BARLEY GENETICS NEWSLETTER - GrainGenes - US Department ...

Barley Genetics Newsletter 

Volume 37 

Editorial Committee 

P. Bregitzer 

U. Lundqvist 

V. Carollo Blake

Table of Contents 

Information about the Barley Genetics Newsletter 

The Barley Genetics Newsletter is published electronically at 

http://wheat.pw.usda/gov/ggpages/bgn 

Contributions for publication in the Barley Genetics Newsletter should be sent to the 

Technical Editor, Dr. Phil Bregitzer (see Instructions to contributors below for details on 

submission). Reports on research activities (including ongoing projects, descriptions of 

new genetic and cytological techniques, and current linkage maps) are invited for the 

Research Notes section. Researchers are encouraged to submit descriptions of genetic 

stocks for the Barley Genetic Stocks section. Letters to the editors are welcome and will 

be published. Please inform the Technical Editor of any errors you notice in this volume 

or in previous volumes; corrections will be published in future volumes, and electronic 

copy will be appropriately corrected. 

All correspondence and contributions to the Barley Genetics Newsletter should be in 

English. Please include your complete mailing address, including your country, and an email 

address (if you have one) with all correspondence and contributions. 

Acknowledgements 

The contributors of research reports and the diligence of the many Coordinators make 

this publication possible. Victoria Carollo Blake and the GrainGenes team at the USDA- 

ARS make possible the electronic version of BGN.

Instructions for contributors 

Volume 37 (2007) of the Barley Genetics Newsletter 

Submissions will be published via the internet (http://wheat.pw.usda.gov/ggpages/bgn/). 

Approximately quarterly, new submissions will be appended to existing submissions; the 

page numbers of existing submissions will not change and citation information will 

remain constant. BGN 37 will consist of all submissions received prior to the end of the 

calendar year of 2007, and will be compiled into a printable version that will be available 

via the Graingenes website. Send submissions to: 

Dr. Phil Bregitzer, BGN Technical Editor, 

USDA-ARS, 1691 S. 2700 W., 

Aberdeen, ID, 83210, USA. 

Telephone: (voice) 208-397-4162 ext. 116; (fax) 208-397-4165 

e-mail: pbregit@uidaho.edu 

Coordinators assigned at the International Barley Genetics Symposium should submit 

their reports to: 

Dr. Udda Lundqvist 

Coordinator, Barley Genetics Newsletter 

Nordic Genetic Resource Center 

P.O. Box 41 

SE-230 53 Alnarp, Sweden 

Phone: +46 40 536640 

FAX: +46 40 536650 

Cell phone: +46 70 624 1502 

E-mail: udda@nordgen.org 

Manuscripts should be written in English and be brief. Each paper should be prepared 

separately, with the title and the authors' names and addresses at the top of the first page. 

For each paper to be included in Barley Genetics Newsletter Volume 37, submit a file to 

the Technical Editor in one of the following ways (in order of preference): 

1. As an attachment to an e-mail message 

2. A 3.5" diskette or CD; include also one high quality printed copy 

3. High-quality paper copy (acceptable only in unusual circumstances) 

Instructions for file preparation 

Text and tables for each article can be in one file, but place each figure in a separate file. 

Name these files with your initials, a manuscript number, and "txt" or "fig" (in the case of 

separate files for text and figures), and a number for each figure (in the case of separate 

files). For example, the files for a manuscript plus two figures from Phil Bregitzer would 

be: pb1txt.wpd, pb1fig1.gif , and pb1fig2.gif .

File Formats for Text and Tables: Preferred: Word or WordPerfect, PC-compatible 

formatting. Macintosh formats are not acceptable. 

Please keep formatting simple and consistent with that of BGN 36. Use Times New 

Roman Font, 12 pt, with both right and left justification, except for the title and author 

information and tables, which should be centered. Please use only tabs and hard returns in 

the preparation of text files. Tables must be prepared using the table feature of your word 

processing program, and not prepared using tabs. Please do not add additional lines to 

your table except with the table formatting tools in your word processor. Please use 

center justification for tables, and not "full" justification (i.e. left and right justification, 

that is used for text). Figures can be submitted in any common format but avoid the 

necessity of color for interpretation, to enable printing and copying hardcopy in black and 

white without losing information contained in the figures.

Table of Contents 

Barley Genetics Newsletter, Volume 37, 2007 

[Other volumes of the Barley Genetics Newsletter] 

Click here for a complete printable version of Volume 37 (Please Note: 2.12 MB) 

Information about the Barley Genetics Newsletter, p. i 

Instructions for contributors, p. ii 

Research Notes 

Dominance and recessiveness of parameters of Aluminum-resistance of 

barley F2 hybrids at different concentrations of stress factor (.doc, .pdf) 

F. M. Lisitsyn, I. I. Lisitsyna 

Frequency distributions and composite interval mapping for QTL 

analysis in ‘Steptoe’ x ‘Morex’ barley mapping population (.doc, pdf) 

H. S. Rao, O. P. Basha, N. K. Singh, K. Sato, H. S. Dhaliqal 

PCR-based markers targeting barley putative grain yield and quality 

QTLs regions (.doc, pdf) 

I. A. del Blanco, D. A. Schmierer, A. Kleinhofs , S. E. Ullrich 

Genetic architecture for yield and quality component traits over two 

environments in barley (Hordeum vulgare L.) (.doc, .pdf) 

A. K. Verma, S.R. Vishwakarma and P.K. Singh 

Line x tester analysis in barley (Hordeum vulgare L.) across 

environments (.doc, .pdf) 

A. K. Verma, S.R. Vishwakarma and P.K. Singh 

Four new barley mutants (.doc, .pdf) 

S.A.I .Wright, M. Azarang, A. B. Falk 

The Scandinavian barley chlorophyll mutant collection (.doc, .pdf) 

M. Hansson 

CAPS markers targeting barley Rpr1 region (.doc, .pdf) 

L. Zhang, A. Kleinhofs 

1 – 4 

5 - 20 

21 - 23 

24 - 28 

29 - 33 

34 - 36 

37 - 43 

44 - 46 

Tolerance to high copper ions concentration in the nutrient medium of 47 - 49

some Bulgarian cultivars (.doc, .pdf) 

J. Stoinova, S. Phileva, M. Merakchyiska, S. Paunova 

Coordinator's Reports 

Rules for Nomenclature and Gene Symbolization in Barley (.doc, .pdf) 

J. D. Franckowiak , U. Lundqvist 

Overal Coordinator's Report (.doc, .pdf) 

U. Lundqvist 

Barley Genetic Stocks for 2007 (.doc, .pdf) 

L. Dahleen, J.D. Franckowiak, U. Lundqvist 

Descriptions of Barley Genetic Stocks for 2007 (.doc, .pdf) 

L. Dahleen, J.D. Franckowiak, U. Lundqvist 

100 - 104 

105 - 153 

153 - 187 

188 - 301

Barley Genetics Newsletter 37:1-4 (2007) 

Dominance and recessiveness of parameters of Aluminum-resistance of barley 

F2 hybrids at different concentrations of stress factor 

E. M. Lisitsyn and I. I. Lisitsyna 

North-East Agricultural Research Institute, 166-а Lenin street, Kirov, 610007, Russia 

e-mail: edaphic@mail.ru 

Till now there is no uniform opinion in the scientific literature about number and type of 

action of genes coding barley aluminum resistance. For example, Rigin, Yakovleva (2001) 

considers, that it is controlled by two oligogenes, as a minimum, with possible action of genes 

with weaker effect. Other authors assume the control of the parameter by one dominant gene Pht 

[Stolen, Andersen, 1978], or gene Alp [Reid, 1971], both located on chromosome 4 [Minella, 

Sorrells, 1997]. 

Gourley et al [1990] concluded, that type of action of genes coding aluminum resistance in 

sorghum (additive, partially or completely dominant), depends not only on a researched genotype, 

but also on used Al concentration. Aniol [1995, 1996] has established, that when the 

concentration of aluminum in test solution is low (30-40 µМ), cereal cultures (wheat, rye) use 

mechanisms that block accumulation of aluminum in roots (for example, chelation of aluminum 

at the expense of exudation of organic acids by root system), at higher concentration of 

aluminum in root growth environment (200-300 µМ) the basic role is played by other 

physiological mechanisms of Al-resistance. Thus the author remarks [Aniol, 1997] that the 

aluminum resistance of wheat plants at a concentration of 296 µМ is controlled by 2 genes and 

at a concentration of 592 µМ aluminum resistance is controlled by three genes. He wrote, that 

genes located in D-genome of wheat, are expressed only at high Al concentration, and genes 

located on chromosome 5А are expressed at all studied concentrations. 

The aim of our research was to determine the influence of Al concentration on a direction 

and character of dominance of parameters of roots growth of barley F2 hybrid seedlings. 

Material and Methods 

The direct and reciprocal F2 hybrids of four selection numbers of barley (№№ 565-98, 

889-93, 999-93 and 1030-93), bred in North-East Agricultural Research Institute (Kirov, Russia) 

were taken for the analysis. By results of the preliminary laboratory analyses the parental forms 

of these hybrids differed significantly on a level of Al-resistance that corresponded to the 

research aim. A level of Al-resistance (relative root length - RRL) was estimated under 

conditions of rolled culture on five-day barley seedlings according to the technique described 

earlier [Lisitsyn, 2000] by division of value of root length of each individual seedling in test 

treatment variant (0.5 and 1.0 mM of aluminum as sulphate salt, рН 4.3) on value of average root 

length of control variant (without the stress factor, рН 6.0). Each sample volume consists of 99- 

105 seedlings in each treatment variant. 

Character of dominance for parameters of root growth of F2 hybrid plants was estimated by 

equation [Petr, Frey, 1966]: 

d = F2 - MP 

HP-MP 

1


, 

where d = degree of dominance; F2, НР, МР = means of F2 hybrids, resistant parent value, and 

mid parent value, respectively. 

Results and Discussion 

Expression of Al-resistance genes appreciably depend on a concentration of aluminum in 

test solution and with its increase the resistance of all hybrids was reduced without exception 

(table 1). 

Table 1. Parameters of root growth of barley F2 hybrids under laboratory condition 

Hybrid 

0 mM Al 

Root length, mm 

0.5 mM Al 1.0 mM Al 

RRL, % 

0.5 mM 1.0 mM 

565-98 x 889-93 109.2±1.5 71.2±1.2 56.3±1.0 65.2±0.6 51.6±0.5 

889-93 x 565-93 103.0±1.1 84.7±1.3 71.3±1.2 82.3±0.7 69.2±0.7 

565-98 x 999-93 113.6±1.6 71.8±1.8 48.3±1.2 63.2±0.9 42.6±0.6 

999-93 x 565-98 103.3±2.2 65.8±0.9 55.3±1.2 63.7±0.5 53.5±0.7 

565-98 x 1030-93 112.7±1.1 74.2±1.1 57.0±1.3 65.8±0.6 50.6±0.7 

1030-93 x 565-98 110.8±1.4 79.3±1.3 65.2±1.0 71.6±0.7 58.8±0.5 

889-93 x 999-93 107.7±2.2 76.0±1.7 61.0±1.5 70.5±0.7 56.6±0.8 

999-93 x 889-93 106.9±1.1 70.7±1.5 58.2±0.8 66.1±0.8 54.5±0.4 

889-93 x 1030-93 107.6±1.4 75.0±2.0 64.5±1.5 69.7±1.1 59.9±0.8 

1030-93 x 889-93 102.1±1.6 79.0±1.0 62.9±0.8 77.4±0.6 61.6±0.5 

999-93 x 1030-93 104.9±1.6 75.6±1.6 52.2±1.7 72.0±0.9 49.8±0.9 

1030-93 x 999-93 111.2±1.2 77.4±1.0 59.6±1.2 69.5±0.5 53.6±0.6 

As it is visible from data, submitted in table 2, depending on the cross and aluminum 

concentration used, for some hybrids the large value of root length was dominated, for others 

hybrids – the smaller value, but for the third part of hybrids dominance of root length was absent 

practically. It is possible to note the same character of dominance for RRL parameter. The 

similar phenomenon was earlier marked in the literature for other cereals. So, [Camargo, 1981, 

1984] pointed out, that Al-resistance of wheat F2 population was coded by dominant genes at 

concentration of aluminum 3 mg/l, but became recessive at increase of concentration of the 

stressful factor up to 10 mg/l. Similar results were described in the researches with wheat [Bona 

et al., 1994]. 

2


Table 2. Influence of direction of crossing on character of dominance of parameters of root 

growth of barley F2 hybrids 

Degree of dominance of a parameter 

Hybrid 

Root length RRL 

0 mM Al 0.5 mM Al 1.0 mM Al 0.5 mM 1.0 mM 

565-98 x 889-93 0.33 -0.78 -1.94 -1.21 -5.35 

889-93 x 565-93 -0.94 0.34 1.26 0.99 5.00 

565-98 x 999-93 1.19 -1.42 -1.51 -4.65 -3.13 

999-93 x 565-98 -0.44 -2.12 -0.70 -4.50 -0.85 

565-98 x 1030-93 -0.81 -0.45 -0.51 -0.37 -0.40 

1030-93 x 565-98 -2.00 -0.05 0.44 0.11 0.13 

889-93 x 999-93 4.33 1.18 1.10 -0.16 0.23 

999-93 x 889-93 3.80 -0.38 0.40 -1.16 -0.47 

889-93 x 1030-93 -0.25 10.14 1.98 1.67 1.15 

1030-93 x 889-93 -1.11 15.96 1.58 3.47 1.40 

999-93 x 1030-93 -0.35 1.05 -4.00 0.59 0.17 

1030-93 x 999-93 0.44 1.49 7.00 0.30 1.22 

As it is follows from data, submitted in table 2, depending on a concrete combination of 

crossing domination of root length under control conditions, under both Al treatments and of 

RRL parameter can have positive or negative meanings, changing from negative superdomination 

till positive super-domination. Character and direction of domination can coincide 

for parameters of roots length under control conditions and under aluminum treatment, but 

sometimes can have an opposite direction. 

Directions of crossing caused opposite character of dominance of researched parameters of 

Al-resistance for hybrids 565-98 х 889-93 and 889-93 х 565-98. This tendency is some less expressed 

at hybrids received from crossing of breeding numbers 565-98 and 1030-93. At the same 

time direct and reciprocal hybrids between breeding number 565-98 and breeding number 999- 

93 for main part of researched parameters have shown only different degree of dominance, but 

not its different direction. 

Direct and reciprocal hybrids between selection numbers 889-93 and 1030-93 had least 

differences on a direction and character of dominance. 

References: 

Aniol A.M. 1995. Physiological aspects of aluminum tolerance associated with the long arm of 

chromosome 2D of the wheat (Triticum aestivum L.) genome. Theor Appl Genet. 91: 510- 

516 

Aniol A. 1996. Aluminum uptake by roots of rye seedlings of differing tolerance to aluminum 

toxicity. Euphytica 92: 155-162. 

3


Aniol A. 1997. the aluminum tolerance in wheat. plant Breeding: Theories, achievements and 

problems. Proc. Int. Conf., Dotnuva - Akademija, Lithuania: 14-22 

Ригин Б.В., Яковлева О.В. 2001. Генетические аспекты толерантности ячменя к токсичным 

ионам алюминия [Genetic aspects of barley tolerance against toxic Al ions] Генетические 

ресурсы культурных растений. Межд. науч.-практ. конф., 13-16 ноября, С-Пб: 397 [In 

Russian] 

Minella E., Sorrells M.E. 1997. Inheritance and chromosom locationof Alp. A gene controlling 

aluminum tolerance in 'Dayton' barley. Plant Breeding, V.116: 465-469 

Reid D.A. 1971. Genetic control of reaction to aluminum in winter barley. Barley Genetics II – 

Proc. 2 nd Int. Barley Genetics Symp., Pullman, Wash.: 409-413 

Stolen O., Andersen S. 1978. Inheritance of tolerance to low soil pH in barley. Hereditas, V.88. 

101-105 

Gourley L.M., Rogers S.A., Ruiz-Gomez C., Clark R.B. 1990. Genetic aspects of aluminum 

tolerance in sorghum. Plant Soil, V.123: 211-216. 

Petr F.C., Frey K.J. 1966. Genotype correlations, dominance and heritability of quantitative 

characters in oats. Crop Sci., V.6. 259-262 

Bona L., Carver B.F., Wright R.J., Baligar V.C. 1994. Aluminum tolerance of segregating wheat 

populations in acidic soil and nutrient solutions. Communic. Soil Sci. Plant Anal., V.25. 

327-339 

Camargo C.E.O. 1981. Wheat improvement. 1. The heritability of tolerance to aluminum 

toxicity. Bragantia, V.40. 33-45 

Camargo C.E.O. 1984. Wheat improvement. IV. Heritability studies on aluminum tolerance 

using three concentrations of aluminum in nutrient solutions. Bragantia, V.44. 49-64 

Lisitsyn E. M. 2000. Intravarietal Level of Aluminum Resistance in Cereal Crops. J Plant Nutrit., 

V.23(6): 793-804 

4


Frequency distributions and composite interval mapping for QTL analysis in 

‘Steptoe’ x ‘Morex’ barley mapping population 

ABSTRACT 

H. S. Rao 1, 2† , O. P. Basha 1 , N. K. Singh 1 , K. Sato 3 , H. S. Dhaliwal 1 * 

Indian Institute of Technology Roorkee, UA, India 

1 Department of Biotechnology, Indian Institute of Technology Roorkee, 

Roorkee 247667, Uttaranchal, INDIA 

2 Present address: 101, Maize Genetics Unit, Division of Genetics, LBS Building, 

Indian Agricultural Research Institute, New Delhi 110012, INDIA 

3 Barley Germplasm Center, Okayama University, Kurashiki 710-1146, JAPAN 

*corresponding author Email: hsdhafbs@iitr.ernet.in 

FAX: 91-1332-273560 Tel.: 01332-285259 

† Additional author Email: hsr_f12@rediffmail.com 

With the advancement of QTL mapping strategies, the traditional approaches for the 

identification of genes and their effects responsible for trait expression are gradually losing 

significance. The phenotypic data for heading days, plant height, peduncle length, number of 

tillers and stripe rust was recorded on 150 recombinant inbred line (RIL) population developed 

from a barley cross of ‘Steptoe’ and ‘Morex’. Preliminary examinations of frequency distribution 

plots were fairly useful in the prediction of number of genes governing traits expression in barley 

(Hordeum vulgare L.). The predictions were then systematically confirmed through QTL 

mapping. Molecular marker data for the population available at the public domain (GrainGenes 

website) was used for the construction of linkage map and QTL analysis. Clear colinearity was 

observed between the number of QTLs identified and the number of genes predicted based upon 

frequency distribution study alone. A total of 17 QTLs were detected for the five traits evaluated. 

Several major QTLs were detected on chromosome 2H, which could serve as candidate for mapbased 

studies of phenomena such as pleiotropism, recombination hot spots, gene-rich regions and 

QTL clustering. 

Keywords. Barley, frequency distribution, quantitative trait loci, recombinant inbred line, 

peduncle length, stripe rust, gene rich region. 

INTRODUCTION 

Cultivated barley (Hordeum vulgare L.) is a diploid (2n=14) which ranks fourth among 

the most important cereal crops in the world after rice, wheat and maize. Barley belongs to the 

same tribe Triticeae as that of wheat and rye and it resembles wheat in many respects. Barley is 

however, more tolerant to soil salinity and drought than wheat. Many important traits of 

economic and agronomic importance in barley are quantitative in nature displaying continuous 

5

variation. The efficiency of breeding programs depends on our knowledge of the genetic control 

and genomic location of QTLs governing the trait(s) of interest. With the advent of molecular 

markers (Botstein et al. 1980) and the user-friendly statistical software it has become possible to 

resolve and map the QTLs for complex traits on chromosomes. 

QTL analysis in barley is significant not only for the crop itself but also for comparative 

mapping with other cereal crops. The identification of diverse taxa sharing segments of similar 

gene orders throughout their genomes has been the major outcome of comparative mapping 

where chromosome alignment has hastened identification of new genes for their ultimate 

introgression into suitable cultivars. The genetic maps of diploid wheat, Triticum monococcum 

and barley, Hordeum vulgare L. are remarkably conserved except for few regions where 

translocation and inversion of chromosome segments have taken place (Dubcovsky et al. 1996). 

There is also a high level of genomic conservation at specific regions with rice, maize and oat 

(Deynze et al. 1995, Han et al. 1998). 

The results of several QTL mapping studies have indicated that there are only few major 

genes, which interact with numerous minor genes and environment to give continuous trait 

phenotype characteristic of quantitative traits. Thus examination of frequency distribution plots 

at single location is useful in assessing the probable number of major genes controlling a trait. 

This is particularly useful when resources are limiting and a decision has to be taken on priority 

basis before starting a breeding program for which trait QTL mapping experiment should be 

undertaken. The present article deals with the mapping of QTLs for a number of traits in a barley 

‘Steptoe’ x ‘Morex’ RIL mapping population and its relationship with the predictive value of 

frequency distribution for the traits. 

MATERIALS AND METHODS 

Plant Material 

150 recombinant inbred lines (RILs) derived from a cross between two barley (Hordeum 

vulgare L.) genotypes ‘Steptoe’ and ‘Morex’, obtained from Dr. Kazuhiro Sato, Okayama 

University, Japan was used as a mapping population and it was phenotyped for five traits. Each 

of the RILs and the parents were sown as a single one meter row with row to row spacing of 

30cm in the experimental field at the Indian Institute of Technology Roorkee, India in the winter 

season of 2005. Normal fertilizers, irrigation and other agronomic practices were followed for 

growing the population. Both ‘Steptoe’ and ‘Morex’ are hulled, six-rowed spring barley 

varieties. ‘Steptoe’ is a late flowering and dwarf line with reduced peduncle, few tillers per plant 

and moderate resistance to stripe rust. On the other hand, ‘Morex’ is early flowering and tall 

genotype with long peduncle, more tillers per plant and high susceptibility to stripe rust. 

Phenotypic Data 

The data on five quantitative traits were recorded as the average of five competitive 

plants per RIL. The number of days to heading was recorded as the number of days from sowing 

till half of the tillers in a RIL had flowered. Plant height (cm) was recorded as the length of plant 

from the base at the soil surface to the tip of spike of the tallest tiller excluding awns. Peduncle 

6

length was measured as the length of peduncle from the base of flag leaf to the base of basal 

spikelet of a spike. The number of effective tillers bearing spikes was taken as the number of 

tillers per plant. The data on natural incidence of stripe rust at the adult plant stage under field 

conditions was recorded as percent severity of the leaf area covered by stripes of uredia and the 

type of pustules, where the symbol S for susceptible was used for large pustules without any 

necrotic area; MS, MR for moderately susceptible/resistance for small pustules with or without 

necrotic areas around them and R for hypersensitive immune reaction without any pustule. 

Data Analysis 

The basic statistical analysis was performed for all the traits recorded. Mean, range and 

standard deviations were estimated. Correlation coefficient among various traits was calculated 

to infer probable inter-relationships between the traits studied. Frequency distribution plots for 

traits were presented as about ten phenotypic classes in the RIL population. 

Genotypic data and Linkage mapping 

Genotypic data for 343 molecular markers available at the public domain (GrainGenes 

website: http://www.gene.pbi.nrc.ca) for 150 RILs of ‘Steptoe’ x ‘Morex’ mapping population 

was utilized for the construction of linkage map. Standard χ 2 test was used to test the segregation 

pattern of each marker. Linkage map was constructed by using the software package 

MAPMAKER/EXP version 3.0 (Lincoln et al. 1992). A LOD score of 3.0 and a maximum 

recombination frequency of 0.40 were used to declare linkage between two markers. 

QTL mapping 

QTL analysis was performed using the method of Composite Interval Mapping (CIM) 

(Zeng 1994) as in QTL Cartographer version 2.5 (Wang et al. 2005). Composite interval 

mapping combines the approaches of interval mapping (IM) and Single Marker Analysis in a 

multiple regression framework. Initially it builds cofactors by selecting most significant markers 

through Single Marker Analysis methodology. Once the model containing cofactors is built, the 

entire genome is rescanned using interval mapping. We used model 6 with window size 10 cM 

where forward and backward regression method was utilized. Walk speed was set at 2 cM to 

scan the entire genome. We performed 1000 permutations at 0.05 significance level to balance 

type 1 and type 2 errors and declare appropriate threshold levels for QTL (Churchill and Doerge 

1994). The best estimate of QTL location was assumed to correspond to the position having the 

peak significance level and the confidence interval was drawn according to 1-LOD support 

interval (Lander and Botstein 1989). 

RESULTS 

Frequency distribution for various traits 

The frequency distributions for the five traits evaluated are given in Figure 1. Only plant 

height showed normal distribution while all other traits displayed various levels of skewedness. 

The days to heading trait was roughly partitioned into two phenotypic classes, one with early 

7

heading habit while the other showing late heading trait. Peduncle length also showed two 

phenotypic classes but the distribution tended to be strongly influenced by embedded peduncle 

genotype rather than emerged peduncle. Tiller numbers showed broad range with transgressive 

segregation towards both ends. The histogram for stripe rust showed continuous disease 

distribution pattern and the phenotypic classes were clearly partitioned into five clusters. 

Phenotypic data Analysis 

Except for the heading days all traits showed transgressive segregation and their phenotypic 

values exceeded beyond both of the mean parental values (Table 1). The correlation coefficients 

between most of the trait combinations were found to be significant ( Table 2). As expected 

peduncle length had extraordinarily high correlation with heading days and plant height. 

Peduncle length and heading habit were negatively correlated, i.e. the emerged peduncle inbred 

lines had more probability of early heading habit whereas the embedded peduncle lines had late 

heading. The significant positive correlation between plant height and peduncle extrusion could 

explain the fact that in taller plants, peduncle grew faster to emerge out of the boot leaf before 

anthesis. 

TABLE 1. Trait means in parent and trait means, standard deviations (SD) and range in RILs of 

Steptoe x Morex population 

Parents RIL population 

Trait Steptoe Morex Range Mean ± SD 

Heading days 126.0 100.0 101.0 – 126.0 112.05 ± 7.35 

Plant height (cm) 66.4 100.1 61.0 – 126.6 95.57 ± 13.27 

Peduncle length (cm) 5.7 24.2 0 – 28.6 10.21 ± 6.61 

Tiller number 2.6 3.1 1.2 – 6.4 3.49 ± 1.08 

Stripe rust (%) 12.5 75 0 – 100 43.11 ± 22.83 

TABLE 2. Correlation coefficient (r) among various traits in RIL population 

Plant height Peduncle length Tiller number Stripe rust 

Heading days -0.5491* -0.7392* -0.4987* -0.2056 

Plant height 0.6360* 0.5112* 0.1595 

Panicle exertion 0.3880* 0.1334 

Tiller number 0.2111 

* P < 0.0001 

Linkage map 

Out of the 434 polymorphic molecular markers data available at GrainGenes website, we 

selected 343 by rejecting markers with more than 40% missing genotypes and those showing 

segregation distortion at 0.05 significance level (χ 2 =3.841). Except for the two regions in 

chromosomes 5 (1H) and 6 (6H), the whole genome was adequately covered with markers and 

the centromeres were placed on consensus positions based on marker orders along the 

chromosomes. The order of markers and centromere positions did not vary much from their 

8

established map positions. The combined length of the linkage map was 824.1 cM with average 

spacing of 2.40 cM between adjacent markers. 

Genomic distribution of QTLs 

QTLs detected by CIM analysis as implemented in QTL Cartographer version 2.5 are 

presented in Table 3. The parent contributing respective alleles for increasing trait value for 

heading days (HD), plant height (PH), peduncle length (PL), number of tillers (TN) and the allele 

conferring resistance to stripe rust (SR) were indicated in the table. In the present study, five 

QTLs were identified for heading days exceeding the threshold LOD score. ‘Morex’ parent 

contributed early heading alleles for all the QTLs identified. Most of the phenotypic variance 

was explained by the QTLs on 2H and 1H while those on 7H and 3H had only a minor effect. 

Identification of several plant height QTLs spread throughout genome (7H, 2H, 2H, 3H, 6H, 6H 

and 5H) supported the results of frequency distribution. The two QTLs on 2H and 3H together 

explained about 40% of the phenotypic variance. The alleles responsible for increase or decrease 

in height had come from both of the parents and thus supporting transgressive segregation 

observed for some of the RILs. Two major QTLs, one each on chromosomes 2H and 3H were 

identified for peduncle length while a third putative QTL detected on 1H had only a minor effect. 

Only one QTL was identified for tillering ability on chromosome 2H. For stripe rust, although 

four resistance QTLs spread across chromosomes 2H, 3H, 4H and 5H were identified, none of 

them explained significant phenotypic variance. 

TABLE 3. Chromosome mapping of various QTLs with nearest linked molecular marker for 

different traits 

Trait Chrom Marker interval Position LOD Additiv R 2 x Allele 

Heading 

date 

Plant 

height 

Peduncle 

length 

osome 

(cM) 

1 (7H) ABC156d - ABG022A 41.61 4.35 1.8964 6.60 S 

2 (2H) ABG005 - Pox 33.41 18.78 4.1443 31.42 S 

2 (2H) Adh8 – CDO537 47.00 6.39 2.47 8.00 S 

3 (3H) ABG471 - ABG399 38.11 3.22 1.6616 4.96 S 

5 (1H) ABC307A-cMWG706A 31.31 11.69 3.2381 19.35 S 

1 (7H) Pgk2B - PSR129 67.91 2.49 2.8861 4.72 S 

2 (2H) ABG005 - Pox 33.41 8.83 -5.7128 18.43 M 

2 (2H) Adh8 - CDO537 43.31 8.41 -6.1379 20.57 M 

3 (3H) ABC156c - AtpbB 46.81 12.37 -5.7998 18.77 M 

6 (6H) CDO497 - ABR335 40.91 3.07 3.2705 6.00 S 

6 (6H) BCD340E - ksuD17 45.91 3.74 3.5796 7.24 S 

7 (5H) ABG708 - Dor5 30.31 4.93 -4.2142 9.72 M 

2 (2H) ABG358 - ABG459 28.71 19.30 -3.9943 36.24 M 

3 (3H) ABG471 - ABG399 38.11 4.63 -2.6111 15.38 M 

5 (1H) ABC307A 92.31 2.61 -1.7200 6.76 M 

Tiller # 2 (2H) MWG858 - ABG358 28.61 4.89 -0.3615 11.02 M 

Stripe rust 

resistance 

2 (2H) MWG858 - ABG358 26.61 2.95 -4.9528 6.22 S 

3 (3H) ABG377 - MWG555b 61.31 5.10 7.0202 11.30 M 

4 (4H) ABC321 - ABR315 30.21 3.24 -5.1908 6.88 S 

7 (5H) ABG391 124.81 2.64 -4.6547 5.56 S 

9 

e 

100

DISCUSSIONS 

Frequency distribution of various traits 

RILs are inbred lines derived from a cross of two diverse parents in which the individual 

genes are resolved into homozygous progenies. If we construct a histogram on such a population, 

the number and size of phenotypic classes obtained is directly related to the number of genes 

influencing the trait. For example, if a single gene controls the trait, there will be two phenotypic 

classes of equal sizes and if two genes control the trait there will be three phenotypic classes in 

1:2:1 size proportion. If we assume the genes are additive and explaining equal variance, their 

should be n + 1 number of phenotypic classes observed for n number of genes in the population 

for as many number of additive gene combinations. On the other hand if epistatic interactions 

were significant and the individual genes were contributing unequally towards the overall 

phenotype, the distribution of phenotypic classes becomes skewed. From the preliminary 

observation of histograms (Figure 1) the approximate number of genes responsible for each trait 

could be predicted. For example, there should be one gene explaining most of the phenotypic 

variance for heading days as we observed two broad phenotypic classes in the histogram. There 

should also be one more gene with lesser but significant effect, which is responsible for minor 

third phenotypic class in between the two major classes. Height is the perfect example of 

quantitative inheritance where we expect large number of alleles acting additively to give normal 

distribution. The presence of two phenotypic classes is the indicative of single gene inheritance 

for peduncle length, but their unequal proportion could be explained by presence of one more 

parallel allele contributing towards short peduncle length phenotype. Tillering trait showed 

normal distribution and large transgressive segregation beyond both parental types. Thus, in 

barley we do not expect tiller number to be governed by single gene. Although we observed only 

one QTL exceeding the threshold LOD score, there is an indication of two more putative QTLs 

on chromosomes 7H and 1H (Figure 3). Also, some of the QTLs on chromosomes 3H and 6H 

identified by Franckowiak and Lundqvist, 2002, Buck-Sorlin, 2002 and Babb and Muehlbauer, 

2003, remained undetected in the present study. The most probable explanation could be that 

‘Steptoe’ and ‘M’ are not diverse enough with respect to tillering ability and it actually limited 

the QTL mapping approach to detect all genes of the trait. Frequency distribution of stripe rust 

has shown overall normal disease distribution pattern clustered in three major segregative and 

two minor transgressive groups. Both parents were susceptible to stripe rust but the rust 

progressed slowly in ‘Steptoe’ with very low terminal severity, usually called slow rusting. The 

five classes for rust severity could be explained by the presence of four genes, each of which was 

contributing additively towards resistance to stripe rust. When the resistance alleles for all four 

genes were present in a single genotype (4R), maximum resistance is expected which was 

observed with zero percent rust severity in the first transgressive group. Similarly, genotypes 

with 3R+1S, 2R+2S, 1R+3S and 4S allele combinations explained second, third, fourth and fifth 

groups, respectively in the frequency distribution plot. 

QTL Analysis 

Heading Days: Days to Flower or heading days is considered to be an important trait for 

planning of a breeding program. Early-heading genotypes are preferred when the objective is to 

10

grow a cultivar late or early in the growing season. Heading time in barley and wheat is governed 

by three major genetic systems: vernalization requirement (response to low temperature at the 

initial stages of plant development), photoperiod sensitivity (day length) and narrow-sense 

earliness (response to sum of temperature over a long period). Vernalization is the requirement 

of low temperature period to plants for transition from a vegetative to a reproductive phase. 

Among the vrn loci, Vrn1 on the group 5 chromosomes of Triticeae (A, B, D and H genomes) 

are the most extensively characterized in terms of its effects and inheritance (Law et al. 1976, 

Galiba et al. 1993, Kato et al. 1999). The vernalization responsive phenotype is often found in 

conjunction with photoperiod sensitivity, a delay in flowering when plants are grown under 

short-day conditions (Karsai et al. 2001). Low vernalization requirement of barley was probably 

met with partially but longer photoperiod could be available only in the last week of March and 

hence delayed flowering in RILs with Ppd. The Ppd – H1 photosensitivity locus was first 

described by Laurie et al. (1994) on the short arm of chromosome 2H. In barley, eps 2S, located 

near the centromere region of the 2H chromosome has been reported to be a QTL for the 

environment independent narrow-sense earliness (Laurie et al. 1995). The RILs in the present 

investigation were sown without vernalization treatment. The QTL analysis carried out without 

partitioning of heading trait into three categories identified two significant QTL on 2H which 

probably represent Ppd and eps loci. Thus major effect on heading days under field conditions 

was due to the photoperiod and environment independent narrow sense earliness genes. Major 

role of 2H in determining heading days in barley is also inferred from the investigations carried 

out by Marquez-Cedillo et al. (2001), Kicherer et al. (2000), Karsai et al. (2005) and Qi et al. 

(1998) who detected heading days QTL on chromosomes 2H; 2H; 2H, 4H, 5H; and 2H, 7H, 

respectively. 

Plant Height: Before the green revolution, one of the major causes of yield loss was lodging of 

tall cultivars during rain and strong winds. Plant height and culm stiffness are reported to be the 

two most important traits determining lodging resistance in cereal plants (Keller et al. 1999). 

Murthy and Rao (1980) and Stanca et al. (1979) have worked out significant correlation between 

lodging resistance and dwarfness in barley. Recently Chloupek et al. (2006) demonstrated the 

significance of different sets of semi-dwarf genes in the determination of different root system 

size that was further implicated with biotic and abiotic stresses. With the development of semidwarf 

varieties, yield loss was largely overcome and the plant utilized its resources in increasing 

harvest index rather than its biomass. If the objective of the breeding program is to enhance the 

grain production as in most instances, the breeder prefers dwarf variety but if the objective is to 

utilize the plant for dual purpose for fodder as well, then the breeder obviously goes with taller 

varieties. Several studies in the recent past had identified QTL for plant height in barley 

distributed throughout genome but the major QTLs identified in the present study on 

chromosome 2H and 3H were found to occur more often than others. For example, Thomas et al. 

(1995) detected plant height QTLs on 1H, 3H and 7H; Marquez-Cedillo et al. (2001) on 2H, 3H, 

4H and 5H; Kicherer et al. (2000) identified on 2H and 3H; Qi et al. (1998) on 2H, 3H and 7H; 

Teulat et al. (2001) on 2H, 3H, 4H, 5H, 6H and 7H; Zhu et al. (1999) on 1H, 3H, 4H and 6H; and 

Chloupek et al. (2006) on 3H, 4H, 5H and 7H. 

Peduncle length: Peduncle length is an important character in barley as the inability of spikes to 

emerge out of boot leaf not only eliminates outcrossing but also adversely affects the use of its 

photosynthetic contribution to seed-setting and seed development. From the preliminary 

11

observation on correlation coefficient, we can predict that heading date and plant height jointly 

influences the ability of peduncle to emerge out since early heading and tall plants had emerged 

peduncle. We can infer that photoperiod (2H) had major effect on peduncle length while narrow 

sense earliness (2H and 1H) had relatively minor effect on peduncle length. Chromosome 3H 

also had significant influence on the trait which might be coming from major plant height QTL 

on the same chromosome. Hence, we can conclude that peduncle length is a composite trait 

whose component traits include heading days and plant height. 

Number of Tillers: Tiller number is regarded as an important yield component in wheat, barley 

and rice as the number of effective tillers is equal to the number of spikes. The plants with lesser 

tiller number generally have long spikes with increased grain weight and overall sturdy plant 

architecture (Vasu at al. 2006). But the advantage of high tiller numbered plant is that the overall 

harvest index from single plant is much higher and it saves the unit area of land required to grow 

plants for similar yields. In the present study, the tillering ability of plants behaved as a single 

gene inherited trait and only one QTL on chromosome 2H could be detected. Although earlier 

studies have also indicated single gene inheritance pattern for the trait, chromosomal locations of 

QTLs were not consistent with the present study. Franckowiak and Lundqvist, 2002, Buck-Sorlin 

2002 and Babb and Muehlbauer 2003 have identified major QTL lnt1 on chromosome 3HL and 

a second QTL cul2 on 6HL. 

Stripe Rust: Stripe rust is a major disease in Triticeae and its causal organism in barley is a 

biotrophic fungus, Puccinia striiformis f. sp. hordei. The characteristic feature of the disease is 

the appearance of pale stripes on leaves followed by emergence of orange brown uredosori that 

contain fungal spores. Yield loss of upto 30 % may occur, as photosynthetic and metabolic 

capabilities of the plant are severely impaired. Rust resistance in Triticeae is mainly of two types 

viz., vertical and horizontal. Vertical resistance is race-specific conditioned by gene-for-gene 

interaction between host and pathogen (Flor 1946). Horizontal resistance, on the other hand is 

race-non-specific governed by multiple genes with small effects. The results of the present 

analysis show that the resistance QTLs identified were acting in a race non-specific manner 

where they prevent pathogen(s) to form a basic compatibility reaction. The ‘Steptoe’ is a slow 

stripe rusting genotype. The rust infection is of susceptible type but the disease progresses very 

slowly without causing an appreciable loss. Some of the QTLs for resistance mapped in the 

present study were colinear with the previously mapped QTL using different barley populations 

on chromosomes 4H, 5H (Chen et al. 1994); 2H, 3H, 1H, 6H (Toojinda et al. 2000); 1H, 2H, 4H, 

6H, 7H (Berloo et al. 2001); 2H, 4H (Kicherer et al. 2000); and on 3H, 4H, 7H (Toojinda et al. 

1998) using local rust pathotypes further confirming their race-non-specific resistance. The 

QTLs with their low individual phenotypic variances when pyramided in a single genotype could 

confer high overall resistance. The approach for pyramiding of resistance QTLs was well 

demonstrated for 1H, 4H and 7H conferring resistance to stripe rust at seedling stage in barley by 

Castro et al., (2003). 

QTL clusters 

Although the large genome size (4.9 × 10 9 bp) of barley makes the genetic manipulations 

difficult, some of the recent advances in comparative genomics have suggested the presence of 

recombination hot spots and gene-rich regions in Triticeae where targeted approaches could be 

utilized for genome analysis (Gill et al. 1996). Identification of multiple QTLs on chromosomes 

12

2H and 3H were also indicative of gene-rich regions in barley. 2H is especially important 

because it contained QTLs for all of the traits analyzed in the present study. Aissani and Bernardi 

(1991) suggested the distribution of less conserved genes in euchromatic regions while the 

distribution of conserved genes in the heterochromatin region. This could be of evolutionary 

significance as the genes in euchromatin region exposed to manipulations were providing 

diversity for the plants to adjust to different environmental conditions while the genes of 

heterochromatin region might be regulatory in function, which must be conserved for their 

essential role in the very existence of the organism. 

Although the QTL analysis is of tremendous use in the identification of genomic regions 

pertaining to the traits of economic importance, it fails to identify the complete set of genes of a 

biochemical pathway leading to the expression of trait. Many of the conserved genes for which 

there are no allelic variants cannot be detected by this approach. Such genes have been conserved 

through evolutionary forces and any attempt to change them could have deleterious effect on the 

survival ability of the organism. 

CONCLUSION 

It has been shown here that QTL mapping is an accurate approach for the identification 

of genes underlying a trait but it is also cost intensive to carry out such exercise for all traits. On 

the other hand, construction of frequency distribution plots in routinely developed mapping 

populations could be used as diagnostic assessment for the prediction of number and effects of 

genes before planning QTL mapping experiment. Although such an approach is very crude, it 

would be useful in making appropriate allocation of resources. 

In the present study, it has been found that proximal region of chromosome 2H is of 

special interest as it contains QTLs for all of the traits studied explaining large phenotypic 

variances and thus the region could serve as candidates for further investigation. Significant 

correlation among various traits was because of QTL linked in coupling phase and in some of the 

instances pleiotropism cannot be ruled out. The other genomic regions of interest include 

chromosome 3(3H) and chromosome 5(1H), which harbors QTL for heading, peduncle length 

and plant height. Further study needs to be carried out to fine map and ultimately dissect out the 

individual genes in the region. Map-based cloning is gradually becoming a feasible approach for 

dissection of the QTL genes in Triticeae (Li et al. 2003). The individual QTL effects could be 

studied efficiently by generating near isogenic lines (NILs) in an organized backcross program, 

which specifically nullifies the background noise. In the recent past bioinformatics tools have 

gained significant importance to aid in silico comparative genomic studies in species with large 

unmanipulable genomes like barley and wheat with the help of well studied genomes such as 

Arabidopsis thaliana, rice and maize. 

ACKNOWLEDGEMENT 

The authors extend thanks to Dr. Firoz Hossain, Indian Agricultural Research Institute, New 

Delhi for his valuable suggestions and discussion while preparing the manuscript. 

13

Figure 1. Frequency distribution plots for heading days (HD), plant height (PH), peduncle length 

(PL), tiller number (TN), and stripe rust (SR) in RILs of Steptoe x M population. 

14

Figure 2. Genetic map of SM barley RIL population with 343 molecular markers indicating QTLs 

for heading days (HD), plant height (PH), peduncle length (PL), number of tillers (TN) and stripe 

rust (SR). Vertical bar and the symbols represent confidence interval and peak LOD scores 

respectively for various QTLs 

15

Figure 2. (continued) Genetic map of SM barley RIL population with 343 molecular markers 

indicating QTLs for heading days (HD), plant height (PH), peduncle length (PL), number of 

tillers (TN) and stripe rust (SR). Vertical bar and the symbols represent confidence interval and 

peak LOD scores respectively for various QTLs. 

16

Figure 3. QTL likelihood maps for various traits obtained from composite interval mapping 

(CIM) analysis indicating LOD score along the ordinate while genetic map (all chromosomes 

together) along the abscissa. The respective threshold LOD estimated by 1000 permutations at 

0.05 significance, are represented as horizontal line. 

17

REFERENCES 

Aissani, B., and G. Bernardi, 1991: CpG islands: features and distribution in the genomes of 

vertebrates. Gene 106, 173-183 

Babb, S., G. J. Muehlbauer, 2003: Genetic and morphological characterization of the barley 

uniculm2 (cul2) mutant. Theor. Appl. Genet. 106, 846–857 

Botstein, D., R. L. White, M. Skolnick, and R. W. Davis, 1980: Construction of genetic linkage 

map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 32, 

314-331 

Buck-Sorlin, G. H. 2002: The search for QTL in barley (Hordeum vulgare L.) using a new 

mapping population. Cell Mol. Biol. Lett. 7, 523–535 

Castro, A. J., X. Chen, P. M. Hayes, and M. Johnston, 2003: Pyramiding Quantitative Trait 

Locus (QTL) Alleles Determining Resistance to Barley Stripe Rust: Effects on Resistance 

at the Seedling Stage. Crop Sci. 43, 651–659 

Chen, F. Q., D. Prehn, P. M. Hayes, D. Mulroney, A. Corey and H. E. Vivar, 1994: Mapping 

genes for resistance to barley stripe rust (Puccinia striiformis f. sp. hordei). Theor. Appl. 

Genet. 88, 215–219 

Chloupek, O., B. P. Forster, and W. T. B. Thomas, 2006: The effect of semi-dwarf genes on root 

system size in field-grown barley. Theor. Appl. Genet. 112, 779–786 

Churchill, G. A., and R. W. Doerge, 1994: Empirical threshold values for quantitative trait 

mapping. Genetics 138, 963-971 

Deynze, A. E. V., J. C. Nelson, E. S. Yglesias, S. E. Harrington, D. P. Braga, S. R. McCouch, 

and M. E. Sorrells, 1995: Comparative mapping in grasses. Wheat relationships. Mol. 

Genet. Genomics 248, 744-754 

Dubcovsky, J., Ming-Cheng Luo, Gan-Yuan Zhong, R. Bransteitter, A. Desai, A. Kilian, A. 

Kleinhofs, and J. Dvorak, 1996: Genetic map of diploid wheat, Triticum monocuccum L. 

and its comparison with maps of Hordeum vulgare L. Genetics 143, 983-999 

Flor, H.H., 1946: Genetics of pathogenicity in Melampsora lini. J. Agric. Res. 73, 335–357 

Franckowiak, J. D., and U. Lundqvist, 2002: Current List of New and Revised Barley Genetic 

Stock Descriptions. Barley Genet. Newsl. 32, 47 

Galiba, G., S. A. Quarrie, J. Sutka, A. Morgounov, and J. W. Snape, 1995: RFLP mapping of 

vernalization (Vrn1) and frost resistance (Fr1) genes on chromosome 5A of wheat. Theor. 

Appl. Genet. 90, 1174-1179 

Gill, K. S., B. S. Gill, T. R. Endo, E. V. Boyko, 1996: Identification and high-density mapping of 

gene-rich regions in chromosome group 5 of wheat. Genetics 143, 1001-1012 

Han, F., A. Kleinhofs, S. E. Ullrich, A. Kilian, M. Yano, and T. Sasaki, 1998: Synteny with rice: 

Analysis of barley malting quality QTL and rpg4 chromosome regions. Genome 41, 373– 

380 

Karsai, I., K. Meszaros, L. Lang, P. M. Hayes, and Z. Bedo, 2001: Multivariate analysis of traits 

determining adaptation in cultivated barley. Plant Breed. 120, 217-222 

Karsai, I., P. Szucs, K. Meszaros, T. Filichkina, P. M. Hayes, J. S. Skinner, L. Lang, and Z. 

Bedo, 2005: The Vrn-H2 locus is a major determinant of flowering time in a facultative x 

winter growth habit barley (Hordeum vulgare L.) mapping population. Theor. Appl. Genet. 

110, 1458-1466 

Kato, K,, H. Miura, and S. Sawada, 1999: QTL mapping of genes controlling ear emergence time 

and plant height on chromosome 5A of wheat. Theor. Appl. Genet. 98, 472-477 

18

Keller, M., Ch. Karutz, J. E. Schmid, P. Stamp, M. Winzeler, B. Keller, and M. M. Messmer, 

1999: Quantitative trait loci for lodging resistance in a segregating wheat x spelt 

population. Theor. Appl. Genet. 98, 1171-1182 

Kicherer, S., G. Backes, U. Walther, and A. Jahoor, 2000: Localising QTLs for leaf rust 

resistance and agronomic traits in barley (Hordeum vulgare L.). Theor. Appl. Genet. 100, 

881-888 

Lander, E. S., and D. Botstein, 1989: Mapping Mendelian factors underlying Quantitative traits 

using RFLP linkage maps. Genetics 121, 185-199 

Laurie, D. A., N. Pratchett, J. H. Bezant, and J. W. Snape, 1994: Genetic analysis of a 

photoperiod response gene on the short arm of chromosome 2 (2H) of Hordeum vulgare 

(barley). Heredity 72, 619-627 

Laurie, D. A., N. Pratchett, J. H. Bezant, and J. W. Snape, 1995: RFLP mapping of five major 

genes and eight quantitative trait loci controlling flowering time in winter x spring barley 

(Hordeum vulgare L.) cross. Genome 38, 575-585 

Law, C. N., A. J. Worland, B. Giorgi, 1976: The genetic control of ear-emergence time by 

chromosomes 5A and 5D of wheat. Heredity 36, 49-58 

Li, H., S. A. Brooks, W. Li, J. P. Fellers, H. N. Trick, and B. S. Gill, 2003: Map-based cloning of 

leaf rust resistance gene Lr21 from the large and polyploid genome of bread wheat. 

Genetics 164, 655-664 

Lincoln, S. E., M. Daly, and E. S. Lander, 1992: Constructing genetic maps with 

MAPMAKER/EXP 3.0. Whitehead Institute technical report, 3 rd edn. Cambridge 

Marquez-Cedillo, L. A., P. M. Hayes, A. Kleinhofs, W. G. Legge, B. G. Rossnagel, K. Sato, S. 

E. Ullrich, and D. M. Wesenberg, The North American Barley Genome Mapping Project, 

2001: QTL analysis of agronomic traits in barley based on the doubled haploid progeny of 

two elite North American varieties representing different germplasm groups. Theor. Appl. 

Genet. 103, 625-637 

Murthy, B. N., and M. V. Rao, 1980: Evolving suitable index for lodging resistance in barley. 

Indian J. Genet. Plant. Breed. 40, 253-261 

Qi, X., R. E. Niks, P. Stam, and P. Lindhout, 1998: Identification of QTLs for partial resistance 

to leaf rust ( Puccinia hordei) in barley. Theor. Appl. Genet. 96, 1205–1215 

Stanca, A. M., G. Jenkins, and P. R. Hanson, 1979: Varietal responses in spring barley to natural 

and artificial lodging and to a growth regulator. J. Agric. Sci. Camb. 93, 449-456 

Teulat, B., O. Merah, I. Souyris, and D. This, 2001: QTLs for agronomic traits from a 

Mediterranean barley progeny grown in several environments. Theor. Appl. Genet. 103, 

774–787 

Thomas, W. T. B., W. Powell, R. Waugh, K. J. Chalmers, U. M. Barua, P. Jack, V. Lea, B. P. 

Forster, J. S. Swanston, R. P. Ellis, P. R. Hanson, and R. C. M. Lance, 1995: Detection of 

quantitative trait loci for agronomic, yield, grain and disease characters in spring barley 

(Hordeum vulgare L.). Theor. Appl. Genet. 91, 1037-1047 

Toojinda, T., E. Baird, A. Booth, L. Broers, P. Hayes, W. Powell, W. Thomas, H. Vivar, and G. 

Young, 1998: Introgression of quantitative trait loci (QTLs) determining stripe rust 

resistance in barley: an example of marker-assisted line development. Theor. Appl. Genet. 

96, 123–131 

Toojinda, T., L. H. Broers, X. M. Chen, P. M. Hayes, A. Kleinhofs, J. Korte, D. Kudrna, H. 

Leung, R. F. Line, W. Powell, L. Ramsay, H. E. Vivar, and R. Waugh, 2000: Mapping 

19

quantitative and qualitative disease resistance genes in a doubled haploid population of 

barley (Hordeum vulgare). Theor. Appl. Genet. 101, 580–589 

van Berloo, R., H. Aalbers, A. Werkman, and R. E. Niks, 2001: Resistance QTL confirmed 

through development of QTL-NILs for barley leaf rust resistance. Mol. Breed. 8, 187-195 

Vasu K., S. Sood, H. S. Dhaliwal, P. Chhuneja, B. S. Gill, 2006: Identification and mapping of a 

tiller inhibition gene (tin3) in wheat. Theor. Appl. Genet. (Published online) 

Wang, S., C. J. Basten, Z. B. Zeng, 2005: Windows QTL Cartographer 2.5. Department of 

Statistics, North Carolina State University, Raleigh 

http://www.statgen.ncsu.edu/qtl/crt/WQTL.htm 

Zang, Z. B., 1994: Precision mapping of quantitative trait loci. Genetics 136, 1457-1468 

Zhu, H., L. Gilchrist, P. Hayes, A. Kleinhofs, D. Kudrna, Z. Liu, L. Prom, B. Steffenson, T. 

Toojinda, and H. Vivar, 1999: Does function follow form? Principal QTLs for Fusarium 

head blight (FHB) resistance are coincident with QTLs for inflorescence traits and plant 

height in a doubled-haploid population of barley. Theor. Appl. Genet. 99, 1221–123 

20


PCR-based markers 

targeting barley putative grain yield and quality QTLs regions 

Isabel A. del Blanco*, Deric A. Schmierer, Andris Kleinhofs and Steven E. Ullrich 

Department of Crop and Soil Sciences, Washington State University, Pullman, WA, 99164-6420 

*e-mail: mailto:blanco@wsu.edu 

Abstract 

Eight restriction fragment length polymorphism (RFLP) and two genes delimiting, or included 

in, chromosome fragments containing putative QTLs for grain yield and quality were sequenced 

and converted to PCR-markers. Eight markers were co-dominant between two-rowed barley 

cultivars Harrington and Baronesse after digestion with restriction enzymes. Three were 

dominant-recessive after designing specific primers exploiting single nucleotides polymorphisms 

(SNPs) between those two cultivars. 

Introduction 

Two chromosomal regions from Baronesse have been reported as containing putative grain yield 

QTLs, one on chromosome 2(2HL) (between markers ABG461C and MWG699) and the other 

on chromosome 3(3HL) (between markers MWG571A and MWG961) (Schmierer et al., 2004). 

Subsequent analysis of Harrington/Baronesse derived inbred lines suggested other additional 

regions as candidates for grain yield QTLs. These regions are on chromosome 7(5HL) (between 

markers ABC717 and ABC718) and on the telomeric region of the short arm of chromosome 

2(2HS) (ABG058). 

Since RFLP methodology needs large amounts of DNA and entails a complex procedure with 

radioactively labeled probes and Southern blotting, which requires several days to produce 

results, we converted RFLP targeting those putative QTL regions to PCR-markers: cleaved 

amplified polymorphic sites (CAPS) and SNPs. The conversion of RFLP clones to PCR-based 

markers rendered a much simpler technique that facilitated the screening of large numbers of 

genotypes at the seedling stage, since it requires a small amount of DNA. 

Materials and Methods 

Genomic DNA extraction was modified from Edwards et al. (1991); the modification added an 

extra-step of chloroform-isoamyl alcohol (24:1) extraction. CAPS were developed from RFLP 

clones. Primers were designed from the cloned sequences and used to amplify genomic DNA 

from the parental cultivars Harrington and Baronesse. If no fragment length polymorphism was 

observed, the fragments from both parents were sequenced to discover SNPs. These SNPs were 

analyzed to identify restriction enzymes that could be used to develop CAPS, or to design 

cultivar-specific primers. CAPS markers were also developed for gene Dhn1 (Choi et al., 2000) 

and a candidate gene for seed dormancy and/or pre-harvest sprouting, GA20-oxidase (Li et al., 

2004). Reactions for SNPs were set under stringent conditions (annealing temperatures ~ Tm) 

and short cycles (annealing ≤ 15 s). Extensions were 1min or 2min depending on product size. 

21

Primer3 software (Rozen and Skaletsky, 2000) assisted the process of primer design. PCR 

products were visualized on 1% or 2%, depending on the fragment size, agarose gel under UV 

light. PCR products were purified with Exonuclease I (Exo-SAP-IT, UBS, Cleveland, OH). 

Sequencing reactions were performed on an Applied Biosystems 3100 Genetic Analyzer (Perkin 

Elmer Applied Biosystem Division, Foster City, CA) with the ABI PRISM Big Dye Terminator 

v3.1 cycle sequencing kit. Products were confirmed by sequencing in both directions. Analysis 

of sequences to find restriction sites and/or SNPs was done with the tools provided by the San 

Diego Super Computer Center (SDSC, http://workbench.sdsc.edu). 


Details of developed PCR markers are listed in Tables 1 (CAPS) and 2 (SNPs). CAPS marker 

MWG699 yielded small fragments difficult to visualize after digestion with enzyme Taq1, even 

when 3% UltraPure Agarose-1000 was used to run PCR products. To avoid this problem, 

cultivar-specific markers were developed taking advantage of SNPs between the parental 

genotypes. The two SNP sites are different than the TaqI restriction site, for this reason they are 

considered two different markers for locus MWG699. 

Table 1. Summary of developed CAPS markers, their location, primers and restriction enzymes 

Chr. Locus Bin Forward primer 

Reverse primer 

3(3H) MWG571A 009 5’-GTATCGTCAACACGGCAGCGT-3’ 

5’-TACCTGTCAGAAGTGCAGTACC-3’ 

3(3H) MWG961 012 5’-TCAACTCCAGCCTTCACACACAAC-3’ 

5’-AAGACGAAGGAGACGTTGTTCATG-3’ 

2(2H) MWG699 010 5’-ACCCACTGGGTTTGATACTACAAAG-3’ 

5’-GTGATGTTATTGGTGACTTGAACTC-3’ 

1(7H) 

7(5H) 

MWG851A 

Dhn1** 

001 

011 

5’-CAAGAACTCCATTCCAATGTACCTG-3’ 

5’-TACTTCCAGATCCATGACAAGCTAC-3’ 

5’-TCACTGTTCGTACTTCGTAGCACC-3’ 

5’-TCCGCAGTTGCTCCTCCAAT-3’ 

7(5H) ABC309 015 5’-CAGAGATACCACTGGGATTCTAAAC-3’ 

5’-CGAAAACCCTAGGAGAGCTAATC-3’ 

7(5H) MWG2249 015 5’-AGCCATGCCGGTCTTGTCAAGAAAG-3’ 

5’-ATGCATCTGATCCCTGGAGAAGAAC-3’ 

7(5H) GA20-oxidase 015 5’-GTCCATCATGCGCCTCAACTACTAC-3’ 

5’-TAGCAAATCTTGCCATCCATCCATG-3’ 

Enzyme 

BamHI 

BsgI 

TaqI* 

HaeIII, MspI 

TaqI, HpyCH4 IV 

HinfI 

* Restriction enzyme (TaqI) previously reported by Tanno et al. (2002) in a different population 

** Primers from Choi et al. (TAG 101:350-354) 

22 

AluI 

AvaI

Table 2. Cultivar-specific PCR primers developed exploiting nucleotide polymorphisms 

between Harrington (H) and Baronesse (B) cultivars 

Chr. Locus Bin Forward primer 

Reverse primer 

2(2H) MWG699-H* 010 5’-ATGGCTATCGCTTGACCAA-3’ 


2(2H) MWG699-B* 010 5’-ATGGCTATCGTTTGACCAG-3’ 


2(2H) ABG058-H 001 5’-TCTAGGCTTGCATTTGTCTACAAAG-3’ 

5’-ATGCTGCTTCGCTGTCTACAATAAC-3’ 

2(2H) ABG058-B 001 5’-CAATAATCTCTCTTGCCATCATGCC-3’ 

5’-ATGCTGCTTCGCTGTCTACAATAAC-3’ 

7(5H) ABC717-H* 009 5’-AACCAAGGCTACCAAGGTAATCCTG-3’ 

5’-CTCGTACTAACTTCCTACATGGCAA-3’ 

7(5H) ABC717-B* 009 5’-AACCAAGGCTACCAAGGTAATCCTG-3’ 

5’-CTCGTACTAACTTCCTACATGGCAC-3’ 

*Note: These primers require stringent conditions when running PCR 

References 

Choi, D.W., M.C. Koag and T.J. Close. 2000. Map locations of barley Dhn genes determined by 

gene-specific PCR. Theor. Appl. Genet. 101:350-354. 

Edwards K., C. Johnstone and C. Thompson. 1991. A simple and rapid method for the 

preparation of plant genomic DNA for PCR analysis. Nucleic Acids Res. 19(6):1349. 

Li, C., P. Ni, M. Francki, A. Hunter, Y. Zhang, D. Schibeci, H. Li, A. Tarr, J. Wang, M. Cakir, J. 

Yu, M. Bellgard, R. Lance and R. Appels. 2004. Genes controlling seed dormancy and 

pre-harvest sprouting in a rice-wheat-barley comparison. Funct. Integr. Genomics 4:84- 

93. 

Schmierer, D.A., N. Kandemir, D.A. Kudrna, B.L. Jones, S.E. Ullrich and A. Kleinhofs. 2004. 

Molecular marker-assisted selection for enhanced yield in malting barley. Mol. Breed. 

14:463-473. 

Rozen, S. and H.J. Skaletsky. 2000. Primer3 on the SSS for general users and for biologist 

programmers. In S. Krawetz and S. Misener (ed.) Bioinformatics methods and protocols: 

Methods in molecular biology. Humana Press, Totowa, NJ, p. 365-386. Available at 

http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plusAbout.cgi (verified April 

2007). 

Tanno, K., S. Taketa, K. Takeda and T. Komatsuda. 2002. A DNA marker closely linked to the 

vrs1 locus (row-type gene) indicates multiple origins of six-rowed cultivated barley 

(Hordeum vulgare L.). Theor. Appl. Genet. 104:54-60. 

23

Barley Genetics Newsletter 37: 24-28 (2007) 

Genetic Architecture for Yield and Quality Component Traits Over Two 

Environments in Barley (Hordeum vulgare L.) 

Ambresh Kumar Verma, S.R. Vishwakarma and P.K. Singh 

Department of Genetics and Plant Breeding 

Narendra Deva University of Agriculture and Technology, 

Kumarganj, Faizabad, (UP) 224 229, INDIA. 

e-mail: ambreshv@gmail.com 

Abstract 

Triple test-cross analysis involving three testers K-560, Narendra Jau-3 and their hybrid K-560 x 

Narendra Jau-3, were cross to 15 strains/varieties of barley to estimate the epistatic, additive and 

dominance components of genetic variance. Modified triple test-cross was done for eleven 

metric traits in two [normal fertile soil (E1) and saline sodic soil (E2)] environments. Epistasis 

was evident for all the characters under study in both environments except plant height in E2, 

protein content in E1 and lysine content in both conditions. The i type epistasis was significant 

for seed yield per plant in E1 only, while j and l type epistasis were significant for most of the 

traits. Additive (D) component was important in all cases in both conditions except number of 

effective tillers per plant in E1 and lysine content in E1 & E2 where as non fixable dominance (H) 

component were significant for all the characters in both conditions except number of effective 

tillers per plant in E1, length of main spike in E2 and lysine content in both environments. The 

most of the traits showed partial dominance and directional element, F was non- significant for 

all the traits, suggesting ambidirectional nature of dominance. 

Key words: barley, modified triple test-cross, genetic variation, protein content, seed yield 

Introduction 

To enable present barley varieties acceptable in the international market, there is need to develop 

better quality genotypes suitable for making product with consumer acceptability. Thus there is 

an urgent need to improve grain quality as well as develop better quality genotypes for suitable 

processing industry. The consumer acceptability of genotype is affected by chemical constituent 

of the grains. It is therefore, desirable to access basic physiochemical characteristics of the grains 

so that these can be combined with high yield. The information about nature and magnitude of 

genetic components of variance for yield and quality characters is essential for planning an 

efficient breeding programme in any crop. The modified triple test-cross analysis of (Ketata et 

al., 1976) provide efficient detection and estimation of epistatic variance along with unbiased 

estimates of additive and dominance component of genetic variance in determining the 

inheritance of eleven traits in barley using modified triple test-cross (TTC) analysis. 


Two barley pure lines, viz. testers K-560, Narendra Jau-3 and their hybrid (K-560 x Narendra 

Jau-3) were cross to 15 lines (Kedar, RD-2552, Narendra Jau-1, Narendra Jau-2, Narendra Jau-4, 

RD-2035, BL-2, BH-512, Ratna, Jagrati, DL-88, Azad, K-603, NDB-1173 and RD-2624) of 

barley to develop a set of 45 crosses. The experimental materials consisting of 3 testers, 15 lines, 

24

30 single crosses and 15 three-way crosses were evaluated in randomized block design with three 

replications during rabi 2004-05 in two viz. normal fertile soil (E1) and saline sodic (E2) 

condition at Genetics and Plant Breeding Research Farm of Narendra Deva University of 

Agriculture & Technology, Kumarganj , Faizabad, U.P. India. Each entry was shown in a 3 m 

long single row plant with 10 cm spacing within and 25 cm between rows. Observations were 

recorded on five randomly selected competitive plants for eleven quantitative traits (Table 1). 

The pelshenke vale, protein content and lysine content were estimated by the method of 

(Pelshenke, 1933; Lowery’s, 1951; and Felker et al.; 1978) respectively. Character means were 

used for modified triple test- cross analysis (Ketata et al., 1976). 


The triple test-cross (TTC) analysis revealed that significant epistasis was present for all the 

characters in both environments except plant height in E2 , protein content in E1 and lysine 

content in both conditions (Table 1). The partitioning of epistasis in to i and j and l types showed 

that additive x additive (i) interaction was significant for seed yield per plant in normal fertile 

soil condition only. The j and l type epistasis was significant for all the characters in both the 

environments except days to maturity and protein content in E1 while lysine content in both 

environments. Existence of significant epistasis in inheritance of seed yield and some other yield 

components in barley was reported by others also (Gorshkova and Gorodov, 1981). Greater 

importance of j and l type epistasis than i component was reported earlier by (Singh, et al., 1984; 

Tripati and Singh, 1983; Verma and Yunus, 1986.). On the contrary, (Nanda, et al., 1982) 

reported i type epistasis to be more important than j and l type epistasis, and (Singh, 1980) 

reported equal importance of these two sub components. The estimates of the components of 

genetic variance, additive (D), dominance (H) and F components and the degree of dominance 

(H/D 0.5 ) are given in Table 2. The additive (D) component was important in all cases in both 

conditions except number of effective tillers per plant in E1 and lysine content in E1 & E2 where 

as non fixable dominance (H) component was significant for all the characters in both condition 

except number of effective tillers per plant in E1, length of main spike in E2 and lysine content in 

both environments. The estimates of D were higher than H for most of the traits, which 

suggested partial dominance. The directional element of dominance, F was non-significant for all 

the characters in both environments indicated presence of ambidirectional dominance, and alleles 

with increasing and decreasing effects appear to be dominant and recessive to the same extent. 

The significant of additive component for seed yield and quality component traits, except 

number of effective tillers per plant and lysine content indicates that substantial improvement in 

yield status can still be achieved by following conventional breeding procedure in barley. The 

significant contribution of additive x additive type epistasis for seed yield suggested that this 

component should not be ignored while predicting the recombinants extractable from segregating 

generations. Further results provided evidence of j and l type epistasis for most of the traits 

studied. However, in autogamus crops like barley, where commercial exploitation of hybrid has 

started, this type of epistasis is of more use. 

References 

Felker, C.; Libanauskas, C.K.; Wainer, G. 1978. Estimation of lysine in foods. Crops Sci. 

18:480-490. 

25

Gorshkova, V.A.; Gorodova, V.T. 1981. Use of top crosses in studying breeding material of 

spring barley. Biological Lelektsiyai Semeno Vod Zorm Culture 47:54. 

Ketata, H.; Smith, E.L.; Edwards, L.H.; McNew, R.W. 1976. Detection of epistatic, additive and 

dominance variance in winter wheat (Triticum aestivum L.). Crop Sci. 16:1- 4. 

Lowry’s, O.H.; Roserbrough, N.J.; Farr, A.L.; Randall, R.J. 1951. Protein measurement with the 

folin phenol reagent. J. Biol. Chem. 193:265-278. 

Nanda, G.S.; Singh, P.; Gill, K.S. 1982. Epistasis, additive and dominance variation in triple test 

cross of bread wheat. Theor. Appl. Genet. 62:49-52. 

Pelshenke, P.A. 1933. A short method for determination of gluten quality of wheat. Cereal 

Chem. 10-90. 

Singh, G.; Nanda, G.S.; Gill, K.S. 1984. Inheritance of yield and its components in five crosses 

of spring wheat. Indian J. agric. Sci. 54:943-949. 

Singh, S. 1980. Detection of component of genetic variance and genotype x environment 

interaction in spring wheat. J. agric. Sci. Camb. 95:67-72. 

Tripathi, I.D.; Singh, M. 1983. Triple test-cross analysis in three barley populations under saline 

alkaline soil conditions. J. agric. Sci. Camb. 101:117-121. 

Verma, S.S.; Yunus,M. 1986. Role of epistasis in the analysis of genetic component of variance 

in bread wheat. Indian J. agric. Sci. 56:687-689. 

26

Table 1. ANOVA (mean square) of triple test-cross to test epistasis for eleven characters in barley under 

normal fertile soil (E1) and saline sodic soil condition (E2) 

Sources of 

variation 

Environ- 

ments 

d.f. Days to 

maturity 

Plant 

height 

(cm) 

No. of 

effective 

tillers 

/plant 

Length 

of main 

spike 

(cm) 

Grains 

per 

spike 

Seed 

yield/ 

plant 

(g) 

1000 

seed 

weight 

(g) 

Pelshenke 

value 

(minutes) 

‘i’ Type epistasis 

‘j+I’ type pistasis 

E1 

E2 

E1 

1 

14 

7.20 

369.80 

37.53 

3.99 

220.81 

34.78* 

0.17 

8.28 

8.13** 

10.86 

3.64 

1.64** 

428.76 

366.35 

206.09** 

22.36* 

300.13 

81.08** 

9.16 

0.793 

25.28** 

2121.80 

1355.77 

315.23** 

0.61 

2.11 

4.40 

0.75 

1.49 

0.56 

5.83 

1.12 

205.13** 

E2 

* 

74.66** 43.17* 

* 

11.57** 1.21** 307.31** 169.98** 23.90* 330.28** 7.46** 0.97 131.66** 

Total epistasis E1 

E2 

15 35.51* 

94.33** 

32.73* 

* 

55.01 

7.60** 

11.35** 

2.25** 

1.37** 

220.93** 

311.24** 

77.16** 

178.65** 

24.20** 

22.36* 

435.66** 

398.64** 

4.15 

7.10** 

0.57 

0.90 

191.84** 

122.96** 

‘i’ type epistasis 

x blocks 

E1 

E2 

2 1.80 

92.45** 

1.00 

55.20* 

4.34** 

2.07** 

2.71** 

0.91** 

107.19** 

91.59* 

5.59 

75.03** 

2.29** 

0.198 

530.45** 

338.94** 

0.15 

0.527 

0.19 

3.73 

1.46 

0.28 

‘j+I’ type 

E1 28 15.64 7.92 0.14 0.43 24.12 3.34 0.18 32.68 9.62 1.28 2.03 

epistasis x blocks E2 

2.53 14.17 0.32 0.15 23.78 0.723 12.15 11.18 0.71 1.80 0.31 

Total epistasis x E1 30 14.72 7.46 0.14 0.55 29.66 3.49 0.32 36.86 10.00 2.42 1.99 

blocks 

E2 

8.53 16.91 0.43 0.20 28.30 5.68 11.36 33.03 0.69 2.68 0.49 

*, ** Significant at 5% and 1% probability levels, respectively. 

27 

Protein 

content 

(%) 

Lysine 

content 

(%) 

Husk 

content 

(%)

Table 2. Estimates of additive (D) and dominance (H) components of variance, parameter F, and degree of dominance (H/D) 0.5 

in barley under normal fertile soil (E1) and saline sodic soil (E2 ) condition 

Sources of 

variation 

Environ- 

ments 

D E1 

E2 

H E1 

E2 

(H/D) 0.5 

E1 

E2 

F E1 

E2 

Days to 

maturity 

Plant 

height 

(cm) 

Number 

o f 

effective 

tillers / 

plant 

Length 

of main 

spike 

(cm) 

Grains per 

spike 

Seed 

yield/ 

plant 

(g) 

1000 

seed 

weight 

(g) 

Pelshenke 

value 

(minutes) 

Protein 

content 

(%) 

Lysine 

content 

(%) 

Husk 

content 

(%) 

25.51** 429.12** 4.67 4.70** 520.15** 67.72** 17.21** 250.46** 16.77** 1.63 125.83** 

40.72** 150.58** 2.64** 2.60** 239.90** 50.43** 22.74** 190.35** 14.75** 1.90 78.26** 

20.09** 20.06** 3.11 1.46** 167.30** 33.78** 12.57** 374.09** 4.89** 0.86 77.24** 

37.45** 45.28** 4.41** 0.76 224.90** 69.57** 10.56** 237.02** 8.30** 0.65 57.05** 

0.60 0.22 0.82 0.56 0.57 0.71 0.85 1.22 0.54 0.74 0.83 

0.96 0.55 1.29 0.54 0.81 1.17 0.68 1.12 0.75 0.58 0.85 

0.28 0.18 0.31 0.03 0.02 0.04 0.26 -0.08 -0.06 -0.25 0.20 

0.10 -0.02 0.15 0.12 0.11 -0.10 0.20 -0.27 0.01 -0.05 0.19 

*, ** Significant at 5% and 1% probability levels, respectively. 

28

Barley Genetics Newsletter 37: 29–33 (2007) 

Line x Tester Analysis in Barley (Hordeum vulgare L.) Across Environments 

Ambresh Kumar Verma, S.R. Vishwakarma and P.K. Singh 

Department of Genetics and Plant Breeding 

Narendra Deva University of Agriculture and Technology, 

Kumarganj, Faizabad, (UP) 224 229 India. 

e-mail: ambreshv@gmail.com 

Abstract 

A combining ability effects study was conducted through line x tester analysis under normal 

fertile and saline sodic soil environments. The results indicated the predominance of nonadditive 

gene action for all the traits. The line Kedar and tester K-560 in normal fertile soil and 

tester Lakhan in saline sodic soil while RD-2552, Narendra Jau-4 and NDB-1173 under both 

environments proved good general combiners for seed yield and quality components characters. 

The crosses Kedar x K-560, K-603 x K-560, DL-88 x Lakhan and RD-2035 x K-560 in normal 

and RD-2552 x Narendra Jau-3, Narendra Jau-1 x K-560, Narendra Jau-4 x Lakhan, NDB-1173 

x K-560, and RD-2624 x K-560, in saline sodic soil while RD-2552 x Lakhan, RD-2035 x 

Narendra Jau-3, BL-2 x Lakhan and Jagrati x K-560 in both environment exhibited highest sca 

effects for seed yield and other quality traits, showing their desirability to offer transgressive 

segregants in succeeding generations. 

Key words: barley, combining ability, gene action, protein content, lysine content. 

Introduction 

Research on barley (Hordeum vulgare L.) bears special significance due to its great elasticity of 

adaptation under various stresses and lot of potential both for domestic and industrial uses. 

Barley also has been very important winter cereal crop in India , because of its versatile nature, 

lower cost of cultivation, superior nutritional qualities and many other uses. The major uses of 

barley grains, however are in the production of malt, which is used to make beer, beverage 

industrial alcohol, whisky, malt syrups, malted milk and vinegar. The spent malt after brewing is 

used as feed. Combining ability analysis helps in identification of desirable parents and crosses 

for their further exploitation in breeding programme. Therefore, the present study was 

undertaken to estimate combining ability effects for yield and quality components characters and 

also to identify suitable parents and crosses in barley under normal fertile and saline soil 

environments. 


The material consisted of 15 lines, namely RD-2552, Narendra Jau-1, Narendra Jau-2, Narendra 

Jau-4, RD-2035, BL-2, BH-512, Ratna, Kedar, Jagrati, DL-88, Azad, K-603, NDB-1173 and 

RD-2624 with 3 testers viz., Narendra Jau-3, K-560 and Lakhan crosses were attempted in line x 

tester fashion. The resulting 45 F1s along with lines and testers were planted in a randomized 

block design with three replicates during rabi 2004-2005 under normal fertile soil and saline 

sodic environments at Research Farm of Narendra Deva University of Agriculture and 

Technology, Kumarganj, Faizabad. Each treatment (genotype) was shown in 3 m length having 

row to row and plant to plant distance of 25 cm and 10 cm, respectively. The observations were 

recorded on days to maturity, plant height (cm), number of effective tillers/plant, length of main 

29

spike (cm), grains per spike, seed yield/plant (g), 1000 seed weight (g), pelshenke value 

(minutes), protein content (%), lysine content (%) and husk content (%) on five randomly 

selected plants from each replication and environments. The combining ability analysis was 

carried out following the method proposed by (Kempthorne,1957). 


The analysis of variance for combining ability for eleven characters showed that variances due to 

gca and sca were significant for the characters like days to maturity, plant height, length of main 

spike, grains per spike, seed yield per plant, 1000 seed weight, pelshenke value, protein content 

and husk content under both normal fertile and saline sodic soil conditions, suggesting thereby 

importance of both additive and non additive gene actions for the inheritance of these characters. 

The role of both additive and non-additive effects to grain yield and its component characters in 

barley have been reported previously (Choo et al.,1988; Bhatnagar and Sharma1995;1998). 

However, the component of variation due to sca was higher than gca for all the characters in all 

the environments indicating the predominance of non-additive gene action. Such results infers 

that the chosen material had high selection history. Similar results of predominance of sca 

variance over gca variance have also been reported by (Guo and Xu,1994; Phogat et al.1995; 

Madic,1996; El-Seidy,1997a & 1997b; Bouzerzour and Djakoune,1998). 

A perusal of the gca estimates (Table1) showed that the parents RD-2552, Narendra Jau-4, NDB- 

1173 in both environments while, Kedar & K-560 in E 1, and Lakhan in E2 

were the best 

combiners for seed yield and good/ medium combiner for most of the important yield and quality 

component characters. Further the parents Ratna, Narendra Jau-1, RD-2552, Narendra Jau-3, 

Narendra Jau-1 for early maturity, Lakhan, Narendra Jau-1 for dwarf plant height, Azad, RD- 

2624, NDB-1173 and Ratna for high protein content and Narendra Jau-1, Narendra Jau-2 and 

Lakhan for high lysine content were found to be good general combiners in both the 

environments. 

Significant gca values indicated the importance of additive or additive x additive gene effect as 

earlier reported by (Griffing,1956). In view of this, these parents offered the best possibilities for 

the development of improved lines of barley through hybridization programme. It is, therefore, 

recommended that to improve yield one should breed for superior combining ability for the 

component traits with an ultimate objective to improve the pace of its genetic improvement. 

The estimates of specific combining ability effects of top five ranking crosses for all the 

characters are present in Table 2. The perusal of sca effects revealed that crosses Kedar x K-560, 

K-603 x K-560, DL-88 x Lakhan RD-2552 x K-560 in normal and RD-2552 x Narendra Jau-3, 

Narendra Jau-1 x K-560, Narendra Jau-4 x Lakhan, NDB-1173 x K-560 & RD-2624 x K-560 in 

saline sodic and RD-2552 x Lakhan, RD-2035 x Narendra Jau-3, BL-2 x Lakhan and Jagrati x K- 

560 under both environments were for seed yield per plant and with other characters. The crosses 

RD-2035 x Narendra Jau-3 and BL-2 x Lakhan are excellent crosses for seed yield in both 

environments. Therefore, these crosses should be particularly exploited vigorously in future 

breeding programmes to obtain good segregants which would lead to buildup a population with 

high genetic yield potential with develop salt tolerant genotypes. 

30

References 

Bhatnagar, V. K., Sharma, S. N. 1995. Diallel analysis for combining ability for grain yield and 

its components in barley. Indian J. Genet. 55:228-232. 

Bhatnagar, V. K., Sharma, S. N. 1998. Diallel analysis for grain yield and harvest index in barley 

under diverse environments. Rachis. 16:22-27. 

Bouzerzour, H., Djakoune, A. 1998. Inheritance of grain yield and grain yield components in 

barley. Rachis. 16:9-16. 

Choo, T. M., Reinbergs, E., Jui, P. Y.1988. Comparison of F2 and F1 

diallel analyses in barley. 

Genome 30:865-869. 

El-Seidy, E. S. H.1997a. Inheritance of earliness and yield in some barley crosses. Ann. Agric. 

Sci. Moshtohor. 35:715-30. 

El-Seidy, E. S. H. 1997b. Inheritance of plant height, grain yield and its components in three 

barley crosses (Hordeum vulgare L.). Ann. Agric. Sci. Moshtohor. 35:63-76. 

Guo, Y. Y., Xu, S. Y. 1994. Genetic analysis of yield traits in two-rowed barley. Acta Agric. 

Zhejiangensis 6:156-60. 

Griffing, B.1956. Concept of general and specific combining ability in relation to diallel crossing 

system. Aust. J. Biol. Sci. 9:463-493 

Kempthorne, O. 1957. An Introduction to Genetical Statistics. John Wiley & Sons. Inc. New 

York. 

Madic, M. 1996. Inheritance of spike traits and grain yield in barley (H. vulgare L.) hybrids. 

Rev. Res. Work, Fac. Agric. Belgrade 41:53-65. 

Phogat, D. S., Singh,D., Dahiya, G. S., Singh, D. 1995. Genetics of yield and yield components 

in barley (Hordeum vulgare L.). Crop Res. Hisar. 9:363-369. 

31

Table 1. Estimates of general combining ability (gca) effects of parents (lines & testers) for 11 characters in 

barley under normal fertile soil condition (E1) & saline sodic soil condition (E2) 

Parents 

Kedar 

K-603 

DL-88 

RD-2552 

Azad 

Narendra Jau -1 



NDB-1173 

RD-2035 

RD-2624 

BL-2 

Jagrati 

BH-512 

Ratna 

SE (gi) lines 

SE(gi-gj) lines 

K-560 

Narendra Jau-3 

Lakhan 

SE (gi) testers 

Environments 

Days to 

maturity 

Plant 

height 

(cm) 

No. of 

effective 

tillers 

/plant 

Length 

of main 

spike 

(cm) 

* Significant at 5% probability level, ** Significant at 1% probability level 

32 

Grains 

/spike 

Seed 

yield/ 

plant 

(g) 

1000 

seed 

weight 

(g) 

Pelshenke 

value 

(minute) 

Protein 

content 

(%) 

Lysine 

content 

(%) 

Husk 

content 

(%) 

E1 0.63** 3.45** 0.40* -0.18* -0.71 1.02* 1.10* 6.58** 0.39** -0.12** 2.30** 

E2 1.23** 5.76** 0.26 -0.13 -0.72 0.73 0.99** 5.25** 0.27** -0.26** 1.35** 

E1 -0.12 -0.62 0.20 -0.26** -3.08** -0.45 -1.04* -1.92* 0.26** -0.18** 0.13 

E2 -1.27** 3.62** -0.27 -0.60** -5.51** -1.58** -1.67** -1.67 0.26** -0.13** 0.44* 

E1 0.63** 3.85** -1.02** -0.63** -4.14** -3.04** -0.74 0.33 -0.21** 0.02 -1.67** 

E2 -0.19 3.40** -0.34 -0.46** -1.82* -0.77 -0.86** 0.58 -0.32** 0.07** -1.23** 

E1 -0.62** -4.96** 0.14 0.04 6.76** 1.19* -1.11* -9.92** -0.68** 0.25** -1.88** 

E2 -0.69** -2.65** 0.37* 0.11 4.37** 1.83** -0.83** -7.58** -0.52** 0.33** -1.15** 

E1 2.21** -6.84** -0.11 0.17* 4.86** 0.53 0.11 7.16** 2.06** -0.59** 1.24** 

E2 2.56** 0.42 0.08 0.18 5.20** 0.57 0.08 6.17** 1.94** -0.53** 0.93** 

E1 -0.62** -2.76** 0.34* 0.32** -0.54 0.54 0.55 -0.34 -1.38** 0.56** -0.23 

E2 -0.52* -4.57** 0.29 0.19 1.50 0.71 0.67** 0.42 -0.49** 0.59** -0.60** 

E1 -1.54** 3.59** 0.08 0.80** 1.23 0.48 0.28 -3.42** -1.68** 0.51** 1.50** 

E2 0.06 -4.55** 0.33 0.49** 0.34 0.46 0.14 -3.25** -1.77** 0.52** 1.44** 

E1 0.29 -2.66** 1.31** 0.65** 4.73** 3.54** -0.32 -6.76** -1.01** 0.34** 0.35 

E2 1.14** 2.68** 0.50** 0.50** 1.78 0.90* -0.29 -6.83** -1.05** 0.10** 0.69** 

E1 -2.71** -1.98** -0.11 0.71** 6.99** 2.14** 1.75** -1.76* 0.93** -0.28** -1.99** 

E2 -2.11** -4.08** 0.00 0.52** 6.08** 1.24** 2.09** -1.67 0.99** -0.32** -1.98** 

E1 0.13 0.22 -0.21 -0.23* 4.15** 0.66 -0.99* -2.34** -0.35** 0.11** 1.05** 

E2 -0.36 -1.69** 0.09 -0.15 3.43** 0.02 -0.94** -2.08* -0.46** 0.12** 0.98** 

E1 0.71** -3.44** -0.45** -0.38** -9.32** -3.52** -1.60** 0.08 1.63** -0.40** -0.63** 

E2 -0.19 -0.77 -0.60** -0.05 -3.70** -2.36** -1.47** 0.33 1.54** -0.35** -0.40 

E1 1.54** 1.89** 0.43* -0.13 -2.49* 0.63 0.29 3.24** -0.09* -0.03 -1.33** 

E2 0.23 -2.29** 0.36* -0.08 -3.35** 0.66 0.03 3.33** -0.18** -0.04** -1.35** 

E1 1.13** 4.50** -0.26 -0.32** -4.47** -1.22** 1.20** 1.24 -0.30** 0.15** 0.93** 

E2 1.39** -2.44** -0.45* -0.21 -3.45** -0.98* 1.12** 1.58 -0.47** 0.18** 0.69** 

E1 -0.12 7.09** -0.31 -0.36** 1.19 -0.74 0.03 0.99 0.02 -0.05 2.49** 

E2 0.31 4.29** -0.18 -0.35* 0.12 -0.41 0.12 -0.33 -0.07** -0.03* 2.14** 

E1 -1.54** -1.34* -0.44** -0.21* -5.17** -1.75** 0.49 6.83** 0.41** -0.29** -2.26** 

E2 -1.61** 2.87** -0.45* 0.04 -4.27** -1.04* 0.83** 5.75** 0.33** -0.25** -1.94** 

E1 0.22 0.64 0.17 0.09 0.97 0.45 0.45 0.75 0.04 0.03 0.21 

E2 0.22 0.52 0.17 0.13 0.93 0.45 0.21 0.88 0.03 0.01 0.20 

E1 0.31 0.90 0.23 0.13 1.37 0.64 0.64 1.05 0.06 0.04 0.30 

E2 0.31 0.74 0.25 0.19 1.31 0.64 0.30 1.24 0.04 0.02 0.29 

E1 0.88** 1.83** 0.27** 0.18** 0.68 0.76** 0.19 -5.77** 0.18** -0.04** -1.20** 

E2 1.31** -0.87** 0.07 0.05 0.41 0.41 -0.22* -5.17** 0.14** -0.06** -0.87** 

E1 -0.81** 2.69** 0.31** 0.09 -0.18 0.21 0.24 1.94** 0.07** -0.06** 0.17 

E2 -0.36** 0.59* -0.04 0.08 0.48 -0.02 0.17 1.97** 0.34** -0.11** -0.12 

E1 0.10 -6.63** -0.90** -0.16** 0.79 -1.11** -0.42 2.30** -0.44** 0.22** 1.37** 

E2 0.02 -0.70* 0.17 -0.05 0.09 0.78** 0.15 2.06** -0.60** 0.26** 1.40** 

E1 0.11 0.33 0.09 0.05 0.5 0.23 0.23 0.39 0.02 0.02 0.11 

E2 0.11 0.27 0.09 0.07 0.48 0.23 0.11 0.45 0.01 0.01 0.10 

E1 0.16 0.46 0.12 0.06 0.71 0.33 0.33 0.54 0.03 0.02 0.15 

SE(gi-gj) 

testers E2 0.16 0.38 0.13 0.10 0.68 0.33 0.15 0.64 0.02 0.01 0.15

Table 2. Promising crosses for seed yield and quality component in barley under normal 

fertile soil and saline sodic soil condition. 

Characters Normal fertile soil environment Saline sodic soil environment 

Days to maturity Kedar x Lakhan, RD-2552 x K-560, RD- 

2552 x Narendra Jau-3, Narendra Jau-1 x 

K-560, RD-2624 x Lakhan 

Plant height (cm) Jagrati x Lakhan, BL-2 x Lakhan, 

Narendra Jau-2 x Lakhan, RD-2035 x 

Lakhan, Kedar x Narendra Jau-3 

K-603 x K-560, RD-2624 x Lakhan, 

Narendra Jau-1 x K-560, Kedar x Lakhan, 

Jagrati x Narendra Jau-3 

Ratna x Narendra Jau-4, BL-2 x Lakhan, 

DL-88 x K-560, RD-2035 x Lakhan, RD- 

2624 x Lakhan 

Number of effective 

tillers/plant 

RD-2035 x K-560, BL-2 x Narendra Jau-3, 

Jagrati x K-560, BL-2 x Lakhan 

Narendra Jau-1 x K-560, Narendra Jau-4 x 

Lakhan, NDB-1173 x K-560, RD-2035 x 

Narendra Jau-3 

Length of main spike 

(cm) 

K-603 x K560, K-603 x Narendra Jau-3, 

DL-88 x Lakhan, RD-2035 x K-560,Jagrati 

x K-560 

Grains/spike BL-2 x Lakhan, Kedar x K-560, K-603 x 

K-560, DL-88 x Lakhan, RD-2035 x 

Lakhan 

Seed yield per plant 

(g) 

BL-2 x Lakhan, RD-2035 x Narendra Jau- 

3, Jagrati x K-560, RD-2552 x Lakhan, 

Kedar x K-560 

DL-88 x Lakhan, NDB-1173 x Lakhan, 

RD-2035 x Lakhan 

BL-2 x Lakhan, RD-2624 x K-560, DL-88 

x Lakhan, Narendra Jau-4 x Narendra Jau- 

3, RD-2035 x Narendra Jau-3 

Narendra Jau-1 x K-560, Narendra Jau-4 x 

Lakhan, NDB-1173 x K560, RD-2053 x 

Narendra Jau-3, BL-2 x Lakhan 

1000-seed BL-2 x Lakhan, Jagrati x K-560, BL-2 x Lakhan, Narendra Jau-4 x Lakhan 

weight (g) RD-2035 x Narendra Jau-3, Narendra Jau- 

4 x Lakhan, 

Pelshenke Narendra Jau- 1 x K-560, RD-2552 x K- 

value (minute) 560, RD-2624 x Lakhan, Narendra Jau- 4 x 

K-560, BL-2 x Narendra Jau-3 

Protein RD-2552 x K-560, Narendra Jau-4 x K- 

content (%) 

560, Kedar x Narendra Jau-3, BH-512 x 

Lakhan, Ratna x K-560 

Lysine DL-88 x K-560, Kedar x K-560, K-603 x 

content (%) 

K-560, 

RD-2035 x Narendra Jau-3, RD-2552 x 

Lakhan 

Husk Narendra Jau-2 x Narendra Jau-3, Kedar x 

content (%) 

Narendra Jau-3, K-603 x K-560, Azad x 

K-560, DL-88 x K-560 

33 

RD-2552 x Narendra Jau-3, RD-2035 x 

Narendra Jau-3, Jagrati x Narendra Jau-3 

RD-2552 x K-560, Narendra Jau- 4 x 

Lakhan, RD-2552 x Narendra Jau-3, RD- 

2035 x Narendra Jau-3, Jagrati x Narendra 

Jau-3 

Narendra Jau-4 x K-560, RD-2552 x K- 

560, K-603 x Narendra Jau-3, NDB-1173 

x K-560, Kedar x Narendra Jau-3 

K-603 x K-560, DL-88 x K-560, Narendra 

Jau-4 x Lakhan, Kedar x Lakhan, Narendra 

Jau-4 x Narendra Jau-3 

Narendra Jau-2 x Narendra Jau-3, Kedar x 

Narendra Jau-3, Narendra Jau-4 x 

Narendra Jau-3, K-603 x K-560, 

DL-88 x K-560

Barley Genetics Newsletter 37: 34–36 (2007) 

Four new barley mutants 

Sandra AI Wright 1 , Manochehr Azarang 2 , Anders B Falk 3 

1 Dipartimento di Scienze Animali, Vegetali e dell’Ambiente, Facoltà di Agraria, Università del 

Molise, Campobasso, Italy 

2 Maselaboratorierna, Uppsala, Sweden 3 Department of Plant Biology and Forest Genetics, 

University of Agricultural Sciences, Uppsala, Sweden 

Introduction 

We screened a fast-neutron mutated barley population to isolate and characterize barley lesion 

mimic mutants. The albino mutant frequency in this population was found to be around 2%, 

suggesting that a sufficiently high level of mutants could potentially be found. From a screen of 

about 5000 M2 spikes, we found four mutants that were characterized by the presence of necrotic 

or chlorotic leaf areas in the form of spots or stripes. The four mutants were designated 1661, 

2721, 3091 and 3550. The mutants were characterized with respect to their visual appearance. In 

order to relate these mutants properly to previously described barley lesion mimic mutants, we 

cultivated all previously described barley mutants with aberrant leaf phenotypes (Davis et al.. 

1997) and compared the phenotypes to those of the newly obtained mutants. 


The near-isogenic barley line Bowman(Rph3) was obtained from Dr Jerry D. Franckowiak, 

North Dakota, USA. It was constructed by introgression of the Rph3 resistance gene from the 

cultivar Estate into the cultivar Bowman, and represents the 7th backcross. Mutation was 

performed with fast neutrons at the International Atomic Energy Agency (IAEA), Vienna, 

Austria, with a dose of 5 Gy. Five thousand M2 spikes were sown and the mutant plants were 

screened for aberrant leaf phenotype. Selected mutants were backcrossed twice to wildtype 

Bowman (Rph3), and their phenotypes were analyzed using the backcrossed material. Plants 

were grown either in a greenhouse or in caged outdoor compartments during the summer. 

Experiments were done in controlled growth chambers at 22°C with 16/8 hours of light/darkness 

(long day conditions), or 8/16 hours of light/darkness (short day conditions). Allelism tests were 

done as inspections of leaf phenotypes of F1 plants resulting from crosses between relevant 

mutants. An AFLP-based procedure was used to screen for molecular markers linked to the 

mutants (Castiglioni et al. 1998). 


Mutant 1661 displays chlorotic stripes (Figure 1). These stripes are most pronounced on the first 

leaf. Under long day conditions, the stripes do not appear on the later emerging leaves and the 

plants eventually seem to recover from the phenotype conferred by the mutation. Under short 

day conditions the mutation is semi-lethal since all leaves develop the characteristic chlorotic 

stripes and the plants fail to reach maturity and produce seeds. However, the phenotype initially 

proves to be more severe under long day conditions. Mutant 1661 is phenotypically similar to the 

previously described mutants mottled leaf 1 and mottled leaf 5, which have clearly marked white 

34

ands across the leaves (Davis et al. 1997). Allelism tests indicated that 1661 is not allelic to 

these. None of the pre-mapped Proctor-Nudinka AFLP markers were linked to mutant 1661. 

Mutant 2721 is characterized by chlorotic leaf spots and streaks that coalesce and eventually 

form large white patches on the leaves (Figure 1). The phenotype is displayed on all leaves and 

as the leaves mature, the white regions gradually become darker, seeming to undergo necrosis 

and death. Often the necrosis affects the leaf edges, resulting in wrinkled leaf edges. Under short 

day conditions, the leaf phenotype is delayed by several days and is reduced in severity. 

Eventually all leaves display the phenotype even under short day conditions. The mutant initially 

appears to be similar to the mottled leaf 2 (Davis et al. 1997) and mottled leaf 6 (Franckowiak 

2002) mutants, which display yellow bands on the leaves. However, these mutants do not display 

the necrosis of 2721. Allelism tests suggest that 2721 is not allelic to the mottled leaf mutants. 

None of the pre-mapped Proctor-Nudinka AFLP markers were linked to mutant 2721. 

Mutant 3091 has brown spots towards the leaf tips and leaf edges, particularly on the first leaf 

(Figure 1). Short days do not significantly alter the phenotype. The leaf phenotype resembles 

those of mutants nec4 and nec5 (Davis et al.. 1997). However, allelism tests indicate that mutant 

3091 is not allelic to either of these two. For the mutation in 3091, linkage was detected to the 

AFLP marker E37M33-6 on barley chromosome 3 (3H). 

Mutant 3550 has conspicuous black or brown spots on the leaves (Figure 1). The spots usually 

do not coalesce. They appear on all above-ground parts of the plant including the bristles. Mutant 

3550 is delayed in maturation and ripening, with seeds being ready for harvest about four weeks 

later than in the wildtype. Short day conditions lead to a slightly less pronounced phenotype. 

Mutant 3550 is similar to the nec1 mutant (Davis et al. 1997), but allelism could be ruled out due 

to different mapping positions. The mutation in 3550 was localized on chromosome 7 (5H). 

Linkage was detected to the AFLP markers E40M38-7, E36M36-5, E42M36-14, E42M40-2 and 

E41M32-5. 

References: 

Castiglioni, P., Pozzi, C., Heun, M., Terzi, V., Müller, K.J., Rodhe, W. and Salamini, F. 1998. 

An AFLP-based procedure for the efficient mapping of mutations and DNA probes in 

barley. Genetics 149:2039–2056. 

Davis, M.P., J.D. Franckowiak, T. Konishi, and U. Lundqvist, 1997. New and revised 

descriptions of barley genes. Barley Genetics Newsletter 26: 22-516. 

Franckowiak, J.D. 2002., BGS 629 Mottled leaf 6. Barley Genetics Newsletter 32:170. 

35

Bowman(Rph3) 

1661 2721 3091 3550 

Figure 1. Leaf phenotypes of the parent cultivar Bowman(Rph3) and four lesion mimic mutants; 1661, 2721, 3091, 

3550. 

36

Barley Genetics Newsletter 37: 37 – 43 (2007) 

The Scandinavian Barley Chlorophyll Mutation Collection 

Mats Hansson 

Department of Biochemistry, Lund University 

P.O. Box 124, SE-221 00 Sweden 

Barley (Hordeum vulgare L.) albina, striata, chlorina, tigrina, viridis and xantha mutants, which 

can be obtained from the Department of Biochemistry, Lund University, Sweden. 

The collection was previously held at the Carlsberg Laboratory, Copenhagen, Denmark, by 

Professor Diter von Wettstein. 

Please contact the cordinator for Nuclear genes affecting the chloroplast: 

Mats Hansson 

Department of Biochemistry 

Lund University 

Box 124 

SE-22100 Lund, Sweden 

Tel. +46 46 2220105 

Fax +46 46 2224116 

Email mats.hansson@biochemistry.lu.se 

Available mutants are marked by “×”. If missing, the mutant might be present in the collection of 

the Nordic Gene Bank (www.nordgen.org). 

Albina mutants 

alb 7 × 

alb 10 

alb 11 × 

alb 12 

alb 13 × 

alb 14 

alb 15 

alb 16 × 

alb 17 × 

alb 18 × 

alb 19 × 

alb 20 

alb 21 

37 

alb 22 × 

alb 24 × 

alb 25 × 

alb 26 × 

alb 27 × 

alb 28 × 

alb 29 

alb 30 

alb 32 × 

alb 33 

alb 34 

alb 35 

alb 36

alb 37 

alb 38 

alb 40 

alb 41 

alb 42 × 

alb 43 

alb 44 

alb 45 × 

alb 46 × 

alb 47 

alb 48 

alb 49 

alb 50 × 

alb 51 

alb 52 × 

alb 53 

alb 54 

alb 55 × 

alb 56 

alb 57 

alb 58 

alb 59 × 

alb 60 × 

alb 61 

alb 62 

alb 63 

alb 64 

alb 65 

alb 66 × 

alb 67 

alb 68 

alb 69 

alb 70 

alb 71 

alb 72 

alb 73 

alb 74 

alb 75 

alb 76 × 

alb 77 

alb 78 × 

alb 80 

alb 81 × 

alb 82 

38 

alb 83 

alb 84 

alb 85 

alb 86 

alb 87 

alb 88 

alb 89 × 

alb 90 × 

alb 91 

alb 92 

alb 94 

alb 95 × 

alb 96 

alb 97 

alb 98 

alb 99 

alb 100 

alb 101 

alb 102 

alb 103 

alb 104 

alb 105 

alb 106 

alb 107 

alb 108 

alb 109 

alb 110 

alb 111 × 

alb 112 

alb 113 × 

alb 114 

alb 115 

alb 116 

alb 117 

alb 118 

alb 119 

alb 120 

alb 122 × 

alb 123 

alb 124 

alb 125 

alb 126 

alb 127 

alb 128

alb 129 

alb 130 

alb 131 

alb 132 

alb 133 × 

Striata mutants 

Arnason × 

Arnason grøn 

striata 4 × 

striata 6 × 

striata 7 × 

striata 8 

striata 11 

striata 12 

striata 13 

striata 15 

striata 16 

striata 17 

striata 19 

striata 21 

striata 22 × 

striata 23 

striata 26 

striata 33 × 

striata 34 × 

striata 35 × 

striata 36 × 

striata 37 

striata 38 

striata 39 

striata 104 × 

striata 105 × 

39 

alb 134 × 

alb 135

Chlorina mutants 

clo 101 × 

clo 102 × 

clo 103 × 

clo 104 × 

clo 105 × 

clo 106 L × 

clo 106 L (A+B) × 

clo 106 line LA 

clo 106 line LB 

clo 106 line M × 

clo 106 line ML × 

clo 107 × 

clo 108 × 

clo 109 × 

clo 110 × 

clo 111 × 

clo 112 × 

clo 113 × 

clo 114 × 

clo 115 × 

clo 116 × 

clo 117 × 

clo 118a × 

clo 118b × 

clo 119 × 

clo 121 × 

clo 122 × 

clo 123 × 

clo 124 × 

clo 125 = Xan-h.Clo125 × 

clo 126 × 

clo 127 × 

clo 130 × 

clo 131a 

clo 131b 

clo133a × 

clo133b × 

clo 134 × 

clo135 × 

40 

clo 136 × 

clo 137 × 

clo 138 × 

clo 140 × 

clo 141 × 

clo 142 × 

clo 143 × 

clo 144 × 

clo 145 × 

clo 146 × 

clo 147 × 

clo 148 × 

clo149 × 

clo 150 × 

clo 151 × 

clo 152 × 

clo 153 × 

clo 154 × 

clo 155 × 


clo 158 × 

clo 159 × 

clo 160 × 


clo 164 × 

clo 165 × 

clo 166 × 

clo 167 het 

clo170 × 

clo 171 × 

clo 173 × 

clo 174 × 

clo 175 × 

clo 176 × 

clo 177 

clo 179 × 

clo 180 ×

Tigrina mutants 

tig 1 × 

tig 3 

tig 6 × 

tig 7 × 

tig 11 × 

tig 12 × 

tig 13 

tig 14 

tig 15 × 

tig 17 

tig 18 

tig 19 × 

tig 20 × 

tig 21 × 

tig 22 

Viridis mutants 

vir 10 × 

vir 11 × 

vir 12 × 

vir 13 × 

vir 14 × 

vir 15 × 

vir 17 × 

vir 18 × 

vir 19 × 

vir 21 × 

vir 23 × 

vir 24 × 

vir 25 × 

vir 27 × 

vir 29 × 

xan 75 = vir 30 × 

vir 33 × 

vir 34 × 

vir 35 × 

vir 38 × 

vir 39 × 

41 

tig 23 × 

tig 24 × 

tig 24 hom 

tig 25 × 

tig 26 × 

tig 27 × 

tig 28 × 

tig 29 hom × 

tig 30 × 

tig 31 × 

tig 32 × 

tig 33 × 

tig 34 × 

vir 41 × 

vir 42 × 

vir 43 × 

vir 44 × 

vir 45 × 

vir 46 × 

vir 47 × 

vir 49 × 

vir 50 × 

vir 51 

vir 52 × 

vir 55 × 

xan 76 = vir 56 × 

vir 59 

vir 60 × 

vir 61 × 

vir 63 × 

vir 64 × 

vir 65 × 

vir 68 × 

vir 69 ×

vir 101 × 

vir 102 × 

vir 103 

vir 104 × 

vir 105 

vir 106 

vir 107 

vir 108 

vir 109 

vir 109 

vir 110 

vir 111 

vir 112 

vir 113 light 

vir 113 dark 

vir 114 

vir 115 × 

vir 119 

vir 120 × 

vir 121 × 

vir 122 × 

vir 123 × 

vir 129 

vir 130 × 

vir 131 

vir 132 × 

vir 133 × 

vir 134 

Xantha mutants 

xan 3 × 

xan 10 × 

xan 11 × 

xan 12 × 

xan 13 × 

xan 14 

xan 15 × 

xan 16 × 

xan 17 × 

xan 18 × 

xan 19 × 

42 

vir 135 

vir 137 × 

vir 138 

vir 139 

vir 141 

vir 142 hom 

vir 142 

vir 143 × 

vir 144 

vir 145 hom 

vir 145 

vir 149 

vir 152 × 

vir 156 × 

vir 157 × 

vir 158 

vir 159 × 

vir 160 × 

vir 165 

vir 166 × 

vir 167 

vir 168 × 

vir 169 

vir 170 = xan 83 × 

vir 519 × 

xan 20 × 

xan 21 × 

xan 22 

xan 23 × 

xan 24 

xan 25 × 

xan 26 × 

xan 27 × 

xan 28 × 

xan 29 

xan 30 ×

xan 31 × 

xan 32 

xan 33 

xan 35 × 

xan 37 × 

xan 38 × 

xan 39 × 

xan 40 × 

xan 41 × 

xan 42 × 

xan 43 

xan 44 × 

xan 45 × 

xan 46 × 

xan 47 × 

xan 48 × 

xan 49 × 

xan 50 × 

xan 51 × 

xan 52 × 

xan 53 × 

xan 54 

xan 55 × 

xan 56 × 

xan 57 × 

xan 58 × 

xan 59 × 

xan 60 × 

xan 62 × 

xan 63 × 

xan 64 × 

xan 65 

xan 66 

xan 68 × 

xan 69 

xan 70 

xan 71 × 

xan 72 × 

xan 73 × 

xan 74 × 

xan-q.75 = vir30 

xan-q.76 = vir56 

xan-q.77 = vir-xa1 

43 

xan-q.78 = vir-alb1 

xan-q.79 = xa-alb3 

xan-q.80 = alb-l.26 

xan 81 = Proto 1 × 


xan 83 = vir 170 (Proto 3) × 


xan 101 

xan 102 

xan 103 

xan 104 

xan 105 

xan 106 

xan 107

Barley Genetics Newsletter (2007) 37: 44-46 

CAPS markers targeting barley Rpr1 region 

Ling Zhang* and Andris Kleinhofs 

Department of Crop and Soil Sciences 

Washington State University, Pullman, WA, 99164-6420 

*E-mail: lzhang1@wsu.edu 

Abstract 

Eight cleaved amplified polymorphic sequences (CAPS) markers were developed around Rpr1 

genetic region. Eight markers were co-dominant between barley cultivars Morex and Steptoe 

after digestion with restriction enzymes. 

Introduction 

In barley, resistance to Puccinia graminis f. sp. tritici pathotype MCC requires the presence of at 

least of two host genes, Rpg1 (Brueggeman et al., 2002) and Rpr1 (Zhang et al., 2006). 

Mutational analysis and transcript-based cloning were used to isolate 3 candidate Rpr1 genes. 

These 3 candidate Rpr1 genes, HU03D17U_s_at, Contig4901_s_at and Contig7061_s_at were 

mapped to chromosome 4 bin 5. Screening recombinants between the three candidate genes will 

identify the real Rpr1 gene. Therefore, molecular markers in this region are needed. 

Cleaved amplified polymorphic sequences (CAPS) markers are PCR-based markers, requires a 

small amount of genomic DNA, which will facilitate the screening of large numbers of 

genotypes at the seedling stage. 141 probesets representing a major Rpr1 eQTL served as a 

starting point to develop CAPS markers. Here we report the development and mapping of CAPS 

markers in the Rpr1 region. 


CAPS markers development 

Plant genomic DNA extraction was modified from Edwards et al. (1991); the modification added 

an extra-step of chloroform-isoamyl alcohol (24:1) extraction. Barley EST unigene sequences 

(HarvEST assembly#21; http://harvest.ucr.edu/) were used as templates for primer design. RFLP 

clone MWG058 was sequenced using primers T3 and T7 with the BigDye terminator system on 

ABI Prizm 377 DNA sequencer (Applied Biosystems) at the Bioanalytical Center, Washington 

State University, Pullman. A pair of primers was designed from the MWG058 sequence. All the 

primer pairs listed in Table 1 were used to amplify genomic DNA from the parent cultivars 

Morex and Steptoe. All PCRs of 20μl contained 20-50ng of genomic DNA, 0.1mMdNTP mix, 

12.5 pmol of each primer, 1μl of RedTaq DNA polymerase (Sigma), and 2 μl of 10xRedTaq 

reaction buffer. Amplification was performed in a PTC-100 programmable thermal controller 

(MJ Research, Cambridge, MA) at 95°C for 4 min, followed by 35 cycles of 95°C for 1 min, 

60°C for 1 min, and 72°C for 1 min; this was followed by 7 min at 72°C. PCR products were 

purified using the Gel Extraction Kit (Qiagen, Valencia, CA) and sequenced. Steptoe sequence 

was compared to the Morex sequence in order to identify single nucleotide polymorphisms 

(SNPs) that could be utilized for CAPS marker development. Sequence analysis was done by 

VectorNTI software (Invitrogen). SNPs were identified and restriction enzymes (New England 

44

BioLabs) were selected (Table 1). All the PCR products were digested directly using restriction 

enzymes correspondingly. Cleaved PCR products were then separated on 1% agarose gel. 

Genetic mapping 

The Steptoe x Morex "minimapper" population consisting of 35 selected doubled-haploid lines 

(DHL), was used to map the molecular markers to the barley Bin map (Kleinhofs and Graner 

2002). CAPS marker genetic order and the distance between snp_3139 and LZ2502 was 

estimated based on segregation data from Steptoe x Rpr1 F2 population. 


Details of developed CAPS markers are listed in Tables 1 and Fig. 1. Molecular mapping in 

Steptoe x Morex population with CAPS markers showed that LZ6641, LZ13393 and LZ10152 

co-segregated with LZMWG058, ABG484 and BCD453B, respectively. Markers snp_3139 

(Druka, personal communication) and LZ2502 are the closest to Rpr1 delimiting the 3 markers 

LZ17u, LZ4901 and LZ7061 that co-segregate with Rpr1. LZ2502 and sn3139 are about 1cM 

apart and can be used to screen recombinants in Steptoe x rpr1 F2 population. 

Figure 1. Chromosome locations of eight CAPS marker in barley chr. 4 (4H). 

45

Table 1. Summary of developed CAPS markers, primers, restriction enzymes and annotation. All 

the CAPS markers were mapped to Chr 4 (4H), except LZ15227 was mapped to Chr 7 (5H). 

Markers 

Affymetrix 

Probesets 

LZ2502 Contig 

2502_at 

LZ6641 Contig 

6641_at 

LZ6435 Contig 

6435_at 

LZ13393 Contig 

13393_at 


15227_s_at 

LZ1321 Contig 

1321_at 


10152_at 

LZMWG058 a 

snp_3139 b 

Forward Primer 

Reverse Primer 

2502F: AGCTTCAGCTTCAGGTCGAT 

2502R: GAAACTTAGAACCTGAACC 

6641F: TGATTGATCCTTTGCTGTCT 

6641R: CTGGAAAGCGTTCAAATGCT 

6435F:ACACCAGGAAGATCATCGAC 

6435R:ACAATGGAGAACACATGGTT 

13393F:AAGTGGACCGCGAAGCACGT 

13393R:GCAGCATGTCAGGTTATACA 

15227F:ATGGACTAATGACCCCAACA 

15227R:TGCAACACACAAAGCCAGTC 

1321F: CACTATCGACTTCCCGGAAT 

1321R: ACTGCAATCAGGGTTCATCA 

10152F: AGATCTCCGGCTACGTGCTG 

10152R: CGTACATCAGCTCGAAGAAA 

MWG058F: ATTCATGCATCTACCCATCTCA 

MWG058R: TTGGATTGGCTAGAATCCTGGA 

3139F: AACCACGCAGCAAGCCTAT 

3139R: CTCGCTTCCTCCGTCATCAT 

Enzyme Annotation 

HpyCH4V putative IAA1 protein 

AvaII putative expressed SLT1 protein 

DdeI phosphoenolpyruvate carboxykinase 

(ATP) -like protein 

AvaII hypothetical protein 

AseI microtubule associated protein 

Sau3A or 

MboI 

Sau3A or 

MboI 

calmodulin 

BtsI unknown 

DdeI unknown 

putative membrane protein 

a 

LZMWG058 was developed from RFLP clone MWG058. 

b 

snp_3139 sequence provided by Druka A, Scottish Crop Research Institute (SCRI), Invergowrie, 

Dundee DD2 5DA, UK 

References 

Brueggeman R., Rostoks N., Kudrna D., Kilian A., Han F., Chen J., Druka A., Steffenson B., 

Kleinhofs A. 2002. The barley stem rust-resistance gene Rpg1 is a novel diseaseresistance 

gene with homology to receptor kinases. Proc. Natl. Acad. Sci. USA 99: 9328- 

9333. 

Edwards K., Johnstone C., Thompson C. 1991. A simple and rapid method for the preparation of 

plant genomic DNA for PCR analysis. Nucleic Acids Res. 19 (6):1349. 

Kleinhofs A., Graner A. 2002. An integrated map of the barley genome. In: R. L. Phillips and I. 

Vasil, eds., DNA-Based Markers in Plants, 2nd Edition. Kluwer Academic Publishers, 

Boston. pp. 187-199. 

Zhang L., Fetch T., Nirmala J., Schmierer D., Brueggeman R., Steffenson B., Kleinhofs A. 2006. 

Rpr1, a gene required for Rpg1-dependent resistance to stem rust in barley. Theor Appl 

Genet 113: 847-855 

46


Tolerance to high copper ions concentration in the nutrient medium of some 

Bulgarian barley cultivars 

J. Stoinova 1 , S. Phileva 1 , M. Merakchyiska 2 and S. Paunova 2 

1 D. Kostov Institute of Genetics, Bulgarian Academy of Sciences, 1113 Bulgaria 

2 M. Popov Institute of Plant Physiology, Bulgarian Academy of 

Sciences, 1113 Bulgaria 

Abstract. The winter two-rowed barley cultivars Obzor, Krasii 2, Vihren and Karan were 

examined for tolerance to environmental copper ions pollution. The plants were treated with 10 -6 

M and 10 -5 M CuSO4.5H2O for 7 days. It was found that under 10 -6 M the roots of cultivars 

Krassi 2 and Vihren were longer by 9% and 16% respectively, while plant green part was 

identical to that of the control. The root of cultivar Karan was severely inhibited its length 

reaching 77% that of the control. The green part was less affected. The data suggest that cultivars 

Krasii 2 and Vihren are tolerant while cultivar Karan is susceptible to increased copper ions 

concentration in the environment. 

Key words: barley, tolerance, copper ions 

Barley is an economically important crop being efficiently used in animal husbandry and 

brewing. Resistant to abiotic and biotic stress barley cultivars are a reliable tool to produce high 

quality stuff avoiding diverse chemical substances for pest control and other agricultural 

practices. Acevedo and Fereres (1993 ) concluded that breeding for abiotic stress resistance is 

becoming more promising with the recognition that selection showed be carried out in the target 

environment and that it is related to narrow adaption. 

During the last decades barley resistance to certain heavy metals has been examined in 

different aspects. It was shown that increased boron concentration in the environment reduce 

plant growth rate, while relative susceptibility of the genotypes to boron toxicity was not 

affected ( Nable et al.,1999). The effect of high boron concentration on barley was studied on 

cell level ( Jenkin et al.,1993). Data from studies with leaf protoplasts revealed that lack of cell 

walls prevents manifestation of differences between tolerant and susceptible barley genotypes. 

Treatment of H. vulgare seeds with nickel sulphate resulted into morphological alterations and 

increased chlorophyll and protein percentage, as well as that of the aberrant cells (Mishra and 

Singh, 1999). Addition of copper (2-4 kg/ha) led to higher grain yield from wheat, rye and oats 

(Piening et al., 1989). Tang et al. (2000) studied the location of genes for tolerance to 

aluminium and found that the latter is disposed to the long arm of 4H chromosome, while 

according to Rigin and Yakovleva (2001) the tolerance is coded by two polygenes. 

The purpose of this investigation was to examine the tolerance to increased copper ions 

concentration in the nutrient medium of four Bulgarian barley cultivars. 


The winter two-rowed cultivars Obzor, Krassi 2, Vihren and Karan were studied. The seeds 

were germinated in moist filter paper rols in a semi-dark chamber at 18° C. After germination 

(2.5 – 3.5 cm root length) the shoots were transffered on a solution containing 10 -6 M or 10 -5 M 

CuSO4.5H2O at a temperature of while the control plants were grown in distilled water. All 

47

plants were grown at 12 h illumination/12 h dark and 20°- 24° C. After 7 days treatment 

biometric data were collected. To determine copper tolerance of the plants usually the tolerance 

index (Simon, 1978) was used, i.e. the plant growth in a heavy metal polluted medium was 

compared to that under control conditions: 

growth in a polluted medium 

IT = 

100 

growth under control conditions 

The data of copper influence on length of root and shoot have been processed by the variation 

statistical method. 


A three-fold treatment with 10 -6 M copper ions concentration of the root (cultivar Obzor) 

caused inhibition (93-94% as compared to the control ) or stimulation up to 103%. In the case of 

the cultivar Karan the roots were strongly inhibited their length varying from 62% to 94% of the 

control. The plants of the cultivar Krassi 2 and cultivar Vihren responded to two of the 

treatments through stimulated root growth from 122% to 135% and from 116% to 129%, 

respectively. The shoot length was less affected, some inhibition varying from 1% to 6% or 

stimulation up to 2 – 4% being manifested by the cultivars Obzor, Krassi 2 and Vihren. More 

significant inhibition was manifested by cultivar Karan. 

The higher (10 -5 M) copper ions concentration severely inhibited both root and shoot of the 

plants from all cultivars after the three treatment accomplished. 

The mean data (Table 1) show that 10 -6 M ions stimulate (9-16%) root growth of the plants 

from cultivars Krassi 2 and Vihren while the roots of the plants from Karan reaced only 77% of 

the control. The green part of the plants was equal to that of the control ones. The variation 

coefficients revealed slight heterogenic variation, while the plant green part length variation was 

homogenic, exept that for cultivar Karan. Higher (10 -5 M) copper ions concentration highly 

reduced root growth, root length reaching 32-41% that of the control. The aboveground part of 

the plants from cultivar Krassi 2 and cultivar Vihren was identical to that of the control while 

those of cultivar Karan and Obzor were 69-75% that of the control. The variation coefficients 

revealed slight heterogenic variation. 

Under 10 -6 M copper ions concentration root mass of cultivar Obzor and cultivar Karan 

reaching 90-91% that of the control, the negative effect being stronger than that exerted on 

cultivars Krassi 2 and Vihren. The green part mass increased (1-3%) in the case of cultivar 

Obzor, cultivar Krassi 2 and cultivar Vihren, while that of cultivar Karan was slightly inhibited. 

10 -5 M copper ions concentration redused plant green part and root mass to 75-79% and 52- 

61%, respectively. 

To conclude, the cultivars Krassi 2 and Vihren manifested tolerance to increased copper ions 

concentration in the environment as under 10 -6 M the root was 9-16% longer than that of the 

control combined with less reduction of the mass (94%) of the control. The grain yield was 672 

kg/da and 677 kg/da, respectively. Therefore, they are suitable for cultivation in highly polluted 

regions. 

Cultivar Karan proved to be susceptible to copper pollution its root being severely reduced. 

Reference 

48


Avecedo,E. and Fereres, E. 1993. Resistance to abiotic stress. In: Plant Breeding: principles and prospects 

(ed. by Hayward, M .D; Bosemark, N. O., Romagoza, I.). London, UK, Chapman and Hall Ltd, 

406-421. 

Jenkin, M., Hu, H. N.,Brown, P., Graham, R., Lance, R. and Sparrow, D. 1993. Investigation on boron 

uptake at the cellular level. Plant and Soil, 155/56, 143-146. 

Mishra, K. and Singh, R. J. 1999. Nickel genotoxicity assessment in Hordeum vulgare. J of 

Environmental Biology, 20, 71-72. 

Nable, R. O., Lance, R. C. H. and Cartwright, B. 1990. Uptake of boron and silicon by barley genotypes 

with differing susceptibilities to boron toxicity. Annals of Botany, 66, 83-90. 

Piening, L. J., Mac Pherson, D. J. and Malhi, S. S. 1989. Stem melanosis of some wheat, barley and oat 

cultivars on a copper deficient soil. Can. J of Plant Pathology, 11, 65-67. 

Rigin, B.V. and Yakovleva, O. V. 2001. Genetic aspects of barley tolerance to toxic aluminium ions. 

International research-practic conference Sankt-Peterburg, 13-16 november, 2001, p. 397. 

Simon, E. 1978. Heavy metals in soils, vegetation development and heavy metal tolerance in plant 

populations from metalliferous areas. New. Phytol., 81, 175-188. 

Tang, Y., Sorre, M. E., Kohain, L.V. and Garvin, D. F. 2000. Identification of RFLP markers linked to 

the barley aluminium tolerance gene Alp. Crop science, 40, 778-782. 

Table 1. Influence of copper ions on the length of root and shoot 

Variant Cultivar 

Length root Length shoot 

%control M ± m Vc% %control M ± m Vc% 

Control 100 12.0 ± 0.13 10.57 100 14.30 ± 0.13 8.93 

10 -6 M 97 11.7 ± 0.18 12.84 99 14.20 ±.0.13 7.88 

10 -5 Obzor 

M 

38 4.6 ±.0.36 14.82 75 10.67 ±.0.13 11.91 

Control 100 12.8 ± 0.21 15.28 100 14.40 ±.0.13 9.62 

10 -6 M 116 14.8 ± 0.23 15.51 100 14.40 ± 0.12 8.49 

10 -5 Krassi 2 

M 

41 5.3 ± 0.25 12.40 73 10.50 ± 0.11 11.11 

Control 100 13.7 ± 0.29 19.65 100 16.40 ± 0.15 8.40 

10 -6 M 109 15.0 ± 0.23 15.29 99 16.20 ±.0.16 9.47 

10 -5 Vihren 

M 

40 5.5 ± 0.08 15.75 72 11.80 ± 0.16 12.85 

Control 100 14.5 ± 0.23 14.65 100 15.40 ± 0.18 10.26 

10 -6 M 77 11.2 ± 0.22 16.50 98 15.10 ± 0.21 12.16 

10 -5 Karan 

M 

32 4.6 ± 0.08 16.49 69 10.60 ± 0.19 16.15 

49

Barley Genetics Newsletter (2007) 37: 100 - 104 

Rules for Nomenclature and Gene Symbolization in Barley 

Jerome D. Franckowiak 1 and Udda Lundqvist 2 

1 HermitageResearch Station 

Queensland Department of Primary Industries and Fisheries 

Warwick, Queensland 4370, Australia 

2 Nordic Gene Bank 

P.O. Box 41, SE-230 53 Alnarp, Sweden 

In this volume of the Barley Genetics Newsletter the recommended rules for nomenclature and 

gene symbolization in barley as reported in BGN 2:11-14, BGN 11:1-16, BGN 21:11-14, BGN 

26:4-8, and BGN 31:76-79 are again reprinted. Also, the current lists of new and revised BGS 

descriptions are presented by BGS number order (Table 1) and by locus symbol in alphabetic 

order (Table 2) in this issue. 

1. In naming hereditary factors, the use of languages of higher internationality should be 

given preference. 

2. Symbols of hereditary factors, derived from their original names, should be written in 

Roman letters of distinctive type, preferably in italics, and be as short as possible. 

AMENDMENT: The original name should be as descriptive as possible of the 

phenotype. All gene symbols should consist of three letters. 

COMMENTS: All new gene symbols should consist of three letters. Existing 

gene symbols of less than three letters should be converted to the three-letter 

system whenever symbols are revised. When appropriate, one or two letters 

should be added to existing symbols. 

For example, add the letters "ap" to "K" to produce the symbol "Kap" to replace 

"K" as the symbol for Kapuze (hooded). As another example, add the letters "ud" 

to "n" to produce the symbol "nud" to replace "n" as the symbol for naked seed. 

Similarly the letter "g" can be added to "ms" to produce the symbol "msg" for 

genetic male sterility and the letter "e" can be added to "ds" to produce the 

symbol "des" for desynapsis. When inappropriate or when conflicts arise, 

questions should be referred to the Committee on Genetic Marker Stocks, 

Nomenclature, and Symbolization of the International Barley Genetics 

Symposium for resolution. 

3. Whenever unambiguous, the name and symbol of a dominant begin with a capital letter 

and those of a recessive with a small letter. 

100

AMENDMENT: When ambiguous (co-dominance, incomplete dominance, etc.) all 

symbols should consist of a capital letter followed by two small letters that designate the 

character, a number that represents a particular locus, and a letter or letters that represents 

a particular allele or mutational event at that particular locus. 

COMMENTS: As an example, the letters "Mdh" can be used to designate the 

character malate dehydrogenase, "Mdh1" would represent a particular locus for 

malate dehydrogenase and "Mdh1a", "Mdh1b", "Mdh1c", etc. would represent 

particular alleles or mutational events at the "Mdh1" locus. Row number can be 

used as an example of symbolizing factors showing incomplete dominance. At the 

present time, the symbol "v" is used to represent the row number in Hordeum 

vulgare, "V" is used to represent the row number in Hordeum distichum, and "V t " 

is used to represent the row number in Hordeum deficiens. According to the 

amendment to Rule 3, if row number were to be designated by the letters "Vul", 

the designation of the locus on chromosome 2 would then become "Vul1" and the 

alleles "v", "V", and "V t " would be designated "Vul1a", "Vul1b", and "Vul1c". 

SUPPLEMENTARY AMENDMENT: A period should be placed before the allele 

symbol in the complete gene symbol. 

COMMENTS: Since DNA sequences similar to those of the original locus may 

occur at several positions in the Hordeum vulgare genome, a three-letter symbol 

plus a number is inadequate to represent all potential loci. Also, both numbers and 

letters have been assigned to specific mutants and isozymes in Hordeum vulgare. 

The six-rowed spike locus is used as an example although the symbol Vul1 for 

row number in Hordeum vulgare is not recommended because the botanical 

classification of Hordeum spp has changed. The locus symbol vrs1 and the name 

six-rowed spike 1 are recommended for the v locus. Gene symbols recommended 

for common alleles at the vrs1 locus are vrs1.a, vrs1.b, vrs1.c, and vrs1.t for the 

"v", "V", "v lr ", and "V t " genes, respectively. 

4. Literal or numeral superscripts are used to represent the different members of an allelic 

series. 

AMENDMENT: All letters and numbers used in symbolization should be written on one 

line; no superscripts or subscripts should be used. 

5. Standard or wild type alleles are designated by the gene symbols with a + as a superscript 

or by a + with the gene symbol as a superscript. In formulae, the + alone may be used. 

AMENDMENT: This rule will not be used in barley symbolization. 

6. Two or more genes having phenotypically similar effects are designated by a common 

basic symbol. Non-allelic loci (mimics, polymeric genes, etc.) are distinguished by an 

additional letter or Arabic numeral either on the same line after a hyphen or as a 

subscript. Alleles of independent mutational origin may be indicated by a superscript. 

101

AMENDMENT: Barley gene symbols should consist of three letters that designate the 

character, a number that represents a particular locus, and a letter or letters that represents 

a particular allele or mutational event at that particular locus. All letters and numbers 

should be written on the same line without hyphens or spaces. Alleles or mutational 

events that have not been assigned to a locus should be symbolized by three letters that 

designate the character followed by two commas used to reserve space for the locus 

number when determined, followed by a letter or letters representing the particular allele 

or mutational event. After appropriate allele testing, the correct locus number will be 

substituted for the commas. Where appropriate (when assigning new symbols or when 

revising existing symbols) letters representing alleles or mutational events should be 

assigned consecutively without regard to locus number or priority in discovery or 

publication. 

COMMENTS: The use of the proposed system of symbolization can be 

illustrated by the desynaptic mutants. Two loci are known: lc on chromosome 1 

(7H) and ds on chromosome 3 (3H). These will be resymbolized as des1a and 

des2b. A large number of desynaptic mutants have been collected. They will be 

designated des,,c, des,,d, des,,e, etc. If allele tests show that des,,c is at a different 

locus than des1 and des2, des,,c will become des3c. If allele tests show that des,,d 

is at the same locus as des2, des,,d will become des2d. In practical use, the 

symbol des will be used when speaking of desynapsis in general or if only one 

locus was known for the character. The symbol des2 will be used when speaking 

of that particular locus, and the symbol des2b will be used only when speaking of 

that particular allele or mutational event. If additional designation is needed in 

particular symbolization, it can be obtained by adding numbers behind the allele 

letters, and, if still further designation is needed, letters can be added to the 

symbol behind the last number. Symbolization consisting of alternation of letters 

and numbers written on the same line without hyphens or spaces will allow for 

the expansion of the symbol as future needs arise. In any work with large numbers 

of polymeric gene mutants, every mutant has to be given a designation not shared 

by any other mutant of this polymeric group and this designation should become a 

part of the permanent symbol representing that particular allele or mutational 

event. This requirement can be met by assigning allele designations in 

consecutive order without regard to locus number. 

SUPPLEMENTARY AMENDMENT: A period should be used instead of two commas 

in gene symbols for mutants within a polymeric group that can not be assigned to a 

specific locus. 

COMMENTS: The des symbol should be used when referring to desynapsis in 

general; des1 and des2, for specific loci; des1.a and des2.b for specific genes or 

alleles at their respective loci; and des.c, des.d, des.e etc., for desynaptic mutants 

not assigned to a specific locus. 

SUPPLEMENTARY AMENDMENT: 

Even if the locus in question is the only one known that affects a given phenotype, the 

three-letter basic symbol is followed by a serial number. 

102

7. Inhibitors, suppressors, and enhancers are designated by the symbols I, Su, and En, or by 

i, su, and en if they are recessive, followed by a hyphen and the symbol of the allele 

affected. 

AMENDMENT 

This rule is no longer appicable and will not be used in barley symbolization. 

8. Whenever convenient, lethals should be designated by the letter l or L and sterility and 

incompatibility genes by s or S. 


COMMENTS: J.G. Moseman (BGN 2:145-147) proposed that the first of the 

three letters for designating genes for reaction to pests should be R. The second 

and third letters will be the genus and species names of the pest. 

SUPPLEMENTARY COMMENT: A motion was passed during the workshop on 

"Linkage Groups and Genetic Stock Collections" at the Fifth International Barley 

Genetics Symposium in 1986 (Barley Genetics V:1056-1058, BGN 17:1-4), that 

the International Committee for Nomenclature and Symbolization of Barley 

Genes should "recommend use of Ml as the designation of genes for resistance to 

powdery mildew.” 

9. Linkage groups and corresponding chromosomes are preferably designated by Arabic 

numerals. 

SUPPLEMENTARY AMENDMENT: The current wheat homoeologous group 

numbering scheme (the Triticeae system) is recommended for Hordeum vulgare 

chromosomes. Arabic numerals followed by an H will indicate specific barley 

chromosomes. The H. vulgare chromosomes should be 7H, 2H, 3H, 4H, 1H, 6H, and 5H 

instead of 1, 2, 3, 4, 5, 6, and 7, respectively. 

10. The letter X and Y are recommended to designate sex chromosomes. 


11. Genic formulae are written as fractions with the maternal alleles given first or above. 

Each fraction corresponds to a single linkage group. Different linkage groups written in 

numerical sequence are separated by semicolons. Symbols of unlocated genes are placed 

within parenthesis at the end of the formula. In euploids and aneuploids, the gene 

symbols are repeated as many times as there are homologous loci. 

12. Chromosomal aberrations should be indicated by abbreviations: Df for deficiency, Dp for 

duplication, In for inversion, T for translocation, Tp for transposition. 

13. The zygotic number of chromosomes is indicated by 2n, the gametic number by n, and 

basic number by x. 

103

14. Symbols of extra-chromosomal factors should be enclosed within brackets and precede 

the genic formula. 

The following recommendations made by the International Committee for Nomenclature and 

Symbolization of Barley Genes at the Fourth International Barley Genetics Symposium in 1981 

(Barley Genetics IV:959-961) on gene and mutation designations were as follows. 

AMENDMENT: 

A. Present designations for genes and mutations. - Most of the present designations should 

be maintained. However, new designations may be given, when additional information 

indicates that new designations would aid in the identification of genes and mutations. 

B. New designations for genes and mutations. - New genes or mutations will be designated 

by characteristic, locus, allele, and then the order of identification or mutational event. 

Three letters will be used to identify new characteristics. Consecutive numbers will be 

used to identify the order of identification or mutational event. Loci will be designated by 

numbers and alleles by letters when they are identified. For example, des-6 indicates that 

this is the sixth gene or mutation identified for the characteristic des (desynaptic). des 1-6 

and des 2-7 indicate that gene or mutational events 6 and 7 for the desynaptic 

characteristic have been shown to be at different loci and those loci are then designated 1 

and 2, respectively. des 1a6 and des 1b8, indicate that the gene or mutational events 6 

and 8 for the characteristic desynaptic have been shown to be at different alleles at locus 

1 and those alleles are then designated a and b. 

SUPPLEMENTARY COMMENT: 

A motion was passed during the workshop of the "Nomenclature and Gene 

Symbolization Committee" at the Fifth International Barley Genetics Symposium in 1986 

(Barley Genetics V:1056-1058) that "the recommended systems for Nomenclature and 

Gene Symbolization of the International Committee be published annually in the Barley 

Genetics Newsletter." 

SUPPLEMENTARY COMMENT 2: 

At the workshop for ”Recommendations of Barley Nomenclature” held at Saskatoon, 

July 31, 1996 and adopted at the General Meeting of the Seventh International Barley 

Genetics Symposium, it was recommended that a period instead of a dash be used to 

designate the allele portion of the gene symbol. Consequently, the first gene symbol for 

the characteristic des (desynapsis) should be expressed as des1.a. The code des1 

identifies a specific locus. The period indicates that the symbol a identifies a specific 

allele or mutational event that produces a desynaptic phenotype. (The allele symbol a 

will be always associated with this specific desynaptic mutant even if the locus symbol is 

changed based on subsequent research results.) 

104


REPORTS OF THE COORDINATORS 

Overall coordinator’s report 

Udda Lundqvist 

Nordic Gene Bank 

P.O. Box 41. SE-230 53 Alnarp 

e-mail: udda@nordgen.org 

Since the latest overall coordinator’s report in Barley Genetics Newsletter Volume 36, some 

changes of the coordinators have taken place. I do hope that most of you are willing to continue 

with this work and provide us with new important information and literature search in the future. 

A replacement was found for Chromosome 4H, namely Arnis Druka, Genetics Programme at the 

Scottish Crop Research Institute, Invergowrie, Dundee, United Kingdom. Please observe some 

address changes have taken place since the last volume of BGN. Jerry Franckowiak, the 

Coordinator for chromosome 2H, the semi-dwarf collection and all his immense efforts creating 

isogenic lines in the Bowman genetic background of many different barley genetic stocks has 

moved from North Dakota State University to Warwick, Queensland, Australia. The Curator, An 

Hang, for the Barley Genetics Stock Center at the USDA-ARS station at Aberdeen, Idaho, USA, 

has retired during the year 2007. Dr. Harold Bockelman from the same station is nominated as 

successor. An Hang has been involved and engaged in Barley Genetics since many decades, first 

together with Tak Tsuchiya at Fort Collins, Colorado and since 1990 at Aberdeen, Idaho. He 

took care of the move of all genetic barley stocks from Fort Collins to Aberdeen, has been 

evaluating and increasing most of them. He has been a considerable collaborator and colleague 

to the barley community, handled with big carefulness all the different barley types and 

transferred a large knowledge to all of us. I take this opportunity to thank him for all his 

kindness, helpfulness, enthusiasm and inspiration during all these years. All the best wishes to 

him in the future and his retirement. But I want to thank those who have resigned for their good 

corporation and the reliability of sending informative reports during all the years. 

In this connection I also want to call upon the barley community to pay attention on the AceDB 

database for ’Barley Genes and Barley Genetic Stocks’. It contains much information connected 

with images and is useful for barley research groups inducing barley mutants and looking for 

new characters. It gets updated continuously and some more images are added to the original 

version. The searchable address is: www.untamo.net/bgs 

In some months the 10th International Barley Genetics Symposium will be organized in 

Alexandria, Egypt. I hope that many of you will be to participate in the meetings. It is of big 

importance to discuss the future of different items, especially the coordination system and the 

future of Barley Genetics Newsletter. I would like to encourage the coordinators and their 

colleagues already to-day to provide me with suggestions, ideas, items or topics to be brought up 

during the meetings. 

105


List of Barley Coordinators 

Chromoosome 1H (5): Gunter Backes, The University of Copenhagen, Faculty of Life Science, 

Department of Agricultural Sciences, Thorvaldsensvej 40, DK-1871 Fredriksberg C, Denmark. 

FAX: +45 3528 3468; e-mail: 

Chromosome 2H (2): Jerry. D. Franckowiak, Hermitage Research Station, Queensland 

Department of Primary Industries and Fisheries, Warwick, Queensland 4370, Australia, FAX: 

+61 7 4660 3600; e-mail: 

Chromosome 3H (3): Luke Ramsey, Genetics Programme, Scottish Crop Research Institute, 

Invergowrie, Dundee, DD2 5DA, United Kingdom. FAX: +44 1382 562426. E-mail: 

 

Chromosome 4H (4): Arnis Druka, Genetics Programme, Scottish Crop Research Institute, 

Invergowrie, Dundee, DD2 5DA, United Kingdom. FAX: +44 1382 562426. e-mail: 

 

Chromosome 5H (7): George Fedak, Eastern Cereal and Oilseed Research Centre, Agriculture 

and Agri-Food Canada, ECORC, Ottawa, ON, Canada K1A 0C6, FAX: +1 613 759 6559; email: 

 

Chromosome 6H (6): Duane Falk, Department of Crop Science, University of Guelph, Guelph, 

ON, Canada, N1G 2W1. FAX: +1 519 763 8933; e-mail: 

Chromosome 7H (1): Lynn Dahleen, USDA-ARS, State University Station, P.O. Box 5677, 

Fargo, ND 58105, USA. FAX: + 1 701 239 1369; e-mail: 

Integration of molecular and morphological marker maps: Andy Kleinhofs, Department of 

Crop and Soil Sciences, Washington State University, Pullman, WA 99164-6420, USA. FAX: 

+1 509 335 8674; e-mail: 

Barley Genetics Stock Center: An Hang, USDA-ARS, National Small Grains Germplasm 

Research Facility, 1691 S. 2700 W., Aberdeen, ID 83210, USA. FAX: +1 208 397 4165; e-mail: 

 

and 

Harold Bockelmann, National Small Grains Collection, U.S. Department of Agriculture – 

Agricultural Research Service, 1691 S. 2700 W., Aberdeen, ID 83210, USA. FAX: +1 208 397 

4165. e-mail: 

Trisomic and aneuploid stocks: An Hang, USDA-ARS, National Small Grains Germplasm 

Research Facility, 1691 S. 2700 W., Aberdeen, ID 83210, USA. FAX: +1 208 397 4165; e-mail: 

 

Translocations and balanced tertiary trisomics: Andreas Houben, Institute of Plant Genetics 

and Crop Plant Research, Corrensstrasse 3, DE-06466 Gatersleben, Germany. FAX: +49 39482 

5137; e-mail: 

106


List of Barley Coordinators (continued) 

Desynaptic genes: Andreas Houben, Institute of Plant Genetics and Crop Plant Research, 

Corrensstrasse 3, DE-06466 Gatersleben, Germany. FAX: +49 39482 5137; e-mail: 

 

Autotetraploids: Wolfgang Friedt, Institute of Crop Science and Plant Breeding, Justus-Liebig- 

University, Heinrich-Buff-Ring 26-32, DE-35392 Giessen, Germany. FAX: +49 641 9937429; email: 

 

Disease and pest resistance genes: Brian Steffenson, Department of Plant Pathology, 

University of Minnesota, 495 Borlaug Hall, 1991 Upper Buford Circle, St. Paul, MN 55108- 

6030, USA. FAX: +1 612 625 9728; e-mail: 

Eceriferum genes: Udda Lundqvist, Nordic Gene Bank, P.O. Box 41, SE-230 53 Alnarp, 

Sweden. FAX:.+46 40 536650; e-mail: < udda@nordgen.org> 

Chloroplast genes: Mats Hansson, Department of Biochemistry, University of Lund, Box 124, 

SE-221 00 Lund, Sweden. FAX: +46 46 222 4534 e-mail: 

Genetic male sterile genes: Mario C. Therrien, Agriculture and Agri-Food Canada, P.O. Box 

1000A, R.R. #3, Brandon, MB, Canada R7A 5Y3, FAX: +1 204 728 3858; e-mail: 

 

Ear morphology genes: Udda Lundqvist, Nordic Gene Bank, P.O. Box 41, SE-230 53 Alnarp, 

Sweden. FAX: +46 40 536650; e-mail: < udda@nordgen.org> 

or 

Antonio Michele Stanca: Istituto Sperimentale per la Cerealicoltura, Sezione di Fiorenzuola 

d’Arda, Via Protaso 302, IT-29017 Fiorenzuola d’Arda (PC), Italy. FAX +39 0523 983750, email: 

 

Semi-dwarf genes: Jerry D. Franckowiak, Hermitage Research Station, Queensland Department 

of Primary Industries and Fisheries, Warwick, Queensland 4370, Australia, FAX: +61 7 4660 

3600; e-mail: < Jerome.franckowiak@dpi.qld.gpv.au > 

Early maturity genes: Udda Lundqvist, Nordic Gene Bank, P.O. Box 41 SE-230 53 Alnarp, 

Sweden. FAX: +46 40 536650; e-mail: 

Biochemical mutants - Including lysine, hordein and nitrate reductase: Andy Kleinhofs, 

Department of Crop and Soil Sciences, Washington State University, Pullman, WA 99164-6420, 

USA. FAX: +1 509 335 8674; e-mail: 

Barley-wheat genetic stocks: A.K.M.R. Islam, Department of Plant Science, Waite Agricultural 

Research Institute, The University of Adelaide, Glen Osmond, S.A. 5064, Australia. FAX: +61 8 

8303 7109; e-mail: 

107


Coordinator’s Report: Barley Chromosome 1H (5) 

Gunter Backes 

The University of Copenhagen 

Faculty of Life Sciences 

Department of Agricultural Sciences 

Thorvaldsensvej 40 

DK-1871 Frederiksberg C, Denmark 

guba@life.ku.dk 

In Arabidopsis, HLM1 encodes the cyclic nucleotide-gated ion channel 4. A mutant plant for this 

gene shows necrotic lesions and thereby similarities to the hypersensitive response (HR) to 

pathogens. Rostoks et al. (2006) isolated the homolog of this gene from the previously 

characterized barley mutant nec1 and localized the gene in the ‘Steptoe’ x ‘Morex’ “minimapper 

population” to chromosome 1H, Bin9. 

In an attempt to localize transcription factors (TFs ) belonging to the gene family of C-repeat 

binding factors (CBF), their regulators and MYB-TFs, altogether known to regulate plant 

response to cold and drought stress, Tondelli et al. (2006) localized several homologs to the 

respective Arabidopsis genes in a joined map of the three populations ‘Nure’ × ‘Tremois’, 

‘Proctor’ × ‘Nudinka’ and ‘Steptoe’ × ‘Morex’. Further, they compared the loci of these putative 

TFs with the position of published QTLs. They localized 9 homologs and assigned two further 

homologs by wheat-barley addition lines to the respective chromosomes. On chromosome 1H 

they localized HvMYB4 to Bin6, a homolog to AtMyb2 from Arabidopsis and OsMYB4 from rice, 

both known to be part of the regulation processes during abiotic stresses. 

In a similar effort, Skinner et al. (2006) localized the barley homologs of 14 Arabidopsis CBF- 

TFs and 2 further TFs in the barley populations ‘Steptoe’ × ‘Morex’ and 88Ab536 × 

‘Strider’.The authors also tested the ‘Steptoe’ × ‘Morex’ population in climatic chambers for 

cold tolerance and localized QTLs based on these data. On chromosome 1H, they localized 

HvZFP16-1, a homolog to AtZAT12, to Bin4. A further homolog of the same Arabidopsis gene, 

HvZFPR16-2 was assigned to 1H by wheat-barley addition lines. A QTL for cold tolerance was 

localized on 1H, Bin11, by a LOD score of 5.7. No co-localization between the QTLs and the 

TFs localized in this study was found. Nevertheless, comparison with literature indicated QTLs 

at the position of two candidate gene loci on 5H. 

The same group (Szücs et al. 2006) published results describing the localization of photoreceptor 

genes and vernalization-related genes together with QTLs for photoperiod response. Mapping of 

both, the candidate genes and QTLs, was carried out in DH populations of the crosses ‘Dicktoe’ 

× ‘Morex’ and ‘Dicktoe’ × ‘Kompolti korai’. While none of the candidate genes was localized on 

chromosome 1H, two QTL were detected with the ‘Dicktoo’ × ‘Morex’ population: a major QTL 

in Bin11 and a further QTL in Bin12. 

In order to localize qualitative and quantitative resistance against rice blast in barley, Inukai et al. 

(2006) analyzed a segregating DH population from the cross ‘Baroness’ × BCD47 with two 

different rice blast isolates in a greenhouse experiment. For one of the isolates, a qualitative 

segregation was found and consequently a new resistance gene, RMo1, was localized on 

chromosome 1H, Bin2 at or near the position of the Mla-locus. For the other isolate, a 

108


quantitative segregation was found and a major QTL was detected at the position of RMo1, while 

further 3 QTLs were localized on the chromosomes 3H, 4H and 7H. 

Jafary et al. (2006) investigated the inheritance and specificity of plant factors that determine the 

degree of basal defence by host- and nonhost pathogens. For this purpose, they analyzed 152 

RILs from the cross ‘Vada’ x ‘SusPtrit’ with 2 rust isolates from barley rusts and 8 isolates from 

rusts with no barley-specificity, isolated from cultivated and wild Poaceae. ‘SusPtrit’ is an 

experimental barley accession selected for susceptibility to the wheat leaf rust fungus Puccinia 

triticina. On chromosome 1H, an R-gene against the fungus Puccinia hordei-secalini was 

localized. P. hordei-secalini has no host-specificity for H. vulgare. Furthermore, three different 

QTLs were detected. One of them conferred resistance against P. hordei-murini, one against P. 

graminis f.sp. lolii and one against P. graminis f.sp. tritici. Only the latter has barley-specificity. 

As the linkage map for 1H in this analysis purely consisted of AFLP marker, it was not possible 

to assign the R-gene or QTLs to the Bin-map. 

A new qualitative resistance gene against spot blotch, Rcs6, caused by Cochliobolus sativus, was 

localized on chromosome 1H either proximal on Bin1 or distal on Bin2 by Bilgic et al. (2006). 

They tested the DH population ‘Calcuchima-sib’ × ‘Bowman-BC’ with two different isolates 

both on seedlings in the greenhouse and on adult plants in the field. While one isolate identified 

the above mentioned resistance gene both in the seedlings and the adult plants, the other isolate 

detected different quantitative resistance loci for the greenhouse compared with the field, none of 

them on the position of Rcs6. 

Rsp2 and Rsp3, originally designated Sep2 and Sep3, are barley resistance genes against speckled 

leaf blotch in barley, caused by Septoria passerinii. These genes were mapped by Zhong et al. 

(2006) in an F2:3 population of the cross 'Foster' x 'Clho 4780' based on seedling tests with a 

specific isolate. These two genes are either closely linked or allelic and are localized on 

chromosome 1H and, as estimated by the flanking markers, more exactly in Bin3. 

Sameri et al. (2006) localized QTLs for different agronomic traits in an RIL population derived 

from a cross between two Japanese barley varieties ‘Azumamugi’ and ‘Kanto Nakate Gold’. 

‘Azumamugi’ is an oriental type barley, while ‘Kanto Nakate Gold’ belongs to the occidental 

type of barley varieties in Japan. The agronomic traits were evaluated in a field experiment on 

one location over two years. On chromosome 1H, one QTL for days to heading was localized 

near the position of Ppd-H2 (photoperiod sensitivity, Bin9/10) and one QTL for days to heading 

and days to maturity was detected near the position of eam8 (‘early maturity’, Bin14). 

In an F2:4 population from a cross between two wild barleys (H. v. ssp. spontaneum) from Israel, 

Vanhala and Stam (2006) localized QTL for seed dormancy. One of the lines (‘Mehola’) 

originates from the Jordan valley with low humidity and shows high seed dormancy, while the 

other line (‘Ashkelon’) originates from the Mediterranean coast with relatively high humidity 

and shows low dormancy. The germination rate was tested after 0 days, 14 days, 28 days and 42 

days of after-ripening at + 40˚ C. On chromosome 1H, the only QTL where the ‘Ashkelon’-allele 

prolongated the dormancy was found, while for the four other QTLs, on chromosomes 2H, 5H, 

6H and 7H, ‘Mehola’ contributed the allele with the higher dormancy. As the map of 1H was 

solely based on AFLPs, it was not possible to assign the position to a Bin. 

QTLs for grain yield (Bin11/12), heading date (Bin7), plant height (Bin14), ear length (Bin9, 

Bin13), spikelets/spike (Bin8/9), grain/spike (Bin8/9), spikes/plant (Bin12) and 1000-grain mass 

(Bin9, Bin11/12) were detected on chromosome 1H in an advanced-backcross experiment (Li et 

109


al. 2006). The wild barley parent was the line ‘HS584’, and the recurrent cultivated parent was 

the variety ‘Brenda’. The field trials were carried out on 2 locations during four years. The map 

positions of the marker were based on the ‘Igri’ × ‘Franka’ and ‘Steptoe’ × ‘Morex’ SSR maps 

((Li et al., 2003). 

In another advanced-backcross with the wild barley line ‘ISR42-8’ and the recurrent cultivated 

parent ‘Scarlett’, von Korff et al. (2005) analyzed agronomic traits in a field experiments (four 

locations during two years). On 1H, QTLs were found for ears per m² (Bin14), heading date 

(Bin13), plant height (Bin13), harvest index (Bin13, Bin14) and yield (Bin6-8). 

References: 

Bilgic, H., B. J. Steffenson, and P. M. Hayes. 2006. Molecular mapping of loci conferring 

resistance to different pathotypes of the spot blotch pathogen in barley. Phytopathology 

96(7): 699-708. 

Inukai, T., M. I. Vales, K. Hori, K. Sato, and P. M. Hayes. 2006. RMo1 confers blast 

resistance in barley and is located within the complex of resistance genes containing Mla, 

a powdery mildew resistance gene. Mol. Plant Microbe Interact. 19(9): 1034-1041. 

Jafary, H., L. J. Szabo, and R. E. Niks. 2006. Innate nonhost immunity in barley to different 

heterologous rust fungi is controlled by sets of resistance genes with different and 

overlapping specificities. Mol. Plant Microbe Interact. 19(11): 1270-1279. 

Li, J. Z., X. Q. Huang, F. Heinrichs, M. W. Ganal, and M. S. Roder. 2006. Analysis of QTLs 

for yield components, agronomic traits, and disease resistance in an advanced backcross 

population of spring barley. Genome 49(5): 454-466. 

Li, J. Z., T. G. Sjakste, M. S. Röder, and M. W. Ganal. 2003. Development and genetic 

mapping of 127 new microsatellite markers in barley. Theor. Appl. Genet. 107(6): 1021- 

1027. 

Rostoks, N., D. Schmierer, S. Mudie, T. Drader, R. Brueggeman, D. G. Caldwell, R. 

Waugh, and A. Kleinhofs. 2006. Barley necrotic locus nec1 encodes the cyclic 

nucleotide-gated ion channel 4 homologous to the Arabidopsis HLM1. Mol. Genet. 

Genom 275(2): 159-168. 

Sameri, M., K. Takeda, and T. Komatsuda. 2006. Quantitative trait loci controlling agronomic 

traits in recombinant inbred lines from a cross of oriental- and occidental-type barley 

cultivars. Breed. Sci. 56(3): 243-252. 

Skinner, J. S., P. Szücs, J. von Zitzewitz, L. Marquez-Cedillo, T. Filichkin, E. J. Stockinger, 

M. F. Thomashow, T. H. H. Chen, and P. M. Hayes. 2006. Mapping of barley 

homologs to genes that regulate low temperature tolerance in Arabidopsis. Theor. Appl. 

Genet. 112(5): 832-842. 

110


Szücs, P., I. Karsai, J. von Zitzewitz, K. Meszaros, L. L. D. Cooper, Y. Q. Gu, T. H. H. 

Chen, P. M. Hayes, and J. S. Skinner. 2006. Positional relationships between 

photoperiod response QTL and photoreceptor and vernalization genes in barley. 

Theor. Appl. Genet. 112(7): 1277-1285. 

Tondelli, A., E. Francia, D. Barabaschi, A. Aprile, J. S. Skinner, E. J. Stockinger, A. M. 

Stanca, and N. Pecchioni. 2006. Mapping regulatory genes as candidates for cold 

and drought stress tolerance in barley. Theor. Appl. Genet. 112(3): 445-454. 

Vanhala, T. K. and P. Stam. 2006. Quantitative trait loci for seed dormancy in wild barley 

(Hordeum spontaneum c. Koch). Genet. Resour. Crop. Evol. 53(5): 1013-1019. 

von Korff, M., H. Wang, and J. Léon. 2005. AB-QTL analysis in spring barley. I. Detection of 

resistance genes against powdery mildew, leaf rust and scald introgressed from wild 

barley. Theor. Appl. Genet. 111(3): 583-590. 

Zhong, S. B., H. Toubia-Rahme, B. J. Steffenson, and K. P. Smith. 2006. Molecular mapping 

and marker-assisted selection of genes for septoria speckled leaf blotch resistance in 

barley. Phytopathology 96(9): 993-999. 

111


Coordinator’s report: Chromosome 2H (2) 

J.D. Franckowiak 

Hermitage Research Station 



e-mail: jerome.franckowiak@dpi.qld.gpv.au 

Komatsuda et al. (2007) cloned the six-rowed spike 1 (vrs1) gene located on chromosome 2HL 

of barley. Expression of the Vrs1 was strictly localized in the lateral-spikelet primordia of 

immature spikes and suggests that the VRS1 protein suppresses development of lateral spikelets. 

Phylogenetic analysis of the six-rowed cultivars and mutants demonstrated that six-rowed spike 

trait originated repeatedly from two-rowed barley, at least three different origins among 

domesticated accessions. Also, the DNA sequence defects in many of vrs1 mutants held in the 

Nordic Gene Bank were identified. 

When the DNA sequence of vrs1 was determined, Pourkheirandish et al. (2007) found that the 

region around the vrs1 locus was collinear with rice chromosome 4. However, the rice 

orthologue for the vrs1 sequence was found on rice chromosome 7. The authors speculated that a 

transposition of the chromosomal segment Vrs1 to chromosome 2H occurred during the 

evolution of barley. Pourkheirandish et al. (2007) also reported that the vrs1 locus is a region of 

suppressed recombination based on the study of more than 13,000 gametes. 

Řepková et al. (2006) reported on the mapping of four new sources of resistance to powdery 

mildew, caused by Blumeria graminis f. sp. hordei, that were identified in accessions of wild 

barley, Hordeum vulgare ssp. spontaneum. Accession PI 466197 was found to have two 

dominant resistance genes. One is an allelic at the mla locus and the other was located on 

chromosome 2HS based on a highly significant linkage with molecular marker Bmac0134. 

Dahleen and Franckowiak (2006) found that cer-zt locus is located on chromosome 2HS based 

on linkage to molecular marker Bmac0134 in bin 2H-1. The cert-zt.389 mutant has very little 

surface wax on the spike (Lundqvist and Franckowiak, 1997), but little effect on other 

agronomic traits except a slightly increased number of kernels per spike (Dahleen and 

Franckowiak, 2006). 

Based on the analysis of 134 recombinant chromosome substitution lines (RCLs) from the BC3 

generation of the backcross of wild barley line (OUH602) into ‘Haurna Nijo’, Hori et al. (2005) 

found that QTLs for short spike and lax spike are on chromosome 2HL near the closed flowering 

(cleistogamy, cly1/Cly2) locus of Haurna Nijo. In a previous paper, Hori et al. (2003) reported 

that these QTLs plus one for short culm were observed in a population of doubled-haploid lines 

from a Haurna Nijo/OUH602 cross. 

Using recombinant inbred lines, Yun et al. (2005) found a QTL for resistance to Septoria 

speckled leaf blotch (SSLB, caused by Septoria passerinii Sacc.) from H. vulgare subsp. 

spontaneum, located in bins 7 to 11 of chromosome 2H. They examined a recombinant inbred 

line (RIL) population developed from a cross between wild barley accession OUH602 and the 

two-rowed malting cultivar ‘Harrington’ for reaction to SSLB. About 40% of the variation in 

112


response to SSLB was explained by the QTL on 2H, named QTL Rsp-2H-7-ll. The mapped 

disease resistances were validated using an advanced backcross population (BC2F6:8) from the 

same donor parent, but having two more backcrosses to Harrington (Yun et al., 2006). 

A QTL regulating synthesis of cell wall (1,3;1,4)-beta-D-glucans was located between the 

markers Adh8 bin 6 and ABG019 bin 7 with the peak closer to ABG019 on 2H (Burton et al., 

2006). The cellulose synthase-like (CslF) gene cluster in cereals was identified as candidates 

responsible for mediating cell wall (1,3;1,4)- ß -D-glucan synthesis using of rice synteny and by 

transforming Arabidopsis (Burton et al., 2006). The research was based on the map location of a 

major QTL for (1,3;1,4)-ß-D-glucan content of un-germinated barley grains on 2H. This report is 

believed the first example of a map-based cloning of a QTL in barley. 

Korff et al. (2006) reported on a large number of QTLs for agronomic traits detected in doubledhaploid 

lines from the second backcross of ‘Scarlett’ backcrossed to Hordeum vulgare ssp. 

spontaneum accession ISR42-8. Using a population 301 BC2DH in eight environments, they 

reported detection of 86 QTLs for nine agronomic traits. The QTLs having large effects that 

were associated with chromosome 2H included: ears/m2, days to head (Eam1 or Ppd-H1), plant 

height (sdw1 from Scarlett), and yield. 

Yin et al. (2005) confirmed that a QTL having an important effect on preflowering duration in 

the ‘Apex’/‘Prisma’ population of 94 recombinant inbred lines (RILs) was located on the long 

arm of chromosome 2H. The other QTL having a large effect was located on chromosome 3H at 

the same position as the sdw1 gene from Prisma. 

Dragan et al. (2007) located two members of the nicotianamine synthase (NAS) family of genes 

on the short arm of chromosome 2H (2HS). Nicotianamine is involved chelation of iron and 

other heavy metals and their transport in the plant. 

The number of molecular markers located on chromosome 2H has been increased by several 

studies. Beaubien and Smith (2006) placed 7 of the 60 new mapped SSR markers on 2H at bin 

positions that previously had been identified as being poorly covered by SSR markers currently 

available. Stein et al. (2007) published an expressed sequence tag (EST)-based map for barley 

based 200 anchor markers from three previously published maps. The map contained 1,055 loci 

and a map size of 1,118.3 cM. The map for 2H contained 179 EST loci and a map length of 

165.1 cM. Using barley-wheat addition lines and the Barley1 Affymetrix GeneChip probe array, 

Cho et al. (2006) associated 1,787 of 4,104 transcript accumulation patterns detected in Betzes, 

but not Chinese Spring, with specific barley chromosomes. Of these 271 were associated with 

the 2H addition line of Chinese Spring. 

Takahashi et al. (2006) mapped in barley miniature inverted-repeat transposable elements 

(MITEs), which represent a large superfamily of transposons that is moderately to highly 

repetitive and frequently found near or within plant genes. To elucidate the organization of 

MITEs in the barley genome, MITEs were integrated into the genetic map of barley using 93 

doubled haploid lines from a Haruna Nijo by H. vulgare ssp. spontaneum accession OUH602 

cross. They described the use of MITEs in amplified fragment length polymorphism (AFLP) 

mapping and demonstrate their superiority over conventional AFLP mapping. A total of 214 loci 

covered a total map distance of 1,165 cM, and 39 were placed on 2H. 

113


References: 

Beaubien, K.A., and K. P. Smith. 2006. New SSR markers for barley derived from the EST 

database. Barley Genet. Newsl. 36:30-36. 

Burton, R.A., S.M. Wilson, M. Hrmova, A.J. Harvey, N.J. Shirley, A. Medhurst, B.A. 

Stone, E.J. Newbigin, A. Bacic, and G.B. Fincher. 2006. Cellulose synthase-like CslF 

genes mediate the synthesis of cell wall (1,3;1,4)-beta-D-glucans. Science 311:1940- 

1943. 

Cho, S., D.F. Garvin, and G.J. Muehlbauer. 2006. Transcriptome analysis and physical 

mapping of barley genes in wheat–barley chromosome addition lines. Genetics 172:1277- 

1285. 

Dahleen, L.S. and J.D. Franckowiak. 2006. SSR linkages to eight additional morphological 

marker traits. Barley Genet. Newsl. 36:12-16. 

Dragan Perovic, D., P. Tiffin, D. Douchkov, H. Bäumlein, and A. Graner. 2007. An 

integrated approach for the comparative analysis of a multigene family: The 

nicotianamine synthase genes of barley. Funct. Integr. Genomics 7:169-179. 

Hori, K., T. Kobayashi, A. Shimizu, K. Sato, K. Takeda, and S. Kawasaki. 2003. Efficient 

construction of high-density linkage map and its application to QTL analysis in barley. 

Theor. Appl. Genet. 107:806-813. 

Hori, K., K. Sato, N. Nankaku, and K. Takeda. 2005. QTL analysis in recombinant 

chromosome substitution lines and doubled haploid lines derived from a cross between 

Hordeum vulgare ssp. vulgare and Hordeum vulgare ssp. spontaneum. Mol. Breeding 

16(4):295-311. 

Komatsuda, T., M. Pourkheirandish, C. He, P. Azhaguvel, H. Kanamori, D. Perovic, N. 

Stein, A. Graner, T. Wicker, A. Tagiri, U. Lundqvist, T. Fujimura, M. Matsuoka, T. 

Matsumoto, and M. Yano. 2007. Six-rowed barley originated from a mutation in a 

homeodomain-leucine zipper I-class homeobox gene. PNAS 104:1424-1429. 

von Korff, M., H. Wang, J. Léon, and K. Pillen. 2006. AB-QTL analysis in spring barley: II. 

Detection of favourable exotic alleles for agronomic traits introgressed from wild barley 

(H. vulgare ssp. spontaneum). Theor. Appl. Genet. 112:1221-1231. 

Lundqvist, U., and J.D. Franckowiak. 1997. BGS 437, Eceriferum-zt, cer-zt. Barley Genet 

Newsl. 26:389 

Pourkheirandish, M., T. Wicker, N. Stein, T. Fujimura, and T. Komatsuda. 2007. Analysis 

of the barley chromosome 2 region containing the six-rowed spike gene vrs1 reveals a 

breakdown of the rice-barley micro collinearity by a transposition. Theor. Appl. Genet. 

114:1357-1365. 

Řepková, J., A. Dreiseitl, P. Lízal, Z. Kyjovská, K. Teturová, R. Psotková, and A. Jahoor. 

2006. Identification of resistance genes against powdery mildew in four accessions of 

Hordeum vulgare ssp. spontaneum. Euphytica 151:23-30. 

114


Stein, N., M. Prasad, U. Scholz, T. Thiel, H. Zhang, M. Wolf, R. Kota, R.K. Varshney, D. 

Perovic, I. Grosse, and A. Graner. 2007. A 1,000-loci transcript map of the barley 

genome: new anchoring points for integrative grass genomic. Theor. Appl. Genet. 

114:823-839. 

Takahashi, H., H. Akagi, K. Mori, K. Sato, and K. Takeda. 2006. Genomic distribution of 

MITEs in barley determined by MITE-AFLP mapping. Genome 49:1616- 1618. 

Yin, X., P.C. Struik, F.A. van Eeuwijk, P. Stam, and J. Tang. 2005. QTL analysis and QTLbased 

prediction of flowering phenology in recombinant inbred lines of barley J. Exp. 

Bot. 56 (413):967-976. 

Yun, S.J., L. Gyenis, E. Bossolini, P.M. Hayes, I. Matus, K.P. Smith, B.J. Steffenson, R. 

Tuberosa, and G.J. Muehlbauer. 2006. Validation of quantitative trait loci for multiple 

disease resistance in barley using advanced backcross lines developed with a wild barley. 

Crop Sci. 46:1179-1186. 

Yun, S.J., L. Gyenis, P.M. Hayes, I. Matus, K.P. Smith, B.J. Steffenson, and G.J. 

Muehlbauer. 2005. Quantitative trait loci for multiple disease resistance in wild barley. 

Crop Sci. 45:2563-2572. 

115


Coordinator’s Report: Barley Chromosome 3H 

L. Ramsay 

Genetics Programme 

Scottish Crop Research Institute 

Invergowrie, Dundee, DD2 5DA, Scotland, UK. 

e-mail: Luke.Ramsay@scri.ac.uk 

Over the last year there have been a number of publications reporting the mapping of genes and 

QTL on barley chromosome 3H. One of the highlights of this reporting period was the genetic 

mapping of over 1000 genes, including 179 on 3H, by Stein et al. (2007). This worked 

confirmed the syntenic relationship of 3H to rice chromosome 1 and importantly put the detailed 

EST information underlying this and previous reports in the public domain. This includes the 

details of which genes are represented by the EST derived microsatellites reported by Varshney 

et al. (2006) that included 35 that map to 3H. Another report of EST derived microsatellites with 

the associated EST information, including 11 on 3H, was that of Beaubien and Smith (2006). 

Another important general mapping paper was the development of a consensus map derived 

from DArT marker loci (Wenzl et al, 2006) that opens up the possibility of using loci derived 

from this technology as proxies for more expensive genic markers. Also of importance is the 

detailed consensus map presented by Marcel et al. (2007) which brings together standard AFLP, 

microsatellite and RFLP loci and that will allow additional alignment of past work with the 

positions of genic loci. 

A range of QTL on chromosome 3H were again reported this year. In a RIL population derived 

from a cross between Azumamugi and Kanto Nakate Gold studied by Sameri et al. (2006) QTL 

were found on 3H for a range of agronomic characters including plant height, spike length and 

awn length. The position of the QTL found indicates that they are due to the segregation of uzu 

in the population. Li et al. (2006) reported the positions of QTL for a range of agronomic traits 

using recombinant chromosome substation lines derived from a Hordeum vulgare subsp. vulgare 

(cltv. Brenda) by Hordeum vulgare subsp. spontaneum (accession HS584) cross to delineate 

association with genomic regions. The QTL found on 3H included those for yield and 

components such as spikelet no. per spike, grain no. per spike, thousand-grain mass as well as 

other traits such as heading date, plant height, ear length, leaf length and leaf area. A QTL for 

resistance on 3H was also found to leaf rust in two trials which may relate to the two QTL for 

leaf rust resistance found on chromosome 3H in a consensus map by Marcel et al. (2007) in a 

summary of work on six mapping populations. One of the populations used in the construction 

of this consensus map, L94 x Vada, was also tested for mildew and scald resistance and a novel 

powdery mildew resistance QTL designated Rbgq2 was detected on 3H which did not map to a 

region where a major gene for powdery mildew has previously been reported (Shtaya et al. 

2006). Another of the populations included in the report of Marcel et al. 2007 was that derived 

from a cross between an experimental line SusPrit and Vada to study the inheritance of non-host 

immunity to rusts (Jafary et al. 2006). This work found three QTL on 3H associated with host 

and non-host resistance to Puccinia spp. Other disease QTL reported on 3H included the 

improved resolution of spot blotch resistance QTL on the Calicuchima-sib / Bowman BC 

population by Bilgic et al. (2006) and a scald resistance QTL on the long arm of 3H identified 

using a partial map of a doubled haploid population derived from a Mundah/Keel cross (Cheong 

et al., 2006). 

116


References: 

Beaubien, K.A. and K.P. Smith. 2006 New SSR markers for barley derived from the EST 

database. Barley Genetics Newsletter 36: 30-43. 

Bilgic, H., B.J. Steffenson, and P.M. Hayes. 2006. Molecular mapping of loci conferring 

resistance to different pathotypes of the spot blotch pathogen in barley. Phytopathology 

96: 699-708. 

Cheong, J., K. Williams, and H. Wallwork, 2006. The identification of QTLs for adult plant 

resistance to leaf scald in barley. Australian Journal of Agricultural Research 57: 961- 

965. 

Jafary, H., L.J. Szabo, and R.E. Niks, 2006. Innate nonhost immunity in barley to different 


overlapping specificities. Molecular Plant-Microbe Interactions 19: 1270-1279. 

Li, J.Z., X.Q. Huang, F. Heinrichs, M.W. Ganal, and M.S. Roder, 2006. Analysis of QTLs 

for yield components, agronomic traits, and disease resistance in an advanced backcross 

population of spring barley. Genome 49: 454-466. 

Marcel, T.C., R.K. Varshney, M. Barbieri, H. Jafary, M.J.D. de Kock, A. Graner and R.E. 

Niks, 2007. A high-density consensus map of barley to compare the distribution of 

QTLs for partial resistance to Puccinina hordei and of defence gene homologues. Theor 

Appl. Genet 114: 487-500. 

Samuri, M., K. Takeda and Komatsuda, T. 2006. Quantitative trait loci controlling 

agronomic traits in recombinant inbred lines from a cross of oriental- and occidental-type 

barley cultivars. Breeding Science 56: 243-252. 

Shtaya, M.J.Y., T.C. Marcel, J.C. Sillero, R.E. Niks, and D. Rubiales, 2006. Identification of 

QTLs for powdery mildew and scald resistance in barley. Euphytica 151: 421-429. 

Stein, N., M. Prassa, U. Scholz, T. Thiel, H. Zhang, M. Wolf, R. Kota, R.K. Varshney, D. 

Perovic, I. Grosse and A. Graner, 2007. A 1,000-loci transcript map of the barley 

genome: new anchoring points for integrative grass genomics. Theor Appl Genet on-line 

preprint DOI 10.1007/s00122-006-0480-2 

Varshney, R.K., I. Grosse, U. Hahnel, R. Siefken, M. Prasad, N. Stein, P. Langridge, L. 

Altschmied, and A. Graner, 2006. Genetic mapping and BAC assignment of ESTderived 

SSR markers shows non-uniform distribution of genes in the barley genome. 

Theor Appl Genet 113: 239-250. 

Wenzl, P., H.B. Li, J. Carling, M.X. Zhou, H. Raman, E. Paul, P. Hearnden, C. Maier, L. 

Xia, V. Caig, J. Ovesna, M. Cakir, D. Poulsen, J.P. Wang, R. Raman, K.P. Smith, 

G.J. Muehlbauer, K.J. Chalmers, A. Kleinhofs, E. Huttner, and A. Kilian, 2006. A 

high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci 

and agricultural traits. BMC Genomics 7:206. 

117


Coordinator’s Report: Chromosome 4H 

Arnis Druka 

Genetics Programme 

Scottish Crop Research Institute 

Invergowrie, Dundee, DD2 5DA, Scotland, UK. 

e-mail: adruka@scri.sari.ac.uk 

Several papers that relate to the genes on chromosome 4H have been published in 2006 - 2007. 

At least four of them combine mRNA abundance analyses with phenotypic trait genetic analyses 

clearly showing added value of such approach (Malatrasi et al., 2006; Zhang et al., 2006; Wang 

et al., 2007 and Walia et al., 2007). 

The HvMATE gene, encoding a multidrug and toxic compound extrusion protein has been 

identified as a candidate controlling aluminium (Al) tolerance in barley. The gene itself was 

found not to be polymorphic between Al-tolerant and sensitive cultivars, but it accumulates 

mRNA 30 times more in the Al tolerant cultivar. HvMATE mRNA accumulation was measured 

in the F(2:3) families and was found significantly correlated with the Al tolerance and Alactivated 

citrate efflux phenotypes that have been mapped on the long arm of chromosome 4H 

(Wang et al., 2007). 

A different study addressed the salt tolerance in barley by analysing single feature 

polymorphisms (SFPs) and an oligonucleotide pool assay for single nucleotide polymorphisms 

(SNPs) in the salt tolerant cultivar Golden Promise and intolerant cultivar Maythorpe. Golden 

Promise has been generated by inducing mutation in the cultivar Maythorpe. The transcriptome 

analysis indicates that the response of the two genotypes to the salinity stress is quite different.. 

This study identified 3 haplotype blocks spanning 6.4 cM on chromosome 1H, 23.7 cM on 

chromosome 4H and 3.0 cM on 5H suggesting that Golden Promise is not isogenic (Walia et al., 

2007). 

A gene encoding the branched-chain amino acid aminotransferase (HvBCAT-1) that mapped on 

chromosome 4H, was identified by using differential mRNA display applied to ABA, drought 

and cold treated barley seedling shoots. Transcript levels of Hvbcat-1 increased in response to 

drought stress. The complementation of a yeast double knockout strain revealed that HvBCAT-1 

can function as the mitochondrial (catabolic) BCATs in vivo. This allowed to put forward the 

hypothesis, that under drought stress conditions, one of the detoxification mechanisms could be 

associated with degradation of the branched-chain amino acids (Malatrasi et al., 2006). 

Zhang et al. (2006) have reported a novel locus that is required for Rpg1 gene mediated 

resistance to the stem rust (Puccinia graminis f. sp. tritici) fungus. It was identified by inducing 

the irradiation mutations in the resistant barley cultivar and selecting for susceptible individuals 

in the M2 progeny. Rpg1 gene in one such susceptible mutant plants was found to be intact and 

the following mutation mapping identified a locus on chromosome 4H, that was named Rpr1 

(Required for P. graminis resistance). Several candidate genes or novel markers for this locus 

were identified by using large scale parallel transcript profiling approach. 

Other papers that related to chromosome 4H were describing either characterization and 

mapping gene families and the candidate genes for certain QTLs (Brueggeman et al., 2006; 

118


Skinner et al., 2006) or mapping novel QTLs (Friesen et al., 2006; Richardson et al., 2006; Yan 

and Chen 2006; von Korff et al., 2006). 

Thus, Brueggeman et al. (2006) reported mapping of members of the serine/threonine kinaselike 

protein family that encode at least one predicted catalytically active kinase domain. One of 

them was localized to chromosome 4H. In a different study, allelic nature and map locations of 

barley homologs to three classes of Arabidopsis low temperature regulatory genes-CBFs, ICE1, 

and ZAT12 were investigated for associations with the LT tolerance QTLs. In the same study, 

phenotyping of the Dicktoo x Morex (DxM) mapping population under controlled freezing 

conditions identified three new low temperature tolerance (LT) QTLs on 1H-L, 4H-S, and 4H-L 

in addition to the previously reported 5H-L Fr-H1 QTL. (Skinner et al., 2006). 

Barley interaction with the net blotch fungi, Pyrenophora teres f. teres (net-type net blotch 

(NTNB)) and Pyrenophora teres f. maculata (spot-type net blotch (STNB)) was studied using a 

doubled-haploid population derived from the lines SM89010 and Q21861. Major QTLs for 

NTNB and STNB resistance were located on chromosomes 6H and 4H, respectively (Friesen et 

al., 2006). 

Barley and the stripe rust fungus (Puccinia striiformis f. sp. hordei) interaction phenotypes, such 

as latency period, infection efficiency, lesion size and pustule density were mapped using i- 

BISON lines (intermediate barley near-isogenic lines). The (i-BISON) lines represented disease 

resistance QTL combined in one-, two-, and three-way combinations in a susceptible 

background. The 4H QTL allele had the largest effect followed by the alleles on 

chromosomes1H and 5H (Richardson et al., 2006). 

In a different study Yan and Chen (2006) reported population of 182 recombinant inbred lines 

(RILs) (F8) derived from cultivars Steptoe and GZ that was generated to map the resistance to 

two barley stripe rust fungus strains on the long arm of barley chromosome 4H. 

The BC2DH population derived from a cross between the spring barley cultivar Scarlett and the 

wild barley accession ISR42-8 (Hordeum vulgare ssp. spontaneum) was developed to evaluate 

nine agronomic traits. Favourable ISR42-8 alleles were detected for the yield-related traits that 

have QTLs on the long arm of chromosome 4H (von Korff et al., 2006). 

References: 

Brueggeman R. T. Drader, and A. Kleinhofs 2006. The barley serine/threonine kinase gene 

Rpg1 providing resistance to stem rust belongs to a gene family with five other members 

encoding kinase domains. Theor. Appl. Genet. 113(6):1147-1158. 

Friesen T.L., J.D. Faris, Z. Lai, and B.J. Steffenson. 2006. Identification and chromosomal 

location of major genes for resistance to Pyrenophora teres in a doubled-haploid barley 

population. Genome 49(7):855-859. 

Malatrasi M., M. Corradi, J.T. Svensson, T.J. Close, M. Gulli, and N. Marmiroli 2006. A 

branched-chain amino acid aminotransferase gene isolated from Hordeum vulgare is 

differentially regulated by drought stress. Theor. Appl. Genet. 113(6):965-976. 

119


Richardson K.L., M.I. Vales, J.G. Kling, C.C. Mundt, and P.M. Hayes. 2006. Pyramiding 

and dissecting disease resistance QTL to barley stripe rust. Theor. Appl. Genet. 

113(3):485-495. 

Skinner J.S., P. Szucs, J. von Zitzewitz, L. Marquez-Cedillo, T. Filichkin, E.J. Stockinger, 

M.F. Thomashow, T.H. Chen, and P.M. Hayes. 2006. Mapping of barley homologs to 

genes that regulate low temperature tolerance in Arabidopsis. Theor. Appl. Genet. 

112(5):832-842. 

von Korff M., H. Wang, J. Léon, and K. Pillen. 2006. AB-QTL analysis in spring barley: II. 


(H. vulgare ssp. spontaneum). Theor. Appl. Genet. 112(7):1221-1231. 

Walia H., C. Wilson, P. Condamine, A.M. Ismail, J. Xu, X. Cui, and T.J. Close. 2007. 

Array-based genotyping and expression analysis of barley cv. Maythorpe and Golden 

Promise. BMC Genomics. Mar 30; 8:87. 

Wang J., H. Raman, M. Zhou, P.R. Ryan, E. Delhaize, D.M. Hebb, N. Coombes, and N. 

Mendham. 2007. High-resolution mapping of the Alp locus and identification of a 

candidate gene HvMATE controlling aluminium tolerance in barley (Hordeum vulgare 

L.). Theor. Appl. Genet. Jun 6 [Epub ahead of print]. 

Yan G.P. and X.M. Chen. Molecular mapping of a recessive gene for resistance to stripe rust in 

barley. Theor. Appl. Genet. 2006 113(3):529-537. 

Zhang L., T. Fetch, J. Nirmala, D. Schmierer, R. Brueggeman, B. Steffenson, and A. 

Kleinhofs. 2006. Rpr1, a gene required for Rpg1-dependent resistance to stem rust in 

barley. Theor. Appl. Genet. 113(5):847-855. 

120



George Fedak 

Eastern Cereals and Oilseeds Research Centre 

Agriculture and Agri-Food Canada 

Ottawa ON K1A 0C6 

e-mail: fedakga@agr.gc.ca 

The grain hardness locus (Ha) of barley consists of a cluster of genes located on the short arm of 

5H designated as Hina, Hinb-1, Hinb-2 and GSP. Eighty diverse barley genotypes were screened 

for kernel hardness, ruminant digestibility and haplotypes of the four alleles. The highest level of 

genetic variation was obtained with GSP followed by Hina, Hinb-2. Hina was significantly 

related to grain hardness while Hinb-1 and Hinb-2 were significantly associated with dry water 

digestibility. (Turuspekov et al., 2007). 

Using the Nure (winter) x Tremois (spring) mapping population, two low temperature QTL were 

located on the long arm of chromosome 5H. FrHi was located in a distal position and Fr-H2 in a 

proximal location. The location of the latter coincided with the location of a QTL regulating the 

accumulation of two COR proteins; COR14b and TMC-Ap3. Six barley genes for the CBF 

transcription factor have been mapped in a single cluster in this region and they represent 

candidate genes for Fr-H2. (Francia et.al., 2007) 

In a related study, Lombda phage libraries were constructed from 2 spring (Morex and Tremois) 

and two winter (Dicktos, Nure) cultivars. Clones containing CBF genes were sequenced. It was 

found that the winter varieties have a large duplication at the Fr-H2 gene resulting in an increased 

number of CBF genes at this locus. The spring barley Tremois, however, has a significant 

deletion at this locus. This suggests that the relative numbers of CBF in the cluster contributes to 

different levels of winterhardiness (Knox et.al.,2007). 

References: 

Francia, E., D. Baraboschi, A. Tondelli, G. Laido, A.M. Stanca, E. Stockinger and N. 

Pecchioni, 2007. Fine mapping of a Hv CBF gene cluster, at Fr-H2, a QTL controlling 

frost resistance in barley. PAG - XV Poster 331. Plant and Animal Genomes XV 

Conference, Jan 13-17, 2007. San Diego CA. 

Knox, A.K., H. Chang . and E.I. Stockinger, 2007. Comparative Sequence analysis of CBF 

genes at the Fr-H2 locus in four barley cultivars. PAG – XV Poster 321. Plant and Animal 

Genomes XV Conference, Jan 13-17, 2007. San Diego CA. 

Turuspekov Y., B. Beecher, Y. Darlington, J. Bowman, T. Blake and M. Gioux. 

2007.Genetic variation of hardness locus in barley. PAG-XV Poster 329. Plant and 

Animal Genomes XV Conference, Jan 13-17, 2007, San Diego CA. 

121



Lynn S. Dahleen 

USDA-Agricultural Research Service 

Fargo, ND 58105, USA 

e-mail: DAHLEEN@fargo.ars.usda.gov 

Barley gene mapping in 2006 showed a greater emphasis on using candidate gene approaches in 

addition to standard qualitative and quantitative trait mapping. Increased use of public EST and 

BAC libraries was evident, providing tools to better understand the barley genome. 

Efforts to map morphological genes have continued. Roder et al. (2006) mapped the shrunken 

endosperm gene seg8 to a 4.6 cM interval near the centromere of chromosome 7H, while Taketa 

et al. (2006) developed a fine map of the naked caryopsis nud locus, placing it in a 0.66 cM 

region. Rostoks et al. (2006) found that the barley homolog of the Arabidopsis HLM1 gene 

corresponded to the nec1 locus on chromosome 7H. Allelic variation was uncovered at the locus 

that causes necrotic spotting of nec1 plants. Rossini et al. (2006) examined candidate rice genes 

in regions syntenous with markers linked to various barley morphological mutants. On 

chromosome 7H they found brh1 candidate genes on rice chromosome 6 and candidates for 

suKF-76, suKE-74 (suppressors of Hooded) and sld4 on rice chromosomes 6 and 8. The low 

resolution of the barley maps in this region resulted in selection of rather large rice regions and 

numerous candidate genes. Yan et al. (2006) identified the AtFT flowering locus as an ortholog 

of the barley and wheat vernalization gene VRN3. The barley gene VRN-H3 was located on the 

short arm of chromosome 7H, not chromosome 1H as previously thought based on loose linkage 

with BLP. Szucs et al. (2006) mapped genes for photoreceptor gene families and vernalization 

regulation, and compared their locations to QTL for photoperiod response. The barley ortholog 

to a wheat flowering repressor, HvVRT-2 mapped to the short arm of chromosome 7H. This 

locus coincided with a photoperiod QTL with small effects mapped in the Dicktoo x Morex 

population. Tondelli et al. (2006), using a similar approach, mapped candidate genes for cold or 

drought response based on sequences identified in other plants. Two orthologs of Arabidopsis 

genes (AtFRY1 and AtICE1) that have a prominent role in cold acclimation were identified on 

chromosome 7H. 

QTL analyses for a variety of traits were reported this year. Chloupek et al. (2006) mapped root 

system size traits in a population segregating for two semidwarf genes, sdw1 and ari-e.GP. On 

chromosome 7H, they identified a region associated with height, and another region associated 

with harvest index, plant weight, root system size at grain filling and total root system size. 

Advanced backcross QTL analysis continued, with von Korff et al. (2006) detecting favorable 

alleles from wild barley in crosses with Scarlett. Out of the 86 QTL identified for 9 traits, the H. 

spontaneum alleles improved performance for 31. QTL for height, heading date, harvest index, 

lodging at flowering, vegetative dry biomass, thousand grain weight, brittleness and yield were 

located on chromosome 7H. Li et al. (2006), in a similar study of a wild barley x Brenda 

advanced backcross, found 100 QTL. Chromosome 7H QTL included yield, heading date, 

height, ear length, spikelets per spike, seed per spike, spikes per plant, thousand grain weight, 

leaf length, and leaf area loci. Yun et al. (2006) also used advanced backcross lines from a cross 

of H. spontaneum with Harrington to validate QTLs for disease resistance loci. A QTL for spot 

122


blotch resistance previously identified in a RIL population was confirmed to be located on 


Additional disease resistance genes were located in several studies. Cheong et al. (2006) located 

a QTL for adult plant resistance to leaf scald using two populations. One of these QTL was 

located on the short arm of chromosome 7H. Rossi et al. (2006) located QTL for barley strip rust 

and leaf rust resistance plus a powdery mildew resistance QTL on chromosome 7H. Jafary et al. 

(2006) located genes involved in nonhost immunity to rust pathogens, including four QTL on 

chromosome 7H controlling reactions to seven rust species. Brueggeman et al. (2006) identified 

five additional members of the Rpg1 gene family, including one that is closely linked to Rpg1 on 


Kilian et al. (2006) examine haplotype structure at seven loci, including the Adh3 and Waxy loci 

on chromosome 7H, to compare sequence diversity between 20 domesticated and 25 wild 

barleys. As expected, more haplotypes were identified in the wild barley than the domesticated 

barley. At Adh3, wild barley showed 15 haplotypes while domesticated barley had three and at 

Waxy, the wilds had 17 haplotypes compared to 4 in the domesticated barley. This diversity was 

also evident in nucleotide sequence, with more polymorphic sites in the wild barley than in the 

domesticated barley. Pickering et al. (2006) examined associations between chromosomes in two 

H. vulgare x H. bulbosum hybrids. Chromosome 7HS-7H b S associations were higher than the 

average for other chromosome arms in both hybrids examined. 

References. 

Brueggeman R, T Drader and A Kleinhofs. 2006. The barley serine/threonine kinase gene 

Rpg1 providing resistance to stem rust belongs to a gene family with five other members 

encoding kinase domains. Theor Appl Genet 113:1147-1158. 

Cheong J, K Williams and H Wallwork. 2006. The identification of QTLs for adult plant 

resistance to leaf scald in barley. Austral J Agric Res 57:961-965. 

Chloupek O, BP Forster and WTB Thomas. 2006. The effect of semi-dwarf genes on root 

system size in field-grown barley. Theor Appl Genet 112:779-786. 

Jafary H, LJ Szabo and RE Niks. 2006. Innate nonhost immunity in barley to different 


overlapping specificities. MPMI 19:1270-1279. 

Kilian B, H Ozkan, J Kohl, A von Haeseler, F Borale, O Deusch, A Brandolini, C Yucel, W 

Martin and F Salamini. 2006. Haplotype structure at seven barley genes: relevance to 

gene pool bottlenecks, phylogeny of ear type and site of barley domestication. Mol Gen 

Genomics 276:230-241. 

Korff M von, H Wang, J Leon and K Pillen. 2006. AB-QTL analysis in spring barley: II. 


(H. vulgare ssp. spontaneum). Theor Appl Genet 112:1221-1231. 

Li JZ, XQ Huang, F Heinrichs, MW Ganal and MS Roder. 2006. Analysis of QTLs for yield 

components, agronomic traits, and disease resistance in an advanced backcross 

population of spring barley. Genome 49:454-466. 

123


Pickering R, S Klatte and RC Butler. 2006. Identification of all chromosome arms and their 

involvement in meiotic homoeologous associations at metaphase 1 in 2 Hordeum vulgare 

L. x Hordeum bulbosum L. hybrids. Genome 49:73-78. 

Roder MS, C Kaiser and W Weschke. 2006. Molecular mapping of the shrunken endosperm 

genes seg8 and sex1 in barley (Hordeum vulgare L.). Genome 49:1209-1214. 

Rossi C, A Cuesta-Marcos, I Vales, L Gomez-Pando, G Orjeda, R Wise, K Sato, K Hori, F 

Capettini, H Vivar, X Chen and P Hayes. 2006. Mapping multiple disease resistance 

genes using a barley mapping population evaluated in Peru, Mexico, and the USA. Mol 

Breed 18:355-366. 

Rossini L, A Vecchietti, L Nicoloso, N Stein, S Franzago, F Salamini and C Pozzi. 2006. 

Candidate genes for barley mutants involved in plant architecture: an in silico approach. 

Theor Appl Genet 112:1073-1085. 

Rostoks N, D Schmierer, S Mudie, T Drader, R Brueggeman, DG Caldwell, R Waugh and 

A Kleinhofs. 2006. Barley necrotic locus nec1 encodes the cyclic nucleotide-gated ion 

channel 4 homologous to the Arabidopsis HLM1. Mol Gen Genomics 275:159-168. 

Szucs P, I Karsai, J von Zitzewitz, K Meszarus, LLD Cooper, YQ Gu, THH Chen, PM 

Hayes and JS Skinner. 2006. Positional relationships between photoperiod response 

QTL and photoreceptor and vernalization genes in barley. Theor Appl Genet 112:1277- 

1285. 

Taketa S, T Awayama, S Amano, Y Sakurai and M Ichii. 2006. High-resolution mapping of 

the nud locus controlling the naked caryopsis in barley. Plant Breed 125:337-342. 

Tondelli A, E Francia, D Barbaschi, A Aprile, JS Skinner, EJ Stockinger, AM Stanca and 

N Pecchioni. 2006. Mapping regulatory genes as candidates for cold and drought stress 

tolerance in barley. Theor Appl Genet 112:445-454. 

Yan L, D Fu, C Li, A Blechl, G Tranquilli, M Bonafede, A Sanchez, M Valarik, S Yasuda 

and J Dubcovsky. 2006. The wheat and barley vernalization gene VRN3 is an orthologue 

of FT. PNAS 103:19581-19586. 

Yun SJ, L Gyenis, E Bossolini, PM Hayes, I Matus, KP Smith, BJ Steffenson, R Tuberosa 

and GJ Muehlbauer. 2006. Validation of quantitative trait loci for multiple disease 

resistance in barley using advanced backcross lines developed with a wild barley. Crop 

Sci 46:1179-1186. 

124


Integrating Molecular and Morphological/Physiological Marker Maps 

A. Kleinhofs 

Dept. Crop and Soil Sciences and 

School of Molecular Biosciences 

Washington State University 

Pullman, WA 99164-6420, USA 

e-mail: andyk@wsu.edu 

There has been only limited progress in mapping morphological markers during the past year. 

However, there is a major effort under way in Europe to map the morphological mutant isolines 

developed by Jerry Franckowiak (for details see 

http://www.smallgraincereals.org/SGCNewsletterSummer2007.pdf). This effort, when 

completed, should provide a map of 1000 morphological markers with accurate reference to 

molecular markers. 

A recessive barley stripe rust resistance gene rpsGZ (from Grannenlose Zweizeilige) was 

mapped to chromosome 4H bin9 (Yan and Chen, 2006). This gene cosegregated with several 

RGAP markers identified in the publication complete with primer information. It is also closely 

linked to SSR markers EBmac0679 and EBmac0701. 

Septoria speckled leaf blotch resistance genes Rsp1, Rsp2, and Rsp3 were mapped (Lee and 

Neate, 2007a). Rsp2 cosegregated with MWG938 placing it on chromosome 5(1H) bin2. Rsp3 

was closely linked to Rsp2 on chromosome 5S(1HS). Rsp2 was flanked by RAPD markers 

OPBA12314C and OPB17451R at 2.4 and 3.5 cM, respectively. I was not able to locate these to 

a specific bin. Rsp1 was mapped to chromosome 3H short arm flanked by RAPD markers 

OPC2441R (3.0 cM) and UBC285158R (4.3 cM). In addition closely linked DArT markers were 

also identified. Specific bin location was not possible. The RAPD markers were converted into 

sequence tagged markers and primer sequences published (Lee and Neate, 2007b). 

Aluminum tolerance gene Alp was mapped to chromosome 4H bin7 closely linked to ABG715 

and cosegregating with several markers including HvMATE (AV942930) which was proposed 

as a candidate gene for the Alp locus (Wang et al., 2007) 

Five barley flowering locus T-like (FT-like) genes were mapped (Faure et al., 2007). HvFT1 

maps on chromosome 1(7H) between markers AF022725 and Bmac31 closely linked to VRN-H3 

and ABC158 placing it in bin4. The VRN-H3 gene was previously believed to be located on 

chromosome 5(1H), but more recently shown to be on chromosome 1(7H) (Yan et al., 2006). 

HvFT2 was mapped on chromosome 3H between markers Bmac067 and MWG985 placing it in 

bin6. HvHT3 was mapped to chromosome 7(5H) cosegregating with PSR162 placing it in bin11. 

HvFT4 was mapped to the short arm of chromosome 2H proximal to cMWG663 placing it in 

bin6. HvHT5 was mapped to chromosome 4H long arm cosegregating with scsnp20989. It was 

not possible for me to determine the bin placement. 

125


The naked caryopsis gene (nud) has been previously mapped to chromosome 1(7H) bin 7. It has 

now been mapped at a high resolution (Taketa et al., 2006). The closest SCAR marker SKT9, 

mapped 0.06 cM from the nud locus based on 4,760 gametes from 6 mapping populations. 

Barley lipoxygenase (Lox-1) thermostability factor was shown to cosegregate with the structural 

gene LoxA (Hirota et al., 2006). The LoxA and LoxC loci were previously mapped to 

chromosome 4H bin3 and chromosome 7(5H) probably bin 10 (van Mechelen et al., 1999). 

Barley homologs of large number of Arabidopsis low temperature regulatory genes were mapped 

assigning either linkage map or chromosome locations to 1 ICE1, 2 ZAT12 and 17 CBF 

homologs (Skinner et al., 2006). Eleven of the CBF genes with assigned linkage map positions 

formed two tandem clusters on 5HL(7L). These were coincident with reported Triticeae low 

temperature tolerance and CO R gene accumulation QTL and suggest that one or more of the 

CBF genes may be candidates for Fr-H2 QTL. 

Bin Assignments for Morphological Map Markers and closest molecular marker 

* - indicates that the gene has been cloned 

red - indicates that the gene is very accurately mapped with molecular markers 

yellow - indicates that it is fairly accurately mapped with molecular markers 

blue - indicates that the gene has been approximately mapped mainly using Bulked 

Segregant Analysis 

Chr.1(7H) 

BIN1 ABG704 

*Rpg1 RSB228 Brueggeman et al., PNAS 99:9328, ‘02 

Run1 

Rdg2a MWG851A Bulgarelli et al., TAG 108:1401, ‘04 

Rrs2 MWG555A Schweizer et al., TAG 90:920, ‘95 

mlt 

brh1 MWG2074B Li et al., 8 th IBGS 3:72, ‘00 

BIN2 ABG320 

Est5 iEst5 Kleinhofs et al., TAG 86:705, ‘93 

fch12 BCD130 Schmierer et al., BGN 31:12, ‘01 

*wax Wax Kleinhofs BGN 32:152, ‘02 

gsh3 His3A Kleinhofs BGN 32:152, ‘02 

BIN3 ABC151A 

fch5 ABC167A Kleinhofs BGN 32:152, ‘02 

Rcs5 KAJ185 Johnson & Kleinhofs, unpublished 

yvs2 

cer-ze ABG380 Kleinhofs BGN 27:105, ‘96 

BIN4 ABG380 

wnd 

*HvFT1 ABC158 Faure et al., Genetics 176:599, '07 

VrnH3 ABC158 Yan et al., PNAS 103:19581, '06 

Lga BE193581 Johnson & Kleinhofs, unpublished 

abo7 

126


BIN5 ksuA1A 

ant1 

nar3 MWG836 Kleinhofs BGN 32:152, ‘02 

ert-m 

ert-a 

BIN6 ABC255 

ert-d 

fch8 

fst3 

cer-f 

msg14 

BIN7 ABG701 

dsp1 cMWG704 Sameri & Komatsuda JARQ 41:195, '07 

msg10 

rsm1 ABC455 Edwards & Steffenson, Phytopath. 86:184,’96 

sex6 

seg5 

seg2 

pmr ABC308 Kleinhofs BGN 27:105, ‘96 

mo6b Hsp17 Soule et al., J Her. 91:483, ‘00 

nud sKT9 Taketa et al., Plant Breeding 125:337, '06 

fch4 MWG003 Kleinhofs BGN 27:105, ‘96 

BIN8 *Amy2 Amy2 Kleinhofs et al., TAG 86:705, ‘93 

lks2 WG380B Costa et al., TAG 103:415, ‘01 

ubs4 

blx2 

BIN9 RZ242 

lbi3 

Rpt4 Psr117D Williams et al., TAG 99:323, ‘99 

xnt4 

lpa2 ? Larson et al., TAG 97:141, ‘98 

msg50 

Rym2 

seg4 

BIN10 ABC310B 

Xnt1 BF626025 Hansson et al., PNAS 96:1744, ‘99 

xnt-h BF626025 Hansson et al., PNAS 96:1744, ‘99 

BIN11 ABC305 

Rph3 

Tha2 Toojinda et al., TAG 101:580, ‘00 

BIN12 ABG461A 

Mlf 

xnt9 

seg1 

msg23 

BIN13 Tha 

Rph19 Rlch4(Nc) Park & Karakousis Plt. Breed. 121:232. ‘02 

127


Chr.2(2H) 

BIN1 MWG844A 

sbk 

brh3 Bmac0134 Dahleen et al., J. Heredity 96:654, ‘05 

BIN2 ABG703B 

BIN3 MWG878A gsh6 Kleinhofs BGN 32:152, ‘02 

gsh1 

gsh8 

BIN4 ABG318 

Eam1 

Ppd-H1 MWG858 Laurie et al., Heredity 72:619, ‘94 

sld2 

rtt 

flo-c 

sld4 

BIN5 ABG358 

fch15 

brc1 

com2 

BIN6 Pox 

msg9 

abo2 

Rph15 P13M40 Weerasena et al., TAG 108:712 ‘04 

rph16 MWG874 Drescher et al., 8thIBGS II:95, ‘00 

BIN7 Bgq60 

yst4 CDO537 Kleinhofs BGN 32:152, ‘02 

Az94 CDO537 Kleinhofs BGN 32:152, ‘02 

gai MWG2058 Börner et al., TAG 99:670, ‘99 

msg33 

*HvCslF (barley Cellulose synthase-like) Burton et al., Science 311:1940 ‘06 

*Bmy2 

msg3 

fch1 

BIN8 ABC468 

Eam6 ABC167b Tohno-oka et al., 8thIBGS III:239, ‘00 

gsh5 

msg2 

eog ABC451 Kleinhofs BGN 27:105, ‘96 

abr 

cer-n 

BIN9 ABC451 

Gth 

hcm1 

wst4 

*vrs1 MWG699 Komatsuda et al., Genome 42:248, ‘00 

BIN10 MWG865 

cer-g 

Lks1 

mtt4 

Pre2 

128


Chr. 3(3H) 

msg27 

BIN11 MWG503 

Rha2 AWBMA21 Kretschmer et al., TAG 94:1060, ‘97 

Ant2 MWG087 Freialdenhoven et al., Plt. Cell 6:983, ’94 

*Rar1 AW983293B Freialdenhoven et al., Plt. Cell 6:983, ’94 

fol-a 

gal MWG581A Börner et al., TAG 99:670, ‘99 

fch14 

Pau 

BIN12 ksuD22 

Pvc 

BIN13 ABC252 

lig BCD266 Pratchett & Laurie Hereditas 120:35, ‘94 

nar4 Gln2 Kleinhofs BGN 27:105, ‘96 

Zeo1 cnx1 Costa et al., TAG 103:415, ‘01 

lpa1 ABC157 Larson et al., TAG 97:141, ‘98 

BIN14 ABC165 

BIN15 MWG844B 

gpa CDO036 Kleinhofs BGN 27:105, ‘96 

wst7 MWG949A Costa et al., TAG 103:415, ‘01 

MlLa Ris16 Giese et al., TAG 85:897, ‘93 

trp 

BIN1 Rph5 ABG070 Mammadov et al., TAG 111:1651, ‘05 

Rph6 BCD907 Zhong et al., Phytopath. 93:604, ‘03 

Rph7 MWG848 Brunner et al., TAG 101:783, ‘00 

BIN2 JS195F BI958652; BF631357; BG369659 

ant17 

sld5 

mo7a ABC171A Soule et al., J. Hered. 91:483, ‘00 

brh8 

BIN3 ABG321 

xnt6 

BIN4 MWG798B 

btr1 Senthil & Komatsuda Euphytica 145:215, ‘05 

btr2 Senthil & Komatsuda Euphytica 145:215, ‘05 

lzd 

alm ABG471 Kleinhofs BGNL 27:105, ‘96 

BIN5 BCD1532 

abo9 

sca 

yst2 

dsp10 

BIN6 ABG396 

Rrs1 Graner et al., TAG 93: 421 ´96 

Rh/Pt ABG396 Smilde et al., 8th IBGS 2:178, ‘00 

Rrs.B87 BCD828 Williams et al., Plant Breed. 120:301, ‘01 

129


AtpbB 

abo6 

xnt3 

HvHT2 Bmac067 Faure et al., Genetics 176:599, '07 

msg5 

ari-a 

yst1 

zeb1 

ert-c 

ert-ii 

cer-zd 

Ryd2 WG889B Collins et al., TAG 92:858, ‘96 

*uzu AB088206 Saisho et al., Breeding Sci. 54:409, ‘04 

BIN7 MWG571B 

cer-r 

BIN8 ABG377 

wst6 

cer-zn 

sld1 

BIN9 ABG453 

wst1 

BIN10 CDO345 

vrs4 

Int1 

gsh2 

BIN11 CDO113B 

als 

sdw1 PSR170 Laurie et al., Plant Breed. 111:198, ‘93 

BIN12 His4B 

sdw2 

BIN13 ABG004 

Pub ABG389 Kleinhofs et al., TAG 86:705, ‘93 

BIN14 ABC161 

cur2 

BIN15 ABC174 

Rph10 

fch2 

BIN16 ABC166 

eam10 

Est1/2/3 

*rym4 eIF4E Stein et al.,Plt. J. 42:912, ‘05 

*rym5 eIF4E and Kanyuka et al., Mol. Plant Path. 6:449, ’05 

Est4 

ant28 

Chr.4(4H) 

BIN1 MWG634 

BIN2 JS103.3 

fch9 

130


sln 

BIN3 Ole1 

Dwf2 Ivandic et al., TAG 98:728, ‘99 

*LoxA MWG011b van Mechelen et al., Plt. Mol. Biol. 39:1283, '99 

LoxB van Mechelen et al., Plt. Mol. Biol. 39:1283, '99 

Lox-1 thermo Hirota et al., Plant breeding 125:231, '06 

Ynd 

int-c MWG2033 Komatsuda, TAG 105:85, ‘02 

Zeo3 

glo-a 

rym1 MWG2134 Okada et al., Breeding Sci. 54:319, ‘04 

BIN4 BCD402B 

*Kap X83518 Müller et al., Nature 374:727, ‘95 

lbi2 

zeb2 

lgn3 

BIN5 BCD808B 

lgn4 

lks5 

eam9 

msg24 

BIN6 ABG484 

glf1 

rym11 MWG2134 Bauer et al., TAG 95:1263, ‘97 

Mlg MWG032 Kurth et al., TAG 102:53, ‘01 

cer-zg 

brh2 

BIN7 bBE54A 

glf3 

Alp HvMATE Wang et al., TAG 115:265 '07 

frp 

min1 

blx4 

sid 

blx3 

BIN8 BCD453B 

blx1 

BIN9 ABG319A 

ert1 

rpsGZ EBmac0679 Yan & Chen, TAG 113:529, '06 

BIN10 KFP221 

*mlo P93766 Bueschges et al., Cell 88:695, ‘97 

BIN11 ABG397 

BIN12 ABG319C 

Hsh HVM067 Costa et al., TAG 103:415, ‘01 

Hln 

*sgh1(ZCCT-H; HvSnf2) Zitzewitz et al., PMB 59:449, ‘05 

yhd1 

BIN13 *Bmy1 pcbC51 Kleinhofs et al., TAG 86:705, ‘93 


131



Wsp3 

Chr. 5(1H) 

BIN1 Tel5P 

Rph4 

Mlra 

Cer-yy 

Sex76 Hor2 Netsvetaev BGN 27:51, ‘97 

*Hor5 Hor5 Kleinhofs et al., TAG 86:705, ‘93 

BIN2 MWG938 

Rsp2 MWG938 Lee & Neate, Phytopath. 97:155, '07 


Rrs14 Hor2 Garvin et al., Plant Breed. 119:193-196, ‘00 

*Mla6 AJ302292 Halterman et al., Plt J. 25:335, ‘01 

BIN3 MWG837 


Rps4 

Mlk 

BIN4 ABA004 

Lys4 

BIN5 BCD098 

Mlnn; 

msg31; 

sls; 

msg4; 

fch3; 

BIN6 Ica1 

amo1 

BIN7 JS074 

clh 

vrs3 

Ror1 ABG452 Collins et al., Plt. Phys. 125:1236, ‘01 

BIN8 Pcr2 

fst2 

cer-zi 

cer-e 

ert-b 

MlGa 

msg1 

xnt7 

BIN9 Glb1 

*nec1 BF630384 Rostoks et al., MGG 275:159, '06 

BIN10 DAK123B 

abo1 

Glb1 

BIN11 PSR330 

*HvFT3 PSR162 Faure et al., Genetics 176:599, '07 

PpdH2 PSR162 Laurie et al., Genome 38:575, '95 

wst5 

132


cud2 

BIN12 MWG706A 

rlv 

lel1 

BIN13 BCD1930 

Blp ABC261 Costa et al., TAG 103:415, ‘01 

BIN14 ABC261 

fch7 

trd 

eam8 

Chr. 6(6H) 

BIN1 ABG062 

*Nar1 X57845 Kleinhofs et al., TAG 86:705, ‘93 

abo15 

BIN2 ABG378B 

nar8 ABG378B Kleinhofs BGN 27:105, ‘96 

nec3 

Rrs13 

BIN3 MWG652A 

BIN4 DD1.1C 

msg36 

BIN5 ABG387B 

nec2 

ant21 

msg6 

eam7 

BIN6 Ldh1 

rob HVM031 Costa et al., TAG 103:415, ‘01 

sex1 

gsh4 

ant13 

cul2 Crg4(KFP128) Babb & Muehlbauer BGN 31:28, ‘01 

fch11 

mtt5 

abo14 

BIN7 ABG474 

BIN8 ABC170B 

BIN9 *Nar7 X60173 Warner et al., Genome 38:743, ‘95 

*Amy1 JR115 Kleinhofs et al., TAG 86:705, ‘93 

*Nir pCIB808 Kleinhofs et al., TAG 86:705, ‘93 

mul2 

cur3 

BIN10 MWG934 

lax-b 

raw5 

cur1 

BIN11 Tef1 

BIN12 xnt5 

133


Aat2 

BIN13 Rph11 Acp3 Feuerstein et al., Plant breed. 104:318, ‘90 

lax-c 

BIN14 DAK213C 

dsp9 

Chr. 7(5H) 

BIN1 DAK133 

abo12 

msg16 

ddt 

BIN2 MWG920.1A 

dex1 

msg19 

nld 

fch6 

glo-b 

BIN3 cud1 ABG705A 

lys3 

fst1 

blf1 

vrs2 

BIN4 ABG395 

cer-zj 

cer-zp 

msg18 

wst2 

Rph2 ITS1 Borovkova et al., Genome 40:236, ‘97 

lax-a PSR118 Laurie et al., TAG 93:81, ‘96 

com1 

ari-e 

ert-g 

ert-n 

BIN5 Ltp1 

rym3 MWG028 Saeki et al., TAG 99:727, ‘99 

BIN6 WG530 

BIN7 ABC324 

BIN8 ABC302A 

BIN9 BCD926 

srh ksuA1B Kleinhofs et al., TAG 86:705, ‘93 

cer-i 

mtt2 

lys1 

cer-t 

dsk 

var1 

cer-w 

Eam5 

134


BIN10 ABG473 

raw1 

msg7 

BIN11 MWG514B 

Rph9/12ABG712 Borokova et al., Phytopath. 88:76, ‘98 

*Sgh2 (HvBM5A) Zitzewitz et al., PMB 59:449, ‘05 

*Ror2 AY246906 Collins et al., Nature 425:973, ‘03 

lbi1 

Rha4 

raw2 

BIN12 WG908 

none 

BIN13 ABG496 

rpg4 ARD5303 Druka et al., unpublished 

RpgQ ARD5304 Druka et al., unpublished 

BIN14 ABG390 

var3 

BIN15 ABG463 

135


References: 

Babb, S.L. and G.J. Muehlbauer. 2001. Map location of the Barley Tillering Mutant uniculm2 

(cul2) on Chromosome 6H. BGN31:28. 

Bauer, E., J. Weyen, A. Schiemann, A. Graner, and F. Ordon. 1997. Molecular mapping of 

novel resistance genes against Barley Mild Mosaic Virus (BaMMV). Theor. Appl. Genet. 

95:1263-1269. 

Borovkova, I.G., Y. Jin, B.J. Steffenson, A. Kilian, T.K. Blake, and A. Kleinhofs. 1997. 

Identification and mapping of a leaf rust resistance gene in barley line Q21861. Genome 

40:236-241. 

Borokova, I.G., Y. Jin, and B.J. Steffenson. 1998. Chromosomal Location and Genetic 

Relationship of Leaf Rust Resistance Genes Rph9 and Rph12 in Barley. Phytopathology 

88:76-80. 

Börner, A., V. Korzun, S. Malyshev, V. Ivandic, and A. Graner. 1999. Molecular mapping of 

two dwarfing genes differing in their GA response on chromosome 2H of barley. Theor. 

Appl. Genet. 99:670-675. 

Brueggeman, R., N. Rostoks, D. Kudrna, A. Kilian, F. Han, J. Chen, A. Druka, B. 

Steffenson, and A. Kleinhofs. 2002. The barley stem-rust resistance gene Rpg1 is a 

novel disease-resistance gene with homology to receptor kinases. Proc. Natl. Acad. Sci. 

USA 99:9328-9333. 

Brunner, S., B. Keller, and C. Feuillet. 2000. Molecular mapping of the Rph7.g leaf rust 

resistance gene in barley (Hordeum vulgare L.). Theor. Appl. Genet. 101:763-788. 

Büschges, R., K. Hollricher, R. Panstruga, G. Simons, M. Wolter, A. Frijters, R. van 

Daelen, T. van der Lee, P. Diergaarde, J. Groenendijk, S. Töpsch, P. Vos, F. 

Salamini, and P. Schulze-Lefert. 1997. The barley mlo gene: A novel control element 

of plant pathogen resistance. Cell 88:695-705. 

Bulgarelli, D., N.C. Collins, G. Tacconi, E. Dellaglio, R. Brueggeman, A. Kleinhofs, A.M. 

Stanca, and G. Vale. 2004. High resolution genetic mapping of the leaf stripe resistance 

gene Rdg2a in barley. Theor. Appl. Genet. 108:1401-1408. 

Burton, R.A., S.M. Wilson, M. Hrmova, A.J. Harvey, N.J. Shirley, A. Medhurst, B.A. 

Stone, E.J. Newbigin, A. Bacic, and G.B. Fincher. 2006. Cellulose synthase-like CslF 

genes mediate the synthesis of cell wall (1,3; 1,4)-b-D-glucans. Science 311:1940-1943. 

Collins, N.C., N.G. Paltridge, C.M. Ford, and R.H. Symons.1996. The Yd2 gene for barley 

yellow dwarf virus resistance maps close to the centromere on the long arm of barley 

chromosome 3. Theor. Appl. Genet. 92:858-864. 

Collins, N.C., T. Lahaye, C. Peterhänsel, A. Freialdenhoven, M. Corbitt, and P. Schulze- 

Lefert. 2001. Sequence haplotypes revealed by sequence-tagged site fine mapping of the 

Ror1 gene in the centromeric region of barley chromosome 1H. Plant Physiology 

125:1236-1247. 

136


Collins, N.C., H. Thordal-Christensen, V. Lipka, S. Bau, E. Kombrink, J-L. Qiu, R. 

Hückelhoven, N. Stein, A. Freialdenhoven, S.C. Somerville, and P. Schulze-Lefert. 

2003. Snare-protein-mediated disease resistance at the plant cell wall. Nature 425:973- 

976. 

Costa, J.M., A. Corey, M. Hayes, C. Jobet, A. Kleinhofs, A. Kopisch-Obusch, S.F. Kramer, 

D. Kudrna, M. Li, O. Piera-Lizaragu, K. Sato, P. Szues, T. Toojinda, M.I. Vales, 

and R.I. Wolfe. 2001. Molecular mapping of the Oregon Wolfe Barleys: a 

phenotypically polymorphic doubled-haploid population. Theor. Appl. Genet. 103:415- 

424. 

Drescher, A., V. Ivandic, U. Walther, and A. Graner. 2000. High-resolution mapping of the 

Rph16 locus in barley. p. 95-97. In: S. Logue (ed.) Barley Genetics VIII. Volume II. 

Proc. Eigth Int. Barley Genet. Symp. Adelaide. Dept. Plant Science, Waite Campus, 

Adelaide University, Glen Osmond, South Australia. 

Dahleen, L.S., L.J. Vander Wal, and J.D. Franckowiak. 2005. Characterization and molecular 

mapping of genes determining semidwarfism in barley. J. Heredity 96:654-662. 

Edwards, M.C. and B.J. Steffenson. 1996. Genetics and mapping of barley stripe mosaic virus 

resistance in barley. Phytopath. 86;184-187. 

Faure S, J. Higgins, A. Turner, and D.A. Laurie. 2007. The FLOWERING LOCUS T-like 

gene family in barley (Hordeum vulgare). Genetics 176:599-609. 

Feuerstein, U., A.H.D. Brown, and J.J. Burdon. 1990. Linkage of rust resistance genes from 

wild barley (Hordeum spontaneum) with isoenzyme markers. Plant. Breed. 104:318-324. 

Freialdenhoven, A., B. Scherag, K. Hollrichter, D.B. Collinge, H. Thordal-Christensen, and 

P. Schulze-Lefert. 1994. Nar-1 and Nar-2, two loci required for Mla12-specified racespecific 

resistance to powdery mildew in barley. Plant Cell 6:983-994. 

Garvin, D.F., A.H.D. Brown, H. Raman, and B.J. Read. 2000. Genetic mapping of the barley 

Rrs14 scald resistance gene with RLFP, isozyme and seed storage protein marker. Plant 

Breeding 119:193-196. 

Giese, H., A.G. Holm-Jensen, H.P. Jensen, and J. Jensen. 1993. Localisation of the 

Laevigatum powdery mildew resistance gene to barley chromosome 2 by the use of 

RLFP markers. Theor. Appl. Genet. 85:897-900. 

Graner, A. and A. Tekauz. 1996. RFLP mapping in barley of a dominant gene conferring to 

scald (Rynchosporium secalis). Theor. Appl. Genet. 93:421-425. 

Haltermann, D., F. Zhou, F. Wei, R.P. Wise, and P. Schulze-Lefert. 2001. The MLA6 coiled 

coil, NBS-LRR protein confers AvrMla6-dependent resistance specificity to Blumeria 

graminis f. sp. hordei in barley and wheat. Plt. J. 25:335-348. 

137


Hansson, A., C.G. Kannangara, D. von Wettstein, and M. Hansson. 1999. Molecular basis 

for semidomiance of missense mutations in the XANTHA-H (42-kDa) subunit of 

magnesium chelatase. Proc. Natl. Acad. Sci. USA 96:1744-1749. 

Hirota, N., T. Kaneko, K. Ito, and K. Takeda. 2006. Mapping a factor controlling the 

thermostability of seed lipoxygenase-1 in barley. Plant Breeding 125:231-235. 

Ivandic, V., S. Malyshev, V. Korzun, A. Graner, and A. Börner. 1999. Comparative mapping 

of a gibberellic acid-insensitive dwarfing gene (Dwf2) on chromosome 4HS in barley. 


Kanyuka, K., A. Druka, D..G. Caldwell, A. Tymon, N. McCallum, R. Waugh, and M. J. 

Adams. 2005. Evidence that the recessive bymovirus resistance locus rym4 in barley 

corresponds to the eukaryotic translation initiation factor 4E gene. Molecular Plant 

pathology 6:449-458. 

Kleinhofs, A., A. Kilian, M.A. Saghai Marrof, R.M. Biyashev, P. Hayes, F.Q. Chen, N. 

Lapitan, A. Fenwick, T.K. Blake, V. Kanazin, E. Ananiev, L. Dahleen, D. Kudrna, J. 

Bollinger, S.J. Knapp, B. Liu, M. Sorells, M. Heun, J.D. Franckowiak, D. Hoffman, 

R. Skadsen, and B.J. Steffenson. 1993. A molecular, isozyme and morphological map 

of the barley (Hordeum vulgare) genome. Theor. Appl. Genet. 86:705-712. 

Kleinhofs, A. 1996. Integrating Barley RFLP and Classical Marker Maps. Coordinator’s report. 

BGN27:105-112. 

Kleinhofs, A. 2002. Integrating Molecular and Morphological/Physiological Marker Maps. 

Coordinator’s Report. BGN32:152-159. 

Komatsuda, T., W. Li, F. Takaiwa, and S. Oka. 1999. High resolution map around the vrs1 

locus controlling two- and six-rowed spike in barley. (Hordeum vulgare). Genome 

42:248-253. 

Komatsuda, T., and Y. Mano. 2002. Molecular mapping of the intermedium spike-c (int-c) and 

non-brittle rachis 1 (btr1) loci in barley (Hordeum vulgare L.). Theor. Appl Genet. 

105:85-90. 

Kretschmer, J.M., K.J. Chalmers, S. Manning, A. Karakousis, A.R. Barr, A.K.M.R. Islam, 

S.J. Logue, Y.W. Choe, S.J. Barker, R.C.M. Lance, and P. Langridge. 1997. RFLP 

mapping of the Ha2 cereal cyst nematode resistance in barley.Theor. Appl. Genet. 

94:1060-1064. 

Kurth, J., R. Kolsch, V. Simons, and P. Schulze-Lefert. 2001. A high-resolution genetic map 

and a diagnostic RFLP marker for the Mlg resistance locus to powdery mildew in barley. 


Larson, S.R., K.A. Young, A. Cook, T.K. Blake, and V. Raboy. 1998. Linkage mapping of 

two mutations that reduce phytic acid content of barley grain. Theor. Appl. Genet. 

97:141-146. 

138


Laurie, D.A., N. Pratchett, C. Romero, E. Simpson, and J.W. Snape. 1993. Assignment of 

the denso dwarfing gene to the long arm of chromosome 3 (3H) of barley by use of RFLP 

markers. Plant. Breed. 111:198-203. 

Laurie, D.A., N. Pratchett, J.H. Bezan, and J.W. Snape. 1994. Genetic analysis of a 

photoperiod response gene on the short arm of chromosome 2 (2H) of Hordeum vulgare 

(barley). Heredity 72:619-627. 

Laurie, D.A., N. Pratchett, J.H. Bezan, and J.W. Snape. 1995. RFLP mapping of five major 

genes and eight quantitative trait loci controlling flowering time in a winter x spring 

barley (Hordeum vulgare L.) cross. Genome 38:575-585. 

Laurie, D.A., N. Pratchett, R.A. Allen, and S.S. Hantke. 1996. RFLP mapping of the barley 

homeotic mutant lax-a. Theor. Appl. Genet. 93:81-85. 

Lee S.H. and S.M. Neate. 2007a. Molecular mapping of Rsp1, Rsp2, and Rsp3 genes conferring 

resistance to Septoria speckled leaf blotch in barley. Phytopathology 97:155-161. 

Lee S.H. and S.M. Neate. 2007b. Sequence tagged site markers to Rsp1, Rsp2, and Rsp3 genes 

for resistance to Septoria speckled leaf blotch in barley. Phytopathology 97:161-169. 

Li. M., D. Kudrna, and A. Kleinhofs. 2000. Fine mapping of a Semi-dwarf gene Brachytic1 in 

barley. p. 72-74. In: S. Logue (ed.) Barley Genetics VIII. Volume III. Proc. Eigth Int. 

Barley Genet. Symp. Adelaide. Dept. Plant Science, Waite Campus, Adelaide University, 

Glen Osmond, South Australia. 

Mammadov, J.A., B. J. Steffenson, and M.A. Saghai Maroof. 2005. High resolution mapping 

of the barley leaf rust resistance gene Rph5 using barley expressed sequence tags (ESTs) 

and synteny with rice. Theor. Appl. Genet. 111:1651-1660. 

Mechelen J.R. van, R.C. Schuurink, M. Smits, A. Graner, A.C. Douma, N.J.A. Sedee, N.F. 

Schmitt, and B.E Valk. 1999. Molecular characterization of two lipoxygenases from 

barley. Plant Molecular Biology 39:1283-1298. 

Müller, K.J., N. Romano, O. Gerstner, F. Gracia-Maroto, C. Pozzi, F. Salamini, and W. 

Rhode. 1995. The barley Hooded mutation caused by a duplication in a homeobox gene 

intron. Nature 374:727-730. 

Netsvetaev, V.P. 1997. High lysine mutant of winter barley - L76. BGN27:51-54. 

Okada, Y., R. Kanatani, S. Arai, and I. Kazutoshi. 2004. Interaction between barley mosaic 

disease-resistance genes rym1 and rym5, in the response to BaYMV strains. Breeding 

Science 54 (4):319-324. 

Park, R.F. and A. Karakousis. 2002. Characterization and mapping Rph19 conferring 

resistance to Puccinia hordei in the cultivar ’Rea1’ and several Australian barley. Plant 

Breeding 121:232-236. 

Pratchett, N. and D.A. Laurie. 1994. Genetic map location of the barley developmental mutant 

liguleless in relation to RFLP markers. Hereditas 120:35-39. 

139


Rostoks, N., D. Schmierer, S. Mudie, T. Drader, R. Brueggeman, D. Caldwell, R. Waugh, 

and A. Kleinhofs. 2006. Barley necrotic locus nec1 encodes the cyclic nucleotide-gated 

ion channel 4 homologous to the Arabidopsis Hlm1. Mol.Gen. Genomics 275:159-168. 

Saeki, K., C. Miyazaki, N. Hirota, A. Saito, K. Ito, and T. Konishi. 1999. RFLP mapping of 

BaYMV resistance gene rym3 in barley (Hordeum vulgare). Theor. Appl. Genet. 99:727- 

732. 

Saisho, D., K.-I. Tanno, M. Chono, I. Honda, H. Kitano, and K. Takeda. 2004. Spontaneous 

Brassinolide-insensitive barley mutants ’uzu’ adapted to East Asia. Breeding Science 

54(4): 409-416. 

Sameri, M. and T. Komatsuda. 2007. Location of quantitative trait loci for yield components in 

a cross oriental x occidental barley cultivar (Hordeum vulgare L.). Japan Agricultural 

Research Quaterly 41(3):195-199. 

Schmierer, D., A. Druka, D. Kudrna, and A. Kleinhofs. 2001. Fine Mapping of the fch12 

chlorina seedling mutant. BGN31:12-13. 

Schweizer, G.F., M. Baumer, G. Daniel, H. Rugel, and M.S. Röder. 1995. RFLP markers 

linked to scald (Rhynchosporium secalis) resistance gene Rh2 in barley. Theor. Appl. 

Genet. 90:920-922. 

Skinner J.S., P. Szucs, J. von Zitzewitz, L. Marquez-Cedillo, T. Filichkin, E.J. Stockinger, 

M.F. Thomashow, T.H.H. Chen, and P.M. Hayes. 2006. Mapping of barley homologs 

to genes that regulate low temperature tolerance in Arabidopsis. Theor. Appl. Genet. 

112:832-842. 

Smilde, W.D., A. Tekauz, and A. Graner. 2000. Development of a high resolution map for the 

Rh and Pt resistance on barley Chromosome 3H. p. 178-180. In: S. Logue (ed.) Barley 

Genetics VIII. Volume II. Proc. Eigth Int. Barley Genet. Symp. Adelaide. Dept. Plant 

Science, Waite Campus, Adelaide University, Glen Osmond, South Australia. 

Soule, J.D., D.A. Kudrna, and A. Kleinhofs. 2000. Isolation, mapping, and characterization of 

two barley multiovary mutants. J. Heredity 91:483-487. 

Senthil, N. and T. Komatsuda. 2005. Inter-subspecific maps of non-brittle rachis gene btr1/btr2 

using occidental, oriental and wild barley lines. Euphytica 145:215-220. 

Stein, N., D. Perovic, J. Kumlehn, B. Pellio, S. Stracke, S. Streng, F. Ordon, and A. Graner. 

2005. The eukaryotic translation initian factor 4E confers multiallelic recessive 

Bymovirus resistance in Hordeum vulgare (L.). The Plant Journal 42:912-922. 

Taketa, S., T. Awayama, S. Amano, Y. Sakurai, and M. Ichii. 2006. High-resolution mapping 

of the nud locus controlling the naked caryopsis in barley. Plant Breeding 125:337-342. 

Tohno-oka, T., M. Ishii, R. Kanatani, H. Takahashi, and K. Takeda. 2000. Genetic Analysis 

of photoperiotic response of barley in different daylength conditions. p.239-241. In: S. 

140


Logue (ed.) Barley Genetics VIII. Volume III. Proc. Eigth Int. Barley Genet. Symp. 

Adelaide. Dept. Plant Science, Waite Campus, Adelaide University, Glen Osmond, South 

Australia. 

Toojinda, T., L.H. Broers, X.M. Chen, P.M. Hayes, A. Kleinhofs, J. Korte, D. Kudrna, H. 

Leung, R.F. Line, W. Powell, L. Ramsey, H. Vivar, and R. Waugh. 2000. Mapping 

quantitative and qualitative disease resistance genes in a doubled haploid population of 

barley (Hordeum vulgare). Theor. Appl. Genet. 101:580-589. 

Wang, J., H. Raman, M. Zhou, P.R. Ryan, E. Delhaize, D.M. Hebb, N. Coombes, and N. 

Mendham. 2007. High-resolution mapping of the Alp locus and identification of a 

candidate gene HvMATE controlling aluminum tolerance in barley (Hordeum vulgare 

L.). Theor. Appl. Genet. 115:265-276. 

Warner, R.L., D.A. Kudrna, and A. Kleinhofs. 1995. Association of the NAD(P)H-bispecific 

nitrate reductase structural gene with the Nar7 locus in barley. Genome 38:743-746. 

Weerasena, J.S., B.J. Steffenson, and A.B. Falk. 2004. Conversion of an amplified fragment 

length polymorphism marker into a c-dominant marker in mapping Rph15 gene 

conferring resistance to barley leaf rust, Puccinia hordei Otth. Theor. Appl. Genet. 

108:712-719. 

Williams, K.J., A. Lichon, P. Gianquitto, J.M. Kretschmer, A. Karakousis, S. Manning, P. 

Langridge, and H. Wallwork. 1999. Identification and mapping of a gene conferring 

resistance to the spot form of net blotch (Pyrenophora teres f. maculata) in barley. Theor. 

Appl. Genet. 99: 323-327. 

Williams, K., P. Bogacki, L. Scott, A. Karakousis, and H. Wallwork. 2001. Mapping of a 

gene for leaf scald resistance in barley line ’B87/14’ and validation of microsatellite and 

RFLP markers for marker-assisted selection. Plant Breed. 120:301-304. 

Yan G.P., and X.M. Chen. 2006. Molecular mapping of a recessive gene for resistance to stripe 

rust in barley. Theor. Appl. Genet. 113:529-537. 

Yan L., D. Fu, C. Li, A. Blechl, G. Tranquilli, M. Bonafede, A. Sanchez, M. Valarik, S. 

Yasuda, and J. Dubcovsky. 2006. The wheat and barley vernalization gene VRN3 is an 

orthologue of FT. Proc. Natl. Acad. Sci. USA 103:19581-19586. 

Zhong, S.B., R.J. Effertz, Y. Jin, J.D. Franckowiak, and B.J. Steffenson. 2003. Molecular 

mapping of the leaf rust resistance gene Rph6 in barley and its linkage relationships with 

Rph5 and Rph7. Phytopathology 93 (5):604-609. 

Zitzewitz, J. von, P. Scucs, J. Dobcov, L. Yan, E. Francia, N. Pecchioni, A. Casas, T.H.H. 

Chen, P.M. Hayes, and J.S. Skinner. 2005. Molecular and structural characterization of 

barley vernalization genes. Plant Molecular Biology 59:449-467. 

141


Coordinator’s report: Barley Genetic Stock Collection 

A. Hang and K. Satterfield 

USDA-ARS, National Small Grains Germplasm Research Facility, 

Aberdeen, Idaho 83210, USA 

e-mail: anhang@uidaho.edu 

In 2006, 655 barley genetic stocks were planted in the field and in the greenhouse for evaluation 

and for seed increase. 

Two mapping populations, including SSD F6 seed OSU 11/Harrington and SSD F6 seed 

OSU 15/Harrington, derived from single seed descent (SSD) of crosses between Hordeum 

vulgare subps. Spontaneum and cultivar “Harrington” obtained from Dr. Pat Hayes, Oregon 

State University (OSU), were planted in the field for seed increase. 

Four necrotic or lesion mimic mutants obtained from Dr. Anders Falk, Biological Research 

Center, Sweden, were also grown in the greenhouse for observation and for seed increase. 

Three hundred forty-five samples of barley genetic stocks were shipped to researchers in 

2006. 

Coordinator’s report: Trisomic and aneuploid stocks 

An Hang 

USDA-ARS, National Small Grains Germplasm Research Facility, 

Aberdeen, Idaho 83210, USA 

e-mail: anhang@uidaho.edu 

There is no new information about trisomic and aneuploid stocks. Lists of these stocks are 

available in BGN 25:104. Seed request for these stocks should be sent to the coordinator. 

142


Coordinator’s report: Translocations and balanced tertiary trisomics 

Andreas Houben 

Institute of Plant Genetics and Crop Plant Research 

DE-06466 Gatersleben, Germany 

email: houben@ipk-gatersleben.de 

Restructured barley chromosomes have been used by Nasuda et al. (2005) to elucidate the 

function of centromere-localized DNA sequences. The satellite sequences (AGGGAG)(n) and 

Ty3/gypsy-like retrotransposons are known to localize at the barley centromeres. Using a 

gametocidal system, which induces chromosomal mutations in barley chromosomes added to 

common wheat, the authors obtained an isochromosome for the short arm of barley chromosome 

7H (7HS) that lacked the barley-specific satellite sequence (AGGGAG)(n). Two telocentric 

derivatives of the isochromosome arose in the progeny: 7HS* with and 7HS** without the 

pericentromeric C-band. FISH analysis demonstrated that both truncated telosomes lacked not 

only the barley-specific centromeric repeats but also any of the known wheat centromeric 

tandem repeats. Although they lacked these centromeric repeats, both truncated 

telochromosomes showed normal mitotic and meiotic transmission. Indirect immunostaining 

revealed that centromere-specific proteins localized at the centromeric region of 7HS*. The 

authors conclude that the barley centromeric repeats are neither sufficient nor obligatory to 

assemble kinetochores, and discussed the possible formation of a novel centromere in a barley 

chromosome. 

The collection is being maintained in cold storage. To the best knowledge of the coordinator, 

there are no new publications dealing with balanced tertiary trisomics in barley. Limited seed 

samples are available any time, and requests can be made to the coordinator. 

Reference: 

Nasuda, S., Hudakova, S., Schubert, I., Houben, A., and Endo, T.R. 2005. Stable barley 

chromosomes without centromeric repeats. Proc Natl Acad Sci U S A 102: 9842-9847. 

Coordinator’s report: Autotetraploids 

Wolfgang Friedt 

Institute of Crop Science and Plant Breeding I. 

Justus-Liebig-University, Heinrich-Buff-Ring 26-32 

DE-35392 Giessen, Germany 

e-mail: wolfgang.friedt@agrar.uni-giessen.de 

Fax: +49(0)641-9937429 

The collection of barley autotetraploids (exclusively spring types) described in former issues of 

BGN is maintained at the Giessen Field Experiment Station of our institute. The set of stocks, 

i.e. autotetraploids (4n) and corresponding diploid (2n) progenitors (if available) have last been 

grown in the field for seed multiplication in summer 2000. Limited seed samples of the stocks 

are available for distribution. 

143


Coordinator’s report: Eceriferum Genes 





Dahleen and Franckowiak (2006) could localize the eceriferum-zt locus on chromosome 2HS 

based on their molecar linkage studies and found linkage in bin 2H-01 d 16.8 distal from the 

SSR molecular marker Bmac 0134. Surface wax coating on the spike appears slightly reduced 

with eceriferum-zt. The wax code for this mutant gene is + ++ ++ . 

No further research work on gene localization has been reported on these collections of 

Eceriferum and Glossy genes. All descriptions in Barley Genetics Newsletter (BGN) Volume 26 

are valid and still up-to-date. All Swedish Eceriferum alleles can be seen in the SESTO database 

of the Nordic Gene Bank. Descriptions, images and graphic chromosome map displays of the 

Eceriferum and Glossy genes are available in the AceDB database for Barley Genes and Barley 

Genetic Stocks, and they get currently updated. Its address is found by: www.untamo.net/bgs 

As my possibilities in searching literature are very limited, I apologize if I am missing any 

important papers. Please send me notes of publications and reports to include in next year’s 

reports. 

Every research of interest in the field of Eceriferum genes, ‘Glossy sheath’ and ‘Glossy leaf’ 

genes can be reported to the coordinator as well. Seed requests regarding the Swedish mutants 

can be forwarded to the coordinator udda@nordgen.org or to the Nordic Gene Bank, 

www.nordgen.org/ngb, all others to the Small Grain Germplasm Research Facility (USDA- 

ARS), Aberdeen, ID 83210, USA, nsgchb@ars-grin.gov or to the coordinator at any time. 

Reference: 

Dahleen, L.S. and J.D. Franckowiak. 2006. SSR linkages to eight additional morphological 

marker traits. Barley Genetic Newsletter 36:12+16. 

144


Coordinator’s report: Nuclear genes affecting the chloroplast 

Mats Hansson 

Department of Biochemistry, 

Lund University, Box 124, 

SE-22100 Lund, Sweden 

E-mail: mats.hansson@biochemistry.lu.se 

Barley nuclear mutants deficient in chlorophyll biosynthesis and chloroplast development are 

named albina, xantha, viridis, chlorina, tigrina and striata depending on their colour and colour 

pattern. In the albina mutants the leaves are completely white due to lack of both chlorophyll and 

carotene pigments. The xantha mutants are yellow and produce carotene, but no chlorophyll. The 

chlorina and viridis mutants are both pale green, but differ in chlorina being viable. The tigrina 

and striata mutants are stripped transverse and along the leaves, respectively. 

Although the mutations are generally lethal, the large endosperm of barley seeds supports plant 

growth for several weeks, allowing analysis of the mutants at a seedling stage. This has been 

utilized in three studies concerning cold acclimation (Svensson et al. 2006), photosystem II 

(Morosinotto et al. 2006) and dominance/recessivity in chlorophyll biosynthesis (Axelsson et al. 

2006), respectively. 

Svensson and collaborators (2006) used the Affymetrix Barley1 GeneChip in combination with 

albina-e.16, albina-f.17, xantha-s.46 and xantha-b.12 to assess the effect of the chloroplast on 

the expression of cold-regulated genes. About 67% of wild-type cold-regulated genes were not 

regulated by cold in any mutant (chloroplast-dependent cold-regulated genes).They found that 

the lack of cold regulation in the mutants is due to the presence of signalling pathway(s) 

normally cold activated in wild type but constitutively active in the mutants, as well as to the 

disruption of low-temperature signalling pathway(s) due to the absence of active chloroplasts. 

They also found that photooxidative stress signalling pathway is constitutively active in the 

mutants. These results demonstrate the major role of the chloroplast in the control of the 

molecular adaptation to cold. 

The barley mutant viridis-zb.63 lacks photosystem I and was employed by Morosinotto et al. 

(2006) to mimic extreme and chronic overexcitation of photosystem II. The mutation was shown 

to reduce the photosystem II antenna to a minimal size of about 100 chlorophylls per 

photosystem II reaction centre, which was not further reducible. The minimal photosystem II 

unit was found to consist of a dimeric photosystem II reaction centre core surrounded by 

monomeric Lhcb4 (chlorophyll protein 29), Lhcb5 (chlorophyll protein 26) and trimeric lightharvesting 

complex II antenna proteins. This minimal photosystem II unit forms arrays in vivo, 

possibly to increase the efficiency of energy distribution and provide photoprotection. In wildtype 

plants, an additional antenna protein, chlorophyll protein 24 (Lhcb6), which is not 

expressed in viridis-zb.63, is proposed to associate to this minimal unit and stabilize larger 

antenna systems when needed. The analysis of the mutant also revealed the presence of two 

distinct signalling pathways activated by excess light absorbed by photosystem II: one, 

dependent on the redox state of the electron transport chain, is involved in the regulation of 

antenna size, and the second, more directly linked to the level of photoinhibitory stress perceived 

by the cell, participates in regulating carotenoid biosynthesis. 

145


Axelsson et al. (2006) studied the enzyme Mg-chelatase, which catalyzes the insertion of Mg 2+ into 

protoporphyrin IX at the first committed step of the chlorophyll biosynthetic pathway. It consists of 

three subunits; I, D and H. The I-subunit belongs to the AAA-protein superfamily (ATPases 

associated with various cellular activities) that is known to form hexameric ring structures in an 

ATP-dependant fashion. Dominant mutations in the Xantha-h gene, encoding the I-subunit, revealed 

that it functions in a cooperative manner. Axelsson et al. demonstrated that the D-subunit, encoded 

by Xantha-g, forms ATP-independent oligomeric structures and should also be classified as an 

AAA-protein. Furthermore, the question of cooperativity of the D-subunit was addressed by 

characterizing xantha-g.28, -g.37, -g.44, -g.45 and -g.65 at the molecular level. The recessive 

behavior in vivo was explained by the absence of mutant proteins in the barley cell. The identified 

mutations were constructed in the corresponding gene of Rhodobacter capsulatus and the resulting 

D-proteins were studied in vitro. Mixtures of wild-type and mutant R. capsulatus D-subunits showed 

a lower activity as compared to wild-type subunits assayed alone. Thus, the mutant D-subunits 

displayed a dominant behavior in vitro thus revealing cooperativity between the D-subunits in the 

oligomeric state. Based on these results, they proposed a model where the D-oligomer forms a 

platform for the stepwise assembly of the I-subunits. The cooperative behavior suggests that the Doligomer 

takes an active part in the conformational dynamics between the subunits of the enzyme. 

The stock list of barley mutants defective in chlorophyll biosynthesis and chloroplast development is 

found elsewhere in this issue of BGN and at 

http://www.mps.lu.se/fileadmin/mps/People/Hansson/Barley_mutants_web.pdf 

Dr. Mats Hansson 

Department of Biochemistry 

Lund University 

Box 124 

SE-22100 Lund, SWEDEN 

Phone: +46-46-222 0105 

Fax: +46-46-222 4534 

E-mail: Mats.Hansson@biochemistry.lu.se 

New references: 

Axelsson, E., A. Sawicki, S. Nilsson, I. Schröder, S. Al-Karadaghi, R. D. Willows and M. 

Hansson. 2006. Recessiveness and dominance in barley mutants deficient in Mgchelatase 

subunit D, an AAA protein involved in chlorophyll biosynthesis. Plant Cell 18: 

3606-3616. 

Morosinotto, T., R. Bassi, S. Frigerio, G. Finazzi, E. Morris and J. Barber. 2006. 

Biochemical and structural analyses of a higher plant photosystem II supercomplex of a 

photosystem I-less mutant of barley. Consequences of a chronic over-reduction of the 

plastoquinone pool. FEBS J. 273: 4616-4630. 

146


Svensson, J.T., C. Crosatti, C. Campoli, R. Bassi, A. Michele Stanca, T.J. Close, and L. 

Cativelli. 2006. Transcriptions analysis of cold acclimation in barley albina and 

xantha mutants. Plant Physiol. 141: 257-270. 

Coordinator’s report: The Genetic Male 

Sterile Barley Collection 

M.C. Therrien 

Agriculture and Agri-Food Canada 

Brandon Research Centre 

Box 1000A, RR#3, Brandon, MB 

Canada R7A 5Y3 

E-mail: MTherrien@agr.gc.ca 

The GMSBC has been at Brandon since 1992. If there are any new sources of male-sterile genes 

that you are aware of, please advice me, as this would be a good time to add any new source to 

the collection. For a list of the entries in the collection, simply E-mail me at the above adress. I 

can send the file (14Mb) in Excel format. We continue to store the collection at -20 o C and will 

have small (5 g) samples available for the asking. Since I have not received any reports or 

requests the last years, there is absolutely no summary in my report. 

147


Coordinator’s report: Ear morphology genes. 



P.O. Box 41 SE-230 53 Alnarp, Sweden 


A. Michele Stanca and Valeria Terzi 

C.R.A., Genomic Research Centre 

Via San Protaso 302 

29017-Fiorenzuola d’Arda, Italy 

e-mail: michele@stanca.it; v.terzi@iol.it 

The studies on barley development in these last years have taken advantages both from genetics 

and genomics approaches. Some barley genes involved in the ear morphology development 

have been mapped on high density molecular linkage maps and this strategy has been 

accompanied by candidate gene approaches (Pozzi et al., 2002). 

In the work of Pozzi et al. (2003) 29 genetic loci for which mutant alleles exist were placed on a 

restriction fragment length polymorphism- amplified fragment length polymorphism (RFLP- 

AFLP) map. Among the 29 loci considered in the work, some specifically affect ear morphology 

and assume characteristics proper to phytomers of other regions (like third outer glume and 

awned palea) or are characterized by the presence of modified organs (like liguleless, 

bracteatum, triple awned lemma and awned lemma). In Table 1 the map positions individuated 

by Pozzi et al. (2003) for some loci involved in ear morphology are reported. 

Table 1. Position of 12 developmental mutant loci in a Proctor X Nudinka AFLP map (from 

Pozzi et al, 2003), but revised regarding symbols and nomenclature. 

Mutant symbol and name Map position Closest marker 

adp1, awned palea1 Chr. 3H/27 E3634-8 

als1, absent lower laterals1 Chr 3H/28 E4234-11 

bra-d.7, bracteatum-d.7 Chr. 1H E3634-7 

dub.1, double seed.1 Chr 5H/66 and 67 E4038-4 

hex-v.3, hexastichon-v.3 Chr. 2H/19-21 E4343-7 

hex-v.4, hexastichon-v.4 Chr. 2H/19 and 20 E3438-3 

int- c.5, intermedium-c.5 Chr. 4H/8 E4143-5 

Kap1, Hooded lemma1 Chr. 4H/36 and 37 E4140-1 

lks2, short awn2 Chr. 7H/6 E4138-3 

lks5, short awn5 Chr. 4H/38 E4143-5 

trp1, triple awned lemma1 Chr. 2H/22 and 23 E3644-13 

trd1, third outher glume1 Chr.1H/52 E3634-7 

The genetics of barley Hooded suppression has been studied by Roig et al. (2004). The genetic 

basis of this phenotype is a mutation in the homeobox Bkn3. After chemical mutagenesis and 

148


complementation tests, five suK (suppressor of K) loci were identified and mapped on 

chromosomes 5H and 7H. 

Comparative genetic studies across species has revealed syntenous conservation in the order of 

genes and markers along grass chromosomes. Starting from this observation, Rossini et al. 

(2006) used a synteny approach comparing barley and rice genomes to individuate candidate 

genes for a set of barley developmental mutants. 

The gene vrs1 (six-rowed spike 1) responsible for the six-rowed spike in barley has been recently 

isolated by means of positional cloning by Komatsuda et al. (2007). The wild type Vrs1 gene, 

present in two-rowed barley, encodes a transcription factor that includes a homeodomain with a 

closely linked leucine zipper motif. VRS1 protein suppresses lateral rows and give two-rowed 

spike, whereas a mutation in the homeodomain-leucine zipper of Vrs1 resulted into loss of 

function and development of six-rowed phenotype. 

The conservation and implementation of the barley morphological mutant collections is essential 

for future studies, ranging from the use of computer graphic L-system- models to simulate the 

final morphology of a plant (Buck-Sorlin et al., 2004) to the use of genomic tools for the 

elucidation of the gene functions. 

Regarding the Swedish mutation collection two new additional mutant loci could be mapped 

based on molecular mapping studies using simple sequences repeat (SSR) markers (Dahleen et 

al. 2005, Dahleen and Franckowiak. 2006). 

(1). The intermedium spike-k (int-k) gene could be localized in the centromeric region of 

chromosome 7H, closely linked to Bmag0217 and Bmac0162 in bins 6 to 7. This spike mutant 

has a short and dense spike and the lateral spikelets are enlarged with a pointed apex. 

Occasionally they have a short awn. The central spikelets are semi-sterile and there is no seed set 

in the lateral spikelets. Plants have a dense coating of wax surface. They also have significantly 

reduced height, peduncle length, awn length, kernels per spike, leaf length, kernel weight and 

yield. 

(2). The erectoides-t (ert-t) gene, one of the dense spike mutant loci, could be localized near the 

tip of chromosome 2HS, approximately 11.4 cM distal from SSR marker Bmac0134, near the 

boundary between bins 2H-01 and 2H-02. The spikes of this mutant gene are semicompact, 

rachis internode length is about 2.7 mm and culm length is about 2/3 of normal. These 

phenotypic traits plus short awns are inheritated together. Based on general appearance of the 

plants, ert-t can be placed in the brachytic class and by diallelic crosses three earlier identified 

Brachytic 3 (brh3) phenotypes were found to be allelic at the ert-t locus (Franckowiak, 2006). 

References 

Buck-Sorlin, G., O. Kniemeyer, and W. Kurth. 2004. Integrated grammar representation of 

genes, metabiolites and morphology: the example of hordeomorphs. 2004. Fourth 

International Workshop on Functional Structural Plant Models, Montpellier, France pp. 

386-389. 

Dahleen, L.S., L.J.Vander Val, and J.D. Franckowiak. 2005. Characterixation and molecular 

mapping of genes determining semidwarfism in barley. J. Hered. 96:654-662. 

149


Dahleen, L.S., and J.D. Franckowiak. 2006. SSR Linkages to Eight Additional Morphological 

Marker Traits. Barley Genetics Newsletter (BGN) 36:12-16. 

Franckowik, J,D. 2006. Coordinator’s report: Chromosome 2H (2). BGN 36:54-56 

Komatsuda, T., M. Pourkheirandish, C. He, P. Azhaguvel, H. Kanamori, D. Perovic, N. 

Stein, A. Graner, T. Wicker , A. Tagiri, U. Lundqvist, T. Fujimura, M. Matsuoka, 

T. Matsumoto, and M. Yano M. 2007. Six-rowed barley originated from a mutation in a 

homeodomain-leucine zipper I-class homeobox gene. PNAS 104: 1424-1429. 

Pozzi, C., L. Rossini, L. Santi, M.R. Stile, L. Nicoloso, F. Barale, D. Vandoni, I. Decimo, C. 

Roig, P. Faccioli, V. Terzi, Y. Wang, and F. Salamini, F. 2002. Molecular genetics of 

barley development: from genetics to genomics. In: From biodiversity to genomics: 

breeding strategies for small grain cereals in the third millenium. Eucarpia Cereal Section 

Meeting, 2002. pp 463- 466. 

Pozzi, C., D. Di Pietro, G. Halas, C. Roig, and F. Salamini. 2003. Integration of a barley 

(Hordeum vulgare) molecular linkage map with the position of genetic loci hosting 29 

developmental mutants. Heredity, 90: 390-396. 

Roig, C., C. Pozzi, L. Santi, J. Muller, Y. Wang, M.R. Stile, L. Rossini, A.M. Stanca, and F. 

Salamini. 2004. Genetics of barley Hooded suppression. Genetics, 167: 439-448. 

Rossini L., A. Vecchietti, L. Nicoloso, N. Stein, S. Franzago, F. Salamini, C. and Pozzi. 

2006. Candidate genes for barley mutants involved in plant architecture: an in silico 

approach. Theoretical and Applied Genetics, 112: 1073-1085. 

150


Coordinator’s report: Semidwarf genes 

J.D. Franckowiak 

Hermitage Research Station 



e-mail: jerome.franckowiak@dpi.qld.gpv.au 

The sdw1 (denso) gene for the semidwarfism in barley was shown to be orthologous to the sd1 of 

rice based on similar map positions and linkage of both semidwarf genes to RFLP maker R1545 

(Zhang et al., 2005). Both genes are sensitive to gibberellic acid (GA) treatments and encode a 

GA20-oxidase mutant (HV20ox2), which produces lower levels of GA and causes the dwarf 

phenotype. Zhang et al. (2005) reported that the barley and rice genes shared 88% sequence 

similarity and 89% amino acid identity. 

Yin et al. (2005) confirmed that QTLs that lengthening the preflowering duration in the 

‘Apex’/‘Prisma’ population of 94 recombinant inbred lines (RILs) were located in the long arms 

of chromosome 2H and 3H and originated from Prisma. The QTL on 3HL was associated with 

presence of the sdw1 gene from Prisma and likely is a pleiotropic effect of sdw1 gene. 

Korff et al. (2006) detected the presence of the sdw1 gene from ‘Scarlett’ in doubled-haploid 

lines from the second backcross of Scarlett to Hordeum vulgare ssp. spontaneum accession 

ISR42-8. QTLs for plant height were detected also on other chromosomes by Korff et al. (2006). 

Gruszka et al. (2006) reported that a semidwarf mutant 093AR, which was produced by MNU 

(N-methyl-N-nitrosourea) treatment of variety Aramir, is allelic to the uzu (uzu1 on chromosome 

3HL) dwarfing gene. Their analysis of the DNA sequence of the HvBRI1 gene of 093AR showed 

a single-nucleotide substitution of the C to A substitutions at the positions 1760 and 1761. 

Gruszka et al. (2006) also confirmed that the uzu1 mutation was an A to G change at position 

2612 of the HvBRI1 gene. Chono et al. (2003) previously reported that the mutation resulted in 

an amino acid change at the highly conserved residue (His-857 to Arg-857) of the kinase domain 

of BRI1 (brassinosteroids) receptor protein. This change caused reduced sensitivity to BRs and 

reduced plant height (Chono et al., 2003). 

References: 

Gruszka, D., J. Zbieszczyk, M. Kwasniewski, I. Szarejko and M. Maluszynski. 2006. A new 

allele in a uzu gene encoding brassinosteroid receptor. Barley Genet. Newsl 36:1-2. 

author: wintergrun@op.pl 

Chono, M., I. Honda, H. Zeniya, K. Yoneyama, D. Saisho, K. Takeda, S. Takatsuto, T. 

Hoshino and Y. Watanabe. 2003. A semidwarf phenotype of barley uzu results from a 

nucleotide substitution in the gene encoding a putative brassinosteroid receptor. Plant 

Physiol. 133:1209-1219. 

von Korff, M., H. Wang, J. Léon, and K. Pillen. 2006. AB-QTL analysis in spring barley: II. 


(H. vulgare ssp. spontaneum). Theor. Appl. Genet. 112:1221-1231. 

151


Yin, X., P.C. Struik, F.A. van Eeuwijk, P. Stam, and J. Tang. 2005. QTL analysis and QTLbased 

prediction of flowering phenology in recombinant inbred lines of barley J. Exp. 

Bot. 56(413):967-976. 

Zhang, J., X. Yang, P. Moolhuijzen, C. Li, M. Bellgard, R. Lance, and R. Appels. 2005. 

Towards isolation of the barley green revolution gene. Australian Barley Technical 

Symposium 2005. 

http://www.cdesign.com.au/proceedings_abts2005/posters%20(pdf)/poster_li.pdf. 

Verified 4 July 2007. 

Coordinator’s report : Wheat-barley genetic stocks 

A.K.M.R. Islam 

Faculty of Agriculture, Food & Wine, The University of Adelaide, Waite Campus, 

Glen Osmond, SA 5064, Australia 

e-mail: rislam@waite.adelaide.edu.com 

The production of five different disomic addition lines (1Hm, 2Hm, 4Hm, 5Hm and 7Hm) of 

Hordeum marinum chromosomes to Chinese Spring wheat has been reported earlier. It has now 

been possible to isolate a monosomic addition for chromosome 6Hm. Amphiploids have also 

been produced between H. marinum and more cultivars of commercial wheat (Islam and Colmer, 

unpublished). 

References: 

Islam,S; Malik, AI; Islam, AKMR; Colmer TD. 2007. Salt tolerance in a Hordeum marinum- 

Triticum aestivum amphiploid, and its parents. J Experimental Botany (in Press). 

152


Coordinator’s report: Early maturity genes 



P-O. Box 41 

SE-23 053 Alnarp, Sweden 


Not much new research on gene localization has been reported on the Early maturity or 

Praematurum genes since the latest reports in Barley Genetic Newsletter (BGN) or in the AceDB 

database for Barley Genes and Barley Genetic Stocks. 

During the last years many reports are published on various QTLs detected in populations 

derived from wild x cultivated barley crosses with the goal of transferring desirable genes into 

cultivated barley lines. 

Korff et al. (2006) transferred favourable genes from wild barley to cultivated barleys and made 

evaluations in backcrosses of a doubled haploid population. A QTL for Early heading was 

associated with the Early maturity 1 (Eam1 or Ppd-H1) gene in the bin 3 region of 2HS. 

Several QTLs were found in crosses between two- and six-rowed cultivars. One QTL for early 

heading is reported and found in bin 8 of 2HL and is probably the Eam6 gene from a six-rowed 

parent (Franckowiak 2006). 

All information and descriptions made in the Barley Genetics Newsletter are valid and up-todate. 

As my possibilities in searching literature are very limited, I apologize if I am missing any 

important papers and reports. I would like to call on the barley community to assist me by 

sending notes of publications and reports to include in next year’s report. Descriptions, images 

and graphic chromosome map displays of the Early maturity or Praematurum genes are available 

in the AceDB database for Barley Genes and Barley Genetic Stocks. They get currently updated 

and are searchable under the address: www.untamo.net/bgs 

Every research of interest in the field of Early maturity genes can be reported to the coordinator 

as well. Seed requests regarding the Swedish mutants can be forwarded to the coordinator or 

directly to the Nordic Gene Bank, www.nordgen.org/ngb, all others to the Small Grain 

Germplasm Research Facility (USDA-ARS), Aberdeen, ID 83210, USA, nsgchb@ars-grin.gov 

or to the coordinator at any time. 

References: 

Franckowiak, J.D. 2006. Coordinator’s report: Chromosome 2H. Barley Genetics Newsletter 

36:54-56. 

Korff, M. von, H. Wang, J. Léon, and K. Pilen. 2006. AB-QTL analysis in spring barley: II. 


(Hordeum vulgare ssp. spontaneum). Theor. Appl. Genet. 112:1221-1231. 

153


Descriptions of barley genetic stocks for 2007. 

Lynn Dahleen, 1 , Jerome D. Franckowiak 2 , Udda Lundqvist 3 

1 USDA-ARS, State University Station, P.O. Box 5677, 

Fargo, ND 58105-5051, USA 

2 Hermitage Research Station, 



3 Nordic Gene Bank 


In this volume of the Barley Genetics Newsletter, seventy six new and revised Barley Genetic 

Stock descriptions are published (Table 1). The current list of new and revised BGS descriptions, 

including those in Table 1, are again presented by BGS number order (Table 2) and by locus 

symbol in alphabetic order (Table 3) in this issue. Information on the description location, 

recommended locus name, chromosomal location, previous gene symbols, and the primary 

genetic stock (GSHO number) are included in these lists. The GSHO stocks are held in the 

USDA-ARS Barley Genetic Stocks collection at the National Small Grains collection, (U.S. 

Department of Agriculture – Agricultural Research Service), Aberdeen, Idaho 83210, USA. The 

NGB stocks are held in the Nordic Gene Bank, P.O. Box 41, SE-230 53 Alnap, Sweden. This 

information is available through the Internet at the following addresses: 

(1) www.ars.usda.gov.PacWest/Aberdeen 

(2) www.ars-grin.gov:7000/npgs/descriptors/barley-genetics (GRIN) 

(3) http://wheat.pw.usda.gov/ggpages/bgn/ 

154


Table 1. A listing of Barley Genetic Stock (BGS) descriptions published in this issue of the 

Barley Genetics Newsletter, giving recommended locus symbols and names, and stock 

location information. 

BGS Locus symbol* Chr. Locus name or phenotype Descr. GSHO 

no. Rec Prev. loc. † vol.p. no. ‡ 

1 brh1 br, ari-i 7HS Brachytic 1 37:188 25 

2 fch12 fc, clo-fc 7HS Chlorina seedling 12 37:190 36 

6 vrs1 v, Int-d 2HL Six-rowed spike 1 37:192 196 

7 nud1 n, h 7HL Naked caryopsis 1 37:195 115 

10 lks2 lk2, lk4 7HL Short awn 2 37:197 1232 

22 Rsg1 Grb 7H Reaction to Schizaphis gramineum 1 37:199 1317 

32 Rph9 Pa9 5HL Reaction to Puccinia hordei 9 37:201 1601 

41 brh7 brh.w 5HS Brachytic 7 37:203 1687 

44 brh16 brh.v 7HL Brachytic 16 37:204 1686 

60 lig1 li, aur-a 2HL Liguleless 1 37:205 6 

79 wst7 rb 2HL White streak 7 37:207 247 

82 Zeo1 Knd 2HL Zeocriton 1 37:209 1613 

85 yst4 yst4 2HL Yellow streak 4 37:210 2502 

87 fch14 f14 2HL Chlorina seedling 14 37:211 1739 

88 Rph2 Pa2, A 5HS Reaction to Puccinia hordei 2 37:212 1593 

96 Rph15 Rph16 2HS Reaction to Puccinia hordei 15 37:214 1586 

98 Eam6 Ea6 2HS Early maturity 6 37:216 

100 sld4 sld.d 7HS Slender dwarf 4 37:218 2479 

101 als1 als 3HL Absent lower laterals 1 37:219 1065 

102 uzu1 uz, u 3HL Uzu 1 or semi-brachytic 1 37:220 1300 

108 alm1 al, ebu-a 3HS Albino lemma 1 37:222 270 

122 Rph5 Pa5, Rph6 3HS Reaction to Puccinia hordei 5 37:224 1597 

130 eam10 easp 3HL Early maturity 10 37:226 2504 

136 Rph7 Pa7, Pa5 3HS Reaction to Puccinia hordei 7 37:228 1318 

142 brh8 brh.ad 3HS Brachytic 8 37:230 1671 

148 brh14 brh.q 3HL Brachytic 14 37:231 1682 

149 Rpc1 3H Reaction to Puccinia coronata var hordei 1 37:232 1601 

155 glf1 gl, cer-zh 4HL Glossy leaf 1 37:233 98 

157 brh2 br2, ari-l 4HL Brachytic 2 37:235 573 

178 int-c i, v5 4HS Intermedium spike-c 37:237 776 

179 Hsh1 Hs 4HL Hairy leaf sheath 1 37:240 986 

185 brh5 brh.m 4HS Brachytic 5 37:242 1678 

186 sld3 sld.e 4HS Slender dwarf 3 37:243 2480 

187 brh9 brh.k 4HS Brachytic 9 37:244 1676 

203 Blp1 B 1HL Black lemma and pericarp 1 37:245 988 

214 eam8 eak, mat-a 1HL Early maturity 8 37:247 765 

222 nec1 sp,,b 1HL Necrotic leaf spot 1 37:251 989 

253 cul2 uc2 6HL Uniculm 2 37:253 531 

155


Table 1 (continued) 

BGS Locus symbol* Chr. Locus name or phenotype Descr. GSHO 

no. Rec Prev. loc. † vol.p. no. ‡ 

254 rob1 o, rob-o 6HS Orange lemma 1 37:255 707 

266 ert-e, dsp9 ert-e 6HL Erectoides-e 37:257 477 

306 var1 va 5HL Variegated 1 37:259 1278 

348 Eam5 Ea5 5HL Early maturity 5 37:260 

349 brh4 brh.j 2HL Brachytic 4 37:262 1675 

350 brh6 brh.s 5HS Brachytic 6 37:263 1683 

377 seg1 se1 7HL Shrunken endosperm genetic 1 37:264 750 

379 seg3 se3 3HS Shrunken endosperm genetic 3 37:265 752 



397 seg7 se7 Shrunken endosperm genetic 7 37:269 2468 

437 cer-zt cer-zt 2HS Eceriferum-zt 37:270 1527 

449 cer-yf cer-yf Eceriferum-yf 37:271 1539 

455 seg8 seg8 7H Shrunken endosperm genetic 8 37:272 2469 

474 lax-a lax-a 5HL Laxatum-a 37:273 1775 

516 Rsp2 Sep2 1HS Reaction to septoria passerinii 2 37:275 2511 

517 Rsp3 Sep3 1HS Reaction to septoria passerinii 3 37:276 2512 

518 sdw1 denso 3HL Semidwarf 1 37:277 2513 

546 int-k int-k 7H Intermedium spike-k 37:279 1770 

547 int-m int-m Intermedium spike-m 37:280 1772 

566 ert-t ert-t, brh3 2HS Erectoides-t 37:281 494 

577 Rsg2 Rsg2 Reaction to Schizaphis gramineum 2 37:283 2513 

586 bra-d 1HL Bracteatum-d 37:284 1696 

593 adp1 adp 3HL Awned palea 1 37:285 1950 

599 ant17 ant17 3HS Proanthocyanin-free 17 37:286 

617 cul4 uc-5 3HL Uniculme 4 37:289 2493 

623 eli-a lig-a Eligulum-a 37:290 

633 mnd6 den-6 5HL Many noded dwarf 6 37:291 1713 

636 tst2 lin2 Tip sterile 2 37:292 1781 

653 brh10 brh.l 2HS Brachytic 10 37:293 1677 

654 brh11 brh.n 5HS Brachytic 11 37:294 1679 

655 brh12 brh.o 5HS Brachytic 12 37:295 1680 

656 brh13 brh.p 5HS Brachytic 13 37:296 1681 

657 brh15 brh.u Brachytic 15 37:297 1685 

658 brh17 brh.ab 5HS Brachytic 17 37:298 1669 

659 brh18 brh.ac 5HS Brachytic 18 37:299 1670 

660 nld2 Narrow leafed dwarf 2 37:300 

661 dub1 5HL Double seed 1 37:301 

156


* Recommended locus symbols are based on utilization of a three letter code for barley genes as 

approved at the business meeting of the Seventh International Barley Genetics Symposium at 

Saskatoon, Saskatchewan, Canada, on 05 August 1996. 

† Chromosome numbers and arm designations are based on a resolution passed at the business 

meeting of the Seventh International Barley Genetics Symposium at Saskatoon, Saskatchewan, 

Canada, on 05 August 1996. The Burnham and Hagberg (1956) designations of barley 

chromosomes were 1 2 3 4 5 6 and 7 while new designations based on the Triticeae system are 

7H 2H 3H 4H 1H 6H and 5H, respectively. 

‡ The seed stock associated with each BGS number is held as a GSHO stock number in the 

Barley Genetics Stock Collection at the USDA-ARS National Grains Germplasm Research 

Facility, Aberdeen, Idaho, USA. 

157


Table 2. A listing of Barley Genetic Stock (BGS) descriptions in recent issues of the Barley 

Genetics Newsletter recommended locus symbols and names, and stock location 

information. 

BGS Locus symbol * Chr. Locus name or phenotype Descr. GSHO 

no. Rec. Prev. loc. † vol. p. no. ‡ 

1 brh1 br, ari-i 7HS Brachytic 1 37:188 25 

2 fch12 fc, clo-fc 7HS Chlorina seedling 12 37:190 36 

3 yvs2 yc 7HS Virescent seedling 2 26: 46 41 

4 abo8 ac2, alb-m 7HS Albino seedling 8 26: 47 61 

5 fch8 f8 7HS Chlorina seedling 8 26: 48 40 

6 vrs1 v, Int-d 2HL Six-rowed spike 1 37:192 196 

7 nud1 n, h 7HL Naked caryopsis 1 37:195 115 

9 dsp1 l 7HS Dense spike 1 26: 53 1232 

10 lks2 lk2, lk4 7HL Short awn 2 37:197 566 

11 ubs4 u4, ari-d 7HL Unbranched style 4 26: 56 567 

12 des1 lc 7H Desynapsis 1 26: 57 592 

13 des4 des4 7H Desynapsis 4 26: 58 595 

14 des5 des5 7H Desynapsis 5 26: 59 596 

15 blx1 bl 4HL Non-blue aleurone xenia 1 26: 60 185 

16 wax1 wx, glx 7HS Waxy endosperm 1 26: 61 908 

17 fch4 f4, yv 7HL Chlorina seedling 4 26: 63 1214 

18 fch5 f5, yv2 7HS Chlorina seedling 5 26: 64 1215 

19 blx2 bl2 7HS Non-blue aleurone xenia 2 26: 65 209 

20 Rym2 Ym2 7HL Reaction to BaYMV 2 26: 66 984 

21 Run1 Un 7HS Reaction to Ustilago nuda 1 26: 67 1324 

22 Rsg1 Grb 7H Reaction to Schizaphis graminum 1 37:199 1317 

23 wnd1 wnd 7HS Winding dwarf 1 26: 69 2499 

24 fst3 fs3 7HS Fragile stem 3 26: 70 1746 

25 Xnt1 Xa 7HL Xantha seedling 1 26: 71 1606 

26 snb1 sb 7HS Subnodal bract 1 26: 72 1217 

27 lbi3 lb3 7HL Long basal rachis internode 3 26: 73 536 

28 ert-a ert-a 7HS Erectoides-a 26: 74 468 

29 ert-d ert-d 7HS Erectoides-d 26: 76 475 

30 ert-m ert-m 7HS Erectoides-m 26: 78 487 

31 sex6 sex6 7HS Shrunken endosperm xenia 6 26: 80 2476 


33 ant1 rs, rub-a 7HS Anthocyanin-less 1 26: 82 1620 

34 msg50 msg,,hm 7HL Male sterile genetic 50 26: 83 2404 

35 rsm1 sm 7HS Reaction to BSMV 1 26: 84 2492 

36 xnt4 xc2 7HL Xantha seedling 4 26: 85 42 

37 xnt9 xan,,i 7HL Xantha seedling 9 26: 86 584 

38 smn1 smn 7HS Seminudoides 1 32: 78 1602 

39 mss2 mss2 7HS Midseason stripe 2 32: 79 2409 

158



BGS Locus symbol * Chr. † Locus name or phenotype Descr. GSHO 

no. Rec. Prev. loc. vol. p. no. ‡ 

40 prm1 prm 7HS Premature ripe 1 32: 80 2429 

41 brh7 brh.w 5HS Brachytic 7 37:203 1687 

42 Pyr1 Pyr1 7HS Pyramidatum 1 32: 82 1581 

43 mov1 mo5 7HL Multiovary 1 35:185 

44 brh16 brh.v 7HL Brachytic 16 37:204 1686 

51 rtt1 rt 2HS Rattail spike 1 26: 87 216 

52 fch15 or 2HS Chlorina seedling 15 26: 88 49 

53 abo2 a2 2HS Albino seedling 2 26: 89 70 

55 fch1 f, lg 2HS Chlorina seedling 1 26: 90 112 

56 wst4 wst4 2HL White streak 4 26: 91 568 

57 eog1 e, lep-e 2HL Elongated outer glume 1 26: 92 29 

58 vrs1 lr, v lr 2HL Six-rowed spike 1 26: 94 153 

59 gpa1 gp, gp2 2HL Grandpa 1 26: 95 1379 

60 lig1 li, aur-a 2HL Liguleless 1 37:205 6 

61 trp1 tr 2HL Triple awned lemma 1 26: 97 210 

62 sbk1 sk, cal-a 2HS Subjacent hood 1 32: 83 267 

63 yvs1 yx, alb-c2 2HS Virescent seedling 1 26: 99 68 

64 des7 des7 2H Desynapsis 7 26:100 598 

65 Eam1 Ea, Ppd-H1 2HS Early maturity 1 26:101 1316 

66 vrs1 V d 2HL Two-rowed spike 1 26:103 346 

67 vrs1 V t 2HL Deficiens 1 26:104 684 

68 Pvc 1 Pc 2HL Purple veined lemma 1 26:105 132 

69 Gth 1 G 2HL Toothed lemma 1 26:106 309 

70 Rph1 Pa 2H Reaction to Puccinia hordei 1 26:107 1313 

71 com2 bir2 2HS Compositum 2 26:108 1703 

72 glo-c glo-c 2H Globosum-c 26:109 1329 

73 fol-a fol-a 2HL Angustifolium-a 26:110 1744 

74 flo-c flo-c 2HS Extra floret-c 26:111 1743 

75 Lks1 Lk 2HL Awnless 1 26:112 44 

76 Pre2 Re2, P 2HL Red lemma and pericarp 2 26:113 234 

77 hcm1 h 2HL Short culm 1 26:115 2492 

78 mtt4 mt,,e, mt 2HL Mottled leaf 4 26:116 1231 

79 wst7 rb 2HL White streak 7 37:207 247 

80 ant2 pr, rub 2HL Anthocyanin-less 2 26:118 1632 

81 gsh7 gs7 Glossy sheath 7 26:119 1759 

82 Zeo1 Knd 2HL Zeocriton 1 37:209 1613 

83 sld2 sld2 2HS Slender dwarf 2 26:121 2491 

84 mss1 mss 2H Midseason stripe 1 26:122 1404 


86 fch13 f13 Chlorina seedling 13 26:124 16 

159






88 Rph2 Pa2, A 5HS Reaction to Puccinia hordei 2 37:212 1593 

89 ari-g ari-g, lk10 Breviaristatum-g 26:128 1655 

90 ert-j ert-j 2H Erectoides-j 26:129 484 

91 ert-q ert-q 2H Erectoides-q 26:130 1562 

92 ert-u ert-u, br5 2H Erectoides-u 26:131 496 

93 ert-zd ert-zd, br7 2H Erectoides-zd 26:132 504 

94 abo4 a4 2H Albino seedling 4 26:133 167 

95 abo13 alb,,p 2HL Albino seedling 13 26:134 585 

96 Rph15 Rph16 2HS Reaction to Puccinia hordei 15 37:214 1586 

97 acr1 acr 2HL Accordion rachis 1 32: 85 1617 

98 Eam6 Ea6, Ea 2HS Early maturity 6 37:216 

99 lin1 s, rin 2HL Lesser internode number 1 32: 88 2492 

100 sld4 sld.d 7HS Slender dwarf 4 37:218 2479 

101 als1 als 3HL Absent lower laterals 1 37:219 1065 

102 uzu1 uz, u 3HL Uzu 1 or semi brachytic 1 37:220 1300 

104 yst1 yst, ys 3HS Yellow streak 1 26:138 1140 

105 xnt3 xc, vir-l 3HS Xantha seedling 3 26:139 66 

106 abo6 ac 3HS Albino seedling 6 26:140 30 

107 wst1 wst, wst3 3HL White streak 1 26:141 159 

108 alm1 al, ebu-a 3HS Albino lemma 1 37:222 270 

109 yst2 yst2 3HS Yellow streak 2 26:144 570 

111 dsp10 lc 3HS Dense spike 10 26:145 71 

112 abo9 an 3HS Albino seedling 9 26:146 348 

113 xnt6 xs 3HS Xantha seedling 6 26:147 117 

114 cur2 cu2 3HL Curly 2 26:148 274 

115 btr1 bt1 3HS Non-brittle rachis 1 26:149 1233 

116 btr2 bt2 3HS Non-brittle rachis 2 26:150 842 

117 fch2 f2, lg5 3HL Chlorina seedling 2 26:151 107 

118 lnt1 rnt, int-l 3HL Low number of tillers 1 26:153 833 

119 des2 ds 3H Desynapsis 2 26:154 593 

120 zeb1 zb 3HL Zebra stripe 1 26:155 1279 



123 Ryd2 Yd2 3HL Reaction to BYDV 2 26:158 1315 

124 vrs4 mul, int-e 3HL Six-rowed spike 4 26:159 775 

125 lzd1 lzd, dw4 3HS Lazy dwarf 1 26:161 1787 

126 sld1 dw1 3HL Slender dwarf 1 26:162 2488 

127 Pub1 Pub 3HL Pubescent leaf blade 1 26:163 1576 

128 sca1 sca 3HS Short crooked awn 1 26:164 2439 

160





129 wst6 wst,,j 3HL White streak 6 26:165 2500 

130 eam10 easp 3HL Early maturity 10 37:226 2504 

131 gra-a gran-a 3HL Granum-a 26:167 1757 

132 ari-a ari-a 3HS Breviaristatum-a 26:168 1648 

133 sdw2 sdw-b 3HL Semidwarf 2 26:169 2466 

134 ert-c ert-c 3HL Erectoides-c 26:170 471 

135 ert-ii ert-ii 3HL Erectoides-ii 26:172 483 


137 Rph10 Rph10 3HL Reaction to Puccinia hordei 10 26:174 1588 

138 nec4 nec4 3H Necrotic leaf spot 4 26:175 

139 nec5 nec5 3H Necrotic leaf spot 5 26:176 

140 xnt8 xan,,h 3HS Xantha seedling 8 26:177 582 

141 rym5 Ym 3HL Reaction to Barley yellow mosaic virus 5 32: 90 

142 brh8 brh.ad 3HS Brachytic 8 37:230 1671 

143 sex8 sex.j 3HS Shrunken endosperm 8 32: 93 2471 

144 sld5 sld5 3HS Slender dwarf 5 32: 94 2483 

146 cal-d cal-d 3H Calcaroides-d 32: 95 1697 

147 mov2 mo 3HS Multiovary 2 35:190 

148 brh14 brh.q 3HL Brachytic 14 37:231 1682 

149 Rpc1 3H Reaction to Puccinia coronata var. hordei 1 37:232 1601 

151 fch9 f9 4HS Chlorina seedling 9 26:178 571 

152 Kap1 K 4HS Hooded lemma 1 26:179 985 

155 glf1 gl, cer-zh 4HL Glossy leaf 1 37:233 98 

156 lbi2 lb2, ert-i 4HL Long basal rachis internode 2 26:183 572 

157 brh2 br2, ari-l 4HL Brachytic 2 37:235 573 

158 yhd1 yh 4HL Yellow head 1 26:185 574 

160 min2 en-min Enhancer of minute 1 26:186 266 

161 min1 min 4HL Semi-minute dwarf 1 26:187 987 

163 sgh1 sh1 4HL Spring growth habit 1 26:188 575 

164 Hln1 Hn 4HL Hairs on lemma nerves 1 26:189 576 

165 glf3 gl3, cer-j 4HL Glossy leaf 3 26:190 577 

166 msg25 msg,,r 4HL Male sterile genetic 25 26:192 744 

167 rym1 Ym 4HL Reaction to barley yellow mosaic virus 1 32: 96 

168 glo-a glo-a 4HS Globosum-a 26:194 1328 

170 lgn3 lg3 4HL Light green 3 26:195 171 

171 lgn4 lg4, lg9 4HL Light green 4 26:196 681 

172 lks5 lk5, ari-c 4HL Short awn 5 26:197 1297 

173 blx3 bl3 4HL Non-blue aleurone xenia 3 26:198 2506 

174 blx4 bl4 4HL Non-blue (pink) aleurone xenia 4 26:199 2507 

176 ovl1 ovl 4H Ovaryless 1 35:191 

161





178 int-c i, v5 4HS Intermedium spike-c 37:237 776 

179 Hsh1 Hs 4HL Hairy leaf sheath 1 37:240 986 

180 sid1 nls 4HL Single internode dwarf 1 26:203 2477 

181 eam9 ea,,c 4HL Early maturity 9 26:204 1732 

182 flo-a flo-a Extra floret-a 26:205 1741 

183 Ynd1 Yn 4HS Yellow node 1 32:98 

184 Zeo3 Zeo.h 4HL Zeocriton 3 32:99 1611 

185 brh5 brh.m 4HS Brachytic 5 37:242 1678 

186 sld3 ant17.567 4HS Slender dwarf 3 37:243 2480 

187 brh9 brh.k 4HS Brachytic 9 37:244 1676 


202 trd1 t, bra-c 1HL Third outer glume 1 26:207 227 

203 Blp1 B 1HL Black lemma and pericarp 1 37:245 988 

207 abo1 at 1HL Albino seedling 1 26:210 51 

208 fst2 fs2 1HL Fragile stem 2 26:211 578 

213 Sgh3 Sh3 1HL Spring growth habit 3 26:212 764 

214 eam8 eak, mat-a 1HL Early maturity 8 37:247 765 

215 des6 des6 1H Desynapsis 6 26:216 597 

218 Rph4 Pa4 1HS Reaction to Puccinia hordei 4 26:217 1314 

220 fch3 f3 1HS Chlorina seedling 3 26:218 851 

221 wst5 wst5 1HL White streak 5 26:219 591 

222 nec1 sp,,b 1HL Necrotic leaf spot 1 37:251 989 

223 zeb3 zb3, zbc 1HL Zebra stripe 3 26:221 1451 

224 ert-b ert-b 1HL Erectoides-b 26:222 470 

225 clh1 clh 1HL Curled leaf dwarf 1 26:223 1212 

226 rvl1 rvl 1HL Revoluted leaf 1 26:224 608 

227 sls1 sls 1HS Small lateral spikelet 1 26:225 2492 

228 Sil1 Sil 1HS Subcrown internode length 1 26:226 1604 

229 cud2 cud2 1HL Curly dwarf 2 26:227 1712 

230 glo-e glo-e 1HL Globosum-e 26:228 1755 

231 cur5 cu5 1HS Curly 5 26:229 1710 

232 Lys4 sex5 1HS High lysine 4 26:230 2475 

233 xnt7 xan,,g 1HL Xantha seedling 7 26:231 581 

234 mov3 mo-a 1H Multiovary 3 32:102 

235 lel1 lel 1HL Leafy lemma 1 32:103 1780 

251 mul2 mul2 6HL Multiflorus 2 26:232 1394 

252 eam7 ea7, ec 6HS Early maturity 7 26:233 579 

253 cul2 uc2 6HL Uniculm 2 37:253 531 

254 rob1 o, rob-o 6HS Orange lemma 1 37:255 707 

255 xnt5 xn 6HL Xantha seedling 5 26:237 43 

162





257 raw5 r,,e 6HL Smooth awn 5 26:238 785 

258 dsp9 l9, ert-e 6HL Dense spike 9 26:239 1774 


261 nec2 nec2 6HS Necrotic leaf spot 2 26:241 1224 

262 cur1 cu1 6HL Curly 1 26:242 1705 

263 cur3 cu3 6HL Curly 3 26:243 1707 

264 mtt5 mt,,f 6HL Mottled leaf 5 26:244 2410 

265 nec3 nec3 6HS Necrotic leaf spot 3 26:245 1330 

266 ert-e ert-e, dsp9 6HL Erectoides-e 37:257 477 


268 lax-b lax-b 6HL Laxatum-b 26:248 1776 

269 lys6 lys6 6H High lysine 6 26:249 1786 

270 abo14 alb,,q 6HL Albino seedling 14 26:250 586 

271 abo15 alb,,t 6HS Albino seedling 15 26:251 

301 fst1 fs 5HL Fragile stem 1 26:252 629 

302 mtt2 mt2 5HL Mottled leaf 2 26:253 1398 

303 var3 va3 5HL Variegated 3 26:254 1277 

304 wst2 wst2 5HL White streak 2 26:255 766 

305 crm1 cm 5HL Cream seedling 1 26:256 20 

306 var1 va 5HL Variegated 1 37:259 1278 

308 lbi1 lb, rac-a 5HL Long basal rachis internode 1 26:258 580 

309 Sgh2 Sh2 5HL Spring growth habit 2 26:259 770 

311 dex1 sex2 5HS Defective endosperm xenia 1 26:260 

312 raw1 r 5HL Smooth awn 1 26:261 27 

313 fch6 f6, yv 5HL Chlorina seedling 6 26:262 1390 

314 vrs2 v2 5HL Six-rowed spike 2 26:263 773 

315 vrs3 v3, int-a 1HL Six-rowed spike 3 26:264 774 

317 ddt1 ddt 5HS Reaction to DDT 1 26:266 331 

319 rpg4 rpg4 5HL Reaction to Puccinia graminis 4 26:267 2438 

320 int-b int-b 5HL Intermedium spike-b 26:268 1764 

321 srh1 s, l 5HL Short rachilla hair 1 26:269 27 

322 dsk1 dsk 5HL Dusky 1 26:270 1714 

323 nld1 nld 5HL Narrow leafed dwarf 1 26:271 769 

324 cud1 cud 5HL Curly dwarf 1 26:272 1711 

325 crl1 crl, cl Curly lateral 1 26:273 1211 

326 blf1 bb 5HL Broad leaf 1 26:274 1393 

327 flo-b flo-b 5HL Extra floret-b 26:275 1742 

328 ari-e ari-e 5HL Breviaristatum-e 26:276 1653 

329 ari-h ari-h 5HL Breviaristatum-h 26:277 1656 

330 ert-g ert-g, br3 5HL Erectoides-g 26:278 479 

163





331 ert-n ert-n 5HL Erectoides-n 26:279 488 

332 Ert-r Ert-r Erectoides-r 26:280 492 


334 raw6 r6 5HL Smooth awn 6 26:282 2437 

335 msg49 msg,,jw 5HL Male sterile genetic 49 26:283 2402 

336 glo-b glo-b 5HL Globosum-b 26:284 1326 

337 blf2 bb2, nlh 5HL Broad leaf 2 26:285 1667 

338 lys1 lys 5HL High lysine 1 26:286 1784 

339 lys3 sex3 5HL High lysine 3 26:287 1785 

340 raw2 r2 5HL Smooth awn 2 26:289 27 

341 abo12 alb,,o 5HS Albino seedling 12 26:290 583 

342 glo-f glo-e 5HL Globosum-f 26:291 

343 Lfb1 Lfb 5HL Leafy bract 1 28: 30 1577 

344 var2 va2 5HL Variegated 2 32:104 2496 

345 rym3 ym3 5HS Reaction to barley yellow mosaic virus 3 32:105 


347 mnd4 m4 5HL Many noded dwarf 4 32:108 1798 

348 Eam5 Ea5 5HL Early maturity 5 37:260 

349 brh4 brh.j 2HL Brachytic 4 37:262 1675 

350 brh6 brh.s 5HS Brachytic 6 37:263 1683 

351 gsh1 gs1, cer-q 2HS Glossy sheath 1 26:292 735 

352 gsh2 gs2, cer-b 3HL Glossy sheath 2 26:294 736 

353 gsh3 gs3, cer-a 7HS Glossy sheath 3 26:296 737 

354 gsh4 gs4, cer-x 6HL Glossy sheath 4 26:298 738 

355 gsh5 gs5, cer-s 2HL Glossy sheath 5 26:300 739 

356 gsh6 gs6, cer-c 2HS Glossy sheath 6 26:302 740 

357 msg1 ms1 1HL Male sterile genetic 1 26:304 1810 


359 msg3 ms3 2HS Male sterile genetic 3 26:307 1130 

360 msg4 ms4 1H Male sterile genetic 4 26:308 2392 







367 msg11 ms11 Male sterile genetic 11 26:315 1812 




164













379 seg3 se3 3H Shrunken endosperm genetic 3 37:265 752 



382 sex1 lys5 6HL Shrunken endosperm xenia 1 26:330 755 




386 des3 des3 Desynapsis 3 26:334 594 









395 msg26 msg,,u 7HS Male sterile genetic 26 26:343 745 


397 seg7 se7 Shrunken endosperm genetic 7 37:269 2468 

399 cer-d cer-d Eceriferum-d 26:346 425 

400 cer-e cer-e 1HL Eceriferum-e 26:347 1518 

401 cer-f cer-f 7HS Eceriferum-f 26:348 427 

402 cer-g cer-g 2HL Eceriferum-g 26:349 428 

403 cer-h cer-h Eceriferum-h 26:351 429 

404 cer-i cer-i 5HL Eceriferum-i 26:352 430 

405 cer-k cer-k 7HS Eceriferum-k 26:354 432 

406 cer-l cer-l Eceriferum-l 26:355 433 

407 cer-m cer-m Eceriferum-m 26:356 434 

408 cer-n gs9 2HL Eceriferum-n 26:357 435 

409 cer-o cer-o Eceriferum-o 26:359 436 

410 cer-p cer-p Eceriferum-p 26:360 437 

411 cer-r cer-r 3HL Eceriferum-r 26:361 439 

165





412 cer-t cer-t 5HL Eceriferum-t 26:362 441 

413 gsh8 cer-u, gs8 2HS Glossy sheath 8 26:364 442 

414 cer-v cer-v 2HS Eceriferum-v 26:366 443 

415 cer-w cer-w 5HL Eceriferum-w 26:367 1519 

417 cer-y cer-y Eceriferum-y 26:368 446 

418 cer-z cer-z 7HS Eceriferum-z 26:369 447 

419 cer-za cer-za 5HL Eceriferum-za 26:370 1521 

420 cer-zb cer-zb Eceriferum-zb 26:371 1522 

421 cer-zc cer-zc Eceriferum-zc 26:372 450 

422 cer-zd cer-zd 3HL Eceriferum-zd 26:373 451 

423 cer-ze gl5 7HS Eceriferum-ze 26:374 452 

424 cer-zf cer-zf Eceriferum-zf 26:376 453 

425 cer-zg cer-zg 4HL Eceriferum-zg 26:377 454 

427 cer-zi cer-zi 1HL Eceriferum-zi 26:378 456 

428 cer-zj cer-zj 5HL Eceriferum-zj 26:379 457 

429 cer-zk cer-zk 2H Eceriferum-zk 26:381 458 

430 cer-zl cer-zl Eceriferum-zl 26:382 459 

431 cer-zn cer-zn 3HL Eceriferum-zn 26:383 1523 

432 cer-zo cer-zo Eceriferum-zo 26:384 462 

433 cer-zp cer-zp 5HL Eceriferum-zp 26:385 463 

434 cer-zq cer-zq Eceriferum-zq 26:386 1524 

435 cer-zr cer-zr Eceriferum-zr 26:387 1525 

436 cer-zs cer-zs Eceriferum-zs 26:388 1526 

437 cer-zt cer-zt 2HS Eceriferum-zt 37:270 1527 

438 cer-zu cer-zu Eceriferum-zu 26:390 1528 

439 cer-zv cer-zv Eceriferum-zv 26:391 1529 

440 cer-zw cer-zw Eceriferum-zw 26:392 1530 

441 cer-zx cer-zx Eceriferum-zx 26:393 1531 

442 cer-zy cer-zy Eceriferum-zy 26:394 1532 

443 cer-zz cer-zz Eceriferum-zz 26:395 1533 

444 cer-ya cer-ya 3HS Eceriferum-ya 26:396 1534 

445 cer-yb cer-yb 2HL Eceriferum-yb 26:397 1535 

446 cer-yc cer-yc Eceriferum-yc 26:398 1536 

447 cer-yd cer-yd 3HS Eceriferum-yd 26:399 1537 

448 cer-ye cer-ye 5HL Eceriferum-ye 26:400 1538 

449 cer-yf cer-yf Eceriferum-yf 37:271 1539 

450 cer-yg cer-yg 7HS Eceriferum-yg 26:402 1540 

451 cer-yh cer-yh 3HS Eceriferum-yh 26:403 1541 

454 blx5 bl5 7HL Non-blue aleurone xenia 5 26:404 2509 

455 seg8 seg8 7H Shrunken endosperm genetic 8 37:272 2469 

166





460 cur4 cu4, glo-d 2HL Curly 4 26:406 1708 

461 zeb2 zb2, f10 4HL Zebra stripe 2 26:407 93 

462 yst3 yst,,c 3HS Yellow streak 3 26:409 48 

463 gig1 gig, sf 2H? Gigas 1 26:410 1650 

464 msg27 msg,,ae 2HL Male sterile genetic 27 26:411 2379 

465 msg28 msg,,as 6H Male sterile genetic 28 26:412 2380 

466 msg29 msg,,a 5HL Male sterile genetic 29 26:413 2381 

467 msg30 msg,,c 7HL Male sterile genetic 30 26:414 2382 

468 msg31 msg,,d 1HS Male sterile genetic 31 26:415 2383 

469 msg32 msg,,w 7H Male sterile genetic 32 26:416 2384 

470 msg33 msg,,x 2HS Male sterile genetic 33 26:417 2385 

471 msg34 msg,,av 6H Male sterile genetic 34 26:418 2386 

472 abr1 abr 2HL Accordion basal rachis internode 1 26:419 1563 

473 com1 bir1 5HL Compositum 1 26:420 1702 

474 lax-a lax-a 5HL Laxatum-a 37:273 1775 

475 lax-c lax-c 6HL Laxatum-c 26:423 1777 

498 msg35 msg,,dr 2HL Male sterile genetic 35 26:424 2387 

499 msg36 msg,,bk 6HS Male sterile genetic 36 26:425 2388 

500 msg37 msg,,hl Male sterile genetic 37 26:426 2389 

501 msg38 msg,,jl Male sterile genetic 38 26:427 2390 

502 msg39 msg,,dm 6H Male sterile genetic 39 26:428 2391 

503 msg40 msg,,ac 6H Male sterile genetic 40 26:429 2393 

504 msg41 msg,,aj Male sterile genetic 41 26:430 2394 

505 msg42 msg,,db 3H Male sterile genetic 42 26:431 2395 

506 msg43 msg,,br Male sterile genetic 43 26:432 2396 

507 msg44 msg,,cx Male sterile genetic 44 26:433 2397 

508 msg45 msg,,dp Male sterile genetic 45 26:434 2398 

509 msg46 msg,,ec Male sterile genetic 46 26:435 2399 

510 msg47 msg,,ep Male sterile genetic 47 26:436 2400 

511 Rpg1 T 7HS Reaction to Puccinia graminis 1 26:437 701 

512 Rpg2 T2 Reaction to Puccinia graminis 2 26:439 187 

513 xnt2 xb Xantha seedling 2 26:440 2 

515 Rsp1 Sep Reaction to Septoria passerinii 1 26:441 2510 

516 Rsp2 Sep2 Reaction to Septoria passerinii 2 37:275 2511 

517 Rsp3 Sep3 Reaction to Septoria passerinii 3 37:276 2512 

518 sdw1 denso 3HL Semidwarf 1 37:277 2513 

519 mnd1 m Many-noded dwarf 1 26:446 253 

520 msg48 msg,,jt 2H Male sterile genetic 48 26:447 2401 

521 mtt1 mt 1HS Mottled leaf 1 26:448 622 

522 cer-yi cer-yi Eceriferum-yi 26:449 1542 

167





523 cer-yj cer-yj Eceriferum-yj 26:450 1543 

524 cer-yk cer-yk Eceriferum-yk 26:451 1544 

525 cer-yl cer-yl Eceriferum-yl 26:452 1545 

526 cer-ym cer-ym Eceriferum-ym 26:453 1546 

527 cer-yn cer-yn Eceriferum-yn 26:454 1547 

528 cer-yo cer-yo Eceriferum-yo 26:455 1548 

529 cer-yp cer-yp Eceriferum-yp 26:456 1549 

530 cer-yq cer-yq Eceriferum-yq 26:457 1550 

531 cer-yr cer-yr Eceriferum-yr 26:458 1551 

532 cer-ys cer-ys Eceriferum-ys 26:459 1552 

533 cer-yt cer-yt Eceriferum-yt 26:460 1553 

534 cer-yu cer-yu Eceriferum-yu 26:461 1554 

535 cer-yx cer-yx Eceriferum-yx 26:462 1555 

536 Cer-yy Gle1 1HS Eceriferum-yy 26:463 1556 

537 cer-yz cer-yz Eceriferum-yz 26:464 1557 

538 cer-xa cer-xa Eceriferum-xa 26:465 1558 

539 cer-xb cer-xb Eceriferum-xb 26:466 1559 

540 cer-xc cer-xc Eceriferum-xc 26:467 1560 

541 cer-xd cer-xd Eceriferum-xd 26:468 1561 

542 Dwf2 Dwf2 Dominant dwarf 2 24:170 

543 int-f int-f Intermedium spike-f 26:469 1767 

544 int-h int-h Intermedium spike-h 26:470 1768 

545 int-i int-i Intermedium spike-i 26:471 1769 

546 int-k int-k 7H Intermedium spike-k 37:279 1770 

547 int-m int-m Intermedium spike-m 37:280 1772 

548 Fol-b Ang Angustifolium-b 26:474 17 

549 Lga1 Log Long glume awn 1 26:475 835 

550 ari-b ari-b Breviaristatum-b 26:476 1649 

551 ari-f ari-f Breviaristatum-f 26:477 1654 

552 ari-j ari-j Breviaristatum-j 26:478 1658 

553 ari-k ari-k Breviaristatum-k 26:479 1659 

554 ari-m ari-m Breviaristatum-m 26:480 1661 

555 ari-n ari-n Breviaristatum-n 26:481 1662 

556 ari-o ari-o Breviaristatum-o 26:482 

557 ari-p ari-p Breviaristatum-p 26:483 1664 

558 ari-q ari-q Breviaristatum-q 26:484 1665 

559 ari-r ari-r Breviaristatum-r 26:485 1666 

560 ert-f ert-f Erectoides-f 26:486 478 

561 ert-h ert-h Erectoides-h 26:487 481 

562 ert-k ert-k Erectoides-k 26:488 485 

168





563 ert-l ert-l Erectoides-l 26:489 486 

564 ert-p ert-p Erectoides-p 26:490 490 

565 ert-s ert-s Erectoides-s 26:491 493 

566 ert-t ert-t, brh3 2HS Erectoides-t 37:281 494 

567 ert-v ert-v Erectoides-v 26:493 497 

568 ert-x ert-x Erectoides-x 26:494 498 

569 ert-y ert-y Erectoides-y 26:495 499 

570 ert-z ert-z Erectoides-z 26:496 500 

571 ert-za ert-za Erectoides-za 26:497 501 

572 ert-zb ert-zb Erectoides-zb 26:498 502 

573 ert-zc ert-zc Erectoides-zc 26:499 503 

574 ert-ze ert-ze Erectoides-ze 26:500 505 

575 Rph6 Pa6 Reaction to Puccinia hordei 6 26:501 1598 

576 Rph8 Pa8 Reaction to Puccinia hordei 8 26:502 1600 

577 Rsg2 Rsg2 Reaction to Schizaphis graminum 2 37:283 2513 

578 mat-b mat-b Praematurum-b 26:504 1788 

579 mat-c mat-c Praematurum-c 26:506 1789 

580 mat-d mat-d Praematurum-d 26:507 1790 

581 mat-e mat-e Praematurum-e 26:508 1791 

582 mat-f mat-f Praematurum-f 26:509 1792 

583 mat-g mat-g Praematurum-g 26:510 1793 

584 mat-h mat-h Praematurum-h 26:511 1794 

585 mat-i mat-i Praematurum-i 26:512 1795 

586 bra-d bra-d 1HL Bracteatum-d 37:284 1696 

587 abo3 a2, alb-za Albino seedling 3 26:514 165 

588 abo10 at2 Albino seedling 10 26:515 57 

589 abo11 at3, alb t Albino seedling 11 26:516 233 

590 Rph13 Rph13 Reaction to Puccinia hordei 13 28: 31 1591 

591 Rph14 Rph14 Reaction to Puccinia hordei 14 28: 32 1592 

592 yhd2 yh2 Yellow head 2 28: 33 757 

593 adp1 adp Awned palea 1 37:285 1618 

594 ant3 rub Anthocyanin-deficient 3 29: 82 1641 

595 ant4 ant4 Anthocyanin-deficient 4 29: 83 1642 

596 ant5 rs2 Anthocyanin-deficient 5 29: 84 1643 

597 ant6 ant6 Anthocyanin-deficient 6 29: 85 1644 

598 ant13 ant13 6HL Proanthocyanin-free 13 29: 86 1624 

599 ant17 ant17 3HS Proanthocyanin-free 17 37:286 


601 ant19 ant19 Proanthocyanin-free 19 29: 92 1631 

602 ant20 ant20 Anthocyanin-rich 20 29: 93 1633 

169





603 ant21 ant21 6H Proanthocyanin-free 21 29: 94 1634 





608 ant28 ant28 3HL Proanthocyanin-free 28 29: 99 

609 ant29 ant29 Proanthocyanin-free 29 29:100 

610 ant30 ant30 Proanthocyanin-free 30 29:101 

611 Nec6 Sp Necrotic leaf spot 6 32:112 2424 

612 gig2 gig2 Gigas 2 32:113 1750 

613 brc1 brc-5 2HS Branched 1 32:114 

614 Zeo2 Zeo2 Zeocriton 2 32:115 637 

615 wxs1 wxs1 Waxy spike 1 32:116 

616 cul3 cul3 Uniculme 3 32:117 2494 

617 cul4 uc-5 3HL Uniculme 4 37:289 2493 

618 mnd3 mn3, m3 3H Many noded dwarf 3 32:119 1797 

619 bra-a bra-a 7HS Bracteatum-a 32:120 1693 

620 cal-b cal-b 5H Calcaroides-b 32:121 1697 

621 Cal-c Cal-c 5HL Calcaroides-c 32:122 1567 

622 cal-e cal-23 5HS Calcaroides-e 32:123 

623 eli-a lig-a Eligulum-a 37:290 

624 ops1 op-3 Opposite spikelets 1 32:125 2427 

625 sci-a sci-3 Scirpoides 1 32:126 

626 scl-a scl-6 Scirpoides leaf-a 32:127 

627 viv-a viv-5 Viviparoides-a 32:128 2498 

628 sex7 sex.i 5HL Shrunken endosperm 7 32:129 2470 

629 mtt6 mtt6 Mottled leaf 6 32:130 2411 

630 Ari-s ari-265 Breviaristatum-s 32:131 

631 brh3 brh.g, ert-t Brachytic 3 32:132 1672 

632 mnd5 mnd5 Many noded dwarf 5 32:133 

633 mnd6 den-6 5HL Many noded dwarf 6 37:291 1713 

634 pmr2 nec-50 Premature ripe 2 32:135 2421 

635 nec7 nec-45 Necroticans 7 32:136 2420 

636 tst2 lin2 Tip sterile 2 37:292 1781 

637 nar1 nar1 6HS NADH nitrate reductase-deficient 1 35:194 

638 nar2 nar2 5HL NADH nitrate reductase-deficient 2 35:195 





170







645 bsp1 bsp1 Bushy spike 1 35:202 

646 ovl2 ovl2 Ovaryless 2 35:204 

647 tst1 tst1 Tip sterile 1 35:205 

648 mov4 mo8 Multiovary 4 35:206 

649 asp1 asp1 Aborted spike 1 35:207 

650 sun1 sun1 Sensitivity to Ustilago nuda 1 35:208 

651 lam1 lam1 Late maturity 1 35:209 

652 ylf1 ylf1 Yellow leaf 1 35:210 

653 brh10 brh.l 2HS Brachytic 10 37:293 1677 

654 brh11 brh.n 5HS Brachytic 11 37:294 1679 

655 brh12 brh.o 5HS Brachytic 12 37:295 1680 

656 brh13 brh.p 5HS Brachytic 13 37:296 1681 

657 brh15 brh.u Brachytic 15 37:297 1685 

658 brh17 brh.ab 5HS Brachytic 17 37:298 1669 

659 brh18 brh.ac 5HS Brachytic 18 37:299 1670 

660 nld2 Narrow leafed dwarf 2 37:300 

661 dub1 5HL Double seed 1 37:301 

* Recommended locus symbols are based on utilization of a three-letter code for barley genes as 


Saskatoon, Saskatchewan, Canada, on 05 August 5 1996. 

† Chromosome numbers and arm designations are based on a resolution passed at the business 

meeting of the Seventh International Barley Genetics Symposium at Saskatoon, Saskatchewan, 

Canada, on August 05 1996. The Burnham and Hagberg (1956) designations of barley 

chromosomes were 1 2 3 4 5 6 and 7 while new designations based on the Triticeae system are 

7H 2H 3H 4H 1H 6H and 5H, respectively. 

‡ The seed stock associated with each BGS number is held as a GSHO stock number in the 

Barley Genetics Stock Collection at the USDA-ARS National Small Grains Germplasm 

Research Facility, Aberdeen, Idaho, USA. 

171


Table 3. An alphabetic listing of recently published Barley Genetic Stock (BGS) descriptions for 

loci in barley (Hordeum vulgare), including information on chromosomal locations, 

recommended locus names, and original cultivars. 

Locus symbol* BGS Chr. Locus name or phenotype Descr. Parental cultivar 

Rec. Prev. no. loc. † vol. p. 

abo1 at 207 1HL Albino seedling 1 26:210 Trebi 

abo2 a2 53 2HS Albino seedling 2 26:89 Nilsson-Ehle No 2 

abo3 alb-za 587 Albino seedling 3 26:514 Unknown cultivar 

abo4 a4 94 2H Albino seedling 4 26:133 Unknown cultivar 

abo6 ac 106 3HS Albino seedling 6 26:140 Colsess 

abo8 ac2 4 7HS Albino seedling 8 26:47 Coast 

abo9 an 112 3HS Albino seedling 9 26:146 Nigrinudum 

abo10 at2 588 Albino seedling 10 26:515 Canadian Thorpe 

abo11 at3 589 Albino seedling 11 26:516 Trebi 

abo12 alb,,o 341 5HS Albino seedling 12 26:290 Titan 

abo13 alb,,p 95 2HL Albino seedling 13 26:134 Titan 

abo14 alb,,q 270 6HL Albino seedling 14 26:250 Shabet 

abo15 alb,,t 271 6HS Albino seedling 15 26:251 Betzes 

abr1 abr 472 2HL Accordion basal rachis 26:419 Bonus 

internode 1 

acr1 acr 97 2HL Accordion rachis 1 32:85 Burma Girl 

adp1 adp 593 3HL Awned palea 1 37:285 Unknown cultivar 

alm1 al 108 3HS Albino lemma 1 37:222 Russia 82 

als1 als 101 3HL Absent lower laterals 1 37:219 Montcalm 

ant1 rs 33 7HS Anthocyanin-less 1 26:82 Bonus 

ant2 pr 80 2HL Anthocyanin-less 2 26:118 Foma 

ant3 594 Anthocyanin-deficient 3 29:82 Bonus 

ant4 595 Anthocyanin-deficient 4 29:83 Foma 

ant5 596 Anthocyanin-deficient 5 29:84 Bonus 

ant6 597 Anthocyanin-deficient 6 29:85 Foma 

ant13 598 6HL Proanthocyanidin-free 13 29:86 Foma 

ant17 599 3HS Proanthocyanidin-free 17 37:286 Nordal 

ant18 600 7HL Proanthocyanidin-free 18 29:90 Nordal 

ant19 601 Proanthocyanidin-free 19 29:92 Alf 

ant20 602 Anthocyanidin-rich 20 29:93 Foma 

ant21 603 6H Proanthocyanidin-free 21 29:94 Georgie 

ant22 604 7HS Proanthocyanidin-free 22 29:95 Hege 802 

ant25 605 Proanthocyanidin-free 25 29:96 Secobra 18193 

ant26 606 Proanthocyanidin-free 26 29.97 Grit 

ant27 607 Proanthocyanidin-free 27 29:98 Zebit 

ant28 608 3HL Proanthocyanidin-free 28 29:99 Grit 

ant29 609 Proanthocyanidin-free 29 29:100 Ca 708912 

ant30 610 Proanthocyanidin-free 30 29:101 Gunhild 

172





ari-a 132 3HS Breviaristatum-a 26:168 Bonus 

ari-b 550 Breviaristatum-b 26:476 Bonus 

ari-e 328 5HL Breviaristatum-e 26:276 Bonus 

ari-f 551 Breviaristatum-f 26:477 Bonus 

ari-g 89 Breviaristatum-g 26:128 Bonus 

ari-h 329 5HL Breviaristatum-h 26:277 Foma 

ari-j 552 Breviaristatum-j 26:478 Bonus 

ari-k 553 Breviaristatum-k 26:479 Bonus 

ari-m 554 Breviaristatum-m 26:480 Bonus 

ari-n 555 Breviaristatum-n 26:481 Bonus 

ari-o 556 Breviaristatum-o 26:482 Bonus 

ari-p 557 Breviaristatum-p 26:483 Foma 

ari-q 558 Breviaristatum-q 26:484 Kristina 

ari-r 559 Breviaristatum-r 26:485 Bonus 

Ari-s ari-265 630 Breviaristatum-s 32:131 Kristina 

asp1 649 Aborted spike 1 35:207 Steptoe 

blf1 bb 326 5HL Broad leaf 1 26:274 Bonus 

blf2 bb2 337 5HL Broad leaf 2 26:285 Hannchen 

Blp1 B 203 1HL Black lemma and pericarp 1 37:245 Nigrinudum 

blx1 bl 15 4HL Non-blue aleurone xenia 1 26:60 Goldfoil 

blx2 bl2 19 7HS Non-blue aleurone xenia 2 26:65 Nepal 

blx3 bl3 173 4HL Non-blue aleurone xenia 3 26:198 Blx 

blx4 bl4 174 4HL Non-blue (pink) aleurone 26:199 Ab 6 

xenia 4 

blx5 bl5 454 7HL Non-blue aleurone xenia 5 26:404 BGM 122 

bra-a 619 7HS Bracteatum-a 32:120 Bonus 

bra-d 586 1HS Bracteatum-d 37:284 Foma 

brc1 brc-5 613 2HS Branched 1 32:114 

brh1 br 1 7HS Brachytic 1 37:188 Himalaya 

brh2 br2 157 4HL Brachytic 2 37:235 Svanhals 

brh3 brh.g, ert-t 631 Brachytic 3 32:132 Birgitta 

brh4 brh.j 349 5HS Brachytic 4 37:262 Birgitta 

brh5 brh.m 185 4HS Brachytic 5 37:242 Birgitta 

brh6 brh.s 350 5HS Brachytic 6 37:263 Akashinriki 

brh7 brh.w 41 5HS Brachytic 7 37:203 Volla 

brh8 brh.ad 142 3HS Brachytic 8 37:230 Birgitta 

brh9 brh.k 187 4HS Brachytic 9 37:244 Birgitta 

brh10 brh.l 653 2HS Brachytic 10 37:293 Birgitta 

brh11 brh.n 654 5HS Brachytic 11 37:294 Birgitta 

brh12 brh.o 655 5HS Brachytic 12 37:295 Birgitta 

173





brh13 brh.p 656 5HS Brachytic 13 37:296 Birgitta 

brh14 brh.q 148 3HL Brachytic 14 37:231 Akashinriki 

brh15 brh.u 657 Brachytic 15 37:297 Julia 

brh16 brh.v 44 7HL Brachytic 16 37:204 Korál 

brh17 brh.ab 658 5HS Brachytic 17 37:298 Morex 

brh18 Brh.ac 659 5HS Brachytic 18 37:299 Triumph 

bsp1 645 Bushy spike 1 35:203 Morex 

btr1 bt 115 3HS Non-brittle rachis 1 26:149 A 222 

btr2 bt2 116 3HS Non-brittle rachis 2 26:150 Sakigoke 

cal-b 620 5H Calcaroides-b 32:121 Bonus 

Cal-c 621 5HL Calcaroides-c 32:122 Bonus 

cal-d 146 3H Calcaroides-d 32:95 Foma 

cal-e 622 5HS Calcaroides-e 32:123 Semira 

cer-d 399 Eceriferum-d + ++ ++ 26:346 Bonus 

cer-e 400 1HL Eceriferum-e -/+ ++ ++ 26:347 Bonus 

cer-f 401 7HS Eceriferum-f + + ++ 26:348 Bonus 

cer-g 402 2HL Eceriferum-g + + ++ 26:349 Bonus 

cer-h 403 Eceriferum-h - ++ ++ 26:351 Bonus 

cer-i 404 5HL Eceriferum-i - ++ ++ 26:352 Bonus 

cer-k 405 7HS Eceriferum-k + ++ ++ 26:354 Bonus 

cer-l 406 Eceriferum-l + ++ ++ 26:355 Bonus 

cer-m 407 Eceriferum-m +/++ + ++ 26:356 Bonus 

cer-n gs9 408 2HL Eceriferum-n - - ++ & 26:357 Bonus 

- +/- ++ 

cer-o 409 Eceriferum-o -/+ ++ ++ 26:359 Bonus 

cer-p 410 Eceriferum-p ++ ++ + 26:360 Bonus 

cer-r 411 3HL Eceriferum-r +/- + ++ 26:361 Bonus 

cer-t 412 5HL Eceriferum-t +/- ++ ++ 26:362 Bonus 

cer-v 414 2HS Eceriferum-v +/- ++ ++ 26:366 Bonus 

cer-w 415 5HL Eceriferum-w +/- ++ ++ 26:367 Bonus 

cer-y 417 Eceriferum-y + +/++ ++ 26:368 Bonus 

cer-z 418 7HS Eceriferum-z - - ++ 26:369 Bonus 

cer-za 419 5HL Eceriferum-za ++ ++ - 26:370 Foma 

cer-zb 420 Eceriferum-zb - ++ ++ 26:371 Bonus 

cer-zc 421 Eceriferum-zc +/- ++ ++ 26:372 Bonus 

cer-zd 422 3HL Eceriferum-zd ++ ++ - 26:373 Bonus 

cer-ze gl5 423 7HS Eceriferum-ze ++ ++ - 26:374 Bonus 

cer-zf 424 Eceriferum-zf ++ ++ + 26:376 Bonus 

cer-zg 425 4HL Eceriferum-zg ++ ++ + 26:377 Foma 

cer-zi 427 1HL Eceriferum-zi + + ++ 26:378 Bonus 

174





cer-zj 428 5HL Eceriferum-zj ++ ++ - 26:379 Bonus 

cer-zk 429 2H Eceriferum-zk + + +/- 26:381 Bonus 

cer-zl 430 Eceriferum-zl - - ++ 26:382 Bonus 

cer-zn 431 3HL Eceriferum-zn +/- ++ ++ 26:383 Foma 

cer-zo 432 Eceriferum-zo - ++ ++ 26:384 Foma 

cer-zp 433 5HL Eceriferum-zp ++ ++ - 26:385 Bonus 

cer-zq 434 Eceriferum-zq ++ ++ - 26:386 Foma 

cer-zr 435 Eceriferum-zr +/- ++ ++ 26:387 Foma 

cer-zs 436 Eceriferum-zs + ++ ++ 26:388 Foma 

cer-zt 437 2HS Eceriferum-zt + ++ ++ 37:270 Foma 

cer-zu 438 Eceriferum-zu - + ++ 26:390 Bonus 

cer-zv 439 Eceriferum-zv - - - 26:391 Foma 

cer-zw 440 Eceriferum-zw + + ++ 26:392 Foma 

cer-zx 441 Eceriferum-zx + + ++ 26:393 Bonus 

cer-zy 442 Eceriferum-zy ++ ++ + 26:394 Bonus 

cer-zz 443 Eceriferum-zz ++ ++ - 26:395 Bonus 

cer-ya 444 3HS Eceriferum-ya ++ ++ - 26:396 Bonus 

cer-yb 445 2HL Eceriferum-yb ++ ++ - 26:397 Bonus 

cer-yc 446 Eceriferum-yc - ++ ++ 26:398 Bonus 

cer-yd 447 3HS Eceriferum-yd - ++ ++ 26:399 Bonus 

cer-ye 448 5HL Eceriferum-ye ++ ++ - 26:400 Foma 

cer-yf 449 Eceriferum-yf ++ ++ + 37:271 Bonus 

cer-yg 450 7HS Eceriferum-yg - - - 26:402 Carlsberg II 

cer-yh 451 3HS Eceriferum-yh - ++ ++ 26:403 Bonus 

cer-yi 522 Eceriferum-yi ++ ++ - 26:449 Foma 

cer-yj 523 Eceriferum-yj ++ ++ - 26:450 Bonus 

cer-yk 524 Eceriferum-yk + + ++ 26:451 Bonus 

cer-yl 525 Eceriferum-yl - - ++ 26:452 Bonus 

cer-ym 526 Eceriferum-ym - - - 26:453 Bonus 

cer-yn 527 Eceriferum-yn + + ++ 26:454 Kristina 

cer-yo 528 Eceriferum-yo ++ ++ + 26:455 Bonus 

cer-yp 529 Eceriferum-yp ++ ++ + 26:456 Bonus 

cer-yq 530 Eceriferum-yq ++ ++ - 26:457 Kristina 

cer-yr 531 Eceriferum-yr -/+ + ++ 26:458 Foma 

cer-ys 532 Eceriferum-ys ++ ++ - 26:459 Bonus 

cer-yt 533 Eceriferum-yt - ++ ++ 26:460 Bonus 

cer-yu 534 Eceriferum-yu ++ ++ - 26:461 Bonus 

cer-yx 535 Eceriferum-yx + + ++ 26:462 Foma 

Cer-yy Gle1 536 1HS Eceriferum-yy - ++ ++ 26:463 Bonus 

cer-yz 537 Eceriferum-yz + + ++ 26:464 Bonus 

175





cer-xa 538 Eceriferum-xa ++ ++ - 26:465 Foma 

cer-xb 539 Eceriferum-xb - ++ ++ 26:466 Bonus 

cer-xc 540 Eceriferum-xc + + ++ 26:467 Bonus 

cer-xd 541 Eceriferum-xd + + ++ 26:468 Bonus 

clh1 clh 225 1HL Curled leaf dwarf 1 26:223 Hannchen 

com1 bir1 473 5HL Compositum 1 26:420 Foma 

com2 bir2 71 2HS Compositum 2 26:108 CIMMYT freak 

crl1 cl 325 Curly lateral 1 26:273 Montcalm 

crm1 cm 305 5HL Cream seedling 1 26:256 Black Hulless 

cud1 cud 324 5HL Curly dwarf 1 26:272 Akashinriki 

cud2 229 1HL Curly dwarf 2 26:227 Akashinriki 

cul2 uc2 253 6HL Uniculm 2 37:253 Kindred 

cul3 616 Uniculme 3 32:117 Donaria 

cul4 uc-5 617 3HL Uniculme 4 37:289 Bonus 

cur1 cu1 262 6HL Curly 1 26:242 48-cr cr-17 

cur2 cu2 114 3HL Curly 2 26:148 Choshiro 

cur3 cu3 263 6HL Curly 3 26:243 Akashinriki 

cur4 cu4 460 2HL Curly 4 26:406 Asahi 5 

cur5 cu5 231 1HS Curly 5 26:229 Glenn 

ddt1 ddt 317 5HS Reaction to DDT 1 26:266 Spartan 

des1 lc 12 7H Desynapsis 1 26:57 Mars 

des2 ds 119 3H Desynapsis 2 26:154 Husky 

des3 386 Desynapsis 3 26:334 Betzes 

des4 13 7H Desynapsis 4 26:58 Betzes 











des15 394 Desynapsis 15 26:342 Ingrid 

dex1 sex2 311 5HS Defective endosperm xenia 1 26:260 BTT 63-j-18-17 

dsk1 dsk 322 5HL Dusky 1 26:270 Chikurin-Ibaraki 1 

dsp1 l 9 7HS Dense spike 1 26:53 Honen 6 

dsp9 l9, ert-e 258 6HL Dense spike 9 26:239 Akashinriki 

176





dsp10 lc 111 3HS Dense spike 10 26:145 Club Mariout 

dub1 661 6HL Double seed 1 37:301 Bonus 

Dwf2 542 Dominant dwarf 2 24:170 Klages/Mata 

Eam1 Ea 65 2HS Early maturity 1 26:101 Estate 

Eam5 Ea5 348 5HL Early maturity 5 37:260 Higuerilla*2/ 

Gobernadora 

eam6 Ea6, Ea 98 2HS Early maturity 6 37:216 Morex 

eam7 ea7 252 6HS Early maturity 7 26:233 California Mariout 

eam8 eak, ert-o 214 1HL Early maturity 8 37:247 Kinai 5 

eam9 ea,,c 181 4HL Early maturity 9 26:204 Tayeh 8 

eam10 easp 130 3HL Early maturity 10 37:226 Super Precoz 

eli-a lig-a 623 Eligulum-a 37:290 Foma 

eog 1 e 57 2HL Elongated outer glume 1 26:92 Triple Bearded 

Club Mariout 

ert-a ert-6 28 7HS Erectoides-a 26:74 Gull 

ert-b ert-2 224 1HS Erectoides-b 26:222 Gull 

ert-c ert-1 134 3HL Erectoides-c 26:170 Gull 

ert-d ert-7 29 7HS Erectoides-d 26:76 Gull 

ert-e dsp9 266 6HL Erectoides-e 37:257 Bonus 

ert-f ert-18 560 Erectoides-f 26:486 Bonus 

ert-g ert-24 330 5HL Erectoides-g 26:278 Bonus 

ert-h ert-25 561 Erectoides-h 26:487 Bonus 

ert-ii ert-79 135 3HL Erectoides-ii 26:172 Bonus 

ert-j ert.31 90 2H Erectoides-j 26:129 Bonus 

ert-k ert-32 562 Erectoides-k 26:488 Bonus 

ert-l ert-12 563 Erectoides-l 26:489 Maja 

ert-m ert-34 30 7HS Erectoides-m 26:78 Bonus 

ert-n ert-51 331 5HL Erectoides-n 26:279 Bonus 

ert-p ert-44 564 Erectoides-p 26:490 Bonus 

ert-q ert-101 91 2H Erectoides-q 26:130 Bonus 

Ert-r Ert-52 332 Erectoides-r 26:280 Bonus 

ert-s ert-50 565 Erectoides-s 26:491 Bonus 

ert-t brh3 566 2HS Erectoides-t 37:281 Bonus 

ert-u ert-56 92 2H Erectoides-u 26:131 Bonus 

ert-v ert-57 567 Erectoides-v 26:493 Bonus 

ert-x ert-58 568 Erectoides-x 26:494 Bonus 

ert-y ert-69 569 Erectoides-y 26:495 Bonus 

ert-z ert-71 570 Erectoides-z 26:496 Bonus 

ert-za ert-102 571 Erectoides-za 26:497 Bonus 

ert-zb ert-132 572 Erectoides-zb 26:498 Bonus 

177





ert-zc ert-149 573 Erectoides-zc 26:499 Bonus 

ert-zd ert-159 93 2H Erectoides-zd 26:132 Bonus 

ert-ze ert-105 574 Erectoides-ze 26:500 Bonus 

fch1 f 55 2HS Chlorina seedling 1 26:90 Minn 84-7 

fch2 f2 117 3HL Chlorina seedling 2 26:151 28-3398 

fch3 f3 220 1HS Chlorina seedling 3 26:218 Minn 89-4 

fch4 f4 17 7HL Chlorina seedling 4 26:63 Montcalm 

fch5 f5 18 7HS Chlorina seedling 5 26:64 Gateway 

fch6 f6 313 5HL Chlorina seedling 6 26:262 Himalaya 

fch7 f7 201 1HL Chlorina seedling 7 26:206 Smyrna 

fch8 f8 5 7HS Chlorina seedling 8 26:48 Comfort 

fch9 f9 151 4HS Chlorina seedling 9 26:178 Ko A 

fch11 f11 260 6HL Chlorina seedling 11 26:240 Himalaya 

fch12 fc 2 7HS Chlorina seedling 12 37:190 Colsess 

fch13 f13 86 Chlorina seedling 13 26:124 Niggrinudum 

fch14 f14 87 2HL Chlorina seedling 14 37:211 Shyri 

fch15 or 52 2HS Chlorina seedling 15 26:88 Trebi IV 

flo-a 182 Extra floret-a 26:205 Foma 

flo-b 327 5HL Extra floret-b 26:275 Foma 

flo-c 74 2HS Extra floret-c 26:111 Foma 

fol-a 73 2HL Angustifolium-a 26:110 Proctor 

Fol-b Ang 548 Angustifolium-b 26:474 Unknown 

fst1 fs 301 5HL Fragile stem 1 26:252 Kamairazu 

fst2 fs2 208 1HL Fragile stem 2 26:211 Oshichi 

fst3 fs3 24 7HS Fragile stem 3 26:70 Kobinkatagi 4 

gig1 gig 463 2H? Gigas 1 26:410 Tochigi Golden 

Melon 

gig2 612 Gigas 2 32:113 ND12463 

glf1 gl 155 4HL Glossy leaf 1 ++ ++ - 37:233 Himalaya 

glf3 gl3 165 4HL Glossy leaf 3 ++ ++ - 26:190 Goseshikoku 

glo-a 168 4HS Globosum-a 26:194 Proctor 

glo-b 336 5HL Globosum-b 26:284 Villa 

glo-c 72 2H Globosum-c 26:109 Villa 

glo-e 230 1HL Globosum-e 26:228 Foma 

glo-f 342 5HL Globosum-f 26:291 Damazy 

gpa1 gp 59 2HL Grandpa 1 26:95 Lyallpur 

gra-a gran-a 131 3HL Granum-a 26:167 Donaria 

gsh1 gs1 351 2HS Glossy sheath 1 - - ++ 26:292 CIho 5818 

gsh2 gs2 352 3HL Glossy sheath 2 - - ++ 26:294 Atlas 

gsh3 gs3 353 7HS Glossy sheath 3 - - ++ 26:296 Mars 

178





gsh4 gs4 354 6HL Glossy sheath 4 - - ++ 26:298 Gateway 

gsh5 gs5 355 2HL Glossy sheath 5 + - ++ 26:300 Jotun 

gsh6 gs6 356 2HS Glossy sheath 6 - - ++ 26:302 Betzes 

gsh7 gs7 81 Glossy sheath 7 - - ++ 26:119 Akashinriki 

gsh8 cer-u 413 2HS Glossy sheath 8 + + ++ 26:364 Bonus 

Gth1 G 69 2HL Toothed lemma 1 26:106 Machine 

(Wexelsen) 

hcm1 h 77 2HL Short culm 1 26:115 Morex 

Hln1 Hn 164 4HL Hairs on lemma nerves 1 26:189 Kogane-mugi 

Hsh1 Hs 179 4HL Hairy leaf sheath 1 37:240 Kimugi 

int-b 320 5HL Intermedium spike-b 26:268 Bonus 

int-c i 178 4HS Intermedium spike-c 37:237 Gamma 4 

int-f 543 Intermedium spike-f 26:469 Foma 

int-h 544 Intermedium spike-h 26:470 Kristina 

int-i 545 Intermedium spike-i 26:471 Kristina 

int-k 546 7H Intermedium spike-k 37:279 Kristina 

int-m 547 Intermedium spike-m 37:280 Bonus 

Kap1 K 152 4HS Hooded lemma 1 26:179 Colsess 

lam1 651 Late maturity 1 35:209 Steptoe 

lax-a 474 5HL Laxatum-a 37:273 Bonus 

lax-b 268 6HL Laxatum-b 26:248 Bonus 

lax-c 475 6HL Laxatum-c 26:423 Bonus 

lbi1 lb 308 5HL Long basal rachis internode 

1 

26:258 Wisconsin 38 

lbi2 lb2 156 4HL Long basal rachis internode 

2 

26:183 Montcalm 

lbi3 lb3 27 7HL Long basal rachis internode 26:73 Montcalm 

3 

lel1 lel 235 1HL Leafy lemma 1 32:103 G7118 

Lfb1 Lfb 343 5HL Leafy bract 1 28:30 Montcalm 

Lga1 Log 549 Long glume awn 1 26:475 Guy Mayle 

lgn3 lg3 170 4HL Light green 3 26:195 No 154 

lgn4 lg4 171 4HL Light green 4 26:196 Himalaya / 

Ingrescens 

lig1 li 60 2HL Liguleless 1 37:205 Muyoji 

lin1 s, rin 99 2HL Lesser internode number 1 32:88 Natural occurence 

Lks1 Lk 75 2HL Awnless 1 26:112 Hordeum inerme 

lks2 lk2 10 7HL Short awn 2 37:197 Honen 6 

lks5 lk5 172 4HL Short awn 5 26:197 CIho 5641 

lnt1 lnt 118 3HL Low number of tillers 1 26:153 Mitake 

179





lys1 lys 338 5HL High lysine 1 26:286 Hiproly 

lys3 sex3 339 5HL High lysine 3 26:287 Bomi 

Lys4 sex5 232 1HS High lysine 4 26:230 Bomi 

lys6 269 6H High lysine 6 26:249 Bomi 

lzd1 lzd 125 3HS Lazy dwarf 1 26:161 Akashinriki 

mat-b 578 Praematurum-b 26:504 Bonus 

mat-c 579 Praematurum-c 26:506 Bonus 

mat-d 580 Praematurum-d 26:507 Bonus 

mat-e 581 Praematurum-e 26:508 Bonus 

mat-f 582 Praematurum-f 26:509 Bonus 

mat-g 583 Praematurum-g 26:510 Bonus 

mat-h 584 Praematurum-h 26:511 Bonus 

mat-i 585 Praematurum-i 26:512 Bonus 

min1 min 161 4HL Semi-minute dwarf 1 26:187 Taisho-mugi 

min2 en-min 160 Enhancer of minute 1 26:186 Kaiyo Bozu 

mnd1 m 519 Many-noded dwarf 1 26:446 Mesa 

mnd3 m3 618 3H Many noded dwarf 3 32:119 Montcalm 

mnd4 m4 347 5HL Many noded dwarf 4 32:108 Akashinriki 

mnd5 632 Many noded dwarf 5 32:133 C2-95-199 

mnd6 den-6 633 5HL Many noded dwarf 6 37:291 Bonus 

mov1 mo6b 43 7HL Multiovary 1 35:185 Steptoe 

mov2 mo7a 147 3HS Multiovary 2 35:190 Steptoe 

mov3 mo-a 234 1H Multiovary 3 32:102 Akashinriki 

mov4 648 Multiovary 4 35:206 Steptoe 

msg1 357 1HL Male sterile genetic 1 26:304 CIho 5368 

msg2 358 2HL Male sterile genetic 2 26:306 Manchuria 

msg3 359 2HS Male sterile genetic 3 26:307 Gateway 

msg4 360 1H Male sterile genetic 4 26:308 Freja 

msg5 361 3HS Male sterile genetic 5 26:309 Carlsberg II 

msg6 362 6HS Male sterile genetic 6 26:310 Hanna 

msg7 363 5HL Male sterile genetic 7 26:311 Dekap 

msg8 364 5HL Male sterile genetic 8 26:312 Betzes 

msg9 365 2HS Male sterile genetic 9 26:313 Vantage 

msg10 366 7HS Male sterile genetic 10 26:314 Compana 

msg11 367 Male sterile genetic 11 26:315 Gateway 

msg13 368 Male sterile genetic 13 26:316 Haisa II 

msg14 369 7HS Male sterile genetic 14 26:317 Unitan 

msg15 370 Male sterile genetic 15 26:318 Atlas/2*Kindred 

msg16 371 5HS Male sterile genetic 16 26:319 Betzes 

msg17 372 Male sterile genetic 17 26:320 Compana 

180





msg18 373 5HL Male sterile genetic 18 26:321 Compana 

msg19 374 5HS Male sterile genetic 19 26:322 CIho 14393 

msg20 375 1H Male sterile genetic 20 26:323 Hannchen 

msg21 376 Male sterile genetic 21 26:324 Midwest Bulk 

msg22 383 7H Male sterile genetic 22 26:331 Glacier/Compana 




msg26 395 7HS Male sterile genetic 26 26:343 Unitan 

msg27 464 2HL Male sterile genetic 27 26:411 Firlbecks III 

msg28 465 6H Male sterile genetic 28 26:412 York 

msg29 466 5HL Male sterile genetic 29 26:413 Ackermans MGZ 

msg30 467 7HL Male sterile genetic 30 26:414 Compana 

msg31 468 1HS Male sterile genetic 31 26:415 51Ab4834 

msg32 469 7H Male sterile genetic 32 26:416 Betzes 


msg34 471 6H Male sterile genetic 34 26:418 Paragon 

msg35 498 2HL Male sterile genetic 35 26:424 Karl 


msg37 500 Male sterile genetic 37 26:426 Clermont 

msg38 501 Male sterile genetic 38 26:427 Ingrid 

msg39 502 6H Male sterile genetic 39 26:428 CIho 15836 

msg40 503 6H Male sterile genetic 40 26:429 Conquest 

msg41 504 Male sterile genetic 41 26:430 Betzes 

msg42 505 3H Male sterile genetic 42 26:431 Betzes 

msg43 506 Male sterile genetic 43 26:432 Betzes 

msg44 507 Male sterile genetic 44 26:433 HA6-33-02 

msg45 508 Male sterile genetic 45 26:434 RPB439-71 

msg46 509 Male sterile genetic 46 26:435 Hector 

msg47 510 Male sterile genetic 47 26:436 Sel 12384CO 

msg48 520 2H Male sterile genetic 48 26:447 Simba 

msg49 335 5HL Male sterile genetic 49 26:283 ND7369 

msg50 34 7HL Male sterile genetic 50 26:83 Berac 

mss1 mss 84 2H Midseason stripe 1 26:122 Montcalm 

mss2 39 7HS Midseason stripe 2 32:79 ND11258 

mtt1 mt 521 1HS Mottled leaf 1 26:448 Montcalm 

mtt2 mt2 302 5HL Mottled leaf 2 26:253 Montcalm 

mtt4 mt,,e 78 2HL Mottled leaf 4 26:116 Victorie 

mtt5 mt,,f 264 6HL Mottled leaf 5 26:244 Akashinriki 

mtt6 629 Mottled leaf 6 32:130 ND6809 

181





mul2 251 6HL Multiflorus 2 26:232 Montcalm 

nar1 637 6HS NADH ntrate reductasedeficient 

1 

35:194 Steptoe 

nar2 638 5HL NADH ntrate reductasedeficient 

2 



3 

35:197 Winer 


4 



5 



6 



7 



8 


nec1 222 1HL Necrotic leaf spot 1 37:251 Carlsberg II 

nec2 261 6HS Necrotic leaf spot 2 26:241 Carlsberg II 

nec3 265 6HS Necrotic leaf spot 3 26:245 Proctor 

nec4 138 3H Necrotic leaf spot 4 26:175 Proctor 

nec5 139 3H Necrotic leaf spot 5 26:176 Diamant 

Nec6 Sp 611 Necrotic leaf spot 6 32:112 Awnless Atlas 

nec7 nec-45 635 Necroticans 7 32:136 Kristina 

nld1 nld 323 5HL Narrow leafed dwarf 1 26:271 Nagaoka 

nld2 660 Narrow leafed dwarf 2 37:300 Steptoe 

nud1 n, nud 7 7HL Naked caryopsis 1 37:195 Himalaya 

ops1 op-3 624 Opposite spikelets 1 32:125 Bonus 

ovl1 176 4H Ovaryless 1 35:191 Kanto Bansei Gold 

ovl2 646 Ovaryless 2 35:204 Harrington 

pmr1 pmr 40 7HS Premature ripe 1 32:80 Glenn 

pmr2 nec-50 634 Premature ripe 2 32:135 Bonus 

Pre2 Re2 76 2HL Red lemma and pericarp 2 26:113 Buckley 3277 

Pub1 Pub 127 3HL Pubescent leaf blade 1 26:163 Multiple Dominant 

Pvc1 Pc 68 2HL Purple veined lemma 1 26:105 Buckley 2223-6 

Pyr1 42 7HS Pyramidatum 1 32:82 Pokko/Hja80001 

raw1 r 312 5HL Smooth awn 1 26:261 Lion 

raw2 r2 340 5HL Smooth awn 2 26:289 Lion 

raw5 r,,e 257 6HL Smooth awn 5 26:238 Akashinriki 

raw6 r6 334 5HL Smooth awn 6 26:282 Glenn 

182





rob1 o 254 6HS Orange lemma 1 37:255 CIho 5649 

Rpc1 149 3H Reaction to Puccinia 

coronata var. hordei 1 

37:232 Hor 2596 

Rpg1 T 511 7HS Reaction to Puccinia 

graminis 1 

26:437 Chevron 

Rpg2 T2 512 Reaction to Puccinia 

graminis 2 

26:439 Hietpas 5 

rpg4 319 5HL Reaction to Puccinia 

graminis 4 

26:267 Q21861 

Rph1 Pa 70 2H Reaction to Puccinia hordei 

1 

26:107 Oderbrucker 

Rph2 Pa2 88 5HS Reaction to Puccinia hordei 

2 

37:212 Peruvian 

Rph3 Pa3 121 7HL Reaction to Puccinia hordei 

3 

26:156 Estate 


4 

26:217 Gull 


5 

37:224 Magnif 102 


6 

26:501 Bolivia 


7 

37:228 Cebada Capa 

Rph8 Pa8 576 Reaction to Puccinia hordei 

8 

26:502 Egypt 4 

Rph9 Pa9 32 5HL Reaction to Puccinia hordei 

9 

37:201 HOR 2596 

Rph10 137 3HL Reaction to Puccinia hordei 

10 

26:174 Clipper C8 


11 

26:247 Clipper C67 


12 

26:281 Triumph 

Rph13 590 Reaction to Puccinia hordei 

13 

28:31 PI 531849 

Rph14 591 Reaction to Puccinia hordei 

14 

28:32 PI 584760 

Rph15 Rph16 96 2HL Reaction to Puccinia hordei 

15 

37:214 PI 355447 

183





Rsg1 Grb 22 7H Reaction to Schizaphis 

graminum 1 

37:199 Omugi 

Rsg2 577 Reaction to Schizaphis 

graminum 2 

37:283 PI 426756 

rsm1 sm 35 7HS Reaction to BSMV 1 26:84 Modjo 1 

Rsp1 Sep 515 Reaction to Septoria 

passerinii 1 

26:441 CIho 14300 

Rsp2 Sep2 516 Reaction to Septoria 

passerinii 2 

37:275 PI 70837 

Rsp3 Sep3 517 Reaction to Septoria 

passerinii 3 

37:276 CIho 10644 

rtt1 rt 51 2HS Rattail spike 1 26:87 Goldfoil 

Run1 Un 21 7HS Reaction to Ustilago nuda 1 26:67 Trebi 

rvl1 rvl 226 1HL Revoluted leaf 1 26:224 Hakata 2 

Ryd2 Yd2 123 3HL Reaction to BYDV 2 26:158 CIho 2376 

Rym1 Ym 167 4HL Reaction to BaYMV 1 32:96 Mokusekko 3 

Rym2 Ym2 20 7HL Reaction to BaYMV 2 26:66 Mihori Hadaka 3 

rym3 ym3 345 5HS Reaction to BaYMV 3 32:105 Chikurin Ibaraki 

rym5 Ym 141 3HL Reaction to BaYMV 5 32:90 Mokusekko 3 

sbk1 sk, cal-a 62 2HS Subjacent hood 1 32:83 Tayeh 13 

sca1 sca 128 3HS Short crooked awn 1 26:164 Akashinriki 

sci-a sci-3 625 Scirpoides-a 32:126 Bonus 

scl-a scl-6 626 Scirpoides leaf-a 32:127 Foma 

sdw1 sdw 518 3HL Semidwarf 1 37:277 M21 

sdw2 sdw-b 133 3HL Semidwarf 2 26:169 Mg2170 

seg1 se1 377 7HL Shrunken endosperm genetic 

1 

37:264 Betzes 

seg2 se2 378 7HS Shrunken endosperm genetic 

2 

26:326 Betzes 

seg3 se3 379 3H Shrunken endosperm genetic 

3 

37:265 Compana 


4 

37:267 Compana 

seg5 se5 381 7HS Shrunken endosperm genetic 

5 

26:329 Sermo/7*Glacier 


6 

37:268 Ingrid 

seg7 se7 397 Shrunken endosperm genetic 

7 

37:269 Ingrid 

184





seg8 455 7H Shrunken endosperm genetic 

8 

37:272 60Ab1810-53 

sex1 lys5 382 6HL Shrunken endosperm xenia 1 26:330 Compana 

sex6 31 7HS Shrunken endosperm xenia 6 26:80 K6827 

sex7 sex.i 628 5HL Shrunken endosperm xenia 7 32:129 I90-374 

sex8 sex.j 143 6HS Shrunken endosperm xenia 8 32:93 I89-633 

sgh1 sh1 163 4HL Spring growth habit 1 26:188 Iwate Mensury C 

Sgh2 Sh2 309 5HL Spring growth habit 2 26:259 Indian Barley 

Sgh3 Sh3 213 1HL Spring growth habit 3 26:212 Tammi/Hayakiso 2 

sid1 nls 180 4HL Single internode dwarf 1 26:203 Akashinriki 

Sil1 Sil 228 1HS Subcrown internode length 1 26:226 NE 62203 

sld1 dw-1 126 3HL Slender dwarf 1 26:162 Akashinriki 

sld2 83 2HS Slender dwarf 2 26:121 Akashinriki 

sld3 ant-567 186 4HS Slender dwarf 3 37:243 Manker 

sld4 100 7HS Slender dwarf 4 37:218 Glacier 

sld5 144 3HS Slender dwarf 5 32:94 Indian Dwarf 

sls1 sls 227 1HS Small lateral spikelet 1 26:225 Morex 

smn1 smn 38 7HS Seminudoides 1 32:225 Haisa 

snb1 sb 26 7HS Subnodal bract 1 26:72 L50-200 

srh1 s 321 5HL Short rachilla hair 1 26:269 Lion 

sun1 650 Sensitivity to Ustilago nuda 1 35:208 Steptoe 

trd1 trd 202 1HL Third outer glume 1 26:207 Valki 

trp1 tr 61 2HL Triple awned lemma 1 26:97 CIho 6630 

tst1 647 Tip sterile 1 35:205 Steptoe 

tst2 lin2 636 Tip sterile 2 37:292 Donaria 

ubs4 u4 11 7HL Unbranched style 4 26:56 Ao-Hadaka 

uzu1 uz 102 3HL Uzu 1 or semi brachytic 1 37:220 Baitori 

var1 va 306 5HL Variegated 1 37:259 Montcalm 

var2 va2 344 5HL Variegated 2 32:104 Montcalm 

var3 va3 303 5HL Variegated 3 26:254 Montcalm 

viv-a viv-5 627 Viviparoides-a 32:128 Foma 

vrs1 v 6 2HL Six-rowed spike 1 37:192 Trebi 

vrs1 lr 58 2HL Six-rowed spike 1 26:94 Nudihaxtoni 

vrs1 V d 66 2HL Two-rowed spike 1 26:103 Svanhals 

185





vrs1 V t 67 2HL Deficiens 1 26:104 White Deficiens 

vrs2 v2 314 5HL Six-rowed spike 2 26:263 Svanhals 

vrs3 v3 315 1HL Six-rowed spike 3 26:264 Hadata 2 

vrs4 v4 124 3HL Six-rowed spike 4 26:159 MFB 104 

wax1 wx 16 7HS Waxy endosperm 1 26:61 Oderbrucker 

wnd1 wnd 23 7HS Winding dwarf 1 26:69 Kogen-mugi 

wst1 wst 107 3HL White streak 1 26:141 CIho 11767 

wst2 304 5HL White streak 2 26:255 Manabe 

wst4 56 2HL White streak 4 26:91 Kanyo 7 

wst5 221 1HL White streak 5 26:219 Carlsberg II 

wst6 wst,,j 129 3HL White streak 6 26:165 Akashinriki 

wst7 rb 79 2HL White streak 7 37:207 GS397 

Xnt1 Xa 25 7HL Xantha seedling 1 26:71 Akanshinriki 

xnt2 xb 513 Xantha seedling 2 26:440 Black Hulless 

xnt3 xc 105 3HS Xantha seedling 3 26:139 Colsess 

xnt4 xc2 36 7HL Xantha seedling 4 26:85 Coast 

xnt5 xn 255 6HL Xantha seedling 5 26:237 Nepal 

xnt6 xs 113 3HS Xantha seedling 6 26:147 Smyrna 

xnt7 xan,,g 233 1HL Xantha seedling 7 26:231 Erbet 

xnt8 xan,,h 140 3HS Xantha seedling 8 26:177 Carlsberg II 

xnt9 xan,,i 37 7HL Xantha seedling 9 26:86 Erbet 

yhd1 yh 158 4HL Yellow head 1 26:185 Kimugi 

yhd2 yh2 592 Yellow head 2 28:34 Compana 

ylf1 652 Yellow leaf 1 35:210 Villa 

Ynd1 Yn 183 4HS Yellow node 1 32:98 Morex 

yst1 yst 104 3HS Yellow streak 1 26:138 Gateway 

yst2 109 3HS Yellow streak 2 26:144 Kuromugi 148/ 

Mensury C 

yst3 yst,,c 462 3HS Yellow streak 3 26:409 Lion 

yst4 85 2HL Yellow streak 4 37:210 Glenn 

yst5 346 5HL Yellow streak 5 32:107 Bowman / ant10.30 

yvs1 yx 63 2HS Virescent seedling 1 26:99 Minn 71-8 

yvs2 yc 3 7HS Virescent seedling 2 26:46 Coast 

zeb1 zb 120 3HL Zebra stripe 1 26:155 Mars 

zeb2 zb2 461 4HL Zebra stripe 2 26:407 Unknown 

zeb3 zb3 223 1HL Zebra stripe 3 26:221 Utah 41 

Zeo1 Knd 82 2HL Zeocriton 1 37:209 Donaria 

Zeo2 614 Zeocriton 2 32:115 36Ab51 

Zeo3 Mo1 184 4HL Zeocriton 3 32:99 Morex 

186


* Recommended locus symbols are based on utilization of a three-letter code for barley genes as 


Saskatoon, Saskatchewan, Canada, on 05 August 1996. 

† Chromosome numbers and arm designations are based on the Triticeae system. Utilization of 

this system for naming of barley chromosomes was at the business meeting of the Seventh 

International Barley Genetics Symposium at Saskatoon, Saskatchewan, Canada, on 05 August 

1996. The Burnham and Hagberg (1956) designations of barley chromosomes were 1 2 3 4 5 6 

and 7 while new designations based on the Triticeae system are 7H 2H 3H 4H 1H 6H and 5H, 

respectively. 

187


Stock number: BGS 1 

Locus name: Brachytic 1 

Locus symbol: brh1 

BGS 1, Brachytic 1, brh1 

Previous nomenclature and gene symbolization: 

Brachytic = br (10, 12). 

Breviaristatum-i = ari-i (5, 8). 

Dwarf x = dx1 (6). 

Inheritance: 

Monofactorial recessive (10, 12). 

Located in chromosome 7HS [1S] (3), about 9.3 cM distal from the fch12 

(chlorina seedling 12) locus (12), 0.8 cM distal from RFLP marker BCD129 (9), 

about 5.0 cM from AFLP marker E4134-8 in subgroup 1 of the Proctor/Nudinka 

map (11), and about 13.6 cM proximal from SSR marker HVM04 in bin 1H-02 (2). 

Description: 

Plants have short leaves, culms, spikes, awns, and kernels. The seedling leaf is 

about 2/3 normal length. A similar reduction in the size of other organs is 

observed, but the awns are less than 1/2 normal length (6). The mutant 

phenotype is easy to classify at all stages of growth. The approximately 20% 

reduction in kernels size is caused primarily by a reduction in kernel length. The 

yields of the brh1 mutants are about 2/3 normal and lodging is greatly reduced in 

the Bowman brh1 lines (2). Börner (1) reported that ari-i.38 seedlings are 

sensitive to gibberellic acid. Powers (10) states that the assigned gene symbol 

for this mutant is br and that L.J. Stadler selected this symbol. 

Origin of mutant: 

A spontaneous mutant in Himalaya (CIho 1312) (10, 12). 

Mutational events: 

brh1.a in Himalaya (12); brh1.c (GSHO 229) in Moravian (PI 539135) (13); arii.38 

(NGB 115888, GSHO 1657) in Bonus (PI 189763) (8, 14); brh1.e (GSHO 

1690) in Aramir (PI 467786) (14); brh1.f (dx1, GSHO 1422) in Domen (CIho 

9562) (6); brh1.t (OUM136, GSHO 1691) in Akashinriki (PI 467400, OUJ659); 

brh1.x (7125, DWS1224, GSHO 1692) in Volla (PI 280423); brh1.z (Hja80001) in 

Aapo; brh1.aa (Hja80051) in a Hja80001 cross (4, 7); and brh1.ae (FN53) in 

Steptoe (CIho 15229) (4). 

Mutant used for description and seed stocks: 

brh1.a in Himalaya (GSHO 25); brh1.a in Bowman (PI 483237)*7 (GSHO 1820); 

ari-i.38 in Bowman*6 (GSHO 1821); brh1.e in Bowman*7 (GSHO 1822); brh1.t in 

Bowman*7 (GSHO 1823); brh1.x in Bowman*7 (GSHO 1824); brh1.z in 

Bowman*7 (GSHO 2179). 

References: 

1. Börner, A. 1996. GA response in semidwarf barley. Barley Genet. Newsl. 

25:24-26. 

2. Dahleen, L.S., L.J. Vander Wal, and J.D. Franckowiak. 2005. Characterization 

and molecular mapping of genes determining semidwarfism in barley. J. Hered. 

96:654-662. 

3. Fedak, G., T. Tsuchiya, and S.B. Helgason. 1972. Use of monotelotrisomics 

for linkage mapping in barley. Can. J. Genet. Cytol. 14:949-957. 

4. Franckowiak, J.D. 1995. The brachytic class of semidwarf mutants in barley. 

Barley Genet. Newsl. 24:56-59. 

188


5. Gustafsson, Å., A. Hagberg, U. Lundqvist, and G. Persson. 1969. A proposed 

system of symbols for the collection of barley mutants at Svalöv. Hereditas 

62:409-414. 

6. Holm, E., and K. Aastveit. 1966. Induction and effects of the brachytic allele in 

barley. Adv. Front Plant Sci. 17:81-94. 

7. Kivi, E. 1986. (personal communications). 

8. Kucera, J., U. Lundqvist, and Å. Gustafsson. 1975. Inheritance of 

breviaristatum mutants in barley. Hereditas 80:263-278. 

9. Li , M., D. Kudrna, and A. Kleinhofs. 2000. Fine mapping of a semi-dwarf gene 

brachytic 1 in barley. p. 72-74. In S. Logue (ed.) Barley Genetics VIII. Volume III, 

Proc. Eighth Int. Barley Genet. Symp., Adelaide, Dept. Plant Science, Waite 

Campus, Adelaide University, Glen Osmond, South Australia. 

10. Powers, L. 1936. The nature of the interactions of genes affecting four 

quantitative characters in a cross between Hordeum deficiens and vulgare. 

Genetics 21:398-420. 

11. Pozzi, C., D. di Pietro, G. Halas, C. Roig, and F. Salamini. 2003. Integration 

of a barley (Hordeum vulgare) molecular linkage map with the position of genetic 

loci hosting 29 developmental mutants. Heredity 90:390-396. 

12. Swenson, S.P. 1940. Genetic and cytological studies on a brachytic mutant in 

barley. J. Agric. Res. 60:687-713. 

13. Szarejko, I., and M. Maluszynski. 1984. New brachytic mutant of spring 

barley variety Aramir. Barley Genet. Newsl. 14:33-35. 

14. Tsuchiya, T. 1974. Allelic relationships of genes for short-awned mutants in 

barley. Barley Genet. Newsl. 4:80-81. 

Prepared: 

T. Tsuchiya and T.E. Haus. 1971. BGN 1:104. 

Revised: 

T. Tsuchiya. 1980. BGN 10:100. 

J.D. Franckowiak. 1997. BGN 26:44. 

J.D. Franckowiak and L. S. Dahleen. 2007. BGN 37:188-189. 

189



Locus name: Chlorina seedling 12 

Locus symbol: fch12 

BGS 2, Chlorina seedling 12, fch12 


Chlorina seedling-c = fc (3). 

Chlorina seedling-fc = clo-fc (7). 

Inheritance: 

Monofactorial recessive (3). 

Located in chromosome 7HS [1S] (1, 4), about 3.6 cM distal from the gsh3 

(glossy sheath 3) locus (6), and about 9.3 cM proximal from the brh1 (brachytic 

1) locus (8), in bin 7H-02 about 2.3 cM from RFLP marker KFP027 and cosegregating 

with markers BCD130 and ABC327 (5). 

Description: 

Seedling leaves are yellow with green tips and new leaves show a yellow base 

and a green tip. As the plant develops, leaf color changes to pale green (3). 

Plants are vigorous, but anthesis is delayed and seed yield may be low. 


A spontaneous mutant in Colsess (CIho 2792) (3). 


fch12.b (fc) in Colsess (Colsess V) (3); fch12.l (Trebi chlorina 453, GSHO 155), 

fch12.m (Trebi V, GSHO 158), fch12.n (Trebi IX, GSHO 18), fch12.o (Trebi XI, 

GSHO 163) in Trebi (PI 537442) (2); clo-fc.110 in Bonus (PI 189763) (7); fch12.b 

may be present in the brachytic chlorina stocks (GSHO 124 and GSHO 174) (9). 


fch12.b in Colsess (GSHO 36); fch12.b in Bowman (PI 483237)*7 (GSHO 1826). 

References: 



2. McMullen, M. 1972. Allelism testing of seven chlorina mutants in Trebi barley. 


3. Robertson, D.W., and G.W. Deming. 1930. Genetic studies in barley. J. Hered. 

21:283-288. 

4. Robertson, D.W., G.W. Deming, and D. Koonce. 1932. Inheritance in barley. J. 

Agric. Res. 44:445-466. 

5. Schmierer, D., A. Druka, D. Kudrna, and A. Kleinhofs. 2001. Fine mapping of 

the fch12 chlorina seedling mutant. Barley Genet. Newsl. 31:12-13. 

6. Shahla, A., and T. Tsuchiya. 1987. Cytogenetic studies in barley chromosome 

1 by means of telotrisomic, acrotrisomic and conventional analysis. Theor. Appl. 

Genet. 75:5-12. 

7. Simpson, D.J., O. Machold, G. Høyer-Hansen, and D. von Wettstein. 1985. 

Chlorina mutants of barley (Hordeum vulgare L.). Carlsberg Res. Commun. 

50:223-238. 

8. Swenson, S.P. 1940. Genetic and cytological studies on a brachytic mutation 

in barley. J. Hered. 31:213-214. 

9. Wang, S., and T. Tsuchiya. 1991. Genetic analysis of the relationship between 

new chlorina mutants in genetic stocks and established f series stocks in barley. 


Prepared: 

190


T. Tsuchiya and T. E. Haus. 1971. BGN 1:105. 

Revised: 

T. Tsuchiya. 1980. BGN 10:101. 

J.D. Franckowiak and A. Hang. 1997. BGN 26:45. 

J.D. Franckowiak. 2007. BGN 37:190-191. 

191



Locus name: Six-rowed spike 1 

Locus symbol: vrs1 

BGS 6, Six-rowed spike 1, vrs1 


Two-row vs six-row = Zz (21). 

Six-row vs two-row = Aa (6). 

Two-rowed = D (17). 

Six-row vs two-row = Vv (3). 

Six-row vs two-row (distichon) vs two-row (deficiens) = A, a s , a f (8). 

Reduced lateral spikelet appendage on the lemma = lr (9). 

Allelic series v, V d , V, and V t (22). 

Hexastichon mutants = hex-v (5, 6). 

Intermedium spike-d = Int-d (4). 

Reduced lateral spikelet appendage on the lemma = v lr (19). 

The vrs1 DNA sequence identified as HvHox1 (10). 

Inheritance: 

A multiple allelic series, incomplete dominant allele interactions based on the 

size and shape of lateral spikelets (1, 19, 22). 

Located in chromosome 2HL (3, 6, 12, 14), about 30.5 cM distal from the eog1 

(elongated outer glume 1) locus (18), in bin 2H-09 and in a 0.90-cM interval 

between markers cMWG699 and MWG865 (11). 

Description: 

Alleles at this complex locus modify development of the lateral spikelets and the 

associated lemma awn. The vrs1.a allele (v gene) is present in most six-rowed 

cultivars and produces well-developed lateral spikelets (6). Based on 

phylogenetic analysis of the six-rowed cultivars, the six-rowed gene originated 

independently at least three times (vrs1.a1, vrs1.a2, and vrs1.a3) from different 

wild type (Vrs1.b) alleles (10). The lemma awn of lateral spikelets will vary from 

3/4 to nearly as long as those of central spikelets, depending upon alleles 

present at other loci. The Vrs1.b allele (V gene, distichon) is present in many 

two-rowed cultivars and reduces lateral spikelets to sterile bracts with a rounded 

tip. The Vrs1.t allele (V t gene, deficiens) causes an extreme reduction in the size 

of lateral spikelets. The lr or v lr (vrs1.c) gene in Nudihaxtoni and Bozu types will 

not recombine with the vrs1.a allele (12, 19) and produces phenotypes similar to 

the Vrs1.d allele (V d gene) of Svanhals (22). The series of induced mutants in 

two-rowed barley called hex-v and Int-d mutants differ in the size of lateral 

spikelets, but they interact with the vrs1.a allele as incomplete dominants (5). 

Many heterozygous combinations with vrs1.a have a pointed tip on the lemma of 

sterile lateral spikelets. Alleles at the int-c (intermedium spike-c) locus modify 

lateral size in the presence of vrs1.a, Vrs1.b, and Vrs1.d, but not when Vrs1.t is 

present (22). Multiple origins of vrs1 alleles in six-rowed barley have been 

confirmed by molecular analysis (20). Komatsuda et al. (10) found that 

expression of the Vrs1 gene was strictly localized in the lateral-spikelet primordia 

of immature spikes and suggested that the VRS1 protein suppresses 

development of lateral spikelets. 


Natural occurrence in six-rowed barley and induced frequently by mutagenic 

agents (10, 14). 

192



vrs1.a1 in most six-rowed cultivars (1, 10, 22); vrs1.a2 in Dissa and Valenci (10), 

vrs1.a3 in Natsudaikon Mugi (OUK735) (10), Vrs1.b in wild barley (10), Vrs1.b2 

in Pamella Blue (OUH630) (10), Vrs1.b3 in Bonus (PI 189763) (10), Vrs1.t in a 

few two-rowed cultivars (10, 22); vrs1.c or lr in Nudihaxtoni (PI 32368) (12, 19); 

Vrs1.d in Svanhals (PI 5474) (22); 23 induced mutants from programs in 

Belgium, Germany, and Hungary (2); hex-v.3 (NGB 115545), -v.4 (NGB 115546), 

-v.6 (NGB 115547), -v.7 (NGB115548), -v.8 (NGB 115549), -v.9 (NGB 115550), - 

v.10 (NGB 115551), -v.11 (NGB 115552), -v.12 (NGB 115553), -v.18 (NGB 

115559), -v.44 (NGB 115581), -v.45 (NGB 115582 ), -v.46 (NGB 115583 ), -v.47 

(NGB 115584), -v.48 (NGB 115585), in Bonus, -v.13 (NGB 115554), -v.14 (NGB 

115555), -v.15 (NGB 115556), -v.16 (NGB 115557), -v.17 (NGB 115558), -v.19 

(NGB 115560), -v.21 (NGB 115562), -v.22 (NGB 115563), -v.23 (NGB 115564), 

-v.24 (NGB 115565), -v.25 (NGB 115566), -v.26 (NGB 115567), -v.27 (NGB 


(NGB 115572), -v.35 (NGB 115574) in Foma (CIho 11333), -v.20 (NGB 115561) 

in Ingrid (CIho 10083), -v.33 (NGB 115573), -v.36 (NGB 115575), -v.38 (NGB 


(NGB 115580) in Kristina (NGB 1500) (5, 14); hex-v.49 (NGB 115586) in Bonus, 

-v.50 (NGB 115587), -v.51 (NGB 115588) in Sv 79353, -v.52 (NGB 119353) in 

Golf (PI 488529) (13); Int-d.11 (NGB 115429), -d.12 (NGB 115430), -d.22 (NGB 

115440), -d.24 (NGB 115442), -d.28 (NGB 115446), -d.36 (NGB 115454) in 

Foma, -d.40 (NGB 115458), -d.41 (NGB 115459), -d.50 (NGB 115468), -d.57 

(NGB 115475), -d.67 (NGB 115485), -d.68 (NGB 115486), -d.69 (NGB 115487) 

in Kristina (5, 15); Int-d.73 (NGB 115491), -d.80 (NGB 115498), -d.82 (NGB 

115500) in Bonus, -d.93 (NGB 115511), -d.94 (NGB 115512), -d.96 (NGB 

115514), -d.97 (NGB 115515), -d.100 (NGB 115518) in Hege (NGB 13692) (13); 

vrs1.o (v1b) in New Golden (16). 

Mutant used for description and seed stock: 

vrs1.a in Trebi (PI 537442, GSHO 196); vrs1.a in Bonneville (CIho 7248) (7); 

vrs1.a from Glenn (CIho 15769) in Bowman (PI 483237)*8 (GSHO 1907); Intd.12 

in Bowman*7 (GSHO 1910). 

References: 

1. Biffen, R.H. 1906. Experiments on the hybridization of barleys. Proc. Camb. 

Phil. Soc. 13:304-308. 

2. Fukuyama, T., J. Hayashi, I. Moriya, and R. Takahashi. 1972. A test for 

allelism of 32 induced six-rowed mutants. Barley Genet. Newsl. 2:25-27. 

3. Griffee, F. 1925. Correlated inheritance of botanical characters in barley, and 

manner of reaction to Helminthosporium sativum. J. Agric. Res. 30:915-935. 



62:409-414. 

5. Gustafsson, Å., and U. Lundqvist. 1980. Hexastichon and intermedium 

mutants in barley. Hereditas 92:229-236. 

6. Harlan, H.V., and H.K. Hayes. 1920. Occurrence of the fixed intermediate, 

Hordeum intermedium haxtoni, in crosses between H. vulgare pallidium and H. 

distichum palmella. J. Agric. Res.19:575-591. 

7. Hockett, E.A. 1985. Registration of two- and six-rowed isogenic Bonneville 

barley germplasm. Crop Sci. 25:201. 

8. Hor, K.S. 1924. Interrelations of genetic factors in barley. Genetics 9:151-180. 

9. Immer, F.R., and M.T. Henderson. 1943. Linkage studies in barley. Genetics 

193


28:419-440. 

10. Komatsuda, T., M. Pourkheirandish, C. He, P. Azhaguvel, H. Kanamori, D. 

Perovic, N. Stein, A. Graner, T. Wicker, A. Tagiri, U. Lundqvist, T. Fujimura, M. 

Matsuoka, T. Matsumoto, and M. Yano. 2007. Six-rowed barley originated from a 

mutation in a homeodomain-leucine zipper I-class homeobox gene. PNAS 

104:1424-1429. 

11. Komatsuda, T., and K. Tanno. 2004. Comparative high resolution map of the 

six-rowed locus 1 (vrs1) in several populations of barley, Hordeum vulgare L. 

Hereditas 141:68-73. 

12. Leonard, W.H. 1942. Inheritance of reduced lateral spikelet appendages in 

the Nudihaxtoni variety of barley. J. Am. Soc. Agron. 34:211-221. 

13. Lundqvist, U. (unpublished). 

14. Lundqvist, U., and A. Lundqvist. 1987. Barley mutants - diversity and 

genetics. p. 251-257. In S. Yasuda and T. Konishi (eds.) Barley Genetics V. 

Proc. Fifth Int. Barley Genet. Symp., Okayama, 1986. Sanyo Press Co., 

Okayama. 

15. Lundqvist, U., and A. Lundqvist. 1988. Induced intermedium mutants in 

barley: origin, morphology and inheritance. Hereditas 108:13-26. 

16. Makino, T., M. Furusho, and T. Fukuoka. 1995. A mutant having six-rowed 

gene allelic to v locus. Barley Genet. Newsl. 24:122. 

17. Miyake, K., and Y. Imai. 1922. [Genetic studies in barley. 1.] Bot. Mag., 

Tokyo 36:25-38. [In Japanese.] 

18. Swenson, S.P., and D.G. Wells. 1944. The linkage relation of four genes in 

chromosome 1 of barley. J. Am. Soc. Agron. 36:429-435. 

19. Takahashi, R., J. Hayashi, I. Moriya, and S. Yasuda. 1982. Studies on 

classification and inheritance of barley varieties having awnless or short-awned 

lateral spikelets (Bozu barley). I. Variation of awn types and classification. 

Nogaku Kenyu 60:13-24. [In Japanese with English summary.] 

20. Tanno, K., S. Taketa, K. Takeda, and T. Komatsuda. 2002. A DNA marker 

closely linked to the vrs1 locus (row-type gene) indicates multiple origins of sixrowed 

barley (Hordeum vulgare L.) Theor. Appl. Genet. 104:54-60. 

21. Ubisch, G. von. 1916. Beitrag zu einer Faktorenanalyse von Gerste. Z. 

Indukt. Abstammungs. Vererbungsl. 17:120-152. 

22. Woodward, R.W. 1949. The inheritance of fertility in the lateral florets of the 

four barley groups. Agron. J. 41:317-322. 

Prepared: 

T.E. Haus. 1975. BGN 5:106. 

Revised: 

J.D. Franckowiak and U. Lundqvist. 1997. BGN 26:49-50. 

U. Lundqvist and J.D. Franckowiak. 2007. BGN 37:192-194. 

194



Locus name: Naked caryopsis 1 

Locus symbol: nud1 

BGS 7, Naked caryopsis 1, nud1 


Naked caryopsis = k (14). 

Naked caryopsis = s (21). 

Naked caryopsis = n (6, 9). 

Hulless = h (10). 

Inheritance: 

Monofactorial recessive (6, 14, 19). 

Located in chromosome 7HL [1L] (3, 11, 12, 14, 20), near the centromere (3, 11), 

about 9.6 cM proximal from the lks2 (short awn 2) locus (15), about 10.5 cM 

proximal from the dsp1 (dense spike 1) locus (15, 16), in bin 7H-07 about 13.1 

cM distal from RFLP marker MWG808 (2), co-segregating with AFLP markers 

KT3 and KT7 and SCAR marker sKT7 (7), about 0.06 cM distal from SCAR 

marker sTK3 and the same distance proximal from sTK9 (17). 

Description: 

The lemma and palea do not adhere to the caryopsis and the grain will thresh 

free of the hull at maturity. The naked caryopsis trait is expressed in all 

environments (16). The naked lines fail to produce a cementing substance 

present in covered lines (4). The nud1.a mutant depressed the expression by 10 

to 20% of other traits such as plant height, seed weight (1, 8) and altered malt 

quality parameters (8). The nud1.a gene is often associated with the dsp1.a 

(dense spike 1) gene in Japanese cultivars (16). Allele IV of the marker sKT7 

near the nud1 locus was the only one found in naked barley cultivars (18); 

however, the geographic distribution for haplotypes of allele IV suggest migration 

of naked types toward eastern Asia (18). 


In an unknown cultivar, but its origin was monophyletic probably in southwestern 

Iran (18), widespread in cultivated barley in Asia. 


nud1.a in Himalaya (CIho 1312) (21); nud1.b in Haisa (Mut 4129), nud1.c (Mut 

3041/62) in Ackermann's Donaria (PI 161974) (13). 


nud1.a in Himalaya (GSHO 115), nud1.a from Sermo (CIho 7776) in Betzes (PI 

129430)*7 (CIho 16559, GP 37), nud1.a from Sermo in Compana (CIho 5438)*7 

(CIho 16185, GP 41), nud1.a from Sermo in Decap (CIho 3351)*7 (CIho 16563, 

GP 45) (5); nud1.a from Stamm (PI 194555) in Betzes*7 (CIho 16566, GP 48), 

nud1.a from Stamm in Compana*7 (CIho 16183, GP 50), nud1.a from Stamm*7 

in Freja (CIho 7130)*7 (CIho 16568, GP 52) (5); nud1.a from R.I. Wolfe's Multiple 

Recessive Marker Stock in Bowman (PI 483237)*8 (GSHO 1847). 

References: 

1. Choo, T-M., K.M. Ho, and R.A. Martin. 2001. Genetic analysis of a hulless X 

covered cross of barley using doubled-haploid lines. Crop Sci. 41:1021-1026. 

2. Costa, J.M., A. Corey, M. Hayes, C. Jobet, A. Kleinhofs, A. Kopisch-Obusch, 

S.F. Kramer, D. Kudrna, M. Li, O. Piera-Lizaragu, K. Sato, P. Szues, T. Toojinda, 

M.I. Vales, and R.I. Wolfe. 2001. Molecular mapping of the Oregon Wolfe 

195


Barleys: a phenotypically polymorphic doubled-haploid population. Theor. Appl. 

Genet. 103:415-424. 



4. Gaines, R.L., D.B. Bechtel, and Y. Pomeranz. 1985. A microscopic study on 

the development of a layer in barley that causes hull-caryopsis adherence. 

Cereal Chem. 62:35–40. 

5. Hockett, E.A. 1981. Registration of hulless and hulless short-awned spring 

barley germplasm (Reg. nos. GP 35 to 52). Crop Sci. 21:146-147. 

6. Hor, K.S. 1924. Interrelations of genetic factors in barley. Genetics 9:151-180. 

7. Kikuchi, S., S. Taketa, M. Ichii, and S. Kawasaki. 2003. Efficient fine mapping 

of the naked caryopsis gene (nud) by HEGS (high efficiency genome 

scanning)/AFLP in barley. Theor. Appl. Genet. 108:73-78. 

8. McGuire, C.F., and E.A. Hockett. 1981. Effect of awn length and naked 

caryopsis on malting quality of Betzes barley. Crop Sci. 21:18-21. 

9. Miyake, K., and Y. Imai. 1922. [Genetic studies in barley. 1.] Bot. Mag., Tokyo 

36:25-38. [In Japanese.] 

10. Neatby, K.W. 1926. Inheritance of quantitative and other characters in a 

barley cross. Sci. Agric. 7:77-84. 

11. Persson, G. 1969. An attempt to find suitable genetic markers for dense ear 

loci in barley I. Hereditas 62:25-96. 

12. Robertson, D.W. 1937. Inheritance in barley. II. Genetics 22:443-451. 

13. Scholz, F. 1955. Mutationsversuche an Kulturpflanzen. IV. Kulturpflanze 

3:69-89. 

14. So, M., S. Ogura, and Y. Imai. 1919. [A linkage group in barley.] Nogaku 

Kaiho 208:1093-1117. [In Japanese.] 

15. Takahashi, R., J. Hayashi, T. Konishi, and I. Moriya. 1975. Linkage analysis 

of barley mutants. BGN 5:56-60. 

16. Takahashi, R., J. Yamamoto, S. Yasuda, and Y. Itano. 1953. Inheritance and 

linkage studies in barley. Ber. Ohara Inst. landw. Forsch. 10:29-52. 

17. Taketa, S., T. Awayama, S. Amano, Y. Sakurai, and M. Ichii. 2006. Highresolution 

mapping of the nud locus controlling the naked caryopsis in barley. 

Plant Breed. 125:337-342. 

18. Taketa, S., S. Kikuchi, T. Awayama, S. Yamamoto, M. Ichii, and S. Kawasaki. 

2004. Monophyletic origin of naked barley inferred from molecular analyses of a 

marker closely linked to the naked caryopsis gene (nud). Theor. Appl. Genet. 

108:1236-1242. 

19. Tschermak, E. von. 1901. Über Züchtung neuer Getreiderassen mittelst 

künstlicher Kreuzung. Kritisch-historische Betrachtungen. Zeitschrift für das 

landwirtschaftliche Versuchswesen Oesterreich 4:1029-1060. 

20. Tsuchiya, T., and R.J. Singh. 1973. Further information on telotrisomic 

analysis in barley. Barley Genet. Newsl. 3:75-78. 

21. Ubisch, G. von. 1921. Beitrag zu einer Faktorenanalyse von Gerste. III. Z. 


Prepared: 


Revised: 

J.D. Franckowiak and T. Konishi. 1997. BGN 26:51-52. 


196



Locus name: Short awn 2 

Locus symbol: lks2 

BGS 10, Short awn 2, lks2 


Short awn = a (15, 16). 

Short awn = lk (14). 

Short awn 2 = lk1 (7). 

Short awn 2 = lk2 (11). 

Short awn 4 = lk4 (2, 5). 

Inheritance: 


Located in chromosome 7HL [1L] (6, 13), estimates range from 7.9 to 10.5 cM 

distal from the nud1 (naked caryopsis 1) locus (3, 12, 13), about 2.8 cM distal 

from molecular marker WG541 in bin 7H-05 (8), about 8.6 cM proximal from 

RFLP marker WG380B in bin 7H-08 (1). 

Description: 

Awns of both central and lateral spikelets are reduced to about 3/5 of the long 

awned type. Texture of the short awn is finer and more flexible than that of the 

long awn, especially in non-uzu genotypes (13, 14). The awn length of 

heterozygotes in some crosses is shorter that of the normal parent. Other plant 

characteristics are apparently unaltered by the lks2.b gene. 


Spontaneous occurrence in some cultivars distributed in China, Japan, Korea, 

and Nepal (5, 10, 12, 14). 


lks2.b in many cultivars of Oriental origin, often associated with the dsp1.a 

(dense spike 1) gene (6, 12, 14); a possible mutant in Morex (CIho 15773) (9, 

10). 


lks2.b in Honen 6 (OUJ469, PI 307495, GSHO 566) (14); lks2.b from Sermo 

(CIho 7776) in Betzes (PI 129430)*7 (CIho 16558, GP 36), lks2.b from Sermo in 

Compana (CIho 5438)*7 (CIho 16188, GP 40), lks2.b from Sermo in Decap (CIho 

3351)*7 (CIho 16562, GP 44) (4); lks2.b from R.I. Wolfe's Multiple Recessive 

Stock in Bowman (PI 483237)*9 (GSHO 1850). 

References: 





Genet. 103:415-424. 

2. Eslick, R.F., and E.A. Hockett. 1967. Allelism for awn length, lk2, in barley 

(Hordeum species). Crop Sci. 7:266-267. 

3. Eslick, R.F., and E.A. Hockett. 1972. Recombination values of four genes on 

chromosome 1. BGN 2:123-126. 

4. Hockett, E.A. 1981. Registration of hulless and hulless short-awned spring 

barley germplasm (Reg. nos. GP 35 to 52). Crop Sci. 21:146-147. 

5. Litzenberger, S.C., and J.M. Green. 1951. Inheritance of awns in barley. 

Agron. J. 43:117-123. 

197




7. Myler, J.L. 1942. Awn inheritance in barley. J. Agric. Res. 65:405-412. 

8. Pozzi, C., P. Faccioli, V. Terzi, A.M. Stanca, S. Cerioli, P. Castiglioni, R. Fink, 

R. Capone, K.J. Müller, G. Bossinger, W. Rohde, and F. Salamini. 2000. 

Genetics of mutations affecting the development of a barley floral bract. Genetics 

154:1335-1346. 

9. Ramage, T. 1984. A semi-dominant short awn mutant in Morex. Barley Genet. 

Newsl. 14:19-20. 

10. Ramage, T., and J.L.A. Eckhoff. 1985. Assignment of mutants in Morex to 

chromosomes. Barley Genet. Newsl. 15:22-25. 

11. Robertson, D.W., G.A. Wiebe, and F.R. Immer. 1941. A summary of linkage 

studies in barley. J. Am. Soc. Agron. 33:47-64. 

12. So, M., S. Ogura, and Y. Imai. 1919. [A linkage group in barley.] Nogaku 

Kaiho 208:1093-1117. [In Japanese.] 

13. Takahashi, R., J. Hayashi, T. Konishi, and I. Moriya. 1975. Linkage analysis 

of barley mutants. Barley Genet. Newsl. 5:56-60. 


linkage studies in barley. Ber. Ohara Inst. landw Forsch. 10:29-52. 

15. Takezaki, Y. 1927. [On the genetical formulae of the length of spikes and 

awns in barley, with reference to the computation of the valency of the heredity 

factors.] Rep. Agric. Exp. Sta., Tokyo 46:1-43. [In Japanese.] 

16. Ubisch, G. von. 1921. Beitrag zu einer Faktorenanalyse von Gerste. III. Z. 


Prepared: 

R. Takahashi. 1972. BGN 2:176. 

Revised: 

R. Takahashi and T. Tsuchiya. 1973. BGN 3:119. 


J.D. Franckowiak 2007. BGN 37:197-198. 

198


BGS 22, Reaction to Schizaphis graminum 1, Rsg1 


Locus name: Reaction to Schizaphis graminum 1 (greenbug) 

Locus symbol: Rsg1 


Greenbug resistance = Grb (8). 

Resistance to Schizaphis graminum Rondani (greenbug) = Rsg,,a (3). 

Inheritance: 

Monofactorial dominant (2, 3, 9). 

Located in chromosome 7H [1] (4). 

Description: 

Resistant seedlings infested with greenbugs (aphids) are not killed, while 

susceptible seedlings are killed, eight weeks after infestation by the buildup of 

the greenbug population (2, 3, 4). The resistance provided by Post 90 (PI 

549081), having the Rsg1.a gene, to most S. graminum biotypes was commonly 

2 to 3 readings on a 1 to 9 scale (7). Accessions with the Rsg1.a gene conferred 

resistance to most, but not all greenbug populations (5). 


Natural occurrence in Bozu Omugi (OUJ028, PI 87181), Derbent (PI 76504), and 

Kearney (PI 539126, CIho 7580) (1, 3). 


Rsg1.a in Bozu Omugi, Derbent, Kearney, Dobaku (PI 87817), and CIho 5087 

(PI 82683) (3, 7). 


Rsg1.a in Bozu Omugi (GSHO 1317); Rsg1.a in Post 90 (PI 549081) from Will () 

(5). 

References: 

1. Atkins, I.M., and R.G. Dahms. 1945. Reaction of small-grain varieties to 

greenbug attack. USDA Tech. Bull. 901. 

2. Gardenshire, J.H. 1965. Inheritance and linkage studies on greenbug 

resistance in barley (Hordeum vulgare L.). Crop Sci. 5:28-29. 

3. Gardenshire, J.H., and H.L. Chada. 1961. Inheritance of greenbug resistance 

in barley. Crop Sci. 1:349-352. 

4. Gardenshire, J.H., N.A. Tuleen, and K.W. Stewart. 1973. Trisomic analysis of 

greenbug resistance in barley, Hordeum vulgare L. Crop Sci. 13:684-685. 

5. Mornhinweg, D.W., L.H. Edwards, L.H. Smith, G.H. Morgan, J.A. Webster, 

D.R. Porter, and B.F. Carver. 2004. Registration of ‘Post 90’ barley. Crop Sci. 

44:2263. 

6. Porter, D.R., J.D. Burd, and D.W. Mornhinweg. 2007. Differentiating greenbug 

resistance genes in barley. Euphytica 153:11-14. 

7. Porter, D.R., and D.W. Mornhinweg. 2004. Characterization of greenbug 

resistance in barley. Plant Breed. 123:493-494. 

8. Robertson, D.W., G.A. Wiebe, and R.G. Shands. 1955. A summary of linkage 

studies in cultivated barley, Hordeum species: Supplement II, 1947-1953. Agron. 

J. 47:418-425. 

9. Smith, O.D., A.M. Schlehuber, and B.C. Curtis. 1962. Inheritance studies of 

greenbug (Toxoptera graminum Rond.) resistance in four varieties of winter 

barley. Crop Sci. 2:489-491. 

Prepared: 

199


J.G. Moseman. 1976. BGN 6:119. 

Revised: 



200


BGS 32, Reaction to Puccinia hordei 9, Rph9 


Locus name: Reaction to Puccinia hordei 9 (barley leaf rust) 

Locus symbol: Rph9 


Resistance to Puccinia hordei Otth 9 = Pa9 (3, 7, 8). 

Resistance to Puccinia hordei Otth 9 = Pa9 (2). 

Resistance to Puccinia hordei 12 = Rph12 (1, 2, 9). 

Inheritance: 


Located in chromosome 5HL [7L] (5), about 26.1 cM distal from the raw1 

(smooth awn 1) locus (5), in bin 5H-11 about 9.3 cM proximal from esterase 9 

(Est9) and about 22.5 cM proximal from STS marker ABC155 (1), about 29.2 cM 

distal from the var1 (variegated 1) locus (1). 

Description: 

Seedling reaction types range from 0; or necrotic fleck to 23- or reduced pustule 

size (4, 6), but 0; reactions are more common with the Rph9.z allele, formerly 

Rph12.z (1, 2, 5). The resistant reaction of the Rph9.i allele is temperature 

sensitive and is inactivated above 20°C (3). Heterozygotes show an intermediate 

reaction to pathogenic isolates of Puccinia hordei (5). The original cultivar 

‘Trumpf’ was also marketed in the United Kingdom as ‘Triumph’. 


Natural occurrence in Abyssinian (Hor 2596, CIho 1234) (3, 7); natural 

occurrence in Hordeum vulgare subsp. spontaneum, but transferred to the 

cultivar Trumpf (Triumph, PI 548762, GSHO 1590) (2, 9). 


Rph9.i in Abyssinian (3, 7); Rph9.z in Trumpf (2, 9). 


Rph9.i in Abyssinian (GSHO 1601); Rph9.i in Bowman (PI 483237)*8 (GSHO 

1866); Rph12.z in Trumpf (GSHO 1590); Rph12.z in Bowman (PI 483237)*9 

(GSHO 2145). 

References: 

1. Borovkova, I.G., Y. Jin, and B.J. Steffenson. 1998. Chromosomal location and 

genetic relationship of leaf rust resistance genes Rph9 and Rph12 in barley. 

Phytopathology 88:76-80. 

2. Clifford, B.C. 1985. Barley leaf rust. p. 173-205. In W.R. Bushnell and A.P. 

Roelfs (eds.) The Cereal Rusts, Vol. II. Academic Press, New York. 

3. Clifford, B.C., and A.C.C. Udeogalanya. 1976. Hypersensitive resistance of 

barley to brown rust (Puccinia hordei Otth). p. 27-29. In Proc. 4th Eur. Medit. 

Cereal Rusts Conf., Interlaken, Switzerland. 

4. Golan, T., Y. Anikster, J.G. Moseman, and I. Wahl. 1978. A new virulent strain 

of Puccinia hordei. Euphytica 27:185-189. 

5. Jin, Y., G.D. Stadler, J.D. Franckowiak, and B.J. Steffenson. 1993. Linkage 

between leaf rust resistance genes and morphological markers in barley. 


6. Reinhold, M., and E.L. Sharp. 1982. Virulence types of Puccinia hordei from 

North America, North Africa and the Middle East. Plant. Dis. 66:1009-1011. 

7. Tan, B.H. 1977. A new gene for resistance to Puccinia hordei in certain 

Ethiopian barleys. Cereal Rust Bull. 5:39-43. 

201


8. Udeogalanya, A.C.C., and B.C. Clifford. 1976. Genetical, physiological and 

pathological relationships of resistance to Puccinia hordei and P. striiformis in 

Hordeum vulgare. Trans. Br. Mycol. Soc. 71:279-287. 

9. Walther, U. 1987. Inheritance of resistance to Puccinia hordei Otth in the 

spring barley variety Trumpf. Cereal Rusts Powdery Mildews Bull. 15:20-26. 

Prepared: 

J.D. Franckowiak and Y. Jin. 1997. BGN 26:81. 

J.D. Franckowiak and Y. Jin. 1997. BGN 26:281 as BGS 333, Reaction to 

Puccinia hordei 12, Rph12. 

Revised: 


202







Brachytic-w = brh.w (3). 

Inheritance: 


Located in chromosome 5HS [7S] (1), approximately 4.6 cM proximal from SSR 

marker Bmac0113 in bin 5H-04 (1). 

Description: 

Plants are about 5/6 of normal height and awns are about 3/4 of normal length. 

The rachis internodes are slightly shorter than normal for Bowman. The seedling 

leaf of brh7 plants is short and wide and leaf blades are wider than those of 

normal sibs. The Bowman line with brh7 showed less lodging than Bowman. 

Although the kernels of brh7 plants seem plumper and more globose shaped 

than those from normal sibs, the primary difference is a 10 to 15% reduction in 

kernel length. Kernel weights and grain yields of the brh7 line are slightly lower 

than those of normal Bowman (1, 2). 


An induced mutant in Volla (PI 280423) (4). 


brh7.w in Volla (7101, DWS1211) (4, 5). 


brh7.w in Volla (GSHO 1687); brh7.w in Bowman (PI 483237)*7 (GSHO 1943). 

References: 



96:654-662. 

2. Franckowiak, J.D. (Unpublished). 



4. Franckowiak, J.D., and A. Pecio. 1992. Coordinator’s report: semidwarf genes. 

A listing of genetic stocks. Barley Genet. Newsl. 21:116-127. 

5. Gaul, H. 1986. (Personal communications). 

Prepared: 


Revised: 

J.D. Franckowiak and L.S. Dahleen. 2007. BGN 37:203. 

203







Brachytic-v = brh.v (2). 

Inheritance: 


Located in chromosome 7HL [1L] (1), approximately 7.4 cM proximal from SSR 

marker Bmag0135 in bin 7H-13 (1). 

Description: 

Plants are less than 2/3 of normal height and awns are about 3/4 of normal 

length in the Bowman backcross-derived line. The peduncle is about 2/3 normal 

length. The rachis internodes are slightly shorter than normal. The tip of the spike 

has a fascinated appearance because spikelets are very close together. The 

seed yield of the Bowman line with brh16 was less than 1/3 of Bowman’s yield. 

Since kernels per spikes and kernel size were not reduced, much of the yield 

loss was probably associated with reduced tillering (1). The original introduction 

(HE 2816) contained two dwarf mutants, but only brh16.v gene was isolated in 

the Bowman backcross-derived line. 


Probably an ethyl methanesulphonate induced mutant in Korál (PI 467778) (4). 


brh16.v in HE 2816 (DWS1176) from a cross between two semidwarf mutants (3, 

4). 


brh16.v in HE 2816/Bowman (GSHO 1686); brh16.v in Bowman (PI 483237)*7 

(GSHO 2177). 

References: 



96:654-662. 



3. Franckowiak, J.D., and A. Pecio. 1992. Coordinator’s report: semidwarf genes. 

A listing of genetic stocks. Barley Genet. Newsl. 21:116-127. 

4. Váša, M. 1986. (Personal communications). 

Prepared: 


204



Locus name: Liguleless 1 

Locus symbol: lig1 

BGS 60, Liguleless 1, lig1 


Ligule and auricle less = al (9). 

Liguleless = li (8). 

Exauriculum = aur-a (1). 

Inheritance: 


Located in chromosome 2HL (6, 9, 10); about 25.1 cM distal from the mtt4 

(mottled leaf 4) locus (2); and near AFLP marker E3633-1 in subgroup 21 of the 

Proctor/Nudinka map (7). 

Description: 

The ligule and auricle of all leaves are absent, and the leaf blades are erect 

along the stem. Liguleless plants can be identified visually at all stages of growth 

(9). Reverse mutation of some mutants is possible (4). The fine structure analysis 

of the lig1 locus conducted by Konishi (5) showed that some mutants can 

recombine. Bowman backcross-derived lines with lig1 gene are similar in 

agronomic traits and maturity to Bowman (2). 


A spontaneous mutant in an unknown cultivar, Muyoji (liguleless) (8). 


lig1.my as Muyoji (OUL007) (9); lig1.ky in Koyo (PI 190819), lig1.a1 (OUM001), 

lig1.a2 in Akashinriki (PI 467400, OUJ659); lig1.c1, lig1.c2, lig1.c3, lig1.c4 in 

Chikurin Ibaraki 1 (OUJ030, CIho 7370) (5); aur-a.1 (lig1.b1) (NGB 114359), aura.2 

(lig1.b2) (NGB 114360), aur-a.7 (lig1.b7) (NGB 114365), aur-a.8 (lig1.b8) 

(NGB 114366), aur-a.9 (lig1.b9) (NGB 114367) in Bonus (PI 189763), aur-a.3 

(lig1.b3) (NGB 114361), aur-a.4 (lig1.b4) (NGB 114362), aur-a.5 (lig1.b5) (NGB 

114363), aur-a.6 (lig1.b6) (NGB 114364), aur-a.10 (lig1.b10) (NGB 114368) in 

Foma (CIho 11333) (5); aur-a.11 (NGB 114369), aur-a.12 (NGB 114370, NGB 

114371) in Kristina, aur-a.13 (NGB 114372), aur-a.14 (NGB 114373) in Bonus, 

aur-a.15 (NGB 119377) in Golf (PI 488529) (6); lig1.2 in Bonus, found in eli-2 

(eligulum-2) (NGB 115389) stock as the second mutant (2). 


lig1.my as Muyoji (GSHO 6); lig1.my in Bowman (PI 483237)*8 (GSHO 1930); 

lig1.2 in Bowman*5 (2). 

References: 



62:409-414. 


3. Hayashi, J., T. Konishi, I. Moriya, and R. Takahashi. 1984. Inheritance and 

linkage studies in barley. VI. Ten mutant genes located on chromosomes 1 to 7, 

except 3. Ber. Ohara Inst. landw. Biol., Okayama Univ. 18:227-250. 

4. Konishi, T. 1975. Reverse mutation at the ligule-less locus (li) of barley. BGN 

5:21-23. 

5. Konishi, T. 1981. Reverse mutation and interallelic recombination at the liguleless 

locus in barley. p. 838-845. In M.J.C. Ascher, R.P. Ellis, A.M. Hayter, and 

R.N.H. Whitehouse. (eds.) Barley Genetics. IV. Proc. Fourth Int. Barley Genet. 

Symp. Edinburgh. Edinburgh University Press. 

6. Lundqvist, U. (Unpublished). 

205


7. Pozzi, C., D. di Pietro, G. Halas, C. Roig, and F. Salamini. 2003. Integration of 

a barley (Hordeum vulgare) molecular linkage map with the position of genetic 



studies in barley: Supplement II, 1947-1953. Agron. J. 47:418-425. 


linkage studies in barley. Ber. Ohara Inst. landw. Forsch. 10:29-52. 

10. Woodward, R.W. 1957. Linkages in barley. Agron. J. 49:28-32. 

Prepared: 


Revised: 

J.D. Franckowiak, U. Lundqvist, T. Konishi. 1997. BGN26:96. 


206



Locus name: White streak 7 

Locus symbol: wst7 

BGS 79, White streak 7, wst7 


Ribbon grass = rb (6). 

White streak-k = wst,,k (10). 

White streak-B = wst,,B (8). 

Inheritance: 


Located in chromosome 2HL (5, 7, 8,9), about 22.0 cM distal from the gpa1 

(grandpa 1) locus (2, 9), over 29.4 cM distal from the lig1 (liguleless 1) locus (8), 

in bin 2H-15 about 6.1 cM from RFLP marker MWG949A (1). 

Description: 

Vertical white streaks of variable width and number develop in the leaf blades of 

young secondary tillers. Fewer white streaks and fewer tillers with white streaks 

occur as environmental conditions become warm. White streaks can be found 

until near maturity, but they are difficult to observe after heading under field 

conditions. Often the lower or first leaves on early tillers have more and wider 

streaks. The mutant has no apparent affect on agronomic traits in the Bowman 

backcross-derived line (4). 


A spontaneous mutant isolated by Robertson (6, 11). 


wst7.k in an unknown cultivar (2, 11). 


wst7.k in an unknown cultivar (GSHO 247); wst7.k from R.I. Wolfe's Multiple 

Recessive Marker Stock in Bowman (PI 483237)*7 (GSHO 1935). 

References: 





Genet. 103:415-424. 

2. Doney, D.L. 1961. An inheritance and linkage study of barley with special 

emphasis on purple pigmentation or the auricle. M.S. Thesis. Utah State Univ., 

Logan. 

3. Franckowiak, J.D. 1996. Coordinator's report: Chromosome 2. Barley Genet. 

Newsl. 25:88-90. 


5. Kasha, K.J. 1982. Coordinator's report: Chromosome 6. Barley Genet. Newsl. 

12:90-92. 


studies in barley: Supplement I, 1940-1946. J. Am. Soc. Agron. 39:464-473. 

7. Schondelmaier, J., G. Fischbeck, and A. Jahoor. 1993. Linkage studies 

between morphological and RFLP markers in the barley genome. Barley Genet. 

Newsl. 22:57-62. 

8. Shin, J.S., S. Chao, L. Corpuz, and T.K. Blake. 1990. A partial map of the 

barley genome incorporating restriction fragment length polymorphism, 

207


polymerase chain reaction, isozyme, and morphological marker loci. Genome 

23:803-810. 

9. Walker, G.W.R. 1974. Linkage data for rb and mt3. Barley Genet. Newsl. 4:90- 

91. 

10. Wolfe, R.I., and J.D. Franckowiak. 1991. Multiple dominant and recessive 

genetic marker stocks in spring barley. Barley Genet. Newsl. 20:117-121. 


Prepared: 

J.D. Franckowiak and R.I. Wolfe. 1997. BGN 26:117. 

Revised: 


208



Locus name: Zeocriton 1 

Locus symbol: Zeo1 

BGS 82, Zeocriton 1, Zeo1 


"Kurz und dicht" = Knd (6). 

Inheritance: 

Monofactorial incomplete dominant (5). 

Located in chromosome 2HL, about 9.2 cM distal from the lig1 (liguleless 1) 

locus (4), in bin 2H-13 about 7.3 cM distal from RFLP marker cnx1 (1). 

Description: 

Plants heterozygous for Zeo1 have short culms, compact spikes, and wide 

kernels. Homozygotes have shorter culms (short peduncle), very compact 

spikes, large outer glumes with long awns, and reduced fertility. Generally, the 

spike emerges from the side of the sheath in homozygotes. Although the name 

zeocriton is used for this gene, this gene is not from Spratt, the dense ear type 

described by Engledow (2). 


An X-ray induced mutant in Donaria (PI 161974) (5). 


Zeo1.a in Donaria (Mut 2657) (5); Zeo1.b, received as "Kurz und dicht" and 

placed in R.I. Wolfe's Multiple Dominant Marker Stock (GSHO 1614), was 

probably derived from Mut 2657 (3, 6). 


Zeo1.a in Donaria (GSHO 1613); Zeo1.a in Bowman (PI 483237)*5 (GSHO 

1931); Zeo1.b in Bowman*9 (GSHO 1932). 

References: 


S.F. Kramer, D. Kudrna, M. Li, O. Piera-Lizaragu, K. Sato, P. Szücs, T. Toojinda, 



Genet. 103:415-424. 

2. Engledow, F.L. 1924. Inheritance in barley. III. The awn and the lateral floret 

(cont'd): fluctuation: a linkage: multiple allelomorphs. J. Genet. 14:49-87. 

3. Franckowiak, J.D. 1992. Allelism tests among selected semidwarf barleys. 


4. Luna Villafaña, A., and J.D. Franckowiak. 1995. (Unpublished). 

5. Scholz, F., and O. Lehmann. 1958. Die Gaterslebener Mutanten der 

Saatgerste in Beziehung zur Formenmannigfaltigkeit der Art Hordeum vulgare 

L.s.l. I. Kulturpflanze 6:123-166. 

6. Wolfe, R.I. (Unpublished). 

Prepared: 

J.D. Franckowiak and R.I. Wolfe. 1997. BGN 26:120. 


209



Locus name: Yellow streak 4 

Locus symbol: yst4 

BGS 85, Yellow streak 4, yst4 


None. 

Inheritance: 


Located in chromosome 2HL, near the vrs1 (six-rowed spike 1) locus (2), in bin 

2H-07 near RFLP marker CDO537 (3). 

Description: 

Plants have a yellow-green color with numerous, vertical yellow streaks in the 

leaves. The yellow-green color is retained until maturity, but the yellow streaks 

may be difficult to observe after heading. Plant vigor and height are reduced, 

heading is delayed, and seed yields are low. 


A sodium azide induced mutant in Glenn (CIho 15769) (1). 


yst4.d in Glenn (DWS1059) (2). 


yst4.d in Glenn (GSHO 2502); yst4.d in Bowman (PI 483237)*7 (GSHO 1922). 

References: 

1. Faue, A.C. 1987. Chemical mutagenesis as a breeding tool for barley. M.S. 

Thesis. North Dakota State Univ., Fargo. 

2. Faue, A.C., A.E. Foster, and J.D. Franckowiak. 1989. Allelism testing of an 

induced yellow streak mutant with the three known yellow streak mutants. Barley 

Genet. Newsl. 19:15-16. 

3. Kleinhofs, A. 2002. Integrating molecular and morphological/physiological 

marker maps. Coordinator’s Report. Barley Genet. Newsl. 32:152-159. 

Prepared: 


Revised: 


210



Locus name: Chlorina seedling 14 

Locus symbol: fch14 

BGS 87, Chlorina seedling 14, fch14 


Chlorina seedling 14 = f14 (2). 

Inheritance: 


Located in chromosome 2HL (2), probably between the vrs1 (six-rowed spike 1) 

and the ant2 (anthocyanin-less 2) loci (2), likely in bin 2H-11 (3, 4). 

Description: 

Seedlings have a pale yellow-green color. The leaves gradually become greener 

starting at the tip of the leaf blade, and mutant plants are indistinguishable in 

color from normal sibs at heading (2). When grown in the field, plants produce 

slightly thinner kernels with about a 10% reduction in kernel weight (1). 


A spontaneous mutant in Shyri (Lignee 640//Kober/Teran 78) from Ecuador (2). 


fch14.w in Shyri (2, 5). 


fch14.w in Shyri (GSHO 1739); fch14.w in Bowman (PI 483237)*6 (GSHO 1911). 

References: 


2. Franckowiak, J.D. 1995. Notes on linkage drag in Bowman backcross derived 

lines of spring barley. Barley Genet. Newsl. 24:63-70. 


marker maps. Barley Genet. Newsl. 36:66-82. 

4. Kudrna, D., A. Kleinhofs, A. Kilian, and J. Soule. 1996. Integrating visual 

markers with the Steptoe x Morex RFLP map. p. 343. In A.E. Slinkard, G.J. 

Scoles, and B.G. Rossnagel (eds.) Proc. Fifth Int. Oat Conf. & Seventh Int. 

Barley Genet. Symp., Saskatoon. Univ. of Saskatchewan, Saskatoon. 

5. Rivendeneira, M. (Personal communications). 

Prepared: 


Revised: 


211







Resistance to Puccinia anomala Rostr = Pa (2). 

Resistance to Puccinia hordei Otth 2 = Pa2 (9, 15). 

Resistance to Puccinia hordei A = A (8, 9). 

Inheritance: 

Monofactorial incomplete dominant (2, 14). 

Located in chromosome 5HS [7S] (1), not in the long arm (10), distal from the 

secondary constriction (1), in bin 5H-04 about 3.5 cM proximal from RFLP 

marker CDO749 (1). 

Description: 

The seedling reaction type is 0 n - 1 c with race 4 culture 57-19 (2); heterozygotes 

have reaction types ranging from 1 to 3, depending on parents. Responses will 

vary for homozygotes and heterozygotes when different rust cultures are tested 

(8). 


Natural occurrence in Peruvian (CIho 935) and several other cultivars (2, 4, 6, 

12, 15, 16). 


Rph2.b in Peruvian (4, 12); Rph2.j in Batna (CIho 3391) (7, 12); Rph2.k in 

Weider (No 22, PI 39398) (2, 11, 15); Rph2.l in Juliaca (PI 39151) (3, 12); 

Rph2.m in Kwan (PI 39367, GSHO 1392) ( 2, 4, 12); Rph2.n in Chilean D (PI 

48136) (4, 14); an allele at the Rph2 locus is present in Purple Nepal (CIho 

1373), Modia (CIho 2483), Morocco (CIho 4975), Barley 305 (CIho 6015), Marco 

(PI 94877) (2); Austral (CIho 6358) (4, 6, 7, 12); Marocaine 079 (CIho 8334) (6); 

Q21861 (PI 584766), TR306 (1, 13); accessions with a second Rph gene 

besides the Rph2 allele include Carre 180 (CIho 3390), CIho 14077 (12); Ricardo 

(PI 45492) (2, 14, 16); Ariana (CIho 14081) (11, 12, 16); Quinn (PI 39401) (8, 9); 

Bolivia (PI 36360) (2, 8, 9); Reka 1 (CIho 5051) (4, 6, 7, 12); tentative Rph2 allele 

symbols are Rph2.q in Quinn, Rph2.r in Bolivia (GSHO 1598), Rph2.s in Ricardo, 

Rph2.t in Reka 1 (GSHO 1594), and Rph2.u in Ariana based on differential 

reactions and different cultivar origins (5, 8, 9, 12); Rph2.y from HJ198*3/HS2310 

(PI 531841, GSHO 1595) (3). 


Rph2.b in Peruvian (GSHO 1593); Rph2.b in Bowman (PI 483237)*3 (GSHO 

2320); Rph2.t from Rika 1 in Bowman*8 (GSHO 2321). 

References 

1. Borovkova, I.G., Y. Jin, B.J. Steffenson, A. Kilian, T.K. Blake, and A. Kleinhofs. 

1997. Identification and mapping of a leaf rust resistance gene in the barley line 

Q21861. Genome 40:236-241. 

2. Henderson, M.T. 1945. Studies of the sources of resistance and inheritance of 

reaction to leaf rust, Puccinia anomala Rostr., in barley. Ph.D. Thesis. Univ. of 

Minnesota, St. Paul. 

3. Jin, Y., G.H. Cui, B.J. Steffenson, and J.D. Franckowiak. 1996. New leaf rust 

resistance genes in barley and their allelic and linkage relationships with other 

Rph genes. Phytopathology 86:887-890. 

212


4. Levine, M.N., and W.J. Cherewick. 1952. Studies on dwarf leaf rust of barley. 

U.S. Dept. Agr. Tech. Bull.1056. 17p. 

5. Moseman, J.G., and L.W. Greeley. 1965. New physiological strains of Puccinia 

hordei among physiological races identified in the United States from 1959 

through 1964. Plant Dis. Rep. 49:575-578. 

6. Moseman, J.G., and C.W. Roane. 1959. Physiologic races of barley leaf rust 

(Puccinia hordei) isolated in the United States from 1952 to 1958. Plant Dis. Rep. 

43:1000-1003. 

7. Reinhold, M., and E.L. Sharp. 1982. Virulence types of Puccinia hordei from 

North America, North Africa and the Middle East. Plant. Dis. 66:1009-1011. 

8. Roane, C.W. 1962. Inheritance of reaction to Puccinia hordei in barley. I. 

Genes for resistance among North American race differentiating varieties. 


9. Roane, C.W., and T.M. Starling. 1967. Inheritance of reaction to Puccinia 

hordei in barley. II. Gene symbols for loci in different cultivars. Phytopathology 

57:66-68. 

10. Roane, C.W., and T.M. Starling. 1989. Linkage studies with genes 

conditioning leaf rust reaction in barley. Barley Newsl. 33:190-192. 

11. Sharp, E.L., and M. Reinhold. 1982. Resistance gene sources to Puccinia 

hordei in barley. Plant Dis. 66:1012-1013. 

12. Starling, T.M. 1955. Sources, inheritance, and linkage relationships of 

resistance to race 4 of leaf rust (Puccinia hordei Otth), race 9 of powdery mildew 

(Erysiphe graminis hordei El. Marchal), and certain agronomic characters in 

barley. Iowa State Coll. J. Sci. 30:438-439. 

13. Steffenson, B.J., and Y. Jin. 1997. A multi-allelic series at the Rph2 locus for 

leaf rust resistance in barley. Cereal Rusts Powdery Mildews Bull. (in press). 

14. Tan, B.H. 1977. Evaluation host differentials of Puccinia hordei. Cereal Rust 

Bull. 5:17-23. 

15. Watson, I.A., and F.C. Butler. 1947. Resistance to barley leaf rust (Puccinia 

anomala Rostr.). Linnean Soc. New South Wales, Proc. 72:379-386. 

16. Zloten, R.R. 1952. The inheritance of reaction to leaf rust in barley. M.S. 

Thesis. Univ. of Manitoba, Winnipeg. 

Prepared: 

Y. Jin and J.D. Franckowiak. 1997. BGN 26:126-127. 

Revised: 


213







Rph16 = Reaction to Puccinia hordei 16 (6, 9). 

Inheritance: 

Monofactorial dominant (1, 2). 

Located in chromosome 2HS (1, 6); over 32.3 cM proximal from the vrs1 (sixrowed 

spike 1) locus (1); in bin 2H-6 near molecular markers MWG874 (6) and 

MWG2133 (9); cosegregation with AFLP marker P13M40 (9); about 25.2cM 

distal from the centromere (9); about 14 cM proximal from the Eam1 (Early 

maturity 1) locus (3). 

Description: 

The seedling reaction to most isolates of Puccinia hordei is a relatively large 

necrotic fleck, hypersensitive reaction (1). The seedling infection type of 

heterozygotes is indistinguishable from that of homozygous resistant seedlings. 

Alleles at this locus were found in six of the first seven Rph genes from Hordeum 

vulgare subsp spontaneum evaluated in Bowman backcross-derived lines (1, 2). 

The Rph15 locus is likely allelic to Rph16 based on the failure to recover 

susceptible recombinants (9). Only one of the 350 leaf rust isolates (90-3 from 

Israel) was found to be virulent on Rph15 lines (4, 9). Resistance to isolate 90-3 

was observed in progeny from a cross between a line with Rph15 to another 

source of leaf rust resistance (8). Rph15 represents one of the most effective leaf 

rust resistance genes reported in Hordeum vulgare (9). 


Natural occurrence in accession PI 355447 of Hordeum vulgare subsp 

spontaneum, but isolated in a selection that contained one Rph gene from the 

original accession crossed to Bowman (PI 483237) (1, 7). 


Rph15.ad in PI 355447 (1, 2, 5), PI 354937, PI 391024, PI 391069, PI 391089, 

and PI 466245 (1, 2); Rph15.ae from HS084 (6, 9); PI 466245 has at least two 

genes for leaf rust resistance (7). 


Rph15.ad in selection from a cross to Bowman (GSHO 1586); Rph15.ad in 


References: 

1. Chicaiza, O. 1996. Genetic control of leaf rust in barley. Ph.D. dissertation, 

North Dakota State Univ., Fargo. 

2. Chicaiza, O., J.D. Franckowiak, and B.J. Steffenson. 1996. New sources of 

resistance to leaf rust in barley. pp. 706-708. In A.E. Slinkard, G.J. Scoles, and 

B.G. Rossnagel (eds.). Proc. Fifth Int. Oat Conf. & Seventh Int. Barley Genet. 

Symp., Saskatoon. Univ. of Saskatchewan, Saskatoon. 

3. Falk, A.B. (Personal communications). 

4. Fetch, T.G. Jr., B.J. Steffenson, and Y. Jin. 1998. Worldwide virulence of 

Puccinia hordei on barley. Phytopathology 88:S28. 

5. Franckowiak, J.D., Y. Jin, and B.J. Steffenson. 1997. Recommended allele 

symbols for leaf rust resistance genes in barley. Barley Genet. Newsl. 27:36-44. 

6. Ivandic, V.,U. Walther, and A. Graner. 1998. Molecular mapping of a new gene 

214


in wild barley conferring complete resistance to leaf rust (Puccinia hordei Otth). 


7. Jin, Y., and B.J. Steffenson. 1994. Inheritance of resistance to Puccinia hordei 

in cultivated and wild barley. J. Hered. 85:451-454. 

8. Sun, Y., J.D. Franckowiak, and S.M. Neate. 2005. Reactions of barley lines to 

leaf rust, caused by Puccinia hordei. Proceedings of the 18th North American 

Barley Researchers Workshop, July 17-20, 2005, Red Deer, Alberta, Canada 

http://www1.agric.gov.ab.ca/$department/deptdocs.nsf/all/fcd10135#Reactions 

9. Weerasena, J.S., B.J. Steffenson, and A.B. Falk. 2004. Conversion of an 

amplified fragment length polymorphism marker into a co-dominant marker in the 

mapping of the Rph15 gene conferring resistance to barley leaf rust, Puccinia 

hordei Otth. Theor. Appl. Genet. 108:712-719. 

Prepared: 

J.D. Franckowiak and O. Chicaiza. 1998. BGN 28:29. 

Revised: 



215



Locus name: Early maturity 6 

Locus symbol: Eam6 

BGS 98, Early maturity 6, Eam6 


Early heading = Ea (9). 

Early maturity 6 = Ea6 (7). 

Inheritance: 

Monofactorial dominant (9). 

Located in chromosome 2HS, about 13.5 cM proximal from the vrs1 (six-rowed 

spike 1) locus (9), near the gsh5 (glossy sheath 5) locus based on linkage drag 

(1, 2), near molecular marker ABC167b in bin 2H-08 (5, 8). 

Description: 

Alleles at the Eam6 locus alter the timing of floral initiation when barley is grown 

under long-day conditions. In temperate climates, the Eam6.h gene induces 

spring barley to head two to five days earlier than plants with the recessive allele 

(1, 5). A much stronger response to long photoperiods is associated with the 

Eam1 gene. Tohno-oka et al. (8) reported that Eam6 gene from Morex (CIho 

15773) is effective when the photoperiod is 13 hours or longer and that the Eam1 

gene from Steptoe (CIho 15229) induces early heading when the photoperiod is 

14 hours or longer. In North Dakota, plants with both the Eam1 and Eam6 genes 

head one to two days earlier than those with only the Eam1 gene (1). The 

factors, Eam1 and Eam6, for early heading were studied possibly by Yasuda (10) 

and named “A” and “B”, respectively. A QTL for long-day photoperiod response 

in North American two-rowed and six-rowed barleys in the Eam6 region of 2H 

was reported by Moralejo et al. (6) and Horsley et al. (3), respectively. Eam6 may 

interact with other maturity genes because a QTL for early heading was detected 

in 2HS under both short- and long-day environments in the Harrington/Morex 

mapping population (4). 


Natural occurrence in many spring, six-rowed barley, represented by the cultivar 

Morex (CIho 15773) (8). 


Eam6.h in an unknown cultivar (8), possibly Trebi (CIho 936) (1); Eam6.h in 

Morex (4, 5, 8). 


Eam6.h in Morex (CIho 15773, GSHO 2492); Eam6.h from Nordic (CIho 15216) 

in Bowman (PI 483237) (1). 

References: 

1. Franckowiak, J.D., and G. Yu (Unpublished). 

2. Franckowiak, J.D., and U. Lundqvist. 1997. BGS 355, glossy sheath 5, gsh5. 


3. Horsley, R.D., D. Schmierer, C. Maier, D. Kudrna, C.A. Urrea, B.J. Steffenson, 

P.B. Schwarz, J.D. Franckowiak, M.J. Green, B. Zhang, and A. Kleinhofs. 2006. 

Identification of QTLs associated with Fusarium head blight resistance in barley 

accession CIho 4196. Crop Sci. 46:145-156. 

4. Krasheninnik, N. 2005. Genetic association of Fusarium head blight resistance 

and morphological traits in barley. Ph.D. Thesis. North Dakota state Univ., Fargo, 

ND. 

216


5. Marquez-Cedillo, L.A., P.M. Hayes, A. Kleinhofs, W.G. Legge, B.G. 

Rossnagel, K. Sato, S.E. Ullrich, and D. M. Wesenberg. 2001. QTL analysis of 

agronomic traits in barley based on the doubled haploid progeny of two elite 

North American varieties representing different germplasm groups. Theor. Appl. 

Genet. 103:625-637. 

6. Moralejo, M., J.S. Swanston, P. Muñoz, D. Prada, M. Elía, J.R. Russell, L. 

Ramsay, L. Cistué, P. Codesal, A.M. Casa, I. Romagosa, W. Powell, and J.L. 

Molina-Cano. 2004. Use of new EST markers to elucidate the genetic differences 

in grain protein content between European and North American two-rowed 

malting barleys. Theor. Appl. Genet. 110:116-125. 

7. Robertson, D.W., G.A. Wiebe, R.G. Shands, and A. Hagberg. 1965. A 

summary of linkage studies in cultivated barley, Hordeum species: Supplement 

III, 1954-1963. Crop Sci. 5:33-43. 

8. Tohno-oka, T., M. Ishit, R. Kanatani, H. Takahashi, and K. Takeda. 2000. 

Genetic analysis of photoperiodic response of barley in different daylength 

conditions. p. 239-241. In S. Logue (ed.) Barley Genetics VIII. Volume III. Proc. 

Eighth Int. Barley Genet. Symp., Adelaide. Dept. Plant Science, Waite Campus, 

Adelaide University, Glen Osmond, South Australia. 


10. Yasuda, S. 1958. (Genetic analysis of the response to short photoperiod in a 

barley cross by means of the partitioning method.) Nogaku Kenkyu 46:54-62 [In 

Japanese]. 

Prepared: 


Revised: 


217


BGS 100, Slender dwarf 4, sld4 


Locus name: Slender dwarf 4 

Locus symbol: sld4 


Slender dwarf d = sld.d (2). 

Inheritance: 


Located in chromosome 7HS [5S] (4), near AFLP marker E 4134-2 in subgroup 6 

of the Proctor/Nudinka map (4). 

Description: 

Plants with the sld4.d gene have reduced vigor and are light green in color during 

early stages of growth (6). The sld4.d mutant is apparently very environmentally 

sensitive in the Bowman derived line. Plants can vary from less than 1/2 to 3/4 of 

normal height and heading can be delayed over 10 days in certain environments. 

The number of fertile spikelets per spike varies from 2/3 normal to near normal. 

Depending on the delay in heading, kernels vary from very thin to near normal. 

Grain yield of the Bowman backcross-derived line can vary from very low to 

nearly normal (1). 


A neutron induced mutant in Two-row Glacier (5). (Glacier is available as CIho 

6976.) 


sld4.d in Two-row Glacier (80-T-5899-2-13, DWS1368) (2, 3, 5). 


sld4.d in Two-row Glacier (GSHO 2479); sld4.d in Bowman (PI 483237)*7 

(GSHO 1880). 

References: 


2. Franckowiak, J.D. 1999. Coordinator’s report: Semidwarf genes. Barley Genet. 

Newsl. 29:74-79. 

3. Franckowiak, J.D., and A. Pecio. 1992. Coordinator’s report: Semidwarf 

genes. A listing of genetic stocks. Barley Genet. Newsl. 21:116-127. 




5. Ramage, R.T., and P. Curtis. 1981. A light green, dwarf mutant located on 

chromosome 2. Barley Genet. Newsl. 11:37-38. 

6. Ramage, R.T., and R.A. Ronstadt-Smith. 1983. Location of a light green dwarf 

mutant on chromosome 2. Barley Genet. Newsl. 13:62-64. 

Prepared: 


Revised: 


218


BGS 101, Absent lower laterals 1, als1 


Locus name: Absent lower laterals 1 

Locus symbol: als1 


Absent lower laterals = als (2). 

Inheritance: 


Located in chromosome 3HL (2, 3, 5, 6), about 31.2 cM distal from the uzu1 (uzu 

1) locus (2), about 39.7 cM proximal from the cur2 (curly 2) locus (3), and near 

AFLP marker E4234-11 in subgroup 28 of the Proctor/Nudinka map (4). 

Description: 

Lateral spikelets at the base of the spike fail to develop or are partially 

developed. Tillers are large, coarse, and stiff, and only 1 or 2 tillers are produced 

in the six-rowed stock. The plants resemble those of the (cul2) uniculm 2 mutant 

(2). Plants of the Bowman backcross-derived line commonly produce 3 to 5 tillers 

with short spikes; and seed yields are very low (1). 


A gamma-ray induced mutant in Montcalm (CIho 7149) (2). 


als1.a in Montcalm (Alb Acc 281) (2). 


als1.a in Montcalm (GSHO 1065); als1.a in Bowman (PI 483237)*7 (GSHO 

1990). 

References: 

1. Babb, S., and G.J. Muehlbauer. 2003. Genetic and morphological 

characterization of the barley uniculm 2 (cul2) mutant. Theor. Appl. Genet. 

106:846-857. 

2. Kasha, K.J., and G.W.R. Walker. 1960. Several recent barley mutants and 

their linkages. Can. J. Genet. Cytol. 2:397-415. 

3. Konishi, T., J. Hayashi, I. Moriya, and R. Takahashi. 1984. Inheritance and 

linkage studies in barley. VII. Location of six new mutant genes on chromosome 

3. Ber. Ohara Inst. landw. Biol., Okayama Univ. 18:251-264. 




5. Shahla, A., and T. Tsuchiya. 1983. Telotrisomic analysis in Triplo 3S in barley. 

Barley Genet. Newsl. 13:25. 

6. Singh, R.J., and T. Tsuchiya. 1974. Further information on telotrisomic 


Prepared: 


Revised: 



219


BGS 102, Uzu 1, uzu1 


Locus name: Uzu 1 (semi-brachytic) 

Locus symbol: uzu1 


Normal vs uzu = h (12). 

Uzu = u (4). 

Uzu (semi-brachytic) = uz (11). 

Uzu 2 = uz2 (3, 13, 15). 

Uzu 3 = uz3 (3, 13, 15). 

Hordeum vulgare BR-insensitive 1 = HvBRI1 (1). 

Inheritance: 

Monofactorial recessive (4, 7, 9, 11). 

Located in chromosome 3HL (5, 6, 11), about 17.6 cM proximal from the alm1 

(albino lemma 1) locus (10), in bin 3H-06 near cDNA marker, C1271 (1). 

Description: 

The uzu1.a gene has pleiotropic effects on the elongation of the coleoptile, leaf, 

culm, rachis internode, awn, glume, and kernel (8, 9, 11). These organs are often 

reduced in length and increased in width. Changes in organ length are 

temperature sensitive, but heading date and maturity are unaltered. The 

coleoptile of uzu plants shows a prominent projection or hook near the apex. 

Sometimes the coleoptile of the mutant shows a V-shaped notch on the side 

opposite from the projection. Thus, the apex of the coleoptile has two notches, 

one on each side (9, 13, 14). The temperature sensitive reduction in culm length 

of uzu1.a plants ranges from less than 15% in cool environments to over 75% in 

warm ones. Chono et al. (1) reported that the uzu1.a or HVBRI1 gene is caused 

by a mutation that changed a highly conserved residue of the kinase domain of 

BRI1 (Arabidopsis BR-insensitive 1) (brassinosteroids) receptor protein from His- 

857 to Arg-857. 


Natural occurrence in many cultivars of Japanese origin (8, 9). 


uzu1.a in many Japanese cultivars (9, 13, 15); uzu1.b (092AR) in Aramir (PI 

467781) (2). 


uzu1.a in Baitori 11 (OUJ371, PI 182624, GSHO 1300); uzu1.a in Bowman (PI 

483237)*7 (GSHO 1963). 

References: 

1. Chono, M., I. Honda, H. Zeniya, K. Yoneyama, D. Saisho, K. Takeda, S. 

Takatsuto, T. Hoshino and Y. Watanabe. 2003. A semidwarf phenotype of barley 

uzu results from a nucleotide substitution in the gene encoding a putative 

brassinosteroid receptor. Plant Physiol. 133:1209-1219. 

2. Gruszka, D., J. Zbieszczyk, M. Kwasniewski, I. Szarejko and M. Maluszynski. 

2006. A new allele in a uzu gene encoding brassinosteroid receptor. Barley 


3. Leonard, W.H., H.O. Mann, and L. Powers. 1957. Partitioning method of 

genetic analysis applied to plant height inheritance in barley. Colorado Agric. 

Expt. St. Tech. Bull. 60:1-24. 


220



5. Singh, R.J., A. Shahla, and T. Tsuchiya. 1982. Telotrisomic analysis of three 

genes with newly obtained telotrisomic, Triplo 3S, in barley. BGN 12:42-44. 

6. Singh, R.J., and T. Tsuchiya. 1974. Further information on telotrisomic 


7. So, M., S. Ogura, and Y. Imai. 1919. [A linkage group in barley.] J. Sci. Agric. 

Soc. Jpn. 208:1093-1117. [In Japanese.] 

8. Takahashi, R. 1942. Studies on the classification and the geographical 

distribution of the Japanese barley varieties. I. Significance of the bimodal curve 

of the coleoptile length. Ber. Ohara Inst. landw. Forsch. 9:71-90. 

9. Takahashi, R. 1951. Studies on the classification and geographical distribution 

of the Japanese barley varieties. II. Correlative inheritance of some quantitative 

characters with the ear types. Ber. Ohara Inst. landw. Forsch. 9:383-398. 

10. Takahashi, R., and J. Hayashi. 1959. Linkage study of albino lemma 

character in barley. Ber. Ohara Inst. landw. Biol., Okayama Univ. 11:132-140. 

11. Takahashi, R., and J. Yamamoto. 1951. Studies on the classification and 

geographical distribution of the Japanese barley varieties. III. On the linkage 

relation and the origin of the "uzu" or semi-brachytic character in barley. Ber. 

Ohara Inst. landw. Forsch. 9:399-410. 

12. Takezaki, Y. 1927. On the genetical formulae of the length of spikes and 

awns in barley, with reference to the computation of the valency of the heredity 

factors. Rep. Agric. Exp. Sta., Tokyo 46:1-42. 

13. Tsuchiya, T. 1972. Genetics of uz, uz2 and uz3 for semi-brachytic mutations 

in barley. Barley Genet. Newsl. 2:87-90. 

14. Tsuchiya, T. 1976. Allelism testing in barley. II. Allelic relationships of three 

uzu genes. Crop Sci. 16:496-499. 

15. Tsuchiya, T. 1981. Further results on the allelic relationships of three uzu 

genes in barley. J. Hered. 72:455-458. 

Prepared: 


Revised: 

T. Tsuchiya. 1984. BGN 14:92. 



221



Locus name: Albino lemma 1 

Locus symbol: alm1 

BGS 108, Albino lemma 1, alm1 


Albino lemma = al (9). 

Eburatum = ebu-a (3). 

Inheritance: 


Located in chromosome 3HS (9), about 16.5 cM distal from the uzu1 (uzu 1) 

locus (2, 5, 6, 7, 8, 9), in bin 3H-04 about 4.8 cM proximal from RFLP marker 

MWG844B (1). 

Description: 

The lemma and palea are white in color and mostly devoid of chlorophyll, but 

they terminate into green tips with green awns. The basal part of lower leaf 

sheaths and stem nodes are devoid of chlorophyll. Ligules and joints between 

the leaf sheath and blade are white in color (9, 10). Plant vigor is reduced slightly 

and maturity is delayed in the Bowman backcross-derived line. 


Spontaneous occurrence in an unknown cultivar (Russia 82) (OUU086, NSL 

43389) (9). 


alm1.a in Russia 82 (9); alm1.b in Liberty (CIho 9549) (2); alm1.c (Mut 966/61) in 

Proctor (PI 280420) (4); ebu-a.1 (NGB 115236), -a.2 (NGB 115237), -a.3 (NGB 

115238) in Foma (CIho 11333) (3, 10); ebu-a.4 (NGB 115239), -a.5 (NGB 

115240) in Foma (6). 


alm1.a in Russia 82 (GSHO 270); alm1.a in Bowman (PI 483237)*8 (GSHO 

1953). 

References: 





Genet. 103:415-424. 

2. Eslick, R.F., W.L. McProud. 1974. Positioning of the male sterile 5 (msg5) on 




62:409-414. 

4. Häuser, H., and G. Fischbeck. 1972. Translocations and genetic analysis of 

other mutants. Barley Genet. Newsl. 2:28-29. 

5. Konishi, T., J. Hayashi, I. Moriya, and R. Takahashi. 1984. Inheritance and 

linkage studies in barley. VII. Location of six new mutant genes on chromosome 

3. Ber. Ohara Inst. landw. Biol., Okayama Univ. 18:251-264. 


7. Moriya, I., and R. Takahashi. 1980. Linkage studies of three barley mutants. 


8. Nonaka, S. 1973. A new type of cultivar, Mitake, with very few in number, but 

222


thick and stiff culms. Barley Genet. Newsl. 3:45-47. 

9. Takahashi, R., and J. Hayashi. 1959. Linkage study of albino lemma character 

in barley. Ber. Ohara Inst. landw. Biol., Okayama Univ. 11:132-140. 

10. Tsuchiya, T. 1973. Allelism testing between established marker stocks and 

Swedish mutants. Barley Genet. Newsl. 3:67-68. 

Prepared: 


Revised: 

T. Tsuchiya. 1980. BGN 10:111. 

J.D. Franckowiak and U. Lundqvist. 1997. BGN 26:143. 


223







Resistance to Puccinia hordei Otth 5 = Pa5 (6, 7). 

Resistance to Puccinia hordei B = B (5). 

Resistance to Puccinia hordei Otth = X (5, 6). 

Resistance to Puccinia hordei Otth = Pax (6). 

Resistance to Puccinia hordei 6 = Rph6.f (11). 

Inheritance: 

Monofactorial incomplete dominant (3, 5, 6). 

Located in chromosome 3HS (4, 11); about 7.0 cM distal from Rph7 (11), about 

0.5 cM proximal from RFLP marker CDO549 (11), about 2.5 cM distal from RFLP 

marker MWG2021 (4). 

Description: 

Rph5.e in Magnif 102 showed a seedling infection type of 0 - 0; c with race 4 

culture 57-19, and Rph6.f from Bolivia had a 0; n - 1 c seedling infection type with 

race 4 culture 57-19. (3). Heterozygotes frequently show an intermediate 

response (type 2 or 3 reaction) to inoculation with pathogenic races, and 

incomplete dominance is observed in segregating progenies (3, 5, 6). Zhong et 

al. (11) demonstrated that Rph5.e is allelic to the Rph6.f gene extracted from 

Bolivia (PI 36360). Rph6.f was identified as a monofactorial dominant, but an 

allele at the Rph2 (reaction to Puccinia hordei 2) locus is present in the original 

cultivar Bolivia (PI 36360) (5, 6, 8). 


Natural occurrence in Quinn (PI 39401) (6, 10); natural occurrence in Bolivia (PI 

36360) (2, 5). 


Rph5.e in Magnif 102 (PI 337140) (10), Rph5.f (formerly Rph6.f) in Bolivia (11), 

Rph5.ai in Quinn along with Rph2.q (5, 6). 


Rph5.e in Malteria Heda*4/Quinn (Magnif 102, GSHO 1597) (10); Rph5.e in 

Bowman (PI 483237)*8 (GSHO 1865); Rph5.f in Bowman*8 (GSHO 2323); 

Rph6.f in Bolivia (GSHO 1598); Rph6.f (without an Rph2 allele) in Bowman (PI 

483237)*4 (GSHO 2323) (1). 

References: 

1. Chicaiza, O., J.D. Franckowiak, and B.J. Steffenson. 1996. Backcross-derived 

lines of barley differing for leaf rust resistance genes. pp. 198-200. In G.H.J. 

Kema, R.E. Niks, and R.A. Daamen (eds.) Proc. 9th Eur. & Medit. Cereal Rusts 

& Mildews Conf. Drukkerij Ponsen en Looijen B.V., Wageningen. 

2. Henderson, M.T. 1945. Studies of the sources of resistance and inheritance of 

reaction to leaf rust, Puccinia anomala Rostr., in barley. Ph.D. Thesis. Univ. of 

Minnesota, St. Paul. 

3. Jin, Y., G.H. Cui, B.J. Steffenson, and J.D. Franckowiak. 1996. New leaf rust 

resistance genes in barley and their allelic and linkage relationships with other 

Rph genes. Phytopathology 86:887-890. 

4. Mammadov, J.A., J.C. Zwonitzer, R.M. Biyashev, C.A. Griffey, Y. Jin, B.J. 

Steffenson, and M.A. Saghai Maroof. 2003. Molecular mapping of leaf rust 

224


resistance gene Rph5 in barley. Crop Sci. 43:388-393. 

5. Roane, C.W. 1962. Inheritance of reaction to Puccinia hordei in barley. I. 

Genes for resistance among North American race differentiating varieties. 



hordei in barley. II. Gene symbols for loci in differential cultivars. Phytopathology 

57:66-68. 


hordei in barley. III. Genes in the cultivars Cebada Capa and Franger. 










10. Yahyaoui, A.H., and E.L. Sharp. 1987. Virulence spectrum of Puccinia hordei 

in North Africa and the Middle East. Plant Dis. 71:597-598. 

11. Zhong, S., R.J. Effertz, Y. Jin, J.D. Franckowiak, and B.J. Steffenson. 2003. 

Molecular mapping of the leaf rust resistance gene Rph6 in barley and its linkage 

relationships with Rph5 and Rph7. Phytopathology 93:604-609. 

Prepared: 

C.W. Roane. 1976. BGN 6:122. 

J.D. Franckowiak and Y. Jin. 1997. BGN 26:501, as BGS 575, Reaction to 

Puccinia hordei 6, Rph6. 

Revised: 


J.D. Franckowiak and B.J. Steffenson. 2005. BGN 35:188. 


225




Locus symbol: eam10 

BGS 130, Early maturity 10, eam10 


Early maturity sp = easp (8). 

Inheritance: 


Located in chromosome 3HL (8); about 2.0 ± 5.8 cM from the Est1-Est4 

(esterase 1, esterase 4) locus (8); about 5.8 cM distal from RFLP marker 

Xmwg546 (1). 

Description: 

In winter nurseries at Cuidad Obregón, Sonora, Mexico and Davis, California, 

USA, plants of Super Precoz 2H head about 11 days earlier than lines with the 

genes eam7.g or eam8.k for photoperiod insensitivity from Atsel and Sv Mari, 

respectively (8). The eam10.m gene appears to suppress expression of the 

eam7.g and eam8.k genes (8). Plants expressing eam10.m become chlorotic 

(yellow green) under photothermal stress. Zeaxanthin increases at the expense 

of chlorophyll and other pigments (7). The chlorotic appearance is similar to that 

observed in plants homozygous for other recessive genes for early maturity 

(eam7, eam8, and eam9) (2, 5, 7). Plants in the Bowman eam10.m line head two 

days earlier than Bowman under long days and are slightly shorter (5). 


Present in Super Precoz 2H (PI 527381) from Russia (7), but originating probably 

as an induced mutant in MC20 (3, 4, 7). 


eam10.m in Super Precoz 2H plus a dominant maturity enhancer ( 4, 5, 7); 

eam10.m in Amber Nude without the enhancer (4). 


eam10.m in Super Precoz 2H (GSHO 2504); eam10.m in Amber Nude (GSHO 

2505); eam10.m from Super Precoz in Bowman (PI 483237)*5. 

References: 

1. Börner, A., G.H. Buck-Sorlin, P.M. Hayes, S. Malyshev, and V. Korzun. 2002. 

Molecular mapping of major genes and quantitative trait loci determining 

flowering time in response to photoperiod in barley. Plant Breed. 121:129-132. 

2. Dormling, I., and Å. Gustafsson. 1969. Phytotron cultivation of early barley 

mutants. Theor. Appl. Genet. 39:51-61. 

3. Favret, E.A. 1972. El mejoramiento de las plantas por induccíon de 

mutaciones en latinoamerica. p. 49-59. In Induced Mutations and Plant 

Improvement. Int. Atomic Energy Agency, Vienna. 

4. Favret, E.A., and G.S. Ryan. 1966. New useful mutants in plant breeding. p. 

49-61. In Mutations in Plant Breeding. Int. Atomic Energy Agency, Vienna. 


6. Gallagher, L.W. (Unpublished). 

7. Gallagher, L.W., A.A. Hafez, S.S. Goyal, and D.W. Rains. 1994. Nuclear 

mutations affecting chloroplastic pigments of photoperiod-insensitive barley. 

Plant Breed. 113:65-70. 

8. Gallagher, L.W., K.M. Soliman, and H. Vivar. 1991. Interactions among loci 

conferring photoperiod insensitivity for heading time in spring barley. Crop Sci. 

226


31:256-261. 

Prepared: 

L.W. Gallagher and J.D. Franckowiak. 1997. BGN 26:166. 

Revised: 


227







Resistance to Puccinia hordei Otth y = Pay (7). 



Inheritance: 

Monofactorial dominant (7, 10). 

Located in chromosome 3HS (14, 15), linkage to markers in the centromeric 

region was reported (11), about 24.0 cM from the ant17 (proanthocyanidin-free 

17) locus (5), in bin 3H-01 about 1.3 cM distal from RFLP marker cMWG691 (6), 

about 3.2 cM from receptor-like kinase gene Hv3Lrk (2), about 7.0 cM proximal 

from Rph5 locus (16). 

Description: 

The seedling reaction type is 0; n - 1 c (4, 11). Temperature studies show that 

resistance conferred by the Rph7.g gene is not expressed well above 20ºC (4, 

15). Cebada Capa is indistinguishable from the cultivar Forrajera Klein (possibly 

identical to PI 331904) (1). The Rph7 regions from Morex (rph7) and Cebada 

Capa (Rph7) were sequenced and compared to similar regions from 39 other 

cultivars. The data suggest that a large amount of haplotype variability exists in 

the cultivated barley gene pool and indicate rapid and recent divergence at this 

locus (12). 


Natural occurrence in Cebada Capa (PI 53911) (7, 8, 10). 


Rph7.g in Cebada Capa (7, 8, 10); Rph7.g in France 7 and France 21 (7); 

Rph7.g in Dabat, Gondar (PI 199964), and La Estanzuela (9, 13, 16); Rph7.ac in 

Tu17a, a Bowman backcross-derived line from Tunisia 17 (3). 


Rph7.g in Cebada Capa (GSHO 1318); Rph7.g in Bowman (PI 483237)*8 

(GSHO 1994). 

References: 

1. Arias, G. (Personal communications). 

2. Brunner, S., B. Keller, and C. Feuillet. 2000. Molecular mapping of the Rph7.g 

leaf rust resistance gene in barley (Hordeum vulgare L.). Theor. Appl. Genet. 

101:783-788. 

3. Chicaiza, O., J.D. Franckowiak, and B.J. Steffenson. 1996. New sources of 

resistance to leaf rust in barley. p. 706-708. In A.E. Slinkard, G.J. Scoles, and 

B.G. Rossnagel (eds.) Proc. Fifth Int. Oat Conf. & Seventh Int. Barley Genet. 

Symp., Saskatoon. Univ. of Saskatchewan, Saskatoon. 

4. Clifford, B.C., and H. W. Roderick. 1981. Detection of cryptic resistance of 

barley to Puccinia hordei. Trans. Br. Mycol. Soc. 76:17-24. 

5. Falk, D.E. 1985. Genetic studies with proanthocyanidin-free barley. Barley 


6. Graner, A., S. Streng, A. Drescher, Y. Jin, I. Borovkova, and B.J Steffenson. 

2000. Molecular mapping of the leaf rust resistance gene Rph7 in barley. Plant 

Breed. 119:389-392. 

228


7. Johnson, R. 1968. The genetics of resistance of some barley varieties to 

Puccinia hordei. p. 160-162. In Proc. Eur. Medit. Cereal Rust Conf., Oeiras, 

Portugal. 

8. Nover, I., and C.O. Lehmann. 1974. Resistenzeigenschaften im Gersten- und 

Weizensortiment Gatersleben. 18. Prüfung von Sommergersten auf ihr Verhalten 

gegen Zwergrost (Puccinia hordei Otth). Kulturpflanze 22:25-43. 

9. Parlevliet, J.E. 1976. The genetics of seedling resistance to leaf rust, Puccinia 

hordei Otth, in some spring barley cultivars. Euphytica 25:249-254. 


hordei in barley. III. Genes in the cultivars Cebada Capa and Franger. 


11. Roane, C.W., and T.M. Starling. 1989. Linkage studies with genes 

conditioning leaf rust reaction in barley. Barley Newsl. 33:190-192. 

12. Scherrer, B., E. Isidore, P. Klein, J-S. Kim, A. Bellec, B. Chalhoub, B. Keller, 

and C. Feuillet. 2005. Large intraspecific haplotype variability at the Rph7 locus 

results from rapid and recent divergence in the barley genome. Plant Cell 

17:361-374. 

13. Tan, B.H. 1978. Verifying the genetic relationships between three leaf rust 


14. Tuleen. N.A., and M.E. McDonald. 1971. Location of genes Pa and Pa5. 

Barley Newsl. 15:106-107. 

15. Udeogalanya, A.C.C., and B.C. Clifford. 1976. Genetical, physiological and 

pathological relationships of resistance to Puccinia hordei and P. striiformis in 

Hordeum vulgare. Trans. Br. Mycol. Soc. 71:279-287. 

16. Zhong, S., R.J. Effertz, Y. Jin, J.D. Franckowiak, and B.J. Steffenson. 2003. 

Molecular mapping of the leaf rust resistance gene Rph6 in barley and its linkage 

relationships with Rph5 and Rph7. Phytopathology 93:604-609. 

Prepared: 


Revised: 


229







Brachytic-ad = brh.ad (3). 

Inheritance: 


Located in chromosome 3HS (4), near the btr1 (non-brittle rachis 1) locus based 

on linkage drag (4), about 26.3 cM proximal from SSR marker HVM60 in bin 3H- 

08 (1). 

Description: 

In the Bowman backcross-derived line, brh8 plants are 3/4 to 5/6 of normal 

height and awns are 2/3 to 3/4 of normal length. The peduncle is 3/4 normal 

length. The seedling leaf of brh8 plants is shorter and wider than those of normal 

sibs and the leaf blades are slightly wider. Kernels of brh8 plants are shorter than 

that of normal sibs and their weights are nearly15% lower. Heading dates are 2 

or 3 days later, spikes have 3 to 4 more kernels, and rachis internodes are about 

20% shorter. Grain yield is nearly normal (1, 2). 


Probably a sodium azide induced mutant in Birgitta (NSGC 1870, NGB 1494, 

NGB 14667) (6). 


brh8.ad in Birgitta (17:16:1, DWS1008) (5, 6). 


brh8.ad in Birgitta (GSHO 1671); brh8.ad in Bowman (PI 483237)*8 (GSHO 

1944). 

References: 



96:654-662. 








6. Lehmann, L.C. 1985. (Personal communications). 

Prepared: 


Revised: 


230







Brachytic-q = brh.q (4). 

Inheritance: 


Located in chromosome 3HL (2), approximately 24.9 cM proximal from SSR 

marker Bmac0029 in bin 3H-15 (2). 

Description: 

Plants are about 2/3 normal height and awns, peduncles are about 2/3 normal 

length, and rachis internodes are about 7/8 normal length (2, 6, 7). Seedling 

leaves of brh14.q plants are relatively short, but they do respond to gibberellic 

acid treatment (1). Leaf blades are about 3/4 normal length. The kernels of brh14 

plants are slightly shorter and smaller than those of normal sibs, but there are 

slightly more kernels per spike. However, the grain yields of the brh14 line to 

average 1/3 to 1/4 of those for Bowman reduced because tillering was reduced. 

Plants show an erect growth habit (2, 3). Failure of the internode below the 

peduncle to elongate was observed in double dwarfs involving brh14.q in the 

Akashinriki genetic background (7). 


An ethyl methanesulfonate induced mutant in Akashinriki (OUJ659, PI 467400) 

(6, 7). 


brh14.q in Akashinriki (OUM131, dw-d, DWS1035, GSHO 1682) (4, 5, 6, 7). 


brh14.q in Akashinriki (GSHO 1682); brh14.q in Bowman (PI 483237)*6 (GSHO 

2175). 

References: 


25:24-26. 



96:654-662. 






6. Konishi, T. 1976. The nature and characteristics of EMS-induced dwarf 

mutants in barley. p. 181-189. In H. Gaul (ed.). Barley Genetics III. Proc. Third 

Int. Barley Genet. Symp., Garching, 1975. Verlag Karl Thiemig, München. 

7. Konishi, T. 1977. Effects of induced dwarf genes on agronomic characters in 

barley. p. 21-38. In Use of dwarf mutations. Gamma-Field Symposium No. 16. 

Prepared: 


231


BGS 149, Reaction to Puccinia coronata var. hordei 1, Rpc1 


Locus name: Reaction to Puccinia coronata var. hordei 1 

Locus symbol: Rpc1 


None. 

Inheritance: 


Located in chromosome 3H centromeric region (1), approximately 2.5 cM from 

RAPD marker OPO08-700 (1). 

Description: 

Crown rust of barley was identified as a new disease of barley in North America 

(2). In seedling tests, resistant cultivars exhibited necrotic or chlorotic flecks (0; to 

; infection types) at infection sites and no sporulation (3). Adult plant reactions of 

Hor2596 were resistant to moderately resistant (3). Hor 2596 is one of the 

differential lines for barley leaf rust (caused by Puccinia hordei), see BGS 032, 

Rph9.i (reaction to Puccinia hordei 9). The F1 plants from the Bowman/Hor2596 

cross exhibited slightly higher infection types (1,2 reaction) than the resistant 

parent (3). 


Natural occurrence in Abyssinian (Hor 2596, CIho 1234) (3). 


Rpc1.a in Hor 2596 (3). 


Rpc1.a in Hor 2596 (GSHO 1601) (3). 

References: 

1. Agrama, H.A., L. Dahleen, M. Wentz, Y, Jin, and B. Steffenson. 2004. 

Molecular mapping of the crown rust resistance gene Rpc1 in barley. 


2. Jin, Y., and B. Steffenson. 1999. Puccinia coronata var. hordei nov.: 

morphology and pathogenicity. Mycologia 91:877-884. 

3. Jin, Y., and B. Steffenson. 2002. Sources and genetics of crown rust 

resistance in barley. Phytopathology 92:1064-1067. 

Prepared: 

Y. Jin and J.D. Franckowiak. 2007. BGS 37:232. 

232



Locus name: Glossy leaf 1 

Locus symbol: glf1 

BGS 155, Glossy leaf 1, glf1 


Waxless bloom on leaves = w1 (11). 

Glossy = gl (9). 

Glossy leaves = gl (16). 

Glossy leaf = gl (15). 

Glossy seedling 2 = gl2 (3, 9). 

Eceriferum-zh = cer-zh (4). 

Inheritance: 


Located in chromosome 4HL (3, 9, 12, 14), about 7.5 cM distal from the lbi2 (long 

basal rachis internode 2) locus (1), and about 4.8 cM distal from the Mlg (Reg2, 

reaction to Erysiphe graminis 2) locus (1). 

Description: 

Surface wax coating on the leaf blade appears absent from the seedling stage to 

near maturity, and leaves have a shiny appearance (wax code ++ ++ -) (4). 

Plants are semidwarf, relatively weak, and late in heading. The stock in the 

Bonus is highly sterile (4), but the Bowman backcross-derived line has nearly 

complete fertility. The lack of surface waxes reduces the ability of growing germ 

tube of certain fungi to find the stomata openings (10). 


A radiation induced mutant in Himalaya (CIho 1312) (9, 13), an X-ray induced 

mutant in Bonus (PI 189763) (4). 


glf1.a, glf1.b (gl2, GSHO 22) in Himalaya (13); glf1.f in 34-119-1, glf1.g in II-34- 

199-7-2 (GSHO 89) (2); cer-zh.54 (NGB 110938) in Bonus (4, 5); cer-zh.266 

(NGB 111153), -zh.308 (NGB 111195), -zh.357 (NGB 111244, NGB 117254), - 

zh.366 (NGB 111253), -zh.432 (NGB 111320), -zh.433 (NGB 111321, NGB 

117256) in Foma (CIho 11333) (5, 8); cer-zh.325 (NGB 111212) in Foma (5); cerzh.373 

(NGB 111260) in Foma (6); cer-zh.865 (NGB 111753) in Bonus (7). 


glf1.a in Himalaya (GSHO 98); cer-zh.54 in Bonus (GSHO 455) is used for 

allelism tests; glf1.a in Bowman (PI 483237)*8 (GSHO 2015). 

References: 

1. Forster, B.P. 1993. Coordinator's report: Chromosome 4. Barley Genet. Newsl. 

22:75-77. 

2. Haus, T.E., and T. Tsuchiya. 1972. Allelic relationships among glossy seedling 

mutants. Barley Genet. Newsl. 2:79-80. 

3. Immer, F.R., and M.T. Henderson. 1943. Linkage studies in barley. Genetics 

28:419-440. 

4. Lundqvist, U., and D. von Wettstein. 1962. Induction of eceriferum mutants in 

barley by ionizing radiations and chemical mutagens. Hereditas 48:342-362. 

5. Lundqvist, U., and D. von Wettstein. 1971. Stock list for the eceriferum 



mutants II. Barley Genet. Newsl. 3:110-112. 

233



mutants IV. Barley Genet. Newsl. 5:92-96. 

8. Lundqvist, U., P. von Wettstein-Knowles, and D. von Wettstein. 1968. 

Induction of eceriferum mutants in barley by ionizing radiations and chemical 

mutagens. II. Hereditas 59:473-504. 

9. Robertson, D.W., and O.H. Coleman. 1942. Location of glossy and yellow leaf 

seedlings in two linkage groups. J. Am. Soc. Agron. 34:1028-1034. 

10. Rubiales, D., M.C. Ramirez, T.L.W. Carver, and R.E. Niks. 2001. Abnormal 

germling development by brown rust and powdery mildew on cer barley mutants. 

Hereditas 135:271-276. 

11. Smith, L., 1951. Cytology and genetics of barley. Bot. Rev. 17:1-355. 

12. Tsuchiya, T. 1981. Revised linkage maps of barley. 1981. Barley Genet. 

Newsl. 11:96-98. 

13. Tsuchiya, T., and T.E. Haus. 1973. Allelism testing in barley. I. Analysis of 

ten mapped genes. J. Hered. 64:282-284. 

14. Tsuchiya, T., and R.J. Singh. 1982. Chromosome mapping in barley by 

means of telotrisomic analysis. Theor. Appl. Genet. 61:201-208. 

15. Walker, G.W.R., J. Dietrich, R. Miller, and K. Kasha. 1963. Recent barley 

mutants and their linkages II. Genetic data for further mutants. Can. J. Genet. 

Cytol. 5:200-219. 


Prepared: 

T.E. Haus and T. Tsuchiya. 1971. BGN 1:141 as BGS 155, Glossy seedling, gl; 

and BGN 1:145 as BGS 159, Glossy seedling 2, gl2. 

U. Lundqvist. 1975. BGN 5:144 as BGS 426, Eceriferum-zh, cer-zh. 

Revised: 

T. Tsuchiya. 1980. BGN 10:114 as BGS 155, Glossy seedling, gl; and BGN 

10:116 as BGS 159, Glossy seedling 2, gl2. 



234







Brachytic 2 = br2 (9). 

Breviaristatum-l = ari-l (4, 5). 

Inheritance: 


Located in chromosome 4HL (8), about 1.5 cM proximal from the glf3 (glossy leaf 

3) locus (3, 8), over 22.8 cM proximal from the Kap1 (hooded lemma 1) locus (8), 

near AFLP marker E4140-7 in subgroup 38-40 of the Proctor/Nudinka map (7), 

and about 15.9 cM distal from SSR marker Bmag0353 near the boundary 

between bins 4H-06 and 4H-07 (2). 

Description: 

Plant height and vigor are reduced to about 2/3 normal; the awn is less than 1/4 

normal length; the spike is semi-compact; and the leaf, kernel, glume and glume 

awn, rachilla, and coleoptile are shorter than in the original cultivar. Auricles are 

well developed and larger than those of the original cultivar (9). In the Bowman 

backcross-derived lines, the peduncle is about 1/2 normal length, kernel weights 

are slightly over 2/3 normal, yield is about 1/2 normal; however, rachis internode 

lengths are normal (2). The ari-l.3 allele at the brh2 locus is sensitive to 

gibberellic acid treatment (1). 


An X-ray induced mutant in Svanhals (PI 5474) (9). 


brh2.b in Svanhals (Kmut 28, OUM283) (8); ari-l.3 (NGB 115848) in Bonus (PI 

189763) (5); ari-l.132 (NGB 115942) in Foma (CIho 11333) (6); ari-l.135 (NGB 

115945), -l.145 (NGB 115956), -l.214 (NGB 116023), -l.237 (NGB 116047) in 

Foma, -l.257 (NGB 116066) in Kristina (NGB 1500) (5). 


brh2.b in Svanhals (GSHO 573); ari-l.3 in Bonus (GSHO 1660); brh2.b in 

Bowman (PI 483237)*7 (GSHO 2016); ari-l.3 in Bowman*7 (GSHO 2017). 

References: 


25:24-26. 



96:654-662. 

3. Forster, B.P. 1993. Coordinator's report: Chromosome 4. BGN 22:75-77. 



5. Kucera, J., U. Lundqvist, and Å. Gustafsson. 1975. Inheritance of 

breviaristatum mutants in barley. Hereditas 80:263-278. 





8. Takahashi, R., J. Hayashi, and I. Moriya. 1971. Linkage studies in barley. 

235



9. Tsuchiya, T. 1962. Radiation breeding in two-rowed barley. Seiken Ziho 14:21- 

34. 

Prepared: 

T.E. Haus and T. Tsuchiya. 1971. BGN 1:143. 

Revised: 

T. Tsuchiya. 1980. BGN 10:115. 


J.D. Franckowiak and L. S. Dahleen. 2007. BGN 37:235-236. 

236



Locus name: Intermedium spike-c 

Locus symbol: int-c 

BGS 178, Intermedium spike-c, int-c 


Intensifer for Z = W (22). 

Infertile intermedium = i (12, 20, 21). 

Allelic series I h , I, i (12, 23). 

Intermedium spike-c = int-c (6, 7, 17, 18). 

Six-rowed spike 5 = v5 (24). 

Inheritance: 


Located in chromosome 4HS (3, 5, 18, 21, 24), about 13.1 cM proximal from the 

fch9 (chlorina seedling 9) locus, about 14.5 cM distal from the Kap1 (hooded 

lemma 1) locus (2, 3, 4, 5, 11), and about 3.5 cM from AFLP marker E4143-5 in 

subgroup 8 of the Proctor/Nudinka map (19). 

Description: 

Alleles at the int-c (v5) locus alter the size of lateral spikelets. The lemma apex of 

lateral kernels is rounded or weakly pointed, awnless or short-awned (1, 9, 16). 

Lower lateral spikelets may develop poorly in some int-c mutants (4), while seed 

development may occur in all lateral spikelets of others (6, 15). Variability in 

lateral spikelet development exists among the int-c mutants and environmental 

conditions can alter expressivity. The Int-c.a (formerly I) allele in six-rowed barley 

increases the size of lateral spikelets, while the int-c.b (formerly i) allele in tworowed 

barley prevents anther development in lateral spikelets (9, 22). The int-c.5 

mutant in Bonus produces fertile stamens in lateral spikelets (9). In the presence 

of the Int-c.h (formerly I h ) allele of Mortoni, lateral spikelets are male fertile and 

may occasionally set seed (8, 12). Spikes of vrs5.n (v5) plants appear similar to 

those of six-rowed barley, but lateral spikelets are smaller (less than half the size 

of the central spikelets) and broader (3, 4). 


Natural occurrence in many two-rowed barley cultivars; an X-ray induced mutant 

in Gamma 4 (3, 5). 


int-c.b (i) in two-rowed barley (23); Int-c.h (I h ) in Mortoni (CIho 2210, GSHO 72) 

(8, 12); vrs5.n (v5) in Gamma 4 (38X-197, OUM338) (3, 5, 14); int-c.5 (NGB 

115423) in Bonus (PI 189763) (15, 18); int-c.7 (NGB 115425), -c.62 (NGB 

116835), -c.63 (NGB 115481) in Bonus, -c.13 (NGB 115431), -c.15 (NGB 

115433), -c.16 (NGB 115434), -c.18 (NGB 115436), -c.25 (NGB 115443), -c.29 

(NGB 115447) in Foma (CIho 11333), -c.33 (NGB 115451), -c.38 (NGB 115456), 

-c.45 (NGB 115463), -c.48 (NGB 115466), -c.49 (NGB 115467), -c.53 (NGB 

115471), -c.56 (NGB 115474), -c.60 (NGB 115478) in Kristina (NGB 1500) (15); 

int-c.70 (NGB 115488), -c.76 (NGB 115494), -c.78 (NGB 115496), -c.84 (NGB 

115502) in Bonus, -c.95 (NGB 115513) in Hege (NGB 13692) (13). 


vrs5.n in Gamma 4 (GSHO 776); int-c.b in Hordeum distichon var. nigrinudum 

(GSHO 988); int-c.5 in Bonus (GSHO 1765); int-c.b from Compana (CIho 5438) 

in Bonneville (CIho 7248)*6 (CIho 16176) (10); vrs5.n in Bowman (PI 483237)*6 

(GSHO 2002); int-c.5 in Bowman*6 (GSHO 2003). 

237


References: 

1. Åberg, E., and G.A. Wiebe. 1945. Irregular barley, Hordeum irregulare sp. nov. 

J. Washington Acad. Sci. 35:161-164. 

2. Forster, B.P. 1993. Coordinator's report: Chromosome 4. Barley Genet. Newsl. 

22:75-77. 

3. Fukuyama, T. 1982. Locating a six-rowed gene v5 on chromosome 4 in barley. 


4. Fukuyama, T., J. Hayashi, and R. Takahashi. 1975. Genetic and linkage 

studies of the five types of induced 'six-row' mutants. Barley Genet. Newsl. 5:12- 

13. 

5. Fukuyama, T., R. Takahashi, and J. Hayashi. 1982. Genetic studies on the 

induced six-rowed mutants in barley. Ber. Ohara Inst. landw. Biol., Okayama 

Univ. 18:99-113. 

6. Gustafsson, Å., and U. Lundqvist. 1980. Hexastichon and intermedium 




62:409-414. 

8. Gymer, P.T. 1977. Probable allelism of Ii and int-c genes. Barley Genet. 

Newsl. 7:34-35. 

9. Gymer, P.T. 1978. The genetics of the six-row/two row character. Barley 


10. Hockett, E.A. 1985. Registration of two- and six-rowed isogenic Bonneville 

barley germplasm. Crop Sci. 25:201. 

11. Jensen, J. 1987. Linkage map of barley chromosome 4. p. 189-199. In S. 

Yasuda and T. Konishi (eds.) Barley Genetics V. Proc. Fifth Int. Barley Genet. 

Symp., Okayama. 1986. Sanyo Press Co., Okayama. 

12. Leonard, W.H. 1942. Inheritance of fertility in the lateral spikelets of barley. 

Genetics 27:299-316. 


14. Lundqvist, U. 1991. Coordinator's report: Ear morphology genes. Barley 


15. Lundqvist, U., and A. Lundqvist. 1988. Induced intermedium mutants in 

barley: origin, morphology and inheritance. Hereditas 108:13-26. 

16. Nötzel, H. 1952. Genetische Untersuchungen an röntgeninduzierten 

Gerstenmutanten. Kühn-Archiv 66:72-132. 

17. Nybom, N. 1954. Mutation types in barley. Acta Agric. Scand. 4:430-456. 

18. Persson, G. 1969. An attempt to find suitable genetic markers for dense ear 

loci in barley I. Hereditas 62:25-96. 

19. Pozzi, C., D. di Pietro, G. Halas, C. Roig, and F. Salamini. 2003. Integration 

of a barley (Hordeum vulgare) molecular linkage map with the position of genetic 


20. Robertson, D.W. 1929. Linkage studies in barley. Genetics 14:1-36. 

21. Robertson, D.W. 1933. Inheritance in barley. Genetics 18:148-158. 

22. Ubisch, G. von. 1916. Beitrag zu einer Faktorenanalyse von Gerste. Z. 


23. Woodward, R.W. 1947. The I h , I, i allels in Hordeum deficiens genotypes of 

barley. J. Am. Soc. Agron. 39:474-482. 


Prepared: 


238


Revised: 


239



Locus name: Hairy leaf sheath 1 

Locus symbol: Hsh1 

BGS 179, Hairy leaf sheath 1, Hsh1 


Hairy leaf sheath = Hs (7). 

Inheritance: 


Located in chromosome 4HL (6), over 8.7 cM proximal from the yhd1 (yellow 

head 1) locus, and over 22.5 cM distal from the mlo (reaction to Erysiphe 

graminis hordei-o) locus (3, 5), in bin 4H-12 about 1.1 cM proximal from RFLP 

marker HVM067 (2). 

Description: 

Short hairs (1 to 3 mm) are scattered or in rows on leaf sheaths of the basal part 

of the plant. The density of hairs varies considerably among cultivars and with 

changes in growing conditions. With few exceptions, no hairs are observed on 

the sheath of upper leaves (4, 5). Heterozygotes and smooth awned cultivars 

seem to have fewer hairs. 


Natural occurrence in a few cultivars and in some accessions of Hordeum 

vulgare subsp spontaneum (1, 5, 6). 


Hsh1.a introduced into cultivated barley from its wild progenitor (5). 


Hsh1.a in Kimugi (OUL012, GSHO 986) (5, 6); Hsh1.a from R.I. Wolfe's Multiple 

Dominant Marker Stock in Bowman (PI 483237)*10 (GSHO 2026). 

References: 

1. Cauderon, A. 1951. Étude de I'hérédité de trois couples de caractères 

morphologiques chez l'orge cultivée. Ann. Amélior. Plant. 1:9-19. 





Genet. 103:415-424. 

3. Hayashi, J., and R. Takahashi. 1986. Location of hs for hairy sheath and yh for 

yellow head character on barley chromosome 4. Barley Genet. Newsl. 16:24-27. 

4. Patterson, F.L., and R.G. Shands. 1957. Independent inheritance of four 

characters in barley. Agron. J. 49:218-219. 

5. Takahashi, R., and J. Hayashi. 1966. Inheritance and linkage studies in barley. 

II. Assignment of several new mutant genes to their respective linkage groups by 

the trisomic method of analysis. Ber. Ohara Inst. landw. Biol., Okayama Univ. 

13:185-198. 

6. Takahashi, R., J. Hayashi, and S. Yasuda. 1957. [Four genes in linkage in 

barley, which are inherited independently of the markers in the known seven 

linkage groups in barley.] Nogaku Kenkyu 45:1-10. [In Japanese.] 

7. Takahashi, R., S. Yasuda, J. Yamamoto, and I. Shiojiri. 1953. [Physiology and 

genetics of ear emergence in barley and wheat. II. Genic analysis of growth-habit 

in two spring barleys.] Nogaku Kenkyu 40:157-168. [In Japanese.] 

Prepared: 

240


R. Takahashi. 1972. BGN 2:184 as BGS 158. 

Revised: 

J.D. Franckowiak and T. Konishi. 1997. BGN 26:202. 


241







Brachytic-m = brh.m (3). 

Inheritance: 


Located in chromosome 4HS (4), near the int-c (intermedium spike-c) locus (4), 

about 13.0 cM proximal from SSR marker Bmac0310 near the boundary between 

bins 4H-06 and 4H-07 (1). 

Description: 

Plants are about 3/4 normal height and awns are about 3/4 of normal length. 

Peduncles are less than 2/3 normal length. Seedling leaves of brh5 plants are 

relatively short. The kernels of brh5 plants are shorter than those of normal sibs 

and weigh about 30% less. Plants lodge easily and the grain yield is about 1/2 

normal (1, 2). 


A sodium azide induced mutant in Birgitta (NSGC 1870, NGB 1494, NGB 14667) 

(6). 


brh5.m in Birgitta (17:18:2, DWS1010) (5, 6). 


brh5.m in Birgitta (GSHO 1678); brh5.m in Bowman (PI 483237)*7 (GSHO 2001). 

References: 



96:654-662. 









Prepared: 


Revised: 


242



Locus name: Slender dwarf 3 

Locus symbol: sld3 

BGS 186, Slender dwarf 3, sld3 


Anthocyanin-free = ant-567 (5). 

Proanthocyanidin-free 17.567 = ant17.567 (4). 

Slender dwarf e = sld.e (3). 

Inheritance: 


Located in chromosome 4HS, based on linkage drag with the int-c (intermedium 

spike-c) locus (2). 

Description: 

Plants show reduced vigor and are about 3/4 normal height. The number of 

spikelets per spike is about 3/4 that of normal sibs and kernels are slightly 

smaller. Rachis internodes can be slightly longer and grain yields are about 3/4 

normal (1). The mutant gene sld3.e was isolated as a second mutant in the stock 

ant17.567 (proanthocyanidin-free 17) (1). The Bowman backcross-derived line 

for sld3.e does not show a reduction in anthocyanin pigmentation or the large 

reduction in kernel size (1). 


A sodium azide induced mutant isolated with ant-567 in Manker (CIho 15549) (5). 


sld3.e in ant17.567 (DWS1050) (1). 


sld3.e in Bowman/ant17.567 (GSHO 2480); sld3.e in Bowman (PI 483237)*7 

(GSHO 1998). 

References: 




3. Franckowiak, J.D. 1999. Coordinator’s report: Semidwarf genes. Barley Genet. 

Newsl. 29:74-79. 

4. Jende-Strid, B. 1988. Coordinator's report: Anthocyanin genes. Stock list of ant 

mutants kept at the Carlsberg Laboratory. Barley Genet. Newsl. 18:74-79. 

5. Ullrich, S.E. 1983. (Personal communications). 

Prepared: 


Revised: 


243







Brachytic-k = brh.k (3). 

Inheritance: 


Located in chromosome 4HS (1), about 11.7 cM distal from SRR marker 

Bmac0310 in bin 4H-06 (1). 

Description: 

Culms and peduncles are about 3/4 normal length and awns are 3/4 to 5/6 of 

normal length. Rachis internodes are slightly shorter than those of normal sibs. 

Seedling leaves of brh9 plants are relatively short. The kernels of brh9 plants are 

shorter and kernel weight are about 20% lower than those of normal sibs. Grain 

yields averaged less than 1/2 normal (1, 2); however, plants appeared nearly 

normal when grown in Dundee, Scotland (2). The brh9.k gene was found to nonallelic 

at brh5 locus, which is located in the same region of 4HS (1). 



(5). 


brh9.k in Birgitta (17:14:4, DWS1006) (4, 5). 


brh9.k in Birgitta (GSHO 1676); brh9.k in Bowman (PI 483237)*6 (GSHO 2170). 

References: 



96:654-662. 







Prepared: 


244


BGS 203, Black lemma and pericarp 1, Blp1 


Locus name: Black lemma and pericarp 1 

Locus symbol: Blp1 


Black lemma and caryopsis = B (6). 

Black pericarp = Bk (1). 

Black lemma and pericarp = B (7). 

Inheritance: 


Located in chromosome 1HL [5L] (3, 5), about 16.0 cM proximal from the trd1 

(third outer glume 1) locus (3), in bin 1H-13 about 8.8 cM proximal from RFLP 

marker ABC261 (2). 

Description: 

Black pigmentation of the lemma and pericarp develops slightly before 

maturation of the spike. Pigmented organs may include all parts of the spike, 

awns, the upper portion of the stem, and upper leaves. The intensity of 

pigmentation associated with each of the dominant alleles at the Blp1 locus is 

characteristic of that allele, and is relatively stable over environments (7). Black 

seed is produced by melanin-like pigment in the pericarp (1). Woodward (7) 

reports that the dominance ranking of alleles at the Blp1 locus is related to the 

intensity of black pigmentation they confer, with the Blp1.b (B) allele conferring 

extreme black pigmentation. The Blp1.mb (B mb ) allele is associated with medium 

black and a reduced distribution pattern; and the Blp1.g (B g ) allele is associated 

with light black or gray coloration (7, 8). 


Natural occurrence in several cultivars (6, 7). 


Blp1.b (B) in Hordeum distichon var nigrinudum No 1 (7); Blp1.mb (B mb ) in CIho 

2970 (GSHO 226) (7); Blp1.g (B g ) in Blackhull (CIho 878, GSHO 199) and Black 

Smyrna (CIho 191, GSHO 222) (7). 


Blp1.b in Hordeum distichon var nigrinudum No 1 (GSHO 988); Blp1.b from R.I. 

Wolfe's Multiple Dominant Marker Stock (GSHO 1580) in Bowman (PI 483237)*8 

(GSHO 2054). 

References: 

1. Buckley, G.F.H. 1930. Inheritance in barley with special reference to the color 

of the caryopsis and lemma. Sci. Agric. 10:460-492. 





Genet. 103:415-424. 

3. Ivanova, K.V. 1937. A new character in barley "third outer glume" — Its 

inheritance and linkage with color of the flowering glumes. Bull. Appl. Bot., 

Genet., & Pl. Breed. II. 7:339-353. 

4. Robertson, D.W. 1929. Linkage studies in barley. Genetics 14:1-36. 



245


III, 1954-1963. Crop Sci. 5:33-43. 

6. Tschermak, E. von. 1901. Über Züchtung neuer Getreiderassen mittelst 

künstlicher Kreuzung. Kritisch-historische Betrachtungen. Zeitschrift für das 

landwirtschaftliche Versuchswesen Oesterreich 4:1029-1060. 

7. Woodward, R.W. 1941. Inheritance of melanin-like pigment in the glumes and 

caryopses of barley. J. Agric. Res. 63:21-28. 

8. Woodward, R.W. 1942. Linkage relationships between the allelomorphic 

series, B, B mb , B g , and Atat factors in barley. J. Amer. Soc. Agron. 34:659-661. 

Prepared: 


Revised: 


J.D. Franckowiak. 2007: BGN 37:245-246. 

246




Locus symbol: eam8 

BGS 214, Early maturity 8, eam8 


Early heading k = eak (26). 

Early maturity-a = ea-a (8, 21). 

Praematurum-a = mat-a (3, 8, 13, 14, 26). 

Erectoides-o = ert-o (8, 18). 

Inheritance: 


Located in chromosome 1HL [5L] (21), about 11.4 cM distal from the trd1 (third 

outer glume 1) locus and 20.9 cM distal from the Blp1 (black lemma and pericarp 

1) locus (21, 24). 

Description: 

Early heading is associated with decreased culm length, spike length, kernels per 

spike, and grain yield (16, 24, 26). When grown in the fall at Kurashiki, Japan, 

plants head about 20 days earlier than the standard mid-season cultivar, 

Akashinriki, because they are day-length neutral or photoperiod insensitive (26). 

Day-length neutrality is observed in early heading mutants isolated from spring 

barley in Sweden (2, 9). Under controlled environmental conditions, number of 

days to heading does not change as photoperiod is altered (2, 10). All mat-a 

induced mutants are characterized by yellowish-green seedlings at an early 

stage of development under controlled environmental conditions (1). Other eam8 

mutants show a similar response by becoming yellow green under specific 

growing conditions, 8 to 12 hours of illumination at low temperatures (below 

10°C) plus high temperature (20°C or higher) during the dark period (5, 21, 24). 

The color change is caused by photothermal stress, which increases the 

zeaxanthin content at the expense of chlorophyll and other pigments (5, 19, 24). 

The mutant stock mat-a.8 was released as the cultivar Mari (9, 11). When grown 

under 12 h days, the levels of phytochrome B (phyB) decreases in light-grown 

BMDR-1 plants, containing an allele at the eam8 locus, compared to normal 

plants (12). The instability of phyB content was reported to be responsible for 

photoperiod insensitivity of eam8 mutants (12). Under continuous light and with 

far-red light treatment for seven days, most differences in heading date between 

BMDR-1 and BMDR-8 (Shabet) are eliminated (19). 


An X-ray induced mutant in Maja (PI 184884, NGB 8815) (6, 7, 10); natural 

occurrence in Kinai 5 (OUJ493) and Kagoshima Gold (OUJ219) (21, 25). 


ert-o.16 (NGB 112618) in Maja (6); eam8.k in Kagoshima Gold, Kinai 5 (CIho 

11560), and Kindoku (OUU332) (21, 22, 25); mat-a.8 (NGB 1491, NGB 4694, 

NGB 14656, NGB 110008), -a.11 (NGB 110011), -a.12 (NGB 110012) in Bonus 

(PI 189763) (7, 14); mat-a.27 (NGB 110027), -a.45 (NGB 110045), -a.46 (NGB 

110046), -a.48 (NGB 110048), -a.62 (NGB 110062) in Bonus, -a.110 (NGB 

110110), -a.130 (NGB 110130), -a.153 (NGB 110153), -a.221 (NGB 110221), - 

a.238 (NGB 110238), -a.255 (NGB 110255), -a.272 (NGB 110272), -a.274 (NGB 

110274), -a.287 (NGB 110287), -a.289(NGB 110289), -a.294 (NGB 110294), - 


247


110384), -a.390 (NGB 110390),-a.404 (NGB 110404), -a.406 (NGB 110406), - 

a.407 (NGB 110407) in Foma (CIho 11333), -a.509 (NGB 110509), -a.641 (NGB 

110641), -a.703 (NGB 110703), -a.733 (NGB 110733),in Kristina (NGB 1500), - 


110813), -a.832 (NGB 110832), -a.903 (NGB 116858), -a.909 (NGB 117440), - 

a.921 (NGB 117452) in Bonus, -a.961 (NGB 117492), -a.970 (NGB 117501), - 

a.976 (NGB 117507), -a.984 (NGB 117515), -a.1011 (NGB 117542), in Sv 

79353, -a.1032 (NGB 117563), -a.1033 (NGB 117564), -a.1034 (NGB 117565), - 

a.1035 (NGB 117566), -a.1036 (NGB 117567), -a.1037 (NGB 117568), -a.1039 

(NGB 117570), -a.1040 (NGB 117571), -a.1041 (NGB 117572), -a.1042 (NGB 

117573), -a.1043 (NGB 117574), -a.1044 (NGB 117575), -a.1045 (NGB 117576), 

-a.1046 (NGB 117577), -a.1047 (NGB 117578), -a.1048 (NGB 117579), -a.1049 

(NGB 117580) in Sv Vg74233 (13); mat-a.1050 (NGB 117581), -a.1051 (NGB 

117582), -a.1052 (NGB 117583), -a.1053 (NGB 117584), -a.1054 (NGB 117585), 



117592), -a.1062 (NGB 117593), -a.1063 (NGB 117594), -a.1064 (NGB 117595), 



117604), -a.1074 (NGB 117605) in Sv Vg74233 (15); eam8.q (Ea8), eam8.r 

(Ea9), eam8.s (Ea10), eam8.t (Ea16) in Chikurin Ibaraki 1 (OUJ069, CIho 7370, 

GSHO 783) (23); eam8.u (Mut 2571) in Donaria (PI 161974) (5, 17); eam8.v in 

Munsing (CIho 6009, GSHO 636) (4, 19, 20); eam8.w in Early Russian (CIho 

13839) (4), BMDR-1 (eam8.y) from the original mutant in a dwarf line 

backcrossed to Shabet (CIho 13827) (19). 


eam8.k in Kinai 5 (OUJ439, GSHO 765); ert-o.16 in Maja (GSHO 489); eam8.k in 

Bonus*5 (25); mat-a.8 in Tochigi Golden*5 (25); eam8.u in Munsing/7*Titan 

(CIho 16526) (20); eam8.k in Bowman (PI 483237)*7 (GSHO 2063); ert-o.16 in 


References: 

1. Dormling, I., and Å. Gustafsson. 1969. Phytotron cultivation of early barley 

mutants. Theor. Appl. Genet. 39:51-61. 

2. Dormling, I., Å. Gustafsson, H.R. Jung, and D. von Wettstein. 1966. Phytotron 

cultivation of Svalöf's Bonus barley and its mutant Svalöf's Mari. Hereditas 

56:221-237. 

3. Favret, E.A., and J.H. Frecha. 1967. Allelism test of genes for earliness. Barley 

Newsl. 10:121. 

4. Gallagher, L.W. (Unpublished). 

5. Gallagher, L.W., A.A. Hafez, S.S. Goyal, and D.W. Rains. 1994. Nuclear 

mutations affecting chloroplastic pigments of photoperiod-insensitive barley. 

Plant Breed. 113:65-70. 

6. Gustafsson, Å. 1947. Mutations in agricultural plants. Hereditas 33:1-100. 

7. Gustafsson, Å., A. Hagberg, and U. Lundqvist. 1960. The induction of early 

mutants in Bonus barley. Hereditas 46:675-699. 



62:409-414. 

9. Gustafsson, Å., A. Hagberg, G. Persson and K. Wiklund. 1971. Induced 

mutations and barley improvement. Theor. Appl. Genet. 41:239-248. 

10. Gustafsson, Å., and U. Lundqvist. 1976. Controlled environment and short- 

248


day tolerance in barley mutants. p. 45-53. In Induced Mutants in Cross-breeding. 

Proc. Advisory Group, Vienna. 1975. Int. Atomic Energy Agency, Vienna. 

11. Hagberg, A. 1961. [Svalöfs original Mari barley.] Aktuellt från Svalöf. 

Allmänna Svenska Utsädesaktiebolaget. p. 13-16. [In Swedish.] 

12. Hanumappa, M., L.H. Pratt, M.-M. Cordonnier-Pratt, and G.F. Deitzer. . 1999. 

A photoperiod-insensitive barley line contains a light-labile phytochrome B. Plant 

Physiol. 119:1033-1040. 

13. Lundqvist, U. 1991. Swedish mutation research in barley with plant breeding 

aspects. A historical review. p. 135-148. In Plant Mutation Breeding for Crop 

Improvement. Proc. Int. Symp. Vienna, 1990. Int. Atomic Energy Agency, Vienna. 

14. Lundqvist, U. 1992. Coordinator's report: Earliness genes. Barley Genet. 

Newsl. 21:127-129. 


16. Mellish, D.R., B.L. Harvey, and B.G. Rossnagel. 1978. The effect of a gene 

for earliness in 2-row barley. Barley Newsl. 22:76. 

17. Mettin, D. 1961. Mutationsversuche an Kulturpflanzen. XII. Über das 

genetische Verhalten von frühreifen Gerstenmutanten. Züchter 31:83-89. 

18. Persson, G., and A. Hagberg. 1969. Induced variation in a quantitative 

character in barley. Morphology and cytogenetics of erectoides mutants. 


19. Principe, J.M., W.R. Hruschka, B. Thomas, and G.F. Deitzer. 1992. Protein 

differences between two isogenic cultivars of barley (Hordeum vulgare L.) that 

differ in sensitivity to photoperiod and far-red light. Plant Physiol. 98:1444-1450. 

20. Smail, V.W., R.F. Eslick, and E.A. Hockett. 1986. Isogenic heading date 

effects on yield component development in 'Titan' barley. Crop Sci. 26:1023- 

1029. 

21. Takahashi, R., and S. Yasuda. 1971. Genetics of earliness and growth habit 

in barley. p. 388-408. In R.A. Nilan (ed.) Barley Genetics II. Proc. Second Int. 

Barley Genet. Symp., Pullman, WA, 1969. Washington State Univ. Press, 

Pullman. 

22. Takahashi, R., S. Yasuda, J. Hayashi, T. Fukuyama, I. Moriya, and T. 

Konishi. 1983. Catalogue of barley germplasm preserved in Okayama University. 

Inst. Agric. Biol. Sci., Okayama Univ., Kurashiki, Japan. 217 p. 

23. Ukai, Y., and A. Yamashita. 1981. Early mutants of barley induced by ionizing 

radiation and chemicals. p. 846-854. In M.J.C. Asher, R.P. Ellis, A.M. Hayter, and 

R.N.H. Whitehouse (eds.) Barley Genetics IV. Proc. Fourth Int. Barley Genet. 

Symp., Edinburgh. Edinburgh Univ. Press, Edinburgh. 

24. Yasuda, S. 1977. Linkage of the earliness gene eak and its pleiotropic effects 

under different growth conditions. Ber. Ohara Inst. landw. Biol., Okayama Univ. 

17:15-28. 

25. Yasuda, S. 1978. Effects of the very early gene, eak, on yield and its 

components in barley. BGN 8:125-127. 

26. Yasuda, S., T. Konishi, and H. Shimoyama. 1965. [Varietal difference in 

yellowing of barleys under a certain controlled condition of temperature and 

photoperiod, and its mode of inheritance.] Nogaku Kenkyu 51:53-65. [In 

Japanese.] 

Prepared: 

S. Yasuda. 1972. BGN 2:198. 

Revised: 

J.D. Franckowiak, U. Lundqvist, T. Konishi, and L.W. Gallagher. 1997. BGN 

26:213-215. 

249



250



Locus name: Necrotic leaf spot 1 

Locus symbol: nec1 

BGS 222, Necrotic leaf spot 1, nec1 


Mutant no. 10 (2). 

Parkland spot = sp,,b (1). 

Inheritance: 


Located in chromosome 1HL [5L] (1, 2, 4), near the centromere (1), about 34.5 

cM proximal from the wst5 (white streak 5) locus (3, 5), about 10.0 cM distal from 

the msg1 (male sterile genetic 1) locus (4, 6), in bin 5H-09 near EST marker 

BF630384 (7). 

Description: 

Small black-brown spots develop on all light-exposed parts of the plant starting 

near the leaf tip at the three-leaf stage (1, 2). The spots are oval (the longest 

dimension is parallel to the leaf veins) and generally less than 1 to 2 mm in size. 

The spots are concentrated in awn and the most distal parts of the leaf blade, but 

may occur on all plant parts (2, 4). The nec1 locus is an orthologue of 

Arabidopsis necrotic mutant HLM1 that encodes the cyclic nucleotide-gated ion 

channel 4 (7). 


A mutant induced by combined treatment with gamma-rays and diethyl sulfate of 

Carlsberg II (CIho 10114, NGB 5085) (2). 


nec1.a in Carlsberg II (Mutant no 10) (2, 3); sp,,b (GSHO 1284) in Parkland 

(CIho 10001) (1, 4); a mutant in Morex (CIho 15773) (6); FN085 and FN370 in 

Steptoe (CIho 15229) (7); FN338 in Morex (CIho 15773) (7). 


nec1.a in Carlsberg II (GSHO 989); nec1.a from R.I. Wolfe's Chromosome 5 

Marker Stock in Bowman (PI 483237)*7 (GSHO 2052). 

References: 



2. Jensen, J. 1971. Mapping of 10 mutant genes for necrotic spotting in barley by 

means of translocation. p. 213-219. In R.A. Nilan (ed.) Barley Genetics II. Proc. 

Second Int. Barley Genet. Symp., Pullman, WA, 1969. Washington State Univ. 

Press, Pullman. 

3. Jensen, J. 1992. Coordinator's report: Chromosome 5. Barley Genet. Newsl. 

21:89-92. 

4. Jensen, J., and J.H. Jørgensen. 1973. Locating some genes on barley 


5. Nielsen, G., H. Johansen, and J. Jensen. 1983. Localization on barley 

chromosome 5 of the locus Pgd2 coding for phosphogluconate dehydrogenase. 


6. Ramage, T., and J.L.A. Eckhoff. 1985. Assignment of mutants in Morex to 

chromosomes. Barley Genet. Newsl. 15:22-25. 

7. Rostoks, N., D. Schmierer, S. Mudie, T. Drader, R. Brueggeman, D. Caldwell, 

R. Waugh, and A. Kleinhofs. 2006. Barley necrotic locus nec1 encodes the cyclic 

251


nucleotide-gated ion channel 4 homologous to the Arabidopsis Hlm1. Mol. Gen. 

Genomics 275:159-168. 

Prepared: 

J. Jensen. 1981. BGN 11:101. 

Revised: 



252



Locus name: Uniculm 2 

Locus symbol: cul2 

BGS 253, Uniculm 2, cul2 


Uniculm 2 = uc2 (8). 

Inheritance: 


Located in chromosome 6HL (4, 6), about 1.3 cM distal from the gsh4 (glossy 

sheath 4) locus (3, 5), about 11.4 cM from the msg36 (male sterile genetic 36) 

locus (3, 5), about 2.2 cM proximal from the rob1 (orange lemma 1) locus (3, 4, 

5), about 8.8 cM from RFLP markers cMWG679 and ABG458 (1), and about 6.2 

cM from AFLP marker E4343-10 in subgroup 54 of the Proctor/Nudinka map (7). 

Description: 

The cul2 plants have a single elongated culm (stem), the stem is much greater in 

diameter than normal, and plants are usually earlier than normal (8). The cul2 

plants initiate vegetative axillary meristems, but tillers fail to develop (1). Irregular 

placement of some spikelets and male fertility in lateral spikelets occur in the 

original stock (5) and in the Bowman backcross-derived line (1). Yield of uniculm 

plants is not restored when grown under high plant populations (2). Double 

mutant combinations with most other mutants that affect tiller number resulted in 

a uniculm vegetative phenotype (1). 


A thermal neutron induced mutant in Kindred (CIho 6969) (8). 


cul2.b in Kindred (GBC379) (5), cul2.k (unc k ) in an unknown cultivar from the 

Max-Planck-Institut für Züchtungsforschung (7). 


cul2.b in Kindred (GSHO 531, CIho 115530); cul2.b in Bowman (PI 483237)*4 

(GSHO 2074); cul2.b plus rob1.a from sel 79Cal in Bowman*8 (GSHO 2075). 

References: 


characterization of the barley uniculm2 (cul2) mutant. Theor. Appl. Genet. 

106:846–857. 

2. Dofing, S.M. 1996. Near-isogenic analysis of uniculm and conventional-tillering 

barley lines. p. 617-619. In A.E. Slinkard, G.J. Scoles, and B.G. Rossnagel (eds.) 

Proc. Fifth Int. Oat Conf. & Seventh Int. Barley Genet. Symp., Saskatoon. Univ. 

of Saskatchewan, Saskatoon. 

3. Falk, D.E., M.J. Swartz, and K.J. Kasha. 1980. Linkage data with genes near 

the centromere of barley chromosome 6. Barley Genet. Newsl. 10:13-16. 




5. Kasha, K.G., D.E. Falk, and A. Ho-Tsai. 1978. Linkage data with genes on 


6. Kirby, E.J. 1973. Effect of temperature on ear abnormalities in uniculm barley. 

J. Exp. Bot. 24:935-947. 



253



8. Shands, R.G. 1963. Inheritance and linkage of orange lemma and uniculm 

characters. Barley Newsl. 6:35-36. 

Prepared: 

C.R. Burnham. 1971. BGN 1:156. 

Revised: 



254



Locus name: Orange lemma 1 

Locus symbol: rob1 

BGS 254, Orange lemma 1, rob1 


Orange lemma = pl (14). 

Orange lemma = br (1, 2). 

Orange lemma = o (15). 

Robiginosum-o = rob-o (6). 

Inheritance: 


Located in chromosome 6HS (4, 5, 17, 18), about 10.8 cM proximal from the 

msg36 (male sterile genetic 36) locus (5, 9), and about 2.2 cM distal from the 

cul2 (uniculm 2) locus (5, 7, 9), in bin 6H-06 near RFLP marker HVM031 (3). 

Description: 

The lemma, palea, and rachis have an orange pigmentation that is present in 

immature spikes, can be observed at heading, and is retained in mature grain 

and spikes (2, 15). The orange pigmentation is visible at the base of sheath of 

seedlings and in exposed nodes after jointing. Internodes have a layer of orange 

tissue and stems have an orange color as the straw dries. The mutant stock for 

rob1.f (OUM189) has a lighter orange lemma color than that in other mutants at 

the rob1 locus (10). The Bowman backcross-derived line with the rob1 gene had 

slightly lower acid-detergent lignin (ADL) content than Bowman (13), but it was 

also more susceptible to common root rot, caused by Bipolaris sorokiniana (11). 


A spontaneous mutant in CIho 5649 (15). 


rob1.a in CIho 5649 (GBC340, GSHO 707) (8, 15); rob1.b (OUM185), rob1.c 

(OUM186), rob1.d (OUM187), rob1.e (OUM188), rob1.f (OUM189) in Akashinriki 

(OUJ659, PI 467400) (10); rob1.1 (NGB 115071, NGB 119367), rob1.2 (NGB 

115072, NGB 119368) in Bonus (PI 189763), rob1.3 (NGB 115073, NGB 

119369), rob1.4 (NGB 115074, NGB 119370), rob1.5 (NGB 115075, NGB 

119371), rob1.6 (NGB 115076, 119372) in Foma (CIho 11333), rob1.7 (NGB 

115077, NGB 119373) in Kristina (NGB 1500) (12); rob1.g (200A12/8/2) from 

Emir (CIho 11790) isolated following a cross to Hordeum bulbosum (16). 


rob1.a in CIho 5649 (GSHO 707); rob1.a in Bowman (PI 483237)*8 (GSHO 

2069). 

References: 

1. Bauman, A. 1926. Barley with orange lemmas. Bull. Appl. Bot. & Pl. Breed. 

16:181-186. 

2. Buckley, G.F.H. 1930. Inheritance in barley with special reference to the color 

of caryopsis and lemma. Sci. Agric. 10:460-492. 





Genet. 103:415-424. 

4. Falk, D.E. 1994. Creation of a marked telo 6S trisomic for chromosome 6. 

255



5. Falk, D.E., M.J. Swartz, and K.J. Kasha. 1980. Linkage data with genes near 

the centromere of barley chromosome 6. Barley Genet. Newsl. 10:13-16. 



62:409-414. 




8. Ivanova, K.V. 1937. A new character in barley "third outer glume" — Its 

inheritance and linkage with color of the flowering glumes. Bull. Appl. Bot., 

Genet. & Pl. Breed. II. 7:339-353. 

9. Kasha, K.G., D.E. Falk, and A. Ho-Tsai. 1978. Linkage data with genes on 


10. Konishi, T. (Unpublished). 

11. Kutcher, H.R., K.L. Bailey, B.G. Rossnagel, and J.D. Franckowiak. 1996. 

Linked morphological and molecular markers associated with common root rot 

reaction in barley. Can. J. Plant Sci. 76:879-883. 

12. Lundqvist. U. (Unpublished). 

13. Meyer, D.W., J.D. Franckowiak, and R.D. Nudell. 2006. Forage quality of 

barley hay. Agronomy Abstracts 2006. 

14. Miyake, K., and Y. Imai. 1922. [Genetic studies in barley. 1.] Bot. Mag., 

Tokyo 36:25-38. [In Japanese.] 

15. Myler, J.L., and E.H. Stanford. 1942. Color inheritance in barley. J. Am. Soc. 

Agron. 34:427-436. 

16. Pickering, R.A. 2003. (Personal communications). 

17. Ramage, R.T., C.R. Burnham, and A. Hagberg. 1961. A summary of 

translocation studies in barley. Crop Sci. 1:277-279. 

18. Shahla, A., J.W. Shim, and T. Tsuchiya. 1983. Association of the gene o for 

orange lemma with the short arm of chromosome 6 (6S) in barley. BGN 13:83- 

84. 

Prepared: 

C.R. Burnham. 1971. BGN 1:157. 

Revised: 

J.D. Franckowiak, T. Konishi, and U. Lundqvist. 1997. BGN 26:235-236. 


256



Locus name: Erectoides-e 

Locus symbol: ert-e 

BGS 266, Erectoides-e, ert-e 


Erectoides-17 = ert-17 (2). 

Dense spike = la (4). 

Dense spike 9 = l9 (4). 

Inheritance: 


Located in chromosome 6HL (3, 7, 8), about 27.2 cM distal from the xnt5 (xantha 

seedling 5) locus (5), over 26.9 cM distal from the Aat2 (aspartate 

aminotransferase 2) locus (11). 

Description: 

Spikes are very compact with rachis internode length values from 1.2 to 1.5 mm. 

Plants are about 2/3 normal height. Partial fertility and reduced vigor are noted 

among ert-e mutants. The peduncle is very short and spikes often emerge from 

the side of the flag sheath (7, 9). A large deficiency of mutant plants is frequently 

noted in segregating populations (7). Spike density decreases greatly when 

plants are treated with GA3 as the flag leaf emerges (10). The mutant ert-e.17 is 

allelic to mutant dsp9.i (dense spike 9, see BGS 258) (1). 


An X-ray induced mutant in Bonus (PI 189763) (2). 


ert-e.17 (NGB 112619 ), -e.65 (NGB 112664) in Bonus (2); ert-e.94 (NGB 

112693), -e.143 (NGB 112742) in Bonus, -e.331 (NGB 112846), -e.396 (NGB 

114150) in Foma (CIho 11333) (9); dsp9.i (OUM113) in Akashinriki (4); dsp9.j 

(OUM106), dsp9.k (OUM107), dsp9.l (OUM115), dsp9.m (OUM118) in 

Akashinriki (6). 


ert-e.17 in Bonus (GSHO 477); ert-e.17 in Bowman (PI 483237)*6 (GSHO 2091); 

dsp9.i in Akashinriki (GSHO 1774); dsp9.i in Bowman (PI 483237)*7 (GSHO 

2090). 

References: 


2. Hagberg, A., Å. Gustafsson, and L. Ehrenberg. 1958. Sparsely contra densely 

ionizing radiations and the origin of erectoid mutants in barley. Hereditas 44:523- 

530. 

3. Hagberg, A., G. Persson, and A. Wiberg. 1963. Induced mutations in the 

improvement of self-pollinated crops. p. 105-124. In E. Åkerberg and A. Hagberg 

(eds.) Recent Plant Breeding Research. Svalöf 1946-1961. Almqvist & Wiksell, 

Stockholm. 

4. Konishi, T. 1973. Genetic analyses of EMS-induced mutants in barley. Barley 


5. Konishi, T. 1978. New linkage data on chromosome 6 of barley. Barley Genet. 

Newsl. 8:71-72. 

6. Konishi, T. (Unpublished). 

7. Persson, G. 1969. An attempt to find suitable genetic markers for the dense 

ear loci in barley I. Hereditas 62:25-96. 

257


8. Persson, G., and A. Hagberg. 1962. Linkage studies with the erectoides loci. 

Barley Newsl. 5:46-47. 




10. Stoy, V., and A. Hagberg. 1967. Effects of growth regulators on ear density 


11. Yoshimi, R., and T. Konishi. 1995. Linkage analysis of several isozyme loci in 

barley. Barley Genet. Newsl. 24:35-37. 

Prepared: 

U. Lundqvist and J.D. Franckowiak. 1997. BGN 26:246. 

Revised as BGS 258: 

T. Konishi and J.D. Franckowiak. 1997. BGS 258, Dense spike 9, dsp9. BGN 

26:239. 

Revised: 


258



Locus name: Variegated 1 

Locus symbol: var1 

BGS 306, Variegated 1, var1 


Variegated = va (4). 

Inheritance: 


Located in chromosome 5HL [7L] (4), about 4.6 cM proximal from the raw1 

(smooth awn 1) locus (3. 4), in bin 5H-09 about 29.2 cM proximal from the Rph9 

(reaction to Puccinia hordei 9) locus (1). 

Description: 

Narrow white stripes develop on young leaves, but they are not as well defined 

than those of white streak 7 (wst7). White stripes are visible on the foliage and 

stems of older plants (3). When sown in plots, selections homozygous for the 

var1.a gene have a whitish cast until heading (2). The Bowman backcrossderived 

line for var1 shows slightly delayed heading and may be slightly shorter 

(2). 


A gamma-ray induced mutant in Montcalm (CIho 7149) (4). 


var1.a in Montcalm (Alb Acc 311) (4). 


var1.a in Montcalm (GSHO 1278); var1.a in Bowman (PI 483237)*7 (GSHO 

2121). 

References: 

1. Borovkova, I.G., Y. Jin, and B.J. Steffenson. 1998. Chromosomal location and 

genetic relationship of leaf rust resistance genes Rph9 and Rph12 in barley. 



3. Jensen, J. 1981. Construction of a barley chromosome 7 linkage map. p. 927- 

939. In M.J.C. Asher, R.P. Ellis, A.M. Hayter, and R.N.H. Whitehouse (eds.) 

Barley Genetics IV. Proc. Fourth Int. Barley Genet. Symp., Edinburgh. Edinburgh 

Univ. Press, Edinburgh. 

4. Walker, G.W.R., J. Dietrich, R. Miller, and K. Kasha. 1963. Recent barley 

mutants and their linkages II. Genetic data for further mutants. Can. J. Genet. 

Cytol. 5:200-219. 

Prepared: 


Revised: 



259




Locus symbol: Eam5 

BGS 348, Early maturity 5, Eam5 


Early maturity = Ea (5, 8). 

Early maturity 3 = Ea3 (2, 3). 



Inheritance: 


Located in chromosome 5HL [7L] (2), very close to the raw1 (smooth awn 1) 

locus (1, 8, 9). 

Description: 

Plants with the Eam5 gene head 3 to 10 days earlier than normal sibs under 

short-day conditions (1, 5). Early heading is commonly associated a shorter 

stature compared to normal sibs. The slight reduction in height is also observed 

under long-day conditions. Peduncles and rachis internodes are slightly 

shortened (1). The Eam5 gene appears to be the common early maturity gene 

present in winter sown spring barley cultivars used in China and Japan; and it is 

present in the ICARDA/CIMMYT barley lines developed in Mexico. Complex 

interactions with other genes conditioning photoperiod response have been 

observed (1, 9). Takahashi and Yasuda (7) classified plants that were about 10 

days earlier than normal spring barley as having the Sgh2.II (spring growth of 

habit 2, grade 2) gene, but an earliness factor closely linked to the rough awn 

gene was earlier identified in spring barley (8). 


Natural occurrence in Indian cultivars (2, 3) and isolated from ICARDA/CIMMYT 

selection CMB85-533-H-1Y-1B-0Y-5B (Higuerilla*2/Gobernadora) (1). 


Eam5.x in CMB85-533 (1), Eam5.x in a number of Chinese cultivars planted in 

the fall (9). 


Eam5.x in CMB85-533; Eam5.x in Bowman (PI 483237)*6 (GSHO 3424). 

References: 


2. Jain, K.B.L. 1961. Genetic studies in barley. III. Linkage relations of some 

plant characters. Indian J. Genet. Plant Breed. 21:23-33. 

3. Murty, G.S., and K.B.L. Jain. 1960. Genetic studies in barley. II. Inheritance of 

fertility of lateral florets and certain other characters. J. Indian Botan. Soc. 

39:281-308. 

4. Nilan, R.A. 1964. The cytology and genetics of barley, 1951-1962. Monogr. 

Suppl. 3, Res. Stud. Vol. 32, No. 1. Washington State Univ. Press, Pullman. 

5. Robertson, D.W., G.A. Wiebe, and F.R. Immer. 1941. A summary of linkage 

studies in barley. J. Am. Soc. Agron. 33:47-64. 



III, 1954-1963. Crop Sci. 5:33-43. 

260


7. Takahashi, R., and S. Yasuda. 1971. Genetics of earliness and growth habit in 

barley. p. 388-408. In R.A. Nilan (ed.) Barley Genetics II. Proc. Second Int. 

Barley Genet. Symp., Pullman, WA, 1969. Washington State Univ. Press, 

Pullman. 

8. Wexelsen, H. 1934. Quantitative inheritance and linkage in barley. Hereditas 

18:307-348. 

9. Yu, G. 2006. Development of early maturing two-rowed malting barley with 

Fusarium head blight resistance. Ph.D. Thesis. North Dakota State University, 

Fargo. 

Prepared: 


Revised: 

J.D. Franckowiak and G. Yu. 2007. BGN 37:260-261. 

261







Brachytic-j = brh.j 4, 5). 

Inheritance: 


Located in chromosome 2HL (3), about 14.1 cM distal from SSR marker 

EBmac0850 in bin 2H-08 (1). 

Description: 

Seedling leaves of brh4 plants are short and wide compared to those of 

Bowman. Plants are 3/4 to 5/6 normal height and awns are about 3/4 of normal 

length. Plants have a rather erect growth habit. Peduncle length is about 3/4 

normal and rachis internodes are slightly shortened. Heading is delayed by about 

2 days and the fertile spikelet number is increased by over 3, but these effects 

could be caused by pleiotropism or linkage drag with the Eam6 (early maturity 6) 

locus. The kernels of brh4 plants are slightly shorter (8.3 vs. 9.4 mm), more 

globose shaped, and slightly smaller (46 vs. 56 mg) than those of Bowman. The 

yield reduction was non-significant in comparisons between the brh4.j Bowman 

line and Bowman (1, 2). 



(6). 


brh4.j in Birgitta (17:13:6, DWS1005) (5, 6). 


brh4.j in Birgitta (GSHO 1675); brh4.j in Bowman (PI 483237)*7 (GSHO 2130). 

References: 



96:654-662. 









Prepared: 


Revised: 


262







Brachytic-r = brh.r (3). 

Brachytic-s = brh.s (3). 

Inheritance: 


Located in chromosome 5HS [7S] (4), about 12.0 cM distal from SSR marker 

Bmag0394 in bin 5H-03 (1). 

Description: 

Plants of the Bowman backcross-derived line are 2/3 to 3/4 normal height and 

awns are 1/2 to 2/3 normal length. The seedling leaf of brh6 plants is shorter than 

that of normal sibs (1, 2). Peduncles and leaf blades are 2/3 normal length and 

the grain is nearly normal (1). However, kernels are nearly 20% lighter than those 

of Bowman with both decreased length and width (1, 2). Although grain yield of 

the near-isogenic line for brh6 was lower than those of tall Akashinriki, the brh6 

line was considered a high yielding dwarf (7). 


An ethyl methanesulfonate induced mutant in Akashinriki (OUJ659, PI 467400) 

(6, 7). 


brh6.r in Akashinriki (OUM133, dw-h, DWS1036, GSHO 1683), brh6.s in 

Akashinriki (OUM135, DWS1037, GSHO 1684) (3, 5, 6). 


brh6.r in Akashinriki (GSHO 1683); brh6.r in Bowman (PI 483237)*7 (GSHO 

2132). 

References: 



96:654-662. 








6. Konishi, T. 1976. The nature and characteristics of EMS-induced dwarf 

mutants in barley. p. 181-189. In H. Gaul (ed.). Barley Genetics III. Proc. Third 

Int. Barley Genet. Symp., Garching, 1975. Verlag Karl Thiemig, München. 

7. Konishi, T. 1977. Effects of induced dwarf genes on agronomic characters in 

barley. p. 21-38. In Use of dwarf mutations. Gamma-Field Symposium No. 16. 

Prepared: 

J.D. Franckowiak and T. Konishi. 2002. BGN 32:111. 

Revised: 


263


BGS 377, Shrunken endosperm genetic 1, seg1 


Locus name: Shrunken endosperm genetic 1 

Locus symbol: seg1 


Shrunken endosperm = se1 (4). 

Inheritance: 


Located in chromosome 7HL [1L] (3), linked to the msg23 (male sterile genetic 

23) locus (5). 

Description: 

Seed is long and thin and the 100-kernel weight is about 33% of normal. Good 

stands can be established in the field if optimum environmental conditions prevail 

during germination and emergence (3, 5). This mutant is associated with an 

increase in percentage lysine in the protein (5). Tannins are not deposited in 

seg1 chalazal cell central vacuoles, but rather appeared to cause cytoplasmic 

disorganization and cell death (1). Light microscopy revealed that seg1 mutants 

exhibited premature termination of grain filling because of the necrosis and 

crushing of the chalazal and nucellar projection of the pericarp early during grain 

filling (2). 


A spontaneous mutant in Betzes (PI 129430) (3). 


seg1.a in Betzes (3, 4). 


seg1.a in Betzes (GSHO 750); seg1.a in Bowman (PI 483237)*7 (GSHO 1852). 

References: 

1. Felker, F.C., D.M. Peterson, and O.E. Nelson. 1984. Development of tannin 

vacuoles in chalazal and seed coat of barley in relation to early chalazal necrosis 

in the seg1 mutant. Planta 161:540-549. 

2. Felker, F.C., D.M. Peterson, and O.E. Nelson. 1985. Anatomy of immature 

grains of eight material effect shrunken endosperm barley mutants. Amer. J. Bot. 

72:248-256. 

3. Jarvi, A.J. 1970. Shrunken endosperm mutants in barley, Hordeum vulgare. 

Ph.D. Thesis. Montana State Univ., Bozeman. 

4. Jarvi, A.J., and R.F. Eslick. 1971. BGS 377, Normal vs. shrunken endosperm, 

se1. Barley Genet. Newsl. 1:190. 

5. Jarvi, A.J., and R.F. Eslick. 1975. Shrunken endosperm mutants in barley. 

Crop Sci. 15:363-366. 

Prepared: 

A.J. Jarvi and R.F. Eslick. 1971. BGN 1:190. 

Revised: 

R.F. Eslick. 1976. BGN 6:135. 

T. Tsuchiya. 1980. BGN 10:124. 



264








Proanthocyanidin-free 17 = ant17 (3). 

Inheritance: 


Located in chromosome 3HS (1, 6), over 30.8 cM from the centromere (6). 

Description: 

Seed size is reduced to about 33% of normal when grown under field conditions. 

Seeds are long and thin similar to those from seg1 plants; seeds are viable and 

good stand establishment is possible (6). Light microscopy revealed that seg3 

mutants exhibited premature termination of grain filling because of the necrosis 

and crushing of the chalazal and nucellar projection of the pericarp early during 

grain filling (2). The mutant ant17.148 is an allele at the seg3 locus (3); thus, all 

mutants at the proanthocyanidin-free 17 (ant17) locus might be alleles at the 

shrunken endosperm genetic 3 locus. Alleles at the seg3 locus that have been 

examined in the Bowman genetic background showed a variable reduction in 

kernel weight: ant17.148 and seg3.c about 1/3 normal and ant17.567 about 3/4 

normal (3). The seg3 locus was named before the ant17 locus, but many more 

mutants were identified at the ant17 locus. Therefore, see BGS 599 for a 

complete listing of ant17 mutants. 


A spontaneous mutant in Compana (PI 539111) (4). 


seg3.c in Compana (4, 5), ant17.148 (Galant, NGB 13698) in Triumph (PI 

268180, NGB 13678) (3). 


seg3.c in Compana (GSHO 752); seg3.c in Bowman (PI 483237)*7 (GSHO 

1957), ant17.148 in Bowman*4 (GSHO 1973). 

References: 

1. Boyd, P.W., and D. E. Falk. 1990. (Personal communications). 



72:248-256. 

3. Franckowiak, J.D. (Personal communications). 






Crop Sci. 15:363-366. 

Prepared: 


B. Jende-Strid. 1999. BGN 29:88-89, as BGS 599, proanthocyanidin-free 17, 

ant17. 

Revised: 

265


R.F. Eslick. 1976. BGN 6:137. 

T. Tsuchiya. 1980. BGN 10:126. 



266








Inheritance: 


Located in chromosome 7HL [1L] (2), over 34.0 cM from the centromere (4). 

Description: 

Under field conditions in the original mutant, seed size is reduced to about 38% 

of normal and seed set is about 50% of normal. Stand establishment is poor 

under field conditions (2, 4). Endosperms of seg4 were characterized by 

progressively distorted, disorganized growth, but the quantity of endosperm 

tissue at maturity varied from severely reduced to near normal (1). The stock 

described in the 1997 revision was incorrect and was in fact a mixture with 

GSHO 755 (BGS 382, shrunken endosperm xenia 1, sex1), which was identified 

by Dr. Marion Röder, IPK, Gatersleben. 


A spontaneous mutant in Compana (PI 539111) (2). 


seg4.d in Compana (2, 3). 


seg4.d in Compana (GSHO 753). 

References: 



72:248-256. 






Crop Sci. 15:363-366. 

Prepared: 


Revised: 

R.F. Eslick. 1976. BGN 6:138. 

T. Tsuchiya. 1980. BGN 10:127. 



267








Inheritance: 


Located in chromosome 3HL (4). 

Description: 

Seed size is reduced, but the degree reduction is affected by environment. Seed 

weights of 25, 50, and 75% of normal are reported for plants grown in the field in 

Arizona, in the field in Montana, and in the greenhouse in Arizona, USA, 

respectively (4). Pollen mother cell meiosis and pollen fertility are normal. Seed 

from seg6.g plants can be used to establish stands under field conditions (4). 

Light microscopy revealed that seg6 mutants exhibited premature termination of 

grain filling because of the necrosis and crushing of the chalazal and nucellar 

projection of the pericarp early during grain filling (1). 


A spontaneous mutant in Ingrid (CIho 10083) (3). 


seg6.f in an unknown hybrid, seg6.g in Ingrid (3). 


seg6.g in Ingrid (GSHO 2467); seg6.g in Bowman (PI 483237)*4 (GSHO 1975). 

References: 



72:248-256. 

2. Ramage, R.T. 1983. Chromosome location of shrunken endosperm mutants 

seg6g and seg8k. Barley Genet. Newsl. 13:64-65. 

3. Ramage, R.T., and R.F. Eslick. 1975. BGS 396, Shrunken endosperm, xenia, 


4. Ramage, R.T., and J.F. Scheuring. 1976. Shrunken endosperm mutants seg6 

and seg7. Barley Genet. Newsl. 6:59-60. 

Prepared: 

R.T. Ramage and R.F. Eslick. 1975. BGN 5:114. 

Revised: 


T. Tsuchiya. 1980. BGN 10:130. 

R.T. Ramage. 1983. BGN 13:115. 



268








Inheritance: 


Location is unknown. 

Description: 

Seed size is reduced less than other seg mutants, but the degree reduction is 

affected by environment. Seed weights of 40, 75, and 90% of normal are 

reported for plants grown in the field in Arizona, in the field in Montana, and in the 

greenhouse in Arizona, USA, respectively (4). Pollen mother cell meiosis and 

pollen fertility are normal. Seed from seg7.h plants can be used to establish 

stands under field conditions (4). The shrunken endosperm trait was very difficult 

to detect in the crosses to Bowman (2). Light microscopy revealed that seg7 

mutants exhibited premature termination of grain filling because of the necrosis 

and crushing of the chalazal and nucellar projection of the pericarp early during 

grain filling (1). 


A spontaneous mutant in Ingrid (CIho 10083) (3). 


seg7.h in Ingrid (4). 


seg7.h in Ingrid (GSHO 2468); seg7.h in Bowman (PI 483237)*3 (GSHO 2352). 

References: 



72:248-256. 


3. Ramage, R.T., and R.F. Eslick. 1975. BGS 397, Shrunken endosperm, xenia, 


4. Ramage, R.T., and J.F. Scheuring. 1976. Shrunken endosperm mutants seg6 

and seg7. Barley Genet. Newsl. 6:59-60. 

Prepared: 


Revised: 


T. Tsuchiya. 1980. BGN 10:131. 



269



Locus name: Eceriferum-zt 

Locus symbol: cer-zt 

BGS 437, Eceriferum-zt, cer-zt 


None. 

Inheritance: 


Location in chromosome 2HS (1), in bin 2H-01 about 16.8 distal from SSR 

marker Bmac0134 (1). 

Description: 

Surface wax coating on the spike appears slightly reduced (wax code + ++ ++) 

(3). The reduction in the surface wax seemed greater in plants selected from the 

backcrosses to Bowman (wax code +/- ++ ++). 


An ethyl methanesulfonate and neutron induced mutant in Foma (CIho 11333) 

(2). 


cer-zt.389 (NGB 111276), -zt.479 (NGB 111367) in Foma (2). 


cer-zt.389 in Foma (GSHO 1527); cer-zt.389 in Bowman (PI 483237)*2 (GSHO 

2205). 

References: 

1. Dahleen, L.S., and J.D. Franckowiak. 2006. SSR linkages to eight additional 

morphological marker traits. Barley Genet. Newsl. 36:12-16. 




Prepared: 

U. Lundqvist. 1975. BGN 5:155. 

Revised: 



270



Locus name: Eceriferum-yf 

Locus symbol: cer-yf 

BGS 449, Eceriferum-yf, cer-yf 


None. 

Inheritance: 



Description: 

Surface wax coating on the leaf blade is reduced (wax code ++ ++ +) (3). In the 

Bowman backcross-derived line, mutant plants have pale green leaves, heading 

is delayed by several days, and plants are slightly shorter (1). 


A neutron induced mutant in Bonus (PI 189763) (2). 


cer-yf.652 (NGB 111540), -yf.804 (NGB 111692) in Bonus (3). 


cer-yf.652 in Bonus (GSHO 1539); cer-yf.652 in Bowman (PI 483237)*3 (GSHO 

2212). 

References: 




mutants II. Barley Genet. Newsl. 3:110-112. 

Prepared. 


Revised: 


Revised: 


271







None. 

Inheritance: 


Located in chromosome 7H [1] (4). 

Description: 

Seed size is reduced and maturity is delayed. Seed weights of 24, 23, and 27% 

of normal are reported for plants grown in the field in Arizona, in the field in 

Montana, and in the greenhouse in Arizona, USA, respectively (4). Pollen mother 

cell meiosis and pollen fertility are normal. Seed from seg8.k plants can be used 

to establish stands under field conditions (4). Endosperms of seg8 developed as 

two-filled lateral lobes with no central endosperm lobe, resulting in a distinct 

dorsal crease (1). 


A spontaneous mutant in 60Ab1810-53 (CIho 15686) (3). 


seg8.k in 60Ab1810-53 (3, 4). 


seg8.k in 60Ab1810-53 (GSHO 2469); seg8.k in Bowman (PI 483237)*5 (GSHO 

1854). 

References: 



72:248-256. 

2. Ramage, R.T. 1983. Chromosome location of shrunken endosperm mutants 

seg6g and seg8k. Barley Genet. Newsl. 13:64-65. 

3. Ramage, R.T., and C.L. Crandall. 1981. BGS 453, Shrunken endosperm, 

seg8. Barley Genet. Newsl. 11:103. 

4. Ramage, R.T., and C.L. Crandall. 1981. Shrunken endosperm mutant seg8. 


Prepared: 

R.T. Ramage and C.L. Crandall. 1981. BGN 11:103 as BGS 453. 

Revised: 

R.T. Ramage. 1983. BGN 13:116 as BGS 453. 

T. Tsuchiya. 1983. BGN 13:117. BGS number changed to BGS 455. 



272



Locus name: Laxatum-a 

Locus symbol: lax-a 

BGS 474, Laxatum-a, lax-a 


Laxatum-01 = lax-01 (3, 6, 11). 

Laxatum-a = lax-a 01 (12). 

Inheritance: 


Located in chromosome 5HL [7L] (7, 10), about 2.4 cM proximal from the ari-e 

(breviaristatum-e) locus (5, 14), and about 3.1 cM from the ert-g (erectoides-g) 

locus (5, 12, 13). 

Description: 

Florets have five anthers with two developing from transformed lodicules (3, 15); 

however, the extra anthers are deficient in having two rather than four 

microsporangia (1). The grain is thin and angular and caryopses are exposed 

between the lemma and palea. The awn has a very wide base, without a distinct 

notch in the lemma attachment region. Rachis internodes are 13% longer than 

normal. Tillers arise at oblique angles giving isolated plants an appearance of a 

tufty growth habit (6). Treatment of leaves after tillering with GA3 increases rachis 

internode length (15). 


A gamma-ray induced mutant in Bonus (PI 189763) (2, 6, 9). 


lax-a.01 (NGB 116334), -a.4 (NGB 116338), -a.8 (NGB 116342), -a.20 (NGB 

116354), -a.37 (NGB 116372), -a.39 (NGB 116374), -a.54 (NGB 116388) in 

Bonus (6, 9); lax-a.92 (NGB 116425, NGB 116426) in Bonus (9); lax-a.208 (NGB 

116435, NGB 116436), -a.218 (NGB 116446), -a.222 (NGB 116450), -a.229 

(NGB 116457, NGB 116458), -a.249, -a.256 (NGB 116483), -a.278 (NGB 

116503), -a.286 (NGB 116510) in Foma (CIho 11333) (6, 8); -a.353 (NGB 

116559, NGB 116560), -a.369 (NGB 116578, 116579), -a.373 (NGB 116583), - 

a.398 (NGB 116608), -a.405 (NGB 116613), -a.406 (NGB 116614) in Kristina 

(NGB 14661) (7); -a.413 (NGB 116621, NGB 116622), -a.434 (NGB 116647), - 

a.437 (NGB 116650), -a.444 (NGB 116658, NGB 116659), -a.448 (NGB 

116664), -a.450 (NGB 116667, NGB 116668), -a.455 (NGB 116674, NGB 

116675), -a.472 (NGB 116695) in Bonus (8); a lax-a mutant (Mut 2100/61) in 

Proctor (PI 280420) (4). 


lax-a.8 in Bonus (GSHO 1775); lax-a.8 in Bowman (PI 483237)*7 (GSHO 2103). 

References: 

1. Bossinger, G., W. Rohde W, U. Lundqvist U, and F. Salamini F. 1992. 

Genetics of barley development: mutant phenotypes and molecular aspects. p. 

231-264. In P.R. Shewry (ed.) Barley: Genetics, Biochemistry, Molecular Biology 

and Biotechnology. CAB International, Oxford. 

2. Ehrenberg, L., Å. Gustafsson, and U. Lundqvist. 1961. Viable mutants induced 

in barley by ionizing radiations and chemical mutagens. Hereditas 47:257-278. 



62:409-414. 

273


4. Häuser, H., and G. Fischbeck. 1972. Translocations and genetic analysis of 

other mutants. BGN 2:28-29. 

5. Jensen, J. 1981. Construction of a barley chromosome 7 linkage map. p. 927- 

939. In M.J.C. Asher, R.P. Ellis, A.M. Hayter, and R.N.H. Whitehouse (eds.) 



6. Larsson, H.E.B. 1985. Morphological analysis of laxatum barley mutants. 

Hereditas 103:239-253. 

7. Larsson, H.E.B. 1985. Linkage studies with genetic markers and some 

laxatum barley mutants. Hereditas 103:269-279. 


9. Persson, G. 1969. An attempt to find suitable genetic markers for the dense 

ear loci in barley II. Hereditas 63:1-28. 

10. Persson, G., and A. Hagberg. 1965. Localization of nine induced mutations in 

the barley chromosomes. Barley Newsl. 8:52-54. 




12. Søgaard, B. 1974. Three-point tests on chromosome 1 and 7. BGN 4:70-73. 

13. Søgaard, B. 1977. The localization of eceriferum loci in barley. IV. Three 

point tests of genes on chromosome 7 in barley. Carlsberg Res. Commun. 42:35- 

43. 

14. Stoy, V., and A. Hagberg. 1967. Effects of growth regulators on ear density 


15. Wettstein, D. von, Å. Gustafsson, and L. Ehrenberg. 1959. 

Mutationsforschung und Züchtung. p. 7-50. In Arbeitsgemeinschaft für Forschung 

des Landes Nordrhein-Westfalen, Heft 73. Westdeutscher Verlag Köln und 

Opladen. 

Prepared: 

H.E.B. Larsson and U. Lundqvist. 1986. BGN 16:57. 

Revised: 


Revised: 


274


BGS 516, Reaction to Septoria passerinii 2, Rsp2 


Locus name: Reaction to Septoria passerinii 2 

Locus symbol: Rsp2 


Resistance to Septoria passerinii Sacc = Sep2 (1, 2). 

Inheritance: 


Location in chromosome 1HS [5S] (3), about 3.9 cM from the Rsp3 (reaction to 

Septoria passerinii 3) locus (2), cosegregation with SCAR marker E-ACT/M-CAA- 

170a and close to the Rsp3 locus (3), about 17.6 cM proximal from marker RFLP 

Act8 (3). 

Description: 

The Rsp2.b gene conditions a high level of resistance to a single spore culture of 

Septoria passerinii isolated in Minnesota, USA. Pycnidia are observed in some, 

but not all lesions, on all F1 plants (2). 


Natural occurrence in accession CIho 4780 (PI 70837) (2). 


Rsp2.b in PI 70837. 


Rsp2.b in PI 70837 (GSHO 2511). 

References: 

1. Moseman, J.G. 1972. Report on genes for resistance to pests. Barley Genet. 

Newsl. 2:145-147. 

2. Rasmusson, D.C., and W.E. Rogers. 1963. Inheritance of resistance to 

septoria in barley. Crop Sci. 3:161-163. 

3. Zhong, S., H. Toubia-Rahme, B.J. Steffenson, and K.P. Smith. 2006. 

Molecular mapping and marker-assisted selection of genes for septoria speckled 

leaf blotch resistance in barley. Phytopathology 96:993-999. 

Prepared: 

D.C. Rasmusson. 1988. BGN 18:85 as BGS 466. 

Revised: 



275


BGS 517, Reaction to Septoria passerinii 3, Rsp3 


Locus name: Reaction to Septoria passerinii 3 

Locus symbol: Rsp3 


Resistance to Septoria passerinii Sacc = Sep3 (1, 2). 

Inheritance: 


Location in chromosome 1HS [5S] (3), about 3.9 cM from the Rsp2 (reaction to 

Septoria passerinii 2) locus (2), cosegregation with SCAR marker E-ACT/M-CAA- 

170a and close to the Rsp2 locus (3), about 17.6 cM proximal from marker RFLP 

Act8 (3). 

Description: 

The Rsp3.c gene conditions a high level of resistance to a single spore culture of 

Septoria passerinii isolated in Minnesota, USA. Infection occurs on F1 seedlings, 

but is limited to a few lesions (2). 


Natural occurrence in selection II-51-43 from a Feebar/Kindred cross (CIho 

10644) (2). 


Rsp3.c in CIho 10644. 


Rsp3.c in CIho 10644 (GSHO 2512). 

References: 

1. Moseman, J.G. 1972. Report on genes for resistance to pests. Barley Genet. 

Newsl. 2:145-147. 

2. Rasmusson, D.C., and W.E. Rogers. 1963. Inheritance of resistance to 

septoria in barley. Crop Sci. 3:161-163. 

3. Zhong, S., H. Toubia-Rahme, B.J. Steffenson, and K.P. Smith. 2006. 

Molecular mapping and marker-assisted selection of genes for septoria speckled 

leaf blotch resistance in barley. Phytopathology 96:993-999. 

Prepared: 


Revised: 



276



Locus name: Semidwarf 1 

Locus symbol: sdw1 

BGS 518, Semidwarf 1, sdw1 


Denso dwarf = denso (5, 12). 

Inheritance: 

Monofactorial recessive (5, 13), although some F1's tend to be intermediate in 

height compared to their parents (1, 8). 

Location in chromosome 3HL (2, 9), probably proximal from the gsh2 (glossy 

sheath 2) locus, near RFLP marker PSR170 (9), in bin 3H-11 (7), near RFLP 

marker R1545 (16). 

Description: 

Plants homozygous for the sdw1.a gene range from 10 to 30 cm shorter than 

normal sibs, with expression partial dependent on environment (1, 12, 14). Spike 

length is variable, but fully as long as normal barley. The stock used for 

description of the sdw1.a gene, M21, has the short straw and long spike of the 

original 'Jotun Mutant' as well as a large culm diameter from its parent 'Vantage' 

(1, 14). The semidwarf mutants, 'Diamant' and ‘Abed Denso’, are alleles at the 

sdw1 locus (5, 10). Alleles at the sdw1 locus are associated with semiprostrate 

juvenile growth (5, 12), delayed maturity (4, 6, 12, 15), and reduced malt quality 

(4, 6, 12). The sdw1 mutants are GA sensitive (3, 16), and they are very likely 

mutants in an orthologue of the rice sd1 gene (16), which encodes a GA-oxidase 

that produces lower levels of GA and therefore causes the dwarf phenotype (11). 

The original cultivar ‘Trumpf’ was also marketed in the United Kingdom as 

‘Triumph’. 


An X-ray induced mutant in the Norwegian cultivar Jotun (PI 467357) isolated as 

Jotun 22 by Knut Mikaelsen (1, 8). 


sdw1.a in Jotun (66/86, GSHO 1414) (14); sdw1.c (denso) in Abed Denso (PI 

361639) (5); sdw1.d (Diamant) in Valticky (5); sdw1.e (Risø 9265) in Bomi (PI 

43371) (5). 


sdw1.a in M21 (CIho 15481, GSHO 2513) from the cross Jotun Mutant/Kindred// 

Vantage (13); sdw1.d in Trumpf (Triumph, PI 548762, GSHO 2465); sdw1.a from 

a Jotun derivative in Bowman (PI 483237)*7 (GSHO 1978); sdw1.d from Trumpf 

in Bowman*4 (GSHO 1979). 

References: 

1. Ali, M.A.M., O. Okiror, and D.C. Rasmusson. 1978. Performance of semidwarf 


2. Barau, U.M., K.J. Chambers, W.T.B. Thomas, C.A. Hackett, V. Lea, P. Jack, 

B.P. Forster, R. Waugh, and W. Powell. 1993. Molecular mapping of genes 

determining height, time to heading, and growth habit in barley (Hordeum 

vulgare). Genome 36:1080-1087. 

3. Boulger, M.C., R.G. Sears, and W.E. Kronstad. 1982. An investigation of the 

association between dwarfing sources and gibberellic acid response in barley. p. 

550-553. In M.J.C. Asher, R.P. Ellis, A.M. Hayter, and R.N.H. Whitehouse (eds.) 

277




4. Foster, A.E., and A.P. Thompson. 1987. Effects of a semidwarf gene from 

Jotun on agronomic and quality traits of barley. p. 979-982. In S. Yasuda and T. 

Konishi (eds.) Barley Genetics V., Proc. Fifth Int. Barley Genet. Symp., 

Okayama, 1986. Sanyo Press Co., Okayama. 

5. Haahr, V., and D. von Wettstein. 1976. Studies of an induced, high-yielding 

dwarf-mutant of spring barley. p. 215-218. In H. Gaul (ed.) Barley Genetics III., 

Proc. Third Int. Barley Genet. Symp., Garching, 1975. Verlag Karl Thiemig, 

München. 

6. Hellewell, K.B., D.C. Rasmusson, M. Gallo-Meagher. 2000. Enhancing yield of 

semidwarf barley. Crop Sci. 40:352-358. 



8. Lambert, J.W., and M. Shafi. 1959. Inheritance and heritability of height in 

three barley crosses. Barley Newsl. 3:7-8. (Abstr.) 

9. Laurie, D.A., N. Pratchett, C. Romero, E. Simpson, and J.W. Snape. 1993. 

Assignment of the denso dwarfing gene to the long arm of chromosome 3 (3H) of 

barley by use of RFLP markers. Plant Breed. 111:198-203. 

10. Mickelson, H.R., and D.C. Rasmusson. 1994. Genes for short stature in 


11. Murai, M., T. Komazaki, and S. Sato. 2004. Effects of sd1 and Ur1 (Undulate 

rachis – 1) on lodging resistance and related traits in rice. Breed. Science 54: 

333-340. 

12. Powell, W., P.D.J. Caligari, W.T.B. Thomas, and J.L. Jinks. 1985. The effects 

of major genes on quantitatively varying characters in barley. 2. The denso and 

day length response loci. Heredity 54:349-352. 

13. Powell, W., P.D.J. Caligari, W.T.B. Thomas, and J.L. Jinks. 1991. The effects 

of major genes on quantitatively varying characters in barley. 4. The GPert and 

denso loci and quality characters. Heredity 66:381-389. 

14. Rasmusson, D.C., E.E. Banttari, and J.W. Lambert. 1973. Registration of 

M21 and M22 semidwarf barley. Crop Sci. 13:777. 

15. Yin, X., P.C. Struik, F.A. van Eeuwijk, P. Stam, and J. Tang. 2005. QTL 

analysis and QTL-based prediction of flowering phenology in recombinant inbred 

lines of barley. J. Exp. Bot. 56 (413):967-976. 

16. Zhang, J., X. Yang, P. Moolhuijzen, C. Li, M. Bellgard, R. Lance, and R. 

Appels. 2005. Towards isolation of the barley green revolution gene. 

Proceedings of Australian Barley Technical Symposium 2005. 

http://www.cdesign.com.au/proceedings_abts2005/posters%20(pdf)/poster_li.pdf. 

Prepared: 


Revised: 



278



Locus name: Intermedium spike-k 

Locus symbol: int-k 

BGS 546, Intermedium spike-k, int-k 


None. 

Inheritance: 


Located in chromosome 7H [1] (2) in the centromeric region closely linked to 

markers Bmag0217 and Bmac0162 in bins 6 to 7 (2). 

Description: 

The spike is short and dense in the original mutant. Lateral spikelets are 

enlarged and the apex is pointed, and they occasionally have a short awn. Seed 

set does not occur in lateral spikelets and the central spikelets are semi-sterile 

(3). Plants of the original stock have a dense coating of surface waxes. In the 

Bowman backcross-derived line, plants are small and weak (about 1/2 normal 

height) and have short spikes (1/2 normal), reduced awn length (3/4 normal), and 

very poor seed set. Awns of plants in the derived line are semi-rough, but F1 

hybrids with Bowman have semismooth awns (1). 


An ethyl methanesulfonate induced mutant in Kristina (NGB 1500) (3). 


int-k.47 in Kristina (3). 


in-k.47 in Kristina (GSHO 1770, NGB 115465); int-k.47 in Bowman (PI 

483237)*6. 

References: 


2. Dahleen, L.S., and J.D. Franckowiak. 2006. SSR Linkages to Eight Additional 

Morphological Marker Traits. Barley Genet. Newsl. 36:12-16. 

3. Lundqvist, U., and A. Lundqvist. 1988. Induced intermedium mutants in barley: 

origin, morphology and inheritance. Hereditas 108:13-26. 

Prepared: 


Revised: 


279



Locus name: Intermedium spike-m 

Locus symbol: int-m 

BGS 547, Intermedium spike-m, int-m 


None. 

Inheritance: 



Description: 

The spike is very short and has irregular rachis internode lengths. Lateral 

spikelets are enlarged and pointed, but they do not set seed. Spikelet density at 

the base of the spike is increased. Rachis internodes at the tip of the spike are 

very short, and the spike appears to have two or three fused or fasciated terminal 

spikelets. Tillering of int-m plants is increased (1, 4) and heading is slightly earlier 

(4). 


A sodium azide induced mutant in Bonus (PI 189763) (3). 


int-m.85 (NGB 115503) in Bonus (3); int-m.la (GSHO 1773) in Lamont (PI 

512036) (2). 


int-m.85 in Bonus (GSHO 1772); int-m.85 in Bowman (PI 483237)*7 (GSHO 

2273); int-m.la in Bowman (PI 483237)*5 (GSHO 2274). 

References: 


characterization of the barley uniculm 2 (cul2) mutant. Theor. Appl. Genet. 

106:846-857. 



4. Lundqvist, U., and A. Lundqvist. 1988. Induced intermedium mutants in barley: 

origin, morphology and inheritance. Hereditas 108:13-26. 

Prepared: 


Revised: 


280



Locus name: Erectoides-t 

Locus symbol: ert-t 

BGS 566, Erectoides-t, ert-t 


Erectoides-55 = ert-55 (7). 

Brachytic 4 = br4 (10). 

Brachytic-g = brh.g (3). 

Brachytic 3 = brh3 (4). 

Brachytic-i = brh.i (3). 

Brachytic-y = brh.y (3). 

Inheritance: 


Located in chromosome 2HS (2), approximately 11.4 cM distal from SSR marker 

Bmac0134 (2), near the boundary between bins 2H-01 and 2H-02 (2). 

Description: 

Spikes are semicompact, rachis internode length is about 2.7 mm in the original 

mutant, and culm length is about 2/3 of normal. These phenotypic traits plus 

short awns are inherited together (9). Based on general appearance of the 

plants, ert-t can be placed in the brachytic class of semidwarf mutants (3, 10). 

Awns are about 2/3 normal length and curled or coiled near their tips. The ertt.55 

mutant has a short seedling leaves and is sensitive to gibberellic acid 

treatment (1). In the Bowman backcross-derived lines, peduncles are about 2/3 

normal, rachis internodes are slightly short, and lodging is reduced. Kernels are 

slightly lighter and yields are about 1/2 normal (2). 


An X-ray induced mutant in Bonus (PI 189763) (7). 


ert-t.55 in Bonus (NGB 112654) (7); brh3.g (17:10:1, DWS1002), brh3.h (17:11:3, 

DWS1003), brh3.i (17:12:1, DWS1004) in Birgitta (NGB 1494, NGB 14667) (2, 3, 

4, 8); brh3.y (10001, DWS1230, GSHO 1688) in Bido (PI 399485) (2, 3, 6). 


ert-t.55 in Bonus (GSHO 494); ert-t.55 in Bowman (PI 483237)*7 (GSHO 2257); 

brh3.g in Birgitta (GSHO 1672); brh3.g in Bowman*7 (GSHO 2167); brh3.y in 


References: 


25:24-26. 



96:654-662. 


BGN 24:56-59. 

4. Franckowiak. 2002. BGS 631, Brachytic 3, brh3. BGN 32:132. 



6. Gaul, H. 1986. (Personal communications). 

7. Hagberg, A., Å. Gustafsson, and L. Ehrenberg. 1958. Sparsely contra densely 

ionizing radiations and the origin of erectoid mutants in barley. Hereditas 44:523- 

281


530. 





10. Tsuchiya, T. 1976. Allelism testing of genes between brachytic and 

erectoides mutants. Barley Genet. Newsl. 6:79-81. 

Prepared: 


J.D. Franckowiak. 2002. BGS 631, Brachytic 3, brh3. BGN 32:132. 

Revised: 

J.D. Franckowiak and L.S. Dahleen. 2007. BGN 37:281-282. 

282


BGS 577, Reaction to Schizaphis graminum 2, Rsg2 


Locus name: Reaction to Schizaphis graminum 2 (greenbug) 

Locus symbol: Rsg2 


None. 

Inheritance: 



Description: 

Resistant seedlings infested with greenbugs (aphids) are not killed or severely 

stunted by a buildup of the greenbug population, but susceptible seedlings are 

killed or severely stunted (1, 4). The resistance provided by PI 426756 (4 to 5 

readings on a 1 to 9 scale) to most S. graminum biotypes was less effective than 

that provided the Rsg1.a gene in Post 90 (PI 549081) (2 to 3 readings) (3). PI 

426756 was confirmed to provide resistance (2 to 3 readings) to the TX1 isolate 

of S. graminum, which produces a susceptible reaction (9 reading) on Post 90 

(2). 


Natural occurrence in Joa (PI 426756) (1, 4). 


Rsg2.b in PI 426756 (1). 


Rsg2.b in PI 426756 (GSHO 2513). 

References: 

1. Merkle, O.G., J.A. Webster, and G.H. Mogen. 1987. Inheritance of a second 

source of greenbug resistance in barley. Crop Sci. 27:241-243. 

2. Porter, D.R., J.D. Burd, and D.W. Mornhinweg. 2007. Differentiating greenbug 


3. Porter, D.R., and D.W. Mornhinweg. 2004. Characterization of greenbug 

resistance in barley. Plant Breed. 123:493-494. 

4. Webster, J.A., and K.J. Starks. 1984. Sources of resistance in barley to two 

biotypes of greenbug Schizaphis graminum (Rondani), Homoptera: Aphididae. 

Protect. Ecol. 6:51-55. 

Prepared: 


Revised: 


283



Locus name: Bracteatum-d 

Locus symbol: bra-d 

BGS 586, Bracteatum-d, bra-d 


None. 

Inheritance: 


Located in chromosome 1HL [5L] (5), about 4.1 cM from AFLP marker E3634-7 

(5), probably in bin 1H-14 based on the association with trd1 (third outer glume 1) 

(2, 5). 

Description: 

The characteristic trait of this mutant is the presence of a bract (third outer 

glume) outside the two empty glumes of the central spikelet. The bract 

subtending the lowest spikelet is always the largest, embracing in some cases 

about one-half the spike. Bracts become progressively smaller toward the tip of 

the spike. Mutants have elongated basal rachis internodes (3, 4). Pozzi et al. (5) 

suggested that bra-d.7 is allelic to trd1 (third outer glume 1) or near the trd1 

locus. Allelism studies demonstrated that bra-d.7 is not an allele at the trd1 locus 

(3). 


An ethylene imine induced mutant in Foma (CIho 11333) (3). 


bra-d.7 (NGB 114310) in Foma (3). 


bra-d.7 in Foma (GSHO 1696); bra-d.7 in Bowman (PI 483237)*3 (GSHO 2185). 

References: 



62:409-414. 




4. Nybom, N. 1954. Mutation types in barley. Acta Agric. Scand. 4:430-456. 




Prepared: 


Revised: 


284



Locus name: Awned palea 1 

Locus symbol: adp1 

BGS 593, Awned palea 1, adp1 


Awned palea = adp (1). 

Inheritance: 


Located in chromosome 3HL (2), about 5.8 cM distal from AFLP marker E3634-8 

in subgroup 27 of the Proctor/Nudinka map (2). 

Description: 

This mutant was isolated as a partially female sterile plant with abnormal spikes. 

The palea is elongated to form two awns (2), which are derived from two fused 

bracts that form the palea (3). Pistils are often transformed into leafy buds and 

result in low female fertility and greatly reduced seed set. Two of the anthers 

appear normal and the third is deformed to some extent (1). Pollen fertility is 

good (1). 


A spontaneous mutant in an inbred line (1). 


adp1.a in an unknown inbred line (1). 


adp1.a in a selection, with the eog1.a (elongated outer glume 1) gene from 

Svalöfs Guldkorn 91 [AHOR 226, a mutant of Gull (CIho 1145, GSHO 466)] (1), 

crossed to the unknown line (GSHO 1618); adp1.a in Bowman*5 (GSHO 1950). 

References: 

1. Ahokas, H. 1977. A mutant of barley: Awned palea. Barley Genet. Newsl. 7:8- 

10. 




3. Williams, R.F. 1975. The Shoot Apex and Leaf Growth. Cambridge University 

Press, Cambridge. 

Prepared: 


Revised: 


285


BGS 599, Proanthocyanidin-free 17, ant17 


Locus name: Proanthocyanidin-free 17 

Locus symbol: ant17 

Previous nomenclature and symbolization: 

None. 

Inheritance: 


Located in chromosome 3HS (1), it has been shown that ant17.148 is an allele at 

the seg3 (shrunken endosperm genetic 3, see BGS 379) locus (2). 

Description: 

Under normal growing conditions no anthocyanin pigmentation is observed in the 

mutant plants. The testa layers of the grain of the ant17 mutants lack 

proanthocyanidins and catechins, but accumulate homoeriodictyol and 

chrysoeriol (7, 10). A full length cDNA clone from barley, coding for a protein 

consisting of 377 amino acids (42 kDa), has been isolated. It shows a homology 

of 71% to the flavanone-3-hydroxylase enzyme protein from Antirrhinum majus 

(12). It is likely that the ant17 gene codes for one subunit and the ant22 gene for 

the other subunit of the dimeric flavanone 3-hydroxylase enzyme, which 

catalyzes the conversion of flavanones into dihydroflavanols (7, 12). The mutant 

stock ant17.148 was released as cultivar Galant (11). Alleles at the ant17 locus 

that have been examined in the Bowman genetic background showed a variable 

reduction in kernel weight: ant17.148 and seg3.c about 1/3 normal and ant17.567 

about 3/4 normal (2). 


A sodium azide induced mutant in Nordal (NGB 13680) (3). 


ant17.103, 17.104, 17.105, 17.139, 17.140, 17.142, 17.143, 17.145 in Nordal (4); 

ant17.107 in Alf (NGB13682) (4); ant17.147, 17.148 (Galant) (NGB 13698), 

17.150, 17.151, 17.153, 17.154, 17.180, 17.185 in Triumph (PI 268180, NGB 

13678) (4); ant17.352 in Triumph (5); ant17.160 in Gula Abed (NGB 13681) (4); 

ant17.165, 17.167, 17.169, 17.171, 17.174, 17.182 in Ark Royal (PI 447006) (4); 

ant17.192, 17.193 in Georgie (PI 447012, NGB 13683) (4); ant17.199 in Secobra 

4681 (4); ant17.200 in Secobra 4681 (5); ant17.208 in Hege 876 (4); ant17.210, 

17.211, 17.217 in Hege 802 (4); ant 17.216 in Hege 802 (5); ant17.220, 17.221, 

17.224, in Secobra 4743 (NGB 13679) (4); ant17.227 in Ca 59995 (5); ant17.231 

in Tron (4); ant17.237, 17.239, 17.241, 17.242, 17.247, 17.249 in Gunhild (PI 

464655, NGB 13690) (4); ant17.243, 17.246 in Gunhild (5); ant17.250, 17.251, 

17.252, 17.253, 17.255 in Tokak (PI 264251) (4); ant17.267, 17.268, 17.269 in 

Secobra 18193 (NGB 13684) (4); ant17.270 in Secobra 18193 (5); ant17.280 in 

Hege 550/75 (NGB 13692) (9); ant17.288, 17.289, 17.290 in Hege 550/75 (4); 

ant17.293, 17.294, 17.295, 17.296 in Bonus (PI 189763) (4); ant17.297, 17.298, 

17.300, 17.301, 17.307 in Ca 41507 (4); ant17.306, 17.340 in Ca 41507 (5); 

ant17.316 in Ca 33787 (NGB 13693) (5); ant17.318, 17.321, 17.326 in Harry (PI 

491575) (5); ant17.331 in Hege A2/A4 (5); ant17.335, 17.336, 17.338 in 

Ackermann 724/5/7 (5); ant17.359 in Hege15/74-1A (5); ant17.370 in Ackermann 

72/440 (5); ant17.372, 17.413, 17.414, 17.417, 17.418, 17.419, 17.444 in Kaya 

(5); ant17.375 in Fanette (6); ant17.379, 17.382, 17.383, 17.386, 17.387, 17.388, 

17.389, 17.390, 17.391, 17.464, 17.465 in Irene (5); ant17.405 in Odin (6); 

286


ant17.408 in KMJ 326 (5); ant17.410, 17.447 in Catrin (5); ant17.421 in VBS 

18707 (5); ant17.422, 17.423, 17.424, 17.426 in NZ 3789 (5); ant17.432 in NZ 

1836-3 (5); ant17.438, 17.439 in NZ 732.01 (5); ant17.440 in Nordal (5); 

ant17.450 in Ca 601427 (5); ant17.453, 17.455, 17.457, 17.458 in Ackermann 

1734/5 (5); ant17.462 in Pamela (5); ant17.469, 17.470 in Grit (PI 548764, NGB 

13685) (5); ant17.475 in Zenit (PI 564447, NGB 13686) (5); ant17.476 in Zenit 

(6); ant17.480 in Secobra 9709 (5); ant17.501 in Advance (CIho 15804) (4); 

ant17.504 in Karla (CIho 15860) (4); ant17.506, 17.507, 17.508, 17.509 in OR 

9114 (4); ant17.515, 17.516, 17.518 in WA9037-75 (4); ant17.520 in WA9044-75 

(4); ant17.530 in Morex (CIho15773) (4); ant17.537, 17.595, 17.619, 17.620 in 

Advance (5); ant17.560, 17.561, 17.563, 17.565, 17.567 in Manker (CIho 15549) 

(5); ant17.597 in Morex (6); ant17.598 in Morex (5); ant17.600 in S 80351 (5); 

ant17.601 in Moravian 111 (CIho 15812) (5); ant17.604 in Harrington (6); 

ant17.612 in Andre‚ (PI 469107) (5); ant17.624 in Klages (CIho 15478) (5); 

ant17.625 in Robust (M36, PI 476976) (5); ant17.630 in Azure (CIho 15865) (13); 

ant17.636, 17.658 in Cougbar (PI 496400) (13); ant17.637 in 8892-78 (13); 

ant17.661 in Crest (PI 561409) (13); ant17.1502, 17.1505, 17.1519 in Amagi-Nijo 

(4); ant17.1510, 17.1511 in Haruna- Nijo (4); ant17.1515 in Nirakei 61 (4); 

ant17.1537 in Nirakei 62 (5); ant17.1544 in Nirakei 63 (5); ant17.1534 in 

Nirasaki-Nijo 14 (5); ant17.2022, 17.2067 in Natasha (PI 592171) (6); ant17.2084 

in Hege 694/82 (9); ant17.2106 in Ca 708912 (8); ant17.5019 in Sonja (PI 

302047) (9); ant17.5024 in Ackermann 72/27/4 (6); ant17.5028 in Trigger (PI 

473541) (9); ant17.5034 in Kaskade (9); ant17.5035, 17.5036, 17.5037 in Video 

(6); ant17.5038, 17.5039, 17.5040, 17.5042 in Sonja (6); ant17.5044 in 

Ackermann 27/220/8 (6). 

Mutant used for description and seed stock: 

ant17.139 in Nordal (NGB 13697); ant17.148 (Galant) in Triumph (NGB 13698, 

GSHO 1628); ant17.148 in Bowman (PI 483237)*4 (GSHO 1973); ant17.567 in 

Manker (GSHO 1629); ant17.567 in Bowman*5 (GSHO 1974), seg3.c in 

Bowman (PI 483237)*7 (GSHO 1957). 

References: 

1. Boyd, P.W., and D. E. Falk. 1990. (Personal communications). 

2. Franckowiak, J.D. (Personal communications). 

3. Jende-Strid, B. 1978. Mutation frequencies obtained after sodium azide 

treatments in different barley varieties. Barley Genet. Newsl. 8:55-57. 

4. Jende-Strid, B. 1984. Coordinator's report: Anthocyanin genes. Barley Genet. 

Newsl. 14:76-79. 

5. Jende-Strid, B. 1988. Coordinator's report: Anthocyanin genes. Stock list of ant 

mutants kept at the Carlsberg Laboratory. Barley Genet. Newsl. 18:74-79. 


Newsl. 20:87-88. 

7. Jende-Strid, B. 1993. Genetic control of flavonoid biosynthesis in barley. 

Hereditas 119:187-204. 


Newsl. 22:136-137. 

9. Jende-Strid, B. 1995. Coordinator's report: Anthocyanin genes Barley Genet. 

Newsl. 24:162-165. 

10. Jende-Strid, B., and K.N. Kristiansen. 1987. Genetics of flavonoid 

biosynthesis in barley. p. 445-453. In: S. Yasuda and T. Konishi (eds.) Barley 

Genetics V. Proc. Fifth Int. Barley Genet. Symp., Okayama 1986. Sanyo Press 

Co., Okayama. 

287


11. Larsen, J., S. Ullrich, J. Ingversen, A. E. Nielsen, J.S. Gochan, and J. Clanay. 

1987. Breeding and malting behaviour of two different proanthocyanidin-free 

barley gene sources. p. 767-772. In S. Yasuda and T. Konishi (eds.) Barley 

Genetics V. Proc. Fifth Int. Barley Genet. Symp., Okayama. 1986. Sanyo Press 

Co., Okayama. 

12. Meldgaard, M. 1992. Expression of chalcone synthase, dihydroflavonol 

reductase, and flavanone 3-hydroxylase in mutants in barley deficient in 

anthocyanin and proanthocyanidin biosynthesis. Theor. Appl. Genet. 83:695-706. 

13. Ullrich, S., and J. Cochran. 1998. (Personal communications). 

Prepared: 

B. Jende-Strid. 1999. BGN 29:88-89. 

Revised: 

B. Jende-Strid and U. Lundqvist. 2007. BGN 37:286-288. 

288



Locus name: Uniculme 4 

Locus symbol: cul4 

BGS 617, Uniculme 4, cul4 


Uniculme-5 = uc-5 (3). 

Inheritance: 


Located in chromosome 3HL (5), near AFLP marker E4143-4 in subgroup 32 of 

the Proctor/Nudinka map (5). 

Description: 

Plants produce 1 to 4 tillers that are twisted and have slightly bowed culm 

internodes. All secondary tillers are shorter than the primary tiller and have a 

curly appearance. Often secondary tillers are trapped at the base of the primary 

tiller (2, 4). Compared to normal sibs, cul4 plants have peduncles that are slightly 

to 50% longer. Rachis internodes are slightly elongated, and kernels are slightly 

longer. Plant height varies from 2/3 normal to slightly taller than Bowman. The 

mutant cul4.15 exhibits the most variation in height over environments (2). Under 

greenhouse conditions, Bowman line for cul4.5 developed only two axillary tillers, 

and it was uniculm when combined with the cul2.b (uniculm 2) gene (1). 


An ethylene oxide induced mutant in Bonus (PI 189763) (4). 


cul4.3 in Bonus (GSHO 2495, NGB 115062), cul4.5 in Bonus (NGB 115063), 

cul4.15 (NGB 115064) in Foma (CIho 11333), cul4.16 in Bonus (NGB 115065) 

(4). 


cul4.5 in Bonus (GSHO 2493, NGB 115063); cul4.5 in Bowman (PI 483237)*7 

(GSHO 2361). 

References: 


characterization of the barley uniculm2 (cul2) mutant. Theor. Appl. Genet. 

106:846–857. 




62:409-414. 





Prepared: 


Revised: 


289



Locus name: Eligulum-a 

Locus symbol: eli-a 

BGS623, Eligulum-a, eli-a 


Eligulum-a = lig-a (2). 

Eligulum-3 = eli-3 (4). 

Inheritance: 



Description: 

Plants do not have ligules in the junction between the sheath and leaf blade, 

auricles are rudimentary and asymetrically displaced. Plants are about 2/3 of 

normal height and have very wide leaves (3, 4). The peduncle is short and spike 

emergence from the sheath of the flag leaf is poor. Spikes have a compact 

arrangement of spikelets and are extremely compacted near the tip (1, 3). The 

culm breaks very easily just below the nodes. The Bowman backcross-derived 

lines have glume awns that are nearly twice as long as those of Bowman, but the 

lemma awns are about 2/3 of normal (1). 


An ethylene imine induced mutant in Foma (CIho 11333) (2, 3). 


eli-a.2 (NGB 115389), eli-a.3 (NGB 115390), -a.7 (NGB 115392), -a.9 (NGB 

115393), -a.10 (NGB 115394) in Foma (3); eli-a.11 (NGB 115395), -a.14 (NGB 

115397) in Kristina (NGB 1500); eli-a.15 (NGB 115398), -a.16 (NGB 151399) in 

Bonus (PI 189763 (4), -a.216 (FN216) in Steptoe (CIho 15229) (1, 3). 


eli-a.3 in Foma (NGB 115390); eli-a.3 in Bowman (PI 483237)*3. 

References: 




62:409-414. 

3. Kleinhofs, A. (Unpublished). 


Prepared: 


Revised: 

J.D. Franckowiak and A. Kleinhofs. 2005. BGN 35:192. 

Revised: 


290



Locus name: Many noded dwarf 6 

Locus symbol: mnd6 

BGS 633, Many noded dwarf 6, mnd6 


Densinodosum-6 = den-6 (3, 4). 

Inheritance: 


Located in chromosome 5HL [7L] (5), near AFLP marker E3743-3 in subgroup 65 

of the Proctor/Nudinka map (5). 

Description: 

Plants with the mnd6.6 gene are about 2/3 normal height and have many 

elongated internodes in each culm (1, 4). The number of elongated internodes 

can be up to 20 in the original stock when grown in Sweden. Kernels are thin and 

small (4). The number of tillers per plant is increased compared to normal sibs. 

Peduncles are very short, about 1/3 normal length, and awns are about 1/2 

normal length. Spikes are shorter with slightly over half the kernel number of 

Bowman. The Bowman backcross-derived line has 9 to 10 elongated internodes 

per tiller. Kernels of the Bowman mnd6 line are thinner and about 2/3 of normal 

weight (2). The grain yields of the mnd6 line are about 3/4 normal (2). 


An ethylene imine induced mutant in Bonus (PI 189763) (4). 


mnd6.6 in Bonus (NGB 114514) (4); mnd6.8 in Bonus (NGB 114516) (4, 5). 


mnd6.6 in Bonus (GSHO 1713), mnd6.6 in Bowman (PI 483237)*7 (GSHO 

2235). 

References: 

1. Bossinger, G., U. Lundqvist, W. Rohde, and F. Salamini. 1992. Genetics of 

plant developm ent in barley. p. 989-1017. In L. Munck, K. Kirkegaard, and B. 

Jensen (eds.). Barley Genetics VI. Proc. Sixth Int. Barley Genet. Symp., 

Helsingborg, 1991. Munksgaard Int. Publ., Copenhagen. 




62:409-414. 





Prepared: 

U. Lundqvist and J. D. Franckowiak. 2002. BGN 32:134. 

Revised: 

U. Lundqvist and J. D. Franckowiak. 2007. BGN 37:291. 

291



Locus name: Tip sterile 2 

Locus symbol: tst2 

BGS 636, Tip sterile 2, tst2 


None. 

Inheritance: 



Description: 

Spikes of tst2.b plants are 1/4 to 1/2 of normal length because seed set fails in 

the upper portion of the spike. Slow or poor development of the spike reduces 

both the number of rachis internodes and number of fertile spikelets (1, 4). Most 

spikes of the Bowman backcross-derived line set less than 10 seeds. Plants are 

shorter than are normal sibs because peduncles fail to elongate normally. Both 

rachis internode length and awn length are reduced in tst2 plants (1). 


An X-ray induced mutant in Donaria (PI 161974) (3, 4). 


tst2.b in Donaria (Mut. 2249, DWS1337) (2, 3). 


tst2.b in Donaria (GSHO 1781); tst2.b in Bowman (PI 483237)*5 (GSHO 2280). 

References: 




3. Scholz, F. 1956. Mutationsversuche an Kulturpflanzen. V. Die Vererbung 

zweier sich variabel manifestierender Übergangsmerkmale von bespelzter zu 

nackter Gerste bei röntgeninduzierten Mutanten. Kulturpflanze 4:228-246. 

4. Scholz, F., and O. Lehmann. 1958. Die Gaterslebener Mutanten der 

Saatgerste in Beziehung zur Formenmannigfaltigkeit der Art Hordeum vulgare 

L.s.l.I. Kulturpflanze 6:123-166. 

Prepared: 


Revised: 

J.D. Franckowiak. 2005. BGN 35:193. (Locus symbol was changed from lin2.) 


292







Brachytic-l = brh.l (3). 

Inheritance: 


Located in chromosome 2HS (1), approximately 12.9 cM distal from SSR marker 

Bmac0850 in bin 2H-08 (1). 

Description: 

Plants are about 3/4 normal height and peduncles are over 3/4 normal length. 

Awns are about 3/4 of normal length. Rachis internodes are slightly shorter than 

those of normal sibs, but the number of fertile rachis nodes is increased by over 

2. Seedling leaves of brh10 plants are relatively short. Kernels of the Bowman 

brh10 line are shorter (7.3 vs. 9.6 mm) and about 20% lighter than those of 

Bowman. Plants have and erect growth habit and grain yields averaged 20% less 

than those of Bowman (1, 2). 



(5). 


brh10.l in Birgitta (17:15:2, DWS1007) (4, 5). 


brh10.l in Birgitta (GSHO 1677); brh10.l in Bowman (PI 483237)*7 (GSHO 2171). 

References: 



96:654-662. 







Prepared: 


293







Brachytic-n = brh.n (3). 

Inheritance: 


Located in chromosome 5HS [7S] (1), about 6.7 cM proximal from SSR marker 

Bmac0113 in bin 5H-04 (1). 

Description: 

Plants are 2/3 to 3/4 normal height and peduncles are 3/4 to 5/6 normal length. 

The length of the rachis internodes is about 3/4 as long as those of normal sibs. 

Seedling leaves of brh11 plants are relatively short. Kernels of the Bowman 

brh11 line are shorter (7.2 vs. 9.6 mm) and about 25% lighter than those of 

Bowman. Plants have an erect growth habit and grain yields of the brh11 line 

averaged less than 1/2 of those for Bowman (1, 2). 



(5). 


brh11.n in Birgitta (17:19:2, DWS1011) (4, 5). 


brh11.n in Birgitta (GSHO 1679); brh11.n in Bowman (PI 483237)*6 (GSHO 

2172). 

References: 



96:654-662. 







Prepared: 


294







Brachytic-o = brh.o (3). 

Inheritance: 


Located in chromosome 5HS [7S] (1), approximately 13.5 cM distal from SSR 


Description: 

Plants are 2/3 to 3/4 of normal height. Awns and peduncles are about 3/4 normal 

length. The length of the rachis internodes is about 3/4 of normal sibs. Seedling 

leaves of brh12 plants are relatively short. Kernels of the Bowman brh12 line are 

shorter (7.9 vs. 9.6 mm) and about 20% lighter than those of Bowman. Grain 

yields of the brh12 line averaged slightly more than 1/2 of those for Bowman (1, 

2). 



(5). 


brh12.o in Birgitta (17:20:2, DWS1012) (4, 5). 


brh12.o in Birgitta (GSHO 1680); brh12.o in Bowman (PI 483237)*7 (GSHO 

2173). 

References: 



96:654-662. 







Prepared: 


295







Brachytic-p = brh.p (3). 

Inheritance: 


Located in chromosome 5HS [7S] (1), approximately 8.7 cM distal from SSR 


Description: 

Plants are about 2/3 normal height and awns are about 1/2 normal length. 

Peduncles and leaf blades are about 2/3 and 3/4 normal length, respectively. The 

length of the rachis internodes is about 3/4 of that of Bowman. The spikelets at 

the tip of the spike are close together giving a fascinated appearance. Seedling 

leaves of brh13 plants are relatively short. Plants lodge relatively easily. Kernels 

of the Bowman brh13 line are about the same size as those of Bowman, but 

kernel weights are about 20% less. The brh13 plants have and erect growth habit 

and their grain yields are about 1/2 of those Bowman (1, 2). 



(5). 


brh13.p in Birgitta (18:02:4, DWS1013) (4, 5). 


brh13.p in Birgitta (GSHO 1681); brh13.p in Bowman (PI 483237)*6 (GSHO 

2174). 

References: 



96:654-662. 







Prepared: 


296







Brachytic-u = brh.u (3). 

Inheritance: 


Location is unknown (1). 

Description: 

Plants have numerous tillers with small leaves, spikes, and kernels. Prior to 

heading plants appear to be grassy culms similar to those produced by the sld2 

(slender dwarf 2) and sld4 (slender dwarf 4) mutants, but heading is not 

drastically delayed. Culms and peduncles are about 1/2 normal length. Awns and 

rachis internodes are slightly shorter than those of normal sibs. Leaf blades are 

narrow and about 1/2 normal length. Mutant plants headed 2 to 3 days later than 

normal sibs. No lodging was observed. Spikes of brh15 plants had nearly 4 fewer 

kernels than those of Bowman. Kernels of the Bowman brh15 line are slightly 

shorter (8.6 vs. 9.6 mm), thinner (3.4 vs. 3.8 mm), and about 30% lighter than 

those of Bowman. The grain yield of the brh15 line averaged about 2/3 of that 

recorded for Bowman (1, 2). 


A N-methyl-N-nitrosourea induced mutant in Julia (PI 339811) (5, 6). 


brh15.u in Julia (409 JK, DWS1156) (4, 6). 


brh15.u in 409 JK/Bowman (GSHO 1685); brh15.u in Bowman (PI 483237)*5 

(GSHO 2176). 

References: 



96:654-662. 






5. Micke, A. and M. Maluszynski, M. 1984. List of semi-dwarf cereal stocks. In 

Semi-dwarf Cereal Mutants and Their Use in Cross-breeding II. IAEA-TECDOC- 

307. IAEA, Vienna. 

6. Szarejko I., M. Maluszynski, M. Nawrot, and B. Skawinska-Zydron, 1988. 

Semi-dwarf mutants and heterosis in barley. II. Interaction between several 

mutant genes responsible for dwarfism in barley. p. 241-246. In Semi-dwarf 

Cereal Mutants and their Use in Cross-breeding III. IAEA- TECDOC-455, IAEA, 

Vienna. 

Prepared: 


297







Semidwarf mutant = Mo4 (5). 

Brachytic-ab = brh.ab (3). 

Inheritance: 


Located in chromosome 5HS [7L] (1), approximately 11.6 cM proximal from SSR 


Description: 

Plants are about 3/4 normal height and awns are 5/6 of normal length. Peduncles 

are slightly shortened. Rachis internodes are about 20% shorter than those of 

normal sibs. Seedling leaves of brh17 plants are relatively short. Kernels of the 

Bowman brh17 line are shorter (7.7 vs. 9.6 mm) and about 20% lighter than 

those of Bowman. Lodging is reduced in the backcross-derived line and grain 

yields averaged slightly less than those of Bowman (1, 2). 


A sodium azide induced mutant in Morex (CIho 15773) (6). 


brh17.ab in Morex (Wa14355-83, Mo4, DWS1260) (4, 5). 


brh17.ab in Morex (GSHO 1669); brh17.ab in Bowman (PI 483237)*6 (GSHO 

2181). 

References: 



96:654-662. 






5. Nedel, J.L., S.E. Ullrich, J.A. Clancy, and W.L. Pan. 1993. Barley semidwarf 

and standard isotype yield and malting quality response to nitrogen. Crop Sci. 

33:258-263. 

6. Ullrich, S.E., and Aydin, A. 1988. Mutation breeding for semi-dwarfism in 

barley. p. 135-144. In Semi-dwarf Cereal Mutants and Their Use in Crossbreeding 

III. IAEA-TECDOC-455. IAEA, Vienna. 

Prepared: 


298







Brachytic-ac = brh.ac (3). 

Inheritance: 


Located in chromosome 5HS [7L] (1), approximately 9.2 cM distal from SSR 

marker Bmac0163 in bin 5H-01(1). 

Description: 

Plants are about 2/3 normal height and awns are less than 2/3 of normal length. 

Peduncles are slightly coiled and about 5/6 the length of those of normal sibs. 

Rachis internodes are about 20% shorter than those of Bowman. Seedling 

leaves of brh18 plants are relatively short. Kernels of brh18 plants are similar in 

weight to those of Bowman, but slightly shorter. Lodging is reduced, but grain 

yields averaged slight more than 1/2 of those for Bowman (1, 2). 


An induced mutant backcrossed into Triumph (CIho 11612, GSHO 2465) (5). 


brh18.ac in mo6/4*Triumph (402B, DWS1277) (4, 5). 


brh18.ac in Mo6/4*Triumph (GSHO 1670); brh18.ac in Bowman (PI 483237)*6 

(GSHO 2182). 

References: 



96:654-662. 






5. Falk, D. 1985. (Personal communications). 

Prepared: 


299


BGS 660, Narrow leafed dwarf 2, nld2 


Locus name: Narrow leafed dwarf 2 

Locus symbol: nld2 


None. 

Inheritance: 



Description: 

Mutant plants have narrow, dark green leaves, which are erect with welldeveloped 

midribs. Auricles degenerate to tiny projections, but ligules are 

normal. Stem internodes are short, and the upper ones are curved. Spikelets are 

relatively narrow and small, and seed set may be low. Kernels of the Bowman 

nld2 line are thinner (3.2 vs. 3.8 mm) and about 35% lighter than those of 

Bowman (1). Plants are 1/2 to 1/3 of normal height, the spike commonly emerges 

from the side of the sheath before anthesis. Awns of the nld2.b line are similar in 

length to those of Bowman. The nld2.b Bowman line is more vigorous than nld1.a 

in Christchurch, New Zealand and in North Dakota greenhouse nurseries, but 

nld1.a was more vigor in the Dundee, Scotland nursery. Seed yields are 

generally less than 20% of those of Bowman (1). 


A fast neutron induced mutant in Steptoe (CIho 15229) (2). 


nld2.b in Steptoe (2). 


nld2.b in Steptoe; nld2.b in Bowman (PI 483237)*6. 

References: 


2. Kleinhofs, A. (Unpublished). 

Prepared: 

J.D. Franckowiak and A. Kleinhofs. 2007. BGN 37:300. 

300



Locus name: Double seed 1 

Locus symbol: dub1 

BGS 661, Double seed 1, dub1 


None. 

Inheritance: 


Located in chromosome 5HL [7L] (2), near AFLP marker E4038-4 in subgroups 

66 to 67 of the Proctor/Nudinka map (2). 

Description: 

The modification of the top of spike is distinctive and occurs on all tillers. The tip 

of the spike is compacted and a few spikelets form two and three fertile florets 

adjacent to each other. The double spikelets have fused lemmas and paleas 

often enclose the part of two, occasionally more, flowers: six anthers and two 

ovaries (1). The tip of the spike appears phenotypically similar to those of int-m 

(intermedium spike-m) mutants (1). 


An X-ray and ferrisulfate induced mutant in Bonus (PI 189763) (1). 


dub1.1 (NGB 114331), dub1.2 (NGB 114332) in Bonus (1); dub1.3 (NGB 

114333), dub1.7 (NGB 114337), dub1.8 (NGB 114338), dub1.9 (NGB 114339), 

dub1.10 (NGB114340), dub1.11 (NGB 114341), dub1.12 (NGB 114342) in Foma 

(CIho 11333) (1); dub1.18a (NGB 114345), dub1.18b (NGB 114346, 114347) in 

Kristina (NGB 1500) (1); dub1.19 (NGB 114348), dub1.20 (NGB 114349, 

114350) in Bonus (1). 


dub1.1 (NGB 114331) in Bonus (2). 

References: 





Prepared: 


301

BARLEY GENETICS NEWSLETTER - GrainGenes - US Department ...

Create successful ePaper yourself

Delete template?

Save as template?