Scientific Papers Series B Horticulture

SCIENTIFIC PAPERSSERIES B. HORTICULTUREVolume LVII, 2013

University of Agronomic Sciencesand Veterinary Medicine of BucharestFaculty of HorticultureSCIENTIFIC PAPERSSERIES B. HORTICULTUREVolume LVII2013BucharesT

SCIENTIFIC COMMITTEE Bekir Erol AK - University of Harran, Sanliurfa, Turkey Arina ANTOCE - University of Agronomic Sciences and Veterinary Medicine Bucharest, Romania Adrian ASNIC - University of Agronomic Sciences and Veterinary Medicine Bucharest, Romania Adrian BACIU - University of Craiova, Romania Liliana BDULESCU - University of Agronomic Sciences and Veterinary Medicine Bucharest, Romania Lance BUTTERS - University of Central Lancashire, Myerscough College, United Kingdom Mihail COMAN - Research Institute for Fruit Growing Pitesti - Maracineni Elena DELIAN - University of Agronomic Sciences and Veterinary Medicine Bucharest, Romania Alin DOBREI - Banat University of Agricultural Sciences and Veterinary Medicine Timisoara, Romania Elisabeta DOBRESCU - University of Agronomic Sciences and Veterinary Medicine Bucharest, Romania Károly HROTKÓ - Corvinus University of Budapest, Hungary Lucia DRAGHIA - University of Agronomic Sciences and Veterinary Medicine Iasi, Romania Monica DUMITRACU - University of Agronomic Sciences and Veterinary Medicine Bucharest, Romania Gheorghe GLMAN - President of the Romanian Horticultural Society, Romania Gic GRDINARIU - University of Agronomic Sciences and Veterinary Medicine Bucharest, Romania Dorel HOZA - University of Agronomic Sciences and Veterinary Medicine Bucharest, Romania Marian ION - Research and Development Institute for Viticulture and Enology Valea Calugareasca Karsten KLOPP - Obstbauversuchsanstalt Jork, Germany Viorel MITRE - University of Agronomic Sciences and Veterinary Medicine Cluj-Napoca, Romania Ion MITREA - University of Craiova, Romania Adrian PETICIL - University of Agronomic Sciences and Veterinary Medicine Bucharest, Romania Silviero SANSAVINI - University of Bologna, Italy Radu SESTRA - University of Agronomic Sciences and Veterinary Medicine Cluj-Napoca, Romania Florin STNIC - University of Agronomic Sciences and Veterinary Medicine Bucharest, Romania Dorin SUMEDREA - Research Institute for Fruit Growing Pitesti - Maracineni Nicolae TEFAN - President of Horticulture Section - Academy of Agricultural and Forestry Sciences”Gheorghe Ionescu-ieti”, Romania Florin TOMA - University of Agronomic Sciences and Veterinary Medicine Bucharest, RomaniaEDITORIAL BOARDGeneral Editor: Dorel HOZAExecutive Editor: Adrian ASANICMembers: Bekir Erol AK, Valentina BOZHKOVA, Luca CORELLI GRAPPADELLI,Elena DELIAN, Elisabeta DOBRESCU, Monica DUMITRACU, Károly HROTKÓ,Karsten KLOPP, Adrian PETICIL, Florin TOMAPUBLISHERS:University of Agronomic Sciences and Veterinary Medicine of Bucharest - Faculty of HorticultureAddress: 59 Marasti, District 1, 011464 Bucharest, RomaniaPhone: + 40 213 183 636, Fax: +40 213 183 636, Webpage: www.horticultura-bucuresti.roCERES Publishing HouseAddress: 1 Piaa Presei Libere, District l, Zip code 013701, Bucharest, RomaniaPhone: + 40 21 317 90 23, E-mail: edituraceres@yahoo.com, Webpage: www.editura-ceres.roCopyright 2013To be cited: Scientific Papers. Series B. Horticulture, Vol. LVII, 2013The publishers are not responsible for the content of the scientific papers and opinions published in the Volume.They represent the authors’ point of view.ISSN 2285-5653, ISSN-L 2285-5653International Database Indexing: COPERNICUS, CABI (www.cabi.org) and CNCSIS B+.

SUMMARYSUSTAINABLE PRODUCTSAND TECHNOLOGIES IN HORTICULTUREBehaviour of Delta Cultivar Nectarines During the Valorization ProcessAccording to the Fertilization of the Culture - Constana ALEXE, MarianVINTIL, Simona POPESCU, Liana–Melania DUMITRU, GheorgheLMURANU, Lenua CHIRA .................................................................................. 13Research Regarding the Possibilities of Starting and Controlling of MLF inRed Wines from Cernavoda Viti-Vinicol Centre Situated in MurfatlarVineyard - Georgeta BELENIUC, Constantin Baduca CÂMPEANU, ClaudiaTEFAN, Jose PARDO .............................................................................................. 19Influence of Biological Products Used in Foliar Fertilization on the Numberand Quantity of Fruit Reported to the Plant and Area of Culture - GheorgheCÂMPEANU, Florin Constantin IACOB, Nicolae ATANASIU, Elena CATAN,Gabriela NEA ........................................................................................................ 23Organic Weed Control Measures Applied in Organic Tomatoes Culture -Elena CATAN, Gheorghe CÂMPEANU, Nicolae ATANASIU, GabrielaNEA, Vasilica MANEA, Constantin-Florin IACOB ………………………….... 27Researches on the Influence of Some Biological Stimulators to the SeedProduction of French Bean - Ana-Emilia CENU, Victor POPESCU ................ 33Researches Concerning the Resistance Frost of the Table Grape VarietiesGrown in Stefanesti-Arges Vineyard - Adriana COSTESCU, Liviu DEJEU,Camelia POPA ............................................................................................................ 37The Influence of Technological Factors on the Production and Quality of thePepper - Simona Elena DIMACHE (BOBOC), Nicolae ATANASIU, GheorgheCÂMPEANU, Gabriela NEA, Claudiu BOBOC .................................................. 41Research Concerning Effects of Perlite Substrate on Tomato in SoillessCulture - Elena Maria DRGHICI, Maria PELE, Elena DOBRIN .......................... 45Influence of the Pest Control Methods Over the Useful Entomofauna Withinthe Viticultural Ecosystem - Ion ENOIU, Lidia FÎCIU, Sonia DROSU ................ 49Effects of the Different Grape Rootstocks on Berry Skin B, Cu, Fe, Mn andZn Contents of ’Cserszegi Fszeres’ Cultivar - István FEKETE 1 , BélaKOVÁCS 1 , Dávid ANDRÁSI 1 , Éva BÓDI 1 , Nándor RAKONCZÁS ....................... 55The Influence of Development Level of Vines on the Biometric Indices ofCardinal Variety - Mariana GODOROJA, Cornelia LUNGU, GheorgheNICOLAESCU, Valeria PROCOPENCO ................................................................. 61Research Regarding the Influence of the Hybrid and the Number of Stems onthe Field Production of Tomato Plants – Gheorghita HOZA ................................. 65Type of Trellising and Foliar Fertilization Influence on Yield and Quality ForNew Varieties of Gherkins (Cucumis Sativus L.) With Parthenocarpic Fruiting- Florin Constantin IACOB, Gheorghe CÂMPEANU, Nicolae ATANASIU, ElenaCATAN, Gabriela NEA ………………………………………………………. 69Effect of Foliar Fertilization on the Chemical Composition of Five GherkinsFruit Hybrids (Cucumis Sativus L.) Gynoecious Type and Parthenocarpic 735

Fructification - Florin Constantin IACOB, Gheorghe CÂMPEANU, NicolaeATANASIU, Elena CATAN, Gabriela NEA .....................................................Effect of Foliar Fertilizer on Growth and Yield of Seven Potato Cultivars(Solanum Tuberosom L.) - Ali Husain JASIM ......................................................... 77Peach Crop Protection in Sustainable Agriculture Conditions in Small andMedium Farms - Vasile JINGA, Carmen LUPU, Roxana DUDOIU, AndreeaPETCU, Gigel-Gabriel LUPU .................................................................................... 81The Viticulture and Winemaking of Republic of Moldova - Past, Present andFuture - Gheorghe NICOLAESCU, Valeriu CEBOTARI, Ana NICOLAESCU,Dumitru BRATCO, Mariana GODOROJA, Cornelia LUNGU, ValeriaPROCOPENCO ......................................................................................................... 87The Influence of Fertilization Levels and Drip Irrigation Norms on the AppleHarvest in South-Eastern Romanian Conditions - Nicoleta OLTENACU,Catlin Viorel OLTENACU ...................................................................................... 93The Influence of the Drip Irrigation on the Physical and Chemical AppleCharacteristics - Nicoleta OLTENACU, Ctlin Viorel OLTENACU .................. 99Research on Factors Affecting Raspberry Plant Growth - Parascovia SAVA .... 105Phenology Research on Blackberry Development in Republic of Moldova -Parascovia SAVA, Cristina CATERENCIUC ........................................................... 109Comparative Study Regarding the Influence of Biostimulators on theQualitative and Quantitative Potential of Cabernet Sauvignon - MarinelaSTROE, Codrin BUDESCU ....................................................................................... 115Technical Aspects Concerning the Quality Preservation in Fresh andDehydration of Apricots - Marian VINTIL .......................................................... 121Kinematics and Operation Process of the Complex Aggregate Used to Preparethe Germinative Bed in Vegetable Farming - Constantin VLAD, GheorgheBRTUCU ................................................................................................................. 127Results Concerning the Effect of Foliar Fertilizers and Growth PromotersTreatments on Production and Quality of Tomato Fruits - Jeni Gianina VOICU(SIMION) ........................................................................................................................ 131Results Concerning the Effect of Foliar Fertilizers and Growth PromotersTreatments on Production and Quality of Lettuce Cultivated in PlasticTunnels - Jeni Gianina VOICU (SIMION) ………………………………………… 137A Preliminary Survey of the Occurrence of Apple Proliferation in the Northof Romania - Luminia Antonela ZAGRAI, Ioan ZAGRAI .................................... 143HORTICULTURAL BIODIVERSITY AND GENETIC RESOURCESSome Fruit Characteristics of Medlar (Mespilus Germanica L.) GenotypesGrown in Ordu, Turkey - Ahmet AYGÜN, Ali Riza TASÇI .............................. 149The Chorology of Artemisia Alba Turra, A. Lerchiana Weber and A.Tschernieviana Besser (Asteraceae) in Romania - Monica BADEA, IoanaPDURE, Sorin TEFNU, Aurelia DOBRESCU, Liliana BDULESCU ........ 153New Host Plant For Virus Vector Nematode XIPHINEMAITALIAE MEYL,1953 (NEMATODA: LONGIDORIDAE) IN ROMANIA - Mariana BONTA(GROZA), Ioan ROCA, Claudia COSTACHE ...................................................... 1596

PLANT PRODUCTION SYSTEMSThe Effect of Container Type and Soil Substrates on Growth andEstablishment of Selected Landscape Trees - Hani AL-ZALZALEH .................. 255The Growth Characteristics of Six Pear Cultivars Under the “Trident”Training System in South-East of Romania - Iuliu CEAN, Florin STNIC ..... 261Researches on the Microsporegeneses and Pollen Tube Development of SomeCherry Varieties in Experimental Conditions - Maria IORDACHE ……………. 267Researches on Pollen Vitality in Some Apricot Hybrids - Maria IORDACHE,Lenuta COROIANU …...........................................................................……….. 273Some Morphological Properties of Direct Sowed Sweet Corn - Ferenc OROSZ 279ORNAMENTAL PLANTS, DESIGNAND LANDSCAPE ARCHITECTURESome Contributions on introduction of the Genus Abies Mill. Species in theRepublic of Moldova - Vasile BUCATEL ………..…………..…………………. 285Researches Concerning the Postharvest Care of Lisianthus Russelianus CutFlowers - Erzsebet BUTA, Maria CANTOR, Mihai BUTA, Denisa HORT,Orsolya VALKAI ....................................................................................................... 289Use of Ornamental Plants on Different Soil Types From Transylvanian Plain -Erzsebet BUTA, Mihai BUTA, Maria CANTOR, Denisa HORT, Anca HUSTI ...... 295‘Candida Ali’ and ‘Excelsa’ - Romanian Gladiolus Cultivars RecentHomologated - Maria CANTOR, Lenua CHI, Erzsebet BUTA, Denisa HORT 299Researches Concerning the Multiplication In Vivo of Lisianthus forPromoting in Romanian Green Houses - Maria CANTOR, Rodica POP, IuditaElisabeta CSETE, Buta ERZSEBET, Anca HUSTI ................................................... 303THE INFLUENCE OF FERTILIZERS APPLIED ON CONTAINERIZEDCulture of Thuja Occidentalis Columna - Georgeta CAREU, Liana MelaniaDUMITRU, Corina GAV .................................................................................... 309Historical Analysis and Study of Current State of Bran Castle Domain,Inorder to Restore the Historic Landscape Esemble – Former RoyalResidence - Elisabeta DOBRESCU, Anca STNESCU .......................................... 315Objective Necessity of Study and Professional Approach to Restoration ofHistorical Landscape Ensambles in Romania - Elisabeta DOBRESCU ............... 321Spontaneous Species with Ornamental Potential: Aster Oleifolius (Lam.)Wagenitz (I) - Morphology, Ecology, Chorology - Mihaela Ioana GEORGESCU,Ioana Marcela PDURE, Florin TOMA, Monica BADEA, Sorina PETRA …...... 327Study of Applying Different Treatments on Cut Alstroemeria and TheirInfluence on the Shelf Life - Szidónia KOSZEGHI, Endre KENTELKY .............. 333Study of Applying Different Treatments on Cut Hydrangea and TheirInfluence on the Shelf Life - Szidónia KOSZEGHI ................................................. 339Planning a Low Cost Landscaping Studio as a Career Start for YoungProfessionals - Alexandru Paul LAZAR-BÂRA ....................................................... 345Political Landscapes and Urban Identity. Bucharest’s Demolitions andWorldwide Correspondences - Alexandru MEXI, Ioana TUDORA ....................... 351Restauration of the Romanian Writer’s Rotunda – Cismigiu Garden -Alexandru MEXI, Maria BRATU, Violeta RDUCAN ........................................... 3638

Phenological Studies on Some Varieties of Roses from the Collection in the"Dimitrie Brandza" Botanical Garden in Bucharest - Eduard Marius NEGULICI 371Wintering Resistance of Ornamental Woody Plants in Containerized Culture- Ion ROCA .............................................................................................................. 377Quality Parameters of Urban Green Spaces - Anca STNESCU ........................ 381Dendrologic Species in Street Plantations with Sound-Insulating Role - AncaSTNESCU, Elisabeta DOBRESCU ......................................................................... 387MISCELLANEOUSThe Influence of Climatic Conditions on the Grape Quality in the WineCenter of Murfatlar in 2012 - Victoria ARTEM, Arina Oana ANTOCE .............. 393Researches Regarding the Influence of Apple Fruit Sorting upon theEconomic Efficiency in the Commercialisation Process - Adrian CHIRA,Lenua CHIRA, Elena STOIAN ................................................................................ 399Studies Regarding the E.U. Strategy in the Field of Agro-Food Product’sQuality - Lenua CHIRA, Adrian CHIRA, Elena DELIAN, Constana ALEXE 403A Practical Approach of Traceability in the Wine Industry - George A.COJOCARU, Arina Oana ANTOCE ......................................................................... 409Sampling Procedures Applicable for the Quality Assurance Systems in theStarch Industry- Georgiana DECIU, Arina Oana ANTOCE .................................. 415A Brief Overview of Ethylene Management to Extend the Shelf Life ofTomatoes - Elena DELIAN, Adrian CHIRA, Liliana BDULESCU, Lenua CHIRA 423Preliminary Study Related Highlighting the Inhibitory Effect of In Vitro FungusGrowth Mycosphaerella Grossulariae (Auers.) Lind. by Saprophytic Fungi -Eugenia PETRESCU, Tatiana-Eugenia ESAN, Florica CONSTANTINESCU,Maria OPREA, Traian MANOLE, Irina IONESCU-MLNCU ......................... 429The Quality Test of the Burnt Vetiver (Vetiveria Zizanioides) WasteUtilization as an Eco-Friendly Material Pot – Meylinda Nur PUSPITA, PristiSUKMASETYA, Selma Siti LUTFIAH……………..………………………….. 437Tuber Yield and Quality of Nine Genotypes Yam Bean (Pachyrhizus Spp.)Due to Sink-Reproductive Pruning - Wieny H. RIZKY, Sofiya HASANI, AgungKARUNIAWAN......................................................................................................... 4459

SUSTAINABLEPRODUCTSAND TECHNOLOGIESIN HORTICULTURE

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653BEHAVIOUR OF DELTA CULTIVAR NECTARINES DURING THE VALORIZATIONPROCESS ACCORDING TO THE FERTILIZATION OF THE CULTUREConstana ALEXE 1 , Marian VINTIL 1 , Simona POPESCU 1 , Liana-Melania DUMITRU 2 ,Gheorghe LMURANU 2 , Lenua CHIRA 31 Research and Development Institute for Processing and Marketing of the Horticultural Products -Bucharest, No. 1A, Intrarea Binelui Street, District 4, 042159, Bucharest, Romania2 Research Station for Fruit Growing Constanta, 1 Pepinierei Street, 907300,Commune Valu lui Traian, Romania3 University of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Marasti Blvd., District 1, 011464, Bucharest, RomaniaAbstractCorresponding author email: constanta_alexe@yahoo.comThe researchers performed at the Research and Development Institute for Processing and Marketing of theHorticultural Product-Bucharest. They had as object the study of some qualitative indicators (firmness, organolepticappreciation, chemical composition, weight and qualitative losses) of Delta cultivar nectarines at harvest as wellas their evolution during the valorisation process. The nectarines – Delta cultivar (an extra-early cultivar, created bythe researchers from Research Station for Fruit Growing Constanta, in collaborate with Rutgers University, NewJersey – S.U.A.), provided from experimental plots of R. S. F. G. Constanta. They were fertilized in different manners,with organic or chemical fertilizers, applied on soil and/or foliar. The nectarines were stored in three variants: at theambient temperature (26-28 0 C), in cold conditions (T = 2-4°C) and cold + modified atmosphere conditions, for 5, 25and 30 days, respectively. It was found that the quality of the nectarines and their storage capacity varies according tothe fertilisation regime and the conditions in the storage environment, especially the temperature and the gaseouscomposition of the air. Among the fertilisation variants, the V4 variant (soil + foliar chemical fertilisation) induces thebest quality and storage capacity. Foliar fertilisers ensure not only an input of macro-and micro elements but also otherorganic substances which stimulate the metabolism of chlorophyll assimilation, the energetic delivery and finally, thefruit quality. Of the three storage methods (ambient temperature, cold room and cold room + modified atmosphere), thebest results were obtained within the third method, which recorded the smallest losses during storage.Key words: firmness, qualitative losses, storage capacity.INTRODUCTIONDue to a new and valuable sort which is adequateto ecological conditions, both the peachtree and the nectarine tree can ensure theconsumption of fresh fruits for more than threemonth (Lamureanu et al., 2012). The studiesshow that the new nectarine cultivars obtain inthe south-eastern of Romania have a goodquality of the fruits, high and constantproductivity of the trees and enriched the actualsortiment as for fresh consumption as forcanneries (jam, nectar, stewed fruit) too(Margineanu et al., 2011).Nectarines are extremely perishable, whichraises serious problems concerning the maintainingof their quality during the valorization13process, from the moment they are harvesteduntil they reach the consumer.The quality of the nectarines at harvest variesaccording to the technology which was appliedto the culture, the climatic conditions, thecultivar and the maturity phase, while theevolution of this quality during storage dependson an ensemble of factors, beginning with theharvesting, the conditioning and the technologicalconditions in the storage environment(Gherghi et al., 1977) and especially on thetemperature and the gaseous composition(Alexe et al., 2012). If the storage of the fruit isdone while respecting adequate conditions(optimum storage temperatures or the specificmodified atmosphere for a species or cultivar)the biochemical processes are inhibited, thus

the increasing the CO 2 content and also ofair relative humidity - storage in modifiedatmosphere - MA.The duration of the storage (days) variedaccording to the technological variant, being of5 days for the warm storage, 25 days for thecold storage and 30 days for the AM storage.Before entering the storage period and at its endthe fruit were analysed in order to establish thefirmness, the organoleptic characteristics and thebiochemical features of the main components(dry soluble substance, soluble carbohydrates,titratable acidity). Moreover, the weight losses(quantitative) and those cause by alteration(qualitative) suffered by the fruit throughoutthe storage period were established.The firmness was determined by means of anOFD mass penetrometer which measures inpenetrometric units (1PU=0.1 mm) the depth thatthe conical needle (length=24 mm, base diameter= 4 mm) reaches within the pulp of the fruit.The measurements were carried out on a numberof 25 fruit/variant, each fruit being penetratedin 4 different points in the equatorial area.The appreciation of the organoleptic qualitywas achieved by means of carrying out asensorial testing of the fruit and the methodwas that of evaluating on a scale from 1 to 100.Tasting sheet were used comprising threeappreciation criteria: aspect, texture, taste. Eachof the three criteria holds a different weightwithin the general scoring, according to theirimportance. Thus, the “aspect” represents 15%,the “texture” 35% and the “taste” 50%.According to the scores there are five differentquality classes as follows:Grades (quality classesPointsVery good 80 – 100Good 60 – 79Acceptable 40 – 59Mediocre 20 – 39Unsuitable 0 – 19The methods for determining the biochemicalcomponents were the following: refractometry,using an ABBE refractometer to determine thesoluble substance, the Bertrand titrimetricmethod for determination of the solublecarbohydrates, the titrimetric method for thedetermination of the titratable acidity.During storage the thermo-hydric factors in thecold room were checked every day in order to15ensure that the optimum conditions for maintainingthe quality were respected. In addition,the capacity of maintaining the fruit’s qualitywas evaluated, including the apparition anddevelopment of certain storage diseases.RESULTS AND DISCUSSIONS1. FirmnessThe results presented in Table 1 reveal the factthat at harvest the firmness of the nectarinesranges from 68.79 PU at the V4 fertilisingvariant (chemical fertilisers applied on soil +foliar) to 93.57 PU at the V3 variant (chemicalfertilisers applied on the soil), the average percultivar being of 83.56 PU. Table 1. The firmness of the nectarines of the Deltacultivar upon harvesting and after storageMoment ofVariant Average/evaluation V1 V2 V3 V4 cultivarAt harvest 91.28 80.59 93.57 68.79 83.56After warm153.40150.11175.62144.11 155.81storageAfter cold storage 110.91129.35126.35127.95 123.64After AM storage 99.35 119.78123.66125.53 117.08During warm storage for 5 days the firmnessrapidly declines due to the alteration of thepectin substances and the cellular membranes,reaching values ranging from 144.11 PU at theV4 variant to 176.62 PU at the V3 variant, theaverage per cultivar being of 155.81 PU.Cold storage slowed down the structural andcellular alteration of nectarines, after 25 daysthe average firmness being of 155.81 PU,meaning 110.91 PU at the V1 variant, 126.35PU at the V3 variant, 127.95 PU at the V4variant and 129.35 PU at the V2 variant.The enriching of the atmosphere in carbondioxide allowed for the nectarines to be storedfor 30 days while maintaining the firmness atan average level of 117.08 PU, varyingbetween 99.35 PU at the V1 variant and 125.53PU at the V4 variant.2. The organoleptic qualityAt harvest, following the organoleptic test, thenectarines obtained a high score (89.95) due totheir lovely aspect, their high degree offirmness and their pleasant and balanced taste,thus entering the “very good” fruit quality class(Table 2).

Table 2. The organoleptic appreciation of the nectarinesof the Delta cultivarOrganolepticappreciationscore+ gradeAtharvestMoment of evaluationAfter Afterwarm coldstorage storageAfter AMstorageTotal 89.95 83.75 70.07 56.16Aspect 13.80 13.20 12.50 11.25Firmness 34.65 29.05 26.80 27.41Taste 41.50 41.50 30.77 27.50QualifyingVerygoodVerygoodGood AcceptableAfter 5 days of warm storage the parameters ofthe organoleptic properties of the nectarinesremained fairly reasonable, the score being of83.75 points and the grade “very good”. After25 days of cold storage, the nectarines, thoughmaintaining their pleasant aspect, lose theirfirmness and especially their taste, whichexplains why the total score relatively drops to70.07 and the adequate grade is now “good”.During AM storage the nectarines of the Deltacultivar lost their aspect, their firmness andespecially their taste, the latter becoming blandand floury. Because of the very low score(56.16 points), the fruit received the grade“acceptable”. In some cases the nectarinesstored in AM conditions displayed physiologicaldisorders, manifested through shiny, greyspots or the cracking of the skin (a rather scarcephenomenon present at nectarines stored incold conditions as well). This demonstrates thefact that the period in which the fruit had thecapacity to maintain their quality wassurpassed, which means that the duration of thestorage in the atmosphere enriched in carbondioxide was too long.3. Biochemical compositionThe data presented in Table 3 show that thefertilising variant with organic fertilisers (V2)as well as the variant with chemical fertilisersapplied on the soil + foliar (V4) have the largestinput when it comes to enriching the fruitin dry soluble substance (11.10% and 11.24%,respectively) and soluble carbohydrates (8.57%and 8.32%, respectively). From this point ofviews, the V1 variant-witness occupies the lastposition, having, however, the highest contentof malic acid (0.93%).During storage the biochemical content of thenectarines modifies but at a different intensityaccording to the conditions in the storage place.The high temperature during storage favoursthe undergoing of biochemical processes withinthe fruit at a greater intensity, so that after 5days of warm storage the content of dry solublesubstance greatly increases (V1=12.39%,V2=12.73%, V3=11.53%, V4=12.19%,average=12.21%), while the soluble carbohydrates(V1=5.70%, V2=6.56%, V3=7.09),V4=6.81%, average =6.54%) and the malicacid (0.79%, 0.63%, 0.66% and 0.64%,respectively) decrease considerably incomparison to the other storage methods.The lower temperature during cold storageleads to the slowing down of the rhythm ofthese biochemical processes, so that the drysoluble substance increases up to 11.50%within 25 days, while the content of solublecarbohydrates and titratable acidity decreases,reaching 7.76% and 0.71%, respectively –average value/cultivar.Table 3. The main chemical components of the nectarines of the Delta cultivarVariant Biochemical indicatorV1 V2 V3 V4 Average/cultivarAt harvest:-soluble dry substance ( 0 R) 9.77 11.10 10.74 11.24 10.71 -soluble carbohydrates-% 6.95 8.57 8.16 8.32 8.00 -acidity (malic acid/100g) 0.93 0.68 0.71 0.68 0.75Warm:-soluble dry substance ( 0 R) 12.39 12.73 11.53 12.19 12.21 -soluble carbohydrates-% 5.70 6.56 7.09 6.81 6.54 -acidity (malic acid /100g) 0.79 0.63 0.66 0.64 0.68Cold:-soluble dry substance ( 0 R) 11.72 11.49 11.38 11.42 11.50 -soluble carbohydrates-% 6.67 8.25 8.01 8.11 7.76 -acidity (malic acid /100g) 0.88 0.66 0.69 0.62 0.71AM:-soluble dry substance ( 0 R) 11.08 11.25 11.07 10.99 11.09 -soluble carbohydrates-% 6.51 8.08 7.96 7.81 7.59 -acidity (malic acid /100g) 0.87 0.67 0.67 0.62 0.7116

The effect of the low temperature, that of slowingdown the metabolism, adds up to that ofthe carbon dioxide, which has a larger concentrationin the case of storage in a modified atmosphere.During this type of storage the contentof dry soluble substance does not increasevery much as compared to the initial moment(11.09%) and, at the same time, the content ofsoluble carbohydrates and titratable acidityinsignificantly drops (7.59% and 0.71%,respectively).4. Quantitative and qualitative lossesThe losses recorded during warm storage(ambient temperature) for 5 days are presentedin Table 4.Table 4. Losses recorded during warm storage of thenectarinesLosses-%Varianttotal weight depreciationV1 45.71 14.97 30.74V2 36.89 13,32 23.57V3 43.13 13.63 29.50V4 31.79 14.36 17,43Average per cultivar 39.38 14.07 25.31It was noticed that the total losses are significantin all 4 variants of fertilisation and theyare caused by weight losses and especially bydepreciation. The following total losses wererecorded: 45.71% at the V1 variant, 36.89% atthe V2 variant, 43.13% at the V3 variant and31.79% at the V4 variant. The average values ofthese indicators per cultivar are: 39.38% totallosses, 14.07% weight losses and 25.31% alterationlosses. The V4 variant recorded the smallestamount of losses, followed by the V2 variant.The causes which determine the high percentagesof losses by alteration are the late infectionscaused by the Monilinia laxa and the M.fructigena fungi, which occur before harvestingand the attacks of the Rhizopus stolonifer andBotrytis cinerea, which occur during harvestingand manipulation.By using the cold storage method (Table 5) thedeveloping of these fungi and moulds is sloweddown, so that the total losses were greatlyreduced at all fertilisation variants. The valueswere the following: 34.28% at the V1 variant,10.17% at the V2 variant, 22.06% at the V3variant and 5.67% at the V4 variant, the averageper cultivar being of 18.04% total losses.17Table 5. Losses recorded during cold storage of thenectarinesLosses-%Varianttotal weight depreciationV1 34.28 1.50 32.78V2 10.17 1.30 8.87V3 22.06 1.43 20.63V4 5.67 1.33 4.34Average per cultivar 18.04 1.39 16.65It is obvious that, similar to warm storage, theV4 variant records the smallest losses (5.67%),followed by the V2 variant (10.17%).Using the AM storage method led to a greatdecrease in both the weight and the depreciationlosses, the values of the total losses percultivar being of 6.46%, meaning 12.17% at theV1 variant, 6.47% at the V2 variant, 6.99% atthe V3 variant and only 0.23% at the V4variant.Table 6. Losses recorded during AM storage of thenectarinesLosses-%Varianttotal weight depreciationV1 12.17 0.31 11.86V2 6.47 0.33 6.14V3 6.99 0.31 6.68V4 0.23 0.23 -Average per cultivar 6.46 0.29 6.17There were no depreciation losses at the V4variant and the weight losses were very small(0.23%) in comparison to the other storagevariants.CONCLUSIONSThe different fertilization of the trees isreflected in the degree of firmness of the fruit atharvest, but not in their evolution duringstorage. The greatest firmness at harvest isrecorded by the fruits which were chemicallyfertilized at soil + foliar (68.79 PU). Theevolution of the firmness during storage isespecially influenced by the storage conditions.Through warm storage the nectarines easilylose their firmness because of their rapidripening. In the case of cold storage theintensity of the ripening process is decreased sothat the fruit maintain their structural andtextural firmness for a longer period of time (25days). By enriching the atmosphere within thestorage space in carbon dioxide the metabolic

processes become even slower and the firmnessof the fruit is maintained for a longer period oftime (30 days).The organoleptic quality of the Delta cultivarnectarines is better appreciated (89.95 points)at harvest, the fruit having a yellow, juicy pulp,with a balanced, sour-sweet taste. Duringstorage the quality decreases faster than it doesat other studied cultivars (Cora), so that it isindicated that the valorization process becarried out faster because the storage capacityof this cultivar is lower.The fertilization of the nectarine tree culturewith the Murtonik foliar fertilizer (20:20:20 +microelements: Mn, Fe, Cu, Zn, B-chelation)resulted in the enriching of the fruit in drysoluble substance (11.24%) and solublecarbohydrates (8.32%). Moreover, the usage oforganic fertilisers led to the obtaining ofnectarines with a high content of thesebiochemical compounds (11.10% and 8.57%,respectively). During storage the content of drysoluble substance increased, while that ofsoluble carbohydrates and malic aciddecreased, the intensity varying according tothe temperature and the gaseous composition ofthe air in the storage place. The AM storagerecorded the best results regarding the slowingdown of the rhythm of the metabolic processes.The quantitative and qualitative losses recordedduring the storage of the nectarines are greatlyinfluenced by the fertilising regime applied tothe culture. In the case of supplementing thechemical fertilization of the soil with theMurtonik foliar fertiliser the weight losses andespecially those caused by attacks fromdiseases were substantially smaller ascompared to those recorded in the case of thecontrol. From this point of view, good resultswere also obtained in the case of fertilising theculture with organic fertilizers, which containminerals which enhance the quality of the fruitand their resistance to diseases during storage.The maintaining of the nectarines’ qualityduring valorization is also influenced by theenvironmental conditions ensured during thisprocess and especially by the temperature. Buusing the cold method the metabolic processesand the developing of fungi and moulds aregreatly slowed down, so that the losses weresignificantly reduced at all variants of fertilization.The average reduction per cultivar was of54.19% in the case of total losses, 90.12% inthe case of quantitative losses and 34.21% inthe case of depreciation losses. Using the AMstorage method led to an important decrease inboth weight losses (97.93%) as well as indepreciation losses (75.62%).REFERENCESAlexe Constanta, M. Vintila, Veronica Tanasa, Liana-Melania Dumitru, Gh. Lamureanu, 2010. Influence offertilization system on the quality maintaining ofpeach fruits in different storage conditions. Scientificpapers, UASVM Iasi – Horticulture Series, Vol.53, p.305-311.Alexe Constanta, M. Vintila, Simona Popescu, Liana –Melania Dumitru, Gh. Lamuranu, Lenuta Chira,2012. Researches on the influence of technologicalproduction and valorization factors on thecommercial quality of Cardinal peaches cultivar.Scientific papers. Series B. Horticulture. UASVMBucharst, Vol. LVI, p. 13-19.Braniste N., S. Budan S., Butac Madalina, MilitaruMadalina, 2007. Tree, fruit growing shrubs andstrawberries cultivars created in Romania. Ed.Paralela 45, Pitesti p. 310.Dumitru Liana-Melania, Gavat Corina, Lamureanu Gh.,2011.New Romanian nectarine and brugnone cultivars.Scientific papers. Series B. Horticulture.UASVM Bucharest, Vol. LV, p. 374-375.Gherghi A., Millim K., Tasca Gh., 1977. Metods formaintain quality and reduce losses during storage offruits and vegetables. Scientific papers ICVLF, volVIII, Bucuresti, p. 27-31.Ion V., 2004. Biological agriculture. Alma MaterPublishing House, Bucuresti, p. 76-89Ionita G., 2012. Bolile fiziologice se previn cu ingrasamintefoliare. Gradina, via si livada. Horti, nr 3, p. 35.Jamba A., Carabulea B., 2002. Technology of preservationand industrialization horticultural products,Cartea Moldovei, Publishing House, Chisinau, p.308-317.Lamurenu Gh., Caplan I., Moale Cristina, Oprita V.A.,Alexe Constanta, 2012. The evolution of the growthand fructification stages of the clingstones in theconditions of south-eastern Romania, Journal ofHorticulture, Forestry and Biotechnology. Vol 16 (1),Banat University of Agricultural Sciences andVeterinary Medicine Timisoara, Ed. AGROPRINTTimisoara, p. 192-197.Salunke D.K., 1974. Storage, processing and nutritionalquality of fruits and vegetables. CR Press, Utah.18

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653RESEARCH REGARDING THE POSSIBILITIES OF STARTINGAND CONTROLLING OF MLF IN RED WINES FROM CERNAVODAVITI-VINICOL CENTRE SITUATED IN MURFATLAR VINEYARDGeorgeta BELENIUC 1 , Constantin Baduca CÂMPEANU 2 , Claudia TEFAN 3 , Jose PARDO 41 Universitatea Ovidius Constanta, Mamaia street no. 124, Constanta, Romania2 USAMV Craiova, Al. I. Cuza street, no. 13, Craiova, Romania3 ASAS, 61 Mrti Blvd., District 1, Bucharest, Romania4 Univ. La Mancha, Fac. Agraria, Camilo Jose Cela Avenue, s/nº. 13071, CIUDAD REAL, SpainAbstractCorresponding author email: georgetabelen@yahoo.comThe malolactic fermentation (MLF) is a biologically desacidification process of the wines especially red wines, madeby lactic bacteria that convert malic acid (more aggressive for the taste buds) into lactic acid (pleasant taste budsimpress) and CO 2 . Between 2009-2011, were made studies reffering to the possibilities of starting and controlling ofmalolactic fermentation (MLF) in the red wines from Cernavoda Viti-Vinicol Centre, Murfatlar vineyard, as well as onthe conditions of this biochemical process. The degradation of malic acid has three effects upon the wines: reducedacidity, microbial stabilisation and a some modification of the organoleptic properties. In the same time we noticed thatthrough malolactic fermentation, the red wines winning in quality. The starting of MLF can be easy initiated, if for thisare used wines in full MLF. For induce MLF is necessary an initial titre between 3x10 4 till 5,0 x10 4 cells/mm 3 . Afterinoculation the bacteria cells passed through an adaptation period because their functions were limited by the alcoholcontent and pH of the wine, and therefore in the medium remain a bacteria number of 1x10 4 cells/mm 3 . For MLF wecan recommend some strains of lactic bacteria, isolated from vineyard microflora.Key words: malic acid; lactic acid; organoleptic properties, bacteria strain; inoculation.INTRODUCTIONIn grapes, must and wine, malic acid there is ina big quantity like acid L (-)-malic. Duringgrapes transformation proccess, malic acid andits salts reach in must (Cotea D.V. et al., 2005,2009). Many researchers have studied theevolution of malic acid during maturation ofgrapes, alcoholic fermentation, malolacticfermentation and maturation of wines fromvessel (Blouin J. et al., 2003). In the process offermentation and wine storage period, theacidity decreases continuously through:-the natural insolubilisation and precipitation ofpotassium hydrogen tartrate, under theinfluence of alcohol and low wintertemperatures;-through biological degradation of malic acid inmust and wine by yeasts and malolacticbacteria (Târdea C., 2007). In the most casesmalic acid from the wines is reduced by thebiological way through MLF. Malolacticbacteria completely metabolize malic acid fromthe must and wine, with the formation of lacticacid and CO 2 , according to the reaction:HOOC-CH 2 -CHOH+malolactic bacteria ->CH 3 -CHOH-COOH + CO 2 . This proccess isimportant for the wines quality, having in viewthe effect upon the wines: reduced acidity,microbial stabilisation and an organolepticproperties modification (Baduca-Câmpeanu etal., 2008; Kontek A. et al., 1977). By this studyare established the ways for starting andcontrolling of malolactic fermentation in thered wines from Cernavoda viti-vinicol Centresituated in Murfatlar vineyard.MATERIALS AND METHODSThe researches were made in SC VINEXMURFATLAR SRL, a private Viti-VinicolCompany, situated in Cernavoda Viti-VinicolCentre from Murfatlar vineyard, between 2009-2011, having in view:- spontan starting of malolactic fermentation;- using wine in full malolactic fermentation;- using bacterial concentrate from spontaneousmicroflora;19

- usingselectedbacteriafromm Leuconostocoenosspecie,for mallolactic fermfmentationn star-ting (PrahlC. et al. ,1995).The spontaneouss startingg of malomolacticc fermen-tationwasfollowedin thevessvselss withh 10000and10. .000 literscapacity. For F too obtainthewineswitha bigmalolacticbacteriadensity,wereusedwines producedbyy carbonicmace-rationproccess.Strainsof malolacticbacteriausedin researchs(10strains) for r inoculation,wereselectedd innlaboratories of SC VINNEXMURFATLARR SRLLbyspecializedpersonnel, fromm redwines withhlowpH and with thefinishedd spontaneousma-lolacticfermentation.Forr lactic bacteria’ss studyywereusedthetechniquess andthee medimium, indi-catedbyPeynaudandd Domerq (1959), andfortheirclassification wass usedBergey’’s Manual ofDeterminativeBacteriology-NinthEdition (2004)..Thebacterialconcentratewas producedd frommMerlot winne in fulll malomolacticc fermentation, byythetangentialmicrofiltration metmthod.The useofbacterial concentrateof spontaneousmicroflorais recommendedd for thestartinganddcontrollingofMLFinn red wines.The evolutionoff totall numberr off lacticc bacteriawas made by countingg onn Thomamount, andd thenumberof propagationn cells,byy filtermembrane..The evolutionof lactic bacteria in redwines ofCernavodaViti--VinicolCentre wass put inevi-dencee by chromatographyonn paper (thee KunKn-kee method – 1968),andby the evolutionn ofthetotalnumberr ofmalolacticbacteriain wine..RESULTSANDD DISSCUSSIONSI.The spontaneouss startingof fmalolacticfermentationin theSCC VINEXX MURFATLARRCernavodaredwines,is dependingof SOO 2quantityfromthe winnes andof o the tank size. Inntheredwiness withh pH-3,4producedbyymacerationinbig tankk the degradationoff malimcacidis beginningearly, without influencee offree SO2 doses.In the redwinees producedin i smalltankca-pacity( 1000liters)att 188 o temperature, thene-cessarytimeforr mallolactic fermfmentationn star-ting is betwween10-500 days, in i thiss casee beingginfluencedofwineSOO 2 freee content.Thestartingof malicc aciddegradation is pro-ducewheninthe winne mass thertre is a bacteriadensityof 3x10 4 – 4.2x10 4 cells//mmm 3 , degrada-tionn timee for1.4g/ /l malicacid beingbetweenn7-88 days.It hasbeenn found that thestartingof thee me-theemomentoff acquiringinn thewinemassofabacterialdensityoff 4. .2 x 1014 cells/mmm 3 andattthee end ofthee metabolisationof malicacidtheebacterialdensity is 7.1x10 4tabolisationn of malicacidcoincides with cells//mmm 3 (Figure 1).Figure1. Thespeedof malic acidad degradation andbacteria’snumber evolelutionII.Theresearchfoundd thatatt the endoffalcoholicc fermentationn in redd winewes obtainedbyycarbonicmacerationprocesswasonlyy halffmalicacidd metabolized.Whenn thesewineestorage conditions(temperatureandSO 2 2) areeadequatee thesee winescompletesits malomolacticcfermentation in5 days.Blendingg these winesswithotherr winesinn whichthemalomolacticcfermentation is desired, is a goodd solution. Theeresearchhasshownthatif thewine-yeastttimeoffmalicaciddecreases.Usinga proportionoff10% % wine-yeasts wasachivedinthewineeinoculated a titreoff 5.0x10 4 cells//mmm 3 of lacticcbacteria(Figure 2).quantityis higher,themetabolisingFromthefigure2, it canseethat,afterrinoculation, malolacticc bacteriaa went throughaperiodof adjustmentwhenn theirnumberrdecreasedtilll 3.8x100 4 cells/mm 3 and a thennincreasedd reaching 8.0x100 4 cellcls/mmm 3 .III. Thee usingof concentratee bacterialfrommspontaneous microflorais anotherwayyforrstarting malolactic fermentationn proccess.Thisconcentratebacterialwas w obtainedbyytangentialmicroflitrationmethodfromfm annunsulphitatedbut malolactic fermented youngg20

wine of Merlot type, the characteristics ofwhich are shown in table 1.Figure 2. Lactic bacteria number evolution in the winesinoculated with 10% wine-yeasts in full MLFTable 1. The phisico-chemical and microbiologicalcharacteristics of the malolactic fermented MerlotTypeof wineMerlotWine characteristicsAlcohol% vol 11.7Sugars g/l 5.4Tot. ac. g/l H2SO4 4.20Volatile acidity g/l CH3COOH 0.38total 28.2 SO2free 0.0pH 3.30Bacteria no./mm 3 7.0x10 4From the table 1, we can show that at the endof metabolized period of malic acid, the bacterialdensity was 7,0x10 4 cells/mm 3 . In table 2,are shown the results of the microbiologicaltests, content of anthocyans and total polyphenolsin the concentrate bacterial and in thefiltrate obtained.The lactic bacteria number from the concentratebacterial was 2,1x10 6 cells/mm 3 , while thefiltrate was sterile. The content of anthocyansand total polyphenols were greater values in thefiltrate than in the concentrate bacterial.Table 2. The microbiological and phisico-chemicalcharacteristics of the concentrate bacterial and the filtrateobtained from Merlot wineNumberof lacticbacteria/mm 3Anthocianins mg/lPFTg/lConcentratebacterial2.1x 10 6 210.1 1850Filtrate 0 320.0 1990IV. In our researchs, we selected 10 strains oflactic bacteria from young red wines (Pinotnoir, Merlot, Cabernet sauvignon, Feteascaneagra, Blawer). In the selection process werehad in view criteria that they must have,namely: to possess the capability to increase atlow pH, to grow in the presence of alcohol, toproduce low amounts of volatile acids, do notdegrade certain compounds in wine, as pentoze,glycerol, tartaric acid, etc. Of the 10 strainsisolated by us were tested morphologically,physiologically and oenological point of view,it noticed that strains registered with code 1, 2,5, 7, belonging to the species Leuconostocoenos, the codes 3 and 6 the species Leuconostocgracile, and the codes 4, 8 and 10, toPediococcus cerevisiae species. For verificationin production conditions were chosen strains 1,2 and 5 of the species Leuconostoc oenos. Inour experiments, the starting of malolacticfermentation took place when the amount ofinoculum was 2.5x10 4 cells/mm 3 on conditionthat at least 1.2×10 4 cells/mm can formcolonies. After inoculation of lactic bacteria inthe wine, the bacteria passed through anadaptation period because their function waslimited by the alcohol content and pH of thewine. Three selected bacteria strains verified inwines, has realised the malic acid degradationin 5-7 days. Volatile acidity of the wines havehad different growing-up, the smaller was inthe sample inoculated with the strain code 2(0.08 g/l CH 3 COOH), and the biggest at thesample inoculated with strain code 1 (0.16 g/lCH 3 COOH) (Table 3).Table 3. The changes in the wine composition, inoculated with different bacteria strains after malolactic fermentationFree SO The strain code2 Acetaldehyde Totale acidity Vol acidity g/l Increase of vol.pHmg/l mg/l g/l H 2 SO 4CH 3 COOH acidity with:Initial wine 12,2 16,1 4,00 3,60 0,34 -Malolactic bacteria Code 1 10,5 12,6 3,42 3,67 0,50 0,16Malolactic bacteria Code 2 10,5 15,8 3,20 3,59 0,42 0,08Malolactic bacteria Code 5 11,1 29,9 3,30 3,70 3,45 0,1121

To organoleptic analysis of the wines obtained,shown there are differences between samples:sample where MLF was carried out with bacteriastrain under code 2, was balanced, harmonious,soft and velvety, compared with samplesobtained with bacteria strains under code 1 andcode 5 which were nice but not with the sameharmony. Therefore bacteria under code 2, hasbeen recommended for use in the productionprocess in SC VINEX MURFATLAR SRLfrom Cernavoda Viti-Vinicol Centre.CONCLUSIONSIn the red wines obtained by maceration processin tanks of big capacity, the starting of malolacticfermentation was spontaneous producedat the end of alcoholic fermentation. In thered wines produced in small tanks, the malolacticfermentation was later starting, due ofSO 2 high-up level;The quantity of inoculum used for initiation ofMLF was 3x10 4 – 4,2x10 4 cells/mm 3 ;In production conditions the best results giventhe Leuconostoc oenos strain 2, which wasrecommended in production process.REFERENCESBduca-Câmpeanu et al., 2008. The malolactic fermentationand the sensitive features of red wines obtainedin the vinezard of Oltenia county hills from Romania.Anale Univ. Craiova, Vol. XIII ( XLIX ) p. 319-324.Blouin et al., 2003. Analyse et composition des vins.Comprendre le vin. Dunod, Paris.Cotea V. et al, 2009. Tratat de Oenochimie, vol. I-II. Ed.Academiei Romane, Bucuresti.Cotea V., 1985. Tratat de Oenologie, vol. I. Ed Ceres,Bucureti.Kontek R.E. et al., 1977. Factori ai vinificaiei primarecare influeneaz aciditatea volatil a vinului. AnaleICVV., VI.Kunkee R.E., 1968. Control of malolactic fermentation.Am.J.Enol. and Vitic. 18, p. 71-77.Peynaud et Domerq, 1959. Posibilite de provoquer lafermentation malolactique en vinification a l’aide debacteries cultivedes. C.R. Acad. Agric, France, no.45/335.Prahl C. et al., 1995. Malolactic fermentation by directinoculation with a culture of Leuconostoc oenos. 5-thSymp. Internat. Of Enology, Bordeaux.Târdea C., 2007. Chimia si analiza vinului. Ed. “IonIonescu de la Brad” Iai.22

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653INFLUENCE OF BIOLOGICAL PRODUCTS USED IN FOLIARFERTILIZATION ON THE NUMBER AND QUANTITY OF FRUITREPORTED TO THE PLANT AND AREA OF CULTUREGheorghe CÂMPEANU, Florin Constantin IACOB, Nicolae ATANASIU, Elena CATAN,Gabriela NEAAbstractUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Marasti Blvd.,District 1, 011464, Bucharest, RomaniaCorresponding author email: post@info.usamv.roAssortment of cucumbers has evolved rapidly and radically in recent years. The consequence of this development hasresulted in increasing the number of hybrids Cornichon type as well as quality. Recently created F1 hybrids are totallygynoecious and presents type of parthenocarpic fruiting and also being very productive. It presents a high resistance tosome cucumber specific diseases being recommended for both culture in field and protected culture in solarium.Biological products used in foliar fertilization, Cropmax, Bionat and Bioleafz are stimulating synthesis ofphytohormones that regulate the process of maturation facilitating norming of cucumber fruit load, that is responsiblefor increasing the number of flowers and fruits. Fertilizations were made every 10 days, applying organic fertilizersaccording to appropriate technological practices to five hybrid type cucumbers gherkins, Kybria, Karaoke, Compomist,Trilogy and Promisa, pursuing the influence of products used in foliar fertilization on the number and amount of fruitreported to the plant and surface.Key words: Cucumis sativus L., fertilization, fruits, number, quantity.INTRODUCTIONThe present research wants to demonstrate howpickling cucumber production may beinfluenced by hybrids and culture techniques(biofertilizer used for plant growing).The vast majority of the pickling cucumberused in vegetable growing in south of DambovitaCounty is grown for pickling and freshalimentation use (size 3 to 6 cm and 6 to 9 cm).To optimize yield and quality of commercialsize fruits, most growers use biofertilizerproduction growing.Main objectives of this experience are asfollow:-Determining the production potential of somenew hybrids have been used in the culture,using biofertilizer for plant growing.-Comparison of productivity of fruit obtainedin comparative culture conducted in 2010.MATERIALS AND METHODSConditions of experimentThis field experiments were conducted at thefamily farm in 200 square meters solariumtunnels, cultivated with five pickling cucumberscultivars: Karaoke, Componist, Kybria,Trilogy and Promisa (Table 1).Table 1. Experimental variations in solar with picklingcucumber type, Tartasesti 2010.Variant Cultivar Origin Comments1 Trilogy Netherland Rijk Zwaan Hybrid2 Promisa Netherland Rijk Zwaan Hybrid3 Karaoke Netherland Rijk Zwaan Hybrid4 Kybria Netherland Rijk Zwaan Hybrid5 Componist Netherland Rijk Zwaan HybridThe soil pH was 8.06, and soil analyzed N-NH 4 : 29,58, N-NO 3 : 33,25, P-PO 4 : 60,20, K:145. The trials were monofactorial and set afterthe randomized block method using fivecultivars, in tree variant and two replication(Ciulca, 2002, Saulescu, 1968).Specific elements of technology: culture wasestablished by planting seedling on 10/04/2010with distance between rows of 70 cm and 30cm between plants per row.Plant spacing and row spacing were selected onthe basis of current practices. The specific23

works were pickling the cucumbers in solariumtunnels.Experimental culture was harvested by hand,gradually, with registration repeating the productionquality for each variant. Quantities harvestedwere pooled to establish production inaccordance with experimental scale (variations).The experimental design was the latin squareblocks with three replications. Immediatelyafter planting, foliar fertilizers (Cropmax,Bionat and Bioleaf) were applied and then soilfertilizer at a rate of 1 kg/ha (1:2:1/N-P-K) in amicroirigation system.Pickling cucumbers were harvested manuallyon period of 12.05.2010 (32 days after plantingday) up to 12.08.2010 (3 months after daypicking starting).Fruits were harvested when about 30% of themhave about 9-12 cm in long and sortedaccording to market standards.RESULTS AND DISCUSSIONSThe fruit number increased because of the goodconditions of growing.With increased density of fruits on terminalpart of plant the fruit weight per plant decreasedand fruit weight per unit area increased.This study results shows information that couldhelp the farmers in Dambovita county.Plants had good performance as a result ofbiofertilizer used.Profitability of fresh pickling cucumbers itsdirectly linked to hibryd used, selling price andperiod of selling. In this study we try to showthe optimum growing element required tomaximize the revenue.Results of this study suggest that hibryd Kybriahave the highest production of 6.76 kg/sq.mand 13.95 kg/sq.m for the first month of harvestand second one.Table 2. Total production type cornichon cucumber insolarium, Tartasesti 2010, (the first month of harvest).V CultivarAverage ProductionTotal DifferenceFruitsDensityweight per plant production from thenumber/plantculture(g) (kg)(kg/sqm) control1 Trilogy 10.41 97 1.01 4.76 4.81 -2 Promisa 9.78 92 0.90 4.76 4.28 -0.533 Karaoke 15.64 85 1.33 4.76 6.33 +1.524 Kybria 16.13 88 1.42 4.76 6.76 +1.955 Componist 11.47 95 1.09 4.76 5.19 +0.38Figure 1. Total production type cornichon cucumber insolarium, Tartasesti 2010, (the first month of harvest).Table 3. Total production type cornichon cucumber insolarium, Tartasesti 2010, (two month of harvest).V. CultivarAverage Production Total DifferenceFruitsDensityweight per plant production from thenumber/plantculture(g) (kg)(kg/sq.m) control1 Trilogy 17.04 97 1.65 4.76 7.85 -2 Promisa 13.46 92 1.24 4.76 5.90 -1.953 Karaoke 25.20 85 2.14 4.76 10.19 +2.344 Kybria 33.24 88 2.93 4.76 13.95 +6.15 Componist 24.62 95 2.34 4.76 11.14 +3.29Figure 2. Total production type cornichon cucumber insolarium, Tartasesti 2010, (two month of harvest).CONCLUSIONSRegarding number of fruit per plant, hybridKybria are in top with average of 16.13 and33.24.24

For average weigh of fruit, the heaviest one arehybrid Trilogy with 97 g average and thesmallest Karaoke with 85 g.Production per plant: Kybria 1.42 kg (+0.45)and 2.93 kg (+1.28) for the first month ofharvest and second one.Regarding the production per sq.m hybridKybria had 6.76 kg/sq.m (+1.95) and 13.95kg/sq.m (+6.10) for the first and second monthof harvest.Regarding productivity factor the highest fromthe four variants used was Kybria compare toTrilogy control.ACKNOWLEDGEMENTSThe researches were carried out withindoctoral thesis.REFERENCESCiulca S., 2002, Tehnica experimentala, Ed. Mirton,TimisoaraSaulescu N.A., Saulescu N.N., 1968, Câmpul deexperienta, Ed. Agro-Silvica, Bucuresti25

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653ORGANIC WEED CONTROL MEASURES APPLIED IN ORGANICTOMATOES CULTUREElena CATAN 1 , Gheorghe CÂMPEANU 1 , Nicolae ATANASIU 1 , Gabriela NEA 1 ,Vasilica MANEA 2 , Constantin-Florin IACOB 11 University of Agronomic Sciences and Veterinary Medicine of Bucharest, Blvd. Marasti 59,Bucharest 011464, Bucharest, Romania2 National Institute For Chemical - Pharmaceutical Research and Development – ICCF, Calea Vitan112, Sector 3, Bucharest, RomaniaAbstractCorresponding author email: elenacatana2009@yahoo.com; z18silvia@yahoo.comIn vegetable cultures appears weeds which are perceived to be harmful to the culture. Weed infestation lowers itsproduction through competition for soil resources and light, which can lead to underdevelopment of plant and / orinability to best use. Traditionally, removing weeds from crops is done by digging and hoeing. Usually, the crops stillfound some weed, with a low density which does not affect the production. In order to increase vegetable productivitydifferent methods were used to eliminate weeds in crops. Among these biodynamic methods with sand or dry soil ash1:9, the most effective methods are associations with chicken and tomatoes and heat weeding.Key words: chicken tomato associations, weeds, biological control, thermal weeding, signed false.INTRODUCTIONIn the opinion of many scientists weeds areconsidered undesirable plant speciesencountered worked and cultivated soils crops,which causes some damage expressed byreduction in production and its quality (Bucur,2011). Most weeds have medicinal value:plantain (Plantago sp.), Capsella bursapastoris.Beneficial weeds are dandelion(Taraxacum officinale), clover (Trifolium sp.)and other legumes (Balascuta, 1993). The useof herbicides is one of the most effectivemeasures for weed control, but does notreplace, nor exclude other maintenance of soil(Catana et al., 2009). Control of weeds, pestsand diseases must be achieved throughpreventive means, biological and mechanical. Ifit increases the proportion of cultivation croprotation will succeed in reducing the degree ofweeding, as a result of the large numbers ofmaintenance. In the same area, in addition tocrop rotation is necessary rotation of herbicideswith a different spectrum of combat (Catana etal., 2009). Weed species diversity positivelycontributes to more complete use of vital space.The weeds trash are much more diverse and isembedded in the soil, are subject to successfulhumification processes compared to stubble27cereals. Root systems of many weed specieshave a high capacity to extract from the arablelayer and subarable layer inaccessible compoundsfor plant culture. Weeds contemporaryinfluences soil formation process, providing thesoil with certain quantities of items biofile(Bucur, 2011). The most important tillage tohelp unweed are: plowing, seedbed preparation,hoeing and weeding. Through a deep plowingwill kill perennial weeds by cutting and buryingthem. Annual weed species and the perennialpart will be destroyed by the most energeticmechanical work to destroy weeds-hoeing. Tocombat the perennial species are required 3-4mechanical hoeing (Bucur, 2011). Based on thenumber and weight green weed was considereda weed pest threshold degree of weed numberand gravity. Weeding was determined in dynamic,critical period of crop to weed, calledthe herbocritic stage (Bucur, 2011). In orchardsare planted nettles (Urtica dioica), which severaltimes a year mowing and leave the groundas mulch. They also planted grass and otherplant species that many consider weeds (wildcarrot (Daucus carota), wild spinach (Chenopodiumalbum), yarrow (Achillea millefolium),dandelion (Taraxacum officinale)). Couch grass(Triticum repens) is a plant to be removed even

grasping a biological garden. It is also grown inrows in the orchard clover (Trifolium sp.) orclumps of alder (Alnus incana) for fixingatmospheric nitrogen in the soil (Catana et al,2009). Weed density Shepherd's Purse (Capsellabursa-pastoris) and nettle (Urtica dioica)was lowerin the treatments with compost. Invegetable crops can intentionally leave otherplants than those of culture that will be healthrole. Among these against nematodes cansuccessfully call marigold (Calendula officinalis)or marigold (Tagetes sp.) and snails arechased by the smell hyssop (Hyssopus officinalis)or thyme (Thymus serpyllum). To protectplants growing between the lines is plantedgarlic (Allium sativum), marigold (Calendulaofficinalis), Tagetes sp.. The cultivation of valuablemedical plants as vetricea (Tanacetumvulgare), wormwood (Artemisia absinthium),comfrey (Symphytum officinale), nettle (Urticadioica), garlic (Allium sativum), and horseradish(Armoracia rusticana) will consider mostpreparations composites good or as extracts,infusions and concoctions. The aim of thiswork was to analyze and test various ecologicalways of preventing and combating weeds thatcan infest tomato crops in solar.MATERIALS AND METHODSExperimental field is located in southern Muntenia,Teleorman county and has been used foreach variant 100m 2 in solar. The land wasalready converse in organic agriculture. Vegetablesgrown on land are tomato (Lycopersicumesculentum). Other materials: Cropmax, Champion0.3% (copper hydroxide with 50% coppermetal), decoction of Horsetail (Equisetumarvense), infusion of nettle (Urtica dioica),cylinder stove, burning appliances, ash resultingfrom home heating, put the minimum ageof 7 days, black and white film for mulch.MethodsTomato crop in solar technology used in theexperiments: the terrain was prepared by greenmanure fertilization founded in autumn,digging, leveling, remove weeds (10 days afterseedbed preparation), planted seedling age was60 days, planting culture was performed on 5April 2009 after planting scheme 70 x 40 cmwith a density 36-40000 culture plants / ha,flowering began April 20, 2009.Care workswere drip irrigation and 2 hand- hoeing and for28fertilization was used Cropmax at two weeksafter planting.Preventive phytosanitary treatmentswere:-25 April 2009 product preventivetreatment for hand Champion 0.3%-on May 5was used horsetail decoction dilution of 1/10against Septoria,infusion of nettle dilution of1/10, from 10 to 10 days from 20 April 2009until the abolition of culture to prevent diseasesand pests throughout the growing season, nettlewith role of fungicides and insecticides.Trellising was made from planting andcontinued throughout the period until meat.Mulching was done in the first 10 days afterplanting for weed control sheet and maintainssoil moisture. Child cut was performed at 10days after planting, to reduce foliar apparatus.Defoliation was performed at 10 days afterplanting, the plant ventilation, preventingpassage of soil manna plants. The cut of shootshas been made to 7 inflorescences, in order tospeed up fructification and ripening existingfruit. Exploit stimulation was performed byplacing near a beehive solarium, complete withartificial pollination induced by shaking themain wire to support plant every 15 daysthroughout the flowering. First harvest firstcollection was recorded June 10, 2009. Lastharvest and dissolution culture were made on15 September 2009, followed by dissolutionculture and plant remains were transported to acomposting platform.False semantics was made after the preparationphase for sowing train, waiting 12 days, duringwhich weeds have sprouted and grown destroyedthen very rigid, as described by Fitiu, forthe creation culture tomato in solar. Workingvariants were V1: tomato crop planting, V2: 14days after planting, V3: 30 days after plantingfor field experience and witness field, whereweeds were counted in sq. Thermal weedingwas performed in cultured tomato in solar, afterbeing established culture, the technologypresented. Instead weeding thermal manualweeding was made. Working variants were V1:tomato crop planting, V2: 14 days after planting,V3: 30 days after planting for field experienceand witness field, where weeds werecounted in sq. Burning Flame was carried outto prepare the land for crop establishment.Experimental variants field work and thewitness are as follows: V1 burning day, V2: 10days to remove weeds by burning V3 at 20

days after removal of weeds by burning, Control,and will include weeds. Gas consumptionfor soil preparation flame burning weedstomato crop establishment are: V1 in consumptionof 15 liters of gas/1000 sqm, V2 at arate of 20 liters of gas/1000 sqm, Controlwithout gas consumption, and will includeweeds raise counting. Type of existing weedson land that was unprepared with thermalweeds. Working versions are V1: numbermonocotyledonous plants, V2: number dicotyledonousplants, monocotyledonous and dicotyledonousplants Control number. Weed controlwith ash: soil 1:9, it was made after he wassetting the stage for crop cultivation withoutsomething on the land for at least 15 days.Were counted in a number of plant species 15days after soil preparation and management ofgray, with the following types of work: V1couch grass crawler (Agnopyrom repens), V2bindweed (Convolvus arvensis), V3 veronica(Veronica sp.) to control.Association between tomato-chicken was donein a tomato crop as presented technology withthe changes that not have been made hand weedingand was eliminated Cropmax fertilizationand in solar were introduced in the 10 daysafter planting (15 April) 150 chickens aged 7days, which were removed from culture at thebeginning of ripening fruit (June 5). Weedswere counted at 20 days and at 40 days afterplacing puppies in culture. It has also beendetermined average amount offruits per plant.Mulching foil was made in tomato cultureunder given technology, in the first 10 daysafter planting. There were taken in considerationthe following variants: V1 mulchingwith black foil, white foil mulching V2, V3control without mulching. Were countedsprung weeds around plants that have beengrown to 10 days after mulching were removedby weeding, and mulching at 20 days (actually10 days from weeding). All experiments wereperformed in triplicate, and results presentationis average. Each variant of the experiment wasconducted over an area of 100 sqm.RESULTS AND DISCUSSIONSWeed control in tomato crops by falsesemantics, on 1000 sqm, with predominantweeds Veronica (Veronica sp.), Amaranthusretroflexus, Portulaca Oleraceea.Table 1. Weed control by false seeding at tomato cultureWeeds density / sqmVariantExperiment ControlV1 At tomato transplanting 18±2 26±3V2 At 14 days from transplanting 29±4 48±6V3 At 14 days from transplanting 34±3 69±12At 14 days after planting weeds in the fieldwere 29 at experiment and 48 at control in thearea. At 30 days after planting were observed 34and 69 weeds experience in control field. After30 days of culture planting control, in the experimentalfield consisted of 16 weed emergence,while control cultures were counted 43 weeds.Thermal weed is used as a means of weed controlsuch Atriplex, on an area of 100 sqm. Weedcontrol by thermal weed in tomato culture.Table 2. Weed control by thermal weed in tomato cultureWeeds density / sqmVariantExperiment ControlV1 At tomato transplanting 2±1 32±4V2 At 14 days from transplanting 6±2 51±5V3 At 30 days from transplanting 18±4 74±8At the control planting culture in the experimentalfield there were 2 weeds, while zone ofweed control were 32. At 14 days after plantingis noted that the experimental culture have 6weeds and the weed control were 51. At 30days after planting, weeds were 18 in theexperimental and the control 74. During the 30days of experiment, the cultures appeared 16weeds in the experimental field and the control42 weeds have emerged. Results flame burningweeds, depending on when counting weedsfollowing table:Table 3. Removing weeds by burning with flameVariantAt removing the weed byV1thermal processWeeds density /sqmExperiment Control0 64±8V2At 14 days from transplanting 16±3 83±13V3At 30 days from transplanting 32±7 105±16In V1, immediately after burning in fieldexperience was not any weed, while in thecontrol group were 64 weeds.The variant V2 there were a few weeds becauseit's been a short period of cleaning by burning,the weed seeds germinate to light, so 16 plantswere found in lot of experience, while the29

control was 83 weeds. Increased to a periodmore weeds pop up on sqm. In variant V3 werefound 32 plants in the experimental group,while the number of weed control increased to105 plants.Note that 20 days of treatment increased thenumber of weeds experience with 32 plants andthe weed control number increased by 41plants, the total number of weeds in group sqmwere 3.28 times higher than experience. Gasconsumption flame burning weeds in tomatocrop, calculated at an area of 1000 squaremeters, according to Table. 4:Table 4. Gas consumption flame burning weeds intomato culture.VariantThe quantityof weedsburn on sqm,% comparewith controlV1 V2 ControlGas Gas Gasconsumption consumption20 liter 0 literconsumption15 liter91,7±3,1 83,2±2,4 100After flame burning of weeds was observedthat maximum efficiency was achieved at 15liters gas consumption at 1000 mp.The control was untreated weeds are in culture.Flame burning weeds in tomato crops, area0.01 square meters at a density of 70 x 40 cm,depending on the type of weeds, weed correlatedwith the type existing in culture.After thermal weeding there are determined thetype of existing weeds on land unprepared. Suchweeds were counted on a square before treatment,and at 30 days after treatment plants werecounted according to the type found in them.The results are shown below:Table 5. Flame burning weeds, weed correlated with thetype existing in cultureVariant V1 V2 ControlMonocotType of weedsMono Dicoty yledon andcotyledon ledonous DicotyledonousInitial quantity ofweeds, % comparewith control100 100 100Weed quantity, %,distroyed by the78,2±5,8 86,9±3,7 0treatament comparedwith controlThe weeds after thetreatment,% comparewith control21,8±5,8 13,1±3,7 10030Percentage of destruction was not 100%, due tothe existence of perennial weeds in crop.Monocotyledonous weeds were destroyed inthe 2-3 leaf stage, because at that time aresensitive to heat.Note that the efficiency was higher in Dicotyledonousthan Monocotyledon destruction. Combustionwas achieved at temperature of 70-80 o C, so protein coagulates and weeds die.Results of weed biodynamic methods, the ratioof 1:9 ash to dry soil are presented in thefollowing table.The results show that the percentage of allexisting weed control cultures is reduced by22% for creeping couch grass, bindweed and28% to 16% for veronica. Reproduction isinhibited by the introduction of new weeds intothe soil ash obtained by burning their seeds.This is repeated for 3-4 consecutive.Table 6. Weed biodynamic methods, the ratio of 1:9 ashsoil dry for at least 15 daysVariantCouchV1grasscrawlerResults ofweedsdestroyed aftertreatmentcompared withcontrolResults,%plants findafter treatmentcompare withcontrolControl22±2,9 78±2,9 100V2Bindweed 28±4,3 72±4,3 100V3Veronica 16±6,1 84±6,1 100Results weed control in tomato crop usingchicken tomato combination, are shown in thefollowing table:VariantTable 7. Chicken with tomato AssociationAt 20 days after chickenV1puppies introduced in cultureAt 40 days after chickenV2puppies introduced in cultureWeed density/ mpExperimentControl2±1 154±3±2 316± Medium crop, kg/wire 3,2±0,5 1,9±0,3At 20 days after placing puppies in culture isnoted that the field experience are only 2 weedswhile the crop weed control is 154. At 40 daysafter placing puppies in culture, experimentalculture has three weeds, which was 314compared with control weeds. Experiment 20days, compared to the previous determination,

it appears that the culture has grown a weed testcompared to 1620 weeds in the control group.Output gap was 1.3 kg wire tomato productionincrease for the experimental group. This canbe explained by the fact that chickens ateweeds, then fertilized with a fertilizer culturerapidly mineralized (represented by theirmanure) and mobilized soil around plants. Landmulching helps remove weeds from the crop, asshown below:Table 8. Mulching land and the number of weeds sprungNo Var SpecificationNo of weeds at mpAfter 10 daysaftertransplantingAfter 20 daysaftertransplanting1 V1 Black foil 15±2 7±33 V2 White foil 21±5 9±34 V3 Control 83±18 129±26Were counted sprung weeds around plants thathave been grown to 10 days after mulchingwere removed by weeding, and mulching at 20days (actually 10 days from weeding). Numberof weeds at 20 days after planting is less than10 days from planting because of weed seednear existing plants benefit from light to dawn.Moreover, foil prevent weed emergence, butheats the soil to a depth of 4-5 cm by 5-6 o Ccompared to the control. If it was white filmnumber of weeds was higher, the highernumber of weeds around plants as existing infoils rises but suffocate due to temperature. If itwas black film, the number of weeds is lower.Since soil is well warmed by mulching withplastic white culture plants grow more quickly,reaching maturity earlier.CONCLUSIONSThe most efficient mode to combat weeds is theassociation of tomatoes plants with chichen andwith the use of thermal and mulching weeds.A low effciency was found to ash/soil biodynamicmethods.REFERENCESBlscu N., 1993. “Protecia plantelor de grdin cudeosebire prin mijloace naturale”, Ed. Tipocart,Braov.Bucur Gh., 2011. “Rolul culturii protectoare în controlulbiologic al buruienilor la culturile pritoare”, tiinaagricol, nr. 2/2011. ISSN 1857-0003, p. 10-13.Catana E., G. Câmpeanu, N. Atanasiu, G. Nea, V.Zaharachescu, «Preparate ecologice obinute dinplante folosite la combaterea bolilor i duntorilor înlegumicultur la Familia Solanaceae”; Simpozionultiinific “Tendine ale horticulturii rurale, periurbanei urbane în mileniul trei”, 6 nov. 2009, Bucureti.31

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653AbstractRESEARCHES ON THE INFLUENCE OF SOME BIOLOGICALSTIMULATORS TO THE SEED PRODUCTION OF FRENCH BEANAna-Emilia CENU, Victor POPESCUUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Mrti Blvd., District 1, zip code 011464, Bucharest, RomaniaCorresponding author email: ema_april@yahoo.comThe paper presents the results concerning a study on the influence of some biologically stimulators in a comparativecrop in some dwarf French bean varieties used for seed production. The research works were carried out during theyear 2012. Biological material under trial was represented by two dwarf Romanian varieties having green pods(Fantastica, Delicioasa de Pasarea) and one dwarf Romanian varieties having yellow pods (Margareta). Naturalbioactive substances used in the experiments were: Cropmax 0.1% (four treatments on every 10-15 days), Kendal 0.2%(six treatments on every 7-10 days), Viva 0.4% (three treatments on every 15-20 days) and Benefit PZ 0.3% (on everyseven days after pod setting). The variants were grown in an experimental field according to the method of subdividedplots with three replications. The observations performed concerning the phenology and morphological traits of theplants (plant pod number, pod length and weight of one thousand seeds) allowed an accurate characterization of thevarieties under investigation as well an optimum recommendation for the growth regulators on the French bean crops.The processing of the production data of the seed crop was made according to the variance analysis. The influence ofthese treatments has been recorded both on the yield obtained and on the quality of the seed production. The resultsobtained show that the treatment applied with Cropmax and Kendal solution in a concentration of 0.1% and 0.2%increased the seed production by 35% and 30%. The paper presents data from the PhD thesis in the framePOSDRU/107/1.5/S/76888.Key words: biologically stimulators, dwarf french bean, seed production.INTRODUCTIONAmong the most efficient measures to increaseand improve vegetable production one couldHaving a high nutritional value, the pods ofenumerate the production and use of seeds ofdwarf French bean are highly appreciated byhigh biological and agrotechnical value. Thethe consumers and are consumed during theachievements in the vegetable breeding and inwhole year, both fresh, at maturity ofthe technology of production and conditioningconsumption and frozen or as tinned productsof the seeds assured a high role of the seeds in(Ciofu et al., 2003; Popescu, 1996).the vegetable production, they having a strongAccording to some researches the green pods ofinfluence over the level of the yield fromthe French bean have a higher value inquantitative and qualitative point of view. Thenutritional substances than the yellow ones.yield ability of a variety, respectively of aDue to the fact that one could obtain varietiesvegetable seed is well defined by the agrotechnicalconditions and its adaptation to the localhaving natural resistance against the mainpathogens and on the other hand, researchenvironment. Vegetable seeds can be easilyrecent results confirm that it is possible to getsubjected to the degeneration when they areseeds following ecological methods for thegrown under less suitable environmentalcommercial crops, dwarf French bean is afactors, an inferior agrotechnics or when it isspecies very suitable to be grown undernot used for multiplication a biological materialecological agriculture (Falticeanu, 2004).well selected. The true quality of the vegetableThat is why several varieties were createdseeds is determined by the following traits:which are different by their vegetative period,authenticity, germinative ability, absolutepod kind, resistance to diseases and pestsweight (weight of 1,000 grains), purity and(Tigaieru, 2009; Munteanu, 1994).health status (Voinea et al., 1971).33

Maintainance of the genetic structure andprevention of the degeneration of the dwarfFrench bean varieties is achieved by theprocess of conservative selection during theseed production scheme. In the dwarf Frenchbean the method of seed production is appliedby individual selection with a single obtion(Draghici, 2006; Glaman et al., 2002; Szilagyi,2002; Scurtu, 2001).Among the modern methods of growing of seedvegetable crops aiming increase of seedproduction both quantitative and qualitativepoint of view one could count the use of phytoregulatorsfor growing, biological stimulatorsand bioactive substances recommended bymany specialists (Darasteanu et al., 2005;Tofan, 2004).Mode of action of the biostimulators in theplant and their influence upon the growing anddevelopment process of the plants were investigatedby many researchers. Flower abortioncould be prevented by the treatment with amixture of citochinins and giberelins. Giberelinhas a strong influence upon the floweringprocess and in general upon plant development.Fruit setting is linked by the mode howessential metabolites are distributed betweenthe vegetative and generative tissues (Bernardis,2006; Burzo et al., 1999).On the world scale already exists a real industryof production of such chemical and biologicalstimulators due to efficiency of the synthetichormonal substance upon the vegetable plantsand on June 2011 The European BiostimulantsIndustry Consortium (EBIC) was set up (NewAG International, 2012).The main objective of these researches is astudy of some vegetal biostimulators having aneffect of increase upon quantity and quality ofthe seeds in dwarf French bean under the soiland weather conditions from the south of thecountry. This paper presents the seed yieldsobtained in an investigation in order to establishthe most efficient ways of their increase.MATERIALS AND METHODSThe research works were carried out during theyear 2012 at UASVM Bucharest. Thebiological material investigated was studiedunder the open field according to thetechnology for seed crop in dwarf French bean34recommended by the literature of speciality(Voican et al., 2006).Two varieties of dwarf French bean with greenpods-Fantastica and Delicioasa de Pasarea andone with yellow pods-Margareta were used.Among the biostimulators used in present forvegetable crops we chose four products havingan effect upon vigour and resistance of theplants against diseases and pests: Cropmax,Kendal, Viva and Benefit PZ. The experimenthad two factors: factor A-Biostimulators withfive gradations (a 1 -untreated; a 2 -Cropmax0,1%; a 3 -Kendal 0,2%; a 4 -Viva 0,4%; a 5 -Benefit PZ 0,3%), factor B-Varieties havingthree gradations (b 1 -Fantastica, b 2 -Delicioasade Pasarea, b 3 -Margareta). By multiplication ofthese factors 15 experimental variants resulted.Check control was untreated with biostimulators.The experiment was set up in a comparativeculture placed in plots subdivided in threereplications. The surface of a replication plotwas of 9 sq.m.For the location, field preparation and setting ofthe trial, general standards for the dwarf Frenchbean seed crops were observed.The trial followed an onion crop and the soilwas prepared under the shape of furrow beds of1.5 m width. The sowing scheme consisted inthree rows on the furrow at 35 cm apart and 5cm between seeds on the row. The herbicideDual Gold 1 l/ha was applied preemergentlyand the herbicide Basagran 2 l/ha was appliedpostemergently. During the vegetative periodfour manual hoeings were made and humiditywas assured by dripirrigation. To controldisease and pests the following treatments wereapplied with Vondozeb 0.2% + Topsin 0.1%,Funguran 0.4%, Ridomil Gold 0.3%,Milbecknoch 0.075%, Confidor Energy 0.1%,Mospilan 0.022%. A distinct work for this seedcrop was biological purification whichconsisted in removing of untypical plantsconsidering traits for specifity of each cultivar.Purification works were made at the stage whenplants had two cotyledons, during the flowerstage and at the physiological maturity of thefirst pods.Treatments were carried out with a sprayer andsubstances were weighted with a cylinder andan electronic scale. Biostimulators were appliedin the morning as aqueous solutions using 200-

500 l water/ha according to the foliar surface ofthe plants such as:-Cropmax – four foliar treatments at every 10-15 days interval;- Kendal – six foliar treatments at every 7-10days interval;- Viva – three foliar treatments at every 15-20days beginning with the stage of two-threeleaves;- Benefit PZ – three foliar treatments at every 7days beginning with a completely formation ofthe first pods.Both in size of the plots and in registering ofthe observations taken during the vegetativeperiod and regarding the technique of dataprocessing were observed provisions imposedby the experimental technique.Phenological observations were taken registeringimportant data regarding both growing andplant development during the period fromsowing to physiological maturity of the seeds.During the vegetative period biometrical determinationswere made concerning plant height,pod width, pod length and number of pods perplant.After pods harvest at the stage of seed physiologicalmaturity was computed the numberof seeds per plant as well seed weight per plantusing an electronic balance. Production datawere processed statistically by the method ofvariance analysis for polifactorial trials with thetwo factors placed in subdivided plots. Test ofsignificance of the results was assured by theaid of F test for a global evaluation and withDL for evaluation of significance of everydifference individually (Saulescu et al., 1967).RESULTS AND DISCUSSIONSThe trait “number of seeds per plant” isimportant because it determines theproductivity of the variety. It is directlycorrelated with the character “number of podsper plant”.By comparing the average seed yield of thethree varieties taken as control yield, thehighest yield was obtained at the varietyDelicioasa de Pasarea (2.9 t/ha) and thelowerest at the variety Margareta (1.7 t/ha) andthe yield difference were very significant(Table 1).Table 1. Influence of the variety on seed production indwarf French bean, 2012VarietyAverageRelativeyieldSignificanceyield (%) (t/ha)(t/ha)Delicioasade Pasarea2.9 126.1 +0.6 xxxFantastica 2.4 104.3 +0.1 -Average ofvarieties2.3 100.0 -Margareta 1.7 73.9 -0.6 000DL5%=0.25t/ha; DL1%=0.34t/ha; DL0.1%=0.46 t/haComputing average yield of seed obtained bytreatment with the four biostimulators,irrespective of variety, only Cropmax productgave distinct significant gains of 2.7 t/ha bycomparison with control untreated variant(Table 2).Table 2. Influence of the treatments with biostimulatorson seed production in dwarf French bean, 2012BiostimulatorAverageyield(t/ha)Relative Difference Significanceyield (%) (t/ha)Cropmax0.1%2.7 135.0 +0.7 xxKendal 0.2% 2.6 130.0 +0.6 xBenefit PZ0.3%2.2 110.0 +0.2 -Viva 0.4% 2.1 105.0 +0.1 -Controluntreated2.0 100.0 -DL5%=0.49 t/ha; DL1%=0.71 t/ha;DL0.1%=1.06 t/haAverage yield of seeds for the varietyFantastica ranged between 2.0 t/ha (control V1)and 3.0 t/ha (variant treated with Cropmax0.1%, V4).For the variety Delicioasa de Pasarea thehighest seed production was obtained also atthe variant treated with Cropmax 0.1%, V5 (3.2t/ha) by comparison with control variant V2(2.6 t/ha).The variety Margareta gave a seed productionof 1.9 t/ha for the variant treated with Cropmax0.1%, V6 by comparison with control variantV3 (1.5 t/ha) (Table 3).35

Table 3. Interaction variety of dwarf French bean x biostimulators, 2012Fantastica Delicioasa de Pasarea MargaretaVarietyDifferenccancrenccancrenccanceSignifi-Diffe-Signifi-Diffe-Signifi-Biostimulator T/ha %T/ha %T/ha %Cropmax 0.1% 3.0 150.0 +1.0 xx 3.2 123.1 +0.6 - 1.9 126.7 +0.4 -Kendal 0.2% 2.9 145.0 +0.9 x 3.1 119.2 +0.5 - 1.8 120.0 +0.3 -Benefit PZ 0.3% 2.2 110.0 +0.2 - 2.8 107.7 +0.2 - 1.7 113.3 +0.2 -Viva 0.4% 2.1 105.0 +0.1 - 2.7 103.8 +0.1 - 1.6 106.7 +0.1 -Control untreated 2.0 100.0 - 2.6 100.0 - 1.5 100.0 -DL5%=0.66 t/ha; DL1%=0.93 t/ha; DL0.1%=1.34 t/haCONCLUSIONSUnder the weather conditions of the year 2012in the southern part of the country, treatmentswith biostimulators influenced seed yield indwarf French bean by increasing the seedproduction in comparison with variantsuntreated.The best results were obtained by treatmentswith Cropmax 0.1% (2.7 t/ha).The highest seed yield was obtained at thevariant treated with Cropmax 0.1% for thevariety Delicioasa de Pasarea (3.2 t/ha),followed by the variant treated with Kendal0.2% (3.1 t/ha) for the same variety.ACKNOWLEDGEMENTSThe paper presents data from the PhD Thesis inthe frame POSDRU/107/1.5/S/76888, projectfinanced from the European Social Fundthrough the Sectoral Operational Programmefor Human Resources Development 2007-2013.REFERENCESBernardis C. M., 2006. Study on effects of somebioactive substances on differentiation of the flowerbuds in eggplant. Doctor’s degree thesis. Universityof Agriculture-Iassy.Burzo I., Toma S., Craciun C., Voican V., Dobrescu A.,Delian E., 1999. Physiology of the growing plants,Volume 1. Physiological process in growing plants.Publishing House Enterprise Editorial-Publishing-Science-Chishinew.Ciofu R., Stan N., Popescu V., Chilom P., Apahidean S.,Horgos A., Berar V., Lauer K. F., AtanasiuN., 2003.Handbook of vegetable growing. CeresPublishing House-Bucharest, p. 572-602, 865-873.Darasteanu C.C., Paranici S., Nicolau C., Bagiu L., 2005.Implementation of bioregulators as modern imputs inprivate farms for lucrative agricultural technologies.New Publishing House E9-Bucharest, p. 202-211.Draghici E. M., 2006. Seed and plant production invegetable species. Atlas Publishing House PressSRL-Bucharest.Falticeanu M., 2004. Contributions for improvement offield growing technologies in some vegetable species.Doctor’s degree thesis. University of Agriculture-Iassy.Glaman Gh., Margine A., Tudor Z., 2002. The behaviorof some garden bean varieties in Baragan field.Scientific papers, UASVM Bucharest, Horticulture,p.81-86.Munteanu N., 1994.A comparative study of resistance atmain pathogens for some new sources of germoplasmin bean. Doctor’s degree thesis. University ofAgriculture Iassy.The European Biostimulants Industry Consortium, NewAG International, 2012, p. 26-29.Popescu V., 1996. Vegetable Growing-Volume1. CeresPublishing House, Bucharest.Saulescu N.A., Saulescu N.N., 1967. Experimental field.Scurtu I., 2001. Economy and technology of agriculturalcrops. Economical Independence Publishing House,p. 35-38, 74-79.Szilagyi L., 2002. Researches on heredity of somequantitative traits in bean and their correlations.Doctor’s degree thesis. UASVM Bucharest.Tofan M., 2004. A study on the main technological linksin seed cauliflower crop aiming its improvment.Doctor’s degree thesis. University of AgricultureIassy.Tigaieru D., 2009. A study on variability in the frame ofsome hybrid populations in French bean. Doctor’sdegree thesis. University of Agriculture Iassy.Voican V., Scurtu I., Costache M., Lacatus V., Stoian L.,Roman T., Dumitrescu M., 2006. Vegetable growingin open field. Phoenix Publishing House, p. 175-185.Voinea M., Andronicescu D., Poli V., Talpalaru E.,1971. Seed production in vegetable crops. CeresPublishing House, Bucharest, p. 13-46, 85-92.36

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653RESEARCHES CONCERNING THE RESISTANCE FROST OF THE TABLEGRAPE VARIETIES GROWN IN STEFANESTI-ARGES VINEYARDAbstractAdriana COSTESCU 1 , Liviu DEJEU 1 , Camelia POPA 21 University of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Marasti, District 1, 011464, Bucharest, Romania2 National Research & Development Institute for Biotechnology in Horticulture Stefanesti,Sos. Bucuresti - Pitesti, no. 37, CP 117715 , Stefanesti, RomaniaCorresponding author email: cosadriana@yahoo.comIn order to achieve this paper we have studied the freezing resistance and the effect of low temperatures over theviability of the winter shoots at certain grapevine varieties for the tablegrapes cultivated in the vineyard Stefanesti-Arges. The research concerned the varieties: Argessis, Golden of Stefanesti, Moldova, Augusta, Canner and clones:Muscat Adda 22 St., Perlette 10 St., grafted on Kober 5BB rootstock. The research took place in the period 2010-2012.As a result of the study, we have noticed the sensitivity of Perlette and Augusta varieties at the low temperatures of thewinter. We have presented data concerning the determining procedure of the percentage of viable shoots.Key words: table grapes, fertility, productivity, resistance.INTRODUCTIONThe experiment was conducted in 2010-2012,in the collection of INCDBH Stefanestiampelographic - Arges. The study was made ofgrape varieties and clones obtained andcultivated vineyard table Stefanesti. Vineyardarea is characterized by the followingecoclimatic elements Stefanesti: length of thegrowing season for grape-vines, on average177-178 days; The annual average temperature9.8-10.1ºC, global heat balance of vegetationperiod 3530ºC, 1350ºC useful heat balance;average temperatures of the warmest months(July, August 34,7ºC and 34,9ºC) insolationduration of vegetation period on average 1430hours; real heliothermic index of 1.86 duringthe growing season. Therefore fits well studiedvarieties in demand environmental and showedgood behavior even at lower temperatures.The soil is loamy collection is located, theaverage supply of phosphorus, potassium andslightly carbonated, with a slightly acid pH (6.2to 6.4). Rootstock used for grafting thesevarieties was Kober 5BB, planting distancebetween rows of 2.5 m and 1 m row betweenplants, resulting in a total of 4,000 vines / ha.As regards the geographical location, theStefanesti vineyard is located between 44°42’and 44°55’ northern latitude, at the southernlimit of the platform Candesti, in the contact37zone with Campia Romana. The viticulturalplantations are located at altitudes between 200and 415m, the maximal altitudes being theIzvorani Hill (415m) and the Pietroasa Hill(325m).MATERIALS AND METHODSIn the wine-growing practice on one hand andthe grapevine varieties amelioration operationson the other hand, it has been observed that, theheredity of the characters and features of newvarieties obtained by sexual hybridization aremore obvious, as the genitors are geneticallyfurther and have distant origins. In thecharacters of the first variety prevails.Following the manifestation and the degree ofhereditary variability for one or morecharacters, in the wine-growing practice, theresearch analyzes a series of charactersincluding: the growing force, the number ofgrapes on a grapevine, the production pergrapevine, the sugar quantity, the acidity of thegrape must, various maturation age, theresistance to diseases and pests, the resistanceto drought and frost, etc.In the present paper there have been tested fourvarieties of table grapes with differentmaturation ages under the aspect of theirresistance to the low temperatures in the years2010-2012.

Experimental scheme is situated in linearblocks with three variants 3 repetitions, eachrepetition with 12 stocks. Placing suchexperiences two-way 4x3 (varieties) and 2x3(clones) for each experimental year (2010-2012) was the same, taking into study twofactors, namely:Factor A - Variety, whichincludedgraduations:-a 1 Argessis;-a 2 Auriu de Stefanesti;-a 3 Moldova;-a 4 Augusta;-a 5 Perlette 10 St.-a 6 Muscat Adda 22 St-a 7 CannerFactor B - loads of fruit with differentiatedapplication of cutting bearing vineyards,which included graduations:-b 1 load of 15 eyes per vine fruit, cutting thedrill;-b 2 load of 20 eyes per vine fruit, cutting theheart;- of 25 eyes per vine fruit, cutting the string;RESULTS AND DISCUSSIONSGrape-vine buds lose their viability when thetemperature falls below -20 in winter... 22ºCfor wine varieties and below -18...-20°C at thetable (Damian et al, 2004; Dumitriu I.C., 2008).The meteorological data have been extractedfrom the database of the Stefanesti Institute,collected during the interval 1991–2010 (Figure1).Figure 1. Average temperatures (ºC) 1991-2010Grape vines can grow in the most commonareas as one of the most affected by lowtemperatures below resistance. Damage causedby winter frosts can reduce production bothquantitatively and qualitatively importanteconomic effects for both growers andwinemakers as, traders etc (Fennel A., 2004;Grecu V., 2010).Parallelism exists between the annual cycle oftemperature and annual biological cycle of thevine allowed for optimal thermal thresholds formain plant phenophases taken (Olteanu I.,2000).In order to diminish the impact of climatechange it is necessary to adapt the culturalpractices to the evolution of climate over time(Bucur M. et al, 2012).During winter quantities of starch accumulatedin strings begin to decrease and theconcentration of sugars begin to rise. Thesechanges are associated with the development offrost grape-vine. Readiness of the vine vinesfor winter can be appreciated by determiningcarbohydrate accumulated in strings.Throughout the winter synthesize starch thusincreasing the concentration of sugars in string,which is used as a barrier against injury causedby frost. Towards the end of winter there is areverse conversion of carbohydrates so that willhave high concentrations of starch and sugarsdecrease (Bennett J.S., 2002; Georgescu M etal., 1986; Matei P. et al., 2009).Table 1. Report wood / marrow and starch concentrationin the string, the varieties studied (average 2010-2012)Report StarchVarietiesVersionwood/marrow %V 1 0,27 4,3ArgessisV 2 0,25 4,1V 3 0,24 4,0Auriu de StefanestiV 1 0,25 5,2V 2 0,27 5,4V 3 0,23 5,8V 1 0,33 5,7MoldovaV 2 0,30 6,1V 3 0,31 6,3V 1 0,37 5,2Augusta (control) V 2 0,38 5,4V 3 0,35 5,0Dates on the ratio of the diameter of thewood/marrow and shows a correlation betweenthe size of the report and frost resistance of thevarieties studied. Thus the variety Moldova thereport was on average 0.31, the variety Augustaof 0.37 while Argessis and Golden Stefanesti38

varieties this ratio was 0.25, 0.27 respectively(Table 1). Hence the improved frost resistanceof varieties Argessis and Golden Stefanestiirrespective of the applied pruning.Table 2. Report wood / marrow and starch concentrationin the string, the clones studied (average 2010-2012)Report StarchClones Versionwood/marrow %V 1 0,34 5,1Perlette 10 St. V 2 0,30 5,4V 3 0,28 5,6Muscat Adda 22St.Canner (control)V 1 0,35 5,1V 2 0,31 5,3V 3 0,30 5,0V 1 0,35 4,8V 2 0,37 4,5V 3 0,30 4,6The clone Muscat Adda 22 St. this report wasfrom 0.31 to 0.35, the clone Perlette 10 St. from0.28 to 0.34. At the same time the control(Canner apiren variety) this ratio wasapproximate values of the two clones from 0.30to 0.37 (Table 2). This suggests that neitherwitness had chosen better behavior frost, so thetwo clonesirrespective of the applied pruningshowed almost the same values of the ratiowood/marrow.To assess the degree of fertility of a variety offertility coefficient calculated absolute andrelative (CFA CFR), and productivity is toacquire plant and fruit shape keep it on the hubuntil full maturity (Dumitriu I.C., 2008).Making grape-vine through severalphysiological phases represented by floralinduction, differentiation and outside bud,inside the bud, inflorescence growth, flowering,pollination and fertilization, the first fruits andbaking. All these steps must be carried outnormally for a good production and qualitydepend on the percentage of shoots that appearon the block (Iuoras R. and Pop N., 2000).Fertility and productivity are qualities thatcharacterize biological and technologicalagrobiological value variety and the grape-vine.Fertility and productivity are correlated witheach other and directly affect grape production(Stoian I. and Namolosanu I., 2006).Table 3. The fertility varieties and clones studied atINCDBH tefneti-Arge (average 2010-2012)VarietyTO OV TL LF NI CFA CFRArgessis 21 14 14 6 9 1,50 0,64Auriu de Stefanesti 25 17 17 13 19 1,46 1,11Augusta 16 15 15 9 11 1,22 0,30Moldova 28 17 17 8 8 1,00 0,47Perlette 10 St. 17 9 9 1 1 1,00 0,11Muscat Adda 22 St. 28 17 17 8 8 1,00 0,47Canner 22 13 13 4 4 1,00 0,31TO-total eye; OV-eye viable, TL-total shoots, LF-fertiletillers, NI-number of inflorescences, CFA-coefficient ofabsolute fertility, CFR-coefficient of relative fertilityThe highest value CFA was recorded in varietyArgessis (1.5) and the lowest in all varietieshad suffered from frosts of 2012 (Table 4). Thehighest value CFR was recorded in varietyGolden Stefanesti. (1.11) and lowest for clonePerlette 10 St. (0.11).Table 4. The losses of buds at varieties studied (2012)% losses of budsVarietyVersion2012V 1 35ArgessisV 2 32V 3 30V 1 30Auriu de Stefanesti V 2 28V 3 25V 1 59AugustaV 2 60V 3 55V 1 35MoldovaV 2 32V 3 30V 1 55Perlette 10 St.V 2 52V 3 50V 1 30Muscat Adda 22 St. V 2 35V 3 32V 1 60CannerV 2 62V 3 65Between the lower threshold of spring andautumn leaf fall that occurs when normalconditions, length of the growing season rangeswhich ranges from 153-225 days in Romania.(Oltenu I., 2000). Losses buds were evident invarieties Augusta (55-60%) and Canner (62-65%), regardless of the type of cut applied(Table 4).39

improvement especially laboratory staff fortheir support.REFERENCESFigure 2. Value of the temperatures (ºC) 2012Destructive temperatures, low temperaturelimits, the alternation and the duration of thislow temperatures, produced important damagesto grapevine in general and the table grapevarieties in particular (Stroe M et all, 2009;Stroe M. and Bucur M., 2012).The minimum temperatures in 2012 weresignificantly smaller in average years 1991-2010 (-20.9 0 C in February) (Figure 2).CONCLUSIONSDates on the ratio of the diameter of thewood/marrow and shows a correlation betweenthe size of the report and frost resistance of thevarieties studied. Hence the improved frostresistance of varieties Argessis and GoldenStefanesti irrespective of the applied pruning.Argessis variety, showed the lowest resistanceto frost it in hate -20.9ºC temperatures had aviability of 70% and variety Canner of 40%.Most resistant variety of the studied work wasArgessis with a viability of over 70%, so againshowed resistance to frost.Losses buds were evident in varieties Augusta(55-60%) and Canner (62-65%), regardless ofthe type of cut appliedACKNOWLEDGEMENTSThanks to National Research & DevelopmentInstitute for Biotechnology in HorticultureStefanesti-Arges for the material provided andthe possibility of conducting researchBennett J.S., 2002. Relationships between carbohydratesupply and reserves and the reproductive growth ofgrapevines. Thesis, Lincoln University.Bucur Georgeta Mihaela, Dejeu L., Cazan G., TanaseAna, 2012. Research concerning the influences ofclimate changes on grapevine. Scientific PapersSeries B. Horticulture, Vol. LVI, USAMV Bucuresti,p. 43-48.Damian Doina, Calistru Gh., Stoica Carmen, Savin C.,2004. Comportarea unor soiuri de struguri de masa,cu rezistenta genetica sporita, în conditiile podgorieiIasi, Analele ICVV Valea Calugareasca, vol. XVII, p.87-93.Dumitriu I.C., 2008. Viticultura. Editura Ceres,Bucuresti, p. 440.Fennell A., 2004. Freezing Tolerance and Injury inGrapevines, Journal of Crop Improvement, Vol. 10(1-2), p. 201-235.Georgescu Magdalena, Indreas Adriana, Dejeu L.,1986.Comportarea unor soiuri de struguri de masa si de vinobtinute la noi în tara si a unor soiuri cu rezistentebiologice, în conditiile iernii 1984/1985. Lucraristiintifice IANB, seria B, Horticultura, vol.XXIV.Grecu V., 2010. Îndrumatorul viticultorului amator.Soiurile rezistente de vita-de-vie si particularitatilelor de cultura. Editura MAST, p. 188.Iuoras R., Pop Nastasia., 2000. Îndrumator pentru lucraripractice la viticultura. Editura AcademicPress.Matei Petruta, Dejeu L., Mereanu Diana, 2009. Researchconcerning the influence of climate change ongrapevine. Bulletin of USAMV Cluj-Napoca,Horticulture, vol. 66 (1-2), p. 352-358.Olteanu I., 2000. Viticultura. Editura Universitaria,Craiova, p. 599.Stoian V. si Namolosanu I., 2006. Prelucrarea strugurilorsi producerea vinurilor. Editura Ceres Bucuresti.Stroe Marinela Vicuta, Ispas Sofia, Damian I., BucurGeorgeta Mihaela, 2009. Comparative study on thebehavior of clonal selection of the main varietiesgrown in the vineyard Pietroasa, Lucrari stiintifice,seria Horticultura, vol. 52, U.S.A.M.V. Iasi, EdituraIon Ionescu de la Brad, Iasi, p. 743-748.Stroe Marinela Vicuta, Bucur Mihaela, 2012. Studyregarding the influence of low winter temperaturesbetween 2011-2012 on the viability of winter buds ofsome table grape varieties in the conditions of thedidactic experiemental field in Bucharest. Scientificpapers Series B. Horticulture, vol. LVI, p. 181-185.40

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653AbstractTHE INFLUENCE OF TECHNOLOGICAL FACTORSON THE PRODUCTION AND QUALITY OF THE PEPPERSimona Elena DIMACHE (BOBOC), Nicolae ATANASIU, Gheorghe CÂMPEANU,Gabriela NEA, Claudiu BOBOCUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Marasti Blvd, District 1, 011464, Bucharest, RomaniaCorresponding author email: simonaelena.dimache@yahoo.comThe pepper, highly nutritious vegetable species is sensitive to alterations of the vegetation factors that may influenceboth commercial fruit quality and their content in carbohydrates, vitamin C and other biochemical components. Fullpaper shows the modifications and / or production dynamics and its quality in some cultivars of pepper in field cropsfrom two dedicated areas: vegetable basin Silistraru (Braila) and Vidra (Berceni) Ilfov county, within some experiencesregarding the allocated space for plants, their nutrition regimes and harvesting time. The researches were carried outwithin doctoral thesis in POSDRU/107/1.5/S/76888.Key words: Commercial quality, cultivars, field peppers, food quality.INTRODUCTIONPepper is cultivated for its fruits, which havemany uses in human nutrition, such fresh, andprepared or preserved (Stan et al., 2003).Pepper fruits have a particular importance,considering the fact that you can eat fresh, assuch, vitamins being fully utilized by the body(Ceausescu et al., 1984).Pepper is considered a concentrate of vitaminseasily assimilated by the human body. Amongthe vitamins, vitamin C comes first. From somestudies conclude that mature pepper contains 4-6 times more vitamin C than lemon juice ororange juice (Ceausescu et al., 1984).Pepper has twice as much vitamin C thanlemon and twice as much vitamin A (630 IU)than butter (Dumitrescu et al., 1998).Undertaken research purpose: to establish how,fruit maturity evolution technique at physiologicalmaturity influence the commercialquality and food importance of pepper fruitsgrown in the field.MATERIALS AND METHODSTo achieve this experience were studiedvariants shown in Table 1.Table 1. Experimental variants. Peppers for fresh consumption,vegetable basins Silistraru Braila and Berceni Ilfov – 2012Var.no. Area of culture (A) Var.no. Time of harvest (maturity) (C)1(mt1)Technical maturity (c1)Bianca F1 (b1)2 SilistraruPhysiological maturity (c2)3BrailaTechnical maturity (c1)Atris F1 (b2)4 SilistraruPhysiological maturity (c2)5BrailaTechnical maturity (c1)California Wonder F1 (b3)6 Physiological maturity (c2)7(mt2)8Bianca F1 (b1)Technical maturity (c1)Physiological maturity (c2)910BerceniIlfovAtris F1 (b2)Technical maturity (c1)Physiological maturity (c2)1112California Wonder F1 (b3) Technical maturity (c1)Physiological maturity (c2)41

Table 1 shows the type 2x3x2 trifactorialexperience with 12 variants, with the followinggraduations.Experimental factor A - Areal has two graduations:a1 - Silistraru vegetable basin Braila a2 -Ilfov Berceni vegetable basin Experimental factorB - Cultivar, has three graduations: b1 - BiancaF1 b2 - Atris F1 b3 - California Wonder F1Experimental factor C - Time of harvest hastwo graduations: c1 - technical maturity of fruitc2 - physiological maturity of the fruit.The biological material used in experience iscomposed of three cultivars.Bianca F1, a pepper grown successfully inRomania, very early with good capacityfructification, large fruits white-yellow color.Atris F1 early hybrid and highly productive,ripening from green to red. Long fruit withthick pulp is suitable for growing in the fieldand/or solarium. Good taste is juicy at technicalmaturity and also at its physiological.California Wonder F1 hybrid with undeterminedgrowth and long cycle of culture. Beforematurity fruits have green color and atphysiological maturity red color, the pericarpthick and juicy.Specific technology applied to experienceincluded the following groups of works andtechnical parameters (Atanasiu N., 2005).Works in autumn - abolishing pre-culture, basicfertilization with superphosphate simple 3 kgper 100 m 2 (300 kg/ha) deep autumn plowingwith incorporation of crop residues andsuperphosphate.Foundation work, care and harvesting of crops:Experience planting on 15 May 2012, byplanting seedlings rarely without transplanters,produced in solarium with nutrient mixturelayer placed on fresh manure aged 60 days to70 cm between rows and 20 cm between plantsin the row, providing density 71 400 plants/ha(Neata G., 2002).Care of the most important works we mentionintegrated weed combat by herbicides combinedwith hoeing treatments to prevent/combatdiseases and pests and crop specific area(Cristea S. and Neata G., 2004).Fertilization was performed using solublecomplex fertilizers Universol type, with highercontent in nitrogen (blue Universol) until thefirst fruits and higher potassium content(Universol purple) during fructification(Neamtu G. et al.).RESULTS AND DISCUSSIONSInto experience were made observations andmeasurements, after which they were establishedthe following results.Table 2. The average weight of fruits (g). Silistraru Braila, Ilfov Berceni, 2012CultivarTechnical maturityGrams of fruitDifferencesBianca F1 149,4 X +Atris F1 153,7 + +California Wonder F1 168,4 + +Bianca F1 141,2 - XAtris F1 136,2 - -California Wonder F1 149,5 - -The average fruit weight varied for analysiscarried out from 153.7 g registered at the AtrisF1 cultivars, up to the value of 168.4 g atCalifornia Wonder F1 witness against BiancaF1 149.4 g.The differences are small and without statisticalcoverage.Table 3. The dry matter content. Silistraru Braila, Berceni Ilfov, 2012Technical maturityPhysiological maturityCutivarSilistraru Berceni Silistraru BerceniBianca F1 4.50% 4.35% 4.65% 4.47%Atris F1 5.30% 5.15% 5.45% 5.32%California Wonder F1 3.80% 3.65% 3.95% 3.77%42

During the experiments and analyzes performednoted Atris F1 hybrid with a dry mattercontent of 5.45% at its physiological maturityin experimental conditions Silistraru, Braila.The dry matter content increases from technicalmaturity to physiological.Table 4. The pericarp thickness. Silistraru Braila, Berceni Ilfov, 2012Technical maturityPhysiological maturityCutivarSilistraru Berceni Silistraru BerceniBianca F1 4.86 mm 4.64 mm 5.15 mm 4.95 mmAtris F1 4.54 mm 4.41 mm 4.65 mm 4.48 mmCalifornia Wonder F1 7.15 mm 6.94 mm 7.30 mm 7.15 mmDuring this research, the pericarp thicknessranged from 4.54 mm minimum value at AtrisF1 (technical maturity, Silistraru) to 4.86 mmin case of Atris F1 cultivar (technical maturity,Silistraru) and 7.15 mm at cultivar CaliforniaWonder F1 (technical maturity, Silistraru) Thedifferences were smaller when cultivars inBerceni, Ilfov because culture conditions.Table 5. Vitamin C content. Silistraru Braila, Berceni Ilfov, 2012Technical maturityPhysiological maturityCutivarSilistraru, Braila County Berceni, Ilfov County Silistrar, Braila County Berceni, Ilfov CountyBianca F1 131,90 mg/100 g s.p. 126,1 mg/100 g s.p. 139,12 mg/100 g s.p. 135,41 mg/100 g s.p.Atris F1 152,44 mg/100 g s.p. 146,32 mg/100 g s.p. 156,28 mg/100 g s.p. 150,17 mg/100 g s.p.California Wonder F1 118,40 mg/100 g s.p. 109,2 mg/100 g s.p. 125,60 mg/100 g s.p. 119,12 mg/100 g s.p.Vitamin C content recorded the highest valuesin case of cultivar Atris F1 and lowest in caseof cultivar California Wonder F1. Values increasedfrom technical maturity to physiologicalmaturity and are higher in cultivarsfrom Silistraru Braila due to culture conditionsand superior technology.CONCLUSIONSBased on the experimental results held thefollowing conclusions can be drawn:Among the cultivars used in experience standsin terms of average fruits weight with 168.4 gthe hybrid California Wonder, which exceedsthe average weight of fruits witness Bianca F1(149.4 g).The pericarp thickness increases from technicalmaturity to physiological all cases, and towardsthe witness Bianca F1 (5.15 mm, physiologicalmaturity) in experimental conditions Silistraru,Braila County, the hybrid California WonderF1 is distinguished with 7.30 mm (to physiologicalmaturity).Vitamin C content increases from technicalmaturity to physiological maturity and thehighest values we meet at Atris F1 hybrid inexperimental conditions in Silistraru, Braila.In the experiments is remarkable growth indicators:solids content, vitamin C content andthickness of the pericarp cultivars whencompared with cultivars Silistraru Braila inBerceni, Ilfov due to culture conditions andtechnology used.Pericarp thickness and chemical compositionensures a balanced of fruit succulence andparticularly flavor, it recommends the consumptionof fresh and preserved condition.ACKNOWLEDGEMENTSThe researches were carried out withindoctoral thesis in POSDRU/107/1.5/S/76888.REFERENCESAtanasiu N., 2005. Field crops for consumption of freshpeppers, Atar Publishing House, Bucharest.Ceausescu I., Balasa M., Voican V., Savitchi P., RaduGr., Stan N., 1984. General and special vegetable,Didactics and Pedagogical Publishing House,Bucharest.Cristea Stelica, Neata Gabriela, 2004. Fertilizationmaterials and plant protection products, AMDVeterinary Medicine Bucharest.Dumitrescu M., Scurtu I., Stoian L., Glaman Gh.,Costache M., Ditu D., Roman Tr., Lacatusu V., VladC., Zagrean I, 1998. Production of vegetables,Artprint Publishing House, Bucharest.43

Neamtu G., Gheorghe Campeanu, Carmen Socaciu,1995. Vegetable biochemistry, Didactic and PedagogicPublishing House, Bucharest.Neata Gabriela, 2002. Agro-chemistry and soil biology.Printech Publishing House, Bucharest.Stan N., Munteanu N., Stan T., 2003. Vegetable growing,Vol. III, Ion Ionescu de la Brad PublishingHouse, Iasi.44

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653AbstractRESEARCH CONCERNING EFFECTS OF PERLITE SUBSTRATEON TOMATO IN SOILLESS CULTUREElena Maria DRGHICI, Maria PELE, Elena DOBRINUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Marasti Blvd, District 1, 011464, Bucharest, RomaniaCorresponding author email: elena.draghici@horticultura-bucuresti.roIn Romania, soilless culture method in perlite substrate for tomato crop is still in early stages. Few farmers practicethe culture on perlite substrate. Soilless cultures have many advantages such as increased yield, health and uniformproduct, conservation of water and land, better protects an efficient control of environmental pollution and reduce ofworkers for cultivation.The aim of this study was effects of perlite substrate on tomato yield and fruit quality in soillesscultivation.This study has done in the Hortiviticultural Systems Bioengineering Department, University of AgriculturalSciences and Veterinary Medicine-Bucharest. Tomato culture was founded on mattresses filled with perlite.Experimental variants were the type of size particle of perlite from mattress. The mattresses had provided a volume of10 l perlite / plant. We used three types of grain of perlite of 2 mm, 4 mm and 5 mm. The best results were obtainedwhen using perlite as substrate grain 4 mm.Key words: perlite substrate, tomatoes, size grain.INTRODUCTIONSupply the market with fresh vegetables is apriority with economic and social implication.Therefore, the researchers are permanentlyconstrained to finding new modern growingtechnology, perfumed that to assure a highproduction (Abrar, 2011).The most frequently unconventional systemsare the systems of vegetables growing onGrodan and NFT systems.Extending these culture systems have somedrawbacks such as the rock wool culture systemrequires enormous quantities of thismaterial, material subsequently back intocirculation very difficult and NFT systeminvolves rearranging production facilities byinstalling gutters, an operation that is verycostly financially.In view of the above, it is necessary to developtechnologies that are not expensive, can bemade with cheap materials and handy, but atthe same time ensuring high productivity bothquantitatively and qualitatively.The culture of perlite substrate has two majoradvantages: it is very accessible from economicallywithin the global trend as organic(Draghici et al., 2012).In the global horticultural production, vegetablecrops 'without soil' had begun already gain aleading position. These unconventional systemsof culture are great interest both for researchersand for those who practice in order to achieveproducts for human consumption.In Romania, expansion of these systems raisesserious technical and economic issues, so it isnecessary to establish culture technologies applicable,using local materials and equipmentimported or to be accessible to a larger numberof users (Atanasiu N., 2009).Extending this systems create some problemsreferring to polluting because the Grodan is asubstrate that is difficult to recycled.Purpose of research in this study was to identifythe best composition based on perlitesubstrate and recommend it to obtain early andtotal yields, quality and price of low cost.Expanded perlite is a substrate of culture thatcompletely replaces soil.MATERIALS AND METHODSThe experiment was carried out in the vegetablesector in Bucharest, Faculty ofHorticulture.The biological material used was the hybridtomato Gaheris.45

Experience consisted of the following experimentspresented in Table 1.Table 1. Experimental variantsVariants Substrate typesGrowingV1 Control Growing on soilGrowing onV2 Perlite 2mmmattresses50% Perlite of 2mm and Growing onV350% peatmattressesGrowing onV4 Perlite 4mmmattressesGrowing onV5 Perlite 4mm+peatmattressesGrowing onV6 Perlite 5mmmattressesGrowing onV7 Perlite 5mm+peatmattresses- determine the number of inflorescences andflowers in blossom;- percent of binding of fruit;- early production;- the quantity of fruit harvested per plant;- the average fruit per harvest;- the total production;Fruit production was determined by weighing.For each determination was made statisticalanalysisRESULTS AND DISCUSSIONSFrom the figure 1 we can see in dynamic thegrowing of plants on the experimental variants.Culture was established in unheated solarium.Of each variant we use four mattresses of 1 mlong for each where we had planted each threeplants. In total, 24 mattresses were installed.The distance between the mattresses was 90 cmand 35 cm between plants. Therefore, for eachplant we had assured 10 l perlite substrate. Mattresseshad contained 30 l of substrate. Plantdensity was 31,746 plants per ha.Hydroponics mattresses were made of biodegradablepolyethylene, triple laminated, composedof two layers, colored black inside andwhite outside. Mattresses have a length of 1 mand a width of 20 cm. The experiments wererealized on some mattresses prototype createdby SC Procema SRL, Romania.The fertilizing recipe was modified withphenophase. In the first phenophase, immediateperiod after planting, for each plant we gaveamount 50 ml of solution per fertigation-for 2weeks.Daily we had administrated a number of sixwatering.I increased the amount of solution per plant asthe plants increased in height, so had administratedbetween 100 ml and 200 ml dependingon temperature and light.Measurements and determinations made.During the growing season were conductedobservations and determinations so:- increase in plant height;- number of leaves;- number of leaves until the first inflorescence;- number of leaves between inflorescences;- average distance between inflorescences;46Figure 1. Dynamic growing in height of tomato plantsTotal number of the flowers and fruits formedon inflorescences are presented in table 2.Table 2. Total number of the flowers and fruits formedon inflorescencesVariants Inflorescences 1st 2nd 3rd 4th 5th 6thNo. Flowers 9 9 7 7 9 9V1No. fruits 5 5 4 4 3 3No. Flowers 9 9 9 9 11 14V2No. fruits 5 06.05 04.05 02.05 2 7No. Flowers 9 9 9 08.05 7 9V3No. fruits 6 3 5 05.05 02.05 4No. Flowers 8 9 9 7 7 7V4No. fruits 8 4 6 3 7 5No. Flowers 7 9 7 9 5 5V5No. fruits 7 0 4 3 4 1No. Flowers 11 7 5 6 6 5V6No. fruits 6 7 4 2 3 3No. Flowers 7 9 7 7 7 10V7No. fruits 5 6 4 1 0 5In the table no 3 is noted that the highestpercentage of binding occurs in variant no 4

with 70.21% as compared to Control, Variantno 1, were the percentage of binding was 48%.A large percentage of fruit we had obtained atthe V6 about 62.5% and 50.49% at the V3.The variants 2, 5 and 7 we had registered apercentage below 50%.Table 3. Total number of flower and fruits formatted onplant and percentage of bindingVariantsTotal flowers Total fruitsformatted on formatted onplant plantPercentage ofbindingno. no. %V1 Control 50.0 24.0 48V2 Perlit2mm61.0 27.mai 45.08V3 Perlit2mm+peat51.5 26.0 50.49V4 Perlit4mm47.0 33.0 70.21V5 Perlit4mm+peat42.0 19.0 45.24V6 Perlit5mm40.0 25.0 62.5V7 Perlit5mm+peat47.0 21.0 44.68Average 48.36 25.ian 51.85At the first harvesting, are not existingdifferences between variants except the V2where I remarked a positive significancestatistic point and view (Table 4).Variant 2 we harvested 10 fruits with weight offruit of 117 g and at the V5 we harvested only 3fruits per plant with an average of 127 g fruit.Table 5. The number of fruit and average mass of fruit atthe first harvestingVariantsNumber of fruitsobtained on plantno.Products onplantsg/plantAverage massof fruitsgV1 4 400.0 100.00V2 10 1173.0 117.30V3 6 762.5 127.08V4 4 470.0 117.50V5 3 381.5 127.17V6 6 665.5 110.92V7 7 857.0 122.43In the table 6 are presented production, numberof fruits and the average mass of fruit obtainedon plant at the second and last harvested. Wecan remark that at the second harvest, thehighest production had obtained at the V2(1320.4 g/plant) and smallest production at theV6 (920.0 g/plant). In average the mass of fruithad varied between 117.5 g/fruit at V4 and125.0 g/fruit at the V3 (the second harvest). Atthe last harvest were recorded 1322.40 g/plantat the control (V1). In addition, we can observethat at the last harvest the fruit mass wasbetween 101.5 g/fruit at the V2 and 120.0g/fruit at the V7.Table 4. Fruits mass at the first harvest VariantsFruits mass Differences Significancekg Kg %V1 0.40 0.00 100.0 MtV2 ian.17 0.78 295.09 *V3 0.76 0.37 191.82 NV4 0.47 0.07 118.24 NV5 0.38 -0.02 95.97 NV6 0.67 0.27 167.42 NV7 0.86 0.46 215.60 NAverage 0.67 0.27 169.16 NDL5%=0.520 DL1%=0.780 DL01%=1.250 At the first harvest, were collected from V1four fruits with 100g in average fruit.Production obtained from this variant had thelowest referring to average mass (Table 5).Most fruits were harvested from V2. Wereharvested an average of 10 fruits per plant, withan average mass of 117 g on fruit. The largestfruits were harvested at 3 and 5 variants with127 g average fruit. Of all the variants at the47Table 6. The production obtained at the second and thelast harvestedThe second harvest Last harvestProducts Average Products AverageNoNo.Variants on mass on on mass onfruitsfruitsplants fruit plants fruitg/plant No. g g/plant No. gV1 942.4 8 117.8 1322.4 12 110.2V2 1320.0 11 120.0 659.75 06.mai 101.5V3 1250.0 10 125.0 1150.0 10 115.0V4 1645.0 14 117.5 1545.0 15 103.0V5 1089.9 9 121.1 821.10 7 117.3V6 920.0 8 115.0 1265.0 11 115.0V7 964.0 8 120.5 720.00 6 120.0The production obtained during a month was at3.66 kg on the plant at V4 and 2.292 kg on theplant at V5 (Table 7).The highest percentage was recorded at V7 andthe lowest at V3, compared to the control,table 7.

Table 7. Total production on plantVariantsTotal on plantg/plantPercent to control%V1 2662.80 100.00V2 3152.75 118.40V3 3162.50 118.77V4 3660.00 137.45V5 2292.50 86.09V6 2850.50 107.05V7 2541.00 95.43CONCLUSIONSOn the plant were six inflorescences formattedin three months after planting on perlitesubstrate.The number of fruit on inflorescences variedbetween 3 at the fifth and sixth cluster and fiveat the first and second clusters (V1 control).The best results were obtained when usingperlite as substrate grain 4 mm of 3.66 kg onthe plant.ACKNOWLEDGEMENTSThis work was supported by a grant of theRomanian National Authority for ScientificResearch, CNDI–UEFISCDI, financed fromproject number PN-II-PT-PCCA-2011-3.2-1351 - Contract No.68/2012. The perlite andmattresses were obtained with help of managerSomacescu Claudiu of SC PROCEMAPERLIT SRL, Romania.REFERENCESAbrar Hussain Shah, Shams Ul Munir, Noor-Ul-Amin,Safdar Hussain Shah, 2011. Evaluation Of TwoNutrient Solutions For Growing Tomatoes In A Non-Circulating Hydroponics System, Sarhad J. Agric.Vol.27, No.4.Atanasiu N., 2009. Culturi horticole fara sol, ed. Ceres.Draghici E.M., Pele M., 2012. Evaluation some newhybridsfor cultivation in convetional system inspring climatic conditions of Romania, InternationalJournal of Agriculture Science, ISSN 095-3710&ISSN 0975-9107, volume 4, p. 299-305.48

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653INFLUENCE O THEPEST CONTROL METHODS OVER THE USEFULENTOMOFAUNA WITHIN THE VITICULTURAL ECOSYSTEMAbstractIoan ENOIU 1 , Lidia FÎCIU 2 , Sonia DROSU 31 Naturevo Ltd, St. Ion Urdareanu, no 34, Sector 5, Bucharest, Romania2 Research and Development Institute for Viticulture and Winemaking, St. Mantei,Calugareasca Valley, Romania3 Institute of Plant Protection Research and Development, Bd Ion Ionescu de la Brad, no. 8Dictrict 1, 013813, Bucharest, RomaniaCorresponding author email: john.enoiu@naturevo.roThe paper presents the influence of the differential methods to control pests and diseases of vines, respectively chemicalcontrol, biological and integrated, over the useful and harmful in a entomofauna vineyard ecosystem. Experimentaldata obtained showed that the abundance entomofauna (useful and harmful) presented higher values for biologicalcontrol and integrated methods compared to chemical control method. Integrated control, especially chemical, causeda reduction of 4% and 17% in the number of the useful insects compared to the biological control method. The ratiobetween useful and harmful entomofauna recorded in May and June had an average of 1.1, with an upward trend in theuse of biological control method and decreasing for integrated control, especially the chemical. Useful entomofaunarecorded lower values than the harmful for all control methods used, which proves that useful pests are more sensitivethan the harmful ones after application.Key words: methods of pest control, viticulture, useful entomofauna.INTRODUCTIONA full management of viticultural ecosystemcan not be achieved without a reconsiderationof the whole system based on a design thattakes into account both ecological pestknowledge and their destructive potential andcomplex adoption of the most appropriatemeasures for the natural control of the harmfulspecies (Coulon et Sentenac, 2001; Dejeu et al.,2005; Fregona, 2005). Parasites and predatorsof the existing natural background in eachecosystem wine is by far one of the mostimportant natural biotic factors limiting thepopulations of the harmful pests (Perju et al.,1988). Some technological sequences used invineyards, especially treatments of diseases andpests of vines, can influence in an obviousmanner the diversity and numerical abundanceof natural predators populations, with directimplications in maintaining the natural balancewithin the wines ecosystem.Based on these considerations the paper aims topresent the influence of differential methodsof pests and diseases control in vines over theuseful and harmful entomofauna existing in avineyard ecosystem.MATERIALS AND METHODSResearch has been carried out within a vineyardhaving planting distances: 2.0/1.0 m placed intoterraced slope conditions arranged in terraceswide (width 17.2 m, 8 rows of vines). Thebiological material was represented byMerlot/SO4-4 variety.They were experienced 3 differentiated methodto control pests and diseases of the vines,namely:-Chemical control based on the use of contactand systemic insecticides;-Biological control based on the use of ofcopper, sulfur and bioinsecticides;-Integrated control based on the use of lessharmful insecticides, accepted internationallyfor the integrated pest management invineyards to which were added biotechnicalmeans and bioinsecticides.To collect biological material that representsthe useful and harmful entomofauna of the49

vineyard, several methods were useddepending on the targeted species, namely:-Barber traps, which is the classical method forcollecting mobile arthropods on the ground;-Shaking technique that allows collectinguseful and harmful entomofauna by shakingvegetative organs above an entomological net;-Method of leaf samples, allowing an estimateof the entomophagous populations from theleaves.Measurements were made at an interval of twoweeks between May and June. Afterharvesting the samples samples were broughtto the laboratory and analyzed the binocularloupe and microscope to identify the presentspecies. Identified species were classified intotaxonomic groups: orders, families and genus.The relative abundance and the number ofspecies that encounter the the useful and theharmful entomofauna specific for the vineyardecosystem was studied, the subject to the typeof the treatment.Based on the data we have got calculated theratio between the two components of vine pestsand predators respectively.RESULTS AND DISCUSSIONSBased on the role and the importance ofpredators into two vineyard ecosystem, amapping of the vine pest for the three methodsdifferentiated, on diseases and pest control invineyards was concluded.Arthropod fauna collected by means, duringMay-June in the experimental plots,amounted a total of 810 insects. out of these,430 were harmful insects, representing 53.1%and 380 formed entomophagous population,representing 46.9% of the total. The reletiobetween the two populations was 1.13.Function to the pest in the species vineyard,arthropods were divided into two groups: (i)harmful fauna (phytophagous pest that feed ondifferent parts of plants and (ii) useful fauna(parasitoids and predators, whose regime iscarnivorous diet).Harmful species were included into 7 orders:Orthoptera, Thysanoptera, Heteroptera,Homoptera, Coleoptera, Lepidoptera andDiptera and 13 families: Catantopidae,Gryllidae, Thripidae, Miridae, Pentatomidae,Cicadellidae, Aphididae, Elateridae, Halticidae,Bruchidae, Curculionidae and Geometridae (forDiptera, suborder Brachycera).Beneficials were separated into predators andparasites. Predators were included in 7 order:Aranea, Dermaptera, Heteroptera, Neuroptera,Hymenoptera, Coleoptera, and Diptera in 6families. Parasites Hymenoptera belonge to twosuperfamilies, Chalcidoidea andIchneumonoidea. Ants present in a largenumbers were included into Formicoidealsubfamily.The taxonomic classification of the faunacollected specific to the vineyard ecosystemstudied is presented in Table 1.Table 1. Taxonomic classification of the fauna collectedfrom the viticultural ecosystem studied Harmful fauna Useful fauna1. Ord. ORTHOPTERAFam. CatantopidaeCaliptamus italicus L.Fam. GryllidaeGrilus campestris L.Melanogryllus desertusPallas2Ord. THYSANOPTERAFam. Thripidae3. Ord. HETEROPTERAFam. MiridaeLygus sp.Fam. Pentatomidae4. Ord. HOMOPTERAFam. CicadellidaeFam. Aphididae5. Ord. COLEOPTERAFam. ElateridaeFam. HalticidaeFam. BruchidaeFam. Curculionidae6. Ord. LEPIDOPTERAFam. Geometridae7. Ord. DipteraSubord. Brachycera1. O. ARANEAE2. O. DERMAPTERAFam. ForficulidaeForficula auricularia L3. HETEROPTERAFam. AnthocoridaeOrius sp.4. NEUROPTERAFam. ChrysopidaeChrysoperla carnea Steph.5. O. HYMENOPTERASuprafam. ChalcidoideaSuprafam.IchneumonoideaSuprafam. Formicoidea6. Ord. COLEOPTERAFam. CoccinellidaeCoccinella 7-punctata L.Propylea 14-punctata L.Stethorus punctillumWeiseFam. Staphilinidae7. Ord. DIPTERAFam. TachinidaeThe structure and relative abundance andnumber of species that form the harmful faunapopulation specific for the vineyard ecosystemstudied, function of the types of managementregarding the control of the agents on theentire collection period (May-June), ispresented in Table 2.The experimental data obtained, indicate adifference in the number of species collected offunctions of the three types of pestmanagement. Thus, it may be noted that theversion where we used the biological control of50

pest agents, that have been used substancesbased on Cu and S + bioinsecticides wascollected the largest number of copies ofharmful artopode (174 insects), followed by theversion where were used the integrated control(less harmful chemicals + biotechnical means+ bioinsecticides) (152 insects) and variantwho underwent chemical control (104 insects).This is the result of the less toxic effect of theproducts used for the biological control, andeffect of more toxic chemicals used forchemical control. Integrated control place, theabundance of pests on an intermediate position.In terms of the structure of pests, the situationis different on the three pest control methods.In the version with chemical control, thehighest level was occupied by the insects of theorder Coleoptera (51.0%), followed byHomoptera (30.8%) and Orthoptera (11.5%).The remaining 6.73% counted Thisanoptera,Heteroptera, Lepidoptera and Diptera.Whole, pests collected from the chemicallytreated, is below the threshold harmful to thevines. Noticeable is that Ciccadellidae family,wich require careful follow-up for future, giventhat in Europe there are several species ofmycoplasmas carried by these vectors invineyards (eg Scaphoideus titanus, Metcalfapruinosa). Fortunately,these micoplasmas havenot been identified so far in our country.In the variant of biological control, there aretwo groups close to each other: Homoptera andColeoptera occupy 44.3% and 30.5% in thestructure of the pest, followed by Heteropteraand Orthoptera 12.1% and 9.2%.In the version with integrated control, fourgroups of insects occupy close structural levels,as follows: Homoptera (38.8%), Coleoptera(22.4%), Orthoptera (20.4%) and Heteroptera(14.5%).Table 2. Structure and relative and numeric abundance of the harmful insects subjects to the controlling method.Chemical control Biological control Integrated controlToxonomy classificationNr ex. % Nr ex. % Nr ex. %1. Ord. ORTHOPTERA 12 11.5 16 9.2 31 20.42. Ord. THYSANOPTERA 1 1.0 3 1.7 0 0.003. Ord. HETEROPTERA 0 0.0 21 12.1 22 14.54. Ord. HOMOPTERA 32 30.8 77 44.3 59 38.85. Ord. COLEOPTERA 53 51.0 53 30.4 34 22.36. Ord. LEPIDOPTERA 2 1.9 1 0.6 3 2.07. Ord. DIPTERA 4 3.8 3 1.7 3 2.0TOTAL 104 100 174 100 152 100To be noted that all versions include Orthopteragroup, represented by crickets andgrasshoppers, whose presence is justified by thevariety of spontaneous vegetation surroundingthe vineyard ecosystem (Table 3).Useful entomofauna specific for a vineyardecosystem, where three types of pest wereapplied is presented both as structure and asnumber and relative abundance into the Table4.Analyzing the useful entomofauna collectedfrom the vineyard ecosystem under the threemethods of pest control, as in the case of theharmful fauna, we found the same trend: thelargest number of beneficial being collectedfrom biological control version (214 insects),followed by integrated control variant (102insects), while fewer individuals were recordedin chemical control version (64 insects).Table 3. Numerical distribution of the harmfulentomofauna differentiated by the methods applied forpest control in vineyardToxonomy Chemical Biological Integratedclassification control control controlOrd.ORTHOPTERA4 7 12Ord.THYSANOPTERA1 1 0Ord.HETEROPTERA0 10 9Ord. HOMOPTERA 14 25 11Ord.COLEOPTERA17 20 15Ord.LEPIDOPTERA0 0 2Ord. DIPTERA 0 2 0TOTAL 36 65 4951

Table 4. Structure and number and relative abundance ofentomophagous population under different type of pestcontrolToxonomy Chemical Biological Integratedclassification control control control No. % No. % No. %1. Ord. ARANEA 18 28.1 34 15.9 33 32.32. Ord.DERMAPTERA15 23.4 41 19.2 12 11.83. Ord.HETEROPTERA0 0.0 6 2.8 2 2.04. Ord.NEUROPTERA1 1.6 7 3.3 5 4.95. Ord.COLEOPTERA7 10.9 37 17.3 16 15.76. Ord. DIPTERA 1 1.6 9 4.2 3 2.97. Ord.HYMENOPTERA22 34.4 80 37.4 31 30.4TOTAL 64 100 214 100 102 100The beneficial insects were lower as number,but the number of species was higher. As astructure, the highest percentages wereoccupied by ants Hymenoptera group, 37.4%(biological control), 34.4% (chemical control)and 30.4% (integrated control). Ants, althoughthey are not recognized as major predators inthe agroecosystems, are big consumers of freshdejections secreted by some insects, mainlyaphids, and insect remains underdecomposition.A group of predators of a great importance inlimiting the multiplication of pests are beetlesof the family Coccinellidae, Coccinella andStetorus genres. They have occupied thehighest percentage in the alternative ofbiological control structure (17.3%), followedby integrated control option (15.7%) andthen chemical variant (10.9%).Noteworthy are the groups of Aranea (spiderspredators) and Dermaptera (earwig), whichachieved levels between 15.9-32.4% and 11.8-23.4%. Both groups of predators feed on smallinsects (aphids, mites) present on variousvegetable substrates vines, respectivelyspontaneous vegetation. Earwig might producedamages in grapes at harvest time, but withoutthe grapes ripened, they are regarded aspredators of insects.The structure and abundance of entomophagousin the experimental plots of the stationary werethree types of pest management were applied,are shown in Table 5.Table 5. Structure and abundance of the entomophagousinto the stationary , subject to different pest controlmethods in vineyardToxonomy Chemical Biological Integratedclassification control control controlOrd. ARANEA 7 6 18Ord.DERMAPTERA6 8 2Ord.COLEOPTERA1 19 3Ord. DIPTERA 0 1 0Ord.HYMENOPTERA4 31 18TOTAL 18 65 41Table 6. The ratio between the useful and harmfulentomofauna (U / D) for the three methods of pestcontrol in vineyardChemical Biological IntegratedCollection Date ofcontrol control control(no) collection(U/D)1 25.05. 0.96 1.08 1.102 5.06. 0.84 1.48 1.033 19.06 0.46 1.55 0.954 29.06. 0.31 1.03 0.78Based on the harmful and useful entomofaunacollected from the wine ecosystems, a rotationbetween useful and harmful fauna wasachieved for each collection date. The resultsare presented in the Table 6.From Table 6 we can see that the ratio betweenthe two components harmful pests andbeneficial, followed an upward trend under thebiological control and a decreasing if thevariants of integrated and chemical particularly.As a general pole during spring and earlysummer this ratio has a value of 1.1, changes toone or other of the components occurring afterthe intervention with the control treatments:biological, chemical or integrated.CONCLUSIONSEntomofauna abundance of the useful andharmful insects presented higher values for thebiological and integrated control methods,compared to the chemical control method.Compared to the biological control, the mostprotective for the useful entomofauna,integrated control and especially chemical,caused a reduction of 4% and 17% in thenumber of useful insects.The ratio between useful and harmfulentomofauna recorded an average of 1.1, with52

increasing trend for variants where waspracticed the biological control goingdownward in the variant where chemicalcontrol was practiced.Useful entomofauna was lower than theharmful for all 3 methods of control, whichproves that beneficial insects are more sensiblethan the harmful insects, under phytosanitarytreatments.REFERENCESCoulon T., Sentenac G., 2001. Un référentiel national‚Production intégrée des raisins” pour les vignoblesfrançais. Bulletin de l’O.I.V., vol. 74, nr. 845-846, p.445-462.Dejeu et al., 1997. Hortiviticultura si protectia mediului.Ed. Didactica si Pedagogica, BucharestFregoni M., 2005. Viticoltura di qualita. InformatoreAgrario Publishing HousePerju T. et all., 1988. Entomofagii si utilizarea lor înprotectia integrata a ecosistemelor viticole. CeresPublishing House, Bucharest53

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653EFFECTS OF THE DIFFERENT GRAPE ROOTSTOCKS ON BERRY SKINB, CU, FE, MN AND ZN CONTENTS OF ’CSERSZEGI FSZERES’CULTIVARIstván FEKETE 1 , Béla KOVÁCS 1 , Dávid ANDRÁSI 1 , Éva BÓDI 1 , Nándor RAKONCZÁS 2Abstract1 Institute of Food Science, Quality Assurance and Microbiology, Centre for Agricultural andApplied Economic Sciences, University of Debrecen, Böszörményi Street 138., 4032,Debrecen, Hungary2 Institute of Horticulture, Centre for Agricultural and Applied Economic Sciences,University of Debrecen, Böszörményi Street 138., 4032, Debrecen, HungaryCorresponding author email: feketei@agr.unideb.huThe selection of the most appropriate grape rootstock regarding the production purposes has a positive effect on qualityof the grape, the must and the wine: it may produce higher vintage quantity and may increase the vintage quality. Fieldexperiment was set up at the model farm of University of Debrecen on sand soil. 12 different grape rootstocks werecompared (’Aramon x Riparia 143B M et de G’, ’Vitis Berlandieri’, ’Berlandieri x Riparia Szilágyi 157 Pécs’,’Berlandieri x Riparia S.O.4’,’Berlandieri x Riparia T5C Eger’, ’Berlandieri x Riparia T.G. 5.A.5.’,’Berlandieri xRiparia T.8.B.’,’Berlandieri x Riparia T.K. 5.BB’,’Berlandieri x Riparia K.125AA’,’Riparia Sauvage’, ’Riparia Selecta’,’Riparia Tomentosa’). ‘Cserszegi fszeres’ scion was grafted into the above rootstocks. The aim of our research was todetermine how the B, Cu, Fe, Mn and Zn contents of the berry skins change in case of the different grape rootstocks. In2011 we obtained valuable differences in the boron, copper, iron, manganese and zinc concentrations of skins of‘Cserszegi fszeres’ grafted into different rootstocks. The concentrations of B, Cu, Fe, Mn and Zn changed between18.0-32.0 mg kg -1 , between 1.27-4.77 mg kg -1 , between 11.5-45.0 mg kg -1 , between 3.78-14.0 mg kg -1 , and between 2.14-8.53 mg kg -1 , respectively. On the basis of our results the ‘Riparia Sauvage’ could be an advantageous rootstock, as thelargest boron, iron and manganese concentrations were found in its skin. Advantageous rootstocks could be the’Berlandieri x Riparia Szilágyi 157 Pécs’ because of the largest measured copper content and the ‘Vitis Berlandieri’ dueto the largest measured zinc content. These results support that the selection of the rootstocks influence the B, Cu, Fe,Mn and Zn contents of the grape berry.Key words: grape rootstock, berry skin, micro element, ’Cserszegi fszeres’.INTRODUCTIONGrape rootstocks are present in the grapeproduction since the devastation of thephylloxera. Because it is vital to be acquaintedwith characteristics of different rootstocks tochoose the variety most appropriate to givencircumstances, these characteristics werebroadly inspected by many researchers.Choosing the ideal rootstock-scion cultivarcombination at establishment of the vineyardhas a determining effect for its whole lifetime.Crucial evaluative characteristics of rootstockcultivars are the following: soil requirement,mineral nutrition, resistant to loam- and saltcontent, affinity and vegetative cycle (Angeli etal., 1959). Most often utilised grape species inennobling of rootstock cultivars are ’VitisRiparia Scheel.’, ’Vitis Rupestris Mich.’, ’Vitis55Berlandieri Plan.’ and ’Vitis vinifera L.’. Thefirst three varieties are of North-Americanorigin. ’Vitis Riparia Scheel.’ comes from rivervalleys of the east coast, ’Vitis Rupestris Mich.’origins from south-west part of the east coast,while ’Vitis Berlandieri Plan.’ can be find onrocky territories of Texas state. Distinctivecharacteristics of these species result frommany thousand years’ evolution (Kocsis, 2010).In ennobling of rootstock cultivars some other,mainly North-American grape species werealso used (Galet, 1998). However, there are 19listed rootstock varieties in the HungarianNational Variety Registry Catalogue, only afew is propagated for commercial use (Lrinczand Zanathy, 2009). In some other countriespossibilities of different rootstock-scion varietycombinations corresponding to specific

territorial circumstances is more elaborated,spectrum of used rootstock varieties is broader.The cultivated vine plant is called vine stock(Balogh, 1991). Vine stocks are propagated onvegetative way by cuttings or grafted cuttings(Prohászka, 2003). Parts differentiating fromthe cane in the soil form the rooting system,parts forming above ground give the trunk andshoot system of the stock (Kozma, 1993a). Incase of propagation by grafts, the root system isformed by the rootstock cultivar (Americangrape species), and the shoot system growth upfrom the scion (‘Vitis vinifera L.’) (Prohászka,1982). Mineral nutrients are taken up by theroot hairs from the soil. These nutrients get intothe leaves and bunches through the root system,trunk, canes and shoots (Prohászka, 1982;Kozma, 1993a). Certain nutrients can also betaken up through the leaves in smallerquantities (Kozma, 1993a). Through thelifetime of the graft, scion and rootstock partslive together in mutual service. The rootstocktakes up mineral nutrients dissolved in water,the scion fruits and feeds the rootstock withphotosynthates (Kocsis, 2010).Rootstock has direct and indirect effects on thescion (Striegler and Howel, 1991; Csikászné,2008). Hegeds and I’só (1965) demonstrated,that different scion cultivars show their bestperformance on different rootstocks, whichdifferently affect nutrition of scions grafted onthem (Lrincz and Bényei, 1999). Mineralnutrition pattern characteristic for own rootedvine alter in case of grafts (Kozma, 1993b).Quantity and composition of nutrients going tothe direction of the scion is predominantlydetermined by the selection ability/characteristics of the root system (Kozma,1993b).Different rootstocks can be characterized bydifferent root formation. Magnitude, verticaland horizontal extension of the root system isalso an important factor of mineral take up(Vercesi, 1987). Certain rootstock cultivarsform smaller (’Berlandieri x Riparia TK5BB’)others form medium sized (’Aramon xRupestris G 1’) root system. ’Riparia Portalis’can be characterised by a deeper, while’Berlandieri x Riparia S.O.4’ can becharacterised by a shallow root system(Vanekova, 1995).56Effects of rootstocks do not confine forimpinge on mineral take up but also ondistribution of nutrients (Mannini et al. 1992).Withstanding that Kocsis (2010) couldexperimentally prove that scion cultivars showdifferent results when grafted on variousrootstocks concerning mineral take up, in fieldcircumstances: effects of production site andecological factors, affect the modifying powerof rootstocks to a great extent, or evenminimizes it (Csikászné, 2008).Minerals taken up are predominantly locatedinto the solid parts of the bunch: in the skin,seed and cellulose-pectinic cell walls of theflesh. The skin of the berry consists of theepiderma and some cell layers beneath(Ferenczi, 1966). Alkalinity of the of the berryregularly increase 2-3 times by the ripening;however only a more intensive relative increaseis characteristic for the skin (Kállay, 1998).The most important microelements of theberries are B, Cu, Fe, Mn and Zn (Kállay,1998). Most important role of iron is formationof chlorophyll (Prohászka, 1982). The leastiron can be find in the seeds regarding theberries (Kozma, 1993a). Boron has crucial rolein evolution of floral fertility, in amount andquality of the yield, but even a slight overdoseof this element can have toxic effects (Bényeiand Lrincz, 1999; Oláh, 1979). Ruckenbauer(1987) found, that boron uptake of the vine isthe biggest in the berries in case of 10 tons/hayield. Experiments of Candolfi-Vasconcelos etal. (1997) state, that grafts are more effective inboron uptake than own rooted vines.Manganese is a mediator in the synthesis ofcarbohydrates and proteins, since it activatesmany enzymes (such as polyphenol-oxidase,ascorbic acid-oxidase). Zinc plays its mostcritical role in catalysing synthesis oftryptophan (Kozma, 1993a). Copper is one ofthe most important growth factors of the vineplant. One of its important roles is supportingof carbohydrate and protein synthesis (Kozma1993a; Kállay, 2010).Microelement content of the grape skin canalso be interesting from the point of macerationtechnology at processing white aromatic grapecultivars, since by this way a certain amount ofmicroelement of the skin dissolves into themust increasing its alkalinity (Kállay, 2010).Microelement content of the must further on

gets serious role through the fermentationprocess, because enzymatic activity of the yeastrequires adequate amount and ratio ofmicroelements (Erdss, 1973). Further on, inthe wine it is also significant from the point offormation of “minerality”. This concept refersto the mineral content of the wine, also called“salinity”. Both describe a special abundance inthe taste complexity (Hajós, 2008).The aim of our research was to determine howthe B, Cu, Fe, Mn and Zn content of the berryskins changes in case of the different graperootstocks. Data on mineral compositionaffected by different rootstocks are first yearresults of a longer, and more complex work.MATERIALS AND METHODSGrape variety collection of the University ofDebrecen, Centre of Agricultural and AppliedEconomic Sciences was established in 2003 onimmune sandy soil with 3m between row and1m between vine spacing. 28 rootstockcultivars of the collection were trained to baldhead system with one bended wire technology.In 2010 grafting of ‘Cserszegi fszeres’ (alsocalled ‘Woodcutters’ white’) on 14 rootstocksout of the 28 was started with woody-greengrafting in May, following with green graftingup to 20 th of June. On vines grafted in place thescion was situated between 50-150 cm height.Scion was trained to single curtain trainingsystem (Figure 1.).Figure 1. View from a grape variety collection of theUniversity of Debrecen, Centre of Agricultural andApplied Economic Sciences1 st and 2 nd tables show soil parameters of theexperimental field in Pallag of 0-30 and 30-6057cm depth accordingly. To determine thefraction of soil B, Cu, Fe, Mn and Zn content,which could be utilized by the plant, analysiswith NH 4 -acetate + EDTA elution, elaboratedby Lakanen and Erviö (1971) was used.Analysis of mineral composition of the elutionwas checked by Thermo Scientific iCAP 6300Dual type inductively coupled plasma opticalemission spectrometry (ICP- OES).Table 1. Soluble (Lakanen and Erviö, 1971) B, Cu, Fe,Mn and Zn content of soil of Model Farm (mg kg-1)Parameters Average (mg kg -1 )Sampling depth (cm) 0-30 30-60B 0.63 0.60Cu 9.95 7.02Fe 239 213Mn 329 382Zn 6.93 4.65Table 2. General parameters of soil of Model FarmParametersAverageSampling depth (cm) 0-30 30-60pH (KCl) 5.93 5.91Soil texture Sand SandAll water soluble salt (m/m) 0.005 0.006CaCO 3 % (m/m) 0.5 0.5Humic % (m/m) 1.12 1.08In October of 2011 respectful amount of grapecould be harvested of scions on 12 rootstockvarieties. These are the following: ’Aramon xRiparia 143B M. et de G.’, ’Vitis Berlandieri’,’Berlandieri x Riparia Szilágyi 157 Pécs’,’Berlandieri x Riparia S.O.4’, ’Berlandieri xRiparia T5C Eger’, ’Berlandieri x Riparia T.G.5.A.5.’, ’Berlandieri x Riparia T.8.B.’,’Berlandieri x Riparia T.K. 5.BB’, ’Berlandierix Riparia K.125AA’, ’Riparia Sauvage’,’Riparia Selecta’, ’Riparia Tomentosa’.The scion cultivar ’Cserszegi fszeres’ wasennobled by the crossing of ’Irsai Olivér’ and’Traminer’ by Károly Bakonyi inCserszegtomaj (Hungary). This middle ripe,white wine grape variety is commonlyrespected for its good wine quality andresistance to fungal diseases (Balogh, 1993;Bényei and Lrincz, 1999). The point inselection of this cultivar for our study is tofocus on its sensitivity to dry periods, andeffects of rootstock cultivars on this feature.Sample preparation and analyses wereperformed in laboratory of University of

Debrecen, Centre for Agricultural and AppliedEconomic Sciences, Institute of Food Sciences,Quality Assurance and Microbiology.By the analysis 5 elements were checked (B,Cu, Fe, Mn and Zn) in three replications. Theskin was separated and cleared in laboratorycircumstances with laboratory tools (tweezers,flasks). Chemical maceration of the sampleswas carried out with the use of HNO 3 (wet andclosed). Prepared samples were analysed byThermo Scientific iCAP 6300 Dual typeinductively coupled plasma optical emissionspectrometry (ICP-OES).Statistical evaluation of data was done by SPSSv. 14.0 (IBM Company). Correlation betweenparameters and factors was checked by One-Way ANOVA and Tukey-test. Probes weredeemed significant below 5% P-value.Average, deviation and relative standarddeviation (RSD%) were also calculated.RESULTS AND DISCUSSIONSOur inspection aimed to answer, how changedifferent rootstocks affect B, Cu, Fe, Mn andZn content of berry skin of ‘Cserszegi fszeres’.3 rd table presents berry skin analytical results of‘Cserszegi fszeres’ grafted on differentrootstocks expressed on dry matter basis.Bolded values represent the highest, bolded anddented values represent the lowestconcentration.1. Results of boron concentrationData clearly show, that the lowest differencewas experienced in regard to the differentrootstocks in case of boron. The relativestandard deviation between the rootstocks was22.3%, with a mean value of 22.7 mg kg -1 . Thehighest level was experienced at berry skinsamples at ’Riparia Sauvage’, while the lowestvalue was experienced at ’Berlandieri x RipariaS.O.4’.2. Results of copper concentrationResults show, that significant differences weredetected between berry skin Cu contents of’Cserszegi fszeres’ grafted on differentrootstocks. The relative standard deviationbetween Cu content measured in the berry skinswas 36.6%, with a mean value of 2.58 mg kg -1 .The highest Cu-level was experienced at’Berlandieri x Riparia Sz 157 Pécs’, while thelowest value was experienced at ’Berlandieri xRiparia T5C Eger’.3. Results of iron concentrationSignificant differences were experienced incase of iron content of the berry skins of’Cserszegi fszeres’ grafted on differentrootstocks. The relative standard deviation ofiron content measured in berry skin is 33.3%.The calculated mean value was 26.8 mg kg -1 .The highest iron concentration was measured at’Cserszegi fszeres’ grafted on ’RipariaSauvage’, while the lowest was measured at’Berlandieri x Riparia T5C Eger’.4. Results of manganese concentrationSignificant differences were experienced incase of manganese concentration of the berryskins in case of the different rootstocks. Therelative standard deviation of differentrootstocks was 35.1%, with a calculated9.54mg kg -1 mean value. The highestmanganese concentration was measured at skinsamples of ’Cserszegi fszeres’ standing on’Riparia Sauvage’, the lowest value wasmeasured at ’Berlandieri x Riparia Sz 157Pécs’.5. Results of zinc concentrationData show well, that the highest differencesbetween rootstocks were experienced at zincconcentration In respect to this element, therelative standard deviation was 40.5%, and thecalculated mean value was 4.42 mg kg -1 . Thehighest value was measured in case of ’VitisBerlandieri’, the lowest value was experiencedat ’Berlandieri x Riparia Sz 157 Pécs’.58

Table 3. Element content of the berry skins of ‘Cserszegi fszeres’ grafted on different rootstocks (n=3) (2011, Pallag)ROOTSTOCKS B (mg kg -1 ) Cu (mg kg -1 ) Fe (mg kg -1 ) Mn (mg kg -1 ) Zn (mg kg -1 )’AxR 143B M et de G’ 31.9 e ±0.4 1.93 c ±0.03 16.8 b ±0.2 8.07 d ±0.09 3.66 cd ±0.14’V. BERLANDIERI’ 20.2 b ±0.6 2.64 e ±0.05 30.7 f ±0.6 13.1 g ±0.1 8.53 h ±0.12’BxR SZ 157 Pécs’ 18,4 a ±0,2 4.77 h ±0.15 23.2 d ±0.7 3.78 a ±0.16 2.14 a ±0.04’BxR S.O.4’ 18.0 a ±0.3 3.03 f ±0.06 21.3 c ±0.3 5.76 b ±0.14 3.49 c ±0.08’BxR T5C Eger’ 19.0 ab ±0.6 1.27 a ±0.05 11.5 a ±0.1 7.47 cd ±0.16 2.25 a ±0.04’BxR T.G. 5.A.5.’ 22.0 c ±1.1 2.16 cd ±0.08 27.5 e ±1.0 7.69 cd ±0.49 4.31 de ±0.29’BxR T.8.B.’ 26.4 d ±1.0 3.09 f ±0.08 30.3 f ±0.3 12.0 f ±0.4 4.57 f ±0.10’BxR T.K. 5.BB’ 18.1 a ±0.1 2.59 e ±0.05 31.8 f ±0.3 10.2 e ±0.2 4.99 f ±0.13’BxR K.125 AA’ 24.9 d ±0.1 3.55 g ±0.08 36.7 g ±0.3 12.5 fg ±0.4 4.63 ef ±0.17’R. SAUVAGE’ 32.0 e ±0.2 2.30 d ±0.02 45.0 h ±0.9 14.0 h ±0.1 4.95 f ±0.08’R. SELECTA’ 19.4 ab ±0.3 1.59 b ±0.02 24.3 d ±0.6 12.9 g ±0.5 6.51 g ±0.22’R. TOMENTOSA’ 22.7 c ±0,3 2.07 c ±0.06 23.0 d ±0.5 6.92 c ±0.22 3.01 b ±0.10Different letters indicate significant differences between rootstocks regarding the element (P < 5%)CONCLUSIONSIn this research work berry skin B-, Cu-, Fe-,Mn-, and Zn- concentration data have beenprocessed.Based on our examination it could be stated,that there are significant differences in mineralcontent of the berry skins of ‘Cserszegifszeres’ grafted on different rootstocks inregard to the listed elements. The highestrelative standard deviation was experienced inthe case of zinc, while the lowest relativestandard deviation was shown in the case onboron. Differences between experiencedconcentrations can either be due to the geneticfactor, thus to the different rootstocks, or toclimatological factors of the vintage, thatgreatly affect mineral status of the vine (Szkeand Kiss, 1987; Csikászné, 2008). Forevaluation of genetic and climatological(vintage) factors data of many years’experiment is to be collected.Based on our results, it could supposed, that’Riparia Sauvage’ could be an advantageousrootstock, since the highest values on B, Fe andMn were measured in berry skin samples of’Cserszegi fszeres’ grafted on this rootstockvariety. From the point of the highest Cuconcentration ’Berlandieri x Riparia Szilágyi157 Pécs’, while in respect to the Znconcentration ’Vitis Berlandieri’ could behighlighted.ACKNOWLEDGEMENTSThe research work was supported by theTÁMOP 4.2.1./B-09/1/KONV-2010-0007 and59TÁMOP-4.2.2/B-10/1-2010-0024 projects. Theprojects were co-financed by the EuropeanUnion and the European Social Fund.REFERENCESAngeli L., Horváth J., Hullai L., 1959. Szltermesztés,In: Rajman J. (ed.) Kertészeti Ismeretek.,Mezgazdasági kiadó, Budapest, p. 322-323.Balogh I., 1991. Szltermesztési és BorászatiEnciklopédia, Debreceni Agrártudományi Egyetem,Debrecen, p. 11.Balogh I., 1993. Fontosabb szlfajtáink jellemzése,Debreceni Agrártudományi Egyetem, Debrecen, p.33.Bényei F., Lrincz A. 1999. Szlfajtáink, In: Bényei F.,Lrincz A., Sz. Nagy L. Szltermesztés.,Mezgazda kiadó, Budapest, p. 196-199.Candolfi-Vasconcelos M.C., Castagnoli S., Baham J.1997. Grape Rootstocks and Nutrient UptakeEfficiency. Annual Meeting of the OregonHorticultural Society. http://berrygrape.org/graperootstocks-and-nutrientuptake-efficiency/Csikászné K. A., 2008. A termés mennyiség, a termésminség és a levelek tápelem tartalmánakösszefüggése különféle alanyokra oltott Cabernetsauvignon szlfajtán, Doktori Értekezés, PannonEgyetem Georgikon Mezgazdaságtudományi Kar,Keszthely, p. 9., p. 18-28.Erdss T., 1973. A szl és a must kémiai összetétele,In: Kádár Gy. (ed.) Borászat., Mezgazdasági kiadó,Budapest, p. 178-179.Ferenczi S., 1966. A szl, a must és a bor kémiája.Mezgazdasági kiadó, Budapest, p. 32.Galet P., 1998. Grape Varieties and Rootstock Varieties.Oenoplurimedia, Chaintre, France

Hajós Gy., 2008. A bor kémiája, In. Hajós Gy. (ed.)Élelmiszer-kémia, Akadémia kiadó, Budapest, p.498-499.Hegedüs Á., I’só, A., 1965. Az egri borvidékrelegalkalmasabb alanyfajták. Kísérleti közlemények.3, p. 61-77.Kállay M., 1998. Borászati kémia, In: Eperjesi I., KállayM., Magyar I. Borászat., Mezgazda kiadó,Budapest, p. 258.Kállay M., 2010. Borászati kémia, Mezgazda kiadó,Budapest, p. 28-31.Kocsis L., 2010. Szlalanyok egyes fiziológiaijellemzinek és biotikus tényezinek értékelése,MTA doktori értekezés, Keszthely, p. 4-8., p. 28., p.94.Kozma P., 1993. A szl és termesztése I., Akadémiakiadó, Budapest, p. 91., p. 164 -176.Kozma P., 1993b. A szl és termesztése II., Akadémiakiadó, Budapest, p. 45-46.Lakanen E, Lrincz A., Zanathy G. 1999. Szlfajtáink,In: Lrincz A., Zanathy G. (eds.) Szltermesztés.,Budapesti Corvinus Egyetem, Budapest, p. 76-79.Lrincz A., Bényei F., 1999. Tápanyagellátás, In:BényeiLrincz A., Sz. Nagy L. Szltermesztés.,Mezgazda kiadó, Budapest, p. 384-392.Mannini F., Lanati D., Lisa A., 1992. Rootstock effect on'Grignolino' vine nutrient level and must phenoliccompounds and acidity. Quad. Vitic. Univ. Torino16, p. 27-32.Oláh L., 1979. Szlészek Zsebkönyve, Mezgazdaságikiadó, Budapest, p. 135.Prohászka F., 1982. Szl és bor., Mezgazdaságikiadó, Budapest, p. 9-19., p. 115-117.Prohászka F., 2003. Szl és bor., Mezgazda kiadó,Budapest, p. 9.Ruckenbauer W., 1987. Neue Aspekte der Düngung imWeinbau unter besonder Berücksichtigung deNahrstoffentzuges verschiedener Rebsorten. „A szltápanyagellátása” Nemzetközi Tanácskozás. Borsod-Heves megyei Szakszolgálati Állomás. Gyöngyös, p.33-47.Striegler R.K., Howell G.S., 1991. The influence ofrootstock on the cold hardiness of Seyval grapevinesI. Primary and secondary effects on growth, canopydevelopment, yield, fruit quality and cold hardiness.Vitis, 30, p. 1-10.Szke L., Kiss E., 1987. A fajta, a terhelés és az évjárathatása a szllevél tápanyagtartalmára. „A szltápanyagellátása” Nemzetközi tanácskozás.Gyöngyös, 1987. október. 9.Vanekova Z., 1995. A szl morfológiája és fejldése,In: Szke L. (ed.) Szlfajták, Mezgazda kiadó,Budapest, p. 22-25.Vercesi A., 1987. Gli assorbimenti radicali dellavite:meccanismi e fattori influenti. Vignevini,Bologna, 4, p. 47-55.60

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653AbstractTHE INFLUENCE OF DEVELOPMENT LEVEL OF VINESON THE BIOMETRIC INDICES OF CARDINAL VARIETYMariana GODOROJA, Cornelia LUNGU, Gheorghe NICOLAESCU,Valeria PROCOPENCOState Agrarian University of Moldova, 44 Mircesti Street, MD-2049,Chisinau, Republic of MoldovaCorresponding author email: m.godoroja@gmail.comThe grape quality is determined by the development of vines. Homogeneity of plant development depends on the qualityof planting material and agrotechnics used. In our study on vineyards, the vines were classified in three groups - thesmall, medium and large vines. The vines within each group were studied weak, medium and strong shoots, setting aspecific correlation.Key words: biometric indices, Cardinal variety, influence.INTRODUCTIONViticulture is and will remain one of the basicbranches of economy of the Republic ofMoldova. Today the scientists are working toselect the varieties and clones resistant tovarious adverse factors, high productivity andquality. Moldova has favorable conditions forgrowing grapes, but winters in recent yearshave lower minimum temperatures influencingproductivity and quality. Therefore,recommended to protect the vines of tablegrapes' varieties and clones with soil even inthe South of Moldova, especially varieties withearly bud break, for example, the table grapevariety Cardinal.The grapes' resistance to frost and winterconditions is a multilateral particularities of thevines, because gradually formed long beforeinstalling the low temperatures. This complexof characteristics and agronomic measures aredetermining the longevity of vineyardplantation and the development level of vines.The vines of the Cardinal variety arecharacterized with average growth vigor. Levelvine growth is determined mostly by thehomogeneity and quality planting material.The vigor of varieties is given with in a lengthand diameter of the shoots. In the experience,we studied both data diameter as well as length.MATERIALS AND METHODSThe vineyards which we studied are located inCopceac village, Stefan Voda district, in aSouth-East part of Republic of Moldova, in2011-2012 years.The vines of vineyards were classified intothree categories: small grow vigor, mediumgrow vigor and large grow vigor and the shootswere classified into the same three categories.The observations and analyzes were performedaccording to current guidelines (Mnescu,Creola, .a., 1989; Perstniov, N, .a., 2000).Results were processed by the method ofcorrelation and regression analysis:- small grow vigor vines (y 1 , y 2 , y 3 , y 4 ),medium grow vigor vines (y 9 , y 10 , y 11 , y 12 ),large grow vigor vines (y 17 , y 18 , y 19 , y 20 ),general data (y 25 , y 26 , y 27 , y 28 );- small grow vigor shoots (y 1 , y 9 , y 17 , y 25 ),medium grow vigor shoots (y 2 , y 10 , y 18 , y 26 ),large grow vigor shoots (y 3 , y 11 , y 19 , y 27 ),general data (y 4 , y 12 , y 19 , y 28 ).RESULTS AND DISCUSSIONSCardinal-is an early table grape variety. Thegrapes are large, cylindrical-conical shape. Theberry density is different. The berries are verylarge, spherical or oval, red-violet, coveredwith obscure bloom. The peel is thick, butedible. The berries begin to ripening in late I-IIdecade of august. Productivity is high. Thegrapes have a high transportability.61

Figure 1. The diameter of internodes of shoots with small grow vigour(a-small vigour shoots, b-medium vigour shoots, c-large vigour shoots)Figure 2. The diameter of internodes of shoots with medium grow vigour(a-small vigour shoots, b-medium vigour shoots, c-large vigour shoots)Figure 3. The diameter of internodes of shoots with large grow vigour(a-small vigour shoots, b-medium vigour shoots, c-large vigour shoots)The data from figure 1 showed that the diametersof internodes of small grow vigor wasbetween 0,35 to 0,65 cm for small shoots, from0,40 to 0,94 cm for medium shoots and from0,79 to 1,05 cm.The data from figure 2 showed that the diametersof internodes of medium grow vigour wasbetween 0,46 to 0,83 cm for small shoots, from0,74 to 0,89 cm for medium shoots and from1,09 to 1,22 cm.The data from figure 3 showed that the diametersof internodes of large grow vigor wasbetween 0,51 to 0,85 cm for small shoots, from0,59 to 0,78 cm for medium shoots and from0,94 to 1,20cm.The data from figure 4 showed that the lengthof internodes of small grow vigor was between1,60 (1 st internodes) to 4,10 cm (8 th internodes)for small shoots, from 3,85 (1 st internodes) to7,25 cm (4 th internodes) for medium shoots andfrom 2,63 (1 st internodes) to 7,90 cm (5 th internodes).The data from figure 5 showed that the lengthof internodes of medium grow vigor was between2,30 (1 st internodes) to 7,27 cm (5 th internodes)for small shoots, from 3,13 (1 st internodes)to 9,80 cm (8 th internodes) for mediumshoots and from 3,84 (1 st internodes) to 11,74cm (5 th internodes).62

Figure 4. The length of internodes of shoots with small grow vigour (a-small vigour shoots, b-medium vigour shoots, c-large vigour shoots)Figure 5. The length of internodes of shoots with medium grow vigour (a-small vigour shoots, b-medium vigour shoots,c-large vigour shoots)Figure 6. The length of internodes of shoots with large grow vigour (a-small vigour shoots, b-medium vigour shoots, c-large vigour shoots)The data from figure 6 showed that the lengthof internodes of large grow vigor was between6,53 (1 st internodes) to 10,50 cm (8 th internodes)for small shoots, from 4,10 (1 st internodes)to 12,40 cm (9 th internodes) for mediumshoots and from 3,64 (1 st internodes) to 14,00cm (7 th internodes).The data from figure 7 showed the correlationbetween the length and diameters of internodesfor each group of shoots and grow vigor ofvines. For small vines we obtained the nextequation of regression y 4 =0,02761+0,7134x,correlation coefficient r=0,46, coefficient ofdetermination d yx =0,2116 (figure 7a). Formedium vines we obtained the next equation ofregression y 12 =0,03575+0,8317x, correlationcoefficient r=0,28, coefficient of determination63d yx =0,0784 (figure 7b). For large vines weobtained the next equation of regressiony 20 =0,09795+1,1592x, correlation coefficientr=-0,08, coefficient of determinationd yx =0,0064 (figure 7c). For all vines (the generaldata), we obtained the next equation ofregression y 28 =0,05181+0,9067x, correlationcoefficient r=0,21, coefficient of determinationd yx =0,0441 (figure 7d).The general data of all vines for small vigorshoots showed the next equation of regressiony 25 =0,05324+0,9454x, correlation coefficientr=-0,07, coefficient of determinationd yx =0,0049 (figure 7d). For medium vigorshoots showed the next equation of regressiony 26 =0,04636+1,0117x, correlation coefficientr=-0,32, coefficient of determination

d yx =0,1024 (figure 7d). For high vigor shootsshowed the next equation of regressiony 27 =0,02148+0,8435x, correlation coefficientr=-0,37, coefficient of determinationd yx =0,1369 (figure 7d).Figure 7. Results of correlation and regression analysis between length and diameters of internodes of shootsCONCLUSIONSThe correlation between the length anddiameters of internodes for small, medium andlarge grow vigor of vines showed theinsignificant weak correlation between theseindicators. This is due to the biology of variety,quality of planting material and climaticconditions.64REFERENCESMnescu Creola et all, 1989. Controlul biologic alproduciei în Pomicultur i Viticultur. Bucureti.Mokrâk G.P., Perstnev N.D., Gaina B.S., 2006. Obnovleniei ulušenie stolovogo sortimenta vinogradarannih sortov sozrevaniâ v Moldove. In: Uvologie ioenologie. Chiinu, 15-76.Nicolaescu G., Apruda P., Terecenco A., Perstniov N.,2008. Ghid pentru productorii de struguri pentrumas (ediia a II). Chiinu: Iunie-Prim.Perstniov N. et al., 2000. Viticultur. Chiinu.http://vinograd.info/sorta/stolovye/kardinal.html

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653AbstractRESEARCH REGARDING THE INFLUENCE OF THE HYBRIDAND THE NUMBER OF STEMSON THE FIELD PRODUCTION OF TOMATO PLANTSGheorghia HOZAUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Marasti Bld., District 1, 011464, Bucharest, RomaniaCorresponding author email: hozagh@yahoo.comThe tomato crop started near Bucharest city, in a favourable area for vegetable growing, using 3 tomato crossbreeds,pruned with one and two stems in order to study their behaviour from the vegetative and fruit forming point of view.The biological material used for this particular experiment was 3 indeterminate, disease-resistant tomato hybrids, withfruits of roughly 150g, round and regular. The plants were pruned with two stems, the first one being the main and thesecond being formed from the first shoot located at the base of the plant. The crop was propped on trellis, with 5clusters and mulched with agro textile material; the planting scheme was 100cm/40cm for variants pruned with twostems and 80cm/40 for variants pruned with one stem. The results showed that all studied hybrids had a satisfactoryvegetative growth, proved by the height of the plants and their leaves, for both the main and the second stem. In whatregards the formation of fruits, the plants with two stems provided a larger quantity. Thus, the number of fruits perplant was almost double for variants with two stems, the average fruit weight registered similar values for bothtreatments, but a considerably higher fruits yield was noted for Veneia F1and Rhuen F1 hybrids.Key words: tomato, hybrids, two stems, yield.INTRODUCTIONTomato cropping is possible in various systemsdue to the satisfactory results obtained whentechnological optimization is used. Tomatopruning with multiple stems is one of theseimprovements, which leads to cost reductionfor the planting material, hence 20% less plantsper hectare in comparison with one stem crops(Hoza, 2011). This pruning system is widelyused in a protected environment, in extendedcycle as far as our country is concerned, but itcan also be practiced in farm field. Usually,tomato plants are pruned with one stem,however they can also be pruned with 2-3stems for commercial crops and 4 stems fordecorative purposes, in which case plants arepropped variously. Research regarding thetomato plants cropped at varied densities,namely 60cm/40cm and 60cm/50cmrespectively, pruned with 1,2 or 3 stems provedthat a higher distance between plants on therow combined with 2 stems pruning, conductedto the highest total and marketable yield (Ara etall., 2007). Other experiments show that plantspruned with 2 stems and 6 fruits per cluster or 2stems and no fruit pruning gave a significantly65higher marketable and total yield; the 3plants/m 2 density issued in a considerablyhigher marketable crop in comparison with the2,5 or 2 plants/m 2 density and the results provedthat the tomato yield and the fruit qualitycan be influenced by the number of stems andthe plant density, while fruit pruning provedlittle effect on the aforementioned features(Maboko et al., 2011). Moreover, pruningtomato plants with 2 stems proves to have asignificant positive influence on the cropquality and plant health (Kanyomeka andShivute, 2005).MATERIALS AND METHODSThe research was conducted near Bucharestcity, in very favourable climatic conditions fortomato crops. The experiment was outlined intwo straps, with two exponents (Table 1):-Exponent A, represented by hybrids, with 3graduations-Exponent B, represented by the number ofstems, with 2 graduationsThe planting was made in simple rows at80cm/40cm for variants pruned with one stemand a leading density of 3.1 pl/m 2 and

100cm/40cm for variants pruned with twostems and a leading density of 2,5 pl/m 2 , withtransplanted seedling. The crop was subjectedto specific maintenance work, the field wasmulched with agrotextile material, with 5clusters and plants were propped by metallictrellis on1,8 m height. At variants pruned withtwo stems, the second stem was formed fromthe first shoot located at the base of the plantwhich was V propped on band. During thevegetation period, data was collected regardingthe growth of the plants, flower formation, fruitbinding, resulted yield and fruit size.Table 1. The scheme of the experimentA Exponent B ExponentVeneia F 1 V 1 (Mt) - Veneia F1, one stem V 2 – Veneia F1, two stemsFournaise F 1 V 3 – Rhuen F1, one stem V 4 – Rhuen F1, two stemsRuen F 1 V 5 – Fournaise F1, one stem V 6 – Fournaise, F1 two stemsRESULTS AND DISCUSSIONSTomato pruning with two stems represents analternative for growers in what regards thereduction of plants on the cropping fieldwithout the fruits yield being affected. Fromresearch it is clear that from the vegetativegrowth point of view, there were no significantdifferences between the variant pruned withone stem and the other pruned with two stems,as long as the appropriate and regular agrotechnologicalprocedures were conductedequally (Table 2 and 3).Table 2. The height of the main stemVariant V 1 (Mt) Veneia F1 V 2 Veneia F1 V 3 Rhuen F1 V 4 Rhuen F1 V 5 Fournaise F1, V 6 Fournaise F1one stem two stems one stem two stems one stem two stemsH (cm) 102.5 100.3 95.7 82.8 101.6 81.3Table 3. The height of the shoot stemVVariant2V 4V 6Veneia F1 two stemsRhuen F1 two stemsFournaise F1 two stemsH (cm) 99.0 93.1 87.7In what regards the distance between clusters, itwas observed that differences of somecentimeters between the variant pruned withone stems and the ones pruned with two stemsdid not affect the fructification process.The Veneia F1 hybrid registered the highestregularity, the differences noted being under1,5 cm (Table 4 and 5).Table 4. The synthesis of results regarding the average distance between clusters on mainVariantAverage distance between clusters1 - 2 2 - 3 3 - 4 4 - 5V 1 (Mt) – Veneia F1 one stem 13.5 13.9 15.2 15.5V 2 – Veneia F2 two stems 14.1 13.3 15.1 13.9V 3 - Rhuen F1 one stem 7.4 9.4 10.4 10.1V 4 – Rhuen F1 two stems 11.1 13.6 15.1 17.4V 5 – Fournaise F1 one stem 12.8 12.5 16.6 15.4V 6 – Fournaise F1 two stems 8.4 11.0 14.2 8.6Table 5. The synthesis of results regarding the average distance on the second stemVariantAverage distance between clusters1 - 2 2 - 3 3 - 4 4 - 5V 2 – Veneia F1 two stems 14.4 13.5 14.8 13.8V 4 – Rhuen F1 two stems 11.7 14.0 14.7 16.9V 6 – Fournaise F1 two stems 9.6 11.4 12.6 9.466

The process of fruit forming was developed inoptimal conditions, for both one stem and twostems plants. Thus, it was noted that VeneiaF1 hybrid fructified on clusters similarly forboth cases. However, on the second stem, onclusters 1 and 2, the number of fruits wasslightly higher probably due to the optimizationof environmental conditions. For other hybrids,the differences observed were smaller. Thetotal number of fruits on the main stem wascontiguous for studied hybrids, but Veneia F1and Rhuen F1 produced 2-3 more fruits whenthey were pruned with two stems (Table 6).The second stem showed a high regularity offruits formation on each cluster and the totalnumber of fruits was conformable with the oneon the main stem (Table 7).Table 6. The synthesis of results regarding the average number of fruits formed on the main stemAverage number of fruits formed on clusterVariant1 2 3 4 5Total number of fruitsV 1 (Mt) – Veneia F1 one stem 3.3 3.4 4.8 5.2 5.2 21.9V 2 - Veneia F1 two stems 5.3 5.4 4.8 4.8 4.9 25.2V 3 - Rhuen F1 one stem 4.2 3.6 4.9 4.6 4.5 21.8V 4 – Rhuen F1 two stems 4.2 3.7 4.7 5.3 5.6 23.5V 5 – Fournaise F1 one stem 4.7 4.4 4.7 5.1 5.1 24.0V 6 – Fournaise F1 two stems 4.5 5.0 4.1 5.2 5.0 23.8Table 7. The synthesis of results regarding the average number of fruits formed on the second stemAverage number of fruits formed on clusterVariant1 2 3 4 5Total number of fruitsV 2 – Veneia F1 two stems 4.9 4.8 4.6 4.4 3.9 22.6V 4 – Rhuen F1 two stems 3.9 3.6 4.1 4.9 4.7 21.2V 6 – Fournaise F1 two stems 4.3 4.7 3.8 4.7 4.3 21.8Integrating the number of fruits formed onstems, it was ascertained that the second stemproduced lower figures, namely 2-3 less fruitthan the main stem, but overall, the totalnumber of fruits obtained was almost doublefor variants pruned with two stems.Table 8. The synthesis of results regarding the average number of fruits formed on plantAverage number of fruitsVariantMain stemSecond stemTotal number of fruitsV 1 (Mt) – Veneia F1 one stem 21.9 - 21.9V 2 – Veneia F1 two stems 25.2 22.6 47.8V 3 – Rhuen F1 one stem 21.8 - 21,.8V 4 – Rhuen F1 two stems 23.5 21.2 44.7V 5 – Fournaise F1 one stem 24.0 - 24.0V 6 - Fournaise F1 two stems 23.8 21.8 45.6The number of fruits was compassed between21,8 and 25,2 on main stem and 21,2 and 22,6on shoot stem.In what regards the average weight of fruits,there were no significant differences betweenfruits obtained on the main stem and the onesfrom the second stem. However, it wasobserved that fruits formed on the shoot stemwere slightly smaller than the ones from themain stem (Table 9).Pruning plants with two stems brings a roughlyyield doubling on plant level (Table 10). Thisproves to be a great advantage becauseconsidering other features studied, such as thenumber of fruits and their size, it is verycontiguous for both stems. The highest tomatoyield was obtained on Veneia F1 hybridpruned with two stems, 5,2 kg/pl, followed byFournaise F1 with 4,9 kg/pl and Rhuen F1 with4,7 kg/pl.67

Table 9. The synthesis of results regarding the average weight of fruitsAverage weight of fruits on Average weight of fruits on Average weight of fruits Variantmain stem (g)second stem (g)on plant (g)V 1 (Mt) – Veneia F1 one stem 113.9 - 113.9V 2 – Veneia F1 two stems 109.1 108.4 108.8V 3 – Rhuen F1 one stem 120.5 - 120.5V 4 - Rhuen F1 two stems 106.2 103.9 105.0V 5 – Fournaise F1 one stem 112.4 - 112.4V 6 -Fournaise F1 two stems 107.7 105.3 106.5Statistically analysing the fruit quantity onplants pruned with one and two stems, it wasascertained that those pruned with two stemsprovided a higher yield per plant and perfarming area (Table 10).Table 10. Statistic interpretation of results regarding the influence of the number of stems on tomato yieldYieldVariantkg/pl % Gap Meaning kg/m² % Gap MeaningV 1 (Mt) – Veneia F1 one stem 2.5 100 - Mt 7.8 100 - MtV 2 –Veneia F1 two stems 5.2 208 2.7 xxx 13.0 166.6 5.2 xxxV 3 – Rhuen F1 one stem 2.6 104 - NS 8.0 102.6 - NSV 4 – Rhuen F1 two stems 4.7 188 2.1 xxx 11.8 151.3 3.8 xxxV 5 – Fournaise F1 one stem 2.7 108 - NS 8.3 106.4 - NSV 6 - Fournaise two stems 4.9 196 2.2 xxx 12.2 156.4 3.9 xxxDL 5% = 0,3 kg/pl; DL 1% = 0,44 kg/pl; DL 0,1% = 0,63 kg/plDL 5% = 1,18 kg/sqm; DL 1% = 1,69 kg/sqm; DL 0,1% =2,44 kg/sqmCONCLUSIONSThe research conducted on tomato plantspruned with one and two stems can be followedby the next conclusions:The number of seedlings used to start the cropwas reduced with 20% by increasing thedistance between rows up to 100 cm;The quantity of fruits per plant significantlygrew on variants pruned with two stems, F1Veneia F1 hybrid even reaching roughly twiceas many fruits for that particular treatment;The yield per farming area increased due tohigher yield per plant, even though the numberof plants was reduced by 20%;The size of the obtained fruits was appropriatefor the hybrids used;The number of fruits and their size was slightlysmaller on the second stem for all studiedhybrids;Plants proved a highly satisfactory vegetativegrowth, which lead to a similar fruit binding.REFERENCESAra N., Bashar M.K., Begum S, Kakon S.S. 2007. Effectof spacing and stem pruning on the growth and yieldof tomato. Int. J. Sustain. Crop Prod. 2(3), p. 35-39Hoza Gheorghia, Chiorean tefania, Drguin M.D.,2011. Research regarding management systems forplants with two stems, cultivated in solar, Lucrritiinifice, Seria Horticultur, vol 54, nr. 2, Ed. IonIonescu de la Brad, Iai, ISSN 2069-847X, p.157-160.Kanyomeka L., Shivute B., 2005. Influence of pruningon tomato production under controlled environments,Agricultura tropica et subtropica vol. 38(2), pp.79-83.Maboko M.M., Du Plooy C.P., Chiloane S., 2011. Effectof plant population, fruit and stem pruning on yieldand quality of hydroponically grown tomato AfricanJournal of Agricultural Research Vol. 6(22), 12October, ISSN 1991-637X, Academic Journals, p.5144-5148.68

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653TYPE OF TRELLISING AND FOLIAR FERTILIZATION INFLUENCEON YIELD AND QUALITY FOR NEW VARIETIES OF GHERKINS(CUCUMIS SATIVUS L.) WITH PARTHENOCARPIC FRUITINGFlorin Constantin IACOB, Gheorghe CÂMPEANU, Nicolae ATANASIU, Elena CATAN,Gabriela NEAAbstractUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Mrti Blvd., 011464, Bucharest, RomaniaCorresponding author email: fliacob@info.uaic.roThis study was conducted during 2009-2010 in southern Dâmbovita County, in order to determine the impact of foliarfertilization on the production and its quality on five hybrids of cucumber gherkins: Promisa, Trilogy, Karaoke, Kybriaand Componist and were obtained results with significant differences. Hybrids were planted in the same soil type andbearing the same climatic conditions, differences occurred in the production were attributed to variantsstudied. Immediately after establishment of experimental culture, fertilization were made every 10 days withapplication of bio-fertilizer as appropriate technological practices, also were performed observations andmeasurements on the production and quality of the varieties analyzed.Key words: Cucumis sativus L., fertilization, production, quality, gherkins.INTRODUCTIONIn traditional agriculture losses of elementsused in fertilization are important, especially inthe N: P: K case, representing an importanteconomic problem (Guerrero, 1998). Fractionationof fertilization and application in criticalphases is recommended by most researchers(Cadahia, 2000; Guzmán, 2004; Pizarro, 1987).Foliar fertilization creates a positive impact onproduction in most varieties and hybrids(Solorzano, 2001).Researches regarding the technology of cultivationgherkins cucumbers were conducted during2009-2011 in the Tartasesti, DâmbovitaCounty, in the family-owned farm. Taking intoaccount the pedoclimatic conditions of thesouth area of the country and climate conditions,the applied technology present a specialimportance for obtaining high productions andhigh quality. Foliar fertilization represents arare piece of technology applied in the Lunguletu-Brezoaelevegetable basin area (whichincludes Tartasesti), solar crops of vegetablesbeing established in small areas, the most importantare field crops of vegetable, maintainedon the traditional principles of agriculture.Have been attempted combining two elementsof technology, leading and trellising mode of69the plant with foliar fertilization regime, theapproach together of the two elements oftechnology in a area where protected vegetablecrops have a low share will lay the foundationfor future investment in the area (Petrescu,1992; Popescu V and Atanasiu N., 2001)Following research it was observed that thedriving of the plant and foliar fertilization ledto positive results on the production and qualityof gherkins cucumbers, results that support thenecessity of introducing in the technology ofgherkins culture new elements that will comeas a completion of higher genetic potential ofnew hybrids being subject of this study. Themain purpose of this research represents theintroduction of new elements of technology inparallel with the discovery of better hybridsadapted to the climatic conditions of the area.Therefore, research will highlight the followingaspect:- obtaining high yields as a result of foliarfertilization and of the plant leading type ontrellises;- correlation between growing phased andtotal production under the influence oftechnology elements;- productivity of analyzed hybrids.

MATERIALS AND METHODSFor biological material selection were takeninto account first of all the necessity of usinghigh temperature resistant varieties (the Southarea of the country and growing in protectedareas) and very productive. For this wereidentified five RZhybrids (Kybria, Karaoke,Compomist, Trilogy si Promisa). Theexperience was polyfactorial one whereexperimental factors have been the following:- Factor A – Hybrid:A 1 – Kybria;A 2 – Karaoke;A 3 – Compomist;A 4 – Trilogy;A 2 –Promisa.- Factor B – Leading mode:B 1 – The plants were led up to a maximumheight of 2.5 m. The first 30 cm weremaintained without fruit, next 50 cm one fruiton each side sprig preserving all the fruits ofmain stalk nodes, and from ˜ 80 cm has notbeen intervened on the fructification.B 2 – The first 50 cm were maintained withoutfruit, then for the next 50 cm were kept onefruit on side sprig and all the fruit on the mainstem and from 100 cm height were keptabsolutely all the fruit, as illustrated.- Factor C – Foliar fertilization:C 1 – CROPMAX: biological product accordingE.U.C 2 – BIONAT PLUS: product approved bypermit no. 391/16.03.2007.C 2 – BIOLEAFZ: is a liquid plants stimulant.RESULTS AND DISCUSSIONSDuring 2009-2011 the results of plants growthconcerning the stem growing height, number ofsprigs of orders I and II, number of leafs,number of female flowers and number ofrelated fruits appeared, showed somedifferences, thus demonstrating the influence ofexperimental factors on production and itsquality.As a result, at some variants the hight of plantswas different and the number of fruits wasinfluenced by the leading mode of the stem andapplied foliar fertilizer. The differences weremore pronounced at the beginning ofvegetation, first floor of 30 cm and 50 cm highwhich has not have retained fruit having aobvious influence.Figure 1. Trellising schemes used in researchFoliar nutrient solutions applied at the samestage of development of the plant, regardless ofhybrid, had a positive influence on thevegetative growth for variant B 2 (50/100/250),plants having a strictly vegetative growthperiod until they reached the 50 cm height(compared with plants where it was appliedvariant B 1 -30/80/250).In 2009, concerning increase in height ofplants, it was found that the variant B 2 -50/100/250 had higher results compared to B 1 -30/80/250.In 2010, the trends were similar, hybridreaching 234 cm led by the same scheme andfoliar fertilized with the same solution.Maximum height reached in 2010 is detainedalso by Compomist hybrid, but led to thescheme B 1 -30/80/250 and foliar fertilized withCROPMAX.CONCLUSIONSPlants grown after B 1 -30/80/250 leading modeshowed less vegetative growth than plantsgrown after B 2 -50/100/250 leading mode.70

Compomist F1 hybrid reaches value of 239 cmin height in 2009, led by B 2 -50/100/250 schemeand fertilized with BIONAT. In 2010 theresults were similar.Promisa F1 with the scheme B 1 -30/80/250determined a total of 41 fruits representing themaximum number and Trilogy F1 determined19 number of fruits with the scheme B 2 -50/100/250 in the year 2009.REFERENCESCadahia C., Fertirigarea culturilor horticole si ornamentale,Editura Mundiprensa, Venezuela, 2000Guerrero R., Fertilizarea culturilor din clima rece,Volumul 3, Editura Monómero Colombo Venezolano,Colombia, 1998Guzmán M., Fertilizare, populatie, apa, sol si fertilizanti,Editura Almería, España, 2004Petrescu C., Legumicultura, Ed. Didactica si Pedagogica,Bucuresti, 1992Pizarro F., Riego Localizado de Alta Frecuencia,Mundiprensa, Madrid, España, 1987Popescu V., Atanasiu N., Legumicultura, Volumul 2, Ed.Ceres, Bucuresti, 2001Solorzano P., Manual pentru fertilizarea culturilor inVenezuela, Editura Agroisleña, Venezuela, 2001VARIANTNo.HYBRID123456789101112131415161718192021222324252627282930A 1 - KybriaA 2 - KaraokeA 3 -CompomistA 4 - TrilogyA 5 - PromisaA 1 - KybriaA 2 - KaraokeA 3 -CompomistA 4 - TrilogyA 5 - PromisaA 1 - KybriaA 2 - KaraokeA 3 -CompomistA 4 - TrilogyA 5 - PromisaA 1 - KybriaA 2 - KaraokeA 3 -CompomistA 4 - TrilogyA 5 - PromisaA 1 - KybriaA 2 - KaraokeA 3 -CompomistA 4 - TrilogyA 5 - PromisaA 1 - KybriaA 2 - KaraokeA 3 -CompomistA 4 - TrilogyA 5 - PromisaTable 1. Records of growing and developping of plants, Tartasesti, 2009Plant No. of tillersheightTipe.Tipe.LEADING FERTILIZATION(cm) I IIB 1(30/80/250)B 2(50/100/250)B 1(30/80/250)B 2(50/100/250)B 1(30/80/250)B 2(50/100/250)C 1CROPMAXC 2BIONATC 3BIOLEAFZ22821523222622423023823222522922823621022425722423623921822420822223523822721622121923323017121412111091210812913151291171210141016121112811119241920232917192214192217212319241923201928302520261814212219No. ofleafs646965727368706174776167647668696663696762697074696472716866No. offlowers312938424632343142403935383938333129404342293631444134283633No. of relatedfruits25273137402825243834322935303627292529354024322941382921192871

VARIANTNr.HYBRID123456789101112131415161718192021222324252627282930A 1 - KybriaA 2 - KaraokeA 3 -CompomistA 4 - TrilogyA 5 - PromisaA 1 - KybriaA 2 - KaraokeA 3 -CompomistA 4 - TrilogyA 5 - PromisaA 1 - KybriaA 2 - KaraokeA 3 -CompomistA 4 - TrilogyA 5 - PromisaA 1 - KybriaA 2 - KaraokeA 3 -CompomistA 4 - TrilogyA 5 - PromisaA 1 - KybriaA 2 - KaraokeA 3 -CompomistA 4 - TrilogyA 5 - PromisaA 1 - KybriaA 2 - KaraokeA 3 -CompomistA 4 - TrilogyA 5 - PromisaTable 2. Records of growing and developping of plants, Tartasesti, 2010.Plant No. of tillersheightTipe.Tipe.LEADING FERTILIZATION(cm) I IIB 1(30/80/250)B 2(50/100/250)B 1(30/80/250)B 2(50/100/250)B 1(30/80/250)B 2(50/100/250)C 1CROPMAXC 2BIONATC 3BIOLEAFZ2232192382372252362232112352282292342182202172262322342212092232252312142292272242332302291013151216119111210111612101110108119121115111691210138212218212719182417212421172224222124182131272422252017192317No. ofleafs616467747066686477796066677269656460586568716672686263737170No. offlowers293036464334332947443836334039283531413840313532424032263839No. of relatedfruits26262841392728263933313225383626312430332725312836333225243272

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653EFFECT OF FOLIAR FERTILIZATION ON THE CHEMICALCOMPOSITION OF FIVE GHERKINS FRUIT HYBRIDS(CUCUMIS SATIVUS L.) GYNOECIOUS TYPEAND PARTHENOCARPIC FRUCTIFICATIONFlorin Constantin IACOB, Gheorghe CÂMPEANU, Nicolae ATANASIU, Elena CATAN,Gabriela NEAAbstractUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Marasti Blvd., Bucharest, RomaniaCorresponding author email: fliacob@info.uaic.roLarge number of gherkins type cucumbers varieties and hybrids emerging as a result of increasing demands frompretentious consumers related to quality aspects such as shape, color, firmness, appearance and capacity of storage,have led in time to change culture technology, foliar fertilization having a key role to achieve these goals, withoutknowing in detail the long-term influence on the chemical composition of the fruits used or human consumption.Therefore, this study comes to support clarification of these issues. As a result of data obtained concerning chemicalcomposition of the fruits of five cucumber gherkins hybrids: Promisa, Trilogy, Karaoke, Kybria and Componist andinterpreted in the USAMVB it was concluded that it differs depending on fruit size and age at which they were collected.Soil pH, fertilizer pH which is applied to leaf and the degree of hydration of the fruits has a direct influence on thechemical composition.Key words: Cucumis sativus L., fertilization, fruits, number, quantity.INTRODUCTIONChemical composition represents an importantfactor with direct influence on fruits quality ofgherkins cucumber. Information concerning theamount of different chemicals can be obtainedfrom the analysis of dry matter and organicacid titration. Concentrations of these organiccompounds in fruits are different depending onthe cultivar and strongly influenced by theirland reserve, which can be found in the form ofions, being picked up by plants (Rivis, 2004).In order to obtain conclusive results is veryimportant to know the exact amounts ofsubstances (N-NH 4 , N-NO 3 , P, K) in the soiland their concentrations in the solutions used tofoliar fertilization.In one plant exist at one point all commonfructification elements: flowers, small, mediumand large fruit, located to a distance less orgreater than the radicular system having asignificant influence on the chemical compositionof gherkins cucumber fruits. Resultsfollow in the first place nitrates and nitritesroute from the moment of foliar fertilizationthrough fruit until using them in closecorrelation with their quantities in the soil.According to studies on the pollution ofhorticultural products where there is a balanceddiet, approximately 75-80% of nitrate derivedfrom vegetables, nearly 15-20% from water andsomewhere in the 5-7% from meat and milk.Their accumulation in different organs of theplant depends on the speciesWith 1349 samplesto Cucumis sativus L. and its varieties originatingin China, India and Turkey, The U.S.National Plant germplasm is the largest in theworld.MATERIALS AND METHODSTo accomplish this work were studied fivedifferent variants (for five hybrids Promisa,Trilogy, Karaoke, Kybria and Componist) onwhich foliar fertilization was performed withCropmax product. The pH of the culturesubstrate (soil in which was embedded wellfermented manure) was 7.4 for Trilogy and73

Componist variants, 7.5 for Kybria variant and7.6 for Karaoke and Promisa variants.Experimental field was conducted in a largesolar farm, the culture being founded in thesummer of 2010 from seedlings personallyobtained. After soil analysis were obtainedresults which gives to the soil good fertility, N-NH4 content range between 18,25-51,30 ppm,N-NO3-136,7-356,2 ppm, P-28,4-42,1 and K-178,2-223,5 ppm.During the experiment of the summer of 2010soil samples were taken for each variant andfruit samples for each category according tosize (3-6 cm, 6-9 cm, 9-12 cm).RESULTS AND DISCUSSIONSThis study followed the route up to the fruitslevel of nitrogen compounds based onmonofactorial research conducted. Samplescollected were analyzed in the Laboratory ofBiotechnologies of USAMVB and after obtainingthe results we could notice that in mostcases they did not exceed permissible levels ofquality standards.Table 1. Experimental results concerning nitrogencontent of gherkins fruit.CultivarN soil,ppmN fruits(3-6 cm),ppmN fruits(6-9 cm),ppmN fruits(9-12 cm),ppmTrilogy F1 161.45 144.4 152 120Karaoke F1 266.60 285 76 95Promisa F1 226.85 456 114 105ComponistF1281.09 114 323 95Kybria F1 386.78 76 95 114Nitrogen content ranged between ranged from76.00 to 323.00 ppm values in fruits and onlyin one case it exceeded the permissible limit of400.00 ppm (Promisa hybrid sample of smallfruit 3-6 cm, where the value of was 456 ppm).By considering the following aspects:vegetation period was equal for all studiedhybrids, irrigation was performed using auniform system of drip irrigation and foliarfertilization was achieved with the sameproduct, we believe that small differencesbetween the results obtained cannot be madeonly on account of hybrid, is being in closecorrelation with fruit size. Maximum permittedlimit for nitrogen and its compounds in fruitsgherkins is 400 ppm.74Figure 1. Experimental results representation concerningnitrogen content of gherkins fruit.After analyzing the results we can distinguishas follows: for hybrid Promised starting from aconcentration of 226.85 ppm nitrogen in thesoil can be seen a sharp increase in itsconcentration to small fruit stage 3-6 cm with avalue of 456.00 ppm, then decreased to a levelof 105 ppm for large fruit stage 9-12 cm. Thisthreshold which has exceeded the permissiblelimit by 56 ppm not constituted a risk to humanhealth; the fruits of this size are only collectedfor laboratory analysis. According to analyzesof fruits, in the case of Phosphorus the valuesranged from 179.92 to 193.76 ppm for differentfruit sizes of Componist hybrid, observing aslight decrease in concentration as the fruitincreases in size.Table 2. Experimental results concerning phosphoruscontent of gherkins fruit.P soil, P fruits (3-6 P fruits (6-9 P fruits (9-Cultivarppm cm), ppm cm), ppm 12 cm), ppmTrilogy F1 28.4 373.68 553.6 420.1Karaoke F1 32.5 664.32 664.32 512.08Promisa F1 34.1 809.64 588.2 511.3ComponistF142.1 193.76 186.84 179.92Kybria F1 40.2 276.52 560.52 449.8

Figure 2. Experimental results representation concerningphosphorus content of gherkins fruitTable 3. Experimental results concerning potassiumcontent of gherkins fruits.CultivarK soil,ppmK fruits (3- K fruits (6-6 cm), ppm 9 cm), ppmK fruits (9-12 cm),ppmTrilogy F1 185.2 2840 2620 2560Karaoke F1 223.5 3080 2740 2570Promisa F1 215.8 2840 2620 2490ComponistF1178.2 2840 2980 2540Kybria F1 180.2 3340 2620 2700For Karaoke and Promisa hybrids can beobserved sudden decline of P values from664.32 and 809.64 ppm for 3-6 cm fruits to Pvalues of 512.08 or 511.3 ppm for 9-12 cmfruits. Trilogy and Kybria presents onemaximum concentration peak for 6-9 cm fruits,with values of 553.60 ppm and 560.52 ppmrespectively, after which it decreased to 420.1and 449.80 ppm for 9-12 cm fruits.For potassium, as can be seen from the figure 3,the differences are not significant, theconcentrations of all the studied variants beingin the range of 2620 ppm to 3080 ppm, with aslight peak concentration of 3340 ppm forKybria hybrid with 3-6 cm fruits.Figure 3. Experimental results regarding concerningpotassium content of gherkins fruits.CONCLUSIONSIn most cases N content was within normallimits. In the case of Promisa hybrid version(fruit 3-6 cm) was found a high value of Nconcentration that exceeding by 56 ppm thenormal concentration. Growing season,irrigation and the product used for foliarfertilization had no influence on the N amountin the fruits level, variations are due to thestudied hybrid and are based on its ability tosynthesize nitrogen compounds. Phosphorusconcentration varies depending on the size ofthe fruit and the hybrid used. Potassiumanalysis showed significant differences.REFERENCESAlexa E., Contaminanti în produsele horticole sicerealiere, Ed. Solness, Timisoara, 2008Radulescu H., Goian M., Tehnica experimentala, Ed.Mirton, Timisoara, 1999Rivis A., Contaminanti agroalimentari, Ed. Eurostampa,Timisoara, 2004National Plant Germplasm System: Csativus [en linea]75

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653AbstractEFFECT OF FOLIAR FERTILIZER ON GROWTH AND YIELDOF SEVEN POTATO CULTIVARS (SOLANUM TUBEROSOM L.)Ali Husain JASIMUniversity of Babylon, Babylon, IraqCorresponding author email: alihjassim@yahoo.comAn experiment was conducted out during 2009 to study the effect of spraying numbers (0, 2 and4 ) of Alaska foliarfertilizer (N:12, P 2 O 5 :12, K 2 O:36, Fe:0.05%, Cu:0.005%, Mn:0.03% , Zn:0.01% , B: 0.02% , Mo:0.003% ) on growthand yield of 7 potato cvs. (Draga, Aladin, Elpaso, Kurado, Diseree, Provento and Red Brown). Factorial experimentincluded 21 treatments arranged in Random Complete Bloke Design (RCBD) with 4 replications. Results showed thatfoliar fertilizer had a significant effect on plant height, tuber weight and total yield. Potato cvs. differ in all studiedparameters. High yields were obtained from Red Brown, Provento and Draga cvs. Interactions had a significant effecton the most studied parameters.Key words: foliar fertilize , potatoes cultivars.INTRODUCTIONincrease total and/or marketable tuber yield(Kara, 2002; Zebarth et al., 2004; Zelalem etPotato (Solanum tuberosum L.) is the mostal., 2009). It is suggested that late applicationimportant tuber crop, and it is the fourth worldof N in foliar sprays can be benefit to potatocrop after wheat, rice and maize. Moreover,crop with a long growing season and reducepotato is an important vegetable and a goodenvironmental losses of N.source of antioxidants (Chen et al., 2007).Phosphor application significantly increasedAlthough potato is quite adaptable to plantingplant height, marketable tuber yield andconditions, it has, as every culture, certainmarketable tuber number (Zelalem et al.,requirements for ecological conditions.2009). One of the major problems in the use ofStability of a varieties features and preservingphosphate fertilizer is the fixation of appliedquality in different conditions has greatphosphate by the soil. Foliar P applicationimportance; total and graded yield and qualityresulted in higher tuber yield (Ekelof,factors are affected by cultivars and location2007). Application of K increases plant(Tomasiewicz et al., 2003; Haase et al., 2005).height and crop vigour. It increases both theBoth yield and quality of potato are affected byrate and duration of tuber bulking. Itscultivar, environmental conditions and culturalapplication assists in the translocation ofpractices. In trial with Burren, Arnova andcarbohydrates from leaves to tubers. PotassiumAladin cv., Burren was a superior in yield, butincreases the size but not the total number ofArnova was super in tuber mean weighttubers (Trehan et al., 2001). Foliar application(Kadum, 2011).of K increased potato tuber yield. TheFertilizer application has important effects onincreasing of foliar K fertilizer rates (2.5%)the quality and yield of potato (Westermann,was associated with the highest yield (Habib et2005). Uptake of fertilizer nutrients (NPK) byal., 2011). Foliar application of micronutrientspotato per unit area and time is high because ofhas been one of the approaches to achieve anthe rapid rate of early growth and tuberimprovement the nutritional status, yield ofbulking. Foliar fertilization has potential for anpotato end to optimize use of chemicalimportant role in potato production.fertilizers (Khalifa et al., 2003). Potato plantsNitrogen supply plays an important role in thefoliar treated with Unigreen (containing macrobalance between vegetative and reproductiveand micronutrients) 2.5 g/l and Solu Potashgrowth for potato (Alva, 2004). Many previous(50% K 2 O) 3.0 g/l gave higher total yield andstudies have shown that N applications canhigher number of marketable tubers per plant77

and total number of tubers per plant (AbdulRasool et al., 2010).The present investigation aimed to study theresponse of 7 Potato cultivars to the number offoliar fertilizer sprays.MATERIALS AND METHODSA field experiment was carried out on a farm15 km south of Hilla, during 2009 to study theeffect of spraying numbers (0, 2 and 4) ofAlaska foliar fertilizer (N:12, P 2 O 5 : 12, K 2 O:36, Fe: 0.05%, Cu: 0.005%, Mn: 0.03%, Zn:0.01%, B: 0.02%, Mo: 0.003%) on 7 potatovarieties (Draga, Aladin, Elpaso, Kurado,Diseree, Provento, and Red Brown) obtainedfrom Nahar Alawrad Company. Factorialexperiment included 21 treatments arrangementin Random Complete Bloke Design (RCBD)with 4 replications.Potato seed Tubers were sown on 6 Feb. at 25cm apart in the rows. Each plot consisted of 3rows, each of five meters in length and 70 cmwide. The plot area was 10.5 m. DAP fertilizerwas added at the rate of 200 kg/ha dressing 10cm bellow the tubers. The first foliar spray wasmade after 40 days, in which plants wereblossoming and were at the early tuber setstage. The other foliar sprays were made atweakly intervals. Plant length (cm), number ofshoots was determined at 90 days afterplanting. At harvesting (21 May), fresh tuberyield were recorded in terms of number oftubers per plant and tuber weight as well astotal yield.The obtained data were subjected to theanalysis of variance procedure and treatmentmeans were compared to the L.S.D. testaccording to Steel and Torrie, 1980.RESULTS AND DISCUSSIONSData presented in (Table 1) showed that, lengthof potato plants were significantly increased asa result of plant spraying with Alaska fertilizercompared with the control treatment. Inaddition, there were no significant differencesbetween 2 or 4 foliar times of sprays. Theincreases in plant height may be due to the roleof such macro and micro nutrients in thephysiological process and cell division andelongation which indirectly affect tissueformation and consequently vegetative growth78of plant. These results are in good accordancewith those obtained by (Khalifa et al., 2003;Abdul Rasool et al., 2010; Kadum, 2011).The varieties had a significant effect in plantheight. It appeared that it was related to type ofvarious varieties, (Tafi et al., 2010). Theinteraction had a significant effect also.Table 1. Effect of Varieties and Foliar High-K FertilizerNumber on Plant Height (cm)Average 4 time 2 timevar. spray spraycontrol Var.64.3 68 66 59 Draga56.3 63 56 50 Aladin65.7 67 68 62 Elpaso55.7 62 59 46 Kurado62.7 69 68 51 Diseree65.0 69 72 54 Provento56.3 61 59 49 Red BrownAverage of- 65.6 64 53sprayL.S.D. 0.05 var. = 3.1 fertilizer = 2.03 interactions = 5.37Results in (Table 2) showed that foliar fertilizerhad no significant effect on stem numbers.Potato varieties had a significant effect on stemnumbers, and Elpaso had the largest than othercultivars, it gave 4.6 stem which reachedsignificant only with Aladin that gave 4.0cm.In fact the stem numbers are formed afterplanting and before adding foliar fertilizer andcannot affect by it. It can be mentioned that thestem number in different cultivars is as one ofthe internal and compatible characteristicsaffected by the plant environmental condition(Henricksen and Molgaard, 2005).Table 2. Effect of Varieties and Foliar High-K FertilizerNumber on Stem NumbersAverage 4 time 2 timevar. spray spraycontrol Var.4.27 4.2 4.4 4.2 Draga4.00 4.2 4.1 3.7 Aladin4.60 4.7 4.7 4.4 Elpaso4.27 4.3 4.1 4.4 Kurado4.17 4.4 4.2 3.9 Diseree4.30 4.3 4.6 4.0 Provento4.17 4.2 3.9 4.1 Red BrownAverage of- 4.3 4.3 4.1sprayFoliar fertilizer caused an increase in tuberweight as compared with control (Table 3).Four times of foliar fertilizer had no significanteffect on this parameter as compared with two

times. It may be attributed to the increase invegetative growth by fertilizer and in the roleof potassium in translocation of producedphotosynthetic assimilates and its accumulationin storage organs (Habib et al., 2011). Haederet al., (1973) indicated that with adequate Knutrition two thirds of the labeledphotosynthesis product passed within one dayinto the tubers when after flowering intensivegrowth of tubers set in. With insufficient Ksupply only half of the photosynthesis productwas translocated to the tubers during the sameperiod Draga and Aladin varieties weresuperior in this parameter as compared to othervarieties. It may be a variety characters. Theinteractions had a significant effect and Draga+4 time sprayed was significant as comparedwith all interactions.Table 3. Effect of Varieties and Foliar High-K FertilizerNumber on Tuber Weight (gm)Average 4 time 2 timevar. spray spraycontrol Var.71.2 76.8 71.9 65.0 Draga63.6 63.4 63.4 64.0 Aladin59.0 59.0 60.6 57.5 Elpaso57.0 58.2 56.0 56.6 Kurado57.3 56.5 58.9 56.6 Diseree57.8 56.8 57.2 59.6 Provento60.1 62.9 59.9 57.5 Red BrownAverage of- 62.0 61.1 59.6sprayFoliar fertilizer caused a significant effect onyield as compared with the control (Table 4). Itcould be concluded that increasing productivityof potato plants as a result of foliar fertilizer,may be due to increased in weight and numbersof tuber/plant which in turn increased the totaltubers yield (ton/h.). This effect might be dueto that potassium plays an important role in thetransport of assimilates and nutrients (Allisonet al., 2001) as well as the enhanced effect ofother materials contents of the fertilizer. Thesefindings were supported by previousinvestigators such as (Habib et al., 2011; El-Sirafy et al., 2008). The interactions had asignificant effect and Draga+4 time sprayedgave the highest, which differed significantly ascompared with Aladin and Elpaso interaction.These results agreed with (Kadum, 2011).79Table 4. Effect of Varieties and Foliar High-K FertilizerNumber on Tuber Yield (ton/h)Average 4 time 2timevar. spray spraycontrol Var.27.999 29.553 30.045 21.398 Draga21.873 23.693 25.094 16.894 Aladin20.602 21.737 22.022 18.049 Elpaso23.403 26.265 24.640 19.304 Kurado23.829 25.975 27.297 18.357 Diseree23.480 25.595 24.525 20.320 Provento24.116 26.9654 27.666 17.718 Red BrownAverage of- 25.683 25.899 18.959sprayL.S.D. 0.05 var. = 2.543 fertilizer = 1.665 interactions =4.403CONCLUSIONSPotato cultivars differ in growth and yieldbecause of the differences in inheritance andthe ecological conditions. Experiments couldbe made to select the best cultivar to the localconditions. This study was done to evaluateseven cultivars with foliar fertilizer at southregion of Babylon. it could be concluded thatpotato plants foliar with fertilizer contain highpotash, caused an improve in growth and tubersyield per unit area, and it can also recommendthat planting Red Brown, Provento and Dragavarieties in south region of BabylonGovernorate.REFERENCESAbdul Rasool I.J., Al-Jebory K.D.H., Al-Sahaf F.H.,2010. Effect of foliar application of unigreen and solupotash on yield and quality of potato tuber. Jordan J.Agric. Sci., 6 (1), p. 111-119.Allison M.F., Fowler J.H., Allen E.J., 2001. Response ofpotato (Solanum tuberosum) to potassium fertilizers.J. Agric. Sci., Cambridge, 136, p. 407-426.Alva A., 2004. Potato nitrogen management. J. Veg.Crop Prod., 10, p. 97-130.Chen Q., Su J., Nandy S., Kereliuk G., 2007. Screeningpotato genotypes for antioxidant capacity and totalphenolics. Plant Canada Congress.Ekelof J., 2007. Potato yield and tuber set as affected byphosphorus fertilization. M.Sc. thesis, SwedishUniversity of Agricultural Sciences.El-Sirafy Z.M., Abbady K.A., El-Ghamry A.M., El-Dissoky R.A., 2008. Potato yield quality, quantityand profitability as affected by soil and foliarpotassium application. J. Agric. Biol. Sci., 4 (6), p.912-922.Food and Agriculture Organization of the UnitedNations. International Year of the Potato, 2008.www.potato2008.orgHaase T., Krause T., Haase N. U., Bohm H., Loger R.,He J., 2005. Effect of location and cultivar on yield

and quality of organic potatoes for processing tocrisps. Abstracts of 16th Triennial conference of theEAPR, Bilbao, pp: 699-703.Habib H.A.M., Shafeek M.R., Zaki M.F., El-Shal Z.S.,2011. Response of potato plants to foliar applicationwith different sources of potassium. Int. J. Acad.Res., 3 (3), Part 1.Haeder H.E., Mengel K., Forster H., 1973. The effect ofpotassium on translocation of photosynthates andyield pattern of potato plants. J. Sci. Food Agric., 24(12), p. 1479-1487.Henricksen, C.B., Molgaard J.P., 2005. The effect oftiming of ridging on soil nitrogen and potato tuberyield quality. Potato Res., 32, p. 81-89.Jenkins, P.D., Ali H., 2000. Phosphorus supply andprogeny tuber numbers in potato crops. Ann. Appl.Biol., 136, p. 41-46.Kadum, E.A.H., 2011. Effect of spraying organicfertilizer (Humus) on growth and yield of threepotato cultivars. M.Sc. Thesis, Agric. Coll., KufaUniv.Kara K., 2002. The effects of nitrogen and phosphorusapplications in various planting time and at differentdoses on quality. 3rd National Potato Congress,Izmir, Turkey, pp: 347-363.Khalifa R., Kh M., Nofal O.A., Badran N.M., 2003.Influence of foliar feeding with micronutrients on theyield and nutritional status of winter potato var.Diamond. Ann. Agric. Sci., Ain Shams Univ., Cairo,48 (2), p. 473-483.Tafi M., Siyadat S.A., Radjabi R., Mojadam M., 2010.The effect of earthing up on the potato yield inDezful weather condition. Middle-east J. Sci. Res., 5(5), p. 392-396.Tomasiewicz D., Harland M., Moons B., 2003. Irrigationguide to commercial potato production on theCanadian Prairies. Western Potato Council ofCanada, p. 55-60.Trehan S.P., Roy S.K., Sharma R.C., 2001. Potatovariety differences in nutrient deficiency symptomsand responses to NPK. Better Crops International.Potash and Phosphate Institute of Canada (PPIC), 15,p. 18-21.Westermann D.T., 2005. Nutritional requirements ofpotatoes. Amer. J. Potato Res., 82, p. 301-307.Zebarth B.J., Leclerc Y., Moreau G., Botha E., 2004.Rate and timing fertilization of Russet Burbankpotato: yield and processing quality. Can. J. PlantSci., 84, p. 855-863.Zelalem A., Tekalign T., Nigussie D., 2009. Response ofpotato (Solanum tuberosum L.) to different rates ofnitrogen and phosphorus fertilization on vertisols atDebre Berhan, in the central highlands of Ethiopia.Africa. J. Plant Sci., 3, p. 16-24.80

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653PEACH CROP PROTECTION IN SUSTAINABLE AGRICULTURECONDITIONS IN SMALL AND MEDIUM FARMSVasile JINGA 1 , Carmen LUPU 1 , Roxana DUDOIU 1 , Andreea PETCU 2 , Gigel-Gabriel LUPU 3Abstract1 Research-Development Institute for Plant Protection Bucharest,8 Ion Ionescu de la Brad Blvd., District 1, 71592, Bucharest, Romania2 Research and Development Station for Fruit Tree Growing-Baneasa,4 Ion Ionescu de la Brad Blvd, District 1, Bucharest, Romania3 University of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Marasti Blvd., Bucharest, RomaniaCorresponding author email: vasile.jinga@icdpp.roScientific work aims to promote disease management systems of fruit trees stone group (peach), using chemicaltreatment methods with low impact on the environment and human health, which contribute to increase crop qualityand quantity. Research has been conducted on peach species cultivated in Research and Development Station for FruitTree Growing-Baneasa, Bucharest, in the climatic conditions of the year 2012. Stigmina carpophila was the pathogenfor which measures have been taken for its prevention and control. Treatments against pathogen were applied atwarning, depending on the biological reserve of the vegetation period and the climate evolution in that year. Among thefive fungicides used, the best results were obtained with the products Score 250 EC and Systhane C PU.Key words: peach orchard, disease control, ARM software.INTRODUCTIONPrunus persica L. culture has a high economicvalue on national as well as on internationallevel. Production and fruits marketing is thegoal of an intense modern trade. Annually, thetrees suffer from attacks of various pathogenscausing crop diseases which develop dependentto the climate conditions of the year and to thecultivated variety (Ivascu, 2002; Delian, 2006).Long term use of pesticides in pomiculture andignoring its side effects, have had negativeconsequences towards the environment (Hozaet al., 2000; Burzo et al., 2005). Nowdays, themore severe requirements regarding theenvironment protection and health orchards ledto the development of ecological selectivemethods (Toncea, 2001) specifically for thecrops pest control (Jinga et al., 2008). Thetreatments applied during the vegetation perioddetermine the improvement of the yield’squality and quantity (Delian et al., 2012).MATERIALS AND METHODSThe evaluation of several plant protectionproducts efficacy against the main studiedpathogens for the peach culture was developed81during several visits at the Research andDevelopment Station for Fruit Tree Growing-Baneasa. There were taken biological samples(plants with pathogen attack symptoms) fromthis orchard and there were isolated the mainpathogen agents. The isolated pathogens wereused in laboratory experiments for testing thesenew plant protection products proposed in thetechnology. After the laboratory trials, therewere also performed field treatments, duringthe spring season, in the vegetation period, withfungicides, followed by establishing theefficacy of the tested products. In the Prunuspersica L. orchard there were carried outtreatments in order to prevent and control theattack of the main fruit’s pathogens. The attackrate was calculated with the formulas RA%=F*I/100, F%-frequency of the attacked organs,I – intensity of the organ’ attack. The testedpeach variety was Victoria, which is a sensitiveone. During the laboratory trials was tested thebiological action of the following products:Dithane M45, Bravo Folicur Solo 250EW,Score 250 EC and Systhane C PU. It was useda method based on the inclusion of the testedfungicide into the PDA medium, in 5 differentconcentrations. The medium was poured in

Petri dishes, the pathogenic fungi were placedon the medium, and it was observed the growthof the colonies compared to control fungi,growth on medium without fungicide (Baicu etal., 1996; Severin et al., 2001). For eachfungicide concentration was calculated theinhibition percent of the mycelium growth(Alexandri, 1982; Geamanu, 2006).The field trials of the fungicides selected afterthe laboratory tests were made in the 2012spring season. There were used the followingvariants:V1 = untreated controlV2 = Dithane M45 0.2% concentrationV3 = Bravo 500 SC 0.15% concentrationV4 = Folicur Solo 250 EW 0.1% concV5 = Systhane C PU 0.1% concentrationV6 = Score 250 EC 0.02% concentrationWeather conditions during application:Table 1. 1 st treatment 04-04-2012Temperature of air19.2°CRelative humidity 54%Wind speed 0.8Wind directionNCloud cover (%) 0Rainfall with 1 week before of spraying0.4 mmRainfall with 2 weeks after spraying0 mmFirst rainfall after spraying and its amount 15-05-2012Table 2. 2 nd treatment 06-05-2012Temperature of air13.9°CRelative humidity 72%Wind speed 0.5Wind directionNECloud cover (%) 0Rainfall with 1 week before of spraying0.4 mmRainfall with 2 weeks after spraying3.4 mmFirst rainfall after spraying and its amount 19-05-2012Table 3. 3 rd treatment 09-06-2012Temperature of air19.6°CRelative humidity 64%Wind speed 0.7Wind directionNCloud cover (%) 0Rainfall with 1 week before of spraying0 mmRainfall with 2 weeks after spraying0 mmFirst rainfall after spraying and its amount 24-06-2012There were applied 3 treatments on the 4 thApril, 6 th May and 9 th June, in accordance withthe meteorological conditions, and theobservations took place 8 days after eachtreatment, taking into account the frequency(PESING) and the intensity (PESSEV) of theattack. The observations targeted the Stigminacarpophila pathogen which produces the shothole disease (Figure 1).The treatments were carried out using theSOLO atomizer pump (Figure 2).Studies regarding the experimental models ofthe proposed technology took place in an 8years Prunus persica L. orchard, at Researchand Development Station for Fruit TreeGrowing-Baneasa, in order to establish the rateof infectious load from this area.It was used the classical testing method whichconsist in 6 variants in 4 replications with 5trees per each variant in random disposal.82

Figure 1. Shot hole and fruit stain produced by StigminacarpophilaFigure 2. Treatments in vegetation periodRESULTS AND DISCUSSIONSThe biological action of some fungicides on thedevelopment of Stigmina carpophila funguscolonies on leaves and fruits is presented inTable 4.Table 4. Biological action of some fungicides on the development of fungus colonies Stigmina carpophilaColony diameter (mm) at conc.%Inhibition percent at conc.%Product0,2 0,1 0,05 0,025 0,015 0,2 0,1 0,05 0,025 0,015Dithane M 45 0 7 10 16 20 98,6 70,0 65,0 37,1 11,5Bravo 500 SC 0 8 20 25 41 100 80,5 70,5 20,0 14,8Folicur Solo 250 EW 0 0 8 10,5 15 100 91,4 88,6 75,0 50,1Systhane CPU 0 0 8 19 31 100 100 78,5 58,6 42,5Score 250 EC 0 0 0 0 0 100 100 100 87,1 51,5Control70 mmBased on the data presented in Table 4 wereselected the products and their optimal concentrationwhich will further be used during thefield trials in order to control the fungusStigmina carpophila.The products with very good biological actionwere: Folicur Solo 250 EW in 0.1% concentration,Systhane C PU in 0.05% concentration,Score 250 EC in 0.02% concentration, Bravo500 SC in 0.2% concentration, Dithane M 45 in0.2% concentration.During the experiments there were taking intoaccount the 100% fungi inhibition in accordancewith the various factors acting towardsplants.The results obtained in field during the vegetationperiod are presented in Tables 5 and 6.Table 5. The frequency and intensity of the Stigmina carpophila attackTreatment product namePESINC PESSEV PESINC PESSEV PESINC PESSEV% % % % % %04.04.2012 09.05.2012 12.06.2012R 1 27.0 12.0 39.0 12.0 52.0 16.0Variant 1R 2 19.0 10.0 27.0 16.0 43.0 20.0R 3 28.0 9.0 34.0 14.0 48.0 23.0R 4 31.0 12.0 31.0 16.0 51.0 20.0Average 26.3 10.8 32.8 14.5 48.5 19.8R 1 16.0 6.0 20.0 11.0 21.0 13.0Variant 2R 2 12.0 4.0 18.0 12.0 31.0 21.0R 3 17.0 5.0 15.0 6.0 24.0 14.0R 4 14.0 4.0 21.0 10.0 28.0 12.0Average 14.8 4.8 18.5 9.8 26.0 15.0Variant 3 R 1 17.0 5.0 17.0 15.0 20.0 9.083

Variant 4R 2 11.0 4.0 15.0 7.0 22.0 10.0R 3 16.0 4.0 16.0 5.0 17.0 8.0R 4 9.0 5.0 12.0 8.0 21.0 10.0Average 13.3 4.5 15.0 8.8 20.0 9.3R 1 10.0 3.0 16.0 7.0 17.0 6.0R 2 12.0 5.0 10.0 4.0 19.0 7.0R 3 9.0 4.0 12.0 6.0 21.0 8.0R 4 11.0 6.0 14.0 3.0 14.0 7.0Average 10.5 4.5 13.0 5.0 17.8 7.0Treatment product namePESINC PESSEV PESINC PESSEV% % % %PESINC%04.04.2012 09.05.2012 12.06.2012R 1 14.0 7.0 11.0 4.0 11.0 7.0Variant 5 R 2 12.0 4.0 12.0 6.0 16.0 5.0R 3 16.0 4.0 14.0 5.0 14.0 8.0R 4 10.0 5.0 13.0 6.0 16.0 4.0Average 13.0 5.0 12.5 5.3 14.3 6.0Variant 6PESSEV%R 1 10.0 5.0 7.0 5.0 11.0 6.0R 2 12.0 4.0 10.0 4.0 12.0 5.0R 3 9.0 4.0 12.0 3.0 9.0 4.0R 4 8.0 3.0 11.0 3.0 10.0 3.0Average 9.8 4.0 10.0 3.8 10.5 4.5Table 6. Processing of data from the three treatments applied in the vegetation periodVariantTreatmentProduct NamePESINC PESSEV PESINC PESSEV PESINC PESSEV% % % % % %04.04.2012 09.05.2012 12.06.20121 Variant 1 26.3 a b 10.8 32.8 a a 14.5 48.5 a a 19.82 Variant 2 14.8 b 4.8 b 18.5 b 9.8 b 26.0 b 15.0 b3 Variant 3 13.3 b 4.5 b 15.0 bc 8.8 b 20.0 c 9.3 c4 Variant 4 10.5 b 4.5 b 13.0 c 5.0 bc 17.8 c 7.0 cd5 Variant 5 13.0 b 5.0 b 12.5 c 5.3 bc 14.3 cd 6.0 cd6 Variant 6 9.8 b 4.0 b 10.0 c 3.8 c 10.5 d 4.5 dLSD (P=.05) 4.56 1.59 4.32 3.57 4.85 3.41Standard Deviation 3.02 1.05 2.87 2.37 3.22 2.27CV 20.74 18.88 16.91 30.27 14.09 22.1Bartlett's X2 6.773 3.184 5.618 8.991 4.713 10.298P (Bartlett's X2) 0.238 0.672 0.345 0.109 0.452 0.067Replicate F 1.270 2.050 1.114 1.166 0.462 1.136Replicate Prob (F) 0.3204 0.1501 0.3746 0.3555 0.7131 0.3662Treatment F 15.787 23.460 33.049 11.431 71.803 27.351Treatment Prob (F) 0.0001 0.0001 0.0001 0.0001 0.0001 0.0001*Means followed by same letter do not significantly differ (P=0.05, Student-Newman-Keuls)Mean comparisons performed only when AOV Treatment P (F) is significant at mean comparison OSL.The data processed using ARM 8 software(ARM is a recognized and respected standardthroughout the plant production, used bythousands of researchers around the world),concludes, that after the first treatment (April4) all 5 fungicides showed significant effects(b) in fungus control. After the 2 nd treatment(May 9) the results are significant (b) invariants 2 and 3 and significant distinct (bc) invariants 4 and 5 and very significant in variant6. The results obtained after the 3 rd treatment(June 12) are from distinct significant in84variants 3 and 5 up to very significant in variant6.It results that the following contact fungicidesBravo 500 SC and Dithane M 45 (V2 and V3)have a good efficacy, and the systemic ones(V3-V6) present a high efficacy. The bestresults were obtained with V6, the fungicideScore 250 EC.CONCLUSIONSDuring the laboratory trials there were selectedthe products with the best biological activity

against the development of the studied fungi.The products with the highest biological activityagainst the development of fungus coloniesof Stigmina carpophila were: Folicur Solo 250EW in 0.1% concentration, Systhane C PU in0.05% concentration, Score 250 EC in 0.02%concentration, Bravo 500 SC in 0.2% concentration,Dithane M 45 in 0.2% concentration.Laboratory results enable the selection of fungicidesshowing high inhibition percentage inorder to establish a treatment chart for thevegetation period, regarding the control of themajor diseases specific to the peach.The phytosanitary treatments will be made atwarning, according to the evolution of environmentalconditions and pathogenic organisms,pursuant to the proposed technology.It results that the following contact fungicidesBravo 500 SC and Dithane M 45 (V2 and V3)have a good efficacy, and the systemic ones(V3-V6) present a high efficacy. The bestresults were obtained with V6, the fungicideScore 250 EC.REFERENCESAlexandri Al., 1982. Chemoterapia si combaterea bolilorla plante. Ed. Ceres, Bucuresti.Baicu T., Sesan T. E., 1996. Fitopatologie agricola, Ed.Ceres, Bucuresti.Baicu T., Sesan T., 1996. Fitopatologie agricola. Ed.Ceres, Bucuresti.Burzo I., Delian E., Hoza D., 2005. Fiziologia plantelorde cultura. Vol. IV Fiziologia pomilor, arbustilor siplantelor ierboase fructifere, Ed. Elisavaros.Dejeu L., Petrescu C., Chira A., 1997. Horticultura siprotectia mediului, Ed. Ceres, Bucuresti.Delian E., Chira L., Dumitru L., Badulescu L., Chira A.,Petcuci A., 2012-Mineral content of nectarines fruitsin relation to some fertilization practices. ScientificPapers Series B. Horticulture Volume LVI, 201, p.73-81.Delian E., 2006. Fiziologia stresului biotic la plante.Editura Cartea Universitara.Geaman I., Berchez M., Baicu T., 2004. Fitiatrie, Ed.Cris Book Universal Bucuresti.Geaman I., 2006. Microbiologie. Ed. Universitas,Bucuresti.Gheorghies C., 1999. Bolile plantelor horticole,Bucuresti.Gheorghies C., Cristea S., 2001. Fitopatologie, Ed.Ceres, Bucuresti.Hoza D., Chira L., Paun C., 2000. Pomicultura –Îndrumator de lucrari practice, Bucuresti.Ivascu A., 2002. Rentabilizarea culturii piersicului înferme mici si mijlocii. Edit. Cris Book Universal,Bucuresti.Jinga V., Neamtu M., Popescu M., Geaman I., Oprea M.,Gradia M., Tudose M., Vlad F., 2008. Sisteme pentrumanagementul protectiei integrate a speciilorsâmburoase din fermele mici si mijlocii în agriculturadurabila, Editura Ceres, Bucuresti.Severin V., Constantinescu F., Frasin B.L. 2001.Fitopatologie, Editura Ceres, Bucuresti.Toncea I., 2002. Ghid practic de Agricultura ecologica.Editura AcademicPress85

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653THE VITICULTURE AND WINEMAKING OF REPUBLIC OF MOLDOVA -PAST, PRESENT AND FUTUREGheorghe NICOLAESCU 1 , Valeriu CEBOTARI 2 , Ana NICOLAESCU 1 ,Dumitru BRATCO 2 , Mariana GODOROJA 1 , Cornelia LUNGU 1 , Valeria PROCOPENCO 11 State Agrarian University of Moldova, 44, Mircesti str., MD-2049, Chisinau, Republic of Moldova2 Ministry of Agriculture and Food Industry, 162 Stefan cel Mare Blvd., MD-2004,Chisinau, Republic of MoldovaAbstractCorresponding author email: gh.nicolaescu@gmail.comViticulture and winemaking in Moldova has an important role in the national economy. These branches have animportant share in the GDP. At this stage of viticulture and winemaking activity is regulated by Law of Vine and Wine(57/10.03.2006), government resolution on the approval of the restoration and development of viticulture andwinemaking for the period 2002-2020 (1313/07.10.2002) and other regulations. In the period until 2006 the branch hasa rapid growth, and stagnation occurred as a result of the embargo imposed by Russia. At present, the vineyard area isabout 100 000 ha.Key words: Republic of Moldova, viticulture, winemaking industry.INTRODUCTIONViticulture and winemaking in Moldova are themain sectors of agriculture. The favorableclimatic conditions of Moldova, provide anopportunity to successfully cultivate grapes.The main activity of the villagers is cultivationof table grapes and grapes for processing. Formany years’ viticulture and winemaking wassubjected to many tests under the influence ofvarious factors-political, economic, social, etc.At this stage of viticulture and winemakingactivity is regulated by Law of Vine and Wine(57/10.03.2006), government resolution on theapproval of the restoration and development ofviticulture and winemaking for the period2002-2020 (1313/07.10.2002) and otherregulations.The aim of our research was to study thedynamics of development and the state ofviticulture and winemaking at this stage and thelevel of their development in according to theprogram.MATERIALS AND METHODSIn our study, about the situation of viticultureand winemaking, we used the data of theNational Statistical Department and the87Ministry of Agriculture and Food Industry ofRepublic of Moldova. Also we used normativeand legislative acts of the parliament andgovernment of Moldova, the specializedliterature.RESULTS AND DISCUSSIONSThe state of viticulture and winemaking at thisstage is characterized by the following data.The data from figure 1 showed that from 1991to 2011, the total area of vineyards hasdecreased significantly from 176 thousand hato 102 thousand ha, and the area of productivevineyards decreased from 148 thousandhectares to 92 thousand hectares.In the period from 2002 to 2006 the area ofvineyards has been stable, about 108-110thousand hectares. This is due to GD1313/2002 on the restoration of viticulture andwinemaking for the period 2002-2020. After2006, the vineyard's area decreased, thissituation was associated with the embargo forwine from Russia, the largest market forproducts.

decrease of the area of vineyards and thenonhomogeneous weather conditions. Theweather conditions influenced the productionper hectares (next figures).Figure 1. Dynamics of the total and productive area ofvineyards in the Republic of Moldova during 1991-2011years, thousand ha (Nicolaescu et al., 2010; Corobca etal., 2012)Figure 3. Dynamics of the grape yield in the Republic ofMoldova during 2001-2011 years, kg/ha. (Nicolaescu etal., 2010; Corobca et al., 2012)The data from figure 4 showed that the yieldwas nonhomogeneous. They was to influencedby the nonhomogeneous weather conditions.Figure 2. Dynamics of the total, processed and grapesproduction in the Republic of Moldova during 1991-2011 years, thousand t. (Nicolaescu et al., 2010; Corobcaet al., 2012)The data from figure 2 showed that from 2001to 2011, the total area of table grapes vineyardshas been stable, about 15-16 thousand hectares.After that, from 2006 to 2009, the vineyard'sarea decreased, this situation was associatedwith the embargo for wine from Russia, thelargest market for products. In recent years, thesituation has improved.The data from figure 3 showed that from 1991to 2011, the production has decreasedsignificantly from about 600 thousand tones(total production in 1991) to 350 thousand ha(the same indices in 2011). The similarsituation observed for the quantity of processedgrapes in this period, but the table grapesproduction in the period from 2001 to 2011years has between about 30 thousand tones (in2006) and about 77 thousand tones (in 2004).The production decrease was due to theFigure 4. Dynamics of the grapes export from theRepublic of Moldova during 1994-2011 years, thousandUSD. (Nicolaescu et al., 2010)The source of information:http://comtrade.un.orghttp://eur-lex.europa.eu/LexUriServ/LexUriServ.do?uri=OJ:L:2011:282:0001:0912:RO:PDFFigure 5. Dynamics of the grapes import in the Republicof Moldova during 1994-2011 years, thousand USD.(Nicolaescu et al., 2010)The source of information:http://comtrade.un.orghttp://eur-lex.europa.eu/LexUriServ/LexUriServ.do?uri=OJ:L:2011:282:0001:0912:RO:PDF88

Analyzing the dynamics of the total value ofexport of fruits (code 08) and fresh and driedgrapes (code 0806), according to UN database,we can say with certainty that until 1999 theseindices were in a continuous decline and since2000 there has been a considerable increase inexport value (fig. 5). Minimum export of totalfruits (code 08), was in 1999 and constituted20.1 million USD and the maximum value ofexports was in 2011 and amounted to 187million USD. Minimum export of fresh anddried grapes (code 0806), were in 1997 andconstituted 0.7 million USD and the maximumvalue of exports was in 1994 about 24 millionUSD. Export value in 2011 was 17.6 millionUSD, or 25.1 times more than the year 1997and 1.4 times less than in 1994. Also in 2011,the export value of grapes (code 0806), inexport value of fruit structure (code 08) was9.39% (Figure 5).The dynamics of import value (Figure 6)compared to the exports in the period 1994-1999 was relatively stable and in 2000 there isalso a considerable increase. In 2011, theimports of fruit in general (code 08) was about68.4 million dollars, or 57 times more than theyear 1994. The trade balance was positive-118.6 million USD for export.than the year 1994. However, the import valueof fresh grapes in the total structure of thegrapes (code 0806) was 80.62%, 18.38% forraisins. Trade balance in terms of fresh grapesin 2011 was positive by 12.6 million USD forexport.In the structure of exports of table grapes (code0806) in 2011, the share of 78.64% or25,941.62 tons refers to Russia, which isfollowed by Belarus with 14.83% or 4891.03tons and Romania with 6 16% or 2030.79 tons(Figure 7).Figure 7. The structure of import of table grapes in theRepublic of Moldova in 2011, tones,%. (Nicolaescu etal., 2010)The source of information:http://comtrade.un.org;http://eur-lex.europa.eu/LexUriServ/LexUriServ.do?uri=OJ:L:2011:282:0001:0912:RO:PDFFigure 6. The structure of export of table grapes from theRepublic of Moldova in 2011, tones,%. (Nicolaescu etal., 2010)In the structure of imports of table grapes (code0806) in 2011, the share of 86.51% or 5655.93tons is refers Turkey, which is followed byIran-by 5.38% or 351.63 tons, Uzbekistan-with2.90% or 189.35, Greece-by 1.43% or 93.75tonnes and Chile-0.64% or 41.89 tons (Figure8).The source of information:http://comtrade.un.org;http://eur-lex.europa.eu/LexUriServ/LexUriServ.do?uri=OJ:L:2011:282:0001:0912:RO:PDFThe grapes import value (code 0806) in 2011was 6.2 million USD or 155 times more than in1994. In the structure of grape fruit importvalue has returned 9.1%. The trade balance waspositive this 11.4 million USD for export.Fresh grapes (code 080610) registered importvalue of 5.0 million USD or 166.7 times more89

Figure 8. The structure of import of fresh table grapes inthe Republic of Moldova in 2011, tones,%. (Nicolaescuet al., 2010)The source of information:http://comtrade.un.org;http://eur-lex.europa.eu/LexUriServ/LexUriServ.do?uri=OJ:L:2011:282:0001:0912:RO:PDFIn the structure of imports of fresh grapes (code080610), in 2011, the share of 95.13% or5655.93 tons is refers to Turkey, which isfollowed by Greece-by 1.59% or 93.75 tonnesand Chile-0.47% or 27.89 tons (Figure 9).Wine branch is a branch of Agro-IndustrialComplex that provides people with fresh andprocessed production: juices, jams and varioustypes of wines. The food's importance, economicimportance, it has the advantage that incomparison with others. According to scientificresearch of medicine, annual consumptioncalculation time a person is 40-50 kg grapes peryear and approx. 40-50 it coming.Grape production in calculating per capita inthe period 2006-2009, varies between 130 kg(2006) and 192 kg (2009) and of the mass: 8.16kg (2006) and 29.24 kg (2009).Based on the data presented in Table 1, we findthat the production of table grapes in Moldovain calculating per capita in 2006 is 18.13% ofnormal consumption, increasing to 64.99% in2009 compared to the norm of consumption.The results obtained show that local producerscan not cover domestic consumption of freshgrapes. However, we find that the production ofwine in Moldova in computing per capita in2006 is 26.90% of normal consumption, fallingby 16.51% in 2009 compared to the norm ofconsumption.Table 1. The dynamics of production of grapes and wineproduction in Moldova in calculating the per capita(Nicolaescu et al., 2010)Indices 2006 2007 2008 20091. Grape production in the130 167 178 192calculation per capita, kg-in% in comparison with lastx 128,46106,59107,87year-in% in comparison withscientific annual288,89371,11395,56426,67consumption2. The table grapeproduction in the calculation 8,16 10,55 11,68 29,24per capita, kg-in% in comparison with lastx 129,27110,77250,37year-in% in comparison withscientific annual18,13 23,43 25,96 64,99consumption3. Wine production in the12,10 9,58 9,57 7,43calculation per capita, l-in% in comparison with lastx 79,16 99,85 77,65year-in% in comparison withscientific annual26,90 21,29 21,26 16,51consumptionAnalyzing coverage of consumer standard tablegrapes (Table 1.) We can say that Moldova isunable to produce the required amount ofgrapes according to the norm of consumption.At present in force 'Program restoration anddevelopment of viticulture and winemaking inthe years 2002-2020', which was approved torestore the complex in the branches of viticultureand winemaking by the GovernmentalDecision no. 1313 / 07.10.2002 (Monitoruloficial 142 / 17.10.2002, art. 1448).Given the current state of the industry, productioncapacity and level of business developmentof enterprises at that time, were projectedproduction following wines:90

Table 2. Indicative data on volumes of production of wine products and their value (in comparable prices of 2000) inthe 2002-2020 yearsType of winesUnit ofmeasureQuantityYears2000 2010 2015 2020Price,MDL/unitSum Quantity Sum Quantity Sum Quantity Summil.MDLBottled wines 1000 hl 750 896 672 50,27 1000 896 67,02 1100 986 73,76 1500 1.344 100,53Wines in bulk, sparklingwinemil.Euromil.MDLmil.Euromil.MDLmil.Euromil.MDL1000 hl 850 320 272 20,35 900 288 21,54 1000 320 23,94 1500 480 35,91Total: 16 944 70,61 19 1184 88,57 21 1.306 97,69 30 1824 136,44Sparkling wine1000 bottles 5,5 10 55 4,11 8,5 85 6,36 10 100 7,48 12 120 8,981000 hl 41,3 1333 55 4,11 63,8 85 6,36 75 100 7,48 90 120 8,98Divin (cognac) 1000 hl 41,6 4000 166 12,42 40 160 11,97 50 200 14,96 60 240 17,95Brendy 1000 hl 95,5 1660 153 11,44 100 160 11,97 120 192 14,36 140 224 16,76Production value-total(million MDL)in% in comparison with2000mil.Euro1318 98,59 1589 118,86 1798 134,50 2408 180,12100 121 136 183The level of achievement of planned objectiveswill be revealed in later chapters. To obtain thatquantity of wine products necessary to processthe following quantities of grapes and wines.Table 3. Indicative data on volumes of grape processingand use directions of wine obtained in the 2002-2020yearsYearsUnit of2000Indices1990 (formeasure(realreference)data)2010 2015 2020Grapeprocessing1000 tones 770 360 360 430 600Production ofraw wines1000 hl 5.200 2.400 2.4002.800 3.900including----for wines 1000 hl 4.200 1.870 1.5001.700 2.600----for sparkling 1000 hl 500 470 500 500 500----for divinuri(cognac)1000 hl 300 30 300 400 500----for grapejuice1000 hl 200 30 100 200 300Considering the pedoclimatic potential ofMoldova in terms of the culture of the vine, andthe objectives set for achieving certain amountsof wines, the area of vineyards of thecommodity producing grapes at the end of thatperiod should be approx. 100 000 hectares, ofwhich the productive-approx. 80 000 hectares.The area of vineyards per wine regions shouldbe distributed as follows: South wine region(Cahul)-48 000 hectares, the wine region ofCentre-48 000 hectares and wine region North(Balti)-4 000 hectares.Table 4. Indicative data on the development of viticulturein the commodity producing grapes from 2002-2020YearsTotalarea,thousand haAnnual averageProductive area,thousandhaTotalproduction,thousandtonesYield,kg/haTotal area,thousand hadesignedplantingdeforestareaationNecessaryquantityofplantingmaterial,millionpcs2002-200599,6 95,2 434,2 4.560 22,5 9,2 32,2including 2005*94,2 85,5 393,0 4.600 6,0 4,5 15,752006-201091,2 71,7 374,4 5.220 35,0 30,0 105,0including 2010*89,2 64,2 379,0 5.900 8,0 7,0 24,52011-201592,2 64,4 419,6 6.520 30,0 35,0 122,5including 2015*94,2 66,2 460,0 6.950 6,0 7,0 24,52016-202098,0 75,0 570,8 7.610 20,0 25,8 90,3includin100,0g 2020*80,0 640,0 8.000 4,0 5,0 17,5Also it requires the existence of vineyards toproduce wines with designation of origin, giventhe unique climatic conditions favourable forvines. The area of these plantations should beapprox. 5000 hectares.The level of program implementation caneasily see from Figure 9, but the establishmentof vineyards in the years 2008-2009 wasperformed at a lower level compared to plannedprogramme. This, in our opinion, is due tostress growers as a result of the embargoimposed by the Russian Federation.91

this is the winter frosts, late spring frosts, hailin the early stages of growth, prolongedsummer droughts, autumn rains and earlyautumn frosts.To improve the efficiency of viticulture andwine-making is necessary to raise the level oftechnology of vineyards, perform the intendedpurpose of the program development, and todevelop new markets for grapes and wines.Figure 9. The dynamics of vineyardDuring the years, the global production ofgrapes and quantity processed by theprocessing enterprises varies very widely. Thisis due largely to climatic conditions that arecreated in the geographical territory of theRepublic of Moldova.The decisive and destructive climatic factorswhich influencing the successful developmentof viticulture and their intensify in recent yearsthis is the winter frosts, late spring frosts, hailin the early stages of growth, prolongedsummer droughts (flowering and berry growth),autumn rains (berry maturation) and earlyautumn frosts.CONCLUSIONSDuring the years, the total area of vineyards,the global production of grapes and quantityprocessed by the processing enterprises variesvery widely. This is due largely to climaticconditions that are created in the geographicalterritory of the Republic of Moldova.The decisive and destructive climatic factorswhich influencing the successful developmentof viticulture and their intensify in recent yearsREFERENCESArpentin Gh. 2008. Moldovan Viticulture andWinemaking Industry: Past – Future – Challenges –Opportunities. Moldo-American meetings NorthCarolina. November 14. Power point presentation.Corobca V., Fosnea A., Jose Javie Ocon Berango, 2012.Viticultura si pepinieritul viticol în RepublicaMoldova. USAID, CEED II, Chisinau.HG Nr. 152 / 26.02.2013 cu privire la aprobarea moduluide repartizare a mijloacelor fondului desubventionare a producatorilor agricoli pentru anul2013. În: Monitorul Oficial Nr. 41 / 184 din27.02.2013.Legea Viei si Vinului nr. 57 / 10.03.2006. În: MonitorulOficial Nr. 75-78 / 19.05.2006.Nicolaescu Gh., Apruda P., Perstniov N., Terescenco A.Ghid pentru producatorii de struguri pentru masa(editia II). Ch.: “Iunie Prim” SRL, 2008. 133 p. ISBN978-9975-4004-1-1Nicolaescu Gh., Cazac T., Vacarciuc L., Cebotari V.,Cumpanici A., Nicolaescu Ana, Hioara Veronica.Filiera vitivinicola a Republicii Moldova-starea siperspectivele dezvoltarii. Inst. Italian de ComertExterior, Univ. Agrara de Stat din Moldova; red. gen.Gheorghe Nicolaescu; Ch.: S. n., 2010 (Tipogr.“Print-Caro” SRL). 133 p. ISBN 978-9975-4152-5-5.Programul de restabilire si dezvoltare a viticulturii sivinificatiei în anii 2002-2020 / HG nr. 1313 /07.10.2002. În: Monitorul Oficial Nr.142 /17.10.2002.http://comtrade.un.orghttp://faostat.fao.org/site/567/default.aspx#ancor92

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653THE INFLUENCE OF FERTILIZATION LEVELS AND DRIP IRRIGATIONNORMS ON THE APPLE HARVEST IN SOUTH-EASTERN ROMANIANCONDITIONSAbstractNicoleta OLTENACU, Ctlin Viorel OLTENACUUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Marasti Blvd, District 1, 011464, Bucharest, RomaniaCorresponding author email: nicoleta_oltenacu@yahoo.comMaking a modern fruit growing cannot be conceived without providing a corresponding hydric regime that fruit speciesneed. Even in areas with abundant precipitation should be taken into account that they are unevenly distributedthroughout the growing season and that there are critical moments in which trees need to consume water. Low humidityand lack of water can harm large harvest this year or next year to the fruit formation. Taking into account this aspect,in the present study, we wanted to put out the effects of application of modern methods of water located on thebehaviour of apple fruit valuable in terms of the south-eastern Romania, where are encountered optimal cultureconditions and find the best recommendations for production. The content of this paper is based on research,observations, experiments, extensive research of issues prioritized and data processing including the whole range ofissues, starting from the foundation of the application irrigation necessity. As a result, the entire work is based almostexclusively on research findings on the effect of irrigation and fertilization level on apple at Moara Domneasca farmconditions.Factor A-variety: Generos and Florina. Factor B-irrigation norms: non irrigated witness; drop 2 litres /hour; drop 4 litres / hour. FactorC-fertilization levels: 2,5 kilo Megasol or 5 kilo Megasol.The irrigation level resultedin production increases and bonuses obtained as very significant statistically for the two levels of irrigation applied.The highest yields were recorded in variants where rules were applied 4 l / h, with production increases of 40.1%, andincreases the harvest of 5.52 t / ha.Key words: drip irrigation, fertilization, harvest, water norms, varieties.INTRODUCTIONgrowth exaggerated of the shoots and directingthe assimilated towards the fruits (Atkinson D.,Making a modern fruit growing cannot be1977).conceived without providing a hydric systemEven in areas where there is 600-700 mmthat corresponds to the needs of the fruitannual rainfall, water scarcity is need to bespecies. Even in areas with heavy rainfallcover from July through September, orshould be noted that these are distributedsometime in the spring, in March-April, beforeunevenly throughout the growing season andand during flowering and autumn, in Octoberthat there are critical moments in which treesduring intensive growth roots. Over time, waterneed to consume water (Rzekanowski C.,saving problem has become increasinglyRolbiecki S., 2000). Low humidity and lack ofimportant higher with global climate change,water can harm large crop of fruit in the currentrising among other issues also that of theyear or of the fruit formation in the next yearreduction and rationalization of water use for(Cohen D., 1993).irrigation (Popescu M., Godeanu I.,1989).Currently, irrigation is necessary to beBearing this in mind, the present study, weunderstood, according to the principles ofaimed to emphasize the effects of localizedintegrated fruit crops as a highly effective toolapplication of modern methods of water, overfor regulating the activity of vegetative andthe behavior of two valuable apple varieties, inproductive trees (Botu I., Botu M., 2003). It isthe south-eastern Romania conditions, whereknown that a mild water stress has the effect ofare encountered optimal conditions of culture.picking the fruit bud differentiationThe research objective is to observe what is thephenomenon. Also, reducing excessiveimpact of localized irrigation application onwatering result a decrease of the vegetativefruitfulness and establishing recommendations93

for production of localized irrigation on appleapplication in the in the south-eastern RomaniaconditionsMATERIALS AND METHODSThe entire work is based on the results ofpersonal research on the effect of appleirrigation in Moara Domneasca Farmconditions.Researches to develop this work wereconducted in 2008-2011 period. Relief localityis included in the Romanian Plain, Vlasiei Plainsubdivision, in the transition from steppe toforest area. The general relief is flat withnumerous small bumps and depressions, calleddales, of different shapes and sizes.Groundwater is at different depths from 6 m to10 m, depending on the terrain. In 2008, theaccumulated rainfall was 378 mm, in 2009 was559,4 mm, in 2010 was 494,8 mm and in 2011was 288 mm. All values are below the 50-yearannual average of 548.0 mm.The soil type at the Moara Domneasca Farm isreddish brown (preluvosoil), softness subtype.To achieve the objectives, it was imposed anorganization of some tri factorial typeexperiences with the following experimentalfactors:Factor A-variety: Generos and Florina.Factor B-irrigation norms: non irrigatedwitness; drop 2 litres / hour; drop 4 litres /hour.Factor C-fertilization levels: 2,5 kilo Megasolor 5 kilo Megasol.Drip irrigation was started from March 20,administering it daily, for 4 hours. In periodswhere there were registered rainfalls, theirrigation was discontinued. In general, thenumber of watering recommended is 2-5.Fertilization consisted of Megasol productadministration, which is a soluble fertilizerdesigned specifically for use in advancedirrigation systems, especially through the drip,and foliar and basic fertilization. On fruit treeswere applied 5 splashes using the dosesmentioned above.RESULTS AND DISCUSSIONSThe influence of the variety on theproduction of applesTable 1. The Influence of the variety on the productionof apples, average of 2008-2011Prod.Varietyt/ha% Dif. t/ha Signif.Generous 16,53 100,1 0,02 -Florina 16,49 99,9 -0,02 -Average 16,51 100 - MtDl 5% = 0,244 t / ha Dl 1% = 0,563 t / ha Dl 0,1% =1,791 t / haTo analyze the influence of the variety onproduction, we have established as term ofcomparison-stander-by the average productionof the two analyzed varieties, 16,51 t/ha.The Generous variety achieved a production of16,53 t/ha, at a non-significant difference (0,02t/ha) compared to the stander-by.Florina variety enrolled with a production of16,49 t/ha, at a non-significant differencecompared to the stander-by, but negative.We can say that the varieties have a similargenetic potential production (Table 1)The influence of the drip irrigation levels onthe production of applesTable 2. The Influence of the drip irrigation levels on theproduction of apples, average of 2008-2011Irrigation normProd.t/ha%Diff.t/haSignif.Non-irrigated 13,75 100 - Mt2 l/h 16,51 120,1 2,76 ***4 l/h 19,27 140,1 5,52 ***DL 5% = 0,140 t/ha DL 1% = 0,203 t/ha DL 0,1% =0,305 t/haAs shown in Table 2., the irrigation leveldetermined increases of the yields obtained andincreases statistically confirmed as highlysignificant for the two levels of irrigationapplied.Compared to the control (irrigated) productionstandards achieved at 2 l/h were 20,1% higher,which means an increase of 2,76 t/ha, verysignificant.An increase of 5,52 t/ha was recorded also atthe irrigated variant with 4 l/h, which means anadditional crop of 40,1%.The influence of the level of fertilization onthe production of apples94

Table 3. The Influence of the level of fertilization on theproduction of apples, average of 2008-2011Fertilizer DoseProd.t/ha%Diff.t/haSignif.Unfertilized 14,82 100 - Mt2,5 kg /ha 16,52 111,5 1,70 ***5,0 kg /ha 18,18 122,7 3,36 ***DL 5% = 0,074 t/ha DL 1% = 0,101 t/ha DL 0,1% =0,135 t/haTo make an analysis of the data presented inTable 3. was considered as a stander-byproduction obtained on a unfertilized variant,14,82 t/ha. In comparison with this, therecorded production on a dose of 2,5 kg/haMegasol, 16,52 t/ha was higher by 1,70 t/ha,which is a very significant production increase.The dose of 5 kg/ha resulted in a production of18,18 t/ha, with 22,7% over the stander-byproduction, meaning an increase of 3,36 t/ha, avery significantly increase. In conclusion, thefertilization causes very significant productionincreases for all levels of fertilizer applied.Table 4. The Influence of fertilization levels on production of apples for the same level of irrigation, average of 2008-2011Irrigated norm Non-irrigated 2 l/h 4 l/hFertilizer dose Prod. t/ha Dif. t/ha Signif. Prod. t/ha Dif. t/ha Signif. Prod. t/ha Dif. t/ha Signif.Non-fertilizer 12,84 - Mt 14,89 - Mt 16,74 - Mt2,5 kg/ha 13,81 0,97 *** 16,53 1,64 *** 19,23 2,49 ***5,0 kg/ha 14,59 1,75 *** 18,12 3,23 *** 21,84 5,10 ***The influence of fertilization levels onproduction of apples for the same level ofirrigationAs noted previously, fertilization brings verysignificant production increases at allgraduations used but irrigation applicationmakes these increases higher than thoseobtained only after fertilization (Table 4). Onnon-irrigated variant, the production increasewas 0,97 t/ha at a dose of 2,5 kg/ha and 1,75t/ha at a dose of 5 kg/ha Megasol. With thewater irrigation administration, benefitsincreased to 1,64 t/ha, respectively, 3,23 t/ha.Norms of 4 l/h caused increases of productionof 2,49 t/ha, the fertilized variant with 2,5 kg/haand 5,10 t/ha, the fertilized variant with 5kg/ha. All registered harvest ups were verysignificant.Table 5. The Influence of irrigation levels on the production of apples for the same level of fertilization, average of2008-2011Fertilized Dose Non-fertilized 2,5 kg/ha Megasol 5,0 kg/ha MegasolIrrigated norm Prod. t/ha Dif. t/ha Signif. Prod. t/ha Dif. t/ha Signif. Prod. t/ha Dif. t/ha Signif.Non-irrigated 12,84 - Mt 13,81 - Mt 14,59 - Mt2 l/h 14,89 2,05 *** 16,53 2,72 *** 18,12 3,53 ***4 l/h 16,74 3,90 *** 19,23 5,42 *** 21,84 7,25 ***The Influence of irrigation levels on theproduction of apples for the same level offertilizationThe level of irrigation, on fertilizationbackground brings very significant yieldincreases (Table 5). The highest yields fromunfertilized variants were obtained fromirrigation norms of 4 l/ h, 16,74 t/ha with aproduction increase of 3,90 t/ha. Productionincreases amounted to 5,42 t/ha, where wereapplied 2,5 kg/ha Megasol and were irrigatedwith and 4 l/h. The highest yields and hence thelargest yield increases were obtained inirrigated variant with 4 l/h and fertilized with955 kg/ha Megasol, 21,84 t/ha, an increase of7,25 t/ha.The Influence of the variety on theproduction of apples for the same level offertilizationThe data presented in Table 6., shows thatGenerous variety recorded high yields towardsFlorina variety, but yield differences areinsignificant. The biggest difference ofproduction was obtained from unfertilizedvariant, 0,28 t/ha. Florina variety gets higherproduction but only at the variant fertilizedwith 5 kg/ha, where production exceeds the

Generous variety with 0,19 t/ha, increase thatwas statistically uninsured.Table 6. The Influence of the variety on the production of apples for the same level of fertilization), average of 2008-2011Fertilizer dose Non-fertilized 2,5 kg /ha 5,0 kg/haVariety Prod. t/ha Dif. t/ha Signif. Prod. t/ha Dif. t/ha Signif. Prod. t/ha Dif. t/ha Signif.Generous 14,96 - Mt 16,54 - Mt 18,08 - MtFlorina 14,68 -0,28 0 16,51 -0,03 - 18,27 0,19 -DL 5% = 0, 247 t/ha DL 1% = 0,523 t/ha DL 0,1% = 1,536 t/haThe influence of the fertilization level on the production of apples for the same variety andthe same level of irrigationTable 7. The Influence of the fertilization level on the production of apples for the same variety and the same level ofirrigation, average of 2008-2011Variety Generous FlorinaNon-irrigated 2 l/h 4 l/h Non-irrigated 2 l/h 4 l/hFactor BxCProd. t/ha Dif. Prod. t/ha Dif. Prod. t/ha Dif. Prod t/ha Dif. Prod. t/ha Dif. Prod. t/ha Dif.Non-fertilized 12,95 - 15,10 - 16,83 - 12,73 - 14,67 - 16,65 -2,5 kg/ha 13,73 0,78 *** 16,57 1,47 *** 19,32 2,49 *** 13,89 1,16 *** 16,49 1,82 *** 19,14 2,49 ***5,0 kg/ha 14,37 1,42 *** 18,11 3,01 *** 21,77 4,94 *** 14,80 2,07 *** 18,12 3,45 *** 21,90 5,25 ***DL 5% = 0,182 t/ha DL 1% = 0,247 t/ha DL 0,1% = 0,331 t/haAnalyzing the data in Table 7. and shows thatthe two varieties have similar production valuebut the biggest production increases wereachieved at Florina variety. On irrigatedvariants were made between 12,73 and 21,90productions t/ha. Production increases werestatistically confirmed and were in the range of0,78 to 5,25 t/ha, all being very significant.Generous variety was enrolled with the lowestproduction on non-irrigated, 12,95 t/ha and thehighest in irrigated variety with 4 l/h andfertilized with 5 kg/ha Megasol, 21,77 t/ha,variant were the production growth achievedwas 4,94 t/ha. Florina variety recorded thehighest harvest at the same variant 21,90 t/haand an increase of 5,25 t/ha. Irrigationcombined with fertilization determines theincrease of the production increases comparedto variants where he acted only one factor.The influence of irrigation level on theproduction of apples for the same varietyand the same level of fertilizationAnalyzing the data in Table 8. it observed thatthe application of irrigation causes verysignificant production increases at all variantsstudied. At a watering of 2 l/h, increases thecrop increases were recorded as receivingconcomitant irrigation and Megasol. To 2,5kg/ha fertilizer, increases were 2,84 t/ha, thevariety Generous and 2,60 t/ha, at Florinavariety. At 5 kg/ha Megasol, increases were of3,74 t/ha and 3,32 t/ha. Increasing thewater quantity, administered at 4 l/ha resultedin a significant increase of production increasesobtained. Thus, at the dose of 2,5 kg/haMegasol was recorded an increase of 5,59 t/ha,at the Generous variety and 5,25t/ha at Florina variety. Dose of 5 kg/ha resultedin increases of the production of 7,40t/ha at the Generous variety and 7,10 t/ha, atFlorina variety.The Influence of variety on the productionof apples for the same level of irrigation andfertilizationComparing the data in Table 9. it is noted thatbetween the varieties analyzed there are nodifferences of production statistically assured,which suggests a capacity approximately equal.The only variable that was a significantdifference in the non-irrigated and fertilizedwas with 5 kg/ha Megasol (0,43 t/ha). Overallthe production of Florina variety was lowerthan those of the Generous variety.96

Table 8. The Influence of irrigation level on the production of apples for the same variety and the same level offertilization, average of 2008-2011Variety Generous FlorinaNon-fertilized 2,5 kg/ha 5,0 kg /ha Non-fertilized 2,5 kg /ha 5,0 kg /haFactor CxBProd. t/ha Dif. Prod. t/ha Dif. Prod. t/ha Dif. Prod. t/ha Dif. Prod. t/ha Dif. Prod. t/ha Dif.Non-irrigated 12,95 - 13,73 - 14,37 - 12,73 - 13,89 - 14,80 -2 l/h 15,10 2,15 *** 16,57 2,84 *** 18,11 3,74 *** 14,67 1,94 *** 16,49 2,60 *** 18,12 3,32 ***4 l/h 16,83 3,88 *** 19,32 5,59 *** 21,77 7,40 *** 16,65 3,92 *** 19,14 5,25 *** 21,90 7,10 ***DL 5% = 0,247 t/ha DL 1% = 0,350 t/ha DL 0,1% = 0,504 t/haTable 9. The Influence of variety on the production of apples for the same level of irrigation and fertilization, average of2008-2011Irrigation level Fertilization level Generous FlorinaDif.t/haSignif.Non-irrigated Unfertilized 12,95 12,73 -0,22 - 2,5 kg/ha 13,73 13,89 0,16 - 5,0 kg/ha 14,37 14,80 0,43 *2 l/h Unfertilized 15,10 14,67 -0,43 0 2,5 kg/ha 16,57 16,49 -0,08 - 5,0 kg/ha 18,11 18,12 0,01 -4 /h Unfertilized 16,83 16,65 -0,18 - 2,5 kg/ha 19,32 19,14 -0,18 - 5,0 kg/ha 21,77 21,90 0,13 -DL 5% = 0,311 t/ha DL 1% = 0,545 t/ha DL 0,1% = 1,263 t/haThe variants fertilized with 5 kg/ha, regardlessof irrigation level, Florina variety exceeded theproduction Generous variety, showing a greatercapacity for recovery of the fertilizer, butinsignificant.CONCLUSIONSInfluence on the production of apple variety,average of the years 2008-2011. On averageover the three years of experimentation, theGenerous variety showed a higher yieldpotential than Florina variety, but yielddifferences between them are significantInfluence of drip irrigation level on appleproduction, average of the years 2008-2011Irrigation level resulted in increases of theproduction obtained and increases as highlysignificant statistically assured for the twolevels of irrigation applied. The highest yieldswere recorded in variants where were appliednorms of 4 l/h, increases production of 40,1%,and increases of crops of 5,52 t/ha. Influenceof fertilization level on the production ofapple, average of the years 2008-2011.Level of fertilization causes very significantproduction increases for all levels of fertilizerapplied. The highest yields were achieved atdoses of 5 kg/ha Megasol (18,18 t/ha), withincreases of 22,7% (3,36 t/ha).Influence of fertilization on the productionof apples to the same level of irrigation,average of the years 2008-2011.Fertilization brings very significant productionincreases at all graduations used but irrigationapplication makes these increases to besuperior to those obtained only afterfertilization. The highest yields were obtainedat fertilization with a dose of 5 kg/ha,regardless of the norms of irrigation appliedwith a maximum increase irrigated with 4 l/h(5,10 t/ha).Influence of irrigation level on theproduction of apples for the same level offertilization, average of the years 2008-2011.Irrigation resulted in very significantproduction increases regardless of fertilization,yields based on the value of 2,05 t/ha andreaching at a value of 7,25 t/ha. The highestyields and hence the largest yield increaseswere obtained in irrigated variant with 4 l/h andfertilized with 5 kg/ha Megasol, 21,84 t/ha, andan increase of 7,25 t/ha.Influence of variety on the production ofapples for the same level of fertilization,average of the years 2008-2011.97

The only difference between the two varietiesproduction was recorded in the unfertilizedvariant, where the Generous exceeded theproduction of Florina variety by 0,28 t/ha,which is a significant difference statisticallyassured being insignificant. Fertilizeradministration has reduced the distancebetween productions, reaching at the dose of 5kg/ha, Florina variety exceeds the production atthe Generous variety, but the differences areinsignificant.Influence of fertilization level on theproduction of apples for the same varietyand level of irrigation, average of the years2008-2011.Under the same conditions of fertilization andirrigation, the reaction was different varieties.Thus, Generous variety obtained yieldincreases in the range of 0,78 t/ha, at doses of2,5 kg/ha to 1,16 t/ha obtained by Florinavariety, up to 4,94 t/ha, achieved growth in adose of 5 kg/ha towards 5,25 t/ha obtained byFlorina variety. This variety has used moreeffectively the fertilization effect. All registeredproduction increases at all graduations used,were very significant.Influence of irrigation level on theproduction of apples for the same varietyand level of fertilization, average of the years2008-2011.Applying irrigation causes very significantproduction increases at all variants studied.Thus, Generous variety obtained yieldincreases in the range of 2,15 t/ha, the norms of2 l/h compared to 1,94 t/ha obtained by Florinavariety, up to 7,40 t/ha, increase made at normof 4,94 t/ha, increase achieved at a dose of 4l/h, compared to 7,10 t/ha,obtained at Florinavariety. Generous variety exploited moreefficiently the effect of irrigation.All registered production increases at allgraduations used were very significant.Influence of variety on the production ofapples for the same level of irrigation andfertilization, average of the years 2008-2011.There are no differences of productionstatistically assured between the varietiesanalyzed, which suggests a production capacityapproximately equal. Overall the yields ofFlorina variety were lower than the Generousvariety. The largest differences in productionwere of 0,43 t/ha and the lowest, of 0,01 t/ha.REFERENCESAtkinson D. 1977. The effect of trickle irrigation on thedistribution of root growth and activity in fruit trees.Seminaires sur l’irigation localisee, Bologne Italie 6/9novembreBotu I., Botu M. 2003. The modern and sustainable fruittree culture. Ed. Conphys, Râmnicu VâlceaCohen D. 1993. Water deficit and plant growth. Hort.Science, vol.21, nr. 5Popescu M., Godeanu I.,1989.The drip irrigation, amethod for future for treeculture. Hort science nr. 11Rzekanowski C., Rolbiecki S., 2000. The influence ofdrip irrigationon yields of some cultivars of appletrees in central Poland under different rainfallconditions during the vegetation season, ActaHorticulturae 537, Lisbon, Portugal98

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653AbstractTHE INFLUENCE OF THE DRIP IRRIGATION ON THE PHYSICALAND CHEMICAL APPLE CHARACTERISTICSNicoleta OLTENACU, Ctlin Viorel OLTENACUUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Mrti Blvd, District 1, 011464, Bucharest, RomaniaCorresponding author email: nicoleta_oltenacu@yahoo.comThe premise of scientific and technical experiments was to evaluate the behaviour during the winter storage of the 2cultivars of apples (Generos and Florina) introduced into experimental and comparison with other cultivars. The dripirrigation was started from March 20, administering daily for 4 hours. Recommended watering periods, depending onthe weather of the year are:5-15 of March; 1-15 of May (after the fruit tying); 15-25 of July; 10-15 of September; 1-15of November, the supply. The needed water norms are between 300 and 700 m 3 /ha.Key words: chemical, irrigation, organoleptic, physical, storage.INTRODUCTIONMATERIALS AND METHODSInfluence of drip irrigation on productionquality is the effect on the nutritional and foodvalue of fruits (Atkinson D., 1977; Gherghi et.al., 1972). Nutritional and food value of thefruits represents the purpose for growing fruitTo establish the ability to maintain quality freshapples were taken 5 homologated cultivars, ofwhich Generos and Florina disease-resistantand Jonathan, Golden Delicious and Idared,with widespread in the current assortment intrees, fruit bushes and strawberries as our country. Fruits were kept after harvesting asupplements of vitamins, sugars, minerals,acids and energy (calories) needed for properperiod of about 50-60 days, depending oncultivar, in the storage spaces of the resort,body growth and development (Botu, 2003). In from where they were then taken foraddition, the fruits also contain magnesium, experiments and refrigerated in storagemanganese, copper, zinc and iron, as well asthe important minerals in the diet (Gherghi A.,1983)Apples in controlled storage conditions canprolong the storage period of 3-9 monthswithout losing its qualities. Storage andconsumption during the same organolepticcharacteristics depend on the terms offered andconditions (t=0...+4°C, RH = 90-95%) over aperiod of 110 days in cold storage ofBelciugatele Didactic Station, located insidethe Moara Domneasca Farm.After removal from storage were madedeterminations regarding the following:- the quantitative and qualitative lossesrecorded by the fruit during storage;the particular cultivar. It is known that during - modifying fruit firmness (penetrometerstorage, the apples suffer structural-texturalchanges that are produced slower or fasterdepending on the characteristics of cultivarsdetermined) during storage;- evolution of the main chemical componentsof the apples during storage;and storage conditions (Gherghi A et. all., - organoleptic assessment (appearance,2001). When apples with great firmness atharvest are stored in controlled atmospherestorage, they can use the same value until thenext harvest of early cultivars (Gherghi A.,firmness, taste) of fruit after storage.The premise of the scientific and technicalexperiments was to assess behavior duringwinter storage of the 2 cultivars of apples1989).introduced in the experimentation andcomparison with other cultivars. Existence of99

optimal flow experience across storage-keepingwith reference to standardized packaging units,space conditioning, refrigeration thermostaticcell, organoleptic testing laboratory, equipmentand devices for measurements and analyzesprovided made it possible to achieve this goal.The experiments were conducted in 5 differentcomparative variants based on the mentionedcultivars, with 3 repetitions pervariant.During storage it has been made thedaily examination of the thermal-hydric factorsin the refrigeration room, for ensuring thatoptimal conditions to maintain quality(temperature 0 ... 4 0 C and RH 90 .. 95%). Alsowe proceeded to assess the ability to maintainfruit quality by findings the appearancechanges occurred regarding dehydration, theappearance and evolution of different storagedisease. Taking into account the high degree ofmaturity of the fruit during storage and qualitychanges occurring during storage it wasestimated that during cold storage the limit is110 days. After removing apples from thestorage space the determinations wereperformed on the table and impairment losses(spoilage) and fruit firmness, biochemicalanalysis of the main components andorganoleptic testing at this stage. Determinationof mass loss and spoilage during storageproducts was done by weighing samples of fruitresulted, respectively the fruit impaired(spoiled) during storage, compared with theinitial amount deposited, the results beingexpressed as a percentage.Fruit firmness was made manual with apenetrometer piston type Effe-gi 1 mm, on atotal of 25 fruits per variant, each fruit waspenetrated at 4 points in the equatorial zoneafter removing the epidermis in those points.Tests for the main chemical components (drysubstance, total sugar, titratable acidity andascorbic acid) were performed by standardlaboratory methods as follows:- dry substance was determined byrefractometry method using ABB tablerefractometer with results expressed in%:- total sugar by Berthrand method with resultsexpressed in %;- acidity by titrimetric method with resultsexpressed in % of malic acid;- vitamin C (ascorbic acid) byspectrophotometer method, using UV-VISSpecol spectrophotometer and expression inmg/100g.To assess organoleptic tasting were performedusing the tasting sheets that contain a numberof three assessment criteria (appearance,texture, taste). Notation (appreciation) wasperformed using 100 points scale. Each of thethree assessment criteria has different weight ingeneral notation, depending on theirimportance. Thus 'the aspect' represents 15%,'texture' 35% and taste 50%. Depending on thescore achieved 5 quality classes, according toTable 1.Table 1. Classification of fruit after scoringRating (quality category)Scorevery good 80-100good 60- 79acceptable 40-59mediocre 20-39inappropriate 0-19RESULTS AND DISCUSSIONSInfluence of drip irrigation on quantitativeand qualitative lossesThe results of the quantitative and qualitativelosses recorded by the fruit during storage atthe experimental variants are presented inTable 2.Table 2. Losses while preserving applesVar CultivarLosses (%) Remarks onTotalWeight Damage damaged fruits3.54 % grayrottennessV1 Jonathan 19.28 7.41 11.878.33% internalcollapseGoldenV224.20 8.62 15.58 gray rottennessDeliciousV3 Idared 17.55 5.17 12.38 gray rottenness4.26 % grayV4 Florina 14.66 5.88 9.08 rottenness4.82% heart rotV5 Generos 5.94 5.94 - - AVERAGE 16.33 6.60 9.78The data presented shows that total lossesduring storage are between 5.94-24.20%(depending on cultivar), with an average of16.33%. Weight loss varies between 5.17-8.62% with an average of 6.6% and by spoilingfrom 0-15.58% with an average 9.8%.The lowest total losses (5.94%) are recorded onGeneros cultivar (Figure 1).100

Figure 1. The aspect of apples from Generos cultivarafter storageThis variant shows reduced mass loss andrecorded spoiling due to disease attack. Thetotal losses are recorded by Golden Deliciouscultivar (24.20%) that both weight loss andspoiling is the highest (Figure 2)During cold storage the cultivars studiedshowed a different degree of pulp consistency,varying between 3.71 kgf/cm² (V4) and 4.82kgf/cm² (V2).Average value of the 5 variants was 4.13kgf/cm², surpassed by the Golden Deliciouscultivar (4.82 kgf/cm²).During storage, the fruit firmness decreased inall variants in different ratios, ranging from3.93 kgf/cm² on an average of 3.66 kgf/cm²,value with 7.4% less than the original.Fruits which remained firmed are related to: V3(Idared), V1 (Jonathan) and V5 (Generos) onwhich firmness decreased from 3.68-5.85%.Firmness showed the largest decrease in variantV2 (Golden Delicious) were registereddrastically firmness decreased from 37.15%,respectively to 26.76%.Influence of drip irrigation on chemical andphysical characteristics to applesResults on the evolution of the main chemicalcomponents during storage are presented intable 4.Table 4. Principal chemical components of apples duringand after storageFigure 2. The total losses recorded at studied varietiesInfluence of drip irrigation on fruit firmnessResults regarding the fruits firmness(penetrometer determined) during storage arepresented in Table 3Table 3. Firmness of apples during storage and afterstoragePenetration value (kgf/cm²)VariantOn After ReductionCultivarinsertion keeping % V1 Jonathan 3.93 3.73 5.09V2 Golden 4.82 3.53 26.76V3 Idared 4.08 3.93 3.68V4 Florina 3.71 3.23 12.94V5 Generos 4.10 3.86 5.85Average - 4.13 3.66 10.86CultivarDry SolubleSubstance(%)Titratableacidity (%)(malic acid)Totalcarbohydrates(%)Ascorbicacid(mg/100g)initial final initial final initial final initial finalJonathan 13.4 13.5 0.50 0.42 11.26 10.29 9.45 7.66Golden 11.8 12.2 0.39 0.32 9.90 9.00 9.18 7.35Idared 11.8 13.0 0.60 0.53 9.60 8.59 6.70 5.41Florina 12.8 13.1 0.59 0.41 10.66 9.88 9.65 7.68Generos 13.3 13.9 0.65 0.56 11.05 10.47 9.06 7.22Average 12.62 13.14 0.55 0.45 10.50 9.65 8.81 7.06Differences +5.20 -17.0 -8.70 -16.4(%)Initial dry substance content at theexperimental variants was between 11.8 and13.4%, with an average of 12.62%, Jonathancultivar and Generos cultivar with the highestvalues and the lowest at the Golden Deliciousand Idared cultivar. During cold storage thecontent of dry substance increased in allvariants reaching on average of 13.14%. Theaverage increase recorded was 5.20%. Theinitial acidity of the fruit (expressed in malicacid /100g) ranged from 0.39-0.65%, with anaverage of 0.55%. The lowest acidity wasrecorded by Golden Delicious cultivar andhighest by Generos and Idared cultivars.During cold storage fruit acidity decreased inall variants on average with 17.0%.101

Total carbohydrate content initially rangedbetween 9.60% and 11.26% depending on thevariant, with an average of 10.50%. The lowestvalues were seen in Idared cultivar and thehighest at Jonathan cultivar. During coldstorage, the carbohydrate content decreased byaverage of 8.7%. Initial content of ascorbic acid(vitamin C) ranged from 6.70-9.65 mg/100gdepending on the variant, with an average of8.81 mg/100g. Fruits with high content ofascorbic acid belong to the Florinaand Jonathan cultivars. During cold storage,the ascorbic acid content decreased in all cases,with an average of 16.4%. The results of themeasurements regarding the weight average,structural-texture firmness and the form indexof apples are shown in table 5.Table 5. Physical features of applesNo.Average Firmness FormVariant Cultivarcrt. weight (g) (kgf/cm²) index1 V1 Jonathan 171.05 3.47 0.842 V2 Generos 207.37 4.85 0.843 V3 Idared 209.20 4.48 0.834 V4 Florina 179.58 6.24 0.92Golden5 V5delicious149.16 4.47 0.94Overall average 183.27 4.70 0.87Influence of drip irrigation on organolepticOrganoleptic test results from Apple(appearance, firmness, taste) after storage arepresented in Table 6In terms of appearance it was found that theGeneros cultivar has obtained the highest score(15.0) of all experimental variantswhile Golden Delicious had the lowest scorefrom experience. From the point of view ofapple appearance all variants showed a highscore from 12.00–15.00 points depending onthe variant, with an overall average of 13.46points.Regarding firmness, the apples obtained from27.00-34.00 points depending on the variant,with an overall average of 31.40 points. Topratedvariants were Idared and Florina, thelowest being Jonathan cultivar.Meanwhile Jonathan and Golden got the lowestscore (12.0).Regarding taste, the apples obtained from42.86-48.57 points depending on the variant,with an average of 45.14 points.Table 6. Organoleptic assessment of apples after storageRating cultivar taste - (points)TheCultivar FirmnessGrade PlaceAspect Taste averageamountsVeryJonathan 12.86 27.00 44.29 84.15good5VeryGeneros 15.00 32.00 48.57 95.57good1VeryIdared 13.71 34.00 44.29 92.00good3VeryFlorina 13.71 34.00 45.71 93.42good2Goldendelicious 12.00 30.00 42.86 84.86 Verygood4Overallaverage13.46 31.4 45.14 90.00 The highest score for taste assessing wasobtained by Generos. At the opposite side itwas Golden Delicious cultivar with the lowestscore of assessment.The total score in apples taste assessing was84.15-95.57 points depending on variant andrated 'very good', with an overall average of90.00 points. On the first place it standsGeneros. Latest seats were occupied in order byGolden Delicious and Jonathan.CONCLUSIONSConclusions on lossesAmong the cultivars tested best behaved wasGeneros, which ranked first a total loss of5.94% without losses through spoilage. GoldenDelicious presented the worst results, with24.20% total losses of which 15.58% throughspoilage.Conclusions on fruit firmnessCompared to the initial firmness of 3.71-4.82kgf / cm ² depending on the cultivar, applesafter storage showed firmness values of 3.23-3.93 kgf / cm ² depending on the cultivar.The apples firmness dropped during coldstorage levels in average with 7-10%, with arange between 3.68-26.76% depending on thecultivar. Between cultivars were observed inthis order Idared, Jonathan and Generos withfruit firmness reduction between 3.68-5.85%.On the last place between cultivars was locatedGolden Delicious whose firmness decreased by26.76%.102

Conclusions on changes in chemicalconstituentsThe main chemical components (soluble drysubstance, titratable acidity, total sugars andascorbic acid) during storage of apples undergosome changes regarding the increase or thedecrease of their recorded content during thestorage in refrigerated space. In that period of110 days, the soluble solids substance contentincreased by 5.20% and the titratable acidity,total sugars and ascorbic acid were reduced by17.0%, 8.70% and 16.40%From the analysis resulted it is showed thatamong all variants, a balanced content of thesecomponents is found at the variants V1-Jonathan cultivar.Conclusions on fruit size and shape indexApples of the late maturing apple cultivarsstudied, differs in fruit size, structural-texturalfirmness and form index. The average weightof the fruit ranges from 149.16-209.20 g(depending on variant), with an overall averageof 183.27 g. The fruits over 200g/pcs presentedthe Generos and Idared cultivars.Firmness of apples varies between 3.47 and6.24 kgf / cm ² (depending on variant) with anoverall average of 4.70 kgf / cm ². The highestvalue was determined from Florina cultivar,and the lowest, from the Jonathan cultivar. Theform index of apples had an overall average of0.87 with a range from 0.83-0.94, depending onthe variant.Conclusions on some organolepticcharacteristicsIn terms of apple’s appearance, all variantsshowed a high score of 12-15 points, with anoverall average of 13.46 points. Generoscultivar obtained the maximum possible scoreof 15 points, while Golden Deliciouscultivar had the lowest score. In terms offirmness, the apples obtained from 27.00 to34.00 points with an overall average of 31.40points. Idared and Florina cultivars were bestrated and Jonathan cultivar received the fewestpoints. Regarding the taste, the apples obtainedfrom 42.86-48.57 points, with an average of45.14 points. The highest score on tasteassessing was obtained by the Generos cultivar.On the opposite side was the Golden deliciouscultivar with the lowest score.The total score at the apples assessing taste was84.15-95.57 points and was rated 'very good',with an overall average of 90.00 points. Thefirst place was located by the Generos cultivar.The last place was taken in order by the GoldenDelicious and Jonathan cultivars.REFERENCESAtkinson D., 1977. The effect of trickle irrigation on thedistribution of root growth and activity in fruit trees.Seminaires sur l’irigation localisee, Bologne Italie 6/9novembre, p. 51-60Botu I., Botu M., 2003. The modern and sustainable fruittree culture. Ed. Conphys, Râmnicu VâlceaCohen D. 1993. Water deficit and plant growth. Hort.Science, vol.21, nr. 5Gherghi A. et al., 2001. Biochemy and Fiziology offruits. Romanian Academy Editure, BucharestGherghi A., 1983. Fruits and their importance.TechnicEditure, BucharestGherghi A. et al., 1989. Tutorial on technology forkeeping of horticultural products. ICPVILF,Technical tutorial nr. 60Gherghi A., Mircea I. and Millim K., 1972. Valorificareamerelor si perelor, Indrumari tehnice ICVLF, nr. 7,Bucuresti103

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653RESEARCH ON FACTORS AFFECTING RASPBERRY PLANT GROWTHParascovia SAVAIP Scientific and Practical Institute of Horticulture and Food Technologies, 14, str. Costiujeni, MD-2019, Chisinau, Republic of MoldovaAbstractCorresponding author email: psava2110@gmail.comThe paper presents the results and observations made in Moldova in the period 2002-2010 on the factors that influenceplant growth and development phenological phases of 29 introduced raspberry variety. It was established as thebeginning of flowering until early fruit maturation medium passes in 27-47 days. After assessing the extent of fruitingplant varieties revealed the Pathfinder, Hybrid Bulgarian, Lloyd George, Rubin Bulgarian, The Latham. The averageweight of the raspberry fruits is a criterion for assessing their quality and which highlighted these varieties HybridBulgarian, Rubin, September, Delbard Magnific, Lazarevscaia. Study after winter hardiness of raspberry varietyintroduced revealed the most resistant to Pathfinder, June, Cayuga, Solnisco, Lazarevscaia, Balsam. Varieties thatshowed an increased resistance to drought are Stolicinaia, Malling Promise, Lloyd George. Among disease-resistantvarieties (Bean and Septoria) have revealed Kuthbert, Indian Summer, Hybrid Bulgarian, St. Walfried, The LathamKey words: raspberry, phonological phases, weight of berries, plants resistance, Republic of Moldova.INTRODUCTIONHydrological regime is one of the factorslimiting raspberries crop. Raspberry shootsduring the growth and fruits ripening period,especially needs a large amount of moisture.Insufficient or excess of water during thisperiod not only adversely affects the fruits andshoots at the moment, but also largelydetermine their viability, harvest of next year(Kazacov and Kicina, 1980).All varieties of raspberry strength are closelyrelated to temperature regime during thegrowing season determine the plant statusduring the resting state. So now, plant growthin the summer, in wet conditions and hightemperatures leads to branching stems andprevents wood cooking at ramifications arisingprematurely, which freezes in winter. Mostvarieties not withstand temperatures belowminus 25°C (Belîh et al,, 2004; ndratencand Ndtocii, 2002).Deep raspberry plantations thrive fungaldiseases, bacterial, viral, especially bean,Septoria, rust, bacterial cancer. Land too acidicand rich in nitrogen, bean grows more quickly,especially in dense bushes (Hoza, 2005;Bogdanova, 2011).MATERIALS AND METHODSStudies on the impact of growing conditionsand plant development, deploymentphenological development stages of raspberryvarieties introduced and the influence ofclimate on crop of fruits quality. The researchwas conducted in the experimental field of theInstitute of Horticulture as recognized andapproved methods for studying small fruits.The plantation was established in 2000 on landwithout irrigation after planting distance of2.5x0.5 mThe study included 29 introduced varieties ofraspberry: Barnauliscaia, Rubin, DelbardMagnific, Stolicinaia, Kirjaci, Pathfinder,President, Kuthbert, Indian Summer, HybridBulgarian, June, Marfilk, Kobfuller, Cayga,Malling Promise, Solnishco, Lazarevscaia,Balsam, Brigantine, Meteor, Red Wadenswil,Lloyd George, Bulgarian Rubin, PaulCamerzid, September, St. Taylor, Walfried,Latham, Malling Jewel. Varieties were assessedby the degree of fructification with note 1 (lowfructification) up to grade 5 (highfructification), the degree of resistance to bean,Septoria, frost and drought were rated at 0(unaffected) and Note 5 (strongly affected).105

RESULTS AND DISCUSSIONSRaspberry is a very demanding crop in soilmoisture due to shallow the root system. In theabsence of rainfall during critical periods ofplant development (growth period of shootsand fruit formation) and to avoid adverseeffects on raspberry fruit crop requiresirrigation plantation. Still made on rainfall datafrom the period of observation during the years2002-2010 are included in Table 1.Table 1. Rainfall during the research period (mm)Months 2002 2003 2004 2005 2006 2007 2008 2009 2010III 58.7 12.4 31.0 14.8 89.1 33.7 35.6 70.8 29.0IV 30.6 34.9 28.0 49.5 36.6 36.5 43.2 2.7 45.1V 10.4 20.6 75.0 75.8 97.1 19.0 42.6 33.3 69.2VI 60.1 21.6 11.0 104.8 81.6 23,7 62.8 39.0 85.0VII 133.4 17.4 10.0 17.6 53.0 3.6 50.2 67.2 67.2VIII 80.6 27.4 25.6 150.9 67.7 33.8 30.8 32.6 53.0IX 47.1 52.7 69.6 4.9 57.8 24.8 77.7 21.7 46.7X 84.2 62.1 33.4 11.0 13.6 71.0 16.0 29.6 68.9IV-IX 446.4 236.7 374.6 429.3 491.5 246.1 358.9 297.4 464.1year 618.0 376.4 651.9 660.3 560 474.4 460.5 455.1 735.2According to Table 1 analysis of data onrainfall amount shows that the minimum annualprecipitation that has accumulated in 2003 yearwas 376.4 mm, and the largest amount wascollected in 2005 year in the amount of 660.3mm, although rainfall during the year and thevegetation period were uniformly distributed,including during critical periods of growth anddevelopment of the raspberry plant. The highestof monthly precipitation fell in August, 2005 inthe amount of 150.9 mm, in July 2002 year to133.4 mm, in June 2001 year to 129.5 mm.The smallest amount of monthly precipitationfell in July 2007 to 3.6 mm, in September 2005to 4.9 mm in August 2001 to 5.4 mm. Airtemperature and soil moisture are important ondevelopment and deployment of raspberryphenological phases. Temperature during theobservation period is presented in Table 2.season aier, which reached only the value of15.71°C, compared to the highest values of18.69 º C, set in 2007.It also showed the lowest average annualtemperature of only 9°C in 2003, comparedwith the highest temperature of 11.5°C,recorded in 2007.Air temperature during 2007 for June, July andAugust with corresponding values of +23.6,25.8, 23.9°C, which was the highest for theentire period of observations. Especially insummer air temperature ranged between +17.9and +27.7 values and C. Phases phenologicaldevelopment of raspberry plants depends on thevariety and other factors, but in particular onclimatic conditions of the year, Table 3.According to phenological observations(Tables 1, 2, 3), and meteorological datarecorded in 2003 year, fell the least amount ofannual rainfall-376.4 mm was recorded and thelowest average annual temperature +9°C, andin vegetation period + 15.71 º C, which led tothe late burgeoning of raspberry plant at April21 during the researches.Air average temperature higher than usual,recorded in February by + 4.9 º C and +7.2 º Cin March of 2002 year contributed to the earlybudding of raspberry plant from March 20.Phenological phases carrying the raspberryplants, during researchTable 3. Phenological phases carrying the raspberryplants, during researchPhenologicalphases2002 2003 2004 2005 2006 2007 2008 2009 2010 meanbeginning ofvegetation20.03 21.04 25.03 10.04 09.04 29.03 05.04 24.03 03.04Durationbetween phases44 28 51 39 42 43 30 46 45 46flowering 02.05 18.05 13.05 19.05 21.05. 10.05 04.05 08.05 18.05Durationbetween phases43 31 34 27 30 36 47 35 35 33Fruit maturation 14.06 19.06 15.06 14.06 19.06 15.06 20.06 12.06 22.06Table 2. Air temperature during research, (0C)Months 2002 2003 2004 2005 2006 2007 2008 2009 2010III 7.2 1.0 5.4 2.3 2.6 7.1 7.2 3.2 3.4IV 10.4 8.5 10.8 10.5 10.9 10.6 11.0 12.2 11.0V 17.9 11.5 14.8 16.5 15.6 18.9 15.5 16.4 16.8VI 20.1 1.2 19.3 18.6 19.7 23.6 20.9 21.1 21.0VII 24.3 21.6 21.7 27.7 22.1 25.8 22.3 23.9 23.1VIII 21.3 22.6 21.1 21.8 22.2 23.9 23.8 23.0 24.9IX 16.6 15.6 15.9 18.3 17.1 16.7 15.5 18.7 16.1X 9.5 9.2 11.4 17.2 12.1 11.3 12.5 11.6 7.5III-X 17.2 15.7 16.43 18.66 17.1 18.69 17.36 18.13 17.20year 11.0 9.0 10.29 11.43 10.2 11.5 11.4 11.3 10.62The 2003 year was marked by the lowestaverage of temperatures during the growing106Raspberry plants flowering usually begins inearly May, although some delays may occur upin the second half of May, depending on theamount of assets accumulated temperatureneeded to start the phenological phases. Lengthof time between phenological stages of buddingand flowering varies between 28-51 days. Sincethe beginning of flowering until early fruitmaturation medium passes in a period of 27 to47 days.

Figure 1. Flowering period of raspberry fruitsPeriod, which lasts from the beginning ofvegetation, to fruit maturation, varies between59-87 days. Raspberry fruit ripening usuallybegins in the second-the third decade of June,with some deviations depending on thetemperatures set in this period.Raspberry reacts negatively to lack of moistureduring fruit formation and growth, which canlead to fruit weight reduction, fruit quantity andquality.Table 4. Development indices and the degree ofresistance raspberry plant, years 2002-2006VarietyDegree offructification,noteAveragefruit weightgrade,g degree ofBeandamage,note,Degree ofseptoriadamage,noteDegree offrostdamage,noteDegree ofdroughtdamage,note1.Barnauliscaia 2 2.0 2 1 2 32.Rubin 3 3.2 5 3 2 43.DelbardMagnific3 2.9 3 3 1 54.Stolichnaia 4 2.5 4 3 1 05.Chirjaci 4 2.0 4 3 1 46.Paphinder 5 1.6 2 3 0 27.President 1 2.5 2 2 1 -8.Kuthbert 1 1.6 0 0 4 39.IndianSummer3 1.6 0 0 2 210.HybridBulgarian5 3.5 0 0 1 311.June 1 1.3 1 1 0 412.Marfilk 1 2.0 2 2 2 -13.Kobfuller 4 2.4 - - 1 214.Cayga 3 2.5 1 1 0 -15.MallingPromise4 2.1 3 2 2 016.Solnishco 3 2.2 1 1 0 417.Lazarevscaia 4 2.7 4 4 0 118.Balsam 3 2.3 1 2 0 119.Brigantine 3 1.9 2 2 1 220.Meteor 1 1.6 2 2 1 421.RedWadenswil4 1.6 1 1 2 122. LloydGeorge5 2.7 2 3 1 023.RubinBulgarian5 2.5 3 2 2 424.PaulCamerzid2 2.4 - - 2 325.September 4 3.2 4 4 1 526.St. Walfried 4 1.7 0 0 2 127.Taylor 1 2.0 2 2 3 128.The Latham 5 2.1 0 1 1 129.MallingJewel2 2.2 3 2 2 3Variation limits 1-5 1.3-3.5 0-5 0-4 0-4 0-5Raspberry varieties capacity to adapt to the newconditions of growth and development of plants107is different, and lack of rainfall can affect thequantity and quality of the harvest, reduce fruitweight, if necessary measures are not related toirrigation. As a result of research conducted onplant development, degree of fruiting, fruitweight, degree of damage by disease, frost anddrought were assessed raspberry varieties onirrigated land, and the data obtained arepresented in Table 4.Appreciation fruiting varieties studied by theability to highlight varieties allowed Pathfinder,hybrid Bulgarian, Lloyd George, RubinBulgarian, Latham, who showed top marks inthe grade 5 on level fruition.The average weight of the fruits of raspberry isa criterion for assessing the quality varieties.The results obtained on fruit size allowed tohighlight the following varieties of fruitslargest: Hybrid Bulgarian-3.5 g, Rubin,September-3.2 g, Delbard Magnific-2.9 g,Lazarevscaia – 2.7 g. Small fruit varieties from1.3 to 1.6 g were: June, Meteor, Pathfinder,Red Wadenswil, Indian Summer, Kuthbert, St.Walfred.Figure 2. Maturation period of raspberry fruits, varietyDelbard MagnificResearch on winter hardiness of raspberryvariety introduced, included in the study andappreciation revealed the 0 score of thetoughest as: Pathfinder, June, Cayuga,Solnishco, Lazarevscaia, Balsam. Varietiesshowed an increased resistance to drought areStolicinaia, Malling Promise, Lloyd George.Among disease-resistant varieties (bean andSeptoria) were highlighted: Kuthbert, IndianSummer, Hybrid Bulgarian, St. Walfried, TheLatham.

CONCLUSIONSAs a result of scientific research conducted ondeveloping varieties introduced raspberryestablished that:Budding is usually between 20.03-10.04,although there are some variations until 21.04.Early flowering begins average over 28-51days. Early flowering usually occurs in earlyMay at 02.05.Early fruit ripening occurs on average at 27-47days after the beginning of flowering.Maturation begins usually in the second-thethird decade of June from 12 till 20.06.depending on the year.After assessing the extent of fruiting plantvarieties revealed the Pathfinder, HybridBulgarian, Lloyd George, Rubin Bulgarian,The Latham.The average weight of the fruits of raspberry isa criterion for assessing their quality and whichhighlighted the following varieties as HybridBulgarian-3.5 g, Rubin, September-3.2 g,Delbard Magnific-2.9 g, Lazarevscaia-2 7 g.Study regarding the raspberry varietiesintroduced after winter hardiness revealed themost resistant as: Pathfinder, June, Cayuga,Solnishco, Lazarevscaia, Balsam.http://agricultureforlife.usamv.ro:9080/UserArticle#Varieties which showed a high resistance todrought are Stolicinaia, Malling Promise, LloydGeorge.The disease-resistant varieties (bean andSeptoria) have revealed Kuthbert, IndianSummer, Hybrid Bulgarian, St. Walfried, TheLatham.REFERENCESMladin Gh., Mladin Paulina, 1992. Cultura arbutilorfructiferi pe spaii restrânse, Bucureti, p.32-39.zv I., icin, V., 1980. lin. sv,Rsslihzizdat, p. 5-21.ndratenco P., Nadtocii I., 2002. Calina, malina, ojinata oblepiha. Sorti razmnojenia, birocivania tavicoristania. iiv, p.15-40.Belîh ., Backlanova G., Beliaev ., 2004. lincrasnaia v lsstpi Priobia. . Sib.td-ni. i. I. V. icirin. – Nvsibirsc, p.47-56.Hoza D., 2005. Cpunul, zmeurul, coaczul, murul.Tehnici de cultivare. Bucureti, Editura Nemira, p.96-153.Bgdnv I. i dr., 2011. Srt i grthnic plodovîh,iagodnîh i decorativnîh culitur dlia Urala.ctrinburg, «sbestovscaia tipografia, p.36-41.108

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653AbstractPHENOLOGY RESEARCH ON BLACKBERRY DEVELOPMENTIN REPUBLIC OF MOLDOVAParascovia SAVA, Cristina CATERENCIUCIP Scientific and Practical Institute of Horticulture and Food Technologies Chiinau, 14,str. Costiujeni, MD-2019, Chiinau, Republic of MoldovaCorresponding author email: psava2110@gmail.comThe paper presents research results and observations made on the development of phenological stages and plantdevelopment of blackberry varieties Darrow, Smoothstem, Thornfree studied during the years 2010-2012 in theRepublic of Moldova. It was established that during the period between budding and flowering was 31-46 days andfruit ripening begins at 55 -64 days from the beginning of flowering. The varieties studied during fruit maturation untilearly vegetation ranges from 88 to 114 days. The average length of blackberry shoots ranged from 1.18 to 3.29 m andthe average number on bush was 8-11. pcs. The average mass of blackberry fruit settled in the amount of 2.9 to 4.9 g.Bush fruit number ranged from 224 pcs. to 483 pcs.Key words: blackberry, varieties, phenophases, fruit mass.INTRODUCTIONSmall fruits have and continued to have animportant role in the national economy and increating a cleaner environment and beneficialas everyday living. Blackberry bush culturehave a great importance because of tastequalities, herbal capacities, being rich incontent of tannins, flavones, organic acids,vitamin C, pectic substances etc. (Cociu,Oprea, 1989; Chira, 2000).The Importance ofblackberry bush is subject to a number ofadvantages over other fruit crops. One of theseadvantages is that blackberry bush easily andquickly multiply. He enters and gives earlybearing crops rather large. The yields areobtained from plants of blackberry in the 3-4 -third year after planting. Because blackberrybush blooms later, the flowers not affect byspring frosts (Mladin, 1992). Blackberry bush,early varieties, blooms during the last decade ofMay and the first days of June to late varieties.Flowering duration is 5-8 days. While mostvarieties are autogamous, cross pollinationensures maximum yields and high quality. Fruitmaturation occurs gradually, and the during ofripening is related to the particular variety,which varies from 20 to 25 days for earlyvarieties and from 50 to 80 days for latevarieties. Usually, the first fruits of blackberry,109which matures on bush are the largest (Cociu,Oprea, 1989; Babuc, 2012).MATERIALS AND METHODSThe research has been conducted ondemonstration experimental field of Smallfruits laboratory in the Technological-Experimental Station 'Codru' of IP ISPHTA. Asresearch objects was included 3 varieties ofblackberry: Darrow, Smoothstem, Thornfree.Blackberry plantation was established in 2007year after planting distance of 3.0 x 1.5 m,number of plants of each variety in the eachiteration was 20. Scientific study wasperformed according to field and laboratorymethods under accepted and approved programfor small fruits (Cociu, Oprea, 1989;Miciurinsc, 1973).RESULTS AND DISCUSSIONSSwelling buds, that usually occurs in March,with some variation from year to year, the sumof active temperatures reach 60-80°C forblackberry varieties (from a biologicalthreshold +5°C). Blackberry varieties buddingbegins when, the sum of active temperaturesvaries from 80 to 150°C (Balan, Cimpoie,Barbroie, 2002). In the first half of 2012 year

observations were made on phenologicaldevelopment phases of blackberry varieties.Evidence of harm caused by low wintertemperatures was conducted in spring, duringthe accelerated growth of plants. Theimpairment of blackberry plants by low wintertemperatures was established as a result ofobservations and appreciated as middle withthe note 3.The climate conditions on Republicof Moldova are quite complicated. Insufficientrainfall during the year and especially duringthe growing season but besides all these, thereare also unevenly distributed, especially duringcritical periods of plant development, and whenthe air temperatures are too high. Dataaccumulated rainfall amount and temperatureestablished during the vegetation period areincluded in Table 1.Table 1. Climatic conditions during the vegetation period of research2010 2011 2012 Year averageMonthRainfall Air temp Rainfall Air temp Rainfall Air temp Rainfall Air temp(mm) (ºC) (mm) (ºC) (mm) (ºC) (mm) (ºC)IV 45.1 11.0 57.6 9.9 16.4 13.2 39.7 11.4V 69.2 16.8 56.4 16.4 65.3 19.2 63.6 17.5VI 85.0 21.0 161.3 20.1 20,2 23.3 88.83 21.5VII 67.2 23.1 15.5 23.0 36.03 26.0 57.03 24.03VIII 53.0 24.9 16.1 21.1 27.4 22.4 32.2 22.8IX 46.7 16.1 8.2 19.1 38.9 19.2 31.3 18.1X 68.9 7.5 36.4 9.5 46.9 12.9 50.7 10.0Sum (mm)Average(ºC)IV-X435.1 17.2 351.5 17.01 303.5 19.46 363.4 17.9The data included in Table 1 allow us to statethat during the growing season of 2012 yearwas the lowest amount accumulated rainfallamounting to 303 mm and the averagetemperature of air was the highest of 19.46°C.The highest amount of rainfall in the amount of435 mm accumulated during the growingseason of 2010 year, and the averagetemperature comparatively low reached 17.2°C.Research conducted according to methods fieldand laboratory work allowed registration datacovering the period of vegetation phenologicalphases blackberry varieties that have beenexposed in Table 2. The vegetation blackberryplant occurs in early spring, at the end ofMarch and beginning of April when ontemperatures 2-4 º C begin the roots to rise andadventitious buds activate the root of the neck(Mladin Gh., Mladin P., 1992).From making observations on plantdevelopment in terms of new development andconduct phenological phases of blackberryvarieties has been established as a satisfactorygeneral condition of the plants, the plantsshowed good development of the leaf andphenological phases were conducted in normalas characteristic peculiarities of varieties andclimatic conditions during the research. In the110first half of the year were aimed plant diseaseresistance blackberry variety, the result ofwhich has been established that all studiedvarieties are resistant to mildew.As shown in Table 2, the earliest variety ofblackberry that first begins vegetation Darrow,then later start in vegetation Thornfree andSmoothstem varieties. According toobservations made in the conditions of 2012year blackberry plant growth and phenologicalphases were conducted with 6-10 days earlierthan in 2011 year and 7 to 16 days earlier thanin 2010 year.Blackberry plants budding took place in theperiod from 08.04 until 12.04. The earliestblooming the variety Darrow, followed byvariety Smoothstem with 10-12 days later, andthe variety Thornfree blooms with 15 to 18days later than the variety Darrow. Duration ofbudding and flowering periods of blackberryplant varies from 31 to 46 days.Blackberry varieties flowering takes placerelatively late, when temperatures of aier arestable positive. The time difference between thetime of flowering of early varieties and latevarieties was 20 days (Mladin Gh., Mladin P.,1992).

According to observations made, besides thecharacteristic features of blackberry varietiesstudied, flowering phenological phase dependsmainly on climatic conditions laid down in thecorresponding period phenological stage ofdevelopment. Blackberry varieties startflowering took place at 10.05. up to 01.06. andlasted from 28.05 until 21.06. The duration offlowering plants blackberry varieties includedin the study ranged from 16 to 23 days.Blackberry fruit maturation takes place in thelast days of June to the first decade ofSeptember. During fruit ripening at differentblackberry varieties is almost three months,which is very important to provide fresh fruits(Hapova S., 2003).The results obtained allowed to establish thatblackberry fruit ripening took place over 55-64days from the beginning of flowering (Figure1). The varieties studied during the earlyvegetation until fruit maturation period rangedbetween 88 and 114 days. Early maturingvarieties of blackberry took place at 21.06. upto 28.07. and lasted from 29.07 until 09.09.During the period of ripening blackberry planton varieties included in the study ranged from30 to 46 days (Figure 2).As a result of measurements made at varietiesof blackberry plants studied were obtained dataon capacity development and fruitingblackberry plants that have been included inTable 3.The variety Darrow is from the group cumanicaand is an early variety, very productive, withthe ability to suckers, has erect stems, but witha drawback, are endowed with sharp thorns andbend the tip, which creates inconvenience toharvest fruit.According to the data in Table 3 wasestablished that the average length of strains onthe blackberry variety Darrow reached valuesranging from 1.15 m in 2011 year until 1.21 mon 2012 year.The variety Smoothstem average length of thestrains corresponding ranged between 1.58 mand 2.13 m. The variety Thornfree reached thehighest values, the average length of the strainswas corresponding 3.03 m and 3.55 m, datafrom the emerge as the most vigorous variety.The variety,yearsDarrow201020112012Smoothstem201020112012Thornfree201020112012Table 2. Phenological stages of plant development in blackberry varietiesBeginning Phenophases Floweringof budding period beginningend duration15.0410.0408.0421.0420.0410.0428.0426.0412.0432343234334231364617.0519.0510.0522.0523.0522.0529.0501.0628.0502.0606.0628.0509.0608.0612.0621.0618.0619.06161718181621231722Fruits maturationPhenophasesperiod565957625961605564beginning in end durationDurationmass formation12.0717.0721.0623.0721.0715.0728.0726.0721.0705.08 19.0830.07 16.0805.07 29.0718.08 08.0915.08 05.0908.08 28.0819.08 09.0917.08 07.0917.08 02.093730394645444342429389968811410510397104The average length of stems varied between1.18 and 3.29 m, and the limit of changesdeviated from 1.15 to 3.55 m.Average number of strains of the blackberrybush varieties has varied on years from 8shoots on the variety Smoothstem and up to 11pcs. on the variety Darrow. The average massof blackberry fruit ranged from 2.9 g to 4.9 gDarrow variety to variety Thornfree. Limit ofvariation from the average mass of blackberryfruit ranged from 2.7 to 5.1 g The averagevalues of fruits on the blackberrybushes ranged from 224 pcs. on the varietySmoothstem up to 483 pcs. on the varietyThornfree. Limit of variation deviated between195-540 fruits/bush.111

Figure 1. Flowering period and blackberry fruit growthFigure 2. Maturation period of blackberry fruits, varietyDarrow The varietyDarrow20112012Table 3. Plants development and fructification capacity of blackberry varietiesAverage length ofPresence of thornsstems, mthorns branches 1.151.21Number of stemsm/bush, pcs.911Average weight ofa fruit (g)Mean 1.18 10 2.9 286Smoothstembranches without 1.5883.92011thorns2.1384.22012Mean 1.86 8 4.1 224Thornfree20112012branches withoutthorns3.033.55992.73.14.75.1Number offruits/bush, piece.Mean 3.29 9 4.9 483Limit ofvariation 1.15-3.55 8-11 2.7-5.1 195-540216355195252426540The variety Smoothstem average length of thestrains corresponding ranged between 1.58 mand 2.13 m. The variety Thornfree reached thehighest values, the average length of the strainswas corresponding 3.03 m and 3.55 m, datafrom the emerge as the most vigorous variety.The average length of stems varied between1.18 and 3.29 m, and the limit of changesdeviated from 1.15 to 3.55 m.Average number of strains of the blackberrybush varieties has varied on years from 8shoots on the variety Smoothstem and up to 11pcs. on the variety Darrow.mass of blackberryfruit ranged from 2.9 g on variety Darrow to4.9 g on variety Thornfree. Limit of variationfrom the average mass of blackberry fruitranged from 2.7 to 5.1 g. The average values offruits on the blackberry bush ranged from 224pcs. the variety Smoothstem up to 483 pcs. thevariety Thornfree limit of variation deviatedbetween 195-540 fruits / bush.CONCLUSIONSAs a result of research carried out at thediscretion Darrow blackberry varieties,Smoothstem, Thornfree included in the study -found that:The period between budding and floweringvaries between 31-46 days flowering periodfrom 16 to 23 days.Fruit maturation takes place between 55-64days from the beginning of flowering.During the ripening of blackberry fruit isbetween 88 to 114 days.The average length of blackberry stems settledin variety Darrow 1.18 m, 1.86 m in variety andvariety Smoothstem Thornfree 3.29 mAverage number of strains of the blackberrybush was 8 pcs. on the variety Smoothstem, 9pcs. on the variety Thornfree, and 10 pcs. onthe variety Darrow.The average weight of blackberry fruits, settledin the amount of 2.9 g on variety Darrow, on112

the variety Smoothstem 4.1 g, and 4.9 g onvariety Thornfree.Number of fruits on bush ranged from 224 pcs.on the variety Smoothstem, 286 pcs. on thevariety Darrow and 483 pcs. on the varietyThornfree.REFERENCESMladin Gheorghe, Mladin Paulina, 1992. Culturaarbutilor fructiferi pe spaii restrînse. EdituraCERES, Bucureti, p. 88.Cociu V, Oprea t., 1989. Metode de certare înameliorarea plantelor pomicole. Editura Dacia, Cluj-Napoca.Lenua Chira, 2000. “Cultura arbutilor fructiferi”,Editura M.A.S.T, Bucureti, p. 102.Spiridon I., 2008. Hobby. Afacere. Editura Alex – Alex.Bucureti, p. 5.Programa i metodica sortoizucenia plodovîh, iagadnîh iorehoplodnîh cultur.1973. Miciurinsc, 398 s.Balan,V., Cimpoie, Gh., Barbroie, M., 2002.Pomicultura, Chiinu, p. 184-188.Hapova S., 2003. Vsio o iagodnîh culiturah: luciie sorta,novîe rasteniea. Atlas-spravocinic sadovoda. Izd-voOOO Academiea razvitiea, Academiea holding,Iaroslavli, 2003, s.12-15; -. - , , , .5-12.113

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653COMPARATIVE STUDY REGARDING THE INFLUENCE OFBIOSTIMULATORS ON THE QUALITATIVE AND QUANTITATIVEPOTENTIAL OF CABERNET SAUVIGNONMarinela STROE, Codrin BUDESCUUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest , 59 Marasti, 011464,Bucharest, RomaniaCorresponding author email: marinelastroe@yahoo.comAbstractThe popularity, the qualitative parameters and the impressive variability proved by the Cabernet Sauvignon variety,offers new ways of approach to the practice of winery and to scientific research. This paper presents a comparativestudy regarding the influence of some biostimulators on the production and quality potential of the Cabernet Sauvignonvariety, in the ecological, pedological and climatic conditions recorded in Urlati wine center, from Dealu Marevineyard. The experiment proved the application of 3 treatments with these bio-stimulators (Tecnophyt PK, TecaminBRIX, Tecnokel amino CAB 2), during grape phonological growth, as follows: at the binding of the grapes (berry) 1-2mm, when the grapes had a diameter of 4-6 mm and when the grapes had 6-8 mm. Observations and detaileddeterminations regarding the agro-biological and technological behavior were performed in the same time, but theproduction was especially evaluated in terms of physical-chemical parameters of the grapes, in order to obtain somequality wines, with particular notes. All the obtained results in terms of production, quantity and quality are leading tothe idea that the used biostimulator substances had a positive influence, with the remark that for a 5.8% productionincrease, the quality parameters (sugar, acidity, polyphenols) are situated in the same limits, even higher sometimes,fully justifying their use.Key words: biostimulators, ecological factors, phenological, vineyard, variety.INTRODUCTIONCabernet Sauvignon variety owns at presenttime in our country, the largest cultivatedsurface with varieties designed to obtain qualityred wines, and although they are morecultivated in many wine centers (74),positioned in the hilly Carpathians of Munteniaand Oltenia, the South of Moldavia andDobrogea as well as in some wine centers inthe west of the country, found its second homein Dealu Mare vineyard.Although adapted to the climate here, CabernetSauvignon presents an impressing variability ofthe phenolic characters in the plantations,various biotypes being detected here,differenced as follows: according to the type offlowers, the length of the inflorescence, thedegree of ramification of the inflorescence, thebinding percentage of the grapes, the shakingpercentage of the already formed flower(42,8%) as well as the undevelopment of thegrapes, which in some years, leave a mark onthe production.115Starting from this consideration, in the presentpaper has been analyzed the influence and theeffect of foliar application of somebiofertilizers, in different stages regarding thegrowth of the grapes, on the enhancement ofthe productive and technological potential(Antonacci and Perniola, 2012) of this variety,in the wine year 2011-2012.The interpretation of the results obtained afterthis experiment were analyzed under the aspectof production quality parameter definition(production per vine, sugar, acidity),(Pârcalabu, 2010).MATERIALS AND METHODSThe reasearch was made in the wine centerUrlati, which is located in the Dealu Marevineyard where Cabernet Sauvignon varietywas conducted on a semi-high, mixed pruningsystem, Guyot on a semi-stem pruning system,with a load of 30 buds/vine, at a plantingdistance of 1,0/2,5 m (Figure 1).

Figure 1. Cabernet Sauvignon variety in the experimentalfield-wine center Urlati, 2012Bio-stimulators used (Table 1) have a largeaction specter including bio-stimulating effects,growing and auxinic regulators, not being toxicfor humans, bees, fish, non-cumulative andbiodegradable.Table 1. Phenological study of vine during biofertilizers treatment applicationPrincipal growth stage 7: Development of fruits(BBCH MODIFIED PHENOLOGICAL SCALE FOR COST ACTION FA1003)Phenological stage73: Berries groat-sized, bunches beginto hang (4 mm in diameter)Phenological stage71: Fruit set: young fruits begin to swell,remains of flower lost (1-2 mm)I treatmentTecnophyt PK 3 l/haSmall-berry grape only formats13.06.2012II treatmentTecamin BRIX 2 l/haGrapes with berries 4-6 mm in diameter30.06.2012Phenological stage75: Berries pea-sized, bunches hang(7 mm in diameter)III treatmentTecamin BRIX 2 l/ha & Tecnokelamino CAB 2 l/haGrapes with berries 6-8 mm indiameter14.07.2012Foliar treatments have been applied accordingto the experimental protocol, which prefiguredapplying them in different phenophases ofgrape growing, as follows: at binding 1-2 mm,when the grapes were 4-6 mm diameter andwhen the grapes were 6-8 mm diameter (Table2). During growing period were takenobservations on the whole phonologicalspecter, and at the harvesting moment, on amedium sample of 10 grapevines, there weremade the following determinations: fertilitycoefficients (absolute and relative),productivity indexes (absolute and relative –g/sprout), grape number per vine, averageweight of a grape, average weight of 100grapes, production in kilograms/vine, sugar116(g/l), acidity (g/l of tartric acid), anthocyaninsmg/l, polyphenolic total index, and so on. Inorder to provide information regarding thequality of the production obtained, it wasquantified the term of grape production quality(Pârcalabu, 2010) which was expressedthroughout three components: production pervine in kg/vine; sugar concentration of the mustg/l; must concentration in total acidity g/l.Dimensioning the grape production quality ismade for each variety eventhough in the samewine area are cultivated white wine varieties aswell as red wine varieties.A possibility to obtain quality characteristicsindependent from the variety is to divide eachquality component (P-production, Z-sugar

content, A-acidity content) to the optimalvalues of each variety P opt, Z opt , A opt. Optimalvalues in Dealu Mare vineyard – ValeaCalugareasca are the multi-annual averages ofthese values (Pârcalabu, 2010), as follows:sugar – 210 g/l, acidity-4,4 g/l of tartric acid,production – 2,62 kg/vine. Therefore they aredefined: Production quality coefficient: c pdefined by the ecuation: c p = P/P opt ; Qualitycoefficient in sugar must content: c z defined bythe ecuation: c z = Z/Z opt ; Quality coefficient inmust total acidity content c a defined by theecuation: c a = A/A opt . Quality vector has in thiscase, the component c = ( c p, c z, c a ) . The bestquality is considered when, on each componentquality coefficient exist and has the value closeto 1. This being the ideal case, c = (1, 1, 1) or ifthey are expressed in percentages then thisquality will become c = (100%, 100%100%).In this case the values of quality coefficientsare sub-unitary or supra-unitary, we canconclude that, qualitatively speaking, theculture is not at optimal parameters.ExperimentalvaluesCabarnetSauvignon(fertilized)CabarnetSauvignon(control)Small-berry grape only formats13.06.2012Tecnophyt PK 3 l/ha(Potassium phosphate)Total Phosphorus P 2 O 5 30% w/w,Total PotassiumK 2 O 20% w/w, pH 4;Table 2. Applied products featuresActivation of natural defending mechanisms ofthe plants, control and prevention ofphytopatogenous mushrooms (Plasmosparaviticola).Inducind phytoalexines synthesisRepresents an asimilable and concentratedPotassium and Phosphorus sourceGrapes with berries4-6 mm in diameter30.06.2012Tecamin BRIX 2 l/haPotassium (K 2 O) 18%w/w,Boron (B), 0,2% w/wSea weed extract, richin auxines andgiberelines 10% w/wIt enhances the colorof the fruits and thesugar contentDetermines the growthof fruits dimension- - -Grapes with berries 6-8 mmin diameter14.07.2012Tecamin BRIX 2 l/ha&Tecnokel amino CAB 2 l/haCalcium oxide (CaO) 10% w/wBoron (B) 0,2% w/wL-Aminoacides 6% w/wEDTA (Ethylenediaminetetracetic acid)Increases fruit firmness andpost-harvesting qualityIncreases breaking resistanceControl over physiologicaldisfunctions associated with thelack of CalciumOptimal values in Dealu Mare vineyard, Valea Clugreasc are: sugar: 210 g/l, 4.4 g/l tartric acid and production 2,62kg/vineTo evaluate more easily how qualityperformant a variety acts inside an area or afterapplying a technology, it can be introduced therelative quality coefficient (relative to theoptimal values), defined by the threecomponents: Relative quality coefficient inproduction: c p defined by the ecuation c pr =/P opt = c p -1; Relative quality coefficient ingrape must sugar content: : c z defined by theecuation: c zr = /Z opt = c z -1; Relative qualitycoefficient in total acidity grape must content:c a defined by the ecuation: c ar = / A opt = c a -1.Quality vector has, in this case the componentc r = ( c pr, c zr, c ar ) (Table 3). Appreciating thequality potential of a variety in accordance tothe relative quality coefficient is made takinginto consideration the fact that the variety has agreater adaptability area as the relative qualitycoefficient values recorded are closer to zero.Table 3. Quality components of grape production analysis Vectors that define quality parameterc p =P/P opt *c z =Z/Z opt * c = ( c p, c z, c a )c pr = /P opt = c p -1c zr = /Z opt = c z -1c a =A/A opt * c ar = /A opt = c a -1c r = (c pr, c zr, c ar )117

RESULTS AND DISCUSSIONSBecause of the fact that to both of theexperimental variants was applied the sameagrotechnics (pruning type, pruning system,load of buds per vine, planting distances, andso on), it is observed that there weren’tsignificant differences regarding the elementsthat define the fertility of a variety (c.f.a, c.f.r,number of grapes per vine) values obtained forboth of the variants being very close (Table 4).Productivity level was appreciated with thehelp of the productivity indexes (absolute andrelative) that gives informations about thegrape quantity on a fertile sprout, and from thispoint, it is observed that, the fertilized variantobtains higher values (173 g/sprout), incomparation with the control variant (165g/sprout) because the values of a grape’saverage weight know the same differences.The differences more or less significant showedas a result of applying the biofertilizers, in thegrape growing phenophase, practically insuringa better growth of the grapes, gradually in thethree applying stages (13.06.2012, 30.06.2012,14.07.2012), as well as a higher grape weight.At the harvesting moment, Cabernet Sauvignonafter the three treatments obtains grapes with ahigher average weight (92 g), compared to thecontrol variant, difference that is observed inthe average weight of 100 grapes. Regardingthe production that was obtained and itsquality, higher accumulations of sugar areshowed at the fertilized variant (219 g/l),comparing to the control with values of only202 g/l.Production per vine, also shows suchdifferences, and a plus of 5,8% in case of biostimulatorstreatment was made, can beobserved. Surprisingly, comparing the averagevalues of the anthocyans accumulations and thetotal polyphenol index, it is underlined the factthat, at the control variant these values aresuperior, comparing to the fertilized variant.It can be concluded partially that, applying biofertilizersto avoid massive flower shaking anda good grape binding and growing, brings aplus of quality production through grapegrowth, enhances the sugar content and doesn’tenhance grape color (at least in the chosenvariants Tecnophyt PK 3 l/ha, Tecamin BRIX 2l/ha, Tecnokel amino CaB 2 l/ha and for vine,especially).Table 4. Cuantification of the biofertilizers effects on the productive and technological potential of Cabernet Sauvignonvariety in the conditions of Urlati vineyard Experimental variantsand specificationCabernet Sauvignon(fertilized)Cabernet Sauvignon(control)Experimental variantsand specificationCabernet Sauvignon(fertilized)Cabernet Sauvignon(control)Experimental variantsand specificationCabernet Sauvignon(fertilized)Cabernet Sauvignon(control)Absolute fertilitycoefficientRelative fertilitycoefficientAbsolute productivityindex (g/sprout)Relative productivityindex (g/sprout)1,78 1,38 173,0 132,481,89 1,36 165,0 118,4No. ofgrapes/vineAverage weightof a grape (g)Weight of100 grapesProduction(kg /vine)25 92 96,5 2,21024 87 92,3 2,088Sugar(g/l)Evaluating the parameters that defineproduction quality of Cabernet Sauvignon inaccordance to the results obtained after theexperiment was realised through dividing eachquality component (production, sugar, acidity)at optimal values of each variety, (optimalAcidity(g/l tartric)Anthocyans(mg/l)219 4,46 1187,6Total polyphenolicindex202 4,98 1466,7 447,44118values or productive potential of the variety areconsidered average multi-annual values of theclosest area, Valea Clugreasc (Table 5).It is observed that, applying some biofertilizersin different growing stages of the grapes, theseparameters record values close to 1 (1,042 – for

sugar accumulated in grapes and 1,01 for mustacidity) which shows the fact that, the varietyreached at the moment of full maturation atechnological potential close to the optimal(variety potential). For the productionparameter, the value obtained of 0,84 or84,35% shows that from this point of view, thevariety was situated under the optimalparameter.Appreciating the qualitative potential of thevariety in conformity with the relative qualitycoefficient values underline that, underaccumulated sugar quantity and reachedacidity, the biostimulators variant recordsvalues close to zero, which shows a very goodadaptability of the variety and the chosenresearch variant, based on favorableecopedoclimatic conditions in which theexperiment took place. For the control variant,it is observed that the sugar parameter recordsvalues close to 1 (0,96 or 96,19%), underliningthe fact that, the variety has reached at the fullmaturity moment a technological potential veryclose to optimal (variety potential). For theother two parameters, the production per vineand the grape must acidity, the values recordedare even too low (0,79), even too high (1,13),showing the fact that, from this point of viewthe variety situated under its potential. Forappreciating the qualitative variety potentialcompared to the relative quality coefficient it isunderlined the same tendancy – under the sugaraccumulation the control variant records valuesclose to zero (0,04), hierarchically followed bythe values recorded by the acidity and theproduction/vine, with lower values, but not thatlow so that the differences could be statisticallyinsured.Table 5. Cuantification of the effects of biofertilizers on quality parameters of Cabernet Sauvignon variety in theconditions of Urlati vineyardExperimental variants Vectors that define quality parametersc p =P/P opt *c pr = /P opt = c p -1Cabernet Sauvignon(fertilized)Cabernet Sauvignon(control)0,84c z =Z/Z opt *1,042c a =A/A opt *1,01c p =P/P opt0,79c z =Z/Z opt0,96c a =A/A opt1,13c = ( c p, c z, c a )0,84, 1,042, 1,0184,35%, 104,2%, 101,1%c = ( c p, c z, c a )0,79, 96,19, 1,1379,69%, 96,19%, 113,18%0,16c zr = /Z opt = c z -10,042c ar = /A opt = c a -10,013c pr = /P opt = c p -10,20c zr = /Z opt = c z -10,04c ar = /A opt = c a -10,13c r = (c pr, c zr, c ar )0,16 , 0,042 , 0,013c r = (c pr, c zr, c ar )0,20 , 0,04 , 0,13CONCLUSIONSThe results obtained under the aspect ofquantity and quality lead to the idea that thebiostimulating substances used had a positiveinfluence on Cabernet Sauvignon, observingthat at a production rate of 5,8%, parametersthat define quality (sugar, acidity, polyphenols)are situated at the same limits, sometimes evenhigher, justifying their use. Regardingproduction quality it is underlined the fertilizedvariant, the deviation from the optimalproduction being minor – 84,35% and for theaccumulated sugar and the grape must aciditythe values obtained are closer to 1 showing thefact that the variety reached at the moment offull maturity a technological potential close tothe optimal one (variety potential). For thecontrol variant it is observed that the sugarparameter records values close to 1 (0,96 or96,19%), and for production and acidity thevalues recorded are even too low (0,79 or79,69%,) or even too high (1,13 or 113,18%),situating the variety under its optimal potential,but not that far to have and influence on thequality of the wine.REFERENCESAntonacci D., Perniola R., 2012. Trattamento conbiostimolanti per il miglioramento della qualitàdell’uva e della differenziazione a frutto delle gemmein varietà di uve da tavola senza semi. OrganisationInternationale de la Vigne et du Vin, Paris, le 13 mars2012.119

Pârcalabu Liliana, 2010-Cercetari asupra delimitariiunitatilor “terroir” si a sistemului informatic degestionare cu privire special la central viticol ValeaCalugareasca. Teza de doctorat, U.S.A.M.V.Bucuresti, p. 238-242.Stroe Marinela, 2012-Ampelografie. Editura Ceres,Bucuresti, 2012.http://www.diprove.unimi.it/GRAPENET/index.php,Cost action FA1003: East-West ollaboration forGrapevine Diversity Exploration and Mobilization ofAdaptive Traits for Breeding, PHENOTYPINGTRIAL 2012, First circular 12th March 2012.***-O.I.V. guidelines for studies on the effects ofclimate change in vitiviniculture and proposedadaptations. Organisation Internationale de la Vigneet du Vin, Paris, le 13 mars 2012.120

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653TECHNICAL ASPECTS CONCERNING THE QUALITY PRESERVATIONIN FRESH AND DEHYDRATION OF APRICOTSMarian VINTILResearch and Development Institute for Processing and Marketing of the Horticultural Products -Bucharest, No. 1A, Intrarea Binelui Street, District 4, 042159, Bucharest, RomaniaAbstractCorresponding author email: mavintila@yahoo.comThe researches carried on in ICDIMPH-Horting had in view to emphasize the influence of the variety and post-harvesttemperature on quality preservation in fresh and dehydration of apricots from internal production. In this way, threevarieties of apricots (Royal, Mari de Cenad, Cea mai buna de Ungaria), coming from the same orchard and beingsimultaneously harvested, were kept in different conditions (environmental temperature, refrigeration and cold storage)for testing the capacity of quality preservation of fresh fruits. At the same time,the apricots have been tested duringdehydration process, the researches being focused on conduct, quality and output of the product. Taking intoconsideration losses level and the evolution of firmness and some chemical components, resulted that in environmentalconditions Royal variety gave better results, Cea mai buna de Ungaria emphasized its good behaviour in refrigeratedrooms and Mari de Cenad kept better quality than the others in cold conditions. Concerning dehydration, the resultsstated that the variety and maturity stage influence the output and duration of the process. The variety Mari de Cenadregistered the highest drying ratio and the shortest time for dehydration process.Key words: apricots, storage, dehydration, quality preservation.INTRODUCTIONThe apricots are very appreciated on local andinternational markets. Growing conditions arealso very good in our country, every yard fromthe south part of the country having some treeswith savory sweet fruits. In Romania are manylocal valuable varieties, but foreign varietiesare also grown with good results in specificconditions from different areas.Differing from other countries that considerapricots exports (fresh, dehydrated orprocessed) a good income resource, our apricotproduction is in present time only an internaland seasonal resource. Romanian fresh apricotscan be found on the market only 1-2 monthsduring main harvesting period, the importedlots covering the market demand in the rest ofthe year. And the presentation on the market ispoor in comparison with the imported fruits.This old deficiency is still present despite ECRegulation 851/2000 and Romanian StandardSR 3178/2003 containing precised rulesregarding the packaging and presentation forselling.In order to assure the preservation of thequality and to prolong the trading time ofhorticultural products, actual postharvest121technologies are based on cold chain used fromthe producer to the consumer.The storage optimum temperaturerecommended by Cantwell M., 2002 andHardenburg and colab. 1986 is -0,5...0ºC and90-95% relative humidity. The authors do notrecommend controlled atmosphere for freshapricots. Jamba A. and Carabulea B.,2002 areconsidering that the proper temperature for coldstorage of apricots is 0…+0,5ºC and 7...+10ºCfor refrigeration purpose. They admit CA with3% O2 si 5% CO2 for extension of cold storagelife of apricots.In order to find out the behavior of the apricotsfrom internal production in different storageconditions (ambiental temperature, refrigeratedand cold storage), specific comparativeresearches have been done in ICDIMPH-Horting institute using three varieties from theactual range of cultivars.The dehydration of fruit and vegetables hasmany advantages, among which can be:- all over the year consuming, especiallyduring the fruits and vegetable absence,ensuring the human body needs withvitamins, minerals and other components

which sustain the immune system and itsbalance;- using, whatever the time of the year, of thefood recipes based on vegetables and fruits,by the rehydration of industrial driedproducts, both in restaurants and inpizzerias, bakeries and candied fruits;- the dried fruits and vegetables with a richcontent in vitamins and minerals, besidestheir important role in the diet, helps toprevent cardiovascular and digestive tractdiseases;- the dried foods have high nutrient contentin low volume and weight, about 5-7 timesless compared to the fresh ones, presenting asignificant advantage in storage andtransport.MATERIALS AND METHODSThe organization of experimental variants havebeen done on the basis of variety and storageconditions and that is presented in table 1.Table 1. Organization of apricot experimentsVariant VarietyStorage conditionsEnvironmental (20-V1 Royal22°)V2 - idem - Refrigeration (10-12°)V3 - idem - Cold storage (3-5°)Environmental (20-V4 Mari de Cenad22°)V5 - idem - Refrigeration (10-12°)V6 - idem - Cold storage (3-5°)Cea mai buna de Environmental (20-V7Ungaria22°)V8 - idem - Refrigeration (10-12°)V9 - idem - Cold storage (3-5°)Preparation of apricot experiments is illustratedin the figure 1.Figure 1. Apricot experiments during preparationApricots belonging to three varieties (Royal,Mari de Cenad and Cea mai buna de Ungaria)were stored in different thermal conditions(environmental temperature, refrigeration andcold conditions). The evolution of losses (byweight and decay), structural firmness andsome chemical fruit compounds during storagehave been determined.The experiments was developed in 2012, onthe dehydration plant existing in the pilotstation of ICDIMP-Horting Bucharest.The dehydration plant used (fig. 2) is consistof vegetables and fruit dryer (70-300 kg / batchcapacity), using hot air as drying agent. Theinstallation program allows measurement andautomatic/manual programming (Figure 3)of working parameters: temperature, humidity,air speed, driving valve and it is provided withan interface for connection to PC for dataacquisition.Drying temperature was 65-70 0 C, held in thisarea for 12 hours. During the dehydrationprocess was followed the evaluation of thecombined effects of various drying parameters,such as drying temperature, speed and directionof the stream of air movement.122

Figure 2. DryerFigure 3. ProgrammerRESULTS AND DISCUSSIONSThe level of weight and decay losses duringstorage of apricots are presented in the table 2and the fruit firmness evolution in the table 3.The results followed from the data presented inthe table 2 show that in ambiental conditionsthe apricot can be kept maximum 5 days with32,22% total average losses. The fruits fromRoyal variety presented 26,27% total losses,less than others. The highest level of losses wasregistered at Mari de Cenad with 41,53% totallosses. Many of these fruits had wrinkled,spotted and bruised appearance.In refrigerated conditions the apricots havebeen stores 15 days with 16,54-20,59% weightlosses (according to variety) and 4,44-37,77%decay losses (according to variety). The totallosses ranged from 23,41 to 58,36 (according tovariety) with an average of 38,69%. The mostresistant in refrigerated storage was Cea maibuna de Ungaria variety with minimum decayand medium weight losses.In cold storage conditions the apricots havebeen stores 20 days with 10,64-17,67% weightlosses (according to variety) and without anydecay losses. For all that, the varietiespresented some differences. The Royal varietyfruits presented some discolorations (darkerzones of the skin) and maturation process. AndCea mai buna de Ungaria variety presented alsoa visible maturation process and slight wrinkledskin of some fruits. But for Mari de Cenadapricots the cold storage had a good effect onthe maintaining the quality. It reduced thepostmaturation process and was favourable inkeeping the fruit appearance and health.Table 2. Losses during storage of apricots (%) VarietyEnvironmental Refrigerationlosses (%) losses (%)Cold storagelosses (%)weight decay total weight decay total weight decay totalRoyal 18,12 8,15 26,27 16,54 17,78 34,32 10,64 0 10,64Mari de Cenad 20,03 21,50 41,53 20,59 37,77 58,36 17,67 0 17,67C.m.b.de Ungaria 18,62 10,25 28,87 18,97 4,44 23,41 11,51 0 11,51Average 18,92 13,30 32,22 18,70 19,99 38,69 13,27 0 13,27Storage period 5 days 15 days 20 daysVar.no.VarietyTable 3. Evolution of apricot firmness during storageStoragetemperature(°C)Storageperiod(days)Pulp firmness(PU) *Difference(%)Royal initial - 119,30 -V1 -idem- 20-22° 5 148,90 +24,8V2 -idem- 10-12° 15 145,95 +22,3V3 -idem- 3-5° 20 149,35 +25,2 Mari de Cenad initial - 96,75 -123

V4 -idem- 20-22° 5 169,15 +74,8V5 -idem- 10-12° 15 162,65 +68,1V6 -idem- 3-5° 20 98,05 +1,3 C.m.b. de Ungaria initial - 103,13 -V7 -idem- 20-22° 5 150,55 +46,0V8 -idem- 10-12° 15 125,25 +21,4V9 -idem- 3-5° 20 143,85 +39,5 *penetrometric unit (PU) = 0,1mmThe data from table 3 show that initiallyfirmness of the apricots is 96,75-119,30 PU(according to the variety), the maturity degreeof different varieties being closed enough. Inall experimental variants stored fruits presenteda decreasing of fruit pulp firmness with 1,3-74,8% from the initial value.In environmental conditions Royal apricots hada constant evolution of fruit firmness thatdecreased with 22,3-25,2% from the initialvalue (according to the storage conditions andstorage period). In such conditions the Royalapricots kept better its quality in comparisonwith the competitors Mari de Cenad and Ceamai buna de Ungaria that registered adecreasing of 74,8% respectively 46% of theinitial firmness.The Mari de Cenad apricots presented extremefirmness values according to the storageconditions having a great liability face to thetemperature level. This variety was placed onthe latest places concerning storage resistanceto environmental and refrigerated conditionswith 68,1-74,8% firmness decreasing, butoccupied first place with only 1,3% decreasingin cool conditions.Cea mai buna de Ungaria variety had adifferent firmness evolution, being adapted torefrigeration. This variety registered duringrefrigerated storage the lowest pulp firmnessdecreasing (21,4%). However at lowertemperature, specific to the cold storage, thefruits of this variety are wasting 39,5% fromthe initial firmness, the apricot quality beingthus affected in a way.The initial content and evolution of somechemical compounds during storage arepresented in the table 4. The data show that theinitial content of fruits is as follows: 16,4-17,4% soluble solids, 0,91-1,01% acidity and9,27-10,37% total sugars (according to thevariety).Table 4. Initial level and evolution of some chemicalcompounds of apricots during storageStorage Soluble TotalVar.no. Variety Aciditytemperature solids sugars(%)(°C) (%)(%) Royal initial 17,4 0,91 10,37V1 - idem - 20 - 22° 17,3 1,00 11,02V2 - idem - 10 - 12° 17,4 1,20 11,84V3 - idem - 3 - 5° 16,8 1,23 10,07Mari deCenadinitial 17,2 0,87 9,88V4 - idem - 20 - 22° 17,6 1,21 10,33V5 - idem - 10 - 12° 16,2 1,40 9,43V6 - idem - 3 - 5° 17,3 1,72 10,98 C.M.B.U. initial 16,4 1,01 9,27V7 - idem - 20 - 22° 16,6 1,15 9,89V8 - idem - 10 - 12° 16,7 1,25 10,19V9 - idem - 3 - 5° 14,3 1,52 7,44The Royal fruis presented the highest solublesolids and sugar content and Cea mai buna deUngaria the highest acidity.The evolution of these compounds differs froma variant to another. Soluble solids contentpresented after storage figures very closetoinitial ones. Some lower values have beendetermined for Mari de Cenad stored inrefrigeration conditions and Royal and Cea maibuna de Ungaria stored in cold rooms.The postharvest fruit acidity presentedgenerally a increasing tendency for all varietiesand in all storage conditions. The growth isreduced in case of ambiental storage condition,moderate in refrigerated conditions and higherin cold storage conditionsTotal sugar content has an increasing tendencyfor all apricots stored in environmentalconditions and for Royal and Cea mai buna deUngaria varieties kept in refrigerated rooms. Incold conditions the same Royal and Cea maibuna de Ungaria varieties presented however adecreasing of sugar content in the fruits,opposing to Mari de Cenad that registeredhigher sugar content and a good storage result.124

Appearance of the apricots after 5 storage daysin environmental conditions is presented in thefigure 4, after 15 days in refrigerated conditionsin the figure 5 and after 20 days in coldconditions in the figure 6.Figure 4. Appearance of apricots after 5 storage days inenvironmental conditionsminutes after starting the process can be seen astabilization of the humidity values between12-16% with a tendency to form a tray at thevalue of 14%, which indicates a uniformity ofthe air humidity inside the place fordehydration.The temperature variation-analyzing the graph(Figure 8) can be seen that the start temperaturewas 30-33°C, ambient temperaturerespectively. The first hour of operation revealsa faster growth temperature values of 50-60°C.Over the next 120 minutes occurs a slowincrease of temperature, stabilizing its valuesaround 70-73°C, after 180 minutes from theprocess starting.Figure 5. Appearance of apricots after 15 storage days inrefrigerated roomsFigure 6. Appearance of apricots after 20 storage days incold roomsThe variation of air humidity inside the placefor dehydration-analyzing the graph (Figure 7),can be notice that at the beginning of theprocess the humidity was 76-80% in the fourmeasuring points of the place.Figure 7. The variation of humidity inside the place fordehydration in the first 3 hoursDuring the first 30 minutes occurs a suddendecrease of humidity to a value of 35 – 40%.Over the next two hours the humidity decreaseis achieved more slowly, reaching values of20-30%. In the period between 120 and 180Figure 8. The variation of temperature inside the placefor dehydration in the first 3 hoursCONCLUSIONSStorage temperature is the main factor thatdetermines the duration of apricot qualitypreservation. In this way the apricots have beenkept maximum 5 days in ambiental temperaturewith 32,2% total average losses, 15 days inrefrigerated rooms with 38,7% total averagelosses and 20 days in cold storage with 13,3%total average losses. Optimum duration ishowever 3 days in ambiental temperature, 10days in refrigeration and 15 days in coldconditions.Apricot varieties had different behaviour insimilar storage conditions. If Royal apricotshad better results in ambiental temperature, Ceamai buna de Ungaria gave better results inrefrigerated storage and Mari de Cenad keptbetter quality than others in cold conditions.Firmness is a good indicator of fruit quality andits evolution during storage allowed a goodevaluation of quality preservation in differentstorage conditions. Fruit firmness decreasedwith about 25% in all storage conditions. The125

variety Mari de Cenad presented the largestvariation of fruit firmness that decreased with74,8% in ambiental conditions and only with1,2% in cold conditions.The evolution of some chemical compounds(soluble solids, acidity and total sugar) can bean important indicator of the capacity of qualitymaintain in variable storage condition and ofthe maturity stage of apricots. The chemicalevolution differs from a variety to another.Mari de Cenad presented an increase of solublesolids and sugar content of the fruits in coldstore conditions and a decreasing tendency inrefrigerated rooms in opposition with othervarieties. At the same time fruit acidity of thisvariety stored in cold conditions increased with100% compared with only 35-54% registeredby other varieties in similar conditions.Stating experiences results in dehydration allowthe following conclusions:- After 180 minutes inside the place fordehydration the temperature and humiditywere stabilized, in whole its volume;- For the same keeping period of 12 hoursunder the same conditions of temperature,humidity and air drying speed, wereobtained different values of the finalhumidity of the fruits, which indicates thatthe texture, thickness and epidermisinfluenced the dehydration process.In 80% proportion the dehydrated productsexisting in the Romanian market come fromimports. Due to current conditions and theabsence of the performing technologies isrequired the modernization and optimization ofthe specific dehydration technologies, whichcan ensure the obtaining of competitive localproducts (apricots, apples, plums etc.),competitive for both internal market and forexport.REFERENCESCantwell Marita, 2002. Postharvest Technology ofHorticultural Crops, Univ. of California, Div.of Agr.and Nat. Res. Editia III-a, p. 517.Chua, K. J., & Chou, S. K., 2003. Low-cost dryingmethods for developing countries. Trends in foodscience and technology; 2003 Dec; 14 (12) : 519 528,14 (12), p. 519-528.Hardenburg. R.E., Watada A.E., Wang C.Y., 1990. Thecommercial storage of fruits, vegetables and floristand nursery stocks, USDA. Agric Handbook no.66,p. 35.Jamba A., Carabulea B., 2002. Tehnologia pastrarii siindustrializarii produselor horticole. Ed.CarteaMoldovei, Chisinau, p. 305-307.Mohsenin, N.N., 1986. Physical Properties of Plant andAnimal Materials. Gordon and Breach SciencePublishers, New York. Vol. 1.Munde, A.V. 1982. Effect of time and temperatureduring multistage dehydration on onion quality. M.E.unpublished thesis, College of Tech. and Agric.Engng., Sukhadia University, Udaipur.Wilhelm, Luther R, Dwayne A. Suter, and Gerald H.Brusewitz. 2004. Dryng and Dehydration. Chapter 10in Food & Process Engineering Technology, St.Joseph, Michigan, p. 259-284.126

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653KINEMATICS AND OPERATION PROCESS OF THE COMPLEXAGGREGATE USED TO PREPARE THE GERMINATIVE BED INVEGETABLE FARMINGConstantin VLAD 1 , Gheorghe BRTUCU 21 Research and Development Station for Vegetables Growing, 23 Mesteacanului Street, 120024,Buzau, Romania2 Transilvania University, 29 Eroilor Avenue, 500036, Brasov, RomaniaAbstractCorresponding author email: vlad.constantin44@yahoo.comPreparing the germination bed represents an essential work for growing and developing plants in vegetable farming.The machinery used can have a positive or negative influence on improving or degrading the soil’s physio-mechaniccharacteristics and on the quality of the work, therefore choosing them requires a lot of attention. These aspects are aresults of studying the kinematics and work process of the complex aggregate that is used during this stage.Key words: soil, germinative bed preparation, complex aggregate, kinematics, work process.INTRODUCTIONModeling the soil consists of a set of activitiesperformed with the purpose of improve thesoil’s physical, chemical and biological properties.During these activities the soil is overturned,aerated, mixed, crumbled, leveled, pressed andmodeled. Soil activities can be basic activitiesand germinative bed preparation activities.During the germinative bed preparation, thesoil is aerated up to the seeding or plantingdepth, in order for the soil to provide therequired pedoclimatic conditions for the plantsto develop, during the seeding and sproutingstages.The complex aggregates are machines that areused for preparing the germinative bed.The working organs that are shaped like bladeswith variable size are mounted on parallel barscalled blade-bearing bars. These bars are givenan oscillating motion from the tractor’s poweroutlet. They move on a plane perpendicular tothe machinery’s movement direction. Themechanism powering the bars transforms therotation movement into translational-oscillatormovement.MATERIALS AND METHODSThis piece of work will determine and study thetrajectory of the F(x F ,y F ,z F ) point, the top of the127lateral blade on the studied complex aggregate’sblade-bearing bar.The mechanism powering the blade-bearing baris presented in figure 1.a. This case presents acrank-rod mechanism featuring a crankshaft.The running element is the AB crank, while theled element is represented by the BC bar. Theblade-bearing bar executes the translationaloscillatormovement (Caproiu St., 1982,Naghiu L., 2003, Pásztor J and Bratucu Gh.,2008, Sztachó-Pekáry I. et al., 2007). Thechosen frame of reference, xGz, is a mobilesystem which moves at a constant speedreported to a stationary system, according tofigure 1.b.Figure 1. 1. a - Kinematics of a point from the complexaggregate blade-bearing bar, the running mechanism; b -mobile and stationary referenceThe F(x F ,y F ,z F ) point’s coordinates aredetermined using the coordinates of points A,

B, C, D and E (Pásztor J and Bratucu Gh.,2008).A(x A , y A , z A ) point’s coordinates:Where a 1 , b 1 , c 1 are the computable coefficientsfrom the actual construction data:B(x B , y B , z B ) point’s coordinates:where: r is the length of the AB element, in m; – the rotation angle of the AB element, in rad(fig,1.a.)The angle is the variable parameter:where: is the power outlet’s angular speed, inrad/s; n – the power outlet’s speed, in rot/s.Point C(x C , y C , z C ) is located at the intersectionof two circles, one with the origin in point B,having the BC radius, and the other with theorigin in point D, with the radius DC. Byresolving the system formed by the circles’equation, the C point’s coordinates reported tothe mobile reference are obtained.where: H is the height difference between theblade-bearing bar and the power outlet, in m; l– length of the BC element, in m, according tofigure 1.a. From the solutions obtained usingthe system (6) the versions corresponding togeometric restrictions are chosen.The tg expression is determined using theC(x C , y C , z C ) point’s coordinates, which isnecessary for describing the trajectory of pointsE(x E , y E , z E ) i F(x F , y F , z F ):D(x D , y D , z D ) point’s coordinates are consideredto be known are the following:Using the relations (5), the equation system (4)is modified as follows:where: b is the length of the DE element, in m;a - the blade’s length, in m, figure 1.a.RESULTS AND DISCUSSIONSThe xGz reference is considered mobile andhas a translational movement at a constantspeed, v m, reported to the xOz reference (fig, 1.b).The parametric equations reported to the xOyreference are obtained by resolving thefollowing operations:128

where: P F represent the coordinates of point F;T – transformation matrix (Naghiu, L., 2003).The transformed equations will be:These trajectories are shown in figure 2, basedon the parametric equations of point F(x F , y F ,z F ) (Vlad C. and all., 2012).Figure 2. Blades’ tips oscillation on a horizontal planeWhere S is the distance covered by the complexaggregate following the movement's direction.The distance covered by the complex aggregateis time dependent and is calculated using therelation:Parametric equations of the absolute movementof point F(x F , y F , z F ) are obtained by makingthe corresponding replacements:By analyzing the aggregate’s operation, theblade-bearing bar’s oscillation on a planeperpendicular to the movement direct can beobserved. This can be verified by using theparametric equations of point F(x F , y F , z F ). Thefact that the blade-bearing bars follow anoscillatory movement on plane xOz can beobserved in figure 3.Parametric equations xF=f(r, n, H, l, c, L, b, n ) and zF =f( r, n, H, l, c, L, b, n ) can also beused to represent the trajectories on the xOzvertical plane, according to figure 3.The trajectory of the blade’s top (Vlad C. andall., 2012) is determined by using the F(x F , y F ,z F ) point’s parametric equations. By drawingthe trajectory followed by the complexaggregate’s working organ several aspects canbe determined: studying soil modelling atdifferent speeds of the complex aggregate, thetheoretical study of the aggregate’s behaviorand also the theoretical study of the blades’working process.The equations for joined blades and bladesmounted on the other bars can be determinedby using the parametric equations of theabsolute movement (12). During calculations,the following will be taken into consideration:step between the blades, p;phase shift betweentime crankpin, n ;the distance between theblade-bearing bars, d.Figure 3. The blade bar’s oscillatory movement.During operation, the blades follow the bar’smovement, receiving the alternationtranslational movement perpendicular to theforward movement in the xOz plane, accordingto figure 4.129

CONCLUSIONSFigure 4. The operation process executed by the blade invertical planeBy analyzing the blades’ operation mode, it isobserved that there are unprocessed sections inthe soil caused by the vertical oscillation. Asecond and a third blade bar are required to bemounted on the complex aggregate in order toeliminate this inconvenience.The parametric equations are useful forstudying the joint operation process of theblades on a vertical plane, perpendicular to theforward movement, like pictured in figure 5.Figure 5. The blades’ operation process on verticalBy analyzing the the trajectory of the complexaggregate’s blades’ tips, it is observed that thesoil is being processed energetic and uniformup to the set working depth if three operatingorgans mounted on paralel blade bars andworking in phase shift are being used.Parametric equations xF=f(r, n, H, l, c, L, b, n ) and zF =f( r, n, H, l, c, L, b, n ) describesinusoid trajectories of the complex aggregate’sblades on vertical and horizontal plane.By analyzing the work process of the operatingorgans on the complex aggregate, it can beobserved that the agricultural machineryprovides the soil crumbling and a good mixtureof soil layers up to the set working depth, iffitted with two or three blade bars.Parametric equations xF=f(r, n, H, l, c, L, b, n ) and zF =f( r, n, H, l, c, L, b, n ) offer thepossibility to study the complex aggregate’soptimization.The parametric equations representmathematical models for studying the complexaggregate’s dynamics and energetics.REFERENCESBrtucu Gh., Fodor A.N., 2002. Actual ConditionsDemands from Romanian Agriculture overReliability-Maintenance Ration of AgriculturalMachines, in Magazine Mecanizarea Agriculturii,nr.3/2002, p. 33-39.Cproiu St., s.a., 1982. Agricultural Machines for SoilWork, Seeding and Cultures Maintenance, Didacticand Pedagogic Publishing, Bucharest.Cojocaru I., Marin E., 2005. Researches Regarding theManufacturing of some Technical EquipmentsDestined for Greenhouses Agricultural Works, inMagazine INMATEH II, Bucharest, p. 21-31.Naghiu, L., 2003. Researches Regarding Soil WorkingProcess with Rotary Working Organs, PhD Thesis,Cluj-Napoca Technical University.Pásztor J., Brtucu Gh., 2008. Researches About theKinetics and the Dynamics of the Machines forPreparing the Seedbeds in Greenhouses, InternationalConference on New Research in Food and Tourism,Bioatlas, Brasov, Romania.Sztachó-Pekáry I., s.a., 2007. Engeneering Elements,Mezgazda Publishing, Budapest.Vlad, C., Pásztor, J., Brtucu, Gh., Forgó, Z., 2012.Mathematical Modeling of the Vegetable SoilPreparation Process Using a Complex Equipment,The 4th International Conference AdvancedComposite Materials Engineering COMAT 2012,vol.III/2012, Brasov, Romania, p. 834-837.130

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653AbstractRESULTS CONCERNING THE EFFECT OF FOLIAR FERTILIZERSAND GROWTH PROMOTERS TREATMENTS ON PRODUCTIONAND QUALITY OF TOMATO FRUITSJeni Gianina VOICU (SIMION)University of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Marasti Avenue, postcode 011464, Bucharest, RomaniaCorresponding author email: gianina.simion@yahoo.comThe work presents results obtained in protected culture of tomatoes under different treatments with foliar fertilizers(Folimax, Agriphyte) and ecological growth promoter P& R. It wastaken in experience hybrid Balkan F1 and varietyGhittia. The foliar fertilizers and growth promoters treatments has good influence on production and quality of tomatofruits. If the best at production was the hybrid Balkan F 1 , the variety Ghittia was the best at quality. The biggestproduction was obtained by the hybrid Balkan F1 treated with Agriphyte (69.626 t/ha) and the smallest one it was thevariety Ghittia untreated – control (48.865 t/ha). The biggest content of vitamin C was registered at Ghittia variety inthe case of P& R treatment (21.52 mg/100g and the biggest content of lycopene was registered at hybrid Balkan F 1 forAgriphyte treatment (69.39 ppm). The content of soluble carbohydrates was almost constant and has slightly varied ataround 4.8%.Key words: Agriphyte, Folimax, P&R, quality, production.INTRODUCTIONBecause of the big request for consumption,tomatoes are the most cultivated vegetablespecies on protected crops from Romania.The benefits of this culture system are:possibility to obtain of sorts of vegetablesaccording to the request of the market;earliness; good prices; possibility to obtaintomatoes almost all year; big productions/ha(Voican and Lacatus, 2002).For obtaining good productions with maximumeconomic efficiency it needs to practice sometechnologies in which stimulating of growthand development of plants, fertilization andpest control are the most important works.In the production technologies can be useddifferent fertilizers, growth promoters andfoliar fertilizers.Researches on use of fertilizers in protectedcrops shows that use of foliar fertilizers hasvery good effects in vegetable crops in allgrowth and development phases (Davidescuand Davidescu, 2000; Lacatus, et al., 2005).Foliar fertilization is very used in vegetableprotected crops and it has some advantageslike: use of reduced concentration of mineralelements, easier application simultaneously131with pesticides and rapid correction ofnutritional deficiency (Voican and Lacatus,2002).Between foliar fertilizers, the literaturementions foliar fertilizers type F (231; 141;411), the product Cropmax (Ciofu, et al.,2004), liquid foliar fertilizer Folimax (Lacatus,2006).The growth promoters are used for theregulation of the processes of growth anddevelopment of plants especially when themicroclimate conditions are not favorable.Many authors recommended that the treatmentsmust be applied when the flowers arecompletely opened with a solution ofTomatoset, Tomafix, Duraset, or Tomato-stim.The paper presents partial results regarding theinfluence of the treatments with growthpromoters and foliar fertilizers on growth,development and production of tomatoes forprotected crops.MATERIALS AND METHODSThe main objective of the research has beendetermining the optimal variant of stimulationand foliar fertilization of tomatoes in protectedcrops in order to obtain early production of

good quality fruits. Experience has been carriedout in 2012 in Poiana, Ialomita county in hightunnel of 1000 m 2 .The experiment has been carried out in randomblocks in three repetitions and experimentalvariants consist of three products: two foliarfertilizers and one growth promoter, whichwere compared with the control (Table 1).Table 1. Experimental variants – variety Ghittia /hybridBalkan-2012Variants/treatments SpecificationV1 Control(untreated) -V2Folimax-0.3%V3Agriphyte-0.3%V4 P& R-0.5%Foliar fertilizer with microelements; ensuresteady growth, disease resistance, increasethe number of fruits and production.Foliar fertilizer with 33% phosphorus, and28% potassium; secondary has systemicfungicide properties.Organic product with role of protection andrecovery of the plants from damage causedby extreme temperatures or diseases; help toa better use of the nutrients in different typesof soils; increase the assimilation of somenutrients (Fe, Zn, Mn, B, Cu); may be usedtogether with protective agents for plants(herbicides, insecticides, fungicides).Biological material has been represented byvariety Ghittia and hybrid Balkan F 1 .Ghittia: late tomatoes indefinite, the plants arevigorous, fruits are round flattened with 4-6seeds lodge, uniform, of 250-300g weight and4-5 fruit in a cluster, fruits are resistant tocracking, with good firmness. Recommendedfor cultivation in plastic tunnels and field.Balkan: early tomatoes, semi-determinedgrowth. The fruits are rounded, uniform, of100-120g weight, 6 fruit in a cluster.Recommended for cultivation in plastic tunnelsand field.The technology used in the experiences wasselected from the literature for tomatoes (Ciofuet al., 2004).Under climatic conditions of the year 2012, theculture has been established by planting ofseedling on 25 of the April. The seedling wasby 53 days old, 20-22 cm height, 4-5 mmthickness of stem, 5-6 leaves and it has firstinflorescence. The density used was 36.000plants/ha. Care work consisted in watering,hoeing, weeding, removing of early shootswhenever is necessary, sustaining plants on132strings, wire tapping for stimulation ofpollination, pest and diseases control. It hasbeen applied fertilization with differentfertilizers (Folimax, Agriphyte) and growthpromoter (P& R), depending on experimentalvariants, at two weeks and one month fromplanting.Harvesting was done from the second decade ofthe July, by variants.During the experimentation period has beencarried out observations, measurements anddeterminations, which were used specificworking methods namely:Phenological determinations: sowing date, dateof emerging, date of planting, date of floweringand date of harvest.Production potential was determined byrecording the number of fruits/plant, averagemass of fruits and by calculation of the averageproduction/plant and ha, for each variantstudied. The fruits were harvested by qualityclasses according to the average weight offruits as follows:-extra-greater than 80 g;-I-60-80 g;-II-40-60 g;-understas-less than 40 g.The results were interpreted statistically byanalysis of variance-Student test (Ardelean, etal., 2007).Laboratory analysis at tomato fruits:-biochemical analysis: vitamin C content(mg/100 fresh product), soluble carbohydrates(%), acidity (%), lycopene (ppm). Wereharvested fruit samples for biochemicalanalysis of three different harvests and resultsare average of these samples.RESULTS AND DISCUSSIONSFrom the analysis of the results it can beobserved that, regardless of treatment, theproductions were superior to the untreatedcontrol (Table 2, Figure 1 and 2). Regardless ofthe variety the greatest production was obtainedwhen applying foliar fertilization withAgriphyte (66.957 t/ha for Ghittia variety,respectively Balkan F 1 hybrid 69.626 t/ha). Thelargest share of total production was at qualityI. It can also notice a higher share of qualityextra in the case of Ghittia variety forAgriphyte treatment (40%).

Table 2. The production obtained at tomato experiment and the distribution on qualities Poiana, Ialomita county, 2012HYBRID / VARIETYGHITTIABALKAN F 1VARIANTQUALITYTOTALEXTRA I II TOTAL STAS UNDERSTASt/hat/ha % t/ha % t/ha % t/ha % t/ha %Control 18.000 37 19.965 41 9.000 18 46.965 96 1.900 4 48.865Folimax 23.900 37 27.900 43 9.850 15 61.650 96 2.560 4 64.210Agriphyte 26.900 40 27.400 41 10.500 16 64.800 97 2.157 3 66.957P& R 22.350 38 23.920 41 10.100 17 56.370 95 2.650 5 59.020Control 18.570 34 18.471 34 16.005 29 53.046 96 1.955 4 55.001Folimax 21.924 33 25.932 39 15.920 24 63.776 96 2.600 4 66.376Agriphyte 23.410 34 26.920 39 17.015 24 67.345 97 2.281 3 69.626P& R 20.499 32 22.943 36 17.284 27 60.726 96 2.775 4 63.501growth promoter P&R exceed untreated controlwith very significant differences.Figure 1. The production obtained at Ghittia variety andthe distribution of it on qualitiesFigure 2. The production obtained at hybrid Balkan F1and the distribution of it on qualitiesTaking into account the influence of variety/hybrid on the production of tomato (Table 3) itcan be seen that the hybrid Balkan F 1 has madea significantly distinct difference production(3.863 t/ ha) than Ghittia variety.The influence of treatment on tomatoesproduction can be observed in table 4. Asshown in this table all variants treated withfoliar fertilizers (Folimax, Agriphyte) and /orRegarding the influence of foliar fertilizertreatments and growth promoter on eachvariety (Table 5) it can be noted that the yielddifferences obtained from untreated control arevery significant.Table 5. The influence of treatments on each varietyproductionVariant(treatment)Averageproduction(t/ha)% Differences(t/ha)Table 3. The influence of variety on tomatoes productionAverageVariantproduction, % Differences Significance(variety/hybrid)(t/ha)(t/ha)A1 Ghittia 59.763 100 - A2 Balkan F 1 63.626 1063.863 ** DL 5% 1.5423 DL 1% 3.57957 DL 0.1% 11.33411 Table 4. The influence of treatment of tomatoesproductionTreatment AverageDifferencesSigni-ficance%production (t/ha) (t/ha)b1Control 51.933 100 - b2 Folimax 65.293 12613.360 ***b3Agriphyte68.292 13116.359 ***b4 P& R 61.261 1189.328 *** DL 5% 1.884312 DL 1% 2.644951 DL 0.1% 3.734048 Significancea1b1(Control)48.865 100 - a1b2 64.210 13115.345 ***a1b3 66.957 13718.092 ***a1b4 59.020 12110.155 ***a2b155.001 100 - (Control)a2b2 66.376 12111.375 ***a2b3 69.626 12714.625 ***a2b4 63.501 1158.500 *** DL 5% 2.6648189 DL 1% 3.7405256 DL 0.1% 5.280742 133

If it is taking into account both factors (varietyand treatment) it can be noted that the varianttreated with Agriphytehad the most consistentbehaviorregardless of the variety under study,being superior to other types of treatment(Table 6, Figure 3 and 4).The largest increasesof production was realized by Balkan F 1hybrid treated with Agriphyte (69.626 t/ha).Figure 3. Fruits of hybrid Balkan F1Figure 4. Fruits of variety GhittiaVariant(treatment)Averageproduction(t/ha)Table 6. The influence of variety and treatment on tomatoes production%Differences(t/ha)Variant(treatment)Averageproduction(t/ha)%Differences(t/ha)a1b3a1b1 (Control) 48.865 100 -(Control)66.957 100 -a2b1 55.001 113 6.136 ** a2b1 55.001 82 -11.956 000a2b2 66.376 136 17.511 *** a2b2 66.376 99 -0.581a2b3 69.626 142 20.761 *** a2b3 69.626 104 2.669 *a2b4 63.501 130 14.636 *** a2b4 63.501 95 -3.456 0a1b4a1b2 (Control) 64.210 100 -(Control)59.020 100 -a2b1 55.001 86 -9.209 000 a2b1 55.001 93 -4.019 0a2b2 66.376 103 2.166 a2b2 66.376 112 7.356 **a2b3 69.626 108 5.416 ** a2b3 69.626 118 10.606 ***a2b4 63.501 99 -0.709 a2b4 63.501 108 4.481 **DL 5% 2.6107467 DL 5% 2.6107467DL 1% 4.1067505 DL 1% 4.1067505DL 0.1% 7.7606017 DL 0.1% 7.7606017SignificanceSignificance134

As shown in figures 5 and 6 the vitamin C andlycopene content of tomato fruits are bigger fortreated variants than control regardless ofvariety.Figure 8. Soluble carbohydrates and acidity contenthybrid Balkan F1CONCLUSIONSFigure 5. Vitamin C and lycopene content in varietyGhittiaFigure 6. Vitamin C and lycopene content in hybridBalkan F1Regarding the carbohydrates content it can beobserved that it does not vary much bytreatment. The acidity of tomato fruits variesquite widely depending on the treatment andvariety (Figure 7 and 8).Growth promoter and foliar fertilizer treatmentshad a positive influence on the level ofproduction and quality of tomato fruits grownin high tunnel, Poiana county Ialomita 2012.Highest yield was obtained at Agriphytetreatment for both varieties Ghittia and BalkanF 1 (66.957 t/ha, respectively 69.626 t/ha).Regarding the distribution of fruits on thequality classes, Ghittia shows in variant treatedwith Agriphyte, the biggest share ofextra fruit quality class (40% of totalproduction).Production results were interpreted statistically.The differences between Balkan F 1 and Ghittiais distinctly significant and between control andtreated variants were very significant.Vitamin C and lycopene contents variedpositively according to the treatment.The highest content of vitamin C was recordedin variety Ghittia treated with growth promoterP& R (21.52%) and the highest lycopenecontent was at Balkan F 1 hybrid treated withAgriphyte (69.39 ppm).ACKNOWLEDGEMENTSFigure 7. Soluble carbohydrates and acidity content invariety GhittiaThe paper presents data from the Ph. degreethesis in the frame POSDRU / 107/1.5/S/76888, project financed from theEuropean Social Fund through the SectoralOperational Programme for Human ResourcesDevelopment 2007-2013.135

REFERENCESArdelean M., Sestras R., Cordea Mirela, 2007.Horticultural experimental technique, Academic PresPublishing House, Cluj-Napoca, p. 30-33.Ciofu Ruxandra, Stan N., Popescu V., Chilom Pelaghia,Apahidean S., Horgos A., Berar V., Lauer K.F.,Atanasiu N., 2004. Treaty of vegetable crops, CeresPublishing House, Bucharest, p. 308-319, 431-442,603-646.Davidescu D., Davidescu Velicica, 2000. Horticulturalagrochemistry, Ceres Publishing House, Bucharest.Lacatus V. et al., 2005. Vegetable crops in greenhousesand plastic tunnels, Ceres Publishing House,Bucharest.Lacatus V., 2006. Fertilization of tomato plantscultivated in protected system, Session of ScientificPaper, Vidra.Voican V., Lacatus, V., 2002. Protected culture ofvegetables in greenhouses and plastic tunnels, CeresPublishing House, Bucharest.136

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653RESULTS CONCERNING THE EFFECT OF FOLIAR FERTILIZERSAND GROWTH PROMOTERS TREATMENTS ON PRODUCTIONAND QUALITY OF LETTUCE CULTIVATED IN PLASTIC TUNNELSJeni Gianina VOICU (SIMION)University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Marasti Avenue,postcode 011464, Bucharest, RomaniaAbstractCorresponding author email: gianina.simion@yahoo.comThe work presents results obtained in protected crops of lettuce under different treatments with growth promoter P& Rand foliar fertilizers Agriphyte and Folimax, which are cultivated in high tunnels in southern area of Romania. It weretaken in experience three varieties of lettuce: May King, Great Lakes 118 and Lollo Rossa. These treatments showspositive influence on the production and quality of lettuce. Reffer to production the best variant was in the case of thevariety May King which was treated with foliar fertilizer Agriphyte (175 g/ head, 28 t/ha). At the other two varieties thebest results was obtained at variants treated with foliar fertilizer Folimax. The laboratory analyses shows that thenitrate content of leaves was clearly under the maximum admissible level (2000-3000 ppm) and depends by variety andvariant. The content of vitamin C was positively influenced by the treatments, especially by the ecological growthpromoter P& R.Key words: Agriphyte, Folimax, P&R, quality, production.INTRODUCTIONas following: 100 g of lettuce contains 43 mgCa, 32 mg P, 0.3 mg Fe, 350 mg K, 15 mgThe lettuce is cultivated regularly at early invitamin E, 4.2 mg vitamin A, 0.07 mg vitaminspring and in autumn late like successiveBcultures. This system of culture assure the 1 , 0.08 mg vitamin B 2 , 0.5 mg vitamin PP. Itcontains also in this quantity of leaves 0.1%needs of vegetables in these periods of the year,sugar, 1.4% proteins, 0.5% cellulose. Lettuce iscreates the possibility to use more intensive thea good vegetable for remineralization, cleanserconstructions and assure more benefits tosedative, emollient. Its energetic value is of 16producers. Short vegetation period and reducedcalories. Lettuce juice has very good propertiesheight of plants recommended lettuce like abecause of the high content in magnesium andvery good associated culture (Ciofu et al.,iron. This species was cultivated long time ago.2004).Egiptians, Greeks and Romans cultivate lettuceThe advantages of this system of culture are theon large surfaces and appreciated this culturefollowing: possibility of obtaining of very earlylike a very valuable vegetable. In present,and early productions, possibility of obtaininglettuce is spread on all continents, on largegood harvest long time during the year, goodareas, especially in the countries from Westernquality of the products, obtaining of bigEurope, in USA and Japan. In the US, forproduction/ha, avoiding of apparition ofexample, this culture occupies over 100,000 haweather accidents.and the consumption/inhabitant reached 10Lettuce is cultivated for its heads, which arekg/year. In our country, lettuce is grown both inconsumed mostly fresh like salads.pure culture and in the system of associated andIn recent times because of orientation of thesuccessive culture, in all counties andpopulation to a nutrition regime more close toespecially around big cities and industrialnature, lettuce has begun one of the mostlycenters, occupying 14,000-15,000 ha annually.consumed vegetable (Ciofu et al., 2004, IndreaDifferent authors recommended forand Apahidean, 1997). It has nutritionalprolongation of preservation of lettuce a bigimportance because of the high content ofnumber of products. Relatively recent wasvitamins, mineral salts and nutritive substancesdiscovered many regulators of growth and137

fruiting with a large application in vegetablescrops. They are natural or synthetic hormonalsubstances which influence the processes ofgrowth and development of plants (Indrea etal., 2007). The authors shows that is possible toapply these products in combination with foliarfertilizers.These foliar fertilizers are used on large scalein vegetable protected crops because of someadvantages like: reduced concentration ofmineral elements and quickly correction ofnutrition deficiencies (Voican and Lacatus,2002).MATERIALS AND METHODSThe main objective of research was todetermine the optimal variant of stimulationand foliar fertilization of the lettuce inprotected crops for obtaining early and highquality production.The experience was held in 2012 in villagePoiana, Ialomita county, in high tunnels on asurface of 720 m 2 .The installation of trial was done in subdividedparcels, in three repetitions.The experimental variants consist of threeproducts used: two foliar fertilizers and onenatural stimulator, which are compared with auntreated control (Table 1).The technology used in the experiences wasselected from the literature for lettuce (Ciofu etal., 2004).Under climatic conditions of the year 2012, theculture has been established by planting ofseedling on 15 th of October. The seedling wasby 28 days old and 5-6 leaves.Figure 1. View with variety Great Lakes 118Table 1. Experimental variants – 2012Biological material Treatments SpecificationV1 Control-(untreated)V2 Folimax- Foliar fertilizer with microelements; ensure steady growth, disease resistance, increase0.3% the number of fruits and production. May V3Foliar fertilizer with 33% phosphorus and 28% potassium; secondary has systemicKing Great LakesAgriphytefungicideproperties.0.3%118 Lollo Rossa V4 P&R-0.5%Organic product with role of protection and recovery of the plants from damagecaused by extreme temperatures or diseases; help to a better use of the nutrients indifferent types of soils; increase the assimilation of some nutrients (Fe, Zn, Mn, B,Cu); may be used together with protective agents for plants (herbicides, insecticides,fungicides).Biological material has been represented bytwo varieties: May King, Great Lakes 118 andLollo Rossa, recommended for protected andopen field crops. (Table 2, Figure 1).The density used was 160,000 plants/ha.BiologicalmaterialMay KingGreat Lakes118 Lollo RossaCharacterizationTable 2. Description of the lettuce varieties from trialEarly variety, for protected and open field crops, for autumn and spring, with compact medium head,blade present corrugating; resistant to flowering.Mid – early variety, for protected and open field crops; with head by round to oval shape, with curledleaves, crisp and of iceberg type.Forms a distinct compact rosette of blood violet fan -shaped leaves with a non-hearting pale green base.The leaves have a crisp, semi-succulent, hardy texture138

At two weeks from planting it was appliedtreatments with growth promoter (P&R) andfoliar fertilizers (Folimax and Agriphyte) inaccordance with experimental variants.Harvesting was done from the first half ofDecember, by variants.During the experimentation period has beencarried out observations, measurements anddeterminations, which were used specificworking methods namely:Phenological determinations: sowing date, dateof emerging, date of planting and date ofharvest.Production potential was determined byregistering of the mass of each head/ rosetteharvested by variants.The results were interpreted statistically byanalysis of variance - Student test (Ardelean etal., 2007).Laboratory analysis at lettuce:--- agrochemical analysis: N-NO 3 and N-NO 23-content, P-PO 4 content, K + content.- biochemical analysis: vitamin C content(mg/100 fresh product), soluble carbohydrates(%), acidity (%), chlorophyll (mg/100 freshproduct). Were harvested lettuce samples forlaboratory analysis of three different harvestsand results are average of these samples.RESULTS AND DISCUSSIONSFrom the analysis results can be observed thatthe average weight of the head of the May Kinglettuce ranged from 158 g (untreated control) to175 g (Agriphyte). At variety Great Lakes 118the average weight of the head ranged between152 g (untreated control) to 168 g (Folimax).At Lollo Rossa the average weight of therosette varied between 140 g (untreatedcontrol) to 157 g (Folimax) (Table 3, Figure 2).Table 3. The influence of growth promoter and foliarfertilizers treatments on the production of lettuce-2012VarietyAverage weight of theVariant head/ rosette, kg/pl. t/haControl 0.158 25.28Folimax 0.170 27.20May KingAgriphyte 0.175 28.00P& R 0.163 26.08Control 0.152 24.32Folimax 0.168 26.88Great LakesAgriphyte 0.166 26.56P& R 0.160 25.60Control 0.140 22.40Folimax 0.157 25.12Lollo RossaAgriphyte 0.150 24.00P& R 0.146 23.36Concerning the production of lettuce May Kingit was between 25.280 t/ha (control) and 28.000t/ha (Agriphyte). It can be observed that theapplied treatments favored average weight ofthe heads and the production. At Great Lakes118 variety, on first place it was the varianttreated with foliar fertilizers Folimax (26.880 t/ha) compare to the control (24.320 t/ ha). AtLollo Rossa variety, on first place it was thevariant treated with foliar fertilizers FolimaxFigure 2. Production at lettuce experiences, 2012139(25.120 t/ ha) compare to the control (22.400 t/ha). If we take into account the influence ofvariety on the lettuce production (Table 4), itcan be observed that both varieties Great Lakes118 and May King have made a significantlydistinct difference of production (2.120 t/ ha,respectively 2.920 t/ha) compare to LolloRossa.

Table 4. The influence of the variety on the lettuceproductionVariety Averagepoduction (t/ha) % Differencest/haa1 LolloRossa23.720 100 -a2GreatLakes 11825.840 109 2.120 **a3 May King 26.640 112 2.920 **DL 5% 0.50609 DL 1% 1.17459 DL 0.1% 3.71916 The influence of the treatment on the lettuceproduction it can be seen in the table 5. As itshow in this table the variants treated withfoliar fertilizers (Folimax, Agriphyte) exceededthe control with significantly distinctdifference.differences for Folimax treatment, variety MayKing give best results at Agriphyte treatment(Table 6, Figure 3 and 4).Figure 3. View with variety May KingTable 5. The influence of the treatment on the lettuceproductionIf we take into account the influence of thetreatments on the production at the samevariety, it can be noticed different behavior ofthe three varities of lettuce.If varieties LolloRossa and Great Lakes 118 made the biggestFigure 4. View with variety Lollo rossaTable 6. The influence of the treatment on the lettuce production from the same varietySignificationAverageTreatment% Differences Significationproduction (t/ha) t/hab1Control 24.000 100 -b2 Folimax 26.400 110 2.400 **b3Agriphyte26.187 109 2.187 **b4 P& R 25.013 104 1.013Average productionDifferences SignificationTreatment%(t/ha)t/haa1b1 (Control) 22.400 100 -a1b2 25.120 112 2.720 **a1b3 24.000 107 1.600a1b4 23.360 104 0.960a2b1 (Control) 24.320 100 -a2b2 26.880 111 2.560 **a2b3 26.560 109 2.240 *a2b4 25.600 105 1.280a3b1 (Control) 25.280 100a3b2 27.200 108 1.920 *a3b3 28.000 111 2.720 **a3b4 26.080 103 0.800DL 5% 1,77129DL 1% 2,48631DL 0.1% 3,51008140

If we take into account the both factors, varietyand treatment, it can be seen that the variantstreated with Agriphyte behavedconsistently achieving highest differences toany control when is associated with varietyMay King (Table 7).Table 7. The influence of variety and treatments on the lettuce productionAverageDifferences SignificationAverageDifferences Signi-Variant%production (t/ha)t/ha%production (t/ha)t/ha ficationa1b1 22.400 100 - a1b3 24.000 100 -a2b1 24.320 109 1.920 * a2b1 24.320 101 0.320a2b2 26.880 120 4.480 *** a2b2 26.880 112 2.880 **a2b3 26.560 119 4.160 *** a2b3 26.560 111 2.560 **a2b4 25.600 114 3.200 ** a2b4 25.600 107 1.600 *a1b2 25.120 100 - a1b4 23.360 100 -a2b1 24.320 97 -0.800 a2b1 24.320 104 0.960a2b2 26.880 107 1.760 * a2b2 26.880 115 3.520 **a2b3 26.560 106 1.440 a2b3 26.560 114 3.200 **a2b4 25.600 102 0.480 a2b4 25.600 110 2.240 *a1b1 22.400 100 - a1b3 24.000 100 -a3b1 25.280 113 2.880 ** a3b1 25.280 105 1.280a3b2 27.200 121 4.800 *** a3b2 27.200 113 3.200 **a3b3 28.000 125 5.600 *** a3b3 28.000 117 4.000 ***a3b4 26.080 116 3.680 *** a3b4 26.080 109 2.080 *a1b2 25.120 100 - a1b4 23.360 100 -a3b1 25.280 101 0.160 a3b1 25.280 108 1.920 *a3b2 27.200 108 2.080 * a3b2 27.200 116 3.840 ***a3b3 28.000 111 2.880 ** a3b3 28.000 120 4.640 ***a3b4 26.080 104 0.960 a3b4 26.080 112 2.720 **DL 5% 1.58555 DL 5% 1.58555DL1% 2.30163 DL1% 2.30163DL0.1% 3.58707 DL 0.1% 3.58707If we take a look on the results of laboratoryanalysis we can see that none of the variantsis poluted with nitrates/nitrites (Table 8).The nitrates content is well below themaximum level (2000-3000 ppm). The highestnitrate level was recorded at Great Lakes 118 atvariant treated with Agriphyte (345.45 ppm).The highest content of phosphorus was found atvariant Great Lakes 118 treated with growthpromoter P& R (166.38 ppm). The highestcontent of potassium was found at variant MayKing treated with Folimax (4020 ppm).VarietyLollo RossaGreat Lakes 118May KingTable 8. Results of laboratory analysis at lettuceContentTreatment- Acidity Soluble Vitamin C, ChlorophyllN-NO 3 P-PO 4 3- K+% carbohydrates mg/100g mg/100gControl 185.10 132.65 3000.00 0.19 2.09 4.28 60.51Folimax 186.10 126.91 3046.67 0.21 2.11 4.28 63.88Agriphyte 279.14 139.47 3083.33 0.21 2.11 4.25 60.02P& R 301.31 138.11 3060.00 0.21 2.27 4.27 59.27Control 190.41 144.19 3800.00 0.10 2.23 2.63 73.56Folimax 194.17 132.66 3903.33 0.13 2.18 2.60 76.27Agriphyte 345.45 124.97 3700.00 0.15 2.25 2.60 71.57P& R 335.27 166.38 3628.67 0.15 2.25 2.65 72.75Control 152.09 136.63 3593.33 0.15 2.13 2.98 66.89Folimax 179.38 124.31 4020.00 0.18 2.14 3.19 69.20Agriphyte 188.52 120.43 3820.00 0.18 2.09 3.32 66.98P& R 214.17 114.96 3466.67 0.19 2.12 3.30 65.68141

The highest content of soluble carbohydrateswas found at variant Lollo Rossa treated withP& R (2.27%). The biggest content of vitaminC was recorded at variant Lollo Rossa treatedwith Folimax (4.28%). The highest content ofchlorophyll was found at variant Great Lakes118 treated with Folimax (73.56%).CONCLUSIONSThe highest average weight of the head/ rosetteand the highest production was achieved by thevariant May King treated with Agriphyte(175.0 g, 28.0 t/ha).Foliar fertilizers Folimax and Agriphyteachieved the highest average productions onthe experience of lettuce (26.400 t/harespectively 26.187 t/ha).The experimental results were verified statisticallyand differences from control was at leastsignificantly.None of these treatments had pollution effectwith nitrates/ nitrites on the final product.Foliar fertilizer Folimax favored the accumulationof chlorophyll in all varieties and theaccumulation of potassium in Great Lakes 118and May King varieties.ACKNOWLEDGEMENTSThe paper presents data from the Ph. degreethesis in the frame POSDRU/ 107 /1.5/ S/76888, project financed from the EuropeanSocial Fund through the Sectorial OperationalProgramme for Human Resources Development2007-2013.REFERENCESArdelean M., Sestras R., Cordea Mirela, 2007.Horticultural experimental technique, AcademicPresPublishing House, Cluj-Napoca, p. 30-33.Ciofu Ruxandra, Stan, N., Popescu, V., Chilom Pelaghia,Apahidean S., Horgos A., Berar V., Lauer K.F.,Atanasiu, N., 2004. Treaty of vegetable crops, CeresPublishing House, Bucharest, p. 308-319, 900-914.Indrea D.. Apahidean, Al.S., 1997. Culture of earlyvegetables, Ceres Publishing House, Bucharest;Indrea D. et al., 2007. Culture of vegetables, CeresPublishing House, Bucharest, p. 76-77.Voican V., Lacatus V., 2002, Protected culture ofvegetables in greenhouses and plastic tunnels, CeresPublishing House, Bucharest.142

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653AbstractA PRELIMINARY SURVEY OF THE OCCURRENCE OF APPLEPROLIFERATION IN THE NORTH OF ROMANIALuminia Antonela ZAGRAI, Ioan ZAGRAIFruit Research & Development Station Bistrita, 3 Drumul Dumitrei Nou Street, 420127,Bistrita, RomaniaCorresponding author email: lumizagrai@yahoo.comApple proliferation (AP), caused by the ‘Candidatus Phytoplama mali’ (’Ca. P. Mali’), is considered one of the mostimportant disease affecting apple. While different reports showed its largely spread in some European countries, verylimited information about the occurrence of AP in Romanian apple orchards are available. To start to secure thismissing data, a preliminary survey was perform in two apple orchards located in Bistrita area from Romania. Watchingtypical AP symptoms (witches’ brooms, foliar reddening, dwarf fruits), twenty samples from symptomatic trees,belonging to three cultivars (Generos, Florina and Aura), were collected in autumn 2012. Serological DAS-ELISAusing Bioreba monoclonal antibody, and nested-PCR using primer sets to detect AP group, were performed. ELISAresults indicated that 17 out of 20 samples collected were positive, while nested-PCR revealed that all 20 samples wereinfected. Because plenty of trees showed similar symptoms like those sampled, this preliminary survey suggests a highincidence of AP in the two orchards. An extended study on surrounding areas of Bistrita, and then on regional andnational level is necessary to provide relevant data about the AP occurrence in Romanian apple orchards and,subsequently, to recommend control measures, if will be needed.Key words: apple proliferation, DAS-ELISA, nested-PCR, apple orchards, survey.INTRODUCTION(Krczal, et al., 1988), and in Italy (Tedeschiand Alma, 2006).Apple proliferation (AP) is considered one ofThe main symptoms of AP disease are foliarthe most important diseases that occur inreddening, witches’ brooms, enlarged stipulesalmost all European countries, where apple isand small sized fruits with poor taste (Nemeth,grown (Seemüller et al., 2011). Most of the1986). At this time, there are a lot of possibilityapple cultivars are known to be susceptible tofor detection of AP, from indexing on woodythis disease. The causal agent of this disease isindicators and using electron microscopy’Candidatus Phytoplama mali’ (’Ca. P. Mali’),(Seemüller, 1976), to serological methodswhich belongs to the 16SrX phylogenetic group(ELISA) using monoclonal antibodies (Loi et(Seemüller and Schneider, 2004). The firstal, 2002), hybridization and molecular tests,report of AP was made in Northern Italy (Rui etusing direct/nested-PCR and RFLP (Kison etal., 1950). Apple proliferation can beal., 1994), or real-time PCR (Baric and Dallatransmittedby grafting and infected plantVia, 2004). Regarding the serological detectionmaterials, but is not seed transmissible (Seidlof AP group, Ploaie (2006) has showed thatand Komarkova, 1974).there is no serological difference betweenWithin the orchards, the most important naturalApple proliferation, Pear decline and Europeanspread of ’Ca. P. Mali’ is made by insectsstone fruit yellows.vectors. Two Cacopsylla species, C. pictaThe existence of AP in different orchards from(Jarausch et al., 2003; Malagnini et. al., 2010)Romania, based on symptomatology, wasand C. melanoneura (Tedeschi et al., 2002;observed since 1958 (Pop, 1962; Pop et al.,Chireceanu and Fatu, 2012) were reported as1965, 1967). Along 15 years, Gheorghiu (1985)‘Ca. P. mali’ vectors. The pathogen ishad studied the etiology, symptomatology,transmitted by both species in a persistent epidemiology and transmission of AP on twomanner. Also, Fieberiella florii (Stal) was apple cvs., Jonathan and Red Delicious. Duringreported as vector of ‘Ca. P. mali’ in Germany 1967-1973, Gheorghiu (1985) provided data on143

AP monitoring performed in Romanian appleorchards, based on morphologicalsymptoms. In the last thirty years there is alack of information about AP incidence inRomanian apple orchards.To date, there are no studies about theoccurrence of AP in apple orchards fromRomania based on serological and/or moleculartests. To start to secure these missing data, apreliminary survey was carried out in 2012, intwo apple orchards located in Bistrita area,Romania, using serological and molecularassays.MATERIALS AND METHODS‘Florina’ cv., known to be one of the highlysusceptible to AP (Loi et al. 1995) and anothertwo Romanian cultivars, named ‘Generos’ and‘Aura’, were the subject of this study. Twentysamples of symptomatic apple trees werecollected in autumn 2012 from the threecultivars. Sampling was based on typical APsymptoms: witches’ brooms, foliar reddening inlate summer, enlarged stipules and dwarf offruits (Figure 1).Figure 1. Symptom of Apple proliferation disease: dwarfsized fruits (down) compared with healthy fruits (top) –original.Photo 1. Symptom of Apple proliferationdisease: dwarf sized fruits (down) comparedwith healthy fruits (top) – original.Serological diagnoses were performed byDouble Antibody Sandwich-Enzyme LinkedImmunosorbent Assay (DAS-ELISA) – (Clarkand Adams, 1977), using a monoclonalantibody (Loi et. al., 2002) raised against APphytoplasmas group, according to themanufacturer’s instructions (Bioreba,Switzerland). Absorbance values weremeasured at 405 nm after 30 and 60 minutes,using a TECAN plate reader. Samples wereconsidered positive if their absorbance valueswere more than twice those of negativecontrol. Positive and negative controls wereprovided in AP kit (Bioreba), and used both inserological and molecular assay.For molecular detection, total DNA waspurified by using DNeasy Plant Mini Kit andthe protocol recommended by manufacturer(Qiagen, Germany). DNA was extracted fromleaf veins and phloem, which were prior grindto a fine powder under liquid nitrogen. Aliquotsof DNA were then used in nested-PCR. A firstround of amplification was made by using anuniversal primers pair P1/P7 (Deng and Hiruki1991).RESULTS AND DISCUSSIONSSeventeen samples out of twenty reactedpositively by DAS-ELISA, using monoclonalantibody provided by Bioreba, whichspecifically recognize AP (Table 1).Nested-PCR, performed in parallel withserological detection, allowed us to detect16SrX phytoplasmas group. All samples testedby nested-PCR reacted positively, both in thefirst and the second PCR round.Consequently, “infected status” of all the 20trees showing typical AP symptoms analyzedin the present work was confirmed in nested-PCR.However, three samples were foundnegative in DAS-ELISA. There is possible thatthe three isolates were not recognized bymonoclonal antibody.Table 1. Results of serological and molecular testsCultivar Isolate code DAS-ELISA Nested-PCR StatusG1 + + infectedG2 + + infectedG3 + + infectedG4 + + infectedGenerosG5 + + infectedG6 + + infectedG7 + + infectedG8 + + infected144

F1 - + infectedF2 - + infectedF3 + + infectedF4 + + infectedFlorinaF5 + + infectedF6 + + infectedF7 + + infectedF8 + + infectedA1 + + infectedA2 + + infectedAuraA3 + + infectedA4 - + infectedAP positive control + + AP negative control - - Because plenty of trees showed similarsymptoms like those sampled, this preliminarysurvey suggests a high incidence of AP in thetwo orchards. An extended survey onsurrounding areas of Bistrita, and then atregional and national level, focused not only onsymptomatic trees, but also on asymptomatic,is necessary to provide relevant data about theAP occurrences in Romanian apple orchards.Subsequently, overall data will allow toestablish control measures, knowing that thisdisease is included in the list of quarantine.This work can be considered a first step inevaluation of incidence of AP in apple orchardsfrom Romania, by using not only visualmonitoring, but also serological and molecularassays.CONCLUSIONSThe finding of AP in all twenty apple treestested corroborated with plenty of symptomatictrees indicates a potential for a high prevalenceof AP within and around the surveyed orchards.These results request an additional andexhaustive study at regional and national level.Subsequently, appropriate measures to reducethe impact could be recommended, if will beneeded.REFERENCESBaric S., Dalla-Via J. 2004. A new approach to appleproliferation detection: a highly sensitive real-timePCR assay. J. Microbiol. Methods 57, p. 135-145.Chireceanu C., Fatu V., 2012. Data on the HowthornPsyllid Cacopsylla melanoneura (Forster)Populations in Southeast Romania. EcologicaBalkanica, vol. 4 (2), p. 43-49.Clark M., Adams A.N., 1977. Characteristic of themicroplate method of enzyme linked immunosorbent145assay (ELISA) for detection of plant viruses. J. Gen.Virology 34, p. 475-483.Deng S., Hiruki C., 1991. Genetic relatedness betweentwo nonculturable mycoplasmalike organismsrevealed by nucleic acid hybridization andpolymerase chain reaction. Phytopathology 81, p.1475-1479.Jarausch B., Schwind N., Jarausch W., Krczal G.,Dickler E., Seemüller E. 2003. First report ofCacopsylla picta as a vector of apple proliferationphytoplasma in Germany. Plant Dis. 87, p. 101.Gheorghiu E., 1985. Boala proliferarii la mar inRomania. Ed. Ceres.Lee I.-M., Bertaccini A., Vibio M., Gundersen D.E.,1995. Detection of multiple phytoplasmas inperennial fruit trees with decline symptoms in Italy.Phytopathology 85, p. 728–735.Loi N., Carraro L., Musetti R., Firrao G, Osler, R., 1995.Apple proliferation epidemics detected in scrabresistantapple trees. J. Phytopathol. 143, p. 581-584.Loi N., Ermacora P., Carraro L., Osler R., Chen T.A.,2002. Production of monoclonal antibodies againstapple proliferation phytoplasma and their use inserological detection. Eur. J., Plant Pathol. 108, p. 81-86.Kison H., Schneider B., Seemüller E., 1994. RestrictionFragment Length Polymorphisms Within AppleProliferation Mycoplamalike Organism. J. ofPhytopathology, 141, p. 395-401.Krczal G., Krczal H., Kunze L., 1988. Fiebeiella florii(Stal), a vector of apple proliferation agent. ActaHort. 235, p. 99-106.Malagnini V., Pedrazzoli F., Gualandri V., Zasso R.,Bozza E., Fiamingo F., Pozzebon A., Mori N., IoriattiC., 2010. Detection of ‘Cabdidatus Phytoplasma mali’in different populations of Cacopsylla melanoneura,in Italy. Bulletin of Insectology, 63 (1), p. 59-63.Nemeth M., 1986. Virus, Mycoplasma and rickettsiadiseases of fruit trees. Akademiai Kiado, Budapest.Rui D., Cifferi R., Refatti E., 1950. La virosi gegli“scopazzi del mielo” nel Veronese. Not. Mal. Piante13, p. 7-11.Ploaie P., 2006. Isolation and serological detection ofapple proliferation phytoplasma group in Romania.Annals of the ARS – Aniversary volume 1, p. 163-168.Pop I.V., 1962. Principalele viroze ale plantelor in R.P.R.Prob. de Biol., p. 347-401.Pop I.V., Radulescu E., Docea E., Coman T. 1965. VirusDiseases of Fruit Trees in Romania. Zastita bilja, 16,p. 493-496.Pop I.V., Coman T., Gheorghiu E., Motoi E., Apetri A.,1967. Contributii la studiul si combaterea virozelorpomilor fructiferi in Romania. Gradina, Via siLivada, 8, p. 56-59.Schneider B., Seemüller E., Smart C. D., Kirkpatrick B.C., 1995. Phylogenetic classification of plantpathogenic mycoplasma-like organisms orphytoplasmas. In Molecular and DiagnosticProcedures in Mycoplasmology, vol. 2, p. 369–380.Seemüller E., 1976. Investigations to demonstratemycoplasma like organisms in diseased plants by

fluorescence microscopy, Acta Hort. (ISHS) 67, p.109-112Seemüller E., Carraro L., Jarausch W., Schneider, B.,2011. Apple proliferation phytoplasma. In: Virus andVirus-Like Disease of Pome and Stone Fruits. Editedby Hadidi, A., Barba, M., Candresse, T. and Jelkman,W. p. 67-73.Seemüller E., Schneider B., 2004. ‘CandidatusPhytoplasma mali’, ‘Candidatus Phytoplasma pyri’and ‘Candidatus Phytoplasma prunorum’, the casulagents of apple proliferation, pear decline andEuropean stone fruits yellows, respectively.Int.J.Syst.Evol. Microbiol.. 54, p. 1217-1226.Seidl V., Komarkova V., 1974. Studies on natural spreadof proliferation disease on apple. Phytopathol. Z. 81,p. 301-313.Tedeschi R., Bosco A., Alma A., 2002. Populationdynamics of Cacopsilla melanoneura (Homoptera:Psyllidae), a vector of apple proliferationphytoplasma in northwestern Italy. Journal ofEconomic Entomology, 95 (3), p. 544-551.Tedesci R., Alma A., 2006. Fiebiella florii as a vector of‘Ca.P. mali’. Plant Dis. 90, p. 284-290.146

HORTICULTURALBIODIVERSITY ANDGENETIC RESOURCES

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653SOME FRUIT CHARACTERISTICS OF MEDLAR(MESPILUS GERMANICA L.) GENOTYPES GROWN IN ORDU, TURKEYAbstractAhmet AYGÜN, Ali Riza TASÇIOrdu University, Faculty of Agriculture Department of Horticulture, 52200, Ordu, TurkeyCorresponding author email: ayguna70@yahoo.comMedlar is grown mostly as scattered trees within or around hazelnut orchards in the Black Sea Region of Turkey. Theharvested fruits are used for family consumption or sold in local markets. This research was carried out to determinecertain morphological and chemical attributes of 39 medlar genotypes grown in Ordu region in 2012. There was largevariation among the genotypes that the average fruit weight, fruit length and fruit width were between 6.32 and 36.42 g,21.8 and 40.1 mm and 20.6 and 42.7 mm while width and length of calyx basin ranged from 8.3 to 23.3 mm and from3.8 to 11.8 mm, respectively. Soluble dry matter, titreable acid contents and pH varied between 2.3 and 11.9 g/l, 8 and18%, and 3.62 and 4.90, respectively. Based on especially fruit size and weight, the clone #3 was selected as apromising genotype.Key words: Medlar, Mespilus germanica L., pomology, selection.INTRODUCTIONMedlar (Mespilus germanica L.) is a genus inthe Rosaceae family which has many fruitspecies. Medlar is deciduous and growsnaturally as large shrubs or small trees inSouthwest Asia and also in Southeast Europe,mostly in the coast of Black Sea in Turkey for3000 years. The fruits of medlar have brownand sometimes reddish colour and they are 1.5-3 cm in diameter, the small ones have a weightof 10-80 g (Browicz, 1972; Bignami, 2000;Ayaz et al., 2008). The medlar fruit is widelyconsumed in Turkey. In Northeast Anatolia(Turkey) both wild and cultivated forms aregrown, and their fruit is used in different ways.In October, the hard fruit is harvested from themedlar trees and stored in cold, dark andventilated places. However, a substantial partof the crop at different stages of maturity is lefton the trees and harvested later after fruitsoftening has started. The fruit is oftenconsumed or sold in the local markets andstores.Cultivars of Mespilus germanica that aregrown for their fruit include; hollandia,nottingham and russian, dutch (also known asgiant or monstrous), royal, breda giant andlarge russian (Bignami, 2000). There are veryfew kinds of fruit in other types.This study wasconducted in order to determine the fruit149characteristics of genotypes grown in naturalhabitat of Ordu province.MATERIALS AND METHODSPlant materialThe fruits of 39 different genotypes were takeninto consideration among hundreds ofgenotypes grown in the district of Ulubey,Ordu. The fruits were harvested from the treesbefore softening and 15 fruits from eachgenotype were left for softening at 22 ± 2 0 C.The measurements of fruit length, fruitdiameter, width and length of calyx basin weredetermined with digital calipers; fruit and seedweight were determined with 0.01 g sensitiveprecision scales by taking the average of the 15fruits.In soft fruits, the rate of total soluble dry matterwas determined as percentage with handrefractometer. The rate of titreable acid contentwas determined as percentage considering theamount of total base consumed as malic acid,after the titration with 1N NaOH. The pH offruit juice was also determined.The data obtained from the fruits of the 39genotypes were tested using variance analysiswith the statistical packages of minitab(MINITAB Inc.). The differences werecompared with Duncan method with using 0.05F value (P< 0.05).

RESULTS AND DISCUSSIONSFruit characteristics of the 39 genotypes thatwere evaluated in the field observations aregiven in Table 1. According to the results, thegenotype 3 has the highest value for fruitweight (36.42 g) and it is followed by genotype1 (31.28 g) and genotype 33 (30.31 g). Thelowest value for fruit weight was measured inthe genotype 29 (6.32 g).Studies in the literature carried out in differentparts of Turkey showed that the values of fruitweight ranged from 9.46 to 40.80 g (Ozkan etal., 1997; Bostan, 2002; Bostan and Islam,2007; Ercilsi et al., 2012).The highest values in terms of fruit lengthswere found in the genotypes 14 (40.12 mm)and 3 (39.74 mm). The lowest values weredetermined in the genotype 31 (20.69 mm). Inprevious studies, it was indicated that the fruitlengths ranged from 26.53 to 48.73 mm in thegenotypes selected (Ozkan et al., 1997; Bostan,2002; Bostan and Islam, 2007; Ercilsi et al.,2012). Our results are within the range of thevalues reported in the literature.The fruit diameters of analyzed genotypesranged from 23.10 to 42.65 mm. The highestvalue was determined in the genotype 3, as itwas true for fruit length. In the literature, it wasstated that the fruit diameters of identifiedgenotypes varied from 23.67 to 42.51 mm(Ozkan et al., 1997; Bostan, 2002; Bostan andIslam, 2007; Ercilsi et al., 2012). Our fruitdiameter results were almost similar to thesevalues.The width and length of calyx basin increasedwith the coarsening of fruit. For the width ofcalyx basin, the maximum value wasdetermined in the genotype 15 (23.33 mm) andfor the length of calyx basin, the maximumvalue was determined in the genotype 3 (12.94mm).The soluble dry matter contents of genotypesvaried between 8-18%. In the literature thesevalues ranged from 12.5 to 26% (Ozkan et al.,1997; Bostan, 2002; Bostan and Islam, 2007;Ercilsi et al., 2012).The pH value of fruit juice was found between3.62 and 4.76. These differences are notsignificant statistically.The values of titreable acid contents werefound between 2.35 and 11.93 g/l. Thesedifferences are not significant statistically too.150Ozkan et al., (1997) and Bostan (2002)determined the titreable acid contents asbetween 1.91 and 8.71 g/l. Our results arelinear with these findings except the genotypeof 39 (11.93 g/l).The maximum value of genotypes in terms ofseed weight was found in the genotype 2 (4.28g) and it was followed by genotype 4 (4.10 g).The lowest seed weight was found in the fruitsof the genotype 29 (0.92 g).Number of seeds in fruits was found above fourin all genotypes except the genotypes 20, 22and 36. On the other hand, the number of seedswas five in the genotypes 3, 32 and 39. Studiesin the literature showed that the number ofseeds were generally between 4 and 5 (Ozkanet al., 1997; Bostan, 2002; Bostan and Islam,2007).CONCLUSIONSIn this study, fruit characteristics of 39genotypes were investigated. Four genotypeswith fruit weight of 25 g or more, 6 genotypeswith fruit length of 35 mm or longer and 6genotypes with fruit diameter of 35 mm ormore were determined. These leadinggenotypes have the potential of being used indeveloping new varieties.In the study, 5 genotypes producing 17%soluble dry matter were regarded asoutstanding genotypes because of theirchemical composition and they also had highrate of titreable acid contents. This studycarried out in the natural growing area ofmedlar revealed that the genotype 3 waspromising in terms of the characteristicsevaluated in variety development.REFERENCESAyaz F.A., Demir O., Torun H., Kolcuoglu Y., ColakA., 2008. Characterization of polyphenoloxidase(PPO) and total phenolic contents in medlar(Mespilus germanica L.) fruit during ripening andover ripening. Food Chemistry Volume 106, Issue 1,p. 291–298.Baird J.R., Thieret J.W., 1989. The Medlar (Mespilusgermanica, Rosaceae) from antiquity toobscurity. Economic Botany. 43 (3), p. 328–372Bignami C., 2000. Il nespolo comune. L’InformaceAgrario, 25, p. 43–46Bostan S.Z., 2002. Interrelationships among pomologicaltraits and selection of medlar (Mespilus germanica

L.) types in Turkey. J. Amer. Pomolog Soc. 56, p.215-218.Bostan S.Z., Islam A., 2007. A research on breeding byselection of medlar (Mespilus germanica L.) types inEastern Black sea region of Turkey. Proceedings of5th National Horticultural Congress, p. 330-337.Browicz K., 1972. Mespilus L. in: P.H. Davis (Ed.),Flora of Turkey and the East Aegean Islands, Vol. 4Edinburgh University Press, Edinburgh, p. 128–129Ercilsi S., Sengul M., Yildiz H., Sener D., Duralija B.,Voca S., Dujmovic P.D., 2012. Phytochemical andantioxidant characteristics of medlar fruits (Mespilusgermanica L.) Journal of Applied Botany and FoodQuality 85, p. 86–90.Ozkan Y., Gercekcioglu R., Polat M., 1997. A study onthe determination of fruit properties of medlar types(Mespilus germanica L.) from Tokat region.Proceedings of National Pome Fruit Symposium, p.123-129.151

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653THE CHOROLOGY OF ARTEMISIA ALBA TURRA,A. LERCHIANA WEBER AND A. TSCHERNIEVIANA BESSER(ASTERACEAE) IN ROMANIAAbstractMonica BADEA, Ioana PDURE, Sorin TEFNU, Aurelia DOBRESCU,Liliana BDULESCUUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Mrti Blvd., District 1, 011464, Bucharest, RomaniaCorresponding author email: monalisa588@yahoo.comThe paper presents chorological data concerning Artemisia alba Turra, Artemisia lerchiana Weber, and Artemisiatschernieviana Besser (Asteraceae) in Romania. These species of Artemisia are considered rare in Romania.Chorological data regarding Artemisia alba, A. lerchiana and A. tscherneviana distributions are presented usingbibliographical information, data from different Herbaria of Romania and original data collected from fieldwork. Anoriginal chorological map using GEOCOD coordinates is presented for the first time.Key words: Asteraceae, Artemisia species, chorology, distribution map, GEOCOD coordinates, Romania.INTRODUCTIONGenus Artemisia L. is one of the largest andmost widespread types of the nearly 100 generathat make up the family Asteraceae. It isconsidered that the genus includes about 500species worldwide, of which 15 species areannual or biennial. Several members of thegenus can be found as endemic species,introduced by man or, as is the case in SouthAmerica and South Africa, appear as invasivespecies. Artemisia species are perennial, rarelyannual or biennial (Bremer, 1994; Vallès andMcArthur, 2001).In 'Flora Europaea' Artemisia genus contains 57species, and the Illustrated Flora of Romania itis mentioned the presence of 16 species(Ciocârlan, 2009), five of which are consideredrare. In Romania there are few studies on rarespecies of the genus Artemisia (Badea, 2011).Holobiuc and Blidu (2007) and Dihoru andNegrean (2003) realised a distribution maps ofsome rare species usingUniversal TransverseMercator (UTM) system.Artemisia lerchiana species was cited by Borza(1947) as being present in Dobrogea andMoldova. Concerning A. tschernieviana species(syn. A. arenaria) Borza (1947) cites thepresence in Moldova and Dobrogea (FRE2294) also mentioned that the dunes raremarine species from the Black Sea, Constantato Mamaia from Tannery (Prodan, 1925).The main objective of the present study is toadd new and original chorological points and todocument the geographic distribution of the A.alba, A. lerchiana, A. tshernieviana species inRomania using GEOCOD system.MATERIALS AND METHODSThe chorological distribution of the speciesusing UTM coordinates is expressed in Figures4, 5 and 6. Descriptions and details ofdistribution of Artemisia are based oncollections from Herbaria: BUAG-Herbaria ofU.S.A.M.V. Bucharest, BUC-Herbaria ofUniversity of Bucharest, BUCA-Herbaria ofInstitute of Biology Bucharest, CL-Herbaria ofUniversity “Babes-Bolyai”, Cluj-Napoca,CRA-Herbaria of University of Craiova, I-Herbaria of University “Al. I. Cuza” Iasi(according codes with Index Herbariorum, N.H. Holmgren). The chorological map ofArtemisia alba, A. lerchiana, A. tschernievianais based on the cited sources above and newpersonal records obtained during research, ordifferent databases / scientific publicationswhere this species was referred. Thechorological maps of Artemisia alba, A.lerchiana and A. tschernieviana included in thiswork were made by taking in account the153

principles of the GEOCOD System (Oltean andStefanut 2002), which ensures an exactlocalization of villages, communes and townswhere this species was found.RESULTS AND DISCUSSIONSArtemisia albaTurr [syn. A. saxatilis Waldst.& Kit., A. biasolettiana Vis., A. lobelii All., A.incanescens Jord., A. camphorata Vill., A.suavis Jord.]It is a rare, submediteranean calcicole species(Figure 1).County ALBA: FS 94 Coltesti, leg. Csuros etPàll, det. Gergely, 19.10.1957 (CL 659804); FS94 Coltesti, 'Piatra Cetatii', leg. et det. I.Gergely, 22.09.1961 (I 89274, 45278, 33162);Mountains Hasmas: Mt. Hasmasul Mic,Trascaului pe “Piatra Cetatii”, “PiatraUrdasului”, “Piatra Podmon”, Mt. Bedeleu, “Piatra lui Paul cel Mare” (Oprea, 2005);County CARAS-SEVERIN: EQ 58 Ciclova(Oprea 2005, Savulescu et all., 1964);County CONSTANTA: PJ 05 Cotul Vaii, leg.et det. Gavril Negrean, 21.08.2002 (CL656524);Couny CLUJ: Rimetea, (Savulescu et all.,1964); FS 95 Buru, leg. Badea Monica, det. V.Ciocârlan, 11.10.2010 (BUAG 23955);County HARGHITA: Mt. Haghimasu Mic(Savulescu et all., 1964);County SIBIU: KL 68/78 Ocna Sibiului, (FS,Savulescu et all.,1964);County TULCEA: 6 Martie, leg. et det.G.Negrean, 1.06.1984 (BUCA 549790);Artemisia lerchiana Weber [syn. A. incana B.Keller, non Druce; A. taurica auct. roman., nonWilld.]It is a Xerophile, heliophile and calcicole plantwidely spread in the Pontic-Aralo-Caspianarea. The species can be found in Dobrogea(“Capul Dolosman-Jurilovca”). It has apreference for dry, rocky terrain with a gentleto medium slope and chernozem orkastanozems (Figure 2).County IASI: NN 34 Tiganasi (Chifu et all.,1987);County TULCEA: PK 35 Baia, 3.07.1978, G.Negrean (BUCA); PK 46 Jurilovca (CapulDolosman), 31.10.1999, leg. et det. V.Ciocârlan (BUAG 23191); leg. Badea Monica,det. Vasile Ciocârlan, 4.10.2009 (BUAG23959); G. Negrean, 2.07.1978 (HGN);Jurilovca, 27.06. 1983, G. Negrean (BUCM77235);Artemisia tschernieviana Besser [syn. A.arenaria DC.; A. campestris subsp. inodoraNyman.]It is a rare, continental, heliophile,psamophyllous plant. The western limit for hergrowth area is Romanian part of Dobrogea(Figure 3).County CONSTANTA: PJ 28 Agigea, leg. C.Burduja et det. I. Sârbu, 5.08.1967, (I 43001,43002); Capul Midia, leg. Badea Monica, det.Vasile Ciocârlan, 6.07.2011 (BUC 157623; I137117); PJ 28/29 Constanta, leg. C. Petrescuet det. C. Dobrescu, 31.07.1915 (I. 24249,1467); PJ 37/38 Eforie, leg. et det. C. Burduja,27.07.1948 (I. 61355; 61356); PJ 37/38 Eforie,leg. et det. I. Sârbu, 19.10.1971 (I. 36912;36193; 38340); PJ 37/38 Eforie, leg. C.Zahariadi, det. A. Popescu, 30.08.1960,(BUCA 129286); PJ 39 Mamaia, leg. et det. C.Burduja, (I 61357, 61358, 1467); PJ 39Mamaia, leg. Grintescu, 11.08.1910, det.Beldie Alex.,1964, (BUCA 88643); PJ 39Mamaia, leg. M.Tiesen, 11.08.1926 (CL429167); PJ 39 Mamaia, leg. Al. Borza,5.08.1923 (CL 501119, 501146); PK 20Navodari, leg. Popescu, 18.05.1972 (BUCA129079); PJ 27 Techirghiol,, leg. et det. G. P.Grintescu, 17.09.1925 (I 45271, 33158, BUCA18848, 30326, 41826, 30380, 30379, 30378,11278; CL 618230; CRA, 1467); Corbu,(Fagaras, 2008);County SUCEAVA: MN 37 Moara Carp,reserve Frumoasa, leg. M. Paun, M. Olaru, Gh.Popescu, (CRA);County TULCEA: NL 92 Grindul, leg.Popescu, 24.07.1968 (BUCA 133359; BUCA133539), PL91 Letea (Buia, 1963), QL 00/10Sulina (Buia, 1963) Sf. Gheorghe, Ciocârlan,1994;CONCLUSIONSThis study contains data from differentHerbaria from Romania (BUC, BUCA, BUAG,CL, CRA, I) in which we made the revision ofArtemisia L. (Asteraceae) genus and madephotos of the herbaria sheets with Artemisiaalba, A. lerchiana, A.tscherneviana.154

The chorology maps of Artemisia alba, A.lerchiana, and A. tschernieviana species weredeveloped for the first time using GEOCODcoordinates. New and original localities wereadded compared with bibliographicalreferences or data sheets specimens fromHerbaria.Were placed in Herbaria specimens of rareArtemisia species (Artemisia alba and A.lerchiana in BUAG-Herbaria of USAMVBucharest, Artemisia tschernieviana in BUC-Herbaria of University of Bucharest, I-Herbariaof University “Al.I.Cuza” Iasi).These chorological maps add new data in ourmonographic study of Artemisia L.(Asteraceae) genus in Romania.Figure 1. Morphological aspect of Artemisia alba Turra (orig. 1a)Figure 2. Morphological aspect of Artemisia lerchiana Weber (orig.)155

Figure 3. Morphological aspect of Artemisia tschernieviana Besser (orig.)Figure 4. Chorology of Artemisia alba Turra in Romania (orig.)156

Figure 5. Chorology of Artemisia lerchiana Weber in Romania (orig.)REFERENCESFigure 6. Chorology of Artemisia tshernieviana Besser in Romania (orig.)Badea M. L., 2011. Cercetari privind structura tesuturilorsecretoare, compozitia uleiului volatil si corologia launele specii de Artemisia din România, Teza dedoctorat, Bucuresti.Borza Al., 1947. Conspectus Florae RomaniaeRegionumque affinum, Tipog. “Cartea Româneasca”,Cluj.157Bremer K., 1994. Asteraceae, Cladistics andClassification, Timber Press: Portland. CarnegieInstitution of Washington: Washington, DC.Buia A., Paun M., Malos C., Olaru A., 1963. Materialepentru flora Masivului Parâng, Lucr. Gr. Bot.Bucuresti, 1961-1962, p.267-297.Chifu T., Mititelu D., Dascalescu D., 1987. Flora sivegetatia judetului Neamt, Memor. Sect.St, Acad.Romana, Ser. IV, X, vol.1, p. 281-302.

Dihoru Gh., Negrean G., 2009. Cartea Rosie a PlantelorVasculare din România, Ed. Academiei Române,Bucuresti, p. 630.Ciocârlan V., 1994. Flora Deltei Dunarii, Ed. Ceres,Bucuresti, p. 40.Ciocârlan V., 2009. Flora ilustrata a României, Ed.Ceres,Bucuresti.Fagaras M., Skolka M., Anastasiu P., Cogalniceanu D.,Negrean Banica G., Tudor M., Samoila C., 2008.Biodiversitatea Zonei Costiere a Dobrogei dintreCapul Midia si Capul Kaliacra, Ed. EX PONTO,Constanta, p. 451.Holobiuc I., Blindu R., 2006-2007. In vitro cultureintroduction for exsitu conservation of some rareplant species, Rom. J. Biol. Plant Biol., Vol. 51-52, p.13-23.Oltean M., Stefanut S. 2002. Atlas Florae Romaniae,Proceed. Inst. Biol. IV, p. 101-108.Oprea A., 2005. Lista critica a plantelor vasculare dinRomânia, Ed. Universitatii 'Alexandru Ioan Cuza'Iasi, p. 374-375.Prodan I., 1925. Flora nisipurilor din România subraportul fixarii si ameliorarii. Conspectul sistematical speciilor. Inst. Arte Grafice, Bucuvina, p. 89.Savulescu T., Ghisa E., Grintescu I., Gusuleag M.,Morariu I., Nyarady E.I., Prodan I., 1964. FloraR.P.R., Ed. Academiei Române, vol.IX, Bucuresti.Valles J. and McArthur E.D., 2001. Artemisiasystematics and phylogeny: cytogenetic andmolecular insights. In Shrubland ecosystem geneticsand biodiversity: proceedings, E. D. McArthur and D.J. Fairbanks, eds; 2000 June 13-15; Provo, UT. Proc.RMRS-P-21. Ogden, UT: U.S. Department ofAgriculture, Forest Service, Rocky MountainResearch Station.Artemisia L. (Asteraceae) genus inhttp:/eunis.eea.europa.eu/references/1780/speciesIndex herbariorum, N. H. Holmgren,http://sciweb.nybg.org/science2/IndexHerbariorum.asp.158

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653NEW HOST PLANT FOR VIRUS VECTORNEMATODE XIPHINEMAITALIAE MEYL, 1953(NEMATODA: LONGIDORIDAE) IN ROMANIAMariana BONTA (GROZA) 1 , Ioan ROCA 1 , Claudia COSTACHE 21 University of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Marasti Blvd., 011464, Bucharest, Romania2 Central Phytosanitary Laboratory, 11 Voluntari Blvd., 077190, Bucharest, RomaniaAbstractCorresponding author email: mariana_bonta@yahoo.comExcept direct damage to root system, Xiphinema italiae Meyl, 1953 has been reported to be a vector of Grapevinefanleaf virus (GFLV) (Cohn et al., 1958). Soil samples were collected at a depth of 20-40 cm from orchards andvineyards. Xiphinema italiae was identified in rhisosphere of peach orchard. A polymerase chain reaction protocol andthe morphological and morphometrical characters has been used for the reliable identification of X. italiae.Morphometrics and illustrations of females are provided. Prunus persica L.is a new host plant for Xiphinema italiae forRomania.Key words: Longidoridae, morphology, PCR Multiplex.INTRODUCTIONXiphinema italiae Meyl, 1953 is widespreadmigratory plant parasitic nematode, speciesoccurring in southern and central Europe:Bulgaria (Peneva and Choleva, 1992,Peneva,1997) France (Wang et al., 2003)Greece (Avgelis & Tzortzakakis, 1997,Tzortzakakis et al. 2006) Hungary (Nagy,1999), Italy (Martelli et al.,1966), Moldavia(Polinovskij, 1979), Serbia (Barsi & Lamberti,2003), Slovakia (Liškova et al., 1993) andSpain (Teliz et al., 2007) (Gutiérrez-Gutiérrezet al., 2011).. Outside Europe it was found inCuba (Dias-Silveira & Herrera, 1995), Egypt(Lamberti et al., 1996), Libya (Siddiqui et al.,1987), Nigeria (Khan et al., 1993) and SouthAfrica (Knoetze et al., 2000). Xiphinema italiaehas been reported to be a vector of GFLVaccording to Cohn et al., 1970). In Romania,Romacu, 1971 found X. italiae in associationwith grapevines from sandy soil in Platonetiand Saveni (Ialomia county).MATERIALS AND METHODSFor this study, soil samples were collected fromthe rhizosphere of peach trees at a depth of 20-40 cm from Valul lui Traian (Constanacounty).159Nematodes were extracted from 200cm 3 soil bya sieving and decanting technique, Nematodeswere heat killed at 60ºC for two minutes andfixed in a 4% formaldehyde solution. Thespecimens were processed to mounted onpermanent microscopic glass slides (Seinhorst,1959).The morphological and morphometricalobservations were made using Leica DMLBmicroscope fitted with Leica FDC 295 camera.Multiplex PCR. DNA isolation was carried outby placing 4 nematodes in 10 μL of lysis buffer(1X Platinum Taq DNA polymerase /Invitrogenand 60 μg of proteinase K/mL) between twoglass slides and crushed gently. Thehomogenate was taken up carefully with apipette, transferred to 0,2 mL Eppendorf tubesand frozen at-80°C for 15 min. After the tubeswere incubated at 60°C for 1 h and 95°C for 15min.Amplification was carried out in a 25-μlreaction mixture containing the 2,5 μl lysisbuffer (nematode lysate as PCR template), 1xPlatinum Taq DNA polymerase buffer(Invitrogen), 1.5 mM MgCl 2 (Invitrogen), 0.2mM each of dATP, dCTP, dGTP, and dTTP(Sigma 10mM), 0.8 pmol each primer, and0.5 units of Platinum Taq DNA polymerase

(Invitrogen). The primers A-ITS 1, I27, D24,V18, ITA26 were used (Wang et al. 2003).Amplifications were performed in a thermalcycler (Mastercycler Pro S – Eppendorf), withthe following cycling conditions: 95°C for 3min followed by 39 cycles at 94°C for 1 min,58°C for 1 min, and 72°C for 1 min 30 s, andending with 1 cycle at 72°C for 5 min andstorage at 4°C.Amplification product (10 μl PCR product) wasseparated on 1,5% agarose gel (Sigma) and0,5X TBE at 100V. The gels were visualizedwith photo documentation system GENi(Syngene).RESULTS AND DISCUSSIONSXiphinema italiae Meyl, 1953 (Table 1, Figure3).Female: Body almost straight, tapering forwardand backward, tail end ventrally curved.Cuticle 1,5-1,7μm thick in postlabial region,2,2-2,7 μm at mid body, 3-4,3 μm. Head end4,3-5μm convex, clearly separated fromadjacent body by a constriction, laterallyrounded. Basal bulb measuring 17-18x113-120μm. Prerectum 451-607μm, rectum 23-31μm.Tail conical, elongated, tapering ventrally andor dorsally before end. Terminus rounded.Juveniles: The scatter plot diagram based onfunctional and replacement odontostyle andbody length reveals the presence of threejuveniles stages (the second, third, fourth)(Figure 1).Table 1. Measurements of Xiphinema pachtaicum (all inmicrometres)n=number of specimens; a=bodylength/greatest body diameter; b=bodylength/distance from anterior to end ofesophageal bulb; c=body length; c´=taillength/anal body diameter; V%=distance ofvulva from anterior endFigure 1. Scatter plot of odontostyle and replacementodontostyle agaist body length of Xiphinema italiae.160Figure 2. Electrophoresis of the amplification productsfrom DNA isolated from Xiphinema italiae: lane M-100bp DNA ladder (Fermentas), lane A,B – X. italiae

Molecular differentiation showed a singlefragment of approximately 414bp wasamplified (Figure 2), according to Wang et al.,2003 which correspond to Xiphinema italiae.Figure 3. Xiphinema italiae Meyl, 1953: A, anteriorregion of female with lips region, odontostyle,odontophore, guiding ring; B, oesophageal bulb; C,posterior genital branch; D, anterior genital branch; E,head end; F, vaginal region; G, female tail; H, rectum.Scale bar: 20μm; 50μm.CONCLUSIONSXiphinema italiae was recorded on Prunuspersica for the first time in Romania.The monitoring of virus vector nematodesthrough soil samples, before set up the orchardsand vineyards, can assure healthy crop.Accurate identification of Xiphinema spp. isimportant in regard to their virus transmissioncapability.For a reliable diagnosis is necessary to combineidentification using morphometric charactersand molecular technics.ACKNOWLEDGEMENTSThis research was carried out with the supportof POSDRU/107/1.5/S/76888 project.REFERENCESAvgelis A.D., Tzortzakanis E.A., 1997. Occurrence anddistribution of Xiphinema species and Grapefanleaf nepovirus in vineyards of Greek island ofSamos. Nematologia Mediterranea, 25, p. 177-182.Barsi L., Lamberti F., 2003. Morphometrics of adults andjuvenile stages of three longidorid nematodes(Nematoda: Dorylaimida) from Vojvodina province,Northern Serbia. Nematol. Medit., 31, p. 65-85.Cohn E., Tanne E., Nitzany F.E., 1970.Xiphinemaitaliae, a new vector of grapevine fanleafevirus. Phytopatology, 60, p. 181-182.Gutiérrez-Gutiérrez C., Castillo P., Cantalapiedra-Navarrete C., Landa, B. B., Derycke, S., Palomares-Rius J. E., 2011. Genetic structure of Xiphinemapachtaicum and X. index populations based onmitochondrial DNA variation. Phytopathology 101,p. 1168-1175.Lamberti F., Agostinelli A., Radicci V., 1996.Longidorid nematodes from Northern Egypt.Nematol. Medit., 24, p. 307-339.Liškova M., Lamberti F., Sabova M., Valocka B.,Agostinelli A., 1993. First record of some specieslongidorid nematodes from Slovakia. NematologiaMediterranea, 21, p. 183-194.Martelli G.P., Cohn E., Dalmaso A., 1966. Aredescription of Xiphinema italiae Meyl, 1953 andits relationship to Xiphinema arenarium Luc etDalmaso, 1963 and Xiphinema conurum Siddiqi,1964. Nematologica, 12, p. 183-194.Nagy P., 1999. New faunistic record for Longidorusattenuatus Hooper, 1961 and Xiphinema italiaeMeyl, 1953 (Nematoda: Longidoridae) in Hungary.Növényvédelem, 35, p. 15.Peneva V., Choleva B., 1992. Nematodes of familyLongidoridae from forest nurseries in Bulgaria. II.The genus Xiphinema Cobb. 1913. Helmintology 32,p. 47-66.Romascu, 1971. Xiphinema americanum Cobb, 1913 siXiphinema italiae Meyl, 1953 (Nematoda:Dorylaimidae), noi daunatori ai vitei de vie, AnaleleI.C.P.P., vol. VII, p. 203-209.Seinhorst J.W., 1959. A rapid method for the transfer ofnematodes from fixative to anhydrous glycerin.-Nematologica4, p. 67-69.Teliz D., Landra B., Rapaport H.E, Camacho F.P., DiazJ. R. M., Castillo P., 2007. Plant parasitic nematodesinfecting grapevine in south Spain and susceptiblereaction to root-knot nematodes of rootstocksreported as moderately resistant. Plant. Disc., 91, p.1147-1157.Tzortzakanis E., Pateras D., Charoulis A., 2006.Occurrence of Xiphinema species in grapevine areasof Tyranvos with comments on the distribution of X.italiae in Greece. Helminthologia, 43, p. 186-187.Wang X., Bosselut N., Castagnone C., Voisin R., AbadP., Esmenjaud D., 2003. Multiplex Polymerase ChainReaction Identification of Single Individuals of theLongidorid Nematodes Xiphinema index, X.diversicaudatum, X. vuittenezi and X. italiae UsingSpecific Primers from Ribosomal Genes –Nematology, Vol. 93, No. 2, p. 160-166.161

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653STUDY ON THE FREE AMINO ACID PROFILE OF LEAVES FOR GRAPESVARIETIES OF GALBEN DE ODOBETI SORTOGROUPMarioara BOSOI 1 , Constantin ÂRDEA 21 Research and Development Station for Viticulture and Oenology Odobeti, Stefan cel Mare no. 61,625300, Odobeti, Romania2 University of Agricultural Sciences and Veterinary Medicine Iai, Mihail Sadoveanu Avenue no.3,Iai, RomaniaAbstractCorresponding author email: mioara_bosoi@yahoo.comResearches on amino acid profile carried out so far in the genus Vitis showed its great variability, suggestingimportance of the genetic involvement in this variability This paper presents preliminary results of investigating theamino acid profile from leaves to the grape varieties of sortogroup Galben de Odobeti. The grape varieties taken inthe study were: Galben de Odobeti, Btut neagr, Zghihar de Hui, Negru moale and Negru vârtos. For extractionof free amino acids from the leaves of the vine has been used the method Bieleski & Turner (1966) adjusted forgrapevine, and separation technique was performed by thin-layer chromatography (TLC). Identification andquantitative estimation of free amino acids was performed using analysis and image processing software - ImageJver.1.46. The amount of free amino acids ranged between 18.76 mg / mg fresh leaf at Galben de Odobeti variety and14.33 mg / mg for Negru moale variety. In the varieties Galben de Odobeti, Btut neagr and Zghihar de Hui themost abundant free amino acids were: aspartic acid (Asp), glutamic acid (Glu), serine (Ser), threonine (Thr), proline(Pro) and glycine (Gly). The predominant amino acids for Negru moale variety were: aspartic acid (Asp), serine (Ser),glycine (Gly), glutamic acid (Glu), threonine (Thr), proline (Pro) and arginine (Arg). Amino acids predominantly toNegru vârtos variety are: aspartic acid (Asp), glutamic acid (Glu), serine (Ser), threonine (Thr), proline (Pro) andarginine (Arg). Aspartic acid (Asp) is found in large quantities compared with other amino acids, representing 31.7%of total amino acids identified for Negru vârtos variety, 31.5% at Zghihar de Hui variety, 30.5% fpr Negru moalevariety, 27. 5% for Galben de Odobeti variety and 25.3% for the variety Btut neagr. Statistical ratio Pro / Argand amino predominant ratio (Asp / Ser), genetically differentiate the Btut neagr variety the other varietiesbelonging to the sortogroup Galben de Odobeti, with a confidence interval of 95%. These preliminary data provide abasis for further research that can demonstrate that amino acid profile of the leaves can be used as method indiscriminant analysis of grape varieties.Key words: amino acid profile, Galben de Odobeti, sortogroup, thin-layer chromatography.INTRODUCTIONincreases during aging reaching values between200 and 6500 mg/l of each amino acidThe fund management in grape germplasm isvariations from one year to another, and fromone of the most important issues is the growingone variety to another (ârdea, 2007). Shareconcern of researchers from all countries.amino acids in grapes is high and is 20 -30% ofClassical identification methods based onthe total nitrogen compounds (Poux andcharacteristics ampelographic / botanical notOurnac, 1970). Total amino acid contentthe most accurate, with certain restrictions dueespecially predominant ratio of amino acidsto instability morphological characteristicsdiffer significantly from one variety to another,influence environmental conditions.so knowing the amino acid spectrum ofResearch on amino acid profile made so far invegetative organs and grapes can be a means ofthe genus Vitis showed its great variability,differentiation of vine varieties in terms ofsuggesting importance of the geneticinvolvement in this variability (Kliewer et al.,genetically (Hernández-Orte et al., 1990).1966, Kliewer 1969; Klub et al., 1978; MarcyStudies on free amino acid profiles of grapeset al. 1981; Notsuka et al., 1984, Huang andmade so far reported variations in the geneticOugh, 1991). On vines, the total amino acidsmaterial and suggests new biochemicaldescriptors (Shiraishi, 1996).163

The characterization of the grapevine varietiesbased on free amino acid profile shows a greatimportance to complement the modern methodson investigation of the vine varieties(isoenzymatic analysis and DNA analysis).MATERIALS AND METHODSThe biological material was represented by fivelocal varieties to Galben de Odobetisortogroup (Galben de Odobeti, Zghihar deHui, Btut neagr, Negru moale and Negruvârtos), belonging ampelographic collection ofResearch and Development Station forViticulture and Winemaking Odobeti.Samples for analyses were the young leafobtained by forcing cuttings - eye. The leafsamples (2 or 3 leaves, ~ 5 g ) were collectedfrom each variety in plastic bags, labeled,stored on ice and brought to laboratory foranalyses.For extraction of free amino acids from theleaves of the vine has been used the methodBieleski & Turner (1966) adjusted forgrapevine. This method ensures the extraction,separation and quantitative estimation of aminoacids from small samples of vegetal freshtissue, by thin layer chromatography technique.For extraction of free amino acids in biologicalmaterial and for the preparation of standardsolutions of amino acids was used a mixturesolution with methanol, chloroform and waterin a ratio of 12:5:3 v/v/v. For each grapevariety was weighed a sample of 0.5 gbiological material. The fresh leaves werelyophilized and crushed in a mortar with liquidnitrogen until was obtained a fine powder.0,200 g was transferred for each sample in aEppendorf tube 1.5 ml. Over powder was added200 ml extraction solution (methanol:chloroform: water - M/C/W) in ratio of 12/5/3(v/v/v), which allowed the removal of pigmentsand lipids from plant material in chloroformlayer. Cell suspensions were treated with sonicfrequencies for 1 hour at 4 ° C, causing rupturecell membranes. After sonication the sampleswere stored in a refrigerator at 4 º C for at least1 h. To obtain the supernatant containing theamino acids, the sample was centrifuged at13,500 rpm for 15 minutes at 4 ° C.The chromatographic separation of amino acidswas achieved on TLC plates with silica gel164stationary phase 60 on aluminum foil 20 x 20(TLC Silicagel 60), manufactured by MerckKGaA, Germany. TLC plates were made withsize 10 x 7 cm and have been marked the areasof application for samples. Using standardamino acids were produced by Merck KGaA,Germany, in the solution of methanol:chloroform: water (12:5:3 v / v / v). Samples (2l) were applied with an automaticmicropipette with volume control, from left toright at the bottom of the plate, in the areasmarked for each cultivar. The chromatographicseparation or development of plates was donein mono dimension, was used the developmentsystem based on n - butanol / glacial acetic acid/ water (ratio 4:1:1 v/v/v). Afterchromatographic separation, the TLC plates areready for viewing and identification of aminoacids separated. To ensure reproducible results,the tests were repeated three times forpredominant amino acids, to all five varieties.View amino acids was performed usingspecific reagents – ninhydrin (a solution inconcentration of 0,25%). Amino acids appearas separate spots colors. The TLC platesviewed ninhydrin solution, sensitive to lightwere scanned or photographed for thequalitative and quantitative evaluation of freeamino acids separated from each sample. Toidentify amino acids separated in samples wascalculated the retention factor (Rf) comparedwith each standard amino acid. Quantitativedetermination of free amino acids in thesamples was performed using image analysisprogram - ImageJ ver 1.46 r, and the valuesobtained were expressed in g free amino acidfor 1 mg fresh leaf tissue.The data obtained were processed statisticallyfor analysis of variance (ANOVA test) and hasbeen determined significance of differences forthe total free amino acids content and the ratiobetween the predominant amino acids (Studenttest). Analysis of variance and Student test wasperformed using the Microsoft Excel menuTools - Data Analysis.RESULTS AND DISCUSSIONS14 amino acids were identified. In Figure 1 and2 are presented TLC plates with amino acidsseparated and visualized with ninyidrin solutionfor the five cultivars studied. Standard aminoacids used: alanine (Ala) and histidine (His). In

Figure 3 is presented the amino acid profile inleaves (chromatogram) to the cultivars ofGalben de Odobeti sortogroup, with standardglutamic acid (Glu). The amino acid profile forthe variety Galben de Odobeti is presented infigure 4.Figure 1. TLC plate with amino acids separated andvisualized (St.– Ala)Figure 2. TLC plate with amino acids separated andvisualized (St.– His)Figure 3. Amino acid profile of leaves for the varietiesanalyzed (St. - Glu)165

Figure 4. Amino acid profile of the leaves to cultivars Galben de OdobetiThe results with the free amino acids content inleaves to the cultivars of Galben de Odobetisortogroup, expressed in g/mg fresh leaf tissueand percentage are summarized in Table 1. Thetotal content of free amino acids in leaves ofvine varieties of Galben de Odobetisortogroup varied between 18.76 g/mg freshleaf tissue in the variety Galben de Odobetiand 14.33 g/mg fresh leaf tissue to the cultivarNegru moale, with intermediate values for thecultivars Zghihar de Hui (14.54 g/mg), (cv)Btut neagr (15.20 g/ mg) and (cv) Negruvârtos (17.74 g/ mg). Aspartic acid (Asp) isfound in much higher amounts than otheramino acids identified, representing 31.7% oftotal amino acids identified to the cultivarNegru vârtos, 31.5% to the variety Zghihar deHui, 30.5% to (cv) Negru moale, 27.5% to(cv) Galben de Odobeti and 25.3% to thevariety Btut neagr.Table 1. Free amino acid content in the leaves at vine varieties of Galben de Odobeti sorto groupThe variety Galben de Odobeti Zghihar de Hui Batut neagr Negru moale Negru vârtosAmino acidg/mg % g/mg % g/mg % g/mg % g/mg %Aspartic acid (Asp) 5.15 27.5 4.58 31.5 3.84 25.3 4.37 30.5 5.62 31.7Glutamic acid (Glu) 2.04 10.9 1.37 9.4 2.17 14.3 1.30 9.1 2.06 11.6Serine (Ser) 2.21 11.8 1.73 11.9 1.82 12.0 1.65 11.5 2.06 11.6Threonine (Thr) 2.04 10.9 1.75 12.0 1.59 10.5 1.13 7.9 1.83 10.3Proline (Pro) 1.28 6.8 0.82 5.6 1.46 9.6 1.13 7.9 1.15 6.5Arginine (Arg) 0.99 5.3 0.71 4.9 0.87 5.7 0.88 6.1 1.26 7.1Glycine (Gly) 1.27 6.8 0.86 5.9 0.91 6.0 1.35 9.4 0.71 4.0Lysine (Lys) 0.93 5.0 0.72 5.0 0.81 5.3 0.76 5.3 0.81 4.6Alanine (Ala) 1.09 5.8 0.75 5.2 0.56 3.7 0.53 3.7 0.72 4.1Leucine (Leu) 0.81 4.3 0.69 4.7 0.49 3.2 0.45 3.1 0.50 2.8Histidine (His) 0.65 3.5 0.37 2.5 0.47 3.1 0.54 3.8 0.54 3.0Phenylalanine (Phe) 0.11 0.6 0.05 0.3 0.04 0.3 0.06 0.4 0.15 0.8Valine (Val) 0.13 0.7 0.07 0.5 0.09 0.6 0.11 0.8 0.20 1.1Methionine (Met) 0.06 0.3 0.07 0.5 0.08 0.5 0.07 0.5 0.13 0.7Amino acid content 18.76 100.0 14.54 100.0 15.20 100.0 14.33 100.0 17.74 100.0166

The most abundant of the free amino acids inleaves were:- to the variety Galben de Odobeti: asparticacid (Asp), serine (Ser), threonine (Thr),glutamic acid (Glu), proline (Pro) andglycine (Gly), representing 74.7% of totalamino acids identified;- to the variety Zghihar de Hui: asparticacid (Asp), threonine (Thr), serine (Ser) andglutamic acid (Glu), representing 64.8% oftotal amino acids content;- to the variety Btut neagr: aspartic acid(Asp), glutamic acid (Glu), serine (Ser),threonine (Thr), and proline (Pro),representing 71.7% of the amino acidsidentified;- to the variety Negru moale: aspartic acid(Asp), glycine (Gly), serine (Ser), glutamicacid (Glu), threonine (Thr), and proline(Pro), representing 76.3% of total aminoacids content;- to the variety Negru vârtos: aspartic acid(Asp), glutamic acid (Glu), serine (Ser),threonine (Thr), arginine (Arg) and proline(Pro), represents 78.8% of total amino acidscontent;Statistical interpretation of data obtained ontotal amino acid content in leaves of vinevarieties belonging to Galben de Odobetisortogroup by analysis of variance/ANOVAtest shows that there is no statisticalsignificance between the five varieties, becausethe value of P is 0.938854, greater than thecritical value of P, 0.05.The ratio proline/arginine and the ratio ofpredominant amino acids (aspartic acid/serine)are considered parameters what remainconstant from year to year and differsignificantly from one variety/cultivar toanother and can be called descriptivebiochemical parameters. The ratio Pro/Arg hasvalues between 0.91 to the cultivar Negruvârtos and 1.68 for the cultivar Btut neagrand the ratio Asp / Ser ranges from 2.11 to thevariety Btut neagr and 2.73 to the varietyNegru vârtos (Table 2).Statistical interpretation of experimental dataobtained for the ratio Pro/Arg by analysis ofvariance/ANOVA test shows the existence of astatistical significance between the fivecultivars because P value is less than thecritical value of P, that is 0.05 (Table 3).Table 2. The values of biochemical descriptors for grapevine varieties to Galben de Odobeti sortogroupThe variety/Biochemical descriptorsGalben de Odobeti Zghihar de Hui Btut neagr Negru moale Negru vârtosPro/Arg ratio 1,29 1,15 1,68 1,28 0,91Asp/Ser ratio 2,33 2,65 2,11 2,65 2,73Table 3. The significance of differences to the ratio proline / arginine in the leaves of vine varieties to Galben deOdobeti sortogroupThe vine variety Galben de Odobeti Zghihar de Hui Btut neagr Negru moale Negru vârtosGalben de Odobeti 0 Zghihar de Hui 0.06542 0 Btut neagr 0.00051 0.00064 0 Negru moale 0.94536 0.06777 0.00093 0 Negru vrtos 0.01346 0.06722 0.00096 0.01368 0Statistical the ratio proline/arginine geneticallydifferentiates the variety Btut neagr theother varieties of Galben de Odobetisortogroup, with a confidence interval of 95%.A significant difference exists between thevariety Negru vârtos and the varieties Galbende Odobeti and Negru moale. Varianceanalisys/ANOVA test for the ratio predominantamino acids (aspartic acid/serine), statisticallydifferentiates the variety Btut neagr by theother varieties except the variety Galben deOdobeti with a confidence interval of 95%,while this difference is not significant for thevariety Galben de Odobeti (Table 4).167

Table 4. The significance of differences in the ratio aspartic acid / serine of leaf vine varieties of Galben de OdobetisortogroupThe vine variety Galben de Odobeti Zghihar de Hui Btut neagr Negru moale Negru vârtosGalben de Odobeti 0 Zghihar de Hui 0.11292 0 Btut neagr 0.23710 0.00732 0 Negru moale 0.08869 0.93531 0.00357 0 Negru vârtos 0.06510 0.44839 0.00510 0.39683 0CONCLUSIONSThe total free amino acids content in leavesvaries between 18.76 g/mg fresh leaf tissue tothe variety Galben de Odobeti and 14.33g/mg to the variety Negru moale, withintermediate values for the variety Negruvârtos (17.74 g/mg), (cv) Btut neagr(15.20 g/mg) and (cv) Zghihar de Hui(14.54 g/mg).The most abundant of the free amino acids inleaves of native varieties to Galben deOdobeti sortogroup are: Asp. Ser. Thr. Glu.Pro. Arg and Gly. Aspartic acid is found inlarge amounts compared with other aminoacids predominant.The ratio proline/arginine has differentiatedstatistically the variety Btut neagr by theother varieties of Galben de Odobetisortogroup with a confidence interval of 95%.Significant difference exists between thevarieties Galben de Odobeti and Negruvârtos and between the varieties Negru moaleand Negru vârtos.The ratio between predominant amino acids(aspartic acid/serine) has differentiatedgenetically the variety Btut neagr by theother varieties (except the variety Galben deOdobeti) with a confidence interval of 95%.There is significant difference between thevarieties Galben de Odobeti and Negruvârtos and between the varieties Negru moaleand Negru vârtos.The amino acid profile of leaves can be used asdiscriminant analysis method of vine varietiesto Galben de Odobeti sortogroup. with theother modern methods of investigation(isoenzyme analysis and DNA analysis).ACKNOWLEDGEMENTSThe authors are grateful Mr. Ass. Prof.Gheorge Stoian, Ph.D., in the Department ofBiochemistry and Molecular Biology,University of Bucharest, Faculty of Biology,for their help in working with TLC.REFERENCESBieleski R.L.. Turner N.A., 1966. Separation andestimation of amino acids in crude plant extracts bythin-layer electrophoresis andchromatography. Anal. Biochem., p. 278–293.Hernández-Orte P., Guitart Ana, Cacho J., 1999.Changes in the Concentration of Amino AcidsDuring the Ripening of Vitis vinifera TempranilloVariety from the Denomination d'Origine Somontano(Spain). Am. J. Enol. Vitic. 50:2, p. 144-154.Huang Z., Ough C. S., 1991. Amino Acid Profiles ofCommercial Grape Juices and Wines. Am. J. Enol.Vitic. 42:3, p. 261-267.Kliewer W.M., 1967. Annual cyclic changes in theconcentration of free aminoacids in grapevine. Am. J.Enol. Vitic. 18., p. 126–137.Shiraischi Mikio, 1996. Proposed BiochemicalDescriptors for Amino Acids to Evaluate GrapeGermoplasm, J. Japan. Soc. Hort. Sci. 65(2), p. 283-289.ârdea C., 2007. Chimia si analiza vinului, Ed. “IonIonescu de la Brad, p. 754-770.168

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653STUDIES UPON THE PHONOLOGY OF ROSIE DE ARIES ONION PLANTSFROM THE FIRST YEAR OF THE SEEDS PRODUCTION PROCESS ANDTHE MAIN CHARACTERISTICS OF THE PARENT PLANTS FROM 2007UNTIL 2009 YEARAbstractJanina-Claudia CPUAN, Elena TEFNESCU, Elena Liliana DUMITRACU,Minerva HEITZVegetable Research and Development Station Iernut, Str. Energeticianului 1A,Iernut, jud. Mures, RomaniaCorresponding author email: elenastef14@yahoo.comThe research was carried out in the period of 2007-2009 year, in the environmental conditions of SCDL Iernut. Thisspanned the duration of vegetation phases of plans from the experimental variants, since I st year-parent plant phase, inthree eras of sowing. The vegetation period of the parent plants (emergence- bulb maturity) was, as average on thisthree years of study, of: 125 days in the Ist age (1751 o C), 110 days in the II nd age (1821 o C) and 106 days in the IIIrdage (2130 o C). The studied characteristics were: weight of the bulb, the longitudinal diameter, the transversal diameter,the shape index and the height of the plant.Key words: phenological dates, important characteristics of the bulb.INTRODUCTIONThe area of origin and the spread of Alliumgenus on globe and also the phenotypicvariability of characteristics for adaptability tothe bulb to different environmental conditions.Through the process of improvement andselection, experts have created valuablevarieties and hybrids of onion.Knowledge of the specific requirements ofgrowth and development of each cultivardetermines the development of specificproduction technologies.This paper represents a sequence of study plantrequirements of Rosie de Iernut red onion forthe phases of growth and development in theenvironmental conditions of SCDL Iernut.MATERIALS AND METHODSThe investigations were carried out on threebiological cycles “from seed to seed”.The experiences were organized into fourrehearsals and three epochs (ages).The biological material used for the obtainingof the parent plants bulbs was made from theseed of the author, the Rosie de Iernut variety.Have been studied the vegetation phases andphenophases, having as main objective theduration of phenophases in correlation with theamount of accumulated temperature onphenophases and the influence of someimportant characteristics of the biologicalmaterial (bulbs – parent plants).During the periods of experience for producingthe bulbs-parent plant (I st year) have beencarried out specific maintenance work. Havebeen carried out observations and biometricmeasurements for the selection of biologicalmaterial, where were made also the biologicalpurification as special works in production ofthe biological material for the multiplication ofa cultivar.In the laboratory, after harvesting the bulbshave made observations and biometricalmeasurements for choice, selection ofbiological material typical for the variety. Thebiometric calculations were establishedselection parameters using confidence intervalsof the varietal characteristics of the variety,thus eliminating ± the variants.RESULTS AND DISCUSSIONSThe important stages of the experiences ofproducing bulbs were: sowing, emergence,commencement of the bulb (figure 1), thedeeply bulb formation and bulb harvesting.169

The studied phenophases (table 1), as duration(table 2, figure 2) and the sum of the degrees oftemperature on phenophases (table 2, figure 3),accounted the periods between phases and thelength of the growing season was representedby the period between plant emergence andplant harvesting.Table 2. The length of phenophases and the amount ofaccumulated temperature degrees/phenophase, on sowingagesI st age II nd age III rd agePhenophase Period C Period C Period(Days) (Days) (Days)o CSowing-emergence 25 141 15 112 10 171Emergence-bulbformation47 527 37 543 32 585Bulb formationmaturityconsumer62 880 58 982 60 1262Maturity consumerharvesting16 344 15 296 14 283Sowing-harvesting 150 1892 125 1933 116 2301Figure 1. Rosie de Aries varietyTable 1. The vegetation phenophases of the motherplants of Rosie de Aries onion variety, on sowing ages–the average on 3 yearsPhenophaseSowing-emergenceEmergence-bulbformationBulb formation-maturityconsumerMaturity consumerharvestingVegetation periodI st age26.03-20.0420.04-10.0610.06-10.0810.08-23.0826.03-23.08PeriodII nd age III rd age15.04- 01.05-29.04 10.0529.04- 10.05-05.06 11.0605.06- 11.06-02.08 10.0802.08- 10.08-17.08 24.0815.04- 01.05-17.08 24.08The plant emergence had after: 25 days(141°C) during the I st age, 15 days (112°C)during the II nd age and after 10 days (171°C)during the III rd age.The commencement of the bulb formation hadbeen manifested from the emergence asfollows: 47 days (527°C) during the I st age, 37days (543 o C) during II nd age and after 32 days(585°C) in the III rd age.The maturity consumer, the average on threeyears, was recorded in approximately 62 days(880°C) in the I st age, 58 days (982°C) duringII nd age and after 60 days (1262 o C) in the III rdage, from the commencement of the bulb.170Figure 2. The length of phenophases/ages of sowing tothe Rosie de Aries onion variety, the average on 3 years-SCDL IernutFigure 3. The amount of temperature degrees onphenophases and ages of sowing, the average on 3 years-SCDL IernutThe harvesting of the bulbs was carried outafter an average of 16 days (344°C) during theI st age, 15 days (296°C) during the II nd age andafter 14 days (283°C) in the third age, from thebulbs maturation.During the growing season, the three-yearaverage, it took 125 days (1751 o C) in the I stage, 110 days (1821 o C) during the II nd age andafter 106 days (2130 o C) in the III rd age.The average of accumulated temperature’degrees (°C) /day regarding the phenophasesgrowth and the mother plants development ofRosie de Aries variety on seeding ages wasmanifested by increasing from the first age

until the second one and the greatest valueswere recorded during the III rd age (table 3,figure 3).Table 3. The average of accumulated temperaturedegrees (°C) /day to the phenophases growth and themother plant development of Rosie de Aries, the averageon 3 years – SCDL IernutFigure 4. The°C average daily accumulated/phenophasesand ages to Rosie de Aries variety, the average on 3years – SCDL Iernut(ages), each of these characteristics were thesame variability in all eras: the weight of thebulb has great variability in all eras, shapeindex recorded medium variability in all agesand the height of the plant has small variabilityin all ages (table 4).Table 4. Variability indexes of the onion parent plant, theaverage (2007-2009), SCDL IernutI st II nd III rdPhenophaseage age ageMeanSowing-Emergence 5,64 7,46 17,1 10,06Emergence-Bulb formation 11,21 14,67 18,28 14,72Bulb formation-Matureconsumer14,19 16,93 21,03 17,38Mature consumer-Harvesting21,5 19,73 20,21 20,48Vegetation period 11,68 15,46 19,83 15,66Variability indexes VariaCharacteristicx med s 2 s s % k bilityI st ageThe weight of the54-64,2 104,0410,2 25 Highbulb (g)74,4Form indexes 0,88 0,014 0,12 18,5 0,76-1,00 MediumHeight of parentplant (cm)The weight of thebulb (g)56,8 7,84 2,8 8,4II nd age54-59,652,46345,96 18,6 30,08 33,8-71SmallHighForm indexes 0,78 0,02 0,14 10,0 0,6-0,9 MediumHeight of parent56,12 11,62 3,4112,65 52,7- Smallplant (cm)59,5The weight of thebulb (g)III rd age46 237,16 15,4 30,6 30,6-61,4HighForm indexes 0,62 0,01 0,12 17,4 0,50-0,74 MediumHeight of parentplant (cm)48,2 12,96 3,6 9,2 44,6-51,8SmallThe quantitative characteristics of onion bulbswere influenced by the temperature conditionsduring the growing season. There have beenvalue differences between ages, in particularconcerning the weight of bulb, bulb size(longitudinal diameter – ØL, transversaldiameter – ØTr), and form index-IF.In the I st age (table 4), the bulbs of the parentplant have been characterized through: theaverage weight of the bulb of 64.2 g, the indexform (IF) - 0.88 and the plant height-56.8 cm.In the II nd age (table 4), the bulbs of the parentplant have been characterized through: theaverage weight of 52,46 g, index form (IF) –0.78 and the height of the plant – 56,12 cm.In the III rd age (table 4), the bulbs of the parentplant have been characterized through: theaverage weight of the bulb-46 g, the index form(IF) - 0.62, the height of the plant – 48.2 cm.Although the features: average weight of thebulb, the bulb-shaped index and the height ofthe plant have different values in different eras171CONCLUSIONSDuring the phenophases - “sowing-emergence”and “emergence-bulb formation”-decreased thenumber of days since the I st epoch to the III rdage.The phenophases - 'the beginning of the bulbformation-the maturity consumption' and 'thematurity consumption-harvesting' have almostthe same period of days for all three ages.The longest vegetative period was recorded inthe Ist age and the shortest in the III rd age.The average weight of the bulb decreases fromthe I st age to the III rd age, but records highvariability in all ages.The shape index tends to be almost unitary tothe I st age dropping to the III rd age, recordingmiddle variability to all ages.The leaves’ rosette of the plants recorded thelargest height to the I st age and dropping downuntil the III rd age.

REFERENCESCapusan Janina, 2013. Rezultate pariale privindinfluena unor factori agrotehnologici asupraproduciei cantitative i calitative la cultura de ceapsemincer Roie de Arie, USAMV-Cluj Napoca, c.doctoral, Facultatea de Horticultur (referat).172

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653BIODIVERSITY OF AUCHENORRHYNCHA INSECTS IN A PEARORCHARD FROM SOUTH-EAST OF ROMANIAIuliu CEAN 1 , Mirela CEAN 21 University of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Mrti Blvd., 011464, Bucharest, Romania2 Central Phytosanitary Laboratory, 11 Blvd. Voluntari, Ilfov, 077190, Bucharest, RomaniaAbstractCorresponding author email: iuliucean@yahoo.comThe aim of the study was detection and identification of existing planthopper, leafhopper and cixiid fauna in the pearorchard of University of Agronomic Sciences and Veterinary Medicine of Bucharest. Studied biological material consistof adult stage has been obtained from yellow and white sticky traps which were placed in host plant canopy. Theidentification of the collected material has been carried in the Entomology Laboratory of Central PhytosanitaryLaboratory. Based on morphological characters were identified following species: Metcalfa pruinosa (Say, 1830)(Flatidae), Reptalus panzeri (Low, 1883) (Cixiidae), Fieberiella florii (Stal1864), Psammotettix notatus (Melichar1896), Zyginidia pullula (Boheman 1845), Neoaliturus fenestratus Herrich-Schäfer 1834 (Cicadellidae). Photos withmale genitalia details are provided.Key words: Flatidae, Cixiidae, Cicadellidae, morphological identification.INTRODUCTIONPlanthopper, leafhopper and other relatedspecies are pests of cultivated plants and can bealso vectors of different plant diseases.The aim of the study was focused on thebiodiversity of Auchenorrhynchaspecies (planthopper and leafhopper)assemblages of pear orchard in 2012 to identifypossible vectors of specific disease on host.MATERIALS AND METHODSSurvey was carried in a modern eight year oldpear orchard planted with the cultivars AbbéFétel, Red Williams, Conference, Beurre Bosc,Alexander Lucas, Clapp’s Favorite. Plantingdistance was 2 m within the row and 4 mbetween the rows. One sampling method wasapplied using sticky traps placed in tree’scanopy using one trap/15-20 tree. The stickytraps (yellow and white), sticky on one sidewere 25X20 cm size. Traps were hanged intothe middle part of the canopy during thevegetation period. Regular checks andreplacements of the traps were done forfaunistical survey.Accurate species identification requiresexamination of the structures of the male173genitalia. Identification of the males to speciesrequires removing the abdomen then placing ina 10% KOH solution for 12-24 h at roomtemperature. To examine genitalia remove theabdomen from KOH place it in a Petri dishfilled with water for few minutes, then place itin a drop of glycerin to study. For microscopicobservation a drop of glycerin was put on aslide on which dissection of the aedeagus wasperformed.Identification were made to the genus andspecies level according to (Ribauld 1952),(Delia Giustina 1989), (Holzinger, 2003), (LeQuesne 1960).RESULTS AND DISCUSSIONSAs a result of our investigation altogether 265individuals have been found in pear orchardbelonging to 3 Auchenorryncha families,namely Flatidae, Cixiidae and Cicadellidae(figure 1).During the sampling period extending fromMay to October presence of 6 species wasestablished. Metcalfa pruinosa (Say, 1830)from Flatidae family, Reptalus panzeri (Low,1883) from Cixiidae family, Fieberiella florii(Stal 1864) , Psammotettix notatus (Melichar1896), Zyginidia pullula (Boheman 1845),

Neoaliturus fenestratus Herrich-Schäfer 1834from Cicadellidae family.Figure 1. The structure of Auchenorrhyncha family in2012The most common species collected in thisarea, was Neoaliturus fenestratus 41individuals, representing 15% of total recordspecies, followed by Fieberiella florii andZyginidia pullula species which were alsopresent in large number in samples, 11% in firstcase and 12% in second (table 1) of total recordspecies. The other recorded species werepresent with less frequency. Also, some specieshave remained unidentified.Table 1. Identified Cicadellidae species and their densityCicadellidae species No of AbundanceNoidentifiedindiv. (%)1. Fieberiella 30 112. Neoaliturus 41 153. Zyginidia 32 124. Psammotettix 8 3 Total 111 We present below some information onidentified Auchenorrhyncha in the monitoredarea about their biology and few morphologicalcharacters useful for their identification.Metcalfa pruinosa is an insect with onegeneration per year and is very polyphagous.Adults are present between July and October.This species overwinters in eggs stage, the eggsare inserted into the bark of host plants. Theyare 5.5 to 8 mm in length have broadlytriangular front wings that are held close to thebody in a vertical position. The color of adultsis brown to gray, due to the presence orabsence of a bluish white waxy powder.Forewings in the basal half have a pair of dark174spots. It is an invasive species quite new forEurope, (introduced in Italy in 1970) and alsofor our fauna. Has been recorded in Romania inConstanta region in 2009 for first time (Predaet al., 2009), then in western part of the countryin 2010 (Gogan et al., 2010) and also inBucharest area in 2011 (Chireceanu et al.,2011).Genitalia: Male pygofer and subgenital platesnot differentiated from ringlike segment IX;anal tube short, with elongate tongue likeprocess (grooved on midline) above lowerangle; styles held vertically, in ventral aspectslender, slightly divergent near tips, in lateralaspect broadening towards tips, bearingrecurved hook beyond tip of aedeagus, setose,articulated against undifferentiated sternite IX;connective linear; aedeagus curved dorsal,parallel-margined to truncate tip bearing twopairs of processes directed forward (CABI,2013) (Annex I, figures 1A, 1B).Reptalus panzeri, polyphagous, hasone generation per year and larva overwinter.Adults polyphagouus and lives in the shrubsand herb layer. Imagoes are active from midJune till beginning of August. This insect canbe vector diseases. It is believed that nymphs,like those of other Cixiids, are root feedersAdult has vertex much broader than long. Eyesusually grayish, sometimes marginated reddish.Overall length: 4.6-5.2 (male) and 5.7-6.8 mm(female) (Le Quesne, 1960). First segment ofhind tarsus apically without platellae(Holzinger et al., 2003).Genitalia: Styles symmetrical (Holzinger et al.,2003), male anal tube produced laterally intosharp angles posteriorly; projection ofparameres long; sclerotized projections at lowermargin of genital segment pointed apically (LeQuesne, 1960) (Annex I, figures 2A, 2B).Neoaliturus fenestratus Body small, slender,general coloration of the body deep browalmost black with red tinge; total length of themale and female 3.9 to 4.5 mm; Forewingsdeep brown, apical third with irregularlyshaped and sized whitish patches.Genitalia: aedeagus oval narrowing at bothends, with tips biforked, the connective at thebase of aedegus biforked posteriorly; genitalplate triangular; its outer lateral margin with arow of identical spines (Al-Asady et al., 2003)(Annex I, figures 3A., 3B.).

Fieberiella florii is a polyphagous speciesliving on woody plants. Has one generation ayear and on woody plants and overwinter instage of egg. Imagoes emerge from thebeginning of June till end of October.Length 6.5-7mm male and 7-7.5 mm female.Round vertex, wings and body covered withdark punctuation.Genitalia: Pygofer in lateral aspect about 1%times as long as wide; aedeagus in lateralaspect broad medially, shaft curved laterally,tube like and narrow, shaft with numerousminute spines; style short in dorsal aspectsimple, with distal half curved laterally;connective large (Ribaut, 1952) (Annex II,figures 4A., 4B.)Ziginidia pullula small species overall length2.2-2.6 mm male and 2,6-3.0 mm female. Thegeneral color is dark grey-yellowish. It is amultivoltine species, able to produce up to fourgenerations a year in some area of the Europe.Genitalia: the anal tube has a pair of appendixdeveloped and sinuous; sides of male genitalsegment with Y-shaped lobe internally;aedeagus with two appendages long and thinwhich are very difficult to observe in lateralposition (Delia Giustina, 1989) (Annex II.figures 6A., 6B.)Psammotettix notatus:Small, linear species. Length overall over 3 mmfor male and female. Head much larger thanpronotum. The general color of pronotum andfore wings very pigmented. Fore wingsdeveloped, rounded symmetrical covers thebody entirely.Genitalia: Genital sternit in trapezoidal form;basal part of the aedegus simple, withoutannexes; aedeagus in lateral aspect round orless sharp; shaft tubelike and those two arms ofshaft like U or V; style in dorsal aspect shorterthan connective and apex curved laterally;connective very long, free; gonopore onventral surface, near apex, bifid apically inventral aspect (Ribaut, 1952) (Annex II. figures5A., 5B.)CONCLUSIONSThe Fulgoromorpha and Cicadomorphaconstitute an important part of the trophicnetwork of land ecosystem.Because some of the identified genera likeFieberiella, Psammotettix and Neoaliturus havebeen reported to transmit phytoplasmas to fruittrees (Fos et al., 1986), (Jensen, 1957),(Narayanasamy, 2011) it is important tomonitor their presence in orchard in order toestablish their role in propagation of thedisease.All planthopper, leafhopper and cixiid speciesidentified in the orchard were recordedpreviousin the country (Boguleanu, 1994), (Chireceanuet al., 2011), (Gogan et al., 2010), (Preda et al.,2009) but we must underline the presence ofthe exotic pest Metcalfa pruinosa in themonitored area. It is not very clear if thisspecies can be a vector disease but its presenceon host plants and ability to establish in newareas must be take in account. Followingspecies haven’t been recorded in Bucharest areaby Boguleanu (1994) : Reptalus panzeri,Fieberiella florii, Psammotettix notatus andZyginidia pullula, so we can record here thesespecies as result as our work.ACKNOWLEDGEMENTSThis work was carried out with the support ofCentral Phytosanitary Laboratory and financedby POSDRU/CPP 107/DMI 1.5/S/76888Project. I would like to thank Mrs. Ping-pingChen, specialist at Plant Protection Service,Netherlands, for confirmation of the pests andalso for identification of Psammotettix notatus(Melichar 1896) species.REFERENCESAl-Asady H. S., Al-Gailany H. B. D., 2003. Externalmorhological study of the leafhopper Neoaliturisfenestratus Herrich-Schaeffer 1964 (Homoptera:Cicadellidae) from Iraq. Bull. Iraq nat. Hist. Mus. 10(1), p. 1-5.Boguleanu Gh. Gh., 1994. Fauna daunatoare culturiloragricole si forestiere din Romania.Vol II. Ed. TehnicaAgricola.CABI. 2013. Invasive species compendium. Wallingford,UK: CAB International. www.cabi.org/isc.Chireceanu C., Gutue C., 2011. Metcalfa pruinosa (Say)(Hemiptera: Flatidae) identified in a new southeastern area of Romania (Bucharest area).Delia Giustina W., 1989. Homoptères Cicadellidae III.Compléments aux ouvrages d' Henri Ribaut. FaunedeFrance 73. Paris: INRA.Gogan A., Grozea I., Virteiu A. M., 2010. Metcalfapruinosa Say (Insecta:Homoptera: Flatidae)-first175

occurrence in western part of Romania. ResearchJournal of Agricultural Science. 42 (4), p. 63-67.Fos A., Bové J. M., Lallemand J., Saillard C., Vignault J.C., Ali Y., Brun P., Vogel R., 1986. La cicadelleNeoaliturus haematoceps (Mulsant et Rey) et vecteurde Spiroplasma citri en Mediterranée. Annales del’Institut Pasteur Microbiologie. 137A, p. 97–107.Jensen D.D., 1957. Transmission of peach leaf roll virusby Fieberiella florii (Stal) and a new vector,Osbornellus borealis Delong & Mohr. Journal ofEconomic Entomology. 50, p. 668–672.Holzinger W. E., Kammerlander I., Nickel H., 2003. TheAuchenorrhyncha of Central Europe. Die ZikadenMittleleuropas. Vol.1. Fulgoromorpha.Cicadomorpha excl. Cicadellidae. Brill.Narayanasamy P., 2011. Microbial Plant pathogensdetectionand disease diagnosis. Bacterial andPhytoplasmal Pathogens. Vol.2. Springer.Le Quesne W. J., 1960. Handbooks for the Identificationof British Insects. Hemiptera Fulgoromorpha. RoyalSociety of London. Vol. II Part 3.Preda C., Skolka M., 2009. First record of a new alieninvasive species in Constanta-Metcalfa pruinosa(Homoptera: Fulgoroidea). In: Paltineanu C. (Ed.)Lucrarile Simpozionului Mediul si Agricultura inregiunile aride: prima editie. Estfalia, p.141-146.Ribaut H., 1952. Homoptères Auchenorrhynques II(Jassidae). Faune de France. P. Lechevalier et fls.Figure 2. Annex I: figure 1A. Metcalfa pruinosa(genitalia), 1B. (aedeagus); figure 2A. Reptalus panzeri(genitalia complex), 2B. (aedeagus); figure 3A.Neoaliturus fenestratus (aedeagus with connective), 3B.(aedeagus in dorsal view).Figure 3. Annex II: figure 4A Fieberiella florii(genitalia), 4 B (connective); figure 5A Psammotettixnotatus (aedeagus), 5 B (connective); Figure 6AZyginidia pullula (genitalia complex in lateral view), 6B(aedeagus in lateral position).176

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653SSR ANALYSIS CONCERNING THE RESISTANCE TO PPV(Plum pox virus) IN SEVERAL ROMANIAN APRICOT PROGENIESFrgua CIOMAGA 1 , Ligia ION 1 , Cristina MOALE 21 University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59, Marasti Blvd,011464, Bucharest, Romania2 Research Station for Fruit Growing Constanta, Constanta, RomaniaAbstractCorresponding author email: ionnagyligia@yahoo.frPlum pox virus (PPV) is a devastating stone fruit disease of major importance, and better understanding of the geneticcontrol of resistance to this trait would be useful for more efficient development of resistant cultivars. Previous studieshave reported a locus major effect from PPV resistance on linkage group 1. The hybrids were grafted simultaneouslyand subsequently inoculated with the PPV-M and D strains. The symptom scoring on leaves was performed three timesover two vegetative cycles. The PPV resistant loci were mapped using composite interval mapping (CIM).This paperpresents data from PhD thesis part of the project POSDRU/107/1.5/S/76888, funded by European Social Fund throughthe Sectorial Operational Programme Human Resources Development 2007-2013.Key words: disease, markers, Prunus armeniaca, PPV, SSR, Sharka.INTRODUCTIONPlum pox virus (PPV) infection causes theSharka disease of Prunus, has spread from theBalkan countries throughout most of theEuropean subcontinent and around theMediterranean basin.Considerable economic loss and significantreduction in productive areas stimulatedbreeding programs aimed at enhancingresistance to the pathogen in such countries asGreece (Karayiannis et all., 2002), France(Audergon et all., 1994), Italy (Bassi et all.,1995), Spain (Egea et all., 1999) and the CzechRepublic (Polak, 1994).As a result of the intensive search for a sourceof resistance within available apricotgermplasm, some North American cultivars‘Stark Early Orange’ (SEO), ‘Goldrich’,‘Harlayne’, ‘NJA 45’, and others were found tohave natural resistance to PPV (Martinez-Gomez eta ll., 2000). These cultivars were usedas donors for a resistance trait in conventionalbreeding programs based on crosses betweenresistant and the best local cultivars susceptibleto virus.Recently, resistant selections have beenreleased for regional trials (Badenes and Llacer,2006; Dosba et all., 1992; Karayiannis et all,1999; Polak et all., 1997)177Several studies suggest that the resistance isconferred by a limited number (1–3) of genes(Dicenta et all., 2000; Dosba et all., 1992;Krska B et all., 2002; Karayiannis et all., 2007).Development of molecular marker maps forsegregating crosses is a significantaccomplishment toward understanding thegenetics of PPV resistance and developingmarkers that could potentially be useful inbreeding programs. Four molecular geneticmaps based on intraspecific crosses introducingPPV resistance from North American cultivars‘Stark Early Orange’ and ‘Goldrich’ have beenestablished to map a PPV resistance inapricot (Lambert et all., 2007; Sicard et all.,2007). On these maps, a major genomic regionassociated with PPV resistance was located onthe Prunus G1 at a distance of 20–40 cm. Intotal, five SSR markers linked to the targetedresistance locus were identified in this region.Three of them have been already successfullytested for marker assisted selection (MAS) in aset of susceptible/resistant cultivars.MATERIALS AND METHODSPlant materialWe are worked with 5 apricot population:

Pop 3 = Population 3 obtained by crossesbetween (‘Mari de Cenad, x,NJA 21’) x ‘KesthPshor’Pop 2 = Population 2 obtained by crosses‘Sirena’ x ‘NJA 42’Pop 4 = Population 4 obtained by crosses‘Cristal’ x ‚NJA 21’Pop 1 = Population 1 obtained by crosses ‘Maride Cenad’ x ‚SEO’Pop 5 = population 5 obtained by crossesbetween (‘Viceroy’, x,NJA 2’) x ‘NJA17’The apricot selection R9 P 53 (‘NJA 2’×‘Viceroy’) was crossed as a female parent to‘NJA 17’ a PPV resistant apricot cultivar.Theselection R13 VT 8/57 resistant to PPV (issuedfrom ‘Mari de Cenad x NJA 21) was crossed asa female parent to ‘Kesth Pshor’ (susceptible toPPV) in the frame of the Faculty ofHorticulture of University of AgronomicSciences and Veterinary Medicine of BucharestRomania in 2008. Crosses were performed byhand pollination with isolation of flowers afterthe petals and anthers removal from the flowerbuds. The F1 seeds were stratified at 5 o C for 3months and subsequent seedlings were grownin an insect-proof greenhouse.The young apricot populations sticks weregrafted onto inoculated GF305 (used likesusceptible rootstock) ready for testing to PPVresistance.DNA extractionGenomic DNA was extracted using themodified CTAB procedure [23]. DNAconcentrations were measured and workingsolutions of genomic DNA at 10 ng/μl and at100 ng/μl in 0.1× TE (0.01M Tris pH 8.0, 0,001M EDTA) buffer was prepared for the targetedSSR and AFLP analyses, respectively.SSR analysis‘Stark Early Orange’, ‘R13 VT 8/57’ NJA andR9 P 53 were screened with 3 SSR primercombinations from [2], associated withPPVresistance.PGS 1.21, PGS 1-24 and ppb22-195-F:CTCTTCTCGCCTCCCAATTT andR:GCTTAGCCCTGGGTACAAG andF:ATCTGCTCTTTCCCTCACCT withR:GATTATCCCTCAACCCATCC.PCR reactions, electrophoresis, and detectionof PCR products for the ‘Kesth Pshor’ × R13VT 8/57’ population were carried out accordingto conditions specified in (Zhebentyayeva etall., 2002). SSR primer combinations revealingpolymorphism were screened all apricotpopulations. The mix PCR consit in 10Xbuffer-2ul, MgCl2 (25 mM)-1.2 ul, dNTP 10mM – 0.16 ul, PGS 1.21-F – 0.6ul, PGS 1.21-R– 0.6 ul, PGS 1.24-F – 0.4 ul, PGS1.24-R – 0.4ul, ppb22-195-F-0.28 ul,ppb22-195-R – 0.28uland Taq 0.1 ul. A 2-μl aliquot of the PCRreaction was separated by electrophoresis on anagarose gel 2% in order to confirm theamplification of fragments of the expected sizeand DNA concentration. (Figure 1.).The PCR-products were diluted (45 ul H2O and5 ul DNA) and used to prepare the plate forsequencing.RESULTS AND DISCUSSIONSAll four SSR primer combinations amplifiedexpected size fragments in germoplasm understudy. SSR scores for genotypes are included insupporting documentation, Table 1. For all SSRloci, we recorded genotypes in order of theirelectrophoretic mobility from fastest to slowestband.The infection process was different for variousplant individuals; in some plants the presenceof PPV was detected after the first dormancyperiod, in some in the three vegetative cycles,while some plants were not infected at all.Selections ‘Kesth Pshor’ × ’R13 VT 8/57’ and’R9 P 53’ were screened with 3 SSR primercombinations. The products of PCR wereseparated by electrophoresis on an agarose gel2% in order to confirm the amplification offragments of the expected size and DNAconcentration. (Figure 1)Figure 1. Electrophoresis for PCR with SSR markers inapricot progeniesThese SSRs were polymorphic. This presenceof polymorphism is slightly higher than thatpreviously reported by Hurtado et al. (2002)178

and Vilanova et al. (2003a; 46% and 42%,respectively) in apricot. Additionally, the SSRs,(PGS1_24)-F:CTCTTCTCGCCTCCCAATTTwith R:GCTTAGCCCTGGGTACAAG andF:ATCTGCTCTTTCCCTCACCT withR:GATTATCCCTCAACCCATCC weresignificant for the first screening in a lagerpopulation and may be useful for starting aMAS in breeding for PPV resistance. Furtherevaluation of these loci will be necessary tocharacterize the genetic control of the PPVresistance trait. Due to the co-dominant natureof SSRs along with their high genetictransportability, the development of SSRsassociated with PPV resistance in apricot couldfacilitate the use of MAS in breeding strategiesaimed at breeding for natural resistance.Table 1. Results concerning the implement of markersPGS 1,24 and Ppb0022-195 in Romanian progenies.GénotypePpb0022-195 MapdistancecMPpb0022-195Mapdist..cMPGS124Mapdist.cMPGS124Mapdist.cMKesthPhor 112.01 129.53 Viceroy 111.96 100.93 H2+ 107 116.4 98.93 102.9MariCenad 111.98 100.92 NJA 17 107.01 112.01 98.9 100.91Cristal 111.84 100.78 102.73Sirena 111.81 100.78 127.76Tabriz 112.01 100.88 SEO 107.11 111.97 98.9 100.91Pop3-37 111.9 100.79 Pop3-38 111.83 129.42 Pop3-42 111.9 102.73 129.43Pop3-49 111.93 129.42 Pop3-64 107.05 111.98 98.89 100.92Pop3-65 112 129.62 Pop3-68 107.13 98.88 102.93Pop3-71 Pop3-73 107.08 98.94 Pop3-74 107.12 112.03 98.96 127.93Pop3-76 107.1 112.04 98.94 129.24Pop3-77 106.97 98.76 Pop3-78 111.91 100.81 Pop3-79 106.94 111.91 98.81 102.76Pop3-80 106.97 111.92 98.78 100.83Pop3-81 111.9 100.77 Pop1-20 107.08 112 98.94 100.96Pop1-21 111.88 102.75 129.09Pop1-22 111.89 129.18 Pop1-55 106.96 111.86 98.8 127.76Pop1-72 106.98 11.87 9875 137.97Pop2-106 107.01 111.91 102.81 106.46Pop2-14 107.03 11.87 98.74 100.78Pop2-17 11.92 102.85 Pop2-43 11.93 100.89 102.89Pop2-47 107.06 111.99 100.87 106.51Pop2-66 111.91 101.81 102.78Pop2-63 111.97 100.85 102.83Pop2-69 107 106.37 Pop2-70 111.92 100.81 102.74Pop2-82 111.84 100.75 Pop4-104 111.92 102.9 129.28Pop4-19 107.03 111.95 98.88 129.3Pop4-45 107.07 111.92 98.83 129.22Pop4-46 107.12 111.98 98.94 129.32Pop4-48 107.91 98.75 Pop4-54 106.97 111.91 98.74 129.11pop4-59 106.94 111.87 98.74 129.13pop5.51 112.3 100.97 Pop5-52 112.4 100.95 pop5-53 107.1 112.01 98.86 100.94Pop 1 = Population 1 obtained by crosses ‘Mari de Cenadx SEO’Pop 2 = Population 2 obtained by crosses ‘Sirena x NJA42’Pop 3 = Population 3 obtained by crosses between (‘Maride Cenad, x,NJA 17’) x ‘Kesth Pshor’Pop 4 = Population 4 obtained by crosses ‘Cristal x NJA21’Pop 5 = population 5 obtained by crosses between(‘Viceroy’, x,NJA 2’) x ‘NJA17’For the marker ‘Ppb0022-195’ the region withresistance is situate between 107 / 112 (Tab. 1)The success of markers detection of PPV wasconfirmed to depend on the quality andquantity of isolated DNA during theexperiments and (Guilford et all., 1997) applieda similar method of isolation in CTAB buffer.CONCLUSIONSTargeted SSR analysis is a very direct way tolink the molecular markers to a trait of interest.SSR markers developed for specific genomeregions have been used to identify genes ofagronomic importance for evidence of selectionduring domestication in maize (Vigouroux etall., 2002) and to verify wheat–barleyintrogression (Hernandez et all, 2002). Theyare the most likely candidates for MAS in cropsof economical importance and appear to besuitable for apricot as well (Ribaut andHoisington, 1998; Badenes and Llacer, 2006).The identifying of a natural source of resistanceto PPV, using this resistant source into newcrosses with Romanian commercial cultivars179

well adapted in our country, and the implementof marker-assisted selection (MAS), based onmarkers tightly associated with resistance, as ameasure to substantially streamline thebreeding process, may be a promising strategyto obtain apricot varieties with natural geneticresistance to PPV.First couple of markers PGS 1.21 (Reverse andForward) could be enough for the screening ofa larger population of apricot and then start todevelop the others SSRs associated with PPVresistance to facilitate the use of MAS inRomanian apricot breeding programACKNOWLEDGEMENTSThis paper presents data from PhD thesis partof the project POSDRU/107/1.5/S/76888,funded by European Social Fund through theSectorial Operational Programme HumanResources Development 2007-2013.REFERENCESAudergon J-M., Dosba F., Karayiannis I., Dicenta F.,1994. Amélioration de l’abricotier pour la résistanceá la sharka. EPPO Bul 24, p. 741–748.Aranzana M., Pineda A., Cosson P., Dirlewanger E.,Ascasibar J., Cipriani G., Ryder C., Testolin R.,Abbott A., King G., Iezzoni A., Arús P., 2003. A setof simple-sequence repeat (SSR) markers coveringthe Prunus genome. Theor Appl Genet 106, p. 819–825.Badenes M.L., Llácer G., 2006. Breeding for resistance:breeding for Plum pox virus resistant apricots(Prunus armeniaca L.) in Spain. BulletinOEPP/EPPO Bulletin 36, p. 323–326.Bassi D., Bellini E., Guerriero R., Monastra F., PennoneF., 1995. Apricot breeding in Italy. ActaHorticulturae 384, p. 47–54.Dicenta F., Martinez-Gómez P., Burgos L., Egea J.,2000. Inheritance of resistance to plum potyvirus(PPV) in apricot, Prunus armeniaca. Plant Breeding119, p. 161–164.Dosba F., Orliac S., Dutrannoy F., Maison P., MassonieG., Audergon J-M., 1992. Evaluation of resistance toplum pox virus in apricot trees. Acta Horticulturae309, p. 211–220Egea J., Burgos L., Martínez-Gómez P., Dicenta F.,1999. Apricot breeding for sharka resistance at theCEBAS-CSIC, Murcia (Spain). Acta Horticulturae488, p. 153–157.Guilford P., Prakash S., Zhu J.M., Rikkerink E., GardinerS., Bassett H., Forster R., 1997. Microsatellites inMalus×domestica (apple): abundance, polymorphismand cultivar identification. Theor. Appl. Genet., 94,p. 249–254.Hernández P., Dorado G., Cabrera A., Laurie D.A.,Snape J.W., Martín A., 2002. Rapid verification ofwheat-Hordeum introgression by direct staining ofSCARS, STS, and SSR amplicons. Genome 45, p.198–203.Hurtado M.A., Romero C., Vilanova S., Abbott A.G.,Llacer G., Badenes M.L., 2002. Genetic linkage mapof two apricot cultivars (Prunus armeniaca L.) andmapping of PPV (sharka) resistance. Theor ApplGenet 105, p. 182–192.Karayiannis I., Mainou A., Tsaftaris A., 1999. Apricotbreeding in Greece for fruit quality and resistance toplum pox virus. Acta Horticulturae 488, p. 111–117.Karayiannis I., Thomidis T., Tsaftaris A., 2007.Inheritance of resistance to Plum pox virus in apricot(Prunus armeniaca L.). Tree Genetics & GenomesDOI 10.1007/s11295-007-0095-z.Krška B., Salava J., Polák J., Komínek P., 2002.Inheritance of resistance to plum pox virus in apricot.Plant Protection Sci 38, p. 180–182.Krška B., Vachun Z., Necas T., 2005. The apricotbreeding program at the Horticulture faculty inLednice. Acta Horticulturae 717, p. 145– 148.Lambert P., Dicenta F., Rubio M., Audergon J.M., 2007.QTL analysis of resistance to sharka disease in theapricot (Prunus armeniaca L.) ‘Polonais’ x ‘StarkEarly Orange’ F1 progeny. Tree Genetics & Genomes3, p. 299–309.Martinez-Gomez P., Dicente F., Audergon J-M., 2000.Behavior of apricot (Prunus armeniaca L.) cultivarsin the presence of sharka (plum pox potyvirus) : Areview. Agronomie-Paris 20, p. 407–422.Polák J., 1994. Breeding to resistance to plum poxpotyvirus in the Czech Republic. EPPO Bul 24, p.781–782.Polák J., Oukropec I., Komínek P., Krška B., BittóovaM., 1997. Detection and evaluation of resistance ofapricots and peaches to plum pox virus. J Plant DisProtection 104, p. 466–473.Ribaut J.M., Hoisington D., 1998. Marker-assistedselection: new tools and strategies. Trends Plant Sci3, p. 236–239Sicard O., Marandel G., Soriano J.M., Lalli D.A.,Lambert P., Salava J., Badenes M., Abbott A.,Decroocq V., 2007. Flanking the major Plum poxvirus resistance locus in apricot with co-dominantmarkers (SSRs) derived from candidate resistancegenes. Tree Genetics & Genomes DOI10.1007/s11295-007-0114-0.Vigouroux Y., McMullen M., Hittinger C.T., HouchinsK., Schulz L., Kresovich S., Matsuoka Y., DoebleyJ., 2002. Identifying genes of agronomic importancein maize by screening microsatellites for 416 TreeGenetics & Genomes (2008) 4, p. 403–417 evidenceof selection during domestication. Proc Natl Acad SciUSA 99:9650–965.Yang Z-N., Ye X-R., Molina J., Roose M.L., MirkovT.E., 2003. Sequence analysis of a 282-kilobaseregion surrounding the Citrus Tristeza Virusresistance gene (Ctv) locus in Poncircus trifoliate L.Raf. Plant Physiol 131, p. 482–492.180

Zhebentyayeva T.N., Reighard G.L., Krška B., GorinaV.M., Abbott A.G., 2002. Origin of resistance toplum pox virus in apricot: microsatellite (SSR) dataanalysis. Plant Protection Sci 38, p. 117– 121.Vilanova S., Romero C., Abernathy D., Abbott A.G.,Burgos L., Llácer G., Badenes M.L., 2003b.Construction and application of a bacterial artificialchromosome (BAC) library of Prunus armeniaca L.for the identification of clones linked to the selfincompatibility locus. Mol Genet Genomics269:685–691.181

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653NECESSITY OF CULTIVATION AND CLASSIFICATIONOF THE TABLE GRAPES VARIETIES FOR COMMERCIALIZATIONAbstractAdriana COSTESCUUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Marasti, District 1, 011464, Bucharest, RomaniaCorresponding author email: cosadriana@yahoo.comResearch in this paper were conducted during 2010-2012 to INCDBH Stefanesti Arges refer to native table grapesvarieties. Table grapes should be a pleasant and attractive. This condition is crucial because consumers considerprimarily 'eye' size, shape and color of the grapes. In grape production, in addition to climatic conditions and varietycultivated a decisive influence has applied agrotechnics plantation. Obtaining high yields of high quality and at a lowcost price agrotechnical requires the application of a differentiated varieties. In 2009, vineyards supplying grapes fortable had 9.384 ha, representing 5.08% of the total area for growing plantations and nurseries. Table grape exportswas insignificant in recent years, however imports soared.Key words: table grapes, export, productivity, commercialization.INTRODUCTIONGrape production is the indicator reflectingperhaps most visible as the hub biologicalpotential and professionalism and ability tomanage properly grower's holding in each yearsince the beginning of phenophases first to last,so a correctly applied technologies lead toobtaining an appropriate grape harvest bothquantitatively and qualitatively.Quality table grapes from the combination ofall the physical, chemical and organolepticrequirements satisfy and stimulate consumerinterest. It is estimated differently depending onthe subject (consumer, retailer, manufacturer)and product. The consumer is interested,primarily organoleptic quality, based on tastecharacteristics (flavor, sugar content, acidity),olfactory (aroma), tactile (consistency pulp),visual (color, size, freshness, etc.).Grain trader appreciates homogeneity,integrity, appearance (absence of defects inshape, parasites, flesh alterations, impropercolor), capacity retention and transport featureswhich allow product to reach the consumer inthe best conditions.MATERIALS AND METHODSAfter 1989, due to the difficulties of thetransition and globalization expansion areacovered with vineyards for grapes decreased183continuously, reaching in 2008 to 10 732 haand 62 ha come bearing live young (Dejeu L.,2010) (table 1). Table grape exports wasinsignificant in recent years, however importssoared. In the future it is necessary to relaunchthe production lines, given the increasedrequirements for table grapes to consumers.Table 1. Cultural situation vine vines for table grapes inRomania (after Dejeu L., 2010)YearSpecification2005 2006 2007 2008Total vines on fruitfor table grapes (ha)12 813 12 578 11 523 10 732Young vines (ha) 48 91 73 62Total production oftable grapes (t)39 338 67 053 81 046 87 164Table grape exports(t)200 100 909 306Importation of tablegrapes (t)2 044 9 000 18 959 21 500Averageconsumption of tablegrapes (kg / resident/ year)4,39 3,11 4,62 5,00Quality of the items, the size of grapes(bunches) determined according to weight andelsewhere, is a character presentationimportance in terms of trade in table grapesappearance (Sestras R., 2004).Table grape varieties, as well as those for wine,sugar content (with acid) is one of the most

important elements of quality grape-vine. Ofcarbohydrates, monosaccharides are the mostimportant because it represents over 95% of thetotal sugars accumulate in the grapes and themonosaccharides glucose and fructose are themost representative (Tardea C., 2000). Tablegrape varieties relationship between the twomain sugars (glucose and fructose) should be infavor of glucose (Ardelean M., 1986).New marketing standards for table grapes cameinto force in the EU in 2008, as a result of theEuropean Commission Regulation no.1221/2008. Table grapes can be divided intothree categories:- Extra. The grapes in this class must be ofsuperior quality to shape, development andcoloring typical of the variety, allowing theproduction area and have no defects. Berriesmust be firm, firmly attached to the pedicel,evenly covered the cob and bloom;- Category I. Grapes must be of good quality,take shape, typical of the variety,corresponding to the production area. Berriesmust be firm, firmly attached to the pedicel andcovered with bloom. Grains may have someslight defects that do not impair normalappearance, quality, keeping quality andpresentation in the package of the product:slight defects of shape, color and burns causedby the sun, but affects only the skin.- Category II includes grapes that can not beclassified in the higher classes, grapes mayshow slight defects in shape, development andcoloring, provided these do not impair theessential characteristics of the variety, allowingfor the production. Berries must be firm andsufficiently attached to pedicel and, if possible,covered with bloom. Assigned to clusters maybe less uniform than in other categories. Grainsmay have the following defects, provided theyretain their essential characteristics as regardsthe quality, keeping quality and presentation:defects of form, color, light skin burns in thesun, slight bruising, slight skin defects.RESULTS AND DISCUSSIONSTable grape varieties are generally growingvarieties with high force, high productionpotential and a lower capacity to accumulatesugars in the beans. This indicator of thequality of significance in that, in the case ofgrapes for fresh consumption, taste qualities are184given by a balance between sugar content andacidity must.Groups of varieties are found higheraccumulation of sugars in varieties withmedium production potential. Late maturingvarieties, those with high production potentialand high growth force accumulates loweramounts of sugars. In 2012, a year rich inresources heliothermal varieties studied haveaccumulated large quantities of sugars from thegrapes recorded. Between 2010 and 2011,normal in terms of climate, accumulation ofsugars were low, and because the higherproduction of grapes obtained (Table 2).Table 2. Sugars values in table grape varieties cultivatedat INCDBH Stefanesti-ArgesSUGARS g/lVARIETY2010 2011 2012Argessis 140,3 138,5 155,2Auriu de Stefanesti 140,2 140,9 146,3Augusta 137,8 139,4 143,2Muscat Adda 130,4 127,9 137,8Perlette 10St 145,2 156,1 164,0Muscat Adda 22St 140,5 145,2 198,0Canner 140,8 150,1 169,0For all varieties studied, the highest amounts ofsugars accumulated in 2012 and lowest in 2010(Table 1). This variation in sugar content ofwine is determined mainly by the production ofgrapes, leaf area on each block. Such sugarsthat have accumulated grapes during the threeyear study ranged from 130.4 to 140.8 in 2010,127.9 to 140.9 in 2011 and 137.8 to 198, 0 in2012.Titrable acidity of the must expressed in g / lH2SO4 was determined at full maturity of thegrapes. Although the specific climaticconditions vineyard Stefanesti-Arges, aciditygrape varieties of wine grape vines usuallyremains sharp, high temperatures in recentyears indicate qualitatively affect thisconsiderably. Thus, in 2012, due to hightemperatures, acidity showed lower values,especially in the early and mid-maturingvarieties such as Augusta and golden ArgessisStefanesti and in 2010 and 2011, whentemperature and insolation values were closethe annual average, titrable acidity was thecharacteristic varieties tested (Costescu A.,2012) (table 3).

Variations in acidity of the varieties studied,there were different due to the volume of foliardeveloped the hub, shading generated by it andequally grape production levels. Muscat Adda,extending the grain growth and delay theirmaturation achieved a higher level of titrableacidity of the must. Thus, this variety wasaverage titrable acidity of 5.29 g / l H2SO4.Table 3. Acidity values in table grape varieties grown inINCDBH Stefanesti-ArgesACIDITY g/l HVARIETY2 so 42010 2011 2012Argessis 5,14 5,11 5,01Auriu de Stefanesti 5,07 5,15 5,20Augusta 3,50 3,56 3,50Muscat Adda 5,15 5,21 5,51Perlette 10St 3,80 4,15 3,30Muscat Adda 22St 3,81 3,60 2,90Canner 3,90 4,18 4,30Varieties studied showed acidity valuesbetween 3.50 to 5.15 in 2010, from 3.56 to 5.15in 2011 and from 2.90 to 5.20 in 2012.Acidity values of varieties with less densefoliage device were located within specifictable grape varieties (3.50 to 5.51) (Costescu A.and colab., 2010, Popa C. et all, 2007).Glucoacidimetric index used to determine whenconsumer maturity, so to set the date harvest.Value of this index for table grapes is usuallybetween 2.5 to 4.5 range, given that tablegrapes contain 135-200 g / l sugar and 3.5 to6.0 g / l H2SO4 acidity (Martin, T., 1974).Following glucoacidimetric index values(Table 4) shows large differences from onevariety to another, between experimentation.Varieties studied showed balanced values ofthe ratio of accumulated sugars and titrableacidity of must: Argessis (2.72 to 2.84), goldenStefanesti (2.63 to 2.71), Muscat Adda (2.25 to2, 57), Augusta (3.75 to 4.04).Table 4. Glucoacidimetric index values in the studiedperiod (average 2010-2012)GLUCOACIDIMETRIC INDEXVARIETY2010 2011 2012Argessis 2,73 2,71 3,09Auriu de Stefanesti 2,76 2,73 2,81Augusta 3,93 3,91 4,09Muscat Adda 2,53 2,45 2,50Perlette 10St 3,82 3,76 4,97Muscat Adda 22St 3,79 4,03 6,82Canner 3,61 3,59 3,93Taking into account the varieties studied, it isfound that the highest values for this indicatorwere obtained from clone Adda 22 Del.Muscat. in 2012 (6.82) and lowest in MuscatAdda (2.50) also in 2012. Table grapeproducers constantly seek that level of qualityto meet customer needs: large grapes, rare ingrain, uniform in size, firmly attached pedicel,thin skin, evenly colored, crunchy flesh,pleasant, neutral or aromatic see Quality tablegrapes from the combination of all the physical,chemical and organoleptic requirements satisfyand stimulate consumer interest. It is estimateddifferently depending on the subject (consumer,retailer, manufacturer) and product.The consumer is interested, primarilyorganoleptic quality, based on tastecharacteristics (flavor, sugar content, acidity),olfactory (aroma), tactile (consistency pulp),visual (color, size, freshness, etc.) ds few,small, or no seeds. Resistance is important forstorage grain separation.Grain trader appreciates homogeneity,integrity, appearance (absence of defects inshape, parasites, flesh alterations, impropercolor), capacity retention and transport featureswhich allow product to reach the consumer inthe best conditions.The manufacturer aims to maximize besidesgrapes and satisfying the consumer and thetrader. New marketing standards for tablegrapes came into force in the EU in 2008, as aresult of the European Commission Regulationno. 1221/2008.Quality standards refer to minimumrequirements and rules that should be respectedproducers and exporters of fruits andvegetables and aim for food and fresh grapes,from varieties belonging to Vitis viniferaGrain trader appreciates homogeneity,integrity, appearance (absence of defects inshape, parasites, flesh alterations, impropercolor), capacity retention and transport featureswhich allow product to reach the consumer inthe best conditions.Rules define the quality characteristics thatmust have table grapes after preparation andpackaging. Given the specific provisions laiddown for each class and the tolerances allowed,grapes and berries must be:-sound, produce affected by mold ordeterioration such as to make them unfit for185

consumption;-clean, practically free of anyvisible foreign substances and attacks by pestsand diseases; abnormal external moisture-free,odorless and / or taste.Also, the beans should be whole, well formed,normally developed. Grapes must be harvestedcarefully and degree of maturation to thetransport, related operations and to arrive insatisfactory condition at the place ofdestination.Must must have a refractometric index of atleast:-12 º Brix for the Alphonse Lavalle varieties,Cardinal and Victoria;-13 º Brix for other varieties of seeds;-14 º Brix for all seedless varieties.AlphaIn addition, all varieties must report sugar /acidity satisfactory. The standards of theInternational Organization of Vine and Wineon minimum maturity requirements for tablegrapes (VITI Resolution 1/2008) states thatgrapes that have a refractive index (° Brix)equal to or greater than 16 are consideredmature. In contrast, white varieties (and pink)table grape with a refractive index less than 16,you must have a minimum ratio 'sugar (g / l) /acidity (g / l expressed as tartaric acid) '20 / 1to be considered mature. If black varieties oftable grape with a refractive index of between12.5 and 16 must have a report 'sugar / acidity'of at least 20/1, to be considered mature.Grapes that have those values less than 12 arenot considered mature. Minimum requirementsdetermined by the weight calibration tablegrape varieties large and small grains grown inthe field (or in greenhouses) are presented inTable 5.Table 5. Minimal weight of grapes (g) for differentqualitative categories (Reglement CE nr. 1221/2008)CategoryIn thegreenhouseOn the fildgrapes withTable grapelarge berriesExtra 300 200 150I 250 150 100II 150 100 75grapes withsmall berriesEach category are allowed tolerances in respectof quality and size of 5-10%. Each packagemust be uniform and contain content thangrapes of the same origin, variety, quality anddegree of maturation.186CONCLUSIONSTable grapes must be harvested carefully anddegree of maturation to the transport, relatedoperations and to arrive in satisfactorycondition at the place of destination.Grapes and berries must be: healthy, produceaffected by mold or deterioration such as tomake them unfit for consumption, clean,practically free of any visible foreignsubstances and attacks by pests and diseases;without abnormal external moisture, odorlessand / or taste.Grapes for sale to be complete, well-formed,normally developed.Quality table grapes from the combination ofall the physical, chemical and organolepticrequirements satisfy and stimulate consumerinterest. It is estimated differently depending onthe subject (consumer, retailer, manufacturer)and product.ACKNOWLEDGEMENTSThanks POSDRU, Contract cod:POSDRU/CPP107/DM11.5/S/76888 forfinancial support, to the University ofAgricultural Science and Veterinary MedicineBucharest who made this project and NationalResearch& Development Institute forBiotechnology in Horticulture Stefanesti-Argesfor the material provided and the possibility ofconducting research.REFERENCESArdelean M., 1986. Ameliorarea plantelor horticole,Tipo Agronomia, Cluj-Napoca.Costescu Adriana, Liviu Dejeu, Camelia Popa, 2012.Evaluating the quality of the tablegrape varietiesobtained and cultivated in the vineyard Stefanesti –Arges, in Scientific Papers Series B Horticulture,University of Agronomic Sciences and VeterinaryMedicine of Bucharest, Faculty of Horticulture, vol.LVI, ISSN 2285-5653, ISSN-L 2285-5653, p. 69-72Costescu Adriana, Popa Camelia, Visoiu Emilia, NeculaCezarina, Iordache Stefania, 2010. The ameliorationof the Muscat d'Adda variety through clone selection,Annals Foods and Techology, University ofTargoviste, p. 74-78.Dejeu L., 2010. Viticultura, Editura Ceres, Bucuresti,480 p.Martin T., 1974. Cultura soiurilor pentru struguri demasa, Editura Agro-Silvica, BucurestiPopa Camelia, Radulescu Ion, Matei Viorica, 2007.Golden Stefanesti - a new vine variety for table

grape. Analele Universitatii din Craiova, SeriaBiologie, Horticultura, Tehnologia PrelucrariiProduselor Agricole, Ingineria Mediului, vol XII(XLVIII), p. 41-44.Regulamentul (CE) nr. 1221/2008 al Comisiei din 5decembrie 2008 de modificare a Regulamentului(CE) nr. 1580/2007 de stabilire a normelor deaplicare a Regulamentelor (CE) nr. 2200/96, (CE) nr.2201/96 si (CE) nr. 1182/2007 ale Consiliului însectorul fructelor si legumelor privind standardele decomercializare. Jurnalul Oficial L 336, 13.12.2008,p.1-80;Sestras R., 2004. Ameliorarea speciilor horticole, EdituraAcademic Pres, p. 9-66.Târdea C-tin si colab., 2000 Sestras R., 2004-Ameliorarea speciilor horticole, Editura AcademicPres, p. 9-66.187

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653IDENTIFICATION OF PLOIDY LEVEL ON VARIETIESAND HYBRIDS OF KIWIFRUIT (ACTINIDIA SP.)Ramona COTRU 1 , Florin STNIC 1 , Giuseppe SCAPIGLIATI 21 University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Marasti Blvd,District 1, 011464, Bucharest, Romania2 Department for Innovation in Biological systems, Food, Agriculture and Forestry (DIBAF),University of Tuscia, Via S. Camillo de Lellis snc, 01100, Viterbo, ItaliaAbstractCorresponding author email: ramona_cotrut@yahoo.comThe genus Actinidia includes over 66 species and over 118 taxon, that range in ploidy level from diploid to octoploid.Although there is basic information on ploidy levels of various species, sampling has been limited and little informationon specific cultivars and hybrids is available. The objective of this research was to determine ploidy levels among adiverse collection of species, hybrids, and cultivars using flow cytometry. Nuclei were extracted, stained with propidiumiodide (PI), and analyzed using a flow cytometer. Among the selections tested we found Actinidia arguta as diploid (2n= 2x) and tetraploid (2n = 4x), Actinidia deliciosa 'Hayward' as hexaploid (2n = 6x), Actinidia chinensis'Soreli' tetraploid (2n = 4x) and the interspecific hybrid A. arguta x A. deliciosa as diploid (2n = 2x). This informationprovides further insight into reproductive biology, substantiation of numerous hybrids and induced polyploids that willhelp facilitate the development of improved hybrids in the future.Key words: chromosomes, flow cytometry, interspecific hybrid, polyploidy, plant breeding.INTRODUCTIONvariation in ploidy make hybridization betweenActinidia species difficult. Better knowledgeCommercial kiwifruit production is based onand understanding of polyploidy of cultivarstwo Actinidia species, A. deliciosa C.F. Ling etand hybrids could facilitate kiwifruitA.R. Ferguson and A. chinensis Planch.improvement.Nevertheless, at present, A. arguta isPolyploidy has been an important process in thecommercially cultivated in Oregon in US, Chileevolution of plants and is an important factor inand New Zealand, and small-scale productionplant breeding because it can influencefor local consumption is conducted in manyreproductive compatibility, fertility, andregions under a relatively cool climatephenotypic traits (Chen and Ni, 2006; Jones(Ferguson and Huang, 2001). The genusand Ranney, 2009; Ranney, 2006; Soltis et al.,Actinidia Lindl. comprises 66 species and about2004). Hence, accurate and specific knowledge118 taxa with remarkably wide natural rangeof ploidy levels of species and cultivars isextending from the tropics (latitude 0º) to coldimportant information for kiwi breeders.temperate regions (50º N). Since the first seedThe base chromosome number for Actinidia isintroduction of A. deliciosa was made from 1n = 1x = 29. However, different subgeneraChina to New Zeeland in 1904, the economic contain species with a variety of ploidy levelspotential of kiwifruit has been extensively ranging from 2n = 2x = 58 to 2n = 6x =174;exploited (Ferguson and Bollard 1990).respectively 2n = 8x =232. The range in ploidyThere is considerable genetic diversity amongst levels within this genus also provides anthe species within the genus Actinidia, opportunity to indirectly substantiate hybridityparticularly in fruit skin type, skin colour, flesh when parents differ in ploidy levels.colour and flavour (Ferguson and Huang, Because many Actinidia species are polyploids2007).with high chromosome numbers, traditionalThis diversity provides many opportunities for cytology based on light microscopicdeveloping new types of kiwifruit. Dioecy, examination is a difficult and time-consuminglong generation cycles, high heterozygosity and process.189

Flow cytometry has proved to be an efficientmeans of estimating genome size andassociated ploidy level (Dolezˇel et al., 2007;Jones et al., 2007). Therefore, the objective ofthis study is to identify the ploidy levels of adiverse collection of species, hybrids, andcultivars of Actinidia developing a database foruse by kiwi breeders.MATERIALS AND METHODSThe plant material was constituted by acollection of plants from Actinidia arguta,Actinidia deliciosa, Actinidia chinensis and oneinterspecific crosses of Actinidia, total of130 plants were kept in a green house.Flow cytometric analysis was performed foreach of the Actinidia accessions by collectingleaf samples (3-5 per each), young fullyexpanded leaf collected from the shoot tips; tomaintain an adequate moister and ensure acorrect conservation tissues, the leaves wereplaced in plastic bags in a refrigerator at 4ºC.Using the method of Galbraith et al. (1983), 50mg Actinidia leaf tissue without midribs wasplaced in plastic Petri dishes chopped with arazor blade adding 0.5 ml of ice-cooledhomogenization (Otto I buffer) to homogenizethe tissues and release the nuclei, and kept onice for 5 min.After filtration through 42-μm nylon mesh thenuclear suspension were treated with 2.5 ml ofa staining solution containing 10 ml Tris, 50mM sodium citrate, 2 mM MgCl2, 1% (w/v)PVP 30, 0.1% (v/v) Triton X-100 and 1 mg/mlpropidium iodide (PI), pH 7.5, letting thesamples stand 5 min prior to flow cytometricanalysis.Samples were run on a Coulter Epics XL-MCLflow cytometer EXPO 32 ADC; for eachaccession was gated between 5000-10000events of a sample. Relative fluorescenceintensity was assessed using FL2, green lightsource detector (excitation 488 nm).Data were interpreted using WinMDI 2.9software. As an internal standard was usedPisum sativum cv. Ctirad. The measurementswere tripricated by using three leaf samplescollected from each plant.RESULTS AND DISCUSSIONSWe have evaluate for ploidy level six seletionsof Actinidia arguta, two of A. deliciosa‘Hayward’, one of A. chinensis ‘Soreli’ and oneinterspecific hybrid, A. arguta x A. deliciosa,using flow cytometry (Table 1).Table 1. Selection of species, hybrids of kiwi (Actinidiasp.)SpeciesGenotype No. plantsActinidia arguta R8P23 10Actinidia arguta R10P10 10Actinidia arguta R9P18 10Actinidia arguta R8P1 10Actinidia arguta R9P16 10Actinidia arguta x deliciosa P1 10Actinidia deliciosa’Hayward’ Hk 10Actinidia deliciosa’Hayward’ H8 30Actinidia chinensis’Soreli’ S 30Total 130The ploidy levels of Actinidia plants wereclearly distinguished by flow cytometry.Among Actinidiasp. tested, we found: Actinidiaarguta (2n=2x) R9P18, R8P23 as diploidplants, R10P10, R8P1, R9P16 astetraploid Actinidia arguta (2n=4x), plants; forActinidia deliciosa ‘Hayward’ (2n=6x) HK, H8as hexaploid; for Actinidia chinensis ‘Soreli’(2n=4x) tetraploid; for interspecific crosses A.arguta x A. deliciosa (2n=2x) P1 as diploid(Table 2).Table 2. Estimation of ploidy level of kiwi genotypes(Actinidia sp.)SpeciesGenotype Ploidy No.level chromosomesActinidia arguta R8P23 2x 58Actinidia arguta R10P10 4x 116Actinidia arguta R9P18 2x 58Actinidia arguta R8P1 4x 116Actinidia arguta R9P16 4x 116Actinidia arguta xdeliciosaP1 2x 58Actinidiadeliciosa’Hayward’Hk 6x 174Actinidiadeliciosa’Hayward’H8 6x 174Actinidiachinensis’Soreli’S 4x 116The results of an analysis are described as amono-parametric (fluorescence intensity/object) histograms peaks, each of them190

epresenting the fluorescence intensity of apopulation of nuclei. Their intensity (positionof the histogram) is proportional to the amountof nuclear DNA (Figure 1).Figure 1. Frequency distribution histograms of fluorescence intensity stained with propidium iodide (PI) (A, A. argutaR8P23; B, A. chinensis ‘Soreli’; C, A. arguta 108P10, D, A. deliciosa var. deliciosa cv. Hayward K; Log values offluorescence intensity% CV for nuclei are given on each histogram).The comparison between the position of thesample’s peak and the internal standard’s peakgive a ratio of relatives intensities. The ploidylevels are calculated by comparingexperimental values with the value obtainedfrom Pisum sativum sample having a knownploidy level.As a result, ploidy analysis in which the DNAcontents of Arguta sp. collection, nuclei werecompared to those from a specie having knownploidy (Pisum sativum 2n=2x).This comparison can be made either betweentwo analyses performed under identicalconditions, or, in our case, through mixing thetwo samples for simultaneous measurement.Counting chromosomes in Actinidia speciesand their hybrids is technically difficult due tothe high numbers of chromosomes involvedand their small size. Chromosome numbershave been reported for only a few species butthe data support a polyploid sequence 2n = 2x,2n = 4x, 2n = 6x with x= 29. To determineploidy, the number of basic chromosome sets in191

cell nuclei, using chromosome counting individing cells is an unambiguous way and istime consuming, that is way a high-throughputsolution is to use flow cytometry, makingpossible a rapid and reliable ploidy estimation.CONCLUSIONSFlow cytometry (FCM) was originallydeveloped as a rapid technique to analyse bloodsamples for medical diagnosis and is nowadaysused for countless medical applications by theanalyses of individual cells at high speed. Inplant sciences, and breeding in particular, flowcytometry is mainly known as a tool for ploidyanalysis. The first ploidy applications focusedon crop plants (De Laat et al. 1987) and plantbreeding still dominates this field.The method is fast, accurate and simple andreplaced microscopic chromosome counts sinceGalbraith et al. (1983) introduced choppingwith a razor-blade as an easy standard protocolfor plant analysis.At different stages in plant breeding flowcytometry generates valuable information. Aswell for the selection of parent plants forhybridisation as for the evaluation of hybrids,ploidy determination or genome size analysesare useful. Flow cytometry is an indispensabletool in polyploidisation to screen plants treatedwith mitotic inhibitors.Such conclusions clearly highlight theindispensability of cytotype determination(most effectively realized by FCM) in anyexperimental study that may involveheteroploid plant samples.ACKNOWLEDGEMENTSPart of this work was supported Department forInnovation in Biological systems, Food,Agriculture and Forestry (DIBAF), Universityof Tuscia. We greatly thank Dr. GiuseppeScapigliati, Phds. C. Marozzi, Mr. GiusseppeZuccherelli for their assistance and thecollections of plant materials, and to SectoralOperational Programme Human ResourcesDevelopment 2007-2013 ''Doctoral and postdoctoralresearch support'POSDRU/107/1.5/S/76888.REFERENCESChen Z.J., Z. Ni., 2006. Mechanisms of genomicrearrangements and gene expression changes in plantpolyploids. Bioessays 28, p. 240–252.De Laat A.M.M., Gohde W., Vogelzang M.J.D.C., 1987.Determination of ploidy of single plants and plantpopulations by flow cytometry. Plant Breed 99, p.303-307.Dolezel J., Greilhuber J., Suda J., 2007. Flow Cytometrywith Plant Cells Analysis of Genes, Chromosomesand Genomes. Online ISBN:9783527610921Ferguson A.R., 1999. Kiwifruit cultivars: breeding andselection. Acta Hort. 498, p. 43–51.Ferguson A.R., Bollard E.G., 1990. Domestication of thekiwifruit. Kiwi fruit science and management.R.Richard Publ. N.Z., p.165-246Ferguson A. R.,Huang H., 2007, Genetic Resources ofKiwifruit: Domestication and Breeding, HorticulturalReviews, Volume 33.Galbraith D.W., Harkins K.R., Maddox J.M., AyresN.M., Sharma D.P., Firoozabady E., 1983. Rapidflow cytometric analysis of the cell cycle in intactplant tissues. Science 220, p. 1049–1051.Hopping M. E., 1994. Flow cytometric analysis ofActinidia species, New Zealand Journal of Botany,32:1, p. 85-93Huang , H., A.R. Ferguson., 2001. Kiwi fruit in China.N.Z. J. Crop Hort.29, p. 1-14.Huang H., Wong J., 2000. Genetic diversity in the genusActinidia. Chinese Biodiversity 8, p. 1-12.Jones, J.R., Ranney T.G., Lynch N.P., Krebs S.L., 2007.Ploidy levels and genome sizes of diverse species,hybrids, and cultivars of Rhododendron L. J. Amer.Rhododendron Soc. 61, p. 220–227.Kataoka I., Mizugami T., Kim J.G., Beppu K., FukudaT., Sugahara S., Tanaka K., Satoh H., Tozawa K.,2010. Ploidy variation of hardy kiwifruit (Actinidiaarguta) resources and geographic distribution inJapan. Journal Scientia Horticulturae 124, p. 409–414Ranney, T.G., 2006. Polyploidy: From evolution to newplant development. Proc. Intl. Plant Prop. Soc. 56, p.137–142.Soltis, D.E., P.S. Soltis, and J.A. Tate. 2004. Advancesin the study of polyploidy since plant speciation. NewPhytol.161, p. 173–191.192

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653EVALUATION CONCERNING THE VARIABILITYOF SOME CHARACTERISTICS AT A BULGARIAN TOMATOESCOLLECTION CULTIVATED IN GREENHOUSEMdlina DOLTU, Marian BOGOESCU, Dorin SORAResearch and Development Institute for Processing and Marketing of the Horticultural Products, 1AIntrarea Binelui, District 4, 75614, Bucharest, RomaniaAbstractCorresponding author email: doltu_mada@yahoo.comThe experience was conducted in a tomatoes collection consisting from 3 F 1 hybrids, Bulgarian origin - Prekos, Komand Geo - with large percentage in the vegetable area near Bucharest. The observations and the biometricmeasurements from fruits were made during the growing season, in 2012 year. The researches was conducted in theLaboratory for Protected Cultures of the ICDIMPH-Horting Bucharest and were aimed the evaluation of somedeterminants characteristics to the production and marketing of this vegetable on internal market of Romania. Theresults show that the studied hybrids have genetic variability of the characteristics, favorable traits and are animportant source of germplasm for improvement works of the species.Key words: Bulgarian seeds, Romanian tomatoes.INTRODUCTIONCurrently, are appreciated the tomatoes withtaste by „Romanian tomato”.This aspect is determinant in the marketing ofthis vegetable on the internal market ofRomania; the consumers of our country haveclassical, traditional and less diversifiedoptions.In our country, increasing interest for topreferentially use early tomatoes F 1 hybrids inprotected spaces and field led to thepredominant use of the foreign origin seeds,specifically adapted and intended forcultivation in warm greenhouses, withpretensions for advanced technologies(Vântoru, 2006).Although the price of hybrid seeds is very high,their use is recommended because have thefavorable qualities - precocity, resistance todiseases and pests, quality, high production,etc. (Voican and Lctu, 1998).So, vegetable growers obtain Romaniantomatoes from import seeds.The variety and production technologyinfluences the quality characteristics of thetomatoes.The Bulgarian tomatoes hybrids (Prekos, Komand Geo) have large share in thecultivationarea of the vegetables near193Bucharest because the fruits have size, color,shape, taste by „Romanian tomato”.In the researches of the specialists, Prekos F 1was marked by superior organoleptic qualitiesof the fruits (Maria et al., 2009).MATERIALS AND METHODSThe biological material used in the researchwas formed from Bulgarian tomatoes - 3hybrids F 1 - Prekos, Kom and Geo.The description of the hybrids is shown in table(Table 1).Table 1. The description of the Bulgarian tomatoesHybridType of growth Precocity ResistancesPrekos semideterminatevery VMT, Fusarium spp.,early Verticillum spp.Kom indeterminate earlyVMT, Fusarium spp.,Verticillum spp.,nematoziVMT, Fusarium spp.,Geo indeterminate earlyVerticillum spp.The tomatoes seedlings were produced ingreenhouse specializes in producing seedlings.The plants were obtained in alveolar trays, innutritive substrate – peat, medium fertilized(Figures 1, 2, 3).

Figure 1. Prekos F1Figure 4. Prekos – 45 daysFigure 2. Geo FFigure 5. Kom – 45 daysFigure 3. Kom F1The culture was established on 21.03.2012,with seedlings aged 45 days old (Figures 4, 5,6).194Figure 6. Geo – 45 daysThe conventional technology was used in thetomatoes crop (maintenance works, directing ofthe growth factors etc.) and the fertilizationprogram presented (Table 2).

Table 2. Fertilization program of the tomatoes culture inthe greenhouses - kg/ha (Voican and Lctu 1998) Moment AB10–20 *21–50*51–80*81–110*Ammoniumnitrate(34% N)100-200100300200100Concentratedsuperphosphate(40% P 2 O 5 )0-300----Complex16:48:0--100--Potassiumsulphate(45%K 2 O)200-400--200200Magnesiumsulphate(16%MgO)100-200--5050The experience included 3 plots (100 m 2 /plot)cultivated with tomatoes, 270 plants/plot ( =27000 plants/ha).The first harvesting was realised at 2012/05/07(Prekos) and 2012/05/14 (Geo and Kom).The observations and the biometricmeasurements at tomatoes were made in theLaboratory for Protected Cultures of theICDIMPH-Horting Bucharest.RESULTS AND DISCUSSIONSThe results concerning the morphologicalcharacters of the fruits are presented in thetable3.Table 3. The main characteristics of the tomatoescollectionCharacters of fruit Prekos Kom GeoWeight of fruit (g) 185 180 130Predominant form of sphericalfruitsharp peakspherical sphericalNumber of the3; 4 5 3seminal lodgesExterior color ofimmature fruitExterior color ofmature fruitgreengreen, with lightlid greenred red redThe fruit weight ranged from 130 g (Geo) to185 g (Prekos).The shape and the color to physiologicalmaturity of the tomatoes presented a highvariability; were obtained green fruits, with tip(Prekos), green fruits, spherical, with green lid(Kom) and green fruits, spherical and greenfruits, lid without (Geo) - figure 7. The colorwas red at physiological maturity at all hybrids.The exterior aspect of the fruits was smooth(Prekos) and easy costed (Geo, Kom).The number of the seminal lodges ranged froma hybrid to another: 3-4 seminal lodges(Prekos), 5 seminal lodges (Kom), 3 seminallodges (Geo) - Figures 8, 9, 10.Figure 7. Exterior color of immature fruitFigure 8. Prekos - 3; 4 seminal lodgesFigure 9. Kom - 5 seminal lodgesFigure 10. Geo - 3 seminal lodges195

Interpretation of the results concerning theproduction / ha, by Duncan test, is shown in thefigure 11.Figure 11. The production of the tomatoes hybridsIt is observed insignificant difference betweenthe production/ha obtained from Prekos (83t/ha) and Kom (80 t/ha) and significantdifference from Geo (65 t/ha).CONCLUSIONSThe tomatoes collection researched has animportant genetic variability of thecharacteristics studied.The tomatoes fruits presented characteristics -color, weight, shape, aspect, taste and numberof seminal lodges - optimal, meeting therequirements of the producers and theconsumers.The hybrids investigated have optimalprecocity and high production.The Prekos hybrid is superior the Kom and Geohybrids.The tomatoes collection researched is avaluable source of germplasm for ameliorationworks.These 3 hybrids F 1 of Bulgarian origin -Prekos, Kom and Geo - behaved optimal ingreenhouse, in the climate conditions ofBucharest in 2012 year.REFERENCESMaria C., Stoian L., Filipov F., Criste T.O., Ambru S.,Avasiloie D.I., 2009. Comparative and collectionstudy tomatoes hybrids cultivated in plastic houses inbiologic agriculture conditions, Analele Univ. dinCraiova, seria Agricultur-Montanologie-Cadastru,vol. XXXIX, p. 61-65.Vântoru, C., 2006. Crearea de hibrizi F 1 de tomatetimpurii cu plasticitate ecologic i calitatesuperioar, Tez de doctorat.Voican V., Lctu V., 1998. Cultura protejat alegumelor în sere i solarii, Editura Ceres.196

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653RESEARCH REGARDING THE BREEDINGOF PEACH IN DOBROGEA AREALiana Melania DUMITRU 1 , Corina GAVT 2 , Dan-Victor DUMITRU 3 ,Georgeta CAREU 4 and Adrian ASNIC 51 Research Station for Fruit Growing Constanta, Pepinierei Str. 1, 907300, Valu lui Traian, Romania2 Ovidius University of Constanta, Aleea Universitatii, no.1, Constanta, Romania3 Limagrain Romania, Drumul Garii Odai Street, no.1A, Bucharest, Romania4 Bioterra University Bucharest, 97 Ion Ionescu de la Brad Blvd, 013812, Bucharest, Romania5 University of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Marasti Blvd.,District 1, 011464, Bucharest, RomaniaCorresponding author email: lianadumitru@yahoo.comAbstractPeach is one of the most valuable species cultivated in Romania. At Research Station for Fruit Growing Constanta isthe National Peach Collection with 855 genotypes from worldwide. Between 1981-2012, our peach breeders sorted thebest genitors and made a lot of hybridizations, than they obtained thousand and thousand of hybrids. During the time,31 new peach, pavie, nectarine and brugnone cultivars are registered to Bucharest ISTIS and this new biologicalmaterial enriches and diversifies the Romanian assortment. This paper presents seven new cultivarsKey words: Prunus persica (L) Batch, dwarf, fruit quality, processingINTRODUCTIONPeaches and pavies are appreciated for theirnourishing and therapeutically qualities andare recommended for fresh consumption andfor processing (Delgado, 1992; Bargioni,Pisani, 1993; Cepoiu, Manolache, 2006).Thousand and thousand peach cultivars are inthe world and annually, the breeders obtainnew varieties (Monet, 1990; Fraccaroli,Bargioni, Febi, 2000; Sansavini, 1991;Dumitru, Cepoiu, Stanica, 2001).MATERIAL AND METHODThe biological material is representing byseven new cultivars: ‘Cecilia’ – registered in2000; ‘Raluca’ and ‘Catherine Sel.1’ – omologatedin 2001; ‘Florin’ and ‘Filip’ – in2002; ‘Craita’ – in 2003; ‘Monica’ – in 2007.The American cultivar ‘Redhaven’ – registeredin 1964 in the Official Romanian BreedingCultivar List of Plant was control of thisexperiment.197The rootstock utilised was ‘Tomis 1’, whichwas registered in 1997 and it was obtained inour station by Dr. Alexandra Indreias.The orchard density was 833 trees / ha, forstandard trees (4/3 m) and 2222 trees / ha fordwarf trees (3/1.5 m).The trees were observed from the phenollogicalpoint of view. There were made biometricalmeasurements on fruits and trees;physico-chemical analyses on fruit; appreciationson productivity, behavior to the attack ofmain diseases and parasites, etc.The crown form was the improved vase.RESULTS AND DISCUSSIONS‘Redhaven’ is the American cultivar whichwas introduced in Romania in 1964. After 49years, this variety persists to be cultivated inour peach-orchard. It is the control of thisexperiment (Photo 1).

Photo 1- Redhaven (Control)The Romanian breeders try to obtaine newvaluable cultivars, same (type) ‘Redhaven’,with yellow flesh, but not only, because thetastes of consumers is changing day by day.Then, were created, for a change, aboriginalcultivars with white or orange flesh, withdifferent taste, color, size, firmness, form, etc.In this paper we present seven new cultivarsobtained at Research Station for FruitGrowing Constanta, Romania.‘Raluca’, the author is Liana-Melania Dumitru.Is an early peach cultivar, similar toRedhaven; tree is standard, semivigorous,resistant to frost; autofertile; with big andconstant yield; the fruit is red and attractive;the flesh is yellow and juicy (Photo 2).Photo 3- Cecilia‘Catherine Sel.1’, was obtained by Liana-Melania Dumitru.It is a clingstone cultivar, tree is standard, mediumvigorous, resistant to Taphrina deformans;hight and constant productivity; fruit isbig, orange with red, attractive, the flesh isorange, firm, flavoured, very sweet (Photo 4).Photo 4- Catherine Sel.1‘Craita’ - the author is Liana-Melania Dumitru.It is a dwarf clingstone cultivar; the hightnessof tree is 1.20-1.50 m; big and constant productivity;fruit is yellow-orange, with yellowand firm flesh, very good taste (Photo 5).Photo 2- Raluca‘Cecilia’, the authors are Liana –MelaniaDumitru and Vasile Cociu.It is a dwarf peach with fruit similar toRedhaven; the highness of tree is about 1.40-1.70 m; fruits are big, red, with yellow fleshand good quality (Photo 3).198Photo 5- Craita‘Florin’- the author is Liana-Melania Dumitru.It is an early cultivar with flat fruit andstandard trees; big vigour, resistant to frost;

fruit is big for “sandwich” group; attractive,yellow with red; orange flesh, juicy (Photo 6).‘Monica’- the authors are: Vasile Cociu,Liana-Melania Dumitru and Preda Ionescu.It is also a ”sandwich“ peach, which has theripening time after Filip; very attractive fruit,red-carmin colou; white flesh, sweet and juicy(Foto 8).Photo 6- Florin‘Filip’ - the author is Liana-Melania Dumitru.It is the best Romanian peach cultivar with flatfruit; the tree is standard, autofertil; has medium-bigvigour; very good and constant productivity;fruit is very attractive, excellent taste,sweet, flavoured, rose-red, with white flesh;small stone, no adderence, juicy (Foto 7).Photo 7- FilipPhoto 8- MonicaThe most early cultivars are: ‘Raluca’ and‘Florin’ and the latest are: ‘Cecilia’ and‘Monica’ (Table 1).The yield is between 22.5 t/ha (‘Redhaven’ –Control) and 40.0 t/ha (‘Craita’, dwarf pavie).‘Catherine Sel.1’ (pavie or clingstonecultivar) has also a big production: 30 t/ha(Table 1).The mean weight of fruit varies between 73 g(‘Monica’) and 225 g (‘Catherine Sel.1’).The peach cultivars with flat-fruit have thesize of fruit smaller than the classic one, butthis fact is compensated by the excellent tasteand the atractivity of their fruits (Table 2).The raport stone/fruit is between 3% (‘Filip’)and 8% (‘Redhaven’- Control) and it denotesthe efficiency to processing.Table 1. Ripening time and average yield (2010-2012) Valu lui Traian, Constanta, RomaniaGenotype Category Ripening timeAverage yieldkg/tree t/haDestination of fruitsRedhaven(Control)peach 09.07-16.07 27.0 22.5 flesh consumption and processingRaluca peach 30.06-07.07 29.0 24.2 flesh consumptionCecilia dwarf peach 01.08-13.08 14.5 32.2 flesh consumption and processingCatherine Sel.1 clingstone (pavie) 27.07-10.08 36.0 30.0 processing and flesh consumptionCraita dwarf clingstone 15.07-29.07 18.0 40.0 processing and flesh consumptionFlorin peach with flat fruit 02.07-11.07 27.5 22.9 flesh consumptionFilip peach with flat fruit 14.07-29.07 35.0 29.2 flesh consumption and processingMonica peach with flat fruit 03.08-13.08 32.0 26.7 flesh consumption and processing199

Dry matter (determinate refractometrique) isbetween 10.5% (to ‘Raluca’) and 16% (to‘Monica’).The acidity, which is expressed in mg. malicacid / 100 g flesh fruit, varies between 0.32mg% (‘Filip’) and 0.67 mg% (‘Redhaven’-Control) (Table 2).Table 2. Quality test of fruit Valu lui Traian,Constanta, RomaniaGenotype FruitmeanStonemean%stoneDrymatterAcidity*(mg%)weigh(g)weigh(g)fruit (%)Redhaven 150.0 12.0 8.0 11.0 0.67(Control)Raluca 172.0 13.0 7.6 10.5 0.56Cecilia 220.0 10.0 4.5 12.5 0.66Catherine 225.0 12.0 5.3 14.7 0.44Sel.1Craita 125.0 8.5 6.8 13.2 0.55Florin 105.0 6.0 5.7 11.5 0.40Filip 77.5 2.3 3.0 14.8 0.32Monica 73.0 2.7 3.7 16.0 0.36* Acidity: mg malic acid/100 g flesh fruitGeneraly, the cultivar with flat fruit havemore sugar and less acidity (‘Filip’ and‘Monica’) than normal peach cultivars.A big percent of dry matter have also theclingstone (pavie): 13.2% (‘Craita’) and14.7% (‘Catherine Sel.1’) (Table 2).CONCLUSIONS1. The new cultivars obtained at Constanta aresuitable not only for ecoclimatic conditions ofsouth-east of Romania, but also for otherareas from the south, west and central part ofRomania and also for other European countrys,like Ungary, Bulgary, France, etc.2. All these new cultivars are more good thancontrol cultivar (‘Redhaven’) and enriched theexisting assortment.ACKNOWLEDGEMENTSThe paper was supported by UMPP – ASASBucuresti, Sectorial Plan ADER 2020, ProjectADER 1.1.8., Contract 118/2011.REFERENCESBargioni, G., Loreti, F., Pisani, P.L. (1993).Performance of peach and nectarine in a high densitysistem in Italy, Hortscience, vol. 18(2) Italy.Cepoiu, N., Manolache, C. (2006). Piersicul –sortimente si tehnologii moderne. Editura Ceres,Bucuresti.Delgado M. (1992). Peches pour une meilleure tenuedes fruits. Lárboriculture fruitier. Nr. 450, Mai.Dumitru, L.M., Cepoiu, N., Stanica, F. (2001). Newdwarf, peach tree varieties registered in 2000 by FruitResearch Station Constanta, Romania. The V thInternational Symposium of Peach, Davis, California,S.U.A.Fraccaroli, S., Bargioni, G., Febi, A. (2000). Lapeschicoltura Veronese alle soglie del 2000. Verona-Italy.Monet, R. (1990). Orientation actuelles desprogrammes de creation varietale du pecher. JourneesPeches et Nectarines. 10-11.01.Moissac.Sansavini, S. (1991). La Peches-Enjeux technique de laproduction italienne. L’arboriculture fruitiere, Nr.435,Janvier..200

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653PRESENT AND PERSPECTIVE OF ALMOND IN SOUTH-EASTERNROMANIACorina GAV 1 , Liana Melania DUMITRU 1 , Georgeta CAREU 21 Research Station for Fruit Growing Constanta, Pepinierei Str. 1, 907300, Valu lui Traian, Romania2 Bioterra University, No. 81 Garlei Street, District 1, Bucharest, RomaniaAbstractCorresponding author email: corina_gavat@yahoo.comAlmond is almost unknown to most people in our country, even abroad is widespread and appreciated for its fruit withmany uses. At Research Station for Fruit Growing Constanta, during 1984-1994, it were studied over 45 cultivars ofalmonds. Currently germoplasm consists of 54 cultivars and selections of almonds that have been studied regardingbehavior in the phenology and pollination process.Key words: Prunus amygdalus Bartock, cultivars, phenology, pollination.INTRODUCTIONAlmond belongs to the group of nuts crops andhas a major economic importance innourishment industry, because of its many usesand multiple chemical components of the fruit.Almonds is considered an almost completefruit; depending of the cultivar, ripening timeand place of culture their sweet or bitter corecontaining large amounts of fat, proteinsubstances, carbohydrates, minerals, etc.(Cociu, 2003, 2007).Being classified as thermopile tree species, thealmond found in the south east part of thecountry optimal climatically conditions forculture, although almond orchards declinedgreatly, in the last two decades.Currently, almond became a 'luxury' fruit; theirfruit being exported in high quantities in mostadvanced countries at a higher selling price.The purpose of this study is to provide data onthe almond assortment recommended forclimatic conditions in Dobrogea.MATERIALS AND METHODSRSFG Constanta is located in the south-easternRomania, in the area between the Danube andthe Black Sea and has specific steppe climaticconditions. The mean yearly temperatures are11.6°C, hard winters and very hot summerswith low rainfalls. Frosts return is a quite oftenphenomena in spring, fact that affects fruit treeswith early blooming as almond.Absolute temperature beyond the limits ofresistance of almond species: - 26°C, -30 °C orabove + 40°C is rare (once in 20 or once 30years). Rainfall is deficient to the requirementsof the trees; the average amount of rainfall isaround 400 mm, with unequal distribution inthe active growing season (April 1 toSeptember 30). Chernozem soil type is deep,with good condition for water circulation, wellsupplied with humus.The almond genotypes were studied at RSFGConstanta more than ten years. The plantingdistance was 5 m between rows and 4 mbetween trees on row; the almond rootstockwas bitter almond. The crown shape wasvase.The trees were pruned every year,fertilized and irrigated; the phyto-sanitarytreatments were applied uniformly in the field.All studied cultivars were observed from thephenological point of view. The beginning offlowering was considered when the first openflower was visible and the end of it was noticedwhen the last petals of the flowers fell. Theblooming intensity was noted from 0 (absent)to 5 (abundant), according with the researchmethodology of fruit tree breeding (Cociu,1989).The self fertility of almond cultivars wasevaluated by isolating branches with flowersusing paper bags. The fruit were numbered andwere expressed as percentage. The kernelstrengthening occurs when the embryocotyledons pass from liquid to solid state, and it201

was evaluated by using a large-sized needle.The fruit on the branches were pierced duringtheir growth. The kernel was consideredstrengthened when the needle had notpenetrated the fruit. The almond kernel yieldwas evaluated by weighing the tree crop(kg/tree).RESULTS AND DISCUSSIONSThe beginning of the flowering was gradually,starting with Tuono (25.03), followed by Maride stepa (29.03); the last one that flowering wasTardy non Pareille (18.04). Also, the end of theflowering was recorded between 16.04 (Maride stepa) and 1.05 (Ai). The flowering on thesame tree at the studied cultivars is gradually.That was noted to other fruit tree as peach andapricot (Manescu, 1975). The late floweringcultivars flowering time ranged from 12 to 14days; the cultivars that bloom earlier had alonger flowering period, even over 30 days(Tuono). The flowering intensity was abundantand very abundant, being noted by 5 or 4-5 toall studied almond cultivars. The kernelstrengthening of almond begins on 8.06(Ferragnes) and finish on 20.08 (TetenyBotermo, Nikitski, Feraduel). The kernelstrengthening phase has the highestrequirements for water and nutrientsconsumption (critical phase). The fruit yield isreduced during the very dried growing seasons;many of them remain small, dry orincompletely formed; also, the phenomena wasnoticed by Cociu (1954). The ripening timestarted on 3.09 (Preanîi), followed by Mari destepa, continuing every 2 or 3 days, until on2.10 (Tuono) for a period of one month. Allcultivars studied are auto incompatible in thepollination processes, as shown in table 2.Table 1. The phenology of flower buds and ripening time of almond at Valu lui Traian, south-eastern Romania(multiannual date)Beginning of End of Flowering timeKernel RipeningCultivar Intensity flowering flowering (days)strengthening timePreanîi 3.04 21.04 18 5 17.06 3.09Mari de stepa 29.03 16.04 19 4 10.06 6.09TetenyBotermo6.04 22.04 16 5 20.06 10.09Lovrin 5.04 22.04 17 5 11.06 17.09Pomorie 3.04 21.04 18 4-5 8.06 18.09Thompson 8.04 27.04 19 5 17.06 19.09Nikitski 9.04 27.04 18 3-4 21.06 22.09Feraduel 16.04 28.04 12 5 20.06 28.09Ferragnes 16.04 30.04 14 5 8.06 1.10Ai 14.04 1.05 17 4-5 11.06 20.09Tardy non pareille 18.04 30.04 12 4-5 10.06 20.09Marcona 10.04 27.04 17 4-5 19.06 26.09Tuono 25.03 28.04 34 2 9.06 2.10Table 2. The pollination behavior of almond cultivars, Valu lui TraianSelf pollinationOpen pollinationCultivarNumber of flowers Number ofNumber of Number of % in paper bagsfruitsflowers fruitsPreanîi 264 0 0 - -Mari de step - - - 98 16TetenyBotermo240 0 0 - -Lovrin 153 0 0 - -Thompson 315 0 0 458 36Nikitski 250 0 0 420 159Feraduel Ferragnes 320 0 0 197 40Ai 255 1 0 - -Marcona 338 0 0 - -202

The highest yields were recorded at Preanîi (8.8kg /tree), followed by Lovrin (7.0 kg/ tree) andFerragnes (6.7 kg/tree), table 3. A big kernelweight was recorded to Feraduel (1.7 g). Theshells of the studied cultivars were both hardand thin, table 3.At RSFG Constanta the present assortment hasthe following cultivars and selections: Sabina,Sandi, Cristi, Adela, April, Ana (created atRSFG Oradea) and Autofertil 1 Autofertil 2Autofertil 3 (hybrids obtained atRSFG Constanta) Teteny Record BT almond1-12, Migdal RT 70-12, Migdal T.B. 12-24/61,12-25/51 Kedvenk, T.B. 12-27, Apolka 12-33/36, Andosa, Szeget (almond cultivars andselections introduced from Hungary).In 2012, a number of 54 genotypes weregrafted in order to be introduced in germplasmfound.Table 3. Average yield of almond at Valu lui Traian,south-eastern Romania (multiannual date)CultivarAverageyieldkg/treeShellweight(g)Kernelweight(g)Softness ofshellPreanîi 8.8 1.8 1.0 softMari destepa3.4 3.5 1.4 hardTetenyBotermo3.8 2.2 1.0 softLovrin 7.0 4.6 1.2 hardThompson 3.0 3.1 1.0 softNikitski 3.5 4.0 1.4 softFeraduel 5.0 5.9 1.7 hardFerragnes 6.7 3.5 1.4 hardAi 3.5 3.0 1.5 softMarcona 5.0 1.5 0.8 hardTuono 1.0 - - hardCONCLUSIONSThe almond cultivars studied provide goodyields and can be recommended to be plantedin orchards in south-eastern part of Romaniaalthough flowering time occurs earlier than inother fruit species.The almond cultivars studied are autoincompatible; therefore it should be providedpollinators cultivars for orchard.Studied cultivars yielding for one month,starting in early September (Preanîi) until earlyOctober (Tuono).REFERENCESCociu V., 1954. Migdalul. Ed. Agro-Silvica de Stat,Bucuresti.Cociu V., Oprea St., 1989. Metode de cercetare înameliorarea plantelor pomicole. Ed. Dacia, Cluj-NapocaCociu V., 2003. Culturile nucifere. Ed. Ceres, Bucuresti.Cociu V., 2007. Sa ne cunoastem si sa ne iubim pomii:nucul, alunul, migdalul. Ed. M.A.S.T., Bucuresti,2007.Manescu Creola, Baciu Eugenia, Cosmin Silvia, 1985.Controlul biologic în pomicultura. Ed. Ceres,Bucuresti.203

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653THE INFLUENCE OF FERTILIZATION RECIPES UPON SEEDPRODUCTION OF MADARASENI CLIMBING BEAN VARIETYAbstractAlexander Kurt HEITZ, Elena TEFNESCU, Elena Liliana DUMITRACU,Minerva HEITZSCDL Iernut, Energeticianului street, no.1/A, 545100, Mures district, RomaniaCorresponding author email: elenastef14@yahoo.comThe investigations were conducted at SCDL Iernut.. The experience has included 11 fertilization types based onnitrogen, phosphorus and potassium (N, P 2 O 5 and K 2 O), in four repetitions. The spread fertilizers was made gradually,in three main points: 1. In autumn was applied the whole dose of P 2 O 5 from superphosphate; 2. Before sowing, momentin which was administered 1/2 N (nitrogen) and 1/2 K (kalium) doses; 3. During the growing season, in thedevelopment plant stage of the climbing bean “early flowering', was applied 1/2 N (nitrogen) and 1/2 K (potassium)doses.From the comparison of the yields productions as the average achieved over the three-year study of theexperimental variants, both toward the witness V1 as well as against the average of 11 variants revealed that the bestoption was V 4 (N/P 2 O 5 /K 2 O -100/150/150) variant.Key words: climbing beans, fertilization recipes, seed.INTRODUCTIONEnsuring the environmental conditions specificto each cultivar determines the achievement ofcultivars production at the full potential. Bothtemperature and humidity conditions andcultivar specific nutrients are the main factorsin their productions (Heitz A.K., 2013).In this paper are presented the results ofresearches on the influence of some fertilizerrecipes (NPK) of Madaraseni climbing beanvariety under the environmental conditions ofSCDL Iernut.100/150/300; in 4 repetitions, where V 1 -theunfertilized variant was used as control group(Table 1, Figure 4).MATERIALS AND METHODSResearches has been carried out in the period of2010-2012 year on Madaraseni climbing beanvariety (Figure 1,2,3), created at SCDL Iernut.It was used as a biological material – pre-basicseed.The purpose of the experiments was to forcethe phonotypical expression of genetic potentialregarding the capacity of seeds production ofMadaraseni climbing bean by using the bestrecipes of chemical fertilizers (NPK).Experience has encompassed 11 variants(N/P 2 O 5 /K 2 O):V 1 -0/0/0, V 2 -0/150/150, V 3 -50/150/150, V 4 -100/150/150, V 5 -200/150/150,V 6 -100/0/150, V 7 -100/75/150, V 8 -100/300/150,V 9 -100/150/0, V 10 -100/150/75, V 11 -205Figure 1. Madaraseni variety-plantsFigure 2. Madaraseni variety – pods and flowers

Figure 3. Madaraseni variety-seedsTable 1. Experimental variantsThe applied fertilizer dose (kg s.a./ha)The variantN P 2 O 5 K 2 OV 1 0 0 0V 2 0 150 150V 3 50 150 150V 4 100 150 150V 5 200 150 150V 6 100 0 150V 7 100 75 150V 8 100 300 150V 9 100 150 0V 10 100 150 75V 11 100 150 300Method of workingManagement of fertilizer was made gradually,in three main points:1. In fall was applied, on variants, the entiredose of P 2 O 5 from superphosphate;2. At the preparation of the seedbed forseeding, at which time was administered thedose of 1/2 N (nitrogen) and 1/2 K (potassium);3. During the vegetation period, in the developmentphase-'starting blooming'-of the climbingbean plant was applied the dose of 1/2 N(nitrogen) and 1/2 K (potassium).The cultivation technologySetting up experience has been carried out inthe second decade of May, at the time when theground was not recorded temperature decreasesbelow the 8-10°C at the depth of sowing.The location of the experienceThe experience has been carried out on theground with medium texture, with a neutral PHslightly acidic (pH 6.5-7.0). The land preparationbegan on fall through a furrow of 22-24cm deepness and through the fertilizers’ incorporation(superphosphate) from the base fertilization.On spring, before sowing, was made thesoil mobilization, herbicide, the application ofexperimental variants, fertilizing with half fromthe total dose of nitrogen and potassium on theexperimental variants. The experience wasencased after the hoeing vegetables, after theplanting scheme: 80cm between rows and 35cm between plants/row (Figure 6).Figure 4. Fertilization prescriptions of the experimentalvariants of Madaraseni climbing bean, the average(2010-2012) – SCDL IernutThe setting of the experience-in superposedblocks, randomized, four repetitions (Ceapoiu,1968) with tape on all the edges of experience(Figure 5).Figure 5. Arranging experimental variants206Figure 6. Sowing chart (scheme)Before sowing, the seed was treated withNitragin-beans.During the growing season were made 2 mechanicalhoeing with the growers followed bythe manual hoeing on row (for three times).Fertilization from the vegetation period wascarried out at the 'early blooming' time with thesecond half of the nitrogen and potassiumfertilizers.

During the growing season have been madephenotypically observations and biological purificationsby which the untypical plants havebeen removed, damaged by disease or pestswith mechanical blows from different sources.Harvesting was performed in the physiologicalmaturity stage, gradually, on experimentalvariants.RESULTS AND DISCUSSIONSAfter extracting and selecting seeds manually,on variants, the quantity of produced seeds ineach variant has been weighed separately. Theexperimental results (Table 2, Figure 7) fortheproduction of seed were statistically processed.Figure 7. Seeds production of the Madaraseni climbingbeans, the average on 3 years (2010-2012)-SCDL IernutIn comparative culture organized on variants infour repetitions have been calculated the seedproduction/ha (Table 2) by which wasestablished the fertilizers recipes influence onseed production per unit area by using thesignification of statistical differences (Table3, 4).Table 2. Bean seeds’ production (t/ha) of Madarasenivariety (2010-2012), on variants and repetitions – SCDLIernutVariant R1 R2 R3 R4 V meanV1 2,43 2,5 2,43 2,5 9,86 2,465V2 2,7 3,06 2,83 2,86 11,45 2,8625V3 3,73 3,83 3,93 3,7 15,19 3,7975V4 4,3 4,16 4,13 4,33 16,92 4,23V5 3,8 3,86 3,93 4,1 15,69 3,9225V6 2,6 2,46 2,53 2,4 9,99 2,4975V7 3,1 3,3 3,2 3,13 12,73 3,1825V8 2,96 2,96 3,06 3,26 12,24 3,06V9 3,06 3,2 3,06 3,2 12,52 3,13V10 3,46 3,6 3,5 3,56 14,12 3,53V11 3,16 3,1 3,03 3,23 12,52 3,13Dispersional analysis (Ceapoiu N., 1968) hasbeen determined by indicators relating the sumof squared deviations for: total (SP T ), rehearsals(SP R ), versions (SP V ), error (SP E ) and thedegrees of their freedom (GL) (Table 3).Table 3. Dispersional analysis (2010-2012)Variability cause SP GL s 2 Testul FTOTAL 13,1139 43 REPETITIONS 0,05022 3 VARIANTS 12,774 10 1,277 130,64 (2.16; 2.98)ERRORS 0,293 30 0,009 Because the calculated value 'F' is greater thanthe theoretical value of 'F' indicates thatbetween variants exists differences significantdistinctly or very significantly, as it continuesthe statistically calculation for the interpretationof the obtained results.Table 4. Influena reetelor de îngrmintelor chimiceasupra produciei de smân/ha la soiul de fasoleurctoare Mdreni, media pe 3 ani (2010-2012) –SCDL Iernut Influence of chemical fertilizer recipes onseed production/ha to the Mdreni climbing beanvariety, the average on 3 years (2010-2012) – SCDLIernutYield %Var.(t/ha) x. med MtDiff. Diff.Signif(x. med ) (Mt) Signifx. med 3,25 100 132 0 Mt 0,78 **V 1 – Mt. 2,46 75,8 100 -0,78 00 0 MtV 2 2,86 88,0 116 -0,38 - 0,39 -V 3 3,79 116 154 0,54 * 1,33 ***V 4 4,23 130 171 0,98 *** 1,76 ***V 5 3,92 120 159 0,67 ** 1,45 ***V 6 2,49 76,8 101 -0,75 00 0,03 -V 7 3,18 97,9 129 -0,06 - 0,71 **V 8 3,06 94,1 124 -0,19 - 0,59 *V 9 3,13 96,3 127 -0,12 - 0,66 **V 10 3,53 108 143 0,28 - 1,06 ***V 11 3,13 96,3 127 -0,12 - 0,66 **s d = 0,221; t 5% = 2.04; t 1% = 2.75; t 0.1% = 3.65DL 5% = 0,221 x 2.04 = 0,450DL 1% = 0,221 x 2.75 = 0,607DL 0.1% = 0,221 x 3.65 = 0,806From the statistic analysis of the results, asaverage on three years, concerning thesignificance of the differences against thevariants average (Table 4), have been resulting:-V 4 has recorded a difference very significant,-V 5 has recorded a difference distinctlysignificant,-V 3 has recorded a significantly difference,207

-V 5 has recorded a difference distinctlysignificant,-V 1 and V 6 have recorded a differencedistinctly negative significant.From the statistic analysis of the results, asaverage on three years, concerning thesignificance of the differences against the V 1 -Mt (Table 4) witness variant have resulted:-V 3 ,V 4 ,V 5 ,V 10 have recorded a difference verysignificantly positive towards V 1 –Mt variant;-x med , V 7 , V 9 , V 11 have recorded a differencedistinctly positive significant towards V 1 –Mtvariant;-V 8 has recorded a difference significantlypositive towards V 1 –Mt variant;-V 2 and V 6 have recorded a differenceinsignificant positive towards the control.CONCLUSIONSThe experimental results, as average on threeyears of study, showed that:-V 4 variant-100/150/150 has recorded adifference very significantly positive both fromthe V 1 -0/0/0 witness variant and from theaverage of the variants, from which results thatV 4 represents the best recipe of fertilization.-Increasing the dose of nitrogen is justified onlyup to 100 kg/ha, and the doses of phosphorusand potassium are justified only up to 150kg/ha.REFERENCESCeapoiu N., 1968. Metode statistice aplicate înexperientele agricole si biologice, Editura Agro-Silvica Bucuresti.Heitz A.K., 2013. Rezultate privind perfecionareatehnologiei de producere a seminelor de fasoleurctoare, USAMV-Cluj Napoca, c. doctoral,Facultatea de Horticultur208

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653DETERMINATION ON VITAMIN C IN SEVERAL OLD ROMANIANAPPLE CULTIVARS BY HPLC DURING COLD STORAGEAbstractDan Petrior MANAFU, Dorel HOZA, Ligia ION1 University of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Marasti Blvd, 011464, Bucharest, RomaniaCorresponding author email: ionnagyligia@yahoo.frHigh pressure liquid chromatographic (HPLC) methods were used for measurement of vitamin C and organic acidchanges of forty old Romanian apple cultivars (“Prescurate”,“Gurguiate”,“Zori”,“Carla”,“Mohorat”, “Trotuse”, “MereTari”,”Mar Orbai” etc.) during cold storage. Harvested apples at the last stage of commercial ripeness were placed inperforated stored at 0°C temperature and 90-95% relative humidity for 60 days. Vitamin C content decreased in allcultivars but no significant differences were found in the most important of them from the beginning to the end of thestorage. The highest share of total acids was contributed by citric acid. The high level of vitamin C was measured in thecultivars” Trotuse”, “Ancuta”,”Wachsman Sammeling”and “Wachsman Amalie”. Malic acid content of cultivars alsodecreased with storage time. Tartaric, oxalic and fumaric acid contents fluctuated during storage, but at the end of coldstorage these organic acids had decreased in comparison to initial values.Key words: apple, acids, HPLC, organic ,storage, vitamin C.INTRODUCTIONVariety Office) are applied, as the briefdescriptions and number codes provideThe Apple (Malus x malus) is one of leadingsufficient information for cultivars to befruits which is being grown in temperate regiondifferentiated. They have the advantage thatof the world. Its beautiful appearance, crispythey can be applied on an international scaleflesh, pleasant flavour and sweet taste attractand enable the results obtained by differentthe consumers and fetch high (Adisa, 1986)research teams to be easily compared.Of the old genotypes known to exist in theThe nutritional value of apples is mainly due toCarpathian Basin, almost 200 local cultivarsthe content of Vitamin C (Sanz et al., 1999). Ashave been collected in the germoplasmantioxidant content is becoming an increasinglycollection over the last years.important parameter with respect to fruits andSome of the cultivars found in the germoplasmvegetables, it is of great interest to evaluatecollection could be use not only in breeding,changes in the antioxidant status during fruitbut also in organic farming, so there is a greatstorage (Perez and Sanz, 2001).need for the re-evaluation of the old appleDuring the postharvest period of strawberries,cultivars. Some of the old apple varieties haveprompt cooling and providing properbecome well adapted to the soil and climatictemperature (0°C) and relative humidity (90-conditions of the Carpathian Basin producing95%) are the most important factors togood yields and highly appreciated fruit qualitypreventing the undesirable quality changes(Mitre et al., 2009)(Kader, 1990). The concentration of organicIt is important to examine old apple cultivarsacids is an important factor influencing thebecause the pomological descriptions availableorganoleptic properties of fruits (Lee andfor old cultivars are not uniform. ManyKader, 2000). Their changes during storagecollections of cultivar descriptions use severalshould be reduced. Besides good sensorynames for one cultivar, or the same name forfeatures, consumers prefer apples because ofseveral cultivars. Nowadays, in most cases theguidelines given by UPOV (Uniontheir high content of vitamin C (Schöpplei etInternationale pour la Protection des Obtentionsal., 2002).Végétales) or CPVO (Community PlantVitamin C, one of the most importantnutritional quality factors in apples, has been209

found to prevent the formation of N-nitrosocompounds, the cancer causing substancesfrom nitrates and nitrites found in preservedmeats and some drinking water (Du et al.,2009). Vitamin C has many biological activities(reducing carcinogenesis and cardiovasculardiseases, stimulating the immune system) in thehuman body (Simon, 1992).There are several methods to determine vitaminC content; however some of them needsubjective evaluation and some are notpractical (Agar, 1995). Several postharvestfactors influence the vitamin C and organicacid contents of apple. Despite manyinvestigations in the area of nutrition andpostharvest changes of apples, knowledgeabout the determination of vitamin C andorganic acids by using HPLC is inadequate. Ithas been indicated that ascorbic acid content offruit should be measured by HPLC becauseascorbic acid produces an oxidative-reductionreaction (Asami et al., 2003). The aim of thisresearch was to measure the vitamin C(ascorbic acid) and organic acid contents of 20old Romanian apples varieties by using HighPerformance Liquid Chromatography (HPLC)during cold storage period.MATERIALS AND METHODSForty old apples cultivars (Prescurate,Gurguiate, Viesti, Rosii Stetin, Zori, Carla,Mohorat, Gustav Durabil, WachsmanSammeling, Wachsman Amelie, Ancuta,Ardelean, Trotuse,etc.) grown in the researchand application center of HorticultureDepartment in Bucharest located in south ofRomania region were harvested at the last stageof commercial ripeness (red colour with asurface area of > 75-80%). Harvested fruits inthe early morning were transported to the postharvest laboratory within 30 min. Applescultivars were sorted to eliminate fruits withdefects including overripe or too small fruit.Fruits were selected randomly and placed inperforated (8 perforations with 10 mm diameteron each box) plastic boxes (capacity: 750 g) foreach replicates. Four replicates were used pertreatment. Packaged fruits were stored at 0°Ctemperature and 90-95% relative humidity for10 days. Apples fruits cultivars were analyzedat 5 days intervals (0, 5, and 10 days of storage)during cold storage.Vitamin C (Ascorbic acid) and Organic AcidAnalysisThe HPLC analysis was carried out todetermine the vitamin C and organic acids on aShimadzu class LC VP HPLC system withclass LC-VP software, a pump (LC-6AD), anda UV-VIS detector (SPD-10AV VP). Thecolumns used were YMC Pack-ODS (250 mmx 4.6 mm I.D., 5 μm) for organic acids andSGE (250 mm x 4.6 mm I.D., 5 μm) forvitamin C. The mobile phases were wateradjusted to pH 2.2 with trifluoroacetic acid(organic acids) and to pH 3 with phosphoricacid (vitamin C). Separation was carried out byisocratic elution with a flow rate of 0.4 ml min-1 and column temperature was ambient. TheUV detector was set at 210 nm and 254 nm,respectively. Quantitation was based on thepeak area measurement.Sample (10 g) was extracted in 10 ml wateradjusted to pH 1.5 with trifluoroacetic acid fororganic acids and with 10 ml phosphoric acidwater(2%, v/v) for vitamin C. The extractswere filtered through filter paper. Then, 1.5 mlbuffer (0.01 M KH2PO4, pH 8.0) was added to1.5 ml sample extract. From this, 1.5 ml(organic acids) and 1 ml (vitamin C) of thesemixtures were loaded on to C18 cartridges.After loading, 3 ml water adjusted to pH 1.5with trifluoroacetic acid for organic acids and 2ml phosphoric acid-water(2%, v/v) for vitamin C were passed throughthe cartridges. For HPLC, 20 μl of the eluentswere injected.RESULTS AND DISCUSSIONSGenerally, fruits and vegetables show a gradualdecrease in vitamin C content as the storagetemperature or duration increases (Adisa,1986). In this research, change in vitamin C ofapples during cold storage is shown in Figure1. Vitamin C levels decreased for most ofcultivars from the beginning to the end of thestorage, but this reduction was not statisticallysignificant (P

Likewise, vitamin C content of ‘Gurguiate,Mohorat si Rosii de Stetin, Muntenesc cu coadascurta’ decreases drastically at the 15th day ofstorage in comparison to initial value (Figure2). This can be due to continuous ripeningprocess of fruits.Figure 1. Vitamin C of old apples cultivars during coldstorage.Figure 2. Vitamin C content of varieties ‘Gurguiate,Mohorat si Rosii de Stetin, Muntenesc cu coada scurta’Figure 3. Vitamin C content of varieties ‘Gurguiate’ and‘Trotuse’ at the end of stor¬age.Vitamin C is quite unstable and thus it is alsoan indication of fruit freshness (Holcroft andKader, 1999). Vitamin C content of ‘Gurguiate’was lower than ‘Trotuse’ at the end of storage(Figure 3). It can be concluded that the changein vitamin C content is cultivar dependent.Therefore, this characteristic of cultivars shouldbe taken into consideration in choosing acultivar for storage. The cultivars which loseless vitamin C during storage could bepreferred.Table 1. Results concerning the vitamin C in oldRomanian apples varieties 0, 5, and 10 days of storageNr.CultivarCrt.30.10.2012Mg/100g.p.p.04.11.2012Mg/100g.p.p.09.11.2012Mg/100g.p.p.1. Prescurate 18.59 10.11 5.592. Gurguiate 14.52 6.51 2.043. Red Free 12.45 8.24 3.45Malus4.Floribunda10.04 6.22 3.045. Viesti 16.54 8.45 4.526. Rosii de Stetin 12.82 4.22 2.827. Zori 18.86 9.15 4.868. Carla 19.15 8.98 4.179. Mohorat 12.49 7.52 2.7910. Gustav Durabil 14.57 9.36 4.6911. WachsmanSammeling12. Wachsman24.34 16.3 8.3428.55 19.51 10.55Amalie13. Ancuta 31.42 25.61 13.4214. Ardelean 17.98 8.96 4.4315. Trotuse 35.32 25.36 14.94Rosii de16.Geoagiu25.86 13.51 4.8617. Knis 12.91 9.36 3.91Nobile de18.Geoagiu21.78 12.36 5.78Favoritul lui19.Polocsay12.87 8.89 3.8720. Mere tari 14.73 8.52 4.7321. Malus Teifera 15.28 7.69 5.2822. Pokomache 15.01 8.61 5.0123. Satmaresti 16.50 9.63 5.5024. Cormose 18.83 12.31 4.8325. Calugaresc 16.96 12.36 5.2626. Anisovska 15.93 8.96 3.9327. Marut alb 14.36 8.21 4.3628. Seghese 15.12 9.65 5.1229. Poinic 19.91 14.31 5.9130. Mar15.23 9.63 4.23Muntenesc31. Smeurii 12.27 7.25 3.27Muntenesc cu32.coada scurta12.73 6.94 2.7333. Rosiorcalugaresc34. Rosior15.68 8.51 3.68romanesc19.32 12.35 5.3235. Mar Orbai 18.49 13.21 6.67Verzi de36.Radaseni18.57 11.11 4.5737. Fara nume 24.42 21.32 9.42Dulci de38.Radaseni22.50 16.63 10.5039. Cernenko 19.65 12.67 4.7640. Rosu de Cluj 23.11 19.20 13.11211

CONCLUSIONSThe accurate analysis of vitamin C and organicacids of apples by HPLC enables us to observethe quality changes during postharvest period.Vitamin C and organic acid content of themajority of cultivars changed as a function ofstorage time. Both cultivars had lost vitamin Ccontents at the end of the storage, but ‘Trotuse’showed a greater decrease than ‘Gurguiate’.These results showed that changes in vitamin Ccontents of apples are cultivar dependent. Onthe other hand, the consumer should take intoconsideration that the loss of vitamin Cincreases with storage time. During storage, thehighest share of total acids was exhibited bycitric acid. This acid decreased by 10 days ofcold storage in comparison to initial values.In future investigations, we propose that theobjective analytical determination of thesecritical components should be coupled withsubjective evaluation by a taste panel toprovide useful and meaningful informationabout quality changes of apples during thestorage.REFERENCESAdisa V. A., 1986. The influence of molds and somestorage factors on the ascorbic acid content of orangeand pineapple fruits. Food Chemistry 22, p. 139-146.Agar T., 1995. A sensitive method to determination of L-Ascorbic asid, dehydroascorbicasid and total vitaminC:microfluorometric method (in Turkish). CukurovaUniversity Journal of the Faculty of Agriculture 9 (1),p. 11-20.Asami D.K., Hong Y.J., Barrett D.M. and Mitchell A.E.,2003. Comparison of the total phenolic and ascorbicacid content of freeze-dried and air-driedmarionberry, strawberry, and corn grown usingconventional, organic, and sustainable agriculturalpractices. Journal of Agricultural and FoodChemistry 51, p. 1237-1241.Asif Ali M., Raza H., Azam M., Khan and Manzoor H.,2004. Effect of different periods of ambient storageon chemical composition of apple fruit. Int. J. Agri.Biol. 6 (2), p. 568-571.Du G., Li M., Ma F. and Liang D., 2009. Antioxidantcapacity and the relationship with polyphenol andvitamin C in Actinidia fruits. Food Chemistry 113, p.557-562.Holcroft D.M. and Kader A.A., 1999. Controlledatmosphere-induced changes in pH and organic acidmetabolism may affect color of stored strawberryfruit. Postharvest Biology and Technology 17, p. 19-32.Kader A.A., 1990. Quality and its maintenance inrelation to postharvest physiology of strawberry, Thestrawberry into the 21 st century, proceeding of thethird north American strawberry conference,Houston, Texas, p.145-152.Lee S.K. and Kader A.A, 2000. Preharvest andpostharvest factors influencing vitamin C content ofhorticultural crops. Postharvest Biology andTechnology 20, p. 207-220.Mitre I, Mitre V, Ardelean M, Sestras R, SestrasA, 2009. Evaluation of old apple cultivars grown incentral Transylvania, Romania. Not Bot HortiAgrobo 37 (1), p. 235-237.Pelayo C., Ebeler S.E., Kader A.A., 2003. Postharvestlife and flavor quality of three strawberry cultivarskept at 5°C in air or air + 20 kPa CO 2 . PostharvestBiology and Technology 27 (2), p. 171-183.Perez A.G., Sanz C., 2001. Effect ofhigh-oxygen andhigh-carbon-dioxide atmospheres on strawberryflavor and other quality traits. Journal of Agriculturaland Food Chemistry 49, p. 2370-2375.Sanz C., Perez A.G., Olias R., Olias J.M., 1999. Qualityof strawberries packed with perforatedpolypropylene. Journal of Food Science 64 (4), p.748-752.Schöpplein E., Krüger E., Rechner A., Hoberg E., 2002.Analytical and sensory qualities of strawberrycultivars. Acta Horticulture 567, p. 805-808.Simon J.A., 1992. Vitamin C and cardiovascular disease.Journal of the American College of Nutrition 11, p.107-125.212

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653AbstractINFLUENCE OF WINTER FROSTS ON SOME PEACH CULTIVARSOF DOBROGEACristina MOALEResearch Station for Fruit Growing Constanta, No.1, Pepinierei Street, 907300,Commune Valu lui Traian, district Constanta, RomaniaCorresponding author email: moalecristina@yahoo.comThis heat-loving species always found good conditions for growth and fructification in the south-eastern part ofRomania, and especially in Dobrogea. Climate accidents are increasingly studied in fruit trees in recent years underglobal climate change. The limitative factor of the peach production in this area is represented by temperatureoscillations during winter, i.e. relatively high values followed by low temperatures, which may compromise the fruityield in certain years (2010; 2011; 2012). At the Research Station for Fruit Growing Constanta, a total of 6 cultivars ofpeach (Springcrest, Springold, Collins, Cardinal, Redhaven, Southland) with different maturation periods were studied.This paper presents the manner in which the peach tree species replied to winter frosts in the climatic conditionsrecorded in the winters of 2010, 2011 and 2012. The obtained results demonstrate the importance of choosing theproper assortment of peach cultivars for the region.Key words: Prunus persica, late frosts, Cardinal, Redhaven, Southland, loses.INTRODUCTIONPeach fruit tree is the third species after appleand plum trees in our country and is grown inwarmer areas with average annual temperatureof 10 to 11.5°C, with deep porous soil, pHbetween 5.7 and 7.5 and active limestonecontent not exceeding 7% g/g when using francrootstock, and 15% when the rootstock isalmond (Stanica F. and Braniste N., 2011).Due to climate change in recent years it hasbeen found that the resistance of peachcultivars is very different from one year toanother.The Black Sea Coast is situated in the area withthe largest annual average sums of day lengthon the country’s territory, sums which exdeeds2250-2300 hours (Paltineanu Cr. et al., 2000).Previous research papers hay revealed that theimpact of climatic changes upon fruit-growingspecies can already be felt. For instance, by theend of the 1990s, the flowering of the trees inGermany was occurring several days earlier(Chmielewschi F.M. et al., 2004 and 2005).The vegetative season in Europe became longerby 10 days in the past 10 years (ChmielewschiF.M. and Rotzer T., 2002). Due to the earlyflowering of the trees, in certain regions ofEurope there was an increase in the risk of213damage caused by late frosts (Anconelli et al.,2004; Sunley et al., 2006; Legave J.M. andClauzel G., 2006; Legave J.M. et al., 2008;Chitu E. et al., 2004 and 2008) or by thedisorders in the pollination and fruit settingprocesses (Zavalloni C. et al., 2006).Thepurpose of this paper is to highlight theinfluence of winter frosts on some cultivars ofpeach production of Dobrogea in the lest threeyears.MATERIALS AND METHODSThe observations and determinations werecarried out in the plots cultivated with some ofthe nectarine tree cultivars 3 to 5 days after theclimatic accidents recorded in the years 2010,2011 and 2012. The plots are situated in theexperimental base within the Research Stationfor Fruit Growing (R.S.F.G. Constanta), Valului Traian. The degree of differentiation of theflowering buds was relatively good. Samples ofbranches were collected and analysed, thesebelonging to 6 peach tree cultivars: Springold,Springcrest, Cardinal, Collins, Redhaven andSouthland, which were planted in 1986. Thestock parent that was used was the franc peachtree with a density of 625 trees/ha (4m x 4m

planting scheme). The chosen shape of thecanopy was the free palmette.The soil is a calcareous chernozem, with aloamy texture and a low alkaline pH (8.2) on itsentire profile. On average, the climaticconditions were also favourable to the growthand fructification of the trees, with theexception of the years 2010, 2011 and 2012,when a strong frost occurred in January andFebruary, causing the loss of several floweringbuds. The climatic data were recorded with theaid of an automatic meteorological station, typeWatchDog, and were processed as diurnalaverages.It was found that the resistance is very differentpeach cultivars from year to year due to climatechange in recent years and the magnitude ofclimatic accidents.Determinations were carriedout in order to assess the losses of floweringbuds due to temperature variations duringwinter and the low diurnal temperatures.RESULTS AND DISCUSSIONSAlthough the south-eastern part of Romania hasbeen considered to be favourable to the cultureof peach tree, this suffered because of theclimatic variations, mainly the aggressivenessof the low temperatures in alternation with themaximum positive values. The peach treerecorded losses because of these variationswhich occurred during the dormancy period inthe climatic conditions of 2010, 2011 and2012.It was noticed that the resistance of peachtree cultivars differs from one year to anotherbecause of the climatic changes occurred in thepast years. Other factors are: the alternationbetween minimum and maximum temperaturesduring winter, which reduces the trees’resistance and last but not least, the severity ofthe climatic accidents (Figure 1).Figure 2 reveals the fact that the coldest monthin the period October 2009 – March 2010 wasJanuary 2010, when, for 10 consecutive days,the values recorded ranged between-10.1°C(January 29 th ) and-17.7°C (January 24 th and25 th ). Moreover, in the same period, thetemperatures in the valleys dropped bellow-18°C, up to-20°C (local observations). Thesevalues, together with the big diurnal differencesin temperature in the month of February causedthe loss of some flowering bud, in earlycultivars such as Springold (61%), Springcrest(59%) and Cardinal (39%).Figure 1. Aspects of the winters of 2010, 2011 and 2012with the frost on the branchesIn the October 2010-March 2011 period, thelowest temperature was recorded in January:-12°C. The lowest temperature recorded duringthis period affected Springold cultivars in 40%and Spingcrest with 38%.As can be observed in Figure2c, January wasthe coldest month, with 9 days displayingaverage diurnal values ranging between-10.2°Cand-17.6°C. These values, together with theextreme amplitudes in February (7 days withaverage diurnal values ranging from-10.4°C to-16.4°C) and 8 consecutive days of glazed frostand ice on branches caused the loss of 31%-63% of the flowering buds of all the studiedcultivars.214

Figure 2. Air temperature (°C) in the cold periods: October 2009 – March 2010 (a), October 2010 – March 2011 (b),October 2011 – March 20120 (c) at Valu lui Traian, ConstantaThus, the losses for the Springold cultivar wereof approximately 61% in 2010, 39% in 2011and 89% in 2012, there being differencesbetween cultivars. The losses caused by frostfor the Springcrest cultivar were of 59% in2010, 37% in 2011 and 84% in 2012. For theCardinal cultivar the losses were of 39% in2152010, 29% in 2011 and 66% in 2012, whereasfor the Collins cultivar, the values were 37% in2010, 21% in 2011 and 54% in 2012. For theRedhaven cultivar the values were thefollowing: 32% in 2010, 23% in 2011 and 62%in 2012. Finally, for the Southland cultivar, the

losses represented 29% in 2010, 16% in 2011and 48% in 2012 (Figure 3).Figure 3. Procentage of peach tree flowering budsperished due to frosts during the winter of 2010, 2011and 2012 at Valu lui Traian, ConstanaUnder these conditions, the Springold andSpringcrest cultivars were destroyed at a levelof magnitude over 60%, the Cardinal cultivar –45%, the Redhaven cultivar, which was lessafftected, was destroyed at a level of 39%,while the Collins and Southland cultivars wereaffected with 37% and 31%, respectively(Figure 3). The climatic accidents recorded inthe months of January and February 2010 and2012, when the temperature suddenly droppedto-17°C (minimum diurnal temperature in2010) and-16.4°C + 8 days of hoarfrost in 2012affected the peach production for the earlycultivars Springold, Springcrest and Cardinaland partially for the Redhaven, Collins andSouthland cultivars (Figure 4 and 5).Figure 4. Procentage of peach tree flowering budserished because of frosts (average over the three years),Valu lui TraianFigure 5. Aspects of the winter of 2012 with glazed froston the branchesCONCLUSIONSThe fruit production of the peach tree specieswas affected in variable percentages accordingto the cultivar, following the climatic accidentsrecorded in the winters of 2010, 2011 and2012.The novelty of the results is the fact that thefrosts in the winters of 2010, 2011 and 2012affected the peach tree species according to thecultivar (approximately 31-63%).The flowering buds losses were over 60% inSpringold and Springcrest cultivars: howeverthese cultivars were also planted in the lowestaltitude locations.The smallest losses in the three studied years(2010, 2011 and 2012) were recorded theSouthland cultivar.There was an increasing trend in frost damagesfor the last three years.216

REFERENCESAnconelli S., Antolini G., Facini O., Giorgiadis T.,Merletto V., Nardino M., Palara U., Pasquali A.,Pratizzoli W., Reggitori G., Rossi F., Sellini A.,Linoni F, 2004. Previsione e difesa dalle gelatetardive – Risultati finali del progetto DISGELO.CRPV Diegaro di Cesena (FO). Natiziario tecnicoN.70, ISSN 1125-7342, p. 64.Chitu E., Butac M., Ancu S. and Chitu V., 2004. Effectsof low temperatures in 2004 on the buds viability ofsome fruit species grown in Maracineni area. Annalsof the University of Craiova. Vol. IX (XLV), ISSN1435-1275, p. 115-122.Chitu E., Sumedrea D., Paltineanu C., 2008.Phenological and climatic simulation of late frostdamage in plum orchard under the conditions ofclimate changes foreseen for Romania. ActaHorticulturae (ISHS) 803, p. 139-146.Chmielewski F.M., Rotzer T, 2002. Annual and spatialvariability of the begenning of growing season inEurope in relation to air temperature changes. Clim.Res. 19 (1), p. 257-264.Chmielewski F.M., Muller A., Bruns E., 2004. Climatechanges and trends in phenology of fruit trees andfield crop in Germany, 1961-2000, Agricultural andForest Meteorology 121 (1-2), p. 69-78.Chmielewski F.M., Muller A., Kuchler W., 2005.Possible impacts of climate change on naturalvegetation in Saxony (Germany). Int. J. Biometeorol,50, p. 96-104.Legave J.M. and Clazel G., 2006. Long-term evolutionof flowering time in apricot cultivars grown insouthern France: wich future imtacts of globalwarmings Acta Horticulturae, 714, p. 47-50.Legave J.M., Farrera I., Almeras T., Calleja, M., 2008.Selecting models of apple flowering time andunderstading how global warming has had an impacton this trait. Journal of Horticultural Science &Biotechnology, 83, p. 76-84.Paltineanu Cr., Mihailescu I.F., Seceleanu I., 2000.Dobrogea, conditiile pedoclimatice, consumul sinecesarul apei de irigatie ale principalele culturiagricole. Editura Ex Ponto, Constanta, p. 258.Stanica F., Braniste N., 2011. Ghid pentrupomicultori Editura Ceres, Bucuresti 2011 ISBN976-973-40-0859-9 p. 93-104Sunley R.J., Atkinson C.J., Jones, H.G., 2006. Chill unitmodels and recent changes in the occurrence ofwinter chill and soring frost in the United Kingdom.Jurnal of Horticulturae. Science & Biotechnology,81, p. 949-958.Zavalloni C., Andersen J.A., Flore J.A., BlackJ.R., Beedy T.L., 2006. The pileus project: climateimpacts on sour cherry production in the great lakesregion in past and projected future time frames. ActaHorticulturae, 707, p. 101-108.217

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653INFLUENCE OF FUNGICIDES AND ANTAGONISTIC YEAST PRODUCTON POSTHARVEST STRAWBERRIES QUALITYAbstractCristina PETRIOR 1 , Gheorghe CÂMPEANU 2 , Elena DELIAN 21 Research Station for Fruit Tree Growing Baneasa, 4 Ion Ionescu de la Brad Blvd.,District 1, Bucharest, Romania2 University of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Marasti Blvd., District 1, Bucharest, RomaniaCorresponding author email: crisstop@yahoo.comDecay of fruits after harvest often causes loss as a great 30-40% of harvest crop. Much of this is due to rotmicroorganisms which are currently controlled by fungicides and antagonistic yeast treatments but they may havepotential toxicity on human health and the environment. Biological control of postharvest diseases presents analternative and attractive option. Therefore the aim of this study was to evaluate effects of preharvest application offungicide treatments on decay and quality of strawberry fruit and during storage. Strawberry fruits were analysed inall experimental variants for quality parameters (dry matter, titratable acidity, soluble solids, ascorbic acid content,anthocyanins) at harvest and after cold storage. The results obtained indicates that preharvest applicationof antifungic treatments maintaing quality of strawberry postharvest and during storage and reduce the appearance ofgray mold. Vitamin C and soluble solids slightly decreased after cold storage period for both control and treatmentsvariants. Also, preharvest treatment does not affected the total anthocyanins content in fruit at harvest and during coldstorage.Key words: biologic control, Botrytis cinerea, decay, fruit quality.INTRODUCTIONlarge volumes. Due to high moisture, sugarsand acids content, these fruits are highStrawberries are known as a highly perishableperishable, being an ideal substrate for thefruit and susceptible to mechanical injury,proliferation of microorganisms, such as fungusphysiological deterioration and microbialof the generous: Botrytiscinerea and Rhizopusdecay, but very appreciated by the consumersstolonifer.(Costa et al., 2011). However, aAmong the main problems associated with theconsiderable amount of strawberry fruit is lostquality of strawberry, we can distinguished theduring fruit growth and after harvest becausegrey mold (Botrytis cinerea) a common type ofdecay.rottenness that attacks the fruit during any of itsThe flavour is one of the most importantdeveloping stage, and is the main diseaseproperties that gives commercial value to theduring ripening time. (Sesan, 2006; Wszelakifruits in generally. Strawberry flavor isand Mitcham, 2003).conditionated in part by the balance betweenDue to the high affinity to rotting, researchessugars and acids expressed in ripe fruit. It isare being conducted to find a method ofvery important to know the best stage at whichconserving the fruit for a longer period by thewe can harvest the fruits. Attempts have beenuse different methods in order to make itsmade to assess the stage of ripeness oftransport to farther markets viable.strawberry fruits in terms of titratable acidity orPromising results have been achieved usingsugar/acid ratio.antagonistic microorganisms to effectivelyThe high perishability of strawberry is theinhibit postharvest pathogens ofreason for its relatively short period of harvestcompels the producer to sell the fruitsdifferent harvested commodities (Abano andimmediately, evidently prejudicing him withSam-Amoah, 2012; Zhao et al, 2011;respect to the reduced price due to its sale inXianghong and Shiping, 2009; Grabenisan etal., 2007; Janisiewicz and Korsten, 2002).219

Taking into the account these and the fact thatfruits are eaten especially by the children andby the people with health problems, theresearchers are concerned to find storagemethods without chemicals like syntheticfungicides (De Souza et al.,1999; Sanz et al.,1999). The cold storage atmosphere preventsdecay development by retarding pathogenicmicroorganisms growth and reducing pathogenenzyme activity (Menel et al., 2012).The use of synthetic fungicides render severeside effects affecting the environment andhuman health. The usage of antagonistic yeastproduct against postharvest pathogens offers aviable option with hopeful results.The potential use of Saccharomyces cerevisiaeyeast was studied and emphasize by someauthors for corn and sorghum species (Piccininet al., 2005; Roncatto and Pascholati, 1998).Until now, in literature there are very fewinformation about the effects of S. cerevisiaeyeast on disease and maintaining qualitypostharvest of strawberry (Gouvea et al., 2009).Therefore, the objective of this study is toevaluate the combined effect of antagonisticyeast (based on S.cerevisiae), syntheticfungicides and cold storage to prevent decaydevelopment and extend the shelf life ofstrawberry.MATERIALS AND METHODSStrawberry cultivars studied were Favette,Cardinal, Pandora, Hood. For all cultivars wereapplied three plant treatments prior toharvest, in different stages: at full bloom, fruitonset and preripening of fruit in threeexperimental variants:V1-control-plants was sprayed with distilledwaterV2-plants was sprayed with Topsin solutionV3-plants was sprayed with antagonistic yeastproduct (suspension of Saccharomycescerevisiae)Samples were taken from 15 fruit at harvestand after 6 days during cold storage (4º-5ºC).There were three replication for the assays ineach treatment, and the experiment wasrepeated in two seasons. Fruits qualityattributes was analyzed by specific methods:- dry matter was measured by drying someknown amount of fresh fruit to a constantweight in a oven at 105°C, the results wereexpressed in percentage- soluble solids content (SSC) was determinedby measuring refractive index of strawberryjuice using an Abbe refractometer withtemperature correction, and the results wereexpressed as ° Brix- titratable acidity (TA) content was measuredby titration of fruit juice with solution 0.1 NNaOH until reaching an endpoint of pH 8.1and expressed as a percentages of citric acid-the ratio between the soluble solids contentand the titratable acidity, which reflects thefruit taste feature, was derived.- ascorbic acid content wasspectrophotometrically determined using the2,6-dichlorophenol-indophenol method and theresults were expressed as mg /100 g FW- total anthocyanins content was determinatedusing the pH diferential method (Giusti andWrolstad, 2001). The pigment content wascalculated and expressed as pelargonidin-3-glucoside/100 g FW, the most abundantanthocyanin in the strawberry fruit.- the presence of Botrytis cinerea was visuallyevaluated during the experiment, expressed asa percentage of fruit showing decay symptoms.RESULTS AND DISCUSSIONSStrawberry fruits were analyzed in allexperimental variants for quality parameters atharvest and after 6 days of cold storage (4-5ºC) in the aim to evaluate influence ofantifungic treatments on fruit qualityevolution.The dry matter content remained practicallyconstant at Favette and Pandora cultivars atharvest for all 3 variants (table 1). However wecan observe an increase of dry matter for V2and V1 variants at Cardinal and Hood at harvest. Afterstorage dry matter increased slightly in case allvariants studied for all four cultivars (table 2).The fruits treated with antagonistic yeast (V3)had higher levels of the SSC to control for allcultivars studied at harvest stage. These resultsare in accordance with dates obtained byGouvea et al., 2009. Strawberry fruit SSCdecreased slightly after 6 days of coldstorage for all three variants studied. Similar220

esults were obtained by Costa et al., 2011 andAlmenar et al., 2007. This parameter is ofcommercial interest, especially for fresh fruit,because the consumer prefer sweeter fruit.Little differences in TA content were alsoobserved among treated strawberry and controlat harvest (table 1) Strawberry presented anincrease in acidity during storage as seen intable 2. These results are in agreement withstudies of De Souza et al., 1999; Sanz et al.,1999.The SSC/TA ratio decreased after 6 daysof cold storage ranging from 16.62 to 8.54(table 2) with values above the commercialrequired (8.00) characterized by equilibratetaste.Sugars and acids are utilized as the mainsubstrates of respiratory metabolism, causingcorresponding changes in SS, TA and pHduring storage. The differences in TA and SSCresults among different experiments may berelated to different respiratory rates ofcultivars. Thus as higher SSC degradation isrelated to great respiratory rate and to higherfruit decay.At harvest there are no differences between theanthocyanins content of varieties treated withfungicides or yeast product and the untreatedvarieties (table 1). The content of anthocyaninsvaries according to the cultivar. Such as Hoodcultivar have a content higher compared toFavette and Cardinal and closed toPandora These results are in agreement withresults of Costa et al., 2011 and Zheng et al.,2007.After 6 days of storage the total anthocyaninscontent increase slightly. There are nodifferences between cultivars treatments anduntreatment after storage.The strawberry are fruits with medium ascorbicacid content and all cultivars studied presentsan average content of 65 mg/100 g freshweight and varied with cultivar at harvest.After 6 days of cold storage ascorbic acidscontent decrease for all cultivars studied andthere are no differences between control andtreatment fruit (table 2).It can be seen that the cultivars with highcontent of anthocyanins at the same time have ahigh concentration of ascorbic acid. Thesecultivars have also had a low percentageof Botrytis cinerea compared to other, after 6days of storage.The quantity of decayed fruit increases withstorage time but is decrease in variants treatedwith fungicides and antagonistic yeast (table 2).In our study the presence of Botrytiscinerea was observed in great percent atuntreated sample especially after 6 days of coldstorage. These results are in agreement withobservations of Costa et al., 2011 and Menel etal., 2012. Thus it can be concluded that as bothtreatments with fungicides and antagonisticsyeast support resistance to infections and thusincrease shelf –life of cultivars.According to the results obtained by us, anessential role in maintaining the quality offruits and disease resistance postharvest it hasthe antioxidant capacity of cultivars expressedtheir increased content in anthocyanins,ascorbic acid, polyphenols. Spraying withfungic treatments were effective in inhibitingstrawberry fruit decay especially at harvest.Mold development on the fruits were alsoreduced by cold storage and treatments withyeast.CONCLUSIONSThe results showed that efficacy ofyeast product in inhibiting gray mold decayand maintaining the quality of fruit duringstorage. Evolution of quality parameterspostharvest and after cold storage wasdependent on cultivar.An essential role in maintaining the quality ofstrawberries and disease resistancepostharvest it has the antioxidant capacity ofcultivars.Therefore a combination of yeast producttreatment with resistant cultivar provides agreat new potential in preventing andcontrolling major diseases.The results suggest that applicationof antagonistic yeast product beforeharvest may be a promising technology tomaintain quality of strawberry postharvest andduring cold storage.REFERENCESAbano E.E., Sam-Amoah L.K., 2012. Application ofantagonistics microorganisms for the control of221

postharvest decays in fruits and vegetables. Int. J.Adv. Biol.Res., 21 (1), p. 1-8.Almenar E., Del-Valle V., Hernandez Munoz P.,Lagaron J.M., Catala R., Gavaro R., 2007 EquilibrumMAP of wild strawberries. J.Sci. Food Agric., 87, p.1931-1939.Costa F.B., Duarte P.S., Puschmann R., Finger F.L.,2011. Quality of fresh cut strawberry. Hortic.Bras.,29, p. 477-484.De Souza A., Scalon S., Chitarra M., Chitarra A., 1999.Post-harvest application of CaCl2 in strawberryfruits: evaluation of fruit quality and post-harvestlife. Cienc. E Agrotec. Lavras, 23 (4), p. 841-848.Giusti M.M; Wrolstad R.E., 2001. Unit F 1.2:Characterization and measurement of anthocyaninsby UV–VIS spectroscopy. In Wrolstad, R. E., (Eds),Current Protocols in Food Analytical Chemestry;John Wiley & Sons: New York, F1.2.1 – F1.2.13.Goueva A., Kuhn O.J., Mazaro S.M., Mio L.L.M.,Deschamps C., Biasi L.A., Fonseca V.C., 2009.Control of leaf and flower diseases and postharvestquality of strawberry plants treated with S.cerevisiae.Hortic. Bras. 27 (4), p. 527-533.Grebenisan I., Cornea P., Mateescu R., Cimpeanu C.,Olteanu V., Campeanu G., Stefan L.A., Oancea F.,Lupu C., 2007. Metschnikowia Pulcherrima a newyeast with potential for biocontrol of postharvestfruit rots. Acta Hort.767, p. 355-360.Janisiewicz W.J., Korsten L., 2002. Biological control ofpostharvest diseases of fruits. Ann. Rev.Phytopathol., 40, p. 411-441.Menel K., Faten K., Moktar H., 2012. Combiningbiocontrol agent and high oxygen atmosphere toreduce postharvest decay of strawberries. Afr. J.Microbiol. Res., 6 (24), p. 5179-5187.Montero T., Molla E., Esteban R., Lopez-Andreu F.,1996. Quality attributes of strawberry duringripening. Sci. Horticulturae., 65, p. 239-250.Piccinin E., Di Pierdo R.M., Pascholati S.F., 2005. Efeitode S.cerevisiae na produtividade de sorgo e naseveridade de doencas foliares no campo.Fitopatologia Brasileira, 30, p. 5-9.Roncatto M.C., Pascholati S.F, 1998. Alteracoes naatividade e no perfil electroforetico da peroxidase emfolhas de milho e sorgo tratades com leveduraS.cerevisiae. Sci.Agricola, 55, p. 395-402.Sanz C., Perez A., Olias R. Olias J. 1999. Quality ofstrawberries packed with perforated polypropylene..J.Food Sci., 64, p. 748-752.Sesan T.E. 2006. Integrated control of strawberrydiseases. Phytopatol. Pol., 39, p. 133-148.Wszelaki A., Mitcham E., 2003. Effect of combinationsof hot water dips, biological control and controlledatmospheres for control of gray mold on harvestedstrawberries. Postharvest Biol. and Technol., 27, p.255-264.Xianghong M., Shiping T., 2009. Effects of preharvestapplication of antagonistic yeast combined withchitosan on decay and quality of harvest table grapefruit. J. Sci. Food Agric., 89 (11), p. 1931-1939.Zheng Y., Wang S.Y., Wang C.Y., Zheng W., 2007.Changes in strawberry phenolics, anthocyanins andantioxidant capacity in response to high oxygentreatment. Leb. Technol., 40, p. 49-57.Zhao Y., Wang R., Tu K., Liu K., 2011. Efficacity ofpreharvest spraying with Pichia guilliermondii onpostharvest decay and quality of cherry tomato fruitduring storage. Afr. J. Biotechnol., 10 (47), p. 9613-9622.222

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653BEHAVIOUR OF SOME NEW VARIETIES OF TABLE GRAPESIN THE FIRST THREE YEARS AFTER PLANTING ON IMPROVEDSANDY SOILS FROM SOUTHERN OLTENIAIulian ROI 1 , Mihaela CROITORU 1 , Emanuela Cristina VLADU 21 Research–Development Centre for Agricultural Plants on Sands–Dbuleni, Street Victoriei, 130,Code 207220, Dbuleni, Romania2 Faculty of Agriculture and Horticulture, Str. Libertii, nr. 19, Craiova, RomaniaAbstractCorresponding author email: iulianratoi@yahoo.comThe study was effectuated out on a number of 12 varieties of autochthonous and foreign origin. The experience wasfounded in the year 2010. Climatic conditions were favorable for cultivation of vines in year I and II and lessfavourable in the third year after planting, when they recorded, in winter, the minimum negative temperatures (-27 °C),well below the limit of resistance of the vine and in the summer very high temperatures associated with droughtrendered and sunstroke. After planting all vines were entered in vegetation. At the end of vegetation period thepercentage of normally developed vines was between 75 and 100. In year II continued the process of planting in placesempty. In the year III (2012) have obtained the grapes on the buds situated at base of vines because the buds situatedabove the snow (about 35-40 cm thick) were perished all buds. With all these difficulties were emphasized a fewvarieties from the point of view of precocious and from the point of view of the potential to make on the short elements(2-3 eyes). From the point of view of precocious has noted the Prima Cl. 1022, that reached maturity of consumption at15.07.2012. Transilvania and the Prima Cl. 1022 varieties, were highlighted, and in terms of the production of grapes,which means they have the potential to make on the short elements. The Prima Cl. 1022 achieved 9998 Kg/ha yieldand Transilvania achived 10073 Kg/ha yield.Key words: range, sandy soils, table grapes, vine.INTRODUCTIONViticulture is an important branch of culture inour country. Culture of table grape varieties isthe second production direction for harvestersin the areas with higher heat as sandy soilsfrom Southern and South-Western Oltenia.Vine varieties with table grapes are appropriateconditions of culture in our country (Martin T.et al., 1974).In order to establish the different types of tablegrape varieties have carried out studies on theirbehaviour in different areas (Bani P.,Vldoianu Em., 1979; Costescu Adriana et al.,2012; Dumitru I. et al., 2009; Rotaru L., 2005;Mohammad A, Popa A., 2005).After an assortment of table grape varieties iscontinuous improvement a priority of thisprocess (Cichi D, Costea D.C., 2008; Popa C.et al., 2008; Popa C. et al., 2009; Stroe M.V. etal., 2012).223MATERIALS AND METHODSThe study was effectuated out on a number of12 varieties of autochthonous and foreignorigin. The experience was founded in the year2010. The climatical conditions were favorablefor cultivation of vines in year I and II and lessfavourable in the third year after planting, whenthey recorded, in winter, the minimum negativetemperatures (-27 o C), well below the limit ofresistance of the vine and in the summer veryhigh temperatures associated with drought andsunstroke.The studied varieties were the following:Silvania, Timpuriu de Cluj, Muscat deHamburg Cl. 4 Pt., Tamina, Somean,Splendid, Napoca, Victoria, Prima Cl. 1022,Coarn neagr selecionat, Muscat deHamburg Cl. 202, Transilvania. Were planted20-40 vines from each variety. Thefertilization, at land preparation, made with 60t/ha manure, 300 kg/ha Complex 15 15 15. Atplanting were applied 5 Kg/pit

manure semifermentated. In vegetative period,in may month, was applied 100 kg/ha Complex15 15 15. To combat pests and diseases, wemaked a total of 11 chemical treatments, 3 withRidomil plus 48,5 WP – 0.3% + Sulfomat80PU - 0.5%, 3 with Shavit F 72 WDG - 0.2%,3 with Champ 77 WG 0.3% + Sulfomat 80PU- 0.5% and 2 with Dithane M45-0.2%+Sulfomat 80PU -0.5%.Were effectuated the following experimentalobservations and measurements:- entrance in vegetation;- planting rate of striking root;- the number of eyes formed on the vine duringthe year;- annual increases total length;- number of shoots with thickness exceeding 6mm at the second internode;- grapes production in III year after planting.The climatical conditions were favourable in Iand II years (2010 and 2011 years) afterplanting and less favourable in III year (2012year). In 2012 year perished all buds locatedabove the layer of snow, which have 35-40 cmthick. Although all vines entered in vegetationafter planting but not all have developednormally in the first year (Table 1). At theTransilvaniavariety, all planted vines havedeveloped normally. In others, losses werebetween 1 and 9 vines, respectively 2.5% at thevarieties Coarn neagr selecionat andMuscat Hamburg Cl. 202 and 25% at thevariety Somean.Table 1. Percentage of vines developed normally at the end of vegetation table grape varieties in first year after plantingRemaining vines Number of vines sickly or feebleVarietyNumber of planting vinesnr. % nr. %Silvania 40 33 82.5 7 17.5Timpuriu de Cluj 20 18 90 2 10Muscat de Hamburg Cl. 4 Pt. 40 36 90 4 10Tamina 20 19 95 1 5Somean 20 15 75 5 25Splendid 40 37 92.5 3 7.5Napoca 20 17 85 3 15Victoria 40 31 77.5 9 22.5Prima Cl. 1022 40 31 77.5 9 22.5Coarn neagr selecionat 40 39 97.5 1 2.5Muscat de Hamburg Cl. 202 40 39 97.5 1 2.5Transilvania 40 40 100 - -The vigour of vines is shown by the length ofthe annual total number of nodes formed onvine (Table 2). The total length of annualincreases recorded the values between 173cm/vine at Victoria variety, and 507 cm/vine atTransilvania variety. With good results in thisregard were highlighted Tamina variety (453cm /vine). The worst result were achieved atTimpuriu de Cluj variety (185 cm/vine) andSomean variety (188 cm/vine).Although, internodes length is charactervariety, the number of nodes formed on avines are approximately proportional to thelength total annual increasing. The largestnumber of nodes formed at Transilvaniavariety (120/vine) and the lowest, the Victoriavariety (39/vine).In II year after planting continued the processofplanting in places empty.224Table 2. Vine vigour in the first year after planting thevarieties of table grapes in first yearVarietyTotal length of annualincreases in the vine(cm)Number ofnodes formedSilvania 230 65Timpuriu de Cluj 185 58Muscat de293 81Hamburg Cl. 4 Pt.Tamina 453 110Somean 188 49Splendid 296 63Napoca 326 87Victoria 173 39Prima Cl. 1022 199 53Coarn neagrselecionat368 83Muscat deHamburg Cl. 202385 91Transilvania 507 12

In this year the buds have resisted over thewinter, so that the percentage of viability ofvegetation was 100, all varieties.Plant vigour, expressed through the length ofvegetative increases and the number of shootswith a diameter greater than 6 mm above theinsertion point, the values differ from onevariety to another (Table 3).Table 3. The viability of the buds at the entrance ofvegetation and vigor all the different varieties of vineswith table grapes in the II year of plantingVarietyViability ofthe buds atthe entranceof vegetation%Totalannualincreases(cm/vine)Number ofshoots with adiameter greaterthan 6 mm abovethe insertionpoint/vineSilvania 100 153 3Timpuriu deCluj100 280 3Muscat deHamburg100 300 4Tamina 100 275 2Somean 100 555 2Splendid 100 620 3Napoca 100 410 3Otilia 100 366 3Victoria 100 260 2Prima Cl.1022Coarnneagrselecionat100 350 3100 980 4Muscat deHamburg Cl.202100 554 3Transilvania 100 770 4The most vigorous variety was Coarn neagrselecionat, which on the four shootsregistered the annual increases of 980cm/vine. The variety with vigour of the lowestwas Silvania (153 cm/3 shoots).In the III year (2012) have obtained the grapeson the buds located at base of vines because thebuds situated above the snow layer (about 30cm thick) were all perished.Because to the reduce temperature value thedry cutting was effectuated using the shortelements, of 2-3 eyes length. Even in theseconditions have not been in all growth buds, atall varieties. The percentage of bud growth wasbetween 70 and 100 (Table 4). Two varietieshave a viability percentage of 100%, Timpuriude Cluj i Splendid, only. The lowest number of225buds go in the vegetation at the Taminavariety, 68 percent. With the growth of budsover 90% were most varieties, 8, Silvania andMuscat of Hamburg, with a percentage of 95.Other varieties have a percentage of the growthof buds between 80 and 89.Vines vigour was expressed by the sum of totalannual increases, the number of eyes formed onthe vine and the number of shoots with adiameter greater than 6 mm, in the course of ayear.The difference of vigour between the vines arevery large, in specially, as regards the amountof the total annual increases and the number ofeyes formed on the vine in the course of a year(Table 4).Thus, if the Silvania variety recorded 625cm/vine, the annual increases and 64 eyesformed on the vine, at the Victoria variety, thesame elements have values of 1364 cm/vineand 84 eyes/vine. The less vigorous varietiesare part of Silvania, are Timpuriu de Cluj andSomean. Differences were recorded regardingof the number of the shoots with diameter of 6mm to the vine, which has values from 3 to 5.Although it suffered considerable losses ofbuds and wood stocks were able to fruiting,even if not at the level of genetic potential. Haddemonstrated the potential of fruiting of thesevarieties to make grapes on the short elements(2-3 eyes length). If some varieties of fruitingprocess was symbolic, others that productionwas at the level of a normal year fromclimatical point of view, with a large capacityof fruiting on the short elements inserted to thevine base, such as the Transilvania (10073Kg/ha) and the Prima Cl. 1022 (9998 Kg/ha),(Table 5). A level of production have beensatisfied with the varieties Muscat de Hamburg(5302 Kg/ha), Muscat de Hamburg Cl 202(4999 Kg/ha) and Victoria (4923 Kg/ha).Without the potential for fruiting on the shortelements were Otilia (1515 Kg/ha) Somean(2196 Kg/ha), Napoca (2272 Kg/ha) andCoarn neagr selecionat (2575 Kg/ha). Thequality of production of grapes had advantagesand disadvantages due to the climaticalconditions of this year for agriculture (Table 5).

Figure 1. Prima Cl. 1022 varietyThe advantages in terms of the content of totalsugars, which recorded higher values. Insteadthe weight of 100 grains and total aciditytitrable were smaller. Varieties of table grapesaccumulates usually, lower levels of sugars, atthe consumption maturity.In this year the content of sugars exceeded thevalue of 152 g/l in all varieties, from theTransilvania variety, to 241 g/l. The lowersugar content of 152 g/l was recorded thePrima Cl. 1022 variety, which has reachedmaturity early consumption, to date 15.07.2012.Table 4. The viability of buds at the entrance of vegetation and vigour all the different varieties of vines with tablegrapes in the 3rd year of the plantingVarietyThe viability of the budat the entrance ofvegetation%Sum of totalannual increases(cm/vine)Number of eyesformationed on thevineNumber of shoots with a diametergreater than 6 mm, in the course ofa year mm/vineSilvania 95 625 64 3Timpuriu de Cluj 100 658 66 5Muscat de95 788 82 5HamburgTamina 68 826 86 5Somean 92 690 72 5Splendid 100 770 67 5Napoca 92 818 64 3Otilia 84 790 74 4Victoria 84 1364 84 4Prima Cl. 1022 87 898 65 5Coarn neagrselecionat90 1124 85 5Muscat deHamburg Cl. 20290 1068 80 5Transilvania 100 1256 99 5A sugar content of over 200 g/l were recordedand the varieties Otilia (204,5 g/l), Muscat deHamburg (214,1 g/l). A sugar content of morethan 180 g/l have been Tamina and Coarnneagr selecionat (184,3 g/l), Somean(185,4 g/l) and Timpuriu de Cluj (192,8 g/l). Alower potential of sugar, along with the PrimaCl. 1022, are Napoca (162 g/l).Climatical conditions influenced the negativeweight of 100 grains of grapes specially to latematuring varieties. The varietiy which hasrecorded the lowest weight, 167 g,was Silvania and the variety with the highestweight was the Tamina, 661 g. Wereemphasized the Victoria (648 g) andTransilvania (616 g) varieties. Varieties with aweight of 100 grains smaller are Silvania,226Somean, Napoca, Timpuriu deCluj. Total titrable acidityexpressed in g/l H 2 SO 4 , decreased due to veryhigh temperatures and drought in allvarieties studied, with values between 2.1 and4.2 g/l H 2 SO 4 . The lower the value of the totaltitrable acidity was the Silvania variety (2.1 g/lH 2 SO 4 ). Higher values, which have contributedto a more balanced taste, were recorded atTransilvania and Tamina varieties (4 g/lH 2 SO 4 .Lower values of total titrable acidity registeredat varieties Timpuriu de Cluj (2,15 g/l H 2 SO 4 ),Napoca (2,25 g/l H 2 SO 4 ) and Victoria (2,8 g/lH 2 SO 4 ).

In this year the vegetative stage of vines werecarried out close to normal until around June 15(Table 6). Amid increasing temperatureand installation of drought, the sum oftemperature for a certain vegetative stage wasachieved in ashorter time, so the vegetative stage havesucceeded with rapidity. In this way theprecociousness of varieties has increased,evidence that some varieties of ripe stagebegan on the 26.06.2012, at Prima Cl. 1022variety.The appearance of leaves, flourished andstarted farming grains stages were conductedlike some normal years of climatical pointof view. The appearance of leaves started mostearly on the Somean at 04.04.12 and the latest,on the date of 14.04.12, at Coarn neagrselecionat variety. The end of this vegetativestage occurred, most early on the Somean on9.4.2012, and later, on data 20.04.12 at Coarnneagr selecionat variety. The Prima Cl.1022 variety, which was the early, theappearance of leaves began on the 9.4.2012 andfinished in 16.04.2012. Blooming stage began,most early, on 12.05.2012 and ended,at early, on 23.05.2012 data to Prima Cl.1022 variety.Table 5. The production of grapes and the quality of the different varieties of vines in the 3rd year after plantingYield Weight of 100 grapes grains Total sugar Total titrable acidityVariantKg/hagg/lg/l H 2 SO 4Silvania 2575 167 173.7 2.1Timpuriu de Cluj 1628 261 192.8 2.15Muscat de Hamburg 5302 305 214.1 3.8Tamina 2424 661 184.3 4Somean 2196 237 185.4 3.75Splendid 4544 399 173.7 3.1Napoca 2272 265 162 2.25Otilia 1515 250 204.5 3.5Victoria 4923 648 153.8 2.8Prima Cl. 1022 9998 372 152 3.8Coarn neagr selecionat 2575 316 184.3 3.75Muscat de Hamburg Cl. 202 4999 389 196 3.5Transilvania 10073 616 241 4.2Table 6. Phenological observations at different vine varieties with table grapes in the 3rd year after planting, 2012yearThe appearance of leaves Blooming Farming grains Ripe stageVariantBiginning end Biginning end -Biginning- -Biginning- MaturitySilvania 10.04.12 17.04.12 20.05.12 03.06.12 27.05.12 10.07.12 20.08.12Timpuriu de Cluj 06.04.12 12.04.12 19.05.12 03.06.12 25.05.12 07.07.12 16.08.12Muscat de Hamburg 06.04.12 12.04.12 21.05.12 03.06.12 26.05.12 12.07.12 17.08.12Tamina 06.04.12 12.04.12 20.05.12 04.06.12 26.05.12 12.07.12 17.08.12Somean 04.04.12 09.04.12 20.05.12 04.06.12 26.05.12 13.07.12 14.08.12Splendid 05.04.12 12.04.12 22.05.12 04.06.12 27.05.12 08.07.12 14.08.12Napoca 07.04.12 13.04.12 14.05.12 29.05.12 19.05.12 06.07.12 20.08.12Otilia 05.04.12 12.04.12 20.05.12 04.06.12 26.05.12 09.07.12 17.08.12Victoria 10.04.12 16.04.12 22.05.12 06.06.12 27.05.12 15.07.12 20.08.12Prima Cl. 1022 09.04.12 16.04.12 12.05.12 23.05.12 18.05.12 26.06.12 15.07.12Coarn neagr selecionat 14.04.12 20.04.12 23.05.12 09.06.12 28.05.12 18.07.12 25.08.12Muscat de Hamburg Cl. 202 09.04.12 15.04.12 22.05.12 06.06.12 27.05.12 12.07.12 20.08.12Transilvania 12.04.12 17.04.12 23.05.12 09.06.12 28.05.12 18.07.12 22.08.12Blooming stage was immediately followed bythe beginning of the growth of the grains,which triggered the main early on 25.05.2012data at Prima Cl 1022 variety. Where asblooming stage lasts about 12 days, the period227of growth of the grains overlap a few days overthis stage, because the blooming has brokendown. The following vegetative stages wereproduced in fewer days than was known due tothe accumulation in a shorter time to

temperature required for a different stages. AsI mentioned above ripe stage began on June6.06. 2012 at Prima Cl 1022 variety and on6.07.2012 at Napoca variety.CONCLUSIONSIn first year at the Transilvania variety, allplanted vines have developed normally. Inothers, losses were between 1 and 9vines, 2.5% at Coarn neagr selecionatvariety and Muscat Hamburg Cl. 202 variety,and 25% for the Somean variety.From point of view of vigour emphasizedTransilvania variety with 120 nodes formed onvine and 507 cm the total length of annualincreases.In the II year of planting the vine vigour,expressed through the length of vegetativeshoots and the number of shoots with diametergreater than 6 mm/shoot above the insertionpoint, the values differ from one variety toanother. The table grape varieties at morevigorous variety was Coarn neagrselecionat variety, which on the four shootsregistered a value of 980 cm.The year three after planting, also, is forformation. Because of this, and to the fact thatin 2012 the buds located at the height under 15-20 cm, were affected by the negative minimumtemperatures, in the winter time, the varieties inquestion have not been expressing the truepotential of fruiting. In this regard for the nextyear will take action to protect 2-3 shoots.With all these difficulties were able to tear off afew varieties, from the point of view of theprecociousness, or from the point of view of thepotential to fruiting on the short elements (2-3eyes length).From the point of view of precociousnessgrapes table varieties noted the Prima Cl. 1022that reached consumption maturity at 15.7.12.Transilvania variety and the Prima Cl. 1022variety, were highlighted, and in terms of theproduction of grapes, which means they havethe potential to fruiting on the short elements.REFERENCESBani P., Vldoianu Em., 1979. Studiul comportriiunor soiuri cu struguri pentru mas pe nisipurileameliorate din Oltenia. Analele SCCCPN Dbuleni,Publishing Scrisul românesc, Craiova., vol. III, p.445-454.Cichi D.D., Costea D.C., 2008. Soiuri de vi de viecultivate i cultivabile în România. Publishing Arves,Craiova, p. 300-308.Costescu A., Dejeu L., Popa C., 2012. Evaluating thequality of the table grape varieties obtained andcultivated in the vineyard tefneti – Arge.Scientific papers of University of AgronomicSciences and Veterinary Medicine of Bucharest,Faculty of Horticulture, Series B. Horticulture,Volume LVI. p. 69-72.Dumitru I., Cezarina Necula, Camelia Popa, tefaniaIordache, Cristina Rizescu, 2009. The behavior ofvariety for table grapes – Muscat Iantarnii invineyards conditions of tefneti Arge. BulletinUASVM Horticulture, 66(1), p. 272-275.Rotaru L., 2005. The behaviour of some new varieties oftable grapes in Romania, in the ecoclimaticalconditions of the nord-est region. AgriculturalUniversity – Plovdiv, Bulgaria, Scientific Works, vol.L., Book 6, Jubilee Scientific Conference ,,State ofthe art and problem of agricultural sciense andeducation”, 19-20 october.Martin T. et all., 1974. Strugurii de mas. EdituraCERES, Bucureti.Mohammad Ahmad Abdel Majid Bishtawi, Popa A.,2005. Comportarea unor soiuri de mas în condiiileecopedoclimatice din centrele viticole Dbuleni,Banu Maracine, Drgani. Analele Universitii dinCraiova, vol X (XLVI). Editura Universitaria,Craiova, p. 39-44.Popa C., Necula C., Cichi D., Giugea N., 2009. Studieson the behaviour of variety Golden tefneti invineyards tefneti and Banu Mrcine. AnaleleUniversitii din Craiova, Seria Biologie,Horticultura, Tehnologia Prelucrrii ProduselorAgricole, Ingineria Mediului, vol. XIII (XLIX), p.45-48.Popa C., Cichi D., Necula C., 2008. Argessis and Goldentefneti new varieties for table grapes withbiological strength. Proceedings of the 32 st WorldCongress of Vine and Wine, 7 th General Assembly ofthe O.I.V., Verona, Italia. Edition Naklada.Stroe M. V., Bucur G. M., 2012. Study regarding theinfluence of low winter temperatures between 2011-2012 on the viability of winter buds of some tablegrape varieties in the conditions of the didacticexperimental field in Bucharest. Scientific papers ofUniversity of Agronomic Sciences and VeterinaryMedicine of Bucharest, Faculty of Horticulture,Series B. Horticulture, Volume LVI, p. 181-184.228

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653RESEARCH REGARDING THE BEHAVIOR OF CLONAL FETEASCANEAGRA 10 PT TO LOCAL CLIMATE CHANGESMarinela STROE 1 , Sofia ISPAS 2 , Drago MATEI 2 , Damian ION 2 , Elena DUMITRU 21 University of Agronomic Sciences and Veterinary Medicine of Bucharest,9 Marasti Blvd., 011464, Bucharest, Romania2 Pietroasa Vineyards Research and Development Station, Pietroasele, 127420, Buzau, RomaniaAbstractCorresponding author email: marinelastroe@yahoo.comThroughout numerous research stations and prestigious institutes and wine traditions in our country, owner ofgermplasm fond, we encounter vineyard center Pietroasa, which quality attributes derive from, on one hand theecopedoclimatic specific conditions existing here and on the other hand from the scientific activity headed to creatingnew vine varieties and improving the main soils of the assortment through clonal selection. In the last years, though, asin almost all our country regions, we assist with certain worry to a series of extreme climate events (strong winds,maximum extreme temperatures in summer, minimum extreme temperatures in winter as well as the phenomenon calledfreezing rain, all with effects on the normal growing cycle of vine plants. In this paper it is observed the influence of theclimate changes on the agrobiological and technological potential of the clonal selection Feteasca neagra 10, thenewest achievement of S.C.D.V.V. Pietroasa (patented in 2010) between 2010-2012. Climate data has been collectedfrom the research station’s own weather station and implied daily observations regarding the evolution of theparameters – temperature, precipitations, insolation – and based on these parameters were calculated the climateindexes that define the favorability degree of an area, as well as the Huglin index. The results obtained after the studyprove that they are in direct correlation with these area climate changes, and that on the short run have a positiveinfluence on the precocity of grape maturation, on the sugar accumulation potential, all together giving an extra qualityto the final product, the wine.Key words: climatical index, grape varietes, favourability, vineyard.INTRODUCTIONAlthough in the vineyard’s assortment prevailsgrape varieties for white wines, the mainwinery profile is obtaining white, superiorquality wines, in the Pietroasa wine area,characterized by a moderate droughtmicroclimate, warm temperate, with cool nights(IS1, IH4, IF3), there are favorable conditionsfor varieties of quality red wines (Feteascaneagra, Babeasca Neagra, Merlot). In thepresent study, the evolution of qualitativeparameters of the clonal selection Feteascaneagra 10 obtained in 2010 at P.V.R.D.SPietroasa was observed in the conditionsdetermined by area’s climate changes troughoutthree wine years (2010-2012), which proved tobe special under the climate recorded indexesreport. At the same time were analyzed thecorrelations met between the accumulation andincrease of the sugar quantities of the grapemust and the higher values of the Huglin index229(Tonietto and Carbonneau, 2004, Laget et al.,2008). The observations made are of localinterest as well as national interest, because itgives undeniable proofs of climate annualchanges, of which manifestations haveconsequences on the annual growing cicle ofthe vine. (Jones et al., 2005). The necessity ofour reasearch derives from the fact that, inpresent time, the wine assortment is formed ofold varieties and the replacement of these oneswith new clonal selections is wanted, and haveto correspond with the following parameters: tomake maximum usage of the climateconditions, to have medium productivity andvigor, constant quality productions according tosuperior quality wines, and the quality to beexpressed in a superior alcohol and aciditypotential, and to have a very good pest,environment factors and diseases resistance andso on.

MATERIALS AND METHODSTo accomplish the objective presented above,the research was made between 2010-2012 inan experimental device placed on an slopingland, in the superior third of the slope withsoutheastern exposition and 12% inclination.The soil is limestone, the mother rock is at lowdepth, the reaction is low alkaline, with a highlevel of calcium carbonate which variesbetween 14% in the A horizon and 20-36% inthe B horizon; in the C horizon limestonemother rock predominates. The biologicalmaterial which is the object of this research isthe clonal selection Feteasca Neagra 10Pt(Table 1). The selection was grafted on theKober 5 BB rootstock, the grapevines wereconducted on a semi-stem (Guyot on a semistem)at a planting distance of 2,0/1,2m, with aload of 30 buds/vine. The data was collectedfrom the vineyard’s own weather station andregarded daily observations about the evolutionof the parameters – temperature, precipitations,insolation and based on these parameters werecalculated the climate indexes which define thedegree of favorability of an area, the realheliotermic index (IHr), the hidrothermalcoefficient (CH), the bioclimatic index of vine(Ibcv), oenoclimatic aptitude index (IAOe), aswell as Huglin index calculation. The Huglinindex (HI) is calculated from April the 1 st toSeptember 30 th , in the northic hemisphere andit’s defined as follows:Tm = Medium air temperature (ºC)Tx = Maximum air temperature (ºC)k = day length coefficient according to thelattitude, with values between 1,02-1,06 forlattitudes of 40-50 0 , and for Romania (44,1 0 –46,0 0 ) it has the value of 1,04.This reference index is used on a large scale invineyards because it gives information aboutthe heat potential of the area, presenting a highprimary importance in choosing the rightassortment on one hand and it is positivelycorrelated with the accumulated sugar quantityon the other hand. The values of this indexcalculated in different wine regions determinesthis way not only a classifications of theindexes, but the establishment of the minimumtemperature required for the progress of thegrowing cycle of the vines in that area.The clonal selection (Table 1) was observedthroughout the whole phenological specter, andin the harvesting moment, on a medium sampleof 15 grapes there were made the followingdeterminations: average weight of a grape,average weight of 100 grapes, glucoacidimetricindex, production/vine, sugar (g/l),acidity (g/l sulfuric acid). The results obtainedwere analyzed with the one-dimensionalindexes – arithmethic mean, maximum, andminimum, indexes that can be applied for themajority of the quantitative characters whichhave the property to variate in time and space.Table 1. Main characteristics of the clonal selection Feteasca Neagra 10 PtAmpelographic characteristicsClonal selection of the Feteasca neagra variety, characterized by a large productivitypotential accompanied by a high sugar accumulation potential.The grape is medium-large, cylindrical-conical, compact, with small, black grapes,uniform in size and colour, without manifesting the grape shrinking disease called“small grains” and “very small grains”.Agrobiological and technological characteristicsFertility: 68% fertile budsGrape weight: 142gProduction per bud: 2,8 kgSugar: 242 gramms per literTotal acidity: 5,5g/l H 2 SO 4Production direction (clonal selection type)It ensures quality productions and obtaining high quality red wines, intense in colour,smooth and balanced, with controlled name of origin (D.O.C).Important attributes of the selection: good productivity, high sugar content which infavorable years can reach 267 g/l (quality clone).230

RESULTS AND DISCUSSIONSClimate features of the wine years duringexperimentation periodWine year 2010. Under the aspect of thethermal regime, January was extremely cold,and between January the 22 nd – January the 31 stthere were registered consecutively minimumtemperature values of the air under 25ºC, theabsolute value of winter (of the month) was-26,6ºC, on the soil being of-27,9ºC, affectingthe biological resistance of the plants. Thehydric regime was a little bit over the normalvalues in spring, accompanied by the thermalregime as well as over the normal for theperiod, associated with the overheatedtemperatures, higher than 35ºC from Augustwhich favored the installation of hydric stressand the rush of ripening process of the grapes,the dehydration of the grapes and the reducingof their volume. Autumn was not uniform,drought in September and extremely cold inOctober (-4,4ºC), and in November it wasregistered a thermal surplus of +73,6ºC,(maximum values of 24ºC).Wine year 2011. Regarding the temperatures,winter was close to the multi-annual values ofthe season. Summer was close to the normalthermal regime, with a medium seasontemperature of 21,5 ºC from the multi-annualaverage of 21,3ºC. The rain regime wasvariable during the summer, knowing a growthof 77,8 mm between June-July whenhidrometeorological extreme phenomenonswere signaled such as torrential rains, windintensifications with an aspect of storm andsevere hail on 24th of August which byintensity and duration produced damages ofabout 75-90%. Autumn was not uniform underthe thermal and hydric aspect, excessively hot,with maximum values over 33-34ºC in the airtemperature, in September, and cold withnegative values under-5,2ºC in October.Wine year 2012. The cold season registerssevere temperatures (under -23ºC) and snow(February). Extreme negative temperatures,blizzard and glazed frost between January 24thand February 6th brought values of-23,1º C inair temperature, on soil recording -26,7ºC.February registered a record mediumtemperature value of -5,5ºC which was 4,4º Clower than the average multi-annual231temperature of-1,1ºC. The amount of budlosses was due to the large interval in whichtemperatures maintained critical, but also to therain phenomenon which froze on the vinesstrings (freezing rain) signaled betweenFebruary the 4th-February the 6 th . Spring wasclose to the normal limit, and the summer of2012 was extremely drought, with a highhydric defficit on the base of a large thermalsurplus which marked the progress of thephysiological and biochemical processes atnormal parameters, but as well as on the qualityand quantity of the grape production. Thesummer of 2012 was remarked by a largenumber of days with consecutive maximumtemperatures over 35ºC (41ºC-August 15 th )and consecutive nights (tropical) withminimum temperatures of the air larger than20ºC. Autumn was extremely hot, with airtemperatures of 33ºC (September), poor inprecipitations and the rain deficit accentuatedin autumn was rebuilt increasingly starting withNovember.The analysis of climate conditions in relationto the synthetic indexesAnalyzing the growing active period inaccordance with the active balance, we canconclude that the year of 2012 was the onlyyear in this study interval that had a highthermal contribution (3835,5) with multipleinfluences (positive and negative) in the growthand development of plants. So, the level andthe amount of temperature degrees associatedwith a plus of insolation hour number, but alsothe soil drought cumulated with the atmospheredrought, determined the maturation phase ofthe grapes, 7 days earlier than normal (25 th ofJuly), determining an advance of the fullmaturity. Analyzing the values of the foursynthetic indexes, it can be observed that thewine station registers high heliothermicresources, which have as a correspondent lowwater resources and that the most sensitive isthe bioclimate index, which’s large specter issituated between 5,38-11,2. Regarding theevolution of the values of Huglin index, thevalues recorded during the time of the studyshow that it suffers a growth tendency from oneyear to another, with some exceptions (2007-2009), reaching a maximum of 2639,7 in theyear of 2012, conditions in which the wineareal characterized by a warm temperate

climate (IH4), becomes for this year a hotclimate (IH5) – (IS1, IH5, IF3).Analyzing the obtained qualitative dataIt is observed that, the results of the experimentare directly correlated with the unfavorableevolution of the climate factors during 2010-2012 and that, each year of culture, through theevolution of the weather recorded phenomenon,leaves a mark on the manifestation of one andeach variety. Although the clonal selectionscomes from an old local soil (Feteasca neagra),with a climatic remarkable adaptability, thewaves of cold and the absolute minimumtemperatures recorded in the air of-26,6 0 C(January 2010), of-23,2 0 C (January 2012)produced important bud losses during thegrowing rest period.In table 3, it is observed that the clonalselection Feteasca neagra 10 Pt, records amedium value of 42% winter buds viability,with a minimum of only 20% in the year 2012,minimum which was due to the large timeperiod in which the temperatures maintainedcritical, but also to the phenomenon of rainfrozen on the vine strings (freezing rain),between February the 4th-February the 6th.Analyzing the recorded production of 6,3 tonesper hectar it is also observed that the smallestvalue is recorded by the clonal selection in2012, when it obtained the smallest values of agrape medium weight values (175g), as well asa minimum weight value of 100 grapes (140g).It can be mentioned the fact that on this fond oflow productivity, the sugar accumulatedquantity reached the maximum level of 243 g/l,quantity that offers qualitative constancy and ahigh alcohol potential because this selectionaccumulates in the good wine years, around242 g/l.Table 2. Evolution of the climate elements in the wine area of Pietroasa (2007-2012)Specification%viablebudsTable 3. Evolution of quality parametres during 2010-2012Yield(kg/vine)Sugar(g/l)Acidity g/lH 2 SO 4Average Year Year YearSpecification2007-Max Min2010 2011 20122009global 4233,4 3920,44019,14205,74233,43920,4 Thermic balance active 3577.2 3473,13388,33835,53835,53388,3useful 1677,2 1626,21616,21955,61955,61616,2Absolute minimumAir -17,13 -26,6 -16,1 -23,1 -16,1 -26,6temperature°CSoil -19,5 -27,9 -17,4 -26,7 -17,4 -27,9The sum of the hours of real insolation (Sir) 2060,7 2036,42049,32125,32125,32036,4The sum of the annual precipitations (mm) 522,6 655,2 601,1 579,6 655,2 522,6Number of days of active period 205,6 214 207 220 220 205,6The hydrothermic coefficient CH) 0,82 1,17 1,19 0,97 1,19 0,82The real heliotermic index (IHr) 1,37 1,12 1,05 1,08 1,37 1,05The viticultural bioclimatic index Indices agroclimatics (Ibcv)9,05 5,96 5,38 11,2 11,2 5,38Index of the oenoclimatic aptitude(IAOe).5185,7 4816,44373,25074,55185,74373,2Gluco-AcidimetricIndexAverageweight ofa grape (g)Weight ofonehundredgrapes(g)FullmaturityClonal selection Feteasca neagra 10 Pt2010 57 8,0 235 5,5 4,3 180 210 16.092011 49 7,0 231 5,8 4,0 180 165 18.09Wine 2012 20 6,3 243 5,5 4,4 175 140 10.09year average 42 7,1 236,3 5,6 4,2 178,3 171,7 15.09min 20 6,3 231,0 5,5 4,0 175,0 140,0 10.09max 57 8 243,0 5,8 4,3 180,0 210,0 18.09232

Figure 1. Evolution of Huglin Index between 2007-2012 in the wine area of PietroasaFigure 2. Evolution of Huglin Index and content sugars (g/l) for clonal selection Feteasca neagra 10 PtA partial conclusion that can be made is thatthe particularities of these wine years left amark on the agrobiological and tehnologicalbehavior of the clonal selection Feteasca neagra10 Pt, and that particularly, the productionsobtained in this years are much under theselection limits, practically hierarchialdescending, as follows: 2010, 2011, 2012without being majorly affected by thoseparameters that define and insure the quality ofa wine (sugar, acidity).It is worth mentioning the fact that, lowproductions of the year 2011 were due to thehydrometeorological extreme phenomenons233under the form of torrential rains, windintensifications with storm aspect and extremehail on the 24th of August, which byintensification and duration produced damagesin the Pietroasa area of 75-90%, and in the yearof 2012, due to the extreme air temperatureslimits (-23,1ºC) and (-26,7ºC – record value) atsoil, which lead to bud losses of approximately80% for all cultivated varieties in this winearea.After the study, following the evolution ofHuglin Index values in the wine area ofPietroasa (index that offers relations regardingthe thermal potential of the wine area) and the

quantities of sugar accumulated in thematuration process, it can be observed a directcorrelation in general (figure 2) and only in theconditions of the year 2012 the recorded valuesovercome the potential of the clonal selection(242 g/l). These accumulations (235 g/l, 231g/l) reach a level which insures obtaining agood alcoholic potential for superior qualitywines. Based on the same data, it can beobserved a precocity of grape maturation (6-8days in advance) undependable of theproduction year.culture technologies, oenological practices andso on.These information represent the basic elementstaken into consideration for a better, deeperreflection on what it means choosing theassortment, on introducing into culture somevarieties and clonal selections more appropriatefor the culture technologies, on finding somelong-lasting adaptation solutions to the climatechanges of the technologies, oenologicalpractices and so on.In conclusion, the biological value of the newclones obtained by applying the clonal selectionis sustained by the hereditary analyzedspecific of each variety, biotype, or assortmentgroup.REFERENCESFigure 3. Clonal selection Feteasca neagra 10 Pt, 2010CONCLUSIONSIt is observed that, special climate features ofthe last years, defined by the climate unspecificchanges to Pietroasa station, determines a fasterprocess of the phenophases and have an effecton the precocity of grape maturation and sugaraccumulation which finally bring a plus ofquality to the wines that are obtained.Clonal selection newly obtained Feteascaneagra 10 Pt present promising perspectivesdue to the high degree of adaptation, and thesuccess of integrating and expanding it in theculture depends on finding adaptation and longlastingsolutions to the climate changes inHuglin P., 1978. Nouveau mode d’évaluation despossibilités héliothermiques d’un milieu viticole.Comptes Rendus de l’Académie d’Agriculture,France, p. 1117-1126.Tondut J.L., Laget F., Deloire A., 2008. Climat et viticulture:evolution des temperatures sur le departementde l’Herault, un exemple de rechauffementclimatique-Revue francaise d’oenologie, publicationofficialle des oenologues de France. Articletechcnique R.F.O.E. nr. 219.Jones G. V., White M. A. Cooper O. R., Storchmann K.,2005. Climate change and global wine quality.Climatic Change 73, p. 319-343.Laget F., Kelly M.T., Deloire A, 2008. Indications ofclimate evolution in a mediterranean area considerationsfor the wine and viticulture sectors. OrganisationInternationale de la Vigne et du Vin, Verona,Italia, le juin 2008.Tonietto J. and Carbonneau A., 2004. A multicriteria climaticclassification system for grape-growing regionsworldwide. Agricultural and Forest Meteorology 124,p. 81-97.Tonietto J. and Carbonneau, A., 2004. A multicriteriaclimatic classification system for grape-growingregions worldwide. Agricultural and ForestMeteorology 124, p. 81-97.*** O.I.V. guidelines for studies on the effects of climatechange in vitiviniculture and proposed adaptations.Organisation Internationale de la Vigne et du Vin,Paris, le 13 mars 2012.234

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653AbstractPHYLOGENETIC ANALISYS OF MANGIFERA BASE ON RBCLSEQUENCES, CHLOROPLAST DNASuparman SUPARMAN 1 , Adi PANCORO 2 , Topik HIDAYAT 31 Department of Biology Education, Universitas Khairun, jalan bandara Babullah Ternate,Maluku Utara, Indonesia2 Genetics Laboratory, School of Life Science and Technology,Institut Teknologi Bandung,Jalan Ganesha 10, Bandung, Indonesia3 Department of Biology Education, Universitas Pendidikan Indonesia (UPI),Jalan Setiabudi 229 Bandung, Bandung, IndonesiaCorresponding author email: suparman_bio@yahoo.comGenus of Mangifera has 69 species that mostly distributed around Borneo, Sumatra, Java and Malay Peninsula.Phylogenetic study of this genus is conducted in order to investigate the ancestor trait and relationships among thosespecies. Phylogenetic tree is constructed based on nucleotide variation in rbcL gene within 16 samples of Mangifera :13 species from Indonesia and 3 species from Thailand. Two species from the other genera are added as outgroups.Genomic DNA was extracted using CTAB protocol and amplified with rbcL primers. Sequencing result is analyzedusing BLAST function on NCBI. Multiple sequence alignment from all samples of rbcL sequences is generated usingBioedit and ClustalX program. Subsequently phylogenetic is constructed by using Maximum Parsimony method inPAUP* 4.0b10 software. The aligned rbcL comprised 905 characters which had 72 characters of parsimonyinformative with consistency index (CI) 0,889 and retention index (RI) 0,962. Phylogeny generated four main groups.Group I consist of M. cochinchinensis and M. macrocarpa (Thailand); group II : M. indica M. cesia, M. aplanat and M.altisima ; group III : M. laurina, M. longipes, M. similis, and M. gedebe ; group IV : M. laurina (Thailand), M. foetida,M. caesia, Mangifera spp, and M. odorata. Phylogenetic analysis revealed that Mangifera is monophyletic. There is adiversification between M. laurina from Indonesia and Thailand, as well as M. macrocarpa. Phylogenetic analysis alsoprovides information which support the assumption that M. odorata is a hybrid of M. indica and M. foetida, andstrongly support the assumption that M. longipes is a synonim of M. laurina.Key words: Mangifera, Phylogenetic, rbcL.INTRODUCTIONcomplexity of the vegetative and generativeorgan. The newer classification base onMangifera is a genus of Anacardiaceae. Mostmorphology is doubted (Yonemori et al.,of its member are spread in Borneo, Sumatra,2002).Java, Malay peninsula, and also other part ofIt can be revealed by uncertain position for 11Asia (Mukherjee, 1953). Classification systemspecies, beside that, there are two controversialof Mangifera has been developed. Mukherjeespecies: M. longipes and M. odorata. In the old(1953) classified Mangifera in two sectionsclassification there is M. longipes (Mukherjee,with five species incertaesedis.1953; Hou, 1978) but in the latest classificationToday Mangifera has 69 species and classifiedthere is not (Kosterman and Bompard, 1993).to three subgenus they are Mangifera, LimusThey said that M. longipes is synonym with M.(Marchand), and uncertain position Kostermansand Bompard (1993).laurina but they showed different somemorphology characters.Mangifera was determined from one ancestorIn other species, Mangifera odorata was the(Mukherjee, 1953) otherwise Kostermans andhybrid result between M. indica dengan M.Bompard (1993) contradicted that theory. Theyfoetida (Hou, 1978), but Kosterman andsuggested that the genus original was twoBompard (1993) rejected the statement.different ancestors.Some previous molecular phylogeneticClassification of Mangifera is still labileanalyses in Mangifera were done. A research of(Hidayat dkk, 2011). It is because theinternal trancribed spacer (ITS) DNA nuclear235

ibosomal to investigate 13 species ofMangifera (Yonemori et al., 2002); Usingamplified fragment length polymorphism(AFLP) information by Yamanaka (Yamanakaet al., 2006); using trnL-F gene sequence toanalysis four species of Mangifera (Fitmawatiand Hartana, 2010); also phylogenetic anddiversification of Mangifera from Indonesianand Thailand by Hidayat (Hidayat et al., 2011).All molecular phylogenetic researches ofMangifera were to analysis the phylogeneticand phyletic original of ancestor. So that, it isquite important to construct phylogenetic treeand analyze phylogenetic of Mangifera usingdifferent molecular marker, especially based onrbcL gene sequence as marker in plant. rbcL isgene for coding ribulose-1,5-bisphospatecarboxylase (RuBisCO).All kind of plants have this gene with moderatemutation. Mutation in rbcL has positivecorrelation with species diversification inAngiosperm (Barraclough et al., 1996), so it isexpected will be able to give phylogeneticinformation closer to the real condition.MATERIALS AND METHODS16 samples of Mangifera, 13 samples of leafare collected from Indonesia (Kebun RayaBogor) and three samples from Thailand(Forestry Departemnt of Kasetsart University,Bangkok). Two Outgroup, they are Boueamacrophylla from Bogor and Anacardiumoccidentale. The last outgroup is taken fromNCBI genebank (Aguilar and Sosa, 2004).Three main steps of research are rbcL primerdesign, DNA genome isolation from Mangiferaleaf and rbcL amplification, and the last isphylogenetic tree construction.Template of rbcL gene was retrieved fromMangiferaindicarbcL gene in NCBI (Gadek, etal., 1996). That sequence was used fordesigning primer both rbcL-F and rbcL-R byGenamicsExpression software and confirmedwith primer blast at NCBI.DNA Genome was extracted from Mangiferaleaf using CTAB method protocol (Porebski etal., 1997) with modification. Then, rbcL genewas amplified by PCR and sequenced inMacrogen Inc (Korea) with the same primer.For constructing Phylogenetic tree, all thesequences were edited and performedalignment by Bioedit and ClustalX program(Thompson et al., 1997)Phylogenetic tree constructed with maximumparsimony (MP) and neighbour joining (NJ)using PAUP* 40.b10 (Swofford, 2002).Appearance the phylogenetic tree use tree viewwin 32 software (Roderic, 2001).Table 1. Plant material and originNumber NAME OF SPECIES ORIGIN1 Mangifera caesia Jack Java, Indonesia2 Mangifera similis Auet Sumatera, Indonesia3 Mangiferamacrocarpa Blume Java, Indonesia4 Mangifera laurina Blume Java, Indonesia5 Mangiferagedebe Miquel Sumatra, Indonesia6 Mangifera indica Lin Java, Indonesia7 Mangifera sp Borneo, Indonesia 8 Mangiferaapplanata Kosterm Borneo, Indonesia9 Mangiferacasturi Kosterm Borneo, Indonesia10 Mangiferaodorata Griff Java, Indonesia11 Mangiferafoetida Lour Java, Indonesia12 Mangiferaaltissima Blanco Java, Indonesia13 Mangiferalongipes Griff Java, Indonesia14 M. cochinchinensis Engler Thailand15 Mangiferalaurina Blume Thailand16 Mangifera macrocarpa Blume Thailand17 Bouea macrophylla Griff * Java, Indonesia18 Anacardium ocidentale Lin* * Accession number in NCBI: AY462008.1 = outgroup* = outgroup which taken from NCBI236

RESULTS AND DISCUSSIONSPhylogenetic tree resultThe aligned rbcL comprises 905 characters. Ofthese, 807 characters are constant and 72 arepotentially parsimony informative. From themost parsimony tree (MPTs), consistency index(CI) is 0,889 and retention index (RI) is 0,962.The values showed that all characters areimportant in constructing tree and RI revealthat homoplasy is very small.Phylogenetic tree as shown in figure 1, it wasconstructed with maximum parsimony methodand bootstrap 1000x. Neighbourjoining (NJ)method is also done to show difference ofgenetic distance and analyze similaritysequence among samples.Phylogenetic analysis MangiferaPhylogenetic analysis from the tree hadrevealed the important answer about theancestor trait. It is monophyletic tree with fourmain groups. The first group consists of twospecies from Thailand which are M.macrocarpa (Thailand) and M. cochincinensis.Group II consist of M. indica, M. caesia, M.aplanata, and M. altisima. Group III consist ofM.longipes, M. laurina, M. similis, and M.macrocarpa. Group IV consist of mix samplesfrom Thailand and Indonesia, such as M.laurina (Thailand), M. sp, M. kasturi, M.foetida, and M. odorata.The result reveal that two species of Mangiferafrom Thailand grouped in one but other species(M. laurina) join to Indonesian Mangifera. Thegroup systems show some differences withclassification system made by Kostermans andBompard (1993).Monophyletic character of Mangifera ancestortrait based on rbcL gene shows the same resultwith ITS (Yonemori et al., 2001) and matK(Hidyat et al., 2011) with different DNAsequences. Overall results of Mangiferaancestor are monophyletic. The monophyleticancestor of Mangifera is supported by characterof stomata (Hidayat et al, 2009). Therefore, theconsequence for the ancestor is agree withMukherjee (1953), that said Mangifera comefrom one origin and divided into three species.That is M.duperreana as root of section I, M.lagenifera and M.macrocarpa as root of sectionII. That species are the oldest among all speciesof Mangifera.Phylogenetic analysis also shows biogeographyrelationship of Mangifera. It can be seen fromthe diversification of same species, which istaken from difference land with long distance.Phylogenetic pattern among species also giveinformation in species status and taxonomyimplication in genus Mangifera.Figure 1. One of the most parsimony tree with bootstrap 1000x. The number on the node is Bootstrap value in%.237

Biogeography of Genus MangiferaTwo species of Mangifera from Thailand madegroup I: M. cochynsinensis and M. macrocarpa(gambar III.1), meanwhile M. laurina joint ingroup III. It reveals diversification amongspecies from Indonesian islands and Thailandespecially in M. laurina and M. macrocarpafrom Thailand and Indonesia.Phylogenetic analysis based on matK (Hidayatet al., 2011) in Mangifera also showsseparation between species which come fromdifferent geography. It may be caused bydifferent natural geographical condition sincemany years ago. So the sequences of DNA arechanged or mutated. Another hypothesis iscalculated from different variety of sample, yetthis hypothesis is weak.Phylogenetic relathionship and memberstatus of MangiferaSome closes species based on the phylogenetictree, are M. cochinshinensis and M.macrocarpa from Thailand. These species aregroup I. While in group II, M. caesia, M.aplanata, and M. altissima also had a closerelationship and sistergroup with M. indica.Relationship between M. altissima and M.applanata also close Mangifera phylogeneticbased on matK (Hidayat dkk, 2011). In groupIII, M. gedebe, M. similis, and M.macrocarpa closed and sister group with Mlaurina & M. longipes.Group III is similar to matK phylogenetic,otherwise M. macrocarpa in matK is Thailandsamples. Group IV, M. odorata, M. spp and M.casturi closed and sister group withM. foetida, beside M. laurina from Thailand isin group but outer than other.Relationship in phylogenetic based on rbcLsequences also reveals status of M. odorata andstatus M. longipes. Species of M. odorata is thehybride of M. indica and M. foetida (Hou,1978) . The conclusion does not directly agreewith that opinion, but our analyses reveal it ispossible. Not all the species (M. odorata,M.indica and M. foetida) are in one group. M.odorata and M. foetida are in one grup (groupIV), while both of them are separated with M.indica (group II).M. odorata and M. foetida also have closerelationship based on ITS marker (Yonemori etal., 2002). AFLP analysis in showing hybridstatus of M. odorata reveal that similarity index238between M. odorata and M. foetida is higherthan M. indica and M. odorata (Kiew et al.,2003; Teo et al., 2002). They indicate that M.odorata is hybrid result of M indica and Mfoetida, it was followed by backcrossing withM. foetida. So, it refers to be similar with M.foetida than M. indica.The next research using matK sequencesanalysis shows a different result. It shows thatM. odorata is closer to M. indica than M.foetida (Hidayat dkk, 2011). This differenceresult among rbcL gene, ITS and matK stillsupport hybrid status of M. odorata). It needsmore analysis using three combination of thatmarker to answer that controversial.Phylogenetic tree give information of M.longipes status. Species M. longipes in newerclassification of Mangifera is synonym with M.laurina. Species of M. longipes Griff spread inSumatera, Malay Peninsula, Borneo, LesserSunda island and Philipina (Hou, 1978).however M. laurina Blume is endemic speciesin Philippines archipelago and Selayar island(Sulawesi) with local name are Mangga Aer,Mangga parih and Apale/i (local name inPalawan island). Based on the analysis, it ispossible that both of them are different species.Figure 2. Phylogenetic tree using Neighbour Joiningmethods. Numbers on the nodes are bootstrap value in%and number bellow is genetic distance.

Phylogenetic tree using MP likely to supportthat M. longipes is synonim with M. laurina. Itshow on phylogenetic tree, M. longipes and M.laurina make one same clade at one internalnodus. In phylogenetic, it means booth of themcome from one ancestor and are very closetaxon. Phylogram tree (fig2) using NJ methodsreveal some genetic distance between M.laurina and M. longipes but very little.Therefore, the conclusion for this controversyis strongly support that M. laurina is synonymwith M. longipes.Taxonomic implicationPhylogenetic information of Mangifera basedon rbcL can become reference and base inMangifera classification without ignoremorphology and anatomy information as thefirst reference. Topological analysis of treePhylogenetic uncover different pattern withnewer classification of Mangifera. For examplethe closer kinship species M. laurina, M.gedebe, M. sismilis and M. macrocarpa, aredifferent subgenus and different section.Phylogenetic based on rbcL gene is supportedby matK gene and this difference pattern ofclassification also indicated by ITS marker(Yonemori et al., 2002). It means that theclassification system of Mangifera today isinconsistence.In different case, as a reference, speciesmember of Caragana (Fabaceae) are reformedafter molecular analysis from tribe of Galegeaeto become different tribe of Hedysarea (Zhanget al., 2009). Based on molecular informationrbcL, trnS-trnG and ITS, another section andgroup in Caragana are recommended tocontemplate and observeOur research was limited in samples andsequence of base so it is too early inrecommending for classification reform but theresult can consider in reanalysis of Mangiferaclassification. It is strongly supported byanother molecular marker such as ITS andmatK, so it is very important for collaboratingsome molecular marker in making bestclassification system of Mangifera.CONCLUSIONSPhylogenetic analysis of 16 species of Mangiferausing rbcL gene sequence in chloroplastreveal that Mangifera is a monophyletic239ancestor, there are diversification betweenThailand and Indonesian sample.It result also supports that M. odorata is hybridresult of M. indica and M.Foetida. The analysisalso support that M. longipes is synonym withM. Laurina.The classification system is revealed quitedifferently with previous system.ACKNOWLEDGEMENTSThe research is supported by AP project 2009-2010 and genetics laboratory of SITH ITB. Wewould like to thank Puri Arta as researchassistant of Pancoro group, Asri P lestari,Husna N Praja, all ITB genetic laboratorymembers and Desy Apriliani (UdayanaUniversity) for discussing the grammar.REFERENCESAguilar C.J., Sosa V., 2004. The evolution of toxicphenolic compounds in a group of Anacardiaceaegenera. Taxon Journal 53 (2), p. 357-364.Barrachlough T.G., Harvey P.H., Nee S., 1996. Rate ofrbcL gene sequences evolution and speciesdiversification in flowering plants (Angiospermae).The Royal Society. Proc. R. Soc. Lond. B 263, p.589-591.Fitmawati, Hartana A., 2010. Phylogenetic Study ofMangifera laurina and its related Species UsingcpDNA trnL-F spacer Marker, HAYATI JournalBioscience Vol. 17 No.1, p 9-14.Gadek P.A., Fernando E.S., Quinn C.J., Hoot S.B.,Terrazas T., Sheahan M.C., and Chase M.W., 1996.Sapindales: molecular delimitation and infraordinalgroups. Am. J. Bot. 83 (6), p. 802-811.Hidayat T., Pancoro A., Kusumawaty D., Eiadthong W.,2011. Molecular Diversification and Phylogeny ofMangifera (Anacardiaceae) in Indonesia andThailand. Proceeding of the International Conferenceon Advanced Science, Engineering and informationTechnology, Putrajaya, Malaysia, p. 88-91Hou D., 1978. Anacardiaceae (revisions). FloraMalesiana, Series I, 8 (3), p. 395-548.Kiew R. Teo L.L, Gan Y.Y., 2003. Assesment of thehybrid status of some Malesian plants usingAmplified Fragment Length Polymorphism. Telopea10 (1), p. 225-232.Kostermans A. J. G. H., Bompard J. M., 1993. Themanggoes: Their Bothany, Nomenclature, Horticultureand Utilization. IBPGR Academic Press.Harcourte Brace & Company. London.Mukherjee S.K., 1953. Origin, Distribution, andPhylogenetic affinity of the species of Mangifera L.Journal of the Linnean Society, Botany. LV, p. 65-83.Mukherjee, S.K., Litz R.E., 2009. Introduction: Botanyand Importance. The mango 2nd Edition. Botany

productionand uses. Center for tropical Agricultureand Botany-CAB International.Porebski S, Bailey L.G., Baum B.R., 1997. Modificationof a CTAB DNA extraction Protocol for PlantsContaining High Polysaccaride and PolyphenolComponents, Plant Molecular Biology Reporter 15(1), p. 8-15.Roderic D.M., 2001. Tree View Win 32. http://taxonomy.zoology.gla.ac.uk/rod/rodhtml..Sawangchote P., Grote P.J., Dilcher D.L., 2009. TertiaryLeaf Fossils of Mangifera (Aanacardiaceae) from Libasin, Thailand as examples of the Utility of LeafMarginal Venation Characters. American Journal ofBotany 96 (11), p. 2048-2061.Swofford D.L., 2000. PAUP*, Phylogenetic AnalysisUsing Parsimony (*and Other Methods). Versi4.0b10. Sinauer Associates.Teo L.L., Kiew R., Set O., Lee S.K. Gan Y.Y., 2002.Hybrid status of kuwini, Mangifera odorata Griff.(Anacardiaceae) verified by amplified fragmenthlength polymorfism. Molecular ecology 11,Blackwell sciene Ltd., p. 1456-1469.Thompson J.D., Gibson T.J., Plewniak F., Jeanmougin,F., Higgins D.G., 1997. The ClustalX windowsinterface: flexible strategies for multiple sequencealignment aided by quality analysis tools. NucleicAcids Research, 25, p. 4876-4882.Yamanaka N., Hasran M., Xu D. H., Tsunematsu H.,Idris S., Ban, T., 2006. Genetic relationship anddiversity of four Mangifera species revealed throughAFLP analysis, Genetic Resources and Cropevolution 53, p. 949-954.Yonemori K., Honso C., Kanzaki S., WiadthongW., Sugiura A., 2002. Phylogentic relathionship ofmangifera species revealed by ITS sequences ofnuclear ribosomal DNA and a possibility of theirhybrid origin. Plant Syst. Evol. 231, p. 59-75.Zhang M., Fritsch P.W., Cruz B.C., 2009. Phylogeny ofCaragana (Fabaceae) based on DNA sequence datafrom rbcL, trnS–trnG, and ITS. Journal MolecularPhylogenetics and Evolution 50, p. 547–559.240

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653VARIABILITY OF SOME APRICOT VARIETIES AND HYBRIDSPRODUCTIVITY TRAITS CREATED IN ROMANIAValerica TUDOR, Adrian ASNIC, Georgeta TEMOCICOUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Marasti Blvd, District1, 011464, Bucharest, RomaniaAbstractCorresponding author email: valentina67t@yahoo.comCurrent requirements of the species Prunus armeniaca in terms of creating new varieties require a conducted extensiveresearch in the apricot breeding program in the south-eastern of Romania. It’s been proceeded for early selectionsbased on correlations in order to create new varieties with high productivity and organoleptic qualities. Characteristicsand traits of the 36 varieties and hybrids of apricot studied, grouped according to the period of maturation, werestudied starting with the IPGRI descriptors used in Genus Prunus. The characteristics were followed: trunk crosssectionalarea (cm 2 ), fruit production (t/ha), the number of fruit tree branches unit length of thick branch and fruitbranch type specific for apricot. The resulting correlations between fruit production (t/ha) and the number of fruit treebranches unit length of thick branch R 2 =0,1084***. For series of data belonging to fruit production (t/ha) and numberof fructification branches (spur branches, short branches, long branches and mixt branches) the correlation coefficienthad a lowered value, between 0,0007 si 0,0524**. So, this resulted in a somewhat correlation between fruit production(t/ha) and number of spur branches to the unit length of thick branch R 2 = 0524**.Key words: apricot, varieties, productivity, fructification branches, correlations.INTRODUCTIONThe creation of apricot varieties with differentfruit maturation periods, especially extra earlyand late maturation (Bassi D. and AudergonJ.M., 2006), has been a priority since 1980 toimprove the program in Romania. The markethad a demand for extra early apricots(Audergon J.M., 1995), until recently satisfiedby importing them from the Mediterraneancountries like Italy, France, Spain and Turkeyis a strong argument for the scientists involvedin the improvement of this species.MATERIALS AND METHODSThe biological material is represented by 36varieties and hybrids of apricot with differentfruit maturation periods: very early (ve), early(e), middle (m) and late (l).These were grouped according to the period ofmaturation and studied starting with the IPGRIdescriptors used in Genus Prunus.The characteristics were followed: trunk crosssectionalarea (cm 2 ), fruit production (t/ha), thenumber of fruit tree branches unit length ofthick branch and fruit branch type specific forapricot.241The trunk cross-sectional area was calculatedafter the formula TSA (cm 2 ) = D x d, in whichD = diameter of the trunk on the rows directionand d = diameter of the trunk perpendicular onthe row direction.Characteristics of fructification type is agenetic particularity and it shows thepredominating fructification of the varieties. 3trees were marked from each variety andhybrid, choosing and marking the thick branchin which the dynamically numbered andmeasurements of the fructification branches(Cociu V. and Oprea St., 1989). They werecounted and registered: number of fructificationbranches unit length of thick branch, number ofspur branches unit length of thick branch,number of short branches unit length of thickbranch, number of long branches unit length ofthick branch and number of mixt branches unitlength of thick branch.Fruit production was calculated from themedium production, cross-referred to thedensity of 625 trees per hectare (4 x 4m).For a more objective interpretation, the resultswere statistically processed using statisticalsoftware, obtaining the coefficient of variability

analysis of variance to express the variability inthe character analysis.RESULTS AND DISCUSSIONSTrunk cross-sectional area (cm 2 )The lower section of the trunk had thephenotypes: Andrei (m) with 180 cm 2 , 82.12.2BIV (e) and Valeria (ve) with 184 cm 2 andRares (ve) with less than 190 cm 2 . The mostphenotypes with over 250 cm 2 , resulted to be:Adina (l), Excelsior, Ilinca, Bucovina (m) andFavorit (l).Significant differences were provided for aprobability of error of up to 5% betweenmaturation groups, with limits ranging from189 cm 2 to 231 cm 2 (Figure 1). Variability tothe index of section of the trunk has a highvalue, expressed by the variability coefficientof 55,92%.Figure 1. Phenotype influence on cross-sectional area ofthe trunk based on the year of studyThe total number of fructification branches /linear meter of thick branchThe phenotype Ilinca (m) had the highestaverage number with 47 of fruiting branches.45 of fruiting branches had the phenotypes:Viorica (e), Nicusor (m) and Excelsior (m).With 44 of fruiting branches presented thephenotypes: Adina (l), Favorit (l) and Carmela(e) each with 43 of fruiting branches and Dacia(e) with 40 of fruiting branches. The coefficientof variability of the total number offructification branches/linear meter of thickbranch, expressed a medium-high value by thecoefficient of 21.81%.Number of spur branches / linear meter ofthick branchThe phenotypes with the bigest number of spurbranches were: Nicusor (m) – 27 branches,Valeria (ve), Viorica, Carmela (e) with 26branches, Dacia (e) and Rares (ve) with 25branches, Ilinca (m) – 24 branches, Alexandruand Andrei (m) each with 21.The variability of number spur branches /linearmeter of thick branch has a high valueexpressed by the coefficient of 71,57%.Number of short branches /linear meter ofthick branchThe phenotype 85.2.89 BIII (m) had the mostshort branches number/linear meter of thickbranch (over 22), followed by the phenotypes:Adina (l), 85.4.108 BIII (m), 85.3.100 BIII (m),82.28.62 BIV (m) and 82.12.7 BIV (l), withmedium between 15-20 short branches /linearmeter of thick branch. The variability of thenumber of short branches/linear meter of thickbranch had a high value, expressed by thecoefficient of 52,61%.Number of mixed branches /linear meter ofthick branchThe phenotypes with the most mixed branchesnumber were: 82.16.7 BIV (l) with 26 mixedbranches/linear meter of thick branch,Excelsior (m), 82.15.48 BIV (l), 82.32.9 BIV,82.7.65 BIV,Ilinca (m) and 82.4.41 BIV (l) between 20 and25 mixed branches/linear meter of thick branch.Groups of very early phenotypes do not bearfruit on the mixed branches.Significant differences were provided betweenthe late maturation group (15 branches), themedium (10) and the early (2 branches) (Figure2). The variability of the number of mixedbranches /linear meter of thick branch has ahigh value, expressed by the coefficient of102,05%.Figure 2. Influence of maturation class of fruits on on thenumber of medium branches / linear meter of thickbranch based of the year of study242

Number of long branches /linear meter ofthick branchThe phenotypes with highest number of longbranches number with medium maturationwere: 85.18.5BIII, 85.1.96 BIII – Nicusor,85.4.108 BIII, 85.4.95 BIII, Excelsior Mt.,85.2.89 BIII and the phenotype with early (e)maturation Carmela. The variability of numberlong branches /linear meter of thick branch hasa high value, expressed by the coefficient of59,66%.Fruit production (t/ha)The most productive phenotypes were: Dacia,Viorica (e), followed by Excelsior (m), Adina(l), Carmela (e), Nicusor, Siret, Ilinca, Favorit,Bucovina, the differences were not statisticallyassured. Variability in fruit production (t/ha)had a high value, expressed by the coefficientof variability of 72,96%.Correlations between fruit production (t/ha)and its componentsOn the 36 phenotypes a series of correlationswere made between fruit production (t/ha) andits components referring on the number of thefructification branch / linear meter of branchand the type of fructification branches withdirect implication on fruit production. Firstcorrelation is showed between fruit production(t/ha) and the number of fructification branchesper unit length of thick branch, by the existenceof a high coefficient of correlation 0,1084(Figure 3).Figure 4. Intensity correlation between fruit productionand tree trunk cross sectional areaThe correlation of coefficient calculatedbetween the number of fructification branchesand number of spur branches was 0,2379(Figure 5), between the number of fructificationbranches and number of long branches 0,1072(Figure 6), between the number of fructificationbranches and number of short branches 0,0623(Figure 7) showing a high correlation, while thecorrelation coefficient obtained between thenumber of fructification branches and numberof mixed branches had a smaller value of0,0117 (Figure 8), which indicate a reducteddegree of correlation.Figure 3. Intensity correlation between fruit productionand the number of fruit tree branches unit length of thickbranchFigure 5. Intensity correlation between the number ofbranches of fruit and number of may branches to the unitlength of thick branchA strong correlation was observed between fruitproduction (t/ha) and tree trunk cross-sectionalarea which is based on determining a highcorrelation coefficient of 0,7748 (Figure 4).243

highlighted by a correlation coefficient of 0,466(Figure 9), but with other types of fruitbranches, the correlation is different.Figure 6. Intensity correlation between the number offructification branches and number of long branches tothe unit length of thick branchFigure 9. Intensity correlation between cross-sectionalarea of the trunk and the number of fruit branches to theunit length of thick branchCONCLUSIONSFigure 7. Intensity correlation between the number ofbranches of fruit and number of short branches to theunit length of thick branchThese significant correlations were foundbetween:- fruit production (t/ha) and number fruitingbranches/linear meter of thick branch R 2 =0,1084***.- fruit production (t/ha) and tree trunk crosssectionalarea R 2 = 0,7748***.- the number of fruit branches and the numberof spur branches R 2 = 0,2879***.- the number of fruit branches and the numberof long branches R 2 = 0,1072 ***.- trunk cross-sectional area and the numberfruiting branches / linear meter of thick branchR 2 = 0,466 ***.REFERENCESFigure 8. Intensity correlation between the number ofbranches of fruit and number of mixt branches to the unitlength of thick branchCorrelation between trunk cross-sectionalarea and the number fruiting branchesDirect relationship between trunk crosssectionalarea and the number of fructificationbranches/linear meter of thick branch isAudergon J.M., 1995. Variety and breeding, apricotculture. Acta Horticulturae 384, p. 35-44.Bassi D., Audergon J.M., 2006. Apricot breeding: updateand perspectives. Acta Horticulturae 701, p. 279-294.Balan V., Tudor V., Petrisor C., 2006. Maintenance ofbiodiversity of apricot tree phenotypes in Romania.ActaHorticulturae 701, p. 199-206.Cociu V., Oprea St., 1989. Metode de cercetare inameliorarea plantelor pomicole, Ed. Dacia, Cluj-Napoca.Tudor V., 2010. Teza de doctorat. Cercetari privindcomportarea noilor soiuri si hibrizi de cais obtinuti laS.C.D.P. Baneasa pentru zona de sud a tarii.244

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653AbstractNEW H1 BUZAU F1 HYBRID OF EGGPLANT OBTAINEDAT V.R.D.S. BUZUCostel VÎNTORU, Eliza TEODORESCU, Bianca ZAMFIRVegetable Research and Development Station Buzau, No. 23, Mesteacanului Street,zip code 120024, Buzau, RomaniaCorresponding author email: costel_vinatoru@yahoo.comThe absence of local hybrids for greenhouses imposed starting an intensive breeding program at V.R.D.S. Buzau since1996. The main purpose of the program is obtaining valuable hybrids which show strongly F1 heterosis. Through interand intraspecific hybridization works in Solanum genus, besides disease resistance inheritance, valuable features canbe obtained: genetical resistance at extreme weather, extremely high or low temperatures, water stress or salinity(Downey M.C.,1991). Obtaining productive hybrids with genetical resistance at Verticilium dahliae fungus allows theelimination or the decrease of chemical treatments which would lead to cost reduction and environmental pollutiondecrease (M. Tudor,1996). After evaluation and intensive breeding work with germplasm resource, it was obtained anumber of 22 stable genitors. After general and specific combining ability were obtained a large number of hybridcombinations. L1 A and L1 S hybrid showed F1 superiority and phenotipical uniformity, obtaining H1 Buzau F1 hybridin 2010. Comparative crops both from greenhouses and field revealed valuable genetical resource which demonstratedphenotipically reproductive and adaptive heterosis and also high productivity and ecological plasticity.Key words: breeding, heterosis, hybrid, genitor, germplasm.INTRODUCTIONHybrid F1 eggplant seeds become a necessity,especially for glass crops. In our country, thelack of local hybrids at these species led to thepurchase of foreign hybrids at very high pricesand these did not meet the consumers andgrowers requirements. As a result, BreedingLaboratory from V.R.D.S. Buzau studied aresearch plan since 1996 which aimedobtaining F1 local hybrids at eggplant incompetition with ones from prestigious brands.In the breeding works has been studied avaluable genetic material, adapted to ourenvironmental conditions but it had not beenneglected foreign genotypes which had shownimportant features.MATERIALS AND METHODSThe research started in 1996 acquiring valuablegenetical material for collection field.Germplasm resource contains over 60important lines advanced breeded. Afterforming the collection field, it was evaluatedwith observation sheets and chromosomal map.After the evaluation the important material wastransferred from the collection field to the work245field where was intensively improved. Workingfield contains 22 valuable genitors which arepart of the conservative selection plan. Themain criteria which formed the base forchoosing the material for collection and totransfer it in the working field were:- genetical inheritance of the genitors whichmanifests clearly important phenotypicalfeatures- genitors stability and uniformity expressedthrough decreased variability of the maincharacters and their progeny transfer- genetical ability of the genitors tohybridization process, this aim being reachedby testing combining general and specificabilityThe 22 genitors that form the work field werecrossed and were obtained a number ofcombinations in order to obtain reproductive,adaptive and metabolic heterosis. Hybridcombination which demonstrated clearly thisphenomenon was realized between L 1 A and L1 S genitors. It was used classical hybridizationby female flowers castration and elimination ofstamens before opening to avoid selfpollinating.

without heat and in open field. Crop technologywas the classical one for each system. Tohighlight the main parameters of the newhybrid, Aragon by Hazera, a top market hybridwas used as monitor.The main data from theboth crop systems measured at genitors, newhybrid and monitor plants and fruits arepresented in table nr. 1,2, 3 and 4:Figure 1. HybridizationAs novelty in hybridization process (Figure 1)was the implementation of a new technologymethod of pollen transfer from maternal topaternal genitor. This method was elaborated atV.R.D.S. Buzau and consists of using a liquidsolution of water and sugar or honey mixedwith patern pollen and then the flowers aresprayed bathing with this solution. Thismethod has many advantages as:-the liquid solution feeds and hydrate pollengrains giving them long life and resistance todrought.- adding pollen grains to female flower is asofter action avoiding aggression andmutilation.- sugar or honey are adherent so they are fixingthe pollen grains to flower stigma avoidingpollen release.-higher efficiency, secure and easer work in thehybridization process.Table 1. The main biometric data measured ingreenhousePlantheight(cm)Shootno.Leafno./plant HabitPlantdiameter(cm)Cultivarmainsec. big smallL 1 A 200 3 8 32 36 erect 70L 1 S 80 3 6 35 62 erect 65H1 Bz F1 100 4 8 52 86 Globular 70ARAGONF1(MT)92 4 8 48 68 globular 67The registered values highlight the maincharacters distinctibility of the genitor, hybridand monitor plants. In what concerns plantheight, genitor L1 A range first followed by H1Bz. In what concerns shoots number/plant, H 1Bz came first followed by monitor. The bignumber of leafs, superior to genitors andmonitor hybrid demonstrates that this plantmanifest somatic heterosis which is animportant feature for breeding. Altoughgenitors of the hybrid have erect habit, F1hybrid resulted has an uniform globular shaperesembling with the one of monitor. Plantdiameter highlights increased vigor of thehybrid from both genitor and monitor.RESULTS AND DISCUSSIONSThe research undertaken at this species from1996 since now had finished with valuableresults:-it was constituted and conservated agermplasm resource of which could beobtained new valuable creations-were obtained 22 important genitors with highability to create new varieties and hybrids-the entire collected material was tested forgeneral and specific combining ability and theresults were saved on computer-H1 Buzau F1 hybrid was obtained in 2010which meets the main proposed objective.H1 Buzau F1 hybrid was studied 3 years afterthe release in two crop systems: greenhouse246Table 2. The main biometric data measured in fieldPlantheight(cm)Shootno.Leafno./plant HabitPlantdiameter(cm)Cultivarmainsec. big smallL 1 A 118 3 6 24 22 erect 46L 1 S 68 3 5 26 36 erect 40H1 Bz F1 75 4 6 38 48 Globular 45ARAGONF1(MT)71 4 5 32 41 globular 42The values registered in field are significantlyreduced at all studied parameters both atgenitors and H1 Bz hybrid and monitor. Thehabit of the plant was not transformed in thisenvironmental conditions.

Table 3. The main biometric data measured at fruits in greenhouseCultivarFruit Fruit diameter FruitFruits no.Fruit colourweight (cm)lenght/plant(gr) base middle top (cm) outside insidePulp consistencyL1A 12 380 3.4 5.5 1.5 24 black Yellow NormalL1 S 6 441 4.8 8.1 4 20 black Yellow NormalH1 Bz F1 8 777 5.4 8.4 6 28 black White FluffyARAGON F1 (MT) 8 628 4.8 7.2 5.1 26 black White FluffyTable no. 3 presents that the number of fruitsper plant at H1 Bz hybrid represented anaverage of the genitors values but averageweight was significantly higher than gemitorsand monitor. The fruit shape could bereconstituted easily after the values concerningfruit base, middle and top shape, measurementswhich demonstrated H 1 Bz superiority. Theinside and outside fruit colour and consistencyshows that hybrid production is high qualityand meets the present requirements of theconsumers. (Figure 2).Table 4. The main biometric data measured at fruits in fieldCultivarFruit Fruit diameter FruitFruit colourweight (cm)lenght(gr) base middle top (cm) outside insidePulp consistencyL1A 223 2.8 4.3 1.3 19 black Yellowish white NormalL1 S 315 3.6 6.8 3.3 17 black Yellowish white NormalH1 Bz F1 482 4.5 7.2 5.4 22 black White FluffyARAGON F1 (MT) 420 3.9 6.6 4.6 21 black White FluffyBiometric measurements registered in the fieldshows that all studied cultivars presentedsignificantly reduced values at all characters,only inside and outside colour and pulpconsistency remaining unchanged. Even in thiscrop system, the new hybrid showed superiorityboth to the monitor and genitors.Figure 3. Hybridization (fruit group detail)Figure 2. Crop detail; fruit lenght and longitudinalsection of fruitCONCLUSIONSThe registered values of H 1 Bz hybrid (Figure3) in the two crop systems, both greenhouseand field, showed clearly reproductive andadaptive heterosis phenomenon objectifiedthrough yield significantly higher than genitors247

ut the fruit had a reduced number of seeds andthe pulp is white and fluffy.After testing for 3 years at V.R.D.S. Buzau andin other vegetable areas where the seed hadbeen spread, they came to the conclusion thatthis new hybrid must be introduced widely forproduction replacing the missing varieties forgreenhouse and field so it was registered andproposed starting with 2013 for patenting.REFERENCESBunescu D, Sindile N., Atanasiu C., 1972. Comportareaunor soiuri, linii si hibrizi de patlagele vinete, Analevol.II, I.C.D.L.F. Vidra, Ed. M.A.D.R.-A.S.A.S.,Bucuresti, p. 11-23Dracea I., 1972. Genetica. Editura Didactica siPedagogica, Bucuresti, p 317-332Tudor M., 1996. Posibilitatea obtinerii formelorandrosterile de patlagele vinete prin hibridareainterspecifica” “Anale”-vol. XIV, I.C.D.L.F. Vidra,Ed. M.A.D.R.-A.S.A.S., Bucuresti, p. 53-59.248

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653NEW LINES OF AMARANTHUS OBTAINED AT V.R.D.S. BUZUBianca ZAMFIR, Costel VÎNTORU, Eliza TEODORESCUVegetable Research and Development Station Buzau, No. 23, Mesteacanului Street, zip code120024, Buzau, RomaniaCorresponding author email: costel_vinatoru@yahoo.comAbstractThe conservation and revaluation of biodiversity initiated by S.C.D.L. Buzau and Genetics and Breeding Laboratoryaimed to study Amaranthaceae species. These species were neglected until now both scientifically and as crop. Theappeareance of these species is not known but it is well known that were here since ancient times. A proof is theexistence of endemic populations and a wide range of biotypes which contains 16 species of Celosia and Amaranthuswith origin in the Romanian geographic area.The research of S.C.D.L. Buzau during 2005-2012 highlighted newvaluable data, especially in what concerns their multiple uses and wide range of expressivity of these species. Thisstudy of 3 new obtained lines is a step towards this species. Data and germplasm source accumulated till nowguarantee that in the future we can enrich scientific data.Key words: biodiversity, biotype, endemic, expression, germplasm.INTRODUCTIONModern possibilities to inform peoplenowadays and free travelling abroad since 1990highlighted new valuable data aboutAmaranthaceae family. Altough for manypeople this species is considered a weed, thescientists proved otherwise, that this can be avaluable food, an exceptional medicinal herb,an important biomass resource and last but notleast a real ornamental plant. In the past, in ourcountry, this plant was collectively known as”red amaranth”, being used in Romanianhouseholds in various dishes and wild amaranthcultivars were used in animal feed. As the timepassed this edible plant was neglected andnowadays we rarely find it in traditionalhouseholds. (Figure 1)Starting 2005, Breeding Laboratoryof V.R.D.S. Buzau studied this speciescreating and implementing a specificalbreeding program for this species.The main objectives of this program were:-preservating genetic sources and enrichingcountinously the general collection field withnew genotypes-valuable genotypes breeding for obtaining newcreations with phenotypical expression specificfor uses direction-gathering a database for better knowing thespecies.249Figure 1. Amaranthus seedlings linesMATERIALS AND METHODSBreeding works started with a documentationprogram focused on national and internationalachievements. After this study we concludedthat nationally this species is little knowncompared with international top achievements.

Genetic autochthonous heritage wasinventoried and 16 species were discovered inspontaneous flora, many belonging toAmaranthus retroflexus, Amaranthus liividusand Amaranthus blitoides species. Worldwidewe found that are over 800 species ofAmaranthus.The next step aimed to form a collection fieldwhich has presently 20 valuable genotypesfrom local and foreign origins. Afterintensively breeding works, 3 of them werepromoted in the work field: L1, Amaranthusretroflexus, L4, Amaranthus caudatus, L5,Amaranthus cruentus. These lines correspondD.U.S. criteria demonstrating distinctness,homogeneity and stability as for wereundergone to conservative selection program.Crop establishment was made by seedlingsgrown on 70 holes alveolar pallets on redgrounded nutritional turf substrate. Seedlingsproduction is similar to the other vegetablespecies production, to mention that seedlingswere thinned after spring and a single plant wasleft per hole. This work was necessary becauseof the extremely small size of the seeds,making imposible the introduction only of oneseed in a hole. Field crop establishment wasmade on 1,4 m shaped land using L 445 tractorin aggregate with MMS 1,2. Planting was madein equidistant rows spaced at 70 cm and 35-40cm distance between plants per row. The cropdid not require special care works, were onlymanually and mechanical breed and irrigated.Was not necessary to apply chemical orbiological treatements against pests anddiseases or soil and foliar fertilization. The 3crops displayed original potentiall forsuccessfully ecological cultivation.from rare villages placed 700-800 m altitude.The residents used it in the past as edible plantespecially to prepare soups. As the plantmatured, it lost its juiciness becoming stringand being used for animal feed. Afterspecifically selection works we limited themain characteristics variability, we eliminatedatypical biotypes and the species performancesdramatically increased. The main use of theline is the edacious one because of its exceptionproperties : juiciness of shoots and leaves, yieldpotential, over 22 t/ha and last but not least redor garnet natural colour present all over theplant.Figure 2. Seedling details: entire plant, upper andunderside of the leafRESULTS AND DISCUSSIONSBreeding works ended obtaining until now 3new valuable lines with different applicationdirections. Also a rich germplasm collectionwas gathered containing valuable lines indifferent breeding state, one of them grown forthe first time in our country and would bepresented in our future works.The obtained lines are the following:L1-Amaranthus retroflexusThis line (Figure 2) comes from an endemiclocal population discovered in the Buzaumountain side, Lopatari locality composed250Figure 3. L1 crop and inflorescence detailL4- Amaranthus caudatusThis line (Figure 3 and 4) was cultivated alsofor the first time in our country, was purchasedthrough a biologic material exchange with aprivate Dutch collector. This species iscollectively called ”elephant trunk”, similar

varieties existed in our country too but called”turkey crest”. Initially this cultivar presentedmany biotypes but after a rigouros selectionatypical biotypes were eliminated, the mainbiotype that respected criteria required by”variety” notion was maintained.In the breeding program, the main objective forthis line was aimed on ornamental use of theplant that was successfully accomplished. Thepossibility of using this line like an edible plantis not excluded but we mention that the ediblevegetative mass yield is smaller than the oneobtained at L1 and more restricted concerningperiod of time. It can be used with that purposeuntil flowering.characters variability cultivar and after theimplementation of the breeding program welimited these characters variability to a normalstate. The aim of breeding was to use the plantas an ornamental one but we did not excludeother uses, especially alimentary one. Thisplant is vigorous, remarkable by its erect spikeinflorescence intense red garnet coloured,extremely beautiful. (Figure 7). The studiesundertaken until now showed that this biologiccreation and also the previous ones did notrequire special technologies, L4 and L5 couldbe cultivated in protected grounds andornamental pots mentioning that their sizedramatically diminished in pots compared withnatural field conditions.Figure 4. Seedling details: entire plant, upper andunderside of the leafFigure 6. Seedling details: entire plant, upper andunderside of the leafFigure 5. L4 crop and inflorescence detailFigure 7. L5 crop and inflorescence detailL5-Amaranthus cruentusThis line (Figure 5 and 6) comes from the sameplace as line 4. This line was also cultivatedfrom the first time in our country since 2006.At the beginning it behaved as a large main251The main characteristics of Amaranthus lines inseedling state are presented in table 1 and themain characteristics of the plants in table nr.2:

Table 1. The main characteristics of Amaranthusseedlings linesCharacteristics/lines L1 L4 L5Sowing date 3.04.2012 3.04.2012 3.04.2012Spring date 9.04.2012 9.04.2012 9.04.2012Planting date 23.05.2012 23.05.2012 23.05.2012Seedling height (cm) 20 22 24Collar diameter (mm) 4 3 4Number of leaves 16 10 12Leaf lenght (cm) 3 5,7 6Stalk lenght (cm) 2,3 2,3 2The undertaken research demonstrate that all 3obtained lines produce a large number of seeds,L5 ranks first after L4 and the last being L1.We conclude that seed maturation is phasedstarting with inflorescence base to the top. Allthe lines preserve germination ability becauseof seed body covered with a glassy and chitinintegument that confers long storage period.According to the conducting tests made in 2005and restored on the same seed batch in 2012germination percentage meanwhile has beendecreased averagely for all the lines with 5%.The seeds sizes are too small, L1 has a seed of 1-1,2 mm diameter (Figure 8), L 4 (Figure 9)presents a very shiny seed of 1 mm diameter andL5 (Figure 10) has a smaller seed of 0,8 mm,slightly flattened similar with grains of sand.Figure 8. L1 seeds detailFigure 9. L4 seeds detailFigure 10. L5 seeds detailTable 2. The main characteristics of the plantsCharacter/line L1 L4 L5Plant height (cm) 85 165 115Stem height (cm) 6 28 16Number of shoots/plant 12 3 7Plant diameter (cm) 70 55 75greenishredred redpurple garnet-Inflorescence colourInflorescence length (cm) 12 78 38Number of inflorescenceramifications4 6 8Seeds colourblackrosewhiteblackCONCLUSIONSResearch carried out in 2005-2012 ended untilnow with the following results:-a germplasm collection was gathered at thisspecies from collection field and work field.-breeding works for L1, L4 and L5 lines endedand would be registered and proposed atI.S.T.I.S. for patenting and seed production andbroad range multiplication.-a valuable database was gathered which wouldcontribute successfully at breeding works.REFERENCESBayer company product, 1996. Determinator de buruieni,p. 27-29.Bayer company, 2012. Catalog de produse, p. 208.Pârvu C., 2006. Universul plantelor, Editura ASAB,Bucuresti, p. 21-22.252

PLANTPRODUCTIONSYSTEMS

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653THE EFFECT OF CONTAINER TYPE AND SOIL SUBSTRATES ONGROWTH AND ESTABLISHMENT OF SELECTED LANDSCAPE TREESHani AL-ZALZALEHAridland Agriculture Department, Kuwait Institute for Scientific Research, P.O.Box:24885, Safat,13109, Safat, KuwaitAbstractCorresponding author email: ahr96ha@yahoo.comRoot coiling and spiraling are the problems faced by the nurserymen for producing quality tree seedlings forlandscaping. The effects of various container types and substrate interactions on plant growth, and the influence ofcontainer type on post transplanting in the desert environment were investigated. Two arid- region plant species knownfor producing deep taproots (Acacia saligna and Eucalyptus viminalis) were selected for the study. Conventionalnursery pots were compared with root trainers and spring rings to determine the root growth and architecture. Resultsshowed that Acacia plants grown in spring rings showed significant increased plant height where as conventional potsgive highest root weight and as a consequence produced greater plant biomass. Clear trends for Eucalyptus was lessobvious, but tended to contrast with the findings for Acacia. Studies on the effect of combination of organic soil andcontainer type revealed that Eucalyptus plants grown in conventional containers have the highest plant growth. Amongthe soil mixes, Eucalyptus grown in 100% clay soil had a greater leaf area. When the plants were transplanted into anarid landscape, the plants grown in the spring rings distributed in all directions in the soil, and this habit is likely to aidthe tree in future. In this study, the results showed that container type could affect the aerial parts but this depends onthe plant species. Results demonstrated that spring rings reduce harmful root biomass (encircling roots) and encourageroot primordia. Differences in root and shoot growth resulting from the use of a range of growing media did not seemto interact with container type. The effect of the spring ring on plants grown in the landscape was obvious visually inthe short term but not apparent from growth quantification.Key words: arid, containers, landscaping, root trainers, spring rings.INTRODUCTIONDevelopment of management strategies thatpotentially promote rapid post-transplant rootgrowth is the key to successful seedlingestablishment. The urbanization demands hugequantity of diversified quality plantingmaterials, growing medium and the plantcontainers. Moreover, with the introduction ofindoor and miniature gardens different types ofcontainers and soil mixes are found to beessential for the proper growth of the plants.Plants grown in conventional containers for toolong often have deformed roots that are kinkedor grow along the sides or bottom of the rootball. Root restriction is an inherent problemwith container grown trees (Arnold, 1996).Delay in transplanting from a conventionalcontainer to the landscape increases the chanceof developing poor root architecture. Manyalternative container types have been designedto reduce the incidence of deformed roots(Gilman et al., 2003). The important factor indeciding an improved container is to prevent255the development of a few dominant roots, andso produce a fibrous root system on all sidesthat holds the root ball together (Mullan andWhite, 2002). The longevity of individuallycontainer grown trees depends on containervolume, dimensions and the container shape.Container type (Sutherland and Day, 1988) andcontainer dimension (Schuch and Pittenger,1996; Nesmith and Duval, 1998) also have amarked effect on root and plant growth(Handreck and Black, 1984). In a work onEucalyptus camaldulensis, Ngulube (1989) findthat seedling growth increases with plantingtube size.Soil physics also interacts with rootarchitecture. The physical property of the soildetermines the growth of the root system(Cockroft and Wallbrink, 1966). Roots tend toelongate more in a sandy soil whereas they areshort and more branched in a loamy soil (Perry,1982; Muthana et al., 1984). When the physicalfactors experienced by container grown plantsare compared to landscape destination, the

performance of the container plants might beimproved in long term. The growing mediatexture could affect plant growth since it willcontrol moisture, aeration and nutrients(Awang and Hamzah, 1986). The rate andpattern of root growth in the soil vary with thephysical, chemical, and microbiologicalproperties of soil (Brown and Scott, 1984). Thephysical properties of the soil can modify rootdiameter, development of root hairs and thebranching pattern of lateral roots (Lucas, 1987).However the interaction between the containersize and soil substrates is less well understoodand less frequently studied.Considering the massive greenery activity inKuwait, it is important to produce plants withquality characteristics, and with no initialdeformation in their root system. To achievethis objective, suitable plants as well as the bestpossible production technologies foroptimization of greenery enhancement is to bedeveloped (Bhat, 1997; Taha et al., 1988).Poorly formed root systems may disruptmanagement objectives and cause unplannedmaintenance expenses. The development, size,form and function of root systems arecontrolled by environmental and managementconditions that modify the expression ofcharacteristics (Harris, 1992). The findings ofthis study are likely to help landscape engineersand environmentalists.The present study tries to understand theeffectiveness of alternative containers anddifferent soils on tree growth. Evaluation ofdifferent containers on plant growth aftertransplanting in the field at a desertenvironment was also studied.MATERIALS AND METHODSExperiment no.1The first two experiments were conducted at agreenhouse of Plant Sciences Department,University of Reading, United Kingdom withan average daily maximum temperature of34°C and a minimum of 18°C. The Seedsobtained from Chiltern Seeds Company weregerminated in plug trays. The dimension ofeach cell in the tray was 3.7x5.5x1.5 cm. Threeweeks after germination, seedlings weretransplanted into the treatment containers filledwith SHL potting mixture. Conventionalnursery plastic pots (4.5x9x3cm) were256compared with root trainers (4x10x3cm), andspring rings (3.5x10x3.5cm). Every week eachcontainer was turned 90 degrees so that lightlevels around each plant were relatively even.After fifteen weeks, plants were harvested andrecorded the data. The number of leaves perplant was counted and leaf area was measuredwith an automatic leaf area meter (Delta TDevices). Leaf and shoot fresh weight wastaken immediately after excision from plant.Leaf and shoot dry weights were recorded. Dryweight for leaf and shoot was determined afterdrying for 72 hours at 80°C. Shoot height fromthe soil level to the tip was recorded. The freshand dry weight of the root and the root lengthwas also measured. The experiment was laidout in a randomized design with five plants pertreatment. Three blocks consisted of threetreatments with five replications, giving a totalof 45 replicates for each experimentExperiment no; 2A total of 120 uniform seedlings were chosenfor the trial. The container treatments wereConventional pots, Spring rings and Roottrainers where as clay 100%, sand 100%,sand85% and clay 15%, sand 70% and clay 30%,sand 55% and clay 45 were the soil seriestreatments. Throughout the study, containerswere rotated and excess bottom roots wereclipped to maintain root growth within thecontainers. The time gap between the twodestructive harvests was five months. Theexperiment was laid as a completelyrandomized design with eight replications.Experiment no. 3Eucalyptus seedlings grown in UnitedKingdom were air shipped to Kuwait and wasexperimented at Salmiya waterfront experimentstation. Spring rings, Root trainers, and Roundcontainers were used as treatments. Thedimensions were 3.5x10x3.5cm, 4x10x3 cmand 3.5x10x3.5cm respectively for Springrings, Root trainers, and Round containers. Theplants remained in the containers for ninemonths and then transplanted into an open fieldin a randomized block design at a spacing of3x3 m. Destructive harvesting took place aftera year. All plants were carefully dug up fromthe field and the soil particles were washed off.Fine sieves were used to prevent any loss ofroot biomass.

Data were subjected to statistical analysis withthe SAS (SAS Institute Inc., Cary, NC)package. Method of least significant different(LSD) was applied to separate means.RESULTS AND DISCUSSIONSEffect of container geometryThe effect of different containers on root andshoot growth of Acacia saligna and Eucalyptusviminalis was listed in (Table.1). A. salignaplants grown in spring rings show a significantincrease in plant height. None of theexperimental containers allowed Acacia plantsto produce a marked difference in leaf area orleaf number. Even though the leaf fresh and dryweight was higher in conventional pots, it didnot vary significantly from the spring rings.The negligible difference in the shoot fresh anddry weight and also total top biomass fresh anddry weight reveals that the differences incontainers did not affect much in the shootgrowth of the plants. The low fresh and dryweight of roots in spring rings may be due tothe self pruning of roots when come in contactwith air after emerging from the numerousholes. The net result shows that the total plantbiomass has significantly higher inconventional pots and root trainers than othertreatment. Any environmental change orrestriction might affect the plant morphologicalgrowth. For example, on apple trees caused adecrease in leaf area and dry weight of totalplant, but these growth declines may beexpected where resources are limiting relativeto the ability of the root system to meet theneeds of the top growth (Ferree, 1989). It wasfound that in spring rings under both water androot restrictions branching of the shoot andtotal plant dry matter accumulation weregreatly reduced (Krizek and Dubik, 1987).The actual mechanism by which the differencein plant height among different containerscould occur is not clear. It may be due to thecontainer shape and the openings around springrings that will produce a better growingmedium as a result of better gas exchange. Thegrowing media in containers should have highwater movement, good drainage and aeration(Donahue et al., 1983). The excess water notused by a seedling produces a waterloggedcondition that impairs aeration; this in turnreduces photosynthesis, translocation andgrowth (Sutherland and Day, 1988). It may alsobe that the proliferation of root tips due to airpruning in spring rings could lead to anincrease in root produced hormones.Alternatively, plants grown in spring rings havesuffered from higher levels of moisture loss andhence the reduction in root growth could be aform of stress response. ParametersTable 1. Effect of different containers on root and shoot growth of A. saligna and E. viminalis.Plant height (cm)Leaf area (cm2)Leaf numberLeaf fresh weight (gram)Leaf dry weight (gram)Shoot fresh weight (gram)Shoot dry weight (gram)Total top biomass fresh weight (gram)Total top biomass dry weight (gram)Root length (cm)Root fresh weight (gram)Root dry weight (gram)Total plant biomass fresh weight (gram)Total plant biomass dry weight (gram) Acacia saligna Eucalyptus viminalisCP RT SR CP RT SR57.40b 51.20b 60.90a 85.83a 75.17b 84.90a34.94 24.32 30.69 41.57 37.38 41.2517.67 14.80 14.67 179.20 174.80 189.4017.14a 11.79b 13.63a 6.77b 7.99a 6.43b3.20a 2.25b 2.93a 2.72 2.71 2.675.35 4.47 5.58 7.85b 6.30b 8.64a1.46 1.26 1.77 3.26a 2.39b 3.44a22.49 16.26 19.21 17.33 16.99 17.744.66 3.51 4.70 5.97 5.10 6.1116.43c 23.70a 19.90b 14.80c 21.40a 19.20b15.19a 6.20b 5.52b 11.77b 16.30a 11.63b4.74a 2.73b 3.52ª 1.60b 2.28a 1.76b58.77 49.68 49.32 29.10 33.30 29.379.40a 6.24b 8.22ª 7.57 7.38 7.87CP: Conventional Nursery Pot; RT: Root Trainer; SR: Spring Ring; Level of significance (0.05)Within each row means followed by a different letter are significantly different from each other.In E. viminalis, conventional pots producedplants with maximum height but did not vary257significantly from spring rings. No significantdifferences are seen among different containers

in leaf area and leaf number. The difference inshoot fresh and dry weight was found to benegligible in both conventional pots and springrings. No marked significant variation in totaltop biomass showed that shoot growth was notaffected by the differences in containers.Schuch and Pittenger (1996) grew Eucalyptuscitriodora in two different containers and foundno differences in shoot dry weight. Root length,root fresh and dry weights were significantlyhigher in root trainers than the other treatments.Root length is influenced by container depthand hence perhaps it is not surprising that roottrainers gave the highest value. The type ofnursery container used during production canhave a dramatic impact on root morphology ofcontainer grown plants (Arnold, 1996).Effect of different soil mixes and containertype over two periods of destructive harvestTable 2. Interaction level of soil mixes and containers attwo harvest level.Interaction Plant Leaf Aerial Root Totalparameters height area weight weight weightContainers * * * * *Soil * * * *Containers XSoil * Harvest * * * * *Containers XHarvest * * * Soil X Harvest * * * *Containers XSoilX Harvest * Level of significance-0.05.The above showed that the plant height wasaffected positively by the time period(expected) but also by container type. Plantsgrown in a conventional container were thetallest in comparison to plants grown into othertypes of container. The container formationmay retain soil moisture more successfully, orproduced a root patterning that allowed moreeffective nutrient up take those results in anincreased plant height. However it is importantnot just to focus on height as an indicator ofgrowth success as plants grown in spring ringshad a higher leaf area. It is known that growingmedia can be the determining factor for plantdevelopment and vigor. Different inorganic soilratios can give negative or positive effects onplant growth, based on both physical and258chemical factors that can affect the shoot androot ratio (Aung, 1974) . Different soil mediacan affect growth and possibly survival ofcontainer grown seedlings. However in thistrail the effect of soil type was not significantfor plant height but Eucalyptus grown in soilwith 100% clay did have a greater leaf area.The results again suggest that different plantparts respond differently to different types ofenvironment.The total aerial dry weight was affectedstrongly by interactions between container, soiland harvest time but the relationship wascomplex and clear trends are hard to discern.There was an interaction between containertype and harvest time and soil type and harvesttime. This could reflect the relative rates atwhich roots colonize the different soil volumesand the time at which some growth equilibriumis reached. Root vigor can be determined byweight increment over a standard time (Rogersand Vyvyan, 1934). A desirable trend was thatsand performed well at the first harvest butpoorly by the second. This could be due tonutrient exhaustion or inability to effectivelymeet the moisture needs of the larger plantbiomass. In this study the container type hadgreat impact on root dry weight but there isinevitably an interaction with time (Gilman andKane, 1990).There was also a strong relationbetween soil and harvest period for root dryweight. Data from an underground rootlaboratory has shown that the extent of contactbetween root and soil is dynamic and can varywith time (Atkinson and Wilson, 1979). Thelonger the roots are growing in the same mediaand in the same container the greater theincrease the root biomass that is likely to beproduced, but fluctuations in root mass can alsooccur. However if a plant is left for a long timein the same container it will become root boundand the roots themselves will become thebarrier to aeration and water movement. Thismight be not true with the new spring rings. Inthis study air pruning affects root biomass andled to less overall plant biomass, but longerterm trails may give different results.Effect of container type on posttransplantingThe data from (Table 3) showed that plantheight increment and number of branches didnot differ significantly between the treatments.

Also, the dry biomass and root length did notsignificantly among the treatments. Plantswhich were grown in the spring ring containershad root systems that were distributed evenlythrough the soil and in all directions. The rootsystems from plants grown in root trainers andround containers had roots that were moreactive in the base and greater biomass. It is wellrecognized that tree survival and growth isstrongly influenced by the root system. Theroot system is the means by which soil-basedresources are used, tree anchorage is achieved(Fitter, 1991).Table 3. Effect of alternate containers on plant growth inarid climateAirParameterPruner Root Trainer Roundcontainer Plant height increment 55.8 78.0 72.0 Number of branches 24.0 22.0 30.0 Root biomass 7.54 8.32 10.18 Root length 57.19 63.3 42.70 *Level of significance-0.05A positive root distribution was found in plantsSprig ring containers. This would improve thetree’s ability to tolerate the harsh environmentof Kuwait’s desert. In the long term, plantsgrown in conventional containers might faceproblems with environmental stresses inKuwait. Good root systems can be shaped innurseries using proper containers (Long, 1978).There was only a significant difference in theroot length. This could aid the plant inabsorbing moisture during drought stress andstrengthen anchorage in high winds. From theobservations and the data, it is clear that plantgrowth was not affected by the container type.The plant root system was well distributed inall directions when growth in the field, and nodeformed roots were detected in plants initiatedin spring ring containers.CONCLUSIONSThis study reveals that spring rings have betterresults on A. saligna plant height whereasconventional pots gave the highest in totalbiomass production. Clear trends were lessobvious for Eucalyptus, but tended to contrastwith the findings for Acacia. Container typecould affect the aerial parts but this depends onthe plant species. On the other hand containertype and shape had direct impact on rootbehavior but not necessarily on root production.Among the soil substrates Eucalyptus grown in100%clay had a greater leaf area. Spring ringcontainers reduced harmful root biomass andencircling of roots. The plant root system waswell distributed when grown in the field, andno deformed roots were detected in treestransplanted from spring ring containers.ACKNOWLEDGEMENTSThe author would like to thank KuwaitUniversity and Kuwait Institute for ScientificResearch for providing the finance,infrastructural facilities and encouragement.REFERENCESArnold M.A., 1996. Mechanical correction andmechanical avoidance of circling of rootsdifferentially affect post transplant root regenerationand field establishment on container grown Shumarkoak. Journal of American Society of HorticultureScience, 121, p. 258-263.Atkinson D., Wilson S.A., 1979. The root soil interfaceand its significance for fruit tree roots of differentages. In: Harley J.L., Scott R.R (Eds), Soil RootInterface. Academic Press, p. 259-271.Aung L.H., 1974. Root and shoot relationship. In: CarsonE.W (Eds), Plant Root and its Environment.University Press, Virginia, p. 29-61.Awang K., Hamzah M.B., 1986. Effect of pottingmixtures and fertilizers on the growth of Acaciamangium wild seedlings. Malaysian ApplicationBiology, 15 (1), p. 31-42.Bhat N.R., 1997. Screening of selected plants forlandscape beautification and greenery development inKuwait. Kuwait Institute for Scientific Research,Report No. 5143, Kuwait.Brown D.A., Scott H.D., 1984. Dependence of cropgrowth and yield on root development and activity.In: Barber S.A., Bouldin D.R (Eds), Roots, Nutrient,Water Influx and Plant Growth. Soil Science Societyof America, p. 101-136.Cockroft B., Wallbrink J.C., 1966. Root distribution oforchard trees. Australian journal of AgricultureResearch (17), p. 49-54Donahue R.L., Miller R.W., Shickluna J.C., 1983. Anintroduction to soils and plant growth. EnglewoodCliffs, Prentice Hall, New Jersey.Ferree D.C., 1989. Growth and carbohydrate distributionof young apple trees in response to root pruning andtree density. Horticulture Science, 24 (1), p. 62-65.Fitter A.H., 1991. Characteristics and functions of rootsystems. Marcel Decker, New York, 3-25.Gilman E.F., Kane M.E., 1990. Root growth of Redmaple following planting from containers.Horticulture Science, 25 (5), p. 527-528.259

Gilman E.F., Grabosky J., Stodola A., 2003. Irrigationand container type impact on Red maple (Acerrubrum L.) five years after landscape planting.Journal of Arboriculture, 29 (4), p. 231-235.Handreck K.A., Black N.D., 1984. Growing Media forOrnamental Plants and Turf. New South WalesUniversity Press, Sydney, Australia.Harris R.W., 1992. Integrated management of landscapetrees, shrubs and vines. Englewood Cliffs, PrenticeHall, New Jersey.Krizek D.T., Dubik S.P., 1987. Influence of water stressand restricted root volume on growth anddevelopment of urban trees. Journal of Arboriculture,13 (2), p. 47-55.Long J.N., 1978. Root system form and its relation togrowth in young conifers. In: Eden E.V., KinghornJ.M (Eds), Proceedings of the Root Form of PlantedTrees Symposium, Victoria Canada, 16-19 May.British Columbia Ministry of Forestry, Canada, p.222-240.Lucas W. J., 1987. Functional aspects of cells in rootapices. In: Gregory P.J., Lake J.V., Rose A (Eds),Root Development and Functions. Seminar Series 30,Cambridge University Press, p. 123-136.Mullan G.D., White P.J., 2002. Seedling quality makinginformed choices. Department of Conservation andland management, Wheat belt Region, WesternAustralia.Muthana K.D., Meena G.L., Bhatia N.S., Bhatia O.P.,1984. Root system of desert tree species. My Forest,(3), p. 27-36.Nesmith, D.S., Duval J.R., 1998. The effect of containersize. Horticulture Technology, 8 (4), p. 495-498.Nglube M.R., 1989. Polythene tube sizes of risingEucalyptus seedlings for dry land afforestrationprogrammes in Malawi. Journal of Tropical Forestry,5 (1), p. 30-35.Perry T.O., 1982. The ecology of tree roots and practicalsignificance. Journal of Arboriculture, 8 (8), p. 197-211.Rogers W.S., Vyvyan M.C., 1934. Rootstock and soileffect on apple root systems, The Journal ofPomology and Horticulture Science, 12 (1), p. 110-150.Schuch U.K., Pittenger D.R., 1996. Root and shootgrowth of Eucalyptus in response to containerconfiguration and copper carbonate. HorticultureScience, 31 (1), p. 165.Sutherland R.J., Day R.J., 1988. Container volumeaffects survival and growth of White Spruce, BlackSpruce and Jack Pine Seedlings. Northern Journal ofApplied Forestry, 5, p. 185-189.Taha F. K; D. Houkal; A. Hegab; V. Agarwal; E. El-Nasri; and M. Khan. 1988. Plant testing program forthe Kuwait waterfront project. Vol II, KuwaitInstitute for Scientific Research, Report No. KISR28995, Kuwait.260

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653THE GROWTH CHARACTERISTICS OF SIX PEAR CULTIVARS UNDERTHE “TRIDENT” TRAINING SYSTEM IN SOUTH-EAST OF ROMANIAAbstractIuliu CEAN, Florin STNICUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Blvd. Mrti,Bucharest, 011464, Bucharest, RomaniaCorresponding author email: iuliucean@yahoo.comNew orchards are heading to increase the planting density per hectare or to create an increased number of productivestructures (scaffolds, axes, etc.) per surface unit. One way to accomplish the second task is to divide the growth vigorover more branches. This goal can be achieved by new tree training systems asthree-axis shape called “Trident”“Candelabro”, “Chandelier” or “Candlestick”. A replicated trial was established in the orchard of the University ofAgronomic Sciences and Veterinary Medicine of Bucharest to evaluate the behavior of some self-rooted pear cultivarson “Trident” training system. The orchard spacing was 4 X 2.0 m and studied varieties were Abbé Fétel, Conference,Clapp’s Favorite, Max Red Bartlett, Beurré Bosc and Alexander Lucas. The trunk diameter, total annual shoot lengthand shoot number, tree height and other growth parameters were measured annually at the beginning of growingseason. The obtained results indicate differences between varieties. The greatest values for height tree were registeredin Abbé Fétel variety in both season and the lowest values for Clapp’s Favorite variety in 2011 and Max Red Bartlettvariety in 2012.The data referring to trunk cross section pointed out very significant positive differences at Abbé Fételand significant positive differences in case of “Conference” variety from average used as control in 2011. In 2012, twovarieties showed significant positive differences from the average experience, respectively Conference and Max RedBartlett.In 2011 varieties Conference, Abbé Fétel and Max Red Bartlett produced more long shoots than the averageof trial and in 2012 the varieties mentioned above and Beurré Bosc” formed long shoots more thanthe average.Key words: orchard system, self-rooted trees, tree growth.INTRODUCTIONTree architecture is an important aspect for thebreeders having regard that growth vigour andspecific type of growth andfructification affects directly the number oftrees/unit of area. The need to reduce bothpruning costs and the use of growth regulatorschanged the objectives of researches mainly inoptimization of training methods based onnatural tree habit (Lauri et. al., 2000). There arenumerous technical and organizationalinnovations (cultivars, rootstocks, croppingtechniques and defense techniques) that affectthe whole life of an orchard (Galli et al., 2011).Two aspects, trees cultivated on their own rootsand “Trident” training system were the subjectof our study.The use of self-rooted cultivars has had a greatsuccess in pear in the last decade. It offers thepossibility to obtain high quality yields and itis good technique that can be extend in pearorchard (Stanica et al., 2000). It also couldprovide some tolerance to disease, especiallyfire blight (Erwinia amylovora) (Spornbergeret. al., 2008).The “Trident” system proposes a centralleader and two side branches that are trainedvertically that means finally the tree presentthree leaders (Vercammen, 2011). Distributingvegetation over three axes induces less vigoursince tree sends nutrients responsible withgrowth in three axes instead of one. As bi-axissystem “Trident” system is based on the sameconcept and the same effects, such as: a goodexposure of fruit to sunlight, reducing treeheight, reduction of cultural practices, less useof growth regulators, considerable speeding ofharvest and pruning should appear (Dorigoni,2008). The aim of the present work was tostudy the behavior of six self-rooted pearvarieties in terms of vegetative growth of thetrees.MATERIALS AND METHODSThe study was conducted between 2011-2012in a modern pear orchard located in Bucharest261

area of latitude 26.5 degree East and longitude44.3 degree North. The altitude is about 90 mabove the sea level.The plant material used in this study includedself-rooted cultivars “Abbé Fétel”, “Max RedBartlett”, “Conference”, “Beurré Bosc”,“Alexander Lucas”, “Clapp’s Favorite”.Spacing between rows was 4 m and in the row2 m, the trees being leaded as “Trident” leadingform. A randomized block design for eachcultivar in tree replications with three trees perplot was set-up.There were used two support systems, onenamely T 4- wire with galvanized wire (figure1) and the other with two wire and threebamboo tutors/tree (figure 2). Figure 1. T-4 wire support systemFigure 2. Two wire and three bamboo tutorsThe existing drip irrigation system on eachrows provides 2l/hour water. It consist ofcontinuous dripping line and individualdrippers every 0.5.m.The soil is typical brown-reddish with 40%clay content in the surface layer.The average annual temperature is 10.6C andannual sum of precipitation is 574.3 mm.Measurements were carried out at thebeginning of each season, early in the spring,with roulette and caliper and results wereexpressed in cm.The trunk thickness was measured at 50 cmabove ground and was used to calculate thetrunk cross sectional area. Also were measured:tree height, the total length and/or number ofvegetative shoots. Total shoots were measuredor counted and classified as vegetative shootsor flowering shoots. Some data were processedwith variance analysis and t-test was applied.RESULTS AND DISCUSSIONSTo assure stability of system in ground wasThe growing vigour of the trees cultivated inused classical anchorage system and on the rowhigh density system shows us that between theevery 10 meters, concrete espaliers werepear varieties have appeared differencesplaced.regarding the trunk thickness growth, the heightThe alleyways were cultivated with perennialsof trees and transversal cross section.and were mowed mechanical in the growingThe trunk is an important element whichseason. On tree row the soil was maintainedcharacterizes the tree vigour and it is analyzedclean of weed by hand and mechanicaland correlated with a series of other biometricalcultivation.process and indices (Comanescu et al., 2012).The analysis of tree height values among thevarieties showed that tree height was lowest in262

“Clapp’s Favorite” in 2011 where the height ofthe tree constituted 170 cm and “Max RedBartlett” in 2012 with the height of the treeconstituted 200 cm. The highest values for thisparameter was registered in “Abbé Fétel” inboth seasons, with the height of the treeconstituted 250 cm in 2011 and 280 cm in 2012whereas in other varieties the recorded valueswere intermediate (table 1).Values of the trunk thickness comprisedbetween 2.10 and 2.93 cm in 2011 registeredthe pear tree varieties: “Max Red Bartlett: (2.70cm), “Clapp’s Favorite” (2.10 cm), “BeurréBosc” (2.62 cm), “Alexander Lucas” (2.50 cm),“Abbé Fétel” (2.93 cm) and “Conference”(2.88 cm). In 2012 the recorded values wereplaced between 2.80-3.82 cm with lowestvalues at “Clapp’s Favorite” (2.80 cm) andhighest at “Conference” variety (3.82 cm).Growth of trees, expressed as a trunk crosssection area registers extreme values,comprised between 3.5 cm 2 at “Clapp’sFavorite” variety and 6.7 cm 2 at “Abbé Fétel”variety in 2011. In the next year the valuescomprised between 6.2 cm 2 at “Clapp’sFavorite” variety and 11.6 cm 2 at “Max RedBartlett”. The data from 2011 were statisticallyprocessed as compared to the average of thetrial, used as control and pointed out verysignificant positive differences at “Abbé Fétel”and significant positive differences in case of“Conference” variety. In 2012 two varietiesshowed significant positive differences fromthe average of experience, respectively“Conference” and “Max Red Bartlett”.Significant negative differences, as comparedwith average, taken as control, registered the“Clapp’s Favorite” variety. Vigour withinsignificant differences, as compared withaverage had the varieties “Beurré Bosc”,“Clapp’s Favorite”, “Alexander Lucas”, “MaxRed Bartlett” in 2011 and “Abbé Fétel”,“Beurré Bosc” and “Alexander Lucas” in 2012.The average of annual vegetative shoot growthin 2011 was 147.8 cm/tree in “Clapp’sFavorite”, 257.8 cm/tree in “Beurré Bosc”,288.2 cm/tree in “Alexander Lucas”, 320.1cm/tree in “Conference”, 327.7 cm/tree in“Max Red Bartlett” and the highest value(413.5 cm/tree) in “Abbé Fétel”. In 2012 theregistered values were as follows: 346.5cm/tree in “Alexander Lucas”, 360.1 cm/tree in“Clapp’s Favorite”, 386.8 cm/tree in “AbbéFétel”, 405.6 cm/tree in “Conference” and 411cm/tree in “Beurré Bosc” varieties (fig. 3). In2011 trees from “Conference”, “Abbé Fétel”and “Max Red Bartlett” produced more longshoots than the average of trial (292.5 cm/tree).In 2012 the varieties mentioned above andadditional “Beurré Bosc” produced long shootsmore than the average (384 cm/tree).In 2011, a large number of vegetative spursproduced “Conference” (68) and “Beurré Bosc”(45) while “Max Red Bartlett” and “Clapp’sFavorite” formed the fewest number of spurs(39 and 38).Table 1. Vegetative growth in 2011 and 2012DifferencesTransversal cross sectionTree height (cm) Trunk thickness (cm)Pear variety(cm 2 as to average Significance)(cm 2 )2011 2012 2011 2012 2011 2012 2011 2012 2011 2012Abbé Fétel 250 280 2.93 3.48 6.7 9.5 +1.3 +0.35 NConference 210 250 2.88 3.82 6.5 11.4 +1.1 +2.25Beurré Bosc 190 250 2.62 3.28 5.4 8.5 0 -0.65 N NClapp’s Favorite 170 220 2.10 2.80 3.5 6.2 -1.9 -2.95 NAlexander Lucas 180 210 2.50 3.14 4.9 7.7 -0.5 -1.45 N NMax Red Bartlett 180 200 2.70 3.84 5.7 11.6 +0.3 +2.45 NAverage 196.6 235 2.62 3.39 5.4 9.15 - - - -DL 5 %=0.80 cm 2 (2011) N= not significant DL 5%=1.8 cm 2 (2012)DL 1%=1.14 cm 2 *= significant difference DL1%=2.5 cm 2DL 0.1%=1.65 cm 2 **= distinctive significant difference DL 0.1%=3.7 cm 2263

In 2012 “Alexander Lucas” produce the largestnumber of vegetative spurs (122), followed byBeurré Bosc“ (80) and the lowest number wasregistered in “Clapp’s Favorite” (table 3).The total length of the flowering shootsregistered the highest value in both years for“Max Red Bartlett” (119.4 cm/tree in 2011 and395.8 cm/tree in 2012) and the lowest value for“Beurré Bosc” (16.8 cm/tree in 2011 and 293.2cm/tree in 2012) (table 2). The varieties “MaxRed Bartlett”, “Conference” and “AbbéFétel” produced over than 300 cm/tree offlowering brindles in 2012 (table 2).The values of offshoots length varied between0 and 26.1 cm/tree in 2011 and 7.8 -107.8cm/tree in 2012 with the highest valueregistered in “Max Red Bartlett” variety in2011 (26.1 cm/tree) and “Alexander Lucas”variety in 2012 (107.8 cm/tree) (table 2).“Alexander Lucas” variety formed the largestnumber of flowering dards in 2011 (67) and“Abbé Fétel” variety in 2012 (33) (table 3).Trees formed also fruit bourses, one of themremained undeveloped others are formed bydifferent shoots as spurs, dards or spurs anddards. “Abbé Fétel” and “Conference” formedconstantly spurs, dards and bourses but thehighest number of bourses with dards wasregistered in 2011 for “Alexander Lucas”variety (99) followed by “Clapp’s Favorite”variety with 54 bourses with dards (table 3).Table 2. Flowering shoots (cm/tree) registered between2011-2012Flowering shoots (cm/tree) Pear variety Brindles Offshoots Total length‘11 ‘12 ‘11 ‘12 ‘11 ‘12A. Fétel 33.1 302.2 11.8 61.8 44.9 364Conf. 27.5 321.7 15.3 14.5 42.8 336.2Beurré Bosc 16.8 213.5 0 7.8 16.8 221.3Clapp Fav. 17.6 271.2 0 22 17.6 293.2Al. Lucas 103.8 250 8.6 107.8 112.4 357.8Max RedBart.93.3 363.1 26.1 32.7 119.4 395.8Figure 3. Long shoots registered (cm/tree) between2011-2012Pear varietyTable 3. Average number/tree and type of vegetative and flowering shootsVegetativeshoots (no/tree)Spurs Flowering shoots (no/tree)Dards Fruit bourses undeveloped with spurs with dards with spurs&dards2011 2012 2011 2012 2011 2012 2011 2012 2011 2012 2011 2012Abbé Fétel 49 51 24 33 3 5 57 6 5 1 4 0Conference 68 54 25 10 0 16 10 61 0 0 0 0Beurré Bosc 54 83 9 5 0 0 0 8 0 0 0 0Clapp’s Favorite 38 50 14 3 0 3 5 2 54 0 0 0Alexander Lucas 45 122 67 24 0 3 5 11 99 0 0 0Max Red Bartlett 39 60 11 22 7 0 54 57 1 8 0 0CONCLUSIONSThe results showed that the studied pearvarieties have capability to growth in Bucharestarea.In term of tree height we registered insignificantdifferences between self rooted varietiesthat could be interpreted as a uniformity ofgrowth of studied cultivars.In 2011 trunk cross section area showed differencesallowing cultivars to be ranked in orderof decreasing vigor: “Abbé Fétel”, “Conference”,“Max Red Bartlett”, “Beurré Bosc”,“Alexander Lucas” and “Clapp’s Favorite”. In264

2012 the order was “Conference”, “Max RedBartlett”, “Abbé Fétel” “Alexander Lucas”and “Clapp’s Favorite”.ACKNOWLEDGEMENTSThis work was developed and financed withinthe framework of POSDRU/CPP 107/DMI1.5/S/76888 Project.REFERENCESComanescu D., Petre G., Petre V., 2012. The behavior ofsome apple trees varieties with genetic diseaseresistancein a high density system. Scientific papers.Series B. Horticulture. Vol. LVI., p. 63-68.Dorigoni A., 2008. Bi-axis-an alternative training systemfor apple growing. In Australian fruitgrower. 11 (2),12-16.Galli F., Ancarani V., Serra S., Musacchi S., 2011. Trainingsystems and roostocks for high density planting(HDP) of the cultivar “Abbé Fetel”: developmentaltrials in Italy. Acta Horticulturae no. 909.Proceedings of the XI th International Symposium onpear. Vol.2. p. 247-280.Lauri P. E., Costes E., 2000. European pear architectureand fruiting-branch management: overview of anINRA Research Program. Acta Horticulturae no. 596.Proceedings of the VIII th International Symposiumon pear. Vol. 2. p. 621-626.Stanica F., Dumitrascu M., Peticila A., 2000. Behaviourof three pear cultivars propagated in vitro and selfrooted,on tatura trellys canopy. Acta Horticulturaethno. 596. Proceedings of the VIIIInternational Symposium on pear. Vol.2. p.647-649.Spornberger A., Brunmayer R., Fischer G., KaufmannC., Osterc G., 2008. Testing of pear trees on theirown roots in comparison with important usedrootstocks under organic farming conditions withspecial regard to fire blight (E. amylovora). In: Boos.Markus (Ed.) Ecofruit - 13 th International Conferenceon Cultivation Technique and PhytopathologicalProblems in Organic Fruit-Growing: Proceedings tothe Conference from 18 th February to 20 th February2008 at Weinsberg/Germany, p. 216-219.Vercammen J., 2011. High-density pear systemscompared. Good Fruit Growth. September 2011.265

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653RESEARCHES ON THE MICROSPOREGENESESAND POLLEN TUBE DEVELOPMENT OF SOME CHERRY VARIETIESIN EXPERIMENTAL CONDITIONSAbstractMaria IORDACHEResearch-Development Station for Fruit Trees- Growing Baneasa,4 Ion Ionescu de la Brad Blvd., District 1, 71592, Bucharest, RomaniaCorresponding author email: mioaraiordache@yahoo.comBiological characteristics of pollen formation and development are dependent on weather conditions in the winter andearly spring thermal stabilization. In the last years, the weather disturbances manifested by late frosts, affected,mainly, physiological processes in mature pollen, which occurred by the reducing pollen germination capacity both asa percentage and also the development in terms of development in length (LPT) of the pollen tube. It were used specificmethods Carnoy fixation for high lighting the microsporogenesis stages and the germination on liquid medium in orderto selection optimal variants for the maximum potentialities of the pollen biological value. The work has been done onRomanian varieties of sweet cherry with different periods of ripening: Boambe de Cotnari, Severin, Daria, fromResearch & Development Station for Pomiculture Baneasa orchards. We observed a normal evolution at the anthers anthe trades level of microspores, consisting a good premise for the germinative manifestation capacity of the pollen. Invitro conditions of the developmentdynamics of the pollinic tube varied from 18% at 45% as dominant values. Inconclusionwe was considered germinated pollen all the granulates that had pollinic tubes length approximately equalwith double the diameter pollen. Key words: cherry, length pollen tube, microsporogenesis.INTRODUCTIONMicrosporogenesis is determined by geneticfactors and is dependent or conditioned duringhis deployment, by sudden thermal fluctuationsin winter wich often produce profounddisturbances.Microsporogenesis begins with reductiondivision (R!) and marks the passagethetransition from deep winter rest to optional rest(Bordeianu et al.,1961; Tarnavschi, 1963). Transition to the tetrad stage, then uninucleatemicrospores and pollen stage transition tobinucleat pollen, depends onPollen maturation phase corresponds to thebiological threshold (+6.5°C) for swelling buds(Ivacu, 2002).Gonzales et al. (2001), in its study onmicrosporogenesis, said on the other specieseconomic value, there is no strict relationshipbetween the type and configurationmicrosporogenesis fourfold orientation isstrongly influenced by tree especially duringmeiosis and there is also no direct correlation267between the type and diaphragmmicrosporogenesis mature pollen grains.Hedhly et al. (2004), said the pollengermination is the stage preceding the polenictube growing in stil. Each of these two stages(germination and pollen tube growth isstimulated (driven) by ambient thermalconditions such as: moderate temperature thatstimulates the stigma secretion, increases theadherence of the pollen and promotes thegermination and the slightly higher temperatureaccelerate the pollen tube growth and simulatesthe process of fertilization (Hedhly, 2004).Concerning nutrition media for the pollengermination consulted in national literature ondifferent species of fruit trees, these contains1,5% agar-agar (Cociu, Oprea, 1989; Butac etal., 2006; Blidariu et al., 2008), but also withsome exceptions such as liquid medium(Iordache et al., 2010).The object of this paper/research, is theanalysis of the pollen through microscopicallymethods, microsporogenesis determination,degree of maturation pollen by the evolution ofsporoderma, the final size from young

microspore to mature pollen, determination/analysisof pollen viability and germinationcapacity, and the relationship betweenvariations of media and dynamic pollen tubegermination, of three Romanian varieties ofcherry.These three varieties of cherry are available inour plantation of fruit trees and have not beeninvestigated (studied) and characterized fromthis point of view.MATERIALS AND METHODSIn 2011 there were evaluated microscopicallythree Romanian cherry cultivars with mediumand late ripening period: Severin, Daria, andBoambe de Cotnari. The age of the treesalternates between 7 and 9 years and belong tothe Baneasa SCDP collection. The samplesconsisted of flowering buds and open flowersthat were harvested as follows: flowering budswere collected in February-March and in Aprilthe flowers were collected in the first day ofanthezis and then the flowering buds.Flowering period lasted approximately 7 days.The flowering shoots were first fixed in Carnoysolution for several hours then preserved inethanol 70ºC (Andrei et al., 2003).Open flowers and the buds being opened(balloon stage) were analyzed immediatelyafter harvest (not being necessary orappropriate their setting and preserve).By dividing into sections (severing) theflowering buds that are being in progress(stage) before the swelling buds (pre-swelling)and swelling of the bud stage (March-April),we obtained the necessary data in the processof observing the early stages of themicrosporogenesis (tetrad with microspores,both very young and young microspores, thegradual appearance of the specific elements ofsporoderma, the apertures forming, etc.)The microscopical examination af samples inMarch has made on permanent preparations inglycerin gelatin, using optical microscopy IORtype ML4-M. It was used objectives 10x, 20xfor camera and 40x for microscopicexamination.For better observation (examination) of themorphological elements (features) mentioned,the preparations were stained with Carmin268Acetic Acid (ACA) or Methylene Blue vitaldye alcoholic solution (Andrei et al., 1972).They highlighted easier the differences betweenthe microspores with normal maturation of theimmatures, were identified viable microsporesby the non viables.At the pollen viability were estimated (V%)viability and germination capacity (G%) foreach variety separately. They used anthersextracted from several flowers forming ahomogeneons sample that represents faithfullythe biological potential of the pollen at thattime. Viability (V%) was expressed as apercentage in comparison of the viable pollenwith all pollen grains of microscopic fieldsexamined.To assess (estimate) the capacity ofgermination (G%), anthers were placed in eachsmall bottle as indicator (watch glass) and fewdrops of distilled water for hydration for pollenrelease.These unessential process and comparable withnatural hydration of pollen on the stigmasecretion (Xie B. et al., 2010).The pollen contained in each watch glass wasan sample mean for the cultivar examined.From the sample mean of each variety havebeen sowings of germination media twodifferent concentration of sucrose (15% and20%).The culture media that are used to the assess ofthe pollen germination are liquid media(distilled water) containing and 0,01% boricacid (H 3 BO 3 ).For each concentration of sucrose were seededthree versions (v 1 , v 2 , v 3 ) with which (by meansof them) was tasted the action of some flowerparts on (upon) germination.For the safety results were made in all threerepetitions (parallel sowing) as follows:- v 1 – the drop of liquid medium has beenseeded only with pollen;- v 2 – the drop of liquid medium has beenseeded with pollen together with pestle;- v 3 - the drop of liquid medium has beenseeded with pollen accompanied by emptyanthers.Pestle was introduced to try a simulation of theconditions in vivo referring to the stimulatingeffects that gineceu induced on the germinationrelease (on the stigma) and then on thedevelopment of the pollen tube. Pestle but

could have a negative effect of environmentalcontamination with saprophytic germs (yeast,molds) and may be itself an undesiderablenutritional support for the development of thesegerms.Therefore, similarly I kept 3-5 anthers emptiedin the drops (v 3 ), to pursue these possiblenegative processes.After sowing the first laboratory tests weredone after an interval of 5 hours.Microscopic examination of samples taken inApril, was done by transmitted light and thephase contrast with objectives 10x, 20x, 40x.To maintain unaltered microscopicpreparations, both microspors extracted fromthe flowering buds (February-March) and themature pollen extracted from open flowers orbuds in the process of flowering (April) used toassess the viability and germinative capacity,were included after examination, in permanentpreparations in glycerin gelatin (Andrei et al.,2003).Figure 1. Pollen mother cells (PMC), Ob.20x, Oc.10xRESULTS AND DISCUSSIONSConcerning microsporogenesis and thedevelopment of young microspores, theflowering cherry buds taken in February it wasrevealed the normal development of anthers inappearance and size during organogenesis inthe three varieties studied.The flowering cherry buds of 8 March – werepointed out (highlighted) tetrades ofmicrospores that characterizes pre-swollen budstage (before flowering buds swelling). Theappearance being normally not observeddistartions of the microspores in tetrad ordisproportionate development betweenmicrospores. It was also observed theuniformity and normality of the cellular contentbetween tetrad components.The microscopic field were observed andpollen mother cells (PMC), due to nonsynchronizing of microsporogenesis process(Figure1, Figure 2 ).269Figure 2. Tetrade chain of microspores in cherry varietyBoambe Cotnari, Ob.20x, Oc.10xOn March 18 began to appear very youngmicrospores that still coexist with tetrades andthe flowering cherry buds of 21 March it wasobserved that anthers, microspores veryyoung contains, recently released from thetetrad. Exin contour was devoid of visibleornaments and was examined with objectives10x,20x,40x.Contour was approximately circular. Uniformappearance, almost spherical, is explained bythe lack of sporoderma stratification.The apertures not appear obvious just becauseexin is still thin and devoid (without)ornamentations. In some granules, aperturs aremarked by obvious folds.The flowering cherry buds of 25 March notedtjat microspores are large rand have amaximum size of approx. 23,5 . Change insizes and uneven appearance of microsporesare due to non synchronizing of maturationstage of microspores at different anthers ofsome bud.There are also differences from one variety toanother on the stage of maturation of

microspores at certain date. Microspores aresignificantly different from those of 21 Marchas they start to differentiate at sporodermaslevel weaks ornamentations and we observe theapertures shape. However it also notes thecytoplasmic granulation at the granules withstill thin sporoderma .Concerning mature pollen: as the floweringcherry buds of 6 April, sporoderma has aspecific appearance for mature pollen, weproceeded of ots application to test theviability. Were revealed the microsporesappearance with a normal development forapprox. 70% in deep red and yellowmicrospores containing reduced or absentcell and pollen with methyl blue stainingvital dyestuff alcoholic solution, to highlightthe presence of oil droplets that alwaysaccompany young pollen maturation (Figure 3and Figure 4).Viability and germinative capacity of the threeRomanian varieties of cherry have maximumvalue for version 2 (v 2 ) with 20%sucrose. Boambe de Cotnari cultivar hadviability (V%) 80% and maximumgermination (G%) of 48%. Severinvariety had viability (V%) 75% and maximumgermination (G%) of 25% and Daria varietyhad viability (V%) 60% and the maximumgermination (G%) of 18%.As currently practiced were considered asbeing germinated the grains that has pollentube lenght at least equal twice the diameter ofpollen.Figure 4. Staining Pollen with methylene blue vitaldyestuff alcoholic solution, to highlight the presence ofoil droplets that always accompany young pollenmaturation in Daria variety, Ob.20x, Oc.10xThe results of 3 repetitions for eachexperiment, were expressed as a percentagebased on the corresponding arithmetic mean(Figure 5).The pollen tube length (PTL) / varietycorrelated with average sucrose % in variantsv 1 , v 2 , v 3 are thus: pollen tube germinated atcherry varieties in the Romanian culture media,varies in length from approx. 30 to about400. (Figure 6).To determine if a relationship exists betweenpollen tubes development and the medium thepollen germinated it was formed the graphicwhich were placed at intervals in order oflength () all „PTL max” and the correspondingexperiments (Figure 7).Figure 3. Red color, intense reaction to viable maturepollen during the test for viability, in cherry Severinvariety, Ob.10x, Oc.10x.Figure 5. Dynamic pollen (V% and G%) for 3 varietiesof cherry in variants (v1,v2.v3) with 20% sucrose.270

Figure 6. Mature pollen during germination, in cherryBoambe de Cotnari variety , Ob.10x, Oc.10xFigure 7. Dynamic pollen tube length (PTL ) for 3varieties of cherry in variants (v1,v2.v3) with 20%sucroseCONCLUSIONSAs a result of these experiments conducted in2011, in which has been evaluated thebiological value of the pollen at 3 varieties ofRomanian cherry, we conclude the following:The pollen maturation went in normalphysiological conditions, undisturbed inaccordance with the evolution of relativelymild weather winter 2011.Tetrades and microspores had a normal aspectfor the development phasem.Mature pollen showed viability between 60%and 80% and germination 18% - 45%.The best germination has been on liquidmedium with sucrose 20% and (H 3 BO 3 ) 0,01%.Boambe de Cotnari cultivar is in the top, bothin viability (80%) and in germination (48%)271and variety Daria is in the last place with 60%viability and 18% maximum germination.The best germination of all varieties wasobtained in variant (v2/medium + pollen +pestle) with 20% sucrose. Thus confirming thestimulant role of pestle in triggering ofgermination and pollen tube growth.The poor germination was v 3 with 20%sucrose and v 3 with 15% sucrose in allvarieties. Version 3 (v 3 /medium + anthers)usually has a minimum value due to thenegative influence of environmental anthertissue on germination.For version (v 1 ) 20% sucrose, germination wasequivalent to (v 1 ) 15% sucrose and and hadmoderate values. Version 1 (v 1 /medium +pollen) can be considered indicative value forpotential germination of pollen specificgranules in the absence of pistle influence.PTL max. was recorded in variety Boambe deCotnari (400 ) also in the version (v2) on anaverage of 20% sucrose.The 3 Romanian varieties cherry have broughtforth the specific potential of each.It confirms good germination (18-45%) and thecorresponding binding undisturbed weatherconditions during flowering andmicrosporogenesis.REFERENCESAndrei M., Paraschivoiu R., 2003. MicrotehnicaBotanic. Editura Niculescu. Bucureti, p. 120-223.Andrei M., Rdulescu D., 1972. Caiet pentru tehnicapreparrii i conservrii materialului biologic–Tehnica obinerii preparatelor microscopice. (Fac.Biologie) Univ.Bucuresti. p. 1-83.Balan V., 2008. Caisul i caisele. Editura CeresBucuresti.Baciu E., 1971. Contributii la studiul microsporogenezeila unele specii din subfamilia prunoideae. Lucr.St.seria B XIV 1971. Horticulture IANB. Bucuresti, p.241-245.Blidariu A., Iordnescu O., Micu R., Drgunescu A.,2008. Researches concerning pollen’s germinationand viability of some sour cherries varieties in theplain area of Banat. Bulletin Horticulture UASVM.Bucuresti. vol. 65(1), p. 505-507.Bordeianu T., Tarnavschi I., Radu I. F., Bumbac E.,Botez M., Andrei M., 1961. Studiul privind repausulde iarna si pragul biologic la mugurii floriferi de cais.Revista Studii si cercetari. Seria biologie, 4.Butac M., Militaru M., 2006. Fertilitatea i germinareapolenului la genotipuri de mr, pr, prun, cire i

viin utilizate ca genitori potentiali în ameliorare.Lucrarile Stiintifice ale ICDP PitetiMrcineni.vol.XXII:20-27.Cociu V., Oprea, St., 1989. Metode de cercet. înameliorarea plantelor pomicole. Ed. Dacia, Cluj-Napoca, p. 82-87.Gonzales F., Rudall P.,J., Furness C., 2001.Microsporogenesis and systematic ofAristolochiaceae. Botanical Journal ofLinnean Society, vol. 137, p. 221-224.Hendhly A., Hormaza JI., Herrero M., 2004. Efect oftemperature on pollen tube kinetics and dynamicsin sweet Cherry Prunus avium (Rosaceae). AmericanJurnal of Botany 91(4)m p 558-564.Iordache M., esan T., Andrei M., 2010,Researches onviability and germinative capacity of the pollen insome romanian appricot varieties. Symposium ISHS-ICDP-Piteti Mrcineni, Scientific Papers of theR.I.F.G. Piteti, vol XXVI, p. 46-50.Ivacu A., Toma St., 2001. Autofertilitatea nectarinuluisi influenta unor fungicide asupra germinariipolenului. Lucr. St. ICPP Pitesti Maracineni. vol.XX, p. 62-68.Ivacu A., 2002. S redescoperim piersicul. Ed.Universitas Company. Bucureti, p. 13-221.Tarnavschi, I., Bordeianu, T., Radu, I.F., Bumbac, E.,Botez, M., 1963. Diferenierea mugurilor de rod imicrosporogeneza, Acta Botanica HotiBucurestiensis (1961-1962), fascicol 1. (vol. Festiv),p. 343-361.Xie, B., Wang, X., Hong, Z., 2010. Precocious pollengermination in Arabidopsis plants with alteredcallose deposition during microsporogenesis,Springer, Planta 231, p. 809-823.272

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653RESEARCHES ON POLLEN VITALITY IN SOME APRICOT HYBRIDSAbstractMaria IORDACHE, Lenua COROIANUResearch-Development Station for Fruit Trees - Growing Baneasa,4 Ion Ionescu de la Brad Blvd, District 1, 71592, Bucharest, RomaniaCorresponding author email: mioaraiordache@yahoo.comPollen vitality as a biological feature is an important factor in the reproduction on amfimictic way and has majorimplications for the quantity and quality of fruit. In 2012, the negative effects upon the flowering buds that areproduced in winter by climatic factors manifested by sudden thermal fluctuations with persistent frost and hard frost,without intermediate temperatures from a period to another have led to strong hurting of buds of fruit. Physiologicaldisturbances due to the low temperatures have had a prolonged effect with repercussions in the microsporesmaturation, regarding the pollen viability and germinative capacity in some apricot tree. The object of the work is toevaluate the performance in germination %R(G/V) of the pollen, relationship expressed through germinal capacity andof mature pollen viability released from anthers that was affected by frost. There were evaluated microscopically thepollen vitality at apricot tree, hybrids: HB.82.62B.IV. and Nicusor cultivar with a different maturation period from theexisting collection of SCDP Baneasa. As a result of the effectuated experiment there were obtained following values:the two biological indicators of mature pollen from apricot, the germinal capacity (G%), viability (V%) and theirrelation expressed by the performance in germination %R(R/V), on both sucrose environments (15% and 20%),havehad values between 11%-33% for germinal capacity (G%), 25%-50% for viability (V%)and for efficiency ingermination %R(G/V)between 44%-77% . In conclusion, leaders were the 826.62 hybrid and Nicusor cultivar.Key words: germination capacity, pollen tube, viability.INTRODUCTIONThe assessment of the fertility degree throughpollen vitality and “fruit bounded, fruit set”quantity in natural conditions for fruit treesholdings, always involves, the effect ofenvironmental conditions, too.In vitro experiments of the pollen viability andgermination, is practiced method for thefertility estimation of pollen of fruit growingspecies, (cultivar or hybrid), in forecastingcrop, and for to check resistance, tolerance andadaptability pollen (respectively cultivar), tothe fluctuations and weather risks (very coldwinter frosts return spring frosts, etc.,).In vitro experiments are a good test forforecasting fertility rates in plantation flowers(Hedhly et al., 2004).Concentrations of sucrose used by someresearchers for the pollen germination testing invitro environments, were different, (Cociuand Oprea, 1989; Butac et al., 2006;Pdureanu, 2007; Blidariu et al., 2008;Iordache et al., 2010).Boric acid (H 3 BO 3 ) was added to the mediumin vitro, at various concentrations (Butac et al.,2006; Iordache et al., 2010).Both germination and pollen tubesdevelopment, are stimulated and depended byambient thermal conditions.Temperature during germination, has adeterminative effect on pollen tube kinetics anddynamics (both in medium as in style),stimulating then the fertilization process(Hedhly et al., 2004), in comparative study oftwo cultivars of Prunus avium L., Spain andCanada.The temperatures that for the pollengermination used were were between 18°C, and25°C (Butac et al., 2006; Pdureanu, 2007;Blidariu et al., 2008).The favorable temperature of pollen tubedevelopment for fruit trees, is between 10°Cand 20°C, (Hedhly et al., 2004).The temperatures below 10°C and above 20°Cdetermine the reduced germination rate andpollen tube development (Hedhly et al., 2004).273

The objective of this paper, is to evaluate thepotential fertility pollen, in laboratoryexperimental conditions.These apricot hybrids experienced in thisresearch, are existing in ours fruit treeplantation and have not been examined / testedand characterized and this point of view. thepollen germination (in vitro), in liquid medium(deprived of agar-agar), because we consideredit may be relatively comparable, withintercellular fluid composition of stylar tissue,that pollen tube develops, and allow betterdispersion of pollen and thus favors in liquidmedium, the development of pollen tubes.MATERIALS AND METHODSNicusor cultivar. Age of the trees is 8, withmedium and late ripening period. In April (onthe first day of anthesis in 04.04.2012), therewere taken from open flowers and floweringbuds for determing the viability and thecapacity of pollen germination.To asses the viability and to represent as realpossible the biological potential of the pollen atthat time, to each sample and analysis partly,were used fresh anthers that were extractedfrom the stem filaments of the flowers orcurrent flowering buds.directly on microscope slide glass, there wereapplied (according to the Method Andrei andParaschivoiu, 2003), directly on the fresh andmature pollen, e few drops reagent 2,3,5-Trifeniltetrazol Clorid, for coloring reaction(Andrei and Paraschivoiu, 2003).The pollen viability was evaluated under amicroscope in transmitted light, by examiningof the morphological and physiologicalcharacteristics of the pollen cell.The method is recommending the counting thecolored grains only as a result of the deep redreaction (Andrei and Paraschivoiu, 2003).The viability was expressed in per cent (V%)confronted by the total grains counted in thefield by reporting of the viable pollen to totalgrains of microscopic fields examined.For creating the media culture in vitro todetermine / assess germination capacity (G%)of the mature pollen, was hydrated (previously)the pollen, released from anthers fresh , onseveral slides glass.This essential process is comparable withnatural hydration of pollen on the stigmasecretion (Xie B. et al., 2010).Then separately, were made sowing ongermination media in 2 different and separatedconcentration of sucrose (15% and 20%) inwhich added 0,01% boric acid (H 3 BO 3 ).We believe that, the pollen germinationadvantage on the liquid medium directly onslide glass, allows at better microscopicexamination through transparency and thetransmited light unlike the germination on solidmedium in Petri dishes, which cannot beexamined only in direct light at o “powerenlargement“ of max. 200x for stereomagnifier.Also the pollen germination testing, was donein 3 different germination the tasting in 3germination variants (v1,v2,v3) by introducingof some floral parts (ginaeceum / pistil and theremaining emptied anthers), in germinationmedium to emphasize their influence / actionon pollen germination (Iordache et.al., 2010).So each microscopic slide was a test variant(V1,V2,V3) thus as follows:- Variant V1- liquid drops was seeded onlywith pollen- Variant V2 – drop of liquid was seeded withpollen together pistil, for a simulation of theconditions in vivo, relating to the stimulatingeffects that gynaeceum induces on startingof germination (on stigma) and then onpollinic tube development.- Variant V3 – liquid drop was seeded withpollen together remaining emptied anthersfor to have in view these possible negativeprocesses.Slides with media were kept at on averagetemperatures 17°C to 20°C in wet atmosphereso that the liquid medium doesn’t evaporate andthus it is maintained constant concentration inboric acid and sucrose.To reduce the risk of environmentalcontamination and to avoid the deterioration ofgermination medium, all the tools with whichthey were working, including filter paper andcultural medium were sterilized previously(Andrei and Paraschivoiu, 2003)..After sowing, the first laboratory tests weremade after a period of 5 hours of testing and 24hours.274

As currently is practiced they were consideredgerminated grains that had pollen tube length atleast twice the pollen diameter.To point out the pollen tube and nuclei wereapplied specific colorings on germinationmedia with dilluate solution of Methyl Blue.(Andrei and Rdulescu, 1972).The germinative capacity of the viable pollenwas expressed as a percentage (G%) based onthe corresponding arithmetic media.Then the values of germination (G%) werereported, the viability (V%) corresponding tothe hybrid / cultivar to obtain of the efficiencyin the germination of pollen % R(G/V).After the microscopical preparations, thegerminated pollen was included in glycerinjelly to maintain the microscopical preparationunaltered (Andrei and Paraschivoiu, 2003).For microscopic examination was used opticalmicroscope IOR type ML-4M.To point out the viability and the pollengermination, examination, assessments andphotographs were made in transmitted light,polarized light, and objectives 10x, 20x, 40xand C.F. (phase contrast) with 10x ocular.It was used ocular micrometer to measurepolinic dimensions.RESULTS AND DISCUSSIONSRegarding pollen viability evaluation (V%):viability ratio (%) is the first condition inpollen germination and gives us informationabout the probability of fertilization of thepistil.After the application of the specific enzymaticmethod for the determining viability (V%) ofthe pollen, the intense red color reaction hasoccurred at the following hybrids of apricot:Hybrid 82.6.62.B.IV. had maximum of approx.50% and at the apricot Hybrid 82.28.62.B.IV.has registered a low value of approx 25%,having as leaders / having in view theviability), the Hybrid 82.6.62.B.IV. andNicusor cultivar (Table 1, Figure 1).The viable mature pollen grains at apricot, hadthe following dimensions: from 48,3μ - 50,1μin the equatorial optical section (imageobtained in polar view) and from 44,0 μ - 46,3μ in optical meridian section (image obtained inequatorial view).Figure 1. Viability at Nicusor apricot cultivar,05.Apil.2012It was found that in terms of size andmorphological aspect and theapertures development, the germinal grains, so,with the normal physiological developmenthave dimensions close to those typical of thesame species (Tarnavschi et al., 1981-1984).Regarding evaluation of germination (G%) bythe action of pollen composition averageson 15% and 20% sucrose: the germinativecapacity (G%) of each hybrid and cultivarindividually has expressed by two maximvalues corresponding germination on the twomedium with 15% and 20% sucrose, to variant(v2).The highest values of germination capacity(G%) were at the Hybrid 82.6.62.B.IV. andNicusor cultivar, (table 1, figure 2, figure 3):28% and followed by 33% on sucrose medium20% followed by 33% and 37% on sucrosemedium 15%.It is a remarkable fact that from the point ofpractical view, in general the germination (G%)in 30% is considered satisfactory, because thespecialized literature recognizes that thisgermination is representative for thefertilitydegree of the flowers, respectively the bindingof future fruit (Ivascu, 2001).Therefore, germination value (G%)presented in table and graph, are themaximum values recorded for each hybrid, tocertain concentration of the medium withsucrose included in the experiment.275

Table 1. Relationship between germination G% viability and germination yield % R(G/V) at the apricot cultivars andhybrids evaluated in 2012MATURE POLLENGermination max.(G%) of total Germination max.(G%) of total Germination max.(G%) of totalHybrid/cultivarpollenpollenpollenZh 20% Zh 20% Zh 20% Zh 20%HB82.28.62.B.IV11 15 25 44 60HB 82.4.41.B.IV 17 19 30 57 63HB 82.6.62.B.IV 28 33 50 56 66NICUOR 33 37 48 68 77(*)The viability is determined by coloring with 2,3,5 Trifeniltetrazolclorid(**)The germination productivity (% RG/V) is calculated by the ratio of germination/viability (%)Figure 2. Apricot hybrid 82.662.BIV. on medium, with115% sucrose (04.April.2012)Regarding the evaluation of pollen germination(G%) by the action of experimented floral partsin 3 variants (v1,v2,v3), on pollen germinationon the mediums with 15% and 20% sucrose:the maximum values obtained depending on thevariants are representative for pollengermination from each of the hybrids studied.The highest germination values are observed atin second variant (V2/medium+pollen+pistille)and it is confirmed the incentive role of thepistil (at both mediums with 15% and 20%sucrose), except apricot hybrid 82.28.62.B.IV.,where V1>V2 on both environments.Generally the size relation between the threevariants (v1,v2,v3) is the following:- Variant (V2/medium+pollen+pistil) hasmaximum value because the incentive roleof the pistil in the germination and the pollentube growth.- Variant (V3/medium+anthers), has aminimum value as a result of a possiblenegative influences on germination that theanthers tissue has.- Variant (V1/medium+pollen), has an averagevalue (in the absence of favorable influence ofthe pistil, and the absence of the276negative influence of the anthers) and can beconsidered the indicative value for the specificgermination potential of pollen grain.The percentage germination (G%) appearscorrelated with viability (V%) respecting thenatural relationship between them.For each hybrid and cultivar as well, thegermination value were assigned to theviability values (V%), separately forgermination medium with sucrose 15% andseparately for the germination medium with20% sucrose.In this way was given by the productivity ingermination % R(G/V), that expressed thedegree of correlation between the twobiological characteristics of the pollen (thepower of germination and pollen viability) andthe germination relation/viability expresses asgerminable, viable the pollens are, because noteverything is viable has the power/ its ability togerminate.The highest potential in germination %R(G/V)is 77%, the leader being Nicusor cultivar ofapricot Hybrid 82.6.62.B.IV. on average of15% sucrose and the lowest %R(G/V) is 44%for Hybrid 82.28.62.B.IV. on average 20%sucrose .Figure 3. Action composition average 15% and 20%sucrose on pollen germination of apricot cultivars andhybrids evaluated (2012)

CONCLUSIONSFrom experiments in 2012 in which wasevaluated the viability (V%), the germinationcapacity (G%) and the efficiency ingermination %R(G/V), we have drawn thefollowing conclusions:The flowering of the apricot this year started inthe first days of April.The investigated apricot cultivars and hybridshave yielded in 2012 accordingly to the specificand individual potential but with negativeinfluences due to the microsporogenesis thatwas damaged in part and poor flowering insmall proportion.Regarding the two biological indicators of thepollen, the viability V% and germination G%and their relationship expressed by efficiencyin germination %R(G/V), on both sucrosemedium (15% and 20%), were obtained thefollowing values:The highest germination yield %R(G/V), it hasNicusor apricot cultivar on 15%sucrosemedium that presented 77% R(G/V) interms of only 48% viability (V%) and 37%germination (G%).The best germination percentage regarding theaction in media composition were recorded onliquid medium with 15% confronted with 20%sucrose medium.The highest values of germination and alsoof experienced floral representative parts in 3variants (v1,v2,v3), has consistency two variant(v2/medium+pollen+pistil) under the stimulantinfluence of pestle on both environments.Therefore the variant V2 we consider moreconcluding, because of the interaction betweenpollen and pistil for binding fruits prognosesthan V1.In vitro conditions, the germination (G%) ofthe pollen expresses by the pollen fertilitypotential and this relationship germinationviability expresses as germinable and vigorousare viable pollens and the germination degree%R(G/V) express the correlation degreebetween these two biological characteristics ofthe pollen.REFERENCESAndrei M., Paraschivoiu R., 2003.Microtehnica Botanic. Editura Niculescu.Bucureti, p. 120-223.Andrei M., Rdulescu D., 1972. Caiet pentru tehnicapreparrii i conservrii materialului biologic–Tehnica obinerii preparatelor microscopice.(Fac.Biologie) Univ.Bucuresti, p. 1-83.Baciu E., 1971. Contributii la studiul microsporogenezeila unele specii din subfamilia prunoideae. Lucr.St.seria B XIV 1971. Horticulture IANB. Bucuresti, p.241-245.Blidariu A., Iordnescu O., Micu R., Drgunescu A.,2008. Researches concerningpollen’s germinationand viability of some sour cherries varieties in theplain area of Banat. Bulletin Horticulture UASVM.Bucuresti. vol. 65(1), p. 505-507.Butac M., Militaru M., 2006. Fertilitatea i germinareapolenului la genotipuri de mr, pr, prun, cire iviin utilizate ca genitori potentiali în ameliorare.Lucrarile Stiintifice ale ICDP PitetiMrcineni.vol.XXII, p. 20-27.Cociu V., Oprea, St., 1989. Metode de cercet. înameliorarea plantelor pomicole. Edit. Dacia Cluj-Napoca, p. 82-87.Hedhly A, Hormaza J.I., Herrero M., 2004. Efect oftemperature on pollen tube kinetics and dynamicsin sweet Cherry Prunus avium (Rosaceae). AmericanJurnal of Botany 91(4), p. 558-564.Iordache M., esan T., Andrei M., 2010.Researches onviability and germinative capacity of the pollen insome romanian appricot varieties. Symposium ISHS-ICDP-Piteti Mrcineni,Scientific Papers of theR.I.F.G. Piteti, vol XXVI, p. 46-50.Ivacu A., Toma St., 2001. Autofertilitatea nectarinuluisi influenta unor fungicide asupra germinariipolenului. Lucr. St. ICPP Pitesti Maracineni.vol.XX, p. 62-68.Pdureanu, S., 2007. Citologia germinarii polenului deAmpelopsis brevipedunculata (Maxim) Trautv. Lucr.St. Universitatea Al. Ioan Coza.Iai, vol.50, p. 237-242.Pdureanu, S., 2007. Anomalii aparute in procesul degerminare al polenului la unele Vitaceae, Lucr.St.Universitatea Al. Ioan Cuza Iai, vol.50, p. 231-236Tarnavschi, I., erbnescu J. G., Mitroiu, R.N.,Rdulescu, D., 1981-1984. Monografia polenuluiflorei din Romania, Ed. Academiei RSR, vol. 1-4Xie, B., Wang, X., Hong, Z., 2010. Precocious pollengermination in Arabidopsis plants with alteredcallose deposition during microsporogenesis,Springer, Planta 231, p. 809-823277

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653SOME MORPHOLOGICAL PROPERTIES OF DIRECT SOWED SWEET CORNFerenc OROSZDepartment of Vegetable and Mushroom Growing, Faculty of Horticultural Science, CorvinusUniversity of Budapest, H-1118 Budapest, Ménesi u. 44, Budapest, HungaryAbstractCorresponding author email: ferenc.orosz@uni-corvinus.huIn our trial we compared the effect of propagation time and floating cover on the growing season on some valuableproperties of sweet corn. The following technological variations were compared with the help of the variety Spirit(normal sweet, very early ripening): 1. direct seeded plants with floating cover (with 2 sowing dates); 2. direct seededplants without cover (with 2 sowing dates). The covering by earlier sowing time had favourable influence on plantshighness, ear weight, ear length and no influence on tassels length, and dept of seeds. The covering by later sowingtime had favourable influence on tassels length, ear weight, ear length and dept of seeds and no influence on plantshighness.Key words: sowing time, plants covering.INTRODUCTIONBased on its present growing area, the sweetcorn is the vegetable which is grown on thegreatest area in Hungary. After dates ofHungarian Fruit & Vegetable InterprofessionalOrganization in 2003 the growing area wasabout 38,000 hectares. After 2003 followed asudden and sharp decline, so in 2005 thegrowing area was “just” 24,000 hectares. Afterdiminishing, the plant returned in rise, in 2006against over 30,000 hectares.As early as in the beginning of the 20 th centurysome researchers (Cserháti, 1901) highlightedthe importance of the sowing date. Ripeningcan occur earlier when sowing earlier and usinghigh quality seeds as compared to normal orlate sowing. I’só (1969) and Pásztor (1966), aftertheir multi-year sowing date trial, concluded thefollowing: in the case of an earlier sowing seedgermination will be more protracted, but from thepoint of view of fruit maturing it was morefavourable than late sowing.Also I’só and Szalay (1966, 1969), studied occurof maize generative phenophases. They concluded,that by earlier sowing germination will bemore protracted, but silking and harvesting occursooner than by lately sowing time.After multi-year trial Berzsenyi et al. (1998)have studied the effect of different sowingtimes on maize development. Direct seededsweet corn under vlies cover showed earlierripening and gave better yields in theexperiments of Kassel (1990).In case of direct seeding, as propagationmethod, another earliness increasing solution isthe temporary covering with plastic or vlies,used in different combinations (Hodossi andKovács, 1996).About the covered early sowing as atechnological variation (Aylswirth, 1986)mentioned, that from an early sowed crop,made in first week of April, arranged in twinrows (42 cm) and covered by plastic, we couldharvested marketable cobs.MATERIALS AND METHODSThe experiment was set up in 2008 on an areaequipped for irrigation at the ExperimentalFarm of the Faculty of Horticulture of theCorvinus University of Budapest.The results of the analysis of the soil samplecollected at the beginning of 2006 from the trialarea prior to direct seeding are contained inTable 1.Table 1. Soil analysis results279

The pH of soil was considered calcarous. Thenutrient content of soil in nitrogen was low, inphosphorus very good and in potash good.The test variety was Spirit, a normal sweet cornwith a very early growing period (85 days).Average plant height is 159 cm, ear height is 37cm. Average ear length was 19.6 cm in thevariety comparison trials carried out by theCentral Agricultural Office and average earweight was 245 g (Kovács, 2002).The following treatments were applied duringthe experiment:P1 = uncovered direct seeded (April 8 th ), P2 =covered direct seeded (April 8 th ), P3 = covereddirect seeded (April 21 th ), P4 = the control,uncovered direct seeded (April 21 th ).By both sowing times (April 8 th and April 21 th )a part of the stand was covered with Novagrylfloating row cover having a weight of 19 g/m 2at the two propagation times in order toenhance earliness. The floating row cover wasremoved on May 13 th . The stand was created tocontain 60,607 plants per hectare, according tothe recommendations of the owner of thevariety, at a spacing of 110+40x22 cm in twinrows. Each plot had an area of 6x7m (8 parallelrows and 30 seeds sown in each row). The edgewas the outer two rows of the 8 rows of theplot, respectively. All treatments were set up infour replications.Fertilization was done by top dressing with N.No farmyard manure was applied.During the experiment, we studied some plantmorphological properties according to thefollowing:highness of plants (cm), length of tassels (cm),Ears, together with the husks, were collectedfrom the four central (two twin) rows. Afterthat 20 ears of average appearance wereselected from each row and the followingmeasurements were carried out: unhusked earweight (gram), total ear length (cm), depth ofseeds (mm).The statistical analysis of the results wascarried out by using the programme RopStat1.1. When the standard deviations wereidentical the mean values were compared bypairs using the Tukey-Kramer test, while in thecase of the non identical standard deviations themeans were compared using the Games-Howelltest (Vargha, 2007).RESULTS AND DISCUSSIONSThe highness of plants (cm) is represented inthe figure 1.Figure 1. Highness of plantsThe effect of covering (P2) was favourable onplant high compared to uncovered (P1)treatment by earlier sowing time. The highestvalue of plant highness was registered by plantsof (P4 control) treatment, difference wassignificantly (at p

Figure 2. Tassels lengthIn case of tassels length the time of latersowing has greater influence. Plants from latersowed covered (P3) and uncovered, control(P4) treatments had significantly (at p

Studying the data of total ear length, we foundthat the lengths of later seeded, uncovered(control) treatment P4 were also statisticallysignificantly (at p

ORNAMENTAL PLANTS,DESIGN ANDLANDSCAPEARCHITECTURE

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653AbstractSOME CONTRIBUTIONS ON INTRODUCTION OF THEGENUS ABIES MILL. SPECIES IN THE REPUBLIC OF MOLDOVAVasile BUCATELBotanical Garden (Institute) Academy of Sciences of Moldova, 18 Padurii Street, Chisinau,MoldovaCorresponding author email: vbucatsel@mail.ruThe main objectiveof the presentpaper is to studythe biological peculiaritiesof the genus Abies species andformsgrowing and newly introduced in the Republic of Moldova, by their subsequent identification of the mostperspectives. As a resultof the investigationsfor the first time arerefined the taxonomicalcomposition that include 23species, 3 hybrids and 26 forms and cultivars. The questions ofgrowth and development, also the peculiaritiesofflowering andseed-bearing are studied. Thesustainability of the species and forms ofthe genus Abiesto unfavorableenvironmental factors i. e. to drought hardiness experimentally are established. The peculiaritiesof seed andvegetativepropagationare investigated. For the first timeare tested variousways ofgrafting for decorative formsoffir in thesoil andclimatic conditions. Based on the analysis of obtained data are proved the perspectiveof breeding somespeciesandgarden formsby vegetative ways. The optimal grafting terms,graftingmodalities and their modificationswithreference to the conditions are recommended. A result of investigationsselected andrecommended for usein greenbuildingthe mostornamental speciesand cultivars offir.Key words: introduction, coniferous, fir, species, cultivars.INTRODUCTIONFir (Abies Mill.) is a genus of evergreen forestformingwoody plants in which are providedmore than 50 main species is one of the oldestof the eleven existing genera of the pine(Pinaceae Lindl.). The species of this genuspredominantly in mountainous regions of thenorthern hemisphere, where they form darkconiferous forest are widespread. The most ofthem in the area of sub-zones of middle andsouthern taiga of Siberia and North America, aswell as in the mountainous forests of thetemperate and subtropical zones of Central andSouthern Europe, North Africa and foreignAsia are located ( . . ., 1986).The species of genus Abies have a number ofvaluable ornamental qualities necessary ingreen building - this is the durability andmonumentality, the high sanitary andrecreational properties and the emotionalimpact on people. These properties incombination with a diversity of ecologicalpeculiarities of different species of fir it can besuccessfully used to create park, forest park,and other types green spaces.285The introduction in green plantingscomposition the introduced species is one ofthe perspective ways of enrichment thebiological diversity, as well as increasing theaesthetic value of cultural landscapes. Therepresentatives of the genus Abies does notgrow in natural conditions of the Republic ofMoldova. The first steps on introduction of firsrelate to the second half of XIX century –beginning of XX in the gardens and parks ofthe landlords ( . . 1957; . ., 1967). Furthermore, the experience onintroduction of Abies species was accumulatedin the botanical gardens and arboretums and,particularly active fir has been implementedfrom the middle of XX century. However, up topresent not yet summarized the rich experiencein creating and growing of fir plantings in theRepublic of Moldova.MATERIALS AND METHODSAs biological material for the investigationswere served the species and cultivars of Abiesgenus, which grows in the Botanical GardenAcademy of Sciences of Moldova (the old andnew territory), arboretums, parks and squares

of Chisinau, also the old parks. For carrying outthe actual researches a number of knownmethods, recommendations for clarification ofthe species composition, determination of heatand drought resistance, winter hardiness,reproductive ability, level of adaptation and theperspective of introduction have been used( . ., … 1975; .., 1981; . ., 1979; . .,1982; … 1975; . . 1980; . ., 1975).RESULTS AND DISCUSSIONSAs a result of determining and clarifying thetaxonomic composition of the genus Abies inthe Republic of Moldova we have establishedthe 23 species, 3 hybrids, 26 forms andcultivars (Table 1).Table 1. Taxonomic composition of genus Abies Mill.species in the Republic of Moldova.Species and hybridsCultivarsAurea, Columnaris,Abies alba Mill.'Pendula', 'Pyramidalis'A. amabilis (Dougl. exLoud.) Forb.-A. arizonica Merr. -A. x arnoldiana Nitz. Ioan Pavel II'Nana','Piccolo',A. balsamea (L.) Mill.'Hudsonia'PyramidalisA. borisii-regis Mattf. -A. cephalonica Loud. -A. cilicica Carr -A. concolor (Gord.)Ldl.ex Hildebr.'Argentea','Compacta','Violacea','Lowiana'A. fraseri (Pursh) Poir. -A. holophylla Maxim. -A. homolepis Sieb.etZucc.A. x insignis Carr. ex.Baillyin Rev.A. koreana Wils.A. lasiocarpa (Hook.)Nutt.A. nephrolepis Trautv.)Maxim.A. nordmanniana(Stev.) Spach--Brilliant'Brevifolia','Piccolo','Lumenetta','Silberlocke''Compacta'-'Golden Spreader','Pendula'286A. numidica De Lann.ex Carr.-A. pinsapo Boiss. 'Glauca''Glauca',A. procera Rehd.'Kelleris','Obrighoven'A. recurvata Mast. -A. sachalinensis(Schmidt) Mast.-A. sibirica Ledeb. -A. spectabilis (D.Don)Spach-A. veitchii Lindl. -A. x vilmorinii Mast. -CONCLUSIONSAs a result of determining and refinement ofthe taxonomic composition of the genus Abiesin perennial plantations of the Republic ofMoldova revealed 51 taxa. Our studiesconcerning the growth and development of thegenus Abies have shown that the soil andclimatic conditions of the Republic of Moldovaare favorable for growth of many ornamentalfir species and cultivars. The entry of 16 firspecies in the generative phase indicates totheir adaptability to new environmentalconditions. The good germinating capacity ofseeds of some fir species creates the possibilityof their mass reproduction and its following usein the ornamental gardening. On the example offir blue species was proved that the last have ahigh heat resistance with respect to the types.Thus, when creating a green plantations underconditions of increased heat should be givenpreference to the species with a blue colorationof the needles. Based on the researches wasproved the perspectivity of reproduction of firspecies and cultivars by vegetative way: lowgrowing form by cuttings and with high stemsby grafting. For landscape gardening we canrecommend 13 fir species and, their ornamentalcultivars.The highest number of forms is distinguished:A. concolor, A. koreana and A. procera. Takinginto account the global floristic reserves of thegenus (56 species, 2 subspecies, 9 hybrids, 2varieties and 625 cultivars) [ . ., . ., 1949; . . ., 1986;Den Oden P., Boom B. K. 1978; Aris G.Anders and Derek P., 2012; ], the assortment ofused in the green building of the Republic ofMoldova is comparatively poor. This basically

it is A.alba and A.concolor. The other speciesare used for creating decorative groupings inbotanical gardens, arboretums, old parks, aswell as in private gardens. Seasonal the growthof shoots is one of the main periods of woodyplants life, closely related with climaticconditions of growing.The study of growth and development ofintroduced plants in different soil and climaticconditions allows to judge about theiradaptation to the new environment and toidentify the existence of perspective for theeconomy. Our observations showed that inCentral of Moldova (Chisinau) at theinvestigated species of fir the growth axialshoots begins in late April – early May, with anaverage daily temperature of 8-16 o C. The endof growth in most species occurs at the end ofJune – beginning of July. Deadlines ofbeginning and end of growth vary from year toyear, so that the duration of growth is different.The most intensive growth of shoots isobserved in May. Blossoming and seed wearingis an important moment in the life of any plant.The entry into generative phase is one of thecriteria for assessing the success of plantintroduction. Under the conditions of RepublicMoldova 'blossom' and form seeds of 16species of fir. Their strobilation occurs in thefirst half of May, with an average daily airtemperature 9-18° C and the sum of positivetemperatures 290-480° C. Strobilation periodvaries from year to year, is dependent on theweather and lasts from 6 to 12 days. Seedripening begins in the first decade of October.Whole period of cones from flowering tomaturity, depending on the species, lasts 100 to130 days. For the full development necessitatesthe sum of positive temperatures – 2150-2800°C. The determination of the quality seeds hasshown high laboratory germination (over 70%)in A. concolor, A. nordmanniana and A.numidica, average (40-50%) at A. alba, A.sibirica, A. pinsapo and low (10-25%) in otherspecies. In our opinion low seeds germinationis due to the insufficient number of trees of thatspecies. As a result of experimental study (thetesting into the water chamber ofultrathermostat UT-15) was established moreexpressed heat resistance of fir species needleswith blue color as compared to green. It isknown that an important role in the287introduction plays winter hardiness, of plants,moreover in the process of acclimatization, itcan change. Currently, 90% of cultivatedspecies of the genus Abies have the highestscale of hardiness - I. The part of species has atransitional point, depending on the climaticconditions of the year - I-II. During the periodof investigations types and forms of fir showedthe complete drought resistance, i. e. in allcases was observed the drought resistance - Vby M. R. Duval-Stroev five-point scale [1966].We have also investigated the peculiarities ofseed reproduction. In our experiment, seeds ofthe local reproduction were used. In theresearch program was to identify the optimalgrowing seedlings of some fir species, for whatwere tested different variants and substratesand pre-sowing preparation of seeds, as well asdifferent sowing dates. The higher germinationof seeds group up to 56% of A. concolor and A.nordmanniana on the substratum consisting ofsod soil and river sand (3: 1) was attested. Theuse of chemical solutions (potassiumpermanganate - 1%, heteroauxin - 0.01%,superphosphate - 0.5%) for pre-sowingpreparation of seeds led to a significantincrease in soil germination. Along with theseed method of reproduction, which for themost species of Abies was the major, we carriedout the experimental study on the impact ofdifferent growth factors on the rooting ofcuttings dwarf cultivars. We have précised andexpanded the reproduction methods of fircuttings. The higher percentage of rooting from40 till 55% of the cuttings had the followingcultivars: A. balsamea Nana, A. concolorCompacta, A. koreana Piccolo, A.lasiocarpa Compacta. For the first time in thesoil and climatic conditions of RepublicMoldova was carried out researches oninoculations different species and cultivars ofthe genus Abies. The periods, optimal methodsand the impact of chemicals on the intergrowthof inoculations were studied. In our countrygreat attention was paid to the involvement ofdifferent fir species and cultivars bytransplantation methods. On the basis of theobtained data, we formulated the followingconclusion that a highly ornamental fir speciesand cultivars should be propagated by grafting.The optimal for the reproduction is in thefissure of axial sprout through the apical buds

y cambium on the very center – methodmodified by us. The best results are obtained bygrafting during the spring period, at thebeginning of the swelling buds and in summerfallafter the end of shoot growth. Theprocessing of the grafts cut site by solution ofsuccinic acid (0.01%) and dimethyl sulfoxide(0.1%), directly before inoculation leads toincreasing the percentage of survival. On thebasis of many years of study the growth,development, sustainability and decorativenessfor green building of our country werecommend the following species of the genusAbies such as: A. alba, A. balsamea, A.cephalonica, A. concolor, A. holophylla,A.homolepis, A. koreana, A. nephrolepis, A.nordmanniana, A. numidica, A. pinsapo, A.procera, A. sibirica, and also their highlyornamental cultivars.REFERENCES . ., 1957. . .: , . 1, 207 . . ., . . . .,1949. :. .-., - , . I, . 53-103. . ., . ., 1979. . . , . 5-14. . 1975. .: , 547 .- . ., 1966. . . .. . . . , 24 . . ., 1981. . : , 222 . . ., 1982. . : ,288 . . ., . ., . ., . . . ., 1987. ,239 . . ., . , 1967. , 94 . . ., 1975. 27 . . ., 1980. . .: , 45 . . . 1975. . .:, 510 .Den Oden P., Boom B. K., 1978. Manual of cultivatedconifers. The Hague–Boston–London: MrtinusNijhoff, p. 526.Encyclopedia of Conifers, 2012. Compehensive Guide toCultivars and Species by Aris G. Anders and DerekP., Spicer, Hardcover, 2 volums, p. 1507.Krüssmann G. Handbuch der Nadelgehölze,1983. Berlin, Hamburg, Parey, p. 396.288

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653RESEARCHES CONCERNING THE POSTHARVEST CAREOF LISIANTHUS RUSSELIANUS CUT FLOWERSErzsebet BUTA, Maria CANTOR, Mihai BUTA, Denisa HORT, Orsolya VALKAIUniversity of Agricultural Sciences and Veterinary Medicine of Cluj, 3-5 Manastur Street, ClujNapoca, RomaniaAbstractCorresponding author email: ebuta2008@yahoo.comLisianthus popularity is due not only to the wide range of assortment (small-flowered varieties Piccolo type, edging -Panther Curly, striped -Lilac Shadow), but also due to the attractive character of flowers. Purple color of the petals isthe dominant at the most variety (35 %), followed by white (21 %), pink (12 %), yellow (8 %), and green (9 %),varieties with bicolor petals (9 %). Experiences regarding the postharvest care, using Lisianthus russellianus varietieshave been developed in the flower shop “Decor Studio”, Cluj-Napoca, Cluj County.Biological material used in experiments with Lisianthus russellianus varieties, consisted in tree cultivars as following:'Piccolo White” (white flowers) “Mariachi Pink” (pink flowers), “Echo Blue” (blue flowers). During the experiences itwas investigated the effect of four solutions (Belle Fleur, Floralife, Vitalife and tap/normal water) on the morphologicalcharacters of the studied varieties and the on period of storage. The results obtained show that the variety with thelongest storage period is “Echo Blue” (30 days), and the most favorable nutrient solution was Fleur Bell.Key words: preservation, nutrient solutions, Eustoma.INTRODUCTIONLisianthus russellianus is relatively newspecies in floricultural assortment which itbelongs to the Lisianthus genus, familyGentianaceae. This species is known asEustoma grandiflorum (Armitage, 2001).Lisianthus genus originates in North America,especially Mexico. Genus name allude at thebeauty of calyx and corolla, the shiny satinaspect and very nice border of the flower(„liseé” in French – means smooth).In the areas of origin, it is spontaneous speciesinhabits grasslands stretching from Nebrasca toColorado, Texas and Mexico (Cantor 2010;Bala, 2010).In Texas is popularly known as 'blue bell','prairie rose', and 'prairie gentian'.From the wild forms with blue petals resultedthrough breeding new forms with a greatperfection extremely varied flowers with colorsand shapes (Toma, 2011; Draghia, 2011).The leaves of this 40 cm tall plant are thick andblue-green. The flower are commonly violet tolavender but have been bred in white, pink, andpurple, usually with a darker eye in the center.Flower can be simple or abundant and more289flowers are distributed on a stem that openssuccessively (Armitage, 2004).Plant breeders around the world havediscovered its marvelous properties as a cutflower, and flowers have been bred into amyriad of colors, occurring as singles ordoubles in florists’ coolers across the country(Armitage, 2001). Lisianthus is the mostimportant greenhouse cut flowers, this NorthAmerican species continues to be crossed byAmerican, Dutch, Japanese, and Israelibreeders (Armitage and Laushman, 2003).Some of the cut flower cultivars are also usedin garden design, particularly the Yodel series(single flowers) and the Echo series (double).‘Yodel Lilac’ and ‘Echo White’ have performedquite well in outdoor beds in Athens (Armitage,2004).It is needed well-drained soils, and can bepropagated by seed. Plants are raised almostexclusively from seed by specialistpropagators; terminal cuttings are onlyoccasionally used because they tend to flowerirregularly (Armitage, 2004).Regarding the harvesting of Lisianthus manygrowers find that best results occur when thecentral bud is removed, so that more flowerswill be open simultaneously. Harvest when one

flower is fully colored. Postharvest life isexcellent, 10–15 days. Small buds often fail todevelop after harvesting, and flowers(particularly blue and pink flowers) fade badlyin low light conditions; if placed in high light,these conditions become less severe (Kawabata1995). A 25% decrease in light intensitydetermine results a 40% decrease in colorintensity (Griesbach 1992). Several solutionshave been tested, with varying results.Interestingly, Song et al. (1994) found thatpretreating stems with STS (silver thiosulfate)or Chrysal AVB prior to placing inpreservatives had little effect on longevity butresulted in more flowers opening in the vase.Other research showed that treatment with 0.1mM STS for 24 hours before placing indistilled water increased the vase lifesignificantly. Sucrose too has been studied andrecommended as an alternative to STS. Anotherrecipe, consisting of 10% sugar, citric acid, andantimicrobial agents, pulsed for 24 hours,resulted in 13-day postharvest life and openingof all flower buds on the cut stem (Armitage,2003).MATERIALS AND METHODSExperiments concerning the postharvest care ofLisianthus russellianus were done at „DecorStudio” flower shop from Cluj-Napoca, Clujcounty. Experiments were installed on11.11.2011. It took on average of 38 days.Observations were made at an interval of twodays between 15.11-21.12.2011. Light andmoisture conditions were specific as a normalliving space.The biological material used in experimentswith species Lisianthus russellianus, consistedin three cultivars, as follows: Piccolo White(white flowers), Mariachi Pink (pink flowers),Echo Blue (blue flowers). The material usedcomes from the Netherlands and was acquiredby the company Greenlit from Cluj-Napoca.The control of experiments was Piccolo Whitecultivar.As nutrient solution were used the followings:Belle Fleur, Floralife, Vitalife and tap/normalwater.The experience was bifactorial with 12 variantswhich were placed in randomized blocks, inthree repetitions.290RESULTS AND DISCUSSIONSThe recorded data concerning the effect ofnutrient solution on the postharvest life ofLisianthus were statistical interpreted with„LSD” test (Least Significant Difference) toillustrate the significance of differences.At the set up of experiences, were made someobservations were made on morphologicalcharacters of varieties studied. Were analyzedthe following characteristics: flower stemlength, number of leaves, flower diameter,number of petals and number of flowers perstem.Regarding the effect of nutrient solution on thelength of floral stem can observe that allsolutions appear with a non significantdifference, which means that neither influencedthis character (Table 1). The result from Table2 shows the similar data. Neither cultivarinfluenced favorable the stem length.Table 1. The influence of nutrient solution on the lengthof floral stem at Lisianthus russellianusNutrientsolutionStem lengthAbsolute(cm)Relative(%)±D(days)Signification ofdifferenceTap water(C)68,11 100,0 0,00 -Bell Fleur 66,47 97,6 -1,64 -Vitalife 67,89 99,7 -0,22 -Floralife 66,28 97,3 -1,83 -LSD (p 5%) 2,11 LSD (p 1%) 2,89 LSD (p 0,1%) 3,93 Table 2. Unilateral influence of cultivars on the stemlength at Lisianthus russellianusCultivarsStem lengthAbsolute(cm)Relative(%)±D(cm)Signification ofdifferencePiccoloWhite (C)66,79 100,0 0,00 -MariachiPink66,10 99,0 -0,69 -EchoBlue 68,67 102,8 1,88 -LSD (p 5%) 2,57 LSD (p 1%) 4,25 LSD (p 0,1%) 7,96 In the Table 3 are presented the dataconcerning the influence of nutrient solution onthe number of leaves at Lisianthus russellianuscultivars. The result shows that the best nutrientsolution was Vitalife, which achieved a very

significant difference. The solutions like BellFleur and Floralife registered significantpositive difference. Regarding the cultivarinfluence, Mariachi Pink shows a distinctsignificant difference, that exceed the controlwith 7,67 pieces (Table 4).Table 3. The influence of nutrient solution on the numberof leaves at Lisianthus russellianus cultivarsNutrientsolutionNumber of leavesAbsolute Relative(piece) (%)±D Signification of(piece) differenceTap water(C)22,0 100,0 0,00 -Bell Fleur 28,89 131,3 6,89 *Vitalife 32,67 148,5 10,67 ***Floralife 28,33 128,8 6,33 *LSD (p 5%) 5,56LSD (p 1%) 7,63LSD (p0,1%) 10,38 Table 4. Unilateral influence of cultivars on the numberof leaves at Lisianthus russellianusCultivarsNumber ofleaves ±DAbsolut (piecee)Relative (%)Signification ofdifference(piece)Piccolo White (C) 24,67 100,0 0,00 -Mariachi Pink 32,32 131,1 7,67 **EchoBlue26,92 109,1 2,25 -DL (p 5%) 4,31DL (p 1%) 7,14DL (p 0,1%) 13,36Just one of the nutrient solution influencedfavorable the diameter of flower. Bell Fleurgenerated a difference of 0.53 cm, which showsa significant differences comparing with thecontrol (tap water). The rest of solutionsdetermine a negative difference (Table 5).Table 5. The influence of nutrient solution on thediameter of flowers at Lisianthus russellianus cultivarsNutrientsolutionFlowers diameterAbsolute Relative(cm) (%)±D(cm)Signification ofdifferenceTap water(C)5,42 100,0 0,00 -Bell Fleur 5,96 109,8 0,53 *Vitalife 5,36 98,8 -0,07 -Floralife 5,38 99,2 -0,04 -LSD (p 5%) 0,43LSD (p 1%) 0,59LSD (p 0,1%) 0,81Table 6. The unilateral influence of cultivar upon flowerdiameter at Lisianthus russellianusCultivarsFlower diameterAbsolute Relative(cm) (%)±D(cm)Signification ofdifferencePiccoloWhite (C)4,33 100,0 0,00 -MariachiPink5,75 132,7 1,42 *Echo Blue 6,50 150,0 2,17 ***LSD (p 5%) 0,94LSD (p 1%) 1,56LSD (p 0,1%) 2,91Concerning the unilateral influence of cultivarupon flower diameter at Lisianthusrussellianus, the results described in the Table6 shows that Echo Blue registered verysignificant differences that exceed the controlwith 2.17 cm.Data from Table 7 shows that one of nutrientsolutions had a favorable influence on thenumber of flowers/stem. Bell Fleur nutrientsolution determines a very significantdifference of 1.05 cm, which exceeds thecontrol of experiment with 9.3%.Table 7. The unilateral influence of nutrient solutions onthe number of flowers/stem at Lisianthus russellianusNutrientsolutionNo. of flowers/stemAbsolute Relative(piece) (%)±D Signification of(piece) differenceTap water(C)11.28 100,0 0,00 -Bell Fleur 12.33 109,3 1,05 ***Vitalife 10.36 91.8 -0,92 oooFloralife 11.38 100.8 0,01 -LSD (p 5%) 0,43LSD (p 1%) 0,59LSD (p0,1%)Cultivars 0,81 Table 8. Cultivars influence upon the number offlowers/stem at Lisianthus russellianusNumber offlowers/stem ±DRelative (piece)(%)Absolute(piece)Signification ofdifferencePiccoloWhite (C)10,17 100,0 0,00 -MariachiPink13,08 128,7 2,92 *Echo Blue 9,75 95,9 -0,42 -LSD (p 5%) 2,02LSD (p 1%) 3,34LSD (p 0,1%) 6,26291

Results from table 8 shows that Mariachi Pinkregistered significant differences concerningthe number of flowers/stem. The difference was2.92 pieces, which exceed the control cultivar.Concerning the results from Table 9 neithersolutions influenced favorable the no. ofpetals/flowers. Bell Fleur generates a differenceof 0.33 cm, but it is not statistically assured.Table 9. Unilateral influence of nutrient solution on theno. of petals/flowers at Lisianthus russellianus cultivarsNutrientsolutionNo. of petals/flowersAbsolute Relative(piece) (%)±D Signification of(piece) differenceTap water(C)10,22 100,0 0,00 -Bell Fleur 10,56 103,3 0,33 -Vitalife 9,89 96,7 -0,33 -Floralife 9,22 90,2 -1,00 -LSD (p 5%) 2,10LSD (p 1%) 2,87LSD (p0,1%) 3,91 Table 10. The unilateral influence of cultivars upon thenumber of petals/flower at Lisianthus russellianusCultivarsNumber ofpetals/flower ±DRelative (piece)(%)Absolute(piece)Signification ofdifferencePiccoloWhite (C)5,00 100,0 0,00 -MariachiPink13,33 266,7 8,33 ***Echo Blue 11,58 231,7 6,58 ***LSD (p 5%) 1,79LSD (p 1%) 2,96LSD (p 0,1%) 5,54Data from Table 10 shows the unilateralinfluence of cultivars upon the number ofpetals/flower at Lisianthus russellianus.Cultivars Mariachi Pink and Echo Blue showvery significant differences exceeding thecontrol cultivar with 8.33 pieces respectively6.58 pieces.In the Table 11 is presented the unilateralinfluence of nutrient solution on the postharvestof Lisianthus russellianus. Bell Fleur andFloralife assure a long period of postharvest lifefrom 12.78 days to 11.89 days, comparing withthe control.Table 11. Unilateral influence of nutrient solutions on thepostharvest periodNutrientsolutionNumber of daysAbsolute Relative(days) (%)±D(days)Signification ofdifferenceTap water(C)22,11 100,0 0,00 -Bell Fleur 34,89 157,8 12,78 ***Vitalife 17,67 79,9 -4,44 000Floralife 34,00 153,8 11,89 ***LSD (p 5%) 2,53LSD (p 1%) 3,47LSD (p0,1%) 4,72 Regarding the unilateral influence of cultivarsupon postharvest period, the results from Table12 show that Echo Blue cultivar achievedsignificant difference and this exceed thecontrol cultivar with 4.92 days.Table 12. The unilateral influence of cultivars uponpostharvest periodCultivarsNumber of daysAbsolute Relative(days) (%)±D Signification of(days) differencePiccoloWhite (C)25,67 100 0,00 -MariachiPink25,25 98,4 -0,42 -Echo Blue 30,58 119,2 4,92 *LSD (p 5%) 3,04LSD (p 1%) 5,03LSD (p 0,1%) 9,41CONCLUSIONSAnalyzing the obtained results from researchesconcerning the postharvest care of Lisianthuscut flowers using three cultivars and fournutrient solutions results the followingconclusions:Analyzing the length of floral stem under theeffect of four nutrient solutions can concludethat neither solution influenced favorable thischaracter. Results shows that neither cultivarinfluenced favorable the stem length.The best nutrient solution regarding the numberof leaves was Vitalife, which achieved a verysignificant difference. The solutions like BellFleur and Floralife registered significantpositive difference. Regarding the cultivarinfluence, Mariachi Pink shows a distinctsignificant difference, that exceed the controlwith 7,67 pieces.292

It was studied the influence of nutrientsolutions on the diameter of flowers atLisianthus russellianus cultivars. Bell Fleurgenerated a difference of 0.53 cm, significantdifferences comparing with the control (tapwater). Echo Blue registered very significantdifferences that exceed the control with 2.17cm.Regarding the unilateral influence of nutrientsolutions on the number of flowers/stem atLisianthus russellianus, that Bell Fleurachieved a very significant positive differenceof 1.05 cm, which exceed the experimentcontrol. Mariachi Pink registered significantdifferences concerning the number offlowers/stem. The difference was 2.92 pieces,which exceed the control cultivar.Concerning the influence of nutrient solutionon the no. of petals/flowers at Lisianthusrussellianus cultivars, results show that neithersolution recorded favorable influence. CultivarsMariachi Pink and Echo Blue show verysignificant differences exceeding the controlcultivar with 8.33 pieces respectively 6.58pieces.In the case of the unilateral influence ofnutrient solution on the postharvest ofLisianthus russellianus, can conclude thatsolutions as Bell Fleur and Floralife assure along period of postharvest life from 12.78 daysto 11.89 days, comparing with the control.Echo Blue cultivar achieved significantdifference and this exceeds the control cultivarwith 4.92 days.REFERENCESArmitage A.M., 2001. Armitage’s manual of annuals,biennials, and half-hardy perennials. Timber Press,Portland – Oregon.Armitage A.M., Laushman J.M., 2003. Specialty cutflowers: the production of annuals, perennials, bulbs,and woody plants for fresh and dried cut flowers.Timber Press, Portland Cambridge.Armitage A.M., 2004. Armitage’s, Garden annuals, Acolor encyclopedia, Timber Press, Portland Cambridge.Bala Maria, 2010. Floricultura speciala. TimpolisPublishing House, Timisoara.Cantor M., 2008. Plante ornamentale de interior.Todesco Publishing House, Cluj Napoca.Draghia L., Chelariu L., 2011. Floricultura speciala. IonIonescu de la Brad Iasi Publishing House.Griesbach R. J., 1992. Correlation of pH and lightintensity on flower color in potted Eustomagrandiflorum Grise. HortScience 27 (7), p. 817–818.Kawabata S., Ohta M., Kusuhara Y., Sakiyama R., 1995.Influences of low light intensities on thepigmentation of Eustoma grandiflorum flowers. ActaHortic. 405, p. 173–178.Toma F., 2009. Floricultura si arta florala. Vol. I-V.Invel Multimedia Publishing House, Bucharest.Song C.Y., Bang C.S., Huh K.Y., Lee D.W., Lee J.S.,1994. Effect of postharvest treatment andpreservative solutions on the vase life of cutEustoma. J.Korean Soc. Hort. Sci. 35 (5), p. 487–492.293

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653AbstractUSE OF ORNAMENTAL PLANTS ON DIFFERENT SOIL TYPESFROM TRANSYLVANIAN PLAINErzsebet BUTA, Mihai BUTA, Maria CANTOR, Denisa HORT, Anca HUSTIUniversity of Agricultural Sciences and Veterinary Medicine of Cluj,3-5 Manastur Street, Cluj-Napoca, RomaniaCorresponding author email: ebuta2008@yahoo.comThe paper include necessary issues to help specialists in landscape architecture to choose dendro-floricol assortment,which exploit the studied maximum potential edaphic conditions, given the multitude of requirements expressed byflower plants to edaphic environment. To highlight the issues shown above it was chosen to exemplify some soil typesfrom Transylvanian Plain where soil conditions are not the best for all ornamental plants. Thus we studied andanalyzed the main physico-chemical properties of calcareous soils, sandy, acidic soils and substrates with moistureexcess. The main ornamental plants presented in this paper are adapted to these extreme conditions and can be asolution for use in landscaping.Key words: soil types, ornamentals, landscape design.INTRODUCTIONSoil occupies a well settled place in thebiosphere, finding the boundary between twoworlds, lithosphere and atmosphere, formingthe so-called pedoshere. It is known that thesoil has an important influence on health andplant growth rate. The soil has a stronginfluence on the plants (Reed, 2011). Theknowledge of soil types helps in keeping andgrowing plants effectively and the use of soiltype required for plant will be essential in thegrowth and development of its faster (Pauletteet al., 2010).This paper is based on the study of plantsgrown on different soil types and it’s a helpinghand in choosing these for specific conditionsor places in the garden.In most soils, the relative proportion of clay,sand, and silt particles influence its physicaland chemical nature. The main exception ispeaty soil, which is dark in color and rich inorganic matter. Peaty soils are derived fromsedges or mosses, which have decomposed inwaterlogged conditions. They are acidic andmoisture-retentive, providing ideal conditionsfor acid-loving plants like rhododendrons(Reed, 2011).Clay soils are fertile but are slow to warm inspring, sticky, and slow-draining after rain,baking hard in dry weather. Silty soils feel silky295or soapy and are easily compacted. Sandy soilsfeel gritty and will not stick together to form aball (Reed, 2011; Paulette et al., 2010). Theyare light and free draining and quick to warm inspring, but they will need frequent irrigationand fertilizing. Chalky soils are alkaline,usually pale in color and stony, with chunks ofalkaline minerals visible on the surface. Theyare often shallow and sometimes sticky. Theideal soil type is a loamy one, which has anapproximately equal mixture of clay, silt, andsand. Loamy soils are good for the widestpossible range of plants (Reed, 2011).Bellow is presented the studied soil types andthe dendro-floricol assortment.MATERIALS AND METHODSSoils were analyzed according to the“Methodology of soil study development-ICPA-1987 (Research Institute for Pedologyand Agrochemistry) completed by soilclassification as SRTS-2012 (Romanian SoilToxonomy System).1. Calcaro-rendzic leptosols (WRB – SR-1988) present the next succession of horizons:Am A/R Rrz.The phisico-chemical properties of calcarorendzicleptosols is characterized by: fieldcapacity (CC%) between 23 and 41%; wiltingcoefficient (CO%) 6-14%; available moisture

holding capacity (CU%) 4.5-7.1%; the contentof organic matter is middle; the content of N ismiddle for the entire soil profile 0,172-0,262%;the mobile P is low in the entire soil profile(10-16 ppm); the content of mobile K is middlefor Am and low for A/R; cation exchangecapacity (T) is 37-38 me/100g soil; degree ofbase saturation V% is higher 87-92%; the soilpH is slightly alkaline (Buta, 2009).Due to favorable physicochemical properties,calcaro-rendzic leptosols are distinguishedthrough a very high fertility.Many of the world’s favorite plants occurnaturally on alkaline or limestone soils. Theyinclude pinks, clematis, and many of the jewellikealpine plants found growing on thelimestone mountains of Europe and Asia. Soilsover limestone are almost invariably alkaline innature, but they can also be very fertile if theyare deep and rich in organic matter – a wealthof plants give their ornamental best on suchsoils (Reed, 2011; Cantor, 2008). For calcarorendzicleptosols the following species arerecommended: Chamaecyparis lawsoniana‘Intertexta’, Fraxinus ornus, Morus nigra,Buddleja sp., Cornus mas, Cotinus coggygria,Deutzia crenata ‘Nikko’, Helianthemum‘Rhodanthe Carneum’, Potentilla fruticosa ‘RedAce’, Campsis radicans, Jasminum nudiflorum,Clematis ‘The President’, Aspleniumtrichomanes, Colchicum autumnale, Dicentraspectabilis, Amarantus caudatus, Dianthuscaryophyllus, Cheiranthus cheiri,Alyssummaritimum, Iresine lindenii, Iresine herbstii,Myosotis alpestris, Cercis siliquastrum,Platycodon grandiflorus, Pulsatilla vulgaris,Rudbeckia laciniata ‘Herbstsonne’, Cotoneasterfranchetii, Leontopodium alpinum (Selaru,2007; Iliescu, 2006).2. Calcaric arenosols (WRB – SR-1988)present the next succession of horizons: Ap AoA/R A/B ka.The phisico-chemical properties ischaracterized by: field capacity (CC%) between27 and 39%; wilting coefficient (CO%) 22-23%; available moisture holding capacity(CU%) 3.7-16.10%; the content of organicmatter is low for the entire profile; the contentof N is low for the entire soil profile 0.112-0.130%; the mobile P is low in the entire soilprofile (4-8 ppm); the content of mobile K ismiddle for Am – 135 ppm and low for A/R –29674 ppm; soil texture is sandy for the entireprofile > 57% sand (Buta, 2009).The recommended dendro-floricol assortmentis the following: Stipa gigantean, Portulacagrandiflora, Salvia splendens, Celosia argenteavar. cristata, Delphinium cultorum, Santolinachamaeciparyssus, Hibiscus syriacus, Betulaermanii, Pinus sylvestris Aurea Group, Robiniapseudoacacia ‘Frisia’, Cytisus x praecox, Ericaaustralis, Lavandula pedunculata subsp.Pedunculata, Lavatera x clementii, Perovskia‘Blue Spire’, Phlomis fruticosa, Achillea‘Walther Funcke’, Dictamnus albus, Eremurusrobustus, Eryngium x tripartitum, Lupinus ‘TheChatelaine’, Oenothera macrocarpa,Ornithogalum umbellatum, Salvia officinalis‘Tricolor’ (Reed, 2011; Toma, 2009).3. Distric cambisols (WRB – SR-1988)present the next succession of horizons: Ao BvC.The majority of acid-preferring plants areoriginally from woodland areas, and they prefera cool, more or less shady environment and asoil that is leafy, organic, and moist butwelldrained. In nature, such soils are fairlyfertile because nutrients are annuallyreplenished by the recycling of fallen leaves.There are also many acid-preferring plants thatneed or tolerate more open sites in sun, such aswitch alder, Lithodora diffusa ‘Heavenly Blue’,and most heather (Reed, 2011; Draghia, 2011).The phisico-chemical properties of districtcambisols is characterized by: field capacity(CC%) between 25 and 32%; wiltingcoefficient (CO%) 7-10%; available moistureholding capacity (CU%) 25-32%; the contentof organic matter is low; the content of N ismiddle for the entire soil profile 0.150-0.260%;the mobile P is low in the entire soil profile (

Pinus sylvestris ‘Gold Coin’, Rhododendronluteum, Skimmia japonica ‘Rubella’, Vacciniumvitis-idaea, Deschampsia flexuosa ‘Tatra Gold’,Gentiana sino-ornata, Lilium superbum(Cantor, 2008; Reed, 2011; Toma 2009).4. Hyperskeletic leptosol (WRB – SR-1988)present the next succession of horizons: Ao R.There are recommended species which toleratevery sandy, stony, or shallow and alkaline soils.Hot and dry sites present a challenge to plantsurvival, not only because of the obvious lackof moisture needed for growth, but alsobecause the leaves of many plants – even somecommitted sun-lovers – scorch in very hot sun,particularly where the water supply is short orunreliable (Reed, 2011).The phisico-chemical properties ofhyperskeletic leptosol are characterized by:field capacity (CC%) between 10 and 20%; thecontent of N is very low for the entire soilprofile 0.70 ppm; the mobile P is low in theentire soil profile (< 1.5 ppm); the content ofmobile K is low for the entire profile (67-120ppm) (Buta, 2009).Plants for these sites: Adonis vernalis, Alyssumsaxatile,Gleditsia triacanthos ‘Rubylace’,Robinia x slavinii ‘Hillieri’, Caraganaarborescens ‘Nana’, Cytisus multiflorus,Lavandula dentate, Phlomis purpurea, Alliumhollandicum ‘Purple Sensation’, Amaryllisbelladonna, Anthemis tinctoria ‘E.C. Buxton’,Catananche caerulea ‘Major’, Echinops ritro‘Veitch’s Blue’, Festuca glauca ‘Blaufuchs’,Fritillaria imperialis, Gaillardia x grandiflora‘Kobold’, Geranium cinereum ‘Ballerina’,Oenothera speciosa ‘Rosea’, Papaver orientale‘Allegro’, Tulipa praestans ‘Unicum’, Verbenabonariensis, Viola x wittrockiana, Ajugareptans, Sedum sp., Anemone cornaria, Oxalisadenophylla, Lobelia erinus, Saxifragacuneifolia (Reed, 2011; Iliescu, 2006; Selaru,2007, Chelariu, 2011).5. Haplic gleysols (WRB – SR-1988) presentthe next succession of horizons: Ao AGo Gr.The plants which are developing well on thistype of soils are known as moisture-lovers, butthey are often sold as bog plants. This can bemisleading, since many moisture-loving plantswill not tolerate totally waterlogged soils.Boggy soil saturated with water is usuallybetter for shallow-water, or marginal aquaticplants. These plants can also be used tosurround ponds or pools to bridge the gapbetween water and land. Here, they will maskthe edge of the water in an attractive way, andif the water is still clear, plants like Salix alba‘Britzensis’ or Lysichiton camtschatcensis givemore than double the value when their form isreflected in its mirrorlike surface (Reed, 2011).The phisico-chemical properties of haplicgleysols are characterized by the followings:clay has high values of 22.8% in Aow horizon,and lower in A/Go horizon (21.63%); thecontent of N is high for the entire soil profile0,500% in the first cm; the mobile P is low inthe entire soil profile (1.2-0.2 ppm); the contentof mobile K is low (7-15 ppm); cationexchange capacity (T) is 13-21 me/100g soil;degree of base saturation V% is lower 40-60%;the soil pH is acid 5.2-5.4 (Buta, 2009).Plant species recommended for this soil typeare the following: Metasequoiaglyptostroboides, Salix alba ‘Britzensis’,Cornus alba ‘Elegantissima’, Rhododendron‘Bow Bells’, Vaccinium corymbosum, Astilbe xcrispa ‘Perkeo’, Carex pendula, Darmerapeltata, Filipendula rubra ‘Venusta’, Fritillariameleagris, Gunnera manicata, Hosta ‘FrancesWilliams’, Iris versicolor ‘Kermesina’, Lobeliacardinalis, Hemerocallis flava, Iris sibirica,Lysichiton americanus, Lythrum salicaria‘Feuerkerze’, Matteuccia struthiopteris,Pontederia cordata, Primula japonica‘Postford White’, Rheum palmatum‘Atrosanguineum’, Rodgersia pinnata‘Superba’, Sagittaria latifolia (Reed, 2011).CONCLUSIONSThis paper aimes to support experts inlandscaping for choosing dendro-plants flowerassortment depending on restrictive soilconditions.For example were chosen five soil types, as themost representative with calcareous substrates,sandy, acidic, skeletic and excess moisture.Depending on restrictive soil conditions hasbeen established an assortment of dendrofloricolplants which is suitable for landscapedesign.297

REFERENCESButa M., 2009. Aprecierea calitativa a solurilor dindealurile Cojocna Sic subunitate a CampieiTransilvaniei. PhD thesis, Cluj-Napoca.Reed C., 2011. Plants for places. Dorling KindersleyLimited Publishing House, UK.Cantor M., 2008. Plante ornamentale de interior.Todesco Publishing House, Cluj Napoca.Chelariu E.L., 2011. Evaluation of the assortment ofgrasses decorative by leaf. Bulletin USAMV Cluj –Napoca, Seria Horticulture, Vol. 68 (1), p. 548.Draghia L., Chelariu L., 2011. Floricultura speciala. IonIonescu de la Brad Iasi Publishing House.Iliescu Ana-Felicia, 2006. Arhitectura peisagera. CeresPublishing House, Bucharest.Paulette L., Buta M., 2010. Notiuni teoretice de cartare sibonitare a terenurilor agricole, Risoprint PublishingHouse, Cluj-Napoca.Selaru E., 2007. Cultura florilor de gradina. CeresPublishing House, Bucharest.Toma F., 2009. Floricultura si arta florala. Vol. I-V.Invel Multimedia Publishing House, Bucharest.***WRB (World Reference Base for Soil Resources).298

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653‘CANDIDA ALI’ AND ‘EXCELSA’ - ROMANIAN Gladiolus CULTIVARSRECENT HOMOLOGATEDMaria CANTOR 1 , Lenua CHI 2 , Erzsebet BUTA 1 , Denisa HORT 11 University of Agricultural Sciences and Veterinary Medicine of Cluj, 3-5 Manastur Street, ClujNapoca, Romania2 Fruit Research Station Cluj, Horticultorilor Street, no.5, Cluj Napoca, RomaniaAbstractCorresponding author email: marcantor@yahoo.comGladiolus x hybridus L. is a popular bulb plant grown in Romania in field for cut flowers in summer season. Nowadaysin Romania the activity for improve the assortment of gladiolus by breeding program is limited. This is because of thesmall number of researchers devoted to sustainable breeding work. The Floriculture Department of UniversityAgricultural Sciences and Veterinary Medicine Cluj, in collaboration with Research Fruit Station Cluj, do an intensivefrom many years until the present. ‘Candida Ali’ and ‘Excelsa’ cultivars have recently been registered and patented(2011) having a great floral potential do to their color and good morpho-decorative characteristics.Key words: cultivar, breeding, characters, selection, bulb plant.INTRODUCTIONGladiolus x hybridus L. is a popularfloricultural crop in Romania grown mainly forcut flowers. The modern Gladiolus cultivarsoffer a diversity of colors, shapes, and sizesthat is available in few other flowering plants(Cantor and Tolety, 2010).During the last quarter of a century anincreasing interest was generated in new crops.Dozens of new species and genera enter thecommercial arena each year. Some newcultivars are only selections; others are resultsof intra-and interspecific hybridizations (Craig,2003).Currently many hybridizers work on creatingnew Gladiolus cultivars, but in Romania thisactivity is limited. This is because of the smallnumber of researchers devoted to sustainablework for improving the Gladiolus assortmentby breeding in order to obtain new varietieswith superior characteristics and more adaptedto the climate of Romania.Gladiolus cultivars suitable for cultivationunder the temperate climate of theTransylvanian areas of Romania have beendeveloped by the Floriculture Department,University of Agricultural Sciences andVeterinary Medicine, from 1998 until thepresent. A total of 14 new Gladiolus cultivars299that have a broad spectrum of colors anddesirable characters such as: multipleflowering, vigor, resistance to pests anddiseases, different colors etc. ‘Candida Ali’ and‘Excelsa’ have recently been registered andpatented.Origin‘Candida Ali’, tested as H 1/20, resulted from acontrolled cross between ‘Early Riser’ and‘Priscilla’, made by M. Cantor and L.M. Chis atUASVM Cluj-Napoca in 2001, fallowed byclonally selection and vegetative multiplicationby corms (Figure 1). Further characterizationof this hybrid began in 2007 at ISTIS Bucharest(The State Institute for Variety Testing andRegistration).‘Excelsa’ resulted from the intraspecifichybridization method between the cultivars‘Priscilla’ and ‘Speranta’. The cross was madein 2001 by M. Cantor, and it was selected as ahybrid H 18/1 in 2003 (Figure 2).The purity certificate no 1324/2009 wasobtained in 2009 under the name ‘Candida Ali’and ‘Excelsa’ after being tested in ISTISBucharest on the base of the DUS (distinctivity,uniformity and stability) test and wasrecommended for introduction as commercialcrops in Romania.

Figure 1. Pedigree of ‘Candida Ali’‘Excelsa’ resulted from the intraspecifichybridization method between the cultivars‘Priscilla’ and ‘Speranta’. The cross was madein 2001 by M. Cantor, and it was selected as ahybrid H 18/1 in 2003 (Figure 2).The purity certificate no 1324/2009 wasobtained in 2009 under the name ‘Candida Ali’and ‘Excelsa’ after being tested in ISTISBucharest on the base of the DUS (distinctivity,uniformity and stability) test and wasrecommended for introduction as commercialcrops in Romania.In 2011 ‘Candida Ali’ (patent no. 00252) and‘Excelsa’ (patent no. 00251) were patented asprotected cultivars (Figure 3A, B).To maintain the characteristics of thosecultivars, they must be vegetative propagatedby corms and cormels.Figure 2. Pedigree of ‘Excelsa’Figure 3. A. Candida Ali (H 1/20)300

Figure 4. Excelsa (H 18/1)Description‘Candida Ali’ cultivar has a delicate color offlorets (dark pink bronze with intense pinkneck, white stripes) and it is currently a popularcultivar on the market (Table 1). It is an earlymidseason bloomer in Transylvania area. Theflowers are bell-shaped when open and havegood longevity in the vase as cut flowers. It hasa good vigor (112.1 cm), a long spike andprolific corm producer (115 cormels/corm)which facilitates multiplication (Table 3).The performances of the new cultivars werecompared with a very popular cultivar inRomania, ‘Priscilla’ which is also one of theparents in the cross-breeding process.In 2009 the cultivar ‘Candida Ali’ received aDiploma and Silver Medal at the InternationalSalon of Research and Invent ‘PROINVENT’Cluj-Napoca.CultivarsTable 1. Morphological characteristics of the new Gladiolus cultivarsFlower colorFloretshapeSpotAnothercolorCultivarsDays tofloweringfrom plantingTable 2. Quantitative characteristics of the new gladiolus cultivarsPlantheight(cm)Spikelength(cm)No. offlorets/flowerFlowerwidth(cm)UseNo. of simultaneously floweringfloretsCandida Ali 77 112.1 74.0 15.4 11.5 5.7 5.4Excelsa 66 100.4 45.0 14.3 11.4 5.2 5.0Dark pink bronze with intense pink neck,Cut flower, border or group inCandida AliRound yes purplewhite stripesthe fieldExcelsa Purple red with white narrow Round none white Landscape designCut flowerPriscillacontrolLight rose with dark rose lines Round yes white rose Cut flower, gardenPriscillacontrolVaselife(days)82 121.3 86.2 15.0 11.5 5.1 4.7Table 3. Corm productivities of new Gladiolus cultivarsCultivars No. of cormel/plant Circumference of corm (cm) Corm weight(g)Candida Ali 115 14.4 42.5Excelsa 42 13.8 33.7Priscilla-control 65 14.0 41.3301

The ‘Excelsa’ cultivar is characterized by theremarkable achievement of combining superiormorphological characteristics. This cultivarblooms earlier than many commercialGladiolus cultivars, 66 days from planting, andit has a lovely color that looks beautiful invases (Table 2).As a conclusion the new cultivars represents astep forward in combining a high qualities ingenus Gladiolus, they contributed to improvingthe Romanian assortment.AvailabilityLimited quantities of ‘Candida Ali’ and‘Excelsa’ cultivars may be obtained fromUASVM Cluj-Napoca, by addressing requeststo Maria Cantor at the Department ofFloriculture, room 91.REFERENCESCantor M., Tolety J., 2011. Gladiolus, p. 133-160. In:Chittaranjan Kole (eds.). Wild Crop Relatives:Genomic and Breeding Resources. Plantation andOrnamental Crops. Springer, Heidelberg.Cantor M., 2006. Genetic breeding of Gladiolus hybridusin Romania, Proc. ASHS, HortScience 41 (4) :1041(abstr.).Craig R., 2003. Creating a more beautiful world: acentury of progress in breeding of floral and nurseryplants, HortScience 38 (5), p. 931.302

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653RESEARCHES CONCERNING THE MULTIPLICATION IN VIVO OFLISIANTHUS FOR PROMOTING IN ROMANIAN GREEN HOUSESMaria CANTOR, Rodica POP, Iudita Elisabeta CSETE, Buta ERZSEBET, Anca HUSTIUniversity of Agricultural Sciences and Veterinary Medicine, Faculty of Horticulture, 3-5 ManasturStreet, Cluj-Napoca, RomaniaAbstractCorresponding author email: marcantor@yahoo.comCurrent concerns of plant growers in Romania are to improve the flowers assortment with new species. Our researchesfocused on herbaceous ornamental plant Lisianthus russelianus Hook., (Eustoma grandiflora L.). It is a relatively newspecies in the range of cut and potted flowers for her beautiful colored and vase life. The new species introducedrequires establishing efficient multiplication techniques. The biological material used in the experience were seeds fromSakata company (USA), represented by three cultivars: ‘Echo Lavender’, ‘Flamenco White’ and ‘Mirage Pastel Pink’.Also vegetative multiplication by cuttings was experimented on different culture substrate. Plants were grown ingreenhouses of USAMV Cluj-Napoca and Botanical Garden “Alexandru Borza” Cluj-Napoca. The results obtained willbe using for Romanian growers for diversification their assortment in greenhouse.Key words: eustoma, cultivars, propagation, seeds, cuttings, Gentianaceae.INTRODUCTIONLisianthus is a relatively new species in therange floricultural, Japan being the largestproducer. Lisianthus is a species with greathorticultural potential in Romania.Lisianthus is a moderately cold-tolerant annualor biennial plant native to the southern part ofthe United States and Mexico (Roh andLawson, 1988), belong to Gentianaceae family.In Texas is popularly known as 'blue bell','prairie rose' or 'prairie gentian'. Genus namealludes to the beauty calyx and corolla, theflower look is glossy, satin and beautiful border(„lisieé” in French means smooth, glossy).From crossing wild forms, which shows blueflower petals, resulting in improvement worksform a large flower perfection extremely variedin color and shape.In Europe started to be cultivated only after the1970s. After France, the Netherlands rankssecond in the culture of this beautiful flower. InRomania the first cultures were establishedfrom Companies Codlea and early cultureswere initiated at University of AgronomicSciences Bucharest since 1989 (Cantor, 2009).This plant grows to 50-75 cm in height with20-40 flowers. By nature, Lisianthus initiallyforms a rosette and grows very slowly duringthe winter, stems elongate in the spring, and it303flowers in summer (Roh et al., 1989). In recentdecades, breeders have developed a variety ofcultivars with respect to many traits such asuniform flowering throughout the year, lack ofrosetting, heat tolerance, flower color, andflower size and form, including double flowersetc (Harbaugh, 2006). The importance of thisornamental flower is due to its beauty, diversityof colors, excellent keeping quality, and widerange of different forms (Ali et al., 2008,Kanwar and Kumar, 2009). It is known that tothis genus Lisianthus (Eustoma) are belonging27 species, herbaceous and woody plants. It is arelatively new species in the range of cut andpotted flowers.Due decorative qualities lisianthus culture'sexpansion took in most of Europe and thusflower growers and enthusiasts have expresseda particular interest in this crop. Lisianthusflowers are much used by those who deal withflower arrangements and bouquets for differentoccasions. Lisianthus is highly regarded notonly as a cut flower, and as the plant pot.Currently, in our country, lisianthus culture isnot widespread, although there is marketdemand. Most flowers sold and used by floristsare imported from Holland.For the new species introduced are requiredefficient multiplication techniques to beestablished.

Eustoma randiflorum is commonly propagatedby seed or cutting. Sexual propagation used toobtain seedlings seeds brought from abroad(Netherlands, USA, France, etc). From a gramof seeds can be obtained about 8000 plants(Bala, 2010).Generally, sowing the plants of Lisianthus is inautumn or January-February. Industrial culture,sowing can be done in half, and according tothis period, the number of days to floweringmay vary.Propagation by cuttings is less practiced.Cuttings are cut to a length of 10 to 15 cm(which have three pairs of leaves) and placedon the substrate of peat and perlite, sand orperlite simple. Rooting takes place for 40-50days. The disadvantage of this method is thatthe percentage of shoots of the plant is weaker,we get a few plants and can easily transmitdiseases and pests (Toma, 2009).MATERIALS AND METHODSFor the new species introduced are requiredefficient multiplication techniques to beestablished. The study was about conventionalpropagation methods, by seeds. The biologicalmaterial used in the experience comprised inseeds from Sakata Company, represented bythree F 1 hybrids of Lisianthus russelianus:„Echo Lavender”, „Flamenco White” and„Mirage Pastel Pink”. These were used toobtain plants to start the in vitro and in vivoexperiments in order to establish thegermination and the rooting rates. Seeds weretreated thiuram pelleted. The biologicalmaterial presents the following characters:,,Echo Lavender”. It is one of the mostpopular cultivars with early flowering. Plantsare vigorous in spring, while in summerdroughts become more fragile. The leaves are5-8 cm long, elliptical, slightly sharp andsucculent; they look dull and bluish-greencolor, with 3-5 ribs clearly visible. Summerflower buds open in cones than 5 cm indiameter, showing many shades of purple.,,Flamenco White”. The flowers are simple, issuitable for cultivation in summer whentemperatures are high and days are long. Stemsare vigorous and flowers on top of them arewhite. Leaves are skin, colored bluish green,located opposite the stem. Stem height is 50cm. Blooms two weeks earlier than hybridMirage Pastel Pink.,,Mirage Pastel Pink”. Flowers are simple,ideal for summer flowering. Has smaller petals,and are resistant to transport. The flowers arepink, with the little white. The leaves are greenand vigorous stems are about 40-50 cm inlength. It is resistant to high temperatures andbotrytis.Experience was made in greenhouses ofUSAMV Cluj-Napoca and the greenhouses ofthe Botanical Garden Alexandru Borza Cluj-Napoca.Propagation by seedsSowing was done on 04.03.2011, in smallpockets trays using the neutralized peatsubstrate. The seeds were sown on the surfacebecause they are photosensitive (germinate inthe presence of light). Greenhouse temperaturewas 20-22°C during germination, and thendecreased to 18-20°C. Relative humidity was70-75% and 80-85% of the substrate,maintaining this level through daily watering.Germination occurred at 21 days, after whichobservations were made on the percentage ofgermination. During the period of germinationwere assured maintenance, or weeding,watering and ventilation greenhouse. Lisianthusfrom each hybrid were sown one hundredseeds.After about six weeks on 4/24/2011 plantsproduced two little leaves true. Four days later,on 05.28.2011 was carried out firsttransplantation in alveolar larger trays, then on6/10/2011 moved in pots 7x7cm (Figure 1).304

Figure 1. Plants in cellular trays and pots (original)Vegetative propagation by cuttingsCuttings were made from plants grown in thegreenhouse of the Botanical Garden 'AlexandruBorza' Cluj-Napoca from the seeds of the threehybrids studied. Leaves were removed fromcuttings length exempting those in the apicalzone (Figure 2).Cuttings were trimmed to the size of abouteight cm and planted in wooden boxes ondifferent rooting substrates.For rooting of cuttings were used three types ofsubstrate:-S1-sand river; -S2-peat + sand,mixture of 1:1 and; -S3-peat + sand + gardensoil, mixture of 1:1:1.After 40 days there have been observations onrooting percentage. In vivo plants were grownand maintained in the greenhouse of theUSAMV Cluj-Napoca and served to multiplyby cuttings and in vitro propagation.305

Figure 2. Aspects of in vivo propagation by cuttings (original)RESULTS AND DISCUSSIONSResults of germinationrateIn vivo experience in seed germinationpercentages first comment on were made atabout 21 days, at which time it was consideredthe emergence over. Data on the percentage ofgermination are shown in Table 1. Theperformed analyzes on the percentage ofgermination is a weak seed germination in allhybrids analyzed, with an average rate of 65%(Table 1).Table 1. The percentage of germination in vivo threehybrids examinedHybridnameNo ofseedssownNo of seedsgerminatedPercentage ofgeminated seeds(%)MiragePastel Pink100 64 64EchoLavander100 69 69FlamencoWhite100 62 62Average 100 65 65Analyzing the data in Table 1 it can be seenthat the highest percentage of germination wasobtained in the F 1 hybrid Echo Lavender306

espectively 69%, followed by hybrid MiragePastel Pink with a germination rate of 64%.The lowest percentage of germination wasobtained in hybrid Flamenco White of only62%.The data obtained are in accordance with theliterature, which mentions a low germination inthis species, both because of the very small sizeof seeds and germination special conditions,namely the presence of light (Cantor, 2009).Results for rooting cuttingsData on percentage of rooting cuttings fromthree hybrids analyzed are presented in Table 2.Table 2. Rooting percentage in the three LisianthushybridsVariant 1Number ofrootedcuttingsusedNumber ofrooted cuttingsPercentage ofrooting(%)S1E 30 0 0S2 E 30 5 16S3E 30 3 10S1F 30 0 0S2F 30 4 13S3F 30 3 10S1M 30 0 0S2M 30 8 26S3M 30 4 13Total270 27 10number1Substrate 1Hybrids;S1-river sand; E-Echo Lavender;S2-peat + sand, mixture 1:1; F-Flamenco White;S3-peat + sand + garden soil, mixture 1:1:1; M-Mirage Pastel PinkFrom the table it can be seen that the highestpercentage of rooting was obtained in hybridMirage Pink Pastel on sand and peat substratemixed 1:1 with 26%, followed by hybrid EchoLavender on the same substrate, 16%. A smallpercentage of rooting was recorded and thesubstrate composed of soil-peat-sand in a ratioof 1:1:1. Pastel Pink Mirage hybrid resulted ina 13% and other hybrids with a percentage of10%. If the substrate consists of river sand hasno rooted cuttings.CONCLUSIONSBased on the experiences made the followingconclusions are:Data obtained shows that the seeds size andecological conditions influenced negatively thegermination percentage, registering an averageof only 65% for the analyzed hybrids.The experiments conducted shows that speciesLisianthus russelianus Hook. is quiterecalcitrant to conventional vegetativepropagation, by cuttings, regardless of thesubstrate used.The small percentage of rooting, probably dueto the fact that greenhouse facility was notequipped with 'mist system' that does notensure a high air humidity nor stimulators wereused rootedness.We recommend the promoting culture in ourcountry, of the species Lisianthus russelianusHook., by enriching assortment with newcultivars.Biological material obtained by applyingconventional propagation methods lead toobtaining parent plants which can be used as abasis for in vitro multiplication that willproduce an unlimited number of plants in arelatively short time.REFERENCESAli A., Afrasiab H., Naz S., Rauf M., Iqhbal J., 2008. Anefficient protocol for in vitro propagation of carnation(Dianthus caryophyllus L.). Pak. J. Bot. 40: 111-121.Ardelean M., Sestras R., Cordea M., 2007. Tehnicaexperimentala horticola, Ed. AcademicPres, Cluj-Napoca.Bala Maria, 2010. Floricultura speciala, Ed. Timpolis,Timisoara, p. 320.Cantor Maria, 2009, Floricultura generala, Ed. Todesco,Cluj-Napoca, p. 64-65.Harbaugh B.K., 2006, Lisianthus, Eustomagrandiflorum. In: Anderson NO (Ed), FlowerBreeding and Genetics, Springer, Netherlands, pp645–663.Kanwar J.K., Kumar S., 2009. Influence of growthregulators and explants on shoot regeneration incarnation. Hort. Sci. 36: 140-146.Roh M.S., Lawson R.H., 1988. Tissue culture in theimprovement of Eustoma. HortSci 23, p. 658.Roh M.S., Halevy A.H., Wilkins H.F., 1989. Eustomagrandiflorum. In: Halevy AH (Ed), Handbook ofFlowering, CRC Press, Boca Raton, FL, pp 322–327.Toma F., 2009. Floricultura si arta florala, Vol. 1, Ed.Invel Multimedia Bucuresti.307

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653THE INFLUENCE OF FERTILIZERS APPLIED ON CONTAINERIZEDCULTURE OF THUJA OCCIDENTALIS COLUMNAAbstractGeorgeta CAREU 1 , Liana Melania DUMITRU 2 , Corina GAV 21 Bioterra University, Ion Ionescu de la Brad 97, Code 013812, Bucharest, Romania2 Fruit Research Development Constana, Pepinierei st. 1, Code 907300,Valul lui Traian, Constana, RomaniaCorresponding author email: georgiana.caretu@yahoo.comThe containerized culture of the ornamental plants has an increasing importance for producers. These are interested infinding the proper solutions for the insurance of the best growth conditions for the plants. Fertilizers are indispensablefor success of the type of culture at high parameters.Researches have been done at the Fruit Research DevelopmentConstanta between 2004-2006.The biological material used for studies was represented by plants of Thuja OccidentalisColumna. Substratum for culture, resulted by mixing some compounds, were represented by: Substratum 1 made by:ground celery, ground leaf, peat and sand 1:1:1:0,5; Substratum 2 made by: forest compost and perlit 3:1.Experimental scheme included 6 variants: 2 controls unfertilized, with plants cultivated in the two substratum; 2variants with substratum fertilized with forest compost NPK 15:15:15; 2 variants fertilized during vegetation with Coïcnutritive solution. There were organized (6) six variants with four (4) replications. During the three years of studies hasbeen done agrochemical analysis of substratum from containers, in May and in September, to establish: pH; totalnitrogen; humus %,; organic substance; phosphorus; potassium. The observations made on the plants consisted in:biometric measurements of the plants in May and September regarding: height of plants (cm), trunk thickness diameter(mm), number of offshoots; agrochemical analysis for finding the provisioning level in nutritive elements of the plants.The best substratum for Thuja Occidentalis “Columna” was represented by substratum 1 with complex fertilizer (NPK)15:15:15 applied 5 kg/mc before planting in containers. Substratum 1, fertilized before planting in containers leaded tosignificant growth. Coïc solution applied during vegetation had also considerable influence on plants growth.Key words: complex fertilizer, nutritive solution, substratum.INTRODUCTIONThe containerized culture of the ornamentalplants has an increasing importance forproducers. These are interested in finding theproper solutions for the insurance of the bestgrowth conditions for the plants.Fertilizers are indispensable for success of thetype of culture at high parameters, so that it isnecessary to solve the aspects of using them.MATERIALS AND METHODSResearches have been made at the FruitResearch Development Constanta between2004-2006. The biological material used forstudies was represented by plants of ThujaOccidentalis Columna, multiplied before bycuttings. Substratum for culture, resulted bymixing some compounds, were represented by:-Substratum 1 made by: ground celery, groundleaf, peat and sand 1:1:1:0,5.-Substratum 2made by: forest compost and perlit 3:1.Experimental scheme included 6 variants: -2controls unfertilized, with plants cultivated inthe two substratum; -2 variants with substratumfertilized with forest compost NPK 15:15:15; -2 variants fertilized during vegetation with Coïcnutritive solution. There were organized (6) sixvariants with four (4) replications. Eachreplication included three plants. Plants ofThuja were planted in containers with 12 cmdiameters.Analyses and observationsSubstratum.During the three years of studies has been doneagrochemical analysis of substratum fromcontainers, in May and in September, toestablish the following parameters: pH (inwater) – potentiometer; total nitrogen (N), byKjeldhal method; humus%, by Walklay Blackmethod (modified by Gogoaa); organicsubstance%, by wet combustion method;phosphorus (P), ppm in Al, by Egner – RhiemDomingo method; potassium, ppm in Al, byflame photometry. Biological material. The309

observations made on the plants of Thuja fromcontainers consisted in: -biometricmeasurements of the plants in May andSeptember, for every vegetation cycle,regarding:-height of plants (cm) -trunkthickness diameter (mm) -number of offshootsagrochemicalanalysis for finding theprovisioning level in nutritive elements of theplants which were made in May and Septemberto determine:-N%, by Kjeldhal method-P%, bywet mineralization and colorimetric dosage-K%, by wet mineralization and flamephotometryRESULTS AND DISCUSSIONSIn table 1 are presented the effects of differentnutrition of the plants about the height, trunkthickness diameter and number of offshoots.Table 1. Biometric determinations of Thuja occidentalis " Columna"Table 1 shows that the best results wereregistered at fertilized variants, in substratum 1:22,6 cm increase growth for fertilizing withNPK and 2,9 cm for nutritive solution.Number of offshoots was also bigger in thesevariants towards of unfertilized control andvariant from substratum 2, with lightcomposition.Statistic interpretation of the results of thebiometric measurements are included in table 2and figure 1.Table 2. Statistical interpretation of the growth increase at Thuja Occidentalis " Columna"Height in 2004 Height in 2006 IncreaseVariant(cm)(cm)growthDifference Signification (cm) % V1 Substratum 1- control 20,2 35,0 14,8 100 - -V2 Substratum 1 + NPK 30,2 52,8 22,6 152,7 +7,8 *V3 Substratum 1 + nutritivesolution27,2 49,1 21,9 147,9 +7,1 *V4 Substratum 2- control 27,8 39,4 11,6 100 - -V5 Substratum 2 + NPK 30,1 45,3 15,2 131,0 +3,6 -V6 Substratum 2 + nutritivesolution26,1 42,3 16,2 139,6 +4,6 -x= 17,05; DL 5% = 6.39; 1% = 10,03; 0,1% = 17,08310

Figure 1. The dynamic height growing of the plantsPlants of Thuja occidentalis “Columna” fromsubstratum 1 fertilized with NPK had aprogress of growth with 52,7% bigger than theunfertilized control.Fertilization of plants from substratum 1 withCoïc solution during the vegetation determineda growth of 47,9 cm towards the control (table3).The analysis of the results shows the followingprovisioning of plants in N, P, K.Table 3. Average content in nutritive elements from plants at Thuja Occidentalis " Columna" 2004-2006 Variant N% P% K% May Sept. May Sept. May Sept. 2,37 2,56 1,48 1,63 0,34 0,40 2,81 3,08 1,69 1,89 0,42 0,48 2,69 2,93 1,59 1,78 0,37 0,43 2,05 2,36 1,40 1,57 0,32 0,37 2,28 2,53 1,54 1,70 0,38 0,44 2,36 2,62 1,49 1,66 0,36 0,41The best provisioning was founded at V2,fertilized with NPK (3,08% N in September,1,89% for P and 0,48% for K).Nutritive solution (Coïc solution) appliedduring the vegetation, had also a goodinfluence for plants provisioning at V3 2,93%N in September, 1,78 P% and 0,43% K. Bothvariants (V2 and V3) content plants fromsubstratum 1, with peat.Results of agrochemical analysis of substratumare included in table 4.311

The values of pH diminished in all variants,being 5,8 at V5. Total content of soluble saltswas situated in normal limits between 0,12% atV1 and 0,29% at V5. Phosphorus (P) fromsubstratum diminished, the value being atinferior limit of a temperate provisioning.Potassium had the biggest value at V2,fertilized with NPK (378 ppm).Evolution of content in P and K fromsubstratum is underlined by graphs 2 and 3.Figure 2. Content of P312

Figure 3. Content of KVariation of pH of substratum and total contentin soluble salts is indicated by graphs 4 and 5.Figure 4. Variation of pH313

Figure 5. Content of total soluble saltsCONCLUSIONSThe best substratum for Thuja Occidentalis“Columna” was represented by ground celery,ground leaf, peat and sand 1:1:1:0,5(substratum 1) with complex fertilizer (NPK)15:15:15 applied 5 kg/mc before planting incontainers.Substratum 1, fertilized before planting incontainers leaded to significant growth. Coïcsolution applied during vegetation had alsoconsiderable influence on plants growth.Substratum and fertilization didn’t have animportant influence on trunk thickness ofplants, these being dependent on morphologicalcharacteristics of the variety.The best behavior of the plants was at pH=7,4in substratum 1. The total content of saltsincrease in both substratum, because offertilization but remains in normal limits.Total content in nitrogen (N) showed a goodprovisioning of substratum. The values ofphosphor (P) were temperate and potassium(K) diminished by plants consumption, butremained at good and very good values.The biggest values of nitrogen (N) from leafshad a considerable correlation with the biggestheight of plants.The values of P and K showed a goodprovisioning of plants, the biggest valuesregistered at plants from substratum 1 fertilizedwith NPK before planting.REFERENCESCharpentier S., 1985. Equilibres chimiques etprecipitations dans les solutions nutritives. P.H.M.Rev. Hortic. 258, p. 19-24.Davidescu D., Davidescu Velicica, 1992. Agrochimiehorticola, Ed. Academiei Române, Bucuresti.Krüssman S., 1981. Die Baumschule, Verlag Paul Parey,Berlin.314

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653HISTORICAL ANALYSIS AND STUDY OF CURRENT STATE OF BRANCASTLE DOMAIN, INORDER TO RESTORE THE HISTORICLANDSCAPE ESEMBLE – FORMER ROYAL RESIDENCEElisabeta DOBRESCU, Anca STNESCUUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Marasti, District 1,011464, Bucharest, RomaniaAbstractCorresponding author email: veradobrescu@yahoo.comNational landscape needs to create benchmarks for national identity, especially because it is just beginning. In fact, if ahistoric landscape path could no longer be restored, then landscapers will need to refer to the tradition of a foreignnation. The smaller the funds for management, the greater it’s importance. Assessment of impacts on historic gardensand parks refer to their condition at the time of the study. Due to maintenance deficiencies, management, financing andlack of a national strategy for the conservation, improvement and use of historical monuments with landscape interest,we are currently witnessing rapid degradation of the few landmarks that nation-wide landscape holds. Mostrestorations were aimed at construction areas, the domains of gardens and parks, sometimes with surfaces of tens ofhectares, are not at all addressed, or addressed only theoretically. This study will explore in a historical and landscapepoint of view, the Bran Castle Park, as well as make an analysis of the current status, necessary studies in order toprofessionally restore the historic area.Knowing the main aspects of accounting and inventory of historical componentsassembly also includes a range of information that help sustainable management strategy in the future. Preservation,conservation,but also restoration and revitalization of cultural heritage landscape is a core concern in the developmentof a cultural society. These testimonies of the past are very important milestones, necessary in order to understand thehistorical context of the evolution of society. Maintenance and development of the historical monument landscapevalues, in conjunction with the architectural may lead in the future to a sustainable development of the monument, aconcept that can be incorporated into future marketing strategies.Key words: Historical garden, historical identity, restoration, revitalization, landscaping herritage.INTRODUCTIONAwareness on knowing the cultural heritage,instilling respect for national identity for theappropriation inherited values as elements ofnational identity and continuity are values thatcan be inspired only knowing the history andsuccessive transformations undergone by amonument over time until now.In complex analysis of domain structure, indepthhistorical study of the assembly and thecurrent state of the monument are the essentialpoints of any debut in a professional study of alandscape restoration assembly.Like any restoration, the main objective is thedevelopment of new concepts in terms ofpreservation and conservation of the site of theold structures of historical value. This objectivecan be achieved through a multidisciplinaryapproach and inventory analysis studies byadopting optimal solutions, introducing newfunctions needed by society, by engagingappropriate techniques and materials used.Knowledge, investigation and preservation orrestoration of these gardens is perhaps just asimportant as other cultural values that are partof the heritage of a country and, in many cases,the World Heritage (Law no 451, 2002).Any intervention will be recorded in ananalytical and chronological order to follow thetime evolution and sequence of worksperformed, but also to allow the retrospectivecontrol of the procedure and to ensureconsistency of subsequent interventions.MATERIALS AND METHODSBran Castle was built as a royal fortressthrough the privilege signed by the Hungarianking Louis I of Anjou on November 19 th , 1377.It is the oldest building-the royal residence,preferred especially the second Romanianqueen, Queen Maria.315

Figure 1. Plan of Bran domain (Ion N.D., 2003)Built by the inhabitants of Brasov since 1378, itwas in the successive possession of rulerMircea cel Btrân (between 1412 to 1418) andthen Iancu de Hunedoara who made the firstinterventions on the city, ordering repair andstrengthening works. From the late fifteenthcentury (1498) and by the middle of theeighteenth century is used as the customs,providing management functions of the royaldomain. The architecture of the castle isenriched in 1593 with a round tower added tothe southwest corner of the building, andbetween 1622-1625 with a gate tower, builtafter a rectangular plan.As part of administration and customs control,there are no records on the presence of gardens,at that time they probably had utility role.Between 1883-1886, the area was turned overto the inhabitants of Brasov, the castle receivedthe second intervention, restoration requiredafter employment of an Austrian regiment. In1916 is offered as a gift on the occasion of thecoronation of Emperor Charles I of Austria-Hungary. He is forced to decline due tocollapse of the monarchy and creation ofRomania Mare, on 1 December 1918.The same intention of giving the Castle wasonce again two years later, this time to the newsovereign of Romania Mare.For the fate of the castle, it was its chance toreturn to life, the passion of Queen Maria, whotransformed the city into a welcoming lovelysummer residence of the royal family. Withoutrestorations made by order of the Queen, byarchitect Karel Liman, with money provided bythe domain administrator Crown Prince Barbutirbey, the castle would probably have beenaffected by indifference and degradation thatled to the disappearance of many medievalmonuments.Until 1920, when it is donated to Queen Mariaof Romania, the castle was owned by ForestryOffice in Brasov. But starting this year (1920),the castle and its fields will enter a complexprocess of restoration and renovation.Figure 3. Queen Maria in the park near Mgura Branului(Ion N.D., 2003)Figure 2. Bran Castle seen from Mgura Branului (IonN.D., 2003)316Figure 4. Interior courtyard of Bran Castle (Ion N.D., 2003)

Early interventions focused on transforming themedieval castle with its sober andunwelcoming style into a modern andcomfortable home, without harming itsoriginality, as shown in the Queens memoirs: 'Idid nothing which would take away the feudalappearance, I didn’t transform the quickness ofthe stairs, I didn’t raise the roofs nor did Istraighten the crooked rooms'. Under theguidance of Czech architect Karel Liman QeenMaria brought improvements for 18 years(1920-1938) in the comfort of housing, waterand electricity connected the whole assembly,introduced telephony and the lift serving thecastle with its four floors and also created thelink between the castle and the park.In the period 1920-1922 the first references tothe Bran Castle gardens appear. Creating apictorial, free style garden, the architect KarelLiman, followed valuing dominant architecturalelements, a unique way of undermining thegreen area to the adjacent construction. Brandomain was expanded, encompassing meadowsaround the castle.In the composition appeared constructionfacilities completed to the requirements of thepassionate queen: Tea house, built fromwooden beams (144m.p.), Guest house, builtfrom raw stone (78 m.p.), Princess Ileana’sChildren house (43 m.p.), New personal house(176 m.p.), Staff housing (378 m.p.), Horsestables, Hunting house, Wooden church, twohuts and six garages.special care, by the chief gardener of the castle,Petre Conrad, under the guidance of the royalparc chief, Constantin Pamula.Figure 6. Queen Maria in the garden (Ion N.D., 2003)The Palace Parc was enriched with “fourtyapple trees, twenty trees, fifty cherry trees,twenty five prune trees and seventy blueberryshrubs” brought by the royal garden directionin Cotroceni. Also, the park lake was populatedwith 1000 trouts and a few swans.Figure 7. Queen Maria by the swan lake in Bran CastleParc (Ion N.D., 2003)Figure 5. The tea house and maintenance people in theBran Castle Parc (Ion N.D., 2003)In the year 1922 modern greenhouses werecommissioned, heated by radiators and a planwas made by the royal house architect (KarelLiman) for a rose garden. The garden hadUnfortunately, on 18 th July 1938, Queen Mariadies. The Bran estate becomes the property ofprincess Ileana, the restorations andmaintenance go on for nine more years. Thefirst years of this period (1938-1943) arededicated specially to the current repairs of thecastle, which due to rare inhabitation suffered(princess Ileana lived there six months a year,respecting the condition imposed by King317

Carol the second, her brother, on her marriageto the archduke Anton of Habsurg) Due to thePrincesses marriage with Prince Anton ofHabsurg, she was revoked and forced to live inSonnberg castle, Austria. Starting with 1943,the princess will permanently live in thecountry, living in the castle only in the summermonths and tending more to charity works.The magnitude of the domain transformationswas greatly diminished, this period overlappingwith that of the war, when all the country wasgoing through rough social, material andeconomical times.Still, Princes Ileana inherited the spirit andcharitable soul of Queen Maria, throughout herstay in Romania, looking toward helping andsupporting the nearby residents and the warcasualties. In this purpose she built with greatsacrifice and calling to many acquaintanceswho could help her, a hospital on an estateclose to the Castle. By doing this, she couldexpress the great love and consideration whichshe had for her mother, naming the hospital“Queens Heart”.The abdication of King Mihai I, on 30 th ofDecember 1947, releases the domain in thepossession of the Romanian government.Princess Ileana is forced to leave the countrythe political conditions allowing her to return tothe Castle only in 1990.Romanian cultural legacy. Today only threesections function: Castle Section – with piecesof the royal family patrimony (many of themdisappeared in the communist regime period),Medieval Customs Section – in process ofrestoration and Ethnography Section – in thepark near the Castle.RESULTS AND DISCUSSIONSCurrent stateThe expansion which the domain had duringthe time of Queen Maria is no longer valid.Figure 9. Guest house in the natural park (Dobrescu E.2009)Of the total surface ”233 acres to which 183forest acres (fir and beech), 93 acres ofmeadow and 2 acres of grasslands are added”(Ion N.D., 2003) accessible and arranged fortouristic purpose are just the spaces around thecastle.Figure 8. Queen’s Heart” Hospital in Bran (Ion N.D.,2003)In the year 1957, 10 years after the instaurationof People’s republic of Romania, the BranCastle became a museum, the communistregime starting a long period of degradationand estrangement of the wealth of the royalfamily, which although were not Romanianborn, protected, contributed and cherished the318Figure 10. Lake landscape park (Dobrescu E., 2009)In development is the Medieval customs area.Many of the buildings, surrounded by their

espective terrains, are now out of the touristicroute of the Bran estate. The surface of the Parkholds the Castle area, the park area to theformer garage workshops and the ethnographicarea in the park. The other areas are notpresented, some of them being the property ofother institutions.The Palace Park is precarious maintained, thelake is clogged, the mature vegetation needsregeneration works and the young vegetation isabusively and wrongly added. The bath housewith the swimming basin, placed beyond theriver are not on the touristic route. The samefor the wooden Church, the Big House, theHospital and the cript where Queen Maria’sheart was placed until 1970.Figure 12. Wrong approach in the context of a naturalstyle park (Dobrescu E., 2009)Figure 11. Thuja Occidentalis in a degraded state(Dobrescu E., 2009)Note that the park had, during the Queen, astrong direction for natural landscape design,the grasslands and the lake shores weredesigned to be natural, free, the meadow wasmowed manually, without o special concern foraccuracy and minute details. The flowers werenatural, wild species and they gave the placethe charm sought by the Queen and thecultivated species were only to be found nearthe castle. Fruit bearing trees only completedthe already present masses of trees resemblingthose found in the nearby forests, thus showingthe pragmatism of the natural style and thedesire to be close to nature.We cannot ignore the fact that, currently, thelandscape is not in accord with it’s originalstyle and does not respect the romanticcharacter created in it’s glory days.Figure 13. Inner courtyard of Bran Castle (Dobrescu E.,2008)The Bran Monument did not reveal anydocumentation regarding the gardensurrounding the castle, not until it entered thepossession of the royal court. The wish ofQueen Maria, to be surrounded by a landscapefitting her passion for nature, gave birth to thedesign which we can analyze today (with a bitof imagination). Let us not forget that then, theyoung sovereign came from a country with astrong landscaping tradition (England), withvery refined tastes and an inclination towardsthe romantic style. All the transformationsmade to the castle and the estate were graftedon the old structure of the domain, under theneeds identified at that time.319

Figure 14. Tea house in the natural park (Dobrescu E.,2008)Figure 15. Guest house in the natural park (Dobrescu E.,2008)CONCLUSIONSFollowing the historical review no documentswere found regarding restorations previous tothe ones made by the royal house architect,Karel Liman. All the transformations following1938 have no value from a historical or stylishpoints of views. As such we can consider thatfuture restorations have to keep in mind thehistorical moment marked by Queen Maria andthe aspect of the landscape created in thatperiod. All the restoration interventions have tohave as a historic mark the period between1920 and 1938, taking in consideration thecurrent necessity to adapt the historicalmonument to the touristic functionality and notas a housing facility. Also we have to reclaimthe domains belonging to the Queen whichhave a strong historical hold.The new functions have to keep account of theoriginal atmosphere without major alterationsto the whole image.Restoration, as an actualization of a work ofart, is included just to this filtration and accumulationof data; it is thus natural to identifytwo stages: the first is the reconstruction of theauthentic text of the work, the secondintervention over the matter from which thework is composed.This study is not only a research theme, butalso an action to induce or recover the respecttowards the history and national values ofpatrimony, without which a true restorationcould not take place.REFERENCESL451/2002. Conventia europeana a peisajului, adoptatala Florenta la 20 octombrie 2000Ion N.D., 2003. Castelul Bran-Resedinta a reginei Mariasi a printesei Ileana, Ed. Tritonic.Dobrescu E. Arhiva personala - foto 2007-2009.Brandi C., 1996. Teoria restaurarii, trad. RuxandraBalaci, Editura Meridiane, Bucuresti, p. 81.320

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653OBJECTIVE NECESSITY OF STUDY AND PROFESSIONALAPPROACH TO RESTORATION OF HISTORICAL LANDSCAPEENSAMBLES IN ROMANIAElisabeta DOBRESCUUniversity of Agricultural Sciences and Veterinary Medicine of Bucharest, 59 Marasti, District 1,011464, Bucharest, RomaniaAbstractCorresponding author email: veradobrescu@yahoo.comMajor concerns for preserving the national cultural identity are timid in regards to the landscape, perhaps a lack offunding and focus on other areas of interest. Architecture has received greater concern, but even here the situation wasnot very happy. All the restoration / revitalization interventions are spread, there is no coherent approach to the works,based on priorities for action which result from the analysis of degradation, vulnerability, and overall value ofmonuments.Therefore study and research for the restoration of parks and historic gardens should be thorough,currently lacking a methodology for analysis and evaluation of historical monuments adapted to the specific landscapethat is different from architectural specifics. Studies for a professional approach to historic landscape restorationassemblies could be a starting point in developing the methodology for the restoration of historic parks and gardens inRomania.Key words: Historical identity, cultural landmarks, restoration, the actual functionality, historical garden.INTRODUCTIONKeeping and preserving the cultural heritage isa necessity in the context of recognizing thehistoric, architectural and artistic inheritance ofRomania, but also for understanding the stagesof social, political and cultural development ofthe Romanian territories. The gardens andparks that belong to the historic edifices, asmonuments of the past, represent testimonies ofcertain stages of civilization and culture of apeople, of the way in which historical,economical, social factors as well as the beliefs,the scientific and technical knowledge of thetime determined certain shapes for the space ofhuman living.Knowing, investigating and conserving orrestoring these gardens could prove to be asimportant as doing so with any of the othercultural values that make up the historicalheritage of a country and, in many case, on theworld (Legea 451/2002).In the case of gardens, the effect of the exteriorclimate conditions on the specific constructionsand mostly on the vegetation, correlated withthe potential life span of the botanic species,321determines the degradation over time of thegeneral aspect of the landscape and often leadsto important losses. Preserving the landscape insuch cases means defending them fromphysical destruction, maintaining the basic,original characteristics of the shapes and thecomposing elements that lasted through time.The importance given to restoration andconservation of the historical heritage oflandscape architecture in different Europeancountries reflects in putting in the generalattention, inclusion in the touristic circuit,publishing of specially magazines, formation ofprofessional associations, and especially inallocating funds and attracting sponsors forfinancing studies and restoration projects.MATERIALS AND METHODSIn Romania there are over 29.000 historicalmonuments, of which over 4.000 are in a stateof advanced degradation, collapse and precollapse.Historical monuments, according to thedefinition accepted by the National Ministry ofHistorical Monuments and of Cultures and

Cults, and in conformity with the current laws,are estate goods, constructions and landsituated on the territory of Romania, or outsidethe borders, properties of the Romanian state,significant for the history, culture and nationaland universal civilization.All mentioned above belong to the nationalcultural heritage and are protected by lawsspecific to historical sites.The list of the monuments is pretty vast, yetmany of the aforementioned are alreadyphysically gone (like the Vcreti Estate, inDambovita county), and most didn’t benefitfrom studies or conservation and restorationinterventions.The few restorations undergonelately did not made themselves remarked forprofessionalism.Figure 2. Image from the restauration of the Venetianterraces, done in the time of Martha Bibescu (ChilimanA., 2000)Figure 1. Vcreti Mansion, in Vcreti, Dâmboviacounty (vanished since the comunist period) (Ion N.D.,2008)A professional approach of the historicalmonuments, as it is viewed by the lastinternational conventions concerning culturalheritage, landscape, monuments and sites, showthe importance that these have in the culturalheritage of a community (Florence cart).The process of professional restoration of thehistorical gardens involves an inventory of itscomprising elements and specializedinterventions considering their restoration,conservation and up-keeping, obtaining andmaintaining a high degree of authenticity.Figure 3. Planting on the venetian terrace, at the lastrestauration of the parc palace Brâncovenesc inMogooaia, restauration of a poor qualityThe authenticity of the site refers at the flatdrawing, the volume of the constituentelements as well as all the other vegetal ormineral details that it encompasses. Anyattempt to conserve or restore it assumes asimultaneous intervention on all the parts of theensemble, in order not to affect the structure ofthe initial composition.Restoring and conserving the historical gardensinvolves not only the comprising elements butalso the general context, defined by the exteriorenvironment in which these exist. All thechanges that happen in the physicalenvironment endanger the ecologicalequilibrium of the site.Intervention done on the historical monumentsare made only by respecting the Agreement ofthe Culture and Cults Ministry; the forcemajeure events are an exception, but with thecondition that the changes are reversible.322

According to the current laws, the interventionson any historical monument are represented byall the research endeavors, construction,extension, repair, consolidation, restoration,conservation, landscape setups, as well as anyother involvements that modify the aspect ofthe monument, including current repairs,maintenance work, exterior illumination, safetymeasures or decorative efforts.In the same set of interventions done on themonument are the temporary or permanentplacements of physical boundaries, protectionstructures, pieces of fixed furniture, advertisingsigns, signage or any kind of markings on themonument, movement of the entireconstruction, setting up means of access,pedestrian and non-pedestrian, other utilities,indicators, including the ones in the protectionareas of the monument.Figure 4. „An amusement parc” created on the spot in thehonor Court of the Brâncovenesc Palace in Mogooaia,image which alters the character of the monument(Dobrescu E.)All the interventions that affect the monument,other that the ones concerning changingdestination, maintenance or current repairs, nomatter what their source of finance and thenature of the property, are done under theinspection and control of the Culture and CultsMinistry, of the Directions for Culture, Cultsand National County Cultural Heritage and ofthe Municipality of Bucharest.Conservation and maintenance interventionsthat are permitted must respect a series ofethical principles without which the projectwould not be subject to a certain quality ofrestoration (AIC, 1976).323One of the core ethical principles is that therestorator must have the necessary qualificationfor conservation and restauration activities.The conservers and restaurateurs specialized incertain sectors of activity should limitthemselves only at the activities specific to theirfield of study and should not considerthemselves specialists in other domainsconnected to their own (for example paintingrestorators reconstituting statues)The quality of restorations is the definingelement of a specialist, not the quantity or thevalue of the restored object.A vast professional experience is necessary,gained through continuous formation, throughcollaboration with other specialists fromconnected domains, for a full knowledge of thequalities and abilities of a specialist inrestoration works.Maintaining a critical attitude regarding thetraditional materials and methods used inconservation and restoration of the degradedelements is a necessity, considering that all themanufacturers promote their own materials andwork methods.Any specialist activating in this field is obligedto demonstrate a profound respect for theaesthetic, historic and physical integrity of therestored object.Any investigation or treatment applied on ahistorical piece must be made within the limitsof the competency of the restorator.For each oeuvre that has a historical or artisticcharacteristic the specialist must use the highestand most exact standard of treatment. Certainopportune treatments will be preferred toothers, any other type of treatment that isconsidered unfit for the conservation orrestoration of the piece being damaging.The materials used for restoring the monumentswill have the quality of being reversible, so thattheir potential removal in the future won’taffect the physical integrity of the restoredobject. The changes brought though the worksof restoration must be made to the step that theoriginal object remains recognizable.This creates a limitation of aestheticallyreintegration.The quality of the restorer’s labour is given byhis capacity to keep up with the latestdevelopments of the technology involved inthis field. For this, the specialist is forced to

consult the scientific novelties and develop hisaptitudes so that he can offer the best treatmentin a diverse range of situations.The responsible restorer has the obligation tocoordinate the activity of the auxiliarypersonnel, so that the protection and integrityof the cultural good is assured. A series ofactions which might degrade the site over timeare forbidden. Such actions include theexecution of alleys with paved concrete, anyattempts to mask the lower part of thebuildings, painting with synthetic substances orreplacing covers. It is also forbidden to plantany large scale trees at less than 15m from themonument or the execution of burials at adistance that’s less than 6m from the churchwalls. Depositing, even temporary, of chemicalsubstances or flammable products, solvents orother dangerous substances inside or near themonument are sanctioned according to the locallaws (Legea 41/1995; Legea 50/1991; Legea10/1995).Neither is depositing of construction materials,utilitary materials or household items near ofinside the monument allowed. The change ofusage for the historical monument, digging,erecting new edifices without specialistarcheological assistance or executingconstructions for new buildings in thefunctional area or the protection area of themonument also enters under the rule of law(Legea 11/1994).RESULTS AND DISCUSSIONSFor the professional approach of the restorationprocess for historical gardens and parks, thespecialist must also have knowledge of theCultural heritage, the Natural Heritage andimplicitly the Historical garden, how thehistorical monument classification works, andwhich are the main characteristics needed foran edifice to be declared a historicalmonument.Another important issue to be aware of is thejuristic regime of the monuments, what is thereare of protection and what the protected area iscomprised of, as well as the interventions thatare permitted on a historical monument.The Venetian Carta (1964) gave a widerinterpretation to the notion of “historicmonument”, introducing new concepts as“historic ensemble”, “monumental center”,324“urban reservation”, “area of cultural andnatural protection” etc.So, the notion of “historic monument”encompasses the isolated architectural creation,the urban and rural settlement, as well as thedomains that surround it, parks and gardens,which, together, bring the testimony of acivilization representative of a historical period.Any historical monument has available, fromits setup in the territory, a protective space,which gives its individuality among thesurrounding edifices.Figure 5. Creation of a protection zone for monuments ina rural areaThe specific protection areas (establishedthrough the urbanism documentations approvedby the Historical Monuments Committee), theartistically components of the areas, thecomprising elements of the area and the interiorand exterior furnishing elements, as they aredefined by the application set of rules, areconsidered part of the historical monument.The research regarding the inventory of thelandscape heritage is an indispensable step inthe restoration study, as picturing the currentpicture can establish the necessity and theurgency of the conservation and restorationinterventions.In this context, every historical monument mustdispose of an inventory of its composingelements (done by the owner or theadministrator).This inventory is made up of:

-constructions – buildings with main functions,household side buildings, property walls,towers, living spaces, religious edifices, altarsetc.;-exterior arrangements – access roads, stairs,walk paths, roads, parks, plantations, basins,statues, lakes, exterior installations, fences;-other elements – graveyards, archeologicalelements;-mobile cultural goods;This data is gathered in the Analytic paper ofthe monument, which also includes detailsregarding the official denomination, address,short description, date of construction, historyand state of conservation, sketches and photosof the property, juristic regime, cadastralsurvey, urbanistic reglementations, buildingfounder, prior restoration workings.To be able to make an objective decisionregarding the restoration or revitalization of ahistorical monument, we must know its origin,the influences that determined the choice for acertain style of architecture, the factors thatcontributed to its changes over time. Aprofessional approach of restoration must leadto the establishment of the global value of thehistoric monument and to planning theinterventions that must be done, depending ofthe degree of vulnerability and the historic andaesthetically importance of the composingelements.CONCLUSIONSThe existence of many gardens in Romania,which, even though appear on the List ofhistorical monuments, are little or not known atall, some in state of forgetfulness, pray tonatural or anthropic degradation, somearranged through interventions unfit for theirinitial value, constitute a compelling argumentfor the professional approach of the process ofrestoration.,,… Through restoration we understand anyintervention aimed to bring to its efficiency aproduct of human activity” (Brandi C., 1996).Figure 6. The ruins of the Cantacuzino palace fromFloreti, jud. Prahova, foto 2007 (Dobrescu E.)Figure 7. The Istrate Micescu mansion from Miceti –jud. Arge (Ion N.D., 2008)Sadly, we can observe that in the veryimportant publication that catalogues historicalgardens in the world, The Oxford Companiontogardens 2, Romania is only mentioned a fewtimes, for the Golescu family and baronBruckental from Avrig gardens (page 475-476),the Brâncui sculptural site from Tg.Jiu,informations offered by Maria Golescu in theXX century. In the same volume, Bulgaria hasa 2,5 page synthesis, Hungary around 2 pages(Oxford Companion to Gardens, 1986).In order to be considered a piece of art, thegarden must benefit from objective recognition,it must recreate the artistic sensation every timeit’s visited, it must represent beauty by itself,like a painting, it must allow for “the play ofimagination in contemplation”.Any intervention done to work of art dependson this recognition by its state: “a work of art,no matter how old or classic it is, actuallycomes into being and not only for the potentialas a work of art, when it lives in a certainindividualistic experience” (Dewey, 1951).325

,,The restoration is the methodologic momentof recognition of the work on art in its physicalconsistency and in its double aesthetic polarity,that aims to transfer it in the future.” (BrandiC., 1996)In the case of gardens which do not have ahistorical documentation which can certify theinitial image of the monument beforerestoration, it can come to interpreting datafrom similar monuments from the same periodor to an innovative or eclectic approach to theprocess. In this case valuable elements from ahistorical point of view are kept and newfunctions can be introduced according to theneccesities of the space utilization.The newly introduced functions must take intoaccount the original atmosphere of themonument without altering the image as awhole.The analysis criteria are utilized when reachinga diagnostic and constructing a plan ofrestoration, as a revival, as a reconstitution ofthe authenticity of the work of art:,,Restoration,as an actualization of the work of art, isincluded in this filtration and accumulation ofdata; so it is natural to identify two stages: first,of reconstitution of the authentic text, second,of intervention upon the matter that makes upthe piece” (Brandi C., 1996).The insufficient preoccupation in the domain ofrestoration and revitalization of landscapemonuments, the lack of specialty studies anddocuments of evidence, which may bring intothe attention of the Culture and Cults Ministrythe imperative of restoration based on scientificbasis of historical parks and gardens, is themain argument for getting back the cultural andhistorical identity. Currently, in the archives ofthe Culture and Cults Ministry as well as theachives of the Town Halls that act as owners ofthe landscape monuments, there are nocomplete documents that present a clear and upto date inventory and also a timeline of priorrestoration work.All of these recordings, previous to theprofessional restoration process, must make upthe primary data base which will enable aqualified approach in restoring the importantlandscape monuments from RomaniaREFERENCESLegea nr. 451 din 8 iulie 2002 pentru ratificareaConveniei europene a peisajului, adoptat laFlorena la 20 octombrie 2000 (L451/2002). Lawno.451 from 8 th of April 2002 for the ratification ofthe European Convetion on Landscape, adopted inFlorence at 20 October 2000L 41/1995; L 56/1998: L 5/2000; L 182/2000 The mainnormative acts with incidence in the domain ofhistorical monuments.Dosar restaurare parc Palat Mogooaia, 2000; ParcKiseleff, Parc Herstru. Restoration file PalatMogooaia park, 2000. Park Kiseleff, Park Herstru.Ion N.D., 2008. Reedine i familii aristocrate dinRomânia , Ed. Institutul Cultural Român, p..308.Carta de la Florena, 1982.Chiliman A., 2000. Dosar restuarare, Fotografie deepoc, Arhiva personala.Dobrescu E., Teza de doctorat. Studii privindrevitalizarea i restaurarea unor grdini din România,realizate în sec. XIX – XX, sub influena modelelorfrancez i Italian, p. 42.Codul eticii i standarde de practic în activitatea deconservare i restaurare. Institutul American pentruConservarea Operelor de art i cu caracter istoric(AIC), 1976.Legea 41/ 1995, Legea 50/ 1991, Legea 10/ 1995, Codpenal art. 217, 218, 219, Cod penal art. 360. Legeanr. 11/1994.Monumente Istorice. Manualul Administraiei PubliceLocale, p. 29.Dobrescu E., 2007. Teza de doctorat-Studii privindrevitalizarea i restaurarea unor grdini din România,realizate în sec. XIX – XX, sub influena modelelorfrancez i Italian, p. 19.The Oxford Companion to Gardens, 1986. OxfordUniversity Press, New york, p. 475-476,506, 541.Kant I., 2008. Critica facultii de judecare, Editura All,Bucuresti, p.159.Dewey J., 1951. Arte come esperienza, La nuova Italia,Firenzze, p. 130.Brandi C., 1996. Teoria restaurrii; trad. RuxandraBalaci, Ed. Meridiane, Bucureti, p. 33, 37, 81.326

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653SPONTANEOUS SPECIES WITH ORNAMENTAL POTENTIAL:ASTER OLEIFOLIUS (LAM.) WAGENITZ (I) - MORPHOLOGY,ECOLOGY, CHOROLOGYMihaela Ioana GEORGESCU, Ioana Marcela PDURE, Florin TOMA, Monica BADEA,Sorina PETRAAbstractUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Mrti Blvd.,District 1, 011464, Bucharest, RomaniaCorresponding author email: mihaelaigeorgescu@yahoo.comMorphological characters and environmental factors requirements for Aster oleifolius (Lam.) Wagenitz [syn. A. villosus(L.) Sch.Bip; Linosyris villosa (L.)DC.] (Asteraceae) are presented as arguments to introduce this species among theornamental plants. A chorology map, based on the original or collected data from different herbaria from Romania andreferences, gives the country spread of this species.Key words: Aster oleifolius, Asteraceae, morphology, ecology, chorology.INTRODUCTIONAster oleifolius (Lam.) Wagenitz [syn. A.villosus (L.) Sch.-Bip., non Thunb.; Galatellavillosa (L.) Rchb.f.; Linosyris villosa (L.) DC.;A. cinereus Korsh.; Chrysocoma villosa L.;Crinitaria villosa (L.) Grossh.; Conyzaoleifolia Lam.] from Asteraceae is a perennialherb, 13-35 cm, stem is ascending to erect,densely hairy, leaves alternate, simple, lanceolateto oblanceolate, 15-40cm/10mm; soonleafless and glabrous below, with oblanceolate,greish-white-tomentose leaves above. Capitulashortly pedunculate, narrowly infundibuliform,in dense corymbus. Involucral bracts is severalrows, subacute to subobtuse, long-ciliate, theouter tomentose, the inner somewhat lanate atthe apex; ligules absent; papus-hairs inequal(Merxmuller and Schreiber, 1976). A. oleifoliusis a xeric steppe species on calcareous soils (inthe nemoral areas and in the forest-steppe onlyon sunny steep clines) with continental Eurasiandistribution (Badarau, 2006).Some species of Aster L. are cultivated andsold in the horticultural trade. Some of thesespecies are widely distributed and have beenknown in cultivation for a long time. Due to thegeneral aspect of plant and the greish-white-tomentoseleaves above, A. oleifolius may be usedas ornamental plant with a longer floweringperiod between July-September, sometimes till327October (Figure 1). A. oleifolius has an excellentpotential as ornamental plant in gardens.Figure 1. The capitula and leaf morphology in Asteroleifolius (orig.)The species A. oleifolius was described byLinnaeus with syn. Chrysocoma villosa L. inLinnean Herbarium [S-LINN], in Sweden(http://linnaeus.nrm.se/botany/fbo/c/chrys/chryvil.html.en) (Figure 2).Figure 2. Chrysocoma villosa L. in Linnean Herbarium[Microfiche number: IDC 337.19]

MATERIALS AND METHODSThe chorology map and details of distributionof Aster oleifolius are based on collections fromHerbaria: BCHM, BRHM, BUAG, BVHU, CL,I, IASI, PLHM, SIB, SVHU (according codesto P.K. Holmgren from Index Herbariorum).The chorological map of A. oleifolius is basedon the cited sources above plus new recordsobtained during research, or different databases/ scientific publications where this species wasreferred. The chorological map of A. oleifoliusincluded in this work was made by taking inaccount the principles of the GEOCOD System(Oltean and Stefanut 2002), which ensures anexact localization of villages, communes andtowns where this species was found. The mainobjective of the present study is to documentthe geographic distribution of the A. oleifoliusspecies in Romania using Universal TransverseMercator (UTM) system. The chorological redpoints on the distribution map are representedby data from cited Herbaria and formercitations from literature, and original data fromthe field (Figure 7). The material used formorphological descriptions was collected fromAlah Bair Hill, Constanta County. The specieswas naturalized in “I. Todor” Botanical Garden,on Dobrodjan Colline in USAMV Bucharest(Figure 3).RESULTS AND DISCUSSIONSAster oleifolius is a calcareous species and thecoenotaxonomic framing of this newlyproposed vegetal subassociation is following:Cl. Puccinellio-Salicornietea Topa 1939, Ord.Puccinellietalia Soo 1940, Al. Puccinellionlimosae (Klika 1937) Wendelbg, 1943, 1950,As. Staticeto-Artemisietum santonicae Topa1939 and subass. asteretosum oleifolii subass.nova (Stefan et al., 2009) or As. Staticeto-Artemisietum monogynae (santonicum) Topa1939 (Lupascu et al, 2005)The species was collected from Alah Bair andtransplanted in “I. Todor” Botanical Garden foracclimatization and naturalization regarding themorphological and anatomical studies,cultivation aspects and interest forphytodiversity preservation (Figure 3).Figure 3. A. oleifolius on Dobrodjan Colline in “I.Todor” Botanical Garden, Bucharest (orig.)Aster oleifolius is xeric species with a raredistribution in Romania. The image presentedbellow (Figure 4) is a comparison between A.linosyris (left) and A. oleifolius (right).Though congeneric and sharing the samecharacter-the lack of the ligulae-the two speciesare not immediate and not even closely relatedin the context of the genus Aster. Thedifferences between the two, especially inconcerning the structure of the capitula(Badarau, 2006), leaf nervation and the colourof plants.Figure 4. Two species of Aster in Alba County (photoBadarau)The species is well-represented in Fantanita-Murfatlar, Basarabi (Constanta County). It ispreserved indirectly due to another rare speciesof Romania, like Nepeta parviflora, Paeoniaperegrina, P. tenuifolia, Adonis vernalis,Helianthemum salicifolium, Trigonellagladiata, Stipa lessingiana, Crocus pallasii,Euphorbia dobrogensis, Linum borzeanum,Buffonia tenuifolia, Aster oleifolius, Scutellariaorientalis (Figures 5 and 6).328

Figure 5. A. oleifolius in Fantanita-Murfatlar Reserve,Constanta County (Padure, 2005)Figure 6. A. oleifolius in Fantanita-Murfatlar Reserve,Constanta County (Pdure, 2005)The authors were made an important revisionof A. oleifolius herbal specimens from differentHerbaria (data sheets specimens) to realize apartial monographic study on genus A.oleifolius in Romania. We finally realized forthe first time a chorological map of this species.The partial chorological data are presented infollowing section:Alba County: Rosia de Secas [GS20](Badarau, 2006).Arad County: Sânmartin [ES24] (Merce,2011), Pilu [ES25] (Merce, 2011), Varasand(Merce, 2011), iclu [ES24] (Merce, 2011),Graniceri [ES25] (Merce, 2011), Socodor[ES35] (Merce, 2011).Bihor County: Cefa [ES59] (Merce, 2011).Botosani County: Râsca (I 29490) [NP10],Tataraseni (I 29491) [MP72], Botosani [MN78](Oprea, 2005; Nyárády and Morariu, 1964),Calarasi [NN17/27] (Oprea, 2005), ValeaBahluiului-V. Ilenii (Lupascu et al., 2005),Frumusica [MN96] (SVHU), tefanesti [NN19](Nyárády and Morariu, 1964).Braila County: Jirlau [NL10] (Merce, 2011).Buzau County: Râmnicu Sarat [NL02], Boldu(I 65546) (Nyárády and Morariu, 1964), Buzau329[MK89] (Oprea, 2005), Pâclele Mari andPâclele Mici (Merce, 2011), (BUAG 18412).Cluj County: Cluj [FS97/97] (Oprea, 2005),Agârbiciu [FS78] (Dragulescu, 2003), Sic[GS29] (Merce, 2011), Micesti (Nyárády andMorariu, 1964).Constanta County: Basarabi in Fantanita-Murfatlar Reserve (Figures 5 and 6) [PJ19](Padure, 2005) (CL 430995, CL432191), Agigea (Burduja et al., 1969;Burduja and Horeanu, 1970; Oprea, 2005;Nyárády and Morariu, 1964) [PJ28], Cheia[PK12] (BRHM), Medgidia (Nyárády andMorariu, 1964), Adamclisi (I 24298), Eforie[PJ37] (BCHM), Hagieni (CL 661984)(Cristurean and Ionescu–Teculescu, 1970;Ionescu-Teculescu and Cristurean, 1967),Capul Midia (Nyárády and Morariu, 1964) andGrindul Chituc, Baltagesti [NK92] on Alah-Bair Hill (Oprea, 2005), (Ciocârlan and Costea,1996), Horia [NK84] (BRHM), Dobrogea(Brandza, 1898), Coroana [PJ14] (Sârbu et al.,2009), Vama Veche [PJ24] (SIB), Techirghiol[PJ27] (PLHM), Vânatori [PJ25] (Sârbu et al.,2009), between Vasile Roaita and Eforie(BUAG 4770).Dolj County: Desa [PP65/66] (Merce, 2011).Galati County: Gârboavele (Mititelu et al.,1968; Nyárády and Morariu, 1964) (I 39100),Foltesti (I 39101) [NL86] (Nyárády andMorariu, 1964), Barbosi (I 39103) [NM74](Nyárády and Morariu, 1964), Galati (I 39104)[NL73] (Nyárády and Morariu, 1964), VasileRoaita [NL36] (BVHU), Radesti (I 55985)[NM60], Cuca (I 65545) [NL66], Sârbi [NL28](Oprea, 2005).Giurgiu County: Comana [MJ39] (Merce,2011; Nyárády and Morariu, 1964).Ialomita County: Slobozia (I 65547) [NK23],Amara [NK23/24] (Merce, 2011).Iasi County: Mârzesti (I 4809, I 76515, IASI3188, IASI 3191, IASI 3193, IASI 3194. IASI3196, CL 216511, CL 580006) (Nyárády andMorariu, 1964), Iasi (I 22637, I 22638, I 45308,I 58766) [NN41/41], Bratuleni (I 24297)[NN32] (Nyárády and Morariu, 1964), Hodora(I 24299) [NN04], Mânzatesti (I 24300, I24301) [NN52], Sorogari (I 24302) [NN42],Cotnari (I 60702) [MN94] (Nyárády andMorariu, 1964), Valea lui David (Stefan et al.,2008; Zamfirescu and Zamfirescu, 2008;

Merce, 2011; Zamfirescu, 2010) (IASI 3187, Cl216638), Rediu [NN02], (BUAG 20869), Cîrlig(IASI 3190, IASI 3192), (Stefan et al., 2009;Nyárády and Morariu, 1964), Aroneanu[NN42] (Nyárády and Morariu, 1964),Vânatori [NN84] (Nyárády and Morariu,1964), Cucuteni (I 24296) [MN93] (Nyárádyand Morariu, 1964), Brazu [NN32] (BUAG),ignasi [NN3] (Nyárády and Morariu, 1964),Fântânele [NN15] (Nyárády and Morariu,1964), Fântânele [NN15] (Nyárády and andMorariu, 1964), Focuri [NN15] (Nyárády andMorariu, 1964).Ilfov County: Lehliu (I 137312, I 137313)[MK82].Sibiu County: Sura Mare [KL78] (I 33186, CL27881, CL 86933), (Dragulescu, 2003),Micasasa [KM70] (CL 98798), (Dragulescu,2003), Seica Mare (Dragulescu, 2003) [KL79],Sibiu [KL 77/87] (Oprea, 2005), Rusi [KL79](Dragulescu, 2003), Slimnic [KL78](Dragulescu, 2003), Târnava [KM81](Dragulescu, 2003), Târnavioara (Dragulescu,2003).Suceava County: Radauti (I 39117, I 39118),(Tomescu and Chifu, 2009; Nyárády andMorariu, 1964; Tomescu, 2006), Boldu (I39119), Botosana [MN18/28] (Tomescu andChifu, 2009), Ciprian Porumbescu [MN27](Tomescu and Chifu, 2009).Tulcea County: Ciucurova [PK17] (Oprea,2005; Nyárády and Morariu, 1964), Sulina[QL10] (TMMJ), Greci [NL90] (CL 430994)(Marin and Cristurean: Flora din ParculNaional Munii Macinului,www.parcmacin.ro/c/document.library;Nyárády and Morariu, 1964), Macin [NL80](Oprea, 2005; Nyárády and Morariu, 1964),Babadag (Dihoru and Doni 1970), Sarighiol[PK25] (SVHU), Vasile Alecsandri [PK16](SVHU).Vaslui County: Sasova (I 69056) [NM49],Bolati (I 69062) [NM48], Ratesu Cuzei (I77552) [NM48], Bolati (I 77554), Todiereni(Oprea, 2005), Oltenesti [NM65] (SVHU).The chorogical map using GEOCODcoordinates of Aster oleifoius is presented inFigure 7.Figure 7. Chorological map of A. oleifolius in Romania using GEOCOD coordinates330

CONCLUSIONSAster oleifolius is a perennial herb growing infull-sun calcareous soils, drought resistant plant,sometimes on halomorphic soils in our country(see the map above). There are lots of referencesfrom different scientific publications,monographic studies and un-reviewed voucherspecimens from different Herbaria, which willbe study in the future. We are going to add newand interesting information about A. oleifoliuschorology in Romania. It is necessary to completeour partial study with investigations inother regions in Romania. We are going to proposeusing A. oleifolius as an ornamental plant ingardens due to: morphological aspects of stemand leaves (grey-tomentose, short habitus andperennial beauty), high resistance to drought, fullsungrowing and long term flowering species.ACKNOWLEDGEMENTSThe author warmly thanks to Dr. Sorin Stefanutfor his great help regarding chorological dataand chorology map, also to all curators fromthe mentioned Herbaria for use of Asteroleifolius data specimens and original photos ofHerbaria sheets to complete our chorologicaland morphological studies.REFERENCESBrandza D., 1898. Flora Dobrogei. Inst. De Arte GraficeCarol Gobl, Bucuresti, p. 223.Burduja C., Horeanu C., 1970. Contribution a la connaissancede la vegetation de la reserve de dunesmarines D’Agigea, Anal. St. Univ. Iasi, sect. II, tomXVI, fasc. 2.Burduja C., Volcinschi A., Horeanu C., Bîrca C., 1969.Proiect pentru organizarea floristico-fitogeografice aDobrogei pe teritoriul statiunii de cercetari marine,,I.Borcea” Agigea, Lucr. Stat. Cercet. Marine,, I.Borcea” III, p. 206-213.Chifu T., Stefan N., Manzu C., Zamfirescu S., 2006. Forestcommunities floristically specific to Eastern Romania,Nature Conservation, Environmental Science andEngineering, p. 169-180.Ciocârlan V., Costea M., 1996. Flora rezervatiei botanicedealul Alah-Bair (jud. Constanta). Acta Botanica1994-1995, p. 97-104.Cristurean I., Ionescu–Teculescu V., 1970. Asociatiivegetale din Rezervatia naturala Hagieni, Acta Bot.Horti Buc. 8, p. 245-279.Dihoru Gh., Donita N., 1970. Flora si vegetaia podisuluiBabadag. Edit. Acad. RSR, Bucuresti.Dragulescu C., 2003. Cormoflora judetului Sibiu. Edit.Pelecanus, 2003, Brasov, p. 344.Ionescu-Teculescu V., Cristurean I., 1967. Cercetari floristiceîn rezervatia naturala Padurea Hagieni, Ocrot.Nat. 11 (1), p. 25-36.Lehrer A. Z., Lehrer M., 1990. Cartografierea faunei siflorei României (Coordonate arealografice), Ed.Ceres, Bucuresti.Lupascu A., Anitei L.G., Niacsu L., 2005. Caracterizareaunor asociatii vegetale halofile din bazinul Bahlui pebaza indicilor ecologici, Factori si Procese Pedogeneticedin Zona Temperata, 4, p. 117-125.Merce O., 2011. Fisa de prezentare si strategia d econservarea habitatului 1530*-Mlastini si stepe saraturatepanonice. Contribuii Situl Natura 2000 ROSPA0015.Merxmuller H., Schreiber A., 1976. In Tutin T.G.,Heywood V.H., Burges N.A., Moore D.M., ValentineD.H., Walters S.M., Webb D.A., Flora Europaea, vol.IV, Cambridge Univ. Press, cambridge.Mititelu D., Gociu Z., Patrascu A., Gheorghiu V., 1968.Flora si vegetatia padurii-parc Gârboavele-Galati,Analele St. Ale Univ.,,Al. I. Cuza”, Biol. XIV: 163-173.Nyárády E.I., Morariu I., 1964. In: Savulescu T. et al.,Flora RPR, vol. IX. Edit. Academiei R.P. Române,1964, Bucuresti, p. 190-192.Oltean M., Stefanut S. 2002. Atlas Florae Romaniae,Proceed. Inst. Biol. IV, p. 101-108.Oprea A., 2005. Lista critica a plantelor vasculare dinRomânia. Edit. Univ. „A.I.Cuza”, Iasi, p. 357.Padure I. M., 2005. Cercetari monografice asupra speciilorgenului Nepeta L. în România, teza de doctorat,Universitatea din Bucuresti, Facultatea de Biologie,p. 377.Sârbu A., Sârbu I., Mihai D., 2009. Unprotected grasslandareas from Dobrogea of high botanical value.Contribuii botanice, XLIV, Gradina botanica„Alexandru Borza”, Cluj-Napoca, p. 67-75.Stefan N., Sârbu I., Oprea A., 2008. Phytocoenologicalcontributions to the vegetation of Moldavie (Romania).Rom J.Biol. – Plant Biol., 53 (1), p. 39-45.Stefan N., Sarbu I., Oprea A., 2009. Phytocoenologicalcontributions to the vegetation of Moldavia (Romania),Rom. J. Biol., Plant Biol. 53 (1), p. 39-45.Tomescu C.V., 2006. Diversitatea florei si vegetatieiecosistemelor naturale din bazinul râului Suceava,teza de doctorat, Universitatea „Al. I. Cuza” Iasi,Facultatea de Biologie.Tomescu C.V., Chifu T., 2009. The vascular flora fromSuceava river basin (Suceava county). Analele Univ.„Stefan cel Mare” Suceava, sect. Silvicultura, serienoua nr.1,2009, p. 67-75.Zamfirescu O., 2010. The analysis of the vascular floraof the nature reserve From Valea lui David (Iasi),Tom LVI, fasc. 2, s. II a. Biologie vegetala.Zamfirescu O., Zamfirescu S.R., 2008. Aspects regardingthe vegetation from the floristic reserve „The secularhayfields from Valea lui David”., J. of internationalresearch publication, Ecology and safety (2), p. 77-84.http://www.floraofromania.transsilvanica.net/flora%20of%20romania/AB/Copy%20%2813%29%20of%20species.htm (Badarau S. A., 2006)http://linnaeus.nrm.se/botany/fbo/c/chrys/chryvil.html.en- Chrysocoma villosa L. in Linnean herbarium (S-LINN).331

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653STUDY OF APPLYING DIFFERENT TREATMENTS ON CUTALSTROEMERIA AND THEIR INFLUENCE ON THE SHELF LIFESzidónia KOSZEGHI, Endre KENTELKYSapientia University Department of Horticulture, 1/C, Calea Sighisoarei, 540485, Târgu Mures,RomaniaAbstractCorresponding author email: szidoo@yahoo.comThe importance of cut flowers and flower arrangements vary according to the standard of living. If the standardincreases, the demand for beautiful, more expensive flower arrangements grows as well. At low standard of living, thecostumers give up on, or reduce the acquisition of flowers considered, in this particular case, a luxury. Thus it isessential to know how long the flower can be a decoration, for how many days it stays fresh and beautiful, because ittakes time to get the flowers from the grower to the shops and in our vase, which shortens their lifespan considerably.Another important aspect is the way in which we handle the flowers wilted during transportation and not recoveredeven after putting them into fresh water. What does salt, sugar or grandma’s copper penny have to do with?Objectives: The purpose of my thesis is the prolongation of the lifespan of the cut Alstroemeria. During our experimentwe’ll analyze the effect of some Hungarian and Dutch floral preservatives on the Alstroemeria. The results will then becompared while monitoring the life processes of the flowers in question.Key words: cut flowers, Alstroemeria, vase life, Bioplant, Chrysal, Oasis.INTRODUCTIONIt is vital to consider the prolongation of thelife of cut flowers when harvesting,transporting, storing, handling them in theflower shop, during work with flowerarrangements or even putting them in a vase inour home. For the prolongation of its vase life,it is essential to know the life conditions andthe life process relevant to the plant. Inorganicnutrients, water, light, air – carbon-dioxide andoxygen in particular – and the right temperatureare absolutely essential to the growth anddevelopment of the plant.The organic materials thus produced during thetransformation – assimilation-in the leaf, arepartly used for the plant structure, another partis dissolved during breathing and internalenergy producing, then eliminated (as water,oxygen, carbon-dioxide, ethylene, etc.), orstored. From our point of view the storedorganic materials are the most important(Szabó and Hegyi, 2005).As soon as the cut flower runs out of one of thetwo substances it starts to fade immediately.First the water is consumed. If put in water intime the flower uses its sugar supplies in orderto live (Schmidt, 2001).333We can assure the undisturbed life process ofthe cut flower by means of floral preservativesand salts (Klincsek, 1990).Basically any preservative should have thefollowing ingredients: nutrients (proteins,mainly simple sugars),disinfectants againstmicro-organisms, growth regulator substances,surface tension reducing substances (increaseswater absorption) (Schmidt, 2001).Lack of hygiene causes development of microorganismsleading to water turbidity and badsmell (The Beauty of Chrysal, 2009).MATERIALS AND METHODSThe experiment took place at the UniversitySapientia, the Faculty of Technical and HumanSciences in Târgu Mures in the laboratory ofornamental plants.Altroemeria aurantiaca „Virginia” was cut on30 th October 2011 and arrived from theNetherlands on November 4. Following thepreparation of the solution and the cut, we put10 threads in each vase. They faded onNovember 22, so the experiment lasted 19days.During the experiment we used three of thebest known solutions used for conservation,

control water and a solution developed by ownrecipes (sucrose and chlorine). The differentsolutions in the vases were carefully labeled.Floral preservatives used in the experiment:- Chrysal Clear Rosa-Dutch liquid product,- Chrysal Clear Lilium & Alstroemeria-Dutchgranular product,- Floralife Fresh Oasis-Dutch granularproduct-contains 94% sugar (dextrose),3,8% citric acid, 1,7% of different salts and0,5% preservation solution,- Bioplant-Hungarian product in granularform containing mineral salts anddisinfectant agents against decay.Content of the other two vases:- Sapientia-own recipe containing 50 ml ofchloride and 30 g of sugar- Control-tap water.The equipment used.1. Phyto-monitoring (PhyTech) system is amodern observation tool which recorded thefollowing data throughout the experiment: airhumidity (%) – Inp9 – RHS-2, airtemperature (C°) – Inp8 – AT1, temperature ofthe water in the vase (C°) – Inp7 – ST-22.We chose a leaf from each vase, put a plasticsensor on them for 9 minutes/day which helpedus measure the temperature of the leaf, so werecieved data in every 3 minutes for each givensolution. (C°) – Inp1 – LT1.We used the same procedure for measuring thequantity of water flowing through the strain:using a device attached to the strain wemeasured this quantity (units) Inp12 – SF-5.2. Digital caliper (Mitutoyo). Diametermeasurement was carried out daily with adigital caliper (Mitutoyo) taking into accountthe influence of preservatives (in mm) onblooming. In case of the hydrangea we choseone flower from each vase and measured 3flowers every day. From the Alstroemeria wemeasured one thread from each vase with allthe flowers on it (5 paces).3. Hansatech Fluorescence Monitoring System.Currently this is one of the most modernprocedures for real time monitoring which doesnot affect or destroy the plant; the procedurecan be applied on the plant in its naturalenvironment with a test-retest reliability withina short period of time and high sensitivitychanges in photosynthesis.334The method shows high sensitivity tofunctional changes of the photosynthetic deviceas well as how and where the different physicaland chemical factors act (Fodorpataki, 2010).We selected a leaf from each vase, applied theclips and allowed them to stay in dark for 15minutes. Meanwhile the process ofphotosynthesis in the selected samples stopped,they had become dark-adapted. After applyingthe measuring device on the clips we read thedata on the display.F o – minimal level of fluorescenceF m – temporary maximum fluorescenceF v /F m – maximum or potential quantumperformanceF s – steady state chloro-fluorescenceF m ’ – modulated maximum fluorescencePS II – actual or effective quantum performance4. GTH 2 device. These parameters weremeasured twice a day: in the morning at thebeginning of the program and in the afternoonat to end of it. We used the GTH 2 device,which makes it possible to measure the threeparameters simultaneously.5. Ciras 2 – Measuring stomatal conductance.Ciras 2 is a system which measures leaf gasexchange, evaporation (E) and stomatalconductance (GS).Evaporation is a phase transition from liquid togas (water vapors) usually occurring on thesurface. In case of the living organisms thisphenomenon is called evaporation, transpiration.A gas analyzer consists of a digitalmonitoring unit and a unit of measurement. Themost important part of the unit of measurementis a particle which can be sealed and measuresthe evaporation on the leaf surface. This part ofthe analyzer contains sensors which measuretemperature, humidity inside as well as photonflux density on the leaf surface (light intensity).So we chose an adequate leaf from each vase,placed the particle sensors on the leaf and readthe data on the display after the values werestabilized: E (Transpiration Rate) refers toevaporation, GS refers to stomata conductance(Fodorpataki, 2010).6. Video camera. Using the Sony Steady ShotCamera DCR VX 2000 PAL we could recorddaily, hour by hour the changes occurring inalstroemeria the data being processed later. Thevideo camera is an important part of the

experiment because it shows and illustrates theresults spectacularly.Measurement of water consumption. Each vasewas labeled indicating the type of preservativesused and also used a scale on the vase, so wecould see the daily water consumption. In orderto avoid evaporation respectively to reduceevaporation to the minimum we wrapped thevases in a double layer of foil.Leaf temperature was recorded and measuredby the Phyto-monitoring system. The values ofthe administrated solutions tend to be close. Airtemperature ranges from 22,5 – to 24,4°C andleaf temperature gradually approach airtemperature values.RESULTS AND DISCUSSIONSThe laboratory was monitored by the Phytomonitoringsystem and GTH 2, so the humidityof the laboratory varied between 13,5 – 46%.Water temperature shows a close correlationwith the values recorded in air, ranging from 22– 22,75°C. Leaf temperature started beinglower than the air temperature (0,5°C), butgradually increased towards the end along thewilting process.Figure 3. Water consumption dynamicsWe noticed an increased water consumption inthe case of the Alstroemeria as well, especiallywith Chrysal and Bioplant. Chrysal consumed2470 ml of water in 19 days, Bioplant 2290ml. Oasis consumed 1820 ml, Control 950 mland Sapientia 770 ml of water.Figure 1. Ambient conditions during the experimentFigure 4. Daily water consumptionFigure 2. Leaf temperature335We filled the vases on the first day of theexperiment, so we did not register any waterconsumption on that day. Bioplant was in thefirst place with a daily water consumption of30-250, the highest daily intake was recordedon the fourth day (250 ml). It is followed by

Chrysal where daily consumption ranges from110-225 ml. Control consumed between 30-150ml, Sapientia between 10-100 ml and Oasisbetween 20-150 ml of water. We noticed adramatic increase in water consumption in thelast day before wilting.By applying Games-Howell test we foundsignificant differences between Chrysal,Bioplant, Oasis and Control, Sapientia.prematurely. Bioplant had difficulties inblossoming but eventually did bloom.Figure 7. The potential quantum effect of the leafFigure 5. Water quantity in the stemThe water amount in the stem was measured bythe Phyto-monitoring system. Figure 5. refersto water quantity values and they showsignificant variations among the differentsolutions.Ratio Fv/Fm indicates the maximum degree ofuse of light in photosynthesis. Values below0,75 in this report indicate disturbances in theuse of light. The graphic shows that this ratioremains constant only in the case of Bioplantand Chrysal. On day 11 Control drops belowthis value, Oasis on the 12 th day and Sapientiaon the13 th .Games-Howell test shows significantdifferences between Chrysal, Bioplant andSapientia.Figure 8. Vitality indexFigure 6. Flower diameter measured in AlstroemeriaWe measured flower blooming on a daily basis.This procedure is to indicate the extent of andthe pace (speed) of blooming. In case ofChrysal and Oasis the flowers startedblossoming going through its every stage,Control on the other started the wilting processVitality index of the photosynthesis is theparameter most sensitive to variations inenvironmental factors. Photosynthetic devicesstop measuring when close to value 0 (zero).This happened on day 11 in the case of Control,then on day 15 in the case of Oasis, and on day17 in the case of Sapientia. Using the Games-Howell test we found significant differences336

among all the administrations, except for Oasisand Bioplant.Stomatal conductance indicates the operation ofthe stomata. Measurements were made by theCiras 2 system.Values are consistent with water consumptionand the values measured in the strain Bioplantsingles out in this respect followed by Oasisand Chrysal. Sapientia and Control show weakresults. After applying the Games-Howell testresults show major differences betweenChrysal, Bioplant and Oasis, respectively theControl and Sapientia solutions.CONCLUSIONSFigure 9. Basic fluorescenceBasic florescence shows the degree oforganization of the antennae pigments in thetilacoide membranes in the chloroplasts of theleaves and the degree of energy transferbetween the antennae. If there is a deficiency inthe energy assimilation, the plant tries tocompensate by the growth of rearrangingpigments antennae. The phenomenon wasevident in all three samples: Bioplant, Sapientiaand Oasis. Chrysal and Control showedbalanced behavior.From flowering point of view in the case of the,Alstroemeria we have reached the best resultswith the help of the Bioplant preservatives,closely followed by the Chrysal and then Oasis.The physiological aspect of the flowers in theBioplant treatment were better than that ofother flowers. At the end of the experimentthese flowers were still alive, so their vase lifegot 12 days longer. The Chrysal prolonged thevase life with 9 days, and the Oasis with 6days.Expenditures for the purchase of thesesolutions are worth all she money because theeffects are clearly visible. Compared to thecontrol, Bioplant and Chrysal solution havealmost doubled durability of cut flowers in avase.REFERENCESFigure 10. Stomatal conductanceFodorpataki L.,2010. Növényélettan és ökofiziológiailaboratóriumi gyakorlatok, UBB, Cluj Napoca.Horváth Zs., 2001. Virágkötészet. MezogazdaságiSzaktudás kiadó, Budapest.Klincsek P., 1990. Virágköto kalauz. Zrínyi Nyomdakiadó, Budapest.Szabó J., V.Hegyi I., 2005. Virágköto iskola. Mezogazdakiadó, Budapest.Schmidt G., 2001. Növényházi dísznövényektermesztése. Mezogazda kiadó, Budapest.The Beauty of Chrysal, 2009. CHRYSAL PremiumFlower care. SUM és TÁRSA KFT, Budapest.337

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653STUDY OF APPLYING DIFFERENT TREATMENTS ON CUT HYDRANGEAAND THEIR INFLUENCE ON THE SHELF LIFESzidónia KOSZEGHISapientia University Department of Horticulture, 1/C, Calea Sighioarei, 540485, Târgu Mure,RomaniaAbstractCorresponding author email: szidoo@yahoo.comFlowers have an important role in our lives. They have been part of our celebrations since the beginning of time. Beingassociated to many occasions and events, they express a range of feelings and atmosphere. Flowers give us joy, they fillus with a sense of peace and purity, and in time of sorrow they bring comfort and relief. Their beauty can light up ourdarkest days. Our ancestors used flowers as the symbol of fertility and renewal. Flowers can be given as a gift almostany time and to anyone. Most people, women in particular, have a special talent in choosing flowers and offering themas a gift. In any culture or civilization flowers have always been a comforting presence for mankind. Objectives: Thepurpose of my thesis is the prolongation of the lifespan of the cut Hydrangea. During our experiment we’ll analyze theeffect of some Hungarian and Dutch floral preservatives on the Hydrangeas. The results will then be compared, whilemonitoring the life processes of the flowers in question.Key words: cut flowers, Hydrangea, vase life, Bioplant, Chrysal, Oasis.INTRODUCTIONsurface tension reducing substances (increaseswater absorption) (Schmidt, 2001).The lifespan of the cut flowers is a geneticThe proper nutrient for cut flowers contains theendowment, a feature specific to the speciesfollowing: water softener, pH regulator, water(Horváth, 2001). Scientific knowledge offersabsorption increaser, nutrient (The Beauty ofthe possibility to prolong the lifespan of the cutChrysal, 2009).flower. We can assure the undisturbed lifeDifferent bacteria and fungi can quickly spreadprocess of the cut flower by means of floralin the water of cut flowers. The greatestpreservatives and salts (Klincsek, 1990).damage caused by them is the clogging of theBasically any preservative should have thewood tissue, but they also present other riskfollowing ingredients: nutrients (proteins,factors such as the production of toxins andmainly simple sugars), disinfectants againstethylene. Most disinfectant products on themicro-organisms, growth regulator substances,market contain 8-hydroxy (8-HQ) or its salts.surface tension reducing substances (increasesSilver salts have also a bactericidal effect.water absorption) (Schmidt, 2001).The features of silver thiosulphate (STS) areThe organic materials thus produced during themore favorable: it successfully prevents thetransformation – assimilation-in the leaf, areformation of ethylene and its bactericidal effectpartly used for the plant structure, another partoperates within the tissues. Of all theis dissolved during breathing and internal compounds, the most often used in floralenergy producing, then eliminated (as water, preservatives are organic acids (citric acid,oxygen, carbon-dioxide, ethylene, etc.), or ascorbic acid, tartaric acid). Citric acid reducesstored. From our point of view the stored the pH of water, improves water absorption andorganic materials are the most important(Szabó and Hegyi, 2005).Basically any preservative should have thereduce, the risk of clogging of wood tissue.Floral preservatives contain mineral salts, oftenin the form of KCl, NaCl, Ca (NO 3 ) 2 . Na andfollowing ingredients: nutrients (proteins, Cl have toxic effects on cells, therefore we usemainly simple sugars), disinfectants againstmicro-organisms, growth regulator substances,them only in low concentrations. Various metalsalts (Mg, Cu, Al) significantly improve cutflower longevity. The simplest preservative is a339

solution known as AKN. Content: potassiumammoniumsulfate, or alum (A), potassium (K)and sodium chloride, or table salt (N).Preparation: Dissolve in 1 l of water 0.8 g ofalum, 0.3 g of 40% potassium and 0.2 g tablesalt, add 10 to 15 g of sugar beet (Schmidt,2001).MATERIALS AND METHODSThe experiment took place at the UniversitySapientia, the Faculty of Technical and HumanSciences in Târgu Mures in the laboratory ofornamental plants.On 18 th May 2011 we received 14 pots ofHydrangea macrophylla from the localgreenhouse. On the same day we cut them.After preparing the solutions we put 7 of theflowers in each vase. They faded on June 2 nd ,so the experiment lasted 16 days.During the experiment we used three of thebest known solutions used for conservation,control water and a solution developed by ownrecipes (sucrose and chlorine). The differentsolutions in the vases were carefully labeled.Floral preservatives used in the experiment:-Chrysal Clear Rosa-Dutch liquid product,-Floralife Fresh Oasis-Dutch granular productcontains94% sugar (dextrose), 3,8% citric acid,1,7% of different salts and 0,5% preservationsolution,-Bioplant-Hungarian product in granular formcontaining mineral salts and disinfectant agentsagainst decay.Content of the other two vases:-Sapientia-own recipe containing 50 ml ofchloride and 30 g of sugar,-Control-tap water.The equipment used.1. Phyto-monitoring (PhyTech) system is amodern observation tool which recorded thefollowing data throughout the experiment: airhumidity (%) – Inp9 – RHS-2, air temperature(°C) – Inp8 – AT1, temperature of the water inthe vase (°C) – Inp7 – ST-22.We chose a leaf from each vase, put a plasticsensor on them for 9 minutes/day which helpedus measure the temperature of the leaf, so wereceived data in every 3 minutes for each givensolution. (°C) – Inp1 – LT1.We used the same procedure for measuring thequantity of water flowing through the strain:using a device attached to the strain wemeasured this quantity (units) Inp12 – SF-5.2. Digital caliper (Mitutoyo). Diametermeasurement was carried out daily with adigital caliper (Mitutoyo) taking into accountthe influence of preservatives (in mm) onblooming. We chose one flower from each vaseand measured 3 flowers every day.3. Hansatech Fluorescence Monitoring System.The induction of chloro-florescence signalsemitted depends on the vegetative state of theplant, so that gives information about theeffects of different environmental factors onplants (Fodorpataki, 2010).We selected a leaf from each vase, applied theclips and allowed them to stay in dark for 15minutes. Meanwhile the process ofphotosynthesis in the selected samples stopped,they had become dark-adapted.After applying the measuring device on theclips we read the data on the display:-F o – minimal level of fluorescence,-F m – temporary maximum fluorescence,-F v /F m – maximum or potential quantumperformance,-F s – steady state chloro-fluorescence,-F m ’ – modulated maximum fluorescence, PS II– actual or effective quantum performance.4. GTH 2 device. Carbon-dioxide, relativehumidity, temperature parameters weremeasured twice a day: in the morning at thebeginning of the program and in the afternoonat to end of it. We used the GTH 2 device,which makes it possible to measure the threeparameters simultaneously.5. Ciras 2-Measuring stomatal conductance is asystem which measures leaf gas exchange,evaporation (E) and stomatal conductance(GS). So we chose an adequate leaf from eachvase, placed the particle sensors on the leaf andread the data on the display after the valueswere stabilized: E (Transpiration Rate) refers toevaporation, GS refers to stomata conductance(Fodorpataki, 2010).6. Video camera. Using the Sony Steady ShotCamera DCR VX 2000 PAL we could recorddaily, hour by hour the changes occurring inHydrangea the data being processed later. Thevideo camera is an important part of theexperiment because it shows and illustrates theresults spectacularly.340

Measurement of water consumption. Each vasewas labeled indicating the type of preservativesused and also used a scale on the vase, so wecould see the daily water consumption. In orderto avoid evaporation respectively to reduceevaporation to the minimum, we wrapped thevases in a double layer of foil.RESULTS AND DISCUSSIONSHumidity in the lab was monitored by thePhyto-monitoring system and GTH 2, so itvaried between 43-52%. Water temperatureshowed a close correlation with the valuesrecorded in air, ranging from 22 to 25°C. Leaftemperature started as being lower than airtemperature (by 0,5 to 1,5°C), but graduallyincreased towards the end of the experiment aswithering set in.Leaf temperature was recorded and measuredby the Phyto-monitoring system. There seemsto be a similar tendency among the floralpreservatives applied. Nevertheless, we noticeddifferences in the order of wilting: first, on the9 th day sample Control took ambientaltemperature (21°C), then on the 12 th day sampleSapientia and on 13 th sample Oasis followed.Bioplant withers after 14 days. Only sampleChrysal maintains its beauty throughout theexperiment.Figure 3. Water consumption dynamicsFigure 1. Ambient conditions during the experimentThe highest water consumption was recorded inthe experiment especially with Chrysal whichconsumed 1680 ml of water in 16 days. Thenfollowed Sapientia and Control with aconsumption of 700 ml of water and finallyBioplant consumed 650 ml and Oasis 600 ml ofwater.Figure 2. Leaf temperatureFigure 4. Daily water consumption341

As shown in the figure, Chrysal is on the topwith the highest values indicating daily waterconsumption: from 80-150 ml. Using the SPSSstatistical program, the Games-Howell post hoctest showed that water consumptionsignificantly increased in case of Chrysal inrelation with the other solutions. The highestamount was recorded on the ninth day, when itwas 170 ml. Control consumed daily from 20to 100 ml of water, Sapientia between 30 to110 ml, Bioplant between 20-80 ml, and Oasisbetween 20-100 ml.Instead, those in Control and Sapientia had aslow opening.Figure 7. The potential quantum effect of the leafFigure 5. Water quantity in stemsIn this process there is a general tendencyamong the solutions applied and the order ofwilt: on the 9 th day-Control, on the 12 th day-Sapientia, then after on the 13 th day Bioplantand Oasis.The relation between Fv/Fm stands for themaximum degree of use of light inphotosynthesis. Values below 0,75 in thisreport indicate shortcomings in the use of light.The graphic shows that the quantity of lightused remains almost constant throughout theexperiment. Only values from sample Controldrop below the average on day 6. In this casethe Games-Howell test does not showsignificant differences between solutions.Figure 8. Vitality indexComparing Control with the other solutionsapplied we found that all of them have highervitality indices.Photosynthetic devices stop when the valuesFigure 6. Flower diameterare close to 0 (zero). So it happened on day 10in the case of Control, then on day 13 in theHydrangeas treated with Chrysal, Bioplant and case of Oasis, and on day 15 in the case ofOasis opened quicker and fully to 8-9 days. Bioplant and Sapientia. Using the Games-342

Howell test we did not find significant differencesbetween the administrations.Figure 9. Basic fluorescenceOn the 6 th day Control, on the 8 th Oasis, and onthe 10 th Bioplant values show a suddenincrease, then fall dramatically. It sensesdeficiency in energy assimilation, thus trying tocompensate by increasing the antennae pigmentorganization. Chrysal and Sapientia did notindicate such a deficiency. This time weapplied the SPSS Tukey test which revealed nodifferences between doses.Figure 10. Stomatal conductanceStomatal conductance indicates the way thestomata operate. Measurements were madeusing the Ciras 2 system. Values tend to beconsistent with water consumption and thevalues measured in the stem. Chrysal stands outin this respect, followed by Control, but thelatter gives up after the 9 th day. Bioplant alsoshows potential till day 13. Oasis lasts until day12. After applying the Games-Howell test theresults show major differences between thesolutions especially with Sapientia, howeverChrysal and Bioplant show similar results.CONCLUSIONSFrom flowering point of view in the case of the,Hydrangea we have reached the best resultswith the help of the Chrysal preservatives,closely followed by the Bioplant and thenOasis.The physiological aspect of the flowers in theChrysal treatment were better than that of otherflowers. At the end of the experiment theseflowers were still alive, so their vase life got 10days longer. The Bioplant prolonged the vaselife with 8 days, and the Oasis with 6 days.Expenditures for the purchase of thesesolutions are worth all she money because theeffects are clearly visible. Compared to thecontrol, Chrysal and Bioplant solution havealmost doubled durability of cut flowers in avase.REFERENCESFodorpataki L., 2010. Növényélettan és ökofiziológiailaboratóriumi gyakorlatok, UBB, Cluj Napoca.Horváth Zs., 2001. Virágkötészet. MezogazdaságiSzaktudás kiadó, Budapest.Klincsek P., 1990. Virágköto kalauz. Zrínyi Nyomdakiadó, Budapest.Szabó J., V.Hegyi I., 2005. Virágköto iskola. Mezogazdakiadó, Budapest.Schmidt G., 2001. Növényházi dísznövényektermesztése. Mezogazda kiadó, Budapest.The Beauty of Chrysal, 2009. CHRYSAL PremiumFlower care. SUM és TÁRSA KFT, Budapest.343

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653PLANNING A LOW COST LANDSCAPING STUDIO AS A CAREER STARTFOR YOUNG PROFESSIONALSAbstractAlexandru Paul LAZAR-BÂRAUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Marasti Blvd, District 1, 011464, Bucharest, RomaniaCorresponding author email: alexandru.lazarbara@gmail.comDespite the market opportunities, dramatically low ratios of the Romanian landscape architecture graduates choose tostart private businesses in their professional field. In an attempt to improve these facts, the present paper provides someof the start-up data required for any business plan. Following a brief market analysis there are identified the maindesign and counseling jobs that a small landscape studio should be able to perform. The personnel requirements, the ITinfrastructure (hardware and software) as well as miscellaneous equipment scheme are configured for minimum startupcosts. The medium financial indicator of the landscaping specialist work-hour is calculated after integrating theliquidation period of the studio assets at 1/3 of their usage expectancy and the general benefit ratio at 10%. Inconclusion, the landscape architecture students are advised to gather up the start-up sum for the rewarding businessthat they are preparing for.Key words: business management, landscape venture, residential landscaping, Romanian market, studio infrastructure.INTRODUCTIONwith consultancy services targeted at publicadministrators or public services contractorsThis paper addresses the landscape architecturethat might require landscape marketinggraduates that are looking to developexpertise (Russel, 2010), mainly forindependent careers in their area of expertise incommercial or political-aimed manipulationRomanian market context, in support of theirefficiency (Lazar-Bâra, 2011, 2012).business plan building effort (Stark, 2003).The mass group of the residential servicesRomanian landscaping market, 10 years afterconsumers consist of several market segmentsthe field professionalization start, still has(Thilmany, 2008) by demographic and culturaltogether the goods and the bads of the newfoundniches:considerations, but they share common lifestylefeatures and buying behaviour. They areFor landscape design, the customers are fewusually people between their 30’s to 50’s,but generally wealthy these days, as it was thesocially active, living in suburbs, stronglycase 10 years ago;connected with city life, travelling abroad on aThe landscape architecture and planningregular basis, having above average self-imagebranches target the public sector, but this isstandard, highly vulnerable to marketinghardly a feasible choice for a start-up venture,techniques but also relying on their friend’ssince abusive national regulations favour newcomersexclusion from public auctions; privateadvice, they would rather go for top advertisedproducts than investigate proposals based onenterprises occasionally require landscapequality assessments. Their culture concerningexpertise for marketing purposes, but occasionsenvironmental and landscape substance is notare few and inexperienced small firmsinvolvement are rarely accepted;above the general society’s level –Landscape restoration is a shallow niche tounsustainably low – while their formalpoint at, since historic gardens and parks are expectations concerning the gardens they payscarce in this country.for are high, since their landscape quality benchThis state of facts leaves the new businesses marks are built mostly on short exoticwith the small to medium sized residential escapades or based upon soft media’s visuallandscaping opportunities, extended at best marketing. They pay for landscape servicesrather for social image or property value345

improvement, since they rarely can appreciatethe intimate garden living.Unlike the case in western cultures, they arerarely willing to sacrifice personal comfort orchange lifestyle in support of social orenvironmental sustainability, since they rarelypay for anything that fails to provide immediatebenefits.Despite the narrow opportunities it offers thesedays to new-comers, landscaping marketgenerally follows social development, andRomania is slowly but steadily going westwith consumer behaviours’ changing under themodel’s pressure. In Sweden for example, theconcern for climate change is increasinglydetermining common people counteractingattitudes, up to lifestyle changes (van Borgstedeet al., 2013). It can be presumed this is also apredictable trend for Romania, just as it is rightto anticipate civic and social responsibilityincreases in the following decades.As a well organized western landscape marketreference, the USA case is well illustrated inthe book of Walter Rogers – The ProfessionalPractice of Landscape Architecture: a completeguide to starting and running your own firm.The national context presented in the bookshould a bench mark for many Europeancountries in terms of professional regulations,prospects, responsibility and revenue ascompared to the incomes in other professionalfields. In the USA, just as in the other oldlandscaping tradition countries, the privatesectorclients are more diverse than inRomania, ranging between private companies,NGO-s and individuals with various social andcultural backgrounds (Rogers, 2011). Thelandscape business usually don’t limit to these,approaching most of the areas that a landscapearchitect is prepared to cope with – accordingto Walter Rogers, in 2011 there were 12 maincategories: sustainability-targeted projects;international projects; community development– that used to be a niche in Romania until the2008 real estate market collapse; streetscapecontracts – also a declining market, but owingmostly to the EU financing changes (Lazar-Bâra, 2012); parks and leisure; privatebusinesses site developments; urban andregional planning – still unavailable to mostlandscape professionalsCompared to constructions, real estate,architecture or public services, this is a smallsector in economy considering the financial andhuman resource requirements, but the marketpotential on middle to long term perspective ishigh.MATERIALS AND METHODSIn order to plan a sustainable start kit for asmall residential landscaping studio, the paperwill rely on a synthetic market analysis –focusing on present state, but also depictingtendencies.Based on landscape practitioners’ empiricalobservations, the Romanian landscapeconsumer’s buying behaviour will be analyzedusing the SWOT framework (Russel, 2010)(Table 1).The market analysis shows several nichefeatures (Stark, 2003) : the low customer andsubject diversity define an easy targetablemarket for residential landscaping, withaccessible clients; the business growth potentialis only restricted by the national economicbackward state – while global perspectives arequite positive, considering the expertiserequirements to mitigate at least theenvironmental threats (Heinberg, 2011); thereis no established market leader and the waysare open to new comers.To sustainably approach this design andcounseling niche, the landscape architecturegraduate’s competencies should be solid in thefields of landscape composition, environmentalsciences, plants and planting design, buildingmaterials, garden history and design, visual andcomputer representations, project management,small business marketing and management.Further knowledge is required for theentrepreneur to be able to cut costs ontransportation, IT, legal and accountingservices to fulfill the client’s price expectation:driving license, building and ensuring basicmaintenance to the IT infrastructure, basicknowledge of market, environmental, buildingand urban development regulations, trademarkissues as well as basic accounting skills.346

MotivationsOfferprospectingCustomerbenchmarksBuyingdecisionTable 1. Buying behaviour of the Romanian single family residential landscaping customersStrengths (favouring quality /competition)Personal (species aestheticpreference / nostalgia);functional (sanity/ security/healthy food/ privacy)Internet; friends; garden fairsand cultural events; universityand professional bodyrecommendationsInstinct and logics (rare);local/ regional aestheticlandmarks; personalexperience; professionaladviceWeaknesses(unsustainable)Economic (propertyvalue investment);social status; fashion;keeping family busy athomeGlossy media andbooks; highway andmall advertising;contractor’s andreseller’srecommendationsTourism promotedlandscapes (exotic ornational); commercialbrochures andadvertising inducedreferences;miscellaneous adviceService reliability; personalAdvertising; graphicconnection; design coherence;quality of the designs;business portfolio – similardesign speed –tasks, on similarregardless the subjectsites; environmental, social,complexity; businessurban and culturalportfolio – publiccommitment; priceclients; lowest pricejustificationThe business plan for a starter – especially on aniche market – is not facultative (Stark, 2003).Written in a synthetic manner, it should containat least the following (Stark, 3003; Bangs Jr.,2005) : a market analysis – structure,competition, tendencies; marketing strategy –operable niches, business identity, pricing,promotion plan-client reaching, sales potential;a financial analysis – expenses/earning for oneyear, liabilities/assets’ values; a financialstrategy – collections, insurances and back-ups(fundamental for Romanian starters), cashflow,investments; a general business strategy;the technical operations’ planning – contractsand management, intellectual propertyprotection, licensure (for connected fields),project management and work flow, asset’smaintenance; human resource strategy – skills,tasks and responsibilities need and forecasts,labor costs, performance, team management.Specific to a small landscaping business is theflexibility requirement – since design officesshould capitalize on the larger projects’collaboration opportunities.347OpportunitiesWestern cultureoffensive; middle classprotection anddevelopment policiesForeign fairs and publiccompetitions; nationalmarket transparencyincreaseThreatsConsumerism; Generaland environmentalculture declineDecrease of foreignpressures toward theopening of the marketwould consecratelandscape formalismand mediocrityNational landscape Exotic holidayreferences – promoted for landscapes; foreigntourism support; foreign landscaping materialsreference aidsadvertisingContractor’sSite events (small preferences; joineddisasters, sanitary or commercial proposals ofphytopathological contractors andemergencies, various landscape architecturebuilding phases, offices; the businesses’occasional functional premises accessibility;peaks – weddings, seasonal preferencereceptions, new fauna etc) (usually on spring,before Easter)To build the minimum asset list needed in aresidential landscaping studio, the paperanalyses the firm tasks that require most of thebusinesses’ resources in Romanian context, asrequirement drivers:- Marketing: market identity – managementdecision followed by promotional material’sproduction; advertising and contactmaintenance – web page construction andmaintenance, paper and social mediapresence, public events presence – physicalpresence mobile assets (banners, roll-ups,kiosks and business fair stalls, mobilemultimedia assets); business headquarters(the design of the work spaces and of thereception areas, architectural signaling)- Landscape studio work (production) :documentation, base plan assembly,analysis, general proposal – blue-printproduction and client presentation material(Cantrell et al., 2010), opiniondocumentation and contractor required blueprints,product specifications and technicalmemorandums.

- Field work: documentation visits – sitemeasurements, picture taking / moviecapturing, soil and plant identificationand/or sample collection; client interviews –command outlines formulation, contractdiscussions, proposal blue-print discussions;set-up assistance – plan picketing / on-siteblue-print adaptation, input material qualitycontrol, subcontractor’s monitoring –irrigation (Smith et al., 2010), field workscoordination; field monitoring.To fulfill these tasks, the basic productivityassets are computers – hardware and softwareinfrastructure.A starting venture with the minimum personnelscheme should provide each of its employeesindependent working conditions to maximizeflexibility.The following IT asset categories wereidentified:1. Operating and security systems- Linux / Windows + antivirus2. Productivity tools (office)- Text processors, spreadsheet tools, slideshowediting3. Data and management tools- data base tools, encryption and cloudaccess4. Communication and multimedia tools5. Computer aided design (CAD) tools6. 2d graphics and interactive design tools7. 3d presentation tools8. Project management and field worksassistance tools.For each of these categories there wereanalyzed the possible options according to thefollowing criteria: price, real-lifeproductiveness (following empirical analysiscarried out on professional Romanianlandscape architects) and flexibility.RESULTS AND DISCUSSIONSThe work-hour cost estimations following theIT infrastructure analysis reveals that publiclicensesoftware solutions approach is moreefficient on the short term, but it lacksflexibility.Start-up investment estimation for the lowestbudget would basically approach the GNUlicensed software (GNU Operating System,2013), with minimum software investments forCAD and graphics stations:-The 1 st station: management, accounting,estimating, print server, business archive, backupGNULinux based Hardware – HP ProP3500 MT Sandy Bridge G550 2.6GHz 4GB500GB GMA HD Free Dos + Monitor HP 20inch W2072a: 1800 RON (price.ro, 2013)-The 2 nd station: CAD, graphic design, 3dpresentations, data storage Windows based-OS=650 RON, antivirus=400 RONHardware-HP Pro 6300 MT Intel Core i5-3570 3.4GHz4GB 500GB AMD Radeon HD 7450 1 GB:3500 RON (ibd.) + monitor LED DELLUltraSharp U2713HM 27 inch: 2500 RON(ibd.) Commercial licenses: Brics Cad Pro – allin one, v. 12: 600 euro; Corel Graphics SuiteX5: 180 RON (ibd.); 3d studio max: 3500 $;GNU licensed software: Open Office Suite,Dryad (Plant Generation Software packages,2013)-The 3 rd station: CAD, graphic design, datastorageGNU Linux basedHardware-HP Pro6300 MT Intel Core i5-3570 3.4GHz 4GB500GB AMD Radeon HD 7450 1 GB: 3500RON (ibd.) + monitor LED DELL UltraSharpU2713HM 27 inch: 2500 RON (ibd.) GNUsoftware: Open Office Suite, GimpetcCommercial licenses: Brics Cad Pro linux –all in one, v. 12: 600 euro-The 4 th station –mobile: field work CAD, graphic design, basic3d presentationsLinux based Hardware-LaptopAsus 17.3'' K73SD-TY047D Core i5 2450M2.5GHz 4GB 750GB GeForce GT 610M 1GB:2500 RON (price.ro, 2013) GNU software:Open Office Suite, Gimp etc Commerciallicenses: Brics Cad Pro linux – all in one, v. 12:600 euroConsidering the general lifetime of theequipment at 3 years and the desired liquidationat 1/3 of this time span, the IT investmentsshould ideally generate incomes to cover allbusiness investments in the first year. Thework-hour fee of a landscape studio couldtherefore be found using the following formula:(IT + I+X+W) / 2320-Where IT is the IT total investment –equivalent to ˜ 31000 RON in the present case-I represents current office expenses (rent,maintenance, utilities, consumables) -X standsfor unexpected expenses-W are the company’swage expenses-2320 represents the number ofwork hours for an employee in one year. To348

conclude the presented case, with known yearlyand unpredicted expenses of 18000 RON and 4people working – involving 24000 RON / yearwage expenses, the work-hour reference pricefor landscape architecture services referenceshould be 31.47 RON.Printing and presentationdocuments as well as transportation and fieldrelatedexpenses, just as documentation costswere not included. They should be countedseparately in the deals closed by the startingventure.Despite appearances, landscapingbusiness is tricky considering the complexity ofthe market features, the human and technicalissues, the home trade opacity and the hostilelegal and administrative environment. Previousexperience in the business that graduates areventuring into is a way of painlesslyanticipating the specific challenges, knowcompetition and build key-connections withpotential clients and promoters, lawyers,accountants, even bankers, publicadministration, potential partners, contractors,materials purveyors – especially plants andstone, potential employees, architects,engineers and various specialists. Branchexperience as employees before turning intoemployers is otherwise recommended invarious industries (King, 2005; Thilmany,2008), considering that cumulated bankruptcyrisks of small business start and that of theniche market approach.CONCLUSIONSThe shallow client profile diversity shows thedeep gap between the Romanian and thewestern landscape markets, and the long waythat lays ahead the new ventures.The complex professional grounding thatlandscaping students acquire in college mightbe considered excessive when the businesstarget is individual private landscaping – theprevalent employment niche – but it shouldprovide the graduates enough flexibilityto handle exceptional contracts thus ensuringbusiness’s sustainability (King, 2005; Stark,2003). Furthermore, the landscaping marketwill hopefully approach the western diversitysoon enough, which will make humanresources a major national issue.Landscaping studio infrastructure is the easiestissue, even for a small business. Businessconnections and basic experience are requiredto minimize start-up risks. Technicalcompetence and professional ethics are basicsustainability conditions.The work-hour reference price for landscapearchitecture services should stand as a guidemarkfor clients looking for a fair business.REFERENCES*** 2013. GNU Operating System.http://www.gnu.org/licenses/ (2013/02/28).*** 2013. Price.ro. http://www.price.ro (2013/02/28).*** 2013. Plant generation software packages.http://vterrain.org/Plants/Bangs Jr., D. H., 2005. Business Plans Made Easy.Entrepreneur Media Inc, USA, p. 83-174.van Borgstede C., Andersson M., Johnsson F., 2013.Public attitudes to climate change and carbonmitigation – Implications for energy-associatedbehaviours. Energy Policy (in press).Cantrell B., Michaels W., 2010. Digital Drawing forLandscape Architecture: Contemporary Techniquesand Tools for Digital Representation in Site Design.John Willey & Sons.Heinberg, R., 2011. The End of Growth. New SocietyPublishers. www.endofgrowth.com chapter 7: Lifeafter Growth.King, R., 2005. The Ugly Truth About Small Business:50 things that can go wrong and what you can doabout it. Sourcebooks, Illinois, p. 55-66.Lazar-Bâra A.P., 2011. Round-About by Cain Church.Cluj Napoca.Lazar-Bâra A.P., 2012. Landscaping for SocialManipulation. Warsaw.Lazar-Bâra, A.P., 2012. Landscaping the environmentalresponsibility – village parks and EU money.Craiova.Rogers W., 2011. The Professional Practice ofLandscape Architecture: a complete guide to startingand running your own firm. John Willey & Sons. P.53 – 148.Russel E., 2010. Fundamentals of Marketing. AvaPublishing, Lausanne, p. 140-143.Smith J.G., Hinze J., 2010. Construction Management.Subcontractor Scopes of Work. CRC Press, Taylor &Francis Group, Boca Raton, USA. p. 399-401.Stark J., 2003. Landscape Business Planning Guide.Cornell Cooperative Extension.http://dyson.cornell.eduThilmany D., 2008. What are Niche Markets? WhatAdvantages do they Offer? Colorado StateUniversity.349

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653AbstractPOLITICAL LANDSCAPES AND URBAN IDENTITY. BUCHAREST’SDEMOLITIONS AND WORLDWIDE CORRESPONDENCESAlexandru MEXI, Ioana TUDORAUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest,Landscape Architecture, Biodiversity and Ornamental Horticulture Department,59 Blvd. Mrti Blvd., 011464, Bucharest, RomaniaCorresponding author email: gomealx@yahoo.comA city is made up by its people and by its architectural, urban characteristics. Bucharest lost most of its centralhistorical sites during the last decade of communism. The shifts of paradigm of those days shift the entire history of acity, ripping away the historical, cultural and social center of a European capital. Even if the turnovers in Bucharestare never to be seen elsewhere in the world, the political decisions and expression that lead to a new urban landscapeconstruction have correspondences in many other cities of the world, most of them marked by a similar history, thustotalitarian systems. In order to better understand the scale of what J.B. Jackson called the Second Landscape, at itsmost extreme expression, our paper will present the effects of totalitarian political systems on various urban landscapein the modern period, comparing the scale of the communist demolitions in Bucharest and the corresponding urbantragedies in cities like Berlin, Rome, Paris, or Pyongyang. The study reveals similarities between cities like thosementioned earlier and Bucharest in terms of political construction of the urban landscape, the landscape as a politicaltool, the impact of these politics on historical cities and their “absorption” by the daily life landscape.In order tounderstand the scale of the tragedy and its consequences in the future it is important to look for examples similar to theone given and to search for answers that may solve the problems that the ruins of the late communism era left to thecapital-city of Romania. It is also important to understand how the daily spatial practices (de Certeau) are finallyengulfing and integrating the political landscape from the collective memory.Key words: demolitions, corresponding urban tragedies, ruins, turnovers, urban identity.INTRODUCTIONA city represents a series of layers of peoplethat lived there. All those layers broughtsignificant changes in the way the citytransformed over the years, but few of them leftscars as deep as the ones found in Bucharest.Many old tourist guides and historical albumsshow images of buildings or places that youwill never find today. Though they don’t existanymore, they are part of the city’s collectivememory. When the generation that has seenthose places in reality is gone, those pieces ofurban history will remain present only in booksand some filmed images, but they will cease tospeak to common city dwellers.The human memory associates feelings withplaces and this is why everyone remembers amoment and the place where it took place.However, if such places disappear, what is tohappen with both one’s memory and with theurban-collective memory?Ones of the most aggressive interventions onthe urban tissues were made in various capitalcitiesunder totalitarian political systems. In theframe of this article we will try to observesimilarities and regularities of these totalitarianlandscapes, the outmost expressions of the“Landscape Two”, not in terms of aestheticsand order but in terms of imposition on aspecific site (Jackson, 1984).We also try to further analyse these integrationof huge urban ruptures in the collective mentallandscapes and memory by daily practices,tactics and rhetoric (de Certeau M., 1990).MATERIALS AND METHODSThe research was conducted in the central areaof Bucharest, in the new “civic centre” of thecommunist era and within the places nearby. Aseries of short questionnaires are revealing thevariations in the collective memoryofBucharest dwellers and the manner ofcollective memory-erasing by time.351

Also, comparative studies, concerning othercapitals that submitted under totalitarianregimes and the modification in the urbanlandscapes imposed by political systems aswell as similarities and differences of spacescaleand style between these projects. Thestudy was based on a number of historicaldescriptions and plans, some in situobservations and other previous analysesconcerning the different cities.BUCHAREST’S DRAMAThe House of the Republic was the result of thefear that Ceauescu felt over the 1977earthquake, or so it is presented in the urbanmythology. Even if related to the 1977 andsubsequent studies on Bucharest, the project isa prolongation of the old – interwar period – forthe new Senate House on Dambovia River (theancient Senate Place). The development of theentire project during the time was exhaustivelypresented in an exhibition organized in 1991 atDalles Hall.As any other dictator, hoping to forever bepresent in history, he wanted to buildsomething monumental – a new political centrecapable of holding huge masses of people thathe could control. After a series of seismic andtopographic studies he decided to build his newcentre not on the Dambovia benches (as theold Senate was foreseen) but upwards, on thesafest ground of the capital – Arsenalului Hill,on the southern cornice of the river.The project, started with some modernist styleproposals for the Republic House, developed,with the willing participation of some of thearchitects involved in the project, towards ahuge urban-scale project as a new “civiccentre”. It has to be said that the “civic centre”idea is neither a communist one. As was largelydemonstrated by Radu Alexandru Rau thecivic centre originates in the American CityBeautiful Movement (Rau, 2012). Nor inRomania it was a communist idea. The firstcivic centres were proposed in the interwarperiod by architects or planners that studiedabroad, as Cincinat Sfinescu who studied inGermany. Sfinescu developed the idea of civiccentre and proposed a series of projects forBucharest, including the one on Senate Placeon Dambovia River (Figure 1 - Sfinescu,1932). The civic centre was not initially seen asa concentration of official buildings (as showedby part of the proposal for Bucharest or othercities realised by Sfinescu and others), butslowly evolved towards a civic centre as apolitical and administrative centre (Rau,2012).Figure 1. Sfinescu’s drawing about a separate locationfor the Senate Palace (Rau, 2012 p. 24)The evolution of the house of the People andthe Civic Centre during the 1980 es was of suchkind and scale that offered a good reason forCeauescu to demolish, in the most chaoticallymanner the most part of the city centre and toerase some of the most important andemblematic buildings and landmarks, countinglot of Bucharest’s old churches, the Mihai VodMonastery and the State Archives within it, theentire Unirii Place area – the very generatorcentre of the city and many others. Theeagerness of these demolishing was explainedby the awkward relation of the Dictator withthe city. As “simple peasant, NicolaeCeauescu admired and hated the capital. Thecity was overwhelming. Though he becameabsolute leader of Romania, he felt as astranger in Bucharest and worthless in the faceof the city, a city he felt somehow hostile. TheHouse of the Republic […] was his revengeand a fortress for him to hide against a city hecould not understand (Pandele, 2009).352

Demolitions are usually considered as normalacts, absolutely necessary in any urban society.They are the premises of new, modernisingurban and architectural development. AlthoughFrançoise Choay presents demolitions as anecessity, one must well analyse the situationbefore the demolishing being done. “On theother hand, following another type of logics,but of a similar violence, they [demolitions]never stopped destroying their own patrimony.They destroyed it considering it was of nofurther use, old, malfunctioning, no longer upto-date,lack progress, lack of comfort, and, inpositive terms – standing in the way ofmodernization.” (Choay, 2011)But in Bucharest’s case “many demolitionswere conducted without any project, based onlyon hand gestures made by The Great Leader.His gestures were firm and clear either nervousand panicked. Projects were made after thedemolitions, only to fill the empty spaces. Theirrole was to create a scenario – it did not matterwhat was left behind.” (Pandele, 2009)doesn’t give any sign of reweaving in the last20 years.What makes The House of the People and theCivic Centre the most dramatic project of theRomanian communist era is not just its out-ofscaledimension but also the different logicfrom what was done before. Up to the 1980 esthe entire city was already transformed by thecommunist regime. During the ‘50 es , in theStalinist period, the Soviet model didn’t createimpressive landscapes. Some new, relativelysmall neighbourhoods were built and the onlyemblematic building that was erected was theScnteia House (the centre or the communistpress – figure 3), a small LomonosovUniversity-like that somehow succeed tointegrate in the 19 th century urban framewithout any disruption.Figure 3. Scnteia House 1952–1957 (Google images)In the next two decades huge avenues andboulevards were built, thus creating an entirelynew urban landscape. But these interventionswere done mostly along the ancient urban axis,in the well-known plating manner or the hugenew assemblies were built on almost emptylands, so, hidden behind the new city, the old,historical one was still surviving even if in asomehow scattered way (Figure 4).Figure 2. The historical city and the area demolished inorder to build the House and Axis (Harhoiu, 1997, p.14)As a result of this “monumental bricolages” aquarter of the historical city disappeared andanother part of it rest mutilated (Figure 2). Ahuge urban fracture was thus created,separating the north form the south andgenerating a sort of “two cities in one” thatFigure 4. Griviei Avenue and Balta Alb Assembly(Locuinta urbana 1961-1964)So, the massive demolitions of the ‘80 esrepresented a shock, something that never been353

done before. Also the speed of the demolishingand mostly the lack of any urban logic (thatpreviously was quite clear) generated a sort ofparalyse and awe. We can consider the buildingof civic centre project like a Shock and Aweurban strategy, in the perfect logic of Blank isBeautiful („Shock and Awe are actions thatcreate fears, dangers, and destruction that areincomprehensible to the people at large...”Klein, 2007).worldwide correspondencesThough the Romanian communist demolitionsrepresent the biggest European urban dramasince the last world war, this is not unique, and,in the course of history, many large scale,dramatic demolitions took place in many othercountries and in all types of totalitarian politicalregimes. The study is to reveal, through thefollowing examples that, the urban-collectivememory was seriously affected not only inRomania, but also in other cities and countriesof the world.Haussmann’s ParisThe 19 th century Paris was almost completelytransformed, following the Napoleon III’sLondon-like dream and due to the prefectBaron Haussmann relentless works ofdemolition and reconstruction (Figure 5).Unlike Ceauescu’s demolitions, Haussmann’swere based on principles. All the buildings thatwere to disappear were carefully photographedand measured in detail in order not to beforgotten, while on the area of the new civiccentre, photographing was forbidden. Also,Haussmann had motives for his actions and hebegan his demolitions by founding specializedservices at first. Baron Haussmann became,from a destroyer a praised person. “AndHaussmann – without question, the greatestdestroyer of our capital, as, unlike the case thathe would have made a “historical centre” avantla lettre and a museum, there was no alternativeto this violence – he had to continue Paris asPhilippe-August, Charles V, Francis I, LouisXIV and their contemporaries done beforehim.” (Choay, 2011)Figure 5. Demolition of Butte des Moulins for Avenuede l“The city of lights inherited a medievalstructure, one that did not faced the needs ofthe 19 th century. Baron Haussmann proposed aseries of principles that were approved by themayors. He founded specialized services thatwere later used with success. Haussmann askedfor the measurement and the photographing ofthe buildings that were to be demolished. Hechose the best professionals of each domainand asked for the pragmatic solutions.”(Pandele, 2009)354Figure 6. The achievement of Boulevard Haussmann(www.gutenberg.org)As Françoise Choay presents it, Haussmann’sdemolitions are not singular in Paris. Theprevious debatable disencumbering worksdestroyed part of picturesque sceneries of thecity in order to reveal somemonuments. However, though FrancoiseChoay critics are well funded, the demolishedspaces were rebuilt in a most coherent way andthey contribute to the heritage of the urbanmemory, representing – back then and today –one of the most admired urban developmentmodels. Napoleon III’s vision, accomplished byHaussmann was such a success partly becausehe proposed a functional urban system, one thatstill works (figure 6). “Haussmann’s changesfind theirs most complete form in the publicsquares, gardens and parks that articulates the

old and the new parts of the city.” (Choay,2011)The success of Paris’s destruction andreconstruction is related to the respect due tomajor buildings of the city. Although thatHaussmann demolished some 4300 houses andmade major urban surgery, he called his criticsto name “even a single monument worthy ofinterest, one building precious for its arts,curious by its memories.” (apud Kostof, 2005).Today Paris is considered the most beautifulcity in the world and the old pre-19 th centurycity is almost completely forgotten. The entireurban culture of 19 th and beginning of 20 thcentury Paris replaced the past, creating thenew world-wide landmark and generatingentire new layers of urban memory. Andmostly, Paris proposed a new urban culture: apublic space, one thus integrating theoverwhelming Napoleon project in the city life.Rome – Antiquity and FascismIn a city as Rome almost any demolitionsupposes a destruction of history and heritage.“The reference western example is the one ofthe Constantine Basilica of St. Peter in Rome,the most precious monument of Christianity,demolished in the 16 th century by the will ofPope Leon the 10 th and Julius the 2 nd .” (Choay,2011)The example of the Basilica is not singular inRome. In the fascist regime of BenitoMussolini, he considers that the true heritage ofRome is its antic city form and structure.Obsessed by his idea that “Rome, will again,rule the world!” it was absolutely normal thathe would want to bring Rome to its empireglory. In order to do this, he had to bring backto surface the ancient city. All the relics couldnow be used as propaganda as well.Though he destroyed a large part of Rome andthus affected the collective-urban memory,ripping out memories and landmarks but alsoRenaissance or Baroque period monuments,Mussolini brought back into the public eye andmemory, the old urban tissue of Rome and didnot left behind an empty area (Figure 7).Figure 7. Via dei Fori Imperiali making (Google images)Somehow Il Duce cannot easily be condemned,at least not in its own time paradigm, for thoseactions because, in the logics of that period oftime, his actions were justified, and he didnothing else but brought to light what it wasseen as heritage by demolishing “unimportant”and “ordinary” buildings, also in order tohighlight Rome’s monuments, continuing,among others Michelangelo’s dreams of Spinadei Borghi (Figure 8). If monuments and sacredbuildings were to be considered the expressionof the past periods of history the commonhouses were profane, unimportant and almost“silent” documents so Mussolini states that:“The millennial monuments of our history mustloom gigantic in their necessary solitude”, avision well integrated in the generaliseddisencumbering acts all around the Europeanbig cities of the time (Kostof, 2005)Figure 8. Spina dei Borghi before demolitions (Googleimages)355On another hand it should be observed thatwhat was considered as the “liberation” of theantic area, in order to put forward monuments

as Marcellus theatre or Trajan forum wasdoubled by a real development of Rome as apolycentric city, with new avenues andneighbourhoods but without any strong destructurationof the urban organism. It is alsoimportant to mention that all these visions weredeveloped by a commission formed ofspecialists like Manfredi, Giovannoni,Piacentini, Gerola and others, thus guarantyingthe quality of the future city (Vasilescu, 2011).As a result, today’s Rome, a result of theconfrontation between Mussolini’s totalitarianvision and the Citta Eterna, gained its pastwhile forging its future, both of them melted inan emblematic, unitary image (Vasilescu,2011). Rome cannot be imagined anymorewithout its antic monuments and noisy Vespasrunning in-between.Berlin, post-war and post-wallBerlin is a city that, despite its dramatic history,has reborn and despite the destructions hefaced, he became a blooming city, one that isappreciated both by its inhabitants, and byforeigners. The city’s memory was seriouslyaffected, not only once but by several hugepolitical projects that changed it forever.1950, when he also estimated that he will winthe war (Figure 9). In the centre, partially overthe river Spree, an impressive dome wouldhave been built, and it would have been namedVolkshalle, that in an approximate translationmeans The House of the People. Themonumental building, measuring 290 metershigh would have made the Reichstag a toyhouse, and it would have been used by Hitler tohold his speeches in front of more than 180.000people.” (Bisky, 2006)The project was however seized in 1943 due toAlly bombings. Thus, Berlin escaped from the“architectural demolition” just in order to beerased by the heavily bombardments.Another wave of demolition was deployed, inEastern Berlin, during the communist regime.The emblematic Berlin – Alexanderplatz(transformed in an international symbol byAlfred Döblin’s novel and mostly byRainerWerner Fassbinder’s film) was one of the mostswarming and fashionable urban spaces of the19 th century Berlin (Figure 10). The day-life,around the Hermann Teitz commercial centre,and the night life, around the restaurants andbars, was equalled only by the Potsdamer Platz(another space that was wiped off and replacedwith a sort of mall-complex).Figure 9. The Albert Speer Plan" - HitlerOne of the most important reconstructionprojects for Berlin, in order to transform it in asymbol of power, was lead by Hitler, togetherwith his “personal architect” Albert Speer.Hitler wanted the destruction of a vast part ofthe historical Berlin in order to build his centre.“Hitler never appreciated Berlin, he saw thecity as dirty and too liberal, and he wasdisgusted by the political orientation of itsinhabitants. In consequence, trough Speer, thefuehrer wanted to transform the capital in hisvision and he estimated that he will finish by356Figure 10. Alexanderplatz in 1906, foto: Max MissmannDuring the 1960 es Alexanderplatz was rebuilt inthe new, modern but socialist-realist style. Thusit was transformed in a huge – out of scale –pedestrian area, seen by the communist regimeas the new, modern, ideologically adapted cityheart (Figure 11).After the unification a new reconfiguration ofthe space was proposed. Some skyscrapers arestill waiting for the construction while a new

commercial centre was built, knowingly anelectronics megastore (Figure 12).Figure 11. Berlin-Mitte, Alexanderplatz, 1966, Dick-Foto-VerlagFigure 12. Berlin-Mitte, Alexanderplatz, 2006http://www.stadtentwicklung.berlin.deAt the other end of the former East-Berlincentre a new step in the city’s demolishing tookplace: the intensively debated destruction of thePalast der Republik, the communist parliament(Figure 13).for the communist memory comprehension.And while we are just finishing this paperanother Berlin tragically demolition is takingplace: the Berlin wall, the historical, collectivecity-scar is removed in order to give place tocommercial, private “beautification”.But, despite the destructions, Berlin demonstratesan incomparable aptitude to integrate itsscars and transform them in new life-generatorplaces. Thus it still stays as the cultural capitalof 21th century Europe.Moscow and the stylistic indecisionsIn “Project Russia – Architecture after communism”we found a very interesting, althoughexaggerated, quote that describes most of theRussian cities as being totally synonym withsoviet or communist cities: “Russian city =soviet city. There are huge differences betweenRussian cities and European cities. ExceptingSankt Petersburg, the Russian cities of the 19 thcentury were mostly made out of woodenhouses and only a handful of houses, governmentbuildings, churches and monasteries weremade out of stone. This meant that, in time,very few traces of the past will survive, even incities with a history of over a thousand yearsold. But while communism first appeared inRussia before entering Europe, so did the industrializationbegan in Europe and thenextended to Russia. During the civil war, whilethe middle class stated in Central Europe, Russiawas evolving in the form of dictatorial proletarian.This means that the industrializationprocess in Russia took place exclusively duringthe soviet regime. The Russian city is thus thesoviet city.” (Goldhoorn, 2002)Figure 13. Palast der Republik last traces(Google images)This late demolition raised huge protest of theyounger and older generations that were asking357Figure 14. Development plans for Moscow proposed byLe Corbusier and E. May (Quilici, 1976, p. 269)Moscow development, much older than thecommunist era, was marked, during the totalita-

ian regime, by huge contradictions betweentwo main trends in architecture and planning.On one hand the raise of the Soviet Union wasmarked by the modernist avant-garde, onanother, retrograde visions were seeking formore monumental expressions, paradoxicallyinspired by the European classic architecture(Figures 14, 15).In 1931 the Direction of the Office for MoscowPlan created the Project Brigades in order todefine the future development plans for thecity. Three of the Brigades were formatted byforeigner technicians (E. May, H.Meyer and K.Meyer) but the rest of them were soviet associations.The projects were considered insufficientlyadapted to the Party’s directives beingnot-realistically or not enough revolutionary(figure 14), mostly May’s project that tried tokeep the central historical structure of the city(Quilici, 1976).In the same time classicising forms of urbanspaces were chosen to express the new Sovietpower and the Red Square (Figure 15) becamethe prime model of the Socialist square.for the party members would have been tallerthan the Empire State Building and it wouldhave had a statue of Lenin on top. Only thestatue was taller than the Statue of Liberty.Figure 16. Proposals for the Soviet Palace - the wining,Jofan’s project proposed a 50-70m tall Lenin statue in thetop of the building (Quilici, 1976, pp. 258-259)The most impressive classic architecture wasalso used for the Moscow subway while theentire city was wiped off in order to make placeto huge neighbourhoods and huge officialbuildings (Figure 18).Figure 15. Red Square plan - 1932 (Quilici, 1976, p. 265)At architecture abject level the same strugglebetween modernist and classicist form is to beobserved. While some of the architects wereseeking for simple, modern forms, notbelonging to any passed times; the politicians,as Šusev did in 1933, were asking for moreclassicising forms as “indicated solution, bettersolution for the form and the idea, solution thatexpress the ideology in the most adapted form”(apud Quilici, 1976)Stalin wanted, alike Ceauescu, to create megastructures. He decided to destroy the Cathedralof Jesus the Saviour, in order to build a futureadministrative and political centre of thecountry - the “House of the People” or the“House of the Soviets”. The House of thePeople was never realized. This incredible hostFigure 17. Komsomolskaya station, New Arbat Street,Lomonosov University (Google images)But the new, capitalist Moscow, even if is stillfacing totalitarian politics, became one of themost dynamic cities of the world and now tries,with the help of Jan Gehl’s methods, to rehumaniseits gigantic scaled spaces.Beijing and the Chinese urban landscapeBeijing, the last imperial capital of China is acity with a fascinating history. However, thecity went through a series of successive wavesof demolitions and reconstructions. With theproclamation of The Democratic Republic ofChina in 1949, the city suffers numerousmutilations that can be even seen today. One ofthe most controversial destructions was of theLegation historical district (1856) and ofseveral nearby districts in order to re-plan the358

huge square Tiananmen. In order to transformThe Tiananmen square event the Gate of Chinawas demolished in order to enlarge the plaza(and afterward replaced by the Mao’smausoleum in 1976). During the 50es theexpansion of the place continued, followingMao Zedong’s vision who wanted to makeplace for huge and enthusiastic popular manifestationof some half of million people. Newsymbols are scattered around the place as theMonument of the People’s Heroes, the GreatHall of People or the National Museum ofChina. “In 1958-1959, the square was expandedfrom 29 to 98 acres (11 to 40 hectares). Thegreat Hall of the People occupied the west side,a building one quarter of a mile (400 m.) long;the Historical Museum occupied the east side.The Monument of the People’s Heroes is nowovershadowed by Mao’s tomb.” (Kostof, 2005).Figure 18. Tiananmen Square (Google images)After Mao’s death the plaza was furtherenlarged in order to gain a perfect shape butalso to increase the number of publicmanifestations participants. Thus Tiananmenbecame the absolute symbol of the communistpower, practically erasing the hole (glorious)Chinese (un-communist) past and staying as avainglorious, overwhelming space (Figure 19).Tiananmen Square is not a singular example; itis known that Beijing is facing a series offrequent demolitions of historical buildings andneighbourhoods in order to make room forunrealistic constructions such as highways,huge block of flats, office buildings and malls.Just these new demolitions are not made in thename of the communist ideology but in thename of the new development toward anoriginal social-democracy (Figure 20).359Figure 19. Beijing demolitions (Google images)In an article by Octavian Ciupitu in CurierulRomnesc, the author asks: “who will benefitfrom all those concrete and glass structures thatseem to continuously rise from the earth. Attheir feet, you can still be able to see remains ofthe old city, now on the edge of extinction.”(Ciupitu, 2006)Somehow Beijing succeed in illustrating anapparent “harmless” political system and to putcapitalism (in its wilder but, paradoxically,extremely state-controlled form) in the list ofpolitical systems that are mutilating cities andhistory in order to express its own power.Chaotic demolitions occur in all Chinese cities;traditions and culture are lost in the new urbanlandscape. The population thus loses its identitiesand landmarks. Françoise Choay askes herselfif these new cities, without a past will theyever became cities? “They rather risk ending upat the museum under the 20 th century heritagelabel to illustrate a moment of decisive rupture,although no responsibility was assumed, withthe urban tradition. […] For the urban, today solargely used, is no longer something more thana place in a state of general confusion, waitingfor the “post-urban” term, yet absent from thedictionary to take its place and be recognized.”(Choay, 2011)The new Beijing, still growing fastly, alreadyshows its failures but it is also developing newsocial and environmental politics. It is sodifficult to say now how its public space will belived in the comming years. Today it’s publiclife still rest confined in the old, traditionalneighbourhoods, but new landscape and urbandesign projects are indicating another possiblefuture for the city.

Pyongyang, the hidden cityThe capital of the North Korean Republic is acity that suffered a series of important destructionsand a city that has lost its past in favour ofits present, a past that was abandoned by the nowadayssociety. The city was seriously damagedduring the Korean War, being estimated that90% of the city was destroyed (Joinau, 2012).From this point of view the new establishedregime found the urban past already obliterated.Following the new monumental axis aredeveloped – the Yonggwang and Sungri avenuesare connecting the historical centre withthe Moranbong hill, while the new Kim Il SungSquare is built to became the political centreand emblem of the city (Figure 22).During the 1950-60es the rebuilding of Pyongyangwas mostly focused on new monumentalplazas and official buildings while the wholecity was forming from little shacks scatteredalong the avenues.Figure 20. The Triumph Arch in Moranbong Place(Google images)The civic centre model seems to be used by theKorean architect. Moranbong hill (legendaryplace of the city) became the favourite site formost of the new, emblematic buildings: the firstHistory Museum, Kim Il Sung University,Liberation Tower, the Moranbong Theatre, theKim Il Sung Stadium and the Triumph Arch(Figure 21).Figure 21. 22 Kim Il Sung Place, dominated by his hugestatue (Google images)360Figure 22. Pyongyang avenue and the reality behind(google images)Afterword new blocks of flats, or, it is said, justblock facades were built along the un-scaledlarge avenues, hiding the ever-unfinishedneighbourhoods, lacking streets or any otherpublic amenities (Figure 23). These huge avenuesplated with dull structures, specific tomost communist cities, cannot hide the improvisationand dummy-air of the buildings as“you don’t have to stand very close to buildingsto see that balconies, tiling, vertical and horizontaljoints often depart from the plumb-line.Interesting concave and convex patterns appearin prefabricated, hand-finished concrete walls.Windows panes have bubbles, bands, fish-eyeand bottle-glass effects. Spaces exist underdoors and their frames.” (Willoughby, 2008)This plating logic seems to be the inspirationfor Ceauescu’s dreams for Bucharest, or so itstays in our urban mythology. It is still believedthat Ceauescu’s visit, in 1971, was the triggerfor the further development of Romania,Bucharest as well as his own personality cult.necessarily successfully done neither. Amongthem the emblematic Ryugyong Hotel (Figure24), was erected between 1987 and 1992 whenthe financial difficulties put the construction ata halt. It was planned to be finished in 1989 and

to be the tallest building in the world, but whenit was finally done (on the outside), in 2012 butnow it is only the 47 th tallest one.Figure 23. Ryugyong Hotel (Google images)Meanwhile the city, as the entire countrystruggle with the famine, but Pyongyang ismaybe the outmost political landscape. AsPhilipp Meuser describes Pyongyang, the NorthKorean psycho regime’s capital, as “arguablythe world’s best-preserved open-air museum ofsocialist architecture” (Meuser, 2102)RESULTS AND DISCUSSIONSAs we stated in the previous chapters, cities allover the world have lost or have never had akind of urban memory. Either it’s about demolitions,reconstructions, wars or any other kindof events that triggered urban traumas, manycities have lost parts of their culture, traditionsand memory. “All cultures and all societieshave built and developed themselves throughdemolitions.” (Choay, 2011)But what are the similarities or the differencesof this destruction and rebuilding cycling acts?The most clear and common feature of all thisreconfiguration of historical cities in order tobecame political statements is the “bigness”.We don’t refer only the impressive dimensionsand richness in decoration of the buildings, butalso the inhuman scale of the urban spaces –plazas and avenues – that were created. Whatstays as the common tool for the totalitarianlandscapes is the presence of huge urban voids,conceived as parade spaces and calculated tocontain impressive parades and popular, moreor less enthusiastic, gatherings.361On another hand the obliteration of an “embarrassing”past was hidden under the newmonumentality. In order to create this new spacesthe old cities’ cores, layered expressions ofthe previous political periods and social values,were wiped out. It was not only imposing anew political landscape but also it was all abouterasing the old ones. It is like all the dictatorswere trying to stay as unique, solitary figures oftheir national histories. It was an entire historyrewriting in stone.Also it is quite similar that it was one person’svision that was imposed over the city. Eventhough sometimes specialists were consulted,the vision was clearly imposed by the politicalleader(s) and the technical advice was necessaryjust in order to find the best solutions forthat visions mise-en-place.What differ the political landscape is the architecturallanguage that was chosen in order toexpress the political new values. Even if we canfind a strong penchant for the classical expression,modernism was also part of the game.We can witness a subtle balance between theruptures with the past, sustained by the newarchitectural expressions, and the need ofhistorical quotations as legitimation tools. Alsothe classical architecture seem to be more fittedfor the monumental expressions while themodernist forms are staying insufficiently richin expression means and less sumptuous andimpressive. And impression is all it is about thepolitical landscapes. Out of this balance betweenmodernity and classic result the originality(or the lack of it) in the analysed urbantotalitarian landscapes. Also it is their historicaland aesthetical value. If Napoleon III’s urbanorder, the Russian modernist avant-garde andMussolini’s fascism have their unchallengedplaces in the architecture and arts history it isdifficult to imagine the Romanian, Chinese orKorean edifications entering the aestheticalhistory but as sort of freak expressions ofpolitical regimes, sort of power-story-tellersarchitectural Disneylands.Another difference to be noticed is the balancebetween monumental buildings erecting and themore social-oriented projects. Thus, inHaussmann’s project the rebuilding of Paristook in charge equally the monumentalbuildings, boulevards and places but the entirecoherence of the project was realised using

“ordinary” buildings as the general backgroundof the new political scenery. Mussolini’sprojects were more clearly separated – thecentre was the ground of the newmonumentality while the new, modernneighbourhoods, without lacking their ownmonumental places, were more peripheral. InRomanian and Korean case we can witness atime-splitting between monumental and regularbuildings. While Bucharest was submitted firstto a social revision as huge new residentialassemblies were built and while the outmostexpression of the communist era was also itslast project, in Korean case the timeline wasinversed. The social projects were started justafter the accomplishment of the new “sacredplaces” of the city.CONCLUSIONSBucharest case is neither new and neitherunique if we look at the destructions that itsuffered. On another hand some features ofthese destructions are strikingly different.On one hand is the further continuation ofdemolishing after the fall of the communistregime. If we could expect a revalorisation ofthe old city after 1990, this change ofperspective never came. The only noticeableact of promoting the past is the skin-deeprefurbish of the Lipscani area. But it was donejust in order to transform it in a tourists-trap, ahistorical Disneyland out-door mall that is notappealing neither to locals nor to foreigners.On another hand, even if we somehow acceptnow the House of the People, or at least theidea that it can’t be demolishes, but what canstrike one visiting the city is the incapacity ofreweaving it, of occupying and transform itsscars. It is like, behind the huge boulevards’facades, the time stopped. We are neither ableto recover the past of the city, as the harm doneis way too big, neither to integrate its presentand to recover the urban space.Though the city fascinated due to its particularculture, traditions and heritage, the modernproject (although heavily imposed by thecommunist era and strongly refused at thattime) still haunts Bucharest. It seems that weare not able to learn neither form our own, pastmistakes nor form the others’.After 20 years of democracy we still wanderwhat to do about the city, still expect for one’salone idea instead to try, as Germans did for anexample, to take the space in our own hands.The political projects are clearly orientedtowards further destructions and while we arefighting to save what is still standing we forgetabout our scares. As a result we risk facing, insome time, a totally mutilated city that we areno more able to cope with. Or, as it started tohappen, if we will let it go, the nature willsucceed to bring the life back in the forgottenfractured spaces. But nature is so “unmodern”...REFERENCESBisky J., 2006. Berlin-a profile, ed. Berlinei Zeitung,Berlin.De Certeau M., 1990. L’invention du quotidien, Vol.1.Arts de faire, Gallimard, Paris.Choay F., 2011, Pentru o antropologie a spaiului, ed.Biblioteca Urbanismul, Bucharest.Ciupitu O., 2006. Arhitectura veche din Beijing I,Curierul Romanesc.Goldhoorn B., 2002. Project Russia – architecture aftercommunism, ed. A-fond Publishers, Amsterdam.Harhoiu D., 1997. Bucureti, un ora între Orient iOccident, ed. Simetria, Bucharest.Jackson J.B., 1984. Discovering the VernacularLandscape, Yale University Press, New Haven.Joinau B., 2012. La Flèche et le Soleil. Topomythanalysede Pyongyang, Croisements 2 « Villeréelle, ville rêvée », Paris : Atelier des Cahiers p. 66-95.Klein N., 2007. The Shock Doctrine. The Rise ofDisaster Capitalism, Penguin Group, London, p. 3.Kostof S., 2005. The City Assembled, Thames & Hudson,New York.Meuser P, 2012. Architectural and Cultural Guide:Pyongyang, DOM Publishers, Berlin.Pandele A., 2009. Casa Poporului- Un sfrit înmarmur, ed. Compania, Bucharest.Quilici V., 1976. Cita russa e citta sovietica, GabrieleMazzorra editore, Milano.Rau R.A., 2012. Negotiating the Civic Center.Architects and Politicians in 20th Century Romania,Dissertation submitted in partial fulfillment of therequirements for the for the title of Doctor inEngineering at the Katholieke Universiteit LeuvenArenberg Doctoral School.Sfinescu C., 1932. Estetica Bucuretiului, (inUrbanismul 9-12/1932), Institutul de Arte GraficeBucovina, Bucharest.Vasilescu S., 2011. Arhitectura Italiei fasciste, ed.Arhitext Design, Bucharest.Willoughby R., 2008. North Korea 2 nd Bradt travelguide, The Globe Pequot Press Inc. Guilford,Connecticut.362

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653AbstractRESTAURATION OF THE ROMANIAN WRITER’SROTUNDA – CISMIGIU GARDENAlexandru MEXI, Maria BRATU, Violeta RDUCANUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Mrti Blvd., District 1, 011464, Bucharest, RomaniaCorresponding author email: gomealx@yahoo.comCismigiu Garden is a part of our national heritage and it is almost lost in favour of kitsch and ugliness. As aconsequence of the lack of experience and professionalism of interest and as well of public income, this garden becomesa shadow of its old glory.One of the most important architectural and landscaping compositions in Cismigiu HistoricalGarden is the Writers’ Rotunda. Focusing only on the Rotunda, the study was based on “in situ” research and onhistorical documents research. The study revealed a series of inconsistencies and discrepancies between historical textdescription and historical images as well. Also, our paper lead to showing different patterns on which the Rotunda wasdesigned and it also reveals patrimony objects that seemed to be lost.The aim of this case study is to emphasise theRotunda image created by FriedrichRebhun and how should it look like after a much-needed restoration. In order for acity that lost most of its history and patrimony, attention should be accorded to the built heritage including historicalgardens and parks and especially to their most important features. One of them is the Writer’s Rotunda.Key words: heritage, history, patterns, patrimony, restoration.INTRODUCTIONA city’s patrimony consists in buildings andmonuments, as well as in gardens and parks.One such part of Bucharest’s patrimony is theCismigiu Garden. Designed by Karl FriedrichWilhelm Meyer in 1845, the garden wasdesigned over an old puddle flooded frequentlyby the Dambovita River crossing Bucharest(Panoiu A., 2011). Cismigiu was a romanticgarden, designed according to the 19 th century’scitizens of Bucharest personal desires and wayof life. The garden went through a series ofsuccessive changes that brought new zones ofinterest in the garden. One such newly createdzone of interest is the Writer’s Rotunda. Thisrotunda is part of this garden’s history and alsoit is part of Bucharest patrimony. The actualstate of preservation of this part of history isvery low and special assistance is needed inorder for the Rotunda to be conserved in thefuture.MATERIALS AND METHODSThe research was led in the Romanian’sWriter’s Rotunda during a period of severalmonths, in seasons of autumn and winter.363Special attention was accorded to details,planning sequences, and to the grade ofdeterioration. Our study was based on historicaldescriptions, images and plans. Most of ourwork was to compare text descriptions withimages and plans because there were a lot ofinconsistencies and discrepancies betweenthem. The study reveals how the Rotunda wasmainly designed and how it should be restored.- Cismigiu Garden – Short HistoryCismigiu garden respresents, chronologically,the second public garden of Romania. Designedafter Karl Friedrich Wilhelm Meyer’s plans,Cismigiu garden was designed as a romanticgreen space, but it was also designed accordingto the desires and to the way of life of thecitizens of Bucharest of the XIXth century.The garden went through a series of successivechanges, the last of them being the mostimportant. This way, Cismigiu was redesignedby Wilhelm Knetchel in 1882-1883 and byFriedrich Rebhun in 1910-1943.Along with the new transformations, newlyadded zones contributed to the improvement ofthe garden, and, despite its low surface, itbecame a complex garden, all of the threestages of design bringing new valuable elementsto the garden.

- The Writer’s Rotunda“The construction of the Gheorghe Lazar highschool in 1890, meant that the main entrance tothe garden had to be moved on to the QueenElisabeth boulevard and it also meant giving upthe elm round-point. Those works preceded thedrastic redesign by the German architect,Friedrich Rebhun in the years 1899-1910, whena new, classical style, opposite to Meyer’sconcept was imposed. This transformation canbe seen in many of the garden’s subspaces(theroses terrace, the alley with pergolas, theRomanian Round). The decommissioning ofthe Music and the Semicircular pavilions meanta radical change of the aspect on the SchituMagureanu street side of the garden. Bycreating the Romanian Round and the nearbyspaces, easy terms of accessing those spacesand the garden as well, were created.” (El-Shamali S., 2011).Rica Marcus, in “Parks and Gardens ofRomania” is offering a series of informationabout this newly created space: “it is placedover what used to be a restaurant that leftbehind a circular platform with a diameter ofabout 20 m. According to the Englishtraditions, this forms a bulingrin from all fouraccess points, that descends on a few steps tothe circular alley paved with stone that standsbetween the central round and the surroundingplantation. On the rounds perimeter there wereplanted cone-shaped yews, and groups ofForsythia in between, in contrast of color andform. On the bordure were perennials such asSedum, Stochis, Cerasium, Campanula etc.Parallel to the alley a similar bordure can befound, followed by a lawn with 16 statues ofthe most valuable Romanian writers. Thesilhouettes of the statues of white marble,placed on high stone pedestal were in contrastwith the green background of the compactvegetation. The bulingrin was separated by therest of the garden through a a row of nichesformed by walls of vegetation that stand torepresent the lodges from where you canadmire the center of the composition: the yewround. The niches are formed by iron grids andare climbed by lianas and forsythias. At two ofthe entrances in this garden were placedcolumns with pedestals surrounded by groupsof Cotoneaster horizontalis.” (Marcus R.,1958).364The description made by Rica Marcus is onethat presents numerous elements that made upthe Writer’s Rotunda. However, a few discrepanciesappear between the text descriptionsand the images posted in the same book.Though being described as having 16 statues,photographs posted in the book to emphasizethe description show that there were actually 12statues, three on each quarter of the rotunda.The text description mentions two entries withcolumns while the plan shows that all fourentries had columns, and one image that revealsthe fact that the entrance from the main axishad no columns at all. Though the descriptionmade by Rica Marcus is one of the oldest andmost trustful, the discrepancies between textand images do not reveal how the Rotunda wasoriginally designed by Rebhun.Figure 1. Plan of the Rotunda – 16 statues a 8 columnsappearing on the plan (Marcus R., 1958)Another description of the Rotunda and of itscomponents appears in “Bucharest’s gardens”:“[…] the marble columns from the Rotundawere taken from the Royal Palace during a fire.The iron pergolas, […] were initially placed inthe palace garden, placed by Carol I whileQueen Elisabeth was in a foreign visit, to makethe queen a surprise. When the palace gardenwas disbanded, Rebhun asked for them andbrought them in Cismigiu. The pavement ispart of the pavement that was disbanded fromthe Rondul I de la Sosea.” (Lancuzov Al.,2007). Though interesting details were offered

y this description, those information could notbe yet verified.Figure 2. Entrace from the main axis – sequence of 3statues on a quarter (Marcus R., 1958)sculptors: Mihai Eminescu, Al. Odobescu, TituMaiorescu, I.L. Caragiale, G. Cosbuc, St. O.Iosif, Ion Creanga, Al. Vlahuta, DuliuZamfirescu, M. Onofrei, C. Baraschi, Th.Burca, B.P. Hasdeu, N. Balcescu and V.Alecsandri are the work of Ion Jalea, MilitiaPatrascu, D. Barlad, Oscar Spaethe, IonaPopovici, Cornel Medrea, I.G. Jinga, OscarHan and Al. Calinescu.” (Raducan V.) The textrefers to 16 statues but enumerates only 15.However, out of those 15 statues, only 12 reallyexists, while the rest of the three statues (M.Onofrei, C. Baraschi and Th. Burca) are onlymentioned in documents but do not appear inany visual documents.RESULTS AND DISCUSSIONSIn situ observations and old document researchmade us get an idea of how the Rotunda musthave been designed. We started focusing oneach component of the Rotunda and wediscovered elements that seemed to be lost,planning sequences that were altered in timeand evidences that supported parts of the oldtext or image descriptions.Figure 3. Entrace from the main axis – entrances andcolumns – columns do not appear at the entrance fromthe main axis (Marcus R., 1958)One more interesting description helped us tomake an impression of what used to be TheWriter’s Rotunda: “But the most interestingintervention that Rebhun had in this part of thegarden was the so-called Romanian Round,designed in 1942-1943 over an old restaurant.A scientifically distribution of trees, shrubs andflowers make up, on a circular platform of over20 m length diameter, a spatial frameworkrhythm by the 16 th statues of the mostimportant Romanian writers and by conedshapedyews, placed along a circular stonebrick paved alley. Coned-shaped yews areplanted on the perimeter on the round as well.The space is separated from the garden througha series of niches made up by walls ofshrubs(lianas and forsythias), placed on metalgrills and with a circular row of regular prunedlinden tree in behind. The statues were made bysome of the most important Romanian365VegetationThe Writer’s Rotunda vegetal design is madeup by a handful of plants that are described inhistorical documents and also, partially appearin old images as well.Yew trees are the most common trees in therotunda, and they were placed in sequences,according to the symmetrical design thatcharacterizes the entire composition. Thosetrees are mostly in a advanced state ofdeterioration, having lost their original coneshapedform. According to the Florence Charta(Charte de Florence, 1981), we decided to keepthe original image of the Rotunda, this waybeing obliged to eliminate all the yews andplant new ones. The new yews have to be coneshapedand have approximately 2.5 m high and1.2 to 1.5 m in diameter. Those dimensionswere approximated after scaling severalhistorical images.

Figure 4. Vegetation planRegarding other species of trees such as Tilia,Acer or Quercus, we decided to keep them intheir actual status considering that they are notmajor elements of design in the Rotunda, andthat they are, generally in a good state ofpreservation.Figure 6. Vegetation data sheet, yew no. 9In what concerns low vegetation such asshrubs, lianas or erennials we consideredreplanting roses, in groups of two, in betweenpergolas, such as texts and images suggestedand replanting Wisteria sinensis nearbycolumns, mentioning that this liana must bekept under control in order not to fully coverthe columns. Though historical texts mentionForsythia, Sedum, Campanula, Stochis,Crasium etc. we weren’t able to pinpoint theirexact planting location. Neither plans nor oldimages show those plants appearing in theRotunda, so we decided to fully give up onplanting those plants.Architectural components- StatuesAlthough text descriptions mention more than12 statues, we found no evidence that therereally used to be more that 12 statues in theRotunda. We recommend that the actual statuesbe preserved and no additional changes are tobe made.Figure 5. Vegetation data sheet, yew no. 2366

Figure 7. Statues- ColumnsWe came to the conclusion that the northernand southern entrances to the Rotunda havecolumns with Corinthian capitals, while onlythe western entrance had two columns withIonic capitals. The entrance from the main axishad no columns, as it can be seen on old imagesas well. However two out of six columns arecovered by lianas and one is represented onlyby its pedestal. Thus we propose to restore theones that are left and to make two copies of thecolumns with the ionic capitals in order toplace them at the east entrance, following RicaMarcus’s plans and the Rotunda’s logics ofsymmetry.Figure 8. Columns- BenchesThe Rotunda was designed with 4 stonebenches. All of those benches are in a advancedstate of deterioration, thus we advice that all ofthem be restored, if possible, if not, than theymust be replicated and placed according to theiroriginal location.367

Figure 9. BenchesVasesThere are 4 kinds of vases, that were originallyplaced in sequences according to a logic ofsymmetry that characterizes the entire Round.The largest type of vase is made out ofreinforced concrete and it is placed in thecenter of the composition.Another kind of vase is a plate-likeconcrete vase that it is placed in sequences andin between pergolas. The other two kinds ofvases are made out of stone and are placed insequences in between statues and yews and onboth sides of the circular alley. Most of thevases are in a advanced stage of deterioration.We propose that the vases be restored orreplicated and placed replaced according totheir original position.Figure 10. Vases368

The pergolas are preserved in a relatively goodcondition and they have not been moved orreplaced. We propose that the pergolas beconserved in the future and only minor repairsbe conducted at this moment.On both sides of the circular alley are placed 2kind of stone slabs, also arranged in sequencesaccording to the symmetry design of theRotunda. Alike pergolas, the stone slabs are ina good condition so we consider that onlyminor repairs are to be conducted at thismoment and conservation over time is needed.- Wrought iron pergolas and stone slabsFigure 12. Please protect the Rotunda!Figure 11. Pergolas and stone slabsDamages/DeteriorationsEither it came to damages or deteriorations,lack of experience and lack of concern madethe Rotunda to degrade over time. Newinstallations were added without approval fromspecialists and thus they destroyed the image ofthe composition. While new elements wereadded, old ones were left to deteriorate andpanels with messages for preserving the gardenwere just placed to hide the true nature of thedamages, as shown in the pictures below.369CONCLUSIONSFigure 13. Framing damagesOur research revealed the way the Rotunda wasdesigned by Friedrich Rebhun and how itpresents itself today. Lack of interest and ofexperience, combined with uninspiredmeasures taken inside the Rotunda badlydeteriorated most of this composition.However, the fact that there are still numerouselements that have not yet been damagedbeyond repair give a chance for specialists torestore the Writer’s Rotunda.Immediate actions are needed in order to savenot only this composition, but the entireCismigiu Garden.Our own restoration proposal is based on aminimum of actions, but all of them arenecessary in order to bring back the old imageand atmosphere in this part of the garden.Beside the proposals we made for everyelement of the Rotunda we emphasize that it istotally necessary to remove all the newelements that do not belong to the originaldesign, and we recommend, according to theFlorence Charta, that the entire garden tobenefit from a special visiting program.

REFERENCESPanoiu A., 2011, Evolutia orasului Bucuresti, ed.Arhitext Design, Bucharest, p. 81.El-Shamali S., 2011. Contribuii privind studiul creaiilordin România ale peisagistului Carl Friederich Meyeri punerea acestora în valoare în contemporaneitate,Bucharest, p. 17-18.Marcus R., 1958. Parcuri si gradini din Romania, ed.Tehnica, p. 173.Marcus R., 1958. Parcuri si gradini din Romania, ed.Tehnica, p. 169.Lancuzov Al., 2007. Gradinile Bucurestiului, ed.Caligraf, Bucharest, p. 31Raducan V., Puz Cismigiu, p. 10.Charte de Florence, 1981. Jardins Historiques.Figure 14. Proposed plan for restoration370

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653PHENOLOGICAL STUDIES ON SOME VARIETIESOF ROSES FROM THE COLLECTION IN THE "DIMITRIE BRANDZA"BOTANICAL GARDEN IN BUCHARESTAbstractEduard Marius NEGULICIUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Mrti, District 1, 011464, Bucharest, RomaniaCorresponding author email: marius.negulici@gmail.comThe study shows the influence of climate changes, which are more and more present, especially on the differences oftemperatures recorded in short periods of time as well as similar periods of time throughout the years, in thedevelopment of roses. This study of the influence of temperatures on roses was conducted in the Bucharest area.Thisparticular research was done by observing the behaviour of 10 varieties of roses from “Dimitrie Brandza” BotanicalGarden’s rose collection, between the years of 2011 and 2012. The main aspects of the study were: the growth rate andphenological phases, in correlation with the changes in the atmospheric temperature.Key words: roses, phenological phases, climate changes.INTRODUCTIONClimate changes are more and more evident,which affect all living creatures in differentways, causing behavior changes. On roses,these changes determine a change in growthrhythm, an offset in phenological phases andare a big influence on the lifespan of openflowersA study on the effect of negative temperatureson roses from the Botanical Garden collectionin Iasi was made by Ostaciuc in 1987. Hefollowed, during the winters of 1981 to 1986,rose varieties from the following groups:hybrid tea, polyantha, polyantha hybrids,floribunda, floribunda grandiflora, climbers andpark roses. The research showed that thepolyantha, polyantha hybrids and floribundahave their biological threshold at 10°C, hybridtea at 8°C and climbers and park ones at-15°C(Ostaciuc I., 1987). The present study aims toconduct collection on ten varieties from theBotanical Garden 'Dimitrie Brandza' inBucharest, during their growing season,between the months of May and November2011 and 2012. In the two growing seasons, thestudy followed and compared growth rhythm,the phonological phases and power of growth(the length of the shoots) in correlation with371temperature fluctuations. Data collected fromthis study is part of the PhD thesis.MATERIALS AND METHODSThe biological material that was used fordetermination came from 10 varieties plantedduring 2008 to 2009 in the 'Dimitrie Brandza'Botanical Garden Rose Collection (‘AbrahamDarby’, ‘Acapella’, ‘Angela’, ‘Caprice deMeilland’, ‘Christoph Columbus’, ‘ForeverYoung’, ‘Heritage’, ‘Ingrid Bergman’, ‘Rapsodyin Blue’, ‘Red Berlin’).Temperature data was taken from the NIMH-Bucharest Centre and recorded in tables.The culture technology was used under normalconditions, with cuts during the spring and inthe growing seasons, to stimulate a new waveof blooming.Hydric regime was also similar in the twoyears, without performing additional irrigation.Biodynamic growth rate was determined at aninterval of 4 weeks by measuring andcalculating the average growth of shoots duringMay to November in each of the two years.Important phenophases (budding, leafing andblooming) were determined visually when atleast 80% of the plants showed characteristicphenological aspects.

RESULTS AND DISCUSSIONSResults of the phenophases.Regarding phenophases, there were significantdifferences in blooming for up to 3 weeksbetween the two years, for the 'Rhapsody inBlue' variety, which in 2011 was the most tardyof all, at the opposite pole being the ‘ForeverYoung’ variety which has even shown earlinessin blooming in 2012.Also, in the case of leaves, between the twoyears there were differences of up to a week inmost varieties. (Table 1, 2)Table 1. Phenological phases for researched varieties in2011Variety Budding Leafing BloomingAbraham Darby March 15 March 29 May 24Acapella March 15 March 29 May 30Angela March 15 March 29 May 23Caprice de Meilland March 14 March 29 May 24Christoph Columbus March 16 March 31 May 30Forever Young March 15 March 29 May 19Heritage March 15 March 29 May 25Ingrid Bergman March 15 March 29 May 26Red Berlin March 15 March 31 May 26Rhapsody In Blue March 15 March 31 June 7Table 2. Phenological phases for researched varieties in2012VarietyBudding Leafing BloomingAbraham Darby March 26 April 5 May 13Acapella March 26 April 5 May 18Angela March 24 April 4 May 13Caprice de Meilland March 26 April 5 May 14Christoph Columbus March 26 April 5 May 20Forever Young March 24 April 5 May 5Heritage March 26 April 5 May 15Ingrid Bergman March 25 April 5 May 16Red Berlin March 24 April 4 May 13Rhapsody In Blue March 24 April 4 May 13Results of the growth rate study exhibitgrowth averaged during the months of May toNovember.The majority of the varieties showeddifferences in growth between the two years,with some similarities during the spring, whena more intense growth rate was recorded.This growth rate was correlated withtemperatures recorded during the months ofApril and December. (Table 3, Figure 1-11)Table 3. Growth rate in 2011 and 2012Variety Group MayJune July Aug Sept Oct NovAngela2011park rose 37,5 79,3 80 101 132 130,7 135Angela2012park rose 46,7 44 68 53,377,3128,6122,7AbrahamEnglishDarby36,6 48,2 73 43,420,6 25,1rose201169AbrahamDarby2012Heritage2011Heritage2012ForeverYoung2011ForeverYoung2012RhapsodyIn Blue2011RhapsodyIn Blue2012Acapella2011Acapella2012Caprice deMeilland2011Caprice deMeilland2012ChristophColumbus2011ChristophColumbus2012IngridBergman2011IngridBergman2012Englishrose50 55,5 19 27,9 47 60,5 67,2English14,7 45,7 79 117 99,1 37,6 97,6roseEnglish43,2 63,8 69 65,1 83 84,9 91,4rosefloribunda 27,1 35,9 38 10,1 5,3 16 22,4floribunda 18 26,4 6,2 5,6 7,9 7,8 11,5floribunda 34,4 80,3 85 85 96,7 49,7 80,7floribunda 35,7 38,2 27 15,7 25,9 21,3 41,3hybrid tea 38,5 45,4 54 76,7 72,2 20,8 111hybrid tea 47,3 54,2 74 22,8 61,6 79,2 76,5hybrid tea 22,6 45 67 28,1 72,2 39,6 81,7hybrid tea 36,4 60,8 77 22,5 68,5 84,5 81,5hybrid tea 26,5 55 83 41,2 33,4 19,5 93,8hybrid tea 33,6 74,7 62 37,5 38,8 116,1122,2hybrid tea 22,8 50,8 58 23,2 19,8 9,7 79,6hybrid tea 32,8 45,4 14 16,3 30,7 24,3 36,8Red Berlinhybrid tea 21 45,1 50 29,419,9 11,2 60,62011Red Berlinhybrid tea 65,4 65,6 20 48,759,2 59,3 31,82012On the 'Angela' variety, significant growthdifferences were registered between July andOctober (Figure 1).372

Figure 1. Average growth rate of ‘Angela’ variety fromthe park rose groupIn the English roses group, major differences inthe two years of study were present only in themonth of July on the ‘Abraham Darby’ variety(Figure 2).Figure 3. Average growth rate of ‘Heritage’ variety fromthe English rose group‘Forever Young ' was the variety who showedan uneven growth rate between June andOctober, in the floribunda group (Figure 4),Figure 4. Average growth rate of ‘Forever Young’ varietyfrom the floribunda groupFigure 2. Average growth rate of ‘Abraham Darby’variety from the English rose groupThe ‘Heritage’ variety showed an even growthrate in 2011, but in 2012 it presented importantdifferences in growth, with a maximumrecording in August, followed by a minimumone in October (Figure 3).‘Rhapsody in Blue’ presented the highestgrowth rate in 2011, with a maximumrecording in September and with the month ofNovember showing significant increased ratesfor 2012 (Figure 5).373

Figure 5. Average growth rate of ‘Rhapsody in Blue’variety from the floribunda groupIn 2011, the ‘Acapella’ variety presented thebest growth rate in growing seasons, betweenthe 2 years of study, with a maximum recordingin November (Figure 6).Figure 7. Average growth rate of ‘Caprice de Meilland’from the hybrid tea groupNovember was accounted for significantincreases in the 'Christoph Columbus' variety inthe two years of study (Figure 8).Figure 6. Average growth rate of ‘Acapella’ variety fromthe hybrid tea groupThe growth rate for the ‘Caprice de Meilland’was relatively even during the 2 years of study,with a significant difference recorded in themonth of October (Figure 7).Figure 8. Average growth rate of ‘Christoph Columbus’variety from the hybrid tea groupThe ‘Ingrid Bergman’ variety showed amaximum recording in November for 2011 andin June for 2012 (Figure 9).374

the high temperatures recorded during thesummer, being a determinate factor in thedecrease of growth rate (Figure 11).The evolution of average temperatures recordedwas relatively even between the 2 years ofstudy, with differences of only 5 degrees beingrecorded in similar timeframes of the year.Figure 9. Average growth rate of ‘Ingrid Bergman’variety from the hybrid tea group“Red Berlin’s” growth was uneven during thegrowing season in the two years of study, witha peak in 2012 during May-June and aminimum in July; as for 2011, the maximumwas recorded in November and the minimum inOctober (Figure 10).Figure 11. Average temperature recorded at 14.00 duringthe growth season in 2011 and 2012Figure 10. Average growth rate of ‘Red Berlin’ varietyfrom the hybrid tea groupAll of these differences in growth rate arecorrelated with the average temperaturesrecorded during the months of April andDecember, between the years of 2011 and2012. In 2011 we can clearly see howtemperature uniformity caused a stable increasein the growing season for the majority ofvarieties studied. The graphs presented aboveshow how the cuts performed after the firstwave of blooming, which were different everyyear, did not influence the growth rhythm onthe majority of the varieties studied, with only375CONCLUSIONSThe majority of the varieties studied showedsignificant differences in growth rate during thegrowing seasons of the 2 years of study, theonly exception being the ‘Caprice de Meilland’variety which showed growth rate differencesin the month of October.Climatic conditions in spring resulted in theearliness of blooming in 2012, in comparison tothe same period of 2011.Differences in growth were not affected bymaintenance cuts, but with the advent of hightemperatures during the summer, it caused areduction in growth rate, which only returnedto normal once the drop in temperaturesappeared along with the autumn season.The variety with the most significant increasewas 'Angela', which is a park variety and hasshown an average increase of 135 cmmaximum in November 2011. At the oppositepole is the variety with the lowest growth,which is 'Forever Young’ from the floribundagroup with a maximum of 35.9 cm in July2011.

In 2012 there were higher onset temperaturesduring the spring, which caused a greaterincrease in shoots length in the month of May.ACKNOWLEDGEMENTSThis research represents the objective of thePhD theses in the POS-DRU project:POSDRU/107/1.5/S/76888REFERENCESWagner S., 2002. The rose – from myth to the thirdmillennium, Cluj Napoca, p. 46-48; 89-95.Burzo I., Delian Elena, Hoza D., 2005. The physiologyof crop plants, vol IV,Elisavados Publishing House,Bucharest, p. 60-67; 90-98; 158-204; 346-363.Burzo I, Amariutei A., Zamfir D., 2005. The physiologyof crop plants, vol VI, Elisavaros Publishing House,p. 89-120.Ostaciuc I., 1987. Low temperature effect against rosefrom the collection in the Botanical Garden in Iasi.Culegere de stud. si artic. de biol., Univ. “Al. I.Cuza” (Grad. Botanica) Iasi 3, p. 65-72.376

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653AbstractWINTERING RESISTANCE OF ORNAMENTAL WOODY PLANTSIN CONTAINERIZED CULTUREIon ROCABotanical Garden (Institute) Academy of Sciences of Moldova,18 Padurii Street, MD 2002, Chisinau, Republic of MoldovaCorresponding author email: roscasilva@yahoo.comThe target of the experience consists in establishing the level critical temperatures and the mode preservation duringcold period of the year for the species and cultivars of conifers in containerized culture. Because of at the plants arefortified in container conditions, frequently occurs the phenomenon of spiraling root system, standing at the peripheryof the substrate, endangered by frost and, proceeding from the need of protection during the winter, we suggest thefollowing objectives: * the comparative comportment of the species and cultivars during the cold season, depending onthe way of storage; * the species and cultivars resistance at low temperatures, depending on the ecologicalrequirements of plants. For containerized culture of ornamental species and cultivars were established followingconservation cold season: V 1 – protected plants displayed in greenhouse; V 2 – protected plants and exposed outdoorbut covered with protective acrylic cloth; V 3 – plants unprotected and exposed outdoors throughout the cold period. Asa result of the study it was found that the species and cultivars of conifers remarked the highest coefficient – 100%resistance at low temperatures, where all three variants of wintering (V 1 , V 2 , V 3 ), at the end of the cold period the plantswere started in vegetation and there were no damages caused by the frost.Key words: resistance wintering, containerized culture, preservation variants and cultivars.INTRODUCTIONRoots of the plants in the open field areprotected from the soil mass and penetratesdeeper, thus preserving it from the excess ofhigh and reduced temperatures. At the fall offrost, the temperature sometimes decreasesmore than a few degrees below the criticalpoint, except the portion from the soil surface.Different behaviors have the plants roots incontainerized culture from the temperate andsub temperate zone, where the freezing point isnot lethal, comparatively with the temperatecontinentalclimate in the Republic of Moldova.In temperate zone, the aerial part of themajority of species possesses the ability ofincreasing their resistance to wintering, fromthe moment of reducing the duration of the dayand the decreasing of fall temperatures. On thecontrary, the containerized plant roots in localconditions have a reduced capacity forresistance to wintering or even are missing. Atthe plants grown in the cylindrical shapecontainers is often the phenomenon of spiralingof the roots, so the young roots are much more377vulnerable to the injuries caused by the lowtemperatures. In that case, the containerthickness of the wall performs the duties of theprotector of roots to lethal temperatures. If thetemperatures, fall below the critical point forsome time, the roots, coming in contact withthe interior surface of the container, freezes. Insuch cases, the roots regenerate from theremaining who survived inside the culturesubstrate and from the base of the plant.Therefore, if the temperature persists at orbelow the lethal point then the temperature ofthe culture substratum integral mass alsoreaches the lethal temperatures, thuscompletely destroying the root system. Thedegree of deterioration of the root system isdifficult to determine until start the vegetationseason and only when takes place thedesiccation we can establish the full effect ofthe damage state (Rosca, 2003). From atechnological point of view is recommendedthe transferring of suspicious moderatelyaffected plants in greenhouses heated (Gouin,1973; Rosca, 2003). More authors attest the

fact that root injuries is the major factor whichlimits the containerized culture in the northerncountries and was established that Taxus xmedia 'Hatfieldi' young white roots freezes atthe temperature of – 3°C, those secondary redmaroonat – 7°C and the mature stem from thebase does not freeze until – 19 o C (Mityga et al.,1971; Rosca, 2009).MATERIALS AND METHODSFor containerized culture of ornamentalconiferous species and cultivars such as: Abiesconcolor Lindl. et Gord., Abies nordmanniana(Stev.) Spach., Juniperus communis 'Meyer',Picea glauca 'Conica', Picea pungens f. glauca(Reg.) Beissn, Taxus baccata L., Taxus xmedia 'Hatfieldii', Taxus x media 'Wojtec',Thuja occidentalis 'Danica', Thuja occidentalis'Fastigiata', Thuja occidentalis 'Holmstrup',Thuja occidentalis 'Smaragd', Thuja orientalis'Aurea Nana' following variants of preservationfor the cold period of year have beenestablished: V 1 – protected plants displayed ingreenhouse; V 2 – protected plants and exposedoutdoor but covered with protective acryliccloth; V 3 –unprotected plants and exposedoutdoors throughout the cold period. In theexperience were involved by 20 units / cultivarfor each variant of preservation and was carriedout between 1.XI.2007-15.IV.2008. Meteorologicaldata on the period XI.2007-IV.2008were registered in Chisinau and taken fromState Hydrometeorological Service (Table 1).Juniperuscommuni 20 20 20 20 20 20s 'Meyer'.Piceaglauca 20 20 20 20 20 20'Conica'Piceapungensf. glauca 20 20 20 20 20 20(Reg.)Beissn.Taxusbaccata 20 20 20 20 20 20L.Taxusx media.20'Hatfieldii20 20 20 20 20'Taxusx media 20 20 20 20 20 20'Wojtec'Thujaoccidenta20lis20 20 20 20 20'Danica'Thujaoccidentalis 20 20 20 20 20 20'Fastigiata'Thujaoccidentalis 20 20 20 20 20 20'Holmstrup'Thujaoccidenta20lis20 20 20 20 20'Smaragd'Thujaorientalis20'Aurea20 20 20 20 20Nana'SpeciesandcultivarsAbiesconcolorLindl. etGord.Table 1. Containerized plant resistance at lowtemperatures.Number of plants exposedon 15.11.07.,unitst o = +11 o C;-4,9 o CNumber of plantspreserved on15.04.08.,unitsWintering variantsgreenho protec unprote greenho protec unproteuses ted cted uses ted cted20 20 20 20 20 20Abiesnordmanniana(Stev.)Spach.20 20 20 20 20 20RESULTS AND DISCUSSIONSThe plants experimented concerning theresistance to low temperatures, depending onthe three types of wintering it consists ofspecies and cultivars of conifers. The obtainedresults on wintering containerized conifer yieldare shown in Figures 1-5, Table 1.On the basis of investigations regarding thebehavior of species and cultivars under theconditions of containerized culture, theirresistance to low temperatures, depending onthe mode of conservation, we obtained thefollowing results:378

Figure 1. Number of plants preserved after wintering atthe species Abies concolor Lindl. et Gord.Figure 2. Number of plants preserved after wintering atthe species Abies nordmanniana (Stev.) Spach.Figure 4. Number of plants preserved after wintering atthe species Picea pungens f. glauca (Reg.) Beissn.Figure 5. Outdoor wintering mode.Figure 3. Number of plants preserved after wintering atthe cultivar Juniperus communisFigure 6. Plants coated with protective acrylic cloth.379

We recommend that the species and cultivars ofornamental woody plants in conditions ofcontainerized culture must be maintainedduring the cold season of the year, with the fastrhythm of growing – in conditions ofgreenhouses – V 1 , those with slowrhythm ofgrowth, protected with acrylic cloth, andexposed outdoors – V 2 .Figure 7. Plants placed in the greenhouse for wintering.CONCLUSIONSAs a result of the study it was established thatthe species and cultivars of conifers haveremarked the highest ratio-100% of resistanceat low temperatures, in all three types ofwintering (V 1 , V 2 , V 3 ), which started at the endof the cold vegetation and there were does notinjuries caused by the frost.REFERENCESGouin F.R., 1973. Winter protection of container plants.Proc. Int’l Plant Prop. Soc., 23, p. 255-258.Mityga H.G., Lanphear F.O. 1971. Factors affecting thecold hardiness of Taxus cuspidata roots. Jour. Amer.Soc. Hort. Sci., 96, p. 83-87.Rosca I., 2003. Caracteristicile recipientelor pentruculturile în containere. In: Tezele conf. tinerilorsavanti ai Academiei de Stiinte a Moldovei.Chisinau, p. 77.Rosca I., 2003. Cultura plantelor lemnoase în containere– tehnologie noua de crestere si dezvoltare. In:Buletinul A.S.M., ser. Stiinte Biologice, Chimice siAgricole. Chisinau, nr. 2 (291), p. 163-164.Roshka I., 2009. Aspecte caracteristice rezistentei latemperaturi critice ale plantelor decorative cultivateîn conditii de container. International Conference ofYoung Researches. November 5-6, Chisinau,Moldova. In: Scientific abstracts. p. 56.380

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653AbstractQUALITY PARAMETERS OF URBAN GREEN SPACESAnca STNESCUUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Mrti Blvd., District 1, 011464, Bucharest, RomaniaCorresponding author email: anca_stanescu2001@yahoo.comThe study approaches the problem of urban green space quality by relating the classic functional-aesthetic binomialwith the ecological aspects of quality; the work analyzes the implication of ecological factors in the ensemble of urbangreen quality, considering that the green space is a fundamental component of the urban ecosystem and vegetation isone of the components of this interactive system which includes the socio-economic system with all its functional andspatial structures, urban biotope and biocenosis.Key words: aesthetic functions, quality, urban green space.INTRODUCTIONThe urban green space can be defined as thepart of the urban territory which is composed oforganized (and unorganized) vegetal mass, andwhich’s character results from the interaction ofseveral factors: human, socio-economical,cultural and environmental. Starting from thisdefinition, one can assert that the quality of theurban green space is the ensemble of positiveresponse effects to the biological and socioeconomicalneeds of urban existence, but alsoto the need of urban ambience defined by thepsyche-social needs of spatial identity andaffiliation to the cultural landscape.MATERIALS AND METHODSThe quality of urban green space is assignedthe meaning of quality-value as a positivecharacteristic which results from two types ofmeasurable and immeasurable characteristics:1. Primary qualities which respond tobiological and socio-economical needs bydirect effects in the general state of health, ofthe environment and of micro-climate.2. Secondary qualities which respond to thepsyche-social needs through indirect effects onthe psychological planThe quality of the urban green is directly andmandatory involved in the quality state of theurban environment through its positive andeffects in the different areas of interest: spatialplanning, functional, aesthetic-ambient and381ecological, having unchallenged effects in theensemble of life quality.The environmental factors which affect theurban space (climate, soil, landscape, biologicaland anthropical) also influence the quality ofthe green spaces, through a multitude ofcomponents (social, physical-chemical,inorganic and organic) which affect the state ofbalance of the urban ecosystem and thus thequality of the green infrastructure from the city.There can be made the assertion that theecological field related to the quality of urbangreen is far more ample in proportion to theclassical approach – through the functionalaestheticbinomial – and that it presumesinterdependency relations between the fields ofspatial-functional, aesthetic and ecological. Theclassical approach of quality by means of thefunctional-aesthetical binomial and theimplication of the ecological factor conduce tothe idea that the parameters of functionalityrepresent criteria for evaluating the quality ofurban green spaces, having as the result theefficiency in using the planted areas of the city(by enhancing the degree of socialization).RESULTS AND DISCUSSIONSThe synthesis of the criteria and determinantfactors of the urban green quality (Table 1) willtake into consideration 4 levels of approach:physical, functional, aesthetical and ecological.Each of these approach levels is determined bya series of components, significance, criteria

and parameters of quality. The physicalapproach level primarily includes componentswhich relate to the emplacement inside the city,localization through the relation green space –site, dimensioning, mean and duration of usage,shape. The functional approach level includesthe following components: the functionalcharacter and the functional profile. Theaesthetic approach level includes threecomponents: stylistic composition, principlesof composition and composition elements. Thelevel of ecological approach takes intoconsideration the fact that the urban greensystem is an essential component of the urbanecosystem and also the ecological impactgenerated by the urban green system on thecity. All these components, along with thesignificances, criteria, parameters andquantitative and qualitative determinations areintegrated in the table 1.CONCLUSIONSThe features and components of the overallurban green space quality are determined by thedifferent types of approach:-spatial-functional structure defined by thelocation inside the city and the relationshipwith it, dimensioning, shape, character andprofile of functionality; all these havequantitative determinations and qualitativeexpression through effects: superiorexploitation of the natural potential,percentages and proportions of the greentexture and of the built texture, orientation,information, significance, accessibility, comfortin usage, multi-functionality through therecreational links, complexity and efficiencythrough spatial-functional diversity (Figure 1)-the aesthetic approach defines the qualitativecomponents which can be expressed throughsignificance, semantics, aesthetical diversity,participation in the creation of urban ambianceand contribution to the forming of the culturallandscape (Figure 2)-the ecologic approach includes componentsand features of quality which are expressedthrough efficiency in social and human plan:urban comfort, life quality, efficiency in themicro-climate plan, with positive effects in theimprovement of urban environment conditions(Figure 3).LEVEL OFAPPROACHPHYSICALLEVEL OFAPPROACHCOMPONENTSEMPLACEMENT- inside the city asan urban ensemble- the relation city -green structure- positioning insidethe urban GSsystem- relation GS –system of GS- localization:relation GS – siteDIMENSIONING- influence range- servicedpopulationTable 1. Factors of the urban green qualitySIGNIFICANCEASSIGNED- compared to theresidence areas- compared to theworking areas- compared toendowments- compared totraffic- in proportion tothe same type ofGS units- in proportion todifferent types ofGS units- in proportion tothe proximities- in proportion tonatural elementsin proportion tobuilt areas- surfaces- time fortransiting- users- number ofQUALITY – CRITERIA, PARAMETERS, FACTORSQUANTITATIVE QUALITATIVEDETERMINATION DETERMINATION STATEMENT- distances- distances- ha (m2) of GS- minutes (hours)- indexes m2 ofGS/user382- zonation (areas,bands, points)- direction- personalizationelement of the greenensemble- accordance with thenatural character ofthe site- harmony- contrast- neutrality- urban comfort- exploitation ofnatural potential- orientation(guiding marks)- information- significance- decrease in timeand distances tocover- accessibility- major influenceon proximities- accessibility- comfort- facility of usage- accessibility

FUNCTIONALLEVEL OFAPPROACH- means of usageCOMPONENTS- usage spanSHAPEFUNCTIONALITYCHARACTERCOMPONENTSFUNCTIONALITYCHARACTERFUNCTIONALPROFILEinhabitants from - m2 GS/inhabitantthe serviced area - m2 GS/ha (urban- surface serviced surface)- individual- groupSIGNIFICANCEASSIGNED- mean period ofusage- point-like(spots)- number of users- organized- unorganized- mixed- socialefficiencyQUALITY – CRITERIA, PARAMETERS, FACTORSQUANTITATIVE QUALITATIVEDETERMINATION DETERMINATION STATEMENT- usage mean (hours)- maximum and - differential usage on- comfort degreeminimum period of categories of usersusage- linear - length (m, km)- bands - surface (m2, ha)- plasmatic- integrated- surface (m2/ha) - diversification- surface (m2, ha)- perimeters (m, km)- number of unites ofGS- types ofendowments- equipment,installations- functioningcapacities- direction- orientation- contribution tophysical structure ofurban areas- repartition anddiffusive form- inclusion in otherurban functions(residence,commerce, culture,traffic, industry)- major influenceon proximities- accessibility- decrease inphysicaldiscomfort onurban arteries- creation ofurban greencorridors- chain ofrecreational links-beneficial effectsin the urbanmicroclimate- variety of theurban texture- monofunctionality- specializationQUALITY – CRITERIA, PARAMETERS, FACTORSSIGNIFICANCEQUANTITATIVE QUALITATIVEASSIGNEDDETERMINATION DETERMINATION STATEMENT- balance of GS- multifunctionalityfunctions inproportion to other- varietyintegrated urban - complexity of - complexity- integrator functionsintegrated functions - superior(percentages) - functional hierarchy functional- types of GS specificand complexendowments- profile specificendowments- equipment,- mono-functional installations- multi-functional- arranged spaces(plantations andconstructions)- complexendowments,equipments,installations and383- specificity ofarrangements inproportion to usersprofiles andcategories- balance offunctional elementsin relation to:- importanceintegration aturban level- socialization- specialization- increasedactivity fordistinctcategories ofusers- functionalefficiency- functionaldiversity

AESTHETICALLEVEL OFAPPROACHLEVEL OFAPPROACHECOLOGICALSTYLISTICCOMPOSITIONCOMPONENTSCOMPOSITIONPRINCIPLESCOMPOSITIONELEMENTSCOMPONENTSTHE URBANGREEN SPACESYSTEM –COMPONENT OFTHE URBANECOSYSTEMECOLOGICALIMPACT- architecturalgeometric- free-landscape- mixedSIGNIFICANCEASSIGNED- symmetry,asymmetry- axis- perspective- dominant- compositionalcentre- focal point- rhythm- harmony- contrast- accent- graduationarrangements- plantation surfaces(m2, ha)- proportions,percentages- usage of style indifferent proportions(total, partial)- proportions,percentages- users (percentages) - increaseddegree of activityfor all userscategories- socialization- unit- variety- conformism- nonconformism- contribution todefining theculturallandscapeQUALITY – CRITERIA, PARAMETERS, FACTORSQUANTITATIVE QUALITATIVEDETERMINATION DETERMINATION STATEMENT- proportion of usagein the compositionalensemble- compositionalcharacter andanticipated effects:- dynamic- static- exuberant, sad- order, equilibrium- stringency- hierarchy- cohesion- diffuse- highlighting- semanticsignificance:- grandeur- monumental- uniformity- variety- variety- illustrative- eloquence- plasticity- creation ofspecific andgeneral ambiance- aestheticdiversity- landscape - volume- waters- vegetation- traffics- texture- proportion vegetalmineral- shape, contour- symbolic languageelements- surface- species- colour- light and shadeSIGNIFICANCEASSIGNED- presence in theurban area:- zoning- disseminated- concentrated- linear- punctual- square- garden- park- different rates andproportions in thecolour spectrum- brightness,penumbra, shade(rates andpercentages)- base colours(primary andsecondary)- natural- artificial- constructionand decorativematerials- decorativeobjects- significance:symbol of thephysical orfunctionalcharacter- opportunity ofcharacterexpression- visual andfunctional variety- comfortQUALITY – CRITERIA, PARAMETERS, FACTORSQUANTITATIVE QUALITATIVEDETERMINATION DETERMINATION STATEMENT- amelioration of - diversity of- positioningurban environmental urban texture- distancesconditions in grounds - urban comfort- influence rangeof:- life quality- plantations density- sanitary- biodiversity- dominant species- psychological - cultural(percentages)- ameliorationindexes of noxae andpollution (air, water,384- microclimatic- influence onproximities:- maximumlandscape- efficiency insocio-humanplan:

- street bands and soil, dust, noise)alignments - state of vegetation(percentages ofageing)- resistant/nonresistantspecies- medium- minimum- diversificationof recreationalactivities- culture- education- efficiency inmicroclimateplanFigure 1. Expo 2002 – Swiss National Expo – Yverdon-les-Bains, Switzerland. Image from inside the exhibition.Figure 2. Image from Foggy Bottom, Norfolk, England. The vegetal element dominates through the composition ofherbs and conifers.Figure 3. Image from Tineretului Park, Bucharest.385

REFERENCESArchibugi F., 1997. The Ecological City and the CityEffect. Ashgate Publishing Ltd., Aldershot, England,p. 58-59.Bass B., 2002. Greening of Cities. Encyclopaedia ofGlobal Environmental Change. vol. 3. John Wiley &Sons Ltd., Chicester., p. 93-95.Turner T., 1996. City as Landscape. A post-modern viewof design and planning. E& FN Spon, London.386

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653DENDROLOGIC SPECIES IN STREET PLANTATIONSWITH SOUND-INSULATING ROLEAnca STNESCU, Elisabeta DOBRESCUUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest, 59 Marasti Blvd, District1, 011464, Bucharest, RomaniaAbstractCorresponding author email: anca_stanescu2001@yahoo.comThe study analyses the capacity of different dendrologic species to diminish noise and also considers optimum varietiesof urban street plantations composition with the scope of noise reduction. Optimization restrictions will be analyzed –especially extreme restrictions – along with optimization factors which depend on the dendrologic species assortmentand the quality of the architectural-landscape composition of the plantation; these aspects concord with some spatialdecree restrictions which the landscape specialist must provide for when completing the sound-insulating streetplantations.Key words: arbours, scrubs, sound-insulating, street plantation.INTRODUCTIONStreet plantations are urban green spaces ofgeneral usage which accompany (border) thetraffic arteries of the city; these plantations aresubjected to pollution aggression and noxaegenerated by traffic. Phonic pollution is one ofthe aspects of urban environmental pollution,which leads to the necessity of studyingoptimization versions of noise reduction.The capacity of alignment plantations todecrease sound depends on the dendrologicalspecies assortment, but also on their means ofarrangement by composition manner andspatial-volumetric association of the species.MATERIALS AND METHODSThe optimization of street alignmentscompositions for noise reduction purposes isbased on extreme conditions: dense and smallleafage, dense ramifications and small intervalsbetween leaf nodes.Noise attenuation differs according to species:Acer pseudoplatanus reduces noise by 10-12dB, Tilia platyphilos and Viburnum lantanareduce noise by 8-10 dB, while Carpinusbetulus, Quercus robur, Ilex aquifolium andSyringa vulgaris reduce noise by 6-8 dB.Considering that noise is reduced bypropagation (at the distance d) with 5 dB in theabsence of plantations, the same noise (with thevalue of N dB) will be reduced by 5 dB at halfthe distance (d/2) when plantations areencountered; in the case of an optimizedplantation with dense leafage, the decrease innoise at the distance d/2 is even greater: NdB –5dB – (10+6) dB (Figure 1).Distribution manner and spatial-volumetricassociation of species from street plantationsmay be accomplished by complex compositionof alignments; the composition of complexalignments may include deciduous orrasineferous arbors and scrubs and hedges.387

Figure 1. Optimized version of complex alignmentsRESULTS AND DISCUSSIONSAnalyzing some solution versions (Figure 2, 3,4) for some complex alignments, one canunderstand the aesthetic diversity given byrhythm elements (1-4 individuals which formthe cadence of the rhythm), the alternation ofdeciduous species (as repeatability elements)with the rasineferous species (as rhythmelements), or the alternation of arbor specieswith scrub species (hedges or un-pared scrubs).The arrangement of these samples on severalheight registries (on foreground the short ormedium vegetation and on background the tallvegetation) has as aesthetic role as well as anutilitarian one – noise and noxae reduction,achieving an optimal effect of encapsulationfrom noise, dust and noxae. Therefore, aqualitative-cumulative effects are obtainedthrough the simultaneous presence of qualitiesand aesthetical effects, and also of those withprotection roles against noise and variousnoxae.388

Figure 2. Version 1 of complex alignmentsFigure 3. Version 2 of complex alignmentsFigure 4. Version 3 of complex alignments389

CONCLUSIONSThe optimized version (Figure 1) of completingcomplex alignments has a series ofoptimization restrictions: extremal conditions(dense leafage, small leafs, dense ramificationsand small intervals between leaf nodes), spatialrestrictions which refer to distances andavailable spaces for planting great numbers ofarbors and scrubs, and alternative distributionof species.In conclusion, optimization is achieved throughquantity (large number of plants) and quality(adequate species according to the statedcriteria).In order to create optimum street alignments,the aesthetic aspect must also be taken account(Figure 2, 3, 4), which is realized through thecombination of deciduous and rasineferousspecies of arbors and scrubs.REFERENCESARCHIBUGI, F. 1997. The Ecological City and the CityEffect. Ashgate Publishing Ltd., Aldershot, England,p. 63-65.ILIESCU ANA-FELICIA, 2003. Arhitectur peisager.Editura Ceres, Bucureti, p. 128-131.STNESCU ANCA, 2011. Peisagistic urban vol. II.Editura Printech, Bucureti, p. 91-103.390

MISCELLANEOUS

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653AbstractTHE INFLUENCE OF CLIMATIC CONDITIONS ON THE GRAPEQUALITY IN THE WINE CENTER OF MURFATLAR IN 2012Victoria ARTEM, Arina Oana ANTOCEUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Marasti Ave., District 1, 011464, Bucharest, RomaniaCorresponding author email: aantoce@yahoo.comThe overall climatic conditions, through the main three factors (temperature, sunlight and humidity), exert a majorinfluence on the quality and quantity of the grapes produced during a particular year. For this work, studies wereperformed on several white and black grape varieties authorized for culture in the vineyards of Murfatlar, by followingthe parameters that define the grape maturation (evolution of sugar accumulation, decrease of acids concentration andevolution of berry weight) and the grape quality at the harvest time. The studies showed that the year 2012 was a hotone, with a period of sunshine recorded during the grapevine vegetation exceeding normal value (average of 50 years)by 173.4 hours. The quantity of precipitations was similar to the level recorded as the multiannual average, but the raindistribution was not uniform during the vegetation period. These particularities led to an unsatisfactory development ofthe berries and lower yield. Due to the longer period with higher temperatures the ripening was premature, with acertain benefit in favour of sugar accumulation, while the must acidity was insufficient, due to a more intensecatabolism at these temperatures. The harvest time started earlier for all the varieties, the recorded yields were muchlower, but the grapes were not affected by rot or other diseases. Due to the fact that the grape ripening depends on theclimate parameters of the year and on the region, in order to decide the optimum harvest period for a certain type ofwine the evolution of the grape maturity parameters should be determined each year and the change in climaticinfluences should be systematically recorded.Key words: climatic, grape, Murfatlar.INTRODUCTIONThe influence of climate on agriculture andespecially on viticulture and wine productionhas never been more obvious than today. Whatremains to be argued is the critical aspectregarding the optimal maturation time ofgrapes, so that the wine obtained could acquirethe characteristics of a quality wine (Tate,2001; Bisson et al., 2002; Schultz and Jones,2010).History has shown that winegrape growingregions developed when the climate was mostconducive and that shifts in viable wineproducingregions have occurred due to climatechanges in the past (Le Roy Ladurie, 1971;Pfister, 1988; Jones, 2006).For example, in any viticultural region, theaccumulation of sugars in grapes in optimalconcentrations now happens in a shorter timethan before. Same is true about total acidity andthe aromatic profile optimal for winemaking. Ina warmer-than-normal environment, the393grapevine passes through the variousphenological phases faster, reachingtechnological maturity sooner andaccumulating higher concentrations of sugars inthe berries. While the grower or the winemakerawaits for the grapes to gather aromacompounds, the acidity is lost by respirationand the resulted wines lack balance and needcorrections in the cellar. As a result of thewarming of climate, in various regions a higherconcentration of alcohol in wines was observed(Jones, 2007).MATERIALS AND METHODSThe study was carried out in the Murfatlarviticultural center and was aimed at bothrenowned grape varieties for white and redwines (Chardonnay, Riesling Italian,Sauvignon blanc, Feteasca regala, CabernetSauvignon, Pinot noir, Merlot, Feteasca neagra)as well as varieties obtained by researchers

from SCDVV Murfatlar (Columna andMamaia) from the 2012 harvest.The data regarding climate were recorded usingthe weather station of the research station,model Weather Master 2000.The dynamics of grape maturation for thestudied varieties was monitored by followingthe accumulation of sugars and the decrease ofacidity. At the same time, the evolution of theweight of the berries was also monitored.The determinations were made every 7 days, ondates established in advance. A number of 5berries were harvested from each grape, asfollows: one berry from the left side, one fromthe right side, one from center-front, one fromcenter-back and one from the basis of thegrape. The 5 berries each were harvested from60 grapes (thus giving a total of 300 berries toanalyze). The 60 grapes were made of 10grapes chosen from each of the 6 rows selectedat random, and the location of each grape onthe rows was chosen in zig-zag. The harvestedberries were put in labeled plastic bags andtransported to the laboratory in a cooler box,avoiding their crushing and heating.The determination of sugars was done using aSmart electronic refractometer, on the basis ofthe percentage of dry matter in the grapes. Theread values were adjusted for temperature andthe value of the sugar content of the must wasderived using data tables.The acidity of the must was measured bytitrimetry by neutralizing the acids in adetermined amount of must using a solution ofNaOH of known factor. Based on the amountof base solution used during the titration, thetotal acidity of the must can be calculated.The total acidity was expressed in g/l H 2 SO 4 .The determination of the weight of the berrieswas done using a laboratory technical scale,taking data on the weight of 100 berries.RESULTS AND DISCUSSIONSThe climatic conditions of the year, namely themain three factors (heat, light, humidity)exercise an important influence on the processof grape maturation. This influence can actuallydecide the yield and the quality of that year’scrop. In Table 1, the data on the three climatefactors of 2012 are compared to the multi-yearaverages recorded during the last 50 years inthe viticultural center of Murfatlar, which areconsidered “normal”.The sum of temperature degrees in the periodof vegetation of 2012 was 4100.8°C, comparedto the average value of 3449°C. That is 651.8°Cmore than what is considered the normal value.The maximum temperature recorded in thisperiod was 39.8ºC (in August), and the lowesttemperature recorded was-2ºC (in April).Regarding the precipitations, the sum of rainfallwas 246.4 mm, compared to the average valueof 245.7 mm. So the difference was very small,but the distribution in time of the rainfall wasnot uniform.The total sunshine time was 1780.6 hours,compared to the average of 1587.2 hours (seeTable 1).Table 1. Evolution of air temperature, precipitations and sunshine time during the growth season 2012, compared to themulti-year averagesAir temperature Precipitations Duration of sunshineMonth T avg (50 years T avg Average T min Average T max Multi-year Multi-yearaverage) ( o C) ( o C)( o (mm)C) averageaveragehoursApril 10.2 14.5 -2.0 28.6 33.5 44.5 160.7 210.1May 16.2 19.8 8.4 31.0 50.2 145 261.8 281.1June 20.4 21.2 12.6 37.2 53.2 7.4 314.5 314.0July 22.6 28.0 13.1 38.2 35.6 33.2 323.7 341.6August 22.6 26.1 10.7 39.8 31.6 8.8 305.5 345.6September 17.6 20.7 7.8 36.0 41.6 5.6 221.0 288.2The accumulation of sugars in the berries,between the beginning of ripening and fullmaturity, happens quickly and in largeconcentrations. The increase is faster in thefirst 2-4 weeks at the beginning of the process,and later slows down and even stagnates for aperiod of 3-5 days (Cotea, 1985).The concentration of accumulated sugars in thewhite varieties at full maturity (Figure 1) was394

etween 182-212 g/l, the lowest value beingmeasured for the variety Feteasca regala andthe highest value been seen in Italian Riesling.In case of the varieties for red wines themaximum weight of 100 berries was reachedby the grapes of Mamaia variety, whichweighed 220 g at September 10 (Figure 4).From the beginning of ripening to full maturitythe 100 berries gained 64 g, and after that, untilthe harvesting date (September 18) they lost amere 2 g.Figure 1. Evolution of the concentration of sugar for thevarieties for white winesIn case of the red varieties (Figure 2) theconcentration of sugars at full maturity variedbetween 192 and 219 g/l, the lowest valuebeing seen in Cabernet Sauvignon and thehighest value measured for Merlot and Pinotnoir.Figure 4. Evolution of the weight of 100 berries for thevarieties for red winesUnder the conditions of the Murfatlarviticultural center the fastest decrease of acidity(the steepest slope on the graph) was observedat the white varieties for the variety ItalianRiesling – from 23.7 g/l to 5.2 g/l (Figure 5).The mildest slope (the slowest decrease) wasrecorded for the variety Feteasca regala, from14.0 g/l to 5.0 g/l.Figure 2. Evolution of the concentration of sugar in thevarieties for red winesThe maximum weight of 100 berries of whitevarieties (Figure 3) was attained in grapes ofColumna variety (163 g on September 10).That means that from the beginning of ripeningto full maturity the weight of 100 berriesincreased with 94 g. Afterwards, untilharvesting, the grapes lost some weight so that100 berries weighed 7 g less than at fullmaturity.Figure 5. Evolution of total acidity for the varieties forwhite winesIn case of the varieties for red wines (Figure 6),the steeps slope of the graph of acidity wasobserved for Cabernet Sauvignon, from 20.3 g/lto 5.5 g/l, and the mildest slope was recordedfor the Mamaia variety, from 8.5 g/l to 5.6 g/l.Figure 3. Evolution of the weight of 100 berries for thevarieties for white wines395

Figure 6. Evolution of total acidity for the varieties forred winesThe rate of accumulation of sugar in thevarieties for white wines was between 1.96 and3.12 g/day, with the lowest value in case ofChardonnay and the highest value for ItalianRiesling. As for the varieties for red wines, therate of accumulation of sugars was between2.13 g/day (Cabernet Sauvignon) and 1.42g/day (Mamaia) (see Table 2).Table 2. Rate of accumulation of sugarsVarietySugar (g/day)-for white winesChardonnay 1.96Columna 2.66Feteasca regala 2.22Italian Riesling 3.12Sauvignon blanc 2.53-for red winesCabernet Sauvignon 2.13Merlot 1.60Feteasca neagra 1.72Mamaia 1.42Pinot noir 1.56The rate of decrease of total acidity for thevarieties for white wines was between 0.83 and1.03 g/day, with the lowest value observed forColumna variety and the highest rate in ItalianRiesling. As regards the varieties for red wines,the highest rate of decrease in total acidity wasobserved for the variety Pinot noir (0.80 g/day)and the lowest rate of decrease was seen inCabernet Sauvignon and Mamaia (0.66 g/day,Table 3).Table 3. Rate of decrease in total acidityVarietyMetabolisation of acids (g/l/day)-for white winesChardonnay 0.84Columna 0.83Feteasca regala 0.97Riesling Italian 1.03Sauvignon blanc 0.97-for red winesCabernet Sauvignon 0.66Merlot 0.71Feteasca neagra 0.67Mamaia 0.66Pinot noir 0.80All the grape varieties registered sugarconcentrations between 195 and 234 g/l whichalows them to be used for the production ofwines with controlled denomination of origin,with the exception of the variety Feteascaregala which met the conditions for theGeographical Indication “Colinele Dobrogei”(Table 4.)Table 4. Physico-chemical characteristics of the grapes obtained in the Murfatlar viticultural center, 2012 harvestPhysico-chemical characteristicsQuality level*Table Wines with Wines with ControlledVariety Date Sugar Acidity (g/l Weight 100 wines Geographical Indication Denomination of Origin(g/l) ac. tartric) grains (g) 144.6-178.6-187.0 > 187.1178.5Varieties for white winesChardonnay 14.09.2012 216 6.12 106 xColumna 19.09.2012 195 5.05 156 xFeteasca regala 15.09.2012 187 6.43 119 xRiesling Italian 20.09.2012 228 5.20 106 xSauvignonblanc21.09.2012 219 4.28 139 xVarieties for red winesCabernetSauvignon25.09.2012 211 5.51 95 xMerlot 17.09.2012 221 6.12 109 xFeteasca neagra 13.09.2012 208 6.89 118 xMamaia 18.09.2012 209 5.66 218 xPinot noir 24.09.2012 234 5.20 133 x396

CONCLUSIONSThis study showed that 2012 was a hot year,with a total sunshine duration in the vegetationperiod that was 173.4 hours longer than normal.The level of precipitations in the same periodremained similar to the multi-year average, butrainfall was not distributed uniformly. Thesefactors led to an early development of the grapeberries, the rise in temperature having apositive impact on the accumulation of sugarsin the grapes. The acidity of must at harvesttime showed lower than optimal values, due tothe early arrival of the ripening phase and to ahighest rate of metabolisation of organic acidsat higher temperatures.The unusual aspect of the 2012 harvest was thatsome of the varieties for red wines reached fullmaturity at the same time with certain varietiesfor white wines. This phenomenon occurs onlyin dry years with hot summers, when thematuration of grapes is forced and mostvarieties mature at the same time.The ripening of grapes differs from one year toanother and from one vineyard to another,according to climate conditions, and thereforeevery year every grower must carefully monitorthe ripening of each variety.The harvesting of the grapes is a very importantoperation which must be done at the right time,since it has a major influence on the yield andquality of the harvest.REFERENCESBisson L.F., Waterhouse A.L., Ebler S.E., Walker M.A.and Lapsley J.T., 2002. The present and future ofinternational wine industry, Nature, Vol 418, p. 496-699.Cotea D. Valeriu, 1985. Tratat de oenologie, Vol 1, p.48.Jones, G.V. 2006. Climate and terroir: impacts of climatevariability and change on wine, in Fine Wine andTerroir – The Geoscience Perspective, Macqueen,R.W. and Meinert, L. D. (Eds.): Geoscience CanadaReprint Series Number 9, Geological Association ofCanada, St. John’s, Newfoundland, p. 247.Jones G.V., 2007. Climate change and the global wineindustry, Procedings from the 13-th Australian WineIndustry Technical Conference, Adelaide, Australia.Ladurie E., Bray B., 1971. Times of Feast, Times ofFamine: A History of Climate Since the Year 1000,Doubleday, Garden City, New York.Pfister, C., 1988. ‘Variations in the spring-summerclimate of central Europe from the high middleagesto 1850, Wanner, H. and Siegenthaler, U. (Eds.) :Long and Short Term Variability of Climate Berlin,Springer-Verlag, p. 57–82.Schultz H. R. and Jones G.V., 2010. Climate inducehistoric and future changes in viticulture, Journal ofWine Research, Vol 21, No 2, p 137-145.Tate A. B., 2001. Global warming’s impact on wine,Journal Wine Research, Vol 12, p 95-109.397

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653AbstractRESEARCHES REGARDING THE INFLUENCE OF APPLE FRUITSORTING UPON THE ECONOMIC EFFICIENCYIN THE COMMERCIALISATION PROCESSAdrian CHIRA, Lenua CHIRA, Elena STOIANUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Mrti Blvd., District 1, 011464, Bucharest, RomaniaCorresponding author email: achira63@yahoo.comVery often, the fruit treegrowing exploitations sell their gross production directly from the unit immediately afterharvesting, without storing it. The present paper aims at printing out the economic differences in apple within the fruittree-growing area of Voinesti –Dambivita country, comparing the gross selling of the quality – classified harvest. Thehigher economic efficiency, calculated for the Redix and Ariwa varieties in comparison with the Jonathan and GoldenDelicious varieties is also due to the fact that for the first two varieties the production costs were lower, thanks to thesmaller number of phytosanitary treatments, since these have genetic endurance to the scab disease.Key words: average quality coefficient, quality variation index.INTRODUCTIONIn Romania, agricultural exploitations moreand more market-oriented, becomingincreasingly commercial. In the traditionallyfruit tree-, grapevine – and vegetable – growingareas, the commercial feature is even moreobvious, as production always exceedsconsumption and the surplus is destined tomarket. Nevertheless, the economic results ofthe production activities are influenced byseveral factors such as: the exploitation size,average productions, product quality, availablefinancial resources, the exploitation manager’sexperience, pedoclimatic factors, etc.Production commercialisation also plays animportant part. Very often, the furuit treegrowingexploitations sell their grossproduction directly from the unit immediatelyafter harvesting, without storing it. Thiscommercialisation method is determined byvarious factors, among which: insufficient orimproper storage space; the need to obtainimmediate financial resources for starting theproduction cycle again; difficulties in the retailselling system (particularly the reduced timebudget of the producer – the only of theproducer – the only or the main working forceof the exploitation, additional expensesresulting from going to the market, etc).More, this commercialisation method mayderive the producer of an important share of theprofit which is transferred to the commerciallink. Fruit quality influences the valorizationprice directly (Stoian et al., 2002). The largefruit supply compared with the reduced demandresults is unique – price selling, neglecting theadvantages of previous merchandiseclassification according to quality.The present paper aims at printing out theeconomic differences in apple within the fruittree-growing area of Voinesti, Dâmbovita,comparing the gross selling for a unique priceper kilogram with the retail selling of thequality – classified harvest.MATERIALS AND METHODSThe data resulted from the actual results ofapple production in a family exploitationlocated in the fruit-tree growing area ofVoinesti, Dâmbovita. The varieties grown wereJonathan, Golden Delicious, Redix, Ariwa.The data analysis was performed by calculatingsome technical and economic indicators(income, expenses, profit), while the varietyquality assessment was made by determiningthe quality variation indices and the averagequality coefficient of the variety and the groupof varieties (Pana et al., 1983).399

RESULTS AND DISCUSSIONSFor this purpose, the production results refer tothe average production per hectare in the fourvarieties, out of which two (Redix and Ariwa)are genetically resistant to scab and powderymildew, while the others are considered thestandard for the winter – stored varieties.The fruit quality classification was based on thestandard diameter: 66 mm – Extra quality, 60mm – first quality, 55 mm – second quality; thefruit has fallen prematurely from the treesimproper for consumption were used fordistillation. The prices of the area in 2001 weredifferent, according to quality class: 1,8 Lei/kg– Extra quality; 1,5Lei/kg – first quality;1,1Lei/kg second quality; 0,4 Lei/kg forindustrial processing. For the gross selling, theprice in the area was 1 Leu/kg. Table 1 presentsthe production results obtained and the incomefrom the two commercialisation methods.The average production per hectare and itsstructure according to quality classes weredifferent from one variety to another, accordingto the variety potential and the weatherconditions of the year.The production selling according to qualityclasses may result in an income increasevarying according to variety from 2850 Lei/hato 5066 Lei/ha, which corresponds to anincrease of 21,9%-41,3%, compared with theretail commercialisation. The share of thevarious quality classes in the variety structureindicates that the first and second quality classfruit exceed the Extra quality and industrialprocessing fruit.The production expenses were higher in theJonathan and Golden Delicious varieties,compared with the Redix and Ariwa, as thelatter recorded less expense for phytosanitaryprotection due to their genetic resistance toscab and powdery mildew (Table 2).Moreover, when production is aimed atcommercialisation according to quality class,the production unit cost increases by 0,2 lei/kgas a result of fruit classification.The profit was calculated as difference betweenthe selling income and the total expenses, andvaried from one variety to another. Theanalysis of the profit obtained from the twocommercialisation methods pointed out to thefollowing:-the producer would be more economicallyadvantaged if selling occurred according toquality criteria;-the additional profit per hectare might varybetween 272 lei (Jonathan) and 2766 lei(Redix), which means an increase in the profitof 6,2-43,5%, compared with the gross selling;-the additional profits per hectare were almostfrom 4-7 times higher in the genetically –resistant varieties, compared with the standardones (Jonathan, Golden, etc).VarietyJonathanGoldendeliciousRedixTable 1. Production and income obtained from gross and quality – class apple sellingAverageproductiont/haProductionIncome fromSelling incomeIncome fromaccording to quality Price valorisation accordingdifference according togross valorizationLei/haclass Lei/t to quality classquality class tons % Lei % Lei %E 1,80 13,1 1800 3240 19,413700 +3012 +21,9I 5,12 37,4 1500 7680 45,9 13,7II 4,40 32,1 1100 4840 29,0Ind 2,38 17,4 400 952 5,7Total 13,70 100 (1220) 16712 100+22,6E 2,20 17,5 1800 3960 25,612,6I 3,80 30,1 1500 5700 12600 +2850 36,9II 4,50 35,7 1100 4950 32,0Ind 2,1 16,7 400 840 5,5Total 12,6 100 (1226) 15450 100+44,0E 2,90 25,2 1800 5220 31,5I 5,45 47,4 1500 8175 11500 +5066 49,3 11,5II 2,73 23,7 1100 3003 18,1Ind 0,42 3,7 400 168 1,1Total 11,5 100 (1441) 16566 100 10600 +4382 +41,3400

AriwaE 2,45 23,1 1800 4410 29,4I 5,12 48,3 1500 7680 51,3 10,6II 2,40 22,6 1100 2640 17,6Ind 0,63 6,0 400 252 1,7Total 10,6 100 (1413) 14982 100 VarietyIncome lei/haTable 2. Profit from gross and quality – class sellingGross sellingProduction expenseslei/haProfitlei/haIncomelei/haQuality – class sellingProduction expenseslei/haProfitlei/haProfitdifferencelei/ha %E 3240 1579,3 1660,7Jonathan 13700 9316-Ind 952 2097,91145,9I 7680 4508,9 3171,14384 II 4840 3869,9 970,1 272 6,2Total 13700 9316 4384 16712 12056 4656 E 3960 2072,7 1887,3GoldenI 5700 3565,0 213512600 9324 3276DeliciousII 4950 4228,3 721,7330 10,1Ind 840 1978,0 -1138Total 12600 9324 3276 15450 11844 3606 E 5220 1874,9 3345,1Redix 11500 5140I 8175 3526,5 4648,56360II 3003 1763,3 1239,72766 43,5Ind 168 275,3 -107,3Total 11500 5140 6360 16566 7440,0 9126 E 4410 1714,0 2696Ariwa 10600 5300I 7680 3583,9 4096,15300II 2640 1676,9 963,12262 42,6Ind 252 445,2 -193,2Total 10600 5300 5300 14982 7420 7562 The following emphases the influence of fruitquality in the two groups – standard andgenetically – resistant upon the economicresults obtained from commercialisationaccording the quality class.The I q variation index of quality according tovariety groups was calculated by the formula:than the second – quality and industrialprocessing. Nevertheless, per total, theproduction of genetically – resistant varieties,even if lower, has higher quality compared withthe standard group, particularly as a result inthe increase in the Extra and first – qualitycategories. The same is illustrated by theaverage quality coefficient Kri, calculated foreach variety andeach group, according to the formula:Where: Q1 = average production of genetically– resistant varieties according to qualityclassQ0 = average production of standardvarieties according to quality classThe valuesobtained were Iq Extra = 1.34; Iq I-st quality =1.18; Iq II quality = 0.57; Iq ind =0.23.Calculated for variety groups, the sameindex was Iq = 0.84. The values of the variationindex show that, in both variety groups, theExtra and first quality fruit number was higher401Where: qi = product quality according toquality class; gi = production share accordingto quality class; Ri = quality groupcoefficientThe average quality coefficientmeasures the quality of a product or group ofproducts when production is delivered

according to quality class.The calculated valueswere: Kri Jonathan = 2.54; Kri Golden = 2.51;Kri Redix = 2.06; Kri Ariwa =2.11.The valueof the coefficient is inversely related to thevariety quality; therefore, the order of thevarieties from the view-point of quality is:Ariwa, Redix, Jonathan, Golden Delicious (alsosee their correspondence with total andadditional profits from quality-classselling).The calculation of Kri for varietygroups resulted in the value of 2.08 for thegenetically-resistant varieties, and 2.52 for thestandard varieties. This shows that the formerrecord productions of superior average quality,compared with the latter, while the deviation of2.52-2.08=0.44 is the expression of thisdifference.CONCLUSIONSThe current practice of production valorizationin gross system is economicallydisadvantageous for the fruit producers.This results in profit loss which can reach morethan 40% of the total.It is necessary for the producers to becomefamiliar with the advantages and to turn themto better account.The establishment of some associative forms ofcommercialisation (cooperatives) wouldfacilitate quality – class selling.The apple varieties which are geneticallyresistant to some diseases have superiorproductions of average quality compared withthe standard varieties, and theircommercialisation according to quality classcan increase profits for the producers.REFERENCESPana I., Perca V., Manoiu I, 1983. Methods of economicassessment of agricultural products quality. CeresPublishing House, Bucharest.Stoian E., Chira A., Chira L., Popescu Ghe., 2002.Economic efficiency of apple productionvalorization according to quality. Lucrari stiintificeU.S.A.M.V., Seria B, vol. XLV, p. 72-76.402

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653STUDIES REGARDING THE E.U. STRATEGY IN THE FIELDOF AGRO-FOOD PRODUCT’ S QUALITYLenua CHIRA 1 , Adrian CHIRA 1 , Elena DELIAN 1 , Constana ALEXE 21 University of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Mrti Blvd, Sector 1, 011464, Bucharest, Romania2 Institutul de Cercetare Dezvoltare pentru Industrializarea i Marketingul Produselor HorticoleHorting, Intrarea Binelui nr. 1 A, sector 4, Bucharest, RomaniaAbstractCorresponding author email: lenutachira@yahoo.comBoth basic agricultural products and those with an added value are confronted with an ever increasing competition onthe E.U. market due to the pressure carried out by the products originated in non- E.U. countries, where productioncharges are lower. Therefore, this being the case, the main success recipe for farmers and processors remains thepromotion of quality. The E.U.’s agricultural policy aims at bear up their efforts through community systems andregulations along two main guidelines: basic standards and measures for quality promotion. Over the last years theconsumers’ demand for ecological products has increased. To this effect since 1991 the E.U. has been applying astandard which provides laws regarding the ecological agriculture both for European producers and processors andfor the exporters which come from non-E.U. countries and who want to commercialize ecological products on the E.U.market. The basic principles of the ecological agro-food production have to comply with the requirements of the834/2007 E.U Regulation which also makes mention of the method of labeling and certifying used for ecologicalproducts. Obtaining qualitative products which also correspond to the requirements of the retail chains presupposes theconformation to a set of standards, known worldwide under the name of Global G.A.P. rules, according to whichfarmers and processors can become certified , thus obtaining the statute of the market’s preferred provider.Key words: certification, farmers, labelling, quality, requirements.INTRODUCTIONTaking into consideration the fact that at themoment Earth’s population consists of over 7billion inhabitants and in the near future a moresubstantial increase is foreseen it can beinferred that the demand for agro-food productswill raise rapidly. Vegetables, fruit, grapes,wine and all the other horticultural by-productshave always been highly valued by consumersall over the globe, playing an important role innutrition (Dejeu et al., 1997). The considerableincrease of the horticultural production has tocomply with the ever rising standards anddemands imposed by the consumers.The E.U.’s agricultural policy has to bear up thefarmers’ efforts in occupying the first positionsin the quest for quality. The first steps for thatpurpose have already been taken throughcommunity systems and regulations along twomain guidelines: basic standards and measuresfor quality promotion.E.U’s merchandising standards are regulationswhich imply definitions of products, basic/403minimal standards and labeling requirementsfor customers’ information for a large numberof agricultural products and for some finitefood products. Their aim is that of helpingfarmers deliver qualitative products that meetthe consumers’ expectations, avoiddisappointing the latter and facilitate thecomparison of prices regarding different classesof product quality (Banu et al., 2007).Merchandising standards have been adopted inorder to replace the various national standardsand to thus facilitate the commercial trades onthe exclusive market.Consumers’ request for ecological foodproducts has risen constantly over the lastyears, demand exceeding supply. Thecommunity market of agro-food ecologicalproducts continues to be fragmented at anational level.Since 1991 the E.U. has been applying astandard that implies rules concerningecological agriculture for European producersand processors and for the exporters from the

third party countries who wish to bringecological products into the community market.The community standard strictly observes therules regarding ecological agriculture whichhave been established within the internationalstandard adopted through Codex Alimentarius,which facilitates the recognition of communityecological products that are exported to othercountries.The goals of strategy and policy for the branchof the ecological agriculture were established in2004 and defined in ‘’The European ActionPlan for Food Products and EcologicalAgriculture’’. The most important legislativeprocess consisted of the framing of a newregulation regarding ecological agriculture,enacted in June 2007.The certification systems can enable retailers toassure or to impose conformation to certainproduction and delivery constraints. Theemergence of these systems along the years isthe result of the assessments performed by theretailers which have highlighted the consumers’wish of knowing more details about the foodproducts they are purchasing. The main aspectsthe consumers are concerned of are hygiene(sanitation), safety and the price.Agricultural product qualities includes bothproduct characteristics (physical, chemical,microbiological and organoleptic features –size, appearance, taste, look, ingredients, etc.)and farming attributes (production method,type of animal husbandry, use of processingtechniques, place of farming and of production,etc.).The quest for quality is a vital part of the EUagro-food sector’s strategy in the globalmarketplace. The EU remains an importantproducer of basic agricultural products.Buying food and drink produced in the EUmeans buying quality, chosen from a richdiversity of products reflecting the differenttraditions and regions in the Community.Consumers around the world know this: theEU’s agro-food sector has a reputation for highquality thanks to decades or even centuries ofhard work, investment, innovation and attentionto excellence.This tradition of high quality operates inseveral ways. At a basic level, all farmers in theEU are legally bound to respect some of themost stringent farming requirements in the404world. Among other things, these relate toenvironmental protection, animal welfare andthe use of pesticides and veterinary products.Beyond these basic requirements, farmers andfood producers use their expertise andimagination to give their products other,individual qualities valued by consumers.MATERIALS AND METHODSIn order to be able to perform this studyconcerning the E.U. strategy regarding thequality increase of the agri food products wehave used a series of present-day standards,norms and legal requirements as our source ofinformation, among which I mention:- The E.U. Regulation 834/2007 regarding theobtainment, labeling and certification ofecologic products,- The GlobalGAP Standard regarding theimplementation of good agriculturalpractices for the obtainment of the farmcertification according to the norms,- The Green Paper on agricultural productquality.As a result of these materials and of someresearch papers or specialized publications wehave carried out a synthesis which shows thecurrent situation and the E.U. tendenciesregarding the production andcommercialization of quality agri foodproducts.RESULTS AND DISCUSSIONSThe results of the study which was carried outwere structured in such a manner so as toenable the presentation of the aspects regardingthe production, labeling and certification of theecologic products, of the geographicalindications products and of that of traditionalproducts.THE CURRENT STATE WITHREFERENCE TO THE LABELING ANDTHE CERTIFICATION OF AGRO-FOODPRODUCTSAn essential goal of agricultural quality policyis to inform buyers and consumersabout product characteristics and farmingattributes. Unless buyers and consumers haveaccurate, useful and guaranteed informationabout these characteristics and attributes, theycannot be expected to pay a fair price.

Agricultural quality policy has evolved overtime. However, this evolution has taken placeon a piecemeal basis — instrument byinstrument, sector by sector. Combining thevarious instruments into a more coherent wholeand developing the overall policy would help itto deliver even stronger results. This furtherdevelopment must be sufficiently flexible, takeaccount of the private and national schemesthat dominate the market and ensureinnovation. The full picture is shown in Figure1.Schemes can be either ‘certification-type’ or‘labelling-type’. Certification is best when theundertakings made are complex; these areusually laid down in a detailed specificationand checked periodically (e.g. annually), forexample by a certifying body. Labellingmeasures are best for relatively straightforwardclaims that are normally self-declared byproducers and subject to official controls.Both certification and labelling can show that aproduct meets baseline standards. They canalso both be used to indicate value-addingqualities beyond baseline standards — eitherproduct characteristics or farming attributes.Figure 1. Quality and assurance certification schemesand marketing standards (http://ec.eur-lex.europa.eu/.)Consultations on the development ofagricultural product quality policy began in2006 with a stakeholder hearing, followed by aconference in Brussels on 5-6 February 2007(Codex Alimentarius Commission and the UNEconomic Commission for Europe). TheCommission also launched policy reviews of405the schemes for geographical indications foragricultural products and foodstuffs and fortraditional specialities guaranteed. This workculminated in the Green Paper consultation andthe High Level Conference on AgriculturalProduct Quality held in Prague on 12-13March 2009 (Green Paper on agriculturalproduct quality-COM 2008 641).The main messages from stakeholders includedstrong support for the E.U’s main qualityschemes (geographical indications and organicfarming) and marketing standards, but alsocalled for simplification and streamlining.Farmers, producers and consumers urgedgreater use of place of farming labelling. Onthe other hand, processors and retailers warnedthat it can be difficult to track the farmingorigins of ingredients in processed foodstuffs.As a result of these consultations andexamination of the current measures, theCommission has identified three main issues tobe addressed in developing agricultural productquality policy, namely:– Information:to improve communicationbetween farmers, buyers and consumers aboutagricultural product qualities;– Coherence: to increase the coherence of EUagricultural product quality policy instruments;– Complexity: to make it easier for farmers,producers and consumers to use and understandthe various schemes and labelling terms.Agricultural product quality policy shouldcontribute to achievement of the objectives ofthe CAP. In particular, sustainability of farmingsystems should be further enhanced throughquality policy, and the farming attributes ofproducts of such systems should be betterknown and communicated to citizens andconsumers.Against this background, it is proposed todevelop agricultural product quality policythrough a structured approach, comprising:– For certification-type schemes, thedevelopment of guidelines for good functioningof certification schemes, and ensuringcoherence of any new E.U. schemes.– For labelling-type measures, development ofE.U.marketing standards within the singleCommon Market Organisation.In addition, existing EU schemes andmarketing standards should be simplified andclarified wherever possible.

Stakeholder comments concerned notably theintroduction of the Ecolabel and its potentialoverlap with the existing organic scheme.AIMS REGARDING THE PROMOTIONOF AGRO-FOOD PRODUCTS’ QUALITYE.U. farming requirementsThe Green Paper asked how farmers can bestshow that they have complied with basic EUrequirements, such as environmental rules,animal welfare standards, and strict controls onuse of pesticides and animal health products.Two possibilities were raised: an ‘EUrequirements’ label or logo, or obligatory placeof-farminglabelling. An ‘E.U. requirements’label would be shown on all products (EU orimported) that had been farmed in line with EUminimum requirements. In the Green Paperresponses, the overwhelming view fromconsumers, farmers, processors and retailersand others, was opposed to such a label. On theother hand, many respondents supportedgreater use of place-of-farming labelling asgiving useful basic information aboutagricultural products.Marketing standardsMarketing standards and product directivescontain technical descriptions of agriculturalproducts, their composition, characteristics andthe production methods used. Fisheriesproducts are also covered by a specificmarketing regime. They have been adopted notonly by the EU, but also by multilateral bodies(Food Quality Schemes). There are four typesof information contained in marketingstandards (Table 1).Table 1. Types of marketing standard (http://ec.eurlex.europa.eu/.).RESERVED TERMSPRODUCTCLASSIFICATIONExamples: „free range, eggs:„barn” egs, „first cold pressed”,extra virgin and virgin olive oil,„traditional method”, sparklingwineExamples: friut: extra, class 1,class 2Eggs: large, medium, smallExamples: definition of butter,fruit juice, chocolate, wine,PRODUCT IDENTITYextra virgin olive oilORIGIN OR PLACEOF FARMINGLABELLINGExamples:fruit and vegetables:place of harvestOlive oil: place of harvest andof presiing406In their responses to the Green Paper, farmersand producers, processors, traders and retailerssupported marketing standards, saying they areneeded for sellers to demonstrate the quality ofproduct they offer, and for purchasers to knowwhat they are buying. However, there were alsocalls for simplification. EU marketingstandards were criticised for being too detailed,too prescriptive — relying on compulsory ruleswhen voluntary rules would suffice — and forbeing too cumbersome to adapt quickly tochanging market circumstances.Many respondents to the Green Paper alsowanted „optional reserved terms” to bedeveloped, for example to define what can becalled „mountain product” and „low carbon”.„Optional” reserved terms do not have to beused to describe product in commerce or onlabels, but if they are used, the product mustcorrespond to the definition laid down.In addition, consumers and farmers called forgreater use of „place of farming” labelling(Table 2).The Commission intends to address thefollowing aspects of marketing standards:– need for general basic standard:Compulsory rules could be laid out in a generalbasic marketing standard. This would coverthose matters where a voluntary approachmight distort the single market or compulsorylabelling is necessary to provide consumerswith basic information about products.– place-of-farming labelling:To respond to many consumers’ and farmers’preferences for labelling that identifies theplace where agricultural product was farmed,the Commission will consider appropriatelabelling within marketing standards foragricultural products, while taking into accountthe specificities of some sectors, in particularconcerning processed agricultural products.Table 2. Demand for place of farming labelling(http://ec.eur-lex.europa.eu/.). Placeof farminglabelling Obligatory country of origin labellingand/or place of farming labelling has beenintroduced in Australia (all agriculturalproducts and foodstuffs) and the US(selected agricultural product sectors),among other countries. In the EU,obligatory place of farming labellingapplies to beef and veal, fruit andvegetables, eggs, poultry meat, wine,

honey, olive oil (from 2009) and EUorganic products (from 2010). Originlabelling also applies to aquacultureproducts.„Place of farming” in the context ofmarketing standards refers to the place ofharvest of crop products, birth and raisingof livestock, the place of milking for dairycows, and so on.„Origin” may refer, in the case of aprocessed product, to the place of lastsubstantial transformation, and thereforenot necessarily to the „place of farming” ofthe agricultural product.Optional reserved termsOptional reserved terms should be used whereit is necessary to define information aboutproduct qualities for consumers (e.g. „first coldpressed” extra virgin and virgin olive oil). As apossible alternative to EU legislation, theCommission will investigate further the optionof using CEN, the European Committee forStandardisation, for detailed rules of this type.In addition, the Commission will examine thefeasibility of laying down specific optionalreserved terms for „product of mountainfarming” and „traditional product”.One way of setting more appropriate marketingstandards could be to ask stakeholders todevelop the rules themselves. This is alreadydone for the development of industrialstandards under CEN (Table 3).Table 3. CEN (http://ec.eur-lex.europa.eu/.). The EuropeanCommittee forStandardisation(CEN) CEN is a private entity with 30national members, from EUMember States, and EFTAcountries. CEN activities are theresult of collective activities ofstakeholders, manufacturers, users,research organizations, governmentdepartments, and consumers.CEN develops voluntary EuropeanStandards (ENs). These become thesingle common standard in all 30countries. ENs help build aEuropean Internal Market for goodsand services and assist internationaltrade.– international standards:The Commission will continue to refer to andcontribute actively to the developmentof international standards.Geographical indicationsGeographical indications are names thatidentify products as originating in a territorywhere a given quality, reputation or othercharacteristic of the product is essentiallyattributable to its geographical origin(ec.europa.eu). The geographical indicationsschemes provide protection of intellectualproperty rights for products described byregistered geographical indications; andmarketing assistance, primarily by conveyinginformation as to compliance with thegeographical indication system. The schemesenhance the credibility of products in the eyesof consumers and enable fair competitionbetween producers.Representatives of producers of geographicalindication products have called for greaterrights and control over their use — forexample, to control production (using quotas),and to control the use of geographicalindication names on the packaging of processedproducts.In the international context, the geographicalindications system is well established in the EUand in many non-EU countries. However, insome trading partners, specific legislation doesnot exist or EU names are not widely protectedwithin the non-EU-country systems.Organic farmingSince 1991, the E.U. organic farmingregulation has protected the identity and theadded value of the „organic”, „biologica”’,„ecologica”’, „eco” and „bio” labels. Organicfarming is defined in EU legislation and atinternational level in a Codex Alimentariusguideline. This means consumers can beconfident of the quality of organic products andit facilitates trade in the single market and withnon-EU countries.In order to foster trade in organic products, theCommission will seek mutual recognition oforganic standards with non-EU countries andwill contribute to the development of the CodexAlimentarius organic guideline.Beginning with 2010, the label of the organicproducts obtained in E.U. feature the new ecoleaflogo, as shown in Figure 2.407

Figure 2. The „Eco-leaf” logo of E.UTraditional specialitiesThe EU scheme for registration of „traditionalspecialities guaranteed” was intended toidentify and protect the names of traditionalproducts.The Commission proposes to investigate thefeasibility of introducing the term „traditionalproduct” as a reserved term defined withinmarketing standards and abolishing the currentscheme.CONCLUSIONSPractical steps should improve communicationbetween farmers, buyers and consumers on thequality of agricultural products, unify rules onagricultural products quality, and simplifyschemes and labels.The main aims the E.U. farmers should be inroute for in order to obtain higher-rankingproduct exploitation and a raise of the incomeare:-obtaining ecological products;-promoting products with geographicalindications;-certifying the production systems according tothe ISO, quality and food product safetystandards.The certifying of producers and processors ofagro-food products according to the standards(example Global G.A.P etc) determines theirstatute as the market’s preferred provider.The raise of the level of the consumers’education determines their purchasing of theagro-cultural products according to the relationbetween quality and price, which favors thoseproducers and processors which have beencertified according certain laws and standards(for example Codex Alimentarius, etc).REFERENCESBanu C. et al., 2007. Calitatea si analiza senzoriala aproduselor alimentare. Editura AGIR, Bucuresti.Dejeu L., Petrescu C., Chira A., 1997. Hortiviticultura siprotectia mediului inconjurator, Editura Didactica siPedagogica, Bucuresti.Codex Alimentarius Commission and the UN EconomicCommission for Europe (UN/ECE).Green Paper on agricultural product quality: productstandards, farming requirements and quality schemes– COM (2008) 641.http://register.consilium.europa.eu/pdf/en/http://foodqualityschemes.jrc.ec.europa.eu/en/documents/ReportSTKHHearing_final.pdfhttp://ec.eur-lex.europa.eu/.http://ec.europa.eu/agriculture/organic/home408

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653A PRACTICAL APPROACH OF TRACEABILITYIN THE WINE INDUSTRYAbstractGeorge A. COJOCARU, Arina Oana ANTOCEUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Mrti Blvd., District 1, 011464, Bucharest, RomaniaCorresponding author email: aantoce@yahoo.comTraceability in the wine industry has an undeniable role in a quality assurance management system. It ensures that allmanipulations of raw materials, ingredients and final products are recorded on specific documents, created especiallyto allow a rapid retrieval of the product history. The wine supply chain requires traceability from grape production toprocessing and wine distribution. Maintaining traceability records on specific documents has many benefits for bothproducers and consumers. A practical traceability system ensures: efficient process logistics, rapid decision making bythe producers, but also provides the consumer confidence in the authenticity of wines and proper usage of approvedoenological practices and safety procedures during production. In spite of the legal requirements for traceabilitysystems, they are not widely applied in our wine industry and the documents involved are difficult to be maintained andupdated. This paper proposes a series of specific documents to be used for a more efficient and practical system oftraceability in the wine industry.Key words: traceability, wine, quality assurance management system.INTRODUCTIONHowever, “traceability means the ability totrace and follow a food, feed, food-producingTraceability is regulated by national law no.animal or substance intended to be, or expected150/2004 on food safety and feed, modifiedto be incorporated into a food or feed, throughand completed by law no. 412/2004 and byall stages of production, processing andRegulation (EC) no. 178/2002 of the EuropeanParliament and of the Council of 28 Januarydistribution” (Legea nr 150/2004 si Legea2002, laying down the general principles and412/2004). Article 18 of Regulation (EC) no.requirements of food law, establishing the 178/2002 refers explicitly to tasks of operatorsEuropean Food Safety Authority and laying regarding traceability. According to Article 18down the procedures regarding food safety. In of Regulation (EC) no. 178/2002, winemakingaccordance to legislation, operators must apply operators must comply with the followingthe food legal regulation at all stages of the rules:-traceability shall be established at allwine supply chain, from the production and stages of production, processing andprocessing to transportation and distribution distribution.-winemaking operators shall bestages. Thus, operators are responsible by law able to identify any person from whom theyfor ensuring the traceability of products at all have been supplied with grapes, must, wine, orstages of the production, processing and any oenological substance intended to be, ordistribution, including raw and auxiliary expected to be, incorporated into grapes, mustmaterials packaging materials and operating or wines. -winemaking operators shall have inmaterials. Moreover, materials and oenological place systems and procedures which allow forpractices are specified by Commission this information to be made available to theRegulation (EC) no. 606/2009 of 10 July 2009 competent authorities on demand.-winemakinglaying down certain detailed rules for operators shall have in place systems andimplementing Council Regulation (EC) no. procedures to identify the other businesses to479/2008 as regards the categories of grapevine which their products have been supplied. Thisproducts, oenological practices and the information shall be made available to theapplicable restrictions.competent authorities on demand.-winemakingproducts shall be adequately labeled or409

identified to facilitate its traceability, throughrelevant documentation or information inaccordance with the relevant requirements ofmore specific provisions.MATERIALS AND METHODSImplementation of traceability in wine industryimplies the existence of correlated registrationdocuments for each stage of production anddistribution. For this reason all processes andtechnological operations must be recorded inspecified documents, corresponding to eachproduct stage.Based on the specific technology of grapeproduction to distribution it was considerednecessary to create specific documents toachieve total traceability.This tracking system was developed for awinery located in southern Romania, in thewine region 'Terasele Dunarii' where 500tonnes of grapes of various varieties areprocessed yearly.In order to implement a traceability system, thefirst issue to be resolved concerns the divisionof the entire surface in farms, physical blocksand parcels. It is also necessary that thedivision of the total area takes into account thegrape varieties grown and specific climatic andedaphic conditions because the grapes areharvested and wine batches are formed basedon the grape quality and characteristics. If thesurfaces are not divided properly, the quality ofthe final products may be affected.The specific documents deemed necessary tomaintain a robust traceability system arehereafter presented.Vineyard Record Keeping File. Necessary torecord data from vineyard parcels, thisdocument is a table that contains the followingcolumns:- Date;- Farm / Physical Block / Parcel (F/PB/P) ,same with batch of grapes and containingthe number of a parcel from specifiedphysical block and farm (eg. 1/221/4, whichmeans F/PB/P); this is the most importantkey link for history retrieval;- Area (ha) , referring to parcel;- Preformed works, a column where specificoperations performed in the vineyard aredescribed;410- Auxiliary materials used, referring tofertilizers, pesticides and herbicides;- Dose, referring to dose of the treatmentmaterial used;- Responsible, who is the person whoperformed the work;- Observations, another notes.Grape Maturation Report. Necessary torecord grape maturation evolution data fromvineyard parcels, this document is helping todetermine the optimal time to harvest; is themost critical decision of the grower andwinemaker. Good quality of the grapes atharvest allows for a maximum potential in winequality. Incomplete ripen grapes contain lesssugar, very high acidity, harsh tannins and'green' aromas. Overripen grapes may also leadto uncharacteristic flavor and low acidity. If theassessment is not done properly and harvestdecision is not appropriate, wine quality maybe affected (Zoecklein B.W., 2001).Unfortunately, grape maturity assessment isdifficult to perform, due to the involvement ofseveral factors and the necessity to measureseveral physico-chemical parameters, that arenot always directly correlated (Coombe B.G.,1992; Robinson S.P. and Davies C., 2000).This document is kept for each parcel andcontains the following identification elements:- Variety;- Vintage;- Farm / Physical Block / Parcel, a codewhich is linked with Vineyard RecordKeeping and Harvest Delivery records.In addition to the identification elements, thisdocument contains sets of analyzes of grapesfrom that parcel (Date; Sugars, in g/l; TotalAcidity, in g/100 ml tartaric acid, pH, Brix,Brix*pH² index, Brix/TA index and% v/vestimated alcohol).Harvest Delivery Note. It is a document thatmust contain the following identificationelements: Document number; Variety; Farm/ Physical Block / Parcel; Estimated quantity(kg) ; Real quantity (kg) . This documentaccompanies the grapes to the wine cellar andused for tracking and accounting records. Theestimated quantity is evaluated at the floweringstage and is used for planning in the cellarahead of harvest.Quantitative Grape Receiving Report. It is atracking document used to link the small grape

atches delivered to the winery with fullbatches of grapes resulted from several smallgrape baches and used for a batch of wine. Thereport contains the following columns:- Date/Time;- No. of Delivery note;- Variety;- Harvest mode;- Grape batches (F/ PB/P);- Variety purity (%) ;- Sanitary state of the grapes (% of the saneand affected grapes);- Quantity of small batch (kg);- Total amount per full batch (kg);- Full batch code. It is used to determine thequantity of grapes used per batch ofmust/wine.Qualitative Grape Receiving Report. It is aquality control document for full batches. Itcontains the following identification elements:- No. of document / Date;- Variety / Assortment;- Vintage;- Full batch code;- Total amount of grapes (kg) ;- Variety purity (%) ;- Sanitary state of grapes (%) ;- Harvest method;This document is drawn up after cold settlingoccurs and should contain almost all analyseswhich can be made. Basic analyses are groupedas following:- Sensory analysis of must (Appearance;Color; Odor; Taste;).- Physico-chemical analysis of must (YeastAssimilable Nitrogen; Total acidity, g/ltartaric acid (pH=7); Sugars; Density; pH;Brix; Index Brix*pH²; Index Brix/Ta;Turbidity;).- Analysis performed after corrections(Acidification; Enrichment of sugar; Totalacidity, g/l tartaric acid (pH=7); Sugars,refractometrically; Density; pH; Brix; IndexBrix*pH²; Index Brix/Ta;).Winemaking Batch Sheet. This is the maindocument that includes the processinterventions performed during all stages ofwinemaking. The document contains the fullbatch code and the following columns:- Process / Technological operation;- Date and time;- Inputs;411- Outputs;- Differences;- Measurement unit;- Initial tank no.;- Final tank no.;- Lees tank no.;- Oenological materials used,concentrations, parameters, analyses, etc.This document shows the history of any wineand allows the oenologist to find at anymoment each stage of the applied technology.Blending Report. It is a document that isdrawn when the oenologist wants to make ablend. This document serves both as trackingsheet and a file for the accounting department.It includes the following identificationelements:- No. of document / date;- New batch code;- Variety / Assortment;- Initial Quantities and Batches from whichthe blend was formed.Additional information may be tank numbersof the used batches and alcohol concentration(v/v) of the blend.Bottling Report. This documents is filledwhen wine is ready for bottling. It contains thefollowing identification elements:- Internal batch number;- External batch:No. of document / date;- Variety / Assortment;- Vintage.Contains two tables. First table contains: Inputquantity (liters); Effective quantity (liters);Loss (liters); Bottling recipient capacity (litri);No. of bottling recipients used; No. of Samples;The second table contain: Materials used; Manufacturer;Batches; Quantity of materials (inpieces); Outgoing finished products (pieces);Loss (pieces); Samples materials (pieces).This report may contain a section forcomments.Declaration of conformity. It is the documentthat accompanies the delivered goods Mandatoryinformation which appears on thisdocument is:- No. of document / date;- Beneficiary;- Invoice / Delivery note no. / date;- Brand / Class of quality / Variety /Assortment;- Batches of wines delivered;

- Analysis reports;This document may contain a text by themanufacturer assumes the responsibility thatthe products comply with the law.Delivery Note or/ with Invoice. Proof of salesand purchases of goods.RESULTS AND DISCUSSIONSThe result of wine traceability chain is drawnthrough a flow chart in figure 1.CONCLUSIONSFigure 1. Flow chart of traceability at all stages of the production, processing and distribution.A traceability system for a medium-size cellarwas proposed and the system documents weredrawn and presented. The system improves themanagement in vineyards and cellars, byretrieval history of a parcel and / or a product.The usage of these system documents tomaintain traceability in wine production unitsimproves the quality management, by ensuringthat the raw and auxiliary materials are ofquality, the practices are also recorded andcontrolled, so that the resulted wines are safeand of the expected level of the designedquality.Also, traceability documents are and importantpart of the product recall procedure. Theycontain information which allows us to detectcertain deviations from the normal processwhich may make the final product unsafe or ofa lower quality than the one expected by theconsumer. In case of identifying any safety orquality issue during the process of winemaking,storage or bottling, based on these easy-to-usedocuments we can quickly and surely withdrawfrom the market that particular batches, withminimal financial effort.This model has the advantage against trackingcomputer programs, that enables centralizedview of history on winemaking batch sheetwhich is displayed directly on the wine container.So the oenologists can find out at any timethe wine history.Another advantage is that the operations performedare written in winemaking batch sheetby the cellar foremen at the moment of operationperforming and thus is not possible toforget to update the winemaking batch sheet. Inthe case of a software, updates can be forgottenwith major consequences.Also, these winemaking sheets posted on thetanks provide quick information and allow for412

an efficient decision making. Viewing the resultsof regular analyses on these records givesthe oenologists valuable information regardingthe stability of wine, for example, or whatwines to take for more detailed tests in the viewof creating commercial blends.These documents can also be maintained andupdated by using software programs that workswith sheets and can create databases (i.e. Excelsoftware). Such documents can be updated inreal time or weekly, so that, all the informationappearing on tanks, can also be maintained oncomputer.This type of tracking also provides informationto be used to establish the cost of wine and theprice. Accountants can use these data tocalculate prices and to classify in accordance tothe price each batch of wine.Last but not least, the fact that the team leadersis required to write down all the technologicaloperations performed, makes them morequality oriented and responsible for the workdone.REFERENCESCoombe B.G., 1992. Research on developmentandripening of the grape berry. American Journal ofEnology and Viticulture 43, p. 101-110.Robinson S.P., Davies C., 2000. Molecular biology ofgrape berry ripening. Austral. J. Grape Wine Res. 6,p. 175-188.Zoecklein B.W., 2001. Grape sampling and maturityevaluation for growers. Wine East. 29, p. 12-21.Legea nr. 150 din 14 mai 2004 privind siguranaalimentelor i a hranei pentru animale;Legea nr. 412 din 18 octombrie 2004 pentru modificareai completarea Legii nr. 150/2004 privind siguranaalimentelor i a hranei pentru animale;Regulation (EC) no. 178/2002 of theEuropeanParliament and of the Council of 28 January2002, laying down the general principles andrequirements of food law, establishing the EuropeanFood Safety Authority and and laying downprocedures in matters of food safety;Commission Regulation (EC) no. 606/2009 of 10 July2009 laying down certain detailed rules forimplementing Council Regulation (EC) no.479/2008as regards the categories of grapevine products,oenological practices and the applicable restrictions413

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653AbstractSAMPLING PROCEDURES APPLICABLE FOR THE QUALITYASSURANCE SYSTEMS IN THE STARCH INDUSTRYGeorgiana DECIU, Arina Oana ANTOCEUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Mrti Blvd, District 1, 011464, Bucharest, RomaniaCorresponding author email: aantoce@horticultura-bucuresti.roSampling is one of the most important factors influencing the analysis results. When the results of several analyses areused to develop and implement a monitoring system which must assure the product quality and food-safety, thisbecomes a primary element. As an analysis result can be used in the development of such system, the sampling shouldbe as accurate as possible. The sampling methods are various and depend in principal by the sampled material, thematerial state of aggregation, physical and chemical properties and last but not least, by the presentation mode. At thismoment, the sampling procedures applicable in the starch industry are presented in several standards and have ageneral description based on product categories (e.g.: ISO 24333:2009 Cereals and cereal products – Sampling). Forthe industry, however, these general guidelines are sometimes difficult to apply as such. This paper aims to review thesampling procedures applicable in the starch industry and to create specific sampling method guidelines developed fora starch factory in order to create an optimal monitoring system capable to assure the quality and food-safety forproducts and by-products.Key words: food-safety, quality, sampling, starch.INTRODUCTIONMATERIALS AND METHODSSampling is one of the most important factorsinfluencing the analysis results (Alexander etal. 2007; Thomas et al., 2012). The sample hasto be big enough and representative for wholebatch. The sample size is proportional to thebatch size and depends, in principal on thematerial type and analysis type (Paakkunainenet al., 2009; Tokman N., 2007).For the development of a monitoring systemIn order to establish a specific optimalsampling procedure for the starch industry, weidentified the main international samplinginstructions included in various standards andregulations as follows: SR EN ISO 24333:2009Cereals and cereal products – Sampling,Commission regulation (EC) No 401/2006 of23 February 2006 laying down the methods ofsampling and analysis for the official control ofcapable to assure the product quality and food the levels of mycotoxins in foodstuffs,safety the most important step is fixing theoptimal and specific sampling procedure.For the starch industry, excepting intermediaryproducts, there are three types of materials:grains (corn and corn germs), milled products(starch, corn gluten feed and corn gluten meal)and viscous liquids (glucose syrups).Taking into account all these aspects, this paperpresents and compares all the internationalsampling instructions applicable for the cerealsand cereals products in order to establish thespecific optimal sampling procedure for thefinal products in a starch factory.Commission Regulation (EU) No 836/2011 of19 August 2011 amending Regulation (EC) No333/2007 laying down the methods of samplingand analysis for the official control of the levelsof lead, cadmium, mercury, inorganic tin, 3-MCPD and benzo (a) pyrene in foodstuffs,Commission Regulation (EC) No 152/2009 of27 January 2009 laying down the methods ofsampling and analysis for the official control offeed, Commission Directive 2002/63/EC of 11July 2002 establishing Community methods ofsampling for the official control of pesticideresidues in and on products of plant and animalorigin and repealing Directive 79/700/EEC,Decree ANSVSA No. 27 of 06.06.2011regarding the approval of hygiene and415

microbiological criteria for foodstuffs otherthan those mentioned in Regulation (EC) no.2.073/2005 of 15 November 2005 onmicrobiological criteria for foodstuffs,Commission Regulation (EU) No 619/2011 of24 June 2011 laying down the methods ofsampling and analysis for the official control offeed as regards the presence of geneticallymodified material for which an authorisationprocedure is pending or the authorisation ofwhich has expired.The international standard SR EN ISO24333:2009 Cereals and cereal products –Sampling was the starting point and it wasadapted by other relevant sampling documentsto be found in EU-regulation or specificliterature. SR EN ISO 24333:2009 is applicable“for the dynamic or static sampling, by manualor mechanical means, of cereals and cerealproducts, for assessment of their quality andcondition” (SR EN ISO 24333:2009). It is notappropriate for the determination of thepresence of adventitious genetically modifiedmaterial in non-GM products and formicrobiological criteria. These omissionswould be dealt with only the EU-regulation andspecific literature.The information contained in these documentswere interpreted, adapted for the intended useand transposed into a centralised, specific andoptimal sampling procedure.RESULTS AND DISCUSSIONSFor cereals and cereal products we identifiedseven referential documents which areapplicable for the starch industry.Taking into account the instructions mentionedin these documents and the specific of thestarch factory took for example, we centralizedthe information and issued a single samplingprocedure for raw material and final products.There were identified four categories ofanalyses: specific for product qualitydetermination, for contaminants identificationand determination, microbiological analysesand analyses for non-GMO products.For contaminants the sampling proceduresdepend on the type of the contaminant, beingdifferent for mycotoxins, heavy metals andpesticides.In Table 1, we present the documents wheresampling instruction can be found. It can beseen that for specific quality analysis the onlyharmonized and internationally recognizedsampling procedure is SR EN ISO 24333:2009.This standard indicates a single sample size (1to 3 kg) depending on various criteria like thebatch size, the minimum number of elementarysamples and its size, the sampling method(mechanical or manual) or the packaged unitweight.The minimum sample size is indicated also forcontaminants like ochratoxin A (10 kg),pesticides, heavy metals, dioxin (1 kg), othercontaminants (3 kg). To complete these values,the EU regulations establish the sample sizedepending on the batch size and packagingmode (bulk or packed).Taking into account the product categoriespresented in these documents, we split starchproducts as follows:- Grains:- in bulk:- corn- corn germs- packed:- corn germs:- in big-bags- Milled products:- in bulk:- corn starch- corn gluten feed- corn gluten meal- packed:- corn starch:- in paper bags of 25 kilos- in big-bags- corn gluten feed:- in big-bags- corn gluten meal:- in big-bags- Liquid products:- in bulk:- glucose syrup- packed:- glucose syrup:- in recipients of 45 and 150 kilos- in recipients of 1100 kilos416

Table 1. Sampling procedures applicable for starch industryProduct category Analysis categorySampling procedures applicableInternational standards Legislation (EU / RO) in forceSpecific for quality SR EN ISO 24333:2009 -Contaminants mycotoxins SR EN ISO 24333:2009 Commission Regulation (EC) No 401/2006Food products heavy metals SR EN ISO 24333:2009 Regulation (EC) No 333/2007 pesticides SR EN ISO 24333:2009 Commission Directive 2002/63/ECMicrobiological - Decree ANSVSA 27/2011 non-GMO - 2004/787/EC: Commission RecommendationSpecific for quality SR EN ISO 24333:2009 -Contaminants mycotoxins SR EN ISO 24333:2009 Commission Regulation (EC) No 152/2009 heavy metals SR EN ISO 24333:2009 Commission Regulation (EC) No 152/2009 pesticides SR EN ISO 24333:2009 Commission Directive 2002/63/ECFeed products dioxine SR EN ISO 24333:2009 Commission Directive 2002/70/ECCommission Regulation (EC) No 152/2009; other contaminants SR EN ISO 24333:2009Commission Directive 2002/63/ECMicrobiological - -non-GMO - 2004/787/EC: Commission RecommendationThe analysis categories were split in sixcategories:- specific for quality- mycotoxins- heavy metals- pesticides- microbiological- non-GMOFor each product and analysis category weestablished the specific sampling procedure,taking into account the batch size, theminimum number of elementary samples andquantity of the total sample.For an easier application of this procedure weused an excel file which calculated thesampling frequency depending on the numberof packaging units and pallets.An example for a batch of an approx. 25000kilos is presented in Tables 2 and 3 for foodproducts and in Tables 4 and 5 for feedproducts.The types of analyses performed were groupedin accordance to the sampling proceduresimilarities, so that the analyses specific forquality and those for mycotoxins and heavymetals were presented together (Tables 2 and4), while the analyses for the detection ofpesticides, microbial contamination and thepresence of genetically modified organismswere grouped and included in Tables 3 and 5.In all these tables the abbreviations mean:-parameters measured for all types of samplingprocedures except those involvingmicrobiological analyses:- CP: product code- DA: packed unit weight (kg)- DP: number of packed units in a pallet- DL: batch size (kg)- NP: number of pallets in a batch- NA: number of packed units in a batch- FA: sampling frequency / packed unit- FP: sampling frequency / pallet unit- NPE: number of incremental samples- MPE: size of incremental sample (kg)- PG: size of global sample (kg)- PL: size of laboratory sample (kg)-parameters measured for microbiologicalanalyses:- FP: sampling frequency / pallet unit- NPT: number of tested samples- MPT: tested samples weight-type of food product:- PB: corn- AV: bulk starch- AS: starch packed in 25 kg bags- AB: starch packed in big-bags- GV: bulk glucose syrup417

- G45: glucose syrup packed in 45 kgrecipients- G15: glucose syrup packed in 150 kgrecipients- G11: glucose packed in 1100 kg recipients- GrV: bulk germs- GB: germs packed in big-bags-type of feed product:- TV: bulk corn gluten feed- TB: corn gluten feed packed in big-bags- FV – bulk corn gluten meal- FB – corn gluten meal packed in big-bagsThe values in the table that are marked withyellow colour and font italic are fixed valuesestablished according to EU regulation andtaking into account the factory possibilities.These values should not be changed.The values coloured in green should beintroduced by the operator in order to identifythe correct values from the white cells.Forexample, to identify the sampling procedure fora batch of starch packed to bags of 25 kilos itwas established according to SR EN ISO24333:2009 that the size of incremental sample(MPE) should be 0.1 kg, the size of globalsample (PG) and the size of laboratory sampleshould be 1 kg for each one.As it is known that a bag has 25 kg and a pallethas 30 bags, it was easy to identify that for abatch of 24750 kg, the number of pallets in abatch (NP) is 33 and the number of packedunits in a batch (NA) is 990, using thefollowing formulas:For all packed products, food and feed, thesampling frequency for all analyses types,except non-GMO and microbiological analyses,was calculated following the recommendationsgiven by SR EN ISO 24333:2009, taking intoaccount the possibilities of the starch factory(e.g.: only manual static sampling) andconsidering that there are no significantdifferences between the sampling methods usedfor its (Knight and Wilkin, 2010).For bulk products, food and feed the samplingprocedure is applied as shown in Table 2 andusing the rules shown in figure 1.These rules follows the examples presented inSR EN ISO 24333:2009 for products located intrucks: 3, 5, 8 and 10 sampling points.For quality analyses, in order to determine thesampling frequency / packed unit (FA), theparameters DL (batch size), MPE (size ofincremental sample), PG (size of total sample)and DA (packed unit weight) should be known;for the calculation of FA the formula was used:The sampling frequency / pallet unit (FP) wasafter that calculated by using the followingformula:Then it was identified that the samplingfrequency / packed unit (FA) should be 99, thesampling frequency / pallet unit (FP) should be3.3 and the number of incremental samples(NPE) should be 10, using the followingformulas:For the packed products, the number ofincremental samples, NPE value, can be alsocalculated, based on the number of pallets in abatch (NP) and the above calculated FP value,as follows:418

Table 2. Example of sampling procedure for a 25000 kilos batch of food products for which analyses of quality,mycotoxins and heavy metals are performedFOOD PRODUCTSDL NP NA QUALITY MYCOTOXINS HEAVY METALSCP DA DP FA FP NPE MPE PG PL FA FP NPE MPE PG PL FA FP NPE MPE PG PLPB - - 25000 - - - - 8 0.4 1 1 - - 8 1.3 10 10 - - 8 0.4 1 1AV - - 25000 - - - - 3 0.4 1 1 - - 3 0.4 1 1 - - 3 0.33 1 1AS 25 30 24750 33 990 99.0 3.3 10 0.1 1 1 9.9 0.3 100 0.1 10 10 330.0 11.0 3 0.33 1 1AB 1000 1 25000 25 25 2.5 2.5 10 0.1 1 1 0.3 0.3 100 0.1 10 10 8.3 8.3 3 0.33 1 1GV - - 25000 - - - - 3 0.4 1 1 - - 3 0.4 1 1 - - 3 0.33 1 1G45 45 12 24840 46 552 110.4 9.2 5 0.2 1 1 5.5 0.5 100 0.1 10 10 184.0 15.3 3 0.33 1 1G15 150 4 24600 41 164 32.8 8.2 5 0.2 1 1 1.6 0.4 100 0.1 10 10 54.7 13.7 3 0.33 1 1G11 1100 1 24200 22 22 2.2 2.2 10 0.1 1 1 0.2 0.2 100 0.1 10 10 7.3 7.3 3 0.33 1 1GrV - - 25000 - - - - 8 0.4 1 1 - - 8 0.4 3 3 - - 3 0.33 1 1GB 800 1 12000 15 15 1.5 1.5 10 0.1 1 1 0.2 0.2 100 0.1 10 10 5.0 5.0 3 0.33 1 1Table 3. Example of sampling procedure for a 25000 kilos batch of food products for which analyses of pesticides,microbiological contamination and non-GMO content are performedFOOD PRODUCTSDL NP NA PESTICIDES MICROB. non-GMOCP DA DP FA FP NPE MPE PG PL FP NPT MPT FA FP NPE MPE PG PLPB - - 25000 - - - - 8 0.4 1 1 - - - - - 10 0,5 5 2,5AV - - 25000 - - - - 3 0.33 1 1 - 3 0.5 - - 10 0,5 5 2,5AS 25 30 24750 33 990 330.0 11.0 3 0.33 1 1 6.6 5 0.5 31 1 31 0,2 5 2,5AB 1000 1 25000 25 25 8.3 8.3 3 0.33 1 1 5.0 5 0.5 5 5 5 1,0 5 2,5GV - - 25000 - - - - 3 0.33 1 1 - 3 0.5 - - 10 0,5 5 2,5G45 45 12 24840 46 552 184.0 15.3 3 0.33 1 1 9.2 5 0.5 23 2 23 0,2 5 2,5G15 150 4 24600 41 164 54.7 13.7 3 0.33 1 1 8.2 5 0.5 13 3 13 0,4 5 2,5G11 1100 1 24200 22 22 7.3 7.3 3 0.33 1 1 4.4 5 0.5 5 5 5 1,1 5 2,5GrV - - 25000 - - - - 3 0.33 1 1 - 5 0.5 - - 10 0,5 5 2,5GB 800 1 12000 15 15 5.0 5.0 3 0.33 1 1 3.0 5 0.5 4 4 4 1,3 5 2,5For the determination of mycotoxins level therules imposed by the EU regulations arestricter, therefore the number of fixed values,marked in the table with font italic and yellowcolour is bigger than for the other analyses. Incorn, as it is known that there is veryheterogeneous distribution of the grains, theCommission Regulation (EC) No 401/2006requires to release into a recipient a quantity of50 to 100 kilos and to take the sample in arepresentative way from this 50-100 kilos(meaning five incremental samples of 2 kilos toobtain a global sample of 10 kilos), then for a5000 tonnes batch the sampling procedure mayrequire to release into a recipient a quantity of25 tonnes and to take the sample according torecommends a Guidance document for the SR EN ISO 24333:2009 (meaning 8sampling of cereals for mycotoxins, whichspecifies the impossibility of static samplingfor very large batches stored in closedcylindrical silos (Malone et al., 2008). The cornused for the starch production in the factory,taken as reference, is stored in closedcylindrical silos of 5000 tonnes capacity. As asolution to apply sampling rules to specificincremental samples of approx. 1.3 kilos toobtain a total sample of 10 kilos) from thisquantity located in a truck (Figure 1). Thecalculation was made by using the rule of threeand the real result was between 10 and 20tones. For this adaptation we consider also theliterature. Hallier et al. showed in 2011 that theprincipal source of variability in the mycotoxinpossibilities, we adapted the instruction analysis result is the grain sampling, due to thepresented in the same Guidance for batcheswith reasonable size, as follows: if for a 25tonnes batch of grains the sampling procedureheterogeneous repartition in the grain lots. Itcan decrease with the sample size increasingand can increase proportional with mycotoxin419

concentration (Whitaker, 2003; 2006). For thecereal products, food and feed, although theheterogeneity is lower than in the case ofgrains, it is also very important to collect arepresentative sample (Duarte et al., 2010;Stroka et al., 2004). For bulk products (starch,glucose syrup, germs, corn gluten feed and corngluten meal) we consider only SR EN ISO24333:2009, but for packed products we takeinto consideration both Commission Regulation(EC) No 401/2006 (for food products) andCommission Regulation (EC) No 152/2009 (forfeed products) regarding the number ofelementary samples and the sample size and,according to that, we calculate the samplingfrequency given by SR EN ISO 24333:2009and the number of incremental samples byusing the formula:ISO 24333:2009, considering the minimumsample size specified by Regulation (EC) No333/2007 (1 kilo comprising 3 incrementalsamples). The formula used is:For heavy metals in feed it was applied thesame sampling procedure as for mycotoxins infeed and in addition MPE was calculated as forheavy metals in food.The sampling procedure for pesticides wasissued considering the sample size and thenumber of elementary samples specified byCommission Directive 2002/63/EC for bulkand packed batches lower than 50 tonnes andcalculating the sampling frequency accordingto SR EN ISO 24333:200 and MPE accordingto the formula used for heavy metals in food.For heavy metals in food the samplingfrequency was established according to SR ENTable 4. Example of sampling procedure for a 25000 kilos batch of feed products for which analyses of quality,mycotoxins and heavy metals are performedFEED PRODUCTSDL NP NA QUALITY MYCOTOXINS HEAVY METALSCP DA DP FA FP NPE MPE PG PL FA FP NPE MPE PG PL FA FP NPE MPE PG PLTV - - 25000 - - - - 3 0.4 1 1 - - 8 0.5 4 1 - - 8 0.5 4 1TB 900 1 24300 27 27 2.7 2.7 10 0.1 1 1 0.7 0.7 5.2 0.1 4 1 5.2 5.2 5 0.8 4 1FV - - 25000 - - - - 3 0.2 1 1 - - 8 0.5 4 1 - - 8 0.5 4 1FB 1000 1 4000 4 4 0.8 0.8 5 0.2 1 1 0.1 0.1 4 0.1 4 1 1.0 1.0 4 1 4 1Table 5. Example of sampling procedure for a 25000 kilos batch of feed products for which analyses of pesticides,microbiological contamination and non-GMO content are performedFEED PRODUCTSDL NP NA PESTICIDES MICROB. non-GMOCP DA DP FA FP NPE MPE PG PL FP NPT MPT FA FP NPE MPE PG PLTV - - 25000 - - - - 3 0.33 1 1 - - - - - 10 0,5 5 2,5TB 900 1 24300 27 27 9.0 9.0 3 0.33 1 1 27.0 1 0.5 5 5 5 1,0 5 2,5FV - - 25000 - - - - 3 0.33 1 1 - - - - - 10 0,5 5 2,5FB 1000 1 4000 4 4 4.0 4.0 1 1.00 1 1 4.0 1 0.5 2 2 2 2,5 5 2,5As for microbiology criteria of starch the onlyreference document is Decree ANSVSA27/2011 we applied it as sampling instructionfor all the products (food and feed) to beapplied when required. For the packed productsthe sampling frequency / pallet unit wascalculated with the following equation:For non-GMO analysis we identified the specificsampling procedure taking into account theCommission Recommendation 2004/787/ECwhich specifies that “In case of lots smallerthan 50 tonnes, the size of the bulk sample420

should be 5 kg.” According to this instruction,we calculate the number of the incrementalsamples which should be taken from bulkproducts, as follows:considering the global sample to be 5 kg as it isindicated in the Commission Recommendation2004/787/EC, the values of NPE, MPE, FA, FPwere calculated as follows:For packed products CEN/TS 15568:2006contains relevant information about samplingstrategies and it was easy to use, because of thenumber of incremental samples is given by thesquare root of total number of packages (Sisea,2009). According to this indication andFor both, bulk and packed products, thelaboratory sample (PL) is half of PG.Figure 1. Examples of sampling distribution pointsCONCLUSIONSThe development of a specific samplingprocedure in the starch industry depends on thefactory’s specificity, including infrastructurepossibilities, activities and analysis type.Although the standards and legislation offer ageneral description of the sampling instructions,they can be applied in a harmonized way,on condition that the production process andproducts characteristics are known very well.The sampling procedures to be applied for theanalyses of pesticides, microbiological contaminationand GMO-presence detection for421packed products of food and feed are similar.However, differences appear when the analysesof mycotoxin presence should be performed,the rules for sampling for these types ofanalyses being more strict.For food and feed bulk products the rules fromregulations and standards are more specificand, that for the sampling procedure is simplerthan for packed products.ACKNOWLEDGEMENTSThis research work was carried out with thesupport of a corn starch factory located in thesouth-eastern of Romania.

REFERENCESAlexander T., Reuter T., Aulrich K., Sharma R., OkineE., Dixon W., McAllister T., 2007. A review of thedetection and fate of novel plant molecules derivedfrom biotechnology in livestock production. AnimalFeed Science and Technology, 133, p. 31–62.Duarte S.C., Pena A., Lino C.M., 2010. A review onochratoxin A occurrence and effects of processing ofcereal and cereal derived food products. FoodMicrobiology, 27, p. 187–198.Hallier A., Celette F., David C., 2011. Effects ofsampling and extraction on deoxynivalenolquantification. Food Chemistry, 127, p. 303–307.Knight J.D., Wilkin D.R., 2010. Development andvalidation of on-farm sampling methods for thecollection of marketing (quality) samples at harvest.Journal of Stored Products Research, 46, p. 221–227.Malone R., Malone B., Bond K., 2008. Determination ofDeoxynivalenol and Zearalenone in Single KernelsFrom a Highly Contaminated Corn Sample.Availableathttp://www.trilogylab.com/uploads/Single_Kernel_Poster_2008.pdf.Paakkunainen M., Matero S., Ketolainen J., Lahtela-Kakkonen M., Poso A., Reinikainen S.-P., 2009.Uncertainty in dissolution test of drug release.Chemometrics and Intelligent Laboratory Systems,97, p. 82–90.Sisea C., Pamfil D., 2009. GMO Testing. Bioflux, Cluj-Napoca.Stroka J., Spanjer M., Buechler S., Barel S., Kos G.,Anklama E., 2004. Novel sampling methods for theanalysis of mycotoxins and the combination withspectroscopic methods for the rapid evaluation ofdeoxynivalenol contamination. Toxicology Letters,153, p. 99–107.Thomas T., Gilbert J., Meyer F., 2012. Metagenomics-aguide from sampling to data analysis. MicrobialInformatics and Experimentation, 2:3, p. 1–12.Tokman N., 2007. The use of slurry sampling for thedetermination of manganese and copper in varioussamples by electrothermal atomic absorptionspectrometry. Journal of Hazardous Materials, 143, p.87–94.Whitaker T. B., 2003. Standardisation of mycotoxinsampling procedures: An urgent necessity. FoodControl, 14, p. 233–237.Whitaker T. B., 2006. Sampling Foods for Mycotoxins.Food Additives and Contaminants, 23, p. 50-61.422

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653A BRIEF OVERVIEW OF ETHYLENE MANAGEMENT TO EXTENDTHE SHELF LIFE OF TOMATOESElena DELIAN, Adrian CHIRA, Liliana BDULESCU, Lenua CHIRAUniversity of Agronomic Sciences and Veterinary Medicine of Bucharest,59 Mrti Blvd., District 1, 011464, Bucharest, RomaniaCorresponding author email: delianelena@yahoo.comAbstractTomato (Lycopersicon esculentum Mill.) is one of the most important vegetable cropsin the world of horticulturaleconomy, being commercially valuable worldwide, both for fresh and for processing markets. In addition, tomatorepresent a major research plant material, thus results obtained from its study can be applied to other plants of theSolanaceae family. It is a climacteric fruit, with a respiratory peak during their ripening process. Ethylene is one of themost important natural plant hormonethat regulates fruit ripening. Thus, ethylene biosynthesis management, especiallyduring postharvest period allow producers more time for shipment and increase the shelf life of tomato fruit forconsumers. Maximum tomato loss in quality and quantity occurs from harvesting to consumption. The problem of losscan be controlled by adapting suitable scientific methods of packing and storage and by establishment properlypostharvest management. One of the first and simplest conditions to influence the postharvest production of ethylenerefers to the handling practices and storage temperature. Some classical treatments as for instance, postharvestapplication of 1-methylcyclopropene (1-MCP) as one of ethylene action inhibitor is also successfully used. There arealso recent functional genomic studies in tomato. Integrating molecular approaches with conventional breeding mayenhance fruit quality and could significantly improve the postharvest shelf life of tomato.Key words: Lycopersicon esculentum, postharvest, ripening, shelf life.INTRODUCTIONThe postharvest losses of fruits and vegetablesin the developing countries account for almost50% of the production (Meli et al., 2010).Tomato (Lycopersicon esculentum Mill.) is oneof the most important vegetable crop in theworld of horticultural economy (Upendra et al.,2003), being commercially valuable worldwide(Kimura and Sinha, 2008), both for fresh andfor processing markets (Opiyo and Ying,2005), not only because of its volume, but alsobecause of its overall contribution to nutrition,and its important role in human health (Agravaland Rao, 2000; Martinez-Madrid et al., 2007;Me et al., 2007). The nutrient value of tomatofruit is related to its composition incarbohydrates, organic acids, minerals,vitamins and pigments (Helyes, 1999; Nasrin etal., 2008; Mutari and Debbie, 2011). It is thesecond most widely grown vegetable crop inthe world other than the white potato (Hansonet al., 2001; Panthee and Chen, 2010).In addition, the tomato belongs to theextremely large family Solanaceae and isclosely related to many commercially important423plants such as potato, eggplant, peppers,tobacco, and petunias. Knowledge obtainedfrom its studies can be easily applied to theseplants, which makes tomato important researchmaterial. So, tomato serves as a modelorganism for the family Solanaceae, also amodel system for studying many aspects offruit biology, including development andmetabolism (Kimura and Sinha, 2008; Okabe etal., 2011; Xu et al., 2012), in part due to theavailability of well characterized ripeningmutants (Zhang et al., 2009). Tomato is aclimacteric, perishable vegetable fruit, with avery short life span, usually 2-3 weeks Anincrease in the storage life and improvement oftomato fruit quality is really desirable (Sammiand Masud, 2007). Ethylene synthesized by allhigher plants tissues is involved in regulatingmany growth and developmental processes inplants (Yang, 1985; Abeles et al., 1992) andconstitute an important regulator of fruitripening (Behboodian et al., 2012). Delayingthe fruit ripening process would allowproducers more time for shipment and increase

the shelf life of the fruit for consumers (Opiyoand Ying, 2005).Even if in the past appearance quality has beenemphasized, consumers buy tomatoes on thebasis of appearance and firmness, theirsatisfaction and repeat purchases depend upongood flavor quality (Kader, 1986).MATERIALS AND METHODSA literature search strategy was used, mainlyon the most recent scientific papers on therelationship between ethylene and fruit qualityof tomato, especially during post harvest, usingonline database Science Direct.RESULTS AND DISCUSSIONSGENERAL ASPECTS OF ETHYLENEBIOSYNTHESIS MANAGEMENTDURING FRUIT RIPENINGFruit ripening has received considerableattention due to its commercial importance(Yokotani et al., 2009).The control of fruitsripening is often achieved through earlyharvest, by controlling the postharvest storageatmosphere and by genetic selection for slow orlate ripening varieties (Oms-Oliu et al., 2011).It is know that ethylene function to promotemany aspects of ripening of many climactericfruits, including tomato (Abeles et al., 1992;Yokotani et al., 2009; Barry and Giovannoni,2007) and modulating its levels in thetransgenic plants, as regard as many biotic orabiotic stress factor is readily attainable for avariety of plants [(Stearns and Glick, 2003).Ethylene biosynthesis starts from methioninevia S-adenosyl-L-methionine (AdoMet) havingas an intermediate the non-protein amino acid1-aminocyclopropane-1-carboxylic acid (ACC)(Adams and Yang, 1979). The conversion ofAdoMet to ACC and of ACC to ethylene isassured by ACC synthase and ACC oxidase,respectively (Kende, 1993).Ethylene regulation in climacteric and nonclimactericfruits is under control of twodistinct ethylene producing system defined byMcMurchie et al. (1972): system1(autoinhibitory) and system 2 (autocatalytic).System 1 control the low ethylene productionrate and represent basal ethylene in unripe fruitand vegetative tissues, while system 2 isassociated with the autocatalytic rise in424ethylene production as is the case of matureclimacteric fruits, too (Oetiker and Yang,1995). Fruit ripening and the role of ethylene inits regulation is complex. Therefore,understanding what controls these processes innon climacteric ripening may prove pertinent togaining full understanding of climacteric fruitripening and vice versa (Alexander andGrierson, 2002).Recently, Yokotani et al. (2009) proposed amodel to explain the transition from system 1to system 2. System 1 is produced viaLeACS1A and LeACS6, which are regulated bya negative feedback system, in the case ofabsence of exogenous ethylene and stress, viathe limited expression of LeACS2 and LeACS4,thus registering a limited increase of ethylenebiosynthesis. In a such situation, limitedethylene would play a role as a trigger tostimulate an ethylene burst due to the ethylenedependentexpression of LeACS2 and LeACS4,inducing fruit ripening. System 1 decreaseswith the onset of system 2, as LeACS6 isregulated by a negative feedback system;therefore, system 2 in tomato fruit consists ofboth ethylene-dependent (autocatalytic) andethylene-independent (non-autocatalytic)systems. Even when the effect of system 1ethylene is eliminated, fruit can initiate system2, leading to fruit ripening.Moreover, responses to this hormone is realizedby a signal transduction pathway in whichEthylene Responsive Element Binding Proteins(EREBPs) are transcription factors that helpregulate the ethylene response by regulatingtranscription and gene expression. For example,Zhang et al. (2012) have cloned the geneTomato LeERF1, indicated its location at thecellular level in the nucleus, nucleolus andplastids, and little signal was detected in thecell wall and vacuole. They have establishedrelationship of LeERF1 with the ripening oftomato fruit.MEANS TO EXTEND TOMATO SHELFLIFEMaximum loss in quality and quantity oftomato occurs from harvesting to consumption(Kader, 1986), so, the problem of loss can becontrolled by adapting suitable scientificmethods of packing and storage and byestablishment proper post harvest management(Rahman et al., 2010).

One of the first and simplest conditions toinfluence ethylene production refers to thehandling practices and storage temperature.When matter plants in general are subjected tophysical or biological stress the result may be atissue damage, which implies the production ofthe ethylene, either as a defense response or torepair the damage tissues. So, an increase ofrespiration and softening are registered (Mutariand Debbie, 2011). Tomato sealed in plasticfilms had an extended marketable life and itaffects the gaseous atmosphere around the fruit.The use of KMnO4 contributed to theproduction of CO 2 and water in the packageatmosphere which helped in lowering therespiration and ripening processes (Sammi andMasud, 2007). Post-harvest packing methods,such as storage in perforated (0.25%) polythenebags under ambient conditions (temperature of20 0 -25 0 C and relative humidity of 70-90%)extended up to 17 days tomato shelf lifewithout excessive quality decay (Nasrin et al.,2008). The use of black perforated polythenebags (Rahman et al., 2010), treating fruits withchloride and calcium chloride, and treatment of0.1% gibberellic acid and 0.4 nM salicylic acid(Pila et al., 2010) have been shown to decreasefruit decay and weight loss.There are also used some treatments in relationto ethylene management. For instance, postharvestapplication of 1-methylcyclopropene(1-MCP) as one of ethylene action inhibitor(Sisler, 2006) delayed tomato fruit ripening inrelation to the used concentration (Moretti etal., 2002). Response of various climacteric species,including tomato is variable and dependsalso on internal levels of ethylene (Zhang et al.,2009; Zhang et al., 2010). It should be consideredthat ingress and accumulation in tomatofruit of gaseous 1-MCP applied as gaseous oraqueous formulation is rapidly. The post-exposurefate is due in relation to multiple factors:inherent sorption-capacity, surface properties(e.g., waxes, stoma), volume and continuity ofgas-filled intercellular spaces, and tissue hydration(Dong et al., 2013). In addition, Su andGubler (2012) showed that reducing post-harvestdecay by 1-MCP is also associated with areduction of economic loss caused by diseases.There is also a positive interaction betweenjasmonates resulting from treatment withmethyl jasmonate (MeJA) and ethylene. MeJA425application causes increased jasmonates concentration,which regulate LOX activity associatedwith the production of superoxide anion,which has an impact on ethylene production(Yu et al., 2009). JA-ethylene cross-talk in theethylene synthesis pathways is based on theirsynergistic interaction, as for example the JAethyleneresponsive antifungal defensinPDF1.2 (Spoel et al., 2003) regulation by thesimultaneously activation of JA and ethyleneresponse pathways (Abeles et al., 1992). Kim etal. (2013) obtained contradictory results. Theynoticed that JA has also an inhibitory effect onethylene signaling, which may involve an EIN2(a key protein in ethylene signaling)-independentpathway. JA antagonistic and ethyleneindependently function was also registeredduring lycopene biosynthesis in tomato fruits(Liu et al., 2012).Respiration rate may be also controlled byinfluence its proper molecular mechanism.Alternative oxidase (AOX) and ethylene mediatefruit ripening of tomato. Xu et al. (2012)used tomato plants with reduced LeAOX (Lealternative oxidase) levels and results wereretarded ripening; reduced carotenoids, respiration,and ethylene production; and the downregulationof ripening-associated genes. On theother hand, the fruit that over expressedLeAOX1a accumulated more lycopene, andthey displayed a similar pattern of ripening towild-type fruit.Zhang et al. (2009) described a relationshipbetween ABA and ethylene during tomato fruitripening and senescence as followings: (i) theexpression of the ABA biosynthetic gene(LeNCED1) (which encode 9-cis-epoxy carotenoiddioxygenase (NCED) as a key enzyme inABA biosynthesis) occurs before that ofethylene biosynthesis genes; (ii) ABA contentalso preceded the climacteric increase inethylene production; (iii) ABA may induceethylene biosynthesis via the regulation of ACSand ACO gene expression; (iv) exogenousABA accelerates fruit ripening, and fluridoneor nordihydroguaiaretic acid treatment delayedfruit ripening by inhibition of ABA; and (v)ethylene plays a key role in the later stages offruit ripening.Delaying ripening and enhancing resistance toa post-harvest fungal pathogens can be alsoassure by NO treatments (Lai et al., 2011)

426which suppress ethylene biosynthesis, stimulatethe activity of antioxidant enzymes and regulatethe expression of age-related genes.Tomato is a suitable system for studyingunique biological phenomena not harbored byArabidopsis (Okabe et al., 2011). As Me et al.(2007) noticed, in molecular technologies,using molecular markers in plants breedingprograms is a common procedure. Unfortunately,gene modification techniques introducedinto tomato crop improvement, greatly alteredtomato variety characteristics. Studies performedby Rodríguez et al. (2011) emphasized thatpolymorphic polipeptides from fruit pericarpassociated with quality fruits traits and fruitshelf life can be such useful tomato breedingprograms, as protein molecular markers.The tomato genome was entirely sequenced byThe International Solanaceae Genomics Project(SOL), and many of the gene sequences can beretrieved from databases (Mueller et al., 2009).Also, recently (2012) The Tomato GenomeConsortium presented a high-quality genomesequence of domesticated tomato, a draftsequence of its closest wild relative, Solanumpimpinellifolium,and compared them to eachother and to the potato genome (Solanumtuberosum).Although the tomato is completedsequenced, its genomic resources have not beenfully exploited. Few studies have reported thedetection of quantitative trait loci (QTLs) usingsimple sequence repeat (SSR) markers for fruitquality traits in tomato, in the recent studiescarried out by Yogendra and Gowda (2013).Xu et al. (2013) presented a complete analysisof the RNA helicases (a class of molecularmotor proteins) gene family, including thechromosomal locations, phylogenetic tree, andgene structure analysis and expression profileunder various growth conditions.Twenty years ago Klee (1993) noticed thatbiochemical analysis of transgenic tomato fruitsline expressing 1-aminocyclopropane-1-carboxylicacid (ACC) deaminase enzyme emphasizedno significant differences from controls inthe levels of ACC oxidase or polygalacturonase.Also, transgenic fruit were significantlyfirmer than the control, so, the author conclusionwas that other enzymes may have asignificant role in fruit softening. Meli et al.(2010) identified and targeted two ripeningspecificN-glycoprotein modifying enzymes (amannosidase(a-Man) and ß-D-N-acetylhexosaminidase(ß-Hex) and also demonstrated thatgenetic manipulation of N-glycan processingcan be of strategic importance to enhance fruitshelf life, without any negative effect onphenotype, including yield.To accelerate functional genomic research intomato, Okabe et al. (2011) developed a Micro-Tom TILLING (Targeting Induced LocalLesions In Genomes) platform and to be usedfor efficient mutant isolation, six ethylene receptorgenes in tomato (SlETR1–SlETR6) werescreened. The identification of two novel Sletr1mutant alleles that are distinguished by thelevel of ethylene sensitivity and the characterizationof their associated phenotypes couldprovide insight into the ethylene-mediated fruitripening mechanism in tomato.Behboodian et al. (2012) were employed RNAinterference (RNAi) technology to silence thegenes involved in ethylene biosyntheticpathway, by blocking the expression of specificgene encoding the ACC oxidase. The obtainedresults has successfully demonstrated that severaltransgenic lines of lowland tomato cv. MT1,harboring an hpRNA-ACO1 (ACC oxidase)construct, showed lower ethylene productionbecause the transgenic fruits displayed delayedpost-harvest life with no phenotypic changesand similar amounts of soluble solids content,titratable acidity and ascorbic acid as comparedto wild type fruits. They proposed that,hpRNAi ACO1 could effectively be used todelay post-harvest damage, especially inclimacteric fruits.Research carried out by Xie et al. (2006) emphasizedthat Virus-induced gene silencing(VIGS) technology combined with vacuuminfiltration can silence LeACS2 gene functionfor a certain time and is an efficient way topostpone the post-harvest senescence of tomatofruit. In the same time, vacuum infiltration is aneasy and inexpensive method at room temperature,so, a potential method to maintain thequality of detached tomato fruit. The syringeinfiltration method of VIGS [tobacco rattlevirus (TRV)-LeRIN: the transcription factorRIN (Ripening Inhibitor) belongs to the MADSbox family and regulates tomato ripening] wassuccessfully applied to silence the LeRIN,LeACS2, LeACS4 and LeACO1 genes in tomatofruits. There were identified also, the target genes

of RIN transcription factor in ethylene biosynthesisin tomato fruit (Li et al., 2011).Integrating molecular approaches with conventionalbreeding to enhance fruit quality couldsignificantly improve the post-harvest shelf lifeof tomato. Recently, tomato hybrids with enhancedshelf life were developed using ripeningmutants and agronomically superior Indiancultivars, and hybrids from all possible line xtester crosses were screened for shelf life, yield,and other fruit qualities (Yogendra and Gowda,2013).CONCLUSIONSTomatoes are one of the most important vegetablesworldwide and are used both for freshconsumption, as well as processed, consideringtheir nutritional value and health benefits topeople.Always, there have been major concerns for theimprovement of tomato characteristics feature,including those regarding the ripening dynamics,with a view to reduce the post-harvestloss and to extend shelf life.Ethylene is one of the most important planthormone, which regulates tomato ripening. So,ethylene management by integrating molecularapproaches with conventional breeding couldsignificantly improve the post-harvest shelf lifeof tomato.In addition to breeders focus to increase tomatoproduction and to extend the fruits shelf life,flavor improvement still remains one of themajor challenges (Klee and Tieman, 2013).REFERENCESAbeles F.B., Morgan P.W., Salveit Jr. M.E., 1992.Ethylene in plant biology. New York: AcademicPress. Adams, D.O., Yang, S.F. 1979. Ethylenebiosynthesis: identification of 1-aminocyclopropane-1-carboxylic acid as an intermediate in theconversion of methionine to ethylene. Proc. Nat.Acad. Sci, USA, 76, p. 170-174.Agarwal S., Rao A.V., 2000. Tomato lycopene and itsrole in human health and chronic diseases. CanadianMedical Association, 163, p. 739-744.Alexander L., Grierson D., 2002. Ethylene biosynthesisand action in tomato: a model for climacteric fruitripening. J. Exp. Bot., 53, p. 2039-2055.Barry C.S., Giovannoni J.J., 2007. Ethylene and fruitripening. J. Plant Growth Regul. 26, p.143-159.Behboodian B., Ali Z.M., Ismail I., Zainal Z., 2012.Postharvest Analysis of Lowland Transgenic TomatoFruits Harboring hpRNAi-ACO1 Construct. TheScientific World Journal, Article ID 439870, 9 pages,doi:10.1100/2012/439870 Research Article.Dong X., Ramírez-Sánchez M., Huber D.J., Rao J.,Zhang Y., Choi S.T., Lee J.H., 2013. PostharvestBiology and Technology, 78, p. 40–47.Hanson P., Chen J.T., Cou C.G., Morris R., Opena R.T.,2001. Tomato production. Asian Vegetable ResearchDevelopment Center.Helyes L., 1999. A paradicsom és termesztése. SycaSzakkönyvsolgálat, Budapest, Hungary.Kader A.A., 1986. Effects of postharvest handling procedureson tomato quality. Acta Hort. 190, p.209-221.Kende, H., 1993. Ethylene biosynthesis. Annu. Rev.Plant Physiol. Plant. Mol. Biol., 44, p. 283-307.Kimura S., Sinha N., 2008. Tomato (Solanum lycopersicum): A Model Fruit-Bearing Crop. Cold SpringHarb Protoc; doi:10.1101/pdb.emo 105.Kim J., Patterson S.E., Binder B.M., 2013. Reducingjasmonic acid levels causes ein2 mutants to becomeethylene responsive. FEBS Letters, 587, p. 226–230.Klee H.J.. 1993. Ripening physiology of fruit fromtransgenic tomato (Lycopersicon esculentum) plantswith reduced ethylene synthesis. Plant Physiology,102, p. 911-916.Klee H.J., Tieman D.M., 2013. Genetic challenges of flavorimprovement in tomato. Trends in Genetics xx 1–6.Lai T., Wang Y., Li B., Qin G., Tian S., 2011. Defenceresponse of tomato fruit to exogenous nitric oxideduring postharvest storage. Postharvest Biology andTechnology, 62, p. 127-133.Li L., Zhu B., Fu D., Luo Y., 2011. RIN transcriptionfactor plays an important role in ethylenebiosynthesis of tomato fruit ripening. J. Sci FoodAgric., 91, p. 2308-2314.Liu L., Wei J., Zhang M., Li C., Wang Q., 2012. Ethyleneindependent induction of lycopene biosynthesisin tomato fruits by jasmonates. J. Exp. Bot. doi:10.1093/jxb/ers224.Martinez-Madrid M.C., Egea M.I., Sánchez-Bel P.,2007. Effect of combined 1-MCP and cold storage onthe shelf life and postharvest quality of tomato. InAdvances in Plant Ethylene Research.McMurchie E.J., McGlasson W.B., Eaks I.L., 1972.Treatment of fruit with propylene gives informationabout the biogenesis of ethylene. Nature, 237, p.235–236.Me B.B., Be L.K., Be J.J., Ying T.Y., 2007. Fruit qualityof transgenic tomatoes with suppressed expression ofLeETR1 and LeETR2 genes. Asia Pac. J. Clin. Nutr.,Vol. 16, p.122-126.Meli V.S., Ghosh S., Prabha T.N., Chakraborty N.,Chakraborty S., Datta A., 2010. Enhancement of fruitshelf life by suppressing N-glycan processingenzyms. PNAS, 107, p. 2413-2418.Mueller L.A., Lankhorst R.K., Tanksley S.D., GiovannoniJ.J., White R., Vrebalov J., 2009. A snapshot ofthe emerging tomato genome sequence. PlantGenome, 2, p.78-92.Moretti C.L., Araújo A.L., Maurouelli W.A., SilcaW.L.C., 2002. 1-Methylcyclopropene delays tomatofruit ripening. Horticultura Brasiliera, 20, p. 65-663.427

Mutari A., Debbie R., 2011. The effects of postharvesthandling and storage temperature on the quality andshelf life of tomato. African Journal of Food Scinece,5, p. 446-452.Nasrin T.A.A., Molla M.M., Hossaen M.A., Alam M.S.,Yasmin L., 2008. Effect of postharvest treatments onshelf life and quality of tomato. Bangldesh J. Agri.Res., 33, p. 579-585.Oetiker J.H., Yang S.F., 1995. The role of ethylene infruit ripening. Acta Horticulturae, 398, p.167–178.Okabe Y., Saito T., Matsukura C., Ariizumi T., Bres C.,Rothan C., Mizoguchi T., Ezura H., 2011. TomatoTILLING Technology: Development of a ReverseGenetics Tool for the Efficient Isolation of Mutantsfrom Micro-Tom Mutant Libraries. Plant CellPhysiology, 52, p. 1994-2005.Oms-Oliu G., Hertog M.L.A.T.M., Vande Poel B.,Ampofo-Asiama J., Geeraerd A.H., Nicolai B.M., 2011.metabolic characterization of tomato fruit duringpreharvest development, ripening, and postharvestshelf-life. Postharvest Biology and Technology,Vol.62, p.7-16.Opiyo A.M., Ying T.J., 2005. The effects of 1-methylcyclopropanetreatment on the shelf life and qualityof cherry tomato (Lycopersicon esculentum var,cerasiforme) fruit. International Journal of FoodScience and Technology, 40, p. 665-673.Panthee D.R., Chen F., 2010.Genomics of FungalDisease Resistance in Tomato. Curr Genomics, 11, p.30–39.Pila N., Gol N.B., Rao T.V.R., 2010. Effect of postharvest treatments on physicochemical characteristicsand shelf life of tomato (Lycopersicon esculentumMill.) fruits during storage. American-Eurasian J.Agric. & Environ. Sci., 9, p. 470-479.Rahman M.M., Islam M.N., Wazed M.A., Arfin M.S.,Hossain F.B., 2010. Determination of post harvestlosses and shelf life of tomato as influenced bydifferent types of polythene at refrigerated condition(100 C). Int. J. Sustain., Crop Prod., 5, p. 62-65.Rodríguez G.R., da Costa J.H.P., Tomat D.D., PrattaG.R., Zorzoli R., Picardi L.A., 2011. Pericarp totalprotein profiles as molecular markers of tomato fruitquality traits in two segregating populations. ScientiaHorticulturae, 130, p. 60–66.Sammi S., Masud T., 2007. Effect od different packingsystems on storage life and quality of tomato(Lycopersicon esculentum var, Rio Grande) duringdifferent ripening stages. Internet Journal of FoodSafety, p. 37-44.Sisler E.C., 2006. The discovery and development ofcompounds counteracting ethylene at the receptorlevel. Biotechnolog Adv., 24, p. 357-367.Spoel S.H., Koornneef A., Claessens S.M.C., KorzeliusJ., Van Pelt J.A., Mueller M.J., Buchala A.J.,Métraux J.P., Brown R., Kazan K., Van Loon L.C.,Dong X., Pieterse C.M.J., 2003. NPR1 modulatescross talk between salicylate-and jasmonatedependentdefense pathways through a novel functionin the cytosol. Plant Cell, p. 760–770.Spoel S.H. et al., 2003. NPR1 modulates cross-talkbetween salicylate-and jasmonate-dependent defensepathways through a novel function in the cytosol.Plant Cell, 15, p. 760–770.Stearns J.C., Glick, B.R., 2003. Transgenic plants withaltered ethylene biosynthesis or perception.Biotechnology Advances, 21, p. 193-210.Su H., Gubler W.G., 2012. Postharvest Biology andTechnology, Vol. 64, p.133–137.Upendra M.S., Dris R., Bharat S., 2003. Mineralnutrition of tomato. Journal of Food Agriculture andEnvironment, 1, p.176-183.Xie Y.H., Zhu B.Z., Yang X.L., Zhang H.X., Fu D.Q.,Zhu H.L., Shao Y., Gao H.Y., Luo Y., 2006. Delay ofpostharvest ripening and senescence of tomato fruitthrough virus-induced LeACS2 gene silencing.Postharvest Biology and Technology, 42, p. 8-15.Xu F., Yuan S., Zhang D.W., Lv X., Lin H.H., 2012. Therole of alternative oxidase in tomato fruit ripeningand its regulatory interaction with ethylene. J. Exp.Bot. doi: 10.1093/jxb/ers226.Xu R., Zhang S., Lu L., Cao H., Zheng C., 2013. Agenome-wide analysis of the RNA helicase gene familyin Solanum lycopersicum. Gene, 513, p. 128-140.Yang S.F., 1985. Biosynthesis and action of ethylene.HortScience, 20, p. 41.45.Yogendra K.N., Gowda P.H.R., 2013. Phenotypic andmolecular characterisation of a tomato (Solanumlycopersiocon L.) F2 population segregation forimproved shelf life. Gen. Mol.Res.Yokotani N.,Nakano R., Imanishi S., Nagata M., InabaA., Kubo Y., 2009. Ripening-associated ethylenebiosynthesis in tomato fruit is autocatalytically anddevelopmentally regulated. J Exp Bot., 60, p.3433–3442.Yu M., Shen L., Fan B., Zhao D., Zheng Y., Sheng J.,2009. The effect of MeJA on ethylene biosynthesisand induced disease resistance to Botrytis cinerea intomato. Postharvest Biology and Technology, 54, p.153–158.Zhang M., Yuan B., Leng P., 2009. The role of ABA intriggering ethylene biosynthesis and ripening oftomato fruit. J Exp Bot., 60, p. 1579–1588.Zhang Z., Huber D.J.,Hurr B.M., Rao J., 2009. Delay oftomato fruit ripening in response to 1-methylcyclopropeneis influenced by internal ethylene levels.Postharvest Biology and Technology, 54, p.1–8.Zhang Z., Huber D.J., Rao J., 2010. Short-term hypoxichypobaria transiently decreases internal ethylenelevels and increases sensitivity of tomato fruit tosubsequent 1-methylcyclopropene treatments. PostharvestBiology and Technology, 56, p.131–137.Zhang H., Zhu B., Luo Y., Xie Y., 2012. The research ofsubcellular localization of ethylene response factorLeERF1 in tomato fruit. Procedia EnvironmentalSciences, 12, p.1187 – 1196.The Tomato Genome Consortium. 2012. The tomatogenome sequence provides insights into fleshy fruitevolution. Nature, 485, p.635–641428

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653PRELIMINARY STUDY RELATED HIGHLIGHTING THE INHIBITORYEFFECT OF IN VITRO FUNGUS GROWTH MYCOSPHAERELLAGROSSULARIAE (AUERS.) LIND. BY SAPROPHYTIC FUNGIEugenia PETRESCU 1 , Tatiana-Eugenia ESAN 2 , Florica CONSTANTINESCU 3 ,Maria OPREA 3 , Traian MANOLE 3 , Irina IONESCU-MLNCU 41 Carol Davila School, 161-163, Viitorului Street, 020609, Bucharest, Romania2 University of Bucharest, Biology Faculty, 1-3 Aleea Portocalilor Street, Bucharest, Romania3 Research-Development Institute for Plant Protection Bucharest,8 Ion Ionescu de la Brad Street, 013813, Bucharest, Romania4 Faculty of Biotechnology-USAMV, 59 Mrti Blvd., 011464, Bucharest, RomaniaCorresponding author email: petrescu_eugenia@yahoo.comAbstractMycosphaerella grossulariae (Auers.) Lind., one of the most important pathogenic fungi which affect the black currantecological crops cultivated for alimentary supplements and phytotherapeutics drugs production. The present studybrings the new data related to the possibility of „in vitro” vegetative growth inhibition of fungus mycelium usingsaprophytic fungi species. The species of fungi used for experimental trials was Trichoderma viride, Trichotheciumroseum Link, Epicoccum nigrum Link. and Gliocladium roseum Bainier. The fungus was growth on several culturemedia for comparative testing and establishment of the most efficient medium for vegetative growth of the fungi. In thestudy we also follow the comparative approach doing by biometric measurements of the colonies in which work variantthe pathogenic fungi had the high rate of growing. After the testing was made the PDA medium was selected forexperimentation of inhibitory effect of the saprophytes. The method used for trials was the double cultures technique onthe medium of agar which consists in inoculation of one media fragment of mycelium carrier separated from the agarmedium of saprophytic fungi on some distance from pathogenic fungi. The study carried out had allowed the highlightof the fact that in all experimental variant used the saprophytic fungi had inhibits the Mycosphaerella grossulariaepathogen growing. The detailed analysis of the results we could reveal that the most inhibitory effect was done by T.viride followed by T. roseum and E.nigrum.Key words: blackcurrant crop, inhibitory effect, Mycosphaerella grossulariae, saprophytic fungi.INTRODUCTION429The biological resources and the sustainableexploit potential of aromatic and medicinalplants from our country are immense and representan important sustainable component of Romanianagriculture (Manole, 2008). Romaniahas in his flora up to 3,600 species of plantsand more than 1.000 are considered medicinalplants, spontaneous and cultivated (Alexan etal, 1988; Ardelean and Mohan, 2008; Bojor,2003; Pun, 1995). In the classification ofpharmacological industry are under differentforms included – tea, medicinal and cosmeticsproducts – almost 160 medicinal and aromaticspecies, among 110 are spontaneous collectedand up 50 species are cultivated (Pun, 1995).One of the species introduced in the croppingsystem, the blackcurrant crop (Ribes nigrum L.)are extremely economic important. The extensionof ecological crops of this species areimposed the deeply acknowledgement of thepathogens in the purpose of finding rapidly andefficiently ways to biological control.Mycosphaerella grossulariae (Auers.) Lind. isone of the most important pathogenic fungiwhich affect the black currant ecological cropscultivated for alimentary supplements and phytotherapeuticsdrugs production. In plantationof blackcurrant cultivated as medicinal plant inthe south of Romania, Mycosphaerella grossulariaeproduces spots with picnidia on theblackcurrant’s leaves (Petrescu and Oprea, 2012).The present study brings the new data related tothe possibility of „in vitro” vegetative growthinhibition of fungus mycelium using saprophyticfungi species. The fungal saprophyticspecies used for experimentation are alreadycited as antagonists of various pathogens of

cultivated plants (esan, 1997, esan andOprea, 1995). The in vitro antagonistic activityof some fungi against other fungal pathogens ofblackcurrant was previously investigated(Petrescu and esan, 2012; Petrescu et al., 2012).Biological control with antagonistic strains offungi is an alternative and non polluting methodfor control the plant diseases produced by fungalpathogens (Fokkema, 1996).Related to environmentally friendly alternativecontrol methods of fungal pathogens of blackcurrant,a recent study analyzes the effect ofsome plant extracts on the development of theblackcurrant’s pathogen Sphaerotheca morsuvaethat produces American mildew, and onthe pathogenic fungi isolated from phylloplaneof blackcurrant in the South Eastern part ofRomania, such as Botrytis cinerea, Alternariatenuissima and Fusarium oxysporum (Enacheet al., 2011).The field experimental plots were located in theblackcurrant crops of S.C. Export-ImportHofigal S.A., which are playing the role of cofinancingpartner in the research consortium.The mentioned firm is a promoter of thesystems for ecological agriculture in the case ofsome shrubs crops for alimentary supplementsproduction.MATERIALS AND METHODSWe are using for our study the biologicalmaterial provided from reference isolate of theMycosphaerella grossulariae (Auers.) Lind.CBS 235.37 pathogen, which was purchasedfrom CBS culture collection of microorganisms,Utrecht, the Netherlands, and another 4own isolates of saprophytes fungi obtained in2010 from blackcurrant’s phylloplan, whichwere tested for their in vitro effect on thepathogen. These isolates are four strains of thefungi Trichothecium roseum, Trichodermaviride, Gliocladiumroseum and Epicoccumnigrum.In order to saprophytic fungi isolation theblackcurrant leaves were collected andintroduced in plastic bags and brings to theRDIPP (Research Development Institute forPlant Protection) laboratory of Mycology forprocessing and analysis. In laboratory theleaves were divided into the small pieces withthe help of sterile scissors. The leaves pieces430were then placed on the water-agar media forsporulating stimulation and also on CGA mediaand incubated at the room temperature. Thespores of different saprophytic fungi wereobserved and studied at the optical microscope.The saprophytic fungi spores or a little piece offungi mycelium were being transferred on theculture media in sterile conditions. The culturemedia used for fungi growth and multiplicationwere PDA and MEA. The pathogenic strain ofMycosphaerella grossulariae was inoculatedon different media and the colony diameter andcolony characteristics were registereded. Fourculture media were used, PDA (potato dextroseagar, MEA (malt extract agar) Czapek-Dox andCzapek). Each variant had 3 repetitions.The saprophytic fungi and the pathogen weregrown on PDA medium. On the specified timeintervals biometrics measurements of thereverse side of the diameter of the colonieswere performed in view to establish andcompare the growing rate of the pathogenicfungus Mycosphaerella grossulariae withthose of the saprophytic fungi. Looking for invitro testing of the antagonic effect of the foursaprophytic fungi against the strain ofMycosphaerellagrossulariae the double culturemethod were performed which mean theinoculation of both pathogen and saprophyticfungi on the same Petri dish at the samedistance for the dish centre and the samedistance one for another (Juan, 1964, esan andOprea, 1995). The experimental design consistsin 5 variant on 3 replicates each. The controlmedium culture had inoculated only with thesaprophytic fungi. The Petri dishes selected forthe experiment had a small diameter (60 mm)because of the length rhythm of pathogengrowing. The medium used for testing wasPDA. The diameter of the fungal inoculum,both pathogenic and saprophytic was of 3 mmand the distance between Petri dish centre andinoculum was of 10 mm, respectively. Thedistance between the pathogen inoculum andsaprophytic one was of 20 mm. The saprophyticfungus was inoculated later, at the 5days after pathogen inoculation in the momentwhen the colony characteristics of Mycosphaerellagrossulariae are ready formed. Theincubation was performed at room temperature(±24°C). The periodical measurements ofinternal radius of pathogen colony (the radius

oriented towards the centre of the Petri dish) ona period of 45 days were made and the valuesof these measurements were expressed by themedia value of each variant. In the control casethe internal radius which measures the colonygrowth was also the media of the periodicalmeasurements values. On the basis of thesemedia values of each variant, an inhibitiondegree were calculated after the follow relation,adapted and modified after Zivkovici et al.(2010):colonies. Photos were taken after 7, 10 and 45days.RESULTS AND DISCUSSIONSOn the four media tested the colonies werecircular, with hairy aspect, white colour andback view light brown (Figure 1).Where:I% = percent of growth inhibition;I C = internal radius of the colony of the fungusMycosphaerellagrossulariae in control;I V = internal radius of the fungus Mycosphaerellagrossulariaein variant tested;The inhibition scale used for values measurementsand comparison between variantswere adapted and modified after Zivkovici etal. (2010). This scale has 11 levels whichpermit to appreciate the inhibition degree(Table 1).Periodically observation connected with colourof the colonies, back view of the colonies,contact line aspect and inhibition zone weremade. Where I%

Table 3. The vegetative growth of the fungusMycosphaerella grossulariae (Auers.) Lind.CBS 235.37and the saprophytic fungi Trichoderma viride,Epicoccum nigrum, Gliocladium roseum andTrichothecium roseum grown on PDA mediumColony diameter (mm)Variantafter 3 days after 6 daysTrichoderma viride 61.6 68.0Epicoccumnigrum 31.0 63.0Gliocladiumroseum 13.6 31.3Trichothecium roseum 26.3 55.0M. grossulariae 5.0 7.3Figure 2. Vegetative growth of the colonies of the fungusMycosphaerella grossulariae (Auers.) Lind.CBS 235.37on different culture mediaAmong the five fungi grown on PDA medium,pathogenic fungi showed a significantly lowergrowth rate than saprophytic fungus Trichodermaviride. The other saprophytic fungishowed also significantly higher growth rates,but lower than Trichoderma viride (Figure 3,Table 3).On the whole period of experimentation, in thecontrol variant, fungusMycosphaerellagrossulariae had a constantlygrowing rate and reaching a medium value of5.91 mm after 7 days after inoculation of thesaprophytic fungus in variant (Figure 1a), 7.3mm after 10 days (Figure 1b), 15.8 mm after 30days, 17.9 mm after 40 days and finally 18.7mm after 45 days (Figure 1c). The shape ofcolonies was circular. The colour was whitewith the reverse of light brown (Figure 4).Figure 4. Macroscopic view of the colony ofMycosphaerella grossulariae (Auers.) Lind.CBS 235.37on PDA medium after 7 days (a), after 10 days (b) andafter 45 days (c ) from pathogen inoculation in variantsFigure 3. Diameter of the colonies of the strains of thefungi Trichoderma viride (Td), Epicoccum nigrum(E.n.),Gliocladium roseum (G.r.), Trichothecium roseum (T.r.)and the strain of the pathogenic fungus Mycosphaerellagrossulariae (Auers.) Lind.CBS 235.37 (M.g.) on PDAmedium432The strain of Trichothecium roseum had a fastgrowth to the pathogen strain of Mycosphaerellagrossulariae.After 6 days from itsinoculation, the mycelia of Trichotheciumroseum began to cover all the area around thepathogen and blocked its expansion by theinhibitory effect under the internal radius whichpointed the value of 3.95 mm read on thereverse side. After 7 days the Trichotheciumroseum pink mycelium had developed aroundthe white Mycosphaerellagrossulariae colony(Figure 5a). The division line had his concavityto pathogen fungi oriented who had a low rateof growing. The external radius continuoslygrowing against internal radius, the valueregistered being of 4.4 mm. After 10 days themycelium of T. roseum had completely coveredthe pathogen colony which being totallyinhibited (Figure 5b, Figure5c).

Figure 5. Macroscopic view of the colony ofMycosphaerella grossulariae (Auers.) Lind.CBS 235.37on PDA medium after 7 days (a), after 10 days (b) andafter 45 days (c ) from inoculation of the strain ofTrichothecium roseumAfter 7 days from inoculation of the antagonisticfungus Gliocladiumroseum, internalradius of its colony became in the neighborhoodsthe phytopathogenic fungus colony(Figure 6a). After 10 days the contact lineappeared as an obviously curve with theconcavity oriented to the pathogen; this ischaracteristic of the relationship between thetwo fungal colonies among which there aredifferences in growth rate (Figure 5b). Betweenthe two colonies being in the same Petri dishappeared a small area of sparse mycelium,which persisted throughout the 45 days ofexperimentation and it marked a inhibition ofthe pathogen exercises by saprophytic fungus(Figure 5b, Figure 5c). From this moment, theinternal radius of the pathogen was inhibited inits growth and remained at the value of 5.35mm, while the outer radius continued to growuntil the colony of Mycosphaerellagrossulariaewas completely surrounded by saprophyticfungus colony and the pathogen growth wascompletely inhibited (Figure 6c).pathogenic fungus was partially surrounded bythe colony of the saprophytic fungus andcontinued to grow only by external radius(Figure 7b.). At the end of the experiment,phytopathogenic colony was covered by that ofthe antagonistic (Figure 7c).Figure 7. Macroscopic view of the colony ofMycosphaerella grossulariae (Auers.) Lind.CBS 235.37on PDA medium after 7 days (a), after 10 days and after45 days (c ) from inoculation of the strain of EpicoccumnigrumTrichoderma viride fungus grew very quicklyover phytopathogenic fungus colony, so that at7 days after inoculation antagonistic fungusinvaded the colony, entirely covering the Petridish and determine to cease growth bothinternal and external radius (Figure 8a, Figure8b). Between the two colonies, pathogen’s andantagonist’s, the mycelium of fungus Trichodermaviride was sparse, sign that phytopathogenicfungus present in the vicinity mayhave an inhibitory effect on the fungus . At theend of the experiment, the Petri dish appearedtotally covered by mycelium of the fungus T.viride, except for those inhibition zones thatformed in the right of the two colonies thatinteracted (Figure 8c).Figure 6. Macroscopic view of the colony ofMycosphaerella grossulariae (Auers.) Lind.CBS 235.37on PDA medium after 7 days (a), after 10 days and after45 days (c ) from inoculation of the strain of GliocladiumroseumAfter 7 days the contact zone between colonyof the fungus Epicoccumnigrum and Mycosphaerellagrossulariaecolony became a curvewith the concavity oriented towards pathogenfungus which had a slower growth, and theinner radius was ceased growing (Figure 7a).After 10 days, the white mycelium of theFigure 8. Macroscopic view of the colony ofMycosphaerella grossulariae (Auers.) Lind.CBS 235.37on PDA medium after 7 days (a), after 10 days and after45 days (c ) from inoculation of the strain ofTrichoderma virideThe average values of the percent of growthinhibition calculated after 7 days allowed assessmentof inhibition as in the categories 4 forTrichoderma viride, 3 level for Trichotheciumroseum and Epicoccumnigrum and only 1 levelfor the strain of Gliocladiumroseum (Table 4,Table 9, Figure 10).433

Table 4. The in vitro effect exercised by somesaprophytic fungi on M. grossulariae on PDA medium,expressed by inhibition percent (I%) and inhibition level(0-10), after 7 daysVariant I% levelM. grossulariae/ T. roseum 27,91 3M. grossulariae/ G. roseum 9,47 1M. grossulariae/ E. nigrum 24,53 3M. grossulariae/ T. viride 30,11 4Control (M. grossulariae) 0 0At 10 days after inoculation, inhibition coefficientvalues increased, reaching category 5 forTrichoderma viride and Trichothecium roseum,4 for Epicoccumnigrum and 3 for Gliocladiumroseum(Table 5, Table 9, Figure 10).Table 5. The in vitro relationships between M.grossulariae and some saprophytic fungi on PDAmedium, expressed by inhibition percent (I%) andinhibition level (0-10), after 10 daysVariant I% levelM. grossulariae/ T. roseum 41,64 5M. grossulariae/ G. roseum 26,57 3M. grossulariae/ E. nigrum 38,9 4M. grossulariae/ T. viride 43,42 5Control (M. grossulariae) 0 0After 30 days from the inoculation, the inhibitionvalues were significantly increased for alltested saprophytic fungi, being 73.86% in case ofTrichoderma viride, 73.03 in case of Trichotheciumroseum, 71.77 in case of the strain ofEpicoccumnigrum and only 66.07% in case ofGliocladiumroseum (Table 6, Table 8, Figure 9).Inhibition level was 8 on our scale for threesaprophytic fungal strains (Trichoderma viride,Trichothecium roseum, Epicoccumnigrum) andfor one strain (strain of the fungus Gliocladiumroseum)the level of inhibition was a little lower,7 respectively (Table 6, Table 9, Figure 10).case of Trichoderma viride, inhibition coe was77.91, followed by Trichothecium roseum with77.21 Epicoccumnigrum. Gliocladiumroseumshowed the lowest coefficient of inhibition of71.33 (Table 7, Table 8, Figure 9).Table 7. The in vitro relationships between M.grossulariae and some saprophytic fungi on PDAmedium, expressed by inhibition percent (I%) andinhibition level (0-10), after 45 daysVariant I% levelM. grossulariae/ T. roseum 77,21 8M. grossulariae/ G. roseum 71,33 8M. grossulariae/ E. nigrum 76,14 8M. grossulariae/ T. viride 77,91 8Control (M. grossulariae) 0 0Table 8. Inhibition percent (I%) exercited by saprophyticfungi on M. grossulariae in experimentally variantsVariant (saprophyticstrain fungus)after 7daysAfter10 daysafter30daysafter45daysTrichothecium roseum 27,91 41,64 73,03 77,21Gliocladium roseum 9,47 26,57 66,07 71,33Epicoccum nigrum 24,53 38,9 71,77 76,14Trichoderma viride 30,11 43,42 73,86 77,91Control (M. grossulariae) 0 0 0 0Related to degree of inhibition, however, for allsaprophytic fungi tested for their inhibitoryeffect against the strain of phytopathogenicfungus Mycosphaerella grossulariae, the inhibitionlevel was placed in category 8 (Table 7,Table 9, Figure 10).Table 6. The in vitro effect exercised by somesaprophytic fungi on M. grossulariae on PDA medium,expressed by inhibition percent (I%) and inhibition level(0-10), after 30 daysVariant I% levelM. grossulariae/ T. roseum 73,03 8M. grossulariae/ G. roseum 66,07 7M. grossulariae/ E. nigrum 71,77 8M. grossulariae/ T. viride 73,86 8Control (M. grossulariae) 0 0At the end of the experimentation, after 45 daysof the antagonist inoculation we found that inFigure 9. Evolution of inhibition percent (I%) inexperimentally variants434

Related to the process of the evolution of theinhibition percent values we observed that thisis correlated with growth rate of thesaprophytic fungi.The fact the fungus Trichothecium roseumshowed a higher inhibition than the fungus E.nigrum that had a faster growth, is probablydue to the capacity of the species T. roseum togrow over and hyperparasitize the hyphae ofthe pathogens, while colony of the fungusE. nigrum was slowly surrounding the colonyof Mycosphaerella grossulariae.Table 9. Inhibition level exercited by saprophytic fungion M. grossulariae in experimentally variantsVariantM. grossulariae/ T.roseumM. grossulariae/ G.roseumM. grossulariae/ E.nigrumM. grossulariae/ T.virideControl (M.grossulariae)after 7daysInhibition levelAfter 10 after 30days daysafter 45days3 5 8 81 3 7 83 4 8 84 5 8 80 0 0 0Figure 10. Evolution of inhibition level (0-10) inexperimentally variantsCONCLUSIONSThe best vegetative growth of Mycosphaerellagrossulariae(Auers.) Lind. CBS 235.37mycelia was registered on PDA medium, thistype of medium being selected for growth fungiestimation used in this study and for inhibitioneffect of saprophytic fungi evaluation.Among the 5 species incubated on PDAmedium, the fast growing was observed in thecase of the strain of Trichoderma viride,closely followed by the isolates ofEpicoccumnigrum and Trichothecium roseum.Among saprophytic fungi the length growthwas observed in the case of Gliocladiumroseumisolate.The strain of Mycosphaerellagrossulariae hadthe lowest rate of growing, reaching a mediumvalue of 7.3 mm of colony diameter after 6days in comparison with the saprophytic fungiTrichoderma viride which totally covered thePetri dish surface.All fungi tested related to their inhibitorycapacity were influenced significantly thepathogenic fungus growth, but the strongerinhibitory effect was observed in the case of thestrain of Trichoderma viride, followed by thoseof Trichothecium roseum and Epicoccumnigrum.The lowest inhibitory effect in thefirst 10 days after inoculation was observed inthe case of Gliocladiumroseum strain, but after45 days the inhibition value (I%) was closely tothe other variants.The inhibitory effect was direct proportionalwith the growth rate of both fungi: pathogenicone and the antagonistic with the exception ofTrichothecium roseum and Epicoccumnigrum.Although Trichothecium roseum had a morelength growth rate in comparison withEpicoccumnigrum it expresses a strongerinhibitory effect.ACKNOWLEDGEMENTSThe present study was performed accordingwith the objectives of the project PN-II-62-079/2008 SIMAECO (CNMP-UEFISCDI).435

REFERENCESAlexan M., Bojor O., Crciun F., 1988. Flora medicinala României, vol.I, Ed. Ceres, Bucureti.Ardelean A., Mohan Gh., 2008. Flora medicinal aRomâniei, Ed. All, Bucureti.Bojor O., 2003. Ghidul plantelor medicinale i aromaticede la A la Z, Ed. Fiat Lux, Bucureti.Bojor O., Popescu O., 2009. Fitoterapie tradiional imodern, Ed. Fiat Lux, Bucureti, ediia a V a.Enache Elena, Ionescu Daniela, Oprea Maria, 2011. Thebiological action of some plant extracts in the currantphylloplan pathogens growth used as a medicinalplant, Analele Universitii din Craiova, seriaAgricultur-Montanologie-Cadastru, vol.XLI 2011/2,p. 149-153.Fokkema N.J., 1996, Biological control of fungal plantdiseases, Entomophaga 41 (3/4), p. 333-342.Hulea Ana, 1973. Relations établies in vitro et in vivoentre différentes espèces de champignons vivants inassociation dans les tiges de maïs et produisant lestalk-rot, Rev. Roum. Biol. Botanique 18 (1), p. 47-53.Jouan B., Lemaire J.M., Arnoux, J., 1964. Elementsd’appreciation des interactions entre champignonscultives invitro, Phytiatrie-phytopharmacie 13 (2),p. 185-195.Manole T., 2008. Raport cercetare contract PN II 62.079,unpublished, p. 10.Pun E., 1995. Sntatea Carpailor (Farmacia dincmar), Ed. Arta Grafic, Bucureti.Petrescu Eugenia, esan Tatiana-Eugenia, 2012. In vitrorelationships between fungi isolated fromRibesnigrum L. plants, Lucrri tiinifice, SeriaHorticultur, anul LV, vol. 55, nr.1, p. 573-578.Petrescu Eugenia, Oprea Maria, 2012. Diversity of fungiassociated with Ribes nigrum L. crop in the South ofRomania, Lucrri tiinifice, Seria Horticultur, anulLV, vol. 55, nr.2, p. 521-526.Petrescu Eugenia, esan Tatiana-Eugenia, Oprea Maria,2012. „In vitro evaluation of the relationshipsbetween some fungal pathogens of black currant cropand some saprophytic fungi”, Scientific Bulletin,Series F, Biotechnologies, vol. XVI, Bucureti, p.175-178.Stroe Elena, 1988. Aspecte privind biologia „in vitro” aciupercii Mycosphaerella mori (Fuckel)Lindau,agentul patogen al antracnozei dudului, Bul. Prot.Plant. nr.3/1988, p. 13-17.esan Tatiana Eugenia, Oprea Maria, 1995.Epicoccumpurpurascens.II. In vitro relationshipswith phytophathogenic fungi, Rev. Roum. Biol.Veget., 41(2), p. 145-151.Živkovi Svetlana, Stojanovi S., Ivanovi Ž., GavriloviV., Popovi Tatana, Jelica Balaz, 2010. Screening ofantagonistic activity of microorganisms againstColletotrichum acutatum and Colletotrichumgloeosporioides, Arch. Biol. Sci., Belgrade, 62 (3), p.611-623.436

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653THE QUALITY TEST OF THE BURNT VETIVER (VETIVERIAZIZANIOIDES) WASTE UTILIZATION AS AN ECO-FRIENDLYMATERIAL POTAbstractMeylinda Nur PUSPITA, Pristi SUKMASETYA, Selma Siti LUTFIAHUndergraduate School of Department of Computer Science, Bogor Agricultural University,Jl. Raya Darmaga Kampus IPB Darmaga Bogor 16680, West Java, IndonesiaCorresponding author email: meylinda.cs48@yahoo.comEssential oils of vetiver is an industrial and trading commodities in the international market that plays an importantrole for the perfume, medicine, and cosmetic industries. But the distillery for 12 hours from 1 ton vetiver produced only4 liters of essential oil and of course a lot of waste that has accumulated. The purpose of this research are to overcomethe industrial waste of vetiver treatment without the continues pollutant, to get the view about the mix pot from thevetiver waste technically and to know the quality of the pot made from vetiver waste. Making the sample is started withthe selection between the burnt vetiver waste, cement and sand. Then making sample with the form like a pot that hasthe up diameter (31,3 cm), the bottom diameter (20,3 cm), highty (30 cm), and the mass of vetiver waste pot (5,52 kg)and the mass of reguler pot (5,36 kg). From the research that has been done, it can to get the conclusion that the vetiverwaste pot has better quality than the reguler pot (cement pot). It reviewed from the power of the vetiver waste pot has apower until (583,78 kgf), while the reguler pot has just (410,34 kgf). Besides, this pot can save up to 30% of the cost ofproduction and exactly it eco-friendly.Key words: Vetiver waste, pot, commodities, eco-friendly, saved cost.INTRODUCTIONNowadays, West Java agribusiness and agroindustryhas not treated optimally, but actuallybased on natural characteristics and thediversity of natural resources are verysupportive. It is not surprising if it is used as atarget in the strategic plan of the futuredevelopment in of West Java province, with theagricultural sector (agribusiness and agroindustry),which became the leading sectors ofWest Java, especially in increasing revenue. Italso wants to be a mainstay of the localgovernment in improving IndonesiaDevelopment Index (HDI), especially inovercoming the impact of the prolongedeconomic crisis today (Kastaman 2003).Essential oil is a commodity industry and tradein the international market plays an importantrole, especially as industrial raw materials thatcan reach billions of U.S. dollars. For instance,the price of 1 ounce of vetiver oil could reach25.4 U.S. dollars. If the value is in theexchange rate of the rupiah in it, so for 1 ounceoil it can be range on Rp.228.600,-or USD2,286,000.00 per kilogram of material(Kastaman, 2003).437So many essential oil in Indonesia, such aspatchouli oil, clove oil, vetiver oil, lemongrassscented oil, eucalyptus oil, ylang oil and manymore. One of the efforts to further develop thepotential of essential oils, especially vetiver oilin Garut Regency, this time in the ‘Uras’Cooperation in Bayongbong District, GarutRegency, has tried to build centers ofproduction and oil refining vetiver. Productvalue of Garut Regency vetiver oil. Annually,reach Rp22, 5 billion under management 1508farmers from an area of 1850 ha with a volumeproduct vetiver 31,450 tons per year and 25tons of oil per year (Between West JavaMagazine March 24, 2009, the value of vetiveroil product in Garut Regency is Rp 22.5 billion,Johny Dody Hidayat). While the distillationprocess each ton of vetiver for 12 hours onlyproduce 4 liters of oil at a price of Rp 900thousand per liter and production costs Rp 2, 25million, making it the benefit of farmers atabout Rp 1, 4 million (Haeruman, HeadPlantation Office Garut).However, the processing of waste volumecertainly gained considerable refining. Indeed,there are several ways of processing done by

the community, but still very simple. Thecommunity make the waste to make thecompost mixture, but in the process the wastepiled up in advance amounted to much. Theimpact is make the bad view, and in theaccumulation of the highly pungent smell dueto the persistence of the essential oils that arenot perfectly distils that interfere with thesurrounding air. Later, due to of the otheraccumulation is the water accumulation.Possibly, due to rain water that seeps inlandfills vetiver it can seep into the soil anddisrupt the existing groundwater conditionswhich in the beneath. Following theaccumulation, the people burn it. Followinghoarding, the people and then burn it. Here theproblem arises again, the smoke produceddisturb the surrounding air and can causerespiratory infection. Therefore, furtherresearch is needed to solve these problems witheco-friendly principles.The purpose of this activity are to overcome theindustrial waste of vetiver treatment withoutthe continues pollutant, to get the view aboutthe mix pot from the vetiver waste technically,and know the quality pot that made from wastevetiverBased on empirical observation we get theinformation that vetiver waste is still a problemfor the environment around them because of thebad smell and bad view. The most simple andquickly done by the most farmers in agroindustrialcenters vetiver to handling of vetiverwaste is by burning so the smoke that producedmake the pollution impact.One alternative solution to overcome thisproblem is with analyze the waste material thatis used as a raw flower pot material. It isnecessary to look at the possibility of wasteutilization so that it can overcome thesignificant environmental issues surroundingthe vetiver oil refining industry. In addition, itis expected to add the value of vetiver waste asan additional income for farmers andindustrialists vetiver.MATERIALS AND METHODSThis research were conducted in the centra ofvetiver waste production which is manage byVetiver Uras Cooperation Bayongbong District,Garut Regency during February until May2012. This research use descriptive method438with material characteristic analysis and presstesting in Material Test Laboratory Departmentof Mechanical and Biosystem, and seepagetesting in Cikabayan Green House Laboratory.Department of Agronomi and HorticultureDepartment, Bogor Agricultural University(IPB).RESULTS AND DISCUSSIONSWaste handling that conducted in the field isstill inadequate and still cause pollution, inconnection with the burning of waste after thedistillation process is often done by manyfarmers (Figure 1). Smoke produced stillcontains essential oils so smell of smoke morepung ent. (Kastaman, 2003).Figure 1. The Vetiver Waste Management by Burningthat Caused a Lot of Negative ImpactThe negative impact by (Kastaman, 2003) isthat currently felt by the public about wastemanagement with burning among others: airpollution, water pollution by residual materials/ waste, plants in around the pile of wasteexperiencing barriers to growth, need extensiveburning land so that the land is less productive.The Production of Vetiver Waste PotThe first step in the manufacture of vetiverwaste pot is cut the vetiver into small pieces,The materials that is specified the mixturestirring until evenly (for the composition, themain dough: vetiver waste, cement and sand,while the coating dough: white cement, traso,and mil) then Prepare the pot mold and lid theflower pot mold, used motorcycles oil (grease)to lubricate the pot mold that that will be usedto make the pot. This is to facilitate theseparation of pot from from the mold, theoriginal pot is not sticky Then, put the doughinto the mold and trim while holding andrubbing to get a solid pot and a surface flat. Thecoating dough that contains of mixture waterlubricated to the surface of the pot mold, this isto give color to the outer surface of the pot

efore it is printed using the main dough Thebottom of the mold pot gived the main dough.After the coating dough is evenly, then coveredagain with the main dough that it mixed withthe water as the main ingredient pot. After itspread evenly, sprinkle the main dough withoutwater, to strengthen those pot. When the maindough is evenly distributed on the mold, wesprinkle again with coating dough to give colorto the inside of the pot.After everything is evenly distributed, theinside of the pot must be be smooth usingsmoother scoop. So do with the mouth of thepot, it also must be smooth using smootherscoop. The thickness of the pot that will beproduced is about 5cm. The pot mold left forabout 5minutes, then the pot mold reversedslowly to remove the pot from the mold. Thebond rubbers is removed one by one from themold, then the pot is placed in the shade toavoid the direct sunlight.The Maintenance ProcessMove the vetiverwaste pot that printed to the protected placefrom the sunfor for 12 to 24 hours, until theflower pot come tobe hard.The placement of flower pot in the sheltershould be up and squeezed between the headand the head, so do the leg and the leg offlower pot, so that the surface are ot broken andthe placement of the bottom side of the vetiverwaste waste should be given as the base. Theroom should be covered and kept holding theair circulation so that the pot does not strickendirect of the sunlight. The cooling processshould be performed by air drying or ratherdried. This Drying is carried out for three dayso rperceived vetiver waste pot is dry.Figure 2. Manufacture of vetiver waste process (1) Vetiver waste is cut in to small pieces (2) Vetiver waste is mixedwith cement and sand (3) Stir it so that the dough distribute evenly (5) The printing dan (5) And that is teh eco-friendlyvetiver waste pot.The Results of Seepage Test and PressingTest1. The Results of Seepage TestThe seepagetest is did on the pot by putting water intothe pot until it full during 24 hours. Whenthe seepage test, the pot with normalmaterial and the vetiver waste pot arefulfilled with the same water during 24hours. Start at 08.00 a.m on May 5 th 2012until 08.00 a.m on May 6 th 2012.Table 1. The Seepage Test Result of Vetiver Waste Pot and the Normal PotThe Reducing Water (cm)The RepetitionVetiver Waste PotNormal Pot1 3,50 7,502 3,50 3,503 3,50 3,504 3,75 3,505 3,50 4,506 3,50 3,507 3,50 3,50The Average 3,54 4,21The vetiver waste can absorb the water 3.54 cmin average and the normal pot can absorb thewater 4.21 cm. This indicates both vetiverwaste pot and normal pot able to meet one ofthe requirements of good pots that can absorbthe water.439

2. The Result of Pressing TestTable 2. The Data of the Pressing Test Result of Vetiver Waste PotThe RepetitionVetiver Waste PotNormal PotMassa (Kg) The compressive strength (Kgf) Massa (Kg) The compressive strength (Kg)0 0 Position1 5,030 430,0 5,867 675,02 5,040 307,5 5,420 530,03 5,595 497,5 4,957 266,54 5,700 515,0 5,250 381,35 5,625 502,5 5,625 350,06 5,270 745,0 5,200 177,07 5,265 500,0 5,130 247,58 5,420 425,0 4,945 230,09 5,235 447,5 5,630 165,010 5,350 725,0 5,050 560,011 5,165 442,5 5,670 257,512 5,750 327,5 4,680 127,5Rata-rata 5,370 530,4 5,285 330,6Posisi 180 01 5,180 400,0 5,290 376,02 5,685 807,5 4,935 275,03 5,830 1015,0 5,025 457,54 6,090 632,5 5,495 227,55 6,060 1015,0 5,020 352,56 5,395 325,0 6,190 1312,57 5,435 397,5 4,880 127,58 4,945 650,0 6,295 847,59 5,280 552,5 5,415 105,510 5,395 1251,5 5,620 885,011 5,520 501,5 4.410 395,012 5,585 826,5 5,591 605,0Rata-rata 5,533 697,9 5,347 497,2Rata-Rata Total 5,452 614,2 5,316 413,9The waste vetiver flower pot crushed when theweighted average 583.78 kg of25 experiments. While the normal pot crushedwhen given load average 410.34 kg of 25experiments. It can be seen from the graph thetest results.Figure 3. Exponential curve vetiver waste pot endurance per-ten seconds and maximum durability point440

Imposition of the pot is done every 10 secondsand the load mass increases (see figure 2) every10 seconds too. On the curve is seen thatexponential phase happen followed by a lagphase that states the force pot threshold and thedeath phase of pot declared maximum powerand started to crack.Figure 4. The Durability Comparison Curve against Discounter Mass between Vetiver Pot and Regular Pot at Emphasison Testing in 0o positionFigure 5. The Durability Comparison Curve against Discounter Mass between Vetiver Pot and Regular Pot at Emphasison Testing in 180o positionBased on the results of power pot test generatedthe different crack pot. When the waste vetiverpot given maximum load, pot indirectlycracked. This is caused by the waste burntvetiver fibers that hold pots. The fibers fromwaste vetiver dough stronger bond. Unlikeregular pots. When the regular pot was givenby the maximum load it will instantly crackpot. This is due to there arenothing material that can resist the crack potlike waste fibers. The fibers in the waste burntvetiver pot serves as a frame. From the dataanalisis can conclused that waste vetiver potstronger than regular pot. Another advantage ofpots made from waste burnt vetiver is to reducethe use of sand. The two doughs that is giventhe same proportion of the cement and the sand,while the other dough is added with the burntvetiver waste that is used to make two potswhereas the dough just for one pot. In addition,the mixing of waste burnt vetiver as a pot canreduce environmental pollution.441

Figure 6. Comparison of Results with Regulat Pot and The Waste Vetiver PotFigure 7. The Seepage Test of Waste Vetiver Pot442

Figure 8. Test of Strength Vetiver Waste PotFigure 9. The Pot Condition After Pressing Test443

CONCLUSIONSManufacturing the burnt vetiver waste pot samewith manufacturing the normal pot (cementpot).The comparison of the burnt vetiver waste potis 3:3:2, that is the burnt vetiver waste: sand :cement.Through the seepage test result between theburnt vetiver waste with the normal pot alikecan absorb the water.The quality of the burnt vetiver waste pot hasmuch better quality than regular pot, it is seenfrom the press test results of that the burntvetiver waste pot is stronger than regularpot.Moreover, it can minimize the productioncost and certainly eco-friendly.ACKNOWLEDGEMENTSAuthors say thanks to all those who haveassisted in the preparation of scientific papers.Thanks to: our lecture, Mr. Dr. Ir.Agus Buono,M.Si, M.Kom who has given full support sothat the paper can be completed then for allwho have helped. Hopefully from this paper theauthor can make a real contribution to theadvancement of Indonesia country and it can beuseful to the progress of Indonesia country.REFERENCESHartoyo J dan Roliandi H, 1978. Percobaan pembuatanBriket Arang dari Lima Jenis Kayu Indonesia.Laporan Penelitian. Lembaga Hasil Hutan. Bogor.Karch G.E., Boutette M. 1983. Charcoal Small ScaleProduction and Use. Germany. AppropriateTechnology Exchange. Germany.Kastaman R., 2003. Analisis Kelayakan TeknisPemanfaatan Limbah Akar Wangi.Majalah Antara Jawa Barat, 24 Maret 2009. NILAIPRODUK MINYAK AKAR WANGI GARUT Rp 22,5MILIAR, Johny Dody Hidayat.Paul A. Tipler, Bahasa A., Prasetio L., Rahmad W. Aidi,1998. editor, Joko Sutrisno, Ed.3, Cet.1., Jakarta:Erlangga.Porges J., 1976. Hanbook of Hatchery Ventilating andAir Conditions. News Autter Worty and VincyEngland.444

Scientific Papers. Series B, Horticulture. Vol. LVII, 2013Print ISSN 2285-5653, CD-ROM ISSN 2285-5661, Online ISSN 2286-1580, ISSN-L 2285-5653TUBER YIELD AND QUALITY OF NINE GENOTYPES YAM BEAN(PACHYRHIZUS SPP.) DUE TO SINK-REPRODUCTIVE PRUNINGWieny H. RIZKY 1 , Sofiya HASANI 2 , Agung KARUNIAWAN 31 Agronomy Department of Agriculture Faculty, Universitas Padjadjaran, Sumedang, Indonesia2 Graduate Student of Agriculture Faculty, Universitas Padjadjaran, Sumedang, Indonesia3 Plant Breeding Department of Agriculture Faculty, Universitas Padjadjara, Sumedang, IndonesiaCorresponding author email: wienyetsdc@gmail.comAbstractYam bean tuber starch extract has been widely used for traditional cosmetics material in Indonesia. This experimentwas aimed to acquire yam bean tuber with high yield and starch content. Materials used were 9 yam bean genotypescollection of Agung Karuniawan (Plant Breeding Laboratory, Universitas Padjadjaran ) consisted of three genotypes ofP. erosus, one genotype of P. ahipa, two genotypes of P. erosus intraspecific crossing and three genotypes resulted frominterspecific crossing between P. erosus and P. ahipa. The field trial was conducted at experimental field of Faculty ofAgriculture, Universitas Padjadjaran Jatinangor from August 2009 until March 2010. The experiment was arranged insplit plot design repeated twice. The main plot consisted of two treatments namely without sink-reproductive pruningand with sink-reproductive pruning. The main plot was divided into nine subplots based on genotypes. Pruning andgenotype independently affected tuber fresh weight. The heaviest tuber produced by P. erosus B-1 / EC 033. Genotypesaffected on tuber dry matter and tuber starch content. The highest dry matter was contained in interspesific crossingbetween P. erosus x. P. ahipa EC 550 x AC 208-72h. The highest tuber starch content was resulted by P. ahipa AC 216-139d. Sink-reproductive pruning and genotype interacted in tuber dry matter trait.Key words: Sink-reproductive Pruning, Starch, Yam bean, Yield.INTRODUCTIONYam bean or bengkuang in Indonesian isactually benefited not only for food but also formedication or cosmetic functions. This crops iswidely cultivated in Sumatra, Java, SoutheastNusa, Sulawesi, Bali and Kalimantan(Karuniawan, 2004). At current time, the tuberstarch extract used both as traditional andmodern cosmetics for brightening skinnaturally. In fact, some of modern cosmeticswith yam bean starch extract based have wonseveral national and international awards (Ratu,2012). Therefore the development of yam beantuber starch production is actually needed.From the analysis of 100 g of fresh yam bean,starch content is at 2.1 g - 10.7 g (Sorensen,1996), even in Indonesia the starch content forP. erosus is averaged only around 1% (UTP,2011) The highest dry matter content enclosedin P. ahipa that is equal to 26% - 24% then P.erosus by 6% - 22%. One disadvantage ofstarch yam bean tuber use is the high watercontent, so that although the tuber has greatsize but still has low starch level due to the lowdry matter content. To broaden genetic445diversity and increase the amount of dry matter,Plant Breeding Laboratory, UniversitasPadjadjaran did intraspecific and interspecifichybridization between P. erosus and P. ahipa.Besides plant breeding, the potential of yamcan be improved by developing appropriatecultivation techniques. One of the frequentcultivation techniques is sink-reproductivepruning (Sorensen). This technique is done bycutting off reproductive parts of plants, whichis begun at the first flower bud emergence.Sink-reproductive pruning aimed to reducecompetition of photosynthates distributionbetween the reproductive and tuber sink parts.Flower bud pruning on the yam bean canincrease 30%-70% of tuber fresh weight [6] .Therefore, sink-reproductive pruning will shiftassimilate to tuber.This study aimed to test the simultaneous effectof sink-reproductive pruning on yam bean yieldand tuber quality traits namely starch contentand dry matter content. Further, expectantlythere will be genotypes with high starch contentas potential yam bean genotypes especially forcosmetics raw material.

MATERIALS AND METHODSMaterials used in this experiment were nineyam bean genotypes collection of AgungKaruniawan (Plant Breeding Laboratory,Universitas Padjadjaran ). It consisted of threeP. erosus, one P. ahipa, two intraspecificcrossing of P. erosus and three interspecificcrossing of P. erosus and P. ahipa.The field trial was conducted at experimentalfield of Faculty of Agriculture, UniversitasPadjadjaran Jatinangor located at an altitude of753 m above sea level with Inceptisols soil typeand type C rainfall according to Schmidt-Fergusson. The experiment was conductedfrom August 2009 until March 2010.The experiment was arranged in split plotdesign repeated twice. The main plot consistedof two treatments: without sink-reproductivepruning and with sink-reproductive pruning.The main plot was divided into nine subplotsbased on genotypes. Each subplot size was 2 mx 3 m with spacing 50 cm x 50 cm betweenplants and 100 cm between subplots. Fertilizerrecommendation given referred to the sweetpotato cultivation in dry land.Sink-reproductive application treatment wascarried out after 50% of plants per plot hadentered the flowering phase (R5) (Zanklan,2003), it was done once a week until the harvesttime. Harvesting of tuber was approximately180 days (six months) after planting.Characters observed were tuber fresh weight(g), tuber dry matter content (%) and tuberstarch content (% WB). Yam bean tuber starchcontent was analyzed using Luff Schoorlmethod conducted at Yield Physiology Laboratory,Vegetable Research Institute, LembangWest Bandung.Data were analyzed using statistical analysis ofvariance (anova) using Statistix 8 program.Comparison of the mean value was done usingthe least significant difference test (LSD) onthe real level 5%.RESULTS AND DISCUSSIONSBased on analysis of variance (Table 1),pruning and genotype treatments independentlygave significant different on tuber fresh weightcharacter. Genotypes as the subplot factor, gavesignificant different on all tuber traits observed.Sink-reproductive pruning and genotypes446interacted on tuber dry matter trait in highlysignificant difference.Table 1. Analysis of Variance for Tuber Fresh Weight,Tuber Dry Matter, Tuber Starch Content of NineGenotypes Yam BeanFVariablesInteractionPruning GenotypePxGTFW (g) 2.51 * 11.7 ** 1.9TDM (%) 1.15 4.90 * 18.05 **TSC (%) 0.01 20.30 ** 2.02TFW=Tuber Fresh Weight; TDM=Tuber Dry Matter;TSC= Tuber Starch Content; *=significant on 0,05; **= significant on 0,01Table 2 shows least significant difference(LSD) test on tuber fresh weight affected bypruning and genotype In this study, sinkreproductivepruning generated higher tuberfresh weight trait. Non pruning treatment onlyresulted 122.35 g, whereas, sink-reproductivepruning 371.61 g. Sink-reproductive pruning offlower bud removal diverts assimilate distributioninto tuber storage sinks. The increasedflow of assimilate to the tuber, consequentialon the change in dimensions. In addition, theincreased of assimilate flow also affect tuberfresh weight.The smallest yield result for genotype showedby P. ahipa AC 216-139 d that was 86,45 g pertuber, however the other genotypes were insame group ranged from 205,76 g- 342,95 g pertuber. It is mean that even the elder was P.ahipa but the crossing with P. erosus willincrease the yield.Table 2. Analysis of Variance for Tuber Fresh Weight,Tuber Dry Matter, Tuber Starch Content of NineGenotypes Yam BeanTreatmentsTuber fresh weight (g)Sink-reproductive pruningWithoutWithGenotypesB-10 / EC 550B-1 / EC 033B-56 / CJAC 216-139 dB-10 / EC 550 x AC 216-139 dB-1 / EC 033 x B-56 / CJAC 216-139 d x B-56 / CJB-10 / EC 550 x B-56 / CJB-10 / EC 550 x AC 208-72h122,35 b371,61 a254,32 a342,95 a297,88 a86,45 b205,76 a184,99 a308,46 a308,27 a233,76 aNumbers followed by the same letters are notsignificantly different on alpha 0.05 LSD test

Table 3 defines LSD test for genotypes effecton tuber dry matter and tuber starch content.EC 550 x AC 208-72h had the highest value ondry matter content. Otherwise, on tuber starchcontent character the best result was showed byAC 216-139 d, then followed by EC 550 x AC208-72h. The average tuber starch content ofyam bean produced in Indonesia is about 1%,therefore the new genotype resulted frominterspesific crossing between P. erosus and P.ahipa (EC 550 x AC 208-72h) could beconsidered for further development forcosmetics raw material.Table 3. Effect of genotypes on yam bean tuber drymatter and total starch contentGenotypesB-10 / EC 550B-1 / EC 033B-56 / CJAC 216-139 dB-10 / EC 550 x AC216-139 dB-1 / EC 033 x B-56 /CJAC 216-139 d x B-56 /CJB-10 / EC 550 x B-56 /CJB-10 / EC 550 x AC208-72hTuber Dry Tuber StarchMatter Content% %6,11 de5,36 e7,33 bcde9,39 abcd7,50 abcde8,82 ab6,60 cde8,35 abc10,27 a1,07 c1,20 c1,63 c6,71 a1,34 c1,68 bc1,45 c1,76 bc2,66 bNumbers followed by the same letters are notsignificantly different on alpha 0.05 LSD testThere was interaction between genotypes xsink-reproductive pruning on tuber dry mattercontent, it is shown on Table 4. On nonpruningtreatment, only P. ahipa AC 216-139 dgave smallest mean value for tuber dry mattercharacter. While, contrast result was shown onsink-reproductive pruning, AC 216-139 dgenotype had the highest value than othergenotypes, then followed by interspesifichybrid genotype EC 550 x AC 208-72h.In this study, pruning did not affectthequalitative traits such dry matter and starchcontent of tuber. Yam bean productionincreased as the result of pruning, but thispractice did not affect the percentage of solublesugar content and dry matter percentage.However, there are variations of these traits ongenotypes were evaluated caused by geneticfactors (Zanklan, 2003). This variation can be447seen in the character of dry matter and starch.Tuber dry matter content is a parameter thatreflected the extent of how far photosynthesisproduct is distributed to the tuber. Efficiency ofthe photosynthetic process is shown in the rateof accumulation of dry matter content (Gardneret al., 2008).Table 4. Interaction between Genotypes x Sink-Reproductive Pruning on Tuber Dry MatterTuber Dry MatterGenotypesWithout WithB-10 / EC 550B-1 / EC 033B-56 / CJAC 216-139 dB-10 / EC 550 x AC 216-139 dB-1 / EC 033 x B-56 / CJAC 216-139 d x B-56 / CJB-10 / EC 550 x B-56 / CJB-10 / EC 550 x AC 208-72hPruning8,51 abcA6,04 bcdA7,65 abcdA1,38 dB8,78 abcA10,42 abA9,70 abcA8,34 abcA11,71 aAPruning3,71 BB4,68 BA7,01 BA16,34 AA6,22 BA7,23 BA3,50 BB8,37 AbA8,84 AbANumbers followed by the same letters are notsignificantly different on alpha 0.05 LSD test Smallletter read vertically; Capital letter read horizontallyP. erosus is the most stable species in production,also it produces the prime number foryield (Kale, 2006). P. ahipa is known as specieswith smaller tuber, but higher in dry matterand starch content. Therefore, hybridizationusing those species is expected to gain the newgenotype in high production amount with betterquality especially starch content. This studynoted that intraspesific and interpesific crossesproduced a new genotype with higher productionyield with better quality character fordry matter and starch than the elders.CONCLUSIONSPruning and genotype independently affectedtuber fresh weight. The heaviest tuber producedby P. erosus B-1 / EC 033.Genotypes affected in tuber dry matter andtuber starch content. The highest dry matterwas contained in interspesific crossing between

P. erosus x. P. ahipa EC 550 x AC 208-72h.The highest tuber starch content was resultedby P. ahipa AC 216-139d.Sink-reproductive pruning and genotypeinteracted in tuber dry matter trait.ACKNOWLEDGEMENTSAuthors would like to thanks to IMHEREGranted Program for financial support. Also,thanks to Sinta Prestiana Beza for cooperativework on this study.REFERENCESDe Melo E.P., Krieger N., and Stamford T.L.M, 1994.Physchochemical properties of Jacatupe (Pachyrhizuserosus L. Urban) starch. Starch 46, p. 245- 247.Gardner F.P., Pearce R.B., Dan R.L. Mitchell, 2008.Crops Physiology. Translation of H. Susilo. Jakarta:Universitas Indonesia Perss.Kale P., 2006. Studies on Nutritional and ProcessingProperties of Storage Roots of Different Yam Bean(Pachyrhizus spp) and Wild Mung Bean (Vignavexillata) Species. (Disertation) Cuvillier VerlagGoettingen, Universitaet of Goettingen, Germany.Karuniawan A., 2004. Cultivation Status and GeneticDiversity of Yam Bean (Pachyrhizus erosus) inIndonesia. (Disertation) Cuvillier Verlag Goettingen,Universitaet of Goettingen, Germany.Mustika Ratu, Consumer Products Corporation. Awards.Available online at http://www.mustika-ratu.co.id.[23-01-2012].Nusifera S and Karuniawan A, 2007. Stability of 16Genotypes Yam Bean (Pachyrhizus erosus L. Urban)Tuber Dry Matter Content in Jatinangor West JavaBased AMMI Model. Zuriat, Vol. 18 No. 1.Sørensen M., 1996. Yam Bean Pachyrhizus DC.Promoting the Conservation and Use ofUnderutilized and Neglected Crops. IPGRI. Rome.UPT BPPTK-LIPI Yogyakarta. Pati Bengkuang untukProduk Kecantikan. Available online onhttp/bpptk.lipi.go.id. [15-01-2011]Zanklan A.S., 2003. Agronomic Performance andGenetic Diversity of The Root Crop Yam Bean(Pachyrhizus Spp.) under West African Conditions.(Dissertation). Cuvillier Verlag Gottingen,Uniersitaet of GoettingenGermany.448

Scientific Papers Series B Horticulture

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?