A new approach to species delimitation in Septoria - CBS - KNAW

Studies in Mycology 75: 213–305.A new approach to species delimitation in SeptoriaG.J.M. Verkley 1* , W. Quaedvlieg 1,2 , H.-D. Shin 3 , and P.W. Crous 1,2,41CBS-KNAW Fungal Biodiversity Centre, Upssalalaan 8, 3584 CT, Utrecht, the Netherlands; 2 Microbiology, Department of Biology, Utrecht University, Padualaan 8, 3584 CHUtrecht, the Netherlands; 3 Division of Environmental Science and Ecological Engineering, Korea University, Seoul 136-701, Korea; 4 Wageningen University and ResearchCentre (WUR), Laboratory of Phytopathology, Droevendaalsesteeg 1, 6708 PB Wageningen, the Netherlands*Correspondence: G.J.M. Verkley, g.verkleij@cbs.knaw.nlAbstract: Septoria is a large genus of asexual morphs of Ascomycota causing leaf spot diseases of many cultivated and wild plants. Host specificity has long been a decisivecriterium in species delimitation in Septoria, mainly because of the paucity of useful morphological characters and the high level of variation therein. This study aimed atimproving the species delimitation of Septoria by adopting a polyphasic approach, including multilocus DNA sequencing and morphological analyses on the natural substrateand in culture. To this end 365 cultures preserved in CBS, Utrecht, The Netherlands, among which many new isolates obtained from fresh field specimens were sequenced.Herbarium material including many types was also studied. Full descriptions of the morphology in planta and in vitro are provided for 57 species. DNA sequences weregenerated for seven loci, viz. nuclear ITS and (partial) LSU ribosomal RNA genes, RPB2, actin, calmodulin, Btub, and EF. The robust phylogeny inferred showed that theseptoria-like fungi are distributed over three main clades, establishing the genera Septoria s. str., Sphaerulina, and Caryophylloseptoria gen. nov. Nine new combinationsand one species, Sphaerulina tirolensis sp. nov. were proposed. It is demonstrated that some species have wider host ranges than expected, including hosts from more thanone family. Septoria protearum, previously only associated with Proteaceae was found to be also associated with host plants from six additional families of phanerogams andcryptogams. To our knowledge this is the first study to provide DNA-based evidence that multiple family-associations occur for a single species in Septoria. The distribution ofhost families over the phylogenetic tree showed a highly dispersed pattern for 10 host plant families, providing new insight into the evolution of these fungi. It is concluded thattrans-family host jumping is a major force driving the evolution of Septoria and Sphaerulina.Key words: Evolution, host jumping, host specificity, Multilocus Sequence Typing (MLST), Mycosphaerella, Mycosphaerellaceae, new genus, new species, Pleosporales,Phloeospora, Septoria, Sphaerulina, taxonomy, systematics..Taxonomic novelties: New genus – Caryophylloseptoria Verkley, Quaedvlieg & Crous; New species – Sphaerulina tirolensis Verkley, Quaedvlieg & Crous; New combinations– Caryophylloseptoria lychnidis (Desm.) Verkley, Quaedvlieg & Crous, Caryophylloseptoria silenes (Westend.) Verkley, Quaedvlieg & Crous, Caryophylloseptoria spergulae(Westend.) Verkley, Quaedvlieg & Crous, Sphaerulina aceris (Lib.) Verkley, Quaedvlieg & Crous, Sphaerulina cornicola (DC. : Fr.) Verkley, Quaedvlieg & Crous, Sphaerulinagei (Roberge ex Desm.) Verkley, Quaedvlieg & Crous, Sphaerulina hyperici (Roberge ex Desm.) Verkley, Quaedvlieg & Crous, Sphaerulina frondicola (Fr.) Verkley, Quaedvlieg& Crous, Sphaerulina socia (Pass.) Quaedvlieg, Verkley & Crous; Epitypifications (basionyms) – Ascochyta lysimachiae Lib., Septoria astragali Roberge ex Desm., Septoriacerastii Roberge ex Desm., Septoria clematidis Roberge ex Desm., Septoria cruciatae Roberge ex Desm., Septoria spergulae Westend., Septoria epilobii Westend., Septoriagaleopsidis Westend., Septoria gei Roberge ex Desm., Septoria hyperici Roberge ex Desm., Septoria rubi Westend., Septoria senecionis Westend., Septoria urticae Robergeex Desm.doi:10.3114/sim0018. Hard copy: June 2013.Studies in MycologyINTRODUCTIONFungi classified in the genus Septoria Sacc. are asexual morphsof Ascomycota causing leaf spot diseases on many cultivated andwild plants. Some 3000 Septoria names have been described inliterature (Verkley et al. 2004a, b). Sexual morphs are unknownfor most taxa, but those reported were mostly classified inMycosphaerella and Sphaerulina (Von Arx 1983, Sutton &Hennebert 1994, Crous et al. 2000, Verkley & Priest 2000, Crous etal. 2001, Aptroot 2006). Several overviews of the taxonomic workdone on these fungi have been provided in the literature (Shin &Sameva 2004, Priest 2006, Quaedvlieg et al. 2013). Priest (2006)discussed the complex nomenclatural history of Septoria. The typespecies of Septoria, S. cytisi, is a fungus occurring on the woodylegume Cytisus laburnum (= Laburnum anagyroides) and severalother, mostly herbaceous Fabaceae (Farr 1992, Muthumary 1999).The phylogenetic position of this species for which no culturesare available has for long been uncertain. However, using wellidentifiedherbarium material, Quaedvlieg et al. (2011) were ableCopyright CBS-KNAW Fungal Biodiversity Centre, P.O. Box 85167, 3508 AD Utrecht, The Netherlands.to extract DNA and successfully amplify and sequence nuclearribosomal RNA genes to determine its position in a comprehensivephylogeny inferred for Mycosphaerellaceae.Most taxonomists adopted a generic concept of Septoria thatincluded fungi forming pycnidial conidiomata with holoblastic,hyaline, smooth-walled conidiogenous cells with sympodial and/orpercurrent proliferation and hyaline, smooth, filiform to cylindricalmulti-septate conidia (Sutton 1980, Constantinescu 1984, Sutton &Pascoe 1987, 1989, Farr 1991, 1992). Similar fungi forming acervularconidiomata were classified in Phloeospora, with Phloeospora ulmias the type species, yet some researchers adopted a broaderconcept to include Phloeospora in Septoria (Jørstad 1965, Von Arx1983, Andrianova 1987, Braun 1995). Recent DNA-sequencingstudies have shown that the morphological characters that wereused to delimit coelomycete genera in the past, in particular thosepertaining to conidiomatal structure and conidiogenesis, did notcorrelate well with the sequence-inferred phylogenies (Crous et al.2001, Verkley et al. 2004a, b). Quaedvlieg et al. (2013) present intheir broad-scope study the results of an in-depth morphologicalYou are free to share - to copy, distribute and transmit the work, under the following conditions:Attribution:You must attribute the work in the manner specified by the author or licensor (but not in any way that suggests that they endorse you or your use of the work).Non-commercial: You may not use this work for commercial purposes.No derivative works: You may not alter, transform, or build upon this work.For any reuse or distribution, you must make clear to others the license terms of this work, which can be found at http://creativecommons.org/licenses/by-nc-nd/3.0/legalcode. Any of the above conditions can be waived if you getpermission from the copyright holder. Nothing in this license impairs or restricts the author’s moral rights.213

Verkley et al.and multi-gene sequence analyses of the septoria-like generabased on numerous isolates (including S. cytisi). In their study, theyresolve the affinities and settle the nomenclature of all importantseptoria-like genera in the Dothideales and Pleosporales.Host specificity has long been a decisive criterium in speciesdelimitation in Septoria, mainly because of the paucity of usefulmorphological characters and the high level of variation therein.Traditionally, species of Septoria that were morphologically verysimilar but found on plants of different host families, were regardedas distinct taxa. Material from the same genus or from closely relatedhost genera from the same plant family that could be distinguishedby features such as conidial length and/or width and septationwere usually also considered to belong to separate species.Most taxonomists revising Septoria lacked facilities to thoroughlyinvestigate host ranges. A number of economically importantSeptoria species and species complexes have been subjected toinfection experiments on various hosts, viz. the pathogens of Apium(Cochran 1932, Sheridan 1968) and cultivated Chrysanthemum(Waddell & Weber 1963, Punithalingam & Wheeler 1965). Theresults of these studies largely seemed to confirm the general beliefthat Septoria species have host ranges that are limited to a singlegenus of plants and in relatively few cases, also include a few closelyrelated genera from the same plant family (Priest 2006). Molecularphylogenetic studies on Septoria species infecting Asteraceae(Verkley & Starink-Willemse 2004) and woody perennials (Feau etal. 2006) showed that species that are capable of infecting hostsof the same plant family do not (always) cluster in monophyleticgroups, which is indicative of disjunct evolutionary patterns of thesepathogens and their hosts. To explain these patterns, it has beenpostulated that “host jumping” occurs from typical (susceptible)hosts to “non-host” plants through asymptomatic tissue infectionand subsequent exploration of new susceptible hosts. Examplesof this were found in certain Mycosphaerella species and theirAcacia hosts (Crous et al. 2004b, Crous & Groenewald 2005), butthe mechanisms driving host jumping are not yet understood. Withour study in which we investigate the phylogenetic relationships ofspecies from a wider spectrum of host families we hope to providemore insight into the evolution of these fungal pathogens and theirhost plants and to contribute to understanding such mechanisms.Early molecular phylogenetic studies have confirmed therelationships of septoria-like fungi with sexual morphs withinMycosphaerellaceae, and that the septoria-like fungi are of poly- andparaphyletic origins (Stewart et al. 1999, Crous et al. 2001, Goodwinet al. 2001, Verkley et al. 2004a, b, Verkley & Starink-Willemse, 2004).The ITS and/or LSU nrDNA sequence data used in those studiesdid not provide sufficient phylogenetic information to discriminateclosely related species nor resolve most of the internal nodes in thetrees. Verkley et al. (2004a, b) already concluded that groups withinthe then known “Mycosphaerella clade” showed no correlation toconidiomatal structure or conidiogenesis, confirming the conclusionsdrawn by Crous et al. (2001). Feau et al. (2006) sequenced the ITS,partial β-tubulin gene, and a proportion of the mitochondrial smallsubunit ribosomal gene (mtSSU) to infer a phylogeny for Septoriaassociated with diseases of woody perennials (many of whichare here transferred to Sphaerulina). Although their inferred treesprovided improved resolution, it was clear that even more DNA lociwould be needed to fully resolve closely related species and speciescomplexes within Septoria s. str.The primary goal of our work was to improve the taxonomy ofSeptoria by adopting a polyphasic approach to taxon delimitation.To this end we studied cultures preserved in CBS, Utrecht, theNetherlands and material freshly collected in the field, did a fullcharacterisation of the morphology in planta and in vitro, andsequenced seven DNA loci, viz. nuclear ITS and (partial) LSUribosomal RNA genes, and RPB2, actin (Act), calmodulin (Cal),β-tubulin (Btub), and translation elongation factor 1-alpha (EF)genes. The obtained datasets of the seven loci were also evaluatedfor PCR amplification success rates and barcode gaps in order todetermine which individual, or combination of loci, would be bestsuited for fast and reliable species resolution and identification.Most students of Septoria have focused on material on the naturalsubstrate and did not isolate and deposit cultures in public culturecollections. Of all material we were able to successfully isolate,cultures were deposited in CBS-KNAW Fungal Biodiversity Centre(CBS) in Utrecht, The Netherlands. To assess the nomenclaturethis material was compared to type material as far as it could beobtained for study. Where useful new material and associated purecultures were designated as epitypes, to facilitate future work. Thisstudy supplements the work of Quaedvlieg et al. (2013), who attaina broader perspective and address the complicated taxonomy andpolyphyly of septoria-like fungi, proposing several new genera fortaxa that are distantly related to Septoria cytisi and allied species.MATERIAL AND METHODSCollecting, isolating and morphological comparisonInfected plant material was collected in the field and takento the laboratory. Leaves were examined directly under astereomicroscope to observe sporulating structures, or wheninsufficiently developed, incubated in a Petri-dish with wetted filterpaper for 1–2 d to enhance the development of fruiting bodies.Cirrhi of spores were removed and mounted in tapwater for themicroscopic examination of conidia. Isolates were obtained byeither transferring cirrhi directly onto 3 % malt extract agar (MEA,Oxoid) plates with 50 ppm penicillin and streptomycin, and streakedover the agar surface with an inoculation loop and some sterilewater. Sometimes conidia in water from slide preparations weretaken with a loop and streaked directly onto a plate. After 1–3 dat room temperature, germinated conidia were transferred on tofresh media without antibiotics. New isolates were deposited in theCBS. Cultures taken from the CBS Collection were activated fromlyophilised or cryopreserved material and inoculated on oatmeal(OA) and MEA plates. A complete overview of the material used inthis study is presented in Table 1.For the morphological study in planta hand sections weremade from infected leaves, mounted in water and examinedunder an Olympus BX 50 microscope equipped with brightfield and differential interference contrast (DIC) objectives, andphotographed using a mounted Nikon Digital Sight DS-5M camera.Conidial masses were mounted in water and 30 spores measured.For culture studies, 7–14-d-old cultures were transferred to freshOA, MEA and cherry decoction agar (CHA) plates and placed in anincubator under n-UV light (12 h light, 12 h dark) at 15 ºC to promotesporulation (if otherwise, this is indicated in the descriptions). Mediawere prepared according to Crous et al. (2009). Colony colourswere described according to Rayner (1970). Sporulating structuresobtained from cultures were used for the morphological descriptionin vitro. Photographs of culture plates were taken after 2–3 wkon a photo stand with daylight tubes with a Pentax K110 D digitalcamera. Cultures were incubated up to 40 d to observe sporulationand other features.214

A new approach to species delimitation in SeptoriaDNA isolation, PCR and sequencingGenomic DNA was extracted from fungal mycelium growing onMEA, using the UltraClean® Microbial DNA Isolation Kit (MoBio Laboratories, Inc., Solana Beach, CA, USA). Strains (Table1) were sequenced for seven loci: Actin (Act), calmodulin (Cal),β-tubulin (Btub), internal transcribed spacer (ITS), Translationelongation factor 1-alpha (EF) 28S nrDNA (LSU) and RNApolymerase II second largest subunit (RPB2); the primer setslisted in Table 2 were used. The PCR amplifications wereperformed in a total volume of 12.5 µL solution containing10–20 ng of template DNA, 1 × PCR buffer, 0.7 µL DMSO(99.9 %), 2 mM MgCl 2, 0.4 µM of each primer, 25 µM of eachdNTP and 1.0 U Taq DNA polymerase (GoTaq, Promega).PCR amplification conditions were set as follows: an initialdenaturation temperature of 96 °C for 2 min, followed by 40cycles at the denaturation temperature of 96 °C for 45 s, primerannealing at the temperature stipulated in Table 2, primerextension at 72 °C for 90 s and a final extension step at 72 °C for2 min. The resulting fragments were sequenced using the PCRprimers together with a BigDye Terminator Cycle SequencingKit v. 3.1 (Applied Biosystems, Foster City, CA). Sequencingreactions were performed as described by Cheewangkoon et al.(2008). All novel sequences were deposited in NCBI’s GenBankdatabase and alignments and phylogenetic trees in TreeBASE.Sequence alignement and phylogenetic analysesA basic alignment of the obtained sequence data was first doneusing MAFFT v. 7 (http://mafft.cbrc.jp/alignment /server/index. html;Katoh et al. 2002) and if necessary, manually improved in BioEditv. 7.0.5.2 (Hall 1999). To check the congruency of the multigenedataset, a 70 % neighbour-joining (NJ) reciprocal bootstrapmethod with maximum likelihood distance was performed (Mason-Gamer & Kellogg 1996, Lombard et al. 2010). Bayesian analyses(critical value for the topological convergence diagnostic set to0.01) were performed on the concatenated loci using MrBayes v.3.2.1 (Huelsenbeck & Ronquist 2001) as described by Crous etal. (2006a) using nucleotide substitution models that were selectedusing MrModeltest (Table 3) (Nylander 2004).Kimura-2-parameter valuesThe inter-and intraspecific distances for each individual datasetwere calculated using MEGA v. 4.0 (Tamura et al. 2007) with theKimura-2-parameter (pairwise deletion) model.RESULTSIdentification of the best DNA barcode loci forSeptoria speciesAmplification successThe PCR amplification success rates were very high for all sevenloci, varying from 97 % for RPB2 to 100 % for ITS and LSU (Table3). Good amplification reactions of RPB2 required a 2–3 timeshigher DNA input then the other loci and this locus is therefore lessfavorable for easy identification. The other six loci amplified withoutproblems.Kimura-2-parameter valuesThe Kimura-2-parameter (K2P) distribution graphs are depicted inFig. 1. They visualise the inter- and intraspecific distances per locus(barcoding gap). A good barcoding locus should have no overlapbetween the inter- and intraspecific K2P distances and should havean average interspecific distance that is at least 10 times as high asthe average intraspecific distance of that locus (Hebert et al. 2003).The seven loci show a rather constant degree of intraspecific variationof 0.01 in their K2P distribution graphs, however their interspecificvariations shows considerable differences. The average interspecificvariation in both ITS and LSU datasets is very low (0.015) comparedto their intraspecific variation (0.01), leading to a very low inter- tointraspecific variation ratios of 1.5 : 1 for these two loci (Fig. 1).These low ratios are far below the required 10 : 1 ratio, indicating ageneral lack of natural variation within these two loci, making them illsuitedfor effective identification of the individual species used in thisdataset. These low K2P results for ITS and LSU are consistent withFrequencyFrequencyFrequency120010008006004002000140012001000800600400200070006000500040003000200010000DistanceDistanceDistanceInter RPB2Inter TubInter EFIntra RPB2Intra TubIntra EFInter ActInter CalIntra ActIntra CalInter ITSInter LSUIntra ITSIntra LSUFig. 1. Frequency distributions of the Kimura-2-parameter distances (barcodinggaps) for the seven PCR loci.www.studiesinmycology.org215

Verkley et al.Table 1. Isolates used during this study.Species Old name Isolate no 1 Host Location Collector GenBank Accession no 2CaryophylloseptorialychnidisEF Tub RPB2 LSU ITS Act CalSeptoria lychnidis CBS 109098 Silene pratensis Austria G.J.M. Verkley KF253234 KF252768 KF252292 KF251790 KF251286 KF253595 KF253949Septoria lychnidis CBS 109099 Silene pratensis Austria G.J.M. Verkley KF253235 KF252769 KF252293 KF251791 KF251287 KF253596 KF253950Septoria lychnidis CBS 109101 Silene pratensis Austria G.J.M. Verkley KF253236 KF252770 KF252294 KF251792 KF251288 KF253597 KF253951Septoria lychnidis CBS 109102 Silene pratensis Austria G.J.M. Verkley KF253237 KF252771 KF252295 KF251793 KF251289 KF253598 KF253952Car. pseudolychnidis Septoria lychnidis CBS 128614 Lychnis cognata South Korea H.D. Shin KF253238 KF252772 KF252296 KF251794 KF251290 KF253599 KF253953Septoria lychnidis CBS 128630 Lychnis cognata South Korea H.D. Shin KF253239 KF252773 KF252297 KF251795 KF251291 KF253600 KF253954Car. silenes Septoria silenes CBS 109100 Silene nutans Austria G.J.M. Verkley KF253240 KF252774 KF252298 KF251796 KF251292 KF253601 KF253955Septoria silenes CBS 109103 Silene pratensis Austria G.J.M. Verkley KF253241 KF252775 KF252299 KF251797 KF251293 KF253602 KF253956Car. spergulae Septoria sp. CBS 109010 Spergula morisonii Netherlands A. Aptroot KF253242 KF252776 KF252300 KF251798 KF251294 KF253603 KF253957Septoria dianthi CBS 397.52 Dianthus caryophyllus Netherlands Schouten KF253243 KF252777 KF252301 KF251799 KF251295 KF253604 KF253958Cercospora apii – CBS 118712 – Fiji P. Tyler KF253244 KF252778 KF252302 KF251800 KF251296 KF253605 KF253959Cer. ariminensis – CBS 137.56 Hedysarum coronarium Italy M. Ribaldi KF253245 KF252779 KF252303 KF251801 KF251297 KF253606 KF253960Cer. beticola – CBS 124.31 – Romania E.W. Schmidt KF253246 KF252780 KF252304 KF251802 KF251298 KF253607 KF253961Cercospora sp. – CBS 112737 Rhus typhina Canada K.A. Seifert KF253247 KF252781 – KF251803 KF251299 KF253608 KF253962Cer. zebrina – CBS 118790 Trifolium subterraneum Australia M.J. Barbetti KF253248 KF252782 KF252305 KF251804 KF251300 KF253609 KF253963Cercosporella– CBS 113304 Erigeron annuus South Korea H.D. Shin KF253249 – KF252306 KF251805 KF251301 KF253610 KF253964virgaureaeDothistroma pini – CBS 121011 Pinus palassiana Ukraine A.C. Usichenko KF253250 – KF252307 KF251806 KF251302 KF253611 KF253965Dot. septosporum – CBS 383.74 Pinus coulteri France M. Morelet KF253251 – KF252308 KF251807 KF251303 KF253612 KF253966Mycosphaerella– CBS 228.32 Brassica oleracea Denmark C.A. Jörgensen KF253252 KF252783 KF252309 KF251808 KF251304 KF253613 KF253967brassicicola– CBS 267.53 Brassica oleracea Netherlands F. Quak KF253253 KF252784 KF252310 KF251809 KF251305 KF253614 KF253968Myc. capsellae – CBS 112033 Brassica sp. UK R. Evans KF253254 KF252785 KF252311 KF251810 KF251306 KF253615 KF253969Mycosphaerella sp. CBS 135464; Brassica sp. UK R. Evans – KF252786 KF252312 KF251811 KF251307 KF253616 KF253970CPC 11677Passalora depressa – CPC 14915 Angelica gigas South Korea H.D. Shin KF253256 KF252788 KF252314 KF251813 KF251309 – KF253972Pas. dioscoreae – CBS 135460; Dioscorea tokora South Korea H.D. Shin KF253257 KF252789 KF252315 KF251814 KF251310 KF253618 –CPC 10855– CBS 135463; Dioscorea tenuipes South Korea H.D. Shin KF253258 KF252790 KF252316 KF251815 KF251311 KF253619 –CPC 11513Pas. dissiliens – CBS 219.77 Vitis vinifera Iraq M.S.A. Al-Momen KF253259 KF252791 KF252317 KF251816 KF251312 KF253620 –Pas. fusimaculans – CPC 17277 Agrostis sp. Thailand Pheng Pheng KF253260 KF252792 KF252318 KF251817 KF251313 KF253621 KF253973Pas. janseana – CBS 145.37 – – E.C. Tullis KF253261 KF252793 – KF251818 KF251314 KF253622 KF253974216

A new approach to species delimitation in SeptoriaTable 1. (Continued).Species Old name Isolate no 1 Host Location Collector GenBank Accession no 2EF Tub RPB2 LSU ITS Act CalPassalora sp. – CBS 113998 Cajanus cajan South Africa L. van Jaarsveld KF253262 KF252794 KF252319 KF251819 KF251315 KF253623 –Passalora sp. – CBS 113999 Cajanus cajan South Africa L. van Jaarsveld KF253263 KF252795 KF252320 KF251820 KF251316 KF253624 –Passalora sp. – CBS 114275 Cajanus cajan South Africa L. van Jaarsveld KF253264 KF252796 KF252321 KF251821 KF251317 – –Pseudocercospora – CBS 124155 Eucalyptus camaldulensis Madagascar M.J. Wingfield KF253265 – KF252322 KF251822 KF251318 KF253625 –madagascariensisPse. pyracanthae – CPC 10808 Pyracantha angustifolia South Korea H.D. Shin KF253266 – KF252323 KF251823 KF251319 KF253626 –Pse. pyracanthigena – CBS 112032 Pyracantha angustifolia South Korea M.J. Park KF253267 KF252797 KF252324 KF251824 KF251320 KF253627 KF253975Pse. rhoina – CPC 11464 Rhus chinensis South Korea H.D. Shin KF253268 – KF252325 KF251825 KF251321 – –Pse. schizolobii – CBS 120029 Schizolobium parahybum Ecuador M.J. Wingfield KF253269 KF252798 KF252326 KF251826 KF251322 KF253628 –– CBS 124990 Eucalyptus camaldulensis Thailand W. Himaman KF253270 – KF252327 KF251827 KF251323 KF253629 –Pse. tereticornis – CBS 124996 Eucalyptus nitens Australia A.J. Cargenie KF253271 KF252799 KF252328 KF251828 KF251324 KF253630 KF253976C.F. Hill KF253272 KF252800 KF252329 KF251829 KF251325 KF253631 KF253977Pseudocercosporellacapsellae– CBS 118412 Brassica sp. NewZealand– CBS 127.29 – – K. Togashi KF253273 KF252801 KF252330 KF251830 KF251326 KF253632 KF253978Pella. magnusiana – CBS 114735 Geranium silvaticum Sweden E. Gunnerbeck KF253274 KF252802 – KF251831 KF251327 – KF253979Pella. pastinacae – CBS 114116 Laserpitium latifolium Sweden K. & L. Holm KF253275 KF252803 KF252331 KF251832 KF251328 KF253633 KF253980Ramularia endophylla – CBS 113265 Quercus robur Netherlands G.J.M. Verkley KF253276 – KF252332 KF251833 KF251329 KF253634 KF253981Ram. eucalypti – CBS 120726 Eucalyptus grandiflora Italy W. Gams KF253277 – KF252333 KF251834 KF251330 KF253635 KF253982Ram. lamii – CPC 11312 Leonurus sibiricus South Korea H.D. Shin KF253278 – KF252334 KF251835 KF251331 KF253636 KF253983Readeriella mirabilis – CBS 125000 Eucalyptus globulus Australia I.W. Smith KF253279 KF252804 KF252335 KF251836 KF251332 KF253637 KF253984Septoria abei – CBS 128598 Hibiscus syriacus South Korea H.D. Shin KF253280 KF252805 KF252336 KF251837 KF251333 KF253638 KF253985Sep. aegopodina – CBS 123740 Aegopodium podagraria Czech G.J.M. Verkley KF253281 KF252806 – KF251838 KF251334 KF253639 KF253986Republic– CBS 123741 Aegopodium podagraria Czech G.J.M. Verkley KF253282 KF252807 – KF251839 KF251335 KF253640 KF253987RepublicSep. agrimoniicola – CBS 128585 Agrimonia pilosa South Korea H.D. Shin KF253283 KF252808 KF252337 KF251840 KF251336 KF253641 KF253988– CBS 128602 Agrimonia pilosa South Korea H.D. Shin KF253284 KF252809 KF252338 KF251841 KF251337 – KF253989Sep. anthrisci – CBS 109019 Anthriscus sp. Austria G.J.M. Verkley KF253285 KF252810 KF252339 KF251842 KF251338 KF253642 KF253990– CBS 109020 Anthriscus sp. Austria G.J.M. Verkley KF253286 KF252811 KF252340 KF251843 KF251339 KF253643 KF253991Sep. anthurii – CBS 148.41 Anthurium sp. – P. Kotthoff KF253287 KF252812 KF252341 KF251844 KF251340 KF253644 KF253992– CBS 346.58 Anthurium sp. Germany R. Schneider KF253288 KF252813 KF252342 KF251845 KF251341 KF253645 KF253993Sep. apiicola – CBS 116465 Apium graveolens Netherlands R. Munning KF253289 KF252814 KF252343 KF251846 KF251342 KF253646 KF253994– CBS 389.59 Apium graveolens Italy M. Ribaldi KF253290 KF252815 KF252344 KF251847 KF251343 KF253647 KF253995– CBS 395.52 Apium sp. Netherlands G. van den Ende KF253291 KF252816 KF252345 KF251848 KF251344 KF253648 KF253996www.studiesinmycology.org217

Verkley et al.Table 1. (Continued).Species Old name Isolate no 1 Host Location Collector GenBank Accession no 2EF Tub RPB2 LSU ITS Act Cal– CBS 400.54 Apium graveolens Netherlands J.A. von Arx KF253292 KF252817 KF252346 KF251849 KF251345 KF253649 KF253997Sep. astericola – CBS 128587 Aster tataricus South Korea H.D. Shin KF253293 KF252818 KF252347 KF251850 KF251346 KF253650 KF253998– CBS 128593 Aster yomena South Korea H.D. Shin KF253294 KF252819 KF252348 KF251851 KF251347 KF253651 KF253999Sep. astragali – CBS 109117 Astragalus glycyphyllos Austria G.J.M. Verkley KF253296 KF252821 KF252350 KF251853 KF251349 KF253653 KF254001– CBS 123878 Astragalus glycyphyllos Czech G.J.M. Verkley KF253297 KF252822 KF252351 KF251854 KF251350 KF253654 KF254002Republic– CBS 109116 Astragalus glycyphyllos Austria G.J.M. Verkley KF253298 KF252823 KF252352 KF251855 KF251351 KF253655 KF254003Sep. atropurpurea – CBS 348.58 Aster canus Germany R. Schneider KF253299 KF252824 KF252353 KF251856 KF251352 KF253656 KF254004Sep. bothriospermi – CBS 128592 Bothriospermum tenellum South Korea H.D. Shin KF253300 KF252825 KF252354 KF251857 KF251353 KF253657 KF254005– CBS 128599 Bothriospermum tenellum South Korea H.D. Shin KF253301 KF252826 KF252355 KF251858 KF251354 KF253658 KF254006Sep. bupleuricola – CBS 128601 Bupleurum longiradiatum South Korea H.D. Shin KF253302 KF252827 KF252356 KF251859 KF251355 KF253659 KF254007– CBS 128603 Bupleurum falcatum South Korea H.D. Shin KF253303 KF252828 KF252357 KF251860 KF251356 KF253660 KF254008Sep. calendulae – CBS 349.58 Calendula arvensis Italy R. Schneider KF253304 KF252829 KF252358 KF251861 KF251357 KF253661 KF254009Sep. callistephi – CBS 128590 Callistephus chinensis South Korea H.D. Shin KF253305 KF252830 KF252359 KF251862 KF251358 KF253662 KF254010– CBS 128594 Callistephus chinensis South Korea H.D. Shin KF253306 KF252831 KF252360 KF251863 KF251359 KF253663 KF254011Sep. campanulae – CBS 128589 Campanula takesimana South Korea H.D. Shin KF253307 KF252832 KF252361 KF251864 KF251360 KF253664 KF254012– CBS 128604 Campanula takesimana South Korea H.D. Shin KF253308 KF252833 KF252362 KF251865 KF251361 KF253665 KF254013Sep. cerastii – CBS 102323 Cerastium fontanum Netherlands G.J.M. Verkley KF253309 KF252834 KF252363 KF251866 KF251362 KF253666 KF254014– CBS 128586 Cerastium holosteoides South Korea H.D. Shin KF253310 KF252835 KF252364 KF251867 KF251363 KF253667 KF254015– CBS 128612 Cerastium holosteoides South Korea H.D. Shin KF253311 KF252836 KF252365 KF251868 KF251364 KF253668 KF254016– CBS 128626 Cerastium holosteoides South Korea H.D. Shin KF253312 KF252837 KF252366 KF251869 KF251365 KF253669 KF254017– CPC 12343 Cerastium holosteoides South Korea H.D. Shin KF253313 KF252838 KF252367 KF251870 KF251366 KF253670 KF254018Sep. cf. rubi Septoria sp. CPC 12331 Rubus crataegifolius South Korea H.D. Shin KF253317 KF252842 KF252371 KF251874 KF251370 KF253674 KF254022Septoria rubi CBS 128646 Rubus crataegifolius South Korea H.D. Shin KF253314 KF252839 KF252368 KF251871 KF251367 KF253671 KF254019Septoria rubi CBS 128648 Rubus crataegifolius South Korea H.D. Shin KF253315 KF252840 KF252369 KF251872 KF251368 KF253672 KF254020Septoria rubi CBS 128760 Rubus crataegifolius South Korea H.D. Shin KF253316 KF252841 KF252370 KF251873 KF251369 KF253673 KF254021Sep. cf. sonchi – CBS 128757 Sonchus asper South Korea H.D. Shin KF253500 KF253020 KF252546 KF252057 KF251552 KF253855 KF254204Sep. cf. stachydicola Septoria lycopicola CBS 128662 Stachys riederi South Korea H.D. Shin KF253513 KF253034 KF252559 KF252071 KF251566 KF253867 KF254218Sep. chamaecisti – CBS 350.58 Helianthemum hybridum Germany R. Schneider KF253318 KF252843 KF252372 KF251875 KF251371 KF253675 KF254023Sep. chelidonii – CBS 128607 Chelidonium majus South Korea H.D. Shin KF253319 KF252844 KF252373 KF251876 KF251372 KF253676 KF254024– CPC 12337 Chelidonium majus South Korea H.D. Shin KF253320 KF252845 KF252374 KF251877 KF251373 KF253677 KF254025Sep. chromolaenae – CBS 113373 Chromolaena odorata Cuba S. Neser KF253321 KF252846 KF252375 KF251878 KF251374 KF253678 KF254026218

A new approach to species delimitation in SeptoriaTable 1. (Continued).Species Old name Isolate no 1 Host Location Collector GenBank Accession no 2Sep. chrysanthemella – CBS 128617 ChrysanthemummorifoliumEF Tub RPB2 LSU ITS Act CalSouth Korea H.D. Shin KF253322 KF252847 KF252376 KF251879 KF251375 KF253679 KF254027– CBS 128622 Chrysanthemum boreale South Korea H.D. Shin KF253323 KF252848 KF252377 KF251880 KF251376 KF253680 KF254028– CBS 483.63 Chrysanthemum sp. Netherlands H.A. van der Aa KF253324 KF252849 KF252378 KF251881 KF251377 KF253681 KF254029– CBS 128716 – South Africa E. Oh KF253325 KF252850 KF252379 KF251882 KF251378 KF253682 KF254030– CBS 351.58 Chrysanthemum indicum Germany R. Schneider KF253326 KF252851 KF252380 KF251883 KF251379 KF253683 KF254031– CBS 354.73 ChrysanthemummorifoliumNewZealandG.F. Laundon KF253327 KF252852 KF252381 KF251884 KF251380 KF253684 KF254032Sep. cirsii – CBS 128621 Cirsium setidens South Korea H.D. Shin KF253328 KF252853 KF252382 KF251885 KF251381 KF253685 KF254033Sep. citri (= protearumcomplex)Septoria orchidearum CBS 101013 Masdevallia sp. Netherlands W. Veenbaas-Rijks KF253457 KF252978 KF252504 KF252013 KF251508 KF253812 KF254161Septoria sp. CBS 101354 Gevuina avellana NewZealandS. Ganev KF253458 KF252979 KF252505 KF252014 KF251509 KF253813 KF254162Septoria lobeliae CBS 113392 Lobelia erinus – S. Wolcon KF253460 KF252981 KF252507 KF252016 KF251511 KF253815 KF254164Septoria aciculosa CBS 177.77 Fragaria sp. NewZealandH.J. Boesewinkel KF253463 KF252984 KF252509 KF252019 KF251514 KF253818 KF254167Septoria citri CBS 315.37 – – L.L. Huillier KF253465 – KF252511 KF252021 KF251516 KF253820 KF254169Septoria gerberae CBS 410.61 Gerbera jamesonii Italy W. Gerlach KF253468 KF252988 KF252514 KF252024 KF251519 KF253823 KF254172Septoria hederae CBS 566.88 Hedera helix France H.A. van der Aa KF253470 KF252990 KF252515 KF252026 KF251521 KF253825 KF254174Sep. citricola – CBS 356.36 Citrus sinensis Italy G. Ruggieri KF253329 KF252854 KF252383 KF251886 KF251382 KF253686 KF254034Sep. clematidis – CBS 108983 Clematis vitalba Germany G.J.M. Verkley KF253330 KF252855 KF252384 KF251887 KF251383 KF253687 KF254035– CBS 108984 Clematis vitalba Germany G.J.M. Verkley KF253331 KF252856 KF252385 KF251888 KF251384 KF253688 KF254036Sep. codonopsidis – CBS 128609 Codonopsis lanceolata South Korea H.D. Shin KF253332 KF252857 KF252386 KF251889 KF251385 KF253689 KF254037– CBS 128620 Codonopsis lanceolata South Korea H.D. Shin KF253333 KF252858 KF252387 KF251890 KF251386 KF253690 KF254038Sep. convolvuli – CBS 102325 Calystegia sepium Netherlands G.J.M. Verkley KF253334 KF252859 KF252388 KF251891 KF251387 KF253691 KF254039– CBS 113111 Calystegia sepium NewG.J.M. Verkley KF253335 KF252860 KF252389 KF251892 KF251388 KF253692 KF254040Zealand– CBS 128627 Calystegia soldanella South Korea H.D. Shin KF253336 KF252861 KF252390 KF251893 KF251389 KF253693 KF254041Sep. coprosmae – CBS 113391 Coprosma robusta NewZealandG.J.M. Verkley KF253255 KF252787 KF252313 KF251812 KF251308 KF253617 KF253971Sep. crepidis – CPC 12539 Crepis japonica South Korea H.D. Shin KF253339 KF252864 KF252393 KF251896 KF251392 KF253696 KF254044– CBS 128608 Youngia japonica South Korea H.D. Shin KF253337 KF252862 KF252391 KF251894 KF251390 KF253694 KF254042– CBS 128619 Youngia japonica South Korea H.D. Shin KF253338 KF252863 KF252392 KF251895 KF251391 KF253695 KF254043www.studiesinmycology.org219

Verkley et al.Table 1. (Continued).Species Old name Isolate no 1 Host Location Collector GenBank Accession no 2Sep. cruciatae Septoria sp. CBS 123747 Galium odoratum CzechRepublicSeptoria sp. CBS 123748 Galium odoratum CzechRepublicEF Tub RPB2 LSU ITS Act CalG.J.M. Verkley KF253340 KF252865 KF252394 KF251897 KF251393 KF253697 KF254045G.J.M. Verkley KF253341 KF252866 KF252395 KF251898 KF251394 KF253698 KF254046Sep. cucubali – CBS 102367 Cucubalus baccifer Netherlands G.J.M. Verkley KF253342 KF252867 KF252396 KF251899 KF251395 KF253699 KF254047– CBS 102368 Cucubalus baccifer Netherlands G.J.M. Verkley KF253343 KF252868 KF252397 KF251900 KF251396 KF253700 KF254048– CBS 102386 Saponaria officinalis Netherlands G.J.M. Verkley KF253344 KF252869 KF252398 KF251901 KF251397 KF253701 KF254049Septoria sp. CBS 124874 Fagus sylvatica Germany M. Unterseher KF253345 KF252870 KF252399 KF251902 KF251398 KF253702 KF254050Sep. cucurbitacearum – CBS 178.77 Cucurbita maxima NewZealandH.J. Boesewinkel KF253346 – KF252400 KF251903 KF251399 KF253703 KF254051Sep. dearnessii – CBS 128624 Angelica dahurica South Korea H.D. Shin KF253347 KF252871 KF252401 KF251904 KF251400 KF253704 KF254052Sep. digitalis – CBS 328.67 Digitalis lanata Netherlands H.A. van der Aa KF253348 KF252872 KF252402 KF251905 KF251401 KF253705 KF254053– CBS 391.63 Digitalis lanata Czech V. Holubová KF253349 KF252873 KF252403 KF251906 KF251402 KF253706 KF254054RepublicSep. dolichospora – CBS 129152 Solidago virgaurea South Korea H.D. Shin KF253350 KF252874 – KF251907 KF251403 KF253707 KF254055Sep. dysentericae – CBS 128637 Inula britannica South Korea H.D. Shin KF253351 KF252875 KF252404 KF251908 KF251404 KF253708 KF254056– CBS 128638 Inula britannica South Korea H.D. Shin KF253352 KF252876 KF252405 KF251909 KF251405 KF253709 KF254057– CBS 131892;CPC 12328Inula britannica South Korea H.D. Shin KF253353 KF252877 KF252406 KF251910 KF251406 KF253710 KF254058Sep. ekmaniana – CBS 113385 Chromolaena odorata Mexico M.J. Morris KF253354 KF252878 – KF251911 KF251407 KF253711 KF254059– CBS 113612 Chromolaena odorata Mexico M.J. Morris KF253355 KF252879 – KF251912 KF251408 KF253712 KF254060Sep. epambrosiae – CBS 128629 Ambrosia trifida South Korea H.D. Shin KF253356 KF252880 KF252407 KF251913 KF251409 KF253713 KF254061– CBS 128636 Ambrosia trifida South Korea H.D. Shin KF253357 KF252881 KF252408 KF251914 KF251410 KF253714 KF254062Sep. epilobii – CBS 109084 Epilobium fleischeri Austria G.J.M. Verkley KF253358 KF252882 KF252409 KF251915 KF251411 KF253715 KF254063– CBS 109085 Epilobium fleischeri Austria G.J.M. Verkley KF253359 KF252883 KF252410 KF251916 KF251412 KF253716 KF254064Sep. erigerontis – CBS 109094 Erigeron annuus Austria G.J.M. Verkley KF253360 KF252884 KF252411 KF251917 KF251413 KF253717 KF254065– CBS 109095 Erigeron annuus Austria G.J.M. Verkley KF253361 KF252885 KF252412 KF251918 KF251414 KF253718 KF254066– CBS 128606 Erigeron annuus South Korea H.D. Shin KF253362 KF252886 KF252413 KF251919 KF251415 KF253719 KF254067– CBS 131893;CPC 12340Erigeron annuus South Korea H.D. Shin KF253363 KF252888 KF252414 KF251920 KF251416 KF253720 KF254068Septoria schnabliana CBS 186.93 Erigeron annuus Italy M. Vurro KF253364 KF252887 KF252537 KF252048 KF251543 KF253893 KF254244Sep. eucalyptorum – CBS 118505 Eucalyptus sp. India W. Gams KF253365 KF252889 KF252415 KF251921 KF251417 KF253721 KF254069Sep. exotica – CBS 163.78 Hebe speciosa NewH.J. Boesewinkel KF253366 KF252890 KF252416 KF251922 KF251418 KF253722 KF254070Zealand220

A new approach to species delimitation in SeptoriaTable 1. (Continued).Species Old name Isolate no 1 Host Location Collector GenBank Accession no 2Sep. galeopsidis – CBS 123744 Galeopsis sp. CzechRepublic– CBS 123746 Galeopsis sp. CzechRepublic– CBS 123749 Galeopsis sp. CzechRepublicEF Tub RPB2 LSU ITS Act CalG.J.M. Verkley KF253367 KF252891 KF252417 KF251923 KF251419 KF253723 KF254071G.J.M. Verkley KF253368 KF252892 KF252418 KF251924 KF251420 KF253724 KF254072G.J.M. Verkley KF253369 KF252893 KF252419 KF251925 KF251421 KF253725 KF254073– CBS 191.26 Galeopsis sp. – C. Killian KF253370 KF252894 KF252420 KF251926 KF251422 KF253726 KF254074– CBS 102314 Galeopsis tetrahit Netherlands G.J.M. Verkley KF253371 KF252895 KF252421 KF251927 KF251423 KF253727 KF254075– CBS 102411 Galeopsis tetrahit Netherlands G.J.M. Verkley KF253372 KF252896 KF252422 KF251928 KF251424 KF253728 KF254076– CBS 123745 Galeopsis sp. CzechRepublicG.J.M. Verkley KF253373 KF252897 KF252423 KF251929 KF251425 KF253729 KF254077Sep. gentianae – CBS 128633 Gentiana scabra South Korea H.D. Shin KF253374 KF252898 KF252424 KF251930 KF251426 KF253730 KF254078Sep. gladioli – CBS 121.20 – – – KF253375 KF252899 KF252425 KF251931 KF251427 KF253731 KF254079– CBS 353.29 – Netherlands J.C. Went KF253376 KF252900 KF252426 KF251932 KF251428 KF253732 KF254080Sep. glycines – CBS 336.53 – Japan H. Kurata KF253377 KF252901 – KF251933 KF251429 KF253733 KF254081Sep. glycinicola – CBS 128618 Glycine max South Korea H.D. Shin KF253378 KF252902 KF252427 KF251934 KF251430 KF253734 KF254082Sep. helianthi – CBS 123.81 Helianthus annuus – M. Muntañola KF253379 KF252903 KF252428 KF251935 KF251431 KF253735 KF254083Sep. helianthicola – CBS 122.81 Helianthus annuus – M. Muntañola KF253380 KF252904 KF252429 KF251936 KF251432 KF253736 KF254084Sep. hibiscicola – CBS 128611 Hibiscus syriacus South Korea H.D. Shin KF253381 KF252905 KF252430 KF251937 KF251433 KF253737 KF254085– CBS 128615 Hibiscus syriacus South Korea H.D. Shin KF253382 KF252906 KF252431 KF251938 KF251434 KF253738 KF254086Sep. hippocastani – CBS 411.61 Aesculus hippocastanum Germany W. Gerlach KF253383 KF252907 KF252432 KF251939 KF251435 KF253739 KF254087Sep. justiciae – CPC 12509 Justicia procumbens South Korea H.D. Shin KF253386 KF252910 KF252435 KF251942 KF251438 KF253742 KF254090– CBS 128610 Justicia procumbens South Korea H.D. Shin KF253384 KF252908 KF252433 KF251940 KF251436 KF253740 KF254088– CBS 128625 Justicia procumbens South Korea H.D. Shin KF253385 KF252909 KF252434 KF251941 KF251437 KF253741 KF254089Sep. lactucae – CBS 108943 Lactuca sativa Netherlands P. Grooteman KF253387 KF252911 KF252436 KF251943 KF251439 KF253743 KF254091– CBS 352.58 Lactuca sativa Germany G. Sörgel KF253388 KF252912 KF252437 KF251944 KF251440 KF253744 KF254092Sep. lamiicola – CBS 102328 Lamium album Netherlands G.J.M. Verkley KF253389 KF252913 KF252438 KF251945 KF251441 KF253745 KF254093– CBS 102329 Lamium album Netherlands G.J.M. Verkley KF253390 KF252914 KF252439 KF251946 KF251442 KF253746 KF254094– CBS 102379 Lamium sp. Netherlands G.J.M. Verkley KF253391 KF252915 KF252440 KF251947 KF251443 KF253747 KF254095– CBS 102380 Lamium sp. Netherlands G.J.M. Verkley KF253392 KF252916 KF252441 KF251948 KF251444 KF253748 KF254096– CBS 109112 Lamium album Austria G.J.M. Verkley KF253393 KF252917 KF252442 KF251949 KF251445 KF253749 KF254097– CBS 109113 Lamium album Austria G.J.M. Verkley KF253394 KF252918 KF252443 KF251950 KF251446 KF253750 KF254098– CBS 123882 Lamium sp. CzechRepublicG.J.M. Verkley KF253395 KF252919 KF252444 KF251951 KF251447 KF253751 KF254099www.studiesinmycology.org221

Verkley et al.Table 1. (Continued).Species Old name Isolate no 1 Host Location Collector GenBank Accession no 2– CBS 123883 Lamium sp. CzechRepublic– CBS 123884 Lamium sp. CzechRepublicEF Tub RPB2 LSU ITS Act CalG.J.M. Verkley KF253396 KF252920 KF252445 KF251952 KF251448 KF253752 KF254100G.J.M. Verkley KF253397 KF252921 KF252446 KF251953 KF251449 KF253753 KF254101Sep. lepidiicola – CBS 128635 Lepidium virginicum South Korea H.D. Shin KF253398 KF252922 KF252447 KF251954 KF251450 KF253754 KF254102Sep. leptostachyae – CBS 128613 Phryma leptostachya South Korea H.D. Shin KF253399 KF252923 KF252448 KF251955 KF251451 KF253755 KF254103– CBS 128628 Phryma leptostachya South Korea H.D. Shin KF253400 KF252924 KF252449 KF251956 KF251452 KF253756 KF254104Sep. leucanthemi – CBS 109083 Chrysanthemumleucanthemum– CBS 109086 Chrysanthemumleucanthemum– CBS 109090 Chrysanthemumleucanthemum– CBS 109091 Chrysanthemumleucanthemum– CBS 113112 ChrysanthemumleucanthemumAustria G.J.M. Verkley KF253401 KF252925 KF252450 KF251957 KF251453 KF253757 KF254105Austria G.J.M. Verkley KF253402 KF252926 KF252451 KF251958 KF251454 KF253758 KF254106Austria G.J.M. Verkley KF253403 KF252927 KF252452 KF251959 KF251455 KF253759 KF254107Austria G.J.M. Verkley KF253404 KF252928 KF252453 KF251960 KF251456 KF253760 KF254108NewZealandG.J.M. Verkley KF253405 KF252929 KF252454 KF251961 KF251457 KF253761 KF254109– CBS 353.58 Chrysanthemum maximum Germany R. Schneider KF253406 KF252930 KF252455 KF251962 KF251458 KF253762 KF254110Sep. limonum – CBS 419.51 Citrus limonium Italy G. Goidánich KF253407 KF252931 KF252456 KF251963 KF251459 KF253763 KF254111Sep. linicola – CBS 316.37 Linum usitatissimum – H.W. Hollenweber KF253408 KF252932 KF252457 KF251964 KF251460 KF253764 KF254112Sep. lycoctoni – CBS 109089 Aconitum vulparia Austria G.J.M. Verkley KF253409 KF252933 KF252458 KF251965 KF251461 KF253765 KF254113Sep. lycopersici – CBS 128654 Lycopersicon esculentum South Korea H.D. Shin KF253410 KF252934 KF252459 KF251966 KF251462 KF253766 KF254114– CBS 354.49 Lycopersicon esculentum Canada B.H. MacNeil KF253411 KF252935 KF252460 KF251967 KF251463 KF253767 KF254115Sep. lycopicola – CBS 128651 Lycopus ramosissimus South Korea H.D. Shin KF253412 KF252936 KF252461 KF251968 KF251464 KF253768 KF254116Sep. lysimachiae – CBS 102315 Lysimachia vulgaris Netherlands G.J.M. Verkley KF253413 KF252937 KF252462 KF251969 KF251465 KF253769 KF254117– CBS 108998 Lysimachia vulgaris Netherlands G.J.M. Verkley KF253414 KF252938 KF252463 KF251970 KF251466 KF253770 KF254118– CBS 108999 Lysimachia vulgaris Netherlands G.J.M. Verkley KF253415 KF252939 KF252464 KF251971 KF251467 KF253771 KF254119– CBS 123794 Lysimachia sp. CzechRepublic– CBS 123795 Lysimachia sp. CzechRepublicG.J.M. Verkley KF253416 KF252940 KF252465 KF251972 KF251468 KF253772 KF254120G.J.M. Verkley KF253417 KF252941 KF252466 KF251973 KF251469 KF253773 KF254121Sep. malagutii – CBS 106.80 Solanum sp. Peru G.H. Boerema KF253418 – KF252467 KF251974 KF251470 KF253774 KF254122Sep. matricariae – CBS 109000 Matricaria discoidea Netherlands G.J.M. Verkley KF253419 KF252942 KF252468 KF251975 KF251471 KF253775 KF254123– CBS 109001 Matricaria discoidea Netherlands G.J.M. Verkley KF253420 KF252943 KF252469 KF251976 KF251472 KF253776 KF254124Sep. mazi – CBS 128656 Mazus japonicus South Korea H.D. Shin KF253421 KF252944 KF252470 KF251977 KF251473 KF253777 KF254125222

A new approach to species delimitation in SeptoriaTable 1. (Continued).Species Old name Isolate no 1 Host Location Collector GenBank Accession no 2EF Tub RPB2 LSU ITS Act Cal– CBS 128755 Mazus japonicus South Korea H.D. Shin KF253422 KF252945 KF252471 KF251978 KF251474 KF253778 KF254126Sep. melissae – CBS 109097 Melissa officinalis Netherlands H.A. van der Aa KF253423 KF252946 KF252472 KF251979 KF251475 KF253779 KF254127Sep. menthae – CBS 404.34 – Japan T. Hemmi KF253424 KF252947 – KF251980 KF251476 KF253780 KF254128Sep. napelli – CBS 109104 Aconitum napellus Austria G.J.M. Verkley KF253425 KF252948 KF252473 KF251981 KF251477 KF253781 KF254129– CBS 109105 Aconitum napellus Austria G.J.M. Verkley KF253426 KF252949 KF252474 KF251982 KF251478 KF253782 KF254130– CBS 109106 Aconitum napellus Austria G.J.M. Verkley KF253427 KF252950 KF252475 KF251983 KF251479 KF253783 KF254131Sep. obesa Septoria artimisiae CBS 128588 Artemisia lavandulaefolia South Korea H.D. Shin KF253428 KF252951 KF252476 KF251984 KF251480 KF253784 KF254132SeptoriaCBS 128623 Chrysanthemum indicum South Korea H.D. Shin KF253429 KF252952 KF252477 KF251985 KF251481 KF253785 KF254133chrysanthemella– CBS 128759 ChrysanthemumSouth Korea H.D. Shin KF253430 – KF252478 KF251986 KF251482 KF253786 KF254134morifolium– CBS 354.58 Chrysantemum indicum Germany R. Schneider KF253431 – KF252479 KF251987 KF251483 KF253787 KF254135Sep. oenanthis – CBS 128667 Cicuta virosa South Korea H.D. Shin KF253432 KF252953 KF252481 KF251989 KF251485 KF253788 KF254136Sep. oenanthicola Septoria oenanthis CBS 128649 Oenanthe javanica South Korea H.D. Shin KF253433 KF252954 KF252480 KF251988 KF251484 KF253789 KF254137Sep. orchidearum Septoria cyclaminis CBS 128631 Cyclamen fatrense South Korea H.D. Shin KF253434 KF252955 KF252482 KF251990 KF251486 KF253790 KF254138– CBS 457.78 Listera ovata France H.A. van der Aa KF253435 KF252956 KF252483 KF251991 KF251487 KF253791 KF254139Sep. oudemansii – CBS 619.72 Poa pratensis Germany R. Schneider KF253436 KF252957 KF252484 KF251992 KF254299 – KF254140Sep. pachyspora – CBS 128652 Zyathoxylum schinifolium South Korea H.D. Shin KF253437 KF252958 KF252485 KF251993 KF251488 KF253792 KF254141Sep. paridis – CBS 109111 Paris quadrifolia Austria G.J.M. Verkley KF253438 KF252959 KF252486 KF251994 KF251489 KF253793 KF254142– CBS 109110 Paris quadrifolia Austria G.J.M. Verkley KF253439 KF252960 KF252487 KF251995 KF251490 KF253794 KF254143Septoria violaepalustrisSeptoria violaepalustrisCBS 109108 Viola sp. Austria G.J.M. Verkley KF253440 KF252961 KF252488 KF251996 KF251491 KF253795 KF254144CBS 109109 Viola sp. Austria G.J.M. Verkley KF253441 KF252962 KF252489 KF251997 KF251492 KF253796 KF254145Sep. passifloricola Sep. passiflorae CBS 102701 Passiflora edulis NewZealandC.F. Hill KF253442 KF252963 KF252490 KF251998 KF251493 KF253797 KF254146– CBS 129431 Passiflora edulis South Korea H.D. Shin KF253443 KF252964 – KF251999 KF251494 KF253798 KF254147Sep. perillae – CBS 128655 Perilla frutescens South Korea H.D. Shin KF253444 KF252965 KF252491 KF252000 KF251495 KF253799 KF254148Sep. petroselini – CBS 109521 – Netherlands H.A. van der Aa KF253445 KF252966 KF252492 KF252001 KF251496 KF253800 KF254149– CBS 182.44 Petroselinum sativum Netherlands S.D. de Wit KF253446 KF252967 KF252493 KF252002 KF251497 KF253801 KF254150Sep. phlogis – CBS 102317 Phlox sp. Netherlands G.J.M. Verkley KF253447 KF252968 KF252494 KF252003 KF251498 KF253802 KF254151– CBS 128663 Phlox paniculata South Korea H.D. Shin KF253448 KF252969 KF252495 KF252004 KF251499 KF253803 KF254152– CBS 577.90 Phlox sp. Netherlands H.A. van der Aa KF253449 KF252970 KF252496 KF252005 KF251500 KF253804 KF254153Sep. polygonorum – CBS 102330 Polygonum persicaria Netherlands G.J.M. Verkley KF253450 KF252971 KF252497 KF252006 KF251501 KF253805 KF254154www.studiesinmycology.org223

Verkley et al.Table 1. (Continued).Species Old name Isolate no 1 Host Location Collector GenBank Accession no 2EF Tub RPB2 LSU ITS Act Cal– CBS 102331 Polygonum persicaria Netherlands G.J.M. Verkley KF253451 KF252972 KF252498 KF252007 KF251502 KF253806 KF254155– CBS 108982 Polygonum persicaria Germany G.J.M. Verkley KF253452 KF252973 KF252499 KF252008 KF251503 KF253807 KF254156– CBS 109834 Polygonum persicaria Netherlands G.J.M. Verkley KF253453 KF252974 KF252500 KF252009 KF251504 KF253808 KF254157– CBS 113110 Polygonum persicaria NewZealandC.F. Hill KF253454 KF252975 KF252501 KF252010 KF251505 KF253809 KF254158– CBS 347.67 Polygonum persicaria Netherlands H.A. van der Aa KF253455 KF252976 KF252502 KF252011 KF251506 KF253810 KF254159Sep. posoniensis – CBS 128645 Chrysosplenium japonicum South Korea H.D. Shin KF253456 KF252977 KF252503 KF252012 KF251507 KF253811 KF254160Sep. protearum Septoria sp. CPC 19691 Zanthedeschia aethiopica South Africa P.W. Crous KF253474 KF252994 KF252519 KF252030 KF251525 KF253829 KF254178Septoria sp. CBS 113114 Geum sp. NewG.J.M. Verkley KF253459 KF252980 KF252506 KF252015 KF251510 KF253814 KF254163ZealandSeptoria sp. CBS 119942 Asplenium ruta-muraria Germany G.J.M. Verkley KF253461 KF252982 – KF252017 KF251512 KF253816 KF254165Septoria sp. CBS 135477;CPC 19675Septoria sp. CBS 164.78 Nephrolepis sp. NewZealandSeptoria sp. CBS 179.77 Myosotis sp. NewZealandZanthedeschia aethiopica South Africa P.W. Crous KF253473 KF252993 KF252518 KF252029 KF251524 KF253828 KF254177H.J. Boesewinkel KF253462 KF252983 KF252508 KF252018 KF251513 KF253817 KF254166H.J. Boesewinkel KF253464 KF252985 KF252510 KF252020 KF251515 KF253819 KF254168Septoria sp. CBS 364.97 Skimmia sp. Netherlands J. de Gruyter KF253466 KF252986 KF252512 KF252022 KF251517 KF253821 KF254170Septoria ligustri CBS 390.59 Ligustrum vulgare Italy M. Ribaldi KF253467 KF252987 KF252513 KF252023 KF251518 KF253822 KF254171Septoria pistaciae CBS 420.51 Pistacia vera Italy G. Goidánich KF253469 KF252989 – KF252025 KF251520 KF253824 KF254173Septoria sp. CBS 658.77 Boronia denticulata NewZealandH.J. Boesewinkel KF253471 KF252991 KF252516 KF252027 KF251522 KF253826 KF254175– CBS 778.97 Protea cynaroides South Africa L. Viljoen KF253472 KF252992 KF252517 KF252028 KF251523 KF253827 KF254176Sep. pseudonapelli Septoria napelli CBS 128664 Aconitum pseudolaeve South Korea H.D. Shin KF253475 KF252995 KF252520 KF252031 KF251526 KF253830 KF254179Sep. putrida – CBS 109087 Senecio nemorensis Austria G.J.M. Verkley KF253476 KF252996 KF252521 KF252032 KF251527 KF253831 KF254180– CBS 109088 Senecio nemorensis Austria G.J.M. Verkley KF253477 KF252997 KF252522 KF252033 KF251528 KF253832 KF254181Sep. rumicum Septoria acetosae CBS 503.76 Rumex acetosa France H.A. van der Aa KF253478 KF252998 KF252523 KF252034 KF251529 KF253833 KF254182Sep. saccardoi – CBS 128756 Lysimachia vulgaris South Korea H.D. Shin KF253479 KF252999 KF252524 KF252035 KF251530 KF253834 KF254183Sep. scabiosicola – CBS 102333 Knautia arvensis Netherlands G.J.M. Verkley KF253480 KF253000 KF252525 KF252036 KF251531 KF253835 KF254184– CBS 102334 Knautia arvensis Netherlands G.J.M. Verkley KF253481 KF253001 KF252526 KF252037 KF251532 KF253836 KF254185– CBS 102335 Knautia arvensis Netherlands G.J.M. Verkley KF253482 KF253002 KF252527 KF252038 KF251533 KF253837 KF254186– CBS 102336 Knautia arvensis Netherlands G.J.M. Verkley KF253483 KF253003 KF252528 KF252039 KF251534 KF253838 KF254187– CBS 108981 Knautia arvensis Germany G.J.M. Verkley KF253484 KF253004 KF252529 KF252040 KF251535 KF253839 KF254188– CBS 109021 Knautia arvensis Austria G.J.M. Verkley KF253485 KF253005 KF252530 KF252041 KF251536 KF253840 KF254189224

A new approach to species delimitation in SeptoriaTable 1. (Continued).Species Old name Isolate no 1 Host Location Collector GenBank Accession no 2EF Tub RPB2 LSU ITS Act Cal– CBS 109092 Knautia dipsacifolia Austria G.J.M. Verkley KF253486 KF253006 KF252531 KF252042 KF251537 KF253841 KF254190– CBS 109093 Knautia dipsacifolia Austria G.J.M. Verkley KF253487 KF253007 KF252532 KF252043 KF251538 KF253842 KF254191– CBS 109128 Knautia dipsacifolia Austria G.J.M. Verkley KF253488 KF253008 KF252533 KF252044 KF251539 KF253843 KF254192– CBS 109129 Knautia dipsacifolia Austria G.J.M. Verkley KF253489 KF253009 KF252534 KF252045 KF251540 KF253844 KF254193– CBS 182.93 Succissa pratensis France H.A. van der Aa KF253490 KF253010 KF252535 KF252046 KF251541 KF253845 KF254194– CBS 317.37 – – – KF253491 KF253011 KF252536 KF252047 KF251542 KF253846 KF254195Sep. senecionis – CBS 102366 Senecio fluviatilis Netherlands G.J.M. Verkley KF253492 KF253012 KF252538 KF252049 KF251544 KF253847 KF254196– CBS 102381 Senecio fluviatilis Netherlands G.J.M. Verkley KF253493 KF253013 KF252539 KF252050 KF251545 KF253848 KF254197Sep. siegesbeckiae – CBS 128659 Siegesbeckia glabrescens South Korea H.D. Shin KF253494 KF253014 KF252540 KF252051 KF251546 KF253849 KF254198– CBS 128661 Siegesbeckia pubescens South Korea H.D. Shin KF253495 KF253015 KF252541 KF252052 KF251547 KF253850 KF254199Sep. sii – CBS 102369 Berula erecta Netherlands G.J.M. Verkley KF253496 KF253016 KF252542 KF252053 KF251548 KF253851 KF254200– CBS 102370 Berula erecta Netherlands G.J.M. Verkley KF253497 KF253017 KF252543 KF252054 KF251549 KF253852 KF254201– CBS 118.96 Berula erecta Netherlands H.A. van der Aa KF253498 KF253018 KF252544 KF252055 KF251550 KF253853 KF254202Sep. sisyrinchii – CBS 112096 Sysirinchium sp. NewZealandC.F. Hill KF253499 KF253019 KF252545 KF252056 KF251551 KF253854 KF254203Septoria sp. Pseudocercospora sp. CPC 19976 Feijoa sellowiana Italy G. Polizzy KF253509 KF253030 – KF252067 KF251562 KF253863 KF254214Septoria sp. – CPC 23104 – Italy E. van Agtmaal KF253511 KF253032 KF252557 KF252069 KF251564 KF253865 KF254216Septoria sp. – CBS 109114 Campanula glomerata Austria G.J.M. Verkley KF253501 KF253021 KF252547 KF252058 KF251553 KF253856 KF254205Septoria sp. – CBS 120739 Eucalyptus sp. Italy W. Gams KF253503 KF253023 KF252549 KF252060 KF251555 KF253858 KF254207Septoria sp. Septoria taraxaci CBS 128650 Taraxacum officinale South Korea H.D. Shin KF253504 KF253024 KF252550 KF252061 KF251556 KF253859 KF254208Septoria sp. Septoria posoniensis CBS 128658 Chrysoplenium japonicum South Korea H.D. Shin KF253505 KF253025 KF252551 KF252062 KF251557 KF253860 KF254209Austria P.W. Crous KF253506 KF253026 KF252552 KF252063 KF251558 KF253861 KF254210Septoria sp. – CBS 135472;CPC 19304Septoria sp. – CBS 135474;CPC 19485Septoria sp. – CBS 135478;CPC 19716Septoria sp. – CBS 135479;CPC 19793Septoria sp. – CPC 23103;MP11Vigna unguiculata ssp.sesquipedalisConyza canadensis Brazil R.W. Barreto KF253507 KF253027 KF252553 KF252064 KF251559 KF253862 KF254211Searsia laevigatum South Africa A. Wood KF253508 KF253028 KF252554 KF252065 KF251560 – KF254212Syzygium cordatum South Africa P.W. Crous – KF253029 KF252555 KF252066 KF251561 – KF254213Aesculus sp. Netherlands S.I.R. Videira KF253510 KF253031 KF252556 KF252068 KF251563 KF253864 KF254215Sep. stachydicola – CBS 128668 Stachys riederi South Korea H.D. Shin KF253512 KF253033 KF252558 KF252070 KF251565 KF253866 KF254217Sep. stachydis – CBS 109115 Campanula glomerata Austria G.J.M. Verkley KF253502 KF253022 KF252548 KF252059 KF251554 KF253857 KF254206– CBS 102326 Stachys sylvatica Netherlands G.J.M. Verkley KF253514 KF253035 KF252560 KF252072 KF251567 KF253868 KF254219– CBS 102337 Stachys sylvatica Netherlands G.J.M. Verkley KF253515 KF253036 KF252561 KF252073 KF251568 KF253869 KF254220www.studiesinmycology.org225

Verkley et al.Table 1. (Continued).Species Old name Isolate no 1 Host Location Collector GenBank Accession no 2EF Tub RPB2 LSU ITS Act Cal– CBS 109126 Stachys sylvatica Austria G.J.M. Verkley KF253516 KF253037 KF252562 KF252074 KF251569 KF253870 KF254221– CBS 109127 Stachys sylvatica Austria G.J.M. Verkley KF253517 KF253038 KF252563 KF252075 KF251570 KF253871 KF254222– CBS 123750 Stachys sp. CzechRepublic– CBS 123879 Stachys sp. CzechRepublicG.J.M. Verkley KF253518 KF253039 KF252564 KF252076 KF251571 KF253872 KF254223G.J.M. Verkley KF253519 KF253040 KF252565 KF252077 KF251572 KF253873 KF254224– CBS 449.68 Stachys sylvatica Netherlands H.A. van der Aa KF253520 KF253041 KF252566 KF252078 KF251573 KF253874 KF254225Sep. astericola CBS 347.58 Aster canus Germany R. Schneider KF253295 KF252820 KF252349 KF251852 KF251348 KF253652 KF254000Sep. stellariae – CBS 102376 Stellaria media Netherlands G.J.M. Verkley KF253521 KF253042 KF252567 KF252079 KF251574 KF253875 KF254226– CBS 102378 Stellaria media Netherlands G.J.M. Verkley KF253522 KF253043 KF252568 KF252080 KF251575 KF253876 KF254227– CBS 102410 Stellaria media Netherlands G.J.M. Verkley KF253523 KF253044 KF252569 KF252081 KF251576 KF253877 KF254228Sep. taraxaci – CBS 567.75 Taraxacum sp. Armenia H.A. van der Aa KF253524 KF253045 KF252570 KF252082 KF251577 KF253878 KF254229Sep. tinctoriae – CBS 129154 Serratula coronata South Korea H.D. Shin KF253525 KF253046 KF252571 KF252083 KF251578 KF253879 KF254230Sep. tormentillae – CBS 128643 Potentilla fragarioides South Korea H.D. Shin KF253526 KF253047 KF252572 KF252084 KF251579 KF253880 KF254231– CBS 128647 Potentilla fragarioides South Korea H.D. Shin KF253527 KF253048 KF252573 KF252085 KF251580 KF253881 KF254232Sep. urticae Septoria glechomatis CBS 102316 Glechoma hederacea Netherlands G.J.M. Verkley KF253528 KF253049 KF252574 KF252086 KF251581 KF253882 KF254233– CBS 102371 Urtica dioica Netherlands G.J.M. Verkley KF253529 KF253050 KF252575 KF252087 KF251582 KF253883 KF254234– CBS 102375 Urtica dioica Netherlands G.J.M. Verkley KF253530 KF253051 KF252576 KF252088 KF251583 KF253884 KF254235Sep. verbascicola – CBS 102401 Verbascum nigrum Netherlands G.J.M. Verkley KF253531 KF253052 KF252577 KF252089 KF251584 KF253885 KF254236Sep. verbenae – CBS 113438 Verbena officinalis NewG.J.M. Verkley KF253532 KF253053 KF252578 KF252090 KF251585 KF253886 KF254237Zealand– CBS 113481 Verbena officinalis NewG.J.M. Verkley KF253533 KF253054 KF252579 KF252091 KF251586 KF253887 KF254238ZealandSep. villarsiae – CBS 514.78 Nymphoides peltata Netherlands H.A. van der Aa KF253534 KF253055 KF252580 KF252092 KF251587 KF253888 KF254239– CBS 565.88 Nymphoides peltata Netherlands H.A. van der Aa KF253535 KF253056 KF252581 KF252093 KF251588 KF253889 KF254240– CBS 604.66 Nymphoides peltata Netherlands L. Marvanová KF253536 KF253057 KF252582 KF252094 KF251589 KF253890 KF254241Sep. violae-palustris – CBS 128644 Viola selkirkii South Korea H.D. Shin KF253537 KF253058 KF252583 KF252095 KF251590 KF253891 KF254242– CBS 128660 Viola yedoensis South Korea H.D. Shin KF253538 KF253059 KF252584 KF252096 KF251591 KF253892 KF254243Sphaerulina abeliceae Septoria abeliceae CBS 128591 Zelkova serrata South Korea H.D. Shin KF253539 – KF252585 KF252097 KF251592 KF253894 KF254245Sphaerulina aceris Mycosphaerella CBS 183.97 Acer pseudoplatanus Netherlands H.A. van der Aa KF253540 – KF252586 KF252098 KF251593 KF253895 KF254246latebrosaMycosphaerella CBS 652.85 Acer pseudoplatanus Netherlands H.A. van der Aa KF253541 KF253060 KF252587 KF252099 KF251594 KF253896 KF254300latebrosaMycosphaerella latebrosaCBS 687.94 Acer pseudoplatanus Netherlands G.J.M. Verkley KF253542 KF253061 KF252588 KF252100 KF251595 KF253897 KF254247226

A new approach to species delimitation in SeptoriaTable 1. (Continued).Species Old name Isolate no 1 Host Location Collector GenBank Accession no 2SphaerulinaamelanchierEF Tub RPB2 LSU ITS Act Cal– CBS 135110 Amelanchier sp. Netherlands S.I.R. Videira KF253543 KF253062 KF252589 KF252101 KF251596 KF253898 KF254248Septoria sp. CPC 23107;MP9Septoria sp. CPC 23105;MP22– CPC 23106;MP7Betula sp. Netherlands S.I.R. Videira KF253583 KF253098 KF252626 KF252139 KF251634 KF253937 KF254288Quercus sp. Netherlands S.I.R. Videira KF253544 KF253063 KF252590 KF252102 KF251597 KF253899 KF254249Castanea sp. Netherlands S.I.R. Videira KF253545 KF253064 KF252591 KF252103 KF251598 KF253900 KF254250Sphaerulina azaleae Septoria azaleae CBS 128605 Rhododendron sp. South Korea H.D. Shin KF253546 KF253065 KF252592 KF252104 KF251599 KF253901 KF254251Septoria azaleae CBS 352.49 Rhododendron sp. Belgium J. van Holder KF253547 KF253066 KF252593 KF252105 KF251600 KF253902 KF254252Sphaerulina berberidis MycosphaerellaberberidisCBS 324.52 Berberis vulgaris Switzerland E. Müller KF253548 KF253067 KF252594 KF252106 KF251601 KF253903 KF254253Sphaerulina betulae Septoria betulae CBS 116724 Betula pubescens Scotland S. Green KF253549 KF253068 KF252595 KF252107 KF251602 KF253904 KF254254Septoria betulae CBS 128596 Betula platyphylla South Korea H.D. Shin KF253550 KF253069 KF252596 KF252108 KF251603 KF253905 KF254255Septoria betulae CBS 128597 Betula schmidtii South Korea H.D. Shin KF253551 KF253070 KF252597 KF252109 KF251604 KF253906 KF254256Septoria betulae CBS 128600 Betula platyphylla South Korea H.D. Shin KF253552 KF253071 KF252598 KF252110 KF251605 KF253907 KF254257Sphaerulina cercidis Septoria provencialis CBS 118910 Eucalyptus sp. France P.W. Crous KF253553 KF253072 KF252602 KF252114 KF251609 KF253908 KF254258Septoria cercidis CBS 128634 Cercis siliquastrum South Korea H.D. Shin KF253554 KF253073 KF252599 KF252111 KF251606 KF253909 KF254259Septoria cercidis CBS 129151 Cercis siliquastrum South Korea H.D. Shin KF253555 KF253074 KF252600 KF252112 KF251607 KF253910 KF254260Septoria cercidis CBS 501.50 Cercis siliquastrum Netherlands G. van den Ende KF253556 KF253075 KF252601 KF252113 KF251608 KF253911 KF254261Sphaerulina cornicola Septoria cornicola CBS 102324 Cornus sp. Netherlands A. van Iperen KF253557 KF253076 KF252603 KF252115 KF251610 KF253912 KF254262Septoria comicola CBS 102332 Cornus sp. Netherlands A. van Iperen KF253558 KF253077 KF252604 KF252116 KF251611 KF253913 KF254263Septoria cornicola CBS 116778 Cornus sanguinea USA A.Y. Rossman KF253559 KF253078 – KF252117 KF251612 KF253914 KF254264Sphaerulina frondicola Septoria populi CBS 391.59 Populus pyramidalis Germany R. Schneider KF253572 – KF252617 KF252130 KF251625 KF253927 KF254277Sphaerulina gei Septoria gei CBS 102318 Geum urbanum Netherlands G.J.M. Verkley KF253560 KF253079 KF252605 KF252118 KF251613 KF253915 KF254265Septoria gei CBS 128616 Geum japonicum South Korea H.D. Shin KF253561 KF253080 KF252606 KF252119 KF251614 KF253916 KF254266Septoria gei CBS 128632 Geum japonicum South Korea H.D. Shin KF253562 KF253081 KF252607 KF252120 KF251615 KF253917 KF254267Sphaerulina hyperici Septoria hyperici CBS 102313 Hypericum sp. Netherlands G.J.M. Verkley KF253563 KF253082 KF252608 KF252121 KF251616 KF253918 KF254268Sphaerulina menispermi Septoria menispermi CBS 128666 Menispermum dauricum South Korea H.D. Shin KF253564 KF253083 KF252609 KF252122 KF251617 KF253919 KF254269Septoria menispermi CBS 128761 Menispermum dauricum South Korea H.D. Shin KF253565 KF253084 KF252610 KF252123 KF251618 KF253920 KF254270Sphaerulina musiva Septoria musiva CBS 130559 Populus sp. Canada J. LeBoldus KF253566 – KF252611 KF252124 KF251619 KF253921 KF254271Septoria musiva CBS 130562 Populus sp. Canada J. LeBoldus KF253567 KF253085 KF252612 KF252125 KF251620 KF253922 KF254272Septoria musiva CBS 130563 Populus deltoides × P.balsamiferaCanada J. LeBoldus KF253568 – KF252613 KF252126 KF251621 KF253923 KF254273www.studiesinmycology.org227

A new approach to species delimitation in Septoriaprevious results by Verkley et al. (2004a, b) which showed that bothloci could not resolve the lower phylogenetic relationships betweenclosely related Septoria species. Due to the presence of intronregions in the five remaining protein coding loci, these genes providemuch higher interspecific variation than the more conserved ITS andLSU loci. These protein coding genes thus have (much) higher K2Pinter- to intraspecific variation ratios: for Cal 14 : 1, RPB2 17 : 1, Act23 : 1, EF 26 : 1 and for Btub 29 : 1 (Fig. 1), making them all suitablefor reliable species resolution throughout the range of septoria-likefungi. As the EF and Btub have the largest barcoding gap, these locishould give the highest species resolution and preferably be used foridentifying species.PhylogenyBasal to the seven-locus tree are the outgroup taxon Readeriellamirabilis (CBS 125000), and a monophyletic group comprising 11strains, viz. Dothistroma pini (CBS 121011), D. septospora, (CBS383.74), Passalora dissiliens (CBS 219.77), three Ramulariaspecies (Mycosphaerella s. str., see Quaedvlieg et al. 2013) andthree Zymoseptoria species, including its type species Z. tritici (syn.Mycosphaerella graminicola, Septoria tritici). The basal ingrouptaxa include CBS 619.72 identified as Septoria oudemansii, aPseudocercospora clade with six strains, and Cercosporellavirgaureae (CBS 113304). A well-supported cluster of two basallineages (bootstrap support 100 %) comprises a cluster (100 %)of two isolates identified as S. gladioli, and a second cluster(100 %) containing 10 strains representing four septoria-likespecies that are all associated with leaf spots on plants of thefamily Caryophyllaceae, and for which the new generic nameCaryophylloseptoria is proposed below. These include C. silenes(CBS 109100, 109103), C. lychnidis (CBS 109098–109102), twoisolates originating from Lychnis cognata in Korea for which thenew species C. pseudolychnidis is proposed by Quaedvlieg et al.(2013) (CBS 128614, 128630), and two isolates of C. spergulae(CBS 397.52, 109010).The remaining ingroup can be devided into a Sphaerulina clade(100 %, 51 strains including the basal strain of Sph. abeliceae,CBS 128591) and main Septoria clade (80 %, 259 strains) with,positioned in between smaller groups comprised of “Septoria”cruciatae (CBS 123747, 123748), a small pseudocercosporellalikeclade comprising Passalora fusimaculans (CPC 17277), aclade with Passalora depressa (CPC 14915), “Mycosphaerella”brassicicola and affiliated taxa with Pseudocercosporella asexualmorphs (100 %, 9 strains), and a miscellaneous clade containing“Passalora” sp. (100 %, CBS 113989, 113999, 114275),Passalora dioscoreae (CPC 10855, 11513), Pseudocercosporellamagnusiana (CBS 114735), Passalora janseana (CBS 145.37),“Septoria erigerontis” (CPC 19485), and a Cercospora clade(100 %, 4 strains).The Sphaerulina clade comprises the aforementioned CBS128591 identified as S. abelicaea (from Zelkova serrata) andclades 1 and 2. Clade 1 (100 %, 37 strains) includes at its basethree strains of Sph. cornicola, the sister taxa Sph. betulae andS. westendorpii (syn. S. rubi) on Rubus fruticosus (CBS 102327,109002, 117478), and Sph. socia (CBS 355.58, CBS 357.58).The remainder of clade 1 contains a well-supported cluster of 25strains with various species infecting herbaceous and woody hosts.CBS 109017 and 19018, originating from Rubus idaeus in Austria,represent a species for which Sphaerulina tirolensis sp. nov. isintroduced below. Furthermore this cluster contains Sphaerulinaberberidis (syn. Mycosphaerella berberidis, S. berberidis Niessl),Sph. azaleae, Sph. hyperici, Sph. menispermi, Sph. patriniae,Sph. cercidis, and Sph. gei. Clade 2 (74 %, 13 strains) of theSphaerulina clade includes only species infecting tree, the poplarpathogens Sph. populicola (syn. Mycosphaerella populicola,CBS 100042), Sph. musiva (syn. Septoria musiva, four strains),and Sph. frondicola (syn. Mycosphaerella populi, S. populi, CBS391.59), and furthermore Sphaerulina aceris (syn. Mycosphaerellalatebrosa, Phloeospora aceris, asexual morph S. aceris, threestrains), which causes leaf spot on Acer spp., and Sph. quercicola(syn. S. querciola).At the base of the main Septoria clade, a well-supportedclade 3 (88 %, 16 strains) includes several species associatedwith hosts in the Apiaceae, viz., S. oenanthis (CBS 128667)and S. oenanthicola (CBS 128649; a new species proposed byQuaedvlieg et al. (2013), S. sii (CBS 118.96, 102369, 102370),and S. aegopodii (CBS 123740, 123741), and associated withother plant families, S. dearnessii (CBS 128624), a cluster of twostrains of S. lactucae (CBS 352.58, 108943) and S. sonchi (CBS128757), S. campanulae (CBS 128589, 128604), S. mazi (CBS128656, 128755), and S. gentianae (CBS 128633). In clade 4(100 %, 183 strains) S. bupleuricola (CBS 128601, 128603) andS. scabiosicola (100 %, 12 strains) occupy a basal position andsubclades 4a–d can be distinguished. Subclade 4a (100 %, 46strains) comprises of a group of 13 strains of miscellaneous hostplants, mostly with smaller conidia, viz., two Solanum pathogens S.lycopersici (CBS 354.49, 128654) and S. malagutii (CBS 106.80),S. apiicola (4 strains), S. cucurbitacearum (CBS 178.77), and S.aridis (4 strains), and a second strain identified as S.posonniensis(CBS 128658). Subclade 4b (100 %, 33 strains) harbours severaltaxa infecting Asteraceae, among others S. obesa (four strains),S. senecionis (three strains), S. putrida (CBS 109087, 109088),S. leucanthemi (6 strains), S.cirsii (CBS 128621), six strains ofthe S. chrysanthemella complex, S. exotica (CBS 163.78), andS. posoniensis (CBS 128645). Furthermore this group of 33comprises taxa with relatively large conidia capable of infectingRanunculaceae, viz. S.lycoctoni, S. napelli (CBS 109104–109106)from Austria and S. pseudonapelli (CBS 128664; a new speciesproposed by Quaedvlieg et al. 2013) from Korea. It also includesS. lycopicola (128651), CBS 128662 identified as S. stachydicola(probably misidentified), and two strains of S. astericola (CBS128587, 128593). Subclade 4c (99 %, 15 strains) contains S.matricariae (CBS 109000, 109001), S. lamiicola (8 strains), S.anthrisci (CBS 109019, 109020), and S. petroselini (CBS 182.44,109521), and subclade 4d (100 %, 103 strains) shows foursubgroups, 4d-1–4. Basic to these are found S. dolichospora (CBS129152) and S. helianthi (CBS 123.81). Subclade 4d-1 (100 %, 45strains) contains S. cf. stachydicola (CBS 128668 ; see Quaedvlieget al. 2013), and many other species infecting herbaceous plants,among others S. stachydis (nine strains), S. phlogis (three strains),S. epambrosiae (CBS 128629, 128636), S. cerastii (five strains),S. galeopsidis (seven strains), S. stachydis (9 strains), S. epilobii(CBS 109084, 109085) and S. digitalis (CBS 391.63, 328.67).Subclade 4d-2 (100 %, 35 strains) comprises among others S.polygonorum (six strains), S. urticae and S convolvuli (three strainseach), S.villarsiae, S. crepidis, and S. codonopsidis. Subclade4d-3 (99 %, 11 strains) containing S. erigerontis (five strains), S.lysimachii (five strains), and S. saccardoi (CBS 128756). Subclade4d-4 (100 %, 9 strains) contains S. bothriospermi (CBS 128592,128599), S. tinctoriae (CBS 129154), four strains identified as S.rubi that need to be re-named, and S.agrimoniicola (CBS 128585,128602).www.studiesinmycology.org229

Verkley et al.CaryophyllaceaeRutaceaeAraceaeBrassicaceaeRosaceaePolygonaceaeScrophulariaceaeFabaceaeLamiaceaeRanunculaceaeApiaceaeAsteraceae0.210.820.80.7710.890.9811 Septoria hippocastani CPC 231030.97 Septoria hippocastani CBS 411.611Septoria sp. CBS 112737Septoria astragali CBS 10911611 Septoria astragali CBS 109117Septoria astragali CBS 123878Septoria rumicum CBS 503.76Septoria stellariae CBS 1023761 Septoria stellariae CBS 102378Septoria stellariae CBS 102410Septoria helianthicola CBS 122.810.95 Septoria coprosmae CBS 113391Septoria sp. CBS 1354721 0.72Septoria sp. CPC 197931 Septoria verbenae CBS 113438Septoria verbenae CBS 113481Septoria sp. CPC 199760.58 Septoria limonum CBS 419.51Septoria sp. CBS 120739Septoria chamaecisti CBS 350.58Septoria citricola CBS 356.36Septoria protearum CBS 390.590.911 Septoria protearum CBS 364.97Septoria protearum CBS 119942Septoria protearum CBS 778.97Septoria protearum CBS 164.78Septoria protearum CBS 179.77Septoria protearum CBS 658.77Septoria protearum CBS 1131140.94Septoria protearum CBS 101013Septoria protearum CBS 410.611 Septoria protearum CBS 101354Septoria protearum CBS 1133921 Septoria protearum CBS 420.51Septoria protearum CBS 566.88Septoria protearum CBS 135477Septoria protearum CPC 19691Septoria protearum CBS 177.77Septoria protearum CBS 315.37Septoria lepidiicola CBS 128635Septoria cucubali CBS 1023670.91 Septoria cucubali CBS 1023861Septoria cucubali CBS 102368Septoria cucubali CBS 124874Septoria linicola CBS 316.37Septoria justiciae CBS 125091 Septoria justiciae CBS 128625Septoria justiciae CBS 128610Septoria eucalyptorum CBS 1185051 Septoria anthurii CBS 148.411 Septoria anthurii CBS 346.581 Septoria sisyrinchii CBS 1120961 Septoria passiflorae CBS 1027011 Septoria passifloricola CBS 1294311 Septoria chromolaenae CBS 1133731 Septoria ekmaniana CBS 113385Septoria ekmaniana CBS 1136121 Septoria abei CBS 1285981 Septoria hibiscicola CBS 128615Septoria hibiscicola CBS 128611Septoria sp. CPC 197161 Septoria clematidis CBS 108983Septoria clematidis CBS 1089841 Septoria bupleuricola CBS 128601Septoria bupleuricola CBS 1286031 Septoria agrimoniicola CBS 128585Septoria agrimoniicola CBS 1286020.97 Septoria cf. rubi CBS 128646Septoria cf. rubi CBS 1286481 1 Septoria cf. rubi CBS 1287601 Septoria cf. rubi CPC 12331Septoria tinctoriae CBS 1291541 Septoria bothriospermi CBS 128592Septoria bothriospermi CBS 128599Septoria saccardoi CBS 1287561 Septoria lysimachiae CBS 102315Septoria lysimachiae CBS 1089991 Septoria lysimachiae CBS 108998Septoria lysimachiae CBS 123795Septoria lysimachiae CBS 123794Septoria erigerontis CBS 131893Septoria erigerontis CBS 1286061 Septoria erigerontis CBS 186.93Septoria erigerontis CBS 109094Septoria erigerontis CBS 1090951 Septoria codonopsidis CBS 1286200.62 Septoria codonopsidis CBS 1286090.91Septoria leptostachyae CBS 1286131 Septoria leptostachyae CBS 128628Septoria pachyspora CBS 1286520.87Septoria crepidis CBS 1286191 Septoria crepidis CBS 125390.84 Septoria crepidis CBS 128608Septoria sp. CBS 1286500.58 1 Septoria tormentillae CBS 128643Septoria tormentillae CBS 128647Septoria dysentericae CBS 1286371 Septoria dysentericae CBS 1318920.83 Septoria dysentericae CBS 1286381 Septoria callistephi CBS 128590Septoria callistephi CBS 128594Septoria villarsiae CBS 604.6611 Septoria villarsiae CBS 565.880.73Septoria villarsiae CBS 514.78Septoria glycines CBS 336.53Septoria glycinicola CBS 1286181 Septoria perillae CBS 128655Septoria menthae CBS 404.34Septoria convolvuli CBS 1131111 Septoria convolvuli CBS 1286271 Septoria convolvuli CBS 1023251 Septoria urticae CBS 102316Septoria urticae CBS 102375Septoria urticae CBS 102371Septoria polygonorum CBS 1023301 Septoria polygonorum CBS 347.67Septoria polygonorum CBS 102331Septoria polygonorum CBS 109834Septoria polygonorum CBS 113110Septoria polygonorum CBS 1089820.650.995B5A4D44D34D2SeptoriaFig. 2. Consensus phylogram (50 % majority rule) of 17 222 trees resulting from a Bayesian analysis of the combined seven loci sequence alignment using MrBayes v. 3.2.1.Bayesian posterior probabilities values are indicated on their respective branches and the scale bar indicates 0.2 expected changes per site. The tree was rooted to Readeriellamirabilis (Teratosphaeriaceae) (CBS 125000). The family of the host plant from which the strain was isolated is indicated for 12 most prevalently occurring host families in ourdataset (colour bar according to the legend).230

A new approach to species delimitation in SeptoriaCaryophyllaceaeRutaceaeAraceaeBrassicaceaeRosaceaePolygonaceaeScrophulariaceaeFabaceaeLamiaceaeRanunculaceaeApiaceaeAsteraceae0.20.81110.770.851 Septoria sp. CPC 231041 Septoria digitalis CBS 328.67Septoria digitalis CBS 391.631 Septoria epilobii CBS 109084Septoria epilobii CBS 10908511Septoria taraxaci CBS 567.75Septoria verbascicola CBS 102401Septoria stachydis CBS 347.580.86Septoria stachydis CBS 449.68Septoria stachydis CBS 1091271 Septoria stachydis CBS 109126Septoria stachydis CBS 123750Septoria stachydis CBS 123879Septoria stachydis CBS 1091150.98Septoria stachydis CBS 102337Septoria stachydis CBS 10232611Septoria melissae CBS 109097Septoria galeopsidis CBS 191.26Septoria galeopsidis CBS 1023141 Septoria galeopsidis CBS 102411Septoria galeopsidis CBS 123744Septoria galeopsidis CBS 123745Septoria galeopsidis CBS 1237461 Septoria galeopsidis CBS 123749Septoria orchidearum CBS 1286310.91 Septoria orchidearum CBS 109114Septoria orchidearum CBS 457.780.75Septoria cerastii CBS 102323Septoria cerastii CBS 128612Septoria cerastii CBS 1285861Septoria cerastii CBS 128626Septoria cerastii CPC 123431 1 Septoria epambrosiae CBS 1286291 Septoria epambrosiae CBS 1286361 Septoria phlogis CBS 128663Septoria phlogis CBS 577.90Septoria phlogis CBS 102317Septoria calendulae CBS 349.581 1 1 Septoria siegesbeckiae CBS 128661Septoria siegesbeckiae CBS 1286591 1 Septoria violae-palustris CBS 128660Septoria violae-palustris CBS 1286441 Septoria chelidonii CBS 128607Septoria chelidonii CPC 12337Septoria stachydicola CBS 128668Septoria helianthi CBS 123.81Septoria dolichospora CBS 1291521 Septoria petroselini CBS 182.44Septoria petroselini CBS 1095211 Septoria anthrisci CBS 1090191 Septoria anthrisci CBS 109020Septoria lamiicola CBS 102328Septoria lamiicola CBS 102379Septoria lamiicola CBS 1023290.62Septoria lamiicola CBS 1091121 Septoria lamiicola CBS 102380Septoria lamiicola CBS 109113Septoria lamiicola CBS 1238820.93 Septoria lamiicola CBS 1238831 Septoria lamiicola CBS 1238841 Septoria matricariae CBS 109000Septoria matricariae CBS 109001Septoria pseudonapelli CBS 128664Septoria napelli CBS 1091051Septoria napelli CBS 1091041 Septoria napelli CBS 109106Septoria lycoctoni CBS 1090891 Septoria exotica CBS 163.78Septoria posoniensis CBS 1286451 Septoria chrysanthemella CBS 12871610.96 Septoria chrysanthemella CBS 128617Septoria chrysanthemella CBS 354.731 11 Septoria chrysanthemella CBS 351.581 Septoria chrysanthemella CBS 483.63Septoria chrysanthemella CBS 128622Septoria cirsii CBS 1286210.97Septoria leucanthemi CBS 353.581 Septoria leucanthemi CBS 113112Septoria leucanthemi CBS 1090901 Septoria leucanthemi CBS 109091Septoria leucanthemi CBS 1090831 Septoria leucanthemi CBS 1090861 Septoria putrida CBS 1090871 Septoria putrida CBS 109088Septoria senecionis CBS 1023811 Septoria senecionis CBS 102366Septoria senecionis CBS 1023661 Septoria lycopicola CBS 128651Septoria cf. stachydicola CBS 1286621 Septoria astericola CBS 128587Septoria astericola CBS 128593Septoria obesa CBS 1285881 1 Septoria obesa CBS 128623Septoria obesa CBS 354.580.83Septoria obesa CBS 128759Septoria sp. CBS 1286581 Septoria paridis CBS 1091101 Septoria paridis CBS 109111Septoria paridis CBS 109109Septoria paridis CBS 1091081Septoria apiicola CBS 389.591 Septoria apiicola CBS 116465Septoria apiicola CBS 400.540.95Septoria apiicola CBS 395.521 Septoria cucurbitacearum CBS 178.771 Septoria lycopersici CBS 354.491 Septoria lycopersici CBS 128654Septoria malagutii CBS 106.80Septoria atropurpurea CBS 348.58Septoria scabiosicola CBS 182.93Septoria scabiosicola CBS 317.37Septoria scabiosicola CBS 102335Septoria scabiosicola CBS 1023360.78 Septoria scabiosicola CBS 102334Septoria scabiosicola CBS 102333Septoria scabiosicola CBS 1090920.75Septoria scabiosicola CBS 109093Septoria scabiosicola CBS 1091281 Septoria scabiosicola CBS 109129Septoria scabiosicola CBS 109021Septoria scabiosicola CBS 1089814D14C4B4ASeptoria(cont.)Fig. 2. (Continued).www.studiesinmycology.org231

Verkley et al.CaryophyllaceaeRutaceaeAraceaeBrassicaceaeRosaceaePolygonaceaeScrophulariaceaeFabaceaeLamiaceaeRanunculaceaeApiaceaeAsteraceae0.880.572x110.990.812x12x110.792x0.581 Septoria aegopodina CBS 1237400.8Septoria aegopodina CBS 1237410.88 Septoria gentianae CBS 1286331Septoria oenanthicola CBS 1286490.61 Septoria mazi CBS 1286561 Septoria mazi CBS 1287551 1 Septoria sii CBS 118.961 Septoria sii CBS 1023691 Septoria sii CBS 102370Septoria oenanthis CBS 1286670.991 Septoria campanulae CBS 128589Septoria campanulae CBS 1286040.881 Septoria lactucae CBS 352.581 Septoria lactucae CBS 108943Septoria cf. sonchi CBS 128757Septoria dearnessii CBS 128624Cercospora apii CBS 1187120.99Cercospora zebrina CBS 1187901 1Cercospora ariminensis CBS 137.560.8Cercospora beticola CBS 124.310.8Septoria sp. CBS 135474Passalora janseana CBS 145.372x 11 Passalora dioscoreae CBS 1354600.62Passalora dioscoreae CBS 135463Pseudocercosporella magnusiana CBS 114735Passalora sp. CBS 1139981 Passalora sp. CBS 113999Passalora sp. CBS 1142751 Mycosphaerella brassicicola CBS 228.32Mycosphaerella brassicicola CBS 267.530.94 Mycosphaerella capsellae CBS 112032Pseudocercosporella capsellae CBS 127.2911 Pseudocercosporella capsellae CBS 1184120.79Pseudocercosporella capsellae CBS 1120332x1 2xMycosphaerella sp. CBS 135464Passalora depressa CPC 149150.8Pseudocercosporella pastinacae CBS 114116“Septoria” cruciatae CBS 123747“Septoria” cruciatae CBS 123748Passalora fusimaculans CPC 17277Sphaerulina populicola CBS 1000421 Sphaerulina musiva CBS 130559Sphaerulina musiva CBS 13056311Sphaerulina musiva CBS 130562Sphaerulina musiva CBS 1305690.72Sphaerulina frondicola CBS 391.59Sphaerulina quercicola CBS 663.941 Sphaerulina quercicola CBS 1090090.74Sphaerulina quercicola CBS 1150162xSphaerulina quercicola CBS 115136Sphaerulina aceris CBS 183.971 Sphaerulina aceris CBS 652.85Sphaerulina aceris CBS 687.94Sphaerulina amelanchier CPC 231060.82 Sphaerulina amelanchier CBS 1351100.9 Sphaerulina amelanchier CPC 231051 Sphaerulina rhabdoclinis CBS 102195Sphaerulina sp. CBS 1020630.69 Sphaerulina sp. CPC 23107Sphaerulina gei CBS 1023181 1Sphaerulina gei CBS 128616Sphaerulina gei CBS 128632Sphaerulina viciae CBS 1318981 Sphaerulina cercidis CBS 128634Sphaerulina cercidis CBS 1189101 Sphaerulina cercidis CBS 12915110.54 Sphaerulina cercidis CBS 501.500.65 Sphaerulina sp. CBS 1287580.791 Sphaerulina patriniae CBS 128653Sphaerulina patriniae CBS 12915311 Sphaerulina menispermi CBS 1286661Sphaerulina menispermi CBS 128761Sphaerulina hyperici CBS 1023131 1 Sphaerulina azaleae CBS 352.490.89 Sphaerulina azaleae CBS 128605Sphaerulina berberidis CBS 324.520.831 Sphaerulina tirolensis CBS 109018Sphaerulina tirolensis CBS 10901711 Sphaerulina socia CBS 355.58Sphaerulina socia CBS 357.580.82Sphaerulina betulae CBS 1167241 Sphaerulina betulae CBS 128597Sphaerulina betulae CBS 1286001Sphaerulina betulae CBS 1285961Sphaerulina westendorpii CBS 1090021 Sphaerulina westendorpii CBS 117478Sphaerulina westendorpii CBS 102327Sphaerulina cornicola CBS 102324Sphaerulina cornicola CBS 102332Sphaerulina cornicola CBS 116778Sphaerulina abeliceae CBS 1285911 Caryophylloseptoria spergulae CBS 397.520.96 Caryophylloseptoria spergulae CBS 1090101 Caryophylloseptoria pseudolychnidis CBS 1286300.97 Caryophylloseptoria pseudolychnidis CBS 128614Caryophylloseptoria lychnidis CBS 1090981 Caryophylloseptoria lychnidis CBS 1090991Caryophylloseptoria lychnidis CBS 109101Caryophylloseptoria lychnidis CBS 1091021 Caryophylloseptoria silenes CBS 109100Caryophylloseptoria silenes CBS 1091031 “Septoria” gladioli CBS 121.20“Septoria” gladioli CBS 353.29Cercosporella virgaureae CBS 113304Pseudocercospora flavomarginata CBS 1249901 Pseudocercospora tereticornis CBS 1249961 Pseudocercospora pyracanthigena CPC 108080.97 Pseudocercospora schizolobii CBS 120029Pseudocercospora rhoina CPC 114640.82Pseudocercospora madagascariensis CBS 124155“Septoria” oudemansii CBS 619.721 Dothistroma pini CBS 121011Dothistroma septospora CBS 383.74Passalora dissiliens CBS 219.771Ramularia endophylla CBS 1132651Ramularia eucalypti CBS 120726Ramularia lamii CPC 113121 Zymoseptoria brevis CPC 181021 Zymoseptoria brevis CPC 181071 1 Zymoseptoria tritici CBS 392.59Zymoseptoria tritici CPC 18099Zymoseptoria halophila CBS 128854Readeriella mirabilis CBS 1250000.2321Septoria(cont.)CercosporaIncertae sedisPseudocercosporapseudocercosporellalikeSphaerulinaCaryophylloseptoriaseptoria-likeCercosporellaIncertae sedisDothistromaIncertae sedisRamulariaZymoseptoriaReaderiellaFig. 2. (Continued).232

A new approach to species delimitation in SeptoriaTable 2. Primer combinations used during this study for generic amplification and sequencing.Locus Primer Primer sequence 5’ to 3’: Annealing Orientation Referencetemperature(°C)Translation elongation factor-1α EF1-728F CATCGAGAAGTTCGAGAAGG 52 Forward Carbone & Kohn (1999)EF-2 GGARGTACCAGTSATCATGTT 52 Reverse O’Donnell et al. (1998)β-tubulin T1 AACATGCGTGAGATTGTAAGT 52 Forward O’Donnell & Cigelnik (1997)β-Sandy-R GCRCGNGGVACRTACTTGTT 52 Reverse Stukenbrock et al. (2012)RNA polymerase II second largest subunit fRPB2-5F GAYGAYMGWGATCAYTTYGG 49 Forward Liu et al. (1999)fRPB2-414R ACMANNCCCCARTGNGWRTTRTG 49 Reverse Quaedvlieg et al. (2011)LSU LSU1Fd GRATCAGGTAGGRATACCCG 52 Forward Crous et al. (2009a)LR5 TCCTGAGGGAAACTTCG 52 Reverse Vilgalys & Hester (1990)ITS ITS5 GGAAGTAAAAGTCGTAACAAGG 52 Forward White et al. (1990)ITS4 TCCTCCGCTTATTGATATGC 52 Reverse White et al. (1990)Actin ACT-512F ATGTGCAAGGCCGGTTTCGC 52 Forward Carbone & Kohn (1999)ACT2Rd ARRTCRCGDCCRGCCATGTC 52 Reverse Groenewald et al. (2012)Calmodulin CAL-235F TTCAAGGAGGCCTTCTCCCTCTT 50 Forward Quaedvlieg et al. (2012)CAL2Rd TGRTCNGCCTCDCGGATCATCTC 50 Reverse Groenewald et al. (2012)Table 3. Amplification success, phylogenetic data and the substitution models used in the phylogenetic analysis, per locus.Locus Act Cal EF1 RPB2 Btub ITS LSUAmplification succes (%) 99 100 100 97 100 100 100Number of characters 304 601 619 354 565 574 853Unique site patterns 234 407 507 198 380 261 147Substitution model used GTR-I-gamma HKY-I-gamma GTR-I-gamma GTR-I-gamma HKY-I-gamma GTR-I-gamma GTR-I-gammaNumber of generations (1000×) 10 197Total number of trees (n) 22 962Sampled trees (n) 17 222In clade 5 (92 %, 63 strains) of the main Septoria clade twomain clusters are found. At the base of the subclade 5a (77 %, 52strains), two strains of S. clematidis (CBS 108983–4) and Septoriasp. (CPC 19716) originating from Searsia laevigatum in SouthAfrica. This cluster furthermore comprises three strains isolatedfrom Hibiscus spp., viz., S. hibiscicola (CBS 128611, 128615) and S.abei (CBS 128598), and two main groups, one with S. anthurii (CBS148.41, 346.58), S. sisyrinchii (CBS 112096), the Chromolaenafungi S. chromolaenae (CBS 113373) and S. ekmanniana (CBS113385, 113612), and S. passiflorae (CBS 102701) and S.passifloricola (CBS 129431), and a second group comprising atthe base S. eucalyptorum (CBS 118505; Crous et al. 2006b), andfurthermore S. justiciae (CBS 128610, 128625, and CPC 12509),S. linicola (CBS 316.37), S. cucubali (3 strains, including CBS124874, an endophytic isolate from Fagus leaf litter), S. lepidiicola(CBS 128635) and and a partially unresolved cluster of 23 strainscomprising the plurivorous S. protearum and S. citri complex. Asmall well-supported cluster (100 %) contains S. verbenae (CBS113438, 113481), two unidentified species of Septoria (CPC 19304,from Vigna unguiculata subsp. sesquipedalis and CPC 19793, fromSyzygium cordatum), and M. coacervata (CBS 113391). Subclade5b (100 %, 11 strains) comprises S. helianthicola (CBS 122.81),three strains of S. stellariae, CBS 503.76 identified as S. acetosae,three strains of S. astragali, “Cercospora sp.” (CBS 112737), andfurthermore S. hippocastani (CBS 411.61 and MP11).Examining the distribution of host families throughout the tree,an interesting disjunct pattern is found for the families that arerepresented by more than a few specimens (see legend in Fig. 2).For example, the 28 species infecting Asteraceae are found in allclades and most subclades of the tree, including Sphaerulina; ninespecies infecting Apiaceae are found in clade 3 and subclades4a–d of Septoria; 10 species of Rosaceae in Septoria clades 4, 5and Sphaerulina (clades 1 and 2); six species infecting Lamiaceaeare dispersed in subclades 4b, c, and d-1.TAXONOMYCaryophylloseptoria Verkley, Quaedvlieg & Crous, gen.nov. MycoBank MB804469.Etymology: Named after the plant family on which these taxa occur,Caryophyllaceae.Conidiomata pycnidial, epiphyllous or predominantly epiphyllous,globose to subglobose, or slightly depressed, with a centralostiolum. Conidiomatal wall composed of textura angularis orglobulosa-angularis. Conidiogenous cells hyaline, holoblastic,proliferating percurrently 1–many times with indistinct annellations,www.studiesinmycology.org233

Verkley et al.Fig. 3. Caryophylloseptoria lychnidis. A. CBS 109098, colony on OA. B. Ibid., on CMA. C. Conidia and conidiogenous cells in planta (CBS 109098). D. Conidia on OA (CBS109098). Scale bars = 10 µm.or (in addition) proliferating sympodially. Conidia cylindrical, straight,curved or flexuous, multiseptate, not or somewhat constrictedaround the septa, hyaline, contents with several oil-droplets andgranular material in each cell.Type species: Caryophylloseptoria lychnidis (Desm.) Verkley,Quaedvlieg & Crous.Caryophylloseptoria lychnidis (Desm.) Verkley, Quaedvlieg& Crous, comb. nov. MycoBank MB804470. Fig. 3.Basionym: Septoria lychnidis Desm., Annls Sci. Nat., sér. 3, Bot.11: 347. 1849.For extended synonymy see Shin & Sameva (2004).Description in planta: Symptoms leaf spots circular, whitish to paleyellow, surrounded by a brown border; Conidiomata pycnidial,epiphyllous, several in each leaf spot, globose to subglobose, darkbrown, semi-immersed, 50–100(–120) µm diam; ostiolum central,initially circular, 25–45 µm wide, later more irregular and up to100 µm wide, surrounding cells concolorous or somewhat darker;conidiomatal wall 10–20µm thick, composed of textura angulariswithout distinctly differentiated layers, the cells 3–5 µm diam,the outer cells with brown, somewhat thickened walls, the innercells with hyaline and thinner walls; Conidiogenous cells hyaline,cylindrical and tapering gradually towards the apex, or narrowlyampulliform with a relatively wide and long neck, holoblastic,proliferating percurrently 1–many times with indistinct annellations,rarely also proliferating sympodially, 6–17.5(–22) × 3–4(–5) µm.Conidia cylindrical, straight, more often slightly curved or flexuous,with a narrowly to broadly rounded, sometimes more distinctlypointed apex, towards the broadly truncate base barely attenuated,(0–)3–5(–7)-septate, not constricted around the septa, hyaline,contents with several oil-droplets and minute granular material ineach cell in the living state, with inconspicuous oil-droplets andgranular contents in the rehydrated state, (22–)39–75(–85) × 2–3µm (rehydrated). Sexual morph unknown.Description in vitro: Colonies on OA (3–)4–6 mm diam in 12 d (7–11mm in 3 wk), with an even, pure yellow to straw, glabrous margin,the pigment diffusing into the surrounding medium; coloniesspreading, but in the centre quite distinctly elevated, immersedmycelium pure yellow to straw, later locally citrine-green or citrine;after 10–15 d darkened by numerous immersed or superficialpycnidia arranged in random patterns, the outer wall of thesuperficial pycinidia entirely covered by white to glaucous hyphae,tardily releasing initially buff to straw, later salmon conidial slime;reverse pure yellow, but centre olivaceous and citrine to greenisholivaceous after 3 wk. After incubation over about 7 wk olivaceousblacksectors become visible in the colony consisting mostly ofimmersed strands of dark-walled hyphae, alternating with yellowsectors; some colonies develop wider sectors that remain yellowabove, but more ochreous on reverse. Colonies on CMA 4–6 mmdiam in 12 d (9–12 mm in 3 wk), as on OA, but sporulating earlier.Colonies on MEA 2–4 mm diam in 12 d (5–7(–9) mm in 3 wk; 17–24mm in 7 wk), with an even to ruffled, colourless to buff, glabrousmargin; no diffusing pigment seen; colonies restricted, irregularlypustulate up to 3 mm high, the surface dark, blackish or chestnut,covered by a short, dense mat of white to glaucous-grey, after 7wk straw to pale yellow, aerial mycelium; conidiomata releasingdroplets, later larger masses of first whitish, then salmon conidialslime; reverse brown-vinaceous in the centre, surrounded by hazelor cinnamon areas. Colonies on CHA 4.5 mm diam in 3 wk (24 mmin 7 wk); colony as on MEA, but the surface almost entirely hiddenunder a dense mat of woolly, white aerial mycelium, locally with apure yellow to straw haze which later becomes more intense, anda yellowish pigment diffusing into the surrounding medium; reverse234

A new approach to species delimitation in SeptoriaFig. 4. Caryophylloseptoria silenes. A–C. Colonies CBS 109100. A. On OA. B. On CHA. C. On MEA. D. Conidia and conidiogenous cells in planta (CBS H-21160). E. Ibid., onOA (CBS 109100). F–G. Conidia on OA (CBS 109100). Scale bars = 10 µm.umber to sienna; densely aggregated superficial conidiomata in thecentre releasing masses of amber to pale salmon conidial slime.Conidiomata pycnidial, as in planta, but somewhat larger, 70–145µm diam, mostly single, sometimes merged into complexes,without differentiated ostiolum; conidiogenous cells as in planta,proliferating percurrently with distinct annellations or sympodially,8.5–25 × 3.5–6 µm; conidia cylindrical, straight, slightly curved orflexuous, with a rounded apex, lower part barely attenuated intoa broad truncate base, (0–)1–5-septate, not constricted aroundthe septa, hyaline, with several oil-droplets and minute granularmaterial in each cell, (44–)77–94.5 × (2–)2.5–3 µm.Hosts: Lychnis spp. and Silene spp. (incl. Melandrium).Material examined: Austria, Tirol, Inntal, near Telfs, on living leaves of Silenepratensis (syn. M. album), 4 Aug. 2000, G. Verkley 1047, CBS H-21161, livingculture CBS 109098, 109102; same loc., host, date, G. Verkley 1048, CBS H-21162,living culture CBS 109099, 109101; Netherlands, Hilversum, on living leaves ofSilene dioica (syn. Melandrium rubrum), 22 June 1985, H.A. van der Aa 9524, CBSH-18112.Notes: This fungus has been reported from several species ofLychnis and Silene (including Melandrium), and the size rangesof conidia given by various authors differ considerably. In theoriginal description by Desmazières, the fungus was characterisedas having 5–7-septate conidia, measuring 50–70 ×2.5–3 µm, inwidely opening pycnidia. Diedicke (1915) gave the same sporemeasurements, but Grove (1935) reported 30–50 × 2–3 µm, whileJørstad (1965) gave different ranges on different hosts (overallextremes 27–72 × 2–3 µm). Radulescu et al. (1973) reported 30–76× 2.2–3.3 µm, and Vanev et al. (1997) 26–93.5 × 1.5–3.2 µm. Thecharacters of the Austrian material studied here generally agreewell with previous records, and the range of conidial sizes agreesbest with that given by Vanev et al. (1997). The authors cited abovehave listed various names as synonyms of S. lychnidis, includingS. lychnidis var. pusilla (= S. pusilla). Two strains isolated fromLychnis cognata in South Korea (CBS 128614, 128630) first alsoidentitifed as S. lychnidis, were shown by sequence analyses tobelong to a distinct species, for which the name C. pseudolychnidisis introduced by Quaedvlieg et al. (2013).Caryophylloseptoria silenes (Westend.) Verkley,Quaedvlieg & Crous, comb. nov. MycoBank MB804471.Fig. 4.Basionym: Septoria silenes Westend., in Westendorp & Wallays,Herb. crypt. Belge, Fasc. 19, no 955. 1854; Bull. Acad. R. Belg. Cl.Sci., Sér. 2, 2: 575. 1857.Description in planta: Symptoms leaf spots circular or elliptical,pale yellow to pale brown, surrounded by a dark purplish border;Conidiomata pycnidial, amphigenous but predominately epiphyllous,numerous in each leaf spot, globose to subglobose, immersed,www.studiesinmycology.org235

A new approach to species delimitation in SeptoriaFig. 5. Caryophylloseptoria spergulae. A, B. Colonies CBS 109010. A. On OA. B. On MEA. C. Conidia and conidiogenous cells in planta (CBS H-21150). D–H. Conidia on OA(CBS 109010). Scale bars = 10 µm.granular material and large vacuoles in the living state, oil-dropletsmerged into larger guttules in the rehydrated state, (18–)24–33(–40) × 2.0–2.5(–3.0) µm (rehydrated). Sexual morph unknown.Description in vitro: Colonies on OA less than 2 mm diam after 2wk (6–8 mm in 28 d), restricted, though not much elevated, withan even, colourless, glabrous margin; colony surface covered bya dense continuous or discontinuous mat of grey, finely felted tosomewhat woolly, low aerial mycelium, agar around the colonyshowing a yellow diffusing pigment; immersed mycelium paleluteous to saffron, reverse concolorous, but olivaceous-blackunder areas with well-developed aerial mycelium or conidiomata.Colony sporulating in the centre after about 2 wk, with spores inlarge pale salmon droplets oozing from pycnidioid complexes.Colonies on CMA 8–10 mm diam in 28 d, as on OA, but immersedmycelium soon darkening and olivaceous-black, while the aerialmycelium is somewhat more greenish, and the mat denser andmore continuous; reverse olivaceous-black. Colonies on MEA 5mm diam in 2 wk (8–10 mm in 28 d), restricted, with an even, buff,glabrous margin; colony surface black, but with a diffuse mat ofgreyish white, often with some sulphur yellow (centre), woolly aerialmycelium; fruitbodies developing tardily on the colony surface,sporulating with large, dirty white to pale reddish masses in waterydroplets; reverse dark brick to olivaceous-black. Colonies on CHA7–9 mm diam in 2 wk, as on MEA, but aerial mycelium higher anddenser, in the centre also conspicuously yellowish-pale citrine. Nosporulation observed.Conidiomata mostly olivaceous-brown, irregular mergedcomplexes of initially closed, but soon widely opening stromata,only rarely pycnidial and structurally similar to those on the naturalsubstratum. Conidiogenous cells hyaline, ampuliform, or elongatedampulliform with a relatively long neck, hyaline or very pale brownwww.studiesinmycology.org237

Verkley et al.near the base, holoblastic, proliferating percurrently 1–many timeswith indistinct annellations, also sympodially, mostly after one ormore percurrent proliferations, 7– 14(–22) × 3–5 µm. Conidia onOA hyaline, pale salmon in mass, cylindrical and regularly curved,or abruptly bent in the lower or upper cell, gradually attenuatedto the rounded apex, more abruptly attenuated into a truncatebase, contents granular with large vacuoles, 1(–3)-septate, not orindistinctly constricted around the septa, contents rich in minuteguttulae and granular material, 25.5–41 × (2.0–)2.5–3.0(–4.5) µm.Hosts: On dead leaves and stems of Spergula spp.Material examined: Belgium, Beverloo, on dry leaves and stems of Spergulaarvensis, M. Torquinet s.n., isotype BR-MYCO 159328-54, also distributedin Westendorp & Wallay, Herb.crypt.Belg., Fasc. 23-24: no.1155. Germany,Brandenburg, Kreis Nieder-Barnim, near Prenden, on leaves and stems of Spergulavernalis, 24 July 1920, H. & P. Sydow s.n., distributed in Sydow, Mycothecagermanica 1688, CBS H-4765. Netherlands, on Dianthus caryophyllus, Schoutens.n., CBS 397.52 (sub S. dianthi Desm.); Prov. Gelderland, ‘t Harde, DoornspijkseHeide, De Zanden, on decaying leaves of Spergula morisonii, A. Aptroot 48300, 13June 2000, epitype designated here CBS H-21150 “MBT175350”, living cultureex-epitype CBS 109010.Notes: This fungus was originally described from dry leavesand stems of Spergula arvensis by Westendorp, who describedthe conidia as 30 × 2.5 µm. The type from BR is well-preservedand rich in fruitbodies on leaves and stems, where conidia are1(–2)-septate, 20–38 × 2–2.5(–3) µm. The collection Aptroot48300 from Spergula morisonii agrees in morphology and can beidentified as conspecific, although it contains a larger proportionof 2-septate conidia (that are mostly 30–40 µm long) than in thetype. The material on Spergula vernalis that was distributed asMycotheca germanica 1688 morphologically also agrees with thesecollections.Other names were later introduced for Septoria on members ofthe plant genus Spergularia (= Alsine), which is closely related toSpergula: S. alsines Rostr. 1903 from Spergularia sp., conidia 20–31 × 2–3 µm formed in 55–120 µm wide pycnidia (Teterevnikova-Babayan 1987; conidia 20–25 × 2–3 µm and 3-septate, in theoriginal diagnosis of Rostrup 1903, based on material fromAlsine verna non Spergula vernalis), S. spergulariae 1903, onSpergularia rubra (conidia 30–45 × 2.5–3 µm, “multiseptate”), S.vandasii 1906, on Alsine glomerata, and S. spergularina 1945,on Spergularia longipes (no conidial measurements available).Some of these names could be synonymous with S. spergulae orperhaps S. alsines, but in order to corroborate this, new materialneeds to be collected and compared to the types. According toTeterevnikova-Babayan (1987), S. alsines differs from S. spergulaein conidial shape in that the conidial base is more truncate thanin S. spergulae, and in that it is capable of also killing Minuartiaglomerata. Rhabdospora alsines Mont. 1892, which was describedfrom dead stems of Alsine tenuifolia, is unlikely to be conspecificwith S. spergulae, as its conidia were described as 16–18 × 2 µmand 1-septate.Muthumary (1999) studied type material of S. dianthi 1849 (PC344) and by the drawings he made of it the conidia of this fungusand those of S. spergulae appear very similar in shape. Muthumaryreported that the conidia of S. dianthi were 32–48 (av. 40) × 3–4 (av.3) µm, and mostly 1-, rarely 2-septate. Given these measurements,on average, the conidia in the type of S. dianthi are clearly longerthan in S. spergulae (on average below or around 30). Moreover,S. dianthi is a fungus causing leaf spots on several Dianthus spp.,while S. spergulae is only known from dry and dead host tissues,and is therefore believed to be saprobic (and possibly endophytic).CBS 109010 and the only strain available for S. dianthi (CBS397.52) show 100 % sequence homology of the LSU, ITS, Btuband Cal, while there are only minor differences in Act (99.25 %),EF (97.54 %), and RPB2 (99.42 %). Further work is required toestablish that S. dianthi and S. spergulae are truely distinct taxa.Septoria Sacc., Syll. Fung. 3 : 474. 1884. nom. cons.Type species : S. cytisi Desm.A generic description is provided by Quaedvlieg et al. (2013, thisvolume).Septoria aegopodii Desm. ex J. Kickx, Pl. Crypt. Fland. 1:427. 1876 [Annls Sci. Nat., sér. 6, 7: no 616. 1878?]. Fig. 6.= Septoria podagrariae Lasch, in Rabenh., Herb. mycol. I, no 458. 1843.nomen nudum.= Sphaeria podagrariae Roth, Catal. Bot. 1: 230. 1797.≡ Mycosphaerella podagrariae (Roth : Fr.) Petr., Annls mycol. 19 (3/4):203. 1921.= Cryptosporium aegopodii Preuss, Linnaea 24: 719 (Fungi Hoyersw., no.322). 1853.≡ Phloeospora aegopodii (Preuss) Grove, British Stem- and Leaf-fungi(Coelomycetes) 1: 434. 1935.≡ Septoria aegopodii (Preuss) Sacc., Syll. Fung. 3: 529. 1884 [non Desm.1878].?= Septoria podagrariae var. pimpinellae-magnae Kabát & Bubák, in Bubák &Kabát, Ber. naturw.-med. Ver. Innsbruck 30: 19-36 (extr. 11). 1906.= Mycosphaerella aegopodii Potebnia, Annls mycol. 8(1): 49. 1910.Description in planta: Symptoms leaf spots numerous but small,angular and delimited by veinlets, visible on both sides of the leaf,white to pale yellow. Conidiomata pycnidial, developing soon afterfirst discolouration of the host tissue, predominantly epiphyllous,mostly also visible from the underside of the lesion, severalscattered in each leaf spot, globose to subglobose, pale to darkbrown (drying black), immersed, 125–190 µm diam, releasingconidia in white cirrhi; ostiolum central, initially circular and 17–35µm wide, later becoming more irregular and up to 100 µm wide,surrounding cells dark brown, with thickened cell walls; conidiomatalwall except for the part surrounding the ostiolum poorly developed,about 10–20 µm thick, composed of pale brown to hyalineangular cells 3.5–8 µm diam with thin walls. Conidiogenous cellshyaline, discrete, cylindrical to narrowly or broadly ampulliform,holoblastic, proliferating sympodially, 8–15(–18) × 2.5–4.5 µm.Conidia filiform-cylindrical, straight, curved to somewhat flexuous,attenuated gradually to a relatively broadly rounded apex andbroadly truncate base often provided with a collar of gelatinousmaterial, (0–)1–2(–3)-septate (second and later septa very thinand easily overlooked), not constricted around the septa, hyaline,contents with numerous minute oil-droplets and granular materialin each cell in the living state, with minute oil-droplets and granularcontents in the rehydrated state, (30–)55–95(–115) × 3.5–4 µm(living; 30–72(–80) × 2.5–4 µm, rehydrated).Description in vitro: All attempts to grow the isolates from conidiafailed. Some conidia germinated at the apical cells, but myceliadied within 1–2 d after germination.Hosts: Aegopodium podagraria and Pimpinella sp.Material examined: Austria, Tirol, Ötztal, Ötz near Habichen, on living leaves ofPimpinella sp., 24 July 2000, G. Verkley 1001, CBS H-21187. Netherlands, Prov.Overijssel, Losser, in garden at Mollenbergstraat, on living leaves of Aegopodiumpodagraria, June 1999, G. Verkley 800, CBS H-21192; same substr., Prov. Overijssel,238

A new approach to species delimitation in SeptoriaFig. 6. Septoria aegopodii. A–E. Conidia in planta. A–C. CBS H-21262. D, E. CBS H-21199. Scale bars = 10 µm.Losser, Arboretum Poort-Bulten, June 1999, G. Verkley 801, CBS H-21193; samesubstr., Prov. Utrecht, ‘s Graveland, Gooilust, 5 Sep. 1999, G. Verkley 916, CBSH-21199; same substr., Prov. Limburg, St. Jansberg, near Plasmolen, 9 Sep.1999, G. Verkley 931, CBS H-21211; same substr., Prov. Zeeland, Zuid-Beveland,Community of Borsele, Schouwersweel near Nisse, 27 Aug. 2001, G. Verkley 1116,CBS H-21165; same substr., Prov. Utrecht, Soest, 29 July 2008, G. Verkley 5020,CBS H-21262.Notes: This species is common on Aegopodium podagraria,especially on plants growing under less favourable conditions.Jørstad (1965) noted that in autumn the pycnidia are commonlyaccompanied by immature perithecia (or by “sclerotia”) ofMycosphaerella aegopodii in Sweden, but we have not found anyin The Netherlands. According to van der Aa (pers. comm.), thesexual morph only matures in montane habitats. Aptroot (2006),who studied herbarium specimens collected at high altitudesin several localities in Europe also did not observe any matureascomata. Type material of M. podagrariae could not be located(Aptroot 2006). Simon et al. (2009) studied the cellular interactionsbetween M. podagrariae and Aegopodium podagraria based onGerman material (no cultures preserved).We have not seen the type of S. podagrariae var. pimpinellaemagnae1906 described from Pimpinella magna (= P. major?) inTirol, but since the conidial characters given by Saccardo & Trotter(1913, 45–60 × 2.5–4 µm, 3-septate) are well within the range of S.aegopodii, it is placed here tentatively as a synonym. On Pimpinella,eight other Septoria species or varieties have been described in theliterature, but these could not be studied here. The oldest availablename would be S. pimpinellae Ellis 1893 (later homonyms Laubert1920 and Hollós 1926). According to the diagnoses the conidial sizesdescribed for these taxa largely overlap, and range from 15–35 ×1–1.5(–2) µm, thus all considerably smaller than in S. aegopodii.Septoria aegopodina Sacc., Michelia 1: 185. 1878. Fig. 7.= Septoria aegopodina var. villosa Gonz. Frag., Assoc. españ. Progr. Cienc.Congr. Oporto, 6. Cienc. natur.: 47. 1921.= Septoria aegopodina var. trailii Grove, British Stem-and Leaf-Fungi(Coelomycetes) 1: 396. 1935.Description in planta: Symptoms leaf spots numerous, indefiniteand soon covering large parts of the leaf lamina, visible on bothsides of the leaf, first yellow then pale orange-brown. Conidiomatapycnidial, predominantly hypophyllous, scattered or gregarious,globose to subglobose, pale to dark brown, immersed, 90–160 µmdiam, releasing conidia in white cirrhi; ostiolum central, circular and15–25 µm wide, surrounded by cells with dark brown to almostblack, thickened walls; conidiomatal wall 10–28 µm thick, composedof an outer cell layer of pale brown to hyaline isodiametric angularor globose cells, 3.5–8 µm diam with thickened walls, and an innerlayer of one or more hyaline cells with not or only slightly thickenedwalls. Conidiogenous cells hyaline, discrete, mostly broadlyampulliform, holoblastic, rarely proliferating sympodially, possiblyalso percurrently but no annellations visible, 4–7(–8) × 3–4.5 µm.Conidia filiform to filiform-cylindrical, straight or curved, attenuatedgradually to a narrowly rounded to somewhat pointed apex, andattenuated gradually or more abruptly to a narrowly truncate base,(0–)1–3-septate, not constricted around the septa, hyaline, withnumerous minute and several larger oil-droplets in each cell in theliving state, and minute oil-droplets and granular contents in therehydrated state, (22–)30–42.5 × 1.5–2(–2.5) µm (rehydrated).Sexual morph unknown.Description in vitro (20 ºC, diffuse daylight): Colonies on OA7–10 mm diam in 2 wk, with a very narrow, glabrous and rosybuffmargin; colony restricted, somewhat elevated, immersedmycelium colourless to faintly brick, or much darker, brownvinaceous,but mostly hidden under a dense, woolly mat of purewhite to faintly yellow aerial mycelium; reverse olivaceous-blackto dark brick; a vinaceous pigment diffusing into the surroundingmedium. Colonies on MEA 8–15 mm diam in 2 wk, the margincovered by pure white aerial hyphae; colony restricted, irregularlypostulate in the central area, mostly covered by a dense woollyfloccosemat of smoke grey aerial mycelium, but after 2 wknumerous glabrous, black conidiomata appear on the colonysurface in the centre, releasing milky white conidial slime.Reverse of colony olivaceous-black.www.studiesinmycology.org239

Verkley et al.Fig. 7. Septoria aegopodina. A, B. Colonies CBS 123740. A. On OA. B. On MEA. C–F. Conidia in planta (CBS H-21249). G. Conidia and conidiogenous cells in planta (CBSH-21249). H, I. Conidia on OA (CBS 123741). J. Conidia on MEA (CBS 123740). Scale bars = 10 µm.Conidia on MEA elongated ellipsoidal to cylindrical, straightto distinctly curved, rounded to narrowly pointed at the apex,attenuated gradually to a narrowly truncate base, 0–1-septate,0-septate 8–12 × 2–2.5(–3), 1-septate 10–21 × 2–2.5 μm; Conidiaon OA cylindrical, straight or slightly to distinctly curved, narrowlyrounded to slightly pointed at the apex, attenuated gradually to anarrowly truncate base, 1–3-septate, (16–)20–32 × 1.5–2 μm.Hosts: Aegopodium podagraria and Pimpinella spp.240

A new approach to species delimitation in SeptoriaFig. 8. Septoria anthrisci. A. Conidia and conidiogenous cells in planta (CBS H-21185). B. Conidia on OA (CBS 109020). Scale bars = 10 µm.Material examined: Czech Republic, Moravia, Veltice, Forest of Rendez Vous,on living leaves of Aegopodium podagraria, 16 Sep. 2008, G. Verkley 6013, CBSH-21249, living cultures CBS 123740, 123741.Notes: Morphologically, the material from the Czech Republicavailable here agrees well with S. aegopodina as described byVanev et al. (1997) and Shin & Sameva (2004), although thepycnidia are larger than described by these authors (55–85 μmdiam). The species can easily be distinguished from S. aegopodiioccurring on the same host plant, as the conidia of that fungusare considerably larger (30–115 × 3.5–4 µm), and appearpredominantly 1-septate. The conidia more closely resemblethose of S. anthrisci. The diagnoses of S. aegopodina var. trailiibased on material on Pimpinella saxifraga, and of S. aegopodinavar. villosa on Pimpinella villosa, agree with the description of thetype variety. Both varieties are therefore considered synonyms ofS. aegopodina. In the multigene phylogeny S. aegopodina groupsfairly closely with S. oenanthicola, S. sii and S. oenanthis from thesame host family (Apiaceae), but other taxa from that family likeS. anthrisci are relative distant and belong elsewhere the Septoriaclade (Fig. 2). Other isolates grouping with S. aegopodii includethose of S. mazi from Mazus japonicus (Scrophulariaceae), S.campanulae from Campanula takesimana (Campanulaceae), andS. gentianae from Gentiana scabra var. buergeri (Gentianaceae).Septoria anthrisci Pass. & Brunaud, Rev. Mycol. (Toulouse)5: 250. 1883 [non P. Karst., Meddn Soc. Fauna Flora fenn.13: 10. 1884]. Fig. 8.Description in planta: Symptoms leaf spots numerous but small,circular to elliptical, visible on both sides of the leaf, the centre whiteto pale ochreous, surrounded by a relatively narrow, somewhatelevated, dark reddish brown to black margin. Conidiomatapycnidial, epiphyllous, sometimes also visible from the undersideof the lesion, mostly one, rarely up to three in each leaf spot,subglobose to lenticular, sometimes becoming cupulate, brownto black, immersed, 115–190 µm diam; ostiolum central, initiallycircular and 30–55 µm wide, later becoming more irregular andup to 100 µm wide, surrounding cells concolorous; conidiomatalwall about 12–20 µm thick, composed of an outer layer of palebrown angular cells 4.5–7 µm diam with somewhat thickenedwalls, and an inner layer of thin-walled, pale yellow angularto globose cells 2.5–5 µm diam. Conidiogenous cells hyaline,discrete, rarely integrated in 1-septate conidiophores, globoseor narrowly or broadly ampulliform, holoblastic, mostly with arelatively narrow elongated neck, proliferating percurrently severaltimes with distinct annellations, often also sympodially after or inbetween a few percurrent proliferations, 6–14(–18) × 2.5–5(–6)µm. Conidia filiform, straight, curved to flexuous, attenuatedgradually to a narrowly pointed apex and narrowly truncate base,(0–)1–3(–4)-septate (septa very thin and easily overlooked), notconstricted around the septa, hyaline, contents with several minuteoil-droplets and granular material in each cell in the living state, withminute oil-droplets and granular contents in the rehydrated state,(18–)25–59 (–65) × 1–2 µm (living; rehydrated, 1–1.8 µm wide).Sexual morph unknown.Description in vitro: Colonies on OA 4–6(–9) mm diam in 1 wk (18–22 mm in 22 d), with an even, glabrous, peach, later coral margin,with a concolorous pigment diffusing beyond the colony margin;colonies after 1 wk restricted, distinctly elevated in the centre,immersed mycelium first peach to pale coral, then deep coral, thecolony already appearing darker in the centre after 1 wk due tonumerous almost black pycnidial conidiomata in part merging intolarge complexes, releasing pale whitish or rosy-buff droplets ofconidial slime from one to several short-papillate or more elongatedneck-like openings; reverse in the centre blood colour, surroundedby a first intense peach, later scarlet or coral area. Colonies onCMA 7–8(–9) mm diam in 1 wk (18–21 mm in 22 d), as on OA.Colonies on MEA 6–11 mm diam in 1 wk (24–29 mm in 22 d), withwww.studiesinmycology.org241

Verkley et al.an even, almost glabrous, buff margin, without a diffusing pigment;colonies restricted, irregularly pustulate to hemispherical, alreadyup to 4 mm high after 1 wk, immersed mycelium leaden grey toolivaceous-grey, covered by well-developed white to greyish,appressed, woolly aerial mycelium; conidiomata abundantlydeveloping at the surface in the central area, releasing cirrhi of buffto pale luteous to rosy-buff conidial slime; reverse fuscous black tobrown-vinaceous, surrounded by a narrow pale luteous marginalzone. Colonies on CHA 7–12 mm diam in 1 wk (29–31 mm in 22 d),as on MEA, but the surface more glaucous to glaucous blue green,the margin rosy-buff, and the conidial slime pale flesh.Conidiomata pycnidial, single, brown to black, 100–250 µmdiam, conidiogenous cells as in planta; conidia as in planta, 25–55(–69) × 1.2–2 µm.Hosts: Anthriscus spp., and also Chaerophyllum spp.(Teterevnikova-Babayan 1987; Vanev et al. 1997).Material examined: Austria, Tirol, Ötztal, Sautens, on living leaves of Anthriscus sp.,30 July 2000, G. Verkley 1022, CBS H-21185, living culture CBS 109019, 109020.Notes: According to the short and incomplete original diagnosis,the conidia of S. anthrisci are continuous, 40–50 µm long. The typehost is Anthriscus vulgaris. The description of the species on thehost agrees well with those provided by Vanev et al. (1997) andTeterevnikova-Babayan (1987), although the latter reported conidiaup to 75 µm long. The species is close to S. petroselini (CBS182.44 and CBS 109521), from which it cannot be distinguished byITS sequence, but the EF and Act sequences proved to differ by 4and 27 %, respectively.Of other Septoria species found on the family Apiaceae, onlyS. petroselini is relatively closely related. Septoria petroselini canbe distinguished from S. anthrisci by the larger conidia (29-80 ×1.9-2.5 mm) with up to 7 septa on the host plant, usually species ofPetroselinum or Coriandrum.Septoria apiicola Speg., Boln Acad. nac. Cienc. Córdoba11: 294. 1888. Fig. 9.≡ Rhabdospora apiicola (Speg.) Kuntze, Revisio generum plantarum 3(2): 509. 1898.= Septoria apii Chester, Bull. Torrey Bot. Club 18: 371. 1891 [non Rostr.,Gartn. Tidende 180. 1893, later homonym].= Septoria petroselini var. apii Briosi & Cavara, I funghi parassiti delle piantecoltivate de utili essicati, delineati e descritti, Fasc. 6, no 144. 1891.= Septoria apii-graveolentis Dorogin, Mater. Mikol. Fitopat. Ross. 1 (4): 72.1915.Description in planta: Symptoms on leaves numerous spots,scattered, separate but not well-delimited, circular to elliptical, orconfluent, yellowish or pale brown and in dry conditions also with awhite centre, visible on both sides of the leaf. Conidiomata pycnidial,amphigenous, single, numerous in each lesion, scattered, in smallclusters or in more or less distinct concentric patterns, globoseto subglobose, dark brown to black, immersed, (60–)75–170 µmdiam; ostiolum circular, central, somewhat papillate, 15–45(–55) µm wide, surrounded by darker cells with thickened walls;conidiomatal wall composed of textura angularis, 12.5–20 µmthick, with an outer layer of cells, 4–6.5(–8) µm diam with brown,thickened walls, and an inner layer of hyaline and thin-walledcells 3.5–4 µm diam. Conidiogenous cells cylindrical, or broadlyto elongated ampulliform mostly without distinct neck, hyaline,holoblastic, proliferating percurrently, annellations indistinct, rarelyalso sympodially, 4–8(–10) × 3.5–5 µm. Conidia filiform, straight,curved, or flexuous, gradually attenuated to a narrowly rounded tomore or less pointed apex, more or less abruptly attenuated intoa truncate base, (1–)2–3(–5)-septate, not or only inconspicuouslyconstricted around the septa in the living state, hyaline, containingone to several relatively small oil-droplets in each cell, in therehydrated state with larger oil-masses, 20–48(–56) × 2–2.5 µm(living; rehydrated, NT 1.5–2 µm wide). Sexual morph unknown.Description in vitro (based on CBS 400.54): Colonies on OA12–18 mm diam in 2 wk, with an even to slightly ruffled, glabrous,colourless margin; colonies spreading, remaining almost plane,immersed mycelium dull green to dark herbage green; aerialmycelium moderately to well-developed, woolly-floccose, white;dark brown to black single globose pycnidia developing after7–10 d scattered over the agar surface, more rarely immersed inthe agar, 70–100(–140) µm diam, ostioli often reduced or absent,releasing droplets of milky white conidial slime; reverse dark bluishgreen to black, diffusing pigment absent. Conidiogenous cells as inplanta, but more often proliferating sympodially, 4–12.5 × 3.5–4.5µm. Conidia as in planta, mostly 30–55(–68) × 2–2.5 µm.Hosts: Apium australe, A. graveolens var. graveolens (celery), A.graveolens var. rapaceum (celeriac), A. prostratum.Material examined: Italy, Perugia, culture ex leaf of Apium graveolens, depositedJune 1959, M. Ribaldi s.n., CBS 389.59; Netherlands, culture ex Apium sp.,deposited Aug. 1952, isolated by G. van den Ende s.n., CBS 395.52; Prov. Utrecht,Baarn, Cantonspark, culture ex living leaves of A.graveolens, 1953, depositedOct. 1954, J.A. von Arx s.n., CBS 400.54 = IMI 092628; Prov. Limburg, Venray,Vreedepeel, on living leaves of A. graveolens var. graveolens, Aug. 2004, collectorunknown (G. Verkley 3046), CBS H-21261; same substr., Noord-Brabant, betweenZevenbergen and Zevenbergschen Hoek, 26 Aug. 2004, R. Munning (G. Verkley3048), CBS H-21163, living culture CBS 116465.Notes: According to Priest (2006), it is apparent that at least twospecies of Septoria occur on Apium spp. worldwide. Earlier studiesdemonstrated considerable variation in the dimensions of conidiain material on Apium spp. especially in conidial width, along withother minor morphological differences, and differences in leaf spottype (Cochran 1932, Sheridan 1968). Gabrielson & Grogan (1964)concluded that there was just one species involved, characterisedby pycnidia 55–190 µm diam and conidia 10–72 × 0.9–3.0 µm.They accepted the name S. apiicola, and placed S. apii and S.apii-graveolentis in its synonymy. Jørstad (1965) placed S. apii inthe synonymy of S. petroselini, while Sutton & Waterston (1966)followed Gabrielson & Grogan but described the conidia as 22–56× 2–2.5 µm. As was the case in the material from Australia studiedmore recently by Priest (2006; conidia 30–48 × 2–2.5 µm), mostconidia in the collections available for the present study are 2–2.5µm wide. These collections proved highly homogenous in DNAsequences of the genes investigated and in most morphologicalcharacters. However, morphological and molecular investigationsof more material on Apium from various host species andgeographical regions is required before conclusions can be drawnabout the number of taxa involved on this host genus.According to Sutton & Waterston (1966) and also Priest (2006),the conidiogenous cells of S. apiicola are phialidic, producingseveral conidia enteroblastically and seceding at the same level,and these authors did not report sympodial proliferation. In thematerial we were able to examine however, percurrent proliferationwas mostly seen and rarely also sympodial in planta, whilesympodially proliferating conidiogenous cells were more commonin vitro. The difference may result from the fact that here we studied242

A new approach to species delimitation in SeptoriaFig. 9. Septoria apiicola. a. Colony on OA (CBS 400.54). B, C. Conidia in planta (CBS H-21261). D. Conidia on OA (CBS 400.54). E. Conidia and conidiogenous cells on OA(CBS 400.54). F. Ibid., in planta (CBS H-21261). Scale bars = 10 µm.living material, as we noted that after rehydration of the herbariumvouchers it is indeed very difficult to still see the details, in particularprogressive annellations.Septoria astragali Roberge ex Desm., Annls Sci. Nat., sér.2, Bot. 19: 345. 1843. Fig. 10.?= Septoria astragali var. brencklei Sacc., Atti Memorie Accad. patavina 33:171 (as ‘brinklei’). 1917.Description in planta: Symptoms leaf spots circular or moreirregular, often indefinite or delimited by a dark brown border,white, pale ochreous to yellowish brown, usually several on eachleaflet. Conidiomata pycnidial, often visible on both sides of theleaf, amphigenous, but either predominantly hypo- (V6023) orepiphyllous (V1036), scattered, globose, immersed to semiimmersed,125–170 µm diam; ostiolum circular, central, 20–55 µmwide, surrounding cells somewhat darker; conidiomatal wall up to30 μm thick, composed of an outer layer of isodiametric to irregularcells 3.5–8.5 μm diam with brown walls which are thickened up to1 μm, and an inner layer of hyaline, thin-walled cells 3–7 μm diam.Conidiogenous cells hyaline, ampuliform, or elongated ampulliformwith a distinct neck, hyaline, holoblastic, proliferating sympodially,and sometimes (also) percurrently 1–2 times with indistinctannellations, 10–17 × 5–8 µm. Conidia cylindrical, straight,curved, or flexuous, gradually attenuated to a narrowly rounded tosomewhat pointed apex and a truncate base, (5–)7–9(–11)-septate,somewhat constricted around the septa in the living state (“T”), notconstricted in the rehydrated state, hyaline, contents granular orwith numerous small and a few larger oil-droplets in each cell, (85–)105–145 × 3.5–4 µm (living; rehydrated, 3–3.5 μm wide). Sexualmorph unknown.Description in vitro: Colonies on OA 2–4 mm diam in 10 d (34–37mm in 7 wk), with an even or irregular, glabrous, colourless margin;colonies spreading, the surface plane, immersed mycelium mostlycolourless to buff with very diffuse, short, whitish aerial mycelium,the centre of the colony darkened by numerous superficial andimmersed, separate or confluent pycnidial conidiomata, the outerwww.studiesinmycology.org243

Verkley et al.Fig. 10. Septoria astragali, CBS 109116. A–C. Colonies (15 C, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia and conidiogenous cells on OA (CBS 109116); E–G. Conidiain planta (CBS H-21258). H. Conidiogenous cells on OA (CBS 123878). I. Conidia on OA (CBS 123878). Scale bars = 10 µm.walls covered with short mycelial outgrowth, with a single openingreleasing a stout cirrhus of pale whitish to rosy-buff conidial slime;reverse mostly olivaceous-black due to the conidiomata; afterincubation of 5–7 wk, more of the immersed mycelium darkensto olivaceous-black, with traces of a red pigment especially nearthe margin, and the aerial mycelium becomes more dominant,white or grey. Colonies on CMA 2–3 mm diam in 10 d (27–28 mmin 7 wk), as on OA, but the reddish pigment at the margin moreconspicuous in old cultures. Colonies on MEA 1.5–3 mm diam in 10d ((8–)14–17 mm in 7 wk), with an even to irregular, glabrous, buffmargin; colonies first restricted, while later faster growing hyphalstrands colonize the medium underneath the surface of the agar,pustulate to hemispherical, the surface first ochreous or amber,later olivaceous-grey or black covered by fairly dense, short,white aerial mycelium; some superficial or immersed pycnidialconidiomata formed, releasing cirrhi of pale buff conidial slime;reverse dark umber to brown-vinaceous. Colonies on CHA 1.5–3mm diam in 10 d (15–17 mm in 7 wk), with an irregular marginwhich is hardly visible from above; colonies restricted, irregularlypustulate to hemispherical, the surface dark brick to dark slate244

A new approach to species delimitation in Septoriablue, covered by a diffuse, very short, felty, white aerial mycelium;abundant superficial conidiomata releasing stout cirrhi of rosy-buffconidial slime; reverse blood colour.Hosts: Astragalus spp.Material examined: Austria, Tirol, Ötztal, Ötz, near Habichen W of Ötztaler Aache,1 Aug. 2000, on living leaves of Astragalus glycyphyllos, G. Verkley 1036, epitypedesignated here CBS H-21151 “MBT175673”, living cultures ex-epitype CBS109116, 109117; Carinthia, near Töschling at Wörthersee, on living leaves of A.glycyphyllos, July (year not indicated), Keissler, distributed in Keissler, Kryptogam.exsicc. 1331, PC 0084566. Czech Republic, Moravia, Pavlov, forest around ruin, 18Sep. 2008, on living leaves of A. glycyphyllos, G. Verkley 6023, CBS H-21258, livingculture CBS 123878. France, Lower Normandy, Calvados, Baynes near Forêt deCerisy, 20-21 Sep. 1842, on leaves of A. glycyphyllos, Roberge, “Col. Desmazieres1863, no. 8, 59”, isotype PC 0084563; Côte-d’Or, Montagne de Bard, same substr.,June 1901, Fautrey, PC 0084565 (herb. Mussat); same substr., Pinsguel, nearToulouse, 30 Aug. 1935, Moesz, PC 0084564. Poland, Puszcza Bialowieska, Aug.1922, on living leaves of A. glycyphyllos, W. Siemaszko, distributed in W. Siemaszko,Fung. Bialowiezenses exsicc. 73, PC 0084569. Romania, Transsilvania, distr.Istriţa-Năsăud, Arcalia Arboretum, 1 July 1966, on living leaves of A. glycyphyllos,A. Crişan, distributed in Flora Romania exsicc 3127, PC 0084567; same substr.,Muntenia, distr. Ilfov, Pantelimon, 18 July 1926, T. Săvulescu & C. Sandhu,distributed in Săvulescu, Herb. Mycol. Romanicum 4, 166, PC 0084568 (sub S.astragali f. santonensis).Notes: The type specimen in PC of S. astragali contains severalmounted leaves and is provided with a hand-written description inFrench. Conidia observed in this material are mostly 7–9-septate,85–130 × 2.5–3.5 μm. The type thus agrees well with the originaldescription which indicated conidia 120 × 3 µm, with 9–10 septa.Of the other collections available for this study that generallyall agree with the type in morphology and leaf symptoms, 1036from Tirol is chosen as epitype. Various authors have reportedcomparable conidial measurements for this large-spored Septoria.Jørstad (1965) reported conidial measurements 48–128 × 3–3.5µm, Teterevnikova-Babayan (1987) 60–140 × 3–4 µm, Vanev et al.(1997), 58–112 × 2.5–3.5 µm. According to the original diagnosis,S. astragali var. brencklei, described from Lathyrus venosus inNorth Dakota, has 8–10-septate conidia, 130–150 × 4–5 µm,and Teterevnikova-Babayan (1987) placed it in synonymy with S.astragali. Septoria astragali is one of the first of over 200 Septoriathat were described from plants of the family Fabaceae.Septoria campanulae (Lév.) Sacc., Syll. Fung. 3: 544. 1884.Fig. 11.Basionym: Ascochyta campanulae Lév., Annls Sci. Nat., sér. 3, Bot.5: 277. 1846.Description in planta: Symptoms definite, circular to irregular, paleto dark brown leaf spots, epigenous, usually delimited by blackenedveinlets. Conidiomata pycnidial, predominantly ephiphyllous, rarelyhyphyllous, scattered, globose to subglobose, immersed to semiimmersed,40–125 µm diam; ostiolum circular, central, 10–20 µmwide, surrounding cells darker; conidiomatal wall 10–20 µm diam,composed of an outer layer of brown-walled cells 3.5–10 µm diam,and an inner layer of hyaline cells 3.5–6 µm diam. Conidiogenouscells discrete or integrated in 1–2-septate conidiophores, cylindrical,or ampuliform, sometimes with an elongated neck, hyaline,holoblastic, proliferating sympodially, and often in the same cellalso percurrently showing indistinct annellations, 5–15 × 3–5 µm.Conidia filiform, straight or slightly curved, gradually attenuated toa narrowly rounded or somewhat pointed apex, gradually or moreabruptly attenuated into a narrowly truncate base, 0–1(–3)-septate,not or indistinctly constricted around the septa, hyaline, contentsFig. 11. Septoria campanulae. A. Conidia and conidiogenous cells in planta (CBSH-21178). B. Ibid., on CHA (CBS 109114). Scale bars = 10 µm.with small oil-droplets and minutely granular material in theliving state and rehydrated state, (12.5–)15–25(–32) × 1.5–2 µm(rehydrated). Sexual morph unknown.Description in vitro: Colonies on OA 6–9 mm diam in 10 d (28–32mm in 3 wk; > 65 mm in 7 wk), with an even, somewhat undulating,glabrous, colourless margin; colonies spreading, the surface plane,immersed mycelium pale luteous to ochreous, but radiating greenishor olivaceous hyphal strands soon developing, which later dominatethe olivaceous-black colonies, then also a distinct red pigment isproduced which diffuses beyond the colony margin; scattered, mostlysuperficial pycnidial conidiomata, which are first dark olivaceous, thenwww.studiesinmycology.org245

Verkley et al.almost black, glabrous, with a single or up to 5 ostioli placed on shortpapillae or more elongated necks, that release pale whitish conidialslime; aerial mycelium scanty, diffuse, woolly-floccose, white; reversein the centre most dark slate blue, first surrounded and intermixedwith ochreous to rust, later more coral. Colonies on CMA 5–9 mmdiam in 10 d (24–28 mm in 3 wk; > 70 mm in 7 wk), with an even,glabrous margin; as on OA but immersed mycelium with a greenishhaze throughout, later almost entirely olivaceous-black; aerialmycelium even more scanty, but higher and reverse darker, darkslate blue throughout most of the colony; conidiomata similar as onOA, but necks shorter or absent. Colonies on MEA 7–9 mm diam in 2wk (24–30 mm in 3 wk; > 70 mm in 7 wk), with an even, undulating toruffled, glabrous, buff to honey margin; colonies first more restricted,pustulate to almost conical, but later growing faster with a planesubmarginal area; immersed mycelium rather dark, near the margincovered by woolly to felty white aerial mycelium; mostly composedof spherical conidiomatal initials, superficial mature conidiomatareleasing milky white conidial slime; reverse first dark brick in thecentre, near the margin locally grey-olivaceous or cinnamon, latersepia to brown-vinaceous, the margin honey. Colonies on CHA 4–10mm diam in 10 d (17–32 mm in 3 wk; 45–65 mm in 7 wk), with anirregular or even, buff margin covered by a diffuse, felty white, latergrey aerial mycelium; further as on MEA, but the colony surfaceless elevated and especially near the margin with greyish, felty totufty aerial mycelium; in the centre numerous conidiomata developat the surface, after 3 wk releasing milky white to rosy-buff dropletsof conidial slime; reverse in the centre blood colour, dark brick tocinnamon at the margin.Conidiogenous cells as in planta, but often with relativelylonger necks due to repetitive percurrent proliferation. Conidia as inplanta, but more often 2 and also 3-septate, and mostly 18–34.5 ×1.5–2 µm (OA), 13–32 × 1.5–2 µm (CHA).Hosts: Campanula glomerata, C. takesimana.Material examined: Austria, Tirol, Ötztal, Sulztal, Gries, along the river in thevillage, on living leaves of Campanula glomerata, 1 Aug. 2000, G. Verkley 1034,CBS H-21178, living cultures CBS 109114, 109115. Korea, Taean, on living leavesof C. takesimana, H.D. Shin, living culture SMKC 21949 = KACC 42622 = CBS128589; Daejeon, same substr., H.D. Shin, living culture SMKC 24476 = KACC44787 = CBS 128604.Notes: The first species described on Campanula is S. campanulae,for which Shin & Sameva (2004) provided a detailed descriptionbased on material occurring in Korea on C. punctata and C.takeshimana (conidia mostly 1-septate, 13–24 × 1.5–2 µm). Shin& Sameva summerised the history of the Septoria species on thegenus Campanula. Of the three species most often accepted, viz.,S. campanulae, S. obscura, and S. trachelii, S. campanulae fits thecurrent material best. Septoria arcautei was not mentioned by Shin& Sameva. This species was described from C. glomerata in Spain,and according to the original description by Unanumo, the pycnidiaare predominantly epiphyllous, 55.8–74.8 µm diam, and the conidiacontinuous, 20–25.7 × 0.8 µm. Septoria campanulae is closely relatedto several species from hosts in Apiaceae, including S. aegopodina,S. oenanthis, and S. sii (Fig. 2). Sequencing results of CBS 109114and 109115 were puzzling, suggesting possible contamination.Septoria cerastii Roberge ex Desm., Annls Sci. Nat., sér. 3,Bot. 11: 347. 1849. Fig. 12.Description in planta: Symptoms indefinite, yellow to brown leafspots, but more often on withering parts of leaves, stems and bracts.Conidiomata pycnidial, on leaves amphigenous but predominatelyepiphyllous, scattered or aggregated, globose, semi-immersed,80–125(–150) µm diam; ostiolum circular, central, 20–45 µm wide,surrounding cells somewhat darker; conidiomatal wall composedof textura angularis without distinctly differentiated layers, theouter cells with brown, somewhat thickened walls and 4–6.5 µmdiam, the inner cells hyaline and thin-walled and 3.5–6 µm diam.Conidiogenous cells ampulliform, or elongated ampulliform with adistinct neck, hyaline, holoblastic, proliferating percurrently 1–manytimes with indistinct annellations, also sympodially, 5–10 × 3–5 µm.Conidia filiform to filiform-cylindrical, straight, curved, or flexuous,gradually attenuated to a rounded or more or less pointed apex,abruptly attenuated into a truncate base, (1–)2–4(–5)-septate,not or indistinctly constricted around the septa, hyaline, contentsmoderately rich in small guttulae, minutely granular material andlarge vacuoles in the living state, in the rehydrated state withinconspicuous contents and no oil-droplets, (21–)30–52(–57) ×1.5–2 µm (rehydrated). Sexual morph unknown.Description in vitro: Colonies on OA 2–4 mm diam in 2 wk (10–13mm in 6 wk), the margin irregular to ruffled, almost as dark as restof the colony, covered by diffuse, grey aerial mycelium; the colonyspreading, almost plane to somewhat irregularly lifted and pustulate,immersed mycelium olivaceous-black to black, covered with dense,grey, woolly aerial mycelium; conidiomata starting to develop at thesurface after 10–15 d; reverse olivaceous-black. Colonies on CMA2–5 mm diam in 2 wk (13–17 mm in 6 wk), as on OA; conidialslime milky white; reverse greenish grey to almost black. Colonieson MEA 0.5–1.5 mm diam in 2 wk (4–6 mm in 6 wk), as on OA,with equally dense and long, woolly, grey aerial mycelium; colonyhemispherical, with scarce pycnidial conidiomata developingtardily; reverse dark slate blue to black. Colonies on CHA 1–3 mmdiam in 2 wk (8–12 mm in 6 wk), as on OA, but colonies moredistinctly lifted above the agar surface, hemispherical, and aerialmycelium denser but shorter; conidiomata developing scarcely atthe surface.Conidiomata pycnidial and similar as in planta, 100–150 µmdiam, or merged into larger complexes especially on the agarsurface, dark olivaceous-black to black, up to 250 µm diam; ostiolumas in planta, or absent; Conidiogenous cells hyaline, ampuliform, orelongated ampulliform to cylindrical, with a distinct neck, holoblastic,proliferating percurrently 1–many times with indistinct scars(annellations), also sympodially, 5–12(–15) × 3–5(–6.5) µm. Conidiaon OA similar as in planta, 1–3(–5)-septate, indistinctly constrictedaround the septa, hyaline, contents moderately rich in small guttulae,minutely granular material and large vacuoles in the living state,(26–)35–50(–57) × 1.5–2.5 µm (T), released from superficialconidiomata in whitish cirrhi or slimy masses.Hosts: In leaf spots and on withering leaves, stems and bracts ofCerastium spp. According to Markevičius & Treigienė (2003), alsoon Stellaria holostea.Material examined: Korea, Hoengseong, on C. holosteoides var. hallaisanense,14 May 2006, H.D. Shin, CBS 128586 = KACC 42367 = SMKC 21781; sameloc., substr., H.D. Shin, CBS 128612 = KACC 42831 = SMKC 22609; Jeju, onC. holosteoides, 1 Nov. 2007, H.D. Shin, CBS 128626 = KACC 43220 = SMKC23137. Netherlands, prov. Utrecht, Baarn, on living leaves of Cerastium sp., 9 Aug.1968, H.A. van der Aa 731, CBS H-18069; same loc., substratum, 18 Oct. 1962,H.A. van der Aa, CBS H-18070, and 19 Oct. 1963, CBS H-18071; Prov. NoordHolland, Amsterdamse Waterleidingduinen, near Ruigeveld, on withering leavesof Cerastium fontanum subsp. vulgare, 31 Aug. 1999, G. Verkley & A. van Iperen915, epitype designated here CBS H-21158 “MBT175351”, living culture ex-epitypeCBS 102323. Romania, distr. Ilfov, Malu-Spart, on living leaves of C. fontanum246

A new approach to species delimitation in SeptoriaFig. 12. Septoria cerastii, CBS 102323. A–C. Colonies (15 ºC, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia and conidiogenous cells in planta (CBS H-21158, epitype).E. Conidia on OA (CBS 102323). Scale bars = 10 µm.subsp. triviale, 20 May 1973, G. Negrean, CBS H-18072, distributed in Herb. Mycol.Romanicum, fasc. 50, no. 2475.Notes: The material on Cerastium fontanum examined hereagrees in morphology with the detailed description of Muthumary(1999), who studied type material of S. cerastii (PC 1324) and alsoprovided excellent illustrations. The type host was identified asC. vulgatum, which is a synonym of C. fontanum subsp. vulgare(and C. holosteoides). According to Muthumary, no definite spotsare on the leaves in this collection, but the fungus is nonethelessinterpreted as parasitic. We have the impression from our collectionthat it may be endophytic or a very weak pathogen, but in Korea thefungus causes very characteristic symptoms on C. holosteoidesvar. hallaisanense (Shin & Sameva 2004).This species and S. stellariae occur on two very closely relatedhost genera, Cerastium and Stellaria (Smissen et al. 2002), butthe two can be distinguished morphologically by conidiogenesisand conidial morphology in planta, and the cultures also differconsiderably in pigmentation and growth speed especially on OA.DNA sequence data also support the hypothesis that S. cerastiiand S. stellariae are distinct species, as they differ for example by6 base positions on ITS 1, and the distance in the multilocus treeis considerable. Jørstad (1965) also regarded S. cerastii and S.stellariae as distinct species, indicating that on average the sporesin the latter were much longer (22–96 µm) than in the former(20–43 µm). He mentioned that in two collections of S. cerastiifrom Iceland the conidia reached lengths of 57–60 µm, whereasin collections from Norway attributed to the same species conidiawww.studiesinmycology.org247

A new approach to species delimitation in SeptoriaFig. 13. Septoria clematidis. A, B. Colonies CBS 108983 (15 ºC, nUV). A. On OA. B. On MEA. C. Conidia and conidiogenous cells in planta (CBS H-21182, epitype). D. Ibid.,CBS 108983 on OA. Scale bars = 10 µm.on sterile parts of the colony. Numerous pycnidial conidiomatadeveloping after 2 wk in the agar, on its surface, and also in theaerial mycelium, but no fertile ones observed. Colonies on MEA4.5–7 mm diam in 3 wk (11–18(–22) mm in 7 wk), with a barelyvisible margin; colony restricted, hemispherical, the surface verydark or black, covered by short, diffuse to dense white or greyaerial hyphae; pycnidial conidiomata at the surface releasing cleardroplets without conidial slime after 3 wk, and later first buff, thendirty luteous droplets with conidia; reverse dark slate blue to black,margin pale luteous or buff. Colonies on CHA 4.5–7 mm diam in 3www.studiesinmycology.org249

Verkley et al.wk (15–18 mm in 7 wk), as on MEA, but aerial mycelium denserwith longer hyphae; conidiomatal initials developing scarcely at thesurface, still sterile after 3 wk, but later on releasing dirty buff topale ochreous droplets of conidial slime. In older colonies on MEAand CHA a grey or greyish white, dense mat of aerial hyphae maycover small or larger sectors.Conidiomata as in vitro, pycnidial, often merged to complexstromata, first brownish, then black, glabrous or the surface coveredby short white hyphae; conidiogenous cells as in planta, but larger,7.5–20 × 3–5(–6) µm, holoblastic, proliferating sympodially, nopercurrent proliferation observed; conidia similar in shape as inplanta but mostly 3–7-septate, (45–)55–85(–105) × 4–5(–7) µm.Hosts: Clematis spp.Material examined: Austria, Tirol, Ötztal, Brunau, on living leaves of Clematisvitalba, 30 July 2000, G. Verkley 1025, epitype designated here CBS H-21182“MBT175353”, living cultures ex-epitype CBS 108983, 108984; same loc.,substr., date, G. Verkley 1026, CBS H-21183; same substr., S. Tirol, Eggenthal,Birchabruck, 23 July 1904, J. Kabát, distributed in Kabát & Bubák, Fungi imperfectiexsicc. 163, PC 0084599. France, Parc de Lébisey, 27 July 1848, Roberge (?), ‘Col.Desmazieres 1863, no. 8, 448’, isotype PC 0084593; same loc., substr., June 1848,Roberge, PC 0084596; same substr., Paris, Parc de St Cloud, Aug. 1908, Ludwig,PC 0084607; same substr., Fontainebleau forest, Aug. 1885, PC 0084604; samesubstr., Clères, 27 Aug. 1896 (herb. Mussat), PC 0084598; same substr., Seine-et-Oise, Meudon, 15 Nov. 1844, Roussel (Herb. Roussel), PC 0084594, PC 0084595.Romania, distr. Iaşi, Moldova, Bârnova, same substr., 30 Aug. 1934, T. Săvulescu& C. Sandhu, distributed in Săvulescu, Herb. Mycol. Romanicum 24, 1160, PC0084603, 0084608, 0084597.Notes: This is one of the large-spored species of Septoria fromthe genus Clematis. Teterevnikova-Babayan (1987), who studiedcollections from several species of Clematis observed, 4–6-septateconidia 60–90 × 3–5 µm. Vanev et al. (1997) reported conidiaas 39–100 × 2.5–4 µm. The type of S. clematidis in PC showed4-7-septate conidia 52–78 × 3–3.5 µm, in good agreement with theones observed in the Austrian material (CBS H-21182), which isdesignated above as epitype.The taxonomy of the 15 described species of Septoria onClematis is still unresolved (Shin & Sameva 2004), and wouldcertainly benefit from study of additional fresh material and cultureswhich could be compared with type material. Septoria clematidisRoberge is probably distinct from S. clematidis Pandotra & K.S.M.Sastry, a taxon described on Clematis grata in India that should berenamed because it is a later homonym. According to Muthumary(1999), the conidia in the type of S. clematidis Pan. & Sastry are1–3-septate, 38–66 × 2.5–3 µm, whereas in the original diagnosisthe conidia are described as “ septate”, 25.6–44.8 (av. 36.3) × 2.3–3.2 (av. 2.7). Two other large-spored species are S. jackmanii Ellis& Everh. 1892, which was described from Clematis jackmanii inGeneva, New York and, according to the diagnosis, has conidia 40–70 × 2.5–3 µm (number of septa not given), and also S. williamsiaePriest, based on material on C. aristata in Australia, which has(1–)3(–4)-septate conidia 20–45(–55) × (1.5–)2 µm (Priest 2006).Septoria convolvuli Desm., Annls Sci. Nat., sér. 2, Bot.17:108. 1842. Fig. 14.Description in planta: Symptoms leaf lesions circular, single orconfluent to form irregular extended lesions, pale to dark brown,showing one to several concentric lines and a dark brown,slightly raised line or zone delimiting the lesion, visible on bothsides of the leaf. Conidiomata pycnidial, epiphyllous, several ineach lesion, immersed, subglobose to globose, brown to black,(65–)90–120(–145) µm diam; ostiolum central, circular to irregular,initially 20–40 µm wide, later becoming more irregular and up to70 µm wide, surrounding cells somewhat darker; conidiomatalwall 10–15 µm thick, composed of a homogenous tissue ofhyaline, angular cells, 2.5–4.5 µm diam, the outermost cells palebrown with slightly thickened walls, the inner cells thin-walled.Conidiogenous cells hyaline, discrete, rarely integrated in 1-septateconidiophores, narrowly to broadly ampulliform, holoblastic,proliferating percurrently several times, with indistinct annellationson a relatively elongated neck, or sympodially, 6–10(–17) ×2.5–3.5(–4) µm. Conidia filiform to filiform-cylindrical, slightly tostrongly curved, often elegantly flexuous, attenuated in the uppercell to a narrowly rounded to pointed tip, narrowly truncate at thebase, 1–3(–4)-septate, not constricted around the septa, hyaline,contents minute oil-droplets and granular material in the rehydratedstate, (15–)23–42(–50) × 1.5–2 µm (rehydrated). Sexual morphunknown.Description in vitro: Colonies on OA 3–5 mm diam in 1 wk (16–20mm in 25 d; 40–48 mm in 33 d), with an even, glabrous margin,which is colourless, or faintly salmon due to a diffusable pigmentalready visible after 1 wk (but fading after 3 wk); colonies firstrestricted, conical to irregularly pustulate, but later spreading,immersed mycelium in the centre becoming first yellowish or citrine,then herbage green or darker olivaceous, surrounded by a morepalid, rosy-buff or pale salmon, later hazel outer zone; pycnidiaalready developing in clusters or radiating rows at the colonysurface, but they remain scarce, later releasing pale rosy-buff orwhitish droplets of conidial slime; aerial mycelium remaining scanty,but in the centre it may be well-developed, white, woolly; reversein the centre olivaceous-black to olivaceous-grey, surrounded bya first salmon or rosy-buff zone where the diffusable pigment isformed, but this becomes hazel. Colonies on CMA 3–5 mm diamin 1 wk [(15–)18–21 mm in 25 d; 38–40 mm in 33 d], as on OA, butsalmon pigment only faintly visible after 20 d, the margin becomingrosy-buff; centre much darker earlier on, entirely olivaceous-black,numerous black papillate to rostrate pycnidia developing after 21 d,releasing pale whitish to buff droplets of conidial slime. Colonies onMEA 2–5 mm diam in 1 wk [5–11 mm in 25 d; 16–18(– 23) mm in 33d], with a ruffled, mostly colourless margin already covered by whiteaerial hyphae after 1 wk; a halo of a diffusing pigment is visible after1 wk, which fades later on; colonies restricted, irregularly pustulateand up to 3 mm high after 1 wk, immersed mycelium dark, butmostly invisible from above due to well-developed, white to greyish,dense and short-felted aerial mycelium; black conidiomata alreadydeveloping after 1 wk, releasing large masses of buff conidialslime; reverse mostly sepia to isabelline. Some colonies may showa more spreading growth after 2 wk in sectors, that are glabrous,immersed mycelium almost black. Colonies on CHA 3–5 mm diamin 1 wk (18–30 mm in 25 d; 30–34 in 33 d), with an even, glabrous,colourless margin; colonies irregularly pustulate, up to 3 mm highafter 1 wk, immersed mycelium colourless to pale ochreous, but inthe centre the surface may be already almost black, while after 25d the entire colony attains that colour, the larger part covered bywell-developed, low, dense, pure white, later smoke-grey to greyolivaceous,felty to woolly-floccose, aerial mycelium; conidiomatalinitials developing mainly in the centre after 1 wk; reverse mostlyfawn, but later almost entirely brown-vinaceous.Conidiomata single, 60–150 µm diam, or merged to smallclusters of up to 350 µm diam, olivaceous to brown, formed mostlyon the agar surface; conidiogenous cells as in planta, 6–20 ×2.5–4(–5) µm; conidia as in planta, but often some conidia with250

A new approach to species delimitation in SeptoriaFig. 14. Septoria convolvuli. A, B. Conidia in planta (CBS H-21244). C. Conidia and conidiogenous cells on OA (CBS 102325). Scale bars = 10 µm.cells that are somewhat inflated, and constricted around septa,(22–)30–45(–55) × 1.8–2.5 µm.Hosts: Calystegia spp. and Convolvulus spp.Material examined: Germany, Eiffel, Schalkenmehren near Maar, Daun, on livingleaves of Convolvulus arvensis, 16 Sep. 1970, H.A. van der Aa 2276, CBS H-18082.Netherlands, Prov. Hoord-Holland, Laren, on living leaves of Calystegia sepium, 18July 1970, H.A. van der Aa 2198, CBS H-18081; Prov. Flevoland, Erkemeder beach,in edge of marshland bordering the lake, on living leaves of Ca. sepium, 8 Sep.1999, G. Verkley 927, CBS H-21209, living culture CBS 102325. New Zealand,North Island, Coromandel, Tairua Forest, along roadside of St. Hway 25, nearcrossing 25A, on living leaves of Ca. sepium, 21 Jan. 2003, G. Verkley 1844, CBSH-21244, living culture CBS 113111; same substr., North Isl., Waikato, Taupiri, BobByrne Memorial Park, 27 Jan. 2003, G. Verkley 1896, CBS H-21248; same substr.,North Isl., Northland, Russell, 30 Jan. 2003, G. Verkley 2014, CBS H-21245. SouthKorea, Kangnung, isolated from Ca. soldanella, H.D. Shin, 8 Nov. 2007, KACC43226 = CBS 128627.Notes: Morphologically and genetically the collections availableproved highly homogeneous. Muthumary (1999) and Priest (2006)both reported sympodial conidiogenesis for this species, but didnot observe annellidic conidiogenesis. According to Shin & Sameva(2004), the conidia can be up to 68 µm long and 7-septate. Jørstad(1965) listed several Septoria names that were based on materialfrom Convolvulaceae in the synonymy of S. convolvuli, includingS. septulata. Beach (1919) reported physiological differences forthe species on Convolvulus arvensis, but whether this correlateswith genetic differences still remains to be investigated. Moreover,as already pointed out by Priest (2006), a number of species onCalystegia and Convolvulus still have to be critically re-examined,which would have to include studies in culture.Septoria coprosmae Cooke, Grevillea 14: 129. 1886.Description in vitro: Colonies on OA 32 mm diam in 28 d (45 mm in38 d), with a glabrous, colourless, even margin; colony spreading,the surface glabrous with only a few tufts of pure white aerialmycelium near the centre, immersed mycelium mostly cinnamon,but brick in the centre, reverse concolorous; no diffusing pigmentsobserved. Conidiomata formed after 3–10 d, on the agar surface orsubmerged, simple or complex, with dark, first reddish-brown, thenblack walls, preformed opening undifferentiated or lacking, tardilyreleasing pale salmon to whitish conidial slime (after 30 d or later).Colonies on MEA (Oxoid, 3 %) 35 mm diam in 28 d (45 mm in 38d), spreading but slightly elevated in the centre, with a colourlessto rosy-buff, glabrous, even margin; colony surface leaden-grey toblack, but with a fine felt coverage of minute, white aerial hyphae,reverse mostly dark brick to sepia, surrounded by cinnamon nearthe margin; no diffusing pigments observed. Conidiomata formedfrom 10 d onwards, mostly superficial, complex, opening bytearing of the upper wall and releasing milky white conidial slime.Spermatogonia of an Asteromella-state also formed.www.studiesinmycology.org251

Verkley et al.Conidiomata simple or complex, with several merging cavities,lacking a differentiated ostiolum, opening by tearing of the wall;conidiomatal wall composed of a single layer of isodiametric cells,6–13 μm diam. Conidiogenous cells discrete, or integrated inshort, 1–2-septate conidiophores, hyaline, cylindrical, holoblastic,sympodial; conidia cylindrical, hyaline, smooth-walled, mostlycurved, rounded at the tip, attenuated to a truncate base,(0–)1–3-septate , not or only slightly constricted around the septa,with minute oil-droplets near the ends and the septa, 9–31 × 1.8–2.2 μm (MEA), 17–30 × 1.7–2.0(–2.5) µm (OA); Spermatia hyaline,ellipsoid, with rounded ends and minutely granular contents, 3–5 ×0.8–1.2 μm.Hosts: Coprosma robusta, Coprosma sp.Material examined: New Zealand, North Island, Bay of Islands area, N. of Russell,mycosphaerella-like sexual morph on living leaves of Coprosma robusta, G. Verkley2020, CBS H-21246, living single ascospore isolate CBS 113391.Notes: CBS 113391 was obtained from rehydrated spotted leavesof Coprosma robusta collected in New Zealand that contained amycosphaerella-like sexual morph. No mature asci were observedin this material, nor a septoria-like morph, but the isolate obtaineddeveloped pycnidia agreeing with conidia described for S.coprosmae (30 × 2 µm). In the multilocus phylogeny CBS 113391groups with CPC 19304, originating from Vigna unguiculata subsp.sesquipedalis in Australia, and CPC 19793, isolated from Syzygiumcordatum in Australia, and is also relatively closely related to S.verbenae (CBS 113438, 113481) isolated from Verbena officinalisin New Zealand. Aptroot (2006) investigated an isotype ofMycosphaerella coacervata from BPI and could only find “variouscoelomycetes”. It is unclear whether it contained a Septoria. Sydow(1924) provided a description of the sexual morph of M. coacervataand an associated spermatial state, but not of a Septoria.Septoria cruciatae Roberge ex Desm., Annls Sci. Nat., sér.3, Bot. 8: 20. 1847. Fig. 15.= Septoria urens Pass., Atti Soc. crittog. ital. 2: 31. 1879.= Septoria aparines Ellis & Kellerm., J. Mycol. 5: 143. 1889.≡ Rhabdospora aparines (Ellis & Kellerm.) Kuntze, Revisio generumplantarum 3 (2): 509. 1898.= Septoria asperulae Bäumler, Verh. zool.-bot. Ges. Wien 40: 142. 1890.= Septoria galii-borealis Henn., Bot. Jahrb. Syst. 37: 163. 1905 [non Bubák& Kabát].= Septoria galii-borealis Bubák & Kabát, Hedwigia 52: 350. 1912 [non Henn.,later homonym].?= Phleospora bresadolae Allesch., Ber. bot. Ver. Landshut 12: 60. 1892.?= Septoria relicta Bubák, Annls mycol. 4: 116. 1906.For more synonyms see Jørstad (1965).Description in planta. Symptoms leaf lesions indefinite, usually asingle one on each leaf expanding to ultimately cover the entirelamina, brown. Conidiomata pycnidial, epiphyllous, numerous,semi-immersed to immersed, subglobose to globose, dark brownto black, 170–240 µm diam; ostiolum central, circular, initially25–55 µm wide, later becoming more irregular and up to 90 µmwide, surrounding cells concolourous; conidiomatal wall 20–35 µmthick, composed of an inner layer of isodiametric to irregular cellsmostly 2.5–4.5 µm diam with hyaline cell walls up to 2 μm thick,and an outer layer of hyphal cells, 8–15 × 5–6.5 μm with orangebrown walls thickened up to 2 μm, well developed and up to 15μm thick in the upper part of the pycnidium wall. Conidiogenouscells hyaline, discrete, rarely integrated in 1-septate conidiophores,cylindrical, or narrowly to broadly ampulliform, holoblastic,proliferating rarely percurrently showing 1–2 indistinct annellations,sometimes (also) proliferating sympodially, 10–15(–22) × 3–5.5(–6) µm. Conidia filiform, curved to flexuous, rounded to somewhatpointed at the apex, attenuated modestly towards the truncatebase, (0–)2–3-septate, not constricted around the septa, hyaline,containing several large oil-droplets and granular material in theliving state and rehydrated state, (30–)42–54(–60) × 2.5–3.2 µm(living; rehydrated, 2.0–2.5 µm wide), released in white cirrhi.Description in vitro (20 ºC, diffuse daylight). Colonies on OA 8–12mm diam in 2 wk, with a glabrous, colourless, even margin; colonyrestricted, the surface mostly covered by pure white, woolly-floccoseaerial mycelium, immersed mycelium mostly bright or darkerherbage-green, brick in the centre, reverse dark green to black; ared pigment diffuses into the medium. Conidiomata developing inthe centre on the surface of the colony or in the aerial mycelium,releasing pale milky white to rosy-buff conidial slime. Colonies onMEA 5–7 mm diam in 2 wk, with a barely visible, irregularly ruffledmargin; colony restricted, hemispherical to irregularly pustulate,the surface entirely covered by a dense felty to woolly mat ofpale olivaceous-grey, locally reddish, aerial mycelium, immersedmycelium almost black; reverse olivaceous-black to black;conidiomata developing on the surface in the centre of colonies,releasing milky white to rosy-buff conidial slime. Conidiomata onOA olivaceous-brown to olivaceous, globose, single or aggregated,200–380 μm diam, on the agar mostly without a well-developedostiolum, the wall composed of a rather undifferentiated outer layerof loosely interwoven, pale brown hyphae with barely thickenedwalls, and an inner layer of globose to angular cells with hyalinewalls up to 2 μm thick. Conidia as in planta, mostly 3-septate, 35–65 × 2–2.5(–3) µm (OA).Hosts: Galium spp.Material examined: Czech Republic, Moravia, Milovice, forest Milovika stran, 15Sep. 2008, on living or decaying leaves of Galium odoratum, G. Verkley 6007,epitype designated here CBS H-21250 “MBT175354”, living cultures ex-epitypeCBS 123747, 123748. France, Libisey near Caen, on living leaves of G. cruciatum,Jul.-Sep. 1844, M. Roberge, “Col. Desmazieres 1863, no. 8, 200”, isotype PC0084552, with handwritten description in French; Libisey near Caen, on living leavesof G. cruciatum, July 1844, M. Roberge, PC 0084551; Puy-de-Dôme, Ambert, on G.cruciatum, 23 Aug. 1903, L. Brevière, PC 0084553. Germany, Thüringen, Berka a.Ilm, on leaves of G. rotundifolium, 21 July 1912, H. Diedicke, distributed in Sydow,Mycotheca germanica 1132, PC 0084548. Iran, Pass Ghaleh, on G. coronatum, 10July 1968, Sharif, PC 0084549. Romania, Bucharest, on G. mollugo, 4 Oct. 1974,G. Negrean, distributed in Herb. Mycol. Romanicum 50, 2476, PC 0084550.Notes: The description given above is based on the collections onGalium odoratum and G. cruciatum, including the well-preservedtype specimen from PC and the collection V6007, which agreeswell with this type material. Although the latter is from CzechRepublic and another host species than the type, it is selected hereas epitype as two cultures derived from it are also preserved inCBS. According to Jørstad (1965), on G. boreale conidia are 23–73× (1–)1.5–2(–2.5) µm (with mostly 3 septa), and on G. aparine37–88 × 1–1.5 µm (with up to 5 septa). Jørstad placed five namesin the synonymy of S. cruciatae, including S. asperulae from G.odoratum. He reported limited differences between material ondifferent species of Galium, and it is not unlikely that there is just onespecies capable of infecting several species of Galium. In additionto the names he listed as synonyms of S. cruciatae, S. relicta andPhleospora bresadolae, both described from G. odoratum (syn.Asperula odorata) in Czech Republic and Germany, respectively,252

A new approach to species delimitation in SeptoriaFig. 15. Septoria cruciatae. A, B. Colonies CBS 123747. A. On OA. B. On MEA. C, D. Conidia in planta (CBS H-21250, epitype). E. Conidia on OA (CBS 123748). F. Conidia inplanta (CBS H-21250). G. Conidia and conidiogenous cells in planta (CBS H-21250). H. Conidia on OA (CBS 123747). Scale bars = 10 µm.may also be regarded as synonyms, but we have not studied typematerial for those (conidia reported 38–60 × 3–3.5 μm and 40–60× 2.5–3.5 μm for these two respectively). The multigene phylogenyshows that the epitype of S. cruciatae is not part of the mainSeptoria clade (Fig 1), but basal to a clade of pseudocercosporellalikefungi. A new genus may have to be proposed for it in future.Septoria cucubali Lebedeva, Materialy po mikol. obsled.Rossii 5, 3: 3. 1921. Fig. 16.Description in planta: Symptoms indefinite colourless to paleyellowish brown lesions, both on the lamina and along the leafmargins. Conidiomata pycnidial, epiphyllous, mostly gregarious,globose, black, semi-immersed, 50 –95 µm diam; osiolum central,circular, 20–35 µm wide, provided with slightly darker cells;conidiomatal wall relatively thin, composed of textura angularis,the outer cells 3.5–5 µm diam, with brown, somewhat thickenedwalls, the inner cells 2.5–4.5 µm diam, with hyaline and thin walls.Conidiogenous cells ampulliform to cylindrical, without a distinctneck, hyaline, holoblastic, appearing to be phialidic, but proliferatingpercurrently with indistinct and close annellations, rarely alsoproliferating sympodially, 5–8(–10) × 2–3 µm. Conidia fusiformcylindricalto cylindrical, weakly curved, gradually attenuated to arounded or more or less pointed apex, abruptly attenuated into anarrow, truncate base, mostly 0–1(–3)-septate, not or indistinctlyconstricted around the septa, hyaline, contents minutely granularin the living state, in the rehydrated state with no distinct contents,(9–)15–42(–52) × 2–2.5 µm (rehydrated). Sexual morph unknown.Description in vitro: Colonies on OA 13–18 mm diam in 2 wk (50–55mm in 6 wk), with an even, glabrous, first colourless margin; colonyspreading, immersed mycelium in the centre pale ochreous towww.studiesinmycology.org253

Verkley et al.Fig. 16. Septoria cucubali. A–C. Colonies. A. CBS 102367, on OA. B. Ibid., on CHA. C, D. CBS 102386. C. On MEA. D. On OA. E, F. Conidia on OA (CBS 102386). G. Conidiaand spermatia on OA (CBS 102367). H. Conidia and conidiogenous cells in planta (CBS H-21159). I. Conidia on OA (CBS 102386). Scale bars = 10 µm.sienna with a distinct citrine to olivaceous tone especially towardsthe margin, or a faint salmon haze; aerial mycelium scanty to welldeveloped,woolly-floccose, greyish white, gradually attaining areddish haze; reverse rust to bay, with olivaceous-black areas.Surface of the colony first plane, but later irregularly lifted, withblackish stromata developing on the surface and immersed in theagar, first spherical, closed, later opening widely to expose a milkywhite to luteous conidial slime. Colonies on CMA 9–15 mm diam254

A new approach to species delimitation in Septoriain 2 wk (43–45 mm in 6 wk), with an even, glabrous, colourlessto buff margin; further as on OA, but immersed mycelium only inthe centre sienna, for the most olivaceous to almost dull green;aerial mycelium similar in colour and texture, but scarcer; reverseolivaceous-black, with distinct rust central areas; conidiomata lessdeveloped. Colonies on MEA 9–16 mm diam in 2 wk, with an even,buff or peach to scarlet margin, mostly hidden under tufts of aerialmycelium; colonies hemispherical, sometimes radially striate,immersed mycelium dark ochreous to greyish brown or olivaceousblack,mostly covered by finely felty or floccose-tufty, white, greyishor scarlet aerial mycelium; luteous to reddish diffusable pigmentsometimes present; reverse rust to chestnut, margin apricot;stromata scarcely developing, releasing milky white to rosy-buffconidial slime. Colonies on CHA (4–)6–9 mm diam in 2 wk [(30–)40–46 mm in 6 wk], as on MEA, conidial slime first rosy-buff, laterochreous.Conidiomata pycnidial, as in planta but often larger, 100–175µm, or merging into larger complexes; conidiogenous cells asin planta, but annellations more distinct. Conidia fusiform-cylindricalto cylindrical, straight or weakly curved, gradually attenuated to arounded or more or less pointed apex, abruptly attenuated intoa narrow, truncate base, (0–)1–3(–4)-septate, not or indistinctlyconstricted around the septa, hyaline, contents minutely granularwith small oil-droplets, (9–)15–29(–52) × 2–2.5 µm.Both on the plant and in culture spermatogonia of an Asteromellastate were produced, in which 0-septate, ellipsoid spermatia wereformed 2–3 × 1–1.5 µm. No sexual morph was observed.Hosts: on living leaves of Cucubalus baccifer and Saponariaofficinalis.Material examined: Germany, isolated from leaf litter of Fagus sylvatica, M.Unterseher, living culture CBS 124874. Netherlands, Prov. Gelderland, Millingenaan de Rijn, Millingerwaard, on living leaves of Cucubalus baccifer, 6 Oct. 1999, G.Verkley 941, CBS H-21159, living cultures CBS 102367, 102368; same loc., date,brown leaf margin on living leaves of Saponaria officinalis, 6 Oct. 1999, G. Verkley938, CBS H-21218, living culture CBS 102386.Notes: The material on Cucubalus available for this study showedconidia (9–)15–19(–23) × 2–2.5 µm, thus much shorter andsomewhat narrower than reported for S. cucubali in the originaldiagnosis (34–50 × 1.5–2 µm; based on material collected inJuly), and by Teterevnikova-Babayan (1987). This Dutch materialwas collected much later in the season than the type, and underrelatively dry conditions. Averages of conidial width and especiallylengths seen in specimens collected under adverse conditionssuch as drought or cold can be lower as compared to materialcollected under optimal conditions. The isolates obtained from thismaterial were, however, capable of producing conidia up to 52 µmin length. This would be in good agreement with S. cucubali, as arethe morphology of the pycnidia, the shape and width of the conidia,as well as the symptoms on the plant described by Teterevnikova-Babayan (1987) for S. cucubali. Markevičius & Treigiene (2003)reported S. dimera on Cucubalus, and that species is characterisedby conidia that are wider (21–35 × 3.2–4.3 µm; Vanev et al. 1997report 26–65 × 2.5–4 µm for that species).The isolates from Cucubalus were also very similar to thoseobtained from the material collected in the same area on Saponaria,and the sequences obtained indicate that these isolates all belongto a single species. The material on the plant studied here differsfrom the description of S. saponariae provided by Teterevnikova-Babayan (1987), who describes conidia as 1–3-septate, 25–59 ×3.3–4.5 µm. That species thus has much wider conidia. Host rangeof S. cucubali in literature only mentions Cucubalus, but it is clearfrom the present study that it also includes Saponaria officinalis.The strain isolated from beech leaf litter may be an accidentaldweller and originate from a Caryophyllaceae host growing in thevicinity. That the fungus would be capable of infecting Fagus leavesas an endophyte seems unlikely but cannot be excluded.Septoria cucurbitacearum Sacc., Nuovo G. bot. ital. 8: 205.1876.Description in vitro: Colonies on OA 38 mm diam in 5 wk, with aneven, or slightly undulating, colourless, glabrous margin; coloniesrestricted to moderately spreading, almost entirely olivaceousblack,due to brown-walled immersed hyphae, the surface mostlyglabrous, yet in the centre and around pycnidia often with greyishwhite, pruinose aerial hyphae. Conidiomata numerous, scattered orgregarious, black, pycnidial, with a single often quite long ostiolateneck, but fruitbodies often bursting somewhere in the lower wall,conidial slime pale white; reverse concolourous. Conidiogenouscells hyaline, discrete, ampulliform to cylindrical, holoblastic, with1–3 percurrent proliferations, 8–16 × 3.5–5 µm. Conidia filiform,curved or flexuous, hyaline, 3–5(–7)-septate, not constrictedaround the septa, narrowly rounded at the top, slighty attenuatingto a narrowly truncate base, with minute oil-droplets, (30–)35–55(–72) × 1.5–2(–2.5) µm.Hosts: Cucurbita spp., Cucumis spp. and Citrullus vulgaris.Material examined: New Zealand, culture isolated from living leaves of Cucurbitamaxima, date of collection and isolation unknown (deposited in Feb. 1977), H. J.Boesewinkel s.n., CBS 178.77.Notes: No specimens on plant material were available for this study.A description based on specimens from Cucumis, Cucurbita andCitrullus collected in Australia is provided by Priest (2006), and thesporulating structures observed in CBS 178.77 on OA agree wellwith that description. Septoria cucurbitacearum is the oldest nameon plants of the family Cucurbitaceae, and Punithalingam (1982)discussed the relationship with the other taxa on the host generaCucurbita and Cucumis. On the basis of the multilocus sequenceanalysis it can be concluded that S. cucurbitacearum is closelyrelated to S. lycospersici (CBS 354.49 and 128654), S. malagutii(CBS 106.80), and S. apiicola.Septoria digitalis Pass., Atti Soc. crittog. ital. 2: 36. 1879.Fig. 17.Description in planta (based on CBS H-18090): Symptoms leafspots hologenous, scattered, circular to elliptical, pale yellowishbrown, definite with a dark brown border, or indefinite, surroundedby a larger area of the leaf which turns reddish purple. Conidiomatapycnidial, epiphyllous, numerous scattered in each leaf spot,subglobose to globose, immersed, brown to black, (70–)85–130µm diam; ostiolum central, initially circular and 20–45 µm wide,later more irregular and up to 60 µm wide, surrounding cellsundifferentiated; conidiomatal wall about 12.5–20 µm thick,composed of an outer layer of isodiametric cells 4.5–8(–10) µmdiam or more irregular cells with brown walls 1–2 µm thick, andan inner layer of angular to globose cells 2.5–4(–6) µm diam withrelatively thin, hyaline walls. Conidiogenous cells hyaline, discrete,rarely integrated in 1-septate conidiophores, globose, doliiform orwww.studiesinmycology.org255

Verkley et al.Fig. 17. Septoria digitalis. A, B. Colonies CBS 328.67 (15 ºC, nUV). A. On OA. B. On MEA. C, D. Colonies CBS 391.63 (15 ºC, nUV). C. On OA. D. On MEA. E. Conidia on OA(CBS 328.67). Scale bars = 10 µm.ampulliform, holoblastic, proliferating sympodially and often alsopercurrently, with close indistinct annellations on an elongatedneck, 3–8.5(–10) × 2–3.5(–4.5) µm. Conidia filiform-cylindrical tocylindrical, straight to slightly curved, rarely somewhat flexuous,attenuated gradually to a narrowly rounded to pointed apex, andattenuated gradually or more abruptly to a narrowly truncatebase, 1–3(–4)-septate, not constricted around the septa, hyaline,contents with minute oil-droplets and granular contents in therehydrated state, (16.5–)22–44 × 1.5–2(–2.5) µm (rehydrated).Sexual morph unknown.Description in vitro (18 ºC, near UV light) CBS 328.67: Colonieson OA 12–13 mm diam in 2 wk, with an even to slightly ruffled,glabrous margin; colonies restricted to spreading, with some irregularpustulate elevations in the centre, immersed mycelium dark rust tochestnut, mostly covered by a more or less dense mat of low, woollyto woolly-floccose, greyish to somewhat reddish aerial mycelium,with scattered higher tufts, reverse blood colour; producing a redpigment diffusing into the surrounding agar medium. Colonies onMEA 10–13 mm diam in 2 wk, with an even margin which is mostlycovered by aerial mycelium; colonies restricted, irregularly pustulateand up to 2 mm high in the centre, immersed mycelium dark, entirelycovered by a dense mat of appressed, finely felted, grey to ochreousor rust aerial mycelium, the surface showing numerous sterile blackstromata; reverse dark brick or sepia in the centre, surrounded bydark violet slate. No sporulation or diffusing pigment observed. CBS391.63: Colonies on OA 23–25 mm diam in 2 wk, with an even,glabrous margin; colonies spreading, immersed mycelium fulvousto rust, or some brown-vinaceous, glabrous, or with barely anyaerial mycelium, no sporulation observed; reverse blood colour incentre, fading to red or coral towards the margin; producing somered pigment diffusing into the surrounding agar medium. Colonieson MEA 25–30 mm diam in 2 wk, with an even, undulating, glabrous,buff margin; colonies restricted to spreading, radially striate, up to 2mm high in the centre, immersed mycelium dark, entirely covered bya dense mat of appressed, finely felted, rosy vinaceous to flesh aerialmycelium with greysih or white zones ; reverse brown-vinaceous toblood colour. No sporulation or diffusing pigment observed.Conidia (OA) as in planta, 20–48(–52) × 1.5–2.5 µm.Hosts: Digitalis spp.Material examined: Czech Republic, South Bohemia, Písek, on Digitalis lanata,Sep. 1962 V. Holubová-Jechová, living culture CBS 391.63. Netherlands,Doornspijk, herbal garden, in leaf spot on D. lanata, 22 June 1967, H.A. van der Aa72, CBS H-18090, and dried culture on OA CBS H-18092, living culture CBS 328.67.Notes: The two strains investigated here showed some notabledifferences in colony features, and they are therefore describedseparately above. Nonetheless, these strains showed highlyhomologous sequences of all loci investigated here. The strainsare relatively distant from the closest relatives in the Septoriaclade,viz., among others, S. epilobii (CBS 109084, 109085), S.verbascicola (CBS 102401), and the strains of S. stachydis and S.galeopsidis. According to the original diagnosis, based on materialon Digitalis lutea, the conidia of S. digitalis are continuous, 25–30× 1.5 µm (also in Radulescu et al. 1973, Teterevnikova-Babayan1983). Although conidia observed in the material on D. lanatastudied here are up to 44 µm long and provided with up to 4 septa,it is concluded that the name S. digitalis can be applied to thismaterial.Septoria epilobii Westend., Bull. Acad. r. Belg., Cl. Sci., Sér.2, 19: 120. 1852 [non Roberge ex Desm. 1853]. Fig. 18.= S. epilobii Roberge ex Desm., Annls Sci. Nat., ser. 3, 20 : 94. 1853 [Nom.illeg., later homonym].?= S. epilobii Westend. var. durieui Unamuno, Boln R. Soc. esp. Hist. nat. 34:250. 1934.Description in planta: Symptoms leaf lesions sparse to numerous,single, circular to irregular, rarely entended to the margin of the leaf,brown, often with a greyish centre, well-delimited by a dark brownelevated line, visible on both sides of the leaf. Conidiomata pycnidial,epiphyllous, several in each lesion, subglobose to globose, brownto black, 48–75 µm diam; ostiolum central, circular, initially 15–24µm wide, later becoming more irregular and up to 40 µm wide,surrounding cells dark brown; conidiomatal wall 12–20 µm thick,composed of a homogenous tissue of hyaline, angular cells, 3–6.5µm diam, the outermost cells pale brown with slightly thickenedwalls, the inner cells hyaline and thin-walled. Conidiogenous cells256

A new approach to species delimitation in SeptoriaFig. 18. Septoria epilobii. A–C. Colonies CBS 109084 (15 ºC, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia in planta (CBS H-21171, epitype). E. Conidia andconidiogenous cells on OA (CBS 109094). Scale bars = 10 µm.hyaline, discrete, rarely also integrated in 1-septate conidiophores,cylindrical, or narrowly to broadly ampulliform, holoblastic,proliferating sympodially, sometimes with a relatively narrow andelongated neck (no annellations seen), 5–14 × 3.5–6 µm. Conidiacylindrical or filiform-cylindrical, straight to slightly curved, narrowlyto broadly rounded at the apex, narrowing slightly or more distinctlyto a truncate base, (0–)1–3-septate, not or slightly constrictedaround the septa, hyaline, contents with few minute oil-droplets andgranular material in each cell in the rehydrated state, 25–35(–40) ×1.5–2(–2.5) µm (rehydrated). Sexual morph unknown.Description in vitro: Colonies on OA 12–15(–17) mm diam in 3 wk(45–48 mm in 7 wk), with an even, glabrous, colourless or vaguelybuff margin; colonies spreading, plane, in the centre olivaceousblack,surrounded by olivaceous radiating hyphal strands; reverseconcolourous; aerial mycelium absent, or a tuft of white or greywoolly aerial mycelium in the centre; abundant olivaceous tobrown, then black, pycnidial conidiomata developing after 3 wk,releasing milky white droplets of conidial slime. Colonies on CMA12–14(–16) mm diam in 3 wk (45–50 mm in 7 wk), as on OA, butcentre more homogeneous olivaceous-black after 3 wk; after 7 wklarger outer area saffron to pale ochreous, margin buff; reverseconcolourous; sporulation as on OA, but older conidial slime palesaffron. Colonies on MEA (7–)10–16 mm diam in 3 wk (46–50 mmin 7 wk), with an even, glabrous, rosy-buff or buff margin; coloniesrestricted, conical, in the centre with more irregular pustulateprotruberances, after about 4 wk becoming more spreading, thesurface brown-vinaceous to almost black, locally ochreous to dirtypeach, covered by a diffuse, low, minutely felty whitish to grey aerialmycelium; reverse brown-vinaceous to dark slate blue, locallycinnamon to ochreous; conidiomatal initials developing from 3 wkonwards in most of the colonies, but sporulation occurs sparsely insubmarginal pycnidia after 7 wk in dirty white to rosy-buff droplets.Colonies on CHA 7–12(–16) mm diam in 3 wk (34–38 mm in 7 wk),as on MEA, including sporulation.Conidiomata as in planta, single or merged, with a single or afew papillate openings, which can be positioned on an elongatedneck; conidiogenous cells as in planta, proferating sympodially andpossibly also percurrently, but the presence of annellations couldnot be confirmed, 5–18 × 3.5–6 µm; conidia as in planta, 24–41 ×1.8–2.5 µm.Hosts: Chamaenerion angustifolium and Epilobium spp.Material examined: Austria, Tirol, Ober Inntal, Samnaun Gruppe, Zanderstal nearSpiss, alt. 1800 m, on rocky bank of Zandersbach, on living leaves of Epilobiumfleischeri, 11 Aug. 2000, G. Verkley 1068, epitype designated here CBS H-21171“MBT175355”, living cultures ex-epitype CBS 109084, 109085. Belgium, on thebank of river Wépion, near Namur, on leaves of E. spicatum (= E. angustifolium,Chamaenerion angustifolium), 1829, Bellynck, “Westendorp & Wallay Herb. Crypt.no. 727”, isotype BR-MYCO 158690-95. Netherlands, prov. Utrecht, Baarn,www.studiesinmycology.org257

Verkley et al.Baarnsche bos, ex leaf spot of E. angustifolium, 17 Sep. 1967, L. Marvanová s.n.,living culture CBS 435.67 no longer available (infected with basidiomycete).Notes: In the type specimen of S. epilobii on Epilobium angustifolium(= Chamaenerion angustifolium), from BR, 1–3-septate conidia, 20–40 × 1–1.5 µm are observed. Although the collection of S. epilobiifrom Tirol was collected on another host species, E. fleischeri, itagrees morphologically well with the type material, and thereforethis Austrian collection is chosen here as epitype. It is consideredlikely that a single taxon is capable of infecting various membersof the genera Epilobium and its sister-genus Chamaenerion. Theconcept of S. epilobii maintained here concurs with that of mostauthors (Radulescu et al. 1973, Teterevnikova-Babayan 1987),except Vanev et al. (1997), who gave a much wider length range ofconidia, viz., 12–72 ×1–2 µm, but their concept of S. epilobii mayerroneously have been based in part on specimens of S. alpicola.Septoria epilobii is very distinct from S. alpicola Sacc. 1897, aspecies causing systemic infections in Epilobium spp. in alpineand boreal regions (type host E. alpinum), developing pycnidia onsymptomless leaves as well as stems that produce conidia, 24–95× 0.7–1.5(–2) µm, with up to 7 septa (Jørstad 1965).Septoria epilobii var. durieui Unamuno, which has beendescribed from E. duriaei in Spain, with conidia 30–55 × 1.5 µm, istentatively placed here in the synonymy of S. epilobi.As can be seen in the multilocus phylogeny (Fig. 2), the strainsof Septoria epilobii are closely related to CBS 102401, which wasisolated from Verbascum nigrum, and preliminarily identified as S.verbascicola Berk. & M.A. Curtis. This name is a nomen nudum andthe type should be studied. Other closely related species include S.taraxaci (CBS 567.75), S. stachydis, S. galeopsidis, and S. digitalis.Septoria erigerontis Peck, Rep. N.Y. St. Mus. nat. Hist. 24:87. 1872 [non Berk. & M.A. Curtis 1874; nec Hollós 1926,later homonyms]. Fig. 19.≡ Septoria erigerontea Sacc., Syll. Fung. 3: 547. 1884 [nom. illeg., Art. 52.superfluous nom. nov.].= Septoria erigeronata Thüm., Bull. Soc. Imp. Nat. Moscou 56: 132. 1881.= Septoria schnabliana (Allesch.) Died., KryptogFl. M. Brandenb. 9: 454. 1914.≡ Rhabdospora schnabliana Allesch., Hedwigia 34: 273. 1895.= Septoria chanousii Ferraris, Malpighia 16: 27. 1902.= Septoria stenactidis Vill, in Sydow, Annls mycol. 8: 493. 1910.?= Septoria bosniaca Picb., Glasnik Zemal. Muz. Bosn. Herceg. 45: 68. 1933.Description in planta: Symptoms leaf spots hologenous, scattered,circular to irregular, pale brown, indefinite or surrounded bya slightly darker margin. Conidiomata pycnidial, epiphyllous,numerous scattered in each leaf spot, subglobose to globose,brown to black, semi-immersed, 75–130 µm diam; ostiolumcentral, initially circular and 15–35 µm wide, later more irregular,up to 55 µm wide, surrounding cells dark brown and with morethickened walls; conidiomatal wall about 8–12.5 µm thick,composed of a homogenous tissue of hyaline, angular cells 2.5–4µm diam with relatively thin, hyaline walls, surrounded by a layer ofpale to dark brown cells, 2–5 µm diam, with somewhat thickenedwalls. Conidiogenous cells hyaline, discrete, rarely integrated in1–2-septate conidiophores, cylindrical to doliiform, or narrowly tobroadly ampulliform, holoblastic, proliferating mostly sympodially,rarely also percurrently with indistinct annellations, 6–10 ×2.5–4.5 µm. Conidia filiform, straight, slightly curved to flexuous,attenuated gradually to a narrowly rounded to pointed apex andnarrowly truncate base, (0–)1–3(–5)-septate, not constrictedaround the septa, hyaline, contents with several minute oil-dropletsand granular material in each cell in the living state, with minuteoil-droplets and granular contents in the rehydrated state, (17–)25–50(–62.5) × 1–1.5(–2) µm (rehydrated). Sexual morph unknown.Description in vitro: Colonies on OA 8–11 mm diam in 12 d (42–44mm in 7 wk), with an even, glabrous, colourless to pale red orcoral margin, the pigment also clearly diffusing beyond the margin;colonies spreading, the surface almost plane, immersed myceliumtranslucent and red everywhere (12 d), in the centre with denselyaggregated superficial pycnidial conidiomata often with distinctpapillate to rostrate openings, which later may elongate further,pycnidia elsewhere in radiating rows, later also in concentricrings, releasing milky white to pale buff droplets of conidial slime;aerial mycelium white, felty, scanty, mostly in the centre; reverseconcolorous. Colonies on CMA 7–10 mm diam in 12 d (50–59 mm in7 wk), as on OA, but immersed hyphae darker and olivaceous, butred pigmentation still distinct, especially around the colony margin.Colonies on MEA 4–7 mm diam in 12 d (45–48 mm in 7 wk), with aruffled, colourless to pale buff, plane marginal zone; colony initiallyrestricted, hemispherical after 12 d, with an irregularly pustulatewortysurface, later for the most plane and spreading, immersedmycelium very dark chestnut to black, aerial mycelium on elevatedsurface almost absent, but near margin forming short-tufty mat ofpure white hyphae; superficial pycnidial conidiomata releasing paleflesh or milky white droplets of conidial slime. Colonies on CHA6–8 mm diam in 12 d (29–36 mm in 7 wk), as on MEA, but in somesectors with an even, rosy-buff margin; colonies less elevated inthe centre than on MEA, covered with diffuse, woolly, greyish aerialmycelium in the centre, and a low, dense mat of reddish hyphaenear the margin; pycnidial conidiomata more numerous than onMEA, later in distinct, concentric patterns, producing flesh, latersalmon droplets of conidial slime.Conidiogenous cells (OA) as in planta, but more frequentlyproliferating percurrently and with distinct annellations. Conidia asin planta, up to 85 µm long and 2.5 µm wide.Hosts: Conyza spp. and Erigeron spp.Material examined: Austria, Tirol, Inntal W of Innsbruck, S of Telfs, along road 171,on living leaves of Erigeron annuus, 4 Aug. 2000, G. Verkley 1045, CBS H-21176,living culture CBS 109094, 109095; same substr., country unknown, M. Vurro, livingculture CBS 186.93 (sub S. schnabliana). South Korea, Namyangju, same substr.,H.D. Shin, 3 May 2006, living culture SMKC 21739 = KACC 42356 = CBS 128606;same country, loc. unknown, same substr., living culture CPC 12340 = CBS 131893.Notes: The material available for this study agreed generallywell with the detailed descriptions given for this species in recentliterature (Shin & Sameva 2004, Priest 2006). However, Priest(2006) did not observe sympodial proliferation in the conidiogenouscells. Shin & Sameva (2004) reported conidia up to 70 µm longin material from South Korea. Verkley & Starink-Willemse (2004)already showed that the ITS sequence of CBS 186.93 identifiedas S. schnabliana is identical to that in S. erigerontis (CBS109094), and suspected the conspecificity of this material. Strongevidence for this conspecificity is provided here, as the additionalgenes sequenced were all (almost) identical for the three isolatesinvestigated, and also for CBS 128606 (= KACC 42356) and CBS131893 (= CPC 12340) from the same host in South Korea.According to the diagnosis, Septoria stenactidis, describedfrom Stenactis annua (= E. annuum), has continuous (orindistinctly septate) conidia, 35–40 × 1 µm, which agrees well withS. erigerontis on the type host, and it was already placed in thesynonymy by Jørstad (1965), and recently also by Priest (2006).Priest also included S. chanousii in the synonymy of S. erigerontis.258

A new approach to species delimitation in SeptoriaFig. 19. Septoria erigerontis. A–C. Colonies CBS 109094 (15 ºC, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia in planta (CBS H-21176). E. Conidia and conidiogenouscells on OA (CBS 109094). F, G. Conidia in planta (CBS H-21176). H, I. Conidia on OA (CBS 186.93). Scale bars = 10 µm.This fungus was originally decribed on E. uniflora in Italy, with3–4-septate conidia measuring 45–50 × 1.5 µm. Likewise,S. bosniaca from Erigeron polymorphus described in the diagnosisas a fungus with 0(–3)-septate conidia, 19–42 × 1.3–1.9 µm, isprobably also a synonym.www.studiesinmycology.org259

Verkley et al.Septoria galeopsidis Westend., Bull. Acad. r. Belg., Cl. Sci.,Sér. 2, 2: 577. 1857. Fig. 20.= Ascochyta galeopsidis Lasch in Rabenh., Herb. Myc. I, 1058. 1846 [nom.nud.].= Septoria cotylea Pat. & Har., Bull. Soc. Mycol. France 21: 85. 1905.Description in planta: Symptoms leaf spots irregular or angular,becoming dark brown, in yellow parts of the leaf lamina.Conidiomata pycnidial, hypophyllous, often numerous in eachleaf spot, globose to subglobose, dark brown, almost completelyimmersed, 75–100(–130) µm diam; ostiolum central, initiallycircular, 15–25 µm wide, surrounding cells somewhat darker;conidiomatal wall 10–22 µm thick, composed of textura angulariswithout distinctly differentiated layers, the cells 3–8 µm diam,the outer cells with brown, somewhat thickened walls, the innercells with hyaline and thinner walls. Conidiogenous cells discrete,sometimes integrated into 1–2-septate conidiophores, hyaline,narrowly or broadly ampulliform with a relatively narrow neck,holoblastic, proliferating percurrently with indistinct annellations,and also sympodially, 6–12(–15) × 3.5–5(–6) µm. Conidia filiform,straight or slightly curved, sometimes flexuous, with a rounded orsomewhat pointed apex, attenuated towards the narrowly truncatebase, (0–)3(–5)-septate, not constricted around the septa, hyaline,contents with several minute oil-droplets and granular material ineach cell in the living state, with inconspicuous oil-droplets andgranular contents in the rehydrated state, 20.5–44 × 1.5–2.5 µm(living; rehydrated, 1–2 µm wide). Sexual morph unknown.Description in vitro: Colonies on OA 7–13 mm diam in 2 wk (35–43mm in 6 wk), with an even, glabrous, colourless margin; coloniesalmost plane, immersed mycelium homogeneously olivaceousblackto greenish black (also near the margin); aerial myceliumscanty, woolly-floccose, white or greyish; superficial pycnidialconidiomata scanty, scattered over the central aerea, releasingmilky white droplets of conidial slime; reverse dark slate blue toblack. Colonies on CMA 7–13 mm diam in 2 wk (33–37 mm in 6wk), as on OA, but concentration of conidiomatal development inelevated pustules on the elsewhere flat colony. Colonies on MEA6–11 mm diam in 2 wk (33–39(–46) mm in 6 wk), the margin even,later undulating, buff, narrow and glabrous; colonies hemispherical,often irregularly pustulate or with columnar outgrowths up to 5mm high, immersed mycelium olivaceous-black to black, mostlycovered by a dense mat of finely velted, greyish aerial mycelium;faster growing, glabrous sectors with buff immersed mycelium mayappear after several weeks; conidiomata starting to develop onthe (dark) colony surface, tardily sporulating with whitish to fleshdroplets of conidial slime; reverse brown-vinaceous or olivaceousblack.Colonies on CHA 5–10(–15) mm diam in 2 wk (20–29 mmin 6 wk), with an even, glabrous to nearly so, buff margin; coloniesirregularly pustulate, immersed mycelium olivaceous-black, mostlycovered by a dense but appressed mat of woolly-floccose, greyaerial mycelium, in some slightly faster growing sectors pure white;scattered but scarce superficial conidiomata releasing pale fleshdroplets of conidial slime; reverse blood colour to black.Conidiomata pycnidial and similar as in planta, 100–150 µmdiam, or merged into larger complexes especially on the agarsurface, dark brown, up to 200 µm diam; ostiolum as in planta,or absent. Conidiogenous cells hyaline, ampuliform, or elongatedampulliform to cylindrical, with a distinct neck, holoblastic,proliferating percurrently with indistinct scars (annellations), orsympodially, 8–13(–15) × 3–4.5(–5) µm. Conidia cylindrical,straight or slightly curved, tapering to a rounded or somewhatpointed apex, lower part slightly or more clearly attenuated into abroad truncate base, (0–)1–3(–5)-septate, not constricted aroundthe septa, hyaline, with several oil-droplets and minute granularmaterial in each cell, (37–)50–65 (–70) × 2–2.5 µm.Hosts: Galeopsis angustifolia, G. ladanum, G. pubescens, G.speciosa and G. tetrahit.Material examined: Belgium, in the vicinity of Mons, on leaves of Galeopsis tetrahit,R. P. Clém. Dumont, distributed in Westendorp & Wallays, Herb. crypt. Belge, Fasc.23-24, no 1134, isotype BR-MYCO 158116-06. Czech Republic, Moravia, Mikulov,on living leaves of Galeopsis sp., 15 Sep. 2008, G. Verkley 6003, CBS H-21256,living cultures CBS 123744, 123749; same substr., date, Moravia, Milovice, forestMilovika stran, G. Verkley 6006, CBS H-21254, living cultures CBS 123745, 123746.France, Corrèze, Prât Alleyrat, on living leaves of G. tetrahit, 25 July 1976, H.A. vander Aa 5344, CBS H-18099; loc. unknown, isol. C. Killian ex Galeopsis sp., livingculture CBS 191.26. Netherlands, prov. Noord-Brabant, Cromvoirt, on living leavesof G. tetrahit, 2 June 1963, H.A. van der Aa s.n., CBS H-18097; prov. Gelderland,Putten, on living leaves of G. tetrahit, 8 Aug. 1984, G. de Hoog s.n., CBS H-18100;prov. Utrecht, Soest, on living leaves of G. tetrahit, 4 Aug. 1999, G. Verkley 902, CBSH-21195, living culture CBS 102314; prov. Limburg, St. Jansberg near Plasmolen,on living leaves of G. tetrahit, 9 Sep. 1999, G. Verkley 934, epitype designatedhere CBS H-21215 “MBT175356”, living culture ex-epitype CBS 102411. Romania,distr. Satu-Mare, Pir, on living leaves of G. ladanum, 27 Aug. 1973, G. Negrean s.n.,CBS H-18098.Notes: Jørstad (1965) reported comparable conidial size rangesin specimens on different host species, viz. G. speciosa (extremevalues 20–64 × 1–2.5 µm) and G. tetrahit (28–60 × 1–2 µm),although in most Norwegian collections on G. tetrahit, the maximumconidial length varied downwards to 48 µm. In the originaldiagnosis of S. galeopsidis conidia are described as 30–40 ×1–1.5 µm (Saccardo 1884), while Radulescu et al. (1973) reportedmeasurements ranging between 20–45 µm in length in collectionson various hosts. In the type material from BR investigated hereconidia are mostly 3–5-septate, 19–40 × 1.5–2 µm. In othermaterial available for the present study, maximum length of conidiawas only 44 µm in planta, whereas the strains obtained from it werecapable of forming conidia with a maximum length of 70 µm on OA.The differences with S. lamiicola are discussed under that species.Septoria galeopsidis is closely related to only some of the otherSeptoria species occurring on plants from the family Lamiaceae,especially S. melissae (CBS 109097) and S. stachydis. Septorialamiicola on Lamium spp., which is morphologically quite similarto S. galeopsidis, proves genetically very distinct, although thesetaxa can barely be distinguished by their ITS sequence (99.5 %).Several house-keeping genes do allow an easy identification ofthese species.Septoria heraclei (Lib.) Desm., Pl. crypt. Fr., Fasc. 11, no534. 1831. Fig. 21.Basionym: Ascochyta heraclei Lib., Pl. crypt. Ard., Cent. 1: no. 51.1830.≡ Cylindrosporium heraclei (Lib.) Höhn., Sber. Akad. Wiss. Wien, Math.-naturw. Kl. 115, I: 378. 1906 [non Oudem. 1873, nec Ellis & Everh. 1888].≡ Phloeospora heraclei (Lib.) Petr., Annls mycol. 17: 71. 1919 [non (Lib.)Maire, Bull. Soc. Mycol. France 46: 241. 1930].≡ Cylindrosporium umbelliferarum Wehm., Mycologia 39: 475. 1947.nom. nov.= Septoria heraclei-palmati Maire, Bull. Soc. Mycol. France 21: 167. 1905.Description in planta: Symptoms leaf spots numerous but small,irregular in outline, best visible on the upper side of the leaf,initially yellowish or ochreous, later becoming pale to dark brown,in places white due to loosening of the epidermis. Conidiomatapseudopycnidial, hypophyllous, one, rarely up to three in each260

A new approach to species delimitation in SeptoriaFig. 20. Septoria galeopsidis, CBS 102314. A–C. Colonies (15 ºC, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia on OA. E. Conidia and conidiogenous cells in planta(CBS H-21195). F–H. Conidia on OA (CBS 123744). Scale bars = 10 µm.leaf spot, lenticular, immersed, the upper wall rupturing in an earlystage and conidial masses breaking through the leaf epidermis,pale brown, 115–200 µm diam; ostiolum absent; conidiomatal wallabout 15–28 µm thick, composed of an outer layer of pale brownangular cells, 5–10 µm diam with somewhat thickened walls,and an inner layer of thin-walled, pale yellow angular to globosecells, 4.5–8 µm diam. Conidiogenous cells hyaline, discrete,rarely integrated in 1-septate conidiophores, cylindrical, or broadlyampulliform, holoblastic, proliferating percurrently one to severaltimes with distinct annellations, sometimes also sympodially,www.studiesinmycology.org261

Verkley et al.already considered this name as a synonym of S. heraclei. Otherauthors have mostly accepted S. heracleicola as a further Septoriaspecies on Heracleum, describing the conidia as continuous andranging roughly in size 20–40 × 1–2 µm (Radulescu et al. 1973,Teterevnikova-Babayan 1987, Vanev et al. 1997). Four furtherSeptoria and two Rhabdospora species have been described in theliterature based on material found on various members of the genusHeracleum, all of which according to their original descriptionshave conidia more or less within this range, so with much narrowerconidia than S. heraclei.Septoria hypochoeridis Petrov, Materialy po mikol. i fitopat.Rossii (Leningrad) 6 (1): 55. 1927. Fig. 22.Description in planta: Symptoms leaf spots scattered, 2–5 mmdiam, definite, circular, hologenous, grey to white in the centre,surrounded by a slightly elevated, dark reddish purple or blackzone. Conidiomata pycnidial, hypophyllous, one to a few in eachleaf spot, (sub)globose, immersed, dark brown, 60–95 µm diam;ostiolum central, circular, 15–28 µm diam, surrounded by darkercells; conidiomatal wall about 10–20 µm thick, composed of anouter layer isodiametric or more irregular cells, 5–10 µm diam,with somewhat thickened, pale brown walls, and an inner layerof thin-walled, hyaline angular to globose cells, 4.5–7 µm diam.Conidiogenous cells hyaline, discrete, cylindrical, or broadlyampulliform, holoblastic, proliferating sympodially, percurrentproliferation not observed, 8–15 × 3.5–4(–5.5) µm. Conidia filiform,straight to slightly curved, attenuated gradually to a somewhatpointed apex, or more abruptly just above the broadly truncatebase, 0–1(–2)-septate, not constricted at the septum, hyaline,contents with granular material in the rehydrated state, 15–24 ×1–1.5 µm (rehydrated). Sexual morph unknown.Fig. 21. Septoria heraclei, conidia and conidiogenous cells in planta (CBS H-21224).Scale bars = 10 µm.10–25 × 5–7(–8) µm. Conidia cylindrical, usually strongly curved,attenuated gradually to a blunt to somewhat pointed apex,attenuated gradually, or more abruptly just above the broadlytruncate base, (0–)1–2(–4)-septate, not or indistinctly constrictedaround the septa, hyaline, contents with numerous small oildropletsand granular material in each cell in the living state, withamorphous granular contents in the rehydrated state, 40–55(–70)× 4–6 µm (living; rehydrated, 3–5 µm wide).Description in vitro: Several attempts were made to isolate thisspecies but unfortunately no conidia survived after germination.Hosts: Heracleum spp.Material examined: Austria, Tirol, Ötztal, Ötz near Habichen, on living leaves ofHeracleum sphondylium, 24 July 2000, G. Verkley 1002, CBS H-21186. Netherlands,Prov. Limburg, Gulpen, near Stokhem, on living leaves of H. sphondylium, 28 June2000, G. Verkley 957, CBS H-21224; same substr., Prov. Limburg, upper edge ofSavelsbos, G. Verkley 959, CBS H-21225.Notes: The conidia of this fungus are much wider than in most otherSeptoria species on Apiaceae. Jørstad (1965) reported conidia 35–57 × 3–5 µm, usually with 1 septum. Vanev et al. (1997) observedconidia up to 85 µm long, and 1.8–3.5 µm wide. Septoria heracleipalmatiwas originally described from Heracleum palmatum inGreece, with 1-septate conidia, 50–70 × 3 µm. Jørstad (1965)Description in vitro: No cultures could be obtained. Conidia placedon MEA and OA died shortly after germination.Hosts: Hypochoeris radicata and other Hypochoeris spp.Material examined: New Zealand, North Island, Taupo distr., Tongariro Nat. Park,Taurewa, along road 47, on decaying leaf base of Hypochoeris radicata, 25 Jan.2003, G. Verkley 1871, CBS H-21234.Additional material examined: New Zealand, North Island, Taupo distr., Lake Taupo,shoreline E of Motutaiko Island, on living leaves of Crepis capillaris, 25 Jan. 2003,G. Verkley 1870, CBS H-21235.Notes: The material on Hypochoeris radicata from New Zealandagrees well with the original description and drawing of Septoriahypochoeridis; conidia are reported as continuous to 1-septate,19–22 × 1.5 µm. According to Teterevnikova-Babayan (1987), theconidia of this species can be somewhat larger, 20–25 × 1.5–2µm, and Hypochoeris grandiflora is also infected. Rhabdosporahypochoeridis was described from dead stems of H. radicata inGermany, with curved conidia, 16–30 × 0.6–1 µm, which, accordingto Priest (2006), is suggestive of a Phomopsis with β-conidia ratherthan a Septoria. Another species ocurring on this host and otherAsteraceae is Septoria lagenophorae, which occurs in associationwith Puccinia spp. and other fungi (Priest 2006). This fungus canbe distinguished from S. hypochoeridis by 1–2-septate conidia,15–32 µm long, and conidiogenous cells which are not proliferatingsympodially but produce successive conidia enteroblastically at thesame level through a narrow opening (Priest 2006), so appearingphialidic.262

A new approach to species delimitation in SeptoriaFig. 22. Septoria hypochoeridis, CBS H-21234. A, B. Conidia in planta. Scale bars = 10 µm.The collection on Crepis capillaris studied here may also belongto S. hypochoeridis, but no earlier reports from the host genus Crepishave been documented. This material agrees in all morphologicalcharacters with the collection on Hypochoeris, but the conidia lacksepta. It is certainly morphologically different from Septoria crepidis,which produces much larger, mostly 3-septate conidia [22–55 ×1.5–2(–2.5) cf. Shin & Sameva 2004]. The S. crepidis strains CBS128608 (= KACC 42396), 128619 (= KACC 43092) and 131895 (=CPC 12539) isolated from Crepis japonica (syn. Youngia japonica)in South Korea, group with CBS 128650, Septoria sp. (originallyidentified as S. taraxaci), but by lack of cultures and molecular datafor S. hypochoeridis the phylogenetic relationship with S. crepidisand allied Septoria remains to be resolved.Septoria lactucae Pass., Atti Soc. crittog. ital. 2: 34. 1879[non Peck, Bot. Gaz. 4: 170. 1879. Later homonym, nom.illeg. Art. 53]. Fig. 23.Description in vitro: Colonies on OA 8–9 mm diam in 2 wk, withan even to undulating, colourless margin; colonies spreadingto restricted, immersed mycelium pale luteous, without aerialmycelium, conidiomata developing immersed and on the agarsurface, mostly in the centre and in radiating rows, conidiomatareleasing milky white to rosy-buff conidial masses; reverse hazelwith a tinge of ochreous. Colonies on MEA 4.5–6 mm diam in 2 wk,with a minutely ruffled, buff margin; colonies restricted, irregularlypustulate, the surface almost black, with low and weakly developed,finely felted, white to grey aerial mycelium but also glabrous areasoccur; reverse chestnut to brown-vinaceous. No sporulationobserved.Conidia (OA) filiform to cylindrical, weakly to strongly curved,attenuated gradually towards the relatively broadly, more rarelynarrowly rounded apex, attenuated gradually or more abruptly toa truncate base, hyaline, (0–)1–3-septate, contents granular andsometimes also with minute oil-droplets, (22–)28–38.5(–46) ×2–2.5 µm (living). Sexual morph unknown.Hosts: Lactuca sativa and L. serriola.Material examined: Germany, Potsdam, on leaf of Lactuca sativa, 20 Nov. 1958,G. Sörgel 628, living culture CBS 352.58. Netherlands, on seed of L. sativa, Sep.2000, P. Grooteman s.n., living culture CBS 108943.Notes: Septoria lactucae is the oldest name described in Septoriafrom the host Lactuca sativa. Three others have been describedfrom lettuce (including two later homonyms), and another eight fromother species of the genus Lactuca. Symptoms of the minor leafspot disease of lettuce were described by Punithalingam & Holiday(1972). They describe the conidia as 1–2(–3)-septate, 25–40 ×1.5–2 µm. Muthumary (1999) examined the type and describedthe conidia as fusiform, straight to slightly curved, narrowed at thetip, truncate at the base, 1–3 septate, 32–52 (av. 35) × 2–2.5 µm.According to Jørstad (1965), conidia of S. lactucae are 19–48 ×1.5–2 µm with up to 2 septa, while Priest (2006) describes themas 1–3-septate, 22–33(–36) × 2–2.5(–3) µm. CBS 128757 (KACC43221) isolated from Sonchus asper in South Korea, and identifiedas Septoria sonchi, is very closely related and groups in a clusterwith 100 % bootstrap support with the strains of S. lactucae(Fig. 2).Septoria lamiicola Sacc., Syll. Fung. 3: 358. 1884. nom.nov. pro S. lamii Sacc., Michelia 1: 180. 1878. Fig. 24.≡ Septoria heterochroa Roberge ex Desm. f. lamii Desm., Annls Sci. Nat.,sér. 3, Bot. 8: 22. 1847.= Septoria lamii Westend., in Bellynck, Bull. Acad. Roy. Sci. Belgique 19: 63.1852.= Septoria lamii Pass., in Thüm., Mycoth. univ., Cent. 12, no 1183. 1878; AttiSoc. crittog. ital. 2: 37. 1879.Description in planta: Symptoms leaf spots circular to angular, whiteto pale brown, surrounded by a dark brown border. Conidiomatapycnidial, epiphyllous, several in each leaf spot, globose tosubglobose, dark brown, immersed to semi-immersed, 65–100µm diam; ostiolum central, initially circular, 20–35 µm wide, laterup to 50 µm wide, surrounding cells concolorous or somewhatdarker; conidiomatal wall 12–25 µm thick, composed of texturaangularis without distinctly differentiated layers, the cells 3.5–8µm diam, the outer cells with brown, somewhat thickened walls,the inner cells with hyaline and thinner walls. Conidiogenous cellshyaline, narrowly or broadly ampulliform with a relatively narrowwww.studiesinmycology.org263

Verkley et al.Fig. 23. Septoria lactucae. A–D. Colonies CBS 108943 (15 °C, nUV). A. On OA. B. On MEA. C. Colony margin on OA. D. Colony margin on MEA. E–I. Conidia on OA (CBS108943). Scale bars = 10 µm.neck, holoblastic, proliferating sympodially, and towards the apexoften also percurrently 1–many times with indistinct annellations,5–10(–12) × 3.5–4(–5) µm. Conidia filiform to filiform-cylindrical,straight or slightly curved, rarely flexuous, with a rounded orsomewhat pointed apex, attenuated towards the narrowly truncatebase, (0–)3(–5)-septate, not constricted around the septa, hyaline,contents with several minute oil-droplets and granular material ineach cell in the living state, with inconspicuous oil-droplets andgranular contents in the rehydrated state, (26–)35–50(–54) × 1.5–2.5( –3) µm (living; rehydrated, 1–2 µm wide; V1032, rehydrated,33–52 × 1.5–2). Sexual morph unknown.Description in vitro: Colonies on OA 8–14 mm diam in 2 wk (40–45mm in 6 wk), with an even, glabrous, colourless margin; coloniesplane, immersed mycelium colourless to pale primrose or buff, laterbecoming homogeneously dark herbage green, soon appearingdarker by numerous immersed and superficial pycnidial conidiomata,that release dirty white to rosy-buff conidial slime; aerial myceliumabsent, only developing in the centre after several wk as a sharplydelimited, dense, white, woolly floccose mat; reverse buff at themargin, inwards dark olivaceous-grey. Colonies on CMA 4–8 mmdiam in 2 wk (20–27 mm in 6 wk), with an even, glabrous margin;as on OA but immersed mycelium more honey to pale luteousthroughout, later becoming more greenish, the pycnidial conidiomataas on OA, but in more regular concentric rings, releasing rosy-buff,later salmon conidial slime. Colonies on MEA 7–9 mm diam in 2wk (28–33 mm in 6 wk), with an even (later undulating), glabrous,buff to honey margin; colonies pustulate to almost hemispherical,immersed mycelium rather dark, locally covered by woolly to feltywhite aerial mycelium; mostly composed of spherical conidiomatal264

A new approach to species delimitation in SeptoriaFig. 24. Septoria lamiicola, CBS 102329. A–C. Colonies (15 °C, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia in planta (CBS H-21181). E. Ibid. (CBS H-21216). F.Conidia and conidiogenous cells on OA (CBS 102380). Scale bars = 10 µm.initials, superficial mature conidiomata releasing a dirty white, laterbuff conidial slime; reverse dark brick in the centre, near the margincinnamon to honey. Colonies on CHA 8–14 mm diam in 2 wk (35–42mm in 6 wk), with an even, but later irregular, buff margin coveredby a diffuse, felty white aerial mycelium; further as on MEA, but thecolony surface less elevated, and more homogeneously coveredby diffuse, felty, white aerial mycelium; conidial slime abundantlyproduced, first milky white, later dirty honey; reverse in the centreblood colour, dark brick at the margin.Conidiomata pycnidial, first olivaceous, then almostblack, glabrous, 150–450 µm diam, with 1–5 ostioli placed onshort papillae or more elongated necks up to 350 µm long;conidiogenous cells as in planta, proliferating sympodially andmostly also percurrently with distinct annellations, 8–16 × 3–8µm; conidia cylindrical, straight or slightly curved, tapering to arounded apex, lower part slightly attenuated into a broad truncatebase, (0–)1–5-septate, not constricted around the septa, hyaline,with several oil-droplets and minute granular material in each cell,(34–)50–65(–70) × 2–3 µm.Hosts: Lamium album, L. maculatum, L. purpureum and severalother Lamium spp.Material examined: Austria, Tirol, Ötztal, Sulztal, Gries, alt. 1570 m, on living leavesof Lamium album, 1 Aug. 2000, G. Verkley 1032, CBS H-21181, living culturesCBS 109112, 109113. Czech Republic, Moravia, Pavlov, forest around ruin, onliving leaves of Lamium sp., 18 Sep. 2008, G. Verkley 6020, CBS H-21251, livingcultures CBS 123882, 123883, and 6021, CBS H-21252, living culture CBS 123884.Netherlands, prov. Limburg, St. Jansberg near Plasmolen, on living leaves of L.album, 9 Sep. 1999, G. Verkley 925, CBS H-21207, living cultures CBS 102328,102329; prov. Gelderland, Millingen aan den Rijn, Millingerwaard, on living leaves ofL. album, 6 Oct. 1999, G. Verkley 936, CBS H-21216, living cultures CBS 102379,102380.Notes: According to Jørstad (1965), conidia of S. lamiicola are3-septate, 24–60 × 1–2 µm, while Teterevnikova-Babayan (1987)reported 35–50 × 0.75–1.5 µm from seven Lamium species.For the current study, only fresh material on Lamium album wasavailable. Jørstad (1965) mentioned the resemblance of theconidia with those in S. galeopsidis, but also noted a differencein the wall thickness of the pycnidia, which we did not observe. Awww.studiesinmycology.org265

Verkley et al.much more profound difference is seen between cultures of thetwo species, with colonies of S. galeopsidis on OA being opaqueand dark olivaceous-black even at the margin, while colonies ofS. lamiicola are more translucent yellowish to ochreous, becomingdarker only due to the formation of pycnidia. Priest (2006) pointedtowards differences in conidial width and conidiogenesis betweenS. lamiicola and S. galeopsidis, but having compared both speciesmorphologically in planta and in vitro, we conclude that thesespecies cannot be distinguished using these criteria. These twospecies are, however, readily distinguished by DNA sequencedata, and the multilocus phylogeny provides evidence for a closerelationship with S. matricariae (CBS 109000, CBS 109001), whileother Septoria occurring on the same plant family as S. lamiicola(Lamiaceae) are all much more distant (Fig. 2). The Austrianand Dutch collections of S. lamiicola on L. album are sufficientlyhomogenous to consider them conspecific.Septoria leucanthemi Sacc. & Speg., in Saccardo, Michelia1: 191. 1878. Fig. 25.≡ Rhabdospora leucanthemi (Sacc. & Speg.) Petr., Sydowia 11: 351.1957.For addditional synonyms see Punithalingam (1967b).Description in planta: Symptoms leaf spots hologenous orepigenous, scattered, circular to irregular, pale to dull brownthroughout or with whitish central area, indefinite with concentriczones or delimited by a slightly darker margin. Conidiomatapycnidial, predominantly epiphyllous, numerous scattered in eachleaf spot, subglobose to globose, brown to black, semi-immersed,130–220(–240) µm diam; ostiolum central, circular, 35–100 µmwide, surrounding cells dark brown and with more thickenedwalls; conidiomatal wall about 8–12.5 µm thick, composed of ahomogenous tissue of hyaline, angular cells, 2.5–5 µm diam withrelatively thin, hyaline walls, surrounded by a layer of pale to darkbrown angular to more irregular cells, 3–6.5 µm diam with slightlythickened walls. Conidiogenous cells hyaline, discrete, rarelyintegrated in 1–2-septate conidiophores, cylindrical to doliiform,or ampulliform, holoblastic, proliferating percurrently with indistinctannellations, or sympodially, 6–18 × 4–6.5(–7.5) µm. Conidia filiformto filiform-cylindrical, straight, curved, sometimes slightly flexuous,attenuated gradually to a narrowly rounded to pointed apex, widestnear the base, where attenuating abruptly or more gradually into anarrowly truncate base, (5–)6–13-septate (later secondary septaare developed in some cells), not constricted around the septa,hyaline, contents with several minute oil-droplets and granularmaterial in each cell in the living state, with minute oil-droplets andgranular contents in the rehydrated state, (67–)80–100(–125) ×2.5–3.0(–3.5) µm (rehydrated). Sexual morph unknown.Description in vitro: Colonies on OA 6–8(–11) mm diam in 2 wk(11–14(–17) mm in 3 wk), with an even, glabrous, colourlessmargin; colonies spreading, the surface plane, immersed myceliumpale buff, later more or less rosy-buff; in the centre complexes ofpycnidial conidiomata with pale brown or olivaceous walls releasemasses of pale whitish to buff conidial slime; reverse concolorous,but honey in the centre. Colonies on CMA 9–11(–13) mm diam in2 wk (15–18 mm in 3 wk), as on OA, but with some white diffuseand high aerial hyphae in the centre, and later more elevated in thecentre; reverse in the centre hazel to fawn after 3 wk; conidiomatamuch more numerous and larger than on OA, developing inconcentric or random patterns as discrete, large acervuloid (lateralmost discoid to cupulate) stromata with olivaceous sterile tissues,releasing large masses of pale white to pale buff conidial slime.Colonies on MEA 7–10 mm diam in 2 wk (14–17 mm in 3 wk),with an even, colourless, glabrous margin; colonies restricted,irregularly pustulate to hemispherical, the bumpy surfaceconsisting of numerous protruding conidiomatal initials, appearingdark, with sepia, dark brick and cinnamon tinges, aerial myceliummostly absent, locally dense, pure white and woolly; reverse mostlysepia to fawn or vinaceous buff. Sporulation only observed afterabout 7 wk. Colonies on CHA 7–13 mm diam in 2 wk (15–20 mmin 3 wk), with an even, glabrous, pale vinaceous buff margin;colonies restricted, irregularly pustulate to conical, the surfacebumpy, immersed mycelium honey to hazel, covered by dense todiffuse, pure white, woolly aerial mycelium; conidiomata sparselydeveloping at the surface after 2 wk, the wall slightly darker thanthe surrounding hyphae, releasing pale white conidial slime (evenafter 3 wk); reverse cinnamon in the centre, vinaceous buff or paleochreous at the margin.Conidiomata and conidiogenous cells as in planta. Conidia asin planta, 5–13(–17)-septate, 70–125(–175) × 3–4 µm (OA).Hosts: Various species of the genera Chrysanthemum, Tagetes,Achillea, Centaurea and Helianthus (Waddell & Weber 1963,Punithalingam 1967b, c).Material examined: Austria, Tirol, Ober Inntal, Samnaun Gruppe, Böderweg onLazidalm, on living leaves of Chrysanthemum leucanthemum, 8 Aug. 2000, G.Verkley 1055, CBS H-21173, living cultures CBS 109090, 109091; Same substr.,Tirol, Zanderstal near Spiss, 11 Aug. 2000, G. Verkley 1069, CBS H-21170, livingcultures CBS 109083, 109086. Germany, Hamburg, on living leaves of Chr.maximum, Sep. 1958, R. Schneider s.n. CBS H-18111, living culture CBS 353.58 =BBA 8504 = IMI 91322. New Zealand, Coromandel distr., Coromandel peninsula,Waikawau, coast along St. Hwy 25, on living leaves of Chr. leucanthemum, 22 Jan.2003, G. Verkley 1826, CBS H-21247; same substr., North Island, Coromandel,Tairua Forest, along roadside of St. Hway 25, near crossing 25A, 23 Jan. 2003, G.Verkley 1842b, CBS H-21243, living culture CBS 113112.Notes: The six strains studied here showed minor differences inmorphological characters and DNA sequences, which show highestsimilarity to sequences of CBS 128621, an isolate originating fromCirsium setidens in South Korea, and identified as S. cirsii (Fig. 2).Septoria leucanthemi is also closely related to a number of otherSeptoria species from Asteraceae, such as S. senecionis and S.putrida (Senecio spp.), S. obesa (Chrysanthemum spp., Artemisia)and S. astericola (Aster sp.). It is confirmed here that Septoriaobesa, which has been regarded as a synonym of S. leucanthemiby Jørstad (1965), should be treated as a separate species (seealso the note on S. obesa).Septoria lycoctoni Speg. ex Sacc., Michelia 2 : 167. 1880.Fig. 26.Description in planta: Symptoms leaf spots epigenous, numerous,circular to irregular, single or confluent, white to pale greyish,surrounded by an initially red, then dark brown to black and thickenedborder. Conidiomata pycnidial, epiphyllous, inconspicuous, up to afew in each leaf spot, globose to subglobose, brown, immersed,90–145(–220) µm diam; ostiolum central, circular, more or lesspapillate, 25–55 µm wide; conidiomatal wall 17–35 µm thick,composed of textura angularis, differentiated layers absent, thecells mostly 3.5–5(–11) µm diam, the outer cells with brown,somewhat thickened walls, the inner cells with thinner, hyalinewalls. Conidiogenous cells hyaline, cylindrical, or elongatedampulliform with a relatively narrow neck which widens at the top,266

A new approach to species delimitation in SeptoriaFig. 25. Septoria leucanthemi. A–C. Colonies CBS 109090 (15 °C, nUV). A. On OA. B. On MEA. C. On CHA. D. Conidia and conidiogenous cells on OA (CBS 109090). E, F.Conidia in planta (CBS H-21243). G. Conidia on MEA (CBS 109090). Scale bars = 10 µm.hyaline, holoblastic, proliferating sympodially, 7–18 × 3.5–6 µm.Conidia filiform, straight, more often curved, sometimes flexuous,gradually attenuated to the pointed apex, more or less attenuatedtowards the broadly truncate base, (0–)2–5(–6)-septate, not orindistinctly constricted around the septa, hyaline, with several oildropletsand granular contents in each cell in the rehydrated state,26–47 × 1.5–2 µm (rehydrated; up to 2.5 µm wide in the livingstate). Sexual morph unknown.Description in vitro: Colonies on OA 9–11 mm diam in 2 wk (18–20mm in 3 wk), with an even, glabrous, colourless margin; immersedmycelium mostly coral to scarlet, the pigment diffusing into thesurrounding medium; in the centre black and slightly elevated withmostly superficial, glabrous pycnidia, surrounded by an area withmore scattered pycnidia, releasing pale white to pale flesh dropletsof conidial slime; aerial mycelium only present in the centre, butwell-developed, dense, appressed, woolly, white or greyish, locallywith a flesh haze; reverse scarlet to coral, the centre darker, bloodwww.studiesinmycology.org267

Verkley et al.Fig. 26. Septoria lycoctoni. A–C. Colonies CBS 109089 (15 °C, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia and conidiogenous cells in planta (CBS H-21155). E.Conidia on OA (CBS 109089). Scale bars = 10 µm.colour. Colonies on CMA 9–12 mm diam in 2 wk (17–19 mm in 3wk), as on OA, but pycnidia more numerous, usually only formed inthe centre of the colony. Colonies on MEA (3–)5–9 mm diam in 2 wk(13–18 mm in 3 wk), with an irregular margin; colonies restricted,the surface cerebriform to irregularly pustulate, up to 3 mm high,the surface pale brown, later black, at first almost glabrous, or(especially in brighter-coloured faster growing sectors/colonies)already covered by dense mat of pure white to flesh, woolly aerialmycelium, that later covers most of the colony surface; largemasses of honey or pale amber conidial slime locally emergingfrom immersed conidiomata; reverse of the colony either dark brickor luteous to ochreous, paler towards the margin. Colonies on CHA8–13 mm diam in 2 wk (15–19(–22) mm in 3 wk), with an even orundulating, colourless margin mostly hidden under aerial hyphae;immersed mycelium greenish grey, grey-olivaceous to olivaceousblack,throughout covered by well-developed, tufty whitish greyaerial mycelium that later shows a reddish haze; reverse bloodcolour, but margin paler; in the central part of the colony numerouspycnidia develop, releasing pale whitish to rosy-buff conidial slime;in older colonies the central surface becomes cerebriform andabout 3 mm high, much like on MEA.Conidiomata as in planta, pycnidial with barely protrudingostioli, which later often grow out to elongated necks up 50–150 µmlong; on CMA less differentiated and fairly large, opening by tearingof the upper wall; conidiogenous cells as in planta, but larger, 9–25× 3.5–7.5 µm, proliferating sympodially and also percurrently, butannellations on the necks are inconspicuous; conidia similar inshape as in planta but longer, 3–5(–6)-septate, 30–75 × 1.5–2.5µm.Hosts: Aconitum vulparia (= A. lycoctoni), A. anthora, A.conversiflorum and several other Aconitum spp.Material examined: Austria, Ober Inntal, Samnaun Gruppe, Lawenalm nearSerfaus, alt. 2000 m., on living leaves of Aconitum vulparia (syn. A. lycoctonum), 8Aug. 2000, G. Verkley 1053, CBS H-21155, living culture CBS 109089.268

A new approach to species delimitation in SeptoriaNotes: In the diagnosis of S. lycoctoni, the conidia weredescribed as “indistinctly multiseptate”, measuring 25–35 × 1.5–2 (Saccardo 1884). This fungus was found on A. lycoctonum inItaly. Teterevnikova-Babayan (1987) gave conidial size ranges of25–70 × 1–2 µm for this species, and she included several of thevarieties which were described after 1880, viz., var. sibirica 1896,var. macrospora 1909, var. anthorae 1928. Petrak (1957) observedconidia 20–60 (rarely 70 to 80) × 1.5–2 µm in his collection onAconitum moldavicum.The colonies of Septoria lycoctoni and S. napelli look verysimilar on all media tested, although in S. napelli more red pigmentseems to be produced than in S. lycoctoni, and the conidial slimeis salmon rather than flesh. The two species can more readily bedistinguished from each other by the shape of their conidia. InS. lycoctoni, the mature conidia only attenuate towards the apexabove the uppermost septum, while in S. napelli, the tapering ofthe conidium walls is visible below the second septum from thetop. The difference between the conidia of these species is alsoclear on the plant. Because the conidia of S. napelli are wider, thesepta and the attenuations are easier to observe. In the case ofS. lycoctoni the apical attenuation of conidia is not so clear, whichmay explain why Petrak (1957), who compared this species also tocollections identified as S. napelli (but for reasons explained belowprobably misidentified), circumscribed the conidia of S. lycoctoni asnot-attenuated.The strains of S. napelli (CBS 109104–109106) originatingfrom Aconitum napellus and CBS 109089 of S. lycoctoni are veryclosely related and form a monophyletic group in the multilocusphylogeny (Fig. 2).Septoria lysimachiae (Lib.) Westend., Bull. Acad. r. Belg.,Cl. Sci., Sér. 2, 19: 120. 1852. Fig. 27.Basionym: Ascochyta lysimachiae Lib., Pl. Crypt. Ard. Fasc. 3, 252.1834.Description in planta: Symptoms leaf lesions indefinite, usually onlya few scattered over the leaf lamina, or a single one, most oftendeveloping from the tip to the petiole, greyish to reddish brown.Conidiomata pycnidial, epiphyllous, immersed, subglobose toglobose, black, 95–120(–165) µm diam; ostiolum central, circular,initially 25–35 µm wide, later becoming more irregular and up to90 µm wide, surrounding cells concolourous; conidiomatal wall10–20 µm thick, composed of an outer layer of angular to irregularcells mostly 4.5–10 µm diam with pale to orange brown walls,and an inner layer of isodiametric, hyaline cells 3–6 μm diam.Conidiogenous cells hyaline, discrete, rarely integrated in 1-septateconidiophores, cylindrical, or narrowly to broadly ampulliform,holoblastic, proliferating sympodially, and often also percurrentlyshowing 1–3 indistinct annellations on a neck-like protrusion, 8–15× 3–5(–6) µm. Conidia cylindrical to filiform-cylindrical, slightly tostrongly curved, rarely somewhat flexuous, narrowly rounded topointed at the apex, attenuated gradually or more abruptly towardsa narrowly truncate base, (0–)3–5, later with secondary septadividing the cells, conidia sometimes breaking up into smallerfragments in the cirrhus, not or slightly constricted around the septa,hyaline, containing several large oil-droplets and granular materialin the living and rehydrated state, (28–)35–70(–88) × 2.5–3.5 (–4)µm (living; rehydrated, 2.0–3 µm wide). Sexual morph unknown.Description in vitro: Colonies on OA rather variable in growth speedand pigmentation, 3.5–7 mm diam in 1 wk (20–26 mm in 2 wk),with an even, glabrous, colourless margin; colonies spreading,flat,immersed mycelium first mostly buff, then either rosy-buff topale salmon turning olivaceous or hazel, or long colourless andlater becoming olivaceous-black to greenish black; aerial myceliumwoolly-floccose, white or greyish, mostly developing only in thecentre; reverse olivaceous-black to greenish grey or dark slate blueto black. Conidiomata developing scarcely immersed in the agar,producing small amounts of conidia that are released as rosy-buffdroplet. Colonies on CMA 2–4 mm diam in 1 wk (15–20 mm in 3wk), as on OA, but centre of the colony somewhat elevated, andcolourlous marginal zone narrow, immersed mycelium becomingmore rapidly pigmented with a vinaceous buff tint, in the centrebecoming brown-vinaceous; reverse hazel, in the centre almostblack. Colonies on MEA 3.5–6 mm diam in 1 wk (8–17(–19) mmin 3 wk), with an even to slightly ruffled, buff to rosy-buff, glabrousmargin; some strains with a more uneven outline, strongly fimbriate,with faster growing deeply immersed mycelium often extendingwell beyond the colony margin at the level of the agar surface;colonies spreading, but often distinctly elevated or irregularlypustulate in the centre; immersed mycelium variable in colour, buff,ochreous or brownish, and in the faster growing sectors often witha glaucous haze; aerial mycelium diffuse to dense, pure white,(vinaceous) greyish or brownish, finely felted to woolly; reverseversicoloured, margin and parts of faster growing sectors buff tohoney, in other parts darker, hazel to brown-vinaceous, sometimesmostly olivaceous-black. Some strains show a conspicuous haloof diffusing reddish pigment (CBS 108996, 108997). Scarce darkconidiomata beginning to develop in the centre after 1 wk, releasingpale white droplets of conidial slime after about 3 wk. Colonies onCHA 2–4(–6) mm diam in 1 wk [18–24(–26) mm in 21 d], with aneven or slightly ruffled, glabrous, colourless to buff margin; coloniesirregularly pustulate, immersed mycelium olivaceous-black; aerialmycelium soon covering most of the colony, woolly-floccose, smokegrey with an olivaceous haze, locally grey-olivaceous, in slightlyfaster growing sectors sometimes pure white; reverse mostlybrown-vinaceous. Superficial, blackish conidiomata in the centrereleasing pale rosy-buff to white masses of conidial slime after 1wk; reverse mostly blood colour, or fawn and brown-vinaceous inthe centre.Conidia (OA) cylindrical, slightly to strongly curved to flexuous,narrowly rounded to somewhat pointed at the apex, attenuatedgradually or more abruptly towards a truncate base, mostly3–7(–11)-septate, including the soon formed secondary septa, cellssoon loosing their turgesence and often separating into smallerfragments, in the turgescent state constricted around the septa,hyaline, with many vacuuoles and also containing several large oildropletsand granular material in the living state and rehydratedstate, (30–)40–80–(90) × 2.5–3.5 (–4) µm (living; rehydrated NT2.0–3 µm wide).Hosts: Lysimachia spp.Material examined: Belgium, near Namur, on leaves of Lysimachia vulgaris,Bellynck, isotype BR-MYCO 145978-90, also distributed in M. A. Libert, Pl. Crypt.Ard. Fasc. 3, no. 253. Czech Republic, Mikulov, on living leaves of Lysimachiasp., 15 Sep. 2008, G. Verkley 6004, CBS H-21255, living cultures CBS 123794,123795. Netherlands, Prov. Utrecht, Baarn, De Hooge Vuursche, in the forest, onL. vulgaris, 22 June 2000, G. Verkley 955, epitype designated here CBS H-21227“MBT175357”, living cultures ex-epitype CBS 108998, 108999; Prov. Utrecht, Soest,Stadhouderslaan near monument “De Naald”, on living leaves of L.vulgaris, 4 Aug.1999, G. Verkley 903, CBS H-21196, living culture CBS 102315; Prov. Gelderland,Amerongen, Park Kasteel Amerongen, on living leaves of L. vulgaris, 11 July 2000,G. Verkley 971, CBS H-21230, living culture CBS 108996, 108997.www.studiesinmycology.org269

Verkley et al.Fig. 27. Septoria lysimachiae. A–C. Colonies (15 °C, nUV). A. CBS 123794 on OA. B. CBS 108998 on MEA. C. Ibid., colony margin on MEA. D. Conidia in planta (CBSH-21196). E. Conidia on OA (CBS 108998). F. Conidia in planta (CBS H-21196). G. Conidia on OA (CBS 108998). H. Conidia on OA (CBS 108999). Scale bars = 10 µm.Notes: Shin & Sameva (2003) provided a detailed description ofS. lysimachiae (conidia 35–80 × 1.5–2.5 µm, 3–7-septate). In thetype material from BR the conidia are mostly 3–5-septate, 25–72× 2.5–3.5 µm, and very similar in shape to those observed in thematerial that was collected from the field for the present study. Theisolates show more variation in colony characters than observed inmost other species of Septoria, but this phenotypic heterogeneity isneither reflected in the sporulating structures nor in the sequencedata obtained. The EF, Btub and RPB2 gene sequences proved100 % identical among strains originating from the Netherlands270

A new approach to species delimitation in SeptoriaFig. 28. Septoria matricariae. A. Conidiaand conidiogenous cells in planta (CBSH-21228). B. Conidia on OA (CBS109001). Scale bars = 10 µm.(CBS 102315, 108998 and 108999) and Czech Republic (CBS123794, 123795), while differences found between the Dutch andCzech isolates for Cal and Act were only 3 (99.3 % similarity) and 1bp (99.6 %), respectively. It is concluded therefore that the materialstudied belongs to a single species. Septoria saccardoi, basedon material from Lysimachia vulgaris in Italy, is characterised bycylindrical, curved, 3-septate conidia, 38–40 × 3.5 µm (Saccardo1906). Quaedvlieg et al. (2013) describe this species in detailbased on an isolate originating from of Lysimachia vulgaris var.davuricai in Korea (CBS 128665 = KACC 43962) and because it isdistant to other septoria-like fungi, they propose a new genus nameto accommodate it, Xenoseptoria. CBS 128758, isolated from L.clethoroides in Korea was identified as S. lysimachiae, but basedon sequence analyses it is a distant fungus belonging in the genusSphaerulina.Septoria matricariae Hollós, Annls Mus. nat. Hung. 8: 5.1910 [non Syd. 1921; nec Cejp, Fassatiova & Zavrel, Zpravy153: 13. 1971; later homonyms]. Fig. 28.= S. chamomillae Andrian., Mikol. i Fitopat. 30: 10. 1996. Nom. nov. pro S.matricariae Syd., Annls mycol. 19: 143. 1921; nom. illeg. Art. 53 [non Marchal& Sternon, 1923].?= S. chamomillae Marchal & Sternon, Bull. Soc. r. Bot. Belg. 55: 50. 1922.Description in planta: Symptoms lesions indefinite, leavesbecoming affected from the top towards base, discolouringto yellow and brown. Conidiomata pycnidial, amphigenous,numerous, more or less evenly dispersed over the affected area,globose to subglobose, dark brown to black, immersed, 75–125(–150) µm diam; ostiolum central, circular, often papillate, breakingthrough the leaf epidermis, 25–43(–50) µm wide, surrounding cellsconcolorous or somewhat darker; conidiomatal wall 10–20 µmthick, composed of textura angularis without distinctly differentiatedlayers, the cells 2–6 µm diam, the outer cells with yellowishbrown, thickened walls, the inner cells with hyaline, also relativelythick walls; Conidiogenous cells hyaline, discrete or integrated in1–2-septate conidiophores up to 17.5 µm long, doliiform, narrowlyto broadly ampulliform, holoblastic, proliferating sympodially and/or also percurrently with one or two indistinct annellations, 3.5–10× 3–4.5(–5.5) µm. Conidia filiform, straight, curved or slightlyflexuous, attenuated gradually towards a relatively narrowlyrounded to pointed apex, barely attenuated towards the broadlytruncate base, indistinctly (1–)2–3(–6)-septate, not or indistinctlyconstricted around septa, hyaline, contents with a few minute oildropletsand granular material in each cell in the living state, withinconspicuous oil-droplets and granular contents in the rehydratedstate, 41–58 × 2–3 µm (living; rehydrated, 1.5–2.4 µm wide).Sexual morph unknown.Description in vitro: Colonies on OA 19–24 mm diam in 3 wk (44–48mm in 6 wk), with an even, glabrous, colourless margin; coloniesspreading, the surface plane, immersed mycelium olivaceous-blackwww.studiesinmycology.org271

Verkley et al.to very dark dull green, with numerous dark, radiating hyphae,almost entirely glabrous, few tufts of greyish aerial myceliumin the centre; numerous scattered single or complex pycnidialconidiomata developed already after 1 wk, with a single ostiole orseveral papillate or rostrate openings, from which pale rosy-buffdroplets of conidial slime are released; reverse concolourous.Colonies on CMA 16–18(–20) mm diam in 3 wk (38–50 mm in 6wk), as on OA. Colonies on MEA 9–12(–14) mm diam in 3 wk (27–39 mm in 6 wk), with an even to slightly ruffled buff margin; coloniesrestricted, conical and up to 3 mm high after 3 wk, immersedmycelium near the margin grey-olivaceous, but most of the colonysurface iron grey to greenish black, the outer areas mostly coveredby a low but dense, finely felted, grey aerial mycelium, the centrealmost glabrous; superficial semi-immersed conidiomata releasingpale whitish droplets of conidial slime after 2–3 wk; reverse mostlydark slate blue with olivaceous areas. Colonies on CHA 16–22 mmdiam in 3 wk (39–46 mm in 6 wk), as on MEA, but conidiomatamore numerous, releasing pale whitish to pale rosy-buff droplets orcirrhi of conidial slime, and reverse with a brown-vinaceous tinge.Conidiomata as in planta, pycnidial with a single ostiolum,dark brown to black, rarely merged into complex fruitbodies;conidiogenous cells as in planta, but larger and more oftenintegrated in 1–3-septate conidiophores, 10–15(–23) × 3–6(–7)µm; conidia as in planta, but longer, 36–78(–90) × (1.6–)1.7–2.2µm, contents several oil-droplets in each cell.Hosts: Matricaria spp.Material examined: Netherlands, prov. Limburg, Zuid-Limburg, along roadside nearSavelsbos, on living leaves of Matricaria discoidea (= M. matricarioides), 28 June2000, G. Verkley 960, CBS H-21228, living cultures CBS 109000, 109001. Romania,Suceava, Siret, on leaves of M. discoidea, 7 July 1969, distributed in Contantinescu& Negrean, Herb. mycol. Romanicum Fasc. 40, no. 199, CBS H-18115.Notes: The phylogenetic analyses indicate that S. matricariae isclosest to S. lamiicola, yet rather distant from other Septoria occurringon Asteraceae. The indefinite lesions caused by this speciesare reminiscent of those developed by S. stellariae on Stellariamedia. The leaves seem to whither more rapidly and pycnidiadevelop soon after discolouration of the leaf tissues starts. Stemsare not affected. In the original diagnosis of S. matricariae, basedon material from Matricaria discoidea in Hungary, the conidia aredescribed as continuous and 40–60 × 2–2.5 µm. The Dutch and alsothe Romanian material studied here contain conidia with mostly 1–3septa, but otherwise agree well with Hollós’ description of the type.According to Radulescu et al. (1973) the conidia in material from thesame host plant are also continuous, measuring 25–50 × 1.5–2 µm.As in several other Septoria spp., the septa in S. matricariae are noteasy to observe, and Hollós and others may have overlooked them.Sydow described a Septoria under the same name fromMatricaria chamomilla in Germany with multiseptate conidia 30–60× 1–1.5 µm. The name he proposed was illegitimate because it isa later homonym of S. matricariae Hollós, as is also S. matricariaeCejp et al.. Septoria chamomillae was also described from M.chamomillae in Belgium and has 3–5-septate conidia 35–52 × 1–2µm. Although we have not seen the types of either of these names,we consider them tentatively as synonyms of S. matricariae.Septoria melissae Desm., Annls Sci. Nat., sér. 3, Bot., 20:87. 1853. Fig. 29.≡ Phloeospora melissae (Desm.) Parisi, Bull. Bot. R. Univ. Napoli 6: 292.1921.Description in vitro: Colonies on OA 12–13 mm diam in 2 wk, withan even to slightly ruffled, mostly colourless margin; coloniesrestricted to spreading, somewhat elevated in the centre, immersedmycelium greenish black, with greenish hyphal strands radiating intoor even beyond the colourless margin, the surface mostly glabrousor provided with very diffuse, finely felted, grey aerial hyphae,the elevations in the centre bearing tufts of more well-developed,grey aerial mycelium; conidiomata developing mostly in the centreimmersed or on the agar surface, releasing pale rosy to rosy-buffconidial slime. No diffusing pigment observed. Colonies on MEA5–7(–9) mm diam in 2 wk, with a slightly ruffled margin; coloniesrestricted, pustulate with cerebriform elevations in the centre, thesurface black, covered by a diffuse to dense mat of finely felted,mostly grey aerial mycelium; reverse very dark brown-vinaceous.Conidiomata sparsely developing on the colony surface, releasingdirty reddish brown conidial slime. A very faint pigment is visiblearound the colony.Conidiogenous cells (OA) globose to ampulliform, holoblastic,hyaline, discrete or integrated in 1(–2)-septate conidiophores,proliferating sympodially, percurrent proliferation not observed,4–10 × 3–5 µm. Conidia filiform, straight to flexuous, weakly tomore strongly curved, attenuated gradually to a narrowly rounded,typically pointed apex, attenuated gradually to a narrowly truncateto somewhat rounded base, hyaline, with fine granular material andminute oil-droplets, (0–)3(–5)-septate, (22–)30–50(–61) × 1.5–2µm. Sexual morph unknown.Host: Melissa officinalis.Material examined: Netherlands, Baarn, garden Eemnesserweg, on living leavesof Melissa officinalis, 11 Sep. 2000, H.A. van der Aa s.n. (G. Verkley 1073), CBSH-21169, living cultures CBS 109096, 109097.Notes: This species is the only Septoria described from the genusMelissa. The type material originates from Melissa officinalis inFrance (not seen). According to the short original diagnosis, S.melissae produces conidia 30 × 1.6 µm, and no septa were reported.Radulescu et al. (1973) described the conidia as continuous or with1–3 septa, 25–38 × 1.6 µm. These measurements agree quitewell with those given by Teterevnikova-Babayan (1987; 28–38× 1.5 µm), but Vanev et al. (1997) gave a much wider range ofmeasurements, 20.5–58 × 1.5–2.2 µm (septa 2–5). GeneticallyCBS 109097 is very closely related to S. galeopsidis, but a 5 bpinsertion found in the Btub gene is absent in all sequenced strains ofS. galeopsidis. Septoria melissae can furthermore be distinguishedin culture from S. galeopsidis by the narrower conidia on OA (1.5–2µm, in S. galeopsidis 2–2.5 µm), and the conidiogenous cells,which only proliferate sympodially and not percurrently.Septoria napelli Speg, Decades mycologicae italicae I-XII:no. 117. 1879; Atti Soc. crittog. ital., Ser. 2, 3: 69. 1880. Fig.30.≡ Rhabdospora napelli (Speg.) Petr., Sydowia 11: 376. 1957[misapplication].Description in planta: Symptoms leaf spots hologenous, circular toirregular, single, white to pale greyish, surrounded by a first red,then black, relatively wide border, often completely blackening thenarrow leaflets. Conidiomata pycnidial, epiphyllous, rarely alsohypohyllous, conspicuous, one to many in each leaf spot, globoseto subglobose, black, semi-immersed, 100–150(–200) µm diam;ostiolum central, circular, initially 15–25 µm wide, later opening272

A new approach to species delimitation in SeptoriaFig. 29. Septoria melissae, CBS 109097. A–C. Colonies (15 °C, nUV). A. On OA. B. On MEA. C. On MEA, detail of colony margin. D. Conidia and conidiogenous cells on OA.E–F. Conidia on OA. Scale bars = 10 µm.more widely; conidiomatal wall 15–28 µm thick, composed oftextura angularis, differentiated layers absent, the cells mostly4–10 µm diam, the outer cells with brown, somewhat thickenedwalls, the inner cells with hyaline and thinner walls. Conidiogenouscells hyaline, cylindrical, broadly to narrowly ampulliform, with adistinct neck of variable length, hyaline, holoblastic, with severaldistinct percurrent proliferations, more rarely also sympodial aftera sequence of percurrent proliferations of the same cell, 10–22 ×3.5–8 µm. Conidia filiform, straight, more often irregularly curved,gradually attenuated to the pointed apex, weakly or more distinctlyattenuated towards the broadly truncate base, (3–)4–5(–7)-septate,not constricted around the septa, hyaline, with several relativelylarge oil-droplets and also minute granular contents in each cell inthe rehydrated state, 59–80 × (1.5–)2–3.5 µm (rehydrated; up to 4µm wide in the living state). Sexual morph unknown.Description in vitro: Colonies on OA 9–15 mm diam in 2 wk (45–53mm in 49 d), with an even, glabrous, colourless margin; immersedmycelium coral to scarlet, with pigment diffusing beyond thecolony margin; colony becoming black in the centre and somewhatelevated due to superficial pycnidia, surrounded by an area withmore scattered pycnidia, releasing flesh to salmon droplets ofconidial slime; aerial mycelium well-developed and dense in thecentre, appressed, woolly, white to pale grey; reverse scarlet tocoral, in the centre blood colour. Colonies on CMA 8–12 mm diamin 2 wk (62–65 mm in 49 d), as on OA. Colonies on MEA 5–9 mmdiam in 2 wk (38–44 mm in 49 d), the margin irregular; coloniesrestricted, with a cerebriform surface, becoming about 5 mm high,the surface soon black, first almost glabrous, later mostly coveredby a dense mat of white to flesh, woolly aerial mycelium; honeyor amber conidial slime masses are released from immersedpycnidia; reverse of the colony dark brick or luteous, paler towardsthe margin. Colonies on CHA 8–13 mm diam in 2 wk (55–58 mmin 49 d), with an even or undulating, colourless margin, partlyhidden under aerial hyphae; immersed mycelium grey-olivaceousor olivaceous-black, covered with well-developed, grey and partlygreenish glaucous, later reddish, aerial mycelium; reverse bloodcolour, the margin paler; in the central part of the colony numerouspycnidia develop, releasing rosy-buff conidial slime.Conidiomata as in vitro pycnidial, ostioli initially barely protruding,but later often growing out to form elongated necks up to 100 µmlong; on CMA conidiomata less differentiated, sometimes withoutostiolum and opening by tearing of the upper wall; conidiogenouscells as in planta, but larger, 10–32 × 3.5–8.5(–10) µm, proliferatingsympodially and also percurrently, with distinct annellations on theelonated necks. Conidia similar in shape as in planta but longer,5–7(–11)-septate, 64–95(–118) × 2–3.5(–4) µm.Hosts: Aconitum spp.www.studiesinmycology.org273

Verkley et al.Fig. 30. Septoria napelli. A–C. Colonies CBS 109104 (15 °C, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia and conidiogenous cells on OA (CBS 109104). E. Conidiain planta (CBS H-21153). Scale bars = 10 µm.Material examined: Austria, Ober Inntal, Samnaun Gruppe, Zanderstal near Spiss,alt. 1800 m., on living leaves of Aconitum napellus, 11 Aug. 2000, G. Verkley 1070,CBS H-21153, living cultures CBS 109104, 109105; same loc., host, date, G. Verkley1071, CBS H-21154, living culture CBS 109106. Romania, reg. Mureş-AutonomăMaghiară, on living leaves of A. degenii, 25 Aug. 1953, C. Sandu-Ville s.n., CBSH-18117, distributed in Herb. Mycol. Romanicum, fasc. 35, no. 1742.Notes: According to the brief original diagnosis, S. napelli ischaracterised by 120–130 µm wide hypophyllous pycnidia,and indistinctly septate conidia measuring 50–100 × 2–4 µm.Teterevnikova-Babayan (1987) reported up to 9-septate conidiameasuring 40–100 × 3–4 µm, and Shin & Sameva (2004)3–9-septate conidia, 40–105 × (2.5–)3–5 µm in Korean material.It is doubtful whether the description by Petrak (1957) of S. napelliwas based on correctly identified material. Pycnidia of that funguswere mostly hypophyllous, with 3–7, rarely 8–9-septate conidiameasuring 40–70 (rarely up to ca. 100) × 3–4 µm, arising fromseptate and branched conidiophores. The pycnidial wall wascomposed of globose to angular cells 5–8(–10) µm diam, withwalls thickened to an extent which would avoid any compression.Petrak (1957) also observed young fruitbodies of a sexual morphon dead leaves in between old and empty conidiomata. Althoughthis sexual morph was immature, in his opinion it was “undoubtedlyPleosporaceae, perhaps a species of Leptosphaeria, but certainlynot Mycosphaerella”. Certain similarities in the walls of the asexualand sexual morph, made him suspect that they were produced indifferent stages in the life-cycle of a single fungus. Because of thelarge size of the pycnidia of Petrak’s S. napelli, the structure ofthe pycnidial wall and conidial ontogeny, which were unlike typicalSeptoria, he proposed the combination Rhabdospora napelli.Petrak’s observations of S. napelli probably pertained to a differentseptoria-like fungus (Stagonospora?), probably with pleosporaleanaffinities, but of which the exact identity remains unclear.274

A new approach to species delimitation in SeptoriaThe fungus studied in the present study, which is a member ofthe Septoria clade, generally agrees with the original descriptionof S. napelli. It is unknown whether S. napelli has a sexual morph.Two Mycosphaerella names have been published from Aconitum,M. antonovii on Aconitum excelsum in Siberia, and M. aconitorum,on Aconitum sp. in Austria. Both names were introduced byPetrak, who did not observe associated asexual morphs for theseMycosphaerella spp. A comparison with S. lycoctoni, including themolecular results, is provide above in the notes on S. lycoctoni.CBS 128664 isolated from Aconitum pseudolaeve var. erectumin Korea, is genetically distinct from both Septoria spp. on Aconitumin Europe. The new name S. pseudonapelli is proposed for thisfungus by Quaedvlieg et al. (2013, this volume).Septoria obesa Syd., in Syd. & P. Syd., Annls mycol. 12:163. 1914.= S. artemisiae Unamuno, Assoc. españ. Progr. Cienc. Congr. Salamanca: 46.1923 [nom. illeg., later homonym, non Passerini, 1879].Descriptions in planta are provided by Punithalingam (1967c) andPriest (2006). Sexual morph unknown.Hosts: Artemisia lavandulaefolia and Chrysanthemum spp.Material examined: Germany, Weihenstephan, on Chrysanthemum indicum, R.Schneider Sep. 1957, living culture CBS 354.58 = BBA 8554 = IMI 091324. SouthKorea, Hongcheon, on Artemisia lavandulaefolia, H.D. Shin, 28 June 2006, livingculture SMKC 21934 = KACC 42453 = CBS 128588; Bonghwa, on Chr. indicum,H.D. Shin, 18 Oct. 2007, living culture SMKC 23048 = KACC 43193 = CBS 128623;Jeju, on Chr. morifolium, 5 July 2008, living culture KACC 43858 = CBS 128759.Notes: Jørstad (1965) regarded S. obesa as a synonym of S.leucanthemi, as both have similar conidial morphologies andoccur on several Chrysanthemum spp. Punithalingam (1967b, c),however, recognised S. obesa and S. leucanthemi as separatespecies, noting that the conidia of S. obesa are consistently widerthan those of S. leucanthemi. Verkley & Starink-Willemse (2004)found additional, molecular support for the treatment.as separatespecies in eight polymorphisms found on the ITS sequencesof strains representing these species. Further evidence is nowprovided here based on sequences of six other loci. The hostranges of the two species are also different: S. leucanthemiis capable of infecting various species of a wide range plantgenera, viz. Chrysanthemum, Tagetes, Achillea, Centaurea andHelianthus (Waddell & Weber 1963, Punithalingam 1967b).Septoria obesa seems to mainly infect Chrysanthemum spp.,but it does also infect Artemisia lavendulaefolia, as could bedemonstrated in this study with CBS 128588, a strain originallyidentified as S. artemisiae. The strain is genetically very close tothe other strains of S. obesa studied here and therefore regardedas conspecific. The conidia produced by CBS 128588 are in goodagreement with S. obesa as well, being much larger than in S.artemisiae (30–33 × 1.5 µm, according to the original diagnosisof S. artemisiae Passerini). The later homonym S. artemisiaedescribed by Unamuno based on material on Artemisia vulgarisin Spain with 4-septate conidia 35.5–52.5 × 2.5–3 µm, is placedhere in the synonymy of S. obesa.The conidia of the sunflower pathogen S. helianthi (50–85 ×2–3 μm) are similar to those of S. obesa (50–90 × 2.5–3.5 μm, cf.Priest 2006), but they can be distinguished by the number of septaformed, viz., seldom more than 5 in S. helianthi and 5–11 septa inS. obesa. Verkley & Starink already showed that ITS sequences ofthese species differ by more than 20 base positions, which is alsosupported by the results found in the present study for other genes(Fig. 2).Septoria paridis Pass., Atti Soc. crittog. ital. 2: 41. 1879. Fig.31.Description in planta: Symptoms leaf spots single, scarce, circular toirregular, white to pale ochreous, surrounded by a vague orange toreddish brown zone, visible on both sides of the leaf, decaying to shotholes.Conidiomata pycnidial, epiphyllous, one to a few in each leafspot, globose, black, immersed, 60–100 µm diam; ostiolum central,circular and 35–40 µm wide, surrounding cells concolorous to slightlydarker; conidiomatal wall up to 15 µm thick, composed throughout ofhyaline, angular cells, 2.5–5 µm diam, the outermost cells brown withsomewhat thickened walls, the inner cells hyaline and thin-walled.Conidiogenous cells hyaline, discrete, globose, doliiform, or broadlyampulliform, holoblastic, proliferating percurrently several times withdistinct annellations thus forming a relatively narrow neck, rarelyalso sympodially, 5–8(–11) × 2.5–5 µm. Conidia filiform, straight, orslightly curved, attenuated gradually to a narrowly pointed apex anda narrowly truncate base, 0–3-septate (septa very thin and easilyoverlooked), not constricted around the septa, contents with severalminute oil-droplets and granular material in each cell in the livingstate, with minute oil-droplets and granular contents in the rehydratedstate, (18–)20–28.5(–34) × 1–1.5(–2) µm (living; rehydrated, 1 µmwide). Sexual morph unknown.Description in vitro: Colonies on OA 8–11 mm diam in 10 d (30–35mm in 3 wk; more than 75 mm in 7 wk), with an even, glabrous,colourless margin; immersed mycelium mostly homogeneouslypale coral to pale red, some pigment diffusing beyond the colonymargin, olivaceous to greenish hyphal radial strands also weaklyor more strongly developing in some sectors or entire colonies(especially after 7 wk, when most of the red pigment is no longervisible); in the centre olivaceous-black and slightly elevated dueto superficial and immersed pycnidia, surrounded by an area withmore scattered pycnidia, releasing pale whitish droplets of conidialslime; aerial mycelium very scanty, few minute white tufts; reverseolivaceous-black to greenish grey, surrounded by coral to siennaareas. Colonies on CMA 7–10 mm diam in 10 d (28–33 mm in 3wk; more than 75 mm in 7 wk), as on OA, but the colonies soonerpigmented, dark green, dark blueish green or olivaceous, and ared pigment tardily formed, but more persistent and still well visibleafter 7 wk. Sporulation as on OA. Colonies on MEA 6–11 mmdiam in 10 d (23–30 mm in 3 wk; 64–75 mm in 7 wk), the margineven, glabrous, buff; colonies spreading, but the centre elevated,irregularly pustulate, up to 2 mm high, the surface dark greyishbrown, later black, covered by short felty white aerial mycelium,or higher tufts; reverse of the colony brown-vinaceous or sepia,paler towards the margin. Pycnidia mostly superficial, in densegroups. Colonies on CHA 5–8 mm diam in 10 d (28–35 mm in 3 wk;45–55 mm in 7 wk), with an even to ruffled, glabrous, colourless tobuff margin; immersed mycelium in areas where first sporulationoccurs becoming dark, greenish grey to dark slate blue, latermore throughout colony, covered by well-developed, tufty whitishgrey aerial mycelium that later shows a reddish haze; reverseolivaceous-black to sepia, but margin paler; in the central part ofthe colony numerous pycnidia develop; in older colonies the centrebecomes up to 3 mm high.Conidiomata (OA) as in planta, immersed or developing onthe agar surface, single or merged into complexes 100–220 µmwww.studiesinmycology.org275

Verkley et al.Fig. 31. Septoria paridis. A–C. Colonies (15 °C, nUV). A. On OA (CBS 109110). B. On CHA (CBS 109110). C. On MEA (CBS 109108). D. Conidia and conidiogenous cells inplanta (CBS H-21177, Paris quadrifolia). E. Ibid. (CBS H-21152, Viola palustris). F. Conidia on OA (CBS 109108). Scale bars = 10 µm.diam, superficial pycnidia mostly forming one to several elongatednecks, initially pale brown, then almost black, releasing pale whitishconidial slime, later becoming rosy-buff. Conidiogenous cells asin planta, 7–12(–14) × 2.5–5 µm. Conidia as in planta but someconsiderably longer, 22–38(–45) × 1–1.5 µm.276

A new approach to species delimitation in SeptoriaHosts: Paris quadrifolia, P. incompleta and Viola palustris.Material examined: Austria, Tirol, Leutaschtal Weidach, on river bank, on livingleaves of Paris quadrifolia, 2 Aug. 2000, G. Verkley 1038, CBS H-21177, livingcultures CBS 109110, 109111; Tirol, Ötztal, Sölden, near Hoch-Sölden, on livingleaves of Viola palustris, 31 July 2000, G. Verkley 1037, CBS H-21152, livingcultures CBS 109108, 109109.Notes: According to the original description, conidia of S. paridisare 20 × 1 µm and aseptate. Vanev et al. (1997) describe theconidia as 18–25 × 1–1.3 µm, Teterevnikova-Babayan (1983),20–25 × 1 µm. As is seen in several other Septoria, the conidiacan reach considerably greater length in culture than on the naturalhost plant. In shape of the conidia the species strongly resemblesS. galeopsidis and S. scabiosicola, as do the cultures, although S.galeopsidis does not produce a red pigment on OA. The material onViola palustris (Violaceae) collected in Tirol was initially identifiedas S. violae-palustris, but based on the DNA sequence analysesof seven loci (Fig. 2) and the agreeing phenotype it is concludedthat the material is conspecific with S. paridis. This is the first reportof this fungus on another host genus than Paris, and also outsidethe Liliaceae. A second Septoria occurring on Paris quadrifolia isS. umbrosa. That species differs from S. paridis by much largerconidia, 30–85 × 3–4.5 µm, which are 5–7-septate.Septoria passifloricola Punith., CMI Descr. PathogenicFungi & Bacteria no. 670. 1980.≡ S. passiflorae Louw, Sci. Bull. Dept. Agric. For. Un. S. Africa 229: 34.1941. Nom. illeg. Art 53 [non Syd., Annls mycol. 37: 408. 1939].Description in vitro: Colonies on OA 12–15 mm diam in 2 wk, withan even, glabrous, buff margin; colonies spreading, immersedmycelium mostly homogeneous orange, but no diffusion ofpigments beyond the margin observed; the surface covered byappressed, greyish white to grey aerial mycelium developing inconcentric areas, beneath which mostly superficial, dark brownto almost black pycnidia or more complex conidiomata develop,releasing pale whitish to dirty greyish droplets of conidial slime;reverse orange to sienna. Colonies on CMA 10–14 mm diam in 2wk, as on OA. Colonies on MEA 5–7(–10) mm diam in 2 wk, with aneven, weakly lobed, black margin, which may be covered by shortfluffy, pure white aerial mycelium; colonies spreading but elevatedat the centre, the surface almost black, with immersed conidiomatalcomplexes soon covered by masses of first pale white, buff, andthen brick conidial slime; the central area later entirely coveredby cerebriform, brick masses of slime; reverse brick to almostvinaceous, and fawn. Colonies on CHA 8–10(–14) mm diam in2 wk, with an even, buff margin covered by a diffuse, felty aerialmycelium; further as on MEA, but surface less elevated, and largelycovered by diffuse, felty, grey-white aerial mycelium; conidialslime as on MEA abundantly produced from similar conidiomatalcomplexes, but more intensely pigmented, deep scarlet; reverseblood colour.Conidiogenous cells (OA) hyaline, discrete, broadlyampulliform to cylindrical, holoblastic, with one or two indistinctpercurrent proliferations (sympodial proliferation not observed),8–14 × 3–6 µm; conidia filiform, hyaline, narrowly rounded at thetop, attenuated to a truncate base, straight to somewhat curved,1–2(–3)-septate, not constricted around the septa, mostly 10–30(–35) × 1.5–2(–2.5) µm.Host: Passiflora edulis.Material examined: Australia, Victoria, Wonthaggi, on Passiflora edulis, Mar. 2011,C. Murdoch, living culture CBS 129431. New Zealand, Auckland, Mt Albert, onliving leaves of P. edulis, 21 Feb. 2000, C. F. Hill MAF LYN-118a, living culture CBS102701.Notes: Priest (2006) provided a description of the fungus on thehost, and discussed the nomenclature. He also mentioned theanonymous reporting of a Septoria state observed in ascosporeisolates from a Mycosphaerella sp. found on fruits lesions, butwhether this truly is the sexual morph of S. passifloricola remainsto be corroborated. The multilocus phylogeny (Fig. 2) providesevidence of a close relationship with S. ekmanniana (CBS 113385,113612) and S. chromolaenae (CBS 113373), and also S. sisyrinchii(CBS 112096) and S. anthurii (CBS 148.41, 346.58).Septoria petroselini (Lib.) Desm., Mem. Soc. Roy. Sci. Lille1843: 97. 1843. Fig. 32.Basionym: Ascochyta petroselini Lib., Pl. Crypt. Arduenna 3: 252.1834.≡ Phleospora petroselini (Lib.) Westend., Bull. Acad. r. Bruxelles 12 (9):252. 1845.Description in planta: Symptoms leaf spots indefinite, without adistinct border, pale brown, visible on both sides in green partsof leaves or barely discoloured petioles. Conidiomata pycnidial,numerous, mostly epiphyllous, semi-immersed, black, mostly80–200 mm diam, with a central, first narrow, later wider opening,releasing pale white cirrhi of conidia; conidiomatal wall composedof one or two layers of brown-walled, angular cells, lined by alayer of hyaline cells. Conidiogenous cells hyaline, discrete,holoblastic, sympodially or percurrently proliferating, ampulliform,6–10 × 3–6 mm. Conidia hyaline, filiform, straight to somewhatflexuous, the upper cell tapered into the obtuse apex, relativelywidely truncate at the base, (1–)3–5(–7) septate, not or onlyindistinctly constricted at the septa, contents granular or withminute oil-droplets around the septa and at the ends, 29–80 ×1.9–2.5 mm (living; rehydrated, 1.2–1.5 mm wide). Sexual morphunknown.Description in vitro (18 °C, near UV) CBS 109521: Colonies onOA 13–16 mm diam in 2 wk, with an even, colourless margin;colonies spreading, immersed mycelium mostly pale ochreous,soon appearing dull green due to the development of dark greenhyphal strands, particularly in a discontinuous submarginalzone; reverse in the centre ochreous to fulvous, surrounded byolivaceous-grey. Conidiomata developing after 5–7 d immersedin the agar or on its surface, most numerous in the centre of thecolony, releasing milky white to rosy-buff conidial slime. Conidiaalso produced directly from mycelium near the centre of thecolony. Colonies on MEA 17–20 mm diam in 2 wk, with an evento somewhat ruffled, buff margin; colonies spreading to restricted,somewhat elevated towards the centre, the surface black withmany stromata developing and releasing milky white droplets ofconidial slime, aerial mycelium diffuse to more dense and low,grey; reverse mostly greenish grey to iron-grey, in the centre withfawn to dark brick haze.Conidiomata and conidiogenous cells as in planta. Conidia(OA) filiform to filiform-cylindrical, straight, flexuous or curved,attenuated gradually to the narrowly rounded to pointed apex,attenuated gradually or more abruptly to the narrowly truncatebase, (0–)3–5(–7)-septate, 30–54(–65) × 2–2.5(–3) µm.www.studiesinmycology.org277

Verkley et al.Fig. 32. Septoria petroselini. A, B. Colonies CBS 109521 (15 °C, nUV). A. On OA. B. On MEA. C, D. Conidia on OA (CBS 109521). E. Conidia and conidiogenous cells in planta(CBS H-21166). F. Conidia on OA (CBS 182.44). G. Conidia on OA (CBS 109521). Scale bars = 10 µm.Hosts: Petroselinum crispum (syn. Apium petroselinum), otherPetroselinum spp. and Coriandrum sativum (Priest 2006).Material examined: Netherlands, Prov. Utrecht, Baarn, garden Eemnesserweg 90,on living leaves of Petroselinum crispum, 29 Mar. 2001, H.A. van der Aa 12642,CBS H-21166, living culture CBS 109521; Laren, on living leaves of P. sativum, June1944, S. Dudok de Wit s.n., living culture CBS 182.44 = IMI 100279, dried specimenof culture on CMA, CBS H-18128.Notes: CBS 182.44, isolated from Petroselinum sativum, producesconidia 29–49 × 1–2 µm, and this range of sizes agrees withthose given for S. petroselini by most authors [26–45(–52) ×(1–)1.5–2 µm cf. Priest 2006; 16–46 × 1–2 mm cf. Jørstad 1965on Petroselinum]. In contrast, the conidia in the collection on P.crispum (CBS H-21166), as well as in the isolate CBS 109521derived from it, were up to 80 µm long and 2.5 µm wide, and thepycnidia were also larger than described for S. petroselini, for whichthis material was initially identified as S. apiicola, but the moleculardata provide evidence that it also belongs to S. petroselini. Thematerial is 100 % homologous on ITS, Act, RPB2 and EF, and99.7 % on Cal with CBS 182.44. The range of conidial sizes for S.petroselini is therefore expanded here, although it should be notedthat the conidia formed in vitro are not over 65 µm in length in thematerial available. The ITS sequence of S. anthrisci is distinct fromthat of S. apiicola, but identical to that of S. petroselini and otherspecies. Septoria anthrisci can be distinguished from S. petroseliniby the Act, EF and RPB2 sequences.Septoria phlogis Sacc. & Speg., in Sacc., Michelia 1: 184.1878 [as “phlocis”; non Ellis & Everh., in G. Martin, J. Mycol.3: 85. 1887; nec P. Syd., Mycoth. March., Cent. 18, no 1757;Cent. 23, no 2278. 1887; later homonyms]. Fig. 33.Description in planta: Symptoms leaf lesions developing in areasof the leaf lamina that first turn yellow, indefinite or delimited bydarkening veinlets, hologenous, pale to dark brown. Conidiomatapycnidial, epiphyllous, numerous, semi-immersed to immersed,subglobose to globose, dark brown to black, 100–160 µmdiam; ostiolum central, circular, initially 25–35 µm wide, laterbecoming more irregular and up to 70 µm wide, surrounding cellsconcolourous; conidiomatal wall 15–28 µm thick, composed of anouter layer of isodiametric to irregular cells mostly 5–9 µm diamwith pale brown cell walls up to 2 μm thick, and an inner layer ofhyphal to isodiametric cells 3–5 μm diam with thin, hyaline walls.Conidiogenous cells hyaline, discrete or integrated in 1–2-septateconidiophores up to 22 µm long, cylindrical, or narrowly to broadlyampulliform, holoblastic, often proliferating percurrently withindistinct annellations as well as sympodially, 5–7.5(–8) × 2.5–4(–5) µm. Conidia cylindrical, filiform, straight to slightly curved,278

A new approach to species delimitation in SeptoriaNotes: Priest (2006) described the conidia of S. phlogis as filiform,1–4-septate, straight to curved, (35–)50–73 × (1–)1.5–2 µm,hyaline, with a truncate base and obtuse apex. He accepted S.divaricatae as a separate species, with Phlox drummondi (syn. P.divaricata) as the only known host plant, and S. drummondi as asynonym. Septoria divaricatae has similarly shaped but smallerconidia than S. phlogis, 1–3-septate, (13–)25–40(–45) × 1–1.5µm. The overlap in length of the conidia of the two is minimal, atleast on the host plant, indicating that they might be truly separatetaxa. Several other authors have also accepted S. divaricatae asa distinct entity (Teterevnikova-Babayan 1987, Muthumary 1999).However, Jørstad (1965) considered S. divaricatae a synonym ofS. phlogis, and also S. phlogina. Both S. phlogis and S. divaricataeoccur on P. drummondi and this may have contributed to theconfusion. Investigations based on fresh material on different Phloxspecies, and studies of cultures derived thereof, as well as typematerial of the names mentioned above, will be required in order tosettle the complicated taxonomy of Septoria on Phlox.Molecular identification of S. phlogis is straight-forward, as allprotein-coding genes investigated here, particularly Btub, Cal andRPB2, show unique diagnostic sequences. Septoria epambrosiae(CBS 128629, 128636) is a sister species to S. phlogis. Septoriaepambrosiae is a pathogen of Ambrosia artemisiifolia (Asteraceae),which today is the prime cause of hay fever in many areas wherethis weed occurs.Fig. 33. Septoria phlogis. Conidia and conidiogenous cells in planta (CBS H-21198).Scale bars = 10 µm.narrowly rounded to somewhat pointed at the apex, attenuatedgradually or more abruptly towards the narrowly truncate base,(0–)1–3(–4)-septate, not constricted around the septa, hyaline,containing minute oil-droplets and granular material in the livingand rehydrated state, (22–)32–50(–60) × 1.5–2 µm (rehydrated;living, 2–2.5 µm wide). Sexual morph unknown.Description in vitro: Colonies on OA 15–18 mm diam in 19 d, with aneven, glabrous, buff to rosy-buff margin; colonies spreading, plane;immersed mycelium variably pigmented over sectors, usually eitherbrownish olivaceous, or cinnamon to saffron (honey with a reddishhaze); aerial mycelium scanty, white, locally forming a diffuse woollyfloccosemat; reverse olivaceous-black and cinnamon or saffron.Colonies on CMA 13–18 mm diam in 19 d, as on OA. Colonies onMEA 12–17 mm diam in 19 d, with an even, glabrous, buff margin;colonies spreading, the surface mostly plane, only somewhatelevated or folded towards the centre; immersed mycelium mostlydark salmon to olivaceous-black, covered by a dense, appressedmat of woolly, mostly white to faintly rosy-buff aerial mycelium; anochreous pigment diffuses into the surrounding medium; reversemostly sienna or blood colour, with an ochreous to saffron margin.Colonies on CHA 12–18 mm diam in 19 d, as on MEA.Hosts: Phlox spp.Material examined: Netherlands, Prov. Noord-Holland, Enkhuizen, on living leavesof Phlox sp., 6 Sep. 1949, J.A. von Arx s.n., CBS H-4862; Prov. Utrecht, Baarn,Cantonspark, on living leaves of Phlox sp., 27 Aug. 1999, G. Verkley 911, CBSH-21198, living culture CBS 102317; same substr., Jan. 1932, D. Moll s.n., livingculture CBS 312.32; Garden in Baarn, same substr., 16 Oct. 1990, H.A. van der Aa10919, CBS H-18130, living culture CBS 577.90; same substr., loc., 27 Aug. 1997,H.A. van der Aa 12302, CBS H-18131.Septoria polygonorum Desm., Annls Sci. Nat., sér. 2,Bot.17: 108. 1842. Fig. 34.≡ Spilosphaeria polygonorum (Desm.) Rabenh., Herb. Mycol. II, no.442a. 1856.Description in planta: Symptoms leaf spots small, circular,hologenous, ochreous to brown, sharply delimited by a dark redbrownzone. Conidiomata pycnidial, mainly epiphyllous, severalto many developed in each leaf spot after some time, subgloboseto lenticular, not protruding strongly, brown to almost black, 50–120 µm diam; ostiolum central, initially circular and 25–45 µmwide, surrounding cells concolorous to somewhat darker brown;conidiomatal wall about 10–25 µm thick, composed of angularcells 2.0–6.5 µm diam, the outermost cells pale yellowish brownwith somewhat thickened walls, the inner cells thin-walled.Conidiogenous cells hyaline, discrete, narrowly or broadlyampulliform with a relatively wide neck, holoblastic, often firstproliferating sympodially, and later also percurrently 1–several timeswith distinct annellations, 5–10(–14) × 3.–5.5(–6.5) µm. Conidiafiliform to filiform-cylindrical, straight or slightly curved, or flexuous,attenuated gradually to a narrowly rounded to pointed apex,attenuated more abruptly towards the truncate base, 1–4-septate,not or only inconspicuously constricted around the septa, hyaline,contents with several minute oil-droplets and granular material ineach cell in the living state, with inconspicuous oil-droplets andgranular contents in the rehydrated state, (17–)22–45(–53) × 1.5–2µm (living; rehydrated, 1.2–1.8 µm wide). Sexual morph unknown.Description in vitro: Colonies normally slow-growing, but sometimeswith fast-growing sectors (diam including these between brackets)on all media except MEA. On OA 3–5 [6–7] mm diam in 2 wk [6–7(22–30) mm in 6 wk], the margin regular, glabrous, colourless;colonies spreading, plane, immersed mycelium olivaceous-black,but grey-olivaceous to greenish grey in faster growing sectors thatsometimes develop from typically slow-growing colonies; aerialmycelium generally absent or very scanty, but woolly-floccosewww.studiesinmycology.org279

Verkley et al.Fig. 34. Septoria polygonorum. A–C. Colonies CBS 102331 (15 °C, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia and conidiogenous cells in planta (CBS H-21212). E.Ibid., on OA (CBS 108982). F, G. Conidia on OA (CBS 347.67). Scale bars = 10 µm.appressed on the above mentioned sectors; white conidialslime produced from numerous, scattered pycnidial or stromaticconidiomata; reverse dark slate blue to olivaceous-black. Colonieson CMA 4–5 (6–7) mm diam in 2 wk [5–7 (22–27) mm in 6 wk], ason OA, with similar fast-growing sectors. Colonies on MEA 3–4 mmdiam in 2 wk (6–8 mm in 6 wk), the margin regular, glabrous, barely280

A new approach to species delimitation in Septoriavisible; colonies irregularly pustulate to hemispherical, immersedmycelium olivaceous-black to black, glabrous, the surface bearingnumerous droplets of milky white to dirty buff conidial slime emergingfrom scattered pycnidial conidiomata; reverse olivaceous-black toblack. Colonies on CHA 3–5 mm diam in 2 wk [7–10 (22–26) mm in6 wk], the margin distinctly ruffled, glabrous, ochreous to greyish;colonies irregularly pustulate, immersed mycelium olivaceousblack,lacking aerial mycelium; milky white to dirty buff conidialslime emerging from scattered pycnidial conidiomata; reverseblood colour.Conidiomata (OA) as in planta, single and pycnidial, brownto black, glabrous, 85–150 µm diam, with a single ostiolum up to50 µm wide, rarely also merged into multilocular stromata up to300 µm diam which may have several openings; conidiogenouscells as in planta, proliferating sympodially and/or percurrently,9–20 × 4–7 µm; conidia as in planta but longer, 30–65(–72) ×1.5–2(–2.2) µm.Hosts: Polygonum spp.Material examined: Austria, Tirol, Ötztal, Sautens, on living leaves of Polygonumpersicaria, 30 July 2000, G. Verkley 1024, CBS H-21213, living culture CBS 108982.Netherlands, prov. Utrecht, Baarn, Zandvoordtweg, same substr., 9 July 1967,H.A. van der Aa 98, CBS H-18695, living culture CBS 347.67; same substr., prov.Limburg, St. Jansberg, near Plasmolen, 9 Sep. 1999, G. Verkley 926, CBS H-21208,living cultures CBS 102330, 102331; same substr., prov. Limburg, Savelsbos, 28June 2000, G. Verkley 967, CBS H-21212, living cultures CBS 109007, 109008;Prov. Zeeland, Zuid-Beveland, community of Borsele, Valdijk near Nisse, 27 Aug.2001, G. Verkley 1110, CBS H-21164, living culture CBS 109834. New Zealand,North Island, Coromandel, Tairua Forest, along roadside of St. Hway 25, nearcrossing 25A, 23 Jan. 2003, G. Verkley 1843, CBS H-21242, living culture CBS113110.Notes: More than ten Septoria species have been described fromthe host genus Polygonum, of which S. polygonorum is the oldestone. The material available for the present study agrees generallywell in morphology with the description of S. polygonorum providedby other authors. Priest (2006) described the conidiogenous cellsas holoblastic (first conidium), producing subsequent conidiaenterobastically, seceding at the same level (mode “Event 13:enteroblastic non-progressive”). Muthumary (1999), who studiedtype material of S. polygonorum from PC, observed sympodiallyproliferated cells. Priest may have overlooked the sympodialconidiogenesis, as in the present study sympodially proliferatingcells were also observed in field specimens of S. polygonorum.The strains available from distant geographical origins showedhighly similar sequences for seven loci. The multilocus phylogenyindicates a rather isolated position of S. polygonorum (Fig. 2).Septoria protearum Viljoen & Crous, S. Afr. J. Bot. 64: 144.1998.Description in planta: Symptoms leaf spots varied according to thehost. Conidiomata pycnidial, epiphyllous or amphigenous, semiimmersedor becoming erumpent, subglobose to globose, darkbrown to black, 65–200 µm diam; ostiolum central, circular, slightlypapillate, 18–30(–60) µm wide, surrounding cells concolourous,releasing white cirrhi of conidial slime; conidiomatal wall 10–22 µmthick, composed of 3–4 layers of brown, isodiametric to irregularcells mostly 5–10 µm diam with dark brown cell walls up to 2 μmthick, sometimes with an an inner layer of hyphal to isodiametriccells 3.5–5 μm diam with thin, hyaline walls. Conidiogenous cellshyaline, discrete and globose or doliiform often with an elongatedneck, or integrated in 1–5-septate conidiophores up to 30 µmlong and narrowly to broadly ampulliform, holoblastic, proliferatingpercurrently with indistinct annellations as well as sympodially,4–12 × 1.5–3.5(–5) µm. Conidia hyaline, cylindrical, subcylindricalto obclavate, straight to curved, rounded to somewhat pointedat the apex, attenuated gradually or more abruptly towards thetruncate base, (0–)1–3(–4)-septate, not constricted around thesepta, containing minute oil-droplets and granular material inrehydrated state, (6–)12–22(–30) × 1.5–2 µm (rehydrated). Sexualmorph unknown.Description in vitro (18 ºC, near UV): Colonies on OA 11–16 mmdiam in 1 wk, 23–30 mm in 2 wk, with an even, slightly undulating,colourless margin; colonies plane, spreading, immersed myceliumochreous to pale luteous or rosy-buff and rarely also with greenishtinges, aerial mycelium absent or scarce with few grey to rosybufftufts; conidiomata developing mostly immersed in the agar,scattered or in concentric zones, olivaceous-black, releasingdroplets of milky white to pale salmon conidial slime. Reversecinnamon to hazel or fawn, or rosy-buff. Colonies on MEA 32–36mm diam in 2 wk, with an even, (vinaceous) buff to colourlessundulating margin; colonies restricted with a cerebriform elevatedcentral area or lower and more spreading, radially striate, the entiresurface covered by a dense mat of finely felted, somewhat woolly,white to greysh, or salmon to flesh aerial mycelium; reverse dark,fawn to brown-vinaceous, or olivaceous-black mixed with brightrust to coral. Conidiomata developing after 1 wk, mostly immersedand releasing whitish conidial slime. Colonies on CHA 17–19 mmdiam in 1 wk, 25–31 mm in 2 wk, with an even, saffron margin withsome diffuse white aerial mycelium; colonies spreading but slightlyelevated in the centre, entirely covered by a dense mat of purewhite, locally weakly salmon, woolly and somewhat sticky aerialmycelium, in the marginal area later with a glaucous haze; reversein the centre chestnut, surrounded by rust and apricot zones,margin saffron. Sporulation as on MEA.Conidiomata (OA) pycnidial, globose, single or merging intocomplexes up to 220 µm diam, brown to black, the wall composedof pale brown textura angularis with cells up to 10 µm diam, innercells smaller and hyaline. Conidiogenous cells hyaline, discreteor integrated in simple, 1(–2)-septate conidiophores, cylindricalor narrowly to broadly ampulliform, holoblastic, proliferatingsympodially, and/or percurrently with indistinct annellations, andthen often showing a narrow neck of variable length, 5–10(–13.5)× 2.5–3(–3.5) µm. Conidia filiform to cylindrical, straight, moreoften curved or flexuous, or bent irregularly, rounded to somewhatpointed at the apex, attenuated gradually or more abruptly towardsthe narrowly truncate base, (0–)1–3-septate, not constricted atthe septa, hyaline, contents as in planta, (8–)12–22(–25) × 1.5–2µm (CBS 119942), (12–)15–23.5(–31) × 1–1.5 µm (CBS 179.77),17–35 × 1–1.5(–2) µm (CBS 658.77).Hosts: Asplenium ruta-muraria, Boronia denticulata, Geum sp.,Ligustrum vulgare, Myosotis sp., Nephrolepis sp., Pistacia vera,Protea cynaroides, Protea sp., Skimmia sp. and Zanthedeschiaaethiopica.Material examined: Germany, Potsdam, Maulbeerallee beneath the Orangerie, onliving leaves of Asplenium ruta-muraria, 17 Nov. 2005, V. Kummer 0045/3, CBSH-19729, living culture CBS 119942. Italy, details of loc. unknown, on Pistacia vera,June 1951, deposited by G. Goidánich, living culture CBS 420.51; on Ligustrumvulgare, June 1959, M. Ribaldi, living culture CBS 390.59. Netherlands, Reeuwijk,in leaf spot of Skimmia sp., commercially cultivated under plastic ‘tunnels’, 1996, J.de Gruyter, CBS H-21190, PD 96/11330 = CBS 364.97. New Zealand, Auckland,on Myosotis sp., Dec. 1976, H.J. Boesewinkel, CBS H=18209, living culturewww.studiesinmycology.org281

Verkley et al.CBS 179.77; same area, on Nephrolepis sp., Sep. 1977, H.J. Boesewinkel, CBSH-18211, living culture CBS 164.78; same area, on leaves and stems of Boroniadenticulata, 5 Apr. 1977, H. J. Boesewinkel, CBS H-18120, living culture isolated,CBS 658.77; same area, Albert Park, on leaves of Geum sp., 21 Jan. 2003, G.Verkley V1821, CBS H-21233, living culture CBS 113114. South Africa, GautengProvince, on leaves of Protea cynaroides, Sep. 1996, L. Viljoen, living ex-type cultureof Septoria protearum STE-U 1470 = CBS 778.97; Pilgrims Rest, on Zanthedeschiaaethiopica, 15 July 2011, P.W. Crous, living culture CPC 19675.Notes: The description of S. protearum given by Crous et al.(2004) has been emended here using observations on materialisolated from other hosts than Protea. These fungi are, despiteminor differences in colony characteristics, genetically very similar,and therefore regarded as conspecific. The name S. protearum isadopted as it is based on well-decribed type material and ex-typecultures. The distinction with a number of strains isolated fromCitrus spp., Fragaria sp., Gerbera jamesonii, Gevuina avellana,Hedera helix, Lobelia erinus, and Masdevallia sp. is doubtfulbut, based on the morphological differences in combination witha limited number of polymorphisms on the house-keeping genes,they are treated here as part of Septoria citri (which clusters in theS. protearum complex), which is a species complex that needs tobe further resolved. Material studied and some cultural charactersof CBS 113392 are provided below.Additional material of the Septoria citri complex examined: Country and hostunknown, May 1937, L.L. Huiller, living culture CBS 315.37 (sub Septoria citri).Argentina, in leaf spot of Lobelia erinus, S. Wolcon s.n., ‘V1466’, living cultureCBS 113392. Italy, Sicilia, on Gerbera jamesonii, Nov. 1961, W. Gerlach, livingcultures CBS 410.61 = BBA 9588 (sub S. gerberae). Netherlands, Paterwolde, inglasshouse, in leaf spots of Masdevallia sp., Feb. 1998, W. Veenbaas-Rijks (CBSH-18124), living culture CBS 101013 (sub S. orchidacearum). New Zealand, leafof Gevuina avellana, Nov. 1998, S. Ganev, living culture CBS 101354; Waitakere,culture isolated from leaf of Fragaria sp., Nov. 1975, H. J.Boesewinkel, living cultureCBS 177.77 (sub Septoria aciculosa). Portugal, Algarve, Monchique, in leaf spot onHedera helix, 14 June 1988, H.A. van der Aa 10494, living culture CBS 566.88 (subS. hederae Desm.).Description in vitro (18 ºC, near UV, CBS 113392): Colonies 23–26mm diam in 2 wk, with an even, glabrous colourless margin; coloniesspreading, immersed mycelium orange, lacking aerial mycelium;reverse bay to scarlet. Conidiomata developing in concentric patterns,immersed and on the agar surface, releasing milky white massesof conidial slime. Colonies on MEA 17–23 mm diam in 2 wk, withan even colourless margin mostly covered by white aerial hyphae;colonies spreading but developing cerebriform elevations in the centre,immersed mycelium livid vinaceous to vinaceous buff, with diffuse todense, appressed, whitish to vinaceous buff aerial mycelium.Conidiogenous cells (OA) varied in shape, globose, doliiformto ampulliform or cylindrical, discrete, rarely integrated in 1-septateconidiophores, holoblastic, proliferating sympodially, and alsopercurrently with several close and indisctinct annellations,hyaline, 4.5–8(–10) × 3–5 µm. Conidia filiform to cylindrical,straight to flexuous, often weakly curved, attenuated gradually to anarrowly rounded to somewhat pointed apex, attenuated graduallyor more abruptly to a narrowly truncate to almost rounded base,contents granular with few minute oil-droplets in the living state,(0–)1–3-septate, (12–)15–28 × 1.5–2 µm (living); CBS 177.77 (OA)17–35.5 × 1–2 µm (living).Septoria putrida Strasser, Verh. zool.-bot. Ges. Wien 65:180. 1915. Fig. 35F–J.Description in planta: Symptoms definite leaf spots, hologenous orepigenous, scattered or in clusters, initially pale yellowish, later greyto white, surrounded by a black elevated zone or merely delimitedby leaf veins. Conidiomata pycnidial, one to several in each leafspot, scattered, semi-immersed, predominantly epiphyllous, palebrown, lenticular to globose, 80–180 µm diam; ostiolum circular,central, initially 25–50 µm wide, later opening to 80 µm diam,lacking distinctly differentiated cells; conidiomatal wall composedof textura angularis without distinctly differentiated layers, mostly10–20 µm thick, the outer cells with brown, somewhat thickenedwalls and 4.5–10 µm diam, the inner cells hyaline, thin-walled,4–9 µm diam. Conidiogenous cells hyaline, discrete or integratedin short, 1-septate conidiophores, cylindrical, or ampuliform witha mostly relatively short, but sometimes strongly elongated neck(8–10 µm long), hyaline, holoblastic, proliferating percurrently withdistinct annellations, sometimes also sympodially, 6.5–12(–19.5) ×3.5–5 µm. Conidia cylindrical, usually strongly curved or flexuous,gradually attenuated to a rounded apex, gradually attenuatedinto a broadly truncate base, (0–)3–5-septate, not or indistinctlyconstricted around the septa, hyaline, contents with several smallguttulae and numerous granules in each cell in the living state, oildropletsrarely merged into larger guttules in the rehydrated state,(32–)40–70(–85) × 2–2.5(–3.0) µm (rehydrated). Sexual morphunknown.Description in vitro: Colonies on OA 5.5–8.5 mm diam in 12 d(13–15 mm in 3 wk; 50–55 mm in 7 wk), with an even, somewhatundulating, glabrous, colourless margin; colonies plane, immersedmycelium buff to primrose, in some sectors also with dark herbagegreen to dull green radiating hyphal stands, after 7 wk mostlydark greenish; pycnidial conidiomata scattered immersed andsuperficial, which are first dark olivaceous, then almost black,glabrous or beset with short hyphal protrusions, 150–450 µm diam,mostly with a single ostiolum placed on short papillae, that releasespale whitish or buff conidial slime; aerial mycelium diffuse, woollyfloccose,white to grey; reverse dull green to olivaceous-black inthe centre. Colonies on CMA 4–7 mm diam in 12 d (11–14 mmin 3 wk; 50–55 mm in 7 wk), with an even, glabrous, colourlessmargin; immersed mycelium apart from margin olivaceous-black,at the margin with some local production of a coral pigment after 7wk; aerial mycelium higher, diffuse woolly, greyish; reverse darkeras on OA; conidiomata similar as on OA. Colonies on MEA 2.5–5mm diam in 12 d (11–13 mm in 3 wk; 42–46 mm in 7 wk), with aneven to ruffled, glabrous, colourless to buff margin, which may beirregularly lobate after 7 wk; colonies restricted, pustulate to almosthemispherical, immersed mycelium rather dark, aerial myceliumdiffuse, short, felty white, behind the margin denser and higher;superficial mature conidiomata releasing first milky white, later paleluteous to saffron, then salmon conidial slime; reverse olivaceousblackin the centre, near the margin honey. Colonies on CHA 5–7mm diam in 12 d (8–11 mm in 3 wk), with an irregular, ruffled,colourless margin, older colonies distinctly lobate; the surfacemostly covered by a low, dense to diffuse, felty white, later greyaerial mycelium, near the margin pure white felty to tufty; further ason MEA; conidial slime abundantly produced, first milky white, latersalmon or saffron; reverse in the centre blood colour, dark brick tocinnamon at the margin.Conidia as in planta, (0–)3–5(–6)-septate, 40–85(–97) ×2–2.5(–3) µm.Host: Senecio nemorensis.Material examined: Austria, Tirol, Ober Inntal, Samnaun Gruppe, Lawenalm, onliving leaves of Senecio nemorensis subsp. fuchsii, 8 Aug. 2000, G. Verkley 1052a,282

A new approach to species delimitation in SeptoriaFig. 35. A–E. Septoria senecionis. A–C. Colonies CBS 102381 (15 °C, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia and conidiogenous cells in planta (CBS H-21219,epitype). E. Conidia in planta (CBS H-21219). F–J. Septoria putrida. F, G. Conidia in planta (CBS H-21174). H. Conidiogenous cells in planta (CBS H-21174). I. Conidia andconidiogenous cells in planta (CBS H-21174). J. Ibid., on OA (CBS 109088). Scale bars = 10 µm.CBS H-21174, living cultures CBS 109087, 109088.Notes: Septoria putrida was originally described from Senecionemorensis found in Austria (Sonntagberg), reportedly withwww.studiesinmycology.org283

Verkley et al.0(–9–11?)-septate conidia, 70–80 × 2 µm. The multilocus sequenceanalysis indicates that S. putrida and S. senecionis are closelyrelated but genetically distinct species (Fig. 2). Morphologicallythese sister taxa can best be distinguished based on conidial length;conidia in S. putrida can be up to 85 µm long in planta and evenlonger (up to 97 µm) in culture, whereas those of S. senecionis arerarely longer than 65 in planta and not over 70 µm long in culture.Thirteen more taxa have been described in Septoria on Senecio,of which S. anaxaea Sacc. is another distinctive, long-spored speciesdescribed from Senecio grandidentatus (?= S. praealtus), andrecently also from several other Senecio spp. in Australia. Accordingto Priest (2006), conidia are 3(–6)-septate, 28–75 × 2.5–3 µm (50–130 × 3.5–5 µm, Teterevnikova-Babayan 1987). Most other Septoriaspp. on Senecio may be synonyms of S. senecionis, and this needsto be confirmed by study of the type material.Septoria rumicum Sacc. & Paol., in Saccardo, Bull. Soc. r.Bot. Belg. 28: 23. 1889.Description in vitro: Colonies on OA 3–5 mm diam in 3 wk, with aneven colourless margin; colonies restricted, irregularly pustulate,immersed mycelium olivaceous-black mostly hidden under a low,dense mat of felty grey to white aerial mycelium; reverse olivaceousgrey.Colonies on MEA 6–10(–12) mm diam in 3 wk, with an even orlobed, colourless margin; colonies restricted, irregularly pustulate,immersed mycelium appearing olivaceous-grey under a densemat of woolly-floccose, white to grayish aerial mycelium; reverseolivaceous-black. No sporulation observed.Conidia (OA) cylindrical, filiform, straight or slightly curved,attenuated gradually towards a narrowly rounded to almost pointedapex, attenuated gradually or more abruptly towards the narrowlytruncate base, 3–5(–7)-septate, mostly 60–82 × 2–3 µm.Hosts: Rumex spp. (R. acetosa, R. alpinum).Material examined: France, Corrèze, Roumignac, on leaves of Rumex acetosa,H.A. van der Aa 5338, CBS H-18050, living culture CBS 503.76 ; Haute-Savoie, Mt.Beaudin, on stem of R. alpinus, July 1978, H.A. van der Aa 9594c, CBS H-18163,living culture CBS 522.78.Notes: Jørstad (1965) noted that S. rumicis Trail, which waspublished in the same year as S. rumicum, may be conspecific.Septoria acetosae Oud. was also regarded as a synonym.According to Saccardo (1892, Syll. Fung. 10: 380), S. rumicumproduces mostly epiphyllous pycnidia 100–125 µm diam, andcontinuous (?) conidia 50–68 × 3 µm. Septoria rumicis produceschiefly epiphyllous pycnidia 90–100 µm diam and conidia 24–40× 2–2.5 µm (Teterevnikova-Babayan 1987), according to Jørstad(1965), 20–50 × 2.5–3.5, with 2–3(–5) septa. Septoria acetosaewas treated as a separate species by Teterevnikova-Babayan(1987). According to the latter author, it is characterised by1–3-septate conidia, 28–50 × 3–5 µm. As the conidial sizes of thematerial available here agree best with the original description ofS. rumicum, this name is adopted here. Several other species ofSeptoria have been described from Rumex, most of which need tobe restudied to assess their status.Septoria scabiosicola (Desm.) Desm., Annls Sci. Nat., sér.3, Bot. 20: 96. 1853. Fig. 36.Basionym: Depazea scabiosicola Desm., Annls Sci. Nat., sér. 2,Bot. 6: 247. 1836.Description in planta: Symptoms leaf spots numerous but small,circular, some merging to irregular patterns, centre white,surrounded by a relatively broad, dark margin with a distinctred or purple periphery. Conidiomata pycnidial, epiphyllous butsometimes also visible from the underside of the lesion, one toa few in each leaf spot, subglobose to globose, brown to black,usually fully immersed, 65–130 µm diam; ostiolum central,initially circular and 35–60 µm wide, later becoming moreirregular and up to 80 µm wide, surrounding cells concolorousto pale brown; conidiomatal wall about 10–15 µm thick,composed of a homogenous tissue of hyaline, angular cells2.5–6.5 µm diam, the outermost cells pale brown with somewhatthickened walls, the inner cells thin-walled. Conidiogenous cellshyaline, discrete, doliiform, or narrowly to broadly ampulliform,holoblastic, with a relatively narrow elongated neck, proliferatingpercurrently several times with distinct annellations, often alsosympodially after a few percurrent proliferations, 6–9(–12) ×2.5–3(–5) µm. Conidia filiform to filiform-cylindrical, straight,slightly curved to flexuous, attenuated gradually to a narrowlypointed apex and narrowly truncate base, (0–)3–5(–6)-septate(septa very thin and easily overlooked), not constricted aroundthe septa, hyaline, contents with several minute oil-droplets andgranular material in each cell in the living state, with minute oildropletsand granular contents in the rehydrated state, (17–)30–55 (–79) × 1–2 µm (living; rehydrated, 1–1.8 µm wide). Sexualmorph unknown.Description in vitro: Colonies on OA 9–13 mm diam in 2 wk, withan even, glabrous, colourless margin; immersed mycelium mostlyhomogeneously coral to scarlet, the pigment diffusing beyondthe colony margin; in the centre black and slightly elevated dueto immersed and more frequently superficial pycnidia, surroundedby an area with more scattered pycnidia, releasing pale fleshdroplets of conidial slime; aerial mycelium scanty, consisting ofminute white tufts; reverse scarlet to coral, the centre darker, bloodcolour. Colonies may develop sectors that are unpigmented andglabrous. Colonies on CMA 8–11 mm diam in 2 wk; similar as onOA, but generally less strongly pigmented. Colonies on MEA 6–9mm diam in 2 wk, the margin irregular; colonies restricted, thecentre elevated and cerebriform to irregularly pustulate, up to 2mm high, the surface pale brown, later black, with scanty whiteareal mycelium; reverse of the colony dark brick, paler towards themargin. Colonies on CHA 6–11 mm diam in 2 wk, with an even,glabrous, colourless margin; immersed mycelium greenish grey todark slate blue, throughout covered by well-developed, tufty whitishgrey arial mycelium that later attains a reddish haze; reverse bloodcolour, but margin paler; in the central part of the colony numerouspycnidia develop, releasing pale vinaceous to rosy-buff conidialslime; in older colonies the centre becomes cerebriform and up to3mm high, much as on MEA.Conidiomata (OA) as in planta, pycnidial, sometimes mergedinto larger complex stromata dark brown, glabrous, 80–180µm diam, with a single ostiolum, or without preformed openingand simply bursting open; conidiogenous cells as in planta, butmore often integrated in 1–2-septate conidiophores, often onlyproliferating percurrently and/or sympodially, 6–15 × 3–7.5 µm;conidia as in planta, 1–6(–7)-septate, not constricted around thesepta, hyaline, with several minute oil-droplets and numerousgranules in each cell, (30–)40–80(–100) ×1.5–2(–2.5) µm.Hosts: Knautia spp., Succisa spp. and Scabiosa spp.284

A new approach to species delimitation in SeptoriaFig. 36. Septoria scabiosicola, CBS 102333. A–C. Colonies (15 °C, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia and conidiogenous cells in planta (CBS H-21180).E. Conidia on OA (CBS 109021). Scale bars = 10 µm.Material examined: Austria, Tirol, Ötztal, Brunau, along roadside, on living leavesof Knautia arvensis, 30 July 2000, G. Verkley 1023, CBS H-21184, living culturesCBS 108981, 109021; Tirol, Ötztal, Sautens, in meadow, 30 July 2000, G. Verkley1030, CBS H-21180, living cultures CBS 108985, 108986; Tirol, Ötztal, Ötz, nearPiburger See along forest road, on living leaves of K. dipsacifolia, 1 Aug. 2000,G. Verkley 1033, CBS H-21179, living cultures CBS 109092, 109093; Tirol, OberInntal, Samnaun Gruppe, Serfaus, on living leaves of K. dipsacifolia, 9 Aug. 2000,G. Verkley 1062, CBS H-21172, living cultures CBS 109128, 109129. France,on living leaves of Succissa pratensis, H.A. van der Aa 11375, living culture CBS182.93. Germany, on living leaves of Scabiosa lucida, R. Schneider, living cultureCBS 356.58. Netherlands, prov. Gelderland, near Winssen, along Waalbanddijk,on living leaves of K. arvensis, 9 Sep. 1999, G. Verkley 919, CBS H-21201, livingcultures CBS 102333, 102334; same loc., host, date, G. Verkley 920, CBS H-21203,living cultures CBS 102335, 102336; same loc., host, date, G. Verkley 921, CBSH-21202; unknown host, July 1937, living culture CBS 317.37.Notes: Jørstad (1965) and Radulescu et al. (1973) reportedvariability in the maximum length of conidia on the host plant. Thisis confirmed in the present study, where the highest and lowestmaximum lengths observed in specimens were 79 and 42 µm, inspecimens CBS H-21184 and CBS H-21180, respectively. Bothspecimens were collected from the same host at comparablealtitudes (ca. 700 m), from localities in Tirol, Austria less than threekilometers apart. Isolates obtained from these two collectionsproved equally capable of producing conidia up 100 µm long understandard conditions of incubation.These isolates as well as other from Knautia arvensis, andstrains originating from Scabiosa and Succissa showed nocorrelation between conidial sizes and host, and although somevariation in gene sequences was observed, especially in Act and EF,the data firmly support the hypothesis that they belong to a singletaxon. Several formae have been described in S. scabiosicola, butevidence to support these as separate entities is wanting. Septoriascabiosicola is relatively distantly related from other members ofthe Septoria clade (Fig. 2).Septoria senecionis Westend., Bull. Acad. r. Belg., Cl. Sci.,Sér. 2, 19: 121. 1851. Fig. 35A–E.Description in planta: Symptoms indefinite, hologenous leaflesions, often eventually affecting large parts of the leaf lamina,initially pale yellowish, later pale to dark brown. Conidiomatapycnidial, numerous, scattered, immersed, mostly epiphyllous,pale brown, lenticular to globose, (45–)65–120(–160) µm diam;ostiolum circular, central, initially 20–35 µm wide, later openingwww.studiesinmycology.org285

Verkley et al.to 60 µm diam, lacking distinctly differentiated cells; conidiomatalwall composed of textura angularis without distinctly differentiatedlayers, mostly 15–20 µm thick, the outer cells with brown,somewhat thickened walls and 4.5–10 µm diam, the inner cellshyaline and thin-walled and of comparable diam. Conidiogenouscells hyaline, discrete or integrated in short, 1–2-septateconidiophores, cylindrical, or ampuliform with a relatively shortneck, hyaline, holoblastic, proliferating sympodially, and sometimesalso percurrently with indistinct annellations, 6.5–10(–12.5) × 2.5–4.5 µm. Conidia cylindrical, weakly to strongly curved, or flexuous,gradually attenuated to a rounded apex, gradually or more abruptlyattenuated into a broadly truncate base, (0–)2–5(–6)-septate, notor indistinctly constricted around the septa, hyaline, contents withseveral small guttules and numerous granules in each cell in theliving state, oil-droplets rarely merged into larger guttules in therehydrated state, (20–)40–65 × 2–2.5(–3) µm (rehydrated). Sexualmorph unknown.Description in vitro: Colonies on OA 7–10 mm diam in 2 wk (22–26 mm in 6 wk), with an even, somewhat undulating, glabrous,colourless margin; colonies spreading, the surface plane, immersedmycelium pale luteous or buff, with scattered immersed andsuperficial pycnidial conidiomata, which are first dark olivaceous,then almost black, glabrous, 150–450 µm diam, with a single orseveral (up to 5!) ostioli placed on short papillae or more elongatednecks (up to 350 µm), that release buff to rosy-buff later salmonconidial slime; aerial mycelium diffuse, woolly-floccose, white;reverse honey, but isabelline to hazel in the centre. Colonies onCMA 6–8 mm diam in 2 wk (18–23 mm in 6 wk), with an even,glabrous margin; as on OA but immersed mycelium with a greenishhaze; aerial mycelium higher and reverse darker, later hazel witholivaceous and yellow tinges; conidiomata similar as on OA.Colonies on MEA 7–9 mm diam in 2 wk (18–21 mm in 6 wk), withan even or somewhat undulating, glabrous, buff to honey margin;colonies pustulate to almost hemispherical, immersed myceliumrather dark, near the margin covered by woolly to felty white aerialmycelium; mostly composed of spherical conidiomatal initials,superficial mature conidiomata releasing rosy-buff to salmon, laterhoney conidial slime; reverse dark brick in the centre, near themargin cinnamon to honey. Colonies on CHA 7–14 mm diam in 2wk (20–28 mm in 6 wk), with an irregular, buff margin covered by adiffuse, felty white, later grey aerial mycelium; further as on MEA,but the colony surface less elevated and especially near the marginwith greyish felty to tufty aerial mycelium; conidial slime abundantlyproduced, first rosy-buff, later salmon to ochreous; reverse in thecentre blood colour, dark brick to cinnamon at the margin.Conidiomata on OA see above. Conidia as in planta, mostly(0–)3–5(–6)-septate, 44–63(–70) × 2.5–3 µm.Hosts: Senecio fluviatilis and S. nemorensis.Material examined: Belgium, Château de Namur, on leaves of Senecio sarracenica,1829, A. Bellynck, isotype BR-MYCO 155500-09. Netherlands, Prov. Gelderland,Millingen a/d Rijn, Millingerwaard, on living leaves of S. fluviatilis, 6 Oct. 1999, G.Verkley 939, epitype designated here CBS H-21219 “MBT175358”, living culturesex-epitype CBS 102366, 102381.Notes: The first Septoria that was described on the genus Seneciowas S. senecionis. The type host is Senecio sarracenica (=Senecio fluviatilis), and in later literature it has also been reportedfrom several other species of Senecio (Radulescu et al. 1973).According to the diagnosis by Westendorp, the conidia are 40 ×1.5 µm and 3–4-septate. Vanev et al. (1997) described the conidiaof S. senecionis as 2–6-septate, 29–68 × 2–2.5 µm, Radulescuet al. (1973) as 3–4-septate, 33–57 × 1.2–2 µm. By examiningthe type specimen from BR it is here confirmed that conidia are infact wider than described by Westendorp. It contains a single leafwith a few lesions, and conidia observed are 30–55 × 1.5–2.5 µm,and mostly 3–5-septate. The fresh material that was collected inthe Netherlands from the same host species, Senecio fluviatilis,and from which CBS 102366 and 102381 were isolated, is insufficient agreement with the type and is therefore designated hereas epitype of S. senecionis. Differences with Septoria putrida arediscussed under that species.Septoria sii Roberge ex Desm., Pl. crypt. Fr., Fasc. 44, no2185; Annls Sci. Nat., sér. 3, Bot. 20: 92. 1853. Fig. 37.Description in planta: Symptoms leaf spots, yellow to brown, initiallyvaguely delimited but later well-delimited by veinlets, scattered,later often confluent over large areas, visible on both sides of theleaf. Conidiomata pycnidial, epiphyllous, rarely also hypophyllous,single, scattered or in small clusters, globose to subglobose,immersed, (60–)80–110 µm diam; ostiolum circular, central, 12.5–25(–35) µm wide, surrounding cells concolorous; conidiomatal wallcomposed of textura angularis 5–10 µm thick, with an outer layer ofcells 3–4.5 µm diam with brown, thickened walls, and an inner layerof hyaline and thin-walled cells, 2.5–4 µm diam. Conidiogenouscells hyaline, broadly or elongated ampulliform, normally witha distinct neck, hyaline, holoblastic, proliferating percurrently,annellations indistinct, 5–8.5 × 3–5 µm. Conidia cylindrical, straight,curved, or flexuous, gradually attenuated to a relatively broadlyrounded apex, more or less abruptly attenuated into a truncatebase, 1–3(–4)-septate, slightly to distinctly constricted around thesepta in the fresh, fully hydrated state, hyaline, containing one toseveral relatively large oil-droplets in each cell, in the rehydratedstate with irregular oil-masses (20–)29–35(–42) × 2–2.5(–3) µm(living; rehydrated, 1.5–2 µm wide). Sexual morph unknown.Description in vitro: Colonies on OA 4–9 mm diam in 2 wk [(15–)19–23 mm in 6 wk], with an even, glabrous, colourless margin;colonies remaining almost plane, immersed mycelium olivaceousblack,locally however peach is dominant, which becomes scarletafter several wk; aerial mycelium mostly well-developed, woollyfloccose,white; scattered, mostly immersed pycnidial to stromaticconidiomata developing in the centre, releasing droplets ofmilky white to rosy-buff conidial slime; reverse dark slate blue toolivaceous-black, and locally peach, the pigment not diffusing intothe medium. Colonies on CMA up to 1.5 mm diam in 2 wk [7–10(–25) mm in 6 wk], as on OA, but peach pigment diffusing into themedium, while the colony itself is predominantly olivaceous-black.Colonies frequently develop faster growing sectors that first arebuff and sporulate directly from the mycelium, later become paleluteous with a distinct scarlet pigmentation and forming numerousmostly superficial pycnidia. Colonies on MEA 3–6 mm diam in2 wk [12–14(–26) mm in 6 wk], the margin ruffled, olivaceousblack;colony concolorous, irregularly pustulate-worty, covered bydiffuse to dense felty white or greyish aerial mycelium; numerousconidiomatal initials developing at the surface, mature onesreleasing cirrhi of conidia that first are milky white, later salmon,sometimes merging to form slimy masses covering areas of thecolony surface; the agar surrounding the colony slightly discolouredby diffusing pigment(s). Colonies on CHA 5–6 mm diam in 2 wk[8–13(–15) mm in 6 wk], as on MEA; some parts of the colonies286

A new approach to species delimitation in SeptoriaFig. 37. Septoria sii. A–C. Colonies CBS 102370 (15 °C, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia and conidiogenous cells in planta (CBS H-21223). E. Ibid., onOA (CBS 102369). Scale bars = 10 µm.pale ochreous, tardily sporulating, releasing pale flesh to salmondroplets of conidial slime from superficial pycnidial conidiomata.Cultures sporulating with conidiogenous cells developing in(superficial) mycelial hyphae, solitary or in sequences, in additionto conidiomata. Conidiomata on OA pycnidial, single, dark brownto black, 80–185 µm diam, ostiolum single 30–60 µm diam, orstromatic without a differentiated opening and up to 220 µm diam;conidiogenous cells inside pycnidia as in planta but often withmore elongated neck, holoblastic, percurrently proliferating one toseveral times with indistinct annellations, 7–12.5 × 3–6 µm. Conidiaas in planta, 22–43 × 2.2–2.5 µm.Hosts: Sium latifolium, other Sium spp. and Berula erecta (syn.Sium erectum).Material examined: Netherlands, Prov. Friesland, Terschelling, ditch in polder Sof Hoorn, on living leaves of Berula erecta, 19 Aug. 1995, H.A. van der Aa 12029,CBS H-18173, living culture CBS 118.96; same substr., Prov. Utrecht, ‘s Graveland,Kortenhoefse plassen, “Oppad”, 14 Oct. 1999, G. Verkley & H.A. van der Aa 945,CBS H-21223, living culture CBS 102369; same loc., substr., date, G. Verkley & H.A.van der Aa 946, CBS H-21222, living culture CBS 102370.Notes: The stout conidia with blunt apices and distinct constrictionsaround the septa (at least in the living, turgescent state) and theabsence of sympodial proliferation in conidiogenesis distinguish thisspecies from most other Septoria on Apiaceae here investigated,including S. apiicola. According to the original diagnosis, based onmaterial from Sium latifolium in France, the conidia are 30–40 ×2.5 µm. Most later authors have reported somewhat different sizeranges; for example Teterevnikova-Babayan (1985) observedconidia 20–60 × 1–1.5 µm, Vanev et al. (1997) 20–41 × 1.5–2.2 µm,and Radulescu et al. (1973) reported 30–40 × 2–3 µm. The materialavailable for this study proved homogeneous in morphology andgenotype. The phylogenetic data indicate that this species is veryclosely related to S. mazi, a fungus occurring on Mazus japonica(Scrophulariaceae), but also to S. aegopodina on Aegopodium sp.(Apiaceae). The conidia of S. mazi morphologically resemble thoseof S. sii, but they are narrower and the septa normally indistinct[15–42 × 1.5–2(–2.5) µm, Shin & Sameva 2004].Septoria sisyrinchii Speg., An. Mus. nac. Hist. nat. B. Aires,6: 324. 1899. Fig. 38.Description in planta: Symptoms leaf lesions developing in largeareas of the leaf lamina that first turn yellow, indefinite, hologenous,pale to dark brown, appearing black due to numerous conidiomata.Conidiomata pycnidial, amphigenous, numerous, semi-immersedto immersed, subglobose to globose, black, 70–100(–120) µmdiam; ostiolum central, circular, 15–35 µm wide, sometimesopening more widely, releasing white to pale yellowish cirrhi ofconidial slime, surrounding cells concolourous or somewhat darker;conidiomatal wall 15–20 µm thick, composed of an outer layer ofisodiametric cells 5–8 µm diam with brown, slightly thickened cellwalls up to 1 μm thick, and an inner layer of globose to isodiametriccells 3–6 μm diam with thin, hyaline walls. Conidiogenous cellshyaline, discrete or integrated in 1-septate conidiophores up 15µm long, cylindrical, or ampulliform, holoblastic, proliferatingsympodially, percurrent proliferations not observed, 5–10 × 2.5–3.5µm. Conidia cylindrical to cylindrical-filiform, slightly to stronglycurved, sometimes flexuous, narrowly rounded to somewhatpointed at the apex, attenuated gradually or more abruptly towardswww.studiesinmycology.org287

Verkley et al.Fig. 38. Septoria sisyrinchii, CBS 112096. A–D. Colonies (15 °C, nUV). A. On OA. B. Ibid., reverse. C. On MEA. D. Ibid., detail of colony margin. E–G. Conidia on OA. Scalebars = 10 µm.the truncate base, (0–)1–3-septate, not constricted aroundthe septa, hyaline, containing minute oil-droplets and granularmaterial in the rehydrated state, (15.5–)20–30 × 1.5–2(–2.5) µm(rehydrated). Sexual morph unknown.Description in vitro (18 ºC, near UV): Colonies on OA 11–15 mm diamin 2 wk, with an even, buff margin; colonies restricted to spreading,immersed mycelium a mixture of luteous and saffron, the surfaceprovided with a very diffuse, white fluffy to woolly aerial mycelium,which is denser in zones; reverse sienna; numerous conidiomatadeveloping after 5–7 d especially in the centre, releasing milkywhite rosy-buff conidial slime. Colonies on MEA 10–14 mm diamin 2 wk, with a buff, minutely ruffled margin; colonies restricted,radially striate and somewhat elevated in the centre, the surfacedirty greyish brown, soon covered by large masses ochreous topale brown masses of conidia. Reverse chestnut to blood color, orbrown-vinaceous.Conidiomata and conidiogenous cells as in planta. Conidia asin planta, mostly 18–35× 1.5–2.5 µm.Hosts: Sisyrinchum spp.Material examined: New Zealand, Auckland, Manurewa, Auckland BotanicalGardens, on leaf of Sisyrinchum sp., 28 Dec. 2002, C. F. Hill LYN 755, CBSH-21259, living culture CBS 112096.Notes: The material from Auckland agrees well with the originaldiagnosis of S. sisyrinchii, which was based on material fromSisyrinchium bonariense in Argentina. Conidia were described as0–3-septate, 15–24 × 2.5 µm. The multilocus phylogeny indicatesthat S. anthurii of the genus Anthurium (Araceae) is a closelyrelated species (Fig. 2).Septoria stachydis Roberge ex Desm., Annls Sci. Nat., sér.3, Bot. 8: 19. 1847. Fig. 39.Description in planta: Symptoms leaf spots angular or irregular,greyish to yellowish brown, with a somewhat darker to black border.Conidiomata pycnidial, epiphyllous, rarely also hypophyllous,mostly 1–5 in each leaf spot, globose to subglobose, dark brown,semi-immersed, 65–100(–125) µm diam; ostiolum central,circular, 12–20 µm wide, later opening more widely up to 50 µm,surrounding cells somewhat darker; conidiomatal wall 12–18 µmthick, composed of angular and irregular cells 2.5–6 µm diam,the outer cells with brown, somewhat thickened walls, the innercells with hyaline and thinner walls. Conidiogenous cells discrete,sometimes integrated into 1–septate conidiophores, hyaline,broadly ampulliform with a relatively narrow neck, holoblastic,proliferating percurrently with indistinct annellations, rarely alsosympodially, 5–8(–10) × 2.5–3.5(–5) µm. Conidia filiform to filiformcylindrical,curved or irregularly bent, rarely straight or flexuous,with a narrowly rounded or somewhat pointed apex, with a truncatebase, (0–)1–3(–5)-septate, not constricted around the septa,hyaline, contents with several minute oil-droplets and granularmaterial in each cell in the living state, with inconspicuous oildropletsand granular contents in the rehydrated state, (17–)20–42 × 1–2 µm (living; rehydrated, 1–1.5 µm wide). Sexual morphunknown.Description in vitro: Colonies on OA 13–16 mm diam in 2 wk(V1049: 8–10 mm in 12 d, 16–18 mm in 3 wk; > 50 mm in 7 wk),with an even, glabrous, colourless margin; immersed myceliummostly homogeneously coral after 2 wk, the centre of thecolony already appearing almost black by numerous superficialand immersed pycnidia; olivaceous-black sectors with dark288

A new approach to species delimitation in SeptoriaFig. 39. Septoria stachydis. A–C. Colonies CBS 102337 (15 °C, nUV). A. On OA. B. On CHA. C. On MEA. D. Conidia in planta (CBS H-21226). E. Conidia in planta (CBSH-21175). F–I. Conidia on OA (CBS 123750). Scale bars = 10 µm.pigmented radiating sterile hyphae also present, later becomingmore dominant, or sectors covered by salmon masses of conidiaformed directly from mycelial hyphae; aerial mycelium absent;reverse concolorous, but blood colour in the centre, later mainlyolivaceous-black or dark slate blue. Surface of the colony smooth.Pycnidia numerous after 2 wk, superficial or immersed, releasingsalmon or rosy-buff droplets of conidial slime. Colonies on CMA8–12 mm diam in 2 wk (11–14 mm in 12 d, 14–24 mm in 3 wk), aswww.studiesinmycology.org289

Verkley et al.on OA, but olivaceous-black sectors more dominant, sometimescolony almost entirely so. Colonies on MEA 8–10 (slow growingsectors) to 12–16 (fast growing sectors) in 2 wk (18–21 mmin 3 wk; 43–58 mm in 7 wk), with an even, glabrous, honey tobuff margin; immersed mycelium very dark blood colour; centreof the colony rising high above the agar surface, cerebriform,covered by dirty ochreous conidial slime formed from separateor fused pycnidial conidiomata. Aerial mycelium in slow-growingsectors scanty, scattered minute tufts of white aerial mycelium,in faster growing sectors well-developed, dense, woolly-cottony,first white, later olivaceous-grey to glaucous grey, locally with areddish discoloration; some colonies with a more homogeneous,olivaceous-black felty surface, sporulating after 3 wk in the centre,with superficial black pycnidial conidiomata releasing milky whitemasses of conidial slime. Colonies on CHA 12–18 mm in 2 wk(15–18 mm in 3 wk; 34–38 mm in 7 wk), with an even, glabrous,colourless margin; immersed mycelium greenish grey to dark slateblue, the outer zone covered by well-developed, tufty whitish greyaerial mycelium; reverse blood colour, but margin paler; in thecentral part of the colony numerous pycnidia develop, releasingpale vinaceous to rosy-buff conidial slime; in older colonies thecentre becomes cerebriform, much as on MEA.Conidiomata (OA) immersed in the agar or on the agar surface,black, single, globose, 100–175 µm diam, or irregular, and mergedinto large complexes 190–350 µm diam, with relatively thick walls;ostiolum as in planta, or absent; Conidiogenous cells as in planta,but more often integrated in 1–3-septate conidiophores. Conidia asin planta, 22–47(–54.5) × 1–2 µm.Hosts: Stachys spp.Material examined: Austria, Tirol, Ober Inntal, Lawenwald near Serfaus, on livingleaves of Stachys sylvatica, 8 Aug. 2000, G. Verkley 1049, CBS H-21175, livingcultures CBS 109126, 109127. Czech Republic, Moravia, Veltice, Forest ofRendez Vous, on living leaves of Stachys sp., 16 Sep. 2008, G. Verkley 6008, CBSH-21253, living cultures CBS 123750, 123879. Netherlands, prov. Utrecht, Baarn,Kasteel Groeneveld, on living leaves of St. sylvatica, 7 July 1968, H.A. van derAa 685, CBS H-18175, living culture CBS 449.68; prov. Gelderland, Wageningen,Binnenveld, on living leaves of Stachys sp., 23 July 1981, H.A. van der Aa 7952,CBS H-18176; prov. Gelderland, Winssen, Kasteel Doddendael, on living leavesof St. sylvatica, 9 Sep. 1999, G. Verkley 922, CBS H-21204, living cultures CBS102326, 102337; prov. Limburg, Gulpen, near Stokhem, on living leaves of St.sylvatica, 28 June 2000, G. Verkley 965, CBS H-21226, living cultures CBS 109005,109006. Romania, distr. Ilfov, pădurea Malu Spart, on living leaves of St. sylvatica,27 June 1971, G. Negrean & A. Voicu s.n., CBS H-18178, distributed in Herb. Mycol.Romanicum, fasc. 41, no. 2001; distr. Prahova, Sinaia, Valea Peleşului, on livingleaves of St. sylvatica, 4 Sep. 1971, G. Negrean s.n., CBS H-18177, distributed inHerb. Mycol. Romanicum, fasc. 41, no. 2002.Additional material examined – Germany, loc. unknown, isol. Ziekler, living cultureCBS 307.31, preserved as S. stachydis, identity uncertain.Notes: According to Jørstad (1965), the conidia of S. stachydis onStachys sylvatica are 16–57 × 1–1.5(–2) µm, with a lowest maximumlength for any collection of 32 µm. In the collections available forthe present study, conidia are up to 42 µm in length in planta, and54.5 µm long in vitro. The species differs morphologically from S.stachydicola (Bubák. ex Serebrian.) Jacz., which occurs on thesame host genus. Shin & Sameva (2004) gave a description ofS. stachydicola, based on two collections of Stachys riederi var.japonica from Korea. According to these authors, the conidia of thatspecies are 38–72 × 2–3 µm (3–7-septate), so longer and widerthan those of S. stachydis. Also, the pycnidia are smaller in diam(40–80 µm) and ostioli much wider (20–36 µm) than in S. stachydis.CBS 128668 (= KACC 44796) is described by Quaedvlieg et al.(2013) as Septoria cf. stachydicola. This isolate, and also CBS128662 (=KACC 43871) are both distant from European isolatesof S. stachydis.Septoria stellariae Roberge ex Desm., Annls Sci. Nat., sér.3, Bot. 8: 22. 1847. Fig. 40.? = Sphaeria isariphora Desm., Annls Sci. Nat., sér. 2, Bot. 19: 358. 1843.≡ Mycosphaerella isariphora (Desm.) Johanson, Öfvers. K. Svensk.Vetensk.-Akad. Förhandl. 41 (no. 9): 165. 1884.Description in planta: Symptoms indefinite white or pale yellow topale brown leaf lesions on lower leaves of plants, often startingat the leaf margin, extending rapidly over the lamina and leadingto complete withering of leaves and their petioles. Conidiomatapycnidial, brown, in dense groups on withering petioles and leaves,where mostly epiphyllous, only partly immersed in the host tissue,globose or lenticular, (85–)120–160(–210) µm diam; ostiolumcircular, central, initially 20–35 µm wide, later opening to 80 µm diam,without distinctly differentiated cells; conidiomatal wall composedof textura angularis without distinctly differentiated layers, mostly15–25 µm thick, the outer cells with brown, somewhat thickenedwalls and 4.5–8 µm diam, the inner cells hyaline and thin-walledand 3.5–6.5 µm diam; conidiogenous cells lining the whole innersurface of the pycnidium. Conidiogenous cells hyaline, discrete orintegrated in short simple, 1–2-septate conidiophores, cylindrical,or ampuliform to elongated ampulliform with a relatively short neck,hyaline, holoblastic, proliferating sympodially, 5–12(–15) × 2.5–4µm. Conidia cylindrical to filiform, weakly curved or abruptly bentin the lower cell, sometimes flexuous, gradually attenuated to therounded apex, gradually or more abruptly attenuated into a broadlytruncate base, (0–)1–3(–5)-septate, not or indistinctly constrictedaround the septa, hyaline, contents with several small guttulae andnumerous granules in each cell in the living state, oil-droplets rarelymerged into larger guttules in the rehydrated state, (21–)30–64(–70) × 1.5–2.5(–3) µm (living; rehydrated, 1–2 µm wide).Description in vitro: Colonies on OA 3–5 mm diam in 2 wk, with aneven, glabrous, colourless margin; a yellow pigment diffusing intothe agar beyond the margin; immersed mycelium mostly colourlessto buff or saffron with scanty, whitish aerial mycelium, the centreof the colony darkened by numerous superficial and immersed,separate or confluent pycnidial conidiomata, releasing rosy-buffto salmon conidial slime; reverse pale luteous to saffron, butolivaceous-black in areas with numerous conidiomata. Colonieson CMA 3–6 mm diam in 2 wk, as on OA. Colonies on MEA 2–5mm diam in 2 wk, with an even, glabrous, colourless margin,locally with rapidly outgrowing hyphae forming superficial pycnidialconidiomata; colonies pustulate to hemispherical, the surfacegreenish grey to olivaceous-black covered by fairly dense greyishto saffron, woolly aerial mycelium; some superficial or immersedpycnidial conidiomata formed; reverse dark umber to blood colour.Colonies on CHA 4–8 mm diam in 2 wk, remaining almost plane,with an irregular margin; immersed mycelium greenish grey todark slate-blue in the centre, buff near the margin; aerial myceliumwell-developed, greyish to white, with a distinct flesh discolorationespecially at the margin; reverse blood colour; abundant immersedand superficial pycnidial conidiomata formed, releasing a buff tosaffron conidial slime.Conidiomata (OA) pycnidial and similar as in planta, single,100–250 µm diam, but more often merged into larger complexes,brown to olivaceous brown, and up to 350 µm diam; ostiolum asin planta, or absent. Conidiogenous cells hyaline, as in planta but290

A new approach to species delimitation in SeptoriaFig. 40. Septoria stellariae. A–D. Colonies CBS 102364. A, B. On OA. C. On CHA. D. On MEA. E. Conidia and conidiogenous cells on OA (CBS 102364). Scale bars = 10 µm.predominantly cylindrical, holoblastic, proliferating sympodially,rarely percurrently with indistinct annellations, 5–15(–22) × 2.5–4.5µm. Conidia similar as in planta, (0–)3–5-septate, not or indistinctlyconstricted around the septa, hyaline, contents with several smallguttules and numerous granules in each cell, (20–)30–75(–84) ×2–2.5(–3.0) µm.Hosts: Stellaria spp. and Myosoton spp.Material examined: Germany, Eifel, Gunderath, near Heilbachsee, on livingleaves of Stellaria media, 22 June 1992, H.A. van der Aa 11341, CBS H-5333.Netherlands, Prov. Utrecht, Baarn, on leaves of S. media, 18 May 1985, H.A. vander Aa 9492, CBS H-18179; Prov. Noord-Holland, Laren, on leaves of S. media, 18Feb. 1967, H.A. van der Aa s.n., CBS H-18180; prov. Noord-Brabant, Valkenswaard,on withering leaves and stems of St. media, 1 May 1967 , H.A. van der Aa s.n.,CBS H-18179; Ameland, Nes, on leaves of St. media, 27 May 1967 , H.A. vander Aa s.n., CBS H-18182; Prov. Gelderland, Landgoed Staverden, on witheringleaves and petioles of St. media, 1 Aug. 1999, G. Verkley 901, CBS H-21156, livingcultures CBS 102364, 102410; Prov. Limburg, Mook en Middelaar, St. Jansberg,near Plasmolen, on withering leaves and petioles of St. media, 9 Sept 1999, G.Verkley 933, CBS H-21157, living culture CBS 102378; Prov. Flevoland, Erkemederstrand, on withering leaves and petioles of St. media, 8 Sept 1999, G. Verkley 929,CBS H-21217, living culture CBS 102376; Prov. Flevoland, Ketelmeer, IJsseloog,on withering leaves and petioles of St. media, 22 May 2002, G. Verkley 1141, CBSH-21260. Romania, distr. Vîlcea, Muntele Cozia, Stîna Foarfeca, on living leaves ofS. media, 14 Oct. 1976, G. Negrean s.n., CBS H-18183, distributed in Herb. Mycol.Romanicum, fasc. 60, no. 2990.Notes: This fungus is a weak pathogen of Stellaria media in theNetherlands, on which it is only seen under very humid conditions.Especially the lower parts of plants that are sheltered by thesurrounding vegetation are affected. Jørstad (1965) observedconidia up to 82 µm in length on Stellaria crassifolia, and up to 96µm long on Stellaria media, the type host. It has also been reportedfrom other Stellaria spp., and Myosoton (Radulescu et al. 1973,Vanev et al. 1997, Markevičius & Treigienė 2003). Septoria stellariaevar. macrospora was originally described from the same host asS. stellariae, Stellaria media. According to Teterevnikova-Babayan(1987), conidia of this variety measure 50–120 × 2.5–4 µm. Onfresh plant material studied here conidia longer than 70 µm werenot observed, but the isolates obtained thereof did produce conidiaup to 84 µm long. Sequence analyses of CBS 102376, 102378,and 102410 originating from three different localities showed nosignificant polymorphisms in the seven loci, indicating that materialbelongs to a single taxon. Whether the variety macrospora istenable, is unclear at this point. We agree with Jørstad (1965), thatthe connection with the sexual morph Mycosphaerella isariphorasuggested in the literature, requires confirmation. It is thereforelisted as a tentative synonym of S. stellariae.Septoria urticae Roberge ex Desm., Annls Sci. Nat., sér. 3,Bot. 8: 24. 1847. Fig. 41.Description in planta: Symptoms leaf spots small, angular, oftenmerging to irregular patterns, initially pale yellowish brown,partly becoming dark greyish brown later, with a dark border.Conidiomata pycnidial, epiphyllous, several in each leaf spot,subglobose to lenticular, pale brown, usually fully immersed,70–120 µm diam; ostiolum central, initially circular and 30–45µm wide, later becoming more irregular and up to 80 µm wide,surrounding cells concolorous to pale brown; conidiomatal wallabout 10–17 µm thick, composed of a homogenous tissue ofhyaline, angular cells 2.5–6.5 µm diam, the outermost cells paleyellowish brown with somewhat thickened walls, the inner cellsthin-walled. Conidiogenous cells hyaline, mostly discrete, narrowlyor broadly ampulliform with a relatively narrow neck, holoblastic,www.studiesinmycology.org291

Verkley et al.Fig. 41. Septoria urticae, epitype. A. Conidia andconidiogenous cells in planta (CBS H-21221). B. Ibid.,on OA (CBS 102371). Scale bars = 10 µm.often first proliferating sympodially, and later also percurrently 1–several times with distinct annellations, 6–12(–16) × 4–5.5(–7)µm. Conidia cylindrical, straight or slightly curved, flexuous, orirregularly bent, with a narrowly rounded apex, attenuated towardsthe narrowly truncate base, (0–)1–5(–7)-septate, not constrictedaround the septa, hyaline, contents with several oil-droplets andgranular material in each cell in the living state, with inconspicuousoil-droplets and granular contents in the rehydrated state, (18–)30–57(–75) × 2– 3 µm (living; rehydrated, 2–2.5 µm wide). Sexualmorph unknown.Description in vitro: Colonies on OA 6–7 mm diam in 2 wk (19–22 mm in 6 wk), with an even, glabrous, red to coral margin, thepigment also clearly diffusing beyond the margin; colonies almostplane, immersed mycelium near the margin red, in the centre verydark, blood colour to black, also due to mostly superficial pycnidialconidiomata releasing pale flesh droplets of conidial slime; white,felty aerial mycelium scanty, mostly only just behind the margin;reverse concolorous. Colonies on CMA 4-6 mm diam in 2 wk (16–17 mm in 6 wk), as on OA. Colonies on MEA 6–7(–9) mm diam in2 wk [20–22(–28) mm in 6 wk], with an even, buff to very pale fleshplane marginal zone; the pigment diffusing into the medium; colonyoften hemispherical with an irregularly pustulate-worty surface,immersed mycelium very dark chestnut to black, aerial myceliumabsent, except in faster growing sectors, which are entirely coveredby a dense, felty mat of reddish aerial mycelium; superficial pycnidialconidiomata releasing dirty white to flesh droplets of conidial slime.Colonies on CHA 4–6 mm diam in 2 wk (17–22 mm in 6 wk), ason MEA, but with an initially ruffled (later more even), rather darkmargin and more numerous conidiomata producing flesh dropletsof conidial slime.Conidiomata (OA) pycnidial, pale brown to dark brown,glabrous, 100–230 µm diam, with a single ostiolum as in planta,or ostioli barely differentiated; conidiogenous cells as in planta,but more often integrated in 1–2-septate conidiophores, often onlyproliferating percurrently with distinct annellations on an elongatedneck, 6–14 × 3–7.5 µm; conidia cylindrical, straight or slightlycurved, tapering to a rounded apex, lower part attenuated into abroad truncate base, 1–7(–9)-septate, not constricted around thesepta, hyaline, with several minute oil-droplets and numerousgranulae in each cell, (34–)40–70(–90) ×2.5–3(–3.5) µm.Hosts: Urtica spp. and Glechoma hederacea.Material examined: Netherlands, Prov. Utrecht, Soest, Overhees, on living leavesof Glechoma hederacea, in leaf spots associated with Puccinia glechomatis, 8 Aug.1999, G. Verkley 904, CBS H-21197, living culture CBS 102316; Prov. Utrecht, ‘sGraveland, Kortenhoefse plassen, “Oppad”, on living leaves of Urtica dioica, 14 Oct.1999, H.A. van der Aa & G. Verkley 947, epitype designated here CBS H-21221“MBT175359”, living cultures ex-epitype CBS 102371, 102375.292

A new approach to species delimitation in SeptoriaFig. 42. Septoria verbenae. A. Conidia and conidiogenous cells in planta(CBS H-21241). B. Conidia on OA (CBS 113438). Scale bars = 10 µm.Notes: Muthumary (1999) provided a description and illustrationof type material of S. urticae (PC 1309). Because there are onlyinsignificant differences between his observations of the type andthose observed here in the Dutch collection on the same host, Urticadioica, the latter is selected as epitype. Muthumary reported ostioli20–40 µm wide, while in the Dutch material the ostioli eventuallyopen up further to about 80 µm wide. Muthumary observedconidia 35–50 × 2–2.5 µm with 3–4 septa, but other authors havefound that conidia in planta can be much longer and have moresepta. Jørstad (1965) found that conidia in Norwegean materialon U. dioica were 22–81 × 1–1.5 µm, with up to 6 septa. Priest(2006), who studied material on U. insidia and U. urens in Australiareported conidia (26–)35–50(–70) × 1.5–2 µm, 3–5-septate. Thepresent study shows that in vitro conidia can even be up to 90µm long in this species. The material from Glechoma hederaceaesporulating in association with the rust Puccinia glechomatis,proved morphologically in good agreement with that on Urticadioica, and since it is also genetically similar to the material fromthat host, it is regarded conspecific. Other Septoria species havealso occasionally been found in association with rust sori, viz., S.lagenophorae, which is regarded to be a hyperparasite of rusts,and occasionally also other leaf-spotting fungi (Priest 2006).According to Muthumary, the conidiogenous cells of S. urticaeeach produce a solitary terminal conidium and often also proliferatesympodially. It is established here that S. urticae is also capableof proliferating percurrently, and that this mode of proliferation ismore frequent in pure culture. In contrast, Priest (2006) observedconidiogenous cells that first produced a conidium holoblastically,and subsequent conidia enteroblastically at the same level from anarrow conidiogenous locus, viz. like in phialidic conidiogenesis. It isunclear whether this is truly phialidic conidiogenesis, or just crypticpercurrent proliferation as observed in S. chrysanthemella, wherethe scars of the subsequent secessions are indistinguishable dueto the limitations in the resolution of the light microscope (Verkley1998a).Septoria verbenae Roberge ex Desm., Annls Sci. Nat., sér.3, Bot., 8: 19. 1847. Fig. 42.Description in planta: Symptoms stem lesions and leaf spots small,angular to irregular, and merging to elongated areas, initially red topurplish red, then becoming pale in the centre with a darker border.Conidiomata pycnidial, epiphyllous, one to a few in each lesion,globose, dark brown, immersed, 70–140 µm diam; ostiolum central,circular, 25–40 µm wide, surrounding cells dark; conidiomatal wallabout 12.5–20 µm thick, composed of a homogenous tissue oftextura angularis with hyaline cells 2.5–7.5 µm diam, the outermostcells mid brown with somewhat thickened walls, the inner cellsthin-walled and pale yellowish brown. Conidiogenous cells hyaline,discrete, or integrated in 1–2-septate conidiophores, narrowlywww.studiesinmycology.org293

Verkley et al.ampulliform to almost cylincrical, often with a relatively narrow neck,holoblastic, first proliferating sympodially, and in some cells lateralso percurrently 1–several times with indistinct annellations, 12–18(–20) × 2.5–6 µm. Conidia cylindrical, straight or slightly curved,flexuous, with a narrowly rounded to somewhat pointed apex,attenuated towards the narrowly truncate base, (1–)3(–5)-septate,not constricted around the septa, hyaline, contents with several oildropletsand granular material in each cell in the living state, withinconspicuous oil-droplets and granular contents in the rehydratedstate, (22–)16–48 × (1–)1.5–2 µm (rehydrated). Sexual morphunknown.Description in vitro: Colonies on OA 10–13 mm diam in 2 wk,with an even, colourless margin; colonies restricted to spreading,immersed mycelium citrine to grey-olivaceous, locally soon darkerradiating strands occur, glabrous but in the centre of colonies,where irregular elevations are formed, covered by well-developed,grey to white finely felted aerial mycelium; reverse greenish greyto olivaceous-black. Conidiomata developing immersed or on theagar surface after 10–2 wk. Colonies on MEA 10–13 mm diam in 2wk, with a slighlty ruffled, buff to amber margin; colonies restricted,irregularly pustulate, the surface entirely covered by a low, densemat of whitish to grey finely felted aerial mycelium; reverse darkbrown to almost black, locally fulvous to sienna. No sporulationobserved.Conidia (OA) filiform to cylindrical, typically weakly to stronglycurved, sometimes straight or flexuous, attenuated gradually toa somewhat pointed apex, attenuated gradually or more abruptlyto the narrowly truncate to almost rounded base, hyaline, withgranular contents and minute oil droplets, (1–)3–5(–7)-septate,(22–)28–46(–54) × 1.5–2(–2.5) µm.≡ Cylindrosporium pseudoplatani (Roberge ex Desm.) Died., Annlsmycol. 10: 486. 1912.= Sphaerella latebrosa Cooke, Handb. Brit. Fungi 2: no. 2754. 1871.≡ Mycosphaerella latebrosa (Cooke) J. Schröt., in Cohn, Krypt.-Fl.Schlesien (Breslau) 3.2(3): 334. 1894 [1908].≡ Carlia latebrosa (Cooke) Höhn., Hedwigia 62: 73. 1920.= Septoria seminalis var. platanoidis Allesch., Hedwigia 35: 34. 1896.≡ Cylindrosporium platanoidis (Allesch.) Died., Annls mycol. 10(5): 486.1912.= Septoria epicotylea Sacc., Malpighia 11: 314. 1897.= Phloeospora pseudoplatani Bubák & Kabát in Bubák, Sber. K. böhm. Ges.Wiss., Math.-naturw, Kl., 7: 16. 1903.Description in planta: Symptoms small (0.2–0.5 mm diam), circularto angular, hologenous reddish brown leaf spots. Conidiomataacervular, epi- or hypophyllous, one to a few in each leaf spot,pale brown (drying dark brown), 105–180(–220) µm diam,releasing conidia in white columnar masses; conidiomatal wallHost: Verbena officinalis.Material examined: New Zealand, North Isl., Northland, Bay of Islands area,Manawaora along roadside, on living leaves of Verbena officinalis, 30 Jan. 2003, G.Verkley 2017, CBS H-21240; same loc., date, on stems of V. officinalis, G. Verkley2023, CBS H-21241, living culture CBS 113438, 113481.Notes: Priest (2006) gave a detailed description based on a collectionfrom New South Wales, Australia [conidia (1–)3-septate, 26–48× 1.5(–2) µm]. The two strains available proved morphologicallysimilar. These New Zealand strains proved to have identical Act,Btub, Cal, EF, and RPB2 sequences, distinct from other Septoria.SphaerulinaType species: Sphaerulina myriadea (DC.) Sacc., Michelia 1 : 399.1878.Quaedvlieg et al. (2013, this volume) provide a description basedon the sexual morph and treat several additional species withseptoria-like asexual morphs.Sphaerulina aceris (Lib.) Verkley, Quaedvlieg & Crous,comb. nov. MycoBank MB804473. Fig. 43.Basionym: Ascochyta aceris Lib., Pl. crypt. Ard., Cent. 1: no. 54.1830.≡ Septoria aceris (Lib.) Berk. & Broome, Ann. Mag. Nat. Hist. Ser. 2, 5:379. 1850.≡ Phloeospora aceris (Lib.) Sacc., Syll. Fung. 3: 577. 1884.= Septoria pseudoplatani Roberge ex Desm., Annls Sci. Nat., sér. 3, Bot. 8:21. 1847.Fig. 43. Sphaerulina aceris. A, B. Colonies CBS 183.97. A. On OA. B. On MEA. C,D. Conidia in planta (CBS H-21239). Scale bars = 10 µm.294

A new approach to species delimitation in SeptoriaFig. 44. Sphaerulina cornicola. A–C. Colonies CBS 102324. A. On OA. B. On CHA. C. On MEA.mainly consisting of a basal 15–25(–35) µm thick layer of angularto subglobose, subhyaline to pale brown cells 5–10 µm diam,lateral wall absent or very poorly developed, composed of similar,somewhat darker cells. Conidiogenous cells hyaline, discrete orintegrated in 1(–2)-septate conidiophores, subglobose, doliiformor ampulliform, holoblastic, proliferating percurrently with one toseveral disctinct annellations, or sympodially, sometimes bothtypes of proliferation occur in a single conidiogenous cell, 8–15(–20) × 2.5–4 µm. Conidia cylindrical, straight or more or less curved,attenuated gradually to a broadly rounded apex, attenuated moreor less abruptly to a truncate base, (1–)3-septate, conspicuouslyconstricted around the septa in fresh and rehydrated state, hyaline,contents with numerous minute oil-droplets and granular materialin each cell in the living state, with minute oil-droplets and granularcontents in the rehydrated state, (32–)37–47(–50) × 3–4 µm (living;rehydrated, 2–3 µm wide).Description in vitro. Colonies on OA 3–4 mm diam in 2 wk, with aundulating even margin; colonies restricted, irregularly pustulate,the surface buff or much darker grey to brown, locally glabrousbut mostly covered by a dense mat of finely felted white aerialmycelium, conidiomata developing on the surface releasing conidiain clear droplets, or in milky white to rosy-buff masses; reversedark greyish or brown-vinaceous. Colonies on MEA 3–4(–8) mmdiam in 2 wk, with a undulating even margin; colonies restricted,irregularly pustulate, the surface almost black provided with lowand finely felted, diffuse, grey to white aerial mycelium, conidiomatadeveloping just beneath the colony surface, releasing white cirrhiof conidia; reverse a palet of brown-vinaceous, cinnamon andolivaceous-grey.Conidia (OA) as in planta, (31–)34–50(–58) × 3.5–5 µm.Microconidia (spermatia of the Asteromella state) ellipsoid, hyaline,0-septate, 3–4 × 1.5 µm.Hosts: Acer campestre, A. circinatum, A. hyrcanum (Vanev et al.1997) and A. pseudoplatanus.Material examined: France, locality unknown, on leaves of Acer campestre,distributed in Libert, Pl. Cryptog. Ard. Fasc. 1 (1830): no. 54, isotype BR–MYCO153858-16, type of Ascochyta aceris Lib. Netherlands, prov. Utrecht, Baarn, onAcer pseudoplatanus, July 1969, I. Blok, living culture CBS 514.69; Baarn, gardenWCS, on living leaves of Acer pseudoplatanus, 23 July 1985, H.A. van der Aa9537, CBS H-14666, living culture CBS 652.85; same substr., prov. Zuid-Holland,Wassenaar, Hollandsch Duin, 14 Aug. 1994, G. Verkley 227, CBS H-18040, livingculture CBS 687.94; same substr., prov. Zuid-Holland, Wassenaar, Ganzenhoek, 8Aug. 1995, G. Verkley 307, CBS H-21239, living culture CBS 187.96; same substr.,prov. Utrecht, Baarn, Eemnesserweg, 7 May 1996, H.A. van der Aa 12120, CBSH-14665, living culture CBS 183.97; USA, Oregon, Lane Co., Proxy Falls Trail, onliving leaves of Acer circinatum, 11 Oct. 1996, J. K. Stone & G. Verkley 480, CBSH-21236, living culture CBS 655.97.Notes: This is the oldest septoria-like species described frommembers of the family Aceraceae. It occurs on several speciesof the genus Acer. In the original diagnosis of Libert, three hostspecies were mentioned, viz., A. campestre, A. pseudoplatanusand A. platanoides. Jørstad (1965) treated forms on A. platanoideswith conidia 26–60 × 2–2.5 µm as S. apatela All. (synonyms S.seminalis var. platanoidis All., Phleospora platanoidis Kabát &Bubák, Phloeospora samarigena Bubák & Krieg.), while those on A.campestre remained unsettled. According to Jørstad (1965) conidiaof S. aceris are 24–43 × 2–3 µm, with 3 septa, which agrees wellwith the sizes observed in the type specimen available in the presentstudy. This material also showed a small proportion of 4-septateconidia in one of the fruitbodies. More species with conidia longerthan 60 µm have been described from A. platanoides, and theseneed to be critically assessed in a comprehensive study includingisolates of all Septoria occurring on the genus Acer. No isolatesfrom the the type host A. campestre that would be most suitableas epitype, were available, hence no epitypification is proposedhere. The ultrastructure of conidiogenesis and conidia of S. aceriswas studied by Verkley (1998b), who showed that in a single cellpercurrent as well as sympodial proliferation can occur.A description of the sexual morph known as Mycosphaerellalatebrosa was provided by Kuijpers & Aptroot (2002), but theirspecies concept included several discrete entities that aredistinguishable by their conidial states and occur on distantly relatedhost plants. It is unlikely that these entities can be distinguishedat all by the morphology of the sexual state (Verkley & Starink-Willemse 2004).Sphaerulina cornicola (DC.: Fr.) Verkley, Quaedvlieg &Crous, comb. nov. MycoBank MB804474. Fig. 44.Basionym: Depazea cornicola DC.: Fr., in De Candolle & Lamarck,Flore Française VI: 146. 1815.≡ Septoria cornicola (DC.: Fr.) Desm., Pl. crypt. Fr., Fasc. 7, no 342.1828; Index Pl. crypt. Fr.: 24. 1851.= S. cornicola var. ampla H. C. Greene, Amer. Midl. Nat. 41: 755. 1949 (fideFarr 1991).For extended synonymy see Farr (1991). Neotype on Cornussanguinea, France (BPI, designated by Farr 1991), not seen.Description in planta: Symptoms starting as red discolorations ofthe leaf lamina and margin, which develop to scattered, circularto irregular, hologenous leaf spots, that later become pale brown,and surrounded by a dark brown to black bordering zone and adistinct red or purple periphery. Conidiomata pycnidial, epiphyllous,numerous scattered in each leaf spot, subglobose to globose,brown to black, immersed or semi-immersed, 55–100(–120) µmdiam; ostiolum central, initially circular and 25–40 µm wide, laterbecoming more irregular and up to 60 µm wide, surrounding cellsconcolorous to pale brown. Conidiomatal wall about 10–15 µmthick, composed of a outer layer of hyphal to irregular cells 3.0–8 µmdiam with brown walls, and an inner layer of hyaline cells 3–5 µmwww.studiesinmycology.org295

Verkley et al.diam; Conidiogenous cells hyaline, discrete, doliiform, or narrowlyto broadly ampulliform, holoblastic, proliferating sympodially,sometimes also percurrently with indistinct annellations, 5–12.5(–15) × 3–4(–8) µm. Conidia cylindrical, regularly curved, attenuatedgradually to a rounded or somewhat pointed apex and a narrowlytruncate base, (0–)1–3(–5)-septate, distinctly constricted aroundthe septa only in the fresh state, hyaline, contents with severalminute oil-droplets and granular material in each cell in the livingstate, with amorphous material and granular contents in therehydrated state, (20–)24–40 × 3–4 µm (living; rehydrated, 2–3µm wide). Sexual morph unknown.Description in vitro: Colonies on OA 4–7mm diam in 2 wk (12–16 mm in 6 wk), with an even, glabrous, buff margin; coloniesspreading, the surface first plane, then somewhat pustulate,immersed mycelium a mixture of fawn and rosy-buff tinges, locallydarker olivaceous, the surface largely covered by a rosy-buff tovinaceous buff masses or a film of conidial slime produced directlyby the mycelium; reverse rosy-buff with isabelline to hazel areas,later darker in the centre. Colonies on CMA 3–4 mm diam in 2 wk(8–12 mm in 6 wk), as on OA. Colonies on MEA 4.5–7 mm diamin 2 wk (9–14(–16) mm in 6 wk), restricted, the entire surface ofthe colony regularly cerebriform with large masses of conidialslime (also covering the margin), first salmon, later darkening toochreous or umber, eventually even chestnut; reverse sienna tobay. Colonies on CHA 4–6 mm diam in 2 wk (11–14 mm in 6 wk),as on MEA.Conidia (OA) as in planta, but showing secondary conidiation,1–8(–16)-septate, conidia germinating from intermediatecells (laterally) or the basal cells (axially) to form new conidialfragments of variable length, or branched complexes, rendering aheterogeneous mixture.Host: Cornus sanguinea.Material examined: Germany, Baden-Württemberg, Kussa-Rheinheim, 3 Sep. 1999,A. Aptroot 46371, CBS H-21191. Netherlands, Prov. Noord Brabant, Eindhoven,Milieu- & Educatiecentrum Eindhoven, on living leaves of Cornus sanguinea, 4 Sep.1999, A. van Iperen (G. Verkley 918), CBS H-21237, living cultures CBS 102324,102332; same substr., prov. Limburg, Gulpen, near Stokhem, 28 June 2000, G.Verkley 963, CBS H-21238. USA, Maryland, Prince Georges Co., on C. sanguinea,14 Sep. 2004, A. Y. Rossman 4089 (BPI), living culture CBS 116778.Notes: The material examined has the typical conidia of Sphaerulinacornicola, agreeing with those described by Farr (1991). Septoriacornina can be distinguished from Sphaer. cornicola by morevariously curved, most commonly hooked, falcate or lunate conidia(23–)32–90(–110) × 2–4(–5) µm with rounded apex (Farr 1991,Shin & Sameva 2004). The phylogenetic relationship with S.cornina remains to be clarified.Sphaerulina frondicola (Fr.) Verkley, Quaedvlieg & Crous,comb. nov. MycoBank MB804477.Basionym: Septoria populi Desm, Annls Sci. Nat., sér 2, Bot., 19:345. 1843. nom. nov. pro Depazea frondicola Fr., Observationesmycologicae, 2: 365, t. 5: 6–7. 1818.≡ Sphaeria frondicola (Fr.) Fr., Syst. Mycol. 2: 529. 1822.= Sphaerella populi Auersw., in Gonnermann & Rabenhorst, Mycol. eur.Abbild. Sämmtl. Pilze Eur. 5–6: 11 .1869.≡ Mycosphaerella populi (Auerw.) J. Schroet., in Cohn, Krypt.-Fl.Schlesien (Breslau) 3.2 (3): 336. 1894.Description in vitro (CBS 391.59): Colonies on OA 3–5 mm diamin 2 wk, with an even or slightly ruffled, colourless, glabrousmargin; colonies restricted and up to 2 mm high after 2 wk,immersed mycelium mostly olivaceous to dark herbage green,with moderately developed, greyish white, woolly-floccose aerialmycelium; numerous large, simple or complex, olivaceous toreddish brown stromatic conidiomata formed that open widelyto release masses of rosy-buff conidial slime; reverse mostlyolivaceous-black. Colonies on MEA 2–3(–4) mm diam in 2 wk,with a ruffled, buff, glabrous margin; colonies restricted, up to 2mm high, irregularly pustulate, the surface appearing dark brownto black, but with numerous hemispherical stromata at the surfacewhich are fawn to vinaceous brown, some of which start sporulatingdirectly from the surface forming masses of rosy-buff conidial slimeafter 2 wk; aerial mycelium scarce, locally denser, white; reversealmost black. Colonies on CHA 4–6 mm diam in 2 wk, with an even,rosy-buff margin covered by pure white, woolly aerial mycelium;colonies restricted, up to 2 mm high, immersed mycelium entirelyhidden under a dense mat of pure white, high, woolly aerialmycelium; reverse brown-vinaceous in the centre, surrounded bya rosy-buff to buff marginal zone.Conidiomata not well-developed.Conidiogenous cells observed holoblastic, some cells with a singlepercurrent proliferation. Conidia showing signs of degeneration. Inaddition, cylindrical to dumpbell-shaped spermatia or microconidia,(5.5–)7.5–13.5(–14.5) × 1.2–1.7 mm, are formed from phialides inthe same fruitbodies.Host: Populus pyramidalis.Material examined: Germany, Berlin-Kladow, on living leaves of Populuspyramidalis, Dec. 1959, R. Schneider s.n., BBA 8987, CBS H-18150, living cultureCBS 391.59Notes: CBS 391.59 groups in a subclade of the Sphaerulinaclade(Fig. 2), that was named after the type species Sphaerulinamyriadea that resides in it (Quaedvlieg et al. 2013). Closest relativesare the other poplar pathogens Sphaer. populicola (syns Septoriapopulicola Peck, Mycosphaerella populicola, CBS 100042) andseveral isolates of Sphaer. musiva (synonyms Septoria musiva,Mycosphaerella populorum). CBS 391.59 now only developsatypical sporulating structures not described in detail here.Sphaerulina gei (Roberge ex Desm.) Verkley, Quaedvlieg &Crous, comb. nov. MycoBank MB804475. Fig. 45E–G.Basionym: Septoria gei Roberge ex Desm., Annls Sci. Nat., sér. 2,Bot. 19: 343. 1843.Description in planta: Symptoms leaf lesions irregular, greyishbrown, well-delimited by a dark brown line, surrounding leaf tissueoften yellowish; Conidiomata pycnidial, amphigenous thoughpredominantly epiphyllous, numerous in each lesion, subgloboseto cupulate, brown to black, 35–80 µm diam; ostiolum central,circular, initially 35–60 µm wide, later becoming more irregular andup to 80 µm wide, surrounding cells dark brown; conidiomatal wall10–15 µm thick, composed of a homogenous tissue of hyaline,angular cells 2.5–6.5 µm diam, the outermost cells pale brown withslightly thickened walls, the inner cells thin-walled. Conidiogenouscells hyaline, discrete, rarely also integrated in 1–2-septateconidiophores, cylindrical or narrowly to broadly ampulliform,holoblastic, often with a relatively narrow and elongated neck,proliferating percurrently several times with distinct annellations,rarely also sympodially, 6–10(–15) × 3.5–5(–6) µm. Conidia filiform,slightly curved to flexuous, rarely straight, narrowly rounded at theapex, narrowly truncate at the base, (0–)2–5(–8)-septate (septa296

A new approach to species delimitation in SeptoriaFig. 45. A–D. Sphaerulina hyperici. A–C. Colonies CBS 102313. A. On OA. B. On CHA. C. On MEA. D. Conidia and conidiogenous cells in planta (CBS H-21194, epitype).E–G. Sphaerulina gei. E. Colony on OA (KACC 44051 = CBS 128632). F. Conidia and conidiogenous cells in planta (CBS H-21194, epitype). G. Ibid., on OA (CBS 102318).Scale bars = 10 µm.very thin and easily overlooked), not constricted around the septa,hyaline, contents with several minute oil-droplets and granularmaterial in each cell in the living state, with minute oil-droplets andgranular contents in the rehydrated state, 33–65(–75) × 2–2.8(–3)µm (living; rehydrated, 1.8–2.5 µm wide). Sexual morph unknown.Description in vitro: Colonies on OA 6–8(–15) mm diam in 3 wk, withan even, glabrous, colourless to buff margin; colonies spreading,immersed mycelium at first buff to rosy-buff, tardily becomingolivaceous to olivaceous-black, occassionally some sectorsremaining buff; aerial mycelium mostly wanting, but sometimes witha few greyish tufts, the surface of the colony centre soon covered byrosy-buff masses of conidial slime, produced from conidiogenouscells directly on the mycelium or in pycnidial conidiomata; reverseolivaceous-black, margin buff. Colonies on CMA 7–9 mm diam in3 wk, as on OA, but green pigmentation developing more rapidly.Colonies on MEA 7–9(–11) mm diam in 3 wk, with an irregular,glabrous, rosy-buff margin; a reddish pigment diffusing into theagar; colony spreading to restricted, the surface cerebriform toirregularly lobed, up to 2 mm high, very dark, but locally coveredeither by grey, felted aerial mycelium or masses of salmon conidialslime, produced directly from hyphae or in superficial stromatalconidiomata; reverse rust to chestnut. Colonies on CHA 6–7(–10)mm diam in 3 wk, colony features and sporulation as on MEA, butthe margin covered by whitish aerial mycelium; diffusing pigmentalso present. Sporulating structures on OA very similar to those inplanta, but conidia up to 85 µm long.Hosts: Geum spp.Material examined: Czech Republic, Bohemia, near Tábor, on living leavesof Geum urbanum, 20 July 1903, F. Bubák, distributed in Kabát & Bubák, Fungiimperfecti exsicc. 114, PC 0084558. France, Caen, on living leaves of G. urbanum,“Col. Desmazieres 1863, no. 8, 58”, “Jun-Sep. 1842”, isotype PC 0084556; forestnear Caen, on living leaves of G. urbanum, 1841, Roberge, PC 0084555. Germany,Brandenburg, Buchmühle near Lagow, on living leaves of G. urbanum, 10 Sep.1909, P. Sydow, PC 0084559. Korea, Hoengseong, on living leaves of G. japonicum,H.D. Shin, living culture CBS 128616 = KACC 43029 = SMKC 22748; same substr.,Pyeongchang, H.D. Shin, living culture CBS 128632 = KACC 44051 = SMKC 23686.Latvia, prov. Vidzeme, Kr. Riga, Ogre, on living leaves of G. urbanum, 19 July 1936,J. Smarods, PC 0084557. Netherlands, Prov. Limburg, Schimperbosch, SW ofVaals, on the same substr., 29 Aug. 1999. H.A. van der Aa s.n., CBS H-21168; Prov.Noord Holland, Amsterdamse Waterleidingduinen, Panneland, on living leaves ofG. urbanum, 31 Aug. 1999, G. Verkley & A. van Iperen 914, epitype designatedhere CBS H-21167 “MBT175360”, living culture ex-epitype CBS 102318. Romania,distr. Prahova, Muntenia, Cheia, on living leaves of G. rivale, T. Săvulescu & C.Sandhu, distributed in Săvulescu, Herb. Mycol. Romanicum 8, 377, PC 0084560.Sweden, Gotland, Endre parish, Hulte, on living leaves of G. urbanum, 16 July1898, T. Vestergren, PC 0084561.www.studiesinmycology.org297

Verkley et al.Notes: The type material from PC studied contains one leaf showingthe typical symptoms, and although only old empty fruitbodieswere observed in it, it is almost certain that these are the productof this well-known and common “Septoria” species. The othermaterial studied here was in much better condition and provedhighly homogeneous in both symptoms and morphology of thesporulating structures, including the collection from Geum rivale,with most conidia observed below 70 µm long. Some authors foundconidia up to about 75 µm long in various European collections(Jørstad 1965, Vanev et al. 1997). In the fresh material from TheNetherlands, conidia were no longer than 65 µm on the host plant,but the isolates obtained from it produced conidia up to 85 µm long.This material is chosen here to epitypify Sphaer. gei because it isgeographically the closest one for which also a culture is available.Several authors have recognised Septoria gei f. immarginatafor material on Geum urbanum with smaller conidia, viz. Radulescuet al. (1973), reporting conidia as continuous, 33–56 × 1.1–1.5 µm(in majority 40–46 × 1.5 µm), and Teterevnikova-Babayan (1983),reporting 20–33 × 1.5 µm. Shin & Sameva (2004) considered thisforma a synonym of S. gei, for which they noted the wide range ofconidial sizes. In Asian collections identified as S. gei the conidiaappear to be longer than in material from elsewhere (Shin & Sameva2004), but the Korean isolates included here are genetically veryclose to the ex-epitype strain CBS 102318, and regarded asconspecific. Sequence analyses of the cultures of Sphaer. geiindicate a close relationship with species such as Sphaer. patriniae(CBS 128653, 129153), from Patrinia scabiosaefolia and P. villosa(Valerianaceae) and Sphaer. cercidis (Quaedvlieg et al. 2013).Sphaerulina hyperici (Roberge ex Desm.) Verkley,Quaedvlieg & Crous, comb. nov. MycoBank MB804476. Fig.45A–D.Basionym: Septoria hyperici Roberge ex Desm., Annls Sci. Nat.,sér. 2, Bot.17: 110. 1842.≡ Phleospora hyperici (Roberge ex Desm.) Westend., Bull. Acad. r.Bruxelles 12 (9): 251. 1845.Description in planta: Symptoms leaf lesions indefinite, usuallystarting to develop from the tip of leaf lamina and progressingtowards the basis, irregular, reddish brown, surrounding leaf tissueoften yellowish; Conidiomata pycnidial, amphigenous, denslydispersed in each lesion, only partly immersed, subglobose toglobose or flask-shaped, brown to black, 55–90(–130) µm diam;ostiolum central, circular, often lifted above the leaf surface,25–35(–50) µm wide, surrounded by concolorous or somewhatdarker cells; conidiomatal wall 10–22 µm thick, composed ofa homogenous tissue of hyaline, angular cells 2–5.5 µm diam,the outermost cells pale brown with slightly thickened walls, theinner cells thin-walled. Conidiogenous cells hyaline, discrete orintegrated in 1–2-septate conidiophores, terminal ones narrowlyto broadly ampulliform, holoblastic, producing a single conidium orproliferating sympodially, 6–8(–10) × 3.5–5 µm. Conidia cylindrical,straight, more often slightly curved or flexuous, broadly rounded atthe apex, narrowing slightly to the truncate base, 1–3(–5)-septate,not or slightly constricted around the septa, hyaline, contents witha few oil-droplets and minute granular material in each cell in theliving state, with oil-droplets and granular contents in the rehydratedstate, 24–55(–63) × 2.5–3.5 µm (living; rehydrated, 1.8–2.8 µmwide). Sexual morph unknown (see notes).Description in vitro: Colonies on OA 4–7 mm diam in 2 wk, with aneven, glabrous, colourless margin; centre and some outgrowingsectors entirely pale luteous to buff, where conidia are formeddirectly on the immersed and superficial mycelium; submarginalarea blackish, due to dark pigmented hyphae and superficialpycnidia, covered by diffuse, white tufty to woolly aerial mycelium;reverse concolourous. Colonies on CMA as on OA. Colonies onMEA 3–7 mm diam in 2 wk (32–40 mm in 6 wk), with an irregular,glabrous margin; a reddish pigment diffusing into the agar; colonyrestricted, the surface cerebriform to irregularly lobed, up to 2 mmhigh, immersed mycelium dark, mostly covered by dense, pure white,woolly aerial mycelium, or salmon to saffron by masses of conidia;reverse cinnamon to brick. Colonies on CHA 3–5 mm diam in 2 wk,with an irregular, glabrous margin; colony restricted, the surfacecerebriform to irregularly lobed, up to 2 mm high, dark but mostlycovered by salmon to saffron conidial masses, and some areas witha dense, pure white, woolly-floccose aerial mycelium; reverse darkbrick.Hosts: Hypericum spp.Material examined: Bulgaria, Camkorije, on leaves of Hypericum quadrangulum,31 Aug. 1907, Fr. Bubák, distributed in Kabát & Bubák, Fungi imperfecti exsicc. 469(PC 0084544). Czech Republic, Bohemia, Bukovina, on leaves of H. perforatum,9 June 1906, J. Kabát, distributed in Kabát & Bubák, Fungi imperfecti exsicc. 421(PC 0084542); same substr., E. Moravia, M. Weisskirchen, Aug. 1941, F. Petrak(PC 0084545). France, loc. unknown, on leaves of H. perforatum, isotype PC0084532; Lighhouse of Libisey near Caen, same substr., June 1841, M. Roberge,PC 0084531; same substr., Bois de Plaisir, 16 July 1935 (Herb. G. Viennot-Bourgin),PC 0084533; same substr., Allier, Gennetines, 5 Apr. 1959, A. Lachmann, PC0084535; Landes, Etang near Seignosse, on H. helodes, 5 Aug. 1964, G. Durrieu,PC 0084536; Seine-et-Marne, Fontainebleau forest, on leaves of H. hirsutum, July1888, Feuilleaubols, PC 0084537, 0084540. Germany, Hessen-Nassau, Dillkreis,Langenaubach, on leaves of H. quadrangulum, 12 July 1931, A. Ludwig, distributedin Sydow, Mycotheca germanica 2570, PC 0084538; Brandenburg, Sadowa, onleaves of H. perforatum, 4 Aug. 1907, P. Sydow, distributed in Sydow, Mycothecagermanica 625, PC 0084543. Netherlands, Prov. Utrecht, Soest, along railroadbetween Lange Duinen and De Zoom, on living leaves of Hypericum sp., 28 July1999, G. Verkley 900, epitype designated here CBS H-21194 “MBT175361”, livingculture ex-epitype CBS 102313. Romania, Moldova, distr. Iaşi, Poeni, on leaves ofH. hirsutum, 1 Aug. 1948, C. Sandu-Ville & I. Rădulescu, distributed in Tr. Săvulescu,Herb. Mycol. Romanicum, fasc. 29, no. 1445, PC 0084534, 0084546. Sweden, E.Götland, Gryt parish, ca. 300 m E.-S.E. of Strömmen, on leaves of H. maculatum,18 July 1947, J.A. Nannfeldt 9386, distributed in S. Lundell & J.A. Nannfeldt, Fungiexsicc. Suecici, praes. Upsal. 1910, PC 0084547.Notes: According to Jørstad (1965), the pycnidia of Sphaer. hypericiare immersed hypophylously, but in most collections investigatedhere they protrude with their ostioli from either side of the leaf inabout equal numbers. Jørstad (1965) further noted that the conidialsizes varied considerably between collections, with extreme valuesranging between 15 and 57 µm for length and 1.5–2.5 µm forwidth of conidia. Vanev et al. (1997) reported conidia 21.5–54 ×2–3.2 µm. In the type specimen, which is rich in conidiomata withprotruding dry spore-masses, conidia are mostly 1–3-septate, 25–50 × 2–2.5 µm, thus in good agreement with the collection V900,which is designated as epitype.Four varieties of Septoria hyperici and a few more Septoriaspecies have been described on species of the genus Hypericum.Most of these taxa have conidia in the size range given herefor Sphaer. hyperici, indicating that these might be conspecific.However, more strains should be isolated from the different speciesof Hypericum and compared with type material of these taxa,before firm conclusions about their status can be drawn. Septoriahypericorum, which was described from H. perforatum with conidiareported 15–35 × 4–6 µm, is likely to belong in Stagonospora oranother related asexual morph. The ex-epitype strain of Sphaer.hyperici CBS 102313 is closely related to strains identified as S.298

Verkley et al.Fig. 46. Sphaerulina tirolensis. A. Conidia in planta (CBS H-21232, holotype). B. Conidia on OA (CBS 109017). Scale bars = 10 µm.mat of white or grey aerial mycelium; a diffusable pigment stainingthe surrounding agar more or less ochreous; reverse usually darkumber or olivaceous-black in the centre, surrounded by ochreous,which later becomes fulvous to apricot. Colonies on CHA 3–4 mmdiam in 2 wk, 5–6 mm in 3 wk (12–16 mm in 7 wk), with an evenbut later more irregular, glabrous, buff, rosy-buff or flesh margin;colonies pustulate to almost hemispherical, the surface olivaceousblackto dark slate blue, glabrous, or covered by diffuse, greyish orflesh aerial mycelium, some colonies later covered by a pure white,dense mat of aerial mycelium; diffusable pigment not observed;reverse blood colour to umber. Cultures produce large masses ofpale flesh conidial slime, aggregating around the colony margin.Conidiomata pycnidial or merged into stromatic complexes.Conidiogenous cells as in planta. Conidia straight to curvedor flexuous, narrowly to broadly rounded at the apex, narrowlytruncate at the base, 3–7(–9)-septate, not constricted around thesepta, hyaline, contents granular with minute oil-droplets, 54–96(–108) × 2.5–3 µm.Host: Rubus idaeus.Material examined: Austria, Tirol, Pitztal, Arzl, on living leaves of Rubus idaeus, 30July 2000, G. Verkley 1021, holotype CBS H-21232, living cultures ex-type CBS109017, 109018.Notes: Sphaerulina tirolensis differs from another septoria-likefungus described on R. idaeus, viz. Rhabdospora rubi var. rubiidaeidescribed from stems of R. idaeus in Romania, with conidia(36–)40–50(–60) × 2(–2.5) µm. Demaree & Wilcox (1943) studiedSeptoria leaf-spot diseases of raspberry (R. idaeus) in NorthAmerica. Cylindrosporium rubi, of which the sexual morph isSphaerulina rubi cf. Demaree & Wilcox (1943), is also different.The sequences of the various protein-coding genes fully supportSphaer. tirolensis as a separate species from the next taxon,Sphaer. westendorpii. The latter can be distinguished from Sphaer.tirolensis by the smaller conidia in planta [24–45(–50) × 1.8–2.2µm] and also in culture [30–68(–80) × 1.5–2(–2.5) µm].Sphaerulina westendorpii Verkley, Quaedvlieg & Crous,comb. et nom. nov. MycoBank MB804480. Fig. 47.Basionym: Septoria rubi Westend., in Westend. & Wallay, Herb.crypt. Belge, Fasc. 19, no. 938. 1854; Kickx, Fl. crypt. Flandr. 1:432. 1867.= Mycosphaerella rubi Roark, Phytopathology 11: 329. 1921.Description in planta: Symptoms leaf lesions numerous, circularto irregular, single or confluent, pale yellowish brown to greyishbrown, partly well-delimited by a dark red brown line or zone.Conidiomata pycnidial, epiphyllous, several in each lesion,immersed, subglobose to globose, brown to black, 55–90 µmdiam; ostiolum central, circular, initially 20–40 µm wide, laterbecoming more irregular and up to 70 µm wide, surrounding cellssomewhat darker; conidiomatal wall 10–15 µm thick, composed ofa homogenous tissue of hyaline, angular cells 2.5–3.5 µm diam,the outermost cells pale brown with slightly thickened walls, theinner cells thin-walled. Conidiogenous cells hyaline, discrete,rarely integrated in 1-septate conidiophores, narrowly to broadly300

A new approach to species delimitation in SeptoriaFig. 47. Sphaerulina westendorpii. A. conidia in planta (CBS H-21229, epitype); B. conidia on OA (CBS 102327). Scale bars = 10 µm.ampulliform, holoblastic, proliferating percurrently several timeswith indistinct annellations thus forming a relatively elongated neck,rarely also sympodially, 5–10(–15) × 2.5–3.5(–4) µm. Conidiafiliform-cylindrical, straight, slightly curved to flexuous, narrowlyto broadly rounded at the apex, narrowly truncate at the base,(0–)2–3(–5)-septate, not constricted around the septa, hyaline,contents granular material, sometimes with minute oil-droplets bothin the living and rehydrated state, 24–45(–50) × 1.8–2.2 µm (living;rehydrated, 1.5–2.0 µm wide).Description in vitro: Colonies on OA 8–10 mm diam in 19 d, with aneven, glabrous, colourless or buff to rosy-buff margin; immersedmycelium dark green or dull green, but sectors or other parts ofcolonies may be only olivaceous-buff or rosy-buff to salmon;colonies spreading, with irregular elevations in the centre on whichconidiomata are formed, releasing a whitish conidial slime; aerialmycelium almost absent to well developed and forming a dense,white, woolly-floccose mat; reverse olivaceous-black, locally buffto rosy-buff. Colonies on CMA 5–7(–10) mm diam in 19 d, as onOA, but more distinctly elevated and restricted. In faster growingsectors salmon to ochreous pigmentation (due to weak productionof red pigment?) in a peripheral zone preceedes the formationa dominant greens. Conidial slime also milky white, as on OA.Colonies on MEA 9–12 mm diam in 19 d, with an even, glabrouscolourless to buff margin; colonies restricted, irregularly pustulate tohemispherical; immersed mycelium buff to honey near the margin,olivaceous-black in the centre, sometimes mostly honey; almostentirely covered by a dense, appressed mat of white or grey aerialmycelium; a diffusable pigment staining the surrounding agar moreor less ochreous; reverse usually dark umber or olivaceous-black inthe centre, surrounded by ochreous, which later becomes fulvousto apricot. Colonies on CHA 7–9 mm diam in 19 d, with an evenbut later more irregular, glabrous, buff, rosy-buff or flesh margin;colonies pustulate to almost hemispherical, the surface ochreousto sienna, glabrous, or covered by diffuse, greyish or flesh aerialmycelium; diffusable pigment not observed; reverse blood colourto umber.Conidiomata pycnidial or merged into stromatic complexes,as in planta. Conidiogenous cells as in planta, mostly cylindricaland proliferating percurrently, rarely also sympodially, 7–15(–18) ×2.5–3.5(–4) µm; Conidia as in planta but mostly 3–5-septate andconsiderably longer, 30–68(–80) × 1.5–2(–2.5) µm.Hosts: Rubus spp.Material examined: Belgium, Oostacker, near Gand, on leaves of Rubus sp.,isotype BR-MYCO 159265-88, also distributed in Westend. & Wallay, Herb. crypt.Belge, Fasc. 19, no. 938. Czech Republic, Mikulov, on living leaves of Rubussp., 15 Sep. 2008, G. Verkley 6002, CBS H-21257. Netherlands, prov. Limburg,Gerendal, on living leaves of R. fruticosus s.l., 28 June 2000, G. Verkley 964,epitype designated here CBS H-21229 “MBT175362”, living cultures ex-epitypeCBS 109002, 109003; Prov. Limburg, Mookerheide, in mixed forest, on living leavesof R. fruticosus s.l., 9 Sep. 1999, G. Verkley 923, CBS H-21205, living culture CBS102327; same loc. and substr., 23 Aug. 2004, G. Verkley & M. Starink 3036, CBSH-21263, living culture CBS 117478; same substr., Prov. Limburg, St. Jansbergnear Plasmolen, in mixed forest, G. Verkley 924, CBS H-21206; Prov. Flevoland,Erkemeder strand, in sandy dunes, on living leaves of R. fruticosus s.l., 8 Sep. 1999,G. Verkley 930, CBS H-21210.Notes: Jørstad (1965) discussed the problems regarding thetaxonomy of Septoria species described from Rubus. Some of thelater described taxa have been placed in synonymy with Septoriarubi, but most still need to be reevaluated based on fresh material,culture studies, and molecular characterisation. The type materialin BR contains several well-preserved leaves of the R. fruticosuscomplex, showing typical symptoms. Fruitbodies investigatedcontained mostly 1–3-septate conidia, 17.5–40 × 1–1.5 µm, andwith the typical shape of this common fungus on Rubus spp. Thespecimen CBS H-21229 from R. fruticosus in the south of theNetherlands, is chosen as epitype. This species is nested withinthe Sphaerulina-clade, and a new name in Sphaerulina shouldwww.studiesinmycology.org301

Verkley et al.therefore be proposed for it. Sphaerulina rubi Demaree & Wilcoxis already in use for another fungus with a Cylindrosporium sexualstate (C. rubi Ellis & Morgan, conidia 40–55 × 2.5 µm cf. Saccardo),so Sphaer. westendorpii is proposed here as nomen novum.Sphaerulina rehmiana has been associated with Septoria rosaeCBS 355.58, which has been identified as S. rosae, is geneticallydistinct from Sphaer. westendorpii (Quaedvlieg et al. 2013).Insufficiently known speciesFor the following species no host material was available and thesehave only been studied in culture, mostly based on older isolates,for which details are not described when the strain is regarded asdegenerate.Septoria hippocastani Berk. & Broome, Ann. Mag. nat.Hist., Ser. 2, 5: 379. 1850.Material examined: Germany, Pfälzer Wald, on Aesculus hippocastanum, Sep1961, deposited Nov 1961, W. Gerlach, living culture CBS 411.61 (= BBA 9619).Note: CBS 411.61 is degenerated and sterile, but based onmultilocus sequence analysis it can be concluded that it is aSeptoria s. str. (Fig. 2).Septoria limonum Pass., Atti Soc. crittog. ital., 2: 23. 1879.Description in vitro (18 ºC, near UV): Colonies on OA 20–29 mmdiam in 3 wk, with an even, colourless margin; colonies plane,spreading, immersed mycelium in the centre flesh, surrounded by abroad zone of dark vinaceous to brown-vinaceous, aerial myceliumabsent, or scarce, with few tufts of pure white aerial hyphae; reverseconcolorous. No sporulation observed. Colonies on MEA 25–32 mmdiam in 3 wk, with an even to somewhat ruffled, buff to colourlessmargin; colonies spreading, somewhat elevated in the centre,immersed mycelium appearing grayish, the colony surface almostentirely covered by a dense mat of white to grey, woolly-floccoseaerial mycelium; reverse in the centre rust, surrounded by a broadzone of olivaceous-grey to greenish grey, which is sharply borderedby the narrow buff to luteous margin. No sporulation observed.Material examined: Italy, Citrus limonium, isolated Mar. 1951, deposited by G.Goidanich, living culture CBS 419.51.Notes: In the multilocus sequence analysis (Fig. 2) this straingroups with CBS 356.36 (S. citricola) and few other strains in aweakly supported clade close to the plurivorous Septoria protearumand isolates of Septoria citri. Due to the lack of morphologicalinformation linked to this strain, its identity remains uncertain.DISCUSSIONThe type species of the genus Septoria, S. cytisi, could not beincluded in the multilocus analysis due to the fact that only LSU andITS sequences were available for this species. However, as shownby Quaedvlieg et al. (2011), the position of this taxon is beyonddoubt central to the clade indicated here as the main Septoriaclade. Several “typical” Septoria species infecting herbaceousplants proved genetically distant from S. cytisi and its relatives, andcan best be classified in separate genera, Sphaerulina (Quaedvlieget al. 2013) and Caryophylloseptoria.The identification of Septoria has thus far mainly relied on hosttaxonomy and morphological characters of the shape, size, andseptation of conidia (Jørstad 1965, Teterevnikova-Babayan 1987,Andrianova 1987, Vanev et al. 1997, Muthumary 1999, Shin &Sameva 2004, Priest 2006). Taxonomists have noted that conidialwidth is generally a more reliable character for species identificationthan conidial length, which is more variable. Some also noticed thatSeptoria material collected from the same location and host species,but under different environmental conditions or at different times inthe same season, can differ considerably in average conidial sizes,particularly length (Jørstad 1965). These findings are also confirmedin our study. Reliable identification based on morphologicalcomparison alone is not possible for many Septoria species, andreference sequences will have to be produced for many more taxain future. This will require critical studies of type specimens andalso require the recollection of fresh material. It is crucial that thetypes of the oldest names available for Septoria on certain hostswill need to be studied as part of such work, and where necessaryepitypes designated to fix the genetic application of these names.Although hardly practised thus far by taxonomists, isolation and studyin culture is a valuable and indispensable tool for Septoria speciesdelimitation and identification. We noted that the shape of conidiaon OA generally agree best with those in the source material onthe natural substrate. Under standardised incubation conditions onstandard media cultures originating from deviant voucher material,for example because it developed under adverse conditions, showagain their “normal” phenotypes which is better for comparisonpurposes. Extracting DNA from axenic cultures is straight-forwardand less prone to errors caused by contaminants, a problem oftenencountered when extracting DNA from plant tissue.The K2P results show that the five protein coding genes usedduring this research should all theoretically be able to distinquishevery species in this dataset as their average inter- to intraspecificdistance ration is over 10:1. The problem is that these are averagenumbers, not absolute numbers. For example, the Btub K2P graphin Fig. 1 starts at 0 and not at at 0.29, meaning that there actuallyare a few species in our dataset that are not distinguishable by Btubalone (although obviously by far most species in fact are). To avoidthis, we recommend using at least two of the protein coding lociused in this study for identification of Septoria and allied genera.Because EF and Btub both have very high PCR success ratesand have the highest species resolution percentage of all the lociused in this study, we recommend using these two loci for speciesidentification purposes. It is advisable, however, to first sequencethe ITS and LSU for a preliminary genus identification by blasting inGenBank and other useful databases.The multilocus sequence dataset generally provided goodresolution, with maximum to high bootstrap support for almost allterminal and most of the deeper nodes of the phylogenetic tree. Theintraspecific variation in the genes investigated is limited for mosttaxa, even if specimens originate from such distant geographicorigins as New Zealand, Korea and Europe (S. convolvuli, S.leucanthemi, S. polygonorum). Strains assigned to Septoria citripossibly represent a species complex, one of few groups withinthe main Septoria clade that was not resolved. One case of crypticspeciation is revealed in the S. chrysanthemella complex, whereat least two genetically discrete entities can be found that arephenotypically difficult to distinguish.Our results confirm that most species of Septoria have narrowhost ranges, being limited to a single genus or a few genera of thesame plant family. There were a few notable exceptions, however.We demonstrated that the supposed single-family host ranges302

A new approach to species delimitation in Septoriaof Septoria paridis (Liliaceae) and S. urticae (Urticaceae), eachactually included one additional family (Violaceae and Lamiaceae,respectively). More surprisingly Septoria protearum, previouslyonly associated with Proteaceae (Protea) (Crous et al. 2004), wasnow found to be also associated with Araceae (Zanthedeschia),Aspleniaceae (Asplenium), Rutaceae (Boronia), Boraginaceae(Myosotis), Oleandraceae (Nephrolepis), and Rosaceae (Geum).To our knowledge this is the first study to provide DNA-basedevidence confirming that multiple family-associations occur for asingle species in Septoria. It is to be expected that collecting andsequencing of more material will show more taxa to be plurivorous,and perhaps S. paridis and S. urticae will be among those.Coevolution of plant pathogenic fungi and their hosts hasbeen documented for several groups. Other possible patterns ofevolution have already been suggested for septoria-like fungi inprevious studies but the data available were not sufficient to fullyunderstand the evolution of these fungi (Feau et al. 2006). Therobust phylogeny we inferred revealed polyphyletic distributionpatterns over the entire range of the Septoria clade for no less than10 (singletons excluded) of the host families represented. Theseresults clearly reject the coevolution hypothesis for Septoria, asspecies do not seem to consistently coevolve with hosts from asingle host family but frequently jump successfully to hosts in newfamilies. Caryophylloseptoria seems an exceptional genus in that itonly comprises species infecting Caryophyllaceae, but it should benoted that it now only contains four species, as three other speciesinfecting this family cluster distant within the Septoria clade (S.cucubali, S. cerastii, and S. stellariae). In the other clades somesingle-host family clusters can be found, but they do not comprisemore than six fungal species (S. chrysanthemella and closerelatives of Asteraceae within subclade 4b).We conclude that trans-family host jumping must be a majorforce driving the evolution of Septoria and Sphaerulina. Specieslike S. paridis and S. urticae infecting (at least) two plant familiesmay in fact be cases in point, as they could be in a transitionalperiod of gradually changing from one principal host family toanother, unrelated one. The genetic basis for successful hostjumping is unclear. It may involve horizontal gene transfer, transientphases of endophytic infections in “non-hosts” as a first step in aprocess of genetic adaptation to new optimal hosts, or perhaps acombination of both. Plant pathological research may shed morelight on the mechanisms driving Septoria evolution which would beimportant, as it may in future allow accurate assessment of risksinvolved with the introduction of new crops in areas where Septoriaspecies occur on the local flora.Host family indexThe taxa fully described in the Taxonomy section of this study arelisted below according to the host family.AceraceaeSphaerulina acerisApiaceaeSeptoria aegopodiiS. aegopodinaS. anthrisciS. apiicolaS. heracleiS. petroseliniS. siiAraceaeSeptoria protearumAspleniaceaeSeptoria protearumAsteraceaeSeptoria chromolaenaeS. chrysanthemellaS. ekmannianaS. erigerontisS. hypochoeridisS. lactucaeS. leucanthemiS. matricariaeS. putridaS. senecionisSphaerulina sociaBetulaceaeSphaerulina betulaeBoraginaceaeSeptoria protearumCampanulaceaeSeptoria campanulaeS. citri complexCaryophyllaceaeCaryophylloseptoria lychnidisC. silenesC. spergulaeSeptoria cerastiiS. cucubaliS. stellariaeConvolvulaceaeSeptoria convolvuliCornaceaeSphaerulina cornicolaCucurbitaceaeSeptoria cucurbitacearumDipsacaceaeSeptoria scabiosicolaFabaceaeSeptoria astragaliHypericaceaeSeptoria hypericiIridaceaeSeptoria sisyrinchiiLamiaceaeSeptoria galeopsidisS. lamiicolaS. melissaeS. stachydisLiliaceaeSeptoria paridisOleandraceaeSeptoria protearumOnagraceaeSeptoria epilobiiPassifloraceaeSeptoria passifloricolaPolemoniaceaeSeptoria phlogisPolygonaceaeSeptoria polygonorumwww.studiesinmycology.org303

Verkley et al.S. rumicumPrimulaceaeSeptoria lysimachiaeRanunculaceaeSeptoria clematidisS. lycoctoniS. napelliRosaceaeSeptoria citri complexSphaerulina geiSphaer. tirolensisSphaer. westendorpiiRubiaceaeSeptoria cruciataeS. coprosmaeRutaceaeSeptoria protearumSalicaceaeSphaerulina frondicolaScrophulariaceaeSeptoria digitalisUrticaceaeSeptoria urticaeVerbenaceaeSeptoria verbenaeViolaceaeSeptoria paridisACKNOWLEDGEMENTSWe thank the technical staff of the CBS Collection for their support during thisproject. Arien van Iperen (cultures) and Marjan Vermaas (photographic plates)are acknowledged for their invaluable assistance. Huub van der Aa is thankedfor his help during collecting and identifying material. Simeon Vanev is gratefullyacknowledged for his support with collecting bibliographic data and translatingRussian diagnoses. Part of the DNA barcode sequencing results used in this studywas financially supported by the Fonds Economische Structuurversterking (FES,Dutch Ministery of Education, Culture and Science grant BEK/BPR-2009/137964-U,“Making the Tree of Life Work”).REFERENCESAndrianova TV (1987). Problems of classification and phylogeny of Septoriaspecies. Mikologiya i Fitopatologiya 21: 393–399.Aptroot A (2006). Mycosphaerella and its anamorphs 2. Conspectus ofMycosphaerella. CBS Biodiversity Series 5. CBS-KNAW Fungal BiodiversityCentre, Utrecht, The Netherlands.Arx JA von (1983). Mycosphaerella and its anamorphs. Proceedings KoninklijkeNederlandse Akademie van Wetenschappen, Series C - Biological and MedicalSciences 86 (1): 15–54.Beach WS (1919). Biological spezialization in the genus Septoria. American Journalof Botany 6: 1–33.Braun U (1995). A monograph of Cercosporella, Ramularia and allied genera(Phytopathogenic Hyphomycetes). Vol. 1. IHW-Verlag, Eching.Breeÿen A den, Groenewald JZ, Verkley GJM, Crous PW (2006). Morphological andmolecular characterisation of Mycosphaerellaceae associated with the invasiveweed, Chromolaena odorata. Fungal Diversity 23: 89–110.Cheewangkoon R, Crous PW, Hyde KD, Groenewald JZ, To-anan C (2008). Speciesof Mycosphaerella and related anamorphs on Eucalyptus leaves from Thailand.Persoonia 21: 77–91.Cochran LC (1932). A study of two Septoria leaf spots of celery. Phytopathology22: 791–812.Constantinescu O (1984). Taxonomic revision of Septoria-like fungi parasitic onBetulaceae. Transactions of the British Mycological Society 83: 383–398.Crous PW, Aptroot A, Kang J-C, Braun U, Wingfield MJ (2000). The genusMycosphaerella and its anamorphs. Studies in Mycology 45: 107–121.Crous PW, Groenewald JZ (2005). Hosts, species and genotypes: opinions versusdata. Australasian Plant Pathology 34: 463–470.Crous PW, Denman S, Taylor JE, Swart L, Palm, ME (2004a).Cultivation anddiseases of Proteaceae: Leucadendron, Leucospermum and Protea. CBSBiodiversity Series 2: 1–228.Crous PW, Groenewald JZ, Pongpanich K, Himaman W, Arzanlou M, Wingfield MJ(2004b). Cryptic speciation and host specificity among Mycosphaerella spp.occurring on Australian Acacia species grown as exotics in the tropics. Studiesin Mycology 50: 457–469.Crous PW, Kang J-C, Braun U (2001). A phylogenetic redefinition of anamorphgenera in Mycosphaerella based on ITS rDNA sequences and morphology.Mycologia 93: 1081–1101.Crous PW, Slippers B, Wingfield MJ, Rheeder J, Marasas WFO, et al. (2006a).Phylogenetic lineages in the Botryosphaeriaceae. Studies in Mycology 55:235–253.Crous PW, Verkley GJM, Groenewald JZ, Samson RA (2009). CBS LaboratoryManual Series 1. CBS-KNAW Fungal Biodiversity Centre, Utrecht, TheNetherlands.Crous PW, Wingfield MJ, Mansilla JP, Alfenas AC, Groenewald JZ (2006b).Phylogenetic reassessment of Mycosphaerella spp. and their anamorphsoccurring on Eucalyptus. II. Studies in Mycology 55: 99–131.Demaree JB, Wilcox MS (1943). The fungus causing the so-called “Septoria leafspotdisease” of raspberry. Phytopathology 33: 986–1003.Diedicke H (1915). Pilze VII, Sphaeropsidaea, Melanconiae,. Kryptogamenfl. MarkBrandenburg 9: 1–962.Farr DF (1991). Septoria species on Cornus. Mycologia 83: 611–623.Farr DF (1992). Species of Septoria on the Fabaceae, subfamily Faboidae, tribeGenistae. Sydowia 44: 13–31.Feau N, Hamelin RC, Bernier L (2006). Attributes and congruence of three moleculardata sets: inferring phylogenies among Septoria-related species from woodyperennial plants. Molecular Phylogenetics and Evolution 40: 808–829.Gabrielson RL, Grogan RG (1964). The late blight organism Septoria apiicola.Phytopathology 54: 1251–1257.Goodwin SB, Dunkle LD, Zismann VL (2001). Phylogenetic analysis of Cercosporaand Mycosphaerella based on the internal transcribed spacer region ofribosomal DNA. Phytopathology 91: 648–658.Grove WB (1935). British stem and leaf fungi (Coelomycetes). Vol. I: Sphaeropsidales,Sphaerioideae with hyaline conidia: 1–488.Hall TA (1999). BioEdit: A user-friendly biological sequence alignment editor andanalysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41:95–98.Hebert PDN, Cywinska A, Ball SL, DeWaard JR (2003). Biological identificationsthrough DNA barcodes. Proceedings of the Royal Society of London SeriesB 270: 313–321.Huelsenbeck JP, Ronquist F (2001). MRBAYES: Bayesian inference of phylogenetictrees. Bioinformatics 17: 754–755.Jørstad I (1965). Septoria and septoroid fungi on dicotyledones in Norway. Skrifterutgitt av Det Norske Videnskaps-Akademi i Oslo, I: Mat-Naturv. Klasse 22:1-110.Katoh K, Misawa K, Kuma K, Miyata T (2002). MAFFT: a novel method for rapidmultiple sequence alignment based on fast Fourier transform. Nucleic AcidsResearch 30: 3059–3066.Kuijpers AFA, Aptroot A (2004). A revision of Mycosphaerella section Longispora(Ascomycetes). Nova Hedwigia 75: 451–468.Lombard L, Crous PW, Wingfield BD, Wingfield MJ (2010). Species concepts inCalonectria (Cylindrocladium). Studies in Mycology 66: 1–13.Markevičius V, Treigienė A (2003). Sphaeropsidales. Genus Septoria. MycotaLithuaniae 10, 3: 1–199.Mason-Gamer RJ, Kellogg EA (1996). Testing for phylogenetic conflict amongmolecular data sets in the tribe Triticeae (Gramineae). Systematic Biology 45:524–545.Muthumary J (1999). First contribution to a monograph of Septoria species in India.Madras: Centre for advanced studies in Botany.Nylander JAA (2004). MrModeltest v2. Program distributed by the author.Evolutionary Biology Centre Uppsala University.Petrak F (1925). Beiträge zur Pilzflora Südost-Galiziens und der Zentralkarpathen.Hedwigia 65: 179–330.Petrak F (1957). Die auf Aconiten vorkommenden Arten der Gattung Septoria.Sydowia 11: 375–379.Priest MJ (2006). Fungi of Australia. Septoria. ABRS, Canberra: CSIRO Publishing,Melbourne.Punithalingam E (1967a). Septoria chrysanthemella. CMI Descriptions of PathogenicFungi and Bacteria 137. Commonwealth Mycological Institute, Kew.Punithalingam E (1967b). Septoria leucanthemi. CMI Descriptions of PathogenicFungi and Bacteria 138. Commonwealth Mycological Institute, KewPunithalingam E (1967c). Septoria obesa. CMI Descriptions of Pathogenic Fungiand Bacteria 139. Commonwealth Mycological Institute, Kew.304

A new approach to species delimitation in SeptoriaPunithalingam E (1967d). Septoria socia. CMI Descriptions of Pathogenic Fungi andBacteria 140. Commonwealth Mycological Institute, Kew.Punithalingam E (1982). Septoria cucurbitacearum. CMI Descriptions of PathogenicFungi and Bacteria 740. Commonwealth Mycological Institute, Kew.Punithalingam E, Holiday P (1972). Septoria lactucae. CMI Descriptions ofPathogenic Fungi and Bacteria 335. Commonwealth Mycological Institute,Kew.Punithalingam E, Wheeler BEJ (1965). Septoria spp. occurring on species ofChrysanthemum. Transactions of the British Mycological Society 48: 423–439.Quaedvlieg W, Kema GHJ, Groenewald JZ, Verkley GJM, Seifbarghi S, Razavi M,Gohari A, Mirzadi, Mehrabi R, Crous PW (2011). Zymoseptoria gen. nov.: anew genus to accommodate Septoria-like species occurring on graminicoloushosts. Persoonia 26: 57–69.Quaedvlieg W, Groenewald JZ, Jesús Yáñez-Morales M, Crous PW (2012). DNAbarcoding of Mycosphaerella species of quarantine importance to Europe.Persoonia 29: 101–115.Quaedvlieg W, Verkley GJM, Shin H-D, Barreto RW, Algenas AC, Swart WJ,Groenewald JZ, Crous PW (2013). Sizing up Septoria. Studies in Mycology 75:307–390. (this volume).Radulescu E, Negru A, Docea E (1973). Septoriozele din România. Bucureşti:Editura Academiei Republicii Socialiste România.Rayner RW (1970). A mycological colour chart. CMI and British Mycological Society.Kew, UK.Saccardo PA (1884). Sylloge Fungorum: Sylloge Sphaeropsidearum etMelanconiearum. 3: 542. Padova, Italy.Saccardo PA (1895). Sylloge fungorum: Supplemental Universale, Pars III 11:1–753. Padova, Italy.Saccardo PA (1906). Sylloge fungorum: Supplemental Universale, Pars VII 18:1–838. Padova, Italy.Saccardo PA, Sydow P (1899). Sylloge Fungorum: Supplemental Universale, ParsIV 14: 1–1316. Padova, Italy.Sheridan JE (1968). Conditions for infection of celery by Septoria apiicola. PlantDisease Report 52: 142–145.Shin HD, Sameva EF (2004). Septoria in Korea (Plant Pathogens of Korea 11).National Institute of Agricultural Science and Technology, Republic of Korea.Simon UK, Groenewald JZ, Stierhof Y-D, Crous PW, Bauer R (2009). A necrotrophicphytopathogen forming a special cellular interaction with its host Aegopodiumpodagraria. Mycological Progress 9: 49–56.Smissen RD, Clement JC, Garnock-Jones PJ, Chambers JK (2002). Subfamilialrelationships within Caryophyllaceae as inferred from 5’ ndhF sequences.American Journal of Botany 89: 1336–1341.Stewart EL, Liu Z, Crous PW, Szabo LJ (1999). Phylogenetic relationships amongsome cercosporoid anamorphs of Mycosphaerella based on rDNA sequenceanalysis. Mycological Research 103: 1491–1499.Sutton BC (1980). The Coelomycetes. Fungi imperfecti with Pycnidia, Acervuli andStromata. Commonwealth Mycological Institute, Kew, Surrey, England.Sutton BC, Pascoe IG (1987). Septoria species on Acacia. Transactions of theBritish Mycological Society 89: 521–532.Sutton BC, Pascoe IG (1989). Some Septoria species on native Australian plants.Studies in Mycology 31: 177–186.Sutton BC, Hennebert GL (1994). Interconnections amongst anamorphs and theirpossible contribution to ascomycete systematics. In Ascomycete systematics:problems and perspectives in the nineties (Hawksworth DL, ed.), pp. 77–98.Plenum Press, New York, USA.Sutton BC, Waterston JM (1966) Septoria apiicola. CMI Descriptions of PathogenicFungi and Bacteria 88. Commonwealth Mycological Institute, Kew.Sydow H von (1924). Beiträge zur Kenntnis der Pilzflora Neu-Seelands. I. AnnalesMycologici 22: 299–317.Tamura K, Dudley J, Nei M, Kumar S (2007). MEGA4: Molecular evolutionarygenetics analysis (MEGA) software version 4.0. Molecular Biology andEvolution 24: 1596–1599.Teterevnikova-Babayan DN (1987). Fungi of the genus Septoria in the U.S.S.R.Yerevan: Akademia Nauk Armyanskoi SSR.Vanev SG, Sameva EF, Bakalova GG (1997). Fungi Bulgaricae 3. OrdoSphaeropsidales. Sofia: Editio Academica Prof. Marin Drinov.Verkley GJM (1998a). Ultrastructural evidence for two types of proliferation in asingle conidiogenous cell of Septoria chrysanthemella. Mycological Research102: 368–372.Verkley GJM (1998b). Ultrastructure of conidiogenesis and conidia in two species ofSeptoria sensu lato. Mycologia 90: 189–198.Verkley GJM, Priest MJ (2000). Septoria and similar coelomycetous anamorphs ofMycosphaerella. Studies in Mycology 45: 123–128.Verkley GJM, Starink-Willemse M (2004a). A phylogenetic study of some Septoriaspecies pathogenic to Asteraceae based on ITS ribosomal DNA sequences.Mycological Progress 3: 315–322.Verkley GJM, Starink-Willemse M, Iperen A van, Abeln ECA (2004b). Phylogeneticanalyses of Septoria species based on the ITS and LSU-D2 regions of nuclearribosomal DNA. Mycologia 96: 558–571.Verkley GJM, Crous PW, Groenewald JZ, Braun U, Aptroot A (2004c). Mycosphaerellapunctiformis revisited: morphology, phylogeny, and epitypification of the typespecies of the genus Mycosphaerella (Dothideales, Ascomycota). MycologicalResearch 108: 1271–1282.Waddell HT, Weber GF (1963). Physiology and pathology of Septoria species onChrysanthemum. Mycologia 55: 442–452.White TJ, Bruns T, Lee S, Taylor JW (1990). Amplification and direct sequencing offungal ribosomal RNA genes for phylogenetics. In: PCR protocols: a guide tomethods and applications (Innis MA, Gelfland DH, Sininsky JJ, White TJ, eds).Academic Press, San Diego, USA: 315–322.Zalar P, Hoog GS de, Schroers H-J (2007). Phylogeny and ecology of the ubiquitoussaprobe Cladosporium sphaerospermum, with descriptions of seven newspecies from hypersaline environments. Studies in Mycology 58: 157–183.www.studiesinmycology.org305

A new approach to species delimitation in Septoria - CBS - KNAW

Create successful ePaper yourself

Delete template?

Save as template?