Ps. eustomatis CBS 110822 

Ps. marginalis CPC 12497 

Ps. flavomarginata CBS 118841 

Ps. flavomarginata CBS 124990 

Ps. flavomarginata CPC 14142 

Ps. fraxinites MUCC 891 

Ps. ravenalicola CBS 122468 

Ps. subsessilis CBS 136.94 

Ps. crispans CPC 14883 

Ps. rubi MUCC 875 

Ps. rhamnellae CPC 12500 

Ps. zelkovae MUCC 872 

Ps. atromarginalis CPC 11372 

Ps. paederiae CPC 10007 

Ps. subtorulosa CBS 117230 

Ps. longispora CBS 122470 

Ps. xanthoxyli CPC 10065 

Ps. ampelopsis CPC 11680 

Ps. paraguayensis CBS 111286 

Ps. circumscissa CPC 14511 

Ps. atromarginalis CBS 114640 

Ps. cordiana CBS 114685 

Ps. cruenta CPC 10846 

Ps. pallida CPC 10776 

Ps. kiggelariae CPC 11853 

Ps. xanthocercidis CPC 11665 

Ps. chengtuensis CPC 10696 

Ps. indonesiana CBS 122474 

Ps. fuligena CPC 12296 

Ps. oenotherae CPC 10290 

Ps. tereticornis CPC 13299 

Ps. tereticornis CBS 124996 


Ps. rhoina CPC 11464 

Ps. fijiensis MUCC 792 

Ps. fijiensis CBS 120258 

Ps. hakeae CBS 112226 

Ps. musae CBS 116634 

Ps. dodonaeae CBS 114647 

0.5 

14 

cont. 

56


Passalora eucalypti CBS 111318 

100 Ps. vitis CPC 11595 Vitis, Vitaceae 

Ps. vitis CPC 14661 Vitis, Vitaceae 

Ps. luzardii CPC 2556 Hancornia, Apocynaceae 

100 66 Ps. purpurea CBS 114163 Persea, Lauraceae 

Ps. sordida MUCC 913 Campsis, Bignoniaceae 

95 

Ps. macrospora CBS 114696 Bertholletia, Lecythidaceae 

Ps. nogalesii CBS 115022 Chamaecytisus, Fabaceae 

57 

Pseudocercospora sp. CBS 111373 Eucalyptus, Myrtaceae 

100 

85 Ps. norchiensis CBS 120738 Eucalyptus, Myrtaceae 

100 Ps. norchiensis CBS 114641 Rubus, Rosaceae 

100 

Pseudocercospora sp. CBS 113387 Lantana, Verbenaceae 

100 Ps. sambucigena CPC 10292 Sambucus, Caprifoliaceae 

96 

Ps. sambucigena CPC 14397 Sambucus, Caprifoliaceae 

Ps. pseudostigmina-platani CPC 11726 Platanus, Platanaceae 

67 

Ps. griseola f. griseola CPC 10480 Phaseolus, Fabaceae 

100 Ps. griseola f. griseola CPC 10779 Phaseolus, Fabaceae 


83 

Ps. griseola f. griseola CBS 194.47 Phaseolus, Fabaceae 

Ps. griseola f. griseola CBS 880.72 Phaseolus, Fabaceae 

Ps. griseola f. griseola CBS 119112 Phaseolus, Fabaceae 


Ps. basitruncata CBS 114664 Eucalyptus, Myrtaceae 

100 Ps. angolensis CBS 149.53 Citrus, Rutaceae 

85 Ps. angolensis CPC 4118 Citrus, Rutaceae 

10 changes 

99 

Ps. ocimi-basilici CPC 10283 Ocimum, Lamiaceae 

84 

Ps. punctata CPC 14734 Syzygium, Myrtaceae 

Ps. udagawana CPC 10799 Hovenia, Rhamnaceae 

Ps. cladosporioides CBS 117482 Olea, Oleaceae 

81 

Pseudocercospora sp. CPC 10058 Potentilla, Rosaceae 

Ps. jussiaeae CPC 14625 Ludwigia, Onagraceae 

Ps. dendrobii MUCC 596 Dendrobium, Orchidaceae 

88 

62 Ps. araliae CPC 10154 Aralia, Araliaceae 

76 98 Ps. araliae MUCC 873 Aralia, Araliaceae 

100 Ps. lythri CPC 14588 Lythrum, Lythraceae 

68 

94 

99 

Ps. lythri MUCC 865 Lythrum, Lythraceae 

Ps. nephrolepidis CBS 119121 Nephrolepis, Oleandraceae 

100 

Ps. pouzolziae CBS 122280 Gonostegia, Urticaceae 

Ps. rumohrae CBS 117747 Marattia, Marattiaceae 

Ps. plecthranthi CPC 11462 Plectranthus, Lamiaceae 

99 Ps. balsaminae CPC 10044 Impatiens, Balsaminaceae 

81 Ps. dianellae CBS 117746 Dianella, Liliaceae 

Ps. rhabdothamni CBS 114872 Rhabdothamnus, Gesneriaceae 

95 

Ps. humulicola CPC 10049 Humulus, Cannabaceae 

Ps. humulicola CPC 11358 Humulus, Cannabaceae 

Ps. crocea CPC 11668 Pilea, Urticaceae 

95 57 

96 

Ps. profusa CPC 10055 Acalypha, Euphorbiaceae 

Ps. profusa CPC 10042 Acalypha, Euphorbiaceae 

Ps. robusta CBS 111175 Eucalyptus, Myrtaceae 

100 

100 

Ps. gracilis CBS 243.94 Eucalyptus, Myrtaceae 

Ps. eucalyptorum CPC 12957 Eucalyptus, Myrtaceae 



100 Ps. eucalyptorum CPC 13926 Eucalyptus, Myrtaceae 

64 




Ps. eucalyptorum CBS 116359 Eucalyptus, Myrtaceae 

Ps. eucalyptorum CBS 110777 Eucalyptus, Myrtaceae 


87 






Fig. 5. The first of 1 000 equally most parsimonious trees obtained from a heuristic search with 100 random taxon additions of the combined ITS, ACT and EF-1α sequence 

alignment using PAUP v. 4.0b10. The scale bar shows 10 changes, and bootstrap support values from 1 000 replicates are shown at the nodes. Thickened lines indicate those 

branches present in the strict consensus tree and the tree was rooted to Passalora eucalypti strain CBS 111318 (GenBank GU269845, GU320548 and GU384558, respectively). 


57

Crous et al. 

Ps. rhododendri-indici CPC 10822 Rhododendron, Ericaceae 

Ps. coprosmae CBS 114639 Coprosma, Rubiaceae 

83 100 

Ps. arecacearum CBS 118406 Rhopalostylis, Arecaceae 

Ps. arecacearum CBS 118792 Howea, Arecaceae 

Ps. cf. kaki CPC 10636 Diospyros, Ebenaceae 

55 

Ps. leucadendri CPC 1869 Leucadendron, Proteaceae 

Ps. myrticola MUCC 632 Myrtus, Myrtaceae 

83 

Ps. proteae CPC 15217 Protea, Proteaceae 

Ps. ixorae CBS 118760 Ixora, Rubiaceae 

Ps. cymbidiicola CBS 115132 Cymbidium, Orchidaceae 

76 Ps. lyoniae MUCC 910 Lyonia, Ericaceae 

Ps. theae CBS 128.30 Camelia, Theaceae 

Ps. fori CBS 113285 Eucalyptus, Myrtaceae 

Ps. fori CPC 14880 Eucalyptus, Myrtaceae 

89 

Ps. natalensis CBS 111069 Eucalyptus, Myrtaceae 

59 

Ps. natalensis CBS 111071 Eucalyptus, Myrtaceae 

Ps. libertiae CBS 114643 Libertia, Iridaceae 

Ps. metrosideri CBS 118795 Metrosideros, Myrtaceae 

Ps. melicyti CBS 115023 Melicytus, Violaceae 

Ps. palleobrunnea CPC 13387 Syzygium, Myrtaceae 

Ps. subulata CPC 10849 Eucalyptus, Myrtaceae 

76 

62 Ps. crousii CBS 119487 Eucalyptus, Myrtaceae 

Ps. sawadae CBS 115024 Psidium, Myrtaceae 

Ps. viburnigena CPC 15249 Viburnum, Caprifoliaceae 

Ps. rhoina CPC 11464 Rhus, Anacardiaceae 

100 Ps. xanthoxyli CPC 10065 Xanthoxylum, Rutaceae 

Ps. snelliana CPC 11654 Morus, Moraceae 

Ps. securinegae CPC 10793 Flueggea, Euphorbiaceae 

100 Ps. fijiensis MUCC 792 Musa, Musaceae 

Ps. fijiensis CBS 120258 Musa, Musaceae 

Ps. acericola CBS 122279 Acer, Aceraceae 

81 

Ps. subtorulosa CBS 117230 Melicope, Rutaceae 

60 Pseudocercospora sp. CPC 10645 

100 Ps. eustomatis CBS 110822 Eustroma, Gentianaceae 

94 Ps. oenotherae CPC 10630 Oenothera, Onagraceae 

65 Ps. oenotherae CPC 10290 Oenothera, Onagraceae 

Ps. cruenta CPC 10846 Vigna, Fabaceae 

100 Ps. atromarginalis CBS 114640 Solanum, Solanaceae 

Ps. atromarginalis CPC 11372 Solanum, Solanaceae 

100 Ps. chengtuensis CPC 10696 Lycium, Solanaceae 

Ps. fuligena CPC 12296 Lycopersicon, Solanaceae 

86 

Ps. fuligena MUCC 533 Solanum, Solanaceae 

91 Ps. nandinae CBS 117745 Nandina, Berberidaceae 

Ps. cordiana CPC 2552 Cordia, Boraginaceae 

82 

Pseudocercospora sp. CBS 110998 Eucalyptus, Myrtaceae 

51 Ps. paraguayensis CBS 111286 Eucalyptus, Myrtaceae 

Ps. paraguayensis CPC 1458 Eucalyptus, Myrtaceae 

89 

Ps. pini-densiflorae MUCC 534 Pinus, Pinaceae 

68 

Ps. pyracanthigena CPC 10808 Pyracantha, Rosaceae 

Ps. fukuokaensis CPC 14689 Styrax, Styracaceae 

94 

Ps. fukuokaensis MUCC 887 Styrax, Styracaceae 

64 

Ps. mali MUCC 886 Malus, Rosaceae 

Ps. cercidis-chinensis CPC 14481 Cercis, Fabaceae 

Ps. glauca CPC 10062 Albizzia, Fabaceae 

Ps. chrysanthemicola CPC 10633 Chrysanthemum, Asteraceae 

100 Ps. marginalis CPC 12497 Fraxinus, Oleaceae 

100 Ps. chionanthi-retusi CPC 14683 Chionanthus, Oleaceae 

10 changes 


split was not well-supported in the phylogeny. Deeper nodes of 

the backbone were poorly supported. There were high levels of 

support for several of the smaller sub-clades in this tree, which are 

discussed in the Taxonomy section below. 

Taxonomy 

Isolates representing 146 species of Pseudocercospora were 

subjected to DNA analysis and morphological comparison. 

Phylogenetic analyses based on the LSU gene resolved a total of 

14 clades in the Pseudocercospora complex. 

58


69 

69 

10 changes 

Ps. ampelopsis CPC 11680 Ampelopsis, Vitaceae 

Ps. hakeae CBS 112226 Grevillea, Proteaceae 

100 Ps. longispora CBS 122470 Musa, Musaceae 

Ps. musae CBS 116634 Musa, Musaceae 

99 Ps. assamensis CBS 122467 Musa, Musaceae 

Ps. indonesiana CBS 122474 Musa, Musaceae 

99 Ps. indonesiana CBS 122473 Musa, Musaceae 

Ps. cydoniae CPC 10678 Chaenomeles, Rosaceae 

Ps. cornicola MUCC 909 Cornus, Cornaceae 

99 

Ps. eupatoriella CBS 113372 Chromolaena, Asteraceae 

95 

66 Ps. lilacis CPC 12767 Ligustrum, Oleaceae 

97 Pseudocercospora sp. CPC 15116 Malus, Rosaceae 

100 Ps. crispans CPC 14883 Eucalyptus, Myrtaceae 

Pseudocercospora sp. CBS 110993 Populus, Salicaceae 

Ps. cf. cruenta CBS 117232 Phaseolus, Fabaceae 

55 

Ps. xanthocercidis CPC 11665 Xanthocercis, Fabaceae 

Ps. catappae MUCC 809 Terminalia, Combretaceae 

82 

Ps. destructiva MUCC 870 Euonymus, Celastraceae 

95 Ps. fraxinites CPC 10743 Fontanesia, Oleaceae 

100 Ps. fraxinites MUCC 891 Fraxinus, Oleaceae 

Ps. ravenalicola CBS 122468 Ravenala, Strelitziaceae 

Ps. dovyalidis CPC 13771 Dovyalis, Flacourtiaceae 

87 

Ps. stahlii CBS 117549 Passiflora, Passifloraceae 

Ps. kiggelariae CPC 11853 Kiggelaria, Flacourtiaceae 

Ps. basiramifera CBS 111072 Eucalyptus, Myrtaceae 

100 

Ps. basiramifera CBS 114757 Eucalyptus, Myrtaceae 

Ps. humuli MUCC 742 Humulus, Cannabaceae 

84 

Ps. puderi MUCC 906 Rosa, Rosaceae 

Ps. cercidicola MUCC 896 Cercis, Fabaceae 

Ps. abelmoschi CPC 14478 Hibiscus, Malvaceae 

60 

Ps. coriariae MUCC 840 Coriaria, Coriariaceae 

Ps. callicarpae MUCC 888 Callicarpa, Verbenaceae 

Ps. davidiicola MUCC 296 Davidia, Nyssaceae 

Ps. dodonaeae CBS 114647 Dodonaea, Sapindaceae 

Ps. ranjita CPC 11141 Gmelina, Verbenaceae 

Ps. timorensis MUCC 819 Ipomoea, Convolvulaceae 

100 Ps. tereticornis CBS 124996 Eucalyptus, Myrtaceae 

Ps. tereticornis CPC 13299 Eucalyptus, Myrtaceae 

100 Ps. flavomarginata CPC 13492 Eucalyptus, Myrtaceae 

Ps. flavomarginata CMW 13586 Eucalyptus, Myrtaceae 

Ps. flavomarginata CPC 14142 Eucalyptus, Myrtaceae 

Ps. pancratii CBS 137.94 Hippeastrum, Liliaceae 

100 

Ps. viticicola MUCC 777 Vitex, Verbenaceae 

Pseudocercospora sp. CPC 14711 Pyracantha, Rosaceae 

Ps. exosporioides MUCC 893 Sequoia, Taxodiaceae 

Ps. kaki MUCC 900 Diospyros, Ebenaceae 

Ps. lythracearum CPC 10707 Lagestroemia, Lythraceae 

78 Ps. lythracearum MUCC 890 Lagestroemia, Lythraceae 

Ps. lonicericola MUCC 889 Lonicera, Caprifoliaceae 

99 

Ps. variicolor MUCC 746 Paeonia, Paeoniaceae 

89 Ps. paederiae CPC 10007 Paederia, Rubiaceae 

Ps. subsessilis CBS 136.94 Melia, Meliaceae 

Ps. guianensis MUCC 855 Lantana, Verbenaceae 

100 

Ps. guianensis MUCC 879 Lantana, Verbenaceae 

100 Ps. pyracanthae MUCC 892 Pyracantha, Rosaceae 

61 Ps. weigelae MUCC 899 Weigela, Caprifoliaceae 

Ps. stephanandrae MUCC 914 Stephanandra, Rosaceae 

Ps. prunicola CPC 14511 Prunus, Rosaceae 

63 Ps. corylopsidis MUCC 908 Corylopsis, Hamamelidaceae 

Ps. corylopsidis MUCC 874 Hamamelis, Hamamelidaceae 

Ps. haiweiensis CPC 14084 Eucalyptus, Myrtaceae 

99 Ps. cotoneastri MUCC 876 Cotoneaster, Rosaceae 

Ps. elaeocarpi MUCC 925 Elaeocarpus, Elaeocarpaceae 

89 

Ps. latens MUCC 763 Lespedeza, Fabaceae 

72 

Ps. rhamnellae CPC 12500 Rhamnella, Rhamnaceae 

Ps. catalpigena MUCC 743 Catalpa, Bignoniaceae 

61 

Ps. pallida CPC 10776 Campsis, Bignoniaceae 

68 

Ps. rhapisicola CBS 282.66 Rhapis, Arecaceae 

58 Ps. contraria CPC 14714 Dioscorea, Dioscoreaceae 

Ps. rubi MUCC 875 Rubus, Rosaceae 

Ps. zelkovae MUCC 872 Zelkova, Ulmaceae 

88 

Ps. zelkovae CPC 14484 Zelkova, Ulmaceae 

95 

Ps. zelkovae CPC 14717 Zelkova, Ulmaceae 



59

Crous et al. 

Clade 1 represented Strelitziana (pseudocercospora-like 

but with a separating cell between conidia and conidiogenous 

cells) and Cyphellophora (pseudocercospora-like but phialides 

with flaring collarettes, situated directly on hyphae). Thedgonia 

ligustrina (pseudocercosporella-like, but conidia in chains) 

represented Clade 2. Clade 3 included several isolates of 

Pseudocercospora cantuariensis, which represents a novel genus, 

distinguished from Pseudocercospora based on its broad conidial 

hila and scars, as well hyaline mycelium, and the presence of 

hyphopodia-like structures. Xenostigmina zilleri, characterised 

as being stigmina-like, but also having sympodial proliferation 

of the conidiogenous cells, clustered in Clade 4, which was 

basal to Cladosporium (Cladosporiaceae; Clade 5). Clade 6 

represented several members of Teratosphaeriaceae, known 

to have a wide range of anamorphs, including Microcyclospora. 

Clade 7 represented species of Dissoconium (Dissoconiaceae), 

distinct due to their dimorphic conidia that are actively discharged. 

Clade 8 remains unresolved, and was represented by disjunct 

elements appearing Zasmidium- and pseudocercospora-like 

in morphology, including Microcyclosporella. Clade 9 was 

represented by several Mycosphaerella species such as M. laricina 

(anamorph Pseudocercospora sp.), and Paracercospora egenula. 

Paracercospora was separated from Pseudocercospora based on 

a combination of characters, including pale olivaceous conidia, and 

a minute thickening along the rim of its conidial hila and scars. Clade 

10 included a diverse assemblage of genera. Two genera that differ 

mainly based on their conidiomatal structure, Pseudocercosporella 

and Septoria, clustered in this clade. Miuraea, a genus intermediate 

between Cercospora and Pseudocercospora, also resided within 

this clade. Clade 11 was represented by two coelomycetous species 

of Sonderhenia that clustered basal to Clade 12. The latter included 

a new genus with pseudocercospora-like anamorphs, mostly 

distinguished from Pseudocercospora s. str. by having species 

with smooth, pale brown conidia, and the frequent production 

of red crystals in agar (previously referred to in literature as the 

Mycosphaerella heimii complex). Scolecostigmina (based on S. 

mangiferae), which is characterised by verruculose conidia and 

percurrently proliferating conidiogenous cells, clustered alongside 

to Trochophora, characterised by brown sickle-shaped conidia with 

three thick, dark septa. Passalora eucalypti formed a separate 

lineage in Clade 13 that was adjacent to Pseudocercospora s. str. 

in Clade 14. This clade included the type species, P. vitis that is 

basal in this cluster. Although there was structure within the clade, 

we regard it as representing a single genus, including Stigmina 

platani, the type of Stigmina, Phaeoisariopsis (P. griseola), and 

Pseudophaeoramularia (P. angolensis). Several isolates identified 

from different countries as representing the same species based on 

host, disease symptoms and general morphology, clustered apart 

from one another. These collections were found to represent novel 

cryptic species. 

Treatment of species 

Several novel taxa were identified in this study on the basis 

of phylogenetic analyses of the various gene regions together 

with morphological examination of the specimens and isolates. 

Recognised clades, as well as novel species and genera, are 

described and discussed below. Where descriptions of known taxa 

are freely available online in MycoBank or journals, they are not 

repeated here, other than their generic circumscriptions. 

Clade 1: Strelitziana and Cyphellophora 

Strelitziana M. Arzanlou & Crous, Fungal Planet No. 8: 2006. 

Conidiophores erect, solitary, arising from aerial and submerged 

mycelium, subcylindrical, straight to geniculate-sinuous, pale 

brown. Conidiogenous cells terminal, integrated, rejuvenating 

percurrently, proliferating apically via several short, conspicuous 

denticles; conidiogenesis holoblastic with rhexolytic conidial 

secession. Conidia solitary, pale brown, smooth, long obclavate, 

multi-euseptate; microcyclic conidiation present in culture. 

Type species: Strelitziana africana M. Arzanlou & Crous, Fungal 

Planet No. 8. 2006. 

Notes: The genus Strelitziana presently accommodates four species 

that are primarily distinguished based on their conidial dimensions. 

These include S. africana, S. australiensis, S. eucalypti and S. mali 

(Arzanlou & Crous 2006, Cheewangkoon et al. 2009, Zhang et al. 

2009, Crous et al. 2010). 

Cyphellophora G.A. de Vries, Mycopathol. Mycol. Appl. 16: 

47. 1962. 

Colonies (on OA) with moderate to rapid growth, velvety to lanose, 

in various shades of grey; reverse black. Fertile hyphae pale brown, 

sometimes with constrictions at the septa. Conidiogenous cells 

phialidic, intercalary, sometimes on short side branches, each with 

a short, lateral or terminal collarette. Conidia sickle-shaped, brown, 

smooth-walled, transversely septate, adhering in small bundles 

(from de Vries 1962). 

Type species: Cyphellophora laciniata G.A. de Vries, Mycopathol. 

Mycol. Appl. 16: 47. 1962. 

Notes: The genus Cyphellophora, which is based on C. laciniata 

(isolated from human skin; De Vries et al. 1986), appears to be 

heterogeneous (Decock et al. 2003, Crous et al. 2007a, 2009a, 

Cheewangkoon et al. 2009) and requires further study. 

Clade 2: Thedgonia 

Thedgonia B. Sutton, Trans. Brit. Mycol. Soc. 61: 426. 1973. 

Foliicolous, phytopathogenic, causing discrete leaf spots. 

Conidiomata fasciculate, punctiform. Mycelium internal, hyphae 

subhyaline, septate, branched, forming substomatal stromata, 

hyaline to pale brown. Conidiophores fasciculate, arising from 

stromata, simple, rarely branched, subcylindrical, straight to 

geniculate-sinuous, continuous to septate, smooth, hyaline to 

pale yellowish green. Conidiogenous cells integrated, terminal, 

60


occasionally conidiophores reduced to conidiogenous cells, 

holoblastic-thalloblastic, sympodial, conidiogenous loci more or 

less planate, unthickened, non-pigmented. Conidia in disarticulating 

chains, rarely in branched chains, subcylindrical to obclavate, with 

one to several transverse eusepta, hyaline or almost so, apex 

rounded to truncate, base truncate, hila flat, unthickened, hyaline 

(Crous et al. 2009a). 

Type species: Thedgonia ligustrina B. Sutton, Trans. Brit. Mycol. 

Soc. 61: 426. 1973. 

Thedgonia ligustrina (Boerema) B. Sutton, Trans. Brit. 

Mycol. Soc. 61: 428. 1973. 

Basionym: Cercospora ligustrina Boerema, Tijdschr. Plantenziekten 

68: 117. 1962. 

≡ Cercoseptoria ligustrina (Boerema) Arx, Genera of Fungi Sporulating in 

Pure Culture, ed. 3: 306, Lehre 1981. 

Specimens examined: Asia, on Ligustrum sp., H. Evans, CPC 4296 = W2072, 

CPC 4297 = W 2073, CPC 4298 = W 1877. Netherlands, Eefde, on Ligustrum 

ovalifolium, 23 Mar. 1959, G.H. Boerema, holotype L, ex-type culture CBS 148.59; 

Bilthoven, on L. ovalifolium, 2003, P.W. Crous, CPC 10530 = CBS 124332, CPC 

10532, 10533. South Korea, Namyangju, on L. ovalifolium, 9 Oct. 2002, leg. H.D. 

Shin, isol. P.W. Crous, CBS H-20204, CPC 10019, 10861–10863; Suwon, on L. 

obtusifolium, 2 Oct. 2007, leg. H.D. Shin, isol. P.W. Crous, CBS H-20207, CPC 

14754–14756. 

Notes: Contrary to the earlier hypothesis that Thedgonia belonged 

to the Mycosphaerellaceae (Kaiser & Crous 1998), Crous et 

al. (2009a) showed that it resides in Helotiales. Consequently, 

thedgonia-like anamorphs that occur in the Mycosphaerellaceae 

must be accommodated elsewhere. 

Clade 3: Xenostigmina 

Xenostigmina Crous, Mycol. Mem. 21: 154. 1998. 

Foliicolous, phytopathogenic, causing discrete leaf spots. Mycelium 

internal, consisting of hyaline to pale brown, septate, branched, 

smooth hyphae. Conidiomata sporodochial, brown to black. 

Conidiophores densely aggregated, arising from the upper cells 

of a pale brown stroma, finely verruculose, hyaline to pale brown, 

multiseptate, subcylindrical, straight to variously curved, branched. 

Conidiogenous cells terminal and intercalary, hyaline to pale brown, 

finely verruculose, doliiform to subcylindrical, tapering to flat tipped 

loci, mono- to polyblastic, proliferating sympodially and percurrent; 

loci not thickened or conspicuous. Conidia solitary, pale to medium 

brown, with pale brown apical and basal regions, finely verruculose, 

mostly straight, ellipsoidal, apex subobtuse, frequently extending 

into a beak; base truncate at dehiscence, inner part extending later 

to form a short, subobtuse basal appendage; septation muriform; 

basal marginal frill present (Crous et al. 2009a). 

Type species: Xenostigmina zilleri (A. Funk) Crous, Mycol. Mem. 

21: 155. 1998. 

Specimens examined: Canada, British Columbia, 15 km east of Sardis, on living 

leaves of Acer macrophyllum, 22 Oct. 1985, A. Funk & C.E. Dorworth, holotype 

DAVFP 23272; British Columbia, on living leaves of Acer sp., 2002, leg. K.A. Seifert, 

isol. P.W. Crous, CBS 115686 = CPC 4010, CBS 115685 = CPC 4011; Victoria BC, 

48°30’25.63”N, 123°30’46.99”W, 115 m, fallen leaves of A. macrophyllum, 6 Sep. 

2007, leg. B. Callan, isol. P.W. Crous, epitype designated here CBS H-20208, 

cultures ex-epitype CPC 14376 = CBS 124108, CPC 14377, 14378 (Xenostigmina 

zilleri), CPC 14379 = CBS 124109, CPC 14380, 14381 (Mycopappus aceris). 

Notes: Xenostigmina with its Mycopappus synanamorph is distinct 

from Stigmina s. str., which is a synonym of Pseudocercospora 

s. str. (Crous et al. 2006, Braun & Crous 2006, 2007). The genus 

Xenostigmina (Crous 1998) appears related to Seifertia (Seifert et 

al. 2007) in the Dothideomycetes (Crous et al. 2009b). 

Clade 4: Phaeomycocentrospora 

Phaeomycocentrospora Crous, H.D. Shin & U. Braun, gen. 


Etymology: Name reflects the pale brown appearance of conidia 

and the superficial similarity to Mycocentrospora. 


internal and external, consisting of hyaline, septate, branched, 

smooth, 3–5 μm diam hyphae; hyphopodium-like structures 

present. Caespituli amphigenous. Conidiophores in loose fascicles, 

arising from a poorly developed stroma, or from superficial hyphae 

emerging from stomata, or erumpent through the cuticle; erect 

on superficial hyphae, olivaceous-brown, straight to slightly 

curved, unbranched, not geniculate, obconically truncate at the 

apex; conidiogenous cells integrated, terminal or conidiophores 

reduced to conidiogenous cells, mono- to polyblastic, proliferating 

sympodially, transversely septate; conidiogenous loci broad, more 

or less planate, neither thickened nor darkened. Conidia solitary, 

filiform to cylindrical, straight to moderately curved, subhyaline to 

pale olivaceous, transversely euseptate, usually not constricted at 

septa, tapering somewhat towards an obtuse apex, truncate at the 

base; hilum unthickened, not darkened, broad. 

Type species: Phaeomycocentrospora cantuariensis (E.S. Salmon 

& Wormald) Crous, H.D. Shin & U. Braun, comb. nov. 

Notes: Phaeomycocentrospora is similar to Pseudocercospora in 

that its conidia and conidiophores appear to be pigmented and its 

conidiogenous loci are unthickened and not darkened. It is distinct 

from Pseudocercospora in that its mycelium is hyaline, hyphopodialike 

structures are present, and conidia are hyaline with a pale 

brown inner wall layer, giving the impression of pigmented conidia. 

This fungus also has extremely broad conidial loci and scars that 

are untypical of Pseudocercospora. Chupp (1954) commented that 

Cercospora cantuariensis represented an unusual species that should 

be transferred to a genus of its own. Based on its unique phylogenetic 

placement (Fig. 4) and morphology, Phaeomycocentrospora gen. 

nov. is established for this taxon. Deighton (1971, 1972) assigned 

this species to Mycocentrospora, but the type species M. acerina is 

phylogenetically distinct from other genera morphologically similar to 

it and differs in having conidia with filiform appendages and often with 

strongly swollen intercalary cells. 

Phaeomycocentrospora cantuariensis (E.S. Salmon 

& Wormald) Crous, H.D. Shin & U. Braun, comb. nov. 


Basionym: Cercospora cantuariensis E.S. Salmon & Wormald, J. 

Bot. (London) 61: 134. 1923. 

≡ Centrospora cantuariensis (E.S. Salmon & Wormald) Deighton, Mycol. 

Pap. 124: 8. 1971. 

≡ Mycocentrospora cantuariensis (E.S. Salmon & Wormald) Deighton, 

Taxon 21: 716. 1972. 

≡ Pseudocercospora cantuariensis (E.S. Salmon & Wormald) U. Braun, 

Mycotaxon 48: 281. 1993. 


61

Crous et al. 

Fig. 6. Phaeomycocentrospora cantuariensis (CPC 11691–11693). A. Leaf spots on upper and lower leaf surface. B, C. Sporulation of leaf surface. D–I. Conidiophores and 

conidiogenous cells. J–M. Conidia. Scale bars = 10 μm. 

Leaf spots amphigenous, scattered, often confluent, subcircular 

to irregular, 1–5 mm diam, becoming up to 10 mm diam when 

confluent, greyish to white, centre reddish brown with yellowish 

brown zone on upper surface; greyish brown to grey on lower 

surface. Caespituli amphigenous, but predominantly hypophyllous. 

Mycelium internal and external; internal hyphae hyaline, septate, 

branched, smooth, 3–4 μm diam; external hyphae plagiotropous, 

branched, septate, smooth, hyaline, 3–5 μm diam. Conidiophores 

in loose fascicles, arising from a poorly developed stroma, or from 

superficial hyphae emerging from stomata, or erumpent through 

the cuticle; erect on superficial hyphae, olivaceous-brown, straight 

to slightly curved, unbranched, not geniculate, obconically truncate 

at the apex, proliferating sympodially, 0–3-septate, 30–140 × 7–20 

μm. Conidiogenous cells terminal, unbranched, pale brown, smooth, 

tapering to flat-tipped apical loci, with scars neither thickened 

nor darkened, 4–7 μm diam; at times proliferating percurrently, 

with 1–3 percurrent proliferations at the apex, 12–45 × 5–8 μm. 

Conidia solitary, filiform to cylindrical, straight to moderately curved, 

subhyaline to pale olivaceous, smooth, 3–15(–21)-septate, usually 

not constricted at septa, tapering somewhat towards obtuse apex, 

truncate at the base, or long obconically subtruncate, (100–)140– 

200(–500) × (5–)7–12(–20) μm; hilum unthickened, not darkened, 

4–7 μm diam; conidia appear to have an inner wall layer that is pale 

brown when studied in culture (adapted from Shin & Kim 2001). 

Specimens examined: South Korea, Hoengseong, on Humulus scandens (= H. 

japonicus), 4 Sep. 2005, H.D. Shin, CBS H-20830; Suwon, Acalypha australis, 5 

Nov. 2004, H.D. Shin, cultures CPC 11691–11693; Suwon, H. scandens , 5 Nov. 

2004, H.D. Shin, CBS H-20831, cultures CPC 11694–11696; Hoengseong, on H. 

62


scandens, 11 Oct. 2004, H.D. Shin, CBS H-20832, cultures CPC 11646, 11647; 

Wonju, on H. scandens, 18 Oct. 2002, H.D. Shin, CBS H-20833, cultures 10157, 

10158; Namyangju, on Luffa aegyptica (= L. cylindrica), 22 Oct. 2003, H.D. Shin, 

CBS H-20834, cultures CPC 10762–10766. 

Clade 5: Cladosporium (Cladosporiaceae) 

Cladosporium Link, Ges. Naturf. Freunde Berlin Mag. 

Neuesten Entdeck. Gesammten Naturk. 7: 37. 1816. 

Teleomorph: Davidiella Crous & U. Braun, Mycol. Progr. 2: 8. 2003. 

Saprobic or phytopathogenic. Ascomata pseudothecial, black 

to red-brown, globose, inconspicuous and immersed beneath 

stomata to superficial, situated on a reduced stroma, with 1(–3) 

short, periphysate ostiolar necks; periphysoids frequently growing 

down into cavity; wall consisting of 3–6 layers of textura angularis. 

Asci fasciculate, short-stalked or not, bitunicate, subsessile, 

obovoid to broadly ellipsoid or subcylindrical, straight to slightly 

curved, 8-spored. Pseudoparaphyses frequently present in mature 

ascomata, hyaline, septate, subcylindrical. Ascospores bi- to 

multiseriate, hyaline, obovoid to ellipsoid-fusiform, with irregular 

luminar inclusions, mostly thick-walled, straight to slightly curved; 

frequently becoming brown and verruculose in asci; at times covered 

in mucoid sheath (from Schubert et al. 2007). Mycelium superficial, 

loosely branched, septate, sometimes constricted at septa, hyaline, 

subhyaline to pale brown, smooth or almost so to verruculose or 

irregularly rough-walled, sometimes appearing irregular in outline due 

to small swellings and constrictions, walls unthickened to somewhat 

thickened. Conidiophores both macro- and micronematous, arising 

laterally from plagiotropous hyphae or terminally from ascending 

hyphae. Macronematous conidiophores erect, straight to flexuous, 

somewhat geniculate-sinuous, nodulose or not, unbranched or 

occasionally branched, pluriseptate, pale to medium brown, older 

ones almost dark brown, walls thickened, sometimes even twolayered. 

Conidiogenous cells integrated, terminal or intercalary, 

mono- to usually polyblastic, nodulose to nodose or not, proliferation 

sympodial, with several conidiogenous loci, mostly situated on 

small lateral shoulders, more or less protuberant, characteristically 

coronate (SEM), i.e. with a convex central dome surrounded 

by a low to distinctly raised rim, appearing to be thickened and 

somewhat darkened-refractive. Micronematous conidiophores 

hardly distinguishable from hyphae, sometimes only as short lateral 

outgrowth with a single apical scar, short, conical to almost filiform 

or narrowly cylindrical, pluriseptate, usually short, subhyaline to pale 

brown, almost smooth to minutely verruculose or irregularly roughwalled, 

0–3-septate. Conidiogenous cells integrated, terminal or 

conidiophores reduced to conidiogenous cells, narrowly cylindrical or 

filiform, with a single or two loci. Conidia solitary (in heterosporiumlike 

species) to usually catenate, in unbranched or loosely branched 

chains, straight to slightly curved; small terminal conidia without distal 

hilum, obovoid to ellipsoid to subcylindrical, aseptate, subhyaline to 

pale brown; intercalary conidia with a single or sometimes up to 

three distal hila, limoniform, ellipsoid to subcylindrical, 0–1-septate; 

secondary ramoconidia with up to four distal hila, ellipsoid to 

cylindrical-oblong, 0–1(–2)-septate, pale greyish brown or brown 

to medium brown, smooth to minutely verruculose to verrucose, 

walls slightly to distinctly thickened, apex obtuse or slightly truncate, 

towards the base sometimes distinctly attenuated with hila situated 

on short stalk-like prolongations, hila slightly to distinctly protuberant, 

coronate structure as in conidiogenous loci, somewhat thickened and 

darkened-refractive; microcyclic conidiogenesis occurring; primary 

ramoconidia similar to secondary ramoconidia, except base truncate, 

uniform with conidiogenous cell, and more subcylindrical in shape 

(adapted from Schubert et al. 2007). 

Type species: Cladosporium herbarum (Pers. : Fr.) Link, Ges. 

Naturf. Freunde Berlin Mag. Neuesten Entdeck. Gesammten 

Naturk. 7: 37. 1816. 

Notes: Cladosporium is well-defined by having Davidiella 

teleomorphs and conidiophores that give rise to conidial chains with 

unique coronate scars (David 1997, Braun et al. 2003a, Schubert et 

al. 2007, Bensch et al. 2010, 2012), which easily distinguish it from 

a range of other morphologically similar genera (Crous et al. 2007a, 

b; Braun & Crous, in Seifert et al. 2011). 

Clade 6: Teratosphaeriaceae 

Teratosphaeria Syd. & P. Syd., Ann. Mycol. 10: 39. 1912. 

Phytopathogenic, commonly associated with leaf spots, but also 

on fruit, or causing cankers on stems. Ascomata pseudothecial, 

superficial to immersed, frequently situated in a stroma of brown 

pseudoparenchymatal cells, globose, unilocular, papillate, 

ostiolate, canal periphysate, with periphysoids frequently present; 

wall consisting of several layers of brown textura angularis; inner 

layer of flattened, hyaline cells. Pseudoparaphyses frequently 

present, subcylindrical, branched, septate, anastomosing. Asci 

fasciculate, 8-spored, bitunicate, frequently with multi-layered 

endotunica. Ascospores ellipsoid-fusoid to obovoid, 1-septate, 

hyaline, but becoming pale brown and verruculose, frequently 

covered in mucoid sheath (from Crous et al. 2007a). 

Type species: Teratosphaeria fibrillosa Syd. & P. Syd., Ann. Mycol. 

10: 40. 1912. 

Notes: Teratosphaeria accommodates a group of plant pathogenic 

fungi that can cause serious leaf spot, blotch and canker diseases 

of a range of hosts (Crous 2009, Crous et al. 2007a, 2009b, Hunter 

et al. 2009, 2011). The Teratosphaeriaceae remains to be clearly 

resolved, and several different genera are presently recognised in 

the family. Some are plant-associated such as Batcheloromyces, 

Baudoinea, Capnobotryella, Catenulostroma, Davisoniella, 

Devriesia, Hortea, Penidiella, Phaeothecoidea, Pseudotaeniolina, 

Readeriella, Staninwardia, and Stenella s. str. (Crous et al. 2007a, 

2009a, 2011b), and others including Cystocoleus, Racodium, 

Friedmanniomyces, Elasticomyces, Recurvomyces (Selbmann et 

al. 2008) and Xanthoriicola (Ruibal et al. 2011) are lichenicolous or 

rock inhabiting. 

Microcyclospora Jana Frank, Schroers & Crous, Persoonia 

24: 99. 2010. 

Epiphytic and endophytic, occurring on leaves and fruit. Mycelium 

consisting of branched, septate, pale brown, smooth, 2–3 μm wide 

hyphae. Conidiophores reduced to conidiogenous cells, integrated 

in hyphae, giving rise to peg-like lateral protuberances, 1 µm 

wide, 1–2 µm tall, mono- to polyblastic. Conidia scolecosporous, 

cylindrical, straight to variously curved, flexuous, apex obtuse, 

base truncate, 1–multi-septate, somewhat constricted at septa, 

smooth, pale brown, guttulate, aggregated in mucoid masses; hila 

not thickened or darkened; microcyclic conidiation observed in 

culture. 


63

Crous et al. 

Type species: Microcyclospora pomicola Jana Frank, B. Oertel, 

Schroers & Crous, Persoonia 24: 100. 2010. 

Notes: Microcyclospora was recently introduced in 

Teratosphaeriaceae for three taxa associated with sooty blotch of 

apple (Frank et al. 2010). The species described here resembles 

others presently known in Microcyclospora by having pigmented 

structures and undergoing microcyclic condiation. Other than 

having distinct conidial dimensions, it differs from other genera in 

that its conidiogenous cells are annellidic (not mono- to polyblastic), 

and its conidia are darker brown and verruculose to warty, not pale 

brown and smooth. 

Microcyclospora quercina Crous & Verkley, sp. nov. 

MycoBank MB564815. Figs 7, 8. 

Etymology: Name reflects its host, Quercus. 

Foliicolous, endophytic. Mycelium consisting of branched, septate, 

brown, 1.5–3 μm diam hyphae, guttulate, smooth to verruculose 

or warty, with or without mucoid sheath. Conidiophores reduced to 

conidiogenous cells. Conidiogenous cells lateral on hyphae, brown, 

solitary, not aggregated, 1.5–2 μm diam, with 1–4 percurrent 

proliferations and flaring collarettes. Conidia solitary, subcylindrical 

(rarely obclavate), gently curved, apex obtuse (rarely subobtuse), 

base truncate or long obconically truncate, with slight basal taper 

to hilum that is 2 μm diam, unthickened, nor darkened, frequently 

with small marginal frill, brown, guttulate to granular, smooth, 

appearing warty or roughened due to external mucoid layer which 

is sometimes present, transversely (1–)3–4(–11)-euseptate, 

becoming constricted at septa with age, (12–)30–45(–70) × (2–) 

2.5–3 μm; microcyclic conidiation commonly observed. 

Culture characteristics: Colonies after 2 wk in the dark up to 15 mm 

diam, with sparse aerial mycelium, folded surface and uneven to 

somewhat feathery, lobate margins, exuding copious amounts of 

slime on PDA, but less so on MEA and OA; colonies olivaceousblack 

on all media. 

Specimen examined: Netherlands, endophytic in leaves of Quercus robur, Sep. 

2003, G.J.M. Verkley, holotype CBS H-20835, culture ex-type CPC 10712 = CBS 

130827. 

Clade 7: Dissoconium (Dissoconiaceae) 

Dissoconium de Hoog, Oorschot & Hijwegen, Proc. K. Ned. 

Akad. Wet., Ser. C, Biol. Med. Sci. 86(2): 198. 1983. 

Hyperparasitic, but also reported to be phytopathogenic. Ascomata 

pseudothecial, immersed, globose, unilocular, papillate, ostiolate, 

canal periphysate; wall consisting of 3–4 layers of brown textura 

angularis; inner layer of flattened, hyaline cells. Pseudoparaphyses 

absent. Asci fasciculate, 8-spored, bitunicate. Ascospores ellipsoidfusoid, 

1-septate, hyaline, with or without mucoid sheath. Mycelium 

internal and external, consisting of branched, septate, smooth, 

hyaline to pale brown hyphae. Conidiophores separate, arising 

from hyphae, subcylindrical, subulate or lageniform to cylindrical, 

tapering to a bluntly rounded or truncate apex, straight to once 

geniculate, smooth, medium brown, 0–multi-septate; conidiogenous 

cells polyblastic, with terminal and lateral conidiogenous loci, visible 

as slightly thickened, darkened scars on a rachis. Conidia solitary, 

pale olivaceous-brown, smooth, ellipsoid to obclavate or globose, 

Fig. 7. Microcyclospora quercina (CPC 10712). Line drawing showing conidiogenous 

cells and conidia formed in culture. Scale bar = 10 μm. 

0–1-septate; hila somewhat darkened. Secondary conidia present 

or absent; developing adjacent to primary conidia, pale olivaceous 

to subhyaline, aseptate, pyriform; conidium discharge active or 

passive (from Crous et al. 2009b). 

Type species: Dissoconium aciculare de Hoog, Oorschot & 

Hijwegen, Proc. K. Ned. Akad. Wet., Ser. C, Biol. Med. Sci. 86(2): 

198. 1983. 

Notes: Dissoconium has mycosphaerella-like teleomorphs (Crous 

1998, Crous et al. 2004c) and was recently shown to represent a 

distinct family, Dissoconiaceae (Crous et al. 2009b). Species are 

different from other taxa in Capnodiales in that they form primary 

and secondary conidia that are actively discharged and anastomose 

on the agar surface shortly after germination (De Hoog et al. 1991). 

64


Fig. 8. Microcyclospora quercina (CPC 10712). A, B. Colony on oatmeal and potato-dextrose agar, respectively. C–E. Conidiogenous cells giving rise to conidia (arrows). F. 

Microcyclic conidiation. G, H. Conidia. Scale bars = 10 μm. 

Clade 8: Microcyclosporella and zasmidium-like 

Microcyclosporella Jana Frank, Schroers & Crous, 

Persoonia 24: 101. 2010. 

Epiphytic on leaves and fruit. Mycelium consisting of pale brown, 

smooth to finely verruculose, branched, septate, 2–3.5 μm wide 

hyphae, at times covered in a mucoid layer, with integrated, lateral, 

truncate conidiogenous loci. Conidiophores mostly reduced to 

conidiogenous cells. Conidiogenous cells integrated, intercalary 

on hyphae, rarely terminal, cylindrical to doliiform, pale brown, 

but hyaline if occurring in yeast-like sectors of colonies, smooth, 

mono- or polyblastic, proliferating sympodially; loci inconspicuous, 

truncate, unthickened, not darkened, pale brown to hyaline. 

Conidia hyaline, smooth, subcylindrical to narrowly obclavate or 

narrowly fusoid with acutely rounded apex and obconically truncate 

base, guttulate, transversely 0–6-septate; microcyclic conidiation 

common. 

Type species: Microcyclosporella mali Jana Frank, Schroers & 

Crous, Persoonia 24: 101. 2010. 

Notes: Microcyclosporella was treated as part of the 

Pseudocercosporella generic complex (Batzer et al. 2005), but has 

since been shown to be polyphyletic within Mycosphaerellaceae 

(Crous 2009, Crous et al. 2003, 2009b, c, Frank et al. 2010). The 

clade accommodating Microcyclosporella contains many disjunct 

elements that vary in morphology from Microcyclosporella s. str. 

(hyaline structures) to pigmented structures, namely zasmidiumlike 

(verrucuclose conidia) to pseudocercospora-like (smooth 

conidia) (see Crous et al. 2009b). We suspect that these groups 

may eventually be recognised as distinct genera, but more taxa 

need to be examined to resolve this issue. 

Clade 9: Paracercospora and pseudocercosporalike 

Paracercospora Deighton, Mycol. Pap. 144: 47. 1979. 

Foliicolous, phytopathogenic, causing leaf spots. Mycelium 

internal, hyaline to pale olivaceous. Stromata absent to poorly 

developed. Conidiophores fasciculate, smooth, subhyaline to pale 

olivaceous. Conidiogenous cells integrated, terminal, mono- to 

usually polyblastic, proliferating sympodially; conidiogenous loci 

moderately conspicuous, with narrow thickening along the rim. 

Conidia solitary, subcylindrical to obclavate-cylindrical, smooth, 

subhyaline to pale olivaceous, with a narrow thickening along the 

rim of the hilum. 

Type species: Paracercospora egenula (Syd.) Deighton, Mycol. 

Pap. 144: 48. 1979. 

Specimens examined: Japan, Shimane, on leaves of Solanum melongena, 5 Aug. 

1998, T. Mikami, CNS-415, cultures MUCC 883, MAFF 237766. South Korea, 

Hongcheon, on leaves of S. melongena, 26 Oct. 2005, H.D. Shin, CBS H-20836, 

culture CPC 12537. 

Notes: Stewart et al. (1999) conducted the first phylogenetic 

analysis of the Mycosphaerellaceae and concluded that the 

marginal thickening that occurs along the rims of conidial 

scars and hila, originally thought to be the main character to 

distinguish Paracercospora from Pseudocercospora, was not 

taxonomically significant and suggested that Paracercospora 

be reduced to synonymy with Pseudocercospora. The current 

study provides new evidence that Paracercospora is not a 

synonym of Pseudocercospora, but no consistent morphological 

characters that distinguish it from Pseudocercospora s. str. 

have been identified. Conidia of Paracercospora egenula are 

subhyaline to pale olivaceous with minimal marginal thickening 

of the conidiogenous loci (Fig. 9). Conidial scars and hila of Ps. 

fijiensis (Arzanlou et al. 2008) and Ps. basiramifera (Crous 1998) 

are marginally thickened. Both of the latter species, which belong 

to Pseudocercospora s. str., have pale to medium brown conidia. 

At present Paracercospora may be defined by a combination of 

the minimal marginal thickening of the conidiogenous loci and its 

subhyaline conidia. 

The taxonomic placement of Paracercospora is complicated 

by two other taxa that resolve in the clade together with it. These 

are Passalora brachycarpa (pale olivaceous, catenate conidia, and 


65

Crous et al. 

Fig. 9. Paracercospora egenula (CPC 12537). A. Leaf spots on upper and lower leaf surface. B. Close-up of lesion. C–F. Fascicles with conidiogenous cells. G. Conidia. Scale 

bars = 10 μm. 

Fig. 10. Pseudocercospora tibouchinigena (CBS 116462). A. Leaf spots on upper and lower leaf surface. B, C. Close-up of lesions. D–G. Fascicles with conidiogenous cells. 

H. Conidia. Scale bar = 10 μm. 

66


prominent, thickened, darkened scars; also visible when sporulating 

in culture), and Pseudocercospora tibouchinigena described below, 

which has subhyaline conidia, and unthickened hila and scars. This 

indicates that it is neither a species of Pseudocercospora s. str. 

(subhyaline conidia), nor Paracercospora (lacking any form of scar 

thickening). As a temporary solution, the species on Tibouchina 

is described in Pseudocercospora, although taxa in this subclade 

may eventually be shown to represent a distinct genus. 

Pseudocercospora tibouchinigena Crous & U. Braun, sp. 

nov. MycoBank MB564816. Fig. 10. 

Etymology: Name is derived from Tibouchina, the host on which it 

was collected. 

Leaf spots amphigenous, angular to irregular, 1–3 mm diam, up to 10 

mm long, medium brown, with raised, dark brown border. Mycelium 

internal, hyaline, smooth, consisting of septate, branched, smooth, 

1.5–2 μm diam hyphae. Caespituli fasciculate, predominantly 

hypophyllous, hyaline to pale olivaceous on leaves, up to 60 μm 

wide and 40 μm high. Conidiophores aggregated in dense fascicles, 

arising from the upper cells of a hyaline to subhyaline stroma, 

up to 50 μm wide and 20 μm high; conidiophores subcylindrical 

to ampulliform, 0–3-septate, straight to variously curved or 

geniculate-sinuous, unbranched, 15–25 × 3–5 μm. Conidiogenous 

cells terminal, unbranched, hyaline, smooth, tapering to flat-tipped 

apical loci, proliferating sympodially, 5–10 × 2.5–3.5 μm. Conidia 

solitary, subhyaline, smooth, guttulate or not, subcylindrical or 

narrowly obclavate, apex subobtuse, base obconically truncate, 

straight to variously curved, 3–10-septate, (15–)30–40(–60) × 

(1.5–)2–2.5(–3) μm; hila unthickened, not darkened nor refractive, 

1–1.5 μm diam; prominent microcyclic conidiation observed in vivo. 

Culture characteristics: Colonies after 1 mo at 24 ºC in the dark 

on MEA; erumpent, spreading, with moderate aerial mycelium, and 

smooth, lobate margins. Surface pale olivaceous-grey; reverse 

olivaceous-grey. Colonies reaching 30 mm diam. 

Specimen examined: New Zealand, Auckland, Princes Street, Auckland University 

Campus, on leaves of Tibouchina sp. (Melastomataceae), 9 Aug. 2004, C.F. Hill 

1061, holotype HAL 2359F, culture ex-type CBS 116462. 

Notes: Pseudocercospora tibouchinigena was initially reported 

from New Zealand as P. tibouchina (Braun et al. 2006), which is 

hitherto known only from Brazil. It differs from P. tibouchinae in that 

the latter species has narrowly subcylindrical conidia that are larger, 

40–120 × 2–3 μm (Viégas 1945), than those of P. tibouchinigena. 

The subhyaline conidia of P. tibouchinigena are not typical of 

Pseudocercospora s. str., but for the present, we choose to name 

it in Pseudocercospora until the clade in which it resides has been 

more fully resolved (Fig. 5). 

Clade 10: Cercospora, Miuraea, Phloeospora, 

Pseudocercosporella, Septoria, Xenocercospora 

Cercospora Fresen., in Fuckel, Hedwigia 1(15): 133. 1863 

and in Fuckel, Fungi Rhen. Exs., Fasc. II, No. 117. 1863. 

Mostly phytopathogenic producing conspicuous lesions, but also 

including saprobes. Mycelium internal, rarely also external; hyphae 

colourless or almost so to pigmented, branched, septate, smooth to 

faintly rough-walled. Stromata lacking to well-developed, subhyaline 

to usually pigmented, substomatal to intraepidermal. Conidiophores 

mononematous, macronematous, solitary to fasciculate, arising from 

internal hyphae or stromata, emerging through stomata or erumpent, 

very rarely arising from superficial hyphae, erect, continuous to 

pluriseptate, subhyaline to pigmented, smooth to faintly rough-walled, 

thin- to moderately thick-walled. Conidiogenous cells integrated, 

terminal or intercalary or conidiophores reduced to conidiogenous 

cells, monoblastic, determinate to usually polyblastic, sympodial, 

rarely with a few enteroblastically percurrent rejuvenations which 

are not connected with conidiogenesis; conidiogenous loci (scars) 

conspicuous, thickened and darkened, planate. Conidia solitary, 

very rarely catenate, scolecosporous, obclavate, cylindrical-filiform, 

acicular, hyaline or subhyaline (with a pale greenish tinge), mostly 

pluriseptate, euseptate, rarely with 0–1 or few septa, smooth or 

almost so, hila thickened and darkened, planate (from Crous & Braun 

2003). 

Type species: Cercospora penicillata (Ces.) Fresen., Beiträge zur 

Mykologie 3: 93. 1863. [= C. depazeoides (Desm.) Sacc.]. 

Cercospora sojina Hara, Nogyo Sekai, Tokyo 9: 28. 1915. 

Fig. 11. 

≡ Passalora sojina (Hara) H.D. Shin & U. Braun, Mycotaxon 58: 163. 

1996. 

Specimen examined: South Korea, Hongcheon, on Glycine soja (= G. max subsp. 

soja), 20 Jul. 2004, H.D. Shin, CBS H-20837, culture CPC 12322. 

Notes: Despite sparingly septate and broadly obclavatecylindrical 

conidia that tend to be subhyaline, this species is better 

accommodated in Cercospora than Passalora (Shin & Braun 1996) 

based on phylogenetic analysis. 

Cercospora eucommiae Crous, U. Braun & H.D. Shin, sp. 


Etymology: Name derived from Eucommia, the host on which it 

occurs. 

Leaf spots amphigenous, irregular to subcircular, 2–5 mm 

diam; surface grey-brown to brown with diffuse border; reverse 

olivaceous-brown with diffuse border. Mycelium internal, hyaline, 

consisting of septate, branched, smooth, 2–3 μm diam hyphae. 

Caespituli fasciculate, pale brown, amphigenous, up to 40 μm 

diam and 50 μm high (conidial mass white on leaf surface). 

Conidiophores aggregated in loose fascicles arising from the 

upper cells of a weakly developed brown stroma, up to 30 μm diam 

and 20 μm high, conidiophores pale brown, smooth, 1–3-septate, 

subcylindrical, straight to variously curved, unbranched, 20–50 × 

4–5 μm. Conidiogenous cells terminal, unbranched, pale brown, 

smooth, tapering to flat-tipped apical loci that are thickened, 

somewhat darkened, slightly refractive, 2 μm diam, 15–25 × 

4–5 μm, proliferating sympodially at the apex. Conidia solitary, 

or in unbranched short chains, hyaline to pale olivaceous (with 

age), smooth, guttulate, obclavate, apex obtuse to subobtuse or 

clavate, base obconically subtruncate, straight to mildly curved, 

3–8-septate, (35–)60–75(–80) × (4–)5–6(–8) μm; hila thickened 

along the rim, but not darkened or planate, 1.5–2 μm diam. 

Culture characteristics: Colonies after 2 wk at 24 ºC in the dark 

on MEA; erumpent, spreading, with sparse aerial mycelium, and 


67

Crous et al. 

Fig. 11. Cercospora sojina (CPC 12322). A. Leaf spots on upper and lower leaf surface. B. Close-up of lesion. C–G. Fascicles with conidiophores and conidiogenous cells. H. 

Conidia. Scale bars = 10 μm. 

smooth, lobate margins. Surface folded, dark mouse-grey with 

patches of dirty white; reverse fuscous black becoming greyish 

sepia at margin. Colonies reaching 12 mm diam. 

Specimens examined: South Korea, Chuncheon, on Eucommia ulmoides, 7 Oct. 

2003, H.D. Shin, holotype CBS H-20839, cultures ex-type CPC 10802 = CBS 

131932, CPC 10803, 10804; Chuncheon, on E. ulmoides, 11 Oct. 2002, H.D. Shin, 

CBS H-20838, culture CPC 10047. 

Notes: In the Korean material C. eucommiae occurred in mixed 

infections with a Pseudocercospora species (conidia 22–160 × 

4–7 μm) that resembles P. eucommiae (conidia 15–75 × 2–4 um), 

which is known from this host in China (Guo & Hsieh 1995). The 

description of C. eucommiae reveals the genus Cercospora to be 

paraphyletic. Morphologically C. eucommiae is distinct from other 

species in Cercospora in that the conidial hila and conidiogenous 

scars are different (thickened along the rim, not darkened and 

planate), and conidia also tend to occur in unbranched chains, 

which is not typical of Cercospora. Interestingly, it does not cluster 

with C. eremochloae, which also forms conidia in chains (Crous et 

al. 2011a). Although this species is not part of Cercospora s. str., 

we name it in this genus until further taxa are collected and studied 

to resolve the status of this subclade in relation to Cercospora s. str. 

Miuraea Hara, Byochugai-Hoten (Manual of Pests and 

Diseases): 779. 1948. 

Synonyms: See Braun (1995). 

Foliicolous, phytopathogenic, causing leaf spots. Mycelium internal 

and external, consisting of septate, branched, hyaline to subhyaline 

hyphae. Conidiophores semi-macronematous, mononematous, 

reduced to a single conidiogenous cell, integrated on hyphae, with 

small lateral peg-like protuberances; conidiogenesis holoblastic, 

monoblastic, determinate, occasionally polyblastic, proliferation 

sympodial or percurrent; conidiogenous loci more or less truncate, 

inconspicuous, unthickened, not darkened. Conidia solitary, 

ellipsoid-ovoid, subcylindrical-vermiform, obclavate, subclavate, 

somewhat asymmetrical, euseptate, transversely pluriseptate to 

muriformly septate, hyaline to faintly pigmented, thin-walled; hila 

truncate to somewhat convex, unthickened, not darkened (adapted 

from Braun 1995). 

Type species: Miuraea degenerans (Syd. & P. Syd.) Hara, 

Byochugai-Hoten (Manual of Pests and Diseases): 260. 1948. 

Notes: Morphologically Miuraea is intermediate between 

Pseudocercospora and Pseudocercosporella, which explains 

its phylogenetic position in this clade (Fig. 4). It differs from 

Pseudocercosporella in having superficial mycelium, and very 

broad, muriformly septate conidia. 

Miuraea persicae (Sacc.) Hara, Byochugai-Hoten (Manual 

of pests and diseases): 224. 1948. Fig. 13. 

Basionym: Cercospora persicae Sacc., Hedwigia 15: 119. 1876. 

Teleomorph: “Mycosphaerella” pruni-persicae Deighton, Trans. 

Brit. Mycol. Soc. 50: 328. 1967. 

Specimens examined: South Korea, Chuncheon, Prunus persica, 11 Oct. 2002, 

H.D. Shin, CBS H-20841, culture CPC 10069; Chuncheon, 7 Oct. 2003, P. 

armeniaca, H.D. Shin, CBS H-20840, CPC 10828–10830. 

68


Fig. 12. Cercospora eucommiae (CPC 10047). A. Leaf spots on upper and lower leaf surface. B. Close-up of lesion. C–G. Fascicles with conidiophores and conidiogenous 

cells. H, I. Conidia. Scale bars = 10 μm. 

Fig. 13. Miuraea persicae (CPC 10069). A. Leaf spots on upper and lower leaf surface. B, C. Close-up of fruiting (rather inconspicuous). D, E. Fascicles with conidiophores and 

conidiogenous cells. F. Conidia (note septation). Scale bars = 10 μm. 


69

Crous et al. 

Fig. 14. Pseudocercosporella arcuata (CPC 10050). A. Leaf spots on upper and lower leaf surface. B–D. Close-up of lesions. E, F. Fascicles with conidiophores and 

conidiogenous cells. G. Conidia. Scale bars = 10 μm. 

Phloeospora Wallr., Flora Cryptogamica Germaniae 2: 176. 

1833. 

Phytopathogenic, commonly associated with leaf spots, occurring 

on leaves and fruit. Mycelium immersed, consisting of hyaline, 

septate, branched hyphae. Conidiomata acervular, subepidermal, 

erumpent; wall of thin-walled textura angularis, opening by means 

of an irregular split. Conidiophores reduced to conidiogenous 

cells. Conidiogenous cells hyaline, smooth, cylindrical, discrete, 

indeterminate, proliferating via percurrent proliferations, or 

sympodially, formed from the upper cells of the acervulus. Conidia 

solitary, hyaline, smooth, septate, cylindrical, apex subobtuse to 

obtuse, base truncate, straight to curved. 

Type species: Phloeospora ulmi (Fr.) Wallr., Flora Cryptogamica 

Germaniae 2: 177. 1833. 

Specimens examined: Austria, Ulmus sp., H.A. van der Aa, CBS 613.81; Ulmus 

glabra, G. Verkley, CBS 344.97. Netherlands, Ulmus sp., H.A. van der Aa, CBS 

101564. 

Notes: Phloeospora is distinguished from Septoria by the production 

of conidia in acervuli, whereas conidiomata in the latter genus are 

pycnidial. Both genera are known to be polyphyletic (Verkley & 

Priest 2000, Quaedvlieg et al. 2011) and require further revision. 

Pseudocercosporella Deighton, Mycol. Pap. 133: 38. 1973. 


mostly consistently internal, in some species with internal as well 

as external hyphae, hyaline to pale brown, septate, branched, 

smooth or almost so; stromata lacking or weakly to well-developed, 

substomatal to intraepidermal, usually colourless. Conidiophores 

solitary to fasciculate, emerging through stomata or erumpent 

through the cuticle, arising from inner hyphae or from stromata, 

sometimes formed as lateral branches of superficial hyphae, or 

aggregated in crustose to subglobose sporodochia; conidiophores 

simple, rarely branched, straight and subcylindrical to geniculatesinuous, 

hyaline, occasionally faintly pigmented at the base, rarely 

throughout, one-celled or septate. Conidiogenous cells integrated, 

terminal, or reduced to conidiogenous cells, mono- to polyblastic, 

sympodial; conidiogenous loci inconspicuous, unthickened, neither 

darkened nor conspicuously refractive. Conidia formed singly, rarely 

in simple or branched chains, subcylindrical, filiform, somewhat 

obclavate, 1–multi-euseptate, hyaline, thin-walled, mostly smooth, 

apex obtuse to subacute, base subtruncate, hilum unthickened, 

neither darkened, nor refractive (adapted from Braun 1995). 

Type species: Pseudocercosporella ipomoeae Deighton, Mycol. 

Pap. 133: 39. 1973. [= P. bakeri (Syd. & P. Syd.) Deighton, Mycol. 

Pap. 133: 41. 1973]. 

Note: Pseudocercosporella is polyphyletic (see Frank et al. 2010, 

Crous et al. 2011b) and new taxonomically useful morphological 

features will need to be determined to delineate all the genera 

presently accommodated in this clade. 

Pseudocercosporella arcuata S.K. Singh, P.N. Singh & 

Bhalla, Mycol. Res. 101: 542. 1997. Fig. 14. 

Specimen examined: South Korea, Chuncheon, on Rubus oldhamii (≡ R. pungens 

var. oldhamii), 11 Oct. 2002, H.D. Shin, CBS H-20842, culture CPC 10050. 

Pseudocercosporella capsellae (Ellis & Everh.) Deighton, 

Mycol. Pap. 133: 42. 1973. 

Basionym: Cylindrosporium capsellae Ellis & Everh., J. Mycol. 

3(11): 130. 1887. 

Additional synonyms in Braun (1995). 

Teleomorph: “Mycosphaerella” capsellae A.J. Ingman & Sivan., 

Mycol. Res. 95: 1339. 1991. 

Specimen examined: South Korea, Namyangju, Raphanus sativus, 22 Oct. 2007, 

H.D. Shin, CBS H-20843, cultures CPC 14773 = CBS 131896. 

Pseudocercosporella chaenomelis (Y. Suto) C. Nakash., 

Crous, U. Braun & H.D. Shin, comb. nov. MycoBank 

MB564818. Fig. 15. 

Basionym: Cercosporella chaenomelis Y. Suto, Mycoscience 40: 

513. 1999. 

= Mycosphaerella chaenomelis Y. Suto, Mycoscience 40: 513. 1999. 

Leaf spots amphigenous, irregular to angular, 5–20 mm diam, 

brown, delimited by leaf veins. Mycelium internal, hyaline, consisting 

of septate, branched, smooth, 1.5–2 μm diam hyphae. Caespituli 

70


Fig. 15. Pseudocercosporella chaenomelis (CPC 14795). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with white fruiting (rather inconspicuous). C–F. 

Fascicles with conidiophores and conidiogenous cells. G. Conidia. Scale bars = 10 μm. 

fasciculate to sporodochial, white, predominantly epiphyllous, up to 

200 μm diam and 120 μm high. Conidiophores aggregated in dense 

fascicles, arising from the upper cells of a hyaline stroma, up to 180 μm 

diam and 100 μm high; conidiophores hyaline, smooth, subcylindrical 

to ampulliform, straight to variously curved, unbranched, reduced to 

conidiogenous cells, 5–12 × 3–4 μm, proliferating sympodially at 

the apex. Conidia solitary, hyaline, smooth, guttulate to granular, 

subcylindrical to obclavate, apex subobtuse, base obconically 

truncate, straight to variously curved, 1–4-septate, (10–)30–38(–50) 

× (2–)2.5–3(–4) μm; hila unthickened, not darkened nor refractive, 

1.5–2 μm diam; undergoing microcyclic conidiation on the host. 

Description based on CPC 14795. 

Culture characteristics: Colonies after 1 mo at 24 ºC in the dark on 

MEA; Colonies erumpent, spreading, with aerial mycelium sparse 

to absent, margins smooth, lobate. Surface irregularly folded, with 

a prominent network of ridges; folds appearing cinnamon, with 

surrounding areas and border brown-vinaceous; reverse sepia to 

chestnut, reaching up to 35 mm diam. 

Specimens examined: Japan, Shimane Pref., Matsue, on leaves of Chaenomeles 

sinensis, Y. Suto, 6 Nov. 1983, holotype SFH-917, in Herbarium of SPFRC; 

Mie Pref., Tsu, on leaves of C. sinensis, C. Nakashima, 29 Oct. 2011, epitype 

designated here TFM: FPH-8101, culture ex-epitype MUCC 1510 = CBS 132131. 

South Korea, Kimhae, C. speciosa (= C. lagenaria), 14 Nov. 2007, H.D. Shin, CBS 

H-20844, culture CPC 14795 = CBS 131897. 

Notes: Suto (1999) established the connection between 

Pseudocercosporella chaenomelis (as Cercosporella) and 

Mycosphaerella chaenomelis, which is the cause of a serious 

leaf spot disease referred to as frosty mildew on Chaenomeles 

sinensis in Japan. The fungus was found to overwinter by means 

of ascomata on fallen leaves, which provided the primary inoculum 

for new infections (April to June). Since the disease was previously 

known in Japan to be caused by a species of Cercosporella, Suto 

(1999) chose the latter genus to accommodate the anamorph. 

The hyaline conidia with unthickened conidial hila indicate that the 

fungus is better placed in Pseudocercosporella, and hence a new 

combination is proposed. Based on DNA sequence data from the 

ITS and ACT gene regions, strains from Japan and Korea appear 

identical (unpubl. data). 

Pseudocercosporella chaenomelis occurs in mixed infections 

with Pseudocercospora cydoniae. Pseudocercosporella 

chaenomelis is morphologically comparable only with Ps. gei, 

known on Geum spp. in North America and the Far East of Russia 

(Braun 1995). The latter species differs in having smaller stromata 

(20–45 μm diam) and much longer filiform-acicular conidia, 20–120 

× 1–3(–4) μm (Braun 1995). Pseudocercosporella crataegi on 

Crataegus spp. in North America is distinct, forming superficial 

hyphae with solitary conidiophores, and its much smaller stromata 

and much longer conidia, and Ps. potentillae on Potentilla sp. in 

Russia also differs by having very long conidia (Braun 1995). 

Pseudocercosporella koreana Crous, U. Braun & H.D. 

Shin, sp. nov. MycoBank MB564819. Fig. 16. 

Etymology: Name derived from the country where it was collected. 

Leaf spots amphigenous, indistinct, irregular, chlorotic, up to 6 mm 

diam. Mycelium internal, hyaline, consisting of septate, branched, 

smooth, 1.5–2.5 μm diam hyphae. Caespituli fasciculate, white, 

amphigenous, up to 60 μm diam and 90 μm high. Conidiophores 

aggregated in dense fascicles, on the upper cells of a pale brown 

to hyaline, usually substomatal stroma, up to 45 μm diam and 


71

Crous et al. 

Fig. 16. Pseudocercosporella koreana (CPC 11414). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with white fruiting. C. Substomatal stroma. D–H. 

Fascicles with conidiophores and conidiogenous cells. I. Conidia. Scale bars = 10 μm. 

20 μm high; conidiophores hyaline or pale brown at the base, 

smooth, 0–2-septate, but frequently reduced to conidiogenous 

cells, subcylindrical, straight to variously curved or geniculatesinuous, 

unbranched or branched below, 15–25 × 4–5 μm, 

proliferating sympodially at the apex. Conidia solitary, hyaline, 

smooth, prominently guttulate, narrowly obclavate, apex obtuse 

to subobtuse, base obconically subtruncate, straight to variously 

curved, 3–13-septate, (40–)60–80(–130) × (2.5–)3(–4) μm; hila 

unthickened, neither darkened nor refractive, 2 μm diam. 

Culture characteristics: Colonies after 2 wk at 24 ºC in the dark on 

MEA; surface folded with a prominent network of ridges, erumpent, 

spreading, with sparse aerial mycelium, and smooth, lobate 

margins. Surface olivaceous-grey to iron-grey; reverse iron-grey to 

greenish black. Colonies reaching 6 mm diam. 

Specimen examined: South Korea, Hoengseong, on Vicia amurensis, 4 Aug. 2004, 

H.D. Shin, holotype CBS H-20845, isotype HAL 1850 F, culture ex-holotype CPC 

11414. 

Notes: Braun (1995) listed several species of Pseudocercosporella 

on Fabaceae. None of these occur on Vicia, and only one, 

Ps. tephrosiae (on Tephrosia, Africa), has conidia of similar length 

(40–110 × 3–4.5 μm), although they are wider, subcylindricalacicular, 

and have 3–6 septa. 

Pseudocercosporella oxalidis (Goh & W.H. Hsieh) U. 

Braun, Nova Hedwigia 55: 218. 1992. 

Basionym: Pseudocercospora oxalidis Goh & W.H. Hsieh, Bot. 

Bull. Acad. Sinica 30: 127. 1989. 

Specimen examined: Taiwan, Taipei, Wulai, on living leaves of Oxalis debilis (= O. 

corymbosa), R. Kirschner, 2258, 22 Feb. 2005, culture CBS 118758. 

Septoria Sacc., Syll. Fung. 3: 474. 1884. 

Synonyms: See Sutton (1980). 

Phytopathogenic and endophytic, occurring on leaves, fruit 

and stems, causing discrete lesions. Conidiomata pycnidial, 

immersed, separate or aggregated, globose, papillate or not, 

brown, with a thin wall of brown textura angularis. Ostiole single, 

circular, central, sometimes papillate. Conidiophores reduced 

to conidiogenous cells. Conidiogenous cells hyaline, smooth, 

ampulliform, doliiform or lageniform to short cylindrical, holoblastic, 

determinate or indeterminate, proliferating sympodially and/or 

percurrently; conidiogenous loci unthickened. Conidia solitary, 

hyaline, multiseptate, guttulate or not, thin-walled, filiform, smooth, 

continuous or constricted at the septa; hila unthickened. 

Type species: Septoria cytisi Desm. Ann. Sci. Nat., Bot., Sér. 3, 8: 

24. 1847. 

Note: Septoria is polyphyletic (Quaedvlieg et al. 2011). 

Clade 11: Sonderhenia 

Sonderhenia H.J. Swart & J. Walker, Trans. Brit. Mycol. Soc. 

90: 640. 1988. 

Foliicolous, phytopathogenic, causing discrete leaf spots. Leaf 

spots amphigenous, round to confluent and irregular, surrounded 

by a purple border when young, which becomes dark red to brown 

and raised with age. Ascomata pseudothecial, amphigenous, on 

one side of each lesion, often 1–3, intermingled with conidiomata, 

immersed, black, punctiform, globose to subglobose; apical 

ostiole substomatal; wall olive-brown, of 3–4 layers of textura 

angularis, subhymenium of 1–2 layers of colorless cells. Asci 

72


Fig. 17. Pallidocercospora heimii (CPC 1395). Asci, ascospores, germinating ascospores (after 24 h on malt extract agar), hyphae with conidiogenous loci, and conidia. Scale 

bar = 10 μm. 

fasciculate, bitunicate, subsessile, 8-spored, ovoid to obclavate, 

straight to incurved. Ascospores 2–3-seriate, hyaline, guttulate, 

straight or slightly curved, fusiform, 1-septate, widest just above 

median septum, slightly constricted at septum. Conidiomata 

pycnidial, amphigenous, subepidermal with central non-projecting 

ostiole, scattered, black, globose; wall of 2–3 layers of brown 

cells. Conidiogenous cells minute, olivaceous, proliferating 

enteroblastically and percurrently, lining the inner pycnidial wall 

layer. Conidia ellipsoid to cylindrical or ovoid, straight or bent, 

brown, 3-distoseptate, not constricted, verruculose, apex obtuse, 

base truncate with marginal frill (adapted from Crous 1998). 

Type species: Sonderhenia eucalyptorum H.J. Swart & J. Walker, 


Notes: Sonderhenia includes taxa with mycosphaerella-like 

teleomorphs and pycnidial anamorphs that form brown, transversely 

distoseptate conidia on brown, percurrently proliferating 

conidiogenous cells. Only two species, S. eucalypticola and S. 

eucalyptorum are known. 

Clade 12: Pallidocercospora, Scolecostigmina, 

Trochophora and pseudocercospora-like 

Pallidocercospora Crous, gen. nov. MycoBank MB564820. 

Fig. 17. 

Etymology: The name reflects the pale brown cercospora-like 

conidia in this genus. 

Foliicolous, phytopathogenic, causing discrete leaf spots. 

Ascomata single, black, immersed, globose, glabrous; wall of 

3–4 layers of medium brown textura angularis. Asci fasciculate, 

bitunicate, aparaphysate, subsessile, 8-spored, ellipsoid to 

obclavate or cylindrical, straight or curved, numerous. Ascospores 

2–multi-seriate, oblique, overlapping, straight ellipsoidal to obovoid, 

colourless, smooth, 1-septate. Mycelium predominantly immersed, 

consisting of olivaceous-brown hyphae, smooth, branched, septate, 

2–4 μm diam. Conidiophores in vivo fasciculate, or occurring 

singly on superficial mycelium as lateral projections, unbranched 

or branched, septate, cylindrical, straight to geniculate–sinuous, 

olivaceous-brown. Conidiogenous cells integrated, terminal, 


73

Crous et al. 

cylindrical, straight to geniculate-sinuous, olivaceous-brown, 

proliferating sympodially or percurrently; conidiogenous loci 

unthickened, not darker than the surrounding conidiogenous 

cell. Conidia solitary, straight to irregularly curved, guttulate, 

pale olivaceous to olivaceous-brown, subcylindrical to narrowly 

obclavate, multiseptate; hila neither thickened nor darkened. 

Type species: Pallidocercospora heimii (Crous) Crous, comb. nov. 

Notes: Species of Pallidocercospora have pale olivaceous, 

smooth conidia (generally referred to as the Mycosphaerella heimii 

complex; Crous et al. 2004c), and form red crystals when cultivated 

in agar (on WA, SNA, PDA, MEA), which distinguishes them from 

Pseudocercospora. Pseudocercospora has several synonyms 

(see Seifert et al. 2011). Cercoseptoria with its mostly acicular 

conidia, was correctly treated as synonym of Pseudocercospora 

by Deighton (1976). Other synonyms include Ancylospora Sawada 

(based on A. costi), now treated as P. costina; Cercocladospora G.P. 

Agarwal & S.M. Singh (based on C. adinae, nom. non rite publ.), 

now treated as P. adinicola; and Helicominia L.S. Olive (based on 

H. caperonia), now P. caperoniae, and Pantospora Cif. (based on P. 

guazumae) (see Ellis 1971, Deighton 1976), the muriformly septate 

conidia of the latter are similar to those of Pseudocercospora 

pseudostigmina-platani, though Pantospora has been shown to be 

a genus in its own right (Minnis et al. 2011). 

Pallidocercospora acaciigena (Crous & M.J. Wingf.) Crous 

& M.J. Wingf., comb. nov. MycoBank MB564821. 

Basionym: Pseudocercospora acaciigena Crous & M.J. Wingf., 

Stud. Mycol. 50: 464. 2004. 

Teleomorph: “Mycosphaerella” acaciigena Crous & M.J. Wingf., 

Stud. Mycol. 50: 463. 2004. 

Specimen examined: Venezuela, Acarigua, on leaves of Acacia mangium, May 

2000, M.J. Wingfield, CBS H-9873, holotype of M. acaciigena and P. acaciigena; 

cultures ex-type CBS 115432, 112515, 112516 = CPC 3836–3838. 

Pallidocercospora crystallina (Crous & M.J. Wingf.) Crous 


Basionym: Pseudocercospora crystallina Crous & M.J. Wingf., 

Mycologia 88: 451. 1996. 

Teleomorph: “Mycosphaerella” crystallina Crous & M.J. Wingf., 

Mycologia 88: 451. 1996. 

Specimens examined: South Africa, Kwazula-Natal Province,Umvoti, on leaves 

of Eucalyptus bicostata, Oct. 1994, M.J. Wingfield (holotypes PREM 51922, 

teleomorph; PREM 51923, anamorph, cultures ex-type CPC 800–802); Kwazula- 

Natal Province, leaf litter of E. grandis × camaldulensis, Jun. 1995, M.J. Wingfield 

(PREM 51937, cultures CPC 1178–1180). 

Pallidocercospora heimii (Crous) Crous, comb. nov. 


Basionym: Pseudocercospora heimii Crous, S. African For. J. 172: 

4. 1995. 

Teleomorph: “Mycosphaerella” heimii Crous, S. African For. J. 172: 

2. 1995. 

≡ “Mycosphaerella” heimii Bouriquet, Encycl. Mycol. 12: 418. 1946, nom. 

nud. 

Specimens examined: Madagascar, Moramanga, on leaves of Eucalyptus sp., Apr. 

1994, P.W. Crous, PREM 51749, holotype of teleomorph; PREM 51748, holotype 

of anamorph, cultures ex-type CPC 760–761 = CBS 110682. 

Pallidocercospora heimioides (Crous & M.J. Wingf.) Crous 


Basionym: Pseudocercospora heimioides Crous & M.J. Wingf., 

Can. J. Bot. 75: 787. 1997. 

Teleomorph: “Mycosphaerella” heimioides Crous & M.J. Wingf., 

Can. J. Bot. 75: 787. 1997. 

Specimens examined: Indonesia, N. Sumatra, Lake Toba area, leaves of Eucalyptus 

sp., Mar. 1996, M.J. Wingfield, holotype of teleomorph PREM 54966; holotype of 

anamorph PREM 54967; cultures ex-type CPC 1311, 1312 = CBS 111190). 

Pallidocercospora holualoana (Crous, Joanne E. Taylor & 

M.E. Palm) Crous, comb. nov. MycoBank MB564825. 

Basionym: “Mycosphaerella” holualoana Crous, Joanne E. Taylor & 

M.E. Palm, Mycotaxon 78: 458. 2001. 

Specimen examined: USA, Hawaii, Kona district, Holualoa, on a living leaf of 

Leucospermum sp., P.W. Crous & M.E. Palm, 17 Nov. 1998, holotype PREM 

56926, cultures ex-type CPC 2126–2128). 

Pallidocercospora irregulariramosa (Crous & M.J. Wingf.) 

Crous & M.J. Wingf., comb. nov. MycoBank MB564826. 

Basionym: Pseudocercospora irregulariramosa Crous & M.J. 

Wingf., Can. J. Bot. 75: 785. 1997. 

Teleomorph: “Mycosphaerella” irregulariramosa Crous & M.J. 

Wingf., Can. J. Bot. 75: 785. 1997. 

Specimens examined: South Africa, Northern Province, Tzaneen, on leaves of 

Eucalyptus saligna, Mar. 1996, M.J. Wingfield, holotype of teleomorph PREM 

54964; holotype of anamorph PREM 54965; cultures ex-type CPC 1360 = CBS 

114777). 

Pallidocercospora konae (Crous, Joanne E. Taylor & M.E. 

Palm) Crous, comb. nov. MycoBank MB564827. 

Basionym: “Mycosphaerella” konae Crous, Joanne E. Taylor & 

M.E. Palm, Mycotaxon 78: 459. 2001. 

Specimen examined: USA, Hawaii, Kona district, Holualoa, on a living leaf on 

Leucadendron cv. Safari Sunset, 17 Nov. 1998, P.W. Crous & M.E. Palm, holotype 

PREM 56921; ex-type cultures CPC 2123–2125. 

Scolecostigmina U. Braun, N. Z. J. Bot. 37: 323. 1999. Fig. 

18. 

Foliicolous, phytopathogenic, associated with leaf spots. Mycelium 

immersed, consisting of septate, branched, pigmented hyphae. 

Sporodochia immersed to erumpent; stromata subglobose to 

applanate, composed of brown, angular to subglobose cells. 

Conidiophores numerous, densely aggregated, arising from stroma, 

subcylindrical or somewhat tapered towards the apex, occasionally 

ampulliform, continuous or septate, pigmented, wall somewhat 

thickened, usually verruculose; conidiogenous cells integrated, 

terminal or at times conidiophores reduced to conidiogenous cells, 

holoblastic, proliferating percurrently via conspicuous annellations. 

Conidia solitary, scolecosporous, usually subcylindrical-obclavate, 

transversely pluriseptate, occasionally with few longitudinal or 

oblique septa, euseptate, rarely with few intermixed distosepta, 

thick-walled, pigmented, dark, smooth to verrucose, apex obtuse 

to subacute, base truncate or obconically truncate; secession 

schizolytic (adapted from Braun et al. 1999). 

Type species: Scolecostigmina mangiferae (Koord.) U. Braun & 

Mouch., N. Z. J. Bot. 37: 323. 1999. 

74


Fig. 18. Scolecostigmina mangiferae (CBS 125467). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C–E. Fascicles with conidiophores and 

conidiogenous cells (note rough percurrent proliferations). F. Conidia. Scale bars = 10 μm. 

Fig. 19. Trochophora simplex (CBS 124744). A. Leaf spots on upper and lower leaf surface. B, C. Close-up of leaf spot with fruiting. D–G. Fascicles with conidiophores and 

conidiogenous cells. H, I. Conidia. Scale bars = 10 μm. 

Specimen examined: Australia, Queensland, Mareeba, S16º58’75.5” 

E145º20’60.8”, leaves of Mangifera indica, 10 Aug. 2009, P.W. Crous & R.G. Shivas, 

CBS H-20846, culture CPC 17352, 17351 = CBS 125467. 

Trochophora R.T. Moore, Mycologia 47: 90. 1955. Fig. 19. 

Foliicolous, but pathogenicity unproven. Colonies hypophyllous, 

medium to dark brown, consisting of numerous synnemata. Stroma 

absent, but with a superficial network of hyphae linking the various 


75

Crous et al. 

synnemata. Conidiophores synnematous, mostly unbranched and 

straight, or with 1–2 short branches, straight or curved, cylindrical, 

individual conidiophores tightly aggregated, but separating near 

the apex, pale to medium brown, smooth. Conidiogenous cells 

polyblastic, integrated, terminal, determinate to sympodial, with 

visible unthickened scar, clavate. Conidia solitary, terminal or 

lateral on conidiogenous cells, prominently curved to helicoid, pale 

to medium brown, smooth, transversely euseptate with a darkened, 

thickened band at the septa (adapted from Crous et al. 2009a). 

Type species: Trochophora simplex (Petch) R.T. Moore, Mycologia, 

47: 90. 1955. 

Specimens examined: Japan, Shimane, on Daphniphyllum teijsmannii, 26 April 

2008, C. Nakashima & I. Araki, MUMH 11134, culture MUCC 952. South Korea, 

Jeju, Halla arboretum, on D. macropodum, 29 Oct. 2005, H.D. Shin, CBS H-20847, 

culture CBS 124744. 

Notes: Other pseudocercospora-like species found in this clade are 

P. colombiensis (foliar pathogen of Eucalyptus; Crous 1998), and 

P. thailandica (foliar pathogen of Acacia; Crous et al. 2004d), both 

also having mycosphaerella-like teleomorphs. Morphologically, 

these taxa appear typical members of Pseudocercospora s. 

str. so it would be difficult to identify these as different from 

Pseudocercospora without the aid of DNA sequence comparisons. 

Clade 13: Passalora-like 

Notes: This clade is represented by Passalora eucalypti, which was 

originally described as a leaf spot pathogen of Eucalyptus saligna 

in Brazil (Crous 1998, Crous & Braun 2003). Recently, a second 

species was found to belong to this clade, namely Passalora 

leptophlebiae, which was described from Eucalyptus leptophlebia 

leaves collected in Brazil (Crous et al. 2011a). Both species are 

charaterised by fasciculate conidiophores and catenate, pale brown 

conidia, with thickened, darkened and refractive scars and hila. 

Clade 14: Pseudocercospora s. str. 

Pseudocercospora Speg., Anales Mus. Nac. Hist. Nat. 

Buenos Aires, Ser. 3, 20: 437. 1910. 

Foliicolous, chiefly phytopathogenic, but also endophytic; 

commonly associated with leaf spots, but also occurring on fruit. 

Mycelium internal and external, consisting of smooth, septate, 

subhyaline to brown, branched hyphae. Stroma absent to welldeveloped. 

Conidiophores in vivo arranged in loose to dense 

fascicles, sometimes forming distinct synnemata or sporodochia, 

emerging through stomata or erumpent through the cuticle, often 

arising from substomatal or subcuticular to intraepidermal stromata, 

or occurring singly on superficial hyphae, short to long, septate or 

continuous, i.e. conidiophores may be reduced to conidiogenous 

cells, simple to branched and straight to geniculate-sinuous, pale 

to dark brown, smooth to finely verruculose. Conidiogenous cells 

integrated, terminal, occasionally intercalary, polyblastic, sympodial, 

or monoblastic, proliferating percurrently via inconspicuous or 

darkened, irregular annellations, at times denticulate, pale to dark 

brown; scars inconspicous, or only thickened along the rim, or flat, 

and slightly thickened and darkened, but never pronounced. Conidia 

solitary, rarely in simple chains, subhyaline, olivaceous, pale to 

dark brown, usually scolecosporous, i.e. obclavate–cylindrical, 

filiform, acicular, and transversely plurieuseptate, occasionally 

also with oblique to longitudinal septa, conidia rarely amero- to 

phragmosporous, short subcylindrical or ellipsoidal-ovoid, aseptate 

or only with few septa, apex subacute to obtuse, base obconically 

truncate to truncate, or bluntly rounded, with or without a minute 

marginal frill, straight to curved, rarely sigmoid, smooth to finely 

verruculose; hila usually unthickened, not darkened, at most 

somewhat refractive, occasionally slightly thickened along the 

rim, or rarely flat, and slightly thickened and darkened, but never 

pronounced. 

Type species: P. vitis (Lév.) Speg., Anales Mus. Nac. Hist. Nat. 

Buenos Aires, Ser. 3, 20: 438. 1910. 

Specimens examined: South Korea, Namyangju, on Vitis vinifera, 30 Sep. 2004, 

H.D. Shin, CBS H-20848, CPC 11595 = CBS 132012; V. vinifera, 1 Oct. 2007, H.D. 

Shin, CPC 14661 = CBS 132112. 

Pseudocercospora abelmoschi (Ellis & Everh.) Deighton, 

Mycol. Pap. 140: 138. 1976. Fig. 20. 

Basionym: Cercospora abelmoschi Ellis & Everh., J. Inst. Jamaica 

1: 347. 1893. 

= Cercospora hibisci Tracy & Earle, Bull. Torrey Bot. Club 22: 179. 1895. 

= Cercospora hibisci-manihotis Henn., Hedwigia 43: 146. 1904. 

Specimen examined: South Korea, Suwon, on Hibiscus syriacus, 2 Oct. 2007, H.D. 

Shin, CBS H-20849, CPC 14478 = CBS 132103. 

Pseudocercospora ampelopsis Crous, U. Braun & H.D. 


Etymology: Name derived from the host Ampelopsis, from which it 

was collected. 

Leaf spots amphigenous, irregular to subcircular, 2–8 mm diam, 

dark brown on upper surface, dull brownish green on lower surface. 

Mycelium internal and external, pale brown to brown, consisting of 

septate, branched, smooth, 1.5–4 μm diam hyphae, anastomosing 

on surface. Caespituli fasciculate, brown, amphigenous, emerging 

through stomata (but stromata lacking). Conidiophores aggregated 

in loose fascicles, or solitary, arising from superficial mycelium, 

medium to dark brown, smooth to finely verruculose, 3–6-septate, 

subcylindrical, straight to variously curved, unbranched, 20–80 

× (2.5–)3–5(–6) μm. Conidiogenous cells terminal, unbranched, 

brown, finely verruculose, tapering to flat-tipped apical loci, 

proliferating sympodially, 10–15 × 4–5 μm. Conidia solitary, dark 

brown, finely verruculose, guttulate, obclavate-cylindrical, apex 

obtuse, base obconically subtruncate, straight to gently curved, 

3–12-septate, (35–)40–90(–110) × 3–5(–6) μm; hila unthickened, 

neither darkened nor refractive, 2 μm diam. 


on MEA; surface folded, erumpent, spreading, with sparse aerial 

mycelium, and smooth, lobate margins. Surface olivaceous-grey; 

reverse iron-grey. Colonies reaching 7 mm diam. 

Specimen examined: South Korea, Hongcheon, on Ampelopsis glandulosa var. 

heterophylla, 24 Oct. 2004, H.D. Shin, holotype CBS H-20850, isotype HAL 1866 

F, culture ex-type CPC 11680 = CBS 131583. 

Notes: Pseudocercospora brachypus, which also occurs on 

Ampelopsis, has much shorter and narrower conidia, 25–60 × 

2–3.5 μm (Guo & Hsieh 1995). Pseudocercospora ampelopsis is 

morphologically close to P. riachuelii var. horiana on Ampelocissus, 

76


Fig. 20. Pseudocercospora abelmoschi (CPC 14478). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C–G. Hyphae giving rise to 

conidiogenous cells and conidia. H. Conidia. Scale bars = 10 μm. 

Fig. 21. Pseudocercospora ampelopsis (CPC 11680). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C. Conidiophores and conidiogenous 

cells. D. Conidia. Scale bar = 10 μm. 

Cissus and Parthenocissus species (Crous & Braun 2003). The 

two are similar in that conidiophores are solitary and form in 

fascicles and arise from superficial hyphae, and conidia of the two 

taxa are similar in size. Pseudocercospora ampelopsis differs in 

having much longer pluriseptate conidiophores whereas those of P. 

riachuelii var. horiana are much shorter and 0–1-septate. 

Pseudocercospora angolensis (T. Carvalho & O. Mendes) 

Crous & U. Braun, Sydowia 55: 301. 2003. 

Basionym: Cercospora angolensis T. Carvalho & O. Mendes, Bol. 

Soc. Brot. 27: 201. 1953. 

≡ Phaeoramularia angolensis (T. Carvalho & O. Mendes) P.M. Kirk, 

Mycopathologia 94: 177. 1986. 

≡ Pseudophaeoramularia angolensis (T. Carvalho & O. Mendes) U. 

Braun, Cryptog. Mycol. 20: 171. 1999. 

Specimens examined: Angola, Mozambique Province, on leaves of Citrus × 

aurantium (= × sinensis), Dec. 1951, Carvalho & O. Mendes, BPI 432660, BPI 

442839 (paratypes), BPI 442837 (holotype), IMI 56597 (isotype). Camaroon, 

Yaoundé, on leaves of C. × aurantium, 17 Mar. 1978, E. Milla, IMI 252792. Ethiopia, 

on leaves of Citrus sp., IMI 361170. Kenya, on leaves of C. × aurantium, 15 Nov. 

1991, A. Seif W3753, IMI 351626. Uganda, on leaves of C. × aurantium, 14 Jun. 

1991, W.T.H. Peregrine, IMI 384297. West Africa, intercepted at San Pedro, 

California, USA, on leaves of Citrus sp., 2 Oct. 1953, L.A. Hart, BPI 432661, BPI 

432659. Zambia, on leaves of Citrus sp., 18 Jun. 1973, R.H. Raemakers 7837, 

IMI 176562; Chilanga, on leaves of C. × aurantium, 28 Sep. 1983, D.M. Naik, IMI 

280618; Chilanga, on leaves of Citrus sp., 18 Jul. 1975, B.K. Patel, IMI 196889; 

Lusaka, on leaves of Citrus sp., 17 June 1977, I. Javaid, IMI 214501. Zimbabwe, 


77

Crous et al. 

Fig. 22. Pseudocercospora araliae (CPC 10154). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C–E. Fascicles with conidiophores and 

conidiogenous cells. F. Conidia. Scale bars = 10 μm. 

Fig. 23. Pseudocercospora atromarginalis (CPC 11372–11374). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C, D. Fascicles with 

conidiophores and conidiogenous cells. E. Conidia. Scale bar = 10 μm. 

Bindura, on leaves of Citrus sp., 13 Aug. 1979, A. Rothwell, IMI 240682; on leaves 

of Citrus sp., Sep. 2000, M.C. Pretorius, epitype designated here CBS H-20851, 

culture ex-epitype CPC 4112–4118, 4111 = CBS 112933. 

Pseudocercospora araliae (Henn.) Deighton, Mycol. Pap. 

140: 19. 1976. Fig. 22. 

Basionym: Cercospora araliae Henn., Bot. Jahrb. Syst. 31: 742. 

1902; also 37: 165. 1906. 

≡ Cercosporiopsis araliae (Henn.) Miura, Fl. Manchuria & E. Mongolia, 

27, 3: 533. 1928. 

= Cercospora atromaculans auct., non Ellis & Everh. 

Specimens examined: Japan, Tosa, Ushioe-yama, on Aralia elata var. glabrescens, 

Aug. 1901, T. Yoshinaga, holotype B 700015014; A. elata, T. Kobayashi & C. 

Nakashima, epitype designated here TFM: FPH-8094, ex-epitype cultures MUCC 

873, MAFF 238192. South Korea, Jeju, Halla Arboretum, on A. elata, 14 Sep. 2002, 

H.D. Shin, CBS H-20852, culture CPC 10154; Wonju, on A. elata, 21 Sep. 2003, 

H.D. Shin, CBS H-20853, cultures CPC 10782–10784. 

Pseudocercospora atromarginalis (G.F. Atk.) Deighton, 

Mycol. Pap. 140: 139. 1976. Fig. 23. 

Basionym: Cercospora atromarginalis G.F. Atk. (atramarginalis), J. 

Elisha Mitchell Sci. Soc. 8: 59. 1892. 

= Cercospora rigospora G.F. Atk., J. Elisha Michell Sci. Soc. 8: 65. 1892. 

= Cercospora tosensis Henn., Bot. Jahrb. Syst. 34: 605. 1905. 

= Cercospora nigri Tharp, Mycologia 9: 112. 1917. 

= Cercospora solani-biflori Sawada, Formosan Agric. Rev. 39: 701. 1942, 

nom. inval. 

Specimens examined: Japan, Prov. Tosa, Aki-machi, on Solanum nigrum, Oct. 

1903, Yoshinaga No. 43, (holotype of C. tosensis, B 700015016). South Korea, 

Namyangju, on S. nigrum, 27 Jul. 2004, H.D. Shin, CBS H-20854, CPC 11372– 

11374. New Zealand, Auckland, Jan. 2004, C.F. Hill 970, CBS 114640. 

Notes: Pseudocercospora atromarginalis was described from 

Solanum collected in Auburn Alabama, USA. Material studied here 

from New Zealand and Korea represents the same species, which 

might be authentic for the name. Fresh material from Solanum in the 

USA, and a detailed study of the synonyms listed by Chupp (1954) 

would resolve this issue. An isolate identified as P. chengtuensis 

(on Lycium, Solanaceae) appears identical to Pseudocercospora 

atromarginalis. 

78


Fig. 24. Pseudocercospora balsaminae (CPC 10044). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C–F. Fascicles and solitary 

conidiophores with conidiogenous cells. G. Conidia. Scale bars = 10 μm. 

Pseudocercospora balsaminae (Syd.) Deighton, Mycol. 

Pap. 140: 139. 1976. Fig. 24. 

Basionym: Cercoseptoria balsaminae Syd., Ann. Mycol. 33: 69. 

1935. 

Specimens examined: South Korea, Chuncheon, on Impatiens textorii, 11 Oct. 

2002, H.D. Shin, CBS H-20856, CPC 10044 = CBS 131882; Dongducheon, on I. 

textorii, 11 Oct. 2004, H.D. Shin, CBS H-20855, CPC 10699–10701. 

Pseudocercospora callicarpae (Cooke) Y.L. Guo & W.X. 

Zhao, Acta Mycol. Sin. 8: 118. 1989. 

Basionym: Cercospora callicarpae Cooke, Grevillea 6: 140. 1878. 

= ? Cercospora callicarpicola Naito, Mem. Coll. Agric. Kyoto Imp. Univ. 47: 49. 

1940. 

Specimen examined: Japan, Ibaraki, on Callicarpa japonica, 11 Sep. 1998, T. 

Kobayashi, MUCC 888, MAFF 237784, CNS-442. 

Pseudocercospora catalpigena U. Braun & Crous, Mycol. 

Progr. 2: 198. 2003. 

Specimen examined: Japan, Wakayama, on Catalpa ovata, 30 Oct. 2007, C. 

Nakashima & I. Araki, MUMH 10868, culture MUCC 743. 

Pseudocercospora catappae (Henn.) X.J. Liu & Y.L. Guo, 

Mycosystema 2: 230. 1989. 

Basionym: Cercospora catappae Henn., Bot. Jahrb. Syst. 34: 56. 

1905. 

= Pseudocercospora catappae Goh & W.H. Hsieh, in Hsieh & Goh, Cercospora 

and similar fungi from Taiwan: 57. 1990, homonym of P. catappae (Henn.) X.J. 

Liu & Y.L. Guo, 1989. 

= Ramularia catappae Racib., Paras. Algen u. Pilze Javas II, Batavia: 41. 

1900. 

= Cercospora terminaliae Sawada (terminariae), Taiwan Agric. Rev. 38: 701. 

1942, nom. illeg., homonym of C. terminaliae Syd. 1929. 

Specimens examined: Tanzania, Zanzibar, Dar-es-Salam, on Terminalia catappa, 

26 Oct. 1901, Stuhlmann holotype B 700015015. Japan, Okinawa, on T. catappa, 

17 Nov. 2007, C. Nakashima & T. Akashi, MUMH 10913, culture MUCC 809. 

Pseudocercospora cercidicola Crous, U. Braun & C. 

Nakash., sp. nov. MycoBank MB564829. Fig. 25. 

Etymology: Name reflects the host Cercis, from which it was 

collected. 

Leaf spots amphigenous, irregular to angular, 1–5 mm diam, 

confined by leaf veins, brown on upper surface, with raised, dark 

brown border, on lower surface medium brown, with indistinct 

borders. Mycelium internal, consisting of pale brown, smooth, 

septate, branched, 2–3 μm diam hyphae. Caespituli fasciculate to 

sporodochial, amphigenous, but predominantly epiphyllous, greybrown 

on leaves, up to 130 μm wide and 150 μm high. Conidiophores 

aggregated in dense fascicles arising from the upper cells of a 

brown stroma up to 80 μm wide and 60 μm high; conidiophores 

brown, finely verruculose, 2–6-septate, subcylindrical, straight 

to variously curved, unbranched or branched above, 20–50 × 

3–5 μm. Conidiogenous cells terminal or lateral, unbranched, 

medium brown, finely verruculose, tapering to flat-tipped apical 

loci, proliferating sympodially, 10–20 × 2–3 μm. Conidia solitary, 

medium brown, smooth, guttulate, subcylindrical to narrowly 

obclavate, apex subobtuse, base long obconically subtruncate, 

straight to variously curved, (0–)3–6-septate, (27–)30–50(–60) × 

(2.5–)3(–3.5) μm; hila neither thickened, nor darkened-refractive, 

1.5–2 μm diam. 

Culture characteristics: Colonies on MEA 10–15 mm after 2 wk at 

20 °C in the dark, restricted, with margin mildly lobed, felty, pale 

olivaceous or greyish olivaceous, surrounded by greyish margin; 

reverse olivaceous. 

Specimens examined: Japan, Ibaraki, on Cercis chinensis, 10 Sep. 1998, T. & Y. 

Kobayashi, holotype CBS H-20895, culture ex-type MUCC 896, MAFF 237791 

= CBS 132041; Tokyo, Koishikawa Botanical Garden, on Cercis chinensis, 10 Nov. 

2007, I. Araki & M. Harada, MUMH 11108, culture MUCC 937; Japan, Kanagawa, 

on Cercis chinensis, May 1992, K.Kishi, culture MAFF 237128. 

Notes: Asian collections of cercosporoid fungi on Cercis chinensis 

were considered as representative of Cercospora chionea by 

Chupp (1954). The latter species was shown to be a member 

of Passalora by Braun (1993). Shin & Braun (2000) introduced 

a new species of Pseudocercospora for the taxon occurring on 

Cercis in Asia, namely P. cercidis-chinensis, based on material 

collected in Korea. Phylogenetic data obtained in the present study 

(Fig. 5) show that the Japanese collections are distinct. As the 


79

Crous et al. 

Fig. 25. Pseudocercospora cercidicola (CBS H-20895). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C, D. Fascicles with conidiophores 

and conidiogenous cells. E, F. Conidiophores on superficial hyphae. G. Conidia. Scale bars = 10 μm. 

Fig. 26. Pseudocercospora cercidis-chinensis (CPC 14481). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C, D. Fascicles with 

conidiophores and conidiogenous cells. E. Conidia. Scale bars = 10 μm. 

name Cercospora cercidis Nishikado is illegitimate, a new name, 

P. cercidicola is introduced for the species occurring on Cercis 

in Japan. Pseudocercospora cercidicola is morphologically very 

close to P. cercidis-chinensis but superficial hyphae with solitary 

conidiophores are not formed and the conidia are shorter. 

Pseudocercospora cercidis-chinensis H.D. Shin & U. 

Braun, Mycotaxon 74: 109. 2000. Fig. 26. 

Specimens examined: South Korea, Kyeongju, on Cercis chinensis, 26 Aug. 1998, 

H.D. Shin, holotype KUS-F 14914, isotype HAL; Suwon, C. chinensis, 2 Oct. 2007, 

H.D. Shin, epitype designated here CBS H-20857, culture ex-epitype CPC 14481 

= CBS 132109. 

Note: See P. cercidicola. 

Pseudocercospora chengtuensis (F.L. Tai) Deighton, 

Mycol. Pap. 140: 141. 1976. Fig. 27. 

Basionym: Cercospora chengtuensis F.L. Tai, Lloydia 11: 40. 1948. 

Specimens examined: China, Szechuan, Chengtu, Lycium chinense, Lee Ling No. 

126, 1943, holotype (not seen). South Korea, Dongducheon, Lycium chinense, 28 

Sep. 2003, H.D. Shin, CBS H-20858, culture CPC 10696–10698. 

Notes: The isolate identified here as P. chengtuensis appears to 

be identical to P. atromarginalis (also on Solanaceae) based on 

phylogenetic analysis and the two are morphologically similar. 

Study of of additional collections of both are needed to determine 

whether they are synonymous or distinct species. 

Pseudocercospora chionanthi-retusi Goh & W.H. Hsieh, 

in Hsieh & Goh, Cercospora and similar fungi from Taiwan: 

249. 1990. Fig. 28. 

80


Fig. 27. Pseudocercospora chengtuensis (CPC 10696–10698). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C–G. Fascicles with 

conidiophores and conidiogenous cells. H. Conidia. Scale bars = 10 μm. 

Fig. 28. Pseudocercospora chionanthi-retusi (CPC 14683). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C–H. Fascicles and solitary 

conidiophores with conidiogenous cells. I. Conidia. Scale bars = 10 μm. 

= Cercospora chionanthi-retusi Togashi & Katsuki, Sci. Rep. Yokohama Nat. 

Univ. Sect. II, 1: 1. 1952. 

≡ Pseudocercospora chionanthi-retusi (Togashi & Katsuki) Nishijima, C. 

Nakash. & Tak. Kobay., Mycoscience 40: 270. 1999, nom. illeg., homonym 

of P. chionanthi-retusi Goh & Hsieh, 1990. 

= Pseudocercospora chionanthicola C. Nakash. & Tak. Kobay., Mycoscience 

43: 98. 2002. 

Specimen examined: South Korea, Osan, on Chionanthus retusus, 30 Oct. 2007, 

H.D. Shin, CBS H-20859, culture CPC 14683 = CBS 132110. 

Pseudocercospora chrysanthemicola (J.M. Yen) Deighton, 

Mycol. Pap. 140: 141. 1976. 

Basionym: Cercospora chrysanthemicola J.M. Yen, Rev. Mycol. 29: 

216. 1964. 

Specimen examined: South Korea, Seoul, on Chrysanthemum sp., 6 Sep. 2003, 

H.D. Shin, CPC 10633. 

Pseudocercospora contraria (Syd. & P. Syd.) Deighton, 

Mycol. Pap. 140: 30. 1976. Fig. 29. 

Basionym: Cercospora contraria Syd. & P. Syd., Ann. Mus. Congo, 

Bot., Ser. V, 3: 21. 1909. 

= Cercospora wildemanii Syd. & P. Syd., Ann. Mus. Congo, Bot., Ser. V, 3: 

21. 1909. 

= Mycosphaerella contraria Hansf., Proc. Linn. Soc. London 153: 22. 1941. 

Specimen examined: South Korea, Bukjeju, Jeolmul recreation forest, on 

Dioscorea quinqueloba, 2. Nov. 2007, H.D. Shin, CBS H-20861, CPC 14714 



81

Crous et al. 

Fig. 29. Pseudocercospora contraria (CPC 14714). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C–E. Fascicles with conidiophores, and 

solitary loci on hyphae. F. Conidia. Scale bars = 10 μm. 

Notes: This fungus was first reported from Korea by Shin & Kim 

(2001). Conidial measurements (16–75 × 2.5–4.5 μm) are smaller 

than those of the type collected in the Democratic Republic of the 

Congo (20–120 × 5–8 μm, Chupp 1954), and the Korean material 

may eventually be shown to represent a distinct species. 

Pseudocercospora coriariae (Chupp) X.J. Liu & Y.L. Guo, 

Mycosystema 2: 232. 1989. 

Basionym: Cercospora coriariae Chupp, J. Dept. Agric. Puerto Rico 

14: 285. 1930. 

= Cercospora coriariae F.L. Tai, Lloydia 11: 43. 1948, nom. illeg., 

homonym of C. coriariae Chupp, 1930. 

Specimen examined: Japan, Tokyo, on Coriaria japonica, 10 Nov. 2007, I. Araki & 

M. Harada, MUMH 10942, culture MUCC 840. 

Pseudocercospora cornicola (Tracy & Earle) Y.L. Guo & 

X.J. Liu, Mycosystema 2: 232. 1989. 

Basionym: Cercospora cornicola Tracy & Earle, Bull. Torrey Bot. 

Club 23: 205. 1896. 

Specimen examined: Japan, Tokyo, Cornus alba var. sibirica, 7 Nov. 1998, C. 

Nakashima & E. Imaizumi, CNS-494, culture MUCC 909, MAFF 237773. 

Pseudocercospora corylopsidis (Togashi & Katsuki) C. 

Nakash. & Tak. Kobay., Mycoscience 40: 270. 1999. 

≡ Cercospora corylopsidis Togashi & Katsuki, Bot. Mag. (Tokyo) 65: 20. 

1952. 

= Cercospora hamamelidis auct.; sensu Togashi & Katsuki, Bot Mag. (Tokyo) 

65: 21. 1952, non (Peck) Ellis & Everh. 

Specimens examined: Japan, Kagoshima, on Corylopsis pauciflora, 26 Oct. 1949, 

S. Katsuki, holotype YNU, Isotype TNS-F-243824; Ibaraki, Tsukuba Botanical 

Garden, on C. pauciflora, Oct. 1996, T. Kobayashi; Ibaraki, on C. pauciflora, 9 Nov. 

1998, T. Kobayashi; Tokyo, Todori, on C. pauciflora, 12 Oct. 1979, M. Kusunoki, 

TFM:FPH-6152; Tokyo, Jindai Bot. Park, on C. spicata, 7 Nov. 1998, C. Nakashima 

& E. Imaizumi, epitype designated here TFM: FPH-8095, ex-epitype cultures 

MUCC 908, MAFF 237795; Saitama, isolated from C. pauciflora, Nov. 1995, 

MUCC1249, MAFF 237302; Kagoshima, 26 Oct. 1949, on Hamamelis japonica, 

S. Katsuki, SK2077; Shizuoka, 2 Nov. 1996, on H. japonica, T. Koboyashi & C. 

Nakashima, CNS-114, cultures MAFF 237632, MUCC 874. 

Notes: Isolate MUCC 874, which was isolated from Hamamelis 

japonica (Hamamelidaceae), appears to be phylogenetically 

identical to P. corylopsidis. Based on morphology, there is little 

difference between these specimens other than the presence or 

absence of external mycelium. 

Togashi & Katsuki (1952) reported a fungus on Hamamelis 

japonica as Cercospora hamamelidis (Peck) Ellis & Everh. based 

on a specimen collected in Kagoshima (SK2077). Recently, C. 

hamamelidis was transferred to the genus Passalora (Crous & 

Braun 2003). The Japanese specimens of C. hamamelidis are 

morphologically and phylogenetically identical to Pseudocercospora 

corylopsidis. We conclude that the fungus on Corylopsis and 

Hamamelis in Japan represents P. corylopsidis. In addition, a species 

of Pseudocercospora collected in Tokyo (TFM:FPH-4348, isolate 

MAFF 410032) was recognised as a distinct taxon on Corylopsis 

plants, based on its longer and narrower conidia, and DNA phylogeny. 

Pseudocercospora cotoneastri (Katsuki & Tak. Kobay.) 

Deighton, Trans. Brit. Mycol. Soc. 88: 389. 1987. 

Basionym: Cercospora cotoneastri Katsuki & Tak. Kobay. (as 

"cotoneasteris"), Trans. Mycol. Soc. Japan 17: 276. 1976. 

Specimens examined: Japan, Tokyo, Asakawa Experimental Forest Station, on 

Cotoneaster dammeri, 13 Aug. 1974, T. Kobayashi, holotype TFM:FPH-4185, exholotype 

culture MAFF 410089; Tokyo, Tokyo Agric. Exp. Stn., on C. franchetii, 27 

Sep. 1978, T. Kobayashi, TFM:FPH-4924; Tokyo, Jindai Bot. Park, on C. horizontalis, 

4 Sep. 1975, H. Horie, TFM: FPH-4417; Tokyo, on C. horizontalis, 23 Oct. 1975, 

K. Sasaki, TFM:FPH-4798; Tokyo, culture isolated from Cotoneater sp., 1977, H. 

Horie, culture MAFF 305633; Fukuoka, Kitakyushu, on C. horizontalis,4 Oct. 1975, 

S. Ogawa (TFM:FPH-4401); Shizuoka, Hamamatsu, on C. salicifolius, 1 Nov. 1996, 

T. Kobayashi & C. Nakashima, CNS-126, culture MUCC 876, MAFF 237629. 

Note: Three isolates including the ex-holotype, MAFF 410089, 

305633 and 237629, were identical based on ACT gene sequence 

data (data not shown). 

Pseudocercospora crispans G.C. Hunter & Crous, sp. 


Etymology: Name reflects the characteristic curling or undulate 

nature of the conidia produced by this fungus. 

Leaf spots amphigenous, angular to irregular, predominantly 

occurring next to or close to the mid-rib, 2–15 mm diam, pale 

82


Fig. 30. Pseudocercospora crispans (CPC 14883). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C–F. Fascicles with conidiophores and 

conidiogenous cells. G, H. Conidia. Scale bars = 10 μm. 

brown on the upper side of the leaf, and pale to darker brown 

on the bottom side of the lesion, surrounded by a raised, dark 

brown border with a diffuse red pigment emanating away from 

the border; single, discrete lesions may coalesce to form larger 

lesions. Mycelium smooth, septate, guttulate, thick-walled, 

branched, internal and external, pale brown, 2–4 mm wide. 

Caespituli amphigenous, sparsely scattered over lesion, floccose, 

whitish. Stromata hypophyllous, brown, well-developed, immersed, 

globular to irregular, 40–120 mm diam. Conidiophores brown at 

the base, becoming paler toward apex, arising from cells of brown 

stroma; arranged in loose fascicles, smooth, thick-walled, guttulate, 

unbranched, straight to curved, 0–4-septate, straight to geniculate– 

sinuous, (14–)17–31(–42) × (2–)3–4(–5) μm. Conidiogenous cells 

terminal, unbranched, smooth, guttulate, pale brown, straight to 

geniculate to geniculate–sinuous, proliferating sympodially and 

percurrently, tapering toward apex; apex obtuse to truncate, (8–)9– 

15(–19) × (2–)3(–4) μm. Conidia solitary, smooth, guttulate, curved 

to undulate, pale brown, 3–9-septate, apex acute to subacute, base 

truncate, (40–)65–96(–102) × (2–)3(–4) μm; hila unthickened, not 

darkened. 

Culture characteristics: Colonies on MEA reaching 54 mm diam 

after 30 d at 24 °C. Colonies circular, flat to slightly convex, with 

a feathery margin and profuse aerial mycelium; lavender-grey to 

glaucous-grey (surface) and olivaceous-grey (reverse). 

Specimen examined: South Africa, Western Cape Province, Knysna, on leaves 

of Eucalyptus sp., Jan. 2008, P.W. Crous, holotype CBS H-20392, culture ex-type 

CPC 14883 = CBS 125999. 

Notes: Pseudocercospora crispans is phylogenetically distinct 

from other taxa described from Eucalyptus (Crous et al. 1989, 

Crous & Alfenas 1995, Crous & Wingfield 1997, Crous 1998, 

Braun & Dick 2002, Hunter et al. 2006a), and can be distinguished 

morphologically by its prominently curled conidia. 

Pseudocercospora crocea Crous, U. Braun, G.C. Hunter & 

H.D. Shin, sp. nov. MycoBank MB564831. Fig. 31. 

Etymology: Name reflects the typical diffuse yellow border 

surrounding leaf lesions caused by this fungus. 

Leaf spots distinct, scattered and at the leaf margin, pale brown 

to brown, circular to irregular, 2–5 mm diam, indefinite border, 

with a pale yellow diffuse halo. Mycelium, internal and external, 

subhyaline, septate, branched, smooth, 2–5 mm wide. Caespituli 

amphigenous, grey, scattered over the lesion surface, arachnoid. 

Stromata well-developed, 40–100 mm diam, subimmersed, 

globular, dark brown. Conidiophores fasciculate, brown, becoming 

paler toward the apex, 0–1-septate, smooth, unbranched, straight 

to curved, apex truncate to subtruncate, 0–1-septate, (14–)17–24(– 

32) × (3–)4(–5) μm. Conidiogenous cells terminal, unbranched, pale 


83

Crous et al. 

Fig. 31. Pseudocercospora crocea (CPC 11668). A, B. Leaf spots on upper and lower leaf surface. C. Close-up of leaf spot with fruiting. D, E. Fascicles with conidiophores and 

conidiogenous cells. F–I. Conidia. Scale bars = 10 μm. 

brown, smooth to slightly verruculose, proliferating percurrently, (9–) 

13–18(–21) × (3–)4(–5) μm. Conidia solitary, 4–10-septate, straight 

to curved, sparsely guttulate, narrowly obclavate, apex subobtuse, 

base obconically truncate to long obconically truncate, smooth, 

subhyaline, (67–)79–94(–104) × (3–)4(–5)μm, hila unthickened not 

darkened. 


after 30 d at 24 °C. Colonies circular with feathery margin, flat 

to slightly convex, some folding occurs, with a darker radial ring 

toward the colony margin, aerial mycelium medium; iron-grey to 

olivaceous-grey (surface) and iron-grey (reverse). 

Specimen examined: South Korea, Suwon, on leaves of Pilea hamaoi (≡ P. pumila 

var. hamaoi), 5 Nov. 2004, H.D. Shin, holotype CBS H-20387, isotype HAL 1860 F, 

cultures ex-type CPC 11668 = CBS 126004. 

Notes: Singh et al. (1996) provide an account of the 

Pseudocercospora spp. present on members of Urticaceae. 

Of these, P. crocea is most similar to P. pileae as it also has a 

well-developed stroma. Pseudocercospora pileae is distinct from 

P. crocea, which lacks stromata and has conidiophores that are 

consistently solitary, arising from superficial hyphae. 

Pseudocercospora cydoniae (Ellis & Everh.) Y.L. Guo & 

X.J. Liu, Mycosystema 5: 103. 1992. Fig. 32. 

Basionym: Cercospora cydoniae Ellis & Everh., J. Mycol. 8: 72. 

1902. 

≡ Cercosporina cydoniae (Ellis & Everh.) Sacc., Syll. Fung. 25: 915. 1931. 

≡ Pseudocercospora cydoniae (Ellis & Everh.) U. Braun & H.D. Shin, 

Mycotaxon 49: 356. 1993. 

Specimens examined: South Korea, Seoul, on Chaenomeles speciosa (= C. 

lagenaria), 17 Sep. 2003, H.D. Shin, cultures CPC 10678 = CBS 131923; Jeonju, 

C. sinensis, 15 Oct. 2003, H.D. Shin, CBS H-20863. 

Pseudocercospora dovyalidis (Chupp & Doidge) Deighton, 

Mycol. Pap. 140: 143. 1976. Fig. 33. 

Basionym: Cercospora dovyalidis Chupp & Doidge, Bothalia 4: 

885. 1948. 

≡ Pseudocercosporella dovyalidis (Chupp & Doidge) B. Sutton, Mycol. 

Pap. 138: 99. 1975. 

Leaf spots amphigenous, distinct, 1–3 lesions per leaf, scattered 

over the leaf, 3–10 mm diam, pale brown surrounded by a 

dark brown to black border. Mycelium internal, consisting of 

pale brown, septate, smooth, 2–6 μm diam hyphae. Caespituli 

hypophyllous, evenly distributed over the leaf spot, floccose 

to punctiform, olivaceous to black. Stromata well-developed, 

subimmersed to erumpent, globular, dark brown, 40–100 mm 

diam. Conidiophores fasciculate, emerging from the upper cells 

of stromata, brown, becoming paler toward the apex, smooth, 

0–2-septate, straight to variously curved, guttulate, apex 

84


Fig. 32. Pseudocercospora cydoniae (CPC 10678). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C. Fascicle with conidiophores and 

conidiogenous cells. D, E. Conidiogenous cells. F. Conidia. Scale bars = 10 μm. 

Fig. 33. Pseudocercospora dovyalidis (CPC 13771–13773). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C, D. Fascicles with conidiophores 

and conidiogenous cells. E, F. Conidiogenous cells. G–K. Conidia. Scale bars = 10 μm. 


85

Crous et al. 

Fig. 34. Pseudocercospora flavomarginata (CPC 14142). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C. Fascicle with conidiophores 

and conidiogenous cells. D–F. Conidiogenous cells. G–J. Conidia. Scale bars = 10 μm. 

rounded, conidiophores rarely branched below, (12–)13–22(–34) 

× (3–)3–5(–6) μm. Conidiogenous cells terminal, pale brown, 

smooth, guttulate, proliferating percurrently, (4–)6–12(–15) × (2–) 

3–4(–5) μm. Conidia solitary, pale brown or subhyaline, smooth, 

distinctively guttulate, 1–10-septate, thick-walled, straight to 

curved, broadly filliform to cylindrical, apex rounded to subacute, 

base long obconically truncate, (20–)30–70(–84) × (3–)3–5(–6) 

μm; hila neither thickened nor darkened. 


after 30 d at 24 °C. Colonies circular with a smooth margin, 

either flat with excessive folding into the media or convex, aerial 

mycelium moderate, margin of colony darker than colony interior; 

greenish glaucous to olivaceous-grey (surface) and olivaceousgrey 

(reverse). 

Specimens examined: South Africa, Gauteng, Pretoria, Groenkloof, on Dovyalis 

zeyheri, 18 Feb. 1914, E.M. Doidge, holotype PREM 7398; Gauteng, Walter 

Susulu Botanical Garden, on leaves of D. zeyheri, 2 Mar. 2007, P.W. Crous, epitype 

designated here CBS H-20389, culture ex-type CPC 13771 = CBS 126002. 

Pseudocercospora eucalyptorum Crous, M.J. Wingf., 

Marasas & B. Sutton, Mycol. Res. 93: 394. 1989. 

= Pseudocercospora pseudoeucalyptorum Crous, Stud. Mycol. 50: 210. 2004. 

Specimens examined: South Africa, Western Cape Province, Stellenbosch, 

Stellenbosch Mountain, on leaves of E. nitens, 21 Dec. 1987, P.W. Crous, holotype 

of P. eucalyptorum PREM 49112, cultures ex type CPC16 = CBS 110777. Spain, 

Pontevedra, Lourizán, Areeiro, on leaves of E. globulus, 2003, J.P. Mansilla, 

holotype of P. pseudoeucalyptorum CBS H-9893, culture ex-type CPC 10390 


Note: Pseudocercospora pseudoeucalyptorum is reduced to 

synonymy with P. eucalyptorum on the basis of the phylogeny 

obtained here and similarity in pigmentation (Crous et al. 2004c). 

Pseudocercospora exosporioides (Bubák) B. Sutton & 

Hodges, Mycologia 82: 320. 1990. 

Basionym: Cercospora exosporioides Bubák, Ann. Mycol. 13: 33. 

1915. 

Specimen examined: Japan, Ibaraki, on Sequoia sempervirens, 11 Sep. 1998, T. 

Kobayashi, CNS-448, cultures MUCC 893, MAFF 237788. 

Pseudocercospora flavomarginata G.C. Hunter, Crous & 

M.J. Wingf., Fungal Diversity 22: 80. 2006. Fig. 34. 

Specimens examined: Thailand, Chang Gao Province near Pratchinburi, on 

leaves of Eucalyptus camaldulensis, 2004, M.J. Wingfield, holotype PREM 58952, 

cultures ex-type CBS 118841, 118823, 118824; Chachoengsao Province, on leaves 

of E. camaldulensis, 2001, W. Himaman, CBS H-20388, culture CPC 13492–13494. 

86


Fig. 35. Pseudocercospora fukuokaensis (CPC 14689). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C, D. Fascicles with conidiophores 

and conidiogenous cells. E. Conidia. Scale bars = 10 μm. 

China, on leaves of Eucalyptus sp., 2003, X. Zhou, CBS H-20390, culture ex-type 

CPC 14142 = CBS 126001. 

Notes: Pseudocercospora flavomarginata was described as the 

causal agent of a prominent leaf spot disease of E. camaldulensis 

in Thailand (Hunter et al. 2006a). Based on this study it appears 

that it is present also on this host in China. 

Pseudocercospora fukuokaensis (Chupp) X.J. Liu & Y.L. 

Guo, Mycosystema 5: 103. 1992. Fig. 35. 

Basionym: Cercospora fukuokaensis Chupp, Sci. Rep. Yokahama 

Natl. Univ., Sect. II, Biol. Sci. 1: 2. 1952. 

Specimens examined: Japan, Fukuoka, Futsukaichi-machi, on Styrax japonicus, 

5 Sep. 1951, S. Katsuki, holotype TNS-F243813; Ibaraki, on S. japonicus, 11 

Sep. 1998, T. Kobayashi & C. Nakashima, epitype designated here TFM: FPH- 

8096, ex-epitype cultures MUCC 887, MAFF 237768; Ibaraki, Ibaraki Nat. Mus., 

on S. japonicus, 10 Sep. 1998, T. & Y. Kobayashi; Fukuoka, Fukuoka For. Exp. 

Stn., on S. japonicus, 30 Jul. 1975, S. Ogawa (TFM: FPH-4356); Kaogshima, 

Tanegashima Is., on S. japonicus, 18 Oct. 1997, T. Kobayashi & C. Nakashima 

(culture: MAFF238203); Kagoshima, Tokunoshima Is., on S. japonicus, 8 Nov. 

1993, T. Kobayashi & T. Hosoya (Culture: MAFF236995); Okinawa, Kunigami, on 

S. japonicus, 18 Nov. 1999, T. Kobayashi & C. Nakashima; Fukuoka, Fukuoka For. 

Exp. Stn., on S. obassia, 14 Sep. 1978, S. Ogawa (TFM: FPH -4941); Fukuoka, 

on S. grandiflora (= S. japonicus var. kotoensis), Oct. 2001, T. Kobayashi (MAFF 

238480); Yamaguchi, on S. japonicus, Dec. 1996, T. Kobayashi (MAFF 237634); 

Saitama, on S. japonicus, Sep. 2002, T. Kobayashi & Y.Ono (MAFF 239411). South 

Korea, Osan, S. japonicus, 30 Oct. 2007, H.D. Shin, culture CPC 14689 = CBS 

132111. 

Notes: DNA sequence data for different isolates from Styrax 

japonica collected in Japan are identical, and distinct from the strain 

collected in Korea, suggesting that the Korean material represents 

a different taxon. 

Pseudocercospora fuligena (Roldan) Deighton, Mycol. 

Pap. 140: 144. 1976. 

Basionym: Cercospora fuligena Roldan, Philipp. J. Sci. 66: 8. 1938. 

Holotype: Philippines, Luzon, Laguna, College of Agriculture 

Campus, on Solanum lycopersicum (≡ Lycopersicon esculentum), 

E.F. Roldan No 32, holotype (not seen). 

Specimens examined: Thailand, on Solanum lycopersicum (variety FMMT260), 28 

Aug. 2005, Z. Mersha, CBS H-20864, culture CPC 12296 = CBS 132017. Japan, 

Mie, on Lycopersicon esculentum, 6 Feb. 2007, C. Nakashima, MUCC 533. 

Notes: DNA sequence data (ITS and EF-1α) for 40 Japanese 

isolates revealed variation in only one position (data not shown) and 

the culture from Thailand is very similar genetically. The collections 

of P. fuligena treated in this study are also morphologically similar 

to the description of the holotype specimen, which was collected 

in the Philippines. Chupp (1954) did not see the holotype, nor did 

Deighton (1976) refer to it. Fresh collections from the type location 

are needed to resolve this apparent species complex. 

Pseudocercospora glauca (Syd.) Y.L. Guo & X.J. Liu, Acta 

Mycol. Sin. 11: 132. 1992. Fig. 36. 

Basionym: Cercospora glauca Syd., Ann. Mycol. 27: 432. 1929. 

Specimen examined: South Korea, Wando, Wando arboretum, on Albizzia 

julibrissin, 9 Nov. 2002, H.D. Shin, CBS H-20865, culture CPC 10062 = CBS 

131884. 

Pseudocercospora guianensis (F. Stevens & Solheim) 

Deighton, Mycol. Pap. 140: 145. 1976. 

Basionym: Cercospora guianensis F. Stevens & Solheim, Mycologia 

23: 375. 1931. 

Specimen examined: Japan, Tateyama, Chiba, on Lantana camara, 4 June 1997, 

C. Nakashima CNS-162, cultures MUCC 879, MAFF 238239. 

Pseudocercospora haiweiensis Crous & X. Zhou, sp. nov. 


Etymology: Name is derived from Hai Wei, China, where this 

fungus was collected. 

Leaf spots amphigenous, irregular to subcircular or angular, 2–4 

mm diam, brown, with raised border, and at times with a red-purple 

margin. Mycelium internal, subhyaline, consisting of septate, 

branched, smooth, 2–3 μm diam hyphae. Caespituli fasciculate to 

sporodochial, amphigenous, breaking through epidermis, appearing 


87

Crous et al. 

Fig. 36. Pseudocercospora glauca (CPC 10062). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C. Fascicle with conidiophores and 

conidiogenous cells. D. Conidiophores. E, F. Conidia. Scale bars = 10 μm. 

Fig. 37. Pseudocercospora haiweiensis (CPC 14084). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C. Fascicle with conidiophores and 

conidiogenous cells. D–F. Conidiophores. G. Conidia. Scale bars = 10 μm. 

almost acervular, grey-brown on leaves, up to 90 μm wide and 50 

μm high. Conidiophores aggregated in dense fascicles arising from 

the upper cells of a brown stroma up to 60 μm wide and 30 μm high; 

conidiophores brown, smooth to finely verruculose, 0–2-septate, 

subcylindrical, straight to variously curved or geniculate-sinuous, 

unbranched, 10–25 × 3–4 μm. Conidiogenous cells terminal, 

unbranched, brown, subcylindrical, smooth to finely verruculose, 

tapering to flat-tipped apical loci, proliferating sympodially, rarely 

percurrently near apex, 10–15 × 2.5–3.5 μm. Conidia solitary, 

brown, finely verruculose, guttulate, subcylindrical, apex obtuse, 

base obconically subtruncate to truncate, straight to gently curved, 

3(–5)-septate, (25–)30–40(–45) × 3(–4) μm; hila unthickened, 

neither darkened nor refractive, 1.5 μm wide. 


MEA; surface folded, erumpent, spreading, with moderate aerial 

mycelium, and smooth, lobate margins. Surface olivaceous-grey 

with patches of pale olivaceous-grey; reverse olivaceous-grey. 

Colonies reaching 12 mm diam. 

Specimen examined: China, Hai Wei, on leaves of Eucalyptus sp. (APP 21), 3 June 

2007, X. Zhou, holotype CBS H-20866, culture ex-type CPC 14084 = CBS 131584. 

Notes: A combination of relatively short conidia (1–3-septate, 

25–45 × 3–4 μm) that are subcylindrical in shape, the absence 

of superficial mycelium, and dense fascicles with well-developed 

stromata, distinguish this new species on Eucalyptus from other 

taxa known from this host (Crous 1998, Braun & Dick 2002). 

Pseudocercospora hakeae (U. Braun & Crous) U. Braun & 

Crous, comb. et stat. nov. MycoBank MB564833. 

Basionym: Cercostigmina protearum var. hakeae U. Braun & 

Crous, Sydowia 46: 206. 1994. 

≡ Pseudocercospora protearum var. hakeae (U. Braun & Crous) U. Braun 

& Crous, Mycol. Progr. 1: 22. 2002. 

88


Fig. 38. Pseudocercospora humulicola (CPC 11358). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C–E. Fascicles with conidiophores and 

conidiogenous cells. F. Conidia. Scale bars = 10 μm. 

Specimens examined: South Africa, Northern Province, Louis Trichardt, Hangklip 

Forest Station, on leaves of Hakea salicifolia (= H. saligna), Apr. 1988, C. Roux, 

holotype PREM 51117. Australia, New South Wales, Mount Annan Botanic 

Gardens, on leaves of Grevillea sp., Aug. 1999, P.W. Crous & B. Summerell, JT 

926, DAR 74861, CPC 2968; Mount Tomah Botanic Gardens, on leaves of Grevillea 

sp., Aug. 1999, P.W. Crous & B. Summerell, JT 873, DAR 74862, CPC 3145 = CBS 

112226. 

Note: No culture from Hakea is presently available, and thus 

the position of this taxon on Hakea and Grevillea has yet to be 

confirmed based on DNA sequence comparisons. 

Pseudocercospora humuli (Hori) Y.L. Guo & X.J. Liu, Acta 

Mycol. Sin., Suppl. 1: 345. (1986) 1987. 

Basionym: Cercospora humuli Hori, in S. Takimoto, Trans. Agric. 

Assoc. Chosen 13(12): 34. 1918. 

≡ Cercospora humuli Hori, in Salmon & Wormald. J. Bot. (London) 61: 

135. 1923. 

= Cercospora humuli-japonici Sawada, Taiwan Agric. Rev. 38: 697. 1942, 

nom. inval. 

≡ Pseudocercospora humuli-japonici Sawada ex Goh & W.H. Hsieh, in 

Hsieh & Goh, Cercospora and similar fungi from Taiwan: 239. 1990. 

Specimens examined: Japan, Tokyo, Nishigahara, on Humulus scandens, 28 Sep. 

1915, S. Hori, holotype NIAES herbarium C-487; Wakayama, on H. lupulus var. 

lupulus, 30 Oct. 2007, C. Nakashima & I. Araki, epitype designated here TFM: 

FPH-8097, ex-epitype culture MUCC 742. 

Pseudocercospora humulicola Crous, U. Braun & H.D. 


Etymology: Name derived from Humulus, the plant on which it was 

collected. 

Leaf spots amphigenous, irregular to angular, 0.5–1.5 mm diam, 

brown, with raised border and wide chlorotic halo. Mycelium 

internal, subhyaline, consisting of septate, branched, smooth, 

2–3 μm diam hyphae. Caespituli fasciculate to sporodochial, 

amphigenous, predominantly epiphyllous, pale brown on leaves, 

up to 90 μm wide and 200 μm high. Conidiophores aggregated 

in dense fascicles arising from the upper cells of a brown stroma 

up to 80 μm wide and 30 μm high; conidiophores pale brown, 

smooth, 2–5-septate, subcylindrical, straight to variously curved or 

geniculate-sinuous, unbranched, 40–90 × 3–4 μm. Conidiogenous 

cells terminal, unbranched, subhyaline to pale brown, subcylindrical, 

smooth, tapering to flat-tipped apical conidiogenous loci, 2 μm 

diam, proliferating sympodially, 10–30 × 3–4 μm. Conidia solitary, 

subhyaline, smooth, finely granular, subcylindrical, apex obtuse, 

base truncate, straight to gently curved, 3–12-septate, (70–)80– 

95(–120) × 2.5(–3) μm; hila unthickened, neither darkened nor 

refractive, 2–3 μm wide. 



mycelium, and smooth, lobate margins. Surface pale olivaceousgrey; 

reverse olivaceous-grey. Colonies reaching 10 mm diam. 

Specimens examined: South Korea, Hongchon, on leaves of Humulus scandens, 

9 Jul. 2004, H.D. Shin, holotype CBS H-20867, culture ex-type CPC 11358 = CBS 

131585; Chuncheon, on H. scandens, 11 Oct. 2002, H.D. Shin, CBS H-20868, 

culture CPC 10049 = CBS 131883; Cheongju, on H. scandens, 4 June 2004, H.D. 

Shin, CBS H-20869, culture CPC 10002. 

Notes: Pseudocercospora humulicola is very similar to P. humuli, 

originally described from Japan, but it is distinct based on DNA 

sequence comparisons. In P. humuli conidia are obclavatecylindrical, 

35–120 × 2.5–4 μm (Chupp 1954), while conidia of P. 

humulicola are subcylindrical, and on average longer than 80 μm. 

Furthermore, P. humuli has shorter conidiophores (10–55 μm long, 

0–2-septate) than those of P. humulicola, which are 2–5-septate, 

and 40–90 μm long. 

Pseudocercospora jussiaeae (G.F. Atk.) Deighton, Mycol. 

Pap. 140: 146. 1976. Fig. 39. 

Basionym: Cercospora jussiaeae G.F. Atk., J. Elisha Mitchell Sci. 

Soc. 8: 50. 1892. 

= Cercospora ludwigiae G.F Atk., J. Elisha Mitchell Sci. Soc. 8: 58. 1892. 

Specimen examined: South Korea, Hongcheon, on Ludwigia prostrata, 9 Oct. 

2007, H.D. Shin, KUS-F22981, CBS H-20870, culture CPC 14625 = CBS 132117. 


89

Crous et al. 

Fig. 39. Pseudocercospora jussiaeae (CPC 14625). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C, D. Fascicles with conidiophores and 

conidiogenous cells. E. Conidia. Scale bars = 10 μm. 

Fig. 40. Pseudocercospora kaki (CPC 10837–10839). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C, D. Fascicles with conidiophores 

and conidiogenous cells. E, F. Conidiogenous cells. G. Conidia. Scale bars = 10 μm. 

Pseudocercospora kaki Goh & W.H. Hsieh, in Hsieh & Goh, 

Cercospora and similar fungi from Taiwan: 109. 1990. Fig. 

40. 

Specimens examined: Japan, Toyama, Kureha, on Diospyros kaki, 25 Sep. 1998, 

T. Kobayashi & E. Imaizumi, CNS-472, culture MAFF 238214; Chiba, on D. kaki, 

18 Sep. 1998, S. Uematsu & C. Nakashima, CNS-464, cultures MUCC 900, MAFF 

238238; Chiba, on D. kaki, Nov. 1993, T. Kobayashi, cultures MAFF 237013. South 

Korea, Gongju, on D. lotus, 28 Oct. 2003, H.D. Shin, CBS H-20871, cultures CPC 

10837–10839. 

Additional isolates examined (representing a different lineage): Japan, Kagoshima, 

Oshima Is., on D. kaki, 11 Nov. 1993, T. Kobayashi, CNS-993, culture MAFF 236999; 

Chiba, on D. kaki, Oct. 1991, T. Kobayashi, culture MAFF 235880. 

Notes: The type specimen of this species is from Taiwan but 

the type was not cultured or sequenced. It may be synonymous 

with Cercospora kaki, which is based on material from the USA. 

The Japanese material studied here is different from the Korean 

material based on DNA sequence data. Actin sequences generated 

for additional Japanese isolates resolved two different lineages, 

one of which may be attributed to Cercospora kakivora, but this 

can only be resolved once fresh collections from Taiwan and the 

USA have been obtained. 

Pseudocercospora kiggelariae (Syd.) Crous & U. Braun, 

Sydowia 46: 215. 1994. 

Basionym: Cercospora kiggelariae Syd., Ann. Mycol. 22: 434. 1924. 

Holotype: South Africa, Western Cape Province, Stellenbosch, on 

leaves of Kiggelaria africana, May 1924, C.K. Brain No 1449 (not 

preserved). 

Specimens examined: South Africa, Gauteng, Walter Susulu Botanical Garden, 

on leaves of K. africana, Jan. 2005, W. Gams, neotype designated here CBS 

H-20872, cultures ex-neotype CPC 11853 = CBS 132016; Western Cape Province, 

Hermanus, Fernkloof Botanical Garden, S34º23’52.1” E19º15’58.5”, K. africana, 2 

May 2010, P.W. Crous, CBS H-20873, CPC 18286, 18287. 

90


Fig. 41. Pseudocercospora lythracearum (CPC 10707). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C, D. Fascicles with conidiophores 

and conidiogenous cells. E. Conidiophore with conidiogenous cells. F. Conidia. Scale bars = 10 μm. 

Pseudocercospora latens (Ellis & Everh.) Y.L. Guo & X.J. 

Liu, Mycosystema 2: 236. 1989. 

Basionym: Cercospora latens Ellis & Everh., J. Mycol. 4: 3. 1888. 

≡ Pseudocercospora latens (Ellis & Everh.) U. Braun, Trudy Bot. Inst. im. 

V.L. Komarova 20: 67. 1997, comb. superfl. 

Specimen examined: Japan, Okinawa, on Lespedeza wilfordii (= L. thunbergii 

subsp. formosa), 18 Nov. 2007, C. Nakashima & T. Akashi, MUMH 10815, culture 

MUCC 763. 

Pseudocercospora leucadendri (Cooke) U. Braun & Crous, 

comb. et stat. nov. MycoBank MB564835. 

Basionym: Cercospora protearum var. leucadendri Cooke, 

Grevillea 12: 39. 1883. 

≡ Stigmina protearum var. leucadendri (Cooke) M.B. Ellis, Mycol. Pap. 

131: 7. 1972. 

≡ Cercostigmina protearum var. leucadendri (Cooke) U. Braun & Crous, 

in Crous & Braun, Sydowia 46: 206. 1994. 

≡ Pseudocercospora protearum var. leucadendri (Cooke) U. Braun & 

Crous, Mycol. Progr. 1: 22. 2002. 

= Passalora protearum Kalchbr. & Cooke, Grevillea 19: 6. 1890. 

Specimen examined: South Africa, Western Cape Province, Stellenbosch, Devon 

Valley, Protea Heights, on Leucadendron sp., 3 Apr. 1998, S. Denman & P.W. Crous, 

specimen JT-178, culture CPC 1869 (no longer viable). 

Note: Pseudocercospora protearum has three varieties on 

Proteaceae, viz. protearum, leucadendri and hakeae (Braun & Hill 

2002), that should be recognised as distinct species (Crous et al. 

2004a) as shown here (Fig. 5). 

Pseudocercospora lonicericola (W. Yamam.) Deighton, 

Mycol. Pap. 140: 146. 1976. 

Basionym: Cercospora lonicericola W. Yamam. J. Soc. Trop. Agric. 

6: 604. 1934. 

Holotype: Taiwan, Taihoku, on Lonicera japonica var. sempervillosa, 

3 Nov. 1933, W. Yamamoto (holotype could not be located, and is 

probably lost). 

Specimens examined: Japan, Tokyo, Jindai Bot. Park, on L. japonica, 21 Oct. 1976, 

T. Kobayashi, TFM: FPH-4479; Chiba, Matsudo, on L. japonica, 14 Sep. 1951, E. 

Kurosawa, SK -2207; Fukuoka, Yame, on L. japonica, 29 Nov. 1949, S. Katsuki, 

SK -2206; Kagoshima, Yaku Is., on L. japonica, 29 Dec. 1952, S. Katsuki, SK -392; 

Ibaraki, L. gracilipes var. glabra, 11 Sep. 1998, T. Kobayashi, neotype designated 

here TFM: FPH-8098, ex-neotype cultures MUCC 889, MAFF 237785. 

Pseudocercospora lyoniae (Katsuki & Tak. Kobay.) 


Basionym: Cercospora lyoniae Katsuki & Tak. Kobay., Trans. 

Mycol. Soc. Japan 16: 3. 1975. 

Specimens examined: Japan, Tokyo, Asakawa Experimental Forest, Government 

Forest Experimental Station, on Lyonia ovalifolia var. elliptica, 21 Sep. 1973, H. 

Horie, holotype TFM: FPH-3999; Tokyo, Jindai Bot. Garden, on L. ovalifolia var. 

elliptical, 25 Sep. 1974, T. Kobayashi, TFM: FPH -4202; Tokyo, Jindai Bot. Garden, 

on L. ovalifolia var. elliptica, 7 Nov. 1998, C. Nakashima & E. Imaizumi, epitype 

designated here TFM: FPH-8100, ex-epitype cultures MUCC 910, MAFF 237775. 

Pseudocercospora lythracearum (Heald & F.A. Wolf) X.J. 

Liu & Y.L. Guo, Acta Mycol. Sin. 11: 294. 1992. Fig. 41. 

Basionym: Cercospora lythracearum Heald & F.A. Wolf, Mycologia 

3: 18. 1911. 

≡ Cercosporina lythracearum (Heald & F.A. Wolf) Sacc., Syll. Fung. 25: 

909. 1931. 

= Cercospora lagerstroemiae Syd. & P. Syd., Ann. Mycol. 12: 203. 1914. 

= Cercospora lagerstroemiae-subcostatae Sawada, Taiwan Agric. Res. Inst. 

Rept. 51: 129. 1931. 

≡ Pseudocercospora lagerstroemiae-subcostatae (Sawada) Goh & W.H. 

Hsieh, in Hsieh & Goh, Cercospora and similar fungi from Taiwan: 212. 

1990. 

= Cercospora lagerstroemiicola Sawada, Taiwan Agric. Res. Inst. Rept. 85: 

112. 1943, nom. inval. 

Specimens examined: Japan, Ibaraki, on Lagerstroemia indica, 11 Sep. 1998, T. 

Kobayashi, CNS-444, cultures MUCC 890, MAFF 237786; Kanagawa, isolated 

from L. subcostata, collection date unknown, T. Kobayashi, MAFF 410017; Ibaraki, 

isolated from L. subcostata, Oct. 1994, T. Nishijima, MAFF 237185; Chiba, isolated 

from L. subcostata, Oct. 1993, T. Kobayashi, MAFF 236964. South Korea, Jinju, L. 

indica, 15 Oct. 2003, H.D. Shin, CBS H-20874, KUS-F 19899, culture CPC 10707 


Notes: The material collected from Korea is genetically similar to 

that from Japan (Fig. 5). However, fresh collections from the USA 

are required to determine if the Asian material is the same as 

that from the USA. The synonyms cited by Chupp (1954) could 

represent different species. 


91

Crous et al. 

Fig. 42. Pseudocercospora lythri (CPC 14588). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C, D. Fascicles with conidiophores and 

conidiogenous cells. E. Conidia. Scale bars = 10 μm. 

Pseudocercospora lythri H.D. Shin & U. Braun, Mycotaxon 

74: 111. 2000. Fig. 42. 

Specimens examined: Japan, Tokyo, on Lythrum salicaria (incl. L. anceps) 10 

Nov. 2007, I. Araki & M. Harada, MUMH 11104, culture MUCC865. South Korea, 

Chuncheon, on L. salicaria, 21 Sep. 1991, H.D. Shin, holotype KUS-F 11109; 

Yangku, on L. salicaria, 28 Sep. 2007, H.D. Shin, epitype designated here CBS 

H-20875, culture ex-epitype CPC 14588 = CBS 132115. 

Pseudocercospora marginalis G.C. Hunter, Crous, U. 

Braun & H.D. Shin, sp. nov. MycoBank MB564836. Fig. 43. 

Etymology: Margo, marginalis, referring to border or margin; 

indicating leaf spots that extend along the leaf margin. 

Leaf spots distinct, 2–5 mm diam, also predominantly forming larger 

blotches extending along the length of the leaf margin, brown, 

irregular; border indefinite. Mycelium internal and external, septate, 

smooth, subhyaline, branched, 2–4 μm wide. Caespituli epiphyllous, 

aggregated along leaf veins, floccose, olivaceous, emerging from 

stomata. Stromata well-developed, subimmersed to erumpent, globular 

to elongated, brown, 20–75 μm diam. Conidiophores fasciculate, pale 

brown to brown, straight to curved to undulate, cylindrical, unbranched, 

apex rounded to subtruncate, smooth, finely guttulate, 0–4-septate, 

(15–)18–31(–41) × (3–)4(–5) μm. Conidiogenous cells terminal, 

unbranched, smooth, finely guttulate, pale brown, straight to curved, 

cylindrical, apex rounded to subtruncate, proliferating sympodially 

or percurrently, (5–)8–11(–14) × 3(–4) μm. Conidia solitary, smooth, 

cylindrical to narrowly obclavate, guttulate, thick-walled, straight to 

curved, pale brown to pale olivaceous, apex rounded to obtuse, base 

obconic to long obconically truncate, 1–7-septate, (19–)30–48(–58) × 

(3–)4(–5) μm; hila neither thickened nor darkened. 


on MEA; erumpent, spreading, with moderate aerial mycelium, 

and smooth, even margins. Surface pale olivaceous-grey; reverse 


Specimen examined: South Korea, Jeju, Halla arboretum, on leaves of Fraxinus 

rhynchophylla (≡ F. chinensis subsp. rhynchophylla), 29 Oct. 2005, H.D. Shin, holotype 

CBS H-20397, culture ex-type CPC 12497 = CBS 131582, CPC 12498, 12499. 

Specimens examined of P. fraxinites: South Korea, Jinju, on Fontanesia 

phillyreoides, 15 Oct. 2003, H.D. Shin, CBS H-20876, cultures CPC 10743–10745. 

Japan, Ibaraki, on Fraxinus excelsior, 11 Sep. 1998, T. Kobayashi, CNS-445, 

cultures MUCC 891, MAFF 237787. 

Notes: Although similar to P. fraxinites (conidia 20–60 × 1.5–3 

μm; Chupp 1954) (Fig. 44), conidia of P. marginalis are wider 

and cluster apart from isolates of P. fraxinites on Fontanesia from 

Korea (CPC 10743–10745) and Fraxinus from Japan (MUCC 

891). Pseudocercospora fraxinites was originally described 

from Fraxinus in the USA. Morphological and molecular 

characterisation of new collections and cultures from this host 

in the USA are needed to clarify the limits of P. fraxinites and P. 

marginalis. 

Pseudocercospora melicyti U. Braun & C.F. Hill, Australas. 

Pl. Pathol. 33: 489. 2004. 

Specimen examined: New Zealand, Auckland, Waiatarua, on Melicytus 

macrophyllus, 13 Mar. 2003, C.F. Hill, holotype HAL 1787 F (isotype PDD 77567), 

culture ex-type ICMP 14984 = CBS 115023. 

Pseudocercospora myrticola (Speg.) Deighton, Mycol. 

Pap. 140: 148. 1976. 

Basionym: Cercospora myrticola Speg., Anales Soc. Ci. Argent. 16: 

167. 1883. 

= Cercospora myrti Erikss., Bidrag Känn. om vara odlade Vaxters s jukdomar, 

Stockholm 8: 79. 1885 and Rev. Mycol. 8: 60. 1886. 

= Cercospora saccardoana Scalia, Atti Accad. Gioenia Sci. Nat. Catania, Ser. 

4, 14: 35. 1901. 

= Cercospora amadelpha Syd., Ann. Mycol. 30: 89. 1932. 

= Fusariella cladosporioides P. Karst., Hedwigia 30: 248. 1891. 

Specimen examined: Japan, Kagoshima, on Myrtus communis, 29 May 2007, C. 

Nakashima & K. Motohashi, MUMH 10572, culture MUCC 632. 

Pseudocercospora ocimi-basilici Crous, M.E. Palm & U. 

Braun, sp. nov. MycoBank MB564837. Fig. 45. 

Etymology: Name derived from Ocimum basilicum, the host from 

which it was collected. 

92


Fig. 43. Pseudocercospora marginalis (CPC 12497). A, B. Leaf spots on upper and lower leaf surface. C, D. Fascicles with conidiophores and conidiogenous cells. E. Close-up 

of leaf spot with fruiting. F–J. Conidia. Scale bars = 10 μm. 

Fig. 44. Pseudocercospora fraxinites (CPC 10743–10745). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C–E. Fascicles with conidiophores 

and conidiogenous cells. F. Conidiogenous cells. G. Conidia. Scale bars = 10 μm. 

Leaf spots amphigenous, subcircular, circular or somewhat irregular, 

2–10 mm diam, greyish green, dull grey to dark brown, border 

indistinct, at times raised. Mycelium internal, pale brown, consisting 

of septate, branched, smooth, 2–3 μm diam hyphae. Caespituli 

fasciculate to sporodochial, brown, predominantly hypophyllous, up 

to 90 μm diam and 70 μm high. Conidiophores aggregated in mostly 


93

Crous et al. 

Fig. 45. Pseudocercospora ocimi-basilici (CPC 10283–10285). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C–E. Fascicles with 

conidiophores and conidiogenous cells. F. Conidia. Scale bars = 10 μm. 

dense, small to large, sometimes almost sporodochial fascicles, 

emerging through stomata or erumpent through the cuticle, 

arising from the upper cells of a brown, substomatal to mostly 

intraepidermal stroma, 10–80 μm; conidiophores pale to medium 

brown or olivaceous-brown, smooth, thin-walled, 0–2-septate, 

subcylindrical or attenuated towards the tip, straight to moderately 

geniculate-sinuous, unbranched or branched above, 5–35 × 2–5 

μm. Conidiogenous cells integrated, terminal or conidiophores 

reduced to conidiogenous cells, pale olivaceous-brown, smooth, 

tapering to flat-tipped apical loci, 1–2 μm wide, proliferating 

sympodially, 5–20 × 2–4 μm. Conidia solitary, subhyaline to pale 

olivaceous-brown, smooth, guttulate, shape and size variable, 

small conidia short obclavate-cylindrical to fusiform, longer conidia 

narrowly obclavate-filiform, sometimes acicular, apex subacute to 

subobtuse, base short to long obconically truncate to truncate in 

acicular conidia, straight to curved, 3–12-septate, (25–)30–120 

(–130) × (2–)2.5–5(–5.5) μm; hila unthickened, neither darkened 

nor refractive, 1.5–2.5 μm diam. 

Specimens examined: Fiji (intercepted at the Auckland International Airport, on basil 

foliage imported from Fiji), on Ocimum basilicum, 24 Feb. 2002, C.F. Hill 529, HAL. 

Mexico, on O. basilicum, Dec. 2001, without collector (cultured as MEP 1515), BPI 

841445; (intercepted at Los Angeles), 2 Nov. 2002, L.C. Lastra 1395 A, BPI 747831; 

6 Dec. 2002, M.E. Palm, holotype CBS H-20877, culture ex-type CPC 10283– 

10285 (unfortunately no longer viable). New Zealand, Auckland, Botanical Garden, 

on O. basilicum, 9 Mar. 2002, C.F. Hill 546, HAL. Vanuatu, Efate, Vanuatu Tropical 

Products, on O. basilicum, 25 Oct. 1996, E. McKenzie, PDD 66438; Rainbow 

Garden, on O. basilicum, 22 Oct. 1996, E. McKenzie, PDD 66537. 

Notes: Braun et al. (2003b) examined Pseudocercospora 

collections on Ocimum basilicum from Fiji, New Zealand, and 

Vanuatu and identified those collections as P. ocimicola, in spite 

of some morphological differences observed. Pseudocercospora 

ocimicola differs from collections on Ocimum basilicum, herein 

described as P. ocimi-basilici, in having shorter conidia (about 

25–80 μm long), conidiophores in small, loose fascicles as well as 

solitary conidiophores arising from superficial hyphae, and lacking 

or almost lacking stromata. 

The description of Cercospora ocimicola provided by Chupp 

(1954) covers type material of this species as well as material on 

O. basilicum. Based on type material and additional collections, C. 

ocimicola is redescribed as P. ocimicola in the current study (see 

below). 

Pseudocercospora ocimicola (Petr. & Cif.) Deighton, 

Mycol. Pap. 140: 149. 1976. 

Basionym: Cercospora ocimicola Petr. & Cif., Ann. Mycol. 30: 324. 

1932. 

= C. hyptidicola (as “hypticola”) Chupp & A.S. Mull., Bol. Soc. Venez. Ci. Nat. 

8: 47. 1942, nom. inval. 

Leaf spots lacking or almost so to indistinct or angular-irregular, 

yellowish ochraceous, olivaceous to brownish, centre finally 

sometimes paler, dingy greyish brown to grey, 1–10 mm diam., 

margin indefinite. Mycelium internal and external, superficial, 

hyphae emerging through stomata, sparingly branched, septate, 

subhyaline to olivaceous-brown, 1–3 μm wide, thin-walled, smooth. 

Stromata lacking or small, mostly substomatal, occasionally 

intraepidermal, 10–30 μm diam. Caespituli amphigenous, usually 

not very conspicuous, olivaceous-brown, finely punctiform to 

subeffuse. Conidiophores in small, loose to moderately large and 

denser fascicles, arising from stromata or internal hyphae, through 

stomata or erumpent through the cuticle, or conidiophores solitary, 

arising from superficial hyphae, lateral or occasionally terminal, 

straight and subcylindrical to conical or usually geniculatesinuous, 

unbranched or occasionally branched, pale olivaceous to 

olivaceous-brown, 0–3-septate, thin-walled, smooth, 5–50 × (2–)3– 

5 μm. Conidiogenous cells integrated, terminal or conidiophores 

reduced to conidiogenous cells, 5–20 × 2–4 μm, proliferating 

sympodially, with a single or several inconspicus to flat-tipped 

conidiogenous loci, 1–2 μm wide. Conidia solitary, subhyaline 

to pale olivaceous or olivaceous-brown, thin-walled, smooth, 

obclavate-subcylindrical, apex obtuse to subacute, base truncate 

to obconically truncate, 1–8-septate, (15–)25–75(–85) × 2–4 μm, 

hila unthickened, neither darkened nor refractive, 1–2 μm diam. 

Specimens examined: Brazil, State of Ceará, Pentecoste County, on Ocimum 

sp., 2 Mar. 2001, F. Freire, HAL; State of Ceará, Cascavel County, Preaoca, on 

Marsypianthes chamaedrys; 12 June 1999, F. Freire, HAL. Cuba, Habana, Santiago 

de las Vegas, on Ocimum gratissimum, 6 Sep. 1988, R.F. Castañeda [C88/316], 

HAL; Habana, Santiago de las Vegas, on O. sanctum, 28 Dec. 1987, R.F. Castañeda 

[C87/382], HAL. Dominican Republic, Santiago, Valle del Cibao, Prov. Santiago, Hato 

94


Fig. 46. Pseudocercospora oenotherae (CPC 10290, 10041). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C, D. Fascicles with 


Fig. 47. Pseudocercospora paederiae (CPC 10007). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C. Broken base of detached fascicle. 

D–G. Synnematal fascicles with conidiophores and conidiogenous cells. H. Conidia. Scale bars = 10 μm. 

del Yonque, on O. campechianum (= O. micranthum), 26 Nov. 1930, E.L. Ekman, Cif., 

Mycofl. Doming. Exs. 359, lectotype designated here BPI 845245 and isolectotype 

BPI 438987. India, Midnapur, Daspur, on O. sanctum, 3 Dec. 1967, M. Mandal, BPI 

438988. Venezuela, Les Tincheras, Edo Carabobo, on Hyptis sp., 24 Feb. 1940, M.F. 

Barrus & A.S. Muller, type of Cercospora hyptidicola, CUP-VZ 3863; La Cuchilla, Río 

Claro, Lara, on Hyptis suaveolens, June 2007, R. Urtiaga, HAL. 

Notes: Chupp (1954) reduced C. hyptidicola, described from Venezuela 

on Hyptis sp., to synonymy with C. lycopodis, and Crous & Braun 

(2003) followed this treatment. Braun & Urtiaga (2008) examined 

type material of this species and an additional new collection from 

Venezuela and considered C. hyptidicola a synonym of C. ocimicola 

since the two species are morphologically indistinguishable. Both 

also occur on two closely related plants, Hyptis and Ocimum, in the 

Lamiaceae subfam. Ocimoideae. Pseudocercospora collections on 

Marsypianthes (subfam. Ocimoideae) in Brazil, is morphologically 

also indistinguishable from collections on Ocimum spp. and was 

assigned to P. ocimicola by Braun & Freire (2002). 

Pseudocercospora oenotherae (Ellis & Everh.) Y.L. Guo & 

X.J. Liu, Acta Mycol. Sin. 11: 297. 1992. Fig. 46. 

Basionym: Cercospora oenotherae Ellis & Everh., Proc. Acad. Nat. 

Sci. Philadelphia 46: 380. 1894. 

Specimens examined: South Korea, Seoul, Oenothera odorata, 6 Sep. 2003, H.D. 

Shin, KUS-F 19606, CPC 10630 = CBS 131920; O. odorata, 2 Oct. 2002, H.D. 

Shin, CBS H-20878, cultures CPC 10290 = CBS 131885, CPC 10041. 

Pseudocercospora paederiae Goh & W.H. Hsieh, 

Cercospora and similar fungi from Taiwan: 291. 1990. Fig. 

47. 


pale brown in centre, with raised, dark brown border, at times 

with concentric zones delimited by dark borders. Mycelium 

internal, occasionally in addition with a few external hyphae 


95

Crous et al. 

Fig. 48. Pseudocercospora pallida (CPC 10776–10778). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C, D. Fascicles with conidiophores 


emerging through stomata, pale to medium brown, consisting of 

septate, branched, smooth to finely verruculose, 3–4 μm diam 

hyphae. Caespituli predominantly hypophyllous, synnematous, 

dark brown on leaves, 25–50 μm wide and 100–200 μm high. 

Conidiophores aggregated in dense synnemata arising from 

the upper cells of a brown substomatal stroma 20–40 μm diam; 

individual conidiophores subhyaline to olivaceous-brown, smooth, 

multiseptate, subcylindrical-filiform, straight to gently curved, 

unbranched, 80–200 × 3–5 μm. Conidiogenous cells terminal, 

unbranched, brown, subcylindrical to clavate, smooth, tapering to 

flat-tipped apical loci, neither thickened nor darkened, proliferating 

sympodially, or rarely percurrently near apex, 20–35 × 2–5 μm. 

Conidia solitary, subhyaline, greenish yellow to pale brown, smooth 

to finely verruculose, guttulate, obclavate, short conidia sometimes 

cylindrical or fusiform, apex obtuse to subobtuse, base obconically 

truncate, straight to curved, 1–10-septate, (20–)40–60(–70) × 3–7 

μm; hila not thickened nor darkened or refractive, 1–2 μm diam. 

Specimen examined: South Korea, Pocheon, National Arboretum, Paederia foetida 

(= P. scandens), 23 Oct. 2002, H.D. Shin, CBS H-20879, culture CPC 10007 

(unfortunately no longer viable). 

Notes: A brown leaf spot on P. scandens was reported from the 

Keryong Mountain in Chungnam district, South Korea, including 

the southern districts, Chonnam, Kyeongnam, and Jeju Island 

by Lee et al. (2001). The associated fungus was identified as 

Pseudocercospora paederiae. Characteristics of the Korean 

material are consistent with the original description of P. paederiae 

(from Taiwan), except for longer conidiophores and shorter conidia 

that are up to 10-septate. All characterstics overlap, and the 

Korean collections are tentatively assigned to P. paederiae. New 

collections from Taiwan, together with cultures and sequence 

data are necessary to reassess Pseudocercospora on Paederia 

scandens in Asia. 

Pseudocercospora pallida (Ellis & Everh.) H.D. Shin & U. 

Braun, Mycotaxon 74: 114. 2000. Fig. 48. 

Basionym: Cercospora pallida Ellis & Everh., J. Mycol. 3: 21. 

1887. 

≡ Cercospora langloisii Sacc., Syll. Fung. 10: 647. 1892, nom. superfl. 

= Cercospora duplicata Ellis & Everh., J. Mycol. 5: 70. 1889. 

= Cercospora capreolata Ellis & Everh., J. Mycol. 8: 70. 1902. 

Specimen examined: South Korea, Suwon, on Campsis grandiflora, 14 Oct. 2003, 

H.D. Shin, KUS-F 19888, CBS H-20880, CPC 10776 = CBS 131889. 

Pseudocercospora paraguayensis (Kobayashi) Crous, 

Mycotaxon 57: 270. 1996. 

Basionym: Cercospora paraguayensis Kobayashi, Trans. Mycol. 

Soc. Japan 25: 263. 1984. 

Specimen examined: Brazil, São Paulo, Susano clonal orchard, leaves of 

Eucalyptus nitens, Jun. 1996, P.W. Crous, CPC 1458 = CBS 111317. 

Pseudocercospora pini-densiflorae (Hori & Nambu) 


Basionym: Cercospora pini-densiflorae Hori & Nambu, J. Pl. 

Protect. (Tokyo) 4: 353. 1917. 

≡ Cercoseptoria pini-densiflorae (Hori & Nambu) Deighton, Mycol. Pap. 

140: 167. 1976. 

Teleomorph: “Mycosphaerella” gibsonii H.C. Evans, Mycol. Pap. 

153: 61. 1984. 

Specimens examined: Japan, C-511, NIAES herbarium; Shizuoka, Kanaya, on P. 

densiflora, 6 Mar. 1976, K. Kasai, TFM: FPH-4544; Kumamoto, isolated from P. 

thunbergii, 24 April 1964, Y. Tokushige, MUCC 534. 

Pseudocercospora plectranthi G.C. Hunter, Crous, U. 


Etymology: Name derived from the host genus Plectranthus, from 


Leaf spots distinct, scattered over leaf surface and along leaf 

border, amphigenous, subcircular to irregular, 2–12 mm diam, 

brown to pale brown. Mycelium internal and external, pale 

brown to hyaline, branched, smooth, 1.5–4 mm diam. Caespituli 

amphigenous, predominantly epiphyllous, black, distributed 

evenly over the leaf spot, punctiform. Stromata almost absent, 

weakly developed, subimmersed, globular, olivaceous-brown, 

20–70 μm diam. Conidiophores fasciculate, brown to pale brown, 

straight to curved, smooth, unbranched, apex rounded to truncate, 

0–2-septate, (18–)22–35(–45) × (3–)4(–5) μm. Conidiogenous cells 

integrated, terminal, unbranched, brown to pale brown, smooth, 

proliferating sympodially, (9–)14–21(–25) × (2–)3–4(–5) μm. 

Conidia solitary, pale brown to subhyaline, guttulate, 2–10-septate, 

slightly constricted at septa, filiform, apex obtuse to subobtuse, 

base obconic to long obconic, (41–)62–98(–112) × (3–)4(–5) μm, 

hila unthickened, not darkened. 

96


Fig. 49. Pseudocercospora plectranthi (CPC 11462). A. Leaf spots on lower leaf surface. B. Close-up of leaf spot with fruiting. E. Fascicle with conidiophores and conidiogenous 

cells. C, D, F–H. Conidia. Scale bars = 10 μm. 

Fig. 50. Pseudocercospora profusa (CPC 10055). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C, D. Conidiophores and conidiogenous 

cells. E. Conidia. Scale bars = 10 μm. 


on MEA; erumpent, spreading, with moderate aerial mycelium, and 


iron-grey. Colonies reaching 8 mm diam. 

Specimen examined: South Korea, Jeonju, on leaves of Plectranthus sp., 1 July 


131586, CPC 11463. 

Notes: No species of Pseudocercospora are presently known from 

Plectranthus and allied genera, and as P. plectranthi does not 

correspond to any sequences available in GenBank at present, 

it is described as a new species. Numerous Pseudocercospora 

species have been described from hosts in the Lamiaceae, e.g. P. 

anisomelicola, P. colebrookiae, P. colebrookiicola, P. lamiacearum, 

P. leucadis, P. lycopodis, P. ocimicola, P. perillulae, P. pogostemonis, 

P. salvia, and P. scutellariae, but all of them are morphologically 

easily distinguishable from P. plectranthi by having different conidial 

shapes (mostly obclavate-cylindrical), smaller or no stromata 

or abundant superficial mycelium with solitary conidiophores. 

Pseudocercospora salvia has filiform conidia similar to those of P. 

plectranthi but in the former they are narrower (Hsieh & Goh 1990) 

and conidiophores are not fasciculate. 

Pseudocercospora profusa (Syd. & P. Syd.) Deighton, 

Trans. Brit. Mycol. Soc. 88: 388. 1987. Fig. 50. 

Basionym: Cercospora profusa Syd. & P. Syd., Ann. Mycol. 7(2): 

175. 1909. 

≡ Cercosporiopsis profusa (Syd. & P. Syd.) Miura, in: M. Miura, Flora 

of Manchuria and East Mongolia. Part III. Cryptogams, fungi 3: 530. 

1928. 

Specimens examined: South Korea, Seoul, Acalypha australis, 17 Sep. 2003, H.D. 

Shin, CBS H-20882, culture CPC 10713–10715; Wonju, A. australis, 18 Oct. 2002, 

H.D. Shin, CBS H-20881, culture CPC 10055. 


97

Crous et al. 

Fig. 51. Pseudocercospora proteae (CPC 15217). A. Fascicle with conidiophores and conidiogenous cells. B. Conidiogenous cell giving rise to a conidium. C–F. Conidia. Scale 

bars = 10 μm. 

Fig. 52. Pseudocercospora prunicola (CPC 14511). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C, D. Fascicles with conidiophores with 

conidiogenous cells. E. Hypha with conidiogenous loci. F. Conidia. Scale bars = 10 μm. 

Pseudocercospora proteae Crous, sp. nov. MycoBank 

MB564840. Fig. 51. 

Etymology: Name derived from Protea, the host genus from which 

it was collected. 

Leaf spots absent, with sporulation on adaxial leaf surface, 

prominent among leaf hairs. Mycelium internal and external, 

pale brown, consisting of septate, branched, smooth, 1.5–2 μm 

diam hyphae. Caespituli fasciculate, brown, hypophyllous, up 

to 120 μm diam and 40 μm high. Conidiophores aggregated in 

dense fascicles, arising from the upper cells of a brown stroma, 

up to 100 μm diam and 20 μm high; conidiophores pale brown 

to brown, smooth, 0–2-septate, subcylindrical to somewhat 

doliiform at the base, straight to geniculate-sinuous, unbranched 

or branched above, 15–40 × 3–6 μm. Conidiogenous cells 

terminal, unbranched, pale brown to brown, smooth, proliferating 

sympodially near apex, with flat-tipped loci, 10–15 × 2.5–5 μm. 

Conidia solitary, pale brown, smooth, guttulate, subcylindrical, 

straight to curved, apex obtuse, base truncate, (3–)8–12-septate, 

(35–)70–85(–100) × 3(–3.5) μm; hila unthickened, neither 

darkened nor refractive, 2.5–3 μm diam. 



smooth, even margins. Surface olivaceous-grey; reverse iron-grey. 


Specimen examined: South Africa, Western Cape Province, Stellenbosch, 

Assegaaibos, on leaves of Protea mundii, 16 Apr. 2008, F. Roets, holotype CBS 

H-20883, culture ex-type CPC 15216 = CBS 131587, CPC 15218, 15217. 

Notes: The long, multi-septate, subcylindrical conidia of P. proteae 

are distinct from those of P. stromatosa (25–40 × 2.5–3 μm), and 

from the shorter, verruculose conidia of P. protearum (Taylor & 

Crous 2000, Crous et al. 2004a). 

Pseudocercospora prunicola (Ellis & Everh.) U. Braun, in: 

Braun & Mel’nik, Trudy Bot. Inst. Im. V.L. Komarova 20: 82. 

1997. Fig. 52. 

Basionym: Cercospora prunicola Ellis & Everh., J. Mycol. 3: 17. 

1887. 

≡ Cercoseptoria prunicola (Ellis & Everh.) J.M. Yen, Bull. Trimest. Soc. 

Mycol. France 97: 92. 1981. 

= Cercospora pruni-yedoensis Sawada, Rep. Gov. Agric. Res. Inst. Taiwan 85: 

120. 1943, nom. inval. 

98


Fig. 53. Pseudocercospora pseudostigmina-platani (CPC 11726). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C, E, F. Fascicles with 

conidiophores and conidiogenous cells, giving rise to dimorphic conidia. D. Pseudocercospora conidia. G. Conidia of stigmina-like synanamorph. Scale bars = 10 μm. 

≡ Pseudocercospora pruni-yedoensis Goh & W.H. Hsieh, in Hsieh & Goh, 

Cercospora and similar genera from Taiwan: 282. 1990. 

= Cercospora pruni-persicae J.M. Yen, Bull. Trimest. Soc. Mycol. France 94: 

61. 1978 and Rev. Mycol. 42: 59. 1978. 

≡ Cercoseptoria pruni-persicae (J.M. Yen) J. M. Yen, Bull. Trimest. Soc. 

Mycol. France 97: 92. 1981. 

Misapplied name: Pseudocercospora circumscissa (Sacc.) Y.L. 

Guo & X.J. Liu, Mycosystema 2: 231. 1989. 

Descriptions: Hsieh & Goh (1990: 282–283, as Pseudocercospora 

pruni-yedoensis), Braun & Mel’nik (1997: 82–83). 

Illustrations: Hsieh & Goh (1990: 283, fig. 216, as Pseudocercospora 

pruni-yedoensis), Braun & Mel’nik (1997: 121, fig. 48). 

Specimens examined: South Korea, Suwon, on Prunus yedoensis (≡ Cerasus 

yedoensis), 2 Oct. 2007, H.D. Shin, CBS H-20860, CPC 14511 = CBS 132107. 

Taiwan, Taipei, on Prunus yedoensis, 30 Nov. 1930, K. Sawada, holotype of 

Pseudocercospora pruni-yedoensis, NTU-PPE. USA, Louisiana, Point a la Hache, 

Langlois 542, holotype of Cercospora prunicola, NY (also Ellis & Everh., North 

American Fungi 1771, NY, isotype). 

Notes: Braun & Mel’nik (1997) discussed the intricate taxonomy 

of Passalora and Pseudocercospora on species of Prunus s. lat. 

in detail and demonstrated, based on type material and other 

collections, that two distinct species are involved. Cercospora 

circumscissa is a true Passalora with somewhat thickened and 

darkened conidiogenous loci and hila. Its placement in Passalora 

s. str. has recently been confirmed based on molecular data 

(unpubl.). Superficial mycelium with solitary conidiophores is 

lacking, and the conidia are mostly somewhat rough-walled. 

Passalora circumscissa is also known from Asia, e.g. China, Iran 

and Japan. Some Chinese collections deposited at HMAS have 

been examined and proved to be true Passalora circumscissa 

(e.g. on Prunus mandshurica × Armeniaca mandshurica, Yanji, 

Jilin, HMAS 55845). Other collections belong to Pseudocercospora 

prunicola (e.g. on Prunus yedoensis, Nanjing, Jiangsu, HMAS 

06632, and Changshan, Hunan, HMAS 55847). The Chinese 

authors misapplied the name Pseudocercospora circumscissa. 

The published descriptions of “Pseudocercospora circumscissa” 

in Guo & Hsieh (1995) and Guo & Liu (1998) cover both species, 

namely Passalora circumscissa as well as Pseudocercospora 

prunicola, but the illustrations seem to be based on material of the 

true Pseudocercospora on Prunus. Pseudocercospora prunicola is 

morphologically easily distinguishable from Passalora circumscissa 

by its inconspicuous, unthickened, not darkened conidiogenous 

loci and hila, well-developed superficial hyphae with solitary 

conidiophores and smooth conidia. The position of P. prunicola 

within the Pseudocercospora clade has been confirmed on the 

basis of sequence data retrieved from the present Korean culture. 

Pseudocercospora pseudostigmina-platani Crous, U. 


Etymology: Name reflects its morphological similarity to the 

Pseudocercospora anamorph of Mycosphaerella stigmina-platani. 


medium brown with a wide chlorotic margin. Mycelium predominantly 

internal, pale brown, consisting of septate, branched, smooth, 2–3 

μm diam hyphae. Caespituli fasciculate to sporodochial, brown, 

predominantly hypophyllous, up to 60 μm diam and 30 μm high. 

Conidiophores aggregated in loose to dense fascicles, arising from 

the upper cells of a brown stroma, up to 50 μm diam and 20 μm 

high; conidiophores brown, verruculose, 0–1-septate, subcylindrical 

to somewhat doliiform, straight to slightly curved, unbranched, 10– 

20 × 7–10 μm. Conidiogenous cells terminal, unbranched, brown, 

verruculose, proliferating percurrently near apex, with 1–4 irregular 


99

Crous et al. 

Fig. 54. Pseudocercospora pyracanthigena (CPC 10808). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C, D. Fascicles with conidiophores 

and conidiogenous cells. E. Conidiogenous cell giving rise to a conidium. F. Conidia. Scale bars = 10 μm. 

proliferations, 8–20 × 5–8 μm. Conidia dimorphic: cercostigminalike 

conidia fusoid-ellipsoidal to obclavate, straight to curved, 

apex obtuse, base obconically subtruncate, brown, verruculose, 

3–5-septate, at times constricted at septa, (28–)30–35(–38) × (5–)7– 

8(–9) μm; stigmina-like conidia broadly ellipsoid, straight to curved, 

apex obtuse, base obconically subtruncate, brown, verruculose, 

3-septate, at times constricted at septa, which can also be darkened, 

and wall can appear thick though not distoseptate sensu stricto, (17–) 

21–25(–28) × (9–)10–12 μm; hila unthickened, neither darkened nor 

refractive, 3–3.5 μm diam. 



mycelium, and smooth, lobate margins. Surface pale olivaceousgrey, 

with thin, olivaceous-grey margin; reverse iron-grey. Colonies 

reaching 7 mm diam. 

Specimen examined: South Korea, Suwon, on leaves of Platanus occidentalis, 7 

Nov. 2007, H.D. Shin, holotype CBS H-20884, culture ex-type CPC 11726 = CBS 

131588. 

Notes: Pseudocercospora pseudostigmina-platani resembles the 

Pseudocercospora/Stigmina synanamorphs of Mycosphaerella 

stigmina-platani on Platanus in the USA, although its conidia 

are larger in size. The stigmina-like anamorph has conidia that 

are 3–6-septate, (15–)23–30(–45) × (6–)8–9(–10) μm, and the 

Pseudocercospora conidia are 3–7-septate, (35–)45–60(–100) × 

(4–)4.5–6(–6.5) μm (Crous & Corlett 1998). Based on DNA sequence 

comparisons, the genus Stigmina was treated as synonym of 

Pseudocercospora (Crous et al. 2006). The two species occurring 

on Platanus both with Pseudocercospora/Stigmina synanamorphs 

treated here, further support this synonymy. 

Pseudocercospora pyracanthae (Katsuki) C. Nakash. & 

Tak. Kobay., Ann. Phytopathol. Soc. Japan 63: 313. 1997. 

Basionym: Cercospora pyracanthae Katsuki, Bull. Agric. Improv. 

Sect. Econ. Dept. Fukuoka Pref. 1: 19. 1949. 

Specimens examined: Japan, Fukuoka, Kurume, on Pyracantha angustifolia, 6 

Nov. 1947, S Katsuki, holotype TNS-F-243829; Chiba, Sanbu, October 1976, E. 

Ishizawa, TFM: FPH-4432; Okayama, Okayama, on P. angustifolia, 20 Nov. 1960, H. 

Tanaka, TFM: FPH-3247; P. angustifolia, T. Koboyashi & C. Nakashima, CNS-446, 

culture MUCC892; Ibaraki, on P. angusti, Nov. 1994, T. Nishijima, culture MAFF 

237140; Kumamoto, on P. crenulata, 1973, T. Kobayashi, culture MAFF 410022. 

Notes: DNA sequence data obtained for Japanese isolates of this 

species indicate at least two different taxa. Further research is 

required to select a specimen and isolate that is authentic for the 

name, while other collections probably represent a novel species. 

Pseudocercospora pyracanthigena Crous, U. Braun & 


Etymology: Name derived from the host plant Pyracantha, from 


Leaf spots amphigenous, irregular to angular, up to 7 mm diam, 

brown, with inconspicuous border. Mycelium internal, hyaline 

to pale brown, consisting of septate, branched, smooth, 2–3 μm 

diam hyphae. Caespituli fasciculate to sporodochial, amphigenous, 

but predominantly epiphyllous, olivaceous on leaves, up to 150 

μm wide and 60 μm high. Conidiophores aggregated in dense 

fascicles arising from the upper cells of a brown stroma up to 120 

μm wide and 35 μm high; conidiophores medium brown, smooth, 

0–1-septate, subcylindrical to ampulliform, straight, unbranched, 

mostly reduced to conidiogenous cells, tapering to flat-tipped apical 

loci, proliferating sympodially or percurrently near apex, 7–15 × 2–3 

μm. Conidia solitary, brown, smooth, guttulate, subcylindrical to 

narrowly obclavate, apex subobtuse, base obconically subtruncate 

to truncate, straight to gently curved, 1–4-septate, (30–)35–40(– 

45) × (2.5–)3(–3.5) μm; hila unthickened, neither darkened nor 

refractive, 1.5 μm wide. 



mycelium, and smooth, lobate margins. Surface smoke-grey; 

reverse olivaceous-grey. Colonies reaching 15 mm diam. 

Specimen examined: South Korea, Jeju, Halla arboretum, on leaves of Pyracantha 

angustifolia, 1 Nov. 2007, M.J. Park, holotype CBS H-20885, culture ex-type CPC 

10808 = CBS 131589. 

100


Fig. 55. Pseudocercospora ranjita (CPC 11141). A. Leaf spots on upper leaf surface. B, C. Close-up of leaf spots with fruiting. D–F. Fascicles with conidiophores and 

conidiogenous cells. H. Branched conidiophore. G, I–K. Conidia. Scale bars = 10 μm. 

Notes: Pseudocercospora pyracanthigena is distinct from P. 

pyracanthae (conidia 25–65 × 2.4–4 μm, conidiophores 15–40 × 

2.5–3 μm; Chupp 1954) in having shorter conidia and conidiophores. 

A second species has been recorded on Pyracantha angustifolia in 

Korea (CPC 14711–14713), for which a new name is required. 

Pseudocercospora ranjita (S. Chowdhury) Deighton, 

Mycol. Pap. 140: 151. 1976. Fig. 55. 

Basionym: Cercospora ranjita S. Chowdhury, Lloydia 21: 155. 

1958. 

Leaf spots epiphyllous, distinct, scattered, white to pale brown, 

irregular, 1–4 mm diam, definite raised brown border, surrounded 


101

Crous et al. 

Fig. 56. Pseudocercospora ravenalicola (CBS 122468). A. Leaf spots on upper leaf surface. B, C. Close-up of leaf spots. D–G. Fascicles with conidiophores and conidiogenous 

cells. H–L. Conidia. Scale bars = 10 μm. 

entirely or partly by brown to dark brown irregular halo. Mycelium 

internal and external, 2–5 mm wide, branched, smooth, septate, 

subhyaline to pale brown. Caespituli epiphyllous, few in number, 

distributed over the leaf spot, dark brown to black. Stromata 

well-developed, intraepidermal to subimmersed, brown, globular 

to irregular, 40–90 μm diam. Conidiophores fasciculate, arising 

from the upper cells of stromata, pale brown, straight to curved, 

unbranched and branched, 1–4-septate, irregular in width, apex 

truncate, (20–)27–38(–42) × (3–)3.5–4.5(–5) μm. Conidiogenous 

cells terminal, unbranched, pale brown, smooth to finely verrucose, 

proliferating percurrently, (8–)9–15(–19) × 3(–4) μm. Conidia 

solitary, cylindrical to obclavate, 2–9-septate, subhyaline to pale 

brown, smooth, apex rounded to subobtuse, base obconically to 

long obconically truncate, (26–)44–67(–84) × (3–)4–5(–6) μm; hila 

unthickened nor darkened. 

Culture characteristics: Colonies on MEA reaching 27 mm diam after 

30 d at 24 °C on MEA. Colonies circular with a smooth margin, that is 

darker than the colony centre, slight folding; aerial mycelium moderate; 

greyish blue to olivaceous-grey (surface) and iron-grey (reverse). 

Specimen examined: Indonesia, Northern Sumatra, on leaves of Gmelina sp., Mar. 

2004, M.J. Wingfield, CBS H-20386, culture CPC 11141 = CBS 126005. 

Note: The present collection closely matches the morphological 

description of the type specimen, which was collected from India 

(Chowdhury 1958). 

Pseudocercospora ravenalicola G.C. Hunter & Crous, sp. 


Etymology: Name derived from the plant host Ravenala, from which 

this fungus was isolated. 

102


Fig. 57. Pseudocercospora rhamnellae (CPC 12500–12502). A. Leaf spots on upper leaf surface. B, C. Close-up of leaf spots with fruiting. D, E. Fascicles with conidiophores 

and conidiogenous cells. F–J. Conidia. Scale bars = 10 μm. 

Leaf spots amphigenous, distinct, brown to pale, predominantly 

at leaf margin, but smaller spots are scattered over the whole 

leaf, elongated to irregular; border definite, raised, with dark 

brown to black border. Caespituli amphigenous, sparsely 

scattered over the leaf spot and aggregated toward the lesion 

margin, flocculose, pale to pale olivaceous. Stromata erumpent 

to superficial, globular, pale to dark brown, 30–80 μm diam. 

Conidiophores fasciculate, arising from the stromata, brown, 

becoming paler toward the apex, smooth, 0–3-septate, straight to 

curved, apex subtruncate to rounded, predominantly unbranched, 

sometimes branched below, (14–)17–25(–32) × (3–)4–5(–6) 

μm. Conidiogenous cells terminal, pale brown, smooth, straight 

to geniculate, tapering to a truncate to blunt apex, proliferating 

sympodially and percurrently, (7–)13(–15) × (3–)3.5(–4) μm. 

Conidia solitary, cylindrical, straight to curved, smooth, subhyaline 

to pale brown, 1–6-septate, infrequently constricted at the septa, 

apex obtuse to narrowly rounded, base obconically truncate to 

long obconically truncate, (16–)25–47(–60) × (3–)4(–5) μm; hila 

unthickened, nor darkened. 

Culture characteristics: Colonies after 1 mo at 24 ºC in the dark 


and smooth, lobate margins. Surface smoke-grey in centre, pale 

olivaceous-grey in outer region; reverse olivaceous-grey. Colonies 


Specimen examined: India, Chandigarh, on leaves of Ravenala madagascariensis, 

2 Mar. 2004, W. Gams, holotype CBS H-20394, culture ex-type CBS 122468. 

Note: Pseudocercospora ravenalicola represents the first species 

of Pseudocercospora known from this host and the Strelitziaceae. 

Pseudocercospora rhabdothamni U. Braun & C.F. Hill, 

Australas. Plant Pathol. 33: 489. 2004. 

Specimen examined: New Zealand, Auckland, University Campus, Princes Street, 

on Rhabdothamnus solanderi, 9 Nov. 2003, C.F. Hill, holotype HAL 1790 F, isotype 

PDD 80279, culture ex-isotype CBS 114872, ICMP 15289. 

Note: Two strains have been deposited in CBS under the name 

Ps. rhabdothamni. 

Pseudocercospora rhamnellae G.C. Hunter, H.D. Shin, U. 

Braun & Crous, sp. nov. MycoBank MB564844. Fig. 57. 

Etymology: Name derived from the plant host Rhamnella, from 

which this fungus was isolated. 

Leaf spots distinct, amphigenous, subcircular to irregular, pale to 

dark brown, dark brown to black raised border with effuse spreading 

pale to dark brown halo, solitary or sometimes coalescing, 2–11 


103

Crous et al. 

Fig. 58. Pseudocercospora rhododendri-indici (CPC 10822–10824). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C, D. Fascicles with 


mm diam. Mycelium smooth, branched, internal and external, pale 

brown, septate 2–4 μm diam. Caespituli amphigenous, on adaxial 

surface single, scattered to slightly aggregated, pale to light brown, 

on abaxial surface significantly more dense, mostly aggregated 

over the lesions surface, light brown to light olive-green. Stromata 

medium to large, well-developed, superficial to intraepidermal, pale 

to dark brown, 30–85 μm diam. Conidiophores fasciculate, straight 

to curved, brown, becoming paler to the apex, unbranched, smooth 

to finely verruculose, subcylindrical, 0–1-septate, (10–)13–19(–23) 

× (2–)3–4(–5) μm. Conidiogenous cells terminal, unbranched, pale 

brown, smooth to slightly verruculose, proliferating sympodially or 

percurrently near apex, (3–)5–10(–15) × (2–)3–4(–5) μm. Conidia 

solitary, guttulate, straight to curved, apex obtusely rounded, base 

truncate, solitary, pale brown, thin-walled, smooth, subcylindrical 

to narrowly obclavate, 1–12-septate, (17–)33–57(–80) × (2–)3(–4) 

μm, hila neither thickened, nor darkened or refractive, 2–3 μm diam. 



mycelium, and smooth, lobate margins. Surface olivaceous-grey 

with patches of pale olivaceous-grey; reverse iron-grey. Colonies 


Specimen examined: South Korea, Jeju, Halla arboretum, on leaves of Rhamnella 

franguloides, 29 Oct. 2005, H.D. Shin, holotype CBS H-20395, culture ex-type CPC 

12500 = CBS 131590, CPC 12501, 12502. 

Notes: No species of Pseudocercospora are presently known 

to occur on Rhamnella (Rhamnaceae). Pseudocercospora 

rhamnellae is distinct from P. rhamnaceicola (on Paliurus, Rhamnus 

and Zizyphus; conidia 18–85 × 1.5–2.5 μm, apex pointed, base 

obconically truncate, Hsieh & Goh 1990) by having wider conidia, 

which are subcylindrical-obclavate with an obtusely rounded apex 

and truncate base. The conidiophores are also shorter and wider. 

Further collections are needed to determine whether isolates from 

other hosts in the Rhamnaceae all represent P. rhamnaceicola. 

Pseudocercospora rhododendri-indici Crous, U. Braun & 


Etymology: Name derived from the plant host Rhododendron 

indicum, from which it was collected. 

Leaf spots amphigenous, subcircular to circular, 2–3 mm diam, 

medium brown with a raised, dark brown border. Mycelium internal, 

pale brown, consisting of septate, branched, smooth, 2–3 μm diam 

hyphae. Caespituli fasciculate to sporodochial, olivaceous-brown, 

predominantly epiphyllous, up to 100 μm diam and 80 μm high. 

Conidiophores aggregated in dense fascicles, arising from the 

upper cells of a brown stroma, up to 80 μm diam and 40 μm high; 

conidiophores pale brown, smooth, 0–2-septate, subcylindrical, 

straight to geniculate-sinuous, unbranched, 10–30 × 3–4 μm. 

Conidiogenous cells terminal, pale brown, smooth, tapering to 

flat-tipped apical loci, proliferating sympodially, 10–15 × 3–3.5 μm. 

Conidia solitary, pale brown, smooth, guttulate, subcylindrical, apex 

subobtuse, base truncate, straight to variously curved, 1–4-septate, 

(35–)40–55(–65) × (2–)3 μm; hila unthickened, neither darkened 

nor refractive, 2–3 μm diam. 



and smooth, lobate margins. Surface olivaceous-grey in centre, 

pale olivaceous-grey in outer region; reverse iron-grey. Colonies 


Specimen examined: South Korea, Seoul, on Rhododendron indicum, 27 Oct. 


131591, CPC 10823, 10824. 

Notes: Of the species occurring on Rhododendron, P. rhododendriindici 

differs from P. handelii (conidia narrowly linear to obclavate, 

indistinctly multiseptate, 12–140 × 1.5–3 μm; Chupp 1954) by its 

subcylindrical, 1–4-septate conidia with truncate base and obtuse 

apex, and phylogentic position (Fig. 5). The description and 

illustration of P. handelii based on Chinese material (Guo & Hsieh 

1995) agrees well with Chupp’s (1954) description. The identity of 

Korean collections on Rhododendron indicum described in Shin & 

Kim (2001), characterised by much longer acicular-filiform conidia 

with truncate base, is unclear. Pseudocercospora rhododendriindici 

differs from P. rhododendricola (conidia 54–96 × 2–2.5 μm; 

Yen 1966) by its shorter conidia. Beside epiphyllous colonies, 

P. rhododendricola forms hypophyllous colonies composed of 

small, loose fascicles of conidiophores that emerge through 

stomata, together with superficial hyphae that give rise to solitary 

conidiophores. The hypophyllous fruiting was neither mentioned in 

the original description nor in Yen & Lim (1980). It was observed 

during the re-examination of type material (Singapore, Botanic 

Gardens, on Rhododendron sp., 13 Apr. 1965, S.H. Yen No. 112, 

holotype PC). 

Pseudocercospora rhoina (Cooke & Ellis) Deighton, Mycol. 

Pap. 140: 152. 1976. Fig. 59. 

Basionym: Cercospora rhoina Cooke & Ellis, Grevillea 6: 89. 1878. 

= Cercospora copallina Cooke, Grevillea 12: 31. 1883. 

= Cercospora rhoina var. nigromaculans Peck, Rep. (Annual) New York State 

Mus. Nat. Hist. 42: 129. 1889. 

Specimen examined: South Korea, Namhae, on Rhus chinensis, 30 Jun. 2004, 

H.D. Shin, CBS H-20887, KUS-F 20367, CPC 11464 = CBS 131891. 

104


Fig. 59. Pseudocercospora rhoina (CPC 11464–11465). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C–E. Fascicles with conidiophores 

and conidiogenous cells. F. Conidia. Scale bars = 10 μm. 

Fig. 60. Pseudocercospora sambucigena (CPC 14397–14399). A, B. Leaf spots on upper and lower leaf surface. C, D. Close-up of leaf spots with fruiting. E, F. Fascicles with 

conidiophores and conidiogenous cells. G. Conidiogenous cells. H–L. Conidia. Scale bars = 10 μm. 

Pseudocercospora sambucigena U. Braun, Crous & K. 

Schub., Mycotaxon 92: 400. 2005. Fig. 60. 

Leaf spots distinct, scattered over leaf surface, amphigenous, 

upper surface pale brown to grey, with definite border that is raised 

and dark brown in colour; lower surface pale grey to pale brown, 


105

Crous et al. 

Fig. 61. Pseudocercospora securinegae (CPC 10793). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C, D. Fascicles with conidiophores 


with distinctly raised, brown border, 2–10 mm diam. Mycelium 

smooth, internal and external, consisting of branched, subhyaline, 

2–4 μm diam hyphae. Caespituli amphigenous, predominantly 

occurring on the abaxial lesion surface, evenly distributed over the 

lesion, punctiform, grey to dark brown. Stromata well-developed, 

subimmersed becoming erumpent, globular, dark brown, 45–100 

mm diam. Conidiophores fasciculate, emerging from stomata, 

brown, becoming paler toward the apex, unbranched, straight 

to curved, cylindrical, uniform or irregular in width, rounded 

apex, indistinctly 0–3-septate, (25–)35–51(–60) × (4–)5(–7) μm. 

Conidiogenous cells terminal, unbranched, smooth, pale brown, 

proliferating sympodially and percurrently, conidiogenous loci 

(scars) unthickened to slightly thickened, but not darkened, (10–) 

19–34(–46) × (3–)5 μm. Conidia solitary, pale olivaceous to pale 

brown, smooth, guttulate, apex obtuse, base long obconically 

truncate, shape variable from cylindrical to obclavate, 1–7-septate, 

(40–)68–117(–156) × (4–)5–6(–7) μm; hila unthickened to slightly 

thickened, but not darkened. 


after 30 d in the dark at 24 °C. Colonies circular to subcircular, 

smooth to slightly irregular margin, prominently convex, moderate 

aerial mycelium; pale greenish grey to pale olivaceous-grey 

(surface) and olivaceous-black (reverse). 

Specimens examined: Italy, Parma, on leaves of Sambucus nigra, G. Passerini, 

paratype B 70-6710. Netherlands, Milingerwaard on leaves of Sambucus nigra, 

2007, P.W. Crous, epitype designated here CBS H-20391, cultures ex-epitype 

CPC 14397 = CBS 126000. USA, Pennsylvania, Dauphin Co., on leaves of 

Sambucus pubens, 21 Aug. 1921, O.E. Jennings, Acc. 6736, holotype NY. 

Pseudocercospora securinegae (Togashi & Katsuki) 

Deighton, Mycol. Pap. 140: 152. 1976. Fig. 61. 

Basionym: Cercospora securinegae Togashi & Katsuki, Ann. 

Phytopathol. Soc. Japan 17: 7. 1952. 

Specimen examined: South Korea, Yangpyong, on Flueggea suffruticosa 

(≡ Securinega suffruticosa), 30 Sep. 2003, H.D. Shin, CBS H-20888, culture CPC 


Pseudocercospora snelliana (Reichert) U. Braun, H.D. 

Shin, C. Nakash. & Crous, comb. nov. MycoBank MB564846. 

Figs 62, 63. 

Basionym: Cercospora snelliana Reichert, Bot. Jahrb. Syst. 56: 

724. 1921. 

= Clasterosporium mori Syd. & P. Syd., Mem. Herb. Boiss. 4: 6. 1900. 

≡ Sirosporium mori (Syd. & P. Syd.) M.B. Ellis, Mycol. Pap. 87: 7. 1963. 

≡ Cercospora kusanoi Sawada, Rep. Dept. Agric. Gov. Res. Inst. 

Formosa 35: 109. 1928, nom. nov., non Cercospora mori Hara, 1918. 

= Cercospora bremeri Petr., Sydowia 2: 312. 1948. 

= Cercospora flexuosa Tanaka, unknown, nom. nud., non Tracy & Earle, 1895. 

Leaf spots lacking or amphigenous, but inconspicuous on upper 

leaf surface, chlorotic, irregular, as small speckles, up to 8 

mm diam, or effuse and much larger, forming large blotches or 

covering large portions of the hypophyllous surface with blackish 

colonies. Mycelium internal and external; internal hyphae pale 

olivaceous to pale brown, smooth, 3–4 μm diam, arising through 

stomata, giving rise to external mycelium that is pale yellowish 

green, olivaceous to brown, smooth, thin-walled, 1.5–5 μm 

diam. Conidiophores arising singly from superficial mycelium 

and in small, divergent fascicles from a few substomatal swollen 

hyphal cells, 2–8 μm diam., emerging through stomata, brown, 

smooth, becoming roughened towards apex, wall up to 1 μm 

thick, 1–12-septate, subcylindrical to often subclavate, i.e. width 

somewhat increasing towards the apex, straight to variously 

curved or geniculate-sinuous, unbranched or branched above, 

15–100 × 3–6 μm. Conidiogenous cells terminal or lateral, 

unbranched, brown, becoming paler towards the tip, roughened, 

tapering towards flat-tipped loci, 2–3 μm diam, proliferating 

sympodially (lateral scars as illustrated by Ellis 1971 observed), 

or percurrently near apex, 10–30 × 4–7 μm. Conidia solitary, 

medium to dark olivaceous-brown or brown, small young conidia 

sometimes subhyaline to pale olivaceous, wall up to 1 μm thick, 

smooth or almost so to verruculose, guttulate, smaller conidia 

ellipsoid-ovoid, subcylindrical, larger conidia usually distinctly 

obclavate, apex obtuse, base obconically truncate, subtruncate 

or sometimes rounded, straight to gently curved, 1–10-septate 

(septa somewhat refractive, at times also 1(–2) oblique or 

vertical septa present), (15–)30–70(–80) × (3–)4–6(–7) μm; 

106


Fig. 62. Pseudocercospora snelliana (B 700014740, holotype). Sparse fascicles, and solitary conidiophores on superficial mycelium giving rise to muriformly septate, thickwalled 

conidia. Scale bar = 10 μm. 

Fig. 63. Pseudocercospora snelliana (CPC 11654–11656). A. Leaf spots on the lower leaf surface. B. Close-up of leaf spot with fruiting. C–E. Solitary conidiophores and 

conidiogenous cells. F–H. Conidia. Scale bars = 10 μm. 


107

Crous et al. 

hila neither thickened, nor darkened or refractive, 1–1.5(–2) μm 

diam. 





Specimens examined: Egypt, Kahirahm, near Bahtim, on Morus alba, Nov. 1913, 

Snell, holotype B 700014740. South Korea, Hoengseong, on Morus bombycis, 

11 Oct. 2004, H.D. Shin, CBS H-20889, HAL 1867 F, culture CPC 11654 = CBS 

131592, CPC 11655, 11656. 

Notes: Cercospora kusanoi is based on the same type specimen 

used by Sydow to describe Clasterosporium mori. Sawada (1928) 

considered this fungus a species of Cercospora. He introduced the 

name Cercospora kusanoi because the species epithet mori was 

occupied in Cercospora. The Korean material we studied closely 

resembles the description of the type, which was originally described 

on Morus alba from Japan (Sawada 1928). Pseudocercospora 

mori is also already occupied so type material of P. snelliana, the 

next available epithet, was re-examined. We determined it to be 

conspecific with C. kusanoi, so P. snelliana is introduced as a new 

combination. 

Pseudocercospora stephanandrae (Tak. Kobay. & H. 

Horie) C. Nakash. & Tak. Kobay., Mycoscience 41: 27. 2000. 

Basionym: Cercospora stephanandrae Tak. Kobay. & H. Horie, 

Trans. Mycol. Soc. Japan 20: 331. 1979. 

Specimens examined: Japan, Tokyo, Jindai Bot. Park, on Stephanandra incisa, 21 

Oct. 1976, T. Kobayashi & H. Horie TFM: FPH-4712; Tokyo, Jindai Botanical Park, 

Chofu-City, on S. incisa, 26 Oct. 1974, H. Horie, holotype TFM: FPH 4411; Tokyo, 

Jindai Bot. Park, on S. incisa, 7 Nov. 1998, C. Nakashima & E. Imaizumi, epitype 

designated here TFM: FPH-8099, ex-epitype cultures MUCC 914, MAFF 237799. 

Pseudocercospora timorensis (Cooke) Deighton, Mycol. 

Pap. 140: 154. 1976. 

Basionym: Cercospora timorensis Cooke, Grevillea 12: 38. 1883. 

= Ramularia batatae Racib., Paras. Algen Pilze Javas, Batavia 1: 35. 1900. 

= Cercospora batatae A. Zimmerm., Ber. Land.-Forstw. Deutsch Ostafrikas 2: 

28. 1904. 

= Cercospora batatae Henn., Bot. Jahrb. Syst. 38: 118. 1907, nom. illeg., 

homonym of C. batatae A. Zimmerm., 1904. 

= Cercospora ipomoeae-purpureae J.M. Yen, Rev. Mycol. 30: 173. 1965. 

≡ Pseudocercospora ipomoea-purpureae (J.M. Yen) J.M. Yen, in Yen & 

Lim, Gard. Bull., Singapore 33: 177. 1980. 

Specimen examined: Japan, Okinawa, Ipomoea indica, 19 Nov. 2007, C. Nakashima 

& T. Akashi, MUMH 10923, culture MUCC 819. 

Pseudocercospora udagawana (Katsuki) X.J. Liu & Y.L. 

Guo, Mycosystema 2: 238. 1989. Fig. 64. 

Basionym: Cercospora udagawana Katsuki, Ann. Phytopathol. 

Soc. Japan 20(2–3): 72. 1955. 

Specimen examined: South Korea, Dongducheon, on Hovenia dulcis, 28 Sep. 

2003, H.D. Shin, CBS H-20890, CPC 10799 = CBS 131931. 

Pseudocercospora viburnigena U. Braun & Crous, Mycol. 

Progr. 1: 23. 2002. Fig. 65. 

Basionym: Cercospora tinea Sacc., Michelia 1(2): 268. 1878 (non 

P. tinea Y.L. Guo & W.H. Hsieh, 1994). 

≡ Cercoseptoria tinea (Sacc.) Deighton, Mycol. Pap. 140: 167. 1976. 

≡ Cercostigmina tinea (Sacc.) U. Braun, Cryptog. Bot. 4: 108. 1993. 

Leaf spots distinct, scattered, amphigenous, 4–15 mm diam, 

lesions on abaxial surface dark to pale brown, subcircular to 

irregular, surrounded by a slightly raised dark brown border, 

lesions on adaxial surface dark to pale brown, surrounded by 

a dark brown border with a light red diffuse pigment extending 

outward from the border in older lesions. Mycelium internal 

and external, smooth, subhyaline, branched, 1.5–4 μm wide. 

Caespituli amphigenous, but predominantly hypophyllous, 

evenly distributed over the leaf spot, velvety, olivaceous. 

Stromata well-developed, subimmersed, globular, dark 

brown, 30–80 μm diam. Conidiophores fasciculate, smooth, 

0–2-septate, emerging from the upper cells of the stroma, pale 

brown, straight to curved, irregular in width, apex subtruncate 

to rounded, (14–)17–24(–30) × (3–)4–5(–6) μm. Conidiogenous 

cells integrated, terminal, inconspicuously proliferating 

percurrently, cylindrical, straight, pale brown, at times slightly 

verruculose, (5–)9–15(–19) × (2–) 3(–4) μm. Conidia solitary, 

pale brown, smooth, guttulate, apex obtusely rounded, base 

narrowly truncate, narrowly ellipsoidal to acicular, curved or 

sigmoid, 5–11-septate, (68–)87–110(–120) × (2–)3–4(–5) μm, 

hila unthickened. 


after 30 d at 24 °C in the dark. Colonies circular, convex, smooth 

margin that is distinctly darker than the rest of the colony, slight 

folding occurs toward the edge of the colony, moderate to profuse 

aerial mycelium; olivaceous-grey (surface) and greenish black 

(reverse). 

Specimens examined: Italy, Padova, Viburnum tinus, Oct. 1877, Bizzozera, Sacc., 

Mycoth. Venet. 1252, syntype HAL. Netherlands, Bilthoven, Sweelincklaan 87, on 

leaves of Viburnum davidii, 26 May 2008, M.K. Crous, epitype designated here 

CBS H-20393, culture ex-epitype CPC 15249 = CBS 125998. 

Note: The epitype closely matches the morphology of the holotype 

(Braun & Hill 2002), representing a species that is common on 

Viburnum in Europe. 

Pseudocercospora viticicola (J.M. Yen & Lim) J.M. Yen, 

Gardens Bulletin, Singapore 33: 190. 1980. 

Basionym: Cercospora viticicola J.M. Yen & Lim, Cah. Pacifique 

17: 104. 1973. 

= Cercospora viticis Ellis & Everh. (as "viteae"), J. Mycol. 3: 18. 1887, non 

Pseudocercospora viticis Goh & W.H. Hsieh, 1989. 

≡ Pseudocercosporella viticis (Ellis & Everh.) B.K. Gupta & Kamal, Indian 

Phytopathol. 42: 388. 1989, nom. inval. 

≡ Pseudocercospora viticicola U. Braun, Mycotaxon 48: 296. 1993, nom. 

illeg., homonym of P. viticicola (J.M. Yen & Lim) J.M. Yen, 1980. 

= Cercospora viticis Sawada, Rep. Gov. Agric. Res. Inst. Taiwan 87: 90. 1944, 

nom. illeg., homonym of C. viticis Ellis & Everh., 1887. 

≡ Pseudocercospora viticis Goh & W.H. Hsieh, Trans. Mycol. Soc. 

Republ. China 4: 11. 1989. 

= Cercospora viticis-quinatae J.M. Yen, Bull. Trimestriel Soc. Mycol. France 

93: 158. 1977. 

≡ Pseudocercospora viticis-quinatae (J.M. Yen) J.M. Yen, Bull. Trimestriel 

Soc. Mycol. France 94: 388. (1978) 1979. 

= Pseudocercospora viticigena J.M. Yen, A.K. Kar & B.K. Das, Mycotaxon 16: 

68. 1982. 

Specimens examined: Japan, Okinawa, Okinawa Is, on Vitex trifolia, 19 Nov. 2007, 

C. Nakashima, MUMH 10828, culture MUCC 777; Chiba, Matsudo, on V. agnuscastus, 

7 Nov. 1987, M. Nagashima & T. Kobayashi, TFM: FPH-6912; Shizuoka, 

Kanzanji, on V. agnus-castus, 1 Nov. 1996, T. Kobayashi & C. Nakashima, CNS- 

101, culture MUCC 1069, MAFF 237866; Kuroki, Fukuoka, on V. cannabifolia (≡ V. 

negundo var. cannabifolia), 25 Sep. 1974, S. Ogawa, TFM: FPH-4193. 

108


Fig. 64. Pseudocercospora udagawana (CPC 10799–10801). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C, D. Fascicles with 

conidiophores and conidiogenous cells. E. Solitary conidiogenous cell on superficial hypha. F. Conidia. Scale bar = 10 μm. 

Fig. 65. Pseudocercospora viburnigena (CPC 15249). A. Leaf spots on upper leaf surface. B, C. Close-up of leaf spots with fruiting. D, E. Fascicles with conidiophores and 

conidiogenous cells. F–H. Conidia. Scale bars = 10 μm. 


109

Crous et al. 

Fig. 66. Pseudocercospora xanthocercidis (CPC 11665–11667). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C–E. Fascicles with 

conidiophores and conidiogenous cells. F. Conidia. G. Colony on malt extract agar. H, I. Conidia formed in culture. Scale bars = 10 μm. 

Pseudocercospora weigelae (Ellis & Everh.) Deighton, 


Basionym: Cercospora weigelae Ellis & Everh., Proc. Acad. Nat. 

Sci. Philadelphia 45: 170. 1893. 

Specimen examined: Japan, Ibaraki, on Weigela coraeensis, 10 Sep. 1998, T. & Y. 

Kobayashi, CNS-455, culture MUCC 899, MAFF 237794. 

Pseudocercospora xanthocercidis Crous, U. Braun & A. 

Wood, sp. nov. MycoBank MB564847. Fig. 66. 

Etymology: Name derived from the plant host Xanthocercis, from 



pale to medium brown, with indistinct border. Mycelium internal, 

pale brown, consisting of septate, branched, smooth, 2–3 μm diam 

hyphae. Caespituli sporodochial, hypophyllous, also occurring 

on green leaf tissue, prominent, appearing like insect galls, 

olivaceous-brown on leaves, up to 400 μm wide and 300 μm high. 

Conidiophores aggregated in dense sporodochial fascicles arising 

from the upper cells of a brown stroma up to 300 μm wide and 

250 μm high; conidiophores brown, finely verruculose, 1–2-septate, 

subcylindrical, straight to slightly curved, 20–30 × 5–7 μm. 

Conidiogenous cells terminal, unbranched, brown, subcylindrical, 

finely verruculose, proliferating percurrently near apex, with 

several irregular, rough proliferations, 7–12 × 5–6 μm. Conidia 

solitary, brown, finely verruculose, guttulate, narrowly obclavate, 

apex obtuse, base obconically subtruncate to truncate, straight to 

gently curved, 5–8-septate, (25–)28–36(–40) × (5–)6–7 μm; hila 

unthickened, neither darkened nor refractive, 3–4 μm diam, with 

minute marginal frill visible. 


MEA; surface irregular, folded, erumpent, spreading, with sparse 

aerial mycelium, and smooth, irregularly lobate margins. Surface 

olivaceous-grey, with patches of iron-grey; reverse iron-grey. 


Specimen examined: South Africa, Mpumalanga, Nelspruit, Lowveld National 

Botanical Garden, on Xanthocercis zambesiaca, 14 Sep. 2004, A. Wood, holotype 

HAL 1859 F, isotype CBS H-20891, culture ex-type CPC 11665 = CBS 131593, 

CPC 11666, 11667. 

Notes: No other species of Pseudocercospora are known 

from this host. Pseudocercospora xanthocercidis differs from 

other Pseudocercospora species on legumes by its very 

large sporodochial conidiomata with percurrently proliferating 

conidiogenous cells and verruculose conidia with visible marginal 

frill at the base. There is no comparable species on legumes. 

Pseudocercospora xanthoxyli (Cooke) Y.L. Guo & X.J. Liu, 

Mycosystema 4: 115. 1991. Fig. 67. 

Basionym: Cercospora xanthoxyli Cooke, Grevillea 12: 30. 1883. 

= Cercospora fagaricola Sawada (fagariae), Rep. Gov. Agric. Res. Inst. Taiwan 

85: 105. 1943, nom. inval. 

≡ Pseudocercospora fagaricola Goh & W.H. Hsieh, in Hsieh & Goh, 

Cercospora and similar species from Taiwan: 294. 1990. 

Specimen examined: South Korea, Wando, Wando Arboretum, on Xanthoxylum 

ailanthoides, 9 Nov. 2002, H.D. Shin, CBS H-20892, CPC 10009, 10064–10065. 

Pseudocercospora zelkovae (Hori) X.J. Liu & Y.L. Guo, 

Acta Mycol. Sin. 12: 33. 1993. Fig. 68. 

Basionym: Cercospora zelkowae Hori, Nambu N. Jour. Plant 

Protection 8: 492. 1921. 

110


Fig. 67. Pseudocercospora xanthoxyli (CPC 10009, 10064–10065). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C–E. Fascicles with 

conidiophores and conidiogenous cells. F. Close-up of conidiogenous cells. G. Conidia. Scale bars = 10 μm. 

Fig. 68. Pseudocercospora zelkovae (CPC 14484). A. Leaf spots on upper and lower leaf surface. B. Close-up of leaf spot with fruiting. C–E. Fascicles with conidiophores and 

conidiogenous cells. F. Conidia. Scale bar = 10 μm. 

Holotype: Japan, Tokyo, Forest Experimental Station, on Zelkova 

serrata, Jun. 1920 (not preserved). 

Specimens examined: Japan, Yamagata, Kamabuchi, on Z. serrata, 5 July 1956, K. 

Ito, neotype designated here TFM:FPH169, cultures ex-neotype MAFF 410008, 

MUCC 1398. South Korea, Suwon, on Z. serrata, 2 Oct. 2007, H.D. Shin, CBS 

H-20893, culture CPC 14484 = CBS 132106; Osan, on Z. serrata, 30 Oct. 2007, 

H.D. Shin, CBS H-20894, CPC 14717 = CBS 132118. 

DISCUSSION 

This study provides a broad framework and phylogeny for the 

genus Pseudocercospora. These fungi are very common and 

the foundation that has been set will form the basis for additional 

species to be described and for specific groups to be more 

thoroughly investigated. Although the results clarify several issues 

relating to the taxonomy of Pseudocercospora s. str., the study 

also highlights many remaining taxonomic questions relating to 

this complex. To resolve these issues many species will need to 

be recollected, cultured, and sequenced so that they can be placed 

into this phylogenetic backbone. This is especially true for species 

described in some of the obscure genera treated by Braun (1995) 

and Crous & Braun (2003), many of which (or their type species) 

are not currently known from culture, and thus DNA sequence 

comparisons and phylogenetic inference has not been possible. 

Amongst the cercosporoid fungi, it appears possible and even 

probable that the approximately 1 500 names in Pseudocercospora 

represent the tip of the iceberg in terms of biodiversity. Indeed it 

seems likely that this could emerge as the largest genus of 

cercosporoid fungi known. A significant result of this study was 

the determination that names based on American or European 

type specimens could in most cases not be used when identifying 


111

Crous et al. 

identical diseases on the same hosts in Asia, Africa or South 

America. In this regard, it was surprising to find diversity even 

within a region such as Asia, where isolates from the same host 

and disease symptoms from Korea frequently differed from similar 

collections made in Japan. These important issues, which have 

significant ramifications pertaining to plant health and quarantine, 

will only be resolved when fresh collections from the American 

and European type locations have been made, thus allowing 

DNA sequence based comparisons. Furthermore, it emphasises 

the need to ensure that a DNA sequence has been provided for 

all novel taxa in this complex and that an authentic DNA barcode 

(Schoch et al. 2012) is available. The ITS gene region was found to 

be capable of differentiating only 25 of the 146 Pseudocercospora 

taxa (17 %) to species level in the present study. Where the ITS 

locus fails to provide acceptable resolution, it can be supplemented 

with sequences from the ACT or EF-1α gene regions (Fig. 5), 

though these loci still proved relatively conserved, and 57 taxa had 

less than 1% variation from their closest neighbours, suggesting 

that additional loci still have to be found to provide a more robust 

identification of Pseudocercospora species. 

Focused studies on specific crops such as those on Eucalyptus 

(Crous 1998, Hunter et al. 2006b), Musa (Arzanlou et al. 2007, 

2008, 2010), Chromolaena (Den Breeÿen et al. 2006) and Citrus 

(Pretorius et al. 2003) will undoubtedly confirm the already 

emerging view that many plant species are infected by a complex 

of Pseudocercospora spp. Some of these will clearly be specific 

to the host from which they were isolated, while others reflect 

chance occurrences or infections or broader host ranges (Crous 

& Groenewald 2005). In some instances, these chance infections 

may be caused by fungi that are major pathogens of other, 

completely unrelated hosts (Crous & Groenewald 2005, Arzanlou et 

al. 2008). Although the present study has succeeded in delineating 

Pseudocercospora within the Mycosphaerellaceae, and in the 

process has also delineated several other pseudocercospora-like 

genera, the question relating to host specificity still remains largely 

unanswered. 

The taxa investigated during this study represent the largest 

collection of Pseudocercospora and pseudocercospora-like taxa 

ever subjected to DNA sequence analysis. Of these, the vast 

majority appear to be host-specific. Of the 146 taxa subjected to 

multi-gene analysis, only four were found to occur on more than 

one host. These include P. norchiensis (Myrtaceae and Rosaceae), 

P. fraxinites (Oleaceae), P. atromarginalis (Solanaceae) and P. 

corylopsidis (Hamamelidaceae). In the latter three examples, 

the same species was found on different host genera within the 

same plant family, but never on unrelated hosts. This result was 

somewhat surprising as we initially expected to find at least some 

examples where species are generalists and occur on many hosts 

which are unrelated such as those in the Cercospora apii complex 

(Groenewald et al. 2006, 2007). The occurrence of P. norchiensis 

(a foliar pathogen of Eucalyptus in Italy; Crous et al. 2007c) on 

Rubus in New Zealand (CBS 114641), was highly unexpected, 

and further collections on Rubus from New Zealand will have to 

be made to resolve if this was a mere chance occurrence (Crous & 

Groenewald 2005), or true indication of its host range. 

In future studies of Pseudocercospora, additional taxa should 

be included in the analyses, and further loci screened to obtain a 

better separation of species. There is an urgent need to conduct 

inoculation tests to confirm inferences from taxonomic studies 

about host specificity in this important group of predominantly plant 

pathogenic fungi. For example, it remains to be shown whether 

isolates from different hosts with identical DNA barcodes and 

similar morphology have the ability to cross-infect hosts under 

natural conditions in the field. It appears that for the most part, F.C. 

Deighton was correct in his statement “If a sparrow flies to a cherry 

tree, it’s a cherry tree sparrow. If the same sparrow sits in an apple 

tree, it is an apple tree sparrow”. 


We thank the technical staff, Arien van Iperen (cultures), Marjan Vermaas 

(photographic plates), and Mieke Starink-Willemse (DNA isolation, amplification and 

sequencing) for their invaluable assistance. 

REFERENCES 

Arx JA von (1983). Mycosphaerella and its anamorphs. Proceedings of the 

Koninklijke Nederlandse Akademie van Wetenschappen, Series C 86: 

15–54. 

Arzanlou M, Abeln ECA, Kema GHJ, Waalwijk C, Carlier J, et al. (2007). Molecular 

diagnostics for the Sigatoka disease complex of banana. Phytopathology 97: 

1112–1118. 

Arzanlou M, Crous PW (2006). Strelitziana africana. Fungal Planet No. 8. CBS, 

Utrecht, Netherlands. 

Arzanlou M, Crous PW, Zwiers L-H (2010). Evolutionary dynamics of mating-type 

loci of Mycosphaerella spp. occurring on banana. Eukaryotic Cell 9: 164–172. 

Arzanlou M, Groenewald JZ, Fullerton RA, Abeln ECA, Carlier J, et al. (2008). 

Multiple gene genealogies and phenotypic characters differentiate several 

novel species of Mycosphaerella and related anamorphs on banana. Persoonia 

20: 19–37. 

Ávila A, Groenewald JZ, Trapero A, Crous PW (2005). Characterisation and 

epitypification of Pseudocercospora cladosporioides, the causal organism of 

Cercospora leaf spot of olives. Mycological Research 109: 881–888. 

Ayala-Escobar V, Yañez-Morales MJ, Braun U, Groenewald JZ, Crous PW (2005). 

Cercospora agavicola – a new foliar pathogen of Agave tequilana var. azul from 

Mexico. Mycotaxon 93: 115–121. 

Batzer JC, Gleason ML, Harrington TC, Tiffany LH (2005). Expansion of the sooty 

blotch and flyspeck complex on apples based on analysis of ribosomal DNA 

gene sequences and morphology. Mycologia 97: 1268–1286. 

Beilharz V, Mayers PE, Pascoe IG (2003). Pseudocercospora macadamiae sp. 

nov., the cause of husk spot of macadamia. Australasian Plant Pathology 32: 

279–282. 

Bensch K, Braun U, Groenewald JZ, Crous PW. (2012). The genus Cladosporium. 


Bensch K, Groenewald JZ, Dijksterhuis J, Starink-Willemse M, Andersen B, 

et al. (2010). Species and ecological diversity within the Cladosporium 

cladosporioides complex (Davidiellaceae, Capnodiales). Studies in Mycology 

67: 1–94. 

Braun U (1992). Taxonomic notes on some species of the Cercospora-complex. 

Nova Hedwigia 55: 211–221. 

Braun U (1993). Taxonomic notes on some species of the Cercospora complex (III). 

Mycotaxon 48: 275–298. 

Braun U (1995). A monograph of Cercosporella, Ramularia and allied genera 

(Phytopathogenic Hyphomycetes). Vol. 1. IHW Verlag, Eching, Germany. 


(phytopathogenic hyphomycetes). Vol. 2. Eching, Germany: IHW-Verlag. 

Braun U, Crous PW (2006). (1732) Proposal to conserve the name Pseudocercospora 

against Stigmina and Phaeoisariopsis (Hyphomycetes). Taxon 55: 803. 

Braun U, Crous PW (2007). The diversity of cercosporoid hyphomycetes – new 

species, combinations, names and morphological clarifications. Fungal 

Diversity 26: 55–72. 

Braun U, Crous PW, Dugan F, Groenewald JZ, Hoog GS de (2003a). Phylogeny and 

taxonomy of Cladosporium-like hyphomycetes, including Davidiella gen. nov., 

the teleomorph of Cladosporium s. str. Mycological Progress 2: 3–18. 

Braun U, Dick MA (2002). Leaf spot diseases of eucalypts in New Zealand caused 

by Pseudocercospora species. New Zealand Journal of Forestry Science 32: 

221–234. 

Braun U, Freire FCO (2002). Some cercosporoid hyphomycetes from Brazil – II. 

Cryptogamie Mycologie 23(4): 295–328. 

Braun U, Hill CF (2002). Some new micromycetes from New Zealand. Mycological 

Progress 1: 19–30. 

Braun U, Hill F, Dick M (2003b). New cercosporoid leaf spot diseases from New 

Zealand. Australasian Plant Pathology 32: 87–97. 

112


Braun U, Hill F, Schubert K (2006). New species and new records of biotrophic 

micromycetes from Australia, Fiji, New Zealand and Thailand. Fungal Diversity 

22: 13–35. 

Braun U, Mel’nik VA (1997). Cercosporoid fungi from Russia and adjacent countries. 

Trudy Botaniceskogo Instituta imeni V. L. Komarova 20: 1–130. 

Braun U, Mouchacca J, McKenzie EHC (1999). Cercosporoid hyphomycetes from 

New Caledonia and some other South Pacific islands. New Zealand Journal of 

Botany 37: 297–327. 

Braun U, Urtiaga R (2008). New species and new records of cercosporoid 

hyphomycetes from Venezuela. Feddes Repertorium 119(5–6): 484–506. 



Cheewangkoon R, Crous PW, Hyde KD, Groenewald JZ, To-anan C (2008). Species 

of Mycosphaerella and related anamorphs on Eucalyptus leaves from Thailand. 


Cheewangkoon R, Groenewald JZ, Summerell BA, Hyde KD, To-anun C, Crous PW 

(2009). Myrtaceae, a cache of fungal biodiversity. Persoonia 23: 55–85. 

Chowdhury S (1958). Notes on fungi from Assam, III. Lloydia 21: 152–156. 

Chupp C (1954). A monograph of the fungus genus Cercospora. Published by the 

author, Ithaca, New York. 

Churchill ACL (2010). Mycosphaerella fijiensis, the black leaf streak pathogen of 

banana: progress towards understanding pathogen biology and detection, 

disease development, and the challenges of control. Molecular Plant Pathology 

12: 307–328. 

Crous PW (1998). Mycosphaerella spp. and their anamorphs associated with leaf 

spot diseases of Eucalyptus. Mycologia Memoir 21: 1–170. 

Crous PW (2002). Taxonomy and pathology of Cylindrocladium (Calonectria) and 

allied genera. APS Press, Minnesota, St. Paul, USA. 

Crous PW (2009). Taxonomy and phylogeny of the genus Mycosphaerella and its 

anamorphs. Fungal Diversity 38: 1-24. 

Crous PW, Alfenas AC (1995). Mycosphaerella gracilis and other species of 

Mycosphaerella associated with leaf spots of Eucalyptus in Indonesia. 

Mycologia 87: 121–126. 

Crous PW, Aptroot A, Kang JC, Braun U, Wingfield MJ (2000). The genus 

Mycosphaerella and its anamorphs. Studies in Mycology 45: 107–121. 

Crous PW, Braun U (1996). Cercosporoid fungi from South Africa. Mycotaxon 57: 

233–321. 

Crous PW, Braun U (2003). Mycosphaerella and its anamorphs. 1. Names 

published in Cercospora and Passalora. CBS Biodiversity Series 1: 1–571. 

Centraalbureau voor Schimmelcultures, Utrecht, Netherlands. 

Crous PW, Braun U, Groenewald JZ (2007a). Mycosphaerella is polyphyletic. 


Crous PW, Braun U, Schubert K, Groenewald JZ (2007b). Delimiting Cladosporium 

from morphologically similar genera. Studies in Mycology 58: 33–56. 

Crous PW, Braun U, Wingfield MJ, Wood AR, Shin HD, et al. (2009a). Phylogeny 

and taxonomy of obscure genera of microfungi. Persoonia 22: 139–161. 

Crous PW, Corlett M (1998). Reassessment of Mycosphaerella spp. and their 

anamorphs occurring on Platanus. Canadian Journal of Botany 76: 1523–1532. 

Crous PW, Denman S, Taylor JE, Swart L, Palm ME (2004a). Cultivation and 

diseases of Proteaceae: Leucadendron, Leucospermum and Protea. CBS 

Biodiversity Series 2: 1–228. Centraalbureau voor Schimmelcultures, Utrecht, 

Netherlands. 

Crous PW, Gams W, Stalpers JA, Robert V, Stegehuis G (2004b). MycoBank: an 


50: 19–22. 

Crous PW, Groenewald JZ (2005). Hosts, species and genotypes: opinions versus 

data. Australasian Plant Pathology 34: 463–470. 

Crous PW, Groenewald J Z, Mansilla JP, Hunter GC, Wingfield MJ (2004c). 

Phylogenetic reassessment of Mycosphaerella spp. and their anamorphs 

occurring on Eucalyptus. Studies in Mycology 50: 195–214. 

Crous PW, Groenewald JZ, Gams W (2003). Eyespot of cereals revisited: ITS 

phylogeny reveals new species relationships. European Journal of Plant 

Pathology 109: 841–850. 

Crous PW, Groenewald JZ, Pongpanich K, Himaman W, Arzanlou M, Wingfield MJ 

(2004d). Cryptic speciation and host specificity among Mycosphaerella spp. 

occurring on Australian Acacia species grown as exotics in the tropics. Studies 


Crous PW, Groenewald JZ, Shin HD (2010). Strelitziana albiziae. Fungal Planet No. 

56. Persoonia 25: 132–133. 

Crous PW, Groenewald JZ, Shivas RG, Edwards J, Seifert KA, et al. (2011a). Fungal 

Planet Description Sheets: 69–91. Persoonia 26: 108–156. 

Crous PW, Kang JC, Braun U (2001). A phylogenetic redefinition of anamorph 

genera in Mycosphaerella based on ITS rDNA sequence and morphology. 

Mycologia 93: 1081–1101. 

Crous PW, Liebenberg MM, Braun U, Groenewald JZ (2006). Re-evaluating the 

taxonomic status of Phaeoisariopsis griseola, the causal agent of angular leaf 

spot of bean. Studies in Mycology 55: 163–173. 

Crous PW, Schoch CL, Hyde KD, Wood AR, Gueidan C, et al. (2009b). Phylogenetic 


Crous PW, Summerell BA, Carnegie AJ, Mohammed C, Himaman W, Groenewald 

JZ (2007c). Foliicolous Mycosphaerella spp. and their anamorphs on Corymbia 

and Eucalyptus. Fungal Diversity 26: 143–185. 

Crous PW, Summerell BA, Carnegie AJ, Wingfield MJ, Hunter GC, et al. (2009c). 

Unravelling Mycosphaerella: do you believe in genera? Persoonia 23: 99– 

118. 

Crous PW, Tanaka K, Summerell BA, Groenewald JZ. (2011b). Additions to the 

Mycosphaerella complex. IMA Fungus 2: 49–64. 

Crous PW, Verkley GJM, Groenewald JZ, Samson RA (eds) (2009d). Fungal 

Biodiversity. CBS Laboratory Manual Series 1: 1–269. Centraalbureau voor 

Schimmelcultures, Utrecht, Netherlands. 

Crous PW, Wingfield MJ (1997). New species of Mycosphaerella occurring on 

Eucalyptus leaves in Indonesia and Africa. Canadian Journal of Botany 75: 

781–790. 

Crous PW, Wingfield MJ, Marasas WFO, Sutton BC (1989). Pseudocercospora 

eucalyptorum sp. nov. on Eucalyptus leaves. Mycological Research 93: 394– 

398. 

Crous PW, Wingfield MJ, Park RF (1991). Mycosphaerella nubilosa, a synonym of 

M. molleriana. Mycological Research 95: 628–632. 

Crous PW, Wingfield MJ, Swart WJ (1990). Shoot and needle diseases of pines in 

South Africa. South African Forestry Journal 154: 60–66. 

David JC (1997). A contribution to the systematics of Cladosporium. Revision of the 

fungi previously referred to Heterosporium. Mycological Papers 172: 1–157. 

Decock C, Delgado-Rodríguez G, Buchet S, Seng JM (2003). A new species and 

three new combinations in Cyphellophora, with a note on the taxonomic affinities 

of the genus, and its relation to Kumbhamaya and Pseudomicrodochium. 

Antonie van Leeuwenhoek 84: 209–216. 

Deighton FC (1971). Studies on Cercospora and allied genera. III. Centrospora. 

Mycological Papers 124: 1–13. 

Deighton FC (1972). Mycocentrospora, a new name for Centrospora Neerg. Taxon 

21: 716–716. 

Deighton FC (1976). Studies on Cercospora and allied genera. VI. Pseudocercospora 

Speg., Pantospora Cif. and Cercoseptoria Petr. Mycological Papers 140: 

1–168. 

Deighton FC (1979). Studies on Cercospora and allied genera. VII. New species 

and redispositions. Mycological Papers 144: 1–56. 

Deighton FC (1983). Studies on Cercospora and allied genera. VIII. Further notes 

on Cercoseptoria and some new species and redispositions. Mycological 

Papers 151: 1–13. 

Deighton FC (1987). New species of Pseudocercospora and Mycovellosiella, and 

new combinations into Pseudocercospora and Phaeoramularia. Transactions 

of the British Mycological Society 88: 365–391. 

Den Breeÿen A, Groenewald JZ, Verkley GJM, Crous PW (2006). Morphological and 

molecular characterisation of Mycosphaerellaceae associated with the invasive 

weed, Chromolaena odorata. Fungal Diversity 23: 89–110. 

Drummond AJ, Ashton B, Buxton S, Cheung M, Cooper A, Heled J, Kearse M, Moir 

R, Stones-Havas S, Sturrock S, Thierer T, Wilson A (2011). Geneious v5.5. 

Available from http://www.geneious.com. 

Ellis MB (1971). Dematiaceous Hyphomycetes. Commonwealth Mycological 

Institute, Kew, Surrey, UK. 

Evans HC (1984). The genus Mycosphaerella and its anamorphs Cercoseptoria, 

Dothistroma and Lecanosticta on pines. Mycological Papers 153: 1–102. 

Frank J, Crous PW, Groenewald JZ, Oertel B, Hyde KD, et al. (2010). Microcyclospora 

and Microcyclosporella: novel genera accommodating epiphytic fungi causing 

sooty blotch on apple. Persoonia 24: 93–105. 

Groenewald M, Groenewald JZ, Braun U, Crous PW (2006). Host range of 

Cercospora apii and C. beticola, and description of C. apiicola, a novel species 

from celery. Mycologia 98: 275–285. 

Groenewald M, Groenewald JZ, Linde CC, Crous PW (2007). Development of 

polymorphic microsatellite and single nucleotide polymorphism markers for 

Cercospora beticola (Mycosphaerellaceae). Molecular Ecology Notes 7: 890– 

892. 

Guo Y-L, Hsieh W-H (1995). The genus Pseudocercospora in China. International 

Academic Publishers, Beijing, China. 

Guo YL, Liu XJ (1989). Studies on the genus Pseudocercospora in China I. 

Mycosystema 2: 225–240. 

Hawksworth DL, Crous PW, Redhead SA, Reynolds DR, Samson RA, et al. 

(2011). The Amsterdam Declaration on Fungal Nomenclature. IMA Fungus 

2: 105–112. 

Hillis DM, Bull JJ (1993). An empirical test of bootstrapping as a method for assessing 

confidence in phylogenetic analysis. Systematic Biology 42: 182–192. 

Hoog GS de, Hijwegen T, Batenburg van der Vegte WH (1991). A new species of 

Dissoconium. Mycological Research 95: 679–682. 

Hsieh WH, Goh TK (1990). Cercospora and similar fungi from Taiwan. Maw Chang 

Book. Co., Taipei. 


113

Crous et al. 

Hunter GC, Crous PW, Carnegie AJ, Burgess TI, Wingfield MJ (2011). 

Mycosphaerella and Teratosphaeria diseases of Eucalyptus; easily confused 

and with serious consequences. Fungal Diversity 50: 145–166. 

Hunter GC, Crous PW, Carnegie AJ, Wingfield, MJ (2009). Teratosphaeria nubilosa, 

a serious leaf disease pathogen of Eucalyptus spp. in native and introduced 

areas. Molecular Plant Pathology 10: 1–14. 

Hunter GC, Crous PW, Wingfield BD, Pongpanich K, Wingfield MJ (2006a). 

Pseudocercospora flavomarginata sp. nov., from Eucalyptus leaves in 

Thailand. Fungal Diversity 22: 71–90. 

Hunter GC, Wingfield BD, Crous PW, Wingfield MJ (2006b). A multi-gene phylogeny 

for species of Mycosphaerella occurring on Eucalyptus leaves. Studies in 

Mycology 55: 147–161. 

Kaiser W, Crous PW (1998). Mycosphaerella lupini sp. nov., a serious leaf spot 

disease of perennial lupin in Southcentral Idaho, USA. Mycologia 90: 726–731. 

Katoh K, Kuma K, Toh H, Miyata T (2005). MAFFT version 5: improvement in 

accuracy of multiple sequence alignment. Nucleic Acids Research 33: 511–518. 

Katoh K, Toh H (2007). PartTree: an algorithm to build an approximate tree from a 

large number of aligned sequences. Bioinformatics 23: 372–372. 

Koike SK, Baameur A, Groenewald JZ, Crous PW (2011). Cercosporoid leaf 

pathogens from whorled milkweed and spineless safflower in California. IMA 

Fungus 2: 7–12. 

Lee HB, Yu SH, Kim C-J (2001). First report of leaf spot of Paederia scandens 

caused by Pseudocercospora paederiae in Korea. New Disease Reports 4: 7. 

Maddison DR, Maddison WP (2000). MacClade 4. Analysis of phylogeny and 

character evolution. Sinauer Associates, Inc. 

Minnis AM, Kennedy AH, Grenier DB, Rehner SA, Bischoff JF (2011). Asperisporium 

and Pantospora (Mycosphaerellaceae): epitypifications and phylogenetic 

placement. Persoonia 27: 1–8. 

Moncalvo J-M, Rehner SA, Vilgalys R (1993). Systematics of Lyophyllum section 

Difformia based on evidence from culture studies and ribosomal DNA 

sequences. Mycologia 85: 788–794. 

Nylander JAA (2004). MrModeltest v2.2. Program distributed by the author. 

Evolutionary Biology Centre, Uppsala University. 

O’Donnell K, Kistler HC, Cigelnik E, Ploetz RC (1998). Multiple evolutionary origins 

of the fungus causing Panama disease of banana: concordant evidence from 

nuclear and mitochondrial gene genealogies. Proceedings of the National 

Academy of Sciences of the United States of America 95: 2044–2049. 

Pons N, Sutton BC (1988). Cercospora and similar fungi on Yams (Dioscorea 

species). Mycological Papers 160: 1–78. 

Pretorius MC, Crous PW, Groenewald JZ, Braun U (2003). Phylogeny of some 

cercosporoid fungi from Citrus. Sydowia 55: 286–305. 

Quaedvlieg W, Kema GHJ, Groenewald JZ, Verkley GJM, Seifbarghi S, Razavi M, 

Mirzadi Gohari A, Mehrabi R, Crous PW (2011). Zymoseptoria gen. nov.: a 

new genus to accommodate Septoria-like species occurring on graminicolous 

hosts. Persoonia 26: 57–69. 

Rambaut A (2002). Sequence Alignment Editor. Version 2.0. Department of Zoology, 

University of Oxford, Oxford. 

Rayner RW (1970). A mycological colour chart. CMI and British Mycological Society, 

Kew, Surrey, England. 

Rehner SA, Samuels GJ (1994). Taxonomy and phylogeny of Gliocladium analysed 

from nuclear large subunit ribosomal DNA sequences. Mycological Research 

98: 625–634. 

Ronquist F, Huelsenbeck JP (2003). MrBayes 3: Bayesian phylogenetic inference 

under mixed models. Bioinformatics 19: 1572–1574. 

Ruibal C, Millanes AM, Hawksworth DL (2011). Molecular phylogenetic studies on 

the lichenicolous Xanthoriicola physciae reveal Antarctic rock-inhabiting fungi 

and Piedraia species among closest relatives in the Teratosphaeriaceae. IMA 

Fungus 2: 97–103. 

Sawada K (1928). Descriptive catalogue of the Formosan fungi IV. Report of the 

Department of Agriculture, Government Research Institute of Formosa 35: 

1–162. 

Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, Chen W, 

et al. (2012). Nuclear ribosomal internal transcribed spacer (ITS) region as a 

universal DNA barcode marker for Fungi. Proceedings of the National Academy 

of Sciences of the United States of America 109: 6241–6246. 

Schubert K, Groenewald JZ, Braun U, Dijksterhuis J, Starink M, Hill CF, Zalar P, 

de Hoog GS, Crous PW (2007). Biodiversity in the Cladosporium herbarum 

complex (Davidiellaceae, Capnodiales), with standardisation of methods 

for Cladosporium taxonomy and diagnostics. Studies in Mycology 58: 

105–156. 

Seifert KA, Hughes SJ, Boulay H, Louis-Seize G (2007). Taxonomy, nomenclature 

and phylogeny of three cladosporium-like hyphomycetes, Sorocybe resinae, 

Seifertia azaleae and the Hormoconis anamorph of Amorphotheca resinae. 


Seifert KA, Morgan-Jones G, Gams W, Kendrick B (2011). The Genera of 

Hyphomycetes. CBS Biodiversity Series 9: 1–997. Centraalbureau voor 


Selbmann L, Hoog GS de, Zucconi L, Isola D, Ruisi S, et al. (2008). Drought meets 

acid: three new genera in a dothidealean clade of extremotolerant fungi. 


Shin HD, Braun U (1996). Notes on Korean Cercosporae and allied genera (II). 

Mycotaxon 58: 157–166. 

Shin HD, Braun U (2000). Notes on Korean Cercosporae and allied genera (III). 

Mycotaxon 74: 105–118. 

Shin HD, Kim JD (2001). Cercospora and allied genera from Korea. Plant Pathogens 

of Korea 7: 1–302. National Institute of Agricultural Science and Technology. 

Suwon, Korea. 

Singh PN, Singh SK, Tripathi SC (1996). New species of Pseudocercospora causing 

leaf spots of forest plants in Nepal. Mycological Research 100: 1129–1132. 

Spegazzini C (1910). Mycetes Argentinenses (Series V). Anales del Museo Nacional 

de Historia Natural, Buenos Aires 20: 329–467. 

Stewart EL, Liu Z, Crous PW, Szabo L (1999). Phylogenetic relationships among 

some cercosporoid anamorphs of Mycosphaerella based on rDNA sequence 

analysis. Mycological Research 103: 1491–1499. 

Suto Y (1999). Mycosphaerella chaenomelis sp. nov.: the teleomorph of 

Cercosporella sp., the causal fungus of frosty mildew in Chaenomeles sinensis, 

and its role as the primary infection source. Mycoscience 40: 509–516. 

Sutton BC (1980). The Coelomycetes. Fungi imperfecti with pycnidia, acervuli and 

stromata. Commonwealth Mycological Institute, Kew, Surrey, UK. 

Swofford DL (2003). PAUP*. Phylogenetic Analysis Using Parsimony (*and Other 

Methods). Version 4. Sinauer Associates, Sunderland, Massachusetts. 

Tamura K, Dudley J, Nei M, Kumar S (2007). MEGA 4: Molecular Evolutionary 

Genetics Analysis (MEGA) software version 4.0. Molecular Biology and 

Evolution 24: 1596–1599. 

Taylor JE, Crous PW (2000). Fungi occurring on Proteaceae. New anamorphs for 

Teratosphaeria, Mycosphaerella and Lembosia, and other fungi associated 

with leaf spots and cankers of Proteaceous hosts. Mycological Research 104: 

618–636. 

Togashi K, Katsuki S (1952). New or noteworthy Cercosporae from Japan. Botanical 

Magazine Tokyo 65: 18–26. 

Verkley GJM, Crous PW, Groenewald JZ, Braun U, Aptroot A (2004). Mycosphaerella 

punctiformis revisited: morphology, phylogeny, and epitypification of the type 

species of the genus Mycosphaerella (Dothideales, Ascomycota). Mycological 

Research 108: 1271–1282. 

Verkley GJM, Priest MJ (2000). Septoria and similar coelomycetous anamorphs of 

Mycosphaerella. Studies in Mycology 45: 123–128. 

Viégas AP (1945). Alguns fungos do Brasil – Cercosporae. Boletim de Sociedade 

Brasileira de Agronomia 8: 1–160. 




Vries GA de (1962). Cyphellophora laciniata nov. gen., nov. sp. and Dactylium 

fusarioides Fragoso et Ciferri. Mycopathologia et Mycologia Applicata 16: 

47–54. 

Vries GA de, Elders MC, Luykx MH (1986). Description of Cyphellophora pluriseptata 

sp. nov. Antonie van Leeuwenhoek 52: 141–143. 


fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols: a guide to 

methods and applications (Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds). 

Academic Press, San Diego, California: 315–322. 

Wingfield MJ, De Beer ZW, Slippers B, Wingfield BD, Groenewald JZ, Lombard 

L, Crous PW (2012). One fungus, one name promotes progressive plant 

pathology. Molecular Plant Pathology DOI: 10.1111/J.1364-3703.2011.00768.X 

Yen JM (1966). Etude sur les champignons parasites du Sud-Est asiatique IV. 

Troisieme note sur quelques nouvelles especes de Cercospora de Singapour. 

Revue Mycologique 31: 109–149. 

Yen JM, Lim G (1980). Cercospora and allied genera of Singapore and the Malay 

Peninsula. Garden’s Bulletin Singapore 33: 151–263. 

Zhang Y, Schoch CL, Fournier J, Crous PW, Gruyter J de, et al. (2009). Multi-locus 

phylogeny of Pleosporales: a taxonomic, ecological and evolutionary reevaluation. 


114



Species concepts in Cercospora: spotting the weeds among the roses 

J.Z. Groenewald 1* , C. Nakashima 2 , J. Nishikawa 3 , H.-D. Shin 4 , J.-H. Park 4 , A.N. Jama 5 , M. Groenewald 1 , U. Braun 6 1, 7, 8 

, and P.W. Crous 

1 

CBS-KNAW Fungal Biodiversity Centre, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands; 2 Graduate School of Bioresources, Mie University, 1577 Kurima-machiya, Tsu, 

Mie 514–8507, Japan; 3 Kakegawa Research Center, Sakata Seed Co., 1743-2 Yoshioka, Kakegawa, Shizuoka 436-0115, Japan; 4 Division of Environmental Science and 

Ecological Engineering, College of Life Sciences and Biotechnology, Korea University, Seoul 136-701, Korea; 5 Department of Agriculture, P.O. Box 326, University of Reading, 

Reading RG6 6AT, UK; 6 Martin-Luther-Universität, Institut für Biologie, Bereich Geobotanik und Botanischer Garten, Herbarium, Neuwerk 21, 06099 Halle (Saale), Germany; 

7 

Microbiology, Department of Biology, Utrecht University, Padualaan 8, 3584 CH Utrecht, the Netherlands; 8 Wageningen University and Research Centre (WUR), Laboratory of 

Phytopathology, Droevendaalsesteeg 1, 6708 PB Wageningen, The Netherlands 

*Correspondence: Johannes Z. Groenewald, e.groenewald@cbs.knaw.nl 

Abstract: The genus Cercospora contains numerous important plant pathogenic fungi from a diverse range of hosts. Most species of Cercospora are known only from their 

morphological characters in vivo. Although the genus contains more than 5 000 names, very few cultures and associated DNA sequence data are available. In this study, 360 

Cercospora isolates, obtained from 161 host species, 49 host families and 39 countries, were used to compile a molecular phylogeny. Partial sequences were derived from 

the internal transcribed spacer regions and intervening 5.8S nrRNA, actin, calmodulin, histone H3 and translation elongation factor 1-alpha genes. The resulting phylogenetic 

clades were evaluated for application of existing species names and five novel species are introduced. Eleven species are epi-, lecto- or neotypified in this study. Although 

existing species names were available for several clades, it was not always possible to apply North American or European names to African or Asian strains and vice versa. 

Some species were found to be limited to a specific host genus, whereas others were isolated from a wide host range. No single locus was found to be the ideal DNA barcode 

gene for the genus, and species identification needs to be based on a combination of gene loci and morphological characters. Additional primers were developed to supplement 

those previously published for amplification of the loci used in this study. 

Key words: Cercospora apii complex, co-evolution, host jumping, host specificity, speciation. 

Taxonomic novelties: New species - Cercospora coniogrammes Crous & R.G. Shivas, Cercospora delaireae C. Nakash., Crous, U. Braun & H.D. Shin, Cercospora 

euphorbiae-sieboldianae C. Nakash., Crous, U. Braun & H.D. Shin, Cercospora pileicola C. Nakash., Crous, U. Braun & H.D. Shin, Cercospora vignigena C. Nakash., Crous, 

U. Braun & H.D. Shin. Typifications: epitypifications - Cercospora alchemillicola U. Braun & C.F. Hill, Cercospora althaeina Sacc., Cercospora armoraciae Sacc., Cercospora 

corchori Sawada, Cercospora mercurialis Pass., Cercospora olivascens Sacc., Cercospora violae Sacc.; neotypifications - Cercospora fagopyri N. Nakata & S. Takim., 

Cercospora sojina Hara. 

Published online: 26 September 2012; doi:10.3114/sim0012. Hard copy: June 2013. 


INTRODUCTION 

Species of the genus Cercospora belong to one of the largest genera 

of hyphomycetes and were often linked to the teleomorph genus 

Mycosphaerella (Capnodiales, Mycosphaerellaceae; Stewart et al. 

1999, Crous et al. 2000). The genus Mycosphaerella was shown 

to be polyphyletic (Crous et al. 2007), and subsequently split into 

numerous genera, correlating with its different anamorph states 

(Crous et al. 2009a, b). The genus Cercospora is now considered 

a holomorphic genus in its own right, with some species exhibiting 

the ability to form mycosphaerella-like teleomorphs (Corlett 1991, 

Crous et al. 2004b). Mycosphaerella s. str. on the other hand, is 

restricted to taxa that form Ramularia anamorphs (Verkley et al. 

2004). As Mycosphaerella has been widely applied to more than 40 

different genera, Crous et al. (2009b) expressed their preference 

to use the older, recently monographed (Braun 1998) anamorphtypified 

name Ramularia (1833) for this holomorphic clade, instead 

of the younger, confused teleomorph-typified generic name 

Mycosphaerella (1884). This is allowed under the new, changed 

Article 59 of the International Code for Nomenclature of algae, 

fungi, and plants (ICN) (Hawksworth 2011, Norvell 2011). 

Species of Cercospora are commonly associated with leaf spots 

(Fig. 1), and have also been isolated from necrotic lesions of flowers, 


fruits and seeds or were associated with postharvest fruit rot disease 

(Silva & Pereira 2008) of hosts from across the world (Agrios 2005, 

To-Anun et al. 2011). The cercosporoid fungi have also been used as 

biocontrol agents (Morris & Crous 1994, Inglis et al. 2001, Tessman 

et al. 2001). Species of Cercospora were traditionally named after the 

host from which they were isolated, even to the extent that a species 

of Cercospora was described as new when found on a different 

host plant (Chupp 1954, Ellis 1971). The genus Cercospora was 

first erected by Fresenius for passalora-like fungi with pluriseptate 

conidia (in Fuckel 1863). Chupp’s (1954) monograph accepted 1 419 

Cercospora species and proposed a broad concept for this genus 

based on whether hila were thickened or not, and whether conidia 

were pigmented, single or in chains. The number of Cercospora 

species doubled to more than 3 000 when Pollack (1987) published 

her annotated list of Cercospora names. Since then a combination of 

characters such as conidiomatal structure, mycelium, conidiophores, 

conidiogenous cells and conidia has been used to divide the genus 

into morphologically similar units. Crous & Braun (2003) used the 

structure of conidiogenous loci and hila as well as the absence or 

presence of pigmentation in conidiophores and conidia in their 

revision of names published in Cercospora and Passalora. They 

recognised 659 names in the genus Cercospora, with a further 281 

names referred to as C. apii s. lat. The C. apii complex represented 


Attribution: 






115

Groenewald et al. 

Fig. 1. Foliar disease symptoms associated with Cercospora spp. A. C. achyranthis on Achyranthes japonica. B. C. dispori on Disporum viridescens. C. C. chinensis on 

Polygonatum humile. D. C. cf. flagellaris on Amaranthus patulus. E. C. capsici on Capsicum annuum. F. Cercospora sp. on Ajuga multiflora. G. Cercospora sp. on Cardamine 

leucanthe. H. C. cf. flagellaris on Celosia argentea var. cristata. I. C. zeina on Zea mays. J. C. beticola on Beta vulgaris. K. C. chrysanthemi on Chrysanthemum. L. C. apii on 

Apium. M. C. amoraciae on Rorippa indica. N. C. beticola on Chrysanthemum segetum. O. C. apiicola on Apium. P. C. ipomoeae on Persicaria thunbergii. Q. C. althaeina on 

Althaea rosea. R. C. zebrina on Trifolium repens. S. C. sojina on Glycine max. T. C. brunkii on Geranium nepalense. 

116

Species concepts in Cercospora 

Cercospora species that were morphologically indistinguishable 

from C. apii (Ellis 1971, Crous & Braun 2003). In addition, Crous & 

Braun (2003) introduced the concept of “compound species” which 

consisted of morphologically indistinguishable species with different 

races (host range), genetically uniform or heterogeneous, with 

different degrees of biological specialisation. They also proposed that 

genetically and morphologically clearly distinguishable taxa should 

be treated as separate species, although the study was confounded 

by the general unavailability of Cercospora cultures for DNA 

analyses. Ex-type strains mostly do not exist as such isolates were 

neither designated nor preserved, for the majority of Cercospora 

species (Groenewald et al. 2010a). For most Cercospora species, a 

sexual stage (a mycosphaerella-like state) is not known; or has been 

reported, but not confirmed (Goodwin et al. 2001). The mating type 

genes of some apparently asexual Cercospora species were recently 

characterised, with the discovery that C. beticola, C. zeae-maydis 

and C. zeina were heterothallic, although only one mating type was 

present in populations of C. apii and C. apiicola (Groenewald et al. 

2006b, 2010b). The two mating types of C. beticola were distributed 

approximately equally in the tested populations, indicating that these 

genes might indeed be active, indicative of cryptic sex. More recently 

a skewed distribution of mating types across sugar beet fields from 

different localities was report from Iran, with some fields having both 

mating types and others only the one or the other (Bakhshi et al. 

2011). A further study conducted over a 3-yr period in the USA, 

also led to the conclusion that C. beticola has potential for sexual 

reproduction (Bolton et al. 2012). 

Host specificity and speciation in Cercospora has not been 

studied extensively, but it is known that some species induce leaf 

spot symptoms when inoculated on other hosts, for example, C. 

beticola on all members of Beta (Chenopodiaceae) and other plant 

species (Weiland & Koch 2004) or C. apii and C. beticola isolated 

from disease symptoms on other hosts (Groenewald et al. 2006a). 

Cercospora caricis is used as a biological control agent of Cyperus 

rotundus (Cyperaceae), and Inglis et al. (2001) compared Brazilian 

isolates with an isolate from Florida, USA. The authors used RAPDs 

(Randomly Amplified Polymorphic DNA), RFLPs (Restriction 

Fragment Length Polymorphisms) with a telomeric probe and ITS 

sequencing and found that a cluster of isolates from the Brazilian 

cerrado region showed high genetic similarity, whereas similarity 

between this region and others in Brazil was less that 50 %. They 

also found that the ITS sequence analysis did not support a division 

in the Brazilian isolates (99 % similar sequences) but that it did 

separate the Florida isolate from the Brazilian isolates (96 % similar 

when included with the Brazilian isolates). They concluded that the 

isolate from Florida probably represented cryptic speciation but that 

larger sampling of isolates was required from different geographical 

areas to address this question. Host specificity for some species 

appears to operate at the strain level, as for C. rodmanii, in which 

the original strains of Conway (1976) were shown to be specific to 

water hyacinth, whereas strains identified by morphology and multilocus 

sequence data as the same species, were able to infect beet 

and sugar beet (Montenegro-Calderón et al. 2011). 

A number of molecular studies using ITS phylogenies confirmed 

that Cercospora taxa cluster in a well-supported monophyletic 

clade in Mycosphaerella (Stewart et al. 1999, Crous et al. 2000, 

2009a, b, Goodwin et al. 2001, Pretorius et al. 2003), in contrast 

to other polyphyletic genera such as Septoria (Verkley et al. 2004; 

compared to the monophyletic Zymoseptoria, Quaedvlieg et al. 

2011), Pseudocercospora, Passalora and Zasmidium (Crous et al. 

2009b), to name but a few. The ITS region (ITS1, 5.8S rDNA and 

ITS2) lacks the resolution to distinguish between most Cercospora 

species (Groenewald et al. 2010a). For example, Goodwin et al. 

(2001) found a mean of 1.27 sequence changes over 18 taxa 

from 11 Cercospora species, and Pretorius et al. (2003) found a 

mean of 1.64 changes when they tested 25 taxa representing 11 

Cercospora species. Both Goodwin et al. (2001) and Pretorius 

et al. (2003) observed more transitions than transversions. Only 

a limited number of studies utilising gene sequences other than 

ITS have been published thus far (for example Tessmann et al. 

2001, Crous et al. 2004b, Groenewald et al. 2005, 2006a, 2010a, 

Montenegro-Calderón et al. 2011). Tessmann et al. (2001) found 

that 14 of the 431 aligned translation elongation factor 1-alpha 

characters were parsimony-informative, with only six of the 380 

characters for beta-tubulin and 17 of the 309 histone H3 characters 

being parsimony-informative. The ITS region did not contain any 

differences when compared with the outgroup C. beticola. Crous 

et al. (2004b) used fixed nucleotide changes in aligned nucleotide 

characters (including alignment gaps) to discriminate C. acaciaemangii 

from C. apii and C. beticola, and listed changes at none of 

521 ITS characters (0 %), nine of 300 translation elongation factor 

1-alpha characters (3 %), three of 209 actin characters (1.4 %), 10 

of 312 calmodulin characters (3.2 %), and seven of 388 histone 

H3 characters (1.8 %). A total of 1 730 aligned characters were 

examined, of which 29 (1.68 %) were observed as fixed nucleotide 

changes. Using the same five loci, Groenewald et al. (2005) found 

96 % similarity between C. apii and C. beticola for the calmodulin 

gene, with all other loci having identical sequences. Based on 

the differences in the calmodulin gene, distinctive AFLP banding 

patterns and different growth rates, the authors recognised C. apii 

s. str. and C. beticola s. str. as distinct species. Continuing with 

the same approach, Groenewald et al. (2006a) then proceeded to 

describe C. apiicola, a further distinct species thus far only isolated 

from Apium (Apiaceae). Both Groenewald et al. (2010a) and 

Montenegro-Calderón et al. (2011) used phylogenetic analyses 

of combined ITS, translation elongation factor 1-alpha, actin, 

calmodulin and histone H3 sequence alignments to study species 

boundaries and diversity in Cercospora. Groenewald et al. (2010a) 

concluded that although most loci tested could resolve a large 

number of species, the sum of the whole provided a better resolution 

compared to a subset of loci. In that study, the loci differed in their 

ability to resolve clades, with ITS and translation elongation factor 

1-alpha performing worst (distinguishing three and 10 clades, 

respectively), while actin could distinguish 14 clades, calmodulin 

13 clades and histone H3 12 clades compared to the 16 species 

clades recognised in the combined tree. Montenegro-Calderón et 

al. (2011) concluded that C. rodmanii could be distinguished from 

C. piaropi based on actin, calmodulin and histone H3, but that 

only calmodulin could clearly separate C. rodmanii from the other 

Cercospora species included in their study. These results illustrated 

that the phylogenetic approach using multi-locus sequences was 

one of the most effective ways to recognise different species of 

Cercospora. Although this approach is not suitable to recognise the 

true host range of a species without pathogenicity tests, it does 

provide a handle on the true identity of the strain being used. 

Goodwin et al. (2001) attributed the short branch lengths 

observed for their ITS phylogeny to a relatively recent common 

ancestor that was able to, or acquired the ability to, produce 

cercosporin, a phytotoxic metabolite of polyketide origin (Daub 

& Ehrenshaft 2000). The ability to produce cercosporin probably 

allowed the Cercospora ancestor to rapidly expand its host range 

in a recent adaptive radiation (Goodwin et al. 2001). It has been 

suggested that this compound may enhance virulence (Upchurch 

et al. 1991), but it is not a universal pathogenicity factor as 


117


Table 1. Collection details and GenBank accession numbers of isolates included in this study. 

Species Culture accession number(s) 1 Host name or isolation source Host Family Country Collector GenBank accession numbers 2 

ITS TEF ACT CAL HIS 

Cercospora achyranthis CBS 132613; CPC 10879 Achyranthes japonica Amaranthaceae South Korea: Jeju H.D. Shin JX143523 JX143277 JX143031 JX142785 JX142539 

CPC 10091 Achyranthes japonica Amaranthaceae South Korea: Jeju H.D. Shin JX143524 JX143278 JX143032 JX142786 JX142540 

Cercospora agavicola CBS 117292; CPC 11774 (TYPE) Agave tequilana var. azul Agavaceae Mexico: Penjamo V. Ayala-Escobar & Ma. de AY647237 AY966897 AY966898 AY966899 AY966900 

Jesús Yáñez-Morales 

Cercospora alchemillicola CPC 5259 (TYPE) Alchemilla mollis Rosaceae New Zealand: Auckland C.F. Hill JX143525 JX143279 JX143033 JX142787 JX142541 

Cercospora cf. alchemillicola CPC 5126 Oenothera fruticosa Onagraceae New Zealand: Auckland C.F. Hill JX143526 JX143280 JX143034 JX142788 JX142542 

CPC 5127 Gaura lindheimeri Onagraceae New Zealand: Auckland C.F. Hill JX143527 JX143281 JX143035 JX142789 JX142543 

Cercospora althaeina CBS 126.26; CPC 5066 Malva sp. Malvaceae — C. Killian JX143528 JX143282 JX143036 JX142790 JX142544 

CBS 132609; CPC 10790 Althaea rosea Malvaceae South Korea: Suwon H.D. Shin JX143529 JX143283 JX143037 JX142791 JX142545 

CBS 248.67; CPC 5117 (TYPE) Althaea rosea Malvaceae Romania: Fundulea O. Constantinescu JX143530 JX143284 JX143038 JX142792 JX142546 

Cercospora apii CBS 110813; CPC 5110; 01-3 Moluccella laevis Lamiaceae USA: California S.T. Koike AY156918 DQ233345 DQ233371 DQ233397 DQ233423 

CBS 110816; CPC 5111; 01-4 Moluccella laevis Lamiaceae USA: California S.T. Koike AY156919 DQ233346 DQ233372 DQ233398 DQ233424 

CBS 114416; CPC 10925 Apium sp. Apiaceae Austria Institut fur Pflanzengesundheit AY840516 AY840483 AY840447 AY840414 AY840381 

CBS 114418; CPC 10924 Apium graveolens Apiaceae Italy M. Meutri AY840517 AY840484 AY840448 AY840415 AY840382 

CBS 114485; CPC 10923 Apium graveolens Apiaceae Italy M. Meutri AY840518 AY840485 AY840449 AY840416 AY840383 

CBS 116455; CPC 11556 (TYPE) Apium graveolens Apiaceae Germany: Heilbron K. Schrameyer AY840519 AY840486 AY840450 AY840417 AY840384 

CBS 116504; CPC 11579 Apium graveolens Apiaceae Germany: Heilbron K. Schrameyer AY840520 AY840487 AY840451 AY840418 AY840385 

CBS 116507; CPC 11582 Apium graveolens Apiaceae Germany: Heilbron K. Schrameyer AY840521 AY840488 AY840452 AY840419 AY840386 

CBS 119.25; B 42463; IHEM 3822; Apium graveolens Apiaceae — L. J. Klotz AY179949 AY179915 AY840443 AY840410 AY840377 

CPC 5086 

CBS 121.31; CPC 5073 Beta vulgaris Chenopodiaceae Austria: Wien E.W. Schmidt AY343371 AY343334 AY840444 AY840411 AY840378 

CBS 127.31; CPC 5119 Beta vulgaris Chenopodiaceae Hungary E.W. Schmidt AY840514 AY840481 AY840445 AY840412 AY840379 

CBS 132683; CPC 16663 Moluccella laevis Lamiaceae Zimbabwe S. Dimbi JX143531 JX143285 JX143039 JX142793 JX142547 

G. van den Ende AY840515 AY840482 AY840446 AY840413 AY840380 

CBS 152.52; IMI 077043; MUCL 

16495; CPC 5063 

Beta vulgaris Chenopodiaceae Netherlands: Bergen op 

Zoom 

CBS 252.67; CPC 5084 Plantago lanceolata Plantaginaceae Romania: Domnesti O. Constantinescu DQ233318 DQ233342 DQ233368 DQ233394 DQ233420 

CBS 536.71; CPC 5087 Apium graveolens Apiaceae Romania: Bucuresti O. Constantinescu AY752133 AY752166 AY752194 AY752225 AY752256 

CBS 553.71; IMI 161116; CPC 5083 Plumbago europaea Plumbaginaceae Romania: Hagieni O. Constantinescu DQ233320 DQ233344 DQ233370 DQ233396 DQ233422 

CPC 18601 Apium graveolens Apiaceae USA: California S.T. Koike JX143532 JX143286 JX143040 JX142794 JX142548 

CPC 5112 Moluccella laevis Lamiaceae New Zealand: Auckland C.F. Hill DQ233321 DQ233347 DQ233373 DQ233399 DQ233425 

CPC 5260 Glebionis coronaria 

Asteraceae New Zealand: Auckland C.F. Hill JX143533 JX143287 JX143041 JX142795 JX142549 

(≡ Chrysanthemum coronarium) 

MUCC 567; MUCNS 30; MAFF 238072 

Apium graveolens Apiaceae Japan: Aichi T. Kobayashi JX143534 JX143288 JX143042 JX142796 JX142550 

118




MUCC 573; MAFF 235978 Glebionis coronaria 

(≡ Chrysanthemum coronarium) 


Asteraceae Japan: Hokkaido — JX143535 JX143289 JX143043 JX142797 JX142551 

MUCC 593 Apium graveolens Apiaceae Japan: Shizuoka M. Togawa JX143536 JX143290 JX143044 JX142798 JX142552 

MUCC 923; MAFF 238299 Asparagus officinalis Asparagaceae Japan: Saga J. Yamaguchi JX143537 JX143291 JX143045 JX142799 JX142553 

Cercospora apiicola CBS 116457; CPC 10267 (TYPE) Apium sp. Apiaceae Venezuela: Caripe N. Pons AY840536 AY840503 AY840467 AY840434 AY840401 

CBS 116458; CPC 10657 Apium graveolens Apiaceae South Korea: Kangnung H.D. Shin AY840537 AY840504 AY840468 AY840435 AY840402 

CBS 132644; CPC 10248 Apium sp. Apiaceae Venezuela: Caripe N. Pons AY840539 AY840506 AY840470 AY840437 AY840404 

CBS 132651; CPC 10759 Apium graveolens Apiaceae South Korea: Namyangju H.D. Shin AY840544 AY840511 AY840475 AY840442 AY840409 

CBS 132666; CPC 11642; GRE-4-2 Apium sp. Apiaceae Greece I. Vloutoglou DQ233341 DQ233367 DQ233393 DQ233419 DQ233441 

CPC 10220 Apium sp. Apiaceae Venezuela: Caripe N. Pons AY840538 AY840505 AY840469 AY840436 AY840403 




CPC 10666 Apium sp. Apiaceae South Korea: Kangnung H.D. Shin AY840543 AY840510 AY840474 AY840441 AY840408 

CPC 11641; GRE-3-2 Apium sp. Apiaceae Greece I. Vloutoglou DQ233340 DQ233366 DQ233392 DQ233418 DQ233440 

Cercospora armoraciae CBS 115060; CPC 5366 Gaura sp. Onagraceae New Zealand C.F. Hill JX143538 JX143292 JX143046 JX142800 JX142554 

CBS 115394; CPC 5261 Nasturtium officinale 

Brassicaceae New Zealand: Auckland C.F. Hill JX143539 JX143293 JX143047 JX142801 JX142555 

(= Rorippa nasturtium-aquaticum) 

CBS 115409; CPC 5359 Armoracia rusticana (= A. lapathifolia) Brassicaceae New Zealand: Manurewa C.F. Hill JX143540 JX143294 JX143048 JX142802 JX142556 

CBS 132610; CPC 10811 Armoracia rusticana (= A. lapathifolia) Brassicaceae South Korea: Suwon H.D. Shin JX143541 JX143295 JX143049 JX142803 JX142557 

CBS 132638; CPC 10100 Barbarea orthoceras Brassicaceae South Korea: Pocheon H.D. Shin JX143542 JX143296 JX143050 JX142804 JX142558 

CBS 132654; CPC 11338 Turritis glabra (≡ Arabis glabra) Brassicaceae South Korea: Hoengseong H.D. Shin JX143543 JX143297 JX143051 JX142805 JX142559 

CBS 132672; CPC 14612 Rorippa indica Brassicaceae South Korea: Jecheon H.D. Shin JX143544 JX143298 JX143052 JX142806 JX142560 

CBS 250.67; CPC 5088 (TYPE) Armoracia rusticana (= A. lapathifolia) Brassicaceae Romania: Fundulea O. Constantinescu JX143545 JX143299 JX143053 JX142807 JX142561 

CBS 258.67; CPC 5061 Cardaria draba Brassicaceae Romania: Fundulea O. Constantinescu JX143546 JX143300 JX143054 JX142808 JX142562 

CBS 538.71; IMI 161109; CPC 5090 Berteroa incana Brassicaceae Romania: Hagieni O. Constantinescu JX143547 JX143301 JX143055 JX142809 JX142563 

CBS 540.71; IMI 161110; CPC 5060 Cardaria draba Brassicaceae Romania: Hagieni O. Constantinescu JX143548 JX143302 JX143056 JX142810 JX142564 

CBS 545.71; CPC 5056 Erysimum cuspidatum Brassicaceae Romania: Valea Mraconiei O. Constantinescu JX143549 JX143303 JX143057 JX142811 JX142565 

CBS 555.71; IMI 161117; CPC 5082 Coronilla varia Fabaceae Romania: Hagieni O. Constantinescu JX143550 JX143304 JX143058 JX142812 JX142566 

CPC 10133 Rorippa indica Brassicaceae South Korea: Wonju H.D. Shin JX143551 JX143305 JX143059 JX142813 JX142567 

CPC 11364 Turritis glabra (≡ Arabis glabra) Brassicaceae South Korea: Hoengseong H.D. Shin JX143552 JX143306 JX143060 JX142814 JX142568 

CPC 11530 Acacia mangium Fabaceae Thailand W. Himaman JX143553 JX143307 JX143061 JX142815 JX142569 

MUCC 768 Armoracia rusticana (= A. lapathifolia) Brassicaceae Japan: Okinawa C. Nakashima JX143554 JX143308 JX143062 JX142816 JX142570 


119





Cercospora beticola CBS 113069; CPC 5369 Spinacia sp. Chenopodiaceae Botswana: Gaborone L. Lebogang DQ233325 DQ233351 DQ233377 DQ233403 DQ233429 

CBS 115478; CPC 5113 Limonium sinuatum Plumbaginaceae New Zealand: Auckland C.F. Hill DQ233326 DQ233352 DQ233378 DQ233404 DQ233430 

CBS 116.47; CPC 5074 Beta vulgaris Chenopodiaceae Netherlands: Northwest G.E. Bunschoten AY752135 AY752168 AY752196 AY752227 AY752258 

Brabant 

CBS 116454; CPC 11558 Beta vulgaris Chenopodiaceae Germany S. Mittler AY840526 AY840493 AY840457 AY840424 AY840391 

CBS 116456; CPC 11557 (TYPE) Beta vulgaris Chenopodiaceae Italy: Ravenna V. Rossi AY840527 AY840494 AY840458 AY840425 AY840392 

CBS 116501; CPC 11576 Beta vulgaris Chenopodiaceae Iran: Pakajik A.A. Ravanlou AY840528 AY840495 AY840459 AY840426 AY840393 

CBS 116502; CPC 11577 Beta vulgaris Chenopodiaceae Germany S. Mittler AY840529 AY840496 AY840460 AY840427 AY840394 

CBS 116503; CPC 11578 Beta vulgaris Chenopodiaceae Italy: Ravenna V. Rossi AY840530 AY840497 AY840461 AY840428 AY840395 

CBS 116505; CPC 11580 Beta vulgaris Chenopodiaceae France: Longvic S. Garressus AY840531 AY840498 AY840462 AY840429 AY840396 

CBS 116506; CPC 11581 Beta vulgaris Chenopodiaceae Netherlands M. Groenewald AY840532 AY840499 AY840463 AY840430 AY840397 

CBS 117.47 Beta vulgaris Chenopodiaceae Czech Republic G.E. Bunschoten DQ233322 DQ233348 DQ233374 DQ233400 DQ233426 

CBS 117556; CPC 10171 Beta vulgaris Chenopodiaceae New Zealand: Auckland C.F. Hill AY840534 AY840501 AY840465 AY840432 AY840399 

CBS 122.31; CPC 5072 Beta vulgaris Chenopodiaceae Germany: Gmain E.W. Schmidt AY752136 AY752169 AY752197 AY752228 AY752259 

CBS 123.31; CPC 5071 Beta vulgaris Chenopodiaceae Spain E.W. Schmidt AY840522 AY840489 AY840453 AY840420 AY840387 

CBS 123907; CPC 14616 Goniolimon tataricum Plumbaginaceae Bulgaria S.G. Bobev FJ473422 FJ473427 FJ473432 FJ473437 FJ473442 


CBS 124.31; CPC 5070 Beta vulgaris Chenopodiaceae Romania: Hagieni E.W. Schmidt AY840523 AY840490 AY840454 AY840421 AY840388 

CBS 125.31; CPC 5069 Beta vulgaris Chenopodiaceae — E.W. Schmidt AY840524 AY840491 AY840455 AY840422 AY840389 

CBS 126.31; CPC 5064 Beta vulgaris Chenopodiaceae Germany: Klein 

E.W. Schmidt AY840525 AY840492 AY840456 AY840423 AY840390 

Wanzleben 

CBS 132655; CPC 11341 Chrysanthemum segetum 

Asteraceae South Korea: Namyangju H.D. Shin DQ233332 DQ233358 DQ233384 DQ233410 DQ233434 

(= Ch. coronarium var. spatiosum) 


CBS 539.71; CPC 5062 Beta vulgaris Chenopodiaceae Romania: Bucuresti O. Constantinescu DQ233323 DQ233349 DQ233375 DQ233401 DQ233427 

CBS 548.71; IMI 161115; CPC 5065 Malva pusilla Malvaceae Romania: Hagieni O. Constantinescu & G. DQ233324 DQ233350 DQ233376 DQ233402 DQ233428 

Negrean 

CPC 10166 Beta vulgaris Chenopodiaceae New Zealand C.F. Hill DQ233329 DQ233355 DQ233381 DQ233407 DQ026471 

CPC 10168 Beta vulgaris Chenopodiaceae New Zealand: Auckland C.F. Hill AY840533 AY840500 AY840464 AY840431 AY840398 

CPC 10195 Beta vulgaris Chenopodiaceae New Zealand C.F. Hill DQ233330 DQ233356 DQ233382 DQ233408 DQ026472 


CPC 10204 Beta vulgaris Chenopodiaceae New Zealand: Auckland C.F. Hill DQ233331 DQ233357 DQ233383 DQ233409 DQ233433 

CPC 11344 Chrysanthemum segetum 

(= Ch. coronarium var. spatiosum) 

Asteraceae South Korea: Namyangju H.D. Shin DQ233333 DQ233359 DQ233385 DQ233411 DQ233435 

120





CPC 12022 Beta vulgaris Chenopodiaceae Germany S. Mittler DQ233334 DQ233360 DQ233386 DQ233412 DQ233436 


CPC 12028 Beta vulgaris Chenopodiaceae Egypt M. Hasem DQ233336 DQ233362 DQ233388 DQ233414 DQ233437 




CPC 14618 Goniolimon tataricum Plumbaginaceae Bulgaria S.G. Bobev FJ473424 FJ473429 FJ473434 FJ473439 FJ473444 

CPC 14619 Goniolimon tataricum Plumbaginaceae Bulgaria S.G. Bobev FJ473425 FJ473430 FJ473435 FJ473440 FJ473445 

CPC 15623 Beta vulgaris Chenopodiaceae Mexico: Texcoco Ma. de Jesús Yáñez-Morales JX143555 JX143309 JX143063 JX142817 JX142571 

CPC 18813 Beta vulgaris Chenopodiaceae USA: California S.T. Koike JX143556 JX143310 JX143064 JX142818 JX142572 

CPC 5123 Apium graveolens Apiaceae New Zealand: Auckland C.F. Hill AY752134 AY752167 AY752195 AY752226 AY752257 



CPC 5370 Spinacia sp. Chenopodiaceae Botswana: Gaborone L. Lebogang DQ233328 DQ233354 DQ233380 DQ233406 DQ233432 

MUCC 568; MUCNS 320; MAFF Beta vulgaris Chenopodiaceae Japan: Chiba S. Uematsu JX143557 JX143311 JX143065 JX142819 JX142573 

238206 

MUCC 569; MAFF 305036 Beta vulgaris Chenopodiaceae Japan: Hokkaido K. Goto JX143558 JX143312 JX143066 JX142820 JX142574 

Cercospora cf. brunkii CBS 132657; CPC 11598 Geranium thunbergii 

Geraniaceae South Korea: Namyangju H.D. Shin JX143559 JX143313 JX143067 JX142821 JX142575 

(≡ G. nepalense var. thunbergii) 

MUCC 732 Datura stramonium Solanaceae Japan: Wakayama C. Nakashima & I. Araki JX143560 JX143314 JX143068 JX142822 JX142576 

Cercospora campi-silii CBS 132625; CPC 14585 Impatiens noli-tangere Balsaminaceae South Korea: Inje H.D. Shin JX143561 JX143315 JX143069 JX142823 JX142577 

S. van Wyk AY260065 DQ835084 DQ835103 DQ835130 DQ835157 

Cercospora canescens 

complex 

CBS 111133; CPC 1137 Vigna sp. Fabaceae South Africa: 

Potchefstroom 

CBS 111134; CPC 1138 Vigna sp. Fabaceae South Africa: 

Potchefstroom 

S. van Wyk AY260066 DQ835085 DQ835104 DQ835131 DQ835158 

CBS 132658; CPC 11626; GHA-1-0 Dioscorea rotundata Dioscoreaceae Ghana S. Nyako & A.O. Danquah JX143562 JX143316 JX143070 JX142824 JX142578 

CBS 132659; CPC 11627; GHA-1-1 Dioscorea alata Dioscoreaceae Ghana S. Nyako & A.O. Danquah JX143563 JX143317 JX143071 JX142825 JX142579 

CBS 153.55; CPC 5059 Phaseolus lunatus (= Ph. limensis) Fabaceae USA: Georgia E.S. Luttrell JX143564 JX143318 JX143072 JX142826 JX142580 

CPC 11628; GHA-2-1 Dioscorea rotundata Dioscoreaceae Ghana S. Nyako & A.O. Danquah JX143565 JX143319 JX143073 JX142827 JX142581 

CPC 11640; IMI 186563 Apium sp. Apiaceae USA — JX143566 JX143320 JX143074 JX142828 JX142582 

CPC 15871 — Malvaceae Mexico: Tamaulipas Ma. de Jesús Yáñez-Morales JX143567 JX143321 JX143075 JX142829 JX142583 

CPC 4408; Q 160 IS2 Citrus maxima Rutaceae South Africa: Tsipise K. Serfontein AY260067 DQ835086 DQ835105 DQ835132 DQ835159 

CPC 4409 Citrus maxima Rutaceae South Africa: Tsipise K. Serfontein AY260068 DQ835087 DQ835106 DQ835133 DQ835160 

Cercospora capsici CBS 118712 Lesions on calyx attached to fruit — Fiji P. Tyler GU214653 JX143322 JX143076 JX142830 JX142584 


121





CBS 132622; CPC 14520 Capsicum annuum Solanaceae South Korea: Yanggu H.D. Shin JX143568 JX143323 JX143077 JX142831 JX142585 

CPC 12307 Capsicum annuum Solanaceae South Korea: Hongcheon H.D. Shin GU214654 JX143324 JX143078 JX142832 JX142586 

MUCC 574; MUCNS 810; MAFF Capsicum annuum Solanaceae Japan: Chiba S. Uematsu JX143569 JX143325 JX143079 JX142833 JX142587 

238227 

Cercospora celosiae CBS 132600; CPC 10660 Celosia argentea var. cristata Amaranthaceae South Korea: Chuncheon H.D. Shin JX143570 JX143326 JX143080 JX142834 JX142588 

(≡ C. cristata) 

Cercospora chenopodii CBS 132620; CPC 14237 Chenopodium cf. album Chenopodiaceae France: Ardeche P.W. Crous JX143571 JX143327 JX143081 JX142835 JX142589 

Cercospora cf. chenopodii CBS 132594; CPC 10304 (TYPE) Chenopodium ficifolium Chenopodiaceae South Korea: Hongcheon H.D. Shin JX143572 JX143328 JX143082 JX142836 JX142590 

CBS 132677; CPC 15599 Chenopodium sp. Chenopodiaceae Mexico: Montecillo Ma. de Jesús Yáñez-Morales JX143573 JX143329 JX143083 JX142837 JX142591 

CPC 12450 Chenopodium ficifolium Chenopodiaceae South Korea: Hongcheon H.D. Shin JX143574 JX143330 JX143084 JX142838 JX142592 

CPC 15763 Chenopodium sp. Chenopodiaceae Mexico: Montecillo Ma. de Jesús Yáñez-Morales JX143575 JX143331 JX143085 JX142839 JX142593 

CPC 15859 Chenopodium sp. Chenopodiaceae Mexico: Purificacion Ma. de Jesús Yáñez-Morales JX143576 JX143332 JX143086 JX142840 JX142594 

CPC 15862 Chenopodium sp. Chenopodiaceae Mexico: Purificacion Ma. de Jesús Yáñez-Morales JX143577 JX143333 JX143087 JX142841 JX142595 

Cercospora chinensis CBS 132612; CPC 10831 Polygonatum humile Convallariaceae South Korea: 

H.D. Shin JX143578 JX143334 JX143088 JX142842 JX142596 

Pyeongchang 

Cercospora cf. citrulina CBS 119395; CPC 12682 Musa sp. Musaceae Bangladesh: Western I. Buddenhagen EU514222 JX143335 JX143089 JX142843 JX142597 

CBS 132669; CPC 12683 Musa sp. Musaceae Bangladesh: Western I. Buddenhagen EU514223 JX143336 JX143090 JX142844 JX142598 

MUCC 576; MUCNS 300; MAFF Citrullus lanatus Cucurbitaceae Japan: Okinawa T. Kobayashion et al. JX143579 JX143337 JX143091 JX142845 JX142599 

237913 

MUCC 577; MUCNS 254; MAFF Momordica charanthia Cucurbitaceae Japan: Kagoshima E. Imaizumi & C. Nomi JX143580 JX143338 JX143092 JX142846 JX142600 

238205 

MUCC 584; MAFF 305757 Psophocarpus tetragonolobus Fabaceae Japan: Okinawa — JX143581 JX143339 JX143093 JX142847 JX142601 

MUCC 588; MAFF 239409 Ipomoea pes-caprae Convolvulaceae Japan: Okinawa — JX143582 JX143340 JX143094 JX142848 JX142602 

Cercospora coniogrammes CBS 132634; CPC 17017 (TYPE) Coniogramme japonica var. gracilis Adiantaceae Australia: Queensland P.W. Crous JX143583 JX143341 JX143095 JX142849 JX142603 

(≡ C. gracilis) 

Cercospora corchori MUCC 585; MUCNS 72; MAFF Corchorus olitorius Tiliaceae Japan: Shimane T. Mikami JX143584 JX143342 JX143096 JX142850 JX142604 

238191 (TYPE) 

Cercospora cf. coreopsidis CBS 132598; CPC 10648 Coreopsis lanceolata Asteraceae South Korea: Seoul H.D. Shin JX143585 JX143343 JX143097 JX142851 JX142605 

CPC 10122 Coreopsis lanceolata Asteraceae South Korea: Wonju H.D. Shin JX143586 JX143344 JX143098 JX142852 JX142606 

S. Neser JX143587 JX143345 JX143099 JX142853 JX142607 

Cercospora delaireae CBS 132595; CPC 10455; GV2 

PPRI number: C558 (TYPE) 

Delairea odorata 

(= Senecio mikanioides) 

CPC 10627 Delairea odorata 




Asteraceae South Africa: Long Tom 

Pass 

Asteraceae South Africa: Plettenberg 

Bay 


Bay 

C.L. Lennox JX143588 JX143346 JX143100 JX142854 JX142608 


122







Bay 

Cercospora dispori CBS 132608; CPC 10773 Disporum viridescens Convallariaceae South Korea: 

Pyeongchang 




Cercospora cf. erysimi CBS 115059; CPC 5361 Erysimum mutabile Brassicaceae New Zealand: Manurewa C.F. Hill JX143592 JX143350 JX143104 JX142858 JX142612 

Cercospora euphorbiaesieboldianae 

CBS 113306 (TYPE) Euphorbia sieboldiana Euphorbiaceae South Korea: Samcheok H.D. Shin JX143593 JX143351 JX143105 JX142859 JX142613 

Cercospora fagopyri CBS 132623; CPC 14541 (TYPE) Fagopyrum esculentum Polygonaceae South Korea: Yangpyeong H.D. Shin JX143594 JX143352 JX143106 JX142860 JX142614 

CBS 132640; CPC 10109 Fallopia dumentorum Polygonaceae South Korea: Yangpyeong H.D. Shin JX143595 JX143353 JX143107 JX142861 JX142615 

CBS 132649; CPC 10725 Viola mandschurica Violaceae South Korea: Suwon H.D. Shin JX143596 JX143354 JX143108 JX142862 JX142616 

CBS 132671; CPC 14546 Cercis chinensis Fabaceae South Korea: Yangpyeong H.D. Shin JX143597 JX143355 JX143109 JX142863 JX142617 

MUCC 130 Cosmos bipinnata Asteraceae Japan: Ehime J. Nishikawa JX143598 JX143356 JX143110 JX142864 JX142618 

MUCC 866 Hibiscus syriacus Malvaceae Japan: Ehime J. Nishikawa JX143599 JX143357 JX143111 JX142865 JX142619 

Cercospora cf. flagellaris CBS 113127; RC3766; TX-18 Eichhornia crassipes Pontederiaceae USA: Texas D. Tessmann & R. Charudattan DQ835075 AF146147 DQ835121 DQ835148 DQ835175 

CBS 115482; A207 Bs+; CPC 4410 Citrus sp. Rutaceae South Africa: Messina M.C. Pretorius AY260070 DQ835095 DQ835114 DQ835141 DQ835168 

CBS 132637; CPC 10079 Trachelium sp. Campanulaceae Israel E. Tzul-Abad JX143600 JX143358 JX143112 JX142866 JX142620 

CBS 132646; CPC 10681 Cichorium intybus Asteraceae South Korea: Suwon H.D. Shin JX143601 JX143359 JX143113 JX142867 JX142621 

CBS 132648; CPC 10722 Amaranthus patulus Amaranthaceae South Korea: Namyangju H.D. Shin JX143602 JX143360 JX143114 JX142868 JX142622 

CBS 132653; CPC 10884 Dysphania ambrosioides 

Chenopodiaceae South Korea: Jeju H.D. Shin JX143603 JX143361 JX143115 JX142869 JX142623 

(≡ Chenopodium ambrosioides) 

CBS 132667; CPC 11643 Celosia argentea var. cristata Amaranthaceae South Korea: Hoengseong H.D. Shin JX143604 JX143362 JX143116 JX142870 JX142624 

(≡ C. cristata) 

CBS 132670; CPC 14487 Sigesbeckia pubescens Asteraceae South Korea: Yanggu H.D. Shin JX143605 JX143363 JX143117 JX142871 JX142625 

CBS 132674; CPC 14723 Phytolacca americana Phytolaccaceae South Korea: Jeju H.D. Shin JX143606 JX143364 JX143118 JX142872 JX142626 

CBS 143.51; CPC 5055 Bromus sp. Poaceae — M.D. Whitehead JX143607 JX143365 JX143119 JX142873 JX142627 

CPC 10124 Phytolacca americana Phytolaccaceae South Korea: Pocheon H.D. Shin JX143608 JX143366 JX143120 JX142874 JX142628 

CPC 1051 Populus deltoides Salicaceae South Africa P.W. Crous AY260069 JX143367 JX143121 JX142875 JX142629 

CPC 1052 Populus deltoides Salicaceae South Africa P.W. Crous JX143609 JX143368 JX143122 JX142876 JX142630 

CPC 10684 Phytolacca americana Phytolaccaceae South Korea: Jinju H.D. Shin JX143610 JX143369 JX143123 JX142877 JX142631 

CPC 4411; Q207 F5 Citrus sp. Rutaceae South Africa: Messina M.C. Pretorius AY260071 DQ835098 DQ835118 DQ835145 DQ835172 

CPC 5441 Amaranthus sp. Amaranthaceae Fiji C.F. Hill JX143611 JX143370 JX143124 JX142878 JX142632 

MUCC 127 Cosmos sulphureus Asteraceae Japan: Ehime J. Nishikawa JX143612 JX143371 JX143125 JX142879 JX142633 

MUCC 735 Hydrangea serrata Hydrangeaceae Japan: Wakayama C. Nakashima & I. Araki JX143613 JX143372 JX143126 JX142880 JX142634 

MUCC 831 Hydrangea serrata Hydrangeaceae Japan: Tokyo I. Araki & M. Harada JX143614 JX143373 JX143127 JX142881 JX142635 


123





Cercospora cf. helianthicola MUCC 716 Helianthus tuberosus Asteraceae Japan: Wakayama C. Nakashima & I. Araki JX143615 JX143374 JX143128 JX142882 JX142636 

Cercospora cf. ipomoeae CBS 132639; CPC 10102 Persicaria thunbergii Polygonaceae South Korea: Pocheon H.D. Shin JX143616 JX143375 JX143129 JX142883 JX142637 

CBS 132652; CPC 10833 Ipomoea nil (= I. hederacea) Convolvulaceae South Korea: Chuncheon H.D. Shin JX143617 JX143376 JX143130 JX142884 JX142638 

MUCC 442 Ipomoea aquatica Convolvulaceae Japan: Kagawa G. Kizaki JX143618 JX143377 JX143131 JX142885 JX142639 

Cercospora kikuchii CBS 128.27; CPC 5068 (TYPE) Glycine soja Fabaceae Japan T. Matsumoto DQ835070 DQ835088 DQ835107 DQ835134 DQ835161 

CBS 132633; CPC 16578 Glycine max Fabaceae Argentina — JX143619 JX143378 JX143132 JX142886 JX142640 

CBS 135.28; CPC 5067 Glycine soja Fabaceae Japan H.W. Wollenweber DQ835071 DQ835089 DQ835108 DQ835135 DQ835162 

MUCC 590; MAFF 305040 Glycine soja Fabaceae Japan: Kagoshima H. Kurata JX143620 JX143379 JX143133 JX142887 JX142641 

Cercospora lactucae-sativae CBS 132604; CPC 10728 Ixeris chinensis subsp. strigosa Asteraceae South Korea: Chuncheon H.D. Shin JX143621 JX143380 JX143134 JX142888 JX142642 

(≡ Ixeris strigosa) 

CPC 10082 Ixeris chinensis subsp. strigosa Asteraceae South Korea: Chuncheon H.D. Shin JX143622 JX143381 JX143135 JX142889 JX142643 

(≡ Ixeris strigosa) 

MUCC 570; MUCN S463; MAFF Lactuca sativa Asteraceae Japan: Chiba C. Nakashima JX143623 JX143382 JX143136 JX142890 JX142644 

238209 

MUCC 571; MUCNS 214; MAFF Lactuca sativa Asteraceae Japan: Chiba S. Uematsu JX143624 JX143383 JX143137 JX142891 JX142645 

237719 

Cercospora cf. malloti MUCC 575; MUCNS 582; MAFF Cucumis melo Cucurbitaceae Japan: Okinawa K. Uehara JX143625 JX143384 JX143138 JX142892 JX142646 

237872 

MUCC 787 Mallotus japonicus Euphorbiaceae Japan: Okinawa C. Nakashima & T. Akashi JX143626 JX143385 JX143139 JX142893 JX142647 

Cercospora mercurialis CBS 549.71 Mercurialis annua Euphorbiaceae Romania: Cheia O. Constantinescu JX143627 JX143386 JX143140 JX142894 JX142648 

CBS 550.71 (TYPE) Mercurialis perennis Euphorbiaceae Romania: Cheia O. Constantinescu JX143628 JX143387 JX143141 JX142895 JX142649 

CBS 551.71 Mercurialis ovata Euphorbiaceae Romania: Hagieni O. Constantinescu & 

JX143629 JX143388 JX143142 JX142896 JX142650 

G. Negrean 

Cercospora cf. modiolae CPC 5115 Modiola caroliniana Malvaceae New Zealand C.F. Hill JX143630 JX143389 JX143143 JX142897 JX142651 

Cercospora cf. nicotianae CBS 131.32; CPC 5076 Nicotiana tabacum Solanaceae Indonesia: Medan H. Diddens & A. Jaarsveld DQ835073 DQ835099 DQ835119 DQ835146 DQ835173 

CBS 132632; CPC 15918 Glycine max Fabaceae Mexico: Tamaulipas Ma. de Jesús Yáñez-Morales JX143631 JX143390 JX143144 JX142898 JX142652 

CBS 570.69; CPC 5075 Nicotiana tabacum Solanaceae Nigeria S.O. Alasoadura DQ835074 DQ835100 DQ835120 DQ835147 DQ835174 

O. Constantinescu JX143632 JX143391 JX143145 JX142899 JX142653 

Cercospora olivascens CBS 253.67; IMI 124975; CPC 5085 

(TYPE) 

Aristolochia clematidis Aristolochiaceae Romania: Cazanele 

Dunarii 

Cercospora cf. physalidis CBS 765.79 Solanum tuberosum Solanaceae Peru L.J. Turkensteen JX143633 JX143392 JX143146 JX142900 JX142654 

Cercospora pileicola CBS 132607; CPC 10749 (TYPE) Pilea pumila (= P. mongolica) Urticaceae South Korea: 


Dongducheon 

CBS 132647; CPC 10693 Pilea hamaoi (≡ P. pumila var. Urticaceae South Korea: Hoengseong H.D. Shin JX143635 JX143394 JX143148 JX142902 JX142656 

hamaoi) 

CPC 11369 Pilea pumila (= P. mongolica) Urticaceae South Korea: Hongcheon H.D. Shin JX143636 JX143395 JX143149 JX142903 JX142657 

Cercospora polygonacea CBS 132614; CPC 11318 Persicaria longiseta (≡ P. blumei) Polygonaceae South Korea: Cheongju H.D. Shin JX143637 JX143396 JX143150 JX142904 JX142658 

124





Cercospora punctiformis CBS 132626; CPC 14606 Cynanachum wilfordii Asclepiadaceae South Korea: Bonghwa H.D. Shin JX143638 JX143397 JX143151 JX142905 JX142659 

Cercospora cf. resedae CBS 118793 Reseda odorata Resedaceae New Zealand: Auckland C.F. Hill JX143639 JX143398 JX143152 JX142906 JX142660 

CBS 257.67; CPC 5057 Helianthemum sp. Cistaceae Romania: Bucuresti O. Constantinescu DQ233319 DQ233343 DQ233369 DQ233395 DQ233421 

Cercospora cf. richardiicola CBS 132627; CPC 14680 Ajuga multiflora Lamiaceae South Korea: Incheon H.D. Shin JX143640 JX143399 JX143153 JX142907 JX142661 

MUCC 128 Tagetes erecta Asteraceae Japan: Ehime J. Nishikawa JX143641 JX143400 JX143154 JX142908 JX142662 

MUCC 132 Osteospermum sp. Asteraceae Japan: Shizuoka J. Nishikawa JX143642 JX143401 JX143155 JX142909 JX142663 

MUCC 138 Fuchsia ×hybrida Onagraceae Japan: Shizuoka J. Nishikawa JX143643 JX143402 JX143156 JX142910 JX142664 

MUCC 578; MAFF 238210 Zantedeschia sp. Araceae Japan: Ehime J. Nishikawa JX143644 JX143403 JX143157 JX142911 JX142665 

MUCC 582; MAFF 238880 Gerbera hybrida Asteraceae Japan: Shizuoka J. Takeuchi JX143645 JX143404 JX143158 JX142912 JX142666 

Cercospora ricinella CBS 132605; CPC 10734 Ricinus communis Euphorbiaceae South Korea: Chuncheon H.D. Shin JX143646 JX143405 JX143159 JX142913 JX142667 

CPC 10104 Ricinus communis Euphorbiaceae South Korea: Chuncheon H.D. Shin JX143647 JX143406 JX143160 JX142914 JX142668 

Cercospora rodmanii CBS 113123; RC3660; 28-1 Eichhornia crassipes Pontederiaceae Brazil: Rio Verde R. Charudattan DQ835076 AF146136 DQ835122 DQ835149 DQ835176 

CBS 113124; RC2867 Eichhornia crassipes Pontederiaceae Mexico: Carretero R. Charudattan DQ835077 AF146137 DQ835123 DQ835150 DQ835177 

CBS 113125; RC4101; 400 Eichhornia crassipes Pontederiaceae Zambia M. Morris DQ835078 AF146146 DQ835124 DQ835151 DQ835178 

CBS 113126; RC3409; 62-2 Eichhornia crassipes Pontederiaceae Brazil: Oroco R. Charudattan DQ835079 AF146138 DQ835125 DQ835152 DQ835179 

CBS 113128; RC394; WH83 Eichhornia crassipes Pontederiaceae USA: Florida R. Charudattan DQ835080 AF146142 DQ835126 DQ835153 DQ835180 

CBS 113129; RC397; WH9-BR Eichhornia crassipes Pontederiaceae USA: Florida K. Conway DQ835081 AF146143 DQ835127 DQ835154 DQ835181 

CBS 113130; RC393; WHK Eichhornia crassipes Pontederiaceae USA: Florida R. Charudattan DQ835082 AF146144 DQ835128 DQ835155 DQ835182 

CBS 113131; RC395; WHV Eichhornia crassipes Pontederiaceae Venezuela: Maracay R. Charudattan DQ835083 AF146148 DQ835129 DQ835156 DQ835183 

Cercospora rumicis CPC 5439 Rumex sanguineus Polygonaceae New Zealand: Manurewa C.F. Hill JX143648 JX143407 JX143161 JX142915 JX142669 

Cercospora senecioniswalkeri 

CBS 132636; CPC 19196 Senecio walkeri Asteraceae Laos P. Phengsintham JX143649 JX143408 JX143162 JX142916 JX142670 

Cercospora cf. sigesbeckiae CBS 132601; CPC 10664 Sigesbeckia glabrescens Asteraceae South Korea: Chuncheon H.D. Shin JX143650 JX143409 JX143163 JX142917 JX142671 

CBS 132606; CPC 10740 Paulownia coreana Scrophulariaceae South Korea: Namyangju H.D. Shin JX143651 JX143410 JX143164 JX142918 JX142672 

CBS 132621; CPC 14489 Sigesbeckia pubescens Asteraceae South Korea: Yanggu H.D. Shin JX143652 JX143411 JX143165 JX142919 JX142673 

CBS 132641; CPC 10117 Persicaria orientalis 

Polygonaceae South Korea: Chuncheon H.D. Shin JX143653 JX143412 JX143166 JX142920 JX142674 

(= P. cochinchinensis) 

CBS 132642; CPC 10128 Pilea pumila (= P. mongolica) Urticaceae South Korea: Hongcheon H.D. Shin JX143654 JX143413 JX143167 JX142921 JX142675 

CBS 132675; CPC 14726 Malva verticillata Malvaceae South Korea: Yanggu H.D. Shin JX143655 JX143414 JX143168 JX142922 JX142676 

MUCC 587; MUCNS 197; MAFF Begonia sp. Begoniaceae Japan: Chiba S. Uematsu JX143656 JX143415 JX143169 JX142923 JX142677 

237690 

MUCC 589; MAFF 305039 Glycine max Fabaceae Japan: Saitama H. Kurata JX143657 JX143416 JX143170 JX142924 JX142678 

MUCC 849 Dioscorea tokoro Dioscoreaceae Japan: Tokyo I. Araki JX143658 JX143417 JX143171 JX142925 JX142679 

Cercospora sojina CBS 132018; CPC 12322 Glycine soja Fabaceae South Korea: Hoengseong H.D. Shin GU214655 JX143418 JX143172 JX142926 JX142680 


125





CBS 132615; CPC 11353 (TYPE) Glycine soja Fabaceae South Korea: Hongcheon H.D. Shin JX143659 JX143419 JX143173 JX142927 JX142681 

CBS 132684; CPC 17971; CCC Glycine max Fabaceae Argentina F. Scandiani JX143660 JX143420 JX143174 JX142928 JX142682 

173-09, 09-495 

CPC 11420 Glycine soja Fabaceae South Korea: Hongcheon H.D. Shin JX143661 JX143421 JX143175 JX142929 JX142683 

CPC 17964; CCC 155-09, 09-285-5 Glycine max Fabaceae Argentina F. Scandiani JX143662 JX143422 JX143176 JX142930 JX142684 





CPC 17969; CCC 167-09, 09-881 Glycine max Fabaceae Argentina N. Formento JX143667 JX143427 JX143181 JX142935 JX142689 

CPC 17970; CCC 172-09, 09-320 Glycine max Fabaceae Argentina F. Scandiani JX143668 JX143428 JX143182 JX142936 JX142690 

CPC 17972; CCC 174-09, Glycine max Fabaceae Argentina S. Piubello JX143669 JX143429 JX143183 JX142937 JX142691 

CPC 17973; CCC 176-09, 09-882 Glycine max Fabaceae Argentina N. Formento JX143670 JX143430 JX143184 JX142938 JX142692 





Cercospora sp. A CBS 132631; CPC 15872 Chenopodium sp. Chenopodiaceae Mexico Ma. de Jesús Yáñez-Morales JX143675 JX143435 JX143189 JX142943 JX142697 

Cercospora sp. B CBS 132602; CPC 10687 Ipomoea purpurea Convolvulaceae South Korea: Kangnung H.D. Shin JX143676 JX143436 JX143190 JX142944 JX142698 

Cercospora sp. C CBS 132629; CPC 15841 — Compositae Mexico: Montecillo Ma. de Jesús Yáñez-Morales JX143677 JX143437 JX143191 JX142945 JX142699 

Cercospora sp. D CBS 132630; CPC 15856 — — Mexico Ma. de Jesús Yáñez-Morales JX143678 JX143438 JX143192 JX142946 JX142700 

Cercospora sp. E CBS 132628; CPC 15632 Unidentified wild plant — Mexico: Montecillo Ma. de Jesús Yáñez-Morales JX143679 JX143439 JX143193 JX142947 JX142701 

CPC 15801 Unidentified wild plant — Mexico: Montecillo Ma. de Jesús Yáñez-Morales JX143680 JX143440 JX143194 JX142948 JX142702 

Cercospora sp. F CBS 132618; CPC 12062 Zea mays Poaceae South Africa P. Caldwell DQ185071 DQ185083 DQ185095 DQ185107 DQ185119 

Cercospora sp. G CBS 115518; CPC 5360 Bidens frondosa Asteraceae New Zealand: Kopuku C.F. Hill JX143681 JX143441 JX143195 JX142949 JX142703 

CPC 5438 Salvia viscosa Lamiaceae New Zealand: Manurewa C.F. Hill JX143682 JX143442 JX143196 JX142950 JX142704 

Cercospora sp. H CBS 115205; CPC 5116 Dichondra repens Convolvulaceae New Zealand C.F. Hill JX143683 JX143443 JX143197 JX142951 JX142705 

CPC 11620 Chamelaucium uncinatum Myrtaceae Argentina S. Wolcan JX143684 JX143444 JX143198 JX142952 JX142706 

Cercospora sp. I CBS 114815; CPC 5364 Deutzia purpurascens Hydrangeaceae New Zealand: Manurewa C.F. Hill JX143685 JX143445 JX143199 JX142953 JX142707 

CBS 114816; CPC 5363 Deutzia ×rosea 

Hydrangeaceae New Zealand: Manurewa C.F. Hill JX143686 JX143446 JX143200 JX142954 JX142708 

(= D. gracilis × purpurascens) 

CBS 114817; CPC 5365 Fuchsia procumbens Onagraceae New Zealand: Manurewa C.F. Hill JX143687 JX143447 JX143201 JX142955 JX142709 

CBS 114818; CPC 5362 Deutzia crenata Hydrangeaceae New Zealand: Manurewa C.F. Hill JX143688 JX143448 JX143202 JX142956 JX142710 

126





CBS 115117 Archontophoenix cunninghamiana Arecaceae (Palmae) New Zealand: Whangarei C.F. Hill JX143689 JX143449 JX143203 JX142957 JX142711 

CBS 115121 Gunnera tinctoria Gunneraceae New Zealand: Mt Albert C.F. Hill JX143690 JX143450 JX143204 JX142958 JX142712 

CBS 132597; CPC 10615 Coreopsis verticillata Asteraceae New Zealand: Manurewa C.F. Hill JX143691 JX143451 JX143205 JX142959 JX142713 

CBS 132643; CPC 10138 Ajuga multiflora Lamiaceae South Korea: Suwon H.D. Shin JX143692 JX143452 JX143206 JX142960 JX142714 

CPC 10616 Coreopsis verticillata Asteraceae New Zealand: Manurewa C.F. Hill JX143693 JX143453 JX143207 JX142961 JX142715 

CPC 5440 Nicotiana sp. Solanaceae New Zealand: Manurewa C.F. Hill JX143694 JX143454 JX143208 JX142962 JX142716 

Cercospora sp. J MUCC 541 Antirrhinum majus Plantaginaceae Japan: Aichi M.Matsusaki JX143695 JX143455 JX143209 JX142963 JX142717 

Cercospora sp. K CBS 132603; CPC 10719 Ipomoea coccinea 

Convolvulaceae South Korea: Namyangju H.D. Shin JX143696 JX143456 JX143210 JX142964 JX142718 

(≡ Quamoclit coccinea) 

CPC 10094 Ipomoea coccinea 



CPC 12391 Ipomoea coccinea 



Cercospora sp. L CBS 115477; CPC 5114 Crepis capillaris Asteraceae New Zealand C.F. Hill JX143699 JX143459 JX143213 JX142967 JX142721 

Cercospora sp. M CBS 132596; CPC 10553 Acacia mangium Fabaceae Thailand: Sanamchaikhet K. Pongpanich JX143700 AY752175 AY752203 AY752234 AY752265 

Cercospora sp. N CBS 132619; CPC 12684 Musa sp. Musaceae Bangladesh: Western I. Buddenhagen EU514224 JX143460 JX143214 JX142968 JX142722 

Cercospora sp. O CBS 132635; CPC 18636 Musa sp. Musaceae Thailand: Mae Klang P.W. Crous JX143701 JX143461 JX143215 JX142969 JX142723 

Loung 

Cercospora sp. P CBS 112649; CPC 3946 Citrus sp., leaf spot Rutaceae Swaziland M.C. Pretorius AY260072 DQ835090 DQ835109 DQ835136 DQ835163 

CBS 112722; CPC 3947 Citrus sp., leaf spot Rutaceae Swaziland M.C. Pretorius AY260073 DQ835091 DQ835110 DQ835137 DQ835164 

CBS 112728; CPC 3949 Citrus × sinensis 

Rutaceae South Africa: Komatipoort M.C. Pretorius AY260076 DQ835092 DQ835111 DQ835138 DQ835165 

(≡ C. aurantium var. sinensis) 







CBS 113996; CPC 5326 Cajanus cajan Fabaceae South Africa: Nelspruit L. van Jaarsveld JX143702 JX143462 JX143216 JX142970 JX142724 


CBS 115609; CPC 3945 Citrus sp., leaf spot Rutaceae Swaziland M.C. Pretorius AY260074 DQ835096 DQ835115 DQ835142 DQ835169 

CBS 116365; CPC 10526 (TYPE) Acacia mangium Fabaceae Thailand M.J. Wingfield AY752141 AY752176 AY752204 AY752235 AY752266 

CBS 132645; CPC 10527 Acacia mangium Fabaceae Thailand M.J. Wingfield AY752142 AY752177 AY752205 AY752236 AY752267 

CBS 132660; CPC 11629; GHA-4-0 Dioscorea rotundata Dioscoreaceae Ghana S. Nyako & A.O. Danquah JX143704 JX143464 JX143218 JX142972 JX142726 

CBS 132662; CPC 11635; PNG-009 Dioscorea nummularia Dioscoreaceae Papua New Guinea J. Peters & A.N. Jama JX143705 JX143465 JX143219 JX142973 JX142727 

CBS 132664; CPC 11637; PNG-022 Dioscorea rotundata Dioscoreaceae Papua New Guinea J. Peters & A.N. Jama JX143706 JX143466 JX143220 JX142974 JX142728 

CBS 132665; CPC 11638; PNG-023 Dioscorea bulbifera Dioscoreaceae Papua New Guinea J. Peters & A.N. Jama JX143707 JX143467 JX143221 JX142975 JX142729 


127





CBS 132680; CPC 15827 Ricinus communis Euphorbiaceae Mexico: Tamaulipas Ma. de Jesús Yáñez-Morales JX143708 JX143468 JX143222 JX142976 JX142730 

CPC 10552 Acacia mangium Fabaceae Thailand K. Pongpanich JX143709 AY752174 AY752202 AY752233 AY752264 





CPC 4001 Citrus ×sinensis 

Rutaceae Swaziland M.C. Pretorius AY343372 AY343335 DQ835116 DQ835143 DQ835170 


CPC 4002 Citrus ×sinensis 

Rutaceae Swaziland M.C. Pretorius DQ835072 DQ835097 DQ835117 DQ835144 DQ835171 


CPC 5262 Hibiscus sabdariffa Malvaceae New Zealand: Auckland C.F. Hill JX143714 JX143473 JX143227 JX142981 JX142735 

(imported from Fiji) 

CPC 5327 Cajanus cajan Fabaceae South Africa: Nelspruit L. van Jaarsveld JX143715 JX143474 JX143228 JX142982 JX142736 

MUCC 771 Coffea arabica Rubiaceae Japan: Okinawa C. Nakashima JX143716 JX143475 JX143229 JX142983 JX142737 

Cercospora sp. Q CBS 113997; CPC 5325 Cajanus cajan Fabaceae South Africa: Nelspruit L. van Jaarsveld JX143717 JX143476 JX143230 JX142984 JX142738 






CBS 132656; CPC 11536 Acacia mangium Fabaceae Thailand K. Pongpanich JX143723 JX143482 JX143236 JX142990 JX142744 

CBS 132661; CPC 11634; PNG-002 Dioscorea rotundata Dioscoreaceae Papua New Guinea J. Peters & A.N. Jama JX143724 JX143483 JX143237 JX142991 JX142745 

CBS 132663; CPC 11636; PNG-016 Dioscorea esculenta Dioscoreaceae Papua New Guinea J. Peters & A.N. Jama JX143725 JX143484 JX143238 JX142992 JX142746 

CBS 132679; CPC 15807 Phaseolus vulgaris Fabaceae Mexico Ma. de Jesús Yáñez-Morales JX143726 JX143485 JX143239 JX142993 JX142747 

CBS 132681; CPC 15844 Euphorbia sp. Euphorbiaceae Mexico: Tamaulipas Ma. de Jesús Yáñez-Morales JX143727 JX143486 JX143240 JX142994 JX142748 

CBS 132682; CPC 15850 Taraxacum sp. Asteraceae Mexico: Tamaulipas Ma. de Jesús Yáñez-Morales JX143728 JX143487 JX143241 JX142995 JX142749 

CPC 10550 Acacia mangium Fabaceae Thailand K. Pongpanich AY752139 AY752172 AY752200 AY752231 AY752262 

CPC 10551 Acacia mangium Fabaceae Thailand K. Pongpanich AY752140 AY752173 AY752201 AY752232 AY752263 

CPC 11539 Acacia mangium Fabaceae Thailand K. Pongpanich JX143729 JX143488 JX143242 JX142996 JX142750 

CPC 11639; PNG-037 Dioscorea rotundata Dioscoreaceae Papua New Guinea J. Peters & A.N. Jama JX143730 JX143489 JX143243 JX142997 JX142751 

CPC 15875 Euphorbia sp. Euphorbiaceae Mexico: Tamaulipas Ma. de Jesús Yáñez-Morales JX143731 JX143490 JX143244 JX142998 JX142752 

Cercospora sp. R CBS 114644 Myoporum laetum Myoporaceae New Zealand: Grey Lynn C.F. Hill JX143732 JX143491 JX143245 JX142999 JX142753 

Cercospora sp. S CBS 132599; CPC 10656 Crepidiastrum denticulatum 

(≡ Youngia denticulata) 

Asteraceae South Korea: Yangpyeong H.D. Shin JX143733 JX143492 JX143246 JX143000 JX142754 

128





Cercospora vignigena CBS 132611; CPC 10812 (TYPE) Vigna unguiculata (= V. sinensis) Fabaceae South Korea: Jeongeup H.D. Shin JX143734 JX143493 JX143247 JX143001 JX142755 

CPC 1134 Vigna unguiculata (= V. sinensis) Fabaceae South Africa: 

S. van Wyk JX143735 JX143494 JX143248 JX143002 JX142756 

Potchefstroom 

MUCC 579; MAFF 237635 Vigna unguiculata (= V. sinensis) Fabaceae Japan: Gumma K. Kishi JX143736 JX143495 JX143249 JX143003 JX142757 

Cercospora violae CBS 251.67; CPC 5079 (TYPE) Viola tricolor Violaceae Romania: Cazanele O. Constantinescu JX143737 JX143496 JX143250 JX143004 JX142758 

Dunarii 

CPC 5368 Viola odorata Violaceae New Zealand C.F. Hill JX143738 JX143497 JX143251 JX143005 JX142759 

MUCC 129 Viola sp. Violaceae Japan: Kochi J. Nishikawa JX143739 JX143498 JX143252 JX143006 JX142760 

MUCC 133 Viola tricolor Violaceae Japan: Nagano J. Nishikawa JX143740 JX143499 JX143253 JX143007 JX142761 

MUCC 136 Viola tricolor Violaceae Japan: Shizuoka J. Nishikawa JX143741 JX143500 JX143254 JX143008 JX142762 

Cercospora zeae-maydis CBS 117755; YA-03; A358 Zea mays Poaceae USA: Indiana B. Fleener DQ185072 DQ185084 DQ185096 DQ185108 DQ185120 

CBS 117756; DE-97; A359 Zea mays Poaceae USA: Indiana B. Fleener DQ185073 DQ185085 DQ185097 DQ185109 DQ185121 

CBS 117757; JV-WI-02; A360 Zea mays Poaceae USA: Wisconsin B. Fleener DQ185074 DQ185086 DQ185098 DQ185110 DQ185122 

(TYPE) 

CBS 117758; JH-IA-04; A361 Zea mays Poaceae USA: Iowa B. Fleener DQ185075 DQ185087 DQ185099 DQ185111 DQ185123 

CBS 117759; UC-TN-99; A362 Zea mays Poaceae USA: Tennessee B. Fleener DQ185076 DQ185088 DQ185100 DQ185112 DQ185124 

CBS 117760; NH-PA-99; A363 Zea mays Poaceae USA: Pennsylvania B. Fleener DQ185077 DQ185089 DQ185101 DQ185113 DQ185125 

CBS 117761; PR-IN-99; A364 Zea mays Poaceae USA: Indiana B. Fleener DQ185078 DQ185090 DQ185102 DQ185114 DQ185126 

CBS 117762; DEXTER-MO-00; Zea mays Poaceae USA: Missouri B. Fleener DQ185079 DQ185091 DQ185103 DQ185115 DQ185127 

A365 

CBS 117763; RENBECK-IA-99; Zea mays Poaceae USA: Iowa B. Fleener DQ185080 DQ185092 DQ185104 DQ185116 DQ185128 

A367 

CBS 132668; CPC 12225; CHME 52 Zea mays Poaceae China: Liaoning Province — JX143742 JX143501 JX143255 JX143009 JX142763 

CBS 132678; CPC 15602 Zea mays Poaceae Mexico: Tlacotepec Ma. de Jesús Yáñez-Morales JX143743 JX143502 JX143256 JX143010 JX142764 

Cercospora zebrina CBS 108.22; CPC 5091 Medicago arabica (= M. maculata) Fabaceae — E.F. Hopkins JX143744 JX143503 JX143257 JX143011 JX142765 

CBS 112723; CPC 3957 Trifolium repens Fabaceae Canada: Ottawa K.A. Seifert AY260079 JX143504 JX143258 JX143012 JX142766 

CBS 112736; CPC 3958 Trifolium repens Fabaceae Canada: Ottawa K.A. Seifert AY260080 JX143505 JX143259 JX143013 JX142767 

CBS 112893; CPC 3955 Trifolium pratense Fabaceae Canada: Ottawa K.A. Seifert AY260078 JX143506 JX143260 JX143014 JX142768 

CBS 113070; CPC 5367 Trifolium repens Fabaceae New Zealand: Blockhouse C.F. Hill JX143745 JX143507 JX143261 JX143015 JX142769 

Bay 

CBS 114359; CPC 10901 Hebe sp. Scrophulariaceae New Zealand C.F. Hill JX143746 JX143508 JX143262 JX143016 JX142770 

CBS 118789; WAC 5106 Trifolium subterraneum Fabaceae Australia M.J. Barbetti JX143747 JX143509 JX143263 JX143017 JX142771 

CBS 118790; IMI 262766; WA 2030; Trifolium subterraneum Fabaceae Australia M.J. Barbetti JX143748 JX143510 JX143264 JX143018 JX142772 

WAC 7973 


129




CBS 118791; IMI 264190; WA2054; 

WAC7993 


Trifolium cernuum Fabaceae Australia M.J. Barbetti JX143749 JX143511 JX143265 JX143019 JX142773 

CBS 129.39; CPC 5078 Trifolium subterraneum Fabaceae USA: Wisconsin — JX143750 JX143512 JX143266 JX143020 JX142774 

CBS 132650; CPC 10756 Trifolium repens Fabaceae South Korea: Namyangju H.D. Shin JX143751 JX143513 JX143267 JX143021 JX142775 

CBS 137.56; CPC 5118 Hedysarum coronarium Fabaceae Italy — JX143752 JX143514 JX143268 JX143022 JX142776 

CBS 537.71; IMI 161108; CPC 5089 Astragalus spruneri Fabaceae Romania: Hagieni O. Constantinescu JX143753 JX143515 JX143269 JX143023 JX142777 

CPC 5437 Lotus pedunculatus Fabaceae New Zealand: Auckland C.F. Hill JX143754 JX143516 JX143270 JX143024 JX142778 

CPC 5473 Jacaranda mimosifolia Bignoniaceae New Zealand C.F. Hill JX143755 JX143517 JX143271 JX143025 JX142779 

Cercospora zeina CBS 118820; CPC 11995 (TYPE) Zea mays Poaceae South Africa: 

P. Caldwell DQ185081 DQ185093 DQ185105 DQ185117 DQ185129 

Pietermaritzburg 

CBS 132617; CPC 11998 Zea mays Poaceae South Africa: 

P. Caldwell DQ185082 DQ185094 DQ185106 DQ185118 DQ185130 

Pietermaritzburg 

Cercospora cf. zinniae CBS 132624; CPC 14549 Zinnia elegans Asteraceae South Korea: Yangpyeong H.D. Shin JX143756 JX143518 JX143272 JX143026 JX142780 

CBS 132676; CPC 15075 — — Brazil: Valverde A.C. Alfenas JX143757 JX143519 JX143273 JX143027 JX142781 

MUCC 131 Zinnia elegans Asteraceae Japan: Shizuoka J. Nishikawa JX143758 JX143520 JX143274 JX143028 JX142782 

MUCC 572; MUCNS 215; 

Zinnia elegans Asteraceae Japan: Chiba S. Uematsu JX143759 JX143521 JX143275 JX143029 JX142783 

MAFF 237718 

Septoria provencialis CBS 118910; CPC 12226 Eucalyptus sp. Myrtaceae France P.W. Crous DQ303096 JX143522 JX143276 JX143030 JX142784 

1 

CBS: CBS-KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands; CPC: Culture collection of Pedro Crous, housed at CBS; IHEM: Collection of the Laboratorium voor Microbiologie en Microbiele Genetica, Rijksuniversiteit, Ledeganckstraat 35, 

B-9000, Gent, Belgium; IMI: International Mycological Institute, CABI-Bioscience, Egham, Bakeham Lane, U.K.; Lynfield: Private culture collection and herbarium of Frank Hill, New Zealand; MAFF: Ministry of Agticulture, Forestry and Fisheries, Tsukuba, 

Ibaraki, Japan; MUCC: Culture Collection, Laboratory of Plant Pathology, Mie University, Tsu, Mie Prefecture, Japan; MUCL: Université Catholique de Louvain, Louvain-la-Neuve, Belgium; MUCNS: Active cultures & specimens of Chiharu Nakashima, 

housed at Mie University; MUMH: Mycologicl Herbarium of Mie University, Tsu, Mie, Japan; PPRI: Plant Protection Research Institute, Pretoria, South Africa; WAC: Department of Agriculture Western Australia Plant Pathogen Collection, Perth, Australia. 

2 

ITS: internal transcribed spacers and intervening 5.8S nrDNA; TEF: translation elongation factor 1-alpha; ACT: actin; CAL: calmodulin; HIS: histone H3. 

130


cercosporin is not produced by all species (Assante et al. 1977, 

examples cited by Goodwin et al. 2001, see also review by Weiland 

et al. 2010). Nutritional and environmental conditions influence 

the production of cercosporin, making it useless for application 

in Cercospora taxonomy (Jenns et al. 1989). Genomic studies in 

recent years attempt to understand the metabolic pathway used 

to produce cercosporin and C. nicotianae has become the model 

organism for these studies (e.g. Chung et al. 2003, Choquer et al. 

2005, Chen et al. 2007, Amnuaykanjanasin & Daub 2009). 

In an attempt to address some of the shortcomings highlighted 

in the previous paragraph, we have obtained diseased plant 

material and/or cultures from as many hosts and countries 

as possible over several years. We sequenced the ITS locus 

(including ITS1, 5.8S nrRNA gene and ITS2), as well as parts of 

four genomic protein coding genes, namely translation elongationfactor 

1-alpha, actin, calmodulin and histone H3 for each culture. 

Our primary objective was to re-evaluate the species concept of 

known Cercospora species by consolidating the results of multilocus 

phylogenetic analyses with morphological characteristics 

produced on host plants and different media. A secondary 

objective was to test whether Cercospora species, in general, 

were host-specific. 


Specimens and isolates 

Dried specimens and cultures used in this study are maintained 

in herbaria and culture collections of Genebank, National Institute 

of Agrobiological Sciences, Japan, (MAFF), the Mycological 

Herbarium and Culture Collection, laboratory of Plant Pathology, 

Mie University, Japan (MUMH or MUCC) and the Centraalbureau 

voor Schimmelcultures (CBS-KNAW Fungal Biodiversity Centre, 

Utrecht, The Netherlands), or the working collection of P.W. Crous 

(CPC), housed at CBS (Table 1). A global set of isolates (Table 1) 

was either obtained from personal culture collections, the culture 

collection of the CBS or recollected on diseased plant material, and 

grown in axenic culture. Symptomatic leaves with leaf spots were 

chosen for isolations of Cercospora spp. as explained in Crous 

(1998). To obtain ascospore isolates, excised lesions were placed 

in distilled water for approximately 2 h, after which they were placed 

on the bottom of Petri dish lids, over which the plate containing 2 

% malt extract agar (MEA) (Crous et al. 1991, 2009c) was inverted. 

Germinating ascospores were examined after 24 h, and singleascospore 

cultures established on MEA as explained by Crous 

(1998). Colonies were sub-cultured onto oatmeal agar (OA), V8- 

juice agar (V8), 2 % potato-dextrose agar (PDA) or MEA (Crous et 

al. 2009c) and incubated at 25 °C under continuous near-ultraviolet 

light, to promote sporulation. 

DNA extraction, amplification and phylogeny 

Genomic DNA was isolated from fungal mycelium grown on the 

agar plates following the protocol of Lee & Taylor (1990) or the 

UltraClean Microbial DNA Isolation Kit (Mo Bio Laboratories, 

Inc., Solana Beach, CA, USA). All isolates were sequenced with 

five genomic loci. The primers ITS5 or ITS1 and ITS4 (White et 

al. 1990) were used to amplify the internal transcribed spacers 

areas as well as the 5.8S rRNA gene (ITS) of the nrDNA operon. 

Part of the actin gene (ACT) was amplified using the primer set 

ACT-512F and ACT-783R (Carbone & Kohn 1999) and part of the 

translation elongation factor 1-a gene (EF) using the primer set 

EF1-728F and EF1-986R (Carbone & Kohn 1999). The primer set 

CAL-228F and CAL-737R (Carbone & Kohn 1999) was used to 

amplify part of the calmodulin gene (CAL) whereas the primer set 

CylH3F and CylH3R (Crous et al. 2004c) was used to amplify part 

of the histone H3 gene (HIS). Additional degenerate primers were 

developed from sequences obtained from GenBank as alternative 

forward and reverse primers for some of the loci during the course 

of the study (Table 2); however, these were rarely used but based 

on their degenerate design could be of use to the broader scientific 

community. The protocols and conditions outlined by Groenewald et 

al. (2005) were followed for standard amplification and subsequent 

sequencing of the loci. 

Sequences of Septoria provencialis (isolate CPC 12226) 

were used as outgroup based on availability and phylogenetic 

relationship with Cercospora (Crous et al. 2004b, 2006b). The 

Cercospora sequences were assembled and added to the outgroup 

sequences using Sequence Alignment Editor v. 2.0a11 (Rambaut 

2002), and manual adjustments for improvement were made by 

eye where necessary. Gaps present in the ingroup taxa and longer 

than 10 characters were coded as a single event for all analyses 

(see TreeBASE). 

Neighbour-joining analyses using the HKY85 substitution 

model were applied to each data partition individually to check the 

stability and robustness of each species clade under each data set 

using PAUP v. 4.0b10 (Swofford 2003) (data not shown, discussed 

under the species notes where applicable). Alignment gaps were 

treated as missing data and all characters were unordered and of 

equal weight. Any ties were broken randomly when encountered. 

The robustness of the trees obtained was evaluated by 1 000 

bootstrap replications (Hillis & Bull 1993). 

MrModeltest v. 2.2 (Nylander 2004) was used to determine the 

best nucleotide substitution model settings for each data partition. 

Based on the results of the MrModeltest, a model-optimised 

phylogenetic re-construction was performed for the aligned 

combined data set to determine species relationships using MrBayes 

v. 3.2.0 (Ronquist & Huelsenbeck 2003). The heating parameter 

was set at 0.3 and the Markov Chain Monte Carlo (MCMC) analysis 

of four chains was started in parallel from a random tree topology 

and lasted until the average standard deviation of split frequencies 

came below 0.05. Trees were saved each 1 000 generations and 

the resulting phylogenetic tree was printed with Geneious v. 5.5.4 

(Drummond et al. 2011). New sequences generated in this study 

were deposited in NCBI’s GenBank nucleotide database (www. 

ncbi.nlm.nih.gov; Table 1) and the alignment and phylogenetic tree 

in TreeBASE (www.treebase.org). 

Isolates of Cercospora sp. Q were screened with five more loci 

to test whether additional loci could distinguish cryptic taxa within 

this species. This species was selected based on the intraspecific 

variation present in Fig. 2 (part 5) and also the range of host species 

and countries represented. The primer set GDF1 and GDR1 

(Guerber et al. 2003) was used to amplify part of the glyceraldehyde- 

3-phosphate dehydrogenase (GAPDH) gene, primer set NMS1 and 

NMS2 (Li et al. 1994) for part of the mitochondrial small subunit rRNA 

gene and part of the chitin synthase (CHS) gene was amplified using 

the primers CHS-79F and CHS-354R (Carbone & Kohn 1999). Part 

of the gene encoding for a mini-chromosome maintenance protein 

(MCM7) was amplified using primers Mcm7-709for, Mcm7-1348rev, 

Mcm7-1447rev (Schmitt et al. 2009) and part of the beta-tubulin 

gene using mainly the primers T1, Bt2b and TUB3Rd (see Table 2 

for references). 


131


Table 2. Details of primers used and/or developed for this study and their relation to selected published primers. The start and end positions 

of the primers are derived using the GenBank accession shown next to the locus name as reference in the 5’–3’ direction. See Crous et al. 

(2009a) for information on additional ITS primers. 

Name Sequence (5’ – 3’) Orientation %GC Tm ( o C) Start End Reference 

Actin (Hypocrea orientalis GenBank accession JQ238613) 

ACT-512F ATG TGC AAG GCC GGT TTC GC Forward 60.0 51.4 244 263 Carbone & Kohn (1999) 

ACT-783R TAC GAG TCC TTC TGG CCC AT Reverse 55.0 47.6 544 563 Carbone & Kohn (1999) 

ACT1Fd GCY GCB CTC GTY ATY GAC AAT GG Forward 57.2 45.7 - 50.6 - 54.7 16 38 This study, see also Aveskamp et 

al. (2009) 

ACT1Rd CRT CGT ACT CCT GCT TBG AGA TCC AC Reverse 54.5 48.3 - 50.3 - 51.8 1537 1562 This study 

ACT2Fd GTA TCG TBC TBG ACT CYG GTG AYG GTG Forward 56.8 48.1 - 52.2 - 55.4 854 880 This study 

ACT2Rd ARR TCR CGD CCR GCC ATG TC Reverse 61.7 45.1 - 50.9 - 58.1 940 956 This study, see also Quaedvlieg 

et al. (2011) 

Beta-tubulin (Gibberella zeae GenBank accession FJ214662) 

Bt1a TTC CCC CGT CTC CAC TTC TTC ATG Forward 54.2 50.1 1091 1114 Glass & Donaldson (1995) 

Bt1b GAC GAG ATC GTT CAT GTT GAA CTC Reverse 45.8 45.1 1603 1626 Glass & Donaldson (1995) 

Bt2a GGT AAC CAA ATC GGT GCT GCT TTC Forward 50.0 48.2 163 186 Glass & Donaldson (1995) 

Bt2b ACC CTC AGT GTA GTG ACC CTT GGC Reverse 58.0 52.1 617 640 Glass & Donaldson (1995) 

CYLTUB1F AAA TTG GTG CTG CTT TCT GG Forward 45.0 43.5 170 189 This study 

CYLTUB1R AGT TGT CGG GAC GGA AGA G Reverse 57.9 46.6 563 581 Crous et al. (2004c) 

T1 AAC ATG CGT GAG ATT GTA AGT Forward 38.1 41.5 1 17 O’Donnell & Cigelnik (1997) 

TUB1Fd CAN MAT GMG KGA RAT CGT RGT Forward 47.6 36.8 - 44.5 - 51.9 1 14 This study 

TUB1Rd RGC VTC YTG GTA YTG CTG GTA Reverse 53.2 43.2 - 47.4 - 51.0 1633 1652 This study 

TUB2Fd GTB CAC CTY CAR ACC GGY CAR TG Forward 59.4 46.1 - 51.4 - 56.4 74 96 This study 

TUB2Rd TCA CCA GTG TAC CAA TGM ARG AAA GCC Reverse 48.1 48.3 - 50.1 - 52.0 1545 1565 This study 

TUB3Fd AAA THG GTG CYG CHT TCT GG Forward 50.8 42.5 - 45.9 - 50.5 170 189 This study 

TUB3Rd TCV GWG TTS AGY TGA CCN GGG Reverse 60.3 46.1 - 50.5 -54.0 1039 1059 This study 

TUB4Fd GGH GCY GGH AAC AAC TGG GC Forward 65.8 48.3 - 52.2 - 57.7 600 618 This study 

TUB4Rd CCR GAY TGR CCR AAR ACR AAG TTG TC Reverse 50.0 44.4 - 49.4 - 54.4 581 606 This study 

Calmodulin (Colletotrichum gloeosporioides GenBank accession HM575363) 

CAL-228F GAG TTC AAG GAG GCC TTC TCC C Forward 59.1 49.2 2 23 Carbone & Kohn (1999) 

CAL-737R CAT CTT TCT GGC CAT CAT GG Reverse 50.0 43.4 439 458 Carbone & Kohn (1999) 

CAL1Rd GCA TCA TRA GYT RGA CRA ACT CG Reverse 47.8 41.0 - 45.4 - 49.7 747 769 This study 

CAL2Rd TGR TCN GCC TCD CGG ATC ATC TC Reverse 58.0 47.5 - 50.8 - 54.9 647 669 This study 

Histone H3 (Talaromyces stipitatus GenBank accession XM_002478391) 

CYLH3F AGG TCC ACT GGT GGC AAG Forward 61.1 47.6 28 45 Crous et al. (2004c) 

CYLH3R AGC TGG ATG TCC TTG GAC TG Reverse 55.0 46.6 361 380 Crous et al. (2004c) 

H3-1a ACT AAG CAG ACC GCC CGC AGG Forward 66.7 54.2 10 30 Glass & Donaldson (1995) 

H3-1b GCG GGC GAG CTG GAT GTC CTT Reverse 66.7 54.5 367 387 Glass & Donaldson (1995) 

HIS1Rd RCG RAG RCG ACG GGC Reverse 76.7 45.4 - 50.0 - 54.6 382 396 This study 

HIS2Rd GGA TGG TRA CAC GCT TRG CGT G Reverse 59.1 47.9 - 50.5 - 53.1 240 361 This study 

ITS (Magnaporthe grisea GenBank accession AB026819) 

ITS1 TCC GTA GGT GAA CCT GCG G Forward 63.2 49.5 2162 2180 White et al. (1990) 

ITS4 TCC TCC GCT TAT TGA TAT GC Reverse 45.0 41.6 2685 2704 White et al. (1990) 

ITS5 GGA AGT AAA AGT CGT AAC AAG G Forward 40.9 40.8 2138 2159 White et al. (1990) 

V9G TTA CGT CCC TGC CCT TTG TA Forward 45.0 42.8 2002 2021 de Hoog & Gerrits van den Ende 

(1998) 

Translation elongation factor 1-alpha (Sordaria macrospora GenBank accession X96615) 

CylEF-R2 CAT GTT CTT GAT GAA RTC ACG Reverse 40.5 39.2 - 40.2 - 41.1 783 803 Crous et al. (2004c) 

EF-1 ATG GGT AAG GAR GAC AAG AC Forward 47.5 41.2 - 42.3 - 43.4 190 209 O’Donnell et al. (1998) 

EF-2 GGA RGT ACC AGT SAT CAT GTT Reverse 45.2 41.6 - 42.6 -43.7 798 818 O’Donnell et al. (1998) 

EF-22 AGG AAC CCT TAC CGA GCT C Reverse 57.9 46.2 578 596 O’Donnell et al. (1998) 

EF1-1567R ACH GTR CCR ATA CCA CCR ATC TT Reverse 47.1 43.1 - 47.2 - 52.0 1254 1276 Designed by S. Rehner (www. 

aftol.org/pdfs/EF1primer.pdf) 

132



Name Sequence (5’ – 3’) Orientation %GC Tm ( o C) Start End Reference 

Translation elongation factor 1-alpha (Sordaria macrospora GenBank accession X96615) 

EF1-2218R ATG ACA CCR ACR GCR ACR GTY TG Reverse 54.3 45.6 - 50.4 - 55.1 1782 1804 Designed by S. Rehner (www. 


EF1-526F GTC GTY GTY ATY GGH CAY GT Forward 51.7 40.0 - 45.6 - 52.2 220 239 Designed by S. Rehner (www. 


EF1-728F CAT CGA GAA GTT CGA GAA GG Forward 50.0 42.2 306 325 Carbone & Kohn (1999) 

EF1-986R TAC TTG AAG GAA CCC TTA CC Reverse 45.0 40.9 584 603 Carbone & Kohn (1999) 

EF1Fd GTC GTT ATC GGC CAC GTC G Forward 63.2 48.5 223 241 This study 

EF1Rd CGG MCT TGG TGA CCT TGC C Reverse 65.8 48.8 - 50.4 - 52.0 1836 1852 This study 

EF2Fd GAT CTA CCA GTG CGG TGG Forward 61.1 45.4 273 290 This study 

EF2Rd GGT GCA TYT CSA CGG ACT TGA C Reverse 56.8 48.2 - 49.1 - 49.9 1356 1377 This study 

EF3Fd GAG CGT GAG CGT GGT ATC AC Forward 60.0 48.1 632 651 This study 

EF3Rd GGT ACG CTK GTC RAT ACC ACC Reverse 57.1 45.5 - 47.5 - 49.6 286 306 This study 

EF4Fd GGT GCA TYT CSA CGG ACT TGA C Forward 56.8 48.2 - 49.1 - 49.9 1356 1377 This study 

Taxonomy 

Morphological descriptions are based on structures in vivo, with 

morphological structures in vitro noted where relevant. Structures 

were mounted in clear lactic acid, and 30 measurements (× 1 000 

magnification) determined wherever possible, with the extremes 

of spore measurements given in parentheses. Observations were 

made with a Zeiss V20 Discovery stereo-microscope, and with a 

Zeiss Axio Imager 2 light microscope using differential interference 

contrast (DIC) illumination and an AxioCam MRc5 camera and 

software. Colony colours (surface and reverse) were assessed 

on different culture media at 25 °C in the dark, using the colour 

charts of Rayner (1970). All isolates obtained in this study are 

maintained in culture collections (Table 1). Nomenclatural novelties 

and descriptions were deposited in MycoBank (www.MycoBank. 

org; Crous et al. 2004a). 

RESULTS 

DNA phylogeny 

Amplification products and gene sequences of similar size to 

that reported previously (Groenewald et al. 2005, 2010a) were 

obtained. The resulting concatenated alignment contains 361 taxa 

(including the outgroup taxon), and 471, 263, 199, 240 and 347 

characters (including alignment gaps) were used in the ITS, TEF, 

ACT, CAL and HIS partitions, respectively. Based on the results 

of MrModeltest, the following priors were set in MrBayes for the 

different partitions: all partitions had dirichlet base frequencies and 

GTR+G models with gamma-distributed rates were implemented 

for ITS, ACT and CAL, and HKY+G with gamma-distributed 

rates for TEF while HIS required HKY+I+G with inverse gammadistributed 

rates. The final aligned combined data set contained 

361 ingroup taxa with a total of 1 305 characters and Septoria 

provencialis (isolate CPC 12226) served as the outgroup taxon. 

From this alignment 1 520 characters were used for the Bayesian 

analysis; these contained 588 unique site patterns (48, 172, 111, 

125 and 132 for ITS, TEF, ACT, CAL and HIS, respectively). The 

Bayesian analysis lasted 3 995 000 generations and the consensus 

trees and posterior probabilities were calculated from the 5 994 

trees left after discarding 1 998 trees (the first 1 000 generations) 

for burn-in (Fig. 2). 

The ITS region has limited resolution for almost all species in 

Cercospora and therefore the results of the other gene regions were 

particularly useful for comparison of clade stability. Neighbour-joining 

analyses using the HKY85 substitution model were applied to each 

data partition to check the stability and robustness of each species 

clade under the different partitions (data not shown). The ITS region 

was only able to distinguish C. zeina and C. zeae-maydis from the 

rest of the included species. The TEF region was able to distinguish 

33 of the 73 species clades and especially failed for Cercospora sp. 

M–Q (including C. cf. sigesbeckiae and C. cf. richardiicola; spanning 

most of Fig. 2 part 4 and the upper half of part 5), whereas ACT 

distinguished 43 of the 73 species clades and especially failed for 

Cercospora sp. G–I (Fig. 2 part 1) and including C. cf. flagellaris and 

C. alchemillicola/C. cf. alchemillicola. The ACT region also accounted 

for most of the variation observed for Cercospora sp. Q. The CAL 

region was able to distinguish 34 of the 73 species clades but 

especially failed for Cercospora sp. M, P and Q (including C. kikuchii, 

C. cf. sigesbeckiae, C. cf. richardiicola and C. rodmanii; spanning 

middle of Fig. 2 part 4), as well as a group consisting predominantly 

of C. armoraciae, C. capsici, C. zebrina and C. violae (Fig. 2 part 3). 

Although the locus was able to separate C. beticola and C. apii, it 

could not distinguish C. cf. brunkii and C. cf. resedae from C. apii. The 

HIS region distinguished 46 of the 73 species clades and especially 

failed for Cercospora sp. G–I (Fig. 2 part 1) and Cercospora sp. M, 

P and Q (including C. kikuchii, C. cf. richardiicola and C. rodmanii; 

spanning middle of Fig. 2 part 4). The HIS region also accounted for 

most of the variation observed for C. armoraciae and was responsible 

for the split of C. beticola into two clades. No single gene region was 

found which could reliably distinguish all species and, irrespective 

of which locus was used, occurrences of the same sequence(s) 

shared between multiple species were observed. If data for ITS is not 

taken into consideration, the remaining four loci always distinguish 

the following 18 species: C. agavicola, C. apiicola, C. coniogramme, 

C. cf. erysimi, C. euphorbiae-sieboldianae, C. helianthicola, C. 

mercurialis, C. olivascens, C. pileicola, C. senecionis-walkeri, C. 

violae, C. zeae-maydis, C. zeina, Cercospora sp. A, Cercospora sp. 

C, Cercospora sp. D, Cercospora sp. J, Cercospora sp. R. Some 

species are only distinguished based on a single locus and these 

results are discussed under the species notes, where applicable. 


133


4 

4 

4 

4 

4 

S. provencialis CPC 12226 

CPC 19196 Senecio walkeri Laos 

C. senecionis-walkeri 

CPC 15872 Chenopodium sp. Mexico 

Cercospora sp. A 

CPC 17017 Coniogramme japonica var. gracilis Australia C. coniogrammes sp. nov. 

4 

CPC 11995 Zea mays South Africa 

C. zeina 


CBS 117757 Zea mays USA 


CPC 12225 Zea mays China 




C. zeae-maydis 




0.8 


CPC 15602 Zea mays Mexico 

CPC 10687 Ipomoea purpurea South Korea 

Cercospora sp. B 

CPC 11774 Agave tequilana var. azul Mexico 

C. agavicola 

CPC 10122 Coreopsis lanceolata South Korea 

C. cf. coreopsidis 

CPC 10648 Coreopsis lanceolata South Korea 

CPC 15841 Mexico 

Cercospora sp. C 


Cercospora sp. D 

CPC 5361 Erysimum mutabile New Zealand 

C. cf. erysimi 

CPC 5115 Modiola caroliniana New Zealand 

C. cf. modiolae 


Cercospora sp. E 


CPC 14237 Chenopodium cf. album France 

C. chenopodii 

CPC 10304 Chenopodium ficifolium South Korea 



C. cf. chenopodii 



CPC 12450 Chenopodium ficifolium South Korea 


CPC 5059 Phaseolus lunatus USA 

Posterior probability values: 

= 1.000 

= 0.950 to 0.999 

1 = 0.900 to 0.949 

2 = 0.800 to 0.899 

3 = 0.700 to 0.799 

4 = 0.500 to 0.699 

3 

CPC 1137 Vigna sp. South Africa 

CPC 1138 Vigna sp. South Africa 

CPC 11626 Dioscorea rotundata Ghana 

CPC 4408 Citrus maxima South Africa 

CPC 4409 Citrus maxima South Africa 

CPC 11627 Dioscorea alata Ghana 


CPC 11640 Apium sp. USA 

CPC 5085 Aristolochia clematidis Romania 


CBS 765.79 Solanum tuberosum Peru 

4 

CPC 5360 Bidens frondosa New Zealand 

CPC 5438 Salvia viscosa New Zealand 

CPC 11620 Chamelaucium uncinatum Argentina 

CPC 5116 Dichondra repens New Zealand 

CPC 10660 Celosia argentea var. cristata South Korea 

CPC 5363 Deutzia ×rosea New Zealand 

CPC 10138 Ajuga multiflora South Korea 

CBS 115117 Archontophoenix cunninghamiana New Zealand 

CPC 5440 Nicotiana sp. New Zealand 

CBS 115121 Gunnera tinctoria New Zealand 

CPC 5365 Fuchsia procumbens New Zealand 

CPC 5362 Deutzia crenata New Zealand 

CPC 5364 Deutzia purpurascens New Zealand 

CPC 10615 Coreopsis verticilata New Zealand 

CPC 10616 Coreopsis verticilata New Zealand 

C. canescens complex 

C. olivascens 

Cercospora sp. F 

C. cf. physalidis 

Cercospora sp. G 

Cercospora sp. H 

C. celosiae 

Cercospora sp. I 

Fig. 2. (Part 1). Consensus phylogram (50 % majority rule) of 5 994 trees resulting from a Bayesian analysis of the combined 5-gene sequence alignment using MrBayes v. 

3.2.0. Bayesian posterior probabilities are indicated with colour-coded branches and numbers (see legend) and the scale bar represents the expected changes per site. Species 

clades are indicated in coloured blocks and species names in black text. Hosts and countries of origin are indicated in green and blue text, respectively. The tree was rooted to 

Septoria provencialis (strain CPC 12226). 

134


1 

2 

2 

4 

4 

Fig. 2. (Part 2). 

CBS 550.71 Mercurialis perennis Romania 

CBS 549.71 Mercurialis annua Romania 

CBS 551.71 Mercurialis ovata Romania 

CPC 10749 Pilea pumila South Korea 


CPC 10693 Pilea hamaoi South Korea 

CPC 10812 Vigna unguiculata South Korea 

CPC 1134 Vigna unguiculata South Africa 

MUCC 579 Vigna unguiculata Japan 

CPC 11641 Apium sp. Greece 

CPC 11642 Apium sp. Greece 

CPC 10220 Apium sp. Venezuela 



CPC 10759 Apium graveolens South Korea 

2 CPC 10279 Apium sp. Venezuela 

CPC 10657 Apium graveolens South Korea 

CPC 10666 Apium sp. South Korea 



CBS 113306 Euphorbia sieboldiana South Korea 

CPC 14606 Cynanachum wilfordii South Korea 

CPC 11318 Persicaria longiseta South Korea 

3 

CPC 10091 Achyranthes japonica South Korea 

CPC 10879 Achyranthes japonica South Korea 

CPC 14585 Impatiens noli-tangere South Korea 

CPC 12322 Glycine soja South Korea 

3 



CPC 17964 Glycine max Argentinia 














MUCC 541 Antirrhinum majus Japan 

CPC 10104 Ricinus communis South Korea 

CPC 10734 Ricinus communis South Korea 

CPC 10627 Delairea odorata South Africa 




CPC 12391 Ipomoea coccinea South Korea 


2 


CPC 5441 Amaranthus sp. Fiji Islands 

CPC 10681 Cichorium intybus South Korea 

CPC 11643 Celosia argentea var. cristata South Korea 

CPC 10884 Dysphania ambrosioides South Korea 

MUCC 735 Hydrangea serrata Japan 

CPC 4410 Citrus sp. South Africa 

CPC 4411 Citrus sp. South Africa 


= 1.000 

= 0.950 to 0.999 

1 = 0.900 to 0.949 

2 = 0.800 to 0.899 

3 = 0.700 to 0.799 

4 = 0.500 to 0.699 

0.8 

C. mercurialis 

C. pileicola 

C. vignigena sp. nov. 

C. apiicola 

C. euphorbiae-sieboldianae sp. nov. 

C. punctiformis 

C. polygonacea 

C. achyranthis 

C. campi-silii 

C. sojina 

Cercospora sp. J 

C. ricinella 

C. delaireae sp. nov. 

Cercospora sp. K 

C. cf. flagellaris Clade 1 


135


CBS 113127 Eichhornia crassipes USA 

4 CPC 10079 Trachelium sp. Israel 

CPC 10684 Phytolacca americana South Korea 

CPC 14723 Phytolacca americana South Korea 

2 CPC 10124 Phytolacca americana South Korea 

CPC 5055 Bromus sp. 

MUCC 127 Cosmos sulphureus Japan 

CPC 10722 Amaranthus patulus South Korea 

2 CPC 14487 Sigesbeckia pubescens South Korea 

MUCC 831 Hydrangea serrata Japan 

CPC 1051 Populus deltoides South Africa 

1 

CPC 1052 Populus deltoides South Africa 

MUCC 574 Capsicum annuum Japan 

CPC 12307 Capsicum annuum South Korea 

CPC 14520 Capsicum annuum South Korea 

CBS 118712 Fiji Islands 

3 

CPC 5082 Coronilla varia Romania 

CPC 5056 Erysimum cuspidatum Romania 

CPC 5090 Berteroa incana Romania 

2 CPC 5060 Cardaria draba Romania 

CPC 5061 Cardaria draba Romania 

CPC 5261 Nasturtium officinale New Zealand 

2 

CPC 11530 Acacia mangium Thailand 

1 CPC 11338 Turritis glabra South Korea 

2 

CPC 11364 Turritis glabra South Korea 

CPC 10100 Barbarea orthoceras South Korea 

CPC 5088 Armoracia rusticana Romania 

3 CPC 10811 Armoracia rusticana South Korea 

MUCC 768 Armoracia rusticana Japan 

1 

CPC 14612 Rorippa indica South Korea 

CPC 10133 Rorippa indica South Korea 

CPC 5359 Armoracia rusticana New Zealand 

CPC 5366 Gaura sp. New Zealand 

CPC 5439 Rumex sanguineus New Zealand 

CPC 5114 Crepis capillaris New Zealand 

CPC 10790 Althaea rosea South Korea 

CPC 5066 Malva sp. 

CPC 5117 Althaea rosea Romania 

2 CPC 3955 Trifolium pratense Canada 

CBS 118789 Trifolium subterraneum Australia 

CBS 118790 Trifolium subterraneum Australia 

CPC 10901 Hebe sp. New Zealand 

CBS 118791 Trifolium cernuum Australia 

CPC 5118 Hedysarum coronarium Italy 

4 CPC 5437 Lotus pedunculatus New Zealand 

CPC 5473 Jacaranda mimosifolia New Zealand 

CPC 5089 Astragalus spruneri Romania 

CPC 5091 Medicago arabica 

CPC 10756 Trifolium repens South Korea 

CPC 5367 Trifolium repens New Zealand 

4 CPC 5078 Trifolium subterraneum USA 

CPC 3957 Trifolium repens Canada 

CPC 3958 Trifolium repens Canada 

MUCC 133 Viola sp. Japan 


CPC 5368 Viola odorata New Zealand 


CPC 5079 Viola tricolor Romania 


= 1.000 

= 0.950 to 0.999 

1 = 0.900 to 0.949 

2 = 0.800 to 0.899 

3 = 0.700 to 0.799 

4 = 0.500 to 0.699 

0.8 

C. cf. flagellaris Clade 2 

C. capsici 

C. armoraciae 

C. rumicis 

Cercospora sp. L 

C. althaeina 

C. zebrina 

C. violae 

Fig. 2. (Part 3). 

136


1 

1 

CPC 14549 Zinnia elegans South Korea 

CPC 15075 Brazil 

MUCC 572 Zinnia elegans Japan 

MUCC 131 Zinnia elegans Japan 

MUCC 442 Ipomoea aquatica Japan 

CPC 10833 Ipomoea nil South Korea 

CPC 10102 Persicaria thunbergii South Korea 

3 

1 

2 2 

1 

1 

3 

2 

CPC 10725 Viola mandshurica South Korea 

CPC 10109 Fallopia dumentorum South Korea 

MUCC 866 Hibiscus syriacus Japan 

MUCC 130 Cosmos bipinnata Japan 

CPC 14541 Fagopyrum esculentum South Korea 

CPC 14546 Cercis chinensis South Korea 

CPC 5259 Alchemilla mollis New Zealand 

CPC 5126 Oenothera fruticosa New Zealand 

CPC 5127 Gaura lindheimeri New Zealand 


4 

1 

CBS 113123 Eichhornia crassipes Brazil 

CBS 113124 Eichhornia crassipes Mexico 

CBS 113131 Eichhornia crassipes Venezuela 

CBS 113125 Eichhornia crassipes Zambia 

CBS 113126 Eichhornia crassipes Brazil 




CPC 12684 Musa sp. Bangladesh 

MUCC 138 Fuchsia xhybrida Japan 

MUCC 582 Gerbera hybrida Japan 

3 

MUCC 132 Osteospermum sp. Japan 

MUCC 578 Zantedeschia sp. Japan 

MUCC 128 Tagetes erecta Japan 

CPC 14680 Ajuga multiflora South Korea 

MUCC 590 Glycine soja Japan 


CPC 5067 Glycine soja Japan 

CPC 5068 Glycine soja Japan 

MUCC 587 Begonia sp. Japan 

MUCC 849 Dioscorea tokoro Japan 

MUCC 589 Glycine max Japan 


CPC 10664 Sigesbeckia glabrescens South Korea 

CPC 10117 Persicaria orientalis South Korea 

CPC 10740 Paulownia coreana South Korea 

CPC 14489 Sigesbeckia pubescens South Korea 

1 

CPC 14726 Malva verticillata South Korea 

CPC 18636 Musa sp. Thailand 

MUCC 575 Cucumis melo Japan 

MUCC 787 Mallotus japonicus Japan 

CPC 15827 Ricinus communis Mexico 

CPC 4001 Citrus ×sinensis Swaziland 

CPC 4002 Citrus ×sinensis Swaziland 

CPC 5328 Cajanus cajan South Africa 

1 



CPC 3949 Citrus ×sinensis South Africa 



CPC 11638 Dioscorea bulbifera Papua New Guinea 


4 



= 1.000 

= 0.950 to 0.999 

1 = 0.900 to 0.949 

2 = 0.800 to 0.899 

3 = 0.700 to 0.799 

4 = 0.500 to 0.699 

0.8 

C. cf. zinniae 

C. cf. ipomoeae 

C. fagopyri 

C. alchemillicola 

C. cf. alchemillicola 

Cercospora sp. M 

C. rodmanii 

Cercospora sp. N 

C. cf. richardiicola 

C. kikuchii 

C. cf. sigesbeckiae 

Cercospora sp. O 

C. cf. malloti 

Cercospora sp. P 

Fig. 2. (Part 4). 


137


CPC 11637 Dioscorea rotundata Papua New Guinea 

CPC 5262 Hibiscus sabdariffa New Zealand 

3 CPC 3947 Citrus sp. Swaziland 

CPC 3945 Citrus sp. Swaziland 

CPC 3946 Citrus sp. Swaziland 

CPC 11635 Dioscorea nummularia Papua New Guinea 

MUCC 771 Coffea arabica Japan 

2 CPC 10526 Acacia mangium Thailand 




4 




CPC 11636 Dioscorea esculenta Papua New Guinea 

1 


CPC 15807 Phaseolus vulgaris Mexico 

3 

CPC 15850 Taraxacum sp. Mexico 

CPC 15875 Euphorbia sp. Mexico 





2 




0.8 


CPC 15844 Euphorbia sp. Mexico 

4 



CPC 10831 Polygonatum humile South Korea 

CPC 10773 Disporum viridescens South Korea 

2 

MUCC 585 Corchorus olitorius Japan 

CBS 114644 Myoporum laetum New Zealand 

4 CPC 10656 Crepidiastrum denticulatum South Korea 

2 CPC 10082 Ixeris chinensis subsp. strigosa South Korea 

CPC 10728 Ixeris chinensis subsp. strigosa South Korea 

MUCC 570 Lactuca sativa Japan 

MUCC 571 Lactuca sativa Japan 

MUCC 716 Helianthus tuberosus Japan 

MUCC 588 Ipomoea pes-caprae Japan 



MUCC 584 Psophocarpus tetragonolobus Japan 

4 1 MUCC 576 Citrullus lanatus Japan 

MUCC 577 Momordica charanthia Japan 

CPC 15918 Glycine max Mexico 

CPC 5075 Nicotiana tabacum Nigeria 

CPC 5076 Nicotiana tabacum Indonesia 

3 CPC 11598 Geranium thunbergii South Korea 

MUCC 732 Datura stramonium Japan 

2 CBS 118793 Reseda odorata New Zealand 

3 

CPC 5057 Helianthemum sp. Romania 

3 CPC 5083 Plumbago europaea Romania 

CPC 5087 Apium graveolens Romania 

4 CPC 5063 Beta vulgaris Netherlands 

4 CPC 5119 Beta vulgaris Hungary 

CPC 5073 Beta vulgaris Austria 

MUCC 923 Asparagus officinalis Japan 


= 1.000 

= 0.950 to 0.999 

1 = 0.900 to 0.949 

2 = 0.800 to 0.899 

3 = 0.700 to 0.799 

4 = 0.500 to 0.699 


(continued) 

Cercospora sp. Q 

C. chinensis 

C. dispori 

C. corchori 

Cercospora sp. R 

Cercospora sp. S 

C. lactucae-sativae 

C. cf. helianthicola 

C. cf. citrulina 

C. cf. nicotianae 

C. cf. brunkii 

C. cf. resedae 

C. apii 

Fig. 2. (Part 5). 

138


CPC 5260 Glebionis coronaria New Zealand 

MUCC 573 Glebionis coronaria Japan 

CPC 5084 Plantago lanceolata Romania 

CPC 16663 Moluccella laevis Zimbabwe 

CPC 5111 Moluccella laevis USA 

CPC 5110 Moluccella laevis USA 

CPC 5112 Moluccella laevis New Zealand 

CPC 10924 Apium graveolens Italy 

CPC 10923 Apium graveolens Italy 

MUCC 593 Apium graveolens Japan 

4 

MUCC 567 Apium graveolens Japan 

CPC 18601 Apium graveolens USA 

CPC 10925 Apium sp. Austria 

4 

CPC 5086 Apium graveolens 

4 CPC 11579 Apium graveolens Germany 

CPC 11556 Apium graveolens Germany 

CPC 11582 Apium graveolens Germany 

CBS 117.47 Beta vulgaris Czech Republic 

CPC 5062 Beta vulgaris Romania 

CPC 12031 Beta vulgaris Germany 

3 CPC 10166 Beta vulgaris New Zealand 


CPC 10195 Beta vulgaris New Zealand 


CPC 18813 Beta vulgaris USA 

MUCC 569 Beta vulgaris Japan 

CPC 12030 Beta vulgaris Egypt 

CPC 11581 Beta vulgaris Netherlands 


CPC 14618 Goniolimon tataricum Bulgaria 

CPC 5069 Beta vulgaris 



CPC 11557 Beta vulgaris Italy 

CPC 5065 Malva pusilla Romania 


CPC 5113 Limonium sinuatum New Zealand 




CPC 11578 Beta vulgaris Italy 

4 CPC 5070 Beta vulgaris Romania 





CPC 5123 Apium graveolens New Zealand 

CPC 11580 Beta vulgaris France 


CPC 11576 Beta vulgaris Iran 

CPC 5074 Beta vulgaris Netherlands 

MUCC 568 Beta vulgaris Japan 


CPC 5071 Beta vulgaris Spain 


CPC 11344 Chrysanthemum segetum South Korea 

CPC 11341 Chrysanthemum segetum South Korea 

CPC 5370 Spinacia sp. Botswana 

CPC 5369 Spinacia sp. Botswana 


1 CPC 15623 Beta vulgaris Mexico 


C. apii (continued) 

C. beticola Clade 1 

C. beticola Clade 2 


= 1.000 

= 0.950 to 0.999 

1 = 0.900 to 0.949 

2 = 0.800 to 0.899 

3 = 0.700 to 0.799 

4 = 0.500 to 0.699 

0.8 

Fig. 2. (Part 6). 


139


Table 3. Results from screening Cercospora sp. Q strains with additional loci. The percentage similarity was calculated relative to strain CPC 5325, for which sequences were generated for all loci. The number 

of nucleotides used for the calculation of the similarity is shown in front of the percentage. For abbreviations of loci see Table 1 and in addition: GAPDH: partial glyceraldehyde-3-phosphate dehydrogenase gene; 

mtSSU: partial mitochondrial small rRNA gene; CHS: partial chitin synthase gene; TUB: partial beta-tubulin gene; Mcm7: partial gene encoding a mini-chromosome maintenance protein. 

Original name Culture accession 

number(s) 

Host name Percentage similarity and allele group (I-VI) designation per locus GenBank accession numbers 

GAPDH mtSSU CHS TUB Mcm7 (GAPDH, mtSSU, CHS, TUB, Mcm7) 

Cercospora apii CBS 113997; CPC 5325 Cajanus cajan 979 nt I 573 nt I 299 nt I 597 nt I 501 nt I JX142521, JX142504, JX142487, JX142478, 

JX142473 

Cercospora apii CBS 115410; CPC 5331 Cajanus cajan 966 nt (100 %) I 573 nt (100 %) I 299 nt (100 %) I 597 nt (99 %) I — JX142522, JX142505, JX142488, JX142479, — 

Cercospora apii CBS 115411; CPC 5332 Cajanus cajan 966 nt (100 %) I 573 nt (100 %) I 299 nt (100 %) I 597 nt (99 %) III — JX142523, JX142506, JX142489, JX142480, — 

Cercospora apii CBS 115412; CPC 5333 Cajanus cajan 966 nt (100 %) I 573 nt (100 %) I 299 nt (100 %) I 322 nt (9,9 %) III — JX142524, JX142507, JX142490, JX142481, — 

Cercospora apii CBS 115536; CPC 5329 Cajanus cajan 970 nt (95 %) V 573 nt (100 %) I 299 nt (99 %) II 597 nt (99 %) II — JX142525, JX142508, JX142491, JX142482, — 

Cercospora apii CBS 115537; CPC 5330 Cajanus cajan 970 nt (95 %) V 573 nt (100 %) I 299 nt (99 %) II 597 nt (99 %) II — JX142526, JX142509, JX142492, JX142483, — 

Cercospora acaciae-mangii CPC 10550 Acacia mangium 979 nt (100 %) I 573 nt (100 %) I 299 nt (99 %) II 450 nt (99 %) I 501 nt (99 %) II JX142533, JX142516, JX142499, JX142484, 

JX142475 

Cercospora acaciae-mangii CPC 10551 Acacia mangium 979 nt (99 %) I 573 nt (100 %) I 299 nt (99 %) II — 501 nt (99 %) III JX142534, JX142517, JX142500, —, JX142476 

Cercospora sp. 2 CBS 132656; CPC 11536 Acacia mangium 961 nt (96 %) III 573 nt (100 %) I 299 nt (99 %) II — — JX142527, JX142510, JX142493, —, — 

Cercospora sp. 2 CPC 11539 Acacia mangium 958 nt (96 %) III 573 nt (100 %) I 299 nt (99 %) II — — JX142535, JX142518, JX142501, —, — 

Cercospora dioscoreaepyrifoliae 



CBS 132661; CPC 11634; 

PNG-002 


PNG-016 

Dioscorea rotundata 970 nt (95 %) VI 573 nt (100 %) I 298 nt (99 %) II — 458 nt (99 %) III JX142528, JX142511, JX142494, —, JX142474 

Dioscorea esculenta 969 nt (96 %) IV 573 nt (100 %) I 299 nt (99 %) II — — JX142529, JX142512, JX142495, —, — 

CPC 11639; PNG-037 Dioscorea rotundata 969 nt (95 %) VI 573 nt (100 %) I 299 nt (99 %) II — — JX142536, JX142519, JX142502, —, — 

Cercosporoid CBS 132679; CPC 15807 Phaseolus vulgaris 954 nt (100 %) I 573 nt (100 %) I 299 nt (99 %) III — — JX142530, JX142513, JX142496, —, — 

Cercospora sp. CBS 132681; CPC 15844 Euphorbia sp. 956 nt (96 %) III 573 nt (100 %) I 299 nt (99 %) III — — JX142531, JX142514, JX142497, —, — 

Cercospora sp. CBS 132682; CPC 15850 Taraxacum sp. 960 nt (100 %) I 573 nt (100 %) I 299 nt (99 %) II — — JX142532, JX142515, JX142498, —, — 

Cercospora sp. CPC 15875 Euphorbia sp. 955 nt (99 %) II 573 nt (100 %) I 299 nt (99 %) III 597 nt (99 %) III — JX142537, JX142520, JX142503, JX142485, — 

Septoria provencialis 

(outgroup) 

CBS 118910; CPC 12226 Eucalyptus sp. 885 nt (87 %) — — 502 nt (82 %) 499 nt (81 %) JX142538, —, —, JX142486, JX142477 

Number of identical sequences (excl. outgroup): 6 of 17 17 of 17 4 of 17 0 of 8 0 of 4 

140



Original name Culture accession 

number(s) 

Host name Percentage similarity and allele group (I-VI) designation per locus GenBank accession numbers 

ITS TEF ACT CAL HIS (ITS, TEF, ACT, CAL, HIS) 

Cercospora apii CBS 113997; CPC 5325 Cajanus cajan 481 nt I 306 nt I 221 nt I 312 nt I 378 nt I JX143717, JX143476, JX143230, JX142984, 

JX142738 

Cercospora apii CBS 115410; CPC 5331 Cajanus cajan 481 nt (100 %) I 280 nt (100 %) I 194 nt (100 %) I 280 nt (100 %) I 378 nt (100 %) I JX143718, JX143477, JX143231, JX142985, 

JX142739 


JX142740 


JX142741 

Cercospora apii CBS 115536; CPC 5329 Cajanus cajan 481 nt (100 %) I 280 nt (100 %) I 194 nt (100 %) I 278 nt (100 %) I 378 nt (98 %) III JX143721, JX143480, JX143234, JX142988, 

JX142742 

Cercospora apii CBS 115537; CPC 5330 Cajanus cajan 481 nt (100 %) I 280 nt (100 %) I 194 nt (100 %) I 280 nt (100 %) I 378 nt (98 %) III JX143722, JX143481, JX143235, JX142989, 

JX142743 

Cercospora acaciae-mangii CPC 10550 Acacia mangium 481 nt (99 %) II 306 nt (100 %) I 221 nt (99 %) II 312 nt (100 %) I 377 nt (99 %) IV AY752139, AY752172, AY752200, AY752231, 

AY752262 

Cercospora acaciae-mangii CPC 10551 Acacia mangium 481 nt (99 %) II 306 nt (100 %) I 221 nt (99 %) IV 305 nt (100 %) I 377 nt (100 %) I AY752140, AY752173, AY752201, AY752232, 

AY752263 

Cercospora sp. 2 CBS 132656; CPC 11536 Acacia mangium 473 nt (99 %) III 306 nt (100 %) I 221 nt (99 %) IV 312 nt (100 %) I 378 nt (99 %) IV JX143723, JX143482, JX143236, JX142990, 

JX142744 

Cercospora sp. 2 CPC 11539 Acacia mangium 481 nt (99 %) III 306 nt (100 %) I 221 nt (99 %) IV 312 nt (100 %) I 378 nt (98 %) V JX143729, JX143488, JX143242, JX142996, 

JX142750 





PNG-002 


PNG-016 

Dioscorea rotundata 481 nt (99 %) III 284 nt (100 %) I 221 nt (99 %) II 297 nt (100 %) I 378 nt (99 %) VI JX143724, JX143483, JX143237, JX142991, 

JX142745 

Dioscorea esculenta 481 nt (99 %) III 306 nt (100 %) I 221 nt (99 %) II 303 nt (100 %) I 378 nt (99 %) VI JX143725, JX143484, JX143238, JX142992, 

JX142746 

CPC 11639; PNG-037 Dioscorea rotundata 481 nt (99 %) II 306 nt (100 %) I 221 nt (99 %) II 303 nt (100 %) I 378 nt (99 %) II JX143730, JX143489, JX143243, JX142997, 

JX142751 

Cercosporoid CBS 132679; CPC 15807 Phaseolus vulgaris 481 nt (99 %) II 294 nt (99 %) II 220 nt (99 %) III 312 nt (100 %) I 376 nt (99 %) VI JX143726, JX143485, JX143239, JX142993, 

JX142747 

Cercospora sp. CBS 132681; CPC 15844 Euphorbia sp. 481 nt (99 %) III 294 nt (99 %) II 220 nt (99 %) III 312 nt (99 %) II 376 nt (100 %) I JX143727, JX143486, JX143240, JX142994, 

JX142748 

Cercospora sp. CBS 132682; CPC 15850 Taraxacum sp. 481 nt (99 %) II 294 nt (99 %) II 220 nt (99 %) III 312 nt (100 %) I 377 nt (100 %) VI JX143728, JX143487, JX143241, JX142995, 

JX142749 

Cercospora sp. CPC 15875 Euphorbia sp. 481 nt (99 %) III 294 nt (99 %) II 220 nt (99 %) III 312 nt (100 %) I 378 nt (99 %) VI JX143731, JX143490, JX143244, JX142998, 

JX142752 

Septoria provencialis 

(outgroup) 

CBS 118910; CPC 12226 Eucalyptus sp. 483 nt (98 %) 317 nt (75 %) 227 nt (87 %) 329 nt (81 %) 386 nt (93 %) DQ303096, JX143522, JX143276, JX143030, 

JX142784 

Number of identical sequences (excl. outgroup): 6 of 17 13 of 17 6 of 17 16 of 17 7 of 17 


141


Evaluation of additional loci 

Isolates of Cercospora sp. Q were compared using the five loci used 

for the combined phylogeny and five additional loci as explained in 

the Materials and Methods. The results are summarised in Table 3 

and detailed per locus below: 

ITS — Three allele groups are identified based on sequence 

identity. The variation in this locus is based on nucleotide changes 

at only two positions in the second internal transcribed spacer 

(transitions at positions 451 and 453 compared to the sequence of 

isolate CPC 5325). Although allele group I was confined to isolates 

from Cajanus (Fabaceae), the other two groups were intermixed 

amongst the remaining host genera. 

TEF — Two allele groups are identified based on sequence identity. 

The variation in this locus is based on a single nucleotide change 

(transitions at position 289 compared to the sequence of isolate 

CPC 5325). Although allele group I was confined to isolates from 

Acacia (Fabaceae), Cajanus, and Dioscorea (Dioscoreaceae), the 

other group represents the remaining host genera. 

ACT — Four allele groups are identified based on sequence identity. 

The variation in this locus is based on nucleotide changes at three 

positions (transitions at positions 143, 166 and 173 compared to 

the sequence of isolate CPC 5325). Allele group I was confined 

to isolates from Cajanus, and allele group II is mainly limited to 

Dioscorea (except for one isolate from Acacia), allele group IV is 

limited to the remaining isolates from Acacia, and the remaining 

host genera belong to allele group III. 

CAL — Two allele groups are identified based on sequence identity. 

The variation in this locus is based on a single nucleotide change (a 

transition at position 76 compared to the sequence of isolate CPC 

5325). This single nucleotide change only occurred in isolate CPC 

15844; the rest of the isolates had identical CAL sequences. 

HIS — Six allele groups are identified based on sequence identity. 

The variation in this locus is based on nucleotide changes at 10 

positions (transitions at positions 106, 112, 148, 149, 178, 205, 238, 

301 and 364, as well as a transversion at position 245 compared 

to the sequence of isolate CPC 5325). Allele group II differs from 

allele group I by a unique change of C to T at position 364 and 

allele group V differs from allele group IV by a unique change of A 

to T at position 245. Even if allele group I and II and group IV and 

V are taken as combined groups, isolates from different hosts are 

intermixed and no clear association of host with allele group, as 

with the loci mentioned above, is possible. 

GAPDH — Six allele groups are identified based on sequence 

identity. The variation in this locus is based on numerous nucleotide 

changes (transitions at positions 44, 48–49, 52–53, 56, 63–69, 110, 

122, 149, 158, 206, 257, 287, 329, 335, 395, 440, 479, 530, 533, 

566, 593, 596, 608, 647, 650, 674, 720, 731, 740, 747, 780, 789, 

791–792, 794, 804–806, 808–809, 811–812, 817, 821–822, 824, 

830, 834, 837, 839–840, 842–844, 846, 848, 852, 856, 874, 922 

and 958, transversions at positions 49, 66, 233, 767, 785, 787–789, 

792, 795, 797, 798, 806, 810–811, 814, 818–819, 821, 831, 833, 

843, 848–849, 865 and 883, indels at positions 67, 101 and 803, as 

well as another indel spanning 801–811, compared to the sequence 

of isolate CPC 5325). Allele group II differs from allele group I by a 

unique change of C to T at position 530. This locus represents the 

largest number of nucleotide substitutions of all the loci included for 

Cercospora sp. Q in this study, and therefore has high potential for 

species discrimination. However, if each allele group is accepted 

as a distinct species, it would result in a huge proliferation of taxa 

within this group. 

mtSSU — Only one allele group is identified based on sequence 

identity. No variation was observed over the 573 nucleotides 

sequences for the selected isolates. 

CHS — Three allele groups are identified based on sequence 

identity. The variation in this locus is based on nucleotide changes 

at only three positions (transitions at positions 91, 100 and 217 

compared to the sequence of isolate CPC 5325). Allele group I 

includes four of the six isolates from Cajanus and allele group III 

includes the isolates from Phaseolus (Fabaceae) and Euphorbia 

(Euphorbiaceae); the remaining isolates belong to allele group II. 

TUB — This locus failed to amplify easily, even when several 

different primer combinations were tested. Three allele groups are 

identified based on sequence identity. The variation in this locus 

is based on nucleotide changes at six positions (transitions at 

positions 147 and 396, transversions at positions 172, 189, 213 

and 591 compared to the sequence of isolate CPC 5325). The 

majority of sequences were obtained for the isolates from Cajanus, 

and these isolates end up belonging into all three allele groups. 

Mcm7 — This locus failed to amplify easily, even when both 

available primer combinations were tested. Three allele groups are 

identified based on sequence identity. The variation in this locus 

is based on nucleotide changes at six positions (transitions at 

positions 60, 86, 263, 365 and 470, and a transversion at position 

89, compared to the sequence of isolate CPC 5325). Due to the 

small number of successful sequences, a clear conclusion cannot 

be drawn from this dataset and it was not possible to distinguish 

between the isolates from Acacia and Dioscorea. 

TAXONOMY 

In this paper, a polyphasic approach was taken and species are 

discussed and/or described with consideration to the following 

factors: 

Phylogenetic analyses: Based on the clustering and support in the 

Bayesian tree obtained from the combined ITS, TEF, ACT, CAL and 

HIS alignment (Fig. 2). All genes were also assessed individually 

(data not shown; discussed where applicable in the species notes). 

Morphological characteristics: A few morphological characteristics 

effectively distinguished species (Fig. 3). These are: conidiophores 

(uniform, irregular, attenuated, truncate, long or short obconically 

truncate), conidiogenous cells (terminal, intercalary), loci (apical, 

lateral, circumspersed (all around the conidiogenous cell; 

Hennebert & Sutton 1994); uni-local (single, terminal locus), multilocal 

(multiple loci); thickness, absence of protuberant loci), and 

conidia (dimensions, shape, hilum morphology). 

A diagnostic characteristic of species with wide host ranges 

was circumspersed loci on tenuous conidiophores, whereas the 

species with narrow host ranges had a few distinct apical or lateral 

142


Fig. 3. Overview of morphological structures. A. Fasciculate conidiophores situated on a stroma. B. Conidiophores reduced to uni-local conidiogenous cells. C. Conidiophores 

arising from a weakly developed stroma. D. Fasciculate conidiophore with flexuous conidiophores. E. Conidiophores arising from external mycelium. F. Thickened, darkened and 

somewhat refractive conidial loci (arrows). G. Conidiogenous cells with multi-local loci. H. Fascicle erumpent through stoma. I. Cylindrical conidium with obtuse apex. J. Filiform 

conidium. K, L. Acicular, undulate conidia with subobtusely rounded apices, and truncate bases. M–O. Obclavate conidia with subobtusely rounded apices and obconically 

truncate bases. P. Subcylindical conidium with long obconically truncate base. 

loci on moderately thick-walled to thick-walled conidiophores. 

These characteristics were preserved, even when the fungus was 

cultivated on agar medium. 

The Bayesian analysis resulted in 73 species clades mapped 

onto the phylogenetic tree (Fig. 2); 34 of these were assigned to 

an existing species name, 15 more were morphologically similar 

to existing species but names could not be applied without doubt 

(indicated with “cf.” in the species name, see species notes below), 

a further 19 could not be named unequivocally (“Cercospora spp. 

A–S”) and novel species are introduced below for the remaining 

five clades. 

Cercospora achyranthis Syd. & P. Syd., Ann. Mycol. 7: 171. 

1909. 

Caespituli amphigenous, mainly hypophyllous. Mycelium internal. 

Stromata lacking or composed of a few brown cells, intraepiderimal 

or substomatal. Conidiophores thick-walled, dark brown, arising from 


143


internal hyphae or a few brown cells, solitary, or in loose fascicles 

(2–5), straight, sinuous to distinctly geniculate, flexuous, almost 

uniform in width, somewhat wider at the apex, often constricted at 

septa and proliferating point, conical at the apex, simple, sometimes 

branched, 31–340 × 4.5–6 µm, 2–20-septate. Conidiogenous cells 

integrated, terminal and intercalary, proliferating sympodially, 

multi-local; loci distinctly thickened, darkened, slightly to distinctly 

protuberant, apical or formed on shoulders caused by geniculation, 

2–3 µm diam. Conidia solitary, subhyaline, acicular, cylindrical 

to cylindro-obclavate, straight to slightly curved, long obconically 

truncated and thickened at the base, obtuse at the apex, rarely 

constricted at the septa, 33–172 × 3.5–8 µm, 3–20-septate. 

Specimens examined: South Korea, Jeju, on Achyranthes japonica 

(Amaranthaceae), 14 Sep. 2002, H.D. Shin, CBS H-20983, CPC 10088–10091; on 

A. japonica, 13 Nov. 2003, H.D. Shin, CBS H-20984, CBS 132613 = CPC 10879, 

CPC 10880–10881. 

Notes: This species is characterised by conidiophores with a 

thickened, dark brown wall, vary in shape, often constricted at septa, 

and conical at the apex, sometimes branched, and longer than in 

most other species (31–340 × 4.5–6 µm, 2–20-septate). The conidia 

of C. achyranthis are not hyaline, but subhyaline to pale olivaceous 

and have rather small hila (ca. 2 µm wide), which are reminiscent 

of the genus Passalora. Nevertheless, it is a true Cercospora. 

Cercospora achyranthis is supported by ACT. The TEF and CAL 

phylogenies fail to discriminate C. sojina (also with subhyaline 

conidia and small hila) from C. achyranthis. On the HIS phylogeny, it 

is indistinguishable from C. polygonaceae, to which it is also a sister 

taxon in the combined tree (Fig. 2 part 2). The name C. achyranthis is 

based on Japanese material, and fresh collections from Japan would 

be required to designate an epitype for this taxon. 

Cercospora agavicola Ayala-Escobar, Mycotaxon 93: 117. 

2005. 

Specimen examined: Mexico, State of Guanajuato, Penjamo, on Agave tequilana 

var. azul (Agavaceae), Jan. 2003, V. Ayala-Escobar and Ma. de Jesús Yáñez- 

Morales, holotype CHAPA # 166, isotype HAL 1839 F, culture ex-type CBS 117292 

= CPC 11774. 

Notes: Cercospora agavicola is characterised by large stromata 

and consistently cylindrical conidia, often with swollen tips (Ayala- 

Escobar et al. 2005). In this study using a larger dataset, it is also 

clear that C. agavicola, which is supported by TEF, ACT, CAL 

and HIS regions, is genetically distinct from the other Cercospora 

species studied. In the combined tree (Fig. 2 part 1), it is a sister 

taxon to C. cf. coreopsidis. 

Cercospora alchemillicola U. Braun & C.F. Hill, Mycol. 

Progr. 1: 19. 2002. 

Specimens examined: New Zealand, Auckland, Western Springs Gardens, on 

Alchemilla mollis (Rosaceae), 23 Jul. 2000, C.F. Hill, Lynfield 236 (holotype HAL, 

isotype PDD 73031); on A. mollis, C.F. Hill, Lynfield 564, epitype designated here 

CBS H-20985, culture ex-epitype CPC 5259. 

Notes: Sequences from New Zealand on hosts of Onagraceae 

(Gaura, isolate CPC 5127, and Oenothera, isolate CPC 5126) 

are slightly distinct from that derived from Alchemilla (Rosaceae). 

The collections on Onagraceae (C. cf. alchemillicola) are also 

morphologically different from C. alchemillicola, and represent 

an undescribed species. The three isolates are identical to one 

another on the TEF, ACT, CAL and HIS phylogenies but also to 

some other species, e.g. to Cercospora sp. I, C. cf. physalidis and 

C. celosiae based on the TEF phylogeny, and Cercospora sp. I 

and C. cf. physalidis based on the ACT phylogeny. A similar mix 

is observed in the HIS phylogeny with Cercospora sp. I and C. 

celosiae and in the CAL phylogeny with Cercospora spp. M, O, P, 

Q and C. cf. sigesbeckiae. In the combined tree (Fig. 2 part 4), the 

three isolates represent sister taxa. 

Cercospora cf. alchemillicola 

Specimens examined: New Zealand, Auckland City, Albert Park, on Gaura 

lindheimeri (Onagraceae), C.F. Hill, Lynfield 545, CPC 5127; on Oenothera fruticosa 

(Onagraceae), C.F. Hill, Lynfield 541, CPC 5126. 

Notes: Cercospora on Gaura and Oenothera in New Zealand cannot 

be distinguished on the individual gene trees from C. alchemillicola 

(see species notes under that species above) described from New 

Zealand on Alchemilla mollis (Braun & Hill 2002). We consider the 

latter two isolates to represent a distinct species, which cannot 

be formally named due to the absence of good specimens. In the 

combined tree (Fig. 2 part 4), it is a sister taxon to C. alchemillicola. 

Cercospora althaeina Sacc., Michelia 1: 269. 1878. 

= Cercospora kellermanii Bubák, J. Mycol. 9: 3. 1903. 

= Cercospora althaeina var. praecincta Davis, Trans. Wisconsin Acad. Sci. 18: 

260. 1915. 

≡ Cercospora praecincta (Davis) Chupp, A monograph of the fungus 

genus Cercospora: 376. 1954. 

= Cercospora ramularia Siemaszko, Izv. Kavkazsk. Muz.12: 28. 1919, and 

Arch. Nauk Biol. Towarz. Nauk. Warszawsk. 1: 49. 1923. 

≡ Cercosporina ramularia (Siemaszko) Sacc., Syll. Fung. 25: 910. 1931. 

= Cercospora althaeina var. althaeae-officinalis Săvul. & Sandu, Hedwigia 73: 

127. 1933. 

= Cercospora althaeicola J.M. Yen & S.K. Sun, Cryptog. Mycol. 4: 189. 1983. 

Leaf spots distinct, angular to irregular, mostly vein-limited, 

olivaceous-brown, sometimes greyish brown with dark brown 

margin, centre becoming pale grey with black dots (= stroma 

with conidiophores). Caespituli amphigenous, mostly epiphyllous. 

Mycelium internal. Stromata well-developed, emerging through 

stomatal openings or erumpent through the cuticle. Conidiophores 

in divergent fascicles (6–12), pale olivaceous-brown at the base, 

paler upwards, 0–3-septate, straight to mildly curved, 32–90 × 

4–6.5 µm, conically narrowed at the apex; loci 1.5–2 µm wide, 

conspicuous, apical or on shoulders formed by geniculation. 

Conidia solitary, obclavate-cylindrical to filiform, not acicular, 

straight to mildly curved, hyaline, 1–10-septate, obtuse at the apex, 

subtruncate or obconically truncate at the base, 40–140 × 3.5–5 

µm (adapted from Shin & Kim 2001). 

Specimens examined: Italy, Selva, on Althaea rosea, 1876, holotype in PAD. 

Romania, Fundulea, on A. rosea, O. Constantinescu, epitype designated here 

CBS H-9811, culture ex-epitype CBS 248.67 = CPC 5117. Unknown, on Malva 

sp. (Malvaceae), C. Killian, CBS 126.26 = CPC 5066, (as C. malvacearum). South 

Korea, Suwon, on Althaea rosea (Malvaceae), 14 Oct. 2003, H.D. Shin, CBS 

H-20986, CBS 132609 = CPC 10790. 

Notes: A true Cercospora s. str. close to C. apii s. lat., but 

distinguished by obclavate-cylindrical conidia with obconically 

truncate bases (Crous & Braun 2003). Although only weakly 

supported as distinct from C. armoraciae, we suspect that the 

isolate from Malva sp. represents a different taxon. Further isolates 

and pathogenicity studies are needed to test this hypothesis. The 

species is distinguished in the TEF and ACT phylogenies but 

cannot be distinguished from C. zebrina, Cercospora sp. L and 

144


C. rumicis based on the CAL phylogeny. In the HIS phylogeny the 

three isolates are not identical to any other species but the isolate 

from Malva sp. clusters distinct from the two A. rosea isolates which 

form a sister clade to C. chenopodii. In the combined tree (Fig. 2 

part 3), it is a sister taxon to C. zebrina. 

Cercospora apii Fresen., emend. Groenewald et al. 

Phytopathology 95: 954. 2005. 

Caespituli amphigenous. Mycelium internal. Stromata lacking or 

small, up to 32 µm diam, brown, substomatal or intraepidermal. 

Conidiophores arising from upper part of stromata or internal 

hyphae, solitary to 2–8, in loose to dense fascicles, brown, paler 

towards the apex, simple, mildly sinuous, moderately thick-walled 

to thick-walled, straight or once abruptly geniculate caused by 

sympodial proliferation, slightly curved, uniform in width, wider at 

the base, short conically truncate or truncate at the apex, 12.5–160 

× 5–8 µm. Conidiogenous cells integrated, terminal or intercalary, 

proliferating sympodially, chiefly uni-local; loci distinctly thickened, 

not or slightly protuberant, 2–4 µm diam, apical or formed on 

the shoulder caused by sympodial proliferation. Conidia solitary, 

hyaline, cylindro-obclavate when shorter, longer conidia usually 

acicular, straight to slightly curved, subacute to obtuse at the apex, 

truncate to obconically truncate and thickened at the base, 35–120 

× 3.5–5 µm, 3–10-septate. 

Specimens examined: Austria, Wien, on Beta vulgaris (Chenopodiaceae), Jun. 

1931, E.W. Schmidt, CBS 121.31 = CPC 5073; on Apium sp. (Apiaceae), 28 Aug. 

2003, Institut fur Pflanzengesundheit, CBS 114416 = CPC 10925. Germany, 

Landwirtschaftsamt, Heilbron, on Apium graveolens (Apiaceae), K. Schrameyer, 

culture ex-type CBS 116455 = CPC 11556; CBS 116504 = CPC 11579; CBS 116507 

= CPC 11582. Hungary, on B. vulgaris, Jun. 1931, E.W. Schmidt, CBS 127.31 = 

CPC 5119. Italy, on A. graveolens, M. Meutri, CBS 114418 = CPC 10924; CBS 

114485 = CPC 10923. Japan, Aichi, on A. graveolens, 1 Nov. 1995, T. Kobayashi, 

MUCC 567 = MAFF 238072 = MUCNS 30 (named as C. apii s. str.); Shizuoka, 

on A. graveolens, 8 Jun. 2007, M. Togawa, MUMH 10802, MUCC 593; Saga, on 

Asparagus officinalis (Asparagaceae), 20 Sep. 1999, J. Yamaguchi, MUMH 11400, 

MUCC 923 = MAFF 238299; Hokkaido, on Glebionis coronaria (≡ Chrysanthemum 

coronarium) (Asteraceae), Aug. 1989, MUCC 573 = MAFF 235978. Netherlands, 

Bergen op Zoom, on B. vulgaris, Sep. 1951, G. van den Ende, CBS 152.52 = 

IMI 077043 = MUCL 16495 = CPC 5063. New Zealand, Auckland, on Glebionis 

coronaria (≡ Chrysanthemum coronarium), C.F. Hill, Lynfield 566, CPC 5260; 

on Moluccella laevis (Lamiaceae), C.F. Hill, Lynfield 516, CPC 5112. Romania, 

Hagieni, distr. Constanta, on Plumbago europaea (Plumbaginaceae), 13 Jun. 1970, 

O. Constantinescu, CBS 553.71 = IMI 161116 = CPC 5083 (as C. plumbaginea); 

Bucuresti, on A. graveolens, 2 Oct. 1969, O. Constantinescu, CBS H-9812, CBS 

536.71 = CPC 5087; Domnesti, on Plantago lanceolata (Plantaginaceae), 3 Aug. 

1965, O. Constantinescu, CBS 252.67 = CPC 5084. Unknown, on A. graveolens, 

Mar. 1925, L.J. Klotz, CBS 119.25 = B 42463 = IHEM 3822 = CPC 5086. USA, 

California, on M. laevis, S.T. Koike, CBS 110816 = CPC 5111; CBS 110813 = 

CPC 5110; California, on A. graveolens, 27 Sep. 2010, S.T. Koike, CPC 18601. 

Zimbabwe, on M. laevis, 13 May 2009, S. Dimbi, CBS 132683 = CPC 16663. 

Notes: Various investigators have demonstrated that great variation 

in the size and shape of conidiophores and conidia (conidiophores: 

25–300 × 3.5–9 µm, rarely branched, conidia: 25–315 × 3–6 µm, 

cylindrical, filiform to acicular) is induced by changes in environmental 

conditions, especially humidity. Crous & Braun (2003) pointed out 

these morphological ambiguities, and introduced a concept of 

Cercospora apii s. lat., for taxa morphologically indistinguishable 

from Cercospora apii on A. graveolens. Cercospora apii s. str., 

which is phylogenetically distinct, is characterised in that its 

conidiophores are almost uniform in width, moderately thick-walled 

or thick-walled, short obconically truncate at the apex, and with 

a few loci on integrated conidiogenous cells, and long-cylindrical 

to cylindrical-obclavate to often acicular conidia with truncate or 

obconically truncate basal ends and subacute to obtuse apices. 

According to Crous & Braun (2003), the host plants of C. apii 

s. str. are found in more than 86 genera of several plant families. 

Groenewald et al. (2006a) concluded that C. apii s. str., which 

is mainly isolated from celery, has a wide host range, because 

numerous isolates of C. apii s. lat. originating from various host 

plants have similar nucleotide sequences to the type strain of 

C. apii s. str. 

In principle, the phylogenetic split observed between 

C. beticola and C. apii is only supported by the CAL sequences, 

and for the other genes these two taxa cluster as a large unresolved 

clade. Groenewald et al. (2005) showed that these two species are 

also distinguished by their AFLP fingerprints and growth conditions, 

suggesting that they were operational species units with a different 

ecology. These results indicate that in many cases morphologically 

identical species occurring on different hosts in fact represent 

different species. The situation is complicated in that there are 

several species with wide host ranges. Other species can colonise 

dead material of non-hosts, facilitating what has been described 

as a pogostick hypothesis (Crous & Groenewald 2005), until they 

locate their ideal hosts on which they are primary pathogens. In 

the present study it was further found that the CAL phylogeny fails 

to distinguish C. apii s. str. from C. cf. brunkii and C. cf. resedae, 

which are sister taxa in the combined tree (Fig. 2 part 5). 

Cercospora apiicola M. Groenew., Crous & U. Braun, 

Mycologia 98: 281. 2006. 

Leaf spots amphigenous, subcircular to irregular, 3–10 mm diam, 

medium brown, with a raised or inconspicuous, indefinite margin, not 

surrounded by a border of different colour. Caespituli amphigenous, 

but primarily hypophyllous. Stromata lacking to well-developed, 

30–60 µm diam, medium brown. Conidiophores in fascicles 

(4–10), moderately dense, arising from stromata, emerging 

through stomata or erumpent through the cuticle, subcylindrical, 

upper part geniculate-sinuous, unbranched, 1–3-septate, 25–70 × 

4–6 µm, medium brown, becoming pale brown towards the apex, 

smooth, wall somewhat thickened. Conidiogenous cells integrated, 

terminal, 15–30 × 4–5 µm, occasionally unilocal, usually multilocal, 

sympodial; loci subcircular, planate, thickened, darkened, refractive, 

2.5–3 µm wide. Conidia solitary, cylindrical when small, obclavatecylindrical 

when mature, not acicular, (50–)80–120(–150) × (3–) 

4–5 µm, 1–6(–18)-septate; apex subobtuse, base obconically 

subtruncate; hila 2–2.5 µm wide, thickened, darkened, refractive. 

Specimens examined: Greece, on Apium graveolens, 2000, I. Vloutoglou, CBS 

132666 = CPC 11642; CPC 11641. South Korea, Kangnung, on A. graveolens, 20 

Sep. 2003, H.D. Shin, CPC 10666; Namyangju, on A. graveolens, 30 Sep. 2003, 

CBS 116458 = CPC 10657; on A. graveolens, 22 Oct. 2003, H.D. Shin, CBS 132651 

= CPC 10759. Venezuela, La Guanota, Caripe, Edo. Monagas, 1050 m.s.n.m., on 

Apium sp., 23 Jul. 2002, N. Pons, holotype CBS H-18473, culture ex-type CBS 

116457 = CPC 10267; CBS 132644 = CPC 10248; CPC 10220; CPC 10265–10266; 

CPC 10279; CPC 10666. 

Notes: Morphologically C. apiicola differs from C. apii s. str. in 

having multiple conidiogenous loci and long conically truncate 

conidiogenous cells (Groenewald et al. 2006a). It has a high degree 

of phylogenetic independence from other species of C. apii s. lat. 

supported by TEF, ACT, CAL and HIS regions. It is also clearly 

distinct from C. apii in the combined tree (Fig. 2 part 2 vs. part 5). 

Cercospora armoraciae Sacc., Nuovo Giorn. Bot. Ital. 8: 

188. 1876. 

= ?Cercospora cheiranthi Sacc., Nuovo Giorn. Bot. Ital. 8: 187. 1876. 


145


= Cercospora nasturtii Pass., Hedwigia 16: 124. 1877. 

= Cercospora nasturtii subsp. barbareae Sacc., Michelia 2: 557. 1882. 

≡ Cercospora barbareae (Sacc.) Chupp, Farlowia 1: 579. 1944. 

= Cercospora bizzozeriana Sacc. & Berl., Malpighia 2: 248, 1888. 

= Cercospora atrogrisea Ellis & Everh., Proc. Acad. Nat. Sci. Phiadelphia 45: 

464. 1894. 

= Cercospora bizzozeriana var. drabae Sausa da Câmara, Revista Agron. 

(Lisbon) 1: 25. 1903. 

= Cercospora berteroae Hollós, Ann. Mus. Nat. Hung. 5: 468. 1907. 

= Cercospora drabae Bubák & Kabát, Hedwigia 52: 362. 1912. 

≡ Cercosporina drabae (Bubák & Kabát) Sacc., Syll. Fung. 25: 900. 1931. 

= Cercospora camarae Curzi, Atti Ist. Bot. Univ., Pavia, III, 2: 101. 1925. 

= Cercospora cardamines Losa (as “cardaminae”), Anales Jard. Bot. Madrid 

6: 453. 1946. 

= Cercospora lepidii Niessl, unknown, in herb., HBG fide Chupp (1954, p. 180). 

Caespituli amphigenous. Mycelium internal. Stromata lacking 

to well-developed, up to 60 μm diam, brown, substomatal or 

intraepidermal. Conidiophores arising from internal hyphae or a few 

brown cells, cylindrical, solitary, or in loose to divergent fascicles 

(2–30), pale to pale brown, paler towards apex, moderately thickwalled, 

simple, straight to strongly geniculate, irregular in width, 

often narrowed with successive geniculation, truncate or conically 

truncate at the tip, sometimes constricted at septa, 13–135 × 

2.5–7.5 µm, 0–7-septate. Conidiogenous cells integrated, terminal, 

intercalary, proliferating sympodially, uni-local to multi-local 

(1–3); loci conspicuous, apical or on shoulder of conidiogenous 

cells caused by geniculation, rarely lateral, distinctly thickened, 

somewhat protuberant, refractive or darkened, 1.8–3.5 µm diam. 

Conidia solitary, hyaline, straight to mildly curved, cylindrical, 

cylindro-obclavate to acicular, obconically truncate or truncate, 

distinctly thickened at the base, obtuse at the apex, 15–125 × 2.5–6 

µm, 1–11-septate. 

Specimens examined: Italy, Venice, on Armoracia rusticana (= A. lapathifolia) 

(Brassicaceae), Treviso, Sep. 1874, (syntype Mycoth. Ven. 282, in B, HBG, S). 

Japan, Okinawa, on A. rusticana (= A. lapathifolia), 19 Nov. 2007, C. Nakashima, 

MUMH 10820, MUCC 768. New Zealand, Auckland, Grey Lynn, on Nasturtium 

officinale (= Rorippa nasturtium-aquaticum) (Brassicaceae), 14 Apr. 2002, C.F. 

Hill, Lynfield 576, CBS H-20988, CBS 115394 = CPC 5261 (named as C. nasturtii); 

Manurewa, on A. rusticana (= A. lapathifolia), C.F. Hill, Lynfield 622, CBS 115409 

= CPC 5359 (as C. armoraciae); on Gaura sp. (Onagraceae), C.F. Hill, Lynfield 

634, CBS 115060 = CPC 5366. Romania, Fundulea, on A. rusticana (= A. 

lapathifolia), O. Constantinescu, epitype designated here CBS H-20987, culture 

ex-epitype CBS 250.67 = CPC 5088; Fundulea, on Cardaria draba (Brassicaceae), 

O. Constantinescu, CBS 258.67 = CPC 5061 (as C. bizzozeriana); Hagieni, on 

Berteroa incana (Brassicaceae), O. Constantinescu, CBS 538.71 = IMI 161109 

= CPC 5090 (as C. berteroae); Hagieni, on C. draba, O. Constantinescu, CBS 

540.71 = IMI 161110 = CPC 5060 (as C. bizzozeriana); Hagieni, on Coronilla 

varia (Fabaceae), O. Constantinescu, CBS 555.71 = IMI 161117 = CPC 5082 

(as C. rautensis); Valea Mraconiei, on Erysimum cuspidatum (Brassicaceae), 

O. Constantinescu, CBS 545.71 = CPC 5056 (as C. erysimi). South Korea, 

Hoengseong, on Turritis glabra (≡ Arabis glabra) (Brassicaceae), 23 Jun. 2004, 

H.D. Shin, CBS H-20989, CBS 132654 = CPC 11338 (as C. nasturtii); CPC 11364 

(as C. nasturtii); Jecheon, on Rorippa indica (Brassicaceae), 19 Oct. 2007, H.D. 

Shin, CBS 132672 = CPC 14612 (as C. nasturtii); Pocheon, on Barbarea orthoceras 

(Brassicaceae), 23 Oct. 2002, H.D. Shin, CBS H-20990, CBS 132638 = CPC 10100 

(named as C. nasturtii); Wonju, on R. indica, 18 Oct. 2002, H.D. Shin, CBS H-20991, 

CPC 10133 (as C. nasturtii); Suwon, on A. rusticana (= A. lapathifolia), 14 Oct. 2003, 

H.D. Shin, CBS H-20992, CBS 132610 = CPC 10811 (as C. armoraciae). Thailand, 

on Acacia mangium (Fabaceae), W. Himaman, CPC 11530. 

Notes: See also C. capsici. Cercospora armoraciae is supported 

by the HIS phylogeny. In the TEF phylogeny it is part of a larger 

clade intermixed with C. zebrina, Cercospora sp. L, C. rumicis, 

C. violae and C. althaeina; in ACT the C. armoraciae clade contains 

some intraspecific variation and also includes C. rumicis. In the 

CAL phylogeny, it is a sister clade to C. zebrina, but it contains 

isolates from C. capsici. In the combined tree (Fig. 2 part 3), it is 

a sister taxon to C. capsici. Morphological characteristics of the 

C. armoraciae clade include conidiophores that are often narrowed, 

with successive geniculation, conically truncate at the apex, and 

with distinctly thickened and somewhat protuberant loci, and 

conidia that are cylindro-obclavate to acicular. 

In this study, most Cercospora species on Brassicaceae 

having indistinguishable morphological characteristics are listed 

as synonyms under C. armoraciae. This treatment was proposed 

previously (Crous & Braun 2003). Davis (1929) pointed out that 

similar forms on Brassicaceae, namely C. nasturtii, C. armoraciae, 

C. cheiranthi, etc., were likely conspecific. The results of this study 

support his prediction. Cercospora stanleyae Chupp ex U. Braun & 

Crous (Crous & Braun 2003) is tentatively maintained as a separate 

species due to morphological differences. Cercospora brassicicola 

differs from C. armoraciae in that the former has long conidiophores 

(up to 500 µm in length), and is pathogenic to Brassica. In addition, 

Cercospora thlaspi “thlaspiae” differs from C. armoraciae in that the 

former has long conidiophores (to 400 µm in length) and acicular 

conidia (40–300 × 2–4 µm). 

Cercospora beticola Sacc., emend. Groenewald et al., 


Caespituli hypophyllous. Mycelium internal. Stromata lacking to 

well-developed, up to 60 µm diam, intraepidermal or substomatal, 

brown to dark brown. Conidiophores solitary to 2–18 in loose 

fascicles, slightly divergent, brown, paler towards apex, moderately 

thick-walled, cylindrical, almost uniform in width, simple, geniculate, 

16–200(–450) × 4–6 µm, 1–6-septate, truncate at the apex, 

sometimes constricted at septa. Conidiogenous cells terminal or 

intercalary, proliferating sympodially, with 1–2 loci; loci distinctly 

thickened, not protuberant, apical or formed on shoulder of 

conidiogenous cells caused by geniculation and lateral, 2.5–3(–4) 

µm. Conidia solitary, filiform to acicular, straight to mildly curved, 

rarely cylindro-obclavate, truncate at the base, acute to subacute 

at the tip, 27–250 × 2–5 µm, 3–28-septate. 

Description of caespituli on V8 medium; MUCC 568 (MAFF 

238206): Conidiophores solitary to loosely fasciculate, brown, 

paler towards the apex, uniform in width, smooth, moderately thickwalled, 

straight to slightly sinuous, short conically truncate at the tip, 

50–148 × 3–5 µm, multi-septate. Conidiogenous cells integrated, 

terminal; loci moderately thickened, apical, uni-local, 2–3 µm in 

width. Conidia hyaline, cylindrical to cylindro-obclavate; short 

obconical, slightly thickened and truncate or obconically truncate at 

the base, acute at the apex, 40–88 × 3–6 µm, 3–14-septate. 

Specimens examined: Botswana, Gaborone, on Spinacia sp. (Chenopodiaceae), L. 

Lebogang, CPC 5369–5370. Bulgaria, on Goniolimon tataricum (Plumbaginaceae), 

S.G. Bobev, CBS 123907 = CPC 14616; CBS 123908 = CPC 14620; CBS 132673 

= CPC 14617; CPC 14618–14619. Czech Republic, on Beta vulgaris, Sep. 1947, 

G.E. Bunschoten, CBS 117.47. Egypt, on B. vulgaris, 15 Apr. 2004, M. Hasem, CPC 

12028–12030. France, Longvic, on B. vulgaris, S. Garressus, CBS 116505 = CPC 

11580. Germany, on B. vulgaris, S. Mittler, CPC 12031; CPC 12027; CPC 12022; 

CBS 116502 = CPC 11577; CBS 116454 = CPC 11558; on B. vulgaris, Jun. 1931, 

E.W. Schmidt, CBS 122.31 = CPC 5072; CBS 126.31 = CPC 5064. Iran, Pakajik, 

on B. vulgaris, A.A. Ravanlou, CBS 116501 = CPC 11576. Italy, Ravenna, on B. 

vulgaris, 10 Jul. 2003, V. Rossi, culture ex-epitype CBS 116456 = CPC 11557; CBS 

116503 = CPC 11578. Japan, Chiba, on B. vulgaris, 30 May 1998, S. Uematsu, 

MUCNS 320 = MUCC 568 = MAFF 238206; Hokkaido, on B. vulgaris, 1955, K. 

Goto, MUCC 569 = MAFF 305036. South Korea, Namyangju, on Chrysanthemum 

segetum (= Ch. coronarium var. spatiosum) (Asteraceae), 24 Jun. 2004, H.D. Shin, 

CBS 132655 = CPC 11341 (named as C. chrysanthemi); 27 Jul. 2004, H.D. Shin, 

CPC 11344 (named as C. chrysanthemi). Mexico, Texcoco, on B. vulgaris, 20 Oct. 

2008, Ma. de Jesús Yáñez-Morales, CPC 15623. Netherlands, on B. vulgaris, 

M. Groenewald, CBS 116506 = CPC 11581; Northwest Brabant, on B. vulgaris, 

Nov. 1947, G.E. Bunschoten, CBS 116.47 = CPC 5074. New Zealand, Auckland, 

on Limonium sinuatum (Plumbaginaceae), 25 Feb. 2002, C.F. Hill, Lynfield 533, 

146


CBS 115478 = CPC 5113 (named as C. statices); on B. vulgaris, C.F. Hill, CPC 

5128; Lynfield 539, CPC 5125; CPC 10197; CPC 10204; CPC 10168; CBS 117556 

= CPC 10171; CPC 10168; on Apium graveolens, C.F. Hill, Lynfield 537a, CPC 

5123. Romania, Bucuresti, on B. vulgaris, 17 Oct. 1966, O. Constantinescu, 

CBS 539.71 = CPC 5062; Hagieni, on Malva pusilla (Malvaceae), 15 Jul. 1970, 

O. Constantinescu & G. Negrean, CBS H-9847, CBS H-9849, CBS 548.71 = IMI 

161115 = CPC 5065; on B. vulgaris, Jun. 1931, E.W. Schmidt, CBS 124.31 = CPC 

5070. Spain, on B. vulgaris, Jun. 1931, E.W. Schmidt, CBS 123.31 = CPC 5071. 

Unknown, on B. vulgaris, Jun. 1931, E.W. Schmidt, CBS 125.31 = CPC 5069. USA, 

California, on B. vulgaris, S.T. Koike, CPC 18813. 

Notes: Cercospora beticola is the causal agent of Cercospora 

leaf spot on B. vulgaris, which is one of the most common and 

destructive sugar beet diseases (Weiland & Koch 2004). Despite 

its importance as a plant pathogen, its actual host range remains 

unclear. 

Initial phylogenetic analyses on the genus Cercospora 

employed ITS sequences to reveal phylogenetic relationships 

within the genus (Stewart et al. 1999, Goodwin et al. 2001, 

Pretorius et al. 2003). These analyses failed to discriminate all 

species due to the limited resolution provided by the ITS locus. 

Groenewald et al. (2005, 2006a) subsequently succeeded in using 

multi-locus sequence data from five gene regions to distinguish 

Cercospora species. They also expanded the host range of C. 

beticola. Although isolates of C. beticola have been isolated from 

diverse hosts, these isolates appear to have been colonising nonhosts 

as saprobes or secondary invaders (Crous & Groenewald 

2005), and proof of their pathogenicity has not been confirmed. 

Results from the phylogenetic analyses using CAL and 

combined multi-locus data set divide C. beticola and C. apii s. str. 

into two different clades, with C. beticola splitting further into two 

subclades (also see Fig. 2 part 6) based on sequence changes 

in HIS, probably due to intraspecific variation. The combined data 

clearly show that C. apii s. str. and C. beticola are related sibling 

species, although C. beticola must be retained as a separate 

species. 

Cercospora cf. brunkii 


composed of few dark brown cells, intraepidermal or substomatal. 

Conidiophores brown to dark brown, paler at the apex, 2–6 in loose 

fascicles, moderately thick-walled, straight or 1–2 times geniculate 

caused by sympodial proliferation, uniform in width, mildly 

attenuated at the apex, short obconically truncate or truncate at 

the apex, 30–160 × 4.5–5.5 µm, 0–9-septate. Conidiogenous cells 

integrated, terminal and intercalary, proliferating sympodially, rarely 

percurrently, uni- or multi-local (2–5); loci distinctly thickened, often 

dispersed on whole conidiophores, darkened, apical and lateral, 

2–3 µm diam. Conidia solitary, hyaline, acicular, straight or slightly 

curved, thickened and truncate at the base, acute at the apex, 27– 

110 × 1.5–4 µm, indistinctly multi-septate, 0–9-septate. 

Specimens examined: Japan, Wakayama, on Datura stramonium (Solanaceae), 

30 Oct. 2007, C. Nakashima & I. Araki, MUMH 10858, MUCC 732. South Korea, 

Namyangju, on Geranium thunbergii (≡ G. nepalense var. thunbergii) (Geraniaceae), 

30 Sep. 2004, H.D. Shin, CBS H-20993, CBS 132657 = CPC 11598. 

Notes: This species is basal to C. apii s. str. Fresh collections from 

Geranium (Geraniaceae) are needed from the USA (type locality 

of C. brunkii) to determine if the latter name can be applied to 

this species. The two isolates representing this species are never 

supported in their own clade; in the TEF and ACT phylogenies they 

are intermixed with C. cf. flagellaris, in the CAL phylogeny with C. 

apii and in the HIS phylogeny with C. kikuchii, C. cf. richardiicola 

and Cercospora spp. P and Q. These different shared alleles 

are the likely cause for their separate position in the combined 

phylogeny (Fig. 2 part 5). 

Cercospora campi-silii Speg., Michelia 2: 171. 1880. 

≡ Cercosporidium campi-silii (Speg.) X.J. Liu & Y.L. Guo, Acta Mycol. Sin. 

1: 94. 1982. 

≡ Passalora campi-silii (Speg.) Poonam Srivast., J. Living World 1: 114. 

1994, nom. inval. 

≡ Passalora campi-silii (Speg.) U. Braun, Mycotaxon 55: 228. 1995. 

= Cercospora impatientis Bäumler, Verh. K. K. Zool.-Bot. Ges. Wien 38: 717. 

1888. 

Leaf spots angular to irregular, 1–3 mm diam, center greyish to 

pallid, surrounded by purplish brown to dark brown border lines, 

but brown to greyish brown without definite borders on the abaxial 

surface. Caespituli hypophyllous, but also epiphyllous in later stage 

of disease development. Stromata lacking or composed of a few 

brown cells. Conidiophores arising in fascicles of 5–12(–18), loose 

to moderately dense, emerging through stomata or occasionally 

erumpent through the cuticle, subcylindrical, 2–5 times geniculate, 

sometimes abruptly geniculate, unbranched, 2–4-septate, 40–110 

× 4–5.5 µm, pale brown to olivaceous-brown. Conidiogenous 

cells integrated, terminal, sympodial, multi-local; loci subcircular, 

thickened, darkened, 2.5–3 µm wide. Conidia solitary, obclavatecylindrical 

to elliptical, 25–60 × 4.5–6 µm, (1–)3(–6)-septate, 

subhyaline, apex obtuse, base obconically subtruncate; hila ca. 2 

µm wide, thickened, darkened. 

Specimen examined: South Korea, Inje, on Impatiens noli-tangere (Balsaminaceae), 

29 Sep. 2007, H.D. Shin, CBS 132625 = CPC 14585. 

Notes: Although C. campi-silii was transferred from Cercospora 

to Passalora based on its pale olivaceous conidia (Braun 1995b), 

as in the case of C. sojina, these taxa are best retained in 

Cercospora, which is fully supported by their phylogenetic position 

within Cercospora. Cercospora campi-silii is separated based 

on the TEF, ACT and HIS phylogenies in the present study. Only 

the CAL phylogeny failed to distinguish it from C. sojina and C. 

achyranthis. On the combined tree (Fig. 2 part 2), it is a sister taxon 

to C. sojina. Cercospora campi-silii was described from Europe 

and examination of European material is necessary to determine 

similarity with Korean collections. 

Cercospora canescens complex 

Cultures examined: Ghana, on leaves of Dioscorea rotundata (Dioscoreaceae), 

2000, S. Nyako & A.O. Danquah, CBS 132658 = CPC 11626 = GHA-1-0 (as C. 

dioscoreae-pyrifoliae); CPC 11628 = GHA-2-1; on leaves of Dioscorea alata, 

2000, S. Nyako & A.O. Danquah, CBS 132659 = CPC 11627 = GHA-1-1. Mexico, 

Tamaulipas, unidentified Malvaceae host, 30 Oct. 2008, Ma. de Jesús Yáñez- 

Morales, CPC 15871. South Africa, Northwest Province, Potchefstroom, on Vigna 

sp. (Fabaceae), S. van Wyk, CBS 111133 = CPC 1137; CBS 111134 = CPC 1138; 

Tsipise, Limpopo Province, on Citrus maxima (Rutaceae) fruit spot, K. Serfontein, 

CPC 4408–4409. USA, Georgia, on Phaseolus lunatus (= Ph. limensis) (Fabaceae), 

E.S. Luttrell, CBS 153.55 = CPC 5059 (as C. canescens); on Apium sp., CPC 11640 

= IMI 186563. 

Notes: Morphologically the present clade represents isolates 

that correspond with the description of C. canescens, which was 

originally described from Phaseolus in the USA. It is possible that 

as more isolates are added, the lower subclade, which represents 

hosts in other families, may eventually split off as a distinct taxon. 

Epitype material from the USA is necessary to fix the application 


147


of the name C. canescens. The material on Ph. lunatus (= Ph. 

limensis) could be used in this sense, but C. canescens is a 

complicated species complex. More isolates from the USA are 

necessary to resolve this issue. A sequence of an isolate on 

Phaseolus from Mexico (CPC 15807) clusters in “Cercospora sp. 

Q”, which might be C. canescens. The C. canescens complex is 

supported as a distinct clade in the ACT and CAL phylogenies. The 

TEF sequence of isolate CPC 15871 splits off from the rest of the 

isolates to cluster with C. cf. coreopsidis. In the HIS phylogeny, 

the isolates occur in four distinct but related clades (C. mercurialis 

occurs in an intermediate position between these clades). These 

four clades correspond to the intraspecific variation observed for 

this species in Fig. 2 (part 1). 

Cercospora capsici Heald & F.A. Wolf, Mycologia 3: 15. 

1911. 

Leaf spots circular to subcircular, more or less concentric, 2–10 mm 

diam. Caespituli amphigenous, appearing greyish brown in case 

of abundant sporulation. Mycelium internal. Stromata rudimentary, 

composed of a few swollen cells. Conidiophores straight to 

mildly curved, not branched, in divergent fascicles (3–15), mildly 

geniculate, 30–120 × 3–6 µm, 0–6-septate. Conidiogenous cells 

integrated, terminal, lateral, proliferating sympodially; loci distinct, 

slightly protuberant, apical and formed on shoulder caused by 

geniculation, 2–3 µm wide. Conidia solitary, hyaline, acicular, 

straight to mildly curved, 64–180 × 4–5.5 µm, 2–12-septate, 

subacute at the apex, obconically truncate at the base (adapted 

from Shin & Kim 2001). 

Description of caespituli on V8 medium; MUCC 574 (MAFF 

238227): Conidiophores solitary, pale brown to brown, irregular in 

width, wider at the base, smooth, moderately thick-walled, sinuousgeniculate, 

simple, conically truncated at the tip, 20–130.5 × 3.5–5 

µm, multi-septate. Conidiogenous cells integrated, terminal; loci 

distinctly thickened, apical, 2–2.5 µm in width. Conidia solitary, 

hyaline, cylindro-obclavate to acicular, distinctly thickened and 

long obconically truncated at the base, obtuse to acute at the apex, 

105–200 × 2.5–4.5 µm, 9–18-septate. 

Specimens examined: Fiji, unknown host, fungus fruiting on lesions on calyx 

attached to fruit, 17 Aug. 2005, P. Tyler, CBS 118712. Japan, Chiba, on Capsicum 

annuum (Solanaceae), 1 Oct. 1999, S. Uematsu, MUCC 574 = MAFF 238227 = 

MUCNS 810. South Korea, Hongcheon, on C. annuum, 29 Aug. 2005, H.D. Shin, 

CBS H-20994, CPC 12307; Yanggu, on C. annuum, 28 Sep. 2007, H.D. Shin, CBS 

H-20995, CBS 132622 = CPC 14520. 

Notes: See also C. armoraciae. This species is supported in the 

TEF (related to Cercospora sp. J and C. chenopodii), ACT (related 

to Cercospora sp. J and C. zebrina and C. armoraciae) and HIS 

(related to Cercospora spp. C and D) phylogenies and is part of 

the larger C. armoraciae clade based on CAL. In the combined tree 

(Fig. 2 part 3), it is a sister taxon to C. armoraciae. Morphological 

characteristics of this species on the host plant and in culture are 

almost similar to C. armoraciae. In addition, acicular conidia are 

formed in culture. The application of the name C. capsici to this 

clade is only tentative, since the latter species was described from 

the USA. North American cultures and sequences are needed to 

confirm their identity. 

Several species of Cercospora occur on solanaceous host 

plants. Of these, C. physalidis has been shown to form a species 

complex. Braun & Mel’nik (1997) concluded many species of 

Cercospora apii s. lat. on solanaceous hosts, including C. capsici, 

were synonymous with C. physalidis based on their morphological 

characteristics. Based on the results of pathogenicity tests (C. 

Nakashima, unpubl. data), phylogeny, and morphology (cylindrical 

to obclavate, rarely acicular conidia, and conidiophores that narrow 

at the upper portion), C. capsici must be separated from the C. 

physalidis complex. Likewise, other taxa in this complex such as 

C. lycii, C. nicandrae, C. sciadophila, C. solanacea, and C. solani, 

which consistently have obclavate-cylindrical conidia, must be reexamined. 

Cercospora celosiae Syd., Ann. Mycol. 27: 430. 1929. 

Leaf spots amphigenous, scattered to confluent, distinct, 

subcircular to irregular, small to fairly large, 1–7 mm diam, pale 

brown to brown, surrounded by a dark brown border. Caespituli 

amphigenous. Stromata small, rudimentary to slightly developed, 

composed of several brown, swollen hyphal cells. Conidiophores 

3–20 in loose fascicles, emerging through stomata or erumpent 

through the cuticle, olivaceous-brown throughout, or paler upwards, 

0–5-septate, straight to slightly curved, 1–5 times mildly geniculate, 

sometimes once abruptly geniculate, not branched, 25–200 × 4.5– 

6 µm; loci conspicuous, apical or on shoulders of conidiogenous 

cells caused by geniculation. Conidia solitary, acicular to filiform, 

sometimes shorter ones obclavate-cylindrical, straight to mildly 

curved, hyaline, 2–14-septate, slightly constricted at the septa, 

subacute to subobtuse at the apex, obconically truncate to 

subtruncate at the base, 40–150 × 3–5 µm; hilum conspicuously 

thickened, darkened, and non-protuberant 

Specimen examined: South Korea, Chuncheon, on Celosia argentea var. cristata 

(≡ C. cristata) (Amaranthaceae), 7 Oct. 2003, H.D. Shin, CBS H-20996, CBS 

132600 = CPC 10660. 

Notes: The isolate representing C. celosiae is not supported as 

a separate clade; in the TEF, ACT, CAL and HIS phylogenies 

it is intermixed with predominantly Cercospora sp. I and C. 

alchemillicola / C. cf. alchemillicola, which is also evident from its 

position basal to Cercospora sp. I in the combined phylogeny (Fig. 

2 part 1). Authentic material from China is required to determine 

if C. celosiae should be merged with what is presently treated as 

Cercospora sp. I. 

Cercospora chenopodii Fresen., Beitr. Mykol.: 92. 1863. 

Fig. 4 

= Ramularia dubia Riess, Hedwigia 1: pl. 4, fig. 9. 1854. 

≡ Cercospora dubia (Riess) G. Winter, Fungi Eur. Exs., Ed. nov., Cent. 28, 

No. 2780. 1882 and Hedwigia 22: 10. 1883, nom. illeg., homonym of C. 

dubia Speg., 1880. 

≡ Cercospora dubia (Riess) Bubák, Ann. Mycol. 6: 29. 1908, nom. illeg., 

homonym of C. dubia Speg., 1880. 

≡ Cercosporidium dubium (Riess) X.J. Liu & Y.L. Guo, Acta Mycol. Sin. 

1: 95. 1982. 

≡ Passalora dubia (Riess) Poonam Srivast., J. Living World 1: 115. 1994, 

comb. inval. 

≡ Passalora dubia (Riess) U. Braun, Mycotaxon 55: 231. 1995. 

= Cercospora chenopodii Cooke, Grevillea 12: 22. 1883, nom. illeg., homonym 

of C. chenopodii Fresen., 1863. 

= Cercospora dubia var. urbica Roum., Rev. Mycol. 15: 15. 1893. 

= Cercospora dubia var. atriplicis Bondartsev, Trudy Glavn. Bot. Sada 26: 51. 

1910. 

= Cercospora atriplicis Lobik, Mat. po Fl. Faun. Obsled. Terskogo Okruga: 52. 

1928. 

= Cercospora chenopodii var. micromaculata Dearn., Mycologia 21: 329. 1929. 

= Cercospora penicillata f. chenopodii Fuckel, Fungi Rhen. Exs., Fasc. II, No. 

119. 1863, nom. nud. 

= Cercospora chenopodii var. atriplicis patulae Thüm., in herb. 

= Cercospora bondarzevii Henn., in herb. B. 

148


Fig. 4. Cercospora chenopodii (CBS 132620 = CPC 14237). A. Leaf spots. B. Close-up of lesion. C–F. Conidiophores. G–I. Conidia. Scale bars = 10 µm. 

Specimen examined: France, Ardeche, N44º22’39.8” E4º26’9.1”, on Chenopodium 

cf. album (Chenopodiaceae) next to river, 31 Aug. 2007, P.W. Crous, CBS H-20997, 

CBS 132620 = CPC 14237. 

Notes: Cercospora chenopodii was transferred to the genus 

Passalora as P. dubia by Braun (1995a) based on broadly 

obclavate conidia with visible large loci. The conidia of this species 

are hyaline, and best retained in Cercospora, which has been 

confirmed by results of molecular sequence analyses. The species 

is supported as distinct in the TEF, ACT and HIS phylogenies; in the 

CAL phylogeny it cannot be distinguished from C. cf. chenopodii. 

In the combined tree (Fig. 2 part 1), it is a sister taxon to C. cf. 

chenopodii. Also see C. cf. chenopodii. 

Cercospora cf. chenopodii Fig. 5. 

Leaf spots amphigenous, subcircular, circular, 3–8 mm diam, greyish 

brown to pale brown. Mycelium internal, consisting of septate, 

branched, smooth, pale brown hyphae. Caespituli in fascicles 

(10–40), amphigenous, brown, dense, becoming divergent, up 

to 150 µm wide and 50 µm high. Conidiophores aggregated 

in dense fascicles arising from the upper cells of a moderately 

developed brown stroma; conidiophores olivaceous-brown to 

brown, 2–5-septate, 1–2 times geniculate in upper part, at times 

apically swollen, not branched, 60–135 × 4–7 µm. Conidiogenous 

cells terminal, unbranched, pale brown, smooth, tapering to flattipped 

apical loci, proliferating sympodially, 20–40 × 4–6 µm; loci 

thickened, darkened, refractive, 2–4 µm diam. Conidia solitary, 

smooth, cylindrical to obclavate, straight to slightly curved, hyaline, 

(0–)2–4(–5)-septate, apex obtuse, base obconically truncate, 

(25–)40–65(–80) × (5–)6–7.5(–9) µm; hila thickened, darkened, 

refractive, 2–3 µm diam. 

Culture characteristics: Colonies erumpent, spreading, with sparse 

aerial mycelium, and lobate, smooth margins, and folded surface; 

reaching 10 mm after 2 wk. On MEA iron-grey with patches of dirty 

white, reverse fuscous-black to greyish sepia. On OA and PDA surface 

mouse-grey, with patches of pale mouse-grey, reverse olivaceous-grey. 

Specimens examined: Mexico, Montecillo, Chenopodium sp. (Chenopodiaceae), 

9 Oct. 2008, Ma. de Jesús Yáñez-Morales, CBS 132677 = CPC 15599; CPC 

15763; Purificacion, Chenopodium sp., 12 Oct. 2008, Ma. de Jesús Yáñez-Morales, 

CPC 15859; CPC 15862. South Korea, Hongcheon, on Chenopodium ficifolium 

(Chenopodiaceae), 4 Oct. 2002, H.D. Shin, CBS H-20998, culture CBS 132594 = 

CPC 10304; Hongcheon, on C. ficifolium, 27 Oct. 2005, H.D. Shin, CBS H-20999, 

CPC 12450. 

Notes: The chief difference between C. chenopodii and C. cf. 

chenopodii lies in the denser fascicles observed in the former 

species. Otherwise, the two species are barely distinguishable, 

and the latter species has to be considered a cryptic taxon. In the 

TEF phylogeny these two species are clearly distinct, although 

the isolates of C. cf. chenopodii are intermixed with those of C. 

delaireae, C. ricinella and Cercospora sp. K. The ACT and HIS 

phylogenies separate C. cf. chenopodii from the other species 

included in this study, although the CAL phylogeny could not 

distinguish C. chenopodii and C. cf. chenopodii. In the combined 

tree (Fig. 2 part 1), it is a sister taxon to C. chenopodii. See the 

species notes for C. chenopodii. We refrain from describing this 

species as new until more isolates for C. chenopodii can be 

sequenced to determine the intraspecific variation. 


149


Fig. 5. Cercospora cf. chenopodii (CPC 10304). A. Leaf spots. B. Close-up of lesion. C–E. Fasciculate conidiophores. F–I. Conidia. Scale bars = 10 µm. 

Cercospora chinensis F.L. Tai, Bull. Chin. Bot. Soc. 2: 49. 

1936. 

Caespituli amphigenous. Mycelium internal. Stromata lacking to 

small, up to 30 µm diam, dark brown, intraepidermal or substomatal. 

Conidiophores solitary to 2–5 in loose fascicles, simple, sometimes 

branched, thick-walled, dark brown, paler towards the apex, 

mainly straight, loosely geniculate, almost uniform in width, 

conically truncated and somewhat wider at the apex, 61–100 × 

5–6 µm, 3–6-septate. Conidiogenous cells integrated, proliferating 

sympodially or rarely percurrently, terminal and intercalary, multilocal; 

loci thickened, not protuberant, apical, lateral, 2.5–3 µm 

diam. Conidia solitary, hyaline, acicular to cylindro-obclavate, 

slightly curved, obconically truncate or subtruncate, and thickened 

at the base, acute at the apex, 60–210 × 3.5–5 µm, 2–16-septate. 

Specimen examined: South Korea, Pyeongchang, on Polygonatum humile 

(Convallariaceae), 20 Sep. 2003, H.D. Shin, CBS H-21000, CBS 132612 = CPC 

10831. 

Notes: See the notes for C. dispori below. In the combined tree 

(Fig. 2 part 5), it is a sister taxon to C. dispori and C. corchori. 

Cercospora cf. citrulina 


or small, up to 20 µm, pale brown. Conidiophores pale to pale 

brown, paler towards the apex, irregular in width, wider at the base, 

narrowed successive geniculation at the apex, sinuous-geniculate 

to well geniculate above the middle, thin-walled when young, 

darker and moderately thickened in mature conidiophores, solitary 

or in loose fascicles (2–14), simple, truncate at the apex, 50–86 × 

2.5–5 µm, 0–3-septate. Conidiogenous cells integrated, terminal, 

rarely intercalary, proliferating sympodially, multi-local; loci distinct, 

thickened, apical or on shoulder caused by geniculation, slightly 

protuberant, 2.5–3 µm diam. Conidia solitary, hyaline, cylindrical, 

filiform to acicular, straight to slightly curved, truncate to long 

obconically truncate and distinctly thickened at the base, apex 

subacute, 40–134 × 3–4 µm, multi-septate. 

Specimens examined: Bangladesh (western part), on Musa sp. (Musaceae), I. 

Buddenhagen, CBS 119395 = CPC 12682; CBS 132669 = CPC 12683. Japan, 

Kagoshima, on Momordica charanthia (Cucurbitaceae), 20 Oct. 1997, E. Imaizumi & 

C. Nomi, MUCC 577 = MAFF 238205 = MUCNS 254 (as C. citrullina); Okinawa, on 

Citrullus lanatus (Cucurbitaceae), 6 Mar. 1998, T. Kobayashion et al., MUMH 11402, 

MUCC 576 = MUCNS 300 = MAFF 237913 (as C. citrullina); on Psophocarpus 

tetragonolobus (Fabaceae), MUCC 584 = MAFF 305757 (as C. psophocarpicola); 

on Ipomoea pes-caprae (Convolvulaceae), MUCC 588 = MAFF 239409 (as C. 

ipomoeae). 

Notes: This clade is supported by the TEF, ACT and CAL 

phylogenies. In the HIS phylogeny, the clade is split into the two 

sister clades visible in the combined tree, and may eventually be 

shown to be a species complex. In the HIS phylogeny, MUCC 584, 

MUCC 576 and MUCC 577 are clustering sister to C. chinensis and 

C. dispori whereas the remaining isolates are sister to C. vignigena. 

In the combined tree (Fig. 2 part 5), it is a sister taxon to C. cf. 

helianthicola. 

This taxon is distinguished from other species based on several 

morphological characteristics. Sporulation is mainly observed at 

the apex of conidiophores; slightly protuberant loci are formed on 

shoulders caused by geniculation; the width of conidiogenous cells 

immediately behind the fertile region is generally narrower, and 

150


Fig. 6. Cercospora coniogrammes (CBS 132634 = CPC 17017). A. Leaf spots. B. Close-up of lesion. C–F. Weakly developed fascicles, showing conidiophores with sympodial 

proliferation and multi-local loci. G–I. Cylindrical to acicular conidia. Scale bars = 10 µm. 

conidiogenous cells are truncate at the apex. An isolate obtained from 

Ipomoea pes-caprae (MUCC 588) is located in this clade (Fig. 2 part 

5). It was not possible to examine its morphology in this study and 

thus it is not clear whether or not this fungus was saprobic. An isolate 

identified as C. psophocarpicola (MUCC 584), is also located in this 

clade. There is no morphological basis to divide C. psophocarpicola 

and other isolates in this clade into different species. Besides, the 

pathogenicity of MUCC 584 to Psophocarpus (Fabaceae) was 

confirmed (Ohnuki et al. 1989), thus showing that this species was 

not saprobic. Moreover, the four Japanese isolates examined in this 

study were obtained from the same subtropical islands in Japan. On 

the other hand, two isolates named as “C. hayi” from Musa sp. were 

also located in this clade. According to Crous et al. (2004b), several 

species of Cercospora are known to be able to colonise Musa. 

From the distribution of this taxon, it is natural that this species also 

colonised Musa (Musaceae), which grows in the same region. 

Cercospora coniogrammes Crous & R.G. Shivas, sp. nov. 


Etymology: Named after the host genus from which it was collected, 

Coniogramme. 

Leaf spots amphigenous, subcircular to angular, 1–3 mm diam, 

grey to pale brown, surrounded by a broad brown margin, up to 4 

mm diam. Mycelium internal. Caespituli predominantly epiphyllous. 

Conidiophores aggregated in loose fascicles (2–6), arising from 

the upper cells of a brown, weakly developed stroma, up to 20 

µm diam, brown, finely verruculose in lower part, 3–7-septate, 

subcylindrical, straight to geniculate-sinuous, unbranched, 60–120 

× 5–7 µm. Conidiogenous cells integrated, terminal, unbranched, 

brown, smooth, tapering to flat-tipped loci, proliferating sympodially, 

15–35 × 3–5 µm, with numerous tightly aggregated apical loci, 

proliferating sympodially; loci distinct, thickened and darkened, 

protruding, 2–2.5 µm diam. Conidia solitary, hyaline, cylindrical to 

acicular, straight or slightly curved, apex subobtuse, base truncate, 

(30–)50–85(–120) × (2–)3(–3.5) µm, 1–6-septate, thin-walled, 

smooth; hila thickened, darkened, refractive, 1.5–2 µm diam. 

Culture characteristics: Colonies spreading, flat, with sparse aerial 

mycelium, folded surface and even margins, reaching 25 mm after 

2 wk. On OA blood-red in centre, red at margin. On MEA greyolivaceous 

in centre, smoke-grey at margins, olivaceous-grey in 

reverse. On PDA umber to chestnut in centre, bay at margin, umber 

in reverse. 

Specimen examined: Australia, Queensland, Brisbane, on Coniogramme japonica 

var. gracilis (≡ C. gracilis) (Adiantaceae), holotype CBS H-21001, Aug. 2009, P.W. 

Crous, culture ex-type CBS 132634 = CPC 17017. 

Notes: The numerous, tightly aggregated loci on the conidiogenous 

cells, and cylindrical to acicular conidia are characteristic of this 

species. This species is supported on the TEF, ACT, CAL and HIS 

phylogenies and is basal in the combined tree (Fig. 2 part 1). 

Cercospora corchori Sawada, Trans. Nat. Hist. Soc. 

Formosa 26: 179. 1916. 


small, substomatal or intraepidermal, pale brown to brown, 16–25 


151


µm diam. Conidiophores arising from upper part of stromata or 

internal hyphae, in loose fascicles (5–10), moderately thick-walled, 

pale brown to brown, uniform in width, sometimes attenuated at the 

apex, sinuous-geniculate, sparsely septate, conically truncate at the 

apex, 20–83 × 4–5 µm. Conidiogenous cells integrated, terminal 

and intercalary, proliferating sympodially, multi-local; loci distinct, 

thickened and darkened, apical or formed on the shoulder caused 

by the geniculation, 1–3 µm diam. Conidia hyaline to subhyaline, 

cylindro-obclavate to acicular, straight or slightly curved, truncate 

and thickened at the base, acute at the apex, 30–128 × 2.5–5 µm, 

4–13-septate. 

Description of caespituli on MEA; MUCC 585 (= MAFF 238191): 

Conidiophores solitary, brown, uniform in width, smooth, moderately 

thick-walled, slightly curved, simple, conically truncated at the 

apex, 130–230 × 3.5–4.5 μm, multi-septate. Conidiogenous cells 

integrated, terminal; loci moderately thickened, apical, 2.5–2.5 µm 

in width. 

Specimens examined: Japan, Shimane, on Corchorus olitorius (Tiliaceae), 27 Aug. 

1997, T. Mikami (epitype designated here – TFM:FPH-8114), culture ex-epitype 

MUCC 585 = MAFF 238191 = MUCNS 72. Taiwan, Taipei, on C. olitorius, 30 Jul. 

1909, K. Sawada, (isotype – TNS-F-220392). 

Notes: Cercospora corchori, which is known as the causal agent of 

a seed-borne disease, is distinguished from other species in that 

conidiophores are uniform in width, and conically truncate at the 

apex. Moreover, the species is supported by the ACT, CAL and HIS 

phylogenies. In the TEF phylogeny, it clusters on a longer branch in 

a clade with isolates of Cercospora sp. K and C. lactucae-sativae. 

In the combined tree (Fig. 2 part 5), it is a sister taxon to Cercospora 

spp. R and S. 

Cercospora cf. coreopsidis 

Leaf spots distinct (characteristic for this species), circular to 

subcircular, initially pale brown, later centre grey to dirty grey 

with raised greyish brown margins. Caespituli amphigenous. 

Mycelium internal. Stromata lacking or small, up to 30 µm in diam, 

intraepidermal or substomatal, brown. Conidiophores solitary, or up 

to 2–9 in loose fascicles, irregular in width, slightly attenuated at 

the apex, somewhat wider at mid cells, pale brown, thick-walled, 

paler towards the apex, conically truncate at the apex, geniculate 

at the upper portion, tortuous, 30–156 × 4–5.5 µm, 1–7-septate. 

Conidiogenous cells integrated, intercalary, terminal, proliferating 

sympodially, multi-local; loci thickened, darkened, not protuberant, 

flat, apical, lateral, rarely circumspersed, 1.5–2 µm. Conidia 

solitary, hyaline, filiform to acicular, straight to curved, truncated 

and thickened at the base, tip acute, 40–90(–180) × (1.5–)3–5 µm, 

indistinctly 7–10-septate. 

Specimen examined: South Korea, Seoul, Coreopsis lanceolata (Asteraceae), 17 

Sep. 2003, H.D. Shin, CBS H-21002, CBS 132598 = CPC 10648; Wonju, on C. 

lanceolata, 18 Oct. 2002, H.D. Shin, CPC 10122. 

Notes: The description of the present species is based on Korean 

specimens. Many species of Cercospora have latent pathogenicity 

to asteraceous plants. Although these results show that the 

identification of Cercospora species on these plants is difficult 

based on the host plant, the isolates originating from Coreopsis 

must be treated as a host-specific species in having an independent 

phylogenetic position, which is supported by the TEF, ACT, CAL 

and HIS phylogenies. In the combined tree (Fig. 2 part 1), it is a 

sister taxon to C. agavicola. 

On the other hand, C. beticola, which has also been known 

from Bidens (Asteraceae), was also reported from Coreopsis 

(Asteraceae) (Thaung 1984). Morphological differences between 

these species were not observed. The identification of the Korean 

collections as C. cf. coreopsidis is only tentative and must be 

proven on the base of sequences derived from North American 

isolates, which are not yet available. 

Cercospora delaireae C. Nakash., Crous, U. Braun & H.D. 



Delairea. 

Leaf spots amphigenous, subcircular to angular, grey-brown 

to brown, 3–7 µm diam, surrounded by a large, brown border, 

7–15 mm diam. Caespituli amphigenous, mainly hypophyllous. 

Mycelium internal. Stromata lacking or composed of few brown 

cells, substomatal or intraepidermal. Conidiophores solitary or 

in loose fascicles (2–4), pale brown to brown, irregular in width, 

narrowed at upper portion, moderately thick-walled, smooth, 

straight or abruptly once geniculate, truncate at the tip, 20–120 × 

5–6.5 µm, 1–9-septate. Conidiogenous cells integrated, terminal, 

rarely intercalary, proliferating sympodially, 20–60 × 4–6 µm, 

usually unilocal, rarely multi-local; loci apical or formed on the 

shoulder due to sympodial proliferation, 2–4 µm diam, thickened 

and darkened. Conidia solitary, hyaline, filiform to acicular, 

truncate at the base, tip acute, (55–)80–150(–200) × (3.5–)4(–5) 

µm, 3–15-septate, thin-walled, smooth; hila thickened, darkened, 

2–4 µm diam. 


to moderate aerial mycelium, and smooth, lobed margin and folded 

surface; reaching 20 mm diam after 2 wk. On MEA surface dirty 

white to salmon with patches of olivaceous-grey; reverse iron-grey 

in centre, salmon in outer region. On PDA surface dirty white with 

patches of pale mouse-grey, and red, diffuse pigment surrounding 

culture; reverse olivaceous-grey, but with prominent red pigment. 

On OA spreading, flat, lacking aerial mycelium, with lobate, smooth 

margins; surface red with diffuse red pigment surrounding colony; 

reverse red. 

Specimens examined: South Africa, Eastern Cape Province, Plettenberg Bay, on 

Delairea odorata (= Senecio mikaniodes) (Asteraceae), C.L. Lennox, CPC 10627– 

10629; Mpumalanga, Long Tom Pass, on D. odorata (= Senecio mikanioides), 16 

Jun. 2003, S. Neser, holotype CBS H-21004, culture ex-type CBS 132595 = CPC 

10455. 

Notes: Cercospora delaireae must be regarded as a new species 

based on its distinct phylogenic position (Fig. 2 part 2). In the 

individual gene trees it is distinguished in the ACT, CAL and HIS 

phylogenies; in the TEF phylogeny it cannot be distinguished from 

C. cf. chenopodii. In the combined tree (Fig. 2 part 2), it is a sister 

taxon to C. ricinella. It appears to be specific to Delairea odorata (= 

Senecio mikanioides) (Cape-ivy), and should be further evaluated 

as possible biocontrol agent of this host. Delairea odorata is an 

invasive perennial vine problematic in coastal riparian areas and 

is reported as being toxic to animals and fish. Stem, rhizome and 

stolon fragments resprout if left in the ground after treatment (for 

further information see ). 

152


Fig. 7. Cercospora delaireae (CBS 132595 = CPC 10455). A. Leaf spots. B. Close-up of lesion. C–F. Conidiophores giving rise to conidia. G, H. Conidia. Scale bars = 10 µm. 

Cercospora dispori Togashi & Maki, Trans. Sapporo Nat. 

Hist. Soc. 17: 98. 1942. 


to small, up to 40 µm diam, dark brown, intraepidermal or 

substomatal. Conidiophores solitary, or up to 2–10 in loose 

fascicles, thick-walled, dark brown, paler towards the apex, straight 

or sinuous-geniculate, almost uniform in width, conically truncate 

at the apex, 45–100 × 3.5–5.5 µm, 1–7-septate. Conidiogenous 

cells integrated, proliferating sympodially or rarely percurrently, 

terminal and intercalary, multi-local; loci thickened, not protuberant, 

apical, lateral. Conidia solitary, hyaline, acicular to cylindrical, 

slightly curved, obconically truncate or subtruncate, and thickened 

at the base, acute or obtuse at the apex, 30–85(–200) × 3.5–5 µm, 

2–12-septate, thin-walled, smooth. 

Specimens examined: Japan, Fukuoka, on Disporum smilacinum var. ramosum 

(Convallariaceae), 22 Sep. 1940, Y. Maki & T. Katsuki, holotype in SAPA? 

(specimen could not be located). South Korea, Pyeongchang, on Disporum 

viridescens (Convallariaceae), 20 Sep. 2003, H.D. Shin, CBS 132608 = CPC 10773; 

CPC 10774–10775. 

Notes: Cercospora chinensis and C. dispori are distinguished 

from other C. apii s. lat. species in that their conidiophores are 

uniform in width, thick-walled, dark coloured and conically truncate 

at the apex. In this study, C. chinensis and C. dispori occur on 

Convallariaceae, and cluster together in a well-supported clade. 

On the individual gene trees, these two species (represented by 

isolates CPC 10831 and CPC 10773) rarely cluster and are both on 

long branches in the phylogenetic analyses. In the TEF phylogeny, 

C. dispori cannot be distinguished from C. apii / C. beticola whereas 

C. chinensis is a sister taxon to C. pileicola. In the ACT phylogeny, 

C. chinensis cannot be distinguished from C. apii / C. beticola and 

C. dispori is a sister taxon to the C. apii / C. beticola clade. In the 

CAL phylogeny the two species are indistinguishable and they are 

related to C. lactucae-sativae. In the HIS phylogeny the two species 

are sister taxa related to C. citrullina. In the combined tree (Fig. 2 

part 5), it is a sister taxon to C. chinensis. Based on morphological 

characteristics, there is a difference between the two species in 

that the conidiophores of C. chinensis are sometimes branched. 

Thus, these two species are retained as separate taxa. 

Cercospora cf. erysimi 

Specimen examined: New Zealand, Manurewa, on Erysimum mutabile 

(Brassicaceae), 5 Dec. 2002, C.F. Hill, Lynfield 625, CBS 115059 = CPC 5361. 

Notes: This species is phylogenetically supported by TEF, ACT, 

CAL and HIS. A collection on Erysimum (Brassicaceae) from 

Europe (isolate CPC 5056) clusters within C. armoraciae. The 

latter could also be the “true C. erysimi”, which is still unclear. The 

type of C. erysimi is from North America. Thus, fresh material is 

needed from North America to resolve the application of the name 

“C. erysimi”. In the combined tree (Fig. 2 part 1), it is a sister taxon 

to C. cf. modiolae and Cercospora sp. E. 

Cercospora euphorbiae-sieboldianae C. Nakash., Crous, 

U. Braun & H.D. Shin, sp. nov. MycoBank MB800655. Fig. 8. 

Etymology: Named after the host from which it was collected, 

Euphorbia sieboldiana. 

Leaf spots amphigenous, subcircular to irregular, 3–15 mm diam, 

coalenscing, up to 25 mm diam, brown to greyish brown, becoming 

whitish grey in centre, with blackish margins on upper surface, and 

greyish white to grey on lower surface. Mycelium internal. Caespituli 

amphigenous. Stromata small to well-developed, intraepidermal to 


153


Fig. 8. Cercospora euphorbiae-sieboldianae (CBS 113306). A. Leaf spots. B. Close-up of lesion. C, D. Fasciculate conidiophores. E. Conidiophore giving rise to conidium. F–I. 

Conidia. Scale bars = 10 µm. 

substomatal, brown to dark brown, 20–125 μm. Conidiophores loose 

to densely fasciculate in fascicles of 3–40, pale brown to brown, 

paler towards the apex, irregular in width, somewhat constricted at 

the proliferating point, conically truncate at the apex, 0–2-septate, 

straight or sinuous to geniculate due to sympodial proliferation, 

simple, rarely branched, 15–170 × 4.5–8 μm. Conidiogenous cells 

integrated, terminal, rarely intercalary, proliferating sympodially, 

50–70 × 4–5 µm, multi-local; loci distinctly thickened, darkened, 

apical or formed on the shoulder, rarely lateral, 3–4.5 μm diam. 

Conidia solitary, hyaline to subhyaline, solitary, straight to slightly 

curved, obclavate to obclavate-cylindric, obconically truncated 

at the base, acute to obtuse at the apex, often beak-like at the 

apex, 38–130 × 5.5–8(–12) μm, (4–)3–6(–12)-septate, thin-walled, 

smooth; hila thickened, darkened, 3–4.5 µm diam. 


aerial mycelium and smooth, even margins, reaching 30 mm diam 

after 2 wk at 25 ºC in the dark. On MEA surface grey-olivaceous, 

reverse iron-grey. On PDA surface and reverse olivaceous-grey. 

Colonies forming spermatogonia in culture on both media. 

Specimen examined: South Korea, Samcheok, on Euphorbia sieboldiana 

(Euphorbiaceae), 8 May 2003, H.D. Shin, holotype CBS H-21005, culture ex-type 


Notes: This species is phylogenetically distinguishable from its 

closest relatives in the TEF, ACT, CAL and HIS phylogenies. It is 

related to C. polygonaceae (TEF), C. senecionis-walkeri (ACT), C. 

vignigena (CAL) and C. punctiformis (HIS); therefore it is distinct 

from the other species occurring on Euphorbiaceae included in 

this study. In the combined tree (Fig. 2 part 2), it is a sister taxon 

to C. punctiformis. It is morphologically well distinguished from 

species of the C. apii complex and other species of Cercospora by 

its unusually broadly obclavate-cylindrical conidia (5.5–8(–12) μm) 

with few septa and rather broad loci and hila (3–4.5 µm). 

Cercospora fagopyri K. Nakata & S. Takim., J. Agric. Exp. 

Stat. Gov. Gen. Chosen 15: 29. 1928. 

= Cercospora fagopyri Abramov, in Lavrov, Opred. rastit. paras. kul´t. i dikor. 

polezn. rast. Sibiri, Vyp. I: 22. 1932, nom. nud. 

≡ Cercospora fagopyri Abramov, in Vasilevsky & Karakulin, Fungi 

imperfecti parasitici. 1. Hyphomycetes: 321. 1937, nom. illeg. (homonym). 

= Cercospora fagopyri Chupp & A.S. Mull., Bol. Soc. Venez. Ci.. Nat. 8: 44. 

1942, nom. illeg. (homonym). 

Caespituli caulogenous, or amphigenous on leaves. Mycelium 

internal. Stromata intraepidermal or substomatal, pale brown, 

small to well-developed, 25–60 µm diam. Conidiophores pale 

brown, solitary, or in loose to dense fascicles (2–20), sinuously 

geniculate, rarely geniculate due to sympodial proliferation, usually 

irregular in width, frequently constricted due to proliferation, 

154


attenuated at the tip, truncate at the apex, multi-septate, 20–120 

× 3.5–5.5 µm, 0–5-septate. Conidiogenous cells integrated, mainly 

terminal, rarely intercalary, proliferating sympodially, multi-local; 

loci thickened and darkened, apical and formed on the shoulder 

caused by sympodial proliferation, sometimes lateral, sometimes 

protuberant, 1.5–2.5 µm. Conidia solitary, hyaline, cylindrical to 

acicular, straight or slightly curved, long obconically truncate or 

truncate at the thickened and darkened base, obtuse or acute at 

the apex, 20–100 × 3–4 µm, 3–20-septate, thin-walled, smooth. 

Description of caespituli on V8; (MUCC 130): Caespituli 

dimorphic, either small (common), or large (rarely observed; 

described in parenthesis). Conidiophores solitary to loosely 

fasciculate, arising from hyphae, subhyaline to pale brown, irregular 

in width, smooth, meager and thin-walled, sinuous-geniculate 

to geniculate (straight to geniculate), unbranched, truncated at 

the tip, 15–500 × 3–5 µm, multi-septate. Conidiogenous cells 

integrated, terminal or intercalary, proliferating sympodially, multilocal 

(uni-local); loci moderately thickened, apical, protuberant 

(not protuberant), 1.25–3 µm in width. Conidia solitary, hyaline, 

filiform to acicular, slightly thickened and obconically truncate 

(truncate) at the base, acute at the apex, 45.5–187 × 2–4.5 µm, 

3–16-septate. 

Specimens examined: Japan, Ehime, on Cosmos bipinnata (Asteraceae), 16 Oct. 

2004, J. Nishikawa, MUMH 11394, MUCC 130; on Hibiscus syriacus (Malvaceae), 

MUCC 866. South Korea, Suwon, on Viola mandshurica (Violaceae), 14 Oct. 2003, 

H.D. Shin, CBS H-21006, CBS 132649 = CPC 10725; Yangpyeong, on Cercis 

chinensis, (Fabaceae), 19 Oct. 2007, H.D. Shin, CBS H-21007, CBS 132671 = 

CPC 14546; on Fagopyrum esculentum (Polygonaceae), 9 Oct. 2007, H.D. Shin, 

neotype designated here CBS H-21008, culture ex-neotype CBS 132623 = CPC 

14541 (holotype specimen, South Korea, Suwon, on Fag. esculentum, Sep. 1934, 

K. Nakata & S. Takimoto, could not be located and is undoubtedly not preserved); 

on Fallopia dumentorum (Polygonaceae), 16 Oct. 2002, H.D. Shin, CBS H-21009, 


Notes: Phylogenetically the separation of C. fagopyri is supported 

by the TEF and HIS phylogenies, though it is intermixed with 

strains of C. cf. sigesbeckiae in the ACT phylogeny and of C. 

kikuchii in the CAL phylogeny. In the combined tree (Fig. 2 part 4), 

it is a sister taxon to C. cf. ipomoeae. Presently several isolates 

originating from diverse host families reside in this clade. However, 

lesions on Viola appear to be insect associated, and caused by 

a Colletotrichum species, with Cercospora colonisation being 

secondary. Furthermore, lesions on Fallopia dumentorum appear 

to be associated with chemical damage, not Cercospora, again 

suggestion that Cercospora colonisation was secondary. The 

fungus occurring on Cercis chinensis is distinct, having very long 

conidiophores (200–600 µm), and very long conidia. To resolve 

the host range of C. fagopyri, isolates from Fagopyrum need to be 

recollected in Korea, and pathogenicity established on the hosts 

listed above. Thus the name C. fagopyri can only be applied to 

other isolates than those from Fagopyrum tentatively, awaiting 

additional fresh collections. 

Cercospora cf. flagellaris 


to well-developed, up to 50 µm diam, brown, intraepidermal and 

substomatal. Conidiophores straight or successively geniculate at 

the apex, rarely abruptly geniculate, solitary, or in loose to dense 

fascicles (2–23), pale brown to brown, paler towards the apex, 

simple, rarely branched, uniform in width up to the middle, strongly 

attenuated at the upper portion, sometimes constricted at septa, 

often constricted following sympodial proliferation, 14–140(–270) × 

2.5–6.5 µm, 0–8-septate, truncate or short obconically truncated at 

the apex. Conidiogenous cells integrated, terminal and intercalary, 

proliferating sympodially, multi-local (2–5); loci distinctly thickened, 

apical or formed on the shoulders caused by geniculation, lateral, 

rarely protuberant, small, 1–4 µm. Conidia solitary, hyaline, 

cylindrical to acicular, sometimes obclavate, straight or slightly 

curved, truncate or short obconical truncate at the thickened and 

darkened base, acute at the apex, 18–240 (–300) × 2–4.5 µm, 


Description of caespituli on V8; MUCC 127: Conidiophores 

solitary, arising from hyphae, pale brown, uniform in width, 

sometimes wider at the base, smooth, straight to slightly sinuous, 

conically truncate at the tip, 10–95 × 3–5 µm, multi-septate. 

Conidiogenous cells integrated, terminal; loci distinctly thickened, 

apical, 1.25–2 µm in width. Conidia hyaline, acicular to filiform, 

slightly thickened and truncate at the base, acute at the apex, 35– 

220 × 2–3 µm, 2–15-septate. 

Specimens examined: Fiji, on Amaranthus sp. (Amaranthaceae), C.F. Hill, Lynfield 

677, CPC 5441. Israel, on Trachelium sp. (Campanulaceae), 16 Nov. 2002, E. Tzul- 

Abad, CBS 132637 = CPC 10079 (as C. campanulae). Japan, Ehime, on Cosmos 

sulphureus (Asteraceae), 16 Oct. 2004, J. Nishikawa, MUMH 11393, MUCC 127; 

Tokyo, on Hydrangea serrata (Hydrangeaceae), 10 Nov. 2007, I. Araki & M. Harada, 

MUMH 10933, MUCC 831; Wakayama, on H. serrata, 30 Oct. 2007, C. Nakashima & 

I. Araki, MUMH 10860, MUCC 735. South Korea, Hoengseong, on Celosia argentea 

var. cristata (≡ C. cristata), 11 Oct. 2004, H.D. Shin, CBS 132667 = CPC 11643 (as 

Cercospora sp.); Jeju, on Dysphania ambrosioides (≡ Chenopodium ambrosioides) 

(Chenopodiaceae), 12 Nov. 2003, H.D. Shin, CBS 132653 = CPC 10884 (as C. 

chenopodii-ambrosioidis); on Phytolacca americana (Phytolaccaceae), 1 Nov. 2007, 

H.D. Shin, CBS 132674 = CPC 14723; CPC 14724; Jinju, on P. americana, 15 Oct. 

2003, H.D. Shin, CPC 10684–10686; Namyangju, on Amaranthus patulus, 30 Sep. 

2003, H.D. Shin, CBS 132648 = CPC 10722; Pocheon, on P. americana, 23 Oct. 

2002, H.D. Shin, CPC 10124; Suwon, on Cichorium intybus (Asteraceae), 14 Oct. 

2003, H.D. Shin, CBS 132646 = CPC 10681 (as C. cichorii); Yanggu, on Sigesbeckia 

pubescens (Asteraceae), 28 Sep. 2007, H.D. Shin, CBS 132670 = CPC 14487. 

South Africa, Limpopo Province, Messina, Citrus sp. (Rutaceae), M.C. Pretorius, 

CBS 115482 = CPC 4410; CPC 4411; on Populus deltoides (Salicaceae), P.W. 

Crous, CPC 1051–1052. Unknown, on Bromus sp. (Poaceae), M.D. Whitehead, 

CBS 143.51 = CPC 5055. USA, Texas, on Eichhornia crassipes (Pontederiaceae), 

R. Charudattan & D. Tessmann, 14 Sep. 1996, CBS 113127 (as C. piaropi). 

Notes: The isolates from this species form a monophyletic clade 

identical to one another and the two isolates of C. cf. brunkii on the 

TEF phylogeny. In the CAL phylogeny the C. cf. flagellaris isolates 

form a monophyletic clade, albeit with some intraspecific variation. 

Based on ACT data, the clade splits into four lineages: 1. CPC 4410 

and 4411, 2. CPC 1052, 1051 and 10681, 3, CPC 5441 and, 4. the 

remainder of the isolates. In the HIS phylogeny the species also 

splits into four lineages: 1. CPC 4410, 4411, 10884 and MUCC 

735, 2. CPC 10681 and 11643, 3. CPC 5441 and, 4. the rest of 

the isolates. These splits in phylogeny (see Fig. 2 parts 2–3) are 

not supported by morphology: conidiophores are successively 

geniculate at the upper portion, strongly attenuated at the apex; 

conidiogenous cells are terminal and intercalary with multi-local 

loci, and conidia are truncate or short obconically truncate at the 

thickened base. We strongly suspect that this is a species complex. 

The latter can only be resolved once more authentic isolates for the 

names listed above are included (from original hosts and countries), 

additional DNA loci screened, and pathogenicity tests conducted. 

Included in this species complex is the isolate used by Tessmann 

et al. (2001) as C. piaropi. This isolate is indistinguishable from 

other isolates of C. cf. flagellaris based on the TEF, ACT, CAL and 

HIS phylogenies. Cercospora flagellaris is the older name (1882) 

compared to C. piaropi (1917) and should therefore get taxonomic 

preference. 


155


Cercospora cf. helianthicola 

Caespituli amphigenous. Mycelium internal. Stromata brown, 

lacking or small, intraepidermal or substomatal, up to 25 µm 

diam. Conidiophores simple, occasionally branched, straight to 

geniculate, pale brown, arising from small stromata or internal 

hyphae, solitary or in dense fascicles (up to 15), irregular in 

width, narrowed at successive geniculation, truncate at the apex, 

moderately thick-walled, 20–180 × 3–4 µm, septate. Conidiogenous 

cells integrated, terminal, proliferating sympodially, multi-local; loci 

distinctly thickened, apical and formed on the shoulders caused by 

geniculation, rarely lateral, refractive, 1.5–2 µm. Conidia solitary, 

acicular to cylindrical, hyaline, straight or curved, truncate and 

distinctly thickened at the base, obtuse at the apex, 10–85 × 3–4 

µm, indistinctly multi-septate, thin-walled, smooth. 

Specimen examined: Japan, Wakayama, on Helianthus tuberosus (Asteraceae), 

30 Oct. 2007, C. Nakashima & I. Araki, MUMH 10844, MUCC 716. 

Notes: This species is distinguished from other taxa in that it 

has slightly protuberant apical loci that are at times formed on 

shoulders caused by geniculation. The width of its conidiogenous 

cells is somewhat narrower behind the fertile region, and has a 

truncate apex. Furthermore, its conidiophores are rarely branched. 

A possible name that could be applied is C. helianthicola, though 

the latter species was originally described from South America, 

and fresh collections would be required to confirm its phylogenetic 

position. The isolate used in the current study is distinct in the TEF, 

ACT, CAL and HIS phylogenies. In the combined tree (Fig. 2 part 

5), it is a sister taxon to C. cf. citrulina. 

Cercospora cf. ipomoeae 

Caespituli amphigenous. Mycelium internal. Stromata composed of 

few brown cells, or well-developed, up to 60 µm diam, intraepidermal 

or substomatal. Conidiophores in loose fascicles (2–8), pale brown, 

paler towards apex, straight or geniculate at the apex, irregular in 

width, tip conically truncate, narrowed at the apex, 22.5–92.5 × 

3.5–5.5 µm, 0–4-septate. Conidiogenous cells integrated, terminal, 

proliferating sympodially, multi-local; loci thickened, darkened, 

apical, rarely lateral, rarely slightly protuberant, 2–2.5 µm diam. 

Conidia solitary, hyaline, filiform to acicular, slightly curved, 

obconically truncate or truncate, and thickened and darkened at 

the base, acute or obtuse at the apex, 50–135(–245) × 2.5–3(–7.5) 

µm, 3–19-septate, thin-walled, smooth. 

Specimens examined: Japan, Kagawa, on Ipomoea aquatica (Convolvulaceae), 

Aug. 2005, G. Kizaki, MUMH 11203, MUCC 442; South Korea, Chuncheon, 

on Ipomoea nil (= I. hederacea) (Convolvulaceae), 7 Oct. 2003, H.D. Shin, 

CBS H-21010, CBS 132652 = CPC 10833; Pocheon, on Persicaria thunbergii 

(Polygonaceae), 2 Oct. 2002, H.D. Shin, CBS H-21011, CBS 132639 = CPC 10102. 

Notes: This species is supported in the TEF phylogeny but cannot 

be distinguished from Cercospora sp. M and C. rodmanii in the 

ACT phylogeny. Isolate MUCC 442 clusters separately from the 

other two isolates based on the CAL and HIS phylogenies. In the 

combined tree (Fig. 2 part 4), it is a sister taxon to C. fagopyri. 

Sequences obtained from Cercospora isolates on Ipomoea spp. 

cluster in three different clades. Although the name C. ipomoeae is 

available for this clade, without sequence data from North America 

(and an appropriate epitype) this name cannot be applied with 

certainty, above all since isolates from Ipomoea cluster in different 

clades. 

Cercospora kikuchii (T. Matsumoto & Tomoy.) M.W. 

Gardner, Proc. Indian Acad. Sci. 36: 12. (1926) 1927. 

Basionym: Cercosporina kikuchii T. Matsumoto & Tomoy., Ann. 

Phytopathol. Soc. Japan 1: 10. 1925. 

Specimens examined: Argentinia, on Glycine max (Fabaceae), CBS 132633 = CPC 

16578. Japan, Kagoshima, on Glycine soja (Fabaceae), 1952, H. Kurata, MUCC 

590 = MAFF 305040; on G. soja, Jan. 1927, T. Matsumoto, CBS 128.27 = CPC 

5068 (ex-type of C. kikuchii); on seed of G. soja, Jan. 1928, H.W. Wollenweber, 

CBS 135.28 = CPC 5067. 

Notes: The symptoms on seeds and pods of plants inoculated 

with an isolate of C. richardiicola (MUCC 132; Nakashima, unpubl. 

data) originating from Osteospermum (Asteraceae) in Japan 

were quite similar to those caused by C. kikuchii. Cultures of C. 

kikuchii associated with purple seed stain symptoms cluster apart. 

This indicates that purple seed stain and leaf blight of G. max is 

caused by at least two different species of Cercospora, and that 

the identification of these species should not be based on disease 

symptoms alone. In the TEF and HIS phylogeny, the four isolates 

could not be distinguished from isolates of Cercospora sp. O, P and 

Q, as well as C. cf. richardiicola and C. cf. sigesbeckiae. Although 

these isolates clustered separate in the ACT phylogeny, intermixed 

in the clade was isolate CPC 14680 (C. cf. richardiicola) and isolate 

CPC 18636 (Cercospora sp. O). Similarly, the isolates clustered 

separate in the CAL phylogeny but intermixed with the isolates of 

C. fagopyri. In the combined tree (Fig. 2 part 4), it is a sister taxon 

to C. cf. sigesbeckiae. 

Cercospora lactucae-sativae Sawada, Rep. Gov. Agric. 

Res. Inst. Taiwan 35: 111. 1928. 

≡ Cercospora lactucae Welles, Phytopathology 13: 289. 1923, nom. illeg. 

(homonym), non Henn. 

= Cercospora longispora Cugini ex Trav., Malpighia 17: 217, 1902, nom. illeg. 

(homonym). 

≡ Cercospora longissima Trav., Malpighia 17: correzione (correction slip) 

to p. 217, 1903, nom. illeg. (homonym). 

≡ Cercospora longissima Cugini ex Sacc., Syll. Fung. 18: 607. 1906, nom. 

illeg. (homonym). 

= Cercospora lactucae J.A. Stev., J. Dept. Agric. Puerto Rico 1: 105. 1917, 

nom. illeg. (homonym). 

= Cercospora ixeridis-chinensis Sawada, Rep. Gov. Agric. Res. Inst. Taiwan 

86: 171. 1943, nom. inval. 

= Cercospora lactucae-indicae Sawada, Rep. Gov. Agric. Res. Inst. Taiwan 86: 

172. 1943, nom. inval. 


composed from few brown cells, up to 35 µm diam. Conidiophores 

arising from internal hyphae or a few intraepidermal brown cells, 

brown to pale brown, solitary to loosely fasciculate (2–7), straight or 

mildly geniculate, moderately thick-walled, irregular in width, wider 

and conically truncate at the apex, constricted at proliferating point, 

25–150 × 3.5–6 µm, 0–5-septate. Conidiogenous cells integrated, 

terminal and intercalary, proliferating sympodially, uni-local or 

multi-local (1–2); loci distinctly thickened, 2.5–3.5 µm diam, slightly 

protuberant, apical. Conidia solitary, hyaline, filiform to acicular, or 

obclavate, obconically truncate and distinctly thickened at the base, 

subacute or obtuse, often swelling at the apex, 20–125 × 2–6 µm, 

4–12-septate, thin-walled, smooth, rarely catenate. 

Description of caespituli on V8 & MEA; MUCC 570 and 571 

(= MAFF 238209 and 237719): Conidiophores solitary to loosely 

fasciculate, pale brown to brown, irregular in width, wider at the 

apex, constricted at proliferating point, smooth, moderately thickwalled, 

sinuous-geniculate to geniculate, simple, conically truncate 

at the apex, 22.5–195 × 3–5.5 μm, multi-septate. Conidiogenous 

156


cells integrated, terminal or intercalary, proliferating sympodially; 

loci moderately thickened, apical, 2.5–3.7 µm in width. Conidia 

hyaline, cylindrical to cylindrical obclavate, filiform, acicular, hilum 

distinctly thickened and long obconically truncate at the base, 

obtuse to acute at the apex, 44.5–215.5 × 3–7 µm, 5–20-septate. 

Specimens examined: Japan, Chiba, on Lactuca sativa (Asteraceae), 12 Sep. 

1997, S. Uematsu, MUCC 571 = MAFF 237719 = MUCNS 214; 18 Sep. 1998, 

C. Nakashima, MUMH 11401, MUCC 570 = MAFF 238209 = MUCN S463. 

South Korea, Chuncheon, on Ixeris chinensis subsp. strigosa (≡ Ixeris strigosa) 

(Asteraceae), 11 Oct. 2002, H.D. Shin, CBS H-21012, CPC 10082; 7 Oct. 2003, 

H.D. Shin, CBS H-21013, CBS 132604 = CPC 10728. Taiwan, Taipei, on L. sativa, 

9 Mar. 1924 & 5 Apr. 1924, K. Sawada (TNS-F-220470). 

Notes: This species is characterised in that conidiophores are 

wide and conically truncate at the apex, and constricted at the 

proliferating point. Furthermore, the conidia are not strictly acicular, 

but range from cylindrical-obclavate to acicular and they are rather 

broad, 3–7 µm. This species is phylogenetically well-supported 

based on ACT, CAL and HIS. The species cannot be distinguished 

from the single isolate of Cercospora sp. S in the TEF phylogeny, 

and these two species are also sister groups, but distinct, in the 

ACT phylogeny. The species is distinguished based on the CAL 

phylogeny, and split into two groups (MUCC 571 and 571 versus 

CPC 10082 and 10728) in the HIS phylogeny. In the combined tree 

(Fig. 2 part 5), it is a sister taxon to C. cf. helianthicola. 

Cercospora cf. malloti 


to well-developed, intraepidermal and substomatal, up to 65 µm 

diam. Conidiophores arising from internal hyphae or few brown 

cells, solitary or in loose fascicles (2–11), pale brown to brown, 

paler towards the apex, thick-walled, simple, rarely branched, 

straight or mildly geniculate, abruptly geniculate at the middle, 

or successively geniculate at the upper portion, irregular in 

width, narrowed at the apex, somewhat constricted at the part of 

proliferation, obconically truncate at the apex, 30–115(–250) × 2.5– 

5.5 µm, multi-septate. Conidiogenous cells integrated, terminal and 

intercalary, proliferating sympodially or percurrently, multi-local; loci 

apical or formed on the shoulders caused by geniculation, distinctly 

thickened, refractive, darkened, flattened, rarely protuberant at the 

shoulder of successive geniculation, 1–2 µm diam. Conidia solitary, 

hyaline, filiform to acicular, thickened and truncate at slightly 

protuberant base, obtuse or swelling at the apex, 40–90(–250) × 

1.5–5 µm, 6–11(–20)-septate. 

Description of caespituli on V8; MUCC 575 (= MAFF 237872): 

Conidiophores solitary, brown, paler at the apex, uniform in 

width, smooth, moderately thick-walled, simple, straight to mildly 

geniculate, short conically truncate at the tip, 100–465 × 1.25–3 

µm, multi-septate. Conidiogenous cells integrated, terminal and 

intercalary, proliferating sympodially; loci thickened, flattened, 

apical or formed on the shoulders caused by geniculation, 2–3 

µm in width. Conidia hyaline, long cylindrical to filiform, slightly 

thickened and truncate at the base, obtuse at the apex, 30–430 × 

2–4 µm, 3–19-septate, thin-walled, smooth. 

Specimens examined: Japan, Okinawa, on Mallotus japonicus (Euphorbiaceae), 19 

Nov. 2007, C. Nakashima & T. Akashi, MUMH 10837, MUCC 787; on Cucumis melo 

(Cucurbitaceae), 20 Jan. 1999, K. Uehara, MUCC 575 = MAFF 237872 = MUCNS 

582 (as C. citrullina). 

Notes: This species is supported by DNA sequence data of TEF, 

CAL and HIS. In the ACT phylogeny, the isolates from this species 

are intermixed with some isolates of C. cf. richardiicola (MUCC 

128, 132 and 578) and Cercospora sp. P (isolate MUCC 771). In 

the combined tree (Fig. 2 part 4), it is a sister taxon to Cercospora 

sp. P. The isolates originated from different host plants, but have 

identical conidiophores, which are thick-walled and with distinct loci 

at the apex. However, other characters, which include the pattern of 

geniculation and size of caespituli, are very different. More detailed 

studies are required to describe the morphological characters of 

this species. Cercospora malloti was originally described from 

Mallotus (Euphorbiaceae) collected in the USA, and fresh material 

needs to be recollected. The present application of this name for 

Japanese collections is thus only tentative. 

Cercospora mercurialis Pass., in Thüm., Mycoth. Univ., No. 

783. 1877. 

= Cercospora fruticola Sacc., Fungi Ital., Tab. 674. 1892. 

= Cercospora mercurialis var. annuae Fautrey, in Roumeguere et al., Rev. 

Mycol. 15: 16. 1893. 

= Cercospora mercurialis var. latvici Lepik, Tartu Ülik. Juures Oleva Loodusuur. 

Seltsi Arunded 39: 152. 1933. 

= Cercospora mercurialis var. multisepta Săvul. & Sandu, Hedwigia 75: 225. 

1936. 

Specimens examined: Italy, Parma, on Mercurialis annua (Euphorbiaceae), 1874, 

Passerini, Thüm., Mycoth. Univ. 783, isotypes HBG, HAL. Romania, Distr. Prahova, 

Cheia, on Mercurialis perennis (Euphorbiaceae), 31 Jul. 1969, O. Constantinescu, 

epitype designated here CBS H-9850, culture ex-epitype CBS 550.71; on M. 

annua, 28 Jun. 1967, O. Constantinescu, CBS 549.71; Constanta, Hagieni, on 

Mercurialis ovata (Euphorbiaceae), 14 Jul. 1970, O. Constantinescu & G. Negrean, 

CBS H-9848, BUCM 2012, CBS 551.71. 

Notes: Cercospora mercurialis is supported by TEF, ACT, CAL and 

HIS and can therefore be treated as an individual species. In the 

combined tree (Fig. 2 part 2), it is a sister taxon to C. pileicola. 

Cercospora cf. modiolae 

Specimen examined: New Zealand, leaf spot on Modiola caroliniana (Malvaceae), 

2002, C.F. Hill, Lynfield 535, CPC 5115. 

Notes: This species is phylogenetically supported by TEF and ACT, 

but in the CAL and HIS phylogeny it cannot be distinguished from 

Cercospora sp. E. In the combined tree (Fig. 2 part 1), it is a sister 

taxon to Cercospora sp. E. Cercospora modiolae was described 

from North America and without sequences based on North 

American collections, this name can only tentatively be applied to 

the material from New Zealand. 

Cercospora cf. nicotianae 

Cultures examined: Indonesia, Medan, leaf spot on Nicotiana tabacum 

(Solanaceae), Jan. 1932, H. Diddens & A. Jaarsveld, CBS 131.32 = CPC 5076. 

Mexico, southern region of Tamaulipas, on Glycine max, 17 Oct. 2008, Ma. de 

Jesús Yáñez-Morales, CBS 132632 = CPC 15918. Nigeria, from a leaf spot on N. 

tabacum, Jul. 1969, S.O. Alasoadura, CBS 570.69 = CPC 5075. 

Notes: See C. capsici. The name C. cf. nicotianae, described from the 

USA, can only tentatively be applied here. North American cultures 

and sequence data are needed for comparison and confirmation. 

Phylogenetically, C. cf. nicotianae is supported by CAL and partly HIS 

(CPC 5075 and 5076 were separated from CPC 15918). In the TEF 

phylogeny, the three isolates clustered in a distinct clade with a single 

isolate from C. cf. flagellaris (CPC 5441) but formed three distinct 

lineages in the ACT phylogeny. In the combined tree (Fig. 2 part 5), it 

is a sister taxon to C. cf. brunkii. Notes in the CBS database report that 


157


Fig. 9. Cercospora pileicola (CBS 132607 = CPC 10749). A. Leaf spots. B–E. Weakly developed, fasciculate conidiophores. F–I. Conidia. Scale bars = 10 µm. 

isolate CBS 131.32 was pathogenic when inoculated onto Nicotiana 

leaves. The isolation of C. cf. nicotianae from G. max requires some 

additional explanation. Leaf spots typical of Corynespora cassicola were 

observed, and once incubated in damp chambers, a Cercospora sp. 

was found sporulating on the healthy tissue, which was identified here as 

C. cf. nicotianae. 

Cercospora olivascens Sacc., Michelia 1: 268. 1879. 

Specimens examined: Italy, Selva, on Aristolochia clematidis (Aristolochiaceae), 

Aug. 1877, isotype distributed as Mycoth Veneta 1251, HAL. Romania, Cazanele 

Dunarii, on A. clematidis, 19 Oct. 1966, O. Constantinescu, epitype designated 

here CBS H-21014, culture ex-type CBS 253.67= IMI 124975 = CPC 5085. 

Notes: This species is supported by TEF, ACT, CAL and HIS. In the 

combined tree (Fig. 2 part 1), it is a sister taxon to Cercospora sp. F. 

Cercospora cf. physalidis 

Specimen examined: Peru, on Solanum tuberosum (Solanaceae), L.J. Turkensteen, 


Notes: This species is supported by CAL and HIS. It cannot be 

distinguished from Cercospora sp. I and C. alchemillicola / C. cf. 

alchemillicola based on the TEF and ACT phylogenies. In the 

combined tree (Fig. 2 part 1), it is a sister taxon to Cercospora 

sp. G. According to Braun & Melnik (1997), C. physalidis and 

numerous Cercospora spp. of C. apii s. lat. on various hosts of the 

Solanaceae are morphologically indistinguishable from the latter 

species. Fresh material on Solanum from North America is required 

to resolve this issue. 

Cercospora pileicola C. Nakash., Crous, U. Braun & H.D. 



Pilea. 

Leaf spots circular, 1–2 mm diam, center greyish to pallid, 

surrounded by purplish brown border lines. Caespituli hypogenous. 

Mycelium internal. Stromata lacking to small, to 30 µm diam, 

brown, substomatal. Conidiophores straight to curved, pale brown 

to dark brown, paler towards the apex, solitary or in loose fascicles 

(2–5), sometimes mildly geniculate, simple, thick-walled, uniform in 

width, rarely narrowed after the geniculation, conically truncate at 

the apex, 30–110 × 3–8.5 µm, often swelling at the base, to 9 µm, 

1–3-septate. Conidiogenous cells integrated, terminal, proliferating 

sympodially; loci distinct, slightly protuberant, apical and formed 

on shoulder caused by geniculation, lateral, multi-local (1–2), 

2.5–4 µm diam. Conidia hyaline, cylindrical, acicular to obclavate, 

straight or curved, truncate or long obconically truncate, and slightly 

thickened at the base, acute to obtuse at the apex, 28–175 × 4–7 

µm, 0–12-septate. 

158


Culture characteristics: Colonies erumpent, spreading, with 

moderate, fluffy aerial mycelium and lobate, even margins, reaching 

25 mm diam after 1 wk at 25 ºC in the dark. On MEA surface dirty 

white, reverse cream; red pigment absent. On PDA surface dirty 

white, reverse scarlet, with diffuse red pigment in agar. On OA 

surface scarlet in middle (due to collapsed aerial mycelium), white 

in outer region (due to aerial mycelium), with diffuse red pigment 

surrounding colony. 

Specimens examined: South Korea, Dongducheon, on Pilea pumila (= P. 

mongolica) (Urticaceae), 28 Sep. 2003, H.D. Shin, holotype CBS H-21015, culture 

ex-type CBS 132607 = CPC 10749; Hoengseong, on Pilea hamaoi (≡ P. pumila 

var. hamaoi) (Urticaceae), 10 Oct. 2003, H.D. Shin, CBS H-21016, CBS 132647 = 

CPC 10693; Hongcheon, on Pilea pumila (= P. mongolica), 29 Jul. 2004, H.D. Shin, 

CPC 11369. 

Notes: Cercospora pileicola is characterised by having conidiophores 

that are thick-walled, almost uniform in width, conically truncate at 

the apex, and often swelling at the base; sporulation is restricted 

at the terminal part of conidiophores, and conidia are cylindrical, 

acicular to obclavate with long obconically truncate basal ends and 

rather broad, 4–7 µm. Moreover, this species is phylogenetically 

supported by the TEF, ACT, CAL and HIS phylogenies. In the 

combined tree (Fig. 2 part 2), it is a sister taxon to C. mercurialis. 

Cercospora ganjetica (Purkayastha & Mallik 1978), described from 

India on Urtica urens (Urticaceae), seems to be morphologically 

similar to C. pileicola, above all due to relatively broad conidia, 

but the conidia are strictly cylindrical to obclavate with obconically 

truncate base, i.e. acicular conidia with truncate base are not 

formed. Length and width of conidiophores agree with those of C. 

pileicola, but they are pluriseptate (3–6). The affinity of C. ganjetica 

is quite unclear. Cercospora pileae (Chupp 1954) was described 

from China on “Pilea sp.” with conidia being olivaceous. This species 

is not included in the Chinese monograph of Cercospora species 

(Guo & Liu 2005), but Liu & Guo (1998) reduced this name to 

synonym with Pseudocercospora profusa, suggesting that the type 

host was misidentified, which was confirmed by Y.L. Guo (Beijing, 

in litt.). The type of C. pileae is not Pilea sp. but Acalypha australis 

(Euphorbiaceae). Chinese collections of Cercospora on various 

hosts of the Urticaceae, including Pilea spp., have been assigned 

to Cercospora krugeriana (= nom. inval.), which is a quite distinct 

C. apii-like species with narrower (2.5–5 µm), pluriseptate, acicular 

conidia, up to 214 µm long (Hsieh & Goh 1990, Guo & Liu 2005). 

In addition, the conidiophores are distinctly plurigeniculate. It is 

possible that the latter collections belong to the C. cf. sigesbeckiae 

clade as circumscribed in this study. 

Cercospora polygonacea Ellis & Everh., J. Mycol. 1: 24. 

1885. 

= Cercospora avicularis var. sagittati G.F. Atk., J. Elisha Mitchell Sci. Soc. 8: 

48. 1892. 

= Cercospora polygoni-caespitosi Sawada, Formosan Agric. Rev. 38: 700. 

1942, nom. inval. 

= Cercospora polygoni-blumei Sawada, nom. nud. 


small, up to 30 µm diam, pale olivaceous-brown, intraepiderimal, 

substomatal. Conidiophores successively geniculate at the upper 

portion, pale brown, paler towards the apex, solitary or in loose 

fascicles (2–5), simple, thick-walled, irregular in width, narrowed 

after the geniculation, conically truncated at the apex, 21–100 × 

5–7 µm, 0–3-septate. Conidiogenous cells integrated, terminal, 

intercalary, proliferating sympodially, multi-local (1–6); loci distinct, 

protuberant, apical and formed on shoulder caused by geniculation, 

lateral, 2.5–3 µm diam. Conidia solitary, hyaline, acicular to 

obclavate, straight or slightly curved, truncate or obconically 

truncate, and thickened at the base, obtuse or acute at the apex, 

60–110 × 3.5–5.5 µm, 4–9-septate, thin-walled, smooth. 

Specimen examined: South Korea, Cheongju, on Persicaria longiseta (≡ P. blumei) 

(Polygonaceae), 4 Jun. 2004, H.D. Shin, CBS H-21017, CBS 132614 = CPC 11318. 

Notes: Morphologically the Korean specimen is similar to C. 

polygonaeae, which Chupp (1954) also reported from Asia (Japan). 

Material from the USA on Polygonum (Polygonaceae) is required to 

resolve whether this taxon is the same or phylogenetically distinct. 

The species is phylogenetically distinct from the other species 

included in this study based on the TEF and ACT phylogenies, but 

indistinguishable from C. achyranthis on the HIS phylogeny and 

from C. achyranthis, C. sojina and C. campi-silii based on the CAL 

phylogeny. In the combined tree (Fig. 2 part 2), it is a sister taxon 

to C. achyranthis. 

Cercospora punctiformis Sacc. & Roum., Rev. Mycol. 3: 

29. 1881. 

= Fusicladium cynanchi Reichert, Bot. Jahrb. Syst. 56: 720. 1921. 

= Cercospora punctiformis f. catalaunica Gonz. Frag., Mem. Real Acad. Ci. 

Exact. Madrid, Ser. 2, 6: 250–252. 1927. 

= Cercospora cynanchi Lobik, Mat. Fl. Faun. Obsl. Tersk. Okr., Pjatigorsk: 53. 

1928. 

Leaf spots scattered to confluent, at first appearing as purplish 

spots, later greyish brown with purplish border lines, mostly veinlimited, 

but rather circular to irregular in case of humid and hot 

weather (esp. in rainy summer), mostly less than 7 mm diam. 

Caespituli amphigenous, but abundantly hypophyllous. Mycelium 

internal. Stromata well-developed, up to 35 µm diam, substomatal 

and intraepidermal, brown to dark brown. Conidiophores in 

fascicles (5–30), loose to moderately divergent, olivaceous-brown, 

fairly uniform in colour, but paler towards the apex in longer ones, 

simple, conically truncate at the apex, geniculate (0–4), 20–60(– 

150) × 4–7.5 µm, 0–3-septate. Conidiogenous cells integrated, 

proliferating sympodially, terminal and intercalary; loci distinctly 

thickened, protuberant, apical or formed on the shoulders caused 

by geniculation, 3–4 µm diam. Conidia solitary, hyaline, variable 

in shape and length, obclavato-cylindrical or elliptical, obconically 

truncate and thickened at the base, obtuse to subacute at the 

apex, 25–100(–175) × 4–6.5 µm, 0–8(–12)-septate, thin-walled, 

smooth. 

Specimen examined: South Korea, Bonghwa, on Cynanchum wilfordii 

(Asclepiadaceae), 18 Oct. 2007, H.D. Shin, CBS H-21018, CBS 132626 = CPC 

14606. 

Notes: The Korean sample on Cy. wilfordi is morphologically close 

to Cercospora punctiformis, but the latter species was described 

from North Africa. Hence, sequence data based on North African 

material are needed to confirm the conspecificity of Korean 

collections. The ACT and HIS phylogenies separate C. punctiformis 

from the other species included in this study; in the TEF and CAL 

phylogenies the isolate occurs on a longer branch in a clade 

consisting of C. sojina and C. achyranthis. In the combined tree 

(Fig. 2 part 2), it is a sister taxon to C. euphorbiae-sieboldianae. 

Cercospora cf. resedae 

Specimens examined: New Zealand, Auckland, C.F. Hill, on Reseda odorata 

(Resedaceae), specimen in HAL, CBS 118793 (as C. resedae). Romania, Bucuresti, 


159


on Helianthemum sp. (Cistaceae), 15 Sep. 1966, O. Constantinescu, CBS 257.67 = 

CPC 5057 (as C. cistinearum). 

Notes: Both the names C. resedae and C. cistinearum are 

available for this clade. We give preference to C. resedae, which 

is the older name. However, the application of this name is very 

uncertain and only tentative. Fresh European collections from 

Reseda (Resedaceae) are needed to designate an epitype and fix 

the application of the name. The TEF and ACT phylogenies could 

not distinguish these two isolates from C. apii and C. beticola, and 

the CAL phylogeny could not distinguish it from C. apii. The HIS 

phylogeny places the two isolates in the deviating C. beticola Clade 

1. A combination of these phylogenetic positions explains the basal 

position of the species to the C. apii and C. beticola clades in the 

combined phylogeny (Fig. 2 part 5). 

Cercospora cf. richardiicola 

Caespituli amphigenous. Mycelium internal. Stromata 

intraepidermal or substomatal, lacking to well-developed, up to 55 

µm diam, pale brown to brown. Conidiophores solitary or in loose 

fascicles (2–15), simple, rarely branched, pale brown to reddish 

brown, paler towards the apex, moderately thick-walled, irregular in 

width, sometimes swelling at the shoulders caused by geniculation, 

truncate or short obconically truncate at the apex, straight to 

mildly geniculate, often narrowed with successive geniculation 

at the apex, sometimes swelling at the base to twice the width, 

30–260(–360) × 2–7 µm, multi-septate (2–11). Conidiogenous 

cells integrated, terminal and intercalary, proliferating sympodially, 

or rarely percurrently; loci apical or formed on shoulders caused 

by geniculation, lateral, circumspersed, distinctly thickened and 

darkened, often slightly protuberant, 1.5–3.5 µm diam. Conidia 

solitary, rarely catenate, filiform, cylindrical to acicular, hyaline, 

thickened and truncate or rarely short obconically truncate at the 

base, rounded or acute at the apex, straight or slightly curved, 

25–300 × 2.5–5 µm, 2–20-septate, thin-walled, smooth. 

Description of caespituli on V8; (MUCC 128, 132, 138, 582): 

Caespituli dimorphic in culture; one type is small and commonly 

observed, while the other is large and rarely observed (C. apii 

s. lat. type; described in parenthesis). Conidiophores solitary to 

loosely fasciculate, arising from hyphae, subhyaline to pale brown, 

irregular in width, smooth, meager and thin-walled, sinuousgeniculate 

to geniculate (straight to geniculate), sometimes 

branched (unbranched), truncate or conically truncate at the tip 

(truncate at the tip), 6.5–60(–520) × 2.5–5 µm, multi-septate. 

Conidiogenous cells integrated, terminal or intercalary, proliferating 

sympodially, 1–5 multi-local (uni-local); loci moderately thickened, 

apical and lateral, circumspersed at the apex of conidiogenous 

cells, protuberant (not protuberant), 1.25–2(–4.5) µm in width. 

Conidia hyaline, filiform to acicular, slightly thickened and obconical 

truncate (truncate) at the base, acute at the apex, 27.5–277.5 × 

2–3.5(–6.5) µm, 3–21-septate. 

Specimens examined: Japan, Chiba, on Zantedeschia sp. (Araceae), S. Uematsu 

& C. Nakashima, MUMH 11403, MUCC 578 = MAFF 238210; Ehime, on Tagetes 

erecta (Asteraceae), 27 Oct. 2004, J. Nishikawa, MUMH 11392, MUCC 128; 

Shizuoka, on Fuchsia ×hybrida (Onagraceae), 22 Jun. 2006, J. Nishikawa, 

MUMH 11396, MUCC 138; on Osteospermum sp. (Asteraceae), 11 Sep. 2004, J. 

Nishikawa, MUMH 11395, MUCC 132; Tokyo, on Gerbera hybrida (Asteraceae), J. 

Takeuchi, MUCC 582 = MAFF 238880. 

Notes: The name Cercospora cf. richardiicola can be applied to this 

clade only tentatively. The latter species was described from the 

USA. Hence, sequences obtained from North American collections 

are necessary to confirm the identity with true C. richardiicola. All 

clades within this complex (C. cf. richardiicola, C. kikuchii, C. cf. 

sigesbeckiae) are poorly resolved on TEF, ACT, CAL, and HIS 

regions. The TEF and HIS phylogenies could not distinguish it from 

Cercospora spp. M–Q, C. kikuchii and C. cf. sigesbeckiae. The 

ACT phylogeny split it into three clades, namely isolates MUCC 

128, 132 and 578 intermixed with C. malloti and Cercospora sp. P, 

isolates MUCC 138 and 582 sister to Cercospora sp. N and isolate 

CPC 14680 intermixed with C. kikuchii and Cercospora sp. O. The 

CAL phylogeny could not distinguish the isolates from C. rodmanii, 

C. cf. sigesbeckiae and Cercospora sp. N. Currently this complex is 

split into three sister clades (Fig. 2 part 4), which could be due to a 

common ancestor, and an ongoing process of speciation. 

Cercospora richardiicola is characterised in that conidiophores 

are sometimes swelling at the shoulders caused by geniculation, 

truncate or short obconically truncate at the apex, often narrowed 

(not attenuated) successive geniculation at the apex, and 

sometimes swelling at the base up to twice its median width; 

and loci on conidiogenous cells are circumspersed and distinctly 

thickened. These characteristics were sometimes difficult to find 

on the host plant due to the difference of maturity of the fungus. 

However, the morphological characteristics of this species on V8 

medium were well preserved regardless of differences of host and 

maturity. 

Isolates of C. richardiicola have a tendency to infect a wide host 

range. Isolates are frequently found together with other Cercospora 

spp. on the same leaf spots, which make identification problematic. 

Cercospora ricinella Sacc. & Berl., Atti Reale Ist. Ven. Sci. 

Lett. Art, Ser. 3: 721. 1885. 

≡ Cercosporina ricinella (Sacc. & Berl.) Speg., Anales Mus. Nac. Hist. Nat. 

Buenos Aires 20: 429. 1910. 

= Cercospora albido-maculans G. Winter, Hedwigia 24: 202, 1885 (also in J. 

Mycol. 1: 124. 1885). 

= Cercospora ricini Speg. Anales Mus. Nac. Hist. Nat. Buenos Aires Ser. 2. 3: 

343. 1899. 

Leaf spots circular to angular, 1–10 mm diam, first appearing as 

brown spots, later centre becoming greyish white with reddish 

brown border lines. Caespituli amphigenous, mainly hypophyllous. 

Mycelium internal. Stromata lacking to well-developed, pale brown 

to brown, substomatal or intraepidermal, 14–50 µm. Conidiophores 

pale brown, paler towards apex, sinuous-geniculate to geniculate 

above the middle, in loose fascicles (2–14), slightly divergent, 

irregular in width, slightly attenuated at the apex, conical at the 

tip, sometimes constricted at proliferating point, 35–140 × 4.5–5.5 

µm, 2–4-septate. Conidiogenous cells integrated, terminal and 

intercalary, proliferating sympodially; multi-local at the apex, loci 

distinct, slightly protuberant, mainly apical, lateral, 2–3 µm diam. 

Conidia solitary, rarely catenate, hyaline, cylindrical to cylindroobclavate, 

acicular, obconically truncate or truncate and distinctly 

thickened at the base, acute to subacute at the apex, 20–130 × 

2.5–5.5 µm, 1–8-septate, thin-walled, smooth. 

Specimens examined: South Korea, Chuncheon, on Ricinus communis 

(Euphorbiaceae), 11 Oct. 2002, H.D. Shin, CPC 10104; 7 Oct. 2003, H.D. Shin, 

CBS 132605 = CPC 10734; CPC 10735–10736. 

Notes: This species is characterised in that the conidiophores are 

slightly attenuated at the apex, sinuous-geniculate to geniculate 

above the middle, and the conidia are rarely catenate. It is supported 

by ACT, CAL and HIS. In the TEF phylogeny it could not be 

160


distinguished from C. delaireae, C. cf. chenopodii and Cercospora 

sp. K. In the combined tree (Fig. 2 part 2), it is a sister taxon to C. 

delaireae. Epitype material should be collected in Australia, where 

this species was described from. 

Cercospora rodmanii Conway, Canad. J. Bot. 54: 1082. 

1976. 

Specimens examined: Brazil, Oroco, on Eichhornia crassipes (Pontederiaceae), R. 

Charudattan, CBS 113126 = RC3409; Rio Verde, on E. crassipes, R. Charudattan, 

CBS 113123 = RC3660. Mexico, Carretero, on E. crassipes, R. Charudattan, CBS 

113124 = RC2867. USA, Florida, on E. crassipes, R. Charudattan, CBS 113128 

= RC394; CBS 113130 = RC393; K. Conway, CBS 113129 = RC397. Venezuela, 

Maracay, on E. crassipes, R. Charudattan, CBS 113131 = RC395. Zambia, on E. 

crassipes, M. Morris, CBS 113125 = RC4101. 

Notes: Cercospora rodmanii is supported in the TEF phylogeny. 

In the ACT phylogeny, the clade includes on longer branches 

also C. cf. ipomoeae and Cercospora sp. M. and in the CAL 

phylogeny it was intermixed with isolates of C. cf. richardiicola, 

C. cf. sigesbeckiae and Cercospora sp. N. In the HIS phylogeny, 

it could not be distinguished from Cercospora spp. N–Q. In the 

combined tree (Fig. 2 part 4), it is a sister taxon to Cercospora sp. 

N. Tessmann et al. (2001) considered C. rodmanii to be a synonym 

of C. piaropi whereas Crous & Braun (2003) retained C. rodmanii as 

a separate species. From the results of the present study, we prefer 

to retain these as two separate species as reported previously 

(Groenewald et al. 2010a, Montenegro-Calderón et al. 2011). The 

isolate originally included as C. piaropi in this study (CBS 113127) 

is treated in the present study under C. cf. flagellaris; this isolate is 

also the same isolate used by Tessmann et al. (2001). Montenegro- 

Calderón et al. (2011) confirmed the identity of their isolates 

with the same genes included here, as well as beta-tubulin, and 

demonstrated that their isolates of C. rodmanii were able to also 

infect other important crops such as beet and sugar beet whereas 

C. piaropi (treated under C. cf. flagellaris in this study) isolate CBS 

113127 and C. rodmanii isolate CBS 113129 were specific to water 

hyacinth. 

Cercospora rumicis Pavgi & U.P. Singh, Mycopathol. Mycol. 

Appl. 23: 191. 1964. 

= Cercospora rumicis Ellis & Langl. ex Chupp, A monograph of the fungus 

genus Cercospora: 453. 1954, nom. inval. 

Specimen examined: New Zealand, Manurewa, on Rumex sanguineus 

(Polygonaceae), C.F. Hill, Lynfield 671, CPC 5439. 

Notes: Cercospora rumicis was treated as part of the larger C. apii 

s. lat. complex by Crous & Braun (2003). Although it clusters basal 

to the C. zebrina clade, we suspect that it may represent a distinct 

taxon. Fresh collections are required from India to fix the application 

of this name. In the TEF phylogeny, it is not distinguished from C. 

zebrina and C. armoraciae, and likewise not from C. armoraciae on 

the ACT phylogeny. In the CAL phylogeny, it is not distinguished 

from C. zebrina and C. althaeina. It is distinct from all species 

included in this study based on the HIS phylogeny. In the combined 

tree (Fig. 2 part 3), it is basal to the lineage containing Cercospora 

sp. L, C. althaeina, C. zebrina and C. violae. 

Cercospora senecionis-walkeri Phengsintham, 

Chukeatirote, McKenzie, K.D. Hyde & U. Braun, Pl. Pathol. & 

Quarantine 2(1): 70. 2012. 

Specimen examined: Laos, on Senecio walkeri (Asteraceae), 20 Feb. 2010, 

P. Phengsintham, LC 0396, NUOL P567, CBS 132636 = CPC 19196. 

Notes: Several Cercospora species have been described from 

Senecio (Asteraceae), but all of them are quite distinct from the 

species on S. walkeri. Cercospora senecionis was reduced to 

synonym with C. jacquiniana by Chupp (1954). Based on a reexamination 

of type material, Braun (in Braun & Mel’nik 1997) 

showed that C. senecionis represents a quite distinct true species 

of Cercospora with acicular conidia, similar to those of C. apii s. lat., 

but 80–200 × 3–6 µm in size. Cercospora jaquiniana is similar to 

C. senecionis-walkeri (Pheng et al. 2012) with regard to its conidial 

shape, but has much shorter conidiophores and shorter conidia, 

usually only 1–3-sepate, which are hyaline, subhyaline to faintly 

pigmented. Thus, this species was reallocated to Passalora by 

Braun (in Braun & Mel’nik 1997). The Indian taxon C. senecionisgrahamii 

is close to C. senecionis, but differs in having acicular 

to obclavate conidia, only 3–4 µm wide. The North American C. 

senecionicola is also quite distinct from C. senecionis-walkeri by 

its very narrow acicular-subcylindrical conidia, only 2–3.5 µm 

wide (Chupp 1954). The South American Passalora senecionicola 

(Braun et al. 2006) on Senecio bonariensis (Asteraceae) in 

Argentina is morphologically very close to C. senecionis-walkeri 

but characterised by having quite distinct lesions, larger stromata, 

up to 60 µm diam and short conidia that are cylindrical. Passalora 

senecionicola was assigned to Passalora due to subhyaline to pale 

olivaceous conidia, but it is possible that this species rather belongs 

in Cercospora which may be suggested by the phylogenetic position 

of C. senecionis-walkeri, which clusters within the Cercospora 

clade, although the conidia range from being almost hyaline to 

somewhat pigmented. Cercospora senecionis-walkeri is distinct 

from all other species included in this study based on the TEF, ACT, 

CAL and HIS phylogenies. In the combined tree (Fig. 2 part 1), it is 

basal to the other Cercospora spp. 

Cercospora cf. sigesbeckiae 

Morphologically similar to taxa in the C. apii s. lat. complex. 

Specimens examined: Japan, Chiba, on Begonia sp. (Begoniaceae), 24 Jun. 1997, 

S. Uematsu, MUMH 11405, MUCC 587 = MAFF 237690 = MUCNS 197; Fukuoka, 

on Sigesbeckia glabescens (Asteraceae), 31 Oct. 1948, S. Katsuki, holotype in 

TNS; Saitama, on Glycine max, 1949, H. Kurata, MUCC 589 = MAFF 305039 (as 

C. kikuchii); Tokyo, on Dioscorea tokoro (Dioscoreaceae), 10 Nov. 2007, I. Araki, 

MUMH 10951, MUCC 849. South Korea, Chuncheon, on S. glabrescens, 7 Oct. 

2003, H.D. Shin, CBS H-21019, CBS 132601 = CPC 10664 (as C. sigesbeckiae); 

on Persicaria orientalis (= P. cochinchinensis) (Polygonaceae), 11 Oct. 2002, 

H.D. Shin, CBS 132641 = CPC 10117 (as C. polygonacea); Hongcheon, on Pilea 

pumila (= P. mongolica), 3 Oct. 2002, H.D. Shin, CBS 132642 = CPC 10128 (as C. 

ganjetica); Namyangju, on Paulownia coreana (Scrophulariaceae), 22 Oct. 2003, 

H.D. Shin, CBS H-21020 = HAL 1863, CBS 132606 = CPC 10740; Yanggu, on 

Sigesbeckia pubescens, 28 Sep. 2007, H.D. Shin, CBS 132621 = CPC 14489 (as 

C. sigesbeckiae); on Malva verticillata (Malvaceae), H.D. Shin, CBS H-21021, CBS 

132675 = CPC 14726 (as C. malvacearum). 

Notes: See Cercospora cf. richardiicola. The application of the 

name C. cf. sigesbeckiae (based on type material from Japan), to 

this clade can only be tentative. Japanese cultures and sequences 

are needed to confirm its identity. In the TEF and CAL phylogenies, 

isolates are intermixed with those of Cercospora spp. M–Q, C. 

kikuchii and C. cf. richardiicola; in the ACT phylogeny it cannot be 

distinguished from C. fagopyri. In the HIS phylogeny the isolates 

form a clade on a longer branch in a clade containing C. kikuchii 

and some isolates of C. cf. richardiicola. In the combined tree (Fig. 

2 part 4), it is a sister taxon to C. kikuchii and C. cf. richardiicola. 


161


Cercospora sojina Hara, Nogyokoku (Tokyo) 9: 28. 1915. 

≡ Cercosporina sojina (Hara) Hara, Jitsuyo-sakumotsu-byorigaku: 112. 

1925. 

≡ Cercosporidium sojinum (Hara) X.J. Liu & Y.L. Guo, Acta Mycol. Sinica 

1: 100. 1982. 

≡ Passalora sojina (Hara) Poonam Srivast., J. Living World 1: 118. 1994, 

comb. inval. 

≡ Passalora sojina (Hara) H.D. Shin & U. Braun, Mycotaxon 58: 63. 1996. 

≡ Passalora sojina (Hara) U. Braun, Trudy Bot. Inst. im. V.L. Komarova 20: 

93. 1997, comb. superfl. 

= Cercospora daizu Miura, Manchurian R.R. Agric. Exp. Stat. Bull. 11: 25. 

1920. 

Caespituli amphigenous. Mycelium internal. Stromata small, up to 

35 µm diam, intraepidermal and substomatal, brown. Conidiophores 

solitary or in loose fascicles (2–5), brown, paler towards the apex, 

simple, rarely branched, irregular in width, constricted at the parts 

of proliferation, conically truncate at the apex, straight to geniculate, 

55–200 × 4.5–5 µm, 2–4-septate. Conidiogenous cells integrated, 

proliferating sympodially, terminal and intercalary, uni- or multi-local 

(1–2); loci distinctly thickened, protuberant, apical or formed on the 

shoulders caused by geniculation, 2–4 µm diam. Conidia solitary, 

hyaline, cylindrical to obclavate, fusiform, obovoid, obconically 

truncate and thickened at the base, obtuse at the apex, 25–70 × 

5.5–9 µm, 1–5-septate, thin-walled, smooth. 

Specimens examined: Argentina, on Glycine max (Fabaceae), 2009, F. Scandiani, 

CPC 17964 = CBS 132684 = CPC 17971 = “CCC 173-09, 09-495”; “CCC 155-09, 

09-285-5”; CPC 17965 = “CCC 156-09, 09-285-4”; CPC 17966 = “CCC 157-09, 

09-285-3”; CPC 17967 = “CCC 158-09, 09-285-1”; CPC 17968 = “CCC 159-09, 

09-285-7”; CPC 17969 = “CCC 167-09, 09-881”; CPC 17970 = “CCC 172-09, 09- 

320”; CPC 17972 = CCC 174-09; CPC 17973 = “CCC 176-09, 09-882”; CPC 17974 

= “CCC 177-09, 09-2488-1”; CPC 17975 = “CCC 178-09, 09-1438-2”; CPC 17976 

= “CCC 179-09, 09-2591”; CPC 17977 = “CCC 180-09, 09-2520”. South Korea, 

Hoengseong, on G. soja, 4 Sep. 2005, H.D. Shin, CBS 132018 = CPC 12322; 

Hongcheon, on G. soja, 20 Jul. 2004, H.D. Shin, neotype designated here CBS 

H-21022, culture ex-type CBS 132615 = CPC 11353; CPC 11354; CPC 11420– 

11423. 

Notes: Type material of this species (Japan, Tokyo, on G. max, 

1909, K. Hara) was not located and is probably lost. Cercospora 

sojina was transferred to the genus Passalora based on its distinctly 

thickened loci, and cylindrical and relatively wide conidia (Shin 

& Braun 1996). However, the hyaline conidia of this species are 

indicative of the fact that it is best retained in Cercospora (Crous & 

Braun 2003), which is fully supported by its position in phylogenetic 

trees among other Cercospora species. The species is supported 

as distinct based on the ACT and HIS phylogenies; in the TEF and 

CAL phylogenies the isolates of C. achyranthis and C. campi-silii 

are intermixed with the C. sojina isolates. In the combined tree (Fig. 

2 part 2), it is a sister taxon to C. campi-silii. 

Cercospora sp. A 

Culture sequenced: Mexico, on Chenopodium sp. (Amaranthaceae), 

M. de Jesus Yanez, CBS 132631 = CPC 15872. 

Notes: This isolate is phylogenetically distinct (Fig. 2 part 1) from 

the other species included in this study. Unfortunately, the specimen 

and specimen details were not available for study. 

Cercospora sp. B 


to developed, up to 60 µm, intraepidemal, substomatal, brown. 

Conidiophores straight or geniculate, solitary to 2–21 in dense 

fascicle, 0–5-septate, 20–75 × 4.5–6 µm, almost uniform in width, 

constricted at shoulder, conically truncate or truncate at the tip. 

Conidiogenous cells integrated, terminal, intercalary, proliferating 

sympodially, multilocal; loci thickened, apical, rarely lateral, 2–2.5 

µm diam, slightly protuberant. Conidia solitary, hyaline, cylindroobclavate 

to acicular, obconically truncate at thickened base, tip 

obtuse, 45–135 × 4–5 µm, 4–9-septate, thin-walled, smooth. 

Specimen examined: South Korea, Kangnung, on Ipomoea purpurea 

(Convolvulaceae), 10 Sep. 2003, H.D. Shin, CBS 132602 = CPC 10687 (as C. 

ipomoeae); CPC 10688–10689 (as C. ipomoeae). 

Notes: This isolate was obtained from Ipomoea in Korea, but differs 

in its phylogeny to other isolates of C. cf. ipomoeae. It has a unique 

position in the ACT, CAL and HIS phylogenies and is intermixed with 

C. delaireae and Cercospora sp. K based on the TEF phylogeny. In 

the combined tree (Fig. 2 part 1), it is a basal taxon to C. agavicola. 

Several species of Cercospora have thus far been described from 

Ipomoea, and more collections would be required to resolve the 

status of this collection. 

Cercospora sp. C 

Culture sequenced: Mexico, M. de Jesus Yanez, CBS 132629 = 

CPC 15841. 




Cercospora sp. D 

Culture sequenced: Mexico, M. de Jesus Yanez, CBS 132630 = 

CPC 15856. 




Cercospora sp. E 

Cultures sequenced: Mexico, M. de Jesus Yanez, CBS 132628 = 

CPC 15632, CPC 15801. 

Notes: These isolates are phylogenetically distinct (Fig. 2 part 1) 

from the other species included in this study. Unfortunately, the 

specimen(s) and specimen details were not available for study. 

Cercospora sp. F 

Specimen examined: South Africa, on Zea mays (Poaceae), P. Caldwell, CBS 

132618 = CPC 12062. 

Notes: This isolate, which is supported by the CAL phylogeny, 

must be treated as an independent species. In the TEF and 

HIS phylogenies it is present on a longer branch in a clade 

consisting of isolates of Cercospora spp. G–I, C. alchemillicola 

/ C. cf. alchemillicola, C. cf. physalidis and C. celosiae. In the 

ACT phylogeny it cannot be distinguished from Cercospora sp. 

Q. In the combined tree (Fig. 2 part 1), it is a sister taxon to 

C. cf. physalidis. 

162


Cercospora sp. G 

Caespituli amphigenous. Mycelium internal. Stromata small to 

well-developed, up to 60 µm diam, brown, intraepidermal and 

substomatal. Conidiophores straight or sinuously geniculate, 

loosely fasciculate (3–10), pale brown to brown, paler towards the 

apex, moderately thick-walled, simple, irregular in width, attenuated 

at the apex, irregularly constricted following the proliferation, 30– 

50 × 3.5–4.5 µm, 0–2-septate. Conidiogenous cells integrated, 

terminal, rarely intercalary, proliferating sympodially, multi-local; 

loci thickened, darkened, apical or formed on the shoulders caused 

by geniculation, lateral, sometimes circumspersed, 1.25–2 µm 

in diam. Conidia solitary, hyaline, cylindrical to obclavate, often 

acicular, straight or slightly curved, truncate or subtruncate at the 

thickened base, obtuse or subacute at the apex, 15–165 × 2–4 µm, 


Specimen examined: New Zealand, Manurewa, on Salvia viscosa (Lamiaceae), 

C.F. Hill, Lynfield 626, CPC 5438 (as C. salviicola); Kopuku, on Bidens frondosa 

(Asteraceae), C.F. Hill, Lynfield 559, CBS 115518 = CPC 5360. 

Notes: This species is thus far only known from New Zealand. It 

is distinct from the other included species based on its position 

in the HIS phylogeny; in the TEF and ACT phylogenies it cannot 

be distinguished from Cercospora spp. F, H and I as well as C. 

alchemillicola / C. cf. alchemillicola, C. cf. physalidis and C. 

celosiae. In the CAL phylogeny it forms a distinct clade that cannot 

be distinguished from Cercospora sp. H. In the combined tree (Fig. 

2 part 1), it is a sister taxon to Cercospora sp. H. 

Cercospora sp. H 

Specimens examined: Argentina, on Chamelaucium uncinatum (Myrtaceae), S. 

Wolcan, CPC 11620 = 1CRI. New Zealand, on Dichondra repens (Convolvulaceae), 

C.F. Hill, Lynfield 536, CBS 115205 = CPC 5116. 

Notes: This species is distinct from the other included species 

based on its position in the HIS phylogeny; in the TEF and ACT 

phylogenies it cannot be distinguished from Cercospora spp. F, 

G and I as well as C. alchemillicola / C. cf. alchemillicola, C. cf. 

physalidis and C. celosiae. In the CAL phylogeny it forms a distinct 

clade that cannot be distinguished from Cercospora sp. G. Whether 

Cercospora spp. G and H could be conspecific awaits collection 

of more isolates. In the combined tree (Fig. 2 part 1), it is a sister 

taxon to C. celosiae and Cercospora sp. I. 

Cercospora sp. I 

? Cercospora deutziae Ellis & Everh., J. Mycol. 4: 5. 1888. 

? Cercospora guatemalensis A.S. Mull. & Chupp, Ceiba 1: 173. 1950. 

Specimens examined: South Korea, Suwon, on Ajuga multiflora (Lamiaceae), 

22 Oct. 2002, H.D. Shin, CBS 132643 = CPC 10138 (as C. guatemalensis). 

New Zealand, Manurewa, on Coreopsis verticillata (Asteraceae), 2 Jun. 2003, 

C.F. Hill, Lynfield 866A, CBS 132597 = CPC 10615; Lynfield 866B, CPC 10616; 

on Deutzia crenata (Hydrangeaceae), 5 May 2002, C.F. Hill, Lynfield 610, 

CBS 114818 = CPC 5362 (named as C. deutziae); on Deutzia purpurascens 

(Hydrangeaceae), 5 May 2002, C.F. Hill, Lynfield 607, CBS 114815 = CPC 

5364 (named as C. deutziae); on Deutzia ×rosea (= D. gracilis × purpurascens) 

(Hydrangeaceae), Apr. 2002, C.F. Hill, Lynfield 599, CBS 114816 = CPC 5363 

(named as C. deutziae); on Fuchsia procumbens (Onagraceae), 5 May 2002, 

C.F. Hill, Lynfield 613, CBS 114817 = CPC 5365 (named as C. fuchsia); on 

Nicotiana sp. (Solanaceae), 8 Jun. 2002, C.F. Hill, Lynfield 667, CPC 5440; 

Mt Albert, on Gunnera tinctoria (Gunneraceae), 29 Feb. 2004, C.F. Hill, 

Lynfield 997, CBS 115121; Whangarei, on Archontophoenix cunninghamiana 

(Arecaceae), 10 Feb. 2004, C.F. Hill, CBS 115117. 

Notes: This clade is quite distinct based on the combined tree 

(Fig. 2 part 1), and mainly consists of isolates from various 

host plants in New Zealand. In the TEF and ACT phylogenies it 

cannot be distinguished from Cercospora spp. F, G and H as well 

as C. alchemillicola / C. cf. alchemillicola, C. cf. physalidis and 

C. celosiae. In the CAL phylogeny it forms a distinct clade that 

cannot be distinguished from the single isolate of C. celosiae. In 

the HIS phylogeny it cannot be distinguished from Cercospora sp. 

F, C. alchemillicola / C. cf. alchemillicola and C. celosiae. In the 

combined tree (Fig. 2 part 1), it is a sister taxon to C. celosiae and 

Cercospora sp. H. Most of the Cercospora sp. I isolates from New 

Zealand would be given a species epithet based on each host plant, 

if these were classified with a conventional species concept. From 

the results of the phylogenetic tree, these isolates are recognised 

as belonging to a single species with a wide host range. Braun & 

Hill (2004) examined the collections on Co. verticillata, D. crenata, 

D. purpurascens, D. × rosea, F. procumbens, Nicotiana sp., and 

Braun et al. (2006) studied the samples on A. cunninghamiana 

and G. tinctoria. They referred all of them to C. api s. lat. as 

circumscribed in Crous & Braun (2003) as they are characterised 

by having hyaline acicular conidia formed singly, i.e. the present 

unnamed species is a C. apii-like plurivorous species. 

Cercospora sp. J 

Culture sequenced: Japan, Aichi, on Antirrhinum majus 

(Plantaginaceae), 8 May 2007, M. Matsusaki, MUMH10490, 

MUCC 541. 



was not available for study. 

Cercospora sp. K 


composed of a few brown cells. Conidiophores emerging through 

the cuticle or arising from stomatal openings, pale brown, paler 

towards the apex, almost uniform in width, sometimes narrowed 

at the apex following the sympodial proliferation, often constricted 

at septa and proliferating points, solitary or 2–3 in a loose fascicle, 

straight or slightly curved to sinuously geniculate, moderately thickwalled, 

0–5-septate, 30–110 × 3.5–5 μm, truncate or conically 

truncate at the apex. Conidiogenous cells terminal, rarely intercalary, 

proliferating sympodially; loci slightly thickened, slightly protuberant 

(subtruncate) or flat, refractive, apical and lateral, 1.5–2.5 μm in 

diam. Conidia solitary, hyaline, filiform to acicular or obclavate, 

straight to slightly curved, truncate or obconically truncate at the 

slightly thickened at the basal end, acute at the apex, indistinctly or 

distinctly 1–14-septate, 35–230 × 1.5–5 μm, thin-walled, smooth. 

Specimens examined: South Korea, Namyangju, on Ipomoea coccinea (≡ 

Quamoclit coccinea) (Convolvulaceae), 9 Oct. 2002, H.D. Shin, CPC 12391; 30 

Sep. 2003, H.D. Shin, CBS 132603 = CPC 10719; 15 Oct. 2005, H.D. Shin, CPC 

10094. 

Notes: This species is phylogenetically supported based on DNA 

sequence data of ACT, CAL and HIS. In the TEF phylogeny, 

these isolates cannot be distinguished from C. ricinella, C. cf. 

chenopodii and C. delaireae. In the combined tree (Fig. 2 part 

2), it is a sister taxon to C. cf. flagellaris. Different species of 

Cercospora have been described from Ipomoea spp. Cercospora 


163


ipomoeae-pedis-caprae was previously treated as a synonym of 

C. ipomoeae (Bagyanarayana et al. 1995, Shin & Kim 2001), since 

the length of the conidiophores and conidia in the latter species 

is variable. Braun et al. (2001) pointed out the differences among 

the Cercospora species on Ipomoea spp. based on the description 

of these species by García et al. (1996), and proposed that C. 

ipomoeae-pedis-caprae must be retained as a separate species. 

However, Cercospora isolates on Ipomoea cluster in three different 

places in the tree, and thus this complex remains unresolved and 

without epitypification the application of the names C. ipomoeae 

and C. ipomoeae-pedis-caprae remains unclear. 

Cercospora sp. L 

Specimen examined: New Zealand, on Crepis capillaris (Asteraceae), C.F. Hill, 

Lynfield 534, CBS 115477 = CPC 5114. 

Notes: In vivo material on Crepis capillaris from New Zealand 

collected by C.F. Hill, Auckland, 9 Jul. 2000, deposited at HAL has 

been examined and is characterised as follows: Conidiophores 

solitary or in small, loose fascicles, straight to usually geniculatesinuous, 

unbranched, 20–100 × 3–6 µm, usually 1–4-septate, 

pale olivaceous throughout or olivaceous-brown below and paler 

towards the tip; conidiogenous cells integrated, usually terminal, 

sympodial, multi-local; conidiogenous loci 2–3 µm diam, thickened 

and darkened; conidia solitary, acicular, short conidia occasionally 

subcylindrical, straight curved to somewhat sigmoid, 60–170 × 

3–4 µm, pluriseptate, apex subacute or subobtuse, base truncate, 

occasionally slighty attenuated at the very base (at hilum), hila 2–3 

µm wide. The application of the name Cercospora crepidis Onděj & 

Zavrěl, described from Europe (Czech Republic) on Crepis capillaris, 

for the fungus from New Zealand is not possible. The latter species is 

characterised by having obclavate conidia with distinctly obconically 

truncate base and short, aseptate conidiophores, only 14–22 µm 

long (Ondřej & Zavrěl 1971). In the TEF and CAL phylogeny this 

isolate clusters with C. zebrina and C. armoraciae and on a longer 

branch in the C. zebrina clade in the ACT phylogeny. It is only in the 

HIS phylogeny that this isolate is clearly distinct, clustering as sister 

taxon to C. delaireae. In the combined tree (Fig. 2 part 3), it is a sister 

taxon to C. althaeina and C. zebrina. 

Cercospora sp. M 

Specimen examined: Thailand, Chachoengsao Province, Sanamchaikhet, on 

leaves of Acacia mangium (Fabaceae), 28 May 2003, K. Pongpanich, CBS H-9876, 


Notes: Crous et al. (2004b) isolated several species of Cercospora 

from A. mangium in Thailand, some of which were linked to single 

ascospore isolates of a mycosphaerella-like telemorph (see Crous 

et al. 2004b, fig. 5). Isolate CPC 10553 (=CBS 132596) occurred 

on the same leaf spots with C. acaciae-mangii (CBS 116365 = 

CPC 10526), which is here treated under Cercospora sp. P. The 

TEF phylogeny could not distinguish it from Cercospora spp. N–Q, 

C. kikuchii and C. cf. sigesbeckiae, whereas the HIS phylogeny 

could not distinguish it from some isolates of Cercospora spp. 

P and Q. The ACT phylogeny places it on a longer branch with 

C. rodmanii and C. cf. ipomoeae. The CAL phylogeny could not 

distinguish it from Cercospora spp. P and Q, C. alchemillicola / C. 

cf. alchemillicola and C. cf. sigesbeckiae. In the combined tree (Fig. 

2 part 4), it is basal to the lineage containing C. rodmanii and other 

species. 

Cercospora sp. N 

Specimen examined: Bangladesh (western part), on Musa sp. (Musaceae), I. 

Buddenhagen, CBS 132619 = CPC 12684 (named as C. hayi). 

Notes: Cercospora sp. N has shorter conidiophores than ascribed 

to C. hayi, which was described from Musa in Cuba. It is evident 

that a complex of Cercospora spp. occur on banana. The TEF 

phylogeny could not distinguish it from Cercospora spp. O–Q, C. 

kikuchii and C. cf. sigesbeckiae, whereas the HIS phylogeny could 

not distinguish it from some isolates of Cercospora spp. P and Q 

and C. rodmanii. The CAL phylogeny could not distinguish it from 

C. rodmanii, C. cf. richardiicola and C. cf. sigesbeckiae. The ACT 

phylogeny distinguishes it from the other species included in this 

study. In the combined tree (Fig. 2 part 4), it is a sister taxon to C. 

cf. richardiicola and C. kikuchii. 

Cercospora sp. O 

Specimen examined: Thailand, Chiang Mai, Mae Klang Loung, N18º32.465’ 

E98º32.874’, on Musa sp. (Musaceae), 6 Oct. 2010, P.W. Crous, CBS 132635 = 

CPC 18636 (named as C. hayi). 

Notes: Based on its shorter conidophores, Cercospora sp. O 

is distinct from C. hayi, and morphologically is more similar to 

Cercospora sp. N. The TEF phylogeny could not distinguish it from 

Cercospora spp. M, N and Q, C. kikuchii and C. cf. sigesbeckiae, 

whereas the HIS phylogeny could not distinguish it from some 

isolates of Cercospora spp. N, P and Q and C. rodmanii. The CAL 

phylogeny could not distinguish it from Cercospora spp. P and Q, 

C. alchemillicola / C. cf. alchemillicola and C. cf. sigesbeckiae and 

the ACT phylogeny from C. kikuchii. In the combined tree (Fig. 2 

part 4), it is a sister taxon to C. cf. malloti. 


Specimens examined: Ghana, on leaves of Dioscorea rotundata (Dioscoreaceae), 

2000, S. Nyako & A.O. Danquah, CBS 132660 = CPC 11629 = GHA-4-0; CPC 

11630 = GHA-4-3; CPC 11631 = GHA-5-0; CPC 11632 = GHA-7-4; CPC 11633 

= GHA-8-4 (as C. dioscoreae-pyrifoliae). Japan, Okinawa, on Coffea arabica 

(Rubiaceae), C. Nakashima, MUMH 10823, MUCC 771 (as C. coffeicola). Mexico, 

Tamaulipas, on Ricinus communis, 31 Nov. 2008, Ma. de Jesús Yáñez-Morales, 

CBS 132680 = CPC 15827. New Zealand, Auckland (imported from Fiji islands), on 

leaves of Hibiscus sabdariffa (Malvaceae), C.F. Hill, Lynfield 578, CPC 5262. Papua 

New Guinea, on leaves of Dioscorea nummularia (Dioscoreaceae), 2000, J. Peters 

& A.N. Jama, CBS 132662 = CPC 11635 = PNG-009; on leaves of D. rotundata, 

2000, J. Peters & A.N. Jama, CBS 132664 = CPC 11637 = PNG-022; on leaves of 

Dioscorea bulbifera (Dioscoreaceae), 2000, J. Peters & A.N. Jama, CBS 132665 = 

CPC 11638 = PNG-023. South Africa, Nelspruit, on Cajanus cajan (Fabaceae), L. 

van Jaarsveld, CBS 113996 = CPC 5326; CBS 115413 = CPC 5328; CPC 5327; 

Komatipoort, on Citrus ×sinensis (≡ C. aurantium var. sinensis) (Rutaceae), M.C. 

Pretorius, CBS 112728 = CPC 3949; CBS 112730 = CPC 3948; CBS 112894 = CPC 

3950. Swaziland, on Citrus ×sinensis (≡ C. aurantium var. sinensis), M.C. Pretorius, 

CPC 4001; CPC 4002; on Citrus sp. leaf spot, M.C. Pretorius, CBS 112649 = CPC 

3946; CBS 112722 = CPC 3947; CBS 115609 = CPC 3945. Thailand, on Acacia 

mangium, M.J. Wingfield, CBS 116365 = CPC 10526; CBS 132645 = CPC 10527 

(Mycosphaerella teleomorph ascospore isolate, ex-type of Cercospora acaciaemangii, 

small colonies); on A. mangium, K. Pongpanich, CPC 10552. 

Notes: Isolates of this clade were mainly obtained from Acacia, 

Cajanus, Citrus (Rutaceae), Coffea (Rubiaceae), Dioscorea, 

Hibiscus (Malvaceae) and Ricinus (Euphorbiaceae). Many previously 

described species names have in the past been applied to different 

isolates clustering in this clade. Based on the gene loci screened in 

the present study, we were unable to resolve the taxonomy of these 

isolates, and for now prefer to treat them as an unresolved species 

complex. In none of the single-gene phylogenies generated in this study 

164


did the isolates from this species form a pure monophyletic lineage, 

as isolates were frequently intermixed with that of Cercospora sp. Q, 

C. cf. sigesbeckiae and C. cf. richardiicola. Given this overlap in 

sequence identity and host species, it is possible that Cercospora 

spp. P (Fig. 2 parts 4–5) and Q (Fig. 2 part 5) could be considered 

as a single species complex (see species notes for Cercospora sp. 

Q below). More extensive screening of additional loci is needed to 

define the species boundaries in this complex. Also present in this 

complex are numerous isolates from Dioscorea, for which the name 

C. dioscoreae-pyrifoliae could have been a candidate. From the 

present study it is clear that several species of Cercospora can be 

isolated from this host and a more detailed study is needed to fix that 

name to a specific lineage. 

The ex-type culture of Cercospora acaciae-mangii (Crous et 

al. 2004) is located in the last subclade (Fig. 2 part 5). Cercospora 

acaciae-mangii was isolated from Acacia leaves that also contained 

a mycosphaerella-like teleomorph that formed a Cercospora state 

in culture. However, the same leaf spots were also colonised by a 

second, morphologically similar species (distinguished by its ability 

to form larger, faster-growing colonies in agar). 

Cercospora sp. Q 

Specimens examined: Mexico, on Phaseolus vulgaris (Fabaceae), 20 Oct. 2008, 

M. de Jesus Yanez, CBS 132679 = CPC 15807; Tamaulipas, on Taraxacum sp. 

(Asteraceae), 30 Oct. 2008, Ma. de Jesús Yáñez-Morales, CBS 132682 = CPC 

15850; on Euphorbia sp. (Euphorbiaceae), 31 Oct. 2008, Ma. de Jesús Yáñez- 

Morales, CPC 15875; 30 Oct. 2008, Ma. de Jesús Yáñez-Morales, CBS 132681 

= CPC 15844. Papua New Guinea, on leaves of Dioscorea rotundata, 2000, J. 

Peters & A.N. Jama, CBS 132661 = CPC 11634 = PNG-002, on leaves of Dioscorea 

esculenta (Dioscoreaceae), 2000, J. Peters & A.N. Jama, CBS 132663 = CPC 

11636 = PNG-016; CPC 11639 = PNG-037. South Africa, Nelspruit, on Cajanus 

cajan, L. van Jaarsveld, CBS 113997 = CPC 5325; CBS 115410 = CPC 5331; CBS 

115411 = CPC 5332; CBS 115412 = CPC 5333; CBS 115536 = CPC 5329; CBS 

115537 = CPC 5330. Thailand, on Acacia mangium, K. Pongpanich, CPC 10550 

(big colony on same plate as small colonies of Cercospora acaciae-mangii); CPC 

10551 (big colony); CBS 132656 = CPC 11536; CPC 11539. 

Notes: Several isolates from diverse hosts and families cluster 

in this clade, to which different names can be applied. To resolve 

their taxonomy, fresh collections authentic for the names (based 

on host and country) need to be recollected and included in future 

studies. Based on the genes studied here, we were unable to 

resolve the phylogeny of these taxa. See also the species notes 

for Cercospora sp. P. Screening the isolates from this species with 

five more genomic loci in this study did not clarify their potential 

species boundaries. By testing other candidate loci as they become 

available from comparative genomics and other sources we will 

continue to try and identify optimal genes for species recognision 

in this complex. 

Cercospora sp. R 

Specimen examined: New Zealand, Auckland, Grey Lynn, on Myoporum laetum 

(Myoporaceae), Dec. 2003, C.F. Hill, Lynfield 186-B, CBS 114644. 

Notes: Pseudocercosporella myopori is a true species of 

Pseudocercosporella (Braun & Hill 2002), which was originally 

described without deposting an ex-type culture. A later collection 

deposited at CBS (isolate CBS 114644), however, proved to 

be representative of an undescribed species of Cercospora, 

phylogenetically closely related to Cercospora sp. S and C. corchori 

(Fig. 2 part 5). This isolate has a unique phylogenetic position in the 

TEF, ACT, CAL and HIS phylogenies. In the combined tree (Fig. 2 

part 5), it is a sister taxon to Cercospora sp. S. 

Cercospora sp. S 

Specimen examined: South Korea, Yangpyeong, on Crepidiastrum denticulatum (≡ 

Youngia denticulata) (Asteraceae), 30 Sep. 2003, H.D. Shin, CBS 132599 = CPC 

10656; CPC 10654–10655 (as Cercospora lactucae-sativae). 

Notes: Isolate CPC 10656 is located on a slightly longer branch in 

the majority of genomic loci evaluated (ACT, CAL and HIS); only 

in the TEF phylogeny is it intermixed with isolates of C. lactucaesativae. 

It is a close sister taxon to Cercospora sp. R and C. 

corchori (Fig. 2 part 5), but more isolates need to be collected to 

resolve its identity. 

Cercospora vignigena C. Nakash., Crous, U. Braun & H.D. 



Vigna. 

Leaf spots subcircular, amphigenous, pale to medium brown, 8–20 

mm diam, with inconspicuous margin. Caespituli amphigenous. 

Mycelium internal. Stromata small to well-developed, pale brown 

to brown, intraepidermal and substomatal, 35–60 µm in diam. 

Conidiophores in loose to dense fascicles (2–12), straight to 

slightly sinuous-geniculate, pale brown, paler towards the apex, 

moderately thick-walled or thick-walled, cylindrical, almost uniform 

in width, often wider towards the apex, distinctly conical at the 

apex, 40–130 × 5–7(–10) µm, 0–3-septate. Conidiogenous cells 

integrated, terminal, intercalary, proliferating sympodially, 20–40 × 

4–5 µm, multi-local (1–2); loci distinctly thickened, darkened, slightly 

protuberant, apical and lateral, 2.5–4 µm diam. Conidia solitary, 

rarely catenate, hyaline, straight to slightly curved, cylindrical to 

obclavate, obconically truncate and distinctly thickened at the base, 

subobtuse to obtuse at the apex, (35–)45–70(–150) × (2.5–)4–6(– 

10) µm, (3–)4–7(–14)-septate, thin-walled, smooth. 

Culture characteristics: Colonies spreading, erumpent, with even, 

lobate margins and sparse to moderate aerial mycelium, reaching 

25 mm diam after 2 wk. On OA olivaceous-grey in centre, pale 

olivaceous-grey in outer region. On MEA pale olivaceous-grey with 

patches of dirty white, reverse iron-grey. On PDA pale olivaceousgrey, 

margin submerged, grey-olivaceous; reverse olivaceous-grey. 

Specimens examined: Japan, Gumma, on Vigna unguiculata (= V. sinensis) 

(Fabaceae), Sep. 1993, K. Kishi, MUCC 579 = MAFF 237635. South Africa, 

Potchefstroom, on V. unguiculata (= V. sinensis), 3 Jan. 1995, S. van Wyk, CPC 

1133–1134. South Korea, Jeongeup, on V. unguiculata (= V. sinensis), 29 Oct. 

2003, H.D. Shin, holotype CBS H-21023, culture ex-type CBS 132611 = CPC 

10812. 

Notes: This independent clade is supported by ACT, CAL and HIS 

and is composed of the isolates of Cercospora species that were 

identified as C. canescens on Vigna (Fabaceae) plants. In the TEF 

phylogeny, the clade is split into two lineages, isolates CPC 1134 

and MUCC 579 as sister clade to C. apiicola and CPC 10812 basal 

to C. apii and C. beticola. In the combined tree (Fig. 2 part 2), it 

is basal to the lineage containing C. apiicola and other species. 

The examined isolates of C. canescens (the true C. canescens 

has acicular conidia), for which the original host is the genus 

Phaseolus, were located in other clades. These results show that 

the fungus on Vigna must be treated as a species distinct from C. 

canescens. Cercospora vignicaulis (described on V. unguiculata (= 

V. sinensis) collected from the USA) has in the past been listed as 


165


Fig. 10. Cercospora vignigena (CBS 132611 = CPC 10812). A. Leaf spots. B. Close-up of lesion. C–E. Fasciculate conidiophores. F–I. Conidia. Scale bars = 10 µm. 

a synonym of C. canescens. However, C. vignicaulis has acicular 

conidia, which differs from the isolates studied here, and thus the 

present collection is described as a distinct species that appears to 

be specific to Vigna. 

Cercospora violae Sacc., Nuovo Giron. Bot. Ital. 8: 187. 

1876. 

= Cercospora violae-tricoloris Briosi & Cavara, Atti Ist. Bot. Univ. Pavia 2: 285. 

1892. 

= Cercospora violae var. minor Rota-Rossi, Atti Ist. Bot, Univ. Pavia, Ser. 2, 

13: 199. 1914. 

= Cercospora violae-kiusianae Sawada, Rep. Gov. Agric. Res. Inst. Taiwan 85: 

126. 1943. 

= Cercospora difformis Tehon, Mycologia 40: 322. 1948. 

= Cercospora trinctatis Pass. (unpublished name cited by Chupp 1954) 


to well-developed, up to 80 µm diam, brown, intraepidermal, 

substomatal. Conidiophores in dense fascicles (2–16), irregular 

in width, slightly attenuated at the upper portion, straight or mildly 

sinuous-geniculate, straight, wall moderately thickened, simple, 

pale brown to brown, short conically truncate at the apex, wider 

at the base, 20–175 × 2.5–7.5 µm, 1–10-septate, usually unilocal. 

Conidiogenous cells integrated, terminal, rarely intercalary, 

proliferating sympodially; loci distinct, thickened, apical, rarely 

lateral, 2–3 µm diam, not protuberant. Conidia solitary, hyaline, 

cylindrical to obclavate or acicular, distinctly thickened and 

obconically truncated at the base, obtuse at the apex, 35–195 × 

2.5–5 µm, 0–18-septate, thin-walled, smooth. 

Specimens examined: Italy, Selva, on Viola odorata (Violaceae), Aug. 1874, 

Treviso, isotypes distributed as Sacc. Mycotheca Veneta 279, isotype at HAL 

examined. Japan, Kochi, on Viola sp., 16 Nov. 2004, J. Nishikawa, MUMH 10333, 

MUCC 129; Nagano, on V. tricolor, 16 Feb. 2005, J. Nishikawa, MUMH 10332, 

MUCC 133; Shizuoka, on V. tricolor, 15 Jan. 2003, J. Nishikawa, MUMH 10334, 

MUCC 136. Romania, Cazanele Dunarii, on V. tricolor, O. Constantinescu, epitype 

designated here CBS H-21024, culture ex-epitype CBS 251.67 = CPC 5079. New 

Zealand, on V. odorata, C.F. Hill, CPC 5368. 

Notes: See also C. zebrina. One culture that was isolated from Viola 

(strain CPC 10725) is representative of C. fagopyri. The original 

specimen of this isolate was distinguishable from C. violae in having 

circumspersed and slightly protuberant loci on its conidiophores. 

The isolates included here for C. violae are phylogenetically distinct 

from the other species included in this study on the basis of the 

TEF, ACT, CAL and HIS phylogenies. In the combined tree (Fig. 2 

part 3), it is a sister taxon to C. zebrina. 

Cercospora zeae-maydis Tehon & E.Y. Daniels, Mycologia 

17: 248. 1925. 

Specimens examined: China, Liaoning Province, on Zea mays (Poaceae), CBS 

132668 = CPC 12225 = CHME 52. Mexico, Tlacotepec, on Z. mays, 16 Sep. 2008, 

Ma. de Jesús Yáñez-Morales, CBS 132678 = CPC 15602. USA, Illinois, Alexander 

Co., McClure, on Z. mays, 29 Aug. 1924, P.A. Young, holotype ILLS 4276, isotype 

BPI 442569; Delaware, 1997, B. Fleener, DE-97 = A359 = CBS 117756; Indiana, 

Princeton, 1999, B. Fleener, PR-IN-99 = A364 = CBS 117761; Indiana, Princeton, 

2003, B. Fleener, YA-03 = A358 = CBS 117755; Iowa, Johnston, 2004, B. Fleener, 

JH-IA-04 = A361 = CBS 117758; Iowa, Reinbeck, 1999, B. Fleener, RENBECK- 

IA-99 = A367 = CBS 117763; Missouri, Dexter, 2000, B. Fleener, DEXTER-MO-00 

= A365 = CBS 117762; Pennsylvania, New Holland, 1999, B. Fleener, NH-PA-99 = 

A363 = CBS 117760; Tennessee, Union City, 1999, B. Fleener, UC-TN-99 = A362 

= CBS 117759; Wisconsin, Janesville, 2002, B. Fleener, epitype, CBS H-17774, 

culture ex-epitype JV-WI-02 = A360 = CBS 117757. 

Notes: This species is phylogenetically supported by ITS, TEF, 

ACT, CAL and HIS. In the combined tree (Fig. 2 part 1), it is a basal 

166


lineage. Gray leaf spot of maize was originally attributed to “group 

I” and “group II” siblings of C. zeae-maydis (Wang et al. 1998). 

More detailed information on this species was provided in Crous 

et al. (2006a). 

Cercospora zebrina Pass., Hedwigia 16: 124. 1877. 

≡ Cercosporina zebrina (Pass.) Matsuura, J. Pl. Protect. (Tokyo) 17: 1. 

1930. 

= Cercospora helvola Sacc., Michelia 2: 556. 1882. 

= Cercospora stolziana Magnus, Die Pilze von Tirol (etc.) 3: 558. 1905. 

= Cercospora helvola var. zebrina Ferraris, Fl. Ital. Cryptog. 1: 423, 1910, fide 

Chupp (1954: 341). 

Specimens examined: Australia, on Trifolium cernuum (Fabaceae), M.J. Barbetti, 

CBS 118791 = IMI 264190 = WA 2054 = WAC 7993; on T. subterraneum, M.J. 

Barbetti, CBS 118789 = WAC 5106; CBS 118790 = IMI 262766 = WA 2030 = WAC 

7973. Canada, Ottawa, 13 Lucas lane, on T. repens, 1 Sep. 2000, K.A. Seifert, CBS 

H-21025, CBS 112723 = CPC 3957; CBS 112736 = CPC 3958; on T. pratense, K.A. 

Seifert, CBS H-21026, CBS 112893 = CPC 3955. Italy, on Hedysarum coronarium 

(Fabaceae), CBS 137.56 = CPC 5118 (as C. ariminensis). New Zealand, on Hebe 

sp. (Scrophulariaceae), C.F. Hill, CBS 114359 = CPC 10901; Auckland, on Lotus 

pedunculatus (Fabaceae), C.F. Hill, Lynfield 644, CPC 5437 (as C. loti); Blockhouse 

Bay, on T. repens, C.F. Hill, Lynfield 603, CBS 113070 = CPC 5367; on Jacaranda 

mimosifolia (Bignoniaceae), C.F. Hill, Lynfield 693, CPC 5473 (as C. canescens). 

Romania, Hagieni, on Astragalus spruneri (Fabaceae), O. Constantinescu, CBS 

537.71 = IMI 161108 = CPC 5089 (as C. astragali). South Korea, Namyangju, on 

T. repens, 22 Oct. 2003, H.D. Shin, CBS H-21027, CBS 132650 = CPC 10756. 

Unknown, on Medicago arabica (= M. maculata) (Fabaceae), E.F. Hopkins, CBS 

108.22 = CPC 5091 (as C. medicaginis). USA, Wisconsin, on T. subterraneum, CBS 

129.39 = CPC 5078. 

Notes: Morphological characteristics of the larger C. zebrina 

clade include conidiophores that are short, almost straight, 

slightly attenuated and distinctly conically truncate at the apex 

with distinctly thickened loci, and conidia, which are cylindrical 

to cylindro-obclavate. The type of C. zebrina was collected on 

Trifolium in Italy. More European collections are required to resolve 

this species and to delinate it from other, closely allied species. 

Cercospora althaeina, which has wide host range on 

malvaceous plants, has a similar morphology to C. zebrina. 

Cercospora violae, which clusters basal to the C. zebrina clade, 

has longer and wider conidiophores, and cylindrical to acicular 

conidia, which separates this species from C. zebrina. 

In the TEF phylogeny, isolates are intermixed with those of 

C. armoraciae, C. rumicis and Cercospora sp. L and in the ACT 

and CAL phylogenies with those of Cercospora sp. L and C. 

althaeina. Only in the HIS phylogeny do these isolates form a pure 

monophyletic clade. In the combined tree (Fig. 2 part 3), it is a sister 

taxon to C. violae. 

Cercospora zeina Crous & U. Braun, Stud. Mycol. 55: 194. 

2006. 

Specimens examined: South Africa, KwaZulu-Natal, Pietermaritzburg, on Zea 

mays (Poaceae), 2005, P. Caldwell, holotype CBS H-17775, culture ex-type CBS 

118820 = CPC 11995; CBS 132617 = CPC 11998. 

Notes: This species is phylogenetically supported by ITS, TEF, 

ACT, CAL and HIS. In the combined tree (Fig. 2 part 1), it is a basal 

lineage. More detailed information on this species was provided in 

Crous et al. (2006a). 

Cercospora cf. zinniae 


small, up to 35 µm diam, intraepidermal or substomatal, pale brown 

to brown. Conidiophores in loose fascicles (3–8), pale brown to 

brown, straight, mildly geniculate above the middle, multi-septate, 

attenuated, successively geniculate, tip truncate or conically 

truncate, 65–300 × 3.5–5 µm, 1–12-septate. Conidiogenous cells 

integrated, proliferating sympodially, terminal and intercalary, 

multi-local; loci distinctly thickened, darkened, apical and lateral, 

sometimes circumspersed, often slightly protuberant, 2–2.5 

µm diam. Conidia solitary, hyaline, filiform to acicular, cylindroobclavate, 

straight to curved, long obconically truncate or truncate, 

and thickened at the base, acute at the apex, multi-septate, 30–120 

× 1–4 µm, 3–13-septate. 

Description of caespituli on V8; (MUCC 131): Conidiophores 

solitary, arising from hyphae, subhyaline to pale brown, irregular 

in width, smooth, meager and thin-walled, sinuous-geniculate to 

geniculate, unbranched, truncate or conically truncate at the tip, 

13–63 × 3–5 µm, multi-septate. Conidiogenous cells integrated, 

terminal, proliferating sympodially, single to multi-local (1–2); loci 

moderately thickened, apical, sometimes slightly protuberant, 

1.25–2 µm in width. Conidia hyaline, filiform to acicular, slightly 

thickened and long obconically truncate at the base, acute to 

obtuse at the apex, 25–160 × 2.5–4 µm, 3–11-septate. 

Specimens examined: Brazil, Valverde, Alto Rio Doce, on unknown substrate, A.C. 

Alfenas, CBS 132676 = CPC 15075. Japan, Chiba, on Zinnia elegans (Asteraceae), 

12 Sep. 1997, S. Uematsu, MUCC 572 = MAFF 237718 = MUCNS 215; Shizuoka, 

on Z. elegans, 17 Sep. 2004, J. Nishikawa, MUMH 11397, MUCC 131. South 

Korea, Yangpyeong, on Z. elegans, 18 Oct. 2007, H.D. Shin, CBS 132624 = CPC 

14549. 

Notes: This species is characterised in that the conidiophores 

are mildly geniculate above the middle, multi-septate, attenuated 

with successive geniculation; loci circumspersed and distinctly 

thickened; conidia are narrower than those of other taxa in C. 

apii s. lat. Moreover, this species is phylogenetically supported by 

DNA sequence data of TEF, CAL and HIS. In the ACT phylogeny, 

two distinct lineages are formed, namely CPC 14549 versus CPC 

15075, MUCC 132 and MUCC 572. In the combined tree (Fig. 2 

part 4), it is basal to the lineage containing, for example, C. cf. 

ipomoeae, C. fagopyri and C. rodmanii. North American cultures 

and sequence data are necessary to confirm the identity of Asian 

collections as C. zinniae and to designate an epitype. 

DISCUSSION 

This study was initiated to resolve Cercospora taxonomy on the 

basis of morphological and DNA sequence data. Based on our 

earlier studies incorporating multi-gene phylogenies on smaller 

datasets (Crous et al. 2004b, 2006a, Groenewald et al. 2005, 2006a, 

2010a), we realised this was an ambitious task. Even though a whole 

range of hosts and countries were included in our study, attempts to 

apply existing names to the different clades in the phylogenetic trees 

obtained proved difficult. In addition, the lack of ex-type cultures or 

at least reference sequences from type material, made it especially 

problematic to assign existing names to the derived phylogenetic 

clades. To our knowledge, this study presently represents the largest 

combination of diverse sampling of cercosporoid fungi coupled with 

multi-locus sequence data in a single manuscript. 

One important finding is that Crous & Braun (2003) were overoptimistic 

when they referred 281 Cercospora names to C. apii s. 

lat. based on morphology alone. Of the species treated as distinct 

in the present paper, the following five were originally referred to 

C. apii s. lat. by Crous & Braun (2003), namely C. beticola, C. 


167


canescens, C. fagopyri, C. kikuchii and C. rumicis. The following 

eight species, C. armoraciae, C. corchori, C. lactucae-sativae, C. 

mercurialis, C. polygonacea, C. ricinella, C. violae and C. zebrina, 

treated as distinct in the present study, were treated by Crous & 

Braun (2003) as close to or possibly identical with C. apii s. lat. 

It is evident that morphology alone provides an insufficient basis 

on which to establish synonymies, to describe novel species or in 

many cases to identify species of Cercospora. 

In the last 10 years, 45 novel Cercospora names were lodged 

with MycoBank (Crous et al. 2004a). Of these, only five species 

are based on morphology and multi-locus sequence data, two 

species have morphology supplemented with ITS sequences and 

38 species are based on morphology alone. Of these 45 species, 

only 10 species were described in culture, 26 were reported without 

culture characteristics and of the remaining nine it is unlikely that 

cultures were established. This is an alarming statistic and is 

something that should be addressed by the whole community 

working on cercosporoid fungi. If the situation is compared to that 

of Colletotrichum, it is clear that there is room for improvement. 

Phylogenetic studies on Colletotrichum species based on cultures 

and ITS data date back to at least 20 years, with the last 10 years 

showing a significant increase in species descriptions based on 

multi-locus sequence data (Cannon et al. 2012). 

Groenewald et al. (2010a) reported on the performance of the 

five loci used for the phylogenetic inference in this study. They found 

the ITS region had limited resolution (2.7 % clade recovery) and was 

best be used to confirm the generic affiliation of a species, with less 

value when used for species comparison, specifically within the C. 

apii complex. Although CAL is necessary to distinguish C. apii and 

C. beticola, it only distinguished about half of the observed species 

clades (46.6 % clade recovery), whereas ACT was slightly more 

successful (58.9 % clade recovery). The HIS region compared well 

with ACT (63 % clade recovery), but it did split C. beticola into two 

clades. Both of these C. beticola clades contain isolates from the 

same sugar beet fields in Germany and New Zealand (Groenewald 

et al. 2006b) and whether this implies population variation or the 

presence of an additional cryptic species on sugar beet requires 

further molecular analyses of more C. beticola populations. The TEF 

region was comparable to CAL in terms of clade recovery (45 % clade 

recovery). Although we believe that there is still a need to identify the 

best barcode locus for Cercospora, the current multi-locus approach 

does enable species identification. Comparison of a few Cercospora 

genomes selected from across the phylogenetic tree might reveal a 

single locus with better resolution than the currently used loci. 

Similar to the situation in Pseudocercospora (Crous et al. 2013), 

we also encountered a situation where we could not use names 

based on North American or European types for African or Asian 

cultures and vice versa. Based on morphological features and their 

distinct sequences we have chosen to treat those clades in the 

present study as “cf.” pending comparison of those species with 

(epi-)type material from the original country and host as discussed 

under the species notes above. For numerous clades (“Cercospora 

sp. A–S”), it was not possible to unequivocally assign a species 

name; frequently these clades contained isolates from multiple 

hosts and/or countries and the same hosts occurred in multiple 

clades, or the host information was not available. For example, 

isolates from Cajanus cajan in South Africa can be attributed to 

Cercospora sp. P and Cercospora sp. Q. Crous & Braun (2003) 

list four Cercospora species associated with this host, namely C. 

apii s. str., C. canescens, C. instabilis and C. thirumalacharii. The 

first two species were included in this study, the third is listed on 

Cajanus from numerous countries (but not including South Africa) 

and the last is known from India (Crous & Braun 2003). It was not 

possible to include authentic cultures of the latter two species, 

so any of these two names are potentially available for a clade. 

An additional complicating factor is that there are numerous subclades 

inside Cercospora sp. P and Cercospora sp. Q, which could 

represent either intra-specific variation or the presence of cryptic 

species, which are not distinguished by the loci used in this study. 

We sequenced five additional loci for Cercospora sp. Q isolates 

and did not find a single locus that provided better insight into this 

clade. Isolates from Cajanus also occur in the same clade with 

other hosts, raising the question of wide host range versus simply 

a chance infection (Crous & Groenewald 2005). A similar situation 

was observed for isolates isolated from yams (Dioscorea). Crous 

& Braun (2003) list numerous Pseudocercospora and Passalora 

species, and three Cercospora species (C. aragonensis, C. 

dioscoreae-pyrifoliae and C. golaghatti) from this host genus; of 

the three Cercospora names, C. dioscoreae-pyrifoliae is commonly 

used in literature. In this study, it was not possible to apply this 

name to any of the clades. Isolates from Dioscorea are found in the 

C. canescens complex, Cercospora cf. sigesbeckiae, Cercospora 

sp. P and Cercospora sp. Q, but none of these isolates were 

from the original host or locality of the type description for C. 

dioscoreae-pyrifoliae (based on Dioscorea pyrifolia in Singapore). 

One of the isolates included in the present study (MUCC 849, 

as Cercospora cf. sigesbeckiae) was treated by Nakashima et 

al. (2011) as C. dioscoreae-pyrifoliae. The authors noted that, 

although the morphological characteristics were similar to the 

original description, the width of the conidiophores and conidia was 

different. Similarly, most of the isolates from Dioscorea were sent 

to us under the name C. dioscoreae-pyrifoliae although we could 

not confirm the identification with confidence. These examples 

highlight the need to locate original specimens, or at least recollect 

material that can be used for epitypification, to fix the names used 

in the various phylogenetic clades. It also illustrates the importance 

of establishing cultures, which can be used for future molecular 

studies, when describing taxonomic novelties. 

We believe that this study serves as a backbone for future 

studies on Cercospora taxonomy. Unfortunately, many (epi-)type 

cultures and adequate sequence data are lacking for a significant 

number of Cercospora species. Future studies will require the 

recollection of material from the original hosts and continents so 

that epitypes can be found and names stabilised. Furthermore, 

all species, especially those currently in common use, need 

proper molecular identification. Based on searches in Google and 

Google Scholar, the most commonly used Cercospora species 

names are C. zeae-maydis, C. beticola, C. apii, C. canescens, 

C. kikuchii, C. sojina, C. arachidicola, C. coffeicola, C. personata 

and C. nicotianae. Although the taxonomy of C. apii, C. beticola 

(Groenewald et al. 2005, 2006a) and C. zeae-maydis (Crous et 

al. 2006a) was resolved in the past, the present study resolved C. 

kikuchii and C. sojina but it was unable to resolve C. canescens. 

Similar studies are needed for C. arachidicola, C. coffeicola, C. 

nicotianae and C. personata. 


We would like to thank all colleagues for supplying us with material and cultures, 

without which this study would not have been possible. We thank the technical 

staff, Arien van Iperen (cultures), Marjan Vermaas (photographic plates), and Mieke 

Starink-Willemse (DNA isolation, amplification and sequencing) for their invaluable 

assistance. 

168


REFERENCES 

Agrios GN (2005). Plant pathology, fifth edition. Academic Press, New York. 

Amnuaykanjanasin A, Daub ME (2009). The ABC transporter ATR1 is necessary 

for efflux of the toxin cercosporin in the fungus Cercospora nicotianae. Fungal 

Genetics and Biology 46: 146–158. 

Assante G, Locci R, Camarda L, Merlini L, Nasini G (1977). Screening of the genus 

Cercospora for secondary metabolites. Phytochemistry 16: 243–247. 

Aveskamp MM, Woudenberg JHC, Gruyter J de, Turco E, Groenewald JZ, Crous 

PW (2009). Development of taxon-specific sequence characterized amplified 

region (SCAR) markers based on actin sequences and DNA amplification 

fingerprinting (DAF): a case study in the Phoma exigua species complex. 

Molecular Plant Pathology 10: 403–414. 

Ayala-Escobar V, Yanez-Morales M de, Braun U, Groenewald JZ, Crous PW (2005). 

Cercospora agavicola – a new foliar pathogen of Agave tequilana var. azul from 

Mexico. Mycotaxon 93: 115–121. 

Bagyanarayana G, Braun U, Jagadeeswar P (1995). Notes on Indian Cercosporae 

and allied genera (IV). Cryptogamic Botany 5: 363–366. 

Bakhshi M, Arzanlou M, Babai-Ahari A (2011). Uneven distribution of mating type alleles 

in Iranian populations of Cercospora beticola, the causal agent of Cercospora leaf 

spot disease of sugar beet. Phytopathologia Mediterranea 50: 101–109. 

Bolton M, Secor GA, Rivera V, Weiland JJ, Rudolph K, et al. (2012). Evaluation of 

the potential for sexual reproduction in field populations of Cercospora beticola 

from USA. Fungal Biology 116: 511–521. 

Braun U (1995a). A monograph of Cercosporella, Ramularia and allied genera 

(phytopathogenic hyphomycetes), Vol. 1. IHW-Verlag, Eching. 

Braun U (1995b). Miscellaneous notes on phytopathogenic hyphomycetes (II). 

Mycotaxon 55: 223–241. 


(phytopathogenic hyphomycetes), Vol. 2. IHW-Verlag, Eching. 

Braun U, Delhey R, Kiehr M (2001). Notes on some cercosporoid hyphomycetes 

from Argentina. Fungal Diversity 6: 18–33. 

Braun U, Hill CF (2002). Some new micromycetes from New Zealand. Mycological 

Progress 1: 19–30. 

Braun U, Hill CF (2004). Some new cercosporoid and related leaf spot diseases 

from New Zealand and Fiji. Australasian Plant Pathology 33: 485–494. 

Braun U, Hill CF, Schubert K (2006). New species and new records of biotrophic 

micromycetes from Australia, Fiji, New Zealand and Thailand. Fungal Diversity 

22: 13–35. 

Braun U, Melnik VA (1997). Cercosporoid fungi from Russia and adjacent countries. 

Trudy Botanischeskogo Instituta Imeni V. L. Komarova (St. Petersburg) 20: 

1–130. 

Cannon PF, Damm U, Johnston PR, Weir BS (2012). Colletotrichum – current status 

and future directions. Studies in Mycology 73: 181–213. 



Chen H, Lee M-H, Daub ME, Chung K-R (2007). Molecular analysis of the 

cercosporin biosynthetic gene cluster in Cercospora nicotianae. Molecular 

Microbiology 64: 755–770. 

Choquer M, Dekkers KL, Chen H-Q, Cao L, Ueng PP, et al. (2005). The CTB1 gene 

encoding a fungal polyketide synthase is required for cercosporin biosynthesis 

and fungal virulence of Cercospora nicotianae. Molecular Plant-Microbe 

Interactions 18: 468–476. 

Chung K-R, Ehrenshaft M, Wetzel DK, Daub ME (2003). Cercosporin-deficient 

mutants by plasmid tagging in the asexual fungus Cercospora nicotianae. 

Molecular Genetics and Genomics 270: 103–113. 

Chupp C (1954). A monograph of the fungus genus Cercospora. Ithaca, New York. 

Conway KE (1976). Cercospora rodmanii, a new pathogen of water hyacinth with 

biological control potential. Canadian Journal of Botany 54: 1079–1083. 

Corlett M (1991). An annotated list of the published names in Mycosphaerella and 

Sphaerella. Mycologia Memoir 18: 1–328. 


spot diseases of Eucalyptus. Mycologia Memoir 21: 1–170. 

Crous PW, Aptroot A, Kang J-C, Braun U, Wingfield MJ (2000). The genus 


Crous PW, Braun U (2003). Mycosphaerella and its anamorphs. 1. Names published 

in Cercospora and Passalora. CBS Biodiversity Series 1: 1–571. 

Crous PW, Braun U, Groenewald JZ (2007). Mycosphaerella is polyphyletic. Studies 


Crous PW, Braun U, Hunter GC, Wingfield MJ, Verkley GJM, et al. (2013). 

Phylogenetic lineages in Pseudocercospora. Studies in Mycology 75: 37–114. 

Crous PW, Gams W, Stalpers JA, Robert V, Stegehuis G (2004a). MycoBank: an 


50: 19–22. 



Crous PW, Groenewald JZ, Groenewald M, Caldwell P, Braun U, Harrington TC 

(2006a). Species of Cercospora associated with grey leaf spot of maize. 



(2004b). Cryptic speciation and host specificity among Mycosphaerella spp. 



Crous PW, Groenewald JZ, Risede J-M, Hywel-Jones NL (2004c). Calonectria 

species and their Cylindrocladium anamorphs: species with sphaeropedunculate 

vesicles. Studies in Mycology 50: 415–429. 

Crous PW, Schoch CL, Hyde KD, Wood AR, Gueidan C, et al. (2009a). Phylogenetic 


Crous PW, Summerell BA, Carnegie AJ, Wingfield MJ, Hunter GC, Burgess TI, 

Andjic V, Barber PA, Groenewald JZ (2009b). Unraveling Mycosphaerella: do 

you believe in genera? Persoonia 23: 99–118. 

Crous PW, Verkley GJM, Groenewald JZ, Samson RA (eds) (2009c). Fungal 

Biodiversity. CBS Laboratory Manual Series No. 1. Centraalbureau voor 


Crous PW, Wingfield MJ, Mansilla JP, Alfenas AC, Groenewald JZ (2006b). 


occurring on Eucalyptus. II. Studies in Mycology 55: 99–131. 

Crous PW, Wingfield MJ, Park RF (1991). Mycosphaerella nubilosa, a synonym of 

M. molleriana. Mycological Research 95: 628–632. 

Daub ME, Ehrenshaft M (2000). The photoactivated Cercospora toxin cercosporin: 

Contributions to plant disease and fundamental biology. Annual Review of 

Phytopathology 38: 461–490. 

Davis JJ (1929). Notes on parasitic fungi in Wisconsin. XV. Transactions of the 

Wisconsin Academy of Science, Arts, and Letters 24: 269–277. 

Drummond AJ, Ashton B, Buxton S, Cheung M, Cooper A, et al. (2011). Geneious 

v5.4, Available from http://www.geneious.com/. 

Ellis MR (1971). Dematiaceous hyphomycetes. Kew, England: Commonwealth 

Mycological Institute. 

Fuckel KWGL (1863). Fungi Rhenani exsiccati, Fasc. I-IV. Hedwigia 2: 132–136. 

García CE, Pons N, Benítez de Rojas C (1996). Cercospora and similar fungi on 

Ipomoea species. Fitopatologia Venezolana 9: 22–36. 

Glass NL, Donaldson G (1995). Development of primer sets designed for use with 

PCR to amplify conserved genes from filamentous ascomycetes. Applied and 

Environmental Microbiology 61: 1323–1330. 

Goodwin SB, Dunkle LD, Zismann VL (2001). Phylogenetic analysis of Cercospora 

and Mycosphaerella based on the internal transcribed spacer region of 

ribosomal DNA. Phytopathology 91: 648–658. 

Groenewald JZ, Groenewald M, Braun U, Crous PW (2010a). Cercospora speciation 

and host range. In: Cercospora Leaf Spot of Sugar Beet and Related Species 

(Lartey RT, Weiland JJ, Panella L, Crous PW, Windels CE, eds). APS Press, 

Minnesota USA: 21–37. 

Groenewald M, Groenewald JZ, Braun U, Crous PW (2006a). Host range of 

Cercospora apii and C. beticola, and description of C. apiicola, a novel species 

from celery. Mycologia 98: 275–285. 

Groenewald M, Groenewald JZ, Crous PW (2005). Distinct species exist within the 

Cercospora apii morphotype. Phytopathology 95: 951–959. 

Groenewald M, Groenewald JZ, Crous PW (2010b). Mating type genes in 

Cercospora beticola and allied species. In: Cercospora Leaf Spot of Sugar 

Beet and Related Species (Lartey RT, Weiland JJ, Panella L, Crous PW, 

Windels CE, eds). APS Press, Minnesota USA: 39–53. 

Groenewald M, Groenewald JZ, Harrington TC, Abeln ECA, Crous PW (2006b). 

Mating type gene analysis in apparently asexual Cercospora species is 

suggestive of cryptic sex. Fungal Genetics and Biology 43: 813–825. 

Guerber JC, Liu B, Correll JC, Johnston PR (2003). Characterization of diversity in 

Colletotrichum acutatum sensu lato by sequence analysis of two gene introns, 

mtDNA and intron RFLPs, and mating compatibility. Mycologia 95: 872–895. 

Guo YL , Liu XJ (2005). Flora Fungorum Sinicorum. Vol. 24, Cercospora. Science 

Press, Beijing. 

Hawksworth DL (2011). A new dawn for the naming of fungi: impacts of decisions 

made in Melbourne in July 1011 on the future publication and regulation of 

fungal names. IMI Fungus 2: 155–162. 

Hennebert GL, Sutton BC (1994). Unitary parameters in conidiogenesis. In: 

Ascomycete Systematics, Problems and Perspective in the Nineties 

(Hawksworth DL, ed), NATO ASI Series 296, New York, USA: 65–76. 

Hillis DM, Bull JJ (1993). An empirical test of bootstrapping as a method for assessing 

confidence in phylogenetic analysis. Systematic Biology 42: 182–192. 



Hsieh W-H, Goh T-K (1990). Cercospora and similar fungi from Taiwan. Maw Chang 

Book Company, Taiwan. 

Inglis PW, Teixeira EA, Ribeiro DM, Valadares-Inglis MC, Tigano MS, Mello SCM 

(2001). Molecular markers for the characterization of Brazilian Cercospora 

caricis isolates. Current Microbiology 42: 194–198. 


169


Jenns AE, Daub ME, Upchurch RG (1989). Regulation of cercosporin accumulation 

in culture by medium and temperature manipulation. Phytopathology 79: 213– 

219. 

Lee SB, Taylor JW (1990). Isolation of DNA from fungal mycelia and single spores. 

In: A Guide to Molecular Methods and Applications (Innis MA, Gelfand DH, 

Sninsky JJ, White JW, eds). Academic Press, New York: 282–287. 

Li KN, Rouse DI, German TL (1994). PCR primers that allow intergeneric 

differentiation of ascomycetes and their application to Verticillium spp. Applied 

and Environmental Microbiology 60: 4324–4331. 

Liu XJ, Guo YL (1998). Flora Fungorum Sinicorum. Vol. 9, Pseudocercospora. 

Science Press, Beijing. 

Montenegro-Calderón JG, Martínez-Álvarez JA, Vieyra-Hernández MT, Rangel- 

Macías LI, Razzo-Soria T, et al. (2011). Molecular identification of two strains 

of Cercospora rodmanii isolated from water hyacinth present in Yuriria lagoon, 

Guanajuato, Mexico and identification of new hosts for several other strains. 

Fungal Biology 115: 1151–1162. 

Morris MJ, Crous PW (1994). New and interesting records of South African fungi XIV. 

Cercosporoid fungi from weeds. South African Journal of Botany 60: 325–332. 

Nakashima C, Araki I, Kobayashi T (2011). Addition and re-examination of Japanese 

species belonging to the genus Cercospora and allied genera. X: newly 

recorded species from Japan (5). Mycoscience 52: 253–259. 

Norvell LL (2011). Fungal nomenclature. 1. Melbourne approves a new Code. 

Mycotaxon 116: 481–490. 

Nylander JAA (2004) MrModeltest 2.0. Program distributed by the author. Uppsala 

University; Uppsala, Sweden. 

O’Donnell K, Cigelnik E (1997). Two divergent intragenomic rDNA ITS2 types within 

a monophyletic lineage of the fungus Fusarium are nonorthologous. Molecular 

Phylogenetics and Evolution 7: 103–116. 


of the fungus causing Panama disease of banana: concordant evidence from 


Academy of Sciences (USA) 95: 2044–2049. 

Ohnuki M, Sato T, Maoka T (1989). Occurrence of leaf spot on winged bean 

(Psophocarpus tetragonolobus (L.) DC.). Proceedings of the Association for 

Plant Protection of Kyushu 35: 34–36. 

Ondřej M, Zavrěl H (1971). Sbery parazitickych imperfektnich hub rodu Cercospora 

Fresen. z uzemi CSSR II. Časopis Slezského Musea v Opavě, Ser A, Historia 

Naturalis 20: 17–29. 

Phengsintham P, Chukeatirote E, McKenzie EHC, Hyde KD, Braun U (2012). 

Cercospora senecionis-walkeri – a new leaf-spotting hyphomycete from Laos 

and Thailand. Plant Pathology & Quarantine 2(1): 70–73. 

Pollack FG (1987). An annotated compilation of Cercospora names. Mycological 

Memoirs 12: 1–212. 

Pretorius MC, Crous PW, Groenewald JZ, Braun U (2003). Phylogeny of some 

cercosporoid fungi from Citrus. Sydowia 55: 286–305. 

Purkayastha RP, Mallik F (1978). Addition of two new fungi to Indian Hyphomycetes. 

Nova Hedwigia 30: 869–872. 

Quaedvlieg W, Kema GHJ, Groenewald JZ, Verkley GJM, Seifbarghi S, et al. (2011). 

Zymoseptoria gen. nov.: a new genus to accommodate Septoria-like species 

occurring on graminicolous hosts. Persoonia 26: 57–69. 

Rambaut A (2002). Sequence Alignment Editor. Version 2.0. Department of Zoology, 

University of Oxford, Oxford. 

Rayner RW (1970). A mycological colour chart. CMI and British Mycological Society. 

Kew. 



Schmitt I, Crespo A, Divakar PK, Fankhauser JD, Herman-Sackett E, et al. (2009). 

New primers for promising single-copy genes in fungal phylogenetics and 

systematics. Persoonia 23: 35–40. 

Shin HD, Braun U (1996). Notes on Korean Cercosporae and allied genera (II). 

Mycotaxon 58: 157–166. 

Shin HD, Kim JD (2001). Cercospora and allied genera from Korea. National 

Institute of Agricultural Science and Technology, Suwon, Korea. 

Silva M, Pereira OL (2008). Postharvest Cercospora apii fruit rot disease on 

Cucurbita maxima (Cucurbitaceae). Australasian Plant Disease Notes 3: 

21–23. 

Stewart EL, Liu Z, Crous PW, Szabo LJ (1999). Phylogenetic relationships among 



Swofford DL (2003). PAUP*: phylogenetic analysis using parsimony (*and other 

methods), version 4. Sinauer Associates, Sunderland, Massachusetts. 

Tessmann DJ, Charudattan R, Kistler HC, Rosskopf EN (2001). A molecular 

characterization of Cercospora species pathogenic to water hyacinth and 

emendation of C. piaropi. Mycologia 93: 323–334. 

Thaung MM (1984). Some fungi of Cercospora complex from Burma. Mycotaxon 

19: 425–452. 

To-Anun C, Hidayat I, Meeboon J (2011). Genus Cercospora in Thailand: Taxonomy 

and phylogeny (with a dichotomous key to species). Plant Pathology & 

Quarantine 1: 11–87. 

Upchurch RG, Walker DC, Rollins JA, Ehrenshaft ME, Daub ME (1991). Mutants 

of Cercospora kikuchii altered in cercosporin synthesis. Applied and 

Environmental Microbiology 57: 2940–2945. 

Verkley GJM, Starink-Willemse M, Iperen A van, Abeln ECA (2004). Phylogenetic 

analyses of Septoria species based on the ITS and LSU-D2 regions of nuclear 

ribosomal DNA. Mycologia 96: 558–571. 

Wang J, Levy M, Dunkle LD (1998). Sibling species of Cercospora associated with 

gray leaf spot of maize. Phytopathology 88: 1269–1275. 

Weiland JJ, Chung K-R, Suttle JC (2010). The role of cercosporin in the virulence 

of Cercospora spp. to plant hosts. In: Cercospora Leaf Spot of Sugar Beet and 

Related Species (Lartey RT, Weiland JJ, Panella L, Crous PW, Windels CE, 

eds). APS Press, Minnesota USA: 39–53. 

Weiland JJ, Koch G (2004). Sugar-beet leaf spot disease (Cercospora beticola 

Sacc.). Molecular Plant Pathology 5: 157–166. 

White TJ, Bruns T, Taylor J (1990). Amplification and direct sequencing of fungal 

ribosomal RNA genes for phylognetics. In: A Guide to Molecular Methods and 

Applications (Innis MA, Gelfand DH, Sninsky JJ, White JW, eds). Academic 

Press, New York: 315–322. 

170


Alternaria redefined 

J.H.C. Woudenberg 1,2* , J.Z. Groenewald 1 , M. Binder 1 , and P.W. Crous 1,2,3 

1 

CBS-KNAW Fungal Biodiversity Centre, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands; 2 Wageningen University and Research Centre (WUR), Laboratory of Phytopathology, 

Droevendaalsesteeg 1, 6708 PB Wageningen, The Netherlands; 3 Utrecht University, Department of Biology, Microbiology, Padualaan 8, 3584 CH Utrecht, The Netherlands 

*Correspondence: Joyce H.C. Woudenberg, j.woudenberg@cbs.knaw.nl 

Abstract: Alternaria is a ubiquitous fungal genus that includes saprobic, endophytic and pathogenic species associated with a wide variety of substrates. In recent years, DNAbased 

studies revealed multiple non-monophyletic genera within the Alternaria complex, and Alternaria species clades that do not always correlate to species-groups based 

on morphological characteristics. The Alternaria complex currently comprises nine genera and eight Alternaria sections. The aim of this study was to delineate phylogenetic 

lineages within Alternaria and allied genera based on nucleotide sequence data of parts of the 18S nrDNA, 28S nrDNA, ITS, GAPDH, RPB2 and TEF1-alpha gene regions. 

Our data reveal a Pleospora/Stemphylium clade sister to Embellisia annulata, and a well-supported Alternaria clade. The Alternaria clade contains 24 internal clades and 

six monotypic lineages, the assemblage of which we recognise as Alternaria. This puts the genera Allewia, Brachycladium, Chalastospora, Chmelia, Crivellia, Embellisia, 

Lewia, Nimbya, Sinomyces, Teretispora, Ulocladium, Undifilum and Ybotromyces in synonymy with Alternaria. In this study, we treat the 24 internal clades in the Alternaria 

complex as sections, which is a continuation of a recent proposal for the taxonomic treatment of lineages in Alternaria. Embellisia annulata is synonymised with Dendryphiella 

salina, and together with Dendryphiella arenariae, are placed in the new genus Paradendryphiella. The sexual genera Clathrospora and Comoclathris, which were previously 

associated with Alternaria, cluster within the Pleosporaceae, outside Alternaria s. str., whereas Alternariaster, a genus formerly seen as part of Alternaria, clusters within the 

Leptosphaeriaceae. Paradendryphiella is newly described, the generic circumscription of Alternaria is emended, and 32 new combinations and 10 new names are proposed. A 

further 10 names are resurrected, while descriptions are provided for 16 new Alternaria sections. 


Key words: Allewia, Chalastospora, Crivellia, Embellisia, Lewia, Nimbya, Paradendryphiella, Sinomyces, systematics, Teretispora, Ulocladium, Undifilum. 

Taxonomic novelties: New combinations – Alternaria abundans (E.G. Simmons) Woudenb. & Crous, Alternaria alternariae (Cooke) Woudenb. & Crous, Alternaria atra 

(Preuss) Woudenb. & Crous, Alternaria bornmuelleri (Magnus) Woudenb. & Crous, Alternaria botrytis (Preuss) Woudenb. & Crous, Alternaria caespitosa (de Hoog & C. Rubio) 

Woudenb. & Crous, Alternaria cantlous (Yong Wang bis & X.G. Zhang) Woudenb. & Crous, Alternaria caricis (E.G. Simmons) Woudenb. & Crous, Alternaria cinerea (Baucom 

& Creamer) Woudenb. & Crous, Alternaria didymospora (Munt.-Cvetk.) Woudenb. & Crous, Alternaria fulva (Baucom & Creamer) Woudenb. & Crous, Alternaria hyacinthi (de 

Hoog & P.J. Mull. bis) Woudenb. & Crous, Alternaria indefessa (E.G. Simmons) Woudenberg & Crous, Alternaria leptinellae (E.G. Simmons & C.F. Hill) Woudenb. & Crous, 

Alternaria lolii (E.G. Simmons & C.F. Hill) Woudenb. & Crous, Alternaria multiformis (E.G. Simmons) Woudenb. & Crous, Alternaria obclavata (Crous & U. Braun) Woudenb. & 

Crous, Alternaria obovoidea (E.G. Simmons) Woudenb. & Crous, Alternaria oudemansii (E.G. Simmons) Woudenb. & Crous, Alternaria oxytropis (Q. Wang, Nagao & Kakish.) 

Woudenb. & Crous, Alternaria penicillata (Corda) Woudenb. & Crous, Alternaria planifunda (E.G. Simmons) Woudenb. & Crous, Alternaria proteae (E.G. Simmons) Woudenb. 

& Crous, Alternaria scirpinfestans (E.G. Simmons & D.A. Johnson) Woudenb. & Crous, Alternaria scirpivora (E.G. Simmons & D.A. Johnson) Woudenb. & Crous, Alternaria 

septospora (Preuss) Woudenb. & Crous, Alternaria slovaca (Svob.-Pol., L. Chmel & Bojan.) Woudenb. & Crous, Alternaria subcucurbitae (Yong Wang bis & X.G. Zhang) 

Woudenb. & Crous, Alternaria tellustris (E.G. Simmons) Woudenb. & Crous, Alternaria tumida (E.G. Simmons) Woudenb. & Crous, Paradendryphiella salina (G.K. Sutherl.) 

Woudenb. & Crous, Paradendryphiella arenariae (Nicot) Woudenb. & Crous. New names – Alternaria aspera Woudenb. & Crous, Alternaria botryospora Woudenb. & Crous, 

Alternaria brassicae-pekinensis Woudenb. & Crous, Alternaria breviramosa Woudenb. & Crous, Alternaria chlamydosporigena Woudenb. & Crous, Alternaria concatenata 

Woudenb. & Crous, Alternaria embellisia Woudenb. & Crous, Alternaria heterospora Woudenb. & Crous, Alternaria papavericola Woudenb. & Crous, Alternaria terricola 

Woudenb. & Crous. Resurrected names – Alternaria cetera E.G. Simmons, Alternaria chartarum Preuss, Alternaria consortialis (Thüm.) J.W. Groves & S. Hughes, Alternaria 

cucurbitae Letendre & Roum., Alternaria dennisii M.B. Ellis, Alternaria eureka E.G. Simmons, Alternaria gomphrenae Togashi, Alternaria malorum (Ruehle) U. Braun, Crous 

& Dugan, Alternaria phragmospora Emden, Alternaria scirpicola (Fuckel) Sivan. New sections, all in Alternaria – sect. Chalastospora Woudenb. & Crous, sect. Cheiranthus 

Woudenb. & Crous, sect. Crivellia Woudenb. & Crous, sect. Dianthicola Woudenb. & Crous, sect. Embellisia Woudenb. & Crous, sect. Embellisioides Woudenb. & Crous, sect. 

Eureka Woudenb. & Crous, sect. Infectoriae Woudenb. & Crous, sect. Japonicae Woudenb. & Crous, sect. Nimbya Woudenb. & Crous, sect. Phragmosporae Woudenb. & 

Crous, sect. Pseudoulocladium Woudenb. & Crous, sect. Teretispora Woudenb. & Crous, sect. Ulocladioides Woudenb. & Crous, sect. Ulocladium Woudenb. & Crous, sect. 

Undifilum Woudenb. & Crous. New genus – Paradendryphiella Woudenb. & Crous. 


INTRODUCTION 

Alternaria is a ubiquitous fungal genus that includes saprobic, 

endophytic and pathogenic species. It is associated with a wide 

variety of substrates including seeds, plants, agricultural products, 

animals, soil and the atmosphere. Species of Alternaria are known 

as serious plant pathogens, causing major losses on a wide range 

of crops. Several taxa are also important postharvest pathogens, 

causative agents of phaeohyphomycosis in immuno-compromised 

patients or airborne allergens. Because of the significant negative 

health effects of Alternaria on humans and their surroundings, a 


correct and rapid identification of Alternaria species would be of 

great value to researchers, medical mycologists and the public 

alike. 

Alternaria was originally described by Nees (1816), based on 

A. tenuis as the only species. Characteristics of the genus included 

the production of dark-coloured phaeodictyospores in chains, and 

a beak of tapering apical cells. Von Keissler (1912) synonymised 

both A. tenuis and Torula alternata (Fries 1832) with Alternaria 

alternata, due to ambiguities in Nees’s description of A. tenuis. Two 

additional genera, Stemphylium (Wallroth 1833) and Ulocladium 

(Preuss 1851) were subsequently described for phaeodictyosporic 


Attribution: 






171

Woudenberg et al. 

hyphomycetes, further complicating the taxonomic resolution in 

this group of fungi. Several re-descriptions and revised criteria of 

these genera (Saccardo 1886, Elliot 1917, Wiltshire 1933, 1938, 

Joly 1964) resulted in a growing number of new species. Results of 

a lifetime study on Alternaria taxonomy based upon morphological 

characteristics were summarised in Simmons (2007), in which 275 

Alternaria species were recognised. One species was transferred 

to the genus Prathoda and three new genera, Alternariaster, 

Chalastospora and Teretispora, were segregated from Alternaria. 

Molecular studies revealed multiple non-monophyletic genera 

within the Alternaria complex and Alternaria species clades, 

which do not always correlate to species-groups based upon 

morphological characteristics (Pryor & Gilbertson 2000, Chou & 

Wu 2002, de Hoog & Horré 2002, Pryor & Bigelow 2003, Hong 

et al. 2005, Inderbitzin et al. 2006, Pryor et al. 2009, Runa et al. 

2009, Wang et al. 2011, Lawrence et al. 2012). The A. alternata, 

A. brassicicola, A. infectoria, A. porri and A. radicina speciesgroups 

were strongly supported by these studies and two new 

species-groups, A. sonchi (Hong et al. 2005) and A. alternantherae 

(Lawrence et al. 2012) and three new genera, Crivellia (Inderbitzin 

et al. 2006), Undifilum (Pryor et al. 2009) and Sinomyces (Wang et 

al. 2011), were described. The latest molecular revision of Alternaria 

(Lawrence et al. 2013) introduced two new species groups, A. 

panax and A. gypsophilae, and elevated eight species-groups 

to sections within Alternaria. The sexual phylogenetic Alternaria 

lineage, the A. infectoria species-group, did not get the status of 

section, in contrast to the eight asexual phylogenetic lineages in 

Alternaria. The Alternaria complex currently comprises the genera 

Alternaria, Chalastospora (Simmons 2007), Crivellia, Embellisia, 

Nimbya, Stemphylium, Ulocladium, Undifilum and the recently 

described Sinomyces together with eight sections of Alternaria and 

the A. infectoria species-group. 

The aim of the present study was to delineate the phylogenetic 

lineages within Alternaria and allied genera, and to create a robust 

taxonomy. Phylogenetic inferences were conducted on sequence 

data of parts of the 18S nrDNA (SSU), 28S nrDNA (LSU), the 

internal transcribed spacer regions 1 and 2 and intervening 

5.8S nrDNA (ITS), glyceraldehyde-3-phosphate dehydrogenase 

(GAPDH), RNA polymerase second largest subunit (RPB2) and 

translation elongation factor 1-alpha (TEF1) gene regions of extype 

and reference strains of Alternaria species and all available 

allied genera. 

MATERIAL AND METHODS 

Isolates 

Based on the ITS sequences of all ex-type or representative 

strains from the Alternaria identification manual present at the 

CBS-KNAW Fungal Biodiversity Centre (CBS), Utrecht, The 

Netherlands (data not shown), 66 Alternaria strains were included 

in this study together with 61 ex-type or representative strains of 16 

related genera (Table 1). Alternaria is represented by the ex-type 

or representative strains of the seven species-groups and species 

that clustered outside known Alternaria clades. Because of the 

size and complexity of the A. alternata, A. infectoria and A. porri 

species-groups, we only included known species; the complete 

species-groups will be treated in future studies. 

Freeze-dried strains were revived in 2 mL malt/peptone (50 % 

/ 50 %) and subsequently transferred to oatmeal agar (OA) (Crous 

et al. 2009a). Strains of the CBS collection stored in liquid nitrogen 

were transferred to OA directly from -80 ºC. DNA extraction was 

performed using the UltraClean Microbial DNA Isolation Kit (MoBio 

laboratories, Carlsbad, CA, USA), according to the manufacturer’s 

instructions. 

Taxonomy 

Morphological descriptions were made for isolates grown on 

synthetic nutrient-poor agar plates (SNA, Nirenberg 1976) with a 

small piece of autoclaved filter paper placed onto the agar surface. 

Cultures were incubated at moderate temperatures (~ 22 ºC) 

under CoolWhite fluorescent light with an 8 h photoperiod for 7 d. 

The sellotape technique was used for making slide preparations 

(Crous et al. 2009a) with Shear’s medium as mounting fluid. 

Photographs of characteristic structures were made with a Nikon 

Eclipse 80i microscope using differential interference contrast 

(DIC) illumination. Growth rates were measured after 5 and 7 d. 

Colony characters were noted after 7 d, colony colours were rated 

according to Rayner (1970). Nomenclatural data were deposited in 

MycoBank (Crous et al. 2004). 

PCR and sequencing 

The SSU region was amplified with the primers NS1 and NS4 (White 

et al. 1990), the LSU region with LSU1Fd (Crous et al. 2009b) and 

LR5 (Vilgalys & Hester 1990), the ITS region with V9G (De Hoog 

& Gerrits van den Ende 1998) and ITS4 (White et al. 1990), the 

GAPDH region with gpd1 and gpd2 (Berbee et al. 1999), the RPB2 

region with RPB2–5F2 (Sung et al. 2007) and fRPB2–7cR (Liu et 

al. 1999) and the TEF1 gene with the primers EF1-728F and EF1- 

986R (Carbone & Kohn 1999) or EF2 (O’Donnell et al. 1998). The 

PCRs were performed in a MyCycler TM Thermal Cycler (Bio-Rad 

Laboratories B.V., Veenendaal, The Netherlands) in a total volume 

of 12.5 µL. The SSU and LSU PCR mixtures consisted of 1 µL 

genomic DNA, 1´ GoTaq® Flexi buffer (Promega, Madison, WI, 

USA), 2 µM MgCl 2 

, 40 µM of each dNTP, 0.2 µM of each primer 

and 0.25 Unit GoTaq® Flexi DNA polymerase (Promega). The 

ITS and GAPDH PCR mixtures differed from the original mix by 

containing 1 µM MgCl 2 

, the RPB2 and TEF1 PCR mixtures differed 

from the original mix by containing 2 µL genomic DNA and the 

RPB2 mixture differed from the original mix by containing 0.5 U 

instead of 0.25 U GoTaq® Flexi DNA polymerase. Conditions for 

PCR amplification consisted of an initial denaturation step of 5 min 

at 94 ºC followed by 35 cycles of 30 s at 94 ºC, 30 s at 48 ºC and 

90 s at 72 ºC for SSU, LSU, ITS and 40 cycles of 30 s at 94 ºC, 30 

s at 52 ºC / 59 ºC and 45 s at 72 ºC for TEF1 using respectively 

EF2 or EF1-986R as reverse primer and a final elongation step of 

7 min at 72 ºC. The partial RPB2 gene was obtained by using a 

touchdown PCR protocol of 5 cycles of 45 s at 94 ºC, 45 s at 60 

ºC and 2 min at 72 ºC, followed by 5 cycles with a 58 ºC annealing 

temperature and 30 cycles with a 54 ºC annealing temperature. 

The PCR products were sequenced in both directions using the 

PCR primers and the BigDye Terminator v. 3.1 Cycle Sequencing 

Kit (Applied Biosystems, Foster City, CA, USA), according to 

the manufacturer’s recommendations, and analysed with an ABI 

Prism 3730XL Sequencer (Applied Biosystems) according to the 

manufacturer’s instructions. Consensus sequences were computed 

from forward and reverse sequences using the BioNumerics v. 4.61 

software package (Applied Maths, St-Martens-Latem, Belgium). All 

generated sequences were deposited in GenBank (Table 1). 

172


Embellisia annulata CBS 302.84 

Pleospora tarda CBS 714.68 

Stemphylium herbarum CBS 191.86 

0.1 

0.98/80 Clathrospora heterospora CBS 175.52 

Comoclathris magna CBS 174.52 

1.0/99 Alternaria alternata CBS 916.96 

Alternaria limoniasperae CBS 102595 

0.79/62 Alternaria daucifolii CBS 118812 

1.0/89 Alternaria arborescens CBS 102605 

1.0/88 Alternaria gaisen CBS 632.93 

1.0/97 Alternaria tenuissima CBS 918.96 

Alternaria longipes CBS 540.94 

Nimbya gomphrenae CBS 108.27 

Alternaria alternantherae CBS 124392 

Alternaria perpunctulata CBS 115267 

1.0/99 0.88/39 Alternaria dauci CBS 117097 

0.91/41 Alternaria pseudorostrata CBS 119411 

0.76/35 Alternaria tagetica CBS 479.81 

Alternaria porri CBS 116698 

Alternaria solani CBS 116651 

0.98/85 

Alternaria macrospora CBS 117228 

0.76/98 Alternaria axiaeriisporifera CBS 118715 

Alternaria vaccariae CBS 116533 

1.0/96 Alternaria gypsophilae CBS 107.41 

Alternaria ellipsoidea CBS 119674 

1.0/95 

Alternaria nobilis CBS 116490 

Alternaria saponariae CBS 116492 

Alternaria juxtiseptata CBS 119673 

Alternaria vaccariicola CBS 118714 

Alternaria petroselini CBS 112.41 

Alternaria selini CBS 109382 

1.0/88 

Alternaria smyrnii CBS 109380 

Alternaria carotiincultae CBS 109381 

0.97/79 

Alternaria radicina CBS 245.67 

1.0/90 

Alternaria cinerariae CBS 116495 

Alternaria sonchi CBS 119675 

0.75/48 

Alternaria brassicae CBS 116528 

Alternaria helianthiinficiens CBS 117370 

Alternaria helianthiinficiens CBS 208.86 

Alternaria brassicicola CBS 118699 

0.90/99 Alternaria solidaccana CBS 118698 

Alternaria septorioides CBS 106.41 

Alternaria mimicula CBS 118696 

Embellisia conoidea CBS 132.89 

Ulocladium botrytis CBS 198.67 

Ulocladium tuberculatum CBS 202.67 

1.0/99 Ulocladium obovoideum CBS 101229 

Ulocladium cucurbitae CBS 483.81 

1.0/96 Ulocladium consortiale CBS 104.31 

Ulocladium brassicae CBS 121493 

1.0/99 Ulocladium atrum CBS 195.67 

0.98/97 

Ulocladium multiforme CBS 102060 

0.63/56 

Ulocladium solani CBS 123376 

Ulocladium subcucurbitae CBS 121491 

0.98/65 

Ulocladium cantlous CBS 123007 

Ulocladium arborescens CBS 115269 

1.0/89 

Ulocladium septosporum CBS 109.38 

1.0/96 

Ulocladium chartarum CBS 200.67 

1.0/91 

Ulocladium capsici CBS 120006 

Alternaria elegans CBS 109159 

Alternaria simsimi CBS 115265 

1.0/79 

Alternaria dianthicola CBS 116491 

1.0/98 

Alternaria cheiranthi CBS 109384 

1.0/47 

Alternaria resedae CBS 115.44 

Embellisia indefessa CBS 536.83 

0.96/90 Alternaria avenicola CBS 121459 

1.0/93 

Alternaria calycipyricola CBS 121545 

0.96/75 Alternaria photistica CBS 212.86 

0.97/56 

Alternaria panax CBS 482.81 

0.99/80 

Alternaria eryngii CBS 121339 

Alternaria thalictrigena CBS 121712 

Teretispora leucanthemi CBS 421.65 

Teretispora leucanthemi CBS 422.65 

Alternaria japonica CBS 118390 

Alternaria nepalensis CBS 118700 

1.0/88 Alternaria anigozanthi CBS 121920 

Embellisia leptinellae CBS 477.90 

1.0/96 Alternaria triglochinicola CBS 119676 

0.85/44 1.0/99 

Embellisia eureka CBS 193.86 

Alternaria geniostomatis CBS 118701 

Alternaria cumini CBS 121329 

1.0/99 

1.0/99 Embellisia hyacinthi CBS 416.71 

Embellisia novae-zelandiae CBS 478.90 

Embellisia proteae CBS 475.90 

Embellisia planifunda CBS 537.83 

0.88/67 

Embellisia tumida CBS 539.83 

Embellisia lolii CBS 115266 

Embellisia dennisii CBS 110533 

Embellisia dennisii CBS 476.90 

Undifilum bornmuelleri DAOM 231361 

Alternaria capsici-annui CBS 504.74 

1.0/98 

Ulocladium oudemansii CBS 114.07 


Sinomyces alternariae CBS 126989 

Alternaria argyranthemi CBS 116530 

1.0/76 Alternaria ethzedia CBS 197.86 

1.0/71 Alternaria oregonensis CBS 542.94 

1.0/74 Alternaria conjuncta CBS 196.86 

0.87/36 

0.96/55 Alternaria infectoria CBS 210.86 

Ybotromyces caespitosus CBS 177.80 

Chmelia slovaca CBS 567.66 

1.0/81 

Alternaria armoraciae CBS 118702 

Embellisia abundans CBS 534.83 

Chalastospora ellipsoidea CBS 121331 

Chalastospora cetera CBS 121340 

0.86/40 

Chalastospora obclavata CBS 124120 

0.55/* 

1.0/98 Alternaria molesta CBS 548.81 

Alternaria mouchaccae CBS 119671 

Alternaria limaciformis CBS 481.81 

Alternaria chlamydospora CBS 491.72 

1.0/64 

Embellisia phragmospora CBS 274.70 

Embellisia didymospora CBS 766.79 

0.93/56 

1.0/98 Embellisia chlamydospora CBS 341.71 

Embellisia tellustris CBS 538.83 

Embellisia allii CBS 339.71 

Alternaria soliaridae CBS 118387 

1.0/99 

Nimbya caricis CBS 480.90 

Nimbya scirpicola CBS 481.90 

Brachycladium penicillatum CBS 116608 

Crivellia papaveracea CBS 116607 

Brachycladium papaveris CBS 116606 

sect. Alternata 

sect. Alternantherae 

sect. Porri 

sect. Gypsophilae 

sect. Radicina 

sect. Sonchi 

• 

• 

sect. Brassicicola 

sect. Ulocladioides 

sect. Pseudoulocladium 

sect. Dianthicola 

sect. Cheiranthus 

sect. Panax 

• 

sect. Teretispora 

sect. Japonicae 

sect. Eureka 

sect. Embellisioides 

• 

sect. Undifilum 

sect. Ulocladium 

• 

sect. Infectoriae 

sect. Chalastospora 

sect. Phragmosporae 

sect. Embellisia 

• 

sect. Nimbya 

sect. Crivellia 

A 

l 

t 

e 

r 

n 

a 

r 

i 

a 

Fig. 1. Bayesian 50 % majority rule consensus tree based on the GAPDH, RPB2 and TEF1 sequences of 121 strains representing the Alternaria complex. The Bayesian 

posterior probabilities (PP) and RAxML bootstrap support values (ML) are given at the nodes (PP/ML). Thickened lines indicate a PP of 1.0 and ML of 100. The tree was rooted 

to Stemphylium herbarum (CBS 191.86). The monotypic lineages are indicated by black dots. 


Multiple sequence alignments were generated with MAFFT v. 6.864b 

(http://mafft.cbrc.jp/alignment/server/index.html), and adjusted by 

eye. Two different datasets were used to estimate two phylogenies; 

an Alternaria complex phylogeny and a Pleosporineae family tree. 

The first tree focusses on the Alternaria complex, the second one 

was produced to place the genera Comoclathris, Clathrospora and 

Alternariaster in the context of the Alternaria complex. The relatives 

of the three genera were determined with standard nucleotide blast 

searches, with both the SSU and LSU sequences, against the 

nucleotide database in GenBank. This resulted in a selection of 35 


173


Table 1. Isolates used in this study and their GenBank accession numbers. Bold accession numbers were generated in other studies. 

Old species 

name 

Alternaria 

alternantherae 

New species 

name 

Alternaria 

alternantherae 

Alternaria 

Section 

Strain Status 2 Host / Substrate Country Other collection 

GenBank accession numbers 

number 1 number 1 

SSU LSU RPB2 ITS GAPDH TEF1 

Althernantherae CBS 124392 Solanum melongena China HSAUP2798 KC584506 KC584251 KC584374 KC584179 KC584096 KC584633 

Alternaria alternata Alternaria alternata Alternata CBS 916.96 T Arachis hypogaea India EGS 34.016 KC584507 DQ678082 KC584375 AF347031 AY278808 KC584634 

Alternaria anigozanthi Alternaria anigozanthi Eureka CBS 121920 T Anigozanthus sp. Australia EGS 44.066 KC584508 KC584252 KC584376 KC584180 KC584097 KC584635 

Alternaria arborescens Alternaria arborescens Alternata CBS 102605 T Lycopersicon 

USA EGS 39.128 KC584509 KC584253 KC584377 AF347033 AY278810 KC584636 

esculentum 

Alternaria argyranthemi Alternaria argyranthemi CBS 116530 T Argyranthemum sp. New Zealand EGS 44.033 KC584510 KC584254 KC584378 KC584181 KC584098 KC584637 

Alternaria armoraciae Alternaria armoraciae Chalastospora CBS 118702 T Armoracia rusticana New Zealand EGS 51.064 KC584511 KC584255 KC584379 KC584182 KC584099 KC584638 

Alternaria avenicola Alternaria avenicola Panax CBS 121459 T Avena sp. Norway EGS 50.185 KC584512 KC584256 KC584380 KC584183 KC584100 KC584639 

New Zealand EGS 51.066 KC584513 KC584257 KC584381 KC584184 KC584101 KC584640 

Alternaria 

axiaeriisporifera 

Alternaria 

axiaeriisporifera 

Gypsophilae CBS 118715 T Gypsophila 

paniculata 

Alternaria brassicae Alternaria brassicae CBS 116528 R Brassica oleracea USA EGS 38.032 KC584514 KC584258 KC584382 KC584185 KC584102 KC584641 

Alternaria brassicicola Alternaria brassicicola Brassicicola CBS 118699 R Brassica oleracea USA EGS 42.002; ATCC 

96836 

Alternaria 

calycipyricola 

Alternaria 

calycipyricola 

Panax CBS 121545 T Pyrus communis China EGS 52.071; RGR 

96.0209 

KC584515 KC584259 KC584383 JX499031 KC584103 KC584642 

KC584516 KC584260 KC584384 KC584186 KC584104 KC584643 

Alternaria capsici-annui Alternaria capsici-annui Ulocladium CBS 504.74 Capsicum annuum – KC584517 KC584261 KC584385 KC584187 KC584105 KC584644 

Alternaria carotiincultae Alternaria carotiincultae Radicina CBS 109381 T Daucus carota USA EGS 26.010 KC584518 KC584262 KC584386 KC584188 KC584106 KC584645 

Alternaria cheiranthi Alternaria cheiranthi Cheiranthus CBS 109384 R Cheiranthus cheiri Italy EGS 41.188 KC584519 KC584263 KC584387 AF229457 KC584107 KC584646 

KC584520 KC584264 KC584388 KC584189 KC584108 KC584647 

Alternaria 

chlamydospora 

Alternaria 

chlamydospora 

Phragmosporae CBS 491.72 T Soil Egypt EGS 31.060; ATCC 

28045; IMI 156427 

Alternaria cinerariae Alternaria cinerariae Sonchi CBS 116495 R Ligularia sp. USA EGS 49.102 KC584521 KC584265 KC584389 KC584190 KC584109 KC584648 

Alternaria conjuncta Alternaria conjuncta Infectoriae CBS 196.86 T Pastinaca sativa Switzerland EGS 37.139 KC584522 KC584266 KC584390 FJ266475 AY562401 KC584649 

Alternaria cumini Alternaria cumini Eureka CBS 121329 T Cuminum cyminum India EGS 04.158a KC584523 KC584267 KC584391 KC584191 KC584110 KC584650 

Alternaria dauci Alternaria dauci Porri CBS 117097 R Daucus carota USA EGS 46.006 KC584524 KC584268 KC584392 KC584192 KC584111 KC584651 

Alternaria daucifolii Alternaria daucifolii Alternata CBS 118812 T Daucus carota USA EGS 37.050 KC584525 KC584269 KC584393 KC584193 KC584112 KC584652 

Alternaria dianthicola Alternaria dianthicola Dianthicola CBS 116491 R Dianthus × allwoodii New Zealand EGS 51.022 KC584526 KC584270 KC584394 KC584194 KC584113 KC584653 

KC584527 KC584271 KC584395 KC584195 KC584114 KC584654 

Alternaria elegans Alternaria elegans Dianthicola CBS 109159 T Lycopersicon 

esculentum 

Burkina Faso EGS 45.072; IMI 

374542 

Alternaria ellipsoidea Alternaria ellipsoidea Gypsophilae CBS 119674 T Dianthus barbatus USA EGS 49.104 KC584528 KC584272 KC584396 KC584196 KC584115 KC584655 

Alternaria eryngii Alternaria eryngii Panax CBS 121339 R Eryngium sp. – EGS 41.005 KC584529 KC584273 KC584397 JQ693661 AY562416 KC584656 

Alternaria ethzedia Alternaria ethzedia Infectoriae CBS 197.86 T Brassica napus Switzerland EGS 37.143 KC584530 KC584274 KC584398 AF392987 AY278795 KC584657 

Alternaria gaisen Alternaria gaisen Alternata CBS 632.93 R Pyrus pyrifolia cv. Nijiseiki 

Japan EGS 90.512 KC584531 KC584275 KC584399 KC584197 KC584116 KC584658 

174



Old species 

name 

Alternaria 

geniostomatis 

New species 

name 

Alternaria 

geniostomatis 

Alternaria 

Section 





Eureka CBS 118701 T Geniostoma sp. New Zealand EGS 51.061 KC584532 KC584276 KC584400 KC584198 KC584117 KC584659 

Alternaria gypsophilae Alternaria gypsophilae Gypsophilae CBS 107.41 T Gypsophila elegans – EGS 07.025; IMI 

264349 

Alternaria 

helianthiinficiens 

Alternaria 


Alternaria 


Alternaria 


CBS 117370 R Helianthus annuus UK EGS 50.174; IMI 

388636 

KC584533 KC584277 KC584401 KC584199 KC584118 KC584660 

KC584534 KC584278 KC584402 KC584200 KC584119 KC584661 

CBS 208.86 T Helianthus annuus USA EGS 36.184 KC584535 KC584279 KC584403 JX101649 KC584120 EU130548 

Alternaria infectoria Alternaria infectoria Infectoriae CBS 210.86 T Triticum aestivum UK EGS 27.193 KC584536 KC584280 KC584404 DQ323697 AY278793 KC584662 

Alternaria japonica Alternaria japonica Japonicae CBS 118390 R Brassica chinensis USA EGS 50.099 KC584537 KC584281 KC584405 KC584201 KC584121 KC584663 

KC584538 KC584282 KC584406 KC584202 KC584122 KC584664 

Alternaria juxtiseptata Alternaria juxtiseptata Gypsophilae CBS 119673 T Gypsophila 

paniculata 

Australia EGS 44.015; DAR 

43414 

Alternaria limaciformis Alternaria limaciformis Phragmosporae CBS 481.81 T Soil UK EGS 07.086; IMI 

052976; QM 1790 

Alternaria 

limoniasperae 

Alternaria 

limoniasperae 

KC584539 KC584283 KC584407 KC584203 KC584123 KC584665 

Alternata CBS 102595 T Citrus jambhiri USA EGS 45.100 KC584540 KC584284 KC584408 FJ266476 AY562411 KC584666 

Alternaria longipes Alternaria longipes Alternata CBS 540.94 R Nicotiana tabacum USA EGS 30.033; QM 

9589 

Alternaria macrospora Alternaria macrospora Porri CBS 117228 T Gossypium 

barbadense 

Alternaria mimicula Alternaria mimicula Brassicicola CBS 118696 T Lycopersicon 

esculentum 

KC584541 KC584285 KC584409 AY278835 AY278811 KC584667 

USA EGS 50.190 KC584542 KC584286 KC584410 KC584204 KC584124 KC584668 

USA EGS 01.056; QM 26a KC584543 KC584287 KC584411 FJ266477 AY562415 KC584669 

Alternaria molesta Alternaria molesta Phragmosporae CBS 548.81 T Phocaena phocaena Denmark EGS 32.075 KC584544 KC584288 KC584412 KC584205 KC584125 KC584670 

Alternaria mouchaccae Alternaria mouchaccae Phragmosporae CBS 119671 T Soil Egypt EGS 31.061 KC584545 KC584289 KC584413 KC584206 AY562399 KC584671 

Alternaria nepalensis Alternaria nepalensis Japonicae CBS 118700 T Brassica sp. Nepal EGS 45.073; IMI KC584546 KC584290 KC584414 KC584207 KC584126 KC584672 

374543 

Alternaria nobilis Alternaria nobilis Gypsophilae CBS 116490 R Dianthus caryophyllus New Zealand EGS 51.027; NZMAF KC584547 KC584291 KC584415 KC584208 KC584127 KC584673 

Lynfield 743 

Alternaria oregonensis Alternaria oregonensis Infectoriae CBS 542.94 T Triticum aestivum USA EGS 29.194 KC584548 KC584292 KC584416 FJ266478 FJ266491 KC584674 

Alternaria panax Alternaria panax Panax CBS 482.81 R Aralia racemosa USA EGS 29.180 KC584549 KC584293 KC584417 KC584209 KC584128 KC584675 

USA KC584550 KC584294 KC584418 KC584210 KC584129 KC584676 

Alternaria 

perpunctulata 

Alternaria 

perpunctulata 

Althernantherae CBS 115267 T Alternanthera 

philoxeroides 

Alternaria petroselini Alternaria petroselini Radicina CBS 112.41 T Petroselinum sativum – EGS 06.196 KC584551 KC584295 KC584419 KC584211 KC584130 KC584677 

Alternaria photistica Alternaria photistica Panax CBS 212.86 T Digitalis purpurea UK EGS 35.172 KC584552 KC584296 KC584420 KC584212 KC584131 KC584678 

Alternaria porri Alternaria porri Porri CBS 116698 R Allium cepa USA EGS 48.147 KC584553 KC584297 KC584421 DQ323700 KC584132 KC584679 


175



Old species 

name 

Alternaria 

pseudorostrata 

New species 

name 

Alternaria 

pseudorostrata 

Alternaria 

Section 




Porri CBS 119411 T Euphorbia 

pulcherrima 

Alternaria radicina Alternaria radicina Radicina CBS 245.67 T Daucus carota USA EGS 03.145; ATCC 

6503; IMI 124939; 

QM 1301; QM 6503 


USA EGS 42.060 KC584554 KC584298 KC584422 JN383483 AY562406 KC584680 

KC584555 KC584299 KC584423 KC584213 KC584133 KC584681 

“Alternaria resedae” Alternaria sp. Cheiranthus CBS 115.44 Reseda odorata – EGS 07.030 KC584556 KC584300 KC584424 KC584214 KC584134 KC584682 

Alternaria saponariae Alternaria saponariae Gypsophilae CBS 116492 R Saponaria officinalis USA EGS 49.199 KC584557 KC584301 KC584425 KC584215 KC584135 KC584683 

Alternaria selini Alternaria selini Radicina CBS 109382 T Petroselinum crispum Saudi Arabia EGS 25.198; IMI KC584558 KC584302 KC584426 AF229455 AY278800 KC584684 

137332 

Alternaria septorioides Alternaria septorioides Brassicicola CBS 106.41 T Reseda odorata Netherlands EGS 52.089; MUCL KC584559 KC584303 KC584427 KC584216 KC584136 KC584685 

20298 

Alternaria simsimi Alternaria simsimi Dianthicola CBS 115265 T Sesamum indicum Argentina EGS 13.110 KC584560 KC584304 KC584428 JF780937 KC584137 KC584686 

Alternaria smyrnii Alternaria smyrnii Radicina CBS 109380 R Smyrnium olusatrum UK EGS 37.093 KC584561 KC584305 KC584429 AF229456 KC584138 KC584687 

Alternaria solani Alternaria solani Porri CBS 116651 R Solanum tuberosum USA EGS 45.020 KC584562 KC584306 KC584430 KC584217 KC584139 KC584688 

Alternaria soliaridae Alternaria soliaridae CBS 118387 T Soil USA EGS 33.024 KC584563 KC584307 KC584431 KC584218 KC584140 KC584689 

Alternaria solidaccana Alternaria solidaccana Brassicicola CBS 118698 T Soil Bangladesh EGS 36.158; IMI 

049788 

Alternaria sonchi Alternaria sonchi Sonchi CBS 119675 R Sonchus asper Canada EGS 43.131; IMI 

366167 

KC584564 KC584308 KC584432 KC584219 KC584141 KC584690 

KC584565 KC584309 KC584433 KC584220 KC584142 KC584691 

Alternaria tagetica Alternaria tagetica Porri CBS 479.81 R Tagetes erecta UK EGS 33.081 KC584566 KC584310 KC584434 KC584221 KC584143 KC584692 

Alternaria tenuissima Alternaria tenuissima Alternata CBS 918.96 R Dianthus sp. UK EGS 34.015 KC584567 KC584311 KC584435 AF347032 AY278809 KC584693 

Alternaria thalictrigena Alternaria thalictrigena CBS 121712 T Thalictrum sp. Germany KC584568 KC584312 KC584436 EU040211 KC584144 KC584694 

Alternaria 

triglochinicola 

Alternaria 

triglochinicola 

Eureka CBS 119676 T Triglochin procera Australia EGS 41.070 KC584569 KC584313 KC584437 KC584222 KC584145 KC584695 

Alternaria vaccariae Alternaria vaccariae Gypsophilae CBS 116533 R Vaccaria hispanica USA EGS 47.108 KC584570 KC584314 KC584438 KC584223 KC584146 KC584696 

Alternaria vaccariicola Alternaria vaccariicola Gypsophilae CBS 118714 T Vaccaria hispanica USA EGS 46.003; ATCC KC584571 KC584315 KC584439 KC584224 KC584147 KC584697 

26038 

Alternariaster helianthi Alternariaster helianthi CBS 119672 R Helianthus sp. USA EGS 36.007 KC584626 KC584368 KC584493 

Alternariaster helianthi Alternariaster helianthi CBS 327.69 Helianthus annuus – KC584627 KC584369 KC584494 

Ascochyta pisi Ascochyta pisi CBS 126.54 Pisum sativum Netherlands EU754038 DQ678070 DQ677967 

Boeremia exigua Boeremia exigua CBS 431.74 Solanum tuberosum Netherlands PD 74/2447 EU754084 EU754183 GU371780 

Brachycladium 

papaveris 

Brachycladium 

penicillatum 

Alternaria papavericola Crivellia CBS 116606 T Papaver somniferum USA KC584579 KC584321 KC584446 FJ357310 FJ357298 KC584705 

Alternaria penicillata Crivellia CBS 116608 T Papaver rhoeas Austria DAOM 230457 KC584572 KC584316 KC584440 FJ357311 FJ357299 KC584698 

176



Old species 

name 

New species 

name 

Alternaria 

Section 

Chaetodiplodia sp. Chaetodiplodia sp. CBS 453.68 Halimione 

portulacoides 

Chaetosphaeronema 

hispidulum 

Chaetosphaeronema 

hispidulum 





Netherlands DQ678001 DQ678054 KC584499 

CBS 216.75 Anthyllis vulneraria Germany EU754045 EU754144 GU371777 

Chalastospora cetera Alternaria cetera Chalastospora CBS 121340 T Elymus scabrus Australia EGS 41.072 KC584573 KC584317 KC584441 JN383482 AY562398 KC584699 

Chalastospora 

Alternaria breviramosa Chalastospora CBS 121331 T Triticum sp. Australia KC584574 KC584318 KC584442 FJ839608 KC584148 KC584700 

ellipsoidea 

Chalastospora 

Alternaria obclavata Chalastospora CBS 124120 T Air USA EGS 12.128 KC584575 FJ839651 KC584443 KC584225 KC584149 KC584701 

obclavata 

Chmelia slovaca Alternaria slovaca Infectoriae CBS 567.66 T Human Slovakia ATCC 24279 KC584576 KC584319 KC584444 KC584226 KC584150 KC584702 

Clathrospora elynae Clathrospora elynae CBS 161.51 Carex curvula Switzerland KC584628 KC584370 KC584495 

Clathrospora elynae Clathrospora elynae CBS 196.54 Carex curvula Switzerland KC584629 KC584371 KC584496 

Clathrospora 

heterospora 

Cochliobolus 

heterostrophus 

Alternaria sp. Alternata CBS 175.52 Juncus mertensianus USA EGS 35.1619; IMI 

068085; QM 1277 

Cochliobolus 

heterostrophus 

CBS 134.39 Zea mays – DSM 1149 AY544727 AY544645 DQ247790 

Cochliobolus sativus Cochliobolus sativus DAOM 226212 Hordeum vulgare Canada DQ677995 DQ678045 DQ677939 

KC584577 KC584320 KC584445 KC584227 KC584151 KC584703 

Comoclathris magna Alternaria sp. Alternata CBS 174.52 Anemone occidentalis USA EGS 39.1613; IMI 

068086; QM 1278 

Comoclathris 

compressa 

Comoclathris 

compressa 

Coniothyrium 

palmarum 

Comoclathris 

compressa 

Comoclathris 

compressa 

Coniothyrium 

palmarum 

CBS 156.53 Castilleja miniata USA EGS No. C-20285-I KC584630 KC584372 KC584497 

CBS 157.53 Ligusticum 

purpureum 

USA EGS No. 1952a-1633 KC584631 KC584373 KC584498 

CBS 400.71 Chamaerops humilis Italy EU754054 EU754153 DQ677956 

KC584578 DQ678068 DQ677964 KC584228 KC584152 KC584704 

Crivellia papaveracea Alternaria penicillata Crivellia CBS 116607 T Papaver rhoeas Austria DAOM 230456 KC584580 KC584322 KC584447 KC584229 KC584153 KC584706 

KC793336 KC793338 DQ470924 

Dendryphiella 

arenariae 

Paradendryphiella 

arenariae 

Dendryphiella salina Paradendryphiella 

salina 

CBS 181.58 T Coastal sand France DAOM 63738; IMI 

067735; MUCL 4129 

CBS 142.60 Spartina sp. UK MUCL 9639 KC793337 KC793339 KC793340 

Embellisia abundans Alternaria abundans Chalastospora CBS 534.83 T Fragaria sp. New Zealand EGS 29.159 KC584581 KC584323 KC584448 JN383485 KC584154 KC584707 

Embellisia allii Alternaria embellisia Embellisia CBS 339.71 R Allium sativum USA ATCC 22412; IMI KC584582 KC584324 KC584449 KC584230 KC584155 KC584708 

155707; MUCL 

18571; QM 8609 

Embellisia annulata Cicatricea salina CBS 302.84 T Cancer pagurus North Sea, 

Skagerrak 

KC584583 KC584325 KC584450 JN383486 JN383467 KC584709 


177



Old species 

name 

Embellisia 

chlamydospora 

New species 

name 

Alternaria 

chlamydosporigena 

Alternaria 

Section 




Embellisia CBS 341.71 R Air USA EGS 10.073; ATCC 

22409; IMI 155709; 

MUCL 18573; QM 

7287 


KC584584 KC584326 KC584451 KC584231 KC584156 KC584710 

Embellisia conoidea Alternaria conoidea Brassicicola CBS 132.89 Ricinus communis Saudi Arabia KC584585 KC584327 KC584452 AF348226 FJ348227 KC584711 

Embellisia dennisii Alternaria dennisii CBS 110533 Senecio jacobaea New Zealand KC584586 KC584328 KC584453 KC584232 KC584157 KC584712 

Embellisia dennisii Alternaria dennisii CBS 476.90 T Senecio jacobaea Isle of Man IMI 151744 KC584587 KC584329 KC584454 JN383488 JN383469 KC584713 

Embellisia 

didymospora 

Alternaria didymospora Phragmosporae CBS 766.79 Seawater Adriatic Sea KC584588 KC584330 KC584455 FJ357312 FJ357300 KC584714 

Embellisia eureka Alternaria eureka Eureka CBS 193.86 T Medicago rugosa Australia IMI 273162 KC584589 KC584331 KC584456 JN383490 JN383471 KC584715 

Embellisia hyacinthi Alternaria hyacinthi Embellisioides CBS 416.71 T Hyacinthus orientalis Netherlands EGS 19.102; IMI KC584590 KC584332 KC584457 KC584233 KC584158 KC584716 

279179 

Embellisia indefessa Alternaria indefessa Cheiranthus CBS 536.83 T Soil USA EGS 30.195 KC584591 KC584333 KC584458 KC584234 KC584159 KC584717 

Embellisia leptinellae Alternaria leptinellae Eureka CBS 477.90 T Leptinella dioica New Zealand EGS 39.101 KC584592 KC584334 KC584459 KC584235 KC584160 KC584718 

Embellisia lolii Alternaria lolii Embellisioides CBS 115266 T Lolium perenne New Zealand KC584593 KC584335 KC584460 JN383492 JN383473 KC584719 

Embellisia novaezelandiae 

Embellisia 

phragmospora 

Alternaria botryospora Embellisioides CBS 478.90 T Leptinella dioica New Zealand EGS 39.099 KC584594 KC584336 KC584461 AY278844 AY278831 KC584720 

Alternaria 

phragmospora 

Phragmosporae CBS 274.70 T Soil The 

netherlands 

EGS 27.098; ATCC 

18914 

KC584595 KC584337 KC584462 JN383493 JN383474 KC584721 

Embellisia planifunda Alternaria planifunda Embellisioides CBS 537.83 T Triticum aestivum Australia IMI 115034 KC584596 KC584338 KC584463 FJ357315 FJ357303 KC584722 

Embellisia proteae Alternaria proteae Embellisioides CBS 475.90 T Protea sp. Australia IMI 320290; IMI KC584597 KC584339 KC584464 AY278842 KC584161 KC584723 

341684 

Embellisia tellustris Alternaria tellustris Embellisia CBS 538.83 T Soil USA EGS 33.026 KC584598 KC584340 KC584465 FJ357316 AY562419 KC584724 

Embellisia tumida Alternaria tumida Embellisioides CBS 539.83 T Triticum aestivum Australia KC584599 KC584341 KC584466 FJ266481 FJ266493 KC584725 

CBS 115.96 Chenopodium album Netherlands PD 94/1576 EU754089 EU754188 GU371775 

Heterospora 

chenopodii 

Heterospora 

chenopodii 

Julella avicenniae Julella avicenniae BCC 18422 Mangrove wood Thailand GU371831 GU371823 GU371787 

Leptosphaerulina 

australis 

Leptosphaerulina 

australis 

CBS 317.83 Eugenia aromatica Indonesia GU296160 GU301830 GU371790 

Loratospora aestuarii Loratospora aestuarii JK 5535B Juncus roemerianus USA GU296168 GU301838 GU371760 

Neophaeosphaeria 

filamentosa 

Neophaeosphaeria 

filamentosa 

CBS 102202 Yucca rostrata Mexico GQ387516 GQ387577 GU371773 

Nimbya caricis Alternaria caricis Nimbya CBS 480.90 T Carex hoodii USA EGS 13.094 KC584600 KC584342 KC584467 AY278839 AY278826 KC584726 

“Nimbya gomphrenae” Alternaria sp. Alternata CBS 108.27 Gomphrena globosa – KC584601 KC584343 KC584468 KC584236 KC584162 KC584727 

Nimbya scirpicola Alternaria scirpicola Nimbya CBS 481.90 R Scirpus sp. UK EGS 19.042 KC584602 KC584344 KC584469 KC584237 KC584163 KC584728 

178



Old species 

name 

Ophiosphaerella 

herpotricha 


dryadis 

Peyronellaea 

glomerata 

Peyronellaea zeaemaydis 

Phaeosphaeria 

ammophilae 

Phaeosphaeria 

avenaria 

Phaeosphaeria 

eustoma 

New species 

name 

Ophiosphaerella 

herpotricha 


dryadis 

Peyronellaea 

glomerata 

Peyronellaea zeaemaydis 

Phaeosphaeria 

ammophilae 

Phaeosphaeria 

avenaria 

Phaeosphaeria 

eustoma 

Alternaria 

Section 





CBS 620.86 Bromus erectus Switzerland ETH 9373 DQ678010 DQ678062 DQ677958 

CBS 643.86 Dryas octopetala Switzerland ETH 9446 KC584632 GU301828 GU371733 

CBS 528.66 Chrysanthemum sp. Netherlands PD 63/590 EU754085 EU754184 GU371781 

CBS 588.69 T Zea mays USA EU754093 EU754192 GU371782 

CBS 114595 Ammophila arenaria Sweden UPSC 3568 GU296185 GU304859 GU371724 

DAOM 226215 Avena sativa Canada OSC 100096 AY544725 AY544684 DQ677941 

CBS 573.86 Dactylis glomerata Switzerland ETH 9239 DQ678011 DQ678063 DQ677959 

Phoma complanata Phoma complanata CBS 268.92 Anglica sylvestris Netherlands PD 75/3 EU754081 EU754180 GU371778 

Phoma herbarum Phoma herbarum CBS 276.37 Wood pulp Sweden DQ678014 DQ678066 DQ677962 

Plenodomus lingam Plenodomus lingam DAOM 229267 Brassica sp. France DQ470993 DQ470946 DQ470894 

Pleospora betae Pleospora betae CBS 109410 Beta vulgaris Netherlands PD 77/113 EU754079 EU754178 GU371774 

Pleospora calvescens Pleospora calvescens CBS 246.79 Atriplex hastata Germany PD 77/655 EU754032 EU754131 KC584500 

Pleospora chenopodii Pleospora chenopodii CBS 206.80 Chenopodium quinoa Bolivia PD 74/1022 JF740095 JF740266 KC584501 

Pleospora fallens Pleospora fallens CBS 161.78 Olea europaea New Zealand GU238215 GU238074 KC584502 

Pleospora halimiones Pleospora halimiones CBS 432.77 Halimione 

portulacoides 

Netherlands IMI 282137 JF740096 JF740267 KC584503 

Pleospora incompta Pleospora incompta CBS 467.76 Olea europaea Greece GU23822 GU238087 KC584504 

Pleospora tarda Pleospora tarda CBS 714.68 T Medicago sativa Canada EGS 04.118C; IMI 

135456; MUCL 

11717; QM 1379 

Pleospora typhicola Pleospora typhicola CBS 132.69 Typha angustifolia Netherlands JF740105 JF740325 KC584505 

KC584603 KC584345 AF107804 KC584238 AF443881 KC584729 

Pyrenochaeta nobilis Pyrenochaeta nobilis CBS 407.76 T Laurus nobilis Italy EU754107 DQ678096 DQ677991 

Pyrenophora 

phaeocomes 

Saccothecium 

sepincola 

Setomelanomma 

holmii 

Pyrenophora 

phaeocomes 

Saccothecium 

sepincola 

Setomelanomma 

holmii 

DAOM 222769 Calamagrostis villosa Switzerland DQ499595 DQ499596 DQ497614 

CBS 278.32 Ribes nigrum USA GU296195 GU301870 GU371745 

CBS 110217 Picea pungens USA GU296196 GQ37633 GU371800 


179



Old species 

name 

New species 

name 

Alternaria 

Section 





Sinomyces alternariae Alternaria alternariae Ulocladium CBS 126989 T Daucus carota USA EGS 46.004 KC584604 KC584346 KC584470 AF229485 AY278815 KC584730 

Stemphylium herbarum Stemphylium herbarum CBS 191.86 T Medicago sativa India EGS 36.138; IMI 276975 

GU238232 GU238160 KC584471 KC584239 AF443884 KC584731 

KC584605 KC584347 KC584472 KC584240 KC584164 KC584732 

Teretispora 

leucanthemi 

Teretispora 

leucanthemi 

Ulocladium 

arborescens 

Alternaria leucanthemi Teretispora CBS 421.65 T Chrysanthemum 

maximum 

Alternaria leucanthemi CBS 422.65 R Chrysanthemum 

maximum 

Netherlands ATCC 16028; IFO 

9085; IMI 111986; 

QM 7227 

USA EGS 17.063; ATCC 

16029; IMI 111987; 

QM 8579 

KC584606 KC584348 KC584473 KC584241 KC584165 KC584733 

Alternaria aspera Pseudoulocladium CBS 115269 T Pistacia vera Japan IMI 369777 KC584607 KC584349 KC584474 KC584242 KC584166 KC584734 

Ulocladium atrum Alternaria atra Ulocladioides CBS 195.67 T Soil USA ATCC 18040; IMI 

124944; QM 8408 

Ulocladium botrytis Alternaria botrytis Ulocladium CBS 197.67 T Contaminant USA ATCC 18042; IMI 

124942; MUCL 

18556; QM 7878 

Ulocladium botrytis Alternaria sp. Ulocladioides CBS 198.67 R Soil USA ATCC 18043; IMI 

124949; MUCL 

18557; QM 8619 

Ulocladium brassicae Alternaria brassicaepekinensis 

KC584608 KC584350 KC584475 AF229486 KC584167 KC584735 

KC584609 KC584351 KC584476 KC584243 KC584168 KC584736 

KC584610 KC584352 KC584477 AF229487 KC584169 KC584737 

Ulocladioides CBS 121493 T Brassica pekinensis China HSAUPwy0037 KC584611 KC584353 KC584478 KC584244 KC584170 KC584738 

Ulocladium cantlous Alternaria cantlous Ulocladioides CBS 123007 T Cucumis melo China HSAUP0209 KC584612 KC584354 KC584479 KC584245 KC584171 KC584739 

Ulocladium capsici Alternaria concatenata Pseudoulocladium CBS 120006 T – – HSAUPIII 0 

0035 KC584613 KC584355 KC584480 KC584246 AY762950 KC584740 

Ulocladium chartarum Alternaria chartarum Pseudoulocladium CBS 200.67 T Populus sp. Canada ATCC 18044; DAOM KC584614 KC584356 KC584481 AF229488 KC584172 KC584741 

59616b; IMI 124943; 

MUCL 18564; QM 

8328 

Ulocladium consortiale Alternaria consortialis Ulocladioides CBS 104.31 T – – KC584615 KC584357 KC584482 KC584247 KC584173 KC584742 

Ulocladium cucurbitae Alternaria cucurbitae Ulocladioides CBS 483.81 R Cucumis sativus New Zealand EGS 31.021; LEV KC584616 KC584358 KC584483 FJ266483 AY562418 KC584743 

7067 

Ulocladium multiforme Alternaria multiformis Ulocladioides CBS 102060 T Soil Canada KC584617 KC584359 KC584484 FJ266486 KC584174 KC584744 

Ulocladium 

Alternaria obovoidea Ulocladioides CBS 101229 Cucumis sativus New Zealand KC584618 KC584360 KC584485 FJ266487 FJ266498 KC584745 

obovoideum 

Ulocladium oudemansii Alternaria oudemansii Ulocladium CBS 114.07 T – – ATCC 18047; IMI KC584619 KC584361 KC584486 FJ266488 KC584175 KC584746 

124940; MUCL 

18563; QM 1744 

Ulocladium 

septosporum 

Alternaria septospora Pseudoulocladium CBS 109.38 Wood Italy KC584620 KC584362 KC584487 FJ266489 FJ266500 KC584747 

180






Alternaria 

Section 

New species 

name 

Old species 

name 


China HSAUP 0521 KC584621 KC584363 KC584488 KC584248 KC584176 KC584748 

Ulocladium solani Alternaria heterospora Ulocladioides CBS 123376 T Lycopersicon 

esculentum 

China KC584622 KC584364 KC584489 KC584249 EU855803 KC584749 

Ulocladioides CBS 121491 T Chenopodium 

glaucum 

Alternaria 

subcucurbitae 

Ulocladium 

subcucurbitae 

KC584623 KC584365 KC584490 FJ266490 KC584177 KC584750 

Alternaria terricola Ulocladioides CBS 202.67 T Soil USA ATCC 18048; IMI 

124947; MUCL 

18560; QM 8614 

Ulocladium 

tuberculatum 

Undifilum bornmuelleri Alternaria bornmuelleri Undifilum DAOM 231361 T Securigera varia Austria DAOM 231361 KC584624 KC584366 KC584491 FJ357317 FJ357305 KC584751 

Ybotromyces 

Alternaria caespitosa Infectoriae CBS 177.80 T Human Spain KC584625 KC584367 KC584492 KC584250 KC584178 KC584752 

caespitosus 

1 

ATCC: American Type Culture Collection, Manassas, VA, USA; BCC: BIOTEC Culture Collection, Thailand; CBS: Culture collection of the Centraalbureau voor Schimmelcultures, Fungal Biodiversity Centre, Utrecht, The Netherlands; DAOM: Canadian 

Collection of Fungal Cultures, Ottawa, Canada; DAR: Plant Pathology Herbarium, Orange Agricultural Institute, Australia; DSM: German Collection of Microorganisms and Cell Cultures, Leibniz Institute, Braunschweig, Germany; EGS: Personal collection 

of Dr. E.G. Simmons; ETH: Swiss Federal Institute of Technology, Switzerland; HSAUP: Department of Plant Pathology, Shandong Agricultural University, China; IFO: Institute for Fermentation Culture Collection, Osaka, Japan; IMI: Culture collection of 

CABI Europe UK Centre, Egham UK; JK: Personal collection of Dr. J. Kohlmeyer; LEV: Plant Health and Diagnostic Station, Levin, New Zealand; MUCL: (Agro)Industrial Fungi and Yeast Collection of the Belgian Co-ordinated Collections of Micro-organisms 

(BCCM), Louvain-la Neuve, Belgium; NZMAF: New Zealand Ministry of Agriculture and Forestry; OSC: Oregon State University Herbarium, USA; PD: Plant Protection Service, Wageningen, The Netherlands; RGR: Personal collection of Dr. R.G. Roberts; 

UPSC: Uppsala University Culture Collection, Sweden; QM: Quarter Master Culture Collection, Amherst, MA, USA. 

2 

T: ex-type strain; R: representative strain. 

species (Table 1) for which the SSU, LSU and RPB2 sequence 

data set was present or could be completed. Blast searches with 

Embellisia annulata gave hits with two marine Dendryphiella species, 

Dendryphiella arenariae and Dendryphiella salina, which we also 

included. Phylogenetic analyses of the sequence data consisted of 

Bayesian and Maximum likelihood analyses of both the individual 

data partitions as well as the combined aligned dataset. Bayesian 

analyses were performed with MrBayes v. 3.2.1 (Huelsenbeck & 

Ronquist 2001, Ronquist & Huelsenbeck 2003). The Markov Chain 

Monte Carlo (MCMC) analysis used four chains and started from a 

random tree topology. The sample frequency was set at 100 and the 

temperature value of the heated chain was 0.1. The temperature 

value was lowered to 0.05 when the average standard deviation of 

split frequencies did not fall below 0.01 after 5M generations (RPB2 

and Pleosporineae phylogeny). Burn-in was set to 25 % after which 

the likelihood values were stationary. Maximum likelihood analyses 

including 500 bootstrap replicates were run using RAxML v. 7.2.6 

(Stamatakis & Alachiotis 2010). The online tool Findmodel (http:// 

www.hiv.lanl.gov/content/sequence/findmodel/findmodel.html) was 

used to determine the best nucleotide substitution model for each 

partition. For the SSU (Pleosporineae family tree), LSU, ITS, RPB2 

and TEF1 partitions a GTR model with a gamma-distributed rate 

variation was suggested, and for the SSU (Alternaria complex) 

and GAPDH partitions a TrN model with gamma-distributed rate 

variation. Sequences of Stemphylium herbarum (CBS 191.86) 

were used as outgroup in the Alternaria phylogeny and those of 

Jullella avenicae (BCC 18422) in the Pleosporineae phylogeny. The 

resulting trees were printed with TreeView v. 1.6.6 (Page 1996) and 

together with the alignments deposited into TreeBASE (http://www. 

treebase.org). 

RESULTS 

Phylogeny 

For defining the taxonomy of Alternaria and allied genera, 121 

strains were included in the Alternaria complex alignment. The 

alignment length and unique site patterns of the different genes and 

gene combinations are stated in Table 2. The original ITS alignment 

consisted of 577 characters of which the first 78 are excluded 

as this contained a non-alignable region. In the original TEF1 

alignment (375 characters) we coded the major inserts (Table 3), 

which otherwise would negatively influence the phylogeny, resulting 

in a TEF1 alignment of 269 characters. All phylogenies, different 

phylogenetic methods and gene regions or gene combinations 

used on this dataset (data not shown, trees and alignments lodged 

in TreeBASE), show a weak support at the deeper nodes of the 

tree. The only well-supported node (Bayesian posterior probability 

of 1.0, RAxML Maximum Likelihood support value of 100) in all 

phylogenies separates Embellisia annulata CBS 302.84 and 

the Pleospora/Stemphylium clade from the Alternaria complex 

(Fig. 1). In the Alternaria clade, six monotypic lineages and 24 

internal clades occur consistently in the individual and combined 

phylogenies, although positions vary between the different gene 

regions or combinations used. The support values for the clades 

within Alternaria (called sections) are plotted in a heat map (Table 

2) per gene and phylogenetic method used. The support values for 

the different phylogenetic methods vary, with the Bayesian posterior 

probabilities being higher than the RAxML bootstrap support 

values (Table 2). The SSU, LSU and ITS phylogenies display a 


181


Table 2. Summary of locus and phylogenetic results as well as a heat map of the Bayesian posterior probabilities and RAxML boostrap support values per Alternaria section. 

1-region 2-region 3-region 6-region 1-region 2-region 3-region 6-region 

SSU LSU ITS GAPDH RPB2 TEF GAPDH GAPDH RPB2 GAPDH SSU SSU LSU ITS GAPDH RPB2 TEF GAPDH GAPDH RPB2 GAPDH ALL 

RPB2 TEF1 TEF1 RPB2 LSU RPB2 TEF1 TEF1 RPB2 LSU 

TEF1 ITS TEF1 ITS 

GAPDH GAPDH 

RPB2 RPB2 

TEF1 TEF1 

Aligned length 1021 851 499 573 786 269 1359 842 1055 1628 3999 1021 851 499 573 786 269 1359 842 1055 1628 3999 

Unique site patterns 45 57 148 272 296 224 568 496 520 792 1042 45 57 148 272 296 224 568 496 520 792 1042 

No. of sampled trees 39002 31578 75002 23702 56028 12452 10128 13728 44852 5778 16278 

(post burnin) 

Bayesian Posterior Probabilities RAxML bootstrap support 

Sect. Alternantherae * * 

Sect. Alternata 

Sect. Brassicicola 

Sect. Chalastospora * * 

Sect. Cheiranthus * * * * * * * * 

Sect. Crivellia * * 

Sect. Dianthicola * * * * 

Sect. Embellisia * * 

Sect. Embellisioides * * * * * * 

Sect. Eureka * * * * * * 

Sect. Gypsophilae * * 

Sect. Infectoriae * * * * 

Sect. Japonicae 

Sect. Nimbya 

Sect. panax * * 

Sect. Phragmosporae * * * * 

Sect. Porri * * 

Sect. Pseudoulocladium * * * * * * * * 

Sect. Radicina 

Sect. Sonchi * * * * 

Sect. Teretispora 

Sect. Ulocladioides * * * * 

Sect. Ulocladium * * 

1.00 0.95–0.99 0.90–0.94 0.80–0.89 0.70–0.79 100 95–99 90–94 80–89 70–79 

0.50–0.69 0.25–0.49 0.01–0.24 no support 50–69 25–49 1–24 no support 

*= section not complete *= section not complete 

182


Table 3. Coded inserts in the TEF1 sequence alignment. 

Species Nt position Coded Nt position Coded 

Alternaria elegans 23 to 39 TC 

Alternaria simsimi 23 to 39 TCC 

Alternaria dauci 186 to 205 C 221 to 269 TACTT 

Alternaria macrospora 186 to 205 C 221 to 269 TCCCC 

Alternaria porri 186 to 205 C 221 to 269 ACTTA 

Alternaria pseudorostrata 186 to 205 C 221 to 269 TGGTA 

Alternaria solani 186 to 205 C 221 to 269 -AAGG 

Alternaria tegetica 186 to 205 C 221 to 269 CACAC 

low resolution, which reflects in poor to no support of the sections. 

Therefore, we chose not to include them in the multi-gene alignments, 

except in the all-gene alignment. In the GAPDH phylogenies, sect. 

Cheiranthus, sect. Nimbya and sect. Pseudoulocladium are poorly 

supported and “A. resedae” clusters separate from sect. Cheiranthus. 

In the RPB2 phylogenies the support values for sect. Alternata, sect. 

Embellisioides and sect. Eureka are relatively low; A. cumini clusters 

in sect. Embellisioides instead of sect. Eureka and U. capsici clusters 

separate from sect. Pseudoulocladium. The TEF1 phylogenies did 

not support sect. Nimbya and show relative low support for sect. 

Cheiranthus, sect. Dianthicola, sect. Embellisioides, sect. Panax, 

sect. Phragmosporae and sect. Radicina, and A. cumini clusters 

outside sect. Eureka. In the 2-region phylogenies U. capsici clusters 

outside sect. Pseudoulocladium based on GAPDH and RPB2, E. 

indefessa clusters outside sect. Cheiranthus based on GAPDH and 

TEF1, and sect. Eureka is poorly supported based on RPB2 and 

TEF1. The combined phylogeny based on the GAPDH, RPB2 and 

TEF1 sequences (Fig. 1) is displayed, as these are the genes with 

the best resolution. 

The final Pleosporineae alignment included 74 strains, 

representing six families, and consisted of 2 506 characters 

(SSU 935, LSU 796, RPB2 775) of which 700 were unique site 

patterns (SSU 111, LSU 145, RPB2 444). In the SSU alignment a 

large insertion at position 446 in the isolates Chaetosphaeronema 

hispidulum CBS 216.75, Pleospora fallens CBS 161.78, Pleospora 

flavigena CBS 314.80 and Ophiosphaerella herpotrichia CBS 

620.86 was excluded from the phylogenetic analyses. A total of 

43 202 trees were sampled after the burn-in. The type species 

of Clathrospora, C. elynae, forms a well-supported clade, located 

basal to the Pleosporaceae (Fig. 2), outside the Alternaria complex. 

The type species of Comoclathris, C. lanata, was not available for 

study but the two Comoclathris compressa strains cluster in a wellsupported 

clade within the Pleosporaceae outside Alternaria s. 

str. The genus Alternariaster, with Alternariaster helianthi as type 

and only species, also clusters outside the Alternaria complex and 

even outside Pleosporaceae; it belongs to the Leptosphaeriaceae 

instead (Fig. 2). Embellisia annulata is identical to Dendryphiella 

salina, and forms a well-supported clade in the Pleosporaceae 

together with Dendryphiella arenariae. As the type species of 

Dendryphiella, D. vinosa, clusters outside the Pleosporineae 

(dela Cruz 2006, Jones et al. 2008), Dendryphiella salina and D. 

arenariae are placed in a new genus, Paradendryphiella, below. 

Taxonomy 

Based on DNA sequence data in combination with a review 

of literature and morphology, the species within the Alternaria 

clade are all recognised here as Alternaria (Fig 1). This puts the 

genera Allewia, Brachycladium, Chalastospora, Chmelia, Crivellia, 

Embellisia, Lewia, Nimbya, Sinomyces, Teretispora, Ulocladium, 

Undifilum and Ybotromyces in synonymy with Alternaria, resulting 

in the proposal of 32 new combinations, 10 new names and the 

resurrection of 10 names. Species of Alternaria were assigned 

to 24 Alternaria sections, of which 16 are newly described, and 

six monotypic lineages. The (emended) description of the genus 

Alternaria, the Alternaria sections and monotypic lineages with 

new Alternaria names and name combinations are treated below 

in alphabetical order. Finally the description of the new genus 

Paradendryphiella is also provided. 

Alternaria Nees, Syst. Pilze (Würzburg): 72. 1816 [1816– 

1817]. 

= Elosia Pers., Mycol. Eur. (Erlanga) 1: 12. 1822. 

= Macrosporium Fr., Syst. Mycol. (Lundae) 3: 373. 1832. 

= Rhopalidium Mont., Ann. Sci. Nat., Bot., Sér. 2, 6: 30. 1836. 

= Brachycladium Corda, Icon. Fungorum hucusque Cogn. (Prague) 2: 14. 

1838. 

= Ulocladium Preuss, Linnaea 24: 111. 1851. 

= Chmelia Svob.-Pol., Biologia (Bratislava) 21: 82. 1966. 

= Embellisia E.G. Simmons, Mycologia 63: 380. 1971. 

= Trichoconiella B.L. Jain, Kavaka 3: 39. 1976 [1975]. 

= Botryomyces de Hoog & C. Rubio, Sabouraudia 20: 19. 1982. (nom. illegit.) 

= Lewia M.E. Barr & E.G. Simmons, Mycotaxon 25: 289. 1986. 

= Ybotromyces Rulamort, Bull. Soc. Bot. Centre-Ouest, Nouv. Sér. 17: 192. 

1986. 

= Nimbya E.G. Simmons, Sydowia 41: 316. 1989. 

= Allewia E.G. Simmons, Mycotaxon 38: 260. 1990. 

= Crivellia Shoemaker & Inderb., Canad. J. Bot. 84: 1308. 2006. 

= Chalastospora E.G. Simmons, CBS Biodiversity Ser. (Utrecht) 6: 668. 2007. 

= Teretispora E.G. Simmons, CBS Biodiversity Ser. (Utrecht) 6: 674. 2007. 

= Undifilum B.M. Pryor, Creamer, Shoemaker, McLain-Romero & Hambl., 

Botany 87: 190. 2009. 

= Sinomyces Yong Wang bis & X.G. Zhang, Fungal Biol. 115: 192. 2011. 

Colonies effuse, usually grey, dark blackish brown or black. Mycelium 

immersed or partly superficial; hyphae colourless, olivaceousbrown 

or brown. Stroma rarely formed. Setae and hyphopodia 

absent. Conidiophores macronematous, mononematous, simple 

or irregularly and loosely branched, pale brown or brown, solitary 

or in fascicles. Conidiogenous cells integrated, terminal becoming 

intercalary, polytretic, sympodial, or sometimes monotretic, 

cicatrized. Conidia catenate or solitary, dry, ovoid, obovoid, 

cylindrical, narrowly ellipsoid or obclavate, beaked or non-beaked, 

pale or medium olivaceous-brown to brown, smooth or verrucose, 

with transverse and with or without oblique or longitudinal septa. 

Septa can be thick, dark and rigid and an internal cell-like structure 

can be formed. Species with meristematic growth are known. 

Ascomata small, solitary to clustered, erumpent to (nearly) 

superficial at maturity, globose to ovoid, dark brown, smooth, 

apically papillate, ostiolate. Papilla short, blunt. Peridium thin. 

Hamathecium of cellular pseudoparaphyses. Asci few to many per 

ascoma, (4–6–)8-spored, basal, bitunicate, fissitunicate, cylindrical 

to cylindro-clavate, straight or somewhat curved, with a short, 

furcate pedicel. Ascospores muriform, ellipsoid to fusoid, slightly 

constricted at septa, yellow-brown, without guttules, smooth, 3–7 

transverse septa, 1–2 series of longitudinal septa through the 

two original central segments, end cells without septa, or with 1 

longitudinal or oblique septum, or with a Y-shaped pair of septa. 

Type species: Alternaria alternata (Fr.) Keissl. 


183


0.96/55 

1.0/54 

0.52/28 

1.0/97 

Alternaria brassicae CBS 116528 

Alternaria sonchi CBS 119675 

Alternaria helianthiinficiens CBS 208.86 

Embellisia eureka CBS 193.86 

Embellisia hyacinthi CBS 416.71 

1.0/65 

1.0/95 Alternaria dianthicola CBS 116491 

1.0/83 

0.97/66 

Ulocladium chartarum CBS 200.67 


Alternaria cheiranthi CBS 109384 

1.0/91 

0.97/50 

Alternaria alternantherae CBS 124392 

Alternaria alternata CBS 916.96 

A 

l 

0.99/34 Alternaria porri CBS 116698 

t 

0.56/23 

Alternaria radicina CBS 245.67 

e 

0.68/27 

1.0/89 Alternaria saponariae CBS 116492 r 

1.0/57 

0.92/25 

Alternaria thalictrigena CBS 121712 

Alternaria panax CBS 482.81 

n 

a 

Teretispora leucanthemi CBS 421.65 r 

Alternaria brassicicola CBS 118699 i 

0.66/- 

0.97/53 

Alternaria japonica CBS 118390 

Embellisia dennisii CBS 110533 

Sinomyces alternariae CBS 126989 

a 

1.0/9 

0.99/73 

Alternaria argyranthemi CBS 116530 

Undifilum bornmuelleri DAOM 231361 

Chalastospora cetera CBS 121340 

0.82/23 

0.99/38 

0.98/95 

Alternaria infectoria CBS 210.86 

Alternaria soliaridae CBS 118387 

Nimbya scirpicola CBS 481.90 

Embellisia allii CBS 339.71 

Embellisia phragmospora CBS 274.70 

Crivellia papaveracea CBS 116607 

Pyrenophora phaeocomes DAOM 222769 

Pleosporaceae 

Embellisia annulata CBS 302.84 

Dendryphiella salina CBS 142.60 Paradendryphiella gen. nov. 

Dendryphiella arenariae CBS 181.58 

Pleospora herbarum CBS 191.86 

Cochliobolus heterostrophus CBS 134.39 

Cochliobolus sativus DAOM 226212 

Comoclathris compressa CBS 156.53 

0.98/79 

Comoclathris compressa CBS 157.53 

1.0/79 

Pleospora typhicola CBS 132.69 

Pleospora incompta CBS 467.76 

0.96/83 Pleospora calvescens CBS 246.79 

Pleospora halimiones CBS 432.77 

1.0/79 1.0/97 Pleospora chenopodii CBS 206.80 

Pleospora betae CBS 109410 

1.0/65 

Chaetodiplodia sp. CBS 453.68 

Clathrospora elynae CBS 161.51 

Clathrospora elynae CBS 196.54 

Pleospora fallens CBS 161.78 

Alternariaster helianthi CBS 119672 

0.94/51 

Alternariaster helianthi CBS 327.69 

0.68/31 

Plenodomus lingam DAOM 229267 

0.55/- 

Neophaeosphaeria filamentosa CBS 102202 

0.87/54 

0.70/- 

Paraleptosphaeria dryadis CBS 643.86 

0.65/49 

Heterospora chenopodii CBS 115.96 

0.52/- 

Pleospora flavigena CBS 314.80 

0.94/67 

Coniothyrium palmarum CBS 400.71 

Pyrenochaeta nobilis CBS 407.76 

Ophiosphaerella herpotricha CBS 620.86 

Coniothyriaceae 

Cucurbitariaceae 

1.0/89 

Phaeosphaeria ammophilae CBS 114595 

Phaeosphaeria avenaria DAOM 226215 

0.86/85 

Phaeosphaeria eustoma CBS 573.86 

Chaetosphaeronema hispidulum CBS 216.75 

Loratospora aestuarii JK 5535B 

Setomelanomma holmii CBS 110217 

Saccothecium sepincola CBS 278.32 

Leptosphaerulina australis CBS 317.83 

0.56/49 0.85/41 Phoma complanata CBS 268.92 

1.0/81 

Phoma herbarum CBS 276.37 

0.99/90 Ascochyta pisi CBS126 54 

Didymellaceae 

1.0/91 

Peyronellaea glomerata CBS 528.66 

Peyronellaea zeae-maydis CBS 588.69 

Boeremia exigua CBS 431.74 

Julella avicenniae BCC 18422 

0.1 

Leptosphaeriaceae 


Fig. 2. Bayesian 50 % majority rule consensus tree based on the SSU, LSU and RPB2 sequences of 74 strains representing the Pleosporineae. The Bayesian posterior 

probabilities (PP) and RAxML bootstrap support values (ML) are given at the nodes (PP/ML). Thickened lines indicate a PP of 1.0 and ML of 100. The tree was rooted to Julella 

avicenniae (BCC 18422). 

184


Fig. 3. Alternaria sect. Alternantherae: conidia and conidiophores. A–D. A. alternantherae. E–H. A. perpunctulata. Scale bars = 10 µm. 

ALTERNARIA SECTIONS 

Section Alternantherae D.P. Lawr., Gannibal, Peever 

& B.M. Pryor, Mycologia 105: 540. 2013. Fig. 3. 

Type species: Alternaria alternantherae Holcomb & Antonop. 

Diagnosis: Section Alternantherae contains short to moderately 

long conidiophores with a conidiogenous tip which can be enlarged. 

Conidia are narrowly ellipsoid or ovoid, sometimes subcylindrical, 

solitary or rarely paired, sometimes slightly constricted near some 

septa, longitudinal or oblique septa occasionally occur, disto- and 

euseptate, with a long apical narrow beak. The conidial beak is 

unbranched, septate or aseptate, long filiform, and sometimes 

swollen at the end. Internal compartmentation occurs, cell lumina 

tend to be broadly octagonal to rounded. 

Notes: Section Alternantherae was recently established by 

Lawrence et al. (2013) after first being described as speciesgroup 

A. alternantherae (Lawrence et al. 2012). The described 

section consists of three former Nimbya species which formed 

a separate clade amidst the Alternaria species-groups based 

on sequences of the GAPDH, ITS and Alt a 1 genes (Lawrence 

et al. 2012). Nimbya celosiae is placed in this section based 

on the data of Lawrence et al. (2012), while N. gomphrenae is 

placed in the section based on ITS sequence data from Chou 

& Wu (2002). 

Alternaria alternantherae Holcomb & Antonop., Mycologia 68: 

1126. 1976. 

≡ Nimbya alternantherae (Holcomb & Antonop.) E.G. Simmons & Alcorn, 

Mycotaxon 55: 142. 1995. 

Alternaria celosiicola Jun. Nishikawa & C. Nakash., J. 

Phytopathol.: doi: 10.1111/jph.12108 (p. 3). 2013. 

Basionym: Nimbya celosiae E.G. Simmons & Holcomb, Mycotaxon 

55: 144. 1995. 

≡ Alternaria celosiae (E.G. Simmons & Holcomb) D.P. Lawr., M.S. Park 

& B.M. Pryor, Mycol. Progr. 11: 811. 2012. (nom. illegit., homonym of 

Alternaria celosiae (Tassi) O. Savul. 1950). 

Alternaria gomphrenae Togashi, Bull. Imp. Coll. Agric. 9: 6. 1926. 

≡ Nimbya gomphrenae (Togashi) E.G. Simmons, Sydowia 41: 324. 1989. 

Alternaria perpunctulata (E.G. Simmons) D.P. Lawr., M.S. Park & 

B.M. Pryor, Mycol. Progr. 11: 811. 2012. 

Basionym: Nimbya perpunctulata E.G. Simmons, Stud. Mycol. 50: 

115. 2004. 

Section Alternata D.P. Lawr., Gannibal, Peever & B.M. 

Pryor, Mycologia 105: 538. 2013. Fig. 4. 

Type species: Alternaria alternata (Fr.) Keissl. 

Diagnosis: Section Alternata contains straight or curved primary 

conidiophores, short to long, simple or branched, with one or several 

apical conidiogenous loci. Conidia are obclavate, long ellipsoid, small 

or moderate in size, septate, slightly constricted near some septa, 

with few longitudinal septa, in moderately long to long, simple or 

branched chains. The conidium body can narrow gradually into a 

tapered beak or secondary conidiophore. Secondary conidiophores 

can be formed apically or laterally with one or a few conidiogenous 

loci. 


185


Fig. 4. Alternaria sect. Alternata: conidia and conidiophores. A, N. A. daucifolii. B, L–M. A. arborescens. C, H–J. A. alternata. D, O. A. gaisen. E. A. limoniasperae. F, K. A. 

tenuissima. G, P. A. longipes. Scale bars = 10 µm. 

Notes: Next to the species that are displayed in our phylogeny, 

14 more are included in sect. Alternata based on the study of 

Lawrence et al. (2013) and confirmed by our molecular data (not 

shown). We chose not to include 11 species from the study of 

Lawrence et al. (2013). The species A. gossypina, A. grisae, A. 

grossulariae, A. iridis, A. lini, A. maritima and A. nelumbii were 

not recognised by Simmons (2007) and the strains of A. malvae, 

A. rhadina, A. resedae and A. tomato used by Lawrence et al. 

(2013) were not authentic. Section Alternata comprises almost 60 

Alternaria species based on ITS sequence data (data not shown). 

The molecular variation within this section is low. 

Alternaria alternata (Fr.) Keissl., Beih. Bot. Centralbl., Abt. 2, 29: 

434. 1912. 

Basionym: Torula alternata Fr., Syst. Mycol. (Lundae) 3: 500. 1832 

(nom. sanct.). 

186


Fig. 5. Alternaria sect. Brassicicola: conidia and conidiophores. A, H. A. brassicicola. B, I, L–M. A. mimicola. C, G. A. solidaccana. D, J–K. A. conoidea. E–F. A. septorioides. 

Scale bars = 10 µm. 

= Alternaria tenuis Nees, Syst. Pilze (Würzburg): 72. 1816 [1816–1817]. 

Additional synonyms listed in Simmons (2007) 

Alternaria angustiovoidea E.G. Simmons, Mycotaxon 25: 198. 

1986. 

Alternaria arborescens E.G. Simmons, Mycotaxon 70: 356. 1999. 

Alternaria burnsii Uppal, Patel & Kamat, Indian J. Agric. Sci. 8: 

49. 1938. 

Alternaria cerealis E.G. Simmons & C.F. Hill, CBS Biodiversity 

Ser. (Utrecht) 6: 600. 2007. 

Alternaria citriarbusti E.G. Simmons, Mycotaxon 70: 287. 1999. 

Alternaria citrimacularis E.G. Simmons, Mycotaxon 70: 277. 1999. 

Alternaria colombiana E.G. Simmons, Mycotaxon 70: 298. 1999. 

Alternaria daucifollii E.G. Simmons, CBS Biodiversity Ser. 

(Utrecht) 6: 518. 2007. 

Alternaria destruens E.G. Simmons, Mycotaxon 68: 419. 1998. 

Alternaria dumosa E.G. Simmons, Mycotaxon 70: 310. 1999. 

Alternaria gaisen Nagano ex Hara, Sakumotsu Byorigaku, Edn 

4: 263. 1928. 

= Alternaria gaisen Nagano, J. Jap. Soc. Hort. Sci. 32: 16–19. 1920. (nom. 

illegit.) 

= Alternaria kikuchiana S. Tanaka, Mem. Coll. Agric. Kyoto Univ., Phytopathol. 

Ser. 28: 27. 1933. 

= Macrosporium nashi Miura, Flora of Manchuria and East Mongolia, Part III 

Cryptogams, Fungi: 513. 1928. 

Alternaria herbiphorbicola E.G. Simmons, CBS Biodiversity Ser. 

(Utrecht) 6: 608. 2007. 

Alternaria limoniasperae E.G. Simmons, Mycotaxon 70: 272. 

1999. 

Alternaria longipes (Ellis & Everh.) E.W. Mason, Mycol. Pap. 2: 

19. 1928. 

Basionym: Macrosporium longipes Ellis & Everh., J. Mycol. 7: 134. 

1892. 

= Alternaria brassicae var. tabaci Preissecker, Fachliche Mitt. Österr. 

Tabakregie 16: 4. 1916. 

Alternaria perangusta E.G. Simmons, Mycotaxon 70: 303. 1999. 

Alternaria postmessia E.G. Simmons, CBS Biodiversity Ser. 

(Utrecht) 6: 598. 2007. 


187


Fig. 6. Alternaria sect. Chalastospora: conidia and conidiophores. A. A. cetera. B. A. obclavata. C. A. breviramosa. D, H. A. armoraciae. E–G. A. abundans. Scale bars = 10 µm. 

Alternaria tangelonis E.G. Simmons, Mycotaxon 70: 282. 1999. 

Alternaria tenuissima (Nees & T. Nees : Fr.) Wiltshire, Trans. Brit. 

Mycol. Soc. 18: 157. 1933. 

Basionym: Macrosporium tenuissimum (Nees & T. Nees) Fr., Syst. 

Mycol. (Lundae) 3: 374. 1832 (nom. sanct.). 

≡ Helminthosporium tenuissimum Kunze ex Nees & T. Nees, Nova Acta 

Acad. Caes. Leop.-Carol. German. Nat. Cur. 9: 242. 1818. 

Additional synonyms listed in Simmons (2007). 

Alternaria toxicogenica E.G. Simmons, Mycotaxon 70: 294. 1999. 

Alternaria turkisafria E.G. Simmons, Mycotaxon 70: 290. 1999. 

Section Brassicicola D.P. Lawr., Gannibal, Peever & 

B.M. Pryor, Mycologia 105: 541. 2013. Fig. 5. 

Type species: Alternaria brassicicola (Schwein.) Wiltshire 

Diagnosis: Section Brassicicola contains short to moderately long, 

simple or branched primary conidiophores with one or several 

apical conidiogenous loci. Conidia are ellipsoid, ovoid or somewhat 

obclavate, small or moderate in size, septate, slightly or strongly 

constricted at most of their transverse septa, with no to many 

longitudinal septa, in moderately long to long, simple or branched 

chains, with dark septa and cell walls. Secondary conidiophores 

can be formed apically or laterally with one or a few conidiogenous 

loci. Chlamydospores may occur. 

Notes: Our molecular data support the morphological placement 

of A. septorioides and A. solidaccana in section Brassicicola 

(Simmons 2007). The other three species were already assigned 

to this section based on previous molecular studies (Pryor et al. 

2009, Runa et al. 2009, Lawrence et al. 2012). Alternaria japonica 

was previously linked to the A. brassicicola species-group (Pryor 

& Gilbertson 2000, Pryor & Bigelow 2003, Lawrence et al. 2013), 

but this association was questioned by Hong et al. (2005). In our 

analyses, A. japonica clustered in sect. Japonicae. 

Alternaria brassicicola (Schwein.) Wiltshire, Mycol. Pap. 20: 8. 

1947. 

Basionym: Helminthosporium brassicicola Schwein., Trans. Amer. 

Philos. Soc., Ser. 2, 4: 279. 1832. 

Additional synonyms listed in Simmons (2007) 

Alternaria conoidea (E.G. Simmons) D.P. Lawr., Gannibal, Peever 

& B.M. Pryor, Mycologia 105: 542. 2013. 

Basionym: Embellisia conoidea E.G. Simmons, Mycotaxon 17: 

226. 1983. 

Alternaria mimicula E.G. Simmons, Mycotaxon 55: 129. 1995. 

Alternaria septorioides (Westend.) E.G. Simmons, CBS 

Biodiversity Ser. (Utrecht) 6: 570. 2007. 

Basionym: Sporidesmium septorioides Westend., Bull. Acad. Roy. 

Sci. Belgique., Cl. Sci., Sér. 2, 21: 236. 1854. 

= Alternaria resedae Neerg., Annual Rep. Phytopathol. Lab. J.E. Ohlsens 

Enkes, Seed Growers, Copenhagen 7: 9. 1942 (nom. nud.). 

= Alternaria resedae Neerg., Danish species of Alternaria & Stemphylium: 

150. 1945. 

Alternaria solidaccana E.G. Simmons, CBS Biodiversity Ser. 

(Utrecht) 6: 572. 2007. 

Section Chalastospora (E.G. Simmons) Woudenb. & 

Crous, comb. et stat. nov. MycoBank MB803733. Fig. 

6. 

Basionym: Chalastospora E.G. Simmons, CBS Biodiversity Ser. 

(Utrecht) 6: 668. 2007. 

Type species: Alternaria cetera E.G. Simmons 

Diagnosis: Section Chalastospora contains short to long, simple or 

branched primary conidiophores with one or several conidiogenous 

loci. Conidia are pale to medium brown, narrowly ellipsoid to 

ellipsoid or ovoid, beakless, with no to multiple transverse eusepta 

and rarely longitudinal septa, solitary or in chains. Secondary 

conidiophores can be formed apically or laterally with one or a few 

conidiogenous loci. 

188


Fig. 7. Alternaria sect. Cheiranthus: conidia and conidiophores. A–B. A. indefessa. B–C. A. cheiranthi. Scale bars = 10 µm. 

Notes: Previous studies already placed E. abundans in the 

Chalastospora-clade (Andersen et al. 2009, Lawrence et al. 2012). 

Our study also placed Alternaria armoraciae in this section, while 

Crous et al. (2009c) showed that Chalastospora gossypii, formerly 

Alternaria malorum, belonged to this section based on sequences 

of the ITS and LSU genes. 

Alternaria abundans (E.G. Simmons) Woudenb. & Crous, comb. 


Basionym: Embellisia abundans E.G. Simmons, Mycotaxon 17: 

222. 1983. 

Alternaria armoraciae E.G. Simmons & C.F. Hill, CBS Biodiversity 

Ser. (Utrecht) 6: 660. 2007. 

Alternaria breviramosa Woudenb. & Crous, nom. nov. MycoBank 

MB803690. 

Basionym: Chalastospora ellipsoidea Crous & U. Braun, Persoonia 

22: 145. 2009, non Alternaria ellipsoidea E.G. Simmons, 2002. 

Etymology: Name refers to the short lateral branches. 

Alternaria cetera E.G. Simmons, Mycotaxon 57: 393. 1996. 

≡ Chalastospora cetera (E.G. Simmons) E.G. Simmons, CBS Biodiversity 

Ser. (Utrecht) 6: 668. 2007. 

Alternaria malorum (Ruehle) U. Braun, Crous & Dugan, Mycol. 

Progr. 2: 5. 2003. 

Basionym: Cladosporium malorum Ruehle, Phytopathology 21: 

1146. 1931. 

= Cladosporium gossypii Jacz., Khlopkovoe Delo, 1929 (5–6): 564. 1929, non 

Alternaria gossypii (Jacz.) Y. Nisik., K. Kimura & Miyaw., 1940. 

≡ Chalastospora gossypii (Jacz.) U. Braun & Crous, Persoonia 22: 144. 

2009. 

= Cladosporium malorum Heald, Wash. State Agric. Exp. Sta. Bull., Special 

Ser. 245: 48. 1930. (nom. nud.) 

Additional synonyms in Crous et al. (2009c). 

Alternaria obclavata (Crous & U. Braun) Woudenb. & Crous, 


Basionym: Chalastospora obclavata Crous & U. Braun, Persoonia 

22: 146. 2009. 

Section Cheiranthus Woudenb. & Crous, sect. nov. 


Type species: Alternaria cheiranthi (Lib.) P.C. Bolle 

Diagnosis: Section Cheiranthus contains short to moderately long, 

simple or branched primary conidiophores with one or several 

conidiogenous loci. Conidia are ovoid, broadly ellipsoid with 

transverse and longitudinal septa, slightly or strongly constricted at 

the septa, in short to long, simple or branched chains. Secondary 

conidiophores can be formed apically or laterally with a single 

conidiogenous locus. 

Notes: Next to Alternaria cheiranthi and Embellisia indefessa, 

sect. Cheiranthus contains a non-sporulating strain formerly 

known as Alternaria resedae, CBS 115.44. Because Alternaria 

resedae is synonymised with Alternaria septorioides (Simmons 

2007), which clusters in section Brassisicola, CBS 115.44 will be 

treated as “Alternaria sp.”. Alternaria cheiranthi and E. indefessa 

have been linked to Ulocladium (Pryor & Gilbertson 2000, Pryor 

& Bigelow 2003, Hong et al. 2005, Pryor et al. 2009, Runa et al. 

2009, Lawrence et al. 2012), but based on morphology could not be 

placed here. Our extensive dataset showed that they form a sister 

section to section Ulocladioides. 

Alternaria cheiranthi (Lib.) P.C. Bolle, Meded. Phytopathol. Lab. 

“Willie Commelin Scholten” 7: 43. 1924. 

Basionym: Helminthosporium cheiranthi Lib. [as “Helmisporium”], 

in Desmazières, Plantes Cryptogames du Nord de la France, edn 

1: 213. 1827. 

≡ Macrosporium cheiranthi (Lib.) Fr., Syst. Mycol. (Lundae) 3: 374. 1832. 

Alternaria indefessa (E.G. Simmons) Woudenberg & Crous, 


Basionym: Embellisia indefessa E.G. Simmons, Mycotaxon 17: 

228. 1983. 

Section Crivellia (Shoemaker & Inderb.) Woudenb. & 


8. 

Basionym: Crivellia Shoemaker & Inderb., Canad. J. Bot. 84: 1308. 

2006. 

Type species: Alternaria penicillata (Corda) Woudenb. & Crous 

(= Cucurbitaria papaveracea De Not.). 

Diagnosis: Section Crivellia is characterised by straight or curved, 

simple or branched primary conidiophores, with geniculate, 

sympodial proliferations. Conidia are cylindrical, straight to curved 

to inequilateral, with transverse eusepta, rarely constricted at 


189


Fig. 8. Alternaria sect. Crivellia: conidia and conidiophores. A–B. A. papavericola. C–D. A. penicillata. Scale bars = 10 µm. 

septa, single or in short, simple or branched chains. Secondary 

conidiophores are formed apically or laterally. Microsclerotia or 

chlamydospores may occur. Sexual morphs observed. 

Notes: Section Crivellia contains the type species of the sexual 

morph Crivellia, C. papaveracea, with Brachycladium penicillatum 

asexual morph, and Brachycladium papaveris. The genus was 

established by Inderbitzin et al. (2006) based on the finding that 

C. papaveraceae, formerly Pleospora papaveraceae, belonged to 

the Alternaria-complex instead of Pleospora s. str. based on ITS, 

GAPDH and TEF1 sequences. 

Alternaria papavericola Woudenb. & Crous, nom. nov. MycoBank 

MB803749. 

Basionym: Helminthosporium papaveris Sawada, J. Nat. Hist. Soc. 

Formosa 31: 1. 1917. 

≡ Dendryphion papaveris (Sawada) Sawada, Special Publ. Coll. Agric. Natl. 

Taiwan Univ. 8: 200. 1959, non Alternaria papaveris (Bres.) M.B. Ellis, 1976. 

≡ Brachycladium papaveris (Sawada) Shoemaker & Inderb., Canad. J. 

Bot. 84: 1310. 2006. 

Etymology: Name refers to the host. 

Alternaria penicillata (Corda) Woudenb. & Crous, comb. nov. 


Basionym: Brachycladium penicillatum Corda, Icon. Fungorum 

hucusque Cogn. (Prague) 2: 14. 1838. 

≡ Dendryphion penicillatum (Corda) Fr., Summa Veg. Scand., Sect. Post. 

(Stockholm): 504. 1849. 

= Cucurbitaria papaveracea De Not., Sferiacei Italici: 62. 1863. 

≡ Pleospora papaveracea (De Not.) Sacc., Syll. Fungorum (Abellini) 2: 

243. 1883. 

≡ Crivellia papaveracea (De Not.) Shoemaker & Inderb., Canad. J. Bot. 

84: 1308. 2006. 

Note: The asexual name, Brachycladium penicillatum is older than 

the sexual name, Cucurbitaria papaveracea, and therefore the 

species epithet penicillatum is chosen above papaveracea. 

Section Dianthicola Woudenb. & Crous, sect. nov. 


Type species: Alternaria dianthicola Neerg. 

Diagnosis: Section Dianthicola contains simple or branched primary 

conidiophores, with or without apical geniculate proliferations. 

Conidia are narrowly ovoid or narrowly ellipsoid with transverse 

and few longitudinal septa, slightly constricted at the septa, with a 

long (filamentous) beak or apical secondary conidiophore, solitary 

or in short chains. 

Note: Based on the ITS sequence, Alternaria dianthicola clustered 

near Ulocladium (Chou & Wu 2002). Our extensive dataset places 

it in a sister section to section Ulocladioides. 

Alternaria dianthicola Neerg., Danish species of Alternaria & 

Stemphylium: 190. 1945. 

Alternaria elegans E.G. Simmons & J.C. David, Mycotaxon 75: 

89. 2000. 

Alternaria simsimi E.G. Simmons, Stud. Mycol. 50: 111. 2004. 

Section Embellisia (E.G. Simmons) Woudenb. & Crous, 

comb. et stat. nov. MycoBank MB803737. Fig. 10. 

Basionym: Embellisia E.G. Simmons, Mycologia 63: 380. 1971. 

Type species: Alternaria embellisia Woudenb. & Crous (≡ 

Helminthosporium allii Campan., Embellisia allii (Campan.) E.G. 

Simmons). 

Diagnosis: Section Embellisia contains simple, septate 

conidiophores, straight or with geniculate sympodial proliferation. 

Condia are solitary, ovoid to subcylindrical, straight to inequilateral, 

transseptate; septa can be thick, dark and rigid in contrast to the 

external wall. Chlamydospores may occur. 

Notes: Section Embellisia contains the first two species described in 

the genus Embellisia, Embellisia allii (type species) and Embellisia 

chlamydospora (Simmons 1971) together with Embellisia tellustris. 

This clade is also resolved in the latest molecular revision of 

Embellisia based on sequences of the GAPDH, ITS and Alt a 1 

genes as Embellisia group I (Lawrence et al. 2012). 

Alternaria chlamydosporigena Woudenb. & Crous, nom. nov. 


Basionym: Pseudostemphylium chlamydosporum Hoes, G.W. 

Bruehl & C.G. Shaw, Mycologia 57: 904. 1965, non Alternaria 

chlamydospora Mouch., 1973. 

≡ Embellisia chlamydospora (Hoes, G.W. Bruehl & C.G. Shaw) E.G. 

Simmons, Mycologia 63: 384. 1971. 

Etymology: Name refers to the formation of chlamydospores during 

growth. 

190


Fig. 9. Alternaria sect. Dianthicola: conidia and conidiophores. A–B. A. dianthicola. C–E. A. simsimi. F–H. A. elegans. Scale bars = 10 µm. 

Fig. 10. Alternaria sect. Embellisia: conidia and conidiophores. A–D. A. embellisia. E–H. A. tellustris. Scale bars = 10 µm. 

Alternaria embellisia Woudenb. & Crous, nom. nov. MycoBank 

MB803693. 

Basionym: Helminthosporium allii Campan., Nuovi Ann. Agric. 

Roma 4: 87. 1924, non Alternaria allii Nolla, 1927. 

≡ Embellisia allii (Campan.) E.G. Simmons, Mycologia 63: 382. 1971. 

Etymology: Name refers to the genus Embellisia for which it served 

as type species. 

Alternaria tellustris (E.G. Simmons) Woudenb. & Crous, comb. 


Basionym: Embellisia tellustris E.G. Simmons [as “telluster”], 

Mycotaxon 17: 234. 1983. 


191


Fig. 11. Alternaria sect. Embellisioides: conidia and conidiophores. A–B. A. hyacinthi. C–E. A. lolii. F–H. A. botryospora. I–K. A. planifunda. L–N. A. proteae. O–P. A. tumida. 


192


Section Embellisioides Woudenb. & Crous, sect. nov. 


Type species: Alternaria hyacinthi (de Hoog & P.J. Mull. bis) 

Woudenb. & Crous 

Diagnosis: Section Embellisioides contains simple, septate 

conidiophores, straight or with multiple, geniculate, sympodial 

proliferations. Apical or lateral, short secondary conidiophores may 

occur. Condia are solitary or in short chains, obovoid to ellipsoid, 

with transverse and longitudinal septa; transverse septa can be 

thick, dark and rigid in contrast to the external wall. Chlamydospores 

and a sexual morph may occur. 

Note: In Lawrence et al. (2012) the section is named Embellisia 

group III. 

Alternaria botryospora Woudenb. & Crous, nom. nov. MycoBank 

MB803705. 

Basionym: Embellisia novae-zelandiae E.G. Simmons & C.F. Hill, 

Mycotaxon 38: 252. 1990, non Alternaria novae-zelandiae E.G. 

Simmons, 2002. 

Etymology: Name refers to the clusters of conidia. 

Alternaria hyacinthi (de Hoog & P.J. Mull. bis) Woudenb. & Crous, 


Basionym: Embellisia hyacinthi de Hoog & P.J. Mull. bis, 

Netherlands J. Pl. Pathol. 79: 85. 1973. 

Alternaria lolii (E.G. Simmons & C.F. Hill) Woudenb. & Crous, 


Basionym: Embellisia lolii E.G. Simmons & C.F. Hill, Stud. Mycol. 

50: 113. 2004. 

Alternaria planifunda (E.G. Simmons) Woudenb. & Crous, comb. 


Basionym: Embellisia planifunda E.G. Simmons, Mycotaxon 17: 

233. 1983. 

Alternaria proteae (E.G. Simmons) Woudenb. & Crous, comb. 


Basionym: Embellisia proteae E.G. Simmons, Mycotaxon 38: 258. 

1990. 

= Allewia proteae E.G. Simmons, Mycotaxon 38: 262. 1990. 

Alternaria tumida (E.G. Simmons) Woudenb. & Crous, comb. 


Basionym: Embellisia tumida E.G. Simmons, Mycotaxon 17: 236. 

1983. 

Section Eureka Woudenb. & Crous, sect. nov. 


Type species: Alternaria eureka E.G. Simmons 

Diagnosis: Section Eureka contains simple, septate conidiophores, 

straight or with geniculate, sympodial proliferations. Apical or lateral, 

short secondary conidiophores may occur. Condia are solitary or in 

short chains, narrowly ellipsoid to cylindrical, with transverse and 

longitudinal septa, slighty constricted at the septa, with a blunt 

rounded apex. Chlamydospores and a sexual morph may occur. 

Notes: Section Eureka contains four Alternaria species and two 

former Embellisia species. From the Alternaria species only the ITS 

sequence of A. geniostomatis was previously used in a molecular 

study (Toth et al. 2011), showing it to cluster separate from the 

other Alternaria spp. The two Embellisia species were included in 

the latest molecular-based revision of Embellisia (Lawrence et al. 

2012) where they formed Embellisia group IV. A sexual morph is 

known for the type species of this section. 

Alternaria anigozanthi Priest, Australas. Pl. Pathol. 24: 239. 1995. 

Alternaria cumini E.G. Simmons, CBS Biodiversity Ser. (Utrecht) 

6: 664. 2007. 

Alternaria eureka E.G. Simmons, Mycotaxon 25: 306. 1986. 

≡ Embellisia eureka (E.G. Simmons) E.G. Simmons, Mycotaxon 38: 260. 

1990. 

= Lewia eureka E.G. Simmons, Mycotaxon 25: 304. 1986. 

≡ Allewia eureka (E.G. Simmons) E.G. Simmons, Mycotaxon 38: 264. 

1990. 

Alternaria geniostomatis E.G. Simmons & C.F. Hill, CBS 


Alternaria leptinellae (E.G. Simmons & C.F. Hill) Woudenb. & 

Crous, comb. nov. MycoBank MB803696. 

Basionym: Embellisia leptinellae E.G. Simmons & C.F. Hill, 

Mycotaxon 38: 254. 1990. 

Alternaria triglochinicola Alcorn & S.M. Francis, Mycotaxon 46: 

359. 1993. 

Section Gypsophilae D.P. Lawr., Gannibal, Peever & 

B.M. Pryor, Mycologia 105: 541. 2013. Fig. 13 

Type species: Alternaria gypsophilae Neerg. 

Diagnosis: Section Gypsophilae contains simple, or occasionally 

branched, primary conidiophores, with one or a few conidiogenous 

loci. Conidia are ellipsoid to long ovoid, with multiple transverse and 

longitudinal septa, conspicuously constricted near some transverse 

septa, solitary or in short chains. Secondary conidiophores are 

formed apically with one or two conidiogenous loci or laterally with 

a single conidiogenous locus. Species from this section occur on 

Caryophyllaceae. 

Notes: Section Gypsophilae was recently established by Lawrence 

et al. (2013) containing the four Alternaria species, A. gypsophilae, 

A. nobilis, A. vaccariae and A. vaccariicola. Our dataset adds four 

Alternaria species, A. axiaeriisporifera, A. ellipsoidea, A. saponariae, 

and A. juxtiseptata to this section. Simmons (2007) noted the 

similarity of the primary conidia of A. ellipsoidea to A. gypsophilae, 

A. nobilis, A. saponariae and A. vaccariae. This section contains all 

Alternaria species that occur on Caryophyllaceae (Simmons 2002), 

except A. dianthicola which resides in sect. Dianthicola. 

Alternaria axiaeriisporifera E.G. Simmons & C.F. Hill, CBS 


Alternaria ellipsoidea E.G. Simmons, Mycotaxon 82: 31. 2002. 

Alternaria gypsophilae Neerg., Danish species of Alternaria & 

Stemphylium: 207. 1945. 

Alternaria juxtiseptata E.G. Simmons, Mycotaxon 82: 32. 2002. 

Alternaria nobilis (Vize) E.G. Simmons, Mycotaxon 82: 7. 2002. 

Basionym: Macrosporium nobile Vize, Grevillea 5(35): 119. 1877. 

Alternaria saponariae (Peck) Neerg., Annual Rep. Phytopathol. 

Lab. J.E. Ohlsens Enkes, Seed Growers, Copenhagen 3: 6. 1938 

[1937–1938]. 

Basionym: Macrosporium saponariae Peck, Rep. (Annual) 

NewYork State Mus. Nat. Hist. 28: 62. 1876 [1875]. 


193


Fig. 12. Alternaria sect. Eureka: conidia and conidiophores. A–B. A. anigozanthi. C–D. A. cumini. E–F. A. leptinellae. G–H. A. triglochinicola. I–J. A. geniostomatis. K–L. A. 

eureka. Scale bars = 10 µm. 

Alternaria vaccariae (Săvul. & Sandu) E.G. Simmons & S.T. 

Koike, Mycotaxon 82: 21. 2002. 

Basionym: Macrosporium vaccariae Săvul. & Sandu, Hedwigia 73: 

130. 1933. 

Alternaria vaccariicola E.G. Simmons, CBS Biodiversity Ser. 

(Utrecht) 6: 594. 2007. 

Section Infectoriae Woudenb. & Crous, sect. nov. 


Type species: Alternaria infectoria E.G. Simmons 

Diagnosis: Section Infectoriae contains short to long, simple or branched 

primary conidiophores with one or several conidiogenous loci. Conidia 

are obclavate, long-ellipsoid, small or moderate in size, septate, slightly 

constricted near some septa, with few longitudinal septa, in moderately 

long to long, branched chains. Long, geniculate, multi-locus secondary 

conidiophores can be formed apically or laterally. Sexual morphs are 

known, and meristematic growth has been reported. 

Notes: In addition to the six species that are displayed in our 

phylogeny, 19 more are included based on the study of Lawrence 

et al. (2013), confirmed with our molecular data (not shown). From 

these 25 species, nine species have a known sexual morph in 

Lewia. Three species from the study of Lawrence et al. (2013) are 

not included; A. photistica (sect. Panax) and A. dianthicola (sect. 

Dianthicola) cluster elsewhere in our phylogenies and A. peglionii is 

marked as a taxon incertae sedis by Simmons (2007). The human 

pathogenic genera Ybotromyces and Chmelia are also embedded 

in sect. Infectoriae. 

194


Fig. 13. Alternaria sect. Gypsophilae: conidia and conidiophores. A–B. A. axiariisporifera. C–D. A. ellipsoidea. E–G. A. saponariae. H–I. A. vaccariae. J–K. A. nobilis. L–M. A. 

juxtiseptata. N–P. A. vaccariicola. Scale bars = 10 µm. 

Alternaria alternarina E.G. Simmons, CBS Biodiversity Ser. 

(Utrecht) 6: 644. 2007. 

= Pyrenophora alternarina M.D. Whitehead & J. Dicks., Mycologia 44: 748. 1952. 

≡ Lewia alternarina (M.D. Whitehead & J.G. Dicks.) E.G. Simmons, CBS 


Alternaria arbusti E.G. Simmons, Mycotaxon 48: 103. 1993. 

Alternaria caespitosa (de Hoog & C. Rubio) Woudenb. & Crous, 


Basionym: Botryomyces caespitosus de Hoog & C. Rubio, 

Mycotaxon 14: 19. 1982. 

≡ Ybotromyces caespitosus (de Hoog & C. Rubio) Rulamort, Bull. Soc. 

Bot. Centre-Ouest, Nouv. Sér. 21: 512. 1990. 


195


Fig. 14. Alternaria sect. Infectoriae: conidia and conidiophores. A–B. A. ethzedia. C–D. A. infectoria. E–F. A. conjuncta. G–H. A. oregonensis. Scale bars = 10 µm. 

Alternaria californica E.G. Simmons & S.T. Koike, CBS 


Alternaria conjuncta E.G. Simmons, Mycotaxon 25: 294. 1986. 

= Sphaeria scrophulariae Desm., Ann. Sci. Nat., Bot., Sér. 2, 6: 245. 1836. 

≡ Leptosphaeria scrophulariae (Desm.) Sacc., Syll. Fungorum (Abellini) 

2: 57. 1883. 

≡ Heptameria scrophulariae (Desm.) Cooke, Grevillea 18(no. 86): 31. 

1889. 

≡ Pleospora scrophulariae (Desm.) Höhn., Sitzungsber. Kaiserl. Akad. 

Wiss., Math.-Naturwiss. Cl., Abt. 1. 126(4–5): 374. 1917. 

≡ Lewia scrophulariae (Desm.) M.E. Barr & E.G. Simmons, Mycotaxon 

25: 294. 1986. 

Alternaria daucicaulis E.G. Simmons, CBS Biodiversity Ser. 

(Utrecht) 6: 640. 2007. 

= Lewia daucicaulis E.G. Simmons, CBS Biodiversity Ser. (Utrecht) 6: 640. 

2007. 

Alternaria ethzedia E.G. Simmons, Mycotaxon 25: 300. 1986. 

= Lewia ethzedia E.G. Simmons, Mycotaxon 25: 299. 1986. 

Alternaria frumenti E.G. Simmons & C.F. Hill, CBS Biodiversity 

Ser. (Utrecht) 6: 620. 2007. 

Alternaria graminicola E.G. Simmons, CBS Biodiversity Ser. 

(Utrecht) 6: 626. 2007. 

Alternaria hordeiaustralica E.G. Simmons & Alcorn, CBS 


= Lewia hordeiaustralica E.G. Simmons & Alcorn, CBS Biodiversity Ser. 

(Utrecht) 6: 614. 2007. 

Alternaria hordeicola E.G. Simmons & Kosiak, CBS Biodiversity 

Ser. (Utrecht) 6: 630. 2007. 

= Lewia hordeicola Kwaśna & Kosiak, Mycologia 98: 663. 2006. 

Alternaria humuli E.G. Simmons, Mycotaxon 83: 139. 2002. 

Alternaria incomplexa E.G. Simmons, Mycotaxon 57: 394. 1996. 

Alternaria infectoria E.G. Simmons, Mycotaxon 25: 298. 1986. 

= Pleospora infectoria Fuckel, Jahrb. Nassauischen Vereins Naturk. 23–24: 

132. 1870 [1869–70]. 

≡ Sphaeria infectoria (Fuckel) Cooke, Handb. Brit. Fungi 2: 897. 1871. 

≡ Pleospora phaeocomoides var. infectoria (Fuckel) Wehm., A World 

Monograph of the Genus Pleospora and its Segregates: 121. 1961. 

≡ Lewia infectoria (Fuckel) M.E. Barr & E.G. Simmons, Mycotaxon 25: 

296. 1986. 

Alternaria intercepta E.G. Simmons, Mycotaxon 83: 134. 2002. 

= Lewia intercepta E.G. Simmons & McKemy, Mycotaxon 83: 133. 2002. 

Alternaria merytae E.G. Simmons, Mycotaxon 83: 136. 2002. 

Alternaria metachromatica E.G. Simmons, Mycotaxon 50: 418. 

1994. 

Alternaria novae-zelandiae E.G. Simmons, Mycotaxon 83: 142. 

2002. 

Alternaria oregonensis E.G. Simmons, Mycotaxon 50: 417. 

1994. 

Alternaria slovaca (Svob.-Pol., L. Chmel & Bojan.) Woudenb. & 


Basionym: Aureobasidium slovacum Svob.-Pol., L. Chmel & Bojan., 

Conspect. Verruc. 5: 116. 1966. 

≡ Chmelia slovaca (Svob.-Pol., L. Chmel & Bojan.) Svob.-Pol., Biologia 

(Bratislava) 21: 83. 1966. 

Alternaria triticimaculans E.G. Simmons & Perelló, Mycotaxon 

50: 413. 1994. 

Alternaria triticina Prasada & Prabhu, Indian Phytopathol. 15 

(3–4): 292. 1963. [1962] 

Alternaria ventricosa R.G. Roberts, Mycotaxon 100: 164. 2007. 

Alternaria viburni E.G. Simmons, Mycotaxon 83: 132. 2002. 

= Lewia viburni E.G. Simmons & McKemy, Mycotaxon 83: 130. 2002. 

196


Fig. 15. Alternaria sect. Japonicae: conidia and conidiophores. A–B. A. japonica. C–E. A. nepalensis. Scale bars = 10 µm. 

Fig. 16. Alternaria sect. Nimbya: conidia and conidiophores. A–B. A. caricis. C–D. A. scirpicola. Scale bars = 10 µm. 

Section Japonicae Woudenb. & Crous, sect. nov. 


Type species: Alternaria japonica Yoshii 

Diagnosis: Section Japonicae contains short to long, simple 

or occasionally branched primary conidiophores with a single 

conidiogenous locus. Conidia are short, to long-ovoid with 

transverse and longitudinal septa, conspicuously constricted at 

most of the transverse septa, in short chains. Apical secondary 

conidiophores are produced with a single conidiogenous locus. The 

species within this section occur on Brassicaceae. 

Note: Alternaria japonica was previously connected to the A. 

brassicicola species-group (Pryor & Gilbertson 2000, Pryor & 

Bigelow 2003, Lawrence et al. 2013), but this association was 

questioned by Hong et al. (2005). 

Alternaria japonica Yoshii, J. Pl. Protect. 28: 17. 1941. 

= Alternaria matthiolae Neerg., Danish species of Alternaria and Stemphylium: 

184. 1945. 

Alternaria nepalensis E.G. Simmons, CBS Biodiversity Ser. 

(Utrecht) 6: 480. 2007. 

Section Nimbya (E.G. Simmons) Woudenb. & Crous, 


Basionym: Nimbya E.G. Simmons, Sydowia 41: 316. 1989. 

Type species: Alternaria scirpicola (Fuckel) Sivan. 

Diagnosis: Section Nimbya contains simple, short to moderately 

long conidiophores, which may form one or a few short to long, 

geniculate, sympodial proliferations. Conidia are narrowly elongateobclavate, 

gradually tapering apically, solitary or in short chains, 

with transverse disto- and eusepta, sometimes slightly constricted 

near eusepta. Apical condiophores with a single conidiogenous 

locus can be formed. Internal compartmentation occurs, cell lumina 

tend to be broadly octagonal to rounded. A sexual morph may 

occur. 

Notes: Section Nimbya contains the type species of Nimbya, N. 

scirpicola, and N. caricis (Simmons 1989). A more extensive study 

on Nimbya (Lawrence et al. 2012) found that N. scirpinfestans and 

N. scirpivora also belonged to this section based on sequences of 

the GAPDH, ITS and Alt a 1 genes. 

Alternaria caricis (E.G. Simmons) Woudenb. & Crous, comb. 


Basionym: Nimbya caricis E.G. Simmons, Sydowia 41: 328. 1989. 


197


Fig. 17. Alternaria sect. Panax: conidia and conidiophores. A–B. A. avenicola. C–D. A. calycipyricola. E–F. A. panax. G–H. A. photistica. Scale bars = 10 µm. 

Alternaria scirpicola (Fuckel) Sivan., Bitunicate Ascomycetes and 

their Anamorphs (Vaduz): 526. 1984. 

Basionym: Sporidesmium scirpicola Fuckel, Jahrb. Nassauischen 

Vereins Naturk. 23–24: 140. 1870 [1869–70]. 

≡ Clasterosporium scirpicola (Fuckel) Sacc., Syll. Fungorum (Abellini) 4: 

393. 1886. 

≡ Cercospora scirpicola (Fuckel) Zind.-Bakker, Rev. Mycol. (Paris) 5: 66. 

1940. 

≡ Alternaria scirpicola (Fuckel) M.T. Lucas & J. Webster, Čas. Slez. Mus., 

Ser. A, Hist. Nat. 23: 151. 1974 (nom. inval.). 

≡ Nimbya scirpicola (Fuckel) E.G. Simmons, Sydowia 41: 316. 1989. 

= Sphaeria scirpicola DC., in Lamarck & de Candolle, Fl. Franç., Edn 3 (Paris) 

2: 300. 1805. 

≡ Clathrospora scirpicola (DC.) Höhn., Ann. Mycol. 18(1/3): 77. 1920. 

≡ Macrospora scirpicola (DC.) Fuckel, Jahrb. Nassauischen Vereins 

Naturk. 23–24: 139. 1870 [1869–70]. 

≡ Pyrenophora scirpicola (DC.) E. Müll., Sydowia 5(3–6): 256. 1951. 

Note: Although Sphaeria scirpicola DC. (de Candolle 1805) 

predates Sporidesmium scirpicola Fuckel (Fuckel 1870), a valid 

combination in Alternaria already exists, thus we choose to 

retain Alternaria scirpicola (Fuckel) Sivan., which is also a well 

established name. 

Alternaria scirpinfestans (E.G. Simmons & D.A. Johnson) 

Woudenb. & Crous, comb. nov. MycoBank MB803701. 

Basionym: Nimbya scirpinfestans E.G. Simmons & D.A. Johnson, 

Mycotaxon 84: 420. 2002. 

= Macrospora scirpinfestans E.G. Simmons & D.A. Johnson, Mycotaxon 84: 

417. 2002. 

Alternaria scirpivora (E.G. Simmons & D.A. Johnson), Woudenb. 

& Crous, comb. nov. MycoBank MB803702. 

Basionym: Nimbya scirpivora E.G. Simmons & D.A. Johnson, 

Mycotaxon 84: 424. 2002. 

= Macrospora scirpivora E.G. Simmons & D.A. Johnson, Mycotaxon 84: 422. 

2002. 

Section Panax D.P. Lawr., Gannibal, Peever & B.M. 


Type species: Alternaria panax Whetzel 

Diagnosis: Section Panax contains simple or branched, short 

to moderately long primary conidiophores, with one or a few 

conidiogenous loci. Conidia are obclavate to ovoid, with multiple 

transverse and longitudinal septa, conspicuously constricted 

near several transverse septa, solitary or in simple or branched, 

short chains. Apical secondary conidiophores are formed with 

one or several conidiogenous loci, multiple lateral secondary 

conidiophores with a single conidiogenous locus may occur. 

Notes: Section Panax was recently described by Lawrence et al. 

(2013) and consists of A. calycipyricola, A. eryngii and A. panax. Our 

extended dataset added the species A. avenicola and A. photistica 

to this section. Three species, A. avenicola, A. calycipyricola, and 

A. photistica have earlier been placed in the A. infectoria speciesgroup 

based on their morphological characters (Simmons 2007), 

and two of them have a known sexual morph; Lewia avenicola 

(Simmons 2007) and Lewia photistica (Simmons 1986). A 

phylogenetic study based on Alt a 1 and GAPDH sequences placed 

A. photistica in the A. infectoria species-group (Hong et al. 2005) 

but an extensive study on the A. infectoria species-group (Andersen 

et al. 2009) confirmed our finding, and placed this species outside 

the A. infectoria species-group. Additional research performed on 

multiple A. photistica strains support our sequence data (data not 

shown). 

198


Fig. 18. Alternaria sect. Phragmosporae: conidia and conidiophores. A–B. A. didymospora. C. A. phragmospora. D–E. A. limaciformis. F–G. A. molesta. H–I. A. mouchaccae. 


Alternaria avenicola E.G. Simmons, Kosiak & Kwaśna, in 

Simmons, CBS Biodiversity Ser. (Utrecht) 6: 114. 2007. 

= Lewia avenicola Kosiak & Kwaśna, Mycol. Res. 107: 371. 2003. 

Alternaria calycipyricola R.G. Roberts, Mycotaxon 100: 162. 

2007. 

Alternaria eryngii (Pers.) S. Hughes & E.G. Simmons, Canad. J. 

Bot. 36: 735. 1958. 

Basionym: Conoplea eryngii Pers., Mycol. Eur. (Erlanga) 1: 11. 

1822. 

≡ Exosporium eryngianum (Pers.) Chevall., Flore Générale des Environs 

de Paris 1: 39. 1826. 

≡ Exosporium eryngii (Pers.) Duby, Bot. Gallicum., Edn 2 (Paris) 2: 882. 

1830. 

≡ Helminthosporium eryngii (Pers.) Fr., Syst. Mycol. (Lundae) 3: 361. 

1832. 

Alternaria panax Whetzel, Bull. U.S.D.A. 250: 11. 1912. 

= Macrosporium araliae Dearn. & House, Circ. New York State Mus. 24: 58. 

1940. 

= Alternaria araliae H.C. Greene, Trans. Wisconsin Acad. Sci. 42: 80. 1953. 

Alternaria photistica E.G. Simmons, Mycotaxon 25: 304. 1986. 

= Lewia photistica E.G. Simmons, Mycotaxon 25: 302. 1986. 

Section Phragmosporae Woudenb. & Crous, sect. 


Type species: Alternaria phragmospora Emden 

Diagnosis: Section Phragmosporae contains simple, short to 

moderately long, primary conidiophores, with one or multiple 

geniculate, sympodial proliferations. Conidia are (broad) ovoid to 

long ovoid, ellipsoid, curved, or limaciform, with multiple transverse 

and few to multiple longitudinal septa, some septa darkened, 

slightly to conspicuously constricted near several transverse septa, 

solitary or in simple short chains. Apical secondary conidiophores 

are formed with one or several conidiogenous loci. All species 

within the section are known from soil and seawater environments. 

Note: Section Phragmosporae contains six species of which two 

were linked to Embellisia. 

Alternaria chlamydospora Mouch. [as “chlamydosporum”], 

Mycopathol. Mycol. Appl. 50: 217. 1973. 

Alternaria didymospora (Munt.-Cvetk.) Woudenb. & Crous, 


Basionym: Embellisia didymospora Munt.-Cvetk., Mycologia 68: 

49. 1976. 

Alternaria limaciformis E.G. Simmons, Mycotaxon 13: 24. 1981. 

Alternaria molesta E.G. Simmons, Mycotaxon 13: 17. 1981. 

Alternaria mouchaccae E.G. Simmons, Mycotaxon 13: 18. 1981. 

≡ Ulocladium chlamydosporum Mouch., Rev. Mycol. (Paris) 36: 114. 

1971, non Alternaria chlamydospora Mouch., 1973. 

Alternaria phragmospora Emden, Acta Bot. Neerl. 19: 393. 1970. 

≡ Embellisia phragmospora (Emden) E.G. Simmons, Mycotaxon 17: 232. 

1983. 

Section Porri D.P. Lawr., Gannibal, Peever & B.M. 

Pryor, Mycologia 105: 541. 2013. Fig. 19 

Type species: Alternaria porri (Ellis) Cif. 


199


Fig. 19. Alternaria sect. Porri: conidia and conidiophores. A–C. A. daucii. D–F. A. pseudorostrata. G–H. A. solani. Scale bars = 10 µm. 

Diagnosis: Section Porri is characterised by broadly ovoid, 

obclavate, ellipsoid, subcylindrical or obovoid (medium) large 

conidia, disto- and euseptate, solitary or in short to moderately 

long chains, with a simple or branched, long to filamentous beak. 

Conidia contain multiple transverse and longitudinal septa and 

are slightly constricted near some transverse septa. Secondary 

conidiophores can be formed apically or laterally. 

Notes: In addition to the six species that are displayed in our 

phylogeny, 40 more are included based on the study of Lawrence 

et al. (2013), confirmed with own molecular data (not shown). 

With almost 80 species section Porri is the largest Alternaria 

section (data not shown). The section displays a higher level 

of genetic variation than the second largest section; section 

Alternata. 

Alternaria acalyphicola E.G. Simmons, Mycotaxon 50: 260. 1994. 

Alternaria agerati Sawada ex E.G. Simmons, Mycotaxon 65: 63. 

1997. 

= Alternaria agerati Sawada, Rep. Dept. Agric. Gov. Res. Inst. Formosa 86: 

165. 1943. (nom. inval., Art. 36.1) 

Alternaria agripestis E.G. Simmons & K. Mort., Mycotaxon 50: 

255. 1994. 

Alternaria anagallidis A. Raabe, Hedwigia 78: 87. 1939. 

Alternaria aragakii E.G. Simmons, Mycotaxon 46: 181. 1993. 

Alternaria argyroxiphii E.G. Simmons & Aragaki, Mycotaxon 65: 

40. 1997. 

Alternaria bataticola Ikata ex W. Yamam., Trans. Mycol. Soc. 

Japan 2(5): 89. 1960. 

= Macrosporium bataticola Ikata, Agric. Hort. (Tokyo) 22: 241. 1947 (nom. 

inval., Art. 36.1). 

Alternaria blumeae E.G. Simmons & Sontirat, Mycotaxon 65: 81. 

1997. 

Alternaria calendulae Ondřej, Čas. Slez. Mus. v Opavĕ, Ser. A, 

Hist. Nat. 23(2): 150. 1974. 

= Alternaria calendulae W. Yamam. 1939 (nom. nud.). 

= Macrosporium calendulae Nelen, Bull. Centr. Bot. Gard. (Moscow) 35: 90. 

1959 (nom. inval., Art. 36.1). 

= Macrosporium calendulae Nelen, Bot. Mater. Otd. Sporov. Rast. Bot. Inst. 

Akad. Nauk S.S.S.R. 15: 144. 1962. 

= Alternaria calendulae Nirenberg, Phytopathol. Z. 88(2): 108. 1977 (nom. 

illegit., Art. 53.1). 

Alternaria capsici E.G. Simmons, Mycotaxon 75: 84. 2000. 

Alternaria carthami S. Chowdhury, J. Indian Bot. Soc. 23: 65. 1944. 

= Macrosporium anatolicum A. Săvul., Bull. Sect. Sci. Acad. Roumaine 26: 

709. 1944. 

Alternaria cassiae Jurair & A. Khan, Pakistan J. Sci. Industr. Res. 

3(1): 72. 1960. 

Alternaria cichorii Nattrass, First List of Cyprus Fungi: 29. 1937. 

≡ Alternaria porri f.sp. cichorii (Natrass) T. Schmidt, Pflanzenschutzberichte 

32: 181. 1965. 

≡ Macrosporium cichorii (Nattrass) Gordenko, Mikol. Fitopatol. 9(3): 241. 

1975. 

Alternaria cirsinoxia E.G. Simmons & K. Mort., Mycotaxon 65: 

72. 1997. 

Alternaria crassa (Sacc.) Rands, Phytopathology 7: 337. 1917. 

Basionym: Cercospora crassa Sacc., Michelia 1(no. 1): 88. 1877. 

Alternaria cretica E.G. Simmons & Vakal., Mycotaxon 75: 64. 

2000. 

Alternaria cucumerina (Ellis & Everh.) J.A. Elliott, Amer. J. Bot. 

4: 472. 1917. 

Basionym: Macrosporium cucumerinum Ellis & Everh., Proc. Acad. 

Nat. Sci. Philadelphia 47: 440. 1895. 

200


Alternaria cyphomandrae E.G. Simmons, Mycotaxon 75: 86. 

2000. 

Alternaria danida E.G. Simmons, Mycotaxon 65: 78. 1997. 

Alternaria dauci (J.G. Kühn) J.W. Groves & Skolko, Canad. J. 

Res., Sect. C, Bot. Sci. 22: 222. 1944. 

Basionym: Sporidesmium exitiosum var. dauci J.G. Kühn, Hedwigia 

1: 91. 1855. 

Additional synonyms in Simmons 2007. 

Alternaria dichondrae Gambogi, Vannacci & Triolo, Trans. Brit. 

Mycol. Soc. 65(2): 323. 1975. 

Alternaria euphorbiicola E.G. Simmons & Engelhard, Mycotaxon 

25: 196. 1986. 

≡ Macrosporium euphorbiae Reichert, Bot. Jahrb. Syst. 56: 723. 1921. 

(nom. illegit., Art 53.1). 

Alternaria grandis E.G. Simmons, Mycotaxon 75: 96. 2000. 

Alternaria hawaiiensis E.G. Simmons, Mycotaxon 46: 184. 1993. 

Alternaria limicola E.G. Simmons & M.E. Palm, Mycotaxon 37: 

82. 1990. 

Alternaria linicola J.W. Groves & Skolko, Canad. J. Res., Sect. C, 

Bot. Sci. 22: 223. 1944. 

Alternaria macrospora Zimm., Ber. Land-Forstw. Deutsch- 

Ostafrika 2: 24. 1904. 

≡ Macrosporium macrosporum (Zimm.) Nishikado & Oshima, Agric. Res. 

(Kurashiki) 36: 391. 1944. 

= Sporidesmium longipedicellatum Reichert, Bot. Jahrb. Syst. 56: 723. 1921. 

≡ Alternaria longipedicellata (Reichert) Snowden, Rep. Dept. Agric. 

Uganda: 31. 1927 [1926]. 

Alternaria multirostrata E.G. Simmons & C.R. Jacks., 


Alternaria nitrimali E.G. Simmons & M.E. Palm, Mycotaxon 75: 

93. 2000. 

Alternaria passiflorae J.H. Simmonds, Proc. Roy. Soc. 

Queensland. 49: 151. 1938. 

Alternaria poonensis Ragunath, Mycopathol. Mycol. Appl. 21: 

315. 1963. 

Alternaria porri (Ellis) Cif., J. Dept. Agric. Porto Rico 14: 30. 1930 

[1929]. 

Basionym: Macrosporium porri Ellis, Grevillea 8 (no. 45): 12. 1879. 

Alternaria protenta E.G. Simmons, Mycotaxon 25: 207. 1986. 

Alternaria pseudorostrata E.G. Simmons, Mycotaxon 57: 398. 1996. 

Alternaria ricini (Yoshii) Hansf., Proc. Linn. Soc. Lond. : 53. 1943. 

Basionym: Macrosporium ricini Yoshii, Bult. Sci. Fak. Terk. Kjusu 

Imp. Univ. 3(4): 327. 1929. 

Alternaria rostellata E.G. Simmons, Mycotaxon 57: 401. 1996. 

Alternaria scorzonerae (Aderh.) Loer., Netherlands J. Pl. Pathol. 

90(1): 37. 1984. 

Basionym: Sporidesmium scorzonerae Aderh.,Arbeiten Kaiserl. 

Biol. Anst. Land-Forstw . 3: 439. 1903. 

Alternaria sesami (E. Kawam.) Mohanty & Behera, Curr. Sci. 27: 

493. 1958. 

Basionym: Macrosporium sesami E. Kawam., Fungi 1(2): 27. 1931. 

Alternaria solani Sorauer, Z. Pflanzenkrankh. Pflanzenschutz 6: 

6. 1896. 

= Macrosporium solani Ellis & G. Martin, Amer. Naturalist 16(12): 1003. 

1882 

≡ Alternaria solani (Ellis & G. Martin) L.R. Jones & Grout, Vermont Agric. 

Exp. Sta. Annual Rep. 9: 86. 1896. 

Additional synonyms in Simmons (2007). 

Alternaria solani-nigri R. Dubey, S.K. Singh & Kamal [as “solaninigrii”], 

Microbiol. Res. 154(2): 120. 1999. 

Alternaria steviae Ishiba, T. Yokoy. & Tani, Ann. Phytopathol. Soc. 

Japan 48(1): 46. 1982. 

Alternaria subcylindrica E.G. Simmons & R.G. Roberts, 

Mycotaxon 75: 62. 2000. 

Alternaria tagetica S.K. Shome & Mustafee, Curr. Sci. 35: 370. 

1966. 

Alternaria tomatophila E.G. Simmons, Mycotaxon 75: 53. 2000. 

Alternaria tropica E.G. Simmons, Mycotaxon 46: 187. 1993. 

Alternaria zinniae H.Pape ex M.B. Ellis, Mycol. Pap. 131: 22. 1972. 

= Alternaria zinniae H. Pape, Angew. Bot. 24: 61. 1942. (nom. inval., Art. 36.1) 

Section Pseudoulocladium Woudenb. & Crous, sect. 


Type species: Alternaria chartarum Preuss 

Diagnosis: Section Pseudoulocladium is characterised by simple 

or branched conidiophores with short, geniculate, sympodial 

proliferations. Conidia are obovoid, non-beaked with a narrow 

base, in simple or (mostly) branched chains. Apical secondary 

conidiophores with multiple conidiogenous loci and lateral 

secondary conidiophores with a single conidiogenous locus can be 

formed. 

Note: It forms a sister clade to section Ulocladioides. 

Alternaria aspera Woudenb. & Crous, nom. nov. MycoBank 

MB803712. 

Basionym: Ulocladium arborescens E.G. Simmons, Stud. 

Mycol. 50: 117. 2004, non Alternaria arborescens E.G. 


Etymology: Name refers to the conspicuously ornamented 

conidia. 

Alternaria chartarum Preuss, Bot. Zeitung 6: 412, 1848. 

≡ Sporidesmium polymorphum var. chartarum (Preuss) Cooke, Fungi 

Brit. Exs., ser. 2: 329. 1875. 

≡ Ulocladium chartarum (Preuss) E.G. Simmons, Mycologia 59: 88. 1967. 

= Alternaria stemphylioides Bliss, Mycologia 36: 538. 1944. 

≡ Alternaria chartarum f. stemphylioides (Bliss) P. Joly, Encycl. Mycol. 

(Paris) 33: 161. 1964. 

Alternaria concatenata Woudenb. & Crous, nom. nov. MycoBank 

MB803713. 

Basionym: Ulocladium capsici F. Xue & X.G. Zhang [as 

“capsicuma”], Sydowia 59: 174. 2007, non Alternaria capsici E.G. 


Eymology: Name refers to the concatenated conidia. 

Alternaria septospora (Preuss) Woudenb. & Crous, comb. nov. 


Basionym: Helminthosporium septosporum Preuss, Linnaea 24: 

117. 1851. 

≡ Macrosporium septosporum (Preuss) Rabenh., Bot. Zeitung 9: 454. 

1851. 

≡ Ulocladium septosporum (Preuss) E.G. Simmons, Mycologia 59: 87. 

1967. 

Section Radicina D.P. Lawr., Gannibal, Peever & B.M. 


Type species: Alternaria radicina Meier, Drechsler & E.D. Eddy 

Diagnosis: Section Radicina contains straight, simple or 

branched, short or long, primary conidiophores with multiple, 

short geniculate, sympodial proliferations with single or a few 

conidiogenous loci at the apex. Sporulation resembles a cluster 

or clumps of conidia. Conidia are widely ovoid to narrowly 


201


Fig. 20. Alternaria sect. Pseudoulocladium: conidia and conidiophores. A–B. A. aspera. C–D. A. concatenata. E–F. A. chartarum. G–H. A. septospora. Scale bars = 10 µm. 

ellipsoid, moderate in size, beakless, with several transverse 

and longitudinal septa, solitary or in short chains. Solitary, short, 

apical secondary conidiophores may occur. The species from this 

section occur on Umbelliferae. 

Note: This section was first recognised by Pryor & Gilbertson 

(2000) based on sequence data of the ITS and mitochondrial SSU. 

Alternaria carotiincultae E.G. Simmons, Mycotaxon 55: 103. 

1995. 

Alternaria petroselini (Neerg.) E.G. Simmons, More dematiaceous 

hyphomycetes (Kew): 417. 1976. 

Basionym: Stemphylium petroselini Neerg., Zentralbl. Bakteriol., 2. 

Abt., 104: 411. 1942. 

≡ Stemphylium radicinum var. petroselini (Neerg.) Neerg., Danish species of 

Alternaria & Stemphylium: 357. 1945. 

≡ Alternaria radicina var. petroselini (Neerg.) Neerg., Encycl. Mycol. 33: 123. 

1964. 

Alternaria radicina Meier, Drechsler & E.D. Eddy, Phytopathology 

12: 157. 1922. 

≡ Stemphylium radicinum (Meier, Drechsler & E.D. Eddy) Neerg., Annual 

Rep. Phytopathol. Lab. J.E. Ohlsens Enkes, Seed Growers, Copenhagen 

4: 14. 1939. 

≡ Thyrospora radicina (Meier, Drechsler & E.D. Eddy) Neerg., Bot. 

Tidsskr. 44: 361. 1939. 

≡ Pseudostemphylium radicinum (Meier, Drechsler & E.D. Eddy) 

Subram., Curr. Sci. 30: 423. 1961. 

Alternaria selini E.G. Simmons, Mycotaxon 55: 109. 1995. 

Alternaria smyrnii (P. Crouan & H. Crouan) E.G. Simmons, 

Mycotaxon 55: 41. 1995. 

Basionym: Helminthosporium smyrnii P. Crouan & H. Crouan, 

Florule Finistère (Paris): 11. 1867. 

≡ Macrosporium smyrnii (P. Crouan & H. Crouan) Sacc., Syll. Fungorum 

(Abellini) 4: 527. 1886. 

Section Sonchi D.P. Lawr., Gannibal, Peever & B.M. 


Type species: Alternaria sonchi Davis 

Diagnosis: Section Sonchi is characterised by subcylindrical, 

broadly ovoid, broadly ellipsoid or obclavate, (medium) large 

conidia, single or in short chains, with multiple transverse and few 

longitudinal septa, slightly constricted at the septa, with a blunt 

taper which can form secondary conidiophores. 

Notes: The species-group was described by Hong et al. (2005) 

based on molecular data of the GAPDH and Alt a 1 regions. 

Lawrence et al. (2013) included A. brassicae as a basal lineage 

in sect. Sonchi, which is supported as a monotypic lineage in our 

analyses. The species from section Sonchi occur on multiple hosts 

within the Compositae. 

Alternaria cinerariae Hori & Enjoji, J. Pl. Protect. 18: 432. 1931. 

Alternaria sonchi Davis, in Elliott, Bot. Gaz. 62: 416. 1916. 

Section Teretispora (E.G. Simmons) Woudenb. & 


23. 

202


Fig. 21. Alternaria sect. Radicina: conidia and conidiophores. A–C. A. carotiincultae. D–E. A. petroselini. F–G. A. radicina. H–I. A. selini. J–L. A. smyrnii. Scale bars = 10 µm. 

Fig. 22. Alternaria sect. Sonchi: conidia and conidiophores. A–B. A. cinerariae. C–D. A. sonchi. Scale bars = 10 µm. 


203


Fig. 23. Alternaria sect. Teretispora: conidia and conidiophores. A–D. A. leucanthemi. Scale bars = 10 µm. 

Basionym: Teretispora E.G. Simmons, CBS Biodiversity Ser. 

(Utrecht) 6: 674. 2007. 

Type species: Alternaria leucanthemi Nelen 

Diagnosis: Section Teretispora is characterised by simple 

conidiophores, sometimes extending at the apex with one or two, 

geniculate, sympodial proliferations, bearing single, long cylindrical 

mature conidia lacking a beak portion, with many transverse and a 

few longitudinal septa, constricted at most of the transverse septa. 

Secondary conidiophores with a single conidium are rarely formed 

at the apex; instead, they may form from the base of the primary 

conidium. 

Notes: The genus Teretispora had Teretispora leucanthemi, 

formerly Alternaria leucanthemi (= Alternaria chrysanthemi), as 

type and only species (Simmons 2007). We choose to treat this 

as a section, which retains the name Teretispora, rather than a 

monotypic lineage. 

Alternaria leucanthemi Nelen, in Nelen & Vasiljeva, Bot. Mater. 

Otd. Sporov. Rast. Bot. Inst. Akad. Nauk S.S.S.R. 15: 148. 1962. 

≡ Teretispora leucanthemi (Nelen) E.G. Simmons, CBS Biodiversity Ser. 

(Utrecht) 6: 674. 2007. 

= Alternaria leucanthemi Nelen, Bull. Centr. Bot. Gard. (Moscow) 35: 83. 1959. 

(nom. inval., Art. 36.1) 

= Alternaria chrysanthemi E.G. Simmons & Crosier, Mycologia 57: 142. 

1965. 

Section Ulocladioides Woudenb. & Crous, sect. nov. 


Type species: Alternaria cucurbitae Letendre & Roum. 

Diagnosis: Section Ulocladioides is characterised by conidiophores 

with short, geniculate, sympodial proliferations. Conidia are 

obovoid, non-beaked with a narrow base, single or in chains, which 

may form secondary conidiophores at the apex. 

Note: Section Ulocladioides resembles section Ulocladium and 

contains the majority of the species included in this study from the 

genus Ulocladium (11/17). 

Alternaria atra (Preuss) Woudenb. & Crous, comb. nov. 


Basionym: Ulocladium atrum Preuss, Linnaea 25: 75. 1852. 

≡ Stemphylium atrum (Preuss) Sacc., Syll. Fungorum (Abellini) 4: 520. 

1886. 

Alternaria brassicae-pekinensis Woudenb. & Crous, nom. nov. 


Basionym: Ulocladium brassicae Yong Wang bis & X.G. Zhang, 

Mycologia 100: 457. 2008, non Alternaria brassicae (Berk.) Sacc., 

1880. 

Etymology: Name refers to the host from which it was originally 

isolated. 

Alternaria cantlous (Yong Wang bis & X.G. Zhang) Woudenb. & 


Basionym: Ulocladium cantlous Yong Wang bis & X.G. Zhang, 

Mycologia 102: 376. 2010. 

Alternaria consortialis (Thüm.) J.W. Groves & S. Hughes [as 

“consortiale”], Canad. J. Bot. 31: 636. 1953. 

Basionym: Macrosporium consortiale Thüm., Herb. Mycol. Oecon. 

9: no. 450. 1876. 

≡ Stemphylium consortiale (Thüm.) J.W. Groves & Skolko, Canad. J. 

Res., Sect. C, Bot. Sci.: 196. 1944. 

≡ Pseudostemphylium consortiale (Thüm.) Subram., Curr. Sci. 30: 423. 

1961. 

≡ Ulocladium consortiale (Thüm.) E.G. Simmons, Mycologia 59: 84. 1967. 

= Stemphylium ilicis Tengwall, Meded. Phytopathol. Lab. “Willie Commelin 

Scholten” 6: 44. 1924. 

Alternaria cucurbitae Letendre & Roum., in Roumeguère, Rev. 

Mycol. (Toulouse) 8 (no. 30): 93. 1886. 

≡ Ulocladium cucurbitae (Letendre & Roum.) E.G. Simmons, Mycotaxon 

14: 48. 1982. 

Alternaria heterospora Woudenb. & Crous, nom. nov. MycoBank 

MB803724. 

Basionym: Ulocladium solani Yong Wang bis & X.G. Zhang, Mycol. 

Progr. 8: 209. 2009, non Alternaria solani Sorauer, 1896. 

Etymology: Name refers to the various conidial morphologies 

observed during growth. 

Alternaria multiformis (E.G. Simmons) Woudenb. & Crous, 


Basionym: Ulocladium multiforme E.G. Simmons, Canad. J. Bot. 

76: 1537. 1999 [1998]. 

Alternaria obovoidea (E.G. Simmons) Woudenb. & Crous, comb. 


Basionym: Ulocladium obovoideum E.G. Simmons, Mycotaxon 37: 

104. 1990. 

Alternaria subcucurbitae (Yong Wang bis & X.G. Zhang) 

Woudenb. & Crous, comb. nov. MycoBank MB803722. 

Basionym: Ulocladium subcucurbitae Yong Wang bis & X.G. Zhang, 

Mycologia 100: 456. 2008. 

204


Fig. 24. Alternaria sect. Ulocladioides: conidia and conidiophores. A–B. A. atra. C–D. A. brassicae-pekinensis. E–F. A. cantlous. G–H. A. multiformis. I–J. A. obovoidea. K–L. A. 

heterospora. M–N. A. subcucurbitae. O–P. A. terricola. Scale bars = 10 µm. 


205


Fig. 25. Alternaria sect. Ulocladium: conidia and conidiophores. A–B. A. capsici-annui. C–D. A. oudemansii. E–F. A. alternariae. G–H. A. botrytis. Scale bars = 10 µm. 

Alternaria terricola Woudenb. & Crous, nom. nov. MycoBank 

MB803725. 

Basionym: Ulocladium tuberculatum E.G. Simmons, Mycologia 59: 

83. 1967, non Alternaria tuberculata M. Zhang & T.Y. Zhang, 2006. 

Etymology: Name refers to soil from which it was originally isolated. 

Section Ulocladium (Preuss) Woudenb. & Crous, 


Basionym: Ulocladium Preuss, Linnaea 24: 111. 1851. 

Type species: Alternaria botrytis (Preuss) Woudenb. & Crous 

Diagnosis: Section Ulocladium is characterised by simple 

conidiophores, or with one or two short, geniculate, sympodial 

proliferations, with (mostly) single, obovoid, non-beaked conidia 

with a narrow base. 

Notes: Section Ulocladium resembles sect. Ulocladioides. The 

epitype of Ulocladium, U. botrytis CBS 197.67, and the isotype 

of U. oudemansii (CBS 114.07) cluster with the Sinomyces 

representative, as do many other strains stored as U. botrytis in 

the CBS collection (data not shown). Furthermore, a strain stored 

as A. capsici-annui (CBS 504.74) in the CBS collection clusters 

within the Sinomyces clade and displays identical morphological 

features. 

Alternaria alternariae (Cooke) Woudenb. & Crous, comb. nov. 


Basionym: Sporidesmium alternariae Cooke, Handb. Brit. Fungi 1: 

1440. 1871. 

≡ Stemphylium alternariae (Cooke) Sacc., Syll. Fungorum (Abellini) 4: 

523. 1886. 

≡ Ulocladium alternariae (Cooke) E.G. Simmons, Mycologia 59: 82. 1967. 

≡ Sinomyces alternariae (Cooke) Yong Wang bis & X.G. Zhang, Fungal 

Biol. 115: 194. 2011. 

Alternaria botrytis (Preuss) Woudenb. & Crous, comb. nov. 


Basionym: Ulocladium botrytis Preuss, Linnaea 24: 111. 1851. 

≡ Stemphylium botryosum var. ulocladium Sacc. (nom. nov.), Syll. 

Fungorum (Abellini) 4: 522. 1886. 

≡ Stemphylium botryosum var. botrytis (Preuss) Lindau, Rabenhorst’s. 

Kryptog.-Fl., Edn 2 (Leipzig) 1(9): 219. 1908. 

Alternaria capsici-annui Săvul. & Sandu, Hedwigia 75: 228. 1936. 

Alternaria oudemansii (E.G. Simmons) Woudenb. & Crous, 


Basionym: Ulocladium oudemansii E.G. Simmons, Mycologia 59: 

86. 1967. 

Section Undifilum (B.M. Pryor, Creamer, Shoemaker, 

McLain-Romero & Hambl.) Woudenb. & Crous, comb. 

et stat. nov. MycoBank MB803748. Fig. 26. 

Basionym: Undifilum B.M. Pryor, Creamer, Shoemaker, McLain- 

Romero & Hambl., Botany 87: 190. 2009. 

Type species: Alternaria bornmuelleri (Magnus) Woudenb. & Crous 

Diagnosis: Section Undifilum is characterised by ovate to obclavate 

to long ellipsoid, straight to inequilateral, single, transseptate conidia; 

206


Fig. 26. Alternaria sect. Undifilum: conidia and conidiophores. A–D. A. bornmuelleri. Scale bars = 10 µm. 

septa can be thick, dark and rigid, and form unique germ tubes, which 

are wavy or undulate until branching. Species of this section occur on 

Fabaceae and almost all produce the toxic compound swaisonine. 

Notes: Section Undifilum shares morphological features with 

section Embellisia, but is characterised by the formation of a wavy 

germ tube upon germination (Pryor et al. 2009). Based on previous 

studies, the swaisonine producing species U. oxytropis (Pryor et al. 

2009, Lawrence et al. 2012), U. fulvum and U. cinereum (Baucom 

et al. 2012) also belong to this section, although the type species, 

A. bornmuelleri, does not produce swaisonine. 

Alternaria bornmuelleri (Magnus) Woudenb. & Crous, comb. 


Basionym: Helminthosporium bornmuelleri Magnus, Hedwigia 38 

(Beibl.): 73. 1899. 

≡ Undifilum bornmuelleri (Magnus) B.M. Pryor, Creamer, Shoemaker, 

McLain-Romero & Hambl., Botany 87: 190. 2009. 

Alternaria cinerea (Baucom & Creamer) Woudenb. & Crous, 


Basionym: Undifilum cinereum Baucom & Creamer, Botany 90: 

872. 2012 

Alternaria fulva (Baucom& Creamer) Woudenb. & Crous, comb. 


Basionym: Undifilum fulvum Baucom & Creamer, Botany 90: 871. 

2012 

Alternaria oxytropis (Q. Wang, Nagao & Kakish.) Woudenb. & 


Basionym: Embellisia oxytropis Q. Wang, Nagao & Kakish., 

Mycotaxon 95: 257. 2006. 

≡ Undifilum oxytropis (Q. Wang, Nagao & Kakish.) B.M. Pryor, Creamer, 

Shoemaker, McLain-Romero & Hambl., Botany 87: 191. 2009. 

Monotypic lineages 

The following six species are not assigned to one of the 24 above 

described Alternaria sections and are treated as separate, single 

species, lineages in this study. Future studies, including more 

and/or new Alternaria species, might eventually give rise to the 

formation of new sections, when these new species show to be 

closely related to one of these monotypic lineages. 

Alternaria argyranthemi E.G. Simmons & C.F. Hill, Mycotaxon 65: 

32. 1997. 

Alternaria brassicae (Berk.) Sacc., Michelia 2(no. 6): 129. 1880. 

Basionym: Macrosporium brassicae Berk., Engl. Fl., Fungi (Edn 2) 

(London) 5: 339. 1836. 

Additional synonyms listed in Simmons (2007). 

Alternaria dennisii M.B. Ellis, Mycol. Pap. 125: 27. 1971. 

≡ Embellisia dennisii (M.B. Ellis) E.G. Simmons, Mycotaxon 38: 257. 

1990. 

Alternaria helianthiinficiens E.G. Simmons, Walcz & R.G. 

Roberts [as “helianthinficiens”], Mycotaxon 25: 204. 1986. 

Alternaria soliaridae E.G. Simmons, CBS Biodiversity Ser. 

(Utrecht) 6: 374. 2007. 

Alternaria thalictrigena K. Schub. & Crous, Fungal Planet No. 12: 

2. 2007. 

Paradendryphiella Woudenb. & Crous, gen. nov. 


Colonies on SNA effuse, entire, velvety, olivaceous. Reverse 

olivaceous-grey to iron-grey. Mycelium consisting of branched, 

septate hypha, (sub)hyaline, smooth. Conidiophores subhyaline, 

simple or branched, septate or not, straight or flexuous, often 

nodose with conspicuous, brown pigmentation at the apical 

region; at times reduced to conidiogenous cells. Conidiogenous 

cells terminal or lateral, with denticles aggregated at apex, with 

prominent conidial scars, thickened but not darkened; sometimes 

proliferating with a new head or a short, inconspicuous sympodial 

rachis. Conidia produced holoblastically, on narrow denticle, 

smooth, cylindrical to obclavate, straight or slightly flexuous, 1–7 

transverse septa, pale to medium brown, often with dark septa 

(often constricted), and a darkened zone of pigmentation at 

the apex, and at the hilum, which is thickened, and somewhat 

protruding, with a minute marginal frill. Chlamydospores and 

sexual state not observed. 

Type species: Paradendryphiella salina (G.K. Sutherl.) Woudenb. 

& Crous 

Paradendryphiella salina (G.K. Sutherl.) Woudenb. & Crous, 


Basionym: Cercospora salina G.K. Sutherl., New Phytol. 15: 43. 1916. 

≡ Dendryphiella salina (G.K. Sutherl.) Pugh & Nicot, Trans. Brit. Mycol. 

Soc. 47(2): 266. 1964. 

≡ Scolecobasidium salinum (G.K. Sutherl.) M.B. Ellis, More dematiaceous 



207


Fig. 27. Paradendryphiella gen. nov.: conidia and conidiophores. A–B, D–E, G–I. P. salina. C, F. P. arenariae. Scale bars = 10 µm. 

= Embellisia annulata de Hoog, Seigle-Mur., Steiman & K.-E. Erikss., Antonie 

van Leeuwenhoek J. Microbiol. Serol. 51: 409. 1985. 

Paradendryphiella arenariae (Nicot) Woudenb. & Crous, comb. 


Basionym: Dendryphiella arenariae Nicot, [as “arenaria”] Rev. 

Mycol. (Paris) 23: 93. 1958. 

≡ Scolecobasidium arenarium (Nicot) M.B. Ellis, More dematiaceous 


DISCUSSION 

The well-supported node for the Alternaria clade obtained in the 

present study, and the low bootstrap support at the deeper nodes 

within the Alternaria complex is also consistently seen in previous 

phylogenetic studies published on these genera (Pryor & Bigelow 

2003, Inderbitzin et al. 2006, Pryor et al. 2009, Runa et al. 2009, 

Wang et al. 2011, Lawrence et al. 2012). The only phylogenetic study 

which displays a second fully supported node is based on a fivegene 

combined dataset of GAPDH, Alt a 1, actin, plasma membrane 

ATPase and calmodulin (Lawrence et al. 2013). This node, called 

clade A by the authors, supports eight “asexual” Alternaria speciesgroups 

and an Ulocladium (sect. Ulocladioides in our phylogenies) 

clade. By resolving these eight asexual phylogenetic lineages of 

Alternaria together with Ulocladium, which is sister to the sexual 

A. infectoria species-group and other sexual genera, Lawrence et 

al. (2013) elevated the asexual species-groups to sections within 

Alternaria. If we take this node as cut-off for the genus Alternaria 

in our phylogenies, this would leave an Alternaria clade with 14 

internal clades (sections) and three monotypic lineages. In order 

to create a stable phylogenetic taxonomy, seven new genera need 

to be described of which three would be monotypic; E. dennissii, 

A. argyranthemi and A. soliaridae. Embellisia species would be 

assigned to five different genera of which four would be new, 

leaving only E. allii, E. chlamydospora and E. tellustris in the genus 

Embellisia. The well-known (medical) A. infectoria species-group 

would also have to be transferred to a new genus. This node is not 

supported in our study (0.98 PP /65 ML Fig 1) and also the strict 

asexual/sexual division is not supported as two sexual morphs are 

found in section Panax. This approach would therefore give rise 

to multiple small genera, and would not end up in a logical and 

workable situation. 

Based on our phylogenetic study on parts of the SSU, LSU, ITS, 

GAPDH, RPB2 and TEF1 gene regions of ex-type and reference 

strains of Alternaria species and all available allied genera, we 

resolved a Pleospora/Stemphylium-clade sister to Embellisia 

annulata, and a well-supported Alternaria clade. The Alternaria 

clade contains 24 internal clades and six monotypic lineages. In 

combination with a review of literature and morphology, the species 

within the Alternaria clade are all recognised here as Alternaria s. 

str. This puts the genera Allewia, Brachycladium, Chalastospora, 

Chmelia, Crivellia, Embellisia, Lewia, Nimbya, Sinomyces, 

Teretispora, Ulocladium, Undifilum and Ybotromyces in synonymy 

with Alternaria. 

The support values for the different sections described in this 

study are plotted in a heatmap per gene/gene combination and 

phylogenetic method used (Table 2). This shows that the Bayesian 

method provides greater support than the Maximum Likelihood 

bootstrap support values, which is in congruence with previous 

reports (e.g. Douady et al. 2003). The sections Cheiranthus, 

Eureka and Nimbya have the lowest support values. For sect. 

Eureka this is mainly caused by the position of A. cumini, which 

clusters within sect. Embellisioides based on its RPB2 sequence 

and as a monotypic lineage based on its TEF1 sequence. Section 

Cheiranthus and Nimbya are small sections, with relative long 

branches. Future studies, including more strains and/or species in 

these sections, are necessary to check the stability of these long 

branches. 

The sexual genus Crivellia with its Brachycladium asexual 

morph was described by Inderbitzin et al. (2006) with Crivellia 

papaveraceae (asexual morph Brachycladium penicillatum) as 

type species and B. papaveris, with an unnamed sexual morph, as 

second species. The genus Brachycladium, which was synonymised 

208


with Dendryphion (Ellis 1971), was resurrected for the non-sexual 

stage based on polyphyly within Dendryphion and morphological 

distinction from its type species, D. comosum. The type species of 

Brachycladium, B. penicillatum, resides in Alternaria sect. Crivellia, 

which places Brachycladium in synonymy with Alternaria instead 

of Dendryphion. 

The genus Chalastospora was established by Simmons (2007) 

based on Chalastospora cetera, formerly Alternaria cetera. Two 

new Chalastospora species, C. ellipsoidea and C. obclavata, and 

A. malorum as C. gossypii were later added to the genus, based on 

sequence data of the ITS and LSU regions (Crous et al. 2009c). The 

genus is characterised by conidia which are almost always narrowly 

ellipsoid to narrowly ovoid with 1–6 transverse eusepta, generally 

lacking oblique or longitudinal septa (Crous et al. 2009c). Our 

study shows that Alternaria armoraciae and Embellisia abundans 

also belong to this clade. Juvenile conidia of A. armoraciae are 

ovoid, but vary from being narrow to broadly ovoid and ellipsoid, 

with 3–5 transverse septa and a single longitudinal septum in up 

to four of the transverse segments (Simmons 2007). Embellisia 

abundans was already mentioned as part of the Chalastospora 

clade (Andersen et al. 2009, Lawrence et al. 2012), and has long 

ovoid or obclavate conidia with 3–6 transverse septa and rarely 

any longitudinal septa (Simmons 1983). The description of sect. 

Chalastospora does therefore not completely follow the original 

description of the genus Chalastospora. 

The genus Embellisia is characterised by the thick, dark, rigid 

conidial septa and the scarcity of longitudinal septa (Simmons 

2007). It was first described by Simmons (1971), with Embellisia 

allii as type and E. chlamydospora as second species. Multiple 

Embellisia species followed after the description of the genus, 

which was later linked to the sexual genus Allewia (Simmons 

1990). The latest molecular-based revision was performed based 

on sequences of the GAPDH, ITS and Alt a 1 genes (Lawrence 

et al. 2012). They found that Embellisia split into four clades and 

multiple species, which clustered individually amidst Alternaria, 

Ulocladium or Stemphylium spp. Our results mostly support 

these data, but with the inclusion of more ex-type/representative 

strains of Alternaria some additions were made to the different 

Embellisia groups mentioned by Lawrence et al. (2012). Group 

I (sect. Embellisia) and III (sect. Embellisioides) are identical 

to the treatment of Lawrence et al. (2012) but group II (section 

Phragmosporae) and IV (section Eureka) are both expanded 

with four Alternaria species. As not all species from group II and 

IV display the typical morphological characters of Embellisia, we 

chose to name these Alternaria sections based on the oldest 

species residing in the respective sections. Embellisia abundans 

was already mentioned as being part of the Chalastospora-clade 

and E. indefessa formed a clade close to Ulocladium, which we 

now assign to sect. Cheiranthus. Embellisia dennisii also forms 

a separate lineage in our phylogenies; therefore the old name 

Alternaria dennissii is resurrected. Furthermore, the clustering of E. 

conoidea within the A. brassicicola species-group and E. annulata 

close to Stemphylium, now assigned as Paradendryphiella gen. 

nov., is confirmed by our phylogenetic data. The morphological 

character of thick, dark, rigid septa seems to have evolved multiple 

times and does not appear to be a valid character for taxonomic 

distinction at generic level. 

The sexual morphs Lewia (Simmons 1986) and Allewia 

(Simmons 1990) were linked to Alternaria and Embellisia 

respectively, with the only difference between these genera 

being the morphology of their asexual morphs. Lewia 

chlamidosporiformans and L. sauropodis are transferred to the 

genus Leptosphaerulina (Simmons 2007), which leaves 11 Lewia 

species with a known Alternaria anamorph. Most of them (9/11) 

reside in sect. Infectoriae, the others are found in sect. Panax. 

Allewia only contains two species of which one resides in sect. 

Eureka and one in sect. Embellisioides. With the establishment of 

the new International Code of Nomenclature for algae, fungi and 

plants (ICN), the dual nomenclature system for sexual and asexual 

fungal morphs was abandoned and replaced by a single-name 

nomenclature (Hawksworth et al. 2011, Norvell 2011). In order to 

implement the new rules of the ICN, we synonymised Lewia and 

Allewia with Alternaria. 

Although multiple molecular studies included Nimbya isolates in 

their phylogenies (Chou & Wu 2002, Pryor & Bigelow 2003, Hong et 

al. 2005, Inderbitzin et al. 2006, Pryor et al. 2009), a more extensive 

molecular-based study was recently published by Lawrence et al. 

(2012). Based on sequences of the GAPDH, ITS and Alt a 1 genes, 

the authors found a Nimbya clade which contained the type species 

N. scirpicola together with N. scirpinfestans, N. scirpivora and N. 

caricis. The N. scirpicola isolate which we included in our study, was 

assigned to this genus by Simmons (1989) based on morphological 

characters, as is the one used in other molecular studies (Pryor 

& Bigelow 2003, Hong et al. 2005, Lawrence et al. 2012). The 

sequences of the ITS, GAPDH and Alt a 1 genes of these isolates 

are however not identical, but do cluster in the same clade in the 

two phylogenies (data not shown), together with the isolate of N. 

caricis. The N. gomphrenae isolate we included in our phylogeny was 

not representative of the name. Simmons mentioned in 1989 that 

Togashi (1926) described two different fungi and deposited the smallspored 

species in the CBS collection, instead of the large-spored N. 

gomphrenae isolate. Nimbya gomphrenae CBS 108.27, which does 

not sporulate anymore, will therefore be treated as “Alternaria sp.”, 

and resides in sect. Alternata. The ITS sequence of N. gomphrenae 

from Chou & Wu (2002) actually clusters within sect. Alternantherae. 

This section was described by Lawrence et al. (2012) and consists 

of three Nimbya species, which they renamed to Alternaria based 

on the position of the clade amidst the Alternaria species-groups. 

Based on the data from Chou & Wu (2002), the name Alternaria 

gomphrenae is resurrected and placed in sect. Alternantherae. 

The genus Sinomyces was described in by Wang et al. (2011) 

to accommodate Ulocladium alternariae and two new species 

from China, S. obovoideus and S. fusoides (type). The genus was 

differentiated from Ulocladium based on its simple conidiophores 

with a single apical pore or 1–2 short, uniperforate, geniculate 

sympodial proliferations. Unfortunately, our DNA sequence 

analyses of the ex-type cultures of the two new species from 

China (CBS 124114 and CBS 123375) were not congruent with 

the GAPDH (both species) and Alt a 1 (S. obovoideus) sequences 

deposited in GenBank (data not shown), leading us to doubt the 

authenticity of these strains. This matter could not be resolved in 

spite of contacting the original depositors. The ex-type strain of S. 

alternariae (CBS 126989) was therefore included as representative 

of the genus Sinomyces. The presence of the epitype of Ulocladium, 

U. botrytis CBS 197.67, in this section resulted in us rejecting the 

name Sinomyces, and calling this sect. Ulocladium. In addition, the 

presence of U. oudemansii in this section, with conidiophores with 

1–5 uniperforate geniculations (Simmons 1967), also disagrees 

with the mentioned differentiation of Sinomyces from Ulocladium. 

The type species of Ulocladium, U. botrytis, was typified by 

two representative strains QM 7878 (CBS 197.67) and QM 8619 

(CBS 198.67) (Simmons 1967). Molecular studies performed 

afterwards showed that these strains are not identical (de Hoog & 

Horré 2002). Most molecular studies performed used CBS 198.67 


209


as representative of U. botrytis (Pryor & Gilbertson 2000, Pryor 

& Bigelow 2003, Hong et al. 2005, Xue & Zhang 2007, Pryor et 

al. 2009, Runa et al. 2009, Wang et al. 2010, Wang et al. 2011, 

Lawrence et al. 2012), which clusters in section Ulocladioides. 

However, de Hoog & Horré (2002) epitypified U. botrytis with CBS 

197.67, which clusters with Sinomyces strains, as does Ulocladium 

oudemansii, now named sect. Ulocladium. Extended phylogenetic 

analyses on all U. botrytis strains present in the CBS culture 

collection (16 isolates) also highlight this issue as they cluster either 

within sect. Ulocladium or sect. Ulocladioides (data not shown), 

both with one of the representative strains described by Simmons 

(1967). The suggestion to synonymise Ulocladium with Alternaria 

has been made several times in the past (Pryor & Gilbertson 2000, 

Chou & Wu 2002). The latest systematic revision of the genus 

Ulocladium (Runa et al. 2009) based on sequences from the ITS, 

GAPDH and Alt a 1 genes supported previous findings of polyand 

paraphyletic relationships of Ulocladium among Alternaria, 

Embellisia and Stemphylium spp. (de Hoog & Horré 2002, Pryor 

& Bigelow 2003, Hong et al. 2005). Ulocladium alternariae and U. 

oudemansii, now known as sect. Ulocladium, cluster separately. 

The core Ulocladium clade, containing the two sister clades now 

called sect. Ulocladioides and sect. Pseudoulocladium, was 

confirmed by later studies (Wang et al. 2010, Lawrence et al. 2012). 

Alternaria cheiranthi and Embellisia indefessa have been linked to 

Ulocladium (Pryor & Gilbertson 2000, Pryor & Bigelow 2003, Hong 

et al. 2005, Pryor et al. 2009, Runa et al. 2009, Lawrence et al. 

2012), but missed the diagnostic feature of Ulocladium. Our study 

showed that they form a sister section, sect. Cheiranthus, to sect. 

Ulocladioides. The confusing taxonomy in this genus strengthens 

our decision to reduce Ulocladium to synonymy with Alternaria. The 

characteristics of the former genus Ulocladium are added to the 

new broader Alternaria generic circumscription. 

The genus Undifilum was described by Pryor et al. (2009) 

to accommodate the species U. oxytropis and U. bornmuelleri. It 

shares the morphological feature of thick, dark and rigid septa with 

the genus Embellisia, but was characterised by the formation of 

a wavy germ-tube upon germination (Pryor et al. 2009). A recent 

study on fungal endophytes in locoweeds in the US described two 

new Undifilum species (Baucom et al. 2012). Both new species 

produce the toxic compound swaisonine, which is also produced 

by U. oxytropis. Swaisonine is the cause of a neurological disease, 

locism, of grazing animals, resulting in economic losses in livestock 

(James & Panter 1989). The production of swaisonine seems to be 

related to this section, although the type-species, U. bornmuelleri, 

does not produce this toxin. 

The genus Ybotromyces contains one species, Y. caespitosus 

(originally Botryomyces caespitosus), which was isolated from a 

skin lesion of a human patient (de Hoog & Rubio 1982). De Hoog et 

al. (1997) discovered a high similarity to Alternaria spp. based on 

restriction patterns of the ITS and SSU rDNA. A phylogeny study of 

melanised meristematic fungi based on their SSU and ITS rDNA 

sequences (Sterflinger et al. 1999) placed Y. caespitosus within the 

Pleosporales together with Alternaria and Pleospora. De Hoog & 

Horré (2002) hypothesized that the ex-type strain of Y. caespitosus, 

CBS 177.80, is likely a synanamorph of a yet undescribed Alternaria 

species. Our phylogeny supports this hypothesis, and places the 

genus in sect. Infectoriae. 

Chmelia slovaca, described from dermatic lesions of a human 

(Svobodová 1966), also clusters with sect. Infectoriae as was 

shown previously (de Hoog & Horré 2002). The genus produces 

different types of chlamydospores and sporadically blastospores, 

but no conidia or conidiophores, which makes it difficult to identify 

based on morphology. De Hoog & Horré (2002) were confident that 

Chmelia is a sterile member of A. infectoria, which is in agreement 

with our results. 

Genera unrelated to Alternaria 

The placement of the sexual genus Pleospora (1863) with 

Stemphylium (1833) asexual morphs as basal sister clade to the 

Alternaria complex is well-documented in multiple molecular studies 

(Chou & Wu 2002, Pryor & Bigelow 2003, Hong et al. 2005, Pryor 

et al. 2009, Lawrence et al. 2012). Therefore, we only included the 

type species of both genera in our phylogenies and used them as 

outgroup in the Alternaria phylogeny. Pleospora herbarum with its 

Stemphylium herbarum (CBS 191.86) asexual morph is the type 

species of the genus Pleospora. Stemphylium botryosum with its 

Pleospora tarda (CBS 714.68) sexual morph is the type species of 

the genus Stemphylium. 

Embellisia annulata proved to be identical to the marine 

species Dendryphiella salina, and forms a well-supported clade 

in the Pleosporaceae together with D. arenariae. Several DNAbased 

studies (dela Cruz 2006, Jones et al. 2008, Zhang et al. 

2009) concluded that the marine Dendryphiella species, D. 

arenariae and D. salina, belonged to the Pleosporaceae as sister 

clade to the Pleospora/Stemphylium complex. Furthermore, 

they showed the type species of Dendryphiella, D. vinosa, to 

be only distantly related, based on sequences of the ITS, SSU, 

LSU (Jones et al. 2008) and ITS, TEF1, RPB2 (dela Cruz 2006) 

gene regions. The transfer of the marine Dendryphiella species to 

Scolecobasidium (Ellis 1976), was also disputed. Scolecobasidium 

does not belong to the Pleosporales based on ITS, TEF1, and 

RPB2 sequences (dela Cruz 2006) and the morphology of the two 

Dendryphiella species does not fit the generic circumscription of 

Scolecobasidium (dela Cruz 2006, Jones et al. 2008). Ellis (1976) 

described denticles on the conidiogenous cells when the conidia 

become detached. However other observers describe a marginal 

basal frill on the conidia after detachment, leaving a scar on the 

conidiophore. We propose to place the two species in the new 

genus Paradendryphiella as C. arenariae and C. salina. The need 

for a new genus to accommodate the two species was already 

suggested by Jones et al. (2008). 

A recent study on Diademaceae, a family which is characterised 

by a flat circular operculum and bitunicate asci (Shoemaker 

& Babcock 1992), excluded the sexual genera Comoclathris 

and Clathrospora, and (provisionally) placed them in the 

Pleosporaceae with alternaria-like asexual morphs (Zhang et al. 

2011). Molecular data of two strains (Dong et al. 1998, Schoch et 

al. 2009) placed them within the Pleosporaceae. A confusing factor 

is that Dong et al. (1998) use the name Comoclathris baccata in 

their paper for strain CBS 175.52, but submitted their sequences 

under the name Clathrospora diplospora to GenBank. Shoemaker 

& Babcock (1992) synonymised Clathrospora diplospora with 

Comoclathris baccata, which renders Comoclathris as the correct 

generic name. The confusion around these genera is illustrated 

by the fact that the CBS collection currently harbours six strains 

named as Clathrospora species of which four were renamed by 

Shoemaker & Babcock in 1992 based on morphological studies, 

and three of these four strains were even transferred to the genus 

Comoclathris. The type species of Clathrospora, C. elynae is 

represented by two strains of which one, CBS 196.54, was also 

studied morphologically by Shoemaker and Babcock (1992). They 

form a well-supported clade, located basal to the Pleosporaceae 

210


(Fig. 2), outside the Alternaria complex. The type species of 

Comoclathris, Comoclathris lanata, was not available to us, but 

the two Comoclathris compressa strains cluster together in a 

well-supported clade within the Pleosporaceae, also outside the 

Alternaria complex, which we believe to be the correct phylogenetic 

placement of the genus. Two other strains, named Comoclathris 

magna (CBS 174.52) and Clathrospora heterospora (CBS 

175.52) by Shoemaker and Babcock (1992), cluster amidst sect. 

Alternata. Culture studies performed by Simmons (1952) showed 

the presence of alternaria-like conidia in these cultures and no 

(mature) ascospore formation. Presumably the species observed 

by Shoemaker and Babcock (1992) on plant material were lost 

during cultivation and became replaced by A. alternata speciesgroup 

isolates. Both strains will be treated as “Alternaria sp.” 

The genus Alternariaster was first described by Simmons 

(2007) with Alternariaster helianthi, formerly Alternaria helianthi or 

Helminthosporium helianthi, as type and only species. It is distinct 

from Alternaria by the lack of a pigmented conspicuous internal, 

circumhilar ring in its conidia and conidiophores. Our study showed 

that this genus is clearly not part of the Alternaria complex and 

belongs to the Leptosphaeriaceae (Fig. 2) (Alves et al. 2013). 

In the recently published book “The genera of Hyphomycetes” 

(Seifert et al. 2011) three more genera are linked to Alternaria, 

namely Pantospora, Briansuttonia and Rhexoprolifer. A recent 

study on Pantospora included ITS and LSU sequence data of 

the type species Pantospora guazumae, which placed the genus 

in Mycosphaerellaceae (Minnis et al. 2011). This refutes the 

link with Alternaria. The genus Rhexoprolifer was described in 

1996 by Matsushima with R. variabilis as type and only species, 

isolated from South Africa. Rhexoprolifer variabilis has rhexolytic 

conidial liberation and proliferating conidiophores with both 

phragmosporous and dictyosporous conidia. Briansuttonia was 

described in 2004 to accommodate Corynespora alternarioides 

(Castañeda Ruiz et al. 2004). The distoseptate muriform conidia 

of Briansuttonia do resemble Alternaria and Stemphylium, but 

the conidiogenous loci and euseptate conidia of Alternaria and 

holoblastic conidial ontogeny and euseptate muriform conidia of 

Stemphylium were enough for the authors to regard their taxon as 

a different genus. Both asexual genera presently lack molecular 

data, and we were unable to obtain any living specimens of these 

taxa. It would be valuable to include both genera in a future study 

to resolve the connection among genera with muriform conidia 

and Alternaria. 

The description of Alternaria s. str. in the present study is 

supported by i) a well-supported phylogenetic node in multiple 

analyses, ii) high similarity of clades within Alternaria based on 

SSU, LSU and ITS data, and iii) variation in the order of the clades 

between the different gene phylogenies, which is in congruence 

with low support values at these deeper nodes. We follow the 

precedence introduced by Lawrence et al. (2013) to assign the 

taxonomic status of sections of Alternaria for the different clades 

found, thus allowing us to retain the former generic names but 

associated with a different taxonomic status. For end-users, this 

also results in a more stable and understandable taxonomy and 

nomenclature. 

DEDICATION 

We would like to dedicate this manuscript to the late Dr E.G. Simmons, who spent 

over 50 years of his life researching the systematics of the genus Alternaria. Without 

the time EGS spent on characterising the species included in this study, and his 

impeccable strain collection, which he placed in CBS for preservation and further 

study, the present study would not have been possible. 

Acknowledgements 

Mrs M. Vermaas is thanked for preparing the photoplates, Mrs J. Bloem for assisting 

with the molecular work, and Prof. dr B.M. Pryor for sending us the Undifilum 

isolate. This research was supported by the Dutch Ministry of Education, Culture 

and Science through an endowment of the FES programme “Making the tree of 

life work”. 

References 

Alves JL, Woudenberg JHC, Duarte LL, Crous PW, Barreto RW (2013). Reappraisal 

of the genus Alternariaster (Dothideomycetes). Persoonia 31: 77–85. 

Andersen B, Sørensen JL, Nielsen KF, Gerrits van den Ende AHG, Hoog GS de 

(2009). A polyphasic approach to the taxonomy of the Alternaria infectoria 

species-group. Fungal Genetics and Biology 46: 642–656. 

Baucom DL, Romero M, Belfon R, Creamer R (2012). Two new species of Undifilum, 

fungal endophytes of Astragalus (locoweeds) in the United States. Botany 90: 

866–875. 

Berbee ML, Pirseyedi M, Hubbard S (1999). Cochliobolus phylogenetics and 

the origin of known, highly virulent pathogens, inferred from ITS and 

glyceraldehyde-3-phosphate dehydrogenase gene sequences. Mycologia 91: 

964–977. 



Castañeda Ruiz RF, Heredia GP, Arias RM, Saikawa M, Minter DW, et al. (2004). 

Two new hyphomycetes from rainforests of México, and Briansuttonia, a new 

genus to accommodate Corynespora alternarioides. Mycotaxon 89: 297–305. 

Chou HH, Wu WS (2002). Phylogenetic analysis of internal transcribed spacer 

regions of the genus Alternaria, and the significance of filament-beaked 

conidia. Mycological Research 106: 164–169. 

Crous PW, Gams W, Stalpers JA, Robert V, Stegehuis G (2004). MycoBank: an 

online initiative to launch mycology into the 21 st century. Studies in Mycology 

50: 19–22. 

Crous PW, Verkley GJM, Groenewald JZ, Samson RA (eds) (2009a). Fungal 

Biodiversity. CBS laboratory Manual Series 1. CBS-KNAW Fungal Biodiversity 

Centre, Utrecht, The Netherlands. 

Crous PW, Schoch CL, Hyde KD, Wood AR, Gueidan C, et al. (2009b). Phylogenetic 


Crous PW, Braun U, Wingfield MJ, Wood AR, Shin HD, et al. (2009c). Phylogeny 

and taxonomy of obscure genera of microfungi. Persoonia 22: 139–161. 

Cruz TEE dela (2006). Marine Dendryphiella species from different geographical 

locations: an integrated, polyphasic approach to its taxonomy and 

physioecology. Ph.D. dissertation. Fakültat für Lebenswissenschaften der 

Technischen Universität Carolo-Wilhelmina, Braunschweig, Germany. 

Dong J, Chen W, Crane JL (1998). Phylogenetic studies of the Leptosphaeriaceae, 

Pleosporaceae and some other Loculoascomycetes based on nuclear 

ribosomal DNA sequences. Mycological Research 102: 151–156. 

Douady CJ, Delsuc F, Boucher Y, Doolittle WF, Douzery EJP (2003). Comparison 

of Bayesian and Maximum Likelihood Bootstrap Measures of Phylogenetic 

Reliability. Molecular Biology and Evolution 20: 248–254. 

Elliott JA (1917). Taxonomic characters of the genera Alternaria and Macrosporium. 

American Journal of Botany 4: 439–476. 

Ellis MB (1971). Dematiaceous hyphomycetes. Commonwealth Mycological 

Institute, Kew, UK. 

Ellis MB (1976). More dematiaceous hyphomycetes. Commonwealth Mycological 


Fries EM (1832). Systema mycologicum. vol. 3. E. Moritz, Greifswald, Germany. 

Hawksworth DL, Crous PW, Redhead SA, Reynolds DR, Samson RA, et al. (2011). 

The Amsterdam Declaration on Fungal Nomenclature. IMA Fungus 2: 105–112 

Hong SG, Cramer RA, Lawrence CB, Pryor BM (2005). Alt a 1 allergen homologs 

from Alternaria and related taxa: analysis of phylogenetic content and 

secondary structure. Fungal Genetics and Biology 42: 119–129. 

Hoog GS de, Rubio C (1982). A new dematiaceous fungus from human skin. 

Sabouradia 20: 15–20. 

Hoog GS de, Uijthof JMJ, Gerrits van den Ende AHG, Figge MJ, Weenink XO 

(1997). Comparative rDNA diversity in medically significant fungi. Microbiology 

and Culture Collections 13: 39–48. 




211


Hoog GS de, Horré R (2002). Molecular taxonomy of the Alternaria and Ulocladium 

species from humans and their identification in the routine laboratory. Mycoses 

45: 259–276. 



Inderbitzin P, Shoemaker RA, O’Neill NR, Turgeon BG, Berbee ML (2006). 

Systematics and mating systems of two fungal pathogens of opium poppy: the 

heterothallic Crivellia papaveracea with a Brachycladium penicillatum asexual 

state and a homothallic species with a Brachycladium papaveris asexual state. 

Canadian Journal of Botany 84: 1304–1326. 

James LF, Panter KE (1989). Locoweed poisoning in livestock. In: Swaisonine and 

related Glycosidase inhibitors (James LF, Elbein AD, Molyneux RJ, Warren CD, 

eds). Iowa State University Press, Ames, Iowa, USA: 23–38. 

Joly P (1964). Le genre Alternaria. Encyclopédie mycologique XXXIII, P. Lechevalier, 

Paris, France. 

Jones EBG, Klaysuban A, Pang K-L (2008). Ribosomal DNA phylogeny of marine 

anamorphic fungi: Cumulospora varia, Dendryphiella species and Orbimyces 

spectabilis. The Raffles Bulletin of Zoology Supplement 19: 11–18. 

Keissler K von (1912). Zur kenntnis der pilzflora krains. Beihefte zum Botanischen 

Zentralblatt 29: 395–440. 

Lawrence DP, Park MS, Pryor BM (2012). Nimbya and Embellisia revisited, with 

nov. comb for Alternaria celosiae and A. perpunctulata. Mycological Progress 

11: 799–815. 

Lawrence DP, Gannibal PB, Peever TL, Pryor BM (2013). The sections of Alternaria: 

Formalizing species-groups concepts. Mycologia 105: 530–546. 

Liu YJ, Whelen S, Hall BD (1999). Phylogenetic relationships among ascomycetes: 

evidence from an RNA polymerse II subunit. Molecular Biology and Evolution 

16: 1799–1808. 

Matsushima T (1996). Matsushima Mycological Memoirs No. 9. Matsushima Fungus 

Collection, Kobe (published by the author). 

Minnis AM, Kennedy AH, Grenier DB, Rehner SA, Bischoff JF (2011). Asperisporium 

and Pantospora (Mycosphaerellaceae): epitypifications and phylogenetic 

placement. Persoonia 27: 1–8. 

Nees von Esenbeck CG (1816). Das system der pilze und schwämme. Wurzburg, 

Germany. 

Nirenberg HI (1976). Untersuchungen über die morphologische und biologische 

Differenzierung in der Fusarium-Section Liseola. Mitteilungen aus der 

Biologischen Bundesanstalt für Land- und Forstwirtschaft Berlin-Dahlem 169: 

1–117. 

Norvell LL (2011). Fungal nomenclature. 1. Melbourne approves a new code. 

Mycotaxon 116: 481–490. 


of the fungus causing Panama disease of banana: Concordant evidence from 



Page RDM (1996). TreeView: an application to display phylogenetic trees on 

personal computers. Computer Applications in the Biosciences 12: 357–358. 

Preuss CGT (1851). Übersicht untersuchter pilze, besonders aus der Umgegend 

von Hoyerswerda. Linnaea 24: 99–153. 

Pryor BM, Gilbertson RL (2000). Molecular phylogenetic relationships amongst 

Alternaria species and related fungi based upon analysis of nuclear ITS and mt 

SSU rDNA sequences. Mycological Research 104: 1312–1321. 

Pryor BM, Bigelow DM (2003). Molecular characterization of Embellisia and Nimbya 

species and their relationship to Alternaria, Ulocladium and Stemphylium. 

Mycologia 95: 1141–1154. 

Pryor BM, Creamer R, Shoemaker RA, McLain-Romero J, Hambleton S (2009). 

Undifilum, a new genus for endophytic Embellisia oxytropis and parasitic 

Helminthosporium bornmuelleri on legumes. Botany 87: 178–194. 

Rayner RW (1970). A Mycological Colour Chart. Commonwealth Mycological 




Runa F, Park M, Pryor B (2009). Ulocladium systematics revisited: phylogeny and 

taxonomic status. Mycological Progress 8: 35–47. 

Saccardo PA (1886). Sylloge Fungorum Omnium hucusque cognitorum, Volume 4. 

Padua, Italy. 

Schoch CL, Crous PW, Groenewald JZ, Boehm EWA, Burgess TI, et al. (2009). A 

class-wide phylogenetic assessment of Dothideomycetes. Studies in Mycology 

64: 1–15. 

Seifert K, Morgan-Jones G, Gams W, Kendrick B (2011). The genera of 

Hyphomycetes. CBS Biodiversity Series 9. CBS Fungal Biodiversity Centre, 

Utrecht, The Netherlands. 

Shoemaker RA, Babcock CE (1992). Applanodictyosporous Pleosporales: 

Clathrospora, Comoclathris, Graphyllium, Macrospora, and Platysporoides. 

Canadian Journal of Botany 70: 1617–1658. 

Simmons EG (1952). Culture studies in the genera Pleospora, Clathrospora, and 

Leptosphaeria. Mycologia 44: 330–365. 

Simmons EG (1967). Typification of Alternaria, Stemphylium, and Ulocladium. 

Mycologia 59: 67–92. 

Simmons EG (1971). Helminthosporium allii as type of a new genus. Mycologia 

63: 380–386. 

Simmons EG (1983). An aggregation of Embellisia species. Mycotaxon 17: 216– 

241. 

Simmons EG (1986). Alternaria themes and variations (22–26). Pleospora/ 

Stemphylium and Lewia / Alternaria. Mycotaxon 25: 287–308. 

Simmons EG (1989). Macrospora Fuckel (Pleosporales) and related anamorphs. 

Sydowia 41: 314–329. 

Simmons EG (1990). Embellisia and related teleomorphs. Mycotaxon 38: 251–265. 

Simmons EG (2002). Alternaria themes and variations (287–304). Species on 

Caryophyllaceae. Mycotaxon 82: 1–40. 

Simmons EG (2007). Alternaria. An identification manual. CBS Biodiversity Series 6. 

CBS Fungal Biodiversity Centre, Utrecht, The Netherlands. 

Stamatakis A, Alachiotis N (2010). Time and memory efficient likelihood-based tree 

searches on phylogenomic alignments with missing data. Bioinformatics 26: 

i132–i139. 

Sterflinger K, Hoog GS de, Haase G (1999). Phylogeny and ecology of meristematic 

ascomycetes. Studies in Mycology 43: 5–22. 

Sung G-H, Sung J-M, Hywel-Jones NL, Spatafora JW (2007). A multi-gene 

phylogeny of Clavicipitaceae (Ascomycota, Fungi): Identification of localized 

incongruence using a combinational bootstrap approach. Molecular 

Phylogenetics and Evolution 44: 1204–1223. 

Svobodová Y (1966). Chmelia slovaca gen. nov., a dematiaceous fungus, 

pathogenic for man and animals. Biológia, Bratislava 21: 81–88. 

Togashi K (1926). On a new species of Alternaria causing a leafspot disease of 

Gomphrena globosa L. Bulletin of Imperial College of Agriculture and Forestry 

(Morioka) 9: 1–16. 

Toth B, Csosz M, Szabo-Hever A, Simmons EG, Samson RA, Varga J (2011). 

Alternaria hungarica sp. nov., a minor foliar pathogen of wheat in Hungary. 

Mycologia 103: 94–100. 




Xue F, Zhang XG (2007). Ulocladium capsicuma, a new species identified by 

morphological and molecular phylogenetic data. Sydowia 59: 161–178. 

Wallroth CFW (1833). Flora Cryptogamica Germaniae Sectio 2. J.L. Schrag, 

Nürnberg, Germany. 

Wang Y, Pei Y-F, O’Neill NR, Zhang X-G (2010). Ulocladium cantlous sp. nov. 

isolated from northwestern China: its morphology and molecular phylogenetic 

position. Mycologia 102: 374–383. 

Wang Y, Geng Y, Ma J, Wang Q, Zhang X-G (2011). Sinomyces: a new genus of 

anamorphic Pleosporaceae. Fungal Biology 115: 188–195. 




Academic Press, San Diego, California, USA: 315–322. 

Wiltshire SP (1933). The foundation species of Alternaria and Macrosporium. 


Wiltshire SP (1938). The original and modern conceptions of Stemphylium. 


Zhang Y, Schoch CL, Fournier J, Crous PW, Gruyter J de, et al. (2009). Multi-locus 

phylogeny of Pleosporales: a taxonomic, ecological and evolutionary reevaluation. 


Zhang YM, Koko TW, Hyde KD (2011). Towards a monograph of Dothideomycetes: 

Studies on Diademaceae. Cryptogamie, Mycologie 32: 115–126. 

212


A new approach to species delimitation in Septoria 

G.J.M. Verkley 1* , W. Quaedvlieg 1,2 , H.-D. Shin 3 , and P.W. Crous 1,2,4 

1 

CBS-KNAW Fungal Biodiversity Centre, Upssalalaan 8, 3584 CT, Utrecht, the Netherlands; 2 Microbiology, Department of Biology, Utrecht University, Padualaan 8, 3584 CH 

Utrecht, the Netherlands; 3 Division of Environmental Science and Ecological Engineering, Korea University, Seoul 136-701, Korea; 4 Wageningen University and Research 

Centre (WUR), Laboratory of Phytopathology, Droevendaalsesteeg 1, 6708 PB Wageningen, the Netherlands 

*Correspondence: G.J.M. Verkley, g.verkleij@cbs.knaw.nl 

Abstract: Septoria is a large genus of asexual morphs of Ascomycota causing leaf spot diseases of many cultivated and wild plants. Host specificity has long been a decisive 

criterium in species delimitation in Septoria, mainly because of the paucity of useful morphological characters and the high level of variation therein. This study aimed at 

improving the species delimitation of Septoria by adopting a polyphasic approach, including multilocus DNA sequencing and morphological analyses on the natural substrate 

and in culture. To this end 365 cultures preserved in CBS, Utrecht, The Netherlands, among which many new isolates obtained from fresh field specimens were sequenced. 

Herbarium material including many types was also studied. Full descriptions of the morphology in planta and in vitro are provided for 57 species. DNA sequences were 

generated for seven loci, viz. nuclear ITS and (partial) LSU ribosomal RNA genes, RPB2, actin, calmodulin, Btub, and EF. The robust phylogeny inferred showed that the 

septoria-like fungi are distributed over three main clades, establishing the genera Septoria s. str., Sphaerulina, and Caryophylloseptoria gen. nov. Nine new combinations 

and one species, Sphaerulina tirolensis sp. nov. were proposed. It is demonstrated that some species have wider host ranges than expected, including hosts from more than 

one family. Septoria protearum, previously only associated with Proteaceae was found to be also associated with host plants from six additional families of phanerogams and 

cryptogams. To our knowledge this is the first study to provide DNA-based evidence that multiple family-associations occur for a single species in Septoria. The distribution of 

host families over the phylogenetic tree showed a highly dispersed pattern for 10 host plant families, providing new insight into the evolution of these fungi. It is concluded that 

trans-family host jumping is a major force driving the evolution of Septoria and Sphaerulina. 

Key words: Evolution, host jumping, host specificity, Multilocus Sequence Typing (MLST), Mycosphaerella, Mycosphaerellaceae, new genus, new species, Pleosporales, 

Phloeospora, Septoria, Sphaerulina, taxonomy, systematics.. 

Taxonomic novelties: New genus – Caryophylloseptoria Verkley, Quaedvlieg & Crous; New species – Sphaerulina tirolensis Verkley, Quaedvlieg & Crous; New combinations 

– Caryophylloseptoria lychnidis (Desm.) Verkley, Quaedvlieg & Crous, Caryophylloseptoria silenes (Westend.) Verkley, Quaedvlieg & Crous, Caryophylloseptoria spergulae 

(Westend.) Verkley, Quaedvlieg & Crous, Sphaerulina aceris (Lib.) Verkley, Quaedvlieg & Crous, Sphaerulina cornicola (DC. : Fr.) Verkley, Quaedvlieg & Crous, Sphaerulina 

gei (Roberge ex Desm.) Verkley, Quaedvlieg & Crous, Sphaerulina hyperici (Roberge ex Desm.) Verkley, Quaedvlieg & Crous, Sphaerulina frondicola (Fr.) Verkley, Quaedvlieg 

& Crous, Sphaerulina socia (Pass.) Quaedvlieg, Verkley & Crous; Epitypifications (basionyms) – Ascochyta lysimachiae Lib., Septoria astragali Roberge ex Desm., Septoria 

cerastii Roberge ex Desm., Septoria clematidis Roberge ex Desm., Septoria cruciatae Roberge ex Desm., Septoria spergulae Westend., Septoria epilobii Westend., Septoria 

galeopsidis Westend., Septoria gei Roberge ex Desm., Septoria hyperici Roberge ex Desm., Septoria rubi Westend., Septoria senecionis Westend., Septoria urticae Roberge 

ex Desm. 

doi:10.3114/sim0018. Hard copy: June 2013. 


INTRODUCTION 

Fungi classified in the genus Septoria Sacc. are asexual morphs 

of Ascomycota causing leaf spot diseases on many cultivated and 

wild plants. Some 3000 Septoria names have been described in 

literature (Verkley et al. 2004a, b). Sexual morphs are unknown 

for most taxa, but those reported were mostly classified in 

Mycosphaerella and Sphaerulina (Von Arx 1983, Sutton & 

Hennebert 1994, Crous et al. 2000, Verkley & Priest 2000, Crous et 

al. 2001, Aptroot 2006). Several overviews of the taxonomic work 

done on these fungi have been provided in the literature (Shin & 

Sameva 2004, Priest 2006, Quaedvlieg et al. 2013). Priest (2006) 

discussed the complex nomenclatural history of Septoria. The type 

species of Septoria, S. cytisi, is a fungus occurring on the woody 

legume Cytisus laburnum (= Laburnum anagyroides) and several 

other, mostly herbaceous Fabaceae (Farr 1992, Muthumary 1999). 

The phylogenetic position of this species for which no cultures 

are available has for long been uncertain. However, using wellidentified 

herbarium material, Quaedvlieg et al. (2011) were able 


to extract DNA and successfully amplify and sequence nuclear 

ribosomal RNA genes to determine its position in a comprehensive 

phylogeny inferred for Mycosphaerellaceae. 

Most taxonomists adopted a generic concept of Septoria that 

included fungi forming pycnidial conidiomata with holoblastic, 

hyaline, smooth-walled conidiogenous cells with sympodial and/or 

percurrent proliferation and hyaline, smooth, filiform to cylindrical 

multi-septate conidia (Sutton 1980, Constantinescu 1984, Sutton & 

Pascoe 1987, 1989, Farr 1991, 1992). Similar fungi forming acervular 

conidiomata were classified in Phloeospora, with Phloeospora ulmi 

as the type species, yet some researchers adopted a broader 

concept to include Phloeospora in Septoria (Jørstad 1965, Von Arx 

1983, Andrianova 1987, Braun 1995). Recent DNA-sequencing 

studies have shown that the morphological characters that were 

used to delimit coelomycete genera in the past, in particular those 

pertaining to conidiomatal structure and conidiogenesis, did not 

correlate well with the sequence-inferred phylogenies (Crous et al. 

2001, Verkley et al. 2004a, b). Quaedvlieg et al. (2013) present in 

their broad-scope study the results of an in-depth morphological 


Attribution: 






213

Verkley et al. 

and multi-gene sequence analyses of the septoria-like genera 

based on numerous isolates (including S. cytisi). In their study, they 

resolve the affinities and settle the nomenclature of all important 

septoria-like genera in the Dothideales and Pleosporales. 

Host specificity has long been a decisive criterium in species 

delimitation in Septoria, mainly because of the paucity of useful 

morphological characters and the high level of variation therein. 

Traditionally, species of Septoria that were morphologically very 

similar but found on plants of different host families, were regarded 

as distinct taxa. Material from the same genus or from closely related 

host genera from the same plant family that could be distinguished 

by features such as conidial length and/or width and septation 

were usually also considered to belong to separate species. 

Most taxonomists revising Septoria lacked facilities to thoroughly 

investigate host ranges. A number of economically important 

Septoria species and species complexes have been subjected to 

infection experiments on various hosts, viz. the pathogens of Apium 

(Cochran 1932, Sheridan 1968) and cultivated Chrysanthemum 

(Waddell & Weber 1963, Punithalingam & Wheeler 1965). The 

results of these studies largely seemed to confirm the general belief 

that Septoria species have host ranges that are limited to a single 

genus of plants and in relatively few cases, also include a few closely 

related genera from the same plant family (Priest 2006). Molecular 

phylogenetic studies on Septoria species infecting Asteraceae 

(Verkley & Starink-Willemse 2004) and woody perennials (Feau et 

al. 2006) showed that species that are capable of infecting hosts 

of the same plant family do not (always) cluster in monophyletic 

groups, which is indicative of disjunct evolutionary patterns of these 

pathogens and their hosts. To explain these patterns, it has been 

postulated that “host jumping” occurs from typical (susceptible) 

hosts to “non-host” plants through asymptomatic tissue infection 

and subsequent exploration of new susceptible hosts. Examples 

of this were found in certain Mycosphaerella species and their 

Acacia hosts (Crous et al. 2004b, Crous & Groenewald 2005), but 

the mechanisms driving host jumping are not yet understood. With 

our study in which we investigate the phylogenetic relationships of 

species from a wider spectrum of host families we hope to provide 

more insight into the evolution of these fungal pathogens and their 

host plants and to contribute to understanding such mechanisms. 

Early molecular phylogenetic studies have confirmed the 

relationships of septoria-like fungi with sexual morphs within 

Mycosphaerellaceae, and that the septoria-like fungi are of poly- and 

paraphyletic origins (Stewart et al. 1999, Crous et al. 2001, Goodwin 

et al. 2001, Verkley et al. 2004a, b, Verkley & Starink-Willemse, 2004). 

The ITS and/or LSU nrDNA sequence data used in those studies 

did not provide sufficient phylogenetic information to discriminate 

closely related species nor resolve most of the internal nodes in the 

trees. Verkley et al. (2004a, b) already concluded that groups within 

the then known “Mycosphaerella clade” showed no correlation to 

conidiomatal structure or conidiogenesis, confirming the conclusions 

drawn by Crous et al. (2001). Feau et al. (2006) sequenced the ITS, 

partial β-tubulin gene, and a proportion of the mitochondrial small 

subunit ribosomal gene (mtSSU) to infer a phylogeny for Septoria 

associated with diseases of woody perennials (many of which 

are here transferred to Sphaerulina). Although their inferred trees 

provided improved resolution, it was clear that even more DNA loci 

would be needed to fully resolve closely related species and species 

complexes within Septoria s. str. 

The primary goal of our work was to improve the taxonomy of 

Septoria by adopting a polyphasic approach to taxon delimitation. 

To this end we studied cultures preserved in CBS, Utrecht, the 

Netherlands and material freshly collected in the field, did a full 

characterisation of the morphology in planta and in vitro, and 

sequenced seven DNA loci, viz. nuclear ITS and (partial) LSU 

ribosomal RNA genes, and RPB2, actin (Act), calmodulin (Cal), 

β-tubulin (Btub), and translation elongation factor 1-alpha (EF) 

genes. The obtained datasets of the seven loci were also evaluated 

for PCR amplification success rates and barcode gaps in order to 

determine which individual, or combination of loci, would be best 

suited for fast and reliable species resolution and identification. 

Most students of Septoria have focused on material on the natural 

substrate and did not isolate and deposit cultures in public culture 

collections. Of all material we were able to successfully isolate, 

cultures were deposited in CBS-KNAW Fungal Biodiversity Centre 

(CBS) in Utrecht, The Netherlands. To assess the nomenclature 

this material was compared to type material as far as it could be 

obtained for study. Where useful new material and associated pure 

cultures were designated as epitypes, to facilitate future work. This 

study supplements the work of Quaedvlieg et al. (2013), who attain 

a broader perspective and address the complicated taxonomy and 

polyphyly of septoria-like fungi, proposing several new genera for 

taxa that are distantly related to Septoria cytisi and allied species. 

MATERIAL AND METHODS 

Collecting, isolating and morphological comparison 

Infected plant material was collected in the field and taken 

to the laboratory. Leaves were examined directly under a 

stereomicroscope to observe sporulating structures, or when 

insufficiently developed, incubated in a Petri-dish with wetted filter 

paper for 1–2 d to enhance the development of fruiting bodies. 

Cirrhi of spores were removed and mounted in tapwater for the 

microscopic examination of conidia. Isolates were obtained by 

either transferring cirrhi directly onto 3 % malt extract agar (MEA, 

Oxoid) plates with 50 ppm penicillin and streptomycin, and streaked 

over the agar surface with an inoculation loop and some sterile 

water. Sometimes conidia in water from slide preparations were 

taken with a loop and streaked directly onto a plate. After 1–3 d 

at room temperature, germinated conidia were transferred on to 

fresh media without antibiotics. New isolates were deposited in the 

CBS. Cultures taken from the CBS Collection were activated from 

lyophilised or cryopreserved material and inoculated on oatmeal 

(OA) and MEA plates. A complete overview of the material used in 

this study is presented in Table 1. 

For the morphological study in planta hand sections were 

made from infected leaves, mounted in water and examined 

under an Olympus BX 50 microscope equipped with bright 

field and differential interference contrast (DIC) objectives, and 

photographed using a mounted Nikon Digital Sight DS-5M camera. 

Conidial masses were mounted in water and 30 spores measured. 

For culture studies, 7–14-d-old cultures were transferred to fresh 

OA, MEA and cherry decoction agar (CHA) plates and placed in an 

incubator under n-UV light (12 h light, 12 h dark) at 15 ºC to promote 

sporulation (if otherwise, this is indicated in the descriptions). Media 

were prepared according to Crous et al. (2009). Colony colours 

were described according to Rayner (1970). Sporulating structures 

obtained from cultures were used for the morphological description 

in vitro. Photographs of culture plates were taken after 2–3 wk 

on a photo stand with daylight tubes with a Pentax K110 D digital 

camera. Cultures were incubated up to 40 d to observe sporulation 

and other features. 

214


DNA isolation, PCR and sequencing 

Genomic DNA was extracted from fungal mycelium growing on 

MEA, using the UltraClean® Microbial DNA Isolation Kit (Mo 

Bio Laboratories, Inc., Solana Beach, CA, USA). Strains (Table 

1) were sequenced for seven loci: Actin (Act), calmodulin (Cal), 

β-tubulin (Btub), internal transcribed spacer (ITS), Translation 

elongation factor 1-alpha (EF) 28S nrDNA (LSU) and RNA 

polymerase II second largest subunit (RPB2); the primer sets 

listed in Table 2 were used. The PCR amplifications were 

performed in a total volume of 12.5 µL solution containing 

10–20 ng of template DNA, 1 × PCR buffer, 0.7 µL DMSO 

(99.9 %), 2 mM MgCl 2 

, 0.4 µM of each primer, 25 µM of each 

dNTP and 1.0 U Taq DNA polymerase (GoTaq, Promega). 

PCR amplification conditions were set as follows: an initial 

denaturation temperature of 96 °C for 2 min, followed by 40 

cycles at the denaturation temperature of 96 °C for 45 s, primer 

annealing at the temperature stipulated in Table 2, primer 

extension at 72 °C for 90 s and a final extension step at 72 °C for 

2 min. The resulting fragments were sequenced using the PCR 

primers together with a BigDye Terminator Cycle Sequencing 

Kit v. 3.1 (Applied Biosystems, Foster City, CA). Sequencing 

reactions were performed as described by Cheewangkoon et al. 

(2008). All novel sequences were deposited in NCBI’s GenBank 

database and alignments and phylogenetic trees in TreeBASE. 

Sequence alignement and phylogenetic analyses 

A basic alignment of the obtained sequence data was first done 

using MAFFT v. 7 (http://mafft.cbrc.jp/alignment /server/index. html; 

Katoh et al. 2002) and if necessary, manually improved in BioEdit 

v. 7.0.5.2 (Hall 1999). To check the congruency of the multigene 

dataset, a 70 % neighbour-joining (NJ) reciprocal bootstrap 

method with maximum likelihood distance was performed (Mason- 

Gamer & Kellogg 1996, Lombard et al. 2010). Bayesian analyses 

(critical value for the topological convergence diagnostic set to 

0.01) were performed on the concatenated loci using MrBayes v. 

3.2.1 (Huelsenbeck & Ronquist 2001) as described by Crous et 

al. (2006a) using nucleotide substitution models that were selected 

using MrModeltest (Table 3) (Nylander 2004). 

Kimura-2-parameter values 

The inter-and intraspecific distances for each individual dataset 

were calculated using MEGA v. 4.0 (Tamura et al. 2007) with the 

Kimura-2-parameter (pairwise deletion) model. 

RESULTS 

Identification of the best DNA barcode loci for 

Septoria species 

Amplification success 

The PCR amplification success rates were very high for all seven 

loci, varying from 97 % for RPB2 to 100 % for ITS and LSU (Table 

3). Good amplification reactions of RPB2 required a 2–3 times 

higher DNA input then the other loci and this locus is therefore less 

favorable for easy identification. The other six loci amplified without 

problems. 

Kimura-2-parameter values 

The Kimura-2-parameter (K2P) distribution graphs are depicted in 

Fig. 1. They visualise the inter- and intraspecific distances per locus 

(barcoding gap). A good barcoding locus should have no overlap 

between the inter- and intraspecific K2P distances and should have 

an average interspecific distance that is at least 10 times as high as 

the average intraspecific distance of that locus (Hebert et al. 2003). 

The seven loci show a rather constant degree of intraspecific variation 

of 0.01 in their K2P distribution graphs, however their interspecific 

variations shows considerable differences. The average interspecific 

variation in both ITS and LSU datasets is very low (0.015) compared 

to their intraspecific variation (0.01), leading to a very low inter- to 

intraspecific variation ratios of 1.5 : 1 for these two loci (Fig. 1). 

These low ratios are far below the required 10 : 1 ratio, indicating a 

general lack of natural variation within these two loci, making them illsuited 

for effective identification of the individual species used in this 

dataset. These low K2P results for ITS and LSU are consistent with 

Frequency 

Frequency 

Frequency 

1200 

1000 

800 

600 

400 

200 

0 

1400 

1200 

1000 

800 

600 

400 

200 

0 

7000 

6000 

5000 

4000 

3000 

2000 

1000 

0 

Distance 

Distance 

Distance 

Inter RPB2 

Inter Tub 

Inter EF 

Intra RPB2 

Intra Tub 

Intra EF 

Inter Act 

Inter Cal 

Intra Act 

Intra Cal 

Inter ITS 

Inter LSU 

Intra ITS 

Intra LSU 

Fig. 1. Frequency distributions of the Kimura-2-parameter distances (barcoding 

gaps) for the seven PCR loci. 


215


Table 1. Isolates used during this study. 

Species Old name Isolate no 1 Host Location Collector GenBank Accession no 2 

Caryophylloseptoria 

lychnidis 

EF Tub RPB2 LSU ITS Act Cal 

Septoria lychnidis CBS 109098 Silene pratensis Austria G.J.M. Verkley KF253234 KF252768 KF252292 KF251790 KF251286 KF253595 KF253949 




Car. pseudolychnidis Septoria lychnidis CBS 128614 Lychnis cognata South Korea H.D. Shin KF253238 KF252772 KF252296 KF251794 KF251290 KF253599 KF253953 

Septoria lychnidis CBS 128630 Lychnis cognata South Korea H.D. Shin KF253239 KF252773 KF252297 KF251795 KF251291 KF253600 KF253954 

Car. silenes Septoria silenes CBS 109100 Silene nutans Austria G.J.M. Verkley KF253240 KF252774 KF252298 KF251796 KF251292 KF253601 KF253955 

Septoria silenes CBS 109103 Silene pratensis Austria G.J.M. Verkley KF253241 KF252775 KF252299 KF251797 KF251293 KF253602 KF253956 

Car. spergulae Septoria sp. CBS 109010 Spergula morisonii Netherlands A. Aptroot KF253242 KF252776 KF252300 KF251798 KF251294 KF253603 KF253957 

Septoria dianthi CBS 397.52 Dianthus caryophyllus Netherlands Schouten KF253243 KF252777 KF252301 KF251799 KF251295 KF253604 KF253958 

Cercospora apii – CBS 118712 – Fiji P. Tyler KF253244 KF252778 KF252302 KF251800 KF251296 KF253605 KF253959 

Cer. ariminensis – CBS 137.56 Hedysarum coronarium Italy M. Ribaldi KF253245 KF252779 KF252303 KF251801 KF251297 KF253606 KF253960 

Cer. beticola – CBS 124.31 – Romania E.W. Schmidt KF253246 KF252780 KF252304 KF251802 KF251298 KF253607 KF253961 

Cercospora sp. – CBS 112737 Rhus typhina Canada K.A. Seifert KF253247 KF252781 – KF251803 KF251299 KF253608 KF253962 

Cer. zebrina – CBS 118790 Trifolium subterraneum Australia M.J. Barbetti KF253248 KF252782 KF252305 KF251804 KF251300 KF253609 KF253963 

Cercosporella 

– CBS 113304 Erigeron annuus South Korea H.D. Shin KF253249 – KF252306 KF251805 KF251301 KF253610 KF253964 

virgaureae 

Dothistroma pini – CBS 121011 Pinus palassiana Ukraine A.C. Usichenko KF253250 – KF252307 KF251806 KF251302 KF253611 KF253965 

Dot. septosporum – CBS 383.74 Pinus coulteri France M. Morelet KF253251 – KF252308 KF251807 KF251303 KF253612 KF253966 

Mycosphaerella 

– CBS 228.32 Brassica oleracea Denmark C.A. Jörgensen KF253252 KF252783 KF252309 KF251808 KF251304 KF253613 KF253967 

brassicicola 

– CBS 267.53 Brassica oleracea Netherlands F. Quak KF253253 KF252784 KF252310 KF251809 KF251305 KF253614 KF253968 

Myc. capsellae – CBS 112033 Brassica sp. UK R. Evans KF253254 KF252785 KF252311 KF251810 KF251306 KF253615 KF253969 

Mycosphaerella sp. CBS 135464; Brassica sp. UK R. Evans – KF252786 KF252312 KF251811 KF251307 KF253616 KF253970 

CPC 11677 

Passalora depressa – CPC 14915 Angelica gigas South Korea H.D. Shin KF253256 KF252788 KF252314 KF251813 KF251309 – KF253972 

Pas. dioscoreae – CBS 135460; Dioscorea tokora South Korea H.D. Shin KF253257 KF252789 KF252315 KF251814 KF251310 KF253618 – 

CPC 10855 

– CBS 135463; Dioscorea tenuipes South Korea H.D. Shin KF253258 KF252790 KF252316 KF251815 KF251311 KF253619 – 

CPC 11513 

Pas. dissiliens – CBS 219.77 Vitis vinifera Iraq M.S.A. Al-Momen KF253259 KF252791 KF252317 KF251816 KF251312 KF253620 – 

Pas. fusimaculans – CPC 17277 Agrostis sp. Thailand Pheng Pheng KF253260 KF252792 KF252318 KF251817 KF251313 KF253621 KF253973 

Pas. janseana – CBS 145.37 – – E.C. Tullis KF253261 KF252793 – KF251818 KF251314 KF253622 KF253974 

216





Passalora sp. – CBS 113998 Cajanus cajan South Africa L. van Jaarsveld KF253262 KF252794 KF252319 KF251819 KF251315 KF253623 – 

Passalora sp. – CBS 113999 Cajanus cajan South Africa L. van Jaarsveld KF253263 KF252795 KF252320 KF251820 KF251316 KF253624 – 

Passalora sp. – CBS 114275 Cajanus cajan South Africa L. van Jaarsveld KF253264 KF252796 KF252321 KF251821 KF251317 – – 

Pseudocercospora – CBS 124155 Eucalyptus camaldulensis Madagascar M.J. Wingfield KF253265 – KF252322 KF251822 KF251318 KF253625 – 

madagascariensis 

Pse. pyracanthae – CPC 10808 Pyracantha angustifolia South Korea H.D. Shin KF253266 – KF252323 KF251823 KF251319 KF253626 – 

Pse. pyracanthigena – CBS 112032 Pyracantha angustifolia South Korea M.J. Park KF253267 KF252797 KF252324 KF251824 KF251320 KF253627 KF253975 

Pse. rhoina – CPC 11464 Rhus chinensis South Korea H.D. Shin KF253268 – KF252325 KF251825 KF251321 – – 

Pse. schizolobii – CBS 120029 Schizolobium parahybum Ecuador M.J. Wingfield KF253269 KF252798 KF252326 KF251826 KF251322 KF253628 – 

– CBS 124990 Eucalyptus camaldulensis Thailand W. Himaman KF253270 – KF252327 KF251827 KF251323 KF253629 – 

Pse. tereticornis – CBS 124996 Eucalyptus nitens Australia A.J. Cargenie KF253271 KF252799 KF252328 KF251828 KF251324 KF253630 KF253976 

C.F. Hill KF253272 KF252800 KF252329 KF251829 KF251325 KF253631 KF253977 

Pseudocercosporella 

capsellae 

– CBS 118412 Brassica sp. New 

Zealand 

– CBS 127.29 – – K. Togashi KF253273 KF252801 KF252330 KF251830 KF251326 KF253632 KF253978 

Pella. magnusiana – CBS 114735 Geranium silvaticum Sweden E. Gunnerbeck KF253274 KF252802 – KF251831 KF251327 – KF253979 

Pella. pastinacae – CBS 114116 Laserpitium latifolium Sweden K. & L. Holm KF253275 KF252803 KF252331 KF251832 KF251328 KF253633 KF253980 

Ramularia endophylla – CBS 113265 Quercus robur Netherlands G.J.M. Verkley KF253276 – KF252332 KF251833 KF251329 KF253634 KF253981 

Ram. eucalypti – CBS 120726 Eucalyptus grandiflora Italy W. Gams KF253277 – KF252333 KF251834 KF251330 KF253635 KF253982 

Ram. lamii – CPC 11312 Leonurus sibiricus South Korea H.D. Shin KF253278 – KF252334 KF251835 KF251331 KF253636 KF253983 

Readeriella mirabilis – CBS 125000 Eucalyptus globulus Australia I.W. Smith KF253279 KF252804 KF252335 KF251836 KF251332 KF253637 KF253984 

Septoria abei – CBS 128598 Hibiscus syriacus South Korea H.D. Shin KF253280 KF252805 KF252336 KF251837 KF251333 KF253638 KF253985 

Sep. aegopodina – CBS 123740 Aegopodium podagraria Czech G.J.M. Verkley KF253281 KF252806 – KF251838 KF251334 KF253639 KF253986 

Republic 

– CBS 123741 Aegopodium podagraria Czech G.J.M. Verkley KF253282 KF252807 – KF251839 KF251335 KF253640 KF253987 

Republic 

Sep. agrimoniicola – CBS 128585 Agrimonia pilosa South Korea H.D. Shin KF253283 KF252808 KF252337 KF251840 KF251336 KF253641 KF253988 

– CBS 128602 Agrimonia pilosa South Korea H.D. Shin KF253284 KF252809 KF252338 KF251841 KF251337 – KF253989 

Sep. anthrisci – CBS 109019 Anthriscus sp. Austria G.J.M. Verkley KF253285 KF252810 KF252339 KF251842 KF251338 KF253642 KF253990 

– CBS 109020 Anthriscus sp. Austria G.J.M. Verkley KF253286 KF252811 KF252340 KF251843 KF251339 KF253643 KF253991 

Sep. anthurii – CBS 148.41 Anthurium sp. – P. Kotthoff KF253287 KF252812 KF252341 KF251844 KF251340 KF253644 KF253992 

– CBS 346.58 Anthurium sp. Germany R. Schneider KF253288 KF252813 KF252342 KF251845 KF251341 KF253645 KF253993 

Sep. apiicola – CBS 116465 Apium graveolens Netherlands R. Munning KF253289 KF252814 KF252343 KF251846 KF251342 KF253646 KF253994 

– CBS 389.59 Apium graveolens Italy M. Ribaldi KF253290 KF252815 KF252344 KF251847 KF251343 KF253647 KF253995 

– CBS 395.52 Apium sp. Netherlands G. van den Ende KF253291 KF252816 KF252345 KF251848 KF251344 KF253648 KF253996 


217





– CBS 400.54 Apium graveolens Netherlands J.A. von Arx KF253292 KF252817 KF252346 KF251849 KF251345 KF253649 KF253997 

Sep. astericola – CBS 128587 Aster tataricus South Korea H.D. Shin KF253293 KF252818 KF252347 KF251850 KF251346 KF253650 KF253998 

– CBS 128593 Aster yomena South Korea H.D. Shin KF253294 KF252819 KF252348 KF251851 KF251347 KF253651 KF253999 

Sep. astragali – CBS 109117 Astragalus glycyphyllos Austria G.J.M. Verkley KF253296 KF252821 KF252350 KF251853 KF251349 KF253653 KF254001 

– CBS 123878 Astragalus glycyphyllos Czech G.J.M. Verkley KF253297 KF252822 KF252351 KF251854 KF251350 KF253654 KF254002 

Republic 

– CBS 109116 Astragalus glycyphyllos Austria G.J.M. Verkley KF253298 KF252823 KF252352 KF251855 KF251351 KF253655 KF254003 

Sep. atropurpurea – CBS 348.58 Aster canus Germany R. Schneider KF253299 KF252824 KF252353 KF251856 KF251352 KF253656 KF254004 

Sep. bothriospermi – CBS 128592 Bothriospermum tenellum South Korea H.D. Shin KF253300 KF252825 KF252354 KF251857 KF251353 KF253657 KF254005 

– CBS 128599 Bothriospermum tenellum South Korea H.D. Shin KF253301 KF252826 KF252355 KF251858 KF251354 KF253658 KF254006 

Sep. bupleuricola – CBS 128601 Bupleurum longiradiatum South Korea H.D. Shin KF253302 KF252827 KF252356 KF251859 KF251355 KF253659 KF254007 

– CBS 128603 Bupleurum falcatum South Korea H.D. Shin KF253303 KF252828 KF252357 KF251860 KF251356 KF253660 KF254008 

Sep. calendulae – CBS 349.58 Calendula arvensis Italy R. Schneider KF253304 KF252829 KF252358 KF251861 KF251357 KF253661 KF254009 

Sep. callistephi – CBS 128590 Callistephus chinensis South Korea H.D. Shin KF253305 KF252830 KF252359 KF251862 KF251358 KF253662 KF254010 

– CBS 128594 Callistephus chinensis South Korea H.D. Shin KF253306 KF252831 KF252360 KF251863 KF251359 KF253663 KF254011 

Sep. campanulae – CBS 128589 Campanula takesimana South Korea H.D. Shin KF253307 KF252832 KF252361 KF251864 KF251360 KF253664 KF254012 

– CBS 128604 Campanula takesimana South Korea H.D. Shin KF253308 KF252833 KF252362 KF251865 KF251361 KF253665 KF254013 

Sep. cerastii – CBS 102323 Cerastium fontanum Netherlands G.J.M. Verkley KF253309 KF252834 KF252363 KF251866 KF251362 KF253666 KF254014 

– CBS 128586 Cerastium holosteoides South Korea H.D. Shin KF253310 KF252835 KF252364 KF251867 KF251363 KF253667 KF254015 



– CPC 12343 Cerastium holosteoides South Korea H.D. Shin KF253313 KF252838 KF252367 KF251870 KF251366 KF253670 KF254018 

Sep. cf. rubi Septoria sp. CPC 12331 Rubus crataegifolius South Korea H.D. Shin KF253317 KF252842 KF252371 KF251874 KF251370 KF253674 KF254022 

Septoria rubi CBS 128646 Rubus crataegifolius South Korea H.D. Shin KF253314 KF252839 KF252368 KF251871 KF251367 KF253671 KF254019 



Sep. cf. sonchi – CBS 128757 Sonchus asper South Korea H.D. Shin KF253500 KF253020 KF252546 KF252057 KF251552 KF253855 KF254204 

Sep. cf. stachydicola Septoria lycopicola CBS 128662 Stachys riederi South Korea H.D. Shin KF253513 KF253034 KF252559 KF252071 KF251566 KF253867 KF254218 

Sep. chamaecisti – CBS 350.58 Helianthemum hybridum Germany R. Schneider KF253318 KF252843 KF252372 KF251875 KF251371 KF253675 KF254023 

Sep. chelidonii – CBS 128607 Chelidonium majus South Korea H.D. Shin KF253319 KF252844 KF252373 KF251876 KF251372 KF253676 KF254024 

– CPC 12337 Chelidonium majus South Korea H.D. Shin KF253320 KF252845 KF252374 KF251877 KF251373 KF253677 KF254025 

Sep. chromolaenae – CBS 113373 Chromolaena odorata Cuba S. Neser KF253321 KF252846 KF252375 KF251878 KF251374 KF253678 KF254026 

218




Sep. chrysanthemella – CBS 128617 Chrysanthemum 

morifolium 


South Korea H.D. Shin KF253322 KF252847 KF252376 KF251879 KF251375 KF253679 KF254027 

– CBS 128622 Chrysanthemum boreale South Korea H.D. Shin KF253323 KF252848 KF252377 KF251880 KF251376 KF253680 KF254028 

– CBS 483.63 Chrysanthemum sp. Netherlands H.A. van der Aa KF253324 KF252849 KF252378 KF251881 KF251377 KF253681 KF254029 

– CBS 128716 – South Africa E. Oh KF253325 KF252850 KF252379 KF251882 KF251378 KF253682 KF254030 

– CBS 351.58 Chrysanthemum indicum Germany R. Schneider KF253326 KF252851 KF252380 KF251883 KF251379 KF253683 KF254031 

– CBS 354.73 Chrysanthemum 

morifolium 

New 

Zealand 

G.F. Laundon KF253327 KF252852 KF252381 KF251884 KF251380 KF253684 KF254032 

Sep. cirsii – CBS 128621 Cirsium setidens South Korea H.D. Shin KF253328 KF252853 KF252382 KF251885 KF251381 KF253685 KF254033 

Sep. citri (= protearum 

complex) 

Septoria orchidearum CBS 101013 Masdevallia sp. Netherlands W. Veenbaas-Rijks KF253457 KF252978 KF252504 KF252013 KF251508 KF253812 KF254161 

Septoria sp. CBS 101354 Gevuina avellana New 

Zealand 

S. Ganev KF253458 KF252979 KF252505 KF252014 KF251509 KF253813 KF254162 

Septoria lobeliae CBS 113392 Lobelia erinus – S. Wolcon KF253460 KF252981 KF252507 KF252016 KF251511 KF253815 KF254164 

Septoria aciculosa CBS 177.77 Fragaria sp. New 

Zealand 

H.J. Boesewinkel KF253463 KF252984 KF252509 KF252019 KF251514 KF253818 KF254167 

Septoria citri CBS 315.37 – – L.L. Huillier KF253465 – KF252511 KF252021 KF251516 KF253820 KF254169 

Septoria gerberae CBS 410.61 Gerbera jamesonii Italy W. Gerlach KF253468 KF252988 KF252514 KF252024 KF251519 KF253823 KF254172 

Septoria hederae CBS 566.88 Hedera helix France H.A. van der Aa KF253470 KF252990 KF252515 KF252026 KF251521 KF253825 KF254174 

Sep. citricola – CBS 356.36 Citrus sinensis Italy G. Ruggieri KF253329 KF252854 KF252383 KF251886 KF251382 KF253686 KF254034 

Sep. clematidis – CBS 108983 Clematis vitalba Germany G.J.M. Verkley KF253330 KF252855 KF252384 KF251887 KF251383 KF253687 KF254035 

– CBS 108984 Clematis vitalba Germany G.J.M. Verkley KF253331 KF252856 KF252385 KF251888 KF251384 KF253688 KF254036 

Sep. codonopsidis – CBS 128609 Codonopsis lanceolata South Korea H.D. Shin KF253332 KF252857 KF252386 KF251889 KF251385 KF253689 KF254037 

– CBS 128620 Codonopsis lanceolata South Korea H.D. Shin KF253333 KF252858 KF252387 KF251890 KF251386 KF253690 KF254038 

Sep. convolvuli – CBS 102325 Calystegia sepium Netherlands G.J.M. Verkley KF253334 KF252859 KF252388 KF251891 KF251387 KF253691 KF254039 

– CBS 113111 Calystegia sepium New 

G.J.M. Verkley KF253335 KF252860 KF252389 KF251892 KF251388 KF253692 KF254040 

Zealand 

– CBS 128627 Calystegia soldanella South Korea H.D. Shin KF253336 KF252861 KF252390 KF251893 KF251389 KF253693 KF254041 

Sep. coprosmae – CBS 113391 Coprosma robusta New 

Zealand 


Sep. crepidis – CPC 12539 Crepis japonica South Korea H.D. Shin KF253339 KF252864 KF252393 KF251896 KF251392 KF253696 KF254044 

– CBS 128608 Youngia japonica South Korea H.D. Shin KF253337 KF252862 KF252391 KF251894 KF251390 KF253694 KF254042 

– CBS 128619 Youngia japonica South Korea H.D. Shin KF253338 KF252863 KF252392 KF251895 KF251391 KF253695 KF254043 


219




Sep. cruciatae Septoria sp. CBS 123747 Galium odoratum Czech 

Republic 

Septoria sp. CBS 123748 Galium odoratum Czech 

Republic 




Sep. cucubali – CBS 102367 Cucubalus baccifer Netherlands G.J.M. Verkley KF253342 KF252867 KF252396 KF251899 KF251395 KF253699 KF254047 

– CBS 102368 Cucubalus baccifer Netherlands G.J.M. Verkley KF253343 KF252868 KF252397 KF251900 KF251396 KF253700 KF254048 

– CBS 102386 Saponaria officinalis Netherlands G.J.M. Verkley KF253344 KF252869 KF252398 KF251901 KF251397 KF253701 KF254049 

Septoria sp. CBS 124874 Fagus sylvatica Germany M. Unterseher KF253345 KF252870 KF252399 KF251902 KF251398 KF253702 KF254050 

Sep. cucurbitacearum – CBS 178.77 Cucurbita maxima New 

Zealand 

H.J. Boesewinkel KF253346 – KF252400 KF251903 KF251399 KF253703 KF254051 

Sep. dearnessii – CBS 128624 Angelica dahurica South Korea H.D. Shin KF253347 KF252871 KF252401 KF251904 KF251400 KF253704 KF254052 

Sep. digitalis – CBS 328.67 Digitalis lanata Netherlands H.A. van der Aa KF253348 KF252872 KF252402 KF251905 KF251401 KF253705 KF254053 

– CBS 391.63 Digitalis lanata Czech V. Holubová KF253349 KF252873 KF252403 KF251906 KF251402 KF253706 KF254054 

Republic 

Sep. dolichospora – CBS 129152 Solidago virgaurea South Korea H.D. Shin KF253350 KF252874 – KF251907 KF251403 KF253707 KF254055 

Sep. dysentericae – CBS 128637 Inula britannica South Korea H.D. Shin KF253351 KF252875 KF252404 KF251908 KF251404 KF253708 KF254056 

– CBS 128638 Inula britannica South Korea H.D. Shin KF253352 KF252876 KF252405 KF251909 KF251405 KF253709 KF254057 

– CBS 131892; 

CPC 12328 

Inula britannica South Korea H.D. Shin KF253353 KF252877 KF252406 KF251910 KF251406 KF253710 KF254058 

Sep. ekmaniana – CBS 113385 Chromolaena odorata Mexico M.J. Morris KF253354 KF252878 – KF251911 KF251407 KF253711 KF254059 

– CBS 113612 Chromolaena odorata Mexico M.J. Morris KF253355 KF252879 – KF251912 KF251408 KF253712 KF254060 

Sep. epambrosiae – CBS 128629 Ambrosia trifida South Korea H.D. Shin KF253356 KF252880 KF252407 KF251913 KF251409 KF253713 KF254061 

– CBS 128636 Ambrosia trifida South Korea H.D. Shin KF253357 KF252881 KF252408 KF251914 KF251410 KF253714 KF254062 

Sep. epilobii – CBS 109084 Epilobium fleischeri Austria G.J.M. Verkley KF253358 KF252882 KF252409 KF251915 KF251411 KF253715 KF254063 

– CBS 109085 Epilobium fleischeri Austria G.J.M. Verkley KF253359 KF252883 KF252410 KF251916 KF251412 KF253716 KF254064 

Sep. erigerontis – CBS 109094 Erigeron annuus Austria G.J.M. Verkley KF253360 KF252884 KF252411 KF251917 KF251413 KF253717 KF254065 

– CBS 109095 Erigeron annuus Austria G.J.M. Verkley KF253361 KF252885 KF252412 KF251918 KF251414 KF253718 KF254066 

– CBS 128606 Erigeron annuus South Korea H.D. Shin KF253362 KF252886 KF252413 KF251919 KF251415 KF253719 KF254067 

– CBS 131893; 

CPC 12340 

Erigeron annuus South Korea H.D. Shin KF253363 KF252888 KF252414 KF251920 KF251416 KF253720 KF254068 

Septoria schnabliana CBS 186.93 Erigeron annuus Italy M. Vurro KF253364 KF252887 KF252537 KF252048 KF251543 KF253893 KF254244 

Sep. eucalyptorum – CBS 118505 Eucalyptus sp. India W. Gams KF253365 KF252889 KF252415 KF251921 KF251417 KF253721 KF254069 

Sep. exotica – CBS 163.78 Hebe speciosa New 


Zealand 

220




Sep. galeopsidis – CBS 123744 Galeopsis sp. Czech 

Republic 

– CBS 123746 Galeopsis sp. Czech 

Republic 


Republic 





– CBS 191.26 Galeopsis sp. – C. Killian KF253370 KF252894 KF252420 KF251926 KF251422 KF253726 KF254074 

– CBS 102314 Galeopsis tetrahit Netherlands G.J.M. Verkley KF253371 KF252895 KF252421 KF251927 KF251423 KF253727 KF254075 

– CBS 102411 Galeopsis tetrahit Netherlands G.J.M. Verkley KF253372 KF252896 KF252422 KF251928 KF251424 KF253728 KF254076 


Republic 


Sep. gentianae – CBS 128633 Gentiana scabra South Korea H.D. Shin KF253374 KF252898 KF252424 KF251930 KF251426 KF253730 KF254078 

Sep. gladioli – CBS 121.20 – – – KF253375 KF252899 KF252425 KF251931 KF251427 KF253731 KF254079 

– CBS 353.29 – Netherlands J.C. Went KF253376 KF252900 KF252426 KF251932 KF251428 KF253732 KF254080 

Sep. glycines – CBS 336.53 – Japan H. Kurata KF253377 KF252901 – KF251933 KF251429 KF253733 KF254081 

Sep. glycinicola – CBS 128618 Glycine max South Korea H.D. Shin KF253378 KF252902 KF252427 KF251934 KF251430 KF253734 KF254082 

Sep. helianthi – CBS 123.81 Helianthus annuus – M. Muntañola KF253379 KF252903 KF252428 KF251935 KF251431 KF253735 KF254083 

Sep. helianthicola – CBS 122.81 Helianthus annuus – M. Muntañola KF253380 KF252904 KF252429 KF251936 KF251432 KF253736 KF254084 

Sep. hibiscicola – CBS 128611 Hibiscus syriacus South Korea H.D. Shin KF253381 KF252905 KF252430 KF251937 KF251433 KF253737 KF254085 

– CBS 128615 Hibiscus syriacus South Korea H.D. Shin KF253382 KF252906 KF252431 KF251938 KF251434 KF253738 KF254086 

Sep. hippocastani – CBS 411.61 Aesculus hippocastanum Germany W. Gerlach KF253383 KF252907 KF252432 KF251939 KF251435 KF253739 KF254087 

Sep. justiciae – CPC 12509 Justicia procumbens South Korea H.D. Shin KF253386 KF252910 KF252435 KF251942 KF251438 KF253742 KF254090 

– CBS 128610 Justicia procumbens South Korea H.D. Shin KF253384 KF252908 KF252433 KF251940 KF251436 KF253740 KF254088 

– CBS 128625 Justicia procumbens South Korea H.D. Shin KF253385 KF252909 KF252434 KF251941 KF251437 KF253741 KF254089 

Sep. lactucae – CBS 108943 Lactuca sativa Netherlands P. Grooteman KF253387 KF252911 KF252436 KF251943 KF251439 KF253743 KF254091 

– CBS 352.58 Lactuca sativa Germany G. Sörgel KF253388 KF252912 KF252437 KF251944 KF251440 KF253744 KF254092 

Sep. lamiicola – CBS 102328 Lamium album Netherlands G.J.M. Verkley KF253389 KF252913 KF252438 KF251945 KF251441 KF253745 KF254093 

– CBS 102329 Lamium album Netherlands G.J.M. Verkley KF253390 KF252914 KF252439 KF251946 KF251442 KF253746 KF254094 

– CBS 102379 Lamium sp. Netherlands G.J.M. Verkley KF253391 KF252915 KF252440 KF251947 KF251443 KF253747 KF254095 

– CBS 102380 Lamium sp. Netherlands G.J.M. Verkley KF253392 KF252916 KF252441 KF251948 KF251444 KF253748 KF254096 

– CBS 109112 Lamium album Austria G.J.M. Verkley KF253393 KF252917 KF252442 KF251949 KF251445 KF253749 KF254097 

– CBS 109113 Lamium album Austria G.J.M. Verkley KF253394 KF252918 KF252443 KF251950 KF251446 KF253750 KF254098 

– CBS 123882 Lamium sp. Czech 

Republic 



221





Republic 


Republic 




Sep. lepidiicola – CBS 128635 Lepidium virginicum South Korea H.D. Shin KF253398 KF252922 KF252447 KF251954 KF251450 KF253754 KF254102 

Sep. leptostachyae – CBS 128613 Phryma leptostachya South Korea H.D. Shin KF253399 KF252923 KF252448 KF251955 KF251451 KF253755 KF254103 

– CBS 128628 Phryma leptostachya South Korea H.D. Shin KF253400 KF252924 KF252449 KF251956 KF251452 KF253756 KF254104 

Sep. leucanthemi – CBS 109083 Chrysanthemum 

leucanthemum 

– CBS 109086 Chrysanthemum 

leucanthemum 


leucanthemum 


leucanthemum 


leucanthemum 

Austria G.J.M. Verkley KF253401 KF252925 KF252450 KF251957 KF251453 KF253757 KF254105 




New 

Zealand 


– CBS 353.58 Chrysanthemum maximum Germany R. Schneider KF253406 KF252930 KF252455 KF251962 KF251458 KF253762 KF254110 

Sep. limonum – CBS 419.51 Citrus limonium Italy G. Goidánich KF253407 KF252931 KF252456 KF251963 KF251459 KF253763 KF254111 

Sep. linicola – CBS 316.37 Linum usitatissimum – H.W. Hollenweber KF253408 KF252932 KF252457 KF251964 KF251460 KF253764 KF254112 

Sep. lycoctoni – CBS 109089 Aconitum vulparia Austria G.J.M. Verkley KF253409 KF252933 KF252458 KF251965 KF251461 KF253765 KF254113 

Sep. lycopersici – CBS 128654 Lycopersicon esculentum South Korea H.D. Shin KF253410 KF252934 KF252459 KF251966 KF251462 KF253766 KF254114 

– CBS 354.49 Lycopersicon esculentum Canada B.H. MacNeil KF253411 KF252935 KF252460 KF251967 KF251463 KF253767 KF254115 

Sep. lycopicola – CBS 128651 Lycopus ramosissimus South Korea H.D. Shin KF253412 KF252936 KF252461 KF251968 KF251464 KF253768 KF254116 

Sep. lysimachiae – CBS 102315 Lysimachia vulgaris Netherlands G.J.M. Verkley KF253413 KF252937 KF252462 KF251969 KF251465 KF253769 KF254117 

– CBS 108998 Lysimachia vulgaris Netherlands G.J.M. Verkley KF253414 KF252938 KF252463 KF251970 KF251466 KF253770 KF254118 

– CBS 108999 Lysimachia vulgaris Netherlands G.J.M. Verkley KF253415 KF252939 KF252464 KF251971 KF251467 KF253771 KF254119 

– CBS 123794 Lysimachia sp. Czech 

Republic 

– CBS 123795 Lysimachia sp. Czech 

Republic 



Sep. malagutii – CBS 106.80 Solanum sp. Peru G.H. Boerema KF253418 – KF252467 KF251974 KF251470 KF253774 KF254122 

Sep. matricariae – CBS 109000 Matricaria discoidea Netherlands G.J.M. Verkley KF253419 KF252942 KF252468 KF251975 KF251471 KF253775 KF254123 

– CBS 109001 Matricaria discoidea Netherlands G.J.M. Verkley KF253420 KF252943 KF252469 KF251976 KF251472 KF253776 KF254124 

Sep. mazi – CBS 128656 Mazus japonicus South Korea H.D. Shin KF253421 KF252944 KF252470 KF251977 KF251473 KF253777 KF254125 

222





– CBS 128755 Mazus japonicus South Korea H.D. Shin KF253422 KF252945 KF252471 KF251978 KF251474 KF253778 KF254126 

Sep. melissae – CBS 109097 Melissa officinalis Netherlands H.A. van der Aa KF253423 KF252946 KF252472 KF251979 KF251475 KF253779 KF254127 

Sep. menthae – CBS 404.34 – Japan T. Hemmi KF253424 KF252947 – KF251980 KF251476 KF253780 KF254128 

Sep. napelli – CBS 109104 Aconitum napellus Austria G.J.M. Verkley KF253425 KF252948 KF252473 KF251981 KF251477 KF253781 KF254129 

– CBS 109105 Aconitum napellus Austria G.J.M. Verkley KF253426 KF252949 KF252474 KF251982 KF251478 KF253782 KF254130 

– CBS 109106 Aconitum napellus Austria G.J.M. Verkley KF253427 KF252950 KF252475 KF251983 KF251479 KF253783 KF254131 

Sep. obesa Septoria artimisiae CBS 128588 Artemisia lavandulaefolia South Korea H.D. Shin KF253428 KF252951 KF252476 KF251984 KF251480 KF253784 KF254132 

Septoria 

CBS 128623 Chrysanthemum indicum South Korea H.D. Shin KF253429 KF252952 KF252477 KF251985 KF251481 KF253785 KF254133 

chrysanthemella 


South Korea H.D. Shin KF253430 – KF252478 KF251986 KF251482 KF253786 KF254134 

morifolium 

– CBS 354.58 Chrysantemum indicum Germany R. Schneider KF253431 – KF252479 KF251987 KF251483 KF253787 KF254135 

Sep. oenanthis – CBS 128667 Cicuta virosa South Korea H.D. Shin KF253432 KF252953 KF252481 KF251989 KF251485 KF253788 KF254136 

Sep. oenanthicola Septoria oenanthis CBS 128649 Oenanthe javanica South Korea H.D. Shin KF253433 KF252954 KF252480 KF251988 KF251484 KF253789 KF254137 

Sep. orchidearum Septoria cyclaminis CBS 128631 Cyclamen fatrense South Korea H.D. Shin KF253434 KF252955 KF252482 KF251990 KF251486 KF253790 KF254138 

– CBS 457.78 Listera ovata France H.A. van der Aa KF253435 KF252956 KF252483 KF251991 KF251487 KF253791 KF254139 

Sep. oudemansii – CBS 619.72 Poa pratensis Germany R. Schneider KF253436 KF252957 KF252484 KF251992 KF254299 – KF254140 

Sep. pachyspora – CBS 128652 Zyathoxylum schinifolium South Korea H.D. Shin KF253437 KF252958 KF252485 KF251993 KF251488 KF253792 KF254141 

Sep. paridis – CBS 109111 Paris quadrifolia Austria G.J.M. Verkley KF253438 KF252959 KF252486 KF251994 KF251489 KF253793 KF254142 

– CBS 109110 Paris quadrifolia Austria G.J.M. Verkley KF253439 KF252960 KF252487 KF251995 KF251490 KF253794 KF254143 

Septoria violaepalustris 

Septoria violaepalustris 

CBS 109108 Viola sp. Austria G.J.M. Verkley KF253440 KF252961 KF252488 KF251996 KF251491 KF253795 KF254144 

CBS 109109 Viola sp. Austria G.J.M. Verkley KF253441 KF252962 KF252489 KF251997 KF251492 KF253796 KF254145 

Sep. passifloricola Sep. passiflorae CBS 102701 Passiflora edulis New 

Zealand 


– CBS 129431 Passiflora edulis South Korea H.D. Shin KF253443 KF252964 – KF251999 KF251494 KF253798 KF254147 

Sep. perillae – CBS 128655 Perilla frutescens South Korea H.D. Shin KF253444 KF252965 KF252491 KF252000 KF251495 KF253799 KF254148 

Sep. petroselini – CBS 109521 – Netherlands H.A. van der Aa KF253445 KF252966 KF252492 KF252001 KF251496 KF253800 KF254149 

– CBS 182.44 Petroselinum sativum Netherlands S.D. de Wit KF253446 KF252967 KF252493 KF252002 KF251497 KF253801 KF254150 

Sep. phlogis – CBS 102317 Phlox sp. Netherlands G.J.M. Verkley KF253447 KF252968 KF252494 KF252003 KF251498 KF253802 KF254151 

– CBS 128663 Phlox paniculata South Korea H.D. Shin KF253448 KF252969 KF252495 KF252004 KF251499 KF253803 KF254152 

– CBS 577.90 Phlox sp. Netherlands H.A. van der Aa KF253449 KF252970 KF252496 KF252005 KF251500 KF253804 KF254153 

Sep. polygonorum – CBS 102330 Polygonum persicaria Netherlands G.J.M. Verkley KF253450 KF252971 KF252497 KF252006 KF251501 KF253805 KF254154 


223





– CBS 102331 Polygonum persicaria Netherlands G.J.M. Verkley KF253451 KF252972 KF252498 KF252007 KF251502 KF253806 KF254155 

– CBS 108982 Polygonum persicaria Germany G.J.M. Verkley KF253452 KF252973 KF252499 KF252008 KF251503 KF253807 KF254156 

– CBS 109834 Polygonum persicaria Netherlands G.J.M. Verkley KF253453 KF252974 KF252500 KF252009 KF251504 KF253808 KF254157 

– CBS 113110 Polygonum persicaria New 

Zealand 


– CBS 347.67 Polygonum persicaria Netherlands H.A. van der Aa KF253455 KF252976 KF252502 KF252011 KF251506 KF253810 KF254159 

Sep. posoniensis – CBS 128645 Chrysosplenium japonicum South Korea H.D. Shin KF253456 KF252977 KF252503 KF252012 KF251507 KF253811 KF254160 

Sep. protearum Septoria sp. CPC 19691 Zanthedeschia aethiopica South Africa P.W. Crous KF253474 KF252994 KF252519 KF252030 KF251525 KF253829 KF254178 

Septoria sp. CBS 113114 Geum sp. New 


Zealand 

Septoria sp. CBS 119942 Asplenium ruta-muraria Germany G.J.M. Verkley KF253461 KF252982 – KF252017 KF251512 KF253816 KF254165 

Septoria sp. CBS 135477; 

CPC 19675 

Septoria sp. CBS 164.78 Nephrolepis sp. New 

Zealand 

Septoria sp. CBS 179.77 Myosotis sp. New 

Zealand 

Zanthedeschia aethiopica South Africa P.W. Crous KF253473 KF252993 KF252518 KF252029 KF251524 KF253828 KF254177 



Septoria sp. CBS 364.97 Skimmia sp. Netherlands J. de Gruyter KF253466 KF252986 KF252512 KF252022 KF251517 KF253821 KF254170 

Septoria ligustri CBS 390.59 Ligustrum vulgare Italy M. Ribaldi KF253467 KF252987 KF252513 KF252023 KF251518 KF253822 KF254171 

Septoria pistaciae CBS 420.51 Pistacia vera Italy G. Goidánich KF253469 KF252989 – KF252025 KF251520 KF253824 KF254173 

Septoria sp. CBS 658.77 Boronia denticulata New 

Zealand 


– CBS 778.97 Protea cynaroides South Africa L. Viljoen KF253472 KF252992 KF252517 KF252028 KF251523 KF253827 KF254176 

Sep. pseudonapelli Septoria napelli CBS 128664 Aconitum pseudolaeve South Korea H.D. Shin KF253475 KF252995 KF252520 KF252031 KF251526 KF253830 KF254179 

Sep. putrida – CBS 109087 Senecio nemorensis Austria G.J.M. Verkley KF253476 KF252996 KF252521 KF252032 KF251527 KF253831 KF254180 

– CBS 109088 Senecio nemorensis Austria G.J.M. Verkley KF253477 KF252997 KF252522 KF252033 KF251528 KF253832 KF254181 

Sep. rumicum Septoria acetosae CBS 503.76 Rumex acetosa France H.A. van der Aa KF253478 KF252998 KF252523 KF252034 KF251529 KF253833 KF254182 

Sep. saccardoi – CBS 128756 Lysimachia vulgaris South Korea H.D. Shin KF253479 KF252999 KF252524 KF252035 KF251530 KF253834 KF254183 

Sep. scabiosicola – CBS 102333 Knautia arvensis Netherlands G.J.M. Verkley KF253480 KF253000 KF252525 KF252036 KF251531 KF253835 KF254184 

– CBS 102334 Knautia arvensis Netherlands G.J.M. Verkley KF253481 KF253001 KF252526 KF252037 KF251532 KF253836 KF254185 



– CBS 108981 Knautia arvensis Germany G.J.M. Verkley KF253484 KF253004 KF252529 KF252040 KF251535 KF253839 KF254188 

– CBS 109021 Knautia arvensis Austria G.J.M. Verkley KF253485 KF253005 KF252530 KF252041 KF251536 KF253840 KF254189 

224





– CBS 109092 Knautia dipsacifolia Austria G.J.M. Verkley KF253486 KF253006 KF252531 KF252042 KF251537 KF253841 KF254190 




– CBS 182.93 Succissa pratensis France H.A. van der Aa KF253490 KF253010 KF252535 KF252046 KF251541 KF253845 KF254194 

– CBS 317.37 – – – KF253491 KF253011 KF252536 KF252047 KF251542 KF253846 KF254195 

Sep. senecionis – CBS 102366 Senecio fluviatilis Netherlands G.J.M. Verkley KF253492 KF253012 KF252538 KF252049 KF251544 KF253847 KF254196 

– CBS 102381 Senecio fluviatilis Netherlands G.J.M. Verkley KF253493 KF253013 KF252539 KF252050 KF251545 KF253848 KF254197 

Sep. siegesbeckiae – CBS 128659 Siegesbeckia glabrescens South Korea H.D. Shin KF253494 KF253014 KF252540 KF252051 KF251546 KF253849 KF254198 

– CBS 128661 Siegesbeckia pubescens South Korea H.D. Shin KF253495 KF253015 KF252541 KF252052 KF251547 KF253850 KF254199 

Sep. sii – CBS 102369 Berula erecta Netherlands G.J.M. Verkley KF253496 KF253016 KF252542 KF252053 KF251548 KF253851 KF254200 

– CBS 102370 Berula erecta Netherlands G.J.M. Verkley KF253497 KF253017 KF252543 KF252054 KF251549 KF253852 KF254201 

– CBS 118.96 Berula erecta Netherlands H.A. van der Aa KF253498 KF253018 KF252544 KF252055 KF251550 KF253853 KF254202 

Sep. sisyrinchii – CBS 112096 Sysirinchium sp. New 

Zealand 


Septoria sp. Pseudocercospora sp. CPC 19976 Feijoa sellowiana Italy G. Polizzy KF253509 KF253030 – KF252067 KF251562 KF253863 KF254214 

Septoria sp. – CPC 23104 – Italy E. van Agtmaal KF253511 KF253032 KF252557 KF252069 KF251564 KF253865 KF254216 

Septoria sp. – CBS 109114 Campanula glomerata Austria G.J.M. Verkley KF253501 KF253021 KF252547 KF252058 KF251553 KF253856 KF254205 

Septoria sp. – CBS 120739 Eucalyptus sp. Italy W. Gams KF253503 KF253023 KF252549 KF252060 KF251555 KF253858 KF254207 

Septoria sp. Septoria taraxaci CBS 128650 Taraxacum officinale South Korea H.D. Shin KF253504 KF253024 KF252550 KF252061 KF251556 KF253859 KF254208 

Septoria sp. Septoria posoniensis CBS 128658 Chrysoplenium japonicum South Korea H.D. Shin KF253505 KF253025 KF252551 KF252062 KF251557 KF253860 KF254209 

Austria P.W. Crous KF253506 KF253026 KF252552 KF252063 KF251558 KF253861 KF254210 

Septoria sp. – CBS 135472; 

CPC 19304 


CPC 19485 


CPC 19716 


CPC 19793 

Septoria sp. – CPC 23103; 

MP11 

Vigna unguiculata ssp. 

sesquipedalis 

Conyza canadensis Brazil R.W. Barreto KF253507 KF253027 KF252553 KF252064 KF251559 KF253862 KF254211 

Searsia laevigatum South Africa A. Wood KF253508 KF253028 KF252554 KF252065 KF251560 – KF254212 

Syzygium cordatum South Africa P.W. Crous – KF253029 KF252555 KF252066 KF251561 – KF254213 

Aesculus sp. Netherlands S.I.R. Videira KF253510 KF253031 KF252556 KF252068 KF251563 KF253864 KF254215 

Sep. stachydicola – CBS 128668 Stachys riederi South Korea H.D. Shin KF253512 KF253033 KF252558 KF252070 KF251565 KF253866 KF254217 

Sep. stachydis – CBS 109115 Campanula glomerata Austria G.J.M. Verkley KF253502 KF253022 KF252548 KF252059 KF251554 KF253857 KF254206 

– CBS 102326 Stachys sylvatica Netherlands G.J.M. Verkley KF253514 KF253035 KF252560 KF252072 KF251567 KF253868 KF254219 

– CBS 102337 Stachys sylvatica Netherlands G.J.M. Verkley KF253515 KF253036 KF252561 KF252073 KF251568 KF253869 KF254220 


225





– CBS 109126 Stachys sylvatica Austria G.J.M. Verkley KF253516 KF253037 KF252562 KF252074 KF251569 KF253870 KF254221 

– CBS 109127 Stachys sylvatica Austria G.J.M. Verkley KF253517 KF253038 KF252563 KF252075 KF251570 KF253871 KF254222 

– CBS 123750 Stachys sp. Czech 

Republic 

– CBS 123879 Stachys sp. Czech 

Republic 



– CBS 449.68 Stachys sylvatica Netherlands H.A. van der Aa KF253520 KF253041 KF252566 KF252078 KF251573 KF253874 KF254225 

Sep. astericola CBS 347.58 Aster canus Germany R. Schneider KF253295 KF252820 KF252349 KF251852 KF251348 KF253652 KF254000 

Sep. stellariae – CBS 102376 Stellaria media Netherlands G.J.M. Verkley KF253521 KF253042 KF252567 KF252079 KF251574 KF253875 KF254226 

– CBS 102378 Stellaria media Netherlands G.J.M. Verkley KF253522 KF253043 KF252568 KF252080 KF251575 KF253876 KF254227 

– CBS 102410 Stellaria media Netherlands G.J.M. Verkley KF253523 KF253044 KF252569 KF252081 KF251576 KF253877 KF254228 

Sep. taraxaci – CBS 567.75 Taraxacum sp. Armenia H.A. van der Aa KF253524 KF253045 KF252570 KF252082 KF251577 KF253878 KF254229 

Sep. tinctoriae – CBS 129154 Serratula coronata South Korea H.D. Shin KF253525 KF253046 KF252571 KF252083 KF251578 KF253879 KF254230 

Sep. tormentillae – CBS 128643 Potentilla fragarioides South Korea H.D. Shin KF253526 KF253047 KF252572 KF252084 KF251579 KF253880 KF254231 

– CBS 128647 Potentilla fragarioides South Korea H.D. Shin KF253527 KF253048 KF252573 KF252085 KF251580 KF253881 KF254232 

Sep. urticae Septoria glechomatis CBS 102316 Glechoma hederacea Netherlands G.J.M. Verkley KF253528 KF253049 KF252574 KF252086 KF251581 KF253882 KF254233 

– CBS 102371 Urtica dioica Netherlands G.J.M. Verkley KF253529 KF253050 KF252575 KF252087 KF251582 KF253883 KF254234 

– CBS 102375 Urtica dioica Netherlands G.J.M. Verkley KF253530 KF253051 KF252576 KF252088 KF251583 KF253884 KF254235 

Sep. verbascicola – CBS 102401 Verbascum nigrum Netherlands G.J.M. Verkley KF253531 KF253052 KF252577 KF252089 KF251584 KF253885 KF254236 

Sep. verbenae – CBS 113438 Verbena officinalis New 


Zealand 

– CBS 113481 Verbena officinalis New 


Zealand 

Sep. villarsiae – CBS 514.78 Nymphoides peltata Netherlands H.A. van der Aa KF253534 KF253055 KF252580 KF252092 KF251587 KF253888 KF254239 

– CBS 565.88 Nymphoides peltata Netherlands H.A. van der Aa KF253535 KF253056 KF252581 KF252093 KF251588 KF253889 KF254240 

– CBS 604.66 Nymphoides peltata Netherlands L. Marvanová KF253536 KF253057 KF252582 KF252094 KF251589 KF253890 KF254241 

Sep. violae-palustris – CBS 128644 Viola selkirkii South Korea H.D. Shin KF253537 KF253058 KF252583 KF252095 KF251590 KF253891 KF254242 

– CBS 128660 Viola yedoensis South Korea H.D. Shin KF253538 KF253059 KF252584 KF252096 KF251591 KF253892 KF254243 

Sphaerulina abeliceae Septoria abeliceae CBS 128591 Zelkova serrata South Korea H.D. Shin KF253539 – KF252585 KF252097 KF251592 KF253894 KF254245 

Sphaerulina aceris Mycosphaerella CBS 183.97 Acer pseudoplatanus Netherlands H.A. van der Aa KF253540 – KF252586 KF252098 KF251593 KF253895 KF254246 

latebrosa 

Mycosphaerella CBS 652.85 Acer pseudoplatanus Netherlands H.A. van der Aa KF253541 KF253060 KF252587 KF252099 KF251594 KF253896 KF254300 

latebrosa 

Mycosphaerella latebrosa 

CBS 687.94 Acer pseudoplatanus Netherlands G.J.M. Verkley KF253542 KF253061 KF252588 KF252100 KF251595 KF253897 KF254247 

226




Sphaerulina 

amelanchier 


– CBS 135110 Amelanchier sp. Netherlands S.I.R. Videira KF253543 KF253062 KF252589 KF252101 KF251596 KF253898 KF254248 

Septoria sp. CPC 23107; 

MP9 

Septoria sp. CPC 23105; 

MP22 

– CPC 23106; 

MP7 

Betula sp. Netherlands S.I.R. Videira KF253583 KF253098 KF252626 KF252139 KF251634 KF253937 KF254288 

Quercus sp. Netherlands S.I.R. Videira KF253544 KF253063 KF252590 KF252102 KF251597 KF253899 KF254249 

Castanea sp. Netherlands S.I.R. Videira KF253545 KF253064 KF252591 KF252103 KF251598 KF253900 KF254250 

Sphaerulina azaleae Septoria azaleae CBS 128605 Rhododendron sp. South Korea H.D. Shin KF253546 KF253065 KF252592 KF252104 KF251599 KF253901 KF254251 

Septoria azaleae CBS 352.49 Rhododendron sp. Belgium J. van Holder KF253547 KF253066 KF252593 KF252105 KF251600 KF253902 KF254252 

Sphaerulina berberidis Mycosphaerella 

berberidis 

CBS 324.52 Berberis vulgaris Switzerland E. Müller KF253548 KF253067 KF252594 KF252106 KF251601 KF253903 KF254253 

Sphaerulina betulae Septoria betulae CBS 116724 Betula pubescens Scotland S. Green KF253549 KF253068 KF252595 KF252107 KF251602 KF253904 KF254254 

Septoria betulae CBS 128596 Betula platyphylla South Korea H.D. Shin KF253550 KF253069 KF252596 KF252108 KF251603 KF253905 KF254255 

Septoria betulae CBS 128597 Betula schmidtii South Korea H.D. Shin KF253551 KF253070 KF252597 KF252109 KF251604 KF253906 KF254256 

Septoria betulae CBS 128600 Betula platyphylla South Korea H.D. Shin KF253552 KF253071 KF252598 KF252110 KF251605 KF253907 KF254257 

Sphaerulina cercidis Septoria provencialis CBS 118910 Eucalyptus sp. France P.W. Crous KF253553 KF253072 KF252602 KF252114 KF251609 KF253908 KF254258 

Septoria cercidis CBS 128634 Cercis siliquastrum South Korea H.D. Shin KF253554 KF253073 KF252599 KF252111 KF251606 KF253909 KF254259 

Septoria cercidis CBS 129151 Cercis siliquastrum South Korea H.D. Shin KF253555 KF253074 KF252600 KF252112 KF251607 KF253910 KF254260 

Septoria cercidis CBS 501.50 Cercis siliquastrum Netherlands G. van den Ende KF253556 KF253075 KF252601 KF252113 KF251608 KF253911 KF254261 

Sphaerulina cornicola Septoria cornicola CBS 102324 Cornus sp. Netherlands A. van Iperen KF253557 KF253076 KF252603 KF252115 KF251610 KF253912 KF254262 

Septoria comicola CBS 102332 Cornus sp. Netherlands A. van Iperen KF253558 KF253077 KF252604 KF252116 KF251611 KF253913 KF254263 

Septoria cornicola CBS 116778 Cornus sanguinea USA A.Y. Rossman KF253559 KF253078 – KF252117 KF251612 KF253914 KF254264 

Sphaerulina frondicola Septoria populi CBS 391.59 Populus pyramidalis Germany R. Schneider KF253572 – KF252617 KF252130 KF251625 KF253927 KF254277 

Sphaerulina gei Septoria gei CBS 102318 Geum urbanum Netherlands G.J.M. Verkley KF253560 KF253079 KF252605 KF252118 KF251613 KF253915 KF254265 

Septoria gei CBS 128616 Geum japonicum South Korea H.D. Shin KF253561 KF253080 KF252606 KF252119 KF251614 KF253916 KF254266 

Septoria gei CBS 128632 Geum japonicum South Korea H.D. Shin KF253562 KF253081 KF252607 KF252120 KF251615 KF253917 KF254267 

Sphaerulina hyperici Septoria hyperici CBS 102313 Hypericum sp. Netherlands G.J.M. Verkley KF253563 KF253082 KF252608 KF252121 KF251616 KF253918 KF254268 

Sphaerulina menispermi Septoria menispermi CBS 128666 Menispermum dauricum South Korea H.D. Shin KF253564 KF253083 KF252609 KF252122 KF251617 KF253919 KF254269 

Septoria menispermi CBS 128761 Menispermum dauricum South Korea H.D. Shin KF253565 KF253084 KF252610 KF252123 KF251618 KF253920 KF254270 

Sphaerulina musiva Septoria musiva CBS 130559 Populus sp. Canada J. LeBoldus KF253566 – KF252611 KF252124 KF251619 KF253921 KF254271 

Septoria musiva CBS 130562 Populus sp. Canada J. LeBoldus KF253567 KF253085 KF252612 KF252125 KF251620 KF253922 KF254272 

Septoria musiva CBS 130563 Populus deltoides × P. 

balsamifera 

Canada J. LeBoldus KF253568 – KF252613 KF252126 KF251621 KF253923 KF254273 


227





Septoria musiva CBS 130569 Populus deltoides Canada J. LeBoldus KF253569 KF253086 KF252614 KF252127 KF251622 KF253924 KF254274 

Sphaerulina patriniae Septoria patriniae CBS 128653 Patrinia scabiosaefolia South Korea H.D. Shin KF253570 KF253087 KF252615 KF252128 KF251623 KF253925 KF254275 

Septoria patriniae CBS 129153 Patrinia villosa South Korea H.D. Shin KF253571 KF253088 KF252616 KF252129 KF251624 KF253926 KF254276 

Sphaerulina populicola Mycosphaerella 

populicola 

CBS 100042 Populus trichocarpa USA G. Newcombe KF253573 – KF252618 KF252131 KF251626 KF253928 KF254278 

Sphaerulina quercicola Septoria quercicola CBS 109009 Quercus rubra Netherlands G.J.M. Verkley KF253574 KF253089 KF252619 KF252132 KF251627 KF253929 KF254279 

Septoria quercicola CBS 115016 Quercus robur Netherlands G.J.M. Verkley KF253575 KF253090 KF252620 KF252133 KF251628 KF253930 KF254280 

Septoria quercicola CBS 115136 Quercus robur Netherlands G.J.M. Verkley KF253576 KF253091 KF252621 KF252134 KF251629 KF253931 KF254281 

Septoria quercicola CBS 663.94 Quercus robur Netherlands H.A. van der Aa KF253577 KF253092 KF252622 KF252135 KF251630 KF253932 KF254282 

Sphaerulina 

rhabdoclinis 

Dothistroma 

rhabdoclinis 

CBS 102195 Pseudotsuga menziesii Germany H. Butin KF253578 KF253093 KF252623 KF252136 KF251631 – KF254283 

Sphaerulina socia Septoria rosae CBS 355.58 Rosa sp. – – KF253579 KF253094 KF252624 KF252137 KF251632 KF253933 KF254284 

Septoria socia CBS 357.58 Chrysanthemum 

Germany R. Schneider KF253580 KF253095 KF252625 KF252138 KF251633 KF253934 KF254285 

leucanthemum 

Sphaerulina sp. Septoria sp. CBS 102063 Actinidia deliciosa New 


Zealand 

Sphaerulina sp. Septoria lysimachiae CBS 128758 Lysimachia clethroides South Korea H.D. Shin KF253582 KF253097 KF252628 KF252141 KF251636 KF253936 KF254287 

Sphaerulina tirolensis Septoria rubi CBS 109017 Rubus idaeus Austria G.J.M. Verkley KF253584 KF253099 KF252629 KF252142 KF251637 KF253938 KF254289 

Mycosphaerella rubi CBS 109018 Rubus idaeus Austria G.J.M. Verkley KF253585 KF253100 KF252630 KF252143 KF251638 KF253939 KF254290 

Sphaerulina viciae – CBS 131898 Vicia amurense South Korea H.D. Shin KF253586 KF253101 KF252631 KF252144 KF251639 KF253940 KF254291 

Sphaerulina 

Septoria rubi CBS 102327 Rubus sp. Netherlands G.J.M. Verkley KF253587 KF253102 KF252632 KF252145 KF251640 KF253941 KF254292 

westendorpii 

Mycosphaerella rubi CBS 109002 Rubus sp. Netherlands G.J.M. Verkley KF253588 KF253103 KF252633 KF252146 KF251641 KF253942 KF254293 

Septoria rubi CBS 117478 Rubus fruticosus Netherlands G.J.M. Verkley KF253589 KF253104 KF252634 KF252147 KF251642 KF253943 KF254294 

Zymoseptoria brevis – CPC 18102 Phalaris paradoxa Iran M. Razavi KF253590 – KF252635 KF252148 KF251643 KF253944 KF254295 

– CPC 18107 Phalaris minor Iran M. Razavi KF253591 – KF252636 KF252149 KF251644 KF253945 KF254296 

Zymoseptoria halophila – CBS 128854 Hordeum glaucum Iran M. Razavi KF253592 – – KF252150 KF251645 KF253946 KF254297 

Zymoseptoria tritici – CPC 18099 Aegilops tauschii Iran M. Razavi KF253594 – KF252638 KF252152 KF251647 KF253948 KF254299 

– CBS 392.59 Triticum aestivum Switzerland E. Becker KF253593 – KF252637 KF252151 KF251646 KF253947 KF254298 

1 CBS: CBS Fungal Biodiversity Centre, Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands; CPC: Collection Pedro Crous, housed at CBS; S: William Quaedvlieg working collection (will be merged into the CPC collection); MP: Sandra Isabel 

Rodrigues Videira working collection (will be merged into the CPC collection). 

2 

Act:: Actin, Cal: Calmodulin, EF: Translation elongation factor 1-alpha, RPB2: RNA polymerase II second largest subunit, Btub: β-tubulin LSU: 28S large subunit of the nrRNA gene and ITS: internal transcribed spacer regions of the nrDNA operon. 

228


previous results by Verkley et al. (2004a, b) which showed that both 

loci could not resolve the lower phylogenetic relationships between 

closely related Septoria species. Due to the presence of intron 

regions in the five remaining protein coding loci, these genes provide 

much higher interspecific variation than the more conserved ITS and 

LSU loci. These protein coding genes thus have (much) higher K2P 

inter- to intraspecific variation ratios: for Cal 14 : 1, RPB2 17 : 1, Act 

23 : 1, EF 26 : 1 and for Btub 29 : 1 (Fig. 1), making them all suitable 

for reliable species resolution throughout the range of septoria-like 

fungi. As the EF and Btub have the largest barcoding gap, these loci 

should give the highest species resolution and preferably be used for 

identifying species. 

Phylogeny 

Basal to the seven-locus tree are the outgroup taxon Readeriella 

mirabilis (CBS 125000), and a monophyletic group comprising 11 

strains, viz. Dothistroma pini (CBS 121011), D. septospora, (CBS 

383.74), Passalora dissiliens (CBS 219.77), three Ramularia 

species (Mycosphaerella s. str., see Quaedvlieg et al. 2013) and 

three Zymoseptoria species, including its type species Z. tritici (syn. 

Mycosphaerella graminicola, Septoria tritici). The basal ingroup 

taxa include CBS 619.72 identified as Septoria oudemansii, a 

Pseudocercospora clade with six strains, and Cercosporella 

virgaureae (CBS 113304). A well-supported cluster of two basal 

lineages (bootstrap support 100 %) comprises a cluster (100 %) 

of two isolates identified as S. gladioli, and a second cluster 

(100 %) containing 10 strains representing four septoria-like 

species that are all associated with leaf spots on plants of the 

family Caryophyllaceae, and for which the new generic name 

Caryophylloseptoria is proposed below. These include C. silenes 

(CBS 109100, 109103), C. lychnidis (CBS 109098–109102), two 

isolates originating from Lychnis cognata in Korea for which the 

new species C. pseudolychnidis is proposed by Quaedvlieg et al. 

(2013) (CBS 128614, 128630), and two isolates of C. spergulae 

(CBS 397.52, 109010). 

The remaining ingroup can be devided into a Sphaerulina clade 

(100 %, 51 strains including the basal strain of Sph. abeliceae, 

CBS 128591) and main Septoria clade (80 %, 259 strains) with, 

positioned in between smaller groups comprised of “Septoria” 

cruciatae (CBS 123747, 123748), a small pseudocercosporellalike 

clade comprising Passalora fusimaculans (CPC 17277), a 

clade with Passalora depressa (CPC 14915), “Mycosphaerella” 

brassicicola and affiliated taxa with Pseudocercosporella asexual 

morphs (100 %, 9 strains), and a miscellaneous clade containing 

“Passalora” sp. (100 %, CBS 113989, 113999, 114275), 

Passalora dioscoreae (CPC 10855, 11513), Pseudocercosporella 

magnusiana (CBS 114735), Passalora janseana (CBS 145.37), 

“Septoria erigerontis” (CPC 19485), and a Cercospora clade 

(100 %, 4 strains). 

The Sphaerulina clade comprises the aforementioned CBS 

128591 identified as S. abelicaea (from Zelkova serrata) and 

clades 1 and 2. Clade 1 (100 %, 37 strains) includes at its base 

three strains of Sph. cornicola, the sister taxa Sph. betulae and 

S. westendorpii (syn. S. rubi) on Rubus fruticosus (CBS 102327, 

109002, 117478), and Sph. socia (CBS 355.58, CBS 357.58). 

The remainder of clade 1 contains a well-supported cluster of 25 

strains with various species infecting herbaceous and woody hosts. 

CBS 109017 and 19018, originating from Rubus idaeus in Austria, 

represent a species for which Sphaerulina tirolensis sp. nov. is 

introduced below. Furthermore this cluster contains Sphaerulina 

berberidis (syn. Mycosphaerella berberidis, S. berberidis Niessl), 

Sph. azaleae, Sph. hyperici, Sph. menispermi, Sph. patriniae, 

Sph. cercidis, and Sph. gei. Clade 2 (74 %, 13 strains) of the 

Sphaerulina clade includes only species infecting tree, the poplar 

pathogens Sph. populicola (syn. Mycosphaerella populicola, 

CBS 100042), Sph. musiva (syn. Septoria musiva, four strains), 

and Sph. frondicola (syn. Mycosphaerella populi, S. populi, CBS 

391.59), and furthermore Sphaerulina aceris (syn. Mycosphaerella 

latebrosa, Phloeospora aceris, asexual morph S. aceris, three 

strains), which causes leaf spot on Acer spp., and Sph. quercicola 

(syn. S. querciola). 

At the base of the main Septoria clade, a well-supported 

clade 3 (88 %, 16 strains) includes several species associated 

with hosts in the Apiaceae, viz., S. oenanthis (CBS 128667) 

and S. oenanthicola (CBS 128649; a new species proposed by 

Quaedvlieg et al. (2013), S. sii (CBS 118.96, 102369, 102370), 

and S. aegopodii (CBS 123740, 123741), and associated with 

other plant families, S. dearnessii (CBS 128624), a cluster of two 

strains of S. lactucae (CBS 352.58, 108943) and S. sonchi (CBS 

128757), S. campanulae (CBS 128589, 128604), S. mazi (CBS 

128656, 128755), and S. gentianae (CBS 128633). In clade 4 

(100 %, 183 strains) S. bupleuricola (CBS 128601, 128603) and 

S. scabiosicola (100 %, 12 strains) occupy a basal position and 

subclades 4a–d can be distinguished. Subclade 4a (100 %, 46 

strains) comprises of a group of 13 strains of miscellaneous host 

plants, mostly with smaller conidia, viz., two Solanum pathogens S. 

lycopersici (CBS 354.49, 128654) and S. malagutii (CBS 106.80), 

S. apiicola (4 strains), S. cucurbitacearum (CBS 178.77), and S. 

aridis (4 strains), and a second strain identified as S.posonniensis 

(CBS 128658). Subclade 4b (100 %, 33 strains) harbours several 

taxa infecting Asteraceae, among others S. obesa (four strains), 

S. senecionis (three strains), S. putrida (CBS 109087, 109088), 

S. leucanthemi (6 strains), S.cirsii (CBS 128621), six strains of 

the S. chrysanthemella complex, S. exotica (CBS 163.78), and 

S. posoniensis (CBS 128645). Furthermore this group of 33 

comprises taxa with relatively large conidia capable of infecting 

Ranunculaceae, viz. S.lycoctoni, S. napelli (CBS 109104–109106) 

from Austria and S. pseudonapelli (CBS 128664; a new species 

proposed by Quaedvlieg et al. 2013) from Korea. It also includes 

S. lycopicola (128651), CBS 128662 identified as S. stachydicola 

(probably misidentified), and two strains of S. astericola (CBS 

128587, 128593). Subclade 4c (99 %, 15 strains) contains S. 

matricariae (CBS 109000, 109001), S. lamiicola (8 strains), S. 

anthrisci (CBS 109019, 109020), and S. petroselini (CBS 182.44, 

109521), and subclade 4d (100 %, 103 strains) shows four 

subgroups, 4d-1–4. Basic to these are found S. dolichospora (CBS 

129152) and S. helianthi (CBS 123.81). Subclade 4d-1 (100 %, 45 

strains) contains S. cf. stachydicola (CBS 128668 ; see Quaedvlieg 

et al. 2013), and many other species infecting herbaceous plants, 

among others S. stachydis (nine strains), S. phlogis (three strains), 

S. epambrosiae (CBS 128629, 128636), S. cerastii (five strains), 

S. galeopsidis (seven strains), S. stachydis (9 strains), S. epilobii 

(CBS 109084, 109085) and S. digitalis (CBS 391.63, 328.67). 

Subclade 4d-2 (100 %, 35 strains) comprises among others S. 

polygonorum (six strains), S. urticae and S convolvuli (three strains 

each), S.villarsiae, S. crepidis, and S. codonopsidis. Subclade 

4d-3 (99 %, 11 strains) containing S. erigerontis (five strains), S. 

lysimachii (five strains), and S. saccardoi (CBS 128756). Subclade 

4d-4 (100 %, 9 strains) contains S. bothriospermi (CBS 128592, 

128599), S. tinctoriae (CBS 129154), four strains identified as S. 

rubi that need to be re-named, and S.agrimoniicola (CBS 128585, 

128602). 


229


Caryophyllaceae 

Rutaceae 

Araceae 

Brassicaceae 

Rosaceae 

Polygonaceae 

Scrophulariaceae 

Fabaceae 

Lamiaceae 

Ranunculaceae 

Apiaceae 

Asteraceae 

0.2 

1 

0.82 

0.8 

0.77 

1 

0.89 

0.98 

1 

1 Septoria hippocastani CPC 23103 

0.97 Septoria hippocastani CBS 411.61 

1 

Septoria sp. CBS 112737 

Septoria astragali CBS 109116 

1 

1 Septoria astragali CBS 109117 


Septoria rumicum CBS 503.76 

Septoria stellariae CBS 102376 

1 Septoria stellariae CBS 102378 


Septoria helianthicola CBS 122.81 

0.95 Septoria coprosmae CBS 113391 


1 0.72 

Septoria sp. CPC 19793 

1 Septoria verbenae CBS 113438 

Septoria verbenae CBS 113481 


0.58 Septoria limonum CBS 419.51 


Septoria chamaecisti CBS 350.58 

Septoria citricola CBS 356.36 

Septoria protearum CBS 390.59 

0.91 

1 Septoria protearum CBS 364.97 

Septoria protearum CBS 119942 






0.94 



1 Septoria protearum CBS 101354 


1 Septoria protearum CBS 420.51 



Septoria protearum CPC 19691 



Septoria lepidiicola CBS 128635 

Septoria cucubali CBS 102367 

0.91 Septoria cucubali CBS 102386 

1 



Septoria linicola CBS 316.37 

Septoria justiciae CBS 12509 

1 Septoria justiciae CBS 128625 


Septoria eucalyptorum CBS 118505 

1 Septoria anthurii CBS 148.41 

1 Septoria anthurii CBS 346.58 

1 Septoria sisyrinchii CBS 112096 

1 Septoria passiflorae CBS 102701 

1 Septoria passifloricola CBS 129431 

1 Septoria chromolaenae CBS 113373 

1 Septoria ekmaniana CBS 113385 

Septoria ekmaniana CBS 113612 

1 Septoria abei CBS 128598 

1 Septoria hibiscicola CBS 128615 

Septoria hibiscicola CBS 128611 


1 Septoria clematidis CBS 108983 

Septoria clematidis CBS 108984 

1 Septoria bupleuricola CBS 128601 

Septoria bupleuricola CBS 128603 

1 Septoria agrimoniicola CBS 128585 

Septoria agrimoniicola CBS 128602 

0.97 Septoria cf. rubi CBS 128646 

Septoria cf. rubi CBS 128648 

1 1 Septoria cf. rubi CBS 128760 

1 Septoria cf. rubi CPC 12331 

Septoria tinctoriae CBS 129154 

1 Septoria bothriospermi CBS 128592 

Septoria bothriospermi CBS 128599 

Septoria saccardoi CBS 128756 

1 Septoria lysimachiae CBS 102315 

Septoria lysimachiae CBS 108999 

1 Septoria lysimachiae CBS 108998 



Septoria erigerontis CBS 131893 


1 Septoria erigerontis CBS 186.93 



1 Septoria codonopsidis CBS 128620 

0.62 Septoria codonopsidis CBS 128609 

0.91 

Septoria leptostachyae CBS 128613 

1 Septoria leptostachyae CBS 128628 

Septoria pachyspora CBS 128652 

0.87 

Septoria crepidis CBS 128619 

1 Septoria crepidis CBS 12539 

0.84 Septoria crepidis CBS 128608 


0.58 1 Septoria tormentillae CBS 128643 

Septoria tormentillae CBS 128647 

Septoria dysentericae CBS 128637 

1 Septoria dysentericae CBS 131892 

0.83 Septoria dysentericae CBS 128638 

1 Septoria callistephi CBS 128590 

Septoria callistephi CBS 128594 

Septoria villarsiae CBS 604.66 

1 

1 Septoria villarsiae CBS 565.88 

0.73 


Septoria glycines CBS 336.53 

Septoria glycinicola CBS 128618 

1 Septoria perillae CBS 128655 

Septoria menthae CBS 404.34 

Septoria convolvuli CBS 113111 

1 Septoria convolvuli CBS 128627 

1 Septoria convolvuli CBS 102325 

1 Septoria urticae CBS 102316 

Septoria urticae CBS 102375 


Septoria polygonorum CBS 102330 

1 Septoria polygonorum CBS 347.67 





0.65 

0.99 

5B 

5A 

4D4 

4D3 

4D2 

Septoria 

Fig. 2. Consensus phylogram (50 % majority rule) of 17 222 trees resulting from a Bayesian analysis of the combined seven loci sequence alignment using MrBayes v. 3.2.1. 

Bayesian posterior probabilities values are indicated on their respective branches and the scale bar indicates 0.2 expected changes per site. The tree was rooted to Readeriella 

mirabilis (Teratosphaeriaceae) (CBS 125000). The family of the host plant from which the strain was isolated is indicated for 12 most prevalently occurring host families in our 

dataset (colour bar according to the legend). 

230



Rutaceae 

Araceae 

Brassicaceae 

Rosaceae 

Polygonaceae 


Fabaceae 

Lamiaceae 

Ranunculaceae 

Apiaceae 

Asteraceae 

0.2 

0.8 

1 

1 

1 

0.77 

0.85 

1 Septoria sp. CPC 23104 

1 Septoria digitalis CBS 328.67 

Septoria digitalis CBS 391.63 

1 Septoria epilobii CBS 109084 

Septoria epilobii CBS 109085 

11 

Septoria taraxaci CBS 567.75 

Septoria verbascicola CBS 102401 

Septoria stachydis CBS 347.58 

0.86 


Septoria stachydis CBS 109127 

1 Septoria stachydis CBS 109126 




0.98 



1 

1 

Septoria melissae CBS 109097 

Septoria galeopsidis CBS 191.26 

Septoria galeopsidis CBS 102314 

1 Septoria galeopsidis CBS 102411 




1 Septoria galeopsidis CBS 123749 

Septoria orchidearum CBS 128631 

0.9 

1 Septoria orchidearum CBS 109114 

Septoria orchidearum CBS 457.78 

0.75Septoria cerastii CBS 102323 

Septoria cerastii CBS 128612 


1 


Septoria cerastii CPC 12343 

1 1 Septoria epambrosiae CBS 128629 

1 Septoria epambrosiae CBS 128636 

1 Septoria phlogis CBS 128663 

Septoria phlogis CBS 577.90 

Septoria phlogis CBS 102317 

Septoria calendulae CBS 349.58 

1 1 1 Septoria siegesbeckiae CBS 128661 

Septoria siegesbeckiae CBS 128659 

1 1 Septoria violae-palustris CBS 128660 

Septoria violae-palustris CBS 128644 

1 Septoria chelidonii CBS 128607 

Septoria chelidonii CPC 12337 

Septoria stachydicola CBS 128668 

Septoria helianthi CBS 123.81 

Septoria dolichospora CBS 129152 

1 Septoria petroselini CBS 182.44 

Septoria petroselini CBS 109521 

1 Septoria anthrisci CBS 109019 

1 Septoria anthrisci CBS 109020 

Septoria lamiicola CBS 102328 



0.62 


1 Septoria lamiicola CBS 102380 



0.93 Septoria lamiicola CBS 123883 

1 Septoria lamiicola CBS 123884 

1 Septoria matricariae CBS 109000 

Septoria matricariae CBS 109001 

Septoria pseudonapelli CBS 128664 

Septoria napelli CBS 109105 

1 


1 Septoria napelli CBS 109106 

Septoria lycoctoni CBS 109089 

1 Septoria exotica CBS 163.78 

Septoria posoniensis CBS 128645 

1 Septoria chrysanthemella CBS 128716 

1 

0.96 Septoria chrysanthemella CBS 128617 

Septoria chrysanthemella CBS 354.73 

1 1 

1 Septoria chrysanthemella CBS 351.58 

1 Septoria chrysanthemella CBS 483.63 

Septoria chrysanthemella CBS 128622 

Septoria cirsii CBS 128621 

0.97 

Septoria leucanthemi CBS 353.58 

1 Septoria leucanthemi CBS 113112 

Septoria leucanthemi CBS 109090 




1 Septoria putrida CBS 109087 

1 Septoria putrida CBS 109088 

Septoria senecionis CBS 102381 

1 Septoria senecionis CBS 102366 


1 Septoria lycopicola CBS 128651 

Septoria cf. stachydicola CBS 128662 

1 Septoria astericola CBS 128587 

Septoria astericola CBS 128593 

Septoria obesa CBS 128588 

1 1 Septoria obesa CBS 128623 

Septoria obesa CBS 354.58 

0.83 



1 Septoria paridis CBS 109110 

1 Septoria paridis CBS 109111 

Septoria paridis CBS 109109 


1 

Septoria apiicola CBS 389.59 

1 Septoria apiicola CBS 116465 


0.95 


1 Septoria cucurbitacearum CBS 178.77 

1 Septoria lycopersici CBS 354.49 

1 Septoria lycopersici CBS 128654 

Septoria malagutii CBS 106.80 

Septoria atropurpurea CBS 348.58 

Septoria scabiosicola CBS 182.93 

Septoria scabiosicola CBS 317.37 

Septoria scabiosicola CBS 102335 


0.78 Septoria scabiosicola CBS 102334 



0.75 



1 Septoria scabiosicola CBS 109129 



4D1 

4C 

4B 

4A 

Septoria 

(cont.) 



231



Rutaceae 

Araceae 

Brassicaceae 

Rosaceae 

Polygonaceae 


Fabaceae 

Lamiaceae 

Ranunculaceae 

Apiaceae 

Asteraceae 

0.88 

0.57 

2x 

1 

1 

0.99 

0.81 

2x 

1 

2x 

1 

1 

0.79 

2x 

0.58 

1 Septoria aegopodina CBS 123740 

0.8 

Septoria aegopodina CBS 123741 

0.88 Septoria gentianae CBS 128633 

1 

Septoria oenanthicola CBS 128649 

0.61 Septoria mazi CBS 128656 

1 Septoria mazi CBS 128755 

1 1 Septoria sii CBS 118.96 

1 Septoria sii CBS 102369 

1 Septoria sii CBS 102370 

Septoria oenanthis CBS 128667 

0.99 

1 Septoria campanulae CBS 128589 

Septoria campanulae CBS 128604 

0.88 

1 Septoria lactucae CBS 352.58 

1 Septoria lactucae CBS 108943 

Septoria cf. sonchi CBS 128757 

Septoria dearnessii CBS 128624 

Cercospora apii CBS 118712 

0.99 

Cercospora zebrina CBS 118790 

1 1 

Cercospora ariminensis CBS 137.56 

0.8 

Cercospora beticola CBS 124.31 

0.8 


Passalora janseana CBS 145.37 

2x 1 

1 Passalora dioscoreae CBS 135460 

0.62 

Passalora dioscoreae CBS 135463 

Pseudocercosporella magnusiana CBS 114735 

Passalora sp. CBS 113998 

1 Passalora sp. CBS 113999 

Passalora sp. CBS 114275 

1 Mycosphaerella brassicicola CBS 228.32 

Mycosphaerella brassicicola CBS 267.53 

0.94 Mycosphaerella capsellae CBS 112032 

Pseudocercosporella capsellae CBS 127.29 

1 

1 Pseudocercosporella capsellae CBS 118412 

0.79 

Pseudocercosporella capsellae CBS 112033 

2x 

1 2x 

Mycosphaerella sp. CBS 135464 

Passalora depressa CPC 14915 

0.8 

Pseudocercosporella pastinacae CBS 114116 

“Septoria” cruciatae CBS 123747 

“Septoria” cruciatae CBS 123748 

Passalora fusimaculans CPC 17277 

Sphaerulina populicola CBS 100042 

1 Sphaerulina musiva CBS 130559 

Sphaerulina musiva CBS 130563 

1 

1 



0.72 

Sphaerulina frondicola CBS 391.59 

Sphaerulina quercicola CBS 663.94 

1 Sphaerulina quercicola CBS 109009 

0.74 

Sphaerulina quercicola CBS 115016 

2x 


Sphaerulina aceris CBS 183.97 

1 Sphaerulina aceris CBS 652.85 


Sphaerulina amelanchier CPC 23106 

0.82 Sphaerulina amelanchier CBS 135110 

0.9 Sphaerulina amelanchier CPC 23105 

1 Sphaerulina rhabdoclinis CBS 102195 

Sphaerulina sp. CBS 102063 

0.69 Sphaerulina sp. CPC 23107 

Sphaerulina gei CBS 102318 

1 1 



Sphaerulina viciae CBS 131898 

1 Sphaerulina cercidis CBS 128634 

Sphaerulina cercidis CBS 118910 

1 Sphaerulina cercidis CBS 129151 

1 

0.54 Sphaerulina cercidis CBS 501.50 

0.65 Sphaerulina sp. CBS 128758 

0.79 

1 Sphaerulina patriniae CBS 128653 

Sphaerulina patriniae CBS 129153 

1 

1 Sphaerulina menispermi CBS 128666 

1 

Sphaerulina menispermi CBS 128761 

Sphaerulina hyperici CBS 102313 

1 1 Sphaerulina azaleae CBS 352.49 

0.89 Sphaerulina azaleae CBS 128605 

Sphaerulina berberidis CBS 324.52 

0.83 

1 Sphaerulina tirolensis CBS 109018 

Sphaerulina tirolensis CBS 109017 

1 

1 Sphaerulina socia CBS 355.58 

Sphaerulina socia CBS 357.58 

0.82 

Sphaerulina betulae CBS 116724 

1 Sphaerulina betulae CBS 128597 


1 


1 

Sphaerulina westendorpii CBS 109002 

1 Sphaerulina westendorpii CBS 117478 


Sphaerulina cornicola CBS 102324 



Sphaerulina abeliceae CBS 128591 

1 Caryophylloseptoria spergulae CBS 397.52 

0.96 Caryophylloseptoria spergulae CBS 109010 

1 Caryophylloseptoria pseudolychnidis CBS 128630 

0.97 Caryophylloseptoria pseudolychnidis CBS 128614 

Caryophylloseptoria lychnidis CBS 109098 

1 Caryophylloseptoria lychnidis CBS 109099 

1 



1 Caryophylloseptoria silenes CBS 109100 

Caryophylloseptoria silenes CBS 109103 

1 “Septoria” gladioli CBS 121.20 

“Septoria” gladioli CBS 353.29 

Cercosporella virgaureae CBS 113304 

Pseudocercospora flavomarginata CBS 124990 

1 Pseudocercospora tereticornis CBS 124996 

1 Pseudocercospora pyracanthigena CPC 10808 

0.97 Pseudocercospora schizolobii CBS 120029 

Pseudocercospora rhoina CPC 11464 

0.82 

Pseudocercospora madagascariensis CBS 124155 

“Septoria” oudemansii CBS 619.72 

1 Dothistroma pini CBS 121011 

Dothistroma septospora CBS 383.74 

Passalora dissiliens CBS 219.77 

1 

Ramularia endophylla CBS 113265 

1 

Ramularia eucalypti CBS 120726 

Ramularia lamii CPC 11312 

1 Zymoseptoria brevis CPC 18102 


1 1 Zymoseptoria tritici CBS 392.59 

Zymoseptoria tritici CPC 18099 

Zymoseptoria halophila CBS 128854 

Readeriella mirabilis CBS 125000 

0.2 

3 

2 

1 

Septoria 

(cont.) 

Cercospora 

Incertae sedis 

Pseudocercospora 

pseudocercosporella 

like 

Sphaerulina 

Caryophylloseptoria 

septoria-like 

Cercosporella 


Dothistroma 


Ramularia 

Zymoseptoria 

Readeriella 


232


Table 2. Primer combinations used during this study for generic amplification and sequencing. 

Locus Primer Primer sequence 5’ to 3’: Annealing Orientation Reference 

temperature 

(°C) 

Translation elongation factor-1α EF1-728F CATCGAGAAGTTCGAGAAGG 52 Forward Carbone & Kohn (1999) 

EF-2 GGARGTACCAGTSATCATGTT 52 Reverse O’Donnell et al. (1998) 

β-tubulin T1 AACATGCGTGAGATTGTAAGT 52 Forward O’Donnell & Cigelnik (1997) 

β-Sandy-R GCRCGNGGVACRTACTTGTT 52 Reverse Stukenbrock et al. (2012) 

RNA polymerase II second largest subunit fRPB2-5F GAYGAYMGWGATCAYTTYGG 49 Forward Liu et al. (1999) 

fRPB2-414R ACMANNCCCCARTGNGWRTTRTG 49 Reverse Quaedvlieg et al. (2011) 

LSU LSU1Fd GRATCAGGTAGGRATACCCG 52 Forward Crous et al. (2009a) 

LR5 TCCTGAGGGAAACTTCG 52 Reverse Vilgalys & Hester (1990) 

ITS ITS5 GGAAGTAAAAGTCGTAACAAGG 52 Forward White et al. (1990) 

ITS4 TCCTCCGCTTATTGATATGC 52 Reverse White et al. (1990) 

Actin ACT-512F ATGTGCAAGGCCGGTTTCGC 52 Forward Carbone & Kohn (1999) 

ACT2Rd ARRTCRCGDCCRGCCATGTC 52 Reverse Groenewald et al. (2012) 

Calmodulin CAL-235F TTCAAGGAGGCCTTCTCCCTCTT 50 Forward Quaedvlieg et al. (2012) 

CAL2Rd TGRTCNGCCTCDCGGATCATCTC 50 Reverse Groenewald et al. (2012) 

Table 3. Amplification success, phylogenetic data and the substitution models used in the phylogenetic analysis, per locus. 

Locus Act Cal EF1 RPB2 Btub ITS LSU 

Amplification succes (%) 99 100 100 97 100 100 100 

Number of characters 304 601 619 354 565 574 853 

Unique site patterns 234 407 507 198 380 261 147 

Substitution model used GTR-I-gamma HKY-I-gamma GTR-I-gamma GTR-I-gamma HKY-I-gamma GTR-I-gamma GTR-I-gamma 

Number of generations (1000×) 10 197 

Total number of trees (n) 22 962 

Sampled trees (n) 17 222 

In clade 5 (92 %, 63 strains) of the main Septoria clade two 

main clusters are found. At the base of the subclade 5a (77 %, 52 

strains), two strains of S. clematidis (CBS 108983–4) and Septoria 

sp. (CPC 19716) originating from Searsia laevigatum in South 

Africa. This cluster furthermore comprises three strains isolated 

from Hibiscus spp., viz., S. hibiscicola (CBS 128611, 128615) and S. 

abei (CBS 128598), and two main groups, one with S. anthurii (CBS 

148.41, 346.58), S. sisyrinchii (CBS 112096), the Chromolaena 

fungi S. chromolaenae (CBS 113373) and S. ekmanniana (CBS 

113385, 113612), and S. passiflorae (CBS 102701) and S. 

passifloricola (CBS 129431), and a second group comprising at 

the base S. eucalyptorum (CBS 118505; Crous et al. 2006b), and 

furthermore S. justiciae (CBS 128610, 128625, and CPC 12509), 

S. linicola (CBS 316.37), S. cucubali (3 strains, including CBS 

124874, an endophytic isolate from Fagus leaf litter), S. lepidiicola 

(CBS 128635) and and a partially unresolved cluster of 23 strains 

comprising the plurivorous S. protearum and S. citri complex. A 

small well-supported cluster (100 %) contains S. verbenae (CBS 

113438, 113481), two unidentified species of Septoria (CPC 19304, 

from Vigna unguiculata subsp. sesquipedalis and CPC 19793, from 

Syzygium cordatum), and M. coacervata (CBS 113391). Subclade 

5b (100 %, 11 strains) comprises S. helianthicola (CBS 122.81), 

three strains of S. stellariae, CBS 503.76 identified as S. acetosae, 

three strains of S. astragali, “Cercospora sp.” (CBS 112737), and 

furthermore S. hippocastani (CBS 411.61 and MP11). 

Examining the distribution of host families throughout the tree, 

an interesting disjunct pattern is found for the families that are 

represented by more than a few specimens (see legend in Fig. 2). 

For example, the 28 species infecting Asteraceae are found in all 

clades and most subclades of the tree, including Sphaerulina; nine 

species infecting Apiaceae are found in clade 3 and subclades 

4a–d of Septoria; 10 species of Rosaceae in Septoria clades 4, 5 

and Sphaerulina (clades 1 and 2); six species infecting Lamiaceae 

are dispersed in subclades 4b, c, and d-1. 

TAXONOMY 

Caryophylloseptoria Verkley, Quaedvlieg & Crous, gen. 


Etymology: Named after the plant family on which these taxa occur, 

Caryophyllaceae. 

Conidiomata pycnidial, epiphyllous or predominantly epiphyllous, 

globose to subglobose, or slightly depressed, with a central 

ostiolum. Conidiomatal wall composed of textura angularis or 

globulosa-angularis. Conidiogenous cells hyaline, holoblastic, 

proliferating percurrently 1–many times with indistinct annellations, 


233


Fig. 3. Caryophylloseptoria lychnidis. A. CBS 109098, colony on OA. B. Ibid., on CMA. C. Conidia and conidiogenous cells in planta (CBS 109098). D. Conidia on OA (CBS 

109098). Scale bars = 10 µm. 

or (in addition) proliferating sympodially. Conidia cylindrical, straight, 

curved or flexuous, multiseptate, not or somewhat constricted 

around the septa, hyaline, contents with several oil-droplets and 

granular material in each cell. 

Type species: Caryophylloseptoria lychnidis (Desm.) Verkley, 

Quaedvlieg & Crous. 

Caryophylloseptoria lychnidis (Desm.) Verkley, Quaedvlieg 

& Crous, comb. nov. MycoBank MB804470. Fig. 3. 

Basionym: Septoria lychnidis Desm., Annls Sci. Nat., sér. 3, Bot. 

11: 347. 1849. 

For extended synonymy see Shin & Sameva (2004). 

Description in planta: Symptoms leaf spots circular, whitish to pale 

yellow, surrounded by a brown border; Conidiomata pycnidial, 

epiphyllous, several in each leaf spot, globose to subglobose, dark 

brown, semi-immersed, 50–100(–120) µm diam; ostiolum central, 

initially circular, 25–45 µm wide, later more irregular and up to 

100 µm wide, surrounding cells concolorous or somewhat darker; 

conidiomatal wall 10–20µm thick, composed of textura angularis 

without distinctly differentiated layers, the cells 3–5 µm diam, 

the outer cells with brown, somewhat thickened walls, the inner 

cells with hyaline and thinner walls; Conidiogenous cells hyaline, 

cylindrical and tapering gradually towards the apex, or narrowly 

ampulliform with a relatively wide and long neck, holoblastic, 

proliferating percurrently 1–many times with indistinct annellations, 

rarely also proliferating sympodially, 6–17.5(–22) × 3–4(–5) µm. 

Conidia cylindrical, straight, more often slightly curved or flexuous, 

with a narrowly to broadly rounded, sometimes more distinctly 

pointed apex, towards the broadly truncate base barely attenuated, 

(0–)3–5(–7)-septate, not constricted around the septa, hyaline, 

contents with several oil-droplets and minute granular material in 

each cell in the living state, with inconspicuous oil-droplets and 

granular contents in the rehydrated state, (22–)39–75(–85) × 2–3 

µm (rehydrated). Sexual morph unknown. 

Description in vitro: Colonies on OA (3–)4–6 mm diam in 12 d (7–11 

mm in 3 wk), with an even, pure yellow to straw, glabrous margin, 

the pigment diffusing into the surrounding medium; colonies 

spreading, but in the centre quite distinctly elevated, immersed 

mycelium pure yellow to straw, later locally citrine-green or citrine; 

after 10–15 d darkened by numerous immersed or superficial 

pycnidia arranged in random patterns, the outer wall of the 

superficial pycinidia entirely covered by white to glaucous hyphae, 

tardily releasing initially buff to straw, later salmon conidial slime; 

reverse pure yellow, but centre olivaceous and citrine to greenish 

olivaceous after 3 wk. After incubation over about 7 wk olivaceousblack 

sectors become visible in the colony consisting mostly of 

immersed strands of dark-walled hyphae, alternating with yellow 

sectors; some colonies develop wider sectors that remain yellow 

above, but more ochreous on reverse. Colonies on CMA 4–6 mm 

diam in 12 d (9–12 mm in 3 wk), as on OA, but sporulating earlier. 

Colonies on MEA 2–4 mm diam in 12 d (5–7(–9) mm in 3 wk; 17–24 

mm in 7 wk), with an even to ruffled, colourless to buff, glabrous 

margin; no diffusing pigment seen; colonies restricted, irregularly 

pustulate up to 3 mm high, the surface dark, blackish or chestnut, 

covered by a short, dense mat of white to glaucous-grey, after 7 

wk straw to pale yellow, aerial mycelium; conidiomata releasing 

droplets, later larger masses of first whitish, then salmon conidial 

slime; reverse brown-vinaceous in the centre, surrounded by hazel 

or cinnamon areas. Colonies on CHA 4.5 mm diam in 3 wk (24 mm 

in 7 wk); colony as on MEA, but the surface almost entirely hidden 

under a dense mat of woolly, white aerial mycelium, locally with a 

pure yellow to straw haze which later becomes more intense, and 

a yellowish pigment diffusing into the surrounding medium; reverse 

234


Fig. 4. Caryophylloseptoria silenes. A–C. Colonies CBS 109100. A. On OA. B. On CHA. C. On MEA. D. Conidia and conidiogenous cells in planta (CBS H-21160). E. Ibid., on 

OA (CBS 109100). F–G. Conidia on OA (CBS 109100). Scale bars = 10 µm. 

umber to sienna; densely aggregated superficial conidiomata in the 

centre releasing masses of amber to pale salmon conidial slime. 

Conidiomata pycnidial, as in planta, but somewhat larger, 70–145 

µm diam, mostly single, sometimes merged into complexes, 

without differentiated ostiolum; conidiogenous cells as in planta, 

proliferating percurrently with distinct annellations or sympodially, 

8.5–25 × 3.5–6 µm; conidia cylindrical, straight, slightly curved or 

flexuous, with a rounded apex, lower part barely attenuated into 

a broad truncate base, (0–)1–5-septate, not constricted around 

the septa, hyaline, with several oil-droplets and minute granular 

material in each cell, (44–)77–94.5 × (2–)2.5–3 µm. 

Hosts: Lychnis spp. and Silene spp. (incl. Melandrium). 

Material examined: Austria, Tirol, Inntal, near Telfs, on living leaves of Silene 

pratensis (syn. M. album), 4 Aug. 2000, G. Verkley 1047, CBS H-21161, living 

culture CBS 109098, 109102; same loc., host, date, G. Verkley 1048, CBS H-21162, 

living culture CBS 109099, 109101; Netherlands, Hilversum, on living leaves of 

Silene dioica (syn. Melandrium rubrum), 22 June 1985, H.A. van der Aa 9524, CBS 

H-18112. 

Notes: This fungus has been reported from several species of 

Lychnis and Silene (including Melandrium), and the size ranges 

of conidia given by various authors differ considerably. In the 

original description by Desmazières, the fungus was characterised 

as having 5–7-septate conidia, measuring 50–70 ×2.5–3 µm, in 

widely opening pycnidia. Diedicke (1915) gave the same spore 

measurements, but Grove (1935) reported 30–50 × 2–3 µm, while 

Jørstad (1965) gave different ranges on different hosts (overall 

extremes 27–72 × 2–3 µm). Radulescu et al. (1973) reported 30–76 

× 2.2–3.3 µm, and Vanev et al. (1997) 26–93.5 × 1.5–3.2 µm. The 

characters of the Austrian material studied here generally agree 

well with previous records, and the range of conidial sizes agrees 

best with that given by Vanev et al. (1997). The authors cited above 

have listed various names as synonyms of S. lychnidis, including 

S. lychnidis var. pusilla (= S. pusilla). Two strains isolated from 

Lychnis cognata in South Korea (CBS 128614, 128630) first also 

identitifed as S. lychnidis, were shown by sequence analyses to 

belong to a distinct species, for which the name C. pseudolychnidis 

is introduced by Quaedvlieg et al. (2013). 

Caryophylloseptoria silenes (Westend.) Verkley, 

Quaedvlieg & Crous, comb. nov. MycoBank MB804471. 

Fig. 4. 

Basionym: Septoria silenes Westend., in Westendorp & Wallays, 

Herb. crypt. Belge, Fasc. 19, no 955. 1854; Bull. Acad. R. Belg. Cl. 

Sci., Sér. 2, 2: 575. 1857. 

Description in planta: Symptoms leaf spots circular or elliptical, 

pale yellow to pale brown, surrounded by a dark purplish border; 

Conidiomata pycnidial, amphigenous but predominately epiphyllous, 

numerous in each leaf spot, globose to subglobose, immersed, 


235


50–80(–100) µm diam; ostiolum central, initially circular, 20–45 

µm wide, later more irregular and up to 50 µm wide, surrounding 

cells somewhat darker; conidiomatal wall only 10–15 µm thick, 

composed of textura angularis without distinctly differentiated 

layers, the outer cells with brown, somewhat thickened walls and 

4–7.5 µm diam, the inner cells hyaline and thin-walled and 3.5–5 

µm diam; Conidiogenous cells hyaline, ampuliform, or cylindrical 

and widest near the apex, hyaline, holoblastic, proliferating 

percurrently 1–several times with distinct scars (annellations), 

sympodial proliferation not observed, 4–10 × 3–5 µm. Conidia 

cylindrical, straight or slightly curved, with a rounded apex, lower 

part attenuated more or less abruptly into a broad truncate base, 

(0–)1(–4)-septate, somewhat constricted around the septa, hyaline, 

contents with several oil-droplets in each cell in the living state, with 

conspicuous oil-droplets and granular contents in the rehydrated 

state, 21–37 × 2–3.5(–4) µm (rehydrated; in turgescent state up to 

4.5 µm wide). Sexual morph unknown. 

Description in vitro: Colonies on OA 7–9 mm diam in 12 d (7–10 mm 

in 3 wk; 21–23 mm in 7 wk), with an even, later undulating, pure 

yellow to luteous, glabrous margin, the pigment diffusing into the 

medium around the colony; colonies spreading, but in the centre 

quite distinctly elevated, immersed mycelium luteous to ochreousorange, 

darkened by numerous simple, first brownish, then black 

pycnidia arranged in concentric patterns, releasing droplets of initally 

milky white, later pale pure yellow conidial slime; immersed mycelium 

later mostly luteous to sienna, much darker after 7 wk; most of the 

colony covered by a high, woolly-floccose mat of pale grey, later 

straw to pure yellow aerial mycelium; reverse luteous, in the centre 

umber, ultimately becoming almost black. Colonies on CMA 5–7 

mm diam in 12 d (7–9 mm in 3 wk; 18–19 mm in 7 wk), as on OA, 

but immersed mycelium and (more scarce) aerial mycelium more 

intensely pigmented, immersed mycelium appearing rust to sienna 

after 3, but mostly black after 7 wk, and conidial slime earlier pure 

yellow. Colonies on MEA 3–5 mm diam in 12 d (5–9 mm in 3 wk; 17– 

20 mm in 7 wk), with a ruffled, yellowish, glabrous margin; diffusing 

yellow pigment distinct around the colony; colonies restricted, 

irregularly pustulate up to 3 mm high, the surface dark, blackish or 

chestnut, covered by a short, dense, almost pruinose mat of grey 

to pure yellow aerial mycelium; conidiomata releasing droplets of 

initially pale pure yellow, later almost amber conidial slime; reverse 

chestnut or blood. Colonies on CHA 3.5–5 mm diam in 12 d (7–8 mm 

in 3 wk; 12–17 mm in 7 wk), with an even or irregular margin, mostly 

hidden underneath white aerial hyphae; yellow pigment very clear 

diffusing beyond the colony margin after 3 wk; colonies restricted, 

conical or hemispherical, the surface very dark, but mostly covered 

by a dense mat of woolly, initially white, then pure yellow aerial 

mycelium; reverse sienna to fulvous. Sporulating scarcely after 3, but 

more intensely after 7 wk, cirrhi or droplets of pale pure yellow, later 

amber conidial slime released by superficial conidiomata. 

Conidiomata pycnidial, as in planta, but larger, 90–155 µm 

diam, mostly single, sometimes merged into complexes with several 

ostioli; conidiogenous cells as in planta, but often with a more 

elongated neck, proliferating percurrently with distinct annellations 

or sympodially, 7–17 × 3–5 µm; conidia cylindrical, straight or 

slightly curved, with a rounded apex, lower part attenuated more 

or less abruptly into a broad truncate base, (0–)1–3(–4)-septate, 

somewhat constricted around the septa, hyaline, with several oildroplets 

in each cell, (24–)26.5–35(–42) × 3–4(–5) µm. 

Hosts: Silene spp. 

Material examined: Austria, Tirol, Ötztal, Horlachtal, Mühl near Niederthai, alt. 1500 

m, on living leaves of Siline nutans, 3 Aug. 2000, G. Verkley 1041, CBS H-21160, 

living cultures CBS 109100, 109103. 

Notes: Jørstad (1965) examined type material from BR in 

Westend., Herb. crypt. Belge 955, on Silene armeria. He reported 

that among numerous immature pycnidia were a few thin-walled 

pycnidia with 0-septate conidia measuring 21–24 × 2–2.5 µm, but 

in his opinion there was no doubt that collections from other hosts 

like Silene cucubalus (= S. inflata), and from Silene rupestris with 

predominantly 1-septate spores up to 31 µm in length belonged 

to the same species. In the material collected in Austria, we have 

observed predominantly 1-septate conidia, but conidial length did 

vary in different fruitbodies: some pycnidia produced conidia 21– 

28 µm in length, others conidia measuring 26–37 µm in length. 

However, isolates from these pycnidia were similar in colony 

characters and conidia produced did not show such differences in 

size range. 

Priest (2006) noted that there are at least two taxa of Septoria 

occurring on Silene, a short-spored taxon represented by S. 

silenes, and a long-spored taxon for which the name S. silenicola 

applies. This author referred all collections from Australia on this 

host genus to S. silenicola, for which conidia measure (34–)48– 

65(–85) × 2–2.5(–3) µm. 

As pointed out by Petrak (1925) and Jørstad (1965), several of 

the Septoria described on Silene spp. (and Melandrium) are likely 

to be conspecific with S. silenes. Septoria dominii Bubák 1905 was 

already placed in the synonymy of S. silenes by Jørstad (1965), 

and the same could be correct for S. dimera from Silene nutans. 

According to the original diagnosis, the conidia of S. dimera are 

1-septate and measure 28–32 × 4 µm. Radulescu et al. (1973) and 

Markevičius & Treigienė (2003) treated S. dimera as a separate 

species next to S. silenes, reporting measurements for conidia of S. 

dimera as 25–40 × 3–4 µm, and 21–35 × 3.2–4.3 µm, respectively. 

Vanev et al. (1997) also treated S. dimera, reporting conidial 

measurements 26–65 × 2.5–4 µm, but they included material from 

Silene spp. and Cucubalus baccifer. 

Caryophylloseptoria spergulae (Westend.) Verkley, 

Quaedvlieg & Crous, comb. nov. MycoBank MB804472. 

Fig. 5. 

Basionym: Septoria spergulae Westend., in Westendorp & Wallays, 

Herb. crypt. Belge, Fasc. 23-24, no. 1155. 1857; Bull. Acad. R. 

Belg. Cl. Sci., Sér. 2, 2: 576. 1857. 

Description in planta: Symptoms absent. Conidiomata pycnidial, 

black, in dense groups on dead stems and leaves, only partly 

immersed in the host tissue, globose or slightly depressed, 

(50–)75–150 µm diam; ostiolum circular, central, 10–12.5 µm 

wide, without distinctly differentiated cells; pycnidial wall with an 

outer layer of textura globulosa-angularis containing cells 8–12 

µm diam with brown walls, thickened unevenly up to 3µm, and 

an inner layer of textura globulosa-angularis containing cells 5–8 

µm diam with hyaline or pale brown walls. Conidiogenous cells 

hyaline, ampuliform, or elongated ampulliform with a distinct neck, 

hyaline or very pale brown near the base, holoblastic, proliferating 

percurrently 1–many times with indistinct annellations, also 

sympodially, 5–10(–16) × 3–5 µm. Conidia cylindrical, regularly 

curved, or abruptly bent in the lower cell, gradually attenuated to 

the rounded apex, gradually or more abruptly attenuated into a 

truncate base, 1(–2)-septate, not or indistinctly constricted around 

the septum, hyaline, contents rich in small guttulae, minutely 

236


Fig. 5. Caryophylloseptoria spergulae. A, B. Colonies CBS 109010. A. On OA. B. On MEA. C. Conidia and conidiogenous cells in planta (CBS H-21150). D–H. Conidia on OA 

(CBS 109010). Scale bars = 10 µm. 

granular material and large vacuoles in the living state, oil-droplets 

merged into larger guttules in the rehydrated state, (18–)24–33 

(–40) × 2.0–2.5(–3.0) µm (rehydrated). Sexual morph unknown. 

Description in vitro: Colonies on OA less than 2 mm diam after 2 

wk (6–8 mm in 28 d), restricted, though not much elevated, with 

an even, colourless, glabrous margin; colony surface covered by 

a dense continuous or discontinuous mat of grey, finely felted to 

somewhat woolly, low aerial mycelium, agar around the colony 

showing a yellow diffusing pigment; immersed mycelium pale 

luteous to saffron, reverse concolorous, but olivaceous-black 

under areas with well-developed aerial mycelium or conidiomata. 

Colony sporulating in the centre after about 2 wk, with spores in 

large pale salmon droplets oozing from pycnidioid complexes. 

Colonies on CMA 8–10 mm diam in 28 d, as on OA, but immersed 

mycelium soon darkening and olivaceous-black, while the aerial 

mycelium is somewhat more greenish, and the mat denser and 

more continuous; reverse olivaceous-black. Colonies on MEA 5 

mm diam in 2 wk (8–10 mm in 28 d), restricted, with an even, buff, 

glabrous margin; colony surface black, but with a diffuse mat of 

greyish white, often with some sulphur yellow (centre), woolly aerial 

mycelium; fruitbodies developing tardily on the colony surface, 

sporulating with large, dirty white to pale reddish masses in watery 

droplets; reverse dark brick to olivaceous-black. Colonies on CHA 

7–9 mm diam in 2 wk, as on MEA, but aerial mycelium higher and 

denser, in the centre also conspicuously yellowish-pale citrine. No 

sporulation observed. 

Conidiomata mostly olivaceous-brown, irregular merged 

complexes of initially closed, but soon widely opening stromata, 

only rarely pycnidial and structurally similar to those on the natural 

substratum. Conidiogenous cells hyaline, ampuliform, or elongated 

ampulliform with a relatively long neck, hyaline or very pale brown 


237


near the base, holoblastic, proliferating percurrently 1–many times 

with indistinct annellations, also sympodially, mostly after one or 

more percurrent proliferations, 7– 14(–22) × 3–5 µm. Conidia on 

OA hyaline, pale salmon in mass, cylindrical and regularly curved, 

or abruptly bent in the lower or upper cell, gradually attenuated 

to the rounded apex, more abruptly attenuated into a truncate 

base, contents granular with large vacuoles, 1(–3)-septate, not or 

indistinctly constricted around the septa, contents rich in minute 

guttulae and granular material, 25.5–41 × (2.0–)2.5–3.0(–4.5) µm. 

Hosts: On dead leaves and stems of Spergula spp. 

Material examined: Belgium, Beverloo, on dry leaves and stems of Spergula 

arvensis, M. Torquinet s.n., isotype BR-MYCO 159328-54, also distributed 

in Westendorp & Wallay, Herb.crypt.Belg., Fasc. 23-24: no.1155. Germany, 

Brandenburg, Kreis Nieder-Barnim, near Prenden, on leaves and stems of Spergula 

vernalis, 24 July 1920, H. & P. Sydow s.n., distributed in Sydow, Mycotheca 

germanica 1688, CBS H-4765. Netherlands, on Dianthus caryophyllus, Schouten 

s.n., CBS 397.52 (sub S. dianthi Desm.); Prov. Gelderland, ‘t Harde, Doornspijkse 

Heide, De Zanden, on decaying leaves of Spergula morisonii, A. Aptroot 48300, 13 

June 2000, epitype designated here CBS H-21150 “MBT175350”, living culture 

ex-epitype CBS 109010. 

Notes: This fungus was originally described from dry leaves 

and stems of Spergula arvensis by Westendorp, who described 

the conidia as 30 × 2.5 µm. The type from BR is well-preserved 

and rich in fruitbodies on leaves and stems, where conidia are 

1(–2)-septate, 20–38 × 2–2.5(–3) µm. The collection Aptroot 

48300 from Spergula morisonii agrees in morphology and can be 

identified as conspecific, although it contains a larger proportion 

of 2-septate conidia (that are mostly 30–40 µm long) than in the 

type. The material on Spergula vernalis that was distributed as 

Mycotheca germanica 1688 morphologically also agrees with these 

collections. 

Other names were later introduced for Septoria on members of 

the plant genus Spergularia (= Alsine), which is closely related to 

Spergula: S. alsines Rostr. 1903 from Spergularia sp., conidia 20– 

31 × 2–3 µm formed in 55–120 µm wide pycnidia (Teterevnikova- 

Babayan 1987; conidia 20–25 × 2–3 µm and 3-septate, in the 

original diagnosis of Rostrup 1903, based on material from 

Alsine verna non Spergula vernalis), S. spergulariae 1903, on 

Spergularia rubra (conidia 30–45 × 2.5–3 µm, “multiseptate”), S. 

vandasii 1906, on Alsine glomerata, and S. spergularina 1945, 

on Spergularia longipes (no conidial measurements available). 

Some of these names could be synonymous with S. spergulae or 

perhaps S. alsines, but in order to corroborate this, new material 

needs to be collected and compared to the types. According to 

Teterevnikova-Babayan (1987), S. alsines differs from S. spergulae 

in conidial shape in that the conidial base is more truncate than 

in S. spergulae, and in that it is capable of also killing Minuartia 

glomerata. Rhabdospora alsines Mont. 1892, which was described 

from dead stems of Alsine tenuifolia, is unlikely to be conspecific 

with S. spergulae, as its conidia were described as 16–18 × 2 µm 

and 1-septate. 

Muthumary (1999) studied type material of S. dianthi 1849 (PC 

344) and by the drawings he made of it the conidia of this fungus 

and those of S. spergulae appear very similar in shape. Muthumary 

reported that the conidia of S. dianthi were 32–48 (av. 40) × 3–4 (av. 

3) µm, and mostly 1-, rarely 2-septate. Given these measurements, 

on average, the conidia in the type of S. dianthi are clearly longer 

than in S. spergulae (on average below or around 30). Moreover, 

S. dianthi is a fungus causing leaf spots on several Dianthus spp., 

while S. spergulae is only known from dry and dead host tissues, 

and is therefore believed to be saprobic (and possibly endophytic). 

CBS 109010 and the only strain available for S. dianthi (CBS 

397.52) show 100 % sequence homology of the LSU, ITS, Btub 

and Cal, while there are only minor differences in Act (99.25 %), 

EF (97.54 %), and RPB2 (99.42 %). Further work is required to 

establish that S. dianthi and S. spergulae are truely distinct taxa. 

Septoria Sacc., Syll. Fung. 3 : 474. 1884. nom. cons. 

Type species : S. cytisi Desm. 

A generic description is provided by Quaedvlieg et al. (2013, this 

volume). 

Septoria aegopodii Desm. ex J. Kickx, Pl. Crypt. Fland. 1: 

427. 1876 [Annls Sci. Nat., sér. 6, 7: no 616. 1878?]. Fig. 6. 

= Septoria podagrariae Lasch, in Rabenh., Herb. mycol. I, no 458. 1843. 

nomen nudum. 

= Sphaeria podagrariae Roth, Catal. Bot. 1: 230. 1797. 

≡ Mycosphaerella podagrariae (Roth : Fr.) Petr., Annls mycol. 19 (3/4): 

203. 1921. 

= Cryptosporium aegopodii Preuss, Linnaea 24: 719 (Fungi Hoyersw., no. 

322). 1853. 

≡ Phloeospora aegopodii (Preuss) Grove, British Stem- and Leaf-fungi 

(Coelomycetes) 1: 434. 1935. 

≡ Septoria aegopodii (Preuss) Sacc., Syll. Fung. 3: 529. 1884 [non Desm. 

1878]. 

?= Septoria podagrariae var. pimpinellae-magnae Kabát & Bubák, in Bubák & 

Kabát, Ber. naturw.-med. Ver. Innsbruck 30: 19-36 (extr. 11). 1906. 

= Mycosphaerella aegopodii Potebnia, Annls mycol. 8(1): 49. 1910. 

Description in planta: Symptoms leaf spots numerous but small, 

angular and delimited by veinlets, visible on both sides of the leaf, 

white to pale yellow. Conidiomata pycnidial, developing soon after 

first discolouration of the host tissue, predominantly epiphyllous, 

mostly also visible from the underside of the lesion, several 

scattered in each leaf spot, globose to subglobose, pale to dark 

brown (drying black), immersed, 125–190 µm diam, releasing 

conidia in white cirrhi; ostiolum central, initially circular and 17–35 

µm wide, later becoming more irregular and up to 100 µm wide, 

surrounding cells dark brown, with thickened cell walls; conidiomatal 

wall except for the part surrounding the ostiolum poorly developed, 

about 10–20 µm thick, composed of pale brown to hyaline 

angular cells 3.5–8 µm diam with thin walls. Conidiogenous cells 

hyaline, discrete, cylindrical to narrowly or broadly ampulliform, 

holoblastic, proliferating sympodially, 8–15(–18) × 2.5–4.5 µm. 

Conidia filiform-cylindrical, straight, curved to somewhat flexuous, 

attenuated gradually to a relatively broadly rounded apex and 

broadly truncate base often provided with a collar of gelatinous 

material, (0–)1–2(–3)-septate (second and later septa very thin 

and easily overlooked), not constricted around the septa, hyaline, 

contents with numerous minute oil-droplets and granular material 

in each cell in the living state, with minute oil-droplets and granular 

contents in the rehydrated state, (30–)55–95(–115) × 3.5–4 µm 

(living; 30–72(–80) × 2.5–4 µm, rehydrated). 

Description in vitro: All attempts to grow the isolates from conidia 

failed. Some conidia germinated at the apical cells, but mycelia 

died within 1–2 d after germination. 

Hosts: Aegopodium podagraria and Pimpinella sp. 

Material examined: Austria, Tirol, Ötztal, Ötz near Habichen, on living leaves of 

Pimpinella sp., 24 July 2000, G. Verkley 1001, CBS H-21187. Netherlands, Prov. 

Overijssel, Losser, in garden at Mollenbergstraat, on living leaves of Aegopodium 

podagraria, June 1999, G. Verkley 800, CBS H-21192; same substr., Prov. Overijssel, 

238


Fig. 6. Septoria aegopodii. A–E. Conidia in planta. A–C. CBS H-21262. D, E. CBS H-21199. Scale bars = 10 µm. 

Losser, Arboretum Poort-Bulten, June 1999, G. Verkley 801, CBS H-21193; same 

substr., Prov. Utrecht, ‘s Graveland, Gooilust, 5 Sep. 1999, G. Verkley 916, CBS 

H-21199; same substr., Prov. Limburg, St. Jansberg, near Plasmolen, 9 Sep. 

1999, G. Verkley 931, CBS H-21211; same substr., Prov. Zeeland, Zuid-Beveland, 

Community of Borsele, Schouwersweel near Nisse, 27 Aug. 2001, G. Verkley 1116, 

CBS H-21165; same substr., Prov. Utrecht, Soest, 29 July 2008, G. Verkley 5020, 

CBS H-21262. 

Notes: This species is common on Aegopodium podagraria, 

especially on plants growing under less favourable conditions. 

Jørstad (1965) noted that in autumn the pycnidia are commonly 

accompanied by immature perithecia (or by “sclerotia”) of 

Mycosphaerella aegopodii in Sweden, but we have not found any 

in The Netherlands. According to van der Aa (pers. comm.), the 

sexual morph only matures in montane habitats. Aptroot (2006), 

who studied herbarium specimens collected at high altitudes 

in several localities in Europe also did not observe any mature 

ascomata. Type material of M. podagrariae could not be located 

(Aptroot 2006). Simon et al. (2009) studied the cellular interactions 

between M. podagrariae and Aegopodium podagraria based on 

German material (no cultures preserved). 

We have not seen the type of S. podagrariae var. pimpinellaemagnae 

1906 described from Pimpinella magna (= P. major?) in 

Tirol, but since the conidial characters given by Saccardo & Trotter 

(1913, 45–60 × 2.5–4 µm, 3-septate) are well within the range of S. 

aegopodii, it is placed here tentatively as a synonym. On Pimpinella, 

eight other Septoria species or varieties have been described in the 

literature, but these could not be studied here. The oldest available 

name would be S. pimpinellae Ellis 1893 (later homonyms Laubert 

1920 and Hollós 1926). According to the diagnoses the conidial sizes 

described for these taxa largely overlap, and range from 15–35 × 

1–1.5(–2) µm, thus all considerably smaller than in S. aegopodii. 

Septoria aegopodina Sacc., Michelia 1: 185. 1878. Fig. 7. 

= Septoria aegopodina var. villosa Gonz. Frag., Assoc. españ. Progr. Cienc. 

Congr. Oporto, 6. Cienc. natur.: 47. 1921. 

= Septoria aegopodina var. trailii Grove, British Stem-and Leaf-Fungi 

(Coelomycetes) 1: 396. 1935. 

Description in planta: Symptoms leaf spots numerous, indefinite 

and soon covering large parts of the leaf lamina, visible on both 

sides of the leaf, first yellow then pale orange-brown. Conidiomata 

pycnidial, predominantly hypophyllous, scattered or gregarious, 

globose to subglobose, pale to dark brown, immersed, 90–160 µm 

diam, releasing conidia in white cirrhi; ostiolum central, circular and 

15–25 µm wide, surrounded by cells with dark brown to almost 

black, thickened walls; conidiomatal wall 10–28 µm thick, composed 

of an outer cell layer of pale brown to hyaline isodiametric angular 

or globose cells, 3.5–8 µm diam with thickened walls, and an inner 

layer of one or more hyaline cells with not or only slightly thickened 

walls. Conidiogenous cells hyaline, discrete, mostly broadly 

ampulliform, holoblastic, rarely proliferating sympodially, possibly 

also percurrently but no annellations visible, 4–7(–8) × 3–4.5 µm. 

Conidia filiform to filiform-cylindrical, straight or curved, attenuated 

gradually to a narrowly rounded to somewhat pointed apex, and 

attenuated gradually or more abruptly to a narrowly truncate base, 

(0–)1–3-septate, not constricted around the septa, hyaline, with 

numerous minute and several larger oil-droplets in each cell in the 

living state, and minute oil-droplets and granular contents in the 

rehydrated state, (22–)30–42.5 × 1.5–2(–2.5) µm (rehydrated). 

Sexual morph unknown. 

Description in vitro (20 ºC, diffuse daylight): Colonies on OA 

7–10 mm diam in 2 wk, with a very narrow, glabrous and rosybuff 

margin; colony restricted, somewhat elevated, immersed 

mycelium colourless to faintly brick, or much darker, brownvinaceous, 

but mostly hidden under a dense, woolly mat of pure 

white to faintly yellow aerial mycelium; reverse olivaceous-black 

to dark brick; a vinaceous pigment diffusing into the surrounding 

medium. Colonies on MEA 8–15 mm diam in 2 wk, the margin 

covered by pure white aerial hyphae; colony restricted, irregularly 

postulate in the central area, mostly covered by a dense woollyfloccose 

mat of smoke grey aerial mycelium, but after 2 wk 

numerous glabrous, black conidiomata appear on the colony 

surface in the centre, releasing milky white conidial slime. 

Reverse of colony olivaceous-black. 


239


Fig. 7. Septoria aegopodina. A, B. Colonies CBS 123740. A. On OA. B. On MEA. C–F. Conidia in planta (CBS H-21249). G. Conidia and conidiogenous cells in planta (CBS 

H-21249). H, I. Conidia on OA (CBS 123741). J. Conidia on MEA (CBS 123740). Scale bars = 10 µm. 

Conidia on MEA elongated ellipsoidal to cylindrical, straight 

to distinctly curved, rounded to narrowly pointed at the apex, 

attenuated gradually to a narrowly truncate base, 0–1-septate, 

0-septate 8–12 × 2–2.5(–3), 1-septate 10–21 × 2–2.5 μm; Conidia 

on OA cylindrical, straight or slightly to distinctly curved, narrowly 

rounded to slightly pointed at the apex, attenuated gradually to a 

narrowly truncate base, 1–3-septate, (16–)20–32 × 1.5–2 μm. 

Hosts: Aegopodium podagraria and Pimpinella spp. 

240


Fig. 8. Septoria anthrisci. A. Conidia and conidiogenous cells in planta (CBS H-21185). B. Conidia on OA (CBS 109020). Scale bars = 10 µm. 

Material examined: Czech Republic, Moravia, Veltice, Forest of Rendez Vous, 

on living leaves of Aegopodium podagraria, 16 Sep. 2008, G. Verkley 6013, CBS 

H-21249, living cultures CBS 123740, 123741. 

Notes: Morphologically, the material from the Czech Republic 

available here agrees well with S. aegopodina as described by 

Vanev et al. (1997) and Shin & Sameva (2004), although the 

pycnidia are larger than described by these authors (55–85 μm 

diam). The species can easily be distinguished from S. aegopodii 

occurring on the same host plant, as the conidia of that fungus 

are considerably larger (30–115 × 3.5–4 µm), and appear 

predominantly 1-septate. The conidia more closely resemble 

those of S. anthrisci. The diagnoses of S. aegopodina var. trailii 

based on material on Pimpinella saxifraga, and of S. aegopodina 

var. villosa on Pimpinella villosa, agree with the description of the 

type variety. Both varieties are therefore considered synonyms of 

S. aegopodina. In the multigene phylogeny S. aegopodina groups 

fairly closely with S. oenanthicola, S. sii and S. oenanthis from the 

same host family (Apiaceae), but other taxa from that family like 

S. anthrisci are relative distant and belong elsewhere the Septoria 

clade (Fig. 2). Other isolates grouping with S. aegopodii include 

those of S. mazi from Mazus japonicus (Scrophulariaceae), S. 

campanulae from Campanula takesimana (Campanulaceae), and 

S. gentianae from Gentiana scabra var. buergeri (Gentianaceae). 

Septoria anthrisci Pass. & Brunaud, Rev. Mycol. (Toulouse) 

5: 250. 1883 [non P. Karst., Meddn Soc. Fauna Flora fenn. 

13: 10. 1884]. Fig. 8. 


circular to elliptical, visible on both sides of the leaf, the centre white 

to pale ochreous, surrounded by a relatively narrow, somewhat 

elevated, dark reddish brown to black margin. Conidiomata 

pycnidial, epiphyllous, sometimes also visible from the underside 

of the lesion, mostly one, rarely up to three in each leaf spot, 

subglobose to lenticular, sometimes becoming cupulate, brown 

to black, immersed, 115–190 µm diam; ostiolum central, initially 

circular and 30–55 µm wide, later becoming more irregular and 

up to 100 µm wide, surrounding cells concolorous; conidiomatal 

wall about 12–20 µm thick, composed of an outer layer of pale 

brown angular cells 4.5–7 µm diam with somewhat thickened 

walls, and an inner layer of thin-walled, pale yellow angular 

to globose cells 2.5–5 µm diam. Conidiogenous cells hyaline, 

discrete, rarely integrated in 1-septate conidiophores, globose 

or narrowly or broadly ampulliform, holoblastic, mostly with a 

relatively narrow elongated neck, proliferating percurrently several 

times with distinct annellations, often also sympodially after or in 

between a few percurrent proliferations, 6–14(–18) × 2.5–5(–6) 

µm. Conidia filiform, straight, curved to flexuous, attenuated 

gradually to a narrowly pointed apex and narrowly truncate base, 

(0–)1–3(–4)-septate (septa very thin and easily overlooked), not 

constricted around the septa, hyaline, contents with several minute 

oil-droplets and granular material in each cell in the living state, with 

minute oil-droplets and granular contents in the rehydrated state, 

(18–)25–59 (–65) × 1–2 µm (living; rehydrated, 1–1.8 µm wide). 


Description in vitro: Colonies on OA 4–6(–9) mm diam in 1 wk (18– 

22 mm in 22 d), with an even, glabrous, peach, later coral margin, 

with a concolorous pigment diffusing beyond the colony margin; 

colonies after 1 wk restricted, distinctly elevated in the centre, 

immersed mycelium first peach to pale coral, then deep coral, the 

colony already appearing darker in the centre after 1 wk due to 

numerous almost black pycnidial conidiomata in part merging into 

large complexes, releasing pale whitish or rosy-buff droplets of 

conidial slime from one to several short-papillate or more elongated 

neck-like openings; reverse in the centre blood colour, surrounded 

by a first intense peach, later scarlet or coral area. Colonies on 

CMA 7–8(–9) mm diam in 1 wk (18–21 mm in 22 d), as on OA. 

Colonies on MEA 6–11 mm diam in 1 wk (24–29 mm in 22 d), with 


241


an even, almost glabrous, buff margin, without a diffusing pigment; 

colonies restricted, irregularly pustulate to hemispherical, already 

up to 4 mm high after 1 wk, immersed mycelium leaden grey to 

olivaceous-grey, covered by well-developed white to greyish, 

appressed, woolly aerial mycelium; conidiomata abundantly 

developing at the surface in the central area, releasing cirrhi of buff 

to pale luteous to rosy-buff conidial slime; reverse fuscous black to 

brown-vinaceous, surrounded by a narrow pale luteous marginal 

zone. Colonies on CHA 7–12 mm diam in 1 wk (29–31 mm in 22 d), 

as on MEA, but the surface more glaucous to glaucous blue green, 

the margin rosy-buff, and the conidial slime pale flesh. 

Conidiomata pycnidial, single, brown to black, 100–250 µm 

diam, conidiogenous cells as in planta; conidia as in planta, 25– 

55(–69) × 1.2–2 µm. 

Hosts: Anthriscus spp., and also Chaerophyllum spp. 

(Teterevnikova-Babayan 1987; Vanev et al. 1997). 

Material examined: Austria, Tirol, Ötztal, Sautens, on living leaves of Anthriscus sp., 

30 July 2000, G. Verkley 1022, CBS H-21185, living culture CBS 109019, 109020. 

Notes: According to the short and incomplete original diagnosis, 

the conidia of S. anthrisci are continuous, 40–50 µm long. The type 

host is Anthriscus vulgaris. The description of the species on the 

host agrees well with those provided by Vanev et al. (1997) and 

Teterevnikova-Babayan (1987), although the latter reported conidia 

up to 75 µm long. The species is close to S. petroselini (CBS 

182.44 and CBS 109521), from which it cannot be distinguished by 

ITS sequence, but the EF and Act sequences proved to differ by 4 

and 27 %, respectively. 

Of other Septoria species found on the family Apiaceae, only 

S. petroselini is relatively closely related. Septoria petroselini can 

be distinguished from S. anthrisci by the larger conidia (29-80 × 

1.9-2.5 mm) with up to 7 septa on the host plant, usually species of 

Petroselinum or Coriandrum. 

Septoria apiicola Speg., Boln Acad. nac. Cienc. Córdoba 

11: 294. 1888. Fig. 9. 

≡ Rhabdospora apiicola (Speg.) Kuntze, Revisio generum plantarum 3 

(2): 509. 1898. 

= Septoria apii Chester, Bull. Torrey Bot. Club 18: 371. 1891 [non Rostr., 

Gartn. Tidende 180. 1893, later homonym]. 

= Septoria petroselini var. apii Briosi & Cavara, I funghi parassiti delle piante 

coltivate de utili essicati, delineati e descritti, Fasc. 6, no 144. 1891. 

= Septoria apii-graveolentis Dorogin, Mater. Mikol. Fitopat. Ross. 1 (4): 72. 

1915. 

Description in planta: Symptoms on leaves numerous spots, 

scattered, separate but not well-delimited, circular to elliptical, or 

confluent, yellowish or pale brown and in dry conditions also with a 

white centre, visible on both sides of the leaf. Conidiomata pycnidial, 

amphigenous, single, numerous in each lesion, scattered, in small 

clusters or in more or less distinct concentric patterns, globose 

to subglobose, dark brown to black, immersed, (60–)75–170 µm 

diam; ostiolum circular, central, somewhat papillate, 15–45(– 

55) µm wide, surrounded by darker cells with thickened walls; 

conidiomatal wall composed of textura angularis, 12.5–20 µm 

thick, with an outer layer of cells, 4–6.5(–8) µm diam with brown, 

thickened walls, and an inner layer of hyaline and thin-walled 

cells 3.5–4 µm diam. Conidiogenous cells cylindrical, or broadly 

to elongated ampulliform mostly without distinct neck, hyaline, 

holoblastic, proliferating percurrently, annellations indistinct, rarely 

also sympodially, 4–8(–10) × 3.5–5 µm. Conidia filiform, straight, 

curved, or flexuous, gradually attenuated to a narrowly rounded to 

more or less pointed apex, more or less abruptly attenuated into 

a truncate base, (1–)2–3(–5)-septate, not or only inconspicuously 

constricted around the septa in the living state, hyaline, containing 

one to several relatively small oil-droplets in each cell, in the 

rehydrated state with larger oil-masses, 20–48(–56) × 2–2.5 µm 

(living; rehydrated, NT 1.5–2 µm wide). Sexual morph unknown. 

Description in vitro (based on CBS 400.54): Colonies on OA 

12–18 mm diam in 2 wk, with an even to slightly ruffled, glabrous, 

colourless margin; colonies spreading, remaining almost plane, 

immersed mycelium dull green to dark herbage green; aerial 

mycelium moderately to well-developed, woolly-floccose, white; 

dark brown to black single globose pycnidia developing after 

7–10 d scattered over the agar surface, more rarely immersed in 

the agar, 70–100(–140) µm diam, ostioli often reduced or absent, 

releasing droplets of milky white conidial slime; reverse dark bluish 

green to black, diffusing pigment absent. Conidiogenous cells as in 

planta, but more often proliferating sympodially, 4–12.5 × 3.5–4.5 

µm. Conidia as in planta, mostly 30–55(–68) × 2–2.5 µm. 

Hosts: Apium australe, A. graveolens var. graveolens (celery), A. 

graveolens var. rapaceum (celeriac), A. prostratum. 

Material examined: Italy, Perugia, culture ex leaf of Apium graveolens, deposited 

June 1959, M. Ribaldi s.n., CBS 389.59; Netherlands, culture ex Apium sp., 

deposited Aug. 1952, isolated by G. van den Ende s.n., CBS 395.52; Prov. Utrecht, 

Baarn, Cantonspark, culture ex living leaves of A.graveolens, 1953, deposited 

Oct. 1954, J.A. von Arx s.n., CBS 400.54 = IMI 092628; Prov. Limburg, Venray, 

Vreedepeel, on living leaves of A. graveolens var. graveolens, Aug. 2004, collector 

unknown (G. Verkley 3046), CBS H-21261; same substr., Noord-Brabant, between 

Zevenbergen and Zevenbergschen Hoek, 26 Aug. 2004, R. Munning (G. Verkley 

3048), CBS H-21163, living culture CBS 116465. 

Notes: According to Priest (2006), it is apparent that at least two 

species of Septoria occur on Apium spp. worldwide. Earlier studies 

demonstrated considerable variation in the dimensions of conidia 

in material on Apium spp. especially in conidial width, along with 

other minor morphological differences, and differences in leaf spot 

type (Cochran 1932, Sheridan 1968). Gabrielson & Grogan (1964) 

concluded that there was just one species involved, characterised 

by pycnidia 55–190 µm diam and conidia 10–72 × 0.9–3.0 µm. 

They accepted the name S. apiicola, and placed S. apii and S. 

apii-graveolentis in its synonymy. Jørstad (1965) placed S. apii in 

the synonymy of S. petroselini, while Sutton & Waterston (1966) 

followed Gabrielson & Grogan but described the conidia as 22–56 

× 2–2.5 µm. As was the case in the material from Australia studied 

more recently by Priest (2006; conidia 30–48 × 2–2.5 µm), most 

conidia in the collections available for the present study are 2–2.5 

µm wide. These collections proved highly homogenous in DNA 

sequences of the genes investigated and in most morphological 

characters. However, morphological and molecular investigations 

of more material on Apium from various host species and 

geographical regions is required before conclusions can be drawn 

about the number of taxa involved on this host genus. 

According to Sutton & Waterston (1966) and also Priest (2006), 

the conidiogenous cells of S. apiicola are phialidic, producing 

several conidia enteroblastically and seceding at the same level, 

and these authors did not report sympodial proliferation. In the 

material we were able to examine however, percurrent proliferation 

was mostly seen and rarely also sympodial in planta, while 

sympodially proliferating conidiogenous cells were more common 

in vitro. The difference may result from the fact that here we studied 

242


Fig. 9. Septoria apiicola. a. Colony on OA (CBS 400.54). B, C. Conidia in planta (CBS H-21261). D. Conidia on OA (CBS 400.54). E. Conidia and conidiogenous cells on OA 

(CBS 400.54). F. Ibid., in planta (CBS H-21261). Scale bars = 10 µm. 

living material, as we noted that after rehydration of the herbarium 

vouchers it is indeed very difficult to still see the details, in particular 

progressive annellations. 

Septoria astragali Roberge ex Desm., Annls Sci. Nat., sér. 

2, Bot. 19: 345. 1843. Fig. 10. 

?= Septoria astragali var. brencklei Sacc., Atti Memorie Accad. patavina 33: 

171 (as ‘brinklei’). 1917. 

Description in planta: Symptoms leaf spots circular or more 

irregular, often indefinite or delimited by a dark brown border, 

white, pale ochreous to yellowish brown, usually several on each 

leaflet. Conidiomata pycnidial, often visible on both sides of the 

leaf, amphigenous, but either predominantly hypo- (V6023) or 

epiphyllous (V1036), scattered, globose, immersed to semiimmersed, 

125–170 µm diam; ostiolum circular, central, 20–55 µm 

wide, surrounding cells somewhat darker; conidiomatal wall up to 

30 μm thick, composed of an outer layer of isodiametric to irregular 

cells 3.5–8.5 μm diam with brown walls which are thickened up to 

1 μm, and an inner layer of hyaline, thin-walled cells 3–7 μm diam. 

Conidiogenous cells hyaline, ampuliform, or elongated ampulliform 

with a distinct neck, hyaline, holoblastic, proliferating sympodially, 

and sometimes (also) percurrently 1–2 times with indistinct 

annellations, 10–17 × 5–8 µm. Conidia cylindrical, straight, 

curved, or flexuous, gradually attenuated to a narrowly rounded to 

somewhat pointed apex and a truncate base, (5–)7–9(–11)-septate, 

somewhat constricted around the septa in the living state (“T”), not 

constricted in the rehydrated state, hyaline, contents granular or 

with numerous small and a few larger oil-droplets in each cell, (85–) 

105–145 × 3.5–4 µm (living; rehydrated, 3–3.5 μm wide). Sexual 

morph unknown. 

Description in vitro: Colonies on OA 2–4 mm diam in 10 d (34–37 

mm in 7 wk), with an even or irregular, glabrous, colourless margin; 

colonies spreading, the surface plane, immersed mycelium mostly 

colourless to buff with very diffuse, short, whitish aerial mycelium, 

the centre of the colony darkened by numerous superficial and 

immersed, separate or confluent pycnidial conidiomata, the outer 


243


Fig. 10. Septoria astragali, CBS 109116. A–C. Colonies (15 C, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia and conidiogenous cells on OA (CBS 109116); E–G. Conidia 

in planta (CBS H-21258). H. Conidiogenous cells on OA (CBS 123878). I. Conidia on OA (CBS 123878). Scale bars = 10 µm. 

walls covered with short mycelial outgrowth, with a single opening 

releasing a stout cirrhus of pale whitish to rosy-buff conidial slime; 

reverse mostly olivaceous-black due to the conidiomata; after 

incubation of 5–7 wk, more of the immersed mycelium darkens 

to olivaceous-black, with traces of a red pigment especially near 

the margin, and the aerial mycelium becomes more dominant, 

white or grey. Colonies on CMA 2–3 mm diam in 10 d (27–28 mm 

in 7 wk), as on OA, but the reddish pigment at the margin more 

conspicuous in old cultures. Colonies on MEA 1.5–3 mm diam in 10 

d ((8–)14–17 mm in 7 wk), with an even to irregular, glabrous, buff 

margin; colonies first restricted, while later faster growing hyphal 

strands colonize the medium underneath the surface of the agar, 

pustulate to hemispherical, the surface first ochreous or amber, 

later olivaceous-grey or black covered by fairly dense, short, 

white aerial mycelium; some superficial or immersed pycnidial 

conidiomata formed, releasing cirrhi of pale buff conidial slime; 

reverse dark umber to brown-vinaceous. Colonies on CHA 1.5–3 

mm diam in 10 d (15–17 mm in 7 wk), with an irregular margin 

which is hardly visible from above; colonies restricted, irregularly 

pustulate to hemispherical, the surface dark brick to dark slate 

244


blue, covered by a diffuse, very short, felty, white aerial mycelium; 

abundant superficial conidiomata releasing stout cirrhi of rosy-buff 

conidial slime; reverse blood colour. 

Hosts: Astragalus spp. 

Material examined: Austria, Tirol, Ötztal, Ötz, near Habichen W of Ötztaler Aache, 

1 Aug. 2000, on living leaves of Astragalus glycyphyllos, G. Verkley 1036, epitype 

designated here CBS H-21151 “MBT175673”, living cultures ex-epitype CBS 

109116, 109117; Carinthia, near Töschling at Wörthersee, on living leaves of A. 

glycyphyllos, July (year not indicated), Keissler, distributed in Keissler, Kryptogam. 

exsicc. 1331, PC 0084566. Czech Republic, Moravia, Pavlov, forest around ruin, 18 

Sep. 2008, on living leaves of A. glycyphyllos, G. Verkley 6023, CBS H-21258, living 

culture CBS 123878. France, Lower Normandy, Calvados, Baynes near Forêt de 

Cerisy, 20-21 Sep. 1842, on leaves of A. glycyphyllos, Roberge, “Col. Desmazieres 

1863, no. 8, 59”, isotype PC 0084563; Côte-d’Or, Montagne de Bard, same substr., 

June 1901, Fautrey, PC 0084565 (herb. Mussat); same substr., Pinsguel, near 

Toulouse, 30 Aug. 1935, Moesz, PC 0084564. Poland, Puszcza Bialowieska, Aug. 

1922, on living leaves of A. glycyphyllos, W. Siemaszko, distributed in W. Siemaszko, 

Fung. Bialowiezenses exsicc. 73, PC 0084569. Romania, Transsilvania, distr. 

Istriţa-Năsăud, Arcalia Arboretum, 1 July 1966, on living leaves of A. glycyphyllos, 

A. Crişan, distributed in Flora Romania exsicc 3127, PC 0084567; same substr., 

Muntenia, distr. Ilfov, Pantelimon, 18 July 1926, T. Săvulescu & C. Sandhu, 

distributed in Săvulescu, Herb. Mycol. Romanicum 4, 166, PC 0084568 (sub S. 

astragali f. santonensis). 

Notes: The type specimen in PC of S. astragali contains several 

mounted leaves and is provided with a hand-written description in 

French. Conidia observed in this material are mostly 7–9-septate, 

85–130 × 2.5–3.5 μm. The type thus agrees well with the original 

description which indicated conidia 120 × 3 µm, with 9–10 septa. 

Of the other collections available for this study that generally 

all agree with the type in morphology and leaf symptoms, 1036 

from Tirol is chosen as epitype. Various authors have reported 

comparable conidial measurements for this large-spored Septoria. 

Jørstad (1965) reported conidial measurements 48–128 × 3–3.5 

µm, Teterevnikova-Babayan (1987) 60–140 × 3–4 µm, Vanev et al. 

(1997), 58–112 × 2.5–3.5 µm. According to the original diagnosis, 

S. astragali var. brencklei, described from Lathyrus venosus in 

North Dakota, has 8–10-septate conidia, 130–150 × 4–5 µm, 

and Teterevnikova-Babayan (1987) placed it in synonymy with S. 

astragali. Septoria astragali is one of the first of over 200 Septoria 

that were described from plants of the family Fabaceae. 

Septoria campanulae (Lév.) Sacc., Syll. Fung. 3: 544. 1884. 

Fig. 11. 

Basionym: Ascochyta campanulae Lév., Annls Sci. Nat., sér. 3, Bot. 

5: 277. 1846. 

Description in planta: Symptoms definite, circular to irregular, pale 

to dark brown leaf spots, epigenous, usually delimited by blackened 

veinlets. Conidiomata pycnidial, predominantly ephiphyllous, rarely 

hyphyllous, scattered, globose to subglobose, immersed to semiimmersed, 

40–125 µm diam; ostiolum circular, central, 10–20 µm 

wide, surrounding cells darker; conidiomatal wall 10–20 µm diam, 

composed of an outer layer of brown-walled cells 3.5–10 µm diam, 

and an inner layer of hyaline cells 3.5–6 µm diam. Conidiogenous 

cells discrete or integrated in 1–2-septate conidiophores, cylindrical, 

or ampuliform, sometimes with an elongated neck, hyaline, 

holoblastic, proliferating sympodially, and often in the same cell 

also percurrently showing indistinct annellations, 5–15 × 3–5 µm. 

Conidia filiform, straight or slightly curved, gradually attenuated to 

a narrowly rounded or somewhat pointed apex, gradually or more 

abruptly attenuated into a narrowly truncate base, 0–1(–3)-septate, 

not or indistinctly constricted around the septa, hyaline, contents 

Fig. 11. Septoria campanulae. A. Conidia and conidiogenous cells in planta (CBS 

H-21178). B. Ibid., on CHA (CBS 109114). Scale bars = 10 µm. 

with small oil-droplets and minutely granular material in the 

living state and rehydrated state, (12.5–)15–25(–32) × 1.5–2 µm 

(rehydrated). Sexual morph unknown. 


mm in 3 wk; > 65 mm in 7 wk), with an even, somewhat undulating, 

glabrous, colourless margin; colonies spreading, the surface plane, 

immersed mycelium pale luteous to ochreous, but radiating greenish 

or olivaceous hyphal strands soon developing, which later dominate 

the olivaceous-black colonies, then also a distinct red pigment is 

produced which diffuses beyond the colony margin; scattered, mostly 

superficial pycnidial conidiomata, which are first dark olivaceous, then 


245


almost black, glabrous, with a single or up to 5 ostioli placed on short 

papillae or more elongated necks, that release pale whitish conidial 

slime; aerial mycelium scanty, diffuse, woolly-floccose, white; reverse 

in the centre most dark slate blue, first surrounded and intermixed 

with ochreous to rust, later more coral. Colonies on CMA 5–9 mm 

diam in 10 d (24–28 mm in 3 wk; > 70 mm in 7 wk), with an even, 

glabrous margin; as on OA but immersed mycelium with a greenish 

haze throughout, later almost entirely olivaceous-black; aerial 

mycelium even more scanty, but higher and reverse darker, dark 

slate blue throughout most of the colony; conidiomata similar as on 

OA, but necks shorter or absent. Colonies on MEA 7–9 mm diam in 2 

wk (24–30 mm in 3 wk; > 70 mm in 7 wk), with an even, undulating to 

ruffled, glabrous, buff to honey margin; colonies first more restricted, 

pustulate to almost conical, but later growing faster with a plane 

submarginal area; immersed mycelium rather dark, near the margin 

covered by woolly to felty white aerial mycelium; mostly composed 

of spherical conidiomatal initials, superficial mature conidiomata 

releasing milky white conidial slime; reverse first dark brick in the 

centre, near the margin locally grey-olivaceous or cinnamon, later 

sepia to brown-vinaceous, the margin honey. Colonies on CHA 4–10 

mm diam in 10 d (17–32 mm in 3 wk; 45–65 mm in 7 wk), with an 

irregular or even, buff margin covered by a diffuse, felty white, later 

grey aerial mycelium; further as on MEA, but the colony surface 

less elevated and especially near the margin with greyish, felty to 

tufty aerial mycelium; in the centre numerous conidiomata develop 

at the surface, after 3 wk releasing milky white to rosy-buff droplets 

of conidial slime; reverse in the centre blood colour, dark brick to 

cinnamon at the margin. 

Conidiogenous cells as in planta, but often with relatively 

longer necks due to repetitive percurrent proliferation. Conidia as in 

planta, but more often 2 and also 3-septate, and mostly 18–34.5 × 

1.5–2 µm (OA), 13–32 × 1.5–2 µm (CHA). 

Hosts: Campanula glomerata, C. takesimana. 

Material examined: Austria, Tirol, Ötztal, Sulztal, Gries, along the river in the 

village, on living leaves of Campanula glomerata, 1 Aug. 2000, G. Verkley 1034, 

CBS H-21178, living cultures CBS 109114, 109115. Korea, Taean, on living leaves 

of C. takesimana, H.D. Shin, living culture SMKC 21949 = KACC 42622 = CBS 

128589; Daejeon, same substr., H.D. Shin, living culture SMKC 24476 = KACC 


Notes: The first species described on Campanula is S. campanulae, 

for which Shin & Sameva (2004) provided a detailed description 

based on material occurring in Korea on C. punctata and C. 

takeshimana (conidia mostly 1-septate, 13–24 × 1.5–2 µm). Shin 

& Sameva summerised the history of the Septoria species on the 

genus Campanula. Of the three species most often accepted, viz., 

S. campanulae, S. obscura, and S. trachelii, S. campanulae fits the 

current material best. Septoria arcautei was not mentioned by Shin 

& Sameva. This species was described from C. glomerata in Spain, 

and according to the original description by Unanumo, the pycnidia 

are predominantly epiphyllous, 55.8–74.8 µm diam, and the conidia 

continuous, 20–25.7 × 0.8 µm. Septoria campanulae is closely related 

to several species from hosts in Apiaceae, including S. aegopodina, 

S. oenanthis, and S. sii (Fig. 2). Sequencing results of CBS 109114 

and 109115 were puzzling, suggesting possible contamination. 

Septoria cerastii Roberge ex Desm., Annls Sci. Nat., sér. 3, 

Bot. 11: 347. 1849. Fig. 12. 

Description in planta: Symptoms indefinite, yellow to brown leaf 

spots, but more often on withering parts of leaves, stems and bracts. 

Conidiomata pycnidial, on leaves amphigenous but predominately 

epiphyllous, scattered or aggregated, globose, semi-immersed, 

80–125(–150) µm diam; ostiolum circular, central, 20–45 µm wide, 

surrounding cells somewhat darker; conidiomatal wall composed 

of textura angularis without distinctly differentiated layers, the 

outer cells with brown, somewhat thickened walls and 4–6.5 µm 

diam, the inner cells hyaline and thin-walled and 3.5–6 µm diam. 

Conidiogenous cells ampulliform, or elongated ampulliform with a 

distinct neck, hyaline, holoblastic, proliferating percurrently 1–many 

times with indistinct annellations, also sympodially, 5–10 × 3–5 µm. 

Conidia filiform to filiform-cylindrical, straight, curved, or flexuous, 

gradually attenuated to a rounded or more or less pointed apex, 

abruptly attenuated into a truncate base, (1–)2–4(–5)-septate, 

not or indistinctly constricted around the septa, hyaline, contents 

moderately rich in small guttulae, minutely granular material and 

large vacuoles in the living state, in the rehydrated state with 

inconspicuous contents and no oil-droplets, (21–)30–52(–57) × 

1.5–2 µm (rehydrated). Sexual morph unknown. 

Description in vitro: Colonies on OA 2–4 mm diam in 2 wk (10–13 

mm in 6 wk), the margin irregular to ruffled, almost as dark as rest 

of the colony, covered by diffuse, grey aerial mycelium; the colony 

spreading, almost plane to somewhat irregularly lifted and pustulate, 

immersed mycelium olivaceous-black to black, covered with dense, 

grey, woolly aerial mycelium; conidiomata starting to develop at the 

surface after 10–15 d; reverse olivaceous-black. Colonies on CMA 

2–5 mm diam in 2 wk (13–17 mm in 6 wk), as on OA; conidial 

slime milky white; reverse greenish grey to almost black. Colonies 

on MEA 0.5–1.5 mm diam in 2 wk (4–6 mm in 6 wk), as on OA, 

with equally dense and long, woolly, grey aerial mycelium; colony 

hemispherical, with scarce pycnidial conidiomata developing 

tardily; reverse dark slate blue to black. Colonies on CHA 1–3 mm 

diam in 2 wk (8–12 mm in 6 wk), as on OA, but colonies more 

distinctly lifted above the agar surface, hemispherical, and aerial 

mycelium denser but shorter; conidiomata developing scarcely at 

the surface. 

Conidiomata pycnidial and similar as in planta, 100–150 µm 

diam, or merged into larger complexes especially on the agar 

surface, dark olivaceous-black to black, up to 250 µm diam; ostiolum 

as in planta, or absent; Conidiogenous cells hyaline, ampuliform, or 

elongated ampulliform to cylindrical, with a distinct neck, holoblastic, 

proliferating percurrently 1–many times with indistinct scars 

(annellations), also sympodially, 5–12(–15) × 3–5(–6.5) µm. Conidia 

on OA similar as in planta, 1–3(–5)-septate, indistinctly constricted 

around the septa, hyaline, contents moderately rich in small guttulae, 

minutely granular material and large vacuoles in the living state, 

(26–)35–50(–57) × 1.5–2.5 µm (T), released from superficial 

conidiomata in whitish cirrhi or slimy masses. 

Hosts: In leaf spots and on withering leaves, stems and bracts of 

Cerastium spp. According to Markevičius & Treigienė (2003), also 

on Stellaria holostea. 

Material examined: Korea, Hoengseong, on C. holosteoides var. hallaisanense, 

14 May 2006, H.D. Shin, CBS 128586 = KACC 42367 = SMKC 21781; same 

loc., substr., H.D. Shin, CBS 128612 = KACC 42831 = SMKC 22609; Jeju, on 

C. holosteoides, 1 Nov. 2007, H.D. Shin, CBS 128626 = KACC 43220 = SMKC 

23137. Netherlands, prov. Utrecht, Baarn, on living leaves of Cerastium sp., 9 Aug. 

1968, H.A. van der Aa 731, CBS H-18069; same loc., substratum, 18 Oct. 1962, 

H.A. van der Aa, CBS H-18070, and 19 Oct. 1963, CBS H-18071; Prov. Noord 

Holland, Amsterdamse Waterleidingduinen, near Ruigeveld, on withering leaves 

of Cerastium fontanum subsp. vulgare, 31 Aug. 1999, G. Verkley & A. van Iperen 

915, epitype designated here CBS H-21158 “MBT175351”, living culture ex-epitype 

CBS 102323. Romania, distr. Ilfov, Malu-Spart, on living leaves of C. fontanum 

246


Fig. 12. Septoria cerastii, CBS 102323. A–C. Colonies (15 ºC, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia and conidiogenous cells in planta (CBS H-21158, epitype). 

E. Conidia on OA (CBS 102323). Scale bars = 10 µm. 

subsp. triviale, 20 May 1973, G. Negrean, CBS H-18072, distributed in Herb. Mycol. 

Romanicum, fasc. 50, no. 2475. 

Notes: The material on Cerastium fontanum examined here 

agrees in morphology with the detailed description of Muthumary 

(1999), who studied type material of S. cerastii (PC 1324) and also 

provided excellent illustrations. The type host was identified as 

C. vulgatum, which is a synonym of C. fontanum subsp. vulgare 

(and C. holosteoides). According to Muthumary, no definite spots 

are on the leaves in this collection, but the fungus is nonetheless 

interpreted as parasitic. We have the impression from our collection 

that it may be endophytic or a very weak pathogen, but in Korea the 

fungus causes very characteristic symptoms on C. holosteoides 

var. hallaisanense (Shin & Sameva 2004). 

This species and S. stellariae occur on two very closely related 

host genera, Cerastium and Stellaria (Smissen et al. 2002), but 

the two can be distinguished morphologically by conidiogenesis 

and conidial morphology in planta, and the cultures also differ 

considerably in pigmentation and growth speed especially on OA. 

DNA sequence data also support the hypothesis that S. cerastii 

and S. stellariae are distinct species, as they differ for example by 

6 base positions on ITS 1, and the distance in the multilocus tree 

is considerable. Jørstad (1965) also regarded S. cerastii and S. 

stellariae as distinct species, indicating that on average the spores 

in the latter were much longer (22–96 µm) than in the former 

(20–43 µm). He mentioned that in two collections of S. cerastii 

from Iceland the conidia reached lengths of 57–60 µm, whereas 

in collections from Norway attributed to the same species conidia 


247


were no longer than 43 µm. In the Dutch collection studied here, 

conidia also reached 57 µm in length. 

Septoria chromolaenae Crous & den Breeÿen, Fungal 

Diversity 23: 90. 2006. 

A detailed description of the species in planta and in vitro was given 

by Den Breeÿen et al. (2006). 

Material examined: Cuba, near Havana, Chromolaena odorata, S. Neser, 28 Oct. 

1997, holotype CBS H-19756, culture ex-type CBS 113373. 

Notes: This species is closely related to two strains identified as S. 

ekmanniana (CBS 113385, 113612) originating from Chromolaena 

odorata (Asteraceae) in Mexico. The two species can readily be 

distinguished by conidial sizes, particularly in culture (Den Breeÿen 

et al. 2006). Other species in this clade include S. passiflorae (CBS 

102701) and S. passifloricola (CBS 129431), and S. anthurii (CBS 

148.41, 346.58) and S. sisyrinchii (CBS 112096). 

Septoria chrysanthemella complex 

Septoria chrysanthemella Sacc., Syll. Fung. 11: 542. 1895. nom. 

nov. pro S. chrysanthemi Cavara, Atti Ist. bot. Univ. Lab. crittogam. 

Pavia, Ser. 2, 2: 266. 1892 [non Allesch., 1891]. 

A description in planta was provided by Punithalingam (1967a) and 

Priest (2006). Sexual morph: unknown. 

Multilocus sequencing revealed that five of the isolates studied 

here that were identified as S. chrysanthemella belong to a species 

complex, showing the presence of two cryptic sister species. The 

first group includes CBS 354.73, 128616 and 128617, originating 

from Chrysanthemum morifolium in New Zealand and Korea, 

respectively. The second group comprises the two European 

isolates CBS 351.58 and 483.63, and CBS 128622 from Korea, 

from various Chrysanthemum spp. A description of the isolates is 

provided below. 

Group 1: Description in vitro (CBS 354.73): Colonies on OA 

20–23 mm diam in 2 wk, with an even, glabrous margin; colonies 

spreading, immersed mycelium grey-olivaceous and in the centre 

with a brown haze, mostly glabrous but locally with some tufts of 

pure white aerial mycelium; reverse greenish grey to olivaceousgrey. 

Pycnidia developing immersed and on the agar surface after 

10–12 d, releasing pale white conidial slime. Colonies on MEA 

17–20 mm diam in 2 wk, with an even, colourless to buff margin; 

colonies restricted to spreading, in the centre irregularly pustulate, 

the surface dark, provided with diffuse or more dense mat of grey, 

appressed aerial mycelium; reverse brown-vinaceous. Conidiomata 

developing on the agar surface in the centre, releasing milky white 

masses of conidial slime. 

Material examined: New Zealand, Taranaki, Chrysanthemum morifolium, G.F. 

Laundon, 24 Nov. 1972, LEV 6807, living culture CBS 354.73. South Korea, 

Hongcheon, Chr. morifolium, H.D. Shin, 10 Sep. 2007, living culture SMKC 22860 = 

KACC 43086 = CBS 128617. 

Group 2: Description in vitro (CBS 351.58): Colonies on OA 

reaching 32–36 mm diam in 2 wk, with an even, glabrous margin; 

colonies spreading, immersed mycelium pale luteous to faintly 

saffron, mostly glabrous but locally with some tufts of pure 

white aerial mycelium; reverse flesh to saffron. Pycnidia formed 

immersed or on the agar surface after 10–12 d, releasing pale 

white conidial slime. Colonies on MEA reaching 36–40 mm diam in 

2 wk, with an even, cvolourless to buff margin; colonies spreading, 

the surface entirely covered by a dense mat of pure white to rose, 

woolly aerial mycelium; reverse fulvous to ochreous, dark brick in 

the centre. Pycnidia formed mostly on the agar surface after 10–2 

wk, releasing pale white conidial slime. 

Material examined: Germany, Berlin, Chrysanthemum indicum, R. Schneider, 

June 1957, living culture BBA 8432 = CBS 351.58. Netherlands, Baarn, on Chr 

ysanthemum sp., isol. H.A. van der Aa, dep. J.A. von Arx Nov. 1963, living culture 

CBS 483.63. South Korea, Hoengseong, on Chr. boreale, H.D. Shin, 16 Oct. 2007, 

living culture SMKC 23025 = KACC 43191 = CBS 128622. 

Notes: Saccardo (1895) did not specify the host species of S. 

chrysanthemella, but in the original diagnosis of Cavara (for 

which Saccardo proposed a nomen novum to replace the name 

S. chrysanthemi because it was antedated by S. chrysanthemi 

Allesch. 1891), the host was indicated to be Chrysanthemum 

indicum. The fungus was described to produce conidia 55–65 × 

1.5–2 µm, and lacking septa. It will have to be resolved to which 

group of the complex the name S. chrysanthemella should be 

applied. 

Septoria clematidis Roberge ex Desm., Annls Sci. Nat., sér. 

3, Bot. 20: 93. 1853 [non Pandotra & K.S.M. Sastry, nom. 

illeg., Art. 53]. Fig. 13. 

Description in planta: Symptoms leaf spots angular to circular, 

initially mostly pale yellowish brown, then greyish brown, sometimes 

surrounded by a darker border, visible on both sides of the leaf. 

Conidiomata pycnidial, epiphyllous, several in each leaf spot, 

globose to subglobose, dark brown, immersed, 65–120(–160) µm 

diam; ostiolum central, circular, 55–80(–100) µm wide, surrounding 

cells concolorous or somewhat darker; conidiomatal wall 20– 

35 µm thick, composed of textura angularis without distinctly 

differentiated layers, the cells 3–10 µm diam, the outer cells with 

brown, somewhat thickened walls, the inner cells with hyaline and 

thinner walls. Conidiogenous cells hyaline, narrowly to broadly 

ampulliform with a relatively wide and sometimes elongated neck, 

holoblastic, proliferating sympodially and possibly also percurrently 

in some cells but annellations not observed, 8–12.5 × 4–5(–6) µm. 

Conidia cylindrical to filiform-cylindrical, straight, more often curved 

or slightly flexuous, with a relatively broadly rounded, sometimes 

somewhat pointed apex, barely attenuated towards the broadly 

truncate base, (1–)4–5(–6)-septate, not or indistinctly constricted 

around the septa, hyaline, contents with a few oil-droplets and 

minute granular material in each cell in the living state, with 

inconspicuous oil-droplets and granular contents in the rehydrated 

state, (40–)47–67(–80) × (3–)3.5–4 µm (rehydrated). Sexual 


Description in vitro: Colonies on OA 3–6(–8) mm diam in 3 wk 

(12–15 mm in 7 wk), the margin irregular to ruffled, colourless, 

glabrous; the colony almost plane to somewhat irregularly lifted 

and pustulate, immersed mycelium initially in the centre pale greyolivaceous 

with some long aerial hyphae, darkening entirely in 

older colonies to olivaceous-black, this darkening starting where 

pycnicial stromata are formed releasing milky white droplets of 

conidial slime after about 3 wk; reverse of colony dark slate blue 

to olivaceous-black. Colonies on CMA 4–7(–9) mm diam in 3 

wk (12–17 mm in 7 wk), as on OA, but aerial mycelium denser 

248


Fig. 13. Septoria clematidis. A, B. Colonies CBS 108983 (15 ºC, nUV). A. On OA. B. On MEA. C. Conidia and conidiogenous cells in planta (CBS H-21182, epitype). D. Ibid., 

CBS 108983 on OA. Scale bars = 10 µm. 

on sterile parts of the colony. Numerous pycnidial conidiomata 

developing after 2 wk in the agar, on its surface, and also in the 

aerial mycelium, but no fertile ones observed. Colonies on MEA 

4.5–7 mm diam in 3 wk (11–18(–22) mm in 7 wk), with a barely 

visible margin; colony restricted, hemispherical, the surface very 

dark or black, covered by short, diffuse to dense white or grey 

aerial hyphae; pycnidial conidiomata at the surface releasing clear 

droplets without conidial slime after 3 wk, and later first buff, then 

dirty luteous droplets with conidia; reverse dark slate blue to black, 

margin pale luteous or buff. Colonies on CHA 4.5–7 mm diam in 3 


249


wk (15–18 mm in 7 wk), as on MEA, but aerial mycelium denser 

with longer hyphae; conidiomatal initials developing scarcely at the 

surface, still sterile after 3 wk, but later on releasing dirty buff to 

pale ochreous droplets of conidial slime. In older colonies on MEA 

and CHA a grey or greyish white, dense mat of aerial hyphae may 

cover small or larger sectors. 

Conidiomata as in vitro, pycnidial, often merged to complex 

stromata, first brownish, then black, glabrous or the surface covered 

by short white hyphae; conidiogenous cells as in planta, but larger, 

7.5–20 × 3–5(–6) µm, holoblastic, proliferating sympodially, no 

percurrent proliferation observed; conidia similar in shape as in 

planta but mostly 3–7-septate, (45–)55–85(–105) × 4–5(–7) µm. 

Hosts: Clematis spp. 

Material examined: Austria, Tirol, Ötztal, Brunau, on living leaves of Clematis 

vitalba, 30 July 2000, G. Verkley 1025, epitype designated here CBS H-21182 

“MBT175353”, living cultures ex-epitype CBS 108983, 108984; same loc., 

substr., date, G. Verkley 1026, CBS H-21183; same substr., S. Tirol, Eggenthal, 

Birchabruck, 23 July 1904, J. Kabát, distributed in Kabát & Bubák, Fungi imperfecti 

exsicc. 163, PC 0084599. France, Parc de Lébisey, 27 July 1848, Roberge (?), ‘Col. 

Desmazieres 1863, no. 8, 448’, isotype PC 0084593; same loc., substr., June 1848, 

Roberge, PC 0084596; same substr., Paris, Parc de St Cloud, Aug. 1908, Ludwig, 

PC 0084607; same substr., Fontainebleau forest, Aug. 1885, PC 0084604; same 

substr., Clères, 27 Aug. 1896 (herb. Mussat), PC 0084598; same substr., Seine-et- 

Oise, Meudon, 15 Nov. 1844, Roussel (Herb. Roussel), PC 0084594, PC 0084595. 

Romania, distr. Iaşi, Moldova, Bârnova, same substr., 30 Aug. 1934, T. Săvulescu 

& C. Sandhu, distributed in Săvulescu, Herb. Mycol. Romanicum 24, 1160, PC 

0084603, 0084608, 0084597. 

Notes: This is one of the large-spored species of Septoria from 

the genus Clematis. Teterevnikova-Babayan (1987), who studied 

collections from several species of Clematis observed, 4–6-septate 

conidia 60–90 × 3–5 µm. Vanev et al. (1997) reported conidia 

as 39–100 × 2.5–4 µm. The type of S. clematidis in PC showed 

4-7-septate conidia 52–78 × 3–3.5 µm, in good agreement with the 

ones observed in the Austrian material (CBS H-21182), which is 

designated above as epitype. 

The taxonomy of the 15 described species of Septoria on 

Clematis is still unresolved (Shin & Sameva 2004), and would 

certainly benefit from study of additional fresh material and cultures 

which could be compared with type material. Septoria clematidis 

Roberge is probably distinct from S. clematidis Pandotra & K.S.M. 

Sastry, a taxon described on Clematis grata in India that should be 

renamed because it is a later homonym. According to Muthumary 

(1999), the conidia in the type of S. clematidis Pan. & Sastry are 

1–3-septate, 38–66 × 2.5–3 µm, whereas in the original diagnosis 

the conidia are described as “ septate”, 25.6–44.8 (av. 36.3) × 2.3– 

3.2 (av. 2.7). Two other large-spored species are S. jackmanii Ellis 

& Everh. 1892, which was described from Clematis jackmanii in 

Geneva, New York and, according to the diagnosis, has conidia 40– 

70 × 2.5–3 µm (number of septa not given), and also S. williamsiae 

Priest, based on material on C. aristata in Australia, which has 

(1–)3(–4)-septate conidia 20–45(–55) × (1.5–)2 µm (Priest 2006). 

Septoria convolvuli Desm., Annls Sci. Nat., sér. 2, Bot.17: 

108. 1842. Fig. 14. 

Description in planta: Symptoms leaf lesions circular, single or 

confluent to form irregular extended lesions, pale to dark brown, 

showing one to several concentric lines and a dark brown, 

slightly raised line or zone delimiting the lesion, visible on both 

sides of the leaf. Conidiomata pycnidial, epiphyllous, several in 

each lesion, immersed, subglobose to globose, brown to black, 

(65–)90–120(–145) µm diam; ostiolum central, circular to irregular, 

initially 20–40 µm wide, later becoming more irregular and up to 

70 µm wide, surrounding cells somewhat darker; conidiomatal 

wall 10–15 µm thick, composed of a homogenous tissue of 

hyaline, angular cells, 2.5–4.5 µm diam, the outermost cells pale 

brown with slightly thickened walls, the inner cells thin-walled. 

Conidiogenous cells hyaline, discrete, rarely integrated in 1-septate 

conidiophores, narrowly to broadly ampulliform, holoblastic, 

proliferating percurrently several times, with indistinct annellations 

on a relatively elongated neck, or sympodially, 6–10(–17) × 

2.5–3.5(–4) µm. Conidia filiform to filiform-cylindrical, slightly to 

strongly curved, often elegantly flexuous, attenuated in the upper 

cell to a narrowly rounded to pointed tip, narrowly truncate at the 

base, 1–3(–4)-septate, not constricted around the septa, hyaline, 

contents minute oil-droplets and granular material in the rehydrated 

state, (15–)23–42(–50) × 1.5–2 µm (rehydrated). Sexual morph 

unknown. 


mm in 25 d; 40–48 mm in 33 d), with an even, glabrous margin, 

which is colourless, or faintly salmon due to a diffusable pigment 

already visible after 1 wk (but fading after 3 wk); colonies first 

restricted, conical to irregularly pustulate, but later spreading, 

immersed mycelium in the centre becoming first yellowish or citrine, 

then herbage green or darker olivaceous, surrounded by a more 

palid, rosy-buff or pale salmon, later hazel outer zone; pycnidia 

already developing in clusters or radiating rows at the colony 

surface, but they remain scarce, later releasing pale rosy-buff or 

whitish droplets of conidial slime; aerial mycelium remaining scanty, 

but in the centre it may be well-developed, white, woolly; reverse 

in the centre olivaceous-black to olivaceous-grey, surrounded by 

a first salmon or rosy-buff zone where the diffusable pigment is 

formed, but this becomes hazel. Colonies on CMA 3–5 mm diam 

in 1 wk [(15–)18–21 mm in 25 d; 38–40 mm in 33 d], as on OA, but 

salmon pigment only faintly visible after 20 d, the margin becoming 

rosy-buff; centre much darker earlier on, entirely olivaceous-black, 

numerous black papillate to rostrate pycnidia developing after 21 d, 

releasing pale whitish to buff droplets of conidial slime. Colonies on 

MEA 2–5 mm diam in 1 wk [5–11 mm in 25 d; 16–18(– 23) mm in 33 

d], with a ruffled, mostly colourless margin already covered by white 

aerial hyphae after 1 wk; a halo of a diffusing pigment is visible after 

1 wk, which fades later on; colonies restricted, irregularly pustulate 

and up to 3 mm high after 1 wk, immersed mycelium dark, but 

mostly invisible from above due to well-developed, white to greyish, 

dense and short-felted aerial mycelium; black conidiomata already 

developing after 1 wk, releasing large masses of buff conidial 

slime; reverse mostly sepia to isabelline. Some colonies may show 

a more spreading growth after 2 wk in sectors, that are glabrous, 

immersed mycelium almost black. Colonies on CHA 3–5 mm diam 

in 1 wk (18–30 mm in 25 d; 30–34 in 33 d), with an even, glabrous, 

colourless margin; colonies irregularly pustulate, up to 3 mm high 

after 1 wk, immersed mycelium colourless to pale ochreous, but in 

the centre the surface may be already almost black, while after 25 

d the entire colony attains that colour, the larger part covered by 

well-developed, low, dense, pure white, later smoke-grey to greyolivaceous, 

felty to woolly-floccose, aerial mycelium; conidiomatal 

initials developing mainly in the centre after 1 wk; reverse mostly 

fawn, but later almost entirely brown-vinaceous. 

Conidiomata single, 60–150 µm diam, or merged to small 

clusters of up to 350 µm diam, olivaceous to brown, formed mostly 

on the agar surface; conidiogenous cells as in planta, 6–20 × 

2.5–4(–5) µm; conidia as in planta, but often some conidia with 

250


Fig. 14. Septoria convolvuli. A, B. Conidia in planta (CBS H-21244). C. Conidia and conidiogenous cells on OA (CBS 102325). Scale bars = 10 µm. 

cells that are somewhat inflated, and constricted around septa, 

(22–)30–45(–55) × 1.8–2.5 µm. 

Hosts: Calystegia spp. and Convolvulus spp. 

Material examined: Germany, Eiffel, Schalkenmehren near Maar, Daun, on living 

leaves of Convolvulus arvensis, 16 Sep. 1970, H.A. van der Aa 2276, CBS H-18082. 

Netherlands, Prov. Hoord-Holland, Laren, on living leaves of Calystegia sepium, 18 

July 1970, H.A. van der Aa 2198, CBS H-18081; Prov. Flevoland, Erkemeder beach, 

in edge of marshland bordering the lake, on living leaves of Ca. sepium, 8 Sep. 

1999, G. Verkley 927, CBS H-21209, living culture CBS 102325. New Zealand, 

North Island, Coromandel, Tairua Forest, along roadside of St. Hway 25, near 

crossing 25A, on living leaves of Ca. sepium, 21 Jan. 2003, G. Verkley 1844, CBS 

H-21244, living culture CBS 113111; same substr., North Isl., Waikato, Taupiri, Bob 

Byrne Memorial Park, 27 Jan. 2003, G. Verkley 1896, CBS H-21248; same substr., 

North Isl., Northland, Russell, 30 Jan. 2003, G. Verkley 2014, CBS H-21245. South 

Korea, Kangnung, isolated from Ca. soldanella, H.D. Shin, 8 Nov. 2007, KACC 


Notes: Morphologically and genetically the collections available 

proved highly homogeneous. Muthumary (1999) and Priest (2006) 

both reported sympodial conidiogenesis for this species, but did 

not observe annellidic conidiogenesis. According to Shin & Sameva 

(2004), the conidia can be up to 68 µm long and 7-septate. Jørstad 

(1965) listed several Septoria names that were based on material 

from Convolvulaceae in the synonymy of S. convolvuli, including 

S. septulata. Beach (1919) reported physiological differences for 

the species on Convolvulus arvensis, but whether this correlates 

with genetic differences still remains to be investigated. Moreover, 

as already pointed out by Priest (2006), a number of species on 

Calystegia and Convolvulus still have to be critically re-examined, 

which would have to include studies in culture. 

Septoria coprosmae Cooke, Grevillea 14: 129. 1886. 

Description in vitro: Colonies on OA 32 mm diam in 28 d (45 mm in 

38 d), with a glabrous, colourless, even margin; colony spreading, 

the surface glabrous with only a few tufts of pure white aerial 

mycelium near the centre, immersed mycelium mostly cinnamon, 

but brick in the centre, reverse concolorous; no diffusing pigments 

observed. Conidiomata formed after 3–10 d, on the agar surface or 

submerged, simple or complex, with dark, first reddish-brown, then 

black walls, preformed opening undifferentiated or lacking, tardily 

releasing pale salmon to whitish conidial slime (after 30 d or later). 

Colonies on MEA (Oxoid, 3 %) 35 mm diam in 28 d (45 mm in 38 

d), spreading but slightly elevated in the centre, with a colourless 

to rosy-buff, glabrous, even margin; colony surface leaden-grey to 

black, but with a fine felt coverage of minute, white aerial hyphae, 

reverse mostly dark brick to sepia, surrounded by cinnamon near 

the margin; no diffusing pigments observed. Conidiomata formed 

from 10 d onwards, mostly superficial, complex, opening by 

tearing of the upper wall and releasing milky white conidial slime. 

Spermatogonia of an Asteromella-state also formed. 


251


Conidiomata simple or complex, with several merging cavities, 

lacking a differentiated ostiolum, opening by tearing of the wall; 

conidiomatal wall composed of a single layer of isodiametric cells, 

6–13 μm diam. Conidiogenous cells discrete, or integrated in 

short, 1–2-septate conidiophores, hyaline, cylindrical, holoblastic, 

sympodial; conidia cylindrical, hyaline, smooth-walled, mostly 

curved, rounded at the tip, attenuated to a truncate base, 

(0–)1–3-septate , not or only slightly constricted around the septa, 

with minute oil-droplets near the ends and the septa, 9–31 × 1.8– 

2.2 μm (MEA), 17–30 × 1.7–2.0(–2.5) µm (OA); Spermatia hyaline, 

ellipsoid, with rounded ends and minutely granular contents, 3–5 × 

0.8–1.2 μm. 

Hosts: Coprosma robusta, Coprosma sp. 

Material examined: New Zealand, North Island, Bay of Islands area, N. of Russell, 

mycosphaerella-like sexual morph on living leaves of Coprosma robusta, G. Verkley 

2020, CBS H-21246, living single ascospore isolate CBS 113391. 

Notes: CBS 113391 was obtained from rehydrated spotted leaves 

of Coprosma robusta collected in New Zealand that contained a 

mycosphaerella-like sexual morph. No mature asci were observed 

in this material, nor a septoria-like morph, but the isolate obtained 

developed pycnidia agreeing with conidia described for S. 

coprosmae (30 × 2 µm). In the multilocus phylogeny CBS 113391 

groups with CPC 19304, originating from Vigna unguiculata subsp. 

sesquipedalis in Australia, and CPC 19793, isolated from Syzygium 

cordatum in Australia, and is also relatively closely related to S. 

verbenae (CBS 113438, 113481) isolated from Verbena officinalis 

in New Zealand. Aptroot (2006) investigated an isotype of 

Mycosphaerella coacervata from BPI and could only find “various 

coelomycetes”. It is unclear whether it contained a Septoria. Sydow 

(1924) provided a description of the sexual morph of M. coacervata 

and an associated spermatial state, but not of a Septoria. 

Septoria cruciatae Roberge ex Desm., Annls Sci. Nat., sér. 

3, Bot. 8: 20. 1847. Fig. 15. 

= Septoria urens Pass., Atti Soc. crittog. ital. 2: 31. 1879. 

= Septoria aparines Ellis & Kellerm., J. Mycol. 5: 143. 1889. 

≡ Rhabdospora aparines (Ellis & Kellerm.) Kuntze, Revisio generum 

plantarum 3 (2): 509. 1898. 

= Septoria asperulae Bäumler, Verh. zool.-bot. Ges. Wien 40: 142. 1890. 

= Septoria galii-borealis Henn., Bot. Jahrb. Syst. 37: 163. 1905 [non Bubák 

& Kabát]. 

= Septoria galii-borealis Bubák & Kabát, Hedwigia 52: 350. 1912 [non Henn., 

later homonym]. 

?= Phleospora bresadolae Allesch., Ber. bot. Ver. Landshut 12: 60. 1892. 

?= Septoria relicta Bubák, Annls mycol. 4: 116. 1906. 

For more synonyms see Jørstad (1965). 

Description in planta. Symptoms leaf lesions indefinite, usually a 

single one on each leaf expanding to ultimately cover the entire 

lamina, brown. Conidiomata pycnidial, epiphyllous, numerous, 

semi-immersed to immersed, subglobose to globose, dark brown 

to black, 170–240 µm diam; ostiolum central, circular, initially 

25–55 µm wide, later becoming more irregular and up to 90 µm 

wide, surrounding cells concolourous; conidiomatal wall 20–35 µm 

thick, composed of an inner layer of isodiametric to irregular cells 

mostly 2.5–4.5 µm diam with hyaline cell walls up to 2 μm thick, 

and an outer layer of hyphal cells, 8–15 × 5–6.5 μm with orange 

brown walls thickened up to 2 μm, well developed and up to 15 

μm thick in the upper part of the pycnidium wall. Conidiogenous 

cells hyaline, discrete, rarely integrated in 1-septate conidiophores, 

cylindrical, or narrowly to broadly ampulliform, holoblastic, 

proliferating rarely percurrently showing 1–2 indistinct annellations, 

sometimes (also) proliferating sympodially, 10–15(–22) × 3–5.5 

(–6) µm. Conidia filiform, curved to flexuous, rounded to somewhat 

pointed at the apex, attenuated modestly towards the truncate 

base, (0–)2–3-septate, not constricted around the septa, hyaline, 

containing several large oil-droplets and granular material in the 

living state and rehydrated state, (30–)42–54(–60) × 2.5–3.2 µm 

(living; rehydrated, 2.0–2.5 µm wide), released in white cirrhi. 

Description in vitro (20 ºC, diffuse daylight). Colonies on OA 8–12 

mm diam in 2 wk, with a glabrous, colourless, even margin; colony 

restricted, the surface mostly covered by pure white, woolly-floccose 

aerial mycelium, immersed mycelium mostly bright or darker 

herbage-green, brick in the centre, reverse dark green to black; a 

red pigment diffuses into the medium. Conidiomata developing in 

the centre on the surface of the colony or in the aerial mycelium, 

releasing pale milky white to rosy-buff conidial slime. Colonies on 

MEA 5–7 mm diam in 2 wk, with a barely visible, irregularly ruffled 

margin; colony restricted, hemispherical to irregularly pustulate, 

the surface entirely covered by a dense felty to woolly mat of 

pale olivaceous-grey, locally reddish, aerial mycelium, immersed 

mycelium almost black; reverse olivaceous-black to black; 

conidiomata developing on the surface in the centre of colonies, 

releasing milky white to rosy-buff conidial slime. Conidiomata on 

OA olivaceous-brown to olivaceous, globose, single or aggregated, 

200–380 μm diam, on the agar mostly without a well-developed 

ostiolum, the wall composed of a rather undifferentiated outer layer 

of loosely interwoven, pale brown hyphae with barely thickened 

walls, and an inner layer of globose to angular cells with hyaline 

walls up to 2 μm thick. Conidia as in planta, mostly 3-septate, 35– 

65 × 2–2.5(–3) µm (OA). 

Hosts: Galium spp. 

Material examined: Czech Republic, Moravia, Milovice, forest Milovika stran, 15 

Sep. 2008, on living or decaying leaves of Galium odoratum, G. Verkley 6007, 

epitype designated here CBS H-21250 “MBT175354”, living cultures ex-epitype 

CBS 123747, 123748. France, Libisey near Caen, on living leaves of G. cruciatum, 

Jul.-Sep. 1844, M. Roberge, “Col. Desmazieres 1863, no. 8, 200”, isotype PC 

0084552, with handwritten description in French; Libisey near Caen, on living leaves 

of G. cruciatum, July 1844, M. Roberge, PC 0084551; Puy-de-Dôme, Ambert, on G. 

cruciatum, 23 Aug. 1903, L. Brevière, PC 0084553. Germany, Thüringen, Berka a. 

Ilm, on leaves of G. rotundifolium, 21 July 1912, H. Diedicke, distributed in Sydow, 

Mycotheca germanica 1132, PC 0084548. Iran, Pass Ghaleh, on G. coronatum, 10 

July 1968, Sharif, PC 0084549. Romania, Bucharest, on G. mollugo, 4 Oct. 1974, 

G. Negrean, distributed in Herb. Mycol. Romanicum 50, 2476, PC 0084550. 

Notes: The description given above is based on the collections on 

Galium odoratum and G. cruciatum, including the well-preserved 

type specimen from PC and the collection V6007, which agrees 

well with this type material. Although the latter is from Czech 

Republic and another host species than the type, it is selected here 

as epitype as two cultures derived from it are also preserved in 

CBS. According to Jørstad (1965), on G. boreale conidia are 23–73 

× (1–)1.5–2(–2.5) µm (with mostly 3 septa), and on G. aparine 

37–88 × 1–1.5 µm (with up to 5 septa). Jørstad placed five names 

in the synonymy of S. cruciatae, including S. asperulae from G. 

odoratum. He reported limited differences between material on 

different species of Galium, and it is not unlikely that there is just one 

species capable of infecting several species of Galium. In addition 

to the names he listed as synonyms of S. cruciatae, S. relicta and 

Phleospora bresadolae, both described from G. odoratum (syn. 

Asperula odorata) in Czech Republic and Germany, respectively, 

252


Fig. 15. Septoria cruciatae. A, B. Colonies CBS 123747. A. On OA. B. On MEA. C, D. Conidia in planta (CBS H-21250, epitype). E. Conidia on OA (CBS 123748). F. Conidia in 

planta (CBS H-21250). G. Conidia and conidiogenous cells in planta (CBS H-21250). H. Conidia on OA (CBS 123747). Scale bars = 10 µm. 

may also be regarded as synonyms, but we have not studied type 

material for those (conidia reported 38–60 × 3–3.5 μm and 40–60 

× 2.5–3.5 μm for these two respectively). The multigene phylogeny 

shows that the epitype of S. cruciatae is not part of the main 

Septoria clade (Fig 1), but basal to a clade of pseudocercosporellalike 

fungi. A new genus may have to be proposed for it in future. 

Septoria cucubali Lebedeva, Materialy po mikol. obsled. 

Rossii 5, 3: 3. 1921. Fig. 16. 

Description in planta: Symptoms indefinite colourless to pale 

yellowish brown lesions, both on the lamina and along the leaf 

margins. Conidiomata pycnidial, epiphyllous, mostly gregarious, 

globose, black, semi-immersed, 50 –95 µm diam; osiolum central, 

circular, 20–35 µm wide, provided with slightly darker cells; 

conidiomatal wall relatively thin, composed of textura angularis, 

the outer cells 3.5–5 µm diam, with brown, somewhat thickened 

walls, the inner cells 2.5–4.5 µm diam, with hyaline and thin walls. 

Conidiogenous cells ampulliform to cylindrical, without a distinct 

neck, hyaline, holoblastic, appearing to be phialidic, but proliferating 

percurrently with indistinct and close annellations, rarely also 

proliferating sympodially, 5–8(–10) × 2–3 µm. Conidia fusiformcylindrical 

to cylindrical, weakly curved, gradually attenuated to a 

rounded or more or less pointed apex, abruptly attenuated into a 

narrow, truncate base, mostly 0–1(–3)-septate, not or indistinctly 

constricted around the septa, hyaline, contents minutely granular 

in the living state, in the rehydrated state with no distinct contents, 

(9–)15–42(–52) × 2–2.5 µm (rehydrated). Sexual morph unknown. 


mm in 6 wk), with an even, glabrous, first colourless margin; colony 

spreading, immersed mycelium in the centre pale ochreous to 


253


Fig. 16. Septoria cucubali. A–C. Colonies. A. CBS 102367, on OA. B. Ibid., on CHA. C, D. CBS 102386. C. On MEA. D. On OA. E, F. Conidia on OA (CBS 102386). G. Conidia 

and spermatia on OA (CBS 102367). H. Conidia and conidiogenous cells in planta (CBS H-21159). I. Conidia on OA (CBS 102386). Scale bars = 10 µm. 

sienna with a distinct citrine to olivaceous tone especially towards 

the margin, or a faint salmon haze; aerial mycelium scanty to welldeveloped, 

woolly-floccose, greyish white, gradually attaining a 

reddish haze; reverse rust to bay, with olivaceous-black areas. 

Surface of the colony first plane, but later irregularly lifted, with 

blackish stromata developing on the surface and immersed in the 

agar, first spherical, closed, later opening widely to expose a milky 

white to luteous conidial slime. Colonies on CMA 9–15 mm diam 

254


in 2 wk (43–45 mm in 6 wk), with an even, glabrous, colourless 

to buff margin; further as on OA, but immersed mycelium only in 

the centre sienna, for the most olivaceous to almost dull green; 

aerial mycelium similar in colour and texture, but scarcer; reverse 

olivaceous-black, with distinct rust central areas; conidiomata less 

developed. Colonies on MEA 9–16 mm diam in 2 wk, with an even, 

buff or peach to scarlet margin, mostly hidden under tufts of aerial 

mycelium; colonies hemispherical, sometimes radially striate, 

immersed mycelium dark ochreous to greyish brown or olivaceousblack, 

mostly covered by finely felty or floccose-tufty, white, greyish 

or scarlet aerial mycelium; luteous to reddish diffusable pigment 

sometimes present; reverse rust to chestnut, margin apricot; 

stromata scarcely developing, releasing milky white to rosy-buff 

conidial slime. Colonies on CHA (4–)6–9 mm diam in 2 wk [(30–) 

40–46 mm in 6 wk], as on MEA, conidial slime first rosy-buff, later 

ochreous. 

Conidiomata pycnidial, as in planta but often larger, 100– 

175µm, or merging into larger complexes; conidiogenous cells as 

in planta, but annellations more distinct. Conidia fusiform-cylindrical 

to cylindrical, straight or weakly curved, gradually attenuated to a 

rounded or more or less pointed apex, abruptly attenuated into 

a narrow, truncate base, (0–)1–3(–4)-septate, not or indistinctly 

constricted around the septa, hyaline, contents minutely granular 

with small oil-droplets, (9–)15–29(–52) × 2–2.5 µm. 

Both on the plant and in culture spermatogonia of an Asteromella 

state were produced, in which 0-septate, ellipsoid spermatia were 

formed 2–3 × 1–1.5 µm. No sexual morph was observed. 

Hosts: on living leaves of Cucubalus baccifer and Saponaria 

officinalis. 

Material examined: Germany, isolated from leaf litter of Fagus sylvatica, M. 

Unterseher, living culture CBS 124874. Netherlands, Prov. Gelderland, Millingen 

aan de Rijn, Millingerwaard, on living leaves of Cucubalus baccifer, 6 Oct. 1999, G. 

Verkley 941, CBS H-21159, living cultures CBS 102367, 102368; same loc., date, 

brown leaf margin on living leaves of Saponaria officinalis, 6 Oct. 1999, G. Verkley 

938, CBS H-21218, living culture CBS 102386. 

Notes: The material on Cucubalus available for this study showed 

conidia (9–)15–19(–23) × 2–2.5 µm, thus much shorter and 

somewhat narrower than reported for S. cucubali in the original 

diagnosis (34–50 × 1.5–2 µm; based on material collected in 

July), and by Teterevnikova-Babayan (1987). This Dutch material 

was collected much later in the season than the type, and under 

relatively dry conditions. Averages of conidial width and especially 

lengths seen in specimens collected under adverse conditions 

such as drought or cold can be lower as compared to material 

collected under optimal conditions. The isolates obtained from this 

material were, however, capable of producing conidia up to 52 µm 

in length. This would be in good agreement with S. cucubali, as are 

the morphology of the pycnidia, the shape and width of the conidia, 

as well as the symptoms on the plant described by Teterevnikova- 

Babayan (1987) for S. cucubali. Markevičius & Treigiene (2003) 

reported S. dimera on Cucubalus, and that species is characterised 

by conidia that are wider (21–35 × 3.2–4.3 µm; Vanev et al. 1997 

report 26–65 × 2.5–4 µm for that species). 

The isolates from Cucubalus were also very similar to those 

obtained from the material collected in the same area on Saponaria, 

and the sequences obtained indicate that these isolates all belong 

to a single species. The material on the plant studied here differs 

from the description of S. saponariae provided by Teterevnikova- 

Babayan (1987), who describes conidia as 1–3-septate, 25–59 × 

3.3–4.5 µm. That species thus has much wider conidia. Host range 

of S. cucubali in literature only mentions Cucubalus, but it is clear 

from the present study that it also includes Saponaria officinalis. 

The strain isolated from beech leaf litter may be an accidental 

dweller and originate from a Caryophyllaceae host growing in the 

vicinity. That the fungus would be capable of infecting Fagus leaves 

as an endophyte seems unlikely but cannot be excluded. 

Septoria cucurbitacearum Sacc., Nuovo G. bot. ital. 8: 205. 

1876. 

Description in vitro: Colonies on OA 38 mm diam in 5 wk, with an 

even, or slightly undulating, colourless, glabrous margin; colonies 

restricted to moderately spreading, almost entirely olivaceousblack, 

due to brown-walled immersed hyphae, the surface mostly 

glabrous, yet in the centre and around pycnidia often with greyish 

white, pruinose aerial hyphae. Conidiomata numerous, scattered or 

gregarious, black, pycnidial, with a single often quite long ostiolate 

neck, but fruitbodies often bursting somewhere in the lower wall, 

conidial slime pale white; reverse concolourous. Conidiogenous 

cells hyaline, discrete, ampulliform to cylindrical, holoblastic, with 

1–3 percurrent proliferations, 8–16 × 3.5–5 µm. Conidia filiform, 

curved or flexuous, hyaline, 3–5(–7)-septate, not constricted 

around the septa, narrowly rounded at the top, slighty attenuating 

to a narrowly truncate base, with minute oil-droplets, (30–)35–55 

(–72) × 1.5–2(–2.5) µm. 

Hosts: Cucurbita spp., Cucumis spp. and Citrullus vulgaris. 

Material examined: New Zealand, culture isolated from living leaves of Cucurbita 

maxima, date of collection and isolation unknown (deposited in Feb. 1977), H. J. 

Boesewinkel s.n., CBS 178.77. 

Notes: No specimens on plant material were available for this study. 

A description based on specimens from Cucumis, Cucurbita and 

Citrullus collected in Australia is provided by Priest (2006), and the 

sporulating structures observed in CBS 178.77 on OA agree well 

with that description. Septoria cucurbitacearum is the oldest name 

on plants of the family Cucurbitaceae, and Punithalingam (1982) 

discussed the relationship with the other taxa on the host genera 

Cucurbita and Cucumis. On the basis of the multilocus sequence 

analysis it can be concluded that S. cucurbitacearum is closely 

related to S. lycospersici (CBS 354.49 and 128654), S. malagutii 

(CBS 106.80), and S. apiicola. 

Septoria digitalis Pass., Atti Soc. crittog. ital. 2: 36. 1879. 

Fig. 17. 

Description in planta (based on CBS H-18090): Symptoms leaf 

spots hologenous, scattered, circular to elliptical, pale yellowish 

brown, definite with a dark brown border, or indefinite, surrounded 

by a larger area of the leaf which turns reddish purple. Conidiomata 

pycnidial, epiphyllous, numerous scattered in each leaf spot, 

subglobose to globose, immersed, brown to black, (70–)85–130 

µm diam; ostiolum central, initially circular and 20–45 µm wide, 

later more irregular and up to 60 µm wide, surrounding cells 

undifferentiated; conidiomatal wall about 12.5–20 µm thick, 

composed of an outer layer of isodiametric cells 4.5–8(–10) µm 

diam or more irregular cells with brown walls 1–2 µm thick, and 

an inner layer of angular to globose cells 2.5–4(–6) µm diam with 

relatively thin, hyaline walls. Conidiogenous cells hyaline, discrete, 

rarely integrated in 1-septate conidiophores, globose, doliiform or 


255


Fig. 17. Septoria digitalis. A, B. Colonies CBS 328.67 (15 ºC, nUV). A. On OA. B. On MEA. C, D. Colonies CBS 391.63 (15 ºC, nUV). C. On OA. D. On MEA. E. Conidia on OA 

(CBS 328.67). Scale bars = 10 µm. 

ampulliform, holoblastic, proliferating sympodially and often also 

percurrently, with close indistinct annellations on an elongated 

neck, 3–8.5(–10) × 2–3.5(–4.5) µm. Conidia filiform-cylindrical to 

cylindrical, straight to slightly curved, rarely somewhat flexuous, 

attenuated gradually to a narrowly rounded to pointed apex, and 

attenuated gradually or more abruptly to a narrowly truncate 

base, 1–3(–4)-septate, not constricted around the septa, hyaline, 

contents with minute oil-droplets and granular contents in the 

rehydrated state, (16.5–)22–44 × 1.5–2(–2.5) µm (rehydrated). 


Description in vitro (18 ºC, near UV light) CBS 328.67: Colonies 

on OA 12–13 mm diam in 2 wk, with an even to slightly ruffled, 

glabrous margin; colonies restricted to spreading, with some irregular 

pustulate elevations in the centre, immersed mycelium dark rust to 

chestnut, mostly covered by a more or less dense mat of low, woolly 

to woolly-floccose, greyish to somewhat reddish aerial mycelium, 

with scattered higher tufts, reverse blood colour; producing a red 

pigment diffusing into the surrounding agar medium. Colonies on 

MEA 10–13 mm diam in 2 wk, with an even margin which is mostly 

covered by aerial mycelium; colonies restricted, irregularly pustulate 

and up to 2 mm high in the centre, immersed mycelium dark, entirely 

covered by a dense mat of appressed, finely felted, grey to ochreous 

or rust aerial mycelium, the surface showing numerous sterile black 

stromata; reverse dark brick or sepia in the centre, surrounded by 

dark violet slate. No sporulation or diffusing pigment observed. CBS 

391.63: Colonies on OA 23–25 mm diam in 2 wk, with an even, 

glabrous margin; colonies spreading, immersed mycelium fulvous 

to rust, or some brown-vinaceous, glabrous, or with barely any 

aerial mycelium, no sporulation observed; reverse blood colour in 

centre, fading to red or coral towards the margin; producing some 

red pigment diffusing into the surrounding agar medium. Colonies 

on MEA 25–30 mm diam in 2 wk, with an even, undulating, glabrous, 

buff margin; colonies restricted to spreading, radially striate, up to 2 

mm high in the centre, immersed mycelium dark, entirely covered by 

a dense mat of appressed, finely felted, rosy vinaceous to flesh aerial 

mycelium with greysih or white zones ; reverse brown-vinaceous to 

blood colour. No sporulation or diffusing pigment observed. 

Conidia (OA) as in planta, 20–48(–52) × 1.5–2.5 µm. 

Hosts: Digitalis spp. 

Material examined: Czech Republic, South Bohemia, Písek, on Digitalis lanata, 

Sep. 1962 V. Holubová-Jechová, living culture CBS 391.63. Netherlands, 

Doornspijk, herbal garden, in leaf spot on D. lanata, 22 June 1967, H.A. van der Aa 

72, CBS H-18090, and dried culture on OA CBS H-18092, living culture CBS 328.67. 

Notes: The two strains investigated here showed some notable 

differences in colony features, and they are therefore described 

separately above. Nonetheless, these strains showed highly 

homologous sequences of all loci investigated here. The strains 

are relatively distant from the closest relatives in the Septoriaclade, 

viz., among others, S. epilobii (CBS 109084, 109085), S. 

verbascicola (CBS 102401), and the strains of S. stachydis and S. 

galeopsidis. According to the original diagnosis, based on material 

on Digitalis lutea, the conidia of S. digitalis are continuous, 25–30 

× 1.5 µm (also in Radulescu et al. 1973, Teterevnikova-Babayan 

1983). Although conidia observed in the material on D. lanata 

studied here are up to 44 µm long and provided with up to 4 septa, 

it is concluded that the name S. digitalis can be applied to this 

material. 

Septoria epilobii Westend., Bull. Acad. r. Belg., Cl. Sci., Sér. 

2, 19: 120. 1852 [non Roberge ex Desm. 1853]. Fig. 18. 

= S. epilobii Roberge ex Desm., Annls Sci. Nat., ser. 3, 20 : 94. 1853 [Nom. 

illeg., later homonym]. 

?= S. epilobii Westend. var. durieui Unamuno, Boln R. Soc. esp. Hist. nat. 34: 

250. 1934. 

Description in planta: Symptoms leaf lesions sparse to numerous, 

single, circular to irregular, rarely entended to the margin of the leaf, 

brown, often with a greyish centre, well-delimited by a dark brown 

elevated line, visible on both sides of the leaf. Conidiomata pycnidial, 

epiphyllous, several in each lesion, subglobose to globose, brown 

to black, 48–75 µm diam; ostiolum central, circular, initially 15–24 


surrounding cells dark brown; conidiomatal wall 12–20 µm thick, 

composed of a homogenous tissue of hyaline, angular cells, 3–6.5 

µm diam, the outermost cells pale brown with slightly thickened 

walls, the inner cells hyaline and thin-walled. Conidiogenous cells 

256


Fig. 18. Septoria epilobii. A–C. Colonies CBS 109084 (15 ºC, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia in planta (CBS H-21171, epitype). E. Conidia and 

conidiogenous cells on OA (CBS 109094). Scale bars = 10 µm. 

hyaline, discrete, rarely also integrated in 1-septate conidiophores, 

cylindrical, or narrowly to broadly ampulliform, holoblastic, 

proliferating sympodially, sometimes with a relatively narrow and 

elongated neck (no annellations seen), 5–14 × 3.5–6 µm. Conidia 

cylindrical or filiform-cylindrical, straight to slightly curved, narrowly 

to broadly rounded at the apex, narrowing slightly or more distinctly 

to a truncate base, (0–)1–3-septate, not or slightly constricted 

around the septa, hyaline, contents with few minute oil-droplets and 

granular material in each cell in the rehydrated state, 25–35(–40) × 

1.5–2(–2.5) µm (rehydrated). Sexual morph unknown. 


(45–48 mm in 7 wk), with an even, glabrous, colourless or vaguely 

buff margin; colonies spreading, plane, in the centre olivaceousblack, 

surrounded by olivaceous radiating hyphal strands; reverse 

concolourous; aerial mycelium absent, or a tuft of white or grey 

woolly aerial mycelium in the centre; abundant olivaceous to 

brown, then black, pycnidial conidiomata developing after 3 wk, 

releasing milky white droplets of conidial slime. Colonies on CMA 

12–14(–16) mm diam in 3 wk (45–50 mm in 7 wk), as on OA, but 

centre more homogeneous olivaceous-black after 3 wk; after 7 wk 

larger outer area saffron to pale ochreous, margin buff; reverse 

concolourous; sporulation as on OA, but older conidial slime pale 

saffron. Colonies on MEA (7–)10–16 mm diam in 3 wk (46–50 mm 

in 7 wk), with an even, glabrous, rosy-buff or buff margin; colonies 

restricted, conical, in the centre with more irregular pustulate 

protruberances, after about 4 wk becoming more spreading, the 

surface brown-vinaceous to almost black, locally ochreous to dirty 

peach, covered by a diffuse, low, minutely felty whitish to grey aerial 

mycelium; reverse brown-vinaceous to dark slate blue, locally 

cinnamon to ochreous; conidiomatal initials developing from 3 wk 

onwards in most of the colonies, but sporulation occurs sparsely in 

submarginal pycnidia after 7 wk in dirty white to rosy-buff droplets. 

Colonies on CHA 7–12(–16) mm diam in 3 wk (34–38 mm in 7 wk), 

as on MEA, including sporulation. 

Conidiomata as in planta, single or merged, with a single or a 

few papillate openings, which can be positioned on an elongated 

neck; conidiogenous cells as in planta, proferating sympodially and 

possibly also percurrently, but the presence of annellations could 

not be confirmed, 5–18 × 3.5–6 µm; conidia as in planta, 24–41 × 

1.8–2.5 µm. 

Hosts: Chamaenerion angustifolium and Epilobium spp. 

Material examined: Austria, Tirol, Ober Inntal, Samnaun Gruppe, Zanderstal near 

Spiss, alt. 1800 m, on rocky bank of Zandersbach, on living leaves of Epilobium 

fleischeri, 11 Aug. 2000, G. Verkley 1068, epitype designated here CBS H-21171 

“MBT175355”, living cultures ex-epitype CBS 109084, 109085. Belgium, on the 

bank of river Wépion, near Namur, on leaves of E. spicatum (= E. angustifolium, 

Chamaenerion angustifolium), 1829, Bellynck, “Westendorp & Wallay Herb. Crypt. 

no. 727”, isotype BR-MYCO 158690-95. Netherlands, prov. Utrecht, Baarn, 


257


Baarnsche bos, ex leaf spot of E. angustifolium, 17 Sep. 1967, L. Marvanová s.n., 

living culture CBS 435.67 no longer available (infected with basidiomycete). 

Notes: In the type specimen of S. epilobii on Epilobium angustifolium 

(= Chamaenerion angustifolium), from BR, 1–3-septate conidia, 20– 

40 × 1–1.5 µm are observed. Although the collection of S. epilobii 

from Tirol was collected on another host species, E. fleischeri, it 

agrees morphologically well with the type material, and therefore 

this Austrian collection is chosen here as epitype. It is considered 

likely that a single taxon is capable of infecting various members 

of the genera Epilobium and its sister-genus Chamaenerion. The 

concept of S. epilobii maintained here concurs with that of most 

authors (Radulescu et al. 1973, Teterevnikova-Babayan 1987), 

except Vanev et al. (1997), who gave a much wider length range of 

conidia, viz., 12–72 ×1–2 µm, but their concept of S. epilobii may 

erroneously have been based in part on specimens of S. alpicola. 

Septoria epilobii is very distinct from S. alpicola Sacc. 1897, a 

species causing systemic infections in Epilobium spp. in alpine 

and boreal regions (type host E. alpinum), developing pycnidia on 

symptomless leaves as well as stems that produce conidia, 24–95 

× 0.7–1.5(–2) µm, with up to 7 septa (Jørstad 1965). 

Septoria epilobii var. durieui Unamuno, which has been 

described from E. duriaei in Spain, with conidia 30–55 × 1.5 µm, is 

tentatively placed here in the synonymy of S. epilobi. 

As can be seen in the multilocus phylogeny (Fig. 2), the strains 

of Septoria epilobii are closely related to CBS 102401, which was 

isolated from Verbascum nigrum, and preliminarily identified as S. 

verbascicola Berk. & M.A. Curtis. This name is a nomen nudum and 

the type should be studied. Other closely related species include S. 

taraxaci (CBS 567.75), S. stachydis, S. galeopsidis, and S. digitalis. 

Septoria erigerontis Peck, Rep. N.Y. St. Mus. nat. Hist. 24: 

87. 1872 [non Berk. & M.A. Curtis 1874; nec Hollós 1926, 

later homonyms]. Fig. 19. 

≡ Septoria erigerontea Sacc., Syll. Fung. 3: 547. 1884 [nom. illeg., Art. 52. 

superfluous nom. nov.]. 

= Septoria erigeronata Thüm., Bull. Soc. Imp. Nat. Moscou 56: 132. 1881. 

= Septoria schnabliana (Allesch.) Died., KryptogFl. M. Brandenb. 9: 454. 1914. 

≡ Rhabdospora schnabliana Allesch., Hedwigia 34: 273. 1895. 

= Septoria chanousii Ferraris, Malpighia 16: 27. 1902. 

= Septoria stenactidis Vill, in Sydow, Annls mycol. 8: 493. 1910. 

?= Septoria bosniaca Picb., Glasnik Zemal. Muz. Bosn. Herceg. 45: 68. 1933. 

Description in planta: Symptoms leaf spots hologenous, scattered, 

circular to irregular, pale brown, indefinite or surrounded by 

a slightly darker margin. Conidiomata pycnidial, epiphyllous, 

numerous scattered in each leaf spot, subglobose to globose, 

brown to black, semi-immersed, 75–130 µm diam; ostiolum 

central, initially circular and 15–35 µm wide, later more irregular, 

up to 55 µm wide, surrounding cells dark brown and with more 

thickened walls; conidiomatal wall about 8–12.5 µm thick, 

composed of a homogenous tissue of hyaline, angular cells 2.5–4 

µm diam with relatively thin, hyaline walls, surrounded by a layer of 

pale to dark brown cells, 2–5 µm diam, with somewhat thickened 

walls. Conidiogenous cells hyaline, discrete, rarely integrated in 

1–2-septate conidiophores, cylindrical to doliiform, or narrowly to 

broadly ampulliform, holoblastic, proliferating mostly sympodially, 

rarely also percurrently with indistinct annellations, 6–10 × 

2.5–4.5 µm. Conidia filiform, straight, slightly curved to flexuous, 

attenuated gradually to a narrowly rounded to pointed apex and 

narrowly truncate base, (0–)1–3(–5)-septate, not constricted 

around the septa, hyaline, contents with several minute oil-droplets 

and granular material in each cell in the living state, with minute 

oil-droplets and granular contents in the rehydrated state, (17–)25– 

50(–62.5) × 1–1.5(–2) µm (rehydrated). Sexual morph unknown. 


mm in 7 wk), with an even, glabrous, colourless to pale red or 

coral margin, the pigment also clearly diffusing beyond the margin; 

colonies spreading, the surface almost plane, immersed mycelium 

translucent and red everywhere (12 d), in the centre with densely 

aggregated superficial pycnidial conidiomata often with distinct 

papillate to rostrate openings, which later may elongate further, 

pycnidia elsewhere in radiating rows, later also in concentric 

rings, releasing milky white to pale buff droplets of conidial slime; 

aerial mycelium white, felty, scanty, mostly in the centre; reverse 

concolorous. Colonies on CMA 7–10 mm diam in 12 d (50–59 mm in 

7 wk), as on OA, but immersed hyphae darker and olivaceous, but 

red pigmentation still distinct, especially around the colony margin. 

Colonies on MEA 4–7 mm diam in 12 d (45–48 mm in 7 wk), with a 

ruffled, colourless to pale buff, plane marginal zone; colony initially 

restricted, hemispherical after 12 d, with an irregularly pustulateworty 

surface, later for the most plane and spreading, immersed 

mycelium very dark chestnut to black, aerial mycelium on elevated 

surface almost absent, but near margin forming short-tufty mat of 

pure white hyphae; superficial pycnidial conidiomata releasing pale 

flesh or milky white droplets of conidial slime. Colonies on CHA 

6–8 mm diam in 12 d (29–36 mm in 7 wk), as on MEA, but in some 

sectors with an even, rosy-buff margin; colonies less elevated in 

the centre than on MEA, covered with diffuse, woolly, greyish aerial 

mycelium in the centre, and a low, dense mat of reddish hyphae 

near the margin; pycnidial conidiomata more numerous than on 

MEA, later in distinct, concentric patterns, producing flesh, later 

salmon droplets of conidial slime. 

Conidiogenous cells (OA) as in planta, but more frequently 

proliferating percurrently and with distinct annellations. Conidia as 

in planta, up to 85 µm long and 2.5 µm wide. 

Hosts: Conyza spp. and Erigeron spp. 

Material examined: Austria, Tirol, Inntal W of Innsbruck, S of Telfs, along road 171, 

on living leaves of Erigeron annuus, 4 Aug. 2000, G. Verkley 1045, CBS H-21176, 

living culture CBS 109094, 109095; same substr., country unknown, M. Vurro, living 

culture CBS 186.93 (sub S. schnabliana). South Korea, Namyangju, same substr., 

H.D. Shin, 3 May 2006, living culture SMKC 21739 = KACC 42356 = CBS 128606; 

same country, loc. unknown, same substr., living culture CPC 12340 = CBS 131893. 

Notes: The material available for this study agreed generally 

well with the detailed descriptions given for this species in recent 

literature (Shin & Sameva 2004, Priest 2006). However, Priest 

(2006) did not observe sympodial proliferation in the conidiogenous 

cells. Shin & Sameva (2004) reported conidia up to 70 µm long 

in material from South Korea. Verkley & Starink-Willemse (2004) 

already showed that the ITS sequence of CBS 186.93 identified 

as S. schnabliana is identical to that in S. erigerontis (CBS 

109094), and suspected the conspecificity of this material. Strong 

evidence for this conspecificity is provided here, as the additional 

genes sequenced were all (almost) identical for the three isolates 

investigated, and also for CBS 128606 (= KACC 42356) and CBS 

131893 (= CPC 12340) from the same host in South Korea. 

According to the diagnosis, Septoria stenactidis, described 

from Stenactis annua (= E. annuum), has continuous (or 

indistinctly septate) conidia, 35–40 × 1 µm, which agrees well with 

S. erigerontis on the type host, and it was already placed in the 

synonymy by Jørstad (1965), and recently also by Priest (2006). 

Priest also included S. chanousii in the synonymy of S. erigerontis. 

258


Fig. 19. Septoria erigerontis. A–C. Colonies CBS 109094 (15 ºC, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia in planta (CBS H-21176). E. Conidia and conidiogenous 

cells on OA (CBS 109094). F, G. Conidia in planta (CBS H-21176). H, I. Conidia on OA (CBS 186.93). Scale bars = 10 µm. 

This fungus was originally decribed on E. uniflora in Italy, with 

3–4-septate conidia measuring 45–50 × 1.5 µm. Likewise, 

S. bosniaca from Erigeron polymorphus described in the diagnosis 

as a fungus with 0(–3)-septate conidia, 19–42 × 1.3–1.9 µm, is 

probably also a synonym. 


259


Septoria galeopsidis Westend., Bull. Acad. r. Belg., Cl. Sci., 

Sér. 2, 2: 577. 1857. Fig. 20. 

= Ascochyta galeopsidis Lasch in Rabenh., Herb. Myc. I, 1058. 1846 [nom. 

nud.]. 

= Septoria cotylea Pat. & Har., Bull. Soc. Mycol. France 21: 85. 1905. 

Description in planta: Symptoms leaf spots irregular or angular, 

becoming dark brown, in yellow parts of the leaf lamina. 

Conidiomata pycnidial, hypophyllous, often numerous in each 

leaf spot, globose to subglobose, dark brown, almost completely 

immersed, 75–100(–130) µm diam; ostiolum central, initially 

circular, 15–25 µm wide, surrounding cells somewhat darker; 

conidiomatal wall 10–22 µm thick, composed of textura angularis 

without distinctly differentiated layers, the cells 3–8 µm diam, 


cells with hyaline and thinner walls. Conidiogenous cells discrete, 

sometimes integrated into 1–2-septate conidiophores, hyaline, 

narrowly or broadly ampulliform with a relatively narrow neck, 

holoblastic, proliferating percurrently with indistinct annellations, 

and also sympodially, 6–12(–15) × 3.5–5(–6) µm. Conidia filiform, 

straight or slightly curved, sometimes flexuous, with a rounded or 

somewhat pointed apex, attenuated towards the narrowly truncate 

base, (0–)3(–5)-septate, not constricted around the septa, hyaline, 

contents with several minute oil-droplets and granular material in 


granular contents in the rehydrated state, 20.5–44 × 1.5–2.5 µm 

(living; rehydrated, 1–2 µm wide). Sexual morph unknown. 


mm in 6 wk), with an even, glabrous, colourless margin; colonies 

almost plane, immersed mycelium homogeneously olivaceousblack 

to greenish black (also near the margin); aerial mycelium 

scanty, woolly-floccose, white or greyish; superficial pycnidial 

conidiomata scanty, scattered over the central aerea, releasing 

milky white droplets of conidial slime; reverse dark slate blue to 

black. Colonies on CMA 7–13 mm diam in 2 wk (33–37 mm in 6 

wk), as on OA, but concentration of conidiomatal development in 

elevated pustules on the elsewhere flat colony. Colonies on MEA 

6–11 mm diam in 2 wk (33–39(–46) mm in 6 wk), the margin even, 

later undulating, buff, narrow and glabrous; colonies hemispherical, 

often irregularly pustulate or with columnar outgrowths up to 5 

mm high, immersed mycelium olivaceous-black to black, mostly 

covered by a dense mat of finely velted, greyish aerial mycelium; 

faster growing, glabrous sectors with buff immersed mycelium may 

appear after several weeks; conidiomata starting to develop on 

the (dark) colony surface, tardily sporulating with whitish to flesh 

droplets of conidial slime; reverse brown-vinaceous or olivaceousblack. 

Colonies on CHA 5–10(–15) mm diam in 2 wk (20–29 mm 

in 6 wk), with an even, glabrous to nearly so, buff margin; colonies 

irregularly pustulate, immersed mycelium olivaceous-black, mostly 

covered by a dense but appressed mat of woolly-floccose, grey 

aerial mycelium, in some slightly faster growing sectors pure white; 

scattered but scarce superficial conidiomata releasing pale flesh 

droplets of conidial slime; reverse blood colour to black. 

Conidiomata pycnidial and similar as in planta, 100–150 µm 

diam, or merged into larger complexes especially on the agar 

surface, dark brown, up to 200 µm diam; ostiolum as in planta, 

or absent. Conidiogenous cells hyaline, ampuliform, or elongated 

ampulliform to cylindrical, with a distinct neck, holoblastic, 

proliferating percurrently with indistinct scars (annellations), or 

sympodially, 8–13(–15) × 3–4.5(–5) µm. Conidia cylindrical, 

straight or slightly curved, tapering to a rounded or somewhat 

pointed apex, lower part slightly or more clearly attenuated into a 

broad truncate base, (0–)1–3(–5)-septate, not constricted around 

the septa, hyaline, with several oil-droplets and minute granular 

material in each cell, (37–)50–65 (–70) × 2–2.5 µm. 

Hosts: Galeopsis angustifolia, G. ladanum, G. pubescens, G. 

speciosa and G. tetrahit. 

Material examined: Belgium, in the vicinity of Mons, on leaves of Galeopsis tetrahit, 

R. P. Clém. Dumont, distributed in Westendorp & Wallays, Herb. crypt. Belge, Fasc. 

23-24, no 1134, isotype BR-MYCO 158116-06. Czech Republic, Moravia, Mikulov, 

on living leaves of Galeopsis sp., 15 Sep. 2008, G. Verkley 6003, CBS H-21256, 

living cultures CBS 123744, 123749; same substr., date, Moravia, Milovice, forest 

Milovika stran, G. Verkley 6006, CBS H-21254, living cultures CBS 123745, 123746. 

France, Corrèze, Prât Alleyrat, on living leaves of G. tetrahit, 25 July 1976, H.A. van 

der Aa 5344, CBS H-18099; loc. unknown, isol. C. Killian ex Galeopsis sp., living 

culture CBS 191.26. Netherlands, prov. Noord-Brabant, Cromvoirt, on living leaves 

of G. tetrahit, 2 June 1963, H.A. van der Aa s.n., CBS H-18097; prov. Gelderland, 

Putten, on living leaves of G. tetrahit, 8 Aug. 1984, G. de Hoog s.n., CBS H-18100; 

prov. Utrecht, Soest, on living leaves of G. tetrahit, 4 Aug. 1999, G. Verkley 902, CBS 

H-21195, living culture CBS 102314; prov. Limburg, St. Jansberg near Plasmolen, 

on living leaves of G. tetrahit, 9 Sep. 1999, G. Verkley 934, epitype designated 

here CBS H-21215 “MBT175356”, living culture ex-epitype CBS 102411. Romania, 

distr. Satu-Mare, Pir, on living leaves of G. ladanum, 27 Aug. 1973, G. Negrean s.n., 

CBS H-18098. 

Notes: Jørstad (1965) reported comparable conidial size ranges 

in specimens on different host species, viz. G. speciosa (extreme 

values 20–64 × 1–2.5 µm) and G. tetrahit (28–60 × 1–2 µm), 

although in most Norwegian collections on G. tetrahit, the maximum 

conidial length varied downwards to 48 µm. In the original 

diagnosis of S. galeopsidis conidia are described as 30–40 × 

1–1.5 µm (Saccardo 1884), while Radulescu et al. (1973) reported 

measurements ranging between 20–45 µm in length in collections 

on various hosts. In the type material from BR investigated here 

conidia are mostly 3–5-septate, 19–40 × 1.5–2 µm. In other 

material available for the present study, maximum length of conidia 

was only 44 µm in planta, whereas the strains obtained from it were 

capable of forming conidia with a maximum length of 70 µm on OA. 

The differences with S. lamiicola are discussed under that species. 

Septoria galeopsidis is closely related to only some of the other 

Septoria species occurring on plants from the family Lamiaceae, 

especially S. melissae (CBS 109097) and S. stachydis. Septoria 

lamiicola on Lamium spp., which is morphologically quite similar 

to S. galeopsidis, proves genetically very distinct, although these 

taxa can barely be distinguished by their ITS sequence (99.5 %). 

Several house-keeping genes do allow an easy identification of 

these species. 

Septoria heraclei (Lib.) Desm., Pl. crypt. Fr., Fasc. 11, no 

534. 1831. Fig. 21. 

Basionym: Ascochyta heraclei Lib., Pl. crypt. Ard., Cent. 1: no. 51. 

1830. 

≡ Cylindrosporium heraclei (Lib.) Höhn., Sber. Akad. Wiss. Wien, Math.- 

naturw. Kl. 115, I: 378. 1906 [non Oudem. 1873, nec Ellis & Everh. 1888]. 

≡ Phloeospora heraclei (Lib.) Petr., Annls mycol. 17: 71. 1919 [non (Lib.) 

Maire, Bull. Soc. Mycol. France 46: 241. 1930]. 

≡ Cylindrosporium umbelliferarum Wehm., Mycologia 39: 475. 1947. 

nom. nov. 

= Septoria heraclei-palmati Maire, Bull. Soc. Mycol. France 21: 167. 1905. 


irregular in outline, best visible on the upper side of the leaf, 

initially yellowish or ochreous, later becoming pale to dark brown, 

in places white due to loosening of the epidermis. Conidiomata 

pseudopycnidial, hypophyllous, one, rarely up to three in each 

260


Fig. 20. Septoria galeopsidis, CBS 102314. A–C. Colonies (15 ºC, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia on OA. E. Conidia and conidiogenous cells in planta 

(CBS H-21195). F–H. Conidia on OA (CBS 123744). Scale bars = 10 µm. 

leaf spot, lenticular, immersed, the upper wall rupturing in an early 

stage and conidial masses breaking through the leaf epidermis, 

pale brown, 115–200 µm diam; ostiolum absent; conidiomatal wall 

about 15–28 µm thick, composed of an outer layer of pale brown 

angular cells, 5–10 µm diam with somewhat thickened walls, 

and an inner layer of thin-walled, pale yellow angular to globose 

cells, 4.5–8 µm diam. Conidiogenous cells hyaline, discrete, 

rarely integrated in 1-septate conidiophores, cylindrical, or broadly 

ampulliform, holoblastic, proliferating percurrently one to several 

times with distinct annellations, sometimes also sympodially, 


261


already considered this name as a synonym of S. heraclei. Other 

authors have mostly accepted S. heracleicola as a further Septoria 

species on Heracleum, describing the conidia as continuous and 

ranging roughly in size 20–40 × 1–2 µm (Radulescu et al. 1973, 

Teterevnikova-Babayan 1987, Vanev et al. 1997). Four further 

Septoria and two Rhabdospora species have been described in the 

literature based on material found on various members of the genus 

Heracleum, all of which according to their original descriptions 

have conidia more or less within this range, so with much narrower 

conidia than S. heraclei. 

Septoria hypochoeridis Petrov, Materialy po mikol. i fitopat. 

Rossii (Leningrad) 6 (1): 55. 1927. Fig. 22. 

Description in planta: Symptoms leaf spots scattered, 2–5 mm 

diam, definite, circular, hologenous, grey to white in the centre, 

surrounded by a slightly elevated, dark reddish purple or black 

zone. Conidiomata pycnidial, hypophyllous, one to a few in each 

leaf spot, (sub)globose, immersed, dark brown, 60–95 µm diam; 

ostiolum central, circular, 15–28 µm diam, surrounded by darker 

cells; conidiomatal wall about 10–20 µm thick, composed of an 

outer layer isodiametric or more irregular cells, 5–10 µm diam, 

with somewhat thickened, pale brown walls, and an inner layer 

of thin-walled, hyaline angular to globose cells, 4.5–7 µm diam. 

Conidiogenous cells hyaline, discrete, cylindrical, or broadly 

ampulliform, holoblastic, proliferating sympodially, percurrent 

proliferation not observed, 8–15 × 3.5–4(–5.5) µm. Conidia filiform, 

straight to slightly curved, attenuated gradually to a somewhat 

pointed apex, or more abruptly just above the broadly truncate 

base, 0–1(–2)-septate, not constricted at the septum, hyaline, 

contents with granular material in the rehydrated state, 15–24 × 

1–1.5 µm (rehydrated). Sexual morph unknown. 

Fig. 21. Septoria heraclei, conidia and conidiogenous cells in planta (CBS H-21224). 


10–25 × 5–7(–8) µm. Conidia cylindrical, usually strongly curved, 

attenuated gradually to a blunt to somewhat pointed apex, 

attenuated gradually, or more abruptly just above the broadly 


around the septa, hyaline, contents with numerous small oildroplets 

and granular material in each cell in the living state, with 

amorphous granular contents in the rehydrated state, 40–55(–70) 

× 4–6 µm (living; rehydrated, 3–5 µm wide). 

Description in vitro: Several attempts were made to isolate this 

species but unfortunately no conidia survived after germination. 

Hosts: Heracleum spp. 

Material examined: Austria, Tirol, Ötztal, Ötz near Habichen, on living leaves of 

Heracleum sphondylium, 24 July 2000, G. Verkley 1002, CBS H-21186. Netherlands, 

Prov. Limburg, Gulpen, near Stokhem, on living leaves of H. sphondylium, 28 June 

2000, G. Verkley 957, CBS H-21224; same substr., Prov. Limburg, upper edge of 

Savelsbos, G. Verkley 959, CBS H-21225. 

Notes: The conidia of this fungus are much wider than in most other 

Septoria species on Apiaceae. Jørstad (1965) reported conidia 35– 

57 × 3–5 µm, usually with 1 septum. Vanev et al. (1997) observed 

conidia up to 85 µm long, and 1.8–3.5 µm wide. Septoria heracleipalmati 

was originally described from Heracleum palmatum in 

Greece, with 1-septate conidia, 50–70 × 3 µm. Jørstad (1965) 

Description in vitro: No cultures could be obtained. Conidia placed 

on MEA and OA died shortly after germination. 

Hosts: Hypochoeris radicata and other Hypochoeris spp. 

Material examined: New Zealand, North Island, Taupo distr., Tongariro Nat. Park, 

Taurewa, along road 47, on decaying leaf base of Hypochoeris radicata, 25 Jan. 

2003, G. Verkley 1871, CBS H-21234. 

Additional material examined: New Zealand, North Island, Taupo distr., Lake Taupo, 

shoreline E of Motutaiko Island, on living leaves of Crepis capillaris, 25 Jan. 2003, 

G. Verkley 1870, CBS H-21235. 

Notes: The material on Hypochoeris radicata from New Zealand 

agrees well with the original description and drawing of Septoria 

hypochoeridis; conidia are reported as continuous to 1-septate, 

19–22 × 1.5 µm. According to Teterevnikova-Babayan (1987), the 

conidia of this species can be somewhat larger, 20–25 × 1.5–2 

µm, and Hypochoeris grandiflora is also infected. Rhabdospora 

hypochoeridis was described from dead stems of H. radicata in 

Germany, with curved conidia, 16–30 × 0.6–1 µm, which, according 

to Priest (2006), is suggestive of a Phomopsis with β-conidia rather 

than a Septoria. Another species ocurring on this host and other 

Asteraceae is Septoria lagenophorae, which occurs in association 

with Puccinia spp. and other fungi (Priest 2006). This fungus can 

be distinguished from S. hypochoeridis by 1–2-septate conidia, 

15–32 µm long, and conidiogenous cells which are not proliferating 

sympodially but produce successive conidia enteroblastically at the 

same level through a narrow opening (Priest 2006), so appearing 

phialidic. 

262


Fig. 22. Septoria hypochoeridis, CBS H-21234. A, B. Conidia in planta. Scale bars = 10 µm. 

The collection on Crepis capillaris studied here may also belong 

to S. hypochoeridis, but no earlier reports from the host genus Crepis 

have been documented. This material agrees in all morphological 

characters with the collection on Hypochoeris, but the conidia lack 

septa. It is certainly morphologically different from Septoria crepidis, 

which produces much larger, mostly 3-septate conidia [22–55 × 

1.5–2(–2.5) cf. Shin & Sameva 2004]. The S. crepidis strains CBS 

128608 (= KACC 42396), 128619 (= KACC 43092) and 131895 (= 

CPC 12539) isolated from Crepis japonica (syn. Youngia japonica) 

in South Korea, group with CBS 128650, Septoria sp. (originally 

identified as S. taraxaci), but by lack of cultures and molecular data 

for S. hypochoeridis the phylogenetic relationship with S. crepidis 

and allied Septoria remains to be resolved. 

Septoria lactucae Pass., Atti Soc. crittog. ital. 2: 34. 1879 

[non Peck, Bot. Gaz. 4: 170. 1879. Later homonym, nom. 

illeg. Art. 53]. Fig. 23. 

Description in vitro: Colonies on OA 8–9 mm diam in 2 wk, with 

an even to undulating, colourless margin; colonies spreading 

to restricted, immersed mycelium pale luteous, without aerial 

mycelium, conidiomata developing immersed and on the agar 

surface, mostly in the centre and in radiating rows, conidiomata 

releasing milky white to rosy-buff conidial masses; reverse hazel 

with a tinge of ochreous. Colonies on MEA 4.5–6 mm diam in 2 wk, 

with a minutely ruffled, buff margin; colonies restricted, irregularly 

pustulate, the surface almost black, with low and weakly developed, 

finely felted, white to grey aerial mycelium but also glabrous areas 

occur; reverse chestnut to brown-vinaceous. No sporulation 

observed. 

Conidia (OA) filiform to cylindrical, weakly to strongly curved, 

attenuated gradually towards the relatively broadly, more rarely 

narrowly rounded apex, attenuated gradually or more abruptly to 

a truncate base, hyaline, (0–)1–3-septate, contents granular and 

sometimes also with minute oil-droplets, (22–)28–38.5(–46) × 

2–2.5 µm (living). Sexual morph unknown. 

Hosts: Lactuca sativa and L. serriola. 

Material examined: Germany, Potsdam, on leaf of Lactuca sativa, 20 Nov. 1958, 

G. Sörgel 628, living culture CBS 352.58. Netherlands, on seed of L. sativa, Sep. 

2000, P. Grooteman s.n., living culture CBS 108943. 

Notes: Septoria lactucae is the oldest name described in Septoria 

from the host Lactuca sativa. Three others have been described 

from lettuce (including two later homonyms), and another eight from 

other species of the genus Lactuca. Symptoms of the minor leaf 

spot disease of lettuce were described by Punithalingam & Holiday 

(1972). They describe the conidia as 1–2(–3)-septate, 25–40 × 

1.5–2 µm. Muthumary (1999) examined the type and described 

the conidia as fusiform, straight to slightly curved, narrowed at the 

tip, truncate at the base, 1–3 septate, 32–52 (av. 35) × 2–2.5 µm. 

According to Jørstad (1965), conidia of S. lactucae are 19–48 × 

1.5–2 µm with up to 2 septa, while Priest (2006) describes them 

as 1–3-septate, 22–33(–36) × 2–2.5(–3) µm. CBS 128757 (KACC 

43221) isolated from Sonchus asper in South Korea, and identified 

as Septoria sonchi, is very closely related and groups in a cluster 

with 100 % bootstrap support with the strains of S. lactucae 

(Fig. 2). 

Septoria lamiicola Sacc., Syll. Fung. 3: 358. 1884. nom. 

nov. pro S. lamii Sacc., Michelia 1: 180. 1878. Fig. 24. 

≡ Septoria heterochroa Roberge ex Desm. f. lamii Desm., Annls Sci. Nat., 

sér. 3, Bot. 8: 22. 1847. 

= Septoria lamii Westend., in Bellynck, Bull. Acad. Roy. Sci. Belgique 19: 63. 

1852. 

= Septoria lamii Pass., in Thüm., Mycoth. univ., Cent. 12, no 1183. 1878; Atti 

Soc. crittog. ital. 2: 37. 1879. 

Description in planta: Symptoms leaf spots circular to angular, white 

to pale brown, surrounded by a dark brown border. Conidiomata 

pycnidial, epiphyllous, several in each leaf spot, globose to 

subglobose, dark brown, immersed to semi-immersed, 65–100 

µm diam; ostiolum central, initially circular, 20–35 µm wide, later 

up to 50 µm wide, surrounding cells concolorous or somewhat 

darker; conidiomatal wall 12–25 µm thick, composed of textura 

angularis without distinctly differentiated layers, the cells 3.5–8 

µm diam, the outer cells with brown, somewhat thickened walls, 

the inner cells with hyaline and thinner walls. Conidiogenous cells 

hyaline, narrowly or broadly ampulliform with a relatively narrow 


263


Fig. 23. Septoria lactucae. A–D. Colonies CBS 108943 (15 °C, nUV). A. On OA. B. On MEA. C. Colony margin on OA. D. Colony margin on MEA. E–I. Conidia on OA (CBS 

108943). Scale bars = 10 µm. 

neck, holoblastic, proliferating sympodially, and towards the apex 

often also percurrently 1–many times with indistinct annellations, 

5–10(–12) × 3.5–4(–5) µm. Conidia filiform to filiform-cylindrical, 

straight or slightly curved, rarely flexuous, with a rounded or 

somewhat pointed apex, attenuated towards the narrowly truncate 

base, (0–)3(–5)-septate, not constricted around the septa, hyaline, 



granular contents in the rehydrated state, (26–)35–50(–54) × 1.5– 

2.5( –3) µm (living; rehydrated, 1–2 µm wide; V1032, rehydrated, 

33–52 × 1.5–2). Sexual morph unknown. 



plane, immersed mycelium colourless to pale primrose or buff, later 

becoming homogeneously dark herbage green, soon appearing 

darker by numerous immersed and superficial pycnidial conidiomata, 

that release dirty white to rosy-buff conidial slime; aerial mycelium 

absent, only developing in the centre after several wk as a sharply 

delimited, dense, white, woolly floccose mat; reverse buff at the 

margin, inwards dark olivaceous-grey. Colonies on CMA 4–8 mm 

diam in 2 wk (20–27 mm in 6 wk), with an even, glabrous margin; 

as on OA but immersed mycelium more honey to pale luteous 

throughout, later becoming more greenish, the pycnidial conidiomata 

as on OA, but in more regular concentric rings, releasing rosy-buff, 

later salmon conidial slime. Colonies on MEA 7–9 mm diam in 2 

wk (28–33 mm in 6 wk), with an even (later undulating), glabrous, 

buff to honey margin; colonies pustulate to almost hemispherical, 

immersed mycelium rather dark, locally covered by woolly to felty 

white aerial mycelium; mostly composed of spherical conidiomatal 

264


Fig. 24. Septoria lamiicola, CBS 102329. A–C. Colonies (15 °C, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia in planta (CBS H-21181). E. Ibid. (CBS H-21216). F. 

Conidia and conidiogenous cells on OA (CBS 102380). Scale bars = 10 µm. 

initials, superficial mature conidiomata releasing a dirty white, later 

buff conidial slime; reverse dark brick in the centre, near the margin 

cinnamon to honey. Colonies on CHA 8–14 mm diam in 2 wk (35–42 

mm in 6 wk), with an even, but later irregular, buff margin covered 

by a diffuse, felty white aerial mycelium; further as on MEA, but the 

colony surface less elevated, and more homogeneously covered 

by diffuse, felty, white aerial mycelium; conidial slime abundantly 

produced, first milky white, later dirty honey; reverse in the centre 

blood colour, dark brick at the margin. 

Conidiomata pycnidial, first olivaceous, then almost 

black, glabrous, 150–450 µm diam, with 1–5 ostioli placed on 

short papillae or more elongated necks up to 350 µm long; 

conidiogenous cells as in planta, proliferating sympodially and 

mostly also percurrently with distinct annellations, 8–16 × 3–8 

µm; conidia cylindrical, straight or slightly curved, tapering to a 

rounded apex, lower part slightly attenuated into a broad truncate 

base, (0–)1–5-septate, not constricted around the septa, hyaline, 

with several oil-droplets and minute granular material in each cell, 

(34–)50–65(–70) × 2–3 µm. 

Hosts: Lamium album, L. maculatum, L. purpureum and several 

other Lamium spp. 

Material examined: Austria, Tirol, Ötztal, Sulztal, Gries, alt. 1570 m, on living leaves 

of Lamium album, 1 Aug. 2000, G. Verkley 1032, CBS H-21181, living cultures 

CBS 109112, 109113. Czech Republic, Moravia, Pavlov, forest around ruin, on 

living leaves of Lamium sp., 18 Sep. 2008, G. Verkley 6020, CBS H-21251, living 

cultures CBS 123882, 123883, and 6021, CBS H-21252, living culture CBS 123884. 

Netherlands, prov. Limburg, St. Jansberg near Plasmolen, on living leaves of L. 

album, 9 Sep. 1999, G. Verkley 925, CBS H-21207, living cultures CBS 102328, 

102329; prov. Gelderland, Millingen aan den Rijn, Millingerwaard, on living leaves of 

L. album, 6 Oct. 1999, G. Verkley 936, CBS H-21216, living cultures CBS 102379, 

102380. 

Notes: According to Jørstad (1965), conidia of S. lamiicola are 

3-septate, 24–60 × 1–2 µm, while Teterevnikova-Babayan (1987) 

reported 35–50 × 0.75–1.5 µm from seven Lamium species. 

For the current study, only fresh material on Lamium album was 

available. Jørstad (1965) mentioned the resemblance of the 

conidia with those in S. galeopsidis, but also noted a difference 

in the wall thickness of the pycnidia, which we did not observe. A 


265


much more profound difference is seen between cultures of the 

two species, with colonies of S. galeopsidis on OA being opaque 

and dark olivaceous-black even at the margin, while colonies of 

S. lamiicola are more translucent yellowish to ochreous, becoming 

darker only due to the formation of pycnidia. Priest (2006) pointed 

towards differences in conidial width and conidiogenesis between 

S. lamiicola and S. galeopsidis, but having compared both species 

morphologically in planta and in vitro, we conclude that these 

species cannot be distinguished using these criteria. These two 

species are, however, readily distinguished by DNA sequence 

data, and the multilocus phylogeny provides evidence for a close 

relationship with S. matricariae (CBS 109000, CBS 109001), while 

other Septoria occurring on the same plant family as S. lamiicola 

(Lamiaceae) are all much more distant (Fig. 2). The Austrian 

and Dutch collections of S. lamiicola on L. album are sufficiently 

homogenous to consider them conspecific. 

Septoria leucanthemi Sacc. & Speg., in Saccardo, Michelia 

1: 191. 1878. Fig. 25. 

≡ Rhabdospora leucanthemi (Sacc. & Speg.) Petr., Sydowia 11: 351. 

1957. 

For addditional synonyms see Punithalingam (1967b). 

Description in planta: Symptoms leaf spots hologenous or 

epigenous, scattered, circular to irregular, pale to dull brown 

throughout or with whitish central area, indefinite with concentric 

zones or delimited by a slightly darker margin. Conidiomata 

pycnidial, predominantly epiphyllous, numerous scattered in each 

leaf spot, subglobose to globose, brown to black, semi-immersed, 

130–220(–240) µm diam; ostiolum central, circular, 35–100 µm 

wide, surrounding cells dark brown and with more thickened 

walls; conidiomatal wall about 8–12.5 µm thick, composed of a 

homogenous tissue of hyaline, angular cells, 2.5–5 µm diam with 

relatively thin, hyaline walls, surrounded by a layer of pale to dark 

brown angular to more irregular cells, 3–6.5 µm diam with slightly 

thickened walls. Conidiogenous cells hyaline, discrete, rarely 

integrated in 1–2-septate conidiophores, cylindrical to doliiform, 

or ampulliform, holoblastic, proliferating percurrently with indistinct 

annellations, or sympodially, 6–18 × 4–6.5(–7.5) µm. Conidia filiform 

to filiform-cylindrical, straight, curved, sometimes slightly flexuous, 

attenuated gradually to a narrowly rounded to pointed apex, widest 

near the base, where attenuating abruptly or more gradually into a 

narrowly truncate base, (5–)6–13-septate (later secondary septa 

are developed in some cells), not constricted around the septa, 

hyaline, contents with several minute oil-droplets and granular 

material in each cell in the living state, with minute oil-droplets and 

granular contents in the rehydrated state, (67–)80–100(–125) × 

2.5–3.0(–3.5) µm (rehydrated). Sexual morph unknown. 


(11–14(–17) mm in 3 wk), with an even, glabrous, colourless 

margin; colonies spreading, the surface plane, immersed mycelium 

pale buff, later more or less rosy-buff; in the centre complexes of 

pycnidial conidiomata with pale brown or olivaceous walls release 

masses of pale whitish to buff conidial slime; reverse concolorous, 

but honey in the centre. Colonies on CMA 9–11(–13) mm diam in 

2 wk (15–18 mm in 3 wk), as on OA, but with some white diffuse 

and high aerial hyphae in the centre, and later more elevated in the 

centre; reverse in the centre hazel to fawn after 3 wk; conidiomata 

much more numerous and larger than on OA, developing in 

concentric or random patterns as discrete, large acervuloid (later 

almost discoid to cupulate) stromata with olivaceous sterile tissues, 

releasing large masses of pale white to pale buff conidial slime. 

Colonies on MEA 7–10 mm diam in 2 wk (14–17 mm in 3 wk), 

with an even, colourless, glabrous margin; colonies restricted, 

irregularly pustulate to hemispherical, the bumpy surface 

consisting of numerous protruding conidiomatal initials, appearing 

dark, with sepia, dark brick and cinnamon tinges, aerial mycelium 

mostly absent, locally dense, pure white and woolly; reverse mostly 

sepia to fawn or vinaceous buff. Sporulation only observed after 

about 7 wk. Colonies on CHA 7–13 mm diam in 2 wk (15–20 mm 

in 3 wk), with an even, glabrous, pale vinaceous buff margin; 

colonies restricted, irregularly pustulate to conical, the surface 

bumpy, immersed mycelium honey to hazel, covered by dense to 

diffuse, pure white, woolly aerial mycelium; conidiomata sparsely 

developing at the surface after 2 wk, the wall slightly darker than 

the surrounding hyphae, releasing pale white conidial slime (even 

after 3 wk); reverse cinnamon in the centre, vinaceous buff or pale 

ochreous at the margin. 

Conidiomata and conidiogenous cells as in planta. Conidia as 

in planta, 5–13(–17)-septate, 70–125(–175) × 3–4 µm (OA). 

Hosts: Various species of the genera Chrysanthemum, Tagetes, 

Achillea, Centaurea and Helianthus (Waddell & Weber 1963, 

Punithalingam 1967b, c). 

Material examined: Austria, Tirol, Ober Inntal, Samnaun Gruppe, Böderweg on 

Lazidalm, on living leaves of Chrysanthemum leucanthemum, 8 Aug. 2000, G. 

Verkley 1055, CBS H-21173, living cultures CBS 109090, 109091; Same substr., 

Tirol, Zanderstal near Spiss, 11 Aug. 2000, G. Verkley 1069, CBS H-21170, living 

cultures CBS 109083, 109086. Germany, Hamburg, on living leaves of Chr. 

maximum, Sep. 1958, R. Schneider s.n. CBS H-18111, living culture CBS 353.58 = 

BBA 8504 = IMI 91322. New Zealand, Coromandel distr., Coromandel peninsula, 

Waikawau, coast along St. Hwy 25, on living leaves of Chr. leucanthemum, 22 Jan. 

2003, G. Verkley 1826, CBS H-21247; same substr., North Island, Coromandel, 

Tairua Forest, along roadside of St. Hway 25, near crossing 25A, 23 Jan. 2003, G. 

Verkley 1842b, CBS H-21243, living culture CBS 113112. 

Notes: The six strains studied here showed minor differences in 

morphological characters and DNA sequences, which show highest 

similarity to sequences of CBS 128621, an isolate originating from 

Cirsium setidens in South Korea, and identified as S. cirsii (Fig. 2). 

Septoria leucanthemi is also closely related to a number of other 

Septoria species from Asteraceae, such as S. senecionis and S. 

putrida (Senecio spp.), S. obesa (Chrysanthemum spp., Artemisia) 

and S. astericola (Aster sp.). It is confirmed here that Septoria 

obesa, which has been regarded as a synonym of S. leucanthemi 

by Jørstad (1965), should be treated as a separate species (see 

also the note on S. obesa). 

Septoria lycoctoni Speg. ex Sacc., Michelia 2 : 167. 1880. 

Fig. 26. 

Description in planta: Symptoms leaf spots epigenous, numerous, 

circular to irregular, single or confluent, white to pale greyish, 

surrounded by an initially red, then dark brown to black and thickened 

border. Conidiomata pycnidial, epiphyllous, inconspicuous, up to a 

few in each leaf spot, globose to subglobose, brown, immersed, 

90–145(–220) µm diam; ostiolum central, circular, more or less 

papillate, 25–55 µm wide; conidiomatal wall 17–35 µm thick, 

composed of textura angularis, differentiated layers absent, the 

cells mostly 3.5–5(–11) µm diam, the outer cells with brown, 

somewhat thickened walls, the inner cells with thinner, hyaline 

walls. Conidiogenous cells hyaline, cylindrical, or elongated 

ampulliform with a relatively narrow neck which widens at the top, 

266


Fig. 25. Septoria leucanthemi. A–C. Colonies CBS 109090 (15 °C, nUV). A. On OA. B. On MEA. C. On CHA. D. Conidia and conidiogenous cells on OA (CBS 109090). E, F. 

Conidia in planta (CBS H-21243). G. Conidia on MEA (CBS 109090). Scale bars = 10 µm. 

hyaline, holoblastic, proliferating sympodially, 7–18 × 3.5–6 µm. 

Conidia filiform, straight, more often curved, sometimes flexuous, 

gradually attenuated to the pointed apex, more or less attenuated 

towards the broadly truncate base, (0–)2–5(–6)-septate, not or 

indistinctly constricted around the septa, hyaline, with several oildroplets 

and granular contents in each cell in the rehydrated state, 

26–47 × 1.5–2 µm (rehydrated; up to 2.5 µm wide in the living 

state). Sexual morph unknown. 


mm in 3 wk), with an even, glabrous, colourless margin; immersed 

mycelium mostly coral to scarlet, the pigment diffusing into the 

surrounding medium; in the centre black and slightly elevated with 

mostly superficial, glabrous pycnidia, surrounded by an area with 

more scattered pycnidia, releasing pale white to pale flesh droplets 

of conidial slime; aerial mycelium only present in the centre, but 

well-developed, dense, appressed, woolly, white or greyish, locally 

with a flesh haze; reverse scarlet to coral, the centre darker, blood 


267


Fig. 26. Septoria lycoctoni. A–C. Colonies CBS 109089 (15 °C, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia and conidiogenous cells in planta (CBS H-21155). E. 

Conidia on OA (CBS 109089). Scale bars = 10 µm. 

colour. Colonies on CMA 9–12 mm diam in 2 wk (17–19 mm in 3 

wk), as on OA, but pycnidia more numerous, usually only formed in 

the centre of the colony. Colonies on MEA (3–)5–9 mm diam in 2 wk 

(13–18 mm in 3 wk), with an irregular margin; colonies restricted, 

the surface cerebriform to irregularly pustulate, up to 3 mm high, 

the surface pale brown, later black, at first almost glabrous, or 

(especially in brighter-coloured faster growing sectors/colonies) 

already covered by dense mat of pure white to flesh, woolly aerial 

mycelium, that later covers most of the colony surface; large 

masses of honey or pale amber conidial slime locally emerging 

from immersed conidiomata; reverse of the colony either dark brick 

or luteous to ochreous, paler towards the margin. Colonies on CHA 

8–13 mm diam in 2 wk (15–19(–22) mm in 3 wk), with an even or 

undulating, colourless margin mostly hidden under aerial hyphae; 

immersed mycelium greenish grey, grey-olivaceous to olivaceousblack, 

throughout covered by well-developed, tufty whitish grey 

aerial mycelium that later shows a reddish haze; reverse blood 

colour, but margin paler; in the central part of the colony numerous 

pycnidia develop, releasing pale whitish to rosy-buff conidial slime; 

in older colonies the central surface becomes cerebriform and 

about 3 mm high, much like on MEA. 

Conidiomata as in planta, pycnidial with barely protruding 

ostioli, which later often grow out to elongated necks up 50–150 µm 

long; on CMA less differentiated and fairly large, opening by tearing 

of the upper wall; conidiogenous cells as in planta, but larger, 9–25 

× 3.5–7.5 µm, proliferating sympodially and also percurrently, but 

annellations on the necks are inconspicuous; conidia similar in 

shape as in planta but longer, 3–5(–6)-septate, 30–75 × 1.5–2.5 

µm. 

Hosts: Aconitum vulparia (= A. lycoctoni), A. anthora, A. 

conversiflorum and several other Aconitum spp. 

Material examined: Austria, Ober Inntal, Samnaun Gruppe, Lawenalm near 

Serfaus, alt. 2000 m., on living leaves of Aconitum vulparia (syn. A. lycoctonum), 8 

Aug. 2000, G. Verkley 1053, CBS H-21155, living culture CBS 109089. 

268


Notes: In the diagnosis of S. lycoctoni, the conidia were 

described as “indistinctly multiseptate”, measuring 25–35 × 1.5– 

2 (Saccardo 1884). This fungus was found on A. lycoctonum in 

Italy. Teterevnikova-Babayan (1987) gave conidial size ranges of 

25–70 × 1–2 µm for this species, and she included several of the 

varieties which were described after 1880, viz., var. sibirica 1896, 

var. macrospora 1909, var. anthorae 1928. Petrak (1957) observed 

conidia 20–60 (rarely 70 to 80) × 1.5–2 µm in his collection on 

Aconitum moldavicum. 

The colonies of Septoria lycoctoni and S. napelli look very 

similar on all media tested, although in S. napelli more red pigment 

seems to be produced than in S. lycoctoni, and the conidial slime 

is salmon rather than flesh. The two species can more readily be 

distinguished from each other by the shape of their conidia. In 

S. lycoctoni, the mature conidia only attenuate towards the apex 

above the uppermost septum, while in S. napelli, the tapering of 

the conidium walls is visible below the second septum from the 

top. The difference between the conidia of these species is also 

clear on the plant. Because the conidia of S. napelli are wider, the 

septa and the attenuations are easier to observe. In the case of 

S. lycoctoni the apical attenuation of conidia is not so clear, which 

may explain why Petrak (1957), who compared this species also to 

collections identified as S. napelli (but for reasons explained below 

probably misidentified), circumscribed the conidia of S. lycoctoni as 

not-attenuated. 

The strains of S. napelli (CBS 109104–109106) originating 

from Aconitum napellus and CBS 109089 of S. lycoctoni are very 

closely related and form a monophyletic group in the multilocus 

phylogeny (Fig. 2). 

Septoria lysimachiae (Lib.) Westend., Bull. Acad. r. Belg., 

Cl. Sci., Sér. 2, 19: 120. 1852. Fig. 27. 

Basionym: Ascochyta lysimachiae Lib., Pl. Crypt. Ard. Fasc. 3, 252. 

1834. 

Description in planta: Symptoms leaf lesions indefinite, usually only 

a few scattered over the leaf lamina, or a single one, most often 

developing from the tip to the petiole, greyish to reddish brown. 

Conidiomata pycnidial, epiphyllous, immersed, subglobose to 

globose, black, 95–120(–165) µm diam; ostiolum central, circular, 

initially 25–35 µm wide, later becoming more irregular and up to 

90 µm wide, surrounding cells concolourous; conidiomatal wall 

10–20 µm thick, composed of an outer layer of angular to irregular 

cells mostly 4.5–10 µm diam with pale to orange brown walls, 

and an inner layer of isodiametric, hyaline cells 3–6 μm diam. 

Conidiogenous cells hyaline, discrete, rarely integrated in 1-septate 

conidiophores, cylindrical, or narrowly to broadly ampulliform, 

holoblastic, proliferating sympodially, and often also percurrently 

showing 1–3 indistinct annellations on a neck-like protrusion, 8–15 

× 3–5(–6) µm. Conidia cylindrical to filiform-cylindrical, slightly to 

strongly curved, rarely somewhat flexuous, narrowly rounded to 

pointed at the apex, attenuated gradually or more abruptly towards 

a narrowly truncate base, (0–)3–5, later with secondary septa 

dividing the cells, conidia sometimes breaking up into smaller 

fragments in the cirrhus, not or slightly constricted around the septa, 

hyaline, containing several large oil-droplets and granular material 

in the living and rehydrated state, (28–)35–70(–88) × 2.5–3.5 (–4) 

µm (living; rehydrated, 2.0–3 µm wide). Sexual morph unknown. 

Description in vitro: Colonies on OA rather variable in growth speed 

and pigmentation, 3.5–7 mm diam in 1 wk (20–26 mm in 2 wk), 

with an even, glabrous, colourless margin; colonies spreading, 

flat,immersed mycelium first mostly buff, then either rosy-buff to 

pale salmon turning olivaceous or hazel, or long colourless and 

later becoming olivaceous-black to greenish black; aerial mycelium 

woolly-floccose, white or greyish, mostly developing only in the 

centre; reverse olivaceous-black to greenish grey or dark slate blue 

to black. Conidiomata developing scarcely immersed in the agar, 

producing small amounts of conidia that are released as rosy-buff 

droplet. Colonies on CMA 2–4 mm diam in 1 wk (15–20 mm in 3 

wk), as on OA, but centre of the colony somewhat elevated, and 

colourlous marginal zone narrow, immersed mycelium becoming 

more rapidly pigmented with a vinaceous buff tint, in the centre 

becoming brown-vinaceous; reverse hazel, in the centre almost 

black. Colonies on MEA 3.5–6 mm diam in 1 wk (8–17(–19) mm 

in 3 wk), with an even to slightly ruffled, buff to rosy-buff, glabrous 

margin; some strains with a more uneven outline, strongly fimbriate, 

with faster growing deeply immersed mycelium often extending 

well beyond the colony margin at the level of the agar surface; 

colonies spreading, but often distinctly elevated or irregularly 

pustulate in the centre; immersed mycelium variable in colour, buff, 

ochreous or brownish, and in the faster growing sectors often with 

a glaucous haze; aerial mycelium diffuse to dense, pure white, 

(vinaceous) greyish or brownish, finely felted to woolly; reverse 

versicoloured, margin and parts of faster growing sectors buff to 

honey, in other parts darker, hazel to brown-vinaceous, sometimes 

mostly olivaceous-black. Some strains show a conspicuous halo 

of diffusing reddish pigment (CBS 108996, 108997). Scarce dark 

conidiomata beginning to develop in the centre after 1 wk, releasing 

pale white droplets of conidial slime after about 3 wk. Colonies on 

CHA 2–4(–6) mm diam in 1 wk [18–24(–26) mm in 21 d], with an 

even or slightly ruffled, glabrous, colourless to buff margin; colonies 

irregularly pustulate, immersed mycelium olivaceous-black; aerial 

mycelium soon covering most of the colony, woolly-floccose, smoke 

grey with an olivaceous haze, locally grey-olivaceous, in slightly 

faster growing sectors sometimes pure white; reverse mostly 

brown-vinaceous. Superficial, blackish conidiomata in the centre 

releasing pale rosy-buff to white masses of conidial slime after 1 

wk; reverse mostly blood colour, or fawn and brown-vinaceous in 

the centre. 

Conidia (OA) cylindrical, slightly to strongly curved to flexuous, 

narrowly rounded to somewhat pointed at the apex, attenuated 

gradually or more abruptly towards a truncate base, mostly 

3–7(–11)-septate, including the soon formed secondary septa, cells 

soon loosing their turgesence and often separating into smaller 

fragments, in the turgescent state constricted around the septa, 

hyaline, with many vacuuoles and also containing several large oildroplets 

and granular material in the living state and rehydrated 

state, (30–)40–80–(90) × 2.5–3.5 (–4) µm (living; rehydrated NT 

2.0–3 µm wide). 

Hosts: Lysimachia spp. 

Material examined: Belgium, near Namur, on leaves of Lysimachia vulgaris, 

Bellynck, isotype BR-MYCO 145978-90, also distributed in M. A. Libert, Pl. Crypt. 

Ard. Fasc. 3, no. 253. Czech Republic, Mikulov, on living leaves of Lysimachia 

sp., 15 Sep. 2008, G. Verkley 6004, CBS H-21255, living cultures CBS 123794, 

123795. Netherlands, Prov. Utrecht, Baarn, De Hooge Vuursche, in the forest, on 

L. vulgaris, 22 June 2000, G. Verkley 955, epitype designated here CBS H-21227 

“MBT175357”, living cultures ex-epitype CBS 108998, 108999; Prov. Utrecht, Soest, 

Stadhouderslaan near monument “De Naald”, on living leaves of L.vulgaris, 4 Aug. 

1999, G. Verkley 903, CBS H-21196, living culture CBS 102315; Prov. Gelderland, 

Amerongen, Park Kasteel Amerongen, on living leaves of L. vulgaris, 11 July 2000, 

G. Verkley 971, CBS H-21230, living culture CBS 108996, 108997. 


269


Fig. 27. Septoria lysimachiae. A–C. Colonies (15 °C, nUV). A. CBS 123794 on OA. B. CBS 108998 on MEA. C. Ibid., colony margin on MEA. D. Conidia in planta (CBS 

H-21196). E. Conidia on OA (CBS 108998). F. Conidia in planta (CBS H-21196). G. Conidia on OA (CBS 108998). H. Conidia on OA (CBS 108999). Scale bars = 10 µm. 

Notes: Shin & Sameva (2003) provided a detailed description of 

S. lysimachiae (conidia 35–80 × 1.5–2.5 µm, 3–7-septate). In the 

type material from BR the conidia are mostly 3–5-septate, 25–72 

× 2.5–3.5 µm, and very similar in shape to those observed in the 

material that was collected from the field for the present study. The 

isolates show more variation in colony characters than observed in 

most other species of Septoria, but this phenotypic heterogeneity is 

neither reflected in the sporulating structures nor in the sequence 

data obtained. The EF, Btub and RPB2 gene sequences proved 

100 % identical among strains originating from the Netherlands 

270


Fig. 28. Septoria matricariae. A. Conidia 

and conidiogenous cells in planta (CBS 

H-21228). B. Conidia on OA (CBS 

109001). Scale bars = 10 µm. 

(CBS 102315, 108998 and 108999) and Czech Republic (CBS 

123794, 123795), while differences found between the Dutch and 

Czech isolates for Cal and Act were only 3 (99.3 % similarity) and 1 

bp (99.6 %), respectively. It is concluded therefore that the material 

studied belongs to a single species. Septoria saccardoi, based 

on material from Lysimachia vulgaris in Italy, is characterised by 

cylindrical, curved, 3-septate conidia, 38–40 × 3.5 µm (Saccardo 

1906). Quaedvlieg et al. (2013) describe this species in detail 

based on an isolate originating from of Lysimachia vulgaris var. 

davuricai in Korea (CBS 128665 = KACC 43962) and because it is 

distant to other septoria-like fungi, they propose a new genus name 

to accommodate it, Xenoseptoria. CBS 128758, isolated from L. 

clethoroides in Korea was identified as S. lysimachiae, but based 

on sequence analyses it is a distant fungus belonging in the genus 

Sphaerulina. 

Septoria matricariae Hollós, Annls Mus. nat. Hung. 8: 5. 

1910 [non Syd. 1921; nec Cejp, Fassatiova & Zavrel, Zpravy 

153: 13. 1971; later homonyms]. Fig. 28. 

= S. chamomillae Andrian., Mikol. i Fitopat. 30: 10. 1996. Nom. nov. pro S. 

matricariae Syd., Annls mycol. 19: 143. 1921; nom. illeg. Art. 53 [non Marchal 

& Sternon, 1923]. 

?= S. chamomillae Marchal & Sternon, Bull. Soc. r. Bot. Belg. 55: 50. 1922. 

Description in planta: Symptoms lesions indefinite, leaves 

becoming affected from the top towards base, discolouring 

to yellow and brown. Conidiomata pycnidial, amphigenous, 

numerous, more or less evenly dispersed over the affected area, 

globose to subglobose, dark brown to black, immersed, 75–125(– 

150) µm diam; ostiolum central, circular, often papillate, breaking 

through the leaf epidermis, 25–43(–50) µm wide, surrounding cells 

concolorous or somewhat darker; conidiomatal wall 10–20 µm 

thick, composed of textura angularis without distinctly differentiated 

layers, the cells 2–6 µm diam, the outer cells with yellowish 

brown, thickened walls, the inner cells with hyaline, also relatively 

thick walls; Conidiogenous cells hyaline, discrete or integrated in 

1–2-septate conidiophores up to 17.5 µm long, doliiform, narrowly 

to broadly ampulliform, holoblastic, proliferating sympodially and/ 

or also percurrently with one or two indistinct annellations, 3.5–10 

× 3–4.5(–5.5) µm. Conidia filiform, straight, curved or slightly 

flexuous, attenuated gradually towards a relatively narrowly 

rounded to pointed apex, barely attenuated towards the broadly 

truncate base, indistinctly (1–)2–3(–6)-septate, not or indistinctly 

constricted around septa, hyaline, contents with a few minute oildroplets 



state, 41–58 × 2–3 µm (living; rehydrated, 1.5–2.4 µm wide). 




spreading, the surface plane, immersed mycelium olivaceous-black 


271


to very dark dull green, with numerous dark, radiating hyphae, 

almost entirely glabrous, few tufts of greyish aerial mycelium 

in the centre; numerous scattered single or complex pycnidial 

conidiomata developed already after 1 wk, with a single ostiole or 

several papillate or rostrate openings, from which pale rosy-buff 

droplets of conidial slime are released; reverse concolourous. 

Colonies on CMA 16–18(–20) mm diam in 3 wk (38–50 mm in 6 

wk), as on OA. Colonies on MEA 9–12(–14) mm diam in 3 wk (27– 

39 mm in 6 wk), with an even to slightly ruffled buff margin; colonies 

restricted, conical and up to 3 mm high after 3 wk, immersed 

mycelium near the margin grey-olivaceous, but most of the colony 

surface iron grey to greenish black, the outer areas mostly covered 

by a low but dense, finely felted, grey aerial mycelium, the centre 

almost glabrous; superficial semi-immersed conidiomata releasing 

pale whitish droplets of conidial slime after 2–3 wk; reverse mostly 

dark slate blue with olivaceous areas. Colonies on CHA 16–22 mm 

diam in 3 wk (39–46 mm in 6 wk), as on MEA, but conidiomata 

more numerous, releasing pale whitish to pale rosy-buff droplets or 

cirrhi of conidial slime, and reverse with a brown-vinaceous tinge. 

Conidiomata as in planta, pycnidial with a single ostiolum, 

dark brown to black, rarely merged into complex fruitbodies; 

conidiogenous cells as in planta, but larger and more often 

integrated in 1–3-septate conidiophores, 10–15(–23) × 3–6(–7) 

µm; conidia as in planta, but longer, 36–78(–90) × (1.6–)1.7–2.2 

µm, contents several oil-droplets in each cell. 

Hosts: Matricaria spp. 

Material examined: Netherlands, prov. Limburg, Zuid-Limburg, along roadside near 

Savelsbos, on living leaves of Matricaria discoidea (= M. matricarioides), 28 June 

2000, G. Verkley 960, CBS H-21228, living cultures CBS 109000, 109001. Romania, 

Suceava, Siret, on leaves of M. discoidea, 7 July 1969, distributed in Contantinescu 

& Negrean, Herb. mycol. Romanicum Fasc. 40, no. 199, CBS H-18115. 

Notes: The phylogenetic analyses indicate that S. matricariae is 

closest to S. lamiicola, yet rather distant from other Septoria occurring 

on Asteraceae. The indefinite lesions caused by this species 

are reminiscent of those developed by S. stellariae on Stellaria 

media. The leaves seem to whither more rapidly and pycnidia 

develop soon after discolouration of the leaf tissues starts. Stems 

are not affected. In the original diagnosis of S. matricariae, based 

on material from Matricaria discoidea in Hungary, the conidia are 

described as continuous and 40–60 × 2–2.5 µm. The Dutch and also 

the Romanian material studied here contain conidia with mostly 1–3 

septa, but otherwise agree well with Hollós’ description of the type. 

According to Radulescu et al. (1973) the conidia in material from the 

same host plant are also continuous, measuring 25–50 × 1.5–2 µm. 

As in several other Septoria spp., the septa in S. matricariae are not 

easy to observe, and Hollós and others may have overlooked them. 

Sydow described a Septoria under the same name from 

Matricaria chamomilla in Germany with multiseptate conidia 30–60 

× 1–1.5 µm. The name he proposed was illegitimate because it is 

a later homonym of S. matricariae Hollós, as is also S. matricariae 

Cejp et al.. Septoria chamomillae was also described from M. 

chamomillae in Belgium and has 3–5-septate conidia 35–52 × 1–2 

µm. Although we have not seen the types of either of these names, 

we consider them tentatively as synonyms of S. matricariae. 

Septoria melissae Desm., Annls Sci. Nat., sér. 3, Bot., 20: 

87. 1853. Fig. 29. 

≡ Phloeospora melissae (Desm.) Parisi, Bull. Bot. R. Univ. Napoli 6: 292. 

1921. 


an even to slightly ruffled, mostly colourless margin; colonies 

restricted to spreading, somewhat elevated in the centre, immersed 

mycelium greenish black, with greenish hyphal strands radiating into 

or even beyond the colourless margin, the surface mostly glabrous 

or provided with very diffuse, finely felted, grey aerial hyphae, 

the elevations in the centre bearing tufts of more well-developed, 

grey aerial mycelium; conidiomata developing mostly in the centre 

immersed or on the agar surface, releasing pale rosy to rosy-buff 

conidial slime. No diffusing pigment observed. Colonies on MEA 

5–7(–9) mm diam in 2 wk, with a slightly ruffled margin; colonies 

restricted, pustulate with cerebriform elevations in the centre, the 

surface black, covered by a diffuse to dense mat of finely felted, 

mostly grey aerial mycelium; reverse very dark brown-vinaceous. 

Conidiomata sparsely developing on the colony surface, releasing 

dirty reddish brown conidial slime. A very faint pigment is visible 

around the colony. 

Conidiogenous cells (OA) globose to ampulliform, holoblastic, 

hyaline, discrete or integrated in 1(–2)-septate conidiophores, 

proliferating sympodially, percurrent proliferation not observed, 

4–10 × 3–5 µm. Conidia filiform, straight to flexuous, weakly to 

more strongly curved, attenuated gradually to a narrowly rounded, 

typically pointed apex, attenuated gradually to a narrowly truncate 

to somewhat rounded base, hyaline, with fine granular material and 

minute oil-droplets, (0–)3(–5)-septate, (22–)30–50(–61) × 1.5–2 

µm. Sexual morph unknown. 

Host: Melissa officinalis. 

Material examined: Netherlands, Baarn, garden Eemnesserweg, on living leaves 

of Melissa officinalis, 11 Sep. 2000, H.A. van der Aa s.n. (G. Verkley 1073), CBS 

H-21169, living cultures CBS 109096, 109097. 

Notes: This species is the only Septoria described from the genus 

Melissa. The type material originates from Melissa officinalis in 

France (not seen). According to the short original diagnosis, S. 

melissae produces conidia 30 × 1.6 µm, and no septa were reported. 

Radulescu et al. (1973) described the conidia as continuous or with 

1–3 septa, 25–38 × 1.6 µm. These measurements agree quite 

well with those given by Teterevnikova-Babayan (1987; 28–38 

× 1.5 µm), but Vanev et al. (1997) gave a much wider range of 

measurements, 20.5–58 × 1.5–2.2 µm (septa 2–5). Genetically 

CBS 109097 is very closely related to S. galeopsidis, but a 5 bp 

insertion found in the Btub gene is absent in all sequenced strains of 

S. galeopsidis. Septoria melissae can furthermore be distinguished 

in culture from S. galeopsidis by the narrower conidia on OA (1.5–2 

µm, in S. galeopsidis 2–2.5 µm), and the conidiogenous cells, 

which only proliferate sympodially and not percurrently. 

Septoria napelli Speg, Decades mycologicae italicae I-XII: 

no. 117. 1879; Atti Soc. crittog. ital., Ser. 2, 3: 69. 1880. Fig. 

30. 

≡ Rhabdospora napelli (Speg.) Petr., Sydowia 11: 376. 1957 

[misapplication]. 

Description in planta: Symptoms leaf spots hologenous, circular to 

irregular, single, white to pale greyish, surrounded by a first red, 

then black, relatively wide border, often completely blackening the 

narrow leaflets. Conidiomata pycnidial, epiphyllous, rarely also 

hypohyllous, conspicuous, one to many in each leaf spot, globose 

to subglobose, black, semi-immersed, 100–150(–200) µm diam; 

ostiolum central, circular, initially 15–25 µm wide, later opening 

272


Fig. 29. Septoria melissae, CBS 109097. A–C. Colonies (15 °C, nUV). A. On OA. B. On MEA. C. On MEA, detail of colony margin. D. Conidia and conidiogenous cells on OA. 

E–F. Conidia on OA. Scale bars = 10 µm. 

more widely; conidiomatal wall 15–28 µm thick, composed of 

textura angularis, differentiated layers absent, the cells mostly 

4–10 µm diam, the outer cells with brown, somewhat thickened 

walls, the inner cells with hyaline and thinner walls. Conidiogenous 

cells hyaline, cylindrical, broadly to narrowly ampulliform, with a 

distinct neck of variable length, hyaline, holoblastic, with several 

distinct percurrent proliferations, more rarely also sympodial after 

a sequence of percurrent proliferations of the same cell, 10–22 × 

3.5–8 µm. Conidia filiform, straight, more often irregularly curved, 

gradually attenuated to the pointed apex, weakly or more distinctly 

attenuated towards the broadly truncate base, (3–)4–5(–7)-septate, 

not constricted around the septa, hyaline, with several relatively 

large oil-droplets and also minute granular contents in each cell in 

the rehydrated state, 59–80 × (1.5–)2–3.5 µm (rehydrated; up to 4 

µm wide in the living state). Sexual morph unknown. 


mm in 49 d), with an even, glabrous, colourless margin; immersed 

mycelium coral to scarlet, with pigment diffusing beyond the 

colony margin; colony becoming black in the centre and somewhat 

elevated due to superficial pycnidia, surrounded by an area with 

more scattered pycnidia, releasing flesh to salmon droplets of 

conidial slime; aerial mycelium well-developed and dense in the 

centre, appressed, woolly, white to pale grey; reverse scarlet to 

coral, in the centre blood colour. Colonies on CMA 8–12 mm diam 

in 2 wk (62–65 mm in 49 d), as on OA. Colonies on MEA 5–9 mm 

diam in 2 wk (38–44 mm in 49 d), the margin irregular; colonies 

restricted, with a cerebriform surface, becoming about 5 mm high, 

the surface soon black, first almost glabrous, later mostly covered 

by a dense mat of white to flesh, woolly aerial mycelium; honey 

or amber conidial slime masses are released from immersed 

pycnidia; reverse of the colony dark brick or luteous, paler towards 

the margin. Colonies on CHA 8–13 mm diam in 2 wk (55–58 mm 

in 49 d), with an even or undulating, colourless margin, partly 

hidden under aerial hyphae; immersed mycelium grey-olivaceous 

or olivaceous-black, covered with well-developed, grey and partly 

greenish glaucous, later reddish, aerial mycelium; reverse blood 

colour, the margin paler; in the central part of the colony numerous 

pycnidia develop, releasing rosy-buff conidial slime. 

Conidiomata as in vitro pycnidial, ostioli initially barely protruding, 

but later often growing out to form elongated necks up to 100 µm 

long; on CMA conidiomata less differentiated, sometimes without 

ostiolum and opening by tearing of the upper wall; conidiogenous 

cells as in planta, but larger, 10–32 × 3.5–8.5(–10) µm, proliferating 

sympodially and also percurrently, with distinct annellations on the 

elonated necks. Conidia similar in shape as in planta but longer, 

5–7(–11)-septate, 64–95(–118) × 2–3.5(–4) µm. 

Hosts: Aconitum spp. 


273


Fig. 30. Septoria napelli. A–C. Colonies CBS 109104 (15 °C, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia and conidiogenous cells on OA (CBS 109104). E. Conidia 

in planta (CBS H-21153). Scale bars = 10 µm. 

Material examined: Austria, Ober Inntal, Samnaun Gruppe, Zanderstal near Spiss, 

alt. 1800 m., on living leaves of Aconitum napellus, 11 Aug. 2000, G. Verkley 1070, 

CBS H-21153, living cultures CBS 109104, 109105; same loc., host, date, G. Verkley 

1071, CBS H-21154, living culture CBS 109106. Romania, reg. Mureş-Autonomă 

Maghiară, on living leaves of A. degenii, 25 Aug. 1953, C. Sandu-Ville s.n., CBS 

H-18117, distributed in Herb. Mycol. Romanicum, fasc. 35, no. 1742. 

Notes: According to the brief original diagnosis, S. napelli is 

characterised by 120–130 µm wide hypophyllous pycnidia, 

and indistinctly septate conidia measuring 50–100 × 2–4 µm. 

Teterevnikova-Babayan (1987) reported up to 9-septate conidia 

measuring 40–100 × 3–4 µm, and Shin & Sameva (2004) 

3–9-septate conidia, 40–105 × (2.5–)3–5 µm in Korean material. 

It is doubtful whether the description by Petrak (1957) of S. napelli 

was based on correctly identified material. Pycnidia of that fungus 

were mostly hypophyllous, with 3–7, rarely 8–9-septate conidia 

measuring 40–70 (rarely up to ca. 100) × 3–4 µm, arising from 

septate and branched conidiophores. The pycnidial wall was 

composed of globose to angular cells 5–8(–10) µm diam, with 

walls thickened to an extent which would avoid any compression. 

Petrak (1957) also observed young fruitbodies of a sexual morph 

on dead leaves in between old and empty conidiomata. Although 

this sexual morph was immature, in his opinion it was “undoubtedly 

Pleosporaceae, perhaps a species of Leptosphaeria, but certainly 

not Mycosphaerella”. Certain similarities in the walls of the asexual 

and sexual morph, made him suspect that they were produced in 

different stages in the life-cycle of a single fungus. Because of the 

large size of the pycnidia of Petrak’s S. napelli, the structure of 

the pycnidial wall and conidial ontogeny, which were unlike typical 

Septoria, he proposed the combination Rhabdospora napelli. 

Petrak’s observations of S. napelli probably pertained to a different 

septoria-like fungus (Stagonospora?), probably with pleosporalean 

affinities, but of which the exact identity remains unclear. 

274


The fungus studied in the present study, which is a member of 

the Septoria clade, generally agrees with the original description 

of S. napelli. It is unknown whether S. napelli has a sexual morph. 

Two Mycosphaerella names have been published from Aconitum, 

M. antonovii on Aconitum excelsum in Siberia, and M. aconitorum, 

on Aconitum sp. in Austria. Both names were introduced by 

Petrak, who did not observe associated asexual morphs for these 

Mycosphaerella spp. A comparison with S. lycoctoni, including the 

molecular results, is provide above in the notes on S. lycoctoni. 

CBS 128664 isolated from Aconitum pseudolaeve var. erectum 

in Korea, is genetically distinct from both Septoria spp. on Aconitum 

in Europe. The new name S. pseudonapelli is proposed for this 

fungus by Quaedvlieg et al. (2013, this volume). 

Septoria obesa Syd., in Syd. & P. Syd., Annls mycol. 12: 

163. 1914. 

= S. artemisiae Unamuno, Assoc. españ. Progr. Cienc. Congr. Salamanca: 46. 

1923 [nom. illeg., later homonym, non Passerini, 1879]. 

Descriptions in planta are provided by Punithalingam (1967c) and 

Priest (2006). Sexual morph unknown. 

Hosts: Artemisia lavandulaefolia and Chrysanthemum spp. 

Material examined: Germany, Weihenstephan, on Chrysanthemum indicum, R. 

Schneider Sep. 1957, living culture CBS 354.58 = BBA 8554 = IMI 091324. South 

Korea, Hongcheon, on Artemisia lavandulaefolia, H.D. Shin, 28 June 2006, living 

culture SMKC 21934 = KACC 42453 = CBS 128588; Bonghwa, on Chr. indicum, 

H.D. Shin, 18 Oct. 2007, living culture SMKC 23048 = KACC 43193 = CBS 128623; 

Jeju, on Chr. morifolium, 5 July 2008, living culture KACC 43858 = CBS 128759. 

Notes: Jørstad (1965) regarded S. obesa as a synonym of S. 

leucanthemi, as both have similar conidial morphologies and 

occur on several Chrysanthemum spp. Punithalingam (1967b, c), 

however, recognised S. obesa and S. leucanthemi as separate 

species, noting that the conidia of S. obesa are consistently wider 

than those of S. leucanthemi. Verkley & Starink-Willemse (2004) 

found additional, molecular support for the treatment.as separate 

species in eight polymorphisms found on the ITS sequences 

of strains representing these species. Further evidence is now 

provided here based on sequences of six other loci. The host 

ranges of the two species are also different: S. leucanthemi 

is capable of infecting various species of a wide range plant 

genera, viz. Chrysanthemum, Tagetes, Achillea, Centaurea and 

Helianthus (Waddell & Weber 1963, Punithalingam 1967b). 

Septoria obesa seems to mainly infect Chrysanthemum spp., 

but it does also infect Artemisia lavendulaefolia, as could be 

demonstrated in this study with CBS 128588, a strain originally 

identified as S. artemisiae. The strain is genetically very close to 

the other strains of S. obesa studied here and therefore regarded 

as conspecific. The conidia produced by CBS 128588 are in good 

agreement with S. obesa as well, being much larger than in S. 

artemisiae (30–33 × 1.5 µm, according to the original diagnosis 

of S. artemisiae Passerini). The later homonym S. artemisiae 

described by Unamuno based on material on Artemisia vulgaris 

in Spain with 4-septate conidia 35.5–52.5 × 2.5–3 µm, is placed 

here in the synonymy of S. obesa. 

The conidia of the sunflower pathogen S. helianthi (50–85 × 

2–3 μm) are similar to those of S. obesa (50–90 × 2.5–3.5 μm, cf. 

Priest 2006), but they can be distinguished by the number of septa 

formed, viz., seldom more than 5 in S. helianthi and 5–11 septa in 

S. obesa. Verkley & Starink already showed that ITS sequences of 

these species differ by more than 20 base positions, which is also 

supported by the results found in the present study for other genes 

(Fig. 2). 

Septoria paridis Pass., Atti Soc. crittog. ital. 2: 41. 1879. Fig. 

31. 

Description in planta: Symptoms leaf spots single, scarce, circular to 

irregular, white to pale ochreous, surrounded by a vague orange to 

reddish brown zone, visible on both sides of the leaf, decaying to shotholes. 

Conidiomata pycnidial, epiphyllous, one to a few in each leaf 

spot, globose, black, immersed, 60–100 µm diam; ostiolum central, 

circular and 35–40 µm wide, surrounding cells concolorous to slightly 

darker; conidiomatal wall up to 15 µm thick, composed throughout of 

hyaline, angular cells, 2.5–5 µm diam, the outermost cells brown with 

somewhat thickened walls, the inner cells hyaline and thin-walled. 

Conidiogenous cells hyaline, discrete, globose, doliiform, or broadly 

ampulliform, holoblastic, proliferating percurrently several times with 

distinct annellations thus forming a relatively narrow neck, rarely 

also sympodially, 5–8(–11) × 2.5–5 µm. Conidia filiform, straight, or 

slightly curved, attenuated gradually to a narrowly pointed apex and 

a narrowly truncate base, 0–3-septate (septa very thin and easily 

overlooked), not constricted around the septa, contents with several 

minute oil-droplets and granular material in each cell in the living 

state, with minute oil-droplets and granular contents in the rehydrated 

state, (18–)20–28.5(–34) × 1–1.5(–2) µm (living; rehydrated, 1 µm 

wide). Sexual morph unknown. 


mm in 3 wk; more than 75 mm in 7 wk), with an even, glabrous, 

colourless margin; immersed mycelium mostly homogeneously 

pale coral to pale red, some pigment diffusing beyond the colony 

margin, olivaceous to greenish hyphal radial strands also weakly 

or more strongly developing in some sectors or entire colonies 

(especially after 7 wk, when most of the red pigment is no longer 

visible); in the centre olivaceous-black and slightly elevated due 

to superficial and immersed pycnidia, surrounded by an area with 

more scattered pycnidia, releasing pale whitish droplets of conidial 

slime; aerial mycelium very scanty, few minute white tufts; reverse 

olivaceous-black to greenish grey, surrounded by coral to sienna 

areas. Colonies on CMA 7–10 mm diam in 10 d (28–33 mm in 3 

wk; more than 75 mm in 7 wk), as on OA, but the colonies sooner 

pigmented, dark green, dark blueish green or olivaceous, and a 

red pigment tardily formed, but more persistent and still well visible 

after 7 wk. Sporulation as on OA. Colonies on MEA 6–11 mm 

diam in 10 d (23–30 mm in 3 wk; 64–75 mm in 7 wk), the margin 

even, glabrous, buff; colonies spreading, but the centre elevated, 

irregularly pustulate, up to 2 mm high, the surface dark greyish 

brown, later black, covered by short felty white aerial mycelium, 

or higher tufts; reverse of the colony brown-vinaceous or sepia, 

paler towards the margin. Pycnidia mostly superficial, in dense 

groups. Colonies on CHA 5–8 mm diam in 10 d (28–35 mm in 3 wk; 

45–55 mm in 7 wk), with an even to ruffled, glabrous, colourless to 

buff margin; immersed mycelium in areas where first sporulation 

occurs becoming dark, greenish grey to dark slate blue, later 

more throughout colony, covered by well-developed, tufty whitish 

grey aerial mycelium that later shows a reddish haze; reverse 

olivaceous-black to sepia, but margin paler; in the central part of 

the colony numerous pycnidia develop; in older colonies the centre 

becomes up to 3 mm high. 

Conidiomata (OA) as in planta, immersed or developing on 

the agar surface, single or merged into complexes 100–220 µm 


275


Fig. 31. Septoria paridis. A–C. Colonies (15 °C, nUV). A. On OA (CBS 109110). B. On CHA (CBS 109110). C. On MEA (CBS 109108). D. Conidia and conidiogenous cells in 

planta (CBS H-21177, Paris quadrifolia). E. Ibid. (CBS H-21152, Viola palustris). F. Conidia on OA (CBS 109108). Scale bars = 10 µm. 

diam, superficial pycnidia mostly forming one to several elongated 

necks, initially pale brown, then almost black, releasing pale whitish 

conidial slime, later becoming rosy-buff. Conidiogenous cells as 

in planta, 7–12(–14) × 2.5–5 µm. Conidia as in planta but some 

considerably longer, 22–38(–45) × 1–1.5 µm. 

276


Hosts: Paris quadrifolia, P. incompleta and Viola palustris. 

Material examined: Austria, Tirol, Leutaschtal Weidach, on river bank, on living 

leaves of Paris quadrifolia, 2 Aug. 2000, G. Verkley 1038, CBS H-21177, living 

cultures CBS 109110, 109111; Tirol, Ötztal, Sölden, near Hoch-Sölden, on living 

leaves of Viola palustris, 31 July 2000, G. Verkley 1037, CBS H-21152, living 

cultures CBS 109108, 109109. 

Notes: According to the original description, conidia of S. paridis 

are 20 × 1 µm and aseptate. Vanev et al. (1997) describe the 

conidia as 18–25 × 1–1.3 µm, Teterevnikova-Babayan (1983), 

20–25 × 1 µm. As is seen in several other Septoria, the conidia 

can reach considerably greater length in culture than on the natural 

host plant. In shape of the conidia the species strongly resembles 

S. galeopsidis and S. scabiosicola, as do the cultures, although S. 

galeopsidis does not produce a red pigment on OA. The material on 

Viola palustris (Violaceae) collected in Tirol was initially identified 

as S. violae-palustris, but based on the DNA sequence analyses 

of seven loci (Fig. 2) and the agreeing phenotype it is concluded 

that the material is conspecific with S. paridis. This is the first report 

of this fungus on another host genus than Paris, and also outside 

the Liliaceae. A second Septoria occurring on Paris quadrifolia is 

S. umbrosa. That species differs from S. paridis by much larger 

conidia, 30–85 × 3–4.5 µm, which are 5–7-septate. 

Septoria passifloricola Punith., CMI Descr. Pathogenic 

Fungi & Bacteria no. 670. 1980. 

≡ S. passiflorae Louw, Sci. Bull. Dept. Agric. For. Un. S. Africa 229: 34. 

1941. Nom. illeg. Art 53 [non Syd., Annls mycol. 37: 408. 1939]. 


an even, glabrous, buff margin; colonies spreading, immersed 

mycelium mostly homogeneous orange, but no diffusion of 

pigments beyond the margin observed; the surface covered by 

appressed, greyish white to grey aerial mycelium developing in 

concentric areas, beneath which mostly superficial, dark brown 

to almost black pycnidia or more complex conidiomata develop, 

releasing pale whitish to dirty greyish droplets of conidial slime; 

reverse orange to sienna. Colonies on CMA 10–14 mm diam in 2 

wk, as on OA. Colonies on MEA 5–7(–10) mm diam in 2 wk, with an 

even, weakly lobed, black margin, which may be covered by short 

fluffy, pure white aerial mycelium; colonies spreading but elevated 

at the centre, the surface almost black, with immersed conidiomatal 

complexes soon covered by masses of first pale white, buff, and 

then brick conidial slime; the central area later entirely covered 

by cerebriform, brick masses of slime; reverse brick to almost 

vinaceous, and fawn. Colonies on CHA 8–10(–14) mm diam in 

2 wk, with an even, buff margin covered by a diffuse, felty aerial 

mycelium; further as on MEA, but surface less elevated, and largely 

covered by diffuse, felty, grey-white aerial mycelium; conidial 

slime as on MEA abundantly produced from similar conidiomatal 

complexes, but more intensely pigmented, deep scarlet; reverse 

blood colour. 

Conidiogenous cells (OA) hyaline, discrete, broadly 

ampulliform to cylindrical, holoblastic, with one or two indistinct 

percurrent proliferations (sympodial proliferation not observed), 

8–14 × 3–6 µm; conidia filiform, hyaline, narrowly rounded at the 

top, attenuated to a truncate base, straight to somewhat curved, 

1–2(–3)-septate, not constricted around the septa, mostly 10–30(– 

35) × 1.5–2(–2.5) µm. 

Host: Passiflora edulis. 

Material examined: Australia, Victoria, Wonthaggi, on Passiflora edulis, Mar. 2011, 

C. Murdoch, living culture CBS 129431. New Zealand, Auckland, Mt Albert, on 

living leaves of P. edulis, 21 Feb. 2000, C. F. Hill MAF LYN-118a, living culture CBS 

102701. 

Notes: Priest (2006) provided a description of the fungus on the 

host, and discussed the nomenclature. He also mentioned the 

anonymous reporting of a Septoria state observed in ascospore 

isolates from a Mycosphaerella sp. found on fruits lesions, but 

whether this truly is the sexual morph of S. passifloricola remains 

to be corroborated. The multilocus phylogeny (Fig. 2) provides 

evidence of a close relationship with S. ekmanniana (CBS 113385, 

113612) and S. chromolaenae (CBS 113373), and also S. sisyrinchii 

(CBS 112096) and S. anthurii (CBS 148.41, 346.58). 

Septoria petroselini (Lib.) Desm., Mem. Soc. Roy. Sci. Lille 

1843: 97. 1843. Fig. 32. 

Basionym: Ascochyta petroselini Lib., Pl. Crypt. Arduenna 3: 252. 

1834. 

≡ Phleospora petroselini (Lib.) Westend., Bull. Acad. r. Bruxelles 12 (9): 

252. 1845. 

Description in planta: Symptoms leaf spots indefinite, without a 

distinct border, pale brown, visible on both sides in green parts 

of leaves or barely discoloured petioles. Conidiomata pycnidial, 

numerous, mostly epiphyllous, semi-immersed, black, mostly 

80–200 mm diam, with a central, first narrow, later wider opening, 

releasing pale white cirrhi of conidia; conidiomatal wall composed 

of one or two layers of brown-walled, angular cells, lined by a 

layer of hyaline cells. Conidiogenous cells hyaline, discrete, 

holoblastic, sympodially or percurrently proliferating, ampulliform, 

6–10 × 3–6 mm. Conidia hyaline, filiform, straight to somewhat 

flexuous, the upper cell tapered into the obtuse apex, relatively 

widely truncate at the base, (1–)3–5(–7) septate, not or only 

indistinctly constricted at the septa, contents granular or with 

minute oil-droplets around the septa and at the ends, 29–80 × 

1.9–2.5 mm (living; rehydrated, 1.2–1.5 mm wide). Sexual morph 

unknown. 

Description in vitro (18 °C, near UV) CBS 109521: Colonies on 

OA 13–16 mm diam in 2 wk, with an even, colourless margin; 

colonies spreading, immersed mycelium mostly pale ochreous, 

soon appearing dull green due to the development of dark green 

hyphal strands, particularly in a discontinuous submarginal 

zone; reverse in the centre ochreous to fulvous, surrounded by 

olivaceous-grey. Conidiomata developing after 5–7 d immersed 

in the agar or on its surface, most numerous in the centre of the 

colony, releasing milky white to rosy-buff conidial slime. Conidia 

also produced directly from mycelium near the centre of the 

colony. Colonies on MEA 17–20 mm diam in 2 wk, with an even 

to somewhat ruffled, buff margin; colonies spreading to restricted, 

somewhat elevated towards the centre, the surface black with 

many stromata developing and releasing milky white droplets of 

conidial slime, aerial mycelium diffuse to more dense and low, 

grey; reverse mostly greenish grey to iron-grey, in the centre with 

fawn to dark brick haze. 

Conidiomata and conidiogenous cells as in planta. Conidia 

(OA) filiform to filiform-cylindrical, straight, flexuous or curved, 

attenuated gradually to the narrowly rounded to pointed apex, 

attenuated gradually or more abruptly to the narrowly truncate 

base, (0–)3–5(–7)-septate, 30–54(–65) × 2–2.5(–3) µm. 


277


Fig. 32. Septoria petroselini. A, B. Colonies CBS 109521 (15 °C, nUV). A. On OA. B. On MEA. C, D. Conidia on OA (CBS 109521). E. Conidia and conidiogenous cells in planta 

(CBS H-21166). F. Conidia on OA (CBS 182.44). G. Conidia on OA (CBS 109521). Scale bars = 10 µm. 

Hosts: Petroselinum crispum (syn. Apium petroselinum), other 

Petroselinum spp. and Coriandrum sativum (Priest 2006). 

Material examined: Netherlands, Prov. Utrecht, Baarn, garden Eemnesserweg 90, 

on living leaves of Petroselinum crispum, 29 Mar. 2001, H.A. van der Aa 12642, 

CBS H-21166, living culture CBS 109521; Laren, on living leaves of P. sativum, June 

1944, S. Dudok de Wit s.n., living culture CBS 182.44 = IMI 100279, dried specimen 

of culture on CMA, CBS H-18128. 

Notes: CBS 182.44, isolated from Petroselinum sativum, produces 

conidia 29–49 × 1–2 µm, and this range of sizes agrees with 

those given for S. petroselini by most authors [26–45(–52) × 

(1–)1.5–2 µm cf. Priest 2006; 16–46 × 1–2 mm cf. Jørstad 1965 

on Petroselinum]. In contrast, the conidia in the collection on P. 

crispum (CBS H-21166), as well as in the isolate CBS 109521 

derived from it, were up to 80 µm long and 2.5 µm wide, and the 

pycnidia were also larger than described for S. petroselini, for which 

this material was initially identified as S. apiicola, but the molecular 

data provide evidence that it also belongs to S. petroselini. The 

material is 100 % homologous on ITS, Act, RPB2 and EF, and 

99.7 % on Cal with CBS 182.44. The range of conidial sizes for S. 

petroselini is therefore expanded here, although it should be noted 

that the conidia formed in vitro are not over 65 µm in length in the 

material available. The ITS sequence of S. anthrisci is distinct from 

that of S. apiicola, but identical to that of S. petroselini and other 

species. Septoria anthrisci can be distinguished from S. petroselini 

by the Act, EF and RPB2 sequences. 

Septoria phlogis Sacc. & Speg., in Sacc., Michelia 1: 184. 

1878 [as “phlocis”; non Ellis & Everh., in G. Martin, J. Mycol. 

3: 85. 1887; nec P. Syd., Mycoth. March., Cent. 18, no 1757; 

Cent. 23, no 2278. 1887; later homonyms]. Fig. 33. 

Description in planta: Symptoms leaf lesions developing in areas 

of the leaf lamina that first turn yellow, indefinite or delimited by 

darkening veinlets, hologenous, pale to dark brown. Conidiomata 

pycnidial, epiphyllous, numerous, semi-immersed to immersed, 

subglobose to globose, dark brown to black, 100–160 µm 

diam; ostiolum central, circular, initially 25–35 µm wide, later 

becoming more irregular and up to 70 µm wide, surrounding cells 

concolourous; conidiomatal wall 15–28 µm thick, composed of an 

outer layer of isodiametric to irregular cells mostly 5–9 µm diam 

with pale brown cell walls up to 2 μm thick, and an inner layer of 

hyphal to isodiametric cells 3–5 μm diam with thin, hyaline walls. 

Conidiogenous cells hyaline, discrete or integrated in 1–2-septate 

conidiophores up to 22 µm long, cylindrical, or narrowly to broadly 

ampulliform, holoblastic, often proliferating percurrently with 

indistinct annellations as well as sympodially, 5–7.5(–8) × 2.5– 

4(–5) µm. Conidia cylindrical, filiform, straight to slightly curved, 

278


Notes: Priest (2006) described the conidia of S. phlogis as filiform, 

1–4-septate, straight to curved, (35–)50–73 × (1–)1.5–2 µm, 

hyaline, with a truncate base and obtuse apex. He accepted S. 

divaricatae as a separate species, with Phlox drummondi (syn. P. 

divaricata) as the only known host plant, and S. drummondi as a 

synonym. Septoria divaricatae has similarly shaped but smaller 

conidia than S. phlogis, 1–3-septate, (13–)25–40(–45) × 1–1.5 

µm. The overlap in length of the conidia of the two is minimal, at 

least on the host plant, indicating that they might be truly separate 

taxa. Several other authors have also accepted S. divaricatae as 

a distinct entity (Teterevnikova-Babayan 1987, Muthumary 1999). 

However, Jørstad (1965) considered S. divaricatae a synonym of 

S. phlogis, and also S. phlogina. Both S. phlogis and S. divaricatae 

occur on P. drummondi and this may have contributed to the 

confusion. Investigations based on fresh material on different Phlox 

species, and studies of cultures derived thereof, as well as type 

material of the names mentioned above, will be required in order to 

settle the complicated taxonomy of Septoria on Phlox. 

Molecular identification of S. phlogis is straight-forward, as all 

protein-coding genes investigated here, particularly Btub, Cal and 

RPB2, show unique diagnostic sequences. Septoria epambrosiae 

(CBS 128629, 128636) is a sister species to S. phlogis. Septoria 

epambrosiae is a pathogen of Ambrosia artemisiifolia (Asteraceae), 

which today is the prime cause of hay fever in many areas where 

this weed occurs. 

Fig. 33. Septoria phlogis. Conidia and conidiogenous cells in planta (CBS H-21198). 


narrowly rounded to somewhat pointed at the apex, attenuated 

gradually or more abruptly towards the narrowly truncate base, 


containing minute oil-droplets and granular material in the living 

and rehydrated state, (22–)32–50(–60) × 1.5–2 µm (rehydrated; 

living, 2–2.5 µm wide). Sexual morph unknown. 

Description in vitro: Colonies on OA 15–18 mm diam in 19 d, with an 

even, glabrous, buff to rosy-buff margin; colonies spreading, plane; 

immersed mycelium variably pigmented over sectors, usually either 

brownish olivaceous, or cinnamon to saffron (honey with a reddish 

haze); aerial mycelium scanty, white, locally forming a diffuse woollyfloccose 

mat; reverse olivaceous-black and cinnamon or saffron. 

Colonies on CMA 13–18 mm diam in 19 d, as on OA. Colonies on 

MEA 12–17 mm diam in 19 d, with an even, glabrous, buff margin; 

colonies spreading, the surface mostly plane, only somewhat 

elevated or folded towards the centre; immersed mycelium mostly 

dark salmon to olivaceous-black, covered by a dense, appressed 

mat of woolly, mostly white to faintly rosy-buff aerial mycelium; an 

ochreous pigment diffuses into the surrounding medium; reverse 

mostly sienna or blood colour, with an ochreous to saffron margin. 

Colonies on CHA 12–18 mm diam in 19 d, as on MEA. 

Hosts: Phlox spp. 

Material examined: Netherlands, Prov. Noord-Holland, Enkhuizen, on living leaves 

of Phlox sp., 6 Sep. 1949, J.A. von Arx s.n., CBS H-4862; Prov. Utrecht, Baarn, 

Cantonspark, on living leaves of Phlox sp., 27 Aug. 1999, G. Verkley 911, CBS 

H-21198, living culture CBS 102317; same substr., Jan. 1932, D. Moll s.n., living 

culture CBS 312.32; Garden in Baarn, same substr., 16 Oct. 1990, H.A. van der Aa 

10919, CBS H-18130, living culture CBS 577.90; same substr., loc., 27 Aug. 1997, 

H.A. van der Aa 12302, CBS H-18131. 

Septoria polygonorum Desm., Annls Sci. Nat., sér. 2, 

Bot.17: 108. 1842. Fig. 34. 

≡ Spilosphaeria polygonorum (Desm.) Rabenh., Herb. Mycol. II, no. 

442a. 1856. 

Description in planta: Symptoms leaf spots small, circular, 

hologenous, ochreous to brown, sharply delimited by a dark redbrown 

zone. Conidiomata pycnidial, mainly epiphyllous, several 

to many developed in each leaf spot after some time, subglobose 

to lenticular, not protruding strongly, brown to almost black, 50– 

120 µm diam; ostiolum central, initially circular and 25–45 µm 

wide, surrounding cells concolorous to somewhat darker brown; 

conidiomatal wall about 10–25 µm thick, composed of angular 

cells 2.0–6.5 µm diam, the outermost cells pale yellowish brown 

with somewhat thickened walls, the inner cells thin-walled. 

Conidiogenous cells hyaline, discrete, narrowly or broadly 

ampulliform with a relatively wide neck, holoblastic, often first 

proliferating sympodially, and later also percurrently 1–several times 

with distinct annellations, 5–10(–14) × 3.–5.5(–6.5) µm. Conidia 

filiform to filiform-cylindrical, straight or slightly curved, or flexuous, 

attenuated gradually to a narrowly rounded to pointed apex, 

attenuated more abruptly towards the truncate base, 1–4-septate, 

not or only inconspicuously constricted around the septa, hyaline, 



granular contents in the rehydrated state, (17–)22–45(–53) × 1.5–2 

µm (living; rehydrated, 1.2–1.8 µm wide). Sexual morph unknown. 

Description in vitro: Colonies normally slow-growing, but sometimes 

with fast-growing sectors (diam including these between brackets) 

on all media except MEA. On OA 3–5 [6–7] mm diam in 2 wk [6–7 

(22–30) mm in 6 wk], the margin regular, glabrous, colourless; 

colonies spreading, plane, immersed mycelium olivaceous-black, 

but grey-olivaceous to greenish grey in faster growing sectors that 

sometimes develop from typically slow-growing colonies; aerial 

mycelium generally absent or very scanty, but woolly-floccose 


279


Fig. 34. Septoria polygonorum. A–C. Colonies CBS 102331 (15 °C, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia and conidiogenous cells in planta (CBS H-21212). E. 

Ibid., on OA (CBS 108982). F, G. Conidia on OA (CBS 347.67). Scale bars = 10 µm. 

appressed on the above mentioned sectors; white conidial 

slime produced from numerous, scattered pycnidial or stromatic 

conidiomata; reverse dark slate blue to olivaceous-black. Colonies 

on CMA 4–5 (6–7) mm diam in 2 wk [5–7 (22–27) mm in 6 wk], as 

on OA, with similar fast-growing sectors. Colonies on MEA 3–4 mm 

diam in 2 wk (6–8 mm in 6 wk), the margin regular, glabrous, barely 

280


visible; colonies irregularly pustulate to hemispherical, immersed 

mycelium olivaceous-black to black, glabrous, the surface bearing 

numerous droplets of milky white to dirty buff conidial slime emerging 

from scattered pycnidial conidiomata; reverse olivaceous-black to 

black. Colonies on CHA 3–5 mm diam in 2 wk [7–10 (22–26) mm in 

6 wk], the margin distinctly ruffled, glabrous, ochreous to greyish; 

colonies irregularly pustulate, immersed mycelium olivaceousblack, 

lacking aerial mycelium; milky white to dirty buff conidial 

slime emerging from scattered pycnidial conidiomata; reverse 

blood colour. 

Conidiomata (OA) as in planta, single and pycnidial, brown 

to black, glabrous, 85–150 µm diam, with a single ostiolum up to 

50 µm wide, rarely also merged into multilocular stromata up to 

300 µm diam which may have several openings; conidiogenous 

cells as in planta, proliferating sympodially and/or percurrently, 

9–20 × 4–7 µm; conidia as in planta but longer, 30–65(–72) × 

1.5–2(–2.2) µm. 

Hosts: Polygonum spp. 

Material examined: Austria, Tirol, Ötztal, Sautens, on living leaves of Polygonum 

persicaria, 30 July 2000, G. Verkley 1024, CBS H-21213, living culture CBS 108982. 

Netherlands, prov. Utrecht, Baarn, Zandvoordtweg, same substr., 9 July 1967, 

H.A. van der Aa 98, CBS H-18695, living culture CBS 347.67; same substr., prov. 

Limburg, St. Jansberg, near Plasmolen, 9 Sep. 1999, G. Verkley 926, CBS H-21208, 

living cultures CBS 102330, 102331; same substr., prov. Limburg, Savelsbos, 28 

June 2000, G. Verkley 967, CBS H-21212, living cultures CBS 109007, 109008; 

Prov. Zeeland, Zuid-Beveland, community of Borsele, Valdijk near Nisse, 27 Aug. 

2001, G. Verkley 1110, CBS H-21164, living culture CBS 109834. New Zealand, 

North Island, Coromandel, Tairua Forest, along roadside of St. Hway 25, near 

crossing 25A, 23 Jan. 2003, G. Verkley 1843, CBS H-21242, living culture CBS 

113110. 

Notes: More than ten Septoria species have been described from 

the host genus Polygonum, of which S. polygonorum is the oldest 

one. The material available for the present study agrees generally 

well in morphology with the description of S. polygonorum provided 

by other authors. Priest (2006) described the conidiogenous cells 

as holoblastic (first conidium), producing subsequent conidia 

enterobastically, seceding at the same level (mode “Event 13: 

enteroblastic non-progressive”). Muthumary (1999), who studied 

type material of S. polygonorum from PC, observed sympodially 

proliferated cells. Priest may have overlooked the sympodial 

conidiogenesis, as in the present study sympodially proliferating 

cells were also observed in field specimens of S. polygonorum. 

The strains available from distant geographical origins showed 

highly similar sequences for seven loci. The multilocus phylogeny 

indicates a rather isolated position of S. polygonorum (Fig. 2). 

Septoria protearum Viljoen & Crous, S. Afr. J. Bot. 64: 144. 

1998. 

Description in planta: Symptoms leaf spots varied according to the 

host. Conidiomata pycnidial, epiphyllous or amphigenous, semiimmersed 

or becoming erumpent, subglobose to globose, dark 

brown to black, 65–200 µm diam; ostiolum central, circular, slightly 

papillate, 18–30(–60) µm wide, surrounding cells concolourous, 

releasing white cirrhi of conidial slime; conidiomatal wall 10–22 µm 

thick, composed of 3–4 layers of brown, isodiametric to irregular 

cells mostly 5–10 µm diam with dark brown cell walls up to 2 μm 

thick, sometimes with an an inner layer of hyphal to isodiametric 

cells 3.5–5 μm diam with thin, hyaline walls. Conidiogenous cells 

hyaline, discrete and globose or doliiform often with an elongated 

neck, or integrated in 1–5-septate conidiophores up to 30 µm 

long and narrowly to broadly ampulliform, holoblastic, proliferating 

percurrently with indistinct annellations as well as sympodially, 

4–12 × 1.5–3.5(–5) µm. Conidia hyaline, cylindrical, subcylindrical 

to obclavate, straight to curved, rounded to somewhat pointed 

at the apex, attenuated gradually or more abruptly towards the 

truncate base, (0–)1–3(–4)-septate, not constricted around the 

septa, containing minute oil-droplets and granular material in 

rehydrated state, (6–)12–22(–30) × 1.5–2 µm (rehydrated). Sexual 


Description in vitro (18 ºC, near UV): Colonies on OA 11–16 mm 

diam in 1 wk, 23–30 mm in 2 wk, with an even, slightly undulating, 

colourless margin; colonies plane, spreading, immersed mycelium 

ochreous to pale luteous or rosy-buff and rarely also with greenish 

tinges, aerial mycelium absent or scarce with few grey to rosybuff 

tufts; conidiomata developing mostly immersed in the agar, 

scattered or in concentric zones, olivaceous-black, releasing 

droplets of milky white to pale salmon conidial slime. Reverse 

cinnamon to hazel or fawn, or rosy-buff. Colonies on MEA 32–36 

mm diam in 2 wk, with an even, (vinaceous) buff to colourless 

undulating margin; colonies restricted with a cerebriform elevated 

central area or lower and more spreading, radially striate, the entire 

surface covered by a dense mat of finely felted, somewhat woolly, 

white to greysh, or salmon to flesh aerial mycelium; reverse dark, 

fawn to brown-vinaceous, or olivaceous-black mixed with bright 

rust to coral. Conidiomata developing after 1 wk, mostly immersed 

and releasing whitish conidial slime. Colonies on CHA 17–19 mm 

diam in 1 wk, 25–31 mm in 2 wk, with an even, saffron margin with 

some diffuse white aerial mycelium; colonies spreading but slightly 

elevated in the centre, entirely covered by a dense mat of pure 

white, locally weakly salmon, woolly and somewhat sticky aerial 

mycelium, in the marginal area later with a glaucous haze; reverse 

in the centre chestnut, surrounded by rust and apricot zones, 

margin saffron. Sporulation as on MEA. 

Conidiomata (OA) pycnidial, globose, single or merging into 

complexes up to 220 µm diam, brown to black, the wall composed 

of pale brown textura angularis with cells up to 10 µm diam, inner 

cells smaller and hyaline. Conidiogenous cells hyaline, discrete 

or integrated in simple, 1(–2)-septate conidiophores, cylindrical 

or narrowly to broadly ampulliform, holoblastic, proliferating 

sympodially, and/or percurrently with indistinct annellations, and 

then often showing a narrow neck of variable length, 5–10(–13.5) 

× 2.5–3(–3.5) µm. Conidia filiform to cylindrical, straight, more 

often curved or flexuous, or bent irregularly, rounded to somewhat 


the narrowly truncate base, (0–)1–3-septate, not constricted at 

the septa, hyaline, contents as in planta, (8–)12–22(–25) × 1.5–2 

µm (CBS 119942), (12–)15–23.5(–31) × 1–1.5 µm (CBS 179.77), 

17–35 × 1–1.5(–2) µm (CBS 658.77). 

Hosts: Asplenium ruta-muraria, Boronia denticulata, Geum sp., 

Ligustrum vulgare, Myosotis sp., Nephrolepis sp., Pistacia vera, 

Protea cynaroides, Protea sp., Skimmia sp. and Zanthedeschia 

aethiopica. 

Material examined: Germany, Potsdam, Maulbeerallee beneath the Orangerie, on 

living leaves of Asplenium ruta-muraria, 17 Nov. 2005, V. Kummer 0045/3, CBS 

H-19729, living culture CBS 119942. Italy, details of loc. unknown, on Pistacia vera, 

June 1951, deposited by G. Goidánich, living culture CBS 420.51; on Ligustrum 

vulgare, June 1959, M. Ribaldi, living culture CBS 390.59. Netherlands, Reeuwijk, 

in leaf spot of Skimmia sp., commercially cultivated under plastic ‘tunnels’, 1996, J. 

de Gruyter, CBS H-21190, PD 96/11330 = CBS 364.97. New Zealand, Auckland, 

on Myosotis sp., Dec. 1976, H.J. Boesewinkel, CBS H=18209, living culture 


281


CBS 179.77; same area, on Nephrolepis sp., Sep. 1977, H.J. Boesewinkel, CBS 

H-18211, living culture CBS 164.78; same area, on leaves and stems of Boronia 

denticulata, 5 Apr. 1977, H. J. Boesewinkel, CBS H-18120, living culture isolated, 

CBS 658.77; same area, Albert Park, on leaves of Geum sp., 21 Jan. 2003, G. 

Verkley V1821, CBS H-21233, living culture CBS 113114. South Africa, Gauteng 

Province, on leaves of Protea cynaroides, Sep. 1996, L. Viljoen, living ex-type culture 

of Septoria protearum STE-U 1470 = CBS 778.97; Pilgrims Rest, on Zanthedeschia 

aethiopica, 15 July 2011, P.W. Crous, living culture CPC 19675. 

Notes: The description of S. protearum given by Crous et al. 

(2004) has been emended here using observations on material 

isolated from other hosts than Protea. These fungi are, despite 

minor differences in colony characteristics, genetically very similar, 

and therefore regarded as conspecific. The name S. protearum is 

adopted as it is based on well-decribed type material and ex-type 

cultures. The distinction with a number of strains isolated from 

Citrus spp., Fragaria sp., Gerbera jamesonii, Gevuina avellana, 

Hedera helix, Lobelia erinus, and Masdevallia sp. is doubtful 

but, based on the morphological differences in combination with 

a limited number of polymorphisms on the house-keeping genes, 

they are treated here as part of Septoria citri (which clusters in the 

S. protearum complex), which is a species complex that needs to 

be further resolved. Material studied and some cultural characters 

of CBS 113392 are provided below. 

Additional material of the Septoria citri complex examined: Country and host 

unknown, May 1937, L.L. Huiller, living culture CBS 315.37 (sub Septoria citri). 

Argentina, in leaf spot of Lobelia erinus, S. Wolcon s.n., ‘V1466’, living culture 

CBS 113392. Italy, Sicilia, on Gerbera jamesonii, Nov. 1961, W. Gerlach, living 

cultures CBS 410.61 = BBA 9588 (sub S. gerberae). Netherlands, Paterwolde, in 

glasshouse, in leaf spots of Masdevallia sp., Feb. 1998, W. Veenbaas-Rijks (CBS 

H-18124), living culture CBS 101013 (sub S. orchidacearum). New Zealand, leaf 

of Gevuina avellana, Nov. 1998, S. Ganev, living culture CBS 101354; Waitakere, 

culture isolated from leaf of Fragaria sp., Nov. 1975, H. J.Boesewinkel, living culture 

CBS 177.77 (sub Septoria aciculosa). Portugal, Algarve, Monchique, in leaf spot on 

Hedera helix, 14 June 1988, H.A. van der Aa 10494, living culture CBS 566.88 (sub 

S. hederae Desm.). 

Description in vitro (18 ºC, near UV, CBS 113392): Colonies 23–26 

mm diam in 2 wk, with an even, glabrous colourless margin; colonies 

spreading, immersed mycelium orange, lacking aerial mycelium; 

reverse bay to scarlet. Conidiomata developing in concentric patterns, 

immersed and on the agar surface, releasing milky white masses 

of conidial slime. Colonies on MEA 17–23 mm diam in 2 wk, with 

an even colourless margin mostly covered by white aerial hyphae; 

colonies spreading but developing cerebriform elevations in the centre, 

immersed mycelium livid vinaceous to vinaceous buff, with diffuse to 

dense, appressed, whitish to vinaceous buff aerial mycelium. 

Conidiogenous cells (OA) varied in shape, globose, doliiform 

to ampulliform or cylindrical, discrete, rarely integrated in 1-septate 

conidiophores, holoblastic, proliferating sympodially, and also 

percurrently with several close and indisctinct annellations, 

hyaline, 4.5–8(–10) × 3–5 µm. Conidia filiform to cylindrical, 

straight to flexuous, often weakly curved, attenuated gradually to a 

narrowly rounded to somewhat pointed apex, attenuated gradually 

or more abruptly to a narrowly truncate to almost rounded base, 

contents granular with few minute oil-droplets in the living state, 

(0–)1–3-septate, (12–)15–28 × 1.5–2 µm (living); CBS 177.77 (OA) 

17–35.5 × 1–2 µm (living). 

Septoria putrida Strasser, Verh. zool.-bot. Ges. Wien 65: 

180. 1915. Fig. 35F–J. 

Description in planta: Symptoms definite leaf spots, hologenous or 

epigenous, scattered or in clusters, initially pale yellowish, later grey 

to white, surrounded by a black elevated zone or merely delimited 

by leaf veins. Conidiomata pycnidial, one to several in each leaf 

spot, scattered, semi-immersed, predominantly epiphyllous, pale 

brown, lenticular to globose, 80–180 µm diam; ostiolum circular, 

central, initially 25–50 µm wide, later opening to 80 µm diam, 

lacking distinctly differentiated cells; conidiomatal wall composed 

of textura angularis without distinctly differentiated layers, mostly 

10–20 µm thick, the outer cells with brown, somewhat thickened 

walls and 4.5–10 µm diam, the inner cells hyaline, thin-walled, 

4–9 µm diam. Conidiogenous cells hyaline, discrete or integrated 

in short, 1-septate conidiophores, cylindrical, or ampuliform with 

a mostly relatively short, but sometimes strongly elongated neck 

(8–10 µm long), hyaline, holoblastic, proliferating percurrently with 

distinct annellations, sometimes also sympodially, 6.5–12(–19.5) × 

3.5–5 µm. Conidia cylindrical, usually strongly curved or flexuous, 

gradually attenuated to a rounded apex, gradually attenuated 

into a broadly truncate base, (0–)3–5-septate, not or indistinctly 

constricted around the septa, hyaline, contents with several small 

guttulae and numerous granules in each cell in the living state, oildroplets 

rarely merged into larger guttules in the rehydrated state, 

(32–)40–70(–85) × 2–2.5(–3.0) µm (rehydrated). Sexual morph 

unknown. 

Description in vitro: Colonies on OA 5.5–8.5 mm diam in 12 d 

(13–15 mm in 3 wk; 50–55 mm in 7 wk), with an even, somewhat 

undulating, glabrous, colourless margin; colonies plane, immersed 

mycelium buff to primrose, in some sectors also with dark herbage 

green to dull green radiating hyphal stands, after 7 wk mostly 

dark greenish; pycnidial conidiomata scattered immersed and 

superficial, which are first dark olivaceous, then almost black, 

glabrous or beset with short hyphal protrusions, 150–450 µm diam, 

mostly with a single ostiolum placed on short papillae, that releases 

pale whitish or buff conidial slime; aerial mycelium diffuse, woollyfloccose, 

white to grey; reverse dull green to olivaceous-black in 

the centre. Colonies on CMA 4–7 mm diam in 12 d (11–14 mm 

in 3 wk; 50–55 mm in 7 wk), with an even, glabrous, colourless 

margin; immersed mycelium apart from margin olivaceous-black, 

at the margin with some local production of a coral pigment after 7 

wk; aerial mycelium higher, diffuse woolly, greyish; reverse darker 

as on OA; conidiomata similar as on OA. Colonies on MEA 2.5–5 

mm diam in 12 d (11–13 mm in 3 wk; 42–46 mm in 7 wk), with an 

even to ruffled, glabrous, colourless to buff margin, which may be 

irregularly lobate after 7 wk; colonies restricted, pustulate to almost 

hemispherical, immersed mycelium rather dark, aerial mycelium 

diffuse, short, felty white, behind the margin denser and higher; 

superficial mature conidiomata releasing first milky white, later pale 

luteous to saffron, then salmon conidial slime; reverse olivaceousblack 

in the centre, near the margin honey. Colonies on CHA 5–7 

mm diam in 12 d (8–11 mm in 3 wk), with an irregular, ruffled, 

colourless margin, older colonies distinctly lobate; the surface 

mostly covered by a low, dense to diffuse, felty white, later grey 

aerial mycelium, near the margin pure white felty to tufty; further as 

on MEA; conidial slime abundantly produced, first milky white, later 

salmon or saffron; reverse in the centre blood colour, dark brick to 

cinnamon at the margin. 

Conidia as in planta, (0–)3–5(–6)-septate, 40–85(–97) × 

2–2.5(–3) µm. 

Host: Senecio nemorensis. 

Material examined: Austria, Tirol, Ober Inntal, Samnaun Gruppe, Lawenalm, on 

living leaves of Senecio nemorensis subsp. fuchsii, 8 Aug. 2000, G. Verkley 1052a, 

282


Fig. 35. A–E. Septoria senecionis. A–C. Colonies CBS 102381 (15 °C, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia and conidiogenous cells in planta (CBS H-21219, 

epitype). E. Conidia in planta (CBS H-21219). F–J. Septoria putrida. F, G. Conidia in planta (CBS H-21174). H. Conidiogenous cells in planta (CBS H-21174). I. Conidia and 

conidiogenous cells in planta (CBS H-21174). J. Ibid., on OA (CBS 109088). Scale bars = 10 µm. 

CBS H-21174, living cultures CBS 109087, 109088. 

Notes: Septoria putrida was originally described from Senecio 

nemorensis found in Austria (Sonntagberg), reportedly with 


283


0(–9–11?)-septate conidia, 70–80 × 2 µm. The multilocus sequence 

analysis indicates that S. putrida and S. senecionis are closely 

related but genetically distinct species (Fig. 2). Morphologically 

these sister taxa can best be distinguished based on conidial length; 

conidia in S. putrida can be up to 85 µm long in planta and even 

longer (up to 97 µm) in culture, whereas those of S. senecionis are 

rarely longer than 65 in planta and not over 70 µm long in culture. 

Thirteen more taxa have been described in Septoria on Senecio, 

of which S. anaxaea Sacc. is another distinctive, long-spored species 

described from Senecio grandidentatus (?= S. praealtus), and 

recently also from several other Senecio spp. in Australia. According 

to Priest (2006), conidia are 3(–6)-septate, 28–75 × 2.5–3 µm (50– 

130 × 3.5–5 µm, Teterevnikova-Babayan 1987). Most other Septoria 

spp. on Senecio may be synonyms of S. senecionis, and this needs 

to be confirmed by study of the type material. 

Septoria rumicum Sacc. & Paol., in Saccardo, Bull. Soc. r. 

Bot. Belg. 28: 23. 1889. 

Description in vitro: Colonies on OA 3–5 mm diam in 3 wk, with an 

even colourless margin; colonies restricted, irregularly pustulate, 

immersed mycelium olivaceous-black mostly hidden under a low, 

dense mat of felty grey to white aerial mycelium; reverse olivaceousgrey. 

Colonies on MEA 6–10(–12) mm diam in 3 wk, with an even or 

lobed, colourless margin; colonies restricted, irregularly pustulate, 

immersed mycelium appearing olivaceous-grey under a dense 

mat of woolly-floccose, white to grayish aerial mycelium; reverse 

olivaceous-black. No sporulation observed. 

Conidia (OA) cylindrical, filiform, straight or slightly curved, 

attenuated gradually towards a narrowly rounded to almost pointed 

apex, attenuated gradually or more abruptly towards the narrowly 

truncate base, 3–5(–7)-septate, mostly 60–82 × 2–3 µm. 

Hosts: Rumex spp. (R. acetosa, R. alpinum). 

Material examined: France, Corrèze, Roumignac, on leaves of Rumex acetosa, 

H.A. van der Aa 5338, CBS H-18050, living culture CBS 503.76 ; Haute-Savoie, Mt. 

Beaudin, on stem of R. alpinus, July 1978, H.A. van der Aa 9594c, CBS H-18163, 

living culture CBS 522.78. 

Notes: Jørstad (1965) noted that S. rumicis Trail, which was 

published in the same year as S. rumicum, may be conspecific. 

Septoria acetosae Oud. was also regarded as a synonym. 

According to Saccardo (1892, Syll. Fung. 10: 380), S. rumicum 

produces mostly epiphyllous pycnidia 100–125 µm diam, and 

continuous (?) conidia 50–68 × 3 µm. Septoria rumicis produces 

chiefly epiphyllous pycnidia 90–100 µm diam and conidia 24–40 

× 2–2.5 µm (Teterevnikova-Babayan 1987), according to Jørstad 

(1965), 20–50 × 2.5–3.5, with 2–3(–5) septa. Septoria acetosae 

was treated as a separate species by Teterevnikova-Babayan 

(1987). According to the latter author, it is characterised by 

1–3-septate conidia, 28–50 × 3–5 µm. As the conidial sizes of the 

material available here agree best with the original description of 

S. rumicum, this name is adopted here. Several other species of 

Septoria have been described from Rumex, most of which need to 

be restudied to assess their status. 

Septoria scabiosicola (Desm.) Desm., Annls Sci. Nat., sér. 

3, Bot. 20: 96. 1853. Fig. 36. 

Basionym: Depazea scabiosicola Desm., Annls Sci. Nat., sér. 2, 

Bot. 6: 247. 1836. 


circular, some merging to irregular patterns, centre white, 

surrounded by a relatively broad, dark margin with a distinct 

red or purple periphery. Conidiomata pycnidial, epiphyllous but 

sometimes also visible from the underside of the lesion, one to 

a few in each leaf spot, subglobose to globose, brown to black, 

usually fully immersed, 65–130 µm diam; ostiolum central, 

initially circular and 35–60 µm wide, later becoming more 

irregular and up to 80 µm wide, surrounding cells concolorous 

to pale brown; conidiomatal wall about 10–15 µm thick, 

composed of a homogenous tissue of hyaline, angular cells 

2.5–6.5 µm diam, the outermost cells pale brown with somewhat 

thickened walls, the inner cells thin-walled. Conidiogenous cells 

hyaline, discrete, doliiform, or narrowly to broadly ampulliform, 

holoblastic, with a relatively narrow elongated neck, proliferating 

percurrently several times with distinct annellations, often also 

sympodially after a few percurrent proliferations, 6–9(–12) × 

2.5–3(–5) µm. Conidia filiform to filiform-cylindrical, straight, 

slightly curved to flexuous, attenuated gradually to a narrowly 

pointed apex and narrowly truncate base, (0–)3–5(–6)-septate 

(septa very thin and easily overlooked), not constricted around 

the septa, hyaline, contents with several minute oil-droplets and 

granular material in each cell in the living state, with minute oildroplets 

and granular contents in the rehydrated state, (17–)30– 

55 (–79) × 1–2 µm (living; rehydrated, 1–1.8 µm wide). Sexual 



an even, glabrous, colourless margin; immersed mycelium mostly 

homogeneously coral to scarlet, the pigment diffusing beyond 

the colony margin; in the centre black and slightly elevated due 

to immersed and more frequently superficial pycnidia, surrounded 

by an area with more scattered pycnidia, releasing pale flesh 

droplets of conidial slime; aerial mycelium scanty, consisting of 

minute white tufts; reverse scarlet to coral, the centre darker, blood 

colour. Colonies may develop sectors that are unpigmented and 

glabrous. Colonies on CMA 8–11 mm diam in 2 wk; similar as on 

OA, but generally less strongly pigmented. Colonies on MEA 6–9 

mm diam in 2 wk, the margin irregular; colonies restricted, the 

centre elevated and cerebriform to irregularly pustulate, up to 2 

mm high, the surface pale brown, later black, with scanty white 

areal mycelium; reverse of the colony dark brick, paler towards the 

margin. Colonies on CHA 6–11 mm diam in 2 wk, with an even, 

glabrous, colourless margin; immersed mycelium greenish grey to 

dark slate blue, throughout covered by well-developed, tufty whitish 

grey arial mycelium that later attains a reddish haze; reverse blood 

colour, but margin paler; in the central part of the colony numerous 

pycnidia develop, releasing pale vinaceous to rosy-buff conidial 

slime; in older colonies the centre becomes cerebriform and up to 

3mm high, much as on MEA. 

Conidiomata (OA) as in planta, pycnidial, sometimes merged 

into larger complex stromata dark brown, glabrous, 80–180 

µm diam, with a single ostiolum, or without preformed opening 

and simply bursting open; conidiogenous cells as in planta, but 

more often integrated in 1–2-septate conidiophores, often only 

proliferating percurrently and/or sympodially, 6–15 × 3–7.5 µm; 

conidia as in planta, 1–6(–7)-septate, not constricted around the 

septa, hyaline, with several minute oil-droplets and numerous 

granules in each cell, (30–)40–80(–100) ×1.5–2(–2.5) µm. 

Hosts: Knautia spp., Succisa spp. and Scabiosa spp. 

284


Fig. 36. Septoria scabiosicola, CBS 102333. A–C. Colonies (15 °C, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia and conidiogenous cells in planta (CBS H-21180). 

E. Conidia on OA (CBS 109021). Scale bars = 10 µm. 

Material examined: Austria, Tirol, Ötztal, Brunau, along roadside, on living leaves 

of Knautia arvensis, 30 July 2000, G. Verkley 1023, CBS H-21184, living cultures 

CBS 108981, 109021; Tirol, Ötztal, Sautens, in meadow, 30 July 2000, G. Verkley 

1030, CBS H-21180, living cultures CBS 108985, 108986; Tirol, Ötztal, Ötz, near 

Piburger See along forest road, on living leaves of K. dipsacifolia, 1 Aug. 2000, 

G. Verkley 1033, CBS H-21179, living cultures CBS 109092, 109093; Tirol, Ober 

Inntal, Samnaun Gruppe, Serfaus, on living leaves of K. dipsacifolia, 9 Aug. 2000, 

G. Verkley 1062, CBS H-21172, living cultures CBS 109128, 109129. France, 

on living leaves of Succissa pratensis, H.A. van der Aa 11375, living culture CBS 

182.93. Germany, on living leaves of Scabiosa lucida, R. Schneider, living culture 

CBS 356.58. Netherlands, prov. Gelderland, near Winssen, along Waalbanddijk, 

on living leaves of K. arvensis, 9 Sep. 1999, G. Verkley 919, CBS H-21201, living 

cultures CBS 102333, 102334; same loc., host, date, G. Verkley 920, CBS H-21203, 

living cultures CBS 102335, 102336; same loc., host, date, G. Verkley 921, CBS 

H-21202; unknown host, July 1937, living culture CBS 317.37. 

Notes: Jørstad (1965) and Radulescu et al. (1973) reported 

variability in the maximum length of conidia on the host plant. This 

is confirmed in the present study, where the highest and lowest 

maximum lengths observed in specimens were 79 and 42 µm, in 

specimens CBS H-21184 and CBS H-21180, respectively. Both 

specimens were collected from the same host at comparable 

altitudes (ca. 700 m), from localities in Tirol, Austria less than three 

kilometers apart. Isolates obtained from these two collections 

proved equally capable of producing conidia up 100 µm long under 

standard conditions of incubation. 

These isolates as well as other from Knautia arvensis, and 

strains originating from Scabiosa and Succissa showed no 

correlation between conidial sizes and host, and although some 

variation in gene sequences was observed, especially in Act and EF, 

the data firmly support the hypothesis that they belong to a single 

taxon. Several formae have been described in S. scabiosicola, but 

evidence to support these as separate entities is wanting. Septoria 

scabiosicola is relatively distantly related from other members of 

the Septoria clade (Fig. 2). 

Septoria senecionis Westend., Bull. Acad. r. Belg., Cl. Sci., 

Sér. 2, 19: 121. 1851. Fig. 35A–E. 

Description in planta: Symptoms indefinite, hologenous leaf 

lesions, often eventually affecting large parts of the leaf lamina, 

initially pale yellowish, later pale to dark brown. Conidiomata 

pycnidial, numerous, scattered, immersed, mostly epiphyllous, 

pale brown, lenticular to globose, (45–)65–120(–160) µm diam; 

ostiolum circular, central, initially 20–35 µm wide, later opening 


285


to 60 µm diam, lacking distinctly differentiated cells; conidiomatal 

wall composed of textura angularis without distinctly differentiated 

layers, mostly 15–20 µm thick, the outer cells with brown, 

somewhat thickened walls and 4.5–10 µm diam, the inner cells 

hyaline and thin-walled and of comparable diam. Conidiogenous 

cells hyaline, discrete or integrated in short, 1–2-septate 

conidiophores, cylindrical, or ampuliform with a relatively short 

neck, hyaline, holoblastic, proliferating sympodially, and sometimes 

also percurrently with indistinct annellations, 6.5–10(–12.5) × 2.5– 

4.5 µm. Conidia cylindrical, weakly to strongly curved, or flexuous, 

gradually attenuated to a rounded apex, gradually or more abruptly 

attenuated into a broadly truncate base, (0–)2–5(–6)-septate, not 

or indistinctly constricted around the septa, hyaline, contents with 

several small guttules and numerous granules in each cell in the 

living state, oil-droplets rarely merged into larger guttules in the 

rehydrated state, (20–)40–65 × 2–2.5(–3) µm (rehydrated). Sexual 


Description in vitro: Colonies on OA 7–10 mm diam in 2 wk (22– 

26 mm in 6 wk), with an even, somewhat undulating, glabrous, 

colourless margin; colonies spreading, the surface plane, immersed 

mycelium pale luteous or buff, with scattered immersed and 

superficial pycnidial conidiomata, which are first dark olivaceous, 

then almost black, glabrous, 150–450 µm diam, with a single or 

several (up to 5!) ostioli placed on short papillae or more elongated 

necks (up to 350 µm), that release buff to rosy-buff later salmon 

conidial slime; aerial mycelium diffuse, woolly-floccose, white; 

reverse honey, but isabelline to hazel in the centre. Colonies on 

CMA 6–8 mm diam in 2 wk (18–23 mm in 6 wk), with an even, 

glabrous margin; as on OA but immersed mycelium with a greenish 

haze; aerial mycelium higher and reverse darker, later hazel with 

olivaceous and yellow tinges; conidiomata similar as on OA. 

Colonies on MEA 7–9 mm diam in 2 wk (18–21 mm in 6 wk), with 

an even or somewhat undulating, glabrous, buff to honey margin; 

colonies pustulate to almost hemispherical, immersed mycelium 

rather dark, near the margin covered by woolly to felty white aerial 

mycelium; mostly composed of spherical conidiomatal initials, 

superficial mature conidiomata releasing rosy-buff to salmon, later 

honey conidial slime; reverse dark brick in the centre, near the 

margin cinnamon to honey. Colonies on CHA 7–14 mm diam in 2 

wk (20–28 mm in 6 wk), with an irregular, buff margin covered by a 

diffuse, felty white, later grey aerial mycelium; further as on MEA, 

but the colony surface less elevated and especially near the margin 

with greyish felty to tufty aerial mycelium; conidial slime abundantly 

produced, first rosy-buff, later salmon to ochreous; reverse in the 

centre blood colour, dark brick to cinnamon at the margin. 

Conidiomata on OA see above. Conidia as in planta, mostly 

(0–)3–5(–6)-septate, 44–63(–70) × 2.5–3 µm. 

Hosts: Senecio fluviatilis and S. nemorensis. 

Material examined: Belgium, Château de Namur, on leaves of Senecio sarracenica, 

1829, A. Bellynck, isotype BR-MYCO 155500-09. Netherlands, Prov. Gelderland, 

Millingen a/d Rijn, Millingerwaard, on living leaves of S. fluviatilis, 6 Oct. 1999, G. 

Verkley 939, epitype designated here CBS H-21219 “MBT175358”, living cultures 

ex-epitype CBS 102366, 102381. 

Notes: The first Septoria that was described on the genus Senecio 

was S. senecionis. The type host is Senecio sarracenica (= 

Senecio fluviatilis), and in later literature it has also been reported 

from several other species of Senecio (Radulescu et al. 1973). 

According to the diagnosis by Westendorp, the conidia are 40 × 

1.5 µm and 3–4-septate. Vanev et al. (1997) described the conidia 

of S. senecionis as 2–6-septate, 29–68 × 2–2.5 µm, Radulescu 

et al. (1973) as 3–4-septate, 33–57 × 1.2–2 µm. By examining 

the type specimen from BR it is here confirmed that conidia are in 

fact wider than described by Westendorp. It contains a single leaf 

with a few lesions, and conidia observed are 30–55 × 1.5–2.5 µm, 

and mostly 3–5-septate. The fresh material that was collected in 

the Netherlands from the same host species, Senecio fluviatilis, 

and from which CBS 102366 and 102381 were isolated, is in 

sufficient agreement with the type and is therefore designated here 

as epitype of S. senecionis. Differences with Septoria putrida are 

discussed under that species. 

Septoria sii Roberge ex Desm., Pl. crypt. Fr., Fasc. 44, no 

2185; Annls Sci. Nat., sér. 3, Bot. 20: 92. 1853. Fig. 37. 

Description in planta: Symptoms leaf spots, yellow to brown, initially 

vaguely delimited but later well-delimited by veinlets, scattered, 

later often confluent over large areas, visible on both sides of the 

leaf. Conidiomata pycnidial, epiphyllous, rarely also hypophyllous, 

single, scattered or in small clusters, globose to subglobose, 

immersed, (60–)80–110 µm diam; ostiolum circular, central, 12.5– 

25(–35) µm wide, surrounding cells concolorous; conidiomatal wall 

composed of textura angularis 5–10 µm thick, with an outer layer of 

cells 3–4.5 µm diam with brown, thickened walls, and an inner layer 

of hyaline and thin-walled cells, 2.5–4 µm diam. Conidiogenous 

cells hyaline, broadly or elongated ampulliform, normally with 

a distinct neck, hyaline, holoblastic, proliferating percurrently, 

annellations indistinct, 5–8.5 × 3–5 µm. Conidia cylindrical, straight, 

curved, or flexuous, gradually attenuated to a relatively broadly 

rounded apex, more or less abruptly attenuated into a truncate 

base, 1–3(–4)-septate, slightly to distinctly constricted around the 

septa in the fresh, fully hydrated state, hyaline, containing one to 

several relatively large oil-droplets in each cell, in the rehydrated 

state with irregular oil-masses (20–)29–35(–42) × 2–2.5(–3) µm 

(living; rehydrated, 1.5–2 µm wide). Sexual morph unknown. 

Description in vitro: Colonies on OA 4–9 mm diam in 2 wk [(15–) 

19–23 mm in 6 wk], with an even, glabrous, colourless margin; 

colonies remaining almost plane, immersed mycelium olivaceousblack, 

locally however peach is dominant, which becomes scarlet 

after several wk; aerial mycelium mostly well-developed, woollyfloccose, 

white; scattered, mostly immersed pycnidial to stromatic 

conidiomata developing in the centre, releasing droplets of 

milky white to rosy-buff conidial slime; reverse dark slate blue to 

olivaceous-black, and locally peach, the pigment not diffusing into 

the medium. Colonies on CMA up to 1.5 mm diam in 2 wk [7–10 

(–25) mm in 6 wk], as on OA, but peach pigment diffusing into the 

medium, while the colony itself is predominantly olivaceous-black. 

Colonies frequently develop faster growing sectors that first are 

buff and sporulate directly from the mycelium, later become pale 

luteous with a distinct scarlet pigmentation and forming numerous 

mostly superficial pycnidia. Colonies on MEA 3–6 mm diam in 

2 wk [12–14(–26) mm in 6 wk], the margin ruffled, olivaceousblack; 

colony concolorous, irregularly pustulate-worty, covered by 

diffuse to dense felty white or greyish aerial mycelium; numerous 

conidiomatal initials developing at the surface, mature ones 

releasing cirrhi of conidia that first are milky white, later salmon, 

sometimes merging to form slimy masses covering areas of the 

colony surface; the agar surrounding the colony slightly discoloured 

by diffusing pigment(s). Colonies on CHA 5–6 mm diam in 2 wk 

[8–13(–15) mm in 6 wk], as on MEA; some parts of the colonies 

286


Fig. 37. Septoria sii. A–C. Colonies CBS 102370 (15 °C, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia and conidiogenous cells in planta (CBS H-21223). E. Ibid., on 

OA (CBS 102369). Scale bars = 10 µm. 

pale ochreous, tardily sporulating, releasing pale flesh to salmon 

droplets of conidial slime from superficial pycnidial conidiomata. 

Cultures sporulating with conidiogenous cells developing in 

(superficial) mycelial hyphae, solitary or in sequences, in addition 

to conidiomata. Conidiomata on OA pycnidial, single, dark brown 

to black, 80–185 µm diam, ostiolum single 30–60 µm diam, or 

stromatic without a differentiated opening and up to 220 µm diam; 

conidiogenous cells inside pycnidia as in planta but often with 

more elongated neck, holoblastic, percurrently proliferating one to 

several times with indistinct annellations, 7–12.5 × 3–6 µm. Conidia 

as in planta, 22–43 × 2.2–2.5 µm. 

Hosts: Sium latifolium, other Sium spp. and Berula erecta (syn. 

Sium erectum). 

Material examined: Netherlands, Prov. Friesland, Terschelling, ditch in polder S 

of Hoorn, on living leaves of Berula erecta, 19 Aug. 1995, H.A. van der Aa 12029, 

CBS H-18173, living culture CBS 118.96; same substr., Prov. Utrecht, ‘s Graveland, 

Kortenhoefse plassen, “Oppad”, 14 Oct. 1999, G. Verkley & H.A. van der Aa 945, 

CBS H-21223, living culture CBS 102369; same loc., substr., date, G. Verkley & H.A. 

van der Aa 946, CBS H-21222, living culture CBS 102370. 

Notes: The stout conidia with blunt apices and distinct constrictions 

around the septa (at least in the living, turgescent state) and the 

absence of sympodial proliferation in conidiogenesis distinguish this 

species from most other Septoria on Apiaceae here investigated, 

including S. apiicola. According to the original diagnosis, based on 

material from Sium latifolium in France, the conidia are 30–40 × 

2.5 µm. Most later authors have reported somewhat different size 

ranges; for example Teterevnikova-Babayan (1985) observed 

conidia 20–60 × 1–1.5 µm, Vanev et al. (1997) 20–41 × 1.5–2.2 µm, 

and Radulescu et al. (1973) reported 30–40 × 2–3 µm. The material 

available for this study proved homogeneous in morphology and 

genotype. The phylogenetic data indicate that this species is very 

closely related to S. mazi, a fungus occurring on Mazus japonica 

(Scrophulariaceae), but also to S. aegopodina on Aegopodium sp. 

(Apiaceae). The conidia of S. mazi morphologically resemble those 

of S. sii, but they are narrower and the septa normally indistinct 

[15–42 × 1.5–2(–2.5) µm, Shin & Sameva 2004]. 

Septoria sisyrinchii Speg., An. Mus. nac. Hist. nat. B. Aires, 

6: 324. 1899. Fig. 38. 

Description in planta: Symptoms leaf lesions developing in large 

areas of the leaf lamina that first turn yellow, indefinite, hologenous, 

pale to dark brown, appearing black due to numerous conidiomata. 

Conidiomata pycnidial, amphigenous, numerous, semi-immersed 

to immersed, subglobose to globose, black, 70–100(–120) µm 

diam; ostiolum central, circular, 15–35 µm wide, sometimes 

opening more widely, releasing white to pale yellowish cirrhi of 

conidial slime, surrounding cells concolourous or somewhat darker; 

conidiomatal wall 15–20 µm thick, composed of an outer layer of 

isodiametric cells 5–8 µm diam with brown, slightly thickened cell 

walls up to 1 μm thick, and an inner layer of globose to isodiametric 

cells 3–6 μm diam with thin, hyaline walls. Conidiogenous cells 

hyaline, discrete or integrated in 1-septate conidiophores up 15 

µm long, cylindrical, or ampulliform, holoblastic, proliferating 

sympodially, percurrent proliferations not observed, 5–10 × 2.5–3.5 

µm. Conidia cylindrical to cylindrical-filiform, slightly to strongly 

curved, sometimes flexuous, narrowly rounded to somewhat 



287


Fig. 38. Septoria sisyrinchii, CBS 112096. A–D. Colonies (15 °C, nUV). A. On OA. B. Ibid., reverse. C. On MEA. D. Ibid., detail of colony margin. E–G. Conidia on OA. Scale 

bars = 10 µm. 

the truncate base, (0–)1–3-septate, not constricted around 

the septa, hyaline, containing minute oil-droplets and granular 

material in the rehydrated state, (15.5–)20–30 × 1.5–2(–2.5) µm 

(rehydrated). Sexual morph unknown. 

Description in vitro (18 ºC, near UV): Colonies on OA 11–15 mm diam 

in 2 wk, with an even, buff margin; colonies restricted to spreading, 

immersed mycelium a mixture of luteous and saffron, the surface 

provided with a very diffuse, white fluffy to woolly aerial mycelium, 

which is denser in zones; reverse sienna; numerous conidiomata 

developing after 5–7 d especially in the centre, releasing milky 

white rosy-buff conidial slime. Colonies on MEA 10–14 mm diam 

in 2 wk, with a buff, minutely ruffled margin; colonies restricted, 

radially striate and somewhat elevated in the centre, the surface 

dirty greyish brown, soon covered by large masses ochreous to 

pale brown masses of conidia. Reverse chestnut to blood color, or 

brown-vinaceous. 

Conidiomata and conidiogenous cells as in planta. Conidia as 

in planta, mostly 18–35× 1.5–2.5 µm. 

Hosts: Sisyrinchum spp. 

Material examined: New Zealand, Auckland, Manurewa, Auckland Botanical 

Gardens, on leaf of Sisyrinchum sp., 28 Dec. 2002, C. F. Hill LYN 755, CBS 

H-21259, living culture CBS 112096. 

Notes: The material from Auckland agrees well with the original 

diagnosis of S. sisyrinchii, which was based on material from 

Sisyrinchium bonariense in Argentina. Conidia were described as 

0–3-septate, 15–24 × 2.5 µm. The multilocus phylogeny indicates 

that S. anthurii of the genus Anthurium (Araceae) is a closely 

related species (Fig. 2). 

Septoria stachydis Roberge ex Desm., Annls Sci. Nat., sér. 

3, Bot. 8: 19. 1847. Fig. 39. 

Description in planta: Symptoms leaf spots angular or irregular, 

greyish to yellowish brown, with a somewhat darker to black border. 

Conidiomata pycnidial, epiphyllous, rarely also hypophyllous, 

mostly 1–5 in each leaf spot, globose to subglobose, dark brown, 

semi-immersed, 65–100(–125) µm diam; ostiolum central, 

circular, 12–20 µm wide, later opening more widely up to 50 µm, 

surrounding cells somewhat darker; conidiomatal wall 12–18 µm 

thick, composed of angular and irregular cells 2.5–6 µm diam, 


cells with hyaline and thinner walls. Conidiogenous cells discrete, 

sometimes integrated into 1–septate conidiophores, hyaline, 

broadly ampulliform with a relatively narrow neck, holoblastic, 

proliferating percurrently with indistinct annellations, rarely also 

sympodially, 5–8(–10) × 2.5–3.5(–5) µm. Conidia filiform to filiformcylindrical, 

curved or irregularly bent, rarely straight or flexuous, 

with a narrowly rounded or somewhat pointed apex, with a truncate 

base, (0–)1–3(–5)-septate, not constricted around the septa, 


material in each cell in the living state, with inconspicuous oildroplets 

and granular contents in the rehydrated state, (17–)20– 

42 × 1–2 µm (living; rehydrated, 1–1.5 µm wide). Sexual morph 

unknown. 

Description in vitro: Colonies on OA 13–16 mm diam in 2 wk 

(V1049: 8–10 mm in 12 d, 16–18 mm in 3 wk; > 50 mm in 7 wk), 

with an even, glabrous, colourless margin; immersed mycelium 

mostly homogeneously coral after 2 wk, the centre of the 

colony already appearing almost black by numerous superficial 

and immersed pycnidia; olivaceous-black sectors with dark 

288


Fig. 39. Septoria stachydis. A–C. Colonies CBS 102337 (15 °C, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia in planta (CBS H-21226). E. Conidia in planta (CBS 

H-21175). F–I. Conidia on OA (CBS 123750). Scale bars = 10 µm. 

pigmented radiating sterile hyphae also present, later becoming 

more dominant, or sectors covered by salmon masses of conidia 

formed directly from mycelial hyphae; aerial mycelium absent; 

reverse concolorous, but blood colour in the centre, later mainly 

olivaceous-black or dark slate blue. Surface of the colony smooth. 

Pycnidia numerous after 2 wk, superficial or immersed, releasing 

salmon or rosy-buff droplets of conidial slime. Colonies on CMA 

8–12 mm diam in 2 wk (11–14 mm in 12 d, 14–24 mm in 3 wk), as 


289


on OA, but olivaceous-black sectors more dominant, sometimes 

colony almost entirely so. Colonies on MEA 8–10 (slow growing 

sectors) to 12–16 (fast growing sectors) in 2 wk (18–21 mm 

in 3 wk; 43–58 mm in 7 wk), with an even, glabrous, honey to 

buff margin; immersed mycelium very dark blood colour; centre 

of the colony rising high above the agar surface, cerebriform, 

covered by dirty ochreous conidial slime formed from separate 

or fused pycnidial conidiomata. Aerial mycelium in slow-growing 

sectors scanty, scattered minute tufts of white aerial mycelium, 

in faster growing sectors well-developed, dense, woolly-cottony, 

first white, later olivaceous-grey to glaucous grey, locally with a 

reddish discoloration; some colonies with a more homogeneous, 

olivaceous-black felty surface, sporulating after 3 wk in the centre, 

with superficial black pycnidial conidiomata releasing milky white 

masses of conidial slime. Colonies on CHA 12–18 mm in 2 wk 

(15–18 mm in 3 wk; 34–38 mm in 7 wk), with an even, glabrous, 

colourless margin; immersed mycelium greenish grey to dark slate 

blue, the outer zone covered by well-developed, tufty whitish grey 

aerial mycelium; reverse blood colour, but margin paler; in the 

central part of the colony numerous pycnidia develop, releasing 

pale vinaceous to rosy-buff conidial slime; in older colonies the 

centre becomes cerebriform, much as on MEA. 

Conidiomata (OA) immersed in the agar or on the agar surface, 

black, single, globose, 100–175 µm diam, or irregular, and merged 

into large complexes 190–350 µm diam, with relatively thick walls; 

ostiolum as in planta, or absent; Conidiogenous cells as in planta, 

but more often integrated in 1–3-septate conidiophores. Conidia as 

in planta, 22–47(–54.5) × 1–2 µm. 

Hosts: Stachys spp. 

Material examined: Austria, Tirol, Ober Inntal, Lawenwald near Serfaus, on living 

leaves of Stachys sylvatica, 8 Aug. 2000, G. Verkley 1049, CBS H-21175, living 

cultures CBS 109126, 109127. Czech Republic, Moravia, Veltice, Forest of 

Rendez Vous, on living leaves of Stachys sp., 16 Sep. 2008, G. Verkley 6008, CBS 

H-21253, living cultures CBS 123750, 123879. Netherlands, prov. Utrecht, Baarn, 

Kasteel Groeneveld, on living leaves of St. sylvatica, 7 July 1968, H.A. van der 

Aa 685, CBS H-18175, living culture CBS 449.68; prov. Gelderland, Wageningen, 

Binnenveld, on living leaves of Stachys sp., 23 July 1981, H.A. van der Aa 7952, 

CBS H-18176; prov. Gelderland, Winssen, Kasteel Doddendael, on living leaves 

of St. sylvatica, 9 Sep. 1999, G. Verkley 922, CBS H-21204, living cultures CBS 

102326, 102337; prov. Limburg, Gulpen, near Stokhem, on living leaves of St. 

sylvatica, 28 June 2000, G. Verkley 965, CBS H-21226, living cultures CBS 109005, 

109006. Romania, distr. Ilfov, pădurea Malu Spart, on living leaves of St. sylvatica, 

27 June 1971, G. Negrean & A. Voicu s.n., CBS H-18178, distributed in Herb. Mycol. 

Romanicum, fasc. 41, no. 2001; distr. Prahova, Sinaia, Valea Peleşului, on living 

leaves of St. sylvatica, 4 Sep. 1971, G. Negrean s.n., CBS H-18177, distributed in 

Herb. Mycol. Romanicum, fasc. 41, no. 2002. 

Additional material examined – Germany, loc. unknown, isol. Ziekler, living culture 

CBS 307.31, preserved as S. stachydis, identity uncertain. 

Notes: According to Jørstad (1965), the conidia of S. stachydis on 

Stachys sylvatica are 16–57 × 1–1.5(–2) µm, with a lowest maximum 

length for any collection of 32 µm. In the collections available for 

the present study, conidia are up to 42 µm in length in planta, and 

54.5 µm long in vitro. The species differs morphologically from S. 

stachydicola (Bubák. ex Serebrian.) Jacz., which occurs on the 

same host genus. Shin & Sameva (2004) gave a description of 

S. stachydicola, based on two collections of Stachys riederi var. 

japonica from Korea. According to these authors, the conidia of that 

species are 38–72 × 2–3 µm (3–7-septate), so longer and wider 

than those of S. stachydis. Also, the pycnidia are smaller in diam 

(40–80 µm) and ostioli much wider (20–36 µm) than in S. stachydis. 

CBS 128668 (= KACC 44796) is described by Quaedvlieg et al. 

(2013) as Septoria cf. stachydicola. This isolate, and also CBS 

128662 (=KACC 43871) are both distant from European isolates 

of S. stachydis. 

Septoria stellariae Roberge ex Desm., Annls Sci. Nat., sér. 

3, Bot. 8: 22. 1847. Fig. 40. 

? = Sphaeria isariphora Desm., Annls Sci. Nat., sér. 2, Bot. 19: 358. 1843. 

≡ Mycosphaerella isariphora (Desm.) Johanson, Öfvers. K. Svensk. 

Vetensk.-Akad. Förhandl. 41 (no. 9): 165. 1884. 

Description in planta: Symptoms indefinite white or pale yellow to 

pale brown leaf lesions on lower leaves of plants, often starting 

at the leaf margin, extending rapidly over the lamina and leading 

to complete withering of leaves and their petioles. Conidiomata 

pycnidial, brown, in dense groups on withering petioles and leaves, 

where mostly epiphyllous, only partly immersed in the host tissue, 

globose or lenticular, (85–)120–160(–210) µm diam; ostiolum 

circular, central, initially 20–35 µm wide, later opening to 80 µm diam, 

without distinctly differentiated cells; conidiomatal wall composed 

of textura angularis without distinctly differentiated layers, mostly 

15–25 µm thick, the outer cells with brown, somewhat thickened 

walls and 4.5–8 µm diam, the inner cells hyaline and thin-walled 

and 3.5–6.5 µm diam; conidiogenous cells lining the whole inner 

surface of the pycnidium. Conidiogenous cells hyaline, discrete or 

integrated in short simple, 1–2-septate conidiophores, cylindrical, 

or ampuliform to elongated ampulliform with a relatively short neck, 

hyaline, holoblastic, proliferating sympodially, 5–12(–15) × 2.5–4 

µm. Conidia cylindrical to filiform, weakly curved or abruptly bent 

in the lower cell, sometimes flexuous, gradually attenuated to the 

rounded apex, gradually or more abruptly attenuated into a broadly 


around the septa, hyaline, contents with several small guttulae and 

numerous granules in each cell in the living state, oil-droplets rarely 

merged into larger guttules in the rehydrated state, (21–)30–64 

(–70) × 1.5–2.5(–3) µm (living; rehydrated, 1–2 µm wide). 


even, glabrous, colourless margin; a yellow pigment diffusing into 

the agar beyond the margin; immersed mycelium mostly colourless 

to buff or saffron with scanty, whitish aerial mycelium, the centre 

of the colony darkened by numerous superficial and immersed, 

separate or confluent pycnidial conidiomata, releasing rosy-buff 

to salmon conidial slime; reverse pale luteous to saffron, but 

olivaceous-black in areas with numerous conidiomata. Colonies 

on CMA 3–6 mm diam in 2 wk, as on OA. Colonies on MEA 2–5 

mm diam in 2 wk, with an even, glabrous, colourless margin, 

locally with rapidly outgrowing hyphae forming superficial pycnidial 

conidiomata; colonies pustulate to hemispherical, the surface 

greenish grey to olivaceous-black covered by fairly dense greyish 

to saffron, woolly aerial mycelium; some superficial or immersed 

pycnidial conidiomata formed; reverse dark umber to blood colour. 

Colonies on CHA 4–8 mm diam in 2 wk, remaining almost plane, 

with an irregular margin; immersed mycelium greenish grey to 

dark slate-blue in the centre, buff near the margin; aerial mycelium 

well-developed, greyish to white, with a distinct flesh discoloration 

especially at the margin; reverse blood colour; abundant immersed 

and superficial pycnidial conidiomata formed, releasing a buff to 

saffron conidial slime. 

Conidiomata (OA) pycnidial and similar as in planta, single, 

100–250 µm diam, but more often merged into larger complexes, 

brown to olivaceous brown, and up to 350 µm diam; ostiolum as 

in planta, or absent. Conidiogenous cells hyaline, as in planta but 

290


Fig. 40. Septoria stellariae. A–D. Colonies CBS 102364. A, B. On OA. C. On CHA. D. On MEA. E. Conidia and conidiogenous cells on OA (CBS 102364). Scale bars = 10 µm. 

predominantly cylindrical, holoblastic, proliferating sympodially, 

rarely percurrently with indistinct annellations, 5–15(–22) × 2.5–4.5 

µm. Conidia similar as in planta, (0–)3–5-septate, not or indistinctly 

constricted around the septa, hyaline, contents with several small 

guttules and numerous granules in each cell, (20–)30–75(–84) × 

2–2.5(–3.0) µm. 

Hosts: Stellaria spp. and Myosoton spp. 

Material examined: Germany, Eifel, Gunderath, near Heilbachsee, on living 

leaves of Stellaria media, 22 June 1992, H.A. van der Aa 11341, CBS H-5333. 

Netherlands, Prov. Utrecht, Baarn, on leaves of S. media, 18 May 1985, H.A. van 

der Aa 9492, CBS H-18179; Prov. Noord-Holland, Laren, on leaves of S. media, 18 

Feb. 1967, H.A. van der Aa s.n., CBS H-18180; prov. Noord-Brabant, Valkenswaard, 

on withering leaves and stems of St. media, 1 May 1967 , H.A. van der Aa s.n., 

CBS H-18179; Ameland, Nes, on leaves of St. media, 27 May 1967 , H.A. van 

der Aa s.n., CBS H-18182; Prov. Gelderland, Landgoed Staverden, on withering 

leaves and petioles of St. media, 1 Aug. 1999, G. Verkley 901, CBS H-21156, living 

cultures CBS 102364, 102410; Prov. Limburg, Mook en Middelaar, St. Jansberg, 

near Plasmolen, on withering leaves and petioles of St. media, 9 Sept 1999, G. 

Verkley 933, CBS H-21157, living culture CBS 102378; Prov. Flevoland, Erkemeder 

strand, on withering leaves and petioles of St. media, 8 Sept 1999, G. Verkley 929, 

CBS H-21217, living culture CBS 102376; Prov. Flevoland, Ketelmeer, IJsseloog, 

on withering leaves and petioles of St. media, 22 May 2002, G. Verkley 1141, CBS 

H-21260. Romania, distr. Vîlcea, Muntele Cozia, Stîna Foarfeca, on living leaves of 

S. media, 14 Oct. 1976, G. Negrean s.n., CBS H-18183, distributed in Herb. Mycol. 

Romanicum, fasc. 60, no. 2990. 

Notes: This fungus is a weak pathogen of Stellaria media in the 

Netherlands, on which it is only seen under very humid conditions. 

Especially the lower parts of plants that are sheltered by the 

surrounding vegetation are affected. Jørstad (1965) observed 

conidia up to 82 µm in length on Stellaria crassifolia, and up to 96 

µm long on Stellaria media, the type host. It has also been reported 

from other Stellaria spp., and Myosoton (Radulescu et al. 1973, 

Vanev et al. 1997, Markevičius & Treigienė 2003). Septoria stellariae 

var. macrospora was originally described from the same host as 

S. stellariae, Stellaria media. According to Teterevnikova-Babayan 

(1987), conidia of this variety measure 50–120 × 2.5–4 µm. On 

fresh plant material studied here conidia longer than 70 µm were 

not observed, but the isolates obtained thereof did produce conidia 

up to 84 µm long. Sequence analyses of CBS 102376, 102378, 

and 102410 originating from three different localities showed no 

significant polymorphisms in the seven loci, indicating that material 

belongs to a single taxon. Whether the variety macrospora is 

tenable, is unclear at this point. We agree with Jørstad (1965), that 

the connection with the sexual morph Mycosphaerella isariphora 

suggested in the literature, requires confirmation. It is therefore 

listed as a tentative synonym of S. stellariae. 

Septoria urticae Roberge ex Desm., Annls Sci. Nat., sér. 3, 

Bot. 8: 24. 1847. Fig. 41. 

Description in planta: Symptoms leaf spots small, angular, often 

merging to irregular patterns, initially pale yellowish brown, 

partly becoming dark greyish brown later, with a dark border. 

Conidiomata pycnidial, epiphyllous, several in each leaf spot, 

subglobose to lenticular, pale brown, usually fully immersed, 

70–120 µm diam; ostiolum central, initially circular and 30–45 


surrounding cells concolorous to pale brown; conidiomatal wall 

about 10–17 µm thick, composed of a homogenous tissue of 

hyaline, angular cells 2.5–6.5 µm diam, the outermost cells pale 

yellowish brown with somewhat thickened walls, the inner cells 

thin-walled. Conidiogenous cells hyaline, mostly discrete, narrowly 

or broadly ampulliform with a relatively narrow neck, holoblastic, 


291


Fig. 41. Septoria urticae, epitype. A. Conidia and 

conidiogenous cells in planta (CBS H-21221). B. Ibid., 

on OA (CBS 102371). Scale bars = 10 µm. 

often first proliferating sympodially, and later also percurrently 1– 

several times with distinct annellations, 6–12(–16) × 4–5.5(–7) 

µm. Conidia cylindrical, straight or slightly curved, flexuous, or 

irregularly bent, with a narrowly rounded apex, attenuated towards 

the narrowly truncate base, (0–)1–5(–7)-septate, not constricted 

around the septa, hyaline, contents with several oil-droplets and 

granular material in each cell in the living state, with inconspicuous 

oil-droplets and granular contents in the rehydrated state, (18–) 

30–57(–75) × 2– 3 µm (living; rehydrated, 2–2.5 µm wide). Sexual 


Description in vitro: Colonies on OA 6–7 mm diam in 2 wk (19– 

22 mm in 6 wk), with an even, glabrous, red to coral margin, the 

pigment also clearly diffusing beyond the margin; colonies almost 

plane, immersed mycelium near the margin red, in the centre very 

dark, blood colour to black, also due to mostly superficial pycnidial 

conidiomata releasing pale flesh droplets of conidial slime; white, 

felty aerial mycelium scanty, mostly only just behind the margin; 

reverse concolorous. Colonies on CMA 4-6 mm diam in 2 wk (16– 

17 mm in 6 wk), as on OA. Colonies on MEA 6–7(–9) mm diam in 

2 wk [20–22(–28) mm in 6 wk], with an even, buff to very pale flesh 

plane marginal zone; the pigment diffusing into the medium; colony 

often hemispherical with an irregularly pustulate-worty surface, 

immersed mycelium very dark chestnut to black, aerial mycelium 

absent, except in faster growing sectors, which are entirely covered 

by a dense, felty mat of reddish aerial mycelium; superficial pycnidial 

conidiomata releasing dirty white to flesh droplets of conidial slime. 

Colonies on CHA 4–6 mm diam in 2 wk (17–22 mm in 6 wk), as 

on MEA, but with an initially ruffled (later more even), rather dark 

margin and more numerous conidiomata producing flesh droplets 

of conidial slime. 

Conidiomata (OA) pycnidial, pale brown to dark brown, 

glabrous, 100–230 µm diam, with a single ostiolum as in planta, 

or ostioli barely differentiated; conidiogenous cells as in planta, 

but more often integrated in 1–2-septate conidiophores, often only 

proliferating percurrently with distinct annellations on an elongated 

neck, 6–14 × 3–7.5 µm; conidia cylindrical, straight or slightly 

curved, tapering to a rounded apex, lower part attenuated into a 

broad truncate base, 1–7(–9)-septate, not constricted around the 

septa, hyaline, with several minute oil-droplets and numerous 

granulae in each cell, (34–)40–70(–90) ×2.5–3(–3.5) µm. 

Hosts: Urtica spp. and Glechoma hederacea. 

Material examined: Netherlands, Prov. Utrecht, Soest, Overhees, on living leaves 

of Glechoma hederacea, in leaf spots associated with Puccinia glechomatis, 8 Aug. 

1999, G. Verkley 904, CBS H-21197, living culture CBS 102316; Prov. Utrecht, ‘s 

Graveland, Kortenhoefse plassen, “Oppad”, on living leaves of Urtica dioica, 14 Oct. 

1999, H.A. van der Aa & G. Verkley 947, epitype designated here CBS H-21221 

“MBT175359”, living cultures ex-epitype CBS 102371, 102375. 

292


Fig. 42. Septoria verbenae. A. Conidia and conidiogenous cells in planta 

(CBS H-21241). B. Conidia on OA (CBS 113438). Scale bars = 10 µm. 

Notes: Muthumary (1999) provided a description and illustration 

of type material of S. urticae (PC 1309). Because there are only 

insignificant differences between his observations of the type and 

those observed here in the Dutch collection on the same host, Urtica 

dioica, the latter is selected as epitype. Muthumary reported ostioli 

20–40 µm wide, while in the Dutch material the ostioli eventually 

open up further to about 80 µm wide. Muthumary observed 

conidia 35–50 × 2–2.5 µm with 3–4 septa, but other authors have 

found that conidia in planta can be much longer and have more 

septa. Jørstad (1965) found that conidia in Norwegean material 

on U. dioica were 22–81 × 1–1.5 µm, with up to 6 septa. Priest 

(2006), who studied material on U. insidia and U. urens in Australia 

reported conidia (26–)35–50(–70) × 1.5–2 µm, 3–5-septate. The 

present study shows that in vitro conidia can even be up to 90 

µm long in this species. The material from Glechoma hederaceae 

sporulating in association with the rust Puccinia glechomatis, 

proved morphologically in good agreement with that on Urtica 

dioica, and since it is also genetically similar to the material from 

that host, it is regarded conspecific. Other Septoria species have 

also occasionally been found in association with rust sori, viz., S. 

lagenophorae, which is regarded to be a hyperparasite of rusts, 

and occasionally also other leaf-spotting fungi (Priest 2006). 

According to Muthumary, the conidiogenous cells of S. urticae 

each produce a solitary terminal conidium and often also proliferate 

sympodially. It is established here that S. urticae is also capable 

of proliferating percurrently, and that this mode of proliferation is 

more frequent in pure culture. In contrast, Priest (2006) observed 

conidiogenous cells that first produced a conidium holoblastically, 

and subsequent conidia enteroblastically at the same level from a 

narrow conidiogenous locus, viz. like in phialidic conidiogenesis. It is 

unclear whether this is truly phialidic conidiogenesis, or just cryptic 

percurrent proliferation as observed in S. chrysanthemella, where 

the scars of the subsequent secessions are indistinguishable due 

to the limitations in the resolution of the light microscope (Verkley 

1998a). 

Septoria verbenae Roberge ex Desm., Annls Sci. Nat., sér. 

3, Bot., 8: 19. 1847. Fig. 42. 

Description in planta: Symptoms stem lesions and leaf spots small, 

angular to irregular, and merging to elongated areas, initially red to 

purplish red, then becoming pale in the centre with a darker border. 

Conidiomata pycnidial, epiphyllous, one to a few in each lesion, 

globose, dark brown, immersed, 70–140 µm diam; ostiolum central, 

circular, 25–40 µm wide, surrounding cells dark; conidiomatal wall 

about 12.5–20 µm thick, composed of a homogenous tissue of 

textura angularis with hyaline cells 2.5–7.5 µm diam, the outermost 

cells mid brown with somewhat thickened walls, the inner cells 

thin-walled and pale yellowish brown. Conidiogenous cells hyaline, 

discrete, or integrated in 1–2-septate conidiophores, narrowly 


293


ampulliform to almost cylincrical, often with a relatively narrow neck, 

holoblastic, first proliferating sympodially, and in some cells later 

also percurrently 1–several times with indistinct annellations, 12– 

18(–20) × 2.5–6 µm. Conidia cylindrical, straight or slightly curved, 

flexuous, with a narrowly rounded to somewhat pointed apex, 

attenuated towards the narrowly truncate base, (1–)3(–5)-septate, 

not constricted around the septa, hyaline, contents with several oildroplets 



state, (22–)16–48 × (1–)1.5–2 µm (rehydrated). Sexual morph 

unknown. 

Description in vitro: Colonies on OA 10–13 mm diam in 2 wk, 

with an even, colourless margin; colonies restricted to spreading, 

immersed mycelium citrine to grey-olivaceous, locally soon darker 

radiating strands occur, glabrous but in the centre of colonies, 

where irregular elevations are formed, covered by well-developed, 

grey to white finely felted aerial mycelium; reverse greenish grey 

to olivaceous-black. Conidiomata developing immersed or on the 

agar surface after 10–2 wk. Colonies on MEA 10–13 mm diam in 2 

wk, with a slighlty ruffled, buff to amber margin; colonies restricted, 

irregularly pustulate, the surface entirely covered by a low, dense 

mat of whitish to grey finely felted aerial mycelium; reverse dark 

brown to almost black, locally fulvous to sienna. No sporulation 

observed. 

Conidia (OA) filiform to cylindrical, typically weakly to strongly 

curved, sometimes straight or flexuous, attenuated gradually to 

a somewhat pointed apex, attenuated gradually or more abruptly 

to the narrowly truncate to almost rounded base, hyaline, with 

granular contents and minute oil droplets, (1–)3–5(–7)-septate, 

(22–)28–46(–54) × 1.5–2(–2.5) µm. 

≡ Cylindrosporium pseudoplatani (Roberge ex Desm.) Died., Annls 

mycol. 10: 486. 1912. 

= Sphaerella latebrosa Cooke, Handb. Brit. Fungi 2: no. 2754. 1871. 

≡ Mycosphaerella latebrosa (Cooke) J. Schröt., in Cohn, Krypt.-Fl. 

Schlesien (Breslau) 3.2(3): 334. 1894 [1908]. 

≡ Carlia latebrosa (Cooke) Höhn., Hedwigia 62: 73. 1920. 

= Septoria seminalis var. platanoidis Allesch., Hedwigia 35: 34. 1896. 

≡ Cylindrosporium platanoidis (Allesch.) Died., Annls mycol. 10(5): 486. 

1912. 

= Septoria epicotylea Sacc., Malpighia 11: 314. 1897. 

= Phloeospora pseudoplatani Bubák & Kabát in Bubák, Sber. K. böhm. Ges. 

Wiss., Math.-naturw, Kl., 7: 16. 1903. 

Description in planta: Symptoms small (0.2–0.5 mm diam), circular 

to angular, hologenous reddish brown leaf spots. Conidiomata 

acervular, epi- or hypophyllous, one to a few in each leaf spot, 

pale brown (drying dark brown), 105–180(–220) µm diam, 

releasing conidia in white columnar masses; conidiomatal wall 

Host: Verbena officinalis. 

Material examined: New Zealand, North Isl., Northland, Bay of Islands area, 

Manawaora along roadside, on living leaves of Verbena officinalis, 30 Jan. 2003, G. 

Verkley 2017, CBS H-21240; same loc., date, on stems of V. officinalis, G. Verkley 

2023, CBS H-21241, living culture CBS 113438, 113481. 

Notes: Priest (2006) gave a detailed description based on a collection 

from New South Wales, Australia [conidia (1–)3-septate, 26–48 

× 1.5(–2) µm]. The two strains available proved morphologically 

similar. These New Zealand strains proved to have identical Act, 

Btub, Cal, EF, and RPB2 sequences, distinct from other Septoria. 

Sphaerulina 

Type species: Sphaerulina myriadea (DC.) Sacc., Michelia 1 : 399. 

1878. 

Quaedvlieg et al. (2013, this volume) provide a description based 

on the sexual morph and treat several additional species with 

septoria-like asexual morphs. 

Sphaerulina aceris (Lib.) Verkley, Quaedvlieg & Crous, 

comb. nov. MycoBank MB804473. Fig. 43. 

Basionym: Ascochyta aceris Lib., Pl. crypt. Ard., Cent. 1: no. 54. 

1830. 

≡ Septoria aceris (Lib.) Berk. & Broome, Ann. Mag. Nat. Hist. Ser. 2, 5: 

379. 1850. 

≡ Phloeospora aceris (Lib.) Sacc., Syll. Fung. 3: 577. 1884. 

= Septoria pseudoplatani Roberge ex Desm., Annls Sci. Nat., sér. 3, Bot. 8: 

21. 1847. 

Fig. 43. Sphaerulina aceris. A, B. Colonies CBS 183.97. A. On OA. B. On MEA. C, 

D. Conidia in planta (CBS H-21239). Scale bars = 10 µm. 

294


Fig. 44. Sphaerulina cornicola. A–C. Colonies CBS 102324. A. On OA. B. On CHA. C. On MEA. 

mainly consisting of a basal 15–25(–35) µm thick layer of angular 

to subglobose, subhyaline to pale brown cells 5–10 µm diam, 

lateral wall absent or very poorly developed, composed of similar, 

somewhat darker cells. Conidiogenous cells hyaline, discrete or 

integrated in 1(–2)-septate conidiophores, subglobose, doliiform 

or ampulliform, holoblastic, proliferating percurrently with one to 

several disctinct annellations, or sympodially, sometimes both 

types of proliferation occur in a single conidiogenous cell, 8–15 

(–20) × 2.5–4 µm. Conidia cylindrical, straight or more or less curved, 

attenuated gradually to a broadly rounded apex, attenuated more 

or less abruptly to a truncate base, (1–)3-septate, conspicuously 

constricted around the septa in fresh and rehydrated state, hyaline, 

contents with numerous minute oil-droplets and granular material 

in each cell in the living state, with minute oil-droplets and granular 

contents in the rehydrated state, (32–)37–47(–50) × 3–4 µm (living; 

rehydrated, 2–3 µm wide). 

Description in vitro. Colonies on OA 3–4 mm diam in 2 wk, with a 

undulating even margin; colonies restricted, irregularly pustulate, 

the surface buff or much darker grey to brown, locally glabrous 

but mostly covered by a dense mat of finely felted white aerial 

mycelium, conidiomata developing on the surface releasing conidia 

in clear droplets, or in milky white to rosy-buff masses; reverse 

dark greyish or brown-vinaceous. Colonies on MEA 3–4(–8) mm 

diam in 2 wk, with a undulating even margin; colonies restricted, 

irregularly pustulate, the surface almost black provided with low 

and finely felted, diffuse, grey to white aerial mycelium, conidiomata 

developing just beneath the colony surface, releasing white cirrhi 

of conidia; reverse a palet of brown-vinaceous, cinnamon and 

olivaceous-grey. 

Conidia (OA) as in planta, (31–)34–50(–58) × 3.5–5 µm. 

Microconidia (spermatia of the Asteromella state) ellipsoid, hyaline, 

0-septate, 3–4 × 1.5 µm. 

Hosts: Acer campestre, A. circinatum, A. hyrcanum (Vanev et al. 

1997) and A. pseudoplatanus. 

Material examined: France, locality unknown, on leaves of Acer campestre, 

distributed in Libert, Pl. Cryptog. Ard. Fasc. 1 (1830): no. 54, isotype BR–MYCO 

153858-16, type of Ascochyta aceris Lib. Netherlands, prov. Utrecht, Baarn, on 

Acer pseudoplatanus, July 1969, I. Blok, living culture CBS 514.69; Baarn, garden 

WCS, on living leaves of Acer pseudoplatanus, 23 July 1985, H.A. van der Aa 

9537, CBS H-14666, living culture CBS 652.85; same substr., prov. Zuid-Holland, 

Wassenaar, Hollandsch Duin, 14 Aug. 1994, G. Verkley 227, CBS H-18040, living 

culture CBS 687.94; same substr., prov. Zuid-Holland, Wassenaar, Ganzenhoek, 8 

Aug. 1995, G. Verkley 307, CBS H-21239, living culture CBS 187.96; same substr., 

prov. Utrecht, Baarn, Eemnesserweg, 7 May 1996, H.A. van der Aa 12120, CBS 

H-14665, living culture CBS 183.97; USA, Oregon, Lane Co., Proxy Falls Trail, on 

living leaves of Acer circinatum, 11 Oct. 1996, J. K. Stone & G. Verkley 480, CBS 

H-21236, living culture CBS 655.97. 

Notes: This is the oldest septoria-like species described from 

members of the family Aceraceae. It occurs on several species 

of the genus Acer. In the original diagnosis of Libert, three host 

species were mentioned, viz., A. campestre, A. pseudoplatanus 

and A. platanoides. Jørstad (1965) treated forms on A. platanoides 

with conidia 26–60 × 2–2.5 µm as S. apatela All. (synonyms S. 

seminalis var. platanoidis All., Phleospora platanoidis Kabát & 

Bubák, Phloeospora samarigena Bubák & Krieg.), while those on A. 

campestre remained unsettled. According to Jørstad (1965) conidia 

of S. aceris are 24–43 × 2–3 µm, with 3 septa, which agrees well 

with the sizes observed in the type specimen available in the present 

study. This material also showed a small proportion of 4-septate 

conidia in one of the fruitbodies. More species with conidia longer 

than 60 µm have been described from A. platanoides, and these 

need to be critically assessed in a comprehensive study including 

isolates of all Septoria occurring on the genus Acer. No isolates 

from the the type host A. campestre that would be most suitable 

as epitype, were available, hence no epitypification is proposed 

here. The ultrastructure of conidiogenesis and conidia of S. aceris 

was studied by Verkley (1998b), who showed that in a single cell 

percurrent as well as sympodial proliferation can occur. 

A description of the sexual morph known as Mycosphaerella 

latebrosa was provided by Kuijpers & Aptroot (2002), but their 

species concept included several discrete entities that are 

distinguishable by their conidial states and occur on distantly related 

host plants. It is unlikely that these entities can be distinguished 

at all by the morphology of the sexual state (Verkley & Starink- 

Willemse 2004). 

Sphaerulina cornicola (DC.: Fr.) Verkley, Quaedvlieg & 

Crous, comb. nov. MycoBank MB804474. Fig. 44. 

Basionym: Depazea cornicola DC.: Fr., in De Candolle & Lamarck, 

Flore Française VI: 146. 1815. 

≡ Septoria cornicola (DC.: Fr.) Desm., Pl. crypt. Fr., Fasc. 7, no 342. 

1828; Index Pl. crypt. Fr.: 24. 1851. 

= S. cornicola var. ampla H. C. Greene, Amer. Midl. Nat. 41: 755. 1949 (fide 

Farr 1991). 

For extended synonymy see Farr (1991). Neotype on Cornus 

sanguinea, France (BPI, designated by Farr 1991), not seen. 

Description in planta: Symptoms starting as red discolorations of 

the leaf lamina and margin, which develop to scattered, circular 

to irregular, hologenous leaf spots, that later become pale brown, 

and surrounded by a dark brown to black bordering zone and a 

distinct red or purple periphery. Conidiomata pycnidial, epiphyllous, 

numerous scattered in each leaf spot, subglobose to globose, 

brown to black, immersed or semi-immersed, 55–100(–120) µm 

diam; ostiolum central, initially circular and 25–40 µm wide, later 


concolorous to pale brown. Conidiomatal wall about 10–15 µm 

thick, composed of a outer layer of hyphal to irregular cells 3.0–8 µm 

diam with brown walls, and an inner layer of hyaline cells 3–5 µm 


295


diam; Conidiogenous cells hyaline, discrete, doliiform, or narrowly 

to broadly ampulliform, holoblastic, proliferating sympodially, 

sometimes also percurrently with indistinct annellations, 5–12.5(– 

15) × 3–4(–8) µm. Conidia cylindrical, regularly curved, attenuated 

gradually to a rounded or somewhat pointed apex and a narrowly 

truncate base, (0–)1–3(–5)-septate, distinctly constricted around 

the septa only in the fresh state, hyaline, contents with several 

minute oil-droplets and granular material in each cell in the living 

state, with amorphous material and granular contents in the 

rehydrated state, (20–)24–40 × 3–4 µm (living; rehydrated, 2–3 

µm wide). Sexual morph unknown. 

Description in vitro: Colonies on OA 4–7mm diam in 2 wk (12– 

16 mm in 6 wk), with an even, glabrous, buff margin; colonies 

spreading, the surface first plane, then somewhat pustulate, 

immersed mycelium a mixture of fawn and rosy-buff tinges, locally 

darker olivaceous, the surface largely covered by a rosy-buff to 

vinaceous buff masses or a film of conidial slime produced directly 

by the mycelium; reverse rosy-buff with isabelline to hazel areas, 

later darker in the centre. Colonies on CMA 3–4 mm diam in 2 wk 

(8–12 mm in 6 wk), as on OA. Colonies on MEA 4.5–7 mm diam 

in 2 wk (9–14(–16) mm in 6 wk), restricted, the entire surface of 

the colony regularly cerebriform with large masses of conidial 

slime (also covering the margin), first salmon, later darkening to 

ochreous or umber, eventually even chestnut; reverse sienna to 

bay. Colonies on CHA 4–6 mm diam in 2 wk (11–14 mm in 6 wk), 

as on MEA. 

Conidia (OA) as in planta, but showing secondary conidiation, 

1–8(–16)-septate, conidia germinating from intermediate 

cells (laterally) or the basal cells (axially) to form new conidial 

fragments of variable length, or branched complexes, rendering a 

heterogeneous mixture. 

Host: Cornus sanguinea. 

Material examined: Germany, Baden-Württemberg, Kussa-Rheinheim, 3 Sep. 1999, 

A. Aptroot 46371, CBS H-21191. Netherlands, Prov. Noord Brabant, Eindhoven, 

Milieu- & Educatiecentrum Eindhoven, on living leaves of Cornus sanguinea, 4 Sep. 

1999, A. van Iperen (G. Verkley 918), CBS H-21237, living cultures CBS 102324, 

102332; same substr., prov. Limburg, Gulpen, near Stokhem, 28 June 2000, G. 

Verkley 963, CBS H-21238. USA, Maryland, Prince Georges Co., on C. sanguinea, 

14 Sep. 2004, A. Y. Rossman 4089 (BPI), living culture CBS 116778. 

Notes: The material examined has the typical conidia of Sphaerulina 

cornicola, agreeing with those described by Farr (1991). Septoria 

cornina can be distinguished from Sphaer. cornicola by more 

variously curved, most commonly hooked, falcate or lunate conidia 

(23–)32–90(–110) × 2–4(–5) µm with rounded apex (Farr 1991, 

Shin & Sameva 2004). The phylogenetic relationship with S. 

cornina remains to be clarified. 

Sphaerulina frondicola (Fr.) Verkley, Quaedvlieg & Crous, 


Basionym: Septoria populi Desm, Annls Sci. Nat., sér 2, Bot., 19: 

345. 1843. nom. nov. pro Depazea frondicola Fr., Observationes 

mycologicae, 2: 365, t. 5: 6–7. 1818. 

≡ Sphaeria frondicola (Fr.) Fr., Syst. Mycol. 2: 529. 1822. 

= Sphaerella populi Auersw., in Gonnermann & Rabenhorst, Mycol. eur. 

Abbild. Sämmtl. Pilze Eur. 5–6: 11 .1869. 

≡ Mycosphaerella populi (Auerw.) J. Schroet., in Cohn, Krypt.-Fl. 

Schlesien (Breslau) 3.2 (3): 336. 1894. 

Description in vitro (CBS 391.59): Colonies on OA 3–5 mm diam 

in 2 wk, with an even or slightly ruffled, colourless, glabrous 

margin; colonies restricted and up to 2 mm high after 2 wk, 

immersed mycelium mostly olivaceous to dark herbage green, 

with moderately developed, greyish white, woolly-floccose aerial 

mycelium; numerous large, simple or complex, olivaceous to 

reddish brown stromatic conidiomata formed that open widely 

to release masses of rosy-buff conidial slime; reverse mostly 

olivaceous-black. Colonies on MEA 2–3(–4) mm diam in 2 wk, 

with a ruffled, buff, glabrous margin; colonies restricted, up to 2 

mm high, irregularly pustulate, the surface appearing dark brown 

to black, but with numerous hemispherical stromata at the surface 

which are fawn to vinaceous brown, some of which start sporulating 

directly from the surface forming masses of rosy-buff conidial slime 

after 2 wk; aerial mycelium scarce, locally denser, white; reverse 

almost black. Colonies on CHA 4–6 mm diam in 2 wk, with an even, 

rosy-buff margin covered by pure white, woolly aerial mycelium; 

colonies restricted, up to 2 mm high, immersed mycelium entirely 

hidden under a dense mat of pure white, high, woolly aerial 

mycelium; reverse brown-vinaceous in the centre, surrounded by 

a rosy-buff to buff marginal zone.Conidiomata not well-developed. 

Conidiogenous cells observed holoblastic, some cells with a single 

percurrent proliferation. Conidia showing signs of degeneration. In 

addition, cylindrical to dumpbell-shaped spermatia or microconidia, 

(5.5–)7.5–13.5(–14.5) × 1.2–1.7 mm, are formed from phialides in 

the same fruitbodies. 

Host: Populus pyramidalis. 

Material examined: Germany, Berlin-Kladow, on living leaves of Populus 

pyramidalis, Dec. 1959, R. Schneider s.n., BBA 8987, CBS H-18150, living culture 

CBS 391.59 

Notes: CBS 391.59 groups in a subclade of the Sphaerulinaclade 

(Fig. 2), that was named after the type species Sphaerulina 

myriadea that resides in it (Quaedvlieg et al. 2013). Closest relatives 

are the other poplar pathogens Sphaer. populicola (syns Septoria 

populicola Peck, Mycosphaerella populicola, CBS 100042) and 

several isolates of Sphaer. musiva (synonyms Septoria musiva, 

Mycosphaerella populorum). CBS 391.59 now only develops 

atypical sporulating structures not described in detail here. 

Sphaerulina gei (Roberge ex Desm.) Verkley, Quaedvlieg & 

Crous, comb. nov. MycoBank MB804475. Fig. 45E–G. 

Basionym: Septoria gei Roberge ex Desm., Annls Sci. Nat., sér. 2, 

Bot. 19: 343. 1843. 

Description in planta: Symptoms leaf lesions irregular, greyish 

brown, well-delimited by a dark brown line, surrounding leaf tissue 

often yellowish; Conidiomata pycnidial, amphigenous though 

predominantly epiphyllous, numerous in each lesion, subglobose 

to cupulate, brown to black, 35–80 µm diam; ostiolum central, 

circular, initially 35–60 µm wide, later becoming more irregular and 

up to 80 µm wide, surrounding cells dark brown; conidiomatal wall 

10–15 µm thick, composed of a homogenous tissue of hyaline, 

angular cells 2.5–6.5 µm diam, the outermost cells pale brown with 

slightly thickened walls, the inner cells thin-walled. Conidiogenous 

cells hyaline, discrete, rarely also integrated in 1–2-septate 

conidiophores, cylindrical or narrowly to broadly ampulliform, 

holoblastic, often with a relatively narrow and elongated neck, 

proliferating percurrently several times with distinct annellations, 

rarely also sympodially, 6–10(–15) × 3.5–5(–6) µm. Conidia filiform, 

slightly curved to flexuous, rarely straight, narrowly rounded at the 

apex, narrowly truncate at the base, (0–)2–5(–8)-septate (septa 

296


Fig. 45. A–D. Sphaerulina hyperici. A–C. Colonies CBS 102313. A. On OA. B. On CHA. C. On MEA. D. Conidia and conidiogenous cells in planta (CBS H-21194, epitype). 

E–G. Sphaerulina gei. E. Colony on OA (KACC 44051 = CBS 128632). F. Conidia and conidiogenous cells in planta (CBS H-21194, epitype). G. Ibid., on OA (CBS 102318). 


very thin and easily overlooked), not constricted around the septa, 


material in each cell in the living state, with minute oil-droplets and 

granular contents in the rehydrated state, 33–65(–75) × 2–2.8(–3) 

µm (living; rehydrated, 1.8–2.5 µm wide). Sexual morph unknown. 

Description in vitro: Colonies on OA 6–8(–15) mm diam in 3 wk, with 

an even, glabrous, colourless to buff margin; colonies spreading, 

immersed mycelium at first buff to rosy-buff, tardily becoming 

olivaceous to olivaceous-black, occassionally some sectors 

remaining buff; aerial mycelium mostly wanting, but sometimes with 

a few greyish tufts, the surface of the colony centre soon covered by 

rosy-buff masses of conidial slime, produced from conidiogenous 

cells directly on the mycelium or in pycnidial conidiomata; reverse 

olivaceous-black, margin buff. Colonies on CMA 7–9 mm diam in 

3 wk, as on OA, but green pigmentation developing more rapidly. 

Colonies on MEA 7–9(–11) mm diam in 3 wk, with an irregular, 

glabrous, rosy-buff margin; a reddish pigment diffusing into the 

agar; colony spreading to restricted, the surface cerebriform to 

irregularly lobed, up to 2 mm high, very dark, but locally covered 

either by grey, felted aerial mycelium or masses of salmon conidial 

slime, produced directly from hyphae or in superficial stromatal 

conidiomata; reverse rust to chestnut. Colonies on CHA 6–7(–10) 

mm diam in 3 wk, colony features and sporulation as on MEA, but 

the margin covered by whitish aerial mycelium; diffusing pigment 

also present. Sporulating structures on OA very similar to those in 

planta, but conidia up to 85 µm long. 

Hosts: Geum spp. 

Material examined: Czech Republic, Bohemia, near Tábor, on living leaves 

of Geum urbanum, 20 July 1903, F. Bubák, distributed in Kabát & Bubák, Fungi 

imperfecti exsicc. 114, PC 0084558. France, Caen, on living leaves of G. urbanum, 

“Col. Desmazieres 1863, no. 8, 58”, “Jun-Sep. 1842”, isotype PC 0084556; forest 

near Caen, on living leaves of G. urbanum, 1841, Roberge, PC 0084555. Germany, 

Brandenburg, Buchmühle near Lagow, on living leaves of G. urbanum, 10 Sep. 

1909, P. Sydow, PC 0084559. Korea, Hoengseong, on living leaves of G. japonicum, 

H.D. Shin, living culture CBS 128616 = KACC 43029 = SMKC 22748; same substr., 

Pyeongchang, H.D. Shin, living culture CBS 128632 = KACC 44051 = SMKC 23686. 

Latvia, prov. Vidzeme, Kr. Riga, Ogre, on living leaves of G. urbanum, 19 July 1936, 

J. Smarods, PC 0084557. Netherlands, Prov. Limburg, Schimperbosch, SW of 

Vaals, on the same substr., 29 Aug. 1999. H.A. van der Aa s.n., CBS H-21168; Prov. 

Noord Holland, Amsterdamse Waterleidingduinen, Panneland, on living leaves of 

G. urbanum, 31 Aug. 1999, G. Verkley & A. van Iperen 914, epitype designated 

here CBS H-21167 “MBT175360”, living culture ex-epitype CBS 102318. Romania, 

distr. Prahova, Muntenia, Cheia, on living leaves of G. rivale, T. Săvulescu & C. 

Sandhu, distributed in Săvulescu, Herb. Mycol. Romanicum 8, 377, PC 0084560. 

Sweden, Gotland, Endre parish, Hulte, on living leaves of G. urbanum, 16 July 

1898, T. Vestergren, PC 0084561. 


297


Notes: The type material from PC studied contains one leaf showing 

the typical symptoms, and although only old empty fruitbodies 

were observed in it, it is almost certain that these are the product 

of this well-known and common “Septoria” species. The other 

material studied here was in much better condition and proved 

highly homogeneous in both symptoms and morphology of the 

sporulating structures, including the collection from Geum rivale, 

with most conidia observed below 70 µm long. Some authors found 

conidia up to about 75 µm long in various European collections 

(Jørstad 1965, Vanev et al. 1997). In the fresh material from The 

Netherlands, conidia were no longer than 65 µm on the host plant, 

but the isolates obtained from it produced conidia up to 85 µm long. 

This material is chosen here to epitypify Sphaer. gei because it is 

geographically the closest one for which also a culture is available. 

Several authors have recognised Septoria gei f. immarginata 

for material on Geum urbanum with smaller conidia, viz. Radulescu 

et al. (1973), reporting conidia as continuous, 33–56 × 1.1–1.5 µm 

(in majority 40–46 × 1.5 µm), and Teterevnikova-Babayan (1983), 

reporting 20–33 × 1.5 µm. Shin & Sameva (2004) considered this 

forma a synonym of S. gei, for which they noted the wide range of 

conidial sizes. In Asian collections identified as S. gei the conidia 

appear to be longer than in material from elsewhere (Shin & Sameva 

2004), but the Korean isolates included here are genetically very 

close to the ex-epitype strain CBS 102318, and regarded as 

conspecific. Sequence analyses of the cultures of Sphaer. gei 

indicate a close relationship with species such as Sphaer. patriniae 

(CBS 128653, 129153), from Patrinia scabiosaefolia and P. villosa 

(Valerianaceae) and Sphaer. cercidis (Quaedvlieg et al. 2013). 

Sphaerulina hyperici (Roberge ex Desm.) Verkley, 

Quaedvlieg & Crous, comb. nov. MycoBank MB804476. Fig. 

45A–D. 

Basionym: Septoria hyperici Roberge ex Desm., Annls Sci. Nat., 

sér. 2, Bot.17: 110. 1842. 

≡ Phleospora hyperici (Roberge ex Desm.) Westend., Bull. Acad. r. 

Bruxelles 12 (9): 251. 1845. 

Description in planta: Symptoms leaf lesions indefinite, usually 

starting to develop from the tip of leaf lamina and progressing 

towards the basis, irregular, reddish brown, surrounding leaf tissue 

often yellowish; Conidiomata pycnidial, amphigenous, densly 

dispersed in each lesion, only partly immersed, subglobose to 

globose or flask-shaped, brown to black, 55–90(–130) µm diam; 

ostiolum central, circular, often lifted above the leaf surface, 

25–35(–50) µm wide, surrounded by concolorous or somewhat 

darker cells; conidiomatal wall 10–22 µm thick, composed of 

a homogenous tissue of hyaline, angular cells 2–5.5 µm diam, 

the outermost cells pale brown with slightly thickened walls, the 

inner cells thin-walled. Conidiogenous cells hyaline, discrete or 

integrated in 1–2-septate conidiophores, terminal ones narrowly 

to broadly ampulliform, holoblastic, producing a single conidium or 

proliferating sympodially, 6–8(–10) × 3.5–5 µm. Conidia cylindrical, 

straight, more often slightly curved or flexuous, broadly rounded at 

the apex, narrowing slightly to the truncate base, 1–3(–5)-septate, 

not or slightly constricted around the septa, hyaline, contents with 

a few oil-droplets and minute granular material in each cell in the 

living state, with oil-droplets and granular contents in the rehydrated 

state, 24–55(–63) × 2.5–3.5 µm (living; rehydrated, 1.8–2.8 µm 

wide). Sexual morph unknown (see notes). 


even, glabrous, colourless margin; centre and some outgrowing 

sectors entirely pale luteous to buff, where conidia are formed 

directly on the immersed and superficial mycelium; submarginal 

area blackish, due to dark pigmented hyphae and superficial 

pycnidia, covered by diffuse, white tufty to woolly aerial mycelium; 

reverse concolourous. Colonies on CMA as on OA. Colonies on 

MEA 3–7 mm diam in 2 wk (32–40 mm in 6 wk), with an irregular, 

glabrous margin; a reddish pigment diffusing into the agar; colony 

restricted, the surface cerebriform to irregularly lobed, up to 2 mm 

high, immersed mycelium dark, mostly covered by dense, pure white, 

woolly aerial mycelium, or salmon to saffron by masses of conidia; 

reverse cinnamon to brick. Colonies on CHA 3–5 mm diam in 2 wk, 

with an irregular, glabrous margin; colony restricted, the surface 

cerebriform to irregularly lobed, up to 2 mm high, dark but mostly 

covered by salmon to saffron conidial masses, and some areas with 

a dense, pure white, woolly-floccose aerial mycelium; reverse dark 

brick. 

Hosts: Hypericum spp. 

Material examined: Bulgaria, Camkorije, on leaves of Hypericum quadrangulum, 

31 Aug. 1907, Fr. Bubák, distributed in Kabát & Bubák, Fungi imperfecti exsicc. 469 

(PC 0084544). Czech Republic, Bohemia, Bukovina, on leaves of H. perforatum, 

9 June 1906, J. Kabát, distributed in Kabát & Bubák, Fungi imperfecti exsicc. 421 

(PC 0084542); same substr., E. Moravia, M. Weisskirchen, Aug. 1941, F. Petrak 

(PC 0084545). France, loc. unknown, on leaves of H. perforatum, isotype PC 

0084532; Lighhouse of Libisey near Caen, same substr., June 1841, M. Roberge, 

PC 0084531; same substr., Bois de Plaisir, 16 July 1935 (Herb. G. Viennot-Bourgin), 

PC 0084533; same substr., Allier, Gennetines, 5 Apr. 1959, A. Lachmann, PC 

0084535; Landes, Etang near Seignosse, on H. helodes, 5 Aug. 1964, G. Durrieu, 

PC 0084536; Seine-et-Marne, Fontainebleau forest, on leaves of H. hirsutum, July 

1888, Feuilleaubols, PC 0084537, 0084540. Germany, Hessen-Nassau, Dillkreis, 

Langenaubach, on leaves of H. quadrangulum, 12 July 1931, A. Ludwig, distributed 

in Sydow, Mycotheca germanica 2570, PC 0084538; Brandenburg, Sadowa, on 

leaves of H. perforatum, 4 Aug. 1907, P. Sydow, distributed in Sydow, Mycotheca 

germanica 625, PC 0084543. Netherlands, Prov. Utrecht, Soest, along railroad 

between Lange Duinen and De Zoom, on living leaves of Hypericum sp., 28 July 

1999, G. Verkley 900, epitype designated here CBS H-21194 “MBT175361”, living 

culture ex-epitype CBS 102313. Romania, Moldova, distr. Iaşi, Poeni, on leaves of 

H. hirsutum, 1 Aug. 1948, C. Sandu-Ville & I. Rădulescu, distributed in Tr. Săvulescu, 

Herb. Mycol. Romanicum, fasc. 29, no. 1445, PC 0084534, 0084546. Sweden, E. 

Götland, Gryt parish, ca. 300 m E.-S.E. of Strömmen, on leaves of H. maculatum, 

18 July 1947, J.A. Nannfeldt 9386, distributed in S. Lundell & J.A. Nannfeldt, Fungi 

exsicc. Suecici, praes. Upsal. 1910, PC 0084547. 

Notes: According to Jørstad (1965), the pycnidia of Sphaer. hyperici 

are immersed hypophylously, but in most collections investigated 

here they protrude with their ostioli from either side of the leaf in 

about equal numbers. Jørstad (1965) further noted that the conidial 

sizes varied considerably between collections, with extreme values 

ranging between 15 and 57 µm for length and 1.5–2.5 µm for 

width of conidia. Vanev et al. (1997) reported conidia 21.5–54 × 

2–3.2 µm. In the type specimen, which is rich in conidiomata with 

protruding dry spore-masses, conidia are mostly 1–3-septate, 25– 

50 × 2–2.5 µm, thus in good agreement with the collection V900, 

which is designated as epitype. 

Four varieties of Septoria hyperici and a few more Septoria 

species have been described on species of the genus Hypericum. 

Most of these taxa have conidia in the size range given here 

for Sphaer. hyperici, indicating that these might be conspecific. 

However, more strains should be isolated from the different species 

of Hypericum and compared with type material of these taxa, 

before firm conclusions about their status can be drawn. Septoria 

hypericorum, which was described from H. perforatum with conidia 

reported 15–35 × 4–6 µm, is likely to belong in Stagonospora or 

another related asexual morph. The ex-epitype strain of Sphaer. 

hyperici CBS 102313 is closely related to strains identified as S. 

298


menispermi (CBS 128666, 128761), and somewhat more distant 

from species such as Sphaer. gei, and Sphaer. cercidis (CBS 

501.50). 

Petrak (1925) stated that Mycosphaerella hyperici is the sexual 

morph of Septoria hyperici, but this has not been confirmed by culture 

studies. The only culture available of M. hyperici for comparison, 

CBS 280.49, was sequenced by Zalar et al. (2007) and shown 

to group with isolates of Cladosporium halotolerans, so it may be 

a culture contaminant. No strain is available for M. hypericina, a 

species originally described from Hypericum prolificum in the 

US. No asexual morph is known for this taxon which, according 

to Aptroot (2006), is morphologically indistinguishable from M. 

punctiformis (anam. Ramularia endophylla; Verkley et al. 2004c). 

Sphaerulina socia (Pass.) Quaedvlieg, Verkley & Crous, 


Basionym: Septoria socia Pass., Funghi Parm. Septor.: no. 74; Atti 

Soc. crittog. ital. 2: 33. 1879. 

Description in planta: Symptoms leaf lesions circular to irregular, 

single or confluent to form irregular extended lesions, pale to dark 

brown, usually surrounded by a red or purple zone, mostly visible 

on both sides of the leaf. Conidiomata pycnidial, mostly epiphyllous, 

a few to many in each lesion, immersed, globose, brown to black, 

80–100(–110) µm diam; ostiolum central, circular, 15–25 µm 

wide, surrounding cells darker; conidiomatal wall 10–17 µm thick, 

composed 2–3 layers of isodiametric cells, 2–3.5(–5) µm diam, the 

cells in the outermost layer(s) pale brown with slightly thickened 

walls, the inner cells thin-walled. Conidiogenous cells hyaline, 

discrete, rarely integrated in 1(–2)-septate conidiophores, globose, 

or narrowly to broadly ampulliform, holoblastic, proliferating 

percurrently and/or sympodially, sometimes with indistinct 

annellations on an elongated neck, 4–8.5(–12) × 2–3(–3.5) µm. 

Conidia cylindrical, straight to slightly curved, rarely flexuous, 

attenuated in the upper cell to a pointed to narrowly rounded tip, 

attenuated gradually or more abruptly towards a sub-truncate base, 

1–3(–5)-septate, not constricted around the septa, hyaline, contents 

minute oil-droplets and granular material in the rehydrated state, 

(19–)22–34 × 1–1.5(–2) µm (rehydrated). Sexual morph unknown. 

Hosts: Chrysanthemum leucanthemum and other wild or cultivated 

Chrysanthemum spp. 

Material examined: Germany, Torstedt near Harburg, Sep. 1957, R. Schneider s.n., 

BBA 8514, living culture CBS 357.58. New Zealand, North Island, Coromandel, 

Tairua Forest, along roadside of St. Hway 25, near crossing 25A, on living leaves of 

Chrysanthemum leucanthemum, 23 Jan. 2003, G. Verkley 1842a, CBS H-21243. 

Additional material examined: Netherlands, on leaf of Rosa sp., isolated June 1958 

by Plant Protection Service, Wageningen, CBS 355.58 (preserved as S. rosae; 

possibly infection of a fungus originally identified as S. rosae). 

Notes: Punithalingam (1967d) described the conidiogenous cells 

as obpyriform, undifferentiated cells producing blastospores, while 

Muthumary (1999) also observed sympodially proliferating cells in a 

collection from India; the present material from New Zealand clearly 

showed both percurrent and sympodial conidiogenesis, even in 

a single conidiogenous cell. In this respect, S. socia is similar to 

S. chrysanthemella, for which both these proliferations were 

observed with transmission electron microscopy (Verkley 1998a). 

According to Teterevnikova-Babayan (1987) conidia are 

21–35 × 1–1.5 µm, so with these measurements the present 

observations are in good agreement. Verkley & Starink-Willemse 

(2004) noted that the ITS sequence of CBS 357.58 identified 

as S. socia suggested a relatively distant relationship with other 

Septoria species on the family Asteraceae, and that it was more 

closely related to species such as the maple pathogen Sphaerulina 

aceris (syn. Septoria aceris, Mycosphaerella latebrosa) and poplar 

pathogen Sphaerulina populicola. Multilocus sequencing performed 

here confirms that CBS 357.58 groups in the Sphaerulina-clade, 

and that CBS 355.58 originally identified as S. rosae likely got 

infected with S. socia. Septoria rosae is a large spored species 

(70–90 × 3.5–4 µm) for which the name of the presumed sexual 

morph Sphaerulina rehmiana would be accepted (Quaedvlieg et 

al. 2013). Based on the huge difference in conidial size it seems 

very unlikely that it was confused with S. socia. The material from 

New Zealand studied here failed to grow in culture, so a genetic 

comparison was not possible. More isolates will be required to 

determine the affinities of Sphaerulina rehmiana. 

Sphaerulina tirolensis Verkley, Quaedvlieg & Crous, sp. 


Etymology: named after the region in Austria where the type 

material was collected, Tirol. 

Description in planta: Symptoms leaf lesions numerous, circular 

to irregular, mostly single, or confluent, dull brown, amphigenous 

but on the lower surface barely visible due to the white hairs of 

the host; Conidiomata pycnidial, epiphyllous, many in each lesion, 

immersed, subglobose to globose, brown to black, 55–100 µm 

diam; ostiolum central, circular, initially 15–30 µm wide, later up 

to 50 µm wide, surrounding cells somewhat darker; conidiomatal 

wall 15–22 µm thick, composed of an outer layer of pale brown 

angular to irregular cells, 8–12 µm wide with walls thickened to 1.5 

µm, and an inner layer of hyaline, angular to globose, thin-walled 

cells. Conidiogenous cells hyaline, discrete, rarely integrated 

in 1-septate conidiophores, cylindrical or narrowly to broadly 

ampulliform, holoblastic, some proliferating percurrently 1–several 

times with indistinct annellations and forming an elongated neck, 

rarely proliferating sympodially, 5–12.5(–15) × 3.5–4(–5) µm. 

Conidia cylindrical, straight, slightly curved to flexuous, narrowly 

to broadly rounded at the apex, truncate or slightly narrowed at 

the base, (1–)3–7(–9)-septate, not constricted around the septa, 

hyaline, with granular contents and minute oil-droplets, 40–70(–78) 

× 2.5–3(–3.5) µm (rehydrated). Sexual morph not observed. 

Description in vitro: Colonies on OA 2.5–4(–5) mm diam in 2 wk; 

16–20 mm in 7 wk), with an even, glabrous, colourless or buff to 

rosy-buff margin; immersed mycelium dark green or dull green, 

showing some salmon or rosy-buff colours only after more than 6 

wk of incubation; colonies restricted, but with irregular elevations 

in the centre on which complexes of stromatic conidiomata and 

single pycnidia are formed, releasing whitish conidial slime; aerial 

mycelium variable, almost wanting, to well developed as a dense, 

white, woolly-floccose mat; reverse mostly olivaceous-black, 

locally buff to rosy-buff. Colonies on CMA 3–4.5(–5) mm daim in 

2 wk, 6–8 mm in 3 wk (22–25 mm in 7 wk), as on OA, but with 

a narrower colourless margin. Conidial slime also milky white, as 

on OA. Colonies on MEA 2–4(–6) mm diam in 2 wk, 6–9 mm in 3 

wk (16–22 mm in 7 wk), with an even, glabrous colourless to buff 

margin; colonies restricted, irregularly pustulate to hemispherical, 

sometimes with rather high, subglobose outgrowths; immersed 

mycelium buff to honey usually only near the margin, olivaceousblack 

in the centre; almost entirely covered by a dense, appressed 


299


Fig. 46. Sphaerulina tirolensis. A. Conidia in planta (CBS H-21232, holotype). B. Conidia on OA (CBS 109017). Scale bars = 10 µm. 

mat of white or grey aerial mycelium; a diffusable pigment staining 

the surrounding agar more or less ochreous; reverse usually dark 

umber or olivaceous-black in the centre, surrounded by ochreous, 

which later becomes fulvous to apricot. Colonies on CHA 3–4 mm 

diam in 2 wk, 5–6 mm in 3 wk (12–16 mm in 7 wk), with an even 

but later more irregular, glabrous, buff, rosy-buff or flesh margin; 

colonies pustulate to almost hemispherical, the surface olivaceousblack 

to dark slate blue, glabrous, or covered by diffuse, greyish or 

flesh aerial mycelium, some colonies later covered by a pure white, 

dense mat of aerial mycelium; diffusable pigment not observed; 

reverse blood colour to umber. Cultures produce large masses of 

pale flesh conidial slime, aggregating around the colony margin. 

Conidiomata pycnidial or merged into stromatic complexes. 

Conidiogenous cells as in planta. Conidia straight to curved 

or flexuous, narrowly to broadly rounded at the apex, narrowly 

truncate at the base, 3–7(–9)-septate, not constricted around the 

septa, hyaline, contents granular with minute oil-droplets, 54–96(– 

108) × 2.5–3 µm. 

Host: Rubus idaeus. 

Material examined: Austria, Tirol, Pitztal, Arzl, on living leaves of Rubus idaeus, 30 

July 2000, G. Verkley 1021, holotype CBS H-21232, living cultures ex-type CBS 

109017, 109018. 

Notes: Sphaerulina tirolensis differs from another septoria-like 

fungus described on R. idaeus, viz. Rhabdospora rubi var. rubiidaei 

described from stems of R. idaeus in Romania, with conidia 

(36–)40–50(–60) × 2(–2.5) µm. Demaree & Wilcox (1943) studied 

Septoria leaf-spot diseases of raspberry (R. idaeus) in North 

America. Cylindrosporium rubi, of which the sexual morph is 

Sphaerulina rubi cf. Demaree & Wilcox (1943), is also different. 

The sequences of the various protein-coding genes fully support 

Sphaer. tirolensis as a separate species from the next taxon, 

Sphaer. westendorpii. The latter can be distinguished from Sphaer. 

tirolensis by the smaller conidia in planta [24–45(–50) × 1.8–2.2 

µm] and also in culture [30–68(–80) × 1.5–2(–2.5) µm]. 

Sphaerulina westendorpii Verkley, Quaedvlieg & Crous, 

comb. et nom. nov. MycoBank MB804480. Fig. 47. 

Basionym: Septoria rubi Westend., in Westend. & Wallay, Herb. 

crypt. Belge, Fasc. 19, no. 938. 1854; Kickx, Fl. crypt. Flandr. 1: 

432. 1867. 

= Mycosphaerella rubi Roark, Phytopathology 11: 329. 1921. 

Description in planta: Symptoms leaf lesions numerous, circular 

to irregular, single or confluent, pale yellowish brown to greyish 

brown, partly well-delimited by a dark red brown line or zone. 

Conidiomata pycnidial, epiphyllous, several in each lesion, 

immersed, subglobose to globose, brown to black, 55–90 µm 

diam; ostiolum central, circular, initially 20–40 µm wide, later 


somewhat darker; conidiomatal wall 10–15 µm thick, composed of 

a homogenous tissue of hyaline, angular cells 2.5–3.5 µm diam, 

the outermost cells pale brown with slightly thickened walls, the 

inner cells thin-walled. Conidiogenous cells hyaline, discrete, 

rarely integrated in 1-septate conidiophores, narrowly to broadly 

300


Fig. 47. Sphaerulina westendorpii. A. conidia in planta (CBS H-21229, epitype); B. conidia on OA (CBS 102327). Scale bars = 10 µm. 

ampulliform, holoblastic, proliferating percurrently several times 

with indistinct annellations thus forming a relatively elongated neck, 

rarely also sympodially, 5–10(–15) × 2.5–3.5(–4) µm. Conidia 

filiform-cylindrical, straight, slightly curved to flexuous, narrowly 

to broadly rounded at the apex, narrowly truncate at the base, 


contents granular material, sometimes with minute oil-droplets both 

in the living and rehydrated state, 24–45(–50) × 1.8–2.2 µm (living; 

rehydrated, 1.5–2.0 µm wide). 

Description in vitro: Colonies on OA 8–10 mm diam in 19 d, with an 

even, glabrous, colourless or buff to rosy-buff margin; immersed 

mycelium dark green or dull green, but sectors or other parts of 

colonies may be only olivaceous-buff or rosy-buff to salmon; 

colonies spreading, with irregular elevations in the centre on which 

conidiomata are formed, releasing a whitish conidial slime; aerial 

mycelium almost absent to well developed and forming a dense, 

white, woolly-floccose mat; reverse olivaceous-black, locally buff 

to rosy-buff. Colonies on CMA 5–7(–10) mm diam in 19 d, as on 

OA, but more distinctly elevated and restricted. In faster growing 

sectors salmon to ochreous pigmentation (due to weak production 

of red pigment?) in a peripheral zone preceedes the formation 

a dominant greens. Conidial slime also milky white, as on OA. 

Colonies on MEA 9–12 mm diam in 19 d, with an even, glabrous 

colourless to buff margin; colonies restricted, irregularly pustulate to 

hemispherical; immersed mycelium buff to honey near the margin, 

olivaceous-black in the centre, sometimes mostly honey; almost 

entirely covered by a dense, appressed mat of white or grey aerial 

mycelium; a diffusable pigment staining the surrounding agar more 

or less ochreous; reverse usually dark umber or olivaceous-black in 

the centre, surrounded by ochreous, which later becomes fulvous 

to apricot. Colonies on CHA 7–9 mm diam in 19 d, with an even 

but later more irregular, glabrous, buff, rosy-buff or flesh margin; 

colonies pustulate to almost hemispherical, the surface ochreous 

to sienna, glabrous, or covered by diffuse, greyish or flesh aerial 

mycelium; diffusable pigment not observed; reverse blood colour 

to umber. 

Conidiomata pycnidial or merged into stromatic complexes, 

as in planta. Conidiogenous cells as in planta, mostly cylindrical 

and proliferating percurrently, rarely also sympodially, 7–15(–18) × 

2.5–3.5(–4) µm; Conidia as in planta but mostly 3–5-septate and 

considerably longer, 30–68(–80) × 1.5–2(–2.5) µm. 

Hosts: Rubus spp. 

Material examined: Belgium, Oostacker, near Gand, on leaves of Rubus sp., 

isotype BR-MYCO 159265-88, also distributed in Westend. & Wallay, Herb. crypt. 

Belge, Fasc. 19, no. 938. Czech Republic, Mikulov, on living leaves of Rubus 

sp., 15 Sep. 2008, G. Verkley 6002, CBS H-21257. Netherlands, prov. Limburg, 

Gerendal, on living leaves of R. fruticosus s.l., 28 June 2000, G. Verkley 964, 

epitype designated here CBS H-21229 “MBT175362”, living cultures ex-epitype 

CBS 109002, 109003; Prov. Limburg, Mookerheide, in mixed forest, on living leaves 

of R. fruticosus s.l., 9 Sep. 1999, G. Verkley 923, CBS H-21205, living culture CBS 

102327; same loc. and substr., 23 Aug. 2004, G. Verkley & M. Starink 3036, CBS 

H-21263, living culture CBS 117478; same substr., Prov. Limburg, St. Jansberg 

near Plasmolen, in mixed forest, G. Verkley 924, CBS H-21206; Prov. Flevoland, 

Erkemeder strand, in sandy dunes, on living leaves of R. fruticosus s.l., 8 Sep. 1999, 

G. Verkley 930, CBS H-21210. 

Notes: Jørstad (1965) discussed the problems regarding the 

taxonomy of Septoria species described from Rubus. Some of the 

later described taxa have been placed in synonymy with Septoria 

rubi, but most still need to be reevaluated based on fresh material, 

culture studies, and molecular characterisation. The type material 

in BR contains several well-preserved leaves of the R. fruticosus 

complex, showing typical symptoms. Fruitbodies investigated 

contained mostly 1–3-septate conidia, 17.5–40 × 1–1.5 µm, and 

with the typical shape of this common fungus on Rubus spp. The 

specimen CBS H-21229 from R. fruticosus in the south of the 

Netherlands, is chosen as epitype. This species is nested within 

the Sphaerulina-clade, and a new name in Sphaerulina should 


301


therefore be proposed for it. Sphaerulina rubi Demaree & Wilcox 

is already in use for another fungus with a Cylindrosporium sexual 

state (C. rubi Ellis & Morgan, conidia 40–55 × 2.5 µm cf. Saccardo), 

so Sphaer. westendorpii is proposed here as nomen novum. 

Sphaerulina rehmiana has been associated with Septoria rosae 

CBS 355.58, which has been identified as S. rosae, is genetically 

distinct from Sphaer. westendorpii (Quaedvlieg et al. 2013). 

Insufficiently known species 

For the following species no host material was available and these 

have only been studied in culture, mostly based on older isolates, 

for which details are not described when the strain is regarded as 

degenerate. 

Septoria hippocastani Berk. & Broome, Ann. Mag. nat. 

Hist., Ser. 2, 5: 379. 1850. 

Material examined: Germany, Pfälzer Wald, on Aesculus hippocastanum, Sep 

1961, deposited Nov 1961, W. Gerlach, living culture CBS 411.61 (= BBA 9619). 

Note: CBS 411.61 is degenerated and sterile, but based on 

multilocus sequence analysis it can be concluded that it is a 

Septoria s. str. (Fig. 2). 

Septoria limonum Pass., Atti Soc. crittog. ital., 2: 23. 1879. 

Description in vitro (18 ºC, near UV): Colonies on OA 20–29 mm 

diam in 3 wk, with an even, colourless margin; colonies plane, 

spreading, immersed mycelium in the centre flesh, surrounded by a 

broad zone of dark vinaceous to brown-vinaceous, aerial mycelium 

absent, or scarce, with few tufts of pure white aerial hyphae; reverse 

concolorous. No sporulation observed. Colonies on MEA 25–32 mm 

diam in 3 wk, with an even to somewhat ruffled, buff to colourless 

margin; colonies spreading, somewhat elevated in the centre, 

immersed mycelium appearing grayish, the colony surface almost 

entirely covered by a dense mat of white to grey, woolly-floccose 

aerial mycelium; reverse in the centre rust, surrounded by a broad 

zone of olivaceous-grey to greenish grey, which is sharply bordered 

by the narrow buff to luteous margin. No sporulation observed. 

Material examined: Italy, Citrus limonium, isolated Mar. 1951, deposited by G. 

Goidanich, living culture CBS 419.51. 

Notes: In the multilocus sequence analysis (Fig. 2) this strain 

groups with CBS 356.36 (S. citricola) and few other strains in a 

weakly supported clade close to the plurivorous Septoria protearum 

and isolates of Septoria citri. Due to the lack of morphological 

information linked to this strain, its identity remains uncertain. 

DISCUSSION 

The type species of the genus Septoria, S. cytisi, could not be 

included in the multilocus analysis due to the fact that only LSU and 

ITS sequences were available for this species. However, as shown 

by Quaedvlieg et al. (2011), the position of this taxon is beyond 

doubt central to the clade indicated here as the main Septoria 

clade. Several “typical” Septoria species infecting herbaceous 

plants proved genetically distant from S. cytisi and its relatives, and 

can best be classified in separate genera, Sphaerulina (Quaedvlieg 

et al. 2013) and Caryophylloseptoria. 

The identification of Septoria has thus far mainly relied on host 

taxonomy and morphological characters of the shape, size, and 

septation of conidia (Jørstad 1965, Teterevnikova-Babayan 1987, 

Andrianova 1987, Vanev et al. 1997, Muthumary 1999, Shin & 

Sameva 2004, Priest 2006). Taxonomists have noted that conidial 

width is generally a more reliable character for species identification 

than conidial length, which is more variable. Some also noticed that 

Septoria material collected from the same location and host species, 

but under different environmental conditions or at different times in 

the same season, can differ considerably in average conidial sizes, 

particularly length (Jørstad 1965). These findings are also confirmed 

in our study. Reliable identification based on morphological 

comparison alone is not possible for many Septoria species, and 

reference sequences will have to be produced for many more taxa 

in future. This will require critical studies of type specimens and 

also require the recollection of fresh material. It is crucial that the 

types of the oldest names available for Septoria on certain hosts 

will need to be studied as part of such work, and where necessary 

epitypes designated to fix the genetic application of these names. 

Although hardly practised thus far by taxonomists, isolation and study 

in culture is a valuable and indispensable tool for Septoria species 

delimitation and identification. We noted that the shape of conidia 

on OA generally agree best with those in the source material on 

the natural substrate. Under standardised incubation conditions on 

standard media cultures originating from deviant voucher material, 

for example because it developed under adverse conditions, show 

again their “normal” phenotypes which is better for comparison 

purposes. Extracting DNA from axenic cultures is straight-forward 

and less prone to errors caused by contaminants, a problem often 

encountered when extracting DNA from plant tissue. 

The K2P results show that the five protein coding genes used 

during this research should all theoretically be able to distinquish 

every species in this dataset as their average inter- to intraspecific 

distance ration is over 10:1. The problem is that these are average 

numbers, not absolute numbers. For example, the Btub K2P graph 

in Fig. 1 starts at 0 and not at at 0.29, meaning that there actually 

are a few species in our dataset that are not distinguishable by Btub 

alone (although obviously by far most species in fact are). To avoid 

this, we recommend using at least two of the protein coding loci 

used in this study for identification of Septoria and allied genera. 

Because EF and Btub both have very high PCR success rates 

and have the highest species resolution percentage of all the loci 

used in this study, we recommend using these two loci for species 

identification purposes. It is advisable, however, to first sequence 

the ITS and LSU for a preliminary genus identification by blasting in 

GenBank and other useful databases. 

The multilocus sequence dataset generally provided good 

resolution, with maximum to high bootstrap support for almost all 

terminal and most of the deeper nodes of the phylogenetic tree. The 

intraspecific variation in the genes investigated is limited for most 

taxa, even if specimens originate from such distant geographic 

origins as New Zealand, Korea and Europe (S. convolvuli, S. 

leucanthemi, S. polygonorum). Strains assigned to Septoria citri 

possibly represent a species complex, one of few groups within 

the main Septoria clade that was not resolved. One case of cryptic 

speciation is revealed in the S. chrysanthemella complex, where 

at least two genetically discrete entities can be found that are 

phenotypically difficult to distinguish. 

Our results confirm that most species of Septoria have narrow 

host ranges, being limited to a single genus or a few genera of the 

same plant family. There were a few notable exceptions, however. 

We demonstrated that the supposed single-family host ranges 

302


of Septoria paridis (Liliaceae) and S. urticae (Urticaceae), each 

actually included one additional family (Violaceae and Lamiaceae, 

respectively). More surprisingly Septoria protearum, previously 

only associated with Proteaceae (Protea) (Crous et al. 2004), was 

now found to be also associated with Araceae (Zanthedeschia), 

Aspleniaceae (Asplenium), Rutaceae (Boronia), Boraginaceae 

(Myosotis), Oleandraceae (Nephrolepis), and Rosaceae (Geum). 

To our knowledge this is the first study to provide DNA-based 

evidence confirming that multiple family-associations occur for a 

single species in Septoria. It is to be expected that collecting and 

sequencing of more material will show more taxa to be plurivorous, 

and perhaps S. paridis and S. urticae will be among those. 

Coevolution of plant pathogenic fungi and their hosts has 

been documented for several groups. Other possible patterns of 

evolution have already been suggested for septoria-like fungi in 

previous studies but the data available were not sufficient to fully 

understand the evolution of these fungi (Feau et al. 2006). The 

robust phylogeny we inferred revealed polyphyletic distribution 

patterns over the entire range of the Septoria clade for no less than 

10 (singletons excluded) of the host families represented. These 

results clearly reject the coevolution hypothesis for Septoria, as 

species do not seem to consistently coevolve with hosts from a 

single host family but frequently jump successfully to hosts in new 

families. Caryophylloseptoria seems an exceptional genus in that it 

only comprises species infecting Caryophyllaceae, but it should be 

noted that it now only contains four species, as three other species 

infecting this family cluster distant within the Septoria clade (S. 

cucubali, S. cerastii, and S. stellariae). In the other clades some 

single-host family clusters can be found, but they do not comprise 

more than six fungal species (S. chrysanthemella and close 

relatives of Asteraceae within subclade 4b). 

We conclude that trans-family host jumping must be a major 

force driving the evolution of Septoria and Sphaerulina. Species 

like S. paridis and S. urticae infecting (at least) two plant families 

may in fact be cases in point, as they could be in a transitional 

period of gradually changing from one principal host family to 

another, unrelated one. The genetic basis for successful host 

jumping is unclear. It may involve horizontal gene transfer, transient 

phases of endophytic infections in “non-hosts” as a first step in a 

process of genetic adaptation to new optimal hosts, or perhaps a 

combination of both. Plant pathological research may shed more 

light on the mechanisms driving Septoria evolution which would be 

important, as it may in future allow accurate assessment of risks 

involved with the introduction of new crops in areas where Septoria 

species occur on the local flora. 

Host family index 

The taxa fully described in the Taxonomy section of this study are 

listed below according to the host family. 

Aceraceae 

Sphaerulina aceris 

Apiaceae 

Septoria aegopodii 

S. aegopodina 

S. anthrisci 

S. apiicola 

S. heraclei 

S. petroselini 

S. sii 

Araceae 

Septoria protearum 

Aspleniaceae 


Asteraceae 

Septoria chromolaenae 

S. chrysanthemella 

S. ekmanniana 

S. erigerontis 

S. hypochoeridis 

S. lactucae 

S. leucanthemi 

S. matricariae 

S. putrida 

S. senecionis 

Sphaerulina socia 

Betulaceae 

Sphaerulina betulae 

Boraginaceae 


Campanulaceae 

Septoria campanulae 

S. citri complex 


Caryophylloseptoria lychnidis 

C. silenes 

C. spergulae 

Septoria cerastii 

S. cucubali 

S. stellariae 

Convolvulaceae 

Septoria convolvuli 

Cornaceae 

Sphaerulina cornicola 

Cucurbitaceae 

Septoria cucurbitacearum 

Dipsacaceae 

Septoria scabiosicola 

Fabaceae 

Septoria astragali 

Hypericaceae 

Septoria hyperici 

Iridaceae 

Septoria sisyrinchii 

Lamiaceae 

Septoria galeopsidis 

S. lamiicola 

S. melissae 

S. stachydis 

Liliaceae 

Septoria paridis 

Oleandraceae 


Onagraceae 

Septoria epilobii 

Passifloraceae 

Septoria passifloricola 

Polemoniaceae 

Septoria phlogis 

Polygonaceae 

Septoria polygonorum 


303


S. rumicum 

Primulaceae 

Septoria lysimachiae 

Ranunculaceae 

Septoria clematidis 

S. lycoctoni 

S. napelli 

Rosaceae 

Septoria citri complex 

Sphaerulina gei 

Sphaer. tirolensis 

Sphaer. westendorpii 

Rubiaceae 

Septoria cruciatae 

S. coprosmae 

Rutaceae 


Salicaceae 

Sphaerulina frondicola 


Septoria digitalis 

Urticaceae 

Septoria urticae 

Verbenaceae 

Septoria verbenae 

Violaceae 

Septoria paridis 


We thank the technical staff of the CBS Collection for their support during this 

project. Arien van Iperen (cultures) and Marjan Vermaas (photographic plates) 

are acknowledged for their invaluable assistance. Huub van der Aa is thanked 

for his help during collecting and identifying material. Simeon Vanev is gratefully 

acknowledged for his support with collecting bibliographic data and translating 

Russian diagnoses. Part of the DNA barcode sequencing results used in this study 

was financially supported by the Fonds Economische Structuurversterking (FES, 

Dutch Ministery of Education, Culture and Science grant BEK/BPR-2009/137964-U, 

“Making the Tree of Life Work”). 

REFERENCES 

Andrianova TV (1987). Problems of classification and phylogeny of Septoria 

species. Mikologiya i Fitopatologiya 21: 393–399. 

Aptroot A (2006). Mycosphaerella and its anamorphs 2. Conspectus of 

Mycosphaerella. CBS Biodiversity Series 5. CBS-KNAW Fungal Biodiversity 


Arx JA von (1983). Mycosphaerella and its anamorphs. Proceedings Koninklijke 

Nederlandse Akademie van Wetenschappen, Series C - Biological and Medical 

Sciences 86 (1): 15–54. 

Beach WS (1919). Biological spezialization in the genus Septoria. American Journal 

of Botany 6: 1–33. 


(Phytopathogenic Hyphomycetes). Vol. 1. IHW-Verlag, Eching. 

Breeÿen A den, Groenewald JZ, Verkley GJM, Crous PW (2006). Morphological and 

molecular characterisation of Mycosphaerellaceae associated with the invasive 

weed, Chromolaena odorata. Fungal Diversity 23: 89–110. 




Cochran LC (1932). A study of two Septoria leaf spots of celery. Phytopathology 

22: 791–812. 

Constantinescu O (1984). Taxonomic revision of Septoria-like fungi parasitic on 

Betulaceae. Transactions of the British Mycological Society 83: 383–398. 

Crous PW, Aptroot A, Kang J-C, Braun U, Wingfield MJ (2000). The genus 




Crous PW, Denman S, Taylor JE, Swart L, Palm, ME (2004a).Cultivation and 

diseases of Proteaceae: Leucadendron, Leucospermum and Protea. CBS 

Biodiversity Series 2: 1–228. 


(2004b). Cryptic speciation and host specificity among Mycosphaerella spp. 



Crous PW, Kang J-C, Braun U (2001). A phylogenetic redefinition of anamorph 

genera in Mycosphaerella based on ITS rDNA sequences and morphology. 

Mycologia 93: 1081–1101. 

Crous PW, Slippers B, Wingfield MJ, Rheeder J, Marasas WFO, et al. (2006a). 

Phylogenetic lineages in the Botryosphaeriaceae. Studies in Mycology 55: 

235–253. 

Crous PW, Verkley GJM, Groenewald JZ, Samson RA (2009). CBS Laboratory 

Manual Series 1. CBS-KNAW Fungal Biodiversity Centre, Utrecht, The 

Netherlands. 

Crous PW, Wingfield MJ, Mansilla JP, Alfenas AC, Groenewald JZ (2006b). 


occurring on Eucalyptus. II. Studies in Mycology 55: 99–131. 

Demaree JB, Wilcox MS (1943). The fungus causing the so-called “Septoria leafspot 

disease” of raspberry. Phytopathology 33: 986–1003. 

Diedicke H (1915). Pilze VII, Sphaeropsidaea, Melanconiae,. Kryptogamenfl. Mark 

Brandenburg 9: 1–962. 

Farr DF (1991). Septoria species on Cornus. Mycologia 83: 611–623. 

Farr DF (1992). Species of Septoria on the Fabaceae, subfamily Faboidae, tribe 

Genistae. Sydowia 44: 13–31. 

Feau N, Hamelin RC, Bernier L (2006). Attributes and congruence of three molecular 

data sets: inferring phylogenies among Septoria-related species from woody 

perennial plants. Molecular Phylogenetics and Evolution 40: 808–829. 

Gabrielson RL, Grogan RG (1964). The late blight organism Septoria apiicola. 

Phytopathology 54: 1251–1257. 

Goodwin SB, Dunkle LD, Zismann VL (2001). Phylogenetic analysis of Cercospora 

and Mycosphaerella based on the internal transcribed spacer region of 

ribosomal DNA. Phytopathology 91: 648–658. 

Grove WB (1935). British stem and leaf fungi (Coelomycetes). Vol. I: Sphaeropsidales, 

Sphaerioideae with hyaline conidia: 1–488. 

Hall TA (1999). BioEdit: A user-friendly biological sequence alignment editor and 

analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 

95–98. 

Hebert PDN, Cywinska A, Ball SL, DeWaard JR (2003). Biological identifications 

through DNA barcodes. Proceedings of the Royal Society of London Series 

B 270: 313–321. 



Jørstad I (1965). Septoria and septoroid fungi on dicotyledones in Norway. Skrifter 

utgitt av Det Norske Videnskaps-Akademi i Oslo, I: Mat-Naturv. Klasse 22:1- 

110. 

Katoh K, Misawa K, Kuma K, Miyata T (2002). MAFFT: a novel method for rapid 

multiple sequence alignment based on fast Fourier transform. Nucleic Acids 

Research 30: 3059–3066. 

Kuijpers AFA, Aptroot A (2004). A revision of Mycosphaerella section Longispora 

(Ascomycetes). Nova Hedwigia 75: 451–468. 

Lombard L, Crous PW, Wingfield BD, Wingfield MJ (2010). Species concepts in 


Markevičius V, Treigienė A (2003). Sphaeropsidales. Genus Septoria. Mycota 

Lithuaniae 10, 3: 1–199. 

Mason-Gamer RJ, Kellogg EA (1996). Testing for phylogenetic conflict among 

molecular data sets in the tribe Triticeae (Gramineae). Systematic Biology 45: 

524–545. 

Muthumary J (1999). First contribution to a monograph of Septoria species in India. 

Madras: Centre for advanced studies in Botany. 

Nylander JAA (2004). MrModeltest v2. Program distributed by the author. 

Evolutionary Biology Centre Uppsala University. 

Petrak F (1925). Beiträge zur Pilzflora Südost-Galiziens und der Zentralkarpathen. 

Hedwigia 65: 179–330. 

Petrak F (1957). Die auf Aconiten vorkommenden Arten der Gattung Septoria. 

Sydowia 11: 375–379. 

Priest MJ (2006). Fungi of Australia. Septoria. ABRS, Canberra: CSIRO Publishing, 

Melbourne. 

Punithalingam E (1967a). Septoria chrysanthemella. CMI Descriptions of Pathogenic 

Fungi and Bacteria 137. Commonwealth Mycological Institute, Kew. 

Punithalingam E (1967b). Septoria leucanthemi. CMI Descriptions of Pathogenic 

Fungi and Bacteria 138. Commonwealth Mycological Institute, Kew 

Punithalingam E (1967c). Septoria obesa. CMI Descriptions of Pathogenic Fungi 

and Bacteria 139. Commonwealth Mycological Institute, Kew. 

304


Punithalingam E (1967d). Septoria socia. CMI Descriptions of Pathogenic Fungi and 

Bacteria 140. Commonwealth Mycological Institute, Kew. 

Punithalingam E (1982). Septoria cucurbitacearum. CMI Descriptions of Pathogenic 


Punithalingam E, Holiday P (1972). Septoria lactucae. CMI Descriptions of 

Pathogenic Fungi and Bacteria 335. Commonwealth Mycological Institute, 

Kew. 

Punithalingam E, Wheeler BEJ (1965). Septoria spp. occurring on species of 

Chrysanthemum. Transactions of the British Mycological Society 48: 423–439. 

Quaedvlieg W, Kema GHJ, Groenewald JZ, Verkley GJM, Seifbarghi S, Razavi M, 

Gohari A, Mirzadi, Mehrabi R, Crous PW (2011). Zymoseptoria gen. nov.: a 

new genus to accommodate Septoria-like species occurring on graminicolous 

hosts. Persoonia 26: 57–69. 

Quaedvlieg W, Groenewald JZ, Jesús Yáñez-Morales M, Crous PW (2012). DNA 

barcoding of Mycosphaerella species of quarantine importance to Europe. 

Persoonia 29: 101–115. 

Quaedvlieg W, Verkley GJM, Shin H-D, Barreto RW, Algenas AC, Swart WJ, 

Groenewald JZ, Crous PW (2013). Sizing up Septoria. Studies in Mycology 75: 

307–390. (this volume). 

Radulescu E, Negru A, Docea E (1973). Septoriozele din România. Bucureşti: 

Editura Academiei Republicii Socialiste România. 


Kew, UK. 

Saccardo PA (1884). Sylloge Fungorum: Sylloge Sphaeropsidearum et 

Melanconiearum. 3: 542. Padova, Italy. 

Saccardo PA (1895). Sylloge fungorum: Supplemental Universale, Pars III 11: 

1–753. Padova, Italy. 

Saccardo PA (1906). Sylloge fungorum: Supplemental Universale, Pars VII 18: 

1–838. Padova, Italy. 

Saccardo PA, Sydow P (1899). Sylloge Fungorum: Supplemental Universale, Pars 

IV 14: 1–1316. Padova, Italy. 

Sheridan JE (1968). Conditions for infection of celery by Septoria apiicola. Plant 

Disease Report 52: 142–145. 

Shin HD, Sameva EF (2004). Septoria in Korea (Plant Pathogens of Korea 11). 

National Institute of Agricultural Science and Technology, Republic of Korea. 

Simon UK, Groenewald JZ, Stierhof Y-D, Crous PW, Bauer R (2009). A necrotrophic 

phytopathogen forming a special cellular interaction with its host Aegopodium 

podagraria. Mycological Progress 9: 49–56. 

Smissen RD, Clement JC, Garnock-Jones PJ, Chambers JK (2002). Subfamilial 

relationships within Caryophyllaceae as inferred from 5’ ndhF sequences. 

American Journal of Botany 89: 1336–1341. 

Stewart EL, Liu Z, Crous PW, Szabo LJ (1999). Phylogenetic relationships among 



Sutton BC (1980). The Coelomycetes. Fungi imperfecti with Pycnidia, Acervuli and 

Stromata. Commonwealth Mycological Institute, Kew, Surrey, England. 

Sutton BC, Pascoe IG (1987). Septoria species on Acacia. Transactions of the 


Sutton BC, Pascoe IG (1989). Some Septoria species on native Australian plants. 


Sutton BC, Hennebert GL (1994). Interconnections amongst anamorphs and their 

possible contribution to ascomycete systematics. In Ascomycete systematics: 

problems and perspectives in the nineties (Hawksworth DL, ed.), pp. 77–98. 

Plenum Press, New York, USA. 

Sutton BC, Waterston JM (1966) Septoria apiicola. CMI Descriptions of Pathogenic 


Sydow H von (1924). Beiträge zur Kenntnis der Pilzflora Neu-Seelands. I. Annales 

Mycologici 22: 299–317. 

Tamura K, Dudley J, Nei M, Kumar S (2007). MEGA4: Molecular evolutionary 

genetics analysis (MEGA) software version 4.0. Molecular Biology and 

Evolution 24: 1596–1599. 

Teterevnikova-Babayan DN (1987). Fungi of the genus Septoria in the U.S.S.R. 

Yerevan: Akademia Nauk Armyanskoi SSR. 

Vanev SG, Sameva EF, Bakalova GG (1997). Fungi Bulgaricae 3. Ordo 

Sphaeropsidales. Sofia: Editio Academica Prof. Marin Drinov. 

Verkley GJM (1998a). Ultrastructural evidence for two types of proliferation in a 

single conidiogenous cell of Septoria chrysanthemella. Mycological Research 

102: 368–372. 

Verkley GJM (1998b). Ultrastructure of conidiogenesis and conidia in two species of 

Septoria sensu lato. Mycologia 90: 189–198. 



Verkley GJM, Starink-Willemse M (2004a). A phylogenetic study of some Septoria 

species pathogenic to Asteraceae based on ITS ribosomal DNA sequences. 

Mycological Progress 3: 315–322. 

Verkley GJM, Starink-Willemse M, Iperen A van, Abeln ECA (2004b). Phylogenetic 



Verkley GJM, Crous PW, Groenewald JZ, Braun U, Aptroot A (2004c). Mycosphaerella 



Research 108: 1271–1282. 

Waddell HT, Weber GF (1963). Physiology and pathology of Septoria species on 

Chrysanthemum. Mycologia 55: 442–452. 

White TJ, Bruns T, Lee S, Taylor JW (1990). Amplification and direct sequencing of 


methods and applications (Innis MA, Gelfland DH, Sininsky JJ, White TJ, eds). 

Academic Press, San Diego, USA: 315–322. 

Zalar P, Hoog GS de, Schroers H-J (2007). Phylogeny and ecology of the ubiquitous 

saprobe Cladosporium sphaerospermum, with descriptions of seven new 

species from hypersaline environments. Studies in Mycology 58: 157–183. 


305

306


Sizing up Septoria 

W. Quaedvlieg 1,2 , G.J.M. Verkley 1 , H.-D. Shin 3 , R.W. Barreto 4 , A.C. Alfenas 4 , W.J. Swart 5 , J.Z. Groenewald 1 , and P.W. Crous 1,2,6* 

1 

CBS-KNAW Fungal Biodiversity Centre, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands; 2 Wageningen University and Research Centre (WUR), Laboratory of Phytopathology, 

Droevendaalsesteeg 1, 6708 PB Wageningen, The Netherlands; 3 Utrecht University, Department of Biology, Microbiology, Padualaan 8, 3584 CH Utrecht, The Netherlands; 

2 

Microbiology, Department of Biology, Utrecht University, Padualaan 8, 3584 CH Utrecht, the Netherlands; 3 Division of Environmental Science and Ecological Engineering, 

Korea University, Seoul 136-701, Korea; 4 Departamento de Fitopatologia, Universidade Federal de Viçosa, 36750 Viçosa, Minas Gerais, Brazil; 5 Department of Plant 

Sciences, University of the Free State, P.O. Box 339, Bloemfontein 9300, South Africa; 6 Wageningen University and Research Centre (WUR), Laboratory of Phytopathology, 

Droevendaalsesteeg 1, 6708 PB Wageningen, The Netherlands 

*Correspondence: Pedro W. Crous, p.crous@cbs.knaw.nl 

Abstract: Septoria represents a genus of plant pathogenic fungi with a wide geographic distribution, commonly associated with leaf spots and stem cankers of a broad range of 

plant hosts. A major aim of this study was to resolve the phylogenetic generic limits of Septoria, Stagonospora, and other related genera such as Sphaerulina, Phaeosphaeria and 

Phaeoseptoria using sequences of the the partial 28S nuclear ribosomal RNA and RPB2 genes of a large set of isolates. Based on these results Septoria is shown to be a distinct 

genus in the Mycosphaerellaceae, which has mycosphaerella-like sexual morphs. Several septoria-like species are now accommodated in Sphaerulina, a genus previously linked to 

this complex. Phaeosphaeria (based on P. oryzae) is shown to be congeneric with Phaeoseptoria (based on P. papayae), which is reduced to synonymy under the former. Depazea 

nodorum (causal agent of nodorum blotch of cereals) and Septoria avenae (causal agent of avenae blotch of barley and rye) are placed in a new genus, Parastagonospora, which 

is shown to be distinct from Stagonospora (based on S. paludosa) and Phaeosphaeria. Partial nucleotide sequence data for five gene loci, ITS, LSU, EF-1α, RPB2 and Btub were 

generated for all of these isolates. A total of 47 clades or genera were resolved, leading to the introduction of 14 new genera, 36 new species, and 19 new combinations. 


Key words: Capnodiales, Multi-Locus Sequence Typing (MLST), Mycosphaerella, Mycosphaerellaceae, Phaeoseptoria, Phaeosphaeria, Phaeosphaeriaceae, Pleosporales, 

Septoria, Sphaerulina, Stagonospora, systematics. 

Taxonomic novelties: New genera – Acicuseptoria Quaedvlieg, Verkley & Crous, Cylindroseptoria Quaedvlieg, Verkley & Crous, Kirstenboschia Quaedvlieg, Verkley & Crous, 

Neoseptoria Quaedvlieg, Verkley & Crous, Neostagonospora Quaedvlieg, Verkley & Crous, Parastagonospora Quaedvlieg, Verkley & Crous, Polyphialoseptoria Quaedvlieg, R.W. 

Barreto, Verkley & Crous, Ruptoseptoria Quaedvlieg, Verkley & Crous, Septorioides Quaedvlieg, Verkley & Crous, Setoseptoria Quaedvlieg, Verkley & Crous, Stromatoseptoria 

Quaedvlieg, Verkley & Crous, Vrystaatia Quaedvlieg, W.J. Swart, Verkley & Crous, Xenobotryosphaeria Quaedvlieg, Verkley & Crous, Xenoseptoria Quaedvlieg, H.D. Shin, Verkley 

& Crous. New species – Acicuseptoria rumicis Quaedvlieg, Verkley & Crous, Caryophylloseptoria pseudolychnidis Quaedvlieg, H.D. Shin, Verkley & Crous, Coniothyrium sidae 

Quaedvlieg, Verkley, R.W. Barreto & Crous, Corynespora leucadendri Quaedvlieg, Verkley & Crous, Cylindroseptoria ceratoniae Quaedvlieg, Verkley & Crous, Cylindroseptoria 

pistaciae Quaedvlieg, Verkley & Crous, Kirstenboschia diospyri Quaedvlieg, Verkley & Crous, Neoseptoria caricis Quaedvlieg, Verkley & Crous, Neostagonospora caricis 

Quaedvlieg, Verkley & Crous, Neostagonospora elegiae Quaedvlieg, Verkley & Crous, Paraphoma dioscoreae Quaedvlieg, H.D. Shin, Verkley & Crous, Parastagonospora 

caricis Quaedvlieg, Verkley & Crous, Parastagonospora poae Quaedvlieg, Verkley & Crous, Phlyctema vincetoxici Quaedvlieg, Verkley & Crous, Polyphialoseptoria tabebuiaeserratifoliae 

Quaedvlieg, Alfenas & Crous, Polyphialoseptoria terminaliae Quaedvlieg, R.W. Barreto, Verkley & Crous, Pseudoseptoria collariana Quaedvlieg, Verkley & Crous, 

Pseudoseptoria obscura Quaedvlieg, Verkley & Crous, Sclerostagonospora phragmiticola Quaedvlieg, Verkley & Crous, Septoria cretae Quaedvlieg, Verkley & Crous, Septoria 

glycinicola Quaedvlieg, H.D. Shin, Verkley & Crous, Septoria oenanthicola Quaedvlieg, H.D. Shin, Verkley & Crous, Septoria pseudonapelli Quaedvlieg, H.D. Shin, Verkley & Crous, 

Setophoma chromolaenae Quaedvlieg, Verkley, R.W. Barreto & Crous, Setoseptoria phragmitis Quaedvlieg, Verkley & Crous, Sphaerulina amelanchier Quaedvlieg, Verkley & 

Crous, Sphaerulina pseudovirgaureae Quaedvlieg, Verkley & Crous, Sphaerulina viciae Quaedvlieg, H.D. Shin, Verkley & Crous, Stagonospora duoseptata Quaedvlieg, Verkley 

& Crous, Stagonospora perfecta Quaedvlieg, Verkley & Crous, Stagonospora pseudocaricis Quaedvlieg, Verkley, Gardiennet & Crous, Stagonospora pseudovitensis Quaedvlieg, 

Verkley & Crous, Stagonospora uniseptata Quaedvlieg, Verkley & Crous, Vrystaatia aloeicola Quaedvlieg, Verkley, W.J. Swart & Crous, Xenobotryosphaeria calamagrostidis 

Quaedvlieg, Verkley & Crous, Xenoseptoria neosaccardoi Quaedvlieg, H.D. Shin, Verkley & Crous. New combinations – Parastagonospora avenae (A.B. Frank) Quaedvlieg, 

Verkley & Crous, Parastagonospora nodorum (Berk.) Quaedvlieg, Verkley & Crous, Phaeosphaeria papayae (Speg.) Quaedvlieg, Verkley & Crous, Pseudocercospora domingensis 

(Petr. & Cif.) Quaedvlieg, Verkley & Crous, Ruptoseptoria unedonis (Roberge ex Desm.) Quaedvlieg, Verkley & Crous, Septorioides pini-thunbergii (S. Kaneko) Quaedvlieg, Verkley 

& Crous, Sphaerulina abeliceae (Hiray.) Quaedvlieg, Verkley & Crous, Sphaerulina azaleae (Voglino) Quaedvlieg, Verkley & Crous, Sphaerulina berberidis (Niessl) Quaedvlieg, 

Verkley & Crous, Sphaerulina betulae (Pass.) Quaedvlieg, Verkley & Crous, Sphaerulina cercidis (Fr.) Quaedvlieg, Verkley & Crous, Sphaerulina menispermi (Thüm.) Quaedvlieg, 

Verkley & Crous, Sphaerulina musiva (Peck) Quaedvlieg, Verkley & Crous, Sphaerulina oxyacanthae (Kunze & J.C. Schmidt) Quaedvlieg, Verkley & Crous, Sphaerulina patriniae 

(Miura) Quaedvlieg, Verkley & Crous, Sphaerulina populicola (Peck) Quaedvlieg, Verkley & Crous, Sphaerulina quercicola (Desm.) Quaedvlieg, Verkley & Crous, Sphaerulina 

rhabdoclinis (Butin) Quaedvlieg, Verkley & Crous, Stromatoseptoria castaneicola (Desm.) Quaedvlieg, Verkley & Crous. Typifications: Epitypifications – Phaeosphaeria oryzae I. 

Miyake, Phaeoseptoria papayae Speg.; Neotypification – Hendersonia paludosa Sacc. & Speg. 

doi:10.3114/sim0017. Hard copy: June 2013. 

Introduction 

Fungal species belonging to Septoria are among the most common 

and widespread leaf-spotting fungi worldwide. Septoria Sacc. 

(Mycosphaerella, Capnodiales, Dothideomycetes) is based on 

Septoria cytisi, which was first described by Desmazières (1847) 

as a pathogen of Cytisus laburnum (= Laburnum anagyroides). 


The genus Septoria is extremely large, and during the past 150 

years more than 2000 taxa have been ascribed to this asexual 

genus (Verkley & Priest 2000, Verkley et al. 2004). Presently, 

Septoria s.lat. represents a polyphyletic assembly of genera that 

cluster mostly in the Mycosphaerellaceae (a family incorporating 

many plant pathogenic coelomycetes), although fungi with 

septoria-like morphology have also evolved outside this family 


Attribution: 






307

Quaedvlieg et al. 

(Crous et al. 2009a, c). Although many species of Septoria have 

mycosphaerella-like sexual states, the name Mycosphaerella does 

not apply to them, and should not be used in this context. 

Following a proposal accepted by the International Code of 

Nomenclature for algae, fungi and plants (ICN), the generic name 

Septoria Sacc. was conserved over the older synonym Septaria 

Fr. (original spelling). The arguments preceding the typification 

of Septoria and subsequent proposals for name conservation 

by Wakefield (1940), Rogers (1949) and Donk (1964) between 

Septoria sensu Saccardo or Septaria Fries were various. In the 

end the committee for fungi appointed by the ICN followed the 

recommendation of Donk (1964), and decided on Septoria Sacc. 

over Septaria Fr., arguing that Septoria Sacc. had already been in 

prevalent use for many years, and should therefore be accepted as 

the correct name. 

After examining several herbarium specimens of S. cytisi, Sutton 

(1980) circumscribed Septoria as follows: Mycelium immersed, 

branched, septate, pale brown. Conidiomata pycnidial, immersed, 

separate or aggregated (but not confluent), globose, papillate (or 

not), brown, thin-walled of pale brown textura angularis, often with 

a smaller-celled inner layer, somewhat darker and more thickwalled 

around the ostiole. Conidiophores reduced to conidiogenous 

cells. Conidiogenous cells holoblastic, either determinate or 

indeterminate, with a limited number of sympodial proliferations. 

Each locus has a broad, flat, unthickened scar, discrete, hyaline, 

smooth, ampulliform, doliiform or lageniform to short cylindrical. 

Conidia hyaline, multiseptate, filiform, smooth and either continuous 

or constricted at septa. Later work by Constantinescu (1984), 

Sutton & Pascoe (1987, 1989) and Farr (1991, 1992) augmented 

Sutton’s previous generic circumscription by also including species 

with sympodial, enteroblastic and percurrent conidial proliferation. 

Furthermore, based on similarities in conidiomatal development, 

von Arx (1983) and Braun (1995) adopted an even wider concept of 

Septoria that included the acervular forms normally accommodated 

in Phloeospora. 

Morphological traits in Septoria are generally conserved, 

and specific morphological characters by which to describe and 

identify Septoria and septoria-like species are limited. This lack 

of specific morphological characters caused Septoria taxonomy 

to be largely dependent on associated host data, leading to many 

of the described species only being identifiable by host plant, and 

by variation in informative supplementary characters like conidial 

length, width and septation (Jørstad 1965, 1967, Sutton 1980). Of 

these supplementary characters, conidial width appears to be the 

most stable (i.e. it shows the least amount of intraspecific variation) 

and in most Septoria species, intraspecific conidial width rarely 

varies more than 1 μm (Priest 2006). 

This reliance on host data in Septoria taxonomy is far from 

perfect, and should be avoided for identification purposes (see 

Verkley et al. 2013, this volume). Extensive host inoculation 

experiments by Beach (1919) and Teterevnikova-Babayan (1987) 

have shown that identification of Septoria spp. by host specificity 

alone is error prone because many Septoria species are not 

restricted to a single specific host (i.e. several taxa have broader 

host ranges). Septoria species like S. lactucicola and S. lycopersici 

can not only infect multiple plant species within the same genus, 

but can also infect plants belonging to closely allied families and 

genera. In contrast to this, morphologically well distinguishable 

Septoria species can also parasitise the same hosts (e.g. multiple 

distinct Septoria species can be found on both Chrysanthemum 

and Rubus hosts) (Demaree & Wilcox 1943, Punithalingam 

1976, Shin & Sameva 2004). Because host specificity has been 

one of the main criteria used for describing new, morphologically 

indistinguishable Septoria species over the past 150 years, one 

can expect that a certain number of described taxa are in fact 

synonyms of species from related hosts. 

Septoria and septoria-like genera in the molecular 

era 

Although it had previously been speculated by Sutton (1980) that 

Septoria was in fact polyphyletic, definitive proof of this hypothesis 

awaited the introduction of molecular techniques. Cunfer & Ueng 

(1999) were the first to use rDNA sequence data of the internal 

transcribed spacer region (ITS) to postulate that Zymoseptoria tritici 

(then known as Septoria tritici) and several Stagonospora spp. (a 

morphologically similar genus, previously linked to Septoria) actually 

belonged to two distinct genera. Verkley et al. (2004) extended this 

study by employing a combination of 28S nrDNA (LSU) and ITS 

data to prove that Septoria was in fact both poly- and paraphyletic. 

Their work showed that septoria-like species such as Z. tritici and 

Z. passerinii were more closely related to Ramularia than to the 

majority of the other Septoria species used in their datasets. 

Feau et al. (2006) were the first to use a multi-locus polyphasic 

sequencing approach to reliably identify Septoria spp. Besides ITS 

and LSU sequence data, they also used β-tubulin (Btub) sequence 

data to separate closely related species into distinct monophyletic 

groups that frequently correlated with their respective host 

families. These results supported the approach of using multi-gene 

sequence data for studying a large collection of Septoria strains at 

species level. 

Septoria s. str. was finally demarcated when Quaedvlieg et 

al. (2011) managed to obtain both ITS and LSU sequence data 

from S. cytisi herbarium specimens. Phylogenetic analysis of the 

obtained S. cytisi LSU sequence data clearly proved that Z. tritici 

and Z. passerinii [as previously indicated by Cunfer & Ueng (1999) 

and Verkley et al. (2004)] did not belong to Septoria s. str., but in 

fact belonged to a separate genus, closely related to Ramularia. 

These two species were subsequently split off from Septoria and 

placed in a new genus, Zymoseptoria (named for the yeast-like 

state produced in culture). Since the initial Zymoseptoria paper, five 

additional species from members of Poaceae have been described 

in this genus (Crous et al. 2012a, Stukenbrock et al. 2012). 

Septoria-like asexual genera 

Since the description of Septoria by Desmazières (1847), several 

additional septoria-like genera (pycnidial/acervular/stromatic 

conidioma with filiform conidia) have been described which could 

be mistaken for Septoria s. str. 

The two economically most important septoria-like genera are 

probably Zymoseptoria (sexual morph mycosphaerella-like) and 

Parastagonospora (sexual morph phaeosphaeria-like; see below). 

Both of these genera are pathogenic on Poaceae (grasses) and are 

directly or indirectly responsible for significant annual crop losses 

worldwide on cereals such as barley and wheat (Eyal et al. 1987). 

Quaedvlieg et al. (2011) determined that Zymoseptoria formed a 

distinct clade in the Mycosphaerellaceae, while Stagonospora was 

found to cluster in the Phaeosphaeriaceae within the Pleosporales, 

near other genera like Phoma and Phaeosphaeria (Cunfer & 

Ueng 1999, Solomon et al. 2006) which contain important plant 

pathogens. However, besides Zymoseptoria and Parastagonospora 

there are many other, lesser-known septoria-like genera awaiting 

308


elucidation. The goal of the present study is therefore to conduct an 

in-depth morphological and molecular analysis of these septorialike 

genera, and resolve the affinities of Stagonospora and its 

purported sexual morph, Phaeosphaeria. To this end a collection of 

370 Septoria and septoria-like isolates (Table 1) were subjected to 

morphological examination and multi-gene DNA analyses. 

Materials and Methods 

Isolates 

Symptomatic leaves were incubated in moist chambers for up 

to 1 wk to enhance sporulation before single conidial colonies 

were established on 2 % malt extract agar (MEA) (Crous et al. 

2009d). Leaf spots bearing ascomata were soaked in water for 

approximately 2 h, after which they were attached to the inner 

surface of Petri dish lids over plates containing MEA. Ascospore 

germination patterns were examined after 24 h, and single 

ascospore cultures established as described previously (Crous et 

al. 1991, Crous 1998). Colonies were sub-cultured onto synthetic 

nutrient-poor agar (SNA) containing sterile Hordeum vulgare 

(barley) and Urtica dioica (stinging nettle) stems, potato-dextrose 

agar (PDA), oatmeal agar (OA), and MEA (Crous et al. 2009d), 

and incubated at 25 °C under continuous near-ultraviolet light to 

promote sporulation. Isolates were also obtained from the culture 

collections of the CBS-KNAW Fungal Biodiversity Centre (CBS) 

in Utrecht, and the working collection of Pedro Crous (CPC). 

Reference strains were deposited CBS (Table 1). 

DNA extraction, amplification and sequencing 

Genomic DNA was extracted from fungal mycelium growing on 

MEA, using the UltraClean® Microbial DNA Isolation Kit (Mo Bio 

Laboratories, Inc., Solana Beach, CA, USA). Strains (Table 1) were 

screened for five loci (β-tubulin (Btub), internal transcribed spacer 

(ITS), Translation elongation factor 1-alpha (EF-1α) 28S nrDNA 

(LSU) and RNA polymerase II second largest subunit (RPB2) using 

the primer sets listed in Table 2. The PCR amplifications were 

performed in a total volume of 12.5 µL solution containing 10–20 

ng of template DNA, 1 × PCR buffer, 0.7 µL DMSO (99.9 %), 2 mM 

MgCl 2 

, 0.4 µM of each primer, 25 µM of each dNTP and 1.0 U Taq 

DNA polymerase (GoTaq, Promega). PCR amplification conditions 

were set as follows: an initial denaturation temperature of 96 °C 

for 2 min, followed by 40 cycles of denaturation temperature of 96 

°C for 45 s, primer annealing at the temperature stipulated in Table 

2, primer extension at 72 °C for 90 s and a final extension step at 

72 °C for 2 min. The resulting fragments were sequenced using the 

PCR primers together with a BigDye Terminator Cycle Sequencing 

Kit v. 3.1 (Applied Biosystems, Foster City, CA). Sequencing 

reactions were performed as described by Cheewangkoon et al. 

(2008). All novel sequences were deposited in NCBI’s GenBank 

database and alignments and phylogenetic trees in TreeBASE. 


A basic alignment of the obtained sequence data was first done 

using MAFFT v. 7 [(http://mafft.cbrc.jp/alignment /server/index. html) 

(Katoh et al. 2002)] and if necessary, manually improved in BioEdit 

v. 7.0.5.2 (Hall 1999). To check the congruency of the RPB2 and 

LSU dataset, a 70 % neighbour-joining (NJ) reciprocal bootstrap 

method with maximum likelihood distance was performed (Mason- 

Gamer & Kellogg 1996, Lombard et al. 2010). Bayesian analyses 

(critical value for the topological convergence diagnostic set to 

0.01) were performed on the concatenated loci using MrBayes 

v. 3.2.1 (Huelsenbeck & Ronquist 2001) as described by Crous 

et al. (2006) using nucleotide substitution models that were 

selected using MrModeltest v.2.3 (Table 3) (Nylander 2004). In 

order to keep the trees manageable for publication, two separate 

Bayesian trees were run. The first tree was run with all the Septoria 

and septoria-like isolates that either belonged to, or where more 

closely related to the Mycosphaerellaceae (Fig. 1) while the second 

tree contained all the septoria-like isolates either belonging to, or 

being more closely related to the Phaeosphaeriaceae (Fig. 2). 

Parastagonospora nodorum (CBS 259.49) was used as outgroup 

for the Mycosphaerellaceae dataset, while Dothistroma pini (CBS 

121005) was used as outgroup for the Phaeosphaeriaceae dataset. 

As the novel genera and species described in this study were 

already clearly distinquishable in the LSU/RPB2 trees, the ITS, 

EF-1α and Btub sequence data of these isolates were deposited 

in GenBank without their subsequent trees being published in this 

paper. 

Taxonomy 

Taxonomic descriptions were based on isolates sporulating in 

culture. Diseased leaf tissue was viewed under a Zeiss V20 

Discovery stereo-microscope, while a Zeiss Axio Imager 2 light 

microscope with differential interference contrast (DIC) illumination 

and an AxioCam MRc5 camera with Zen software was used to 

capture morphological structures. Adobe Photoshop CS3 was 

used for the final editing of acquired images and photographic 

preparations. For measurements, 30–50 replicates of all relevant 

morphological features were made at ×1000 magnification. Colony 

characters and pigment production were noted after 2–4 wk of 

growth on MEA, PDA and OA (Crous et al. 2009d) incubated at 

25 ºC in the dark. Colony colours (surface and reverse) were rated 

according to the colour charts of Rayner (1970). 

Results 

DNA sequencing and phylogenetic analysis 

The RPB2 and LSU sequence datasets did not show any conficts 

in both the Mycosphaerellaceae and Phaeosphaeriaceae tree 

topologies for the 70 % reciprocal bootstrap trees, allowing us to 

combine them in the multigene analyses. For the Mycosphaerellaceae 

tree, the gene boundaries were: 1–327 bp for RPB2 and 332–1120 

bp for LSU. For the Phaeosphaeriaceae tree (Fig. 2), the gene 

boundaries were 1–777 bp for LSU and 782–1108 bp for RPB2. 

During the generation of the Mycosphaerellaceae tree (Fig. 1), a total 

of 57 048 trees were sampled out of the generated 76 062 trees (75 

%). During the generation of the Phaeosphaeriaceae tree (Fig. 2), 

a total of 2844 trees were sampled out of the generated 3792 trees 

(75 %). 

Taxonomy 

A total of 347 isolates representing 170 species were subjected to 

DNA analysis and morphological comparison. Phylogenetic analyses 

based on the LSU and RPB2 genes resolved a total of 47 clades of 


309


Table 1. Collection details and GenBank accession numbers of isolates included in this study. 

Species Isolate no. 1 Host Location Collector GenBank accession no. 2 

EF-1α Btub RPB2 LSU ITS 

Acicuseptoria rumicis CBS 522.78 Rumex alpinus France H.A. van der Aa KF253105 KF252643 KF252153 KF251648 KF251144 

Boeremia telephii CBS 135415; S670 Lavatera thuringiaca Germany U. Damm – KF252644 KF252154 KF251649 KF251145 

Caryophylloseptoria lychnidis CBS 109098 Silene pratensis Austria G.J.M. Verkley KF253234 KF252768 KF252292 KF251790 KF251286 

CBS 109099 Silene pratensis Austria G.J.M. Verkley KF253235 KF252769 KF252293 KF251791 KF251287 



Car. pseudolychnidis CBS 128614 Lychnis cognata South Korea H.D. Shin KF253238 KF252772 KF252296 KF251794 KF251290 

CBS 128630 Lychnis cognata South Korea H.D. Shin KF253239 KF252773 KF252297 KF251795 KF251291 

Car. silenes CBS 109100 Silene nutans Austria G.J.M. Verkley KF253240 KF252774 KF252298 KF251796 KF251292 


Car. spergulae CBS 397.52 Dianthus caryophyllus Netherlands Schouten KF253243 KF252777 KF252301 KF251799 KF251295 

CBS 109010 Spergula morisonii Netherlands A. Aptroot KF253242 KF252776 KF252300 KF251798 KF251294 

Cercospora beticola CBS 124.31; CPC 5070 Beta vulgaris Romania – KF253106 KF252645 KF252155 KF251650 KF251146 

Cer. capsici CBS 118712 – Fiji P. Tyler KF253244 KF252778 KF252302 KF251800 KF251296 

Cer. zebrina CBS 137.56 Hedysarum coronarium Italy M. Ribaldi KF253245 KF252779 KF252303 KF251801 KF251297 

CBS 118790; IMI 262766 Trifolium subterraneum Australia M.J. Barbetti KF253107 KF252646 KF252156 KF251651 KF251147 

Chaetosphaeronema hispidulum CBS 216.75 Anthyllis vulneraria Germany R. Schneider KF253108 KF252647 KF252157 KF251652 KF251148 

Coniothyrium carteri CBS 105.91 Quercus robur Germany H. Schill KF253165 KF252700 KF252214 KF251712 KF251209 

CBS 101633 Quercus sp. Netherlands – KF253166 KF252701 KF252215 KF251713 KF251210 

Con. glycinicola CBS 124141 Glycine max Zimbabwe C. Lavy KF253167 KF252702 KF252216 KF251714 KF251211 

Con. sidae CBS 135108; CPC 19602 Sida sp. Brazil R.W. Barreto KF253109 KF252648 KF252158 KF251653 KF251149 

Corynespora leucadendri CBS 135133; CPC 19345 Leucadendron sp. South Africa S. Lee KF253110 KF252639 KF252159 KF251654 KF251150 

Cylindroseptoria ceratoniae CBS 477.69 Ceratonia siliqua Spain H.A. van der Aa KF253111 KF252649 KF252160 KF251655 KF251151 

Cyl. pistaciae CBS 471.69 Pistacia lentiscus Spain H.A. van der Aa KF253112 KF252650 KF252161 KF251656 KF251152 

Cytostagonospora martiniana CBS 135102; CPC 17727 Acacia pycnantha Australia P.W. Crous KF253113 KF252651 KF252162 KF251657 KF251153 

Dissoconium commune CPC 12397 Eucalyptus globulus Australia I. Smith KF253190 KF252724 KF252242 KF251740 KF251237 

Dothistroma pini CBS 116484 Pinus nigra USA G. Adams JX901622 JX902193 JX901948 JX901824 JX901736 

CBS 116485 Pinus nigra USA G. Adams JX901625 JX902196 JX901951 JX901827 JX901739 

CBS 116487 Pinus nigra USA G. Adams JX901620 JX902191 JX901946 JX901822 GU214532 

CBS 121005 Pinus pallasiana Russia T. S. Bulgakov KF253115 KF252653 – KF251659 KF251155 

CBS 121011 Pinus pallasiana Russia A.C. Usichenko KF253250 – KF252307 KF251806 KF251302 

Dot. septosporum CBS 383.74 Pinus coulteri France M. Morelet KF253251 – KF252308 KF251807 KF251303 

310





CPC 16798 Pinus mugo ‘Rostrata’ Netherlands W. Quaedvlieg JX901627 JX902198 JX901953 JX901829 JX901741 

CPC 16799 Pinus mugo Netherlands W. Quaedvlieg JX901628 JX902199 JX901954 JX901830 JX901742 

Kirstenboschia diospyri CBS 134911; CPC 19869 Diospyros whyteana South Africa P.W. Crous KF253116 KF252640 KF252164 KF251660 KF251156 

CPC 19870 Diospyros whyteana South Africa P.W. Crous KF253117 KF252641 KF252165 KF251661 KF251157 

Lecanosticta acicola CBS 322.33 – – P.V. Siggers JX901639 JX902213 JX901968 JX901844 JX901755 

CBS 133791 Pinus strobus USA B. Ostrofsky KC013002 KC013008 KC013014 KC013017 KC012999 

Lec. brevispora CBS 133601 Pinus sp. Mexico J.Y. Morales JX901649 JX902224 JX901979 JX901855 JX901763 

Lec. guatamalensis IMI 281598 Pinus oocarpa Guatemala H.C. Evans JX901650 JX902225 JX901980 JX901856 JX901764 

Lec. longispora CBS 133602 Pinus sp. Mexico J.Y. Morales JX901651 JX902227 JX901982 JX901858 JX901766 

Leptosphaeria albopunctata CBS 254.64 Spartina alterniflora USA J. Kohlmeyer KF253118 KF252654 KF252166 KF251662 KF251158 

Mycosphaerella brassicicola CBS 228.32 Brassica oleracea Denmark C.A. Jörgensen KF253252 KF252783 KF252309 KF251808 KF251304 

CBS 267.53 Brassica oleracea Netherlands F. Quak KF253253 KF252784 KF252310 KF251809 KF251305 

Mycosphaerella sp. CBS 135464; CPC 11677 Draba nemorosa var. 

hebecarpa 

South Korea H.D. Shin – KF252786 KF252312 KF251811 KF251307 

Neoseptoria caricis CBS 135097; S653 Carex acutiformis Netherlands W. Quaedvlieg – – KF252167 KF251663 KF251159 

Neosetophoma samarorum CBS 138.96 Phlox paniculata Netherlands – KF253119 KF252655 KF252168 KF251664 KF251160 

CBS 139.96 Poa sp. Netherlands – KF253120 KF252656 KF252169 KF251665 KF251161 

CBS 568.94 Urtica dioica Netherlands G.J.M. Verkley KF253121 KF252657 KF252170 KF251666 KF251162 

Neostagonospora caricis CBS 135092; S616 Carex acutiformis Netherlands W. Quaedvlieg – KF252658 KF252171 KF251667 KF251163 

Neost. elegiae CBS 135101; CPC 16977 Elegia cuspidata South Africa S. Lee KF253122 KF252659 KF252172 KF251668 KF251164 

Paraphoma chrysanthemicola CBS 172.70 Chrysanthemum morifolium Netherlands R. Schneider KF253123 KF252660 KF252173 KF251669 KF251165 

CBS 522.66 Chrysanthemum morifolium UK – KF253124 KF252661 KF252174 KF251670 KF251166 

Parap. dioscoreae CBS 135100; CPC 11357 Dioscorea tokoro South Korea H.D. Shin KF253125 KF252662 KF252175 KF251671 KF251167 

CPC 11355 Dioscorea tokoro South Korea H.D. Shin KF253126 KF252663 KF252176 KF251672 KF251168 

CPC 11361 Dioscorea tokoro South Korea H.D. Shin KF253127 KF252664 KF252177 KF251673 KF251169 

Parap. fimeti CBS 170.70 Apium graveolens Netherlands M.A. de Waard KF253128 KF252665 KF252178 KF251674 KF251170 

CBS 368.91 Juniperus communis Switzerland – KF253129 KF252666 KF252179 KF251675 KF251171 

Parap. radicina CBS 111.79 Malus sylvestris Netherlands G.H. Boerema KF253130 KF252667 KF252180 KF251676 KF251172 

CBS 102875 Lycopersicon esculentum Germany – KF253131 KF252668 KF252181 KF251677 KF251173 

Parastagonospora avenae CBS 289.69 Lolium perenne Germany U.G. Schlösser KF253132 KF252669 KF252182 KF251678 KF251174 

CBS 290.69 Lolium perenne Germany U.G. Schlösser KF253133 KF252670 KF252183 KF251679 KF251175 

Paras. caricis CBS 135671; S615 Carex acutiformis Netherlands W. Quaedvlieg KF253134 KF252671 KF252184 KF251680 KF251176 


311





Paras. nodorum CBS 110109 Lolium perenne Denmark M.P.S. Câmara KF253135 KF252672 KF252185 KF251681 KF251177 

Paras. “nodorum” CBS 259.49 Triticum sp. Canada – KF253143 KF252679 KF252192 KF251688 KF251185 

Paras. poae CBS 135089; S606 Poa sp. Netherlands S.I.R. Videira KF253136 KF252673 KF252186 KF251682 KF251178 

CBS 135091; S613 Poa sp. Netherlands S.I.R. Videira KF253137 KF252674 KF252187 KF251683 KF251179 

Passalora depressa CPC 14915 Angelica gigas South Korea H.D. Shin KF253256 KF252788 KF252314 KF251813 KF251309 

Pas. dioscoreae CBS 135460; CPC 10855 Dioscorea tokoro South Korea H.D. Shin KF253257 KF252789 KF252315 KF251814 KF251310 

CBS 135463; CPC 11513 Dioscorea tenuipes South Korea H.D. Shin KF253258 KF252790 KF252316 KF251815 KF251311 

Phaeophleospora eugeniae CPC 15143 Eugenia uniflora Brazil A.C. Alfenas KF253138 KF252642 – JX901875 KF251180 

CPC 15159 Eugenia uniflora Brazil A.C. Alfenas JX901667 JX902245 JX901999 JX901876 FJ493189 

“Phaeosphaeria” alpina CBS 456.84 Phleum alpinum Switzerland A. Leuchtmann KF253139 KF252675 KF252188 KF251684 KF251181 

Phaeos. caricicola CBS 603.86 Carex pendula Switzerland A. Leuchtmann KF253140 KF252676 KF252189 KF251685 KF251182 

Phaeos. juncicola CBS 110108 Phlox sp. Netherlands M.P.S. Câmara KF253141 KF252677 KF252190 KF251686 KF251183 

Phaeos. nigrans CBS 307.79 Zea mays Switzerland – KF253142 KF252678 KF252191 KF251687 KF251184 

Phaeos. oryzae CBS 110110 Oryza sativa South Korea L. Hausch – KF252680 KF252193 KF251689 KF251186 

Phaeos. papayae CBS 135416 Carica papaya Brazil A.C. Alfenas – KF252681 KF252194 KF251690 KF251187 

“Phaeos.” phragmiticola CBS 459.84 Phragmites australis Switzerland A. Leuchtmann KF253144 KF252682 KF252195 KF251691 KF251188 

“Phaeos.” pontiformis CBS 117487 – Netherlands J. Harrak KF253145 KF252683 KF252196 KF251692 KF251189 

Phaeosphaeria sp. CBS 206.87 Zea mays Gabon J.L. Notteghem KF253146 KF252684 KF252197 KF251693 KF251190 

CBS 135465; CPC 11894 Zea mays South Africa P.W. Crous KF253147 KF252685 KF252198 KF251694 KF251191 

“Phaeos.” typharum CBS 296.54 Nardus stricta Switzerland L.E. Wehmeyer KF253148 KF252686 KF252199 KF251695 KF251192 

“Phaeos.” vagans CBS 604.86 Calamagrostis arundinacea Sweden A. Leuchtmann KF253149 KF252687 KF252200 KF251696 KF251193 

phaeosphaeria-like sp. CBS 123.76 Prunus domestica Serbia M. Arseijevic KF253150 KF252688 KF252201 KF251697 KF251194 

CBS 135461; CPC 11231 Musa sp. Mauritius Y. Jaufeerally-Fakim KF253151 KF252689 KF252202 KF251698 KF251195 

CBS 135466; CPC 12131 Acacia crassicarpa Thailand W. Himaman KF253153 KF252691 KF252204 KF251700 KF251197 

CBS 135469; CPC 12881 Pinus monticola USA G. Newcombe & R.G. 

Ganley 

KF253154 KF252692 KF252205 KF251701 KF251198 

CPC 12130 Acacia crassicarpa Thailand W. Himaman KF253152 KF252690 KF252203 KF251699 KF251196 

Phaeosphaeriopsis glaucopunctata CBS 653.86 Ruscus aculeatus Switzerland A. Leuchtmann KF253155 KF252693 KF252206 KF251702 KF251199 

Phloeospora ulmi CBS 344.97 Ulmus glabra Austria W. Gams KF253158 KF252696 – KF251705 KF251202 

CBS 613.81 Ulmus sp. Austria H.A. van der Aa KF253159 KF252697 KF252208 KF251706 KF251203 

CBS 101564 Ulmus sp. Netherlands H.A. van der Aa KF253156 KF252694 KF252207 KF251703 KF251200 

CBS 109835 Ulmus sp. Netherlands G.J.M. Verkley KF253157 KF252695 – KF251704 KF251201 

Phlogicylindrium eucalyptorum CBS 111680 Eucalyptus nitens Australia P.W. Crous KF253160 KF252698 KF252209 KF251707 KF251204 

312





CBS 111689 Eucalyptus nitens Australia P.W. Crous KF253161 – KF252210 KF251708 KF251205 

Phlyctema vincetoxici CBS 123726 Vincetoxicum officinale Czech Republic G.J.M. Verkley KF253162 KF252699 KF252211 KF251709 KF251206 

CBS 123727 Vincetoxicum officinale Czech Republic G.J.M. Verkley KF253163 – KF252212 KF251710 KF251207 

CBS 123743 Vincetoxicum officinale Czech Republic G.J.M. Verkley KF253164 – KF252213 KF251711 KF251208 

Phoma herbarum CBS 615.75 Rosa multiflora Netherlands G.H. Boerema KF253168 KF252703 KF252217 KF251715 KF251212 

Polyphialoseptoria tabebuiaeserratifoliae 

CBS 112650 Tabebuia serratifolia Brazil A.C. Alfenas KF253169 KF252704 KF252218 KF251716 KF251213 

Pol. terminaliae CBS 135106; CPC 19611 Terminalia catappa Brazil R.W. Barreto KF253170 KF252705 KF252219 KF251717 KF251214 

CBS 135475; CPC 19487 Terminalia catappa Brazil R.W. Barreto KF253171 – KF252220 KF251718 KF251215 

Pseudocercospora chiangmaiensis CBS 123244 Eucalyptus camaldurensis Thailand R. Cheewangkoon JX901676 JX902254 JX902008 JX901885 JX901781 

Pse. eucalyptorum CBS 116303 Eucalyptus nitens South Africa P.W. Crous KF253172 KF252706 KF252221 KF251719 KF251216 

CPC 13816 Eucalyptus glaucescens UK S. Denman KF253230 KF252764 KF252288 KF251786 KF251282 

Pse. madagascariensis CBS 124155 Eucalyptus camaldulensis Madagascar M.J. Wingfield KF253265 – KF252322 KF251822 KF251318 

Pse. natalensis CBS 111069 Eucalyptus nitens South Africa T. Coutinho KF302389 KF302384 KF302393 KF302405 KF302399 

Pse. norchiensis CBS 120738 Eucalyptus sp. Italy W. Gams JX901684 JX902263 JX902017 JX901894 JX901785 

Pse. robusta CBS 111175 Eucalyptus robur Malaysia M.J. Wingfield JX901694 JX902273 JX902027 JX901904 DQ303081 

Pse. schizolobii CBS 120029 Schizolobium parahybum Ecuador M.J. Wingfield KF253269 KF252798 KF252326 KF251826 KF251322 

Pse. tereticornis CPC 13299 Eucalyptus tereticornis Australia P.W. Crous JX901701 JX902280 JX902034 JX901911 GQ852770 

Pseudocercosporella capsellae CBS 127.29 – – K. Togashi KF253273 KF252801 KF252330 KF251830 KF251326 

CBS 112032 Brassica sp. UK R. Evans KF253267 KF252797 KF252324 KF251824 KF251320 

CBS 112033 Brassica sp. UK R. Evans KF253254 KF252785 KF252311 KF251810 KF251306 

CBS 118412 Brassica sp. New Zealand C.F. Hill KF253272 KF252800 KF252329 KF251829 KF251325 

“Pella.” magnusiana CBS 114735 Geranium silvaticum Sweden E. Gunnerbeck KF253274 KF252802 – KF251831 KF251327 

Pella. pastinacae CBS 114116 Laserpitium latifolium Sweden L. Holm KF253275 KF252803 KF252331 KF251832 KF251328 

Pseudoseptoria collariana CBS 135104; CPC 18119 Bambusoideae sp. Iran A. Mirzadi Gohari KF253174 KF252707 KF252223 KF251721 KF251218 

Pseudos. obscura CBS 135103; CPC 18118 Bambusoideae sp. Iran A. Mirzadi Gohari KF253175 KF252708 KF252224 KF251722 KF251219 

Ramularia endophylla CBS 113265 Quercus robur Netherlands G.J.M. Verkley KF253176 KF252709 KF252225 KF251723 KF251220 

Eucalyptus grandis var. 

Ram. eucalypti CBS 120726 

grandiflora Maiden Italy W. Gams KF253177 KF252710 KF252226 

KF251724 KF251221 

Ram. lamii CPC 11312 Leonurus sibiricus South Korea H.D. Shin KF253178 KF252711 KF252227 KF251725 KF251222 

Ram. pratensis CPC 11294 Rumex crispus South Korea – KF253179 KF252712 KF252228 KF251726 KF251223 

Ramularia sp. CBS 115913 Cerastium semidecandrum Netherlands A. Aptroot KF253180 – KF252229 KF251727 KF251224 

Readeriella angustia CBS 124998 Eucalyptus delegatensis Australia B.A. Summerel KF253181 KF252713 KF252230 KF251728 KF251225 

Rea. eucalypti CPC 13401 Eucalyptus sp. Portugal P.W. Crous KF253173 – KF252222 KF251720 KF251217 


313





Rea. readeriellophora CPC 12920 Eucalyptus sp. Australia A. Carnegie KF253114 KF252652 KF252163 KF251658 KF251154 

Ruptoseptoria unedonis CBS 355.86 Arbutus unedo France H.A. van der Aa – KF252715 KF252233 KF251731 KF251228 

CBS 755.70 Arbutus unedo Croatia J.A. von Arx – KF252716 KF252234 KF251732 KF251229 

Sclerostagonospora phragmiticola CBS 338.86 Phragmites australis France H.A. van der Aa KF253184 KF252717 KF252235 KF251733 KF251230 

Septoria abei CBS 128598 Hibiscus syriacus South Korea H.D. Shin KF253280 KF252805 KF252336 KF251837 KF251333 

Sep. “agropyrina” CBS 387.64 – Japan – KF302392 KF302387 KF302398 KF302410 KF302404 

Sep. anthrisci CBS 109020 Anthriscus sp. Austria G.J.M. Verkley KF253286 KF252811 KF252340 KF251843 KF251339 

Sep. anthurii CBS 346.58 Anthurium scherzerianum Germany R. Schneider KF253288 KF252813 KF252342 KF251845 KF251341 

Sep. apiicola CBS 400.54 Apium graveolens Netherlands J.A. von Arx KF253292 KF252817 KF252346 KF251849 KF251345 

“Sep.” arundinacea CBS 133.68 Phragmites australis Netherlands H.A. van der Aa KF253185 KF252718 KF252236 KF251734 KF251231 

CBS 281.72 Phragmites australis Netherlands J.W. Veenbaas-Rijks KF253186 KF252719 KF252237 KF251735 KF251232 

Sep. astericola CBS 128593 Aster yomena South Korea H.D. Shin KF253294 KF252819 KF252348 KF251851 KF251347 

Sep. astragali CBS 109116 Astragalus sp. Austria G.J.M. Verkley KF253298 KF252823 KF252352 KF251855 KF251351 

CBS 123878 Astragalus glycyphyllos Czech Republic G.J.M. Verkley KF253297 KF252822 KF252351 KF251854 KF251350 

Sep. atropurpurea CBS 348.58 Aster canus Germany R. Schneider KF253299 KF252824 KF252353 KF251856 KF251352 

Sep. bothriospermi CBS 128599 Bothriospermum tenellum South Korea H.D. Shin KF253301 KF252826 KF252355 KF251858 KF251354 

Sep. bupleuricola CBS 128603 Bupleurum falcatum South Korea H.D. Shin KF253303 KF252828 KF252357 KF251860 KF251356 

Sep. calendulae CBS 349.58 Calendula arvensis Italy R. Schneider KF253304 KF252829 KF252358 KF251861 KF251357 

Sep. callistephi CBS 128590 Callistephus chinensis South Korea H.D. Shin KF253305 KF252830 KF252359 KF251862 KF251358 

Sep. campanulae CBS 128604 Campanula takesimana South Korea H.D. Shin KF253308 KF252833 KF252362 KF251865 KF251361 

Sep. cerastii CBS 128612 Cerastium holosteoides South Korea H.D. Shin KF253311 KF252836 KF252365 KF251868 KF251364 

Sep. cf. agrimoniicola CBS 128585 Agrimonia pilosa South Korea H.D. Shin KF253283 KF252808 KF252337 KF251840 KF251336 

CBS 128602 Agrimonia pilosa South Korea H.D. Shin KF253284 KF252809 KF252338 KF251841 KF251337 

Sep. cf. rubi CBS 128646 Rubus crataegifolius South Korea H.D. Shin KF253314 KF252839 KF252368 KF251871 KF251367 

Sep. cf. stachydicola CBS 128668 Stachys riederi var. japonica South Korea H.D. Shin KF253512 KF253033 KF252558 KF252070 KF251565 

Sep. chelidonii CBS 128607 Chelidonium majus South Korea H.D. Shin KF253319 KF252844 KF252373 KF251876 KF251372 

Sep. chromolaenae CBS 113373 Chromolaena odorata Cuba S. Neser KF253321 KF252846 KF252375 KF251878 KF251374 

Sep. chrysanthemella CBS 128622 Chrysanthemum boreale South Korea H.D. Shin KF253323 KF252848 KF252377 KF251880 KF251376 

CBS 128716 – South Africa E. Oh KF253325 KF252850 KF252379 KF251882 KF251378 

Sep. cirsii CBS 128621 Cirsium setidens South Korea H.D. Shin KF253328 KF252853 KF252382 KF251885 KF251381 

Sep. citricola CBS 356.36 Citrus sinensis Italy G. Ruggieri KF253329 KF252854 KF252383 KF251886 KF251382 

Sep. clematidis CBS 108983 Clematis vitalba Germany G.J.M. Verkley KF253330 KF252855 KF252384 KF251887 KF251383 

Sep. codonopsidis CBS 128620 Codonopsis lanceolata South Korea H.D. Shin KF253333 KF252858 KF252387 KF251890 KF251386 

314





Sep. convolvuli CBS 128627 Calystegia soldanella South Korea H.D. Shin KF253336 KF252861 KF252390 KF251893 KF251389 

Sep. coprosma CBS 113391 Coprosma robusta New Zealand G.J.M. Verkley KF253255 KF252787 KF252313 KF251812 KF251308 

Sep. crepidis CBS 128608 Youngia japonica South Korea H.D. Shin KF253337 KF252862 KF252391 KF251894 KF251390 

CBS 128619 Youngia japonica South Korea H.D. Shin KF253338 KF252863 KF252392 KF251895 KF251391 

Sep. cretae CBS 135095; CPC 651 Nerium oleander Greece U. Damm – KF252720 KF252238 KF251736 KF251233 

Sep. cruciatae CBS 123747 Galium odoratum Czech Republic G.J.M. Verkley KF253340 KF252865 KF252394 KF251897 KF251393 

Sep. cucubali CBS 102386 Saponaria officinalis Netherlands G.J.M. Verkley KF253344 KF252869 KF252398 KF251901 KF251397 

Sep. cucurbitacearum CBS 178.77 Cucurbita maxima New Zealand H.J. Boesewinkel KF253346 – KF252400 KF251903 KF251399 

Sep. dearnessii CBS 128624 Angelica dahurica South Korea H.D. Shin KF253347 KF252871 KF252401 KF251904 KF251400 

Sep. digitalis CBS 391.63 Digitalis lanata Czech Republic V. Holubová KF253349 KF252873 KF252403 KF251906 KF251402 

Sep. dysentericae CBS 131892; CPC 12328 Inula britannica South Korea H.D. Shin KF253353 KF252877 KF252406 KF251910 KF251406 

Sep. epambrosiae CBS 128629 Ambrosia trifida South Korea H.D. Shin KF253356 KF252880 KF252407 KF251913 KF251409 

Sep. epilobii CBS 109084 Epilobium fleischeri Austria G.J.M. Verkley KF253358 KF252882 KF252409 KF251915 KF251411 

CBS 109085 Epilobium fleischeri Austria G.J.M. Verkley KF253359 KF252883 KF252410 KF251916 KF251412 

Sep. erigerontis CBS 186.93 Erigeron annuus Italy M. Vurro KF253364 KF252887 KF252537 KF252048 KF251543 

CBS 109094 Erigeron annuus Austria G.J.M. Verkley KF253360 KF252884 KF252411 KF251917 KF251413 

CBS 131893; CPC 12340 Erigeron annuus South Korea H.D. Shin KF253363 KF252888 KF252414 KF251920 KF251416 

Sep. eucalyptorum CBS 118505 Eucalyptus sp. India W. Gams KF253365 KF252889 KF252415 KF251921 KF251417 

Sep. exotica CBS 163.78 Hebe speciosa New Zealand H.J. Boesewinkel KF253366 KF252890 KF252416 KF251922 KF251418 

Sep. galeopsidis CBS 191.26 Galeopsis sp. – C. Killian KF253370 KF252894 KF252420 KF251926 KF251422 

CBS 102314 Galeopsis tetrahit Netherlands G.J.M. Verkley KF253371 KF252895 KF252421 KF251927 KF251423 

CBS 102411 Galeopsis tetrahit Netherlands G.J.M. Verkley KF253372 KF252896 KF252422 KF251928 KF251424 

Sep. gentianae CBS 128633 Gentiana scabra South Korea H.D. Shin KF253374 KF252898 KF252424 KF251930 KF251426 

“Sep.” gladioli CBS 121.20 – – W.J. Kaiser KF253375 KF252899 KF252425 KF251931 KF251427 

CBS 353.29 – Netherlands J.C. Went KF253376 KF252900 KF252426 KF251932 KF251428 

Sep. glycinicola CBS 128618 Glycine max South Korea H.D. Shin KF253378 KF252902 KF252427 KF251934 KF251430 

Sep. helianthi CBS 123.81 Helianthus annuus – M. Muntañola KF253379 KF252903 KF252428 KF251935 KF251431 

Sep. hibiscicola CBS 128615 Hibiscus syriacus South Korea H.D. Shin KF253382 KF252906 KF252431 KF251938 KF251434 

Sep. hippocastani CBS 411.61 Aesculus hippocastanum Germany W. Gerlach KF253383 KF252907 KF252432 KF251939 KF251435 

CPC 23103; MP11 Aesculus sp. Netherlands S.I.R. Videira KF253510 KF253031 KF252556 KF252068 KF251563 

Sep. justiciae CBS 128625 Justicia procumbens South Korea H.D. Shin KF253385 KF252909 KF252434 KF251941 KF251437 

Sep. lactucae CBS 352.58 Lactuca sativa Germany G. Sörgel KF253388 KF252912 KF252437 KF251944 KF251440 


315





CBS 108943 Lactuca sativa Netherlands P. Grooteman KF253387 KF252911 KF252436 KF251943 KF251439 

Sep. lamiicola CBS 123884 Lamium sp. Czech Republic G.J.M. Verkley KF253397 KF252921 KF252446 KF251953 KF251449 

Sep. lepidiicola CBS 128635 Lepidium virginicum South Korea H.D. Shin KF253398 KF252922 KF252447 KF251954 KF251450 

Sep. leptostachyae CBS 128613 Phryma leptostachya South Korea H.D. Shin KF253399 KF252923 KF252448 KF251955 KF251451 

CBS 128628 Phryma leptostachya South Korea H.D. Shin KF253400 KF252924 KF252449 KF251956 KF251452 

Sep. leucanthemi CBS 109090 Chrysanthemum 

leucanthemum 

Austria G.J.M. Verkley KF253403 KF252927 KF252452 KF251959 KF251455 

Sep. limonum CBS 419.51 Citrus limonum Italy G. Goidánich KF253407 KF252931 KF252456 KF251963 KF251459 

Sep. linicola CBS 316.37 Linum usitatissimum – H.W. Hollenweber KF253408 KF252932 KF252457 KF251964 KF251460 

Sep. lycoctoni CBS 109089 Aconitum vulparia Austria G.J.M. Verkley KF253409 KF252933 KF252458 KF251965 KF251461 

Sep. lycopersici CBS 128654 Lycopersicon esculentum South Korea H.D. Shin KF253410 KF252934 KF252459 KF251966 KF251462 

Sep. lycopicola CBS 128651 Lycopus ramosissimus South Korea H.D. Shin KF253412 KF252936 KF252461 KF251968 KF251464 

Sep. lysimachiae CBS 102315 Lysimachia vulgaris Netherlands G.J.M. Verkley KF253413 KF252937 KF252462 KF251969 KF251465 

CBS 123795 Lysimachia sp. Czech Republic G.J.M. Verkley KF253417 KF252941 KF252466 KF251973 KF251469 

Sep. malagutii CBS 106.80 Solanum sp. Peru G.H. Boerema KF253418 – KF252467 KF251974 KF251470 

Sep. matricariae CBS 109001 Matricaria discoidea Netherlands G.J.M. Verkley KF253420 KF252943 KF252469 KF251976 KF251472 

Sep. mazi CBS 128755 Mazus japonicus South Korea H.D. Shin KF253422 KF252945 KF252471 KF251978 KF251474 

Sep. melissae CBS 109097 Melissa officinalis Netherlands H.A. van der Aa KF253423 KF252946 KF252472 KF251979 KF251475 

Sep. napelli CBS 109105 Aconitum napellus Austria G.J.M. Verkley KF253426 KF252949 KF252474 KF251982 KF251478 

Sep. obesa CBS 354.58 Chrysanthemum indicum Germany R. Schneider KF253431 – KF252479 KF251987 KF251483 

CBS 128588 Artemisia lavandulaefolia South Korea H.D. Shin KF253428 KF252951 KF252476 KF251984 KF251480 

CBS 128623 Chrysanthemum indicum South Korea H.D. Shin KF253429 KF252952 KF252477 KF251985 KF251481 

Sep. oenanthicola CBS 128649 Oenanthe javanica South Korea H.D. Shin KF253187 KF252721 KF252239 KF251737 KF251234 

Sep. oenanthis CBS 128667 Cicuta virosa South Korea H.D. Shin KF253432 KF252953 KF252481 KF251989 KF251485 

Sep. orchidearum CBS 457.78 Listera ovata France H.A. van der Aa KF253435 KF252956 KF252483 KF251991 KF251487 

CBS 128631 Cyclamen fatrense South Korea H.D. Shin KF253434 KF252955 KF252482 KF251990 KF251486 

Sep. pachyspora CBS 128652 Zyathoxylum schinifolium South Korea H.D. Shin KF253437 KF252958 KF252485 KF251993 KF251488 

Sep. paridis CBS 109108 Viola sp. Austria G.J.M. Verkley KF253440 KF252961 KF252488 KF251996 KF251491 

CBS 109111 Paris quadrifolia Austria G.J.M. Verkley KF253438 KF252959 KF252486 KF251994 KF251489 

Sep. passiflorae CBS 102701 Passiflora edulis New Zealand C.F. Hill KF253442 KF252963 KF252490 KF251998 KF251493 

Sep. perillae CBS 128655 Perilla frutescens South Korea H.D. Shin KF253444 KF252965 KF252491 KF252000 KF251495 

Sep. petroselini CBS 182.44 Petroselinum sativum Netherlands S.D. de Wit KF253446 KF252967 KF252493 KF252002 KF251497 

Sep. phlogis CBS 128663 Phlox paniculata South Korea H.D. Shin KF253448 KF252969 KF252495 KF252004 KF251499 

316





Sep. polygonorum CBS 347.67 Polygonum persicaria Netherlands H.A. van der Aa KF253455 KF252976 KF252502 KF252011 KF251506 

CBS 109834 Polygonum persicaria Netherlands G.J.M. Verkley KF253453 KF252974 KF252500 KF252009 KF251504 

Sep. posoniensis CBS 128645 Chrysosplenium japonicum South Korea H.D. Shin KF253456 KF252977 KF252503 KF252012 KF251507 

Sep. protearum CBS 177.77 Fragaria sp. New Zealand H.J. Boesewinkel KF253463 KF252984 KF252509 KF252019 KF251514 

CBS 390.59 Ligustrum vulgare Italy M. Ribaldi KF253467 KF252987 KF252513 KF252023 KF251518 

CBS 566.88 Hedera helix France H.A. van der Aa KF253470 KF252990 KF252515 KF252026 KF251521 

CBS 778.97 Protea cynaroides South Africa L. Viljoen KF253472 KF252992 KF252517 KF252028 KF251523 

CBS 135477; CPC 19675 Zantedeschia aethiopica South Africa P.W. Crous KF253473 KF252993 KF252518 KF252029 KF251524 

Sep. pseudonapelli CBS 128664 Aconitum pseudolaeve var. 

erectum 

South Korea H.D. Shin KF253475 KF252995 KF252520 KF252031 KF251526 

Sep. putrida CBS 109088 Senecio nemorensis Austria G.J.M. Verkley KF253477 KF252997 KF252522 KF252033 KF251528 

Sep. rumicum CBS 503.76 Rumex acetosa France H.A. van der Aa KF253478 KF252998 KF252523 KF252034 KF251529 

Sep. saccardoi CBS 128756 Lysimachia vulgaris South Korea H.D. Shin KF253479 KF252999 KF252524 KF252035 KF251530 

Sep. scabiosicola CBS 102334 Knautia arvensis Netherlands G.J.M. Verkley KF253481 KF253001 KF252526 KF252037 KF251532 

CBS 102336 Knautia arvensis Netherlands G.J.M. Verkley KF253483 KF253003 KF252528 KF252039 KF251534 

CBS 108981 Knautia arvensis Germany G.J.M. Verkley KF253484 KF253004 KF252529 KF252040 KF251535 

CBS 109093 Knautia dipsacifolia Austria G.J.M. Verkley KF253487 KF253007 KF252532 KF252043 KF251538 

Sep. senecionis CBS 102366 Senecio fluviatilis Netherlands G.J.M. Verkley KF253492 KF253012 KF252538 KF252049 KF251544 

CBS 102381 Senecio fluviatilis Netherlands G.J.M. Verkley KF253493 KF253013 KF252539 KF252050 KF251545 

Sep. siegesbeckiae CBS 128659 Siegesbeckia glabrescens South Korea H.D. Shin KF253494 KF253014 KF252540 KF252051 KF251546 

CBS 128661 Siegesbeckia pubescens South Korea H.D. Shin KF253495 KF253015 KF252541 KF252052 KF251547 

Sep. sii CBS 102370 Berula erecta Netherlands G.J.M. Verkley KF253497 KF253017 KF252543 KF252054 KF251549 

Sep. sisyrinchii CBS 112096 Sysirinchium sp. New Zealand C.F. Hill KF253499 KF253019 KF252545 KF252056 KF251551 

Septoria sp. CBS 128650 Taraxacum officinale South Korea H.D. Shin KF253504 KF253024 KF252550 KF252061 KF251556 

CBS 128658 Chrysosplenium japonicum South Korea H.D. Shin KF253505 KF253025 KF252551 KF252062 KF251557 

CBS 128757 Sonchus asper South Korea H.D. Shin KF253500 KF253020 KF252546 KF252057 KF251552 

CBS 135472; CPC 19304 Vigna unguiculata ssp. 

sesquipedalis 

Austria P.W. Crous KF253506 KF253026 KF252552 KF252063 KF251558 

CBS 135474; CPC 19485 Conyza canadensis Brazil R.W. Barreto KF253507 KF253027 KF252553 KF252064 KF251559 

CBS 135478; CPC 19716 Eucalyptus sp. India W. Gams KF253188 KF252722 KF252240 KF251738 KF251235 

CBS 135479; CPC 19793 Syzygium cordatum South Africa P.W. Crous – KF253029 KF252555 KF252066 KF251561 

CPC 19976 Feijoa sellowiana Italy G. Polizzi KF253509 KF253030 – KF252067 KF251562 


317





CPC 21105 Cluvia sp. South Africa P.W. Crous – – KF302396 KF302408 KF302402 

CPC 23104 – Italy E. van Agtmaal KF253511 KF253032 KF252557 KF252069 KF251564 

Sep. stachydis CBS 347.58 Aster canus Germany R. Schneider KF253295 KF252820 KF252349 KF251852 KF251348 

CBS 102326 Stachys sylvatica Netherlands G.J.M. Verkley KF253514 KF253035 KF252560 KF252072 KF251567 

CBS 109115 Campanula glomerata Austria G.J.M. Verkley KF253502 KF253022 KF252548 KF252059 KF251554 

CBS 109127 Stachys sylvatica Austria G.J.M. Verkley KF253517 KF253038 KF252563 KF252075 KF251570 

Sep. stellariae CBS 102376 Stellaria media Netherlands G.J.M. Verkley KF253521 KF253042 KF252567 KF252079 KF251574 

“Sep.” steviae CBS 120132 Stevia rebaudiana Japan J. Ishiba KF253191 – KF252243 KF251741 KF251238 

“Sep.” tanaceti CBS 358.58 Tanacetum vulgare Germany R. Schneider KF253192 – KF252244 KF251742 KF251239 

Sep. taraxaci CBS 567.75 Taraxacum sp. Armenia H.A. van der Aa KF253524 KF253045 KF252570 KF252082 KF251577 

Sep. tinctoriae CBS 129154 Serratula coronata South Korea H.D. Shin KF253525 KF253046 KF252571 KF252083 KF251578 

Sep. tormentillae CBS 128643 Potentilla fragarioides South Korea H.D. Shin KF253526 KF253047 KF252572 KF252084 KF251579 

CBS 128647 Potentilla fragarioides South Korea H.D. Shin KF253527 KF253048 KF252573 KF252085 KF251580 

Sep. urticae CBS 102316 Glechoma hederacea Netherlands G.J.M. Verkley KF253528 KF253049 KF252574 KF252086 KF251581 

CBS 102375 Urtica dioica Netherlands G.J.M. Verkley KF253530 KF253051 KF252576 KF252088 KF251583 

Sep. verbascicola CBS 102401 Verbascum nigrum Netherlands G.J.M. Verkley KF253531 KF253052 KF252577 KF252089 KF251584 

Sep. verbenae CBS 113438 Verbena officinalis New Zealand G.J.M. Verkley KF253532 KF253053 KF252578 KF252090 KF251585 

Sep. villarsiae CBS 514.78 Nymphoides peltata Netherlands H.A. van der Aa KF253534 KF253055 KF252580 KF252092 KF251587 

Sep. violae-palustris CBS 128644 Viola selkirkii South Korea H.D. Shin KF253537 KF253058 KF252583 KF252095 KF251590 

CBS 128660 Viola yedoensis South Korea H.D. Shin KF253538 KF253059 KF252584 KF252096 KF251591 

septoria-like sp. CBS 134910; CPC 19500 Tibouchina herbacea Brazil D.F. Parreira KF302391 KF302386 KF302397 KF302409 KF302403 

CBS 135471; CPC 19294 Corymbia gummifera Australia P.W. Crous KF253193 KF252725 KF252245 KF251743 KF251240 

CBS 135473; CPC 19311 Phragmites sp. USA – KF253194 KF252726 KF252246 KF251744 KF251241 


S672 

Polygonatum sp. Netherlands U. Damm – – KF252247 KF251745 KF251242 

Septorioides pini-thunbergii CBS 473.91 Pinus thunbergii Japan S. Kaneko & Y. Zinno – KF252727 KF252248 KF251746 KF251243 

Setophoma chromolaenae CBS 135105; CPC 18553 Chromolaena odorata Brazil R.W. Barreto KF253195 KF252728 KF252249 KF251747 KF251244 

Setop. sacchari CBS 333.39 Saccharum officinarum Brazil A.A. Bitancourt – – KF252250 KF251748 KF251245 

Setop. terrestris CBS 335.29 Allium sativum USA H.N. Hansen KF253196 KF252729 KF252251 KF251749 KF251246 

CBS 335.87 Allium cepa Senegal – KF253197 KF252730 KF252252 KF251750 KF251247 

CBS 377.52 Allium cepa – R.H. Larson KF253198 KF252731 KF252253 KF251751 KF251248 

CBS 135470; CPC 18417 Zea mays South Africa S. Lamprecht KF253189 KF252723 KF252241 KF251739 KF251236 

318





Setoseptoria phragmitis CBS 114802 Phragmites australis Hong Kong K.D. Hyde KF253199 KF252732 KF252254 KF251752 KF251249 

CBS 114966 Phragmites australis Hong Kong K.D. Hyde KF253200 KF252733 KF252255 KF251753 KF251250 

Sphaerulina abeliceae CBS 128591 Zelkova serrata South Korea H.D. Shin KF253539 – KF252585 KF252097 KF251592 

Sph. aceris CBS 687.94 Acer pseudoplatanus Netherlands G.J.M. Verkley KF253542 KF253061 KF252588 KF252100 KF251595 

Sph. amelanchier CBS 102063 Actinidia deliciosa New Zealand C.F. Hill KF253581 KF253096 KF252627 KF252140 KF251635 

CBS 135110; MP8 Amelanchier sp. Netherlands S.I.R. Videira KF253543 KF253062 KF252589 KF252101 KF251596 

CPC 23105; MP22 Quercus sp. Netherlands S.I.R. Videira KF253544 KF253063 KF252590 KF252102 KF251597 

CPC 23106; MP7 Castanea sp. Netherlands S.I.R. Videira KF253545 KF253064 KF252591 KF252103 KF251598 

CPC 23107; MP9 Betula sp. Netherlands S.I.R. Videira KF253583 KF253098 KF252626 KF252139 KF251634 

Sph. azaleae CBS 352.49 Rhododendron sp. Belgium J. van Holder KF253547 KF253066 KF252593 KF252105 KF251600 

CBS 128605 Rhododendron sp. South Korea H.D. Shin KF253546 KF253065 KF252592 KF252104 KF251599 

Sph. berberidis CBS 324.52 Berberis vulgaris Switzerland E. Müller KF253548 KF253067 KF252594 KF252106 KF251601 

Sph. betulae CBS 116724 Betula pubescens Netherlands S. Green KF253549 KF253068 KF252595 KF252107 KF251602 

CBS 128600 Betula platyphylla var. japonica South Korea H.D. Shin KF253552 KF253071 KF252598 KF252110 KF251605 

Sph. cercidis CBS 501.50 Cercis siliquastrum Netherlands G. van den Ende KF253556 KF253075 KF252601 KF252113 KF251608 

CBS 118910 Eucalyptus sp. France P.W. Crous KF253553 KF253072 KF252602 KF252114 KF251609 

CBS 128634 Cercis siliquastrum Argentina H.D. Shin KF253554 KF253073 KF252599 KF252111 KF251606 

CBS 129151 Cercis siliquastrum Argentina H.D. Shin KF253555 KF253074 KF252600 KF252112 KF251607 

Sph. cornicola CBS 102324 Cornus sp. Netherlands A. van Iperen KF253557 KF253076 KF252603 KF252115 KF251610 

CBS 102332 Cornus sp. Netherlands A. van Iperen KF253558 KF253077 KF252604 KF252116 KF251611 

Sph. frondicola CBS 391.59 Populus pyramidalis Germany R. Schneider KF253572 – KF252617 KF252130 KF251625 

Sph. gei CBS 102318 Geum urbanum Netherlands G.J.M. Verkley KF253560 KF253079 KF252605 KF252118 KF251613 

CBS 128632 Geum japonicum South Korea H.D. Shin KF253562 KF253081 KF252607 KF252120 KF251615 

Sph. hyperici CBS 102313 Hypericum sp. Netherlands G.J.M. Verkley KF253563 KF253082 KF252608 KF252121 KF251616 

Sph. menispermi CBS 128666 Menispermum dauricum South Korea H.D. Shin KF253564 KF253083 KF252609 KF252122 KF251617 

CBS 128761 Menispermum dauricum South Korea H.D. Shin KF253565 KF253084 KF252610 KF252123 KF251618 

Sph. musiva CBS 130570 Populus deltoides Canada J. LeBoldus JX901725 JX902304 JX902058 JX901935 JX901812 

Sph. myriadea CBS 124646 Quercus dentata Japan K. Tanaka KF253201 KF252734 KF252256 KF251754 KF251251 

Sph. oxyacanthae CBS 135098; S654 Crataegus sp. Netherlands W. Quaedvlieg KF253202 KF252735 KF252257 KF251755 KF251252 

Sph. patriniae CBS 128653 Patrinia scabiosaefolia South Korea H.D. Shin KF253570 KF253087 KF252615 KF252128 KF251623 

Sph. populicola CBS 100042 Populus trichocarpa USA G. Newcombe KF253573 – KF252618 KF252131 KF251626 

Sph. pseudovirgaureae CBS 135109; S669 Solidago gigantea Netherlands S.I.R. Videira KF253203 KF252736 KF252258 KF251756 KF251253 


319





Sph. quercicola CBS 663.94 Quercus robur Netherlands H.A. van der Aa KF253577 KF253092 KF252622 KF252135 KF251630 

CBS 109009 Quercus rubra Netherlands G.J.M. Verkley KF253574 KF253089 KF252619 KF252132 KF251627 

CBS 115016 Quercus robur Netherlands G.J.M. Verkley KF253575 KF253090 KF252620 KF252133 KF251628 



Sph. socia CBS 355.58 Rosa sp. – – KF253579 KF253094 KF252624 KF252137 KF251632 

CBS 357.58 Chrysanthemum leucanthemum Germany R. Schneider KF253580 KF253095 KF252625 KF252138 KF251633 

Sph. tirolensis CBS 109017 Rubus idaeus Austria G.J.M. Verkley KF253584 KF253099 KF252629 KF252142 KF251637 

CBS 109018 Rubus idaeus Austria G.J.M. Verkley KF253585 KF253100 KF252630 KF252143 KF251638 

Sph. viciae CBS 131898 Vicia amurense South Korea H.D. Shin KF253586 KF253101 KF252631 KF252144 KF251639 

Sph. westendorpii CBS 117478 Rubus fruticosus Netherlands G.J.M. Verkley KF253589 KF253104 KF252634 KF252147 KF251642 

Stagonospora cf. paludosa CBS 130005 Carex sp. Russia – KF253204 KF252737 KF252259 KF251757 KF251254 

Sta. duoseptata CBS 135093; S618 Carex acutiformis Netherlands W. Quaedvlieg KF253205 KF252738 KF252260 KF251758 KF251255 

“Sta.” foliicola CBS 110111 Phalaris arundinacea USA N. O’Neil KF253206 KF252739 KF252261 KF251759 KF251256 

Sta. paludosa CBS 135088; S601 Carex acutiformis Netherlands W. Quaedvlieg KF253207 KF252740 KF252262 KF251760 KF251257 

Sta. perfecta CBS 135099; S656 Carex acutiformis Netherlands W. Quaedvlieg KF253208 – KF252263 KF251761 KF251258 

Sta. pseudocaricis CBS 135132; S610 Carex acutiformis France A. Gardiennet KF253210 KF252742 KF252265 KF251763 KF251260 

CBS 135414; S609 Carex acutiformis France A. Gardiennet – KF302383 KF302395 KF302407 KF302401 

Sta. pseudovitensis CBS 135094; S620 Carex acutiformis Netherlands W. Quaedvlieg KF253211 KF252743 KF252266 KF251764 KF251261 

S602 Carex acutiformis Netherlands W. Quaedvlieg KF253212 KF252744 KF252267 KF251765 KF251262 

Stagonospora sp. CBS 135096; 652 Carex acutiformis France A. Gardiennet – – KF252268 KF251766 KF251263 

Sta. uniseptata CBS 135090; S611 Carex acutiformis Netherlands W. Quaedvlieg – KF252745 KF252269 KF251767 KF251264 

CPC 22150; S608 Carex acutiformis Netherlands W. Quaedvlieg KF253214 KF252747 KF252271 KF251769 KF251266 

CPC 22151; S607 Carex acutiformis Netherlands W. Quaedvlieg KF253213 KF252746 KF252270 KF251768 KF251265 

stagonospora-like sp. CBS 516.74 Triticum aestivum Brazil Y.R. Mehta KF253215 KF252748 KF252272 KF251770 KF251267 

CBS 135482; CPC 22155; Poa sp. Netherlands W. Quaedvlieg KF253216 KF252749 KF252273 KF251771 KF251268 

S526 

CBS 135483; CPC 22157; S617 

Carex acutiformis Netherlands W. Quaedvlieg KF253217 KF252750 KF252274 KF251772 KF251269 

S619 Carex acutiformis Netherlands W. Quaedvlieg KF253218 KF252751 KF252275 KF251773 KF251270 

Stromatoseptoria castaneicola CBS 102322 Castanea sativa Netherlands G.J.M. Verkley KF253219 KF252752 KF252276 KF251774 KF251271 

CBS 102377 Castanea sativa Netherlands G.J.M. Verkley KF253220 KF252753 KF252277 KF251775 KF251272 

Teratosphaeria juvenalis CBS 111149 Eucalyptus cladocalyx South Africa P.W. Crous KF253221 KF252754 KF252278 KF251776 KF251273 

320





Ter. molleriana CBS 111164 Eucalyptus globulus Portugal M.J. Wingfield KF253222 KF252755 KF252279 KF251777 KF251274 

Ter. parva CBS 119901 Eucalyptus globulus Ethiopia A. Gezahgne KF253223 KF252756 KF252280 KF251778 KF251275 

Ter. pseudoeucalypti CBS 124577 Eucalyptus grandis × 

Australia V. Andjic KF253224 KF252757 KF252281 KF251779 KF251276 

E. camaldulensis 

Ter. suberosa CPC 13106 Eucalyptus dunnii Australia A.J. Carnegie KF253183 – KF252232 KF251730 KF251227 

Ter. toledana CBS 113313 Eucalyptus sp. Spain P.W. Crous & G. Bills KF253225 KF252758 KF252282 KF251780 KF251277 

Vrystaatia aloeicola CBS 135107; CPC 20617 Aloe maculata South Africa P.W. Crous & W.J. Swart – KF252759 KF252283 KF251781 KF251278 

Xenobotryosphaeria calamagrostidis CBS 303.71 Calamagrostis sp. Italy G.A. Hedjaroude KF253226 KF252760 KF252284 KF251782 KF251279 

Xenoseptoria neosaccardoi CBS 120.43 Cyclamen persicum Netherlands Roodenburg KF253227 KF252761 KF252285 KF251783 KF251280 

CBS 128665 Lysimachia vulgaris var. South Korea H.D. Shin KF253228 KF252762 KF252286 KF251784 KF251281 

davurica 

Zasmidium anthuriicola CBS 118742 Anthurium sp. Thailand C.F. Hill KF253229 KF252763 KF252287 KF251785 FJ839626 

Zas. citri CPC 13467 Eucalyptus sp. Thailand W. Himaman KF253182 KF252714 KF252231 KF251729 KF251226 

Zas. lonicericola CBS 125008 Lonicera japonica South Korea H.D. Shin KF253231 KF252765 KF252289 KF251787 KF251283 

Zas. nocoxi CBS 125009 Twig debris USA P.W. Crous KF253232 KF252766 KF252290 KF251788 KF251284 

Zas. scaevolicola CBS 127009 Scaevola taccada Australia R.G. Shivas & P.W Crous KF253233 KF252767 KF252291 KF251789 KF251285 

Zymoseptoria brevis CBS 128853 Phalaris minor Iran – JQ739777 JF700968 JF700799 JQ739833 JF700867 

CPC 18109 Phalaris paradoxa Iran – JQ739779 JF700970 JF700801 JQ739835 JF700869 

CPC 18112 Phalaris paradoxa Iran – JQ739782 JF700973 JF700804 JQ739838 JF700872 

Zym. halophila CBS 128854; CPC 18105 Hordeum glaucum Iran M. Razavi KF253592 – JF700808 KF252150 KF251645 

Zym. passerinii CBS 120384 Hordeum vulgare USA S. Ware JQ739788 JF700878 JF700979 JQ739844 JF700810 

CBS 120385 Hordeum vulgare USA S. Ware JQ739789 JF700980 JF700811 JQ739845 JF700879 

Zym. pseudotritici CBS 130976 Dactylis glomerata Iran M. Javan-Nikkhah JQ739772 JN982484 JN982482 JQ739828 JN982480 

Zym. tritici CPC 18117 Avena sp. Iran – JQ739801 JF700986 JF700817 JQ739857 JF700885 

1 CBS: CBS-KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands; CPC: Culture collection of Pedro Crous, housed at CBS; IMI: International Mycological Institute, CABI-Bioscience, Egham, Bakeham Lane, U.K.; MP: Working collection of Sandra 

Videira; S: Working collection of William Quaedvlieg. 

2 Btub: β-tubulin; EF-1α: Translation elongation factor 1-alpha; ITS: internal transcribed spacers and intervening 5.8S nrDNA; LSU: 28S large subunit of the nrRNA gene; RPB2: RNA polymerase II second largest subunit. 


321


0.1 

0.96 

0.98 

0.56 

0.8 

0.95 

0.58 


Septoria calendulae CBS 349.58 




Septoria galeopsidis CBS 191.26 

Septoria melissae CBS 109097 

Septoria orchidearum CBS 457.78 

Septoria verbascicola CBS 102401 

Septoria taraxaci CBS 567.75 




Septoria orchidearum CBS 128631 






Septoria chelidonii CBS 128607 

Septoria digitalis CBS 391.63 


Septoria leptostachyae CBS 128613 

1 Septoria leptostachyae CBS 128628 

Septoria codonopsidis CBS 128620 




1 



1 


Septoria callistephi CBS 128590 

Septoria convolvuli CBS 128627 

Septoria perillae CBS 128655 

Septoria dysentericae CPC 12328 

Septoria pachyspora CBS 128652 


Septoria glycinicola CBS 128618 


Septoria phlogis CBS 128663 


Septoria polygonorum CBS 347.67 

Septoria epambrosiae CBS 128629 

Septoria cf. stachydicola CBS 128668 

Septoria saccardoi CBS 128756 

Septoria exotica CBS 163.78 

Septoria posoniensis CBS 128645 


Septoria cirsii CBS 128621 

Septoria lycoctoni CBS 109089 




1 Septoria senecionis CBS 102366 



1 Septoria 

Mycosphaerellaceae 

Fig. 1. A Bayesian 50 % majority rule RPB2/LSU consensus tree containing all Septoria and septoria-like taxa available at the CBS, which cluster in or near the Mycosphaerellaceae. 

Bayesian posterior probabilities support values for the respective nodes are displayed in the tree. A stop rule (set to 0.01) for the critical value for the topological convergence 

diagnosticwas used for the Bayesian analysis. The tree was rooted to Phaeosphaeria nodorum (CBS 259.49). The scalebar indicates 0.1 expectedchanges per site. 

322


0.1 

0.56 

0.71 


1 Septoria obesa CBS 128623 

Septoria obesa CBS 354.58 


Septoria pseudonapelli CBS 128664 

Septoria putrida CBS 109088 

Septoria lycopicola CBS 128651 




1 Septoria malagutii CBS 106.80 

Septoria lycopersici CBS 128654 

Septoria cucurbitacearum CBS 178.77 


Septoria petroselini CBS 182.44 

Septoria anthrisci CBS 109020 

Septoria astericola CBS 128593 

Septoria cf. rubi CBS 128646 

Septoria cf. agrimoniicola CBS 128602 

Septoria cf. agrimoniicola CBS 128585 

Septoria tinctoriae CBS 129154 

Septoria bothriospermi CBS 128599 


1 

Septoria erigerontis CBS 186.93 

Septoria erigerontis CPC 12340 



Septoria helianthi CBS 123.81 

Septoria matricariae CBS 109001 

Septoria atropurpurea CBS 348.58 




1 Septoria limonum CBS 419.51 



0.83 


Septoria citricola CBS 356.36 


Septoria linicola CBS 316.37 

0.59 

0.74 

0.67 

1 

0.98 

0.76 

1 

1 

Septoria cretae CBS 135095 





Septoria lepidiicola CBS 128635 

Septoria cruciatae CBS 123747 

Septoria verbenae CBS 113438 

Septoria sisyrinchii CBS 112096 

Septoria chromolaenae CBS 113373 

Septoria anthurii CBS 346.58 

Septoria passiflorae CBS 102701 

Septoria abei CBS 128598 

Septoria hibiscicola CBS 128615 

Septoria eucalyptorum CBS 118505 

1 Septoria (continued) 




323


0.1 

0.99 

0.64 

0.53 

1 

0.55 

0.98 

0.91 

0.86 

0.73 

0.85 

1 

1 

1 

0.94 

0.84 

0.55 

Septoria rumicum CBS 503.76 






“Pseudocercosporella” magnusiana CBS 114735 

Septoria bupleuricola CBS 128603 

Septoria clematidis CBS 108983 


0.98 

0.55 

0.97 

0.97 

Septoria oenanthis CBS 128667 

Septoria sii CBS 102370 

Septoria mazi CBS 128755 

Septoria lactucae CBS 108943 

1 Septoria lactucae CBS 352.58 


Septoria gentianae CBS 128633 

Septoria oenanthicola CBS 128649 

Septoria coprosma CBS 113391 

Septoria campanulae CBS 128604 


Septoria dearnessii CBS 128624 

Septoria hippocastani CPC 23103 

Septoria hippocastani CBS 411.61 


1 



Sphaerulina amelanchier CBS 135110 



Sphaerulina amelanchier CBS 102063 

Sphaerulina pseudovirgaureae CBS 135109 


1 


Sphaerulina viciae CBS 131898 

Sphaerulina patriniae CBS 128653 


Sphaerulina cercidis CBS 501.50 





Sphaerulina hyperici CBS 102313 

Sphaerulina azaleae CBS 128605 

Sphaerulina azaleae CBS 352.49 

Sphaerulina berberidis CBS 324.52 






Sphaerulina quercicola CBS 663.94 

1 

1 

1 

1 

1 

1 




1 Sphaerulina populicola CBS 100042 


Sphaerulina frondicola CBS 391.59 




1 Septoria (continued) 

2 Sphaerulina 



324


0.1 

1 

1 

1 

1 

0.99 

0.98 

1 

0.96 

1 

1 

0.94 

0.55 

1 

0.69 

0.59 

0.75 

0.57 

1 

Sphaerulina oxyacanthae CBS 135098 

Sphaerulina abeliceae CBS 128591 

1 Sphaerulina cornicola CBS 102332 



Sphaerulina myriadea CBS 124646 


1 Caryophylloseptoria lychnidis CBS 109102 



1 Caryophylloseptoria silenes CBS 109100 

Caryophylloseptoria silenes CBS 109103 

1 Caryophylloseptoria spergulae CBS 397.52 

Caryophylloseptoria spergulae CBS 109010 

Caryophylloseptoria pseudolychnidis CBS 128614 

1 






Pseudocercosporella capsellae CBS 127.29 

0.98 



Mycosphaerella sp. CPC 11677 

Passalora depressa CPC 14915 

Pseudocercosporella pastinacae CBS 114116 

Cercospora zebrina CBS 118790 

1 

Cercospora zebrina CBS 137.56 

Cercospora zebrina IMI 262766 

Cercospora capsici CBS 118712 

1 

Cercospora capsici CBS 118712 

1 Cercospora beticola CBS 124.31 

Cercospora beticola CPC 5070 

Phloeospora ulmi CBS 101564 

Phloeospora ulmi CBS 109835 

1 



‘Septoria’ gladioli CBS 353.29 

‘Septoria’ gladioli CBS 121.20 

1 Passalora dioscoreae CPC 10855 

Passalora dioscoreae CPC 11513 

Neoseptoria caricis CBS 135097 


0.58 Pseudocercospora eucalyptorum CPC 13816 

1 Pseudocercospora robusta CBS 111175 


Pseudocercospora norchiensis CBS 120738 

1 Pseudocercospora chiangmaiensis CBS 123244 

0.99 Pseudocercospora schizolobii CBS 120029 

1 Pseudocercospora madagascariensis CBS 124155 

Pseudocercospora tereticornis CPC 13299 

Zymoseptoria brevis CBS 128853 


Zymoseptoria brevis CPC 18109 

Zymoseptoria pseudotritici CBS 130976 

Zymoseptoria tritici CPC 18117 

Zymoseptoria passerinii CBS 120385 

1 Zymoseptoria passerinii CBS 120384 

Zymoseptoria halophila CPC 18105 

Ramularia eucalypti CBS 120726 

Ramularia pratensis CPC 11294 

Ramularia lamii CPC 11312 

Ramularia sp. CBS 115913 

Ramularia endophylla CBS 113265 

0.82 

1 

2 Sphaerulina (continued) 

3 Caryophylloseptoria 

4 pseudocercosporella-like 

5 Cercospora 

6 Phloeospora 

7 septoria-like 

8 passalora-like 

9 Neoseptoria 

10 Pseudocercospora 

11 Zymoseptoria 

12 Ramularia 




325


8x 

1 

0.1 

4x 

1 

1 

0.98 

1 

1 

1 

0.91 

1 

1 

1 

1 

Dothistroma pini CBS 116484 





Dothistroma septosporum CPC 16799 

1 

Dothistroma septosporum CBS 383.74 

Dothistroma septosporum CPC 16798 

Stromatoseptoria castaneicola CBS 102322 

Stromatoseptoria castaneicola CBS 102377 

L. acicola CBS 322.33 

L. acicola CBS 133791 

1 L. guatamalensis IMI 281598 

1 

L. longispora CBS 133602 

0.66 

L. brevispora CBS 133601 

1 

1 Ph. eugeniae CPC 15143 

Ph. eugeniae CPC 15159 

Cy. martiniana CBS 135102 

0.51 Z. citri CPC 13467 

0.92 Z. scaevolicola CBS 127009 

1 Z. anthuriicola CBS 118742 

1 Z. lonicericola CBS 125008 

1 

Z. nocoxi CBS 125009 

Po. terminaliae CBS 135475 

1 Po. terminaliae CBS 135106 

Po. tabebuiae-serratifoliae CBS 112650 

1 Ruptoseptoria unedonis CBS 355.86 

Ruptoseptoria unedonis CBS 755.70 

D. commune CPC 12397 

0.95 Readeriella eucalypti CPC 13401 

1 Readeriella readeriellophora CPC 12920 

1 

Readeriella angustia CBS 124998 

T. suberosa CPC 13106 

Teratosphaeria parva CBS 119901 

Teratosphaeria molleriana CBS 111164 

Teratosphaeria toledana CBS 113313 

Teratosphaeria juvenalis CBS 111149 

Teratosphaeria pseudoeucalypti CBS 124577 

septoria-like sp. CBS 134910 

0.73 

Cylindroseptoria ceratoniae CBS 477.69 

Cylindroseptoria pistaciae CBS 471.69 

1 Pseudoseptoria obscura CBS 135103 

Pseudoseptoria collariana CBS 135104 

Phaeosphaeria “nodorum” CBS 259.49 

13 Dothistroma 

14 Stromatoseptoria 

15 Lecanosticta 

16 Phaeophleospora 

17 Cytostagonospora 

18 Zasmidium 

19 Polyphialoseptoria 

20 Ruptoseptoria 

21 Dissoconium 

22 Readeriella 

23 Teratosphaeria 

24 septoria-like 

25 Cylindroseptoria 

26 Pseudoseptoria 


Dissoconiaceae 

Teratosphaeriaceae 


Dothideaceae 

Dothioraceae 


Table 2. Primer combinations used during this study for generic amplification and sequencing. 

Locus Primer Primer sequence 5’ to 3’ Annealing 

temperature (°C) 

Orientation 

Reference 

Translation elongation factor-1α EF1-728F CATCGAGAAGTTCGAGAAGG 52 Forward Carbone & Kohn (1999) 

EF-2 GGARGTACCAGTSATCATGTT 52 Reverse O’Donnell et al. (1998) 

β-tubulin T1 AACATGCGTGAGATTGTAAGT 52 Forward O’Donnell & Cigelnik (1997) 

β-Sandy-R GCRCGNGGVACRTACTTGTT 52 Reverse Stukenbrock et al. (2012) 

RNA polymerase II second largest fRPB2-5F GAYGAYMGWGATCAYTTYGG 49 Forward Liu et al. (1999) 

subunit 

fRPB2-414R ACMANNCCCCARTGNGWRTTRTG 49 Reverse Quaedvlieg et al. (2011) 

LSU LSU1Fd GRATCAGGTAGGRATACCCG 52 Forward Crous et al. (2009a) 

LR5 TCCTGAGGGAAACTTCG 52 Reverse Vilgalys & Hester (1990) 

ITS ITS5 GGAAGTAAAAGTCGTAACAAGG 52 Forward White et al. (1990) 

ITS4 TCCTCCGCTTATTGATATGC 52 Reverse White et al. (1990) 

326


Table 3. Amplification success, phylogenetic data and the substitution models used in the phylogenetic analysis, per locus. 

Locus RPB2 LSU 

Amplification succes (%) 99.20 % 100 % 

Number of characters 327 792 

Unique site patterns 197 216 

Substitution model used GTR-I-gamma GTR-I-gamma 

Number of generations (1000×) 2575 

Total number of trees (n) 5152 

Sampled trees (n) 3864 

which 26 contained species belonging to the Septoria (-like) complex. 

These 47 resolved clades belong to a multitude of different families 

within the Dothidiomycetes ranging from the Mycosphaerellaceae in 

the Capnodiales to the Lentitheciaceae in the Pleosporales. It is still 

unclear within the Dothidiomycetes where the phylogenetic family 

borders are located, or even how many phylogenetically substainable 

families there actually are. The family annotation in the phylogenetic 

trees (Figs 1, 2) is therefore based on the closest LSU neighbour that 

was available in GenBank, with clades treated as incertae sedis if no 

closer relationship than 97 % could be found. 

Septoria and septoria-like genera 

In addition to Septoria s. str., numerous septoria-like genera 

(pycnidial/acervular/stromatic conidioma with filiform conidia) have 

since been described. Although the majority of these have no extype 

culture available for DNA analysis, many have type material 

deposited in herbaria, which were available for morphological 

examination. A summary of these genera is provided below. 

Pycnidial forms 

Cytostagonospora Bubák, Ann. Mycol. 14: 150. 1916. Fig. 

3. 

Mycelium immersed, dark brown, branched, septate. Conidiomata 

pycnidial, amphigenous, separate, globose, dark brown to black, 

immersed, unilocular, thick-walled, clypeate; walls of dark brown, 

thick-walled textura angularis to textura globulosa, becoming 

hyaline towards the conidiogenous region, extending in the upper 

part to become a circular clypeus of similar thickness to the wall. 

Ostiole central, circular, papillate to shortly rostrate, depressed, 

situated immersed within the clypeus. Conidiophores reduced to 

conidiogenous cells. Conidiogenous cells holoblastic, determinate, 

discrete, lageniform, hyaline, smooth, formed from the inner cells of 

the pycnidial wall. Conidia hyaline, 0–2-euseptate, not constricted 

at septa, base truncate, apex obtuse, thin-walled, eguttulate, 

smooth, filiform, often curved (Sutton 1980). 

Type species: C. photiniicola Bubák, Ann. Mycol. 14(3–4): 150. 

1916. 

Notes: Von Arx (1983) and Sutton (1980) disagreed about the link 

of Cytostagonospora to Septoria. Von Arx treated it as a synonym 

of Septoria, while Sutton retained it as a separate genus. 

Dearnessia Bubák, Hedwigia 58: 25. 1916. 

Mycelium hyaline to brown, branched, septate. Conidiomata 

pycnidial, amphigenous, separate, globose, immersed, brown; 

wall of thin-walled textura angularis. Ostiole central, circular, 

papillate. Setae ostiolar, approximately straight, unbranched, 

tapered towards apex, dark brown, smooth, thin-walled, septate. 

Conidiogenous cells holoblastic, determinate, discrete, doliiform 

to ampulliform, hyaline, smooth and formed from the inner layer 

of the pycnidial wall. Conidia cylindrical to irregular, hyaline, 

1–multi-transversely euseptate, rarely with 1–2 longitudinal 

eusepta, continuous or constricted, often tapered at the apex, 

base truncate, thin-walled, smooth, guttulate or not (Sutton 1980). 

Type species: D. apocyni Bubák, Hedwigia 58: 25. 1916. 

Dearnessia apocyni Bubák, Hedwigia 58: 25. 1916. Figs 4, 

5. 

Leaf spots amphigenous, irregular, feathery to angular, dark brown, 

3–6 mm diam, surrounded by a wide chlorotic zone up to 3 mm 

diam. Conidiomata epiphyllous, pycnidial, erumpent, up to 150 

µm diam, with central ostiole; wall of 3–6 layers of brown textura 

angularis. Conidiogenous cells doliiform, globose to subcylindrical, 

hyaline, smooth, thin-walled, mode of proliferation obscure, 5–10 × 

4–6 µm. Conidia hyaline, smooth, subcylindrical to obclavate, apex 

obtuse, base truncate to subobtuse, straight to irregular (lateral 

swellings?), 1–4-septate, 16–33 × 5–8 µm. 

Specimen examined: Canada, Ontario, London, on leaves of Apocynum 

androsaemifolium (Apocynaceae), 11 Aug. 1910, J. Dearness, holotype F43227. 

Notes: Because the specimen is in poor condition, no definite 

conclusion could be reached about its potential relationships. 

However, D. apocyni does appear septoria-like in general 

morphology. 

Jahniella Petr., Ann. Mycol. 18: 123. 1921. [1920]. Figs 6, 7. 

Mycelium branched, immersed, septate, brown. Conidiomata 

pycnidial, superficial on epidermis, immersed, separate, globose, 

papillate, dark brown, thick-walled, sclerenchymatic; wall consisting 

of an outer layer of dark brown, thick-walled textura angularis, 

a middle layer of 8 cells thick, of hyaline to pale brown, thickwalled 

cells, and an inner layer of thin-walled, hyaline, irregular 

cells. Ostiole single, circular, with a distinct channel and hyaline 


327


0.01 

0.94 

0.93 

0.55 

0.86 

0.98 

0.97 

0.78 

1 

0.91 

Parastagonospora avenae CBS 289.69 

0.83 

1 Parastagonospora avenae CBS 290.69 

0.99 Parastagonospora caricis CBS 135671 

Parastagonospora nodorum CBS 110109 

1 

Phaeosphaeria nigrans CBS 307.79 

0.84 

Parastagonospora poae CBS 135089 

1 

1 

Parastagonospora poae CBS 135091 

Parastagonospora “nodorum” CBS 259.49 

1 

“Septoria” agropyrina CBS 387.64 

1 

“Stagonospora” foliicola CBS 110111 

“Septoria” arundinacea CBS 133.68 

0.96 

0.83 

Neostagonospora elegiae CBS 135101 

Neostagonospora caricis CBS 135092 

phaeosphaeria-like sp. CBS 135469 

1 

0.94 Chaetosphaeronema hispidulum CBS 216.75 

1 Phaeosphaeria caricicola CBS 603.86 

Phaeosphaeria juncicola CBS 110108 

0.79 

Phaeosphaeriopsis glaucopunctata CBS 653.86 

stagonospora-like sp. CBS 135483 

1 

1 stagonospora-like sp. S619 

0.66 “Phaeosphaeria” vagans CBS 604.86 

“Phaeosphaeria” pontiformis CBS 117487 

1 

“Septoria” arundinacea CBS 281.72 

0.70 

Leptosphaeria albopunctata CBS 254.64 

1 

Sclerostagonospora phragmiticola CBS 338.86 

0.77 “Phaeosphaeria” phragmiticola CBS 459.84 


1 

phaeosphaeria-like sp. CPC 12130 

0.98 

Phaeosphaeria sp. CBS 206.87 

1 Phaeosphaeria papayae CBS 135416 

0.99 

Phaeosphaeria oryzae CBS 110110 

stagonospora-like sp. CBS 135482 

Phaeosphaeria sp. CBS 135465 

stagonospora-like sp. CBS 516.74 

phaeosphaeria-like sp. CBS 123.76 

1 


1 Neosetophoma samarorum CBS 139.96 

Neosetophoma samarorum CBS 568.94 

1 

Neosetophoma samarorum CBS 138.96 

“Phaeosphaeria” typharum CBS 296.54 

1 

“Phaeosphaeria” alpina CBS 456.84 

Paraphoma chrysanthemicola CBS 172.70 

1 

Paraphoma chrysanthemicola CBS 522.66 

0.98 

Paraphoma radicina CBS 111.79 

1 

0.59 Paraphoma radicina CBS 102875 

Paraphoma dioscoreae CPC 11361 

1 

0.71 Paraphoma dioscoreae CBS 135100 

Paraphoma dioscoreae CPC 11355 

1 Paraphoma fimeti CBS 170.70 

1 

Paraphoma fimeti CBS 368.91 

Xenoseptoria neosaccardoi CBS 120.43 

1 

Xenoseptoria neosaccardoi CBS 128665 

Vrystaatia aloeicola CBS 135107 

Setophoma terrestris CBS 135470 

1 

Setophoma terrestris CBS 335.87 

1 



Setophoma sacchari CBS 333.39 

1 

Setophoma chromolaenae CBS 135105 

0.96 

27 Parastagonospora 

28 Neostagonospora 

29 Phaeosphaeriopsis 

30 Incertae sedis 

31 Phaeosphaeria 

32 Neosetophoma 

33 Paraphoma 

34 Xenoseptoria 

35 Vrystaatia 

36 Setophoma 


Fig. 2. A Bayesian 50 % majority rule RPB2/LSU consensus tree containing all Septoria and septoria-like taxa available at the CBS, which cluster in or near the 

Phaeosphaeriaceae. Bayesian posterior probabilities support values for the respective nodes are displayed in the tree. A stop rule (set to 0.01) for the critical value 

for the topological convergence diagnosticwas used for the Bayesian analysis. The tree was rooted to Dothistroma pini (CBS 121005). The scalebar indicates 0.01 

expectedchanges per site. 

328


1.6x 

0.93 

1.4x 

1 

1 

3.8x 

3x 

1.2x 


0.99 

1 

0.54 

1 

Coniothyrium carteri CBS 101633 

Coniothyrium carteri CBS 105.91 

0.82 

Coniothyrium glycinicola CBS 124141 

37 Coniothyrium 

0.93 

Coniothyrium sidae CBS 135108 

Xenobotryo. calamagrostidis CBS 303.71 

“Septoria” steviae CBS 120132 

0.97 

1 Boeremia telephii CBS 135415 

38 Xenobotryosphaeria 

39 Phoma 

0.59 

Phoma herbarum CBS 615.75 

Acicuseptoria rumicis CBS 522.78 

Stagonospora pseudocaricis CBS 135132 

40 Acicuseptoria 

1 Stagonospora pseudocaricis CBS 135414 

1 

Stagonospora paludosa CBS 135088 

Stagonospora cf. paludosa CBS 130005 

0.62 

Stagonospora pseudovitensis S602 

1 

1 Stagonospora pseudovitensis CBS 135094 

0.94 

Stagonospora perfecta CBS 135099 

41 Stagonospora 

0.89 

Stagonospora sp. CBS 135096 

0.97 

Stagonospora duoseptata CBS 135093 

Stagonospora uniseptata CPC 22151 

1 1 

Stagonospora uniseptata CPC 22150 

Stagonospora uniseptata CBS 135090 

0.95 

Corynespora leucadendri CBS 135133 42 Corynespora 

Setoseptoria phragmitis CBS 114966 

1 

1 Setoseptoria phragmitis CBS 114802 


43 Setoseptoria 

Septorioides pini-thunbergii CBS 473.91 44 Septorioides 

Phlyctema vincetoxici CBS 123727 

1 Phlyctema vincetoxici CBS 123726 

1 

Phlyctema vincetoxici CBS 123743 

45 Phlyctema 



“Septoria” tanaceti CBS 358.58 

1 

Kirstenboschia diospyri CBS 134911 

Kirstenboschia diospyri CPC 19870 

46 Kirstenboschia 

1 

Phlogicylindrium eucalyptorum CBS 111680 

Phlogicylindrium eucalyptorum CBS 111689 

45 Phlogicylindrium 


0.01 

Coniothyriaceae 

Pleosporales 

Didymellaceae 

Massarinaceae 

Leptosphaeriaceae 

Corynesporascaceae 

Lentitheciaceae 

Botryosphaeriaceae 

Dermateaceae 



Sordariomycetes 

incertae sedis 

periphysoid cells. Conidiophores reduced to conidiogenous cells. 

Conidiogenous cells holoblastic, determinate, discrete, hyaline, 

ampulliform, lining the wall of the pycnidium. Conidia straight or 

slightly curved, hyaline, thin-walled, smooth, 3–4-euseptate, 

eguttulate, truncate at the base, slightly tapered to the apex (Sutton 

1980). 

Type species: J. bohemica Petr., Ann. Mycol. 18(4–6): 123. 1921. 

[1920] 

Specimen examined: Czech Republic, Bohemia, on stems of Scrophularia nodosa 

(Scrophulariaceae), 18 Mar. 1916, J. Jahn, holotype K(M) 180917, slides ex BPI. 

Note: The specimen correlates closely with the description provided 

by Sutton (1980), except that the conidiomata are superficial, not 

immersed in the epidermis. 

Megaloseptoria Naumov, Morbi Plantarum 14: 144. 1925. 

Figs 8, 9. 

Mycelium immersed, branched, septate, brown. Conidiomata 

pycnidial, separate, globose, slightly papillate, dark brown to 

black, superficial, sessile, often aggregated in groups, unilocular, 

thick-walled; wall of several cell layers of brown textura angularis, 

more darkly pigmented on the outside. Ostiole single, circular. 

Conidiophores hyaline, branched, septate (mainly at the base), 

smooth, straight or irregular, formed from the inner cells of the 

pycnidial wall. Conidiogenous cells enteroblastic, determinate, 

discrete or integrated, doliiform, ampulliform or irregularly 

cylindrical, hyaline, smooth, collarette evident, channel wide, 

periclinal thickening present. Conidia hyaline to pale brown with 

several transverse eusepta, continuous, tapered near the obtuse 

apex and truncate base, thin-walled, smooth, cylindrical, straight 

or slightly curved, often with 2 guttules in each cell (Sutton 1980). 

Type species: M. mirabilis Naumov, Morbi Plant. Script. Sect. 

Phytopath. Hort. Bot. Prince. USSR 14: 144. 1925. 

Megaloseptoria mirabilis Naumov, Morbi Plantarum 14: 

144. 1925. 

Conidiomata aggregated in a black stroma at the ends of 

branchlets, globose, black, smooth, with central ostiole, up to 

600 µm diam, papillate; wall of 3–8 layers of dark brown textura 


329


Fig. 3. Conidia and conidiogenous cells of Cytostagonospora photiniicola (redrawn from Sutton 1980). Scale bar = 10 µm. 

Fig. 4. Conidia and conidiogenous cells of Dearnessia apocyni (F43227). Scale bars = 10 µm. 

Fig. 5. Dearnessia apocyni (F43227). A. Leaf spot. B, C. Conidiogenous cells. D. Conidia. Scale bars = 10 µm. 

330


Fig. 6. Conidia and conidiogenous cells of Jahniella bohemica (redrawn from Sutton 1980). Scale bar = 10 µm. 

Fig. 7. Jahniella bohemica [K(M) 180917]. A. Vertical section through conidioma. B. Ostiolar region with loose cells. C. Conidiogenous cells. D. Conidia. Scale bars = 10 µm. 

Fig. 8. Conidia and conidiogenous cells of Megaloseptoria mirabilis (MA-Fungi 6978-1). Scale bars = 10 µm. 


331


Fig. 9. Megaloseptoria mirabilis (MA-Fungi 6978-1). A. Conidiomata on host tissue. B. Conidiogenous cells. C. Conidia. Scale bars = 10 µm. 

angularis. Conidiogenous cells lining the cavity, subcylindrical 

to ampulliform, hyaline, smooth, 7–15 × 4–8 µm; proliferating 

percurrently near apex. Conidia solitary, scolecosporous, variously 

curved, subcylindrical, tapering in upper third to obtuse apex, base 

truncate, 3–4 µm diam, transversely 30–40-septate, (170–)200– 

250 × (5–)6(–7) µm. 

Specimen examined: Switzerland, Zürich, St. Schnach., on branchlets of Pinus 

pungens var. glauba (Pinaceae), 10 July 1951, E. Müller, holotype MA-Fungi 6978- 

1. 

Note: Megaloseptoria differs from Septoria in that the conidiomata 

are aggregated in a black stroma, which is not the case in Septoria 

s. str. 

Phaeoseptoria Speg., Revista Mus. La Plata 15(2): 39. 

1908. 

Leaf spots angular-subcircular, 0.5–3 mm diam, becoming confluent. 

Conidiomata pycnidial, epiphyllous, subepidermal, black, 60–90 µm 

diam. Conidiogenesis cells hyaline, smooth, holoblastic (?). Conidia 

filiform, obclavate, smooth, 1–3-euseptate, medium brown, 30 × 3 µm 

(Saccardo & Trotter 1913, Walker et al. 1992, Crous et al. 1997). 

Type species: P. papayae Speg., Revista Mus. La Plata 15(2): 39. 

1908. 

Notes: Phaeoseptoria papayae was originally described from 

leaf spots on Carica papaya collected in the São Paulo Botanical 

Garden, Brazil. Presently there are numerous clades that contain 

isolates conforming to this morphology, and this matter can only be 

resolved once fresh material of P. papayae has been recollected to 

clarify its phylogeny (see below). 

Pseudoseptoria Speg., Ann. Mus. Nac. B. Aires, Ser. 3 13: 

388. 1910. 

Mycelium immersed, branched, septate, pale brown. Conidiomata 

pycnidial, solitary or linearly aggregated, immersed, brown, globose, 

unilocular; walls thin, of pale brown textura angularis. Ostiole 

distinct, central, circular. Conidiophores reduced to conidiogenous 

cells. Conidiogenous cells discrete, determinate or indeterminate, 

hyaline, smooth, ampulliform with a prominent cylindrical papilla 

with several percurrent proliferations at the apex. Conidia falcate, 

fusoid, acutely rounded at each end, hyaline, aseptate, guttulate, 

smooth, thin-walled (Sutton 1980). 

Type species: P. donacicola Speg., Ann. Mus. Nac. B. Aires, Ser. 3 

13: 388. 1910. 

Note: Species of Pseudoseptoria are plant pathogenic to members 

of Poaceae. 

Rhabdospora (Durieu & Mont. ex Sacc.) Sacc., Syll. Fung. 

(Abellini) 3: 578. 1884. nom. cons. 

Basionym: Septoria sect. Rhabdospora Durieu & Mont., in Durieu, 

Expl. Sci. Alg. 1 (livr. 15): 592. 1849. [1846–1849]. 

Type species: R. oleandri Durieu & Mont., in Durieu, Expl. Sci. Alg. 

1 (livr. 15): 593. 1849 [1846–1849]. 

Notes: Rhabdospora is a poorly defined genus, originally 

established to accommodate septoria-like species occurring on 

stems (Priest 2006). Of the 11 species treated by Sutton (1980), 

most are currently placed in Septoria. This genus is in need of 

revision pending the recollection of fresh material (on Nerium 

oleander from Algeria). 

Sclerostagonospora Höhn., Hedwigia 59: 252. 1917. 

Conidiomata pycnidial, immersed, separate, dark brown to black, 

globose, unilocular; walls thin, composed of thick-walled, dark 

brown textura angularis; ostiole single, circular, central, papillate. 

Conidiophores reduced to conidiogenous cells. Conidiogenous cells 

holoblastic, determinate, discrete, hyaline, smooth, ampulliform to 

irregular, formed from the inner cells of the pycnidial wall. Conidia 

subcylindrical, pale brown, thin-walled, minutely verruculose, 

3-euseptate, sometimes slightly constricted at the septa (from 

Sutton 1980). 

Type species: S. heraclei (Sacc.) Höhn., Hedwigia 59: 252. 1917. 

Note: Sclerostagonospora differs from Stagonospora in having 

pigmented conidia. 

Septoria (Sacc.) Sacc., Syll. Fung 3: 474. 1884. nom. cons. 

Figs 10, 11. 

= Septaria Fr., Novit. Fl. Svec. 5: 78. 1819. nom. rejic. 

Mycelium slow-growing, pale brown, septate, immersed. 

Conidiomata pycnidial, immersed, separate or aggregated (but 

not confluent), globose, papillate (or not), brown, wall of thin, pale 

332


Conidiomata pycnidial, immersed, unilocular, globose, separate, 

ostiolate; walls of dark brown, thick-walled textura angularis, and 

on the inside of hyaline, thin-walled, flattened cells. Conidiophores 

reduced to conidiogenous cells. Conidiogenous cells doliiform, 

hyaline, with several percurrent proliferations at the apex, formed 

from the inner cells of the pycnidial wall. Conidia hyaline, smooth to 

finely verruculose, 1–multiseptate, cylindrical or fusoid-ellipsoidal, 

straight or slightly curved, often guttulate, constricted or not at 

septa. 

Type species: S. paludosa (Sacc. & Speg.) Sacc., Syll. Fung. 

(Abellini) 3: 453. 1884. 

Fig. 10. Conidia and conidiogenous cells of Septoria cytisi (BPI USO 378994). Scale 


brown textura angularis, inner layer of flattened, hyaline textura 

angularis, frequently somewhat darker and more thick-walled 

around the ostiole. Ostiole single, circular, central. Conidiophores 

reduced to conidiogenous cells. Conidiogenous cells holoblastic, 

either determinate or indeterminate, proliferating sympodially 

and/or percurrently, hyaline, smooth, ampulliform, dolliform or 

lageniform to short cylindrical; scars unthickened. Conidia hyaline, 

multiseptate, filiform, smooth, continuous or constricted at septa. 

Sexual states are mycosphaerella-like. 

Type species: S. cytisi Desm., Ann. Sci. Nat. Bot. 8: 24. 1847. 

Specimen examined: Slovakia, Muehlthal near Bratislava (Pressburg), on leaves 

of Laburnum anagyroides (Leguminosae), 1884, J.A. Baeumler, BPI USO 378994. 

Note: The ITS and LSU sequences of this specimen were published 

respectively under GenBank accession numbers JF700932 and 

JF700954. 

Stagonospora (Sacc.) Sacc., Syll. Fung. (Abellini) 3: 445. 

1884. nom. cons. 

Basionym: Hendersonia subgen. Stagonospora Sacc., Michelia 2 

(no. 6): 8. 1880. 

Stenocarpella Syd. & P. Syd., Ann. Mycol. 15(3–4): 258. 

1917. Fig. 12. 

Mycelium immersed, brown, branched, septate. Conidiomata 

pycnidial, separate or sometimes confluent, globose or elongated, 

dark brown, subepidermal, unilocular, thick-walled; walls 

composed of dark brown, thick-walled textura angularis. Ostiole 

single, circular, papillate, protruding. Conidiophores usually absent. 

Conidiogenous cells cylindrical, hyaline, determinate, discrete, 

phialidic, with collarette and minute periclinal thickening, lining the 

inner layer of the pycnidial wall. Conidia subcylindrical, straight or 

curved, fusiform, apex obtuse, base tapered, truncate, thick-walled, 

smooth-walled, granular, pale to medium brown, 0–3-euseptate. 

Beta conidia hyaline, scolecosporous, curved (Crous et al. 2006, 

Lamprecht et al. 2011). 

Type species: S. zeae Syd. & P. Syd., Ann. Mycol. 15(3–4): 258. 

1917. [= S. macrospora (Earle) B. Sutton] 

Specimens examined: South Africa, KwaZulu-Natal, Hlabisa, rain-damaged Bt Zea 

mays hybrid (Poaceae), 2003-04 season, J. Rheeder (ex-epitype, CBS 117560 = 

MRC 8615, designated in Crous et al. 2006); KwaZulu-Natal, Zea mays kernels, 

2005, P. Caldwell, CPC 11863 = CBS 128560. 

Notes: Stenocarpella presently contains two species, S. macrospora 

and S. maydis, both causing “Diplodia ear rot of maize”. These 

two taxa were previously assigned to Diplodia and Macrodiplodia, 

respectively (Petrak & Sydow 1927, Sutton 1964). Several years 

later, Sutton re-examining these taxa and placed them in their own 

genus, Stenocarpella (Sutton 1977, 1980). Recent phylogenetic 

studies confirmed that these taxa indeed cluster by themselves 

Fig. 11. Septoria cytisi (BPI USO 378994). A. Leaf with symptoms. B. Close-up of leaf spot with conidiomata. C, D. Conidiogenous cells giving rise to conidia. E. Conidia. Scale 



333


Type species: Z. tritici (Desm.) Quaedvlieg & Crous, Persoonia 26: 

67. 2011. 

Notes: Zymoseptoria was split off from Septoria s. str. and 

redescribed by Quaedvlieg et al. (2011) based on LSU sequence 

data when said authors delimitated Septoria s. str. by sequencing 

the ITS and LSU sequences out of S. cytisi herbarium material. 

Phylogenetic analysis showed that Zymoseptoria species cluster 

within a distinct clade inside the Mycosphaerellaceae that is closely 

related to Ramularia, but located distant from Septoria s. str. 

Acervular forms 

Asteromidium Speg., Ann. Soc. cient. argent. 26(1): 66. 

1888. Figs 13, 14. 

Fig. 12. Stenocarpella maydis (top) and S. macrospora (bottom) (redrawn from 

Sutton 1980). Scale bars = 10 µm. 

within the Diaporthales (Crous et al. 2006, Lamprecht et al. 2011), 

supporting the decision of Sutton (1980). 

Trichoseptoria Cavara, Atti Ist. Bot. Univ. Lab. Crittog. Pavia 

2: 40. 1892. 

Type species: T. alpei Cavara, Atti Ist. Bot. Univ. Lab. Crittog. Pavia 

2: 40. 1892. 

Notes: Not much is known about this septoria-like genus, except 

that it is distinguished from Septoria by having setae on its pycnidia 

with 1–2-septate, hyaline conidia. This genus is in further need of 

revision once fresh material has been recollected (Citrus vulgaris, 

Belgiojoso, Alps). 

Mycelium immersed, branched, septate, hyaline. Conidiomata 

acervular, subcuticular, separate or confluent, pulvinate to doliiform, 

at the base, composed of hyaline to pale brown, thin-walled textura 

angularis which extends laterally, finally with separate cells dispersed 

in a mucilaginous matrix to form the overlying wall; cuticle discoloured 

and occasionally pseudoparenchymatous, walls adjacent to the upper 

epidermal wall also discoloured; dehiscence irregular. Conidiogenous 

cells holoblastic, discrete, indeterminate, ± cylindrical, hyaline, smooth, 

with 1–2 sympodial proliferations, scars unthickened, flat, formed from 

the basal and lateral walls. Conidia cylindrical to fusoid, gently tapered 

at each end, apex obtuse, base truncate, thin-walled, guttulate to 

granular, hyaline, 3-septate (Sutton 1980). 

Type species: A. imperspicuum Speg., Ann. Soc. cient. argent. 

26(1): 66. 1888. 

Specimen examined: Paraguay, on leaves of Sapindaceae, 1883, isotype K(M) 

180228, ex B. Balansa Pl. du Paraguay No. 4085. 

Notes: This genus has to be recollected (Sapindaceae, Paraguay) 

to allow for a molecular comparison to other existing genera in this 

Zymoseptoria Quaedvlieg & Crous, Persoonia 26: 64. 2011. 

Conidiomata pycnidial, semi-immersed to erumpent, dark brown 

to black, subglobose, with central ostiole; wall of 3–4 layers of 

brown textura angularis. Conidiophores hyaline and smooth, 

1–2-septate, or reduced to conidiogenous cells, lining the inner 

cavity. Conidiogenous cells are tightly aggregated and ampulliform 

to doliiform or subcylindrical, phialidic with periclinal thickening, 

or with 2–3 inconspicuous, percurrent proliferations at the apex. 

Conidia (Type I) solitary, hyaline, smooth, guttulate, narrowly 

cylindrical to subulate, tapering towards acutely rounded apex, with 

bluntly rounded to truncate base, transversely euseptate; hila not 

thickened nor darkened. On OA and PDA media plates the aerial 

hyphae disarticulate into phragmospores (Type II conidia) that 

again give rise to Type I conidia via microcyclic conidiation; yeastlike 

growth and microcyclic conidiation (Type III conidia) common 

on agar media (Quaedvlieg et al. 2011). 

Fig. 13. Conidia and conidiogenous cells of Asteromidium imperspicuum (redrawn 

from Sutton 1980). Scale bar = 10 µm. 

334


Fig. 14. Asteromidium imperspicuum [K(M) 180228]. A. Conidiomata on host surface. B. Section through conidioma. C, D. Conidiogenous cells and conidia. Scale bars: B = 

75 µm, all others = 10 µm. 

complex. The morphology of the specimen examined correlates 

well with the description provided by Sutton (1980). 

Ciferriella Petr., Ann. Mycol. 28(5/6): 409. 1930. 

Type species: C. domingensis Petr. & Cif., Ann. Mycol. 28(5/6): 

409. 1930. 

= Pseudocercospora Speg., Anales Mus. Nac. Hist. Nat. B. Aires, Ser. 3, 

20: 437. 1910. 

Pseudocercospora domingensis (Petr. & Cif.) Quaedvlieg, 

Verkley & Crous, comb. nov. MycoBank MB804401. Figs 15, 

16. 

Basionym: Ciferriella domingensis Petr. & Cif., Ann. Mycol. 28(5/6): 

409. 1930. 

Leaf spots amphigenous, subcircular, medium brown with dark purple 

margin, 1.5–6 mm diam. Sporulation hypophyllous, fasciculate to 

sporodochial, brown, arising from a brown stroma, up to 50 µm diam. 

Conidiophores medium brown, smooth, subcylindrical, 0–2-septate, 

straight to once geniculate, 15–20 × 3–5 µm. Conidiogenous 

cells terminal, brown, smooth to finely verruculose, ampulliform to 

subcylindrical, proliferating sympodially or percurrently, tapering 

to a truncate apex, 2 µm diam, 10–15 × 3–4 µm. Conidia brown, 

smooth, straight to slightly curved, obclavate, apex subobtuse, base 

obconically truncate, 0–3-septate, 35–60 × 3–4 µm. 

Specimen examined: Dominican Republic, on Vitex umbrosa (Lamiaceae), 26 May 

1929, coll. R. Ciferri, det. F. Petrak, holotype ex N.Y. Bot. Gard. No 01048475. 

Notes: The dimensions of the conidia and conidiophores correlate 

with the observations of Sutton (1980). However, the conidiomata 

are sporodochial to fasciculate, and not acervular. Ciferriella 

domingensis is a typical Pseudocercospora sensu Crous et al. 

(2013). Based on the species presently known from Vitex (Crous 

& Braun 2003), it appears to represent a distinct taxon, for which a 

new combination in Pseudocercospora is proposed. 

Colletogloeum Petr., Sydowia 7: 368. 1953. 

Mycelium immersed, branched, septate, hyaline to pale brown. 

Conidiomata acervular, epidermal to subepidermal, separate, 

occasionally confluent, composed of hyaline to pale brown, thin-walled 

textura angularis. Conidiophores hyaline to pale brown, sparsely 

branched, septate, smooth, cylindrical or slightly irregular, formed from 

Fig. 15. Conidia and conidiogenous cells of Pseudocercospora domingensis (NY 

No 01048475). Scale bars = 10 µm. 

the upper cells of the acervulus. Conidiogenous cells integrated or 

discrete, indeterminate, cylindrical or doliiform, with several percurrent 

proliferations at apex. Conidia hyaline to pale brown, 0-multiseptate, 

straight, curved or irregular, truncate at the base, obtuse at the apex, 

usually thin-walled, smooth, guttulate or not. 

Type species: C. dalbergiae (S. Ahmad) Petr., Sydowia 7: 369. 

1953. [= C. sissoo (Syd.) B. Sutton, Mycol. Pap. 97: 14. 1964.] 

Notes: The exact taxonomic position of Colletogloeum was unclear 

for a long time as it included many species that appear to represent 

asexual morphs of Teratosphaeria. Crous et al. (2009a–c) used ITS 

sequence data from a specimen representative of C. sissoo (IMI 

119162) to demonstate that the type of Colletogloeum clustered near 

the Pseudocercospora complex within the Mycosphaerellaceae. 

Cylindrosporium Grev., Scott. crypt. fl. (Edinburgh) 1: pl. 

27. 1822. 

= Cylindrodochium Bonord., Handb. Allgem. mykol. (Stuttgart): 132. 1851. 


acervular, white, slimy, subcuticular, separate or confluent, 

formed of pale brown to hyaline, thin-walled textura angularis; 

dehiscence irregular. Conidiophores hyaline, parallel, branched 


335


Fig. 16. Pseudocercospora domingensis (NY No 01048475). A. Leaf spot. B, C. Conidiogenous cells. D. Conidia. Scale bars = 10 µm. 

only at the base, 1–2-septate, smooth, formed from the upper 

pseudoparenchyma. Conidiogenous cells enteroblastic, phialidic, 

integrated, cylindrical, hyaline, smooth. Conidia straight or 

slightly curved, aseptate, cylindrical, thin-walled, smooth, hyaline, 

eguttulate (Sutton 1980). 

Type species: C. concentricum Unger, Exanth. Pflanzen (Wien) 2: 

9. 1833. 

Notes: Sutton (1980), Von Arx (1983), Deighton (1987) and Braun 

(1990) could not agree on the taxonomic status of this genus, 

which is associated with light leaf spot of oil seed rape (sexual 

morph Pyrenopeziza brassicae). This genus is in need of revision, 

awaiting the recollection of fresh material of C. concentricum (on 

Pulmonaria officinalis, Germany). 

Phloeospora Wallr., Fl. Crypt. Germ. (Norimbergae) 2: 176. 

1833. 

Mycelium immersed, septate, hyaline. Conidiomata acervular, 

subepidermal, circular, discrete or confluent, composed of hyaline 

to pale brown, thin-walled textura angularis; dehiscence irregular. 

Conidiophores reduced to conidiogenous cells or with one or two 

supporting cells, branched at base or not. Conidiogenous cells 

holoblastic, annellidic, occasionally also sympodial, discrete, 

indeterminate hyaline, smooth, cylindrical, with several apical 

inconspicuous annellations, formed from the upper cells of the 

acervuli. Conidia hyaline, septate, smooth, guttulate or not, 

cylindrical, curved, attenuated towards the apices, apex obtuse to 

subobtuse, base truncate, with minute marginal frill. 

Type species: P. ulmi (Fr.) Wallr., Fl. Crypt. Germ. (Norimbergae) 

2: 177. 1833. 

Notes: Sexual morphs of Phloeospora have been linked to genera 

that resemble the concepts of Mycosphaerella, Didymella and 

Sphaerulina. Verkley & Priest (2000) already noted that this genus 

is heterogeneous and in need of revision. The phylogenetic analysis 

performed in this study confirmed that Phloeospora (based on P. 

ulmi) clusters close to, but separate from Septoria s. str. (Fig. 1). 

Fig. 17. Conidia and conidiogenous cells of Phloeosporella ceanothi (redrawn from 

Sutton 1980). Scale bar = 10 µm. 

to pale brown, thin-walled textura angularis. Conidiogenous cells 

holoblastic, sympodial, discrete, indeterminate, hyaline, smooth, 

lageniform to cylindrical, with 1–2 broad, flat unthickened apical 

scars, formed from the upper pseudoparenchyma. Conidia hyaline, 

2-euseptate, thin-walled, smooth, guttulate, straight, curved or 

irregular, tapered gradually to an obtuse apex and abruptly to a 

truncate base (Sutton 1980). 

Type species: P. ceanothi (Ellis & Everh.) Höhn., Ann. Mycol. 22(1– 

2): 201. 1924. 

Notes: Not much is known of the sexual state of this genus, but 

P. padi has been linked to Blumeriella jaapii (Sutton 1980). A 

phylogenetic analysis performed on available isolates (unpubl. 

data) indicated that Phloeosporella is polyphyletic. However, as the 

type is not known from culture (on Ceanothus, California, USA), 

this matter could not be resolved. 

Phloeosporella Höhn., Ann. Mycol. 22: 201. 1924. Fig. 17. 


acervular, subepidermal, ± circular, discrete, composed of hyaline 

Septogloeum Sacc., Michelia 2(6): 11. 1880. 


acervular, epidermal to subepidermal, separate or confluent, formed 

336


of pale brown thin-walled pseudoparenchyma. Conidiophores 

short, stout, 1–2-septate, hyaline, smooth, branched at the base, 

formed from the upper pseudoparenchyma. Conidiogenous cells 

phialidic, discrete or integrated, determinate, cylindrical, doliiform to 

obpyriform, hyaline, smooth, with minute collarette and prominent 

periclinal thickening. Conidia hyaline, 1–3-euseptate, thin-walled, 

smooth, eguttulate, base truncate, apex obtuse, straight or curved, 

constricted, obovoid (Sutton 1980). 

Type species: S. carthusianum (Sacc.) Sacc., Michelia 2(6): 11. 

1880. 

Notes: Although more than 120 species of Septogloeum have been 

described, the genus was reduced to just two species by Sutton & 

Pollack (1974). Sexual morphs have been linked to Pleuroceras in 

the Diaporthales (Monod 1983). The genus is in need of revision 

pending fresh collections. 

Xenocylindrosporium Crous & Verkley, Fungal Planet 44. 

2009. 

Conidiomata immersed, black, opening by irregular rupture, 

acervuloid, up to 300 μm diam; wall consisting of 3–4 layers of 

pale brown textura angularis. Conidiophores hyaline, smooth, 

subcylindrical, branched, septate, or reduced to ampulliform 

conidiogenous cells. Conidiogenous cells hyaline, smooth, 

ampulliform to subcylindrical, terminal or lateral on septate 

conidiophores, monophialidic with minute periclinal thickening. 

Conidia solitary, hyaline, smooth, curved, widest in middle, tapering 

to acutely rounded apex and truncate base, 0 –1-septate. 

Type species: X. kirstenboschense Crous & Verkley, Fungal Planet 

44. 2009. 

Stromatic forms 

Dothistroma Hulbary, Bull. Ill. Nat. Hist. Surv. 21: 235. 1941. 

Mycelium immersed, branched, septate, pale brown to hyaline. 

Conidiomata sometimes acervular, initially subepidermal later 

erumpent, composed of pale brown, thin-walled textura angularis, 

sometimes eustromatic, multilocular and of darker brown, thickwalled 

tissue. Stromata are strongly erumpent and finally pulvinate. 

Conidiogenous cells holoblastic, discrete, determinate, ampulliform, 

hyaline, smooth, non-proliferating, formed from the upper cells of 

stroma or from inner cells of the locular walls. Conidia hyaline, 

straight or curved, filiform, 1–5-euseptate, continuous, thin-walled 

and smooth (Barnes et al. 2004). 

Type species: D. pini Hulbary, Bull. Ill. Nat. Hist. Surv. 21: 235. 

1941. 

Notes: Dothistroma sexual morphs are mycosphaerella-like (Evans 

1984), and the two species of Dothistroma that have been subjected 

to DNA sequencing (D. septosporum and D. pini) cluster together 

in the “Dothistroma clade” as described by Crous et al. (2009a, c). 

Because of a lack of recognisable morphological characteristics, 

it is virtually impossible to discriminate between D. septosporum 

and D. pini without molecular tools (Barnes et al. 2004). Multiple 

morphological varieties of both D. septosporum and D. pini have 

Fig. 18. Conidia and conidiogenous cells of Phlyctaeniella humuli (IMI 202260) 

(redrawn from Sutton 1980). Scale bar = 10 µm. 

been described based on differences in conidia length alone (e.g. 

D. septosporum var. keniense). However, controversy exists as 

to whether spore size represents an adequate characteristic 

to distinguish among these Dothistroma varieties, as since the 

introduction of molecular tools only D. septosporum and D. pini 

have been confirmed as distinct species. 

Phlyctaeniella Petr., Ann. Mycol. 20: 323. 1922. Fig. 18. 


eustromatic, separate, immersed, pale brown, globose, unilocular, 

scarcely erumpent; side wall and base of several cell layers of 

hyaline, thin-walled textura angularis, above of larger pale brown 

tissue. Ostiole indistinct, and dehiscence by rupture of the upper 

wall. Conidiophores hyaline, smooth, septate, irregularly branched, 

especially at the base, formed from the inner cells of the stroma wall. 

Conidiogenous cells phialidic, integrated or discrete, determinate, 

hyaline, markedly tapered at the apices, smooth, with apical or 

lateral apertures, collarette minute, with periclinal thickening; 

only rarely becoming percurrent. Conidia hyaline, smooth, thinwalled, 

irregularly guttulate, filiform, straight, curved or irregular, 

multiseptate (Sutton 1980). 

Type species: P. polonica Petr., Ann. Mycol. 20: 323. 1922. 

Note: Fresh material needs to be collected of this taxon (on Aruncus 

silvestris, Austria), before its taxonomy can be resolved. 

Septocyta Petr., Ann. Mycol. 25: 330. 1927. Figs 19, 20. 

Mycelium immersed, branched, septate, hyaline to pale brown. 

Conidiomata eustromatic, immersed, separate, erumpent, dark 

brown to black, finally opening widely, unilocular, multilocular or 

convoluted, thick-walled; wall of pale brown, thin-walled textura 

angularis except in the dehiscent region which is darker brown and 

more thick-walled. Ostiole absent, dehiscence by breakdown of the 

upper wall. Conidiogenous cells are holoblastic, sympodial with 1–3 


337


Specimen examined: Germany, Brandenberg, on Rubus fructicosus (Rosaceae), 

7 June 1923, coll. P. Sydow, det. H. Sydow, Sydow Mycoth. Germ. PDD 51271. 

Notes: Septocyta ramealis, the type of Septocyta, has a long list 

of synonyms. The specimen examined here (PDD 51271), differs 

somewhat from the description provided by Sutton (1980), and 

appears to represent a species of Septoria s. str., as the mode 

of conidiogenesis is not that different. Presently there is a single 

ITS sequence labelled as S. ruborum available on GenBank 

(JN133277.1), placing it in the middle of Septoria s. str. As no 

type material of S. ramealis could be located, this matter remains 

unresolved. 

Septopatella Petr., Ann. Mycol. 23: 128. 1925. 

Fig. 19. Conidia and conidiogenous cells of Septocyta ramealis (PDD 51271). Scale 


apical, scarcely protruding, unthickened denticles, indeterminate, 

discrete, ampulliform to lageniform, hyaline, smooth, formed from 

the inner cells of the locular walls. Conidia hyaline, 1–3 euseptate, 

smooth, straight or slightly curved, acicular, apex obtuse, base 

truncate, often with minute guttules associated with septa (Sutton 

1980). 

Type species: S. ramealis (Roberge ex Desm.) Petr., Ann. Mycol. 

25: 330. 1927. 

Septocyta ramealis (Roberge ex Desm.) Petr., Ann. Mycol. 

25: 330. 1927. 

Conidiomata eustromatic to pycnidial, black, up to 160 µm diam, 

aggregated in clusters, erumpent through ruptures in epidermis, 

convulated; wall of 3–8 layers of brown textura angularis. 

Conidiophores lining the inner cavity, reduced to conidiogenous 

cells, or one or two supporting cells. Conidiogenous cells hyaline, 

smooth, ampulliform, proliferating sympodially and percurrently 

near apex, also with lateral denticle-like protrusions, 6–12 × 2.5–4 

µm. Conidia hyaline, smooth, guttulate, (9–)20–30(–35) × 1.5(–2) 

µm, 1(–3)-septate, irregularly curved, subcylindrical, apex obtuse, 

base tapering slightly to truncate hilum, 0.5 µm diam. 

Mycelium immersed, branched, septate, hyaline to subhyaline. 

Conidiomata superficial, often subtended by a superficial, pale 

brown, septate, branched mycelium, pulvinate, separate to 

occasionally aggregated, dark brown to black, finally opening widely, 

cupulate; basal wall of small-celled, brown, thin-walled textura 

angularis, becoming textura porrecta as it merges into the periclinal 

walls; a hypostroma attaches the conidioma to the substrate; 

Ostiole absent. Conidiophores hyaline, septate, branched at the 

base, thin-walled, cylindrical, formed from the gelatinized basal 

wall of the conidioma. Conidiogenous cells holoblastic, sympodial, 

integrated, indeterminate, cylindrical, hyaline, smooth, produced as 

2–3 branches from the apex of the conidiophores. Conidia hyaline, 

3–4-euseptate, thin-walled, smooth, minutely guttulate, straight 

or curved, occasionally irregularly filiform (Dyko & Sutton 1979, 

Sutton 1980). 

Type species: S. septata (Jaap) Petr., Ann. Mycol. 23: 129. 1925. 

Note: Not much is known about this genus, and as no cultures 

of S. septata are presently available (on Pinus montana, Czech 

Republic) this matter cannot be resolved. 

Stictosepta Petr., Sydowia 17: 230. 1964. [1963]. Fig. 21. 


eustromatic, immersed, globose to collabent, papillate, unilocular, 

often convoluted, hyaline; walls thick, of hyaline, thin-walled 

Fig. 20. Septocyta ramealis (PDD 51271). A. Conidiomata on host tissue. B, C. Conidiogenous cells. D. Conidia. Scale bar = 10 µm. 

338


to verruculose-echinulate; hila distinct, slightly to conspicuously 

thickened, darkened, refractive; conidial secession schizolytic. 

Ascomata immersed to superficial, uniloculate, globose to 

subglobose with papillate, central, periphysate ostiole, dark brown 

to black, scattered or gregarious. Peridium of 3–6 layers of thin- to 

thick-walled textura angularis, dark brown to black. Hamathecium 

dissolves at maturity, and no stromatic tissue remains between the 

asci. Asci bitunicate, fissitunicate, 8-spored, cylindrical to cylindricclavate, 

ovoid to ampulliform or saccate, sessile to subsessile, apex 

rounded with distinct or indistinct ocular chamber. Ascospores bi- to 

tri- or multiseriate, ellipsoid-fusoid to obclavate or subcylindrical, 

hyaline, medianly 1-septate, often constricted at the septum, 

smooth-walled, granular to guttulate, mostly lacking any sheath. 

Type species: Ramularia pusilla Unger, Exanth. Pflanzen (Wien): 

169. 1833. 

Fig. 21. Conidia and conidiogenous cells of Stictosepta cupularis (redrawn from 

Sutton 1980). Scale bar = 10 µm. 

textura intricata. Ostiole central and circular, single, furfuraceous. 

Conidiophores hyaline, septate, branched, anastomosing, formed 

from the inner cells of the locular wall. Conidiogenous cells 

sympodial or synchronous, integrated, indeterminate, hyaline, 

thin-walled, with usually two small, unthickened, apical, slightly 

protuberant conidiogenous loci. Conidia hyaline, thin-walled, 

smooth, multiseptate, slightly constricted at the septa, each cell 

medianly guttulate, straight or curved, base truncate, apex obtuse 

(Sutton 1980). 

Type species: S. cupularis Petr., Sydowia 17: 230. 1964. [1963]. 

Note: Not much is known about this genus, but as no isolate of 

S. cupularis is presently available (on stems of Fraxinus, Czech 

Republic), it will not be treated here. 

Sexual morphs linked to Septoria 

Several sexual genera have been linked to Septoria and allied 

genera in literature, but very few have been confirmed in culture. 

Most sexual states cluster in the Mycosphaerella complex. 

Mycosphaerella Johanson, Öfvers. K. Svensk. Vetensk.- 

Akad. Förhandl. 41(no. 9): 163. 1884. 

= Ramularia Unger, Exanth. Pflanzen (Wien): 119. 1833. 

Mycelium immersed to superficial, septate, hyaline, branched. 

Caespituli usually whitish to greyish on host tissue. Conidiophores 

fasciculate to synnematal, rarely solitary, or forming small 

sporodochia, emerging through stomata, from inner hyphae 

or stromata; conidiophores straight, subcylindric to geniculatesinuous, 

aseptate or septate, hyaline, occasionally branched, 

smooth, rarely rough. Conidiogenous cells integrated, terminal, 

polyblastic, elongating sympodially, apex more or less straight 

to geniculate-sinuous or strongly curved, cicatrized, conidial 

scars hardly to conspicuously thickened, but always darkened, 

refractive. Conidia solitary to catenate, sometimes in branched 

chains, 0–4(–multi)-septate, hyaline, ellipsoid-ovoid to cylindricalfusoid, 

rarely filiform, occasionally constricted at the septa, smooth 

Notes: Species of Ramularia (including the Mycosphaerella sexual 

morph) have evolved over a broad developmental and physiological 

adaptation range that includes endophytes, saprophytes and 

symbionts. However, for a major part Ramularia consists of a wide 

range of narrow host range, foliicolous plant pathogens which are 

the cause of significant economical losses in both temperate and 

tropical crops worldwide (Crous et al. 2001). Verkley et al. (2004) 

showed that Mycosphaerella s. str. (linked to M. punctiformis) was 

in fact restricted to species with Ramularia anamorphs, leaving 

many “Mycosphaerella” species to be disposed to other genera. 

In employing the one fungus = one name concept (Hawksworth 

et al. 2011, Wingfield et al. 2012), the choice is to use Ramularia 

over Mycosphaerella, as the former is monophyletic and recently 

monographed (Braun 1995, 1998), while Mycosphaerella is polyand 

paraphyletic, and consists of more than 40 genera, many as 

yet untreated (Crous et al. 2009c) 

Sphaerulina Sacc., Michelia 1(no. 4): 399. 1878. 

Ascomata pseudothecial, immersed, subepidermal, erumpent at 

the top, single to clustered, globose, papillate. Ostiole central, with 

hyaline periphyses; wall of textura angularis, composed of 2–4 

layers of brown cells. Hamathecium dissolving at maturity. Asci 

bitunicate, fissitunicate, clustered, cylindrical to obclavate, rounded 

at apex, with or without a shallow apical chamber, short-stipitate 

or sessile, with 8 biseriate to triseriate ascospores. Ascospores 

subcylindrical to fusiform, rounded at ends, slightly tapered, 

straight or slightly curved, 1–3-septate, with a primary septum 

nearly median, hyaline, smooth, without sheath or appendages. 

Type species: Sphaerulina myriadea (DC.) Sacc., Michelia 1(no. 

4): 399. 1878. 

Notes: The genus Sphaerulina was chiefly separated from 

Mycosphaerella on the basis of ascospore septation (Crous et 

al. 2011). Sphaerulina myriadea, which occurs on hosts in the 

Fagaceae, appears to be a species complex. Results in this 

paper show that Sphaerulina myriadea clusters together with 

many septoria-like species in a clade that is distinct, but very 

closely related to Septoria s. str. The septoria-like species in this 

Sphaerulina clade were subsequently rediscribed in Sphaerulina. 

Species including ones with 1-septate ascospores and septorialike 

asexual morphs are treated below and by Verkley et al. (2013). 


339


Treatment of phylogenetic clades 

Based on the phylogenetic data generated in this study, we 

were able to delineate several clades in the Septoria complex. 

Recognised clades, as well as novel species and genera, are 

described and discussed below. Taxa with descriptions that are 

freely available online in MycoBank or open access journals, are 

not repeated here. 

Clade 1: Septoria 

Description: See above. 

Type species: S. cytisi Desm., Ann. Sci. Nat. Bot. 8: 24. 1847. 

Septoria cf. agrimoniicola Bondartsev, Mater. mikol. 

obslêed. Ross. 2: 6. 1921. 

Leaf spots on the upper leaf surface, distinct, scattered, brown 

with purplish margin, circular to angular, sometimes vein-limited, 

discrete lesions 2–4 mm diam, reaching 10 mm wide when 

confluent, finally the center becoming pale colored to nearly whitish; 

on the lower leaf surface similar but discoloured (Shin & Sameva 

2004). On sterile Carex leaves on WA. Conidiomata pycnidial, 

separate but frequently aggregated and linked by brown stromatic 

tissue in a stroma; globose, black, exuding a creamy conidial mass 

via a central ostiole; conidiomata up to 350 µm diam; wall of 6–12 

layers of dark brown, thick-walled textura angularis. Conidiophores 

reduced to conidiogenous cells or 1–2 supporting cells, hyaline, 

subcylindrical, lining the inner layer of conidioma. Conidiogenous 

cells hyaline, smooth, subcylindrical to ampulliform, 10–17 × 3–4 

µm; proliferating sympodially but also percurrently near apex. 

Conidia hyaline, smooth, guttulate, filiform, apex subobtuse, base 

long obconically truncate, 1–4-septate, (20–)25–35(–40) × 1.5–2(– 

2.5) µm; microcyclic conidiation observed. 

Culture characteristics: Colonies on PDA flat, undulate with 

sparse, white aerial mycelium, surface olivaceous-black, 

reverse olivaceous-black, after 14 d, 3.5 cm diam; on MEA with 

sparse white aerial mycelium, surface olivaceous-black, reverse 

olivaceous-black, after 14 d, 5 cm diam; on OA with sparse white 

aerial mycelium, surface olivaceous, reverse olivaceous, after 14 

d, 3 cm diam. 

confluent, finally the center becoming paler or nearly whitish; on 

the lower leaf surface similar but discoloured (Shin & Sameva 

2004). On OA. Conidiomata solitary to aggregated, black, globose, 

becoming somewhat papillate, up to 250 µm diam, opening by 

means of central ostiole, up to 40 µm diam; wall of 6–8 layers 

of thick-walled, brown textura angularis; exuding a creamy 

conidial mass. Conidiophores reduced to conidiogenous cells. 

Conidiogenous cells lining the inner wall layer, hyaline, discrete, 

ampulliform to lageniform, 4–10 × 3–5 µm, proliferating sympodially 

or percurrently with inconspicuous proliferations. Conidia filiform, 

curved or flexuous, rarely straight, (60–)65–75(–90) × 1.5–2(–3) 

µm, hyaline, guttulate, 4–7(–11)–septate, apex subobtuse, slightly 

tapering from basal septum to truncate base, 1.5–2 µm. 

Culture characteristics: Colonies on PDA erumpent, with feathery 

margin, with sparse white aerial mycelium, surface greenish-black, 

reverse olivaceous-black, after 14 d, 2.5 cm diam; on MEA with 

sparse white aerial mycelium, surface cinnamon to olivaceousblack 

in the younger patches, reverse cinnamon to olivaceousblack 

in patches, after 14 d, 4 cm diam; on OA with sparse white 

aerial mycelium, surface greenish-black, reverse fuscous-black, 

after 14 d, 3 cm diam. 

Specimen examined: South Korea, Incheon, leaf of Stachys riederi var. japonica 

(Lamiaceae), 14 Aug. 2008, H.D. Shin (CBS H-21278, culture CBS 128668 = KACC 

44796 = SMKC 24663). 

Note: The Korean collection was originally identified as Septoria 

stachydicola, which fits the original description provided for this 

taxon (Shin & Sameva 2004). However, authentic European 

material is required for a comparison to confirm this identification, 

as we suspect S. stachydicola may be restricted to Europe. 

Septoria cretae Quaedvlieg, Verkley & Crous, sp. nov. 


Etymology: Named after Crete, the island from where it was 

collected. 

On sterile Carex leaves on WA. Conidiomata up to 250 µm diam, 

brown, immersed, subepidermal, pycnidial, subglobose with central 

Specimen examined: South Korea, Guri, on leaves of Agrimonia pilosa (Rosaceae), 

11 Jul. 2009, H.D. Shin (CBS H-21279, culture CBS 128602 = KACC 44644 = SMKC 

24292). 

Notes: This fungus was first reported from Korea by Shin & Sameva 

(2002) as S. agrimoniicola, and fits well with the original description 

of this European taxon. However, fresh European collections and 

cultures are required for comparison, as S. agrimoniicola may well 

be restricted to Europe. 

Septoria cf. stachydicola Hollós, Mathem. Természettud. 

Közlem. Magg. Tudom. Akad. 35(1): 60. 1926. 

Leaf spots on the upper leaf surface distinct, scattered, brown 

with purplish margin, circular to angular, sometimes vein-limited, 

discrete lesions 2–4 mm diam, reaching 10 mm wide when 

Fig. 22. Conidia and conidiogenous cells of Septoria cretae (CBS 135095). Scale 

bar = 10 µm. 

340


Fig. 23. Septoria cretae (CBS 135095). A. Colony sporulating in culture. B–F. Conidiophores and conidiogenous cells giving rise to conidia. G. Conidia. Scale bars = 10 µm. 

ostiole, exuding creamy conidial mass; wall of 2–3 layers of brown 

textura angularis. Conidiophores reduced to conidiogenous cells, or 

with a supporting cell that gives rise to several conidiogenous cells. 

Conidiogenous cells phialidic, hyaline, smooth, aggregated, lining 

the inner cavity, ampulliform to subcylindrical, straight to curved, 

proliferating sympodially near apex, 10–20 × 2–3.5 µm. Conidia 

hyaline, smooth, thin-walled, subcylindrical to narrowly obclavate, 

granular, with subobtuse apex and obconically truncate to truncate 

base, 1–3-septate, (8–)15–22(–27) × 2(–3) µm. 

Culture characteristics: Colonies on PDA erumpent, with feathery 

margin, lacking aerial mycelium, surface fuscous-black, reverse 

olivaceous-black, after 14 d, 3.5 cm diam; on MEA surface fuscousblack, 

reverse olivaceous-black, after 14 d, 4 cm diam; on OA 

surface fuscous-black, reverse fuscous-black, after 14 d, 3.5 cm 

diam. 

Specimen examined: Greece, Crete, on leaves of Nerium oleander (Apocynaceae), 

7 Jul. 2012, U. Damm, (holotype CBS H-21277, culture ex-type CBS 135095). 

Notes: Several species of Septoria are known on Nerium oleander, 

namely S. juliae [conidia 1–6(–7)-septate, 26–54 × 2.5–5.5 µm], S. 

neriicola (conidia 1-septate, 30–40 × 0.7–1 µm), S. oleandriicola 

[conidia 1–3-septate, 12.5–22.5–37.5(–40) × 2.5–3(–4.5) µm], S. 

oleandrina (conidia 0–1-septate, 9–19 × 1–1.5 µm), and S. rollhansenii 

(conidia 0–4-septate, 25–39 × 3–4 µm) (Bedlan 2011), 

which differ from S. cretae based on conidial dimensions and 

septation. 

Septoria glycinicola Quaedvlieg, H.D. Shin, Verkley & 

Crous, sp. nov. MycoBank MB804403. Fig. 24. 

Etymology: Named after the host genus on which it was collected, 

Glycine. 

On OA. Conidiomata forming in concentric circles, pycnidial, 

separate, black, globose, up to 150 µm diam, opening by a 

central ostiole, up to 30 µm diam, exuding a creamy conidial 

mass; wall consisting of 3–6 layers of brown textura angularis. 

Conidiophores reduced to conidiogenous cells. Conidiogenous 

cells lining the inner cavity, hyaline, smooth, ampulliform, 10–16 

× 2.5–3.5 µm, proliferating sympodially near apex, holoblastic. 

Fig. 24. Septoria glycinicola (CBS 128618). A, B. Colonies sporulating on PDA. C. Conidiogenous cells. D. Conidia. Scale bars = 10 µm. 


341


Conidia hyaline, smooth, guttulate to granular, subcylindrical to 

narrowly obclavate, irregularly to gently curved, apex subobtuse, 

base long obconically truncate, 3–6-septate, (33–)45–55(–65) × 

(1.5–)2 µm. 

Culture characteristics: Colonies on PDA flat, circular, with 

sparse black aerial mycelium with black tufts, surface patches of 

olivaceous-black to fawn in the younger parts, reverse with patches 

of olivaceous-black in the older parts to mouse-grey and pale 

purplish grey in the younger mycelium, after 14 d, 6.5 cm diam, 

pinkish exudate; on OA lobate, with sparse white aerial mycelium, 

surface patches of vinaceous to olivaceous-black, reverse fuscousblack 

to vinaceous-buff; after 14 d, 8.5 cm diam, pinkish exudate; 

on MEA with radial lobes, very short white aerial mycelium, surface 

fuscous-black, reverse olivaceous-black; after 14 d, 4.5 cm diam. 

Specimen examined: South Korea, Namyangju, on leaves of Glycine max 

(Fabaceae), 22 Sep. 2008, H.D. Shin (holotype CBS H-21270, culture ex-type CBS 

128618 = KACC 43091 = SMKC 22879). 

Notes: Septoria glycines is the common Septoria species 

associated with brown spot of soybeans. Septoria glycinicola is 

distinct from S. glycines (conidia 1–4 septate, 21–45 × 1.5–2 µm) 

in that it has larger conidia. 

Septoria oenanthicola Quaedvlieg, H.D. Shin, Verkley & 



Oenanthe. 

On sterile Carex leaves on WA. Conidiomata pycnidial, separate 

but aggregated, black, globose, up to 200 µm diam, opening by 

central ostiole, up to 20 µm diam, exuding a creamy conidial mass; 

wall consisting of dark brown, thickened, 6–10 layers of textura 

angularis. Conidiophores reduced to conidiogenous cells or to one 

supporting cell. Conidiogenous cells hyaline, smooth, 3–5 × 3–7 

µm, ampulliform, proliferating sympodially near apex, holoblastic. 

Conidia hyaline, smooth, guttulate, subcylindrical to narrowly 

obclavate, apex subobtuse, base long obconically truncate, 

1–6-septate, (17–)25–45(–55) × (2–)2.5(–3) µm. 

Culture characteristics: Colonies on PDA flat, undulate with sparse, 

white aerial mycelium, surface olivaceous-grey, reverse olivaceous, 

after 14 d, 2.5 cm diam; on MEA with sparse, white aerial mycelium, 

surface olivaceous-grey, reverse olivaceous-black, after 14 d, 5 cm 

diam; on OA with sparse white aerial mycelium, surface olivaceousgrey, 

reverse olivaceous, after 14 d, 3 cm diam. 

Specimen examined: South Korea, Yangpyeong, on leaves of Oenanthe javanica 

(Apiaceae), 25 May 2006, H.D. Shin (holotype CBS H-21281, culture ex-type CBS 

128649 = KACC 42394 = SMKC 21807). 

Notes: This fungus was originally recorded from Korea by Shin 

(1998) as Septoria oenanthis. However, conidia of Korean 

specimens (30–60 ×1.5–2.5 µm; Shin & Sameva 2004) are much 

larger than that of the American type collection (20–35 × 1.5–2 

µm; Saccardo 1895), and therefore better treated as a separate 

taxon. 

Septoria pseudonapelli Quaedvlieg, H.D. Shin, Verkley & 


Etymology: Named after its morphological similarity to Septoria 

napelli. 

Leaf spots on the upper leaf surface, scattered to confluent, distinct, 

angular to irregular, usually vein-limited, small to large, up to 30 mm 

when confluent, at first appearing small angular brown discoloration, 

later turning blackish brown with or without distinct border line, finally 

central area becoming blackish and surrounded by pale greenish 

margin; on the lower leaf surface similar but discoloured (Shin 

Fig. 25. Septoria oenanthicola (CBS 128649). A. Colony sporulating on MEA. B. Section through conidiomata. C–G. Conidiogenous cells. H. Conidia. Scale bars: B = 200 µm, 

all others = 10 µm. 

342


Fig. 26. Septoria pseudonapelli (CBS 128664). A. Colony sporulating on PDA. B. Section through conidioma. C–E. Conidiogenous cells. F. Conidia. Scale bars: B = 125 µm, 


& Sameva 2004). On sterile Carex leaves on WA. Conidiomata 

pycnidial, separate, black, globose, papillate with short neck (at times 

1–2 necks develop), up to 250 µm wide, 500 µm high with central 

ostiole; wall of 5–7 layers of brown textura angularis. Conidiophores 

reduced to conidiogenous cells. Conidiogenous cells ampulliform, 

lining the inner cavity, hyaline, smooth, with sympodial or apical 

percurrent proliferation, 10–13 × 5–7 µm. Conidia filiform, curved to 

flexuous, (50–)75–90(–100) × (2.5–)3(–3.5) µm, hyaline, guttulate, 

4–10-septate, apex subobtuse, base obconically truncate, 2 µm 

diam. 

Culture characteristics: Colonies on PDA flat, undulate with sparse, 

white aerial mycelium, surface olivaceous-black, reverse olivaceousblack, 

after 14 d, 2 cm diam; on MEA with sparse white aerial mycelium, 

surface olivaceous-black, reverse olivaceous-black, after 14 d, 4 cm 

diam; on OA with sparse white aerial mycelium, surface olivaceous, 

reverse olivaceous, after 14 d, 2 cm diam. 

Specimen examined: South Korea, Chuncheon, on leaves of Aconitum pseudolaeve 

var. erectum (Ranunculaceae), 4 Sep. 2008, H.D. Shin (holotype CBS H-21280, 

culture ex-type CBS 128664 = KACC 43952 = SMKC 23638). 

Notes: This taxon was originally reported as Septoria napelli from 

Korea by Shin & Sameva (2004), and broadly corresponds with the 

original description provided for this taxon (Petrak 1957). However, 

we have examined European material authentic for the name (see 

Verkley et al. 2013, this issue), from which the Korean fungus is 

genetically different. Based on these observations we describe the 

Korean collection as new. 

Clade 2: Sphaerulina 

Sphaerulina Sacc., Michelia 1(no. 4): 399. 1878. 


Type species: Sphaerulina myriadea (DC.) Sacc., Michelia 1(no. 

4): 399. 1878. 

Specimens examined: Germany, Driesen, Lasch [Rabenhorst, Fungi Eur. no. 149] 

(L). Japan, Aomori, Tsugaru, Kidukuri, Bense-marsh (40°51′53″ N, 140°17′42″E), 

on leaves of Q. dentata, 21 Apr. 2007, K. Tanaka 2243 (HHUF 29940; single 

ascospore culture CBS 124646 = JCM 15565). UK, on leaves of Quercus robur 

(Fagaceae), J.E. Vize [Microfungi Brit. Ex. No. 195] (ex IMI 57186, K(M) 167735). 

USA, California: Sequoia National Park. alt. 2590 m, on leaves of Castanopsis 

sempervirens, 18 Jun. 1931, H.E. Parks (BPI 623686); Lake Co., Hoberg’s Resort, 

on leaves of Q. kelloggii, 15 May 1943, V. Miller (BPI 623707); Maryland, Marlboro, 

on leaves of Q. alba, 26 Apr. 1929, C.L. Shear ( BPI 623705); Texas, Houston, on 

leaves of Q. alba, 8 Apr. 1869, H.W. Ravenel (BPI 623704). 

Notes: Sivanesan (1984) linked Sphaerulina to Septoria, 

Cercospora and Cercosporella asexual morphs, though these 

were never confirmed based on DNA data. The latter two 

genera have since been shown to be distinct (Crous et al. 2013, 

Groenewald et al. 2013; this volume), which leaves septoria-like 

asexual morphs such as Sphaerulina rubi Demaree & Wilcox 

(linked to Cylindrosporium rubi Ellis & Morgan), and S. rehmiana 

(linked to Septoria rosae), which confirms the results obtained 

here (Fig. 1). 

Sphaerulina abeliceae (Hiray.) Quaedvlieg, Verkley & 


Basionym: Septoria abeliceae Hiray., Mem. Col. Agr. Kyoto. Imp. 

Univ. 13(3): 33. 1931. 

Specimen examined: South Korea, Jeonju, on leaves of Zelkova serrata 

(Ulmaceae), 29 Oct. 2006, H.D. Shin, CBS 128591 = KACC 42626. 

Sphaerulina amelanchier Quaedvlieg, Verkley & Crous, sp. 

nov. MycoBank MB804407. Figs 27, 28. 


Amelanchier. 

On sterile Carex leaves on WA. Conidiomata pycnidial, brown, 

separate, immersed, globose, up to 150 µm diam, exuding a 

creamy conidial mass via central ostiole; wall of 3–6 layers of brown 

textura angularis. Conidiophores reduced to conidiogenous cells. 

Conidiogenous cells hyaline, smooth, subcylindrical, irregularly 

curved, branched to once geniculate-sinuous, 5–20 × 3–4 µm; 

proliferating sympodially. Conidia hyaline, smooth, guttulate, 

filiform, narrowly obclavate, apex subacutely rounded, base long 

obconically truncate, 1–8-septate, (25–)40–55(–60) × (1.5–)2(–2.5) 

µm; microcyclic conidiation common. Ascomata globose, brown, 


343


Fig. 27. Conidia, conidiogenous cells, ascospore and ascus of Sphaerulina amelanchier (CBS 135110). Scale bars = 10 µm. 

Fig. 28. Sphaerulina amelanchier (CBS 135110). A. Colony on PDA. B. Conidiogenous cells. C. Ascomata on host tissue. D. Germinating ascospore. E, F. Asci. G. Ascospores. 

H. Conidia. Scale bars = 10 µm. 

separate, immersed to erumpent, up to 150 µm diam. Asci broadly 

ellipsoid to obclavate, 22–35 × 7–9 µm; apical chamber visible, 

1–1.5 µm diam. Ascospores fusoid-ellipsoid, hyaline, smooth, 

granular, not to slightly constricted at median septum, widest just 

above septum, prominently curved, (13–)17–20(–25) × (2.5–)3(– 

3.5) µm. Ascospores germinating from both ends, with germ tubes 

parallel to the long axis, developing lateral branches and becoming 

constricted at septum, 3–4 µm diam. 

Culture characteristics: Colonies on PDA radially striate with lobate 

edge, sparse white aerial mycelium, surface fuscous-black to buff 

for the younger tissue, reverse cinnamon to olivaceous-black, after 

14 d, 3 cm diam; on MEA surface patches of hazel to fawm to 

fuscous-black, reverse sepia to olivaceous-black, after 14 d, 4.5 

cm diam; on OA surface pale-vinaceous to fuscous-black, reverse 

cinnamon to fuscous-black, after 14 d, 3 cm diam. 

Specimen examined: Netherlands, Houten, on leaf litter of Amelanchier sp. 

(Rosaceae), 28 Mar. 2012, S. Videira (holotype CBS H-21282, culture ex-type CBS 

135110 = MP8 = S544). 

Note: Presently there are no known species of septoria-like 

fungi known from Amelanchier. Phylogenetically, it is similar 

to Sphaerulina rhabdoclinis (conidia 8–30 × 1.5–2 µm), which 

infects needles of Pseudotsuga menziesii. Phylogenetically similar 

344


isolates occur on Betula, Castanea and Quercus. More isolates 

and molecular data are required to resolve this complex. 

Sphaerulina azaleae (Voglino) Quaedvlieg, Verkley & Crous, 


Basionym: Septoria azaleae Voglino, Syll. Fung. (Abellini) 14(2): 

976. 1899. 

≡ Phloeospora azaleae (Voglino) Priest, Fungi of Australia: 224. 2006. 

Specimens examined: Belgium, on leaves of Rhododendron sp. (Ericaceae), J. van 

Holder, CBS 352.49. South Korea, Hongcheon, on leaves of Rhododendron sp., 18 

Oct. 2009, H.D. Shin, KACC 44865 = CBS 128605. 

Sphaerulina berberidis (Niessl) Quaedvlieg, Verkley & 


Basionym: Septoria berberidis Niessl, in Rabenhorst, Bot. Ztg. 24: 

411. 1866. 

= Sphaerella berberidis Auersw., in Gonnermann & Rabenhorst, Mycol. eur. 

Abbild. Sämmtl. Pilze Eur. 5-6: 3. 1869 (nom. nov. for Sphaeria berberis 

Nitschke ex Fuckel). 

≡ Mycosphaerella berberidis (Auersw.) Lindau, in Engler & Prantl, Nat. 

Pflanzenfam., Teil. I (Leipzig) 1(1): 424. 1897. 

Description in vitro (CBS 116724): Colonies on OA 16–20 mm diam 

after 14 d, with an even, colourless margin; colonies spreading to 

restricted, somewhat elevated in the centre, the surface covered 

by a dense mat of pure white, woolly aerial mycelium; reverse in 

the centre dark brick to brown vinaceous, surrounded by cinnamon 

tinges; small amounts of a yellow to greenish pigment diffusies into 

the surrounding medium. Colonies on MEA 8–10 mm diam after 14 

d, with an even to slighlty ruffled vinaceous buff margin; colonies 

restricted, pustulate, the surface ochraceous or darker, with diffuse 

to locally more dense finely felted grey aerial mycelium; reverse 

brown vinaceous to vinaceous buff. Culture remained sterile. 

Specimen examined: Switzerland, Kt. Graubünden, Rodels-Realta, on Berberis 

vulgaris (Berberidaceae), 2 Jun. 1951, E. Müller, specimen CBS-H4984, culture 


Sphaerulina betulae (Pass.) Quaedvlieg, Verkley & Crous, 


Basionym: Septoria betulae Pass., Primo Elenc. Funghi Parm.: no. 

52. 1867. 

Specimens examined: Netherlands, Olst, leaves of Betula pubescens (Betulaceae), 

Sep. 2004, S. Green, CBS 116724. South Korea, Hongcheon, leaves of B. 

platyphylla var. japonica, 27 May 2008, H.D. Shin, CBS 128600 = KACC 43769. 

Sphaerulina menispermi (Thüm.) Quaedvlieg, Verkley & 


Basionym: Septoria menispermi Thüm., Pilzflora Siber.: no. 818. 1880. 

Specimens examined: South Korea, Chuncheon, on leaves of Menispermum 

dauricum (Menispermaceae), 16 Jun. 2008, H.D. Shin, KACC 43848 = CBS 

128761; Pyeongchang, on leaves of M. dauricum, 23 Sep. 2008, H.D. Shin, KACC 


Sphaerulina musiva (Peck) Quaedvlieg, Verkley & Crous, 


Basionym: Septoria musiva Peck, Ann. Rep. N.Y. St. Mus. Nat. 

Hist. 35: 138. 1883 [1881] 

= Mycosphaerella populorum G.E. Thomps., Phytopathology 31: 246. 1941. 

≡ Davidiella populorum (G.E. Thomps.) Aptroot, CBS Diversity Ser. 

(Utrecht) 5: 164. 2006. 

= Cylindrosporium oculatum Ellis & Everh., J. Mycol. 5(3): 155. 1889. 

Specimen examined: Canada, Quebec, leaf spot of Populus deltoids (Salicaceae), 

J. LeBoldus, CBS 130570. 

Sphaerulina oxyacanthae (Kunze & J.C. Schmidt) 

Quaedvlieg, Verkley & Crous, comb. nov. MycoBank 

MB804414. Figs 29, 30. 

Basionym: Septoria oxyacanthae Kunze & J.C. Schmidt, Myk. 

Hefte (Leipzig) 2: 108. 1823. 

≡ Phloeospora oxyacanthae (Kunze & J.C. Schmidt) Wallr., Fl. Crypt. 

Germ. (Norimbergae) 2: 117. 1833. 

Leaf spots amphigenous, medium to dark brown, subcircular 

to angular, 1–6 mm diam, with dark brown border. Conidiomata 

epiphyllous, up to 150 µm diam, brown, immersed, subepidermal, 

opening by irregular rupture of upper layer, with 3–4 apical flaps, 

exuding a long crystalline flame-like cirrhus of conidia; wall 

3–8 layers of brown textura angularis. On sterile Carex leaves 

on WA. Conidiophores reduced to conidiogenous cells, or with 

one supporting cell that can become fertile, forming a lateral 

conidiogenous locus just below the septum, 10–20 × 2.5–4 µm. 

Conidiogenous cells hyaline, smooth, aggregated, lining the inner 

cavity, terminal and lateral, ampulliform, 5–10 × 2.5–3.5 µm; 

proliferating several times percurrently near apex. Conidia hyaline, 

smooth, guttulate, 6–12-septate, falcate, widest in lower third of 

conidium, flexuous, apical cell tapering to subacute apex, forming a 

curved apical appendage-like elongation, 10–17 µm long, median 

cells are 5–10 µm long, basal cell forming an eccentric appendage 

that tapers to a subacutely rounded base, scar approximately 2–4 

Sphaerulina cercidis (Fr.) Quaedvlieg, Verkley & Crous, 


Basionym: Septoria cercidis Fr., in Léveillé, Ann. Sci. Nat., Bot., 

Sér. 3 9: 251. 1848. 

= Septoria provencialis Crous, Stud. Mycol. 55: 127. 2006. 

Specimens examined: Argentina, La Plata, on Cercis siliquastrum 

(Caesalpiniaceae), 12 Feb. 2008, H.D. Shin, KACC 43596 = CBS 129151; on 

C. siliquastrum, 1 Sep. 2007, H.D. Shin, KACC 44497 = CBS 128634. France, 

Provence, Cheval Blanc camping site, on leaves of Eucalyptus sp., 29 Jul. 2005, 

P.W. Crous, holotype of S. provincialis, CBS H-19701, culture ex-type CBS 118910. 

Netherlands, on C. siliquastrum, Sep. 1950, G. van den Ende, CBS 501.50. 

Fig. 29. Conidia and conidiogenous cells of Sphaerulina oxyacanthae (CBS 

135098). Scale bars = 10 µm. 


345


Fig. 30. Sphaerulina oxyacanthae (CBS 135098). A. Leaves with leaf spots. B. Close-up of conidiomata. C. Section though conidioma. D–F. Conidiogenous cells. G. Conidia 

(note appendages). Scale bars: C = 150 µm, all others = 10 µm. 

µm below basal septum; basal cell (incl. appendage) 11–20 µm 

long, conidia (60–)75–90(–100) × 2(–2.5) µm. 

Culture characteristics: Colonies on PDA umbonate with undulate 

edge and sparse, white aerial mycelium, surface isabelline, reverse 

greyish sepia, after 14 d, 3 cm diam; similar on MEA and PDA. 

Specimen examined: Netherlands, Wageningen, 51°57’50.43”N 5°41’0.41”E, on 

leaves of Crataegus sp. (Rosaceae), Sep. 2012, W. Quaedvlieg (CBS H-21291, 

culture CBS 135098 = S654). 

Notes: Several septoria-like species have been described from 

leaves of Crataegus (Farr & Rossman 2013). The present 

collection matches the description of Septoria oxyacanthae (leaf 

spots on Crataegus oxyacantha in Germany, conidia 8–12-septate; 

conidial dimensions not given). Unfortunately we have been unable 

to locate type material of this species. 

Sphaerulina patriniae (Miura) Quaedvlieg, Verkley & Crous, 


Basionym: Septoria patriniae Miura, Flora of Manchuria and East 

Mongolia, III Cryptogams, Fungi (Industr. Contr. S. Manch. Rly 27) 

3: 465. 1928. 

Specimen examined: South Korea, Pocheon, on leaves of Patrinia scabiosaefolia 

(Valerianaceae), 20 Aug. 2006, H.D. Shin, KACC 42518 = CBS 128653. 

Sphaerulina populicola (Peck) Quaedvlieg, Verkley & 


Basionym: Septoria populicola Peck, Ann. Rep. N.Y. St. Mus. 40: 

59. 1887. 

= Septoria populicola House, Bull. N.Y. St. Mus.: 59. 1920. (nom. illegit.) 

= Mycosphaerella populicola C.H. Thomps., Phytopathology 31: 251. 1941. 

Specimen examined: USA, Washington, Puyallup, on Populus trichocarpa 

(Salicaceae), 2 May 1997, G. Newcombe, CBS 100042. 

Fig. 31. Conidia, conidiogenous loci on a hypha, and conidiogenous cells of 

Sphaerulina pseudovirgaureae (CBS 135109). Scale bars = 10 µm. 

Sphaerulina pseudovirgaureae Quaedvlieg, Verkley & 

Crous, sp. nov. MycoBank MB804417. Figs 31, 32. 

Etymology: Named after its similarity to Septoria virgaureae. 

Conidiomata pycnidial, separate, erumpent, globose, up to 120 µm 

diam, dark brown, exusing a creamy conidial cirrhus through central 

ostiole, somewhat papillate; wall of 2–3 laters of brown textura 

angularis. Conidiophores reduced to conidiogenous cells or with 

one supporting cell, subcylindrical, 0–1-septate, branched below 

or not, pale brown at base, 10–20 × 3–5 µm. Conidiogenous cells 

integrated, hyaline, but pale brown at base, smooth, proliferating 

sympodially near apex, 7–17 × 2–3 µm. Conidia solitary, 

hyaline, smooth, guttulate, subcylindrical to narrowly obclavate, 

scolecosporous, irregularly curved, apex subobtuse, base truncate 

or narrowly obconically truncate, 3–10-septate, (30–)40–60(–80) × 

2.5(–3) µm. 

Culture characteristics: Colonies spreading, erumpent with sparse 

aerial mycelium and smooth, lobate margin and folded surface; 

reaching 13 mm diam after 2 wk. On MEA surface saffron with 

346


Fig. 32. Sphaerulina pseudovirgaureae (CBS 135109). A. Conidiomata forming in culture. B. Conidiogenous cells. C. Microcyclic conidiation. D. Conidia. Scale bars = 10 µm. 

patches of dirty white, reverse saffron to orange; on PDA surface 

and reverse saffron; on OA surface saffron. 

Specimen examined: Netherlands, Nijmegen, de Duffelt, on leaves of Solidago 

gigantea (Asteraceae), Aug. 2012, S. Videira (holotype CBS H-21327, culture extype 

CBS 135109 = S669). 

Notes: Several septoria-like species have been recorded on 

Solidago (Farr & Rossman 2013). Of these taxa Sphaerulina 

pseudovirgaureae is most similar to Septoria virguareae (conidia 

80–100 × 1.5 µm) except that its conidia are shorter and wider. 

Sphaerulina quercicola (Desm.) Quaedvlieg, Verkley & 

Crous, comb. nov. MycoBank MB804419. Figs 33, 34. 

Basionym: Septoria incondita var. quercicola Desm., Ann. Sci. nat., 

Sér. 3, Bot. 20: 95. 1853. 

≡ Septoria quercicola (Desm.) Sacc., Michelia 1: 174. 1879. 

≡ Phleospora quercicola (Desm.) Sacc., in P. A. Saccardo & D. Saccardo, 

1906. Syll. Fung. 18: 490. 1906. 

= Septoria quercina Fautr., in Fautrey & Lambotte, Revue Mycol. 17: 170. 

1895 (nom. illeg., art. 53; non Desmazières, 1847). Nom. nov. pro Septoria 

quercicola f. macrospora Roum., Revue Mycol. 13: 80. 1891. 

Description in vivo. Symptoms definite, small hologenous leaf 

spots, scattered or in clusters, in the centre orange brown, pale 

yellowish brown to white, usually delimited by a blackened, 

somewhat elevated zone, the surrounding leaf tissues becoming 

red or yellow. Conidiomata pycnidial or acervuloid, one to a few 

in each leafspot, scattered, semi-immersed, predominantly 

hypophyllous, pale to dark brown, lenticular to globose, 100–200 

µm diam; ostiolum often not well-developed, initially circular, 

central, soon opening widely, lacking distinctly differentiated cells; 

conidiomatal wall composed of textura angularis without distinctly 

differentiated layers and sometimes only well-developed in the 

lower part of the conidioma, mostly 10–15 µm thick, the outer cells 

with brown, somewhat thickened walls and 4.5–8 µm diam, the 

inner cells hyaline, thin-walled, 3–8 µm diam. Conidiogenous cells 

hyaline, discrete or integrated in simple, short, (1–)3–5-septate 

conidiophores which may be branched at the base, doliiform, 

cylindrical, or ampuliform, hyaline, holoblastic, proliferating 

percurrently with one to several, more or less distinct annellations, 

or sympodially, sometimes both types of proliferation occurring in 

a single conidiogenous cell, 4.5–16(–22.5) × 3–4.5 µm. Conidia 

cylindrical, curved or flexuous, broadly rounded at the apex 

which is provided with a cap of mucilaginous material, attenuated 

Fig. 33. Ascospores and asci of Sphaerulina quercicola (CBS 113266). Scale bar 

= 10 µm. 

gradually to a broadly or more narrowly truncate base which often 

is also provided with an amorphous mass of mucilaginous material, 

hyaline, (0–)1–3-septate, constricted around the septa, sometimes 

at one or more septa also some amorphous mucilaginous material 

may be present, contents with numerous small oil droplets, 

(32.5–)38–50(–65) × 3–4 µm. Ascomata not clearly associated 

with leaf spots, pseudothecial, predominantly hypophyllous, black, 

subepidermal, erumpent to superficial, globose, 100–150 µm 

diam; apical ostiole 5–10 µm wide; wall consisting of 2–3 layers of 

medium brown textura angularis. Asci aparaphysate, fasciculate, 

bitunicate, subsessile, broadly ellipsoidal to subcylindrical, straight 

to slightly curved, 8-spored, 35–50 × 9–12 µm. Ascospores tri- to 


347


Fig. 34. Sphaerulina quercicola (CBS 663.94). A. Leaves with leaf spots. B. Close-up of lesion. C. Conidiogenous cells. D. Conidia. Scale bars = 10 µm. 

Fig. 35. Sphaerulina rhabdoclinis (CBS 102195). A. Conidiomata forming in culture. B. Sporulation on PDA. C. Conidia. Scale bar = 10 µm. 

multiseriate, overlapping, hyaline, guttulate, thin-walled, curved, 

rarely straight, fusoid-ellipsoidal with obtuse ends, widest at septum 

or just above, medianly 1-septate, not constricted at the septum, 

tapering towards both ends, (13–)15–18(–20) × (3.5–)4–4.5(–5) 

µm (av. 17 × 4.5 µm). 

Culture characteristics: Colonies on OA reaching 5–7 mm diam 

in 21 d, with an even to undulating, colourless margin; colonies 

restricted, irregularly pustulate, immersed mycelium appearing 

dark greyish to olivaceous black, rosy buff near the margin, 

covered mostly with a dense mat of woolly, pure white or greyish 

aerial mycelium; reverse in the centre brown vinaceous or more 

greyish black, surrounded by brick to rosy buff. Pycnidia developing 

on the agar surface in the centre, releasing droplets of rosy-buff 

conidial slime. Colonies on MEA reaching 4–6(–8) mm diam in 21 

d, with an even, to irregularly undulating margin which is mostly 

hidden under the aerial mycelium; colonies restricted, irregularly 

pustulate, the surface mostly blackish or very dark grey, covered by 

dense to diffuse, finely felted, white aerial mycelium; reverse mostly 

olivaceous black, near the margin cinnamon to buff. Numerous 

single and aggregated pycnidia developing on the colony surface 

in the centre, releasing milky white to rosy buff conidial slime. 

Conidia as in planta (CBS 663.94) though on average considerably 

longer, 51.5–74.5 × 3–4(–4.5) µm (OA), the apex, base and area 

around septa normally both provided with mucilaginous material as 

described above, (0–)1–3(–5)-septate. 

Specimens examined: Austria, endophyte culture ex twig of Quercus petraea 

(Fagaceae), Aug. 1991, E. Halmschlager 212 (H. A. van der Aa 10986), CBS 456.91. 

France, loc. unknown, on leaves of Quercus sp. (“divers Chênes”), distributed in 

Desmazières, Pl. crypt. Fr., Fasc. 43, no. 2193 (PC, type of Septoria incondita var. 

quercicola Desm.). Netherlands, Utrecht, Baarn, on living leaves of Q. robur, 11 

Aug. 1994, G. Verkley 225 (CBS H-21188), living culture CBS 663.94; prov. Utrecht, 

Soest, De Stompert, on living leaves of Q. rubra, 15 Aug. 1995, G. Verkley 310 

(CBS H-21189), CBS 791.95; Same loc., dead fallen leaves of Q. robur, Apr. 2003, 

G. Verkley s.n., single ascospore-isolate CBS 113266 (‘Crous 3’); Same loc., G. 

Verkley & I. van Kempen, endophyte isolates ex green leaves of Q. robur CBS 

115016, 115136, 115137; Prov. Gelderland, Amerongen, Park Kasteel Amerongen, 

leaf spot of Q. rubra, 11 Jul. 2000, G. Verkley 973 (CBS H-21231), living culture CBS 

109009; Prov. Utrecht, Amelisweerd, on dead leaves of Q. robur, 25 Apr. 2005, G. 

Verkley 3108A, culture CBS 117803, CPC 12097. 

Sphaerulina rhabdoclinis (Butin) Quaedvlieg, Verkley & 


Basionym: Dothistroma rhabdoclinis Butin, For. Path. 30: 196. 

2000. 

Specimen examined: Germany, Wolfenbüttel, on needles of Pseudotsuga menziesii 

(Pinaceae), 24 May 1998, H. Butin, culture ex-type CBS 102195. 

Note: Sphaerulina rhabdoclinis is phylogenetically closely related to 

S. amelanchier, which appears to be a species complex occurring 

on unrelated hosts (see Verkley et al. 2013). 

Sphaerulina viciae Quaedvlieg, H.D. Shin, Verkley & Crous, 

sp. nov. MycoBank MB804418. Figs 36, 37. 


Vicia. 

348


On Anthriscus stem. Conidiomata pycnidial, solitary, erumpent, 

brown, globose, up to 150 µm diam, with central ostiole; wall 

of 3–6 layers of textura angularis. Conidiophores reduced 

to conidiogenous cells. Conidiogenous cells lining the inner 

cavity, hyaline, smooth, subcylindrical, tapering and proliferating 

sympodially at apex, 5–10 × 3–4 µm. Conidia hyaline, smooth, 

guttulate, subcylindrical, irregularly curved, apex obtuse, base 

truncate, (3–)6–multiseptate, not or slightly constricted at septa 

(especially constricted on SNA, OA and MEA), (45–)55–75(–110) 

× (2.5–)3(–3.5) µm. 

Culture characteristics: Colonies erumpent, spreading with folded 

surface and sparse aerial mycelium, and smooth, lobate margin; 

reaching 12 mm diam after 2 wk. On MEA and PDA surface and 

reverse olivaceous-grey. On OA surface pale olivaceous-grey. 

Specimen examined: South Korea, on leaves of Vicia amurense (Fabaceae), 12 

Aug. 2004, H.D. Shin (holotype CBS H-21283, culture ex-type CPC 11414, 11416, 

11415 = CBS 131898). 

Notes: Several septoria-like species are known from Vicia (Farr 

& Rossman 2013). Of these, Sphaerulina viciae is most similar to 

Septoria viceae (conidia 30–60 × 2.5 µm), but distinct in having 

longer and wider conidia. 

Clade 3: Caryophylloseptoria 

Description: See Verkley et al. (2013) 

Type species: Caryophylloseptoria lychnidis (Desm.) Verkley, 

Quaedvlieg & Crous. 

Caryophylloseptoria pseudolychnidis Quaedvlieg, H.D. 

Shin, Verkley & Crous, sp. nov. MycoBank MB804481. Fig. 

38. 

Etymology: Named after its morphological similarity to Septoria 

lychnidis. 

Fig. 36. Conidia and conidiogenous cells of Sphaerulina viciae (CBS 131898). Scale 


Leaf spots on the upper leaf surface, scattered to confluent, 

distinct, circular, angular to irregular, usually very large, reaching 

up to 20 mm diam, often surrounded with yellow halo, lacking 

concentric rings, initially dark brown with pale green border, 

becoming brown to dark brown, finally turning greyish brown to 

pallid in the centre; on the lower leaf surface greyish brown to 

brown with yellowish margin (Shin & Sameva 2004). On sterile 

Carex leaves on WA. Conidiomata pycnidial, globose, up to 250 

µm diam, black with central ostiole, but frequently splitting open 

at maturity, appearing acervular; wall of 6–8 layers of dark brown 

textura angularis. Conidiophores subcylindrical, lining the inner 

cavity, hyaline, smooth, reduced to conidiogenous cells, or with 

1–2 supporting cells, frequently branched at base, 10–25 × 3–5 

µm. Conidiogenous cells subcylindrical to ampulliform, 7–15 × 3–5 

µm; proliferating sympodially or percurrently near apex. Conidia 

Fig. 37. Sphaerulina viciae (CBS 131898). A. Conidiomata forming in culture. B, C, E. Conidiogenous cells. D, F. Conidia. Scale bars = 10 µm. 


349


Fig. 38. Caryophylloseptoria pseudolychnidis (CBS 128630). A. Colony sporulating on MEA. B. Vertical section through conidiomata. C, D. Conidiogenous cells. E. Conidia. 

Scale bar: B = 250 µm, others = 10 µm. 

hyaline, smooth, guttulate, cylindrical, apex obtuse to subobtuse, 

base truncate, 3–3.5 µm; 1–3(–5)-septate, (25–)32–45(–50) × 

(2–)2.5–3(–3.5) µm. 

Culture characteristics: Colonies on PDA flat, undulate, very 

sparse, mixed grey and white aerial mycelium, surface isabelline 

to fuscous-black, reverse olivaceous-black to isabelline for the 

younger tissue, after 14 d, 3 cm diam; on MEA umbonate, striate, 

undulate, surface fuscous-black to honey for the younger tissue 

after 14 d 3.5 cm diam; on OA surface dark-mouse-grey, reverse 

iron-grey to mouse-grey. 

Specimen examined: South Korea, Yangpyeong, Jungmi mountain, on leaves 

of Lychnis cognata (Caryophyllaceae), 27 May 2007, H.D. Shin (holotype CBS 

H-21292, culture ex-type CBS 128630 = KACC 43866 = SMKC 23519). 

Notes: Shin (1995) recorded this species for the first time in 

Korea, while Shin & Sameva (1999) provided a full morphologial 

description. Although it compared well with the original description 

of this European taxon, its conidia tend to be smaller than those of 

S. lychnidis (50–70 × 2.5–3 µm), of which we have also examined 

European material (see Verkley et al. 2013, this issue). 

Clade 4: pseudocercosporella-like 

Note: See Frank et al. (2010). 

Clade 5: Cercospora 

Note: See Groenewald et al. (2013). 

Clade 6: Phloeospora 


Type species: P. ulmi (Fr.) Wallr., Fl. Crypt. Germ. (Norimbergae) 

2: 177. 1833. 

Phloeospora ulmi (Fr.) Wallr., Fl. Crypt. Germ. (Norimbergae) 

2: 177. 1833. Figs 39, 40. 

≡ Septoria ulmi Fr. [as ‘Septaria’], Novit. Fl. Svec. 5(cont.): 78. 1819. 

Fig. 39. Conidia and conidiogenous cells of Phloeospora ulmi (CBS 613.81). Scale 


≡ Septogloeum ulmi (Fr. & Kunze) Died., Krypt. Fl. Brandenburg (Leipzig) 

9: 836. 1915. 

≡ Cylindrosporium ulmi (Fr.) Vassiljevsky, Fungi Imperfecti Parasitici 2: 

580. 1950. 

= Mycosphaerella ulmi Kleb., Z. PflKrankh. 12: 257. 1902. 

= Sphaerella ulmi (Kleb.) Sacc. & D. Sacc., Syll. Fung. (Abellini) 17: 642. 1905. 

Leaf spots angular, vein limited, separate, becoming somewhat 

confluent, initially small yellow-green spots that finally turn brown. 

Conidiomata acervular, hypophyllous, separate, subepidermal, 

composed of thin-walled, medium brown textura angularis, up to 

200 µm diam, opening by irregular rupture, and exuding a prominent 

cirrhus of orange to yellow-orange conidia. Conidiophores reduced 

to conidiogenous cells, or with 1–2 supporting cells, branched 

below or not, subcylindrical, 10–30 × 4–5 µm. Conidiogenous 

cells hyaline, smooth, subcylindrical, straight to once geniculate, 

with numerous prominent percurrent proliferations at apex, 10–15 

× 4–5 µm. Conidia solitary, hyaline, smooth, straight to curved, 

guttulate or not, fusiform, tapering towards an obtuse or subobtuse 

apex, and truncate base, 2–3 µm diam, with minute marginal frill, 

350


Fig. 40. Phloeospora ulmi (CBS 613.81). A, B, D, E. Conidiomata bursting through host tissue. G, H. Microconidiogenous cells. K. Spermatia. C, F, I, J, L. Macroconidiogenous 

cells (arrows denote percurrent proliferation). M. Conidia. Scale bars = 10 µm. 

3–5-septate, (20–)30–50(–60) × (3.5–)4–5(–6) µm. Leaf spots also 

contain black spermatogonia and ascomata. 

Specimens examined: Austria, Innsbruck, near Hungerburg, on leaves of Ulmus sp. 

(Ulmaceae), 21 Sep. 1981, H.A. van der Aa, CBS H-14740, H-14861, culture CBS 

613.81; Innsbruck, road to Hungerburg, on leaves of Ulmus glabra, 20 Oct. 1996, W. 

Gams, CBS 344.97. Netherlands, Baarn, garden of CBS, Oosterstraat 1, on leaves 

of Ulmus sp., 26 Aug. 1998, H.A. van der Aa, CBS H-14739, culture CBS 101564. 

Unknown, on leaves of Ulmus pedunculata, 15 Jul. 1901, A. van Luijk, CBS H-920. 

Note: Distinct from Septoria s. str. by having acervuli, and 

conidiogenous cells with prominent percurrent proliferation. 

Clade 7: septoria-like 

Septoria gladioli Pass., in Rabenhorst, Fungi europ. exsicc.: 

no. 1956. 1875. Passerini, Atti Soc. crittog. ital. 2: 41. 1879. 

Descripton in vitro (18 ºC, NUV). CBS 121.20: Colonies on OA 15– 

18 mm diam after 21 d, with an even to slightly ruffled, colourless 

margin; colonies plane, immersed mycelium olivaceous black, 

fading over amber towards the margin, aerial mycelium absent; 

reverse concolorous. No sporulation observed. Colonies on MEA 

10–15 mm diam after 21 d, with an even, pale luteous to amber 

margin; colonies restricted, irregularly pustulate to cerebriform, 

immersed mycelium ochreous to salmon, covered by diffuse, finely 

felted, white aerial mycelium; reverse in the centre rust, fading 

towards the margin over apricot to pale luteous. No sporulation 

observed. CBS 353.29: Colonies on OA 16–20 mm diam after 

21 d, with an even to slightly ruffled, colourless margin; colonies 

plane, immersed mycelium rosy buff mixed with some olivaceous 

grey, aerial mycelium absent; reverse mainly pale purplish grey 

to pale mouse grey. No sporulation observed. Colonies on MEA 

14–22(–26) mm diam after 21 d, with an even to lobed, buff margin; 

colonies restricted, elevated towards the centre, radially striate, 

immersed mycelium greenish olivaceous fading to ochreous or buff 

salmon, the central part mostly covered by diffuse, finely felted, 

white aerial mycelium; reverse in the centre dark brick to isabelline 

or hazel, fading towards the margin over pale cinnamon to buff. No 

sporulation observed. 

Specimen examined: Netherlands, Mar. 1929, J.C. Went, CBS 353.29. Unknown 

location and host, 1920, W.J. Kaiser, CBS 121.20. 


351


Notes: Priest (2006) provided a complete description of S. gladioli 

on host material, based on observations of an isotype in MEL, and 

several specimens on Gladiolus cultivars collected in Australia. 

The two strains available from the CBS are old and sterile, and 

show some differences that also seem to be reflected in the DNA 

data obtained. Septoria gladioli is the only species of septorioid 

fungi described from the genus Gladiolus. An unusual feature of 

the species is that it overwinters as “sclerotia”, that cause leaf 

infections in the next season (Priest 2006). The conidiogenous 

cells are holoblastic and very distinctly proliferate percurrently to 

form subsequent conidia, but no sympodial proliferation has been 

reported. Based on the multilocus phylogeny, the aforementioned 

isolates should be placed in their own genus, with the genus 

Phloeospora as its closest relative. Recollecting material will be 

required to determine the generic disposition, the delimitation of the 

taxa (as there seem to be at least two) and to which of these taxa 

the name Septoria gladioli should be applied. 

Clade 8: passalora-like 

Passalora dioscoreae (Ellis & G. Martin) U. Braun & Crous, 

in Crous & Braun, CBS Biodiversity Ser. (Utrecht) 1: 162. 

2003. 

mass; wall of 2–3 layers of brown textura angularis. Conidiophores 

0–2-septate, subcylindrical, hyaline to pale brown at base, smooth, 

straight to geniculate-sinuous. Conidiogenous cells phialidic, 

hyaline, smooth, aggregated, lining the inner cavity, subcylindrical 

to ampulliform, straight to geniculate-sinuous; proliferating 

several times percurrently near apex, rarely sympodially. Conidia 

scolecosporous, hyaline, smooth, flexuous, rarely straight, granular, 

thin-walled, narrowly obclavate, apex subobtuse, base long 

obconically truncate, tapering to a truncate hilum, 3–multiseptate. 

Type species: Neoseptoria caricis Quaedvlieg, Verkley & Crous. 

Note: The genus Neoseptoria is morphologically similar to Septoria, 

but distinct in having mono- to polyphialidic conidiogenous cells 

that proliferate percurrently at the apex. 

Neoseptoria caricis Quaedvlieg, Verkley & Crous, sp. nov. 


Etymology: Named after the host genus on which it occurs, Carex. 

Specimen examined: South Korea, on leaves of Dioscorea tokoro (Dioscoreaceae), 

24 Oct. 2003, H.D. Shin (CPC 10855); ibid., on leaves of Dioscorea tenuipes, 1 Jan. 

2004, H.D. Shin (CPC 11513). 

Notes: Passalora dioscoreae is not congeneric with the type 

species of the genus, P. bacilligera. The taxonomy of Passalora 

and its relatives will be treated in a future publication (Videira et 

al., in prep.). 

Clade 9: Neoseptoria 

Neoseptoria Quaedvlieg, Verkley & Crous, gen. nov. 


Etymology: Resembling the genus Septoria. 

Foliicolous. Conidiomata black, immersed, subepidermal, 

pycnidial, subglobose with central ostiole, exuding creamy conidial 

Fig. 41. Conidia and conidiogenous cells of Neoseptoria caricis (CBS 135097). 


Fig. 42. Neoseptoria caricis (CBS 135097). A, B. Conidiomata developing in culture. C, D. Conidiogenous cells. E, F. Conidia. Scale bars = 10 µm. 

352



black, immersed, subepidermal, pycnidial, subglobose with central 


textura angularis. Conidiophores reduced to conidiogenous cells, or 

0–2-septate, subcylindrical, hyaline to pale brown at base, smooth, 

straight to geniculate-sinuous, 10–30 × 2.5–3.5 µm. Conidiogenous 

cells phialidic, hyaline, smooth, aggregated, lining the inner cavity, 

subcylindrical to ampulliform, straight to geniculate-sinuous, 8–15 × 

2.5–3 µm; proliferating several times percurrently near apex, rarely 

sympodially. Conidia scolecosporous, hyaline, smooth, flexuous, rarely 

straight, granular, thin-walled, narrowly obclavate, apex subobtuse, 

base long obconically truncate, tapering to a truncate hilum, 1.5–2 µm 

diam, 3(–5)-septate, (40–)55–68(–80) × (2.5–)3(–3.5) µm. 

Culture characteristics: Colonies on PDA erumpent, undulate, 

lacking aerial mycelium, reverse iron-grey, after 14 d, 3 cm diam; 

on MEA reverse greyish sepia, after 14 d, 3 cm diam, with fine, 

pale pink to orange aerial mycelium; on OA similar to MEA, but with 

pinkish tufts of aerial mycelium. 

Specimen examined: Netherlands, Wageningen, on leaves of Carex acutiformis 

(Cyperaceae), Aug. 2012, W. Quaedvlieg (holotype CBS H-21293, culture ex-type 

CBS 135097 = S653). 

Notes: Several septoria-like species have been described from 

Carex (Farr & Rossman 2013). Of these, N. caricis is most similar 

to S. caricicola (conidia 25–55 × 4 µm; (6–)7(–8)-septate), but 

distinct in having longer and narrower conidia with less septa. 

Clade 10: Pseudocercospora 

Note: See Crous et al. (2013) 

Clade 11: Zymoseptoria 

Note: See Quaedvlieg et al. (2011). 

Clade 12: Ramularia 

Note: See Crous et al. (2009a, c). 

Clade 13: Dothistroma 

Note: See Barnes et al. (2004). 

Clade 14: Stromatoseptoria 

Stromatoseptoria Quaedvlieg, Verkley & Crous, gen. nov. 


Etymology: Stroma = referring to central stoma in pycnidium that 

gives rise to conidiophores; Septoria = septoria-like morphology. 

Foliicolous, plant pathogenic. Conidiomata pycnidial, 

hypophyllous, subglobose to lenticular, very pale brown to 

dark brown, immersed to erumpent, exuding conidia in white 

cirrhus; ostiolum central, circular, surrounding cells concolorous; 

conidiomatal wall composed of a homogenous tissue of hyaline 

to very pale brown, angular to irregular cells. Conidiophores 

subcylindrical, branched, hyaline, septate. Conidiogenous cells 

hyaline, discrete or integrated, cylindrical or narrowly ampulliform, 

holoblastic, often also proliferating percurrently. Conidia 

cylindrical, slightly to distinctly curved, broadly rounded apex, 

attenuated towards a truncate base, transversely euseptate, 

mostly constricted at septa. 

Type species: Stromatoseptoria castaneicola (Desm.) Quaedvlieg, 

Verkley & Crous. 

Notes: Stromatoseptoria is distinguished from Septoria based on 

the central cushion or stroma that gives rise to its conidiophores 

(sensu Coniella and Pilidiella; van Niekerk et al. 2004), and conidia 

that tend to be olivaceous-brown in mass, and also turn olivaceous 

and verruculose with age. 

Stromatoseptoria castaneicola (Desm.) Quaedvlieg, 

Verkley & Crous, comb. nov. MycoBank MB804424. Fig. 43. 

Basionym: Septoria castaneicola Desm., Ann. Sci. Nat., Sér. 3, Bot. 

8: 26. 1847. 

≡ (?) Phleospora castanicola (Desm.) D. Sacc., Mycoth. Ital., Cent. 1-2, 

no. 173. 

= Septoria gilletiana Sacc., Michelia 1: 359. 1878. 

? = Septoria castaneae Lév., Ann. Sci. Nat., Sér. 3, Bot. 5: 278. 1846. 

≡ Cylindrosporium castaneae Krenner, Bot. Közl. 41(3-4): 126. 1944. 

Description in vivo. Leaf spots numerous, small, angular, and often 

merging to irregular patterns, visible on both sides of the leaf, 

initially pale yellowish brown, later reddish brown with a narrow, 

darker border; Conidiomata pycnidial, hypophyllous, several in each 

Fig. 43. Stromatoseptoria castaneicola (CBS 102320). A. Colony sporulating on MEA. B. Stroma giving rise to conidiogenous cells. C, D. Conidiogenous cells. E. Conidia. Scale 

bars: B = 200 µm, all others = 10 µm. 


353


leaf spot, subglobose to lenticular, very pale brown to dark brown, 

usually fully immersed, 80–150(–200) µm diam, releasing conidia 

in white cirrhi; ostiolum not well-differentiated, central, circular, 

18–50 µm wide, surrounding cells concolorous; conidiomatal 

wall about 10–17 µm thick, composed of a homogenous tissue of 

hyaline to very pale brown, angular to irregular cells 4–10 µm diam; 

Conidiophores subcylindrical, branched at base, hyaline, smooth, 

1–2-septate; base frequently brown, verruculose. Conidiogenous 

cells hyaline, discrete or integrated in conidiophores cylindrical 

or narrowly ampulliform, holoblastic, often also proliferating 

percurrently with up to 3 closely positioned annellations, 7–17(– 

20) × 3–4(–5) µm. Conidia cylindrical, slightly to distinctly curved, 

irregularly bent or flexuous, with a relatively broadly rounded apex, 

attenuated towards a truncate base, basal and apical cell often 

both wider than intermediate cells, (0–)2–3(–4)-septate, mostly 

constricted around the septa in the living state, hyaline, contents 

with several oil-droplets and granular material in each cell in the 

living state, with granular contents in the rehydrated state, 30– 

46 × 3–4 µm ("T"; rehydrated, "NT" 2–3 µm wide). Conidia are 

olivaceous-brown in mass, and older conidia also turn olivaceous 

and verruculose, and at times anastomose in culture. 

Culture characteristics: Colonies (CBS 102322) on OA reaching 

4–8 mm diam in 25 d (9–12 mm in 33 d), with an even, glabrous, 

buff margin; colonies restricted, up to 1 mm high, immersed 

mycelium homogeneously buff, where conidiomatal complexes 

develop dark brick to black, in part covered by pure white, dense, 

appressed and woolly aerial mycelium, later a salmon haze occurs 

in the immersed mycelium; reverse buff, locally cinnamon to sepia. 

Colonies on CMA reaching (4–)7–11 mm diam in 25 d (8–12 mm 

in 33 d), as on OA, but with a halo of reddish to salmon, diffusing 

pigment, which becomes more intense after 33 d, and immersed 

mycelium in the centre darker, and aerial mycelium more strongly 

developed, later becoming locally salmon or citrine; reverse brick 

and dark brick, surrounded by a reddish to salmon zone. Colonies 

on MEA reaching 6.5–9 mm diam in 25 d (9–11.5 mm in 33 d), 

with an even, buff to cinnamon margin, entirely hidden under the 

aerial mycelium, with a very faint halo of diffusing pigment; colonies 

restricted, up to 4 mm high, hemispherical to irregularly pustulate, 

entirely covered by a dense mat of felted aerial mycelium, which, 

especialy in the centre, attains a rosy buff or primrose to citrine 

haze; reverse cinnamon to hazel, around a brick to dark brick 

centre. Colonies on CHA reaching 7–9 mm diam in 25 d (9–11 mm 

in 33 d), as on MEA, but no diffusing pigment observed around 

the colonies. Conidiomata on OA developing after 10–15 d, black, 

globose, single or merged to complexes up to 250 µm diam, 

releasing milky white conidial slime. Conidiogenous cells as in 

planta. Conidia as in planta, mostly 3-septate, 30–45 × 3.5–4.5 µm 

(CBS 102320, OA, "T"; "NT" 3 µm wide). 

Specimens examined: Austria, Tirol, Klausen, on leaves of Castanea vesca 

(Fagaceae), Aug., distributed in F. von Höhnel, Krypt. exsicc. no. 415, (PC0084576, 

PC0084583). France, Lébisey, Aug. and Sep. 1843, M. Roberge, ‘Coll. 

Desmazières 1863, no. 8’, on leaves of Castanea sativa (PC0084574, type of 

Septoria castanicola Desm.); same substr., Meudon, 1 Aug. 1849 (PC0084571, 

PC0084589, PC0084590, PC0084591) and Jul. 1852 (PC0084572); same substr., 

loc. and date unknown, ‘Coll. Desmazières 1863, no. 8’ (PC0084570); Seine-et- 

Marne, Fontainebleau, Sep 1881, distributed in Roumeguère, Fungi Gallici exsicc. 

no. 2029 (PC0084575). Netherlands, prov. Utrecht, Baarn, Lage Vuursche, on 

living leaves of Castanea sativa, 29 Aug. 1999, G. Verkley 912 (CBS H-21200), 

cultures CBS 102320–102322; same substr., prov. Limburg, St. Jansberg, 9 Sep. 

1999, G. Verkley 932 (CBS H-21214), culture CBS 102377; same substr., prov. 

Limburg, Molenhoek, Heumense Schans (46-12-55), 23 Aug. 2004, G. Verkley & M. 

Starink 3040, culture CBS 116464. 

Notes: According to the original diagnosis that Desmazières 

published in 1847 based on material on Castanea collected in 

autumn, the conidia are elongated, thin and curved, and about 

40 µm in length. No further details like conidial septa were 

given. The material PC0084574 is the only collection received 

from PC that antidates the publication and assumedly is the 

type. It consists of several leaves with numerous pycnidia in leaf 

spots, some of which belong to Septoria castaneicola with the 

characteristic conidia, but most are a spermatial state of most 

likely the Mycosphaerella punctiformis complex (= Ramularia, 

Verkley et al. 2004). 

Teterevnikova-Babayan (1987) treated S. castaneicola Desm. 

as a synonym of S. castaneae Lév., and both originally were 

described from the same host, Castanea sativa (syn. C. vesca). 

Teterevnikova-Babayan (1987) described the conidia as 3-septate, 

25–40 × 2.5–4.5 µm, which is in fairly good agreement with present 

observations. The type of S. castanaea Lév. could not be studied 

and the name remains doubtful. Even though Léveillé described 

symptoms that match those of S. castaneicola fairly well, he 

described the conidia as aseptate, and failed to give information 

about their size. 

Clade 15: Lecanosticta 

Note: See Quaedvlieg et al. (2012). 

Clade 16: Phaeophleospora 

Note: See Crous et al. (2009b, c). 

Clade 17: Cytostagonospora 

Cytostagonospora Bubák, Ann. Mycol. 14: 150. 1916. 


Type species: Cytostagonospora photiniicola Bubák [as 

“photinicola”], Ann. Mycol. 14: 150. 1916. 

Cytostagonospora martiniana (Sacc.) B. Sutton & H.J. 

Swart, Trans. Br. mycol. Soc. 87: 99. 1986. Figs 44, 45. 

Basionym: Septoria martiniana Sacc., Syll. Fung. (Abellini) 10: 351. 

1892. 

= Septoria phyllodiorum Cooke & Massee, Grevillea 19(90): 47. 1890, non S. 

phyllodiorum Sacc., Hedwigia 29: 156. 1890. 

On sterile Carex leaves on WA. Leaf spots amphigenous, circular, 

grey to brown with raised dark brown border, 1–3 mm diam. 

Conidiomata immersed, subepidermal, epiphyllous, solitary to 

aggregated with stromatic tissue, with central ostiolar opening 

exuding a creamy to white conidial mass, rupturing at maturity 

(pycnidial to acervular), brown, globose, up to 400 µm diam; wall 

of 3–6 layers of brown textura angularis. Conidiophores hyaline, 

smooth, subcylindrical, 0–5-septate, branched or not, 10–15(–50) 

× 3–4 µm, giving rise to terminal and lateral conidiogenous cells. 

Conidiogenous cells hyaline, smooth, subcylindrical or ampulliform, 

4–8 × 3–4 µm, polyphialidic, with apical and lateral loci, with visible 

periclinal thickening, at times also proliferating percurrently (both 

modes can also be present on the same conidiogenous cell). 

Conidia hyaline, smooth, granular, irregularly curved, subcylindrical 

354


to narrowly obclavate, apex subobtuse, base long, obconically 

truncate, (1–)3-septate, (18–)32–45(–50) × (1.5–)2(–3) µm; base 

not thickened, 0.5–1 µm diam. 

Culture characteristics: Colonies on PDA convex, erumpent with 

feathery margin, lacking aerial mycelium, surface fuscous-black, 

reverse olivaceous-black, after 14 d, 4 cm diam, with a beautifull 

purple exudate at the outer edges; on MEA, after 14 d, 3.5 cm 

diam, lacking any exudate; on OA surface fuscous-black, reverse 

olivaceous-grey, after 14 d, 4 cm diam, purplish-red coloured 

exudate. 

Specimen examined: Australia, Warneet close to Melbourne, S38º13’37.8” 

E145º18’25.4”, on leaves of Acacia pycnantha (Mimosaceae), 21 Oct. 2009, P.W. 

Crous (specimen CBS H-21297, culture CBS 135102 = CPC 17727). 

Notes: The present collection matches the description of 

Cytostagonospora martiniana provided by Sutton & Swart (1986). 

As discussed by the authors, this genus is distinct from Septoria 

s. str. based on its conidiomata aggregated in stromatic tissue, 

and unique mode of conidiogenesis. In culture conidiogenous cells 

exhibited a mixture of sympodial proliferation, or were polyphialidic 

with periclinal thickening, but also proliferated percurrently. Species 

of Septoria occurring on Acacia were treated by Sutton & Pascoe 

(1987). 

Clade 18: Zasmidium 

Note: See Crous et al. (2007a, b, 2009c). 

Clade 19: Polyphialoseptoria 

Polyphialoseptoria Quaedvlieg, R.W. Barreto, Verkley & 

Crous, gen. nov. MycoBank MB804425. 

Etymology: Polyphialo = polyphialides; Septoria = septoria-like. 

Foliicolous, plant pathogenic. Conidiomata brown, erumpent, 

pycnidial (acervular in culture), globose, brown; wall of 3–6 

layers of pale brown textura angularis. Conidiophores reduced 


subcylindrical to ampulliform; proliferating sympodially at apex, 

forming polyphialides with minute periclinal thickening, or as 

solitary loci on superficial mycelium in culture. Conidia hyaline, 

smooth, granular to guttulate, scolecosporous, irregularly curved, 

apex subobtuse, base long obconically truncate, transversely multieuseptate, 

in older cultures disarticulating at septa; microcyclic 

conidiation also common in older cultures. 

Fig. 44. Conidia and conidiogenous cells of Cytostagonospora martiniana (CBS 

135102). Scale bars = 10 µm. 

Type species: Polyphialoseptoria terminaliae Quaedvlieg, R.W. 

Barreto, Verkley & Crous. 

Fig. 45. Cytostagonospora martiniana (CBS 135102). A. Leaf spot. B. Conidiomata forming in culture. C–F. Conidiogenous cells. G. Conidia. Scale bars = 10 µm. 


355


Polyphialoseptoria tabebuiae-serratifoliae Quaedvlieg, 

Alfenas & Crous, sp. nov. MycoBank MB804427. Figs 46, 

47. 

Etymology: Named after its host, Tabebuia serratifolia. 

Leaf spots variable in number on mature leaves; initially as small 

spots or purple-brown areas, with the inner part becoming greywhite 

with age, surrounded by a purple-brown halo. Conidiomata 

developing on sterile barley leaves on WA, pale cream in colour, 

erumpent, globose, up to 180 µm diam; wall of 2–3 layers of 

pale brown textura angularis. Conidiophores hyaline, smooth, 

cylindrical, septate, branched, 10–35 × 1.5 µm. Conidiogenous 

cells terminal and lateral, cylindrical, hyaline, smooth, proliferating 

sympodially, 10–15 × 1.5 µm. Conidia solitary, hyaline, smooth, 

granular, irregularly curved, subcylindrical, apex subobtuse, base 

truncate, (0–)1–3(–4)-septate, (15–)25–35(–55) × 1.5(–2) µm. 

Culture characteristics: Colonies flat, spreading, with sparse aerial 

mycelium and smooth, even margins, reaching 40 mm diam after 

2 wk. On OA surface dirty pink; on PDA surface and reverse dirty 

white. On MEA surface folded, dirty white, reverse cinnamon. 

Specimen examined: Brazil, Minas Gerais, Viçosa, on leaves of Tabebuia serratifolia 

(Bignoniaceae), 1999, A.C. Alfenas (holotype CBS H-21299, culture ex-type CBS 

112650). 

Notes: Inácio & Dianese (1998) described Septoria tabebuiaeimpetiginosae 

on T. impetiginosa (conidia 25–67 × 2–4 µm, 

2–6-septate), and also compared this species to S. tabebuiae 

(18–40 × 1.7–2.5 µm, aseptate conidia) on T. berteroi, and S. 

cucutana (34–40 × 0.8–1 µm) on T. pentaphylla and T. spectabilis. 

Furthermore, they also referred to an undescribed species Ferreira 

(1989) mentioned on T. serratifolia in Viçosa, Minas Gerais, 

which is named as S. tabebuiae-serratifoliae in the present study. 

Polyphialoseptoria tabebuiae-serratifoliae is distinct from species 

of Septoria known from Tabebuia based on its conidial morphology. 

Polyphialoseptoria terminaliae Quaedvlieg, R.W. Barreto, 

Verkley & Crous, sp. nov. MycoBank MB804426. Fig. 48. 


Terminalia. 

Leaf spots irregular to subcircular, amphigenous, mostly aggregated 

along leaf veins, pale brown, 3–8 mm diam, surrounded by a 

prominent, wide, red-purple border. On sterile Carex leaves on 

WA. Conidiomata brown, erumpent, pycnidial (acervular in culture), 

up to 600 µm diam, globose, brown, exuding a crystalline cirrhus 

of conidia; wall of 3–6 layers of pale brown textura angularis. 


cells hyaline, smooth, subcylindrical to ampulliform, 5–10 × 3–4 

µm; proliferating sympodially at apex, forming polyphialides 

with minute periclinal thickening, or as solitary loci on superficial 

mycelium in culture. Conidia hyaline, smooth, granular to guttulate, 

scolecosporous, irregularly curved, apex subobtuse, base long 

obconically truncate (1–1.5 µm diam), multiseptate (–16), in 

older cultures disarticulating at septa; microcyclic conidiation also 

common in older cultures, (40–)75–120(–140) × 2–3(–3.5) µm. 

Culture characteristics: Colonies on PDA erumpent with feathery 

margin, lacking aerial mycelium, surface fuscous-black, reverse 

olivaceous-black to buff in the younger tissue, after 14 d, 1 cm 

diam; on MEA surface and reverse isabelline to greyish-sepia; on 

OA surface pale-vinaceous, reverse rosy-buff to buff. 

Specimen examined: Brazil, Minas Gerais, Viçosa, on leaves of Terminalia catappa 

(Combretaceae), 18 May 2010, R.W. Barreto (holotype CBS H-21298, culture extype 

CBS 135106 = CPC 19611); ibed., (CBS 135475 = CPC 19487) 

Notes: As far as we could establish there are presently no species 

of Septoria described from Terminalia, and as this taxon is distinct 

from all taxa in GenBank, we herewith describe it as a novel species. 

A Septoria sp. has been reported on leaves of Terminalia sp. in 

Florida and Venezuela (Farr & Rossman 2013). Polyphialoseptoria 

is distinct from Septoria based on the presence of polyphialides. 

Neoseptoria also has phialides as observed in Polyphialoseptoria, 

but these tend to chiefly be monophialides. 

Clade 20: Ruptoseptoria 

Fig. 46. Conidia and conidiogenous loci on hypha of Polyphialoseptoria tabebuiaeserratifoliae 


Ruptoseptoria Quaedvlieg, Verkley & Crous, gen. nov. 


Fig. 47. Polyphialoseptoria tabebuiae-serratifoliae (CBS 112650). A. Conidiomata forming in culture. B. Conidiogenous cells. C. Conidia. Scale bars = 10 µm. 

356


Fig. 48. Polyphialoseptoria terminaliae (CBS 135106). A. Leaves with leaf spots. B, C. Conidiomata sporulating in culture. D–F. Conidiogenous cells and loci. G. Conidia. Scale 


Etymology: Rupto = irregular rupture of conidiomata; Septoria = 

septoria-like. 

Foliicolous, plant pathogenic. Conidiomata black, appressed, 

elongated, pycnidial, but opening via irregular rupture, convulated; 

exuding a creamy white conidial mass; outer wall dark brown, 

crusty, consisting of 6–8 layers of dark brown textura angularis; 

giving rise to 2–3 inner layers of pale brown to hyaline textura 

angularis. Conidiophores lining the inner cavity, hyaline, smooth 

or pale brown, verruculose at base, branched below, septate, 

subcylindrical. Conidiogenous cells integrated, terminal, 

subcylindrical, smooth; proliferating sympodially at apex, or apex 

phialidic with minute periclinal thickening. Conidia solitary, hyaline, 

smooth, guttulate, subcylindrical to narrowly obclavate, gently 

to irregularly curved, apex subobtuse, base truncate to narrowly 

obovoid, transversely septate. 

Type species: Ruptoseptoria unedonis (Roberge ex Desm.) 

Quaedvlieg, Verkley & Crous. 

Ruptoseptoria unedonis (Roberge ex Desm.) Quaedvlieg, 

Verkley & Crous, comb. nov. MycoBank MB804429. Figs 49, 

50. 

Basionym: Septoria unedonis Roberge ex Desm., Ann. Sci. Nat., 

Bot., Sér. 3(8): 20. 1847. 

= Sphaerella arbuticola Peck, Bull. Torrey Bot. Club 10(7): 75. 1883. 

≡ Mycosphaerella arbuticola (Peck) Jaap, Ann. Mycol. 14(1/2): 13. 1916. 

≡ Mycosphaerella arbuticola (Peck) House, Contr. Univ. Mich. Herb. 9(8): 

587. 1972. 

Leaf spots numerous, small, amphigenous, irregular to subcircular, 

whitish in the middle, with very broad, purple borders. Conidiomata 

black, appressed, elongated, pycnidial, but opening via irregular 

rupture, convulated, up to 450 µm diam, exuding a creamy white 

conidial mass; outer wall dark brown, crusty, consisting of 6–8 

layers of dark brown textura angularis; giving rise to 2–3 inner 

Fig. 49. Conidia and conidiogenous cells of Ruptoseptoria unedonis (CBS 355.86). 


layers of pale brown to hyaline textura angularis. Conidiophores 

lining the inner cavity, hyaline, smooth or pale brown, verruculose 

at base, branched below, 1–2-septate, subcylindrical, 10–15 × 

2–4 µm. Conidiogenous cells integrated, terminal, subcylindrical, 

smooth, 6–12 × 2.5–3.5 µm; proliferating sympodially at apex, or 

apex phialidic with minute periclinal thickening. Conidia solitary, 

hyaline, smooth, guttulate, subcylindrical to narrowly obclavate, 

gently to irregularly curved, apex subobtuse, base truncate to 

narrowly obovoid, 1–3(–6)-septate, (25–)30–47(–56) × 2(–3) um. 


357


Fig. 50. Ruptoseptoria unedonis (CBS 355.86). A, C. Conidiomata forming in culture. B, D. Conidiogenous cells. E. Conidia. Scale bars: A = 450 µm, C = 110 µm, all others = 

10 µm. 

Culture characteristics: Colonies on OA spreading with moderate 

aerial mycelium and smooth, even margins; surface olivaceousgrey 

in outer region, centre dirty white to pale pink, reverse iron 

grey; on MEA surface dark-mouse-grey to mouse-grey, reverse 

greenish-black; on PDA surface mouse-grey to dark-mouse-grey, 

reverse greenish-black. 

Specimen examined: France, Seignosse le Penon, Lamdes, Forest communale de 

Seignosse, on leaves of Arbutus unedo (Ericaceae), Aug. 1986, H.A. van der Aa 

(CBS H-14645, culture CBS 355.86). 

Notes: Mycosphaerella arbuticola (CBS 355.86) is a species 

pathogenic to Arbutus menziesii in California (Aptroot 2006), 

clusters with “Septoria” unedonis (CBS 755.70, CBS H-18192), 

which is associated with leaf spots on Arbutus unedo in Croatia, and 

elsewhere in Europe. Based on these results, the sexual-asexual link 

between these two names is confirmed. Morphologically, however, 

Ruptoseptoria is similar to Septoria, and can only be distinguished 

based on its conidiomata that are convulated, opening by irregular 

rupture, and conidiogenous cells that are frequently phialidic. 

Clade 21: Dissoconium (Dissoconiaceae) 

Note: See Li et al. (2012). 

Clade 22: Readeriella (Teratosphaeriaceae) 

Note: See Crous et al. (2007a, 2009a–c). 

Clade 23: Teratosphaeria 

Note: See Crous et al. (2007, 2009c). 

Clade 24: septoria-like 

Specimen examined: Brazil, Nova Friburgo, on leaves of Tibouchina herbacea 

(Melastomataceae), 15 Dec. 2007, D.F. Parreira (CBS 134910 = CPC 19500). 

Note: The taxonomy of this species could not be resolved, as 

isolate CPC 19500 proved to be sterile. 

Clade 25: Cylindroseptoria 

Cylindroseptoria Quaedvlieg, Verkley & Crous, gen. nov. 


Etymology: Cylindro = cylindrical conidia; Septoria = septoria-like. 

Conidiomata pycnidial with central ostiole, or cupulate, separate, 

brown, short-stipitate, tapering towards base; rim with elongated 

brown, thick-walled cells with obtuse ends; rim covered with mucoid 

layer that flows over from conidiomatal cavity, filled with conidial 

mass; wall of 3–4 layers of medium brown textura angularis, 

becoming hyaline towards inner region. Conidiogenous cells 

hyaline, smooth, ampulliform, lining inner cavity, with prominent 

periclinal thickening at apex. Conidia solitary, hyaline, smooth, 

granular or not, cylindrical with obtuse apex, tapering at base to 

truncate scar, aseptate. 

Type species: Cylindroseptoria ceratoniae Quaedvlieg, Verkley & 

Crous. 

Cylindroseptoria ceratoniae Quaedvlieg, Verkley & Crous, 


Etymology: Named after the host genus on which it occurs, 

Ceratonia. 

Conidiomata separate, brown, cupulate, short-stipitate, rim up to 

300 µm diam, 100–180 µm tall, tapering towards base, 20–50 µm 

diam (on Anthriscus sylvestris stems, not on OA or PDA, where 

they appear more flattened with agar surface); rim with elongated 

brown, thick-walled cells with obtuse ends, 5–12 × 4–5 µm; rim 

covered with mucoid layer that flows over from conidiomatal cavity, 

filled with conidial mass; wall of 3–4 layers of medium brown textura 

angularis, becoming hyaline towards inner region. Conidiogenous 

cells hyaline, smooth, ampulliform, lining inner cavity, 7–12 × 4–6 

µm; apex 2 µm diam, with prominent periclinal thickening. Conidia 

solitary, hyaline, smooth, granular or not, cylindrical with obtuse 

358


apex, tapering at base to truncate scar 1 µm diam, aseptate, (10–) 

12–14(–16) × 3(–3.5) µm. 

Culture characteristics: Colonies spreading, reaching 28 mm diam 

after 2 wk, with sparse aerial mycelium and even, lobate margins. 

On MEA surface iron-grey, reverse olivaceous-grey. On OA surface 

olivaceous-grey. On PDA surface and reverse iron-grey. 

Specimen examined: Spain, Mallorca, Can Pastilla, on leaves of Ceratonia siliqua 

(Caesalpinaceae), 24 May 1969, H.A. van der Aa (holotype CBS H-21300, culture 

ex-type CBS 477.69). 

Notes: Cylindroseptoria ceratoniae is quite distinct in that it 

has cup-shaped acervuli, ampilliform conidiogenous cells with 

periclinal thickening, and hyaline, aseptate, cylindrical conidia. 

Cylindroseptoria needs to be compared with Satchmopsis 

(infundibular conidiomata), Cornucopiella (tubular conidiomata) and 

Thaptospora (cylindrical / lageniform / campanulate conidiomata), 

but the combination of cupulate conidiomata and cylindrical, and 

aseptate conidia is distinct. 

Cylindroseptoria pistaciae Quaedvlieg, Verkley & Crous, 


Etymology: Named after the host genus on which it occurs, Pistacia. 

Conidiomata pycnidial, erumpent, globose, black, separate, 

with black crusty outer layer of cells, up to 200 µm diam, with 

central ostiole; wall of 3–6 layers of brown textura angularis. 


cells phialidic (mostly monophialidic, but a few observed to also be 

polyphialidic), lining the inner cavity, hyaline, smooth, ampulliform, 

5–8 × 3–4 µm, proliferating percurrently (inconspicuous) or with 

periclinal thickening at apex (also occurring as solitary loci on 

superficial hyphae surrounding pycnidia). Conidia hyaline, smooth, 

cylindrical, mostly straight, rarely slightly curved, apex subobtuse, 

base truncate, guttulate, aseptate, (9–)11–13(–18) × 2.5–3(–3.5) 

µm. 

Culture characteristics: Colonies on PDA flat, circular, lacking 

aerial mycelium, surface fuscous-black, reverse olivaceous-black, 

after 14 d, 3.5 cm diam; on MEA surface fuscous-black, reverse 

olivaceous-black, after 14 d, 4.5 cm diam; on OA similar to PDA. 

Specimen examined: Spain, Mallorca, El Arenal, on leaves of Pistacia lentiscus 

(Anacardiaceae), 25 May 1969, H.A. van der Aa (holotype CBS H-21301, culture 

CBS 471.69). 

Notes: Cylindroseptoria pistaciae is tentatively placed in 

Cylindroseptoria, as it has pycnidial rather than cupulate 

conidiomata. However, synapomorphies with Cylindroseptoria 

include phialides with periclinal thickening, and cylindrical, aseptate 

conidia. Further collections are required to determine if conidiomatal 

anatomy is more important than conidiogenesis and conidial 

morphology. For the present, however, the generic circumscription 

Fig. 51. Conidia and conidiogenous cells of Cylindroseptoria ceratoniae (CBS 

477.69). Scale bar = 10 µm. 

Fig. 53. Conidia and conidiogenous cells of Cylindroseptoria pistaciae (CBS 

471.69). Scale bars = 10 µm. 

Fig. 52. Cylindroseptoria ceratoniae (CBS 477.69). A, B. Conidiomata forming in culture. C, D. Conidiogenous cells giving rise to conidia. E. Conidia. Scale bars: B = 45 µm, 



359


Fig. 54. Cylindroseptoria pistaciae (CBS 471.69). A, B. Conidiomata sporulating in culture. C, D. Intercalary chains of chlamydospore-like cells. E, F. Conidiogenous cells. G, 

H. Conidia. Scale bars = 10 µm. 

of Cylindroseptoria has been widened to include taxa with pycnidial 

conidiomata. Cylindroseptoria pistaciae could be confused with 

Septoria pistaciae, though conidia of the latter are 20–30 × 1.6 µm, 

and are 1(–3)-septate (Chitzanidis & Michaelides 2002). 

Clade 26: Pseudoseptoria 

Pseudoseptoria Speg., Ann. Mus. Nac. B. Aires, Ser. 3 13: 

388. 1910. 

= Aphanofalx B. Sutton, Trans. Brit. Mycol. Soc. 86: 21. 1986. 

Caulicolous and foliicolous, plant pathogenic or saprobic. 

Conidiomata stromatic, pycnidioid, unilocular, glabrous, black, 

ostiolate; wall of textura angularis, in some cases cells in the upper 

wall larger and darker than cells in the lower wall. Conidiophores 

reduced to conidiogenous cells lining the cavity of the conidioma. 

Conidiogenous cells discrete or integrated, cylindrical or lageniform, 

colourless, smooth-walled, invested in mucus, with a prominent 

cylindrical papilla with several percurrent proliferations at the 

apex; collarette prominent and extanding past conidia, or reduced 

and inconspicuous. Conidia fusiform, lunate or irregular, curved, 

unicellular, colourless, smooth-walled with or without an excentric 

basal appendage, continuous with conidium body, plectronoid to 

podiform, or with a blunt or spathulate distal end. 

Type species: P. donacicola Speg., Ann. Mus. Nac. B. Aires, Ser. 3 

13: 388. 1910. [= P. donacis (Pass.) B. Sutton]. 

Pseudoseptoria collariana Quaedvlieg, Verkley & Crous, 

sp. nov. MycoBank MB804433. Fig. 55. 

Etymology: Named after its prominently flared collarettes, forming 

a sleeve. 

On sterile Carex leaves on WA. Conidiomata immersed to erumpent, 

globose, dark brown, up to 400 µm diam, unilocular, opening via 


Conidiophores reduced to conidiogenous cells, or branched at 

the base with one supporting cell that is dark brown, encased 

Fig. 55. Pseudoseptoria collariana (CBS 135104). A, B. Colonies sporulating in culture. C–F. Conidiogenous cells with prominent collarettes. G, H. Conidia. Scale bars: A = 400 

µm, all others = 10 µm. 

360


Fig. 56. Pseudoseptoria obscura (CBS 135103). A, B. Colony sporulating in culture. C. Chlamydospore-like cells developing. D, E. Conidiogenous cells. F–H. Conidia. Scale 

bars: B = 250 µm, all others = 10 µm. 

in a mucilaginous matrix. Conidiogenous cells subcylindrical to 

ampulliform, hyaline, smooth to pale brown, finely verruculose, 

18–35 × 3.5–8 µm; apical region with numerous conspicuous 

percurrent proliferations, with long, prominent collarettes that 

completely enclose and extend above young, developing conidia, 

but disintegrating into a mucoid mass with age. Conidia fusiform, 

lunate, curved, aseptate, hyaline, smooth, tapering to an subobtuse 

to spathulate apex, base truncate (1 µm diam), with a single, 

unbranched, eccentric basal appendage, 2–4 µm long; conidia 

(from apex to hilum) (24–)26–28(–30) × (2.5–)3 µm. 

Culture characteristics: Colonies on PDA flat, round with feathery 

margins, lacking aerial mycelium, surface olivaceous-black to rosybuff 

for younger tissue, reverse olivaceous-black, to rosy-buff for 

younger tissue, after 14 d 1.5 cm diam; on MEA surface olivaceousblack 

to buff for younger tissue, reverse olivaceous-black to brick 

for younger tissue, after 14 d, 2 cm diam; on OA similar to MEA. 

Specimen examined: Iran, Golestan Province, on leaves of Bamboo (Poaceae), 12 

May 2009, A. Mirzadi Gohari (holotype CBS H-21302, culture ex-type CBS 135104 

= CPC 18119). 

Pseudoseptoria obscura Quaedvlieg, Verkley & Crous, sp. 


Etymology: Named after the obscure basal appendage that occurs 

on some conidia. 

On sterile Carex leaves on WA. Conidiomata immersed to 

erumpent, globose, dark brown, up to 250 µm diam (smaller than in 

18119), unilocular, opening via central ostiole; wall of 3–6 layers of 

brown textura angularis. Conidiophores reduced to conidiogenous 

cells. Conidiogenous cells subcylindrical to doliiform, hyaline, 

smooth to pale brown, finely verruculose, 6–12 × 2–5 µm; apical 

region with numerous inconspicuous to conspicuous percurrent 

proliferations; collarettes absent to prominent. Conidia fusiform, 

lunate, curved, aseptate, hyaline, smooth, tapering to an subobtuse 

apex; base truncate, rarely with a single, unbranched, eccentric 

basal appendage, 1–2 µm long; conidia (from apex to hilum) (8–) 

12–14(–15) × (2–)2.5(–3) µm. 

Culture characteristics: Colonies on PDA flat, undulate with 

feathery margins, lacking aerial mycelium, surface concentric rings 

of fuscous-black to pale purplish grey to fuscous-black, reverse 

concentric rings of greyish-sepia to fawn to fuscous-black, after 14 

d, 2 cm diam; on MEA similar to PDA; OA flat, undulate, lacking 

aerial mycelium, surface fuscous-black to purplish grey for the 

younger tissue, reverse greyish-sepia to vinaceous-buff for the 

younger tissue. 

Specimen examined: Iran, Golestan Province, on leaves of Bamboo (Poaceae), 12 

May 2009, A. Mirzadi Gohari (holotype CBS H-21303, culture ex-type CBS 135103 

= CPC 18118). 

Notes: Species of the genus Aphanofalx occur on members of 

Poaceae, presumably as saprobes. The genus is characterised 

by having taxa with pycnidial conidiomata, and percurrently 

proliferating conidiogenous cells, and hyaline, aseptate conidia 

with a basal, excentric appendage. In contrast, species of 

Pseudoseptoria are known to occur on members of Poaceae 

as plant pathogens. The genus is also characterised by having 

taxa with pycnidial conidiomata, and percurrently proliferating 

conidiogenous cells, and hyaline, aseptate conidia that lack basal 

appendages. During this study we also investigated three strains 

identified as P. donasis (CBS 291.69, 313.68 and 417.51), the 

type species of Pseudoseptoria. Much to our surprise they formed 

a monophyletic lineage (results not shown) with the two strains 

described here (which have basal appendages), suggesting that 

Pseudoseptoria represents an older name for Aphanofalx, and that 

the basal appendage is a species-specific character, as also found 

in other groups of coelomycetes (Crous et al. 2012b). 

Aphanofalx is presently known from two species, A. mali (conidia 

26–33 × 2–2.5 µm), and A. irregularis (conidia 12–28(–31) × (2–)2.5– 


361


3(–3.5) µm (Nag Raj 1993). Pseudoseptoria collariana [conidia (24–) 

26–28(–30) × (2.5–)3 µm] and P. obscura [conidia (8–)12–14(–15) × 

(2–)2.5(–3) µm] are easily distinguished from these taxa based on 

their conidial dimensions. The three species of Pseudoseptoria treated 

by Sutton (1980), namely P. donacis (conidia 20–23 × 2–2.5 µm), P. 

stromaticola (conidia 16–18.5 × 2 µm) and P. bromigena (conidia 20– 

23 × 2–2.5 µm) can be distinguished from P. collorata and P. obscura 

by conidial dimensions, and lacking basal conidial appendages. 

Clade 27: Parastagonospora 

Parastagonospora Quaedvlieg, Verkley & Crous, gen. nov. 


Etymology: Resembling the genus Stagonospora. 

Foliicolous, plant pathogenic. Ascocarps immersed, globose, 

becoming depressed, medium brown to black; wall of 3–6 layers 

of thick-walled, brown textura angularis; ostiole slightly papillate. 

Asci clavate, cylindrical or curved, shortly stipitate, 8-spored; 

ascus wall thick, bitunicate. Ascospores fusoid, subhyaline to 

pale brown, transversely euseptate (–3), constricted at the septa, 

penultimate cell swollen. Pseudoparaphyses filiform, hyaline, 

septate. Conidiomata black, immersed, subepidermal, pycnidial, 

subglobose with central ostiole, exuding creamy conidial mass; 

wall of 2–3 layers of brown textura angularis. Conidiophores 

reduced to conidiogenous cells. Conidiogenous cells phialidic, 

hyaline, smooth, aggregated, lining the inner cavity, ampulliform 

to subcylindrical, with percurrent proliferation near apex. Conidia 

hyaline, smooth, thin-walled, cylindrical, granular to multi-guttulate, 

with obtuse apex and truncate base, transversely euseptate. 

Type species: Parastagonospora nodorum (Berk.) Quaedvlieg, 


Notes: The genus Parastagonospora is introduced to accommodate 

several serious cereal pathogens that were formerly accommodated 

in either Septoria/Stagonospora, or Leptosphaeria/Phaeosphaeria. 

As shown previously, Septoria is not available for these fungi 

(Quaedvlieg et al. 2011), and neither is Leptosphaeria (de Gruyter 

et al. 2013). Furthermore, in the present study we also clarify the 

phylogenetic positions of Stagonospora and Phaeosphaeria, which 

cluster apart from this group of cereal pathogens, which are best 

accommodated in their own genus, Parastagonospora. 

Parastagonospora is distinguished from Stagonospora in that 

Stagonospora has conidiogenous cells that proliferate percurrently, 

or via phialides with periclinal thickening, and conidia that are 

subcylindrical to fusoid-ellipsoidal. Sexual morphs known for 

species of Parastagonospora are phaeosphaeria-like, whereas 

those observed for Stagonospora s. str. are didymella-like. 

Specimens examined: Germany, Kiel-Kitzeberg, on Lolium multiflorum, 1968, U.G. 

Schlösser, CBS 290.69, CBS 289.69. 

Notes: Although the oldest epithet for this taxon is Pleospora 

tritici (1874), “avenae” has been well established in literature, and 

accepted by the community. We thus recommend that this epithet 

be retained for this pathogen. Parastagonospora avenae leaf blotch 

of barley and rye (f.sp. tritici), appears distinct from the pathogen on 

oats (f.sp. avenaria) (Cunfer 2000), and further research is required 

to resolve this issue. 

Parastagonospora caricis Quaedvlieg, Verkley & Crous, 



Carex. 



ostiole, exuding pale pink conidial cirrhus; wall of 2–3 layers of 


cells. Conidiogenous cells phialidic, hyaline, smooth, aggregated, 

lining the inner cavity, ampulliform, 8–15 × 4–6 µm, with percurrent 

proliferation at apex. Conidia hyaline, smooth, thin-walled, 

scolecosporous, subcylindrical, with subobtuse apex and truncate 

base, 7–15-septate, (50–)60–70(–75) × (5–)6 µm. 

Culture characteristics: Colonies on PDA flat, undulate, with short, 

white aerial mycelium, surface olivaceous-black in the older parts, 

vinaceous-buff in the younger mycelium, reverse olivaceous-black in 

the older parts, brick in the younger mycelium, after 14 d, 4 cm diam; 

on MEA convex, fimbriate, surface fawn to hazel, reverse fusceousblack 

to cinnamon, after 14 d, 3 cm diam; on OA similar to MEA. 

Specimen examined: Netherlands, Veenendaal, de Blauwe Hel, on leaves of Carex 

acutiformis (Cyperaceae), 25 Jul. 2012, W. Quaedvlieg (holotype CBS H-21304, 

culture ex-type CBS 135671 = S615). 

Note: Conidia of P. caricis are larger than those of P. avenae, which 

are (1–)3(–7)-septate, 17–46 × 2.5–4.5 µm (Bissett 1982), and 

narrower than those of Stagonospora gigaspora, which are 58–84 

× 10–14 µm (Ellis & Ellis 1997). 

Parastagonospora avenae (A.B. Frank) Quaedvlieg, 

Verkley & Crous, comb. nov. MycoBank MB804436. 

Basionym: Septoria avenae A.B. Frank, Ber. Dt. Bot. Ges. 13: 64. 

1895. 

≡ Stagonospora avenae (A.B. Frank) Bissett [as ‘avena’], Fungi 

Canadenses, Ottawa 239: 1. 1982 

= Leptosphaeria avenaria G.F. Weber, Phytopath. 12: 449. 1922. 

≡ Phaeosphaeria avenaria (G.F. Weber) O.E. Erikss., Ark. Bot., Ser. 2 

6: 408. 1967. 

= Pleospora tritici Garov., Arch. Triennale Lab. Bot. Crittog. 1: 123. 1874. 

Fig. 57. Conidia and conidiogenous cells of Parastagonospora caricis (CBS 

H-21304). Scale bars = 10 µm. 

362


Fig. 58. Parastagonospora caricis (CBS H-21304). A. Colony sporulating in culture. B, C. Conidiogenous cells. D. Conidia. Scale bars = 10 µm. 

Fig. 59. Parastagonospora nodorum (CBS H-13909). A, C. Ascomata and conidiomata forming in culture. B, D, F. Asci with ascospores. E, G. Conidia. Scale bars = 10 µm. 

Parastagonospora nodorum (Berk.) Quaedvlieg, Verkley & 


Basionym: Depazea nodorum Berk., Gard. Chron., London: 601. 

1845. 

≡ Septoria nodorum (Berk.) Berk., Gard. Chron., London: 601. 1845. 

≡ Stagonospora nodorum (Berk.) E. Castell. & Germano, Annali Fac. Sci. 

Agr. Univ. Torino 10: 71. 1977. [1975–76] 

= Leptosphaeria nodorum E. Müll., Phytopath. J. 19: 409. 1952. 

≡ Phaeosphaeria nodorum (E. Müll.) Hedjar., Sydowia 22: 79. 1969. 

[1968] 

Specimen examined: Denmark, on Lolium perenne, Feb. 2002, M.P.S. Câmara, 


Notes: Parastagonospora nodorum blotch is an important disease 

of cereals, having been reported from barley and wheat in most 

countries where these crops are cultivated (Cunfer 2000). Recent 

studies have also indicated that P. nodorum probably resembles a 

species complex, awaiting further morphological characterisation 

(McDonald et al. 2013). 

Parastagonospora poae Quaedvlieg, Verkley & Crous, sp. 



Poa. 






the inner cavity, ampulliform to subcylindrical, with percurrent 

proliferation near apex, 6–10 × 3–4(–5) µm. Conidia hyaline, 

smooth, thin-walled, cylindrical, granular, with obtuse apex and 

truncate base, medianly 1-septate, (20–)25–27(–32) × (2–)2.5(– 

2.5) µm; ends becoming swollen and guttulate with age. 

Culture characteristics: Colonies on PDA flat, circular, with sparse, 

white aerial mycelium, surface dark-mouse-grey, reverse black, 


363


after 14 d, 8.5 cm diam; on MEA surface hazel, reverse dark-brick 

to sepia; OA similar to MEA. 

Specimens examined: Netherlands, Wageningen, on leaves of Poa sp. (Poaceae), 

2 Aug. 2012, S. Videira J (holotype CBS H-21305, culture ex-type CBS 135089 = 

S606); Wageningen, on leaves of Poa sp., 2 Aug. 2012, S. Videira CBS 135091 = 

S613). 

Note: Conidia of P. poae are narrower than those of P. nodorum, 

which are (0–)1–3-septate, 13–28 × 2.8–4.6 µm (Bissett 1982). 

Clade 28: Neostagonospora 

Neostagonospora Quaedvlieg, Verkley & Crous, gen. nov. 


Etymology: Resembling the genus Stagonospora. 

Foliicolous. Conidiomata immersed, pycnidial, globose, exuding a 

pale luteous to creamy conidial mass; wall of 2–3 layers of pale 



lining the inner cavity, ampulliform to doliiform, tapering at apex with 

prominent periclinal thickening. Conidia hyaline, smooth, granular, 

thin-walled, narrowly fusoid-ellipsoidal to subcylindrical, apex 

subobtusely rounded, base truncate, widest in middle, transversely 

euseptate, becoming constricted with age. 

Type species: Neostagonospora caricis Quaedvlieg, Verkley & 

Crous. 

Note: Neostagonospora is similar to Stagonospora by having 

pycnidial conidiomata with euseptate, hyaline, fusoid-ellipsoidal 

to subcylindrical conidia, but distinct in having conidiogenous cells 

that are phialidic, with prominent periclinal thickening. 

Neostagonospora caricis Quaedvlieg, Verkley & Crous, sp. 


Etymology: Named after the host genus on which it occurs, Carex. 

On sterile Carex leaves on WA. Conidiomata immersed, 

pycnidial, globose, up to 200 µm diam, exuding a pale luteous 

to creamy conidial mass; wall of 2–3 layers of pale brown textura 

angularis. Conidiophores reduced to conidiogenous cells. 


the inner cavity, ampulliform to doliiform, 5–7 × 5–7 µm; tapering 

at apex with prominent periclinal thickening. Conidia hyaline, 

smooth, granular, thin-walled, narrowly fusoid-ellipsoidal, apex 

subobtusely rounded, base truncate, widest in middle, 1-septate, 

becoming constricted with age, (10–)13–16(–19) × (3–)3.5(–4) 

µm. 

Fig. 60. Conidia and conidiogenous cells of Parastagonospora poae (CBS 135091). 


Fig. 62. Conidia and conidiogenous cells of Neostagonospora caricis (CBS 135092). 


Fig. 61. Parastagonospora poae (CBS 135091). A, B. Conidiomata forming in culture. C–E. Conidiogenous cells. F, G. Conidia. Scale bars = 10 µm. 

364


Fig. 63. Neostagonospora caricis (CBS 135092). A. Conidioma forming in culture. B, C. Conidiogenous cells. D. Conidia. Scale bars = 10 µm. 

Culture characteristics: Colonies on PDA flat, undulate, with 

sparse, powdery white aerial mycelium, surface greyish-sepia to 

isabelline, reverse olivaceous-grey to pale olivaceous-grey, after 

14 d, 8.5 cm diam; on MEA erumpent, circular, with fine white 

aerial mycelium, surface honey, reverse cinnamon, after 14 d, 

6 cm diam; on OA similar to PDA but surface honey, reverse 

cinnamon. 

Specimen examined: Netherlands, Veenendaal, de Blauwe Hel, on leaves of Carex 

acutiformis (Cyperaceae), Aug. 2012, W. Quaedvlieg (holotype CBS H-21306, 


Note: Neostagonospora caricis is similar to Septoria caricis 

(conidia 1-septate, 20–35 × 2.5–3 µm; Ellis & Ellis 1997), although 

its conidia are shorter. 

Neostagonospora elegiae Quaedvlieg, Verkley & Crous, 



Elegia. 

On Anthriscus stem. Conidiomata pycnidial, up to 150 µm diam, 

erumpent, globose, brown, opening by a central ostiole, exuding 

a crystalline conidial mass; wall consisting of 3–6 layers of pale 


cells. Conidiogenous cells phialidic, lining the inner cavity, 

hyaline, smooth, ampulliform, 4–7 × 4–6 µm; apex with prominent 

periclinal thickening. Conidia hyaline, smooth, guttulate to granular, 

scolecosporous, irregularly curved, subcylindrical, apex subobtuse, 

base truncate (slight taper from apical septum to apex and basal 

septum to hilum visible in some conidia), (0–)3-septate, (20–)50– 

65(–70) × (2.5–)3 µm. 

Culture characteristics: Colonies spreading, erumpent with 

moderate aerial mycelium and smooth, even margins; reaching 35 

mm diam after 2 wk. On OA pale luteous. On MEA dirty white on 

surface, luteous in reverse. On PDA dirty white on surface, pale 

luteous in reverse. 

Specimen examined: South Africa, Western Cape Province, Harold Porter 

Botanical Garden, on leaves of Elegia cuspidata (Restionaceae), 30 Nov. 2001, S. 

Lee (holotype CBS H-21307, culture ex-type CBS 135101 = CPC 16977). 

Fig. 64. Conidia and conidiogenous cells of Neostagonospora elegiae (CBS 

135101). Scale bars = 10 µm. 

Notes: No septoria-like fungi are presently known from Elegia (Lee 

et al. 2004). Neostagonospora elegiae is distinguished from N. 

caricis based on its conidial morphology. 

Clade 29: Phaeosphaeriopsis 

Phaeosphaeriopsis M.P.S. Câmara, M.E. Palm & A.W. 

Ramaley, Mycol. Res. 107: 519. 2003. 

Saprobic or plant pathogenic. Ascomata solitary or aggregated, 

immersed, subepidermal to erumpent, pushing up flaps of the 

epidermis, globose to pyriform, often papillate, solitary or gregarious 

in a stroma of scleroplectenchyma or dark brown textura angularis, 

often surrounded by septate, brown hyphae extending into the host 

tissues. Asci 8-spored, bitunicate, cylindrical to broadly fusoid, short 

stipitate, with visible apical chamber. Ascospores uni- to triseriate, 

cylindrical, broadly rounded at apex, tapering to narrowly rounded 

base, 4–5-septate, first septum submedian, often constricted, 

medium brown, echinulate, punctate or verrucose. Asexual 

morph coniothyrium-like or phaeostagonospora-like. Conidiomata 

pseudoparenchymatous, sometimes of scleroplectenchyma. 

Conidiogenous cells lining locule, ampulliform, hyaline, proliferating 

percurrently, resulting in inconspicuous annellations. Conidia 

cylindrical, with bluntly rounded ends, 0–3-septate, yellowish 

brown, punctate (Câmara et al. 2003, Zhang et al. 2012). 


365


Fig. 65. Neostagonospora elegiae (CBS 135101). A. Conidioma forming in culture. B–D. Conidiogenous cells. E. Conidia. Scale bars: A = 150 µm, all others = 10 µm. 

Type species: Phaeosphaeriopsis glaucopunctata (Grev.) M.P.S. 

Câmara, M.E. Palm & A.W. Ramaley, Mycol. Res., 107: 519. 2003. 

Phaeosphaeriopsis glaucopunctata (Grev.) M.P.S. 

Câmara, M.E. Palm & A.W. Ramaley, Mycol. Res. 107: 519. 

2003. Figs 66, 67. 

Basionym: Cryptosphaeria glaucopunctata Grev., Fl. Edin.: 362. 

1824. 

≡ Paraphaeosphaeria glaucopunctata (Grev.) Shoemaker & C. E. Babc., 

Can. J. Bot. 63: 1286. 1985. 

= Sphaeria rusci Wallr., Fl. Crypt. Germ. 2: 776. 1833. 

≡ Leptosphaeria rusci (Wallr.) Sacc., Syll. Fung. 2: 74. 1883. 

≡ Paraphaeosphaeria rusci (Wallr.) O. E. Erikss., Ark. Bot., Ser. 2 6: 406. 

1967. 

Ascomata scattered or aggregated, immersed, globose to 

subglobose, up to 250 µm diam; peridium up to 25 µm wide, of 

thick-walled textura angularis; hamathecium of dense, wide, cellular 

pseudoparaphyses, 3–5 μm diam. Asci 8-spored, bitunicate, 

cylindrical to broadly fusoid, with a short pedicel and small apical 

chamber, 50–110 × 10–16 μm. Ascospores uni- to triseriate, 

cylindrical, medium brown, 4(−5)-septate, without constriction 

or slightly constricted at the basal septum, the forth cell from the 

apex usually slightly inflated, the basal cell often longer, 14–28 × 

(3.5–)5–7.5 μm. Conidiomata pycnidial, immersed, scattered or 

aggregated, dark brown, subglobose, ostiolate, up to 200 μm diam. 

Conidiophores reduced to conidiogenous cells. Conidiogenous cells 

lining the inner cavity, ampulliform, hyaline, smooth, 5–10 × 3–6 

µm; proliferating percurrently at apex. Conidia aseptate, smooth 

to finely verruculose, medium brown, subcylindrical, straight to 

reniform with obtuse ends, (5–)7–9(–10) × (2.5–)3(–5) μm. 

Culture characteristics: On PDA colonies flat, spreading, with 

sparse aerial mycelium and smooth, lobate, even margins, surface 

primrose, reverse olivaceous-buff, On OA buff with patches of 

isabelline due to sporulating conidiomata. On MEA dirty white on 

surface, isabelline in reverse (centre), cinnamon in outer region. 

Specimen examined: Switzerland, Kt. Basel-Stadt, Park Basel, on Ruscus aculeatus 

(Ruscaceae), 25 Sep. 1980, A. Leuchtmann (CBS H-21308, culture CBS 653.86). 

Fig. 66. Conidia and conidiogenous cells of Phaeosphaeriopsis glaucopunctata 

(CBS 653.86). Scale bar = 10 µm. 

Notes: The genus Phaeosphaeriopsis is characterised by having 

uni- or multiloculate stromata and 4–5-septate ascospores. 

It presently contains species with coniothyrium-like, and 

phaeostagonospora-like asexual morphs (e.g. P. musae; 

Arzanlou & Crous 2006). The type species, Phaeosphaeriopsis 

glaucopunctata, is associated with leaf spot and necrosis on Ruscus 

aculeatus (Câmara et al. 2003, Golzar & Wang 2012). The fact that 

an isolate identified as Chaetosphaeronema hispidulum (lectotype 

of Chaetosphaeronema) clusters in this clade is puzzling. The 

genus Chaetosphaeronema is characterised by setose, dark brown 

pycnidia with thick-walled outer cell layers, producing hyaline, 

1-septate conidia (Sutton 1980). Isolate CBS 216.75 proved to be 

sterile, however, so this matter could unfortunately not be resolved. 

Clade 30: Sclerostagonospora 


Type species: S. heraclei (Sacc.) Höhn., Hedwigia 59: 252. 1917. 

Sclerostagonospora phragmiticola Quaedvlieg, Verkley & 


366


Fig. 67. Phaeosphaeriopsis glaucopunctata (CBS 653.86). A. Colony on MEA. B. Colony on OA. C–F. Conidiogenous cells giving rise to conidia. G. Conidia. Scale bars = 10 µm 

Fig. 68. Sclerostagonospora phragmiticola (CBS 338.86). A. Colony sporulating in culture. B, C. Conidiogenous cells. D. Conidia. Scale bars = 10 µm. 


Phragmites. 


globose, immersed to erumpent, up to 400 µm diam with central 

ostiole; wall of 6–8 layers of brown textura angularis. Conidiophores 

reduced to conidiogenous cells. Conidiogenous cells lining the 

inner cavity of conidioma, hyaline to pale olivaceous, smooth, 

subcylindrical to doliiform, 6–15 × 3–4 µm, proliferating several 

times percurrently at apex. Conidia brown, smooth, subcylindrical, 

apex obtuse, base truncate, straight to gently curved, 

(1–)3(–5)-euseptate, older conidia swelling, becoming widest in 

second or third cell from base, (15–)20–25(–27) × (3–)3.5(–4) µm. 

Specimen examined: France, Landes, Seignosse, Étang d’Hardy, on leaves of 

Phragmites australis (Poaceae), 11 June 1986, H.A. van der Aa (holotype CBS 

H-21309, culture ex-type CBS 338.86). 

Notes: Sclerostagonospora caricicola fits the concept of 

Sclerostagonospora by having pycnidial conidiomata that give rise 

to hyaline conidiogenous cells that proliferate percurrently, and 

subcylindrical, pigmented conidia. Until fresh material of the type 

species, S. heraclei has been recollected and subjected to DNA 

analysis, the application of this generic name will remain tentative. 

Several other species cluster in this clade, suggesting that the 

sexual morph is phaeosphaeria-like. 

Clade 31: Phaeosphaeria 

Phaeosphaeria I. Miyake, Bot. Mag., Tokyo 23: 93. 1909. 

= Phaeoseptoria Speg., Revta Mus. La Plata 15: 39. 1908. 

Foliicolous. Ascomata immersed, subepidermal, ellipsoidal to 

globose, glabrous; ostiole central, devoid of periphyses; wall 

of 2–3 layers of brown textura angularis. Pseudoparaphyses 

transversely septate, guttulate, encased in mucous. Asci stipitate, 

clavate to cylindrical, stalked, biseriate. Ascospores brown, 

narrowly fusiform, straight or slightly curved, transversely septate, 

smooth to verruculose, enclosed in a mucoid sheath or not. 

Conidiomata pycnidial, immersed, becoming erumpent, brown, 

with central ostiole; wall of 2–3 layers of brown textura angularis. 


cells hyaline, ampulliform to subcylindrical or doliiform; proliferating 

inconspicuously percurrently near apex. Conidia solitary, pale 

brown, smooth, guttulate, subcylindrical to narrowly obclavate, 

apex obtuse, base truncate, straight to curved, transversely 

euseptate, at times slightly constricted at septa; hilum not darkened 

nor thickened. 

Type species: P. oryzae I. Miyake, Bot. Mag. Tokyo, 23(266): 93. 

1909. 

Notes: Phaeosphaeria (1909; based on P. oryzae) is congeneric 

with Phaeoseptoria (1908; based on P. papayae). We choose to 


367


use the sexual name Phaeosphaeria, as it is well established, and 

less confused than Phaeoseptoria, which has become a confused 

concept applied to numerous septoria-like taxa with pigmented 

conidia (see Walker et al. 1992). 

Phaeosphaeria oryzae I. Miyake, Bot. Mag. Tokyo, 23(266): 

93. 1909. Figs 69, 70. 

≡ Pleospora oryzae (I. Miyake) Hara, J. Agric. Soc. Japan 31(361): 17. 

1927. 

≡ Trematosphaerella oryzae (I. Miyake) Padwick, A manual of rice 

diseases: 153. 1950. 

≡ Leptosphaerella oryzae (I. Miyake) Hara, A monograph of rice diseases: 

53. 1959. 

≡ Leptosphaerulina oryzae (I. Miyake) Karan, Mycopath. Mycol. Appl. 24: 

88. 1964. 

= Phaeoseptoria oryzae I. Miyake, J. Coll. Agric. Imp. Univ. Tokyo 2(4): 260. 

1910. 

Ascomata immersed, subepidermal, ellipsoidal to globose, 

glabrous, up to 150 µm diam, ostiole central, up to 20 µm diam, 

devoid of periphyses; wall of 2–3 layers of brown textura angularis. 

Pseudoparaphyses 2–3 µm diam, transversely septate, guttulate, 

encased in mucous. Asci stipitate, cylindrical, 30–55 × 7–9 µm, 

stalked, biseriate. Ascospores brown, narrowly fusiform, straight or 

slightly curved, (15–)17–20(–23) × 4(–5) µm, 3-septate, uniformly 

verruculose, enclosed in a mucoid sheath; after discharge, 

ascospores become prominently swollen, up to 33 µm long and 

8 µm wide. 

Specimens examined: Japan, No. 196178, on 2, Prov. Susuya Shizuoka, Sep. 

1907, ex Herb. Sydow, ex S., as Leptosphaeria oryzae Hori = Phaeosphaeria oryzae 

I. Miyake, slides prepared by O. Eriksson, lectotype (UPS). Korea, on leaf of Oryza 

sativa (Poaceae), intercepted at Port San Francisco, CA, 29 Dec. 1997, coll. L. 

Hausch, det. M.E. Palm, epitype designated here as BPI 744438, culture ex-epitype 

CBS 110110 (MBT175330). 

Notes: Several detailed accounts of this species are available 

(Eriksson 1967, Shoemaker & Babcock 1989, Fukuhara 2002). The 

epitype chosen here closely matches the lectotype in morphology. 

Phaeosphaeria papayae (Speg.) Quaedvlieg, Verkley & 

Crous, comb. nov. MycoBank MB804444. Figs 71, 72. 

Basionym: Phaeoseptoria papayae Speg., Revta Mus. La Plata: 

39. 1908. 

Fig. 69. Asci and ascospores of Phaeosphaeria oryzae (BPI 744438). Scale bars 

= 10 µm. 

Leaf spots associated with infections of Asperisporium caricae, 

amphigenous, pale brown to grey-white, subcircular to angular, 

1–5 mm diam, with red-purple margin; conidiomata developing 

Fig. 70. Phaeosphaeria oryzae (BPI 744438). A. Ascomata on host tissue. B–G. Asci. H. Ascospores. Scale bars = 10 µm. 

368


and sporulating on leaves when incubated in moist chambers, 

with white, fluffy mycelium erumpting from lesions. Conidiomata 

amphigenous, pycnidial, brown, globose, up to 120 µm diam, 

with central ostiole, exuding a brown conidial cirrhus; wall of 

3–4 layers of brown textura angularis. Conidiophores reduced 

to conidiogenous cells. Conidiogenous cells lining the inner 

cavity, hyaline, smooth, ampulliform to subcylindrical or doliiform, 

5–12 × 4–6 µm; proliferating inconspicuously percurrently near 

apex (conidiogenous cells disintegrating at maturity). Conidia 

solitary, pale brown, smooth, guttulate, subcylindrical to narrowly 

obclavate, apex obtuse, base truncate, (1–)3(–4)-septate, at times 

slightly constricted at septa, straight to slightly curved, (15–)26– 

32(–35) × (2.5–)3 µm; hilum not darkened nor thickened, 2 µm 

diam. Ascomata developed after 4 wk in culture on sterile nettle 

stems: aggregated in black clusters, globose, up to 150 µm diam, 

with central ostiole; wall of 2–3 layers of brown textura angularis. 

Asci bitunicate, curved to straight, fasciculate, short stipitate with 

ocular chamber, 40–60 × 8–11 µm. Pseudoparaphyses hyaline, 

smooth, 2–3 µm, septate, constricted at septa, not anastomosing, 

hypha-like with obtuse ends, distributed among asci. Ascospores 

tri to multiseriate, fusoid, curved to straight, brown, verruculose 

throughout, somewhat constricted at septa with age, second cell 

from apex swollen, (18–)24–26(–29) × (3–)4(–5) µm. 

Culture characteristics: Colonies with abundant aerial mycelium, 

covering dish within 2 wk at 24 ºC, fast growing, olivaceous-grey on 

MEA (surface and reverse); margins smooth, even, sterile on MEA, 

PDA and OA, as well as on SNA with sterile barley leaves. 

Specimens examined: Brazil, São Paulo, Botanical Garden, on leaves of Carica 

papaya (Caricaceae), Sep. 1908, IMI 246301, slide ex-holotype; Minas Gerais, 

Viçosa, UFV campus, on leaves of Carica papaya, Mar. 2013, A.C. Alfenas, epitype 

designated here as CBS H-21310, culture ex-epitype CBS 135416 (MBT175331). 

Fig. 71. Conidia, ascospores and ascus of Phaeosphaeria papayae (CBS H-21310). 


Notes: It is interesting to note that Walker et al. (1992) also 

observed Phaeoseptoria papayae to co-occur with Asperisporium 

Fig. 72. Phaeosphaeria papayae (CBS H-21310). A. Leaf spot. B. Conidioma with ostiole (arrow). C–E. Conidiogenous cells. F. Conidia. G–K. Asci and ascospores. Scale bars 

= 10 µm. 


369


caricae on the holotype specimen (noted by Spegazzini as 

Cercospora caricae), suggesting that the co-occurrence of these 

two pathogens is quite common. The fresh collection obtained in 

this study enabled us to elucide the conidiogenesis of the fungus 

(not observed by Walker et al. 1992), and also designate an epitype 

specimen. Phylogenetically it is closely related to Phaeosphaeria 

oryzae, which has Phaeoseptoria oryzae as asexual morph. 

Clade 32: Neosetophoma 

Neosetophoma Gruyter, Aveskamp & Verkley, Mycologia 

102(5): 1075. 2010. 

Foliicolous, plant pathogenic. Conidiomata pycnidial, solitary 

to confluent, on upper surface of agar, globose to irregular, with 

mycelial outgrowths, or confluent, with papillate ostioles, sometimes 

developing long necks, honey to olivaceous or olivaceous-black, 

with up to 10 layers of pseudoparenchymatal cells. Conidiogenous 

cells hyaline, monophyalidic. Conidia slightly yellowish, 

0–1(–3)-septate, ellipsoidal to cylindrical, usally attenuate at one 

end, often guttulate. 

Type species: N. samarorum Gruyter, Aveskamp & Verkley, 

Mycologia 102(5): 1075. 2010. 

Type species: P. radicina (McAlpine) Morgan-Jones & J.F. White, 

Mycotaxon 18: 60. 1983. 

Paraphoma dioscoreae Quaedvlieg, H.D. Shin, Verkley & 



Dioscorea. 

On Anthriscus stem. Conidiomata pycnidial, separate, immersed 

becoming erumpent, globose, with papillate neck and central 

ostiole exuding a crystalline conidial mass; conidiomata up to 350 

µm diam, neck up to 150 µm diam, of darker brown cells than 

body, which is pale brown; wall of 3–6 layers of pale brown textura 

angularis. Conidiophores hyaline, smooth, subcylindrical, reduced to 

conidiogenous cells, 1–5-septate, irregularly branched, 5–20 × 3–5 

µm. Conidiogenous cells phialidic, hyaline, smooth, ampulliform to 

subcylindrical (long, elongated neck on Anthriscus stem, but not on 

MEA), 5–15 × 2–3 µm; apex with prominent periclinal thickening, or 

with several percurrent prolferations (especially on conidiogenous 

cells with elongated necks). Conidia solitary, straight to slightly 

curved, hyaline, smooth, aseptate, cylindrical with obtuse ends and 

a guttule at each end, (5–)6(–7) × 2(–2.5) µm. 

Note: The fact that several strains with a phaeosphaeria-like 

morphology cluster in this clade, suggests that sexual states do 

exist for species of Neosetophoma. 

Clade 33: Paraphoma 

Paraphoma Morgan-Jones & J.F. White, Mycotaxon 18: 58. 

1983. 

Mycelium consisting of branched, septate, subhyaline to pale 

brown, smooth hyphae. Conidiomata pycnidial, solitary to 

aggregated, superficial to immersed, dark brown, globose to 

subglobose, papillate, uniloculate, setose; ostiole circular, single; 

wall of 3–6 layers of brown textura angularis. Setae copious, straight 

to flexuous, smooth to verruculose, thick-walled, septate, pale 

brown to brown. Conidiogenous cells lageniform, monophalidic, 

formed from inner layer of conidiomatal wall, hyaline to subhyaline, 

discrete. Conidia ellipsoid, aseptate, hyaline, smooth, guttulate. 

Chlamydospores if present unicellular. 

Fig. 73. Conidia and conidiogenous cells of Paraphoma dioscoreae (CBS 135100). 

Scale bar = 10 µm. 

Fig. 74. Paraphoma dioscoreae (CBS 135100). A. Conidioma forming in culture. B–E. Conidiogenous cells. F. Conidia. Scale bars: B = 350 µm, all others = 10 µm. 

370


Culture characteristics: Colonies flat, spreading with sparse aerial 

mycelium and even, smooth margins; after 2 wk reaching 30 mm 

diam on MEA, 40 mm on PDA and 50 mm on OA. On PDA dark 

brick, reverse fuscous-black. On OA dark brick with patches of 

sienna and ochreous. On MEA surface dirty white (due to aerial 

mycelium), also somewhat sectored, reverse umber. 

Specimen examined: South Korea, on leaves of Dioscorea tokoro (Dioscoreaceae), 

24 Oct. 2003, H.D. Shin (holotype CBS H-21311, culture ex-type CPC 11357 = CBS 

135100). 

Note: Paraphoma dioscoreae is phylogenetically distinct from the 

three other species presently known in the genus (de Gruyter et 

al. 2010). 

Clade 34: Xenoseptoria 

Xenoseptoria Quaedvlieg, H.D. Shin, Verkley & Crous, gen. 


Etymology: Similar to the genus Septoria s. str., but distinct. 

Xenoseptoria neosaccardoi Quaedvlieg, H.D. Shin, Verkley 

& Crous, sp. nov. MycoBank MB804447. Figs 75, 76. 

Etymology: Resembling Septoria saccardoi, but morphologically 

distinct. 

Leaf spots on the upper leaf surface, scattered, distinct, circular, 

2–4 mm diam, initially appearing as reddish brown discolouration, 

later turning brown to reddish brown without a distinct border 

line, finally central area becoming greyish brown to dull grey and 

surrounded by reddish to dark brown margin, reddish pigments 

may diffuse outward to form a halo; on the lower leaf surface 

initially showing reddish discolouration, later becoming brown with 

distinct border line, center greyish brown to grey with indistinct 

border (Shin & Sameva 2004). On sterile Carex leaves on WA. 

Conidiomata separate, pycnidial, immersed becoming erumpent, 

globose, up to 350 µm diam, brown, becoming ostiolate, developing 

1–3 papillate necks, exuding a pink to orange conidial mass; wall 

of 4–8 layers of brown textura angularis. Conidiophores hyaline, 

Foliicolous, plant pathogenic. Conidiomata separate, pycnidial, 

immersed becoming erumpent, globose, brown, developing 1–3 

papillate necks, exuding a pink to orange conidial mass; wall of 

4–8 layers of brown textura angularis. Conidiophores hyaline, 

smooth, reduced to conidiogenous cells or septate, branched 

below. Conidiogenous cells lining the inner cavity, hyaline, smooth, 

ampulliform to doliiform or subcylindrical, mono- to polyphialidic, 

with prominent periclinal thickening, but also with percurrent 

proliferation. Conidia hyaline, smooth, guttulate, scolecosporous, 

straight to irregularly curved, cylindrical to obclavate, transversely 

euseptate, tapering to subobtuse apex, base obtuse. 

Type species: Xenoseptoria neosaccardoi Quaedvlieg, Verkley & 

Crous. 

Fig. 75. Conidia and conidiogenous cells of Xenoseptoria neosaccardoi (CBS 

128665). Scale bars = 10 µm. 

Fig. 76. Xenoseptoria neosaccardoi (CBS 128665). A, B. Pycnidia forming in culture. C–E. Conidiogenous cells. F, G. Conidia. Scale bars: B = 170 µm, all others = 10 µm. 


371


smooth, reduced to conidiogenous cells or 1–2-septate, branched 

below, 10–20 × 4–6 µm. Conidiogenous cells lining the inner cavity, 

hyaline, smooth, ampulliform to doliiform or subcylindrical, monoto 

polyphialidic, with prominent periclinal thickening, but also with 

percurrent proliferation, 5–15 × 3–5 µm. Conidia hyaline, smooth, 

guttulate, scolecosporous, straight to irregularly curved, cylindrical 

to obclavate, (1–)3-septate, (23–)33–45(–48) × (2.5-)3(–4) µm, 

tapering to subobtuse apex, base obtuse, 2–2.5 µm diam. 

Culture characteristics: Colonies flat, spreading, with sparse aerial 

mycelium and lobate, feathery mergins, reaching 30 mm after 2 wk. 

On PDA surface iron-grey, reverse olivaceous-grey; on OA surface 

olivaceous-grey; on MEA surface folded, bay, reverse umber. 

Specimen examined: South Korea, Pyeongchang, on leaves of Lysimachia vulgaris 

var. davurica (Primulaceae), 30 May 2007, H.D. Shin (holotype CBS H-21312, 

culture ex-type CBS 128665 = KACC 43962 = SMKC 23666). 

Notes: An isolate of Septoria saccardoi (CBS 128756) clusters in 

Septoria s. str., thus well apart from this taxon, which was collected 

in Korea. The Korean collection closely matches that of the original 

description of Septoria saccardoi (on Lysimachia vulgaris in Italy), 

having 3-septate, curved, cylindrical conidia, 38–40 × 3.5 µm, 

3-septate (Saccardo & Saccardo 1906). Xenoseptoria is however 

distinct from Septoria s. str. in forming pycnidia with multiple papillate 

necks, and having conidiogenous cells that are mono- or polyphialidic. 

wall of 6–8 layers of pale brown textura angularis; exuding cirrhus 

of orange conidia. Conidiophores reduced to conidiogenous cells. 

Conidiogenous cells lining the inner cavity of conidioma, globose 

to ampulliform, rarely allantoid, hyaline, smooth; with prominent 

periclinal thickening, or proliferating several times percurrently near 

apex, giving rise to macro- and microconidia. Macroconidia solitary, 

hyaline, smooth, guttulate, subcylindrical to narrowly obclavate 

or acicular, apex obtuse to subobtuse, base truncate to long 

obconically truncate, conidia widest at or just above basal septum, 

transversely euseptate. Microconidia hyaline, smooth, aseptate, 

pear-shaped to globose or ellipsoid, apex obtuse, base truncate. 

Type species: Vrystaatia aloeicola Quaedvlieg, Verkley, W.J. Swart 

& Crous. 

Vrystaatia aloeicola Quaedvlieg, Verkley, W.J. Swart & 



Aloe. 

Clade 35: Vrystaatia 

Vrystaatia Quaedvlieg, W.J. Swart, Verkley & Crous, gen. 


Etymology: Named after the Free State Province in South Africa, 

“Vrystaat” in Afrikaans, where this fungus was collected. 

Foliicolous. Conidiomata black, globose, pycnidial with central, 

dark brown ostiolar area, substomatal on host, erumpent in culture; 

Fig. 77. Macro- and microconidia and conidiogenous cells of Vrystaatia aloeicola 


Fig. 78. Vrystaatia aloeicola (CBS 135107). A. Conidiomata sporulating on PDA, with characteristic orange conidial cirrhi. B–D. Conidiogenous cells. E, F. Conidia. Scale bars 

= 10 µm. 

372


On sterile Carex leaves on WA. Conidiomata black, globose, pycnidial 

with central, dark brown ostiolar area, substomatal on host, erumpent 

in culture; wall of 6–8 layers of pale brown textura angularis; exuding 

cirrhus of orange conidia. Conidiophores reduced to conidiogenous 

cells. Conidiogenous cells lining the inner cavity of conidioma, 

globose to ampulliform, rarely allantoid, hyaline, smooth, 5–12 × 

4–6 µm; with prominent periclinal thickening, or proliferating several 

times percurrently near apex, 2–2.5 µm diam, giving rise to macroand 

microconidia. Macroconidia solitary, hyaline, smooth, guttulate, 

subcylindrical to narrowly obclavate or acicular, apex obtuse to 

subobtuse, base truncate to long obconically truncate, conidia widest 

at or just above basal septum, (1–)3-septate, (30–)40–52(–65) × (2.5–) 

3(–3.5) µm. Microconidia hyaline, smooth, aseptate, pear-shaped to 

globose or ellipsoid, apex obtuse, base truncate, 4–6 × 3–3.5 µm. 

Culture characteristics: On MEA colonies spreading fast, with 

moderate aerial mycelium and smooth, even margin, reaching 30 

mm diam after 2 wk; surface with concentric zones of umber and 

apricot; reverse umber, produces brown exudates; on PDA round 

lobate margins, lacking aerial mycelium, reaching 20 mm diam after 

2 wk, surface fuscous-black to greyish-sepia for younger mycelium, 

reverse fuscous-black to greyish-sepia for younger mycelium; on 

OA round, lobate, lacking aerial mycelium, reaching 30 mm diam 

after 2 wk, surface vinaceous-grey, reverse greyish sepia. 

Clade 36: Setophoma 

Setophoma Gruyter, Aveskamp & Verkley, Mycologia 102: 

1077. 2010. 

Conidiomata pycnidial, solitary to confluent, superficial or 

submerged in agar, globose to subglobose, setose, with papillate 

ostioles, honey to olivaceous to olivaceous-black, with 2–7(–11) 

layers of pseudoparenchymatal cells. Conidiogenous cells hyaline, 

monophyalidic. Conidia aseptate, ellipsoidal to subcylindrical to 

subfusoid, guttulate. 

Type species: S. terrestris (H.N. Hansen) Gruyter, Aveskamp & 

Verkley, Mycologia 102: 1077. 2010. 

Setophoma chromolaenae Quaedvlieg, Verkley, R.W. 

Barreto & Crous, sp. nov. MycoBank MB804450. Figs 79, 

80. 

Specimen examined: South Africa, Orange Free State, Bloemfontein, Free State 

National Botanical Garden, on dead leaf tips of Aloe maculata (Aloaceae), 7 May 

2012, P.W. Crous & W.J. Swart (holotype CBS H-21313, culture ex-type CBS 

135107 = CPC 20617). 

Notes: Vrystaatia is distinct from Septoria s. str. in that it has phialidic 

conidiogenous cells that proliferate percurrently or with prominent 

periclinal thickening, and form macro- as well as microconidia in 

culture, which is not typical of Septoria. Rhabdospora aloetica was 

described from stems of Aloe sp. in Portugal, with aseptate conidia, 

12–16 × 1.5 µm (Saccardo & Saccardo 1906); it is likely this is 

an asexual morph of Diaporthe. As far as we could establish, no 

septoria-like fungi have thus far been described from Aloe. 

Fig. 79. Conidia and conidiogenous cells of Setophoma chromolaenae (CBS 

135105). Scale bar = 10 µm. 

Fig. 80. Setophoma chromolaenae (CBS 135105). A. Conidiomata forming on OA. B, C, F. Conidiomata with setae. D, E. Conidiogenous cells. G. Conidia. Scale bars: B = 22 

µm, C, F = 45 µm, all others = 10 µm. 


373



Chromolaena. 

Conidiomata pycnidial, brown, globose, separate, erumpent, up to 

90 µm diam; outer surface covered in brown setae, up to 80 µm 

long, brown, thick-walled, 3–5 µm diam, 1–4-septate, with slight 

apical taper to obtuse apex; conidial wall of 3–6 layers of brown 


Conidiogenous cells lining the inner cavity, ampulliform, hyaline, 

smooth, 4–6 × 3–6 µm, with prominent periclinal thickening at 

apex. Conidia hyaline, smooth, subcylindrical, somewhat narrowly 

ellipsoid when old, with two prominent guttules at ends, (4.5–)5–6 

(–7) × (2–)2.5(–3) µm. 

Culture characteristics: On MEA spreading, with sparse aerial 

mycelium, folded surface, margin smooth, lobate; surface umber 

with patches of apricot and dirty white, reverse ochreous. On PDA 

surface iron-grey, reverse olivaceous-grey. On OA surface irongrey, 

surrounded by orange to apricot diffuse pigment layer in agar; 

reaching 55 mm diam after 2 wk. 

Specimen examined: Brazil, Rio de Janeiro, Fazenda Santa Rosa, Ponte das 

Laranjeiras, on leaves of Chromolaena odorata (Asteraceae), 6 Apr. 2010, R.W. 

Barreto (holotype CBS H-21314, culture ex-type CBS 135105 = CPC 18553). 

Note: Setophoma chromolaenae is phylogenetically distinct from S. 

sacchari and S. terrestris, the two other species presently known 

from the genus (de Gruyter et al. 2010). 

Clade 37: Coniothyrium (Coniothyriaceae) 

Coniothyrium Corda, Icon. Fung. (Prague) 4: 38. 1840. 

Mycelium immersed, consisting of septate, hyaline to brown, 

branched hyphae. Conidiomata pycnidial, separate, globose, pale 

to dark brown, immersed, unilocular, thin-walled; wall of brown, 

thick-walled textura angularis. Ostiole circular, central, papillate or 

not. Conidiophores reduced to conidiogenous cells. Conidiogenous 

cells lining the inner cavity, phialidic, annellidic, indeterminate, 

discrete, doliiform to cylindrical, hyaline to pale brown, smooth, 

several annellations at apex. Conidia subcylindrical, spherical, 

ellipsoid or broadly clavate, brown, thick-walled, 0(–1)-euseptate, 

smooth to verruculose, apex obtuse, base truncate, at times with 

minute marginal frill (Sutton 1980). 

Type species: C. palmarum Corda, Icon. Fung. (Prague) 4: 38. 

1840. 

Coniothyrium sidae Quaedvlieg, Verkley, R.W. Barreto & 



Sida. 

Conidiomata pycnidial, globose, immersed becoming erumpent, up 

to 200 µm diam; wall consisting of 3–4 layers of subhyaline to pale 

brown textura angularis. Ostiole central, papillate, dark brown, up 

to 30 µm diam, surrounded by a whorl of brown setae, smooth, 

thick-walled, 4–8-septate, straight to curved, tapering to subobtuse 

apices, up to 130 µm long, 5–8 µm diam at base. Conidiogenous 

cells hyaline, smooth, lining the inner cavity, ampulliform to 

Fig. 81. Conidia and conidiogenous cells of Coniothyrium sidae (CBS 135108). 


globose, 4–7 × 4–6 µm; apex with prominent periclinal thickening. 

Conidia solitary, hyaline, smooth, aseptate, granular (in Shear’s 

medium, prominently guttulate in lactic acid), fusoid-ellipsoidal, 

straight to slightly curved, apex obtuse, base truncate to bluntly 

rounded, (9–)10–12(–13) × (2.5–)3 µm. Ascomata developing 

after several weeks on MEA, separate, pseudothecial, erumpent, 

uniloculate, papillate, brown, up to 300 µm diam; wall of 4–8 

layers of brown textura angularis. Asci fasciculate, 8-spored, 

short papillate, hyaline, smooth, subcylindrical, bitunicate, with 

well-developed apical chamber, 2 µm diam, 55–65 × 8–11 µm. 

Ascospores bi- to triseriate, brown, smooth, guttulate, straight to 

slightly curved, (3–)5-septate, apical cell obtusely rounded, basal 

cell somewhat elongated and subobtuse; in ascospores that are 

4-septate, the second cell from the apex is markedly swollen, 

in 5-septate ascospores the third cell from the apex is markedly 

swollen, (18–)20–24(–26) × (4–)5(–5.5) µm. Pseudoparaphyses 

hyaline, smooth, intermingled among asci, anastomosing, cellular, 

constricted at septa, up to 80 µm long, 2–4 µm diam. 

Culture characteristics: Colonies erumpent, spreading, moderate 

aerial mycelium even, lobate margins. On MEA surface olivaceousgrey, 

reverse umber. On OA suface olivaceous-grey with diffuse 

umber pigment in agar. On PDA surface and reverse olivaceousgrey. 

Specimen examined: Brazil, Rio de Janeiro, Nova Friburgo, Riograndina, along 

roadside on Sida sp. (Malvaceae), 24 Feb. 2008, R.W. Barreto (holotype CBS 

H-21315, culture ex-type CPC 19602 = RWB 866 = CBS 135108). 

Note: De Gruyter et al. (2013) placed several phoma-like species 

with a similar morphology in the genus Coniothyrium, to which 

C. sidae is allied. Of interest is the paraphaeosphaeria-like 

sexual morph that developed in culture, which is newly linked 

here to Coniothyrium. The genus Paraphaeosphaeria is linked to 

Paraconiothyrium (Verkley et al. 2004). 

Clade 38: Xenobotryosphaeria 

Xenobotryosphaeria Quaedvlieg, Verkley & Crous, gen. 


Etymology: Resembling the genus Botryosphaeria, but distinct. 

374


Fig. 82. Coniothyrium sidae (CBS 135108). A–E. Conidiomata forming in culture, showing setae. F, G. Conidiogenous cells. H. Conidia. I–K. Asci and ascospores. Scale bars: 

B, D, E = 100 µm, all others = 10 µm. 

Ascomata brown, globose, smooth, ostiolate, superficial on stems; 

wall of 3–4 layers of brown textura angularis. Asci clavate, hyaline, 

smooth, short stipitate, fasciculate, bitunicate, thin-walled, apical 

chamber not visible, 6–8-spored. Ascospores multiseriate, hyaline, 

smooth and thin-walled, granular, broadly ellipsoid, ends obtuse, 

aseptate. Pseudoparaphyses not seen. 

Type species: Xenobotryosphaeria calamagrostidis Quaedvlieg, 


Xenobotryosphaeria calamagrostidis Quaedvlieg, Verkley 

& Crous, sp. nov. MycoBank MB804453. Figs 83, 84. 


Calamagrostis. 

On Anthriscus stem. Ascomata brown, globose, smooth, superficial on 

stems, ostiolate, up to 180 µm diam; wall of 3–4 layers of brown textura 

angularis. Asci clavate, hyaline, smooth, short stipitate, fasciculate, 

bitunicate, thin-walled, apical chamber not visible, 6–8-spored, 60–80 × 

30–40 µm. Ascospores multiseriate, hyaline, smooth and thin-walled, 

granular, broadly ellipsoid, ends obtuse, aseptate, (17–)18–20(–24) × 

(11–)12–13(–14) µm. Pseudoparaphyses not seen. 

Culture characteristics: Colonies flat, spreading, with sparse to no 

aerial mycelium. On PDA surface and reverse dirty white; on MEA 

concolorous with agar; on OA pale pink on surface. 

Specimen examined: Italy, Bergamo Vigolo, on Calamagrostis sp. (Poaceae), 20 

Jun. 1967, G.A. Hedjaroude (holotype CBS H-21316, culture ex-type CBS 303.71). 

Notes: Hedjaroude (1968) studied the specimen (ETH 7131; as 

Phaeosphaeria silvatica), but obviously the incorrect fungus was 

cultivated, as X. calamagrostidis is quite distinct from P. silvatica, 

which has cylindrical-fusoid, brown, 6–8-septate ascospores, 

18–18 × 4–5 µm. Xenobotryosphaeria is reminiscent of genera in 

the Botryosphaeriales, but is phylogenetically distinct (Crous et al. 

2006, Phillips et al. 2008, Liu et al. 2012). It also resembles species 

of Muyocopron (Muyocopronaceae), but the latter genus differs 

in that it has circular, flattened ascomata, as well as prominent 

pseudoparaphyses, which are absent in Xenobotryosphaeria. 

Clade 39: Phoma 

Fig. 83. Ascospores and asci of Xenobotryosphaeria calamagrostidis (CBS 303.71). 


Note: See Aveskamp et al. (2010), de Gruyter et al. (2009, 2013). 


375


Fig. 84. Xenobotryosphaeria calamagrostidis (CBS 303.71). A, C. Ascomata forming in culture. E, G. broken wall with asci. B, D, F. Asci. H. Ascospores. Scale bars: C = 45 

µm, all others = 10 µm. 

Clade 40: Acicuseptoria 

Acicuseptoria Quaedvlieg, Verkley & Crous, gen. nov. 


Etymology: Acicu- from acicular (conidia), and Septoria = septorialike. 

Conidiomata pycnidial, erumpent, brown, globose, with central 

ostiole, exuding a cream conidial mass; wall consisting of 3–6 

layers of thin, brown textura angularis. Conidiophores reduced 


ampulliform; proliferating inconspicuously and percurrently at apex, 

or simply appearing holoblastic. Conidia solitary, hyaline, granular, 

acicular, straight to gently curved, tapering towards apex that is 

acutely rounded, base truncate, transversely euseptate. 

Type species: Acicuseptoria rumicis Quaedvlieg, Verkley & Crous. 

Acicuseptoria rumicis Quaedvlieg, Verkley & Crous, sp. 


Fig. 85. Acicuseptoria rumicis (CBS 522.78). A. Conidiomata sporulating in culture. B–E. Conidiogenous cells. F, G. Conidia. Scale bars = 10 µm. 

376



Rumex. 

On sterile Carex leaves on WA. Conidiomata pycnidial, erumpent, 

brown, globose, up to 300 µm diam, with central ostiole, exuding 

a cream conidial mass; wall consisting of 3–6 layers of thin, brown 


Conidiogenous cells hyaline, smooth, ampulliform, 7–15 × 5–7 µm; 

proliferating inconspicuously and percurrently at apex, or simply 

appearing holoblastic. Conidia solitary, hyaline, granular, acicular, 

straight to gently curved, tapering towards apex that is acutely 

rounded, base truncate, 1.5–2 µm diam, up to 8-septate, (32–)40– 

60(–70) × 2(–2.5) µm. 

Culture characteristics: Colonies lobate, flat with little appressed, 

white aerial mycelium. On MEA surface olivaceous-grey, reverse 

umber. On OA suface olivaceous-grey. On PDA surface and 

reverse olivaceous-grey. 

Specimen examined: France, Haute Savoie, Mt. Beaudin, 2000 m alt., stem 

of Rumex alpinus (Polygonaceae), Oct. 1978, H.A. van der Aa (holotype CBS 

H-18163, culture ex-type CBS 522.78). 

Notes: Acicuseptoria rumicis was originally deposited as Septoria 

rumicum, but is distinct from the latter in having acicular, narrower 

conidia. Acicuseptoria is distinct from Septoria s. str. in having 

acicular conidia. 

Clade 41: Stagonospora 

Stagonospora (Sacc.) Sacc., Syll. Fung. (Abellini) 3: 445. 

1884. 


Type species: S. paludosa (Sacc. & Speg.) Sacc., Syll. Fung. 

(Abellini) 3: 453. 1884. 

Stagonospora duoseptata Quaedvlieg, Verkley & Crous, 


Etymology: Named after the fact that conidia are 2-septate. 

Fig. 86. Conidia and conidiogenous cells of Stagonospora duoseptata (CBS 

135093). Scale bars = 10 µm. 

On sterile Carex leaves on WA. Conidiomata dark brown, 

immersed, subepidermal, pycnidial, globose, up to 400 µm 

diam, exuding a short, hyaline cirrhus of conidia; wall of 3–4 

layers of medium brown textura angularis. Conidiophores 

hyaline, smooth, lining inner cavity, 0–1-septate, subcylindrical, 

10–20 × 4–5 µm. Conidiogenous cells phialidic, hyaline, 

smooth, aggregated, lining the inner cavity, subcylindrical to 

ampulliform or doliiform, 6–8 × 3–4 µm; phialidic with several 

apical percurrent proliferations. Conidia hyaline, smooth, thinwalled, 

granular, fusoid-ellipsoidal, 2-septate, with septa 4–6 

µm inwards from both obtuse conidial ends; conidia widest in 

middle, (18–)20–23(–25) × (5–)6(–7) µm. 

Culture characteristics: Colonies on PDA flattened, circular with 

lobate edges, and fine grey aerial mycelium, surface mouse-grey, 

reverse olivaceous-black, after 14 d, 4 cm diam; on MEA after 14 d, 

4.5 cm diam; on OA similar to MEA. 

Specimen examined: Netherlands, Nijmegen, de Duffelt, on leaves of a Carex 

acutiformis (Cyperaceae), 29 Jul. 2012, W. Quaedvlieg (holotype CBS H-21321, 


Notes: Stagonospora duoseptata is distinct from other species 

occurring on Carex in that it has fusoid-ellipsoidal, 2-septate 

conidia, (18–)20–23(–25) × (5–)6(–7) µm, with septa positioned 

4–6 µm inwards from its obtuse conidial ends. Stagonospora 

biseptata (occurring on Carex lanuginosa, Wisconsin, USA) has 

conidia that are larger, (35–)40–50(–55) × (2–)10–11(–13) µm 

(Greene 1961). 

Fig. 87. Stagonospora duoseptata (CBS 135093). A. Conidiomata forming in culture. B, C. Conidiogenous cells. D. Conidia. Scale bars = 10 µm. 


377


Stagonospora paludosa (Sacc. & Speg.) Sacc., Syll. Fung. 

(Abellini) 3: 453. 1884. Figs 88, 89. 

Basionym: Hendersonia paludosa Sacc. & Speg., Michelia 1(no. 

3): 353. 1878. 

On sterile Carex leaves on WA. Conidiomata black, immersed, 

subepidermal, pycnidial, globose, up to 400 µm diam, exuding a 

short, hyaline cirrhus of conidia; wall of 3–4 layers of medium brown 




at apex with prominent periclinal thickening or 1–2 inconspicuous 

percurrent proliferations visible at apex. Conidia hyaline, smooth, 

thin-walled, granular, or each cell with a large central guttule, 

subcylindrical to fusoid, apex subobtusely to obtusely rounded, base 

truncate (4–7 µm diam), (6–)7–8-septate (becoming constricted at 

septa with age), (45–)55–63(–65) × (9–)10–11 µm. 

Culture characteristics: Colonies on PDA flat, circular, with grey 

aerial mycelium, reverse olivaceous-black to buff at the margins, 

after 14 d, 8.5 cm diam; on MEA umbonate, round, with appressed, 

grey aerial mycelium, with white patches; OA similar to PDA, but 

reverse buff with iron-grey patches at the outer region. 

Specimens examined: Italy, on Carex riparia (Cyperaceae), Feb. 1878, holotype 

(presumably lost). Netherlands, Utrecht, Veenendal, de Blauwe Hel, Carex 

acutiformis (Cyperaceae), 23 Jul. 2012, W. Quaedvlieg (neotype designated here 

CBS H-21317, culture ex-type S601 = CBS 135088) (MBT175339). 

Notes: For more than a century, Stagonospora was confused 

with Septoria. The introduction of molecular techniques around 

the turn of the century made it possible to definitively establish 

that Stagonospora was not linked to Septoria, and that it in fact 

clusters with other important plant pathogenic genera like Phoma 

and Leptosphaeria in the Pleosporales (Cunfer & Ueng 1999, 

Solomon et al. 2006). The type of Stagonospora (S. paludosa) 

was recollected from a Carex during this study and phylogenetic 

analyses showed that this species clustered separately from most 

other known “Stagonospora” spp. (mostly isolated from Poaceae), 

but together with several other Stagonospora species that were also 

collected from Carex. This led to the conclusion that Stagonospora 

s. str. was limited to Carex, and that other commercially important 

stagonospora-like species on Poaceae (e.g. S. avenae and S. 

nodorum) in fact belonged to different genera. 

Stagonospora perfecta Quaedvlieg, Verkley & Crous, sp. 


Etymology: Named after the fact that both sexual and asexual 

morphs of the fungus developed in culture. 

On sterile Carex leaves on SNA. Ascomata developing on SNA, 

solitary, globose, brown, erumpent, up to 300 µm diam, with 


Pseudoparaphyses intermingled among asci, hyaline, smooth, 

guttulate, multi-septate, constricted at septa, branched, hyphallike, 

4–6 µm diam, filling entire cavity. Asci stipitate, hyaline, 

smooth, clavate to fusoid-ellipsoidal, bitunicate, with prominent 

apiculus, 1.5–2.5 µm diam, 8-spored, 45–100 × 12–18 µm. 

Ascospores hyaline, smooth, 3- to multi-seriate in ascus, 

Fig. 88. Conidia and conidiogenous cells of Stagonospora paludosa (CBS 135088). 


Fig. 90. Conidia, conidiogenous cells and ascus with ascospores of Stagonospora 

perfecta (CBS 135099). Scale bars = 10 µm. 

Fig. 89. Stagonospora paludosa (CBS 135088). A, B. Conidiomata forming in culture. C, D. Conidiogenous cells. E, F. Conidia. Scale bars: B = 400 µm, all others = 10 µm. 

378


Fig. 91. Stagonospora perfecta (CBS 135099). A. Conidiomata forming in culture. B. Ascomata forming in culture. C–F, I, J. Asci and pseudoparaphyses. G, H. Conidiogenous 

cells. K. Conidia. Scale bars: B = 300 µm, all others = 10 µm. 

fusoid-ellipsoidal with median septum, prominently constricted 

at septum, tapering towards subobtuse apices, with 1–2 large 

guttules per cell, thin-walled, widest just above septum in 

upper cell, (20–)23–25(–27) × (5–)6–7(–8) µm. Conidiomata 

up to 300 µm diam, brown, immersed, subepidermal, pycnidial, 

subglobose with central ostiole, exuding crystalline to creamy 

conidial mass; wall of 2–3 layers of brown textura angularis. 


cells phialidic, hyaline, smooth, aggregated, lining the inner 

cavity, ampulliform to doliiform or subcylindrical, with several 

percurrent proliferations near apex, 5–12 × 4–6 µm. Conidia 

hyaline, smooth, thin-walled, subcylindrical to narrowly fusoidellipsoidal, 

with obtuse apex and bluntly rounded base, 

2–3-septate, slightly constricted at septa, with 1–2 large guttules 

per cell, (19–)25–29(–32) × (6–)7(–8) µm. 

Culture characteristics: Colonies on PDA flattened, convex, circular, 

with white aerial mycelium, surface fuscous-black, reverse irongrey 

to black, after 14 d, 8.5 cm diam; on MEA surface fuscousblack, 

reverse olivaceous-black; on OA surface isabelline, reverse 

fuscous-black. 

Specimen examined: Netherlands, Limburg, Weert, Moerselpeel, on leaves 

of Carex acutiformis (Cyperaceae), Sep. 2012, W. Quaedvlieg (holotype CBS 

H-21320, culture ex-type CBS 135099 = S656). 

Notes: Stagonospora perfecta is the first species with a confirmed 

sexual state in the genus Stagonospora. Of interest is the fact that it is 

didymella-like, rather than phaeosphaeria-like in morphology, which 

also explains it clustering in the Didymellaceae. Morphologically S. 

perfecta resembles S. vitensis (18–32 × 4–6 µm, 2–3(–4)-septate; 

Ellis & Ellis 1997), but conidia are wider. Stagonospora perfecta is 

closely related to S. pseudovitensis, though in the latter conidia are 

slightly longer, more fusoid-ellipsoidal in shape, and lack a sexual 

morph in culture. 

Stagonospora pseudocaricis Quaedvlieg, Verkley, 

Gardiennet & Crous, sp. nov. MycoBank MB804456. Figs 

92, 93. 

Etymology: Named after the species that it resembles, 

Stagonospora caricis. 


subepidermal, pycnidial, globose, up to 400 µm diam, exuding a 

short, hyaline cirrhus of conidia; wall of 3–4 layers of medium brown 




at apex with prominent periclinal thickening or 1–2 inconspicuous 

percurrent proliferations visible at apex. Conidia hyaline, smooth, 

thin-walled, granular, or each cell with a large central guttule, 

subcylindrical to fusoid, apex subobtusely to obtusely rounded, 

base truncate, (5–)6(–7)-septate, (35–)42–48(–50) × (6–)7–8 µm. 

Culture characteristics: Colonies on PDA flat, circular, with appressed, 

grey aerial mycelium, surface sepia, reverse olivaceous-black to buff, 

after 14 d, 8.5 cm diam; on MEA umbonate, round, with appressed, 

grey aerial mycelium with white patches, surface greyish sepia, 

reverse fuscous-black to olivaceous-black; OA similar to PDA. 

Specimens examined: France, Foncegrive, Rive de la Venelle, on Carex acutiformis 

(Cyperaceae), Oct. 2012, A. Gardiennet (holotype CBS H-21318, culture ex-type 

CBS 135132 = S610); ibed., S609 = CBS 135414). 


379


Note: Conidia of S. pseudocaricis closely resemble those of S. 

caricis (25–45 × 4–8 µm, 5–7-septate; Ellis & Ellis 1997), but are 

longer. 

Stagonospora pseudovitensis Quaedvlieg, Verkley & 


Etymology: Named after the species that it resembles, 

Stagonospora vitensis. 


subepidermal, pycnidial, globose with central ostiole, up to 180 µm 

diam; wall of 3–4 layers of pale brown textura angularis. Conidiophores 

reduced to conidiogenous cells. Conidiogenous cells phialidic, 

hyaline, smooth, aggregated, lining the inner cavity, ampulliform 

to doliiform, 5–7 × 4–5 µm; tapering at apex with inconspicuous 

periclinal thickening or percurrent proliferation. Conidia hyaline, 

smooth, thin-walled, granular, subcylindrical with obtuse apex and 

truncate to bluntly rounded base, 3–4 µm diam, 3-septate, with large 

central guttule in each cell, (25–)28–33(–36) × (6–)7(–8) µm. 

Culture characteristics: Colonies on PDA flat, circular, aerial 

mycelium consisting of some grey tufts, surface pale mouse-grey, 

reverse olivaceous-black, after 14 d, 8.5 cm diam; on MEA similar 

to PDA, but with appressed, white aerial mycelium, and with some 

grey tufts; OA similar to MEA, but reverse olivaceous-grey. 

Specimens examined: Netherlands, Veenendaal, de Blauwe Hel, on leaves of 

Carex acutiformis (Cyperaceae), 23 Jul. 2012, W. Quaedvlieg (holotype CBS 

H-21319, culture ex-type CBS 135094 = S620); ibed., S602. 

Note: Conidia of S. pseudovitensis differ from that of S. vitensis 

(18–32 × 4–6 µm, 2–3(–4)-septate; Ellis & Ellis 1997), by having 

consistently 3-septate, wider conidia. 

Stagonospora uniseptata Quaedvlieg, Verkley & Crous, 


Etymology: Named after the fact that conidia are 1-septate. 


black, immersed, subepidermal, pycnidial, globose with central 

ostiole, exuding yellow conidial masses; wall of 3–4 layers of redbrown 

textura angularis. Conidiophores reduced to conidiogenous 


lining the inner cavity, ampulliform to subcylindrical, 5–8 × 3–4 µm, 

with percurrent proliferation at apex. Conidia hyaline, smooth, thinwalled, 

fusoid-ellipsoidal, with obtuse apex and truncate to bluntly 

rounded base (2 µm diam), medianly 1-septate, prominently 

constricted at septum, straight to irregularly curved, widest in 

middle of either apical or basal cell, granular, including yellowgreen 

reflective guttules, (13–)16–20(–22) × (5–)5.5(–6) µm. 

Fig. 92. Conidia of Stagonospora pseudocaricis (CBS 135132). Scale bar = 10 µm. 

Fig. 94. Conidia and conidiogenous cells of Stagonospora pseudovitensis (CBS 

135094). Scale bars = 10 µm. 

Fig. 93. Stagonospora pseudocaricis (CBS 135132). A. Conidiomata forming in culture. B, C. Conidia. Scale bars = 10 µm. 

380


Fig. 95. Stagonospora pseudovitensis (CBS 135094). A. Conidiomata forming in culture. B, C. Conidiogenous cells. D. Conidia. Scale bars = 10 µm. 

Fig. 96. Conidia and conidiogenous cells of Stagonospora uniseptata (CBS 135090). Scale bars = 10 µm. 

Fig. 97. Stagonospora uniseptata (CBS 135090). A. Conidiomata sporulating in culture. B. Conidiogenous cells. C. Conidia. Scale bars = 10 µm. 

Culture characteristics: Colonies on PDA appressed, circular, 

with short, greyish-white aerial mycelium, surface fusous-black, 

reverse olivaceous-black to hazel, after 14 d, 8.5 cm diam; on 

MEA surface hazel, reverse cinnamon; on OA with patches of 

white aerial mycelium, surface isabelline, reverse olivaceous to 

fuscous-black. 

Specimens examined: Netherlands, Nijmegen, de Duffelt, on leaves of a Carex 

acutiformis (Cyperaceae), 29 Jul. 2012, W. Quaedvlieg, (holotype CBS H-21322, 

culture ex-type CBS 135090 = S611); ibed., S607, S608 = CPC 22151 and CPC 22150. 

Notes: Of the Stagonospora and Septoria species occurring on 

Carex, Stagonospora uniseptata is most similar to Septoria caricis 

(conidia 20–35 × 2.5–3 µm, 1-septate; Ellis & Ellis 1997), but 

distinct in that conidia are shorter and wider. 

Clade 42: Corynespora 

Corynespora Güssow, Z. PflKrankh. PflPath. PflSchutz 16: 

10. 1906. 

Mycelium immersed or superficial. Stroma present in some species. 

Setae and hyphopodia absent. Conidiophores macronematous, 

mononematous, straight or flexuous, unbranched, brown or 

olivaceous brown, smooth. Conidiogenous cells monotretic, 

integrated, terminal, percurrent, cylindrical or doliiform. Conidia 

solitary or catenate, dry, acrogenous, simple, obclavate, rarely 

cylindrical, subhyaline, pale to dark brown or olivaceous brown 

or straw-coloured, euseptate or distoseptate, smooth, rarely 

verruculose (Ellis 1971). 


381


Type species: C. mazei Güssow, Consp. Regni Veget. (Leipzig) 16: 

13. 1906. [= C. cassiicola (Berk. & M.A. Curtis) C.T. Wei, Mycol. 

Pap. 34: 5. 1950.] 

Corynespora leucadendri Quaedvlieg, Verkley & Crous, 



Leucadendron. 

On MEA and PDA after 2 wk. Mycelium consisting of creeping, 

branched, septate, hyaline, smooth, 3–4(–5) µm diam hyphae 

that become brown close to conidiophores; stroma lacking. 

Conidiophores subcylindrical, erect, medium brown, 100–300 µm 

tall, 4–6(–7) µm diam, thick-walled, transversely multiseptate, 

with several swollen nodes of conidiophore rejuvenation (up to 

12 µm diam). Conidiogenous cells terminal, cylindrical, medium 

brown, smooth, ends swollen or not, central locus somewhat 

darkened or inconspicuous, 15–40 × 5–6(–7) µm. Conidia 

medium brown, obclavate to subcylindrical, straight to slightly 

curved, thick-walled, (3–)4–6(–10)-distoseptate, basal locus 

thickened, darkened, protruding, 2–3 µm diam, (35–)70–110(– 

170) × (6–)7–8(–11) µm. 

Culture characteristics: Colonies erumpent, spreading with moderate 

aerial mycelium and smooth, even margin; reaching 25 mm diam 

after 2 wk. On MEA surface dirty white, reverse cinnamon. On PDA 

surface dirty white, reverse buff to rosy buff with diffuse rosy buff 

pigment. On OA surface dirty white with diffuse rosy buff pigment 

in agar. 

Specimen examined: South Africa, Western Cape Province, Helderberg Nature 

Reserve, from the leaves of Leucadendron sp. (Proteaceae), 14 Aug. 2000, S. Lee 

(holotype CBS H-21323, culture ex-type CBS 135133 = CPC 19345). 

Notes: This species was not treated by Marincowitz et al. (2008), 

and presently no species of Corynespora are known from 

Leucadendron. Furthermore, based on conidial morphology, none 

of the species treated by Ellis (1971, 1976) resemble C. leucadendri, 

nor is it similar to any Corynespora sequence presently deposited 

in GenBank. For these reasons we thus introduce C. leucadendri 

as a new taxon. 

Clade 43: Setoseptoria 

Setoseptoria Quaedvlieg, Verkley & Crous, gen. nov. 


Etymology: Named after its conidiomata which are septoria-like, 

but setose. 

Conidiomata pycnidial, brown, immersed, globose with central 

ostiole, somewhat papillate, apical erumpent part at times with 

brown, verruculose to warty setae; wall of 6–8 layers of brown 

textura angularis; inner layer of 6–10 layers of hyaline textura 

angularis. Conidiophores lining the inner cavity, reduced to 

conidiogenous cells, or with one supporting cell. Conidiogenous 

cells hyaline, smooth, subcylindrical to doliiform; apical region with 

several inconspicuous percurrent proliferations, or with periclinal 

thickening; collarette inconspicuous, or prominent, flared. Conidia 

hyaline, smooth, becoming somewhat olivaceous and verruculose 

in older cultures, subcylindrical, tapering in apical part to obtuse or 

subobtuse apex, base truncate, transversely euseptate, straight to 

somewhat curved, mostly with one large central guttule per cell, 

older conidia becoming constricted at septa, disarticulating into 

phragmospores. 

Fig. 98. Conidia and conidiogenous loci of Corynespora leucadendri (CBS 135133). 


Type species: Setoseptoria phragmites Quaedvlieg, Verkley & 

Crous. 

Fig. 99. Corynespora leucadendri (CBS 135133). A–C. Conidiogenous cells giving rise to conidia. D. Conidia. Scale bars = 10 µm. 

382


Fig. 100. Setoseptoria phragmitis (CBS 114802). Conidioma sporulating in culture. B. Setae. C, D. Conidiogenous cells. E. Conidia. Scale bars = 10 µm. 

Setoseptoria phragmitis Quaedvlieg, Verkley & Crous, sp. 



Phragmites. 


immersed, globose with central ostiole, up to 30 µm diam, 

somewhat papillate, up to 200 µm diam, apical erumpent part at 

times with brown, verruculose to warty setae; wall of 6–8 layers 

of brown textura angularis; inner layer of 6–10 layers of hyaline 

textura angularis. Conidiophores lining the inner cavity, reduced to 

conidiogenous cells, or with one supporting cell. Conidiogenous 

cells hyaline, smooth, subcylindrical to doliiform, 7–12 × 3–4 µm; 

apical region with several inconspicuous percurrent proliferations, 

or with periclinal thickening; collarette inconspicuous, or prominent, 

flared. Conidia hyaline, smooth, becoming somewhat olivaceous 

and verruculose in older cultures, subcylindrical, (1–)3-septate, 

(19–)25–35(–38) × (3.5–)4 µm, tapering in apical part to obtuse 

or subobtuse apex, base truncate, 1.5–2.5 µm diam, straight to 

somewhat curved, mostly with one large central guttule per cell, 

older conidia becoming constricted at septa, disarticulating into 

phragmospores. 

Culture characteristics: Colonies on PDA umbonate, round, fluffy 

grey white aerial mycelium on the younger parts with longer grey 

blackish tufts on the older parts, surface olivaceous-black to buff at 

the younger mycelium, reverse olivaceous-black at the older parts 

to buff at the younger mycelium, after 14 days 6 cm diam; on MEA 

similar toPDA but after 14 d, 7 cm diam; on OA similar to PDA. 

Specimens examined: Hong Kong, Mai Po Mangrove, from the leaves of 

Phragmites australis (Poaceae), 12 Mar. 1998, K.D. Hyde (holotype CBS H-21324, 

culture ex-type CBS 114802 = HKUCC 2689); ibid., 3 Feb. 2000, K.D. Hyde (CBS 

114966 = HKUCC 6029). 

Notes: Setoseptoria needs to be compared to Dearnessia and 

Trichoseptoria (see above). The genus Trichoseptoria is poorly 

known, and details about its conidiogenesis is lacking, and thus 

it cannot be compared until it has been recollected. Setoseptoria 

is distinct from Dearnessia in that it has conidiogenous cells with 

prominent percurrent proliferation, and conidia that tend to become 

olivaceous and verruculose in older cultures, and disarticulate into 

phragmospores. Several Septoria species have been described 

from Phragmites, including S. phragmitis (conidia 20–30 × 1.5–2 

µm), S. arundinacea (conidia 6–7-septate, 60–70 × 5–6 µm), S. 

curva (conidia 14–20 × 3.5–4.5 µm), and S. graminum (conidia 

multiseptate, 55–75 × 1–1.3 µm), all of which appear to differ from 

Setoseptoria phragmitis based on its conidial morphology. 

Clade 44: Septorioides 

Septorioides Quaedvlieg, Verkley & Crous, gen. nov. 


Etymology: Resembling the genus Septoria. 

Foliicolous. Conidiomata black, unilocular, globose, flattened, 

opening by means of irregular rupture; wall consisting of 6–10 layers 

of dark brown textura irregularis to angularis, exuding a crystal 

conidial mass. Paraphyses intermingled among conidiophores, 

hyaline, cylindrical, branched at base, septate with obtuse ends. 

Microconidia hyaline, smooth, cylindrical, mostly straight, apex 

obtuse, base truncate. Conidiophores reduced to conidiogenous 

cells or with a supporting cell. Conidiogenous cells lining the inner 

cavity in basal layer, hyaline, smooth, subcylindrical to ampulliform, 

giving rise to macro- and microconidia. Spermatia formed in 

conidiomata, cylindrical, hyaline, smooth, straight to curved. 

Macroconidia hyaline, smooth, guttulate, subcylindrical, straight to 

irregularly curved, tapering in apical cell to subobtuse apex, base 

truncate, transversely euseptate. 

Type species: Septorioides pini-thunbergii (S. Kaneko) Quaedvlieg, 


Septorioides pini-thunbergii (S. Kaneko) Quaedvlieg, 

Verkley & Crous, comb. nov. MycoBank MB804465. Fig. 

101. 

Basionym: Septoria pini-thunbergii S. Kaneko, Trans. Mycol. Soc. 

Japan 30(4): 463. 1989. 

Associated with needle blight, or isolated as endophyte. On PDA. 

Conidiomata black, unilocular, globose, flattened, up to 400 µm 

diam, opening by means of irregular rupture; wall consisting of 6–10 

layers of dark brown textura irregularis to angularis, exuding a crystal 

conidial mass. Paraphyses intermingled among conidiophores, 

hyaline, cylindrical, branched at base, septate with obtuse ends, 

2–2.5 µm diam, up to 80 µm long. Microconidia hyaline, smooth, 


383


Fig. 101. Septorioides pini-thunbergii (CBS 473.91). A. Colony sporulating on PDA. B. Spermatia. C–E. Conidiogenous cells. F. Conidia. Scale bars = 10 µm. 

cylindrical, mostly straight, apex obtuse, base truncate, 5–15 × 

2–2.5 µm. Conidiophores reduced to conidiogenous cells or with 

a supporting cell. Conidiogenous cells lining the inner cavity in 

basal layer, hyaline, smooth, subcylindrical to ampulliform, 10–15 

× 4–6 µm, giving rise to macro- and microconidia. Spermatia 

formed in conidiomata, cylindrical, hyaline, smooth, straight to 

curved, 3–7 × 2 µm. Macroconidia hyaline, smooth, guttulate, 

subcylindrical, straight to irregularly curved, tapering in apical cell 

to subobtuse apex, base truncate, (60–)70–80(–110) × 3.5(–4) µm, 

(1–)3–6(–10)-septate. 

Specimen examined: Japan, Akita Prefecture, Tenno-cho, on needles of Pinus 

thunbergii (Pinaceae), Aug. 1984, S. Kaneko & Y. Zinno, culture ex-type of Septoria 

pini-thunberghii (CBS 473.91). 

Note: Septorioides is distinguished from Septoria by having 

conidiomata that open by means of an irregular split (acervular), 

and having paraphyses intermingled among its conidiophores. 

Septorioides pini-thunbergii was originally described from blighted 

needles of Pinus thunbergii in Japan (Kaneko et al. 1989). It was 

also recently isolated as endophyte from needles of P. densiflora in 

Korea (Yoo & Eom 2012). 

Clade 45: Phlyctema 

Phlyctema Desm., Ann. Sci. Nat., Sér. 3, 8: 16. 1847. 

= Allantozythia Höhn., Mykol. Unters. 3: 322. 1923. 

hyaline conidiophores, and phialidic conidiogenous cells that give 

rise to hyaline, aseptate, fusiform, straight to curved conidia. The 

genus has more than 80 names, and is in need of revision. . The 

type species is linked to a sexual morph known as Neofabraea alba 

(Verkley 1999). 

Phlyctema vincetoxici Quaedvlieg, Verkley & Crous, sp. 



Vincetoxicum. 

Conidiomata immersed, separate, eustromatic, unilocular, 

convulated, opening by irregular rupture, becoming acervular 

to sporodochial, up to 450 µm diam; wall of 3–6 layers of brown 

textura angularis; outer surface covered in brown, warty hyphae. 

Conidiophores hyaline, smooth, subcylindrical, lining the inner 

layer, branched, 1–4-septate, 15–50 × 4–5 µm. Conidiogenous 

cells phialidic, hyaline, smooth, subcylindrical to cymbiform or 

doliiform, with apical periclinal thickening and minute, non-flaring 

collarette, 7–18 × 3.5–5 µm. Conidia hyaline, smooth, guttulate, 

aseptate, fusiform, curved, tapering to subobtuse apex and truncate 

base, (27–)33–37(–40) × 3(–3.5) µm. 


eustromatic, immersed, erumpent, sporodochial, separate, yellowish 

brown, pulvinate, circular, unilocular but convoluted, thick-walled; 

wall of textura angularis, darker brown and thicker-walled at base 

than at the sides. Ostiole absent, dehiscence by irregular rupture. 

Conidiophores hyaline, septate, branched irregularly, cylindrical to 

filiform, formed from the wall lining the conidiomata. Conidiogenous 

cells enteroblastic, phialidic, integrated or discrete, determinate, 

hyaline, with minute collarette and periclinal thickening. Conidia 

hyaline, aseptate, fusiform, eguttulate, straight to slightly curved or 

irregular (Sutton 1980). 

Type species: P. vagabunda Desm., Ann. Sci. Nat., Bot., Sér. 3, 8: 

16. 1847. 

Notes: Phlyctema is characterised by having eustromatic, 

convulated, pulvinate to sporodochial conidiomata, branched, 

Fig. 102. Conidia and conidiogenous cells of Phlyctema vincetoxici (CBS 123727). 


384


Fig. 103. Phlyctema vincetoxici (CBS 123727). A. Colonies forming on OA. B, C. Conidiogenous cells. D. Conidia. Scale bars = 10 µm. 

Culture characteristics: Colonies on PDA flat, circular, with sparse, 

white aerial mycelium, surface dark-brick, reverse greyish sepia, 

after 14 d, 7 cm diam; on MEA undulate, lacking aerial mycelium, 

after 14 d, 6 cm diam; on OA flat, circular, lacking aerial mycelium, 

after 14 d, 8.5 cm diam. 

Specimen examined: Czech Republic, Moravia, Podyji National Park, Masovice, 

Klinka area, on leaves of Vincetoxicum officinale (Asclepiadaceae), 17 Sep. 2008, 

G. Verkley (holotype CBS H-21325, culture ex-type CBS 123727 = V6015.2). 

Notes: No species of Phlyctema has thus far been described on 

Vincetoxicum. Septoria vincetoxici (conidia 30–50 × 1–1.5 µm; 

Saccardo 1884) has somewhat longer, narrower conidia. Phlyctema 

vincetoxici was found sporulating in leaf spots showing numerous 

hypophyllous teleospore sori of the rust fungus Cronartium 

flaccidum (identified by H.A. van der Aa). 

Clade 46: Kirstenboschia 

Kirstenboschia Quaedvlieg, Verkley & Crous, gen. nov. 


Etymology: Kirstenbosch National Botanical Garden is one of the 

most acclaimed botanical gardens of the world, set against the foot 

of Cape Town’s Table Mountain. With more than 7000 plant species, 

it has also proven to be a source of numerous undescribed fungal 

species. Kirstenbosch was established in 1913, and to celebrate its 

centenary (2013), the fungal genus Kirstenboschia is named after 

this beautiful garden. 

Kirstenboschia diospyri Quaedvlieg, Verkley & Crous, sp. 



Diospyros. 

Conidiomata erumpent, sporodochial, up to 300 µm diam, separate, 

appearing creamy to pale yellow when sporulating on SNA with 

barley leaves, with slightly raised outer margin of 3–10 layers of 

textura intricata. Conidiophores lining the inner cavity, hyaline, 

smooth, 0–4-septate, subcylindrical, branched below and above, 

5–15 × 2–4 µm. Conidiogenous cells 5–10 × 2–3 µm, terminal and 

lateral, hyaline, smooth, ampulliform to subcylindrical, proliferating 

sympodially, apical loci truncate, at times appearing subdenticulate, 

1 µm diam. Conidia solitary, hyaline, scolecosporous, smooth, 

granular, thin-walled, acicular to narrowly obclavate with subobtuse 

apex and truncate to long obconically truncate base, 3-septate, 

irregularly curved, (40–)60–70(–75) × (1.5–)2 µm. 

Culture characteristics: Colonies on PDA erumpent, with moderate 

aerial mycelium, and smooth, lobate margin; surface and reverse 

dirty white. On OA dirty white with diffuse brown pigment in agar. 

On MEA surface folded, irregular, strongly erumpent, dirty white, 

reverse sienna. 

Foliicolous. Conidiomata erumpent, sporodochial, separate, with 

slightly raised outer margin of 3–10 layers of textura intricata. 

Conidiophores lining the inner cavity, hyaline, smooth, septate, 

subcylindrical, branched below and above. Conidiogenous cells 

terminal and lateral, hyaline, smooth, ampulliform to subcylindrical, 

proliferating sympodially, apical loci truncate, at times appearing 

subdenticulate. Conidia solitary, hyaline, scolecosporous, smooth, 

granular, thin-walled, acicular to narrowly obclavate with subobtuse 

apex and truncate to long obconically truncate base, 3-septate, 

irregularly curved. 

Type species: K. diospyri Quaedvlieg, Verkley & Crous. 

Fig. 104. Conidia and conidiogenous cells of Kirstenboschia diospyri (CBS 134911). 



385


Fig. 105. Kirstenboschia diospyri (CBS 134911). A. Conidiomata forming in culture. B, C. Conidiogenous cells. D. Conidia. Scale bars: A = 300 µm, all others = 10 µm. 

Specimen examined: South Africa, Western Cape Province, Kirstenbosch Botanical 

Garden, on leaves of Diospyros whyteana (Ebenaceae), 9 Aug. 2011, P.W. Crous 

(holotype CBS H-21326, culture ex-type CBS 134911 = CPC 19869). 

Note: Kirstenboschia is distinguished from Septoria s. str. and 

allied genera based on its distinctive, sporodochial conidiomata, 

and conidiogenous cells that proliferate sympodially, but at times 

are subdenticulate. 

Clade 47: Phlogicylindrium 

Phlogicylindrium Crous, Summerb. & Summerell, Fungal 

Diversity 23: 340. 2006. 

Foliicolous. Conidiomata synnematal to sporodochial, pale brown. 

Macroconidiophores arising from a brown stroma of 3–6 layers 

of textura angularis, giving rise to subcylindrical, hyaline (dark 

brown at the base), smooth, frequently branched conidiophores, 

0–2(–6)-septate. Macroconidiogenous cells hyaline, smooth, 

subcylindrical, proliferating sympodially and percurrently near 

apex. Macroconidia hyaline, smooth, subcylindrical, transversely 

septate, apex obtusely rounded, base truncate, slightly 

curved. Microconidia formed in acervular conidiomata together 

with macroconidia. Microconidiophores intermingled among 

macroconidiophores, hyaline, smooth, subcylindrical, branched, 

1–4-septate. Microconidiogenous cells terminal and lateral, 

hyaline, smooth, ampulliform, phialidic, solitary or in penicillate 

clusters. Microconidia hyaline, smooth, hamate, curved, apex 

subobtuse, base truncate, widest in upper third, aseptate 

(Summerell et al. 2006). 

subcylindrical, 10–15 × 2–4 μm, proliferating sympodially 

and percurrently near apex. Macroconidia hyaline, smooth, 

subcylindrical, 1(–3)-septate, apex obtusely rounded, base 

truncate, slightly curved, (27–)40–50(–55) × 2–2.5(–3) μm. 

Microconidia formed in acervular conidiomata together with 

macroconidia. Microconidiophores intermingled among 

macroconidiophores, hyaline, smooth, subcylindrical, branched, 

1–4-septate, 20–40 × 2–2.5 µm. Microconidiogenous cells 

terminal and lateral, hyaline, smooth, ampulliform, phialidic, 

5–16 × 2–2.5 µm, solitary or in penicillate clusters of up to 3. 

Microconidia hyaline, smooth, hamate, curved, apex subobtuse, 

base truncate, widest in upper third, aseptate, (16–)17–20(–24) 

1.5(–2) µm. 

Specimens examined: Australia, Victoria, Otway Ranges, (near Gellibrand), 

latitude: -38.568412, longitude: 143.539586, elevation: 175 m, on leaves of 

Eucalyptus globulus (Myrtaceae), Sep. 2005, I. Smith, holotype CBS H-19771, 

cultures ex-type CPC 12429 = CBS 120221; New South Wales, on leaves of E. 

nitens, 22 Nov. 1996, P.W. Crous (CBS 111689 = CPC 1547 = STE-U 1547). 

Notes: The present strain represents the second collection of this 

fungus. Isolates from this collection formed a microconidial state 

not observed in the type (Crous et al. 2007c), and novel for species 

of Phlogicylindrium. 

Type species: P. eucalypti Crous, Summerb. & Summerell, Fungal 

Diversity 23: 340. 2006. 

Phlogicylindrium eucalyptorum Crous, Fungal Planet 20. 

2007. Figs 106, 107. 

On OA. Conidiomata synnematal to sporodochial, pale 

brown up to 300 μm diam. Macroconidiophores arising from 

a brown stroma of 3–6 layers of textura angularis, giving rise 

to subcylindrical, hyaline (dark brown at the base), smooth, 

frequently branched conidiophores, 0–2(–6)-septate, 15–25(– 

45) × 3–4 μm. Macroconidiogenous cells hyaline, smooth, 

Fig. 106. Macro- and microconidia and conidiogenous cells of Phlogicylindrium 

eucalyptorum (CBS 111689). Scale bars = 10 µm. 

386


Fig. 107. Phlogicylindrium eucalyptorum (CBS 111689). A. Colony on OA. B, E. Microcyclic conidiation with macro- and macroconidia. C. Macroconidiogenous cells. D. 

Microconidia. F. Macroconidia. Scale bars = 10 µm. 

DISCUSSION 

The main question considered in the present study was: what is 

Septoria? To address this we included 370 isolates representing 

170 species, sampled from six continents. Furthermore, we 

also generated several phylogenetic datasets based on partial 

sequences of the ITS, LSU, Btub, RPB2 and EF-1α loci. In the 

final analysis, it was clear that Septoria is a well-defined genus 

and phylogenetic clade, with pycnidial, ostiolate conidiomata, 

conidiophores reduced to conidiogenous cells that proliferate 

sympodially, and hyaline, filiform conidia with transverse eusepta, 

fitting the original concept of Sutton (1980). However, when host 

material has been incubated for a while, several pycnidial species 

tend to form acervuli (also not clearly defined when studied in 

culture on normal agar media), and conidiogenous cells could 

have a combination of sympodial and percurrent proliferation (as 

observed in Pseudocercospora; Crous et al. 2013). 

The present study, including that of Verkley et al. (2013) 

defined an additional 15 genera that were formerly treated as 

“septoria” in the widest sense. Although it has recently been shown 

that Phoma is a generic complex representing many morphologic 

and phylogenetic genera (Aveskamp et al. 2010, de Gruyter et al. 

2010, 2013), this was not expected to also be the case for Septoria. 

Furthermore, many of the septoria-like genera discussed earlier in 

this paper are presently still not known from sequence, and thus 

their phylogeny remains to be resolved, meaning that they could 

add futher entities to the list of acknowledged septoria-like genera. 

Although Septoria s. str. is a genus in the Mycosphaerellaceae 

(Capnodiales), several of the septoria-like genera clustered outside 

this family. Species of Septoria are morphologically conserved, 

and in the past many taxa were identified based on host, which 

has been shown to be unreliable (see Verkley et al. 2013), as 

several taxa have wide host ranges. Another complication revealed 

in the present study is that many septoria-like genera cluster in 

different phylogenetic clades, but have still retained the Septoria 

morphological characters, which means that as in Phoma, future 

identifications in this complex will also have to rely on DNA 

sequence data to support morphological conclusions. 

The genus Stagonospora has always been separated from 

Septoria on the basis that Septoria has conidiogenous cells with 

sympodial proliferation, whereas in Stagonospora they proliferate 

percurrently. As shown in the present study, however, conidiogenesis 

is far too broad a feature to define all genera that express these modes 

of proliferation in their conidiogenous cells. Stagonospora, which is 

based on S. paludosa, was epitypified in this study, and shown to 

cluster apart from Septoria s. str. Another major surprise lies in the fact 

that Septoria nodorum blotch, caused by “Stagonospora” nodorum, 

clusters in a distinct genus, unrelated to Stagonospora s. str., and 

also separate from Phaeosphaeria s. str. A repercussion from these 

findings is the fact that the common cereal pathogens, which are 

neither Stagonospora, Septoria, Phaeosphaeria or Leptosphaeria 

(see de Gruyter et al. 2013), now have to be accommodated in 

a new genus, Parastagonospora. Furthermore, it appears that 

Stagonospora s. str. occurs on Poaceae, but has thus far only been 

confirmed from Carex, though further sampling will undoubtedly 

extend the host range of this genus. Parastagonospora is thus a 

novel, distinct stagonospora-like genus, which has sexual morphs 

that are phaeosphaeria-like in morphology, thus quite unlike those of 

Stagonospora s. str., which are more didymella-like in morphology. 

The genus Phaeosphaeria is based on P. oryzae (asexual 

morph Phaeoseptoria oryzae), for which we could designate 

an epitype in this study. Furthermore, we also recollected the 

type species of Phaeoseptoria, P. papayae, for which we also 

designated an epitype. As expected, Phaeoseptoria clusters with 

Phaeosphaeria, for which we choose the name of the sexual 

morph, Phaeosphaeria, on the basis that it is clearly resolved, 

and well established in literature. In contrast, Phaeoseptoria has 

in recent years become a muddled concept harbouring unrelated 

coelomycetes with pigmented conidia. 

Obtaining a culture of Cytostagonospora martiniana clarified 

the phylogenetic position of the genus as distinct from Septoria, 

resolving the difference of opinion between von Arx (1983), who 

regarded it as synonym of Septoria, versus Sutton (1980), who 


387


retained it as separate genus. Of interest is the unique mode of 

conidiogenesis, ranging from holoblastic sympodial to polyphialides 

with periclinal thickening to percurrent proliferation. It should be 

noted, however, that although this is a distinct genus, C. mariniana 

is not the type of Cytostagonospora, and C. photiniicola (occurring 

on Photinia serrulata, Austria) will have to be recollected to confirm 

that these two fungi are congeneric. 

The genus Phloeospora (based on P. ulmi) has for long been 

assumed to be a synonym of Septoria based on morphology. It 

is thus good to finally see it resolved as separate phylogenetic 

lineage, which is also supported morphologically based on its 

acervular conidiomata and conidiogenous cells with prominent 

percurrent proliferation. In spite of resolving 21 genera, several 

lineages remain unresolved, and are simply treated as “septorialike” 

awaiting the recollection of additional material. 

It is surprising that so many of the cereal pathogens actually 

have a confused taxonomy. Eyespot disease of wheat, formely 

treated as Tapesia (Ramulispora asexual states), was shown to 

represent a distinct genus Oculimacula (Helgardia asexual states) 

(Crous et al. 2003), while Quaedvlieg et al. (2011) determined that 

Septoria tritici blotch, caused by “Septoria” tritici, is in fact better 

accommodated in a new genus, Zymoseptoria, which appears 

to be restricted to members of Poaceae. The present study also 

resolved the phylogenetic position of Septoria nodorum blotch, which 

proved to not represent a member of Septoria, Stagonospora, or 

Phaeosphaeria, but to represent a distinct genus, described here 

as Parastagonospora. Clearly more attention should be directed 

towards resolving the taxonomy of the pathogens of agricultural 

crops of major economic importance in future, as these findings 

also have implications for genomic studies, where organisms from 

different genera, and even families get compared to one another, 

and new evolutionary hypotheses are proposed on the assumption 

that these taxa are congeneric. To clarify the taxonomy of well-known 

plant pathogens, however, many species will have to be recollected, 

and epitypified, so that authentic cultures and DNA barcodes will 

become available to fix the genetic application of these names. 

General conclusions 

The genus Septoria is defined by having pycnidial to acervular 

conidiomata, and hyaline conidiophores that give rise to 

conidiogenous cells that proliferate sympodially and percurrently, 

forming hyaline, filiform conidia with transverse eusepta. Many 

species have wide host ranges, and host occurrence should not be 

used as primary character for identification (see Verkley et al. 2013, 

this issue). Although species of Septoria and several of the novel 

genera introduced here have mycosphaerella-like sexual states, 

the name Mycosphaerella is restricted to the genus Ramularia, and 

is unavailable for species of Septoria and related genera. 


We thank the technical staff, Arien van Iperen (cultures), and Marjan Vermaas 

(photographic plates), for their invaluable assistance. The research leading to 

these results has received funding from the European Community’s Seventh 

Framework Program (FP7/2007–2013)/grant agreement no. 226482 (Project: QBOL 

- Development of a new diagnostic tool using DNA barcoding to identify quarantine 

organisms in support of plant health) by the European Commission under the theme 

“Development of new diagnostic methods in support of Plant Health policy” (no. 

KBBE-2008-1-4-01). Special thanks also go to Dr Ellen van Agtmaal who prepared 

the line drawings included in this paper from photomicrographs and published 

materials (Sutton 1980) using Adobe Photoshop CS3. 

REFERENCES 

Aptroot A (2006). Mycosphaerella and its anamorphs. 2, Conspectus of 

Mycosphaerella. CBS Biodiversity Series 5. CBS-KNAW Fungal Biodiversity 


Arx JA von (1983). Mycosphaerella and its anamorphs. Proceedings of the 

Koninklijke Nederlandse Akademie van Wetenschappen Series C-Biological 

and Medical Sciences 86(1): 15–54. 

Arzanlou M, Crous PW (2006). Phaeosphaeriopsis musae. Fungal Planet 9. CBS- 

KNAW Fungal Biodiversity Centre, Utrecht, The Netherlands. 

Aveskamp M, Gruyter H de, Woudenberg J, Verkley G, Crous PW (2010). Highlights 

of the Didymellaceae: A polyphasic approach to characterise Phoma and 

related pleosporalean genera. Studies in Mycology 65: 1–60. 

Barnes I, Crous PW, Wingfield BD, Wingfield MJ (2004). Multigene phylogenies 

reveal that red band needle blight of Pinus is caused by two distinct species of 

Dothistroma, D. septosporum and D. pini. Studies in Mycology 50: 551–565. 

Beach WS (1919). Biologic specialization in the genus Septoria. American Journal 

of Botany 6: 1–32. 

Bedlan G (2011). Septoria juliae sp. nov. – a new Septoria species on Nerium 

oleander. Journal für Kulturpflanzen 63: 430–431. 

Bissett J (1982). Stagonospora avenae. Fungi Canadenses 239. National 

Mycological Herbarium, Biosystematics Research Institute, Agriculture 

Canada, Ottawa. 

Braun U (1990). Taxonomic problems of the Ramularia / Cercosporella complex. 






Câmara MPS, Ramaley AW, Castlebury LA, Palm ME (2003). Neophaeosphaeria 

and Phaeosphaeriopsis , segregates of Paraphaeosphaeria. Mycological 

Research 107: 516–522. 






Constantinescu O (1984). Taxonomic revision of Septoria-like fungi parasitic on 

Betulaceae. Transactions of the British Mycological Society 83: 383–398. 


spot diseases of Eucalyptus. Mycologia Memoir 21. APS Press, MN, USA. 

Crous PW, Braun U (2003). Mycosphaerella and its anamorphs: 1. Names published 

in Cercospora and Passalora. CBS Biodiversity Series 1. CBS-KNAW Fungal 

Biodiversity Centre, Utrecht, The Netherlands. 

Crous PW, Braun U, Groenewald JZ (2007a). Mycosphaerella is polyphyletic. 


Crous PW, Braun U, Hunter GC, Wingfield MJ, Verkley GJM, et al. (2013). 

Phylogenetic lineages in Pseudocercospora. Studies in Mycology 75: 37–114. 

Crous PW, Braun U, Schubert K, Groenewald JZ (2007b). Delimiting Cladosporium 

from morphologically similar genera. Studies in Mycology 58: 33–56. 

Crous PW, Ferreira FA, Sutton BC (1997). A comparison of the fungal genera 

Phaeophleospora and Kirramyces (coelomycetes). South African Journal of 

Botany 63: 111–115. 

Crous PW, Groenewald JZ, Gams W (2003). Eyespot of cereals revisited: ITS 

phylogeny reveals new species relationships. European Journal of Plant 

Pathology 109: 841–850. 

Crous PW, Groenewald JZ, Smith IW (2007c). Phlogicylindrium eucalyptorum. 

Fungal Planet 20. CBS-KNAW Fungal Biodiversity Centre, Utrecht, The 

Netherlands. 

Crous PW, Kang JC, Braun U (2001). A phylogenetic redefinition of anamorph 

genera in Mycosphaerella based on ITS rDNA sequence and morphology. 

Mycologia 93: 1081–1101. 

Crous PW, Schoch CL, Hyde KD, Wood AR, Gueidan C, et al. (2009a). Phylogenetic 


Crous PW, Shivas RG, Wingfield MJ, Summerell BA, Rossman AY, et al. (2012a). 

Fungal Planet description sheets 128–127. Persoonia 29: 138–153. 

Crous PW, Slippers B, Wingfield MJ, Rheeder J, Marasas WFO, et al. (2006). 

Phylogenetic lineages in the Botryosphaeriaceae. Studies in Mycology 55: 

235–253. 

Crous PW, Summerell BA, Carnegie AJ, Wingfield MJ, Groenewald JZ (2009b). 

Novel species of Mycosphaerellaceae and Teratosphaeriaceae. Persoonia 23: 

119–146. 

Crous PW, Summerell BA, Carnegie AJ, Wingfield MJ, Hunter GC, et al. (2009c). 

Unravelling Mycosphaerella: do you believe in genera? Persoonia 23: 99–118. 

Crous PW, Tanaka K, Summerell BA, Groenewald JZ (2011). Additions to the 

Mycosphaerella complex. IMA Fungus 2: 49–64. 

388


Crous PW, Verkley GJM, Christensen M, Castañeda-Ruiz RF, Groenewald JZ 

(2012b). How important are conidial appendages? Persoonia 28: 126–137. 

Crous PW, Verkley GJM, Groenewald JZ, Samson RA (2009d). CBS Laboratory 

Manual Series 1. CBS-KNAW Fungal Biodiversity Centre, Utrecht, The 

Netherlands. 

Crous PW, Wingfield MJ, Park RF (1991). Mycosphaerella nubilosa a synonym of M. 

molleriana. Mycological Research 95: 628–632. 

Cunfer BM (2000). Stagonospora and Septoria diseases of barley, oat, and rye. 

Canadian Journal of Plant Pathology 22: 332–348. 

Cunfer BM, Ueng PP (1999). Taxonomy and identification of Septoria and 

Stagonospora species on small-grain cereals. Annual Review of Phytopathology 

37: 267–284. 

Deighton FC (1987). New species of Pseudocercospora and Mycovellosiella, and 

new combinations into Pseudocercospora and Phaeoramularia. Transactions 

of the British Mycological Society 88: 365–391. 

Demaree JB, Wilcox MS (1943). The fungus causing the so-called “Septoria leafspot 

disease” of raspberry. Phytopathology 33: 986–1003. 

Desmazières JBHJ (1847). Quatorzième notice sur les plantes cryptogames 

récemment découvertes en France. Annales des Sciences Naturelles 

Botanique, Série 3, 8: 9–37, 172–193. 

Donk MA (1964). Nomina conervana proposita. Deuteromycetes. Regnum 

Vegetable 34: 7–15. 

Dyko BJ, Sutton BC (1979). Two new and unusual deuteromycetes. Transactions of 

the British Mycological Society 72: 411–417. 

Ellis MB (1971). Dematiaceous Hyphomycetes. Commonwealth Mycological 


Ellis MB (1976). More Dematiaceous Hyphomycetes. Commonwealth Mycological 


Ellis MB, Ellis JP (1997). Microfungi on Land Plants – An Identification Handbook. 

Richmond Publishing, England. 

Eriksson OE (1967). On graminicolous pyrenomycetes from Fennoscandia I, II, Ill. 

Phragmosporous and scolecosporous species. Arkiv för Botanik Series 2, 6: 

381–440. 

Evans HC (1984). The genus Mycosphaerella and its anamorphs Cercoseptoria, 

Dothistroma and Lecanosticta on pines. Mycological Papers 153: 1–102. 

Eyal Z, Sharen AL, Prescott JM, Ginkel M van (1987). The Septoria diseases of 

wheat: concepts and methods of disease management. Mexico, DF, CIMMYT. 

Farr DF (1991). Septoria species on cornus. Mycologia 83: 611–623. 

Farr DF (1992). Species of Septoria on the Fabaceae, subfamily Faboidae, tribe 

Genistae. Sydowia 44: 13–31. 

Farr DF, Rossman AY (2013). Fungal Databases, Systematic Mycology and 

Microbiology Laboratory, ARS, USDA. Retrieved May 3, 2013, from http:// 

nt.ars-grin.gov/fungaldatabases/ 

Feau N, Hamelin RC, Bernier L (2006). Attributes and congruence of three molecular 

data sets: Inferring phylogenies among Septoria related species from woody 

perennial plants. Molecular Phylogenetics and Evolution 40: 808–829. 

Ferreira FA (1989). Patologia Florestal. Principais Doenças Florestais No Brasil. 

Sociedade de Investigaçoes Florestais, Viçosa, MG, Brasil. 

Frank J, Crous PW, Groenewald JZ, Oertel B, Hyde KD, et al. (2010). Microcyclospora 

and Microcyclosporella: novel genera accommodating epiphytic fungi causing 

sooty blotch on apple. Persoonia 24: 93–105. 

Fukuhara M (2002). Three Phaeosphaeria species and Paraphaeosphaeria michotii 

isolated from Phragmites leaves in Osaka, Japan. Mycoscience 43: 275–382. 

Golzar H, Wang C (2012). First report of Phaeosphaeriopsis glaucopunctata as the 

cause of leaf spot and nectrosis on Ruscus aculeatus in Australia. Australasian 

Plant Disease Notes 7: 13–15. 

Goodwin SB (2004). Minimum phylogenetic coverage: An additional criterion to 

guide the selection of microbial pathogens for initial genomic sequencing 

efforts. Phytopathology 94: 800–804. 

Greene HC (1961). Notes on Wisconsin parasitic fungi. XXVII. Wisconsin Academy 

of Sciences, Arts and Letters 50: 141–161. 

Groenewald JZ, Nakashima C, Nishikawa J, Shin H-D, Park J-H, et al. (2013). 

Species concepts in Cercospora: spotting the weeds among the roses. Studies 


Gruyter J de, Woudenberg JHC, Aveskamp MM, Verkley GJM, Groenewald JZ, Crous 

PW (2010). Systematic reappraisal of species in Phoma section Paraphoma, 

Pyrenochaeta and Pleurophoma. Mycologia 102: 1066–1081. 

Gruyter J de, Woudenberg JHC, Aveskamp MM, Verkley GJM, Groenewald JZ, 

Crous PW (2013). Redisposition of Phoma-like anamorphs in Pleosporales. 


Hall TA (1999). BioEdit: A user-friendly biological sequence alignment editor and 

analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 

95–98. 

Hawksworth DL, Crous PW, Redhead SA, Reynolds DR, Samson RA, et al. (2011). 

The Amsterdam Declaration on Fungal Nomenclature. IMA Fungus 2: 105–112. 



Inácio CA, Dianese JC (1998). Some foliicolous fungi on Tabebuia species. 

Mycological Research 102: 695–708. 

Jørstad I (1965). Septoria and septoroid fungi on dicotyleones in Norway. Oslo 

University Press, Oslo. 

Jørstad I (1967). Septoria and Septoroid fungi on Gramineae in Norway. Oslo 

University Press, Oslo. 

Kaneko S, Fujioka H, Zinno Y (1989). A new species of Septoria on Japanese black 

pine. Transactions of the Mycological Society of Japan 30: 463–466. 

Katoh K, Misawa K, Kuma K, Miyata T (2002). MAFFT: a novel method for rapid 

multiple sequence alignment based on fast Fourier transform. Nucleic Acids 

Research 30: 3059–3066. 

Lamprecht SC, Crous PW, Groenewald JZ, Tewoldemedhin YT, Marasas WFO 

(2011). Diaporthaceae associated with root rot of maize. IMA Fungus 2: 13–24. 

Lee S, Mel’nik V, Taylor JE, Crous PW (2004). Diversity of saprobic hyphomycetes 

on Proteaceae and Restionaceae from South Africa. Fungal Diversity 17: 

91–114. 

Li HY, Sun GY, Zhai XR, Batzer JC, Mayfield DA, et al. (2012). Dissoconiaceae 

associated with sooty blotch and flyspeck on fruits in China and the United 

States. Persoonia 28: 113–125. 

Liu JK, Phookamsak R, Mingkhuan M, Wikee S, Li YM, et al. (2012) Towards a 

natural classification of Botryosphaeriales. Fungal Diversity 57: 149–210. 

Liu Y, Whelen S, Hall B (1999). Phylogenetic relationships among ascomycetes: 

evidence from an RNA polymerse II subunit. Molecular Biology and Evolution 

16: 1799–1808. 

Lombard L, Crous PW, Wingfield BD, Wingfield MJ (2010). Species concepts in 


Marincowitz S, Crous PW, Groenewald JZ, Wingfield MJ (2008). Microfungi 

occurring on Proteaceae in the fynbos. CBS Biodiversity Series 7. CBS-KNAW 

Fungal Biodiversity Centre, Utrecht, The Netherlands. 

Mason-Gamer RJ, Kellogg EA (1996). Testing for phylogenetic conflict among 

molecular data sets in the tribe Triticeae (Gramineae). Systematic Biology 45: 

524–545. 

McDonald MC, Razavi M, Friesen TL, Brunner PC, McDonald BA (2012). 

Phylogenetic and population genetic analyses of Phaeosphaeria nodorum and 

its close relatives indicate cryptic species and an origin in the Fertile Crescent. 

Fungal Genetics and Biology 49: 882–895. 

Michaelides T, Morgan DP, Doster MA (1995). Foliar and fruit fungal diseases. In: 

Pistachio Production (L Ferguson, ed). Center for Fruit and Nut Crop Research 

and Information, Pomology Department, University of California, Davis CA.: 

148–159. 

Monod M (1983). Monographie taxonomique des gnomoniacées ascomycètes de 

l’ordre des Diaporthales. Sydowia 9: 1–315. 

Nag Raj TR (1993). Coelomycetous anamorphs with appendage-bearing conidia. 

Mycologue Publications, Waterloo, Ontario. 

Niekerk JM van, Groenewald JZ, Verkley GJM, Fourie PH, Wingfield MJ, Crous PW 

(2004). Systematic reappraisal of Coniella and Pilidiella, with specific reference 

to species occurring on Eucalyptus and Vitis in South Africa. Mycological 

Research 108: 283–303. 

Nylander JAA (2004). MrModeltest v2. Program distributed by the author. 

Evolutionary Biology Centre Uppsala University 2: 1–2. 


of the fungus causing Panama disease of banana: Concordant evidence from 



Petrak F (1957). Über die auf Aconitum vorkommenden Arten der gattung Septoria. 

Sydowia 11: 375–379. 

Petrak F, Sydow H (1927). Die Gattungen der Pyrenomyzeten, Sphaeropsideen 

und Melanconieen. 1. Teil. Die phaeosporen Sphaeropsideen und die Gattung 

Macrophoma. Repertorium specierum novarum regni vegetabilis, Beihefte Bd 

42. 

Phillips AJL, Alves A, Pennycook SR, Johnston PR, Ramaley A, et al. (2008). 

Resolving the phylogenetic and taxonomic status of dark-spored teleomorph 

genera in the Botryosphaeriaceae. Persoonia 21: 29–55. 

Priest MJ (2006). Fungi of Australia: Septoria. ABRS, Canberra: CSIRO publishing, 

Melbourne, Australia. 

Punithalingam E (1976). Septoria chrysanthemella. CMI Descriptions of Pathogenic 

Fungi and Bacteria 669. Commonwealth Mycological Institute, Kew, UK 

Quaedvlieg W, Groenewald JZ, de Jesús Yáñez-Morales M, Crous PW (2012). DNA 

barcoding of Mycosphaerella species of quarantine importance to Europe. 

Persoonia 29: 101–115. 

Quaedvlieg W, Kema GHJ, Groenewald JZ, Verkley GJM, Seifbarghi S, et al. (2011). 

Zymoseptoria gen. nov.: a new genus to accommodate Septoria-like species 

occurring on graminicolous hosts. Persoonia 26: 57–69. 


Kew, UK. 

Rogers DP (1949). Nomina conservanda proposita and nomina confusa – Fungi: 

Nomina conservanda. Farlowia 3: 425–493. 


389


Saccardo PA (1884). Sylloge Fungorum: Sylloge Sphaeropsidearum et 

Melanconiearum 3: 542. Padova, Italy. 

Saccardo PA (1895). Sylloge Fungorum: Supplementum Universale, Pars III 11: 

542. Padova, Italy. 

Saccardo PA, Saccardo D (1906). Sylloge Fungorum: Supplementum Universale, 

Pars VII 18: 1–828. Padova, Italy. 

Saccardo PA, Trotter A (1913). Sylloge Fungorum: Supplementum Universale, Pars 

IX 22: 1–1612. Padova, Italy. 

Shin HD (1995). New fungal diseases of economic resource plants in Korea (II). 

Korean Journal of Plant Pathology 11: 120–131. 

Shin HD, Sameva EF (2002). Taxonomic notes on the genus Septoria in Korea (II). 

Mycotaxon 83: 287–300. 

Shin HD, Sameva EF (2004). Septoria in Korea. National Institute of Agricultural 

Science and Technology, Republic of Korea. 

Shoemaker RA, Babcock CE (1989). Phaeosphaeria. Canadian Journal of Botany 

67: 1500–1599. 

Sivanesan A (1984). The Bitunicate Ascomycetes and their anamorphs. J. Cramer, 

Vaduz, Germany. 

Solomon PS, Lowe RGT, Tan KC, Waters ODC, Oliver RP (2006). Stagonospora 

nodorum: cause of stagonospora nodorum blotch of wheat. Molecular Plant 

Pathology 7: 147–156. 

Stukenbrock EH, Quaedvlieg W, Javan-Nikhah M, Zala M, Crous PW, McDonald 

BA (2012). Zymoseptoria ardabilia and Z. pseudotritici, two progenitor species 

of the septoria tritici leaf blotch fungus Z. tritici (synonym: Mycosphaerella 

graminicola). Mycologia 104: 1397–1407. 

Summerell BA, Groenewald JZ, Carnegie AJ, Summerbell RC, Crous PW (2006). 

Eucalyptus microfungi known from culture. 2. Alysidiella, Fusculina and 

Phlogicylindrium genera nova, with notes on some other poorly known taxa. 

Fungal Diversity 23: 323–350. 

Sutton B, Pollack F (1974). Microfungi on Cercocarpus. Mycopathologia 52: 331– 

351. 

Sutton BC, Pascoe IG (1987). Septoria species on Acacia. Transactions of the 


Sutton BC, Pascoe IG (1989). Some Septoria species on native Australian plants. 


Sutton BC, Swart HJ (1986). Australian leaf-inhabiting fungi XXIII. Colletogloeum 

species and similar fungi on Acacia. Transactions of the British Mycological 

Society 87: 93–102. 

Sutton BC (1964). Coelomycetes III. Annellolacinia gen. nov., Aristastoma, 

Phaecytostroma, Seimatosporium, etc. Mycological Papers 64. Commonwealth 

Mycological Institute, Kew, UK. 

Sutton BC (1977). Coelomycetes VI. Nomenclature of generic names proposed for 

Coelomycetes. Mycological Papers 141. Commonwealth Mycological Institute, 

Kew, UK. 

Sutton BC (1980). The coelomycetes. Fungi imperfecti with pycnidia, acervuli and 

stromata. Commonwealth Mycological Institute, Kew, UK. 

Teterevnikova-Babayan DN (1987). Fungi of the genus Septoria in the U.S.S.R. 

Akademiya Nauk Armyanskoi SSR, Yerevan. 

Verkley GJM (1999). A monograph of the genus Pezicula and its anamorphs. 




Verkley GJM, Crous PW, Groenewald JZ, Braun U, Aptroot A (2004a). Mycosphaerella 



Research 108: 1271–1282. 

Verkley GJM, Silva da M, Wicklow DT, Crous PW (2004b). Paraconiothyrium, a new 

genus to accommodate the mycoparasite Coniothyrium minitans, anamorphs of 

Paraphaeosphaeria, and four new species. Studies in Mycology 50: 323–335. 

Verkley GJM, Starink-Willemse M, van Iperen A, Abeln ECA (2004c). Phylogenetic 



Verkley GJM, Quaedvlieg W, Shin HD, Crous PW (2013). A new approach to species 

delimitation in Septoria. Studies in Mycology 75: 213–305. 

Vilgalys R, Hester M. 1990. Rapid genetic identification and mapping of 



Wakefield EM (1940). Nomina generica conservanda. Transactions of the British 

Mycological Society 24: 282–293. 

Walker J, Sutton BC, Pascoe IG (1992). Phaeoseptoria eucalypti and similar fungi 

on Eucalyptus, with description of Kirramyces gen. nov. (Coelomycetes). 

Mycological Research 96: 911–924. 


fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols: a guide to 


Academic Press, San Diego, California: 315–322. 

Wingfield MJ, De Beer ZW, Slippers B, Wingfield BD, Groenewald JZ, et al. (2012). 

One fungus, one name promotes progressive plant pathology. Molecular Plant 

Pathology 13: 604–613. 

Yoo J-J, Eom A-H (2012). Molecular identification of endophytic fungi isolated 

from needle leaves of conifers in Bohyeon Mountain, Korea. Mycobiology 40: 

231–235. 

Zhang Y, Crous PW, Schoch CL, Hyde KD (2012). Pleosporales. Fungal Diversity 

53: 1–221. 

390

INDEX OF FUNGAL NAMES 

Alphabetical list of fungal species, genera and families treated in 

the Taxonomy sections of the included manuscripts. 

A 

Acicuseptoria 376–377 

Acicuseptoria rumicis 376–377 

Allantozythia 384 

Allewia 183 

Allewia eureka 193 

Allewia proteae 193 

Alternaria 183, 186, 190, 193, 198, 207 

Alternaria abundans 189 

Alternaria acalyphicola 200 

Alternaria agerati 200 

Alternaria agripestis 200 

Alternaria allii 191 

Alternaria alternantherae 185 

Alternaria alternariae 206 

Alternaria alternarina 195 

Alternaria alternata 183, 185–186 

Alternaria anagallidis 200 

Alternaria angustiovoidea 187 

Alternaria anigozanthi 193 

Alternaria aragakii 200 

Alternaria araliae 199 

Alternaria arborescens 187, 201 

Alternaria arbusti 195 

Alternaria argyranthemi 207 

Alternaria argyroxiphii 200 

Alternaria armoraciae 189 

Alternaria aspera 201 

Alternaria atra 204 

Alternaria avenicola 198–199 

Alternaria axiaeriisporifera 193 

Alternaria bataticola 200 

Alternaria blumeae 200 

Alternaria bornmuelleri 206–207 

Alternaria botryospora 193 

Alternaria botrytis 206 

Alternaria brassicae 202, 204, 207 

Alternaria brassicae var. tabaci 187 

Alternaria brassicae-pekinensis 204 

Alternaria brassicicola 188, 197 

Alternaria breviramosa 189 

Alternaria burnsii 187 

Alternaria caespitosa 195 

Alternaria calendulae 200 

Alternaria californica 196 

Alternaria calycipyricola 198–199 

Alternaria cantlous 204 

Alternaria capsici 200–201 

Alternaria capsici-annui 206 

Alternaria caricis 197 

Alternaria carotiincultae 202 

Alternaria carthami 200 

Alternaria cassiae 200 

Alternaria celosiae 185 

Alternaria celosiicola 185 

Alternaria cerealis 187 

Alternaria cetera 188–189 

Alternaria chartarum 201 

Alternaria chartarum f. stemphylioides 201 

Alternaria cheiranthi 189 

Alternaria chlamydospora 190, 199 

Alternaria chlamydosporigena 190 

Alternaria “chlamydosporum” 199 

Alternaria chrysanthemi 204 

Alternaria cichorii 200 

Alternaria cinerariae 202 

Alternaria cinerea 207 

Alternaria cirsinoxia 200 

Alternaria citriarbusti 187 

Alternaria citrimacularis 187 

Alternaria colombiana 187 

Alternaria concatenata 201 

Alternaria conjuncta 196 

Alternaria conoidea 188 

Alternaria “consortiale” 204 

Alternaria consortialis 204 

Alternaria crassa 200 

Alternaria cretica 200 

Alternaria cucumerina 200 

Alternaria cucurbitae 204 

Alternaria cumini 193 

Alternaria cyphomandrae 201 

Alternaria danida 201 

Alternaria dauci 201 

Alternaria daucicaulis 196 

Alternaria daucifollii 187 

Alternaria dennisii 207 

Alternaria destruens 187 

Alternaria dianthicola 190, 193–194 

Alternaria dichondrae 201 

Alternaria didymospora 199 

Alternaria dumosa 187 

Alternaria elegans 190 

Alternaria ellipsoidea 189, 193 

Alternaria embellisia 190–191 

Alternaria eryngii 198–199 

Alternaria ethzedia 196 

Alternaria euphorbiicola 201 

Alternaria eureka 193 

Alternaria frumenti 196 

Alternaria fulva 207 

Alternaria gaisen 187 

Alternaria geniostomatis 193 

Alternaria gomphrenae 185 

Alternaria gossypii 189 

Alternaria gossypina 186 

Alternaria graminicola 196 

Alternaria grandis 201 

Alternaria grisae 186 

Alternaria grossulariae 186 

Alternaria gypsophilae 193 

Alternaria hawaiiensis 201 

Alternaria helianthiinficiens 207 

Alternaria “helianthinficiens” 207 

Alternaria herbiphorbicola 187 

Alternaria heterospora 204 

Alternaria hordeiaustralica 196 


391

Alternaria hordeicola 196 

Alternaria humuli 196 

Alternaria hyacinthi 193 

Alternaria incomplexa 196 

Alternaria indefessa 189 

Alternaria infectoria 194, 196, 198 

Alternaria intercepta 196 

Alternaria iridis 186 

Alternaria japonica 188, 197 

Alternaria juxtiseptata 193 

Alternaria kikuchiana 187 

Alternaria leptinellae 193 

Alternaria leucanthemi 204 

Alternaria limaciformis 199 

Alternaria limicola 201 

Alternaria limoniasperae 187 

Alternaria lini 186 

Alternaria linicola 201 

Alternaria lolii 193 

Alternaria longipedicellata 201 

Alternaria longipes 187 

Alternaria macrospora 201 

Alternaria malorum 189 

Alternaria malvae 186 

Alternaria maritima 186 

Alternaria matthiolae 197 

Alternaria merytae 196 

Alternaria metachromatica 196 

Alternaria mimicula 188 

Alternaria molesta 199 

Alternaria mouchaccae 199 

Alternaria multiformis 204 

Alternaria multirostrata 201 

Alternaria nelumbii 186 

Alternaria nepalensis 197 

Alternaria nitrimali 201 

Alternaria nobilis 193 

Alternaria novae-zelandiae 196 

Alternaria obclavata 189 

Alternaria obovoidea 204 

Alternaria oregonensis 196 

Alternaria oudemansii 206 

Alternaria oxytropis 207 

Alternaria panax 198–199 

Alternaria papavericola 190 

Alternaria papaveris 190 

Alternaria passiflorae 201 

Alternaria peglionii 194 

Alternaria penicillata 189–190 

Alternaria perangusta 187 

Alternaria perpunctulata 185 

Alternaria petroselini 202 

Alternaria photistica 194, 198–199 

Alternaria phragmospora 199 

Alternaria planifunda 193 

Alternaria poonensis 201 

Alternaria porri 199, 201 

Alternaria porri f.sp. cichorii 200 

Alternaria postmessia 187 

Alternaria proteae 193 

Alternaria protenta 201 

Alternaria pseudorostrata 201 

Alternaria radicina 201–202 

Alternaria radicina var. petroselini 202 

Alternaria resedae 186, 188–189 

Alternaria rhadina 186 

Alternaria ricini 201 

Alternaria rostellata 201 

Alternaria saponariae 193 

Alternaria scirpicola 197–198 

Alternaria scirpinfestans 198 

Alternaria scirpivora 198 

Alternaria scorzonerae 201 

Alternaria sect. Alternantherae 185 

Alternaria sect. Alternata 185–186, 200 

Alternaria sect. Brassicicola 188–189 

Alternaria sect. Chalastospora 188 

Alternaria sect. Cheiranthus 189 

Alternaria sect. Crivellia 189–190 

Alternaria sect. Dianthicola 190, 193–194 

Alternaria sect. Embellisia 190, 207 

Alternaria sect. Embellisioides 193 

Alternaria sect. Eureka 193 

Alternaria sect. Gypsophilae 193 

Alternaria sect. Infectoriae 194 

Alternaria sect. Japonicae 188, 197 

Alternaria sect. Nimbya 197 

Alternaria sect. Panax 194, 198 

Alternaria sect. Phragmosporae 199 

Alternaria sect. Porri 199–200 

Alternaria sect. Pseudoulocladium 201 

Alternaria sect. Radicina 201 

Alternaria sect. Sonchi 202 

Alternaria sect. Teretispora 202 

Alternaria sect. Ulocladioides 189–190, 201, 204, 206 

Alternaria sect. Ulocladium 204, 206 

Alternaria sect. Undifilum 206–207 

Alternaria selini 202 

Alternaria septorioides 188–189 

Alternaria septospora 201 

Alternaria sesami 201 

Alternaria simsimi 190 

Alternaria slovaca 196 

Alternaria smyrnii 202 

Alternaria solani 201, 204 

Alternaria solani-nigri 201 

Alternaria “solani-nigrii” 201 

Alternaria soliaridae 207 

Alternaria solidaccana 188 

Alternaria sonchi 202 

Alternaria stemphylioides 201 

Alternaria steviae 201 

Alternaria subcucurbitae 204 

Alternaria subcylindrica 201 

Alternaria tagetica 201 

Alternaria tangelonis 188 

Alternaria tellustris 191 

Alternaria tenuis 187 

Alternaria tenuissima 188 

Alternaria terricola 206 

Alternaria thalictrigena 207 

Alternaria tomato 186 

Alternaria tomatophila 201 

Alternaria toxicogenica 188 

392

Alternaria triglochinicola 193 

Alternaria triticimaculans 196 

Alternaria triticina 196 

Alternaria tropica 201 

Alternaria tuberculata 206 

Alternaria tumida 193 

Alternaria turkisafria 188 

Alternaria vaccariae 193–194 

Alternaria vaccariicola 193–194 

Alternaria ventricosa 196 

Alternaria viburni 196 

Alternaria zinniae 201 

Ancylospora 74 

Ancylospora costi 74 

Aphanofalx 360–361 

Aphanofalx irregularis 361 

Aphanofalx mali 361 

Apocytospora 21 

Apocytospora visci 22 

Aposphaeria corallinolutea 28 

Aposphaeria fusco-maculans 25 

Aposphaeria populina 29 

Aposphaeria pulviscula 25 

Ascochyta aceris 294 

Ascochyta campanulae 245 

Ascochyta caulina 24 

Ascochyta galeopsidis 260 

Ascochyta heraclei 260 

Ascochyta hyalospora 24 

Ascochyta lysimachiae 269 

Ascochyta obiones 25 

Ascochyta petroselini 277 

Ascochytula obiones 25 

Asperisporium caricae 370 

Asteroma tiliae 26 

Asteromella 255, 295 

Asteromella lupini 22 

Asteromella tiliae 27 

Asteromidium 334 

Asteromidium imperspicuum 334 

Aureobasidium slovacum 196 

B 

Bakerophoma tracheiphila 22 

Batcheloromyces 63 

Baudoinea 63 

Beverwykella pulmonaria 29 

Blumeriella jaapii 336 

Botryomyces 183 

Botryomyces caespitosus 195 

Botryosphaeria 374 

Brachycladium 183 

Brachycladium papaveris 190 

Brachycladium penicillatum 190 

Byssothecium circinans 28 

C 

Capnobotryella 63 

Carlia latebrosa 294 

Caryophylloseptoria 233, 349 


Caryophylloseptoria lychnidis 234, 349 

Caryophylloseptoria pseudolychnidis 235, 349 

Caryophylloseptoria silenes 235 

Caryophylloseptoria spergulae 236 

Catenulostroma 63 

Centrospora cantuariensis 61 

Cephalosporium chrysanthemi 21 

Cercocladospora 74 

Cercocladospora adinae 74 

Cercoseptoria 74 

Cercoseptoria balsaminae 79 

Cercoseptoria ligustrina 61 

Cercoseptoria pini-densiflorae 96 

Cercoseptoria pruni-persicae 99 

Cercoseptoria prunicola 98 

Cercoseptoria tinea 108 

Cercospora 67–68, 108, 144, 147–149, 151–152, 154–156, 

159, 161–165, 343, 350 

Cercospora abelmoschi 76 

Cercospora acaciae-mangii 164–165 

Cercospora achyranthis 143–144, 147, 159, 162 

Cercospora agavicola 144, 152, 162 

Cercospora albido-maculans 160 

Cercospora alchemillicola 144, 148, 158, 162–164, also see 

Cercospora cf. alchemillicola 

Cercospora althaeicola 144 

Cercospora althaeina 144, 146, 161, 164, 167 

Cercospora althaeina var. althaeae-officinalis 144 

Cercospora althaeina var. praecincta 144 

Cercospora amadelpha 92 

Cercospora angolensis 77 

Cercospora apii 144–145, 147–148, 153–154, 158, 160–161, 

163, 165, 167 

Cercospora apiicola 145, 165 

Cercospora araliae 78 

Cercospora armoraciae 144, 145–146, 148, 153, 161, 164, 167 

Cercospora “atramarginalis” 78 

Cercospora atriplicis 148 

Cercospora atrogrisea 146 

Cercospora atromaculans 78 

Cercospora atromarginalis 78 

Cercospora avicularis var. sagittati 159 

Cercospora barbareae 146 

Cercospora batatae 108 

Cercospora berteroae 146 

Cercospora beticola 145, 146–147, 152–153, 160, 165 

Cercospora bizzozeriana 146 

Cercospora bizzozeriana var. drabae 146 

Cercospora bondarzevii 148 

Cercospora brassicicola 146 

Cercospora bremeri 106 

Cercospora brunkii 147, also see Cercospora cf. brunkii 

Cercospora callicarpae 79 

Cercospora callicarpicola 79 

Cercospora camarae 146 

Cercospora campi-silii 147, 159, 162 

Cercospora canescens 147–148, 165–166 

Cercospora cantuariensis 61 

Cercospora capreolata 96 

Cercospora capsici 146, 148, 157 

Cercospora “cardaminae” 146 

Cercospora cardamines 146 

393

Cercospora caricae 370 

Cercospora catappae 79 

Cercospora celosiae 144, 148, 162–163 

Cercospora cercidis 80 

Cercospora cf. alchemillicola 144, 148, 158, 162–164 

Cercospora cf. brunkii 145, 147, 155, 157 

Cercospora cf. chenopodii 149, 152, 161, 163 

Cercospora cf. citrulina 150, 156 

Cercospora cf. coreopsidis 148, 152 

Cercospora cf. erysimi 153 

Cercospora cf. flagellaris 147, 155, 157, 161, 163 

Cercospora cf. helianthicola 150, 156–157 

Cercospora cf. ipomoeae 155–156, 161–162, 164, 167 

Cercospora cf. malloti 157, 164 

Cercospora cf. modiolae 153, 157 

Cercospora cf. nicotianae 157–158 

Cercospora cf. physalidis 144, 158, 162–163 

Cercospora cf. resedae 145, 159 

Cercospora cf. richardiicola 147, 156–157, 160–161, 164–165 

Cercospora cf. sigesbeckiae 144, 155–156, 159–161, 164–165 

Cercospora cf. zinniae 167 

Cercospora cheiranthi 145–146 

Cercospora chengtuensis 80 

Cercospora chenopodii 145, 148–149, also see Cercospora cf. 

chenopodii 

Cercospora chenopodii var. atriplicis patulae 148 

Cercospora chenopodii var. micromaculata 148 

Cercospora chinensis 150, 153 

Cercospora chionanthi-retusi 81 

Cercospora chionea 79 

Cercospora chrysanthemicola 81 

Cercospora circumscissa 99 

Cercospora cistinearum 160 

Cercospora citrullina 153, also see Cercospora cf. citrulina 

Cercospora coniogrammes 151 

Cercospora contraria 81 

Cercospora copallina 104 

Cercospora corchori 150, 151–152, 165 

Cercospora coreopsidis see Cercospora cf. coreopsidis 

Cercospora coriariae 82 

Cercospora cornicola 82 

Cercospora corylopsidis 82 

Cercospora “cotoneasteris” 82 

Cercospora cotoneastri 82 

Cercospora crassa 200 

Cercospora crepidis 164 

Cercospora cydoniae 84 

Cercospora cynanchi 159 

Cercospora daizu 162 

Cercospora delaireae 149, 152, 161–164 

Cercospora depazeoides 67 

Cercospora deutziae 163 

Cercospora difformis 166 

Cercospora dioscoreae-pyrifoliae 165 

Cercospora dispori 150, 153 

Cercospora dovyalidis 84 

Cercospora drabae 146 

Cercospora dubia 148 

Cercospora dubia var. atriplicis 148 

Cercospora dubia var. urbica 148 

Cercospora duplicata 96 

Cercospora eremochloae 68 

Cercospora erysimi 153, also see Cercospora cf. erysimi 

Cercospora eucommiae 67–68 

Cercospora euphorbiae-sieboldianae 153, 159 

Cercospora exosporioides 86 

Cercospora “fagariae” 110 

Cercospora fagaricola 110 

Cercospora fagopyri 154–156, 161, 166–167 

Cercospora flagellaris 155, also see Cercospora cf. flagellaris 

Cercospora flexuosa 106 

Cercospora fruticola 157 

Cercospora fukuokaensis 87 

Cercospora fuligena 87 

Cercospora ganjetica 159 

Cercospora glauca 87 

Cercospora guatemalensis 163 

Cercospora guianensis 87 

Cercospora hamamelidis 82 

Cercospora hayi 151, 164 

Cercospora helianthicola see Cercospora cf. helianthicola 

Cercospora helvola 167 

Cercospora helvola var. zebrina 167 

Cercospora hibisci 76 

Cercospora hibisci-manihotis 76 

Cercospora humuli 89 

Cercospora humuli-japonici 89 

Cercospora “hypticola” 94 

Cercospora hyptidicola 94–95 

Cercospora impatientis 147 

Cercospora ipomoeae 156, 164, also see Cercospora cf. 

ipomoeae 

Cercospora ipomoeae-pedis-caprae 164 

Cercospora ipomoeae-purpureae 108 

Cercospora ixeridis-chinensis 156 

Cercospora jacquiniana 161 

Cercospora jussiaeae 89 

Cercospora kaki 90 

Cercospora kakivora 90 

Cercospora kellermanii 144 

Cercospora kiggelariae 90 

Cercospora kikuchii 147, 155–156, 160–161, 164 

Cercospora krugeriana 159 

Cercospora kusanoi 106, 108 

Cercospora lactucae 156 

Cercospora lactucae-indicae 156 

Cercospora lactucae-sativae 152–153, 156, 165 

Cercospora lagerstroemiae 91 

Cercospora lagerstroemiae-subcostatae 91 

Cercospora lagerstroemiicola 91 

Cercospora langloisii 96 

Cercospora latens 91 

Cercospora lepidii 146 

Cercospora ligustrina 61 

Cercospora longispora 156 

Cercospora longissima 156 

Cercospora lonicericola 91 

Cercospora ludwigiae 89 

Cercospora lycii 148 

Cercospora lycopodis 95 

Cercospora lyoniae 91 

Cercospora lythracearum 91 

Cercospora malloti 157, 160, also see Cercospora cf. malloti 

Cercospora mercurialis 148, 157, 159 

394

Cercospora mercurialis var. annuae 157 

Cercospora mercurialis var. latvici 157 

Cercospora mercurialis var. multisepta 157 

Cercospora modiolae 157, also see Cercospora cf. modiolae 

Cercospora mori 106 

Cercospora myrti 92 

Cercospora myrticola 92 

Cercospora nasturtii 146 

Cercospora nasturtii subsp. barbareae 146 

Cercospora nicandrae 148 

Cercospora nicotianae 157, also see Cercospora cf. nicotianae 

Cercospora nigri 78 

Cercospora ocimicola 94 

Cercospora oenotherae 95 

Cercospora olivascens 158 

Cercospora pallida 96 

Cercospora paraguayensis 96 

Cercospora penicillata 67 

Cercospora penicillata f. chenopodii 148 

Cercospora persicae 68 

Cercospora physalidis 148, 158, also see Cercospora cf. 

physalidis 

Cercospora piaropi 155, 161 

Cercospora pileae 159 

Cercospora pileicola 153, 157, 158–159 

Cercospora pini-densiflorae 96 

Cercospora polygonacea 144, 154, 159 

Cercospora polygonaeae 159 

Cercospora polygoni-blumei 159 

Cercospora polygoni-caespitosi 159 

Cercospora praecincta 144 

Cercospora profusa 97 

Cercospora protearum var. leucadendri 91 

Cercospora pruni-persicae 99 

Cercospora pruni-yedoensis 98 

Cercospora prunicola 98–99 

Cercospora psophocarpicola 151 

Cercospora punctiformis 154, 159 

Cercospora punctiformis f. catalaunica 159 

Cercospora pyracanthae 100 

Cercospora ramularia 144 

Cercospora ranjita 101 

Cercospora resedae 160, also see Cercospora cf. resedae 

Cercospora rhoina 104 

Cercospora rhoina var. nigromaculans 104 

Cercospora richardiicola 

richardiicola 

Cercospora ricinella 149, 152, 160, 163 

Cercospora ricini 160 

Cercospora rigospora 78 

Cercospora rodmanii 156, 160–161, 164, 167 

Cercospora rumicis 145–146, 161, 167 

Cercospora saccardoana 92 

Cercospora salina 207 

Cercospora sciadophila 148 

Cercospora scirpicola 198 

Cercospora securinegae 106 

Cercospora senecionicola 161 

Cercospora senecionis 161 

Cercospora senecionis-grahamii 161 

156, 160, also see Cercospora cf. 

Cercospora senecionis-walkeri 154, 161 

Cercospora sigesbeckiae 161, also see Cercospora cf. 

sigesbeckiae 

Cercospora snelliana 106 

Cercospora sojina 67, 144, 147, 159, 162 

Cercospora solanacea 148 

Cercospora solani 148 

Cercospora solani-biflori 78 

Cercospora sp. A 162 

Cercospora sp. B 162 

Cercospora sp. C 148, 162 

Cercospora sp. D 148, 162 

Cercospora sp. E 153, 157, 162 

Cercospora sp. F 158, 162–163 

Cercospora sp. G 158, 162–163 

Cercospora sp. H 162–163 

Cercospora sp. I 144, 148, 158, 162–163 

Cercospora sp. J 148, 163 

Cercospora sp. K 149, 152, 161–163 

Cercospora sp. L 144, 146, 161, 164, 167 

Cercospora sp. M 144, 156, 160–161, 164 

Cercospora sp. N 160–161, 164 

Cercospora sp. O 144, 156, 160–161, 164 

Cercospora sp. P 144, 147, 156–157, 160–161, 164–165 

Cercospora sp. Q 144, 147–148, 156, 160–162, 164–165 

Cercospora sp. R 152, 165 

Cercospora sp. S 152, 157, 165 

Cercospora stanleyae 146 

Cercospora stephanandrae 108 

Cercospora stolziana 167 

Cercospora terminaliae 79 

Cercospora terminariae 79 

Cercospora thlaspi 146 

Cercospora “thlaspiae” 146 

Cercospora timorensis 108 

Cercospora tinea 108 

Cercospora tosensis 78 

Cercospora trinctatis 166 

Cercospora udagawana 108 

Cercospora vignicaulis 165–166 

Cercospora vignigena 150, 154, 165 

Cercospora violae 146, 161, 166–167 

Cercospora violae var. minor 166 

Cercospora violae-kiusianae 166 

Cercospora violae-tricoloris 166 

Cercospora “viteae” 108 

Cercospora viticicola 108 

Cercospora viticis 108 

Cercospora viticis-quinatae 108 

Cercospora weigelae 110 

Cercospora wildemanii 81 

Cercospora xanthoxyli 110 

Cercospora zeae-maydis 166–167 

Cercospora zebrina 144–146, 148, 161, 164, 166–167 

Cercospora zeina 167 

Cercospora zelkowae 110 

Cercospora zinniae see Cercospora cf. zinniae 

Cercosporella 71, 343 

Cercosporella chaenomelis 70–71 

Cercosporidium campi-silii 147 

Cercosporidium dubium 148 

Cercosporidium sojinum 162 

Cercosporina cydoniae 84 

Cercosporina drabae 146 


395

Cercosporina kikuchii 156 

Cercosporina lythracearum 91 

Cercosporina ramularia 144 

Cercosporina ricinella 160 

Cercosporina sojina 162 

Cercosporina zebrina 167 

Cercosporiopsis araliae 78 

Cercosporiopsis profusa 97 

Cercostigmina protearum var. hakeae 88 

Cercostigmina protearum var. leucadendri 91 

Cercostigmina tinea 108 

Chaetodiplodia caulina 24 

Chaetosphaeronema 366 

Chaetosphaeronema hispidulum 366 

Chalastospora 183, 188–189 

Chalastospora cetera 189 

Chalastospora ellipsoidea 189 

Chalastospora gossypii 189 

Chalastospora obclavata 189 

Chiajaea hendersoniae 22 

Chmelia 183, 194 

Chmelia slovaca 196 

Ciferriella 335 

Ciferriella domingensis 335 

Cladosporiaceae 63 

Cladosporium 63 

Cladosporium gossypii 189 

Cladosporium herbarum 63 

Cladosporium malorum 189 

Clasterosporium mori 106, 108 

Clasterosporium scirpicola 198 

Clathrospora scirpicola 198 

Clathrospora typhicola 25 

Clisosporium fuckelii 25 

Clisosporium palmarum 24 

Colletogloeum 335 

Colletogloeum dalbergiae 335 

Colletogloeum sissoo 335 

Coniella 353 

Coniothyriaceae 23–24, 374 

Coniothyrium 374 

Coniothyrium carteri 23 

Coniothyrium dolichi 23 

Coniothyrium fuckelii 25 

Coniothyrium fuckelii var. sporulosum 25 

Coniothyrium glycines 23 

Coniothyrium minitans 26 

Coniothyrium minutum 23 

Coniothyrium multiporum 24 

Coniothyrium obiones 25 

Coniothyrium “obionis” 25 

Coniothyrium palmarum 24, 374 

Coniothyrium sidae 374 

Coniothyrium telephii 24 

Conoplea eryngii 199 

Cornucopiella 359 

Corynespora 381–382 

Corynespora cassiicola 382 

Corynespora leucadendri 382 

Corynespora mazei 382 

Crivellia 183, 189–190 

Crivellia papaveracea 190 

Cronartium flaccidum 385 

Cryptosphaeria glaucopunctata 366 

Cryptosporium aegopodii 238 

Cucurbitaria hendersoniae 22 

Cucurbitaria papaveracea 189–190 

Cucurbitariaceae 24 

Cylindrodochium 335 

Cylindroseptoria 358–360 

Cylindroseptoria ceratoniae 358–359 

Cylindroseptoria pistaciae 359–360 

Cylindrosporium 302, 335 

Cylindrosporium capsellae 70 

Cylindrosporium castaneae 353 

Cylindrosporium concentricum 336 

Cylindrosporium heraclei 260 

Cylindrosporium oculatum 345 

Cylindrosporium platanoidis 294 

Cylindrosporium pseudoplatani 294 

Cylindrosporium rubi 300, 302, 343 

Cylindrosporium ulmi 350 

Cylindrosporium umbelliferarum 260 

Cyphellophora 60 

Cyphellophora laciniata 60 

Cystocoleus 63 

Cytostagonospora 327, 354 

Cytostagonospora martiniana 354–355 

Cytostagonospora “photinicola” 354 

Cytostagonospora photiniicola 327, 354 

D 

Davidiella 63 

Davidiella populorum 345 

Davisoniella 63 

Dearnessia 327, 383 

Dearnessia apocyni 327 

Dendrophoma pleurospora 27 

Dendryphiella “arenaria” 208 

Dendryphiella arenariae 208 

Dendryphiella salina 207 

Dendryphion papaveris 190 

Dendryphion penicillatum 190 

Depazea cornicola 295 

Depazea frondicola 296 

Depazea nodorum 363 

Depazea scabiosicola 284 

Deuterophoma 21 

Deuterophoma tracheiphila 22 

Devriesia 63 

Diaporthe 373 

Didymella 336 

Didymellaceae 379 

Didymosphaeriaceae 31 

Diplodia 333 

Diplodia hyalospora 24 

Diplodina ellisii 24 

Diplodina obiones 25 

Diplodina “obionis” 25 

Diploplenodomus 21 

Dissoconiaceae 64, 358 

Dissoconium 64, 358 

Dissoconium aciculare 64 

396

Dothidea hysterioides 31 

Dothistroma 337, 353 

Dothistroma pini 337 

Dothistroma rhabdoclinis 348 

Dothistroma septosporum 337 

Dothistroma septosporum var. keniense 337 

E 

Elasticomyces 63 

Elosia 183 

Embellisia 183, 190–191, 193, 199 

Embellisia abundans 189 

Embellisia allii 190–191 

Embellisia annulata 208 

Embellisia chlamydospora 190 

Embellisia conoidea 188 

Embellisia dennisii 207 

Embellisia didymospora 199 

Embellisia eureka 193 

Embellisia hyacinthi 193 

Embellisia indefessa 189 

Embellisia leptinellae 193 

Embellisia lolii 193 

Embellisia novae-zelandiae 193 

Embellisia oxytropis 207 

Embellisia phragmospora 199 

Embellisia planifunda 193 

Embellisia proteae 193 

Embellisia “telluster” 191 

Embellisia tellustris 190–191 

Embellisia tumida 193 

Exosporium eryngianum 199 

Exosporium eryngii 199 

F 

Falciformispora lignatilis 28 

Friedmanniomyces 63 

Fusariella cladosporioides 92 

Fusicladium cynanchi 159 

G 

Gloeosporium betae 24 

H 

Helicominia 74 

Helicominia caperonia 74 

Helminthosporium allii 190–191 

Helminthosporium bornmuelleri 207 

Helminthosporium brassicicola 188 

Helminthosporium cheiranthi 189 

Helminthosporium eryngii 199 

Helminthosporium papaveris 190 

Helminthosporium septosporum 201 

Helminthosporium smyrnii 202 

Helminthosporium tenuissimum 188 

“Helmisporium” cheiranthi 189 

Hendersonia paludosa 378 

Hendersonia subgen. Stagonospora 333 

Heptameria circinans 28 

Heptameria scrophulariae 196 

Herpotrichia juniperi 29 

Heterospora 18 

Heterospora chenopodii 18 

Heterospora dimorphospora 18 

Hortea 63 

J 

Jahniella 327 

Jahniella bohemica 329 

K 

Kirstenboschia 385–386 

Kirstenboschia diospyri 385 

L 

Lecanosticta 354 

Lentitheciaceae 28, 327 

Leptophoma 18 

Leptophoma acuta 19 

Leptophoma doliolum 19 

Leptosphaerella oryzae 368 

Leptosphaeria 18–20, 274, 362, 378 

Leptosphaeria agnita 20–21 

Leptosphaeria avenaria 362 

Leptosphaeria biglobosa 21 

Leptosphaeria calvescens 24 

Leptosphaeria chenopodii-albi 18 

Leptosphaeria circinans 28 

Leptosphaeria clavata 24 

Leptosphaeria collinsoniae 21 

Leptosphaeria conferta 21 

Leptosphaeria congesta 21 

Leptosphaeria conoidea 18–19 

Leptosphaeria doliolum 18, 19–20 

Leptosphaeria doliolum subsp. conoidea 19 

Leptosphaeria doliolum subsp. errabunda 19 

Leptosphaeria doliolum subsp. pinguicula 18 

Leptosphaeria doliolum var. conoidea 18 

Leptosphaeria doliolum var. doliolum 20 

Leptosphaeria dryadis 20 

Leptosphaeria dryadophila 20 

Leptosphaeria errabunda 19 

Leptosphaeria etheridgei 19 

Leptosphaeria fallaciosa 22 

Leptosphaeria filamentosa 24 

Leptosphaeria hendersoniae 22 

Leptosphaeria libanotidis 22 

Leptosphaeria “libanotis” 22 

Leptosphaeria lindquistii 22 

Leptosphaeria macrocapsa 19 

Leptosphaeria macrospora 20 

Leptosphaeria maculans 20–22 

Leptosphaeria nitschkei 20 

Leptosphaeria nodorum 363 

Leptosphaeria pedicularis 19 

Leptosphaeria pimpinellae 22 

Leptosphaeria praetermissa 21 


397

Leptosphaeria rostrata 20 

Leptosphaeria rubefaciens 19 

Leptosphaeria rusci 366 

Leptosphaeria sclerotioides 19 

Leptosphaeria scrophulariae 196 

Leptosphaeria sect. Eu-Leptosphaeria 20 

Leptosphaeria sect. Paraleptosphaeria 20 

Leptosphaeria senecionis 20 

Leptosphaeria slovacica 19 

Leptosphaeria sydowii 20 

Leptosphaeria veronicae 20 

Leptosphaeriaceae 18 

Leptosphaerulina oryzae 368 

Lewia 183, 194 

Lewia alternarina 195 

Lewia avenicola 198–199 

Lewia daucicaulis 196 

Lewia ethzedia 196 

Lewia eureka 193 

Lewia hordeiaustralica 196 

Lewia hordeicola 196 

Lewia infectoria 196 

Lewia intercepta 196 

Lewia photistica 198–199 

Lewia scrophulariae 196 

Lewia viburni 196 

M 

Macrodiplodia 333 

Macrospora scirpicola 198 

Macrospora scirpinfestans 198 

Macrospora scirpivora 198 

Macrospora typhicola 25 

Macrosporium 183 

Macrosporium anatolicum 200 

Macrosporium araliae 199 

Macrosporium bataticola 200 

Macrosporium brassicae 207 

Macrosporium calendulae 200 

Macrosporium cheiranthi 189 

Macrosporium cichorii 200 

Macrosporium consortiale 204 

Macrosporium cucumerinum 200 

Macrosporium euphorbiae 201 

Macrosporium longipes 187 

Macrosporium macrosporum 201 

Macrosporium nashi 187 

Macrosporium nobile 193 

Macrosporium porri 201 

Macrosporium ricini 201 

Macrosporium saponariae 193 

Macrosporium septosporum 201 

Macrosporium sesami 201 

Macrosporium smyrnii 202 

Macrosporium solani 201 

Macrosporium tenuissimum 188 

Macrosporium vaccariae 194 

Massaria eburnea 28 

Massarina eburnea 28 

Massarinaceae 28 

Massariosphaeria clavata 24 

Medicopsis 28 

Medicopsis romeroi 28 

Megaloseptoria 329, 332 

Megaloseptoria mirabilis 329 

Melanomma dryadis 20 

Melanomma hendersoniae 22 

Melanomma pulvis-pyrius 30 

Melanomma vindelicorum 28 

Melanommataceae 28 

Melogramma rubronotatum 31 

Metasphaeria macrospora 20 

Microcyclospora 63–64 

Microcyclospora pomicola 64 

Microcyclospora quercina 64 

Microcyclosporella 65 

Microcyclosporella mali 65 

Microdiplodia henningsii 24 

Microdiplodia palmarum 24 

Microsphaeropsis fuckelii 25 

Miuraea 67–68 

Miuraea degenerans 68 

Miuraea persicae 68 

Montagnulaceae 25 

Muyocopron 375 

Muyocopronaceae 375 

Mycocentrospora 61 

Mycocentrospora acerina 61 

Mycocentrospora cantuariensis 61 

Mycopappus 61 

Mycopappus aceris 61 

Mycosphaerella 274–275, 277, 336, 339 

“Mycosphaerella” acaciigena 74 

Mycosphaerella aconitorum 275 

Mycosphaerella aegopodii 238–239 

Mycosphaerella antonovii 275 

Mycosphaerella arbuticola 357–358 

Mycosphaerella berberidis 345 

“Mycosphaerella” capsellae 70 

Mycosphaerella chaenomelis 70–71 

Mycosphaerella coacervata 252 

Mycosphaerella contraria 81 

“Mycosphaerella” crystallina 74 

“Mycosphaerella” gibsonii 96 

Mycosphaerella heimii 74 

“Mycosphaerella” heimioides 74 

“Mycosphaerella” holualoana 74 

Mycosphaerella hyperici 299 

Mycosphaerella hypericina 299 

“Mycosphaerella” irregulariramosa 74 

Mycosphaerella isariphora 290–291 

“Mycosphaerella” konae 74 

Mycosphaerella latebrosa 295, 299 

Mycosphaerella podagrariae 238–239 

Mycosphaerella populi 296 

Mycosphaerella populicola 296, 346 

Mycosphaerella populorum 296, 345 

“Mycosphaerella” pruni-persicae 68 

Mycosphaerella punctiformis 299, 339, 354 

Mycosphaerella rubi 300 

Mycosphaerella stigmina-platani 99–100 

Mycosphaerella ulmi 350 

Mycosphaerellaceae 61, 65, 327, 334–335 

398

N 

Neofabraea alba 384 

Neophaeosphaeria filamentosa 24 

Neoseptoria 352, 356 

Neoseptoria caricis 352–353 

Neosetophoma 370 

Neosetophoma samarorum 370 

Neostagonospora 364 

Neostagonospora caricis 364–365 

Neostagonospora elegiae 365 

Neottiosporina paspali 28 

Nigrograna 31 

Nigrograna mackinnonii 31 

Nimbya 183, 185, 197 

Nimbya alternantherae 185 

Nimbya caricis 197 

Nimbya celosiae 185 

Nimbya gomphrenae 185 

Nimbya perpunctulata 185 

Nimbya scirpicola 197–198 

Nimbya scirpinfestans 197–198 

Nimbya scirpivora 197–198 

P 

Pallidocercospora 73–74 

Pallidocercospora acaciigena 74 

Pallidocercospora crystallina 74 

Pallidocercospora heimii 74 

Pallidocercospora heimioides 74 

Pallidocercospora holualoana 74 

Pallidocercospora irregulariramosa 74 

Pallidocercospora konae 74 

Pantospora 74 

Pantospora guazumae 74 

Papulaspora pulmonaria 29 

Paracercospora 65, 67 

Paracercospora egenula 65 

Paraconiothyrium 25–26, 374 

Paraconiothyrium estuarinum 25 

Paraconiothyrium flavescens 25 

Paraconiothyrium fuckelii 25 

Paraconiothyrium fusco-maculans 25 

Paraconiothyrium lini 26 

Paraconiothyrium maculicutis 26 

Paraconiothyrium minitans 26 

Paraconiothyrium sporulosum 25 

Paraconiothyrium tiliae 26 

Paradendryphiella 183, 207 

Paradendryphiella arenariae 208 

Paradendryphiella salina 207 

Paraleptosphaeria 20 

Paraleptosphaeria dryadis 20 

Paraleptosphaeria macrospora 20 

Paraleptosphaeria nitschkei 20 

Paraleptosphaeria orobanches 20 

Paraleptosphaeria praetermissa 21 

Paraphaeosphaeria 374 

Paraphaeosphaeria filamentosa 24 

Paraphaeosphaeria glaucopunctata 366 

Paraphaeosphaeria michotii 28 

Paraphaeosphaeria rusci 366 

Paraphoma 27, 370 

Paraphoma dioscoreae 370–371 

Paraphoma radicina 370 

Parastagonospora 362 

Parastagonospora avenae 362 

Parastagonospora avenae f.sp. avenaria 362 

Parastagonospora avenae f.sp. tritici 362 

Parastagonospora caricis 362 

Parastagonospora nodorum 362, 363–364 

Parastagonospora poae 363–364 

Passalora 67, 79, 82, 99, 144, 147, 149, 161–162, 352 

Passalora bacilligera 352 

Passalora brachycarpa 65 

Passalora campi-silii 147 

Passalora circumscissa 99 

Passalora dioscoreae 352 

Passalora dubia 148–149 

Passalora eucalypti 76 

Passalora hamamelidis 82 

Passalora leptophlebiae 76 

Passalora protearum 91 

Passalora senecionicola 161 

Passalora sojina 67, 162 

Passeriniella circinans 28 

Penidiella 63 

Perisporium funiculatum 30 

Phaeomycocentrospora 61 

Phaeomycocentrospora cantuariensis 61 

Phaeophleospora 354 

Phaeoramularia angolensis 77 

Phaeoseptoria 332, 367–368 

Phaeoseptoria oryzae 368, 370 

Phaeoseptoria papayae 332, 367–369 

Phaeosphaeria 362, 367–368 

Phaeosphaeria avenaria 362 

Phaeosphaeria nodorum 363 

Phaeosphaeria oryzae 367–368, 370 

Phaeosphaeria papayae 368 

Phaeosphaeria silvatica 375 

Phaeosphaeriopsis 365–366 

Phaeosphaeriopsis glaucopunctata 366 

Phaeothecoidea 63 

Phialophora chrysanthemi 21 

Phleospora bresadolae 252 

Phleospora castanicola 353 

Phleospora hyperici 298 

Phleospora petroselini 277 

Phleospora platanoidis 295 

Phleospora quercicola 347 

Phloeospora 67, 70, 336, 350, 352 

Phloeospora aceris 294 

Phloeospora aegopodii 238 

Phloeospora azaleae 345 

Phloeospora heraclei 260 

Phloeospora melissae 272 

Phloeospora oxyacanthae 345 

Phloeospora pseudoplatani 294 

Phloeospora samarigena 295 

Phloeospora ulmi 70, 336, 350 

Phloeospora villosa 298 


399

Phloeosporella 336 

Phloeosporella ceanothi 336 

Phloeosporella padi 336 

Phlogicylindrium 386 

Phlogicylindrium eucalypti 386 

Phlogicylindrium eucalyptorum 386 

Phlyctaeniella 337 

Phlyctaeniella polonica 337 

Phlyctema 384–385 

Phlyctema vagabunda 384 

Phlyctema vincetoxici 384–385 

Phoma 23, 27, 375, 378 

Phoma acuta 19 

Phoma acuta subsp. acuta f.sp. “phlogis” 19 

Phoma acuta subsp. amplior 18–19 

Phoma acuta subsp. errabunda 19 

Phoma agnita 21 

Phoma apiicola 23 

Phoma betae 24 

Phoma “capitula” 30 

Phoma capitulum 30 

Phoma carteri 23 

Phoma cava 23 

Phoma chenopodii 18 

Phoma chenopodiicola 18 

Phoma conferta 21 

Phoma congesta 21 

Phoma dimorphospora 18 

Phoma doliolum 18–19 

Phoma drobnjacensis 23 

Phoma enteroleuca 21 

Phoma enteroleuca var. enteroleuca 21 

Phoma enteroleuca var. influorescens 22 

Phoma errabunda 19 

Phoma etheridgei 19 

Phoma exigua var. exigua 18 

Phoma fallens 25 

Phoma flavescens 25 

Phoma flavigena 25 

Phoma fusco-maculans 25 

Phoma glaucispora 25 

Phoma glycines 23 

Phoma glycinicola 23 

Phoma herbicola 19 

Phoma heteromorphospora 18 

Phoma hoehnelii 19 

Phoma hoehnelii subsp. amplior 18 

Phoma hoehnelii var. hoehnelii 19 

Phoma hoehnelii var. urticae 19 

Phoma incompta 25 

Phoma intricans 22 

Phoma korfii 20–21 

Phoma leonuri 19 

Phoma lingam 22 

Phoma lini 26 

Phoma lupini 22 

Phoma macdonaldii 22 

Phoma macrocapsa 19 

Phoma minuta 23 

Phoma minutispora 31 

Phoma multipora 24 

Phoma oryzae 31 

Phoma ostiolata 30 

Phoma ostiolata var. brunnea 30 

Phoma ostiolata var. ostiolata 30 

Phoma “pedicularidis” 19 

Phoma pedicularis 19 

Phoma phlogis 19 

Phoma pimpinellae 21–22 

Phoma pratorum 24 

Phoma rostrata 20 

Phoma rostrupii 22 

Phoma rubefaciens 19 

Phoma sanguinolenta 22 

Phoma sclerotioides 19 

Phoma sect. Heterospora 18 

Phoma sect. Plenodomus 21 

Phoma senecionis 20 

Phoma septicidalis 24 

Phoma sydowii 20 

Phoma telephii 24 

Phoma tracheiphila 22 

Phoma tracheiphila f.sp. chrysanthemi 21 

Phoma typharum 25 

Phoma typhina 25 

Phoma valerianae 23 

Phoma variospora 18 

Phoma vasinfecta 21 

Phoma veronicae 20 

Phoma veronicicola 20 

Phoma violae-tricoloris 23 

Phoma violicola 23 

Phoma wasbiae 21, 23 

Phoma westendorpii 18 

Phomopsis 262 

Phyllosticta betae 24 

Phyllosticta chenopodii 18 

Phyllosticta dimorphospora 18 

Phyllosticta glaucispora 25 

Phyllosticta oleandri 25 

Phyllosticta oryzae 31 

Phyllosticta tabifica 24 

Phyllosticta typhina 25 

Phyllosticta valerianae-tripteris f. minor 23 

Phyllosticta violae f. violae-hirtae 23 

Phyllosticta violae f. violae-sylvaticae 23 

Pilidiella 353 

Plectophomella 21, 23 

Plectophomella visci 22–23 

Plenodomus 20–21, 23 

Plenodomus acutus 19 

Plenodomus agnitus 21 

Plenodomus biglobosus 21 

Plenodomus chenopodii 18 

Plenodomus chondrillae 21 

Plenodomus chrysanthemi 21 

Plenodomus collinsoniae 21 

Plenodomus confertus 21 

Plenodomus congestus 21 

Plenodomus doliolum 19 

Plenodomus enteroleucus 21 

Plenodomus fallaciosus 22 

Plenodomus fusco-maculans 25 

Plenodomus gentianae 19 

400

Plenodomus hendersoniae 22 

Plenodomus influorescens 22 

Plenodomus leonuri 19 

Plenodomus libanotidis 22 

Plenodomus lindquistii 22 

Plenodomus lingam 21, 22 

Plenodomus lupini 22 

Plenodomus macrocapsa 19 

Plenodomus meliloti 19 

Plenodomus microsporus 18 

Plenodomus pimpinellae 22 

Plenodomus rabenhorstii 21–22 

Plenodomus rostratus 20 

Plenodomus sclerotioides 19 

Plenodomus senecionis 20 

Plenodomus tracheiphilus 22 

Plenodomus visci 22 

Plenodomus wasabiae 23 

Pleomassaria siparia 30 

Pleopora obiones 25 

Pleospora 190 

Pleospora angustis 24 

Pleospora avenae 362 

Pleospora betae 24 

Pleospora bjoerlingii 24 

Pleospora calvescens 24 

Pleospora chenopodii 24 

Pleospora clavata 24 

Pleospora “clavatis” 24 

Pleospora fallens 25 

Pleospora flavigena 25 

Pleospora halimiones 25 

Pleospora herbarum 25 

Pleospora hyalospora 24 

Pleospora incompta 25 

Pleospora infectoria 196 

Pleospora libanotidis 22 

Pleospora “libanotis” 22 

Pleospora macrospora 20 

Pleospora oryzae 368 

Pleospora papaveracea 190 

Pleospora phaeocomoides var. infectoria 196 

Pleospora scrophulariae 196 

Pleospora tritici 362 

Pleospora typhicola 25 

Pleosporaceae 24, 274 

Pleuroceras 337 

Pleurophoma 27 

Pleurophoma pleurospora 26–27 

Polyphialoseptoria 355–356 

Polyphialoseptoria tabebuiae-serratifoliae 356 

Polyphialoseptoria terminaliae 355–356 

Preussia funiculata 30 

Pseudocercospora 61, 65, 67–68, 74, 76, 79, 94–97, 99–100, 

102, 104, 110, 335, 353 

Pseudocercospora abelmoschi 76 

Pseudocercospora acaciigena 74 

Pseudocercospora adinicola 74 

Pseudocercospora ampelopsis 76–77 

Pseudocercospora angolensis 77 

Pseudocercospora anisomelicola 97 

Pseudocercospora araliae 78 

Pseudocercospora atromarginalis 78, 80 

Pseudocercospora balsaminae 79 

Pseudocercospora basiramifera 65 

Pseudocercospora brachypus 76 

Pseudocercospora callicarpae 79 

Pseudocercospora cantuariensis 61 

Pseudocercospora caperoniae 74 

Pseudocercospora catalpigena 79 

Pseudocercospora catappae 79 

Pseudocercospora cercidicola 79–80 

Pseudocercospora cercidis-chinensis 79–80 

Pseudocercospora chengtuensis 78, 80 

Pseudocercospora chionanthi-retusi 80–81 

Pseudocercospora chionanthicola 81 

Pseudocercospora chrysanthemicola 81 

Pseudocercospora circumscissa 99 

Pseudocercospora colebrookiae 97 

Pseudocercospora colebrookiicola 97 

Pseudocercospora colombiensis 76 

Pseudocercospora contraria 81 

Pseudocercospora coriariae 82 

Pseudocercospora cornicola 82 

Pseudocercospora corylopsidis 82 

Pseudocercospora costina 74 

Pseudocercospora cotoneastri 82 

Pseudocercospora crispans 82–83 

Pseudocercospora crocea 83–84 

Pseudocercospora crystallina 74 

Pseudocercospora cydoniae 71, 84 

Pseudocercospora domingensis 335 

Pseudocercospora dovyalidis 84 

Pseudocercospora eucalyptorum 86 

Pseudocercospora eucommiae 68 

Pseudocercospora exosporioides 86 

Pseudocercospora fagaricola 110 

Pseudocercospora fijiensis 65 

Pseudocercospora flavomarginata 86–87 

Pseudocercospora fraxinites 92 

Pseudocercospora fukuokaensis 87 

Pseudocercospora fuligena 87 

Pseudocercospora glauca 87 

Pseudocercospora guianensis 87 

Pseudocercospora haiweiensis 87 

Pseudocercospora hakeae 88 

Pseudocercospora handelii 104 

Pseudocercospora heimii 74 

Pseudocercospora heimioides 74 

Pseudocercospora humuli 89 

Pseudocercospora humuli-japonici 89 

Pseudocercospora humulicola 89 

Pseudocercospora ipomoea-purpureae 108 

Pseudocercospora irregulariramosa 74 

Pseudocercospora jussiaeae 89 

Pseudocercospora kaki 90 

Pseudocercospora kiggelariae 90 

Pseudocercospora lagerstroemiae-subcostatae 91 

Pseudocercospora lamiacearum 97 

Pseudocercospora latens 91 

Pseudocercospora leucadendri 91 

Pseudocercospora leucadis 97 

Pseudocercospora lonicericola 91 

Pseudocercospora lycopodis 97 


401

Pseudocercospora lyoniae 91 

Pseudocercospora lythracearum 91 

Pseudocercospora lythri 92 

Pseudocercospora marginalis 92 

Pseudocercospora melicyti 92 

Pseudocercospora mori 108 

Pseudocercospora myrticola 92 

Pseudocercospora ocimi-basilici 92, 94 

Pseudocercospora ocimicola 94–95, 97 

Pseudocercospora oenotherae 95 

Pseudocercospora oxalidis 72 

Pseudocercospora paederiae 95–96 

Pseudocercospora pallida 96 

Pseudocercospora paraguayensis 96 

Pseudocercospora perillulae 97 

Pseudocercospora pileae 84 

Pseudocercospora pini-densiflorae 96 

Pseudocercospora plectranthi 96–97 

Pseudocercospora pogostemonis 97 

Pseudocercospora profusa 97, 159 

Pseudocercospora proteae 98 

Pseudocercospora protearum 98 

Pseudocercospora protearum var. hakeae 88 

Pseudocercospora protearum var. leucadendri 91 

Pseudocercospora protearum var. protearum 91 

Pseudocercospora pruni-yedoensis 99 

Pseudocercospora prunicola 98–99 

Pseudocercospora pseudoeucalyptorum 86 

Pseudocercospora pseudostigmina-platani 74, 99–100 

Pseudocercospora pyracanthae 100–101 

Pseudocercospora pyracanthigena 100–101 

Pseudocercospora ranjita 101 

Pseudocercospora ravenalicola 102 

Pseudocercospora rhabdothamni 103 

Pseudocercospora rhamnaceicola 104 

Pseudocercospora rhamnellae 103–104 

Pseudocercospora rhododendri-indici 104 

Pseudocercospora rhododendricola 104 

Pseudocercospora rhoina 104 

Pseudocercospora riachuelii var. horiana 76–77 

Pseudocercospora salvia 97 

Pseudocercospora sambucigena 105 

Pseudocercospora scutellariae 97 

Pseudocercospora securinegae 106 

Pseudocercospora snelliana 106, 108 

Pseudocercospora stephanandrae 108 

Pseudocercospora stromatosa 98 

Pseudocercospora thailandica 76 

Pseudocercospora tibouchina 67 

Pseudocercospora tibouchinigena 67 

Pseudocercospora timorensis 108 

Pseudocercospora udagawana 108 

Pseudocercospora viburnigena 108 

Pseudocercospora viticicola 108 

Pseudocercospora viticigena 108 

Pseudocercospora viticis 108 

Pseudocercospora viticis-quinatae 108 

Pseudocercospora vitis 76 

Pseudocercospora weigelae 110 

Pseudocercospora xanthocercidis 110 

Pseudocercospora xanthoxyli 110 

Pseudocercospora zelkovae 110 

Pseudocercosporella 65, 67–68, 70–72, 165 

Pseudocercosporella arcuata 70 

Pseudocercosporella capsellae 70 

Pseudocercosporella chaenomelis 70–71 

Pseudocercosporella crataegi 71 

Pseudocercosporella dovyalidis 84 

Pseudocercosporella gei 71 

Pseudocercosporella ipomoeae 70 

Pseudocercosporella koreana 71 

Pseudocercosporella myopori 165 

Pseudocercosporella oxalidis 72 

Pseudocercosporella potentillae 71 

Pseudocercosporella tephrosiae 72 

Pseudocercosporella viticis 108 

Pseudophaeoramularia angolensis 77 

Pseudoseptoria 332, 360–362 

Pseudoseptoria bromigena 362 

Pseudoseptoria collariana 360, 362 

Pseudoseptoria collorata 362 

Pseudoseptoria donacicola 332, 360 

Pseudoseptoria donacis 360–362 

Pseudoseptoria obscura 361–362 

Pseudoseptoria stromaticola 362 

Pseudostemphylium chlamydosporum 190 

Pseudostemphylium consortiale 204 

Pseudostemphylium radicinum 202 

Pseudotaeniolina 63 

Pyrenochaeta 27 

Pyrenochaeta cava 23 

Pyrenochaeta dolichi 23 

Pyrenochaeta gentianae 23 

Pyrenochaeta glycines 23 

Pyrenochaeta mackinnonii 31 

Pyrenochaeta minuta 23 

Pyrenochaeta romeroi 28 

Pyrenochaeta telephii 24 

Pyrenochaetopsis 27 

Pyrenochaetopsis pratorum 24 

Pyrenopeziza brassicae 336 

Pyrenophora alternarina 195 

Pyrenophora calvescens 24 

Pyrenophora echinella var. betae 24 

Pyrenophora scirpicola 198 

Pyrenophora typhicola 25 

R 

Racodium 63 

Ramularia 334, 339, 353–354 

Ramularia batatae 108 

Ramularia catappae 79 

Ramularia dubia 148 

Ramularia endophylla 299 

Ramularia pusilla 339 

Readeriella 63, 358 

Recurvomyces 63 

Rhabdospora 262, 332 

Rhabdospora aloetica 373 

Rhabdospora alsines 238 

Rhabdospora aparines 252 

Rhabdospora apiicola 242 

Rhabdospora hypochoeridis 262 

402

Rhabdospora leucanthemi 266 

Rhabdospora napelli 272, 274 

Rhabdospora oleandri 332 

Rhabdospora rubi var. rubi-idaei 300 

Rhabdospora schnabliana 258 

Rhopalidium 183 

Roussoella hysterioides 31 

Ruptoseptoria 356, 358 

Ruptoseptoria unedonis 357 

S 

Satchmopsis 359 

Sclerostagonospora 332, 366–367 

Sclerostagonospora caricicola 367 

Sclerostagonospora heraclei 332, 366–367 

Sclerostagonospora phragmiticola 366 

Sclerotium orobanches 20–21 

Scolecobasidium arenarium 208 

Scolecobasidium salinum 207 

Scolecostigmina 73–74 

Scolecostigmina mangiferae 74 

Seifertia 61 

Septaria 332 

“Septaria” ulmi 350 

Septocyta 337–338 

Septocyta ramealis 338 

Septocyta ruborum 338 

Septogloeum 336–337 

Septogloeum carthusianum 337 

Septogloeum ulmi 350 

Septopatella 338 

Septopatella septata 338 

Septoria 67, 70, 72, 236, 238, 241–242, 245–246, 250–253, 

256, 260, 262–263, 266, 270, 272, 274–275, 277, 279, 281, 

284–287, 293–295, 298–299, 301–302, 327, 332, 334, 336, 

338–339, 340–343, 351–352, 355–356, 358, 362, 371–373, 

377–378, 381, 383–384, 386 

Septoria abeliceae 343 

Septoria aceris 294–295, 299 

Septoria acetosae 284 

Septoria aegopodii 238–239, 241 

Septoria aegopodina 239, 241, 246, 287 

Septoria aegopodina var. trailii 239, 241 

Septoria aegopodina var. villosa 239, 241 

Septoria agrimoniicola 340, also see Septoria cf. agrimoniicola 

Septoria alpicola 258 

Septoria alsines 238 

Septoria anaxaea 284 

Septoria anthrisci 241–242, 278 

Septoria anthurii 248, 277, 288 

Septoria aparines 252 

Septoria apatela 295 

Septoria apii 242 

Septoria apii-graveolentis 242 

Septoria apiicola 242, 255, 278, 287 

Septoria arcautei 246 

Septoria artemisiae 275 

Septoria arundinacea 383 

Septoria asperulae 252 

Septoria astericola 266 

Septoria astragali 243, 245 

Septoria astragali var. brencklei 243, 245 

Septoria astragali var. “brinklei” 243 

Septoria avenae 362 

Septoria azaleae 345 

Septoria berberidis 345 

Septoria betulae 345 

Septoria bosniaca 258–259 

Septoria campanulae 241, 245–246 

Septoria caricicola 353 

Septoria caricis 365, 381 

Septoria castaneae 353–354 

Septoria castaneicola 353–354 

Septoria cerastii 246–247 

Septoria cercidis 345 

Septoria cf. agrimoniicola 340 

Septoria cf. stachydicola 290, 340 

Septoria chamomillae 271–272 

Septoria chanousii 258 

Septoria chromolaenae 248, 277 

Septoria chrysanthemella 248, 293, 299 

Septoria chrysanthemi 248 

Septoria cirsii 266 

Septoria citri 282, 302, also see Septoria protearum 

Septoria citricola 302 

Septoria clematidis 248, 250 

Septoria convolvuli 250–251 

Septoria coprosmae 251–252 

Septoria cornicola 295 

Septoria cornicola var. ampla 295 

Septoria cornina 296 

Septoria cotylea 260 

Septoria crepidis 263 

Septoria cretae 340–341 

Septoria cruciatae 252–253 

Septoria cucubali 253, 255 

Septoria cucurbitacearum 255 

Septoria cucutana 356 

Septoria curva 383 

Septoria cytisi 72, 238, 333–334, 340 

Septoria dianthi 238 

Septoria digitalis 255–256, 258 

Septoria dimera 236, 255 

Septoria divaricatae 279 

Septoria dominii 236 

Septoria drummondi 279 

Septoria ekmanniana 248, 277 

Septoria epambrosiae 279 

Septoria epicotylea 294 

Septoria epilobii 256, 258 

Septoria epilobii var. durieui 256, 258 

Septoria erigeronata 258 

Septoria erigerontea 258 

Septoria erigerontis 258 

Septoria galeopsidis 256, 258, 260, 265–266, 272, 277 

Septoria galii-borealis 252 

Septoria gei 296 

Septoria gei f. immarginata 298 

Septoria gentianae 241 

Septoria gilletiana 353 

Septoria gladioli 351–352 

Septoria glycines 342 

Septoria glycinicola 341–342 


403

Septoria graminum 383 

Septoria helianthi 275 

Septoria heraclei 260, 262 

Septoria heraclei-palmati 260, 262 

Septoria heracleicola 262 

Septoria heterochroa f. lamii 263 

Septoria hippocastani 302 

Septoria hyperici 298–299 

Septoria hypericorum 298 

Septoria hypochoeridis 262–263 

Septoria incondita var. quercicola 347 

Septoria jackmanii 250 

Septoria juliae 341 

Septoria lactucae 263 

Septoria lagenophorae 262, 293 

Septoria lamii 263 

Septoria lamiicola 260, 263, 265–266, 272 

Septoria leucanthemi 266, 275 

Septoria limonum 302 

Septoria lychnidis 234–235, 349–350 

Septoria lychnidis var. pusilla 235 

Septoria lycoctoni 266, 269, 275 

Septoria lycoctoni var. anthorae 269 

Septoria lycoctoni var. macrospora 269 

Septoria lycoctoni var. sibirica 269 

Septoria lycospersici 255 

Septoria lysimachiae 269–271 

Septoria malagutii 255 

Septoria martiniana 354 

Septoria matricariae 266, 271–272 

Septoria mazi 241, 287 

Septoria melissae 260, 272 

Septoria menispermi 299, 345 

Septoria musiva 296, 345 

Septoria napelli 269, 272, 274–275, 342–343 

Septoria neriicola 341 

Septoria nodorum 363 

Septoria obesa 266, 275 

Septoria obscura 246 

Septoria oenanthicola 241, 342 

Septoria oenanthis 241, 246, 342 

Septoria oleandriicola 341 

Septoria oleandrina 341 

Septoria oxyacanthae 345–346 

Septoria paridis 275, 277 

Septoria passiflorae 248, 277 

Septoria passifloricola 248, 277 

Septoria patriniae 346 

Septoria petroselini 242, 277–278 

Septoria petroselini var. apii 242 

Septoria “phlocis” 278 

Septoria phlogina 279 

Septoria phlogis 278–279 

Septoria phragmitis 383 

Septoria phyllodiorum 354 

Septoria pimpinellae 239 

Septoria pini-thunbergii 383 

Septoria pistaciae 360 

Septoria podagrariae 238 

Septoria podagrariae var. pimpinellae-magnae 238–239 

Septoria polygonorum 279, 281 

Septoria populi 296 

Septoria populicola 296, 346 

Septoria protearum 281–282, 302 

Septoria provencialis 345 

Septoria pseudonapelli 275, 342 

Septoria pseudoplatani 294 

Septoria pusilla 235 

Septoria putrida 266, 282–284, 286 

Septoria quercicola 347, 353 

Septoria quercicola f. macrospora 347 

Septoria quercina 347 

Septoria relicta 252 

Septoria roll-hansenii 341 

Septoria rosae 299, 302, 343 

Septoria rubi 300–301 

Septoria rumicis 284 

Septoria rumicum 284, 377 

Septoria saccardoi 271, 371–372 

Septoria saponariae 255 

Septoria scabiosicola 277, 284–285 

Septoria schnabliana 258 

Septoria sect. Rhabdospora 332 

Septoria seminalis var. platanoidis 295 

Septoria senecionis 266, 284, 285–286 

Septoria septulata 251 

Septoria sii 241, 246, 286–287 

Septoria silenes 235–236 

Septoria silenicola 236 

Septoria sisyrinchii 248, 277, 287–288 

Septoria socia 299 

Septoria sonchi 263 

Septoria spergulae 236, 238 

Septoria spergulariae 238 

Septoria spergularina 238 

Septoria stachydicola 290, 340, also see Septoria cf. 

stachydicola 

Septoria stachydis 256, 258, 260, 288, 290 

Septoria stellariae 247, 272, 290–291 

Septoria stellariae var. macrospora 291 

Septoria stenactidis 258 

Septoria tabebuiae 356 

Septoria tabebuiae-impetiginosae 356 

Septoria tabebuiae-serratifoliae 356 

Septoria taraxaci 258, 263 

Septoria trachelii 246 

Septoria ulmi 350 

Septoria umbrosa 277 

“Septoria” unedonis 357–358 

Septoria urens 252 

Septoria urticae 291, 293 

Septoria vandasii 238 

Septoria verbascicola 256, 258 

Septoria verbenae 252, 293 

Septoria viceae 349 

Septoria vincetoxici 385 

Septoria violae-palustris 277 

Septoria virguareae 346–347 

Septoria westendorpii 18 

Septoria williamsiae 250 

Septorioides 383–384 

Septorioides pini-thunbergii 383–384 

Setophoma 373 

Setophoma chromolaenae 373–374 

404

Setophoma sacchari 374 

Setophoma terrestris 373–374 

Setoseptoria 382–383 

Setoseptoria phragmites 382–383 

Sinomyces 183, 206 

Sinomyces alternariae 206 

Sirosporium mori 106 

Sonderhenia 72–73 

Sonderhenia eucalypticola 73 

Sonderhenia eucalyptorum 73 

Sphaerella arbuticola 357 

Sphaerella berberidis 345 

Sphaerella latebrosa 294 

Sphaerella populi 296 

Sphaerella ulmi 350 

Sphaeria acuta 19 

Sphaeria agnita 21 

Sphaeria berberis 345 

Sphaeria calvescens 24 

Sphaeria doliolum 19 

Sphaeria frondicola 296 

Sphaeria herbarum 25 

Sphaeria infectoria 196 

Sphaeria isariphora 290 

Sphaeria juniperi 29 

Sphaeria lingam 22 

Sphaeria maculans 22 

Sphaeria michotii 27 

Sphaeria pertusa 28 

Sphaeria platani 28 

Sphaeria podagrariae 238 

Sphaeria praetermissa 21 

Sphaeria pulvis-pyrius 30 

Sphaeria rusci 366 

Sphaeria scirpicola 198 

Sphaeria scrophulariae 196 

Sphaeria siparia 30 

Sphaeria typhicola 25 

Sphaeronaema gentianae 19 

Sphaeronaema senecionis 20 

Sphaeronaema veronicae 20 

“Sphaeronema” gentianae 19 

Sphaerulina 271, 294, 296, 299, 301, 336, 339, 343 

Sphaerulina abeliceae 343 

Sphaerulina aceris 294, 299 

Sphaerulina amelanchier 343, 348 

Sphaerulina azaleae 345 

Sphaerulina berberidis 345 

Sphaerulina betulae 345 

Sphaerulina cercidis 298–299, 345 

Sphaerulina cornicola 295–296 

Sphaerulina frondicola 296 

Sphaerulina gei 296, 298–299 

Sphaerulina gei f. immarginata 298 

Sphaerulina hyperici 298 

Sphaerulina menispermi 345 

Sphaerulina musiva 296, 345 

Sphaerulina myriadea 294, 296, 339, 343 

Sphaerulina oxyacanthae 345 

Sphaerulina patriniae 298, 346 

Sphaerulina populicola 296, 299, 346 

Sphaerulina pseudovirgaureae 346–347 

Sphaerulina quercicola 347 

Sphaerulina rehmiana 299, 302, 343 

Sphaerulina rhabdoclinis 344, 348 

Sphaerulina rubi 300, 302, 343 

Sphaerulina socia 299 

Sphaerulina tirolensis 299–300 

Sphaerulina viciae 348–349 

Sphaerulina westendorpii 300, 302 

Spilosphaeria polygonorum 279 

Splanchnonema platani 28 

Sporidesmium alternariae 206 

Sporidesmium exitiosum var. dauci 201 

Sporidesmium longipedicellatum 201 

Sporidesmium polymorphum var. chartarum 201 

Sporidesmium scirpicola 198 

Sporidesmium scorzonerae 201 

Sporidesmium septorioides 188 

Sporormia minima 30 

Sporormiaceae 30 

Sporormiella minima 30 

Stagonospora 274, 298, 332–333, 362, 364, 377–379, 381 

Stagonospora “avena” 362 

Stagonospora avenae 362, 378 

Stagonospora biseptata 377 

Stagonospora caricis 379–380 

Stagonospora chenopodii 18 

Stagonospora duoseptata 377 

Stagonospora gigaspora 362 

Stagonospora nodorum 363, 378 

Stagonospora paludosa 333, 377–378 

Stagonospora paspali 28 

Stagonospora perfecta 378–379 

Stagonospora pseudocaricis 379–380 

Stagonospora pseudovitensis 379–380 

Stagonospora uniseptata 380–381 

Stagonospora vitensis 379–380 

Staninwardia 63 

Stemphylium alternariae 206 

Stemphylium atrum 204 

Stemphylium botryosum var. botrytis 206 

Stemphylium botryosum var. ulocladium 206 

Stemphylium consortiale 204 

Stemphylium herbarum 25 

Stemphylium ilicis 204 

Stemphylium petroselini 202 

Stemphylium radicinum 202 

Stemphylium radicinum var. petroselini 202 

Stenella 63 

Stenocarpella 333 

Stenocarpella macrospora 333 

Stenocarpella zeae 333 

Stictosepta 338 

Stictosepta cupularis 339 

Stigmina 61, 100 

Stigmina protearum var. leucadendri 91 

Strelitziana 60 

Strelitziana africana 60 

Strelitziana australiensis 60 

Strelitziana eucalypti 60 

Strelitziana mali 60 

Stromatoseptoria 353 

Stromatoseptoria castaneicola 353 


405

Subplenodomus 23 

Subplenodomus apiicola 23 

Subplenodomus drobnjacensis 23 

Subplenodomus valerianae 23 

Subplenodomus violicola 23 

T 

Teratosphaeria 63, 335, 358 

Teratosphaeria fibrillosa 63 

Teratosphaeriaceae 63–64, 358 

Teretispora 183, 204 

Teretispora leucanthemi 204 

Thaptospora 359 

Thedgonia 60–61 

Thedgonia ligustrina 61 

Thyridaria rubronotata 31 

Thyrospora radicina 202 

Torula alternata 186 

Trematosphaerella oryzae 368 

Trematosphaeria circinans 28 

Trematosphaeria pertusa 28, 30 

Trematosphaeria vindelicorum 28 

Trematosphaeriaceae 28 

Trichoconiella 183 

Trichoseptoria 334, 383 

Trichoseptoria alpei 334 

Trochophora 73, 75 

Trochophora simplex 76 

U 

Ulocladium 183, 189–190, 204, 206 

Ulocladium alternariae 206 

Ulocladium arborescens 201 

Ulocladium atrum 204 

Ulocladium botrytis 206 

Ulocladium brassicae 204 

Ulocladium cantlous 204 

Ulocladium capsici 201 

Ulocladium “capsicuma” 201 

Ulocladium chartarum 201 

Ulocladium chlamydosporum 199 

Ulocladium consortiale 204 

Ulocladium cucurbitae 204 

Ulocladium multiforme 204 

Ulocladium obovoideum 204 

Ulocladium oudemansii 206 

Ulocladium septosporum 201 

Ulocladium solani 204 

Ulocladium subcucurbitae 204 

Ulocladium tuberculatum 206 

Undifilum 183, 206 

Undifilum bornmuelleri 207 

Undifilum cinereum 207 

Undifilum fulvum 207 

Undifilum oxytropis 207 

V 

Vrystaatia 372–373 

Vrystaatia aloeicola 372 

W 

Westerdykella 30 

Westerdykella capitulum 30 

Westerdykella minutispora 31 

Westerdykella ornata 30–31 

X 

Xanthoriicola 63 

Xenobotryosphaeria 374–375 

Xenobotryosphaeria calamagrostidis 375 

Xenocercospora 67 

Xenocylindrosporium 337 

Xenocylindrosporium kirstenboschense 337 

Xenoseptoria 271, 371–372 

Xenoseptoria neosaccardoi 371 

Xenostigmina 61 

Xenostigmina zilleri 61 

Y 

Ybotromyces 183, 194 

Ybotromyces caespitosus 195 

Z 

Zasmidium 355 

Zymoseptoria 334, 353 

Zymoseptoria tritici 334 

406


Studies in Mycology 74 (March 2013) 

Development of Aspergillus niger 

Studies in Mycology 74: Development of Aspergillus niger 

J. Dijksterhuis and H.A.B. Wösten (eds) 

This issue of Studies in Mycology deals with vegetative growth and development of Aspergillus in general and A. niger 

Jan Dijksterhuis and Han Wösten, editors 

in particular. Aspergillus niger is a member of the Aspergillus section Nigri, a group of 26 species that are dubbed 

“the black Aspergilli”. Aspergillus niger is a cosmopolitan fungus. It can be isolated from all continents and is not very 

selective with respect to environmental conditions. Aspergillus niger is used as a cell factory for the production of 

enzymes and metabolites such as organic acids. 

The issue starts with a review on molecular mechanisms underlying differentiation processes in the vegetative 

mycelium and during asexual and sexual development of aspergilli. 

The articles of van Leeuwen et al. show that the RNA composition of dormant conidia is highly different from that 

of germinating conidia (i.e. of conidia during isotropic and polarized growth). The transcriptome of conidia changes 

most dramatically during the first two hours of germination enabling initiation of protein synthesis and respiration. The 

antifungal natamycin does neither affect differential expression of genes nor germination of A. niger conidia during 

the first 2 h of the process. Notably, subsequent stages of germination were effectively blocked by the anti-fungal 

compound, and the transcriptome inside the cells had changed thoroughly. The article of van Veluw et al. focusses on 

stages following germination namely the formation of micro-colonies. It is shown that micro-colonies of a control strain 



are smaller and more heterogeneous in size when compared to strains in which pigmentation genes are inactivated. 

An institute of the Royal Netherlands Academy of Arts and Sciences 

These results are of interest from a biotechnological point of view since productivity is related to the morphology of 

micro-colonies. The results of Van Veluw et al. also indicate the existence of transcriptionally and translationally highly 

active and lowly active hyphae in 1 mm wide micro-colonies of A. niger as was previously shown in macro-colonies with 

a diameter of about 5–7 cm. However, the existence of distinct populations of hyphae with high and low transcriptional 

and translational activity seems to be less robust when compared to macro-colonies. Why colonies have hyphae with different transcriptional and translational activity is still 

not clear but it may have a role in survival in an environment where conditions are dynamic. The article of Bleichrodt et al. focusses on sporulating colonies. Evidence is 

presented that GFP but not mRNA streams from the vegetative mycelium to conidiophores. Apparently, flow of molecules to the reproductive structure is selective. Absence 

of RNA streaming would explain why distinct RNA profiles were found in the aerial mycelium when compared to the vegetative mycelium. Future studies should reveal why 

GFP flows but mRNA does not. 

85 pp., fully illustrated with colour pictures (A4 format), paperback, 2013. € 40 

Studies in Mycology 73: Colletotrichum: complex species or species complexes? 

U. Damm, P.F. Cannon and P.W. Crous (eds) 

This volume of Studies in Mycology is dedicated to Brian C. Sutton, in honour of his scientific contributions to our present 

understanding of the genus Colletotrichum, and for providing a framework for morphology-based identification of taxa in 

the genus. The volume consists of contributions that revise three of the major Colletotrichum species complexes, and a 

concluding paper that summarises the present situation. It provides an online identification tool to all presently recognised 

species, and also gives insight into future research directions. The research papers continue the trend of applying multilocus 

phylogenetics to elucidate cryptic species complexes, and in the process designates numerous epitype specimens 

to fix the genetic application of names. Furthermore, numerous novel taxa are introduced in the C. acutatum (treating 

31 taxa, and introducing 21 novel species), C. boninense (treating 17 taxa, and introducing 12 novel species), and C. 

gloeosporioides (treating numerous taxa of which 22 are accepted, and introducing 9 novel taxa, as well as one novel 

subspecies) species complexes. Although some species appear to have preferences to specific hosts or geographical 

regions, others are plurivorous and are present in multiple regions. The future for Colletotrichum biology will thus have 

to rely on consensus classification and robust online identification tools. In support of these goals, a Subcommission on 

Colletotrichum has been formed under the auspices of the International Commission on Taxonomy of Fungi, which will 

administer a carefully curated barcode database for sequence-based identification of species within the BioloMICS web 

environment. 

Studies in Mycology 73 (September 2012) 

Colletotrichum: complex species or species 

complexes? 

Ulrike Damm, Paul F. Cannon and Pedro W. Crous, editors 





Studies in Mycology 72 (June 2012) 

The genus Cladosporium 

Konstanze Bensch, Uwe Braun, Johannes Z. Groenewald and Pedro W. Crous 




Studies in Mycology 72: The genus Cladosporium 

K. Bensch, U. Braun, J.Z. Groenewald and P.W. Crous 

A monographic revision of the hyphomycete genus Cladosporium s. lat. (Cladosporiaceae, Capnodiales) is presented. It 

includes a detailed historic overview of Cladosporium and allied genera, with notes on their phylogeny, systematics and 

ecology. True species of Cladosporium s. str. (anamorphs of Davidiella), are characterised by having coronate conidiogenous 

loci and conidial hila, i.e., with a convex central dome surrounded by a raised periclinal rim. Recognised species are 

treated and illustrated with line drawings and photomicrographs (light as well as scanning electron microscopy). Species 

known from culture are described in vivo as well as in vitro on standardised media and under controlled conditions. Details 

on host range/substrates and the geographic distribution are given based on published accounts, and a re-examination 

of numerous herbarium specimens. Various keys are provided to support the identification of Cladosporium species in 

vivo and in vitro. Morphological datasets are supplemented by DNA barcodes (nuclear ribosomal RNA gene operon, 

including the internal transcribed spacer regions ITS1 and ITS2, the 5.8S nrDNA, as well as partial actin and translation 

elongation factor 1-α gene sequences) diagnostic for individual species. In total 993 names assigned to Cladosporium s. 

lat., including Heterosporium (854 in Cladosporium and 139 in Heterosporium), are treated, of which 169 are recognised 

in Cladosporium s. str. The other taxa are doubtful, insufficiently known or have been excluded from Cladosporium in its 

current circumscription and re-allocated to other genera by the authors of this monograph or previous authors. 


For a complete list of all CBS-KNAW publications, please visit our website www.cbs.knaw.nl

CBS Laboratory Manual Series 

, 

Food and Indoor Fungi 

cbs laboratory manual series 

Food and Indoor Fungi 

R.A. Samson, J. Houbraken, U. Thrane, J. C. Frisvad & B. Andersen 

CBS Laboratory Manual Series 2: Food and Indoor Fungi 

R.A. Samson, J. Houbraken, U. Thrane, J.C. Frisvad and B. Andersen 

This book is the second in the new CBS Laboratory Manual Series and is based on the seventh edition 

of INTRODUCTION TO FOOD AND AIRBORNE FUNGI. This new version, FOOD AND INDOOR 

FUNGI, has been transformed into a practical user’s manual to the most common micro-fungi found 

in our immediate environment – on our food and in our houses. The layout of the book starts at the 

beginning with the detection and isolation of food borne fungi and indoor fungi in chapters 1 and 2, 

describing the different sampling techniques required in the different habitats. Chapter 3 deals with 

the three different approaches to identification: morphology, genetics and chemistry. It lists cultivation 

media used for the different genera and describes step by step how to make microscope slides and 

tape preparations for morphological identification. The chapter also describes how to do molecular 

and chemical identification from scratch, how to evaluate the results and warns about pitfalls. 

Chapter 4 gives all the identification keys, first for the major phyla (Ascomycetes, Basidiomycetes 

and Zygomycetes) common on food and indoors, then to the different genera in the Zygomycetes and 

the Ascomycetes, with a large section on the anamorphic fungi and a section for yeasts. The section 

on anamorphic fungi contains two keys to the different genera: a dichotomous key and a synoptic key. 

For each genus a key to the species treated is provided, followed by entries on the different species. 

For each species colour plates are accompanied by macro- and a micro-morphological descriptions, 

information on molecular and chemical identification markers, production of mycotoxins, habitats 

and physiological and ecological characteristics. The book is concluded with an extensive reference 

list and appendices on the associated mycobiota on different food types and indoor environments, 

mycotoxins and other secondary metabolites, a glossary on the mycological terms used in the book 

and lastly a detailed appendix on the media used for detection and identification. 

CBS · KNAW · Fungal Biodiversity Centre Utrecht, The Netherlands 


390 pp., fully illustrated with colour pictures (A4 format). Hardbound, 2010. € 70 

CBS Laboratory Manual Series 1: Fungal Biodiversity 

P.W. Crous, G.J.M. Verkley, J.Z. Groenewald and R.A. Samson (eds) 

This book is the first in the new “CBS Laboratory Manual Series”, and focuses on techniques for 

isolation, cultivation, molecular and morphological study of fungi and yeasts. It has been developed 

as a general text, which is based on the annual mycology course given at the CBS-KNAW Fungal 

Biodiversity Centre (Centraalbureau voor Schimmelcultures). It provides an introductory text to 

systematic mycology, starting with a concise treatise of Hyphochytridiomycota and Oomycota, which 

have long been subject of study by mycologists, but are now classified in the Kingdom Chromista. 

These are followed by sections on the groups of “true fungi”: Chytridiomycota, Zygomycota, 

Ascomycota and Basidiomycota. This descriptive part is illustrated by figures of life-cycles and 

schematic line-drawings as well as photoplates depicting most of the structures essential for the study 

and identification of these fungi. Special attention is given to basic principles of working with axenic 

cultures, good morphological analysis, and complicated issues for beginners such as conidiogenesis 

and the understanding of life-cycles. Exemplar taxa for each of these fungal groups, in total 37 

mostly common species in various economically important genera, are described and illustrated in 

detail. In a chapter on general methods a number of basic techniques such as the preparation and 

choice of media, microscopic examination, the use of stains and preparation of permanent slides, 

and herbarium techniques are explained. Further chapters deal with commonly used molecular 

and phylogenetic methods and related identification tools such as BLAST and DNA Barcoding, 

fungal nomenclature, ecological groups of fungi such as soil-borne and root-inhabiting fungi, water 

moulds, and fungi on plants and of quarantine importance. Some topics of applied mycology are also 

treated, including fungi in the air- and indoor environment and fungi of medical importance. Common 

mycological terminology is explained in a glossary, with reference to illustrations in the book. A 

chapter providing more than 60 mycological media for fungal cultivation, and a comprehensive list of 

cited references are also provided. The book is concluded with an index, and dendrograms reflecting 

our current understanding of the evolutionary relationships within the Fungi. 

270 pp., fully illustrated with colour pictures (A4 format). Hardbound, 2009. € 50 

CBS 001 Omslag CBS Laboratory manual series 4dec09_Original Green.indd 1 

Fungal Biodiversity 

1 

cbs laboratory manual series 

Fungal Biodiversity 

Edited by 

P.W. Crous, G.J.M. Verkley, J.Z. Groenewald & R.A. Samson 

CBS · KNAW · Fungal Biodiversity Centre Utrecht, The Netherlands 


12/7/2009 2:15:04 PM 


ering plants in the Southern Hemisphere. Because of their beauty, unique 

aceae cut-flowers have become a highly desirable crop for the export 

industry that provides employment in countries where these flowers are 

ctive agriculturally. Diseases cause a loss in yield, and also limit the export 

ations. In this publication the fungi that cause leaf, stem and root diseases 

e treated. Data are provided pertaining to the taxonomy, identification, 

ar characteristics and control of these pathogens. Taxonomic descriptions 

uded to distinguish species in genera where a number of species affect 

nd colour photographs are included. Where known, factors that affect 

anagement strategies are also presented that will assist growers and 

cing disease in specific areas. Information is also provided relating to crop 

g and export considerations. Further development and expansion of this 

isease-free germplasm from countries where these plants are indigenous. 

fungi that occur on Proteaceae, and to establish the distribution of these 

ne services for use in risk assessments. 

annia – Leptographium – Sporothrix. These are 

lagued forestry and agriculture for millennia, and 

s. Their symbioses with insects, particularly bark 

tic mites, allow them to rapidly spread into new 

try, from one continent to another. Whether they 

f lumber, or diseases of root crops or coffee, the 

uarantine and biosecurity specialists who regulate 

k provides new perspectives on the taxonomy, 

i, new information on their occurrence in previously 

reviews their interactions with invertebrates, their 

iological control might play in controlling them. 

216mm 

iversity Series 13 

CBS Biodiversity Series 

Cultivation and Diseases of Proteaceae 

Crous • Denman • Taylor • Swart • Bezuidenhout • Hoffman • Palm • Groenewald 

24mm 


Cultivation and Diseases of 

Proteaceae: 

Leucadendron, Leucospermum and Protea 

No. 13: Cultivation and Diseases of Proteaceae: Leucadendron, Leucospermum and Protea 

Pedro W. Crous, Sandra Denman, Joanne E. Taylor, Lizeth Swart, Carolien M. Bezuidenhout, Lynn Hoffman, Mary E. Palm and Johannes 

Z. Groenewald 

Proteaceae represent a prominent family of flowering plants in the Southern Hemisphere. Because of their beauty, unique appearance, and 

relatively long shelf life, Proteaceae cut-flowers have become a highly desirable crop for the export market. The cultivation of Proteaceae 

is a thriving industry that provides employment in countries where these flowers are grown, often in areas that are otherwise unproductive 

agriculturally. Diseases cause a loss in yield, and also limit the export of these flowers due to strict phytosanitary regulations. In this 

publication the fungi that cause leaf, stem and root diseases on Leucadendron, Leucospermum and Protea are treated. Data are provided 

pertaining to the taxonomy, identification, host range, distribution, pathogenicity, molecular characteristics and control of these pathogens. 

Pedro W. Crous, Sandra Denman, Joanne E. Taylor, Lizeth Swart, Taxonomic descriptions and illustrations are provided and keys are included to distinguish species in genera where a number of species affect 

Carolien M. Bezuidenhout, Lynn Hoffman, 

13 

Mary E. Palm & Johannes Z. Groenewald 

Proteaceae. Disease symptoms are described and colour photographs are included. Where known, factors that affect disease epidemiology 

are discussed. Disease management strategies are also presented that will assist growers and advisors in making appropriate choices for 

reducing disease in specific areas. Information is also provided relating to crop improvement, cultivation techniques, harvesting and export considerations. Further development and 

expansion of this industry depends on producing and obtaining disease-free germplasm from countries where these plants are indigenous. For that reason it is important to document 

the fungi that occur on Proteaceae, and to establish the distribution of these fungi. These data are essential for plant quarantine services for use in risk assessments. 

303mm 

ersity Series 12 

360 pp., fully illustrated (A4 format). Hardbound, 2013. € 75 

Fold area 

No. 12: Ophiostomatoid Fungi: Expanding Frontiers 

OphiOStOmAtOid Fungi – Expanding Spine 23mm Frontiers 

Seifert . de Beer . Wingfield 

12 

OphiOStOmAtOid Fungi 

Expanding Frontiers 

Edited by Keith A. Seifert, Z. Wilhelm de Beer 

& Michael J. Wingfield 

Keith A. Seifert, Z. Wilhelm de Beer and Michael J. Wingfield (eds) 

The 1992 Convention on Biological Diversity created a new awareness of the economic impact of living organisms. Regulators and 

quarantine specialists in governments all over the world now scrutinise dots on maps, as real-time online disease mapping and prediction 

models allow us to track (and try to prevent) the spread of diseases across borders. Woodlands are more managed, include less genetic 

diversity, and seem to be more susceptible to rapidly spreading disease. Different jurisdictions use different terminology, Biosecurity, 

Alien Invasive Species, Quarantine, but it is now commonplace to see large signs in airports, along highways, and on public hiking 

trails, warning citizens not to accidentally or deliberately facilitate the spread of unwanted pests or microbes. With the ophiostomatoid 

fungi, scientists have to cope with the overlapping behaviour of a triumvirate of kingdoms, the fungi, the animals (bark beetles, mites or 

nematodes), and how all of these impact trees in our forests and cities. 

This book includes 21 papers divided among five themes, plus an appendix. It is a sequel to Ceratocystis and Ophiostoma: Taxonomy, 

Ecology, and Pathogenicity, published by the APS Press in 1993, and like that book is derived from an international symposium, this 

one held on North Stradbroke Island, Australia prior to the 9 th International Mycological Congress. A year before this volume was completed, mycological taxonomy formally 

abandoned the historical two name system, known as dual nomenclature, and we are now adopting a single name binomial system. The appendix to this book provides a 

preliminary view of the nomenclature of the ophiostomatoid fungi using the new single name system. In an attempt at consistency, this naming system is used in all chapters. 

337 pp., fully illustrated (A4 format). Hardbound, 2013. € 75 

ersity Series 11 

Taxonomic Manual of the Erysiphales 

(Powdery Mildews) 

Uwe Braun . Roger T.A. Cook 

11 

Taxonomic Manual 

of the Erysiphales 

(Powdery Mildews) 

Uwe Braun 

Roger T.A. Cook 

No. 11: Taxonomic Manual of the Erysiphales (Powdery Mildews) 

Uwe Braun and Roger T.A. Cook 

The “Taxonomic Manual of the Erysiphales (Powdery Mildews)” is a fully revised, expanded new version of U. Braun’s former monograph 

from 1987, which is out of print. The present book covers the taxonomy of all powdery mildew fungi. New chapters have been prepared 

for phylogenetic relationships, conidial germination, conidia as viewed by Scanning Electron Microscopy, fossil powdery mildews, 

and holomorph classification. The treatment of the Erysiphales, its tribes and genera are based on recent molecular phylogenetic 

classifications. A key to the genera (and sections), based on teleomorph and anamorph characters is provided, supplemented by 

a key solely using anamorph features. Keys to the species are to be found under the particular genera. A special tabular key to 

species based on host families and genera completes the tools for identification of powdery mildew taxa. In total, 873 powdery mildew 

species are described and illustrated in 853 figures (plates). The following data are given for the particular species and subspecific 

taxa: bibliographic data, synonyms, references to descriptions and illustrations in literature, full descriptions, type details, host range, 

distribution and notes. A further 236 taxonomic novelties are introduced, comprising the new genus Takamatsuella, 55 new species, 

four new varieties, six new names and 170 new combinations. A list of excluded and doubtful taxa with notes and their current status is attached, followed by a list of references 

and a glossary. This manual deals with the taxonomy of the Erysiphales worldwide, and provides an up-todate basis for the identification of taxa, as well as comprehensive 

supplementary information on their biology, morphology, distribution and host range. This monograph is aimed at biologists, mycologists and phytopathologists that encounter 

or study powdery mildew diseases. 

707 pp., fully illustrated with 853 pictures and line drawings (A4 format). Hardbound, 2012. € 80 

rsity Series 10 

Guarro . Gene . Stchigel . Figueras 

10 

Atlas of Soil Ascomycetes 

Atlas of Soil 

Ascomycetes 

JOSEP GUARRO 

JOSEPA GENĖ 

ALBERTO M. STCHIGEL 

M. JOSĖ FIGUERAS 

No. 10: Atlas of Soil Ascomycetes 

Josep Guarro, Josepa Gené, Alberto M. Stchigel and M. José Figueras 

This compendium includes almost all presently known species of ascomycetes that have been reported in soil and which sporulate in 

culture. They constitute a very broad spectrum of genera belonging to very diverse orders, but mainly to the Onygenales, Sordariales, 

Eurotiales, Thelebolales, Pezizales, Melanosporales, Pleosporales, Xylariales, Coniochaetales and Microascales. The goal of this 

book is to provide sufficient data for users to recognise and identify these species. It includes the description of 146 genera and 

698 species. For each genus a dichotomous key to facilitate species identification is provided and for each genus and species the 

salient morphological features are described. These descriptions are accompanied by line drawings illustrating the most representative 

structures. Light micrographs, supplemented by scanning electron micrographs and Nomarski interference contrast micrographs of 

most of the species treated in the book are also included. In addition, numerous species not found in soil but related to those included 

in this book are referenced or described. This book will be of value not only to soil microbiologists and plant pathologists concerned with 

the soilborne fungi and diseases, but also to anyone interested in identifying fungi in general, because many of the genera included here 

are not confined to soil. Since most of the fungi of biotechnological or clinical interest (dermatophytes, dimorphic fungi and opportunists) 

are soil-borne ascomycetes, the content of this book is of interest for a wide range of scientists. 

486 pp., fully illustrated with 322 pictures and line drawings (A4 format). Hardbound, 2012. € 70 



No. 9: The Genera of Hyphomycetes 

Keith Seifert, Gareth Morgan-Jones, Walter Gams and Bryce Kendrick 

The Genera of Hyphomycetes is the essential reference for the identification of moulds to all those who work with these fungi, 

including plant pathologists, industrial microbiologists, mycologists and indoor environment specialists, whether they be professionals 

or students. The book compiles information on about 1480 accepted genera of hyphomycetes, and about 1420 genera that are 

synonyms or names of uncertain identity. Each accepted genus is described using a standardized set of key words, connections with 

sexual stages (teleomorphs) and synanamorphs are listed, along with known substrates or hosts, and continental distribution. When 

available, accession numbers for representative DNA barcodes are listed for each genus. A complete bibliography is provided for each 

genus, giving the reader access to the literature necessary to identify species. Most accepted genera are illustrated by newly prepared 

line drawings, including many genera that have never been comprehensively illustrated before, arranged as a visual synoptic key. 

More than 200 colour photographs supplement the line drawings. Diagnostic keys are provided for some taxonomic and ecological 

groups. Appendices include an integrated classification of hyphomycete genera in the phylogenetic fungal system, a list of teleomorphanamorph 

connections, and a glossary of technical terms. With its combination of information on classical morphological taxonomy, 

molecular phylogeny and DNA diagnostics, this book is an effective modern resource for researchers working on microfungi. 

997 pp., fully illustrated with colour pictures and line drawings (A4 format). Hardbound, 2011. € 80 

Other CBS publications 

Atlas of Clinical Fungi CD-ROM version 3.1 

G.S. de Hoog, J. Guarro, J. Gené and M.J. Figueras (eds) 

A new electronic version of the 3rd edition is available since November 2011. It will allows fast and very comfortable search through 

the entire Atlas text the engine is fully equiped for simple as well as advanced search. Items are strongly linked enabling direct use 

of the electronic version as a benchtool for identification and comparison. Text boxes with concise definitions appear explaining all 

terminology while reading. Illustrations are of highest quality and viewers are provided for detailed observation. The Atlas is interactive 

in allowing personal annotation which will be maintained when later versions will be downloaded. 

The electronic version has been developed by T. Weniger. The third edition will contain about 530 clinically relevant species, following 

all major developments in fungal diagnostics. Regular electronic updates of the Atlas are planned, which should include numerous 

references to case reports, as well as full data on antifungals. Future features will include links to extended databases with verified 

molecular information. Note: The Atlas runs on Windows only! Not compatible with Mac 

Atlas of Clinical Fungi version 3.1, interactive CD-ROM, 2011. € 105 

Identification of Common Aspergillus Species 

Maren A. Klich 

Descriptions and identification keys to 45 common Aspergillus species with their teleomorphs (Emericella, Eurotium, Neosartorya and 

Sclerocleista). Each species is illustrated with a one page plate and three plates showing the most common colony colours. 

116 pp., 45 black & white and 3 colour plates (Letter format), paperback, 2002. € 45 

A revision of the species described in Phyllosticta 

Huub A. van der Aa and Simon Vanev 

2936 taxa are enumerated, based on the original literature and on examination of numerous herbarium (mostly type) specimens 

and isolates. 203 names belong to the genus Phyllosticta s.str., and are classified in 143 accepted species. For seven of them new 

combinations are made and for six new names are proposed. The great majority, 2733 taxa, were redisposed to a number of other 

genera. A complete list of these novelties, as included in the book’s abstract, can also be consulted on the web-site of CBS. 

510 pp. (17 x 25 cm), paperback, 2002. € 55 


Studies in Mycology (ISSN 0166-0616) 

The CBS taxonomy series “Studies in Mycology” is issued as individual booklets. Regular subscribers receive each issue automatically. Prices of backvolumes 

are specified below. 

For more information and ordering of other CBS books and publications see www.cbs.knaw.nl and www.studiesinmycology.org. 

75 Crous PW, Verkley GJM, Groenewald JZ (eds) (2013). Phytopathogenic Dothideomycetes. 406 pp., € 70.00 

74 Dijksterhuis J, Wösten H (eds) (2013). Development of Aspergillus niger. 85 pp., €40.00 

73 Damm U, Cannon PF, Crous PW (eds) (2012). Colletotrichum: complex species or species complexes? 217 pp., € 65.00 

72 Bensch K, Braun U, Groenewald JZ, Crous PW (2012). The genus Cladosporium. 401 pp., € 70.00 

71 Hirooka Y, Rossmann AY, Samuels GJ, Lechat C, Chaverri P (2012). A monograph of Allantonectria, Nectria, and Pleonectria (Nectriaceae, Hypocreales, 

Ascomycota) and their pycnidial, sporodochial, and synnematous anamorphs. 210 pp., € 65.00 

70 Samson RA, Houbraken J (eds) (2011). Phylogenetic and taxonomic studies on the genera Penicillium and Talaromyces. 183 pp., € 60.00 

69 Samson RA, Varga J, Frisvad JC (2011). Taxonomic studies on the genus Aspergillus. 97 pp., € 40.00 

68 Rossman AY, Seifert KA (eds) (2011). Phylogenetic revision of taxonomic concepts in the Hypocreales and other Ascomycota - A tribute to Gary J. 

Samuels. 256 pp., € 65.00 

67 Bensch K, Groenewald JZ, Dijksterhuis J, Starink-Willemse M, Andersen B, Summerell BA, Shin H-D, Dugan FM, Schroers H-J, Braun U, Crous PW 

(2010). Species and ecological diversity within the Cladosporium cladosporioides complex (Davidiellaceae, Capnodiales). 96 pp., € 40.00 

66 Lombard L, Crous PW, Wingfield BD, Wingfield MJ (2010). Systematics of Calonectria: a genus of root, shoot and foliar pathogens. 71 pp., € 40.00 

65 Aveskamp M, Gruyter H de, Woudenberg J, Verkley G, Crous PW (2010). Highlights of the Didymellaceae: A polyphasic approach to characterise 

Phoma and related pleosporalean genera. 64 pp., € 40.00 

64 Schoch CL, Spatafora JW, Lumbsch HT, Huhndorf SM, Hyde KD, Groenewald JZ, Crous PW (2009). A phylogenetic re-evaluation of Dothideomycetes. 

220 pp., € 65.00 

63 Jaklitsch WA (2009). European species of Hypocrea. Part I. The green-spored species. 93 pp., € 40.00 

62 Sogonov MV, Castlebury LA, Rossman AY, Mejía LC, White JF (2008). Leaf-inhabiting genera of the Gnomoniaceae, Diaporthales. 79 pp., € 40.00 

61 Hoog GS de, Grube M (eds) (2008). Black fungal extremes. 198 pp., € 60.00 

60 Chaverri P, Liu M, Hodge KT (2008). Neotropical Hypocrella (anamorph Aschersonia), Moelleriella, and Samuelsia. 68 pp., € 40.00 

59 Samson RA, Varga J (eds) (2007). Aspergillus systematics in the genomic era. 206 pp., € 65.00 

58 Crous PW, Braun U, Schubert K, Groenewald JZ (eds) (2007). The genus Cladosporium and similar dematiaceous hyphomycetes. 253 pp., € 65.00 

57 Sung G-H, Hywel-Jones NL, Sung J-M, Luangsa-ard JJ, Shrestha B, Spatafora JW (2007). Phylogenetic classification of Cordyceps and the 

clavicipitaceous fungi. 63 pp., € 40.00 

56 Gams W (ed.) (2006). Hypocrea and Trichoderma studies marking the 90 th birthday of Joan M. Dingley. 179 pp., € 60.00 

55 Crous PW, Wingfield MJ, Slippers B, Rong IH, Samson RA (2006). 100 Years of Fungal Biodiversity in southern Africa. 305 pp., € 65.00 

54 Mostert L, Groenewald JZ, Summerbell RC, Gams W, Crous PW (2006). Taxonomy and Pathology of Togninia (Diaporthales) and its Phaeoacremonium 

anamorphs. 115 pp., € 55.00 

53 Summerbell RC, Currah RS, Sigler L (2005). The Missing Lineages. Phylogeny and ecology of endophytic and other enigmatic root-associated fungi. 

252 pp., € 65.00 

52 Adams GC, Wingfield MJ, Common R, Roux J (2005). Phylogenetic relationships and morphology of Cytospora species and related teleomorphs 

(Ascomycota, Diaporthales, Valsaceae) from Eucalyptus. 147 pp., € 55.00 

51 Hoog GS de (ed.) (2005). Fungi of the Antarctic, Evolution under extreme conditions. 82 pp., € 40.00 

50 Crous PW, Samson RA, Gams W, Summerbell RC, Boekhout T, Hoog GS de, Stalpers JA (eds) (2004). CBS Centenary: 100 Years of Fungal Biodiversity 

and Ecology (Two parts). 580 pp., € 105.00 

49 Samson RA, Frisvad JC (2004). Penicillium subgenus Penicillium: new taxonomic schemes, mycotoxins and other extrolites. 253 pp., € 55.00 

48 Chaverri P, Samuels GJ (2003). Hypocrea/Trichoderma (Ascomycota, Hypocreales, Hypocreaceae): species with green ascospores. 113 pp., € 55.00 

47 Guarro J, Summerbell RC, Samson RA (2002). Onygenales: the dermatophytes, dimorphics and keratin degraders in their revolutionary context. 220 

pp., € 55.00 

46 Schroers HJ (2001). A monograh of Bionectria (Ascomycota, Hypocreales, Bionectriaceae) and its Clonostachys anamorphs. 214 pp., € 55.00 

45 Seifert KA, Gams W, Crous PW, Samuels GJ (eds) (2000). Molecules, morphology and classification: Towards monophyletic genera in the Ascomycetes. 

200 pp., € 55.00 

44 Verkley GJM (1999). A monograph of the genus Pezicula and its anamorphs. 180 pp., € 55.00 

43 Hoog GS de (ed.) (1999). Ecology and evolution of black yeasts and their relatives. 208 pp., € 55.00 

42 Rossman AY, Samuels GJ, Rogerson CT, Lowen R (1999). Genera of Bionectriaceae, Hypocreaceae and Nectriaceae (Hypocreales, Ascomycetes). 248 

pp., € 55.00 

41 Samuels GJ, Petrini O, Kuhls K, Lieckfeldt E, Kubicek CP (1998).The Hypocrea schweinitzii complex and Trichoderma sect. Longibrachiatum. 54 pp., € 

35.00 

40 Stalpers JA (1996). The aphyllophoraceous fungi II. Keys to the species of the Hericiales. 185 pp., € 25.00 

39 Rubner A (1996). Revision of predacious hyphomycetes in the Dactylella-Monacrosporium complex. 134 pp., € 25.00 

38 Boekhout T, Samson RA (eds) (1995). Heterobasidiomycetes: Systematics and applied aspects. 190 pp., € 35.00 

37 Aptroot A (1995). A monograph of Didymosphaeria. 160 pp., € 30.00 

36 Swertz CA (1994). Morphology of germlings of urediniospores and its value for the identification and classification of grass rust fungi. 152 pp., € 30.00 

35 Stalpers JA (1993). The aphyllophoraceous fungi I. Keys to the species of the Thelephorales. 168 pp. (out of stock). 

34 Reijnders AFM, Stalpers JA (1992). The development of the hymenophoral trama in the Aphyllophorales and the Agaricales. 109 pp., € 25.00 

For a complete list of the Studies in Mycology see www.cbs.knaw.nl.

Phytopathogenic Dothideomycetes - CBS - KNAW

Create successful ePaper yourself

Delete template?

Save as template?