BARLEY GENETICS NEWSLETTER - GrainGenes

Barley Genetics 

Newsletter 

Volume 38 

Editorial Committee 

P. Bregitzer 

U. Lundqvist 

V. Carollo Blake 

From left to right, CIho 4196, Mutant G07-014, and Morex spike. 

From A vrs1 mutant in CIho 4196 to facilitate breeding of 6-rowed cultivars with 

Fusarium Head Blight resistance 

The Barley Genetics Newsletter is published electronically at 

http://wheat.pw.usda/gov/ggpages/bgn 

Contributions for publication in the Barley Genetics Newsletter should be sent to the 

Technical Editor, Dr. Phil Bregitzer (see Instructions to Authors on the following pages 

for details on submission). Reports on research activities (including ongoing projects, 

descriptions of new genetic and cytological techniques, and current linkage maps) are 

invited for the Research Notes section. Researchers are encouraged to submit descriptions 

of genetic stocks for the Barley Genetic Stocks section. Letters to the editors are welcome 

and will be published. Please inform the Technical Editor of any errors you notice in this 

volume or in previous volumes; corrections will be published in future volumes, and 

electronic copy will be appropriately corrected. 

Coordinators assigned at the International Barley Genetics Symposium should submit 

their reports by April 30, 2008 to: 

Dr. Udda Lundqvist 

Coordinator, Barley Genetics Newsletter 

Nordic Genetic Resource Center 

P.O. Box 41 

SE-230 53 Alnarp, Sweden 

Phone: +46 40 536640 

FAX: +46 40 536650 

Cell phone: +46 70 624 1502 

E-mail: udda@nordgen.org 

All correspondence and contributions to the Barley Genetics Newsletter should be in 

English. Please include your complete mailing address, including your country, and an email 

address (if you have one) with all correspondence and contributions. 

Acknowledgements 

The contributors of research reports and the diligence of the many Coordinators make 

this publication possible. Victoria Carollo Blake and the GrainGenes team at the USDA- 

ARS make possible the electronic version of BGN.

INSTRUCTIONS FOR CONTRIBUTORS 

TO VOLUME 38 (2008) OF THE BARLEY GENETICS NEWSLETTER 

Submissions will be published via the internet (http://wheat.pw.usda.gov/ggpages/bgn/). 

Approximately quarterly, new submissions will be appended to existing submissions; the 

page numbers of existing submissions will not change and citation information will 

remain constant. BGN 37 will consist of all submissions received prior to the end of the 

calendar year of 2007, and will be compiled into a printable version that will be available 

via the Graingenes website. Send submissions to: 

Dr. Phil Bregitzer, BGN Technical Editor, 

USDA-ARS, 1691 S. 2700 W., 

Aberdeen, ID, 83210, USA. 

Telephone: (voice) 208-397-4162 ext. 116; (fax) 208-397-4165 

e-mail: phil.bregitzer@ars.usda.gov 

Manuscripts should be written in English and be brief. Each paper should be prepared 

separately, with the title and the authors' names and addresses at the top of the first page. 

For each paper to be included in Barley Genetics Newsletter Volume 38, submit a file to 

the Technical Editor in one of the following ways (in order of preference): 

1. As an attachment to an e-mail message 

2. A 3.5" diskette or CD; include also one high quality printed copy 

3. High-quality paper copy (acceptable only in unusual circumstances) 

Instructions for file preparation 

Text and tables for each article can be in one file, but place each figure in a separate file. 

Name these files with your last name, a manuscript number, and "txt" or "fig" (in the case 

of separate files for text and figures), and a number for each figure (in the case of 

separate files). For example, the files for a manuscript plus two figures from Phil 

Bregitzer would be: bregitzer1txt.wpd, bregitzer1fig1.gif , and bregitzer1fig2.gif . 

File Formats for Text and Tables: Preferred: Word or WordPerfect or Word, PCcompatible 

formatting. Macintosh formats are not acceptable 

Please keep formatting simple and consistent with that of BGN 37. Use Times New 

Roman Font, 12 pt, with both right and left justification, except for the title and author 

information and tables, which should be centered. Please use only tabs and hard returns in 

the preparation of text files. Tables must be prepared using the table feature of your word 

processing program, and not prepared using tabs. Please do not add additional lines to 

your table except with the table formatting tools in your word processor. Please use 

center justification for tables, and not "full" justification (i.e. left and right justification, 

that is used for text). Figures can be submitted in any common format but avoid the 

necessity of color for interpretation, to enable printing and copying hardcopy in black and 

white without losing information contained in the figures.

The Barley Genetics Newsletter is published electronically at 

http://wheat.pw.usda/gov/ggpages/bgn 

Contributions for publication in the Barley Genetics Newsletter should be sent to the 

Technical Editor, Dr. Phil Bregitzer (see Instructions to Authors on the following pages 

for details on submission). Reports on research activities (including ongoing projects, 

descriptions of new genetic and cytological techniques, and current linkage maps) are 

invited for the Research Notes section. Researchers are encouraged to submit descriptions 

of genetic stocks for the Barley Genetic Stocks section. Letters to the editors are welcome 

and will be published. Please inform the Technical Editor of any errors you notice in this 

volume or in previous volumes; corrections will be published in future volumes, and 

electronic copy will be appropriately corrected. 

Coordinators assigned at the International Barley Genetics Symposium should submit 

their reports by April 30, 2008 to: 

Dr. Udda Lundqvist 

Coordinator, Barley Genetics Newsletter 


P.O. Box 41 


Phone: +46 40 536640 

FAX: +46 40 536650 

Cell phone: +46 70 624 1502 

E-mail: udda@nordgen.org 

All correspondence and contributions to the Barley Genetics Newsletter should be in 

English. Please include your complete mailing address, including your country, and an email 

address (if you have one) with all correspondence and contributions. 


The contributors of research reports and the diligence of the many Coordinators make 

this publication possible. Victoria Carollo Blake and the GrainGenes team at the USDA- 

ARS make possible the electronic version of BGN.

INSTRUCTIONS FOR CONTRIBUTORS 

TO VOLUME 38 (2008) OF THE BARLEY GENETICS NEWSLETTER 

Submissions will be published via the internet (http://wheat.pw.usda.gov/ggpages/bgn/). 

Approximately quarterly, new submissions will be appended to existing submissions; the 

page numbers of existing submissions will not change and citation information will 

remain constant. BGN 37 will consist of all submissions received prior to the end of the 

calendar year of 2007, and will be compiled into a printable version that will be available 

via the Graingenes website. Send submissions to: 

Dr. Phil Bregitzer, BGN Technical Editor, 

USDA-ARS, 1691 S. 2700 W., 

Aberdeen, ID, 83210, USA. 

Telephone: (voice) 208-397-4162 ext. 116; (fax) 208-397-4165 

e-mail: phil.bregitzer@ars.usda.gov 

Manuscripts should be written in English and be brief. Each paper should be prepared 

separately, with the title and the authors' names and addresses at the top of the first page. 

For each paper to be included in Barley Genetics Newsletter Volume 38, submit a file to 

the Technical Editor in one of the following ways (in order of preference): 

1. As an attachment to an e-mail message 

2. A 3.5" diskette or CD; include also one high quality printed copy 

3. High-quality paper copy (acceptable only in unusual circumstances) 

Instructions for file preparation 

Text and tables for each article can be in one file, but place each figure in a separate file. 

Name these files with your last name, a manuscript number, and "txt" or "fig" (in the case 

of separate files for text and figures), and a number for each figure (in the case of 

separate files). For example, the files for a manuscript plus two figures from Phil 

Bregitzer would be: bregitzer1txt.wpd, bregitzer1fig1.gif , and bregitzer1fig2.gif . 

File Formats for Text and Tables: Preferred: Word or WordPerfect or Word, PCcompatible 

formatting. Macintosh formats are not acceptable 

Please keep formatting simple and consistent with that of BGN 37. Use Times New 

Roman Font, 12 pt, with both right and left justification, except for the title and author 

information and tables, which should be centered. Please use only tabs and hard returns in 

the preparation of text files. Tables must be prepared using the table feature of your word 

processing program, and not prepared using tabs. Please do not add additional lines to 

your table except with the table formatting tools in your word processor. Please use 

center justification for tables, and not "full" justification (i.e. left and right justification, 

that is used for text). Figures can be submitted in any common format but avoid the 

necessity of color for interpretation, to enable printing and copying hardcopy in black and 

white without losing information contained in the figures.

Jørgen Løhde: In Memoriam 

Barley breeder PhD Jørgen Juul Hansen Løhde passed away in Landskrona, Sweden on July 12, 2008. 

He is survived by his wife Anne Marie and daughters Christina and Maria, son-in-law Andreas, his two 

sisters, his brother and their families. 

Jørgen Løehde (JL) was born March 20, 1948 on the island of Fyn in Denmark. 

He became interested at an early age in farming and agricultural research. After internships at 

Trollsminde Research Farm and Idagård Farm in Slagelse, followed by education at Lyngby Agricultural 

School and military service at the Royal Guard in Copenhagen, JL studied at the Royal Veterinary & 

Agricultural University (RVAU), Denmark. He received his degree in agriculture in 1974, and 

continuing his studies obtained his PhD in 1977 with a dissertation on timothy. Through 1981, he worked

at RVAU as a lecturer, as well as co-researcher on the project, “Multi-line Varieties in Barley.” This 

involved cross-breeding of some 30 genes for mildew-resistance into the well-adapted variety Pallas, 

work which subsequently has been widely used within plant breeding research. 

In 1981, JL began his lifelong employment at Weibulls of Landskrona, Sweden. For the first two years, 

he headed up the company’s breeding station in Great Britain, where he among other things took over 

responsibility for a successful winter wheat program. The well-known wheat variety Sleipner got listed 

during these years in amongst other countries England and Denmark. JL carried out the demanding task 

of stock maintenance and seed multiplication for production in an exemplary manner. 

In 1983, Weibulls called JL back to Sweden, where he became the deputy breeder for the comprehensive 

barley breeding program, for which he took over full responsibility in 1986. Together with senior 

breeders Göran Ewertson and Per Lundin, he stood behind the development of internationally successful 

varieties such as Kinnan, Goldie, Maud, Mentor and Meltan. 

Among JL’s more recent developed varieties is Pongo, which in addition to Sweden has spread 

throughout Lithuania; and Cecilia and Gomera which have been marketed even in Spain. The varieties 

Tofta and Maaren were bred for the starch industry in Finland as well as Denmark. The jewel in the 

crown of JL’s many contributions to variety development is his breeding of the extremely high-producing 

variety Gustav, which today is the most cultivated feed barley variety in Sweden. 

JL also had great interest in improving the quality of malt barley for both the beer and whisky industries. 

Currently under propagation are two of JL’s unique malt whisky varieties, Makof and Catriona. JL’s 

strong leadership qualities were put to good use by the company when, from 1995 to 2006, he served as 

head of the Cereal Breeding Department at Svalöf Weibull. 

JL was respected and appreciated both in Sweden and internationally, in the plant breeding community as 

well as in the malt and brewery industries. He represented Sweden in the European Brewery 

Convention. He was active in the organizational committee for the International Barley Genetics 

Symposium held in Helsingborg in 1991 and several other professional meetings & congresses; and was 

also active within the Nordic Agricultural Research Association and Eucarpia. 

JL was very much a family man, even though barley breeding took much of his time during the growing 

season. He also gave much of his energy to his beloved hobbies of hunting and hunting dogs. No 

meeting, business trip or other activity could collide with the Swedish moose hunting season for JL. He 

was chair of Svalöf Weibulls’ hunting club, and his family bought a farm, his beloved Gustavslund, with 

hunting fields in the southern Swedish province of Småland. 

We who have had the privilege of working for many years with JL will remember him as a competent, 

loyal and thoughtful colleague, with warm humor and great professional and social competence. He was 

a skillful, respected and stimulating leader; and always, a trustworthy and thoughtful friend. We will 

deeply be missing Jørgen Løhde. 

Gunnar Svensson, Morten Rasmussen och Therese Christerson, Sweden

Table of Contents 

Barley Genetics Newsletter, Volume 38, 2008 

[Other volumes of the Barley Genetics Newsletter] 

Information about the Barley Genetics Newsletter, p. i 

Instructions for contributors, p. ii 

Memoriam for Jørgan Løhde, p. iii 

Research Notes 

Gamma-induced pericentric inversion in barley (Hordeum vulgare L. (.doc, .pdf) 1-3 

K.I. Gecheff 

Yield response to treatment with vesicular-arbuscular myccorrhiza (VAM) in a 

breeding population of barley (.doc, .pdf) 

M.C. Therrien 

A vrs1 mutant in CIho 4196 to facilitate breeding of 6-rowed cultivars with Fusarium 

Head Blight resistance (.doc, .pdf) 

C. Boyd, R. Horsley, A. Kleinhofs 

Worth of Genetic Parameters to Sort out New Elite Barley Lines over Heterogeneous 

Environments (.doc, .pdf) 

N. Chand, S.R. Vishwakarama, O.P. Verma, M. Kumar 

Phenotypic Stability of Elite Barley Lines over Heterogeneous Environments(.doc, 

.pdf) 

N. Chand, S.R. Vishwakarama, O.P. Verma, M. Kumar 

Coordinator's Reports 

Report of the Workshop on Barley Genetic Linkage Groups, Barley Genome, Genes 

and Genetic Stocks at the 

X. International Barley Genetics Symposium. Alexandria, Egypt, April 2008 (.doc, 

.pdf) 

U. Lundqvist and A.K. Brantestam 

4-6 

7-9 

10-13 

14-17 

100-102 

Overall Coordinator’s Report (.doc, .pdf) 103-133 

U. Lundqvist 

Table of Barley Genetic Stock Descriptions, Latest Version (.doc, .pdf) 134-164 

J.D. Franckowiak, U. Lundqvist 

Rules for Nomenclature and Gene Symbolization in Barley (.doc, .pdf) 165-170 

J.D. Franckowiak, U. Lundqvist

Barley Genetics Newsletter (2008) 38:1-3 

Gamma-induced pericentric inversion in barley (Hordeum vulgare L.) 

K. I. Gecheff, Institute of Genetics, Acad. D. Kostoff 

Bulgarian Academy of Sciences 

1113 Sofia, Bulgaria. 

The karyotype of barley has been subjected to an extensive experimental reconstruction with 

respect of both fundamental and applied aspects (for review see Taketa et al. 2003). 

Reciprocal translocations have been the basic type of structural rearrangements used in this 

species along these lines. To my knowledge, there are very few attempts to use pericentric 

inversions as morphological markers for identification of barley chromosomes. For a long 

time our efforts were aimed at induction by gamma-irradiation of pericentric inversions which 

affect asymmetrically the morphology of barley chromosomes. Three homozygous lines, 

namely, I-11, I-44 and I-39, containing such pericentric inversions in chromosomes 2H, 5H 

and 6H, respectively, were produced so far. The morphology of reconstructed chromosomes is 

described in this paper. 

Dry seeds of both standard two-rowed spring barley variety “Freya” and translocation line T- 

1586, originating from the same variety were used as experimental material. Doses between 

100 and 200 Gy of gamma-rays were applied in order to produce chromosomal 

rearrangements. Data concerning cytological and selection techniques are given in our 

previous papers (Gecheff 1989; 1996). The idiograms of chromosomes were constructed 

following the proposals of Marthe and Künzel (1994). 

Since pachytene analysis that might reveal a specific loop formation in plant heterozygous for 

inversions is practically inapplicable in barley, the examination of the morphology and 

Giemsa N-banding patterns of somatic metaphase chromosomes were the main approach for 

selection of plants of interest and identification of inversion breakpoints. Later on, the nature 

of the induced structural rearrangements were confirmed by examination of meiotic 

metaphase I of F1 hybrid plants in crosses of mutant forms with their parent lines. 

Pericentric inversion 2H 

The karyogram analysis of somatic metaphases of mutant line I-11 revealed an alteration in 

the morphology of chromosome 2H (an apparent increase in the long/short arm ratio) without 

any change in the morphology of the rest of chromosomes of the karyotype. A comparative 

analysis of Giemsa N-banded metaphase chromosomes showed an intrachromosomal transfer 

of the most distal band of the short arm to the long arm of this chromosome, that has evidently 

resulted from a pericentric inversion embracing a large segment with total length of 65 mGNs. 

The putative sites of the inversion breakpoints were found to be located within the segments 

that do not exceed 9 mGNs, as indicated by arrowheads in Fig. 1A. 


This inversion was easily identified because it affects dramatically the standard morphology 

of chromosome 5H. The evident increase of the size of the satellite up to 36 mGNs was 

accompanied by corresponding reduction in the size of the long arm of this chromosome. 

Using the approach mentioned above, the inversion breakpoints are supposed to be localized 

within the segments that have the same length as the satellite (Fig. 1B). 

1



Due to the transfer of the proximal band in the short (satellite) arm of chromosome 6H, it 

became possible to map the inversion breakpoints (indicated by arrowheads in Fig. 1C) with 

great precision. The size of the inverted segment which involves the centromere was found to 

run up to 58 mGNs in length. 

Fig. 1. Idiograms of Giemsa N-banded chromosomes in inversion lines: I-11 (A) – 2H i ; I-44 

(B) – 5H i ; I-39 (C) – 6H i . On the left side of each reconstructed chromosome, the constitution 

of the respective standard type (2H, 5H and 6H) is shown. The putative position of the 

inversion breakpoints are shown by arrowheads. The figures at the end of chromosome arms 

display their size in milliGeNomes (mGN), i. e., one thousandth of the genome length. NOR – 

nucleolus organizing region. 

2


References: 

Gecheff, K. I. 1989. Multiple reconstruction of barley karyotype resulting in complete 

cytological marking of the chromosome complement. Theor. Appl. Genet. 78:683-688. 

Gecheff, K. I. 1996. Production and identification of new structural chromosome mutations in 

barley (Hordeum vulgare L.). Theor. Appl. Genet. 92:777-781. 

Marthe, F. and G. Künzel. 1994. Localization of translocation breakpoints in somatic 

methaphase chromosomes of barley. Theor. Appl. Genet. 89:240-248. 

Taketa, S., I. Linde-Laursen, and G. Künzel. 2003. Cytogenetic diversity. In: R. von Bothmer, 

T. Hintum, H. Knüpff and K. Sato (eds) Diversity in barley (Hordeum vulgare L.), Elsevier, 

pp. 97-119. 

3


Yield response to treatment with vesicular-arbuscular myccorrhiza (VAM) in 

a breeding population of barley 

Mario C. Therrien 

Agriculture and Agri-Food Canada, Brandon Research Centre, Box 1000A, R.R.#3, Brandon, 

MB, Canada, R7A 5Y3, mtherrien@agr.gc.ca 

Abstract 

Vesicular-arbuscular myccorrhiza (VAM; Glomus spp.) are soil fungi that can colonize the roots 

of a number of commercially important crops, including barley, and are implicated in increasing 

the availability of nutrients to the host plant, particularly phosphorus (P). This has been shown to 

increase yields in the host crop. Barley has shown a differential response to increased yield after 

inoculation with VAM culture. Two barley cultivars with differential yield response to VAM 

treatment, Virden and CDC Earl, were crossed and 200 Recombinant Inbred Lines (RILs) were 

produced. Seeds of individual heads, from the parents and RILs, were treated with VAM or left 

untreated and planted as head rows in a Completely Randomized Design (CRD) in a soil low in 

nutrients and nearly devoid of native VAM. Grain and dry matter yield response indicated that 

VAM treatment produced a significant yield increase in CDC Earl and significant yield 

suppression in Virden. VAM-treated RILs demonstrated significant yield suppression, indicating 

that genetic improvement for this trait is unlikely in barley. 

Introduction 

Vesicular-arbuscular myccorrhiza (VAM; Glomus spp.) are fungi that can colonize the roots of a 

number of important crops, including barley (Hordeum vulgare L.) and provide benefits to the 

host plant by mobilizing nutrients from the soil, especially phosphorus (P; Jensen, 1982). The 

effectiveness of VAM has been demonstrated in the field for a number of crops (Jensen, 1984). 

This has led to the availability of commercial inoculants of VAM for field use (Bagyaraj, 1991). 

In barley, colonization by VAM appears to be at least partially dependent on genotype where 

some genotypes demonstrate enhanced biomass and grain yield while others do not (Boyetchko 

and Tewari, 1995). Developing new barley cultivars, with the ability to increase yield with VAM 

inoculation, would be advantageous to producers. This study utilizes a breeding population of 

barley, developed from two genotypes with positive and negative response to VAM inoculation, 

to determine the feasibility of breeding for improved VAM-mediated yield response in barley. 

Materials and Methods 

Using Virden (VAM-negative response) and CDC Earl (VAM-positive response) six-row barley 

cultivars, 300 manual crosses were made yielding 220 F1 seeds. Each F1 seed was then placed 

through four cycles of Single Seed Descent (SSD) producing a total of 220 Recombinant Inbred 

Lines (RILs). Remnant seed of the original parent material was also saved and multiplied along 

with the RILs. The 220 RILs were grown in single 3 m long rows, along with twenty four rows 

of each of the two parents. Three heads were selected, at random, from each row and 

individually manually threshed and stored in labelled envelopes. One half of the RILs and parent 

seed were treated with a commercial inoculum of vesicular-arbuscular micchoryza (VAM; 

Mikro-VAM®) according to manufacturer specifications (Mikro-Tek Inc., Timmons, ON, 

Canada). The remaining half were left untreated as served as the control group. 

4


Each package of seed was sown in individual head rows in a Completely Randomized Design 

(CRD) and each row labelled accordingly. Head rows were sown on a medium-textured clay 

loam soil that had been deliberately sown to canola in the three previous crop years to eliminate 

most of the native VAM and reduce nitrogen (N) and phosphorus (P) levels to 30 and 20 kg ha -1 , 

respectively. Sixty kg ha -1 N, as urea, was added to the soil, prior to sowing, to allow for normal 

crop development. Potassium (K) was not limiting in this soil, being in excess of 300 kg ha -1 of 

native K. Levels of P were not augmented to allow for the expression of VAM activity in a low P 

soil. 

Head rows were allowed to mature completely prior to the entire plants above-ground being 

harvested by hand. Entire rows were individually weighed, to the nearest 0.5 g, to obtain dry 

matter yield per row. Each row was then threshed in a stationary plot combine and the 

subsequent seed collected and weighed to the nearest 0.5 g. to obtain grain yield per row. An 

Analysis of Variance (ANOVA) was performed for both grain and dry matter yield using the 

PROC GLM of SAS (SAS Institute, 1988). 

Results and Conclusions 

The parent cultivars, CDC Earl and Virden, were chosen because they demonstrated differential 

responses to VAM treatment (Boyetchko & Tewari, 1995), with CDC Earl demonstrating a 

positive response and Virden having no, or a negative, response. The parent cultivars, Virden and 

CDC Earl, gave yield responses to VAM treatment that were expected. CDC Earl showed an 

increase in both dry matter yield (Table 1) and grain yield (Table 2) after treatment with VAM, 

whereas Virden showed reduced dry matter yield (Table 1) and a slight reduction (nonsignificant) 

in grain yield (Table 2). 

The yield values for the RILs were intermediate to the parents (Tables 1 and 2), as would be 

expected for the quantitative traits of grain and dry matter yield. For dry matter yield, the RILs 

showed a response similar to Virden, which was a decrease in yield, albeit non-significant (Table 

1). For grain yield, the RILs showed only a slight (non-significant) increase in yield (Table 2), 

with values closer to Virden than to CDC Earl. The results suggest that there would be no genetic 

improvement from a cross between these VAM responsive and non-responsive genotypes. 

Further evaluation with multiple genotypes may provide genetic gain for yield from VAM 

inoculation via recombination from genetic backgrounds differing from those in the present 

study. 

5


Table 1. Average dry matter yield (g plot -1 ) of inoculated vs. uninoculated (control) 

Virden, CDC Earl and RILs treated with VAM. 

Source Control Inoculated Standard 

Error 

Significance Response 

CDC Earl 399.1 435.5 16.1 ** Increase 

Virden 516.5 469.4 27.3 * Decrease 

RILs 450.1 436.7 19.0 ns Decrease 

Average 455.2 447.2 

Std. Error 34.0 11.1 

CV 7.5 2.5 

Table 2. Average grain yield (g plot -1 ) of inoculated vs. uninoculated (control) Virden, 

CDC Earl and RILs treated with VAM. 

Source Control Inoculated Standard 

Error 

Significance Response 

CDC Earl 128.2 140.8 6.1 ** Increase 

Virden 97.8 97.6 8.5 ns No change 

RILs 117.4 119.6 4.3 ns Increase 

Average 114.5 119.3 

Std. Error 8.9 12.5 

CV 7.8 10.5 


The author is grateful to Dr. R.B. Irvine for suggesting the topic and to Dr. R. Mohr for 

providing the plot land. 

References 

Bagyaraj, D.J. 1991. Ecology of vesicular-arbuscular mycchorizae. In: Handbook of Applied 

Mycology: Soil and Plants (Eds. D.K. Arola, R. Rai, K.G. Mukerjii and G.R. Knudsen) pp. 3-34. 

Marcel Dekker, New York, USA. 

Boyetchko, S.M. and J.P. Tewari. 1995. Susceptibility of barley cultivars to vesicular-arbuscular 

mycorrhizal fungi. Can. J. Plant Sci. 75(1): 269-275. 

Jensen, A. 1982. Influence of four vescicular-arbuscular micorrhyzal fungi on nutrient uptake 

and growth in barley. New Phytol. 90: 45-50. 

Jensen, A. 1984. Response of barley, pea and maize to inoculation with different vesiculararbuscular 

mycchorizal fungi in irradiated soil. Plant and Soil 78(3): 315-323. 

SAS Institute. 1988. SAS user’s guide: Statistics. Version 6.04 ed., SAS Inst., Cary, NC. 

6


A vrs1 mutant in CIho 4196 to facilitate breeding of 6-rowed cultivars with 

Fusarium Head Blight resistance. 

Christine Boyd 1 , Richard Horsley 2 , and Andris Kleinhofs 1 

1 Department of Crop and Soil Sciences, Washington State University, Pullman, WA 99164-6420 

2 Department of Plant Sciences, North Dakota State University, Fargo, ND 58105-5051 

Development of commercial 6-rowed Fusarium Head Blight (FHB) cultivars has been difficult 

due to the close linkage of the 2-rowed (Vrs1) trait to a major FHB resistance QTL on 

chromosome 2H bin10 (Horsley et al. 2006; Mesfin et al. 2003). We have initiated a mutation 

program with the FHB resistant 2-rowed line CIho4196 to convert it to a 6-rowed (vrs1) 

phenotype and to correct other undesirable traits such as tall stature and late ripening (Boyd et al. 

2007). 

We have now confirmed a vrs1 mutant in CIho 4196 background. This mutant should 

facilitate breeding for 6-rowed Fusarium Head Blight (FHB) resistant cultivars since it is closely 

linked with the chromosome 2H bin10 FHB resistance. The mutant designated G07-014 was 

isolated in a gamma irradiated CIho 4196 M2 population (proposed gene and allele designation 

vrs1.u). The mutant phenotype was confirmed in Pullman, WA summer 2008 and genotype 

confirmed sequencing. Sequence analysis revealed that the mutant vrs1 gene has a 9 nucleotide 

(nt) deletion compared with the wild-type CIho 4196 Vrs1 gene (Fig. 1). 

(750) 

g07-014 Vrs1 (287) 

CIho4196 Vrs1 (750) 

Consensus (750) 

750 760 770 780 790 800 810 

825 

ACCCCAAGAAGCGGCGGCTCACCGACGAG---------ATTCTGGAGCTGAGCTTCCGGGAGGACCGCAAGCTGGA 

ACCCCAAGAAGCGGCGGCTCACCGACGAGCAGGCCGAGATTCTGGAGCTGAGCTTCCGGGAGGACCGCAAGCTGGA 

ACCCCAAGAAGCGGCGGCTCACCGACGAG ATTCTGGAGCTGAGCTTCCGGGAGGACCGCAAGCTGGA 

Fig.1 Comparison of the CIho 4196 Vrs1 and gene sequence with the mutant G07-014 gene 

sequence. 

Since the 9 nt deletion does not result in a frameshift, we wondered why the protein is 

inactivated. It turned out that the deletion is at the beginning of the homeodomain of exon II, a 

critical region of the gene (Fig. 2). 

Hox 1 

Exon I Exon II 

Splicing product of Vrs1 CI 1-4 7 

669 bp 

Exon III 

Fig. 2. CIho 4196 Vrs1 cDNA structure. The approximate location of the 9 nt deletion is boxed. 

The homeodomain region is underlined. 

7


The mutant spike appears as a typical 6-rowed (Fig. 3) with fully fertile side florets, except that 

the side florets are a bit thin (Fig. 4). This is probably due to the presence of the 2-rowed Int-c 

allele in the mutant (Lundqvist and Lundqvist 1989). 

Fig. 3. From left to right, CIho 4196, Mutant G07-014, and Morex spike. 

Fig. 4. From left to right CIho 4196, Mutant G07-014 and Morex spikelet. 

8


The mutant was tested for FHB reaction in China winter '07-'08 by RH. The results showed that 

the mutant is essentially identical to CIho 4196 in FHB rating and plant height, at least in China 

(Table 1). 

Table 1. Fusarium head blight (FHB) score and plant height of CIho 4196 and G07-014 in the 

2007-2008 FHB nursery at Zhejiang University, Hangzhou, China. 

FHB score 

Entry 7 May 2008 9 May 2008 Average Standart Plant height 

deviation 

--------------------1-5 score†------------------ cm 

CIho 4196 2.0 2.0 2.0 0.00 140 

G07-014 1.0 2.0 1.5 0.71 141 

†Score of 1 = no disease and 5 = severe disease. 

Limited seed is available from AK. 

References: 

Boyd CN, Horsley R, Kleinhofs A (2007) Barley chromosome 2(2H) bin 10 Head Blight 

resistance QTL: mapping and development of isolines. In: Canty SM, Clark, A., Ellis, D., 

van Sanford D. (ed) Proceedings of the 2007 National Fusarium Head Blight Forum 2007 

Dec 2-4. Kansas City, MO, East Lansing: Michigan State University pp 170-172 

Horsley RD, Schmierer D, Maier C, Kudrna D, Urrea CA, Steffenson BJ, Schwarz PB, 

Franckowiak JD, Green MJ, Zhang B, Kleinhofs A (2006) Identification of QTL 

associated with Fusarium Head Blight resistance in barley accession CIho 4196. Crop 

Science 46:145-156 

Lundqvist U, Lundqvist A (1989) The co-operation between intermedium genes and the six-row 

gene hex-v in a six-row variety of barley,. Hereditas 110:227-233 

Mesfin A, Smith KP, Dill-Macky R, Evans CK, Waugh R, Gustus CD, Muehlbauer GJ (2003) 

Quantitative trait loci for Fusarium head Blight resistance in barley detected in a tworowed 

by six-rowed population. Crop Sci 43:307-318 

9


Worth of Genetic Parameters to Sort out New Elite Barley Lines 

over Heterogeneous Environments 

Nanak Chand 1 , S.R. Vishwakarma 1, 2 , O.P. Verma 1† 1, 3 

and Manoj Kumar 

1 

Department of Genetics and Plant Breeding, N.D. University of Agriculture and 

Technology, Kumarganj, Faizabad- 224229 (U.P), INDIA 

2 

Correspondence address: Barley Breeder, Deptt. of Genetics and Plant Breeding, Narendra 

Deva University of Agriculture and Technology, Kumarganj, Faizabad, UP, India; emailvishwakarma_sr@rediffmail.com, 

3 

Present address: Research Scholar, PG 0614, Deptt. of Genetics and Plant Breeding, Institute 

of Agricultural Sciences, BHU, Varanasi 221005, email- manojsbhu07@gmail.com 

† 

Additional author Email: ompverma_2002@yahoo.co.in 

ABSTRACT 

Thirty diverse elite barely lines and six checks were grown in the three environments with 

two replications during Rabi 2006-2007 to study coefficient of variability, heritability and 

expected genetic advance for ten characters i.e., days to ear emergence, days to maturity, total 

tillers per plant, number of effective tillers per plant, plant height (cm), number of grains per 

spike, 1000-grain weight (g), biological yield per plant (g), harvest index (%) and grain yield 

per plant (g).The phenotypic coefficient of variability (PCV) was higher than genotypic 

coefficient of variability (GCV). Environmental coefficient of variability (ECV) was less than 

both the parameters except days to maturity in E2. Grain yield per plant has the highest 

coefficient of variability followed by number of grains per spike. High estimates of 

heritability in broad sense were recorded for 1000-grain weight and number of grains per 

spike followed by biological yield per plant and grain yield per plant. The characters which 

showed higher estimates of genetic advance coupled with higher estimates of heritability 

reflecting additive gene action, were grain yield per plant and number of grains per spike 

followed by biological yield per plant .Thus, selection of these characters should emphasized 

in barley improvement programme. 

Key words: Barley (Hordeum vulgare L.), GCV, PCV, genetic advance, heritability, 

heterogeneous environments. 

INTRODUCTION 

Barley constitutes the fourth agricultural commodity in India after wheat, rice and 

maize. It is the best known crop grown world wide under varying agro climatic situations for 

food, feed and forage. It has superior nutritional qualities due to presence of beta-glucan (an 

anticholesteral substance), acetylcholine carbohydrate substance which nourishes our nervous 

system and recover memory loss, easy digestibility due to low gluten content and high lysine, 

thiamin and riboflavin render cooling and soothering effect in the body. Its alternate uses in 

malt and beer industry and health tonics have proved that barley is an important crop of 

present era. In order to launch a sound breeding programme, it is essential to have an idea of 

the nature and magnitude of variability, heritability and genetic advance in respect of 

breeding material at hand. The concept of heritability explains whether differences observed 

among individuals arose as a result of differences in genetic makeup or due to environmental 

forces. Genetic advance gives an idea of possible improvement of new population through 

selections, when compared to the original population. The genetic gain depends upon the 

amount of genetic variability and magnitude of the masking effect of the environment.


Keeping these points in the view, present investigation was undertaken for study of 

variability, heritability and genetic advance in indigenous elite lines of barley. 

MATERIALS AND METHODS 

The materials used in this study included thirty diverse new advance elite genotypes 

of barely and six checks. These elite lines of barley were collected from N. D. U. A. & T., 

Kumarganj, Faizabad; C. S. A. U. A. & T., Kanpur; P. A. U., Ludhiana; D. W. R., Karnal; C. 

C. S. H. A. U. Hissar; R. A. U. (Durgapura) and J. N. K. V. V., Rewa. These genotypes were 

evaluated in randomized block design with two replications during rabi 2006-2007 and 

evaluated under three environmental conditions viz; rainfed , low fertility situation (E1), and 

saline sodic and late sown condition (E2) at Genetics and Plant Breeding Farm, Kumarganj; 

and normal fertile soil, irrigated and timely sown condition (E3) at Crop Research Station, 

Masodha, Faizabad. Each genotype was grown in 3 rows of 3 m long bed with spacing of 25 

cm between the rows. An approximate distance of 10 cm was maintained between plant to 

plant by hand thinning. Five competitive random plants from the middle row of the 

experimental plots were taken for recording the observations on days to maturity, days to ear 

emergence, number of effective tillers per plant, total tillers per plant, plant height (cm), 

number of grains per spike, 1000-grain weight (g), biological yield per plant (g), harvest 

index (%) and grain yield per plant (g). Heritability in broad sense was calculated as ratio of 

the total genetic variance to the phenotypic variance. Expected genetic advance was 

calculated following Johanson et al. (1955). 

RESULTS AND DISCUSSION 

In the present investigation the phenotypic coefficient of variability (PCV) was higher 

than genotypic coefficient of variability (GCV) for all the characters studied (Table 1). 

Environmental coefficient of variability (ECV) was less than both the parameters except days 

to maturity in E1 and E2. A perusal of coefficient of variability indicates that PCV was quite 

higher for grain yield per plant and number of grains per spike. Day to maturity showed 

considerable low variability, which indicates little opportunity for improvement through 

selection. This observation is in agreement with the result of Andonov et al. (1979) and 

Sandeep et al. (2002). Genotypic coefficient of variability (GCV) for grain yield per plant 

and number of grains per spike was also high except in E3 environment where grain yield 

was recorded low. ECV were high for total tillers per plant in E1, plant height in E2 and 

number of grains per spike in E3. Considerable environmental influences were observed for 

grain yield per plant in E3, total tillers per plant and number of effective tillers per plant in 

E1, suggested that environmental manipulation may be effective for bringing about 

favourable change in expression of these characters. In general, high estimates of heritability 

were found for all the traits except plant height, total tillers per plant and number of effective 

tillers per plant in E1 and days to maturity in (E2). In present study, the highest heritability 

was recorded for 1000-grain weight followed by number of grains per spike in all the 

environments except number of grains per spike in E3. Lowest value of heritability was 

recorded for days to maturity in all the environments except in E3. Similar views were also 

reported by Delogu (1988) and Sinha et al. (1999). Barraiga (1976) reported in spring wheat 

that combination of high variability and high heritability is considered useful for success of 

selection. High amount of genetic variability among the population indicated an increased 

opportunity for the selection of desirable genotypes, as the variation is heritable one. Genetic 

advance expressed in percentage of mean showed a wide range of variations across the 

environments. High heritability estimates were associated with high genetic advance for 

11


number of grains per spike, biological yield per plant and grain yield per plant except in E3 

for grain yield per plant, reflected the involvement of additive gene action for the inheritance 

of these traits. Similar results have been reported by Aidun et al. (1990) and; Vimal and 

Vishwakarma (1998). Such estimates of genetic advance indicated that moderate gains could 

be achieved with strengthening the selection. These results are in close agreement with the 

findings of Lee (1987) also. However, the high estimates of heritability with low genetic 

advance were detected for days to ear emergence and 1000-grain weight except in E2 

environment for 1000-grain weight. The traits possessing low genetic advance with high 

heritability indicates the presence of non additive gene action, thus simple selection 

procedure in early segregating generations will not be effective for screening of the desirable 

traits. 

REFERENCES 

Aidun V.L. and Rossenagel B.G. 1990. Heritability and genetic advance of hull peeling in 

two rowed barley. Canadian Journal of Plant Science, 70: 481-485. 

Andonov K.L., Sariev B.S. and Zhundibaev L.P. 1979. Structure of phenotypic variability in 

traits of spring barley. Acta Agril. Shanghai, 22: 187-188. 

Barraiga B.P. 1976. Variability and heritability of some quantitative characters in spring 

wheat. Agro. Sur. Chile, 42: 71-75. 

Burton G.W. and de Vane E.H. 1953. Estimating heritability in tall fescue (Festua 

qrundinacea) from replicated clonal material. Agron. J., 45: 478-481. 

Delogu G.C., Larenoni Morocc A., Mortiniello P., Odoardi M and Stance A.M. 1988. A 

recurrent selection programme for grain yield in winter barley. Euphytica, 37: 105- 

110. 

Johanson H.W., Robinson H.F. and Comstock C.E. 1955. Estimates of genetic and 

environment variability in soybean. Agron. J., 47: 314-318. 

Lee D.M. 1987. Kernel number in barley; inheritance and role in yield component, 

Dissertation Abs. Int. B. (Sci and Engg), 7: 2682. 

Panse V.G and Sukhatme V.S. 1967. Statistical Methods for Agricultural Workers, I.C.A.R, 

New Delhi. 

Sinha B.C and Saha B.C. 1999. Genetic studies, heritability and genetic advance in Barley 

(Hordeum vulgare L). Journal of Applied Biology, 9(2): 108-116. 

Sundeep Kumar and Prasad L.C. 2002. Variability and correlation studies in barley 

(Hordeum vulgare L.). Research on Crops, 3(2): 432-436. 

Vimal S.C and Vishwakarma S.R 1998. Heritability and genetic advance in barley under 

partially reclaimed saline-sodic soil. Rachis, 17(1/2): 56. 

12


TABLE 1. Estimates of range, grand mean, PCV, GCV, ECV, heritability in broad sense (h 2 b) and 

genetic advance in per cent of mean (GA %) for 10 characters in barley under heterogeneous 

environments 

S.N. Character Environment Range 

1. 

2. 

3. 

4. 

5. 

6. 

7. 

8. 

9. 

10. 

Days to ear 

emergence 

Days to 

maturity 

Total tillers 

per plant 

No. of 

effective 

tillers per 

plant 

Plant height 

(cm) 

No. of grains 

per spike 

1000-grain 

weight (g) 

Biological 

yield per plant 

(g) 

Harvest index 

(%) 

Grain yield 

per plant (g) 

13 

Grand 

mean 

PCV 

(%) 

GCV 

(%) 

ECV 

(%) 

h 2 

(b) 

(%) 

GA 

% of 

mean 

E1 67.50-89.00 80.61 7.45 6.87 2.87 85.10 13.06 

E2 74.50-110.00 83.79 9.14 8.33 3.77 83.00 15.64 

E3 78.50-82.50 75.79 4.84 4.48 1.85 85.30 8.52 

E1 119.00-133.00 127.65 3.26 2.71 2.80 69.40 4.66 

E2 111.00-125.50 119.44 2.86 ±.98 2.07 47.90 2.83 

E3 111.50-134.50 11;.90 3.88 3.46 1.75 79.60 6.36 

E1 8.83-22.42 14.00 19.·1 16.56 10.69 70.60 28.67 

E2 9.16-15.00 11.60 13.91 12.73 5.61 83.70 23.98 

E3 11.30-22.94 16.23 19.55 17.73 8.17 82.50 33.16 

E1 8.66-19.83 13.16 18.97 16.15 9.93 72.60 28.35 

E2 8.34-14.17 10.84 14.72 13.00 6.89 78.10 23.67 

E3 10.93-22.50 15.58 20.95 19.35 8.04 85.30 36.80 

E1 70.00-106.40 84.64 10.98 8.42 7.05 58.80 13.31 

E2 42.67-80.20 60.11 14.49 11.40 8.15 68.40 20.42 

E3 57.70-127.00 103.51 11.31 11.04 2.48 95.20 22.19 

E1 20.67-68.50 51.15 26.23 25.88 4.26 97.40 52.60 

E2 16.33-53.83 32.72 27.28 26.93 4.38 97.40 54.75 

E3 22.83-67.83 50.80 29.28 27.88 8.95 90.70 54.68 

E1 37.78-53.50 46.12 9.45 9.45 0.28 99.90 19.46 

E2 31.37-48.51 41.93 10.88 10.87 0.41 99.90 22.38 

E3 38.11-53.74 46.44 9.37 9.37 0.24 99.90 19.30 

E1 35.83-79.17 53.61 21.07 20.59 4.48 95.50 41.45 

E2 21.76-58.49 33.00 25.91 25.64 3.67 98.00 52.29 

E3 43.00-107.33 62.19 23.71 22.00 8.83 86.10 42.06 

E1 21.00-52.20 42.20 16.28 15.07 6.15 85.70 28.75 

E2 14.42-59.30 37.71 17.28 16.94 3.38 96.20 34.23 

E3 29.62-65.93 42.44 18.01 17.56 3.99 95.10 35.28 

E1 14.00-45.01 23.67 28.15 27.57 5.69 95.90 55.63 

E2 7.00-22.33 12.30 27.42 26.87 5.48 96.00 54.23 

E3 16.83-37.67 25.87 20.41 19.02 7.40 86.90 36.52


Phenotypic Stability of Elite Barley Lines over Heterogeneous 

Environments 

Nanak Chand 1 , S.R. Vishwakarma 1, 2 , O.P. Verma 1† 1, 3 

and Manoj Kumar 

1 

Department of Genetics and Plant Breeding, N.D. University of Agriculture and 

Technology, Kumarganj, Faizabad- 224229 (U.P), INDIA 

2 

Correspondence address: Barley Breeder, Deptt. of Genetics and Plant Breeding, Narendra 

Deva University of Agriculture and Technology, Kumarganj, Faizabad, UP, India; emailvishwakarma_sr@rediffmail.com, 

3 

Present address: Research Scholar, PG 0614, Deptt. of Genetics and Plant Breeding, Institute 

of Agricultural Sciences, BHU, Varanasi 221005, email- manojsbhu07@gmail.com 

† 

Additional author Email: ompverma_2002@yahoo.co.in 

ABSTRACT 

It is perceived that barley cultivation has flourished since 9000 years ago. Due to 

versatile and hardy nature, barley is grown world wide for staple food, industrial and 

medicinal uses. Barley is used in in form of malt, beer, syrups, maltova, horlicks and 

delicious chocolates. Thirty diverse elite lines of barley along with six checks were assessed 

in three environments with two replications for three characters i.e. 1000-grain weight (g), 

harvest index (%) and grain yield per plant (g). The genotypes x environment (G x E) 

interactions were significant for all the traits studied. Among twenty three average yielding 

genotypes, only sixteen genotypes showed suitability for wide adaptation. Better phenotypic 

stability were observed in four genotypes viz., RD2634, RD2689, JB47 and RD2620 having 

high yield mean performance, bi=1 and S 2 di=0. These were found promising for wide 

adaptation over sites across environments. Twelve genotypes namely, JB42, NDB1401, Jyoti, 

BH657, JB40, NDB1280, NDB1289, NDB1281, RD2552, RD2677, RD2683 and Narendra 

Jau 3 had average mean performance with bi=1 and S 2 di=0 showing stability over wider 

range of environments. Only two genotypes viz., DWR51 and K792 associated with bi


some elite lines of barley collected from various coordinated units were sorted out for their 

stability. 

MATERIALS AND METHODS 

The material used in this study included thirty diverse new advance elite genotypes of 

barley with six checks. These elite lines of barley were drawn from N.D. University of 

Agriculture & Technology, Kumarganj (Faizabad), C.S.A. University of Agriculture & 

Technology (Kanpur), Panjab Agriculture University (Ludhiana), Directorate of Wheat 

Research (Karnal), C.C.S. Haryana Agriculture University (Hissar), Rajasthan Agriculture 

University (Durgapura), J.N. Krishi Vishwavidyalaya (Rewa). These genotypes, planted in 

randomized block design with two replications during rabi 2006-07, were evaluated under 

three environmental conditions viz., rainfed, low fertility situation (E1), and saline sodic and 

late sown condition (E2) at Genetics and Plant Breeding Farm, Kumarganj, Faizabad; and 

normal fertile soil, irrigated, timely sown condition (E3) at Crop Research Station, Masodha, 

Faizabad. Each genotype was grown in 3 rows of 3 m long plots with spacing of 25 cm 

between the rows. An approximate distance of 10 cm was maintained between plant to plant 

by hand thinning. Five competitive random plants from the middle row of the experimental 

plots were taken for recording the observations on 1000-grain weight (g), harvest index (%) 

and grain yield per plant (g). Stability analysis was worked out following Eberhart and Russel 

(1966). 

RESULTS AND DISCUSSION 

The phenotypic stability of each variety was expressed by two parameters: the slope 

of regression line and sum of squares of deviation from regression. A stable variety was 

defined as “one with unite regression (bi=1) and low deviation from linearity (S 2 di=0)”. 

Analysis of variance showed that the mean sum of squares due to genotypes (G) and 

environment (E) difference tested against the G x E interaction were significant for all the 

traits studied, indicating the presence of wide variability among the genotypes and 

environment. The significant estimates of G x E interaction indicated that the characters were 

unstable and may considerably fluctuate with change in environments. The G x E (linear) 

interaction was significant against pooled deviation suggesting the possibility of the variation 

for all characters (Table 1). These findings are in close agreement with those of Semin et al. 

(1986), Afiash et al. (1999) and Mohamadi et al. (2005). The result for grain yield per plant 

revealed that out of 36 genotypes, RD2634, RD2689, JB47 and RD2670 had higher mean 

yield, bi=1 and S 2 di=0 were promising for wide adaptation over sites across environments 

(Table 2). Twelve genotypes viz., JB42, NDB1401, Jyoti, BH657, JB40, NDB1280, 

NDB1289, NDB1281, RD2552, RD2677, RD2683 and Narendra Jau 3 had average mean 

performance associated with bi=1 and S 2 di=0 showing stability over wider range of 

environments. For harvest index six genotypes viz., DWR51, JB42, NDB1401, DWR54, 

NDB1289 and RD2677 with average mean, bi=1 and S 2 di=0 showing stability over wider 

range of environments. Only one genotype JB40 with higher mean, bi1 and S 2 di=0, indicating their stability for 

favourable environment. Five genotypes, viz., BH657, NDB1280, NDB1281, RD2552 and 

JB47 had average mean associated with bi >1 and S 2 di =0, indicating their stability for 

favourable environments. For 1000- grain weight, only one genotype RD2634 had average 

mean associated with bi=1 and S 2 di=0, identified for wider adaptation and stability over all 

sites across environments. These results are in conformity with the findings of Yadav and 

15


Rao (1985), Hadjichristodolon (1992), Shahmohamadi et al. (2005) and Verma (2007). Two 

genotypes viz., NDB1401 and RD2668, possessing higher mean, bi=1 and S 2 di=0 showed 

wider stability over all sites across environments. Three genotypes viz., RD2689, BH663 and 

NDB1276 had higher mean performance, bi


TABLE 2. Estimates of stability parameters for 1000-grain weight (g), harvest index (%) and 

grain yield per plant (g) 

S.No. Genotypes 

1000-grain weight (g) 

Xi bi S 

Harvest index (%) Grain yield per plant (g) 

2 di Xi bi S 2 di Xi bi S 2 di 

1 DWR 61 45.06 3.31** 0.43** 39.57 -0.57 -1.36 19.91 1.23 5.57* 

2 RD 2634 44.00 0.55* -0.01 49.85** 3.44 13.85** 23.11 1.12 1.49 

3 BH 855 44.64 1.95** 11.67** 42.61 1.80 83.39** 17.00 0.87 54.54** 

4 RD 2689 48.43** 0.35** 0.01 47.31** 2.81 0.42 22.94 0.62 -0.78 

5 NDB 1173 41.01 2.49** 0.15** 40.85 1.28 30.07** 17.22 0.97 16.64** 

6 BH 646 44.97 -1.66** 0.18** 37.20 1.62 27.58** 19.39 1.11 44.18** 

7 JB 42 41.36 -0.09** 0.37** 40.28 1.44 5.68 21.16 0.95 2.46 

8 NDB 1245 41.35 -0.28** 0.06* 31.81 5.63** 6.46 17.00 1.13 3.65 

9 Lakhan 44.79 1.55** 0.04* 39.59 -0.09 80.98** 21.50 1.34 117.35** 

10 K 792 42.79 -0.78** 0.11** 38.88 0.20 2.03 23.00 0.09* -0.87 

11 NDB 1401 46.99** 0.50* -0.01 39.29 0.63 -1.42 20.67 0.58 -0.98 

12 K 625 39.67 2.85** 0.28** 38.32 0.58 10.76* 16.78 0.57 0.29 

13 DWR 51 47.65** 1.52** 0.05* 42.74 0.05 2.83 20.11 0.39 0.13 

14 Jyoti 48.16** 0.98 0.06* 34.51 -0.83 24.20** 21.89 1.12 -0.84 

15 BH 657 41.36 0.74 0.04* 41.85 2.44 0.78 19.44 1.15 2.28 

16 RD 2696 48.00** 3.46** 0.43** 43.27 1.98 -0.63 18.17 0.67 -0.74 

17 DWR 52 48.20** 1.72** 0.16** 41.24 -0.43 25.71** 19.28 0.99 21.74** 

18 JB 40 42.40 1.27 0.03 47.16** -0.25 -1.83 19.77 0.50 -0.82 

19 NDB 1280 41.81 -1.82** 0.23** 39.73 3.10 -1.63 20.00 0.97 -0.84 

20 DWR 54 47.77** 2.17** 0.12** 40.84 1.35 -1.79 17.94 0.84 0.17 

21 Narendra Jau -1 47.67** -0.29** -0.01 39.88 -0.25 18.37** 18.33 0.36 28.08** 

22 NDB 1289 40.17 -1.52** 0.33** 39.41 1.41 -0.87 18.50 0.76 -0.99 

23 RD 2668 46.07** 1.08 -0.01 41.09 1.93 988.96** 27.78** 2.17** 192.69** 

24 NDB 1281 39.54 -0.73** 0.10** 40.01 1.75 0.13 20.39 0.81 -0.95 

25 RD 2683 43.65 0.82 0.09** 36.06 -0.05 -1.78 20.39 1.21 0.42 

26 RD 2552 41.17 1.09 0.01 41.55 1.59 -1.60 20.27 1.45 2.62 

27 RD 2677 49.94** 2.53** 0.15** 40.26 0.98 0.13 15.33 0.52 -0.98 

28 JB 47 47.49** 2.54** 0.29** 40.14 1.51 -1.87 25.05** 1.47 0.55 

29 BH 673 43.88 1.74** 0.05* 36.90 -2.01 0.91 15.33 0.26 6.89 

30 RD 2620 44.12 4.01** 0.53** 33.73 0.63 -1.87 16.05 1.07 1.43 

31 PL 762 47.65** 2.82** 0.36** 37.71 -1.09 -1.02 22.72 1.22 18.64** 

32 RD 2670 47.59** 2.70** 0.36** 42.39 2.25 -1.85 27.22** 2.26** 5.14* 

33 BH 663 50.26** 0.25 -0.01 47.69** 1.20 -1.62 25.94** 1.70 6.13* 

34 Narendra Jau-3 43.51 -0.67** 0.04* 48.10** 2.54 -1.74 25.44** 1.08 -0.02 

35 NDB1252 43.70 -1.38** 0.07** 39.87 -6.31 3.47 18.89 0.24 -0.65 

36 NDB1276 47.17** 0.27 -0.01 46.47** 3.73 -1.47 28.17** 2.22** 10.35** 

Mean 44.83 1.00 40.78 0.99 20.61 1.00 

SEm± 0.48 0.19 4.36 1.64 2.81 0.38 

17


Report of the Workshop on Barley Genetic Linkage Groups, Barley 

Genome, Genes and Genetic Stocks at the X. International Barley Genetics 

Symposium in Alexandria, Egypt, April 2008. 

Udda Lundqvist, Overall Coordinator 

e-mail: udda@nordgen.org 

and 

Agnese Kolodinska Brantestam 

e-mail: agnese.kolodinska@nordgen.org 

Box P.O. 41 



Agenda: 

The following topics were brought up for discussion during the workshop: 

1. The current coordination system of to-day and its function in the future. 

2. The whole genome coordination. 

3. Integration of molecular and morphological marker maps. 

4, Nomination of coordinators. 

5. Barley Genetics Newsletter. 

6, The International Database for Barley Genes and Barley Genetic Stocks and GrainGenes. 

7. Symbolization and nomenclature problems of barley genes. 

8. Maintenance of barley Genetic Stocks. 

9. International Overall Coordinator. 

1. COORDINATION SYSTEM. 

Discussions were focused on its activities of to-day and to-morrow. There are many possible 

technologies for identifying genes to-day and progress is made in integration of gene based 

maps especially made by the Scottish Crop Research Institute. Bill Thomas, Scotland, 

presented past activities how the coordination group was started with initiation on NIL, SNP 

and AFLP marker integration. When now working on Illumina SNPs marker high throughout 

genotyping, 15 000 markers, QTLs and other technologies can give us much more 

information about each chromosome. He also gave an overview of the progress that is done 

for integration of Gene based maps: (a) 4 500 Illumina SNP markers; (b) 1 000 genes on the 

IPK Gene Map; (c) 2 500 genes in the Japanese EST map; (d) 1 500 SFP markers; (e) 1 000 

Bowman lines mapped with BOPA1 and (f) 11 000 QTLs. It was suggested to have not each 

chromosome coordinated but store and coordinate all 7 chromosomes together. 

2. THE WHOLE GENOME COORDINATION. 

Several participants stressed that we also need the whole genome coordination. This should 

be a team task since the biology of mutants should be evaluated and this is a huge effort and a 

whole time work. For the time being, the time is not ready for one person to handle this. 

Therefore the workshop recommended to continue with to-days system. For publications of 

general QTL locations, the workshop recommended that the estimated Bin map position of 

the gene/QTL must be included. 

3. INTEGRATION OF MOLECULAR AND MORPHOLOGICAL MAPS. 

100


Andy Kleinhofs, USA, has been trying to integrate molecular and morphological maps for 

many years with large success. This is of great importance more than ever. There do exist 

many good maps that could be used as references e.g. SSR maps, DART maps etc. The 

quality of data of these maps is very high and linkage groups are easily detected. We need all 

the basic morphological genes with its information and have them in good shape. In the San 

Diego, USA, meetings, 2008, only very few groups were represented that are working on 

molecular genotyping. David Marshall, The Scottish Crop Research Institute, Dundee, 

Scotland, agreed to take over this responsibility. 

4. NOMINATION OF COORDINATORS. 

In the following, a list of the Chromosome/Linkage Groups and Genetic Stocks Collections is 

presented with the names of the individuals who agreed to be responsible. 

a. Overall Chairman and chromosomes: 

Overall chairman Udda Lundqvist, Sweden assisted by: Agnese Kolodinska Brantestam, 

Sweden 

Chromosome 1H (5) Gunter Backes, Denmark 

Chromosome 2H J.D. Franckowiak, Australia 

Chromosome 3H Luke Ramsey, UK. 

Chromosome 4H Arnis Druka, UK. (replaces Brian Forster who resigned) 

Chromosome 5H (7) George Fedak, Canada 

Chromosome 6H Victoria Blake, USA. 

Chromosome 7H (1) Lynn Dahleen. USA. 

b. Integration of molecular and morphological maps: David Marshall, UK, (replaces 

Andy Kleinhofs, USA, who wants to step down). 

c. Genetic Stocks and Collections: 

Barley Genetic Stock Center: Harold Bockelman, USA, (replaces An Hang who 

retired 2007) 

Trisomics and aneuploids: Harold Bockelman, USA, (replaces An Hang) 

Translocations and BTT: Andreas Houben, Germany 

Desynaptic Genes: Andreas Houben, Germany 

Autotetraploids: Wolfgang Friedt, Germany 

Disease and pest resistance genes: Mark Sutherland, Australia. (replaces Brian Steffenson, 

USA, who wants to step down) 

Eceriferum genes: Udda Lundqvist, Sweden 

Chloroplast genes: Mats Hanssom, Denmark 

Male sterile genes: Mario Therrien, Canada 

Spike morphology genes: Udda Lundqvist, Sweden and Michele Stanca, Italy 

Semi-dwarf genes: J. D. Franckowiak, Australia 

Early maturity genes: Udda Lundqvist, Sweden 

Barley-wheat genetic stocks: A.K.M.R. Islam, Australia 

Coordinators are expected to conduct current literature searches and such research in their 

area of responsibility. Updated information should be published in Barley Genetics 

Newsletter annually. 

101


5. BARLEY GENETICS NEWSLETTER. 

Barley Genetics Newsletter (BGN) has been established in 1970 after decisions made at the 

2nd International Barley Genetics Symposium (IBGS) in Pullman, USA, with its first volume 

1971. The original idea was to report short preliminary barley research notes, descriptions of 

barley genes and stocks, chromosome locations, barley maps and literature references. One of 

the initiators, Bob Nilan, USA, of the Newsletter and the IBGS was attending the workshop 

and became acknowledged. After some discussions and opinions the workshop decided 

strongly to continue the BGN in electronic format as it is the only forum for the barley 

community publishing updated revised gene descriptions and short notes. Phil Bregitzer, 

USA, is continuing to act as main editor. Its availability should be more announced and 

reminders for submissions will be send several times a year. 

6. INTERNATIONAL DATABASE FOR BARLEY GENES AND BARLEY GENETIC 

STOCKS AND GRAINGENES. 

Udda Lundqvist gave a short demonstration of this database with its own special address 

www.untamo.net.bgs. Most parts are linked to GrainGenes. Several participants in the 

workshop stressed that both databases are not easy and simple to use and rather time 

consuming. If you are familiar with barley nomenclature, genetics and Bin maps you get the 

information you need. Victoria Blake, USA, the coordinator for GrainGenes, promised when 

getting suggestions, to improve the use. 

7. SYMBOLIZATION AND NOMENCLATURE PROBLEMS OF BARLEY GENES. 

Udda Lundqvist informed of germplasm problems in connection with the Untamo database 

that Morten Huldén (the former head of the information department at the Nordic Genetic 

Resource Center and now responsible for this database) ran into when he was including 

revised descriptions. 

(a). Germplasm stocks should get assigned a GSHO number and seed samples should have 

been submitted to the Stock Center before descriptions are published. 

(b). References as ‘unpublished’ and ‘personal communication’ should be avoided. 

(c). No clear definitions of disease and pest resistance genes. 

(d). When revising a gene and moved from one locus to another, both descriptions should be 

revised and published. 

In the discussions several participants agreed that in many cases the rules for assigning genes, 

alleles and germplasm stock numbers have not been taken notice on. Especially the 

nomenclature rules for pest and resistance genes failed to follow, the former coordinator 

stressed that this nomenclature exists for a long time, nobody wants to do the allelic tests, 

people usually have not checked the literature and just assigned temporary names in order not 

to miss the allele. The new coordinator urgently asked that new resistant names, genes and 

symbols should first be accepted by the coordinator before publishing. 

The workshop also recommended strongly to publish the rules annually in Barley Genetics 

Newsletter. 

8. MAINTENANCE OF BARLEY GENETIC STOCKS. 

The workshop acknowledged the existence of different barley collections world-wide, its 

necessity to maintain and keep them in good shape and update all information continuously. 

9. INTERNATIONAL OVERALL COORDINATOR. 

The workshop recommended that the to-days chairman for the barley linkage groups and 

collections should continue. 

102


REPORTS OF THE COORDINATORS 

Overall coordinator’s report 

Udda Lundqvist 


P.O. Box 41, SE-230 53 Alnarp 


Since the latest overall coordinator’s report in Barley Genetics Newsletter Volume 37 many 

of us met at the 10th International Barley Genetics Symposium in Alexandria, Egypt, during 

during 6 days in the beginning of April 2008. About 300 participants attended the meetings, 

16 different sessions and 5 workshops were arranged and a number of 100 posters were 

presented. We could get much information of many interesting papers with new and 

interesting results for the barley community. 

As Overall Coordinator I arranged a workshop on ‘Barley Genetic Linkage Groups, Barley 

Genome, Genes and Genetic Stocks’. Discussions were focused on the coordination system of 

to-day and the future and it was stressed if the whole genome should be coordinated by one 

person. After intensive discussions it was decided that for the time being it was not ready to 

do this for one person. Therefore it was recommended to continue with to-days system. Some 

changes of the coordinators have taken place. Victoria Carollo Blake, Bozeman, Montana 

State University, USA, offered herself to take care of chromosome 6H instead of Duane Falk 

who is not engaged in barley work any more. Andy Kleinhofs, USA, who has taken care of 

coordinating the integration of molecular and morphological barley maps wanted to step 

down and he got replaced by David Marshall from the Genetics Programme at the Scottish 

Crop Research Institute, Invergowrie, Dundee, United Kingdom. Also Brian Steffenson, 

USA, the coordinator for disease and pest resistant genes wanted to step down and got 

replaced by Mark Sutherland, Australia. I want to take the opportunity and thank the retired 

coordinators for their willingness to provide us with all important barley information and their 

coorporation. Regarding the Barley Genetics Newsletter the workshop decided after some 

discussions to continue in electronic format as it is the only forum for the barley community 

to publish gene descriptions and short research notes. A summarizing report of the workshop 

is published in this issue of Barley Genetics Newsletter. 

As recommended at the 10th International Barley Genetics Symposium the rules for 

Nomenclature and Gene Symbolization in Barley is published in this volume of BGN. Tables 

of Barley Genetic Stock descriptions by BGS numbers (Table 1) and by locus symbols in 

alphabetic order (Table 2) are again published in this volume. They are necessary for barley 

researchers to find important information in the AceDB database and GrainGenes. 

103


List of Barley Coordinators 

Chromoosome 1H (5): Gunter Backes, The University of Copenhagen, Faculty of Life 

Science, Department of Agricultural Sciences, Thorvaldsensvej 40, DK-1871 Fredriksberg C, 

Denmark. FAX: +45 3528 3468; e-mail: 

Chromosome 2H (2): Jerry. D. Franckowiak, Hermitage Research Station, Queensland 

Department of Primary Industries and Fisheries, Warwick, Queensland 4370, Australia, FAX: 

+61 7 4660 3600; e-mail: 

Chromosome 3H (3): Luke Ramsey, Genetics Programme, Scottish Crop Research Institute, 

Invergowrie, Dundee, DD2 5DA, United Kingdom. FAX: +44 1382 562426. E-mail: 

 

Chromosome 4H (4): Arnis Druka, Genetics Programme, Scottish Crop Research Institute, 

Invergowrie, Dundee, DD2 5DA, United Kingdom. FAX: +44 1382 562426. e-mail: 

 

Chromosome 5H (7): George Fedak, Eastern Cereal and Oilseed Research Centre, 

Agriculture and Agri-Food Canada, ECORC, Ottawa, ON, Canada K1A 0C6, FAX: +1 613 

759 6559; e-mail: 

Chromosome 6H (6): Victoria Carollo Blake, Plant Sciences and Plant Pathology, Montana 

State University, Bozeman, MT 59717, USA.e-mail: 

Chromosome 7H (1): Lynn Dahleen, USDA-ARS, State University Station, P.O. Box 5677, 

Fargo, ND 58105, USA. FAX: + 1 701 239 1369; e-mail: 

 

Integration of molecular and morphological marker maps: David Marshall, Genetics 

Programme, Scottish Crop Research Institute, Invergowrie, Dundee, DD2 5DA, United 

Kingdom. FAX: 44 1382 562426. e-mail: 

Barley Genetics Stock Center: Harold Bockelman, USDA-ARS, National Small Grains 

Germplasm Research Facility, 1691 S. 2700 W., Aberdeen, ID 83210, USA. FAX: +1 208 

397 4165; e-mail: 

Trisomic and aneuploid stocks: Harold Bockelman, USDA-ARS, National Small Grains 

Germplasm Research Facility, 1691 S. 2700 W., Aberdeen, ID 83210, USA. FAX: +1 208 

397 4165; e-mail: 

Translocations and balanced tertiary trisomics: Andreas Houben, Institute of Plant 

Genetics and Crop Plant Research, Corrensstrasse 3, DE-06466 Gatersleben, Germany. FAX: 

+49 39482 5137; e-mail: 

104


List of Barley Coordinators (continued) 

Desynaptic genes: Andreas Houben, Institute of Plant Genetics and Crop Plant Research, 

Corrensstrasse 3, DE-06466 Gatersleben, Germany. FAX: +49 39482 5137; e-mail: 

 

Autotetraploids: Wolfgang Friedt, Institute of Crop Science and Plant Breeding, Justus- 

Liebig-University, Heinrich-Buff-Ring 26-32, DE-35392 Giessen, Germany. FAX: +49 641 

9937429; e-mail: 

Disease and pest resistance genes: Mark Sutherland, Centre for Systems Biology, University 

of Southern Queensland, Toowoomba Q 4350, Australia. FAX: +61 7 4631 1530. e-mail: 

 

Eceriferum genes: Udda Lundqvist, Nordic Genetic Resource Center, P.O. Box 41, SE-230 

53 Alnarp, Sweden. FAX:.+46 40 536650; e-mail: < udda@nordgen.org> 

Chloroplast genes: Mats Hansson, Carlsberg Research Center, Gamle Carlsberg vej 10, DK- 

2500 Valby, Copenhagen Denmark. e-mail: 

Genetic male sterile genes: Mario C. Therrien, Agriculture and Agri-Food Canada, P.O. Box 

1000A, R.R. #3, Brandon, MB, Canada R7A 5Y3, FAX: +1 204 728 3858; e-mail: 

 

Ear morphology genes: Udda Lundqvist, Nordic Genetic Resource Center, P.O. Box 41, SE- 

230 53 Alnarp, Sweden. FAX: +46 40 536650; e-mail: < udda@nordgen.org> 

or 

Antonio Michele Stanca: Istituto Sperimentale per la Cerealicoltura, Sezione di Fiorenzuola 

d’Arda, Via Protaso 302, IT-29017 Fiorenzuola d’Arda (PC), Italy. FAX +39 0523 983750, email: 

40 536650 

Semi-dwarf genes: Jerry D. Franckowiak, Hermitage Research Station, Queensland 

Department of Primary Industries and Fisheries, Warwick, Queensland 4370, Australia, FAX: 

+61 7 4660 3600; e-mail: < Jerome.Franckowiak@dpi.qld.gpv.au > 

Early maturity genes: Udda Lundqvist, Nordic Genetic Resource Center, P.O. Box 41, 

SE-230 53 Alnarp, Sweden. FAX: +46 40 536650; e-mail: 

Barley-wheat genetic stocks: A.K.M.R. Islam, Department of Plant Science, Waite 

Agricultural Research Institute, The University of Adelaide, Glen Osmond, S.A. 5064, 

Australia. FAX: +61 8 8303 7109; e-mail: 

105


Coordinator’s Report: Barley Chromosome 1H (5) 

Gunter Backes 

The University of Copenhagen 

Faculty of Life Sciences 

Department of Agricultural Sciences 

Thorvaldsensvej 40 

DK-1871 Frederiksberg C, Denmark 

e-mail: guba@life.ku.dk 

Hearnden et al. (2007) developed a high-density genetic map using DArT markers and 

microsatellites in a population of 90 doubled haploid lines from a cross between the 

Australian feed barley variety ‘Barque-73’ and the H. vulgare ssp. spontaneum accession 

‘CPI 71284-48’. The map for 1H includes 90 DArT marker loci, 54 genomic and 25 ESTbased 

SSR marker loci as well as 2 InDel marker loci (171 marker loci in total). 

The high-density barley linkage map of Varshney et al. (2007) includes 328 marker loci for 

chromosome 1H (225 AFLP marker loci, 93 RFLP marker loci, 41 SSR marker loci, 7 gene 

loci, one CAP marker locus and one RAPD marker locus). In contrast to the map presented 

above, it is a consensus map based on 6 different mapping populations. It also shows the BIN 

structure as defined by Kleinhofs and Graner (2001), but subdivides 10 cM BINs in 2 sub- 

BINs of 5 cM each. The BINs given in this report relate to this map, if not mentioned 

otherwise. Further this map and the respective segregating populations were used to compare 

the distribution of QTLs for resistance against barley leaf rust caused by Puccinia hordei and 

to compare the detected QTL with defense gene homologs (Marcel et al., 2007). On 

chromosome 1H they found, using the results of green-house experiments in the 

Steptoe/Morex population, the QTL Rphq14 in the BINs 1.2 to 2.1 explaining 13% of the 

phenotypic variance. 

Using RNA from wheat-barley (‘Chinese spring’/‘Betzes’) ditelosomic addition lines on the 

Affimetrix Barley 1 GeneChip, Bilgic et al. (2007) localized 1257 barley genes to different 

chromosome arms. Of those, 24 transcripts were assigned to chromosome 1HS (23 singlecopy 

and one multi-copy transcript). 

A low phytic acid mutation (lpa3-1) causing a reduction of 75% of the phytic acid content in 

the sodium-acide induced mutant M635 compared to the wild-type ‘Harrington’ was localized 

to chromosome 1H BIN 12.2 (Roslinsky et al., 2007). The localization was carried out using 

first 20 F5 RIL lines of a cross CDC Freedom/M635 in a bulk segregant analysis, followed by 

the integration of the resulting partial map into the Harrington/Morex population from the 

North American Barley Genome Mapping Project (Hayes et al., 1997). 

Mutants related to root hair formation were used to localize the effected genes in F2-progenies 

from crosses of four different mutant lines with the varieties ‘Steptoe’ and ‘Morex’ (Janiak 

and Szarejko, 2007). On chromosome 1H, BIN 11.2 or 12.1, rph1 was localized, causing the 

development of root hairs to stop after primordia have been formed. 

FLOWERING LOCUS T-like (FT) genes play a central role in integrating flowering signals in 

Arabidopsis . Based on 13 rice FT gene sequences, barley homologs were searched in EST 

106


databases and five barley FT sequences were detected and localized (Faure et al., 2007). One 

of them, HvFT3 was localized on chromosome 1H, BIN 11 or 12 in a population of 95 

doubled haploid lines from the cross Igri/Triumph (Laurie et al., 1995). 

Lee and Neate (2007a) localized resistance genes against Septoria speckled leaf blotch caused 

by Septoria passerinii present in the barley accessions ‘Clho 1300’ (Rsp1), ‘Clho 4789’ 

(Rsp2) and ‘Clho 10644’ (Rsp3). They crossed each of these accessions to the varieties 

‘Foster’ and ‘Robust’ and used the resulting F2-populations (103 to 125 lines) to greenhouse 

as well as field experiments and a subsequent linkage analysis. On 1HS two of the resistances 

genes were localized: Rsp2 to BIN 2.1 and Rsp3 to BIN 2.2. Because of the low number of 

common markers, the latter BIN-localization of Rsp3 is a rough estimate. The authors also 

published STS markers linked to those resistance genes (Lee and Neate, 2007b) 

Quantitatively acting resistance genes against the net form of net blotch, caused by 

Pyrenophora teres were localized by Lehmensieck et al. (2007). They used three different 

doubled haploid populations (111 to 153 lines) on field trials (2-3 years environments). In the 

Arapiled/Franklin population they detected a QTL on chromosome 1HS, BIN 2-3. It had a 

LOD of 2.9 to 3.3 and explained 9 to 12% of the phenotypic variation. Arapiles contributed 

the allele conferring resistance. 

Against the same disease, Manninen et al. (2006) detected one or several minor QTLs on 1H 

in a doubled haploid population (119 lines) from a cross between the Finnish variety ‘Rolfi’ 

and the Ethiopian accession ‘CI 9819’. The region of the chromosome that associated with net 

blotch resistance covered BIN 4 to 11. 

Panozzo et al. (2007) localized QTLs for malting quality related traits in two different 

doubled haploid population, originating from the crosses ‘Arapiles’ x ’Franklin’ and ‘Alexis’ 

x ‘Sloop’ and comprising 225 and 100 lines, respectively. In the Arapiles/Franklin population, 

2 QTL were detected on chromosome 1H, one in BIN 6.2 effecting hot water extract, diastatic 

power, α-amylase activity, wort β-glucan, wort viscosity and free α-amino acids and one in 

BIN 7.1 effecting β-glucanase activity and free α-amino acids. In the Alexis/Sloop population, 

caused by a lack of common markers with the populations used for binning, only rough 

estimates of the BINs can be given. One QTL was detected in BIN 7 for hot water extract, α - 

amylase activity, wort β-glucan, wort viscosity and free α-amino acids. A second QTL in BIN 

13 affected α-amylase activity, β-glucanase activity and free α-amino acids. 

In a population derived from a cross between a Spanish and a US variety (‘Beka’ x ‘Logan’) 

and after field experiment carried out both in Spain and Scotland, Molina-Cano et al. (2007) 

identified QTLs for β-glucan content. One of the QTLs, explaining 8 to 15% of the 

phenotypic variance, was detected on chromosome 1H, BIN 14. 

Seed dormancy QTLs were localized by Hori et al. (2007) by means of measuring the seed 

germination five and ten weeks after harvest in 7 different RI populations (93-94 lines). 

QTLs on 1H were found in three of these seven populations. In Harbin 2-row/Khanaqin 7, one 

QTL was detected in BIN 9, in Harbin 2 row/Turkey 45 one QTL was detected in BIN 6 and 

in Haruna Nijo/H602 one QTL was detected in BIN 5. The QTLs explained 4%, 12% and 4% 

of the phenotypic variance, respectively. 

An advanced backcross population (BC2F6) derived from a cross between ‘Harrington’ and 

the wild barley (H. v. ssp. spontaneum) accession OUH602 was used by Gyenis et al. (2007) 

107


to search for QTLs associated with morphological and agronomic traits measured in a field 

experiment on five environments. On chromosome 1H, 3 QTLs were found, one associated 

with the fragility of ear rachis in BIN 12, one QTL associated with plant height in BIN 12 and 

one QTL for kernel color in BIN 14 and 15. The QTLs explained 9-54%, 11% and 30% of the 

phenotypic variance, respectively. In this paper, the BINs were directly given by the authors. 

References: 

Bilgic, H., S. Cho, D.F. Garvin, and G.J. Muehlbauer, 2007. Mapping barley genes to 

chromosome arms by transcript profiling of wheat-barley ditelosomic chromosome 

addition lines. Genome 50: 898-906. 

Faure, S., J. Higgins, A. Turner and D.A. Laurie, 2007. The FLOWERING LOCUS T-like 

gene family in barley (Hordeum vulgare). Genetics 176: 599-609. 

Gyenis, L., S.J. Yun, K.P. Smith, B.J. Steffenson, E. Bossolini, M.C. Sanguineti, and G.J. 

Muehlbauer, 2007. Genetic architecture of quantitative trait loci associated with 

morphological and agronomic trait differences in a wild by cultivated barley cross. 

Genome 50: 714-723. 

Hayes, P.M., J. Cereno, H. Witsenjboer, M. Kuiper, M. Zabeau, K. Sato, A. Kleinhofs, 

D. Kudrna, M. Saghai Maroof, D. Hoffman, and N.A.B.G. Project (1997). Journal 

of Agricultural Genomics, Vol. 3. 

http://wheat.pw.usda.gov/jag/papers97/paper297/indexp297.html 

Hearnden, P.R., P.J. Eckermann, G.L. McMichael, M.J. Hayden, J.K. Eglinton, and 

K.J. Chalmers, 2007. A genetic map of 1,000 SSR and DArT markers in a wide 

barley cross. Theor. Appl. Genet. 115: 383-391. 

Hori, K., K. Sato, and K. Takeda, 2007. Detection of seed dormancy QTL in multiple 

mapping populations derived from crosses involving novel barley germplasm. Theor. 

Appl. Genet. 115: 869-876. 

Janiak, A. and I. Szarejko, 2007. Molecular mapping of genes involved in root hair 

formation in barley. Euphytica 157: 95-111. 

Kleinhofs, A. and A. Graner, 2001. An integrated map of the barley genome. In: R.L. 

Phillips & I.K. Vasil (Eds.), DNA marker in plants, pp. 187-199. Kluwer, Dordrecht. 

Laurie, D.A., N. Pratchett, J.H. Bezant, and J.W. Snape, 1995. RFLP mapping of 5 major 

genes and 8 quantitative trait loci controlling flowering time in a winter x spring 

barley (Hordeum vulgare L.) cross. Genome 38: 575-585. 

Lee, S.H. and S.M. Neate, 2007a. Molecular mapping of Rsp1, Rsp2, and Rsp3 genes 

conferring resistance to septoria speckled leaf blotch in barley. Phytopathology 97: 

155-161. 

108


Lee, S.H. and S.M. Neate, 2007b. Sequence tagged site markers to Rsp1, Rsp2, and Rsp3 

genes for resistance to septoria speckled leaf blotch in barley. Phytopathology 97: 162- 

169. 

Lehmensiek, A., G.J. Platz, E. Mace, D. Poulsen, and M.W. Sutherland, 2007. Mapping 

of adult plant resistance to net form of net blotch in three Australian barley 

populations. Aust. J. Agr. Res. 58: 1191-1197. 

Manninen, O.M., M. Jalli, R. Kalendar, A. Schulman, O. Afanasenko, and J. Robinson, 

2006. Mapping of major spot-type and net-type netblotch resistance genes in the 

Ethiopian barley line Cl 9819. Genome 49: 1564-1571. 

Marcel, T.C., R.K. Varshney, M. Barbieri, H. Jafary, M.J.D. de Kock, A. Graner, and 

R.E. Niks, 2007. A high-density consensus map of barley to compare the distribution 

of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. 

Theor. Appl. Genet. 114: 487-500. 

Molina-Cano, J.L., M. Moralejo, M. Elia, P. Munoz, J.R. Russell, A.M. Perez-Vendrell, 

F. Ciudad, and J.S. Swanston, 2007. QTL analysis of a cross between European and 

North American malting barleys reveals a putative candidate gene for beta-glucan 

content on chromosome 1H. Mol. Breed. 19: 275-284. 

Panozzo, J.F., P.J. Eckermann, D.E. Mather, D.B. Moody, C.K. Black, H.M. Collins, 

A.R. Barr, P. Lim, and B.R. Cullis, 2007. QTL analysis of malting quality traits in 

two barley populations. Aust. J. Agr. Res. 58: 858-866. 

Roslinsky, V., P.E. Eckstein, V. Raboy, B.G. Rossnagel, and G.J. Scoles, 2007. Molecular 

marker development and linkage analysis in three low phytic acid barley (Hordeum 

vulgare) mutant lines. Mol. Breed. 20: 323-330. 

Varshney, R.K., T.C. Marcel, L. Ramsay, J. Russell, M.S. Roder, N. Stein, R. Waugh, P. 

Langridge, R.E. Niks, and A. Graner, 2007. A high density barley microsatellite 

consensus map with 775 SSR loci. Theor. Appl. Genet. 114: 1091-1103. 

109


Coordinator’s report: Chromosome 2H (2) 

J.D. Franckowiak 

Hermitage Research Station 

Queensland Department of Primary Industries and Fisheries 

Warwick, Queensland 4370, Australia 

e-mail: jerome.franckowiak@dpi.qld.gpv.au 

The flowering locus T (FT) gene was first identified in Arabidopsis as having a role in the 

photoperiod and vernalization responses. Members of this family of genes, characterized by a 

phosphatidylethanolamine-binding protein (PEBP) domain, were mapped in barley by Faure 

et al. (2007). The family contains five members in barley and the HvFT4 gene mapped to the 

centromeric region of chromosome 2H. 

Nduulu et al. (2007) examined a region of chromosome 2(2H) designated Qrgz-2H-8 in 

which coincident QTLs for Fusarium head blight (FHB) severity, deoxynivalenol (DON) 

concentration, and heading date (HD) have been mapped. It was unclear if FHB resistance at 

this locus is caused by a pleiotropic effect of delayed heading or tightly linked genes. Nduulu 

et al. (2007) identified a recombinant that showed reduced FHB severity and early heading 

and concluded that the relationship between FHB and HD at the Qrgz-2H-8 region is likely 

due to tight linkage rather than pleiotropy. This region of 2H is the same region where the 

HvFT4 gene was mapped and maturity factors early maturity 6 (Eam6) (Franckowiak 2007) 

and earliness per se QTL 2S (eps2S) Laurie et al. (1995) were located. 

Burton et al. (2008) have mapped four cellulose synthase-like CslF (HvCslF) genes to a 

single locus on barley chromosome 2H. This region corresponds to a major quantitative trait 

locus for grain (1,3;1,4)-β-D-glucan content. Only two of the seven CslF genes, HvCslF6 

(7H) and HvCslF9 (1H), are transcribed at high levels in developing grain and are of potential 

relevance for the future manipulation of grain (1,3;1,4)-β-D-glucan levels. 

Pourkheirandish and Komatsuda (2007) developed further the evolutionary implications in 

barley of their research on cloning of alleles at the vrs1 (six-rowed spike 1) locus (Komatsuda 

et al. 2007). Six-rowed barley arose three times as independent events from two-rowed 

barley, but the oldest group of six-rowed barleys is apparently older than existing two-rowed 

groups. 

Forster et al. (2007) extended the barley phytomer concept based on various morphological 

mutants observed in the Optic TILLING population and older collections of barley mutants. 

Phytomers are repeated building blocks that form various parts of the barley plant. The basic 

phytomer is composed of two half nodes separated by an internode with a side arm arising 

from the upper half node and root initials and a bud developing from the lower half node. An 

array of development patterns modified the basic phytomer to form various vegetative and 

reproductive organs. Some genes on chromosome 2H that affect the development of 

morphological structures include abr1 (accordion basal rachis 1), acr1 (accordion rachis 1), 

com2 (compositum 2), eog1 (elongated outer glume 1), ert-t (erectoides-t), lig1 (liguleless 1), 

Lks1 (awnless 1), mnd1 (many noded dwarf 1), sbk1 (subjacent hood 1), vrs1 (six-rowed spike 

1), and Zeo1 (zeocriton 1). 

110


Jafary et al. (2008) reported that barley germplasm contains partial resistance QTLs to several 

leaf rust , caused by Puccinia species, for which barley is not a host. Likewise, a population 

segregating for the Rph7 (resistance to Puccinia hordei 7) showed partial resistance in the 

susceptible portion of the population. Several of partial resistance QTLs for reaction leaf rust, 

including Rphq2 and Rphq6 for P. hordei reaction, were located on chromosome 2H. 

Sameri and Komatsuda (2007) associated a QTL for 100-kernel weight and several other 

QTLs for agronomic traits with chromosome 2H. 

References: 

Burton, R.A., S.A. Jobling, A.J. Harvey, N.J. Shirley, D.E. Mather, A. Bacic, and G.B. 

Fincher. 2008. The genetics and transcriptional profiles of the cellulose synthase-like 

HvCslF gene family in barley. Plant Physiology 146:1821-1833. 

Faure, S., J. Higgins, A. Turner, and D.A. Laurie. 2007. The FLOWERING LOCUS T-like 

gene family in barley (Hordeum vulgare). Genetics 176:599-609. 

Forster, B.P., J.D. Franckowiak, U. Lundqvist, J. Lyon, I. Pitkethly, W.T.B. Thomas. 

2007. The barley phytomer. Annals of Botany 100:725-733. 

Franckowiak, J.D. 2007. BGS 98, early maturity 6, Eam6, revised. Barley Genet. Newsl. 37: 

216−217. 

Jafary, H., G. Albertazzi, T.C. Marcel, and R.E. Niks. 2008. High diversity of genes for 

nonhost resistance of barley to heterologous rust fungi. Genetics 178(4):2327-2339. 

Komatsuda, T., M. Pourkheirandish, C. He, P. Azhaguvel, H. Kanamori, D. Perovic, N. 

Stein, A. Graner, T. Wicker, A. Tagiri, U. Lundqvist, T. Fujimura, M. Matsuoka, 

T. Matsumoto, and M. Yano. 2007. Six-rowed barley originated from a mutation in a 

homeodomain-leucine zipper I-class homeobox gene. PNAS 104:1424-1429. 

Laurie, D.A, Pratchett, N., Bezant, J.H., and Snape, J.W. 1995. RFLP mapping of five 

major genes and eight quantitative trait loci controlling flowering time in a 

winter/spring barley cross. Genome 38: 575−585. 

Nduulu, L.M., A. Mesfin, G.J. Muehlbauer, and K.P. Smith. 2007. Analysis of the 

chromosome 2(2H) region of barley associated with the correlated traits Fusarium 

head blight resistance and heading date. Theor Appl Genet 115:561–570. 

Pourkheirandish, M., and T. Komatsuda. 2007. The importance of barley genetics and 

domestication in a global perspective. Annals of Botany 100:999-1008. 

Sameri, M. and T. Komatsuda. 2007. Localization of quantitative trait loci for yield 

components in a cross oriental × occidental barley cultivar (Hordeum vulgare L.). 

JARQ 41:195-199. 

111


Coordinator’s Report: Barley Chromosome 3H 

L. Ramsay 

Genetics Programme 

Scottish Crop Research Institute 

Invergowrie, Dundee, DD2 5DA, Scotland, UK. 

e-mail: Luke.Ramsay@scri.ac.uk 

Over the last year there have been a number of publications reporting the mapping of genes 

and QTL on barley chromosome 3H. One highlight was the mapping of over 2000 Transcript 

Derived Markers (including 302 on 3H) in the Steptoe x Morex DH population using a 

genetical genomics approach (Potokina et al. 2008). Using the derived map this study found 

23,738 eQTL affecting the expression of 12,987 genes with both cis and trans effects in 

evidence. 

Hu and Wise (2008) reported the mapping of two Lrk/Tak kinase gene clusters 3HS near the 

telomere using the Steptoe x Morex minimapper set. Microarray analysis revealed cultivar 

specific transcript accumulation of some of the family members on 3H, which the authors 

interpreted as indicating subfunctionalization of Lrk/Tak members following tandem 

duplication. At the other end of the chromosome Tyrka et al. (2008) developed a new 

diagnostic SSR for the Hv-eIF4E gene underlying Rym4/Rym5 locus on 3HL. Lee and Neate 

(2007) mapped a single dominant gene denoted Rsp1 that confers resistance to Septoria 

spleckle leaf blotch at seedling and adult stages to 3HS using an F2:3 population derived from 

a Robust x CIho 14300 cross. Somewhat confusingly Yan and Chen (2007) mapped a 

recessive gene denoted rps1.a, for resistance to stripe rust to 3HL using RILs derived from 

BBA 2890 x Steptoe. 

Other genes mapped included a barley haze active protein (Robinson et al. 2007) on 3HS 

mapped using antisera screened by immunoblot on the Chebec x Harrington DH population. 

Suprunova et al. (2007) mapped Hsdr4 (Hordeum spontaneum dehydration-responsive 4) to 

3HL between the SSR markers EBmac541 and EBmag705, using the population MA10-30 x 

WQ23-38, to a region that previously had been shown to affect osmotic adaptation in barley. 

Several new reports of QTL on 3H were published during this reporting period including Fox 

et al. (2007) a grain hardness QTL on the distal end of 3HL using a population derived from a 

Patty x Tallon cross. Munoz-Amatriain et al. (2008) report a QTL for green plant percentage 

on anther culture that maps close to the SSR HVM60 in a cross between Igri and an albino 

producing line (DH46) selected from an Igri x Dobla cross. A major QTL for Russian Wheat 

aphid resistance major was mapped to 3H (in the region of EBmac541) using 191 F2 derived 

F3 families from the cross 'Morex'/STARS-9301B QTL Morex x STARS-9301B (Mittal et al. 

2008). Li et al. (2008) mapped a waterlogging tolerance QTL using two populations 

(TX9425 x Franklin and Yerong x Franklin) that showed consistent QTL for leaf chlorosis 

near the centromeric region of the genetic map of 3H. Ullrich et al. (2008) mapped coincident 

major preharvest sprouting and dormancy QTL in the Steptoe x Morex population 

including one in the centromeric region of 3H. The same region was the site of a minor QTL 

for dormancy in a Stirling x Harrington population (Bonnardeaeux et al. 2008). 

112


Using an association genetics approach Comadran et al. (2008) found consistent QTL for 

yield in droughted environments in bin 4 on 3H. A similar region was found associated with 

adaptation to Mediterranean dryland conditions by von Korff et al. (2008) using RILs derived 

from the ER/Apm x Tadmor cross. QTL on 3H were found for several traits including days to 

heading, plant height and grain yield (von Korff et al. 2008). 

References: 

Bonnardeaux, Y., C. Li, R. Lance, X.Q. Zhang, K. Sivasithamparam, and R. Appels, 

2008. Seed dormancy in barley: identifying superior genotypes through incorporating 

epistatic interactions. Australian Journal of Agricultural Research 59: 517-526. 

Comadran, J., J.R. Russell, F.A. van Eeuwijk, S. Ceccarelli, S. Grando, M. Baum, A.M. 

Stanca, N. Pecchioni, A.M. Mastrangelo, T. Akar, A. Al-Yassin, A. Benbelkacem, 

W. Choumane, H. Ouabbou, R. Dahan, J. Bort, J.L. Araus, A. Pswarayi, I. 

Romagosa, C.A. Hackett, and W.T.B. Thomas, 2008. Mapping adaptation of barley 

to droughted environments. Euphytica 161: 35-45. 

Fox, G.P., B. Osborne, J. Bowman, A. Kelly, M. Cakir, D. Poulsen, A. Inkerman, and R. 

Henry, 2007. Measurement of genetic and environmental variation in barley 

(Hordeum vulgare) grain hardness. Journal of Cereal Science 46: 82-92. 

Hu, P.S. and R.P. Wise, 2008. Diversification of Lrk/Tak kinase gene clusters is associated 

with subfunctionalization and cultivar-specific transcript accumulation in barley. 

Functional & Integrative Genomics 8: 199-209. 

Lee, S.H. and S.M. Neate, 2007. Molecular mapping of Rsp1, Rsp2, and Rsp3 genes 

conferring resistance to septoria speckled leaf blotch in barley. Phytopathology 97: 

155-161. 

Li, H., R. Vaillancourt, N. Mendham, and M. Zhou, 2008. Comparative mapping of 

quantitative trait loci associated with waterlogging tolerance in barley (Hordeum 

vulgare L.). BMC Genomics 9: 401. 

Mittal, S., L.S. Dahleen, and D. Mornhinweg, 2008. Locations of quantitative trait loci 

conferring Russian wheat aphid resistance in barley germplasm STARS-9301B. Crop 

Science 48: 1452-1458. 

Munoz-Amatriain, M., A.M. Castillo, X.W. Chen, L. Cistue, and M.P. Valles, 2008. 

Identification and validation of QTLs for green plant percentage in barley (Hordeum 

vulgare L.) anther culture. Molecular Breeding 22: 119-129. 

Potokina, E., A. Druka, Z.W. Luo, R. Wise, R. Waugh, and M. Kearsey, 2008. Gene 

expression quantitative trait locus analysis of 16,000 barley genes reveals a complex 

pattern of genome-wide transcriptional regulation. Plant Journal 53: 90-101. 

113


Robinson, L.H., P. Healy, D.C. Stewart, J.K. Eglinton, C.M. Ford, and D.E. Evans, 

2007. The identification of a barley haze active protein that influences beer haze 

stability: The genetic basis of a barley malt haze active protein. Journal of Cereal 

Science 45: 335-342. 

Suprunova, T., T. Krugman, A. Distelfeld, T. Fahima, E. Nevo, and A. Korol, 2007. 

Identification of a novel gene (Hsdr4) involved in water-stress tolerance in wild 

barley. Plant Molecular Biology 64: 17-34. 

Tyrka, M., D. Perovic, A. Wardynska, and F. Ordon, 2008. A new diagnostic SSR marker 

for selection of the Rym4/Rym5 locus in barley breeding. Journal of Applied Genetics 

49: 127-134. 

Ullrich, S.E., J.A. Clancy, I.A. del Blanco, H. Lee, V.A. Jitkov, F. Han, A. Kleinhofs, and 

K. Matsui, 2008. Genetic analysis of preharvest sprouting in a six-row barley cross. 

Molecular Breeding 21: 249-259. 

von Korff, M., S. Grando, A. Del Greco, D. This, M. Baum, and S. Ceccarelli, 2008. 

Quantitative trait loci associated with adaptation to Mediterranean dryland conditions 

in barley. Theoretical and Applied Genetics 117: 653-669. 

Yan, G.P. and X.M. Chen, 2007. Molecular mapping of the rps1.a recessive gene for 

resistance to stripe rust in BBA 2890 barley. Phytopathology 97 668-673. 

114


Coordinator’s Report: Chromosome 4H. 

Arnis Druka 

Genetics Programme 

Scottish Crop Research Institute 

Invergowrie, Dundee, DD2 5DA, Scotland, UK. 

e-mail: Arnis.Druka@scri.sari.ac.uk 

Several papers that mention genes and QTLs specifically on chromosome 4H have been 

published in 2007 - 2008. 

Schmalenbach et al., 2008 report development of a set of 59 spring barley introgression lines 

(ILs) from the advanced backcross population S42. The ILs were generated by three rounds of 

backcrossing, two to four subsequent selfings, and, in parallel, marker-assisted selection. Each 

line includes a single marker-defined chromosomal segment of the wild barley accession 

ISR42-8 (Hordeum vulgare ssp. spontaneum), whereas the remaining part of the genome is 

derived from the elite barley cultivar Scarlett (H. vulgare ssp. vulgare). Based on a map 

containing 98 SSR markers, the IL set covers so far 86.6% (1041.5 cM) of the donor genome. 

Each single line contains an average exotic introgression of 39.2 cM, representing 3.2% of the 

exotic genome. The set was used to map QTLs controlling resistance to powdery mildew 

(Blumeria graminis f. sp. hordei L.) and leaf rust (Puccinia hordei L.). The strongest favorable 

effects were mapped to regions 1H, 0-85 cM and 4H, 125-170 cM, where susceptibility to 

powdery mildew and leaf rust was decreased by 66.1 and 34.7%, respectively, compared to 

the recurrent parent. 

Grewal et al., 2007 described mapping of quantitative trait loci (QTL) associated with net 

blotch resistance in a doubled-haploid (DH) barley population using diversity arrays 

technology (DArT) markers. One hundred and fifty DH lines from the cross CDC Dolly 

(susceptible)/TR251 (resistant) were screened as seedlings in controlled environments with 

net-form net blotch (NFNB) isolates WRS858 and WRS1607 and spot-form net blotch 

(SFNB) isolate WRS857. The population was also screened at the adult-plant stage for NFNB 

resistance in the field in 2005 and 2006. A high-density genetic linkage map of 90 DH lines 

was constructed using 457 DArT and 11 SSR markers. A seedling resistance QTL (QRpts4) 

for the SFNB isolate WRS857 was detected on chromosome 4H. Three QTL (QRpt6, QRpts4, 

QRpt7) were associated with resistance to both net blotch forms and lines with one or more of 

these demonstrated improved resistance. Simple sequence repeat (SSR) markers tightly linked 

to QRpt6 and QRpts4 were identified and validated in an unrelated barley population. 

Bilgic et al., 2007 report use of the Affymetrix Barley1 GeneChip for comparative transcript 

analysis of the barley cultivar Betzes, the wheat cultivar Chinese Spring, and Chinese Spring - 

Betzes ditelosomic chromosome addition lines to physically map 1257 barley genes to their 

respective chromosome arm locations. The genes were validated through comparison with our 

previous chromosome-based physical mapping, comparative in silico mapping with rice and 

wheat, and single feature polymorphism (SFP) analysis. It was found to be consistent with 

previous physical mapping to whole chromosomes. In silico comparative mapping of barley 

genes assigned to chromosome arms revealed that the average genomic synteny to wheat and 

rice chromosome arms was 63.2% and 65.5%, respectively. In the 1257 mapped genes, 924 

SFPs were identified. A single small rearrangement event between rice chromosome 9 and 

115


barley chromosome 4H that accounts for the loss of synteny for several genes was also 

identified. 

References: 

Schmalenbach I., N. Körber, and K. Pillen. 2008. Selecting a set of wild barley 

introgression lines and verification of QTL effects for resistance to powdery mildew 

and leaf rust. Theor Appl Genet. 117(7):1093-106. 

Grewal T.S., B.G. Rossnagel, C.J. Pozniak, and G.J. Scoles. 2008. Mapping quantitative 

trait loci associated with barley net blotch resistance. Theor Appl Genet. 

Feb;116(4):529-39. 

Bilgic H., S. Cho, D.F. Garvin, and G.J. Muehlbauer. 2007. Mapping barley genes to 


addition lines. Genome. 50(10):898-906. 

Chromosome 5H (7) 

No report received. 

116


Coordinator’s Report: Chromosome 6H 

Victoria Carollo Blake 

Montana State University 

Bozeman, MT 59717 USA 

e-mail: vblake@montana.edu 

The last chromosome 6H report was submitted in 1999 

( http://wheat.pw.usda.gov/ggpages/bgn/29/c29-08.html). Since then several genes have been 

characterized and QTL placed on 6H. This report will survey the 6H genes from Andy 

Kleinhofs “Integrating Molecular and Morphological/Physiological Marker Maps” and 

attempt to report on any significant mapping progress made since 2000. 

Nar1 (NADH nitrate reductase) is included in 13 GrainGenes maps, with the RFLP 

MWG633/cMWG633 the closest molecular marker on ‘Barley, Consensus 2005, SNP’ 

(GrainGenes Map_Data record name) (Rostoks et al., 2005) and ‘Barley, Consensus 2006, 

Marcel’ (GrainGenes Map_Data record name) (Marcel et al., 2007). Several studies have 

related this gene to nitrate assimilation and most recently, Sicher and Bunce (2008) found 

barley (cv. Steptoe) with a mutant nar1 gene (90% lower expression) showed an elimination 

of the increase of glutamine, aspartate and alanine during the latter half of a photoperiod. 

Rrs13, conferring resistance to Rhynchosporium secalis (leaf blotch, scald) is a member of a 

gene cluster on the short arm of 6H. A review by Zhan et al., 2008, explores gene-mediated 

resistance, disease epidemiology, describes sources of resistance in barley and places 10 

disease-resistance QTL onto 6HS. Grewel et al. (2008) describe a major QTL, designated 

QRpt6 on 6H for net blotch resistance. In a Rika x Kombar DH population Abu-Qamar et al., 

2008 showed segregation for at least two major recessive resistance genes, differing in 

resistance to different pathotypes of Pyrenophora teres f. tere. The NTNB resistance loci, 

named rpt.r and rpt.k mapped 1.8 cM apart and were flanked by the CAP marker ABC02895 

and the locus detected by STS markers GBS0468 and ABC01797. In 2003 Le Gouis et al. 

characterized a gene for resistance to soil-borne barley mild mosaic virus (BaMMV) from the 

cultivar Chikurin Ibaraki, rym15, which mapped to 6H flanked by Bmag0173 and 

EBmac0874. 

sex1, the shrunken endosperm xenia1 gene conferring high lysine was mapped between 

microsatellite markers GBM5012 and GBM1063 in a 4.2 cM interval near the centromere by 

Röder et al., (2006). The authors found an orthologous site on the rice chromosome 2 where 

the interval between regions with homology to the barley markers spans 4.1 Mb. 

cul2, the uniculm2 mutation that causes plants to initiate vegetative axillary meristems but fail 

to develop tillers, and alters inflorescence morphology was genetically and morphologically 

characterized by Babb and Muehlbauer in 2003. They found that cul2 was epistatic to all 

other genes in this study that influence tillering. Linkage analysis placed cul2 between 

cMWG679/ABG458 (8.8 cM) and KFP128 (4.6 cM). 

Amy1, the gene for α-amylase in barley is included on 24 maps currently in GrainGenes, and 

is included in QTL for α-amylase activity in Chebec x Harrington and Harrington x TR306 

(Coventry et al., 2003). Suzuki et al., in 2005 showed that Gibberellin (GA) biosynthesis in 

117


the epithelium of germinating seeds is important for α-amylase expression and cloned 

HvGA3ox2, which encodes the key enzyme. Another region on 6H important for malt quality 

is a QTL for grain protein content (Qgpc6H). This was first described by See et al. in 2002 

who mapped the low protein gene contributed by the cultivar ‘Karl’ (CIho 15487) on the 

‘satellite’ of 6H near the anchor markers abg458, hvm74 and mwg2029. Work on this region 

by Distelfeld et al. in 2008 found colinearity between the barley grain protein content QTL 

and the wheat Gpc-B1 region and suggested that the barley NAC transcription factor is 

responsible for the protein content trait. 

Perovic et al. (2007) mapped nine members of a multigene family for nicotianamine synthase 

(NAS) in barley, three of which fell on 6H. Nicotianamine works as a chelator for iron and 

other heavy metals. Co-linearity with rice suggests that this gene went through at least one 

duplication event prior to the divergence of barley and rice. 

References: 

Abu Qamar, M., Z.H. Liu, J.D. Faris, S. Chao, M.C. Edwards, Z. Lai, J.D. 

Franckowiak, and T.L. Friesen. 2008. A region of the barley chromosome 6H 

harbors multiple major genes associated with net type net blotch resistance. Theor 

Appl Gen. In press. 

Babb, S. and G.J. Muehlbauer. 2003. Genetic and morphological characterization of the 

barley uniculm2 (cul2) mutant. Theor. Appl. Gen. 106:846-857. 

Coventry, S.J., H.M. Collins, A.M. Barr, S.P. Jefferies, K.J. Chalmers, S.J: Logue, and 

P. Langridge. 2003. Use of putative QTLs and structural genes in marker assisted 

selection for diastatic power in malting barley (Hordeum vulgare L.) Aust. J. Agr. 

Res. 54:1241-1250. 

Distelfeld, A., A. Korol, J. Dubcovsky, C. Uauy, T. Blake, and T. Fahima. 2008. 

Colinearity between the barley grain protein content (GPC) QTL on chromosome arm 

6HS and the wheat Gpc-B1 region. Mol. Breed. 22:25-38. 

Grewal, T.S., B.G. Rossnagel, C.J. Pozniak, and G.J. Scoles. 2007. Mapping quantitative 

trait loci associated with barley net blotch resistance. Theor Appl Gen 116: 529-539. 

Le Gouis, J., P. Devaux, K. Werner, D. Hariri, N. Bahrman, D. Béghin, and F. Ordon 

2004. rym15from the Japanese cultivar Chikurin Ibaraki 1 is a new barley mild mosaic 

virus (BaMMV) resistance gene mapped on chromosome 6H. Theor. Appl. Genet. 

108:1521-1525. 

Marcel, T.C., R.K. Varshney, M. Barbieri, H. Jafary, M.J.D. de Kock, A. Graner, 

and R.E. Niks. 2007. A high-density consensus map of barley to compare the 

distribution of QTLs for partial resistance to Puccinia hordei and of defence 

gene homologues. Theor. Appl. Genet. 114-487-500. 

Perovic, D., P. Tiffin, D. Douchkov, H. Bäumlein, and A. Graner. 2007. An integrated 

approach for the comparative analysis of a multigene family: The nicotianamine 

synthase genes of barley. Funct. Int. Gen. 7:169-179. 

118


Röder, M.S., C. Kaiser, and W. Weschke. 2006. Molecular mapping of the shrunken 

endosperm genes seg2 and sex1 in barley (Hordeum vulgare L.) Genome 49:1209- 

1214. 

Rostoks, N., S. Mudie, L. Cardle, J. Russell, L. Ramsay, A. Booth, J.T. Svensson, S.I. 

Wanamaker, H. Walia, E.M. Rodriguez, P.E. Hedley, H. Liu, J. Morris, T.J. 

Close, D.F. Marshall, and R.F. Waugh. 2005. Genome-wide SNP discovery and 

linkage analysis in barley based on genes responsive to abiotic stress. Mol Genet 

Genomics 274:515-527. 

See, D., V. Kanazin, K. Kephart, and T. Blake. 2002. Mapping genes controlling variation 

in barley grain protein concentration. Crop Sci.. 42:680-685. 

Sicher, R.C. and J.A. Bunce. 2008. Growth, photosynthesis, nitrogen partitioning and 

responses to CO2 enrichment in a barley mutant lacking NADH-dependent nitrate 

reductase activity. Physol. Plant. 134:31-40. 

Suzuki, H., K. Ishiyama, M. Kobayashi, and T. Ogawa. 2005. Specific expression of the 

gibberellin 3ß-hydroxylase gene, HvGA3ox2, in the epithelium is important for Amy1 

expression in germinating barley seeds. Plant Biotech 22:195-200. 

von Korff, M., H. Wang, J. Léon, and K. Pillen. 2008. AB-QTL analysis in spring barley: 

III. Identification of exotic alleles for the improvement of malting quality in spring 

barley (H. vulgare ssp. Spontaneum) Mol. Breed. 21:81-93. 

Werner, K., W. Friedt, and F. Ordon. 2007. Localisation and combination of resistance 

genes against soil-borne viruses of barley (BaMMV, BaYMV) using doubled haploids 

and molecular markers. Euphytica 158:323-329. 

Zhan, J., B.D.L. Fitt, H.O. Pinnschmidt, S.J.P. Oxley, and A.C. Newton. 2008. 

Resistance, epidemiology and sustainable management of Rhynchosporium secalis 

populations on barley. Plant Phys. 57:1-14. 

119


Coordinator’s Report: Chromosome 7H 

Lynn S. Dahleen 

USDA-Agricultural Research Service 

Fargo, ND 58105, USA 

e-mail: Lynn.dahleen@ars.usda.gov 

Research on mapping markers and genes continued at a rapid pace in 2007. Five high density 

marker maps were published along with detailed marker information. Varshney et al. (2007) 

developed a consensus simple sequence repeat (SSR) map using six mapping populations. 

The chromosome 7H map contained 127 markers in 157.1 cM for a marker density of 1.24. 

The supplementary information provided with the paper gives primer sequences and protocols 

for most of the markers on the map. Hearnden et al (2007) created a map from a cross 

between cultivated and wild barley (Hordeum vulgare ssp. spontaneum) using 1000 SSR and 

DArT markers. They mapped 164 markers to chromosome 7H including 82 SSRs. The two 

largest marker gaps also were on chromosome 7H. The third consensus map (Wenzl et al. 

2007) combined DArT, SSR, RFLP and STS markers and data from ten mapping populations. 

The map contained 501 markers on chromosome 7H, including 373 DArT markers. The map 

created by Stein et al. (2007) combined EST-based markers and anchor markers and data from 

three mapping populations. The integrated map contained 165 loci on chromosome 7H. The 

fifth high density map published in 2007 was created by Marcel et al. (2007) and included 

five mapping populations. Approximately 50 loci were located on chromosome 7H. This map 

was used to locate QTL for partial resistance to leaf rust. They show three Rph loci on this 

chromosome, two for seedling resistance and one for adult plant resistance. 

Adult plant resistance to the net form of net blotch was mapped by Lehmensiek et al. (2007) 

in three Australian barley populations. They found two QTL, one on each end of chromosome 

7H, that had rather small effects compared to loci on other chromosomes. Shtaya et al. (2007) 

examined leaf rust and powdery mildew resistance in 23 recombinant lines containing 

sections of H. bulbosum chromosomes. Seven of the lines contained H. bulbosum regions 

introgressed into chromosome 7H. Several of these lines showed resistance to races of one or 

both of the pathogens. 

Seed traits were examined in three studies. Hori et al. (2007) located QTL for seed dormancy 

in eight segregating populations. Two loci were located on chromosome 7H, one near the 

centromere and one on the long arm. In the second QTL, greater dormancy was contributed 

by the non-dormant parent. Ullrich et al. (2008) confirmed a QTL previously identified for 

dormancy and alpha-amylase activity on chromosome 7H that was also associated with 

preharvest sprouting. Fox et al. (2007) located regions associated with grain hardness using 

multiple methods. They found four loci on chromosome 7H, with all loci detected by at least 

two methods. 

Malting quality QTL were located in two populations by Panozzo et al. (2007) to identify 

linked markers for selection. They found QTL for hot water extract, diastatic power, alphaamylase, 

protein, viscosity, beta-glucans and free alpha-amino acid content on chromosome 

7H. von Korff et al. (2008) also looked a malting quality traits in an advanced backcross 

population from a cross between cultivated and wild barley. They located a QTL for fine- 

120


grind extract and for Hartong 45°C on chromosome 7H plus three QTL for friability. Some of 

the favorable alleles were from the H. spontaneum parent. 

The FLOWERING LOCUS T-line gene family was mapped in barley by Faure et al. (2007). 

This family consists of five genes, including one, HvFT1, which was located on the short arm 

of chromosome 7H. Four genes involved in root hair formation were mapped by Janiak and 

Szarejko (2007). The locus responsible for the lack of root hairs rhl1 was located on the short 

arm of chromosome 7H, proximal to the centromere. 

Bilgic et al. (2007) used the wheat-barley ditelosomic addition lines on the Affymetrix 

Barley1 GeneChip to physically map barley genes to chromosome arms. Out of the 1257 

genes located to chromosome arms, 119 were mapped to chromosome 7HS and 131 to 7HL. 

Of these, 60-63.8% showed synteny with wheat. Chromosome arm 7HS was syntenic to rice 

chromosomes 6S and 8L and the long arm was syntenic to rice chromosomes 6L and 8S. 

Single feature polymorphisms were detected in 65-79% of the chromosome 7H transcripts. 

References: 

Bilgic, H., S. Cho, D.F. Garvin, and G.J. Muehlbauer. 2007. Mapping barley genes to 


addition lines. Genome 50:898-906. 

Faure, S., J. Higgins, A. Turner, and D.A. Laurie. 2007. The FLOWERING LOCUS T-like 

gene family in barley (Hordeum vulgare). Genetics 176:599-609. 

Fox, G.P., B. Osborne, J. Bowman, A. Kelly, M. Cakir, D. Poulsen, A. Inkerman, and R. 

Henry. 2007. Measurement of genetic and environmental variation in barley 

(Hordeum vulgare) grain hardness. J. Cereal Sci. 46:82-92. 

Hearnden, P.R., P.J. Eckermann, G.L. McMichael, M.J. Hayden, J.K. Eglinton, and 

K.J. Chalmers. 2007. A genetic map of 1,000 SSR and DArT markers in a wide 

barley cross. Theor. Appl. Genet. 115:383-391. 

Hori, K., K. Sato, and K. Takeda. 2007. Detection of seed dormancy QTL in multiple 

mapping populations derived from crosses involving novel barley germplasm. Theor. 

Appl. Genet. 115:869-876. 

Janiak, A. and I. Szarejko. 2007. Molecular mapping of genes involved in root hair 

formation in barley. Euphytica 157:95-111. 

Korff, M. von, H. Wang, J. Leon, and K. Pillen. 2008. AB-QTL analysis in spring barley: 

III. Identification of exotic alleles for the improvement of malting quality in spring 

barley (H. vulgare ssp. spontaneum. Mol. Breeding 21:81-93. 

Lehmensiek, A., G.J. Platz, E. Mace, D. Poulsen, and M.W. Sutherland. 2007. Mapping 

of adult plant resistance to net form of net blotch in three Australian barley 

populations. Australian J. Agric. Res. 58:1191-1197. 

121


Marcel, T.C.. R.K. Varshney, M. Barbieri, H. Jafary, M.J.D. de Kock, A. Graner, and 

R.E. Niks. 2007. A high-density consensus map of barley to compare the distribution 

of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. 

Theor. Appl. Genet. 114:487-500. 

Panozzo, J.F., P.J. Eckermann, D.E. Mather, D.B. Moody, C.K. Black, H.M. Collins, 

A.R. Barr, P. Lim, and B.R. Cullis. 2007. QTL analysis of malting quality traits in 

two barley populations. Australian J. Agric. Res. 58:858-866. 

Shtaya, M.J.Y., J.C. Sillero, K. Flath, R. Pickering, and D. Rubiales. 2007. The resistance 

to leaf rust and powdery mildew of recombinant lines of barley (Hordeum vulgare L.) 

derived from H. vulgare x H. bulbosum crosses. Plant Breeding 126:259-267. 

Stein, N., M. Prasad, U. Scholz, T. Theil, H. Zhang, M. Wolf, R. Kota, R.K. Varshney, D. 

Perovic, I. Grosse, and A. Graner. 2007. A 1,000-loci transcript map of the barley 

genome: new anchoring points for integrative grass genomics. Theor. Appl. Genet. 

114:823-839. 

Ullrich, S.E., J.A. Clancy, I.A. del Blanco, H. Lee, V.A. Jitkov, F. Han, A. Kleinhofs, and 

K. Matsui. 2008. Genetic analysis of preharvest sprouting in a six-row barley cross. 

Mol. Breeding 21:249-259. 

Varshney, R.K., T.C. Marcel, L. Ramsay, J. Russell, M.S. Röder, N. Stein, R. Waugh, P. 

Langridge, R.E. Niks, and A. Graner. 2007. A high density barley microsatellite 

consensus map with 775 SSR loci. Theor. Appl. Genet. 114:1091-1103. 

Wenzl, P., H. Li, J. Carling, M. Zhou, H. Raman, E. Paul, P. Hearnden, C. Maier, L. 

Xia, V. Caig, J. Ovesna, M. Cakir, D. Poulsen, J. Wang, R. Raman, K.P. Smith, 

G.J. Muehlbauer, K.J. Chalmers, A. Kleinhofs, E. Huttner, and A. Kilian. 2007. 

A high-density consensus map of barley linking DArT markers to SSR, RFLP and 

STS loci and agricultural traits. BMC Genomics 7:206. doi:10.1186/1471-2164-7-206. 

Integration of molecular and morphological marker maps. 

No report received. 

122


Barley Genetics Stock Center 

Harold Bockelman 

USDA-ARS 

National Small Grains Germplasm Research Facility 

1691 S, 2700 W. 

Aberdeen, ID 83210, USA 

e-mail: nsgchb@ars-grin.gov 

Recent Additions to the Barley Genetic Stock Collection in the USDA-ARS National Small 

Grains Collection. 

In the past year a total of 166 accessions were added to the collection with accession numbers 

GSHO 3435 to 3600, shown in Table 1. Descriptions of these accessions are available on the 

GRIN database: http://www.ars-grin.gov/npgs. 

Table 1. Barley Genetic Stock Collection Additions in 2007-2008. 

GSHO 

number 

Mutant type Country of 

origin 

123 

District of 

origin 

GSHO 3435 T1-6ai Germany Saxony-Anhalt 

GSHO 3436 T1-7ao Germany Saxony-Anhalt 

GSHO 3437 T2-5ah Germany Saxony-Anhalt 

GSHO 3438 T2-6aq Germany Saxony-Anhalt 

GSHO 3439 T2-7aj Germany Saxony-Anhalt 

GSHO 3440 T3-4ae Germany Saxony-Anhalt 

GSHO 3441 T3-7ax Germany Saxony-Anhalt 

GSHO 3442 T3-7aaa Germany Saxony-Anhalt 

GSHO 3443 T5-6af Germany Saxony-Anhalt 

GSHO 3444 Mla.1. Germany 

GSHO 3445 Mla.13. Germany 

GSHO 3446 Mlp. Germany 

GSHO 3447 mlo.5. Germany 

GSHO 3448 MlL.a Germany 

GSHO 3449 Mlh Germany 

GSHO 3450 Multiple dominant marker stock Canada Alberta 

GSHO 3451 Multiple recessive marker stock Canada Alberta 

GSHO 3452 T4-5q Sweden 

GSHO 3453 T4-5r Sweden 

GSHO 3454 T4-5s Sweden 

GSHO 3455 T4-5t Sweden 

GSHO 3456 T4-5u Sweden 

GSHO 3457 T4-5v Sweden 

GSHO 3458 T4-5w Sweden 

GSHO 3459 T4-5x Sweden 

GSHO 3460 T4-5y Sweden 

GSHO 3461 T4-5z Sweden 

GSHO 3462 T4-5aa Sweden 

GSHO 3463 T4-5ab Sweden 

GSHO 3464 T4-6a Sweden

Table 1. contin. 

GSHO 

number 



origin 

124 

District of 

origin 

GSHO 3465 T4-6b Sweden 

GSHO 3466 T4-6c Sweden 

GSHO 3467 T4-6d Sweden 

GSHO 3468 T4-6e Sweden 

GSHO 3469 T4-6f Sweden 

GSHO 3470 T4-6g Sweden 

GSHO 3471 T4-6h Sweden 

GSHO 3472 T4-6i United States Colorado 

GSHO 3473 T4-6j Germany Bavaria 

GSHO 3474 T4-6k Germany Bavaria 

GSHO 3475 T4-6l Sweden 

GSHO 3476 T4-6m Sweden 

GSHO 3477 T4-6n Sweden 

GSHO 3478 T4-6o Sweden 

GSHO 3479 T4-6p Sweden 







GSHO 3486 T4-7a Sweden 


GSHO 3488 T4-7c United States Arizona 

GSHO 3489 T4-7d United States Arizona 

GSHO 3490 T4-7e United States Arizona 



GSHO 3493 T4-7h United States Arizona 

GSHO 3494 T4-7i Germany Bavaria 

GSHO 3495 T4-7j Sweden 

GSHO 3496 T4-7k Sweden 












GSHO 3508 T5-6d United States Arizona 





GSHO 3513 T5-6i Germany Bavaria


GSHO 

number 



origin 

125 

District of 

origin 














GSHO 3527 T5-7a United States Minnesota 


GSHO 3529 T5-7c Canada Manitoba 






GSHO 3535 T5-7i Sweden 


GSHO 3537 T5-7k Germany Bavaria 

GSHO 3538 T5-7l Germany Bavaria 




















GSHO 3558 T6-7e United States Arizona 

GSHO 3559 T6-7f United States Arizona 

GSHO 3560 T6-7g United States Arizona 


GSHO 3562 T6-7i Sweden 

GSHO 3563 T6-7j Sweden


GSHO 

number 



origin 

126 

District of 

origin 





GSHO 3568 T6-7o United States Arizona 

GSHO 3569 T6-7p United States Arizona 

GSHO 3570 T6-7q United States Arizona 

GSHO 3571 T6-7r United States Arizona 

GSHO 3572 T6-7s United States Arizona 

GSHO 3573 T6-7t Germany Bavaria 

GSHO 3574 T6-7u Germany Bavaria 







GSHO 3581 T6-7ab Sweden 

GSHO 3582 T6-7ac Sweden 

GSHO 3583 T6-7ad Sweden 

GSHO 3584 T6-7ae Sweden 

GSHO 3585 T6-7af Sweden 

GSHO 3586 T6-7ag Sweden 

GSHO 3587 T6-7ah Sweden 

GSHO 3588 T6-7ai Sweden 

GSHO 3589 T6-7aj Sweden 

GSHO 3590 T6-7ak Sweden 

GSHO 3591 T6-7al Sweden 

GSHO 3592 T6-7am Sweden 

GSHO 3593 T6-7an Sweden 

GSHO 3594 T6-7ao Sweden 

GSHO 3595 T6-7ap Sweden 

GSHO 3596 T6-7aq United States Arizona 

GSHO 3597 Mutant 1661 Sweden Uppsala 




References: 

http://ace.untamo.net/bgs 

http://www.ars-grin.gov/npgs 

Wright, S.A.I., M. Azarang, and A.B. Falk. 2007. Four new barley mutants. Barley 

Genetics Newsletter 37:34-36.


Coordinator’s report: Translocations and 

balanced tertiary trisomics 

Andreas Houben 

Leibniz-Institute of Plant Genetics and Crop Plant Research 

DE-06466 Gatersleben, Germany 

email: houben@ipk-gatersleben.de 

Prof. M. Molnar-Lang and colleagues succeeded in developing translocation lines by inducing 

homologous chromosome pairing in a 4H(4D) wheat-barley substitution line previously 

developed in Martonvasar (Sepsi et al., 2006). It was hoped to incorporate various segments 

of the barley 4H chromosome from the 4H(4D) substitution into wheat. Observations were 

made on the frequency with which wheat-barley translocations appeared in the F-2 progeny 

grains from a cross between the line CO4-1, which carries the Ph suppressor gene from 

Aegilops speltoides and thus induces a high level of homologous chromosome pairing, and the 

4H(4D) wheat-barley substitution line, and on which chromosome segments were involved in 

the translocations. Of the 117 plants examined, three (2.4%) were found to contain 

translocations. A total of four translocations were observed, as one plant contained two 

different translocations. The translocations consisted of one centric fusion, two dicentric 

translocations and one acrocentric chromosome. 

Prof. K. Gecheff (Institute of Genetics, Sofia, Bulgaria) kindly donated 42 homozygous 

single translocation lines produced by gamma-irradiation of spring two-rowed barley variety 

‘Freya’. All lines are precisely characterized with respect to the chromosomal localization of 

the translocation break points (Gecheff, 1996). 

The collection is being maintained in cold storage. To the best knowledge of the coordinator, 

there are no new publications dealing with balanced tertiary trisomics in barley. Limited seed 

samples are available any time, and requests can be made to the coordinator. 

Reference: 

Gecheff, K. I., 1996. Production and identification of new structural chromosome mutations 

in barley (Hordeum vulgare L). Theoretical and Applied Genetics. 92:777-781 

Sepsi, A., K. Nemeth, I. Molnar, E. Szakacs, and M. Molnar-Lang. 2006. Induction of 

chromosome rearrangements in a 4H(4D) wheat-barley substitution using a wheat line 

containing a Ph suppressor gene. Cereal Research Communications 34: 1215-1222 

Trisomic and aneuploid stocks 

No report received 

127


Coordinator’s report: Autotetraploids 

Wolfgang Friedt, Institute of Crop Science and Plant Breeding I. 

Justus-Liebig-University, Heinrich-Buff-Ring 26-32 

DE-35392 Giessen, Germany 

e-mail: wolfgang.friedt@agrar.uni-giessen.de 

Fax: +49(0)641-9937429 

The collection of barley autotetraploids (exclusively spring types) described in former issues 

of BGN is maintained at the Giessen Field Experiment Station of our institute. The set of 

stocks, i.e. autotetraploids (4n) and corresponding diploid (2n) progenitors (if available) have 

last been grown in the field for seed multiplication in summer 2000. Limited seed samples of 

the stocks are available for distribution. 

Coordinator’s report: Eceriferum genes 



P.O. Box 41, SE-230 53 Alnarp, Sweden 


No research work on gene localization has been reported on the collections of Eceriferum and 

Glossy genes. All descriptions in Barley Genetics Newsletter (BGN) Volume 26 are valid and 

still up-to-date. Several ones are revised especially in BGN 37, All Swedish Eceriferum 

alleles can be found in the SESTO database information system of the Nordic Genetic 

Resource Center, Sweden. Descriptions, images and graphic chromosome map displays of 

these genes are available in the AceDB database for Barley Genes and Barley Genetic Stocks 

with its address found by: www.untamo.net/bgs . It gets updated continouosly and also 

searchable through the Triticeae database GrainGenes. 

Every research of interest in the field and literature references of these genes can be reported 

to the coordinator as well. Seed requests regarding the Swedish mutant alleles can be 

forwarded to the coordinator udda@nordgen.org or to the Nordic Genetic Resource Center, 

www.nordgen.org/ngb , all the others to the Small Grain Germplasm Research Facility 

(USDA-ARS), Aberdeen, ID 83210, USA, nsgchb@ars-grin.gov or to the coordinator at any 

time. 

128


Coordinator’s report: Nuclear genes affecting the chloroplast 

Mats Hansson 

Carlsberg Laboratory, 

Gamle Carlsberg Vej 10, 

DK-2500 Valby, 

Copenhagen, Denmark 

E-mail: mats@crc.dk 

Barley mutants deficient in chlorophyll biosynthesis and chloroplast development are easily 

distinguished from wild type plants by their deviant colour. Therefore, chlorophyll mutants 

have often been used to optimise and calibrate mutagenesis methods (Lundqvist 1992). 

Chlorophyll mutants have been named albina, xantha, viridis, chlorina, tigrina and striata 

depending on their colour and colour pattern. In the albina mutants the leaves are completely 

white due to lack of both chlorophyll and carotene pigments. The xantha mutants are yellow 

and produce carotene, but no chlorophyll. The chlorina and viridis mutants are both pale 

green, but differ in chlorina being viable. The tigrina and striata mutants are stripped 

transverse and along the leaves, respectively. 

Frigerio et al. (2007) utilized the viridis-zb.63 mutant to study the transcription and 

accumulation of light-harvesting complexes in barley. In viridis-zb.62 the photosystem I is 

depleted and the plastoquinone pool is constitutively reduced. They showed that that the 

mRNA level of all photosynthesis-related genes including genes encoding antenna proteins 

are almost unaffected in the mutant. In contrast, analysis of protein accumulation showed that 

the mutant undergoes strong reduction of its antenna size, with individual gene products 

having different levels of accumulation. They conclude that the plastoquinone redox state 

plays an important role in the long term regulation of chloroplast protein expression, but its 

modulation is active at the post-transcriptional rather than transcriptional level. 

Zakhrabekova et al. (2007) evaluated the possibility to clone genes deficient in barley mutants 

by a microarray approach. In their study barley mutants xantha-h.57 and xantha-f.27 were 

used in combination with the Affymetrix microarray platform. Both xantha-h.57 and xanthaf.27 

are deficient in the chlorophyll biosynthetic enzyme magnesium chelatase, but in 

different genes encoding two of the three subunits of this very complex enzyme. Mutant 

xantha-h.57 produces no Xantha-h mRNA whereas in xantha-f.27 the nonsense mutation in 

the last exon of the gene, results in nonsense-mediated decay of Xantha-f mRNA. Among the 

22,792 probe sets arrayed on the Affymetrix chip, the Xantha-h and Xantha-f genes were 

possible to highlight in a competitive analysis between xantha-h.57 and xantha-f.27. It was 

concluded that it should be possible to use the approach of combining the Affymetrix 

platform with phenotypically similar mutants in order to clone genes only known through 

their mutant phenotype. 

The stock list of barley mutants defective in chlorophyll biosynthesis and chloroplast 

development is found elsewhere in the issue of BGN 37 and at 

http://www.mps.lu.se/fileadmin/mps/People/Hansson/Barley_mutants_web.pdf 

129


Lundqvist, U. 1992. Mutation research in barley. PhD Thesis. The Swedish University of 

Agricultural Sciences. Svalöv. Available from 

http://www.mps.lu.se/fileadmin/mps/People/Hansson/Uddas_thesis.pdf 

New references: 

Frigerio, S., C. Campoli, S. Zorzan, L. I. Fantoni, C. Crosatti, F. Drepper, W. Haehnel, 

L. Cattivelli, T. Morosinotto and R. Bassi. 2007. Photosynthetic antenna size in 

higher plants is controlled by the plastoquinone redox state at the post-transcriptional 

rather than transcriptional level. J. Biol. Chem. 282: 29457-29469. 

Zakhrabekova, S., S. P. Gough, U. Lundqvist and M. Hansson. 2007. Comparing two 

microarray platforms for identifying mutated genes in barley (Hordeum vulgare L.). 

Plant Physiol. Biochem. 45: 617-622. 

Coordinator’s report: The Genetic Male 

Sterile Barley Collection 

M.C. Therrien 

Agriculture and Agri-Food Canada 

Brandon Research Centre 

Box 1000A, RR#3, Brandon, MB 

Canada R7A 5Y3 

E-mail: MTherrien@agr.gc.ca 

The GMSBC has been at Brandon since 1992. If there are any new sources of male-sterile 

genes that you are aware of, please advise me, as this would be a good time to add any new 

source to the collection. For a list of the entries in the collection, simply E-mail me at the 

above address. I can send the file (14Mb) in Excel format. We continue to store the collection 

at -20 o C and will have small (5 g) samples available for the asking. Since I have not received 

any reports or requests the last years, there is absolutely no summary in my report. 

130


Coordinator’s report: Early maturity and 

Praematurum genes 



P-O. Box 41 



Not much new research on gene localization has been reported on the Early maturity or 

Praematurum genes since the latest reports in Barley Genetic Newsletter (BGN) or in the 

AceDB database for Barley Genes and Barley Genetic Stocks. 

All information and descriptions made in the Barley Genetics Newsletter are valid and still 

up-to-date. Some of them are revised especially in BGN 37. All the Swedish Praematurum 

genes with its alleles can be found in the SESTO database information system of the Nordic 

Genetic Resource Center, Sweden. Descriptions, images and graphic chromosome map 

displays of these early maturity or Praematurum genes are available in the AceDB database 

for Barley Genes and Barley Genetic Stocks with its address found by: www.untamo.net/bgs . 

It gets updated continuously and also searchable through the Triticeae database GrainGenes. 

Every research of interest in the field and literature references of these genes can be reported 

to the coordinator as well. Seed requests regarding the Swedish mutant alleles can be 

forwarded to the coordinator or directly to the Nordic Genetic Resource Center, 

www.nordgen.org/ngb, all others to the Small Grain Germplasm Research Facility (USDA- 

ARS), Aberdeen, ID 83210, USA, nsgchb@ars-grin.gov or to the coordinator at any time. 

131


Coordinator’s report: Ear morphology genes 



P.O. Box 41, SE-230 53 Alnarp, Sweden. 


Since the last report in Barley Genetics Newsletter several descriptions on morphological ear 

genes have been revised and updated and one new description on the Double seed 1 (dub1) 

gene has been performed (Dahleen et al. 2007). New developmental mutants as a guide to the 

barley phytomer were studied where several ear motphological genes were included (Forster 

et al. 2007, Franckowiak et al. 2008). All ear morphological genes are backcrossed to the 

cultivar ‘Bowman’ and are available with special GSHO numbers. 

All earlier descriptions in the Barley Genetics Newsletter (BGN) volumes 26, 28, 29, 32, 35 

and 37 are up-to-date and valid. They are also updated in the AceDB database for Barley 

Genes and Barley Genetic Stocks and searchable with its address found by: 

www.untamo.net/bgs 

Every research in the field and literature references of these genes can be reported to the 

coordinator as well. Seed requests regarding the Swedish mutant alleles can be forwarded to 

the coordinator udda@nordgen.org or to the Nordic Genetic Resource Center, 

www.nordgen.org/ngb , regarding all the others and the Bowman near isogenic lines to the 

Small Grain Germplasm Research Facility (USDA-ARS), Aberdeen, ID 83210, USA, 

nsgch@ars-grin.gov or to the coordinator at any time. 

References: 

Forster, B.P., J.D. Franckowiak, U. Lundqvist, J. Lyon, L. Pitkethly, and W.T.B. 

Thomas. 2007. The barley phytomer. Annals of Botany 100: 725-733. 

Franckowiak, J.D., B.P. Forster, U. Lundqvist, J. Lyon, I. Pitkethly, and W.T.B. 

Thomas. 2008. Developmental Mutants as a Guide to the Barley Phytomer. Proc. Xth 

Intern. Barley Genet. Symp. 5.-10. April 2008, Alexandria Egypt. (in press). 

Coordinator’s report : Wheat-barley genetic stocks 

A.K.M.R. Islam 

Faculty of Agriculture, Food & Wine, 

The University of Adelaide, Waite Campus, 

Glen Osmond, SA 5064, Australia 

e-mail: rislam@waite.adelaide.edu.au 

The production of five different disomic addition lines (1Hm, 2Hm, 4Hm, 5Hm and 7Hm) of 

Hordeum marinum chromosomes to Chinese Spring wheat has been reported earlier. It has 

now been possible to isolate a disomic addition for chromosome 6Hm. Amphiploids between 

H. marinum and commercial spring wheats have been reported earlier. Amphiploids of H. 

marinum with winter wheats have also been produced in the mean time. These amphiploids 

show better waterlogging and salt tolerance than wheat parents (Islam and Colmer, 

unpublished). 

132


Reference: 

Islam, A.K.M.R and T.D. Colmer. 2008. Attempts to transfer salt-and waterlogging 

tolerances from Sea barleygrass (Hordeum marinum Huds.) to wheat. Proc. 11th Int. 

Wheat Genet. Symposium, 24-29 August 2008, Brisbane, Australia (in Press). 

Coordinator’s report: Semidwarf genes 

J.D. Franckowiak 

Hermitage Research Station 



e-mail: jerome.franckowiak@dpi.qld.gpv.au 

Using the DNA sequence of rice mutants at the gibberellin (GA) insensitive dwarf 1 (Gid1) 

locus, a GA receptor, Chandler et al. (2008) demonstrated that the putative orthologue from 

barley is the GA sensitivity 1 (gse1) locus. Of 35 gse1 mutants evaluated, 16 carried different 

unique nucleotide substitution in this sequence. Study of maximal daily elongation rate 

(LERmax) of the first leaf of germinated grains with different GA treatments revealed 

considerable variation in LERmax values, which related closely to the degree of dwarfing 

observed during plant growth. The gse1 mutants and their GA responses were previous 

described by Chandler and Robertson (1999). The gsela mutant was characterized by low 

alpha-amylase levels, but the mutant was re responsive to GA treatments (Chandler and 

Robertson, 1999). The study of individual gse1 mutants demonstrated some response 

differences among the gse1 mutants examined (Chandler et al., 2008). 

Willige et al. (2007) reported that the DELLA domain of GA insensitive of barley mutants at 

the slender 1 (sln1) locus suppress GA responses These mutant genes and similar mutants of 

maize and wheat mutants, when introduced into Arabidopsis, conferred GA insensitivity. The 

sln1 mutants in barley were previously described by Chandler et al. (2002). 

Chandler, P.M., C.A. Harding, A.R. Ashton, M.D. Mulcair, N.E. Dixon and L.N. 

Mander. 2008. Characterization of gibberellin receptor mutants of barley (Hordeum 

vulgare L.) Molecular Plant 1:285-294. 

Chandler, P.M., A. Marion-Poll, M. Ellis and F. Gubler. 2002. Mutants at the Slender1 

locus of barley cv. Himalaya. Molecular and physiological characterization. Plant 

Physiol. 129: 181-190. 

Chandler, PM, and M. Robertson. 1999. Gibberellin dose–response curves and the 

characterization of dwarf mutants of barley. Plant Physiol 120:623-632. 

Willige, B.C., S. Ghosh, C. Nill, M. Zourelidou, E.M.N. Dohmann, A. Maier and C. 

Schwechheimer. 2007. The DELLA domain of GA INSENSITIVE mediates the 

interaction with the GA INSENSITIVE DWARF1A gibberellin receptor of 

Arabidopsis. Plant Cell 19:1209-1220. 

133

Barley Genetics Newsletter (2008) 38: 134-164 

Tables of Barley Genetic Stock Descriptions. 

Latest version 

Jerome D. Franckowiak 1 and Udda Lundqvist 2 

1 Hermitage Research Station, 



2 Nordic Genetic Resource Center 


Table 1. A listing of Barley Genetic Stock (BGS) descriptions in recent issues of the Barley 

Genetics Newsletter recommended locus symbols and names, and stock location 

information. 

Table 2. An alphabetic listing of recently published Barley Genetic Stock (BGS) descriptions 

for loci in barley (Hordeum vulgare), including information on chromosomal locations, 

recommended locus names, and original cultivars. 

134

Barley Genetics Newsletter (2008) 134-164 

Table 1. A listing of Barley Genetic Stock (BGS) descriptions in recent issues of the Barley 

Genetics Newsletter recommended locus symbols and names, and stock location 

information. 

BGS Locus symbol * Chr. Locus name or phenotype Descr. GSHO 

no. Rec. Prev. loc. † vol. p. no. ‡ 

1 brh1 br, ari-i 7HS Brachytic 1 37:188 25 

2 fch12 fc, clo-fc 7HS Chlorina seedling 12 37:190 36 

3 yvs2 yc 7HS Virescent seedling 2 26: 46 41 

4 abo8 ac2, alb-m 7HS Albino seedling 8 26: 47 61 

5 fch8 f8 7HS Chlorina seedling 8 26: 48 40 

6 vrs1 v, Int-d 2HL Six-rowed spike 1 37:192 196 

7 nud1 n, h 7HL Naked caryopsis 1 37:195 115 

9 dsp1 l 7HS Dense spike 1 26: 53 1232 

10 lks2 lk2, lk4 7HL Short awn 2 37:197 566 

11 ubs4 u4, ari-d 7HL Unbranched style 4 26: 56 567 

12 des1 lc 7H Desynapsis 1 26: 57 592 

13 des4 des4 7H Desynapsis 4 26: 58 595 

14 des5 des5 7H Desynapsis 5 26: 59 596 

15 blx1 bl 4HL Non-blue aleurone xenia 1 26: 60 185 

16 wax1 wx, glx 7HS Waxy endosperm 1 26: 61 908 

17 fch4 f4, yv 7HL Chlorina seedling 4 26: 63 1214 

18 fch5 f5, yv2 7HS Chlorina seedling 5 26: 64 1215 

19 blx2 bl2 7HS Non-blue aleurone xenia 2 26: 65 209 

20 Rym2 Ym2 7HL Reaction to BaYMV 2 26: 66 984 

21 Run1 Un 7HS Reaction to Ustilago nuda 1 26: 67 1324 

22 Rsg1 Grb 7H Reaction to Schizaphis graminum 1 37:199 1317 

23 wnd1 wnd 7HS Winding dwarf 1 26: 69 2499 

24 fst3 fs3 7HS Fragile stem 3 26: 70 1746 

25 Xnt1 Xa 7HL Xantha seedling 1 26: 71 1606 

26 snb1 sb 7HS Subnodal bract 1 26: 72 1217 

27 lbi3 lb3 7HL Long basal rachis internode 3 26: 73 536 

28 ert-a ert-a 7HS Erectoides-a 26: 74 468 

29 ert-d ert-d 7HS Erectoides-d 26: 76 475 

30 ert-m ert-m 7HS Erectoides-m 26: 78 487 

31 sex6 sex6 7HS Shrunken endosperm xenia 6 26: 80 2476 

32 Rph9 Pa9 5HL Reaction to Puccinia hordei 9 37:201 1601 

33 ant1 rs, rub-a 7HS Anthocyanin-less 1 26: 82 1620 

34 msg50 msg,,hm 7HL Male sterile genetic 50 26: 83 2404 

35 rsm1 sm 7HS Reaction to BSMV 1 26: 84 2492 

36 xnt4 xc2 7HL Xantha seedling 4 26: 85 42 

37 xnt9 xan,,i 7HL Xantha seedling 9 26: 86 584 

38 smn1 smn 7HS Seminudoides 1 32: 78 1602 

39 mss2 mss2 7HS Midseason stripe 2 

135 

32: 79 2409


Table 1 (continued) 

BGS Locus symbol * Chr. † Locus name or phenotype Descr. GSHO 

no. Rec. Prev. loc. vol. p. no. ‡ 

40 prm1 prm 7HS Premature ripe 1 32: 80 2429 

41 brh7 brh.w 5HS Brachytic 7 37:203 1687 

42 Pyr1 Pyr1 7HS Pyramidatum 1 32: 82 1581 

43 mov1 mo5 7HL Multiovary 1 35:185 

44 brh16 brh.v 7HL Brachytic 16 37:204 1686 

51 rtt1 rt 2HS Rattail spike 1 26: 87 216 

52 fch15 or 2HS Chlorina seedling 15 26: 88 49 

53 abo2 a2 2HS Albino seedling 2 26: 89 70 

55 fch1 f, lg 2HS Chlorina seedling 1 26: 90 112 

56 wst4 wst4 2HL White streak 4 26: 91 568 

57 eog1 e, lep-e 2HL Elongated outer glume 1 26: 92 29 

58 vrs1 lr, v lr 2HL Six-rowed spike 1 26: 94 153 

59 gpa1 gp, gp2 2HL Grandpa 1 26: 95 1379 

60 lig1 li, aur-a 2HL Liguleless 1 37:205 6 

61 trp1 tr 2HL Triple awned lemma 1 26: 97 210 

62 sbk1 sk, cal-a 2HS Subjacent hood 1 32: 83 267 

63 yvs1 yx, alb-c2 2HS Virescent seedling 1 26: 99 68 

64 des7 des7 2H Desynapsis 7 26:100 598 

65 Eam1 Ea, Ppd-H1 2HS Early maturity 1 26:101 1316 

66 vrs1 V d 2HL Two-rowed spike 1 26:103 346 

67 vrs1 V t 2HL Deficiens 1 26:104 684 

68 Pvc 1 Pc 2HL Purple veined lemma 1 26:105 132 

69 Gth 1 G 2HL Toothed lemma 1 26:106 309 

70 Rph1 Pa 2H Reaction to Puccinia hordei 1 26:107 1313 

71 com2 bir2 2HS Compositum 2 26:108 1703 

72 glo-c glo-c 2H Globosum-c 26:109 1329 

73 fol-a fol-a 2HL Angustifolium-a 26:110 1744 

74 flo-c flo-c 2HS Extra floret-c 26:111 1743 

75 Lks1 Lk 2HL Awnless 1 26:112 44 

76 Pre2 Re2, P 2HL Red lemma and pericarp 2 26:113 234 

77 hcm1 h 2HL Short culm 1 26:115 2492 

78 mtt4 mt,,e, mt 2HL Mottled leaf 4 26:116 1231 

79 wst7 rb 2HL White streak 7 37:207 247 

80 ant2 pr, rub 2HL Anthocyanin-less 2 26:118 1632 

81 gsh7 gs7 Glossy sheath 7 26:119 1759 

82 Zeo1 Knd 2HL Zeocriton 1 37:209 1613 

83 sld2 sld2 2HS Slender dwarf 2 26:121 2491 

84 mss1 mss 2H Midseason stripe 1 26:122 1404 

85 yst4 yst4 2HL Yellow streak 4 37:210 2502 

86 fch13 f13 Chlorina seedling 13 26:124 16 

136





87 fch14 f14 2HL Chlorina seedling 14 37:211 1739 

88 Rph2 Pa2, A 5HS Reaction to Puccinia hordei 2 37:212 1593 

89 ari-g ari-g, lk10 Breviaristatum-g 26:128 1655 

90 ert-j ert-j 2H Erectoides-j 26:129 484 

91 ert-q ert-q 2H Erectoides-q 26:130 1562 

92 ert-u ert-u, br5 2H Erectoides-u 26:131 496 

93 ert-zd ert-zd, br7 2H Erectoides-zd 26:132 504 

94 abo4 a4 2H Albino seedling 4 26:133 167 

95 abo13 alb,,p 2HL Albino seedling 13 26:134 585 

96 Rph15 Rph16 2HS Reaction to Puccinia hordei 15 37:214 1586 

97 acr1 acr 2HL Accordion rachis 1 32: 85 1617 

98 Eam6 Ea6, Ea 2HS Early maturity 6 37:216 

99 lin1 s, rin 2HL Lesser internode number 1 32: 88 2492 

100 sld4 sld.d 7HS Slender dwarf 4 37:218 2479 

101 als1 als 3HL Absent lower laterals 1 37:219 1065 

102 uzu1 uz, u 3HL Uzu 1 or semi brachytic 1 37:220 1300 

104 yst1 yst, ys 3HS Yellow streak 1 26:138 1140 

105 xnt3 xc, vir-l 3HS Xantha seedling 3 26:139 66 

106 abo6 ac 3HS Albino seedling 6 26:140 30 

107 wst1 wst, wst3 3HL White streak 1 26:141 159 

108 alm1 al, ebu-a 3HS Albino lemma 1 37:222 270 

109 yst2 yst2 3HS Yellow streak 2 26:144 570 

111 dsp10 lc 3HS Dense spike 10 26:145 71 

112 abo9 an 3HS Albino seedling 9 26:146 348 

113 xnt6 xs 3HS Xantha seedling 6 26:147 117 

114 cur2 cu2 3HL Curly 2 26:148 274 

115 btr1 bt1 3HS Non-brittle rachis 1 26:149 1233 

116 btr2 bt2 3HS Non-brittle rachis 2 26:150 842 

117 fch2 f2, lg5 3HL Chlorina seedling 2 26:151 107 

118 lnt1 rnt, int-l 3HL Low number of tillers 1 26:153 833 

119 des2 ds 3H Desynapsis 2 26:154 593 

120 zeb1 zb 3HL Zebra stripe 1 26:155 1279 

121 Rph3 Pa3 7HL Reaction to Puccinia hordei 3 26:156 1316 

122 Rph5 Pa5, Pa6 3HS Reaction to Puccinia hordei 5 37:224 1597 

123 Ryd2 Yd2 3HL Reaction to BYDV 2 26:158 1315 

124 vrs4 mul, int-e 3HL Six-rowed spike 4 26:159 775 

125 lzd1 lzd, dw4 3HS Lazy dwarf 1 26:161 1787 

126 sld1 dw1 3HL Slender dwarf 1 26:162 2488 

127 Pub1 Pub 3HL Pubescent leaf blade 1 26:163 1576 

128 sca1 sca 3HS Short crooked awn 1 26:164 2439 

137





129 wst6 wst,,j 3HL White streak 6 26:165 2500 

130 eam10 easp 3HL Early maturity 10 37:226 2504 

131 gra-a gran-a 3HL Granum-a 26:167 1757 

132 ari-a ari-a 3HS Breviaristatum-a 26:168 1648 

133 sdw2 sdw-b 3HL Semidwarf 2 26:169 2466 

134 ert-c ert-c 3HL Erectoides-c 26:170 471 

135 ert-ii ert-ii 3HL Erectoides-ii 26:172 483 

136 Rph7 Pa7, Pa5 3HS Reaction to Puccinia hordei 7 37:228 1318 

137 Rph10 Rph10 3HL Reaction to Puccinia hordei 10 26:174 1588 

138 nec4 nec4 3H Necrotic leaf spot 4 26:175 

139 nec5 nec5 3H Necrotic leaf spot 5 26:176 

140 xnt8 xan,,h 3HS Xantha seedling 8 26:177 582 

141 rym5 Ym 3HL Reaction to Barley yellow mosaic virus 5 32: 90 

142 brh8 brh.ad 3HS Brachytic 8 37:230 1671 

143 sex8 sex.j 3HS Shrunken endosperm 8 32: 93 2471 

144 sld5 sld5 3HS Slender dwarf 5 32: 94 2483 

146 cal-d cal-d 3H Calcaroides-d 32: 95 1697 

147 mov2 mo 3HS Multiovary 2 35:190 

148 brh14 brh.q 3HL Brachytic 14 37:231 1682 

149 Rpc1 3H Reaction to Puccinia coronata var. hordei 1 37:232 1601 

151 fch9 f9 4HS Chlorina seedling 9 26:178 571 

152 Kap1 K 4HS Hooded lemma 1 26:179 985 

155 glf1 gl, cer-zh 4HL Glossy leaf 1 37:233 98 

156 lbi2 lb2, ert-i 4HL Long basal rachis internode 2 26:183 572 

157 brh2 br2, ari-l 4HL Brachytic 2 37:235 573 

158 yhd1 yh 4HL Yellow head 1 26:185 574 

160 min2 en-min Enhancer of minute 1 26:186 266 

161 min1 min 4HL Semi-minute dwarf 1 26:187 987 

163 sgh1 sh1 4HL Spring growth habit 1 26:188 575 

164 Hln1 Hn 4HL Hairs on lemma nerves 1 26:189 576 

165 glf3 gl3, cer-j 4HL Glossy leaf 3 26:190 577 

166 msg25 msg,,r 4HL Male sterile genetic 25 26:192 744 

167 rym1 Ym 4HL Reaction to barley yellow mosaic virus 1 32: 96 

168 glo-a glo-a 4HS Globosum-a 26:194 1328 

170 lgn3 lg3 4HL Light green 3 26:195 171 

171 lgn4 lg4, lg9 4HL Light green 4 26:196 681 

172 lks5 lk5, ari-c 4HL Short awn 5 26:197 1297 

173 blx3 bl3 4HL Non-blue aleurone xenia 3 26:198 2506 

174 blx4 bl4 4HL Non-blue (pink) aleurone xenia 4 26:199 2507 

176 ovl1 ovl 4H Ovaryless 1 35:191 

138





178 int-c i, v5 4HS Intermedium spike-c 37:237 776 

179 Hsh1 Hs 4HL Hairy leaf sheath 1 37:240 986 

180 sid1 nls 4HL Single internode dwarf 1 26:203 2477 

181 eam9 ea,,c 4HL Early maturity 9 26:204 1732 

182 flo-a flo-a Extra floret-a 26:205 1741 

183 Ynd1 Yn 4HS Yellow node 1 32:98 

184 Zeo3 Zeo.h 4HL Zeocriton 3 32:99 1611 

185 brh5 brh.m 4HS Brachytic 5 37:242 1678 

186 sld3 ant17.567 4HS Slender dwarf 3 37:243 2480 

187 brh9 brh.k 4HS Brachytic 9 37:244 1676 


202 trd1 t, bra-c 1HL Third outer glume 1 26:207 227 

203 Blp1 B 1HL Black lemma and pericarp 1 37:245 988 

207 abo1 at 1HL Albino seedling 1 26:210 51 

208 fst2 fs2 1HL Fragile stem 2 26:211 578 

213 Sgh3 Sh3 1HL Spring growth habit 3 26:212 764 

214 eam8 eak, mat-a 1HL Early maturity 8 37:247 765 

215 des6 des6 1H Desynapsis 6 26:216 597 

218 Rph4 Pa4 1HS Reaction to Puccinia hordei 4 26:217 1314 

220 fch3 f3 1HS Chlorina seedling 3 26:218 851 

221 wst5 wst5 1HL White streak 5 26:219 591 

222 nec1 sp,,b 1HL Necrotic leaf spot 1 37:251 989 

223 zeb3 zb3, zbc 1HL Zebra stripe 3 26:221 1451 

224 ert-b ert-b 1HL Erectoides-b 26:222 470 

225 clh1 clh 1HL Curled leaf dwarf 1 26:223 1212 

226 rvl1 rvl 1HL Revoluted leaf 1 26:224 608 

227 sls1 sls 1HS Small lateral spikelet 1 26:225 2492 

228 Sil1 Sil 1HS Subcrown internode length 1 26:226 1604 

229 cud2 cud2 1HL Curly dwarf 2 26:227 1712 

230 glo-e glo-e 1HL Globosum-e 26:228 1755 

231 cur5 cu5 1HS Curly 5 26:229 1710 

232 Lys4 sex5 1HS High lysine 4 26:230 2475 

233 xnt7 xan,,g 1HL Xantha seedling 7 26:231 581 

234 mov3 mo-a 1H Multiovary 3 32:102 

235 lel1 lel 1HL Leafy lemma 1 32:103 1780 

251 mul2 mul2 6HL Multiflorus 2 26:232 1394 

252 eam7 ea7, ec 6HS Early maturity 7 26:233 579 

253 cul2 uc2 6HL Uniculm 2 37:253 531 

254 rob1 o, rob-o 6HS Orange lemma 1 37:255 707 

255 xnt5 xn 6HL Xantha seedling 5 26:237 43 

139





257 raw5 r,,e 6HL Smooth awn 5 26:238 785 

258 dsp9 l9, ert-e 6HL Dense spike 9 26:239 1774 


261 nec2 nec2 6HS Necrotic leaf spot 2 26:241 1224 

262 cur1 cu1 6HL Curly 1 26:242 1705 

263 cur3 cu3 6HL Curly 3 26:243 1707 

264 mtt5 mt,,f 6HL Mottled leaf 5 26:244 2410 

265 nec3 nec3 6HS Necrotic leaf spot 3 26:245 1330 

266 ert-e ert-e, dsp9 6HL Erectoides-e 37:257 477 


268 lax-b lax-b 6HL Laxatum-b 26:248 1776 

269 lys6 lys6 6H High lysine 6 26:249 1786 

270 abo14 alb,,q 6HL Albino seedling 14 26:250 586 

271 abo15 alb,,t 6HS Albino seedling 15 26:251 

301 fst1 fs 5HL Fragile stem 1 26:252 629 

302 mtt2 mt2 5HL Mottled leaf 2 26:253 1398 

303 var3 va3 5HL Variegated 3 26:254 1277 

304 wst2 wst2 5HL White streak 2 26:255 766 

305 crm1 cm 5HL Cream seedling 1 26:256 20 

306 var1 va 5HL Variegated 1 37:259 1278 

308 lbi1 lb, rac-a 5HL Long basal rachis internode 1 26:258 580 

309 Sgh2 Sh2 5HL Spring growth habit 2 26:259 770 

311 dex1 sex2 5HS Defective endosperm xenia 1 26:260 

312 raw1 r 5HL Smooth awn 1 26:261 27 

313 fch6 f6, yv 5HL Chlorina seedling 6 26:262 1390 

314 vrs2 v2 5HL Six-rowed spike 2 26:263 773 

315 vrs3 v3, int-a 1HL Six-rowed spike 3 26:264 774 

317 ddt1 ddt 5HS Reaction to DDT 1 26:266 331 

319 rpg4 rpg4 5HL Reaction to Puccinia graminis 4 26:267 2438 

320 int-b int-b 5HL Intermedium spike-b 26:268 1764 

321 srh1 s, l 5HL Short rachilla hair 1 26:269 27 

322 dsk1 dsk 5HL Dusky 1 26:270 1714 

323 nld1 nld 5HL Narrow leafed dwarf 1 26:271 769 

324 cud1 cud 5HL Curly dwarf 1 26:272 1711 

325 crl1 crl, cl Curly lateral 1 26:273 1211 

326 blf1 bb 5HL Broad leaf 1 26:274 1393 

327 flo-b flo-b 5HL Extra floret-b 26:275 1742 

328 ari-e ari-e 5HL Breviaristatum-e 26:276 1653 

329 ari-h ari-h 5HL Breviaristatum-h 26:277 1656 

330 ert-g ert-g, br3 5HL Erectoides-g 26:278 479 

140





331 ert-n ert-n 5HL Erectoides-n 26:279 488 

332 Ert-r Ert-r Erectoides-r 26:280 492 


334 raw6 r6 5HL Smooth awn 6 26:282 2437 

335 msg49 msg,,jw 5HL Male sterile genetic 49 26:283 2402 

336 glo-b glo-b 5HL Globosum-b 26:284 1326 

337 blf2 bb2, nlh 5HL Broad leaf 2 26:285 1667 

338 lys1 lys 5HL High lysine 1 26:286 1784 

339 lys3 sex3 5HL High lysine 3 26:287 1785 

340 raw2 r2 5HL Smooth awn 2 26:289 27 

341 abo12 alb,,o 5HS Albino seedling 12 26:290 583 

342 glo-f glo-e 5HL Globosum-f 26:291 

343 Lfb1 Lfb 5HL Leafy bract 1 28: 30 1577 

344 var2 va2 5HL Variegated 2 32:104 2496 

345 rym3 ym3 5HS Reaction to barley yellow mosaic virus 3 32:105 

346 yst5 yst5 5HL Yellow streak 5 32:107 2501 

347 mnd4 m4 5HL Many noded dwarf 4 32:108 1798 

348 Eam5 Ea5 5HL Early maturity 5 37:260 

349 brh4 brh.j 2HL Brachytic 4 37:262 1675 

350 brh6 brh.s 5HS Brachytic 6 37:263 1683 

351 gsh1 gs1, cer-q 2HS Glossy sheath 1 26:292 735 

352 gsh2 gs2, cer-b 3HL Glossy sheath 2 26:294 736 

353 gsh3 gs3, cer-a 7HS Glossy sheath 3 26:296 737 

354 gsh4 gs4, cer-x 6HL Glossy sheath 4 26:298 738 

355 gsh5 gs5, cer-s 2HL Glossy sheath 5 26:300 739 

356 gsh6 gs6, cer-c 2HS Glossy sheath 6 26:302 740 

357 msg1 ms1 1HL Male sterile genetic 1 26:304 1810 


359 msg3 ms3 2HS Male sterile genetic 3 26:307 1130 

360 msg4 ms4 1H Male sterile genetic 4 26:308 2392 







367 msg11 ms11 Male sterile genetic 11 26:315 1812 




141











377 seg1 se1 7HL Shrunken endosperm genetic 1 37:264 750 

378 seg2 se2 7HS Shrunken endosperm genetic 2 26:326 751 

379 seg3 se3 3H Shrunken endosperm genetic 3 37:265 752 


381 seg5 se5 7HS Shrunken endosperm genetic 5 26:329 754 

382 sex1 lys5 6HL Shrunken endosperm xenia 1 26:330 755 




386 des3 des3 Desynapsis 3 26:334 594 









395 msg26 msg,,u 7HS Male sterile genetic 26 26:343 745 


397 seg7 se7 Shrunken endosperm genetic 7 37:269 2468 

399 cer-d cer-d Eceriferum-d 26:346 425 

400 cer-e cer-e 1HL Eceriferum-e 26:347 1518 

401 cer-f cer-f 7HS Eceriferum-f 26:348 427 

402 cer-g cer-g 2HL Eceriferum-g 26:349 428 

403 cer-h cer-h Eceriferum-h 26:351 429 

404 cer-i cer-i 5HL Eceriferum-i 26:352 430 

405 cer-k cer-k 7HS Eceriferum-k 26:354 432 

406 cer-l cer-l Eceriferum-l 26:355 433 

407 cer-m cer-m Eceriferum-m 26:356 434 

408 cer-n gs9 2HL Eceriferum-n 26:357 435 

409 cer-o cer-o Eceriferum-o 26:359 436 

410 cer-p cer-p Eceriferum-p 26:360 437 

411 cer-r cer-r 3HL Eceriferum-r 26:361 439 

142





412 cer-t cer-t 5HL Eceriferum-t 26:362 441 

413 gsh8 cer-u, gs8 2HS Glossy sheath 8 26:364 442 

414 cer-v cer-v 2HS Eceriferum-v 26:366 443 

415 cer-w cer-w 5HL Eceriferum-w 26:367 1519 

417 cer-y cer-y Eceriferum-y 26:368 446 

418 cer-z cer-z 7HS Eceriferum-z 26:369 447 

419 cer-za cer-za 5HL Eceriferum-za 26:370 1521 

420 cer-zb cer-zb Eceriferum-zb 26:371 1522 

421 cer-zc cer-zc Eceriferum-zc 26:372 450 

422 cer-zd cer-zd 3HL Eceriferum-zd 26:373 451 

423 cer-ze gl5 7HS Eceriferum-ze 26:374 452 

424 cer-zf cer-zf Eceriferum-zf 26:376 453 

425 cer-zg cer-zg 4HL Eceriferum-zg 26:377 454 

427 cer-zi cer-zi 1HL Eceriferum-zi 26:378 456 

428 cer-zj cer-zj 5HL Eceriferum-zj 26:379 457 

429 cer-zk cer-zk 2H Eceriferum-zk 26:381 458 

430 cer-zl cer-zl Eceriferum-zl 26:382 459 

431 cer-zn cer-zn 3HL Eceriferum-zn 26:383 1523 

432 cer-zo cer-zo Eceriferum-zo 26:384 462 

433 cer-zp cer-zp 5HL Eceriferum-zp 26:385 463 

434 cer-zq cer-zq Eceriferum-zq 26:386 1524 

435 cer-zr cer-zr Eceriferum-zr 26:387 1525 

436 cer-zs cer-zs Eceriferum-zs 26:388 1526 

437 cer-zt cer-zt 2HS Eceriferum-zt 37:270 1527 

438 cer-zu cer-zu Eceriferum-zu 26:390 1528 

439 cer-zv cer-zv Eceriferum-zv 26:391 1529 

440 cer-zw cer-zw Eceriferum-zw 26:392 1530 

441 cer-zx cer-zx Eceriferum-zx 26:393 1531 

442 cer-zy cer-zy Eceriferum-zy 26:394 1532 

443 cer-zz cer-zz Eceriferum-zz 26:395 1533 

444 cer-ya cer-ya 3HS Eceriferum-ya 26:396 1534 

445 cer-yb cer-yb 2HL Eceriferum-yb 26:397 1535 

446 cer-yc cer-yc Eceriferum-yc 26:398 1536 

447 cer-yd cer-yd 3HS Eceriferum-yd 26:399 1537 

448 cer-ye cer-ye 5HL Eceriferum-ye 26:400 1538 

449 cer-yf cer-yf Eceriferum-yf 37:271 1539 

450 cer-yg cer-yg 7HS Eceriferum-yg 26:402 1540 

451 cer-yh cer-yh 3HS Eceriferum-yh 26:403 1541 

454 blx5 bl5 7HL Non-blue aleurone xenia 5 26:404 2509 

455 seg8 seg8 7H Shrunken endosperm genetic 8 37:272 2469 

143





460 cur4 cu4, glo-d 2HL Curly 4 26:406 1708 

461 zeb2 zb2, f10 4HL Zebra stripe 2 26:407 93 

462 yst3 yst,,c 3HS Yellow streak 3 26:409 48 

463 gig1 gig, sf 2H? Gigas 1 26:410 1650 

464 msg27 msg,,ae 2HL Male sterile genetic 27 26:411 2379 

465 msg28 msg,,as 6H Male sterile genetic 28 26:412 2380 

466 msg29 msg,,a 5HL Male sterile genetic 29 26:413 2381 

467 msg30 msg,,c 7HL Male sterile genetic 30 26:414 2382 

468 msg31 msg,,d 1HS Male sterile genetic 31 26:415 2383 

469 msg32 msg,,w 7H Male sterile genetic 32 26:416 2384 

470 msg33 msg,,x 2HS Male sterile genetic 33 26:417 2385 

471 msg34 msg,,av 6H Male sterile genetic 34 26:418 2386 

472 abr1 abr 2HL Accordion basal rachis internode 1 26:419 1563 

473 com1 bir1 5HL Compositum 1 26:420 1702 

474 lax-a lax-a 5HL Laxatum-a 37:273 1775 

475 lax-c lax-c 6HL Laxatum-c 26:423 1777 

498 msg35 msg,,dr 2HL Male sterile genetic 35 26:424 2387 

499 msg36 msg,,bk 6HS Male sterile genetic 36 26:425 2388 

500 msg37 msg,,hl Male sterile genetic 37 26:426 2389 

501 msg38 msg,,jl Male sterile genetic 38 26:427 2390 

502 msg39 msg,,dm 6H Male sterile genetic 39 26:428 2391 

503 msg40 msg,,ac 6H Male sterile genetic 40 26:429 2393 

504 msg41 msg,,aj Male sterile genetic 41 26:430 2394 

505 msg42 msg,,db 3H Male sterile genetic 42 26:431 2395 

506 msg43 msg,,br Male sterile genetic 43 26:432 2396 

507 msg44 msg,,cx Male sterile genetic 44 26:433 2397 

508 msg45 msg,,dp Male sterile genetic 45 26:434 2398 

509 msg46 msg,,ec Male sterile genetic 46 26:435 2399 

510 msg47 msg,,ep Male sterile genetic 47 26:436 2400 

511 Rpg1 T 7HS Reaction to Puccinia graminis 1 26:437 701 

512 Rpg2 T2 Reaction to Puccinia graminis 2 26:439 187 

513 xnt2 xb Xantha seedling 2 26:440 2 

515 Rsp1 Sep Reaction to Septoria passerinii 1 26:441 2510 

516 Rsp2 Sep2 Reaction to Septoria passerinii 2 37:275 2511 

517 Rsp3 Sep3 Reaction to Septoria passerinii 3 37:276 2512 

518 sdw1 denso 3HL Semidwarf 1 37:277 2513 

519 mnd1 m Many-noded dwarf 1 26:446 253 

520 msg48 msg,,jt 2H Male sterile genetic 48 26:447 2401 

521 mtt1 mt 1HS Mottled leaf 1 26:448 622 

522 cer-yi cer-yi Eceriferum-yi 26:449 1542 

144





523 cer-yj cer-yj Eceriferum-yj 26:450 1543 

524 cer-yk cer-yk Eceriferum-yk 26:451 1544 

525 cer-yl cer-yl Eceriferum-yl 26:452 1545 

526 cer-ym cer-ym Eceriferum-ym 26:453 1546 

527 cer-yn cer-yn Eceriferum-yn 26:454 1547 

528 cer-yo cer-yo Eceriferum-yo 26:455 1548 

529 cer-yp cer-yp Eceriferum-yp 26:456 1549 

530 cer-yq cer-yq Eceriferum-yq 26:457 1550 

531 cer-yr cer-yr Eceriferum-yr 26:458 1551 

532 cer-ys cer-ys Eceriferum-ys 26:459 1552 

533 cer-yt cer-yt Eceriferum-yt 26:460 1553 

534 cer-yu cer-yu Eceriferum-yu 26:461 1554 

535 cer-yx cer-yx Eceriferum-yx 26:462 1555 

536 Cer-yy Gle1 1HS Eceriferum-yy 26:463 1556 

537 cer-yz cer-yz Eceriferum-yz 26:464 1557 

538 cer-xa cer-xa Eceriferum-xa 26:465 1558 

539 cer-xb cer-xb Eceriferum-xb 26:466 1559 

540 cer-xc cer-xc Eceriferum-xc 26:467 1560 

541 cer-xd cer-xd Eceriferum-xd 26:468 1561 

542 Dwf2 Dwf2 Dominant dwarf 2 24:170 

543 int-f int-f Intermedium spike-f 26:469 1767 

544 int-h int-h Intermedium spike-h 26:470 1768 

545 int-i int-i Intermedium spike-i 26:471 1769 

546 int-k int-k 7H Intermedium spike-k 37:279 1770 

547 int-m int-m Intermedium spike-m 37:280 1772 

548 Fol-b Ang Angustifolium-b 26:474 17 

549 Lga1 Log Long glume awn 1 26:475 835 

550 ari-b ari-b Breviaristatum-b 26:476 1649 

551 ari-f ari-f Breviaristatum-f 26:477 1654 

552 ari-j ari-j Breviaristatum-j 26:478 1658 

553 ari-k ari-k Breviaristatum-k 26:479 1659 

554 ari-m ari-m Breviaristatum-m 26:480 1661 

555 ari-n ari-n Breviaristatum-n 26:481 1662 

556 ari-o ari-o Breviaristatum-o 26:482 

557 ari-p ari-p Breviaristatum-p 26:483 1664 

558 ari-q ari-q Breviaristatum-q 26:484 1665 

559 ari-r ari-r Breviaristatum-r 26:485 1666 

560 ert-f ert-f Erectoides-f 26:486 478 

561 ert-h ert-h Erectoides-h 26:487 481 

562 ert-k ert-k Erectoides-k 26:488 485 

145





563 ert-l ert-l Erectoides-l 26:489 486 

564 ert-p ert-p Erectoides-p 26:490 490 

565 ert-s ert-s Erectoides-s 26:491 493 

566 ert-t ert-t, brh3 2HS Erectoides-t 37:281 494 

567 ert-v ert-v Erectoides-v 26:493 497 

568 ert-x ert-x Erectoides-x 26:494 498 

569 ert-y ert-y Erectoides-y 26:495 499 

570 ert-z ert-z Erectoides-z 26:496 500 

571 ert-za ert-za Erectoides-za 26:497 501 

572 ert-zb ert-zb Erectoides-zb 26:498 502 

573 ert-zc ert-zc Erectoides-zc 26:499 503 

574 ert-ze ert-ze Erectoides-ze 26:500 505 

575 Rph6 Pa6 Reaction to Puccinia hordei 6 26:501 1598 

576 Rph8 Pa8 Reaction to Puccinia hordei 8 26:502 1600 

577 Rsg2 Rsg2 Reaction to Schizaphis graminum 2 37:283 2513 

578 mat-b mat-b Praematurum-b 26:504 1788 

579 mat-c mat-c Praematurum-c 26:506 1789 

580 mat-d mat-d Praematurum-d 26:507 1790 

581 mat-e mat-e Praematurum-e 26:508 1791 

582 mat-f mat-f Praematurum-f 26:509 1792 

583 mat-g mat-g Praematurum-g 26:510 1793 

584 mat-h mat-h Praematurum-h 26:511 1794 

585 mat-i mat-i Praematurum-i 26:512 1795 

586 bra-d bra-d 1HL Bracteatum-d 37:284 1696 

587 abo3 a2, alb-za Albino seedling 3 26:514 165 

588 abo10 at2 Albino seedling 10 26:515 57 

589 abo11 at3, alb t Albino seedling 11 26:516 233 

590 Rph13 Rph13 Reaction to Puccinia hordei 13 28: 31 1591 

591 Rph14 Rph14 Reaction to Puccinia hordei 14 28: 32 1592 

592 yhd2 yh2 Yellow head 2 28: 33 757 

593 adp1 adp Awned palea 1 37:285 1618 

594 ant3 rub Anthocyanin-deficient 3 29: 82 1641 

595 ant4 ant4 Anthocyanin-deficient 4 29: 83 1642 

596 ant5 rs2 Anthocyanin-deficient 5 29: 84 1643 

597 ant6 ant6 Anthocyanin-deficient 6 29: 85 1644 

598 ant13 ant13 6HL Proanthocyanin-free 13 29: 86 1624 

599 ant17 ant17 3HS Proanthocyanin-free 17 37:286 


601 ant19 ant19 Proanthocyanin-free 19 29: 92 1631 

602 ant20 ant20 Anthocyanin-rich 20 29: 93 1633 

146





603 ant21 ant21 6H Proanthocyanin-free 21 29: 94 1634 





608 ant28 ant28 3HL Proanthocyanin-free 28 29: 99 

609 ant29 ant29 Proanthocyanin-free 29 29:100 

610 ant30 ant30 Proanthocyanin-free 30 29:101 

611 Nec6 Sp Necrotic leaf spot 6 32:112 2424 

612 gig2 gig2 Gigas 2 32:113 1750 

613 brc1 brc-5 2HS Branched 1 32:114 

614 Zeo2 Zeo2 Zeocriton 2 32:115 637 

615 wxs1 wxs1 Waxy spike 1 32:116 

616 cul3 cul3 Uniculme 3 32:117 2494 

617 cul4 uc-5 3HL Uniculme 4 37:289 2493 

618 mnd3 mn3, m3 3H Many noded dwarf 3 32:119 1797 

619 bra-a bra-a 7HS Bracteatum-a 32:120 1693 

620 cal-b cal-b 5H Calcaroides-b 32:121 1697 

621 Cal-c Cal-c 5HL Calcaroides-c 32:122 1567 

622 cal-e cal-23 5HS Calcaroides-e 32:123 

623 eli-a lig-a Eligulum-a 37:290 

624 ops1 op-3 Opposite spikelets 1 32:125 2427 

625 sci-a sci-3 Scirpoides 1 32:126 

626 scl-a scl-6 Scirpoides leaf-a 32:127 

627 viv-a viv-5 Viviparoides-a 32:128 2498 

628 sex7 sex.i 5HL Shrunken endosperm 7 32:129 2470 

629 mtt6 mtt6 Mottled leaf 6 32:130 2411 

630 Ari-s ari-265 Breviaristatum-s 32:131 

631 brh3 brh.g, ert-t Brachytic 3 32:132 1672 

632 mnd5 mnd5 Many noded dwarf 5 32:133 

633 mnd6 den-6 5HL Many noded dwarf 6 37:291 1713 

634 pmr2 nec-50 Premature ripe 2 32:135 2421 

635 nec7 nec-45 Necroticans 7 32:136 2420 

636 tst2 lin2 Tip sterile 2 37:292 1781 

637 nar1 nar1 6HS NADH nitrate reductase-deficient 1 35:194 

638 nar2 nar2 5HL NADH nitrate reductase-deficient 2 35:195 





147







645 bsp1 bsp1 Bushy spike 1 35:202 

646 ovl2 ovl2 Ovaryless 2 35:204 

647 tst1 tst1 Tip sterile 1 35:205 

648 mov4 mo8 Multiovary 4 35:206 

649 asp1 asp1 Aborted spike 1 35:207 

650 sun1 sun1 Sensitivity to Ustilago nuda 1 35:208 

651 lam1 lam1 Late maturity 1 35:209 

652 ylf1 ylf1 Yellow leaf 1 35:210 

653 brh10 brh.l 2HS Brachytic 10 37:293 1677 

654 brh11 brh.n 5HS Brachytic 11 37:294 1679 

655 brh12 brh.o 5HS Brachytic 12 37:295 1680 

656 brh13 brh.p 5HS Brachytic 13 37:296 1681 

657 brh15 brh.u Brachytic 15 37:297 1685 

658 brh17 brh.ab 5HS Brachytic 17 37:298 1669 

659 brh18 brh.ac 5HS Brachytic 18 37:299 1670 

660 nld2 Narrow leafed dwarf 2 37:300 

661 dub1 5HL Double seed 1 37:301 

* Recommended locus symbols are based on utilization of a three-letter code for barley genes as 

approved at the business meeting of the Seventh International Barley Genetics Symposium at 

Saskatoon, Saskatchewan, Canada, on 05 August 5 1996. 

† Chromosome numbers and arm designations are based on a resolution passed at the business 

meeting of the Seventh International Barley Genetics Symposium at Saskatoon, Saskatchewan, 

Canada, on August 05 1996. The Burnham and Hagberg (1956) designations of barley 

chromosomes were 1 2 3 4 5 6 and 7 while new designations based on the Triticeae system are 

7H 2H 3H 4H 1H 6H and 5H, respectively. 

‡ The seed stock associated with each BGS number is held as a GSHO stock number in the 

Barley Genetics Stock Collection at the USDA-ARS National Small Grains Germplasm Research 

Facility, Aberdeen, Idaho, USA. 

148


Table 2. An alphabetic listing of recently published Barley Genetic Stock (BGS) descriptions for 

loci in barley (Hordeum vulgare), including information on chromosomal locations, 

recommended locus names, and original cultivars. 

Locus symbol* BGS Chr. Locus name or phenotype Descr. Parental cultivar 

Rec. Prev. no. loc. † vol. p. 

abo1 at 207 1HL Albino seedling 1 26:210 Trebi 

abo2 a2 53 2HS Albino seedling 2 26:89 Nilsson-Ehle No 2 

abo3 alb-za 587 Albino seedling 3 26:514 Unknown cultivar 

abo4 a4 94 2H Albino seedling 4 26:133 Unknown cultivar 

abo6 ac 106 3HS Albino seedling 6 26:140 Colsess 

abo8 ac2 4 7HS Albino seedling 8 26:47 Coast 

abo9 an 112 3HS Albino seedling 9 26:146 Nigrinudum 

abo10 at2 588 Albino seedling 10 26:515 Canadian Thorpe 

abo11 at3 589 Albino seedling 11 26:516 Trebi 

abo12 alb,,o 341 5HS Albino seedling 12 26:290 Titan 

abo13 alb,,p 95 2HL Albino seedling 13 26:134 Titan 

abo14 alb,,q 270 6HL Albino seedling 14 26:250 Shabet 

abo15 alb,,t 271 6HS Albino seedling 15 26:251 Betzes 

abr1 abr 472 2HL Accordion basal rachis 

internode 1 

26:419 Bonus 

acr1 acr 97 2HL Accordion rachis 1 32:85 Burma Girl 

adp1 adp 593 3HL Awned palea 1 37:285 Unknown cultivar 

alm1 al 108 3HS Albino lemma 1 37:222 Russia 82 

als1 als 101 3HL Absent lower laterals 1 37:219 Montcalm 

ant1 rs 33 7HS Anthocyanin-less 1 26:82 Bonus 

ant2 pr 80 2HL Anthocyanin-less 2 26:118 Foma 

ant3 594 Anthocyanin-deficient 3 29:82 Bonus 

ant4 595 Anthocyanin-deficient 4 29:83 Foma 

ant5 596 Anthocyanin-deficient 5 29:84 Bonus 

ant6 597 Anthocyanin-deficient 6 29:85 Foma 

ant13 598 6HL Proanthocyanidin-free 13 29:86 Foma 

ant17 599 3HS Proanthocyanidin-free 17 37:286 Nordal 

ant18 600 7HL Proanthocyanidin-free 18 29:90 Nordal 

ant19 601 Proanthocyanidin-free 19 29:92 Alf 

ant20 602 Anthocyanidin-rich 20 29:93 Foma 

ant21 603 6H Proanthocyanidin-free 21 29:94 Georgie 

ant22 604 7HS Proanthocyanidin-free 22 29:95 Hege 802 

ant25 605 Proanthocyanidin-free 25 29:96 Secobra 18193 

ant26 606 Proanthocyanidin-free 26 29.97 Grit 

ant27 607 Proanthocyanidin-free 27 29:98 Zebit 

ant28 608 3HL Proanthocyanidin-free 28 29:99 Grit 

ant29 609 Proanthocyanidin-free 29 29:100 Ca 708912 

ant30 610 Proanthocyanidin-free 30 

149 

29:101 Gunhild





ari-a 132 3HS Breviaristatum-a 26:168 Bonus 

ari-b 550 Breviaristatum-b 26:476 Bonus 

ari-e 328 5HL Breviaristatum-e 26:276 Bonus 

ari-f 551 Breviaristatum-f 26:477 Bonus 

ari-g 89 Breviaristatum-g 26:128 Bonus 

ari-h 329 5HL Breviaristatum-h 26:277 Foma 

ari-j 552 Breviaristatum-j 26:478 Bonus 

ari-k 553 Breviaristatum-k 26:479 Bonus 

ari-m 554 Breviaristatum-m 26:480 Bonus 

ari-n 555 Breviaristatum-n 26:481 Bonus 

ari-o 556 Breviaristatum-o 26:482 Bonus 

ari-p 557 Breviaristatum-p 26:483 Foma 

ari-q 558 Breviaristatum-q 26:484 Kristina 

ari-r 559 Breviaristatum-r 26:485 Bonus 

Ari-s ari-265 630 Breviaristatum-s 32:131 Kristina 

asp1 649 Aborted spike 1 35:207 Steptoe 

blf1 bb 326 5HL Broad leaf 1 26:274 Bonus 

blf2 bb2 337 5HL Broad leaf 2 26:285 Hannchen 

Blp1 B 203 1HL Black lemma and pericarp 1 37:245 Nigrinudum 

blx1 bl 15 4HL Non-blue aleurone xenia 1 26:60 Goldfoil 

blx2 bl2 19 7HS Non-blue aleurone xenia 2 26:65 Nepal 

blx3 bl3 173 4HL Non-blue aleurone xenia 3 26:198 Blx 

blx4 bl4 174 4HL Non-blue (pink) aleurone 26:199 Ab 6 

xenia 4 

blx5 bl5 454 7HL Non-blue aleurone xenia 5 26:404 BGM 122 

bra-a 619 7HS Bracteatum-a 32:120 Bonus 

bra-d 586 1HS Bracteatum-d 37:284 Foma 

brc1 brc-5 613 2HS Branched 1 32:114 

brh1 br 1 7HS Brachytic 1 37:188 Himalaya 

brh2 br2 157 4HL Brachytic 2 37:235 Svanhals 

brh3 brh.g, ert-t 631 Brachytic 3 32:132 Birgitta 

brh4 brh.j 349 5HS Brachytic 4 37:262 Birgitta 

brh5 brh.m 185 4HS Brachytic 5 37:242 Birgitta 

brh6 brh.s 350 5HS Brachytic 6 37:263 Akashinriki 

brh7 brh.w 41 5HS Brachytic 7 37:203 Volla 

brh8 brh.ad 142 3HS Brachytic 8 37:230 Birgitta 

brh9 brh.k 187 4HS Brachytic 9 37:244 Birgitta 

brh10 brh.l 653 2HS Brachytic 10 37:293 Birgitta 

brh11 brh.n 654 5HS Brachytic 11 37:294 Birgitta 

brh12 brh.o 655 5HS Brachytic 12 37:295 Birgitta 

150





brh13 brh.p 656 5HS Brachytic 13 37:296 Birgitta 

brh14 brh.q 148 3HL Brachytic 14 37:231 Akashinriki 

brh15 brh.u 657 Brachytic 15 37:297 Julia 

brh16 brh.v 44 7HL Brachytic 16 37:204 Korál 

brh17 brh.ab 658 5HS Brachytic 17 37:298 Morex 

brh18 Brh.ac 659 5HS Brachytic 18 37:299 Triumph 

bsp1 645 Bushy spike 1 35:203 Morex 

btr1 bt 115 3HS Non-brittle rachis 1 26:149 A 222 

btr2 bt2 116 3HS Non-brittle rachis 2 26:150 Sakigoke 

cal-b 620 5H Calcaroides-b 32:121 Bonus 

Cal-c 621 5HL Calcaroides-c 32:122 Bonus 

cal-d 146 3H Calcaroides-d 32:95 Foma 

cal-e 622 5HS Calcaroides-e 32:123 Semira 

cer-d 399 Eceriferum-d + ++ ++ 26:346 Bonus 

cer-e 400 1HL Eceriferum-e -/+ ++ ++ 26:347 Bonus 

cer-f 401 7HS Eceriferum-f + + ++ 26:348 Bonus 

cer-g 402 2HL Eceriferum-g + + ++ 26:349 Bonus 

cer-h 403 Eceriferum-h - ++ ++ 26:351 Bonus 

cer-i 404 5HL Eceriferum-i - ++ ++ 26:352 Bonus 

cer-k 405 7HS Eceriferum-k + ++ ++ 26:354 Bonus 

cer-l 406 Eceriferum-l + ++ ++ 26:355 Bonus 

cer-m 407 Eceriferum-m +/++ + ++ 26:356 Bonus 

cer-n gs9 408 2HL Eceriferum-n - - ++ & 26:357 Bonus 

- +/- ++ 

cer-o 409 Eceriferum-o -/+ ++ ++ 26:359 Bonus 

cer-p 410 Eceriferum-p ++ ++ + 26:360 Bonus 

cer-r 411 3HL Eceriferum-r +/- + ++ 26:361 Bonus 

cer-t 412 5HL Eceriferum-t +/- ++ ++ 26:362 Bonus 

cer-v 414 2HS Eceriferum-v +/- ++ ++ 26:366 Bonus 

cer-w 415 5HL Eceriferum-w +/- ++ ++ 26:367 Bonus 

cer-y 417 Eceriferum-y + +/++ ++ 26:368 Bonus 

cer-z 418 7HS Eceriferum-z - - ++ 26:369 Bonus 

cer-za 419 5HL Eceriferum-za ++ ++ - 26:370 Foma 

cer-zb 420 Eceriferum-zb - ++ ++ 26:371 Bonus 

cer-zc 421 Eceriferum-zc +/- ++ ++ 26:372 Bonus 

cer-zd 422 3HL Eceriferum-zd ++ ++ - 26:373 Bonus 

cer-ze gl5 423 7HS Eceriferum-ze ++ ++ - 26:374 Bonus 

cer-zf 424 Eceriferum-zf ++ ++ + 26:376 Bonus 

cer-zg 425 4HL Eceriferum-zg ++ ++ + 26:377 Foma 

cer-zi 427 1HL Eceriferum-zi + + ++ 26:378 Bonus 

151





cer-zj 428 5HL Eceriferum-zj ++ ++ - 26:379 Bonus 

cer-zk 429 2H Eceriferum-zk + + +/- 26:381 Bonus 

cer-zl 430 Eceriferum-zl - - ++ 26:382 Bonus 

cer-zn 431 3HL Eceriferum-zn +/- ++ ++ 26:383 Foma 

cer-zo 432 Eceriferum-zo - ++ ++ 26:384 Foma 

cer-zp 433 5HL Eceriferum-zp ++ ++ - 26:385 Bonus 

cer-zq 434 Eceriferum-zq ++ ++ - 26:386 Foma 

cer-zr 435 Eceriferum-zr +/- ++ ++ 26:387 Foma 

cer-zs 436 Eceriferum-zs + ++ ++ 26:388 Foma 

cer-zt 437 2HS Eceriferum-zt + ++ ++ 37:270 Foma 

cer-zu 438 Eceriferum-zu - + ++ 26:390 Bonus 

cer-zv 439 Eceriferum-zv - - - 26:391 Foma 

cer-zw 440 Eceriferum-zw + + ++ 26:392 Foma 

cer-zx 441 Eceriferum-zx + + ++ 26:393 Bonus 

cer-zy 442 Eceriferum-zy ++ ++ + 26:394 Bonus 

cer-zz 443 Eceriferum-zz ++ ++ - 26:395 Bonus 

cer-ya 444 3HS Eceriferum-ya ++ ++ - 26:396 Bonus 

cer-yb 445 2HL Eceriferum-yb ++ ++ - 26:397 Bonus 

cer-yc 446 Eceriferum-yc - ++ ++ 26:398 Bonus 

cer-yd 447 3HS Eceriferum-yd - ++ ++ 26:399 Bonus 

cer-ye 448 5HL Eceriferum-ye ++ ++ - 26:400 Foma 

cer-yf 449 Eceriferum-yf ++ ++ + 37:271 Bonus 

cer-yg 450 7HS Eceriferum-yg - - - 26:402 Carlsberg II 

cer-yh 451 3HS Eceriferum-yh - ++ ++ 26:403 Bonus 

cer-yi 522 Eceriferum-yi ++ ++ - 26:449 Foma 

cer-yj 523 Eceriferum-yj ++ ++ - 26:450 Bonus 

cer-yk 524 Eceriferum-yk + + ++ 26:451 Bonus 

cer-yl 525 Eceriferum-yl - - ++ 26:452 Bonus 

cer-ym 526 Eceriferum-ym - - - 26:453 Bonus 

cer-yn 527 Eceriferum-yn + + ++ 26:454 Kristina 

cer-yo 528 Eceriferum-yo ++ ++ + 26:455 Bonus 

cer-yp 529 Eceriferum-yp ++ ++ + 26:456 Bonus 

cer-yq 530 Eceriferum-yq ++ ++ - 26:457 Kristina 

cer-yr 531 Eceriferum-yr -/+ + ++ 26:458 Foma 

cer-ys 532 Eceriferum-ys ++ ++ - 26:459 Bonus 

cer-yt 533 Eceriferum-yt - ++ ++ 26:460 Bonus 

cer-yu 534 Eceriferum-yu ++ ++ - 26:461 Bonus 

cer-yx 535 Eceriferum-yx + + ++ 26:462 Foma 

Cer-yy Gle1 536 1HS Eceriferum-yy - ++ ++ 26:463 Bonus 

cer-yz 537 Eceriferum-yz + + ++ 26:464 Bonus 

152





cer-xa 538 Eceriferum-xa ++ ++ - 26:465 Foma 

cer-xb 539 Eceriferum-xb - ++ ++ 26:466 Bonus 

cer-xc 540 Eceriferum-xc + + ++ 26:467 Bonus 

cer-xd 541 Eceriferum-xd + + ++ 26:468 Bonus 

clh1 clh 225 1HL Curled leaf dwarf 1 26:223 Hannchen 

com1 bir1 473 5HL Compositum 1 26:420 Foma 

com2 bir2 71 2HS Compositum 2 26:108 CIMMYT freak 

crl1 cl 325 Curly lateral 1 26:273 Montcalm 

crm1 cm 305 5HL Cream seedling 1 26:256 Black Hulless 

cud1 cud 324 5HL Curly dwarf 1 26:272 Akashinriki 

cud2 229 1HL Curly dwarf 2 26:227 Akashinriki 

cul2 uc2 253 6HL Uniculm 2 37:253 Kindred 

cul3 616 Uniculme 3 32:117 Donaria 

cul4 uc-5 617 3HL Uniculme 4 37:289 Bonus 

cur1 cu1 262 6HL Curly 1 26:242 48-cr cr-17 

cur2 cu2 114 3HL Curly 2 26:148 Choshiro 

cur3 cu3 263 6HL Curly 3 26:243 Akashinriki 

cur4 cu4 460 2HL Curly 4 26:406 Asahi 5 

cur5 cu5 231 1HS Curly 5 26:229 Glenn 

ddt1 ddt 317 5HS Reaction to DDT 1 26:266 Spartan 

des1 lc 12 7H Desynapsis 1 26:57 Mars 

des2 ds 119 3H Desynapsis 2 26:154 Husky 

des3 386 Desynapsis 3 26:334 Betzes 

des4 13 7H Desynapsis 4 26:58 Betzes 











des15 394 Desynapsis 15 26:342 Ingrid 

dex1 sex2 311 5HS Defective endosperm xenia 1 26:260 BTT 63-j-18-17 

dsk1 dsk 322 5HL Dusky 1 26:270 Chikurin-Ibaraki 1 

dsp1 l 9 7HS Dense spike 1 26:53 Honen 6 

dsp9 l9, ert-e 258 6HL Dense spike 9 26:239 Akashinriki 

153





dsp10 lc 111 3HS Dense spike 10 26:145 Club Mariout 

dub1 661 6HL Double seed 1 37:301 Bonus 

Dwf2 542 Dominant dwarf 2 24:170 Klages/Mata 

Eam1 Ea 65 2HS Early maturity 1 26:101 Estate 

Eam5 Ea5 348 5HL Early maturity 5 37:260 Higuerilla*2/ 

Gobernadora 

eam6 Ea6, Ea 98 2HS Early maturity 6 37:216 Morex 

eam7 ea7 252 6HS Early maturity 7 26:233 California Mariout 

eam8 eak, ert-o 214 1HL Early maturity 8 37:247 Kinai 5 

eam9 ea,,c 181 4HL Early maturity 9 26:204 Tayeh 8 

eam10 easp 130 3HL Early maturity 10 37:226 Super Precoz 

eli-a lig-a 623 Eligulum-a 37:290 Foma 

eog 1 e 57 2HL Elongated outer glume 1 26:92 Triple Bearded Club 

Mariout 

ert-a ert-6 28 7HS Erectoides-a 26:74 Gull 

ert-b ert-2 224 1HS Erectoides-b 26:222 Gull 

ert-c ert-1 134 3HL Erectoides-c 26:170 Gull 

ert-d ert-7 29 7HS Erectoides-d 26:76 Gull 

ert-e dsp9 266 6HL Erectoides-e 37:257 Bonus 

ert-f ert-18 560 Erectoides-f 26:486 Bonus 

ert-g ert-24 330 5HL Erectoides-g 26:278 Bonus 

ert-h ert-25 561 Erectoides-h 26:487 Bonus 

ert-ii ert-79 135 3HL Erectoides-ii 26:172 Bonus 

ert-j ert.31 90 2H Erectoides-j 26:129 Bonus 

ert-k ert-32 562 Erectoides-k 26:488 Bonus 

ert-l ert-12 563 Erectoides-l 26:489 Maja 

ert-m ert-34 30 7HS Erectoides-m 26:78 Bonus 

ert-n ert-51 331 5HL Erectoides-n 26:279 Bonus 

ert-p ert-44 564 Erectoides-p 26:490 Bonus 

ert-q ert-101 91 2H Erectoides-q 26:130 Bonus 

Ert-r Ert-52 332 Erectoides-r 26:280 Bonus 

ert-s ert-50 565 Erectoides-s 26:491 Bonus 

ert-t brh3 566 2HS Erectoides-t 37:281 Bonus 

ert-u ert-56 92 2H Erectoides-u 26:131 Bonus 

ert-v ert-57 567 Erectoides-v 26:493 Bonus 

ert-x ert-58 568 Erectoides-x 26:494 Bonus 

ert-y ert-69 569 Erectoides-y 26:495 Bonus 

ert-z ert-71 570 Erectoides-z 26:496 Bonus 

ert-za ert-102 571 Erectoides-za 26:497 Bonus 

ert-zb ert-132 572 Erectoides-zb 26:498 Bonus 

154





ert-zc ert-149 573 Erectoides-zc 26:499 Bonus 

ert-zd ert-159 93 2H Erectoides-zd 26:132 Bonus 

ert-ze ert-105 574 Erectoides-ze 26:500 Bonus 

fch1 f 55 2HS Chlorina seedling 1 26:90 Minn 84-7 

fch2 f2 117 3HL Chlorina seedling 2 26:151 28-3398 

fch3 f3 220 1HS Chlorina seedling 3 26:218 Minn 89-4 

fch4 f4 17 7HL Chlorina seedling 4 26:63 Montcalm 

fch5 f5 18 7HS Chlorina seedling 5 26:64 Gateway 

fch6 f6 313 5HL Chlorina seedling 6 26:262 Himalaya 

fch7 f7 201 1HL Chlorina seedling 7 26:206 Smyrna 

fch8 f8 5 7HS Chlorina seedling 8 26:48 Comfort 

fch9 f9 151 4HS Chlorina seedling 9 26:178 Ko A 

fch11 f11 260 6HL Chlorina seedling 11 26:240 Himalaya 

fch12 fc 2 7HS Chlorina seedling 12 37:190 Colsess 

fch13 f13 86 Chlorina seedling 13 26:124 Niggrinudum 

fch14 f14 87 2HL Chlorina seedling 14 37:211 Shyri 

fch15 or 52 2HS Chlorina seedling 15 26:88 Trebi IV 

flo-a 182 Extra floret-a 26:205 Foma 

flo-b 327 5HL Extra floret-b 26:275 Foma 

flo-c 74 2HS Extra floret-c 26:111 Foma 

fol-a 73 2HL Angustifolium-a 26:110 Proctor 

Fol-b Ang 548 Angustifolium-b 26:474 Unknown 

fst1 fs 301 5HL Fragile stem 1 26:252 Kamairazu 

fst2 fs2 208 1HL Fragile stem 2 26:211 Oshichi 

fst3 fs3 24 7HS Fragile stem 3 26:70 Kobinkatagi 4 

gig1 gig 463 2H? Gigas 1 26:410 Tochigi Golden 

Melon 

gig2 612 Gigas 2 32:113 ND12463 

glf1 gl 155 4HL Glossy leaf 1 ++ ++ - 37:233 Himalaya 

glf3 gl3 165 4HL Glossy leaf 3 ++ ++ - 26:190 Goseshikoku 

glo-a 168 4HS Globosum-a 26:194 Proctor 

glo-b 336 5HL Globosum-b 26:284 Villa 

glo-c 72 2H Globosum-c 26:109 Villa 

glo-e 230 1HL Globosum-e 26:228 Foma 

glo-f 342 5HL Globosum-f 26:291 Damazy 

gpa1 gp 59 2HL Grandpa 1 26:95 Lyallpur 

gra-a gran-a 131 3HL Granum-a 26:167 Donaria 

gsh1 gs1 351 2HS Glossy sheath 1 - - ++ 26:292 CIho 5818 

gsh2 gs2 352 3HL Glossy sheath 2 - - ++ 26:294 Atlas 

gsh3 gs3 353 7HS Glossy sheath 3 - - ++ 26:296 Mars 

155





gsh4 gs4 354 6HL Glossy sheath 4 - - ++ 26:298 Gateway 

gsh5 gs5 355 2HL Glossy sheath 5 + - ++ 26:300 Jotun 

gsh6 gs6 356 2HS Glossy sheath 6 - - ++ 26:302 Betzes 

gsh7 gs7 81 Glossy sheath 7 - - ++ 26:119 Akashinriki 

gsh8 cer-u 413 2HS Glossy sheath 8 + + ++ 26:364 Bonus 

Gth1 G 69 2HL Toothed lemma 1 26:106 Machine (Wexelsen) 

hcm1 h 77 2HL Short culm 1 26:115 Morex 

Hln1 Hn 164 4HL Hairs on lemma nerves 1 26:189 Kogane-mugi 

Hsh1 Hs 179 4HL Hairy leaf sheath 1 37:240 Kimugi 

int-b 320 5HL Intermedium spike-b 26:268 Bonus 

int-c i 178 4HS Intermedium spike-c 37:237 Gamma 4 

int-f 543 Intermedium spike-f 26:469 Foma 

int-h 544 Intermedium spike-h 26:470 Kristina 

int-i 545 Intermedium spike-i 26:471 Kristina 

int-k 546 7H Intermedium spike-k 37:279 Kristina 

int-m 547 Intermedium spike-m 37:280 Bonus 

Kap1 K 152 4HS Hooded lemma 1 26:179 Colsess 

lam1 651 Late maturity 1 35:209 Steptoe 

lax-a 474 5HL Laxatum-a 37:273 Bonus 

lax-b 268 6HL Laxatum-b 26:248 Bonus 

lax-c 475 6HL Laxatum-c 26:423 Bonus 

lbi1 lb 308 5HL Long basal rachis internode 1 26:258 Wisconsin 38 

lbi2 lb2 156 4HL Long basal rachis internode 2 26:183 Montcalm 

lbi3 lb3 27 7HL Long basal rachis internode 3 26:73 Montcalm 

lel1 lel 235 1HL Leafy lemma 1 32:103 G7118 

Lfb1 Lfb 343 5HL Leafy bract 1 28:30 Montcalm 

Lga1 Log 549 Long glume awn 1 26:475 Guy Mayle 

lgn3 lg3 170 4HL Light green 3 26:195 No 154 

lgn4 lg4 171 4HL Light green 4 26:196 Himalaya / 

Ingrescens 

lig1 li 60 2HL Liguleless 1 37:205 Muyoji 

lin1 s, rin 99 2HL Lesser internode number 1 32:88 Natural occurence 

Lks1 Lk 75 2HL Awnless 1 26:112 Hordeum inerme 

lks2 lk2 10 7HL Short awn 2 37:197 Honen 6 

lks5 lk5 172 4HL Short awn 5 26:197 CIho 5641 

lnt1 lnt 118 3HL Low number of tillers 1 26:153 Mitake 

156





lys1 lys 338 5HL High lysine 1 26:286 Hiproly 

lys3 sex3 339 5HL High lysine 3 26:287 Bomi 

Lys4 sex5 232 1HS High lysine 4 26:230 Bomi 

lys6 269 6H High lysine 6 26:249 Bomi 

lzd1 lzd 125 3HS Lazy dwarf 1 26:161 Akashinriki 

mat-b 578 Praematurum-b 26:504 Bonus 

mat-c 579 Praematurum-c 26:506 Bonus 

mat-d 580 Praematurum-d 26:507 Bonus 

mat-e 581 Praematurum-e 26:508 Bonus 

mat-f 582 Praematurum-f 26:509 Bonus 

mat-g 583 Praematurum-g 26:510 Bonus 

mat-h 584 Praematurum-h 26:511 Bonus 

mat-i 585 Praematurum-i 26:512 Bonus 

min1 min 161 4HL Semi-minute dwarf 1 26:187 Taisho-mugi 

min2 en-min 160 Enhancer of minute 1 26:186 Kaiyo Bozu 

mnd1 m 519 Many-noded dwarf 1 26:446 Mesa 

mnd3 m3 618 3H Many noded dwarf 3 32:119 Montcalm 

mnd4 m4 347 5HL Many noded dwarf 4 32:108 Akashinriki 

mnd5 632 Many noded dwarf 5 32:133 C2-95-199 

mnd6 den-6 633 5HL Many noded dwarf 6 37:291 Bonus 

mov1 mo6b 43 7HL Multiovary 1 35:185 Steptoe 

mov2 mo7a 147 3HS Multiovary 2 35:190 Steptoe 

mov3 mo-a 234 1H Multiovary 3 32:102 Akashinriki 

mov4 648 Multiovary 4 35:206 Steptoe 

msg1 357 1HL Male sterile genetic 1 26:304 CIho 5368 

msg2 358 2HL Male sterile genetic 2 26:306 Manchuria 

msg3 359 2HS Male sterile genetic 3 26:307 Gateway 

msg4 360 1H Male sterile genetic 4 26:308 Freja 

msg5 361 3HS Male sterile genetic 5 26:309 Carlsberg II 

msg6 362 6HS Male sterile genetic 6 26:310 Hanna 

msg7 363 5HL Male sterile genetic 7 26:311 Dekap 

msg8 364 5HL Male sterile genetic 8 26:312 Betzes 

msg9 365 2HS Male sterile genetic 9 26:313 Vantage 

msg10 366 7HS Male sterile genetic 10 26:314 Compana 

msg11 367 Male sterile genetic 11 26:315 Gateway 

msg13 368 Male sterile genetic 13 26:316 Haisa II 

msg14 369 7HS Male sterile genetic 14 26:317 Unitan 

msg15 370 Male sterile genetic 15 26:318 Atlas/2*Kindred 

msg16 371 5HS Male sterile genetic 16 26:319 Betzes 

msg17 372 Male sterile genetic 17 26:320 Compana 

157





msg18 373 5HL Male sterile genetic 18 26:321 Compana 

msg19 374 5HS Male sterile genetic 19 26:322 CIho 14393 

msg20 375 1H Male sterile genetic 20 26:323 Hannchen 

msg21 376 Male sterile genetic 21 26:324 Midwest Bulk 

msg22 383 7H Male sterile genetic 22 26:331 Glacier/Compana 




msg26 395 7HS Male sterile genetic 26 26:343 Unitan 

msg27 464 2HL Male sterile genetic 27 26:411 Firlbecks III 

msg28 465 6H Male sterile genetic 28 26:412 York 

msg29 466 5HL Male sterile genetic 29 26:413 Ackermans MGZ 

msg30 467 7HL Male sterile genetic 30 26:414 Compana 

msg31 468 1HS Male sterile genetic 31 26:415 51Ab4834 

msg32 469 7H Male sterile genetic 32 26:416 Betzes 


msg34 471 6H Male sterile genetic 34 26:418 Paragon 

msg35 498 2HL Male sterile genetic 35 26:424 Karl 


msg37 500 Male sterile genetic 37 26:426 Clermont 

msg38 501 Male sterile genetic 38 26:427 Ingrid 

msg39 502 6H Male sterile genetic 39 26:428 CIho 15836 

msg40 503 6H Male sterile genetic 40 26:429 Conquest 

msg41 504 Male sterile genetic 41 26:430 Betzes 

msg42 505 3H Male sterile genetic 42 26:431 Betzes 

msg43 506 Male sterile genetic 43 26:432 Betzes 

msg44 507 Male sterile genetic 44 26:433 HA6-33-02 

msg45 508 Male sterile genetic 45 26:434 RPB439-71 

msg46 509 Male sterile genetic 46 26:435 Hector 

msg47 510 Male sterile genetic 47 26:436 Sel 12384CO 

msg48 520 2H Male sterile genetic 48 26:447 Simba 

msg49 335 5HL Male sterile genetic 49 26:283 ND7369 

msg50 34 7HL Male sterile genetic 50 26:83 Berac 

mss1 mss 84 2H Midseason stripe 1 26:122 Montcalm 

mss2 39 7HS Midseason stripe 2 32:79 ND11258 

mtt1 mt 521 1HS Mottled leaf 1 26:448 Montcalm 

mtt2 mt2 302 5HL Mottled leaf 2 26:253 Montcalm 

mtt4 mt,,e 78 2HL Mottled leaf 4 26:116 Victorie 

mtt5 mt,,f 264 6HL Mottled leaf 5 26:244 Akashinriki 

mtt6 629 Mottled leaf 6 32:130 ND6809 

158





mul2 251 6HL Multiflorus 2 26:232 Montcalm 

nar1 637 6HS NADH ntrate reductasedeficient 

1 

35:194 Steptoe 

nar2 638 5HL NADH ntrate reductasedeficient 

2 



3 

35:197 Winer 


4 



5 



6 



7 



8 


nec1 222 1HL Necrotic leaf spot 1 37:251 Carlsberg II 

nec2 261 6HS Necrotic leaf spot 2 26:241 Carlsberg II 

nec3 265 6HS Necrotic leaf spot 3 26:245 Proctor 

nec4 138 3H Necrotic leaf spot 4 26:175 Proctor 

nec5 139 3H Necrotic leaf spot 5 26:176 Diamant 

Nec6 Sp 611 Necrotic leaf spot 6 32:112 Awnless Atlas 

nec7 nec-45 635 Necroticans 7 32:136 Kristina 

nld1 nld 323 5HL Narrow leafed dwarf 1 26:271 Nagaoka 

nld2 660 Narrow leafed dwarf 2 37:300 Steptoe 

nud1 n, nud 7 7HL Naked caryopsis 1 37:195 Himalaya 

ops1 op-3 624 Opposite spikelets 1 32:125 Bonus 

ovl1 176 4H Ovaryless 1 35:191 Kanto Bansei Gold 

ovl2 646 Ovaryless 2 35:204 Harrington 

pmr1 pmr 40 7HS Premature ripe 1 32:80 Glenn 

pmr2 nec-50 634 Premature ripe 2 32:135 Bonus 

Pre2 Re2 76 2HL Red lemma and pericarp 2 26:113 Buckley 3277 

Pub1 Pub 127 3HL Pubescent leaf blade 1 26:163 Multiple Dominant 

Pvc1 Pc 68 2HL Purple veined lemma 1 26:105 Buckley 2223-6 

Pyr1 42 7HS Pyramidatum 1 32:82 Pokko/Hja80001 

raw1 r 312 5HL Smooth awn 1 26:261 Lion 

raw2 r2 340 5HL Smooth awn 2 26:289 Lion 

raw5 r,,e 257 6HL Smooth awn 5 26:238 Akashinriki 

raw6 r6 334 5HL Smooth awn 6 26:282 Glenn 

159





rob1 o 254 6HS Orange lemma 1 37:255 CIho 5649 

Rpc1 149 3H Reaction to Puccinia 

coronata var. hordei 1 

37:232 Hor 2596 

Rpg1 T 511 7HS Reaction to Puccinia 

graminis 1 

26:437 Chevron 

Rpg2 T2 512 Reaction to Puccinia 

graminis 2 

26:439 Hietpas 5 

rpg4 319 5HL Reaction to Puccinia 

graminis 4 

26:267 Q21861 

Rph1 Pa 70 2H Reaction to Puccinia hordei 

1 

26:107 Oderbrucker 

Rph2 Pa2 88 5HS Reaction to Puccinia hordei 

2 

37:212 Peruvian 

Rph3 Pa3 121 7HL Reaction to Puccinia hordei 

3 

26:156 Estate 


4 

26:217 Gull 


5 

37:224 Magnif 102 


6 

26:501 Bolivia 


7 

37:228 Cebada Capa 

Rph8 Pa8 576 Reaction to Puccinia hordei 

8 

26:502 Egypt 4 

Rph9 Pa9 32 5HL Reaction to Puccinia hordei 

9 

37:201 HOR 2596 

Rph10 137 3HL Reaction to Puccinia hordei 

10 

26:174 Clipper C8 


11 

26:247 Clipper C67 


12 

26:281 Triumph 

Rph13 590 Reaction to Puccinia hordei 

13 

28:31 PI 531849 

Rph14 591 Reaction to Puccinia hordei 

14 

28:32 PI 584760 

Rph15 Rph16 96 2HL Reaction to Puccinia hordei 

15 

37:214 PI 355447 

160





Rsg1 Grb 22 7H Reaction to Schizaphis 

graminum 1 

37:199 Omugi 

Rsg2 577 Reaction to Schizaphis 

graminum 2 

37:283 PI 426756 

rsm1 sm 35 7HS Reaction to BSMV 1 26:84 Modjo 1 

Rsp1 Sep 515 Reaction to Septoria 

passerinii 1 

26:441 CIho 14300 

Rsp2 Sep2 516 Reaction to Septoria 

passerinii 2 

37:275 PI 70837 

Rsp3 Sep3 517 Reaction to Septoria 

passerinii 3 

37:276 CIho 10644 

rtt1 rt 51 2HS Rattail spike 1 26:87 Goldfoil 

Run1 Un 21 7HS Reaction to Ustilago nuda 1 26:67 Trebi 

rvl1 rvl 226 1HL Revoluted leaf 1 26:224 Hakata 2 

Ryd2 Yd2 123 3HL Reaction to BYDV 2 26:158 CIho 2376 

Rym1 Ym 167 4HL Reaction to BaYMV 1 32:96 Mokusekko 3 

Rym2 Ym2 20 7HL Reaction to BaYMV 2 26:66 Mihori Hadaka 3 

rym3 ym3 345 5HS Reaction to BaYMV 3 32:105 Chikurin Ibaraki 

rym5 Ym 141 3HL Reaction to BaYMV 5 32:90 Mokusekko 3 

sbk1 sk, cal-a 62 2HS Subjacent hood 1 32:83 Tayeh 13 

sca1 sca 128 3HS Short crooked awn 1 26:164 Akashinriki 

sci-a sci-3 625 Scirpoides-a 32:126 Bonus 

scl-a scl-6 626 Scirpoides leaf-a 32:127 Foma 

sdw1 sdw 518 3HL Semidwarf 1 37:277 M21 

sdw2 sdw-b 133 3HL Semidwarf 2 26:169 Mg2170 

seg1 se1 377 7HL Shrunken endosperm genetic 

1 

37:264 Betzes 

seg2 se2 378 7HS Shrunken endosperm genetic 

2 

26:326 Betzes 

seg3 se3 379 3H Shrunken endosperm genetic 

3 

37:265 Compana 


4 

37:267 Compana 

seg5 se5 381 7HS Shrunken endosperm genetic 

5 

26:329 Sermo/7*Glacier 


6 

37:268 Ingrid 

seg7 se7 397 Shrunken endosperm genetic 

7 

37:269 Ingrid 

161





seg8 455 7H Shrunken endosperm genetic 

8 

37:272 60Ab1810-53 

sex1 lys5 382 6HL Shrunken endosperm xenia 1 26:330 Compana 

sex6 31 7HS Shrunken endosperm xenia 6 26:80 K6827 

sex7 sex.i 628 5HL Shrunken endosperm xenia 7 32:129 I90-374 

sex8 sex.j 143 6HS Shrunken endosperm xenia 8 32:93 I89-633 

sgh1 sh1 163 4HL Spring growth habit 1 26:188 Iwate Mensury C 

Sgh2 Sh2 309 5HL Spring growth habit 2 26:259 Indian Barley 

Sgh3 Sh3 213 1HL Spring growth habit 3 26:212 Tammi/Hayakiso 2 

sid1 nls 180 4HL Single internode dwarf 1 26:203 Akashinriki 

Sil1 Sil 228 1HS Subcrown internode length 1 26:226 NE 62203 

sld1 dw-1 126 3HL Slender dwarf 1 26:162 Akashinriki 

sld2 83 2HS Slender dwarf 2 26:121 Akashinriki 

sld3 ant-567 186 4HS Slender dwarf 3 37:243 Manker 

sld4 100 7HS Slender dwarf 4 37:218 Glacier 

sld5 144 3HS Slender dwarf 5 32:94 Indian Dwarf 

sls1 sls 227 1HS Small lateral spikelet 1 26:225 Morex 

smn1 smn 38 7HS Seminudoides 1 32:225 Haisa 

snb1 sb 26 7HS Subnodal bract 1 26:72 L50-200 

srh1 s 321 5HL Short rachilla hair 1 26:269 Lion 

sun1 650 Sensitivity to Ustilago nuda 1 35:208 Steptoe 

trd1 trd 202 1HL Third outer glume 1 26:207 Valki 

trp1 tr 61 2HL Triple awned lemma 1 26:97 CIho 6630 

tst1 647 Tip sterile 1 35:205 Steptoe 

tst2 lin2 636 Tip sterile 2 37:292 Donaria 

ubs4 u4 11 7HL Unbranched style 4 26:56 Ao-Hadaka 

uzu1 uz 102 3HL Uzu 1 or semi brachytic 1 37:220 Baitori 

var1 va 306 5HL Variegated 1 37:259 Montcalm 

var2 va2 344 5HL Variegated 2 32:104 Montcalm 

var3 va3 303 5HL Variegated 3 26:254 Montcalm 

viv-a viv-5 627 Viviparoides-a 32:128 Foma 

vrs1 v 6 2HL Six-rowed spike 1 37:192 Trebi 

vrs1 lr 58 2HL Six-rowed spike 1 26:94 Nudihaxtoni 

vrs1 V d 66 2HL Two-rowed spike 1 26:103 Svanhals 

162





vrs1 V t 67 2HL Deficiens 1 26:104 White Deficiens 

vrs2 v2 314 5HL Six-rowed spike 2 26:263 Svanhals 

vrs3 v3 315 1HL Six-rowed spike 3 26:264 Hadata 2 

vrs4 v4 124 3HL Six-rowed spike 4 26:159 MFB 104 

wax1 wx 16 7HS Waxy endosperm 1 26:61 Oderbrucker 

wnd1 wnd 23 7HS Winding dwarf 1 26:69 Kogen-mugi 

wst1 wst 107 3HL White streak 1 26:141 CIho 11767 

wst2 304 5HL White streak 2 26:255 Manabe 

wst4 56 2HL White streak 4 26:91 Kanyo 7 

wst5 221 1HL White streak 5 26:219 Carlsberg II 

wst6 wst,,j 129 3HL White streak 6 26:165 Akashinriki 

wst7 rb 79 2HL White streak 7 37:207 GS397 

Xnt1 Xa 25 7HL Xantha seedling 1 26:71 Akanshinriki 

xnt2 xb 513 Xantha seedling 2 26:440 Black Hulless 

xnt3 xc 105 3HS Xantha seedling 3 26:139 Colsess 

xnt4 xc2 36 7HL Xantha seedling 4 26:85 Coast 

xnt5 xn 255 6HL Xantha seedling 5 26:237 Nepal 

xnt6 xs 113 3HS Xantha seedling 6 26:147 Smyrna 

xnt7 xan,,g 233 1HL Xantha seedling 7 26:231 Erbet 

xnt8 xan,,h 140 3HS Xantha seedling 8 26:177 Carlsberg II 

xnt9 xan,,i 37 7HL Xantha seedling 9 26:86 Erbet 

yhd1 yh 158 4HL Yellow head 1 26:185 Kimugi 

yhd2 yh2 592 Yellow head 2 28:34 Compana 

ylf1 652 Yellow leaf 1 35:210 Villa 

Ynd1 Yn 183 4HS Yellow node 1 32:98 Morex 

yst1 yst 104 3HS Yellow streak 1 26:138 Gateway 

yst2 109 3HS Yellow streak 2 26:144 Kuromugi 148/ 

Mensury C 

yst3 yst,,c 462 3HS Yellow streak 3 26:409 Lion 

yst4 85 2HL Yellow streak 4 37:210 Glenn 

yst5 346 5HL Yellow streak 5 32:107 Bowman / ant10.30 

yvs1 yx 63 2HS Virescent seedling 1 26:99 Minn 71-8 

yvs2 yc 3 7HS Virescent seedling 2 26:46 Coast 

zeb1 zb 120 3HL Zebra stripe 1 26:155 Mars 

zeb2 zb2 461 4HL Zebra stripe 2 26:407 Unknown 

zeb3 zb3 223 1HL Zebra stripe 3 26:221 Utah 41 

Zeo1 Knd 82 2HL Zeocriton 1 37:209 Donaria 

Zeo2 614 Zeocriton 2 32:115 36Ab51 

Zeo3 Mo1 184 4HL Zeocriton 3 32:99 Morex 

163


* Recommended locus symbols are based on utilization of a three-letter code for barley genes as 

approved at the business meeting of the Seventh International Barley Genetics Symposium at 

Saskatoon, Saskatchewan, Canada, on 05 August 1996. 

† Chromosome numbers and arm designations are based on the Triticeae system. Utilization of 

this system for naming of barley chromosomes was at the business meeting of the Seventh 

International Barley Genetics Symposium at Saskatoon, Saskatchewan, Canada, on 05 August 

1996. The Burnham and Hagberg (1956) designations of barley chromosomes were 1 2 3 4 5 6 

and 7 while new designations based on the Triticeae system are 7H 2H 3H 4H 1H 6H and 5H, 

respectively. 

164


Rules for Nomenclature and Gene Symbolization in Barley 

Jerome D. Franckowiak 1 and Udda Lundqvist 2 

1 HermitageResearch Station 



2 Nordic Genetic Resource Center 


In this volume of the Barley Genetics Newsletter the recommended rules for 

nomenclature and gene symbolization in barley as reported in BGN 2:11-14, BGN 11:1- 

16, BGN 21:11-14, BGN 26:4-8, BGN 31:76-79, BGN 34:132-136, BGN 35:114-149, 

and BGN 37:100-104 are again reprinted. Also, the current lists of new and revised BGS 

descriptions are presented by BGS number order (Table 1) and by locus symbol in 

alphabetic order (Table 2) in this issue. 

1. In naming hereditary factors, the use of languages of higher internationality should 

be given preference. 

2. Symbols of hereditary factors, derived from their original names, should be 

written in Roman letters of distinctive type, preferably in italics, and be as short as 

possible. 

AMENDMENT: The original name should be as descriptive as possible of the 

phenotype. All gene symbols should consist of three letters. 

COMMENTS: All new gene symbols should consist of three letters. 

Existing gene symbols of less than three letters should be converted to the 

three-letter system whenever symbols are revised. When appropriate, one 

or two letters should be added to existing symbols. 

For example, add the letters "ap" to "K" to produce the symbol "Kap" to 

replace "K" as the symbol for Kapuze (hooded). As another example, add 

the letters "ud" to "n" to produce the symbol "nud" to replace "n" as the 

symbol for naked seed. Similarly the letter "g" can be added to "ms" to 

produce the symbol "msg" for genetic male sterility and the letter "e" can 

be added to "ds" to produce the symbol "des" for desynapsis. When 

inappropriate or when conflicts arise, questions should be referred to the 

Committee on Genetic Marker Stocks, Nomenclature, and Symbolization 

of the International Barley Genetics Symposium for resolution. 

3. Whenever unambiguous, the name and symbol of a dominant begin with a capital 

letter and those of a recessive with a small letter. 

AMENDMENT: When ambiguous (co-dominance, incomplete dominance, etc.) 

all symbols should consist of a capital letter followed by two small letters that 

165


designate the character, a number that represents a particular locus, and a letter or 

letters that represents a particular allele or mutational event at that particular locus. 

COMMENTS: As an example, the letters "Mdh" can be used to designate 

the character malate dehydrogenase, "Mdh1" would represent a particular 

locus for malate dehydrogenase and "Mdh1a", "Mdh1b", "Mdh1c", etc. 

would represent particular alleles or mutational events at the "Mdh1" locus. 

Row number can be used as an example of symbolizing factors showing 

incomplete dominance. At the present time, the symbol "v" is used to 

represent the row number in Hordeum vulgare, "V" is used to represent the 

row number in Hordeum distichum, and "V t " is used to represent the row 

number in Hordeum deficiens. According to the amendment to Rule 3, if 

row number were to be designated by the letters "Vul", the designation of 

the locus on chromosome 2 would then become "Vul1" and the alleles "v", 

"V", and "V t " would be designated "Vul1a", "Vul1b", and "Vul1c". 

SUPPLEMENTARY AMENDMENT: A period should be placed before the 

allele symbol in the complete gene symbol. 

COMMENTS: Since DNA sequences similar to those of the original locus 

may occur at several positions in the Hordeum vulgare genome, a threeletter 

symbol plus a number is inadequate to represent all potential loci. 

Also, both numbers and letters have been assigned to specific mutants and 

isozymes in Hordeum vulgare. The six-rowed spike locus is used as an 

example although the symbol Vul1 for row number in Hordeum vulgare is 

not recommended because the botanical classification of Hordeum spp has 

changed. The locus symbol vrs1 and the name six-rowed spike 1 are 

recommended for the v locus. Gene symbols recommended for common 

alleles at the vrs1 locus are vrs1.a, vrs1.b, vrs1.c, and vrs1.t for the "v", 

"V", "v lr ", and "V t " genes, respectively. 

4. Literal or numeral superscripts are used to represent the different members of an 

allelic series. 

AMENDMENT: All letters and numbers used in symbolization should be written 

on one line; no superscripts or subscripts should be used. 

5. Standard or wild type alleles are designated by the gene symbols with a + as a 

superscript or by a + with the gene symbol as a superscript. In formulae, the + 

alone may be used. 

AMENDMENT: This rule will not be used in barley symbolization. 

6. Two or more genes having phenotypically similar effects are designated by a 

common basic symbol. Non-allelic loci (mimics, polymeric genes, etc.) are 

distinguished by an additional letter or Arabic numeral either on the same line 

166


after a hyphen or as a subscript. Alleles of independent mutational origin may be 

indicated by a superscript. 

AMENDMENT: Barley gene symbols should consist of three letters that 

designate the character, a number that represents a particular locus, and a letter or 

letters that represents a particular allele or mutational event at that particular locus. 

All letters and numbers should be written on the same line without hyphens or 

spaces. Alleles or mutational events that have not been assigned to a locus should 

be symbolized by three letters that designate the character followed by two 

commas used to reserve space for the locus number when determined, followed by 

a letter or letters representing the particular allele or mutational event. After 

appropriate allele testing, the correct locus number will be substituted for the 

commas. Where appropriate (when assigning new symbols or when revising 

existing symbols) letters representing alleles or mutational events should be 

assigned consecutively without regard to locus number or priority in discovery or 

publication. 

COMMENTS: The use of the proposed system of symbolization can be 

illustrated by the desynaptic mutants. Two loci are known: lc on 

chromosome 1 (7H) and ds on chromosome 3 (3H). These will be 

resymbolized as des1a and des2b. A large number of desynaptic mutants 

have been collected. They will be designated des,,c, des,,d, des,,e, etc. If 

allele tests show that des,,c is at a different locus than des1 and des2, des,,c 

will become des3c. If allele tests show that des,,d is at the same locus as 

des2, des,,d will become des2d. In practical use, the symbol des will be 

used when speaking of desynapsis in general or if only one locus was 

known for the character. The symbol des2 will be used when speaking of 

that particular locus, and the symbol des2b will be used only when 

speaking of that particular allele or mutational event. If additional 

designation is needed in particular symbolization, it can be obtained by 

adding numbers behind the allele letters, and, if still further designation is 

needed, letters can be added to the symbol behind the last number. 

Symbolization consisting of alternation of letters and numbers written on 

the same line without hyphens or spaces will allow for the expansion of the 

symbol as future needs arise. In any work with large numbers of polymeric 

gene mutants, every mutant has to be given a designation not shared by any 

other mutant of this polymeric group and this designation should become a 

part of the permanent symbol representing that particular allele or 

mutational event. This requirement can be met by assigning allele 

designations in consecutive order without regard to locus number. 

SUPPLEMENTARY AMENDMENT: A period should be used instead of two 

commas in gene symbols for mutants within a polymeric group that can not be 

assigned to a specific locus. 

COMMENTS: The des symbol should be used when referring to 

desynapsis in general; des1 and des2, for specific loci; des1.a and des2.b 

167


for specific genes or alleles at their respective loci; and des.c, des.d, des.e 

etc., for desynaptic mutants not assigned to a specific locus. 

SUPPLEMENTARY AMENDMENT: 

Even if the locus in question is the only one known that affects a given phenotype, 

the three-letter basic symbol is followed by a serial number. 

7. Inhibitors, suppressors, and enhancers are designated by the symbols I, Su, and En, 

or by i, su, and en if they are recessive, followed by a hyphen and the symbol of 

the allele affected. 

AMENDMENT 

This rule is no longer appicable and will not be used in barley symbolization. 

8. Whenever convenient, lethals should be designated by the letter l or L and sterility 

and incompatibility genes by s or S. 


COMMENTS: J.G. Moseman (BGN 2:145-147) proposed that the first of 

the three letters for designating genes for reaction to pests should be R. The 

second and third letters will be the genus and species names of the pest. 

SUPPLEMENTARY COMMENT: A motion was passed during the 

workshop on "Linkage Groups and Genetic Stock Collections" at the Fifth 

International Barley Genetics Symposium in 1986 (Barley Genetics 

V:1056-1058, BGN 17:1-4), that the International Committee for 

Nomenclature and Symbolization of Barley Genes should "recommend use 

of Ml as the designation of genes for resistance to powdery mildew.” 

9. Linkage groups and corresponding chromosomes are preferably designated by 

Arabic numerals. 

SUPPLEMENTARY AMENDMENT: The current wheat homoeologous group 

numbering scheme (the Triticeae system) is recommended for Hordeum vulgare 

chromosomes. Arabic numerals followed by an H will indicate specific barley 

chromosomes. The H. vulgare chromosomes should be 7H, 2H, 3H, 4H, 1H, 6H, 

and 5H instead of 1, 2, 3, 4, 5, 6, and 7, respectively. 

10. The letter X and Y are recommended to designate sex chromosomes. 


11. Genic formulae are written as fractions with the maternal alleles given first or 

above. Each fraction corresponds to a single linkage group. Different linkage 

groups written in numerical sequence are separated by semicolons. Symbols of 

unlocated genes are placed within parenthesis at the end of the formula. In 

168


euploids and aneuploids, the gene symbols are repeated as many times as there are 

homologous loci. 

12. Chromosomal aberrations should be indicated by abbreviations: Df for deficiency, 

Dp for duplication, In for inversion, T for translocation, Tp for transposition. 

13. The zygotic number of chromosomes is indicated by 2n, the gametic number by n, 

and basic number by x. 

14. Symbols of extra-chromosomal factors should be enclosed within brackets and 

precede the genic formula. 

The following recommendations made by the International Committee for Nomenclature 

and Symbolization of Barley Genes at the Fourth International Barley Genetics 

Symposium in 1981 (Barley Genetics IV:959-961) on gene and mutation designations 

were as follows. 

AMENDMENT: 

A. Present designations for genes and mutations. - Most of the present designations 

should be maintained. However, new designations may be given, when additional 

information indicates that new designations would aid in the identification of 

genes and mutations. 

B. New designations for genes and mutations. - New genes or mutations will be 

designated by characteristic, locus, allele, and then the order of identification or 

mutational event. Three letters will be used to identify new characteristics. 

Consecutive numbers will be used to identify the order of identification or 

mutational event. Loci will be designated by numbers and alleles by letters when 

they are identified. For example, des-6 indicates that this is the sixth gene or 

mutation identified for the characteristic des (desynaptic). des 1-6 and des 2-7 

indicate that gene or mutational events 6 and 7 for the desynaptic characteristic 

have been shown to be at different loci and those loci are then designated 1 and 2, 

respectively. des 1a6 and des 1b8, indicate that the gene or mutational events 6 

and 8 for the characteristic desynaptic have been shown to be at different alleles at 

locus 1 and those alleles are then designated a and b. 

SUPPLEMENTARY COMMENT: 

A motion was passed during the workshop of the "Nomenclature and Gene 

Symbolization Committee" at the Fifth International Barley Genetics Symposium 

in 1986 (Barley Genetics V:1056-1058) that "the recommended systems for 

Nomenclature and Gene Symbolization of the International Committee be 

published annually in the Barley Genetics Newsletter." 

SUPPLEMENTARY COMMENT 2: 

At the workshop for ”Recommendations of Barley Nomenclature” held at 

169


Saskatoon, July 31, 1996 and adopted at the General Meeting of the Seventh 

International Barley Genetics Symposium, it was recommended that a period 

instead of a dash be used to designate the allele portion of the gene symbol. 

Consequently, the first gene symbol for the characteristic des (desynapsis) should 

be expressed as des1.a. The code des1 identifies a specific locus. The period 

indicates that the symbol a identifies a specific allele or mutational event that 

produces a desynaptic phenotype. (The allele symbol a will be always associated 

with this specific desynaptic mutant even if the locus symbol is changed based on 

subsequent research results.) 

170

BARLEY GENETICS NEWSLETTER - GrainGenes

Create successful ePaper yourself

Delete template?

Save as template?