plant surface microbiology.pdf

PLANT SURFACE MICROBIOLOGY

Ajit Varma 

Lynette Abbott 

Dietrich Werner 

Rüdiger Hampp (Eds.) 

Plant Surface 

Microbiology 

With 138 Figures, 2 in Color 

1 23

Professor Dr. Ajit Varma 

Director 

Amity Institiute of Microbial Sciences 

Amity University 

Noida 201303 

UP, India 

email: ajitvarma@aihmr.amity.edu 

Professor Dr. Lynette Abbott 

School of Earth and Geographical Sciences 

The University of Western Australia 

Nedlands WA 6009 

Australia 

email: labbott@cyllene.uwa.edu.au 

ISBN 978-3-540-74050-6 

Library of Congress Control Number: 2007934913 

Springer-Verlag Berlin Heidelberg New York 

Professor Dr. Dietrich Werner 

FG Zellbiologie und Angewandte Botanik 

Philipps Universität Marburg 

35032 Marburg 

Germany 

email: djg.werner@gmx.de 

Professor Dr. Rüdiger Hampp 

Physiological Ecology of Plants 

University of Tübingen 

72116 Tübingen 

Germany 

email: ruediger.hampp@uni-tuebingen.de 

This work is subject to copyright. All rights are reserved, whether the whole or part of the material is concerned, 

specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on 

microfilm or in any other way, and storage in data banks. Duplication of this publication or parts thereof is permitted 

only under the provisions of the German Copyright Law of September 9, 1965, in its current version, and permissions 

for use must always be obtained from Springer-Verlag. Violations are liable for prosecution under the 

German Copyright Law. 

Springer-Verlag is a part of Springer Science+Business Media 

springer.com 

© Springer-Verlag Berlin Heidelberg 2004, 2008 

The use of general descriptive names, registered names, trademarks, etc. in this publication does not imply, even in 

the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations 

and therefore free for general use. 

5 4 3 2 1 0 – Printed on acid free paper

Preface 

The complexity of plant surface microbiology is based on combinations.A large 

number of microbial species and genera interact with several hundred thousand 

species of higher plants. At the same time, they interact with each other. 

Therefore, this book describes only some very important model interactions 

which have been studied intensively over the last years.The methods developed 

for some important groups of microorganisms can be used for a large number 

of other less studied interactions and combinations. The pace of discovery has 

been particularly fast at two poles of biological complexity,the molecular events 

leading to changes in growth and differentiation, as well as the factors regulating 

the structure and diversity of natural populations and communities. 

The area of plant surfaces is enormous. A single maize plant has a leaf 

surface of up to 8000 cm 2 , a single beech tree has a leaf surface of around 

4.5 million cm 2 . The leaf area index (LAI) varies from 0.45 in tundra areas 

up to 14 in areas with a dense vegetation. Calculated for all plant surfaces 

above ground, the surface area is more than 200 million km 2 . This area is still 

surpassed by the below ground surface areas of plants, especially those with 

an extensive root hair system. For a single rye plant, a root hair surface of 

around 400 m 2 has been calculated. Even if this is an exceptional case, it can 

be assumed that in many plants the root and root hair surface is ten times 

larger than the surfaces of the above ground plant parts. This means that 

more than 2000 million km 2 of plant surface is present underground. Taking 

both figures together, it exceeds the land surface area of the planet Earth of 

149 million km 2 by more than a factor of 10. 

This volume summarizes and updates both the state of knowledge and theories 

and their possible biotechnological applications. It will thus be of interest 

to a diverse audience of researchers and instructors, especially biologists, 

biochemists, agronomists, foresters, horticulturists, mycologists, soil scientists, 

ecologists, plant physiologists, plant molecular biologists, geneticists, 

and microbiologists. 

In the planning of the book, invitations for contributions were extended to 

leading international scientists working in the field of plant surface microbi-

VI 

ology. The basic concepts in plant surface microbiology are discussed at 

length in 30 chapters including a few specialized and innovative methodologies 

and novel techniques. The editors would like to express deep appreciation 

to each contributor for his/her work, patience and attention to detail during 

the entire production process. It is hoped that their reviews, interpretations, 

and basic concepts will stimulate further research. We are confident that the 

joint efforts of the authors and editors will contribute to a better understanding 

of the advances in the study of the challenging area of surface microbiology 

and will further stimulate progress in this field. 

It has been a pleasure to edit this book, primarily due to the stimulating 

cooperation of the contributors.We would like to express sincere thanks to all 

the staff members of Springer-Verlag, Heidelberg, especially, Drs. Dieter 

Czeschlik and Jutta Lindenborn for their help and active cooperation during 

the preparation of the book. 

New Delhi, India Ajit Varma 

Nedlands, Australia Lynette Abbott 

Marburg, Germany Dietrich Werner 

Tübingen, Germany Rüdiger Hampp 

July 2003 

Preface

Contents 

1 The State of the Art . . . . . . . . . . . . . . . . . . . . . . . 1 

Ajit Varma, Lynette K. Abbott, Dietrich Werner 

and Rüdiger Hampp 

Section A 

2 Root Colonisation Following Seed Inoculation . . . . . . . 13 

Thomas F.C. Chin-A-Woeng and Ben J.J. Lugtenberg 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 13 

2 Bacterial Root Colonisation . . . . . . . . . . . . . . . . . . 13 

3 Analysis of Tomato Root Tip Colonisation 

After Seed Inoculation Using a Gnotobiotic Assay . . . . . . 14 

3.1 Description of the Gnotobiotic System . . . . . . . . . . . . 14 

3.2 Seed Disinfection . . . . . . . . . . . . . . . . . . . . . . . . 15 

3.3 Growth and Preparation of Bacteria . . . . . . . . . . . . . . 16 

3.4 Seed Inoculation . . . . . . . . . . . . . . . . . . . . . . . . 17 

3.5 Analysis of the Tomato Root Tip . . . . . . . . . . . . . . . . 17 

3.6 Confocal Laser Scanning Microscopy . . . . . . . . . . . . . 18 

4 Genetic Tools for Studying Root Colonisation . . . . . . . . 18 

4.1 Marking and Selecting Bacteria . . . . . . . . . . . . . . . . 18 

4.2 Rhizosphere-Stable Plasmids . . . . . . . . . . . . . . . . . 21 

4.3 Genetic and Metabolic Burdens . . . . . . . . . . . . . . . . 21 

5 Behaviour of Root-Colonising 

Pseudomonas Bacteria in a Gnotobiotic System . . . . . . . 22 

5.1 Colonisation Strategies of Bacteria . . . . . . . . . . . . . . 22 

5.2 Competitive Colonisation Studies . . . . . . . . . . . . . . . 23 

5.3 Monocots versus Dicots . . . . . . . . . . . . . . . . . . . . . 25 

6 Influence of Abiotic and Biotic Factors . . . . . . . . . . . . 25

VIII 

Contents 

6.1 Abiotic Factors . . . . . . . . . . . . . . . . . . . . . . . . . 25 

6.2 Biotic Factors . . . . . . . . . . . . . . . . . . . . . . . . . . 27 

7 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . 28 

References and Selected Reading . . . . . . . . . . . . . . . . . . . . . 28 

3 Methanogenic Microbial Communities Associated 

with Aquatic Plants . . . . . . . . . . . . . . . . . . . . . . . 35 

Ralf Conrad 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 35 

2 Role of Plants in Emission of CH 4 to the Atmosphere . . . . 35 

3 Role of Photosynthates and Plant Debris for CH 4 Production 38 

4 Methanogenic Microbial Communities on Plant Debris . . . 40 

5 Methanogenic Microbial Communities on Roots . . . . . . . 42 

6 Interaction of Methanogens and Methanotrophs . . . . . . . 44 


4 Role of Functional Groups of Microorganisms 

on the Rhizosphere Microcosm Dynamics . . . . . . . . . . 51 

Galdino Andrade 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 51 

2 General Aspects of Functional Groups 

of Soil Microorganisms . . . . . . . . . . . . . . . . . . . . . 52 

3 Carbon Cycle Functional Groups . . . . . . . . . . . . . . . 53 

4 Functional Groups of Microorganisms of the Nitrogen Cycle 55 

5 Functional Groups of Microorganisms of the Sulphur Cycle 57 

6 Functional Groups of Microorganisms 

of the Phosphorus Cycle . . . . . . . . . . . . . . . . . . . . 59 

7 Dynamics of the Rhizosphere Functional Groups 

of Microorganisms . . . . . . . . . . . . . . . . . . . . . . . 60 

8 Relationship Among r and k Strategist Functional Groups . 61 

9 Arbuscular Mycorrhizal Fungi Dynamics 

in the Rhizosphere . . . . . . . . . . . . . . . . . . . . . . . 61 

10 Dynamics Among the Functional Micro-Organism Groups 

of the Carbon, Nitrogen, Phosphorus and Sulphur Cycles . . 65 

References and Selected Reading . . . . . . . . . . . . . . . . . . . . . 68

Contents IX 

5 Diversity and Functions of Soil Microflora 

in Development of Plants . . . . . . . . . . . . . . . . . . . . 71 

Ramesh Chander Kuhad, David Manohar Kothamasi, 

K.K. Tripathi and Ajay Singh 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 71 

2 Functional Diversity of Soil Microflora . . . . . . . . . . . . 72 

3 Role of Soil Microflora in Plant Development . . . . . . . . 76 

3.1 Mycorrhiza . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76 

3.2 Actinorhiza . . . . . . . . . . . . . . . . . . . . . . . . . . . 80 

3.3 Plant Growth-Promoting Rhizobacteria . . . . . . . . . . . 82 

3.4 Phosphate-Solubilizing Microorganisms . . . . . . . . . . . 84 

3.5 Lignocellulolytic Microorganisms . . . . . . . . . . . . . . . 85 

4 Plant Growth Promoting Substances Produced 

by Soil Microbes . . . . . . . . . . . . . . . . . . . . . . . . . 88 

5 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . 90 


6 Signalling in the Rhizobia–Legumes Symbiosis . . . . . . . 99 


1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 99 

2 The Signals from the Host Plants . . . . . . . . . . . . . . . 101 

2.1 Phenylpropanoids: Simple Phenolics, Flavonoids 

and Isoflavonoids . . . . . . . . . . . . . . . . . . . . . . . . 102 

2.2 Metabolization of Flavonoids and Isoflavonoids . . . . . . . 104 

2.3 Vitamins as Growth Factors and Signal Molecules . . . . . . 106 

3 Signals from the Microsymbionts . . . . . . . . . . . . . . . 107 

3.1 Nod Factors . . . . . . . . . . . . . . . . . . . . . . . . . . . 107 

3.2 Cyclic Glucans . . . . . . . . . . . . . . . . . . . . . . . . . . 109 

3.3 Lipopolysaccharides . . . . . . . . . . . . . . . . . . . . . . 110 

3.4 Exopolysaccharides . . . . . . . . . . . . . . . . . . . . . . . 110 

4 Signal Perception and Molecular Biology 

of Nodule Initiation . . . . . . . . . . . . . . . . . . . . . . . 111 


X 

Section B 

Contents 

7 The Functional Groups of Micro-organisms Used 

as Bio-indicator on Soil Disturbance Caused 

by Biotech Products such as Bacillus thuringiensis 

and Bt Transgenic Plants . . . . . . . . . . . . . . . . . . . . 121 


1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 121 

2 General Aspects of Bacillus thuringiensis . . . . . . . . . . . 122 

3 Survival in the Soil . . . . . . . . . . . . . . . . . . . . . . . 123 

4 History of Bacillus thuringiensis-Transgenic Plants . . . . . 124 

5 Persistence of the Protein Crystal in the Soil . . . . . . . . . 125 

6 Effect of Bacillus thuringiensis and Its Bio-insecticide 

Protein on Functional Soil Microorganism Assemblage . . . 126 


8 The Use of ACC Deaminase-Containing 

Plant Growth-Promoting Bacteria to Protect Plants 

Against the Deleterious Effects of Ethylene . . . . . . . . . 133 

Bernard R. Glick and Donna M. Penrose 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 133 

2 Ethylene . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 134 

3 ACC Deaminase . . . . . . . . . . . . . . . . . . . . . . . . . 135 

3.1 Treatment of Plants with ACC Deaminase 

Containing Bacteria . . . . . . . . . . . . . . . . . . . . . . . 137 

4 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . 140 


9 Interactions Between Epiphyllic Microorganisms 

and Leaf Cuticles . . . . . . . . . . . . . . . . . . . . . . . . 145 

Lukas Schreiber, Ursula Krimm and Daniel Knoll 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 145 

2 Physical and Chemical Parameters of the Phyllosphere . . . 147 

3 Leaf Surface Colonisation and Species Composition . . . . . 149 

4 Alteration of Leaf Surface Wetting . . . . . . . . . . . . . . . 150 

5 Interaction of Bacteria with Isolated Plant Cuticles . . . . . 152 

6 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . 153 


Contents XI 

10 Developmental Interactions Between Clavicipitaleans 

and Their Host Plants . . . . . . . . . . . . . . . . . . . . . 157 

James F. White Jr., Faith Belanger, Raymond Sullivan, 

Elizabeth Lewis, Melinda Moy, William Meyer 

and Charles W. Bacon 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 157 

2 Endophyte/Epibiont Niche . . . . . . . . . . . . . . . . . . . 157 

3 Coevolution of Clavicipitalean Fungi with Grass Hosts . . . 158 

4 The Jump from Insects to Plants . . . . . . . . . . . . . . . . 158 

4.1 Trans-Kingdom Jump . . . . . . . . . . . . . . . . . . . . . . 158 

4.2 Intermediate Stages in the Transition to Plants . . . . . . . . 158 

4.3 Parasitism of Grass Meristematic Tissues . . . . . . . . . . . 160 

5 Developmental Differentiation of Endophytic 

and Epiphyllous Mycelium . . . . . . . . . . . . . . . . . . . 160 

5.1 Plant Cell Wall Alteration . . . . . . . . . . . . . . . . . . . . 160 

5.2 Endophytic Mycelial Growth . . . . . . . . . . . . . . . . . . 160 

5.3 Control of Endophytic Mycelial Development . . . . . . . . 163 

5.4 Epiphyllous Mycelial Development . . . . . . . . . . . . . . 163 

5.5 Expression of Fungal Secreted Hydrolytic 

Enzymes in Infected Plants . . . . . . . . . . . . . . . . . . . 164 

6 Modifications of Plant Tissues for Nutrient Acquisition . . . 165 

6.1 Development of the Stroma in Epichloë . . . . . . . . . . . . 165 

6.2 Stroma Development in Myriogenospora . . . . . . . . . . . 166 

6.3 Mechanisms for Modifying Plant Tissues . . . . . . . . . . . 168 

6.4 Evaporative-Flow Mechanism for Nutrient Acquisition . . . 169 

6.5 The Cytokinin Induction Hypothesis . . . . . . . . . . . . . 169 

7 Evolution of Asexual Derivatives of Epichloë . . . . . . . . . 171 

7.1 Reproduction and Loss of Sexual Reproduction . . . . . . . 171 

7.2 The Hypotheses . . . . . . . . . . . . . . . . . . . . . . . . . 172 

7.3 The Process of Stroma Development and its Loss . . . . . . 173 

7.4 The Shift from Pathogen to Mutualist . . . . . . . . . . . . . 174 

8 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . 174 


11 Interactions of Microbes with Genetically Modified Plants . 179 

Michael Kaldorf, Chi Zhang, Uwe Nehls, 

Rüdiger Hampp and François Buscot 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 179 

2 Changes in Microbial Communities Induced 

by Genetically Modified Plants . . . . . . . . . . . . . . . . . 181

XII 

3 Impact of Genetically Modified Plants 

on Symbiotic Interactions . . . . . . . . . . . . . . . . . . . 184 

4 Horizontal Gene Transfer . . . . . . . . . . . . . . . . . . . . 186 

5 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . 191 


Section C 

Contents 

12 Interaction Between Soil Bacteria 

and Ectomycorrhiza-Forming Fungi . . . . . . . . . . . . . 197 

Rüdiger Hampp and Andreas Maier 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 197 

2 Bacteria . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 198 

3 Bacterial Community Structure . . . . . . . . . . . . . . . . 198 

4 Association of Bacteria with Fungal/Ectomycorrhizal 

Structures . . . . . . . . . . . . . . . . . . . . . . . . . . . . 199 

5 Bacteria Associated with Sporocarps and Ectomycorrhiza . 200 

6 Benefits from Bacteria/Ectomycorrhiza Interactions . . . . 201 

7 Possible Mechanisms of Interaction . . . . . . . . . . . . . . 202 

8 Biochemical Evidence for Interaction . . . . . . . . . . . . . 203 

9 Impacts of Environmental Pollution . . . . . . . . . . . . . . 206 

10 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . 206 


13 The Surface of Ectomycorrhizal Roots and the 

Interaction with Ectomycorrhizal Fungi . . . . . . . . . . . 211 

Ingrid Kottke 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 211 

2 Long and Short Roots of Ectomycorrhiza-Forming Plants . 212 

3 A Cuticle-Like Layer on the Surface of Short Roots . . . . . 214 

4 Involvement of the Cuticle-Like Layer 

in Mycorrhiza Formation . . . . . . . . . . . . . . . . . . . . 218 

5 Involvement of the Cuticle-Like Layer in Hyphal Attachment 218 

6 Digestion of the Suberin Layer and the Cell Wall 

of the Root Cap . . . . . . . . . . . . . . . . . . . . . . . . . 220 

7 Hartig Net Formation . . . . . . . . . . . . . . . . . . . . . . 221 

8 Pectins in the Cortical Cell Walls of Nonmycorrhizal 

Long and Mycorrhizal Short Roots . . . . . . . . . . . . . . 222 

9 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . 223 


Contents XIII 

14 Cellular Ustilaginomycete—Plant Interactions . . . . . . . 227 

Robert Bauer and Franz Oberwinkler 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 227 

2 The Term Smut Fungus . . . . . . . . . . . . . . . . . . . . . 227 

3 Life Cycle . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 228 

4 Hosts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 228 

5 Cellular Interactions . . . . . . . . . . . . . . . . . . . . . . 229 

5.1 Local Interaction Zones . . . . . . . . . . . . . . . . . . . . . 230 

5.2 Enlarged Interaction Zones . . . . . . . . . . . . . . . . . . 234 

6 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . 235 


15 Interaction of Piriformospora indica 

with Diverse Microorganisms and Plants . . . . . . . . . . . 237 

Giang Huong Pham, Anjana Singh, Rajani Malla, 

Rina Kumari, , Ram Prasad, Minu Sachdev, 

Karl-Heinz Rexer, Gerhard Kost, Patricia Luis, 

Michael Kaldorf, François Buscot, Sylvie Herrmann, 

Tanja Peskan, Ralf Oelmüller, Anil Kumar Saxena, 

Stephané Declerck, Maria Mittag, Edith Stabentheiner, 

Solveig Hehl and Ajit Varma 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 237 

2 Interaction with Microorganisms . . . . . . . . . . . . . . . 238 

2.1 Rhizobacteria . . . . . . . . . . . . . . . . . . . . . . . . . . 238 

2.2 Chlamydomonas reinhardtii . . . . . . . . . . . . . . . . . . 239 

2.3 Sebacina vermifera . . . . . . . . . . . . . . . . . . . . . . . 239 

2.4 Other Soil Fungi . . . . . . . . . . . . . . . . . . . . . . . . . 240 

2.5 Gaeumannomyces graminis . . . . . . . . . . . . . . . . . . 240 

3 Interaction with Bryophyte . . . . . . . . . . . . . . . . . . . 242 

4 Interaction with Higher Plants . . . . . . . . . . . . . . . . . 242 

4.1 Monocots . . . . . . . . . . . . . . . . . . . . . . . . . . . . 245 

4.2 Legumes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 245 

4.3 Orchids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 246 

4.4 Medicinal Plants . . . . . . . . . . . . . . . . . . . . . . . . . 247 

4.5 Economically Important Plants . . . . . . . . . . . . . . . . 249 

4.6 Timber Plants . . . . . . . . . . . . . . . . . . . . . . . . . . 252 

4.7 Unexpected Interactions with Wild Type 

and Genetically Modified Populus Plants . . . . . . . . . . . 253 

4.8 Nonmycorrhizal Plants . . . . . . . . . . . . . . . . . . . . . 255

XIV 

4.9 Arabidopsis thaliana . . . . . . . . . . . . . . . . . . . . . . 256 

4.10 Root Organ Culture . . . . . . . . . . . . . . . . . . . . . . . 259 

5 Cell Wall Degrading Enzymes . . . . . . . . . . . . . . . . . 260 

6 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . 263 


16 Cellular Basidiomycete–Fungus Interactions . . . . . . . . 267 


1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 267 

2 Occurrence of Mycoparasites Within the Basidiomycota . . 267 

3 Hosts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 268 

4 Cellular Interactions . . . . . . . . . . . . . . . . . . . . . . 268 

4.1 Colacosome-Interactions . . . . . . . . . . . . . . . . . . . . 268 

4.2 Fusion-Interaction . . . . . . . . . . . . . . . . . . . . . . . 275 

5 Basidiomycetous Mycoparasitism, a Result of Convergent 

Evolution? . . . . . . . . . . . . . . . . . . . . . . . . . . . . 277 

6 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . 278 


Section D 

Contents 

17 Fungal Endophytes . . . . . . . . . . . . . . . . . . . . . . . 281 

Sita R. Ghimire and Kevin D. Hyde 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 281 

2 Definition of a Fungal Endophyte . . . . . . . . . . . . . . . 281 

3 Role of Endophytes . . . . . . . . . . . . . . . . . . . . . . . 282 

4 Modes of Endophytic Infection and Colonization . . . . . . 283 

5 Isolation of Endophytes . . . . . . . . . . . . . . . . . . . . 284 

6 Molecular Characterization of Endophytes . . . . . . . . . . 285 

7 Are Endophytes Responsible for Host Exclusivity/ 

Recurrence in Saprobic Fungi? . . . . . . . . . . . . . . . . . 286 

8 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . 287 


Contents XV 

18 Mycorrhizal Development and Cytoskeleton . . . . . . . . . 293 

Marjatta Raudaskoski, Mika Tarkka and Sara Niini 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 293 

2 Cytoskeletal Components . . . . . . . . . . . . . . . . . . . 293 

2.1 Expression of Tubulin-Encoding Genes . . . . . . . . . . . . 294 

2.2 Expression of Actin-Encoding Genes . . . . . . . . . . . . . 297 

3 Organization of Cytoskeleton in Endomycorrhiza . . . . . . 298 

3.1 Root Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . 298 

3.2 Fungal Hyphae . . . . . . . . . . . . . . . . . . . . . . . . . 300 

4 Organization of Cytoskeleton in Ectomycorrhiza . . . . . . 300 

4.1 Root Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . 300 

4.2 Fungal Hyphae . . . . . . . . . . . . . . . . . . . . . . . . . 304 

5 Regulation of Actin Cytoskeleton Organization 

in Fungal Hyphae and Plant Cells . . . . . . . . . . . . . . . 305 

6 Actin Binding-Proteins . . . . . . . . . . . . . . . . . . . . . 307 

7 Microtubule-Associated Proteins . . . . . . . . . . . . . . . 308 

7.1 Plant Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . 308 

7.2 Fungal Hyphae . . . . . . . . . . . . . . . . . . . . . . . . . 310 

8 Cell Cycle and Cytoskeleton in Mycorrhiza . . . . . . . . . . 313 

9 Cytoskeletal Research Methods . . . . . . . . . . . . . . . . 315 

9.1 Indirect Immunofluorescence Microscopy . . . . . . . . . . 316 

9.2 Microinjection Method . . . . . . . . . . . . . . . . . . . . . 317 

9.3 Green Fluorescence Protein Technique . . . . . . . . . . . . 317 


19 Functional Diversity of Arbuscular Mycorrhizal Fungi 

on Root Surfaces . . . . . . . . . . . . . . . . . . . . . . . . 331 

M. Zakaria Solaiman and Lynette K. Abbott 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 331 

2 Mycorrhiza Formation and Ecological Specificity . . . . . . 332 

2.1 Establishment of the Symbiosis . . . . . . . . . . . . . . . . 333 

2.2 Spore Germination and Hyphal Growth . . . . . . . . . . . 333 

2.3 Role of Plant Root Exudates . . . . . . . . . . . . . . . . . . 333 

3 Functioning of Arbuscular Mycorrhizas 

in Nutrient Exchange . . . . . . . . . . . . . . . . . . . . . . 334 

3.1 Metabolic Activity During Mycorrhiza Formation . . . . . . 335 

3.2 Gene Expression During Mycorrhiza Formation . . . . . . . 336 

3.3 Nutrient Exchange Mechanisms in Arbuscular Mycorrhizas 336 

4 Functional Diversity of Arbuscular Mycorrhizal Fungi 

in Root and Hyphal Interactions . . . . . . . . . . . . . . . . 338

XVI 

Contents 

4.1 Diversity of Arbuscular Mycorrhizal Fungi Inside Roots . . 339 

4.2 Relationship Between Hyphae in the Root and in the Soil . . 340 

5 Role of Arbuscular Mycorrhizal Fungi Associated 

with Roots in Soil Aggregation . . . . . . . . . . . . . . . . . 340 

6 Environmental Influence on Functional Diversity 

of Arbuscular Mycorrhizal Fungi . . . . . . . . . . . . . . . 341 

7 Role of Plant Mutants in Studying the Interactions 

Between Arbuscular Mycorrhizal Fungi and Roots . . . . . 341 

8 Conclusion and Future Research Needs . . . . . . . . . . . . 343 


20 Mycorrhizal Fungi and Plant Growth 

Promoting Rhizobacteria . . . . . . . . . . . . . . . . . . . 351 

José-Miguel Barea, Rosario Azcón 

and Concepción Azcón-Aguilar 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 351 

2 Main Types of Rhizosphere Microorganisms . . . . . . . . . 352 

3 Mycorrhizal Fungi . . . . . . . . . . . . . . . . . . . . . . . . 353 

4 Plant Growth Promoting Rhizobacteria . . . . . . . . . . . . 354 

5 Reasons for Studying Arbuscular Mycorrhizal Fungi 

and Plant Growth Promoting Rhizobacteria Interactions 

and Main Scenarios . . . . . . . . . . . . . . . . . . . . . . . 356 

6 Effect of Plant Growth Promoting Rhizobacteria 

on Mycorrhiza Formation . . . . . . . . . . . . . . . . . . . 357 

7 Effect of Mycorrhizas on the Establishment of Plant 

Growth Promoting Rhizobacteria in the Rhizosphere . . . . 357 

8 Interactions Involved in Nutrient Cycling and Plant 

Growth Promotion . . . . . . . . . . . . . . . . . . . . . . . 359 

9 Interactions for the Biological Control of Root Pathogens . . 361 


21 Carbohydrates and Nitrogen: Nutrients 

and Signals in Ectomycorrhizas . . . . . . . . . . . . . . . . 373 

Uwe Nehls 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 373 

2 Trehalose Utilization by Ectomycorrhizal Fungi . . . . . . . 374 

3 Carbohydrate Uptake . . . . . . . . . . . . . . . . . . . . . . 374 

4 Carbohydrate Metabolism . . . . . . . . . . . . . . . . . . . 376 

5 Carbohydrate Storage . . . . . . . . . . . . . . . . . . . . . . 376

Contents XVII 

6 Carbohydrates as Signal, Regulating Fungal 

Gene Expression in Ectomycorrhizas . . . . . . . . . . . . . 377 

7 Nitrogen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 380 

8 Utilization of Inorganic Nitrogen . . . . . . . . . . . . . . . 381 

9 Utilization of Organic Nitrogen . . . . . . . . . . . . . . . . 382 

10 Proteolytic Activities of Ectomycorrhizal Fungi . . . . . . . 383 

11 Uptake of Amino Acids . . . . . . . . . . . . . . . . . . . . . 383 

12 Regulation of Fungal Nitrogen Export in Mycorrhizas 

by the Nitrogen-Status of Hyphae . . . . . . . . . . . . . . . 385 

13 Carbohydrate and Nitrogen-Dependent Regulation 

of Fungal Gene Expression . . . . . . . . . . . . . . . . . . . 385 

14 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . 385 


22 Nitrogen Transport and Metabolism 

in Mycorrhizal Fungi and Mycorrhizas . . . . . . . . . . . . 393 

Arnaud Javelle, Michel Chalot, Annick Brun 

and Bernard Botton 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 393 

1.1 Ecological Significance of Ectomycorrhizas . . . . . . . . . 393 

1.2 Nitrogen Uptake and Translocation by Ectomycorrhizas . . 394 

2 Nitrate and Nitrite Transport . . . . . . . . . . . . . . . . . . 395 

2.1 Uptake Kinetics . . . . . . . . . . . . . . . . . . . . . . . . . 395 

2.2 Characterization of Nitrate and Nitrite Transporters . . . . 395 

3 Ammonium Transport . . . . . . . . . . . . . . . . . . . . . 398 

3.1 Physico-Chemical Properties of Ammonium: 

Active Uptake Versus Diffusion . . . . . . . . . . . . . . . . 398 

3.2 Physiology of Ammonium Transport in Ectomycorrhizas . . 399 

3.3 Isolation of Ammonium Transporter Genes . . . . . . . . . 400 

3.4 Regulation of the Ammonium Transporters . . . . . . . . . 400 

3.5 Other Putative Functions of Ammonium Transporters . . . 402 

4 Amino Acid Transport . . . . . . . . . . . . . . . . . . . . . 403 

4.1 Utilization of Amino Acids by Ectomycorrhizal Partners . . 403 

4.2 Molecular Regulation of Amino Acid Transport . . . . . . . 404 

5 Reduction of Nitrate to Nitrite and Ammonium . . . . . . . 405 

5.1 Reduction of Nitrate to Nitrite . . . . . . . . . . . . . . . . . 405 

5.2 Reduction of Nitrite to Ammonium . . . . . . . . . . . . . . 406 

5.3 Molecular Characterization of Nitrate Reductase 

and Nitrite Reductase . . . . . . . . . . . . . . . . . . . . . . 406 

6 Assimilation of Ammonium . . . . . . . . . . . . . . . . . . 409 

6.1 Role and Properties of Glutamate Dehydrogenase . . . . . . 410

XVIII 

6.2 Role and Properties of Glutamine Synthetase . . . . . . . . 413 

6.3 Role and Properties of Glutamate Synthase . . . . . . . . . . 415 

7 Amino Acid Metabolism . . . . . . . . . . . . . . . . . . . . 417 

7.1 Utilization of Proteins by Ectomycorrhizal Fungi 

and Ectomycorrhizas . . . . . . . . . . . . . . . . . . . . . . 417 

7.2 Amino Acids Used as Nitrogen and Carbon Sources . . . . . 418 

8 Conclusion and Future Prospects . . . . . . . . . . . . . . . 419 


Section E 

Contents 

23 Visualisation of Rhizosphere Interactions 

of Pseudomonas and Bacillus Biocontrol Strains . . . . . . 431 

Thomas F.C. Chin-A-Woeng, Anastasia L. Lagopodi, 

Ine H.M. Mulders, Guido V. Bloemberg 

and Ben J.J. Lugtenberg 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 431 

2 Tomato Foot and Root Rot and the Need 

for Biological Control . . . . . . . . . . . . . . . . . . . . . . 431 

3 Selection of Antagonistic Strains . . . . . . . . . . . . . . . 432 

3.1 Selection of Antagonistic Pseudomonas and Bacillus sp. . . . 432 

3.2 In Vitro Antifungal Activity Test . . . . . . . . . . . . . . . . 434 

4 In Vivo Biocontrol Assays . . . . . . . . . . . . . . . . . . . . 434 

4.1 Fusarium oxysporum—Tomato Biocontrol Assay 

in a Potting Soil System . . . . . . . . . . . . . . . . . . . . . 434 

4.2 Gnotobiotic Fusarium oxysporum–Pythium ultimum 

and Rhizoctonia solani–Tomato Bioassays . . . . . . . . . . 435 

5 Microscope Analysis of Infection and Biocontrol . . . . . . 435 

5.1 Marking Fungi with Autofluorescent Proteins . . . . . . . . 437 

5.2 Marking Rhizosphere Bacteria with Autofluorescent 

Proteins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 438 

5.3 Confocal Laser Scanning Microscopy 

of Rhizosphere Interactions . . . . . . . . . . . . . . . . . . 442 

6 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . 443 


Contents XIX 

24 Microbial Community Analysis in the Rhizosphere 

by in Situ and ex Situ Application of Molecular Probing, 

Biomarker and Cultivation Techniques . . . . . . . . . . . . 449 

Anton Hartmann, Rüdiger Pukall, 

Michael Rothballer, Stephan Gantner, 

Sigrun Metz, Michael Schloter and Bernhard Mogge 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 449 

2 In Situ Studies of Microbial Communities Using 

Specific Fluorescence Labeling and Confocal 

Laser Scanning Microscopy . . . . . . . . . . . . . . . . . . 451 

2.1 Fluorescence in Situ Hybridization . . . . . . . . . . . . . . 451 

2.2 Immunofluorescence Labeling Combined with 

Fluorescence in Situ Hybridization . . . . . . . . . . . . . . 453 

2.3 Application of Fluorescence Tagging and Reporter 

Constructs . . . . . . . . . . . . . . . . . . . . . . . . . . . . 456 

3 Ex Situ Studies of Microbial Communities 

After Separation of Rhizosphere Compartments . . . . . . . 457 

3.1 Recovery of Bacteria from Bulk Soil, Ecto- and 

Endorhizosphere . . . . . . . . . . . . . . . . . . . . . . . . 457 

3.2 Community Analysis by Cultivation and Dot Blot Studies . . 458 

3.3 Community Analysis by Fluorescence 

in Situ Hybridization on Polycarbonate Filters . . . . . . . . 460 

3.4 Community Analysis by (RT) PCR-Amplification 

of Phylogenetic Marker Genes, D/TGGE-Fingerprinting 

and Clone Bank Studies . . . . . . . . . . . . . . . . . . . . . 461 

3.5 Community Analysis by Fatty Acid Pattern 

and Community Level Physiological Profile Studies . . . . . 463 

4 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . 463 


25 Methods for Analysing the Interactions Between Epiphyllic 

Microorganisms and Leaf Cuticles . . . . . . . . . . . . . . 471 

Daniel Knoll and Lukas Schreiber 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 471 

2 Physical Characterisation of Cuticle Surfaces 

by Contact Angle Measurements . . . . . . . . . . . . . . . . 471 

3 Chemical Characterisation of Cuticle Surfaces . . . . . . . . 473 

4 A New in Vitro System for the Study 

of Interactions Between Microbes and Cuticles . . . . . . . 475

XX 

Contents 

4.1 Isolated Cuticles as Model Surfaces for Phyllosphere Studies 475 

4.2 Enzymatic Isolation of Plant Cuticles . . . . . . . . . . . . . 476 

4.3 The Experimental Set-Up of the System . . . . . . . . . . . . 476 

4.4 Inoculation of Cuticular Membranes 

with Epiphytic Microorganisms . . . . . . . . . . . . . . . . 477 

4.5 Measurement of Changes in Cuticular Transport Properties 479 

4.6 Measuring Penetration of Microorganisms 

Through Cuticular Membranes . . . . . . . . . . . . . . . . 481 

4.7 Determination of the Viable Cell Number 

on the Cuticle Surface . . . . . . . . . . . . . . . . . . . . . . 483 

4.8 Microscopic Visualisation of Microorganisms on the Cuticle 483 

5 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . 486 


26 Quantifying the Impact of ACC Deaminase-Containing 

Bacteria on Plants . . . . . . . . . . . . . . . . . . . . . . . . 489 

Donna M. Penrose and Bernard R. Glick 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 489 

2 Selection of Bacterial Strains that Contain ACC Deaminase . 489 

3 Culture Conditions for the Induction 

of Bacterial ACC Deaminase Activity . . . . . . . . . . . . . 491 

4 Gnotobiotic Root Elongation Assay . . . . . . . . . . . . . . 492 

5 Measurement of ACC Deaminase Activity . . . . . . . . . . 493 

5.1 Assay of ACC Deaminase Activity in Bacterial Extracts . . . 494 

6 Measurement of ACC in Plant Roots, Seed Tissues 

and Seed Exudates . . . . . . . . . . . . . . . . . . . . . . . 495 

6.1 Collection of Canola Seed Tissue and Exudate 

During Germination . . . . . . . . . . . . . . . . . . . . . . 495 

6.2 Preparation of Plant Extracts . . . . . . . . . . . . . . . . . 496 

6.3 Protein Concentration Assay . . . . . . . . . . . . . . . . . . 497 

6.4 Measurement of ACC by HPLC . . . . . . . . . . . . . . . . . 498 


Contents XXI 

27 Applications of Quantitative Microscopy in Studies 

of Plant Surface Microbiology . . . . . . . . . . . . . . . . . 503 

Frank B. Dazzo 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 503 

2 Quantitation of Symbiotic Interactions Between 

Rhizobium and Legumes by Visual Counting Techniques . . 504 

2.1 The Modified Fåhraeus Slide Culture Technique 

for Studies of the Root—Nodule Symbiosis . . . . . . . . . . 504 

2.2 Attachment of Rhizobia to Legume Root Hairs . . . . . . . . 506 

2.3 Rhizobium-Induced Root Hair Deformations . . . . . . . . 508 

2.4 Primary Entry of Rhizobia into Legume Roots . . . . . . . . 509 

2.5 In Situ Molecular Interactions Between Legumes 

Roots and Surface-Colonizing Rhizobia . . . . . . . . . . . . 511 

2.6 Cross-Reactive Surface Antigens and Trifoliin A Host Lectin 511 

2.7 Rhizobium Acidic Heteropolysaccharides . . . . . . . . . . . 513 

2.8 Rhizobium Lipopolysaccharides . . . . . . . . . . . . . . . . 516 

2.9 Chitolipooligosaccharide Nod Factors . . . . . . . . . . . . 518 

2.10 Epidermal Pit Erosions . . . . . . . . . . . . . . . . . . . . . 522 

2.11 Elicitation of Root Hair Wall Peroxidase by Rhizobia . . . . 524 

2.12 In Situ Gene Expression . . . . . . . . . . . . . . . . . . . . 525 


Rhizobium and Legumes by Image Analysis . . . . . . . . . 526 

3.1 Definitive Elucidation of the Nature of Rhizobium 

Extracellular Microfibrils . . . . . . . . . . . . . . . . . . . . 526 

3.2 Rhizobial Modulation of Root Hair Cytoplasmic Streaming 527 

3.3 Motility of Rhizobia in the External Root Environment . . . 527 

3.4 Root Hair Alterations Affecting Their Dynamic 

Growth Extension and Primary Host Infection . . . . . . . . 528 

4 A Working Model for Very Early Stages of Root 

Hair Infection by Rhizobia . . . . . . . . . . . . . . . . . . . 529 

5 Improvements in Specimen Preparation and 

Imaging Optics for Plant Rhizoplane Microbiology . . . . . 529 

6 CMEIAS: A New Generation of Image Analysis 

Software for in Situ Studies of Microbial Ecology . . . . . . 531 

6.1 CMEIAS v. 1.27: Major Advancements in Bacterial 

Morphotype Classification . . . . . . . . . . . . . . . . . . . 531 

6.2 CMEIAS v. 3.0: Comprehensive Image Analysis 

of Microbial Communities . . . . . . . . . . . . . . . . . . . 532 

6.3 CMEIAS v. 3.0: Plotless and Plot-Based Spatial 

Distribution Analysis of Root Colonization . . . . . . . . . . 533 

6.4 CMEIAS v. 3.0: In Situ Analysis of Microbial 

Communities on Plant Phylloplanes . . . . . . . . . . . . . . 535

XXII 

Contents 

6.5 CMEIAS v. 3.0: In Situ Geostatistical Analysis 

of Root Colonization by Pioneer Rhizobacteria . . . . . . . 540 

6.6 CMEIAS v. 3.0: Quantitative Autecological Biogeography 

of the Rhizobium–Rice Association . . . . . . . . . . . . . . 541 

6.7 CMEIAS v. 3.0: Spatial Scale Analysis of in Situ 

Quorum Sensing by Root-Colonizing Bacteria . . . . . . . . 543 

7 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . 544 


28 Analysis of Microbial Population Genetics . . . . . . . . . . 551 

Emanuele G. Biondi, Alessio Mengoni 

and Marco Bazzicalupo 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 551 

2 Materials for RAPD, AFLP and ITS . . . . . . . . . . . . . . 552 

3 RAPD . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 553 

4 AFLP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 556 

5 ITS-RFLP Analysis . . . . . . . . . . . . . . . . . . . . . . . 559 

6 Statistical analysis . . . . . . . . . . . . . . . . . . . . . . . . 561 

7 Concluding Remarks . . . . . . . . . . . . . . . . . . . . . . 563 


29 Functional Genomic Approaches for Studies 

of Mycorrhizal Symbiosis . . . . . . . . . . . . . . . . . . . 567 

Gopi K. Podila and Luisa Lanfranco 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 567 

2 Material and Methods . . . . . . . . . . . . . . . . . . . . . . 568 

2.1 Equipment . . . . . . . . . . . . . . . . . . . . . . . . . . . . 568 

2.2 Biological Material . . . . . . . . . . . . . . . . . . . . . . . 569 

2.3 RNA Extraction . . . . . . . . . . . . . . . . . . . . . . . . . 569 

3 RNA Quantification . . . . . . . . . . . . . . . . . . . . . . . 570 

3.1 Construction of a cDNA Library . . . . . . . . . . . . . . . . 570 

4 Conversion Protocol . . . . . . . . . . . . . . . . . . . . . . 577 

4.1 Evaluation of the Quality of the cDNA Library . . . . . . . . 577 

5 Troubleshooting . . . . . . . . . . . . . . . . . . . . . . . . . 578 

6 Sequencing Strategies . . . . . . . . . . . . . . . . . . . . . . 578 

6.1 Data Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . 579 

6.2 Sequence Homology Comparisons . . . . . . . . . . . . . . 579

Contents XXIII 

6.3 Examples of Expressed Sequence Tag Data Analysis . . . . . 579 

7 Macroarrays . . . . . . . . . . . . . . . . . . . . . . . . . . . 582 

7.1 PCR Amplification of cDNA Inserts . . . . . . . . . . . . . . 582 

7.2 Purification and Quantification of PCR Products . . . . . . 583 

7.3 Printing of Macroarrays . . . . . . . . . . . . . . . . . . . . 583 

7.4 Generation of Exponential cDNA Probes from 

RNA for Macroarrays and Hybridization Analysis . . . . . . 584 

7.5 Exponential Amplification of the sscDNAs . . . . . . . . . . 585 

8 Generation of Radiolabeled Probes . . . . . . . . . . . . . . 585 

9 Hybridization of Macroarrays to Radiolabeled Probes . . . 586 

10 Data Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . 586 

10.1 Data Analysis Autoradiography Images on X-ray Films . . . 587 

11 Example of Laccaria bicolor Macroarrays . . . . . . . . . . . 588 

12 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . 590 


30 Axenic Culture of Symbiotic Fungus Piriformospora indica 593 

Giang Huong Pham, Rina Kumari, Anjana Singh, 

Rajani Malla, Ram Prasad, Minu Sachdev, 

Michael Kaldorf, Francois Buscot, Ralf Oelmuller, 

Rüdiger Hampp, Anil Kumar Saxena, Karl-Heinz Rexer, 

Gerhard Kost and Ajit Varma 

1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . 593 

2 Morphology . . . . . . . . . . . . . . . . . . . . . . . . . . . 593 

3 Taxonomy of the Fungus . . . . . . . . . . . . . . . . . . . . 595 

4 Chlamydospore Formation and Germination . . . . . . . . 597 

5 Cultivation . . . . . . . . . . . . . . . . . . . . . . . . . . . . 597 

6 Carbon and Energy Sources . . . . . . . . . . . . . . . . . . 600 

7 Biomass on Individual Amino Acids . . . . . . . . . . . . . . 604 

8 Growth on Complex Media . . . . . . . . . . . . . . . . . . . 604 

9 Phosphatic Nutrients . . . . . . . . . . . . . . . . . . . . . . 605 

10 Composition of Media . . . . . . . . . . . . . . . . . . . . . 606 

11 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . 612 


Subject Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 615

Contributors 

Abbott, Lynette K. 

School of Earth and Geographical 

Sciences 

Faculty of Natural and Agricultural 

Sciences 


Crawley, WA 6009 

Australia 

(e-mail: labbott@cyllene.uwa.edu.au) 

Andrade, Galdino 

State University of Londrina, CCB 

Dept of Microbiology 

Microbial Ecology Laboratory 

PO Box 6001 

86051-990 Londrina, PR 

Brazil 

(e-mail: andradeg@uel.br) 

Azcón, Rosario 

Departamento de Microbiología del 

Suelo y Sistemas Simbióticos 

Estación Experimental del Zaidín 

CSIC 

Prof. Albareda 1 

18008 Granada 

Spain 

Azcón-Aguilar, Concepción 




CSIC 


18008 Granada 

Spain 

Bacon, Charles W. 

Department of Agriculture 

Agriculture Research Service 

Athens, Georgia 

USA 

Barea, José-Miguel 




CSIC 


18008 Granada 

Spain 

(e-mail: josemiguel.barea@eez.csic.es) 

Bauer, Robert 

Universität Tübingen 

Lehrstuhl Spezielle Botanik 

und Mykologie 

Auf der Morgenstelle 1 


Germany 

(e mail: robert.bauer 

@uni-tuebingen.de) 

Bazzicalupo, Marco 

Dipartimento di Biologia Animale e 

Genetica ‘Leo Pardi’ 

Via Romana 17 

50125 Firenze 

Italy 

(email: marcobazzi@dbag.unifi.it)

XXVI 

Contributors 

Belanger, Faith 

Department of Plant Biology 

and Pathology 

Cook College-Rutgers University 

New Brunswick, New Jersey 

USA 

Biondi, Emanuele G. 



Via Romana 17 

50125 Firenze 

Italy 

Bloemberg, Guido V. 

Leiden University 

Institute of Biology 

Wassenaarseweg 64 

2333 AL Leiden 

The Netherlands 

Botton, Bernard 

University Henri Poincaré Nancy 1 

Faculty of Sciences and Techniques 

UMR INRA-UHP no. 1136 

B.P. 236 

54506 Vandoeuvre-Les-Nancy Cedex 

France 

(e-mail: Bernard.Botton 

@scbiol.uhp-nancy.fr) 

Brun, Annick 




B.P. 236 


France 

Buscot, François 

Institute of Ecology 

Department of Environmental Sciences 

University of Jena 

Dornburger Strasse 159 

07743 Jena, Germany 

Present address: Institute of Botany 

Department of Terrestrial Ecology 

University of Leipzig 

Johannisallee 21 

04103 Leipzig 

Germany 

Chalot, Michel 




B.P. 236 


France 

Chin-A-Woeng, Thomas F.C. 






(email: chin@rulbim.leidenuniv.nl) 

Conrad, Ralf 

Max-Planck-Institut für Terrestrische 

Mikrobiologie 

Marburg, Germany 

(e-mail: conrad@staff.uni-marburg.de) 

Dazzo, Frank B. 

Center for Microbial Ecology 

Department of Microbiology and Molecular 

Genetics 

Michigan State University 

East Lansing, MI 48824, 

USA 

(e-mail: dazzo@msu.edu) 

Declerck, Stephané 

Unité de Microbiologie 

Mycothèque de l’Université catholique de 

Louvain 

Université catholique de Louvai 

3 Place Croix du Sud 

1348 Louvain-la-Neuve 

Belgium 

Gantner, Stephan 

GSF–National Research Center for Environment 

and Health 

Institute of Soil Ecology 

Ingolstädter Landstrasse 1 

85764 Neuherberg/München 

Germany

Ghimire, Sita R. 

Centre for Research in Fungal Diversity 

Department of Ecology and Biodiversity 

The University of Hong Kong 

Pokfulam Road, Hong Kong 

Hong Kong SAR 

PR China 

Glick, Bernard R. 

Department of Biology 

University of Waterloo, Waterloo 

Ontario, Canada N2L 3G1 

(e-mail: glick@sciborg.uwaterloo.ca) 

Hampp, Rüdiger 

Institute of Botany 

Department of Physiological Ecology of 

Plants 




Germany 

(e-mail: ruediger.hampp 


Hartmann, Anton 


and Health 




Germany 

(e-mail: anton.hartmann@gsf.de) 

Hehl, Solveig 

Application Specialist 

Advanced Imaging Microscopy 

Carl Zeiss Jena GmbH 

Carl-Zeiss-Promenade 10 

07745 Jena 

Germany 

Herrmann, Sylvie 





07743 Jena 

Germany 

Contributors XXVII 

Hyde, Kevin D. 

Centre for Research in Fungal Diversity 

Department of Ecology and Biodiversity 

The University of Hong Kong 

Pokfulam Road, Hong Kong 

Hong Kong SAR 

PR China 

(e-mail: kdhyde@hkucc.hku.hk) 

Javelle, Arnaud 




B.P. 236 


France 

Kaldorf, Michael 





07743 Jena, Germany 

Present address: Institute of Botany 

Department of Terrestrial Ecology 

University of Leipzig 

Johannisallee 21 

04103 Leipzig 

Germany 

(e-mail: kaldorf@rz.uni-leipzig.de) 

Knoll, Daniel 

Institut für Allgemeine Botanik 

Angewandte Molekularbiologie 

der Pflanzen 

Universität Hamburg 

Ohnhorststrasse 18 

22609 Hamburg 

Germany 

Kost, Gerhard 

FB Biologie 

Spezielle Botanik und Mykologie 

Philipps-Universität Marburg 

35032 Marburg 

Germany 

Kothamasi, David Manohar 

Department of Microbiology 

University of Delhi South Campus 

Benito Juarez Road 

New Delhi 110 021, India

XXVIII 

Contributors 

Kottke, Ingrid 

Fakultät für Biologie 

Botanisches Institut 

Spezielle Botanik 

Mykologie und Botanischer Garten 




Germany 

(e-mail: ingrid.kottke 


Krimm, Ursula 

Institut für Zelluläre und Molekulare 

Botanik (IZMB) 

Abteilung Ökophysiologie 

Universität Bonn 

Kirschallee 1 

53115 Bonn 

Germany 

Kuhad, Ramesh Chander 

Department of Microbiology 

University of Delhi South Campus 

Benito Juarez Road 

New Delhi 110 021 

India 

(e-mail: kuhad@hotmail.com) 

Kumari, Rina 

School of Life Sciences 

Jawaharlal Nehru University 

New Delhi 110067 

India 

Lagopodi, Anastasia L. 






Lanfranco, Luisa 

Dipartimento di Biologia Vegetale dell’Università 

Viale Mattioli 25 

10125 Torino 

Italy 

Lewis, Elizabeth 


and Pathology 



USA 

Lugtenberg, Ben J.J. 






Luis, Patricia 





07743 Jena 

Germany 

Maier, Andreas 


Department of Physiological 

Ecology of Plants 




Germany 

Malla, Rajni 




India 

Mengoni, Alessio 



Via Romana 17 

50125 Firenze 

Italy 

Metz, Sigrun 


and Health 




Germany

Meyer, William 


and Pathology 



USA 

Mittag, Maria 

7Institute of General Botany 

Friedrich-Schiller-University Jena 

Am Planetarium 1 

07743 Jena 

Germany 

Mogge, Bernhard 


and Health 




Germany 

Moy, Melinda 


and Pathology 



USA 

Mulders, Ine H.M. 






Nehls, Uwe 

Physiologische Ökologie der Pflanzen 




Germany 

(e-mail: uwe.nehls@uni-tuebingen.de) 

Niini, Sara 

Department of Biosciences 

Plant Physiology 

P.O. Box 56 

00014 Helsinki University 

Finland 

Oberwinkler, Franz 


Lehrstuhl Spezielle Botanik 

und Mykologie 



Germany 

(e mail: franz.oberwinkler 


Oelmüller, Ralf 

Institute of General Botany 




07743 Jena 

Germany 

Penrose, Donna M. 



Ontario, Canada N2L 3G1 

Peskan, Tanja 

Institute of General Botany 




07743 Jena 

Germany 

Pham, Giang Huong 




India 

Podila, Gopi K. 

Department of Biological Sciences 

University of Alabama 

Huntsville, AL-35899 

USA 

(e-mail: podilag@email.uah.edu) 

Prasad, Ram 




India 

Contributors XXIX

XXX 

Contributors 

Pukall, Rüdiger 

DSMZ–German Collection of Microbes 

and Cell Cultures GmbH 

Mascheroder Weg 1b 

38124 Braunschweig 

Germany 

Raudaskoski, Marjatta 

Department of Biosciences 

Plant Physiology 

P.O. Box 56 

00014 Helsinki University 

Finland 

(e-mail: marjatta.raudaskoski 

@helsinki.fi) 

Rexer, Karl-Heinz 

FB Biologie 

Spezielle Botanik und Mykologie 

Philipps-Universität Marburg 

35032 Marburg 

Germany 

Rothballer, Michael 


and Health 




Germany 

Sachdev, Minu 




India 

Saxena, Anil Kumar 

Division of Microbiology 

Indian Agricultural Research Institute 


India 

Schloter, Michael 


and Health 




Germany 

Schreiber, Lukas 

Institut für Zelluläre und Molekulare 

Botanik (IZMB) 

Abteilung Ökophysiologie 

Universität Bonn 

Kirschallee 1 

53115 Bonn 

Germany 

(e mail: lukas.schreiber@uni-bonn.de) 

Singh, Ajay 



Ontario N2T 2J3 

Canada 

Singh, Anjana 




India 

Solaiman, M. Zakaria 

Soil Science and Plant Nutrition 

School of Earth and 

Geographical Sciences 

Faculty of Natural 

and Agricultural Sciences 


Crawley, WA 6009 

Australia 

Stabentheiner, Edith 

Institute for Plant Physiology 

Karl-Franzens University Graz 

University Street 51 

8010 Graz 

Austria 

Sullivan, Raymond 


and Pathology 



USA 

Tarkka, Mika 


Botanisches Institut 



Germany

Tripathi,K.K. 

Department of Biotechnology 

Ministry of Science and Technology 

C.G.O. Complex, Lodi Road 

New Delhi110 003 

India 

Varma, Ajit 




India 

(email: ajitvarma73@hotmail.com) 

Werner, Dietrich 

Fachbereich Biologie 

Fachgebiet Zellbiologie und 

Angewandte Botanik 

Philipps-University Marburg 

Germany 

(e-mail: werner@mailer.uni-marburg.de) 

Contributors XXXI 

White Jr., James F. 


and Pathology 



USA 

(e-mail: jwhite@AESOP.Rutgers.edu) 

Zhang, Chi 


Department of Physiological Ecology 

of Plants 




Germany

1 The State of the Art 

Ajit Varma, Lynette K. Abbott, Dietrich Werner 

and Rüdiger Hampp 

As we enter the second century of research on associative and symbiotic 

microorganisms, it is heartening to see that attention is increasingly focused 

on the functions of these organisms in the natural and semi-natural systems 

in which it evolved. This volume, while encapsulating the spirit of the new 

adventure, also provides two further opportunities. It enables us to assess the 

strength of the platform from which we launch into this challenging area 

and to identify which experimental approaches might provide the most realistic 

evaluation of the roles played by surface microorganisms in natural 

communities. The long and difficult climb towards understanding the 

impacts of the microflora upon the species composition and dynamics, 

above and below ground, of plant communities is just beginning. This volume 

demonstrates both the strength and the weakness of the position from 

which we launch into the future. The strength may be that we have much 

precise information about microbial function under simplified conditions. 

The weakness, on the other hand, is that we have, as yet, little reliable information 

about the extent to which these functions are expressed under relevant, 

essentially multi-factorial circumstances of the kind that prevail in 

nature. The plant carries its major microbial community on its entire 

exposed surfaces, from apical tip to root cap. These plant surfaces represent 

an oozing, flaking layer of integument which discharges a wide range of substances 

that support a vast number of spatially discrete and specialized 

microbial communities, including parasites and symbionts, which can have 

a major impact on plant growth and development. In today’s scenario the 

plant surface is considered as a dynamic adaptable envelope, flexible in both 

its own right and the first barrier between the moist, concentrated, balanced 

plant cell and a hostile ever-changing external environment. It is well known 

that the microbial diversity on the plant surface and in the soil habitats is 

much greater compared to the insight using cultivation techniques. Manipulation 

of the plant surface microflora to improve its health is a desirable and 

much needed goal in plant microbiology. However, efforts to exploit this 

type of biological control have frequently been impeded because of major 

Plant Surface Microbiology 

A.Varma, L. Abbott, D. Werner, R. Hampp (Eds.) 

© Springer-Verlag Berlin Heidelberg 2004

2 

Ajit Varma et al. 

technical difficulties that must be overcome in order to fully understand the 

microbial ecology of this ecosystem, especially the lack of ability to extract 

in situ data that are both informative and quantifiable at spatial scales relevant 

to the ecological niches of the microorganisms involved. The entire volume 

is divided into five broad sections. 

The combining aspect of the chapters in sections A and B are microbial 

communities in their interactions with higher plants. The communities are 

mainly dominated by a few species, however, a large number of other species 

may be equally important, although they are present only in the range of 1 % 

of the total population or less. Experimental studies concentrate, of course, on 

the major components of the communities. These representatives are also 

used for biotechnology purposes such as seed inoculation by Pseudomonas 

and Bacillus control strains (Chap. 2). The interactions of methanogens and 

methanotrophs independent of the plant photosynthesis and the plant root 

ecology is a major contribution to the global CH 4 cycle. These communities 

are especially present in anoxic sites in wetlands such as flooded rice fields. 

The different carbon sources affect the CH 4 to CO 2 ratio, an important aspect 

for the impact of different root components on the microbial communities in 

the rhizosphere, as described in Chapter 3. Abiotic factors also influence the 

colonization of Pseudomonas fluorescens on seeds and include, besides 

growth substrates, also temperature, soil humidity and pH (Chap. 3). The 

dynamics of microorganism populations in the rhizosphere is a topic where a 

large number of research groups worldwide are involved. This is related to the 

huge amount of organic carbon exudated from plant roots into the rhizosphere, 

in the order of 10 % or more of the total carbon assimilation by photosynthesis 

in higher plants. All major nutrient cycles such as the carbon cycle, 

the nitrogen cycle, the sulfur cycle, the phosphorus cycle and the cycle for 

micronutrients are much more active in this rhizosphere soil compared to the 

bulk soil. The enormous diversity in this microhabitat is increased by the fact 

that many different plant families and species exudate different sets of components 

into the soil. In addition, the composition of lignins and hemicellulose 

in the cell walls can be quite different, leading to a different composition 

of the rhizosphere communities (Chap. 4). More information on the major 

groups of microorganisms in soils in general are covered in Chapter 5, 

describing especially the impact of microorganisms on plant development by 

mycorrhiza species, actinorhiza species, plant growth-promoting rhizobacteria 

(PGPR), phosphate-solubilizing microorganisms and the important group 

of lignocellulolytic microorganisms. 

Biotic signals from the microsymbionts inducing symbiosis and nodule 

development in legumes are even more specific in determining the interaction 

of the plants with their specific associated bacteria such as Bradyrhizobium 

japonicum, Mesorhizobium loti, Sinorhizobium meliloti, Rhizobium 

tropici or Rhizobium etli. Flavonoids and nod factors (lipochitooligosaccharides) 

are the major components of the chemical language, in which the

1 The State of the Art 3 

microsymbionts and the host plants communicate to each other. The signalling 

concept studied in this type of symbiosis is equally complicated as the 

mammalian notch homologues and the integrin-adhesion-receptor signalling 

in other multicellular organisms (Chap. 6). A large stimulus for ongoing 

and future research in the area of plant surface microbiology will be 

available from the use of already completed genome projects and on-going 

genome projects for prokaryotic and eukaryotic organisms. At present, about 

145 genome projects are finished and more than 580 projects are on-going 

(http://wit.integratedgenomics.com/GOLD/gold.html). A list of completed 

genomes present in the public data bases, available in June 2003, is presented 

in Table 1. It is interesting to note that plant symbiotic and parasitic bacteria 

such as Bradyrhizobium japonicum, Mesorhizobium loti, Sinorhizobium 

meliloti and Pseudomonas synringae have the largest procaryotic genomes. 

On the other side, there are some animal pathogenic organisms like Rickettsia 

Table 1. Complete genomes present in the public DataBases, June 2003 

(http://wit.integratedgenomics.com/GOLD/gold.html) 

Organism Size (kb) ORF number 

Archaeal 

Methanosarcina mazei 4.096 3,371 orfs MAP 

Methanobacterium thermoautotrophicum 

Bacterial 

1.751 1,918 orfs MAP 

Bradyrhizobium japonicum 9.105 8.317 orfs MAP 

Mesorhizobium loti 7.596 6.752 orfs MAP 

Sinorhizobium meliloti 6.690 6.205 orfs MAP 

Nostoc sp. PCC 7120 6.413 5.366 orfs MAP 

Pseudomonas synringae 6.397 5.615 orfs MAP 

Pseudomonas aeruginosa 6.264 5.570 orfs MAP 

Escherichia coli 0157:H7, Sakai 5.594 5.448 orfs MAP 

Xanthomonas campestris pv. Campestris 5.076 4.182 orfs MAP 

Agrobacterium tumefaciens 4.915 5.402 orfs MAP 

Bacillus subtilis 4.214 4.099 orfs MAP 

Escherichia coli 0157:H7, EDI.933 4.100 5.283 orfs MAP 

Nitrosomonas europeae 2.812 2.573 orfs MAP 

Borrelia burgdorferi B 31 1.230 1.256 orfs MAP 

Rickettsia prowazekii 1.111 834 orfs MAP 

Chlamydia trachomatis 

Eukaryal 

1.042 896 orfs MAP 

Orysa sativa L. ssp. indica 420.000 50.000 orfs 

Oryza sativa ssp. japonica 420.000 50.000 orfs 

Arabidopsis thaliana 115.428 25.498 orfs 

Neurospora crassa 43.000 10.082 orfs 

Schizosaccharomyces pombe 14.000 4.824 orfs 

Saccharomyces cerevisiae 12.069 6.294 orfs

4 


prowazekii with only 1.1 Mb, Chlamydia trachomatis with 1.04 Mb and Borellia 

burgdorferi with 1.23 Mb. 

Bacillus thuringiensis and Bt transgenic plants are examples for biotechnology 

concentrated on a small number of well-studied soil microorganisms. 

The bio-insecticide protein is present only at a certain stage of sporulation in 

these organisms. Under natural conditions the spores have only a very limited 

survival time with less than 20 % present after 24 h (Chap. 7). The toxin from 

Bacillus thuringiensis released from transgenic plants in the soil is much more 

stable with 25 % still present after 120 days. The toxin is protected from degradation 

by linkage and adsorption to clay minerals. Many other important signal 

molecules produced by plants and microorganisms in the soil may also 

have very different half-life times by specific adsorption to soil minerals. The 

impact of increasing concentrations of these toxins in soils due to this biocontrol 

technique has not been sufficiently studied. Increases and decreases of 

specific subpopulations of soil microorganisms have been reported (Chap. 7). 

The other side of interactions, promotion instead of inhibition, is a topic of 

Chapter 8, which studies the mechanisms of plant growth-promoting rhizobacteria 

by phytohormones such as auxin and ethylene. An intermediate of 

ethylene synthesis is 1-aminocyclopropane-1-carboxylic acid (ACC). Microorganisms 

with an ACC deaminase gene increase stress tolerance of several 

plant species (Chap. 8). Compared to the rhizosphere, the communities in the 

phyllosphere have been studied less. The main reason is that the plant exudation 

from the rhizodermis is much larger than from the epidermis, due to the 

cuticles limiting carbon supply to the leaf surfaces. In contrast to bacteria, 

fungi have the ability to penetrate the cuticles and get access to carbon supplies 

(Chap. 9). Future work may concentrate especially on conditions where 

oligotrophic situations persist and genotypes adapted to these conditions 

may be present and not been recognized so far. The presence of animals in the 

interface of plants and microorganisms is another important aspect of communities, 

with the example of the Clavicipitaceae. It is very interesting to note 

that species of this family predominantly infect insects or the ancestors of 

grass-infecting species (Chap. 10). By sophisticated mechanisms, the fungi 

modify the plant tissues for nutrient acquisition. The shift from pathogenic 

interaction to mutualistic interaction in some species is a general aspect 

related to symbiosis and phytopathology. A completely new field of research 

has been developed, using the interaction of genetically modified plants 

(GMP) with microbial communities or specific microorganisms (Chap. 11). In 

the list of GMP species, important crop plants such as potatoes, maize, cotton, 

tobacco and alfalfa are used. The aspect of horizontal gene transfer (HGT) 

from GMP plants to associated bacterial species and fungal species is a topic 

for several biotechnology research projects. 

Section C deals with interactions between plants, fungi, and bacteria. The 

plant root constitutes an environment which forms the basis for multiple relationships 

with microorganisms. Fine roots of most plants are associated with


symbiotic fungi, which facilitate uptake of nutrients and water.An example of 

such a symbiotic interaction (termed mycorrhiza), which occurs mainly with 

roots of trees in temperate and alpine regions is ectomycorrhiza. The formation 

of the resulting symbiotic structure is commonly associated with 

changes in root morphology. Properties of the root surface are obviously an 

important parameter which determines the establishment of the physical 

contact with soil fungi. Chapter 12 gives an overview about the current knowledge 

on this topic with regard to the interaction of soil bacteria and ectomycorrhiza-forming 

fungi. This includes recent data on the effects of a co-cultivation 

of a range of soil bacteria (Actinomycetes) with an important and widely 

distributed ectomycorrhiza-forming fungus, Amanita muscaria, as part of a 

model system. A specific topic is the interference of a bacterial strain, which 

highly promotes fungal growth with the protein complement of the latter. 

Chapter 13 deals with respective root properties such as type of root (long/ 

short root) and surface chemistry. Here, hydrophobic cuticle layers obviously 

play an important role in hyphal attachment. In addition, compatible fungi 

are able to penetrate and digest this layer. How far this process is involved in 

altering the morphology of fungal hyphae when inside the root cortex (Hartig 

net formation) is discussed. As the data presented in this chapter originate 

mainly from ultrastructural investigations, possible pitfalls of such studies 

are also addressed. 

An integral part of root–fungus associations are soil bacteria. These can 

support the development of the root/fungus interaction by improving fungal 

root colonization, the availability of nutrients, or by producing exudates (e.g., 

antibiotics) which can prevent attacks of pathogenic microorganisms. While 

ectomycorrhizas only constitute a small fraction of all root/fungus interactions 

known, another form of this symbiosis, namely endomycorrhiza, dominates 

by far, and facilitates nutrient uptake of many crop plants. Fungi forming 

this type of mycorrhiza can usually not be cultured in the absence of a 

plant root. Chapter 14 focuses on structural studies of the interaction of these 

fungi with their host plants. Electron microscopy reveals interaction-specific 

structures such as fungal deposits and interactive vesicles, which can be used 

for diagnostic purposes. Piriformospora indica is possibly an exception 

because this fungus can be cultivated separately and forms structures comparable 

to those of endomycorrhizas. Chapter 15 deals with the diverse interactions 

of this fungus with roots from a variety of plants (from bryophytes to a 

wide range of angiosperms) and various groups of soil microorganisms, 

including bacteria of the rhizosphere (compare also Chap. 12) and other soil 

fungi such as Aspergillus or Gaeumannomyces (root pathogen). 

Interactions between smut fungi and their plant hosts are another topic of 

Section C. The term “smut fungus” characterizes fungi sharing similar organization 

and life strategies. As these fungi can considerably reduce crop 

yields, they are of economic importance. Most of them are members of the 

Ustilaginomycetes, which comprise a large number of species. Fungi can also

6 


parasite on other fungi. Basidiomycetes, e.g., include saprobes, mycorrhizaforming 

fungi, plant parasites, but also fungi which are parasites of other 

fungi. Hosts are both Basidiomycetes and Ascomycetes. Ultrastructural investigations 

of this kind of organismic interaction (Chap. 16) revealed two main 

types, the formation of colacosomes and the fusion between pathogen and 

host fungus cells. Colacosomes are unique organelles, which appear at the 

interface between parasite and host while fusion is based on specialized interactive 

cells (haustoria), which establish a direct cytoplasmic connection. 

Many microorganisms coexist with plants in ways that do not lead to plant 

disease, symbiosis, or other specific interactions. Some fungi or bacteria can 

be latent pathogens. Some have little or no influence on the plant, but may 

form toxic compounds that are damaging to grazing animals. Microorganisms 

that form more or less benign associations with plants are generally 

termed ‘endophytes’ and are genetically diverse. A large number of fungal 

endophytes can be difficult to identify because they include a high proportion 

with sterile mycelia (Chap. 17). Overall, the roles of many of these organisms 

are poorly understood. 

The mechanisms for entry of endophytic organisms into plants can be 

investigated using methodologies such as those applied to elucidate the 

cytoskeletal rearrangements of plant cells and fungal hyphae at the plant– 

microbe interface during colonization of roots by mycorrhizal fungi (Chap. 

18). Invading organisms have been shown to influence the expression of plant 

genes for some filamentous structures within the cell cytoskeleton. Indirect 

immunofluorescence microscopy has been used to investigate the cytoskeleton 

of some mycorrhizal associations demonstrating the separation and 

invagination of the plasma membrane from the plant cell wall in response to 

growth of fungi inside the cell wall. 

Colonization of plants by related and unrelated groups of microorganisms 

may occur simultaneously. For example, saprophytes, pathogens and mycorrhizal 

fungi may be associated with the same root systems and colonize roots 

to different degrees.Several species of arbuscular mycorrhizal fungi can simultaneously 

colonize the same sections of root,although they are generally separated 

in different cells or parts of the root cortex. Prior colonization by one 

organism can influence sequential colonization by other organisms. This 

occurs to varying degrees for different groups of plant endophytes, symbionts 

and pathogens. The relative extent to which roots become colonized by several 

species of arbuscular mycorrhizal fungi present in the same soil depends on 

the relative abundance of propagules of the fungi in the soil,the developmental 

stage of the hyphae associated with fungal propagules, the susceptibility of the 

roots to invasion and the physiological responses of the root to different 

species of fungi (Chap. 19). Investigations of the molecular communication 

between these fungi and their host plants during root colonization and nutrient 

acquisition are now beginning to be understood in terms of gene expression 

in plants and fungi. This provides a basis for predicting physiological


responses of plants to colonization by communities of arbuscular mycorrhizal 

fungi comprising species with different capacities to take up phosphorus from 

soil, transport it along hyphae and transfer it to the plant. 

When microbial communities are established in association with roots, 

they may be affected by changes in rooting patterns and exudates (Chap. 20). 

Introduction of plant growth promoting rhizobacteria (PGPRs) into the 

soil/plant/microbial environment can influence organisms already present 

(e.g., pathogenic and mycorrhizal fungi) in addition to the roots themselves. 

Techniques for microbial community fingerprinting are being adapted for 

assessment of PGPRs, in addition to in situ methods such as confocal laser 

scanning microscopy, to understand root – microbial associations from the 

perspective of communities of organisms that perform different, and sometimes 

contrasting, functions. 

Nutrients introduced into the rhizosphere from plants and decaying 

organic matter can influence physiological responses of microorganisms and 

their interactions with plants. Gene regulation in some ectomycorrhizal fungi 

has been shown to be altered in nutrient-limiting environments and this 

could have consequences for nutrient uptake and transfer to plants. For example, 

regulation of gene expression associated with some sugars has been 

shown to depend on the concentration of specific carbohydrates in the 

medium with threshold responses identified (Chap. 21). Expression of ammonium 

transporter genes can be stimulated for some fungi grown under nitrogen-limiting 

conditions and this could have important consequences for plant 

establishment in nitrogen-limiting natural ecosystems. Different patterns of 

gene regulation have been identified for the ectomycorrhizal fungus Amanita 

muscaria in relation to carbon and nitrogen nutrition. Some genes are regulated 

by both nitrogen and carbon nutrition, while others by either nitrogen 

or carbon (Chap. 21). Recent advances in the adaptation of molecular techniques 

to studies of plant and fungal biochemistry have contributed to understanding 

nitrogen metabolism in plants and microorganisms (Chap. 22). For 

some time, studies of nitrogen assimilation by ectomycorrhizal fungi have 

investigated nitrate and nitrite uptake kinetics, ammonium transport and 

amino acid transport. Techniques such as immunogold and 14 C labelling can 

now be combined with gene cloning to clarify physiological processes 

involved in nitrogen assimilation in ectomycorrhizal fungi to highlight their 

differences from saprophytic and pathogenic fungi. 

Section E deals with the sophisticated and novel techniques to formulate 

critical experiments and their design in order to retrieve excellent and reliable 

results. Background information for the selection of beneficial properties of 

Pseudomonas and Bacillus strains from the rhizospheric antagonistic to phytopathogenetic 

community requires elaboration, evaluation and bioassay 

(Chap. 23). After the selection of strains, these can be marked with a reporter 

gene and used to study cellular and molecular interactions between one or 

more beneficial microbes. These strains can also serve as a tool to study the

8 


interaction with soil-borne phytopathogens in the rhizosphere of their host 

plants. Autofluorescent proteins can be used for the noninvasive study of rhizosphere 

interactions using epifluorescence and confocal laser scanning 

microscopy (CSLM). Autofluorescent proteins have become an outstanding 

and convenient tool for studying rhizosphere and other in situ environmental 

interactions and have allowed microbiologists to visualize the spatial distribution 

of various microorganisms. The advent of fluorescent proteins offers a 

broad range of applications to track bacteria and study gene expression in the 

rhizosphere. The whole procedure of isolation, screening of antifungal activity, 

determining disease suppression in bioassays, preparation and transformation 

of protoplasts, allows fast isolation of potential biocontrol strains. The 

gnotobiotic test system has proven to be a valuable test system to study interactions 

between biocontrol bacteria, phytopathogen, and host plant. Combined 

with the use of autofluorescent proteins, it provides us with an extraordinary 

opportunity to study the intricate cellular and molecular interactions 

that the key players use to mediate their actions in the rhizosphere. In depth 

characterization of bacterial communities residing in environmental habitats 

has been greatly stimulated by the application of molecular phylogenetic 

tools such as 16S ribosomal RNA-directed oligonucleotide probes derived 

from extensive 16S rDNA sequence analysis. These phylogenetic probes are 

successfully applied in diverse microbial habitats using the fluorescent in situ 

hybridization (FISH) technique. In addition, the application of the immunofluorescence 

techniques to detect specific subpopulations or enzymes and of 

fluorescence marker-tagged bacteria or reporter constructs enables a highly 

resolving population and functional analysis. Phylogenetic in situ studies of 

the population structure can thus be supplemented with functional or phenotypic 

in situ investigation approaches. Two experimental approaches to investigate 

root-associated bacterial communities are presented in Chapter 24. On 

one hand, population and functional studies can be conducted directly in the 

rhizoplane (in situ) by combining specific fluorescence probing with confocal 

laser scanning microscopy yielding detailed information about the localization 

and small scale distribution of bacterial cells and their activities on the 

root surface. On the other hand, the separated rhizosphere compartments and 

the bacteria extracted from these different compartments allow a variety of 

subsequent ex situ studies. The separation into the three compartments, bulk 

soil, ectorhizosphere and rhizoplane/endorhizosphere, has to be performed 

with great care and actually needs an optimization for each plant and soil type 

under study. The degree by which adhering soil particles (ectorhizosphere) 

are included in the rhizosphere studies considerably influences the outcome 

of the study, since these soil particles are carrying a microbial community 

resembling, to a varying extent, the soil situation as compared to the root surface 

or rhizoplane situation. Certainly, in situ and ex situ studies (with separated 

rhizosphere compartments) both complement each other to give a more 

comprehensive picture. Although the microscopic in situ approach has the


great advantage of providing detailed spatial information about root surface 

colonization, quantitative and qualitative data about the structural and functional 

diversity of root colonization can be obtained by a variety of complimentary 

ex situ approaches. 

The plant cuticle forms the solid surface environment for epiphyllic microorganisms.Detailed 

analysis of a variety of microbe – cuticle interactions combining 

physicochemical, ecophysiological and microbial aspects are presented 

in Chapter 25.Isolated cuticles are excellent model surfaces to study the mechanisms 

of such interactions. Using the in vitro system, even minor changes in 

cuticular wax composition or permeability can be examined in relation to 

microbial growth.Working with entire leaves such changes would probably be 

masked by the physiological influence of the leaf.Therefore,this new approach 

might be very helpful to reveal possible mechanisms of interactions that occur, 

in reality, only in the scale of microhabitats. The impact of cuticular features 

will help us to understand the observed heterogeneous colonization of the leaf 

habitat and the formation of micro-colonies.Vice-versa the capacity of microbial 

cells to change cuticular properties might be of crucial importance for a 

successful colonization of the leaf surfaces and could contribute substantially 

to microbial fitness of individual epiphyllic species.Changes in cuticular properties 

in relation to microbial growth can be assessed in vitro under controlled 

conditions. Pseudomonas putida GR12-2, a well-known plant growth promoting 

strain, contains the enzyme 1-aminocyclopropane-1-carboxylic acid 

(ACC) deaminase. This enzyme hydrolyses ACC, the immediate precursor of 

ethylene in plant tissues.Ethylene is required for seed germination and the rate 

of ethylene production increases during germination and seedling growth. 

One model has been suggested where ACC deaminase containing growth-promoting 

bacteria can lower ethylene levels and thus stimulate plant growth. A 

rapid and novel procedure for the isolation of ACC deaminase-containing bacteria 

has been described in Chapter 26. In order to be able to test the model, a 

method for measuring ACC in plant tissues is described. Since all of the available 

methods for ACC quantification had problems and limitations associated 

with their use,Waters AccQ.Tag Method,designed to measure amino acids,was 

successfully applied for ACC analysis. This procedure is simple and relatively 

sensitive. 

The protocol for understanding Rhizobium-legume root nodule symbiosis 

has been taken up by various microscopy techniques including bright-field, 

phase contrast, Nomarski interference contrast, polarized light, real time and 

time-lapse video, dark-field, conventional and laser scanning confocal epifluorescence, 

scanning electron, transmission electron, and field-emission scanning/transmission 

electron microscopies combined with visual counting 

techniques and manual interactive applications of image analysis. A new generation 

of innovative, customized image analysis software-CMEIAS (Center 

for Microbial Ecology Image Analysis System), designed specific digital 

images of microbial populations and communities and extracted all the infor-

10 


mative, quantitative data of in vitro microbial ecology from them at spatial 

scales relevant to the microbes themselves. New computer-assisted imaging 

technology has been successfully applied to the fascinating field of plant surface 

microbiology (Chap. 27). CMEIAS software can “count what really 

counts” to enhance the quantitative analysis of microbial communities and 

populations in situ without cultivation. 

Knowledge of genetic diversity in the bacterial population has increased 

considerably over the last 15 years, due to the application of molecular techniques 

to microbial ecological studies. Among the molecular methods, the 

PCR-based techniques provide a powerful and high throughput approach for 

the study of genetic diversity in bacterial populations. Some of the most commons 

are the PCR-RFLP of specific sequences (16S rDNA, intergenic transcribed 

spacer, ITS), the repetitive extragenic palindromic-PCR and the BOX- 

PCR based on the presence of repetitive elements within the bacterial 

genome, the DNA amplification fingerprintings, RAPDs (random amplified 

polymorphic DNA, and AFLPs (amplified fragment length polymorphism). 

ITS, RAPD and AFLP have been shown to be particularly relevant for the 

study of genetic diversity within populations of bacteria belonging to the 

same or closely related species (Chap. 28). AFLP shows some advantages over 

the other methods due to high stringency PCR conditions which give reproducibility 

and easy application to plant, animal and bacterial genomic DNA. 

AFLP has a high informational content per single reaction, in fact, up to 100 

different bands can be displayed in a single lane and the scoring can be done 

with an automatic sequencer. 

While there is a considerable amount of knowledge based on the ecology 

and physiology of mycorrhizal fungi and their uses, the knowledge about cellular 

and molecular aspects leading to the growth and development of the 

mycorrhizal fungus, as well as the establishment of a functioning symbiosis is 

still limited. An appropriate approach to the study of these special fungi is to 

understand the molecular process leading to the host recognition, development 

and functioning of mycorrhiza through the analysis of expressed 

sequences.With the advent of many highly sophisticated techniques that have 

been successfully applied to the functional analysis of genes from many 

organisms, it is now possible to apply similar strategies to study the various 

aspects of the mycorrhizal symbiosis (Chap. 29). The protocol describes 

expressed sequence tags (EST) and macroarray techniques. These approaches 

provide efficient tools for mycorrhizal symbiosis research. They have the resolution 

and ability to obtain a more comprehensive view of various stages of 

mycorrhiza development or treatment effects due to nutritional changes or 

differences due to host responses. Data can be exchanged and compared 

between different laboratories and eventually will provide a platform to 

understand the key players (genes) that are markers for ectomycorrhizal and 

AM fungal symbiosis. A large number of media compositions are available in 

the literature for the cultivation of various groups of fungi, but almost no lit-


erature is available for axenic cultivation of symbiotic fungi. Chapter 30 deals 

with the possible methods and the tested media composition to cultivate Piriformospora 

indica. These media can be utilized to understand the morphological 

and functional properties, or to test possible biotechnological applications. 

Finally, for many groups of microorganisms, growth in axenic conditions is 

not yet possible. New methodologies for producing axenic cultures of the 

symbiotic fungus Piriformospora indica provide avenues for advancing the 

study of growth of other symbiotic organisms separately from their hosts. 

This is an important avenue of further studies, because it will allow us to 

understand a wider range of interactions between plants and can more closely 

reflect the enormous diversity of plant/microbe associations that exist in 

every environment.

2 Root Colonisation Following Seed Inoculation 

Thomas F.C. Chin-A-Woeng and Ben J.J. Lugtenberg 

1 Introduction 

This chapter provides protocols for the use of a gnotobiotic sand system to 

study root colonisation after seed inoculation. The complete experimental 

setup for a gnotobiotic system to grow plants for 7–14 days in the presence of 

inoculated bacteria or fungi is described. Subsequently, rhizosphere interactions 

and the in situ behaviour of inoculated organisms is visualised using 

autofluorescent proteins or other reporter systems. The behaviour of a good 

root-colonising Pseudomonas strain in this gnotobiotic system is described in 

terms of distribution, localisation, and root colonisation strategies as observed 

by microscopy. 

2 Bacterial Root Colonisation 

Microbial attachment to and proliferation on roots is generally referred to as 

root colonisation. Root colonisation is an important factor in plant pathogenesis 

of soil-borne microorganisms as well as in beneficial interactions used 

for microbiological control, biofertilisation, phytostimulation, and phytoremediation. 

Various methods for studying rhizosphere colonisation under axenic as 

well as under field soil conditions have been described and the experimental 

approaches taken often depend on the problems studied. In this chapter, we 

describe a method for studying bacterial colonisation of the plant root system 

after introduction by seed inoculation. This simple system can be extended to 

study the influence of individual biotic and abiotic factors such as those present 

in potting soil. 

Root colonisation is influenced by many variables. These factors can be 

biotic, such as genetic traits of the host plant and the colonising organism. For 

example, the possession of certain colonisation genes such as sss and/or 

colS/colR is necessary for efficient competitive root colonisation. In addition, 




14 

Thomas F.C. Chin-A-Woeng and Ben J. J. Lugtenberg 

abiotic factors, such as growth substrate, soil humidity, soil and rhizosphere 

pH, and temperature heavily influence root colonisation. The study of the 

molecular mechanism of root colonisation of a host plant by one or more bacterial 

strains is complicated due to many biotic and abiotic field-soil variables 

which can be difficult to control. The use of a gnotobiotic system limits the 

biological variation and results in more reliable and reproducible experimental 

data. However, since the purpose of colonisation studies is to learn about 

the processes which occur under realistic conditions, we always test interesting 

gnotobiotic results in field or potting soil. With only one exception, the 

gnotobiotic results also appear to be the case in soil. 

Various visualisation systems, including light and electron microscopy and 

confocal laser scanning microscopy (CLSM) combined with reporter systems 

such as those using genes for autofluorescent proteins, b-glucuronidase, and 

b-galactosidase allow us to determine numbers of bacteria on the root and 

follow the fate of inoculant bacteria in the spermosphere after seed inoculation 

and along the root system after growth. 

In this chapter, we will also focus on the genetic and metabolic burdens in 

the rhizosphere as a consequence of genetic modification of the organisms 

required to enable the marking, tracking, recovery, and selection of bacteria 

in and from the rhizosphere. The gnotobiotic system provides a reproducible 

method to study root colonisation in terms of strategies and competition. 

Afterwards, the data should be verified under more natural conditions as 

emphasised before. Various growth substrates including sand, potting soil, 

field soil, and stonewool have been successfully used in the root colonisation 

system presented in this chapter. The system has been extended by introducing 

soil-borne pathogens, which allows the study of interactions between 

pathogen, microbes, and host plants at the cellular level which may be important 

for applications such as biocontrol. 

3 Analysis of Tomato Root Tip Colonisation After Seed 

Inoculation Using a Gnotobiotic Assay 

3.1 Description of the Gnotobiotic System 

To assay colonisation, a gnotobiotic sand system comprised of two glass tubes 

is used. A silicone ring of 15 mm, cut from a silicone tube (25x35 mm, Rubber 

BV, Hilversum, The Netherlands), is placed around the top tube (outer diameter 

25 mm, inner diameter 21 mm, length 200 mm) at 5 cm from the end 

(Fig. 1). The same end is closed with gauze using a rubber band. This end is 

placed in a bottom tube (outer diameter 40 mm, inner diameter 35 mm, height 

95 mm) that contains 3 ml of water to prevent the tube content from desiccation. 

Subsequently, high quality quartz sand (quartz sand 0.1–0.3 mm; 

Wessem BV, Wessem, The Netherlands) is moisturised with plant nutrient

Fig. 1. Colonisation tube system (for explanation, 

see text) 

solution (PNS: 1.25 mM Ca(NO 3) 2, 1.25 mM KNO 3, 0.50 mM MgSO 4, 0.25 mM 

KH 2 PO 4 and trace elements (0.75 mg/l KI, 3.00 mg/l H 3 BO 3 , 10.0 mg/l 

MnSO 4◊H 2O, 2.0 mg/l ZnSO 4◊5H 2O, 0.25 mg/l Na 2MoO 4◊2H 2O, 0.025 mg/l 

CuSO 4 ◊5H 2 O, 0.025 mg/l CoCl 2 ◊6H 2 O, pH adjusted to 5.8; 10 % v/w).After thorough 

mixing, the top tubes are loosely filled with about 60 g of moisturised 

sand and closed with a cotton plug. The entire system is sterilised at 120 °C for 

20 min. 

3.2 Seed Disinfection 

2 Root Colonisation Following Seed Inoculation 15 

Many ways have been described to disinfect the surface of seeds of various 

crop plants without causing notable decreased seed germination efficiency. 

Common household bleach (sodium hypochlorite) or ethanol is often used 

for seed surface treatments. Most bacteria and fungi on the seed coat are 

killed after treatment with these disinfectants. Higher concentrations of up to

16 


50 % (v/v) sodium hypochlorite can be prepared from commercial stocks. The 

effectiveness of a certain procedure is dependent upon the species and source 

of the seeds. To ensure sterility, checks should be performed by placing the 

disinfected seeds on rich agar medium. Care should be taken to remove traces 

of the disinfectant since this may influence germination efficiency as well as 

the survival of the bacteria after coating or inoculation of the seed. Sterilised 

tomato (Lycopersicon esculentum) seeds are obtained by rinsing tomato seeds 

with household bleach (adjusted to approximately 5 % sodium hypochlorite) 

and stirring in a sterile flask for 3 min. Not all seeds sink to the bottom of the 

flask despite stirring. After 3 min, sterilised demineralised water is added and 

most, if not all, seeds will then sink to the bottom of the flask. Seeds that 

remain floating are discarded. The hypochlorite is removed by washing the 

seeds five times extensively with 20 ml sterile water, followed by 2-h washing 

in sterile water during which the water is replaced at least three times. Contamination 

checks, carried out by placing the disinfected seeds on King’s 

medium B agar (KB), show whether the seeds are free of contaminating 

microorganisms. For colonisation assays, this method is a reliable disinfection 

method. For disinfection of grass and wheat seeds, NaOCl/0.1 % SDS 

solutions can be used. 

If seedlings are used instead of seeds, the surface disinfected seeds are 

placed on PNS solidified with 1.8 % Bacto Agar and placed in the dark to allow 

germination. Prior to transfer to a suitable temperature for germination (e.g. 

28 °C for tomato), the seeds are incubated overnight at 4 °C, which often 

improves the germination efficiency and enhances synchronous germination 

of the seeds. For seeds such as tomato, wheat, or radish, it subsequently takes 

1–2 days before 3–5-mm root tips appear. Seeds are inspected for proper germination 

and seedlings with the same length of root tips are selected. 

3.3 Growth and Preparation of Bacteria 

Liquid cultures of bacterial strains are grown overnight on a rotary shaker. 

For colonisation experiments with a mixture of strains (e.g. wild type versus 

mutant) a suspension of washed bacteria is prepared in a 1:1 ratio. A volume 

of 1.0 ml of an overnight culture is sedimented by centrifugation and the 

supernatant is discarded. The cells are washed with 1 ml phosphate buffered 

saline (PBS: 20 mM sodium phosphate, 150 mM NaCl, pH 7.4) and resuspended 

in PBS. The concentration of bacteria in this suspension is determined 

by measuring the optical density (OD 600 nm ). The strains are diluted to 

a concentration of 1◊10 8 CFU/ml. If a mixture of strains is to be used for inoculation, 

the cells are mixed prior to inoculation of the seeds or seedlings, e.g. 

in a 1:1 ratio. The suspension is vortexed vigorously to yield a homogenous 

suspension of two strains.

3.4 Seed Inoculation 

Seeds are placed in the bacterial suspension with sterile forceps and shaken 

gently for a few seconds. After approximately 10 min, the inoculated seeds are 

aseptically planted in the sand column of the gnotobiotic system, 5 mm below 

the sand surface.At a concentration of the inoculation mixture of 10 8 CFU/ml, 

the number of bacteria attaching to tomato seeds or seedlings is close to saturation 

(approximately 10 4 CFU/seed) and lowering the inoculation concentration 

to 10 4 CFU/ml does not appear to have an effect on the numbers and distribution 

of bacteria on the root system after 7 days of growth. Care should be 

taken not to damage the roots of the seedling since this will induce formation 

of lateral roots. The seedlings are grown in a climate-controlled chamber 

(19 °C, 16/8 h day/night cycles, 70 % relative humidity) for 7 days, or until the 

root tips penetrate the gauze. 

The gnotobiotic system can be used to study the root colonisation behaviour 

of bacteria or be used to test strains for their competitive colonisation 

abilities. To screen for mutants that are impaired in competitive root colonisation, 

two mutants can be employed. Depending on the selectable properties 

of the strains (one strain must be marked with an antibiotic resistance or a 

reporter) the suspension can be plated on an appropriate selective medium to 

check the ratio of the strains. The use of Tn5lacZ marked strains allows the 

discrimination between wild type and mutant on 5-bromo-4-chloro-3indolyl-b-galactopyranoside 

(X-gal) plates after reisolation of the bacteria 

from part of the root system. Since chances are small that two randomly 

picked mutants are both colonisation mutants, one Tn5 (white) mutant can be 

tested against a Tn5lacZ mutant (blue), which allows faster screening for 

colonisation mutants, after which each mutant has to be tested against the 

wild-type strains. 

3.5 Analysis of the Tomato Root Tip 


To reisolate bacteria from the rhizosphere, the complete sand column is carefully 

removed from the tube. Most of the still adhering rhizosphere sand is 

removed and a length of 1–2 cm root tip is cut off with caution to prevent 

cross-contamination from upper root parts. If the complete root system is to 

be analysed, the root can be divided into segments. The root segments are 

shaken in 1 ml sterile PBS in the presence of the adhering rhizosphere sand or 

sterile glass beads to release tightly associated bacteria from the root surface 

on an Eppendorf shaker for 20 min. The bacterial suspension thus obtained is 

diluted with PBS and plated using a spiral plater on solid medium supplemented 

with X-gal when lacZ is used as a marker. The use of an automatic 

plating system and counter usually allows fast and accurate bacterial counts 

covering five orders of magnitude using a single dilution step.

18 


With P. fluorescens strains WCS365 and WCS365::Tn5lacZ,a 10 4 dilution of 

the resuspended bacteria is plated with a spiral plater on KB medium containing 

X-gal (40 mg/ml). After growth, the numbers of white and blue 

colonies are determined. Since the bacteria are lognormally distributed in the 

rhizosphere, the data are log 10(CFU+1)/cm transformed prior to statistical 

analysis with ANOVA followed by the non-parametric Wilcoxon-Mann-Whitney 

U-test to test significance between sample data. Details of the statistical 

approaches when handling these experimental data have been reviewed. 

Alternatively, root sections can be prepared for visualisation by light, electron, 

or confocal laser scanning microscopy to obtain details of the distribution 

pattern of the bacteria on the root surface. 

3.6 Confocal Laser Scanning Microscopy 

Autofluorescent proteins have been successfully expressed in bacterial cells 

and are widely used to monitor the localisation of bacterial cells or gene 

expression in cells. Autofluorescent proteins can be detected in living cells 

without staining or invasive detection methods and require no cofactors. Furthermore, 

the generation and discovery of various forms of autofluorescent 

proteins, such as BFP, CFP, YFP, DsRed, with differing luminescent and spectral 

properties have spurred additional interest in the use of these proteins as 

reporters. Autofluorescent protein-labelled strains have been used to study 

microbial communities in various environmental applications such as the 

study of dynamics and distribution of bacteria in soil, water systems, rhizospheres, 

activated sludges, biodegradation/bioremediation, biofilms, and root 

nodulation. The protein can also be used to study gene expression and gene 

transfer in bacterial populations. 

The analysis of autofluorescent proteins using CLSM is a very powerful 

technique to visualise microorganisms in complex environments such as in 

biofilms and the rhizosphere. 

Computer-assisted CLSM provides high resolution imaging under noninvasive 

conditions. With software for three-dimensional image analysis, a 

spatial arrangement of the distribution of labelled bacteria can be determined. 

4 Genetic Tools for Studying Root Colonisation 

4.1 Marking and Selecting Bacteria 

While antibiotic resistance can be very well applied as a marker to select bacteria 

in vitro, field conditions often require other or additional selection 

methods. There are numerous ways to track bacteria in the rhizosphere, asso-


ciated habitats, and phyllosphere. Commonly used marker genes include the 

gusA, lacZ, phoA, xylE, luxAB, luc, and celB genes (Table 1). 

The use of reporter genes such as b-galactosidase or b-glucuronidase as 

reporter genes has greatly facilitated the localisation of bacteria on the root 

surface. For b-galactosidase staining, roots or root sections can be directly 

fixed in 1.25 % (v/v) glutaraldehyde in Z buffer (10 mM KCl, 1 mM MgSO 4, 

50 mM KH 2PO 4, 50 mM K 2HPO 4, pH 7.0) for 30 min. Subsequently, the roots 

are washed twice in Z buffer for 30 min and stained overnight at 28 °C in a 

solution of X-Gal (0.8 mg/ml). The roots can be mounted for light microscopic 

analysis after thorough rinsing in Z buffer. The use of cross-linking fixation 

immobilises the bacteria on the root surface and the enzyme in the tissue. 

Although plants are known to possess endogenous b-galactosidase 

activity, this method gives no background of b-galactosidase activity from a 

number of plant root systems including tomato and Arabidopsis, since 

endogenous plant b-galactosidases are inactivated at high temperatures. By 

making cross-sections of roots after staining, the method can also be used to 

study bacterial-root associations in which bacteria penetrate deeper into the 

root tissue. In a similar way bacteria carrying a b-glucuronidase gene can be 

detected on the root system after staining with 5-bromo-4-chloro-3-indolylb-D-glucuronide. 

The major advantage of the use of b-glucuronidase is that 

plants do not possess endogenous b-glucuronidase activity. 

The optimal reporter system should provide an easy and non-invasive way 

to follow the fate of individual cells in the rhizosphere. In addition, it should 

provide the possibility to quantify the activity of specific promoters in the rhizosphere. 

Many of the reporters have several drawbacks and restrictions, 

which limit their application. Some make use of specific substrates, have high 

background signals, or require sophisticated and expensive equipment for 

detection (Table 1). Compared to these reporters, autofluorescent proteins 

possess several advantages and have been shown to be good tools for the 

detection of cells (see Chap. 23, Visualisation of rhizosphere interactions of 

Pseudomonas and Bacillus biocontrol strains), and are promising tools for the 

measurement of gene activities in the rhizosphere. Nowadays, an argon laser 

(488-nm wavelength) is often used to excite red-shifted gfp-variants. An epifluorescence 

microscope equipped with a standard fluorescein isothiocyanate 

filter is effective for the detection of gfp red-shifted mutants which have excitation 

and emission maxima at 488 and 510 nm, respectively. A DAPI (4¢6diamidino-2-phenylindole) 

filter set with excitation at 330–380 nm and barrier 

filters at 435 nm can be used to detect wild-type Gfp. Autofluorescently 

labelled colonies on agar plates can be detected under a hand-held UV-lamp 

or a low-resolution binocular microscope equipped with a UV lamp. Other 

methods such as flow cytometry can be used to quantify gfp-labelled bacteria. 

Individual cells can be detected, quantified, and sorted with high speed and 

accuracy. On media without added iron, fluorescent pseudomonads tend to 

emit background fluorescence, which can obscure the GFP fluorescence. For

20 

Table 1. Reporter genes commonly used for the detection of bacteria in environmental applications 

Gene Gene product or function Advantages and disadvantages for use in the rhizophere References 


gusA b-Glucuronidase No background in rhizobia and plants. Requires substrate. Sharma and Signer (1990); 

Streit et al. (1992) 

lacZ b-Galactosidase High background in most plants and bacteria. Drahos et al. (1986); 

Katupitiya et al. (1992); 

Krishnan and Pueppke (1992) 

phoA Alkaline phosphatase High background in most plants and bacteria. Reuber et al. (1991) 

xylE Catechol 2,3-dioxygenase Soluble end product. Winstanley et al. (1991) 

luxA, luc Luciferase Amplification and or photographic exposure for detection. O’Kane et al. (1988); 

de Weger et al. (1991); 

Low resolution. Silcock et al. (1992); 

de Weger et al. (1997) 

celB b-Glucosidase Detection after denaturation of endogenous enzymes. Voorhorst et al. (1995) 

tfdA 2,4-Dichlorophenoxyacetate Low resolution. King et al. (1991) 

monooxygenase 

gfp, bfp, yfp, Autofluorescent protein High resolution. Real-time application. Requires oxygen Chalfie et al. (1994) 

cfp, rfp for proper folding. 

Antibiotic Antibiotic resistance Requires plate counting. Hagedorn (1994) 

resistance 

Heavy metal Heavy metal resistance Requires plate counting. de Lorenzo (1994) 

resistance

selection using GFP-expressing bacteria, this can be easily overcome by the 

addition of 0.45 mM FeSO 4 ◊H 2 O. Since most GFP gene sequences are known, 

gfp-tagged cells can also be detected by molecular methods such as gene 

probing, DNA hybridisation, or PCR. 

4.2 Rhizosphere-Stable Plasmids 

To understand the biological significance of genes and mutations, they need 

to be studied or expressed in the context in which they are assumed to function. 

Also, the complementation of rhizosphere-expressed mutations and 

expression of reporter genes need to be performed in situ. One consideration 

when studying processes in complex living systems, such as under soil or rhizosphere 

conditions, is that antibiotic selection often cannot be applied. In 

addition, bacteria in the rhizosphere are assumed to be covered by a mucigel 

layer or form biofilms which are known to have increased resistance to antibiotics. 

Therefore, field and rhizosphere studies often require the use of rhizosphere-stable 

plasmids, e.g. for complementation of mutations or for tracking 

bacteria. While naturally occurring plasmids are often stably maintained 

within a bacterial population in the absence of selection pressure, many 

cloning vectors disappear without the appropriate selection. Plasmids with 

genes for complementation or reporter studies should therefore be stably 

maintained in strains without antibiotic pressure or be integrated into the 

chromosome. 

The Pseudomonas replicon pVS1 is stably maintained in many genera 

including Pseudomonas, Agrobacterium, Rhizobium, Burkholderia, Aeromonas, 

and Comamonas. Cloning vectors harbouring a 3.8-kb region of pVS1 

with functions for replication (rep) and stability (sta) also appear to be stably 

maintained. pVS1 derivatives pVSP41, pWTT2081, pME6010, pME6030, 

pME6040, and derivatives have been shown to be completely stable in various 

rhizosphere bacteria in the rhizospheres of various crop plants. Although the 

incompatibility group of pVS1 has not been determined, the replicon appears 

to be compatible with IncP-1, IncP-4, IncP-8, IncP-10, and IncP-11 plasmids in 

P. aeruginosa. 

4.3 Genetic and Metabolic Burdens 


Another consideration when introducing foreign or additional DNA on plasmids 

into bacterial strains is a plasmid or metabolic burden. The presence of 

a plasmid may confer a metabolic burden on the cells because of the presence 

of additional DNA and/or the expression of the reporter gene. Although the 

effects are often not visible under laboratory conditions, the presence of a 

plasmid may very well cause a genetic or metabolic burden in the rhizosphere

22 


and e.g. negatively affect the colonisation ability of a strain, as was shown for 

the presence of the rhizosphere-stable plasmid pWTT2081 in P. fluorescens 

WCS365 in the tomato rhizosphere. In competitive colonisation studies it is, 

therefore, of crucial importance to restore the balance by introducing the 

same empty vector in other strains when they are compared. Similarly, some 

biocontrol strains marked with autofluorescent proteins show decreased control 

of disease compared to the wild type such as in the control of seed-borne 

net blotch by Pseudomonas chlororaphis MA 342. E. coli cells harbouring 

DsRed also appear to be smaller than untransformed bacteria. 

5 Behaviour of Root-Colonising Pseudomonas Bacteria in a 

Gnotobiotic System 

5.1 Colonisation Strategies of Bacteria 

Using light, electron, or confocal laser scanning microscopy, bacteria can be 

directly visualised on the root surface and as such allow determination of distribution 

and colonisation patterns. Although light microscopy offers an easy 

way of visualising bacteria on the root, the resolution is often just below that 

necessary for detailed studies. More recently, CLSM has provided much more 

detailed information on the distribution and interactions in the rhizosphere. 

The number of bacteria present on the root system can also be simply followed 

by dilution plating of cell suspensions of bacteria that have been reisolated 

from root sections. On many plant root systems bacteria appear to be 

distributed lognormally rather than in a uniform way. In a typical bioassay 

with tomato seedlings grown for 7 days in a gnotobiotic sand system bacteria 

also appear to be distributed lognormally. High bacterial numbers are found 

at the root base (10 7 –10 8 CFU/cm) which rapidly decrease to 10 3 –10 4 CFU/cm 

at the root tip. Under the same growth conditions, bacterial numbers on one 

of the many roots of wheat are one order of magnitude higher, whereas in 

competition with indigenous rhizobacteria the numbers are usually one order 

of magnitude lower. 

The pattern of microbial occupation of root sites by bacteria varies considerably 

with plant species and conditions under which plants are grown, but 

the percentage of root surface covered is usually estimated less than 10 %. 

Often, the distribution within a small area of the plant root surface appears to 

consist of heavily populated areas, whereas other parts are practically devoid 

of bacteria. Pseudomonas cells on the tomato root are mainly present as elongated 

stretches on indented areas, such as junctions between epidermal cells 

and the deeper parts of the root epidermis, and root hairs. 

Transmission (TEM) and scanning electron microscopy (SEM) of the 

root–soil interface can reveal more details regarding the spatial relationships 

of microorganisms, soil, and roots than light microscopy.After removal of the

plant roots from the sand, these can be directly fixed and prepared according 

to standard protocols for TEM or SEM analyses. A prominent feature 

observed with these techniques is the mucilage or biofilm which surrounds 

the root and in which microorganisms develop. This biofilm is believed to 

provide a contact between soil and roots for diffusion of nutrients and may 

give some protection from other microorganisms. Although the film is also 

produced by the plant under axenic conditions, it appears to be thicker in 

non-sterile roots, where bacterial capsular material such as exopolysaccharides 

(EPS) may contribute significantly to this layer. The biofilm can also be 

visualised using confocal laser scanning microscopy combined with fluorescently 

marked bacteria. The encapsulation of bacteria in a mucigel may have 

considerable consequences for the action of certain diffusible compounds 

such as autoinducer molecules involved in quorum sensing. This phenomenon 

also complicates proper visualisation of marked bacteria that have penetrated 

deeper into the surface layers of the root. CLSM usually can cope with 

these difficulties since the system can focus on multiple planes of the specimen. 

An in-depth study of the stages of root colonisation by CLSM has shown 

that P. fluorescens WCS365 microcolonies on the root surface are usually 

formed from one single cell, since mature microcolonies that have been visualised 

on the root surface usually consist of one type of bacterium. The lognormal 

distribution of bacteria on the root tip indicates that most bacteria 

remain close to the inoculation site after seed inoculation. It is believed that 

occasionally, single cells detach from older parts of the root and travel along 

the growing root tip to establish new colonies. In later stages, mixed microcolonies 

can be observed with CLSM, indicating that other bacteria can join at 

some stage of microcolony formation. 

5.2 Competitive Colonisation Studies 


For a long-lasting effect, biocontrol bacteria must compete with the native 

microflora and establish themselves for several months at a high level in the 

rhizosphere. Successful colonisation of the plant root is often considered to be 

important for the success of various applications for beneficial purposes and 

for suppression of plant diseases. When studying colonisation traits in our 

laboratory, we therefore determine competitive root colonisation of two or 

more strains on the root. 

It was assumed that various bacterial traits contribute to the ability of a 

bacterial strain to colonise the rhizosphere and that loss of such a trait 

reduces the ability to establish itself effectively in the rhizosphere and, hence, 

also reduces its beneficial effects. Using initially competitive root tip colonisation 

in the gnotobiotic system as the assay, various competitive colonisation 

genes and traits were identified. One of the identified traits involved in coloni-

24 


sation is chemotaxis towards root exudate. cheA – chemotaxis mutants of various 

P. fluorescens strains appear to be strongly reduced in competitive root 

colonisation (de Weert et al. 2002). Chemotaxis was also suggested to be the 

first step in establishment of bacterial seed and root colonisation. 

Flagella-less Pseudomonas strains, when tested in competition with the 

wild type after application on seeds, are severely impaired in colonisation of 

the root tip of potato and tomato. A non-motile mutant of the Fusarium oxysporum 

f. sp. radicis-lycopersici (F.o.r.l.) antagonist P. chlororaphis PCL1391, 

was 1000-fold impaired in competitive tomato root tip colonisation. 

Agglutination and attachment of Pseudomonas cells to plant roots are likely 

to play a role in colonisation. Compounds that can mediate attachment or 

agglutination are adhesins, fimbriae, pili, cell surface proteins, and polysaccharides. 

The degree of attachment to tomato roots is correlated with the 

number of type 4 fimbriae on bacterial cells of P. fluorescens WCS365. The 

outer membrane protein OprF of P. fluorescens OE28.3 is involved in attachment 

to plant roots. A root-surface glycoprotein agglutinin was shown to 

mediate agglutination of P. putida isolate Corvallis, but had no effect on 

colonisation. 

Various Pseudomonas mutant derivatives lacking the O-antigen side chain 

of lipopolysaccharide (LPS) are impaired in colonisation. The colonisation 

defect in strains with defective LPS can be explained by assuming that for the 

optimal functioning of nutrient uptake systems, an intact outer membrane is 

required. 

Genes for the biosynthesis of amino acids and vitamin B1 and for utilisation 

of root exudate components such as organic acids are also important for 

colonisation of P. fluorescens WCS365 on tomato roots (Simons et al. 1997; 

Wijfjes et al. in preparation) and P. chlororaphis PCL1391. Putrescine is an 

important root exudate component of which the uptake level must be carefully 

regulated. P. fluorescens mutants with an increased putrescine level have 

a decreased growth rate resulting in a colonisation defect. 

Other traits that are likely to influence colonisation include generation 

time, osmotolerance, resistance to predators, host plant cultivar, and soil type. 

Genes of which the role in colonisation were not obvious were identified 

after screening of a random Tn5 mutant library of P. fluorescens WCS365 in 

competition with the parental strain. They include the nuoD gene which is 

part of a 14-gene operon encoding NADH dehydrogenase NDH-1 (Camacho 

et al. 2002). The biocontrol strain P. fluorescens WCS365 possesses two NADH 

dehydrogenases, and apparently, the absence of NDH-1 cannot be adequately 

compensated for by the other NADH dehydrogenase under rhizosphere conditions, 

resulting in lower fitness on the root. 

A two-component regulatory system consisting of the colS and colR genes, 

which have homology to sensor kinases and response regulators, respectively, 

was also shown to be involved in efficient root colonisation of strain P. fluorescens 

WCS365. It was concluded that an environmental stimulus is impor-

tant for colonisation, but neither the nature of the stimulus, nor the target 

genes are known. 

The sss gene, encoding a protein of the lambda integrase gene family of 

site-specific recombinases, to which XerC and XerD also belong, is necessary 

for adequate root colonisation of P. fluorescens WCS365 and P. chlororaphis 

PCL1391. It was postulated that a certain bacterial subpopulation, which 

expresses an as yet unknown cell surface component regulated by a site-specific 

recombinase, is important for competitive colonisation of P. fluorescens 

WCS365. 

For some strains the production of secondary metabolites contributes to 

the ecological competence of strains as was indeed shown for the phenazineproducing 

strains P. fluorescens 2–79 and P. aureofaciens 30–84 using 

phenazine biosynthetic mutants. Phenazine-minus strains had a reduced survival 

and a diminished ability to compete with the resident microflora. However, 

production of the antifungal factor 2,4-diacetylphloroglucinol in P. fluorescens 

strain F113 did not influence its persistence in the soil. 

5.3 Monocots Versus Dicots 

Differences in colonisation of bacterial strains may be attributed to different 

root exudate compositions of the host plant. Sugars, organic acids, and amino 

acids are considered to be the major readily metabolisable exudate compounds. 

The role of root exudate composition in colonisation behaviour was 

studied for a number of plants including tomato and grass. The amount of 

organic acid in tomato root exudate appears to be five times higher than that 

of exudate sugars. Using mutants of P. fluorescens WCS365, it was shown that 

organic acids are the nutritional basis for tomato root colonisation by this 

strain (Wijfjes et al. 2002, in prep.), whereas sugars appear to be less essential 

for colonisation. For monocots such as wheat and grass, a ten times higher 

number of Pseudomonas bacteria was found on the root compared to dicots 

such as tomato, radish, or potato. Since dicots and monocots have different 

organic acid and sugar compositions, increased root colonisation efficiency 

by certain strains might be related to a better growth on root exudates of 

monocots. 

6 Influence of Abiotic and Biotic Factors 

6.1 Abiotic Factors 


Commercial inoculants are mostly attached to the seed or are applied in the 

furrow where the bacteria can reach the seedling. However, for laboratory 

studies, bacterisation of seedlings instead of seeds will increase reproducibil-

26 


ity since the experiments start with a homogenous set of seedlings and this 

eliminates problems associated with irregular seed germination. The use of a 

sterile system not only ensures more reproducible bacterial numbers on the 

root system, but also results in higher numbers on the root due to the absence 

of competition by indigenous soil bacteria. 

Various environmental conditions influence root colonisation efficiency in 

the gnotobiotic sand system. The effect of a number of biotic and abiotic factors 

on colonisation was determined in a tomato-P. fluorescens WCS365 system. 

These factors include growth substrate, temperature, soil humidity, pH, 

and the presence of (competing) indigenous bacteria. Usually, ten times lower 

bacterial numbers are found on the tomato root system when experiments are 

performed in non-sterile potting soil instead of sterile quartz sand, which 

might be explained by the presence of indigenous competing organisms. The 

choice of material to sustain growth of seedlings is mainly determined by the 

system of interest. The use of chemically clean sand ensures a reliable experimental 

approach, but cannot be applied for studies requiring field conditions. 

Sand can be replaced by potting or field soil and the soil can be practically 

freed from indigenous organisms by gamma irradiation. Rockwool drained in 

plant nutrient solution also supports plant growth and bacterial colonisation. 

For more compact soil systems, such as clay-containing soils, the soil can be 

amended with sand to facilitate the recovery of roots from the system. The 

gnotobiotic system has been tested for tomato, radish, potato, cucumber, 

grass, and wheat, and may well be suitable for growth of other plant species. 

Although our seedlings in the gnotobiotic sand system are normally grown 

for 7 days, they can be grown for up to 14 days without watering. 

To determine the influence of a number of abiotic factors on colonisation 

in the gnotobiotic system, P. fluorescens WCS365 was marked with a b-glucuronidase 

reporter and singly inoculated on tomato seedlings. The overall 

bacterial distribution of the marked bacteria was determined using dilution 

plating and visualised using root prints (unpublished data). Increasing fluid 

content from 10 up to 20 % (v/w) in sand results in an overall increase of bacterial 

numbers on the tomato root tip. The increased colonisation may be due 

to increased motility or passive transport of bacteria down the root. Utilisation 

of 5 % (v/w) nutrient solution severely limits plant growth and consequently, 

bacterial numbers are lower. Temperatures at which plants are grown 

need to be selected depending on the plant species. Although we grow tomato 

seedlings at an intermediate temperature of 19 °C, growth is significantly 

enhanced at higher temperatures (e.g. 28 °C). This is also reflected in the number 

of bacteria sustained by the plant root system, possibly due to the effect of 

increased root exudation on bacterial growth.

6.2 Biotic Factors 


In potting soil, numbers of inoculated bacteria on the root system are usually 

ten-fold lower. Decreased root colonisation is not only caused by competition 

with soil-borne bacteria since numbers of inoculated bacteria on roots in 

non-sterilised and gamma-irradiated soil are comparable. 

Sometimes plant roots grown in potting soil are difficult to remove from 

the glass colonisation tube. In such cases, a mixture of potting soil/sand (1:3 

w/w) can be used as a compromise between the wish to use potting soil and 

that to experimentally study colonisation. 

When a fungal pathogen is included in the system, it is possible to determine 

biocontrol abilities of strains under controlled conditions. In our lab, 

bioassays with tomato and the fungal pathogens Fusarium oxysporum f. sp. 

radicis-lycopersici (F.o.r.l.), Rhizoctonia solani, and Pythium ultimum systems 

have been successfully employed to determine antifungal abilities of 

pseudomonads and bacilli (Lagopodi et al. unpublished data) and to perform 

microscopic analyses of rhizosphere interactions (see Chap. 23, Visualisation 

of Rhizosphere Interactions of Pseudomonas and Bacillus Biocontrol Strains). 

The pathogen can be introduced together with the biocontrol agent onto the 

seed or mixed with the sand as a spore or mycelium suspension, depending on 

the question under study. For the tomato-F.o.r.l. system, spores are collected 

from a 3-day-old culture of F.o.r.l. grown in liquid Czapek-Dox medium. 

Mycelium obtained from a PDA agar culture was used for inoculation of the 

culture. Spores are collected after passage through a miracloth filter, washed 

with water, and resuspended in PNS. Numbers of spores can be determined 

using a haemocytometer. Finally, the spores are mixed through the sand to a 

final concentration of 50 CFU/g sand. 

P. ultimum is grown for 3–4 weeks in clarified V8-medium (20 % V8 vegetable 

juice [Campbell Foods, Inc.], 25 mM CaCO 3,30mg/ml cholesterol). 

Prior to use,V8 is clarified by sedimentation at 6000 rpm for 30 min. Alternatively, 

the fungus can be cultured in hemp (Cannabis sp.) seed extract for 

1–2 weeks. Oospores that are abundantly produced during incubation are collected 

and freed from the mycelium. The fungal mycelium is washed three 

times in sterile water and blended in 0.1 M sucrose for 1–2 min. The culture is 

incubated for 2 h at 130 rpm at 28 °C. The suspension is sedimented by centrifugation 

at 4000 rpm for 10 min., resuspended in 1 M sucrose, and incubated 

at –20 °C for 12 h to kill the mycelium fragments. After washing with 

water, the suspension is layered over 1 M sucrose and centrifuged at 2351 rpm 

for 1 min. Consecutive washing steps remove most of the mycelium fragments. 

Oospores are added to the sand to a final concentration of 3–24 

oospores/g sand. 

Plants are judged according to a fixed disease index based upon disease 

symptoms (Table 2). The presence of the fungus on diseased plants can be 

confirmed by dipping suspected diseased parts in 0.05 % household bleach

28 


Table 2. Pythium ultimum and Fusarium oxysporum f. sp. radicis-lycopersici disease 

indices 

Disease symptoms Disease index 

No visible symptoms 0 

Small brown spots on the main root and/or the crown 1 

Brown spots on the central root and extensive discoloration of crown 2 

Damping-off or wilting 3 

Dead plant 4 

for 30 s and rinsing in sterile water to surface-disinfect the sample, followed 

by incubation on PDA agar medium. 

7 Conclusions 

The sand gnotobiotic system has proven to be a good tool to study rhizosphere 

interactions. Environmental and biotic conditions can be more carefully 

controlled in this system than in natural soils. Under controlled conditions, 

it also allows the enrichment of strains for particular traits. In our lab 

mutant screening has resulted in numerous mutants involved in root colonisation, 

which subsequently have been genetically characterised. Combined 

with the use of autofluorescent proteins and CLSM, the gnotobiotic system is 

a powerful tool to study the interactions between biocontrol bacteria, the 

pathogen, and the host plant. Unstable fluorescent proteins provide the tools 

for study of gene expression in the rhizosphere. Rhizosphere-associated phenomena 

such as bacterial cell-to-cell signalling events and signalling between 

pathogens and rhizosphere bacteria can be investigated in a clean and reproducible 

way. 

References and Selected Reading 

Bahme JB, Schroth MN (1987) Spatial-temporal colonization patterns of a rhizobacterium 

on underground organs of potato. Phytopathology 77:1093–1100 

Bloemberg GV, O’Toole GA, Lugtenberg BJJ, Kolter R (1997) Green fluorescent protein as 

a marker for Pseudomonas spp. Appl Environ Microbiol 63:4543–4551 

Bloemberg GV,Wijfjes AH, Lamers GE, Stuurman N, Lugtenberg BJ (2000) Simultaneous 

imaging of Pseudomonas fluorescens WCS365 populations expressing three different 

autofluorescent proteins in the rhizosphere: new perspectives for studying microbial 

communities. Mol Plant-Microbe Interact 13:1170–1176 

Bowen GD, Rovira AD (1976) Microbial colonization of plant roots. Annu Rev Phytopathol 

14:121–144


Buell CR, Anderson AJ (1993) Expression of the aggA locus of Pseudomonas putida in 

vitro and in planta as detected by the reporter gene, xylE. Mol Plant-Microbe Interact 

6:331–340 

Bull CT, Weller DM, Thomashow LS (1991) Relationship between root colonization and 

suppression of Gaeumannomyces graminis var. tritici by Pseudomonas fluorescens 

strain 2–79. Phytopathology 81:954–959 

Camacho MM (2001) Molecular characterization of type 4 pili, NDHI and PyrR in rhizosphere 

colonization of Pseudomonas fluorescens WCS365. PhD Thesis, Universiteit 

Leiden, Leiden 

Camacho Carvajal MM, Wijfjes AHM, Mulders IHM, Lugtenberg BJJ, Bloemberg GV 

(2002) Characterization of NADH dehydrogenases of Pseudomonas fluorescens 

WCS365 and their role in competitive root colonisation. Mol Plant-Microbe Interact 

15:662–671 

Campbell R, Rovira AD (1973) The study of the rhizosphere by scanning electron 

microscopy. Soil Biol Biochem 5:747–752 

Caroll H, Moënne-Loccoz Y, Dowling D, O’Gara F (1995) Mutational disruption of the 

biosynthesis genes coding for the antifungal metabolite 2,4-diacetylphloroglucinol 

does not influence the ecological fitness of Pseudomonas fluorescens F113 in the rhizosphere 

of sugar beets. Appl Environ Microbiol 61:3002–3007 

Chalfie M, Tu Y, Euskirchen G, Ward WW, Prasher DC (1994) Green fluorescent protein 

as a marker for gene expression. Science 263:802–805 

Chin-A-Woeng TFC, de Priester W, van der Bij AJ, Lugtenberg BJJ (1997) Description of 

the colonization of a gnotobiotic tomato rhizosphere by Pseudomonas fluorescens 

biocontrol strain WCS365, using scanning electron microscopy. Mol Plant-Microbe 

Interact 10:79–86 

Chin-A-Woeng TFC, Bloemberg GV, van der Bij AJ, van der Drift KMGM, Schripsema J, 

Kroon B, Scheffer RJ, Keel C, Bakker PAHM, Tichy HV, de Bruijn FJ, Thomas-Oates JE, 

Lugtenberg BJJ (1998) Biocontrol by phenazine-1-carboxamide-producing Pseudomonas 

chlororaphis PCL1391 of tomato root rot caused by Fusarium oxysporum f. sp. 

radicis-lycopersici. Mol Plant-Microbe Interact 11:1069–1077 

Chin-A-Woeng TFC, Bloemberg GV, Mulders IHM, Dekkers LC, Lugtenberg BJJ (2000) 

Root colonization by phenazine-1-carboxamide-producing bacterium Pseudomonas 

chlororaphis PCL1391 is essential for biocontrol of tomato foot and root rot. Mol 

Plant-Microbe Interact 13:1340–1345 

Christensen BB, Sternberg C, Molin S (1996) Bacterial plasmid conjugation on semisolid 

surfaces monitored with the green fluorescent protein (GFP) from Aequorea victoria 

as a marker. Gene 173:59–65 

Clarholm M (1984) Heterothrophic, free-living protozoa: neglected microorganisms 

with an important task in regulating bacterial populations. In: Klug MJ, Reddy CA 

(eds) Current perspectives in microbial ecology. American Society of Microbiology, 

Washington, DC, pp 321–326 

Cormack BP, Valdivia RH, Falkow S (1996) FACS-optimized mutants of the green fluorescent 

protein (GFP). Gene 173:33–38 

Davies KG, Whitbread R (1989) A comparison of methods for measuring the colonisation 

of a root system by fluorescent pseudomonads. Plant Soil 116:239–246 

de Lorenzo V (1994) Designing microbial systems for gene expression in the field. Trends 

Biotechnol 12:365–371 

de Weert S, Vermeiren H, Mulders IHM, Kuiper I, Hendrickx N, Bloemberg GV, Vanderleyden 

J, DeMot R, Lugtenberg BJJ (2002) Flagella-driven chemotaxis towards exudate 

components is an important trait for tomato root colonization by Pseudomonas fluorescens. 

Mol Plant-Microbe Interact 15:1173–1180

30 


de Weger LA, Bakker PAHM, Schippers B, van Loosdrecht MCM, Lugtenberg BJJ (1989) 

Pseudomonas spp. with mutational changes in the O-antigenic side chain of their 

lipopolysaccharide are affected in their ability to colonize potato roots. In: Lugtenberg 

BJJ (ed) Signal molecules in plants and plant-microbe interactions. NATO ASI 

Series H, Springer, Berlin Heidelberg New York, pp 197–202 

Dekkers LC (1997) Isolation and characterization of novel rhizosphere colonization 

mutants of Pseudomonas fluorescens WCS365. PhD Thesis, Leiden University, Leiden, 


Dekkers LC, van der Bij AJ, Mulders IHM, Phoelich CC, Wentwood RAR, Glandorf DCM, 

Wijffelman CA, Lugtenberg BJJ (1998a) Role of the O-antigen of lipopolysaccharide, 

and possible roles of growth rate and of NADH:Ubiquinone oxidoreductase (nuo) in 

competitive tomato root-tip colonization by Pseudomonas fluorescens WCS365. Mol 


Dekkers LC, Phoelich CC, van der Fits L, Lugtenberg BJJ (1998b) A site-specific recombinase 

is required for competitive root colonization by Pseudomonas fluorescens 

WCS365. Proc Natl Acad Sci USA 95:7051–7056 

Dekkers LC, Bloemendaal CP, de Weger LA, Wijffelman CA, Spaink HP, Lugtenberg BJJ 

(1998 c) A two-component system plays an important role in the root-colonizing ability 

of Pseudomonas fluorescens strain WCS365. Mol Plant-Microbe Interact 11:45–56 

Dekkers LC, Mulders IH, Phoelich CC, Chin-A-Woeng TFC, Wijfjes AH, Lugtenberg BJ 

(2000) The sss colonization gene of the tomato-Fusarium oxysporum f. sp. radicislycopersici 

biocontrol strain Pseudomonas fluorescens WCS365 can improve root colonization 

of other wild-type Pseudomonas spp. bacteria. Mol Plant-Microbe Interact 

13:1177–1183 

DeMot R, Veulemans B, Vanderleyden J (1991) Root-adhesive protein of Pseudomonas 

fluorescens OE28–3. In: Keel C, Knoller B, Défago G (eds) Plant growth-promoting 

rhizobacteria. Progress and prospects. International organization for biological and 

integrated control of noxious animals and plants. Proceedings of the 2nd International 

Workshop on PGPR. WPRS Bulletin XIV/8, 308–312 

de Weger LA, Dunbar P, Mahafee WF, Lugtenberg BJJ, Sayler G (1991) Use of bioluminescence 

markers to detect Pseudomonas spp. in the rhizosphere. Appl Environ Microbiol 

57:3641–3644 

de Weger LA, Kuiper I, van der Bij AJ, Lugtenberg BJJ (1997) Use of a lux-based procedure 

to rapidly visualize root colonisation by Pseudomonas fluorescens in the wheat 

rhizisphere. Anton Leeuw Int J G 72:365–372 

Drahos DJ, Hemming BC, McPherson S (1986) Tracking recombinant organisms in the 

environment: b-galactosidase as a selectable non-antibiotic marker for fluorescent 

pseudomonads. Bio/Technology 4:439–444 

Errampalli D, Okamura H, Lee H, Trevors JT, van Elsas JD (1998) Green fluorescent protein 

as a marker to monitor survival of phenanthrene-mineralizing Pseudomonas sp. 

UG14Gr in creosote-contaminated soil. FEMS Microbiol Ecol 26:181–191 

Errampalli D, Leung K, Cassidy MB, Kostrzynska M, Blears M, Lee H, Trevors JT (1999) 

Applications of the green fluorescent protein as a molecular marker in environmental 

microorganisms. J Microbiol Meth 35:187–199 

Foster RC (1986) The ultrastructure of the rhizoplane and rhizosphere. Annu Rev Phytopathol 

24:211–234 

Glandorf DCM, Sluis I, Anderson AJ, Bakker PAHM, Schippers B (1994) Agglutination, 

adherence, and root colonization by fluorescent pseudomonads.Appl Environ Microbiol 

60:1726–1733 

Greaves MP, Darbyshire JF (1972) The ultrastructure of the mucilaginous layer on plant 

roots. Soil Biol Biochem 4:443–449 

Habte M, Alexander M (1977) Further evidence for the regulation of bacterial populations 

in soil by protozoa. Arch Microbiol 113:181–183


Hagedorn C (1994) Spontaneous and intrinsic antibiotic resistance markers. In: Weaver 

RS, Angle S, Bottomley P (eds) Methods of soil analysis, Part 2, Microbiological and 

chemical properties. Soil Science of America, Inc, Madison, WI, pp 575–591 

Heeb S, Itoh Y, Nishijyo T, Schnider U, Keel C, Wade J, Walsh U, O’Gara F, Haas D (2000) 

Small, stable shuttle vectors based on the minimal pVS1 replicon for use in gram-negative, 

plant-associated bacteria. Mol Plant-Microbe Interact 13:232–237 

Hoffland E, Findenegg GR, Nelemans JA (1989) Solubilization of rock phosphate by rape. 

Plant Soil 113:161–165 

Howie WJ, Cook RJ, Weller DM (1987) Effect of soil matric potential and cell motility on 

wheat root colonization by fluorescent pseudomonads suppressive to take-all. Phytopathology 

77:286–292 

Itoh Y, Haas D (1985) Cloning vectors derived from the Pseudomonas plasmid pVSP1. 

Gene 36:27–36 

Itoh Y, Watson JM, Haas D, Leisinger T (1984) Genetic and molecular characterization of 

the Pseudomonas plasmid pVS1. Plasmid 11:206–220 

Jakobs S, Subramaniam V, Schonle A, Jovin TM, Hell SW (2000) EFGP and DsRed 

expressing cultures of Escherichia coli imaged by confocal, two-photon and fluorescence 

lifetime microscopy. FEBS Lett 479:131–135 

Jenny H, Grossenbacher K (1963) Root-soil boundary zones as seen in the electron 

microscope. Soil Sci Soc Am Proc 27:273–277 

Katupitiya S, New PB, Elmerich C, Kennedy IR (1992) Improved N 2 -fixation in 2,4-Dtreated 

wheat roots associated with A. lipoferum: studies of colonisation using 

reporter genes. Soil Biol Biochem 27:447–452 

King EO, Ward MK, Raney DE (1954) Two simple media for the demonstration of 

pyocyanin and fluorescein. J Lab Clin Med 44:301–307 

King RJ, Short KA, Seidler RJ (1991) Assay for detection and enumeration of genetically 

engineered microorganisms which is based on the activity of a deregulated 2,3dichlorophenoxyacetate 

monooxygenase. Appl Environ Microbiol 57:1790–1792 

Kloepper JW, Beauchamp CJ (1992) A review of issues related to measuring colonization 

of plant roots by bacteria. Can J Microbiol 38:1219–1232 

Knudsen IMB, Hockenhull J, Jensen DF, Gerhardson B, Hokeberg M, Tahvonen R, Teperi 

E, Sundheim L, Henriksen B (1997) Selection of biological control agents for controlling 

soil and seed-borne diseases in the field. Eur J Plant Pathol 103:775–784 

Krishnan HB, Pueppke SG (1992) A nolC-lacZ gene fusion in Rhizobium fredii facilitates 

direct assessment of competition for nodulation of soybean. Can J Micriobiol 

38:515–519 

Kuiper I, Bloemberg GV, Lugtenberg BJ (2001a) Selection of a plant-bacterium pair as a 

novel tool for rhizostimulation of polycyclic aromatic hydrocarbon-degrading bacteria. 

Mol Plant-Microbe Interact 14:1197–1205 

Kuiper I, Bloemberg GV, Noreen S, Thomas-Oates JE, Lugtenberg BJJ (2001b) Increased 

uptake of putrescine in the rhizosphere inhibits competitive root colonization by 

Pseudomonas fluorescens strain WCS365. Mol Plant-Microbe Interact 14:1096–1104 

Lagopodi AL, Ram AFJ, Lamers GEM, Punt PJ, van den Hondel CAMJJ, Lugtenberg BJJ, 

Bloemberg GV (2002) Novel aspects of tomato root colonization and infection by 

Fusarium oxysporum f. sp. radicis-lycopersici revealed by confocal laser scanning 

microscopic analysis using the green fluorescent protein as a marker. Mol Plant- 

Microbe Interact 15:172–179 

Lewis K (2001) Riddle of biofilm resistance. Antimicrob Agents Chemother 45:999–1007 

Loper JE, Suslow TV, Schroth MN (1984) Lognormal distribution of bacterial populations 

in the rhizosphere. Phytopathology 74:1454–1460 

Loper JE, Haack C, Schroth MN (1985) Population dynamics of soil pseudomonads in 

rhizosphere of potato (Solanum tuberosum L.). Appl Environ Microbiol 49:416–422

32 


Lugtenberg BJJ, de Weger LA, Schippers B (1994) Bacterization to protect seed and rhizosphere 

against disease. BCPC Monograph 57:293–302 

Lugtenberg BJJ, Dekkers LC, Bansraj M, Bloemberg GV, Camacho M, Chin-A-Woeng 

TFC, van den Hondel C, Kravchenko L, Kuiper I, Lagopodi AL, Mulders I, Phoelich C, 

Ram A, Tikhonovich I, Tuinman S, Wijffelman C, Wijfjes A (1999a) Pseudomonas 

genes and traits involved in tomato root colonization. In: de Wit PJGM, Bisseling T, 

Stiekema WJ (eds) 1999 IC-MPMI Congress Proceedings: Biology of plant-microbe 

interactions, volume 2. International Society for Molecular Plant-Microbe Interactions, 

St. Paul, MN, pp 324–330 

Lugtenberg BJJ, Kravchenko LV, Simons M (1999b) Tomato seed and root exudate sugars: 

composition, utilization by Pseudomonas biocontrol strains and role in rhizosphere 

colonization. Environ Microbiol 1:439–446 

Lugtenberg BJJ, Dekkers LC, Bloemberg GV (2001) Molecular determinants of rhizosphere 

colonization by Pseudomonas. Annu Rev Phytopathol 39:461–490 

Mah TF, O’Toole GA (2001) Mechanisms of biofilm resistance to antimicrobial agents. 

Trends Microbiol 9:34–39 

Mazzola M, Cook RJ, Thomashow LS, Weller DM, Pierson LS (1992) Contribution of 

phenazine antibiotic biosynthesis to the ecological competence of fluorescent 

pseudomonads in soil habitats. Appl Environ Microbiol 58:2616–2624 

McLoughlin AJ (1994) Plasmid stability and ecological competence in recombinant cultures. 

Biotechnol Adv 12:279–324 

Miller WG, Lindow SE (1997) An improved GFP cloning cassette designed for prokaryotic 

transcriptional fusions. Gene 191:149–153 

Möller S, Steinberg C,Andersen JB, Christensen BB, Ramos JL, Givskov M, Molin S (1998) 

In situ gene expression in mixed-culture biofilms evidence of metabolic interactions 

between community members. Appl Environ Microbiol 64:721–732 

Nordström K (1989) Mechanisms that contribute to the stable segregation of plasmids. 

Annu Rev Genet 23:37–69 

O’Kane DJ, Lingle WL, Wampler JE, Legocki RP, Szalay AA (1988) Visualization of bioluminescence 

as a marker of gene expression in rhizobium-infected soybean root nodules. 

Plant Mol Biol 10:387–399 

Okker RJ, Spaink H, Hille J, van Brussel TA, Lugtenberg B, Schilperoort RA (1984) Plantinducible 

virulence promoter of the Agrobacterium tumefaciens Ti plasmid. Nature 

312:564–566 

Palmer RJJ, Sternberg C (1999) Modern microscopy in biofilm research: confocal 

microscopy and other approaches. Curr Opin Biotechnol 10:263–268 

Partridge JE, Smith FD, Harpending PR, Rasmussen JL, Sanford JC (1991) Preparation of 

mycelium-free suspensions of oospores of Phytophtera megasperma var. sojae.Appl 

Environ Microbiol:480–485 

Prosser JI (1994) Molecular marker systems for detection of genetically engineered 

micro-organisms in the environment. Microbiology 140:5–17 

Rengel Z, Ross G, Hirsch P (1998) Plant genotype and micronutrient status influence colonization 

of wheat roots by soil bacteria. J Plant Nutr 21:99–113 

Reuber TL, Long SL, Walker GC (1991) Regulation of Rhizobium meliloti exo genes in 

free-living cells and in planta examined using TnphoA fusions. J Bacteriol 173:426– 

434 

Rhodes DJ, Powell KA (1994) Biological seed treatments – the development process. 

BCPC Monograph 57:303–310 

Rovira AD, Sands DC (1974) Quantitative assessment of the rhizoplane microflora by 

direct microscopy. Soil Biol Biochem 6:211–216 

Rovira AD, Campbell R (1975) A scanning electron microscope study of interactions 

between micro-organisms and Gaeumannomyces graminis (syn. Ophiobolus graminis) 

on wheat roots. Microbial Ecol 3:177–185


Ryder MH, Pankhurst CE, Rovira AD, Corell RL, Ophel Keller KM (1994) Detection of 

introduced bacteria in the rhizosphere using marker genes and DNA probes. In: 

O’Gara F, Dowling DN, Boesten B (eds) Molecular ecology of rhizosphere microorganisms.VCH, 

Weinheim, pp 29–47 

Scher FM, Kloepper JW, Singleton CA (1985) Chemotaxis of fluorescent Pseudomonas 

spp. to soybean seed exudates in vitro and in soil. Can J Microbiol 31:570–574 

Sharma SB, Signer ER (1990) Temporal and spatial regulation of the symbiotic genes of 

Rhizobium meliloti in planta revealed by transposon Tn5-gusA. Genes Dev. 4:344–356 

Silcock DJ, Waterhouse RN, Glover LA, Prosser JI, Killham K (1992) Detection of a single 

genetically engineered modified bacterial cell in soil by using charge coupled deviceenhanced 

microscopy. Appl Environ Microbiol 58:2444–2448 

Simons M, van der Bij AJ, Brand J, de Weger LA, Wijffelman CA, Lugtenberg BJJ (1996) 

Gnotobiotic system for studying rhizosphere colonization by plant growth-promoting 

Pseudomonas bacteria. Mol Plant-Microbe Interact 9:600–607 

Simons M, Permentier HP, de Weger LA, Wijffelman CA, Lugtenberg BJJ (1997) Amino 

acid synthesis is necessary for tomato root colonization by Pseudomonas fluorescens 

strain WCS365. Mol Plant-Microbe Interact 10:102–106 

Singleton LL, Mihail JD, Rush CM (1992) Methods for research on soil-borne phytopathogenic 

fungi. American Phytopathological Society Press, St. Paul, Minnesota 

Sokal RR, Rohlf FJ (1981) Biometry: the principles and practice of statistics in biological 

research. Freeman, New York, pp 432–436 

Stanisich VA, Bennett PM, Richmond MH (1977) Characterization of a translocation unit 

encoding resistance to mercuric ions that occurs on a nonconjugative plasmid in 

Pseudomonas aeruginosa. J Bacteriol 129:1227–1233 

Streit W, Kosch K, Werner D (1992) Nodulation competitiveness of Rhizobium leguminosarum 

bv. phaseoli and Rhizobium tropici strains measured by glucuronidase (gus) 

gene fusion. Biol Fertil Soils 14:140–144 

Teeri TH, Lehvaslaiho H, Franck M, Uotila J, Heino P, Palva ET,Van Montagu M, Herrera- 

Estrella L (1989) Gene fusions to lacZ reveal new expression patterns of chimeric 

genes in transgenic plants. EMBO J 8:343–350 

Timms-Wilson TM, Bailey MJ (2001) Reliable use of green fluorescent protein in fluorescent 

pseudomonads. J Microbiol Meth 46:77–80 

Tombolini R, van der Gaag DJ, Gerhardson B, Jansson JK (1999) Colonization pattern of 

the biocontrol strain Pseudomonas chlororaphis MA 342 on barley seeds visualized by 

using green fluorescent protein. Appl Environ Microbiol 65:3674–3680 

van der Bij AJ, de Weger LA, Tucker WT, Lugtenberg BJJ (1996) Plasmid stability in 

Pseudomonas fluorescens in the rhizosphere. Appl Environ Microbiol 62:1076–1080 

Voorhorst WGB, Eggen RIL, Luesink EJ, de Vos WM (1995) Characterization of the celB 

gene coding for b-glucosidase from the hyperthermophilic archaeon Pyrococcus 

furiosus and its expression and mutation analysis in Escherichia coli. J Bacteriol 

177:7105–7111 

Ward DM (1989) Molecular probes for analysis of microbial communities. In: Characklis 

WG, Wilderer PA (eds) Structure and function of biofilms. Wiley, New York, pp 

145–155 

Warren TM, Williams V, Flechcher M (1992) Influence of solid surface, adhesive ability, 

and inoculum size on bacterial colonization in microcosm studies. Appl Environ 

Microbiol 58:2954–2959 

Weller DM (1988) Biological control of soilborne plant pathogens in the rhizosphere 

with bacteria. Annu Rev Phytopathol 26:379–407 

Winstanley G, Morgan JAW, Pickup RW, Saunders JR (1991) Use of a xylE marker gene to 

monitor survival of recombinant Pseudomonas putida populations in lake water by 

culture on nonselective media. Appl Environ Microbiol 57:1905–1913

3 Methanogenic Microbial Communities Associated 

with Aquatic Plants 

Ralf Conrad 


Methanogenic microbial communities are typically active at anoxic sites that 

are depleted in electron acceptors other than CO 2 and H + .At these sites CH 4 is 

one of the major products of degradation of organic matter. The degradation 

products of cellulose, for example, which has an oxidation state of zero, would 

be CH 4 and CO 2 in a ratio of 1:1. Organic matter with a higher or lower oxidation 

state would yield respectively less or more CH 4 (Yao and Conrad 2000). 

Consequently, anoxic methanogenic habitats can be significant sources in the 

global CH 4 cycle. The global CH 4 cycle is important with respect to atmospheric 

chemistry and climate, since CH 4 is an important greenhouse gas and 

has tripled in abundance over the last two centuries (Cicerone and Oremland 

1988; Ehhalt 1999). The most important individual source for atmospheric 

CH 4 is wetlands (including flooded rice fields), which account for about 

175 Tg CH 4 per year or 33 % of the total atmospheric CH 4 budget (Conrad 

1997; Aulakh et al. 2001). The general microbiology and that of methanogenic 

microbial communities in flooded soils has recently been reviewed in detail 

(Kimura 2000; Liesack et al. 2000; Conrad and Frenzel 2002). In the following 

I will concentrate on methanogenic microbial communities associated with 

aquatic plants. 

2 Role of Plants in Emission of CH 4 to the Atmosphere 

Aquatic plants are an integral part of wetland ecosystems that emit CH 4 into 

the atmosphere. Aquatic plants interact in three different ways with the 

microbial CH 4 cycling, i.e., by serving as gas conduits, by supplying O 2 to the 

rhizosphere and by supplying organic substrates to the soil (Fig. 1). 

Aquatic plants live in anoxic soil habitats and thus have to make sure that 

their roots are supplied with O 2. The supply of O 2 is accomplished by vascular 

gas transport and aerenchyma systems. These systems and their mode of 




36 

CH 4 

Ralf Conrad 

O 2 

CH 4 

methanogenic 

substrates 

O 2 

straw & 

stubbles 

C 

sloughed-off cells 

exudates 

B 

aerenchymatous 

leaf sheeth 

Fig. 1. Role of aquatic plants for cycling of CH 4 by serving as gas conduits (C): cross section 

through an aerenchymatous leaf sheath, by supplying O 2 to the rhizosphere (B), and 

by supplying organic substrates to the soil; A, B and C are sites where O 2 is available 

(taken from Frenzel 2000) 

operation can be different in the different plant species (Armstrong 1979; 

Grosse et al. 1996; Jackson and Armstrong 1999). However, they all allow for 

transport of O 2 to the roots and vice-versa allow for the transport of CH 4 from 

the anoxic soil into the atmosphere. In rice fields, up to about 90 % of total 

CH 4 emission can be accomplished by ventilation through the rice plants 

(Holzapfel-Pschorn et al. 1986; Aulakh et al. 2001). The exact contribution of 

rice plants to the transport of CH 4 from the soil into the atmosphere depends 

on the size of the rice plants and their capacity for gas transport (Aulakh et al. 

A

3 Methaogenic Microbial Communities Asociated with Aquatic Plants 37 

2001). Other aquatic plants have similar features (Chanton and Dacey 1991; 

Grosse et al. 1996). Due to ventilation through aquatic plants, only a few bubbles 

accumulate in the soil and the ratio of CH 4 to N 2 in soil gas is relatively 

low (Chanton and Dacey 1991). Transport through the aquatic plants results 

in the fractionation of the stable isotope composition of CH 4 (delaying transport 

of heavy carbon and hydrogen), the extent being dependent on the mode 

of gas transport, e.g., by molecular diffusion or thermo-osmosis (Chanton 

and Dacey 1991; Chanton and Whiting 1996). 

By supplying O 2 to the rhizosphere, aquatic plants create a habitat there 

that is partially oxic. The presence of O 2 and increase in the redox potential 

have been demonstrated in the rhizosphere of aquatic plants (Frenzel 2000). 

However, O 2 availability may be spatially and temporarily restricted. Leakage 

of O 2 from the roots only occurs at specific sites, e.g., at the tips and where lateral 

roots emerge (Armstrong 1967).As the root grows, the soil sites which are 

affected by O 2 leakage change also (Flessa and Fischer 1992; Flessa 1994). A 

further factor, which affects the availability of O 2 , is microbial respiration of 

organic substrates, which also varies in time and space. Availability of useful 

substrates can dramatically limit the availability of O 2 in the rhizosphere (Van 

Bodegom et al. 2001a, b). The creation of oxic microhabitats may have dramatic 

effects on methanogenic microbial communities that also occur in the 

rhizosphere. First, O 2 is probably toxic to most of the anaerobic microorganisms 

and to methanogenic ones in particular (see below). Second, availability 

of O 2 allows the microbial and/or chemical oxidation of reduced inorganic 

compounds such as ammonia, sulfide and ferrous iron. These oxidation activities 

in turn result in the availability of inorganic oxidants and an increase of 

the redox potential in the rhizosphere beyond the zone where molecular O 2 is 

available. The availability of nitrate, sulfate and ferric iron, in turn, allows the 

operation of microbial nitrate reduction, sulfate reduction and iron reduction 

interfering with the activity of methanogenesis (Conrad 1993; Conrad and 

Frenzel 2002). Most of all, however, availability of O 2 allows the partial oxidation 

of CH 4 produced by the methanogenic microbial community. In fact, a 

significant percentage of the CH 4 produced in the anoxic soil and/or the rhizosphere 

is oxidized by methanotrophic bacteria (Frenzel 2000). The methanotrophic 

bacteria live by oxidation of CH 4 with O 2 to CO 2 and thus depend on 

the availability of both CH 4 and O 2 . The methanotrophic activity in the rhizosphere 

of aquatic plants scavenges a significant part of the produced CH 4 

which otherwise would be emitted into the atmosphere. The percentage of 

oxidized CH 4 varies with circumstances, but is typically in the order of 30 % of 

the CH 4 produced (Frenzel 2000). The CH 4 that escapes oxidation is generally 

enriched in isotopically heavy carbon (Chanton et al. 1997; Tyler et al. 1997; 

Krüger et al. 2002). The methanotrophs live directly on the root surface, partially 

even penetrating into the root (Gilbert et al. 1998), but may also be 

active a short distance away from the root surface if O 2 is available (Van Bodegom 

et al. 2001a).

38 

Ralf Conrad 

Finally, aquatic plants stimulate the methanogenic microbial communities 

in the rhizosphere and the bulk soil by providing additional organic substrates 

that can be methanogenically degraded. Theoretically, we may expect 

two different classes of organic substrates that originate from the plants, i.e., 

soluble exudates that are released from the roots briefly after being generated 

through photosynthesis, and structural organic matter provided by plant 

debris. 

3 Role of Photosynthates and Plant Debris 

for CH 4 Production 

Field observations suggested that root exudate-driven CH 4 production might 

play a major role in CH 4 emission from flooded rice fields (Holzapfel- 

Pschorn et al. 1986). Another preliminary indication of photosynthesis 

affecting CH 4 production came from field observations that CH 4 emission 

from various wetlands correlates with primary productivity (Whiting and 

Chanton 1993; Joabsson and Christensen 2001) and that CO 2 enrichment of 

the atmosphere results in increased CH 4 emission (Dacey et al. 1994; Hutchin 

et al. 1995; Megonigal and Schlesinger 1997; Ziska et al. 1998). However, CO 2 

enrichment and increased temperature caused in Florida rice fields a 

decreased CH 4 emission, probably because of enhanced delivery of O 2 into 

the rhizosphere (Schrope et al. 1999). This study is in contrast to that by 

Ziska et al. (1998) on rice fields in the Philippines, and shows that field 

observations have to be interpreted with care due to the highly complex 

interactions in the ecosystem. 

However, there are more direct indications that plant photosynthesis 

affects the methanogenic microbial community in the rhizosphere. For example, 

CH 4 production is correlated to the extent of root exudation in rice 

(Aulakh et al. 2001). Pulse labeling studies with rice and other aquatic plants 

have shown that different percentages (acetate>CH 4, indicates the 

degradation pathway of the excreted organic substrate to CH 4. 

Other pulse-labeling studies have shown that photosynthate-derived CH 4 

contributes more than 50 % to the total CH 4 emission from flooded rice fields 

(Minoda et al. 1996; Watanabe et al. 1999). These studies also confirmed the 

speculations from earlier field work (Holzapfel-Pschorn et al. 1986; Schütz et 

al. 1989) that seasonal peaks in CH 4 emission were due to decomposition of 

rice straw, followed by stimulation through root exudation and finally 

through decay of roots (Fig. 3).


Fig. 2. Transfer of carbon via rice 

plants to the soil and into CH 4 . 

Above After pulse labeling of the 

rice plants with 14 CO 2 , radioactivity 

transiently accumulates in soil 

organic compounds and is ultimately 

converted to 14 CH 4 ; below 

specific radioactivities indicate 

that radioactive compounds are 

converted in the sequence lactate>propionate>acetate>CH 

4 

(taken from Dannenberg and Conrad 

1999) 

Radioactivity [Bq ml -1 ] 

Specific radioactivity [Bq nmol -1 ] 

500 

400 

300 

200 

100 

Experiment #1 

lactate 

propionate 

acetate 

CH 4 

0 

0 2 4 6 8 10 12 14 16 

Time [d] 

0 

0 2 4 6 

Besides the more direct effect of photosynthesis through root exudation, 

CH 4 production in wetlands is furthermore stimulated by plant debris. This 

may be decaying roots or dead aboveground plant material. In rice fields, for 

example, rice straw from the previous season is often plowed under to 

improve soil quality. Also, composted plant material is used as soil fertilizer. 

There are numerous studies which show that addition of such organic matter 

dramatically increases CH 4 emission rates (Denier van der Gon 1999). 

Decomposition of isotopically labeled rice straw contributes significantly to 

production and emission of CH 4 during the early season (Chidthaisong and 

Watanabe 1997; Watanabe et al. 1998, 1999) 

8 

7 

6 

5 

4 

3 

2 

1 

Time [d] 

A 

lactate 

propionate 

acetate 

CO 2 

CH 4 

B

40 

Ralf Conrad 

Fig. 3. Emission of CH 4 from strawfertilized, 

planted rice field soil and 

partitioning of the primary carbon 

from which CH 4 was formed, determined 

by using 13 C-labeled CO 2 , rice 

straw and soil organic matter; rice 

plant C1 is carbon released within 

2 weeks after assimilation of 13 CO 2 ; 

rice plant C2 is other plant-derived 

carbon, presumably from sloughed-off 

root cells or decaying roots (taken 

from Watanabe et al. 1999) 

4 Methanogenic Microbial Communities on Plant Debris 

Straw and decomposing roots are important plant debris in flooded rice 

fields. Rice straw mainly consists of cellulose, hemicellulose and lignin and 

is encrusted with silica (Tsutsuki and Ponnamperuma 1987; Watanabe et al. 

1993). After a rapid mineralization of 80–90 % of the straw during the first 

year, a more resistant fraction of organic matter remains. The latter is 

degraded slowly with a half-life of about 2 years (Neue and Scharpenseel 

1987). Rice straw is colonized by microorganisms and the structure of the 

leave blades and sheaths gradually disintegrates. The degradation process 

becomes visually apparent after about 3 weeks (Kimura and Tun 1999; Tun 

and Kimura 2000) with a dry weight loss of about 50 % during the first 

30 days (Glissmann and Conrad 2002). Degradation of rice straw proceeds 

via hydrolysis, fermentation of the released sugars, syntrophic conversion of 

primary fermentation products to acetate, CO 2 and H 2, and conversion of 

acetate and H 2/CO 2, respectively, to CH 4 (Glissmann and Conrad 2002). The 

same degradation pathway is generally found in methanogenic environments 

such as lake sediments or anaerobic digestors (Zinder 1993). The 

methanogenic degradation pathway of rice straw is similar to that of the 

organic matter present in flooded soil to which no rice straw was added, but 

the rate of CH 4 production is lower in the unamended soil (Glissmann and


Conrad 2000). Under steady state conditions, the conversion of rice straw to 

CH 4 is limited by the hydrolysis of the straw polysaccharides, which become 

increasingly recalcitrant to decomposition (Glissmann and Conrad 2002). It 

is likely that rice straw is in this way gradually converted to soil organic matter 

and humus. 

The bacteria that colonize and degrade rice straw mainly consist of 

clostridia (Weber et al. 2001a) which belong to the same taxonomic clusters 

as found in unamended soil (Chin et al. 1999; Hengstmann et al. 1999; Lüdemann 

et al. 2000). On the other hand, the community of methanogenic 

archaea on rice straw is less diverse and abundant than in the bulk soil 

(Weber et al. 2001b). The genus Methanosaeta, in particular, was lacking in 

degrading straw. This genus is common in bulk soil (Grosskopf et al. 1998) 

and especially becomes abundant at limiting acetate concentrations (Fey and 

Conrad 2000). Consistent with the low abundance of methanogens on rice 

straw is the observation that straw pieces retrieved from the soil mainly 

exhibit fermentative production of H 2 and fatty acids, while the subsequent 

conversion of the fatty acids to CH 4 takes place in the bulk soil to where the 

fatty acids are released (Glissmann et al. 2001). Hence, methanogenic degradation 

of rice straw is compartmentalized in a way that methanogenesis 

occurs in the soil at some distance to the microbial community that colonizes 

the straw (Fig. 4). 

Fig. 4. Conceptual model 

of methanogenic degradation 

of rice straw, and 

the localization of the 

major processes either 

on the straw or in the soil 

slurry (taken from Glissmann 

et al. 2001) 

Slurry 

Straw 

Biopolymers 

Hydrolysis 

of polymers 

Monoand 

oligomers 

Fermentation 

Fatty acids 

and alcohols 

Fermentation 

and syntrophic 

degradation 

Homoacetogenesis 

H 2 + CO2 

Acetate 

Methanogenesis 

CH 4

42 

Ralf Conrad 

The general colonization patterns of rice roots with microorganisms and 

their potential involvement in degradation of the dead roots have been 

reviewed by Kimura (2000). It is likely that dead roots are decomposed in a 

similar way to rice straw, but detailed studies are lacking. 

5 Methanogenic Microbial Communities on Roots 

Plant roots are apparently colonized by methanogenic microorganisms. This 

evidence came from incubation of excised roots of aquatic plants under 

anoxic conditions resulting in substantial CH 4 production (Kimura et al. 1991; 

King 1994; Frenzel and Bosse 1996). Subsequently, it was shown by Grosskopf 

et al. (1998) that rice roots are indeed inhabited by a diverse community of 

methanogenic archaea, which can be retrieved by DNA extraction, and amplification 

of the archaeal SSU rRNA genes. Archaeal diether lipids were also 

detected on rice roots (Reichardt et al. 1997). 

Production of CH 4 on rice roots is dominated by H 2/CO 2-utilizing 

methanogens (Lehmann-Richter et al 1999; Conrad et al. 2000). The most 

prominent group of methanogens on rice roots is that of the uncultivated rice 

cluster I (Grosskopf et al. 1998). Since this cluster is also dominant in soils in 

which CH 4 is exclusively produced from H 2 /CO 2 (Fey et al. 2000) and in 

methanogenic enrichment cultures on H 2/CO 2 (Lueders et al. 2001), it is likely 

that it is responsible for the observed H 2/CO 2 dependent methanogenesis on 

rice roots. However, methanogens belonging to Methanobacteriaceae and 

Methanomicrobiaceae, i.e., groups that are able to utilize H 2/CO 2, have also 

been detected (Grosskopf et al. 1998). Populations of acetoclastic Methanosarcina, 

on the other hand, only developed at a later stage of anoxic incubation 

of excised rice roots, when sufficient acetate had accumulated and only in the 

absence of phosphate. Phosphate concentrations higher than 10 mM were 

found to prohibit the activity of acetoclastic methanogenesis (Conrad et al. 

2000). Collectively, these observations suggest that the methanogenic flora in 

situ produces CH 4 mainly from H 2/CO 2 rather than from acetate. This is a 

major difference to the behavior in the soil, where acetate is the dominant 

methanogenic substrate. 

Consequently, the stable isotopic signature of the produced CH 4 was 

found to be different for the methanogenic microbial communities in the 

soil and on the roots (Conrad et al. 2000, 2002). This fact may have implications 

for estimates dealing with the budget of atmospheric CH 4 and the 

global CH 4 cycle, for which the stable isotopic signature of CH 4 is an important 

constraint (Stevens 1993). Unfortunately, we presently do not know how 

much the methanogenic microbial community on rice roots, or on the roots 

of aquatic plants in general, contribute to the CH 4 source strength of wetland 

ecosystems compared to the methanogenic microbial communities in the 

anoxic soil.


Another implication of the observations concerns the structure of the 

methanogenic microbial community on the roots, which seem to be very simple, 

consisting only of H 2-producing fermenting and H 2-consuming methanogenic 

microorganisms. However, experiments with excised rice roots have 

demonstrated a more complex community of fermenting bacteria including 

vigorous fermentative production of acetate, propionate and butyrate (Conrad 

and Klose 1999, 2000). Interestingly, a significant percentage (up to 60 %) 

of these fatty acids was produced by reduction of CO 2. The stable isotope signature 

of the produced acetate was consistent with the production by CO 2 

reduction (Conrad et al. 2002). Acetate production from CO 2 indicates that 

homoactogenic bacteria were active, a likely conclusion, since homoacetogenic 

Sporomusa are members of the rice root microflora (Rosencrantz et al. 

1999). Homoactogens have also been found on the roots of sea grass (Küsel et 

al. 1999, 2001). Approximately 30 % of the root epidermal cells of sea grass 

were colonized with microorganisms that hybridized with an archaeal probe 

suggesting the presence of methanogens (Küsel et al. 1999). Presently, little is 

known about the fate of the produced fatty acids. Propionate and butyrate can 

potentially be further converted to acetate, CO 2 and H 2 by syntrophic bacteria, 

which are present in the anoxic rice soil, followed by H 2/CO 2-dependent 

methanogenesis (Krylova et al. 1997). Syntrophic oxidation of acetate, however, 

is unlikely since [2- 14 C]acetate was hardly turned over in root preparations 

(Lehmann-Richter et al. 1999). The most likely fate of the acetate produced 

by the root microflora is its escape into the bulk soil where it is 

methanogenically decomposed (Fig. 5). Alternatively, acetate may be a substrate 

for anaerobic bacteria using nitrate, ferric iron or sulfate as electron 

Fig. 5. Conceptual model of the 

localization of methanogenic 

archaea (MA), homoacetogenic 

bacteria (HAB), methane-oxidizing 

bacteria (MOB) and aerobic 

bacteria (AB) in vicinity of rice 

roots and to each other, and the 

flow of organic carbon. The insertion 

of lateral roots (and root 

tips) are the most likely sites 

where O 2 and organic substrates 

(e.g., sugars) are released into the 

soil

44 

Ralf Conrad 

acceptor. However, little is known about the activity of these functional 

groups on the roots of aquatic plants (Bodelier et al. 1997; Nijburg and Laanbroek 

1997; King and Garey 1999; Küsel et al. 1999; Wind et al. 1999; Arth and 

Frenzel 2000). 

6 Interaction of Methanogens and Methanotrophs 

Although it has become evident that methanogenesis is stimulated by plant 

photosynthesis (see above), it has been a rather unexpected result that 

methanogenic activity is obviously localized directly on the root surface. This 

result was surprising, since textbook knowledge suggests that methanogenic 

archaea need an absolutely O 2-free environment, which the root surface does 

not provide (see above). Quite the contrary, roots have been shown to be the 

site of methanotrophic activity (Frenzel 2000). This discrepancy between 

roots being colonized by both aerobic and anaerobic microorganisms has not 

been completely reconciled. 

One possible explanation is a spatially heterogeneous colonization of the 

roots. The aerobic methanotrophs would colonize only those parts where O 2 

is leaking from the roots and the methanogens only those that stay anoxic. 

However, methanogens would probably only colonize the roots if provision of 

the substrate (H 2) is better there than in the bulk soil. Production of H 2 

requires microbial fermentation activity and this in turn requires the provision 

of a degradable substrate. Hence, colonization of roots by methanogens 

is most likely at the sites with high leakage rates of organic substrates. The 

localization of sites with exudation of organic substrates along the root is not 

quite clear, but the root tips were found to be most actively excreting sucrose 

in an annual grass (Jaeger et al. 1999). However, root tips are also the most 

active sites of O 2 leakage (Armstrong 1967). Thus, we have to expect that the 

optimal sites for colonization by methanotrophs and methanogens are the 

same. 

Another possible explanation is that the methanogens are largely protected 

from O 2, because they are living in the vicinity of O 2-consuming methanotrophs. 

A similar close association of methanotrophs and methanogens has 

been hypothesized for pelagic microbial assemblages, thus explaining the formation 

of CH 4 in oxic ocean surface water (Sieburth 1991). Although 

Sieburth’s hypothesis has so far not been confirmed in pelagic microbial flocs 

(Ploug et al. 1997), experiments in microbial chemostat cultures have shown 

that anaerobic methanogens can co-exist with aerobic microorganisms under 

aerated conditions (Gerritse and Gottschal 1993). 

Moreover, at least some of the species of methanogens seem to be more 

resistant to exposure to O 2 than generally expected. For example, 

methanogens in rice field soil have been found to survive desiccation of the 

soil and prolonged exposure to air (Fetzer et al. 1993). Methanosarcina bark-


eri was found to be able to initiate CH 4 production despite a positive redox 

potential of the medium (Fetzer and Conrad 1993). Methanogenic activity has 

been detected in just that part of the termite gut that is oxygenated (Brune 

and Friedrich 2000), and Methanobrevibacter isolates were able to grow 

slowly despite the presence of low O 2 concentrations (Leadbetter and Breznak 

1996). Recently, some methanogenic species were found to contain catalase 

and superoxide dismutase to protect against oxidative stress (Shima et al. 

1999, 2001; Brioukhanov et al. 2000). Unfortunately, we do not know the O 2 

resistance of the methanogenic species that inhabit rice roots, in particular 

the uncultivated rice cluster I methanogens (Lueders et al. 2001). 

As methanogens and methanotrophs live in the same environments in 

close vicinity, it might be possible that they communicate with each other not 

only by transfer of CH 4, but also more directly through gene exchange. R.K. 

Thauer (Germany) and his group have recently put forward this idea. It is 

indeed intriguing that methanotrophic bacteria contain genes and coenzymes, 

which had been postulated to be specific for methanogens. Thus, 

methanotrophs seem to contain tetrahydromethanopterin in addition to 

tetrahydrofolate, and utilize tetrahydromethanopterin-dependent enzymes 

for catabolic C1 transfer reactions similarly to the methanogens (Chisdoserdova 

et al. 1998; Vorholt et al. 1999). It is likely that methanotrophs have 

acquired the necessary genes from methanogens. The other way round, 

methanogens seem to have acquired genes that are of bacterial origin. Thus, 

Methanosarcina and Methanobrevibacter species contain a monofunctional 

catalase. Such an enzyme is unexpected for Archaea, which generally contain 

a bifunctional catalase (Shima et al. 2001). Roots of aquatic plants would be a 

possible habitat where such gene transfers between methanogenic Archaea 

and methanotrophic Bacteria might occur. 

Acknowledgements. I thank Peter Frenzel and Rolf Thauer for discussion. 


Armstrong W (1967) The use of polarography in the assay of oxygen diffusing from 

roots in anaerobic media. Physiol Plantarum 20:540–553 

Armstrong W (1979) Aeration in higher plants. Adv Bot Res 7:226–332 

Arth I, Frenzel P (2000) Nitrification and denitrification in the rhizosphere of rice: the 

detection of processes by a new multi-channel electrode. Biol Fertil Soils 31:427–435 

Aulakh MS, Wassmann R, Rennenberg H (2001) Methane emissions from rice fields – 

Quantification, mechanisms, role of management, and mitigation options.Adv Agron 

70:193–260 

Bodelier PLE, Wijlhuizen AG, Blom CWPM, Laanbroek HJ (1997) Effects of photoperiod 

on growth of and denitrification by Pseudomonas chlororaphis in the root zone of 

Glyceria maxima, studied in a gnotobiotic microcosm. Plant Soil 190:91–103

46 

Ralf Conrad 

Brioukhanov A, Netrusov A, Sordel M, Thauer RK, Shima S (2000) Protection of 

Methanosarcina barkeri against oxidative stress: identification and characterization 

of an iron superoxide dismutase. Arch Microbiol 174:213–216 

Brune A, Friedrich M (2000) Microecology of the termite gut: structure and function on 

a microscale [Review]. Curr Opin Microbiol 3:263–269 

Chanton JP, Dacey JW (1991) Effects of vegetation on methane flux, reservoirs, and carbon 

isotopic composition. In: Rogers JE, Whitman WB (eds) Trace gas emissions by 

plants. Academic Press, San Diego, pp 65–92 

Chanton JP, Whiting GJ (1996) Methane stable isotopic distributions as indicators of gas 

transport mechanisms in emergent aquatic plants. Aquat Bot 54:227–236 

Chanton JP, Whiting GJ, Blair NE, Lindau CW, Bollich PK (1997) Methane emission from 

rice: Stable isotopes, diurnal variations, and CO 2 exchange. Global Biogeochem Cycles 

11:15–27 

Chidthaisong A, Watanabe I (1997) Methane formation and emission from flooded rice 

soil incorporated with 13 C-labeled rice straw. Soil Biol Biochem 29:1173–1181 

Chin KJ, Hahn D, Hengstmann U, Liesack W, Janssen PH (1999) Characterization and 

identification of numerically abundant culturable bacteria from the anoxic bulk soil 

of rice paddy microcosms. Appl Environ Microbiol 65:5042–5049 

Chistoserdova L, Vorholt JA, Thauer RK, Lidstrom ME (1998) C-1 transfer enzymes and 

coenzymes linking methylotrophic bacteria and methanogenic archaea. Science 

281:99–102 

Cicerone RJ, Oremland RS (1988) Biogeochemical aspects of atmospheric methane. 

Global Biogeochem Cycles 2:299–327 

Conrad R (1993) Mechanisms controlling methane emission from wetland rice fields. In: 

Oremland RS (ed) The biogeochemistry of global change: radiative trace gases. Chapman 

and Hall, New York, pp 317–335 

Conrad R (1997) Production and consumption of methane in the terrestrial biosphere. 

In: Helas G, Slanina J, Steinbrecher R (eds) Biogenic volatile organic carbon compounds 

in the atmosphere. SBP Academic Publ, Amsterdam, pp 27–44 

Conrad R, Klose M (1999) Anaerobic conversion of carbon dioxide to methane, acetate 

and propionate on washed rice roots. FEMS Microbiol Ecol 30:147–155 

Conrad R, Klose M (2000) Selective inhibition of reactions involved in methanogenesis 

and fatty acid production on rice roots. FEMS Microbiol Ecol 34:27–34 

Conrad R, Frenzel P (2002) Flooded soils. In: Bitton G (ed) The encyclopedia of environmental 

microbiology. Wiley, New York, pp 1316.1333 

Conrad R, Klose M, Claus P (2000) Phosphate inhibits acetotrophic methanogenesis on 

rice roots. Appl Environ Microbiol 66:828–831 

Conrad R, Klose M, Claus P (2002) Pathway of CH 4 formation in anoxic rice field soil and 

rice roots determined by 13C-stable isotope fractionation. Chemosphere 47:797–806 

Dacey JWH, Drake BG, Klug MJ (1994) Stimulation of methane emission by carbon dioxide 

enrichment of marsh vegetation. Nature 370:47–49 

Dannenberg S, Conrad R (1999) Effect of rice plants on methane production and rhizospheric 

metabolism in paddy soil. Biogeochemistry 45:53–71 

Denier van der Gon H (1999) Changes in CH 4 emission from rice fields from 1960 to 

1990s – 2. The declining use of organic inputs in rice farming. Global Biogeochem 

Cycles 13:1053–1062 

Ehhalt DH (1999) Gas phase chemistry in the troposphere. In: Zellner R (ed) Global 

aspects of atmospheric chemistry. Springer, Berlin Heidelberg New York, pp 21–109 

Fetzer S, Conrad R (1993) Effect of redox potential on methanogenesis by Methanosarcina 

barkeri. Arch Microbiol 160:108–113 

Fetzer S, Bak F, Conrad R (1993) Sensitivity of methanogenic bacteria from paddy soil to 

oxygen and desiccation. FEMS Microbiol Ecol 12:107–115


Fey A, Conrad R (2000) Effect of temperature on carbon and electron flow and on the 

archaeal community in methanogenic rice field soil. Appl Environ Microbiol 

66:4790–4797 

Flessa H (1994) Plant-induced changes in the redox potential of the rhizospheres of the 

submerged vascular macrophytes Myriophyllum verticillatum L and Ranunculus circinatus 

L. Aquat Bot 47:119–129 

Flessa H, Fischer WR (1992) Plant-induced changes in the redox potentials of rice rhizospheres. 

Plant Soil 143:55–60 

Frenzel P (2000) Plant-associated methane oxidation in rice fields and wetlands 

[Review]. Adv Microb Ecol 16:85–114 

Frenzel P, Bosse U (1996) Methyl fluoride, an inhibitor of methane oxidation and 

methane production. FEMS Microbiol Ecol 21:25–36 

Gerritse J, Gottschal JC (1993) Two-membered mixed cultures of methanogenic and aerobic 

bacteria in O 2 -limited chemostats. J Gen Microbiol 139:1853–1860 

Gilbert B, Assmus B, Hartmann A, Frenzel P (1998) In situ localization of two methanotrophic 

strains in the rhizosphere of rice plants. FEMS Microbiol Ecol 25:117–128 

Glissmann K, Conrad R (2000) Fermentation pattern of methanogenic degradation of 

rice straw in anoxic paddy soil. FEMS Microbiol Ecol 31:117–126 

Glissmann K, Conrad R (2002) Saccharolytic activity and its role as a limiting step in 

methane formation during the anaerobic degradation of rice straw in rice paddy soil. 

Biology and Fertility of Soils 35:62–67 

Glissmann K, Weber S, Conrad R (2001) Localization of processes involved in methanogenic 

degradation of rice straw in anoxic paddy soil. Environ Microbiol 3:502–511 

Grosse W, Armstrong J, Armstrong W (1996) A history of pressurised gas-flow studies in 

plants. Aquat Bot 54:87–100 

Großkopf R, Stubner S, Liesack W (1998) Novel euryarchaeotal lineages detected on rice 

roots and in the anoxic bulk soil of flooded rice microcosms. Appl Environ Microbiol 

64:4983–4989 

Hengstmann U, Chin KJ, Janssen PH, Liesack W (1999) Comparative phylogenetic 

assignment of environmental sequences of genes encoding 16S rRNA and numerically 

abundant culturable bacteria from an anoxic rice paddy soil. Appl Environ 

Microbiol 65:5050–5058 

Holzapfel-Pschorn A, Conrad R, Seiler W (1986) Effects of vegetation on the emission of 

methane from submerged paddy soil. Plant and Soil 92:223–233 

Hutchin PR, Press MC, Lee JA,Ashenden TW (1995) Elevated concentrations of CO 2 may 

double methane emissions from mires. Global Change Biol 1:125–128 

Jackson MB, Armstrong W (1999) Formation of aerenchyma and the processes of plant 

ventilation in relation to soil flooding and submergence [review]. Plant Biol 1:274– 

287 

Jaeger CH III, Lindow SE, Miller S, Clark E, Firestone MK (1999) Mapping of sugar and 

amino acid availability in soil around roots with bacterial sensors of sucrose and 

tryptophan. Appl Environ Microbiol 65:2685–2690 

Joabsson A, Christensen TR (2001) Methane emissions from wetlands and their relationship 

with vascular plants: an Arctic example. Global Change Biol 7:919–932 

Kimura M (2000) Anaerobic microbiology in waterlogged rice fields. In: Bollag JM, 

Stotzky G (eds) Soil biochemistry, vol 10. Marcel Dekker, New York, pp 35–138 

Kimura M, Tun CC (1999) Microscopic observation of the decomposition process of leaf 

sheath of rice straw and colonizing microorganisms during the cultivation period of 

paddy rice. Soil Sci Plant Nutr 45:427–437 

Kimura M, Murakami H, Wada H (1991) CO 2 ,H 2 ,and CH 4 production in rice rhizosphere. 

Soil Sci Plant Nutr 37:55–60 

King GM (1994) Associations of methanotrophs with the roots and rhizomes of aquatic 

vegetation. Appl Environ Microbiol 60:3220–3227

48 

Ralf Conrad 

King GM, Garey MA (1999) Ferric iron reduction by bacteria associated with the roots of 

freshwater and marine macrophytes. Appl Environ Microbiol 65:4393–4398 

King JY, Reeburgh WS (2002) A pulse-labeling experiment to determine the contribution 

of recent plant photosynthates to net methane emission in arctic wet sedge tundra. 

Soil Biol Biochem 34:173–180 

Krüger M, Eller G, Conrad R, Frenzel P (2002) Seasonal variation in pathways of CH 4 production 

and in CH 4 oxidation in rice fields determined by stable isotopes and specific 

inhibitors. Global Change Biol 8:265–280 

Krylova NI, Janssen PH, Conrad R (1997) Turnover of propionate in methanogenic 

paddy soil. FEMS Microbiol Ecol 23:107–117 

Küsel K, Pinkart HC, Drake HL, Devereux R (1999) Acetogenic and sulfate-reducing bacteria 

inhabiting the rhizoplane and deep cortex cells of the sea grass Halodule 

wrightii. Appl Environ Microbiol 65:5117–5123 

Küsel K, Karnholz A, Trinkwalter T, Devereux R, Acker G, Drake HL (2001) Physiological 

ecology of Clostridium glycolicum RD-1, an aerotolerant acetogen isolated from sea 

grass roots. Appl Environ Microbiol 67:4734–4741 

Leadbetter JR, Breznak JA (1996) Physiological ecology of Methanobrevibacter cuticularis 

sp. nov and Methanobrevibacter curvatus sp. nov, isolated from the hindgut of 

the termite Reticulitermes flavipes. Appl Environ Microbiol 62:3620–3631 

Lehmann-Richter S, Großkopf R, Liesack W, Frenzel P, Conrad R (1999) Methanogenic 

archaea and CO 2 -dependent methanogenesis on washed rice roots. Environ Microbiol 

1:159–166 

Liesack W, Schnell S, Revsbech NP (2000) Microbiology of flooded rice paddies 

[Review]. FEMS Microbiol Rev 24:625–645 

Lüdemann H,Arth I, Liesack W (2000) Spatial changes in the bacterial community structure 

along a vertical oxygen gradient in flooded paddy soil cores. Appl Environ 

Microbiol 66:754–762 

Lueders T, Chin KJ, Conrad R, Friedrich M (2001) Molecular analyses of methyl-coenzyme 

M reductase alpha-subunit (mcrA) genes in rice field soil and enrichment cultures 

reveal the methanogenic phenotype of a novel archaeal lineage. Environ Microbiol 

3:194–204 

Megonigal JP, Schlesinger WH (1997) Enhanced CH 4 emissions from a wetland soil 

exposed to elevated CO 2 . Biogeochemistry 37:77–88 

Megonigal JP,Whalen SC, Tissue DT, Bovard BD,Albert DB,Allen AS (1999) A plant-soilatmosphere 

microcosm for tracing radiocarbon from photosynthesis through 

methanogenesis. Soil Sci Soc Am J 63:665–671 

Minoda T, Kimura M,Wada E (1996) Photosynthates as dominant source of CH 4 and CO 2 

in soil water and CH 4 emitted to the atmosphere from paddy fields. J Geophys Res 

101:21091–21097 

Neue HU, Scharpenseel HW (1987) Decomposition pattern of 14 C-labeled rice straw in 

aerobic and submerged rice soils of the Philippines. Sci Total Environ 62:431–434 

Nijburg JW, Laanbroek HJ (1997) The fate of 15 N-nitrate in healthy and declining Phragmites 

australis stands. Microb Ecol 34:254–262 

Ploug H, Kühl M, Buchholz-Cleven B, Joergensen BB (1997) Anoxic aggregates – an 

ephemeral phenomenon in the pelagic environment? Aquat Microb Ecol 13:285–294 

Reichardt W, Mascarina G, Padre B, Doll J (1997) Microbial communities of continuously 

cropped, irrigated rice fields. Appl Environ Microbiol 63:233–238 

Rosencrantz D, Rainey FA, Janssen PH (1999) Culturable populations of Sporomusa spp. 

and Desulfovibrio spp. in the anoxic bulk soil of flooded rice microcosms. Appl Environ 

Microbiol 65:3526–3533 

Schrope MK, Chanton JP, Allen LH, Baker JT (1999) Effect of CO 2 enrichment and elevated 

temperature on methane emissions from rice, Oryza sativa. Global Change Biology 

5:587–599


Schütz H, Holzapfel-Pschorn A, Conrad R, Rennenberg H, Seiler W (1989) A 3-year continuous 

record on the influence of daytime, season, and fertilizer treatment on 

methane emission rates from an Italian rice paddy. J Geophys Res 94:16405–16416 

Shima S, Netrusov A, Sordel M, Wicke M, Hartmann GC, Thauer RK (1999) Purification, 

characterization, and primary structure of a monofunctional catalase from Methanosarcina 

barkeri. Arch Microbiol 171:317–323 

Shima S, Sordel-Klippert M, Brioukhanov A, Netrusov A, Linder D, Thauer RK (2001) 

Characterization of a heme-dependent catalase from Methanobrevibacter arboriphilus. 

Appl Environ Microbiol 67:3041–3045 

Sieburth JM (1991) Methane and hydrogen sulfide in the pycnocline: a result of tight 

coupling of photosynthetic and “benthic” processes in stratified waters. In: Rogers JE, 

Whitman WB (eds) Microbial production and consumption of greenhouse gases: 

methane, nitrogen oxides, and halomethanes. American Society for Microbiology, 


Stevens CM (1993) Isotopic abundances in the atmosphere and sources. In: Khalil MAK 

(ed) Atmospheric methane: sources, sinks, and role in global change, Springer, Berlin 

Heidelberg New York, pp 62–88 

Tsutsuki K, Ponnamperuma FN (1987) Behavior of anaerobic decomposition products 

in submerged soils . Effects of organic material amendment, soil properties, and temperature. 

Soil Sci Plant Nutr 33:13–33 

Tun CC, Kimura M (2000) Microscopic observation of the decomposition process of leaf 

blade of rice straw and colonizing microorganisms in a Japanese paddy field soil during 

the cultivation period of paddy rice. Soil Sci Plant Nutr 46:127–137 

Tyler SC, Bilek RS, Sass RL, Fisher FM (1997) Methane oxidation and pathways of production 

in a Texas paddy field deduced from measurements of flux, d 13 C, and dD of 

CH 4 . Global Biogeochem Cycles 11:323–348 

Van Bodegom P, Goudriaan J, Leffelaar P (2001a) A mechanistic model on methane oxidation 

in a rice rhizosphere. Biogeochem 55:145–177 

Van Bodegom P, Stams F, Mollema L, Boeke S, Leffelaar P (2001b) Methane oxidation and 

the competition for oxygen in the rice rhizosphere. Appl Environ Microbiol 67:3586– 

3597 

Vorholt JA, Chistoserdova L, Stolyar SM, Thauer RK, Lidstrom ME (1999) Distribution of 

tetrahydromethanopterin-dependent enzymes in methylotrophic bacteria and phylogeny 

of methenyl tetrahydromethanopterin cyclohydrolases. J Bacteriol 

181:5750–5757 

Watanabe A, Katoh K, Kimura M (1993) Effect of rice straw application on CH 4 emission 

from paddy fields. 2. contribution of organic constituents in rice straw. Soil Sci Plant 

Nutr 39:707–712 

Watanabe A, Yoshida M, Kimura M (1998) Contribution of rice straw carbon to CH 4 

emission from rice paddies using 13 C-enriched rice straw. J Geophys Res 103:8237– 

8242 

Watanabe A, Takeda T, Kimura M (1999) Evaluation of origins of CH 4 carbon emitted 

from rice paddies. J Geophys Res 104:23623–23629 

Weber S, Stubner S, Conrad R (2001a) Bacterial populations colonizing and degrading 

rice straw in anoxic paddy soil. Appl Environ Microbiol 67:1318–1327 

Weber S, Lueders T, Friedrich MW, Conrad R (2001b) Methanogenic populations 

involved in the degradation of rice straw in anoxic paddy soil. FEMS Microbiol Ecol 

38:11–20 

Whiting GJ, Chanton JP (1993) Primary production control of methane emission from 

wetlands. Nature 364:794–795 

Wind T, Stubner S, Conrad R (1999) Sulphate-reducing bacteria in rice field soil and on 

rice roots. Syst Appl Microbiol 22:269–279

50 

Ralf Conrad 

Yao H, Conrad R (2000) Electron balance during steady-state production of CH 4 and CO 2 

in anoxic rice soil. Eur J Soil Sci 51:369–378 

Zinder SH (1993) Physiological ecology of methanogens. In: Ferry JG (ed) Methanogenesis: 

ecology, physiology, biochemistry and genetics. Chapman and Hall, New York, pp 

128–206 

Ziska LH, Moya TB,Wassmann R, Namuco OS, Lantin RS,Aduna JB,Abao E, Bronson KF, 

Neue HU, Olszyk D (1998) Long-term growth at elevated carbon dioxide stimulates 

methane emission in tropical paddy rice. Global Change Biology 4:657–665

4 Role of Functional Groups of Microorganisms on 

the Rhizosphere Microcosm Dynamics 



This chapter discusses the role of functional microorganism groups that live 

in the rhizosphere and contribute to nutrient cycling. Soil ecology has much 

to contribute to our knowledge of important processes at the ecosystem 

level, such as how plant growth is affected by the rhizosphere biota, organic 

matter dynamics and nutrient cycling, and soil structure dynamics (Brussaard 

1998). 

Many groups work directly on plant nutrition, such as rhizobia and mycorrhiza 

fungi which are symbiotic. These groups have been studied extensively 

in the last few decades, but little has been investigated about the relationship 

between other functional groups, notwithstanding that many other interactions 

exist in the rhizosphere that are ecologically important to maintain life 

on Earth and consequently in the soil, since this is a part of the whole. 

Many steps of nutrient cycling are made exclusively by microorganism 

populations, and some of them may participate in one or more biogeochemical 

cycles. The understanding of these interactions between different populations 

according to specific phenotypes could give a better perspective about 

the processes that are occurring. A percentage of the microbial community 

can be grown in culture medium under laboratory conditions, if cultured 

microorganisms are considered as a sample of microbial community in soil 

microcosms. Grouping the microbial communities by phenotypes is more 

realistic than determining the species that are involved in these process. 

Although only a small amount of high quality data can be obtained, it is possible 

to monitor the effects of hazardous chemical products, environmental 

disturbance, and disturbances in nutrient cycling and soil fertility controlled 

by these organisms, and also ecosystem health. 

Functionality aspects are more important than biodiversity in natural or 

sustainable agriculture systems. Some questions could be raised concerning 

biodiversity. The first question that should be asked is: what is more important 

to the Earth? The number of species that compose the functional group 




52 


or the transformation power of one group? On the other hand, other questions 

could be asked such as: what is the importance of one species inside the 

biological dynamic system? What is the capacity of one species to influence 

nutrient cycling? What does a species represent within the biological 

dynamic? What importance can one species have in nutrient cycling? These 

questions could lead us to conclude that we need to review our vision of the 

soil microcosm, extend our understanding of the biological processes and 

interactions that occur in the soil – plant system, assuming that these 

processes are a whole, and each functional group is only a small fraction of 

the whole. Only in this way can we improve the determination of the environmental 

impact of any disturbance effect on the soil microbial community, not 

only on one specific group of microorganisms. The several functional groups 

which take part in different stages of the carbon, phosphorus, nitrogen and 

sulphur biogeochemical cycles should be assessed, looking for a correlation 

between them and a response in plant growth. 

Microflora biodiversity is important for other objectives, such as searching 

for specific microbial phenotypes to use in food or the pharmaceutical industry. 

Its importance in the environment should also be investigated, since molecular 

biology does not permit assessment of the microbial interaction mechanisms 

in the soil microcosm. 

2 General Aspects of Functional Groups of Soil 

Microorganisms 

In a soil microbial ecosystem individual cells grow and form populations 

(Fig. 1). Metabolically related populations constitute groupings called functional 

groups, and sets of functional groups conducting complementary physiological 

processes interact to form microbial communities. Microbial communities 

then interact with communities of macroorganisms to define the 

whole biosphere. 

We can define the functional groups of microbial populations that take 

part in the same transformation of nutrients in the soil, where the same population 

of microorganisms may participate in different steps in different 

Individual Population 

Fig. 1. The individual cells grow and form populations

Population 1 

Population 2 

Population 3 

Population 4 

Population 5 

cycles (Fig. 2). An example is the cellulolytic functional group; if the soil suspension 

is inoculated in Petri dishes with selective culture media for cellulolytic 

microorganisms, where cellulose is the only carbon source, and the 

culture is incubated at 28 °C for 3 days, some colonies will form halos around 

the colonies after staining with Congo red. If we count the different organisms 

by decreasing order of numbers, we can observe colonies forming units 

of fungi, actinomycetes and then bacteria. Many species will be observed 

within the fungi group, as will also occur with actinomycetes and bacteria 

populations. 

The number of colony forming units (CFU) and the ratio between colony 

size and degradation halo diameter should be considered in an evaluation 

study, while assessing the cellulolytic activity. These parameters determine 

the community size and/or the activity of the individuals that compose it. The 

biodiversity of the fungi, actinomycetes and bacteria that form this functional 

group are secondary parameters when assessing the functionality of the biogeochemical 

cycle under study. 

3 Carbon Cycle Functional Groups 

4 Microorganisms on the Rhizosphere Microcosm 53 

Celulase 

producers 

Protease 

producers 

Functional 

group of 

celulolytic 

Functional 

group of 

Proteolytic 

Fig. 2. Many populations of microorganisms may participate in one or more 

biogeochemical cycling 

C cycle 

N cycle 

The largest carbon reservoir is present in the sediments and rocks of the 

Earth, but the turnover time is so long that flow from this compartment is relatively 

insignificant on a human scale. From the viewpoint of living organisms, 

a large amount of organic carbon is found in land plants. This represents 

the carbon of forests and grasslands and constitutes the major site of photosynthetic 

CO 2 fixation. However, more carbon is present in dead organic 

material, called humus, than in living organisms (Madigan et al. 2000) 

Plant residues are the largest fraction of all organic carbon entering the 

soil. Plants contain 15–60 % cellulose, 10–30 % hemicellulose, 2–30 % lignin,

54 


and 2–15 % protein. Soluble substances, such as sugars, amino sugars, organic 

acids, and amino acids, can constitute 10 % of the dry weight (Paul and Clark 

1989). Soil microbes use residue components as substrates for energy and also 

as carbon sources in the synthesis of new cells. The presence or absence of 

substrates can increase or decrease the populations. 

Microorganism populations capable of cellulose, starch and both animal 

and plant protein hydrolisation can be assessed in the carbon cycle. These 

polymers are broken into smaller units of sugars and amino acids, respectively 

(Fig. 3). 

The functional group of cellulotic microorganisms is formed by fungi, 

actinomycetes and bacteria. These microorganisms can produce exoenzymes 

called cellulases. The term cellulase describes a diversity of enzyme complexes 

that act in two distinct stages. First, there is a loss of the crystalline 

Photosynthesis 

POLYMERS 

Celulose, Starch, Protein 

Hidrolytic 

Activity 

UNITS 

Sugar, Amino acids 

Aerobic 


Plant 

Biosynthesis 

Sun Light 

CO2 

CO2 + H2O 

Energy 

Biomass 

Fig. 3. The activity of some functional groups of 

microorganisms in the carbon cycle


structure, and then the depolymerisation itself occurs. The resultant disaccharide, 

cellobiose, is hydrolysed by the enzyme cellobiase to glucose (Paul 

and Clark 1989). 

The amylolytic group hydrolyses starch, which is a common reserve of 

polysaccharide that serves as an energy storage product in plants. Starch is 

called amylose when it is a linear polymer of glucose linked in the a1-4 position. 

The a1-4 linkage facilitates a more rapid breakdown rate than the b1-4 

linkage found in cellulose. Glucose can also be found linked in a1-6 positions 

to produce a polymer known as amylopectin. 

Extracellular enzymes known as amylases are produced by numerous 

fungi, actinomycetes and some bacteria. a-amylases hydrolyse both amylose 

and amylopectin to units consisting of several glucose molecules. b-amylase 

reduces amylose to maltose (two glucose units), subsequent hydrolysis of maltose 

by an a1-4 glucosidase (maltase) yields glucose, and amylopectin is broken 

down to a mix of maltose and dextrins. 

The proteolytic functional group can act in both the carbon and nitrogen 

cycles, described later. Many microorganisms, such as fungi, actinomycetes 

and bacteria may produce extra-cell enzymes called proteinases and peptidases. 

The proteinases degrade proteins releasing peptides which in turn are 

attacked by the peptidases releasing amino acids which are transported inside 

the cells (Fig. 3). 

The amino acids may be used as a source of either carbon or nitrogen. In 

the carbon cycle, the amino acids are catabolised into various compounds, as 

intermediate metabolites of the glucolytic path or tricarboxylic acid cycle. In 

this conversion, the amino acid undergoes a de-amination process where the 

amine group is removed and converted into ammonia (NH 3 + ) which may be 

excreted by the cells. The carboxylic group can enter in the tricarboxylic acid 

cycle or undergo a process of de-carboxylisation (removal of COOH) and dehydrogenisation, 

releasing carbon dioxide and nitrogen compounds, such as 

amines and di-amines. 

4 Functional Groups of Microrganisms of the Nitrogen Cycle 

Plants, animals, and most microorganisms require combined forms of nitrogen 

for incorporation into cellular biomass, but the ability to fix atmospheric 

nitrogen is restricted to a limited number of bacteria and symbiotic associations.Whereas 

many habitats depend on plants for a supply of organic carbon 

that can be used as a source of energy, all organisms depend on the bacterial 

fixation of atmospheric nitrogen (Atlas and Bartha 1993). 

Several functional groups in the nitrogen cycle can be used as bioindicators 

of disturbances in the soil. Among these, the groups to be considered are the 

symbiotic or free-living nitrogen fixers for legumes and non-legumes plants, 

respectively, and others which participate in the mineralisation process of the

56 


organic nitrogen in the soil such as free-living ammonifiers and protozoans, 

which also have an important function of mobilisation and mineralisation of 

nitrogen compounds (Fig. 4). The choice of these groups within the nitrogen 

cycle was based on their ability to produce ammonia as an end product. Both 

the nitrogen fixers and the ammonifiers such as the protozoa release ammonia 

into the rhizosphere. However, the pathway production is different: (1) the 

first group uses atmospheric nitrogen that by biological fixation produces 

ammonia, (2) the second group takes part in the mineralisation process of 

nitrogen organic compounds and, (3) the third group, such as microorganism 

predators, obtain proteins from their prey and excrete ammonia, among other 

substances. 

Atmospheric nitrogen fixation is a fundamental process for the maintenance 

of the biosphere, as all organisms require proteins. Nitrogenase is an 

enzyme complex which is responsible for nitrogen fixation and requires great 

quantities of energy for its activity. Non-symbiotic biological fixation of 

nitrogen is carried out by some free-living bacteria genera which are associ- 

Protozoans 

Feeding 

Bacteria 

Excretion 

Microbiota 

Proteins 

Aminoacids 

Excretion 

Celular death 

Proteases 

Peptidases 

Microbial 

Mineralization 

NH4 + N2 

Nitrogen 

fixation 

Fig. 4. The activity of some functional groups of microorganisms in the nitrogen cycle


ated with the plant rhizosphere. The symbiotic association of microorganisms 

and legumes is the most effective in terms of the quantity of nitrogen 

fixed. The quantity of nitrogen fixed per year by these microorganism groups 

is much greater than free-living fixing. 

The mineralisation of nitrogen compounds in the soil (ammoniation and 

nitrification) is an essentially microbiological process. The two phases are 

equally important because the plants are capable of absorbing the nitrogen in 

the two forms (NH 3 + and NO3 – ). When there is no addition of nitrogen fertilisers, 

as in the case of natural areas, nitrification depends on the ammoniation 

rate for the supply of NH 3 + substrate. 

Ammoniation which occurs in the de-amination process of nitrogen 

organic compounds is carried out by a large variety of heterotrophic microorganisms 

that can use amino acids as a source of nitrogen and carbon. 

The protozoans are composed of the three groups flagellates, amoebae and 

ciliates and are important in maintaining plant-available nitrogen and the 

mineralisation process. The role of protozoa in the soils is still unclear, but 

evidence for their central position is now accumulating. Protozoans can consume 

150–900 g of bacteria m –2 year –1 , which is equal to a production of 15–85 

times standing crop (Stout and Heal 1967). This means that preying on bacteria 

is an important mechanism in nutrient uptake, resulting in greater mineralisation 

and higher nitrogen release by plants (Juma 1993; Fig. 4). 

The correlation among these functional groups is obvious and very important 

in maintaining the nitrogen cycle and soil fertility. Any factor which 

alters the populations of these groups will have an immediate response in 

plant growth. 

5 Functional Groups of Microrganisms of the Sulphur Cycle 

Plants, algae, and many heterotrophic microorganisms assimilate sulphur in 

the form of sulphate. For incorporation into amino acids biosynthesis as cysteine, 

methionine and coenzymes in the form of sulphydril (S-H) groups, sulphate 

needs to be reduced to the sulphide level by assimilatory sulphate 

reduction. 

The stages assessed in the sulphur cycle involve the organic sulphur mineralisers 

and the sulphate reducers. These two functional groups participate at 

different stages of the sulphur cycle and have hydrogen sulphide (H 2S) formation 

as an end product. Hydrogen sulphide, which is volatile, may decrease the 

sulphur concentration if it does not complex with other compounds in the soil 

(Fig. 5). 

Mineralisation of organic sulphur in soil is greatly mediated by microbial 

activity. Carbon-linked sulphur is mineralised either though oxidative (aerobic) 

decomposition or a desulphirisation (anaerobic) process. The mineralisation 

process may be direct (cell-mediated), involving enzymes such as sul-

58 

SO4 


Assimilatory 

sulfate 

Reduction 

Dissimilatory 

Sulfate 

reduction 

Living organisms 

Proteins 

Sulphur 

aminoacids 

H2S 

Excretion 

Celular death 

Proteases 

Peptidases 

Dissimilatory 

Sulfate 

Reduction 

Fig. 5. The activity of some functional 

groups of microorganisms in the sulphur 

cycle 

phatases where elements such as nitrogen and sulphur-linked carbon mineralised 

by microorganisms oxidize the organic carbon compounds to obtain 

energy. The heterotrophic soil microorganisms decompose organic sulphur to 

form sulphide. In the case of indirect mineralisation, those elements that exist 

as sulphate esters are hydrolysed by endo or exoenzymes. This process occurs 

by positive feedback or negative control (Sylvia et al. 1998). 

The activity of these microorganisms may be aerobic or anaerobic. Anaerobic 

microorganisms exist in fairly low numbers in the rhizosphere of plants 

which live in non-flooded soils. Bearing in mind that sulphate is fundamental 

for plant metabolism and that the turnover of organic to inorganic sulphate 

implies availability of the nutrient for plant growth, the study of these populations 

may complement the analysis of functional microorganism groups as 

indicators of environmental impact or of biotic fertility indexes in sustainable 

agricultural systems or natural areas.

6 Functional Groups of Microrganisms 

of the Phosphorus Cycle 


The main functional groups of the phosphorus cycle are the mycorrhizal 

fungi and the inorganic phosphate solubiliser microorganisms. The interaction 

between these two microbial groups is fundamental for the nutrition of 

the majority of native plants and is also of agronomic interest. 

The phosphate solubiliser functional group can include fungi, actinomycetes 

and bacteria that are capable of solubilizing inorganic phosphate by 

production and excretion of organic and inorganic acids, of a phosphatase 

group of enzymes and of carbon dioxide (CO 2) in the rhizosphere soil solution. 

Carbon dioxide can cause the solubilisation of calcium, magnesium and 

Heterotrophic 


Insoluble 

Inorganic 

Phosphate 

Nitrifying 

Bacteria 

CO2 

Organic 

Acids Soluble 

Inorganic 

Phosphate 

Mycorrhiza 

Fungi 

Plant 

Root 

Nitric Acid 

Sulfur Oxiding 

Sulfur Reducing 

H2SO4 

H2S 

Fig. 6. The activity of some functional groups of microorganisms in the phosphorus 

cycle

60 


phosphate compounds. The nitrifying, sulphur oxidants and sulphur- reducing 

bacteria can also solubilise insoluble phosphate salts and produce H 2S 

under anaerobic conditions. Many microorganisms and plants can produce 

organic acids by acting as solubilizing agents and quelants and releasing 

orthophosphate in the soil solution (Sylvia et al. 1998). Soluble phosphate in 

the soil solution can be absorbed and transported to the plant by arbuscular 

mycorrhizal (AM) fungus mycelia. The interaction between the phosphate 

solubilisers and the mycorrhizae can stimulate mycorrhizal colonisation 

and/or plant growth by increasing the phosphorus levels (Fig. 6). 

The arbuscular mycorrhizal fungi are symbiotic fungi of plant roots. This 

symbiosis is present in almost all plants in the most different ecosystems 

(Hayman 1982). The symbiotic relationship between plant roots and mycorrhizal 

fungi improves plant mineral nutrient acquisition from the soil, especially 

immobile elements such as P, Zn and Cu, but also more mobile ions such 

as S, Ca, K, Fe, Mg, Mn, Cl, Br and N (Tinker 1984). In soils where such elements 

may be deficient or less available, mycorrhizal fungi increase efficiency 

of mineral uptake, resulting in increased plant growth (Linderman 1988). 

The mycorrhizal complex (AM fungi and root) changes the nutritional and 

physicochemical conditions of the rhizosphere, and has a large negative or 

positive impact on the functional microorganism groups. This effect depends 

on the cycle to which the functional group belongs. However, in spite of the 

importance of the mycorrhizae, these groups should not be assessed in isolation. 

7 Dynamics of the Rhizosphere Functional Groups 

of Microrganisms 

The interaction of specific biological systems, in a ecosystem or microcosm, 

depends on the interplay of three general factors – environment, biological 

community structure (biodiversity), and biological activity (function). The 

role of diversity, particularly of microorganisms, and the relationship 

between microbial diversity and function is largely unknown (Griffiths et al. 

1997). As can be seen, each functional group can interact with different biogeochemical 

soil cycles and the environmental impact caused by an agent can 

be determined by the changes observed in the populations, as a determined 

environmental condition can affect the microbial activity without affecting 

the community biodiversity (Griffiths et al. 1997). The dynamic behaviour of 

perturbed communities is a branch of general ecology closely related to the 

study of natural and artificial disturbances in microbial habitats. Another 

important factor is the relationship between resistance and resilience, whose 

combined effects determine the ecosystem stability. Resistance is the inherent 

capacity of the system to hold disturbance, whereas resilience is the capacity 

to recover after disturbance.


8 Relationship Among r and k Strategist Functional Groups 

The determination of the r and k strategists (Andrews 1984) is also related to 

soil disturbance, resilience and health. The r strategist microorganism has a 

high reproductive rate with few competitive adaptations. On the other hand, 

the k strategist microorganism reproduces more slowly than the r strategist, 

and is usually a more stable and permanent member of the community. 

Fungi and actinomycetes are normally k strategists and are involved in the 

carbon cycle degrading cellulose and structural proteins among other macromolecules. 

The stability of these compounds and the slow k strategist growth 

rate render them not very sensitive to swift environmental changes. On the 

other hand, the r strategists such as bacteria are more sensitive to quick environmental 

changes. Heterotrophic bacteria populations are affected by the 

lack of carbohydrates which occurs due to changes in the rhizosphere carbon 

flow in the photosynthesis function variations between day and night. Only 

heterotrophic bacteria populations that have metabolic diversity and can 

manage to use other compounds, such as amino acids for obtaining carbon 

and energy, will keep their numbers in the rhizosphere. The other populations 

decrease their CFU number. Plants begin photosynthesis at daybreak with a 

consequent increase in carbon concentration in the exudates, and the heterotrophic 

bacteria community returns to its previous composition. 

9 Arbuscular Mycorrhizal Fungi Dynamics in the 

Rhizosphere 

The MA can also be considered k strategists and influence several biogeochemical 

soil cycles: (1) the carbon cycle due to alterations in the flow of carbon 

compounds from the exudates, (2) the phosphorus cycle due to stimulus 

to phosphate-solubilising bacteria activity and absorption of soluble phosphorus 

by plants (Toro 1998), (3) the nitrogen cycle due to stimulus to symbiotic 

(Toro 1998) and non-symbiotic fixation (Vosátka and Gryndler 1999) and 

to the rhizosphere ammoniation process (Amora-Lazcano et al. 1998). The 

sulphur cycle is also influenced by alterations in the autotrophic sulphur oxidising 

and sulphate reducing bacteria populations (Amora-Alzcano and Azón 

1997). 

The term mycorrhizosphere (Oswald and Ferchau 1968) refers to the zone 

of influence of the mycorrhiza (fungus-root) in the soil. The mycorrhizosphere 

has two components. One is the rhizosphere, a thin layer of soil that surrounds 

the root and is under the joint, direct influence of the root, root hairs, 

and AM hyphae adjacent to the root. The other, the hyphosphere, is not 

directly influenced by the root. The hyphosphere is a zone of AM hypha-soil 

interactions (Marschner 1995), and may be more or less densely permeated by 

the AM soil mycelium.

62 


In our laboratory, hypha colonisation of some MA fungus species by bacteria 

in spores germinated in 1 % agar-water medium on a Petri dish was 

observed. These bacteria had as their single nutrient source the products 

excreted by the MA mycelia in the medium (Fig. 7). The bacteria formed a 

dense cell layer around the hypha in an experiment with Glomus etunicatum. 

From this layer, as the exudate excretion increased the medium nutrient to 

optimum levels, the bacteria developed and colonised the remaining mycelia 

(Fig. 8). 

In an axenic conditions experiment with maize plants and colonised Glomus 

clarum mycelia, the bacteria which colonised the G. clarum mycelia without 

plants continued to prefer products excreted by the mycelia, and no 

colonies were observed in the plant roots (Fig. 9). These results seem to indicate 

that the fungus mycelia produce some growth factor essential for the bacteria 

growth, which is not found in the maize root exudates. However, the 

mechanisms involved in this interaction are not yet known. 

H 

A B 

Fig. 7. Bacterial growth around arbuscular mycorrhiza hyphae in water-agar 1 %. BC 

Bacteria colonies , H hyphae. A Scutellospora heterogama (x40), B corresponds to black 

box indicated in A (x100) C Glomus clarum (x100) 

BC 

C 

BC 

H


Fig. 8. Bacterial colonising AM hyphae of Glomus etunicatum in 1 % water-agar. BC Bacteria 

colonies, H hyphae. A General aspects of mycelia colonised by bacteria (x20), B corresponds 

to black box indicated in the A, where bacteria is growing around hyphae 

(x100), C bacteria growing around hyphae (x400) 

In the soil, Andrade et al. (1997) observed sorghum plants inoculated with 

several exotic or native Glomus species either exotic or native to the test soil. 

The soils adhering to the root were considered rhizosphere or not adhering to 

the root were considered hyphosphere. Bacterial numbers were greater in 

rhizo- than in hyphosphere soil. Isolates of Bacillus and Arthrobacter were 

most frequent in hyphosphere and Pseudomonas in rhizosphere soils. More 

bacterial species were found in hyphosphere than in rhizosphere soil, and 

bacterial communities varied within and among AM treatments. The development 

of the AM mycelium in soil had little influence on the composition of 

the microflora in the hyphosphere, while AM root colonisation was positively 

related with bacterial numbers in the hyphosphere and with the presence of 

Pseudomonas in the rhizosphere. 

In another experiment, Andrade et al. (1998) inoculated Alcaligenes eutrophus 

and Arthrobacter globiformis in sorghum plants. The first is an isolate 

of the Glomus mosseae hyphosphere and the second an isolate of the G. 

mosseae and G. intraradices mycorrhizosphere. Ten days after inoculation,

64 


Fig. 9. Bacteria colonising mycelia of Glomus clarum in the hyphosphere of maize plants 

grown under axenic conditions in 1 % water-agar. Bacteria did not colonise maize roots, 

colonies were observed only around mycelia (x40). BC Bacteria colonies, H hyphae, R 

root 

the A. globiformis population present in bulk soil, in the rhizosphere and 

hyphosphere were similar, but that present in the mycorrhizosphere was 

larger. A. eutrphus was dependent on the presence of G. mosseae in the soil, 

indicating that even in soil some bacteria may depend on MA-excreted 

metabolic products. 

These results show that the MA-plant system is very complex and the influence 

of these microorganisms is fundamental for the regulation of the biogeochemical 

cycles in the rhizosphere system. On the other hand, the 

microorganisms of other cycles also influenced the mycorrhizal activity and 

root infection with direct consequences on the plant growth and soil fertility. 

In degraded areas of tropical regions, the soil is compacted displaying minimum 

aeration and draining capacity, aluminium and manganese toxicity 

and low fertility indices especially for nitrogen, phosphorus and organic matter. 

In these areas, the re-vegetation process is directly related to the interaction 

between the plant roots and the functional microorganism groups. The 

pioneer plants are the first to colonise these low fertility areas, and they are 

very dependent on AM for phosphorus. The pioneer plants in this process are 

r strategists which improve the physicochemical characteristics of the soil 

and fertility levels with time, allowing other groups of more demanding


plants (k strategists) to establish in the area and to form a forest in equilibrium. 

The pioneer plants can survive under adverse conditions due to the presence 

in the rhizosphere of microorganisms which supply nutrients for their 

metabolism, and in turn, their exudates maintain these rhizosphere microorganisms. 

The k strategist mycorrhizae are sufficiently stable to maintain the 

required nutrient levels for this plant group. In this sense, groups of r strategist 

microorganisms succeed each other, maintaining the dynamic of the system 

and the reconstitution of other biogeochemical cycles until the system 

equilibrium is reached with the establishment of late secondary and climax 

plant groups. 

10 Dynamics Among the Functional Microrganism Groups 

of the Carbon, Nitrogen, Phosphorus and Sulphur Cycles 

There are several stages in each biogeochemical cycle, and many microorganisms 

can take part in one or more cycles depending on the diversity of their 

metabolic path (Fig. 10). Microbiota metabolic versatility makes a single bacteria 

species able to use various carbohydrates, such as glucose, fructose and 

saccharose, as a carbon and energy source, and in their absence they can use 

amino acids or other compounds. 

The biosphere is composed of all living organisms which depend on matter 

transformation for their maintenance. The functional microorganism groups 

are inserted in this system which transforms matter and maintains the levels 

of nutrients available on Earth. Due to their functional importance, they can 

be used as biological indicators to determine any natural or artificial impact 

which may occur in the soil. It is obvious that the complexity of the biological 

interactions occurring on the soil–plant interface must be simplified to allow 

quick and accurate assessment of these microorganism populations. Thus, 

only those stages of the biogeochemical cycles which directly influence plant 

growth should be chosen. However, different stages can be selected according 

to the experimental objective. 

Autotrophic organisms have the important function of matter de-mineralisation 

and transform it into organic molecules. In this group are plants that 

de-mineralise carbon, i.e. transform carbon dioxide (CO 2) into glucose, which 

is then polymerised mainly into starch, cellulose, hemicellulose and lignin. 

Plants are also responsible for transforming NO 3 – ,NH3 + ,and SO4 2– into amino 

acids, PO 4 2– into nucleic acids while ATP, NADP, and SO4 2– can be transformed 

into glutathione. 

In a simplified way, plants can be considered as nutrients from the soil 

solution plus solar energy accumulated in chemical form. Plants generally 

release organic molecules into the soil in two ways: (1) by depositing dead 

plant material to form the litter; and, (2) by exuding excretion and lysates into

66 


Plants 

Carbon 

Desmineralization 

Starch 

Celulose 

Lignin 

Hidrolytic 

Activity 

Sugars 

Carbon 

Source 

Heterotrophic 


CO2 

Organic Acids 

Soluble 

Inorganic 

Phosphate 

Carbon Source 

N 


Carbon Source 

Sulfur 

Source 

Carbon 

Nitrogen 

Source 

SO4 -2 

BIOSPHERE 

H2SO4 

Insoluble 

Inorganic 

Phosphate 

Phosphatases 

Proteins 

Mycorrhiza 

Fungi 

Protozoans 

Proteases 

Peptidases 

Microbial 

mineralization 

H2S 

Excretion 

Phosphate 


NH3 + 

Plant 

Root 

NO3 - 

Nutrient Uptake 

N2 

Nitrogen 

fixation 

Aminoacids 

Nitrogen 


Sulfur 

mineralization 

Nitrification 

Sulfate 

Reduction 


Organic 

Phosphate 

Feeding 

Bacteria 

Organic Acids 

Nitric Acid 


Fig. 10. The interaction among functional groups of microorganisms in the carbon, 

nitrogen, phosphorus and sulphur cycles


the rhizosphere, a phenomenon known as rhizodeposition. These compounds, 

which are continuously released into the soil, constitute the main 

nutrient sources, maintain the microbiota, the fertility and participate in the 

maintenance of the soil structure. 

Microorganisms are classified into several categories according to the carbon 

and energy source used, but only some groups will be considered in this 

chapter. The heterotrophic microorganisms can use glucose or amino acids as 

carbon sources. Glucose can be obtained from some macromolecules, such as 

cellulose and starch, which undergo lytic action by enzymes produced by the 

cellulose and starch-reducing microorganisms (Fig. 10). 

Proteins are degraded to amino acids by proteolytic organisms, which can 

use these compounds as carbon or nitrogen sources. On the other hand, sulphur 

amino acids such as cystine and cysteine can also be used to obtain sulphur 

which is used in the biosynthesis of other compounds necessary for cell 

metabolism. The amino acids can also be used by the cell without lysis of the 

molecule, as many microorganism species are not able to biosynthesise all the 

amino acids required by the cell. 

Protozoa, such as amoebas, ciliates and flagellates, are organisms which 

have the function of immobilising and mineralising the nitrogen in the rhizosphere 

system. Bacteria are their main nutrient source, and they obtain 

nitrogen and other nutrients for their metabolism from them. Some of these 

nitrogen compounds are released into the soil as inorganic NH 3 + and can be 

absorbed by the root or by other microorganism groups such as nitrifiers, sulphate 

reducers or oxidisers or phosphate solubilisers. Biological nitrogen fixation 

is very important in the introduction of NH 3 + molecules into the rhizosphere 

(free-living N fixers) or in the plant (symbiotic N fixers). These fixed 

molecules can be transformed in NO 3 – or used in the biosynthesis of amino 

acids that will form the cell proteins when polymerised. Sulphur amino acids 

may be synthesised from SO 4 2– obtained by the oxidation of S by sulphur cycle 

bacteria. NO 3 – and NH3 + can be used in amino acid biosynthesis and also as 

final receptors of electrons for some groups of facultative anaerobic bacteria. 

Phosphate exists in the soil mainly in the soluble inorganic form. Several 

solubilisation mechanisms have been described and many microorganisms 

produce compounds which can solubilise phosphates. The nitrogen cycle 

functional group, the nitrifiers, produces NO 3 – that can form nitric acid. The 

sulphur cycle functional group can produce SO 4 2– that can form H2SO 4 or 

reduce it to H 2S, which will also solubilise insoluble inorganic phosphate. In 

the degradation of sulphur amino acids, proteolytic microorganisms release 

H 2S or CO 2, which can form carbonic acid. Both molecules can also solubilise 

inorganic phosphate. The carbon cycle microorganisms form CO 2 and 

organic acids as end products of their catabolism, and both compounds are 

responsible for pH reduction and inorganic phosphate solubilisation. 

Soluble inorganic phosphate is absorbed mainly by the mycorrhizal fungi 

that transport these molecules to the plant, which in turn transform them into

68 


organic phosphate. This phosphate is deposited in the soil by rhizodeposition 

or absorbed in the organic form by heterotrophic microorganisms which take 

part in the nitrogen, carbon or sulphur cycles (Fig. 10). 


Amora-Lazcano E, Azcón R (1997) Response of sulfur cycling microorganisms to arbuscular 

mycorrhizal fungi in the rhizosphere of maize. Appl Soil Ecol 6:217–222 

Amora-Lazcano E, Vázquez MM, Azcón R (1998) Response of nitrogen-transforming 

microorganisms to arbuscular mycorrhiza fungi. Biol Fertil Soils. 27:65–70 

Andrade G, Linderman RG, Bethlenfalvay GJ (1998) Bacterial associations with the mycorrhizosphere 

and hyphosphere of the arbuscular mycorrhizal fungus Glomus 

mosseae. Plant Soil 202:79–87 

Andrade G, Mihara KL, Linderman RG, Bethlenfalvay GJ (1997) Bacteria from rhizosphere 

and hyphosphere soils of different arbuscular mycorrhizal fungi. Plant Soil 

192:71–79 

Andrews JH (1984) Relevance of r and k theory to the ecology of plant pathogens. In: 

Klug MJ, Reddy CA (eds) Current perspectives in microbial ecology. American Society 

for Microbiology, Washington, pp 1–7 

Atlas RM, Bartha R (eds) (1993) Microbial ecology: fundamentals and applications, 3rd 

edn. The Benjamin/Cummings Publishing Company, California, 563 pp 

Brussaard L (1998) Soil fauna, guilds, functional groups and ecosystem processes. Appl 

Soil Ecol 9:123–135 

Griffiths BS, Ritz K, Wheatley RE (1997) In: Insan H, Ranger A (eds) Microbial communities: 

functional versus structural approaches. Springer, Berlin Heidelberg New York, 

pp 1–10 

Hayman DS (1982) Influence of soils and fertility on activity and survival of vesiculararbuscular 

mycorrhizal fungi. Phytopathology 72:1119–1125 

Juma NG (1993) Interactions between soil structure/texture, soil biota/soil organic matter 

and crop production. Geoderma 57:3–30 

Linderman RG (1988) Mycorrhizal interactions with the rhizosphere microflora. The 

mycorrhizosphere effect. Phytopathology 78:366–371 

Madigan TM, Martinko JM, Parker J (eds) (2000) Microbial ecology. In: Brock biology of 

microorganisms, 9th edn, Prentice Hall, New Jersey, pp 642–719 

Marschner H (ed) (1995) The soil–root interface (rhizosphere) in relation to mineral 

nutrition. Mineral nutrition of higher plants, 2nd edn. Academic Press, London, pp 

537–595 

Oswald ET, Ferchau HA (1968) Bacterial associations of coniferous mycorrhizae. Plant 

Soil 28:187–192 

Paul EA, Clark FE (eds) (1989) Carbon cycling and soil organic mater. In: Soil microbiology 

and biochemistry. Academic Press, San Diego, pp 93–116 

Stout JD, Heal OW (1967) Protozoa. In: Burgues A, Raw F (eds) Soil biology. Academic 

Press, New York, pp 149–195 

Sylvia DM, Fuhrman JJ, Hartel PG, Zuberer DA (eds) (1998) Principles and applications 

of soil microbiology. Prentice Hall, Englewood Cliffs, pp 346–367 

Tinker PB (1984) The role of microorganisms in mediating and facilitating the uptake of 

plant nutrients from soil. Plant Soil 76:77–91 

Toro M,Azcón R, Barea JM (1998) The use of isotopic dilution techniques to evaluate the 

interactive effects of Rhizobium genotype, mycorrhizal fungi, phosphate-solubilizing


rhizobacteria and rock phosphate on nitrogen and phosphorus acquisition by Medicago 

sativa. New Phytol 138:265–273 

Vosátka M, Gryndler M (1999) Treatment with culture fractions from Pseudomonas 

putida modifies the development of Glomus fistolosum mycorrhiza and response of 

potato and maize plants to inoculation. Appl Soil Ecol 11:245–251

5 Diversity and Functions of Soil Microflora in 

Development of Plants 

Ramesh Chander Kuhad, David Manohar Kothamasi, 

K. K. Tripathi and Ajay Singh 


Soil is a dynamic and complex system consisting of living organisms interacting 

with inorganic mineral particles and organic matter. A wide range of 

functions is performed by soil that directly or indirectly sustains the world’s 

human population. Soil plays a vital role in food production, as a reservoir 

for water and filter for pollutants. Soils store almost twice as much carbon 

as the atmosphere does and are important links in the natural cycle that 

determines atmospheric carbon dioxide level (O’Donnell and Görres 1999). 

Soils sustain an immense diversity of microbes, which exceeds that of 

eukaryotic organisms (Torsvik and Øvreås 2002). Microorganisms exist in 

every conceivable place on earth, even in extreme environments. One gram 

of soil may harbor up to 10 billion microorganisms of possibly thousands of 

different species. 

It is widely accepted that the extent of microbial diversity has not been adequately 

explored. Some bacteriologists believe that about 100,000 to 1 billion 

bacterial species actually exist in the earth environment and only about 4000 

species have been described (Staley 1997). Mycologists estimate that there are 

more than 1.5 million species of fungi of which only 72,000 species have been 

isolated or described (Hawksworth 1997). Microorganisms can exist either in 

an active or in a dormant yet persistent form. The ratio of viable counts to 

direct counts reflects the ratio between the numbers of the active (dividing) 

cells and the quiescent cells, and most bacteria in soil are in the latter form 

(Hattori et al. 1997). The tropics are considered to be richer in microbial 

diversity than boreal or temperate environments (Hunter-Cevera 1998). Some 

microbiologists believe that there is an equal amount of microbial diversity in 

the deserts.Actinomycetes with motile spores appear to be widely distributed 

in littoral zones and arid environments. 

Analysis of microbial functional diversity is important when considering 

the ability of the ecosystem to respond to changing environmental conditions, 

links between ecosystem processes and functional diversity and the 




72 

Ramesh Chander Kuhad et al. 

need to conserve the microbial gene pool (Prosser 2002). Fortunately, with the 

development of advanced molecular in situ methods and improved cultivation 

procedures, more accurate estimates of the microbial functional diversity 

on earth can be predicted and their role in the soil ecosystem can be thoroughly 

evaluated. In this chapter, the interaction and functional diversity of 

microorganisms in the soil environment related to plant growth and development 

is discussed. 

2 Functional Diversity of Soil Microflora 

The microbial functional diversity encompasses a range of activities and has 

been assumed to influence ecosystem stability, productivity and resilience 

towards stress and disturbances. Typically, microorganisms decrease with 

depth in the soil profile, as do the plant roots and soil organic matter. Differences 

in microbial community structures reflect the ability of microorganisms 

to respond to specific environmental controls and substrates (Paul and 

Clark 1998). For example, the arbuscular mycorrhizal fungus, Glomus,occurs 

worldwide on a variety of agricultural plants. Examination of the crop rotations 

shows that strains of this fungus change with the type and nutrition of 

the host crop. The fluorescent pseudomonads are attracted to plant roots and 

show genetic and physiological divergence between soil and plant surfaces. 

While Penicillium is abundant in temperate and cold climates, Aspergillus 

predominates in warm areas. Cyanobacteria are commonly found in neutral 

to alkaline soils, but rarely under acidic conditions. Depending on the preferred 

metabolites present in the soil, nitrogen-fixing, sulfur- and hydrogenoxidizing 

and nitrifying bacteria are often found in addition to the denitrifiers, 

sulfate-reducers and methanogens. Various microbial processes in soil, 

which directly or indirectly influence plant development, are shown in 

Table 1. 

Microbiologists are continually learning that microbial function in the 

ecosystem is as diverse as the microbes themselves. In studying functional 

relationships between agricultural plants and microbes, Shen (1997) reported 

that Pseudomonas and Bacillus spp. enable plants to remain healthy and help 

improve growth yields. Microbially digested organic waste enhances plant 

growth and improves soil structure and nutrients (Shen 1997). Denitrifying 

bacteria can utilize nitrous oxides (NO x) as the terminal electron acceptor. 

Many denitrifiers produce NO x reductase and can metabolize NO x in aerobic 

and anaerobic conditions (Stepanov and Korpelal 1997). 

Soil comprises a variety of microhabitats with different physicochemical 

gradients and discontinuous environmental conditions. Microbes adapt to the 

microhabitat and live together in consortia with more or less clear boundaries, 

interacting with each other and with other parts of the soil biota (Yin et 

al. 2000; Tiedje et al. 2001). Competitive interactions are also thought to be a

5 Diversity and Functions of Soil Microflora in Development of Plants 73 

Table 1. Major processes of soil microflora influencing plant growth 

Microbial process Examples of microbes 

Organic matter decomposition Trichoderma, Fusarium, Bacillus, Streptomyces, 

Clostridium 

Symbiotic nitrogen fixation Rhizobium, Bradyrhizobium, Frankia, Anabaena 

Nonsymbiotic nitrogen fixation Azotobacter, Beijerinckia, Aerobacter, Chlorobium, 

Nostoc 

Nitrogen mineralization Bacillus, Pseudomonas, Serratia 

Nitrification Nitrobacter, Nitrosomonas 

Denitrification Achromobacter, Pseudomonas 

Phosphate solubilization Azotobacter, Enterobacter, Bacillus, Aspergillus, 

Penicillium, Rhizoctonia, Trichoderma 

Sulfur transformation Desulfovibrio, Thiobacillus 

Iron transformation Ferribacterium, Leptothrix 

Phytohormone production Azotobacter, Azospirillum, Pseudomonas, 

Rhizobium, Bacillus, Flavobacterium, Actinomyces, 

Nocardia, Fusarium, Gibberella, Aletrnaria, 

Penicillium 

Siderophore production Neurospora, Trichoderma, Agaricus, Fusarium, 

Penicillium, ericoid mycorrhizal fungi, Nocardia, 

Pseudomonas, Bacillus, Aeromaonas, Erwinia 

Biotic control Pseudomonas, Bacillus, Strepetomyces 

key factor controlling microbial community structure and diversity. The 

impact of soil structure and spatial isolation on microbial diversity and community 

structure has been clearly demonstrated (Staley 1997; Pankhurst et al. 

2002). More than 80 % of the bacteria were found located in micropores of stable 

soil microaggregates (2–20 mm) in soils subjected to different fertilization 

treatments (Ranjard and Richaume 2001). Such microhabitats offer most 

favorable conditions for microbial growth with respect to water and substrate 

availability, gas diffusion and protection against predation. Soil structure and 

water regime influence competitive interactions by causing spatial isolation 

within communities. A high diversity in soil with high spatial isolation may 

also have been caused by a higher heterogeneity of carbon resources in the 

soil. Particle size and other factors like pH and type and amount of available 

organic compound may highly impact microbial diversity and community 

structure (De Fede et al. 2001). Soil microbes are also subjected to considerable 

seasonal fluctuations in environmental conditions such as temperature, 

water content, and nutrient availability (Smit et al. 2001). 

Catabolic diversity has been used to investigate the effect of stress and the 

disturbance on the soil biodiversity. The catabolic response profile (CRP), a

74 


measure of short-term substrate-induced respiration, has been used to calculate 

the diversity and catabolic functions expressed in situ (Degens et al. 

2001). When soils from long-term managed environments were subjected to 

stress and disturbances, microbial communities with low catabolic evenness 

(crop fields) were less resistant to stress and disturbance than were communities 

with high catabolic evenness (pasture). After a major disturbance 

(landslides, volcanic eruptions, etc.), marked changes in catabolic functional 

diversity has been reported in developing soil ecosystems (Schipper et al. 

2001). 

Most members of the soil biota are organotrophs. The major source of carbon 

input for soil organisms are the plant roots and organic residues contributed 

during and following plant growth. The proportion of nitrogen, carbon 

and other organic matter changes with both plant types and landscape, 

which in turn, alter microbial mass, activity and diversity (Paul and Clark 

1998). 

Microorganisms play an essential role in functioning and sustainability of 

all natural ecosystems including biogeochemical cycling of nutrients and 

biodegradation. Most soils are exposed to fluctuating environmental conditions 

and the high diversity of organic substrate is likely to have a positive 

effect on the function. Interactions between different trophic levels were elucidated 

in a simple ecosystem model in which primary producers (plants) and 

decomposers (microorganisms) were linked through cycling of a limiting 

nutrient factor for the primary producers (Loreau 2001). The model predicts 

that microbial diversity has a positive effect on nutrient cycling efficiency, and 

contributes to increased ecosystem processes. However, in interacting microbial 

consortia, a small linear change in diversity may result in nonlinear 

changes in the process, therefore relationship between microbial diversity 

and soil processes may not necessarily be linear. 

Biochemical quality of the substrate and the physical availability of those 

components to the degradative microorganisms are key determinants of the 

rate of decomposition processes in soils, and reflects a number of interacting 

components (Bending et al. 2002). In the case of crop residues, nitrogen content 

and structural polymers such as lignin interact to control microbial 

nitrogen mineralization-immobilization processes during decomposition. 

The types of nutritional substrates available are different in soils with varying 

soil organic matter quality, and directly affect the microbial communities 

active in the soil. Native soil organic matter content may also significantly 

affect the enzyme diversity, which is found greater in high organic matter soil. 

Organic acids, such as malate, citrate and oxalate, have also been proposed to 

be involved in many rhizospheric processes, including nutrient acquisition, 

metal detoxification, alleviation of anaerobic stress in roots, mineral weathering 

and pathogen attraction (Jones 1998). 

The ecological relevance of the community structure for the function of 

systems is the main reason to study the microbial diversity. There is no single


technique available today that can reveal the entire diversity of a microbial 

community. Several approaches are available for assessment of microbial 

diversity (Bridge and Spooner 2001; Dahllöf 2002; Prosser 2002). Time-consuming 

cultivation-based assessment of microbial diversity has been widely 

used (Torsvik et al. 1996).With advanced methods, identification can be accelerated 

by automated methods, e.g., Biolog; phospholipid fatty acid (PLFA) 

profiling, fatty acid methyl ester profiling (FAME), DNA-hybridization and reassociation. 

However, potential limitations of this approach are widely 

accepted. Separation of biomass from particulate material varies between 

species, and, with growth form (spore, cells, and mycelia), introduces bias. It is 

almost impossible to design growth media and cultivation conditions that are 

suitable for all members of the microbial community. The approach of identification 

using traditional methods, based on phenotypic characteristics, is 

also limited for analysis of diversity in complex environments, such as soil 

when quantification of the diversity is required. 

The importance and need to study the vast biodiversity in different environments 

has stimulated the development of molecular methods for cultureindependent 

study of microbial communities. These methods have employed 

a combination of analysis of genes and microscopy. Analysis of 16S rRNA 

genes is now widely used for the analysis of bacterial populations and analysis 

of 18S rRNA genes and internal transcribed spacer (ITS) regions are 

increasingly used for fungal population analysis (Hunter-Cevera 1998; Bridge 

and Spooner 2001; Torsvik and Øvreås 2002). Ribosomal RNA genes are ideal 

for this purpose because they possess regions with sequences conserved 

between all bacteria or fungi, facilitating alignment of sequences when making 

comparisons, while other regions exhibit different degrees of variation, 

enabling distinction between different groups. These differences provide the 

basis for a phylogenic taxonomy and enable quantification of evolutionary 

differences between different groups. Polymerase chain reaction (PCR)-based 

fingerprinting techniques provide a rapid analysis of changes in whole community 

structure with high resolution. These fingerprinting techniques, such 

as denaturind gradient gel electrophoresis (DGGE), amplified rDNA restriction 

analysis (ARDRA), terminal restriction fragment length polymorphism 

(T-RFLP) and ribosomal intergenic spacer analysis (RISA), provide information 

on the species composition, and can be used to compare common species 

present in samples. Sequence information can also be used to design and construct 

fluorescent-labelled oligonucleotide probes specific for particular 

microbial groups using fluorescence in situ hybridization (FISH technique). 

For a comprehensive description and discussion on potential and limitations 

of various molecular approaches, excellent reviews by Bridge and Spooner 

(2001), Kozdroj and van Elsas (2001), Dahllöf (2002), Prosser (2002) and 

Torsvik and Øvreås (2002) may be consulted.

76 


3 Role of Soil Microflora in Plant Development 

3.1 Mycorrhiza 

Fungi, which form a symbiotic association with plant roots, are referred to as 

mycorrhizal fungi and the association itself is called as mycorrhiza. There are 

five broad groups of mycorrhiza: the ectomycorrhizae, the arbuscular mycorrhizae, 

the ericaceous mycorrhizae, the ectendomycorrhizae, and the orchidaceous 

mycorrhizae (Bagyaraj and Varma 1995; Hodge 2000). The most common 

mycorrhizal association found in cultivated crop plants throughout the 

world is the arbuscular mycorrhizal (AM) fungi. Ectomycorrhiza (EM), 

formed by fungi belonging to basidiomycetes and ascomycetes, are commonly 

associated with temperate trees, whereas ericoid mycorrhiza are found in the 

plants from the family Ericaceae and plant communities at high latitude and 

altitude (Perotto et al. 2002; Koide and Dickie 2002). Orchid mycorrhizae are 

associated with orchids. The AM and ectendomycorrhizal fungi are more 

prevalent in the tropics and arid/semiarid regions. AM, the most prevalent 

plant-fungus association, comprise about 150 species, belonging to the order 

Glomales of Zygomycotina (Simon 1996; Myrold 2000). 

Most angiosperm, gymnosperm, fern and bryophyte families form mycorrhizae. 

It is believed that plants growing in aquatic, water logged and saline 

habitats usually do not form mycorrhizae. However, AM colonization in the 

mangrove plants of the Great Nicobar Islands in India has been reported in 

the past. Among the monocots, Cyperaceae and Juncaceae often do not form 

mycorrhizal associations. In the dicots, Brassicaceae, Chenopodiaceae, Proteaceae, 

Restionaceae, Zygophylaceae, Lecythidaceae, Sapotaceae and all families 

of Centrospermae do not form mycorrhizae. Families rich in glucosinolates 

predominantly lack mycorrhizae because of the inhibitory action on 

fungal growth (Vierheilig et al. 2000). 

Mycorrhizae form the connecting link between the biotic and geochemical 

portions of the ecosystem ( Miller and Jastrow 1994). Mycorrhizae aid the 

plant in better growth by assisting it in absorbing useful nutrients from the 

soil, in the competition between plants and in increasing the diversity of a 

given area (Koide and Dickie 2002; Perotto et al. 2002). Owing to their role in 

nutrient cycling, mycorrhizae keep more nutrients in the biomass and, 

thereby increase the productivity of the ecosystem. Mycorrhizal links 

between seedlings and mature trees may help the seedlings in establishing 

themselves by providing them with the required nutrients. 

AM form hyphal links between plants of different species which could be 

involved in the transfer of nutrients between plants. At the plant community 

level, AM hyphae form a network – the wood-wide web that facilitates carbon 

exchange between the host and the symbiont, uptake of nutrients and their 

movement between plants (Watkins et al. 1996; Fitter et al. 1998; Helgason et 

al. 1998; Sen 2000). AM are present in most soils and are generally not consid-


ered to be host-specific. However, population sizes and species composition is 

highly variable and influenced by plant characteristics. A number of environmental 

factors such as temperature, soil pH, soil moisture, P and N levels, 

heavy metal concentration (Boddington and Dodd 1999), the presence of 

other microorganisms, application of fertilizers and soil salinity (Bationo et 

al. 2000) may affect population diversity and size. 

Mycorrhizae regulate plant communities by affecting competition, composition 

and succession (Kumar et al. 1999). In competition between plants, 

mycorrhizae in the soil favor the growth of one species and are detrimental to 

other competing species. AM may regulate competition between plants by 

making available to mycorrhizal plants, the resources that are not available to 

nonmycorrhizal neighbors. AM symbiosis may also increase intraspecific 

competition (Facelli et al. 1999). As a result, density of individuals of a single 

species would be reduced, thereby allowing the co-existence of individuals of 

different species. This would lead to an increase in species diversity. 

Mycorrhizae govern species composition in communities by influencing 

plant fitness at the establishment phase and preventing nonmycorrhizal 

plants from growing in soils colonized by them. This has a selective advantage 

for the fungus. Maintaining a high proportion of compatible host 

species at the expense of noncompatible species provides the fungus with an 

undisturbed carbon supply (Francis and Read 1994). Owing to their role in 

nutrient uptake, mycorrhizae may play an important part in determining the 

rate and direction of the process by influencing either the outcome of succession 

or by affecting the composition and diversity of species (Smith and 

Read 1997). 

The above pattern of succession seems to be true in temperate regions. In 

tropical countries like India, mycorrhizal plants act as pioneer species. It has 

been reported that mycorrhizal species like Adhatoda vasica, Solanum xanthocarpum, 

Sporobolus sp. and Desmostachya sp. form the pioneer vegetation 

in alkaline wastelands (Janardhanan et al. 1994). 

The functioning of plant communities depends to a large extent on decomposition, 

which makes nutrient elements available to the plants. Decomposition 

is essentially carried out by the soil biota (bacteria, fungi, nematodes, 

arthropods, annelids), which breaks down the litter and organic matter of the 

soil (Zhu and Ehrenfeld 1996). The external mycelium of both ectomycorrhiza 

and AM interact with these organisms. Some soil organisms have been found 

to feed on AM spores. By bringing about changes in the abundance and activity 

of decomposers, mycorrhizal fungi are believed to hasten the process of 

decomposition and thereby the nutrient cycling. 

An important role played by the fungal component in plant growth is the 

absorption of nutrients from the soil, making them available to the plants 

(Hooker and Black 1995; Goicoechea et al. 2000). Nitrogen, phosphorous and 

potassium are the important nutrient elements required by plants for their 

growth.AM assist in nutrient uptake by exploring the soil beyond the range of

78 


roots (Torrisi et al. 1999). Extra radical AM hyphae augment the uptake of 

nutrients from up to 12 cm away from the root surface (Cui and Caldwell 

1996). 

The network of hyphae may increase the availability of nutrients like N or 

P from locked sources by decomposing large organic molecules (George et al. 

1995). Mycorrhizal fungi are also known to develop bridges connecting the 

root with the surrounding soil particles to improve both nutrient acquisitions 

by the plant and soil structure (Varma 1995; Hodge 2000). Unlike N 2-fixing 

bacteria that function as biological fertilizers, AM fungi do not add P to the 

soil. They only improve its availability to the plant. There is evidence that 

phosphatase activity is higher in the rhizosphere around AM than in nonmycorrhizal 

roots. P uptake is enhanced with the increase in root colonization by 

mycorrhizae.A system of barter operates, the colonized plant provides photosynthate 

to the fungus, in return, its extraradical hypha makes more P available 

to the host (Merryweather and Fitter 1995). Plants rely more on AM when 

growing in soils deficient in P (Bationo et al. 2000). Depriving a plant in its 

natural environment of mycorrhizae on a long-term basis can also reduce P 

acquisition. Plants that are nonmycorrhizal invest more in their vegetative tissues 

like shoots and roots. In contrast, in mycorrhizal plants, the functions of 

the roots are taken over by the AM hyphae, thereby permitting the host plant 

to invest its resources in reproductive organs. 

Nitrogen occurs in the soil predominantly in the form of nitrate and 

ammonia, which is water-soluble and readily available for absorption. Studies 

with labelled N have revealed that the AM increases N uptake by plants (Bijbijen 

et al. 1996; Faure et al. 1998; Mädder et al. 2000). AM fungal hyphae have 

been credited with the uptake and transfer of large amounts of N from the soil 

to the host (Johansen et al. 1996; Hodge et al. 2000). However, there is little reciprocal 

transfer of N from the plant to the fungi, which makes uptake and 

assimilation of N by the symbiont essential for its growth (Bijbijen et al. 1996). 

Since AM form underground hyphal links between plants, N transfer between 

plants by means of such links is possible. Using labelled 15 N, Frey and Schüepp 

(1993) demonstrated that N flows from Trifolium alexandrium to Zea mays 

via AM fungal network. AM are believed to enhance N 2-fixation by symbiotic 

legumes by increasing root and nodule biomass, N 2-fixation rates, root N 

absorption rates, and plant N and P content (Olesniewicz and Thomas 1999). 

Mycorrhizae have also been reported to be involved in the uptake of other 

micro- and macro-nutrients like K, S, Mg, Zn, Cu, Ca and Na (Díaz et al. 1996; 

Hodge 2000). 

Soil microorganisms, particularly saprophytic fungi affect the development 

and function of AM symbiosis. Fracchia et al. (2000) investigated the 

effect of the saprophytic fungus Fusarium oxysporum on AM colonization 

and plant dry matter was studied in greenhouse and field experiments using 

host plants, maize, sorghum, lettuce, tomato, wheat, lentil and pea and AM 

fungi, Glomus mosseae, G. fasciculatum, G. intraradices, G. clarum and G.


deserticola. The greatest plant growth and AM colonization responses in sterilized 

and nonsterilized soils was observed with pea, G. deserticola and 

sodium alginate pellets as carrier for F. oxysporum inoculum.Application of F. 

oxysporum increased shoot dry matter, N and P concentrations of pea and 

sorghum plants and the level of AM fungi colonization. 

Piriformospora indica, a newly described axenically cultivable phytopromotional 

endosymbiont, which mimics the capabilities of AM fungi, was 

recently described by Varma et al. (1999) and Singh et al. (2000). The fungus 

has a broad host spectrum and inoculation with the fungus and application 

of culture filtrate promotes plant growth and biomass production. It mobilizes 

the insoluble phosphate and translocates the phosphorus to the host in 

an energy-dependent process. As a biological hardening agent of micropropagated 

plants, it renders more than 90 % survival rate for laboratory to 

field transferred plantlets. Regenerative protoplasts of P. indica have been 

successfully isolated, which opens up the possibility of improving symbiosis 

by transgenic manipulation of the fungal component in a symbiosis-specific 

manner. 

In the ectomycorrhizal (EM) symbiosis between fungi and trees, the fungus 

completely ensheaths the tree roots and takes over water and mineral nutrient 

supply, while the plant supplies photosynthate (Wiemken and Boller 2002). N 

and P are the main elements limiting plant growth in terrestrial ecosystems. 

One of the great assets of the ectomycorrhizal symbiosis is its capability to 

short-circuit nutrient uptake from organic material to the symbiotic partner. 

In addition to mobilizing mineral nutrients from organic sources, EM fungi 

may also link plants to rock directly though secretion of organic acids and 

solubilizing nutrients from the mineral part of soil. Many EM fungi also retain 

considerable saprotrophic potential, for example, production of lignindegrading 

enzymes, a quality that benefits the symbionts in the acquisition of 

nutrients from lignin-rich organic material. 

Sulfur nutrition of plants is largely determined by sulfate uptake of the 

roots, the allocation of sulfate to the sites of sulfate reduction and assimilation, 

the reduction of sulfate to sulfide and its assimilation into reduced sulfur-containing 

amino acids and peptides and the allocation of reduced sulfur 

to growing tissues (Rennenberg 1999). EM colonization of oak and beech tree 

roots can alter the response of sulfate uptake to sulfate availability in the soil 

and enhance xylem transport of sulfate to the leaves. Simultaneously, sulfate 

reduction in the roots seems to be stimulated by EM association. These interactions 

between EM association and the processes involved in sulfur nutrition 

are required to provide sufficient amounts of reduced sulfur for 

increased protein synthesis that is used to enhance tree growth. 

Information on the diversity of ericoid mycorrhizal endophytes in the Ericaeae 

and Epacridaceae has been compiled over the years by several authors 

(Varma and Bonfante 1994; Read 1996; Bergero et al. 2000; Berch 2001; Perotto 

et al. 2002). Hymenoscyphus ericae and Oidiodendron sp. appear to be the

80 


dominant fungi in the diverse assemblages of symbionts colonizing the 

plants. Unlike other mycorrhizal symbionts, where the fungal partner produces 

an extensive mycelial phase that grows from the host roots and act as an 

efficient nutrient collecting system, ericoid fungi produce little mycelial 

growth external to the root. It is now widely accepted that the major benefit 

conferred upon the ericaceous host plant by mycorrhizal infection is enzymatic 

degradation of organic nutrient sources in soil and transfer of much of 

the resulting products across the fungus–root interface (Cairney and Burke 

1998). Ericoid mycorrhizal fungi produce a range of extracellular enzymes 

including cellulases, hemicellulases, ligninases, pectinases, phosphatases, proteases 

and polyphenol oxidases which not only have the potential to mediate 

utilization of organic sources of nitrogen and phosphorus in soil, but also 

allow them to decompose the plant cell wall, facilitating access to mineral 

nutrients sequestered within the walls of moribund plant cells. 

Ericoid mycorrhizal fungi can interact with metals in the surrounding 

environment by releasing extracellular metabolites that can modify heavy 

metal bioavailability. Ericoid mycorrhizal symbiosis can reduce metal toxicity 

to the host, allowing plants to survive in soils with potentially toxic amounts 

of soluble and insoluble metal species. In addition to metabolites, fungi can 

also respond to the presence of metals with the release of specific proteins in 

the surrounding medium. The mechanism of arsenic tolerance in ericoid 

mycorrhizal fungi has been investigated by Sharples et al. (2000). Arsenic 

enters the cell through the phosphate transporter, causing the fungi to 

enhance both phosphate and arsenate uptake.Active and specific efflux mechanisms 

are adopted by ericoid fungi from polluted sites to decrease cellular 

concentrations of arsenic while retaining phosphate. 

3.2 Actinorhiza 

Actinorhiza is the symbiotic association between the actinomycete Frankia 

and the roots of several nonleguminous woody angiosperms. The symbiosis 

is established when Frankiae infect roots and lead to the development of nodules 

that are active in N 2 fixation. Actinorhizal plants are distributed among 

24 genera of 8 angiosperm families (Verghese et al. 1998). These plants are 

neither related, nor do they share characters that would identify them as 

uniquely symbiotic. The large phylogenetic disparity in comparison to the 

symbiotic legumes suggests that relationship between angiosperms and 

Frankia occurred early in evolutionary time resulting in significant divergence 

since then. 

Morphological, physiological and cytochemical criteria are employed to 

assign strains to the genus Frankia (Lechevalier 1994; Maunuksela 2001). The 

morphological features used for taxonomic purposes include the formation 

of septate, branching hyphae, production of multilocular sporangia, presence


of nonmotile spores in multilocular sporangia and the production of thickwalled, 

lipid encapsulated structures called vesicles – the seat of nitrogen fixation. 

On the basis of host specificity, Frankia isolates have been classified 

into four major groups: (1) Alnus–Myrica; (2) Casuarina–Myrica; (3) Myrica- 

Eleagnus; (4) members of Elagenceae. 

Actinorhizal genera have a worldwide distribution with a few exemptions. 

Africa, with the exception of Myrica species, is lacking in native actinorhiza. 

Actinorhizal genera can be characterized as inhabiting nutrient-poor sites in 

temperate regions. The Frankia-Alnus symbiosis is the most extensively studied 

actinorhiza. Alnus, Casuarina and Elaeagnus are the most widely distributed 

actinorhizal plants largely due to the introduction by man to all the continents. 

Although the N 2 -fixing potential of Frankia-Alnus symbiosis may be 

high, the amount of nitrogen actually fixed is low because of unfavorable 

environmental conditions. Therefore, proper management practices that optimize 

efficiency of the nitrogen-fixing system are required (Dommergues 

1997). 

Frankia populations occur in three niches, the root nodules, the rhizosphere 

and the soil. In the soil, Frankia can be (1) a symbiont of actinorhizal 

plants, (2) an associate of nonhost plants or (3) a saprophyte. Although the 

biochemical and molecular events of the Frankia-actinorhizal plant symbiosis 

are not as well understood as the Rhizobium-legume symbiosis, there is a 

regulated series of events leading to this close association between Frankia, 

the compatible host plant and the subsequent formation of root nodules. 

Frankia infection can be through (1) root hair (Casuarinaceae and Myricaceae) 

or (2) through intercellular spaces of the root epidermis and root 

cortex (Elaeagnceae and Ceanothus). In Alnus, infection is initiated via root 

hairs, which become branched in response to Frankia contact (Maunuksela 

2001). The host cell produces wall-like material containing pectin, hemicellulose 

and encapsulates the Frankia hyphae within the host cells. Division of 

root cortical cells results in the formation of a prenodule. The actual nodule 

lobe originates in the pericycle and becomes infected by penetrating Frankia 

hyphae. 

Actinorhizal plants are pioneer species that have the ability to colonize lownitrogen 

and disturbed sites such as fires, volcanic eruptions and flooding. 

They facilitate succession in the sites by soil solubilization and augmenting 

N 2-content. A well-developed actinorhizal plant root system favors soil-binding 

capacity, which improves the quality of impoverished soils and strongly 

supports the use of these plants in land reclamation. Many actinorhizal plants 

are also mycorrhizal and possess the ability to absorb other nutrients. As succession 

progresses, non N 2 -fixing plants are able to replace the original actinorhizal 

pioneers. Myrica faya growing at a volcanic site in Hawaii was able to 

fix 18.5 kg N/ha/year and significantly increased the amount of available N 2 in 

soils under the plants. Non N 2-fixing plants growing in the vicinity of M. faya 

accumulated greater biomass in comparison to plants growing at sites away

82 


from Myrica. This is indicative of the importance of actinorhizal plants in the 

ecosystem development. Actinorhizal plants are also used as intercrops for 

other tree species (Dommergues 1997). 

3.3 Plant Growth-Promoting Rhizobacteria 

The rhizosphere is the region of soil surrounding the roots that is subject to 

influence by the root and rhizobacteria are plant-associated bacteria that are 

able to colonize and persist on roots (Subba Rao 1999). Several genera of bacteria 

such as Arthrobacter, Agrobacterium, Azotobacter, Burkholderia, Cellulomonas, 

Micrococcus, Flavobacterium, Mycobacterium, Pseudomonas and 

others have been reported to be present in the rhizosphere (see chap. 12, this 

vol.). It has been demonstrated that the metabolic activities of bacteria associated 

with the rhizosphere are different from those of the nonrhizosphere 

soils. Electron and direct microscopy has revealed that up to 10 % of the root 

surface is colonized by microorganisms in a random fashion depending on 

the presence of soil organic matter. Some strains of plant growth-promoting 

rhizobacteria (PGPR) can effectively colonize plant roots and protect plants 

from diseases caused by a variety of root pathogens and growth promotion of 

plants through formation of plant growth hormones. Considerable progress 

has been made using molecular techniques to elucidate the important microbial 

factors or genetic traits involved in the PGPR-stimulated plant growth 

and in the suppression of fungal root diseases (Glick and Bashan 1997; 

Kumari and Srivastava 1999; Bloemberg and Lugtenberg 2001; Zehnder et al. 

2001). Several genera of allelopathic nonpathogenic bacteria have been identified 

and characterized which produce plant growth-inhibiting allelochemicals 

(Barazani and Friedman 2001). Allelochemicals like phytoxins, 

geldanamycin, nigericin and hydanthocidin have been isolated from Streptomyces 

viridochromogenes. 

PGPR can affect plant growth either directly or indirectly. The direct 

effect of PGPR include providing the host plants with fixed nitrogen, P and 

Fe solubilized from the soil and phytohormones that are synthesized by the 

bacteria (Glick 1995). The indirect effect on plant growth occurs when PGPR 

reduces or prevents the harmful effects of one or more phytopathogenic 

organisms. PGPR effective in biocontrol produce a variety of substances 

including antibiotics, siderophores and a variety of enzymes (chitinase, protease, 

lipase, b-1,3-glucanase etc.) to limit the damage to plants by phytopathogens. 

PGPR have also been reported to reduce heavy metal toxicity 

in plants (Burd et al. 2000). 

Symbiotic nitrogen fixation has long been considered to be an excellent 

replacement of N fertilization. The most efficient nitrogen fixers are strains of 

Rhizobium, Sinorhizobium, Mesorhizobium, Bradirhizobium and Azorhizobium, 

which form a host-specific symbiosis with leguminous plants (Paul and


Clark 1998; Subba Rao 1999). The genes involved in nitrogen fixation, nitrogen 

assimilation and regulation in various bacteria have been studied extensively 

(Glick and Bashan 1997; Bloemberg and Lugtenberg 2001; Rengel 2002). 

Several of the nif and fix genes, involved in N 2-fixation, have been characterized 

in different nitrogen fixers. Most of the organism contains similar nitrogenase 

complexes. Increased efficacy of N 2 -fixation can be achieved by selecting 

and manipulating the best combination of host genotype and bacteria. 

Improvement in the symbiotic relationship in suboptimal environmental situations 

related to soil-borne or environmental stress is also important to 

improve N 2-fixation. 

Free-living N 2-fixing rhizobacteria are capable of fixing atmospheric nitrogen. 

The aerobic, free-living bacteria that utilize organic substrates as a source 

of energy include Azotobacter, found in neutral and alkaline soils. Members of 

the same family Beijerinckia and Derxia have a broader pH range and are 

more often found in acidic soils in the tropics. Azospirillum, Acetobacter, 

Herbaspirillum and Azoarcus have frequently been found associated with 

grasses (Steenhoudt and Vanderleyden 2000). Azotobacter and Beijerinckia 

require aerobic conditions for the production of energy required for N 2 fixation. 

However, in these organisms as well as other diazotrophs, the activity of 

nitrogenase is inhibited by O 2 and special mechanisms for the protection of 

nitrogenase are present. Facultative microaerophilic organisms such as 

Azospirillum, Klebsiella and Bacillus produce energy in the form of ATP by 

oxidative pathways in an environment where nitrogenase does not need to be 

as well protected from O 2. The amount of N 2 fixed by free-living diazotrophs 

such as Azotobacter and Pseudomonas is generally a few kilograms per 

hectare (Paul and Clark 1998). Nitrogen-fixing microorganisms in the waterlogged 

rice fields may contribute 40–50 kg per hectare which is a cumulative 

effect of free-living as well as symbiotic organisms such as blue-green algae, 

Azotobacter, Azospirillum, Rhizobium, Beizerinckia, Clostridium, Desulfovibrio 

and Pseudomonas (Subba Rao 1999). 

Soil amendments and artificial inoculation of beneficial rhizobacteria can 

induce changes in rhizosphere microflora (Bashan 1998; Bai et al. 2002). Rhizosphere 

nitrogen fixation could be enhanced by incorporation of N 2-fixing 

capacity into common rhizosphere. The large scale application of PGPR in 

agriculture is attractive as it substantially reduces the use of chemical fertilizers 

and pesticides. A growing number of PGPR are being marketed, and at 

present, biofertilizer application accounts for approximately 65 % of the N 

supply to crops worldwide (Bloemberg and Lugtenberg 2001). Integrated 

approaches have been applied with a combination of AM fungi or biocontrol 

fungi like Trichoderma and PGPR for the beneficial plant growth and disease 

control effects (Valdenegro et al. 2001; Elliot and Broschat 2002). Recently 

focus has also been directed towards the development and use of rhizobacteria 

as biocontrol agents to combat fungal diseases (Naseby et al. 2001; Unge 

and Jansson 2001).

84 


3.4 Phosphate-Solubilizing Microorganisms 

After nitrogen, phosphorus is the major plant growth-limiting nutrient, 

though P is abundant in soils in both inorganic and organic forms. Most of the 

mineral nutrients in soil solution are present in millimolar amounts, however, 

P is present only in micromolar (up to 10 mm) amounts. Low level of availability 

of P is due to high reactivity of soluble P with Ca, Fe and Al (Gyaneshwar 

et al. 2002). Calcium phosphates are the predominant form of P in calcareous 

soils, whereas inorganic P in acidic soil is associated with Fe and Al 

compounds. In soils with high organic matter, organic P may make up as 

much as 50 % of the total soluble P available in soil. Phosphate-solubilizing 

microorganisms (PSM) are ubiquitous in soils and play an important role in 

supplying P to plants in a sustainable manner. Although a lot of laboratory 

work on phosphate solubilization has been done, the results of field trials 

were highly variable (Nahas 1996). 

In spite of the importance of PSM in agriculture, the detailed biochemical 

and molecular mechanisms of P solubilization is not known. Mineral P solubilizing 

ability of microbes could be linked to specific genes which may be 

present in even non P-solubilizing bacteria (Goldstein 1995). The ability to 

solubilize the mineral–phosphate complexes has been attributed to the ability 

of PSM to reduce the pH of the surroundings by releasing organic acids such 

as acetate, lactate, oxalate, tartarate, succinate, citrate, gluconate etc. (Kim et al. 

1998; Ezawa et al. 2002). These organic acids can either dissolve the mineral 

phosphate as a result of anion exchange or can chelate Fe or Al ions associated 

with the phosphate. However, acidification does not seem to be the only 

mechanism of P solubilization, as the ability to reduce pH in some cases does 

not correlate with the ability to solubilize mineral phosphates (Jones 1998; 

Gyaneshwar et al. 2002). 

Plants have been shown to benefit from the association with microorganisms 

under P-deficient conditions, either resulting from a better uptake of the 

available P or by accession of the nonavailable form of P-source.Various kinds 

of bacteria and fungi have been isolated and characterized for their ability to 

solubilize mineral phosphate complexes. Although P-solubilizing bacteria 

outnumber P-solubilizing fungi in soil, fungal isolates generally exhibit 

greater P-solubilizing ability than bacteria in both liquid and solid media 

(Goldstein 1995; Gyaneshwar et al. 2002). Phosphate-solubilizing strains of 

bacteria Enterobacter agglomerans (Kim et al. 1998) and Azotobacter chroococcum 

(Kumar and Narula 1999) have been isolated from wheat rhizosphere 

and characterized for solubilization of hydroxyapetite, tricalcium phosphate 

and Mussoorie rock phosphate in laboratory experiments. Nautiyal et al. 

(2000) described the isolation and characterization of four unidentified bacterial 

strains from the chickpea rhizosphere in alkaline soil. NBRI 2601 was 

the most efficient strain in terms of its capability to solubilize phosphorus in 

the presence of 10 % salt, pH 12 and 45 °C. Seed inoculation with an acid-tol-


erant strain of Bacillus sp. significantly increased the vegetative and grain 

yield of fingermillet, maize, amaranth, buckwheat and french bean (Pal 1998). 

Although plants inoculated with PSM exhibit increased growth and P contents 

in laboratory studies, large variations have been found in the effectiveness 

of inoculations in field conditions. 

Phosphate solubilizing fungi and their role in plant nutrition and growth 

have been extensively studied. Among the known fungal genera are 

Aspergillus (Goenadi et al. 2000; Narsian and Patel 2000), Penicillium 

(Whitelaw et al. 1999; Reyes et al. 2001), Rhizoctonia (Jacobs et al. 2002) and 

Cyathus (Singal et al. 1991). Supplementation of A. niger cultivated on sugar 

beet waste material to soil significantly improved the growth rate and shoot P 

concentration of Trifolium repens (Vassilev et al. 1996). Reddy et al. (2002) 

reported the biosolubilization of different rock phosphates by three isolates of 

A. tubingensis for the first time. Altomare et al. (1999) investigated the capability 

of biocontrol fungus Trichoderma harzianum to solubilize MnO 2, metallic 

zinc and rock phosphate and discussed its possible role in plant growth. 

Application of encapsulated fungal or bacterial cell systems for effective use 

as soil microbial inoculants in P solubilization and plant nutrition has been 

discussed in detail by Vassilev et al. (2001). 

Nodule formation in legumes is often limited by the availability of P (Subba 

Rao 1999). While there are only a few reports on P solubilization by Rhizobium 

(Chabot et al. 1996), the improvement in the efficiency of N 2-fixation in 

legumes has been demonstrated by supplementation of P in alfalfa, clover, 

cow pea and pigeon pea (Al-Niemi et al. 1997). In chickpea and barley growing 

in soils treated with insoluble phosphate and inoculated with Mesorhizobium 

mediterraneum, the P content increased by 100 and 125 %, respectively 

(Peix et al. 2001). The dry matter, N, K, Ca and Mg contents in both plants also 

increased significantly. A coculture inoculum of Rhizobium meliloti and a 

phosphate-solubilizing fungus, Penicilium bilalii increased the P uptake of 

several field crops (Rice et al. 1995). Co-inoculations of AM fungi with PSM 

have shown positive effects on plant growth and crop yield (Toro et al. 1997; 

Ezawa et al. 2002). Beneficial effects of enriching vermicompost by nitrogenfixing 

and phosphate-solubilizing bacteria have also been demonstrated 

(Kumar and Singh 2001). 

3.5 Lignocellulolytic Microorganisms 

The high cellulose and lignin contents of plant residue incorporated into soil 

emphasize the importance of lignocellulolytic microorganisms in the mineralization 

processes in soil (Kuzyakov and Domanski 2000). The chemical 

composition of the entire plant residues, their decomposition and biochemical 

transformations in the soil during humification has been investigated in 

detail (Paul and Clark 1998). The importance of microbial biomass and extra-

86 


cellular lignocellulolytic enzyme activity in the assessment of soil quality is 

established by the essential role of soil microbes in nutrient cycling within 

agricultural ecosystems (Christensen and Johnston 1997). During the microbial 

degradation and humification of plant residues, about 80 % of the residual 

carbon is released to the atmosphere as CO 2 (Omar 1994). The amendment 

of infertile or saline soils with plant residues and their subsequent 

degradation by cellulolytic soil microflora with a concomitant increase in CO 2 

could increase soil aeration, improve its structure and also increase soil fertility. 

The activities of cellulolytic microbes affect the availability of energy and 

specific nutrients to a group of organisms deficient in hydrolytic enzyme 

activities (Jensen and Nybroe 1999). 

Soils managed with organic inputs generally have larger and more active 

microbial populations than those managed with mineral fertilizers (Badr El- 

Din et al. 2000). Reincorporation of organic matter into the soil improves soil 

fertility, enhances microbial growth and buffers the soil environment from 

sudden changes. There are many types of agroindustrial organic refuse which 

can be transformed and applied to soil as crop amendments, such as compost, 

thus reducing the need for chemical fertilizers. During the composting 

process, the organic substrate present in the agricultural wastes is mainly 

transformed oxidatively into a stabilized organic matter. The slow transformation 

of lignocellulosic material results in the formation of humic substances. 

Several researchers have established a positive correlation between 

the amount of humic substances and promotion of plant growth. Application 

of different combinations of coir with peat and vermiculate significantly 

increased the growth of tomato transplants with respect to root dry weight, 

stem diameter and leaf area (Arenas et al. 2002). 

Straw incorporation could also be beneficial in enhancing symbiotic nitrogen 

fixation and crop growth (Abd-Alla and Omar 1998). In nonsymbiotic 

nitrogen fixation studies in the laboratory and in the field, a significant 

increase in nitrogenase activity associated with the breakdown of straw after 

inoculation with various combinations of cellulolytic fungi and bacteria has 

been reported (Halsall and Gibson 1991; Chapman et al. 1992). Application of 

wheat straw with cellulolytic fungi, Trichoderma harzianum significantly 

enhanced growth, nodulation, nodule efficiency and increased the concentration 

of Ca, Mg and K in the shoots and roots of fenugreek plants grown in 

saline soil (Abd-Alla and Omar 1998). The increase in dry matter production 

and nitrogen content was due to improved N 2 fixation reflected by enhanced 

formation and growth of nodules as well as nitrogenase activity. 

Inoculation of straw with lignocellulolytic organisms offers potential for 

manipulating and improving the composting of cellulosic waste (Verstraete 

and Top 1999; Hart et al. 2002). Composts produced using this method provide 

a more sustainable approach to agriculture, enabling subsistence farmers 

to utilize their agricultural waste products as a means to improve soil quality. 

Saprophytic lignin-decomposing basidiomycetes isolated from plant litter


were found to play an important role in soil aggregation and stabilization 

(Caesar-Ton That and Cochran 2000). The basidiomycete produced large 

quantities of extracellular water-insoluble and heat-resistant materials that 

bind soil particles into aggregates. 

Differences in the chemical properties of the organic matter from highly 

lignocellulosic compost after incubation with two lignocellulolytic microorganisms 

were studied by Requena et al. (1996). Inoculation with Trichoderma 

viride and Bacillus sp. enhanced degradation processes and the degree of 

organic matter humification. Both degradation-humification pathways beneficially 

affected the lettuce growth demonstrating that inoculation with lignocellulolytic 

microbes may be a useful tool to improve agronomic properties of 

lignocellulosic wastes by modifying the chemical structure and properties of 

their organic matter. Rajbanshi et al. (1998) found significant positive effects 

of seeding material (substrates with a high number of degradative microbes) 

on total organic carbon and organic matter contents of grass straw-leaf mix. 

Temporal changes in soil moisture, soil temperature, and carbon input 

from crop roots, rhizosphere products (root exudate, mucilage, sloughed cells 

etc.), and crop residues can have a large effect on soil microbial activity 

(Jensen et al. 1997; Ritz et al. 1997). Crop growth often stimulates an increase 

in the size of microbial biomass during the growing season and after harvest. 

Enzyme activity displays different temporal patterns of the various soil 

enzymes. Some cellulases are closely related to inputs of fresh organic materials, 

plant growth and plant residues, while others appear to be more sensitive 

to soil temperature and moisture. 

Due to their dynamic nature, soil microbial biomass and soil enzymes 

respond quickly to changes in organic matter input. In a field experiment 

after 8 years of cultivation with low- or high-organic matter input, pronounced 

and constant increase in endocellulase and b-glucosidase activities 

and variable increase in microbial biomass carbon and cellobiohydrolase 

activity was observed over the sampling period (Debosz et al. 1999). Temporal 

variations in endocellulase activity showed a different pattern from those for 

b-glucosidase activity, with highest activity in the autumn/winter and early 

summer samplings. On all sampling dates, endocellulase activity in the higher 

organic matter was about 30 % higher than in the low organic matter treatments. 

Specific organic amendments such as mulched straw has been reported to 

influence soil suppression of plant diseases (Knudsen et al. 1999). Many fungi, 

known as antagonists to plant pathogens, e.g., Trichoderma sp., produce a 

wide range of cellulolytic enzymes which are believed to be associated with 

their antagonistic abilities. Rasmussen et al. (2002) investigated the relationship 

between soil cellulolytic activity and suppression of seedling blight of 

barley caused by Fusarium culmorum in arable soils. A bioassay for disease 

suppression in test soils indicated that the samples from 6 to 13-cm depth 

exhibited positive correlation between soil suppressiveness and the activities

88 


of b-glucosidase and cellobiohydrolase, where soil representing the highest 

disease suppression had the highest activity. Furthermore, soil suppressiveness, 

as well as the enzyme activity significantly correlated with the soil content 

of total C and N. 

4 Plant Growth Promoting Substances Produced by Soil 

Microbes 

The ability of soil microorganisms to produce various metabolites stimulating 

plant growth is considered to be one of the most important factors in soil 

fertility (Frankenberger and Arshad 1995; Paul and Clark 1998; Subba Rao 

1999). Some PGPR control the damage to plants from plant pathogens by a 

number of different mechanisms including physical displacement and outcompeting 

the phytopathogen, secretion of siderophores to prevent 

pathogens in the immediate vicinity from proliferating, production of 

enzymes, antibiotics and a variety of small molecules that inhibit the phytopathogen 

and stimulation of systemic resistance in plants (Glick and 

Bashan 1997). Microbially produced antibiotics have a potential role in indirectly 

promoting plant growth by controlling plant diseases (Kumari and Srivastava 

1999). Two prominent antifungal antibiotics are griseofulvin, a metabolic 

product of Penicillium griseofulvum and aureofungin, a metabolic 

product of Streptoverticillium cinnamomeum. 

Soil microorganisms produce a variety of phytohormones such as auxins, 

gibberellins, cytokinins, ethylene and abscisic acid.Auxin production is widespread 

among many soil and rhizosphere microorganisms (fungi,bacteria and 

actinomycetes) and algae (Martens and Frankenberger 1993). Tryptophan is 

considered the physiological precursor of auxin for both plant and soil 

microbes. A number of indole compounds and phenylacetic derivatives have 

been reported with auxin activity. Indole-3-acetic acid (IAA) is considered the 

most physiologically active auxin in plants. Auxins are known to affect cell 

enlargement involving cell wall extensibility. Plant growth responses also 

include root and shoot dry weights, root/stem elongation and root/shoot 

ratios.Species of Agrobacterium,Azospirillum,Pseudomonas,Rhizobium,Ustilago, 

Gymnosporangium, Rhizopus and Synchytrium produce IAA in pure cultures 

or in association with higher plants (Subba Rao 1999). 

Gibberellins (GA) are an important group of plant hormones that are 

diterpenoid acids. The involvement of GA in almost all phases of plant growth 

and development, starting from germination to senescence is well known. 

However, the most prominent physiological effect of GA is in shoot elongation. 

Some other plant growth related functions of GA include overcoming 

dormancy and dwarfism in plants, inducing flowering in some photoperiodically 

sensitive and other low temperature-dependent plants, and contributing 

to fruit setting. Several soil microbes are known to produce gibberellins or


gibberellin-like substances (Kumar and Lonsane 1989; Steenhoudt and Vanderleyden 

2000). The common bacterial genera are Arthrobacter, Azotobacter, 

Azospirillum, Pseudomonas, Rhizobium, Bacillus, Brevibacterium and Flavobacterium. 

Actinomyces and Nocardia are the important actinomycetes and 

Fusarium, Gibberella, Aletrnaria, Aspergillus, Penicillium and Rhizopus are 

known fungi. 

Cytokinins, N 6 -substituted aminopurines, regulate cell division and differentiation 

in certain plant tissues. Cytokinins play an important role in nodule 

development and formation. Along with auxins, cytokinins stimulate mature 

root cells to undergo polyploid mitosis. Symbiotic N 2-fixing bacteria, Rhizobium, 

free-living N 2-fixing bacteria Azospirillum and Azotobacter,and mycorrhizal 

fungus, Rhizopogon roseolus are known to produce cytokinins in the 

rhizosphere along with other growth-promoting substances (Nieto and 

Frankenberger 1989). Other bacteria that produce cytokinins or cytokininlike 

substances include Agrobacterium, Bacillus, Paenibacillus and Pseudomonas 

(Timmusk et al. 1999). 

Ethylene (C 2H 4) is the only phytohormone that is a gas under physiological 

temperature and pressure. Ethylene is considered to be a promoter of senescence 

and an inhibitor of growth and elongation. It can also promote flowering, 

fruit ripening and stimulate cell elongation in certain plants (Elsgaard 

2001). Bacterial species of Aeromonas, Citrobacter, Arthrobacter, Erwinia, Serratia, 

Klebsiela and Streptomyces, and fungal species of Acremonium, 

Alternaria, Mucor, Fusarium, Pythium, Neurospora and Candida are capable 

of producing ethylene (Subba Rao 1999). 

Abscisic acid (ABA) is generally involved in deceleration or cessation of 

plant growth.ABA is active in regulating abscission of young leaves and fruits, 

dormancy of buds and seeds, and ripening of fruit. ABA production in two 

bacterial species, Azospirillum brasilense and Rhizobium spp. and several phytopathogenic 

fungi such as Cercospora, Fusarium, Cladsporium, Monilia, Pestatoria 

and Verticillium has been demonstrated (Frankenberger and Arshad 

1995; Paul and Clark 1998). 

Siderophores are low molecular weight (

90 


in solubility and transport of iron, hydroxamate siderophores are also 

involved in iron storage. 

Based on the chemical nature of their coordination sites, microbial 

siderophores are classified as hydroxamates, catecholates, carboxylates and 

mixed type. Hydroxamates are produced both by bacteria and fungi. In most 

fungi, a mixture of siderophores is produced which varies depending on cultivation 

conditions. Aspergilli produce ferricrocin accompanied by fusarinines, 

while certain penicillia produce ferrichrome accompanied by coprogen. 

Similar observations have been made with Neurospora, Gliocladium, 

Trichoderma and Agaricus bisporus (Neilands and Leong 1986). Fusarinines 

(fusigens) produced by species of Fusarium and Penicillium are linear and 

cyclic hydroxamic acids joined by ester bonds. Ericoid mycorrhizal fungi produce 

ferrichrome and fusarinines. 

Varieties of bacterial hydroxamates are known. Ferrioxamine, produced by 

actinomycetes, Nocardia and Pseudomonas stutzeri, is a cyclic trihydroxamate. 

Citrate hydroxamates are characterized by the presence of two hydroxamates 

and one citrate group as ligand, it is a linear citratehydroxamic acid 

obtained from Klebsiella pneumonia and several enteric bacteria. Catecholate 

siderophores are generally less diverse than the hydroxamates, and are conjugated 

to amino acids or polyamine backbones. Species of Bacillus, Aeromaonas 

and Erwinia are known to produce catecholate siderophores. Carboxylate 

(complexone) siderophores are produced by Rhizopus microsporus, 

Rhizobium meliloti and Staphylococcus hycius. Pyoverdines, the mixed types 

form a wide class of mixed siderophores showing a great variety of structures. 

Some strains of fluorescent pseudomonads produce hydroxamate siderophores 

(ferribactin) in addition to pyoverdine siderophores. 

The plant growth-promoting rhizobacteria (PGPR) owe their plant growth 

promoting activity to their stronger siderophores with higher stability constants 

that outgrow the other bacterial population in competition for iron and 

finally displace them from the root surface. The siderophore-producing PGPR 

have become important in the biological control of plant pathogens (Glick 

and Bashan 1997). 

5 Conclusions 

Microorganisms play an essential role in the functioning and sustainability of 

soil ecosystems including biogeochemical cycling of nutrients and biodegradation. 

Recent advances in soil community analysis using molecular and biochemical 

approaches have helped us understand the enormous microbial 

diversity and their functional significance in nutrient recycling in soil and 

plant development. Soil diversity exceeds that of aquatic environments and 

provides a great resource for the biological exploitation of novel organisms, 

processes and products. Microbes isolated from soil and developed as biofer-


tilizers or inoculants play an important role in enhancing plant growth 

enhancing efficiency of biological nitrogen fixation, availability of P, trace elements 

such as Fe and Zn, and production of plant growth substances. The 

development of better screening procedures and understanding the genetic 

basis of rhizosphere competence will help in developing novel microbial inoculants 

that will be better suited to survive and perform their desirable function 

in a natural environment.As we explore the soil microbial diversity more, 

we must remember that the microbes evolve more quickly than we can study 

them, providing an ever-increasing diversity of function, not only in agriculture, 

but also for industrial applications. 

Acknowledgements. The authors thank Mr. Manoj Kumar for the preparation of the 

manuscript. 


Abd-Alla MH, Omar SA (1998) Wheat straw and cellulolytic fungi application increases 

nodulation, nodule efficiency and growth of fenugreek (Trigonella foenum-graceum 

L.) grown in saline soil. Biol Fertil Soil 26:58–65 

Al-Niemi TS, Kahn ML, McDermott TR (1997) P metabolism in the Rhizobium tropicibean 

symbiosis. Plant Physiol 113:1233–1242 

Altomare C, Norvell WA, Bjoerkman T, Harman GE (1999) Solubilization of phosphates 

and micronutrients by the plant growth-promoting and biocontrol fungus Trichoderma 

harzianum Rifai 1295–22. Appl Environ Microbiol 65:2926–2933 

Arenas M,Vavrina CS, Cornell JA, Hanlon EA, Hochmuth GJ (2002) Coir as an alternative 

to peat in media for tomato transplant production. Hort Science 37:309–312 

Badr El-Din SMS,Attia M,Abo-Sedera SA (2000) Field assessment of composts produced 

by highly effective cellulolytic microorganisms. Biol Fertil Soils 32:35–40 

Bagyaraj DJ (1984) Biological interactions with VA mycorrhizal fungi. In: Powell CL, Bagyaraj 

DJ (eds) VA Mycorrhiza. CRC Press, Boca Raton, pp 131–153 

Bagyaraj DJ, Varma A (1995) Interaction between arbuscular mycorrhizal fungi and 

plants. Their importance in sustainable agriculture in arid and semiarid tropics. Adv 

Microb Ecol 14:119–142 

Bai Y, D’Aoust F, Smith DL, Driscoll BT (2002) Isolation of plant growth promoting Bacillus 

strains from soybean root nodules. Can J Microbiol 48:230–238 

Barazani O, Friedman J (2001) Allelopathic bacteria and their impact on higher plants. 

Crit Rev Microbiol 27:41–55 

Bashan Y (1998) Inoculants of plant growth-promoting bacteria for use in agriculture. 

Biotechnol Adv 16:729–770 

Bationo A, Wani SP, Bielders CL, Vlek PLG, Mokwunye AU (2000) Crop residue and fertilizer 

management to improve soil organic carbon content, soil quality and productivity 

in the desert margins of West Africa. In: Lal R, Kimble JM, Steward BA (eds) 

Advances in soil science. Global climate change and tropical ecosystems. CRC Press, 


Bending GD, Turner MK, Jones JE (2002) Interactions between crop residue and soil 

organic matter quality and the functional diversity of soil microbial communities. 

Soil Biol Biochem 34:1073–1082

92 


Berch SM (2001) Molecular diversity and phylogeny of ericoid mycorrhizal fungi. Plant 

Soil 244:55–66 

Berch SM, Allen TR, Berbee ML (2002) Molecular detection, community structure and 

phylogeny of ericoid mycorrhizal fungi. Plant Soil 244:55–66 

Bergero R, Perotto S, Girlanda M,Vidano G, Luppi AM (2000) Ericoid mycorrhizal fungi 

are common root associates of a Mediterranean ectomycorrhizal plant Quercus ilex. 

Mol Ecol 9:1639–1650 

Bijbijen JN, Urquiaga S, Ismaili M, Alves BJR, Boddey RM (1996) Effect of arbuscular 

mycorrhizae on uptake of nitrogen by Brachiaria arrecta and Sorghum vulgare from 

soils labelled for several years with 15 N. New Phytol 133:487–494 

Bloemberg GV, Lugtenberg BJJ (2001) Molecular basis of plant growth promotion and 

biocontrol by rhizobacteria. Curr Opin Plant Biol 4:343–350 

Boddington CL, Dodd JC (1999) Evidence that differences in phosphate metabolism in 

mycorrhizae formed by species of Glomus and Gigaspora might be related to their life 

cycle strategies. New Phytol 142:531–538 

Bridge P, Spooner B (2001) Soil fungi: diversity and detection. Plant Soil 232:147–154 

Burd GI, Dixon DG, Glick BR (2000) Plant growth-promoting bacteria that decrease 

heavy metal toxicity in plants. Can J Microbiol 46:237–245 

Caesar-TonThat TC, Cochran VL (2000) Soil aggregate stabilization by a saprophytic 

lignin-decomposing basidiomycete fungus. I. Microbiological aspects. Biol Fertil Soil 

32:374–380 

Cairney JWG, Burke RM (1998) Extracellular enzyme activities of the ericoid mycorrhizal 

endophyte Hymenoscyphus ericae (Read) Korf and Kernen: their likely roles in 

decomposition of dead plant tissue in soil. Plant Soil 205:181–192 

Chabot R, Antoun H, Cesas MP (1996) Growth promotion of maize and lettuce by phosphate 

solubilizing Rhizobium leguminosarum biovar phaseoli. Plant Soil 184:311–321 

Chapman SJ,Veal DA, Lynch JM (1992) Effect of oxygen concentration on dinitrogen fixation 

and volatile fatty acid production by Clostridium butyricum growing in association 

with fungi on cellulose and on wheat straw. J Appl Bacteriol 72:9–15 

Christensen BT, Johnston AE (1997) Soil organic matter and soil quality lessons learned 

from long-term experiments at Askov and Rothamsted. In: Gregorich EG, Carter MR 

(eds) Soil quality for crop production and ecosystem health. Elsevier, Amsterdam 

Cui M, Caldwell MM (1996) Facilitation of plant phosphate acquisition by arbuscular 

mycorrhizae from enriched to soil patches. I. Roots and hyphae exploiting the same 

volume. New Phytol 133:453–460 

Dahllöf I (2002) Molecular community analysis of microbial diversity. Curr Opin 


Debosz K, Rasmussen PH, Pedersen AR (1999) Temporal variations in microbial biomass 

C and cellulolytic enzyme activity in arable soils: effects of organic matter input.Appl 

Soil Ecol 13:209–218 

De Fede KL, Pannaccione DG, Sexstone AJ (2001) Characterisation of dilution enrichment 

cultures obtained from size-fractionated soil bacteria by BIOLOG (R) community 

level physiological profiles and restriction analysis of 16S rRNA genes. Soil Biol 

Biochem 33:1555–1562 

Degens BP (1998) Microbial functional diversity can be influenced by the addition of 

simple organic substrates to soil. Soil Biol Biochem 30:1981–1988 

Degens BP, Scipper LA. Sparling GP, Duncan LC (2001) Is the microbial community in a 

soil with reduced catabolic diversity less resistant to stress or disturbance? Soil Biol 

Biochem 33:1143–1153 

Diaz G, Azcon-Aguilar C, Honrubia M (1996) Influence of arbuscular mycorrhizae on 

heavy metal (Zn and Pb) uptake and growth of Lygeum spartum and Anthyllis cytisoides. 

Plant Soil 180:241–249


Dommergues YR (1997) Contribution of actinorhizal plants to tropical soil productivity 

and rehabilitation. Soil Biol Biochem 29:931–941 

Elliott ML, Broschat TK (2002) Effects of a microbial inoculant on plant growth and rhizosphere 

bacterial populations of container-grown plants. Hort Technol 12:222–225 

Elsgaard L (2001) Ethylene turnover in soil, litter and sediment. Soil Biol Biochem 

33:249–252 

Ezawa T, Smith SE, Smith FA (2002) P metabolism and transport in AM fungi. Plant Soil 

244:221–230 

Facelli E, Facelli JM, Smith SE, Mclaughlin MJ (1999) Interactive effects of arbuscular 

mycorrhizal symbiosis intraspecific competition and resource availability on Trifolium 

subterraneum cv. Mt. Barker. New Phytol 141:535–547 

Faure S, Cliquet J-B, Thephany G, Boucaud J (1998) Nitrogen assimilation in Lolium 

perenne colonized by the arbuscular mycorrhizal fungus Glomus fasciculatum. New 

Phytol 138:411–417 

Fitter AH, Graves JD, Watkins NK, Robinson D, Scrimgeour C (1998) Carbon transfer 

between plants and its control in networks of arbuscular mycorrhizas. Funct Ecol 

12:406–412 

Fortin JA, Becard G, Declerck S, Dalpe Y, St-Arnaud M, Coughlan AP, Piche Y (2002) 

Arbuscular mycorrhiza on root-organ cultures. Can J Bot 80:1–20 

Fracchia S, Garcia-Romera I, Godeas A, Ocampo JA (2000) Effect of the saprophytic fungus 

Fusarium oxysporum on arbuscular mycorrhizal colonization and growth of 

plants in greenhouse and field trials. Plant Soil 223:175–184 

Francis R, Read DJ (1994) The contributions of mycorrhizal fungi to the determination 

of plant community structure. Plant Soil 159:11–25 

Frankenberger Jr WT, Arshad M (1995) Phytohormones in soils. Microbial production 

and function. Marcel Dekker, New York 

Frey B, Schüepp H (1993) A role of vesicular arbuscular (VA) mycorrhizal fungi in facilitating 

inter-plant N transfer. Soil Biol Biochem 25:651–658 

Glick BR (1995) The enhancement of plant growth by free-living bacteria. Can J Microbiol 

41:109–117 

Goenadi D, Siswanto H, Sugiarto Y (2000) Bioactivation of poorly soluble phosphate 

rocks with a phosphorus-solubilizing fungus. Soil Sci Soc Am J 64:927–932 

Goldstein AH (1995) Recent progress understanding the molecular genetics and biochemistry 

of calcium phosphate solubilization by gram negative bacteria. Biol Agric 

Hort 12:185–193 

George E, Marschner H, Jakobsen I (1995) Role for arbuscular mycorrhizal fungi in 

uptake of phosphorous and nitrogen from soil. Crit Rev Biotechnol 15:257–270 

Glick BR, Bashan Y (1997) Genetic manipulation of plant growth-promoting bacteria to 

enhance biocontrol of phytopathogens. Biotechnol Adv 15:353–378 

Goicoechea N, Antolin MC, Sanchez-Diaz M (2000) The role of plant size and nutrient 

concentrations in associations between Medicago, and Rhizobium and/or Glomus. 

Biol Plant 43:221–226 

Gyaneshwar P, Naresh Kumar G, Parekh LJ, Poole PS (2002) Role of soil microorganisms 

in improving P nutrition of plants. Plant Soil 245:83–93 

Halsall DM, Gibson AH (1991) Nitrogenase activity (C 2 H 2 reduction) in straw-amended 

wheat belt soils in response to diazotroph inoculation. Soil Biol Biochem 23:987–998 

Hart TD, De Leij FAAM, Kinsey G, Kinsey G, Kelley J, Lynch JM (2002) Strategies for the 

isolation of cellulolytic fungi for composting of wheat straw. World J Microbiol 


Hattori T, Mitsui H, Haga H, Wakao N, Shikano S, Gorlach K, Kasahara Y, El-Beltagy A, 

Hattori R (1997) Advances in soil microbial ecology and the biodiversity Ant van 

Leeuwen Hoek 72:21–28

94 


Hawksworth DL (1997) The fascination of fungi: exploring fungal diversity. Mycologist 

11:18–22 

Helgason T, Daniell TJ, Husband R, Fitter AH,Young JPW (1998) Ploughing up the woodwide 

web. Nature 394:431 

Hodge A (2000) Microbial ecology of arbuscular mycorrhiza. FEMS Microbiol Ecol 

32:91–96 

Hodge A, Robinson D, Fitter AH (2000) An arbuscular mycorrhizal inoculum enhances 

root proliferation in, but not nitrogen capture from nutrient rich patches in soil. New 

Phytol 145:575–584 

Hooker JE, Black KE (1995) Arbuscular mycorrhizal fungi as a component of sustainable 

soil plant systems. Crit Rev Biotechnol 15:201–212 

Hunter-Cevera JC (1998) The value of microbial diversity. Curr Opin Microbiol 

1:278–285 

Jacobs H, Boswell GP, Ritz K, Davidson FA, Gadd GM (2002) Solubilization of calcium 

phosphate as a consequence of carbon translocation by Rhizobium solani. FEMS 

Microbiol Ecol 40:65–71 

Janardhanan KK, Abdul-Khaliq Naushin F, Ramaswamy K (1994) Vesicular arbusicular 

mycorrhiza in an alkaline usar land ecosystem. Curr Sci 67:465–469 

Jenesen SL, Mueller T, Magid J, Nielsen NE (1997) Temporal variations of C and N mineralization, 

microbial biomass and extractable organic pools in soil after oilseed rape 

straw incorporation in the field. Soil Biol Biochem 29:1043–1055 

Jensen LE, Nybroe O (1999) Nitrogen availability to Pseudomonas fluorescens DF57 is 

limited during decomposition of barley straw in bulk soil and in barley rhizosphere. 


Johansen A, Finaly RD, Olsson PA (1996) Nitrogen metabolism of external hyphae of the 

arbuscular mycorrhizal fungus Glomus intaradices. New Phytol 133:705–712 

Jones DL (1998) Organic acids in the rhizosphere – a critical review. Plant Soil 205:25–44 

Kim KY, Jordan D, McDonald GA (1998) Enterobacter agglomerans, phosphate solubilizing 

bacteria and microbial activity in soil: effect of carbon sources. Soil Biol Biochem 

30:995–1003 

Knudsen IMB, Debosz K, Hockenhull J, Jensen DF, Emholt S (1999) Suppressiveness of 

organically and conventionally managed soils towards brown foot rot of barley. Appl 


Koide RT, Dickie IA (2002) Effects of mycorrhizal fungi on plant populations. Plant Soil 

244:307–317 

Kozdroj J, van Elsas JD (2001) Structural diversity of microorganisms in chemically perturbed 

soil assessed by molecular and cytochemical approaches. J Microbiol Meth 

43:197–212 

Kumar PKR, Lonsane BK (1989) Microbial production of gibberellins: state of the art. 

Adv Appl Microbiol 34:29–139 

Kumar V, Narula N (1999) Solubilization of inorganic phosphates and growth emergence 

of wheat as affected by Azotobacter chroococcum mutants. Biol Fertil Soils 28:301–305 

Kumar A, Nivedita P, Upadhyaya RS (1999) VA mycorrhizae and revegetation of coal 

mine spoils: a review. Trop Ecol 40:1–10 

Kumar V, Singh KP (2001) Enriching vermicompost by nitrogen fixing and phosphate 

solubilizing bacteria. Biores Technol 76:173–175 

Kumari V, Srivastava JS (1999) Molecular and biochemical aspects of rhizobacterial ecology 

with emphasis on biological control. World J Microbiol Biotechnol 15:535–543 

Kuzyakov Y, Domanski G (2002) Carbon input by plants into the soil. J Plant Nutr Soil Sci 

163:421–431 

Lechevalier MP (1994) Minireview: taxonomy of the genus Frankia (Actinomycetales). 

Int J Syst Bacteriol 44:1–8


Loreau M (2001) Microbial diversity, producer-decomposer interactions and ecosystem 

processes: a theoretical model. Proc R Soc Biol Sci B 268:303–309 

Madder P,Vierheilig H, Boller T, Streitwolf-Engel B, Frey B, Christie P,Wiemken A. (2000) 

Transport of 15 N from a soil compartment separated by a polytetraflouroethylene 

membrane to plant roots via the hyphae of arbuscular mycorrhizal fungi. New Phytol 

146:155–161 

Martens DA, Frankenberger Jr WT (1993) Metabolism of tryptophan in soil. Soil Biol 

Biochem 25:1679–1687 

Maunuksela L (2001) Molecular and physiological characterization of rhizosphere bacteria 

and Frankia in forest soils devoid of actinorhizal plants. Ph.D thesis. University 

of Helsinki, Helsinki, Finland 

Merryweather J, Fitter A (1995) Phosphorus and carbon budgets mycorrhizal contributions 

in Hyacinthoides nonscripta (L.) Chouard ex Rothm under natural conditions. 

New Phytol 129:619–627 

Miller RM, Jastrow JD (1994) Vesicular arbuscular mycorrhizae and plant biogeochemical 

cycling. In: Pfleger FL, Linderman RG (eds) Mycorrhizae and plant health, APS 

Press, St. Paul, USA, pp 189–212 

Myrold DD (2000) Microorganisms. In: Alexander DE, Fairbridge RW (eds) Encyclopedia 

of Environmental Science. Kluwer, Amsterdam, pp 409 

Nahas E (1996) Factors determining rock phosphate solubilization by microorganisms. 

World J Microbiol Biotechnol 112:567–572 

Narsian V, Patel HH (2000) Aspergillus aculeatus as a rock phosphate solubilizer. Soil Biol 

Biochem 32:559–565 

Naseby DC, Way JA, Bainton NJ, Lynch JM (2001) Biocontrol of Pythium in the pea rhizosphere 

by antifungal metabolite producing and non-producing Pseudomonas 

strains. J Appl Microbiol 90:421–429 

Nautiyal CS, Bhadauria S, Kumar P, Lal H, Mondal R, Verma D (2000) Stress induced 

phosphate solubilization in bacteria isolated from alkaline soils. FEMS Microbiol Lett 

182:291–296 

Neilands JB, Leong SA (1986) Siderophores in relation to plant growth and disease.Annu 

Rev Plant Physiol 37:187–208 

O’Donnell AG, Görres HE (1999) 16S rDNA methods in soil microbiology. Curr Opin 


Olesniewics KS, Thomas RB (1999) Effects of mycorrhizal colonization on biomass production 

and nitrogen fixation of black locust (Roina pseudoacacia) seedlings grown 

under elevated atmospheric carbon dioxide. New Phytol 142:133–140 

Omar SA (1994) Degradation and mineralization of wheat straw by some cellulolytic 

fungi in pure culture. Microbiol Res 149:157–161 

Pal SS (1998) Interaction of an acid tolerant strain of phosphate solubilizing bacteria 

with a few acid tolerant crops. Plant Soil 198:169–177 

Pankhurst CE, Pierret A, Hawke BG, Kirby JM (2002) Microbiological and chemical properties 

of soil associated with macrospores at different depths in a red-duplex soil in 

NSW Australia. Plant Soil 238:11–20 

Paul EA, Clark FE (1998) Soil microbiology and biochemistry, 2nd edn. Academic Press, 

San Diego 

Peix A, Rivas-Boyero AA, Mateos PF, Rodriguez-Barrueco C, Martinez-Molina E, 

Velazquez E (2001) Growth promotion of chickpea and barley by a phosphate solubilizing 

strain of Mesorhizobium and mediterraneum under growth chamber conditions. 


Perotto S, Girlanda M, Martino M (2002) Ericoid mycorrhizal fungi: some new perspectives 

on old acquaintances. Plant Soil 244:41–53

96 


Prosser JI (2002) Molecular and functional diversity in soil microorganisms. Plant Soil 

244:9–17 

Rajbanshi SS, Endo H, Sakamoto K, Inubushi K (1998) Stabilisation of chemical and biochemical 

characteristics of grass straw and leaf mix during in-vessel composting with 

and without seeding material. Soil Sci Plant Nutr 44:485–495 

Ranjard L, Richaume A (2001) Quantitative and qualitative microscale distribution of 

bacteria in soil. Res Microbiol 152:707–716 

Rasmussen PH, Knudsen IMB, Elmholt S, Jensen DF (2002) Relationship between soil 

cellulolytic activity and suppression of seedling blight of barley in arable soils. Appl 


Read DJ (1996) The structure and function of the ericoid mycorrhizal root. Ann Bot 

77:365–374 

Reddy MS, Kumar S, Babita K, Reddy MS (2002) Biosolubilization of poorly soluble rock 

phosphates by Aspergillus tubingensis and Aspergillus niger. Biores Technol 

84:187–189 

Rennenberg H (1999) The significance of ectomycorrhizal fungi for sulfur nutrition of 

trees. Plant Soil 215:115–122 

Rengel Z (2002) Breeding for better symbiosis. Plant Soil 245:147–162 

Requena N, Azcon R, Baca MT (1996) Chemical changes in humic substances from compost 

due to incubation with lignocellulolytic microorganisms and effects on lettuce 

growth. Appl Microbiol Biotechnol 45:857–863 

Reyes I, Baziramakenga R, Bernier L,Antoun H (2001) Solubilization of phosphate rocks 

and minerals by a wild type strain and two UV-induced mutants of Penicillium rugulosum. 


Rice WA, Olsen PE, Legget ME (1995) Co-culture of Rhizobium meliloti and a phosphorus 

solubilizing fungus (Penicillium bilaii) in sterile peat. Soil Biol Biochem 27: 

703–705 

Ritz K, Wheatley RE, Griffiths BS (1997) Effects of animal manure application and crop 

plants upon size and activity of soil microbial biomass under organically grown 

spring barley. Biol Fert Soils 24:372–377 

Schipper LA, Dehgens BP, Sparling GP, Duncan LC (2001) Changes in microbial heterotrophic 

diversity along five plant successional sequences. Soil Biol Biochem 

33:2093–2103 

Sen R (2000) Budgeting for the wood – wide web. New Phytol 145:161–165 

Sharples JM, Mehrag A, Chambers SM, Cairney JWG (2000) Mechanism of arsenate resistance 

in the ericoid mycorrhizal fungus Hymenoscyphus ericae. Plant Physiol 

124:1327–1334 

Shen D (1997) Microbial diversity and application of microbial products for agricultural 

purposes in China. Agric Ecosyst Environ 62:237–245 

Simon L (1996) Phylogeny of the Glomales: Deciphering the past to understand the present. 

New Phytol 133:95–101 

Singal R, Gupta R, Kuhad RC, Saxena RK (1991) Solubilization of inorganic phosphates 

by a Basidiomycetous fungus Cyathus. Ind J Microbiol 31:397–401 

Singh A, Sharma J, Rexer K-H, Varma A (2000) Plant productivity determinants beyond 

minerals, water and light: Piriformospora indica – a revolutionary plant growth-promoting 

fungus. Curr Sci 79:1548–1554 

Smit E, Leeflang P, Gommans S, van der Broek J, van MS, Werners K (2001) Diversity and 

seasonal fluctuations of the dominant members of the bacterial soil community in a 

wheat field as determined by cultivation and molecular methods. Appl Environ 

Microbiol 67:2284–2291 

Smith SE, Read DJ (1997) Growth and carbon economy of VA mycorrhizal plants. In: 

Mycorrhizal symbiosis. 2nd edn. Academic Press, London, pp 105–125


Staley JT (1997) Biodiversity: are microbial species threatened? Curr Opin Biotechnol 

8:340–345 

Steenhoudt O, Vanderleyden J (2000) Azospirrilum, a freeliving nitrogen fixing bacterium 

closely associated with grasses: genetic, biochemical and ecological aspects. 

FEMS Microbiol Rev 24:487–506 

Stepanov AL, Korpelal TK (1997) Microbial basis for the biotechnological removal of 

nitrogen oxides from flue gases. Biotechnol Appl Biochem 25:97–104 

Subba Rao NS (1999) Soil microbiology, 4th edn, Science Publishers, New Hampshire 

Suneja S, Lakshminarayana K (1999) Siderophore production of Azotobacter. In: Narula 

N (ed) Azotobacter in sustainable agriculture, CBS Publishers, New Delhi, pp 64–73 

Timmusk S, Nicander B, Granhall U, Tillberg E (1999) Cytokinin production by Paenibacillus 

polymyxa. Soil Biol Biochem 31:1847–1852 

Tiedje JM, Cho JC, Murray A, Travers D, Xia B, Zhou J (2001) Soil teeming with life: new 

frontiers for soil science. In: Rees RM, Ball BC, Campbell CD, Watson CA (eds) Sustainable 

management of soil organic matter, CAB International, London, pp 393–412 

Toro M,Azcon R, Barea J (1997) Improvement of arbuscular mycorrhiza development by 

inoculation of soil with phosphate solubilizing rhizobacteria to improve rock phosphate 

bioavailability (32P) and nutrient cycling. Appl Environ Microbiol 63:4408– 

4412 

Torrisi V, Pattinson GS, McGee PA (1999) Localized elongation of roots of cotton follows 

establishment of arbuscular mycorrhizas. New Phytol 142:103–112 

Torsvik V, Øvreås L (2002) Microbial diversity and function in soil: from genes to ecosystems. 

Curr Opin Microbiol 5:240–245 

Torsvik V, Sorheim R, Goksoyr J (1996) Total bacterial diversity in soil and sediment 

communities – a review. J Ind Mcirobiol 17:170–178 

Unge A, Jansson J (2001) Monitoring population size, activity, and distribution of gfpluxAB-tagged 

Pseudomonas fluorescence SBW25 during colonization of wheat. 


Valdenegro M, Barea JM,Azcon R (2001) Influence of arbuscular-mycorrhizal fungi, Rhizobium 

meliloti strains and PGPR inoculation on the growth of Medicago arborea 

used as nodel legume for revegetation and biological reactivation in a semi-arid 

mediterranean area. Plant Growth Regul 34:233–240 

Varma A (1995) Ecophysiology of mycorrhizal fungi. In: Varma A, Hock B (eds) Mycorrhizae: 

structure, function, molecular biology and biotechnology, Springer-Verlag, 

Berlin Heidelberg New York, pp 561–592 

Varma A, Bonfante P (1994) Utilization of cell wall related carbohydrates by ericoid mycorrhizal 

endophytes. Symbiosis 16:301–313 

Varma A, Verma S, Sudha A, Sahay N, Butehorn B, Franken P (1999) Piriformospora 

indica, a cultivable plant-growth-promoting root endophyte. Appl Environ Microbiol 

65:2741–2744 

Vassilev N, Franco I,Vassileva M,Azcon R (1996) Improved plant growth with rock phosphate 

solubilized by Aspergillus niger grown on sugar beet waste. Biores Technol 

55:237–241 

Vassilev N,Vassileva M, Fenice M, Fedirici F (2001) Immobilized cell technology applied 

in solubilization of insoluble inorganic (rock) phosphates and P plant acquisition. 

Biores Technol 79:263–271 

Verghese SK, Sarma G, Chauhan V, Misra AK (1998) Optimising actinorhizal symbiosis 

using molecular markers. In: Rai B, Dkahr MS (eds) New trends in microbial ecology. 

NEH University, Shilong and International Society for Conservation of Natural 

Resources, BHU,Varanasi, India, pp 350–354 

Verstaete W, Top EM (1999) Soil clean up: lessons to remember. Int Biodeter Biodeg 

43:147–153

98 


Vierheilig H, Bennett R, Kiddle G, Kaldorf M, Ludwig-Muller J (2000) Differences in glucosionolate 

patterns and arbuscular mycorrhizal status of glucosionolate containing 

species. New Phytol 146:343–352 

Watkins NK, Fitter AH, Graves JD, Robinson D (1996) Carbon transfer between C3 and 

C4 plants linked by a common mycorrhizal network, quantified using stable carbon 

isotopes. Soil Biol Biochem 28:471–477 

Whitelaw MA, Harden TJ, Helyar KR (1999) Phosphate solubilization in solution culture 

by the soil fungus Penicillium radicum. Soil Biol Biochem 31:655–665 

Wiemken V, Boller T (2002) Ectomycorrhiza: gene expression, metabolism and the 

wood-wide web. Curr Opin Plant Biol 5:1–7 

Yin B, Crowley D, Sparovek G, De Melo WJ, Borneman J (2000) Bacterial functional 

redundancy along a soil reclamation gradient. Appl Environ Microbiol 66:4361–4365 

Zehnder GW, Murphy JF, Sikora EJ, Kloepper JW (2001) Application of rhizobacteria for 

induced resistance. Eur J Plant Pathol 107:39–50 

Zhu W, Ehrenfeld JG (1996) The effects of mycorrhizal roots on litter decomposition, soil 

biota and nutrients in a spodsolic soil. Plant Soil 179: 109–118

6 Signalling in the Rhizobia–Legumes Symbiosis 



During the last few years, significant progress has been made in the understanding 

of signal production, signal perception and signal regulation in 

plants, microorganisms and animals. In mammalian systems, the notch signal 

regulation has been studied intensively with a number of proteins involved in 

the signal transport and the proteolytic modifications of the notch signals 

(Fig. 1). The involvement of several organelles such as lysosomes, endoplasmic 

reticulum and the Golgi network points to interesting similarities and 

differences to the signalling across and through the symbiosome membrane 

(Werner 1992). Four different mammalian notch homologues have been identified 

(Baron et al. 2002). The integrin-adhesion-receptor signalling is another 

surface related crosstalk in multicellular organisms (Schwartz and Ginsberg 

2002). The cell adhesion involving integrins leads to a phosphorylation of different 

growth-factor receptors, including those for the fibroblast growth factor, 

the hepatocyte growth factor and the epidermal growth factor (Giancotti 

and Ruoslahti 1999).Very recently, a plant receptor-like kinase has been identified 

in the laboratory of Martin Parniske, The Sainsbury Laboratory, UK, 

which is required for the rhizobial legume symbiosis as well as for the arbuscular 

mycorrhiza symbiosis (Stracke et al. 2002). The SYMRK (symbiosis 

receptor-like kinase) genes have been studied and characterized in Lotus and 

in pea. The protein has a signal peptide, a transmembrane and an extracellular 

protein kinase domain. The SYMRK is part of a symbiotic signal transduction 

pathway with the perception of a microbial signal molecule, leading 

to a rapid symbiosis-related gene activation. In Medicago sativa,a “nodulation 

receptor kinase” NORK was identified with a predicted function in Nod-factor 

perception/transduction (Endre et al. 2002). 

Besides the short-distance signalling between microorganisms and plant 

surfaces, long-distance signalling also affects the plant partner of the interaction. 

Using mutants of Arabidopsis, the role for long-chain fatty acids in cellto-cell 

communication has been established and the plant hormones abscisic 




100 


Fig. 1. Notch trafficking and signal regulation. Trafficking of Notch through the cell in 

conjunction with covalent modifications of Notch may confer potential points of regulation 

of Notch-signalling levels. Proteins known or suspected to affect particular steps in 

the transport process or the proteolytic modification of Notch are indicated in bold. 

Numbers indicate the potential decision points that could determine signal levels. 1 

Notch trafficking to the Golgi body may be subject to quality control and cargo selection 

by P24 family proteins. 2 Small GTPases such as Rab6 may regulate transport to trans- 

Golgi where Furin-dependent proteolysis occurs. 3 Notch transported to the cell surface 

may undergo endocytosis (4), or 5 ligand-dependent activation at the cell surface. The 

latter is accompanied at least in some tissues by 6 trans-endocytosis of the Notch extracellular 

domain into the adjacent ligand-bearing cell. 7 The remaining membrane-tethered 

intracellular domain undergoes Presenilin-dependent cleavage releasing Notchintra 

for translocation to the nucleus leading to regulation to target gene expression. 8 

Accumulation of Notch-intra in the nucleus may be regulated by its ubiquitination and 

proteosome-dependent degradation (Baron et al. 2002)

acid, ethylene and jasmonates are involved in the long-distance signalling, 

regulating, e.g., the stomata number by environmental signals such as the CO 2 

partial pressure (Lake et al. 2002). Other long-distance signals, e.g., from roots 

to shoots, are transported in the xylem. This roots to shoots signalling has a 

lag time of only a few hours, persisting for several days (Jackson 2002). 

Abscisic acid (ABA) plays an important role in the signalling from the roots 

and the rhizosphere, e.g., in water stress for the regulation of stomata behavior 

(Wilkinson and Davies 2002). The signalling process includes the following 

steps: ABA sequestration in the root, ABA synthesis and catabolism in the 

root, the transfer of ABA across the root and into the xylem, the exchange of 

ABA from the xylem lumen to the xylem parenchyma in the shoot, the concentration 

of ABA in the leaf symplastic reservoir, the cleavage of ABA conjugates, 

the transfer of ABA from the leaf into the phloem and an assumed interaction 

between nitrate stress and the ABA signal. 

Moreover, in unicellular eukaryotic model organisms specific signal molecules 

have been identified, such as phosphatidylinositol (3,5) bisphosphate 

modified by the phosphatidylinositol 3-phosphate 5-kinase in Schizosacchromyces 

pombe and which are required to respond to nutritional starvation 

(Morishita et al. 2002). This pathway is also necessary for mating the 

pheromone signal in this yeast. The question arises if these compounds also 

play a role in microbes – plant surface signalling. The costs for biological 

signalling are an important aspect in evolution. New results indicate that 

there is a shift to signals with high cost and an underutilization of signals 

with low costs (de Polavieja 2002). The signal structure follows a generalized 

Boltzmann form, penalizing signals with high costs and a high sensitivity to 

errors. In this respect, costs are defined in metabolic costs, time costs or risk 

costs. 

In bacteria key components for major regulatory pathways have been identified 

such as the protein H-NS (Schröder and Wagner 2002). It is a small DNA 

binding protein, regulating a diverse range of genes such as for anaerobic 

growth phase activation, endochitinase, nitrate reductase, leucine responsive 

regulatory proteins, a proline/glycine betaine transport system, an activator 

for capsular polysaccharide synthesis and an invasion regulatory gene. 

2 The Signals from the Host Plants 

6 Signalling in the Rhizobia–Legumes Symbioses 101 

In principle, molecules released from plant surfaces can be substrates and signals 

for microorganisms. Types and functions of root exudates in the rhizosphere 

have recently been reviewed by Brimecombe et al. (2001), Neumann 

and Römheld (2001) and Uren (2001). Their functions as signal molecules 

have been reviewed by Werner (2001) and Werner and Müller (2002).

102 


2.1 Phenylpropanoids: Simple Phenolics, Flavonoids and Isoflavonoids 

The basis of this biochemical pathway is the shikimate pathway, producing 

aromatic amino acids and several vitamins and co-factors. The phenylalanine-ammonia-lyase 

(PAL) produces cinnamate from phenylalanine, which is 

a precursor of a large number of phenolics, phenylpropanoids and flavonoids 

(Paiva 2000). Major cinnamate derivatives are para-coumaric acid, caffeic 

acid, ferulic acid and sinapic acid, leading to plant surface polymers such as 

suberin and lignin. The ortho-hydroxylation of cinnamate gives coumarate, a 

precursor of coumarin, which has a strong antimicrobial activity. Another 

derivate is salicylic acid, which has also antimicrobial activity and a function 

in signal transduction during plant pathogenic interactions. Especially well 

studied is the function of acetosyringone, inducing vir gene expression in 

Agrobacterium tumefaciens, with a broad range of host plants. Dimers of 

phenylpropanoids form lignans such as the antifungal compound magnolol 

and the toxic compound podophyllotoxin. The biosynthesis of major classes 

of flavonoids and isoflavonoids are summarized in Fig. 2, according to Dixon 

and Steele (1999). Major enzymes involved are chalcone synthase, chalcone 

reductase, chalcone isomerase, flavone synthase I and II, flavonol synthase, 

isoflavone synthase and flavonoid 3¢-hydroxylase. The major nod genes 

inducing compounds in legumes are isoflavones such as daidzein (R1=H) and 

genistein (R1=OH). The pterocarpan at the end of this pathway includes phytoalexins 

such as medicarpin from alfalfa and glyceollin I from soybeans. In 

addition to the intensively studied effects of flavonoids and isoflavonoids in 

the interaction of plants with microorganisms, the health-promoting effects 

in medical sciences are another intensively studied area. Genistein, for 

instance, has been shown in human cell lines to inhibit prostate tumor 

growth, stomach tumor growth and anti-angiogenesis (Rice-Evans and Miller 

1996; Hollman and Katan 1998). Genistein has also an effect in preventing 

bone-loss caused by deficiency of estrogens in female mice (Ishimi et al. 

1999). 

Fig. 2. The biosynthesis of the major classes of flavonoid derivates. The enzymes are: 

CHS chalcone synthase, CHR chalcone reductase, CHI chalcone isomerase, FSI flavone 

synthase I, FSII flavone synthase II, ‘IFS’ isoflavone synthase, consisting of 2-hydroxyisoflavanone 

synthase (2HIS) and 2-hydroxyisoflavanone dehydratase (2-HID), F3bH 

flavanone 3b hydroxylase, F3¢H flavonoid 3¢hydroxylase, F3¢5H flavonoid 3¢,5¢-hydroxy-


lase, DFR dihydroflavonol reductase, ANS anthocyanidin synthase, 3GT anthocyanidin 

3-glucosyltransferase, IOMT isoflavone O-methyltransferase, IFR isoflavone reductase, 

VR vestitone reductase, DMID 7,2¢-dihydroxy, 4¢-methoxyisoflavanol dehydratase. 

Enzymes in white are 2-oxoglutarate-dependent dioxygenases, in black bold are 

cytochrome P450s, and highlighted in grey are NADPH-dependent reductases. Simplifications 

include not discriminating between the 5-hydroxy (R1=OH) and 5-deoxy 

(R1=H) flavonoids and isoflavonoids, for which the loss of the 5-hydroxyl occurs 

because of the co-action of CHR with CHS, showing only the anthocyanin pathway leading 

to the compounds with a di-substituted B-ring (cyaniding derivatives). Parallel pathways 

function in the formation of anthocyanins with mono- and tri-substituted B-rings. 

In the latter, F3¢5¢H can act at the level of the dihydroflavonol with a mono-or di-substituted 

B-ring. The pathway to epicatechin from a dihydroflavonol is shown to follow two 

routes, both via leucocyanidin. It is unclear whether there is a specific form of DFR that 

functions only in condensed tannin biosynthesis. The 4¢-O-methylation of the B-ring of 

isolflavones occurs in alfalfa, pea and other legumes, but not in bean or soybean (Dixon 

and Steele 1999)

104 


2.2 Metabolization of Flavonoids and Isoflavonoids 

A degradation pathway for luteolin by Sinorhizobium meliloti and for 

daidzein by Bradyrhizobium japonicum is shown in Fig. 3. Identified metabolites 

from luteolin were caffeic acid, phoroglucinol, protocatechuic acid and 

phenylacetic acid. Daidzein, p-coumaric acid, p-hydroxybenzoic acid, phenylacetic 

acid and resorcinol were major metabolites. Umbeliferone has also 

been found to be produced from coumestrol (Cooper et al. 1995). 

Fig. 3. Proposed degradation pathway for luteolin by Sinorhizobium meliloti and for 

daidzein by Bradyrhizobium japonicum (Cooper et al. 1995)


Flavanone metabolites from animals and humans are summarized in 

Table 1 (Heilmann and Merfort 1998).A number of flavanes, flavanoles, trans- 

3-hydroxyflavanes, 6-hydroxyflavanones, 6-hydroxyflavanes, 4-hydroxyflavanes, 

3,6-dihydroxy-flavanes, 3,4-dihydroxy-flavanes and methoxyflavanes 

have been identified. The best studied flavane is catechin. The major metabolites 

of this compound in humans are 3-hydroxybenzoic acid, 3-hydroxyphenylpropionic 

acid, 3-hydroxyhippuric acid, 3,4-dihydroxyphenylbenzoic 

acid, 5-(3,4-dihydroxy)-valerianic acid and d-(3-hydroxy-4-methoxyphenyl)g-valerolactone. 

Metabolites excreted from mammalians can, in certain locations 

of the soil, therefore also significantly increase the concentrations of 

flavonoid and isoflavonoid metabolites which may affect the plant-microbe 

interactions. Sulfation of flavonoids and phenolic dietary compounds by 

cytosolic sulfotransferases has been studied in detail by Pai et al. (2001). The 

mechanisms for a chemoprotective action of these compounds is the inhibition 

of the bioactivation of carcinogens by the human cytosolic sulfotransferases. 

The ten known cytosolic sulfotransferases have a different substrate 

specificity, e.g., the isoform PST has a high activity with flavonoids, but no 

activity with isoflavonoids (Pai et al. 2001). 

A fluoroimmunoassay has been developed to detect small concentrations 

of daidzein and genistein as phytoestrogens in blood plasma. After synthesis 

of 4¢-O-carboxymethyl-daidzein and 4¢-O-carboxymethyl-genistein, these 

compounds were linked to bovine serum albumin and used to immunize rabbits. 

The antisera were cross-reactive with some isoflavonoids, but not with 

flavonoids (Wang et al. 2000). The assays could detect daidzein and genistein 

in the range between 1 and 370 nMol/l. The actual concentrations in the blood 

plasma were in the range between 4 and 7 nMol/l. The correlation coefficient 

between this fluoroimmunoassay and a reference method, using an isotope 

dilution gaschromatography mass spectrometry, was in the range of 0.95– 

0.99. Another method to detect low concentrations of estrogenic flavonoids 

was the development of a recombinant yeast strain in which the human estrogen 

receptor was stably integrated into the genome. The most active 

flavonoids in this assay were naringenin, apigenin, kaempferol, phloretin, 

Table 1. Metabolites from flavanones (Heilmann and Merfort 1998) 

Flavane-4-a-ol 4¢-hydroxyflavane 

Flavane-4-b-ol 4¢-hydroxyflavane-4-a-ol 

Trans-3-hydroxyflavanone 4¢- hydroxyflavane-4-b-ol 

Trans-3-hydroxyflavane-4-a-ol 3,6-dihydroxy-flavane-4-a-ol 

Trans-3-hydroxyflavane-4-b-ol 3,6-dihydroxy-flavane-4-b-ol 

Flavone-3-ol 3,4-dihydroxy-flavane-4-a-ol 

6-Hydroxyflavanone 3,4-dihydroxy-flavane-4-b-ol 

6-Hydroxyflavane-4-a-ol 4¢-hydroxy-3¢-methoxyflavane-4-a-ol 

6-Hydroxyflavane-4-b-ol 4¢-hydroxy-3¢-methoxyflavane-4-b-ol

106 


equol, genistein, daidzein and biochanin A. The main feature for the estrogenic 

activity in these compounds is a single hydroxyl group at the 4¢-position 

of the B-ring of the flavan nucleus. It must be pointed out that the estrogenic 

activity of these flavonoids is 4,000–4,000,000 times lower than that of 17bestradiol 

(Breinholt and Larsen 1998). In the Handbook of Flavonoids (Harborne 

1994), about 900 different isoflavones, chalcones, pterocarpans, Bflavonoids, 

rotenoids, isoflavanes and coumestrols are listed. Nevertheless, 

new flavonoids can be found by studying less known legumes. In Ulex airensis 

and Ulex europaeus three new isoflavonoids called ulexin C, ulexin D and 

7-O-methylisolupalbigenin could be isolated and characterized (Maximo et 

al. 2002). 

Another important group of plant signals involved in symbiosis and 

defense reactions are fatty acid-derived signals (Weber 2002). The best studied 

compound in this category is jasmonic acid and its volatile methyl ester. 

Almost 20 different jasmonate signalling mutants in Arabidopsis are known 

(Staswick et al. 1998; Thomma et al. 1998; Hilpert et al. 2001). With Arabidopsis 

it has also been shown that keto, hydroxy and hydroperoxy fatty acids such 

as ketodienoic fatty acid can accumulate in plants after infection with 

Pseudomonas syringae. By infiltration of these compounds into Arabidopsis 

leaves, the gene encoding glutathione-S-transferase (GST1) has been demonstrated 

(Weber 2002). From a large number of flavonoids and isoflavonoids 

tested for their ability to inhibit the ascorbate-induced microsomal lipid peroxidation, 

kaempferol has been showed to have the highest activity of all 

flavonoids tested (Cos et al. 2001). 

2.3 Vitamins as Growth Factors and Signal Molecules 

On a molecular basis the best-studied system is the effect of biotin on growth 

and survival of Sinorhizobium meliloti. Already, nanomolar concentrations of 

biotin increase the colonization of alfalfa roots sevenfold and addition of 

avidin, a biotin-binding protein from eggs, reduces the colonization by a factor 

of 7. Biotin is a co-factor of carboxylation reactions and biotinylated carboxylases 

have been demonstrated in Rhizobium etli (Dunn 1996). From the 

biotin biosynthesis pathway, several genes such as bioA, bioC and bioH are 

apparently not functional and also for bioD, no homology genes have been 

found (Entcheva et al. 2001). On the other hand, components of a prokaryotic 

biotin transporter have been identified with bioMN, which are activated 

under biotin deficiency. Rhizobia have a very efficient uptake system for 

biotin. The kM values are 40 times lower than those for the transport system 

for E. coli. With biotin limitation the synthesis of PHB is significantly 

increased in Sinorhizobium meliloti and Rhizobium etli. Under biotin limitation 

the transcription rate of the gene, responsible for proteins of PHB degradation 

is down-regulated. Addition of biotin at nanomolar concentrations

increases the activity of the bdhA gene more than fivefold, as demonstrated 

for strains with a lac-Z-fusion (Streit et al. 1996; Hofman et al. 2000). 

Another very interesting signal molecule derived from a vitamin is 

lumichrome, which is produced from riboflavin and functions as a signal 

molecule in the rhizosphere (Philipps et al. 1999). Nanomolar concentrations 

of lumichrome around the roots increase the root respiration and also photosynthesis. 

This may be of general significance since a number of riboflavinproducing 

bacteria have been identified on roots in a significantly higher 

number than in the bulk soil (Strzelczyk and Rozycki 1985). 

3 Signals from the Microsymbionts 

3.1 Nod Factors 


A breakthrough in understanding infection, nodulation and host specificity 

in the Rhizobium-legume symbiosis was the identification of Nod factors 

such as lipochitooligosaccharides (LCOs) produced and excreted by more 

than 30 different nod, nol and noe genes and their corresponding proteins 

from the microsymbionts. The first identified Nod factors were from Rhizobium 

meliloti (Lerouge et al. 1990) and from Rhizobium leguminosarum bv. 

viciae (Spaink et al. 1991). The general structure of Nod factors are N-acetylglucosamine 

backbone with four or five GlcNAc residues with different substituents 

at nine different positions such as N-methyl, O-carbamyl, O-acetyl, 

O-sulfyl, a-linked fucosyl, 2-O-methylfucosyl, 4-O-acetyl-2-O-methylfucosyl, 

3-O-sulfate-2-O-methylfucosyl, ethyl, glyceryl, mannosyl and N-glycosyl 

groups. Another major residue variable is the fatty acid group attached to the 

nitrogen of the nonreducing end of the Nod factor. Fatty acids with 16–18 carbons 

and a different degree of unsaturation in different positions of the double 

bonds are mainly present. In addition, C18–C22 (w-1)-hydroxy fatty acids, 

Fig. 4. General structure of the Nod factors produced by rhizobia. The presence of substituents 

numbered R1–R9 is variable within various strains of rhizobia. In the absence 

of specific substituents, the R groups stand for hydrogen (R1), hydroxy (R2, R3, R4, R5, 

R6, R8, and R9), and acetyl (R7) (Spaink 2000)

108 


Table 2. Modifications of Nod factors (Modified from Spaink 2000 and Pacios-Bras et al. 

2002) a 

Bacterial strain Nodulated GlcNAc Special substituents c 

plant residues 

tribes (n) b 

S. meliloti Galegeae 3,4,5 R4:Ac, R5:S, C16:2, C16:3, C26(w-1)OH 

R. leguminosarum 

bv. Viciae RBL5560 Galegeae 3,4,5 R4:Ac, C18:4 

bv. Viciae TOM Galegeae 3,4,5 R4:Ac, R5:Ac, C18:4 

bv. Viciae A1 Galegeae 3,4,5 R4:Ac, R5:Ac, C18:4, C18:3 

bv. Trifolii ANU842 Galegeae 3,4,5 R4:AC, R5:Ac, R6:Et, C20:4, C20:3, C18:3 

R. galegae Galegeae 4,5 R4:Cb, R9:Ac, C18:2, C18:3, C20:2, C20:3 

M. huakuii Galegeae 3,4,5 R5:S, R7:G, C18:4 

M. loti 

E1R, NZP2235 Loteae 4,5 R1:Me, R3:Cb, R5:AcFuc 

NZP2037 Loteae 

Genisteae 4,5 R1:Me, R2:Cb, R3:Cb, R5:AcFuc 

NZP2213 Loteae 2,3,4,5 R1:Me, R3:Cb, R5:AcFuc, R9:Fuc 

B. aspalati bv. carnosa Crotalarieae 3,4,5 R1:Me, R3:Cb, R4:Cb 

B. japonicum USDA110 Phaseoleae 5 R5:MeFuc 

B. japonicum USDA135 Phaseoleae 5 R4:Ac, R5:MeFuc 

B. elkanii USDA61 Phaseoleae 4,5 R1:Me, R4:Ac, R3:Cb, R5:MeFuc, R6:Gro 

R. etli Phaseoleae 4,5 R1:Me, R3:Cb, R5:AcFuc 

R. etli KIM5S Phaseoleae 6 R1:Me, R2-R6:H, R7:acetyl, R8:H, ring 

5:acetyl or H 

R. tropici Phaseoleae, 4,5 R1:Me, R5:S, R6:Man 

Mimoseae 

S. fredii 

USDA257 23 Tribes 3, 4,5 R5:MeFuc 

NGR234 26 Tribes 4,5 R1:Me, R3:Cb, R4:Cb, R5:MeFuc/AcMe- 

Fuc/SmeFuc 

Rhizobium sp. GRH2 Acacieae 3,5,6 R1:Me, R5:S 

S. teranga bv. acaciae Acacieae 5 R1:Me, R3/4:Cb, R5:S 

Mesorhizobium ORS1001 Acacieae 5 R1:Me, R3/4:Cb, R5:S 

A. caulinodans Robinieae 4,5 R1:Me, R4:Cb, R5:Fuc, R8:Ara 

S. sahelii Robinieae 4,5 R1:Me, R3/4:Cb, R5:Fuc, R8:Ara 

S. teranga bv. sesbaniae Robinieae 4,5 R1:Me, R3/4:Cb, R5:Fuc, R8:Ara 

a For backbone structure, see Fig. 4 

b The underlined numbers of N-acetylglucosamine (GlcNAc) residues indicate the most abundant 

species 

c The indicated substituents do not always occur in all lipochitin oligosaccharides (LCOs) produced, 

leading to a mixture of LCOs, which do or do not contain all possible substituents. 

Abbreviations: Me, N-methyl; Cb, O-carbamyl; Ac, O-acetyl; S, O-sulfyl; Fuc, a-linked fucosyl; 

MeFuc, 2-O-methylfucosyl, AcMeFuc, 4-O-acetyl-2- O-methylfucosyl; SmeFuc, 3-O-sulfate-2-Omethylfucosyl; 

Et, ethyl, Gro, glyceryl, Man, mannosyl; G, N-glycolyl; FA, fatty acyl

which are perhaps intermediates in the synthesis of C23 (w-1) hydroxy fatty 

acyl groups in lipopolysaccharides, can be present in Nod factors of Sinorhizobium 

meliloti (Demont et al. 1994). Figure 4 and Table 2 summarize the 

large variations of Nod factors identified so far. A novel lipochitin oligosaccharide 

has recently been found in Rhizobium etli KIM5S (Pacios-Bras et al. 

2002). This is the first case where the major LCO contains six oligosaccharide 

residues and differs by this point from all other rhizobia analyzed so far. An 

additional specificity was that the chitin backbone was deacetylated in one or 

two of the GlcNAc moieties, although these were only minor compounds. The 

fatty acids of these Nod factors were C16:0, C16:1, C18:0, C18:1 and C17:1. In 

this respect, the fatty acids are much more variable than those of Rhizobium 

etli strain CE3. Moreover, the host range of strain KIM5S of Rhizobium etli 

was different from the Rhizobium type strain CE3, since it could not nodulate 

Lotus japonicus, although it did nodulate Siratro.In Sinorhizobium meliloti it 

has been shown that an enzymatic N-deacetylation of the Nod factors 

decreases their biological activity, but increases the stability in the rhizosphere 

(Staehelin et al. 2000). 

In all rhizobia the nodABC genes are essential for the synthesis of the core 

LCO: NodC synthesizes the chito-oligosaccharide backbone and nodB 

removes N-acetyl groups from the sugar at its nonreducing end.All other nod, 

nol and noe genes are responsible for the modifications of this general structure, 

as indicated in Table 2. NodD is a positive transcription regulator from 

the Lysr family and present in all rhizobia. In some rhizobial species such as 

Sinorhizobium meliloti, nodD genes are present in multiple forms and their 

proteins respond to different groups of flavonoids. NodG has the enzymatic 

activity of an 3-oxoacyl-acyl carrier protein reductase and is thereby homologous 

to FabG involved generally in fatty acid elongation (López-Lara and 

Geiger 2001). 

3.2 Cyclic Glucans 


Cyclic glucans in rhizobia are small molecules linked either by b-(1,2) glycosidic 

bonds with 17–40 units in Rhizobium and Sinorhizobium or by b-(1,3) 

and b-(1,6) glycosidic bonds in Bradyrhizobium japonicum. Dominant substituents 

can be either sn-1-phosphoglycerol (Breedveld and Miller 1998) or 

phosphocholine (Rolin et al. 1992). The function of the cyclic glucans in Rhizobium, 

Sinorhizobium and Bradyrhizobium is to protect against hypoosmotic 

conditions. Rhizobia also produce, however, large quantities of cyclic 

glucans in the endosymbiotic stage. A specific function during this stage is 

assumed to be an increase in the solubility of flavonoids and Nod factors 

(Morris et al. 1991; Schlaman et al. 1997). Another hypothesis is, that b-glucans 

play a decisive role in the suppression of the host plant defense response 

with rhizobia, compared to phytopathogenic bacteria.

110 


3.3 Lipopolysaccharides 

Lipopolysaccharides (LPS) of rhizobia have been studied in only a few species 

such as Rhizobium etli and Rhizobium trifolii. The structure contains three 

parts, the lipid A, the core chain and the repeat unit of the O-antigen chain.All 

three parts are very variable. Typical features of rhizobial LPS are the very 

long chain hydroxy fatty acids (Hollingsworth and Carlson 1989). The genes 

of the LPS core and O-antigen synthesis have been localized on a plasmid 

(Vinuesa et al. 1999). A mutation in a glycosyltransferase produced a rough 

colony phenotype with a disruption of the O-antigen biosynthesis. 

The LPS in rhizobia may be involved in the infection process (Brewin 1998; 

Kannenberg et al. 1998). Their function is perhaps not in the first stages of 

symbiosis development, but in the release of the bacteria from the infection 

thread, and the first steps of the symbiosome membrane development. For the 

LPS moreover, a function in the suppression of the host plant defense 

response has been assumed, comparable to the LPS functions in plant 

pathogens (Schoonejans et al. 1987). 

3.4 Exopolysaccharides 

The exopolysaccharides (EPS) have been studied in detail by a large number 

of rhizobial strains (Becker and Pühler 1998; Becker et al. 1998; Van Workum 

and Kijne 1998). In Sinorhizobium meliloti two types of EPS forms could be 

discriminated, EPS I as a succinoglucan and EPS II as a galactoglucan with 

two size classes in each form, one with thousands of saccharide units and a 

low-molecular-weight class with only 8–40 saccharide units. All genes 

involved in the biosynthesis of the repeating units have been identified, especially 

in the laboratory of Alf Pühler. 

Exopolysaccharides play a major role in the primary stage of the infection 

of the host plants. It has been suggested that EPS are involved in the suppression 

of a defense response by the host plants and EPS mutants are eliciting a 

pronounced plant defense response (Parniske et al. 1994). There are linkages 

between the lipopolysaccharide and extracellular polysaccharide synthesis. A 

knockout of the dTDP-L-rhamnose synthase affects lipopolysaccharide and 

extracellular polysaccharide production, as shown for Azorhizobium caulinodans 

(Gao et al. 2001). The mutation affecting this gene induced only ineffective 

nodular structures on the host Sesbania rostrata, with no bacteroids 

and leghemoglobin present in the nodules. The bacteria were trapped in 

thick-walled infection threads.


4 Signal Perception and Molecular Biology of Nodule 

Initiation 

On the molecular and cellular level a large number of responses of legume 

roots to Nod factors (LCOs) are known (Table 3). In the epidermis and the 

root hairs, ion fluxes, plasma membrane depolarization and accumulation of 

calcium in the root hair tips have been observed within seconds. In the range 

of minutes; cytoskeleton modifications, root hair deformation and specific 

gene expression, e.g., for ENOD 12 are found as well as calcium 2+ spiking and 

phospholipase C and D activation. In the range of hours to days, formation of 

pre-infection threads and cell divisions in the nodule primordium can be 

observed, together with the expression of other early nodulins such as ENOD 

20. At the same time, in the vascular tissue, an inhibition of polar auxin transport 

and a specific gene expression of ENOD 40 follow. Several of these reactions 

are triggered by nanomolar concentrations of Nod factors. 

Table 3. Responses of legume roots to Nod factors (modified from Cullimore et al. 2000; 

Hartog et al. 2001; Hogg et al. 2002) 

Tissue Responses Rapidity of Concen- Tested 

response tration plant genera 

of Nod and species 

factors 

applied 

Epidermis Ion fluxes Seconds nM Medicago 

and root Plasma membrane Seconds nM Medicago 

hairs depolarization 

Increase in intracellular pH Seconds nM Medicago 

Accumulation of Ca 2+ in Seconds nM Medicago, Vigna 

root hair tip 

Ca 2+ spiking 10 min nM Medicago, Pisum 

Gene expression Minutes–hours fM–pM Medicago 

(e.g., ENOD12, RIP1) 

Root hair deformation Minutes–hours nM–µM Many 

Cytoskeleton modification Minutes–hours fM–pM Phaseolus, Vicia 

Phospholipase C and Minutes–hours nM Vicia sativa 

D activation 

Cortex Gene expression (e.g., ENOD20) Hours–days pM Medicago 

Formation of pre-infection Days nM–µM Vicia 

threads 

Cell division leading to nodule Days nM–µM Many 

primordium formation 

Competitive nodulation blocking Days nM Pisum 

(Cnb) 

Vasculature Inhibition of polar auxin Minutes Trifolium 

transport 

Gene expression (e.g., ENOD40) 24 h-days nM–µM Glycine, Vicia, 

Medicago

112 


There is increasing evidence that there is more than one LCO receptor 

responsible for these very different biochemical and structural phenotypes of 

Nod factor responses. In Medicago sativa a number of responses such as root 

hair deformation, membrane depolarization and ion fluxes require a sulfate 

group on the reducing sugar, whereas nonsulfated factors can elicit an 

increase in the cytosolic pH in root hairs (Felle et al. 1996). The presence of 

more than one LCO receptor is supported by different affinities with 4 nM for 

the Nod factor binding site NFBS2 and 86 nM for the binding site NFBS1 

(Gressent et al. 1999). Both receptors have a more than 100-fold higher affinity 

for Nod factors compared to chitin fragments. This means that they are 

different from the chitin fragment receptors in legumes and grasses (Stacey 

and Shibuya 1997). From Glycine and Dolichos a lectin nucleotype phosphohydrolase 

has been shown to have Nod factor-binding activity. It is plasma 

membrane located and may also have some functions in phosphate transport 

(Etzler et al. 1999; Thomas et al. 1999). With Medicago truncatula ENOD 12gene 

activation, it has been shown that heterotrimeric G proteins may be 

involved in the LCO signal transduction pathway (Pingret et al. 1998). This 

indicates an interesting relationship to signalling concepts in animal cells (see 

Sect. 1). The involvement of Nod factors in the different signalling pathways 

with G protein involvement was found by studying the phospholipase C activity 

in Medicago roots, by using the G protein activator mastoparan (Hartog et 

al. 2001). Similar to Nod factors, mastoparan produces root hair deformation 

in zone 1. It also increases the concentration of phosphatidic acid and diacylglycerol 

pyrophosphate four- to sixfold. The concentration of Nod factors also 

plays an important role.Addition of Nod factors to the cultivar Afghanistan in 

pea roots strongly inhibits nodulation (Hogg et al. 2002). The most obvious 

phenotype was the inhibition of infection thread initiation. The gene involved 

had been identified as sym2 A in this pea cultivar. Nod factors (LCOs) also have 

effects in nonlegume cells such as tobacco protoplasts (Röhrig et al. 1996). 

They activate the expression of the AX11 gene involved in auxin signalling. 

Auxin and LCOs are transduced in tobacco cells by different pathways at, or 

before, the AX11 transcription. The biochemical study on Nod factor integration 

into membranes revealed that they are rapidly transferred between 

membranes and from membrane vesicles to root hair cell walls (Goedhart et 

al. 1999). It was also shown that the Nod factors did not flip-flop between different 

membrane leaflets. Nod factors are present in buffers as monomers at a 

concentration effective in biological systems of around 10 nM, but when 

dioleoylphosphatidylcholine (DOPC) vesicles are added, the Nod factors 

associate with these vesicles. Our limited knowledge of the involvement of 

calcium spiking in the Ca 2+ signal pathway is obvious in the present models of 

calcium oscillations (Schuster et al. 2002). A general model involves six types 

of concentration variables: inositol-1,4,5-trisphosphate, cytoplasmic calcium, 

endoplasmic reticulum calcium and mitochondrial calcium, the occupied 

binding site of calcium buffers and the active IP 3-receptor calcium released


channel. The long search for the molecular identification of the gene responsible 

for the regulation of nodule number on the host plants (supernodulation) 

was successful. Characterized were a receptor like kinase with the HAR 

1 gene (Krusell et al. 2002; Nishimura et al. 2002) and the GmNARK gene from 

soybeans, a CLAVATA 1 like receptor kinase (Searle et al. 2002). HAR 1 and 

NARK are the same genes from different species, as summarized by Downie 

and Parniske (2002). 

Besides Nod factors, rhizobia also excrete other components relevant for 

the symbiosis development, e.g., type III secretion systems (TTSSs). Rhizobial 

TTSS clusters contain an open reading frame, homologous to ysc and hrc 

genes (Bogdanove et al. 1996; Hueck 1998; Marie et al. 2001). Two proteins 

have been identified in Rhizobium NGR234, secreted in a TTSS dependent 

way: nolX and y4xL.In Bradyrhizobium japonicum a new two-component system, 

ElmS and ElmR, has recently been identified, coding for a putative regulator 

protein and a putative sensor histidine kinase with unknown functions 

(Mühlencoert and Müller 2002). In agreement with the results from cytological 

observations in the chapter of F. Dazzo (see Chap 27, this Vol.), the population 

density-dependent expression of Bradyrhizobium japonicum nodulation 

genes has been reported (Loh et al. 2002). Induction of nod genes is high 

at low culture densities and is repressed at high population densities. The 

expression of NolA and NodD2 was mediated by an extracellular factor 

excreted into the medium. Two rhizobia species with a very broad host range 

are Rhizobium strain NGR234 and Rhizobium fredii USDA257 (Pueppke and 

Broughton 1999). They nodulate a wide range of mimosoid legumes, especially 

Acacia species and also the nonlegume Parasponia andersonii. In a few 

cases, only Rhizobium fredii USDA257 could nodulate some host plants such 

as Glycine max and Glycine soja. The most important result was that there is 

no relationship between the origin of the host plants and the ability of the 

strains to nodulate specific host plant species. The strain NGR234 shows significant 

dynamics of the genome architecture (Mavingui et al. 2002) with a 

large-scale DNA rearrangement, cointegration and excision exist between the 

three replicons, the symbiotic plasmids, the megaplasmid and the chromosome. 

Going from the laboratory to the field under natural conditions, especially 

in agricultural soils, we must realize that there are not only a large number of 

soil, microbial and plant factors involved, but nowadays also a large number 

of agrochemicals present in small quantities on seeds and also on emerging 

roots (Johnsen et al. 2001). Pesticide effects on specific populations of soil 

bacteria have been demonstrated for Rhizobium species (Ramos and Ribeiro 

1993) and with nitrifying bacteria (Martinez-Toledo et al. 1992). The degradation 

of these pesticides by the microbial communities in soils is another relevant 

aspect, contributing to the complexity of effects of molecules on the plant 

surface microbial interaction (Soulas and Lagacherie 2001). A large number 

of resistance genes in Rhizobium species is a strategy to deal with many

114 


antimicrobial factors concentrated around plant roots. Several multidrug 

efflux pumps have been identified, e.g., in Rhizobium etli (González-Pasayo 

and Martinez-Romero 2000). 

Every specific symbiotic interaction has also to take a look to other strategies 

of the symbiotic communication. There is increasing evidence that the 

genetic requirements in the symbiotic interaction, e.g., between different Rhizobium 

species, pathogens and arbuscular mycorrhiza fungi species with 

their respective host plants, partially overlap (Parniske 2000). Different symbiotic 

and pathogenic interactions finally branch to very specific functions 

and nutrient exchanges. Common pathways and different aspects of symbiosis 

and defense developments are fascinating aspects of future research 

(Werner et al. 2002). 

Acknowledgements. I thank the European Union for support in the INCO-DEV Project 

ICA-CT-2001–10057, the JSPS, Japan, and Mrs Lucette Claudet for the excellent work for 

this article. 


Baron M, Aslam H, Flasza M, Fostier M, Higgs JE, Mazaleyrat SL, Wilkin MB (2002) Multiple 

levels of Notch signal regulation. Mol Membr Biol 19:27–38 

Becker A, Pühler A (1998) Specific amino acid substitutions in the proline-rich motif of 

the Rhizobium meliloti ExoP protein result in enhanced production of low-molecular-weight 

succinoglycan at the expense of high-molecular-weight succinoglycan. J 

Bacteriol 180:395–399 

Becker BU, Kosch K, Parniske M, Müller P (1998) Exopolysaccharide (EPS) synthesis in 

Bradyrhizobium japonicum: sequence, operon structure and mutational analysis of 

an exo gene cluster. Mol Gen Genet 259:161–171 

Bogdanove AJ, Beer SV, Bonas U, Boucher CA, Collmer A, Coplin DL, Cornelis GR, Huang 

H-C, Hutcheson SW, Panopoulos NJ et al. (1996) Unified nomenclature for broadly 

conserved hrp genes of phytopathogenic bacteria. Mol Microbiol 20:681–683 

Breedveld MW, Miller KJ (1998) Cell-surface b-glucans. In: Spaink HP, Kondorosi A, 

Hooykaas PJJ (eds) The Rhizobiaceae: molecular biology of model plant-associated 

bacteria. Kluwer, Dordrecht, pp 81–96 

Breinholt V, Larsen JC (1998) Detection of weak estrogenic flavonoids using a recombinant 

yeast strain and a modified MCF7 cell proliferation assay. Chem Res Toxicol 

11:622–629 

Brewin NJ (1998) Tissue and cell invasion by Rhizobium: the structure and development 

of infection threads and symbiosomes. In: Spaink HP, Kondorosi A, Hooykaas PJJ 

(eds) The Rhizobiaceae: molecular biology of model plant-associated bacteria. 

Kluwer, Dordrecht, pp 347–360 

Brimecombe MJ, De Leij FA, Lynch JM (2001) The effect of root exudates on rhizosphere 

microbial populations. In: Pinton R, Varanini Z, Nannipieri P (eds) The rhizosphere. 

Marcel Dekker, New York, pp 95–140 

Cooper JE, Rao JR, Eveaert E, De Cooman L (1995) Metabolism of flavonoids by rhizobia. 

In: Tikhonovich IA, Provorov NA, Romanov VI, Newton WE (eds) Nitrogen fixation: 

fundamentals and applications. Kluwer, Dordrecht, pp 287–292


Cos P, Calomme M, Sindambiwe JB, De Bruyne T, Cimanga K, Pieters L,Vanden Berghe D 

(2001) Cytotoxicity and lipid peroxidation-inhibiting activity of flavonoids. Planta 

Med 67:515–519 

Cullimore JV, Ranjeva R, Bono J-J (2001) Perception of lipo-chitooligosaccharidic Nod 

factors in legumes. Trends Plant Sci 6:24–30 

Demont N, Ardourel M, Maillet F, Promé D, Ferro M et al. (1994) The Rhizobium meliloti 

regulatory nodD3 and syrM genes control the synthesis of a particular class of nodulation 

factors N-acylated by (omega-1)-hydroxylated fatty acids. EMBO J 13:2139– 

2149 

Dixon RA, Steele CL (1999) Flavonoids and isoflavonoids – a gold mine for metabolic 

engineering. Trends Plant Sci 4:394–400 

Downie JA, Parniske M (2002) Fixation with regulation. Nature 420:369–370 

Dunn MF, Encarnación S, Araíza G, Vargas MC, Dávalos A, Peralta H, Mora Y, Mora J 

(1996) Pyruvate carboxylase from Rhizobium etli: Mutant characterization, nucleotide 

sequence, and physiological role. J Bacteriol 178:5960–5970 

Endre G, Kereszt A, Kevei Z, Mihacea S, Kalo P, Kiss GB (2002) A receptor kinase gene 

regulating symbiotic nodule development. Nature 417:962–966 

Entcheva P, Liebl W, Johann A, Hartsch T, Streit WR (2001) Direct cloning from enrichment 

cultures, a reliable strategy for the isolation of complete operons and genes from 

microbial consortia. Appl Environ Microbiol 67:89–99 

Etzler ME, Kalsi G, Ewing NN, Roberts NJ, Day RB, Murphy JB (1999) A Nod factor binding 

lection with apyrase activity from legume roots. Proc Natl Acad Sci USA 

96:5856–5861 

Felle HH, Kondorosi E, Kondorosi A, Schultze M (1996) Rapid alkalinization in alfalfa 

root hairs in response to rhizobial lipochitooligosaccharide signals. Plant J 

10:295–301 

Gao M, D’Haeze W, dee Rycke R,Wolucka B, Holsters M (2001) Knockout of an azorhizobial 

dTDP-L-rhamnose synthase affects lipopolysaccharide and extracellular polysaccharide 

production and disables symbiosis with Sesbania rostrata. Mol Plant 


Giancotti FG, Ruoslahti E (1999) Integrin signaling. Science 285:1028–1033 

Goedhart J, Röhrig H, Hink MA, van Hoek A, Visser AJWG, Bisseling T, Gadella Jr TWJ 

(1999) Nod factors integrate spontaneously in biomembranes and transfer rapidly 

between membranes and to root hairs, but transbilayer flip-flop does not occur. Biochemistry 

38:10898–10907 

González-Pasayo R, Martinez-Romero E (2000) Multiresistance genes of Rhizobium etli 

CFN42. Mol Plant Microbe Interact 13:572–577 

Gressent F, Drouillard S, Mantegazza N, Samain E, Geremia RA, Canut H, Niebel A, 

Driguez H, Ranjeva R, Cullimore J, Bono JJ (1999) Ligand specificity of a high-affinity 

binding site for lipochitooligosaccharidic Nod factors in Medicago cell suspension 

cultures. Proc Natl Acad Sci USA 96:4704–4709 

Harborne JB (ed) (1994) The flavonoids. Chapman and Hall, London, 621 pp 

Hartog M den, Musgrave A, Munnik T (2001) Nod factor-induced phosphatidic acid and 

diacylglycerol pyrophosphate formation: a role for phospholipase C and D in root 

hair deformation. Plant J 25:55–65 

Heilmann J, Merfort I (1998) Aktueller Kenntnisstand zum Metabolismus von Flavonoiden 

II. Resorption und Metabolismus von Flavonen, Flavanonen, Flavanen, Proanthocyanidinen 

und Isoflavonoiden. Pharmazie in unserer Zeit 27:173–183 

Hilpert B, Bohlmann H, op den Camp RO, Przybyla D, Miersch O, Buchala A, Apel K 

(2001) Isolation and characterization of signal transduction mutants of Arabidopsis 

thaliana that constitutively activate the octadecanoid pathway and form necrotic 

microlesions. Plant J 26:435–446

116 


Hofmann K, Heinz EB, Charles TC, Hoppert M, Liebl W, Streit WR (2000) Sinorhizobium 

meliloti strain 1021 bioS and bdhA gene transcription are both affected by biotin 

available in defined medium. FEMS Microbiol Lett 182:41–44 

Hogg B, Davies AE, Wilson KE, Bisseling T, Downie JA (2002) Competitive nodulation 

blocking of cv.Afghanistan pea is related to high levels of nodulation factors made by 

some strains of Rhizobium leguminosarum bv. viciae. Mol Plant Microbe Interact 

15:60–68 

Hollingsworth RI, Carlson RW (1989) 27-hydroxyoctacosanoic acid is a major structural 

fatty acyl component of the lipopolysaccharide of Rhizobium trifolii ANU 843. J Biol 

Chem 264:9300–9303 

Hollman PC, Katan MB (1998) Bioavailability and health effects of dietary flavonols in 

man. Arch Toxicol (Suppl) 20:237–248 

Hueck CJ (1998) Type III in protein secretion systems in bacterial pathogens of animals 

and plants. Microbiol Mol Biol Rev 62:379–433 

Ishimi Y, Miyaura C, Ohmura M, Onoe Y, Sato T, Uchiyama Y, Ito M, Wang X, Suda T, 

Ikegami S (1999) Selective effects of genistein, a soybean isoflavone on b-lymphopoiesis 

and bone loss caused by estrogen deficiency. Endocrinology 140:1893– 

1900 

Jackson MB (2002) Long-distance signalling from roots to shoots assessed: the flooding 

story. J Exp Bot 53:175–181 

Johnsen K, Jacobsen CS, Torswik V, Sorensen J (2001) Pesticide effects on bacterial diversity 

in agricultural soils – a review. Biol Fertil Soils 33:443–453 

Kannenberg EL, Reuhs BL, Forsberg LS, Carlson RW (1998) Lipopolysaccharides and Kantigens. 

Their structures, biosynthesis and functions. In: Spaink HP, Kondorosi A, 

Hooykaas PJJ (eds) The Rhizobiaceae: molecular biology of model plant-associated 

bacteria. Kluwer Acad, Dordrecht, pp 120–154 

Krusell L, Madsen LH, Sato S, Aubert G, Genua A, Szczyglowski K, Duc G, Kaneko T, 

Tabata S, de Bruijn F, Pajuelo E, Sandal N, Stougaard J (2002) Shoot control of root 

development and nodulation is mediated by a receptor-like kinase. Nature 420:422– 

426 

Lake JA, Woodwart FI, Quick WP (2002) Long-distance CO 2 signalling in plants. J Exp 

Biol 53:183–193 

Lerouge P, Roche P, Faucher C et al. (1990) Symbiotic host-specificity of Rhizobium 

meliloti is determined by a sulphated and acylated glucosamine oligosaccharide signal. 

Nature 344:781–784 

Loh J, Lohar DP, Andersen B, Stacey G (2002) A two-component regulator mediates population-density-dependent 

expression of the Bradyrhizobium japonicum nodulation 

genes. J Bacteriol 184:1759–1766 

López-Lara IM, Geiger O (2001) The nodulation protein NodG shows the enzymatic 

activity of an 3-Oxoacyl-acyl carrier protein reductase. Mol Plant-Microbe Interact 

14:349–357 

Marie C, Broughton WJ, Deakin WJ (2001) Rhizobium type III secretion systems: legume 

charmers or alarmers? Curr Opin Plant Biol 4:336–342 

Martinez-Toledo MV, Salmeron V, Gonzalez-Lopez J (1992) Effect of the insecticides 

pyrimifosmethyl and chlorpyrifos on soil microflora in an agricultural loam. Plant 

Soil 147:25–30 

Mavingui P, Flores M, Guo X, Dávila G, Perret X, Broughton WJ, Palacios R (2002) 

Dynamics of genome architecture in Rhizobium sp. strain NGR 234. J Bacteriol 

184:171–176 

Maximo P, Lourenço A, Feio SS, Roseiro JC (2002) Flavonoids from Ulex airensis and 

Ulex europaeus spp. europaeus. J Nat Prod 65:175–178 

Morishita M, Morimoto F, Kitamura K, Koga T, Fukui Y, Maekawa H, Yamashita I, Shimoda 

C (2002) Phosphatidylinositol 3-phosphate 5-kinase is required for the cellular


response to nutritional starvation and mating pheromone signals in Schizosaccharomyces 

pombe. Genes Cells 7:199–215 

Morris VJ, Brownsey GJ, Chilvers GR, Harris JE, Gunning AP, Stevens BJH (1991) Possible 

biological roles for Rhizobium leguminosarum extracellular polysaccharide and 

cyclic glucans in bacteria-plant interactions for nitrogen-fixing bacteria. Food 

Hydrocoll 5:185–188 

Mühlencoert E, Müller P (2002) A novel two-component system of Bradyrhizobium 

japonicum: ElmS and ElmR are encoded in diverse orientations. DNA Sequence 

13:93–102 

Neumann G, Römheld V (2001) The release of root exudates as affected by the plant’s 

physiological status. In: Pinton R, Varanini Z, Nannipieri P (eds) The Rhizosphere. 


Nishimura R, Hayashi M,Wu G-J, Kouchi H, Imaizumi-Anraku H, Murakami Y, Kawasaki 

S, Akao S, Ohmori M, Nagasawa M, Harada K, Kawaguchi M (2002) HAR1 mediates 

systemic regulation of symbiotic organ development. Nature 420:426–429 

Pacios-Bras C, van der Burgt YEM, Deelder AM, Vinuesa P, Werner D, Spaink HP (2002) 

Novel lipochitin oligosaccharide structures produced by Rhizobium etli KIM5s. Carbohydr 

Res 337:1193–1202 

Pai TG, Suiko M, Sakakibara Y, Liu M-C (2001) Sulfation of flavonoids and other phenolic 

dietary compounds by the human cytosolic sulfotransferases. Biochem Biophys 

Res Com 285:1175–1179 

Paiva NL (2000) An introduction to the biosynthesis of chemicals used in plant-microbe 

communication. J Plant Growth Regul 19:131–143 

Parniske M (2000) Intracellular accommodation of microbes by plants: a common developmental 

program for symbiosis and disease? Curr Opin Plant Biol 3:320–328 

Parniske M, Schmidt PE, Kosch K, Müller P (1994) Plant defense responses of host plants 

with determinate nodules induced by EPS-defective exoB mutants of Bradyrhizobium 

japonicum. Mol Plant Microbe Interact 7:631–638 

Phillips DA, Joseph CM,Yang GP, Martínez-Romero E, Sanborn JR,Volpin H (1999) Identification 

of lumichrome as a Sinorhizobium enhancer of alfalfa root respiration and 

shoot growth. Proc Natl Acad Sci USA 96:12275–12280 

Pingret JL, Journet EP, Barker DG (1998) Rhizobium Nod factor signalling: evidence for 

a G protein-mediated transduction mechanism. Plant Cell 10:659–672 

Polavieja GG de (2002) Errors drive the evolution of biological signalling to costly codes. 

J Theor Biol 214:657–664 

Pueppke SG, Broughton WJ (1999) Rhizobium sp. Strain NGR234 and R. fredii USDA257 

share exceptionally broad, nested host ranges. Mol Plant Microbe Interact 12:293–318 

Ramos MLG, Ribeiro WOJ (1993) Effect of fungicides on survival of Rhizobium on seeds 

and the nodulation of bean (Phaseolus vulgaris L.) Plant Soil 152:145–150 

Rice-Evans CA, Miller NJ (1996) Antioxidant activities of flavonoids as bioactive components 

of food. Biochem Soc Trans 24:790–794 

Röhrig H, Schmidt J, Walden R, Czaja I, Lubenow H, Wieneke U, Schell J, John M (1996) 

Convergent pathways for lipochitooligosaccharide and auxin signaling in tobacco 

cells. Proc Natl Acad Sci USA 93:13389–13392 

Rolin DB, Pfeffer PE, Osman SF, Szwergold BS, Kappler F, Benesi AJ (1992) Structural 

studies of a phosphocholine substituted b-(1,3); (1,6) macrocyclic glucan from 

Bradyrhizobium japonicum USDA 110. Biochim Biophys Acta 1116:215–225 

Schlaman HRM, Gisel AA, Quaedvlieg NEM, Bloemberg GV, Lugtenberg BJJ et al. (1997) 

Chitin oligosaccharides can induce cortical cell division in roots of Vicia sativa when 

delivered by ballistic microtargeting. Development 124:4887–4893 

Schoonejans E, Expert D, Toussaint A (1987) Characterization and virulence properties 

of Erwinia chrysanthemi lipopolysaccharide-defective. øEC2-resistant mutants. J 

Bacteriol 169:4011–4017

118 


Schröder O, Wagner R (2002) The bacterial regulatory protein H-NS – a versatile modulator 

of nucleic acid structures. Biol Chem 383:945–960 

Schuster S, Marhl M, Höfer T (2002) Modelling of simple and complex calcium oscillations. 

From single-cell responses to intercellular signalling. Eur J Biochem 269:1333– 

355 

Schwartz MA, Ginsberg MH (2002) Networks and crosstalk: integrin signalling spreads. 

Nature Cell Biol 4:E65-E68 

Searle IR, Men AT, Laniya TS, Buzas DM, Searle IR, Men AE, Laniya TS, Buzas DM, Iturbe- 

Ormaetxe I, Carroll BJ, Gresshoff PM (2003) Long-distance signaling in nodulation 

directed by a CLAVATA1-like receptor kinase. Science 3299:109–112 

Soulas G, Lagacherie B (2001) Modelling of microbial degradation of pesticides in soils. 

Biol Fertil Soils 33:551–557 

Spaink HP (2000) Root nodulation and infection factors produced by rhizobial bacteria. 

Ann Rev Microbiol. 54:257–288 

Spaink HP, Sheeley DM, van Brussel AAN et al. (1991) A novel highly unsaturated fatty 

acid moiety of lipooligosaccharide signals determines host specificity of Rhizobium. 

Nature 354:125–130 

Stacey G, Shibuya N (1997) Chitin recognition in rice and legumes. Plant Soil 

194:161–169 

Staehelin C, Schultze M, Tokuyasu K, Poinsot V, Promé J-C, Kondorosi E, Kondorosi A 

(2000) N-deacetylation of Sinorhizobium meliloti Nod factors increases their stability 

in the Medicago sativa rhizosphere and decreases their biological activity. Mol Plant 


Staswick PE, Yuen GY, Lehman CC (1998) Jasmonate signaling mutants of Arabidopsis 

are susceptible to the soil fungus Pythium irregulare. Plant J 15:747–754 

Stracke S, Kistner C,Yoshida S, Mulder L, Sato S, Kaneko T, Tabata S, Sandal N, Stougaard 

J, Szczyglowski K, Parniske M (2002) A plant receptor-like kinase required for both 

bacterial and fungal symbiosis. Nature 417:959–962 

Streit WR, Joseph CM, Phillips DA (1996) Biotin and other water-soluble vitamins are 

key growth factors for alfalfa rhizosphere colonization by Rhizobium meliloti 1021. 

Molec Plant-Microbe Interact 9:330–338 

Strzelczyk E, Rozycki H (1985) Production of B-group vitamins by bacteria isolated from 

soil, rhizosphere, and mycorrhizosphere of pine (Pinus sylvestris L.). Zbl Mikrobiol 

140:293–301 

Thomas C, Sun Y, Naus K, Lloyd A, Roux S (1999) Apyrase functions in plant phosphate 

nutrition and mobilizes phosphate from extracellular ATP. Plant Physiol 119:543–551 

Thomma B, Eggermont K, Penninckx IAMA, Mauch-Mani B,Vogelsang R, Cammue BPA, 

Broekaert WF (1998) Separate jasmonate-dependent and salicylate-dependent 

defense-response pathways in Arabidopsis are essential for resistance to distinct 

microbial pathogens. Proc Natl Acad Sci USA 95:15107–15111 

Uren NC (2001) Types, amounts, and possible functions of compounds released into the 

rhizosphere by soil-grown plants. In: Pinton R,Varanini Z, Nannipieri P (eds) The rhizosphere. 


Van Workum WAT, Kijne JW (1998) Biosynthesis of rhizobial exopolysaccharides and 

their role in the root nodule symbiosis of leguminous plants. In: Romeo JT, Downum 

KR, Verpoorte R (eds.) Phytochemical signals and plant-microbe interactions. 

Plenum, New York, pp 139–166 

Vinuesa P, Reuhs BL, Breton C, Werner D (1999) Identification of a plasmid-borne locus 

in Rhizobium. etli KIM5s involved in lipopolysaccharide O-chain synthesis and 

nodulation of Phaseolus vulgaris. J Bacteriol 181:5606–5614 

Wang GJ, Lapcik O, Hampl R, Uehara M, Al-Maharik N, Stumpf K, Mikola H, Wähälä K, 

Adlercreutz H (2000) Time-resolved fluoroimmunoassay of plasma daidzein and 

genistein. Steroids 65:339–348


Weber H (2002) Fatty acid-derived signals in plants. Trends Plant Sci 7:217–224 

Werner D (1992) Symbiosis of plants and microbes. Chapman and Hall, London, 389 pp 

Werner D (2001) Organic signals between plants and microorganisms. In: Pinton R, 

Varanini Z, Nannipieri P (eds) The rhizosphere. Marcel Dekker, New York, pp 197–222 

Werner D, Müller P (2003) Communication and efficiency in the symbiotic signal 

exchange. In: Heldmaier G, Werner D (eds) Environmental signal processing and 

adaptation. Springer, Berlin Heidelberg New York, pp 9–38 

Werner D, Barea JM, Brewin NJ, Cooper JE, Katinakis P, Lindström K, O’Gara F, Spaink 

HP, Truchet G, Müller P (2002) Symbiosis and defence in the interaction of plants with 

microorganisms. Symbiosis 32:83–104 

Wilkinson S, Davies WJ (2002) ABA-based chemical signalling: the co-ordination of 

responses to stress in plants. Plant Cell Environ 25:195–210

7 The Functional Groups of Micro-organisms Used 

as Bio-indicator on Soil Disturbance Caused by 

Biotech Products such as Bacillus thuringiensis and 

Bt Transgenic Plants 



Insects are usually controlled with insecticides. Of the insecticides 5 % are 

biological, and more than 90 % of biological insecticides are based on Bacillus 

thuringiensis (Bt; Sanchis 2000). The use of bio-insecticides has increased 

because of the growing need to obtain better quality food and to protect the 

environment, but very little is known about the impact these organisms have 

on the environment and mainly on the soil functional microorganism 

groups. 

Due to the efficiency of bio-insecticides based on B. thuringiensis,the gene 

which produces the bio-insecticide crystal was introduced into plants to produce 

Bt-transgenic plants. Transformed tobacco using the Ti plasmodium 

from Agrobacterium tumefasciens was obtained in the 1980s. Later, the electroporation 

and bombardment or bio-ballistic of embryos method, which is 

more efficient for transformation of a greater number of plant species with 

the cry B. thuringiensis gene, was used (Peferoen 1997). The second generation 

of Bt-transgenic plants is presently obtained with the introduction of at 

least two cry genes in the plant genome, and there are already more than 20 

species of transgenic plants of economic importance being used in a few 

countries (Sanchis 2000). 

Although transgenic plants have been produced and sown for two decades, 

there is little information about their environmental impact. Currently proposed 

plant gene products will probably have less impact on soil ecosystems 

than some familiar and accepted practices. However, some transgenic plant 

products may have measurable adverse effects on soil organisms that will 

have to be monitored for some years after widespread introduction (Tomlin 

1994). 




122 


Some studies have assessed B. thuringiensis spore and vegetative cell survival 

in the soil. The soil permanence of the protein crystal released by Bttransgenic 

maize root exudates has also been assessed (Saxena et al. 1999). 

The analysis of the soil stability of B. thuringiensis indicated that the bacterium 

was not active, and that the number of cells inoculated either in the 

vegetative or in the spore form decreased rapidly a few hours after inoculation. 

However, the soil can be considered its natural deposit, as the spores are 

released into the soil after the death of an insect and persist in this form for 

several years until they find another host insect. The B. thuringiensis toxin 

produced by Bt-maize is transferred to the soil by root exudates, pollen and 

other plant parts. Tapp et al. (1995a) reported that the B. thuringiensis crystal 

is adsorbed by the clay minerals in the soil, and thus may be protected from 

biodegradation action of hydrolytic enzymes such as proteases, and may 

remain active in the soil for several months. 

Pesticides have protocols to evaluate non-target effects where many organisms 

are used as biological indicators. Similar test protocols could be 

extended to plant bio-insecticide manufacturers. The soil biological process is 

poorly understood, and care should be taken to prevent further negative 

impacts on soil ecosystems from genetically modified organisms. Although 

these might be non-target events, all effects of Bt-plants on the soil environment 

must be well understood. 

2 General Aspects of Bacillus thuringiensis 

The B. thuringiensis bacterium is a Gram positive rod, aerobic, chemoheterotrophic, 

with perithiquious flagella that sporulates when the environmental 

conditions are not favourable. The bio-insecticide protein is formed 

when the sporulation event is activated and cells should be isolated from soil 

or infected insects. 

Meadows (1993) suggested three hypotheses for the natural habitat of B. 

thuringiensis based on isolation studies. The bacterium could be an insect 

pathogen, a component of the normal flora of the phylosphere tree species, or 

a soil microorganism. 

According to the first hypothesis, the release of the crystal would be a strategy 

to kill the insect larvae, which would permit spore germination and vegetative 

cell multiplication. 

The second hypothesis was suggested by a study where great quantities of 

B. thuringiensis were found in tree species, and could be disseminated by the 

wind or rain, and the soil would only be a deposit where B. thuringiensis did 

not multiply (Smith and Couche 1991). 

These studies have shown that B. thuringiensis is widely distributed in soils 

throughout the world. Wide distribution even in localities which cannot be 

correlated with the presence of insects reinforces the hypothesis that the bac-

7 The Functional Groups of Micro-organisms and Biotech Products 123 

terium uses the soil as a natural habitat (Martin and Travers 1989). Soil survival 

studies showed that the number of inoculated vegetative cells decreases 

rapidly and only viable spores are found after 5 days. Vegetative cell multiplication 

was not observed (Villas-Bôas et al. 2000). 

Lereclus et al. (2000) suggested that during the sporulation phase the cry 

regulation gene has the function of producing high quantities of Cry protein 

to kill the insect, allowing the bacterium to complete its biological cycle, 

(spore germination – multiplication – sporulation – dispersion). Virulence 

factors, acting in unfavourable environmental conditions, enable the bacterium 

to damage and invade host tissues, obtaining ideal conditions for 

spore germination and cell multiplication. 

3 Survival in the Soil 

Knowledge of B. thuringiensis survival in the soil is important in the context 

of its use for biological control. It is also relevant in the study of the interactions 

with other soil microorganisms. The commercial B. thuringiensis formulas 

are composed of mixtures of spores and crystals, which are released in 

great quantities into the environment each year. The behaviour of these 

spores and crystals in the soil has been studied in the field, greenhouse and in 

sterilised and natural soils (Thomas et al. 2000; Villas Bôas et al. 2000). In 

these assessments, the spores were inoculated into the soil and their recovery 

was monitored. 

Some reports demonstrated that, initially, the number of colony spore 

forming units of B. thuringiensis declines rapidly. Vilas-Boas et al. (2000) 

observed that after 24 h only 20 % of the spores survived in sterilised 

soils. 

Addison (1993) observed that several factors could affect the survival of the 

spores, such as pH, moisture and nutrient availability. Spore viability seemed 

to be little influenced by soil type or temperature. The results on nutrient 

availability are controversial. Cell remains could be an extra source of nutrients 

for the native microbiota and inoculated bacteria, but B. thuringiensis is 

unable to use nutrients released by the lysis of inoculated dead cells (West et 

al. 1985). 

Competition with soil microbiota is one of the factors that most affects 

spore viability in the soil. In the soil microcosm, B. thuringiensis spores have 

a greater mortality index because of competition from other microorganisms 

(Pruett et al. 1980). 

The initial decline in the number of colony forming units after a 24-h permanence 

in the soil is about 80 %. The surviving cells rapidly produce spores, 

increasing the number of viable spores until the number of vegetative cells is 

matched. This means that at a given moment, the number of spores will equal 

that of the vegetative cells, and will remain stable for several months.

124 


Nutrient limitation is one of the main characteristics of soils (Edwards 

1993). Microorganisms develop strategies in this oligotrophic environment to 

capture nutrients and survive the environmental stress. Spore formation is 

one of the strategies of bacterium survival when the environmental conditions 

are unfavourable for growth. The spore can endure stress conditions for 

long periods of time. 

When inoculated into the soil, the spore number falls, after this initial fall, 

the number of cells stabilised due to vegetative cell sporulation. Petras and 

Casida (1985) observed an exceptional fall in the spore number during the 

first 2 weeks, but the number of viable spores stabilised in the third week. 

However, West et al. (1985) reported that spores of the B. thuringiensis var 

aizawai HD137 presented low mortality when inoculated into sterilised soil 

and persisted with little decrease in the initial number for 135 days. 

4 History of Bacillus thuringiensis-Transgenic Plants 

At the end of the 1980s, tobacco plants were the first to receive the B. 

thuringiensis cry gene using the Agrobacterium transformation system. The 

Agrobacterium tumefasciens system was used in the transformation of several 

dicotyledon plants. However, the electroporation and particle bombardment 

methods are more efficient for the transformation of monocotyledon and 

other dicotyledon plants (Peferoen 1997). 

The first transgenic plants obtained showed low expression of the complete 

gene for Cry protein production. From then onwards, only truncated genes 

were introduced which codify the toxic nucleus of the Cry protein, thereby 

increasing the expression in several plants such as tobacco (Mazier et al. 

1997), sugar cane (Arencibia et al. 1997) and peanuts (Singsit et al. 1997). Bttransgenic 

potato, cotton and maize cultivation (Schnepf et al. 1998) began in 

1996 and, today, there are more than 20 transgenic plant species of agronomic 

interest on the market. 

Promoters, such as CaMV 35 s of the cauliflower mosaic virus and ubiquitinine-1 

from maize are being used to increase the expression of the cry gene to 

the required levels. In addition to this strategy, greater cry gene expression levels 

were obtained by altering the sequence of the gene to increase the cytosine 

and guanine content and enhance the expression level from 0.02 to 0.5 % of the 

plant soluble protein.However,the most pronounced expression level of the cry 

gene in plants (3–5 % soluble protein) was obtained with the introduction of the 

unmodified gene in chloroplasts, a cell organelle which has the transcription 

and translation apparatus similar to that of prokaryotes (McBride et al.1995). 

New generations of transgenic plants have been developed to express other 

types of cry genes or genes expressing proteins that could have insecticide 

action, such as protease inhibitors, lectin, kinases, cholesterol, oxidases, 

inhibitors of the a-amylase and Vip proteins (Sanchis 2000).


5 Persistence of the Protein Crystal in the Soil 

The release of the use of transgenic plants with cry genes for agricultural pest 

control in the 1990s has raised a lot of controversy and concern in the scientific 

community. It is common sense that four factors must be very carefully 

assessed: (1) the potential of selection for insects resistant to the Cry proteins, 

(2) the persistence of the crystal released by the root exudates and lysis in the 

soil, (3) the non-selectivity towards other non-pathogenic insects, (4) the 

impact of the bio-insecticide crystal protein on the functional groups of soil 

microorganisms. 

Several studies on the persistence of the B. thuringiensis toxin released by 

transgenic plants into the soil have shown that the toxin degradation is relatively 

quick during the first 45 days, and less than 25 % of the initial bio-activity 

is maintained after 120 days (Palm et al. 1994, 1996; Sims and Holden 1996; 

Sims and Ream 1997). On the other hand, Tapp et al. (1995a) showed that part 

of the insecticide activity of B. thuringiensis may be maintained because of 

the rapid adsorption and binding of the toxin in the soil clay minerals. Other 

authors reported that a substantial proportion of the Cry1Ab toxin released in 

the Bt-maize roots exudates could be detected and maintained their bioinsecticide 

activity for 234 days after release into the soil. This indicates that 

the protein crystal is very stable in the soil and is protected from microbial 

action due to adsorption by the soil clay (Saxena et al. 1999). Experimental 

results on adsorption of the protein to soil particles (Saxena and Stotzky 

2000) indicated that the cry1Ab gene coded toxin released by Bt-maize root 

exudates in sandy soil supplemented with montmorillonite and caullinite 

bound preferentially to clay minerals. This confirmed that adsorption to clay 

minerals is one of the main factors in the permanence and activity maintenance 

of the bio-insecticide crystals in the soil. 

Crystals were detected by the ELISA method (enzyme-linked immunosorbent 

assay). The permanence of the toxin was also determined in other soil 

types, with predominance of those with low organic matter content. Palm et 

al. (1994, 1996) observed a fall in the purified toxin concentration in the soil in 

the first 14 days after inoculation, with stabilisation after this period. In the 

case of transgenic plant-produced toxin, the fall in the soil concentration 

occurred for about 10 days and then remained stable. However, toxin production 

was continuous throughout the plant lifecycle with a consequent accumulation 

of bio-insecticide crystals in the soil. The lowest rate of recuperation 

after extraction was obtained in soil with a high quantity of organic matter, 

indicating that much of this protein may also be adsorbed by the soil organic 

matter. 

Saxena and Stotzky (2000) observed that the B. thuringiensis toxin 

expressed in Bt-transgenic maize was released into the rhizosphere through 

exudates and lysates and that much of the released crystal remained active 

for several months. Although Bt-transgenic plants produce and accumulate

126 


significant quantities of bio-insecticide crystals in pollen, leaves and roots, 

their effect on the functional groups of soil microorganisms is little understood. 

The influence of the mineralogical composition of the soil on the stability 

of the bio-insecticide crystals has been reported by several authors. Tapp et al. 

(1995a) showed that the toxin is rapidly adsorbed or linked to clay minerals in 

the soil, remaining protected from degradation by soil microorganisms. In 

another study, Tapp et al. (1995b) showed that the toxin adsorbed by clay minerals 

becomes resistant to hydrolytic action of the enzymes produced by the 

soil microbiota. It has also been shown that soils with high levels of organic 

matter have a high protein crystal adsorption capacity (Palm et al. 1994). Sims 

et al. (1996) observed that B. thuringiensis var kurstaki Cry1Ab toxin present 

in Bt-transgenic maize tissues incorporated in the soil can be detected by 

bioassays with insects susceptible to the bio-insecticide action of the crystal. 

According to the results obtained by these authors, the bioassay allows the 

detection of smaller quantities of the protein (around 0.5 ng/ml in the diet) 

compared to the ELISA test (50.0 ng/g of soil). Sims et al. (1997), working with 

bioassays on B. thuringiensis var kurstaki transgenic cotton toxin inactivation 

in soils, observed that the toxin mean life in the soil ranges from 15 to 32 days, 

and less than 25 % of the initial activity remains after 120 days. 

6 Effect of Bacillus thuringiensis and Its Bio-insecticide 

Protein on Functional Soil Microorganism Assemblage 

Plant roots and their surfaces constitute dynamic habitats densely colonised 

by soil-borne microbiota. The high microbial activity in these habitats is due 

to a flow of organic substances from the photosynthetic parts of the plants to 

the roots (Olsson and Person 1999). This flow consists of low molecular 

weight organic substances (e.g. sugars, fatty acids and amino acids), as well as 

more complex substances (e.g. starch, cellulose and proteins). The chemical 

composition of this organic matter (the rhizodeposition) varies among plant 

species and growth stages, and is affected by plant growth conditions (Curl 

and Truelove 1986). The functional groups of microorganisms of nitrogen, 

phosphorus and carbon cycling are important to the maintenance of nutrient 

turnover. These microorganisms interact with the plant roots, supply nutrients 

and participate actively in plant nutrition and growth (Andrade 1999). 

Mycorrhizal fungi are ubiquitous soil inhabitants and form a symbiotic 

relationship with the roots of most terrestrial plants. When arbuscular mycorrhizae 

(AM) form, there are significant changes in the plant and root physiology. 

Photosynthetic rates increase and the nutritional status of the host tissues 

changes and thus, the quality and quantity of root exudates (Linderman 

1992). Altered exudation induces changes in the composition of microbial 

communities in the rhizosphere soil (Andrade et al. 1997) that may influence


formation and behaviour of rhizobia nodules. Such changes could influence 

the competition between rhizobia and other rhizobacteria. If bacteria selectively 

favoured in the rhizoplane enhanced rhizobia competitiveness, then 

nodulation would be favoured (Linderman 1992). 

In general, soil productivity and nutrient cycling are influenced by soil 

microbial populations. The relationships among functional groups of 

microorganisms of C, N and P cycling, and their influence on the plant 

growth, are potential indicators to evaluate disturbance in the soil environment. 

A corresponding rise in the input of Bt and its toxins into soil systems can 

be expected with the increased use of B. thuringiensis-based insecticides, 

whether by direct spraying, in insect cadavers, or in transgenic plant material 

or microorganisms (Addison 1993). Very little attention has been paid to the 

effects that B. thuringiensis might have on the indigenous soil assemblages, 

and the information that is available is often confusing. Petras and Casida 

(1985) reported that endogenous soil bacteria, actinomycetes, fungi and 

nematodes increased moderately compared with the control when using a 

spore and crystal suspension of B. thurigiensis subsp. kurstaki isolated from 

Dipelr, a commercial preparation. Pruett et al. (1980) inoculated B. thuringiensis 

subsp. galleriae into clay soil and reported that bacterial populations 

increased 2 weeks after inoculation and were still increasing at the end of the 

135-day experiment. 

In contrast to the above studies, Atlavinyté et al. (1982) reported a decrease 

in indigenous soil microbiota when B. thuringiensis subsp. galleriae was inoculated 

into the soil. Bacterial numbers had decreased 50 % and actinomycetes 

by 90 % after 45 days, and in contrast, fungal populations had increased by 

300–500 % compared with the control. 

The influence of B. thuringiensis subsp. kurstaki and its protein on functional 

groups of soil assemblages was assessed for the first time in our laboratory, 

and we discuss our findings as follows. 

In non-sterile soil B. thuringiensis vegetative cells seemed to be unable to 

compete with the indigenous microorganisms in non-sterile soil. Under these 

conditions, the number of cells decreased drastically, sporulation occurred 

quickly and the number of spores was stable, approximately four log unit for 

at least 45 days. The cell number decrease was greater in non-sterile soil than 

in sterile soil conditions (Villas Bôas et al. 2000). The same results were found 

by Thomas et al. (2000). Their results suggested that, although the soils used 

were of different types and composition, B. thuringiensis apparently did not 

show biological activity after spores had been released into the environment 

and could persist for several years (Pruett et al. 1980; Pedersen et al. 1995). 

However, some species of Bacillus genera such as B. megaterium, B. subtilis, B 

cereus suppressed pathogen fungi and/or bacteria and saprophyte fungi populations 

in microcosm soil (Reddy and Rhae 1989; Halverson et al. 1993; 

Young et al. 1995; Kim et al. 1997). In many cases, the results showed a great

128 


decrease in the viable vegetative or spore form Bacillus units in the soil. Reddy 

and Rhae (1989) reported that a strain of B. subtilis introduced into an onion 

rhizosphere at a concentration of 7.2¥10 5 seed –1 could be recovered at only 

7¥10 3 plant –1 after 30 days, despite the decrease in numbers, the B. subtilis was 

effective in suppressing indigenous soil microbiota in the rhizosphere. Young 

et al. (1995) also observed that B. cereus survival was not influenced by developing 

wheat roots and the absence of a rhizosphere effect may be due to the 

fact that B. cereus was isolated originally from non-rhizosphere soil. The 

Bacillus spp. are often reported to be present in low numbers in the rhizosphere 

compared with other bacteria, such as fluorescent pseudomonas (Elliot 

Juhnke et al. 1987). 

Populations of C, P-cycling microorganisms and formed nodules changed 

during the plant growth period and were influenced by B. thuringiensis inoculation 

in soybean plants. No differences were found on assemblages of bacteria 

and fungi in soil inoculated with B. thuringiensis, but time influenced the 

populations. The time corresponded to plant growth, AM root colonisation 

and nodule formation. Some physiological changes during plant growth, 

including C compounds released to the medium, influenced bacteria growth 

(Amora-Lazcano and Azcón 1997). AM colonisation and Bradyrhizobium 

japonicum nodulation normally decreased the amount of plant root-derived 

and organic matter available for heterotrophic bacteria and other soil 

microorganism growth by altering the root cell permeability, thus affecting 

exudation (Schwab et al. 1983). The carbon cycling microbiota populations 

also decreased their number of cells, possibly because of changes in C concentration 

in the rhizosphere. Negative correlation between symbiotic and 

cellulolytic, amylolytic and proteolytic microorganisms shows that carbon 

compounds from the root are important factors for their proliferation. Deleterious 

effects of AM roots on soil bacteria have also been observed, suggesting 

C competition (Marschner and Crowley 1996), although AM fungi and 

rhizobia do not consume C from the rhizosphere due to their symbiotic condition 

(Secilia and Bagyaraj 1987; Paulitz and Linderman 1989). Cellulolytic 

and amylolytic microorganisms decreased their cell number during the 

experiment, whereas proteolytic microorganisms increased their population 

the first time. This result suggested that this group had an extra supply of 

nutrients from inoculated crystal protein. The faster decrease in the proteolytic 

cell number after day 15 could be explained by the small amount of ICP 

free in the soil. Saxena et al. (1999) suggested that ICP binds rapidly and 

tightly to clays and humic acids and is protected against microbial degradation 

by being bound to soil particles. AM infection and nodule number 

increased in the time following the plant growth. The saprophyte fungi population 

decreased when the soil was inoculated with Cry- strain, and the same 

effect was observed in AM infection. In another experiment carried out under 

axenic conditions in Petri dishes, Cry– and Cry+ strains showed an inhibitory 

effect against the growth of some saprophytes fungi. This fungistasis effect


might be explained by degrading enzymes produced (Cody 1989) or another 

compound that would attack the fungus cell wall or inhibit the fungal growth. 

Probably, these enzymes and other metabolites are produced at a vegetative 

phase when B. thuringiensis multiplies, nevertheless, this does not happen in 

the soil (Thomas et al. 2000; Vilas Bôas et al. 2000). However, much of the cell 

contents were released during the cell/spores lysis after inoculation and could 

have a suppressor effect on soil microbiota. 

The B. thuringiensis effect on plant growth was observed only in plants 

inoculated with Cry+ strain and ICP.Although the Cry+ strain inhibited mycorrhizal 

colonisation, plant growth was not affected, possibly because soil fertility 

status and nitrogen fixation were not affected by B. thuringiensis inoculum. 

The same results were found by Reddy and Rhae (1989) with B. subtilis 

and other rhizobacteria. 

AM fungi were suppressed by B. thuringiensis inoculum due to the use of 

spores as inoculum, but due to the fact that B. thuringiensis is found in low 

numbers in the rhizosphere, it is difficult to explain the inhibitory effect 

mechanism. Other authors (Andrade et al. 1995; Bethlenfalvay et al. 1997) 

found the same inhibitory effect by Bacillus spp. on mycorrhizae fungi 

colonising pea plants. Some strains of Bacillus spp. can probably suppress the 

release of AM fungi and other soil microorganism cellular contents, but this 

subject needs more investigation to conclude the mechanisms involved. 

The present data provide evidence that B. thuringiensis inoculum does not 

produce an effect on plant growth when soil fertility is involved. However, B. 

thuringiensis var. Kurstaki HD1 demonstrated inhibitory effects on some 

functional groups of microorganisms that could be involved in deleterious 

effects in the field when the nutritional condition is oligotrophic. However, 

the cumulative effect of protein crystal was not evaluated. It should also be 

emphasised that the accumulative effect of the protein crystal due to successive 

cultivation of Bt-transgenic plants has not yet been assessed, but some 

authors have suggested that there may be a deleterious effect on the microbiota 

(Saxena et al. 1999) and macrofauna (Donegan et al. 1997). 

The groups of soil functional microorganisms may be either positively or 

negatively affected by B. thuringiensis products, whether produced by bacteria 

or transgenic plants. Up to now, the results obtained by microbial ecologists 

are still preliminary, and it is clear that exhaustive studies should be carried 

out before releasing these plants into the environment. The dynamic of 

the functional groups of microorganisms in the presence of these plants must 

be understood. In addition, the accumulative effect of the crystal on these 

microorganism groups should be assessed together with their subsequent 

effects on the bio-geochemical cycles. Confidence that Bt-plants will not damage 

the environment when released for intense cultivation will be obtained 

after the positive or negative effects they may have on the environment are 

established.

130 



Addison JA (1993) Persistence and nontarget effects of Bacillus thuringiensis in soil: a 

review. Can J For Res 23:2329–2342 

Amora-Lazcano E, Azcón R (1997) Response of sulphur cycling microorganisms to 

arbuscular mycorrhizal fungi in the rhizosphere of maize. Appl Soil Ecol 6:217–222 

Andrade G (1999) Interacciones microbianas en la rizosfera. In: Siqueira JO, Moreira 

FMS, Lopes AS, Guilherme LR, Faquin V, Furtinni AE, Carvalho JG (eds) Soil fertility, 

soil biology and plant nutrition interrelationships. Brazilian Soil Science Society/ 

Federal University of Lavras/Soil Science Department (SBCS/UFLA/DCS), Lavras, 

Brazil, pp 551–575 

Andrade G, Azcón R, Bethlenfalvay GJ (1995) Mycorrhizae in sustainable agriculture 1. 

An agrosystem affecting rhizobacterium modifies plant soil responses to a mycorrhizal 

fungus. Appl Soil Ecol 2:195–202 



192;71–79 

Arencibia A,Vázquez RI, Prieto D, Téllez P, Carmona ER, Coego A, Hernández L, Selman- 

Housein G, De La Riva GA (1997) Transgenic sugarcane plants resistant to stem borer 

attack. Mol Breed 3:247–255 

Bethlenfalvay GJ, Andrade G, Azcón-Aguilar C (1997) Mycorrhizae in sustainable agriculture. 

2. Plant and soil microorganisms in nodulated and nitrate fertilized peas. Biol 

Fertil Soils 24:164–168 

Cody RM (1989) Distribution of chitinase and chitibiose in Bacillus. Curr Microbiol 

19:201–205 

Curl EA, Truelove B (1986) The rhizosphere.Advances series in agricultural sciences, vol 

15, Springer, Berlin Heidelberg New York, pp 288 

Donegan KK, Seidler RJ, Fieland VJ, Schaller DL, Palm CJ, Ganio LM, Cardwell DM, Steinbergers 

Y (1997) Decomposition of genetically engineered tobacco under field conditions: 

persistence of the proteinase inhibitor I product and effects on soil microbial 

respiration and protozoa, nematode and microarthropod populations. J Appl Ecol 

34:767–777 

Elliot Juhnke M, Mathre DE, Sands DC (1987) Identification and characterization of rhizosphere-competent 

bacteria of wheat. Appl Environ Microbiol 53:2793–2799 

Halverson LJ, Clayton MK, Handelsman J (1993) Population biology of Bacillus cereus 

UW85 in the rhizosphere of field-grown soybeans. Soil Biol Biochem 25:485–493 

Kim DS, Cook RJ, Weller DM (1997) Bacillus sp. L324–92 for biological control of three 

root diseases of wheat grown with reduced tillage. Phytopathology 87:551–558 

Lereclus D, Agaisse H, Grandvalet C, Salamitou S, Gominet M (2000) Regulation of toxin 

and virulence gene transcription in Bacillus thuringiensis. Int J Med Microbiol 

290:295–299 

Linderman RG (1992) Vesicular-arbuscular mycorrhizae and soil microbial interactions. 

In: Bethlenfalvay GJ, Linderman RG (eds) Mycorrhizae in sustainable agriculture. 

ASA Special Publication, Madison, WI, pp 45–70 

Marschner P, Crowley DE (1996) Physiological activity of a bioluminescent Pseudomas 

fluorescens (strain 2–79) in the rhizosphere of mycorrhizal and non-mycorrhizal pepper 

(Capsicum annum L.). Soil Biol Biochem 18:191–196 

Martin PAW, Travers RS (1989) Worldwide abundance and distribution of Bacillus 

thuringiensis isolates. Appl Environ Microbiol 55:2437–2442 

Mazier M, Chaufaux J, Sanchis V, Lereclus D, Giband M, Tourneur J (1997) The cryIC gene 

from Bacillus thuringiensis provides protection against Spodoptera littoralis in young 

transgenic plants. Plant Sci 127:179–190


McBride KE, Svab Z, Schaaf D J (1995) Amplification of a chimeric gene in chloroplasts 

leads to an extraordinary level of an insecticidal protein in tobacco. Bio/technology. 

13:362–365 

Meadows MP (1993) Bacillus thuringiensis in the environment: ecology and risk assessment 

(1993) In: Entwistle PF, Cory JS, Bailey MJ, Higgs S (eds) Bacillus thuringiensis 

an environmental biopesticide: theory and practice. Wiley, Chichester, pp193–220 

Olsson S, Person P (1999) The composition of bacterial population in soil fractions differing 

in their degree of adherence to barley roots. Appl Soil Ecol 12:205–215 

Palm CJ, Donegan K, Harris D, Seidler RJ (1994) Quantification in soil of Bacillus 

thuringiensis var kurstaki d-endotoxin from transgenic plants. Mol Ecol 3:145–151 

Palm CJ, Schaller DL, Donegan KK, Seidler RJ (1996) Persistence in soil of transgenic 

plant produced Bacillus thuringiensis var kurstaki d-endotoxin. Can J Microbiol 

42:1258–1262 

Paulitz TC, Linderman RG (1989) Interactions between fluorescent pseudomonads and 

VA mycorrhizal fungi. New Phytol 113:37–45 

Pedersen JC, Damgaard PH, Eilenberg J, Hansen BM (1995) Dispersal of Bacillus 

thuringiensis var. kurstaki in an experimental cabbage field. Can J Microbiol 41:118– 

125 

Peferoen M (1997) Progress and prospects for field use of Bt genes in crops. Trends 


Petras SF, Casida Jr LE (1985) Survival of Bacillus thuringiensis spores in soil. Appl Environ 

Microbiol 50:1496–1501 

Pruett CJH, Burges HD, Wyborn CH (1980) Effect of exposure to soil on potency and 

spore viability of Bacillus thuringiensis. J Invert Pathol 35:168–174 

Reddy MS, Rhae JE (1989) Bacillus subtilis B-2 and selected onion rhizobacteria in onion 

seedling rhizospheres: effects on seedling growth and indigenous rhizosphere 

microflora. Soil Biol Biochem 21:379–383 

Sanchis V (2000) Biotechnological improvement of Bacillus thuringiensis for agricultural 

control of insect pests: benefits and ecological implications. In: Charles JF, 

Delecluse A, Nielsen-Leroux C (eds) Entomophatogenic bacteria: from laboratory to 

field application. Kluwer Academic, Berlin 

Saxena D, Stotzky G (2000) Insecticidal toxin from Bacillus thuringiensis is released from 

roots of transgenic Bt corn in vitro and in situ. FEMS Microbiol Ecol 33:35–39 

Saxena D, Flores S, Stotzky G (1999) Transgenic plants; insecticidal toxin in root exudates 

from Bt corn. Nature 402:480 

Schnepf E, Crickmore N, Van Rie J, Lereclus D, Baum J, Feitelson J, Zeigler DR, Dean DH 

(1998) Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol Mol Biol 

Rev 62:775–780 

Schwab SM, Menge JA, Leonard RT (1983) Quantitative and qualitative effects of phosphorus 

on extracts and exudates of sundangrass roots in relation to vesicular-arbuscular 

mycorrhiza formation. Plant Physiol 73:761–765 

Secilia J, Bagyaraj DJ (1987) Bacteria and actinomycetes associated with pot cultures of 

vesicular-arbuscular mycorrhizas. Can J Microbiol 33:1067–1073 

Sims SR, Holden LR (1996) Insect bioassay for determining soil degradation of Bacillus 

thuringiensis subsp. kurstaki CryIA(b) protein in corn tissue. Environ Entomol 25: 

659–664 

Sims SR, Ream JE (1997) Soil inactivation of the Bacillus thuringiensis subsp. kurstaki 

CryIIA insecticidal protein within transgenic cotton tissue: laboratory microcosm 

and field studies. J Agric Food Chem 45:1502–1505 

Singsit C, Adang MJ, Lynch RE, Anderson WF, Wang A, Cardineau G, Ozias-Akins P 

(1997) Expression of a Bacillus thuringiensis cryIA(c) gene in transgenic peanut 

plants and its efficacy against lesser cornstalk borer. Transg Res 6:169–176

132 


Smith RA, Couche GA (1991) The philloplane as a source of Bacillus thuringiensis variants. 


Tapp H, Stotzky G (1995a) Insecticidal activity of the toxins from Bacillus thuringiensis 

subspecies kurstaki and tenebrionis adsorbed and bound on pure and soil clays. Appl 

Environ Microbiol 61:1786–1790 

Tapp H, Stotzky G (1995b) Dot blot enzyme-linked immunosorbent assay for monitoring 

the fate of insecticidal toxins from Bacillus thuringiensis in soil. Appl Environ 


Thomas DJI, Alun J, Morgan W, Whipps JM, Saunders JR (2000) Plasmid transfer 

between the Bacillus thuringiensis subspecies kurstaki and tenebrionis in laboratory 

culture and soil and in Lepidopteran and Coleopteran larvae.Appl Environ Microbiol 

118–124 

Tomlin AD (1994) Transgenic plant release: comments on the comparative effects of 

agriculture and foresty practices on soil fauna. Mol Biol 3:51–52 

Villas-Bôas LA, Villas-Bôas GFLT, Saridakis HO, Lemos MVF, Lereclus D, Arantes OMN 

(2000) Survival and conjugation of Bacillus thuringiensis in a soil microcosm. FEMS 


West AW, Burges HD, Dixon TJ,Wyborn CH (1985) Survival of Bacillus thuringiensis and 

Bacillus cereus spore inocula in soil: effects of pH, moisture, nutrient availability and 

indigenous microorganisms. Soil Biol Biochem 17:657–665 

Young CS, Lethbridge G, Shaw LJ, Burns RG (1995) Survival of inoculated Bacillus cereus 

spores and vegetative cells in non-planted and rhizosphere soil. Soil Biol Biochem 

27:1017–1026

8 The Use of ACC Deaminase-Containing Plant 

Growth-Promoting Bacteria to Protect Plants Against 

the Deleterious Effects of Ethylene 



Plant growth-promoting bacteria can affect plant growth and development in 

two different ways: indirectly or directly (Glick 1995; Glick et al. 1999). Indirect 

promotion of plant growth occurs when these bacteria decrease or prevent 

some of the deleterious effects of a phytopathogenic organism by any 

one or more of several different mechanisms. In general, bacteria can directly 

promote plant growth by providing the plant with a compound that is synthesized 

by the bacterium or facilitating the uptake of nutrients. 

There are several ways in which plant growth-promoting bacteria can 

directly facilitate the proliferation of their plant hosts. They may fix atmospheric 

nitrogen; produce siderophores which can solubilize and sequester 

iron and provide it to plants; synthesize phytohormones, including auxins, 

cytokinins, and gibberellins which can enhance various stages of plant 

growth; solubilize minerals such as phosphorus; and synthesize enzymes that 

can modulate plant growth and development (Brown 1974; Kloepper et al. 

1986, 1989; Davison 1988; Lambert and Joos 1989; Patten and Glick 1996; Glick 

et al. 1999). A particular bacterium may affect plant growth and development 

using any one, or more, of these mechanisms. Moreover, many plant growthpromoting 

bacteria possess several properties that enable them to facilitate 

plant growth and, of these, may utilize different ones at various times during 

the life cycle of the plant. 

The mechanism most often invoked to explain the various effects of plant 

growth-promoting bacteria on plants is the production of phytohormones, 

most notably auxin (Brown 1974; Tien et al. 1979; Patten and Glick 1996). 

Since plants as well as plant growth-promoting bacteria can synthesize auxin, 

it is important when assessing the consequences of treating a plant with a 

plant growth-promoting bacterium, to distinguish between the bacterial 

stimulation of plant auxin synthesis and bacterial auxin synthesis (Gaudin et 

al. 1994). To complicate matters, the response of plants to auxin-producing 




134 


bacteria may vary from one species of plant to another, as well as according to 

the age of the plant. 

2 Ethylene 

In higher plants ethylene is produced from L-methionine via the intermediates, 

S-adenosyl-L-methionine (SAM) and 1-aminocyclopropane-1-carboxylic 

acid (ACC; Yang and Hoffman 1984). The enzymes involved in this 

metabolic sequence are SAM synthetase, which catalyzes the conversion of 

methionine to SAM (Giovanelli et al. 1980); ACC synthase, which is responsible 

for the hydrolysis of SAM to ACC and 5¢–methylthioadenosine (Kende 

1989) and ACC oxidase which further metabolizes ACC to ethylene, carbon 

dioxide, and cyanide (John 1991). 

Ethylene, which is produced in almost all plants, mediates a range of plant 

responses and developmental steps. Ethylene is involved in seed germination, 

tissue differentiation, formation of root and shoot primordia, root elongation, 

lateral bud development, flowering initiation, anthocyanin synthesis, flower 

opening and senescence, fruit ripening and degreening, production of volatile 

organic compounds responsible for aroma formation in fruits, storage product 

hydrolysis, leaf and fruit abscission, and the response of plants to biotic 

and abiotic stress (Matoo and Suttle 1991; Abeles et al. 1992; Frankenberger 

and Arshad 1995). In some instances, ethylene is stimulatory while in others it 

is inhibitory. 

The term “stress ethylene” was coined by Abeles (1973) to describe the 

acceleration of ethylene biosynthesis associated with biological and environmental 

stresses, and pathogen attack (Morgan and Drew 1997). The increased 

level of ethylene formed in response to trauma inflicted by chemicals, temperature 

extremes, water stress, ultraviolet light, insect damage, disease, and 

mechanical wounding (Bestwick and Ferro 1998) can be both the cause of 

some of the symptoms of stress (e.g., onset of epinastic curvature and formation 

of arenchyma), and the inducer of responses which will enhance survival 

of the plant under adverse conditions (e.g., production of antibiotic enzymes 

and phytoalexins). 

Chemicals have been used to control ethylene levels in plants. The application 

of compounds such as rhizobitoxin, an amino acid secreted by several 

strains of bacteria, and its synthetic analog, aminoethoxyvinylglycine (AVG), 

can inhibit ethylene biosynthesis; silver thiosulfate can inhibit ethylene action, 

and 2-chloroethylphosphoric acid (ethephon), regarded by some researchers 

as “liquid ethylene”, can release ethylene (Abeles et al. 1992). Sisler and Serek 

(1997) discovered that cyclopropenes can block ethylene perception and are 

potentially useful for extending the life span of cut flowers and the display life 

of potted plants. In addition, tropolone compounds were isolated from wood 

by Mizutani et al. (1998). These compounds, which can inhibit the growth of

wood-rotting fungi, were shown to inhibit the biosynthesis of ethylene in 

excised peach pits.Many of these chemicals are potentially harmful to the environment: 

AVG and silver thiosulfate are highly toxic in food,and silver thiosulfate 

causes blackspotting in flowers (Bestwick and Ferro 1998). 

3 ACC Deaminase 

8 ACC Deaminase-Containing Plant Growth-Promoting Bacteria 135 

In 1978, an enzyme capable of degrading ACC was isolated from Pseudomonas 

sp. strain ACP, and from the yeast, Hansenula saturnus (Honma and Shimomura 

1978; Minami et al. 1998). Since then,ACC deaminase has been detected 

in the fungus, Penicillium citrinum (Honma 1993) and in a number of other 

bacterial strains (Klee and Kishore 1992; Jacobson et al. 1994, Glick et al. 1995; 

Campbell and Thomson 1996) all of which originated in the soil. Many of 

these microorganisms were identified by their ability to grow on minimal 

media containing ACC as its sole nitrogen source (Honma and Shimomura 

1978; Klee et al. 1991; Honma 1993; Jacobson et al. 1994; Glick et al. 1995; 

Campbell and Thomson 1996; Burd et al. 1998; Belimov et al. 2001). 

Enzymatic activity of ACC deaminase is assayed by monitoring the production 

of either ammonia or a-ketobutyrate, the products of ACC hydrolysis 

(Honma and Shimomura 1978). ACC deaminase has been found only in 

microorganisms, and there are no microorganisms that synthesize ethylene 

via ACC (Fukuda et al. 1993). However, there is strong evidence that the fungus, 

Penicillium citrinum, produces ACC from SAM via ACC synthase, one of 

the enzymes of plant ethylene biosynthesis, and degrades the ACC by ACC 

deaminase. It appears that the ACC, which accumulates in the intracellular 

spaces, can induce ACC deaminase (Jia et al. 2000). 

ACC deaminase has been purified to homogeneity from Pseudomonas sp. 

strain ACP (Honma and Shimomura 1978), Hansenula saturnus (Minami et 

al. 1998), Penicillium citrinum (Jia et al. 1999) and partially purified from 

Pseudomonas sp. strain 6G5 (Klee et al. 1991) and Pseudomonas putida 

GR12–2 (Jacobson et al. 1994); enzyme activity is localized exclusively in the 

cytoplasm (Jacobson et al. 1994). The molecular mass and form is similar for 

the bacterial ACC deaminases. The enzyme is a trimer (Honma 1985); the size 

of the holoenzyme is approximately 104–105 kDa (Honma and Shimomura 

1978; Honma 1985; Jacobson et al. 1994) and the subunit mass is approximately 

36.5 kDa (Honma and Shimomura 1978; Jacobson et al. 1994). Similar 

subunit sizes were predicted from nucleotide sequences of cloned ACC deaminase 

genes from Pseudomonas sp. strains ACP (Sheehy et al. 1991) and 6G5 

(Klee et al. 1991), and Enterobacter cloacae UW4 (Shah et al. 1997). 

The molecular mass of the holoenzymes and subunits from Hansenula saturnus 

(69 and 40 kDa, respectively) and Penicillium citrinum (68 and 41 kDa, 

respectively) suggests that these ACC deaminases are dimers (Minami et al. 

1998; Jia et al. 1999).

136 


K m values for the binding of ACC by ACC deaminase have been estimated 

for enzyme extracts from 12 microorganisms at pH 8.5. These values ranged 

from 1.5 to 17.4 mM (Honma and Shimomura 1978; Klee and Kishore 1992; 

Honma 1993) indicating that the enzyme does not have a particularly high 

affinity for ACC (Glick et al. 1999). 

ACC deaminase activity has been induced in both Pseudomonas sp. strain 

ACP and Pseudomonas putida GR12–2 by ACC, at levels as low as 100 nM, 

(Honma and Shimomura 1978; Jacobson et al. 1994); both bacterial strains 

were grown on a rich medium and then transferred to a minimal medium 

containing ACC as its sole nitrogen source. The rate of induction, similar for 

the enzyme from the two bacterial sources, was relatively slow: complete 

induction required 8–10 h. Enzyme activity increased only approximately 

tenfold over the basal level of activity even when the concentration of ACC 

increased up to 10,000-fold. 

Pyridoxal phosphate is a tightly bound cofactor of ACC deaminase in the 

amount of approximately three moles of enzyme-bound pyridoxal phosphate 

per mole of enzyme, or one mole per subunit (Honma 1985). 

Genes encoding ACC deaminase have been cloned from a number of different 

soil bacteria including Pseudomonas sp. strains 6G5 and 3F2 (Klee et al. 

1991; Klee and Kishore 1992), Pseudomonas sp. strain 17 (Campbell and 

Thomson 1996) Pseudomonas sp. strain ACP (Sheehy et al. 1991) and Enterobacter 

cloacae strains CAL2 and UW4 (Glick et al. 1995; Shah et al. 1998); 

yeast, Hansenula saturnus (Minami et al. 1998); and fungus, Penicillium citrinum 

(Jia et al. 1999). 

The ACC deaminase genes from Pseudomonas sp. strains 6G5 and F17, and 

Enterobacter cloacae strains UW4 and CAL2 all have an ORF of 1014 

nucleotides that encodes a protein containing 338 amino acids with a calculated 

molecular weight of approximately 36.8 kDa (Klee et al. 1991; Campbell 

and Thomson 1996; Shah et al. 1998). The genes from these strains are highly 

homologous to each other: at the nucleotide level 6G5, F17, UW4 and CAL2 

are 85–95 % identical to each other (Campbell and Thomson 1996; Shah et al. 

1998) and most of the dissimilarities are in the wobble position (Shah et al. 

1998). However, the DNA sequences from strains UW4 and CAL2 show only 

about 74 % homology with the sequence of the ACC deaminase gene from 

Pseudomonas sp. strain ACP (Sheehy et al. 1991; Shah et al. 1998). 

Sequence data indicate that strain UW4 contains a DNA region similar to 

that of the anaerobic transcription regulator, FNR, (fumarate and nitrate regulator) 

at positions –39 to –49 (Grichko and Glick 2000). Moreover, the ACC 

deaminase gene promoter in strain UW4 is under the transcriptional control 

of a nearby gene that has a DNA sequence similar to a leucine-responsive regulatory 

protein (LRP) and the LRP-like protein is transcriptionally regulated 

by ACC (Grichko and Glick 2000; Li and Glick 2001). 

When a broad host range plasmid containing the ACC deaminase gene 

from Enterobacter cloacae UW4 was introduced into two nonplant growth-


promoting bacteria, Pseudomonas putida ATCC 17399 and Pseudomonas fluorescens 

ATCC 17400, by conjugational transfer, the transconjugants acquired 

the ability to grow on minimal media using ACC as the sole source of nitrogen, 

and to promote the elongation of canola roots (Shah et al. 1998). 

In 1998, Glick et al. proposed a model in which plant growth-promoting 

bacteria can lower plant ethylene levels and in turn stimulate plant growth. In 

this model, the plant growth-promoting bacteria bind to the surface of either 

the seed or root of a developing plant; in response to tryptophan and other 

small molecules in the seed or root exudates (Whipps 1990), the plant growthpromoting 

bacteria synthesize and secrete indole acetic acid (IAA; Fallik et al. 

1994; Patten and Glick 1996), some of which is taken up by the plant. This IAA 

together with endogenous plant IAA, can stimulate plant cell proliferation, 

plant cell elongation or induce the activity of ACC synthase to convert SAM to 

ACC (Kende 1993). 

Much of the ACC produced by this latter reaction is exuded from seeds or 

plant roots along with other small molecules normally present in seed or root 

exudates (Penrose and Glick 2001). The ACC in the exudates may be taken up 

by the bacteria and subsequently hydrolyzed by the enzyme, ACC deaminase, 

to ammonia and a-ketobutyrate. The uptake and cleavage of ACC by plant 

growth-promoting bacteria decreases the amount of ACC outside the plant. 

Increasing amounts of ACC are exuded by the plant in order to maintain the 

equilibrium between internal and external ACC levels.As a result of the activity 

of ACC deaminase, the presence of the bacteria induces the plant to synthesize 

more ACC than it would otherwise need and as well, stimulates the 

exudation of ACC from the plant. 

Thus, plant growth-promoting bacteria are supplied with a unique source 

of nitrogen in the form of ACC that enables them to proliferate under conditions 

in which other soil bacteria may not flourish. As a result of lowering the 

ACC level within the plant, either the endogenous level or the IAA-stimulated 

level, the amount of ethylene in the plant is also reduced. 

Plant growth-promoting bacteria that possess the enzyme ACC deaminase 

and are bound to seeds or roots of seedlings, can reduce the amount of plant 

ethylene and the extent of its inhibition on root elongation. Thus, these plants 

should have longer roots and possibly longer shoots as well, inasmuch as stem 

elongation is also inhibited by ethylene, except in flooding-resistant plants 

(Abeles et al. 1992). 

3.1 Treatment of Plants with ACC Deaminase Containing Bacteria 

Consistent with the above mentioned model, ACC deaminase activity was 

completely lost and the ability to promote the elongation of canola roots 

under gnotobiotic conditions was greatly diminished when the ACC deaminase 

gene (acdS) from Enterobacter cloacae UW4 was replaced, by homolo-

138 


gous recombination, with a version of the same gene that contained a tetracycline 

resistance gene inserted within the coding region (Li et al. 2000). Results 

of an earlier study showed that ACC deaminase mutants of Pseudomonas 

putida GR12–2 did not promote the elongation of canola roots (Glick et al. 

1994). However, in those experiments, the mutants were created by chemical 

mutagenesis, and as a result, one could never be certain that the mutations 

were within the ACC deaminase structural gene per se. In the experiments by 

Li et al. (2000),ACC deaminase function was specifically eliminated by replacing 

the functional gene with an inactive version in order to demonstrate that 

there is no ambiguity as to the nature of the ACC deaminase minus mutants. 

It has been observed that both Escherichia coli and two different nonplant 

growth-promoting pseudomonads acquired the ability to significantly promote 

root elongation after they were transformed with a broad-host-range 

plasmid carrying the Enterobacter cloacae UW4 ACC deaminase gene and its 

upstream transcriptional regulatory region (Shah et al. 1998). Moreover, elongation 

of canola roots following treatment of seeds with an ACC deaminasecontaining 

bacterium is invariably accompanied by a decrease in the level of 

ACC found inside the root (Penrose et al. 2001). These observations confirm 

the effectiveness of ACC deaminase in lowering ACC levels. 

As mentioned earlier, many plants respond to biotic and abiotic stresses by 

synthesizing ethylene.Among these stresses is the presence of heavy metals in 

the environment. It has been reasoned that at least some of the inhibitory 

effect of heavy metals on plant growth is the consequence of the plant synthesizing 

excessive amounts of stress ethylene in response to the presence of the 

metal, especially during early seedling development. Prior to being planted in 

metal-contaminated soil, canola and tomato seeds were treated with a heavy 

metal-resistant bacterium that also contained ACC deaminase. Seeds inoculated 

with the bacterium, Kluyvera ascorbata, and then grown in the presence 

of high concentrations of nickel chloride were partially protected against 

nickel toxicity (Burd et al. 1998). The presence of this bacterium had no measurable 

influence on the amount of nickel accumulated per mg dry weight in 

either roots or shoots of canola plants. Therefore, the bacterial plant growthpromoting 

effect in the presence of nickel was not attributable to a reduction 

of nickel uptake by seedlings. Rather, it reflects the ability of the bacterium to 

lower the level of stress ethylene caused by the nickel. 

Transgenic canola plants that express Enterobacter cloacae UW4 ACC 

deaminase were tested for the ability to proliferate and accumulate metal in 

the presence of high levels of arsenate in the soil. In both the presence and 

absence of the plant growth-promoting bacterium, Enterobacter cloacae 

CAL2, the transgenic plants grew significantly larger than nontransformed 

plants (Nie et al. 2002). 

Flooding is a common biotic stress that affects many plants, often several 

times during the same growing season. Plant roots suffer a lack of oxygen as 

a consequence of flooding, and this in turn causes deleterious effects such as


epinasty, leaf chlorosis, necrosis, and reduced fruit yield. Two of the ACC 

synthase genes, LE-ACS7 and LE-ACS2, are rapidly induced in the roots of 

flooded tomato plants. Of these two genes, LE-ACS7 is expressed earliest 

after flooding and LE-ACS2 is expressed approximately 8 h after flooding; 

the gene, LE-ACS7 is also involved in the early wound response of tomato 

leaves (Shiu et al. 1998). Since ACC oxidase-catalyzed ethylene synthesis cannot 

occur in the anaerobic environment of flooded roots, ACC is transported 

into the aerobic shoots where is converted to ethylene (Bradford and Yang 

1980; Else and Jackson 1998). Treatment of tomato plants with ACC deaminase-containing 

plant growth-promoting bacteria significantly decreases the 

damage suffered by these plants – damage that is caused by the deleterious 

effects of ethylene which normally occurs as a consequence of flooding 

(Grichko and Glick 2001). These ACC deaminase-containing plant growthpromoting 

bacteria can act as a sink for ACC, thereby lowering the level of 

ethylene that can be formed in the shoots. The tomato plants are thus “protected” 

against flooding. 

Many of the symptoms of a diseased plant arise as a direct result of the 

stress imposed by the infection. That is, much of the damage sustained by 

plants infected with fungal phytopathogens occurs as a result of the response 

of the plant to the increased levels of stress ethylene (Van Loon 1984). It has 

also been observed that exogenous ethylene often increases the severity of a 

fungal infection and, as well, ethylene synthesis inhibitors significantly 

decrease the severity of a fungal infection. In a study with over 60 different 

cultivars and breeding lines of wheat, ethylene production increased as a 

result of infection with the fungal phytopathogen, Septoria nodorum, and 

was correlated with increased plant disease susceptibility (Hyodo 1991). The 

damage caused by the fungal phytopathogen, Alternaria, decreased in cotton 

plants by treating them with chemical inhibitors of ethylene synthesis 

(Bashan 1994). The levels of both ethylene and disease severity decreased in 

melon plants infected by the fungal phytopathogen, Fusarium oxysporum, 

following treatment of the plants with ethylene inhibitors (Cohen et al. 

1986). Fungal disease development increased in both cucumber plants 

infected with Colletotrichum lagenarium (Biles et al. 1990) and in tomato 

plants infected with Verticillium dahliae (Cronshaw and Pegg 1976) when 

the plants were pretreated with ethylene. Treatment with ethylene inhibitors 

decreased disease severity in roses, carnations, tomato, pepper, French-bean 

and cucumber infected with the fungus, Botrytis cinerea (Elad 1988 and 

1990). 

Several biocontrol strains were transformed with the Enterobacter cloacae 

UW4 ACC deaminase gene and the effect of the transformation was assessed 

by using the cucumber-Pythium ultimum system (Wang et al. 2000). The 

results of the experiments indicated that ACC deaminase-containing biocontrol 

bacterial strains were significantly more effective than biocontrol strains 

that lacked this enzyme. Moreover, transgenic tomato plants that express ACC

140 


deaminase are also protected, to a significant extent, against phytopathogenmediated 

damage from several different phytopathogens (Lund et al. 1998; 

Robison et al. 2001). In effect, ACC deaminase acts synergistically with other 

mechanisms of biocontrol, such as the production of antibiotics or pathogenesis-related 

proteins, to prevent phytopathogens from damaging plants. As 

with other types of stress, it is assumed that ACC deaminase can act to prevent 

the accumulation of ACC that would otherwise occur as a result of environmental 

stress. 

Ethylene is also a key signal in the initiation of senescence of flowers in 

most plants. For example, carnation flowers produce minute amounts of ethylene 

until there is an endogenous rise (climacteric burst) in the level of this 

phytohormone. This rise in endogenous ethylene concentration is responsible 

for flower senescence (Mol et al. 1995), which in carnations is characterized by 

in-rolling of their petals. 

However, ethylene does not cause senescence in all flower families, and 

even the features of senescence that are caused by ethylene differ from plant 

to plant (Woltering and Van Doorn 1988): for example, Caryophyllaceae (e.g., 

carnations) show ethylene-mediated wilting of their petals, whereas ethylene 

causes petal abscission in Rosaceae (e.g., roses), but does not cause any senescence 

of petals in Compositae (e.g., sunflowers). 

Since ACC is a key element in the senescence of flower petals, a reduction in 

endogenous ACC would lower the amount of ethylene synthesized by the 

flower and delay the senescence of the petals. Many cut flowers (e.g., carnations 

and lilies), sold commercially, are routinely treated with the ethylene 

inhibitor, silver thiosulfate, which in high concentrations is potentially phytotoxic 

and environmentally hazardous. However, the use of ACC deaminasecontaining 

plant growth-promoting bacteria could be an environmentally 

friendly method of lowering ACC levels in cut flowers. As a first step toward 

determining the feasibility of this suggestion, carnation petals were treated 

with ACC deaminase-containing plant growth-promoting bacteria; petal 

senescence was delayed by several days when compared with untreated flower 

petals (Nayani et al. 1998). 

4 Conclusions 

There are a large number of situations in which the manipulation of ACC 

deaminase genes could be used to improve agricultural/horticultural/silvicultural 

practice. Organisms containing these genes may find use in, among 

other things, promoting early root development from either seeds or cuttings, 

increasing the life of cut flowers, protecting plants against a wide range of 

environmental stresses, facilitating the production of volatile organic compounds 

responsible for aroma formation and phytoremediation of contaminated 

soils.


Currently, many consumers worldwide are reluctant to embrace the use of 

genetically modified plants as sources of foods. Thus, for the foreseeable 

future it may be advantageous to use either natural or genetically engineered 

plant growth-promoting bacteria as a means of lowering plant ethylene levels 

rather than genetically modifying the plant itself to achieve the same end. 

Moreover, given the large number of different plants, the various cultivars of 

those plants and the multiplicity of genes that would need to be introduced 

into plants, it is not feasible to genetically engineer all plants to be resistant to 

all types of pathogens and environmental stresses. Rather, it makes a lot of 

sense to engineer plant growth-promoting bacteria to do this job, and the first 

step in this direction could well be the introduction of appropriately regulated 

ACC deaminase genes. 

Acknowledgements. The work from our laboratory that is described here was supported 

by grants from the Natural Science and Engineering Research Council of Canada. We 

wish to acknowledge the role of numerous collaborators and students in the work 

described here including: Chunxia Wang, Geneviève Défago, Shimon Mayak, Varvara 

Grichko, Jiping Li, Mary Robison, Peter Pauls, Saleh Shah, Barbara Moffatt, Genrich Burd, 

Seema Nayani, Gina Holguin, Cheryl Patten, Chris Jacobson and Daniel Ovakim. Thanks 

are also due to Andrei Belimov for sharing his results prior to their publication. 


Abeles FB (1973) Ethylene in plant biology. Academic Press, New York, 302 pp 

Abeles FB, Morgan PW, Saltveit ME Jr (1992) Ethylene in plant biology, 2nd edn. Academic 

Press, San Diego 

Bashan Y (1994) Symptom expression and ethylene production in leaf blight of cotton 

caused by Alternaria macrospora and Alternaria alternata alone and combined. Can 

J Bot 72:1574–1579 

Belimov AI, Safronova, VI, Sergeyeva TA, Egorova TN, Matveyeva VA, Tsyganov VE, 

Borisov AY, Tikhonovich IA, Kluge C, Preisfeld A, Dietz K-J, Stepanok VV (2001) Characterization 

of plant growth promoting rhizobacteria isolated from polluted soils and 

containing 1-aminocyclopropane-1-carboxylate deaminase. Can J Microbiol 27:642– 

652 

Bestwick RK, Ferro AJ (1998) Reduced ethylene synthesis and delayed fruit ripening in 

transgenic tomatoes expressing S-adenosylmethionine hydrolase. US Patent No: 

5,723,746 

Biles CL, Abeles FB, Wilson CL (1990) The role of ethylene in anthracnose of cucumber, 

Cucumis sativus, caused by Colletotrichum lagenarium. Phytopathology 80732–736 

Bradford KJ,Yang SF (1980) Xylem transport of 1-aminocyclopropane-1-carboxylic acid, 

an ethylene precursor, in waterlogged tomato plants. Plant Physiol 65:322–326 

Brown ME (1974) Seed and root bacterization. Annu Rev Phytopathol 12:181–197 

Burd GI, Dixon DG, Glick BR (1998) A plant growth–promoting bacterium that 

decreases nickel toxicity in seedlings. Appl Environ Microbiol 64:3663–3668 

Campbell BG, Thomson JA (1996) 1-Aminocyclopropane-1-carboxylate deaminase 

genes from Pseudomonas strains. FEMS Microbiol Lett 138:207–210

142 


Cohen R, Riov J, Lisker N, Katan J (1986) Involvement of ethylene in herbicide-induced 

resistance to Fusarium oxysporum f. sp. melonis. Phytopathology 76:1281–1285 

Cronshaw DK, Pegg GF (1976) Ethylene as a toxin synergist in Verticillium wilt of 

tomato. Physiol Plant Pathol 9:33–38 

Davison J (1988) Plant beneficial bacteria. Bio/Technology 6:282–286 

Elad Y (1988) Involvement of ethylene in the disease caused by Botrytis cinerea on rose 

and carnation flowers and the possibility of control. Ann Appl Biol 113:589–598 

Elad Y (1990) Production of ethylene in tissues of tomato, pepper, French-bean and 

cucumber in response to infection by Botrytis cinerea. Physiol Mol Plant Pathol 

36:277–287 

Else MA, Jackson MB (1998) Transport of 1-aminocyclopropane-1-carboxylic acid 

(ACC) in the transpiration stream of tomato (Lycopersicon esculentum) in relation to 

foliar ethylene production and petiole epinasty. Aust J Plant Physiol 25:453–458 

Fallik E, Sarig S, Okon Y (1994) Morphology and physiology of plant roots associated 

with Azospirillum. In: Okon Y (ed) Azospirillum/plant associations. CRC Press, Boca 

Raton, pp 77–85 

Frankenberger WT Jr,Arshad M (1995) Phytohormones in soil. Marcel Dekker, New York 

Fukuda H, Ogawa T, Tanase S (1993) Ethylene production by microorganisms. Adv 

Microb Physiol 35:275–306 

Gaudin V, Vrain T, Jouanin L (1994) Bacterial genes modifying hormonal balances in 

plants. Plant Physiol Biochem 32:11–29 

Giovanelli J, Mudd SH, Datko AH (1980) Sulfur amino acids in plants. In: Miflin BJ (ed) 

Amino acids and derivatives, the biochemistry of plants: a comprehensive treatise. vol 

5. Academic Press, New York, pp 453–505 


41:109–117 

Glick BR, Jacobson CB, Schwarze MK, Pasternak JJ (1994) 1-Aminocyclopropane-1-carboxylic 

acid deaminase mutants of the plant growth promoting rhizobacterium 

Pseudomonas putida GR12-2 do not stimulate canola root elongation. Can J Microbiol 

40:911–915 

Glick BR, Karaturovíc DM, Newell PC (1995) A novel procedure for rapid isolation of 

plant growth promoting pseudomonads. Can J Microbiol 41:533–536 

Glick BR, Penrose DM, Li J (1998) A model for the lowering of plant ethylene concentrations 

by plant growth-promoting bacteria. J Theor Biol 190:63–68 

Glick BR, Patten CL, Holguin G, Penrose DM (1999) Biochemical and genetic mechanisms 

used by plant growth-promoting bacteria. Imperial College Press, London 

Grichko VP, Glick BR (2000) Identification of DNA sequences that regulate the expression 

of the Enterobacter cloacae UW4 1-aminocyclopropane-1-carboxylate deaminase 

gene. Can J Microbiol 46:1159–1165 

Grichko VP, Glick BR (2001) Amelioration of flooding stress by ACC deaminase-containing 

plant growth-promoting bacteria. Plant Physiol Biochem 39:11–17 

Honma M (1985) Chemically reactive sulfhydryl groups of 1-aminocyclopropane-1-carboxylate 

deaminase. Agric Biol Chem 49:567–571 

Honma M (1993) Stereospecific reaction of 1-aminocyclopropane-1-carboxylate deaminase. 

In: Pech JC, Latché A, Balagué C (eds) Cellular and molecular aspects of the 

plant hormone ethylene. Kluwer, Dordrecht, pp 111–116 

Honma M, Shimomura T (1978) Metabolism of 1-aminocyclopropane-1-carboxylic acid. 

Agric Biol Chem 42:1825–1831 

Hyodo H (1991) Stress/wound ethylene. In: Mattoo AK, Suttle JC (eds) The plant hormone 

ethylene. CRC Press, Boca Raton, pp 65–80 

Jacobson CB, Pasternak JJ, Glick BR (1994) Partial purification and characterization of 

1–aminocyclopropane-1-carboxylate deaminase from the plant growth promoting 

rhizobacterium Pseudomonas putida GR12-2. Can J Microbiol 40:1019–1025


Jia Y-J, Kakuta Y, Sugawara M, Igarashi T, Oki N, Kisaki M, Shoji T, Kanetuna Y, Horita T, 

Matsui H, Honma M (1999) Synthesis and degradation of 1–aminocyclopropane-1carboxylic 

acid by Penicillium citrinum. Biosci Biotechnol Biochem 63:542–549 

Jia Y-J, Ito H, Matsui H, Honma M (2000) 1-Aminocyclopropane-1-carboxylate (ACC) 

deaminase induced by ACC synthesized and accumulated in Penicillium citrinum 

intracellular spaces. Biosci Biotechnol Biochem 64:299–305 

John P (1991) How plant molecular biologists revealed a surprising relationship between 

two enzymes, which took an enzyme out of a membrane where it was not located, and 

put it into the soluble phase where it could be studied. Plant Mol Biol Rep 9:192–194 

Kende H (1989) Enzymes of ethylene biosynthesis. Plant Physiol 91:1–4 

Kende H (1993) Ethylene biosynthesis. Annu Rev Plant Physiol Plant Mol Biol 

44:283–307 

Klee HJ, Kishore GM (1992) Control of fruit ripening and senescence in plants. US Patent 

No: 5,702,933 

Klee HJ, Hayford MB, Kretzmer KA, Barry GF, Kishore GM (1991) Control of ethylene 

synthesis by expression of a bacterial enzyme in transgenic tomato plants. Plant Cell 

3:1187–1193 

Kloepper JW, Scher FM, Laliberté M, Tipping B (1986) Emergence-promoting rhizobacteria: 

description and implications for agriculture. In: Swinburne TR (ed) Iron, 

siderophores, and plant disease. Plenum, New York, pp 155–164 

Kloepper JW, Lifshitz R, Zablotowicz RM (1989) Free-living bacterial inocula for 

enhancing crop productivity. Trends Biotechnol 7:39–43 

Lambert B, Joos H (1989) Fundamental aspects of rhizobacterial plant growth promotion 

research. Trends Biotechnol 7:215–219 

Li J, Glick BR (2001) Transcriptional regulation of the Enterobacter cloacae UW4 

1–aminocyclopropane-1-carboxylate (ACC) deaminase gene (acdS). Antonie van 

Leewenhoek 80:255–261 

Li J, Ovakim DH, Charles TC, Glick BR (2000) An ACC deaminase minus mutant of Enterobacter 

cloacae UW4 no longer promotes root elongation. Curr Microbiol 41:101–105 

Lund ST, Stall, RE, Klee HJ (1998) Ethylene regulates the susceptible response to 

pathogen infection in tomato. Plant Cell 10:371–382 

Mattoo AK, Suttle JC (1991) The plant hormone ethylene. CRC Press, Boca Raton 

Minami R, Uchiyama K, Murakami T, Kawai J, Mikami K, Yamada T, Yokoi D, Ito H, Matsui 

H, Honma M (1998) Properties, sequence, and synthesis in Escherichia coli of 1aminocyclopropane-1-carboxylate 

deaminase from Hansenula saturnus. J Biochem 

123:1112–1118 

Mizutani F, Golam Rabbany ABM, Akiyoshi H (1998) Inhibition of ethylene production 

by tropolone compounds in young excised peach pits. J Jpn Soc Hortic Sci 67:166–169 

Mol JNM, Holton TA, Koes RE (1995) Floriculture: genetic engineering of commercial 

traits. Trends Biotechnol 13:350–355 

Morgan PW, Drew CD (1997) Ethylene and plant responses to stress. Physiol Plant 

100:620–630 

Nayani S, Mayak S, Glick BR (1998) The effect of plant growth promoting rhizobacteria 

on the senescence of flower petals. Ind J Exp Biol 36:836–839 

Nie L, Shah S, Rashid A, Burd GI, Dixon GD, Glick BR (2002) Phytoremediation of arsenate 

contaminated soil by transgenic canola and the plant growth-promoting bacterium 

Enterobacter cloacae CAL2. Plant Physiol Biochem 40:355–361 

Patten CL, Glick BR (1996) Bacterial biosynthesis of indole-3-acetic acid. Can J Microbiol 

42:207–220 

Penrose DM, Glick BR (2001) Levels of 1–aminocyclopropane-1-carboxylic acid (ACC) 

in exudates and extracts of canola seeds treated with plant growth-promoting bacteria. 

Can J Microbiol 47:368–372

144 


Penrose DM, Moffatt BM, Glick BR (2001) Determination of 1-aminocyclopropane-1carboxylic 

acid (ACC) to assess the effects of ACC deaminase-containing bacteria on 

roots of canola seedlings. Can J Microbiol 47:77–80 

Robinson MM, Shah S, Tamot B, Pauls PK, Moffatt BA, Glick BR (2001) Reduced symptoms 

of Verticillium wilt in tomato plants transformed with ACC deaminase to control 

ethylene biosynthesis. Mol Plant Pathol 2:135–145 

Shah S, Li J, Moffatt BA, Glick BR (1997) ACC deaminase genes from plant growth promoting 

bacteria. In: Ogoshi A, Kobayashi K, Homma Y, Kodama F, Kondo N, Akino S 

(eds) Plant growth-promoting rhizobacteria: present status and future prospects. 

OECD, Paris, pp 320–324 

Shah S, Li J, Moffatt BA, Glick BR (1998) Isolation and characterization of ACC deaminase 

genes from two different plant growth promoting rhizobacteria. Can J Microbiol 

44:833–843 

Sheehy RE, Honma M, Yamada M, Sasaki T, Martineau B, Hiatt WR (1991) Isolation, 

sequence, and expression in Escherichia coli of the Pseudomonas sp. strain ACP gene 

encoding 1-aminocyclopropane-1-carboxylate deaminase. J Bacteriol 173:5260–5265 

Shiu OY, Oetiker JH, Yip WK, Yang SF (1998) The promoter of LE-ACS7, an early flooding-induced 

1-aminocyclopropane carboxylate synthase gene of the tomato, is tagged 

by a Sol3 transposon. Proc Natl Acad Sci USA 95:10334–10339 

Sisler EC, Serek M (1997) Inhibitors of ethylene responses in plants at the receptor level: 

recent developments. Physiol Plant 100:577–582 

Tien TM, Gaskins MH, Hubell DH (1979) Plant growth substances produced by Azospirillum 

brasilense and their effect on the growth of pearl millet (Pennisetum americanum 

L). Appl Environ Microbiol 37:1016–1024 

Van Loon LC (1984) Regulation of pathogenesis and symptom expression in diseased 

plants by ethylene. In: Fuchs Y, Chalutz E (eds) Ethylene: biochemical, physiological 

and applied aspects. Martinus Nijhoff/Dr. W. Junk, The Hague, pp 171–180 

Wang C, Knill E, Glick BR, Défago G (2000) Effect of transferring 1–aminocyclopropane- 

1-carboxylic acid (ACC) deaminase genes into Pseudomonas fluorescens strain CHA0 

and its gacA derivative CHA96 on their growth-promoting and disease-suppressive 

capacities. Can J Microbiol 46:898–907 

Whipps JM (1990) Carbon utilization. In: Lynch JM (ed) The rhizosphere. Wiley Interscience, 

Chichester, pp 59–97 

Woltering EJ, Van Doorn WG (1988) Role of ethylene in senescence of petals – morphological 

and taxonomical relationships. J Exp Bot 39:1605–1616 

Yang SF, Hoffman NE (1984) Ethylene biosynthesis and its regulation in higher plants. 

Annu Rev Plant Physiol 35:155–189

9 Interactions Between Epiphyllic Microorganisms 

and Leaf Cuticles 



Leaves of higher plants are exposed to the atmosphere. Due to the pronounced 

two-dimensional structure of leaves, the surface area of plants is significantly 

enlarged. This allows an efficient absorption of visible light used in photosynthesis 

and it supports the rapid gas exchange of carbon dioxide and oxygen, 

occurring across stomates. With most leaves, stomates representing small 

pores, cover only between 0.5 to 1 % of the total leaf surface area (Larcher 

1996), whereas the largest part of the leaf surface is covered by the plant cuticle 

forming the major interface between the leaves and the atmosphere (Kerstiens 

1996). The cuticle developed during evolution when plants moved from 

their aqueous habitats to the dry land. It protects land living plants from desiccation. 

The water potential in the atmosphere is nearly always lower than the 

water potential of plants, which causes a constant driving force for the flow of 

water from the plant body to the atmosphere (Nobel 1991). Without the cuticle 

forming a very efficient transport barrier for the passive diffusion of water 

from the turgescent plant to the atmosphere, most of the land-living higher 

plants would never be able to survive. 

Besides this major function as a watertight barrier, the plant cuticle also 

limits the leaching of ions and nutrients from the leaf interior (Tukey 1970), 

and it forms a mechanical barrier for most microorganisms trying to infect 

the living leaf tissues (Mendgen 1996; Schafer 1998). Looking at the surfaces 

of healthy, green leaves collected in the environment in their natural habitats 

using different microscopical techniques (fluorescence microscopy, confocal 

laser scanning microscopy or scanning electron microscopy), it becomes 

obvious that leaf surfaces are always covered by epiphyllic microorganisms to 

a certain degree (Fig. 1). This epiphyllic flora is composed of bacteria, yeasts 

and filamentous fungi belonging to different systematic categories (Morris et 

al. 1996). The degree of coverage strongly depends on a series of parameters 

like the plants species, the structure of the leaf surface, the habitat of the plant 

and the age of the leaf (Preece and Dickinson 1971; Dickinson and Preece 




146 


Fig. 1. Micrograph (SEM) of the lower stomatous leaf side of walnut (Juglans regia L.).A 

dense epiphyllic microflora of bacterial (smaller rod-like cells) and yeast cells (larger 

spherical cells) in a depression of the lower leaf surface can be seen 

1976). Population densities of leaf surface microorganisms are characterised 

by large fluctuations, since they are strongly dependent on environmental 

conditions (Fokkema and van den Heuvel 1986). Rapid changes from 

favourable environmental conditions (e.g., high humidity and low irradiance) 

to unfavourable conditions (e.g., low humidity, high irradiance and high temperatures) 

as they can naturally occur within hours or days are followed by 

rapid changes in the density and the number of epiphyllic microorganisms 

(Leben 1988). 

Thus, it can be concluded that the phyllosphere forms a characteristic 

habitat for microorganisms, a fact which has largely been neglected in the 

past (Beattie and Lindow 1995). Plant biologists normally investigate the 

structure and the function of the cuticle as a barrier for water and organic 

compounds (Schönherr and Riederer 1989), whereas plant pathologists are 

mostly interested in the interaction between pathogens and the living epidermal 

cells or the cell walls (Dixon and Lamb 1990). Environmental microbiologists 

are mostly interested in describing the epiphyllic population 

dynamics, the species composition and their potential as antagonists

9 Interactions Between Epiphyllic Microorganisms and Leaf Cuticles 147 

Fig. 2. A scheme of the phyllosphere 

as a habitat for 

microorganisms showing most 

of the relevant climatic and 

plant parameters determining 

the living conditions of the leaf 

surface 

atmosphere 

waxes 

cutin 

epidermal 

wall 

wetting 

biofilm 

penetration 

leaching 

(Andrews 1992; Jacques and Morris 1995; Fiss et al. 2000). However, looking 

at the leaf surface as a microhabitat with very specific boundary conditions, 

investigations of the parameters, limitations and interactions between the 

lipophilic leaf surface and the microorganisms have rarely been carried out 

(Fig. 2). This habitat is characterised by an extreme microclimate due to 

large variations in climatic parameters like light intensity and temperature 

(Andrews and Harris 2000). Due to specific physical, chemical and biological 

properties of leaf surfaces, the phyllosphere is also dominated by a low 

availability of water and nutrients (Schönherr and Baur 1996; Beattie and 

Lindow 1999). Investigating the microbial ecology of the phyllosphere will be 

a combined approach including plant ecophysiological and microbiological 

tools. In the following, several important aspects of the microbial ecology of 

the phyllosphere will be discussed and selected examples for the interactions 

occurring between epiphyllic microorganisms and the leaf surface will be 

given. 

2 Physical and Chemical Parameters of the Phyllosphere 

water 

vapor 

gradient 

The plant cuticle covering the leaf surface is a lipophilic, extracellular 

biopolymer. It is composed of the cutin polymer (Kolattukudy 2001), which is 

a polyester of esterified hydroxy fatty acids, and of cuticular waxes (Walton 

1990), deposited as monomeric compounds to the cutin polymer (intracuticular 

waxes) and to the cutin surface (epicuticular waxes). Cuticular waxes are 

basically linear long chain aliphatic compounds of different chain length and 

different substance classes. Typical wax constituents are alkanes, aldehydes, 

primary and secondary alcohols, acids and esters composed of the respective 

acids and alcohols (Bianchi 1995). Besides these linear long-chain aliphatics,

148 


cuticular waxes of some plant species are dominated by a large degree by 

triterpenoic acids and triterpenols (Gülz 1994; Markstädter et al. 2000). The 

chemical environment which will be sensed by epiphyllic microorganisms living 

on leaf surfaces will be the outermost layer of wax compounds forming 

the true interface between the leaf and the atmosphere. For this reason, analytical 

chemistry such as gas chromatography coupled to different detector 

systems (FID and MS) is an important tool for describing the chemical environment 

of the leaf surface (Riederer and Markstädter 1996). 

Epicuticular waxes often form characteristic three-dimensional structures 

like platelets (Fig. 3), rods, ribbons or filaments (Jeffree 1986). This significantly 

increases leaf surface roughness. As a consequence, water drops, small 

particles, as well as spores and bacterial cells located on the tips of these crystals 

strongly reduce the attachment of particles to the leaf surface. Thus, rain 

or water can simply wash off these loosely attached particles on rough leaf 

surfaces (Barthlott and Neinhuis 1997). Both parameters, the very hydrophobic 

nature of cutin and wax and the often very pronounced roughness of the 

leaf surface, are responsible for the fact that leaf surfaces are a very dry habitat 

since water is very efficiently rejected (Holloway 1970). Nevertheless, with 

increasing leaf age in most cases epicuticular wax crystals tend to disappear, 

probably due to erosion, and the factor roughness will become less significant 

Fig. 3. Micrograph (SEM) of the upper astomatous leaf side of oak (Quercus robur L.) 

showing the dense accumulation of epicuticular wax crystals. The crystals, having the 

shape of small platelets, are oriented in a rectangular angle to the leaf surface leading to 

a pronounced surface roughness


for epiphyllic microorganisms trying to colonise older leaves (Neinhuis and 

Barthlott 1998). 

In addition, cuticular waxes are responsible for establishing the transport 

barrier of the plant cuticle (Riederer and Schreiber 1995). Extraction of cuticular 

waxes with appropriate solvents such as chloroform increased cuticular 

transport for water and dissolved compounds by two to three orders of magnitude 

(Schönherr and Riederer 1989). At room temperature, waxes form 

solid partially crystalline aggregates with a high degree of order (Reynhardt 

and Riederer 1994; Schreiber et al. 1997) and, thus, they efficiently seal the 

amorphous cutin polymer, which itself is fairly permeable for water and dissolved 

compounds (Schönherr and Riederer 1989). The structure of the cuticle 

can best be compared to the technical principle realised in wax-coated 

papers, where the wax establishes a transpiration barrier, whereas the cellulose 

polymer forms a stable matrix for deposition of the wax (Fox 1958). Thus, 

although epiphyllic microorganisms live on a substrate, below which the best 

conditions in terms of water supply and nutrient concentrations exist, the leaf 

surface is an environment with extremely unfavourable conditions, because 

this reservoir below the cuticle is rarely accessible to leaf surface microorganisms 

under normal conditions (Schönherr and Baur 1996). 

3 Leaf Surface Colonisation and Species Composition 

Freshly emerging leaves are basically clean, unwettable and they often have a 

pronounced roughness due to epicuticular waxes crystals (Neinhuis and 

Barthlott 1998). Pronounced succession in leaf surface colonisation has been 

described by several authors (Ercolani 1991; Kinkel 1991; Blakeman 1993). 

Normally, the first detectable microorganisms are bacteria starting to 

colonise the leaf surface (Blakeman 1991). Later in the season, yeasts become 

more and more abundant in the phyllosphere due to additional nutrients like 

pollen and high amounts of sugars becoming available by the activity of 

aphids (Stadler and Müller 1996). Towards the end of the season, especially 

with deciduous trees, leaf surfaces are often densely covered with filamentous 

fungi. This might be related to decreasing barrier properties of the cuticle due 

to leaf ageing. 

Once epiphyllic microorganisms have succeeded in colonising the leaf 

surface they are strongly attached to the surface (Romantschuk 1992) and 

can rarely be removed even after excessive washing (Schreiber and Schönherr 

1993). They often tend to protect themselves in an extracellular matrix 

(Beattie and Lindow 1999), and it has also been shown that biofilms, containing 

different bacterial species, may develop in the phyllosphere (Morris 

et al. 1997, 1998). The species living in the leaf surface belong to diverse taxonomic 

groups. Most abundant bacterial species which have been described 

belonged to the genera Corynebacterium, Erwinia, Pseudomonas, Xan-

150 


thomonas and Bacillus (Ercolani 1991; Morris et al. 1998). Cladosporium, 

Alternaria and Aureobasidium have been described as being abundant filamentous 

fungal species and Cryptococcus and Sporobolomyces were 

described as abundant yeast species in the phyllosphere (Andrews and Harris 

2000; Blakeman 1993). 

However, it must be mentioned that the description of the epiphyllic 

microflora up to now is exclusively based on an identification of the species 

after cultivation on standard media. However, it is well known today from 

environmental microbiology that many bacterial species cannot be cultivated 

with standard techniques (Amann et al. 1995). PCR-based approaches 

showed that the bacterial species composition of aquatic environments, but 

also of soil and rhizosphere communities, is much more complex and 

diverse as it was originally concluded from cultivation-based approaches 

(Marilley et al. 1998; Tiedje et al. 1999; Ogram 2000). A similar approach has 

rarely been carried out in the leaf surface and it is absolutely necessary in 

leaf surface microbiology in future in order to obtain a more realistic and 

complete picture of the species composition in the phyllosphere. Results of 

one of the first approaches, comparing the bacterial species identified using 

PCR versus cultivation-based techniques (Yang et al. 2001), in fact, yielded 

two quite different pictures of the species composition of the phyllosphere. 

This proves that our knowledge of the species composition on leaf surfaces 

obtained from cultivation-based techniques is still rather limited and needs 

further research. 

4 Alteration of Leaf Surface Wetting 

Investigations of the seasonal development of leaf surface wetting have shown 

several times that leaf surfaces become more and more wettable with increasing 

leaf age (Cape 1983; Turunen and Huttunen 1989; Cape and Percy 1993; 

Neinhuis and Barthlott 1998). This was normally attributed to chemical 

changes in the physico-chemical properties of the waxy leaf surface at the 

leaf/atmosphere interface caused by environmental pollution. In addition, it 

was shown that wax erosion due to the constant exposure of the leaf surface to 

wind, rain and the deposition of dust particles from the atmosphere to the leaf 

surface also occurs (van Gardingen et al. 1991), and may be further contributed 

to these observed increases in wetting. However, epiphyllic microorganisms 

as a further parameter contributing to an increased wetting of the 

leaf surface may not be neglected here. 

In simple model experiments, silanised glass surfaces, which are rarely wetted 

by water due to their high hydrophobicity, were colonised by bacteria and 

wetting properties were quantified by measuring contact angles (Knoll and 

Schreiber 1998, 2000). From these experiments, it became obvious that already 

at a coverage of 10 % of the total surface, contact angles decreased by 25°


(Fig. 4A). Maximum effects were a decrease of the contact angle from about 

95° to 30° at a coverage of 70 %. Similar results were obtained when clean ivy 

leaf surfaces were colonised by bacteria. A bacterial coverage of 10 % of the 

leaf surface resulted in a decrease in the contact angle by 25° and only a 25 % 

coverage resulted in decrease from 90° to 40° (Fig. 4B). These experiments 

clearly proved that leaf surface wetting properties can be altered to a large 

degree by the presence of epiphyllic microorganisms. 

Using scanning electron microscopy, gas chromatography and contact 

angle measurements in parallel, investigation of needle (Abies grandis Lindl.) 

and leaf surfaces (Juglans regia L.) during one season supported this observation 

(Schreiber 1996; Knoll and Schreiber 1998). The pronounced increase in 

Contact angle (degree) 

contact angle (degree) 

100 

90 

80 

70 

60 

50 

40 

30 

20 

80 

76 

72 

68 

64 

60 

56 

Silanized 

glass 

pH 3.0 

surface 

pH 9.0 

20/6/1994 

20/7/1994 

15/8/1994 

Abies 

grandis 

current year needles 

pH 3.0 

pH 9.0 

15/10/1994 

180 200 220 240 260 280 300 320 

day of the year 1994 

A 

(a) t = 6 h 

0 10 20 30 40 50 60 70 80 

Area covered by P. fluorescens (%) 

15/11/1994 

C 



80 

75 

70 

65 

60 

55 

50 

45 

40 

100 

90 

80 

70 

60 

50 

40 

30 

Hedera 

helix 

0 5 10 15 20 25 30 

Area covered by epiphytic micro-organisms (%) 

5 

6 

/ 

9 

0 

/ 

2 

5 

5 

7 

/ 

9 

0 

/ 

1 

9 

Juglans 

regia 

8 

/ 

9 

0 

/ 

2 

1 

160 180 200 220 240 260 280 300 

5 

Julian day (1995) 

Fig. 4. Degree of wetting of a silanised glass surface (A) and an ivy (Hedera helix L.) leaf 

surface (B) as a function of the coverage of the leaf surface with epiphyllic microorganisms. 

Seasonal increase of needle (Abies grandis Lindl.) surface (C) and leaf (Juglans 

regia L.) surface (D) wetting due to increasing amounts of microorganisms growing in 

the phyllosphere 

5 

9 

/ 

9 

0 

/ 

1 

1 

B 

D 

5 

0 

/ 

9 

1 

/ 

0 

5

152 


the needle and the leaf surface wetting properties quantified by contact angle 

measurements (Fig. 4C, D) was always in parallel with a significant increase in 

the colonisation of the needle and leaf surfaces with epiphyllic microorganisms 

as seen in scanning electron microscopy. However, changes in the qualitative 

and quantitative wax composition, measured by gas chromatography, 

were not at all correlated with the changes in the wetting properties of the leaf 

surfaces (Schreiber 1996; Knoll and Schreiber 1998). 

From this, it is evident that leaf surface microorganisms have the ability to 

significantly change leaf wettability by altering the physico-chemical properties 

of leaf surfaces. This is probably an important ecological strategy of epiphyllic 

microorganisms improving the living conditions in their environment. 

Increased wetting will increase the water availability in the leaf surface, 

which in turn is highly favourable for the microorganisms living there. Furthermore, 

increased wetting will also more easily lead to the formation of thin 

water films, which is necessary in order to dissolve substances leaching from 

the apoplast to the leaf surface. As a consequence, the availability and the 

amount of nutrients in the phyllosphere will increase as well, which again is 

favourable for epiphyllic microorganisms. 

5 Interaction of Bacteria with Isolated Plant Cuticles 

It is generally believed that plant cuticles form more or less impermeable 

mechanical barriers for bacteria (Agrios 1995). Whereas fungi may have the 

ability to penetrate the cuticle using extracellular enzymes (Schäfer 1998), for 

bacteria an infection of the leaf tissue only seems to be possible via stomates 

or hydathodes forming natural openings or via artificial openings like cracks 

caused by injuries. In order to test this hypothesis, isolated cuticular membranes 

from different plant species were mounted in transpiration chambers 

and cuticular water permeability was quantified as a measure of the effect of 

microorganisms on leaf surface barrier properties. 

Cuticular water permeability of selected species (Vinca major L., Hedera 

helix canariensis L. and Prunus laurocerasus L.) was measured before and 

after inoculation with Pseudomonas fluorescens, which was chosen as a characteristic 

and representative epiphyllic microorganism. With all three investigated 

species, cuticular water permeability significantly increased by factors 

between 40 to 60 % after inoculation with P. fluorescens for 10–12 days (Fig. 5). 

In parallel to the observed increase in cuticular water permeability, it was 

always observed that the bacteria had successfully penetrated the cuticle, 

since bacteria were growing on the inner side of the isolated cuticle, which 

was sterile at the beginning of the experiment. From this observation, it must 

be concluded that the bacteria had induced additional defects to the transport 

barrier of the cuticle, leading to increased rates of water permeability as well 

as paths for penetrating the cuticle (Knoll 1998).

However, at the moment, the mechanism as to how this was achieved by the 

bacteria is not clear. One possibility might be a dissolution of the cutin polymer 

by extracellular bacterial enzymes. Alternatively, one could also image a 

pure physical basis. It was shown in the past that cuticular permeability for 

water and many dissolved compounds can be increased by surfactants 

(Riederer and Schönherr 1990). A similar mechanism might be used by 

microorganisms, since for many of them it has been shown that they are able 

to synthesise biosurfactants (Persson et al. 1988; Bunster et al. 1989; Karanth 

et al. 1999). Moreover, it also may not be forgotten that in reality there are living 

epidermal cells below the cuticle. They probably will significantly contribute 

to inhibiting leaf surface microorganisms from penetrating the cuticle, 

which is not the case in the artificial system using isolated cuticular 

membranes. Future work will have to concentrate on this important question 

of the interaction between epiphyllic microorganisms and the plant cuticle. 

6 Conclusions 


Fig. 5. Interaction 

between Pseudomonas 

fluorescens growing on 

isolated cuticles of different 

plant species and 

cuticular water permeability. 

The effect, which 

was calculated from the 

ratio of cuticular water 

permeability after inoculation 

divided by cuticular 

transpiration before 

inoculation, indicates the 

relative increase in cuticular 

water permeability 

after inoculation with 

bacteria 

effect (P2/P1) 

2.5 

2.0 

1.5 

1.0 

0.5 

0.0 

Pseudomonas fluorescens 

control 

Vinca 

major 

Hedera 

helix can. 

Prunus 

laurocerasus 

In conclusion, it must be stated that lipophilic surfaces of leaves form microhabitats 

for many microorganisms, although living conditions in terms of 

water and nutrient availability and climatic conditions in the phyllosphere are 

far from optimal. Specific interactions between epiphyllic microorganisms 

and the plant cuticle, leading to increased leaf surface wetting and elevated 

rates of cuticular permeability, have been shown to occur. Nevertheless, there 

is still a series of questions which deserves further attention in future 

research. Using molecular biological tools, a more realistic description of the

154 


diversity of the species composition in the phyllosphere must be achieved. 

Physiological experiments will have to analyse in more detail the mechanisms 

forming the basis for the different interactions occurring between epiphyllic 

microorganisms and the plant cuticle. Furthermore, an important question is 

to what extent the aggregation of different epiphyllic species forming biofilms 

increases their ecological fitness in the phyllosphere. Answering these questions 

in the future will significantly help to improve our knowledge of the 

microbial ecology of the phyllosphere. 

Acknowledgements. The authors gratefully acknowledge financial support of this work 

by the Deutsche Forschungsgemeinschaft and the FCI. 


Agrios GN (1995) Plant pathology. San Diego, Academic Press 

Amann R, Ludwig W, Schleifer KH (1995) Phylogenetic identification and in situ detection 

of individual microbial cells without cultivation. Microbiol Rev 59:143–169 

Andrews JH (1992) Biological control in the phyllosphere. Annu Rev Phytopathol 

30:603–635 

Andrews JH, Harris RF (2000) The ecology and biogeography of microorganisms of 

plant surfaces. Annu Rev Phytopathol 38:145–180 

Barthlott W, Neinhuis C (1997) Purity of the sacred lotus, or escape from contamination 

in biological surfaces. Planta 202:1–8 

Beattie GA, Lindow SE (1995) The secret life of foliar bacterial pathogens on leaves.Annu 

Rev Phytopathol 33:145–172 

Beattie GA, Lindow SE (1999) Bacterial colonization of leaves: a spectrum of strategies. 

Phytopathology 89:353–359 

Bianchi G (1995) Plant waxes. In: Hamilton RJ (ed) Waxes: chemistry, molecular biology 

and functions. The Oily Press, Dundee, pp 175–222 

Blakeman JP (1991) Foliar bacterial pathogens: epiphytic growth and interactions on 

leaves. J Appl Bacteriol 70:49–59 

Blakeman JP (1993) Pathogens in the foliar environment. Plant Path 42:479–493 

Bunster L, Fokkema NJ, Schippers B (1989) Effect of surface-active Pseudomonas sp. on 

leaf wettability. Appl Environ Microbiol 55:1340–1345 

Cape JN (1983) Contact angles of water droplets on needles of Scots pine (Pinus sylvestris) 

growing in polluted atmospheres. New Phytol 93:293–299 

Cape JN, Percy KE (1993) Environmental influences on the development of spruce needle 

cuticles. New Phytol 125:787–799 

Dickinson CH, Preece TF (1976) Microbiology of aerial plant surfaces. Academic Press, 

London 

Dixon RA, Lamb CJ (1990) Molecular communication in interactions between plants 

and microbial pathogens. Annu Rev Plant Phys Plant Mol Biol 41:339–367 

Ercolani GL (1991) Distribution of epiphytic bacteria on olive leaves and the influence of 

leaf age and sampling time. Microb Ecol 21:35–48 

Fiss M, Kucheryava N, Schonherr J, Kollar A, Arnold G, Auling G. (2000) Isolation and 

characterization of epiphytic fungi from the phyllosphere of apple as potential biocontrol 

agents against apple scab (Venturia inaequalis). J Plant Dis Prot 107:1–11


Fokkema NJ, van den Heuvel J (1986) Microbiology of the phyllosphere.Academic Press, 

New York 

Fox RC (1958) The relationship of wax crystal structure to the water vapor transmission 

rate of wax films. Tech Assoc Pulp Paper Ind 41:283–289 

Gülz PG (1994) Epicuticular leaf waxes in the evolution of the plant kingdom. J Plant 

Physiol 143:453–464 

Holloway PJ (1970) Surface factors affecting the wetting of leaves. Pest Sci 1:156–163 

Jacques MA, Morris CE (1995) A review of issues related to the quantification of bacteria 

from the phyllosphere. FEMS Microbiol Ecol 18:1–14 

Jeffree CE (1986) The cuticle, epicuticular waxes and trichomes of plants, with reference 

to their structure, functions and evolution. In: Juniper BE, Southwood R (eds) Insects 

and plant surfaces. Edward Arnold, London, pp 23–64 

Karanth NGK, Deo PG, Veenanadig NK (1999) Microbial production of biosurfactants 

and their importance. Curr Sci 77:116–126 

Kerstiens G (1996) Signalling across the divide: a wider perspective of cuticular structure–function 

relationships. Trends Plant Sci 1: 125–129 

Kinkel LL (1991) Microbial population dynamics on leaves. Annu Rev Phytopathol 

35:327–347 

Knoll D (1998) Die Bedeutung der Kutikula bei der Interaktion zwischen epiphyllen 

Mikroorganismen und Blattoberflächen. PhD Thesis, University of Würzburg, Germany 

Knoll D, Schreiber L (1998) Influence of epiphytic micro-organisms on leaf wettability: 

wetting of the upper leaf surface of Juglans regia and of model surfaces in relation to 

colonization by microorganisms. New Phytol 140:271–282 

Knoll D, Schreiber L (2000) Plant-microbe interactions: wetting of ivy (Hedera helix L.) 

leaf surfaces in relation to colonization by epiphytic microorganisms. Microb Ecol 

41:33–42 

Kolattukudy PE (2001) Polyesters in higher plants. Adv Biochem Engin Biotech 71:1–49 

Larcher W (1996) Physiological plant ecology: ecophysiology and stress physiology of 

functional groups. Springer, Berlin Heidelberg New York 

Leben C (1988) Relative humidity and the survival of epiphytic bacteria with buds and 

leaves of cucumber plants. Phytopathology 78:179–185 

Marilley L,Vogt G, Blanc M,Aragno M (1998) Bacterial diversity in the bulk soil and rhizosphere 

fractions of Lolium perenne and Trifolium repens as revealed by PCR 

restriction analysis of 16S rDNA. Plant Soil 198:219–224 

Markstädter C, Federle W, Jetter R, Riederer M, Hölldobler B (2000) Chemical composition 

of the slippery epicuticular wax blooms on Macaranga (Euphorbiaceae) antplants. 

Chemoecology 10:33–40 

Mendgen K (1996) Fungal attachment and penetration. In: Kerstiens G (ed) Plant cuticles: 

an integrated functional approach. BIOS Scientific Publishers, Oxford, pp 

175–188 

Morris CE, Monier JM, Jacques MA (1997) Methods for observing microbial biofilms 

directly on leaf surfaces and recovering them for isolation of culturable microorganisms. 


Morris CE, Monier JM, Jacques MA (1998) A technique to quantify the population size 

and composition of the biofilm component in communities of bacteria in the phyllosphere. 


Morris CE, Nicot PC, Nguyen CN (1996) Aerial plant surface microbiology. Plenum 

Press, New York 

Neinhuis C, Barthlott W (1998) Seasonal changes of leaf surface contamination in beech, 

oak, and gingko in relation to leaf micromorphology and wettability. New Phytol 

138:91–98

156 


Nobel PS (1991) Physicochemical and environmental plant physiology. Academic Press, 

San Diego 

Ogram A (2000) Soil molecular microbial ecology at age 20: methodological challenges 

for the future. Soil Biol Biochem 32:1499–1504 

Persson A, Oesterberg E, Dostalek M (1988) Biosurfactant production by Pseudomonas 

fluorescens 378: growth and product characteristics. Appl Microbiol Biotech 29:1–4 

Preece TF, Dickinson CH (1971) Ecology of leaf surface microorganisms. Academic 

Press, London 

Reynhardt EC Riederer M (1994) Structures and molecular dynamics of plant waxes. II 

Cuticular waxes from leaves of Fagus sylvatica L. and Hordeum vulgare L. Eur Biophys 

J 23:59–70 

Riederer M, Markstädter C (1996) Cuticular waxes: a critical assessment of current 

knowledge. In: Kerstiens G (ed) Plant cuticles: an integrated functional approach. 

BIOS Scientific Publishers, Oxford, pp 189–200 

Riederer M, Schönherr J (1990) Effects of surfactants on water permeability of isolated 

plant cuticles and on the composition of their cuticular waxes. Pest Sci 29:85–94 

Riederer M, Schreiber L (1995) Waxes: the transport barriers of plant cuticles. Plant 

waxes. In: Hamilton RJ (ed) Waxes: chemistry, molecular biology and functions. The 

Oily Press, Dundee, pp 131–156 

Romantschuk M (1992) Attachment of plant pathogenic bacteria to plant surfaces. Annu 

Rev Phytopathol 30:225–243 

Schäfer W (1998) The involvement of fungal cutinase in early processes of plant infection. 

Mol Genet Host-Specific Toxins Plant Dis 13:273–280 

Schönherr J, Baur P (1996) Cuticle permeability studies: a model for estimating leaching 

of plant metabolites to leaf surfaces. In: Morris CE, Nicot PC, Nguyen CN (eds) Aerial 

plant surface microbiology. Plenum Press, New York, pp 1–23 

Schönherr J, Riederer M (1989) Foliar penetration and accumulation of organic chemicals 

in plant cuticles. Rev Environ Cont Toxicol 108:1–70 

Schreiber L (1996) Wetting of the upper needle surface of Abies grandis: influence of pH, 

wax chemistry and epiphyllic microflora on contact angles. Plant Cell Environ 

19:455–463 

Schreiber L, Schönherr J (1993) Determination of foliar uptake of chemicals: influence of 

leaf surface microflora. Plant Cell Environ 16:743–748 

Schreiber L, Schorn K, Heimburg T (1997) 2 H NMR study of cuticular wax isolated from 

Hordeum vulgare L. leaves: identification of amorphous and crystalline wax phases. 

Eur Biophys J 26:371–380 

Stadler B, Müller T (1996) Aphid honeydew and its effect on the phyllosphere microflora 

of Picea abies (L.) Karst. Oecologia 108:771–776 

Tiedje JM, Asuming Brempong S, Nusslein K, Marsh TL, Flynn SJ (1999) Opening the 

black box of soil microbial diversity. Appl Soil Ecol 13:109–122 

Tukey HB (1970) The leaching of substances from plants. Annu Rev Plant Phys 21: 

305–324 

Turunen M, Huttunen S (1989) A review of the response of epicuticular wax of conifer 

needles to air pollution. J Environ Qual 19:35–45 

van Gardingen PR, Grace J, Jeffree CE (1991) Abrasive damage by wind to the needle surfaces 

of Picea sitchensis (Bong) Carr and Pinus sylvestris L. Plant Cell Environ 

14:185–193 

Walton TJ (1990) Waxes, cutin and suberin. Meth Plant Biochem 4:105–158 

Yang CH, Crowley DE, Borneman J, Keen NT (2001) Microbial phyllosphere populations 

are more complex than previously realized. Proc Natl Acad Sci USA 98:3889–3894

10 Developmental Interactions Between 

Clavicipitaleans and Their Host Plants 

James F. White Jr., Faith Belanger, Raymond Sullivan, 

Elizabeth Lewis, Melinda Moy, William Meyer 

and Charles W. Bacon 


Clavicipitalean fungi have evolved to survive as saprophytes, degrading 

organic material, as well as biotrophs of plants, fungi, nematodes, and insects. 

They have become particularly successful as epibionts and endophytes of 

grasses. We believe that the associations between clavicipitalean fungi and 

their hosts constitute unique biotrophic symbioses where the stages of physiological 

adaptation to the plant host may be examined to gain an understanding 

of how evolution among these fungi has progressed. 

2 Endophyte/Epibiont Niche 

In recent years, awareness has developed that many microbes colonize and 

inhabit interior and exterior surfaces of plants. Many microbes may colonize 

plants without eliciting defense responses from host plants or causing disease 

symptoms (Bacon and White 2000). The benefits to plants of hosting beneficial 

microbes are numerous. Diazotrophic bacterial endophytes in sugarcane 

have been shown to fix atmospheric nitrogen that enables hosts to grow indefinitely 

in soils low in available nitrogen. Bacillus subtilis-infected seedlings of 

many plants have been shown to have an enhanced growth rate and survival 

in pathogen-laden soils. Tall fescue seedlings infected by the endophyte Neotyphodium 

coenophialum show enhanced resistance to “damping off” disease 

caused by Rhizoctonia solani (Gwinn and Gavin 1992). Mature plants of F. 

arundinacea show increased drought tolerance and resistance to above 

ground and below ground insect and nematode pests (Gwinn et al. 1991). 

Similarly, several grasses infected by the endophytes Epichloë typhina, E. festucae, 

and E. clarkii were found to deter the feeding of migratory locusts; 

while endophyte-free plants were readily consumed by the locusts (Lewis et 

al. 1993). Arizona fescue (Festuca arizonica) infected by a Neotyphodium 




158 

James F. White Jr. et al. 

endophyte has not been found to possess insect deterrent properties, instead 

growth enhancements have been proposed (Faeth et al. 2000). Finally several 

species of fine fescues infected by Epichloë festucae were found to have an 

increased resistance to the dollar spot disease caused by Sclerotinia homeocarpa. 

It seems evident that plants benefit tremendously from the colonization of 

symbiotic microbes. The benefits to hosting mutualistic microbes likely outweigh 

losses in terms of nutrient use by the microbes. The widespread level of 

infection of grasses by Epichloë and asexual forms in Neotyphodium are evidence 

that these associations also have evolutionary value. In one study of 

endophytes in grasses, infection levels in some hosts (e.g., Achnatherum 

robustum and Festuca versuta) were estimated to be greater than 90 % in populations 

throughout the ranges of the grasses (White 1987). 

3 Coevolution of Clavicipitalean Fungi with Grass Hosts 

It is evident that Epichloë (Clavicipitaceae; Ascomycetes) and related asexual 

endophytes have co-evolved with the cool-season (C-3) grasses in which they 

perennate (White 1988). Species of these endophytes are unknown from 

warm-season (C-4) grasses (White 1987). On the other hand, endophytic 

species in genus Balansia, also in family Clavicipitaceae, appear to have coevolved 

with warm-season grasses and are rarely or never found on cool-season 

hosts (White and Owens 1992). In co-evolving with grasses, it is logical to 

expect that their interactions with hosts became more sophisticated. 

4 The Jump from Insects to Plants 

4.1 Trans-Kingdom Jump 

Analysis of rDNA 26S sequence data indicates that the predominantly insectinfecting 

subfamily Cordycipitoideae (Clavicipitaceae) is the most deeply 

rooted group and is, therefore likely ancestral to grass-infecting species (Sullivan 

et al. 2000).A trans-kingdom host jump is postulated to have occurred to 

plants. Such a jump could have occurred gradually through intermediate 

forms that were parasitic on both insects and plants. 

4.2 Intermediate Stages in the Transition to Plants 

Several Cordycipitoideae exhibit stages of such a transition. Most of the 

Cordycipitoideae (e.g., Cordyceps militaris and C. sinensis) infect insect hosts 

and mummify them, using their necrotrophied bodies as energy to fuel fun-

10 Development Interactions Between Clavicipitaleans and Their Host Plants 159 

gal development (Tzean et al. 1997). In these associations, there is no association 

with plants and no opportunity for the fungi to adapt to plants as hosts. 

However, some species of Cordycipitoideae infect scale insects that are sedentary 

and parasitic on plant hosts by use of stylets with which they penetrate 

and suck sugars from host vascular tissues. In these species some simple 

adaptations for parasitism of plants are evident. In Hypocrella africana, H. 

gaertneriana,andH. schizostachyi, infection of the scale insect is biotrophic 

with the fungus obtaining nutrients from the plant through the living body of 

the insect (Hywel-Jones and Samuels 1998). Here, the parasitized scale insect 

is a bridge to obtain plant nutrients; however, the fungus does not interface 

directly with the plant in any way. This is an indirect adaptation to parasitism 

on plants. The quantity of nutrients available to Hypocrella in this type of 

association far exceeds that available in the body of the insect. Hywel-Jones 

and Samuels (1998) estimated that the stroma attained some 1000 times or 

more the mass of the body of the insect. Hyperdermium bertonii exhibits 

another step toward direct parasitism of plants. This species infects scale 

insects, necrophytizes them, then develops epibiotically on the surface of the 

plant, nourishing itself on sugars that continue to flow from the stylet wound 

left by the scale insect (Sullivan et al. 2000). Although H. bertonii relies on 

scale insects to prepare its parasitism site on plants, it directly absorbs and 

utilizes plant sugars. It is also possible that H. bertonii produces compounds 

that interfere with scar tissue development to prevent the stylet wound from 

sealing. This possibility should be further evaluated. However, at present we 

have no evidence that wound retardant compounds or growth regulator compounds 

are being produced by H. bertonii. Regardless, it is evident that H. 

bertonii has taken physiological steps in adapting to growth on plant sugars. 

In experiments, conducted in vitro where H. bertonii is grown on a minimal 

medium containing minerals and combinations of simple sugars glucose and 

fructose, we have demonstrated that mycelium and conidial production are 

stimulated by equal ratios of glucose to fructose; while higher levels of fructose 

in media induce the fungus to differentiate pigmentation and its mature 

stromal morphology. Hyperdermium bertonii has adapted to utilize changes 

in host sugar content on which it nourishes itself to guide its development. 

Sucrose, leaking directly from the stylet wound, is cleaved to its component 

monomers glucose and fructose. The glucose is likely preferentially absorbed. 

As a result, fructose is left behind to accumulate in the liquid film of sugars on 

which the fungus grows. Increasing concentrations of fructose, or the fructan 

polymers of it, are the probable cues employed by the epiphyte to shift its 

growth from early stroma development to differentiation and maturation. 

The possession of invertases by H. bertonii may also be evidence of adaptation 

to plants. Sucrose is only available in plant tissues. It is a short step from 

the condition of Hyperdermium to infection of plants without the use of 

insects.

160 


4.3 Parasitism of Grass Meristematic Tissues 

On the meristematic tissues of grasses, wounds created by insects are unnecessary 

since the tissues of meristems, such as the inflorescence primordia, are 

bathed in sucrose. Atkinsonella hypoxylon illustrates this point. Atkinsonella 

hypoxylon grows superficially on young leaves of grasses as an epiphyte, perhaps 

degrading wax in the cuticle to obtain nutrients for epiphytic growth 

(White et al. 1991). When the grass begins to produce an inflorescence primordium, 

sucrose is mobilized into the primordium to provide energy for its 

development. The primordium is surrounded by nutrients in liquid, which in 

turn is surrounded by layers of developing leaves. It is believed that the sudden 

increase in sucrose availability and concentration triggers rapid mycelial 

growth that eventually results in formation of the stroma (White and Chambless 

1991). It is interesting that leaves and inflorescence primordia within the 

stroma never develop a cuticular layer that would impede flow of nutrients 

and moisture to the fungus. Prevention of cuticular development and prevention 

of maturation of the inflorescence primordial tissues may be a growth 

regulator effect, although they have not yet been identified for this species. 

5 Developmental Differentiation of Endophytic and 

Epiphyllous Mycelium 

5.1 Plant Cell Wall Alteration 

Epichloë sp. illustrate many of the physiological capacities needed by 

Clavicipitaceae to colonize grasses (White et al. 1991). Epichloë inhabits leaf 

sheaths and growing tillers of grass plants. Endophytic mycelium is largely 

nonbranched and exclusively intercellular (Fig. 1) and often seen to adhere 

closely to parenchyma cell walls as if attached by glue. This may be due to the 

partial degradation of cell wall components by the endophytic mycelium. 

While it is possible that cell walls are modified by endophytes, they remain 

largely intact as evidenced by electron microscopic studies. It is notable that 

during stroma development, profound changes have been observed in cell 

walls of the grass epidermis.Walls of epidermal cells appear to lose structural 

integrity with mycelium of the endophyte frequently penetrating the wall 

(Fig. 2). 

5.2 Endophytic Mycelial Growth 

Endophytic mycelium in young leaves or elongating tillers is frequently narrow 

(1 mm across), straight, oriented parallel to the axis of expansion of the 

cells and plant organ (Fig. 3). Sometimes in very young tissues, the hyphae


Fig. 1. Electron micrograph (TEM) showing hyphae (arrows) of Epichloë amarillans in 

intercellular spaces of vascular tissues of the grass Agrostis hiemalis (¥10,000)

162 


Fig. 2. Electron micrograph (TEM) showing hyphae (arrows) of Epichloë amarillans 

penetrating epidermal tissues of the grass Agrostis hiemalis (¥10,000) 

may be observed to taper to a fine point on the ends where it has been 

stretched and sheered during elongation of the plant tissues. Sheered hyphae 

are seen to recover rapidly with elongation of the sheared ends of the endophytic 

hyphae. In later stages of growth, the endophytic hyphae fully elongate, 

then become convoluted, apparently due to excessive elongation. This has the 

effect of increasing the surface area of the cell wall that an individual hypha 

may come into contact with. Whether an increased contact surface area 

results in increased nutrients leaking from the parenchyma cells to the endophytic 

mycelium is yet to be determined. Such endophytic mycelium is abundant 

in leaf sheaths where many nutrients are stored, but they are rare in the 

leaf blades where photosynthesis is occurring. It is the abundant presence of 

photosynthate within the cells of the leaf sheath that likely accounts for the 

abundance of mycelium in this tissue.


Fig. 3. Section of developing 

Agrostis hiemalis culm 

showing endophytic hypha 

(arrow) oriented parallel 

to the direction of culm 

elongation (¥1000) 

5.3 Control of Endophytic Mycelial Development 

Endophytic mycelium is never observed to produce conidia within tissues of 

the plant. One experiment suggests that conidial development and branching 

are suppressed by unknown factors present within tissues of the leaf sheath 

parenchyma. Media containing basal salts (Murashige and Skoogs), agar 

(1 %), ground leaf sheath tissues of Agrostis hiemalis (0.5 % dry wt.), and low 

concentrations of glucose (0.5 %) produced mycelium of E. amarillans that 

sparsely branched and rarely produced conidiogenous cells, while controls 

that lacked only the ground leaf sheath tissues, branched and produced conidia 

abundantly. 

5.4 Epiphyllous Mycelial Development 

Some species of Epichloë and their asexual derivatives have been found to 

produce an epiphyllous stage where they grow superficially on the surface of

164 


leaf blades. Epiphyllous mycelium tends to be present in the groves at cell 

junctions of the epidermis, may adhere closely to the cuticular surface, is frequently 

branched, and produces abundant wind-disseminated conidia (White 

et al. 1996; Moy et al. 2000). The epiphyllous network of mycelium and conidia 

are frequently connected to internal sources of nutrients by intercellular 

bridges, but are shielded from direct association with the interior leaf substances 

by the waxy cuticle layer on which it spreads. There is no evidence that 

species of Epichloë have the capacity to degrade cuticular waxes. Previous 

studies of the capacity of various Clavicipitaceae to colonize and degrade 

paraffin showed that Epichloë does not colonize paraffin beads in agar culture 

and apparently cannot degrade waxes to gain nutrients, although other 

Clavicipitaceae, such as the predominantly epiphytic Atkinsonella hypoxylon, 

do posses that capacity (White et al. 1991). 

5.5 Expression of Fungal Secreted Hydrolytic Enzymes 

in Infected Plants 

All fungi, whether saprophytic, pathogenic, or mutualistic, acquire their carbon 

and nitrogen by absorption of small molecules from their surroundings. 

Fungi typically secrete numerous enzymes that function in degradation of 

polymeric substances in the environment to their monomeric constituents 

that can then be absorbed by the fungal cells. 

Endophytic fungi are exclusively intercellular and do not invade the plant 

cells. They must, therefore obtain all their carbon and nitrogen compounds 

from the nutrient-poor apoplastic space. Endophytic fungal-secreted proteins 

are likely to be important components of the mutualistic interaction as they 

are located at the interface of the two species. Fungal secreted proteins are 

expected to be synthesized for growth and nutrient acquisition and perhaps 

for defense. 

We have detected expression of several fungal-secreted enzymes in Poa 

ampla infected with a Neotyphodium sp. endophyte. A fungal subtilisin-like 

proteinase was purified from infected leaf sheaths and cDNA and genomic 

clones for the gene were characterized (Lindstrom and Belanger 1994; Reddy 

et al. 1996). The fungal proteinase was found to be expressed at surprisingly 

high levels in the infected plant tissues. It was estimated to be 1–2 % of the 

total leaf sheath protein, suggesting it was a major fungal protein. The amino 

acid sequence of the proteinase is homologous to proteinases believed to be 

important in pathogenicity of entomopathogenic, nematophagous, and mycoparasitic 

fungi (Geremia et al. 1993; Bonants et al. 1995; St. Leger 1995). 

A fungal secreted endochitinase and an endo-b-1,6-glucanase are also 

expressed in the infected P. ampla plants. Sequencing of cDNA clones for the 

chitinase and glucanase revealed they are 38 and 74 % identical, respectively, 

to the homologous enzymes from Trichoderma harzianum. T. harzianum is a


potent mycoparasite of many plant pathogenic fungi (Papavizas 1985; Chet 

1987). Because of this property, it is being investigated as a potential biocontrol 

agent in crop production. 

The physiological roles of the endophytic proteinase, chitinase, and endob-1,6-glucanase 

are not yet known. The endophytic chitinase transcript is 

very abundant as determined from a blot of total RNA isolated from the 

infected plants. This is similar to the situation with the endophytic proteinase 

(Reddy et al. 1996). The endo-b-1,6-glucanase appears to be expressed at 

lower levels. Several roles have been proposed for chitinases and endoglucanases 

from filamentous fungi. Roles in hyphal growth, branching, and 

autolysis have been proposed (Bartnicki-Garcia 1973; Gooday and Gow 1990; 

Peberdy 1990) as well as roles in mycoparasitism. Functions in fungal growth 

and/or in mycoparasitism would be relevant to endophytic infection. Interestingly, 

the homologous proteinase, chitinase, and endo-b-1,6-glucanase from 

T. harzianum are believed to be synergistic components of its mycoparasitic 

activity (Geremia et al. 1993; Garcia et al. 1994; Lora et al. 1995). These 

hydrolytic enzymes function together to break down the cell walls of the fungal 

hosts allowing entry of the T. harzianum hyphae. 

Expression of these hydrolytic enzymes in endophyte-infected plants 

raises the possibility that they may also function as a mycolytic system for the 

endophyte. Such a system could provide the endophyte with a source of nutrients 

in addition to plant derived nutrients found in the apoplast. With a 

mycolytic system, the endopytic hyphae located on the surface of the plant 

(Moy et al. 2000) would have access to additional sources of nutrients from 

other surface-located fungi. By attacking invading fungi, an endophytic 

mycolytic system could also protect the plants from pathogenic fungi, perhaps 

resulting in enhanced disease resistance. Current research is aimed at 

determining the roles of these enzymes in endophyte infection. 

6 Modifications of Plant Tissues for Nutrient Acquisition 

6.1 Development of the Stroma in Epichloë 

The development of sexual reproductive structures in plants poses some special 

problems for Clavicipitaceae. Larger quantities of nutrients are needed to 

provide the fuel for construction of the external mycelial stroma on which are 

produced first spermatia, then perithecia and ascospores (White and Bultman 

1987; Bultman et al. 1995). To obtain large quantities of nutrients from hosts, 

many other groups of biotrophic fungi,e.g.,powdery mildews,downy mildews, 

and rusts may produce haustoria to suck nutrients from individual host cells 

(Alexopoulos et al. 1996). However, clavicipitalean plant biotrophs have 

another strategy.They grow on meristematic tissues before the cuticle has been 

formed and by some unknown mechanism prevent development of the waxy

166 


cuticle and alter the epidermis itself, effectively removing a key barrier to the 

flow of nutrients to the stromal mycelium. The following two examples will 

illustrate this method of nutrient acquisition by these clavicipitaleans. In 

Epichloë the abundance of sucrose in the developing inflorescence primordium 

triggers the fungus to proliferate rapidly and permeate the young 

inflorescence and the leaf sheath of a leaf that surrounds it.This process is comparable 

to that already suggested for stroma development in Atkinsonella 

hypoxylon, except that in Epichloë the mycelium is endophytic and frequently 

permeates vascular tissues as well as nonvascular tissues (White et al. 1991). 

The stroma is composed of a mix of plant tissues and fungal mycelium. These 

stromata are much like those of the scale insect parasites Hypocrella africana, 

H. gaertneriana,andH. schizostachyi,in that the host tissues embedded within 

the stromata remain alive, but are modified so that nutrients will flow freely 

into the developing stromata. Plant tissues embedded within the stroma are 

not only permeated by mycelium, but also possess epidermal cells that are 

hypertrophied, often collapsed, and lack waxy cuticles (White et al. 1997). 

Through these modifications of the host tissues, the endophyte removes all 

barriers to nutrient flow into the stromal mycelium. The development of 

mycelium within the vascular bundle enhances the transfer of nutrients to the 

fungal stroma. By mummifying the living inflorescence primordium and the 

sheath of the leaf that surrounds it, the fungus can intercept all nutrients that 

are transported into the flowering tiller. Mature stromata of Epichloë always 

possess the stromal leaf blade emergent from the top of the stroma (Fig.4).The 

reason for this emergent leaf blade is unknown, but may be a source of plant 

hormones that are needed as a signal to the plant to continue to send nutrients 

into the culm. Experimental work is needed to evaluate this hypothesis. 

6.2 Stroma Development in Myriogenospora 

A second clavicipitalean biotroph that modifies host tissues for nutrient 

acquisition during stroma development is the epiphytic fungus Myriogenospora 

atramentosa. Myriogenospora atramentosa grows superficially on 

the epidermis of young leaves at the crown of many warm-season grasses and 

sedges. As the leaves develop, conidia of M. atramentosa proliferate on the 

folded leaves of the grass. The leaves continue to expand and the conidial 

stroma develops into a linear black perithecial stroma, composed of a single 

line of perithecia (Figs. 5, 6). The plant leaf tissues beneath the stroma are 

modified with hypertrophied epidermal cells that lack a cuticular layer 

(Rykard et al. 1985; White and Glenn 1994). The absence of a cuticle layer on 

the leaf epidermis and modification of the epidermal cells by the fungus permits 

M. atramentosa to absorb nutrients directly through the epidermis of the 

leaf blades to provide energy for stroma development.


Fig. 4. Stroma (arrow) of Epichloë 

amarillans showing white stromal 

mycelium and apical stromal leaf 

(¥3) 

Fig. 5. Black, linear, stroma (arrow) of Myriogenospora 

atramentosa on upper surface of 

leaf of Andropogon sp. (¥2)

168 


6.3 Mechanisms for Modifying Plant Tissues 

Fig. 6. Cross-section of 

stroma of Myriogenospora 

atramentosa showing a single 

perithecium (arrow) bordered 

by the leaf blades on 

either side (¥500) 

The mechanisms whereby the Clavicipitaceae alter development of plant tissues 

is unknown. One hypothesis is that at least some of their secondary 

products may have growth regulator effects. In this respect, it is notable that 

several Clavicipitaceae, including Epichloë festucae and Balansia epichloë 

have been shown to produce the plant auxin indole acetic acid (IAA; Porter et 

al. 1985; Yue et al. 2000). Indeed, other indole derivatives such as the ergot 

alkaloids may also possess auxin-like effects. One effect that auxin has is to 

loosen cell wall fibers, allowing cells to expand. 

Moubarak et al. (1993) demonstrated that ergovaline, an ergot alkaloid 

commonly produced by Epichloë/Neotyphodium endophytes, interferes with 

cell membrane polarization and ATPase activities in animal tissues. These 

data suggest a potential mechanism by which ergot alkaloids may alter physiology 

and structure of plant tissues and acquire nutrients from those tissues. 

If ergot alkaloids, such as ergovaline, inhibit ATPases in grass cells, they may 

enhance leakage of nutrients from cells adjacent to mycelium. Without use of 

ATPases, plant cells would be incapable of utilizing active transport proteins 

to reacquire leaking nutrients.Almost no research has been pursued to evalu-


ate impacts of clavicipitalean-produced secondary metabolites on plant tissues 

themselves. The current scientific wisdom holds that clavicipitalean secondary 

metabolites have impacts on animal tissues as feeding deterrents and 

other defensive compounds. Whether ergot alkaloids, auxin-like compounds 

or other secondary metabolites of these fungi are involved in effecting 

changes in plant tissues embedded within or adjacent to stromal mycelium 

must be further evaluated. It seems likely that this will be a fruitful area for 

future investigation. 

6.4 Evaporative-Flow Mechanism for Nutrient Acquisition 

The stroma of Epichloë maintains a constant flow of water and nutrients into its 

mycelium through an evaporation-driven process (White and Camp 1996; 

White et al. 1997). Water evaporates rapidly from the surface of stromata. As 

water evaporates from the stroma it is replaced by water from the plant. This 

process establishes a flow of water and dissolved nutrients into the stroma from 

mycelium interfacing with the vascular bundles and other tissues embedded 

within the stroma. Evaporative flow mimics the enhanced transpiration that 

occurs in developing inflorescences during elongation of the flowering tillers 

of uninfected grasses, but here the stroma is the recipient of the nutrients. 

6.5 The Cytokinin Induction Hypothesis 

In Atkinsonella hypoxylon stromata form on the inflorescence primordium 

and include parts of several leaves as well (Fig. 7). The stromata are gray 

(sometimes with areas of a yellow pigment) and produce several different 

spore states, including cup-shaped sporodochia that produce moist masses of 

ephelidial conidia, and a layer of neotyphodial conidia borne on tips of elongate 

conidiogenous cells. It is reasonable to expect that the fungus would 

coordinate its development with that of its host grass. For example, the fungus 

mycelium must be able to detect when it is growing on an inflorescence primordium 

rather than on the tiller meristems. On the tiller meristems it will 

produce a low biomass of nonpigmented mycelium and ephelidial conidia, 

but no neotyphodial conidia or other structures; while on the inflorescence 

primordium the entire suite of morphological structures is produced. One 

way for the fungus to coordinate its development to that of the host plant 

would be to use compounds present in the host during different stages of 

development as ‘cues’ to initiate developmental stages in the fungus. Our 

approach to the search for host compounds that may serve as cues for fungal 

development has been a trial and error approach. Over several years, we have 

screened hundreds of compounds that might be present in grass tissues to 

determine how they affect differentiation of A. hypoxylon.

170 


Fig. 7. Two stromata 

(arrows) of Atkinsonella 

hypoxylon on culms of 

Danthonia spicata (¥4) 

Studies on Atkinsonella hypoxylon and A. texensis in vitro have demonstrated 

that certain media additives will induce the fungus to develop in a way 

comparable to that seen on the host grass inflorescence primordia (Bacon and 

White 1994). When these claviciptaleans are grown on media containing agar 

(1 %), basal salts (Murashige and Skoog; Sigma Chemical Company, Inc.), and 

glucose (3 %), colonies are white, with no aerial mycelium or conidia of any 

type. This is an undifferentiated mycelium, the fungus equivalent of ‘callus tissue’. 

Stroma-like colonies with gray pigmentation, sporodochia producing 

ephelidial conidia, and a layer of neotyphodial conidiogenous cells and conidia 

can be induced by inclusion of 100 ppm of the cytokinin zeatin or kinetin 

(Research Organics, Inc. Cleveland, Ohio) in the medium. The stroma-like 

states in culture are most striking when the grass cytokinin zeatin is 

employed. Partial induction of stroma-like states may be induced through use 

of 1 % citrate (sodium or potassium salt) and 0.1–0.5 % acetate (sodium or 

potassium salt). With acetate in the medium the gray pigmentation is seen to 

develop, but differentiated reproductive cells do not form. With citrate in the 

medium, pigmentation, sporodochia and ephelidial conidia form, but the 

neotyphodial conidia do not form. Because induction of differentiation is 

incomplete with the use of acetate and citrate, we believe that these compounds 

are not the primary cues for stroma differentiation, but instead may 

be indirectly causing differentiation by turning on secondary metabolism 

pathways. On the other hand, cytokinins are plant hormones and are expected 

to be present in the developing ovary tissues embedded within the fungal 

stroma since ovaries produce cytokinins for regulation of their own development 

(Miller 1961; Mauseth 2003). Thus the presence of cytokinins may be a


key signal for the fungus to begin a sequence of developmental events that 

end in production of the mature stroma. Some preliminary differential display 

studies were also conducted to examine genes that may be upregulated 

and downregulated when A. hypoxylon was exposed to cytokinin. The results 

of these differential display studies showed that several genes were turned on 

while several others were turned off, however, none of the genes were identified. 

One preliminary study on another clavicipitalean-producing stromata 

on inflorescence primordia, Epichloë festucae, employed a monoclonal antibody-based 

cytokinin detection kit (Phytodetek-t-ZR, Sigma, St. Louis, Missouri) 

to compare levels of cytokinin in stromata and other tissues of the 

grass. The result of this test suggested that cytokinin was present in high concentrations 

within the stromata. However, this test must be considered preliminary 

because of the possibility for cross-reactivity of the antibody with 

other compounds. More precise tests for the presence of cytokinins must be 

employed to evaluate levels in the stromata. Presently, the hypothesis that 

cytokinins are a key cue for development of stromata on the grass inflorescence 

primordium for the grass inflorescence-colonizing clavicipitaleans is 

an interesting hypothesis. However, additional work must be done to evaluate 

this hypothesis. 

7 Evolution of Asexual Derivatives of Epichloë 

7.1 Reproduction and Loss of Sexual Reproduction 

One notable feature of genus Epichloë is the abundance of asexual species, 

often classified in form genus Neotyphodium. Formation of asexual derivatives 

is apparently a relatively frequent phenomenon based on how common 

these asexual forms are in grasses (White 1987). In the sexual cycle of 

Epichloë stromata are produced on grasses, and on stromata spermatia 

develop. In a heterothallic mating process symbiotic flies in genus 

Botanophila (Anthomyidae) vector spermatia between stromata of the opposite 

mating type (Bultman et al. 1995). Following deposition of spermatia on 

a compatible stroma, an ascogenous (dikaryotic) mycelium develops in 

which perithecia and ascospores form. Meiosis takes place within the asci to 

result in the haploid ascospores that are ejected from asci onto surrounding 

vegetation, where they may germinate to form wind-disseminated conidia 

(White and Bultman 1987). Precisely how primary infections of grasses 

occur is still unknown, but may involve a period of epiphyllous growth prior 

to penetration of plant tissues (Moy et al. 2000). Other investigators (Diehl 

1950; Chung and Schardl 1997) have suggested that ovules may be the site of 

entry into plants. However, definitive data that will answer this question are 

still lacking. The asexual forms of Epichloë are seed-transmitted and stromata 

do not form on grass inflorescences. Since these asexual forms do not

172 


form stromata, sexual recombination does not occur. Seed transmission is 

the result of growth of the endophyte in inflorescence primordia. When 

ovules differentiate in the primordia, the fungus is incorporated into tissues 

of the nucellus. When the embryo differentiates within the nucellus, it is 

invaded by endophytic mycelium and the next generation of host has been 

effectively colonized (White and Cole 1986). 

7.2 The Hypotheses 

Two hypotheses have been proposed to explain loss of the sexual cycles by 

species of Epichloë. In the ‘hybridization hypothesis’ it is suggested that 

hybridization between two different species of Epichloë results in ‘hybrids’ 

that cannot undergo sexual reproduction due to meiotic incompatibility of 

the two sets of chromosomes (Schardl and Wilkerson 2000). The frequent 

occurrence of multiple sets of genes in some asexual endophytes supports 

this hypothesis (Leuchtmann and Clay 1990; Tsai et al. 1994; Cabral et al. 

1999). The occurrence of asexual forms such as the endophyte of Lolium 

rigidifolium that do not show multiple copies of genes is problematic for the 

hybridization hypothesis (Moon et al. 2000). The second problem with the 

hybridization hypothesis is that it suggests a very unlikely scenario. It suggests 

that haploid spermatia of one species fuse with haploid mycelium on a 

stroma of an opposite species to produce a dikaryotic mycelium. The next 

steps would involve formation of perithecia, asci, and ascospores. Within the 

asci the two nuclei from different species of Epichloë would fuse to become a 

diploid which would be immediately followed by meiosis to result in production 

of the haploid ascospores. Without formation of ascospores, the hybrid 

would be unable to spread. If the two genomes were meiotically incompatible 

as the ‘hybridization hypothesis’ suggests that first meiosis would not occur 

and ascospores could not be produced. This hypothesis invokes meiotic 

incompatibility, yet demands that meiosis occurred at least once following 

hybridization. It seems unlikely that hybridization and meiotic incompatibility 

account for the origins of asexual Epichloë endophytes. It should be noted 

that speciation by hybridization does work in plants. However, in plants meiosis 

does not occur immediately after hybridization, instead, a diploid forms. 

The diploid may reproduce clonally for a time (Grant 1977). 

The plurality of gene copies present within many asexual endophytes may 

be an indication of a parasexual process that is acting in asexual endophytes 

to produce variation. To evaluate whether multiple gene copies reflect parasexual 

recombinations within populations of asexual endophytes, it is necessary 

to conduct populational studies on gene variation. To this point studies 

examining gene variation in asexual endophytes have involved only a few 

isolates. It will be important to determine whether this parasexual recombination 

(hybridization) is a populational phenomenon and occurring rela-


tively frequently within populations of the fungi or is a rare event, resulting 

in the origins of new species. Until we understand how frequent the asexual 

recombinatorial events are, their importance and significance will be speculation. 

The alternative hypothesis to explain loss of stromata and the sexual cycle 

invokes ecological factors and is termed the ‘environmental selection hypothesis’. 

This hypothesis suggests that stroma development reduces fitness of the 

symbiotic unit (grass and endophyte) and is selected against under certain 

environmental conditions. It is supported by work demonstrating that stromata 

increase the losses of water from plant tissues (White and Camp 1996), 

and decrease the fecundity of hosts by replacing inflorescences with stromata 

(White and Chambless 1991). It has been observed that stromata tend to form 

on plants in soils that contain high levels of moisture, whereas asexual forms 

occur in plants that live in soils that range from very dry to moist. Additional 

ecological studies are needed to confirm the association between soil moisture 

and stromata occurrence. 

7.3 The Process of Stroma Development and its Loss 

To understand the mechanism of loss of stroma-forming ability in Epichloë, 

it is necessary to understand the mechanism of stroma development and the 

interactions between endophyte and grass during stroma development. 

Kirby (1961) proposed that the capacity to form stromata on grasses was a 

function of the growth rate of fungal mycelium in the inflorescence primordium 

versus the growth rate of the inflorescence primordium. That is, 

endophytes that grow rapidly in the inflorescence primordium tissues can 

outgrow the inflorescence primordium, surround it, and trap it in a stromal 

mycelium, thus successfully forming a stroma. If an endophyte cannot grow 

rapidly enough to trap the inflorescence primordium in a stromal mycelium, 

the inflorescence emerges, and develops flowers and seeds that may contain 

the endophyte. 

Central to the issue of stroma development is the question of which nutrients 

provide the energy for stroma formation. Lam et al. (1995) demonstrated 

that Epichloë festucae possesses the sucrose degrading enzyme invertase and 

suggested that this enzyme may play a role in stroma development. Earlier 

work by White et al. (1991) suggests another mechanism. White et al. (1991) 

examined the growth rate of a range of endophytes producing stromata of different 

sizes on several different sugars likely to be found in grass inflorescence 

primordia. These sugars included glucose, fructose, xylose, and arabinose. 

Glucose and fructose result from the cleavage of sucrose that is abundant in 

and around the inflorescence primordium tissues. Xylose and arabinose are 

sugars present in the cell wall polysaccharides of grasses and may be available 

in meristems of the primordium. In this study it was found that there is a pos-

174 


itive correlation between the size of stromata and the growth rate on a selection 

of sugars. Apparently, the larger the stroma formed on a particular host, 

the faster an endophyte must grow to develop that stroma. It was further 

found that endophytes that failed to reach the critical growth rate on any of 

the sugars, tended to produce fewer stromata per plant than endophytes that 

grew rapidly on all of the sugars. From an evolutionary perspective, selection 

against stroma development may be selection for endophytes that grow more 

slowly on nutrients available in host tissues. This hypothesis is consistent with 

at least one important observation. Many asexual endophytes (e.g., Neotyphodium 

coenophialum and N. lolii) are slow growing in culture while stromaforming 

endophytes grow comparably faster. 

7.4 The Shift from Pathogen to Mutualist 

Much is known of the biochemistry and genetics of the interactions between 

plants and pathogenic organisms and how these interactions result in disease 

or in plant resistance (Oliver and Osbourne 1995; Hammond-Kosack and 

Jones 1996). Mutualistic associations, such as those between the fungal endophytes 

and their grass hosts, are believed to have evolved from pathogenic 

associations (Clay 1988). Little is known regarding the genetic changes that 

result in a change from a pathogenic to a mutualistic lifestyle. 

Plant fungal pathogens typically secrete a number of plant cell wall degrading 

enzymes such as cellulases, glucanases, xylanases, and polygalacturonases. 

It is likely that expression of these cell wall degrading enzymes plays 

some role in pathogenicity (Oliver and Osbourne 1995; Mendgen et al. 1996), 

although disruption of individual genes has not resulted is reduced virulence 

(Scott-Craig et al. 1990; Apel et al. 1993; Schaeffer et al. 1994; Bowen et al. 1995; 

Sposato et al. 1995). The presence of other genes encoding the same enzyme 

activity and synergistic activity of different cell wall degrading enzymes in 

pathogenicity may explain these results. 

Claviceps purpurea, a plant pathogen closely related to the Epichloë and 

Neotyphodium endophytes, secretes a polygalacturonase during infection of 

rye ovaries (Tenberge et al. 1996). Polygalacturonase activity is believed to be 

important in splitting the host middle lamellae allowing intercellular growth 

of the fungus (Tenberge et al. 1996). Since the fungal endophytes also have an 

intercellular mode of growth, we have investigated the possibility of endophytic 

polygalacturonase expression in the Neotyphodium sp. endophyte that 

infects the grass Poa ampla. No hybridization was detected in a DNA blot 

using the cloned C. purpurea gene as a probe. Also, nothing was detected in 

PCR reactions using degenerate primers based on conserved amino acid 

regions of polygalacturonase genes from diverse organisms. It appears that 

this endophytic fungus may have lost the gene(s) for polygalacturonase. Perhaps 

loss of this cell wall degrading activity is a factor in the evolution of


pathogen to mutualist. Since the fungal endophytes are exclusively intercellular 

and do not invade the plant cells, it is likely that genes for other cell wall 

degrading enzymes have also been lost. Ultimately, genome sequencing of an 

endophytic fungus will reveal the differences in enzyme coding capacity 

between fungal pathogens and fungal endophytes. 

8 Conclusions 

Our understanding of the range of physiological interactions between 

clavicipitalean mycosymbionts and grasses is virtually nonexistent. The 

majority of the research to date has focused on the agronomic aspects of the 

toxicity problem or on ecology of the hosts as modified by these fungi. As a 

consequence, physiology of clavicipitalean – plant interactions is a fertile and 

potentially important area of research. 


Alexopoulos CJ, Mims CW, Blackwell M (1996) Introductory mycology. Wiley, New York 

Apel PC, Panaccione DG, Holden FR, Walton JD (1993) Cloning and targeted gene disruption 

of XYL1, a 1,4-xylanase gene from the maize pathogen Cochliobolus carbonum. 

Mol Plant-Microbe Interact 6:457–473 

Bacon CW, White JF Jr (1994) Stains, media, and procedures for analyzing endophytes. 

In: Bacon CW, White JF Jr (eds) Biotechnology of endophytic fungi of grasses. CRC 

Press, Boca Raton, Florida, pp 47–58 

Bacon CW, White JF Jr (2000) Microbial endophytes. Marcel-Dekker, New York, pp 341– 

388 

Bartnicki-Garcia S (1973) Fundamental aspects of hyphal morphogenesis. In: Ashworth 

JM, Smith JE (eds) Microbial differentiation. Cambridge University Press, Cambridge 

Bonants PJM, Fitters PFL, Thijs H, den Belder E, Waalwijk C, Henfling JWDM (1995) A 

basic serine protease from Paecilomyces lilacinus with biological activity against 

Meloidogyne hapla eggs. Microbiology 141:775–784 

Bowen JK, Templeton MD, Sharrock KR, Crowhurst RN, Rikkerink EHA (1995) Gene 

inactivation in the plant pathogen Glomerella cingulata: three strategies for the disruption 

of the pectin lyase gene pnlA. Mol Gen Genet 246:196–205 

Bultman TL,White JF Jr, Bowdish TI,Welch AM, Johnston J (1995) Mutualistic transfer of 

Epichloë spermatia by Phorbia flies. Mycologia 87:182–189 

Cabral D, Cafaro M, Saidman B, Lugo M, Reddy PV, White JF Jr (1999) Evidence supporting 

the occurrence of a new species of endophyte in some South American grasses. 

Mycologia 91:315–325 

Chet I (1987) Trichoderma – application, mode of action, and potential as a biocontrol 

agent of soil borne plant pathogenic fungi. In: Chet I (ed) Innovative approaches to 

plant disease control. Wiley, New York 

Chung KR, Schardl CL (1997) Sexual cycle and horizontal transmission of the grass symbiont, 

Epichloë typhina. Mycological Res 101:295–301 

Clarke BB, White, JF Jr, Funk CR Jr, Sun S, Huff DR, Hurley RH (2003) Enhanced resistance 

to dollar spot in endophyte-infected fine fescues. Plant Dis (in press)

176 


Clay K (1988) Clavicipitaceous fungal endophytes of grasses: coevolution and the 

change from parasitism to mutualism. In: Pirozynski KA, Hawksworth DL (eds) 

Coevolution of fungi with plants and animals. Academic Press, London, pp 79–105 

Diehl (1950) Balansia and Balansiae in America, USDA Monograph, US Govt Printing 

Office, Washington, DC, 99 pp 

Faeth S, Sullivan H, Hamilton CE (2000) What maintains high levels of Neotyphodium 

endophytes in native grasses? A dissenting view and alternative hypotheses, In: Paul 

VH, Krohn K, Dapprich PD, Gutter B (eds) Proceedings Fourth International Neotyphodium/Grass 

Interactions Symposium. The University of Paderborn, Soest, p 14 

Garcia I, Lora JM, de la Cruz J, Benitez T, Llobell A, Pintor-Toro JA (1994) Cloning and 

characterization of a chitinase (CHIT42) cDNA from the mycoparasitic fungus Trichoderma 

harzianum. Curr Genet 27:83–89 

Geremia RA, Goldman GH, Jacobs D, Ardiles W, Vila SB, Van Montagu M, Herrera- 

Estrella (1993) A. Molecular characterization of the proteinase-encoding gene, prb1, 

related to mycoparasitism by Trichoderma harzianum. Mol Microbiol 8:603–613 

Gooday GW, Gow NAR (1990) Enzymology of tip growth in fungi. In: Heath IB (ed) Tip 

growth in plant and fungal cells. Academic Press, New York, pp 31–58 

Grant V (1977) Organismic Evolution. WH Freeman, San Francisco 

Gwinn KD, Gavin AM (1992) Relationship between endophyte infestation level of tall 

fescue seed lots and Rhizoctonia zeae seedling disease. Plant Dis 76:911–914 

Gwinn KD, Blank CA, Cole AM, Pless CD (1991) Resistance of endophyte-infected tall 

fescue seedlings to pathogens and pests. Tenn Farm Home Sci 160:72 

Hammond-Kosack KE, Jones JDG (1996) Resistance gene-dependent plant defense 

responses. Plant Cell 8:1773–1791 

Hywel-Jones NL, Samuels GJ (1998) Three species of Hypocrella with large stromata 

pathogenic on scale insects. Mycologia 90:36–46 

Kirby EJM (1961) Host-parasite relations in the choke disease of grasses. Trans Br Mycol 

Soc 44:493–503 

Lam CK, Belanger FC, White JF Jr, Daie J (1995) Invertase activity in Epichloë/Acremonium 

fungal endophytes and its possible role in choke disease. Mycol Res 99:867–873 

Lane GA, Christensen MJ, Miles CO (2000) Coevolution of fungal endophytes with 

grasses: the significance of secondary metabolites. In: Bacon CW, White JF Jr (eds) 

Microbial Endophytes. Marcel-Dekker, New York, pp 341–388 

Leuchtmann A, Clay K (1990)Isozyme variation in the Acremonium/Epichloë fungal 

endophyte complex. Phytopathology 80:1133–1139 

Lewis GC, White JF Jr, Bonnefont J (1993) Evaluation of grasses infected with fungal 

endophytes against locusts. Ann Appl Biol; Tests Agrochem Cultivars 14:142–143 

Lindstrom JT, Belanger FC (1994) A novel fungal protease expressed in endophytic infection 

of Poa species. Plant Physiol 102:645–650 

Lora JM, de la Cruz J, Llobell A, Benitez T, Pintor-Toro JA (1995) Molecular characterization 

and heterologous expression of an endo-b-1,6-glucanase gene from the mycoparasitic 

fungus Trichoderma harzianum. Mol Gen Genet 247:639–645 

Mauseth JD (2003) Botany: An introduction to plant biology. Jones and Bartlett, Boston 

Mendgen K, Hahn M, Deising H (1996) Morphogenesis and mechanisms of penetration 

by plant pathogenic fungi. Ann Rev Phytopathol 34:367–386 

Miller CO (1961) A kinetin-like compound in maize. Proc Natl Acad Sci USA 47:170–174 

Moon CD, Scott B, Schardl CL, Christensen MJ (2000) The evolutionary origins of 

Epichloë endophytes from annual ryegrasses. Mycologia 92:1103–1118 

Moubarak AS, Piper EL, West CP, Johnson ZB (1993) Interaction of purified ergovaline 

from endophyte-infected tall fescue with synaptosomal ATPase enzyme system. J 

Agric Food Chem 41:407–409


Moy M, Belanger F, Duncan R, Freehof A, Leary C, Meyer W, Sullivan R,White JF Jr (2000) 

Identification of epiphyllous mycelial nets on leaves of grasses infected by clavicipitaceous 

endophytes. Symbiosis 28:291–302 

Oliver R, Osbourn A (1995) Molecular dissection of fungal phytopathogenicity. Microbiology 

141:1–9 

Papavizas GC (1985) Trichoderma and Gliocladium: biology, ecology, and potential for 

biocontrol. Annu Rev Phytopathol 23:23–54 

Peberdy JF (1990) Fungal cell walls – a review. In: Kuhn PJ, Trinci APJ, Jung MJ, Goosey 

MW, Copping LG (eds) Biochemistry of cell walls and membranes in fungi. Springer, 

Berlin Heidelberg New York 

Porter JK, Bacon CW, Cutler HG,Arrendale RF, Robbins JD (1985) In vitro auxin production 

by Balansia epichloë. Phytochemistry 24:1429–1431 

Reddy PV, Lam CK, Belanger FC (1996) Mutualistic fungal endophytes express a proteinase 

which is homologous to proteases suspected to be important in fungal pathogenicity. 

Plant Physiol 111:1209–1218 

Rykard DM, Bacon CW, Luttrell ES (1985) Host relations of Myriogenospora atramentosa 

and Balansia epichloë (Clavicipitaceae). Phytopathology 75:950–956 

Schaeffer JH, Leykam J,Walton JD (1994) Cloning and targeted gene disruption of EXG1, 

encoding exo-1,3-glucanase, in the phytopathogenic fungus Cochliobolus carbonum. 


Schardl CL, Wilkinson HH (2000) Hybridization and cospeciation hypotheses for the 

evolution of grass endophytes. In: Bacon CW,White JF Jr (eds) Microbial endophytes. 

Marcel-Dekker, New York, pp 63–83 

Scott-Craig JS, Panaccione DG, Cervone F, Walton JD (1990) Endopolygalacturonase is 

not required for pathogenicity of Cochliobolus carbonum on maize. Plant Cell 

2:1191–1200 

Sposato P, Ahn J-H, Walton JD (1995) Characterization and disruption of a gene in the 

maize pathogen Cochliobolus carbonum encoding a cellulose binding domain and 

hinge region. Mol Plant-Microbe Interact 8:602–609 

St. Leger RJ (1995) The role of cuticle-degrading proteases in fungal pathogenesis of 

insects. Can J Bot 73:1119–1125 

Sullivan RF, Bills GF, Hywel-Jones NL, White JF Jr (2000) Hyperdermium: a new clavicipitalean 

genus for some tropical epibionts of dicotyledonous plants. Mycologia 92:908– 

919 

Tenberge KB, Homann V, Oeser B, Tudzynski P (1996) Structure and expression of two 

polygalacturonase genes of Claviceps purpurea oriented in tandem and cytological 

evidence for pectinolytic enzyme activity during infection of rye. Phytopathology 

86:1084–1097 

Tsai H-F, Liu J-S, Staben C, Christensen MJ, Latch GCM, Siegel MR, Schardl CL (1994) 

Evolutionary diversification of fungal endophytes of tall fescue grass by hybridization 

with Epichloë species. Proc Natl Acad Sci USA 91:2542–2546 

Tzean SS, Hsieh LS, Wu WJ (1997) Atlas of entomopathogenic fungi from taiwan. Council 

of Agriculture, Yuan, Taiwan, Republic of China 

White JF Jr (1987) Widespread distribution of endophytes in the Poaceae. Plant Dis 

71:340–342 

White JF Jr (1988) Endophyte-host associations in forage grasses. XI. A proposal concerning 

origin and evolution. Mycologia 80:442–446 

White JF Jr, Cole GT (1986) Endophyte-host associations in forage grasses. IV. The endophyte 

of Festuca versuta. Mycologia 78:102–107 

White JF Jr, Bultman TL (1987) Endophyte-host associations in forage grasses.VIII. Heterothallism 

in Epichloë typhina. Am J Bot 74:1716–1721

178 


White JF Jr, Chambless DA (1991) Endophyte-host associations in forage grasses. XV. 

Clustering of stromata-bearing individuals of Agrostis hiemalis infected by Epichloë 

typhina. Am J Bot 78:527–533 

White JF Jr, Owens JR (1992) Stromal development and mating system of Balansia 

epichloë, a leaf-colonizing endophyte of warm-season grasses. Appl Environ Microbiol 

58:513–519 

White JF Jr, Glenn AE (1994) A study of two fungal epibionts of grasses: structural features, 

host relationships, and classification in genus Myriogenospora Atk. (Clavicipitales). 

Am J Bot 81:216–223 

White JF Jr, Camp CR (1996) A study of water relations of Epichloë amarillans White, an 

endophyte of the grass Agrostis hiemalis (Walt.) B.S.P. Symbiosis 18:15–25 

White JF Jr, Breen JP, Morgan-Jones G (1991) Substrate utilization in selected Acremonium, 

Atkinsonella, and Balansia species. Mycologia 83:601–610 

White JF Jr, Morrow AC, Morgan-Jones G, Chambless DA (1991) Endophyte-host associations 

in forage grasses. XIV. Primary stromata formation and seed transmission in 

Epichloë typhina: developmental and regulatory aspects. Mycologia 83:72–81 

White JF Jr, Martin TI, Cabral D (1996) Endophyte-host associations in grasses. XXIII. 

Conidia formation by Acremonium endophytes in the phylloplanes of Agrostis 

hiemalis and Poa rigidifolia. Mycologia 88:174–178 

White JF Jr, Bacon CW, Hinton DM (1997) Modifications of host cells and tissues by the 

biotrophic endophyte Epichloë amarillans (Clavicipitaceae; Ascomycotina). Canadian 

J Bot 75:1061–1069 

Yue C, Miller CJ, White JF, Richardson M (2000) Isolation and characterization of fungal 

inhibitors from Epichloë festucae. J Agric Food Chem 48:4687–4692

11 Interactions of Microbes with Genetically 

Modified Plants 

Michael Kaldorf, Chi Zhang, Uwe Nehls, Rüdiger Hampp 

and François Buscot 


The introduction of molecular biological methods into plant breeding has 

offered the possibility to construct genetically modified plants (GMPs) with 

new qualities. Major goals of genetic engineering are the improvement of 

product quality as well as the enhancement of resistance or tolerance to 

pathogen infections, herbicides and abiotic stress factors. 

Attempts to improve the quality of agricultural products include the 

manipulation of the softening of fruits like strawberry (Jimenez-Bermudez et 

al. 2002) and tomato (Quiroga and Fraschina 1997) in order to allow longer 

storage after harvesting, the modification of oil composition of oilseed crops 

(Thelen and Ohlrogge 2002), or the elevation of the provitamin A content of 

rice (Ye et al. 2000) and tomato (Romer et al. 2000). Even in forestry, increased 

wood production and quality are of great commercial interest (Mullin and 

Bertrand 1998). For example, the lignin content of transgenic aspen, in which 

the lignin biosynthesis pathway was downregulated by antisense inhibition, 

was greatly reduced (Hu et al. 1999), indicating that some technical limitations 

for the use of these fast growing trees for cellulose fiber production (e.g., in 

paper industry) might be reduced by genetic engineering. 

In contrast to the examples given above, the basic target of constructing 

GMPs with enhanced resistance to biotic or abiotic stress factors is not a modified 

product quality, but an enhanced productivity and reduction of the production 

costs in agriculture and forestry. The possibility to overcome different 

types of abiotic stress in GMPs has been demonstrated in several 

experiments [e.g., drought-resistant sugar beet (Pilon-Smits et al. 1999), salttolerant 

tomato plants (Zhang and Blumwald 2001), or aluminium-resistant 

Brassica napus plants (Basu et al. 2001)], but until now, none of these GMPs is 

being used for commercial production. 

All GMPs introduced on a large scale into agriculture in the 1990s possess 

resistance genes either against herbicides or against plant pathogens. Many 

different herbicide-resistant transgenic plants like corn, cotton, lettuce, 




180 

Michael Kaldorf et al. 

poplar, potato, rapeseed, soybean, sugar beet, tobacco, tomato, and wheat have 

been developed and field-tested (Saroha et al. 1998). Especially soybean, corn 

and oilseed resistant to the herbicide glyphosate were planted on at least 

15 million ha in the USA, Argentina, Canada and other countries since 1998, 

occupying about 70 % of the total release area for GMPs in 1998 (Warwick et 

al. 1999; Owen 2000). Among the pathogen-resistant GMPs, transgenic corn 

(Owen 2000), cotton (Perlak et al. 2001) and other plants producing insecticidal 

proteins from Bacillus thuringiensis (Bt) are grown on a similar scale 

(11.4 million ha worldwide in 2000, Shelton et al. 2002) as herbicide-resistant 

GMPs. Transgenic plants with different resistances to many other viral, bacterial 

and fungal pathogens have been described (e.g., Düring et al. 1993; Punja 

2001; Solomon-Blackburn and Barker 2001, and references cited therein), 

which are not yet used commercially. 

Since the first field experiment in 1986, more than 25,000 field trials with 

GMPs have been performed worldwide (Warwick et al. 1999), and for all 

GMPs, some common features have to be demonstrated in field experiments 

prior to commercial production. First, the new quality of the transgenic plant 

must be stable under field conditions. Second, all other characteristics important 

for the agricultural use of a plant should remain unaffected in the GMPs 

compared to their parental breeds. Third, negative effects on the environment 

and particularly on nontarget organisms have to be low or missing. Such nontarget 

effects include cases like the negative and – in the worst case – lethal 

impact of Bt transgenic corn pollen on larvae of the monarch butterfly (Losey 

et al. 1999; Hansen Jesse and Obrycki 2000), which correspond to environmental 

risks without direct influence on the performance of the GMPs in the 

field.A further category of nontarget effects includes reduced compatibility of 

GMPs in symbiotic interactions or damage of plant growth promoting bacteria, 

which are not only environmental risks, but might also reduce the productivity 

of GMPs in the field. Especially in the case of pathogen-resistant 

GMPs, a negative impact on nontarget organisms is likely and has to be investigated 

thoroughly prior to the decision to use a GMP commercially. 

The aim of this review is to summarize the effects of transgenic plants on 

nontarget microorganisms. Depending on the specific characters of a GMP, 

these effects might be positive (e.g., enrichment of plant growth-promoting 

bacteria), neutral, or even negative (e.g., increase in plant pathogenic bacteria 

or fungi). Experimental work in this field can be grouped into three categories: 

(1) analysis of effects of GMPs on changes in microorganism communities 

at the root surface and in the rhizosphere; (2) investigations that focus 

on positive interactions between plants and microorganisms like mycorrhizal 

or Rhizobium symbioses that are important factors for plant nutrition and 

health; (3) analysis of horizontal gene transfer (HGT) events as a result of 

tight interactions between GMPs and microorganisms.

11 Interactions of Microbes with Genetically Modified Plants 181 

2 Changes in Microbial Communities Induced by 

Genetically Modified Plants 

Many studies dealing with the impact of GMPs on microbial communities 

have been published since the urgent call of Morra (1994) for this kind of 

research (Table 1). At present, transgenic potatoes producing T4 lysozyme to 

obtain resistance to Erwinia carotovora and other bacterial pathogens 

(Düring et al. 1993) are the best characterized GMP system with respect to 

microbial interactions. In addition, some of the commercially most important 

GMPs like corn and cotton producing the insecticidal Bacillus thuringiensi 

(Bt) toxin, or glyphosate-tolerant Brassica sp., as well as different other GMPs 

have been tested. 

Selective advantages of specific bacteria in the rhizosphere of GMPs were 

demonstrated in two studies. A T4 lysozyme-tolerant Pseudomonas putida 

strain with antibacterial activity to the bacterial pathogen Erwinia carotovora 

was introduced into the rhizosphere of T4 lysozyme-producing potatoes. 

During flowering of the plants, when the highest lysozyme level was detected 

in planta, significantly more colonies of the introduced P. putida strain could 

be reisolated from transgenic potatoes compared to controls (Lottmann et al. 

2000). In the second experiment, the culture of transgenic Lotus corniculatus 

plants producing different opines led to a significant increase in opine-utilizing 

bacteria in the rhizosphere. When the opine-producing plants were 

replaced by nontransgenic plants, the concentration of different fractions of 

opine utilizers in the soil slowly decreased over 22 weeks. However, even then, 

the density of the bacterial fraction specifically using mannopine was still five 

times higher than in soil which had not been planted with the transgenic 

Lotus plants (Oger et al. 2000). This demonstrates that alterations in the soil 

microflora induced by the cultivation of GMPs may be persistent. 

Nontarget effects of GMPs on bacterial communities seem to be common. 

A broad spectrum of both physiological and molecular biological methods 

like community-level physiological profile (CLPP; Griffiths et al. 2000; Dunfield 

and Germida 2001), BIOLOG substrate utilization test (Siciliano et al. 

1998; Di Giovanni et al. 1999), fatty acid methyl ester (FAME) patterns (Siciliano 

et al. 1998; Dunfield and Germida 2001), plate-counting of bacterial 

groups (e.g., spore-forming or cellulose-utilizing bacteria, Donegan et al. 

1999) and T-RFLP (Lukow et al. 2000) have been used to characterize bacterial 

communities associated with GMPs. In addition, population analyses of 

protozoa, nematodes and microarthropods have been included in some studies 

(e.g., Donegan et al. 1997; Saxena and Stotzky 2001). Significant changes in 

the rhizosphere of different GMPs have been shown (see Table 1), which are 

not necessarily linked directly to the presence of new gene product(s). For 

example, changes in the rhizospheric bacterial community of transgenic cotton 

plants producing the Bt toxin were significant, but the purified Bt toxin 

itself displayed no detectable effect on soil microorganisms (Donegan et al.

182 

Table 1: Studies assessing the impact of GMPs on plant-associated and soil microorganisms 


GMP species, Group(s) of organisms investigated Observations Reference 

new characteristics 

Brassica sp., tolerance to the Soil bacterial communities Indications for changes in the soil bacterial Siciliano et al. (1998) 

herbicide glyphosate communities 

Brassica sp., tolerance to the Soil bacterial communities Significant changes in the soil bacterial Dunfield and Germida 

herbicide glyphosate communities (2001) 

Gossypium hirsutum, Bt toxin Leaf material decomposing bacterial, Two of three transgenic cotton lines caused Donegan et al. (1995) 

production resistance to insects fungal, and protozoan populations significant stimulation and qualitative changes 

of bacterial and fungal populations 

Lotus corniculatus, Opine-utilizing bacteria, soil Increase of opine-utilizing bacteria in the rhizo- Oger et al. (2000) 

opine production bacterial community sphere of the GMPs; effect persistent for 22 weeks 

Medicago sativa, a-amylase or Soil bacteria, fungi, protozoa, Significant changes in bacterial populations of Donegan et al. (1999) 

lignin peroxidase production nematodes and micro-arthropods lignin peroxidase plants; population levels of 

fungi, protozoa, nematodes and microarthropods 

not affected 

Medicago sativa, a-amylase or Soil bacterial communities Significant changes in bacterial populations Di Giovanni et al. 

lignin peroxidase production associated with lignin peroxidase plants (1999) 

Nicotiana tabaccum, proteinase Protozoa, nematodes, and Changes in nematode populations, reduced Donegan et al. (1997) 

inhibitor I, resistance to insects microarthropods Collembola populations on litter from GMPs 

Solanum tuberosum, T4 lysozyme Plant-associated bacteria Minor effects on community structure Lottmann et al. (1999) 

production, resistance to bacteria 

Solanum tuberosum, Introduced, pathogen-antagonistic Significant increase of introduced lysozyme- Lottmann et al. (2000) 

T4 lysozyme production bacteria with high lysozyme tolerance tolerant bacteria on GMPs 

Solanum tuberosum, Pseudomonads and enterics from No correlation between phenotypic or genotypic Lottmann and Berg 

T4 lysozyme production the rhizosphere profile and transgenic character (2001)

GMP species, Group(s) of organisms investigated Observations Reference 

new characteristics 


Solanum tuberosum, Rhizosphere bacterial community Only minor effects of lysozyme Heuer and Smalla 

T4 lysozyme production (1999) 

Solanum tuberosum, Rhizosphere bacterial community No detectable effects of lysozyme production Heuer et al. (2002) 

T4 lysozyme production 

Solanum tuberosum, Pathogenic Erwinia carotovara Similar lysozyme sensitivity of Erwinia and most de Vries et al. (1999) 

T4 lysozyme production strains; soil bacteria other soil bacteria 

Solanum tuberosum, Bacillus subtilis Increased killing of B. subtilis on the hairy roots Ahrenholtz et al. (2000) 

T4 lysozyme production of lysozyme-producing plants 

Solanum tuberosum, Total bacterial and fungal populations Only minor effects of the GMPs Donegan et al. (1996) 

Bt toxin production colonizing leaves 

Solanum tuberosum, production Soil bacterial communities; protozoa No effect on protozoa, but significant changes Griffiths et al. (2000) 

of anti-feedant lectines in the physiological profiles of bacterial 

communities 

Solanum tuberosum, Barstar/ Soil bacterial community structure Some significant differences between GMPs Lukow et al. (2000) 

Barnase genes, fungal pathogen and control plants 

resistance 

Zea mays, Bt toxin production Soil bacteria, fungi, protozoa, No significant differences detected Saxena and Stotzky 

and nematodes (2001)

184 


1995). Similarly, the effects of transgenic potatoes producing the lectin GNA 

on nontarget soil organisms could not be attributed to the formation of the 

lectin GNA itself (Griffiths et al. 2000). So far, only one GMP producing an 

antibacterial substance, namely T4 lysozyme-producing potatoes with 

enhanced resistance to Erwinia carotovora, has been investigated in detail for 

nontarget effects on soil bacteria. Most soil bacteria were lysozyme-sensitive 

when tested in laboratory experiments with pure cultures (de Vries et al. 

1999). In addition, increased killing of Bacillus subtilis was observed on the 

root surface of T4 lysozyme-producing potatoes from the field, and this effect 

was ascribed directly to the lysozyme release by the roots (Ahrenholtz et al. 

2000). Nevertheless, the production of lysozyme had only a minor influence 

on the bacterial phyllo- and rhizosphere communities (Heuer and Smalla 

1999; Heuer et al. 2002), which was considered negligible relative to natural 

factors by the authors. Further studies with the same system which focused on 

potentially beneficial plant-associated microbes like auxin-producing bacteria 

or bacteria antagonistic to the pathogenic E. carotovora did not reveal correlations 

between the transgenic character of plants and the pheno- or genotypic 

features of bacterial isolates (Lottmann and Berg 2001). Thus, up to now, 

there is no direct evidence from field experiments that the primary product of 

transgene expression is responsible for significant changes in the soil microbial 

community in any GMP. Instead, secondary effects of GMP generation, 

like somaclonal variation and changes in general plant metabolism induced 

by the transgene insertion or expression, may contribute to a major part of 

the effects described above. 

3 Impact of Genetically Modified Plants on Symbiotic 

Interactions 

The question whether the genetical transformation of plants might reduce 

their ability to form mutualistic symbioses with microorganisms has been 

addressed in a surprisingly small number of studies. 

Biological nitrogen fixation accounts for about 65 % of the nitrogen utilized 

in agriculture worldwide (Vance and Graham 1995). The ability to 

reduce atmospheric nitrogen to ammonia (nitrogen fixation) is restricted to 

prokaryotes. Beside free-living and plant-associated bacteria, members of the 

Rhizobiaceae living symbiotically in the typical root nodules of legumes such 

as alfalfa, clover, pea, and soybean are the agriculturally most important 

group of nitrogen fixing organisms. The symbiotic interaction between rhizobia 

and legumes requires a sequential signal exchange between both partners, 

and therefore, exhibits a high degree of host specificity (Bothe 1993). Transgenic 

plants have been used as a tool to investigate the host recognition of rhizobia 

(Diaz et al. 1989, 2000). For example, the transfer of lectin genes between 

different legumes has been shown as a possible way to modify host specificity


(Diaz et al. 2000; van Rhijn et al. 2001). While the GMPs used in these studies 

have been modified specifically to change the plant–rhizobia interactions, 

possible alterations in the rhizobia symbiosis would be untargeted in 

pathogen- or herbicide-resistant legumes. The constitutive expression of a 

rice basic chitinase gene with putative antifungal effects in alfalfa had no negative 

influence on the interaction with Rhizobium (Masoud et al. 1996). No 

further information is available about interference between genetical modifications 

of plants and nitrogen fixing bacteria, particularly about the herbicide-resistant 

soybean cultivars planted on a large scale since 1996. 

The second important group of plant-microbe symbioses is the mycorrhiza. 

Under natural conditions, the roots of most plants are colonized by 

mycorrhizal fungi, which increase their uptake of water and nutrients, as well 

as their resistance against pathogens and abiotic stress (Smith and Read 

1997). Ectomycorrhiza (EM) is the dominating type of mycorrhiza in gymnosperms 

and many woody angiosperms. EM formation is accompanied by 

morphological changes of both the fungal hyphae and the plant fine roots. 

Typically, hyphae form a mantle of varying thickness around the fine roots. 

From there they extend into the apoplast of the root cortex, forming a highly 

branched network and thus establishing a large surface area for solute 

exchange, the Hartig net (Kottke and Oberwinkler 1986). Arbuscular mycorrhiza 

(AM) can be found in mosses, ferns and many angiosperms, including 

agronomically important plants like barley, corn, potato, rice, soybean, and 

wheat (Smith and Read 1997). The successful use of transgenic host plants in 

basic research on mycorrhiza has demonstrated that the use of common molecular 

biological methods, like the introduction of antibiotic resistance genes 

[e.g., transgenic aspen carrying a hygromycin resistance gene in addition to 

indoleacetic acid-biosynthetic genes, (Tuominen et al. 1995; Hampp et al. 

1996)] or reporter gene constructs (e.g., the gus reporter gene system, Gianinazzi-Pearson 

et al. 2000) into plants, has normally no impact on mycorrhiza 

formation. Only in the case of the symbiosis-related gene enod40 from Medicago 

truncatula, overexpression of the gene accelerated AM colonization, 

while transgenic lines with suppressed enod40 transcript levels exhibited 

reduced mycorrhization (Staehelin et al. 2001). 

Negative nontarget effects of GMPs on mycorrhizal fungi seem to be most 

likely in GMPs constitutively expressing antifungal proteins in order to obtain 

resistance against fungal pathogens (Glandorf et al. 1997). Transgenic Nicotiana 

sylvestris plants with more than tenfold enhanced chitinase activity 

were significantly less colonized by the fungal pathogen Rhizoctonia solani 

compared to control plants. However, neither the quantity of AM colonization 

nor the anatomy of AM hyphae, arbuscules or vesicles were significantly 

affected in the chitinase overproducing plants (Vierheilig et al. 1993). In a further 

study, several pathogenesis-related (PR) proteins were constitutively 

expressed in transgenic tobacco plants to investigate their influence on the 

AM fungus Glomus mosseae (Vierheilig et al. 1995). Two acidic and two basic

186 


chitinases, one acidic and two basic glucanases, as well as three PR proteins of 

unknown function had no detectable influence on AM colonization. Only one 

of the PR proteins tested, an acidic, extracellular b-1,3-glucanase of class II, 

reduced the mycorrhization of transgenic tobacco roots by G. mosseae significantly. 

This observation demonstrates that mycorrhiza formation could be 

affected in GMPs expressing antifungal PR proteins. Therefore, a case-to-case 

investigation of GMPs with increased fungal pathogen resistance seems to be 

necessary to exclude negative effects on AM formation. 

In addition to the quantity of mycorrhizal colonization, the structural and 

functional diversity of mycorrhizal fungi colonizing the root system might be 

influenced in GMPs. Probably due to methodical difficulties, this question has 

not been addressed for AM fungi. Compared to the rather uniform morphology 

of AM fungi, which makes their morphological identification quite difficult, 

EM fungi exhibit many morphological and anatomical characters that 

could be used for their characterization (Agerer 1991). In combination with 

PCR-RFLP and sequence analysis of the ITS region within the fungal rDNA 

(Buscot et al. 2000), EM communities can be described with a sufficient resolution 

to compare the mycorrhization of transgenic and nontransgenic trees, 

even in the field.A release experiment with transgenic aspen carrying the rolC 

gene from Agrobacterium rhizogenes (Fladung and Muhs 2000) was accompanied 

by a detailed analysis of the EM status of the trees. Although rolC modified 

the hormonal balance in the trees, and therefore, might have affected 

their mycorrhization ability, no significant difference in the degree of mycorrhization 

was observed in the transformed aspen. The structure of the EM 

community of the different aspen lines was similar in the first two years of the 

experiment (Kaldorf et al. 2002), but in the third and fourth years, a significantly 

reduced EM diversity was observed on the rolC transgenic aspen compared 

to controls (Kaldorf et al. 2001). In addition, one EM morphotype 

formed by Phialocephala fortinii appeared to be significantly less represented 

on the transgenic line “E2/5” compared to all other transgenic and control 

lines (Kaldorf et al. 2002). This reduced compatibility for one mycobiont represents 

the first example of a clone-specific effect concerning mycorrhization 

of transgenic plants. 

4 Horizontal Gene Transfer 

Three potential pathways have been proposed for the spread of GMPs or the 

transgenes introduced into these plants. Two of these pathways, the establishment 

of self-sustaining GMP populations and the introgression of genes into 

wild populations, regarded as the major risks of GMPs for natural plant communities 

(Wolfenbarger and Phifer 2000), do not involve plant/microorganism 

interactions. The third possibility is the horizontal transfer of genes from 

GMPs to microorganisms, which might lead to bacterial or fungal strains car-


rying genes from GMPs. The exchange of genetic information between different 

bacterial species by transformation, transduction or conjugation seems to 

be common in nature (Krishnapillai 1996; Wöstemeyer et al. 1997 and references 

therein). The detailed analysis of DNA and amino acid sequence data 

has indicated that horizontal transmission of genes, even between bacteria 

and eukaryotes or between eukaryotes from different systematic kingdoms, 

probably occurred in rare cases during evolution (Dröge et al. 1998 and references 

therein), but there is no experimental access to further investigation or 

verification of such horizontal gene transfer (HGT) events. 

The focus of the experimental work on HGT has been the question whether 

antibiotic resistance genes, used as selectable markers in GMPs, can be transferred 

to bacteria, enhancing the frequency of antibiotic-resistant bacteria of 

medical importance (Nielsen et al. 1998). Beside the relevance of this question 

for the risk assessment of GMPs, the transfer of antibiotic-resistance genes is 

easy to detect compared to a possible horizontal transfer of genes which cannot 

be used as a selectable marker for the isolation of transformed bacteria. 

Therefore, experimental data about the possible HGT of other genes are 

scarce. 

The transformation of different bacterial species has been demonstrated 

under optimized laboratory conditions using isolated plasmid DNA, total 

DNA from GMPs and even homogenized plant material from GMPs as the 

source for antibiotic-resistance genes (Schlüter et al. 1995; Gebhard and 

Smalla 1998). The efficiency of the integration of the nptII gene, causing resistance 

to kanamycin, into the genome of Acinetobacter sp. strongly depended 

on the presence of homologous sequences in the bacterial DNA (Nielsen et al. 

1997). This observation was confirmed by de Vries et al. (2001) using Acinetobacter 

sp. and Pseudomonas stutzeri as well as by Bertolla et al. (2000) using 

the plant pathogenic bacterium Ralstonia solanacearum as recipient for 

antibiotic-resistance genes. 

While transformation of bacteria is common under optimized laboratory 

conditions, all experiments under natural conditions indicated that the frequency 

of HGT is drastically reduced compared to optimized conditions. 

Although DNA from transgenic plants can persist in soil for up to 2 years 

(Gebhard and Smalla 1999), the availability of DNA from GMPs could be a 

limiting factor for HGT. Even under otherwise optimized conditions (e.g., use 

of purified DNA from transgenic sugar beet as source for the nptII gen, construction 

of an Acinetobacter strain carrying a deleted nptII gene to allow 

homologous recombination in the recipient bacteria), the frequency of HGT 

was low in sterilized soil microcosms and below the detection limit in nonsterilized 

soil (Nielsen et al. 2000). In a field release experiment with nptIItransgenic 

sugar beet, a total of 4000 kanamycin-resistant colonies of soil bacteria 

isolated from the field release site was checked for the presence of the 

nptII gene from the transgenic plants by dot blot hybridization and PCR. 

None of the isolates carried the nptII gene, indicating a natural kanamycin

188 


resistance of all strains tested, which was not acquired by HGT (Gebhard and 

Smalla 1999). Thus, the conclusion of Bertolla and Simonet (1999) that we are 

a long way from demonstrating that plant–bacterium gene transfer does 

occur under natural conditions, is still valid. 

Approaches to detect HGT from transgenic plants to eukaryotic microorganism 

are sparse. Particular fungi often grow in intimate contact with plants 

or – in the case of endoparasitic and mycorrhizal symbioses – even within 

plants. In these cases, uptake of plant DNA by fungi might be more likely compared 

to soil bacteria, as the plant DNA does not come in contact with soil. 

Indeed, evidence has been presented that the phytopathogenic fungus Plasmodiophora 

brassicae takes up host plant DNA during each infection cycle 

(Bryngelsson et al. 1988), but interactions between Plasmodiophora and 

transgenic Brassica sp. have not been investigated. HGT from plants to saprophytic 

fungi has also been reported (Hoffmann et al. 1994). Transgenic plants 

expressing the hygromycin gene (hph) as selection marker under control of a 

fungal promoter were generated. After cocultivation of dead plant material 

together with Aspergillus, fungal progenies were isolated that revealed resistance 

to hygromycin B on selective agar plates (Hoffmann et al. 1994). The hph 

gene and other foreign DNA sequences could be detected in some of these 

hygromycin B-resistant fungal strains. Nevertheless, in most cases the foreign 

DNA was not stably integrated into the Aspergillus genome. 

In the following, we present some unpublished data evaluating the possibility 

of HGT in mycorrhizal symbioses. Ectomycorrhizas are of special interest 

in this aspect, due to the long life time of the host trees. Therefore, there is 

a need to investigate the possibility of HGT from transformed forest trees to 

EM fungi. Plant cells frequently die during EM interaction and thus, fungal 

hyphae of the Hartig net come in close contact with plant DNA. Filamentous 

fungi are naturally not very competent in the uptake of large DNA fragments. 

In EM however, hyphae of the Hartig net are coenocytic and have a highly 

enlarged plasma membrane surface area due to extensive invaginations (Kottke 

and Oberwinkler 1987). Therefore, they might be more competent for 

DNA uptake than normal hyphae. 

Two different approaches were used to study HGT between plant and fungal 

cells in ectomycorrhizas. In the first approach, transgenic aspen carrying 

the rolC gene from Agrobacterium rhizogenes under control of the lightinducible 

rbcS promoter from potato (Fladung et al. 1997) were grown in vitro 

together with the ectomycorrhizal ascomycete Phialocephala fortinii strain 

5B, isolated from mycorrhizal aspen roots collected in the field (Fladung et al. 

2000).After 12 weeks of cocultivation, P. fortinii was reisolated from colonized 

aspen roots. Fungal hyphae growing out from mycorrhizas were transferred 

to fresh medium for further growth to avoid contamination with plant material. 

Genomic DNA was isolated from the fungal mycelium and analyzed for 

the presence of the rolC gene. To enhance the sensitivity of the PCR assay, a 

“nested” PCR strategy was followed. The first rolC specific primer pair should


amplify a 950-bp DNA fragment. In a second PCR step, a 500-bp fragment of 

rolC should be amplified from the products of the first PCR using a second 

inner primer pair, again specific for rolC. Isolated DNA from transgenic aspen 

leaves was used as positive control for the nested PCR, while the quality of the 

fungal DNA was checked with the primer pair ITS1/ITS4 (White et al. 1990), 

specific for a part of fungal rDNA clusters. The rolC gene was not detected in 

any of the 24 Phialocephala colonies analyzed. The number of 24 samples was 

sufficient to demonstrate that the uptake of plant DNA in Phialocephala EM 

does not occur on a regular basis, as suggested for the Plasmodiophora–Brassica 

interaction (Bryngelsson et al. 1988). 

The second approach was with transgenic plants that contained a small 

marker gene, which could confer herbicide resistance into the target organism 

after HGT. The advantage of this strategy is that a large number of samples 

can be simultaneously screened, but only a small number of the samples able 

to grow on the selection medium have to be investigated in detail. In order to 

monitor HGT in ectomycorrhizas formed between poplar and Amanita muscaria, 

a 1250-bp EcoRI/XbaI fragment of pBG (Straubinger et al. 1992) containing 

the Streptomyces hygroscopicus bar gene under the control of the 

Cochlibolus heterostrophus GPD1 promoter was inserted into the Agrobacterium 

vector pBI121 (Clontech, Palo Alto, CA, USA; Fig. 1). The function of 

amp 

Fig. 1. Cloning strategy for the 

construction of the binary vector 

pBI121/3 

pBG 

4.21 Kb 

A 

ori 

XbaI 

BamH1 

bar 

GPD1 

Nos-P 

RB 

Nos-ter 

BamH1 

NPTII (Kan) 

Pst1 

EcoR1 

EcoRV 

HindIII 

Cla1 

Xho1 

HindIII 

CaMV 35S P 

pBI121/3 

12.27 Kb 

C 

Bar-Gene 

Nos-ter 

Nos-P 

RB 

XbaI 

GPD1 P 

NPTII (Kan) 

LB 

EcoRI 

HindIII 

CaMV 35S P 

pBI121 

13.00 Kb 

B 

GUS 

XbaI 

Nos-ter 

LB 

SstI 

EcoRI

190 


the GPD/bar construct in the ectomycorrhizal fungus A. muscaria was previously 

verified by PEG-mediated protoplast transformation. Transgenic 

poplars containing the GPD/bar construct were generated by Agrobacteriummediated 

transformation. Twenty plants were isolated that originate from different 

calli. PCR amplification was carried out with genomic DNA from transgenic 

poplars using bar-specific primers. PCR products of the expected size 

were obtained from 19 out of a total of 20 putative transgenic poplar plants 

(Fig. 2). Isolated PCR-fragments of three clones were sequenced and revealed 

the introduced bar gene. 

For the investigation of a HGT event, 35,000 ectomycorrhizas formed 

between transgenic poplars and A. muscaria were isolated and transferred to 

selective agar plates.After the first round of selection, 102 putative Basta resistant 

fungal colonies were obtained. However, none of these colonies was able 

to grow after transfer to a fresh selection medium. Genomic DNA isolated 

from fungal hyphae initially growing on the selection medium was investigated 

for the presence of the bar-gene using PCR. No bar-fragment could be 

obtained from any of these investigated clones. The utilization of primers for 

Fig. 2. Analysis of genomic DNA isolated from putative kanamycin-resistant poplar 

transformants. PCR amplification was performed on genomic DNA using primers specific 

for the bar gene that amplifies an internal fragment of 550-bp length. Lanes 1 to 20 

Isolated DNA from putative transformants. P Positive control with diluted DNA of 

pBI121/3, K DNA isolated from a nontransformed poplar plant, M molecular size marker 

(l/HindIII DNA marker)

a single copy gene of A. muscaria (SCIV038, Nehls et al. 2001) revealed PCR 

fragments in any case, indicating that no inhibitors of the PCR reaction were 

present in the genomic DNA preparation. The reason for false positives was 

most probably the low herbicide concentration in the growth medium.A concentration 

of 200 mg/ml Basta (as used in this study) results in fungal background 

growth. This relatively low Basta-concentration was chosen to recognize 

also lateral transfer of the resistance gene lacking its heterologous 

promoter. In this case, the bar-gene might integrate behind a weak A. muscaria 

promoter, resulting in only a weak herbicide resistance. 

The 35,000 mycorrhizas investigated in this study represent, of course, only 

a limited sample number. Nevertheless, since each mycorrhiza does contain a 

large number of competent fungal hyphae in direct contact with plant epidermal 

cells that die under the selection conditions, this sample number is large 

enough to reveal that HGT from the tree to the fungal partner is a quite rare 

or maybe completely missing event in EM symbiosis, at least under axenic 

conditions. 

5 Conclusions 


Taken together, many of the studies cited above demonstrate that transgenic 

plants can induce changes in soil microorganism communities. Nevertheless, 

the importance of these findings is unclear as in most studies, the modifications 

in the rhizosphere of GMPs were not compared to the natural variance 

in the rhizosphere of different plant breeds generated by conventional methods. 

For example, the mycorrhization capacity of modern wheat varieties with 

high pathogen resistance has been shown to be reduced (Hetrick et al. 1992). 

Such potentially negative effects would be considered unacceptable in the 

case of any GMP introduced into agriculture. 

Concerning the investigations on HGT, there is some evidence for the possibility 

of HGT not only between bacteria, but also between plants and 

microorganisms. In soil, HGT must be a rare event, as several attempts to 

detect HGT in field experiments failed. Despite the missing evidence for HGT 

in the field, the possibility of HGT should be kept in mind for risk assessment. 

The question to be answered in a case-to-case consideration is whether a possible 

rare HGT of the introduced genes from GMPs to microorganisms might 

cause specific problems. This is unlikely if the transgene itself is common in 

nature. For example, a natural transfer of the rolC gene from Agrobacterium to 

other bacteria seems much more likely than a HGT from the rolC transgenic 

aspen mentioned above to microorganisms. On the other hand, artificial 

genes generated by genetic engineering might have a high risk potential when 

released into nature.

192 



Agerer R (1991) Characterization of ectomycorrhiza. In: Norris JR, Read DJ, Varma AK 

(eds) Methods in microbiology, vol 23. Academic Press, London, pp 25–73 

Ahrenholtz I, Harms K, de Vries J, Wackernagel W (2000) Increased killing of Bacillus 

subtilis on the hair roots of transgenic T4 lysozyme-producing potatoes. Appl Environ 

Microbiol 66:1862–1865 

Basu U, Good AG, Taylor GJ (2001) Transgenic Brassica napus plants overexpressing aluminium-induced 

mitochondrial manganese superoxide dismutase cDNA are resistant 

to aluminium. Plant Cell Environ 24:1269–1278 

Bertolla F, Simonet P (1999) Horizontal gene transfers in the environment: natural transformation 

as a putative process for gene transfers between transgenic plants and 

microorganisms. Res Microbiol 150:375–384 

Bertolla F, Pepin R, Passelegue-Robe E, Paget E, Simkin A, Nesme X, Simonet P (2000) 

Plant genome complexity may be a factor limiting in situ the transfer of transgenic 

plant genes to the phytopathogen Ralstonia solanacearum. Appl Environ Microbiol 

66:4161–4167 

Bothe H (1993) Metabolism of inorganic nitrogen compounds. Progress in Botany 54. 

Springer, Berlin Heidelberg New York, pp 201–217 

Bryngelsson T, Gustafsson M, Green B, Lind C (1988) Uptake of host DNA by the parasitic 

fungus Plasmodiophora brassicae. Physiol Mol Plant Pathol 33:163–171 

Buscot F, Munch JC, Charcosset JY, Gardes M, Nehls U, Hampp R (2000) Recent advances 

in exploring physiology and biodiversity of ectomycorrhizas highlight the functioning 

of these symbioses in ecosystems. FEMS Microbiol Rev 699:1–14 

de Vries J, Harms K, Broer I, Kriete G, Mahn A, Düring K,Wackernagel W (1999) The bacteriolytic 

activity of transgenic potatoes expressing a chimeric T4 lysozyme gene and 

the effect of T4 lysozyme on soil- and phytopathogenic bacteria. Syst Appl Microbiol 

22:280–286 

de Vries J, Meier P, Wackernagel W (2001) The natural transformation of the soil bacteria 

Pseudomonas stutzeri and Acinetobacter sp. by transgenic plant DNA strictly 

depends on homologous sequences in the recipient cells. FEMS Microbiol Lett 195: 

211–215 

Diaz CL, Melchers LS, Hooykaas PJJ, Lugtenberg EJJ, Kijne JW (1989) Root lectin as a 

determinant of host plant specificity in the Rhizobium-legume symbiosis. Nature 

338:579–581 

Diaz CL, Spaink HP, Kijne JW (2000) Heterologous rhizobial lipochitin oligosaccharides 

and chitin oligomers induce cortical cell divisions in red clover roots, transformed 

with the pea lectin gene. Mol Plant-Microbe Int 13:268–276 

Di Giovanni GD, Wartrud LS, Seidler RJ, Widmer F (1999) Comparison of parental and 

transgenic alfalfa rhizosphere bacterial communities using Biolog GN metabolic fingerprinting 

and enterobacterial repetitive intergenic consensus sequence-PCR 

(ERIC-PCR). Microb Ecol 37:129–139 

Donegan KK, Palm CJ, Fieland VJ, Porteous LA, Ganio LM, Schaller DL, Bucao LQ, Seidler 

RJ (1995) Changes in levels, species and DNA fingerprints of soil microorganisms 

associated with cotton expressing the Bacillus thuringiensis var. kurstaki endotoxin. 

Appl Soil Ecol 2:111–124 

Donegan KK, Schaller DL, Stone JK, Ganio LM, Reed G, Hamm PB, Seidler RJ (1996) 

Microbial populations, fungal species diversity and plant pathogen levels in field 

plots of potato plants expressing the Bacillus thuringiensis var. tenebrionis endotoxin. 

Transgen Res 5:25–35 

Donegan KK, Seidler RJ, Fieland VJ, Schaller DL, Palm CJ, Ganio LM, Cardwell DM, Steinberger 

Y (1997) Decomposition of genetically engineered tobacco under field condi-


tions: persistence of the proteinase inhibitor I product and effects on soil microbial 

respiration and protozoa, nematode and microarthropod populations. J Appl Ecol 

34:767–777 

Donegan KK, Seidler RJ, Doyle JD, Porteus LA, di Giovanni G, Widmers F, Wartrud LS 

(1999) A field study with genetically engineered alfalfa with recombinant Sinorhizonium 

meliloti: effects on the soil ecosystem. J Appl Ecol 36:920–936 

Dröge M, Pühler A, Selbitschka W (1998) Horizontal gene transfer as a biosafety issue: a 

natural phenomenon of public concern. J Biotechnol 64:75–90 

Dunfield KE, Germida JJ (2001) Diversity of bacterial communities in the rhizosphere 

and root interior of field-grown genetically modified Brassica napus. FEMS Microbiol 

Ecol 38:1–9 

Düring K, Porsch P, Fladung M, Lörz H (1993) Transgenic potato plants resistant to the 

phytopathogenic bacterium Erwinia carotovora. Plant J 3:587–598 

Fladung M, Muhs H-J (2000) Field release with Populus tremula (rolC-gene) in Großhansdorf. 

In: Umweltbundesamt (ed) Release of transgenic trees – present achievements, 

problems, future prospects. Humboldt-Universität, Berlin, pp 40–45 

Fladung M, Kumar S, Ahuja MR (1997) Genetic transformation of Populus genotypes 

with different chimaeric gene constructs: transformation efficiency and molecular 

analysis. Transgen Res 6:111–121 

Fladung M, Kaldorf M, Buscot F, Muhs H-J (2000) Untersuchungen zur Stabilität und 

Expressivität fremder Gene in Aspenklonen (Populus tremula und P. tremula x P. 

tremuloides) unter Freilandbedingungen. In: Schiemann J (ed) Biologische Sicherheitsforschung 

bei Freilandversuchen mit transgenen Organismen und anbaubegleitendes 

Monitoring. BEO (Projektträger Biologie, Energie, Umwelt des BMBF), Braunschweig–Jülich, 

Braunschweig, pp 77–83 

Gebhard F, Smalla K (1998) Transformation of Acinetobacter sp. strain BD413 by transgenic 

sugar beet DNA. Appl Environ Microbiol 64:1550–1554 

Gebhard F, Smalla K (1999) Monitoring field release of genetically modified sugar beets 

for persistence of transgenic plant DNA and horizontal gene transfer. FEMS Microbiol 

Ecol 28:261–272 

Gianinazzi-Pearson V, Arnould C, Oufattole M, Arango M, Gianinazzi S (2000) Differential 

activation of H + -ATPase genes by an arbuscular mycorrhizal fungus in root cells 

of transgenic tobacco. Planta 211:609–613 

Glandorf DCM, Bakker PAHM, van Loon LC (1997) Influence of the production of 

antibacterial and antifungal proteins by transgenic plants on the saprophytic soil 

microflora. Acta Bot Neerl 46:85–104 

Griffiths BS, Geoghegan IE, Robertson WM (2000) Testing genetically engineered potato, 

producing the lectins GNA and Con A, on non-target soil organisms and processes. J 

Appl Ecol 37:159–170 

Hampp R, Ecke M, Schaeffer C, Wallenda T, Wingler A, Kottke I, Sundberg B (1996) 

Axenic mycorrhization of wild type and transgenic hybrid aspen expressing T-DNA 

indoleacetic acid-biosynthetic genes. Tree 11:59–64 

Hansen Jesse LC, Obrycki JJ (2000) Field deposition of Bt transgenic corn pollen: lethal 

effects on the monarch butterfly. Oecologia 125:241–248 

Hetrick BAD, Wilson GWT, Cox TS (1992) Mycorrhizal dependence of modern wheat 

varieties, landraces, and ancestors. Can J Bot 70:2032–2040 

Heuer H, Smalla K (1999) Bacterial phyllosphere communities of Solanum tuberosum L. 

and T4-lysozyme-producing transgenic variants. FEMS Microbiol Ecol 28:357–371 

Heuer H, Kroppenstedt RM, Lottmann J, Berg G, Smalla K (2002) Effects of T4 lysozyme 

release from transgenic potato roots on bacterial rhizosphere communities are negligible 

relative to natural factors. Appl Environ Microbiol 68: 1325–1335

194 


Hoffmann T, Golz C, Schieder O (1994) Foreign DNA sequences are received by a wildtype 

strain of Aspergillus niger after co-culture with transgenic higher plants. Curr 

Genet 27:70–76 

Hu WJ, Harding SA, Lung J, Popko JL, Ralph J, Stokke DD, Tsai CJ, Chiang VL (1999) 

Repression of lignin biosynthesis promotes cellulose accumulation and growth in 

transgenic trees. Nat Biotechnol 17:808–812 

Jimenez-Bermudez S, Redondo-Nevado J, Munoz-Blanco J, Caballero JL, Lopez-Aranda 

JM, Valpuesta V, Pliego-Alfaro F, Quesada MA, Mercado JA (2002) Manipulation of 

strawberry fruit softening by antisense expression of a pectate lyase gene. Plant Physiol 

128:751–759 

Kaldorf M, Buscot F, Fladung M, Muhs H-J (2001) Establishment of mycorrhizas on rolCtransgenic 

aspen in a field trial. Abstract of the conference “Molekularbiologie der 

Pilze”, Jena, 30.9.-3.10.2002, pp 50 

Kaldorf M, Fladung M, Muhs H-J, Buscot F (2002) Mycorrhizal colonization of transgenic 

aspen in a field trial. Planta 214: 653–660 

Kottke I, Oberwinkler F (1986) Mycorrhiza of forest trees – structure and function. Tree 

1:1–24 

Kottke I, Oberwinkler F (1987) The cellular structure of the Hartig net: coenocytic and 

transfer cell-like organization. Nord J Bot 7:85–95 

Krishnapillai V (1996) Horizontal gene transfer. J Genet 75:219–232 

Losey JE, Rayor LS, Carter ME (1999) Transgenic pollen harms monarch larvae. Nature 

399:214 

Lottmann J, Berg G (2001) Phenotypic and genotypic characterization of antagonistic 

bacteria associated with roots of transgenic and non-transgenic potato plants. Microbiol 

Res 156:75–82 

Lottmann J, Heuer H, Smalla K, Berg G (1999) Influence of transgenic T4-lysozyme-producing 

potato plants on potentially beneficial plant-associated bacteria. FEMS Microbiol 

Ecol 29:365–377 

Lottmann J, Heuer H, de Vries J, Mahn A, Düring K, Wackernagel W, Smalla K, Berg G 

(2000) Establishment of introduced antagonistic bacteria in the rhizosphere of transgenic 

potatoes and their effect on bacterial community. FEMS Microbiol Ecol 

33:41–49 

Lukow T, Dunfield PF, Liesack W (2000) Use of the T-RFLP technique to assess spatial 

and temporal changes in the bacterial community structure within an agricultural 

soil planted with transgenic and non-transgenic potato plants. FEMS Microbiol Ecol 

32:241–247 

Masoud SA, Zhu Q, Lamb C, Dixon RA (1996) Constitutive expression of an inducible b- 

1,3-glucanase in alfalfa reduces disease severity caused by the oomycete pathogen 

Phytophthora megasperma f. sp. medicagini, but does not reduce disease severity of 

chitin-containing fungi. Transgen Res 5:313–323 

Morra MJ (1994) Assessing the impact of transgenic plant products on soil organisms. 

Mol Ecol 3:53–55 

Mullin TJ, Bertrand S (1998) Environmental release of transgenic trees in Canada – 

potential benefits and assesment of biosafety. Forestry Chron 74:203–219 

Nehls U, Bock A, Ecke M, Hampp R (2001) Differential expression of the hexose-regulated 

fungal genes AmPAL and AmMst1 within Amanita/Populus ectomycorrhizas. 

New Phytol 150:583–589 

Nielsen KM, Gebhard F, Smalla K, Bones AM, van Elsas JD (1997) Evaluation of possible 

horizontal gene transfer from transgenic plants to the soil bacterium Acinetobacter 

calcoaceticus BD413. Theor Appl Genet 95:815–821 

Nielsen KM, Bones AM, Smalla K, van Elsas JD (1998) Horizontal gene transfer from 

transgenic plants to terrestrial bacteria – a rare event? FEMS Microbiol Rev 22:79–103


Nielsen KM, van Elsas JD, Smalla K (2000) Transformation of Acinetobacter sp. strain 

BD413 (pFG4DnptII) with transgenic plant DNA in soil microcosms and effects of 

kanamycin on selection of transformants. Appl Environ Microbiol 66:1237–1242 

Oger P, Mansouri H, Dessaux Y (2000) Effect of crop rotation and soil cover on alteration 

of the soil microflora generated by the culture of transgenic plants producing opines. 

Mol Ecol 9:881–890 

Owen MDK (2000) Current use of transgenic herbicide-resistant soybean and corn in 

the USA. Crop Prot 19:765–771 

Perlak FJ, Oppenhuizen M, Gustafson K, Voth R, Sivasupraniam S, Heering D, Carey B, 

Ihrig RA, Roberts JK (2001) Development and commercial use of Bollgard® cotton in 

the USA – early promises versus today’s reality. Plant J 27:489–501 

Pilon-Smits EAH, Terry N, Sears T, van Dun K (1999) Enhanced drought resistance in 

fructan-producing sugar beet. Plant Physiol Bioch 37:313–317 

Punja ZK (2001) Genetic engineering of plants to enhance resistance to fungal 

pathogens – a review of progress and future prospects. Can J Plant Pathol 23:216–235 

Quiroga GOS, Fraschina AA (1997) Evaluation of sensory attributes and biochemical 

parameters in transgenic tomato fruit with reduced polygalacturonase activity. Food 

Sci Technol Int 3:93–102 

Romer S, Fraser PD, Kiano JW, Shipton CA, Misawa N, Schuch W, Bramley PM (2000) Elevation 

of the provitamin A content of transgenic tomato plants. Nat Biotechnol 

18:666–669 

Saroha MK, Sridhar P, Malik VS (1998) Glyphosate-tolerant crops: genes and enzymes. J 

Plant Biochem Biotechnol 7:65–72 

Saxena D, Stotzky G (2001) Bacillus thuringiensis (Bt) toxin released from root exudates 

and biomass of Bt corn has no apparent effect on earthworms, nematodes, protozoa, 

bacteria, and fungi in soil. Soil Biol Biochem 33:1225–1230 

Schlüter K, Fütterer J, Potrykus I (1995) “Horizontal” gene transfer from a transgenic 

potato line to a bacterial pathogen (Erwinia chrysanthemi) occurs – if at all – at an 

extremely low frequency. Biotech 13:1094–1098 

Shelton AM, Zhao JZ, Roush RT (2002) Economic, ecological, food safety, and social consequences 

of the development of Bt transgenic plants. Annu Rev Entomol 47:845–881 

Siciliano SD, Theoret CM, de Freitas JR, Hucl PJ, Germida JJ (1998) Differences in the 

microbial communities associated with the roots of different cultivar of canola and 

wheat. Can J Microbiol 44:844–851 

Smith SE, Read DJ (1997) Mycorrhizal symbiosis, 2nd edn. Academic Press, San Diego 

Solomon-Blackburn RM, Barker H (2001) Breeding virus resistant potatoes (Solanum 

tuberosum): a review of traditional and molecular approaches. Heredity 86:17–35 

Staehelin C, Charon C, Boller T, Crespi M, Kondorosi A (2001) Medicago truncatula 

plants overexpressing the early nodulin gene enod40 exhibit accelerated mycorrhizal 

colonization and enhanced formation of arbuscules. Proc Natl Acad Sci USA 

98:15366–15371 

Straubinger B, Straubinger E, Wirsel S, Turgeon G,Yoder O (1992) Versatile fungal transformation 

vectors carrying the selectable bar gene of Streptomyces hygroscopicus. 

Fungal Genet Newslet 39:82–83 

Thelen JJ, Ohlrogge JB (2002) Metabolic engineering of fatty acid biosynthesis in plants. 

Metab Eng 4:12–21 

Tuominen H, Sitbon F, Jacobsson C, Sandberg G, Olsson O, Sundberg B (1995) Altered 

growth and wood characteristics in transgenic hybrid aspen expressing Agrobacterium 

tumefaciens T-DNA indoleacetic acid-biosynthetic genes. Plant Physiol 

109:1179–1189 

Vance CP, Graham PH (1995) Nitrogen fixation in agriculture: application and perspectives. 

In: Tikhonovich IA, Provorov NA, Romanov VI, Newton WE (eds) Nitrogen fixation: 

fundamentals and applications. Kluwer, St. Petersburg, pp 77–86

196 


van Rhijn P, Fujishige NA, Lim PO, Hirsch AM (2001) Sugar-binding activity of pea lectin 

enhances heterologous infection of transgenic alfalfa plants by Rhizobium leguminosarum 

biovar viciae. Plant Physiol 126:133–144 

Vierheilig H,Alt M, Neuhaus J-M, Boller T,Wiemken A (1993) Colonization of transgenic 

Nicotiana sylvestris plants, expressing different forms of Nicotiana tabacum chitinase, 

by the root pathogen Rhizoctonia solani and by the mycorrhizal symbiont Glomus 

mosseae. Mol Plant-Microbe Int 6:261–264 

Vierheilig H, Alt M, Lange J, Gut-Rella M, Wiemken A, Boller T (1995) Colonization of 

transgenic tobacco constitutively expressing pathogenesis-related proteins by the 

vesicular arbuscular mycorrhizal fungus Glomus mosseae. Appl Environ Microbiol 

61:3031–3034 

Warwick SI, Beckie HJ, Small E (1999) Transgenic crops: new weed problems for Canada? 

Phytoprotection 80:71–84 

White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal 

ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White 

TJ (eds) PCR protocols: a guide to methods and applications. Academic Press, San 

Diego, pp 315–322 

Wolfenbarger LL, Phifer PR (2000) The ecological risks and benefits of genetically engineered 

plants. Science 290:2088–2093 

Wöstemeyer J, Wöstemeyer A, Voigt K (1997) Horizontal gene transfer in the rhizosphere: 

a curiosity or a driving force in evolution? Adv Bot Res 24:399–429 

Ye X, Al-Babili S, Klöti A, Zhang J, Lucca P, Beyer P, Potrykus I (2000) Engineering the 

provitamin A (b-carotene) biosynthetic pathway into (carotenoid-free) rice endosperm. 

Science 287:303–305 

Zhang HX, Blumwald E (2001) Transgenic salt-tolerant tomato plants accumulate salt in 

foliage but not in fruit. Nat Biotechnol 19:765–768

12 Interaction Between Soil Bacteria and 

Ectomycorrhiza-Forming Fungi 



Roots constitute important plant organs for water and nutrient uptake. However, 

they also release a wide range of carbon compounds of low molecular 

weight which are called exudates. These compounds form the basis for an 

environment rich in diversified microbiological populations, the rhizosphere 

(Hiltner 1904; the rhizosphere has been defined as a narrow zone of soil which 

is influenced by living roots). Bacteria are an important part of these populations. 

In addition, roots of most terrestrial plants develop symbiotic structures 

(mycorrhiza) with soil-borne fungi. In these interactions, the fungal 

partner provides the plant with improved access to water and nutrients in the 

soil due to more or less complex hyphal structures that emanate from the root 

surface and extend far into the soil. The plant, in return, supplies carbohydrates 

for fungal growth and maintenance (Smith and Read 1997; Hampp and 

Schaeffer 1998). Due to leakage and the turnover of mycorrhizal structures, 

these solutes are also released into the rhizosphere where they can be accessed 

by other microorganisms. The term “rhizosphere” has, therefore been 

extended to “mycorrhizosphere” (Oswald and Ferchau 1968). In the latter, two 

different zones can be distinguished: the surface of the mycorrhizal structure, 

affected by both root and fungus, and that occupied by fungal hyphae only. 

The latter has been termed “hyphosphere” (Marschner 1995). Soil free of plant 

and fungal components has been referred to as “bulk soil” (Andrade et al. 

1997). It is reasonable to believe that these different spheres may differ in their 

microbial activities, and it has been shown that microbial communities within 

the rhizosphere are distinct from those of nonrhizosphere soil (Curl and Truelove 

1986; Whipps and Lynch 1986). 

Interactions between soil bacteria and symbiotic fungi can be both negative 

and positive. Mycorrhiza-forming fungi have been shown to reduce bacterial 

viability (Meyer and Linderman 1986). Due to the transfer and exudation 

of plant-derived organic compounds to soil microsites not accessible to 

roots, fungi can promote bacterial growth and survival (Hobbie 1992; Söder- 




198 


ström 1992; Frey-Klett et al. 1997). Furthermore, there is evidence that soil 

bacteria can also enhance the formation of mycorrhizal structures, either by 

promoting growth (helper bacteria; Garbaye 1994) or by protecting them 

from pathogenic micro-organisms. 

2 Bacteria 

Free-living soil bacteria which are beneficial for plant growth are named 

plant-growth-promoting rhizobacteria (PGPR; Kloepper et al. 1989). These 

include species and strains which belong to the genera Azotobacter, Pseudomonas, 

Burkholderia, Acetobacter, Herbaspirillum and Bacillus (Glick 1995; 

Probanza et al. 1996; see also Barea, Chap. 20, this Vol.). 

In contrast to agricultural soils where bacteria dominate, fungi constitute 

the major fraction of the microbial flora of forest soils especially in acidic, 

organic soils under cold climates (Söderström et al.1983; Nohrstedt et al.1989). 

3 Bacterial Community Structure 

Abundance and micro-stratification of bacteria and fungi inhabiting the 

organic layers of a Scots pine forest were analyzed by Berg et al. (1998). They 

counted approx. 5x10 9 bacteria/g dry wt. of organic matter. The mean bacterial 

biomass was between 0.34 and 0.25 mg C/g dry wt. of organic matter. This 

compared to a fungal biomass of between 0.05 and 0.009 mg C /g dry wt.. 

Abundance of bacteria and fungi is influenced by the soil water content, 

and clear seasonal patterns with a peak of microbial biomass in winter were 

reported. The ratio of carbon due to bacteria biomass/fungal biomass was 2:1 

in fresh litter and 28:1 in humus. This is in contrast to reports which give evidence 

that in acid forest soils the fungal biomass exceeds that of bacteria 

(Söderström et al. 1983; Nohrstedt et al. 1989; see also citations in Berg et al. 

1998). The ratio may, however, be altered by increasing N input (Verhoef and 

Brussaard 1990), which may interfere with existing soil food webs (Moore and 

Hunt 1988). 

Generally, bacterial densities in forest soils are an order of magnitude 

lower than those determined from nursery peat (Timonen et al. 1998). In forest 

humus, the common soil species, Pseudomonas fluorescens, a potential 

mycorrhiza helper bacterium in pot cultures, could not be identified in the 

acidic environment. In contrast, spore-forming bacteria such as Bacillus ssp., 

which are also classified as helper bacteria (Garbaye and Duponnois 1992), 

could be identified in mycorrhizospheres of pine. 

Following colonization with ectomycorrhiza (ECM)-forming fungi,changes 

in root exudates result in greater numbers of microbes in the rhizosphere and 

a change in the species types found (Oswald and Ferchau 1968; Malajczuk 1979;

12 Interaction Between Soil Bacteria and Ectomycorrhiza-Forming Fungi 199 

Linderman 1988).Different ectomycorrhizospheres indicate an overall bacterial-enrichment 

gradient from bulk soil to rhizosphere to mycorrhizosphere 

(Frey et al. 1997). 

Active exudation of readily usable carbon-rich substrates into the mycorrhizosphere 

results in enhanced catabolic community development in natural 

lignin-rich forest humus (Heinonsalo et al. 2000). The driving force for community 

development/diversity is obviously the continuous supply of carbohydrates 

from the host plant.A substrate-utilization analysis showed that simple 

carbohydrates are readily used by all inner and outer mycorrhizosphere bacteria 

(Timonen et al. 1998). Mannitol, an important intermediate storage form 

of carbohydrate in many fungi, was preferred by bacterial populations from 

all types of mycorrhizospheres. Bacteria from bulk soil, in contrast, show a 

preference for organic and amino acids (Timonen et al. 1998). 

Bacterial communities from mycorrhizospheres of Pinus sylvestris are 

characterized by a preferential utilization of carbohydrates and organic and 

amino acids (Frey et al. 1997; Timonen et al. 1998; Frey-Klett et al. 2000). Bacteria 

associated with Suillus bovinus ectomycorrhiza favored mannitol, while 

those co-occurring with Paxillus involutus preferred fructose as carbon 

source. Additional carbon sources used by the bacteria (trehalose, glycogen, 

mannitol, N-acetyl-D-glucosamine; Heinonsalo et al. 2000) suggest a limited 

saprophytic turnover in acidic forest soils. 

Rhizosphere bacteria can also make use of contaminating hydrocarbons as 

shown by a decrease in nonpolar hydrocarbons in the mycorrhizosphere 

(Heinonsalo et al. 2000). 

4 Association of Bacteria with Fungal/Ectomycorrhizal 

Structures 

Symbiotic interactions between roots and soil fungi comprise different types, 

the most important ones being endo- and ectomycorrhizas.Endomycorrhiza is 

the most abundant form in soils of most ecosystems. Typical for this mycorrhiza 

is the presence in roots of a series of structures which facilitate solute 

exchange between the partners of symbiosis. These comprise arbuscules, vesicles, 

coiled hyphae etc. (Smith and Read 1997). Ectomycorrhizas, the focus of 

this chapter, are mainly formed with roots of forest trees belonging to temperate 

and boreal regions.They are characterized by defined morphological structures. 

Extraradical mycelia which exploit the soil, form a mantle structure 

around fine roots of their host plant. From there hyphae emanate into the cell 

wall of cortex cells, forming a large surface area (Hartig net) which facilitates 

solute exchange (Smith and Read 1997; see also Kottke Chap. 13, this Vol.). 

In contrast to endomycorrhiza-forming fungi (compare Barea, Chap. 20, 

this Vol.), information about the interaction between bacteria and ectomycorrhiza-forming 

fungi is still rather limited.

200 


Pioneering work in this field has been carried out by Garbaye (for a review 

see Garbaye 1994). Experiments carried out with Picea abies, Pinus nigra, 

Pinus sylvestris, Pseudotsuga menziesii, and Quercus robur (Garbaye et al. 

1992) indicated that soil bacteria can stimulate the inoculation of roots with 

ectomycorrhiza-forming fungi, thereby also reducing the adverse effect of 

pathogens. Both effects resulted in a better seedling growth, and thus the term 

“helper bacteria” was coined. For more recent work, see Dunstan et al. (1998) 

and Poole et al. (2001). 

5 Bacteria Associated with Sporocarps and Ectomycorrhiza 

Twenty seven bacterial species were isolated from both the sporocarps of Suillus 

grevillei and the ECMs of S. grevillei/Larix decidua (Varese et al. 1996). The 

genera Pseudomonas, Bacillus, and Streptomyces were predominant. From 

sporocarps of white truffles (Tuber sp.), bacterial strains such as Micrococcus, 

Moraxella, Staphylococcus and Pseudomonas could be isolated (Citterio et al. 

1995). Gram-positive bacteria seldom stimulated in vitro fungal growth. 

Among gram-negative bacteria, Pseudomonas strains enhanced growth. 

Streptomyces significantly inhibited the fungus. Bacterial supernatants were 

not effective.Volatiles enhanced fungal growth to some extent, but not significantly. 

Most of the bacteria isolated produced siderophores. 

A distinction between the different structures of ECM showed that bacteria 

primarily occurred on the surface of the mantle and in the interhyphal spaces 

(Schelkle et al.1996),but also deep within the mantle (Foster and Marks 1967). 

Bacteria of subclasses of proteobacteria (containing plant-growth-promoting 

rhizobacteria such as Burkholderia, Azospirillum, Acetobacter and Herbaspirillum) 

were detected in high numbers on mantle surfaces (Mogge et al. 

2000). The two most common fungi on beech, Lactarius vellereus and Lactarius 

subdulcis, were associated with members of the a- and b-subclasses of the 

proteobacteria. These bacteria have been shown to be abundant in winter and 

early spring (Timonen et al. 1998). 

Electron microscopy of ECM with Pinus sylvestris and S. bovinus and Paxillus 

involutus (Nurmiaho-Lassila et al. 1997) also revealed bacteria on the 

mantle surface and at inter- and intracellular locations in the mantle and the 

Hartig net (S. bovinus). Fungal strands were colonized only by a few bacteria, 

while the outermost external fine hyphae had extensive monolayers of bacteria 

attached. 

ECM with P. involutus were mostly devoid of bacteria, while the external 

mycelium supported bacteria (Nurmiaho-Lassila et al.1997).From their observations, 

the authors conclude that single ECM fungi create defined mycorrhizosphere 

habitats with distinct populations of bacteria. Knowing that several 

different types of ECM can be formed on the same root in close vicinity,a large 

local biodiversity of ECM-specific bacterial populations could be postulated.


Intracellular bacteria as detected in certain endomycorrhiza-forming fungi 

(Bianciotto et al. 1996) are also described for P. sylvestris/Paxillus involutus 

mycorrhizospheres; Nurmiaho-Lassila et al. (1997) identified Burkholderia 

cepacia in extracts from the respective mycorrhizas. Intracellular bacteria 

were also detected in the mycelium of the ectomycorrhizal fungus Laccaria 

bicolor S238 N (Bertaux, Frey-Klett, Hartmann, Schmidt, Garbaye, pers. 

comm.). 

6 Benefits from Bacteria/Ectomycorrhiza Interactions 

Bacteria are producers of antibiotics. Newer studies show that a variety of 

genera, species and strains of these bacteria (e.g., Bacillus subtilis, Pseudomonas 

fluorescens) can inhibit the growth of pathogenic fungi (Fusarium 

oxysporum; Cylindrocarpon sp.) in co-culture with ECM fungi such as Laccaria 

bicolor, L. proxima and Suillus granulatus (Schelkle and Peterson 1996). 

They can, however, also affect ECM fungi. Burkholderia cepacia significantly 

reduced the in vitro growth of mycelia of Paxillus involutus. B. cepacia, 

Pseudomonas chlororaphis, Ps. fluorescens, and P. involutus reduced the 

mycelial growth of the root pathogens Fusarium moniliforme, F. oxysporum, 

and Rhizoctonia solani (Pedersen et al. 1999). Burkholderia cepacia also 

reduced the formation of ECM short roots by P. involutus on lodgepole pine 

and white spruce seedlings in the short term (2 months), but not upon longer 

incubation (4 months). Pseudomonas chlororaphis and Ps. fluorescens did not 

reduce mycelial growth and mycorrhiza formation. Treatment of the seedlings 

with either B. cepacia or P. involutus increased their survival in the presence of 

some of the root pathogens investigated. From the data given by Pedersen et 

al. (1999) it can thus be concluded that the simplest protective system exists 

when bacteria do not inhibit fungal growth/mycorrhiza formation, but affect 

potential root pathogens (see also Frey-Klett et al. 2000). There are obviously 

also synergistic effects between these bacteria and ECM fungi such as L. proxima 

in inhibiting pathogens (Schelkle and Peterson 1996). 

In addition to preventing pathogen attacks, bacteria can also support ECM 

development directly. This has been shown for different host/fungus combinations 

(Garbaye 1994; Frey-Klett et al. 1997). In general, the effect ascribed to 

the presence of bacteria consists of a significantly increased number of 

infected root tips (Dunstan et al. 1998; Poole et al. 2001). 

This should also have an impact on the respective host plant. Probanza et 

al. (2001) investigated the effect of a co-cultivation with P. tinctorius and 

PGPR belonging to the genus Bacillus in enhancing growth of Pinus pinea. 

Although the bacterial strains promoted seedling growth, this effect could not 

be related to a synergistic interaction with the fungus. A stimulation of shoot 

and root biomass production was also observed for Acacia holoserica 

seedlings, mycorrhizal with Pisolithus alba and after co-cultivation with two

202 


fluorescent pseudomonad strains (Founoune et al. 2002). After 3 months of 

co-culture, the bacterial inoculants disappeared, showing how difficult such 

experiments are to interpret. Obviously, the amount of inoculum supplied can 

also play an important role (Frey-Klett et al. 1999). 

7 Possible Mechanisms of Interaction 

As pointed out by Schelkle and Peterson (1996), and in addition to the production 

of antibiotics, protective or “helper” effects could be due to competition 

for nutrients in the rhizosphere. The formation of siderophores, for 

example could be such a mechanism. Siderophores are iron chelators which 

make iron available for uptake by the bacteria. As these compounds are 

species-specific, Fe-chelates can only be taken up by those bacteria that are 

able to produce them. Protective bacteria synthesizing siderophores could 

thus out-compete pathogens with regard to Fe (Neidhardt et al. 1990). Similar 

mechanisms are known for ECM fungi (Watteau and Berthelin 1990). 

Siderophore release from bacteria into the mycorrhizosphere could also 

improve absorption of Fe by the mycorrhizal fungus. 

Protection from pathogens could, however, also be a mass effect, simply 

due to the large number of nonpathogenic bacteria that accumulate in the rhizosphere 

due to the high nutrient supply. However, as outlined by Garbaye 

(1994), there can be many more mechanisms, such as an improved receptivity 

of the root for mycorrhizal infection, a modification of the rhizospheric soil, 

improvement of the root-fungus recognition, stimulation of germination of 

fungal propagules, as well as an enhancement of fungal growth in the rhizosphere 

(see also Brule et al. 2001) which would increase the probability of contact 

between fungus and root (compare Dunstan et al. 1998). 

In nutrient-poor acidic forest soils modification by micro-organisms 

should be an important factor; the C-rich environment provided by the plant 

is attractive for soil micro-organisms, leading to the formation of functionally 

compatible microbial communities. These are jointly able to co-mobilize soil 

nutrients such as P and N in and around the vegetative mycelium. In addition, 

N-fixing bacterial species including Bacillus spp. are possibly present in the 

mycorrhizosphere of forest trees (Li et al. 1992) as the vegetative mycelium 

represents a niche that is ideally suited for the selection and enrichment of 

associative N-fixing bacteria (Sen 2000). 

In many of the possible mechanisms, phytohormones such as IAA could 

play an important role. A study on the rooting of derooted shoot hypocotyls 

of spruce showed that Laccaria bicolor and Pseudomonas fluorescens BBc6 

(MHB) both increased the number of roots formed per rooted hypocotyl 

(Karabaghli et al. 1998). The same effect was caused by the addition of IAA 

alone (control). Both organisms produced IAA in pure culture.


8 Biochemical Evidence for Interaction 

Streptomycetes are widely distributed saprobic soil bacteria which produce a 

wide range of compounds affecting other organisms. Becker et al. (1999) studied 

mycorrhiza-associated Streptomyces strains with regard to their effect on 

the protein pattern of ECM-forming Laccaria bicolor and Cenococcum 

geophilum, and on two pathogenic fungi (Armillaria ostoyae and A. gallica). 

One of the strains improved the growth of ECM fungi while inhibiting that of 

the pathogens. The effects could be related to differences in fungal gene 

expression (mRNA) and the protein profile obtained after in vitro translation; 

new proteins were induced by the strain supporting the growth of ECM-fungi, 

while the Streptomyces strain leading to adverse effects caused the disappearance 

of bands. 

New techniques allow for the annotation of such protein spots. Only this 

way is it possible to obtain information about the function of the respective 

protein. In the following, we give an example for such an approach for 

Amanita muscaria. 

A. muscaria is a fungus which develops ECM with a wide range of forest 

trees. Grown in dual culture with bacterial isolates obtained from soil samples 

in close vicinity to spruce roots, this fungus exhibited distinct changes in protein 

pattern. Most effective were isolates which were members of the Actinomycetes. 

After 10 weeks of dual inoculation of A. muscaria with a respective soil bacterium 

in Petri dishes, the hyphae of the fungal mycelium changed their phenotype 

in comparison to controls. The hyphal diameter decreased, while cell 

length and the extent of hyphal branching increased. To investigate the molecular 

mechanisms behind these morphological changes, the proteome of A. 

muscaria was screened for differentially expressed polypeptides (two-dimensional 

SDS-PAGE electrophoresis). In Fig. 1, the protein patterns for mycelium 

from A. muscaria in pure culture (A) and after dual culture with the bacterium 

(B) are compared. The pattern reveals about 100 well-separated protein 

spots of which about 20 polypeptides were recognized as differentially 

expressed. Twelve spots were excised from the gels for sequence analysis by 

MALDI-TOF (matrix-assisted laser desorption/ionization time of flight) mass 

spectrometry. 

Reliable matches to known protein sequences with the peptide mass fingerprints 

were obtained for 7 of 12 selected spots.As an example, Table 1 gives 

the peptide masses obtained from protein spot no. 78. They show identity with 

several predicted peptide masses of actin 1 from the saprophytic fungus 

Schizophyllum commune and for actin 2 from the ectomycorrhizal fungus 

Suillus bovinus (Tarkka et al. 2000). 

Actins are highly conserved cytoskeletal proteins that are present in all 

eucaryotic cells. They are probably involved in various processes such as cytoplasmic 

streaming, cell shape determination, tip growth, cell wall deposition,

204 


Fig. 1. Two-dimensional maps of mycelial proteins from Amanita muscaria. Protein 

(300 mg) was loaded onto IEF gels. A A. muscaria pure culture; B dual culture of A. muscaria 

with a soil bacterium. Differentially expressed proteins are indicated in A (open 

circles). Downregulation (closed inverted triangles) or upregulation (closed triangles) of 

the analogous spots is indicated in B. (Gels were stained with SYPRO Ruby fluorescent 

dye; molecular probes, Eugene, OR, USA.). Results obtained from the computer-aided 

evaluation were rigorously compared by visual analysis of the original gels. Stained protein 

spots were excised and digested in-gel with modified trypsin (Promega) according 

to Williams and Stone (1997) 

etc. (Sheterline et al. 1992). At first sight, it looks surprising that a protein 

which is important in cell shape determination is downregulated when 

hyphal morphology changes. However, the decrease in the amount of actin 

coincides with the decrease of the fungal diameter. Interestingly, the amount 

of actin protein increases during fruiting body formation of A. muscaria.The 

hyphae of the fruiting body are swollen and branched (Manachére et al. 1983) 

and the results thus indicate differential regulation of actin during changes in 

A. muscaria hyphal growth pattern. 

These results emphasize the usefulness of proteome analysis in identifying 

molecular events occurring in fungus bacteria interactions.

Table 1. Protein features and data from the peptide mass fingerprint of the protein in spot no. 78. Comparison with the 

computer-generated peptides from Schizophyllum commune and Suillus bovinus indicates identity with fungal actins. Mass 

spectra of peptide mixtures were obtained by MALDI-TOF (matrix-assisted laser desorption/ionization time of flight) mass 

spectrometer (Dr. C. Niehaus, University of Bielefeld, Germany). The database search using the proteolytic peptide masses 

was performed with the Mascot program developed by Perkins et al. (1999) 


Protein identity p78 Actin 1 Actin 2 

Organism Amanita muscaria Schizophyllum commune Suillus bovinus 

MW (Da) Approx. 42,000 41,876 41,979 

pI 5.35 5.30 5.31 

Observed peptides Calculated peptides Calculated peptides 

MW (Da) MW (Da)/sequence MW (Da)/sequence 

780.59 780.45/IVAPPER 780.45/IVAPPER 

908.69 908.54/IVAPPERK 908.54/IVAPPERK 

1141.69 1141.54/GYPFTTTAER - 

1485.89 1485.68/QEYDESGPGIVHR 1485.68/QEYDESGPGIVHR 

1589.19 1588.88/LDLAGRDLTDFLIK 1589.81/DLTDCLIKNLTER 

1790.19 1789.88/SYELPDGQVITIGNER 1789.88/SYELPDGQVITIGNER

206 


9 Impacts of Environmental Pollution 

Microcosms with S. bovinus, P. involutus/Pinus sylvestris in forest humus 

amended with petroleum hydrocarbon were investigated with regard to fungus/bacteria 

responses (Sarand et al. 1998). Hyphae emanating from mycorrhizas 

formed patches around contaminations with a microbial biofilm at the 

hydrocarbon/fungus interface. Bacteria consisted of isolates of Ps. fluorescens. 

This opens possibilities for the bioremediation of environmental pollutants 

by the use of degradative micro-organisms. Sarand et al. (1999) tested m-toluate 

as a model compound for petrol-contaminated sites. Fungal survival (Suillus 

bovinus) on medium containing this compound was increased in co-culture 

on agar plates with degradative bacterial strains of Ps. fluorescens. The 

activity of the bacterium was not affected in a tripartite system containing S. 

bovinus/Pinus sylvestris mycorrhizas. The fungus was not able to degrade mtoluate, 

although mycorrhizal fungi are able to produce enzymes capable of 

degrading complex organic compounds (see Sarand et al. 1999). 

10 Conclusions 

Many of the experiments carried out in order to investigate a possible interaction 

between bacteria and ECM-forming fungi have been carried out under 

sterile conditions or in pot cultures. Experience shows that, when transferred 

to field conditions the respective bacteria will not thrive, but will soon be substituted 

by other genera, species or strains. Thus, a more promising approach 

is to collect bacteria from mycorrhizas obtained from natural sites and introduce 

these into laboratory experiments, with dual cultures being the easiest 

way to investigate molecular interaction. In our experience, Gram-positive 

bacteria such as Actinomycetes, although largely neglected, are abundant at 

least in mycorrhizospheres of spruce stands, and are thus important candidates 

for future approaches. 

Acknowledgements. We gratefully acknowledge critical reading and helpful suggestions 

by Dr. Garbaye (INRA, Nancy, France). As far as our own work is concerned, we are 

indebted to the Deutsche Forschungsgemeinschaft for financial support (Graduate 

School “Infection Biology”)




and hyphosphere soils of different arbuscular-mycorrhizal fungi. Plant Soil 

192:71–79 

Becker DM, Bagley ST, Podila GK (1999) Effects of mycorrhizal-associated streptomycetes 

on growth of Laccaria bicolor, Cenococcum geophilum, und Armillaria 

species and on gene expression in Laccaria bicolor. Mycologia 91:33–40 

Berg MP, Kniese JP,Verhoef HA (1998) Dynamics and stratification of bacteria and fungi 

in the organic layers of a Scots pine forest soil. Biol Fertil Soils 26:313–322 

Bianciotto V, Bandi C, Minerdi D, Sironi M, Tichy HV, Bonfante P (1996) An obligately 

endosymbiotic mycorrhizal fungus itself harbors obligately intracellular bacteria. 


Brule C, Frey-Klett P, Pierrat JC, Courrier S, Gerard F, Lemoine MC, Rousselet JL, Sommer 

J, Garbaye J (2001) Survival in the soil of the ectomycorrhizal fungus Laccaria bicolor 

and the effects of a mycorrhiza helper Pseudomonas fluorescens. Soil Biol Biochem 

33:1683–1694 

Citterio B, Cardoni P, Potenza L, Amicucci A, Atocchi V, Gola G, Nuti M (1995) Isolation 

of bacteria from sporocarps of Tuber magnatum pico, tuber borchii vitt. and Tuber 

maculatum vitt.: identification and biochemical characterization. In: Stocchi V, Bonfante 

P, Nuti M (eds) Biotechnology of ectomycorrhizae. Plenum Press, New-York, pp 

241–248 

Curl EA, Truelove B (1986) The rhizosphere. Springer, Berlin Heidelberg New York, pp 

1–8 

Dunstan WA, Malajczuk N, Dell, B (1998) Effects of bacteria on mycorrhizal development 

and growth of container-grown Eucalyptus diversicolor F. Muell. seedlings. Plant Soil 

201:241–249 

Foster RC, Marks GC (1967) The fine structure of the mycorrhizas of Pinus radiata.Aust 

J Biol Sci 19:1027–1038 

Founoune H, Duponnois R, Ba AM, Sall S, Branget I, Lorquin J, Neyra M, Chote JL (2002) 

Mycorrhiza helper bacteria stimulate ectomycorrhizal symbiosis of Acacia holosericea 

with Pisolithus alba. New Phytol 153:81–89 

Frey-Klett P, Brule C, Garbaye J (1997) A proposed model for the mycorrhiza-helper 

effect of Pseudomonas fluorescens BBc6 on the ectomycorrhizal system Laccaria 

bicolorS238N-Douglas fir. 4th International Workshop on Plant Growth Promoting 

Rhizobacteria, Sapporo, Japan 

Frey-Klett P, Churin JL, Pierrat JC, Garbaye J (1999) Dose effect in the dual inoculation of 

an ectomycorrhizal fungus and a mycorrhiza helper bacterium in two forest nurseries. 


Frey-Klett P, Chavatte M, Courriers S, Martinotii G, Pierrat JC, Garbaye J (2000) Ectomycorrhizosphere 

effect of the Douglas fir-Laccaria bicolor symbiosis on the functional 

diversity of fluorescent pseudomonads in a forest nursery. 5th International Workshop 

on PGPR, Cordoba, Argentine. www.ag.auburn.edu/argentina/pdfmanuscripts/ 

freyklett.pdf 

Frey P, Frey-Klett P, Garbaye J, Berge O, Heulin (1997) Metabolic and genotyping fingerprinting 

of fluorescent pseudomonads associated with the Douglas fir-Laccaria 

bicolor mycorrhizosphere. Appl Environ Microbiol 63:1852–1860 

Frey-Klett P, Pierrat JC, Garbaye J (1997) Location and survival of Mycorrhiza helper 

Pseudomonas fluorescens during establishment of ectomycorrhizal symbiosis 

between Laccaria bicolor and Douglas Fir. Appl Environ Microbiol 63:139–144 

Garbaye J (1994) Helper bacteria: a new dimension to the mycorrhizal symbiosis. New 

Phytol 128:197–210

208 


Garbaye J, Churin JL, Duponnois R (1992) Effects of substrate disinfection, fungicide 

treatment and mycorrhiza helper bacteria (MHB) on ectomycorrhiza formation of 

pedunculate oak inoculated with Laccaria laccata in two bare-root nurseries. Biol 


Garbaye J, Duponnois R (1992) Specificity and function of mycorrhiza helper bacteria 

(MHB) associated with the Pseudotsuga menziesii–Laccaria laccata symbiosis.Symbiosis 

14:335–344 

Glick BR (1995) The enhancement of plant growth by free living bacteria. Can J Microbiol 

41:109–117 

Hampp R, Schaeffer C (1998) Mycorrhiza – Carbohydrate and energy metabolism. In: 

Varma A, Hock B (eds) Mycorrhiza – structure, function, molecular biology and 

biotechnology. Springer, Berlin Heidelberg New York, pp 273–303 

Heinonsalo J, Jorgensen KS, Haahtela K, Sen R (2000) Effects of Pinus sylvestris root 

growth and mycorrhizosphere development on bacterial carbon source utilization 

and hydrocarbon oxidation in forest and petroleum-contaminated soils. Can J Microbiol 

46:451–464 

Hiltner L (1904) Über neuere Erfahrungen und Probleme auf dem gebiet der Bodenbakteriologie 

und unter besonderer Berücksichtigung der Gründüngung und Brache. 

Arb Dtsch Landwirt Ges 98:59–78 

Hobbie SE (1992) Effects of plant species on nutrient cycling. Trends Ecol Evol 7:336–339 

Karabaghli C, Frey-Klett P, Sotta B, Bonnet M, Le Tacon F (1998) In vitro effects of Laccaria 

bicolor S238 N and Pseudomonas fluorescens strain BBc6 on rooting of derooted 

shoot hypocotyls of Norway spruce. Tree Physiol 18:103–111 

Kloepper JW, Lifshitz R, Zablotowicz RM (1989) Free-living bacterial inocula for 

enhancing crop productivity. Trends Biotechnol 7:39–43 

Li CY, Massicotte HB, Moore LVH (1992) Nitrogen-fixing Bacillus sp. associated with 

Douglas-fir tuberculate ectomycorrhizae. Plant Soil 140:35–40 

Linderman RG (1988) Mycorrhizal interactions with the rhizosphere microflora: the 

mycorrhizosphere effect. Phytopathology 78:366–371 

Malajczuk N (1979) The microflora of unsuberized roots of Eucalyptus calophylla R. Br. 

and Ecalyptus marginata Donn ex Sm seedlings grown in soils suppressive and conductive 

to Phytophthora cinnamomi Rands. II. Mycorrhizal roots and associated 

microflora. Aust J Bot 27:235–254 

Manachére G, Rober JC, Durand R, Bret JP, Févre M (1983) Differentiation in the basidiomycetes. 

In: Smith JE (ed) Mycology series; vol 4. Fungal differentiation: A contemporary 

synthesis. Marcel Dekker, New York, pp 481–514 

Marschner H (1995) Mineral nutrition of higher plants. Academic Press, London, 571 pp 

Meyer JR Linderman RG (1986) Response of subterranean clover to dual inoculation 

with vesicular-arbuscular mycorrhizal fungi and a plant growth-promoting bacterium, 

Pseudomonas putida. Soil Biol Biochem 18:185–190 

Mogge B, Loferer C, Agerer R, Hutzler P, Hartmann A (2000) Bacterial community structure 

and colonialization patterns of Fagus sylvatica L. ectomycorrhizospheres as 

determined by fluorescence in situ hybridization and confocal laser scanning 

microscopy. Mycorrhiza 9:271–278 

Moore JC, Hunt HW (1988) Resource compartmentation and the stability of real ecosystems. 

Nature 333:261–263 

Neidhardt FC, Ingraham JL, Schaechter M (eds) (1990) Physiology of the bacterial cell. 

Sinauer, MA, USA 

Nohrstedt H-Ö,Arnebrandt K, Bååth E, Söderström B (1989) Changes in carbon content, 

respiration rate,ATP content, and microbial biomass in nitrogen-fertilized pine forest 

soils in Sweden. Can. J For Res 19:323–328


Nurmiaho-Lassila E-L, Timonen S, Haahtela K, Sen R (1997) Bacterial colonialization 

patterns of intact Pinus sylvestris mycorrhizospheres in dry pine forest soil: an electron 

microscopy study. Can J Microbiol 43:1017–1035 

Oswald ET, Ferchau HA (1968) Bacterial associations of coniferous mycorrhizae. Plant 

Soil 28:187–192 

Pedersen EA, Reddy MS, Chakravarty P (1999) Effect of three species of bacteria on 

damping-off, root rot development, and ectomycorrhizal colonialization of lodgepole 

pine and white seedlings. Eur J For Pathol 29:123–134 

Perkins DN, Pappin DJ, Creasy D, Cotrell JS (1999) Probability-based protein identification 

by searching sequence databases using mass spectrometry data. Electrophoresis 

20:3551–3567 

Poole EJ, Bending GD, Whipps JM, Read DJ (2001) Bacteria associated with Pinus 

sylvestris-Lactarius rufus ectomycorrhizas and their effects on mycorrhiza formation 

in vitro. New Phytol 151:743–751 

Probanza A, Lucas JA, Guiterrez Mañero JF (1996) The influence of native rhizobacteria 

on European alder (Alnus glutinosa (L.) Gaertn.) growth. I. Characterization of 

growth promoting and growth inhibiting bacterial strains. Plant Soil 182:59–66 

Probanza A, Mateos JL, Lucas Garcia JA, Ramos B, de Felipe MR, Guiterrez Manero JF 

(2001) Effects of inoculation with PGPR Bacillus and Pisolithus tinctorius on Pinus 

pinea L. growth, bacterial rhizosphere colonialization, and mycorrhizal infection. 


Sarand I, Timonen S, Nurmiaho-Lassila E-L, Koivula T, Haahtela K, Romantschuk M, Sen 

R (1998) Microbial biofilms and catabolic plasmid harbouring degradative fluorescent 

pseudomonads in Scots pine mycorrhizospheres developed on petroleum contaminated 

soil. FEMS Microbiol Ecol 27:115–126 

Sarand I, Timonen S, Koivula T, Peltola R, Haahtela K, Sen R, Romantschuk M (1999) Tolerance 

and biodegradation of m-toluate by Scots pine, a mycorrhizal fungus and fluorescent 

pseudomonads individually and under associative conditions. J Appl Microbiol 

86:817–826 

Schelkle M, Peterson RL (1996) Suppression of common root pathogens by helper bacteria 

and ectomycorrhizal fungi in vitro. Mycorrhiza 6:481–485 

Schelkle M, Ursic M, Farquhar M, Peterson RL (1996) The use of laser scanning confocal 

microscopy to characterize mycorrhizas of Pinus strobus L. and to localize associated 

bacteria. Mycorrhiza 6:431–440 

Sen R (2000) Budgeting for the wood-wide web. New Phytol 145:161–165 

Sheterline P, Handel SE, Molloy C, Hendry KAK (1992) The nature and regulation of 

actin filament turnover in cells. Acta Histochem 41:303–309 

Smith SE, Read DJ (1997) Mycorrhizal symbiosis, 2nd edn. Academic Press, Cambridge 

Söderström B (1992) Ecological potential of ectomycorrhizal mycelium. In: Read DJ, 

Lewis DH, Fitter AH, Alexander IJ (eds) Mycorrhizas in ecosystems. Cambridge University 

Press, Cambridge, pp 77–83 

Söderström B, Bååth E, Lundgren B (1983) Decrease in soil microbial activity and biomass 

owing to nitrogen amendments. Can J Microbiol 29:1500–1506 

Tarkka MT, Vasara R, Gorfer M, Raudaskoski M (2000) Molecular characterization of 

actin genes from homobasidiomycetes: two different actin genes from Schizophyllum 

commune and Suillus bovinus. Gene 251:27–35. 

Timonen S, Jorgensen KS, Haahtela K, Sen R (1998) Bacterial community structure and 

defined locations of Pinus sylvestris–Paxillus involutus mycorrhizospheres in dry 

pine forest humus and nursery peat. Can J Microbiol 44:499–513 

Varese GC, Portinario S, Trotta A, Scannerini S, Luppi-Mosca AM, Martinotti MG (1996) 

Bacteria associated with Suillus grevillei sporocarps and ectomycorrhizae and their 

effects on in vitro growth of the Microbiont. Symbiosis 21:129–147

210 


Verhoef HA, Brussaard L (1990) Decomposition and nitrogen mineralization in natural 

and agro-ecosystems: the contribution of soil animals. Biogeochemistry 11:175–211 

Watteau F, Berthelin J (1990) Iron solubilization by mycorrhizal fungi producing 

siderophores. Symbiosis 9:59–67 

Whipps JM, Lynch JM (1986) The influence of rhizosphere on crop productivity. Adv 


Williams KR, Stone KL (1997) Enzymatic cleavage and HPLC peptide mapping of proteins. 

In: Walker J (ed) Molecular biotechnology. Humana Press, Totowa, pp 155–167

13 The Surface of Ectomycorrhizal Roots and the 

Interaction with Ectomycorrhizal Fungi 

Ingrid Kottke 


Most of the trees in the temperate and alpine regions live in symbiosis with 

root fungi forming ectomycorrhizas. Ectomycorrhizas (ECM) display a very 

specified cellular organization.A fungal sheath covers the root surface and the 

hyphae invade intercellularly between the root cortical cells establishing the 

so-called Hartig net. The hyphal sheath is formed in a species-specific manner 

(Agerer 1998), but the architecture of the Hartig net is similar in all the 

ectomycorrhizas, independent of plant and fungal species (Blasius et al. 1986, 

Kottke and Oberwinkler 1987, 1989). Establishing the Hartig net, hyphal 

growth undergoes important changes. The hyphae invade as multi-branched, 

fan-like lobes in intimate juxtaposition, starting at the root surface and finally 

covering the root cortical cells in a dense mono-layer (Fig. 1; Jacobs et al. 1989; 

Brunner and Scheidegger 1992; Kottke et al. 1996). 

The Hartig net structure is only established in so-called short roots, a special 

root type of the ectomycorrhiza-forming plants (Marks and Foster 1973; 

Wong et al. 1990). It was hypothesized that the surface of these rootlets might 

trigger the attachment of hyphae and the change of their growth characters 

(Jacobs et al. 1989; Brunner and Scheidegger 1992; Kottke 1997; Bonfante et 

al. 1998). Cysteine-rich, moderately hydrophobic proteins (“hydrophobins”) 

in the walls of the ectomycorrhizal fungus Pisolithus tinctorius (Pers.) Coker 

& Couch were shown to be highly expressed in the early stage of mycorrhiza 

formation and were considered to attach the hyphae to the root surface of 

Eucalyptus globulus ssp. bicostata Kirkp. (Tagu et al. 1996, 2000, 2001; Martin 

et al. 1999). A hydrophobic root surface was, therefore postulated and a cuticle-like 

layer on the surface of short roots may be the substrate for adhesion 

of ectomycorrhizal fungi (Kottke 1997). Recent ultrastructural studies comparing 

long and short roots have supported this hypothesis by revealing the 

origin of the cuticle-like layer on short, but not on long roots. Differences 

were also detected in the amounts of methyl-esterified pectins in the cortical 

cell walls of both the root types. Furthermore, when establishing the Har- 




212 

Ingrid Kottke 

Fig. 1. Ectomycorrhiza formation by Laccaria amethystea and Picea abies. Longitudinal 

section through an early state mycorrhiza. Hyphal attachment to root hairs (arrowhead) 

without changes of hyphal morphology; hyphal attachment to root surface followed by 

hyphal enlargement (arrow) and lobe-like growth of hyphae (double arrow); typical 

Hartig net structure established between root cortical cells down to the endodermis 

(scale 15 mm). cc Cortical cell, e endodermis, hs hyphal sheath, Hn Hartig net, rh root hair 

tig net, the cuticle-like layer has to be penetrated by the hyphae. This process 

has not been shown before and may be considered as a locally restricted 

aggressive or saprophytic phase during ECM formation. 

2 Long and Short Roots of Ectomycorrhiza-Forming Plants 

Ectomycorrhizas are exclusively formed by perennial, woody plants belonging 

to Pinaceae or to distinct families within the Rosidae (sensu “Angiosperm 

Phylogenetic Group”, Bremer et al. 1998). The root system of these ECMforming 

plants is divided into main, or “long roots” of relatively fast and 

unlimited growth and secondary “short roots” of slow and limited growth 

(Noelle 1910; Clowes 1951; Marks and Foster 1973). Ectomycorrhizae are typically 

formed on short roots. However, long roots may become mycorrhizal 

after turning into a resting stage (Wilcox 1968b). It was speculated that the 

growth rate of hyphae might not compete with the growth rate of long roots, 

thus preventing mycorrhiza formation (Marks and Foster 1973). However, sig-

mrc 

rc 

rc 

a b 

c d 

13 Root Surface in Ectomycorrhizas 213 

met 

Fig. 2a–d. Root cap formation of several Pinaceae. a Long root of Picea abies with nonsuberized, 

decaying root cap cells; b long root of Larix decidua at resting stage with 

metacutization of root cap; c short root of Pinus sylvestris with suberized root cap cells 

containing phenols; d root budding in Picea abies from below a hyphal sheath, bud covered 

by suberized root cap cells (scale 15 mm). hs Hyphal sheath, met metacutization, mrc 

moribund root cap cell, rc root cap 

rc 

rc 

hs

214 

Ingrid Kottke 

nificant structural differences exist between the two root types and may be 

even more important for mycorrhiza formation or failure. 

Fast growing long root tips are covered by a conspicuous root cap consisting 

of non-suberized, rapidly decaying cells (Fig. 2a). Dormant long roots and 

short roots have in common that the root cap cells are few and become suberized 

(Fig. 2b, c). This type of root cap cells is also found in root buds even 

when emerging from below a hyphal sheath (Fig. 2d). The process was termed 

metacutization (“Metakutinisierung” Müller 1906) and was found to occur in 

a multitude of gymnosperm and angiosperm perennial species irrespectively 

of the epidermal or cortical cell type on the root surface of these two taxonomic 

groups (Plaut 1918). It was described in detail from light microscope 

studies of Fagus sylvatica L. (Clowes 1954), Betula alleghaniensis Britt., Alnus 

crispa (Ait.) Pursh, Eucalyptus pilularis Smith (Massicotte et al. 1986, 

1987a,b), Abies procera Rehder (Wilcox 1954), Picea abies [L.] Karst. (Kottke et 

al. 1986) and Pinus spp. (Hatch and Doak 1933). 

3 A Cuticle-Like Layer on the Surface of Short Roots 

Ultrastructural investigations yielded further details on the fate of the suberized 

root cap cells of short roots. Young root cap cells become suberized by a 

lamellar layer imposed on the inner side of the cell walls (Figs. 3a, b, 4a). As 

suberin is only weakly stained by osmium and lead, a suberin layer appears 

electron-translucent (Sitte 1975; Kottke and Oberwinkler 1990). Lamellae are 

visible in the suberin layer if waxes are present additionally (Fig. 4a; Sitte 

1975). The suberin layer progressively increases with ageing of the cells. 

Finally, these cells accumulate phenolic substances, become impermeable and 

moribund (Fig. 3a, b). Short roots proliferate slowly under the root cap cells 

(Fig. 2 c) and remain covered by their residues (Fig. 4b, c). The dead root cap 

cells progressively detach from the root (Figs. 3b, 4b, c), but the innermost, 

suberized root cap cell walls remain tightly connected to the root cortical cell 

layer (Figs. 3 c, 4b, c). Thus, the suberin layer of the innermost root cap cells 

covers the whole surface of short roots, similar to a fine cuticle. During the 

elongation of the root the suberin layer is thinned out (Fig. 4e). It fades away 

on the root hairs (Fig. 3d) covering only the root hair base (Fig. 4d). At the 

most proximal parts of the rootlets, the suberin layer may also fade away on 

the surface of cortical cells (Fig. 5a, c), but the cell junctions remain tightly 

covered by the suberin layer all along the rootlet (Fig. 5a, b). The whole situation 

is illustrated by a scheme (Fig. 6). 

The suberin layer is covered by a thin layer of electron-dense material. Phenols 

are strongly stained by osmium and lead and thus appear electron-dense. 

It is not always easy to discern if this material originates from insoluble phenolic 

residues of the former vacuole or from cell walls of the deceased root cap 

cells as vacuoles and moribund cell walls of root cap cells may contain high

ccw 

cc 

rccw 

cc 

rccw 

ccw 

ph 

rccw 

rccw 


rccw 

ph 

a b 

* 

rhcw 

c d 

Fig. 3. a, b Suberized (arrows) root cap cell layers close to the root apex of Picea abies. 

The outer layers detaching (*) and partly decomposed. Cell wall or vacuolar, phenolic 

residues form the superficial layer. Scale 0.5 mm. c Superficial layer on short root cortical 

cell formed by the suberized root cap cell wall lined by phenolic residues (arrow). Scale 

0.3 mm. d Cell wall of root hair with no suberin layer (scale 0.3 mm). cc Cortical cell, ccw 

cortical cell wall, ph phenolic residues, rccw root cap cell wall, rhcw root hair cell wall 

amounts of phenolic residues (Fig. 2 c). An attempt was undertaken to clarify 

the situation by carefully studying the cell layers (Fig. 3a, b). Additional hints 

for recognition of cell wall material were obtained by immunogold labelling 

(see below). At the final stage of root development, when only the innermost 

root cap cell wall and its suberin layer are preserved on the root cortical cell 

wall (Fig. 3 c), the thin, electron-dense layer on top of the suberin layer can 

only be interpreted as the phenolic residues of the former vacuole. Dehydration 

of mycorrhizas in alcohol and embedding in LRWhite resin may obscure 

the suberin layer (Kottke 1997; Bonfante et al. 1998), but high pressure cryofixation, 

dehydration by acetone and embedding in Araldite/Epon or embed-

216 

d 

Ingrid Kottke 

rcc 

ph 

rccw ccw 

a 

rccw 

cc 

ccw 

mrcc 

rccw 

cc 

rh cc 

ccw 

mrcc 

Fig. 4a–e. Cuticle-like layer on surface of short roots of Picea abies. a Lamellate structure 

of the suberin layer (arrowhead). Scale 0.1 mm. b, c Moribund root cap cells detaching 

from root cortical cell, suberized innermost root cap cell wall preserved in tight contact 

to cortical cell wall (arrowheads). Scale 0.5 mm. d Suberin layer fading away at root 

hair basis (arrowhead). Scale 0.5 mm. e Thinning of suberin layer (arrowhead) during 

elongation of cortical cells (scale 0.5 mm). cc Cortical cell, ccw cortical cell wall, ph phenolic 

residues, rcc root cap cell, rccw root cap cell wall, rh root hair 

ph 

e 

b 

ph

cc 

cc 

cc 

sl 

cc 

rcc 


a b 

cc 

cc 

cc 

cc 

rcc 

c d e 

Fig. 5a–e. Suberized root cap cell layer covering cell junctions of short roots, but not of 

long roots (Picea abies). a Residues of suberized root cap cells covering the cell junction 

at the proximal part of a short root, fading away on the cortical cell (arrow). Scale 3 mm. 

b Enlargement of cell junction displaying several suberin layers of moribund root cap 

cells. Scale 1 mm. c Enlargement of cortical cell displaying fading away of the suberin 

layer (arrow). Scale 1 mm. d No suberin layer on the cortical cell wall of a long root. Scale 

1 mm. e No suberin layer on top of the cell junction of a long root (scale 1 mm). cc Cortical 

cell, cj cell junction, rcc root cap cell, sl suberin layer 

ding in Spurr’s resin after fixation in glutaraldehyde yields clear results. The 

electron-dense layer on the root hair surface is no longer considered as a cuticle 

as was erroneously given in Kottke (1997). 

The root cap cells of long roots are not suberized and no cuticle-like layer 

exists on the surface of long roots and their cell junctions (Fig. 5d, e). 

cj 

cj 

sl

218 

Ingrid Kottke 

Fig. 6. Scheme illustrating the fate of 

the suberized root cap cells of short 

roots presumably in most ectomycorrhiza 

forming tree species. Figures 

refer to given micrographs 

4 Involvement of the Cuticle-Like Layer in Mycorrhiza 

Formation 

The cuticle-like, suberin layer covering short roots, by displaying a hydrophobic 

surface, appears to be involved in hyphal attachment at the beginning of 

ECM development. The suberin layer on the cell junctions is a barrier, however, 

that has to be penetrated when the hyphae invade between the root cortical 

cells establishing the Hartig net. 

5 Involvement of the Cuticle-Like Layer in Hyphal 

Attachment 

Using scanning electron microscopy, hyphae of P. tinctorius and Paxillus involutus 

(Batsch) Fr. attached to rootlets of Quercus acutissima Carruth or Betula 

spp., respectively, were found to be embedded in a mucilaginous material 

(Massicotte et al. 1987a, b; Brunner and Scheidegger 1992; Oh et al. 1995). 

Transmission electron microscopy revealed that adhesion of hyphae to the 

root surface was aided by polysaccharide fibrils and binding sites of mannose 

(Piché et al. 1983a; Thomson et al. 1989; Wong et al. 1990; Lei et al. 1991; Tagu 

et al. 2000). Laurent et al. (1999) identified cell-adhesion proteins in the cell


a b 

cc 

sl 

hy 

cc 

hy 

c ccw d 

walls of the ectomycorrhiza-forming fungus P. tinctorius. Investigation of the 

attachment of Laccaria amethystea (Bull.) Murrill to Picea abies short roots 

showed formation of an adhesion pad (Fig. 7a) which was strongly stained by 

the Swift reaction for cysteine-rich proteins (Lewis and Knight 1977; Kottke 

1997). The surface of the hyphae in contact to the suberin layer and to each 

other is stained similarly (Fig. 7b). Attachment of hyphae to the basis of root 

hairs by Swift-positive material was found previously for P. tinctorius and 

cc 

ph 

sl 

cj 

hy 

ccw 

Fig. 7. a Adhesion pad of Laccaria amethystea hyphae in contact with the suberin layer 

of a root cap cell on top of the cortical cell. Scale 0.5 mm. b Swift positive reaction of cysteine-rich 

proteins in the cell wall of hyphae in contact with the root and each other 

(Laccaria amethystea–Picea abies). Scale 1.5 mm. c Long root of Picea abies displaying no 

attachment of Laccaria amethystea hyphae. Scale 15 mm. d Immunogold labelling of 

methyl-esterified pectins by the monoclonal antibody JIM7. The cell junction is covered 

by a suberized root cap cell wall lined by phenolic residues (short root of Picea abies). 

Scale 0.5 mm. cc Cortical cell, ccw cortical cell wall, cj cell junction, ph phenolic residues, 

hy hypha, sl suberin layer

220 

Ingrid Kottke 

Picea mariana Mill. B.S.P. (Thomson et al. 1989). The superficial layer of the 

fungal wall may contain hydrophobins, cysteine-rich proteins, self-assembling 

at the wall/air interface (Wösten et al. 1994; Wessels 1997; Wösten and 

Vocht 2000). Hydrophobins were localized using antibodies in mycorrhizas 

formed by P. tinctorius and E. globulus and in mycorrhizas of Tricholoma terreum 

(Schaeff.) Quél. with the compatible host Pinus sylvestris L. (Mankel et 

al. 2000; Tagu et al. 2001). The cuticle-like layer may thus be considered as the 

hydrophobic surface appropriate for hyphal attachment by hydrophobins. 

Attachment to the tips of root hairs was observed (Kottke 1997), but 

occurred only within a defined, susceptible zone (Thomson et al. 1989). 

Hyphae may also attach to the surface of root cap cells (Bonfante et al. 1998). 

This kind of attachment differs from that to the short root surface. Staining 

for cysteine-rich proteins was found to be negative (Kottke 1997). Attachment 

was neither followed by enlargement of hyphae or lobed ramification, nor by 

any digesting process (Thomson et al. 1989; Kottke 1997). Instead, thickening 

of fungal wall has been observed and the appearance of b-1,3-glucans in the 

root cell wall was shown (Bonfante et al. 1998). 

No attachment to the surface of long roots was found. Hyphae grow along 

the long roots in acropetal direction without apparent changes (Fig. 7 c). 

6 Digestion of the Suberin Layer and the Cell Wall of the 

Root Cap 

The cuticle-like layer covers all the cell junctions of short roots (Figs. 5a, 6). 

The hyphae, therefore, must penetrate the suberin layer and the wall of the 

moribund root cap cell when establishing the Hartig net. Vesicles, probably 

containing a cutinase-like enzyme were frequently observed in hyphae dissolving 

the suberin (Fig. 8a). The hyphae split away the suberized root cap cell 

wall and proliferate below, on top of the surface of the cortical cell (Fig. 8b, c, 

d). This process may explain why finally, when the hyphal sheath covers the 

rootlet, the cuticle-like layer is no longer found. The suberin layer became 

integrated into the hyphal sheath (Fig. 8d). 

The hyphae digest the suberin layer locally and disrupt the root cap cell 

wall, but do not attack the wall of the live cortical cell (Fig. 8a, b). While the 

enzyme activity remains to be proven in situ, there are many indications for a 

controlled cell wall hydrolyzing activity of ECM fungi (for review, see Cairney 

and Burke 1994). ECM fungi digest cell wall material, including the suberin 

layer of the moribund root cap, but not material of live cells during mycorrhiza 

formation (Chilvers 1968; Piché et al. 1983b; Kottke and Oberwinkler 

1986). A strict spatial and temporal regulation of enzyme activity has, thus, to 

be expected when the hyphae contact alive cells.

ccw 

cc 

hy 

sl 

rccw 

hy 

hy 

7 Hartig Net Formation 

cc 


a b 

sl 

ccw 

sl 

rccw 

c cc 

d 

Fig. 8a–d. Cuticle-like suberin layer involved in mycorrhiza formation (Laccaria 

amethystea-Picea abies). a Local digestion of the suberin layer and root cap cell wall, no 

disturbance of cortical cell wall, vesicles probably containing enzymes (arrowhead,scale 

1 mm). b Hypha splitting off the suberin layer and proliferating beneath, on the surface 

of the cortical cell wall. Scale 0.5 mm. c Hypha penetrating between cell junction, suberin 

layer partly digested (arrow) and partly preserved (arrowhead), lobed growth of hyphae 

visible (arrow). Scale 1 mm. d Hyphae proliferating under the suberin layer (arrowheads) 

show lobed branching typical of Hartig net structure (arrows). Scale 1 mm. cc Cortical 

cell, ccw cortical cell wall, hy hypha, rccw root cap cell wall, sl suberin layer 

Lobed growth of hyphae indicating the initialization of the Hartig net was 

found in connection with the digestion of the cuticle-like layer (Fig. 8 c, d). 

Thomson et al. (1989) described the formation of hyphal lobes at the base of 

root hairs. Lobed hyphal growth on the root surface has been observed by 

SEM (Jacobs et al. 1989; Brunner and Scheidegger 1992), but the connection to 

sl 

hy 

hy 

hy

222 

Ingrid Kottke 

suberin digestion is shown here for the first time. It remains to be elucidated 

if there is a direct signalling link between the digestion of the suberin and the 

change of hyphal growth characters.After digesting the suberin layer and disrupting 

the root cap cell wall, the hyphae come into direct contact with the live 

cortical cells. There may then be additional signals involved in triggering the 

hyphal growth changes at the root surface (Salzer et al. 1997, 2000). 

8 Pectins in the Cortical Cell Walls of Nonmycorrhizal Long 

and Mycorrhizal Short Roots 

Methyl-esterified pectins were localized in the root cell walls of Picea abies 

using the monoclonal antibody JIM7 (K. Roberts, John Innes Institute, Norwich 

UK; Fig. 7d). No difference in the amount of pectin was found between 

cortical cells in contact to hyphae and those lacking hyphal contact when 

short roots and mycorrhizas were compared (Fig. 9). The cortical cells of noncolonized, 

long roots, however, were significantly more densely marked by the 

antibody (Fig. 9). There was no difference between both root types in the 

amounts of methyl-esterified pectins in the cell walls of the meristems 

(Fig. 9). During differentiation, the amounts of methyl-esterified pectins obviously 

increase in cortical cell walls of long roots, but are reduced in cortical 

cell walls of short roots. There is no indication for a digestion of pectins by the 

hyphae as no changes in the amounts of pectins was found during early stages 

of Laccaria amethystea- Picea abies mycorrhiza formation. Balestrini et al. 

(1996) could not find any indication for polygalacturonase activity during 

ECM development between Coryllus avellana and Tuber magnatum either. 

The authors supposed de-esterification of the pectins according to increased 

labelling of de-esterified pectins after mycorrhiza formation. In the case of P. 

abies, however, immunogold labelling by the monoclonal antibody JIM5 

showed low amounts of de-esterified pectins and labelling decreased from 

inner cortical cells to outer cortical cells (not shown). High labelling of 

methyl-esterified pectins was detected in roots of Daucus carota L. and Avena 

sativa L. (Knox et al. 1990). This finding would support the view that fast 

growing roots contain high amounts of methyl-esterified pectins in cortical 

cells. 

It is unclear whether the amounts of methyl-esterified pectins have any 

influence on mycorrhiza formation. There is too little knowledge on the 

importance of methyl-esterified pectins for stability or plasticity of cell walls 

and cell-to-cell adhesion (Liners et al. 1994). Previously, reduction of the cell 

wall-bound ferulic acid, linking pectic substances in the cell wall matrix, was 

found to occur during mycorrhiza formation of Picea abies, Larix decidua and 

Arbutus menziesii (Münzenberger et al. 1990, 1995, Weiss et al. 1999). Less 

rigid cortical cell walls were considered a prerequisite for intercellular hyphal 

penetration during Hartig net establishment.

9 Conclusions 


Fig. 9. Amount of immunogold labelling by the monoclonal antibody JIM7 against 

methyl-esterified pectins. Counting of gold granules was carried out by means of image 

analysis in different compartments of ectomycorrhizas, short roots, and long roots. 

Material collected from in vitro cultures of Picea abies inoculated by Laccaria amethystea 

The surface of short roots appears to be important in ECM initialization. So 

far we have only started to understand the process. Further research is needed 

to clarify changes of cell wall components and signal exchanges involved. 

Some progress was, however, obtained by structural and molecular investigations 

during the last few years. Tight attachment of hyphae to the root surface 

is established between hydrophobins on the hyphal surface and the hydrophobic 

root surface. The hydrophobic root surface derives from the residue of the 

suberized root cap of short roots. The lack of a suberized root cap might be 

involved in the lack of a Hartig net in long roots. Digestion of the suberin layer 

and the root cap cell wall may mean the occurrence of a slight, transient and 

locally restricted aggressive phase during ectomycorrhiza formation and may 

explain the slight, transient defence reactions in the early phase (Salzer et al. 

1997, 2000). The lack of pectin digestion by the fungus might avoid severe 

defence reactions of the root. The locally restricted digestion of the moribund, 

suberized root cap cell wall may, however, alternatively be looked upon 

as a saprophytic phase of interaction. Ectomycorrhizal fungi phylogenetically 

derive from saprophytes and not from parasites (Bresinsky et al. 1999) and 

many species have preserved saprophytic growth facilities.

224 

Ingrid Kottke 

When dissolving the suberin layer locally, the hyphae start lobed growth 

typical of Hartig net structure. It is unclear so far if the digestion of the cuticle-like 

layer has itself an inductive effect on hyphal growth. Signals obtained 

from the live cortical cells, reached after digestion of the suberized root cap 

layer, may be more decisive in change of hyphal growth characters. The 

described phenomena are unique in ECM formation and, as far is known, do 

not occur in any other plant-fungus interaction system. 

Acknowledgements. The valuable comments on the manuscript and the introduction to 

immunogold-labelling by Paola Bonfante is greatly appreciated. I also express my gratitude 

to Bettina Grüninger and Esther Strasdas for carrying out the JIM7/JIM5 labelling 

studies. 


Agerer R (1998) Colour atlas of ectomycorrhizae. Einhorn-Verlag, Schwäbisch Gmünd, 

140 pp 

Balestrini R, Hahn MG, Bonfante P (1996) Location of cell-wall components in ectomycorrhizae 

of Coryllus avellana and Tuber magnatum. Protoplasma 191: 55–69 

Blasius D, Feil W, Kottke I, Oberwinkler F (1986) Hartig net structure and formation in 

fully ensheathed ectomycorrhizas. Nordic J Bot 6: 837–842 

Bonfante P, Balestrini R, Martino E, Perotto S, Plassard C, Mousain D (1998) Morphological 

analysis of early contacts between pine roots and two ectomycorrhizal Suillus 

strains. Mycorrhiza 8:1–10 

Bremer K, Chase MW, Stevens PF (1998) An ordinal classification for the families of flowering 

plants. Ann Mo Bot Gard 85:531–553 

Bresinsky A, Jarosch M, Fischer M, Schönberg I, Wittmann-Bresinsky B (1999) Phylogenetic 

relationship within Paxillus s. l. (Basidiomycetes, Boletales): Separation of a 

southern hemisphere genus. Plant Biol 1:327–333 

Brunner I, Scheidegger C (1992) Ontogeny of synthesized Picea abies(L.) Karst.- Hebeloma 

crustuliniforme (Bull. ex St Amans) Quél. ectomycorrhizas. New Phytol 120:359– 

369 

Cairney JW, Burke RM (1994) Fungal enzymes degrading plant cell walls: their possible 

significance in the ectomycorrhizal symbiosis. Mycol Res 98:1345–1356 

Chilvers GA (1968) Low power electron microscopy of the root cap region of eucalypt 

mycorrhizas. New Phytol 67:663 

Clowes FAL (1951) The structure of mycorrhizal roots of Fagus sylvatica. New Phytol 

50:1–16 

Clowes FAL (1954) The root-cap of ectotrophic mycorrhizas. New Phytol 53:525–9 

Hatch AB, Doak KD (1933) Mycorrhizal and other features of the root system of Pinus.J 

Arnold Arbor 14:85–99 

Jacobs PF, Peterson RL, Massicotte HB (1989) Altered fungal morphogenesis during early 

stage ectomycorrhiza formation in Eucalyptus pilularis. Scann Microsc 3:249–255 

Knox JP, Linstead PJ, King J, Cooper C, Roberts K (1990) Pectin esterification in spatially 

regulated both within cell walls and between developing tissues of root apices. Planta 

181:512–521 

Kottke I (1997 ) Fungal adhesion pad formation and penetration of root cuticle in early 

stage Picea abies-Laccaria amethystea mycorrhizas. Protoplasma 196:55–64


Kottke I, Oberwinkler F (1986) Root-fungus interactions observed on initial stages of 

mantle formation and Hartig net establishment in mycorrhizas of Amanita muscaria 

(L. ex Fr.) Hooker on Picea abies (L.) Karst. in pure culture. Can J Bot 64: 2348–2354 

Kottke I, Oberwinkler F (1987) Cellular structure and function of the Hartig net: coenocytic 

and transfer cell-like organization. Nordic J Bot 7:85–95 

Kottke I, Oberwinkler F (1989) Amplification of root-fungus interface in ectomycorrhizae 

by Hartig net architecture. Ann Sci For 46 Suppl:737s–740s 

Kottke I, Oberwinkler F (1990) Comparative investigations on the differentiation of the 

endodermis and the development of the Hartig net in mycorrhizae of Picea abies and 

Larix decidua. Trees 4:41–48 

Kottke I, Rapp C, Oberwinkler F (1986) Zur Anatomie gesunder und “kranker” Feinstwurzeln 

von Fichten: Meristem und Differenzierungen in Wurzelspitzen und Mykorrhizen. 

Eur J For Pathol 16:159–171 

Kottke I, Münzenberger B, Oberwinkler F (1996) Structural approach to function in 

ectomycorrhizas. In: Rennenberg H, Eschrich W, Ziegler H (eds) Trees – contribution 

to modern tree physiology. SPB Academic, The Hague, pp 3–22 

Laurent P, Voiblet C, Tagu D, de Carvalho D, Nehls U, De Bellis R, Ballestrini R, Bauw G, 

Bonfante P, Martin F (1999) A novel class of ectomycorrhiza-regulated cell wall 

polypeptides in Pisolithus tinctorius. Mol Plant Microbe Interact 12:862–871 

Lei J, Wong KK, Piché Y (1991) Extracellular Concanavalin A-binding sites during early 

interaction between Pinus banksiana and two closely related genotypes of the ectomycorrhizal 

basidiomycete Laccaria bicolor. Mycol Res 95:357–363 

Lewis PR, Knight DP (1977) Staining methods for sectioned material. North-Holland 

Publishing Company, Amsterdam, 311 pp 

Liners F, Gaspar T, Van Cutsem P (1994) Acetyl- and methyl-esterification of pectins of 

friable and compact sugar-beet calli: consequences for intercellular adhesion. Planta 

192:545–556 

Mankel A, Krause K, Genenger M, Kost G, Kothe E (2000) A hydrophobin accumulated in 

the Hartig net of ectomycorrhiza formed between Tricholoma terreum and its compatible 

host tree is missing in an incompatible association. J Appl Bot 74:95–99 

Marks GC, Foster RC (1973) Structure, morphogenesis and ultrastructure of ectomycorrhizae. 

In: Marks GC, Kozlowski TT (eds) Ectomycorrhizae. Their ecology and physiology. 

Academic Press, New York, London, pp 1–41 

Martin F, Laurent P, de Carvalho D,Voiblet C, Balestrini R, Bonfante P, Tagu D (1999) Cell 

wall proteins of the ectomycorrhizal basidiomycete Pisolithus tinctorius: identification, 

function, and expression in symbiosis. Fungal Gen Biol 27:161–174 

Massicotte HB, Peterson RL, Ackerley CA, Piche Y (1986) Structure and ontogeny of 

Alnus crispa-Alpova diplophloeus ectomycorrhizae. Can J Bot 64:177–192 

Massicotte HB, Peterson RL, Ackerly CA (1987a) Ontogeny of Eucalyptus pilularis- 

Pisolithus tinctorius ectomycorrhizae. I. Light microscopy and scanning electron 

microscopy. Can J Bot 65:1927–1939 

Massicotte HB, Peterson RL, Ackerly CA (1987b) Ontogeny of Eucalyptus pilularis- 

Pisolithus tinctorius ectomycorrhizae. II. Transmission electron microscopy. Can J Bot 

65:1940–1947 

Müller H (1906) Über die Metakutinisierung der Wurzelspitze und über die verkorkten 

Scheiden in den Achsen der Monokotyledonen. Bot Z 4:54–64 

Münzenberger B, Heilemann J, Strack D, Kottke I, Oberwinkler F (1990) Phenolics of 

mycorrhizas and non-mycorrhizal roots of Norway spruce. Planta 182:142–148 

Münzenberger B, Kottke I, Oberwinkler F (1995) Reduction of phenolics in mycorrhizas 

of Larix decidua Mill. Tree Physiol 15:191–196 

Noelle W (1910) Studien zur vergleichenden Anatomie und Morphologie der Koniferenwurzeln 

mit Rücksicht auf die Systematik. Bot Z 68:169–266

226 

Ingrid Kottke 

Oh KI, Melville LH, Peterson RL (1995) Comparative structural study of Quercus serrata 

and Q. acutissima formed by Pisolithus tinctorius and Hebeloma cylindrosporum. 

Trees 9:171–179 

Piché Y, Peterson RL, Ackerley KA (1983a) Early development of ectomycorrhizal short 

roots of pine (Pinus strobus). Scann Electron Microsc 111:1467–1474 

Piché Y, Peterson RL, Howarth MJ, Fortin JA (1983b) A structural study of the interaction 

between the ectomycorrhizal fungus Pisolithus tinctorius and Pinus strobus roots. 

Can J Bot 61:1185–119 

Plaut M (1918) Über die morphologischen und mikroskopischen Merkmale der Periodizität 

der Wurzel, sowie über die Verbreitung der Metakutisierung der Wurzelhaube 

im Pflanzenreich. Festschr. 100. j. Best. K. Württ. Landw. Hochsch. Hohenheim. 

Verlag Ulmer, Stuttgart, S 129–151 

Salzer P, Boller T (2000) Elicitor induced reactions in mycorrhizae and their suppression. 

In: Podila GK, Douds DD Jr (eds) Current advances in mycorrhizae research. Symposium 

Series, APS Press, The American Phytopathological Society, St. Paul, Minnesota, 

pp 1–10 

Salzer P, Münzenberger B, Schwacke R, Kottke I, Hager A (1997) Signalling in ectomycorrhizal 

fungus-root interactions. Trees – contribution to modern tree physiology. 

SPB Academic, The Hague, pp 339–356 

Sitte, P (1975) Die Bedeutung der molekularen Lamellenbauweise von Korkzellwänden. 

Biochem Physiol Pflanzen 168:287–297 

Tagu D, Martin T (1996) Molecular analysis of cell wall proteins expressed during the 

early steps of ectomycorrhiza development. New Phytol 133:73–85 

Tagu D, Lapeyrie F, Ditengou F, Lagrange H, Laurent P, Missoum N, Nehls U, Martin F 

(2000) Molecular aspects of ectomycorrhiza development. In: Podila GK, Douds DD Jr 

(eds) Current advances in mycorrhizae research. Symposium Series, APS Press, The 

American Phytopathological Society, St. Paul, Minnesota, pp 69–90 

Tagu D, De Bellis R, Balestrini R, De Vries OM, Piccoli G, Stocchi V, Bonfante P, Martin F 

(2001) Immunolocalization of hydrophobin HYDPt-1 from the ectomycorrhizal 

basidiomycete Pisolithus tinctorius during colonization of Eucalyptus globulus roots. 

New Phytol 149:127–135 

Thomson J, Melville IH, Peterson RL (1989) Interaction between the ectomycorrhizal 

fungus Pisolithus tinctorius and root hairs of Picea mariana (Pinaceae). Am J Bot 

76:632–636 

Weiss M, Schmidt J, Neumann D, Wray V, Christ R, Strack D (1999) Phenylpropanoids in 

mycorrhizas of Pinaceae. Planta 208:491–502 

Wessels JG (1997) Hydrophobins: Proteins that change the nature of the fungal surface. 

Adv Microbial Physiol 38:1–45 

Wilcox HE (1968) Morphological studies of the roots of Redpine, Pinus resinosa. II. Fungal 

colonisation of roots and the development of mycorrhizae. Am J Bot 55:688–700 

Wilcox HE (1954) Primary organization of active and dormant roots of noble-fir, Abies 

procera. Am J Bot 41:812–821 

Wösten HA, Asgeirdottir SA, Krook JH, Drenth JH, Wessels JG (1994) The fungal 

hydrophobin Sc3p self-assembles at the surface of aerial hyphae as a protein membrane 

constituting the hydrophobic rodlet layer. Eur J Cell Biol 63:122–129 

Wösten HA, de Vocht ML (2000) Hydrophobins, the fungal coat unravelled. Biochim Biophys 

Acta Rev Biomembr 1469:79–86 

Wong K, Montpetit D, Piché Y, Lei J (1990) Root colonization by four closely related genotypes 

of ectomycorrhizal basidiomycete Laccaria bicolor (Maire) Orton – comparative 

studies using electron microscopy. New Phytol 116:669–679

14 Cellular Ustilaginomycete – Plant Interactions 



The Ustilaginomycetes comprises more than 1300 species in ca. 80 genera of 

basidiomycetous plant parasites. They occur throughout the world, although 

many species are restricted to tropical, temperate or arctic regions. Some 

species of Ustilago and Tilletia, e.g., the barley, wheat or maize smut fungi, are 

well known because they are of economic importance (Trione 1982; Thomas 

1989). For example, from 1983 to 1988 the barley smut fungi reduced annual 

yields from 0.7 to 1.6 % in the prairie provinces in central Canada, causing 

annual losses of about US $8,000,000 (Thomas 1989). Tilletia contraversa is 

important in the international wheat trade (Trione 1982) and 2–5 % in a corn 

field are generally infected by Ustilago maydis, while up to 80 % of a field can 

be infected if conditions are good for the fungus. On the other hand, the galls 

of U. maydis are regarded as a delicacy in the Mesoamerican tradition. They 

are known in Mexico as “Huitlacoche” and in parts of the USA. as “maize 

mushroom”,“Mexican truffles” or “caviar azteca”. 

This chapter focuses predominantly on the cellular interaction of the Ustilaginomycetes 

that represents one of the three classes of the Basidiomycota 

(Begerow et al. 1997). 

2 The Term Smut Fungus 

Like the terms agaric, polypore, lichen etc., the term smut fungus circumscribes 

the organization and life strategy of a fungus, but it is not a taxonomic 

term.Smut fungi evolved in different fungal groups.Most smut fungi are in the 

Ustilaginomycetes. Other smut fungi, in the Microbotryales, are members of 

the Urediniomycetes (Bauer et al. 1997; Begerow et al. 1997). There are significant 

convergences between the urediniomycetous and the ustilaginomycetous 

phragmobasidiate smut fungi. Certain taxa of both groups are similar with 




228 

respect to soral morphology,teliosporogenesis,life cycle,basidial morphology 

and host range. 

3 Life Cycle 

The species of the Ustilaginomycetes share an essentially similar life cycle 

with a saprobic haploid phase and a parasitic dikaryophase (e.g., Sampson 

1939). The haploid phase usually commences with the formation of 

basidiospores after meiosis of the diploid nucleus in the basidium and ends 

with the conjugation of compatible haploid cells to produce dikaryotic, parasitic 

mycelia. The dikaryotic phase ends with the production of basidia. 

Almost all Ustilaginomycetes sporulate on or in parenchymatic tissues of 

the hosts. In the ustilaginomycetous smut fungi, the young basidium becomes 

thick-walled and at maturity separates from the sorus, thus functioning as a 

dispersal agent, the teliospore. The teliospores are usually the most conspicuous 

stage in the smut’s life cycle. Most of the Ustilaginomycetes are dimorphic, 

producing a yeast or yeast-like phase in the haploid state. 

4 Hosts 


The Ustilaginomycetes are ecologically well characterized by their plant parasitism. 

Two species occur on spike mosses (Bauer et al. 1999), one on ferns, 

two on conifers, whereas all other Ustilaginomycetes parasitize angiosperms 

with a high proportion of species on monocots, especially on Poaceae and 

Cyperaceae. Thus, of the ca. 1300 species, ca. 42 % occurs on Poaceae and ca. 

15 % on Cyperaceae. Concerning the hosts two points are remarkable: (1) with 

a few exceptions the teliospore-forming species of the Ustilaginomycetes parasitize 

nonwoody herbs, whereas those without teliospores prefer woody 

trees or bushes. However, almost all species sporulate on parenchymatic tissues 

of the hosts. (2) Two of the angiosperm families with the highest number 

of species, the Orchidaceae with about 20,000 species and the Poaceae with 

about 9000 species, play quite a different role for the Ustilaginomycetes. There 

are no known species on Orchidaceae while the Poaceae are the most important 

host family of the Ustilaginomycetes. This can be tentatively explained by 

the completely different ecological strategies of the two families. Orchid 

species subsist with a few isolated individuals and are highly specialized for 

insect pollination. The Poaceae, however, disperse their dusty pollen by the 

wind and cover about a third of the land surface with numerous individuals. 

The ecology of the Ustilaginomycetes, with dusty teliospores or basidiospores 

dispersed by the wind and with the requirement of extensive host populations 

for successful infection, corresponds well to the ecology of the Poaceae.

5 Cellular Interactions 

14 Cellular Ustilaginomycete – Plant Interactions 229 

Information concerning the cellular interaction of the Ustilaginomycetes has 

come from only a few studies (Mims 1982, 1991; Mims and Nickerson 1986; 

Luttrell 1987; Nagler 1989; Nagler et al. 1990; Snetselaar and Tiffany 1990; 

Mims et al. 1992; Snetselaar and Mims 1994; Bauer et al. 1995, 1997; Martinez 

et al. 1999). Hyphae of the Ustilaginomycetes in contact with host plant cells 

possess zones of host–parasite interaction with fungal deposits resulting 

from exocytosis of primary interactive vesicles. These zones provide ultrastructural 

characters diagnostic for higher groups in the Ustilaginomycetes 

(Bauer et al. 1997). Initially, primary interactive vesicles with electron-opaque 

contents accumulate in the fungal cell (Fig. 1). Depending on the fungal 

species, the primary interactive vesicles may fuse with one another before 

being exocytosed from the fungal cytoplasm. Electron-opaque deposits also 

Fig. 1. Interactive 

vesicles in a hypha of 

Exobasidium pachysporum. 

Scale bar 

0.2 mm

230 


appear at the host side, opposite the point of contact with the fungus. Detailed 

studies indicate that these deposits at the host side originate from the exocytosed 

fungal material by transfer towards the host plasma membrane (Fig. 2; 

Bauer et al. 1995, 1997). 

The following major types, minor types and variations were recognized by 

Bauer et al. (1995, 1997). 

5.1 Local Interaction Zones 

Fig. 2. Transfer stage 

between Mycosyrinx cissi 

(upper cell) and its host 

(lower cell). Note the infiltrated 

host cell wall 

(between the arrows) and 

the electron-opaque 

deposit at the host side 

(arrrowhead). Scale bar 

0.1 mm 

Short-term production of many primary interactive vesicles per interaction 

site results in local interaction zones. This type of cellular interaction characterizes 

the Entorrhizomycetidae and Exobasidiomycetidae (Bauer et al. 1997).

Fig. 3. Local interaction 

zone without interaction 

apparatus between Conidiosporomyces 

ayresii 

(upper cell) and its host 

(lower cell) showing the 

secretion profile of one 

interactive vesicle (arrow). 

Note the electron-opaque 

deposit at the host side 

(arrowhead). Host 

response to infection is 

visible at R. Scale bar 

0.5 mm 


5.1.1 Local Interaction Zones without Interaction Apparatus 

Primary interactive vesicles fuse individually with the fungal plasma membrane 

(Fig. 3). Depending upon the species, local interaction zones without 

interaction apparatus are present in intercellular hyphae or in haustoria. This 

type of cellular interaction characterizes the Entorrhizomycetidae, Georgefischeriales, 

Tilletiales and Microstromatales (Bauer et al. 1997). 

5.1.2 Local Interaction Zones with Interaction Apparatus 

Fusion of the primary interactive vesicles precedes exocytosis. This type of 

cellular interaction characterizes the Exobasidianae (Bauer et al. 1997). 

5.1.2.1 Local Interaction Zones with Simple Interaction Apparatus 

Primary interactive vesicles fuse to form one large secondary interactive vesicle 

per interaction site (Fig. 4). Interaction zones of this type are only located 

in intercellular hyphae. This type of cellular interaction characterizes the 

Entylomatales (Bauer et al. 1997). 

5.1.2.2 Local Interaction Zones with Complex Interaction Apparatus 

Numerous primary interactive vesicles fuse to form several secondary interactive 

vesicles per interaction site. Fusion of the secondary interactive vesicles

232 


Fig. 4. Local interaction zone between Entyloma hieracii (upper cell) and its host (lower 

cell) showing the exocytosis profile of a simple interaction apparatus (arrow). Note the 

electron-opaque deposit at the host side (arrowhead). Host response to infection is visible 

at R. Scale bar 0.5 mm 

then results in the formation of a complex cisternal net. This type of cellular 

interaction characterizes the Doassansiales and Exobasidiales (Bauer et al. 

1997). 

1. Local interaction zones with complex interaction apparatus containing 

cytoplasmic compartments (Fig. 5) 

The intercisternal space of the cisternal net finally becomes integrated in 

the interaction apparatus. Depending upon the species, interaction zones 

of this type are formed by intercellular hyphae or haustoria. This type of 

cellular interaction characterizes the Doassansiales (Bauer et al. 1997). 

2. Local interaction zones with complex interaction apparatus producing 

interaction rings (Fig. 6)


Fig. 5. Local interaction zone between Doassinga callitrichis (upper cell) and its host 

(lower cell) showing the exocytosis profile of a complex intercisternal interaction apparatus 

(arrow). The interaction apparatus and its intercisternal space is excluded from the 

cytoplasm. Note the electron-opaque deposit at the host side (arrowhead). Host 

response to infection is visible at R. Scale bar 0.5 mm 

Fig. 6. Local interaction 

zone between Exobasidium 

pachysporum (upper cell) 

and its host (lower cell) 

showing the exocytose 

profile of a complex interaction 

apparatus (arrows) 

and the sectioned interaction 

ring (double arrowheads). 

Note the electronopaque 

deposit at the host 

side (arrow). Initial host 

response to infection is 

visible at R. Scale bar 

0.5 mm

234 


The intercisternal space does not become integrated in the interaction 

apparatus. The transfer of fungal material towards the host plasma membrane 

occurs in two or three steps. The first transfer results in the deposition 

of a ring at the host plasma membrane. Depending upon the species, 

interaction zones of this type are located in intercellular hyphae or haustoria. 

This type of cellular interaction characterizes the Exobasidiales (Bauer 

et al. 1997). 

5.2 Enlarged Interaction Zones 

Continuous production and exocytosis of primary interactive vesicles results 

in the continuous deposition of fungal material at the whole contact area with 

the host cell. Depending upon the species, this type of interaction zone is 

located in intercellular hyphae (Fig. 2), intracellular hyphae or haustoria 

(Fig. 7). This type of cellular interaction characterizes the Ustilaginomycetidae 

(Bauer et al. 1997). 

Fig. 7. Haustorial apex (h) 

of Ustacystis waldsteiniae 

encased by an electronopaque 

vesicular matrix 

(arrows). Scale bar 0.5 mm

6 Conclusions 


Similar development of the different interaction types occurring in the Ustilaginomycetes 

reveals that these interaction types are homologous to one 

another, thus reflecting variations of a common ancestral type. Accordingly, 

during the phylogenetic history the cellular interactions gradually specialized 

and optimized. An apomorphy for the Ustilaginomycetes is the presence of 

interaction zones with fungal deposits resulting from exocytosis of primary 

interactive vesicles. The contents of the primary interactive vesicles are transferred 

towards the host plasma membrane by different mechanisms in the 

various taxa. This parasitic process is unique among the basidiomycetes (e.g., 

see Littlefield and Heath 1979). Interestingly, a similar parasitic process may 

occur in the downy mildews (Hickey and Coffey 1977; Coffey and Wilson 

1983; Wetherbee et al. 1985). The similarities include the presence of densely 

stained vesicles at the penetration region, the localized increase in the electron 

opacity of the host cell, and the deposition of electron-opaque material 

between host cell wall and host plasma membrane. Because of numerous fundamental 

differences between the downy mildews and the Ustilaginomycetes, 

these similarities must be interpreted as a result of convergent evolution. 

The transfer of fungal material towards the host plasma membrane 

appears to be unusual and its function is basically unknown. Bauer et al. 

(1995) studied the cellular interaction of the ustilaginomycete Ustacystis 

waldsteiniae in detail and hypothesized the following scenario for this fungus: 

the transferred fungal material stabilizes and binds the associated host 

plasma membrane and, thus prevents on the one hand, membrane recycling 

via endocytosis. On the other hand, exocytosis of Golgi products of the host 

cell at this point results in the formation of coralloid vesicular buds extending 

into the fungal deposit. Finally, the vesicular buds separate from the host cytoplasm. 

Bauer et al. (1995) assumed that in this interaction scenario the following 

three characteristics are advantageous for the parasite: (1) the Golgi products 

extruded via exocytosis could serve as direct nutriment for the parasite, 

(2) the formation of the coralloid vesicular buds extending into the fungal 

deposits results in a greatly increased transfer-like host – parasite contact surface, 

and (3) the content of the vesicular buds could also serve as direct nutriment 

for the parasite. 

Acknowledgements. We thank Uwe Simon for critically reading the manuscript, and the 

Deutsche Forschungsgemeinschaft for financial support.

236 



Bauer R, Mendgen K, Oberwinkler F (1995) Cellular interaction of the smut fungus Ustacystis 

waldsteiniae. Can J Bot 73:867–883 

Bauer R, Oberwinkler F, Vánky K (1997) Ultrastructural markers and systematics in 

smut fungi and allied taxa. Can J Bot 75:1273–1314 

Bauer R, Vánky K, Begerow D, Oberwinkler F (1999) Ustilaginomycetes on Selaginella. 


Begerow D, Bauer R, Oberwinkler F (1997) Phylogenetic studies on large subunit ribosomal 

DNA sequences of smut fungi and related taxa. Can J Bot 75:2045–2056 

Coffey MC, Wilson UE (1983) An ultrastructural study of the late-blight fungus Phytophthora 

infestans and its interaction with the foliage of two potato cultivars possessing 

different levels of general (field) resistance. Can J Bot 61:2669–2685 

Hickey EL, Coffey MD (1977) A fine-structural study of the pea downy mildew fungus 

Peronospora pisi in its host Pisum sativum. Can J Bot 55:2845–2858 

Littlefield LJ, Heath MC (1979) Ultrastructure of rust fungi. Academic Press, New York 

Luttrell ES (1987) Relations of hyphae to host cells in smut galls caused by species of 

Tilletia, Tolyposporium, and Ustilago. Can J Bot 65:2581–2591 

Martinez C, Roux C, Dargent R (1999) Biotrophic development of Sporisorium reilianum 

f. sp. zeae in vegetative shoot apex of maize. Phytopathology 89:247–253 

Mims CW (1982) Ultrastructure of the haustorial apparatus of Exobasidium camelliae. 


Mims CW (1991) Using electron microscopy to study plant pathogenic fungi. Mycologia 

83:1–19 

Mims CW, Nickerson NL (1986) Ultrastructure of the host-pathogen relationship in the 

red leaf disease of lowbush blueberry caused by the fungus Exobasidium vaccinii. Can 

J Bot 64:1338–1343 

Mims CW, Snetselaar KM, Richardson EA (1992) Ultrastructure of the leaf stripe smut 

fungus Ustilago striiformis: host-pathogen relationship and teliospore development. 

Int J Plant Sci. 153:289–290 

Nagler A, Oberwinkler F (1989) Haustoria in Urocystis (Tilletiales). Plant Syst Evol 

165:17–28 

Nagler A, Bauer R, Oberwinkler F, Tschen J (1990) Basidial development, spindle pole 

body, septal pore, and host-parasite-interaction in Ustilago esculenta. Nordic J Bot 

10:457–464 

Sampson K (1939) Life cycles of smut fungi. Trans Br Mycolog Soc 23:1–23 

Snetselaar KM, Tiffany LH (1990) Light and electron microscopy of sorus development 

in Sorosporium provinciale, a smut of big bluestem. Mycologia 82:480–492 

Snetselaar KM, Mims CW (1994) Light and electron microscopy of Ustilago maydis 

hyphae in maize. Mycolog Res 98:347–355 

Thomas PL (1989) Barley smuts in the prairie provinces of Canada, 1983–1988. Can J 

Phytopathol 11:133–136 

Trione EJ (1982) Dwarf bunt of wheat and its importance in international wheat trade. 

Plant Dis 66:1083–1088 

Wetherbee R, Hinch JM, Clarke AE (1985) Response of Zea mays roots to infection with 

Phytophthora cinnamomi II. The cortex and stele. Protoplasma 126:188–197

15 Interaction of Piriformospora indica 

with Diverse Microorganisms and Plants 

Giang Huong Pham, Anjana Singh, Rajani Malla, Rina Kumari, 

Ram Prasad, Minu Sachdev, Karl-Heinz Rexer, Gerhard Kost, 

Patricia Luis, Michael Kaldorf, François Buscot, 

Sylvie Herrmann, Tanja Peskan, Ralf Oelmüller, 

Anil Kumar Saxena, Stephané Declerck, Maria Mittag, 

Edith Stabentheiner, Solveig Hehl, and Ajit Varma 


An axenically cultivable Mycorrhiza-like-fungus has been described by 

Varma and his collaborators. The fungus was named Piriformospora indica 

based on its characteristic pear-shaped chlamydospores (Verma et al. 1998). P. 

indica tremendously improves the growth and overall biomass production of 

diverse hosts, including legumes (Varma et al. 1999, 2001; Singh et al. 2002a), 

medicinal and other plants of economic importance (Rai et al. 2001; Singh et 

al. 2003a, b). Interestingly, the host spectrum of P. indica is very much like 

arbuscular mycorrhizal fungi (AMF). In addition, a pronounced growth promotional 

effect was seen with terrestrial orchids (Blechert et al. 1999; Singh 

and Varma 2000; Singh et al. 2000, 2002b). The fungus also provides protection 

when inoculated into the tissue culture-raised plantlets by overcoming the 

‘transient transplant shock’ on transfer to the field and renders almost 100 % 

survival (Sahay and Varma 1999, 2000). The fungus has great potential in 

forestry, horticulture, agriculture, viticulture and especially for better establishment 

of tissue culture-raised plants much needed in the plant industry 

(Singh et al. 2003). This would open up numerous opportunities for the optimization 

of plant productivity in both managed and natural ecosystems, 

while minimizing the risk of environmental damage. The properties of the 

fungus, Piriformospora indica, have been patented (Varma and Franken 1997, 

European Patent Office, Muenchen, Germany. Patent No. 97121440.8–2105, 

Nov. 1998). The culture has been deposited at Braunschweig, Germany (DMS 

No.11827). An 18S rDNA fragment was deposited at EMBL under the accession 

number AF 014929. 




238 

Giang Huong Pham et al. 

The fungus forms inter- and intracellular hyphae in the root cortex, often 

differentiating into dense hyphal coils and chlamydospores. Like AM fungi, 

hyphae multiply within the host cortical tissues and never traverse through 

the endodermis. Likewise, they also do not invade the aerial portion of the 

plant (stem and leaves). 

This chapter details the interaction of P. indica with various groups of 

microorganisms and higher plants. 

2 Interaction with Microorganisms 

2.1 Rhizobacteria 

Piriformospora indica and the respective bacteria Pseudomonas fluorescence 

and Azotobacter chroococcum were placed on defined modified Aspergillus 

medium (see Chap. 30). After 7-day incubation at 25 °C, it was found that Ps. 

fluorescence completely blocked the growth of the fungus. P. indica acquired 

immense, but tiny chlamydospores, perhaps to overcome the stress (Fig. 1). 

Plausible reasons for the inhibition could be the production of ammonia, 

HCN, siderophores, antibiotics or chitinase. In contrast, Az. chroococcum promoted 

the growth of the fungus which produced extensive mycelium with low 

and delayed sporulation. The strains of Pseudomonas sp. and Ps. putrida also 

Fig. 1. Interactions with Pseudomonas fluorescens (left) and Bradyrhizobium sp. (right). 

P. indica was grown in the center of plates with modified Aspergillus medium for 48 h. 

Then freshly grown (early log phase) bacteria were inoculated four times at an equal distance 

close to the margin of the plate. Incubation was done at 25±2 °C. Photographed 

after 5 days. The growth of P. indica was strongly suppressed by Ps. fluorescens and promoted 

by Bradyrhizobium sp.

15 Interaction of Piriformospora indica with Diverse Microorganisms and Plants 239 

initially blocked the growth of P. indica, but the fungus rapidly recovered. 

Bacillus subtilis had neutral effects, whereas strains of Azospirillum and 

Bradyrhizobium promoted the growth of the fungus. 

2.2 Chlamydomonas reinhardtii 

Ch. reinhardtii and P. indica were allowed to grow on MMN 1/10 medium. The 

alga was inoculated as a streak either only on one side or on both sides of a 

fungal disc. Both microorganisms grew well in both experiments, but the 

growth of the alga was more intense and the color of the colony was a much 

darker green if there was only one streak (Fig. 2). At this stage, to our knowledge, 

no suitable explanation can be offered for these phenomena. 

2.3 Sebacina vermifera 

One disc each of P. indica and S. vermifera were placed on Aspergillus 

medium. The distance between the two inocula was 4 cm. Both fungi grew 

normally without inhibiting the growth of each other. The most interesting 

part was that after 7 days at the intersection of two colonies, hyphae turned 

highly intertwined, inflated and produced a large number of chlamydospores. 

Therefore, both strains were able to block each other with a typical deadlock 

Fig. 2. Interaction with Chlamydomonas reinhardtii. P. indica was grown on MS 

medium for 48 h. Thereafter, the green alga was streaked on one side (left) or on both 

sides (right) of the mycelium. Incubation was carried out under 52 µmol/m light and 

24±2 °C temperature. Left Dark green strongly grown algal colonies

240 


reaction. No evidence for the production of basidia and basidiospores was 

recorded (Fig. 3). 

2.4 Other Soil Fungi 

Several commonly occurring soil fungi were tested for the interaction with P. 

indica. The results were highly diverse (Fig. 4). The growth of Aspergillus 

sydowii, Rhizopus stolonifer, andAspergillus niger was completely blocked by 

P. indica. The growth of Cunninghamella echinulata was reduced, whereas 

Rhizopus oryzae, As. flavus and Aspergillus sp. completely blocked the growth 

of P. indica. The data indicated that P. indica divulges a wide range of interaction 

types with diverse soil fungi. 

2.5 Gaeumannomyces graminis 

Fig. 3. Interaction with Sebacina vermifera. 

The fungal inocula were placed 

on Aspergillus medium about 3 cm 

apart and incubated for 5 days. The 

mycelia formed a sharp demarcation 

line where they touched 

In his pioneering work, Dehne (1982) was able to show that AM fungi are able 

to reduce soil-borne diseases and/or the severity of diseases caused by root 

pathogens. P. indica was challenged with a virulent root and seed pathogen G. 

graminis (Fig. 5). In a confrontational experiment, initially the mycelia were 

not able to overcome each other, resulting in sharp borderlines between the 

colonies. After prolonged incubation, P. indica started to invade into the area 

of G. gramins and caused a lysis of the root pathogen hyphae. 

In another experiment, when the P. indica was allowed to grow earlier and 

the pathogen was inoculated later in the center of the solidified Aspergillus 

medium, the pathogen growth was completely blocked. A culture filtrate of P. 

indica also completely inhibited the growth of the pathogen. These experi-


Fig. 4a–f. Interactions with soil fungi. One disc of P. indica and a soil fungus each were 

placed on the solidified Aspergillus medium. Closed arrows indicate where P. indica was 

inoculated, open arrows indicate the inoculation placement of the respective fungus. a 

Aspergillus sydowii, b Rhizopus stolonifer, c Aspergillus niger, d Rhizopus oryzae, e 

Aspergillus flavus, f Aspergillus sp. P. indica strongly suppressed the growth of some 

fungi studied (a–c) or was itself suppressed (f)

242 


Fig. 5. Interaction with Gaeumannomyces graminis (G). Two discs of P. indica (P) and 

the root pathogen were each placed at equal distances. Incubation was done for 7 days on 

Aspergillus medium in the dark at 25±2 °C. Right Top view of the mycelia, left bottom 

view of the mycelia shining through the agar. The mycelia formed a sharp demarcation 

line where they made contact; after prolonged incubation, P. indica invaded the hyphal 

mat of G. graminis 

ments demonstrated that P. indica is able to act as a potential agent for biological 

control of root diseases; however, the chemical nature of the inhibitory 

factor is still unknown. 

3 Interaction with Bryophyte 

To test the ability of P. indica to interact with different kinds of moss and liverwort, 

the plants were first grown in axenic culture. In co-culture with the 

fungus, Eurhynchium praelongum and Cephalozia bicuspidata were weakly 

colonized without causing severe symptoms to the gametophyte. In Riccardia 

incurvata heavy colonization took place, but the growth promotional effect 

was hardly significant. In this liverwort the interaction was intense and the 

fungus entered deeply into the thallus. In a further study, the interaction 

found in this species will be compared to the interaction found in Aneura pinguis, 

a liverwort of the same family Aneuraceae. 

4 Interaction with Higher Plants 

A large number of diverse higher plants (mono- and dicots) interacted with P. 

indica (Table 1). This included terrestrial, annual and perennial herbs, and 

woody plants. Interestingly, P. indica mimics a number of symbiotic proper-


Table 1. Host spectrum tested for P. indica 

Hosts 

Abrus precatorius L. 

Acacia catechu (L.) Willd. 

A. nilotica (L.) Del. 

Adhatoda vasica Nees 

Aneura pinguis (L.) Dumort. 

Arabidopsis thaliana (L.) Heynh. 

Artemisia annua L. 

Azadirachta indica A. Juss. 

Bacopa monnieria (L.) Wett. 

Cassia angustifolia Vahl 

Chlorophytum borivilianum Santapau & R.R. Fernandez 

Ch. tuberosum Baker 

Cicer arietinum L. 

Coffea arabica L. 

Cymbopogon martini (Roxb.) W. Wats. 

Dactylorhiza fuchsii (Druce) Soo’ 

D. incarnata (L.) Soo’ 

D. maculata (L.) Verm. 

D majalis (Rchb.) P.F. Hunt & Summerh. 

D. purpurella (Steph’s) Soo’ 

Daucus carota L. 

Delbergia sissoo Roxb. 

Glycine max (L.) Merr. 

Lycopersicon esculentum Mill. 

Nicotiana attenuata Torr. ex S. Wats L. 

N. tabaccum L. 

Oryza sativa L. 

Petroselinum crispum (Mill.) A. W. Hill 

Pisum sativum L. 

Populus tremula L. 

P. tremuloides Michx. (clone Esch5) 

Prosopis chilensis (Mol.) Stuntz 

P. juliflora (Sw.) DC. 

Quercus robur L. (clone oak DF 159) 

Setaria italica (L.) P. Beauv. 

Solanum melongena L. 

Sorghum vulgare Pers. 

Spilanthes calva DC. 

Tagetes erecta L. 

Tectona grandis L. 

Terminalia arjuna Wight & Arn. 

Tephrosia purpurea (L.) Pers. 

Vigna mungo (L.) Hepper 

V. radiata (L.) R. Wilczek 

Withania somnifera (L.) Dunal 

Zea mays L. 

Zizyphus nummularia Burm. fil. 

Data are based on the root colonization analysis in vivo and in vitro (cf.Varma et al. 

2001; Singh et al. 2003a, b)

244 


Fig. 6. Interactions with Zea mays and Setaria italica. The substratum was sterilized and 

filled into pots (1 kg). Fungal inoculum (1 % w/v) was thoroughly mixed with the soil. 

Plants were irrigated with tap water on alternate days to maintain about 70 % soil moisture. 

They were grown under greenhouse conditions maintained at 25±2 °C, 16 h 

light/8 h dark with fluorescent light intensity 1000 lux and relative humidity 70 %. P. 

indica promoted the growth of both monocots


ties, which are characteristics of AM fungi (Singh et al. 2002a, b; Singh et al. 

2003a, b; Varma et al. 2001). It colonizes the root cortex in a variety of host 

plants and improves their overall biomass production. 

4.1 Monocots 

Recently, we have selected the model plants, Zea mays L. and Setaria italica 

(L.) Beauv. for in-depth studies. The roots were colonized and the growth of 

the plants was highly promoted as a result of interaction with the fungus 

(Fig. 6). The phytopromotional influence was evident from early stages of the 

interaction. 

4.2 Legumes 

P. indica promotes the growth and survival of tissue culture raised-tropical 

legumes like Cicer arietinum L., Vigna radiata (L.) R. Wilczek, Pisum sativum 

L., Vigna mungo L. Hepper (Fig. 7) and Glycine max (L.) Merr. The fungal colonization 

resulted in 100 % survival of the in vitro raised plants, whereas it 

was less than 50 % in uninoculated plants. 

A dramatic increase in the plant growth was observed in C. arietinum and 

V. mungo as compared to their corresponding controls. The percent increase 

in plant height was 35.7 and 14.2 %, respectively, and the increase in fresh 

weight was 90 and 11 %, respectively, as compared to corresponding controls. 

Fig. 7. Interactions with Pisum sativum 

(left) and Vigna mungo (right). Surfacesterilized 

seeds of the legumes were 

germinated on water agar. Approximately 

3-cm-long young seedlings were 

placed on MS agar slants and incubated 

with P. indica (P). Control plants (C) 

did not receive any fungus. Tubes were 

incubated at 25±2 °C and 1000 lux. 

Photographs were taken after 6 days. 

The fungus promoted the growth of 

both legumes

246 

Treated roots were colonized by the fungus and produced extramatrical, interand 

intracellular hyphae. Chlamydospores were observed at maturity. 

4.3 Orchids 


Seeds of Dactylorhiza purpurella (Steph’s.) Soó and D. majalis (Rchb. F.) Hunt 

and Summerh. were surface-sterilized and inoculated with P. indica (Fig. 8). 

After 2 weeks, seeds of D. purpurella started germination. After the appear- 

Fig. 8a–d. Interaction with Dactylorhiza majalis. Seeds of the orchid were surface-sterilized 

and germinated on oat agar. When some of the seeds started to swell, P. indica was 

added. The plates were incubated in the dark at room temperature. a Hyphae penetrating 

into the protocorm testa without traversing into the epidermis. b Hypha penetrating 

into a rhizoid (arrowhead), growing towards the protocorm and then entering into the 

cortex. c Semithin section of a peloton formed in a living cortical cell. d SEM picture of 

a peloton formed in a cortical cell, arrowhead pointing at starch grana (Blechert et al. 

1999; Varma et al. 2001)


ance of the rhizoids the fungus penetrated into them, growing towards the 

protocorm. Inter- and intracellular hyphae spread from the basal swelling of 

the rhizoids and typical pelotons were formed in living cortical cells. Digestion 

of the pelotons started 17 days after inoculation. Differences in the 

growth of the protocorms inoculated with P. indica and the corresponding 

controls were obvious after the intracellular interactions began. P. indica was 

found to be a typical orchid mycorrhizal fungus in vitro, promoting growth in 

all tested Dactylorhiza species (Blechert et al.1999; Singh et al. 2000, 2002b; 

Varma et al. 2001). 

4.4 Medicinal Plants 

The tissue culture-raised plants and seedlings from surface-sterilized seeds 

of medicinal plants, like Spilanthes calva DC, Withania somnifera (L.) Dunal, 

Bacopa monnieria (L.) Wett., Adhatoda vasica L., Azadirachta indica A.Juss. 

(neem), Artemisia annua L., Chlorophytum tuberosum Baker, C. borivilianum 

Santapau & R. R. Fernandez (musli), and Termnalia arjuna L. were inoculated 

with P. indica in mist chambers and nurseries before being transferred 

to the field (Fig. 9). 

Significant increases in growth and yield of the plant species were recorded 

relative to uninoculated controls. Shoot and root length, biomass, basal stem, 

leaf area, overall size, inflorescence number, flower and seed production were 

all enhanced in the presence of the fungus. Net primary productivity was also 

higher than in control plants. The results clearly indicate the commercial 

potential of P. indica for large-scale cultivation of medicinal plants. The differences 

in growth observed may have been caused by a greater absorption of 

water and mineral nutrients due to extensive colonization of roots and the 

proliferation of the mycelium into the soil. 

In another pot trial experiment, neem seedlings were inoculated with Glomus 

mosseae, Scutellospora gilmorei, and P. indica. The treatment was conducted 

using pots with sterile and natural soils. Plant growth of P. indicatreated 

plants was found to be drastically improved compared to those plants 

treated with AM fungi and controls. P. indica-treated plants attained maximum 

height, healthier foliage and a well developed subterranean. 

Bacopa monnieria (L.) Wett. is considered to be important because the 

whole plant has medicinal value. P. indica colonizes the roots of tissue culture-raised 

plants and promoted the overall plant biomass. A biological 

hardening rendered almost 100 % survival on transfer from the laboratory to 

the field. 

S. calva and W. somnifera were treated with P. indica in a field trial. A pronounced 

growth response following the P. indica inoculation was observed. 

The basal stem and leaf areas of treated plants were enhanced. Interestingly, 

large kidney-shaped inflorescences were observed on inoculated S. calva

248 


Fig. 9a–f. Interactions with medical plants. P. indica was used for the inoculation of 

young seedlings of a Adhatoda vasica, b Azadirachta indica, c Terminalia arjuna, d Spilanthus 

calva, e Withania somnifera and f Chlorophytum borivillianum growing in pots. 

After the establishment of the interaction, the latter three plant species were tranferred 

to the field where the pictures were taken. In a–c, e, the control is on the left, inoculated 

plants are on the right. In all experiments growth and flowering of the treated plants 

were obviously promoted


plants, however, these kidney-shaped inflorescences were never observed in 

control plants. The length of the inflorescence and the number of flowers on 

inoculated S. calva plants also increased compared to the controls. Similarly, 

the number of flowers of the inoculated W. somnifera was higher than in the 

controls.For both inoculated medicinal plant species,the number of seeds was 

higher than for the controls (Rai et al.2001),and the overall root biomass of the 

inoculated plants was higher than that of the corresponding controls.The fresh 

and dry weights of both underground and aboveground parts of S.calva and W. 

somnifera-inoculated plants were higher than in the controls. 

4.5 Economically Important Plants 

Plants of economic importance tested in vivo and in vitro were Tagetes erecta 

L. (marigold), Nicotiana tabaccum L. (tobacco), Lycopersicon esculentum Mill. 

(tomato) and Solanum melongena L. (bringal). In a pot trial marigold inoculated 

with P. indica showed healthier plants with early bud formation and 

enlarged flowers compared to the control (Fig. 10). 

Hypocotyl of germinated seeds of tobacco were taken as an explant for callus 

development. Callusing regeneration of the shoot was established on MS 

medium (Murashige and Skoog 1962). Biological hardening of the regenerated 

plantlets with P. indica recorded the maximum capacity for regaining the 

tensile strength of the stem (Fig. 11). Plants treated with G. mosseae possessed 

less tensile strength, but more than the control plantlets. 

Early root induction was recorded in the bringal root organ culture interacting 

with P. indica (Tables 2, 3). This study indicated that P. indica is a potent 

Fig. 10. Interaction with Tagetes erecta. 

The experiment was conducted as 

described in Fig. 6. P. indica-inoculated 

plants (P) were extensive in growth and 

had bigger flowers compared to the 

control (C)

250 


Fig. 11a–d. Interaction with tissue culture-raised Nicotiana tabacum. Surface-sterilized 

seeds of tobacco were germinated on 1/2 strength MS medium. Fifteen days after germination, 

hypocotyl was transferred for callus formation on MS media supplemented with 

NAA 2 mg/l and BAP 0.5 mg/l. Cultures were grown in a controlled tissue culture laboratory. 

Mycelia of P. indica were grown in culture bottles on minimal medium. Regenerated 

shoots were transferred to these bottles. Observations were made after 15 days of treatment; 

root fragments were stained with Trypan blue.After 3 weeks the plants were transferred 

to pots with sterile substratum and grown in a mist chamber. a Massive callus formation 

on 1/2 MS medium of the P. indica-treated plants (right) compared to the control 

(left). b Root fragment of inoculated tobacco plantlet colonized by the fungus. c Differentiation 

of the callus cultures after 15 days of inoculation on regeneration medium; left 

control, right treated plantlet. d Tobacco plants after 8 weeks in a mist chamber, left control, 

right treated plant


plant growth-promoting fungus. It is not only the mycelium in association 

with the root which exerts this effect, fungus culture filtrate containing fungal 

exudates (these may be hormones, proteins, enzymes, polyamines, 

amino acids, etc.) also exhibited almost the same effect. 

P. indica-inoculated tomato seedlings grown in glass tubes on MS 

medium were about three times higher than the control and proliferate root 

biomass was observed. Soon after inoculation adventitious roots appeared 

high above the surface of the substrate. As a result of prolonged incubation, 

the subapical region of the shoot became chlorotic and finally the leaves 

wilted, probably due to the restricted nutrition. However, adventitious roots 

started developing again from the apex, thus maintaining a green tip. 

Table 2. Morphological features of tobacco plantlets after treatment with different 

mycobionts (biological hardening) 

Mycobiont 2 Weeks 4 Weeks 

Control Leaves lost turgor pressure Some leaves turned yellow, stem 

and stem the tensile strength turned brown 

G. mosseae Leaves lost turgor pressure Some leaves dried, stem regained 

and stem the tensile strength tensile strength 

P. indica Leaves lost turgor pressure and Plants were healthy, stem 

stem the tensile strength regained tensile strength 

cf. Sahay and Varma (1999) 

Morphological features of micropropagated tobacco plantlets subjected to biological 

hardening with Glomus mosseae and Piriformospora indica. Soil substrata were sterilized 

soil:sand mixture (3:1). Inocula (spores, hyphae, colonized root pieces, etc.) were 

included at 1 % (w/v) to each pot (10¥6 cm) 

Table 3. Plant biomass and percent-colonization as a result of interaction of the 

plantlets with mycobionts (biological hardening) 

Mycobionts Fresh weight (g/plant) Colonization (%) 

Control 2.18±0.199 nd 

Glomus mosseae 2.69±0.145 64±15.16 

Piriformospora indica 3.08±0.266 76±25.10 

Plants were harvested and the total fresh weight was recorded. Fungal root colonization 

was estimated after staining with Trypan blue. RM ANOVA ON RANKS test shows 

c 2 =8.40 with 3 degrees of freedom. P (est) =0.0384, P (exact) =0.0190. The differences in the 

median value among the treatment groups are greater than would be expected by 

chance, i.e., there is a statistically significant difference (P=0.0190). Data represent mean 

±SD, nd, not detected

252 


4.6 Timber Plants 

Young seedlings of Populus tremula L., Quercus robur L. and Dalbergia sissoo 

Roxb. ex DC. were tested in the green house and followed by field trials. In a 

pot culture experiment, P. indica-inoculated plants of Po. tremula were 

strongly promoted according to their biomass production compared to the 

controls (Fig. 12). Qu. robur (clone oak DF 159) was micro-propagated and 

rooted as described by Herrmann et al. (1998). P. indica was pre-cultivated for 

7 days on Aspergillus medium (Kaefer 1977). Co-culture was performed on 

MMN 1/10 medium (Marx 1969) in Petri dishes. The oak shoots grew out of 

the dish and to avoid rapid wilting, the inoculated dishes were grown in large 

Petri dishes (radius of 145 mm) with moistened absorbent paper sheets. Cocultivation 

was carried out at 25 °C and a photoperiod of 16 h illumination 

(97 W m –2 ; OSRAM L 115 W/20SA cool white) for 10 weeks. At the end of the 

experiment, the roots were colonized by the fungus (Fig. 12). 

Precedent results (Herrmann et al. 1998) showed that an ectomycorrhizal 

fungus Piloderma croceum Erikss. & Hjortst. was able to enhance plant 

growth of oaks before any mycorrhizal formation occurred. Hence, P. indica 

and P. croceum were able to enhance root development. In further investigations 

it would be of interest to compare the effects of both fungi separately 

and in combination on root initiation and elongation, and analyse in which 

Fig. 12. Interactions with ectomycorrhizal plants. Left Seedlings of Populus tremula 

(obtained from Köln, Germany) were treated with P. indica. The experimental design 

was the same as described in Fig. 6. The larger plant was treated with the fungus, the 

smaller plant without fungus. Right Quercus robur (clone oak DF 159) seedlings were 

treated with P. indica under laboratory conditions. It was micro-propagated and rooted 

as described by Herrmann et al. (1998). P. indica was pre-cultivated for 7 days on 

Aspergillus medium. Co-culture was performed on 1/10 MMN medium in Petri dishes. 

Co-cultivation was conducted at 25 °C and a photoperiod of 16 h illumination (97 W/m) 

over a duration of 10 weeks. Picture shows hyphae and spores formed within and around 

the roots


manner diffusing substances may be involved in the phenomena. A similar 

positive response was recorded for P. tremula and D. sissoo. 

4.7 Unexpected Interactions with Wild-Type and Genetically Modified 

Populus Plants 

Hybrid aspen Populus tremula x P. tremuloides Michx. (clone Esch5, kindly 

supplied by Dr. M. Fladung, Federal Research Centre for Forestry and Forest 

Products, Grosshansdorf, Germany) were cultivated in vitro at 25 °C in permanent 

light. Four plants were grown in each Magent GA7 vessel containing 

80 ml of WPM medium (see Chap. 30). When 2-cm cuttings of the shoot 

including the tip were transferred to fresh medium, rooting was initiated at 

the cutting site in most transplants after 5–6 days. When Populus was inoculated 

with P. indica after rooting of transplants had commenced, stimulation 

in the root growth was observed after 5 days. A clear stimulation of root 

branching and an apparent increase in root length were observed (Fig. 13). 

This result confirms the observations made for other plants. No significant 

changes were observed in plant shoot growth. 

In a second experiment, the fungus was allowed to grow in the WPM 

medium 1 week prior to the Populus transplants. Interestingly, plant growth 

and rooting pattern changed under these conditions. The salient changes 

recorded were: 

– inhibition of root formation at the cutting site where rooting normally 

occurs without inoculation with fungus. 

– aerial root formation was induced. 

– deformations occurred in aerial roots when they came into contact with 

the surface of the fungus-inoculated medium, and they failed to grow into 

the medium. 

Shoot growth of inoculated plants was suppressed compared to the control. 

After 6 weeks of cultivation, a profuse fungal mat appeared on the surface of 

the medium, however, plants were not killed. Observed under the light microscope, 

fungal infection was not detected in aerial roots. 

We speculated that one or more chemical compounds were produced by 

the mycelium which were responsible for the changes mentioned above. To 

prepare a crude extract, plant material was removed from the cultures. The 

remaining medium (with or without fungus) was autoclaved for 30 min at 

121 °C. These extracts were mixed with the same volume of double strength 

WPM medium and filled into culture vessels. After solidification, four transplants 

without roots were transferred into these media. After 5 days in the 

medium prepared with the plant extract, the rooting was initiated at the cutting 

site. In contrast, the plants incubated with the extract prepared from both 

types of media did not form any roots (neither in the medium nor in the air).

254 


Fig. 13a–d. Interaction with in vitro grown Populus clone Ech5 on WPM. Explants with 

a length of 2 cm, including one terminal and 5–6 side buds were transferred to Magenta 

GA7 vessels containing 80 ml of WPM medium. a Top view of a noninoculated control 

after 4 weeks of cultivation at 25 °C in constant light; b four discs of P. indica culture 

(snowflake) were placed onto the medium and incubated for 7 days at 25 °C prior to the 

introduction of the plant cuttings; c normal rooting started at the cutting site (arrow) 

after 1 week. The photo shows the typical rooting pattern after 4 weeks; d rooting pattern 

of an inoculated plantlet after 4 weeks of co-cultivation with P. indica; rooting at the cutting 

site was completely blocked (arrow). Instead, aerial rooting appeared above the 

medium, ca. 1 cm apart from the cutting site (arrow). Root tips, when in contact with the 

medium, showed a modified morphology (see circles). Inset shows a magnified view of 

the modified root tips


Water extracts of fungus and plant-grown medium prepared at room temperature 

had no influence on rooting. 

4.8 Non Mycorrhizal Plants 

Most species of the plants are normally infected by mycorrhizal fungi, but 

some plant taxa do not usually form generally recognizable mycorrhizas 

(Tester et al. 1987). Members of, e.g., Brassicaceae, Chenopodiaceae and Amaranthaceae 

(Read 1999; Singh et al. 2003a, b; Varma 1998, 1999; Varma et al. 

2001), belong to this exceptional group of nonmycorrhizal plants. The mechanism 

which determines the nonhost nature of plant species preventing the 

establishment of a functional symbiosis is not known. Present knowledge of 

the sequence of fungal development leading to the establishment of functional 

mycorrhiza suggests that the nonhost nature of plants lies in their 

inability to trigger expression of fungal genes involved in hyphal commitment 

to the symbiotic status. 

It would be useful to assess these plants with respect to their interaction 

with P. indica. In vitro studies with P. indica and S. vermifera recorded that 

these two symbiotic fungi profusely interacted with the root system of the 

crucifer plants, Brassica juncea (L.) Czern. et Coss. (mustard), Brassica oleracea 

var. capitataL. (cabbage), and the Chenopodiaceae Spinacia oleracea L. 

(spinach). Although some of these plants were said to be able to form AM 

(Tester et al. 1987), no mycorrhizal interactions with Glomus mosseae were 

found in the pot trials we conducted. Instead, all the plants inoculated with P. 

indica were colonized by the fungus and recorded phytopromotional effects 

in comparison to the control. However, a high degree of variation was 

recorded in with respect to biomass and their length. Cabbage responded 

most positive with P. indica. Different results were recorded in root systems. 

In cabbage, the fungi profusely colonized inter- and intracellularly the root 

cortex cells. Colonization in mustard was less in comparison to cabbage and 

followed by spinach. 

Further experiments indicated that P. indica did not invade the root of myc – 

mutants of pea (Pisum sativum L.) and soyabean (Glycine max (L.) Merr.). 

When the fungus was confronted with these mutants, plant growth was suppressed 

and the fungal morphology was severely affected. The sporulation of 

P.indicainteracting with wild types was homogenous, while it was heterogeneous 

in myc – mutants (Fig. 14). During the co-cultivation the mycelia turned 

brown and produced a copious amount of mucilage.

256 


Fig. 14. Interaction with myc – mutant of Pisum sativum. Wild-type and myc – mutant of 

pea were inoculated with P. indica. Growth conditions were as described in Fig. 7. Left 

SEM-picture of the surface of colonized roots (wild-type) and mycelial mats of P. indica 

showing dense masses of well differentiated chlamydospores. Right SEM-picture of the 

root surface and the mycelial mat after interaction with myc – mutant and 14 days of 

incubation with a low amount of morphologically heterogeneous chlamydospores 

4.9 Arabidopsis thaliana 

A. thaliana (L.) Heynh. seedlings were pre-germinated for 2 weeks on MS and 

then transferred to Aspergillus medium. Plants were further cultivated with 

or without the fungus P. indica at 22 °C and under short day conditions. Control 

plants (without fungus) remained small with limited root growth and 

branching. In contrast, the co-cultivation with P. indica resulted in promotion 

of the plant growth and extensive root proliferation and elongation.An observation 

of the inoculated roots under the light microscope revealed that the 

fungus colonized the root surface and the cortical zone. Chlamydospores were 

produced by external hyphae (extramatrical) and within the root cortex and 

root hairs (intracellular). The fungal colonization reduced the root hair formation 

(Fig. 15). 

In another independent study, A. thaliana was cultivated on MYP-agar.A 1month-old 

culture was flooded with 10 ml sterilized water to gain a chlamydospore 

suspension for inoculation. Three-day-old A. thaliana seedlings were 

inoculated each with 10 ml of chlamydospore suspension. After 5, 10, 17, and 

31 days of co-cultivation, plants were harvested and the roots examined with 

the light microscope and SEM. Moreover, FDA (fluoresceindiacetate) was used 

to discriminate between living and dead cells. At the latest, 17 days after inoculation, 

the whole root surface of A. thaliana was covered with mycelium. 

Most of the hyphae were growing between root hairs and some were closely 

attached to the rhizodermis. Several of these closely attached hyphae were following 

the anticlinal, axial cell walls of the rhizodermal cells. Keijer (1996) 

found that this is an indication of the beginning of an interaction between 

Rhizoctonia solani and its hosts.


Fig. 15a–d. Interaction with Arabidopsis thaliana. Seedlings were germinated for 

2 weeks on MS and then transferred to Aspergillus medium. Plants were cultivated at 

22 °C and under short day conditions. a Control plants remained small with limited root 

growth and branching; b in contrast, the co-cultivaton with P. indica resulted in the promotion 

of plant growth and extensive root proliferation; c control roots produced a large 

number of root hairs growing uniformly from the top to the base; d inoculated roots as 

seen under the light microscope after staining with cotton blue: P. indica colonized the 

root surface and the cortical zone, spores were produced by external hyphae and in the 

roots and root hairs (inset)

258 


Fig. 16a–e. Interaction with Arabidopsis thaliana. a SEM picture of hyphae closely 

attached to the root surface. Besides normal hyphae (arrowhead) P. indica also forms 

coralloid hyphae (arrow) and chlamydospores (asterisk, collapsed due to preparation); 

b SEM picture of a hypha probably forming an appressorial swelling (arrow), which has 

caused an imprint (arrowhead) on the surface of a rhizodermal cell; c epifluorescence 

LM-picture of a hypha entering a root hair (arrow). Staining: aniline blue; d root stained 

with cotton blue shows intracellular chlamydospores in the rhizodermis (arrows); e a 

segment of the root stained with FDA and observed in epifluorescence showing lower 

FDA-fluorescence (arrowhead) than adjacent regions, indicating less vitality. In bright 

field it was clearly visible that this region was covered with hyphae (arrow chlamydospore)


From 10 days after inoculation on, some hyphae formed irregular, globular 

swellings, which were called coralloid hyphae (Fig. 16). These hyphae preceded 

the production of chlamydospores, which were produced terminally. 

Mature spores could be found from 17 days after inoculation on. On the surface 

of rhizodermal cells occasionally slightly swollen hyphal tips could be 

observed. In some cases an imprint in the host cell wall was visible, probably 

caused by mechanical pressure in combination with enzymes, indicating an 

appressorial function of these hyphal tips (Fig. 16). In some host cells intracellular 

hyphae could be found and at the penetration point, the hyphae had 

generally reduced their diameter. Host cell wall thickenings as an answer to 

the penetration could never be observed. Like hyphae of the external 

mycelium, intracellular hyphae formed coralloid swellings and sometimes 

also produced chlamydospores. A necrotrophic potential of P. indica could be 

demonstrated by vitality tests. Control roots and regions, which were free 

from mycelium were always stained bright green, which indicated the vitality 

of the corresponding cells. Root areas that were covered with hyphae often 

showed weaker or no fluorescence (Fig. 16). This indicates that the fungus is 

able to cause local damage to the root cortex of this host. 

4.10 Root Organ Culture 

Root organ culture of Daucus carota L. (carrot) was prepared as described by 

Bécard and Piche (1992). P. indica interacted with the root organ culture of 

carrot in the same way as was found in other plants tested. The infection rate, 

as a portion of infected root length, has been calculated to be 17 % 9 weeks 

after inoculation, 50 % in the most successful culture and 40 % after pro- 

Fig. 17a–c. Interaction with transformed Daucus carota (Queen Anne’s-lace) root. Root 

organ cultures were inoculated with P. indica and grown for 20 days. a Dark circles represent 

the place for inocula; b hyphae and chlamydospores on the surface of the roots; c 

intracellular sporulation as seen with the LM

260 


longed incubation. Newly developed lateral roots were preferred infection 

sites and most infections started 0.5–1 cm behind the root tips. Bécard and 

Fortin (1988) observed a similar pattern for AMF. The preferential site for primary 

infection by the germ tubes of germinating AM spores was the elongation 

zone of the main root, where lateral root primordia formed. (Fig. 17). 

5 Cell Wall Degrading Enzymes 

The exo-oxidative enzyme laccase has been detected in a large number of 

basidiomycete ectomycorrhizal fungi, in a few ectomycorrhizal ascomycetes 

and only in one endomycorrhizal species (Gramss et al. 1998). All the 

ascomycetes tested showed the presence of laccase, but in basidiomycetes only 

33 out of 44 species were found to be active (Table 4). However, to our knowl- 

Table 4. Laccase activity in mycorrhizal fungi 

Fungal species Systematic positions Laccase References 

activities 

Ectomycorrhizal 

basidiomycetes 

Amanita gemmata Agaricales, Amanitaceae (+) Gramss et al. (1998) 

Amanita muscaria Agaricales, Amanitaceae (+) Gramss et al. (1998) 

Amanita rubescens Agaricales, Amanitaceae (+) Gramss et al. (1998) 

Amanita spissa Agaricales, Amanitaceae (+) Gramss et al. (1998) 

Amanita strobiliformis Agaricales, Amanitaceae (+) Gramss et al. (1998) 

Boletinus cavipes Boletales, Gyrodontaceae (–) Gramss et al. (1998) 

Boletus edulis Boletales, Boletaceae (–) Gramss et al. (1998) 

Boletus erythropus Boletales, Boletaceae (–) Gramss et al. (1998) 

Boletus luridus Boletales, Boletaceae (–) Gramss et al. (1998) 

Boletus piperatus Boletales, Boletaceae (–) Gramss et al. (1998) 

Cortinarius varius Agaricales, Cortinariaceae (+) Gramss et al. (1998) 

Hebeloma crustuliniforme Agaricales, Cortinariaceae (+) Gramss et al. (1998) 

Hebeloma edurum Agaricales, Cortinariaceae (–) Gramss et al. (1998) 

Hebeloma hiemale Agaricales, Cortinariaceae (+) Gramss et al. (1998) 

Hebeloma sinapizans Agaricales, Cortinariaceae (+) Gramss et al. (1998) 

Laccaria amethystina Agaricales, Tricholomataceae (+) Muenzenberger et 

al. (1997) 

Lactarius deliciosus Agaricales, Russulaceae (+) Gramss et al. (1998) 

Lactarius deterrimus Agaricales, Russulaceae (+) Gramss et al. (1998) 

Lactarius necator Agaricales, Russulaceae (–) Gramss et al. (1998) 

Lactarius rufus Agaricales, Russulaceae (+) Gramss et al. (1998) 

Lactarius torminosus Agaricales, Russulaceae (+) Gramss et al. (1998) 

Leccinum scabrum Boletales, Boletaceae (+) Gramss et al. (1998) 

Leccinum versipelle Boletales, Boletaceae (+) Gramss et al. (1998) 

Paxillus involutus Boletales, Paxillaceae (+) Gramss et al. (1999)


edge, the presence of laccase genes in these fungi was shown only in Lactarius 

rufus (Chen et al. 2003). Most fungi tested showed a strong laccase activity. P. 

indica and S. vermifera ss. Warcup and Talbot also showed a positive reaction 

to the ABTS test (oxidation of 2,2¢- azino-bis (3-ethylthiazoline-6-sulfonate), 

i.e., presence of laccase activity (Fig. 18). However, the reaction was faster in 

the former fungus than in the latter. Laccase activity was observed in the very 

young culture (5 days old), whereas in S. vermifera the reaction appeared 

stronger after 10–12 days. 

Other cell wall-degrading enzymes detected in P. indica are given in 

Table 5.All major cell wall degrading enzymes were present in P. indica except 

monoxygenase and phenoloxidase. Table 6 shows the activities of CMC-ase, 

xylanase and polygalacturonase in the plants incubated with P. indica. In the 

case of polygalacturonase, the enzyme activity was higher at the initial stage 

Table 4. (Continued) 

Fungal species Systematic positions Laccase References 

activities 

Pisolithus tinctorius Boletales, Sclerodermataceae (–) Gramss et al. (1998) 

Russula aeruginea Agaricales, Russulaceae (+) Gramss et al. (1998) 

Russula foetens Agaricales, Russulaceae (+) Gramss et al. (1998) 

Russula violeipes Agaricales, Russulaceae (+) Gramss et al. (1998) 

Scleroderma citrinum Boletales, Sclerodermataceae (–) Gramss et al. (1998) 

Suillus aeruginascens Boletales, Boletaceae (+) Gramss et al. (1998) 

Suillus granulatus Boletales, Boletaceae (low) Gramss et al. (1998) 

Suillus grevillei Boletales, Boletaceae (+) Gramss et al. (1998) 

Suillus luteus Boletales, Boletaceae (+) Gramss et al. (1998) 

Suillus variegatus Boletales, Boletaceae (low) Gramss et al. (1998) 

Tricholoma fulvum Agaricales, Tricholomataceae (+) Gramss et al. (1998) 

Tricholoma imbricatum Agaricales, Tricholomataceae (+) Gramss et al. (1998) 

Tricholoma lascivum Agaricales, Tricholomataceae (+) Gramss et al. (1998) 

Tricholoma scalpturatum Agaricales, Tricholomataceae (+) Gramss et al. (1998) 

Tricholoma subannulatum Agaricales, Tricholomataceae (+) Gramss et al. (1998) 

Tricholoma terreum Agaricales, Tricholomataceae (+) Gramss et al. (1998) 

Tricholoma ustaloides Agaricales, Tricholomataceae (+) Gramss et al. (1998) 

Xerocomus badius Boletales, Boletaceae (low) Gramss et al. (1999) 

Xerocomus chrysenteron Boletales, Boletaceae (–) Gramss et al. (1998) 

Xerocomus subtomentosus Boletales, Boletaceae (–) Gramss et al. (1998) 

Ectomycorrhizal ascomycetes 

Morchella conica Pezizales (+) Gramss et al. 1998 

Morchella elata Pezizales (+) Gramss et al. 1998 

Morchella esculenta Pezizales (+) Gramss et al. 1998 

Tuber sp. 

Endomycorrhizal fungi 

Pezizales (+) Miranda et al. 1992 

Glomus etunicatus Glomales (+) Nemec, 1981

262 


Fig. 18. Laccase activity in P. indica. The fungus was grown for 5 days on Aspergillus 

medium, then a small hole (arrow) was cut into the agar at the border of the growing 

mycelial mat. Three drops (30 ml) of ABTS were added. Green coloration appeared and 

was monitored at different time intervals. The evolution of the coloration is given with 

time, but the coloration was immediately obtained after a few seconds. Snowflake indicates 

the fungal growth 

Table 5. Cell wall degrading enzymes from P. indica 

Compound Detection Possible enzymes Important for 

the degradation of 

ABTS + Laccase Lignin 

Ferulic acid + Ferulase Lignin 

Vanillin – Monoxygenase Lignin 

Tannin – Phenoloxidase Phenols 

Starch + Amylase Plant storage polysaccharides 

Cellulose + Cellulase Cellulose 

Gelatine + Protease Proteins 

Pectin + Pectinase Pectin 

Lipid + Lipase Fat 

Xylan + Xylanase Hemicellulose 

Chitin + Chitinase Chitin 

cf. Bütehorn (1999) and Varma et al. (2001) 

(after 20 min) of incubation, i.e., up to 0.058 mmol ml –1 min –1 , and declined to 

0.041 mmol ml –1 min –1 after 80 min of incubation. 

Fungal hyphae entered the cells randomly through the cell wall. It seems 

the entry was facilitated by the combined action of wall degrading enzymes 

and mechanical pressure. 

Under normal conditions AMF do not invade vascular systems and the aerial 

parts of their hosts. Despite heavy root colonization this is also true for P. 

indica and S. vermifera, although these fungi were able to produce heavy 

amounts of cell wall-degrading enzymes.


6 Conclusions 

Table 6. Extracellular hydrolytic enzymes produced in vitro 

by P. indica 

Piriformospora indica is a wide host range organism. It interacts with plant 

growth-promoting rhizobacteria (PGPRs), terrestrial mycobionts, green 

algae, lower and higher plants. Among the PGPRs, Pseudomonas fluorescence 

inhibited the fungus, while strains of Azotobacter, Bradyrhizobium and 

Azospirillum over all enhanced the fungal growth. In vitro and in vivo studies 

as well as field trials have proved phytopromotional effects on most plants 

tested. Exceptions were myc – mutants of pea and soyabean, where the hyphae 

did not invade and the plant growth was negatively influenced. Results 

obtained from the interaction with Arabidopsis thaliana and Hybrid aspen 

(Populus tremula x P. tremuloides) were interesting as they opened new vistas 

to understand the mechanism and molecular basis of plant-fungus symbiosis. 

There are still lots of unanswered questions: how does the fungus promote 

the growth of the plants and why is the growth of nonhosts reduced? what is 

the mechanism of root pathogen suppression? these are only two examples of 

such questions to be answered in the future. 

Acknowledgments. The Indian authors are thankful to DBT, DST, CSIR, UGC, and the 

Government of India for partial financial assistance. We are thankful to Dr. Michael 

Weiss, Germany for providing 28 s rDNA analysis of P. indica. 

IU a 

CMCase 0.013 

Xylanase 0.062 

Polygalacturonase 0.017 

cf.Varma et al. (2001) 

a 0.5 % Na-polypectate (Sigma) was used as the substrate. 

One unit activity (IU) of Pgase is defined as the amount of 

enzyme which releases 1 mol of carboxyl group as equivalent 

to the amount of Na-thiosulphate added to neutralize 

the residual iodine. Polymethylgalacturonase (PMG) was 

completely absent

264 



Bécard G, Fortin JA (1988) Early events of vesicular-arbuscular mycorrhiza formation on 

Ri T-DNA transformed roots. New Phytol 108:211–218 

Bécard G, Piche Y (1992) Establishment of vesicular – arbuscular mycorrhiza in root 

organ culture: Review and proposed methodology. Methods Microbiol 24:89–108 

Blechert O, Kost G, Hassel A, Rexer R-H, Varma A (1999) First remarks on the symbiotic 

interactions between Piriformospora indica and terrestrial orchids. In: Varma A, 

Hock B (eds) Mycorrhizae 2nd edn. Springer, Berlin Heidelberg New York, pp 683–688 

Bütehorn B (1999) Erste Zytologische und molekulare Untersuchungen zu Piriformospora 

indica, einem pflanzenwachstumsfördernden Endophyten. PhD Thesis, Marburg, 

Germany 

Chen DM, Bastias BA, Taylor AFS, Cairney JWG (2003) Identification of laccase-like 

genes in ectomycorrhizal basidiomycetes and transcriptional regulation by nitrogen 

in Piloderma byssinum. New Phythol 157:547–554 

Dehne HW (1982) Interaction between VAM fungi and plant pathogens. Phytopathology 

72:1115–1119 

Gramss G, Kirsche B, Voigt K-D, Günther T, Fritsche W (1998) Conversion rates of five 

polycyclic aromatic hydrocarbons in liquid cultures of fifty-eight fungi and the concomitant 

production of oxidative enzymes. Mycol Res 103:1009–1018 

Gramss G, Günther T, Fritsche W (1999) Spot tests for oxidative enzymes in ectomycorrhizal, 

wood-, and litter decaying fungi. Mycol Res 102:67–72 

Herrmann S, Munch J-C, Buscot F (1998) A gnotobiotic system with oak micro-cuttings 

to study specific effects of mycobionts on plant morphology before, and in the early 

phase of ectomycorrhiza formation by Paxillus involutus and Piloderma croceum. 

New Phytol 138:203–212 

Kaefer E (1977) Meiotic and mitotic recombination in Aspergillus and its chromosomal 

aberrations. Adv Genet 19:33–131 

Keijer J (1996) The initial steps of the interaction process in Rhizoctonia solani.In:Sneh 

B, Jabaji-Hare S, Neate S, Dijst G (eds) Rhizoctonia species: taxonomy, molecular biology, 

ecology, pathology and disease control. Kluwer, Dordrecht, pp 149–162 

Marx DH (1969) The influence of ectotrophic mycorrhizal fungi on the resistance of pine 

roots to pathogenic infections. I.Antagonism of mycorrhizal fungi to root pathogenic 

fungi and soil bacteria. Phytopathology 59:153–163 

Miranda M, Bonfigli A, Zarivi O, Ragnelli AM, Pacioni G, Botti D (1992) Truffle tyrosinase: 

properties and activity. Plant Sci 81:175–182 

Münzenberger B, Otter T, Wustrich D, Polle A (1997) Peroxidase and laccase activities in 

mycorrhizal and non-mycorrhizal fine roots of Norway spruce (Picea abies) and larch 

(Larix decidua). Can J Bot 75:932–938 

Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with 

tobacco tissue cultures. Physiol Plant 15:473–497 

Nemec S (1981) Histochemical characteristics of Glomus etunicatus infection on Citrus 

limon fibrous roots. Can J Bot 59:609–617 

Rai M, Acharya D, Singh A, Varma A (2001) Positive growth responses of the medicinal 

plants Spilanthes calva and Withania somnifera to inoculation by Piriformospora 

indica in a field trial. Mycorrhiza 11:123–128 

Read DJ (1999) Mycorrhiza – The state of art. In: Varma A, Hock B (eds) Mycorrhizae 2nd 

edn. Springer, Berlin Heidelberg New York, pp 3–34 

Sahay NS, Varma A (1999) Piriformospora indica; a new biological hardening tool for 

micropropagated plants. FEMS Microbiol Lett 181:297–302 

Sahay NS, Varma A (2000) Biological approach towards increasing the survival rates of 

the micropropagated plants. Curr Sci 78:126–129


Singh A, Varma A (2000) Orchidaceous mycorrhizal fungi. In: Mukerji KG, Chamola BP, 

Singh J (eds) Mycorrhizal biology. Kluwer Academic/Plenum Publishers, New York, 

pp 265–288 

Singh A, Sharma J, Rexer K-H, Varma A (2000) Plant productivity determinants beyond 

minerals, water and light: Piriformospora indica – A revolutionary plants promoting 

fungus. Curr Sci 79:101–106 

Singh Ar, Singh An,Varma A (2002a) Piriformospora indica – in vitro raised leguminous 

plants: a new dimension in establishment and phytopromotion. Ind J Biotechnol 

1:371–376 

Singh An, Singh Ar, Rexer K-H, Kost G,Varma A (2002b) Root endosymbiont: Piriformospora 

indica – a boon for orchids. J Orchid Soc India 15:89–102 

Singh An, Singh Ar, Kumari M, Rai MK,Varma A (2003a) Biotechnological importance of 

Piriformospora indica Verma et al. – a novel symbiotic mycorrhiza-like fungus: an 

overview. Indian J Biotechnol 2:65–75 

Singh An, Singh Ar, Kumari M, Kumar S, Rai MK, Sharma AP,Varma A (2003b) Unmassing 

the accessible treasures of the hidden unexplored microbial world. In: Prasad BN 

(ed) Biotechnology in sustainable biodiversity and food security. Science Publishers, 

Enfield, NH, pp 101–124 

Tester M, Smith SE, Smith FA (1987) The phenomenon of “nonmycorrhizal” plants. Can 

J Bot 65:419–431 

Varma A (1998) Mycorrhizae, the friendly fungi: what we know and how do we know? In: 

Varma A (ed) Mycorrhiza manual. Springer, Berlin Heidelberg New York, pp 1–24 

Varma A (1999) Functions and applications of arbuscular mycorrhizal fungi in arid and 

semi-arid soils. In: Varma A, Hock B (eds) Mycorrhiza. Springer, Berlin Heidelberg 

New York, pp 521–556 

Varma A,Verma S, Sudha, Sahay NS, Franken P (1999) Piriformospora indica,a cultivable 

plant growth promoting root endophyte with similarities to arbuscular mycorrhizal 

fungi. Appl Environ Microbiol 65:2741–2744 

Varma A, Singh A, Sudha, Sahay N, Sharma J, Roy A, Kumari M, Rana D, Thakran S, Deka 

D, Bharati K, Franken P, Hurek T, Blechert O, Rexer K-H, Kost G., Hahn A, Hock B, 

Maier W, Walter M, Strack D, Kranner I (2001) Piriformospora indica: A cultivable 

mycorrhiza-like endosymbiotic fungus. In: Hock B (ed) Mycota IX. Springer, Berlin 


Verma S,Varma A, Rexer K-H, Hassel A, Kost G, Sarbhoy A, Bisen P, Buetehorn B, Franken 

P (1998) Piriformospora indica gen. nov; a new root-colonizing fungus. Mycologia 

90:895–909

16 Cellular Basidiomycete–Fungus Interactions 



While basidiomycetes are well known as saprobes, ectomycorrhizal symbionts 

or parasites of plants (e.g., Bauer et al. 2001; Hibbett and Thorn 2001), 

their role as parasites of other fungi has received scant attention. Thus, the 

ultrastructure of the host–parasite interaction in basidiomycetous mycoparasites 

has been studied only in a few species (Bauer and Oberwinkler 1990a, b, 

1991; Oberwinkler and Bauer 1990; Oberwinkler et al. 1990a, c, 1999; Zugmaier 

et al. 1994; Kirschner et al. 2001a). 

In this chapter, our data concerning the interfungal cellular interaction of 

basidiomycetes are summarized. 

2 Occurrence of Mycoparasites Within the Basidiomycota 

The division Basidiomycota comprises the classes Urediniomycetes, Ustilaginomycetes 

and Hymenomycetes (Swann and Taylor 1993; Begerow et al. 

1997). Mycoparasites occur in two of these groups: while scattered throughout 

the Urediniomycetes mycoparasites form one of the basal lineages of the 

Hymenomycetes (Swann et al. 2001; Weiß and Oberwinkler 2001). Urediniomycetous 

mycoparasites include the genera Colacogloea, Colacosiphon, 

Cryptomycocolax, Cystobasidium, Heterogastridium, Mycogloea, Naohidea, 

Occultifur, Spiculogloea, Zygogloea, and some species of Platygloea (Bandoni 

1956, 1984; Oberwinkler 1990; Oberwinkler and Bauer 1990; Oberwinkler et 

al. 1990a, b; Roberts 1994, 1996, 1997; Kirschner et al. 2001a). However, the 

phenomenon of mycoparasitism may be more widespread among Urediniomycetes 

than is currently suspected. Many species of Urediniomycetes (e.g., 

members of Agaricostilbum, Atractogloea, Camptobasidium, Chionosphaera, 

Leucosporidium, Naiadella, Rhodosporidium or Sporidiobolus), currently 

thought to be saprobes may be capable of parasitizing fungi (Oberwinkler 

and Bandoni 1982, 1989; Marvanová and Bandoni 1987; Marvanová and 




268 

Suberkropp 1990; Bauer et al. 1997; Roberts 1997; Kirschner et al. 2001b). 

Within the Hymenomycetes, mycoparasitism is common among the Tremellales 

sensu Bandoni (1984). In addition, some lichen parasites (Diederich 

1996) also may belong in the Tremellales. 

3 Hosts 


Hosts of the basidiomycetous mycoparasites are either ascomycetes or basidiomycetes. 

Mycoparasitism on chytrids or zygomycetes is unknown. There 

appears to be no phylogenetic correlation between the basidiomycetous 

mycoparasites and their respective host fungi. In other words, a distinct 

basidiomycetous group of mycoparasites usually occurs on both ascomycetes 

and basidiomycetes. 

4 Cellular Interactions 

The basidiomycetous interfungal cellular interactions can be divided into two 

main types at the structural level. 

4.1 Colacosome-Interactions 

Mycoparasites in the Microbotryomycetidae (Bauer et al. 1997; Swann et al. 

1999) are generally characterized by their interaction via a unique organelle, 

the colacosome, formed at the interface between the parasite and its fungal 

host. This mycoparasitic organelle was firstly described in detail from the 

interaction of the parasite Colacogloea peniophorae and its host Hyphoderma 

praetermissum (Oberwinkler et al. 1990a; Bauer and Oberwinkler 1991). Colacosomes 

develop in the contact area between the parasite and its host as illustrated 

in Fig. 1. They are positioned at the inner surface of the parasite cell 

outside the cytoplasm, but inside the cell wall. Their shape is globular, subglobular 

or beaked. The central part of the colacosome is electron-opaque, 

0.3–0.4 µm diameter, enclosed by a membrane and surrounded by an electron-transparent, 

unstructured sheath of approximately 0.05 µm diameter. 

The colacosome is covered by the plasmalemma. A thin secondary cell wall 

layer is often present along the plasmalemma covering the colacosome. 

During formation (Fig. 2), the plasma membrane of the parasite is folded 

into the cytoplasm, then recurves, and finally fuses with itself at a distance of 

0.2–0.3 µm from the original outgrowth. Consequently, it is surrounded by a 

membrane as a derivative from the plasma membrane. The globose compartment 

is now separated from the cytoplasm by an electron-transparent, intermembranaceous 

space. After separation from the cytoplasm, the vesicular

Fig. 1. Hypha of Colacogloea 

peniophorae with colacosomes 

(arrows) contacting 

host hypha. Bar 1µm 

16 Cellular Basidiomycete–Fungus Interactions 269 

core becomes homogeneous and finally more and more electron-opaque. 

Simultaneously, the intermembranaceous space between the central part of 

the colacosome and the cytoplasm increases slightly in thickness. Interaction 

starts with intrusion of electron-opaque core material of the colacosome into 

the cell wall of the parasite (Fig. 3). The cell wall close to the intrusion peg 

becomes electron-transparent and indistinct in substructure. Intrusion then 

continues through the closely attached cell wall of the host into an electrontransparent 

protuberance formed between the cell wall and the plasmalemma 

of the host (Fig. 4). 

In Colacogloea peniophorae colacosomes develop in great numbers close 

together (Fig. 1). It is evident that in most cases hyphae possessing colacosomes 

and their host hyphae lie for a relatively long distance side by side 

closely attached to one another (Fig. 1). Furthermore, the host hyphae often 

form one or two spirals around the colacosome-possessing hyphae (Bauer 

and Oberwinkler 1991). As discussed by Bauer and Oberwinkler (1991), this 

situation may be explained as follows: in the beginning, the parasite hypha 

grows loosely in the host fructifications. After a first, probably accidental, 

contact of the hypha with a host hypha, colacosomes develop rapidly and in 

great number. The electron-opaque content of the colacosomes penetrates the 

host cell wall. Thus, the colacosomes combine both cells and the first contact

270 


Fig. 2. Diagram of colacosome development, modified from Bauer and Oberwinkler 

(1991).Abbreviations and symbols: CH cell wall of the host Hyphoderma praetermissum, 

CP cell wall of the parasite Colacogloea peniophorae, CS secondary cell wall layer, H cell 

of the host Hyphoderma praetermissum, P cell of the parasite Platygloea peniophorae, PH 

plasma membrane of the host Hyphoderma praetermissum, PP plasma membrane of the 

parasite Colacogloea peniophorae. (top left) Initial stage of invagination of the plasma 

membrane of the parasite. (top right) The plasmalemma of the parasite recurves. (middle 

left) Delimitation of the young colacosome from the cytoplasm. (middle right) The 

central part of the colacosome becomes homogeneous and more and more electronopaque. 

The electron-transparent sheath of the colacosome increases in thickness. 

(lower left) The electron-opaque core material penetrates the cell wall of the parasite and 

begins to intrude the cell wall of the host. (lower left) Final developmental stage with 

colacosome penetration through host cell wall 

remains stable. Furthermore, if the parasite and/or the host hypha continue to 

grow, additional colacosomes are rapidly developed. Consequently, the number 

of connections between both organisms is continually increased and both 

are forced to grow in close contact to each other. The development of colacosomes 

is, therefore accompanied by an increase of the host – parasite interface. 

In this sense, the colacosomes could serve as connecting agents. It is 

unclear from the present data, however, whether or not the colacosomes are 

involved in host–parasite metabolism functions as no specific attempts to


Fig. 3. Hypha of Colacogloea peniophorae (lower cell) in contact with a host hypha (upper 

cell). The electron-opaque core (c) of the colacosome intrudes into the cell wall of the 

parasite. Note the tripartite membrane (arrow) around the core of the colacosome (c). 

The colacosome is covered by a thin secondary cell wall layer (arrowhead) and the 

plasma membrane (double arrowhead) of the parasite. Bar 0.1 µm 

Fig. 4. Hypha of 

Colacogloea peniophorae 

(lower cell) in contact with 

a host hypha (upper cell). 

Final stage of host – parasite 

interaction with the 

content of the electronopaque 

core of the colacosome 

(c) penetrating the 

host cell wall. Bar 0.2 µm

272 


Fig. 5. Longitudinally sectioned hypha of “Mycospira”(m) surrounded by a hyphal spiral 

of the host fungus (three-dimensional configuration reconstructed from serial sections). 

Note the colacosomes (arrows) at the contact area. Bar 1 µm 

Fig. 6. Host cell (H) intruding 

into a hyphal cell of 

Colacogloea sp. Colacosomes 

(arrows) surround the intracellular 

part of the host cell 

which lacks a cell wall. Bar 

1µm


identify them have been made. However, the change in the electron density of 

the core material of the colacosome suggests that an alteration of the chemical 

composition occurs after separation of the colacosome from the cytoplasm. 

Furthermore, the penetration of the parasite and host cell wall appears 

to be enzymatic since both cell walls are not distorted at the site of penetration. 

This interpretation is reinforced by the mycoparasitic behavior of a currently 

undescribed basidiomycete, called here “Mycospira”. In contact with its 

host, a member of Tulasnella, this fungus develops colacosomes in exact spirals. 

As a consequence, the host fungus grows in spirals around the colacosome-possessing 

hyphae (Fig. 5). Thus, the formation of colacosomes results 

Fig. 7. Host cell (H) intruding into a hyphal cell of Cryptomycocolax abnorme.Colacosomes 

(arrows) surround the intracellular part of the host cell which lacks a cell wall. 

Two fusion pores are visible at arrowheads. Note that the colacosomes are more electrontransparent 

than in Fig. 6. Bar 1 µm

274 


in a greatly increased contact zone between the parasite and its host. This is 

also the case in a third type of colacosome-arrangement. In Colacogloea bispora 

(Oberwinkler et al. 1999), Colacogloea sp. (Fig. 6), Colacosiphon (Kirschner 

et al. 2001a), Cryptomycocolax (Oberwinkler and Bauer 1990), Krieglsteinera, 

and Heterogastridium, the appearance of colacosomes is associated with 

curious interaction structures: filamentous outgrowths of the host cells are 

intimately enclosed by galloid parasite cells. Numerous colacosomes are present 

along the contact area between the host intrusion and the parasite cell 

(Fig. 6). These host intrusions always terminate in the parasite cell. They are 

unseptate, often branched and, astonishingly, lack cell walls, thus giving the 

impression of haustoria (of the host into the parasite!!!). In Cryptomycocolax 

a second type of colacosome was found along the cytoplasmic intrusions of 

the host formed into the hyphae of the parasite (Fig. 7; Oberwinkler and 

Bauer 1990). These colacosomes have a more electron-transparent core and 

they fuse with the host cell via a pore of approximately 7–14 nm in diameter 

(Figs. 7, 8). It is clear that the cellular interaction of Cryptomycocolax is complex 

and currently misunderstood. 

Colacosomes have also been found in Atractocolax, Leucosporidium, 

Mastigobasidium, Rhodosporidium and Sporidiobolus, indicating a potential 

for mycoparasitism in these genera that have been assumed to be saprobic 

(Kreger van Rij and Veenhuis 1971; Bauer et al. 1997; Kirschner et al. 1999). 

Fig. 8. Colacosome of Cryptomycocolax 

abnorme in 

contact with the host cytoplasm 

(H) showing the 

fusion pore (arrowhead) in 

detail. Note that the pore 

membranes are continuous 

with both the host plasma 

membrane and the membrane 

surrounding the core 

(c) of the colacosome 

(arrow). Bar 0.1 µm

4.2 Fusion-Interaction 


Typical fusion mycoparasites (Bauer and Oberwinkler 1990a, b) are the 

Tremellales (including the Filobasidiales) of the Hymenomycetes (Bandoni 

1984, 1995). Astonishingly, however, fusion mycoparasites are also scattered 

throughout the Urediniomycetes. For example, the members of Cystobasidium, 

Mycogloea, Naohidea, Occultifur, Spiculogloea and Zygogloea are fusion 

mycoparasites (unpubl. data). Usually, basidiomycetous fusion mycoparasites 

interact with their respective hosts by specialized interactive cells, designated 

often as “tremelloid haustorial cells”. These cells were first described and designated 

as “haustoria” by Olive (1947). Each tremelloid haustorial cell is subtended 

by a clamp and consists of a subglobose basal part with one or more 

thread-like filaments (e.g., see Oberwinkler et al. 1984) that are capable of fusing 

with host cells via a pore of approximately 14–19 nm (Figs. 9, 10; Bauer 

and Oberwinkler 1990a, b). Thus, a direct cytoplasm – cytoplasm connection 

between the parasites and their respective hosts occurs.As discussed by Bauer 

and Oberwinkler (1990a), the following stages in the development of the cel- 

Fig. 9. Haustorial filament of Tetragoniomyces uliginosus (lower cell) in contact with a 

host hypha (upper cell) demonstrating the fusion pore (arrowhead). Bar 0.5 µm

276 


Fig. 10. Haustorial filament of Tetragoniomyces uliginosus (lower cell) in contact with a 

host hypha (upper cell) illustrated to show the fusion pore (arrowhead) in detail. Note 

that the pore membranes are continuous with the plasma membranes of both cells. Bar 

0.1 µm 

Fig. 11. Haustorial filament 

of Christiansenia pallida 

(lower cell) penetrating a 

host cell (upper cell). One 

fusion pore is visible at 

arrowhead. Bar 0.2 µm

Fig. 12. Transverse section 

through a penetrating haustorial 

filament of Christiansenia 

pallida. One fusion pore medianly 

sectioned (arrow) and four 

pores nonmedianly sectioned 

(arrowheads). Bar 0.2 µm 


lular interaction can be recognized: (1) contact of the haustorial filament with 

the host cell, (2) nesting of the haustorial filament into the host cell wall, and 

(3) fusion of the haustorial and host cell protoplasts via a pore. 

In the interaction between Christiansenia pallida and its host (Bauer and 

Oberwinkler 1990b), the haustorial filament forms one or more protrusions 

into the host cells where a lot of fusion pores develop (Figs. 11, 12). 

Direct cytoplasm – cytoplasm connections between mycoparasites and 

their respective hosts represent an unusual type of cellular interaction.As discussed 

by Bauer and Oberwinkler (1990a), this type of interaction may be 

considered as most effective. Substances required by the parasite do not need 

to cross membranes or cell walls. Thus, the fusion pores could serve as direct 

avenues for nutrients (Hoch 1977). 

5 Basidiomycetous Mycoparasitism, a Result of Convergent 

Evolution? 

The different mode of mycoparasitism occurring in the basidiomycetes, as 

discussed above, suggests that mycoparasitism may have evolved at least twice 

(or more) in the basidiomycetous history. Thus, it appears that the Microbotryomycetidae 

(for the subclass, see Swann et al. 1999) arose independently

278 


from the fusion mycoparasites as colacosome-mycoparasites (Bauer et al. 

1997). For the occurrence of fusion mycoparasites in the Urediniomycetes on 

the one hand, and in the Hymenomycetes on the other, two explanations are 

possible: (1) the fusion mycoparasitism occurring in these two groups is a 

result of convergent evolution, and, alternatively (2), the common ancestor of 

both groups or of the basidiomycetes in general was a fusion mycoparasite. 

Additional phylogenetic studies are necessary to clarify this situation. 

6 Conclusions 

The phenomenon of mycoparasitism may be more widespread among basidiomycetes 

than is currently suspected. Our data illustrate that mycoparasitic 

basidiomycetes evolved a fascinating array of different strategies at the cellular 

level to benefit from host metabolites. 

Acknowledgements. We thank Uwe Simon for critically reading the manuscript, and the 

Deutsche Forschungsgemeinschaft for financial support. 


Bandoni RJ (1956) A preliminary survey of the genus Platygloea. Mycologia 48:821–840 

Bandoni RJ (1984) The Tremellales and Auriculariales: an alternative classification. 

Trans Mycol Soc Jpn 25:489–530 

Bandoni RJ (1995) Dimorphic heterobasidiomycetes: taxonomy and parasitism. Stud 


Bauer R, Oberwinkler F (1990a) Direct cytoplasm-cytoplasm connection: an unusual 

host-parasite interaction of the tremelloid mycoparasite Tetragoniomyces uliginosus. 

Protoplasma 154:157–160 

Bauer R, Oberwinkler F (1990b) Haustoria of the mycoparasitic heterobasidiomycete 

Christiansenia pallida. Cytologia 55:419–424 

Bauer R, Oberwinkler F (1991) The colacosomes: new structures at the host-parasite 

interface of a mycoparasitic basidiomycete. Bot Acta 104:53–57 

Bauer R, Oberwinkler F, Vánky K (1997) Ultrastructural markers and systematics in 

smut fungi and allied taxa. Can J Bot 75:1273–1314 

Bauer R, Begerow D, Oberwinkler F, Piepenbring M, Berbee ML (2001) Ustilaginomycetes. 

In: McLaughlin DJ, McLaughlin EG, Lemke PA (eds) Mycota VII Part B, Systematics 

and evolution. Springer, Berlin Heidelberg New York, pp 57–83 

Begerow D, Bauer R, Oberwinkler F (1997) Phylogenetic studies on large subunit ribosomal 

DNA sequences of smut fungi and related taxa. Can J Bot 75:2045–2056 

Diederich P (1996) The lichenicolous heterobasidiomycetes. Bibliotheca Lichenologica 

61:1–198 

Hibbett DS, Thorn RG (2001) Basidiomycota: Homobasidiomycetes. In: McLaughlin DJ, 

McLaughlin EG, Lemke PA (eds) Mycota VII. Part B, Systematics and evolution. 

Springer, Berlin Heidelberg New York, pp 122–168


Hoch HC (1977) Mycoparasitic relationships: Gonatobotrys simplex parasitic on Alternaria 

tenuis. Phytopathology 67:309–314 

Kirschner R, Bauer R, Oberwinkler F (1999) Atractocolax, a new heterobasidiomycetous 

genus based on a species vectored by conifericolous bark beetles. Mycologia 91:538– 

543 

Kirschner R, Bauer R, Oberwinkler F (2001a) Colacosiphon: a new genus described for a 

mycoparasitic fungus. Mycologia 93:634–644 

Kirschner R, Begerow D, Oberwinkler F (2001b) A new Chionosphaera associated with 

conifer inhabiting bark beetles. Mycol Res 105:1403–1408 

Kreger-van Rij NJW, Veenhuis M (1971) Some features of the genus Sporidiobolus 

observed by electron microscopy. Antonie van Leeuwenhoek 37:253–255 

Marvanová L, Bandoni RJ (1987) Naiadella fluitans gen. et sp. nov.: a conidial basidiomycete. 


Marvanová L, Suberkropp K (1990) Camptobasidium hydrophilum and its anamorph, 

Crucella subtilis: a new heterobasidiomycete from streams. Mycologia 82:208–217 

Oberwinkler F (1990) New genera of auricularioid heterobasidiomycetes. Rep Tottori 

Mycol Inst 28:113–127 

Oberwinkler F, Bandoni RJ (1982) Atractogloea: a new genus in the Hoehnelomycetaceae 

(Heterobasidiomycetes). Mycologia 74:634–639 

Oberwinkler F, Bauer R (1989) The systematics of gastroid, auricularioid heterobasidiomycetes. 

Sydowia 41:224–256 

Oberwinkler F, Bauer R (1990) Cryptomycocolax: a new mycoparasitic heterobasidiomycete. 


Oberwinkler F, Bandoni RJ, Bauer R, Deml G, Kisimova-Horovitz L (1984) The life history 

of Christiansenia pallida, a dimorphic, mycoparasitic heterobasidiomycete. 


Oberwinker F, Bauer R, Bandoni RJ (1990a) Colacogloea: a new genus in the auricularioid 

heterobasidiomycetes. Can J Bot 68:2531–2536 

Oberwinkler F, Bauer R, Bandoni RJ (1990b) Heterogastridiales: a new order of basidiomycetes. 


Oberwinkler F, Bauer R, Schneller J (1990 c) Phragmoxenidium mycophilum sp. nov., an 

unusual mycoparasitic heterobasidiomycete. Syst Appl Microbiol 13:186–191 

Oberwinkler F, Bauer R, Tschen J (1999) The mycoparasitism of Platygloea bispora.Kew 

Bull 54:763–769 

Olive LS (1947) Notes on the Tremellales on Georgia. Mycologia 39:90–108 

Roberts P (1994) Zygogloea gemellipara: an auricularioid parasite of Myxarium nucleatum. 

Mycotaxon 52:241–246 

Roberts P (1996) Heterobasidiomycetes from Majorca and Cabrera (Balearic Islands). 

Mycotaxon 60:111–123 

Roberts P (1997) New heterobasidiomycetes from Great Britain. Mycotaxon 63:195–216 

Swann EC, Taylor JW (1993) Higher taxa of basidiomycetes: an 18S rRNA gene perspective. 


Swann EC, Frieders EM, McLaughlin DJ (1999) Microbotryum, Kriegeria and the changing 

paradigm in basidiomycete classification. Mycologia 91:51–66 

Swann EC, Frieders EM, McLaughlin DJ (2001) Urediniomycetes. In: McLaughlin DJ, 

McLaughlin EG, Lemke PA (eds) Mycota VII Part B, Systematics and evolution. 


Weiß M, Oberwinkler F (2001) Phylogenetic relationships in Auriculariales and related 

groups – hypotheses derived from nuclear ribosomal DNA sequences. Mycol Res 

105:403–415 

Zugmaier W, Bauer R, Oberwinkler F (1994) Mycoparasitism of some Tremella species. 

Mycologia 86:49–56

17 Fungal Endophytes 



Fungal endophytes have been isolated from almost every vascular plant studied 

and much has been written about their role and ecology. In this paper we 

review these aspects, but also review the role of molecular techniques in endophyte 

identification, the possible relationship with host specificity of fungal 

saprobes and suggest future areas for study. 

2 Definition of a Fungal Endophyte 

The term endophyte was introduced by De Bary (1866) and was initially 

applied to any organism found within a plant (Wilson 1995). The meaning of 

the term endophyte has been refined over time with the addition of new 

information (Siegel et al. 1984; Carroll 1986; Petrini 1986). Petrini (1991) used 

the term endophyte to mean all organisms inhabiting plant organs that at 

some time in their life can colonize internal plant tissues without causing 

apparent harm to the host. This has been the most widely used definition of 

endophytes and also includes the organisms that have a more or less lengthy 

epiphytic phase and also latent pathogens (Petrini 1991; Schulz et al. 1998). 

There has however, been a certain level of disagreement expressed by some 

mycologists over the inclusion of plant pathogens as endophytes, since endophytes 

are nonaggressive, nonpathogenic and have developed a mutualistic 

role with their hosts (Freeman and Rodriguez 1993; Tyler 1993; Stone et al. 

1994; Sinclair and Cerkauskas 1996). 

Studies on the endophyte composition in different hosts have identified 

organisms with varying roles within their hosts. Organisms having weak parasitic 

associations, localized infection, quiescent infection, latent infection 

and aggressive parasitic relationships with their hosts have often been recovered 

(Jersch et al. 1989; Kehr 1992; Gotz et al. 1993; Kehr and Wulf 1993; 

Williamson 1994; Agrios 1997). Wilson (1995) provided a working definition 




282 


of the term by analyzing the different levels of endophytic association and 

stated that “endophytes are fungi or bacteria which, for all or part of their life 

cycle, invade the tissues of living plants and cause unapparent and asymptomatic 

infections entirely within plant tissues but causes no symptoms of the 

disease”. The same organism may also be described as a saprobe or pathogen 

at other times (Boddy and Griffith 1989). 

3 Role of Endophytes 

Endophytes have previously been defined as mutualists and are closely 

related to virulent pathogens, but have limited pathogenicity, and have probably 

evolved directly from plant pathogenic fungi (Carroll 1988). The mutualistic 

symbiosis includes the lack of destruction of most cells or tissues, 

nutrient and chemical cycling between the fungus and hosts, enhanced 

longevity and photosynthetic capacity of cell and tissue under the influence 

of infection, enhanced survival of fungus, and a tendency towards greater 

host specificity than is seen in necrotrophic infections (Lewis 1973). It is 

often difficult to differentiate between an endophyte and pathogen as many 

plant pathogens undergo an extensive phase of asymptomatic latent infection 

before the appearance of disease symptoms and the mutation in a single 

genetic locus can change a pathogen to nonpathogenic endophytic 

organism with no effect on its host specificity (Freeman and Rodriguez 

1993). Latent infection is the state in which a host is infected with a 

pathogen, but does not show any symptoms and persists until signs or 

symptoms are prompted to appear by environmental or nutritional conditions 

or by the state of maturity of the host or pathogen (Agrios 1997). The 

latent infection is considered as the highest level of parasitism because the 

host and parasite coexist for a period of time with minimal damage to the 

host. Hence, the relationship between plant pathogenic fungi and host is 

considered as parasitic. 

Wilson (1995) argued that the term endophyte bears much affinity to the 

term pathogen and stated that it is often difficult to be able to classify a particular 

species. Sinclair and Cerkauskas (1996) compared endophyte colonization 

and latent infections by fungi and stated that they are distinctly different. 

Endophytic fungi are asymptomatic and considered mutualistic, 

whereas latent infecting fungi are parasitic and cannot be considered mutualistic. 

Rather, they are considered to be one of the most advanced stages of parasitism 

as the host and parasite co-exist for a period of time with minimal 

effect on the host (Sinclair and Cerkauskas 1996). Hammon and Faeth (1992) 

suggested that the disproportionate amount of attention that has been paid to 

the study of grass endophytes has lead to the impression that all endophytes 

must be mutualists. There seems to be a greater probability of mutualism in 

the fungal species that are transmitted through seeds, as transmission will

17 Fungal Endophytes 283 

increase directly as a result of host survival. The association where only one 

fungus is associated within the host plant is more likely to be mutualistic 

(Hammon and Faeth 1992). 

The endophytes associated with grasses have received much attention, and 

many of these have been found to produce physiologically active alkaloids 

that cause their hosts to be toxic to mammals and increase their resistance to 

insect herbivores (Funk et al. 1983; Clay 1988; Cheplick and Clay 1988; 

Prestidge and Gallagher 1988). In the grasses and other plant hosts, endophytes 

have also been shown to enhance plant growth, reduce infection by 

nematodes, increase stress tolerance and increase nitrogen uptake in nitrogen 

deficit-soils (Latch et al. 1985; Clay 1987, 1990; Kimmons 1990; Bacon 1993; 

Gasoni and Stegman De Gurfinkel 1997; Rommert et al. 1998; Verma et al. 

1999; Bultman and Murphy 2000;). Several reviews are available on secondary 

metabolite production by endophytes (Miller 1986; Clay 1991; Petrini et al. 

1992). Endophytes in culture can produce biologically active compounds 

(Brunner and Petrini 1992) including several alkaloids, paxilline, lolitrems 

and tertraenone steroids (Dahlman et al. 1991), antibiotics (Fisher et al. 1984a, 

b) and plant growth promoting factors (Petrini et al. 1992). Endophytes are 

increasingly being identified as a group of organisms capable of providing a 

source of secondary metabolites for use in biotechnology and agriculture 

(Bills and Polishook 1992). 

4 Modes of Endophytic Infection and Colonization 

The colonization of plant tissues by endophytes, plant pathogens and mycorrhizae 

involves several steps involving host recognition, spore germination, 

penetration of the epidermis and tissue colonization (Petrini 1991, 1996). The 

inoculum source of fungal endophytes is widely considered to be the airborne 

spores, and also seed transmission and transmission of propagules by insect 

vectors (Petrini 1991). A high level of genetic diversity of endophyte isolates 

suggests that infection foci arise from different strains of fungi derived from 

constant new inoculum (Hammerli et al. 1992; Rodrigues et al. 1993). In terms 

of mechanical and enzymatic elements of penetration by endophytic fungi, it 

can be assumed that endophytes adopt the same strategy for penetration of 

host tissue as pathogens (Petrini et al. 1992). Fungi can invade plant tissues by 

direct cuticular penetration, via appressoria formed on the cuticle, after 

which penetration occurs through the cuticle and epidermal cell wall or via 

natural openings like stomata (O’Donnell and Dickinson 1980; Muirhead and 

Deverall 1981; Kulik 1988; Cabral et al. 1993; Viret et al. 1993; Viret and Petrini, 

1994). Following penetration the infection may be inter-cellular or intra-cellular 

and may be limited to one cell or in a limited area around the penetration 

site. Limited cytological work on nonclavicipitaceous endophytes have 

shown that the infection of these endophytes in host plants may be inter- or

284 


intra-cellular and often localized in single cells (Stone 1988; Suske and Acker 

1989, Cabral et al. 1993). 

Some endophytic fungi (including those which are latent pathogens) are 

host-specific, whereas others seem to invade any available hosts (Carroll 1988; 

Petrini et al. 1992). When studying the infection of Juncus spp. with the endophytes 

Stagnospora innumerosa and Drechslera spp., Cabral et al. (1993) 

observed callose formation in the individual cells as a host defense response. 

Sieber et al. (1991) found that the synthesis of highly specialized enzymes 

associated the penetration of cuticular layers of the host by the endophyte 

Melanconium spp. Several other investigations have also reported a growth 

response of host calli to endophytes (Hendry et al. 1993; Peters et al. 1998). 

Schulz et al. (1999) studied the secondary metabolites produced by endophytes 

and their host interactions in order to understand why endophytic 

infections are symptomless. The production of herbicidally active substances 

was three times that of soil isolates and twice that of phytopathogenic fungi, 

whereas the phenolic metabolites in the host were higher in the roots of plants 

infected with an endophyte than in those infected with pathogens. Their 

study hypothesized that both the pathogen–host and endophyte–host interaction 

involved constant mutual antagonisms, at least in part based on the 

secondary metabolites the partners produce. The pathogen – host interaction 

was thought to be imbalanced and resulted in disease while that of the endophytes 

and its host is a balanced antagonism. 

5 Isolation of Endophytes 

Techniques for endophyte isolation and culture have been developed gradually 

over time. Bacon and White (1994) have written an excellent review on 

staining, media and procedure for analyzing endophytes. Endophytes can be 

isolated from various plant parts such as seeds, leaf and stem and direct isolation 

of ascospores is also in practice. The plant and plant parts collected 

for studying endophytic communities should look apparently healthy, in 

order to minimize the compounding effect because of plant pathogenic and 

saprobic species. Young tissue is appropriate for isolation as older tissues 

often contain many additional fungi that make isolation of slow growing 

fungi difficult (Bacon and White 1994). The samples should be processed in 

the shortest time possible after collection. Plant parts for investigation 

should be cut into small pieces to facilitate sterilization and isolation 

processes. Bills (1996) discussed various surface sterilization techniques in 

detail. Any method can be used for surface sterilization provided that it can 

eliminate most of the epiphytic fungi from the exterior tissues and encourage 

the growth of the internal mycobiota. The method used by Petrini et al. 

(1992) has been used extensively and found very successful in studying 

endophytes (Rodrigues and Samuels 1990; Schulz et al. 1993). This method

comprises dipping samples in 96 % ethanol for 1 min, then in 65 % commercial 

Chlorox (final concentration 3.25 % aqueous sodium hypochlorite) 

for 10 min and finally in 96 % ethanol for 30 s. Malt extract agar is considered 

the most suitable media for the growth and sporulation of endophytic 

fungi (Bills and Polishook 1992; Bills 1996). Amendment of medium with 

streptomycin sulfate is practised to prevent bacterial contamination. To prevent 

the fast growing fungi overgrowing the plate, a growth inhibitor, Ross 

Bengal is added to the agar. 

Surface-sterilized plant tissues are plated in an appropriate medium 

amended with antibiotics and Rose Bengal and incubated at room temperature 

with periodic light and darkness. Incubated plates are checked after 

1 week of incubation at regular intervals for fungal development. If the colony 

is very small and there is a risk of engulfment by other colonies, it needs to be 

subcultured. Subcultured isolates are generally maintained at room temperature 

for many weeks to study morphological and other characteristics. Some 

isolates may fail to produce reproductive structures even after several 

months. Subculture of these isolates onto medium with autoclaved host tissue 

strips can promote sporulation (Matsushima 1971). In general, sterile isolates 

should be checked regularly for fruiting bodies over a period of 3–4 months 

and the isolates failing to produce fruiting body are referred to as sterile 

“morphotypes” depending on the characteristics of culture. 

Other methods to promote sporulation of morphospecies should also be 

tried. Guo et al. (1998) used twigs in conical flasks over a 3-month period to 

promote sporulation of endophytes. Other methods can be designed, but 

should try to mimic the situation in nature as closely as possible. 

6 Molecular Characterization of Endophytes 


Molecular approaches have been used to resolve the problems in fungal taxonomy 

and in the identification of fungi (Rollo et al. 1995; Ma et al. 1997; 

Zhang et al. 1997; Ranghoo et al. 1999). The use of molecular techniques for 

the direct detection and identification of fungi within natural habitats has 

been reviewed by Liew et al. (1998). Molecular techniques have mainly been 

used in the detection and identification of mycorrhizal fungi and phytopathogenic 

fungi directly from within plant tissues (Mills et al. 1992; Johanson and 

Jeger 1993; Beck and Ligon 1995; Bonito et al. 1995; Abbas et al. 1996; Chambers 

et al. 1998). Similarly, molecular techniques have been employed to detect 

and identify fungi from the grass clothing of Iceman, from bamboo leaves and 

glacial ice strata (Rollo et al. 1995; Ma et al. 1997; Zhang et al. 1997). 

A most frequently encountered problem in endophyte study is the presence 

of mycelia sterilia, making their identification difficult (Guo et al. 2000).Variable 

proportions of mycelia sterilia have been reported ranging from 11 % of 

isolates from palm (Trachycarpus fortunei) in China, 13 % of endophytes

286 


obtained from two Licuala species in Brunei and Australia, 15 % of isolates 

from evergreen shrubs in western Oregon, 16.5 % of isolates from fronds of 

Livistona chinensis in Hong Kong, 27 % of isolates from leaves of Sequoia sempervirens 

in central California and 54 % of isolates obtained from twigs of 

Quercus ilex in Switzerland (Petrini et al. 1982; Espinosa-Garcia and Langenheim 

1990; Fisher et al. 1994; Taylor et al. 1999; Frohlich et al. 2000; Gou et al. 

2000). A high proportion of unidentified endophytic isolates resulting from 

traditional methodology has prompted various workers to develop methodology 

to improve sporulation in mycelia sterilia (Matsushima 1971; Guo et al. 

1998; Taylor et al. 1999; Frohlich et al. 2000). The problem of having many 

nonidentifiable mycelia sterilia, however still remains. Hence, molecular techniques 

could be the best alternative to identify this taxa. 

There have been only a small number of studies using molecular techniques 

to investigate endophytic fungal communities. Random amplified 

polymorphic DNA (RAPD) markers were used to study the genotypic diversity 

in the populations of Rabdocline parkeri from Douglas fir (McCutcheon 

and Carroll 1993). Specific PCR primers were used to amplify rDNA fragments 

of the endophyte Acremonium coenophialum from infected tall fescue 

tissues (Doss and Welty 1995). The genetic diversity of Epichloe typhina, an 

endophyte in Bromus erectus, was studied using a microsatellite-containing 

locus as a molecular marker (Groppe et al. 1995). Guo et al. (2000) performed 

phylogenetic analysis based on rDNA of 19 morphospecies from frond tissues 

of Livistona chinensis and found that they were filamentous Ascomycota 

belonging to the different taxonomic levels in the Loculoascomycetes and 

Pyrenomycetes. The 5.8S gene and flanking internal transcribed spacer of 

rDNA were used in detection and taxonomic placement of endophytic fungi 

within frond tissues of Livistona chinensis (Guo et al. 2001). Ribosomal DNA 

sequence analysis was used to validate the morphospecies concept used in 

endophyte study to group mycelia sterilia (Hyde et al. 2001). Therefore, rDNA 

sequence analysis is in frequent use to resolve the identification problem 

associated with endophytic fungi. These studies show increasing an use of 

molecular techniques in detection, identification, and population and ecological 

studies of endophytes. 

7 Are Endophytes Responsible for Host 

Exclusivity/Recurrence in Saprobic Fungi? 

There has been much debate as to whether saprobic fungi are host-specific as 

this has important implications for estimates of fungal numbers (Hawksworth 

1991, 2001; Fröhlich and Hyde 1999; Hyde 2001). Zhou and Hyde (2001) 

explored the literature on host-specific saprobes and came to the conclusion 

that it was hard to prove that saprobic fungi were host-specific. They introduced 

the terms host exclusivity and host recurrence as more suitable for use

with saprobic fungi. Host exclusivity is the exclusive occurrence of a strictly 

saprobic fungus on a particular host, while host recurrence is the frequent or 

predominant occurrence of a fungus on a particular host. 

The basis for host recurrence in saprobic fungi is interesting and several 

factors may be responsible.Wong and Hyde (2001) thought that host exclusive 

saprobes may be responding to differences in physical structure or nutrient 

levels of the potential hosts. There is also the possibility that enzyme production 

capabilities may influence whether a certain fungus can decay a certain 

host. However, recent studies have shown that most fungi can produce a wide 

range of enzymes capable of degrading simple sugars and cellulose (Lumyong 

et al. 2002). Fewer fungi can produce enzymes capable of digesting lignins 

(Leung and Pointing 2002). This would however, restrict fungi to lignified versus 

nonlignified plant tissues and is unlikely to be responsible for host recurrence 

(restricting fungi to certain plant species) as a large range of host tissues 

incorporate lignins into their tissues. 

Wong and Hyde (2001) studied the saprobes on six grass and one sedge 

species in Hong Kong and found that certain fungi showed host exclusivity or 

specificity. They hypothesized that these fungi may be host-specific endophytes 

that later become saprobes. There is much circumstantial evidence 

supporting this hypothesis and this has been discussed by Zhou and Hyde 

(2001) and Hyde (2001). 

8 Conclusions 


There have now been many studies on the diversity and ecology of endophytes 

of grass and nongrass hosts in both tropical and temperate regions 

(Viret and Petrini 1994; Bussaban et al. 2001; Photita et al. 2001). The problem 

in most of these studies is that two uninformative groups of fungi are generally 

isolated; the first major group being typical endophytic genera such as 

Colletotrichum, Phomopsis and Phyllosticta while the second are mycelia sterilia. 

The first group are rarely recorded as saprobes on the host, although 

some may be pathogens. Therefore, the role of these fungi is puzzling and they 

may actually have no function. It is possible that the spores have landed on the 

plant surface and produced a germ tube which has penetrated the plant 

stoma, but then cannot progress further due to plant defense. Future studies 

should, therefore concentrate on the role of these common endophytes, rather 

than provide uninformative lists with ecological data that have little consequence. 

The mycelia sterilia may be a more important group, but until we can find 

some way to identify more of them, it is impossible to elucidate their function. 

Methods need to be developed to stimulate these fungi to sporulate, or at least 

molecular techniques need to be refined in order to make identification simpler. 

Future studies should, therefore concentrate on developing these meth-

288 


ods, rather than providing uninformative data on mycelia sterilia with ecological 

data that again have little consequence. 

Studies on endophytes have shown the beneficial roles of endophytic associations 

to the host as protection against mammals, resistance to insect herbivores 

and other pathogenic fungi, increased growth and development, nutrient 

uptake and stress tolerance in plants including agriculturally important 

crops. The actual mechanisms involved for such phenomenon, however are 

poorly understood. The current understanding of secondary metabolites of 

host and endophyte origin and their interactions is limited. This area 

demands further studies which could lead to the discovery of novel compounds 

of biotechnological and agricultural importance. The mechanism by 

which a latent form of a pathogen turns pathogenic and vice-versa could be 

an interesting area of research of the highest plant pathological significance. 


Abbas JD, Hertrick BAD, Jurgenson JE (1996) Isolate specific detection of mycorrhizal 

fungi using genome specific primer pairs. Mycologia 88:939–946 

Agrios GN (1997) Plant pathology. Academic Press, London 

Bacon CW (1993) Abiotic stress tolerances (moisture and nutrients) and photosynthesis 

in endophyte-infected tall fescue. Agric Ecosyst Environ 44:123–141 

Bacon CW, White JF (1994) Stain, media and procedure for analyzing endophytes. In: 

Bacon CW, White JF (eds) Biotechnology of endophytic fungi of grasses, CRC Press, 

Boca Raton, pp 47–56 

Beck JJ, Ligon JM (1995) Polymerase chain reaction assays for the detection of 

Stagonospora nodorum and Septoria tritici in wheat. Phytopathol 85:319–324 

Bills GF (1996) Isolation and analysis of endophytic fungal communities from woody 

plants. In: Redlin SC, Carris LM (eds) Endophytic fungi in grasses and woody plants: 

systematic, ecology and evolution, APS Press, St. Paul, MN, pp 31–65 

Bills GF, Polishook JD (1992) Recovery of endophytic fungi from Chamaecyparis thyroides. 

Sydowia 44:1–12 

Boddy L, Griffith GS (1989) Role of endophytes and latent invasion in the development 

of decay communities in sapwood of angiospermous trees. Sydowia 41:41–73 

Bonito RD, Elliott ML, Jardin EAD (1995) Detection of the arbuscular mycorrhizal fungus 

in roots of different plants species with the PCR.Appl Environ Microbiol 61:2809– 

2810 

Brunner F, Petrini O (1992) Taxonomic studies of Xylaria species and xylariaceous endophytes 

by isozymeelectrophoresis. Mycol Res 96:723–733 

Bultman TL, Murphy JC (2000) Do fungal endophytes mediate wound-induced resistance? 

In: Bacon CW, White JF (eds) Microbial endophytes, Marcel Dekker, New York 

Bussaban B, Lumyong, S, Lumyong P, McKenzie EHC, Hyde KD (2001) Endophytic fungi 

from Amomum siamense. Can J Microbiol 47:943–948 

Cabral D, Stone JK, Carroll G (1993) The internal mycobiota of Juncas sp.: microscopic 

and cultural observations of infection pattern. Mycol Res 97:367–376 

Carroll G (1986) The biology of endophytism in plants with particular references to 

woody perennials. In: Fokkema NJ, Van den Heuvel J (eds) Microbiology of phyllosphere, 

Cambridge University Press, Cambridge, pp 205–222


Carroll G (1988) Fungal endophytes in stems and leaves: from latent pathogen to mutualistic 

symbiont. Ecology 69:2–9 

Chambers SM, Sharples JM, Cairney JWG (1998) Towards a molecular identification of 

the Pisonia mycobiont. Mycorrhiza 7:319–321 

Cheplick GP, Clay K (1988) Acquired chemical defenses in grasses: The role of fungal 

endophytes. Oikos 52:309–318 

Clay K (1987) Effect of fungal endophytes on the seed and seedling biology of Lolium 

perenne and Festuca arundinaceae. Oecologia (Berlin) 73:358–362 

Clay K (1988) Clavicipitaceous fungal endophytes of grasses: co-evolution and change 

from parasitism to mutualism. In: Pyrozynski KA, Hawksworth DL (eds) Co-evolution 

of fungi with plants and animals. Academic Press, New York, pp 79–105 

Clay K (1990) Fungal endophytes of grasses. Annu Rev Ecol Syst 21:275–297 

Clay K (1991) Fungal endophytes, grasses and herbivores. In: Barbosa P, Krischik VA, 

Jones CG (eds) Microbial mediation of plant herbivore interactions. Wiley, New York, 

pp 199–226 

Dahlman DL, Eichenseer H, Siegel MR (1991) Chemical perspective on endophyte grass 

interactions and their implications to insect herbivory. In: Barbosa P, Krischik VA, 

Jones CG (eds) Microbial mediation of plant herbivore interactions. Wiley, New York, 

pp 227–252 

De Bary A (1866) Morphologie und Physiologie der Pilze, Flechten, und Myxomyceten. 

Hofmeister’s Handbook of Physiological Botany. vol 2. Leipzig 

Doss PR, Welty RE (1995) A polymerase chain reaction based procedure for detection of 

Acremonium coenophialum in tall fescue. Phytopathol 85:913–917 

Espinosa-Garcia FJ, Langenheim JH (1990) The leaf fungal endophyte community of a 

coastal red wood population diversity and spatial patterns. New Phytol 116:89–97 

Fisher PJ,Anson AE, Pertini O (1984a) Antibiotic activity of some endophytic fungi from 

ericaceous plants. Bot Helv 94:249–253 

Fisher PJ, Anson AE, Pertini O (1984b) Novel antibiotic activity of an endophyte Cryptosporiopsis 

sp. isolated from Vaccinium myrtillus. Trans Br Mycol Soc 83:145–148 

Fisher PJ, Pertini O, Petrini LE, Sutton, BC (1994) Fungal endophytes from leaves and 

twigs of Quercus ilex L. from England, Majorca and Switzerland. New Phytol 127: 

133–137 

Freeman S, Rodriguez RJ (1993) Genetic conversion of a fungal plant pathogen to a nonpathogenic, 

endophytic mutualist. Science 260:75 

Fröhlich J, Hyde KD (1999). Biodiversity of palm fungi in the tropics: are global fungal 

diversity estimates realistic? Biodivers Conserv 8:977–1004 

Fröhlich J, Hyde KD, Petrini O (2000) Endophytic fungi associated with palm. Mycol Res 

104:1202–1212 

Funk CR, Halisky PM, Johnson MC, Siegel MR, Stewart AV, Ahamad S, Hurley RH, Harvey 

IC (1983) An endophytic fungi and resistance to Sod Webworms: association of 

Lolium perenne L. Bio/technology April:189–191 

Gasoni L, Stegman De Gurfinkel B (1997) The endophyte Cladorrhinum foecundissimum 

in cotton roots: phosphorus uptake and host growth. Mycol Res 101:867–870 

Gotz M, Zornabach W, Boyle C (1993) Life cycle of Mycosphaerelle brassicicola (Duby) 

Lindau and ascospore production in vitro. J Phytopathol 139:298–308 

Guo LD, Hyde KD Liew ECY (1998) A method to promote sporulation in palm endophytic 

fungi. Fungal Divers 1:109–113 

Guo LD, Hyde KD, Liew ECY (2000) Identification of endophytic fungi from Livistona 

chinensis based on morphology and rDNA sequences. New Phytol 147:617–630 

Guo LD, Hyde KD, Liew ECY (2001) Detection and taxonomic placement of endophytic 

fungi within frond tissues of Livistina chinensis based on rDNA sequences. Mol Phylogenet 

Evol 20:1–13

290 


Groppe K, Sanders I, Wiemken A, Boller T (1995) A microsatellite marker for studying 

the ecology and diversity of fungal endophytes (Epichloe spp.) in grasses. Appl Environ 

Microbiol 61:3943–3949 

Hammerli UA, Brandle UE, Petrini O, McDermott JM (1992) Differentiation of isolates of 

Discula umbrinella (teleomorph: Apiognomonia errabunda) from beech, chestnut 

and oak using RAPD markers. Mol Plant-Microbe Interact 5:479–483 

Hammon K.E, Faeth SH (1992) Ecology of plant-herbivore communities: a fungal component. 

Nat Toxins 1:197–208 

Hawksworth DL (1991) The fungal dimension of biodiversity: magnitude, significance, 

and conservation. Mycolog Res 95:641–655 

Hawksworth DL (2001) The magnitude of fungal diversity: the 1.5 million species estimate 

revisited. Mycol Res 105:1422–1432 

Hendry SJ, Boddy L, Lonsdale D (1993) Interaction between callus culture of European 

beech, indigenous ascomycetes and derived fungal extracts. New Phytol 123:421–428 

Hyde KD (2001) Where are the missing fungi? Does Hong Kong have the answers? Mycol 

Res 105:1514–1518 

Hyde KD, Lacap DC, Liew ECY (2001) An evaluation of the fungal ‘morphospecies’ concept 

based on ribosomal DNA sequences (Abstract). Phytopathology 91:S113 

Jersch S, Scherer C, Hutz G, Schlosser E (1989) Proanthocianidins as a basis for quiescence 

of Botrytis cinerea in immature strawberry fruits. Z Pflanzenkrankheiten 

Pflanzenschutz 96:365–378 

Johanson A, Jeger MJ (1993) Use of PCR for detection of Mycosphaerella fijiensis and M. 

musicola, the causal agent of Sigayoka leaf spot in banana and plantain. Mycol Res 

97:670–674 

Kehr RD (1992) Pezicula cancer of Quercus rubra L., caused by Pezicula cinnamomea 

(DC) Sacc. II. Morphology and biology of the causal agent. Eur J For Pathol 22:29–40 

Kehr RD, Wulf A (1993) Fungi associated with above ground portion of declined oaks 

(Quercus rubra) in Germany. Eur J For Pathol 23:18–27 

Kimmons CA (1990) Nematode reproduction on endophyte infected and endophyte free 

tall fescue. Plant Dis 74:757–761 

Kulik MM (1988) Observations by scanning electron and brightfield microscopy on the 

mode of penetration of soybean seedlings by Phomopsis phaseoli. Plant Dis 72:115– 

118 

Latch GCM, Hunt WF, Musgrave DR (1985) Endophytic fungi affect growth of perennial 

rye grass. New Zealand J Agric Res 28:165–168 

Leung PC, Pointing SB (2002) Effect of different carbon and nitrogen regimes on Poly R 

decolorization by white rot fungi. Mycolog Res 106:86–92 

Lewis DH (1973) Concept in fungal nutrition and the origin of biotrophy. Biol Rev 

48:261–278 

Liew ECY, Guo LD, Ranghoo VM, Goh TK, Hyde KD (1998) Molecular approaches to 

assessing fungal diversity in the natural environment. Fungal Divers 1:1–17 

Lumyong S, Lumyong P, McKenzie EH, Hyde KD (2002) Enzymatic activity of endophytic 

fungi of six native seedling species from Doi Suthep-Pui National Park, Thailand. Can 

J Microbiol 48(12):1109–1112 

Ma LJ, Catramis CM, Rogers SO, Starmer WT (1997) Isolation and characterization fungi 

entrapped in glacial ice. Inoculum 48:23–24 

Matsushima T (ed) (1971) Microfungi of the Solomon Islands and Papua New Guinea. 

Matsushima, Kobe, Japan, pp 15–20 

McCutcheon TL, Carroll GC (1993) Genotypic diversity in populations of a fungal endophytes 

from Douglas fir. Mycologia 85:180–186 

Miller JD (1986) Toxic metabolites of epiphytic and endophytic fungi of conifers needles. 

In: Fokkema, NJ, Heuvel JVD (eds) Microbiology of phyllosphere. Cambridge 

University Press, Cambridge, pp 223–231


Mills PR, Sreenivasaprasad S, Brown AE (1992) Detection and differentiation of Colletotrichum 

gloeosporioides isolates using PCR. FEMS Microbiol Lett 98:137–144 

Muirhead IF Deverall BJ (1981) Role of appressoria in latent infection of banana fruits by 

Colletotrichum musae. Physiol Plant Pathol 19:77–84 

O’Donnell J and Dickinson CH (1980) Pathogenicity of Alternaria and Cladosporium 

isolated on Phaseolus. Trans Br Mycol Soc 74:335–342 

Peters S, Aust AJ, Draeger S, Schulz B (1998) Interaction in dual cultures of endophytic 

fungi with host and non-host plant calli. Mycologia 90:360–367 

Petrini O (1986) Taxonomy of endophytic fungi of aerial plant tissue. In: Fokkema NJ, 

Van den Heuvel J (eds) Microbiology of phyllosphere. Cambridge University Press, 

Cambridge, pp 175–187 

Petrini O (1991) Fungal endophytes of tree leaves. In: Andrews J, Hirano S (eds) Microbila 

ecology of leaves, Springer, Berlin Heidelberg New York, pp 179–197 

Petrini O (1996) Ecological and physiological aspect of host specificity in endophytic 

fungi. In: Redlin SC, Carris LM (eds) Endophytic fungi in grasses and woody plants. 

APS Press, St. Paul, MN 

Petrini O, Stone J, Carroll FE (1982) Endophytic fungi in evergreen shrubs in western 

Oregon: a preliminary study. Can J Botany 60:789–796 

Petrini O, Fisher PJ, Petrini LE (1992) Fungal endophytes of bracken (Pteridium aquilinum) 

with some reflections on their use in biological control. Sydowia 44:282–293 

Photita W, Lumyong S, Lumyong P, Hyde KD (2001) Endophytic fungi of wild banana 

(Musa acuminata) at Doi Suthep Pui National Park, Thailand. Mycol Res 105:1508– 

1514 

Prestidge RA, Gallagher RT (1988) Endophyte fungus confers resistance to rye grass: 

Argentine stem weevil larval studies. Ecol Entomol 13:429–435 

Ranghoo VM, Hyde KD, Liew ECY, Spatafora JW (1999) Family placement of Ascotaiwanian 

and Ascolacicola based on DNA sequences from the large subunit rRNA gene. 

Fungal Divers 2:159–168 

Rodrigues KF, Samuels GJ (1990) Preliminary study of endophytic fungi in tropical 

palm. Mycol Res 94:827–830 

Rodrigues KF, Leucthmann A, Petrini O (1993) Endophytic species of Xylaria: Cultural 

and isozymic studies. Sydowia 45:116–138 

Rollo F, Sassaroli S, Ubaldi M (1995) Molecular phylogeny of the fungi of the Iceman’s 

grass clothing. Curr Genet 28:289–297 

Rommert AK, Strack D, Aust HJ, Schulz B (1998) Verhalten sich Endophyten unter Nstress 

als Schwachenparasiten? Bielefelder Okol Beitr 14:307–311 

Schulz B, Wanke U, Draeger S and Aust HJ (1993) Endophytes from herbaceous plants 

and shrubs: effectiveness of surface sterilization methods. Mycol Res 97:1447–1450 

Schulz B, Guske S, Dammann U, Boyle C (1998) Endophyte-host interactions. II. Defining 

symbiosis of the endophyte-host interaction. Symbiosis 25:213–227 

Schulz B, Rommert AK, Dammann U, Aust HJ, Strack D (1999) The endophyte-host 

interaction: a balanced antagonism? Mycol Res 103:1275–1283 

Sieber TN, Sieber-Canavesi F, Dorworth CE (1991) Endophytic fungi of red alder (Alnus 

rubra) leaves and twigs in British Colombia. Can J Bot 69:407–411 

Siegel MR, Johnson M.,Varney DR, Nesmith WC, Buckner RC, Bush LP, Burrus PB (1984) 

A fungal endophyte in tall fescue: incidence and dissemination. Phytopathology 

74:932–937 

Sinclair JB, Cerkauskas RF (1996) Latent infection vs. endophytic colonization by fungi. 

In: Redlin SC, Carris LM (eds) Endophytic fungi in grasses and woody plants: systematics, 

ecology and evolution. APS Press, St. Paul, pp 3–29 

Stone JK (1988) Fine structure of latent infection by Rhabdocline parkeri on Douglas fir, 

with observation on uninfected epidermal cells. Can J Bot 66:45–54

292 


Stone JK, Viret O, Petrini O, Chapela IH (1994) Histological studies of host penetration 

and colonization by endophytic fungi. In: Pertini O, Ouellette G (eds) Host wall alterations 

by parasitic fungi. APS Press, St. Paul, pp 115–126 

Suske, J, Acker G (1989) Identification of endophytic hyphae of Lophodermium piceae in 

tissues of green, symptomless Norway spruce needles by immunoelectron microscopy. 

Can J Bot 67:1768–1774 

Taylor JE, Hyde KD, Jones EBJ (1999) Endophytic fungi associated with the temperate 

palm Trachycarpus fortunei within and outside its natural geographical range. New 

Phytol 142:335–346 

Tyler BM (1993) To kill or not to kill: the genetic relationship between a parasite and 

endophyte. Trends Microbiol 1:252–254 

Verma A,Verma S, Sudha, Sahay N, Butehorn B, Franken P (1999) Piriformospora indica, 

a cultivable plat growth promoting root endophyte. Appl Environ Microbiol 65:2741– 

2744 

Viret O, Petrini O (1994) Colonization of beech leaves (Fagus sylcatica) by the endophyte 

Discula umbrinella (teleomorph, Apiognomonia errabunda). Mycol Res 98:423–432 

Viret O, Scheidegger C, Pertini O (1993) Infection of beech leaves (Fagus sylcatica) by the 

endophyte Discula umbrinella (teleomorph, Apiognomonia errabunda) – low temperature 

scanning electron microscopy studies. Can J Bot 71:1520–1527 

Williamson B (1994) Latency and quiescence in survival and success of fungal plant 

pathogen. In: Blackman JP, Williamson B (eds) Ecology of plant pathogens. CAB 

International, London, pp 187–207 

Wilson D (1995) Endophyte – the evolution of term, a classification of its use and definition. 

Oikos 73:274–276 

Wong MKM, Hyde KD (2001) Diversity of fungi on six species of Gramineae and one 

species of Cyperaceae in Hong Kong. Mycol Res 105:1485–1491 

Zhang W, Wildel JF, Clark LG (1997) Bamboozled again! Inadvertent isolation of fungal 

rDNA sequences from bamboos (Poaceae: Bambusoideae). Mol Phylogenet Evol 

8:205–217 

Zhou DQ, Hyde KD (2001) Host-specificity, host-exclusivity and host-recurrence in 

saprobic fungi. Mycol Res 105:1449–1457

18 Mycorrhizal Development and Cytoskeleton 



The formation of mycorrhiza requires morphological changes, both in the 

plant cells and fungal hyphae, necessary for the development and maintenance 

of the signal and nutrient exchange at plant fungal interfaces. It is well 

known that cytoskeletal elements play a central role both in the morphogenesis 

of plant root cells (Barlow and Baluška 2000) and of fungal hyphae (Raudaskoski 

et al. 2001). In the present review, the plant and fungal genes encoding 

the structural proteins of main cytoskeletal elements, microtubules (MTs) 

and microfilaments (MFs), are described. Some speculations of the functional 

significance of cytoskeletal rearrangements observed in plant cells and fungal 

hyphae at the formation of endo- and ectomycorrhiza are presented. The 

reorganization of the cytoskeleton results from interactions with proteins that 

serve by themselves as targets for intra- and extracellular signal mediating 

pathways (Johnson 1999; Kost et al. 1999b). The presence of such pathways in 

mycorrhiza is discussed. The different phases in the cell cycle also requires 

rearrangements in the cytoskeleton (Mews et al. 1997; John et al. 2001). This 

aspect is shortly discussed in association with known effects of mycorrhiza 

on the plant cell cycle. Finally, the general methods used in visualization of 

cytoskeletal components are shortly introduced. 

2 Cytoskeletal Components 

The cytoskeleton is composed of filamentous structures whose arrangements 

are continuously changing in living cells in response to different developmental 

and environmental cues. In plant and fungal cells there are two main 

cytoskeletal proteins: actin and tubulin. Actin monomers polymerize to thin 

filaments known as MFs or actin filaments. Tubulin polymerizes to MTs. Both 

MFs and MTs are polarized structures with minus and plus ends. The minus 

end is often attached to some subcellular structure while the plus end is 




294 


mainly untouched and is able to polymerize and depolymerize more freely 

than the minus end. The polarity of the cytoskeletal elements is well studied 

in animal cells while in plant cells and fungal hyphae, their polarity is known 

only in a few cases (Euteneuer and McIntosh 1980). 

In eukaryotic cells, MTs participate in cell division, cell shape changes, cell 

motility and intracellular organelle trafficking as well as in cell wall synthesis 

(Wasteneys 2000; Lloyd and Hussey 2001). Actin cytoskeleton is involved in 

many different developmental processes including the establishment of cell 

polarity and tip growth (Hepler et al. 2001; Raudaskoski et al. 2001), division 

plane determination, cell elongation, positioning of proteins on membranes 

and cytoplasmic streaming (Meagher et al. 1999). Recently, connections have 

been revealed between MT and actin cytoskeleton mediated by interaction 

between MF- and MT-associated motor molecules or scaffold proteins 

(Goode et al. 2000). Thus, the reorganization in one cytoskeletal component 

may also lead to the reorganization of the other. 

2.1 Expression of Tubulin-Encoding Genes 

MTs in eukaryotic cells are composed of polymerized a- and b-tubulin heterodimers. 

A less abundant form, g-tubulin occurs also in eukaryotic cells 

(Liu et al. 1993). g-Tubulin functions in MT organizing centers in centrosomes 

in animal cells (Joshi et al. 1992) and in spindle pole bodies in fungi (Oakley 

et al. 1990). Higher plants have no discrete MT organizing centers and g-tubulin 

appears to be dispersed around the cells (Joshi and Palevitz 1996). Plant aand 

b-tubulin gene families consist of five to ten genes while in fungi the 

number is much lower with only one or two family members (Joyce et al. 1992; 

Kopczak et al. 1992; Snustad et al. 1992; Villemur et al. 1992, public databases). 

Analysis of tubulin gene expression, mainly done in Arabidopsis and maize, 

has shown that transcripts of tubulin genes occur in all plant tissues, but their 

accumulation can be specific for different plant organs or developmental 

stages (Montoliu et al. 1989; Hussey et al. 1990; Joyce et al. 1992; Villemur et al. 

1994) or induced by environmental factors (Kerr and Carter 1990a). Tubulin 

expression studies in mycorrhizal plants are of special interest, since the 

invading fungus alters the expression pattern of tubulins known from uninfected 

root (Bonfante et al. 1996). 

In maize it has been shown that the accumulation of the transcripts from 

all six a-tubulin genes is relatively high in the root tip, but low in the root cortex 

(Joyce et al. 1992). More detailed analyses at cellular level have shown that 

in the maize root the preferential expression of tua1 and tua3 genes occurs in 

root meristem cells differentiating into cortex and vascular tissue, respectively. 

The transcripts of tua2 gene accumulate in maize root epidermis 

(Uribe et al. 1998), while tua4 transcripts are mainly expressed in root vascular 

tissue (Joyce et al. 1992). In agreement with the idea that a mycorrhizal

18 Mycorrhizal Development and Cytoskeleton 295 

fungus might affect the expression pattern of tubulin genes is the observation 

that tua3 transcripts increased in the differentiated cortical cells at the invasion 

of an endomycorrhizal fungus. Similarly, in the transgenic tobacco, in 

which the Gus expression took place under the promoter of maize tubulin 

gene tua3, Gus activity occurred in differentiated cortical cells infected by 

endomycorrhizal fungus (Bonfante et al. 1996).As with a-tubulins the expression 

of Arabidopsis b-tubulins is relatively high in the root tip and vascular 

tissue, but low in root cortical cells (Villemur et al. 1994). The tub6 and tub8 

genes are preferentially expressed in the root tip and vascular cylinder while 

the high expression of tub4 gene seems to be a unique feature for vascular tissue 

(Villemur et al. 1994). It has not been investigated whether the formation 

of endomycorrhiza is affecting the expression pattern of b-tubulin genes. 

Until now, Eucalyptus globulus is the only ectomycorrhiza forming plant in 

which tubulin expression during ectomycorrhiza formation has been studied 

at the RNA level. An a-tubulin gene was shown to be upregulated during formation 

of symbiosis, and the upregulation of a-tubulin expression paralleled 

the increased formation of lateral roots in Eucalyptus seedlings that were in 

contact with the fungal mycelium (Diaz et al. 1996). In Pinus sylvestris- Suillus 

bovinus and P. contorta–S. variegatus ectomycorrhiza the expression of tubulins 

has been analyzed at the protein level (Timonen et al. 1993, 1996; Niini et 

al. 1996). Different mobility of plant and fungal a-tubulin allowed their comparison 

in one-dimensional (1-D) immunoblots, which suggested that in 

mature ectomycorrhiza the fungal a-tubulin dominated (Timonen et al. 

1996). The comparison of the amount of plant and fungal a-tubulin during 

the development of P. contorta–S. variegates ectomycorrhiza for 60 days also 

indicated that the amount of plant a-tubulin decreased gradually, probably 

due to the development of fungal sheath around the root (Timonen et al. 

1996). No such comparisons could be made between plant and fungal b-tubulin 

or actin due to their similar mobility during the electrophoretic separation. 

The immunoblots of two-dimensional gels from three root types of P. 

sylvestris radicles, main root and first order laterals and short roots as well as 

from different developmental stages of P. sylvestris–S. bovinus ectomycorrhiza 

revealed more differences in the tubulin protein patterns than 1-D 

immunoblots (Niini et al. 1996). Three plant a-tubulins were detected in all 

root types, but the pattern in the short roots differed from that in radicles and 

first-order laterals. This is an interesting observation, since the formation of 

ectomycorrhiza occurs in Pinus short roots probably due to their reduced 

growth rate that could be associated with the occurrence of the short-rootspecific 

a-tubulin pattern. During the development of ectomycorrhiza the initial 

short root-specific a-tubulin pattern gradually changed and two new 

a-tubulins were distinguished in mature ectomycorrhiza. Whether the atubulin 

protein patterns in P. sylvestris short roots and ectomycorrhiza results 

from alterations in the expression of a-tubulin genes or post-transcriptional

296 


modifications of a-tubulin proteins, will be resolved when the number and 

the degree of transcript accumulation of a-tubulin encoding genes in P. 

sylvestris short roots have been clarified. In the immunoblots from the different 

root types and ectomycorrhiza, three different b-tubulins were identified. 

For the expression of P. sylvestris b-tubulins no alterations comparable to 

those in a-tubulin were observed. 

The expression of the tubulin genes in endo- and ectomycorrhizal fungi 

has also obtained some attention. Fragments encoding 267 amino acids from 

the central part of the b-tubulin gene have been cloned from several endomycorrhizal 

fungi including Glomus mossae, G. geosporum, G. coronatum, G. 

clarum, Gigaspora rosea, Acaulospora laevis, andScutellospora castanea (M. 

Stommel and P. Franken, public databases). The deduced amino acid 

sequences of the fragments suggest clearly that there are at least two b-tubulin 

encoding genes in the endomycorrhizal fungi. Comparison of the deduced 

amino acid sequences of the b-tubulin genes in and between different species 

indicates that in each species the b-tubulin amino acid sequences are more 

similar to b-tubulins of other species than to those within the same species. 

The G. rosea b-tubulin transcripts accumulate in dormant and germinated 

spores, in extraradical hyphae and in pea mycorrhiza (Franken et al. 1997; 

Bütehorn et al. 1999), while a- and b-tubulin protein was detected in the 

hyphae of G. mossae elicited by the host plant (Åström et al. 1994). None of 

these experiments have yet shown whether the expression of either the btubulin 

gene is associated with the formation of endomycorrhiza or some 

other specific stage in the life cycle of the endomycorrhizal fungi. 

The immunoblots of a- and b-tubulins from the ectomycorrhizal fungus S. 

bovinus and from its ectomycorrhiza with P. sylvestris indicated the presence 

of three a- and two b-tubulin polypeptides (Niini et al. 1996) in nonsymbiotic 

hyphae and ectomycorrhiza. From the filamentous homobasidiomycete 

Schizophyllum commune that is closely related to S. bovinus,three a- and two 

b-tubulins have also been identified by 2-D gel electrophoresis. Until now, 

only two a- and one b-tubulin encoding genes have been isolated from S. 

commune in spite of several attempts (Russo et al. 1992; Raudaskoski unpublished 

data). The higher number of polypeptides than tubulin encoding genes 

suggests that fungal a- and b-tubulins are targets for posttranslational modifications. 

Recently, a b-tubulin encoding cDNA highly similar to that of S. 

commune has been isolated from S. bovinus. By using the encoding region of 

the S. bovinus b-tubulin gene as a probe, a high, but similar amount of b-tubulin 

mRNAs were detected both in nonsymbiotic and symbiotic hyphae (Lahdensalo 

et al., unpublished). Both in vegetative and ectomycorrhizal hyphae of 

S. bovinus the tubulin polypeptides occurred in doublet patterns (Niini et al. 

1996), which are thought to be due to allelic differences between tubulins of 

the haploid genomes present in the dikaryotic hyphae of S. bovinus. This 

needs to be certified by cloning and further analysis of S. bovinus tubulin 

genes.

2.2 Expression of Actin-Encoding Genes 


Arabidopsis is known to have ten actin genes, two of which are pseudogenes 

(Meagher et al. 1999). Out of the eight expressed actin genes ACT2, ACT8,and 

ACT7 are named Arabidopsis vegetative actin genes due to the accumulation 

pattern of transcripts. ACT2 is expressed in young and old vegetative tissue, 

but ACT8 only in a subset of the organs and tissues expressing ACT2 (An et al. 

1996a). ACT7 is expressed in young expanding vegetative tissues and is also 

involved in phytohormone responses (Kandasamy et al. 2001). The rest of the 

Arabidopsis actin genes appear to be associated with reproductive processes 

(An et al. 1996b; Huang et al. 1997; Meagher et al. 1999). In spite of the high 

number of actin genes in most plant species and the important cell biological 

functions of the actin cytoskeleton, only a few analyses about the expression 

of different actin genes in root tissue have been performed (McLean et al. 

1990) and the effect of mycorrhiza on the expression of actin genes at mRNA 

level has not been investigated. 

One-dimensional analyses of actin expression at the protein level have 

been performed in Pinus ectomycorrhiza. The similar mobility of plant and 

fungal actins in the immunoblots of 1-D gels from P. sylvestris- S. bovinus 

ectomycorrhiza made it difficult to record the contribution of each symbiotic 

partner to the actin signal (Timonen et al. 1993). The presence of the actin signal 

throughout the different developmental stages of ectomycorrhiza was suggested 

to be a reliable marker for still metabolically active symbiosis (Timonen 

et al. 1996). 

In the immunoblots of 2-D gels four actin polypeptides were detected in P. 

sylvestris radicles, main roots and first order laterals and in short roots. The 

polypeptides were also detected in P. sylvestris- S. bovinus young and dichotomous 

mycorrhizal short roots. In fully mature coralloid mycorrhiza only two 

actin polypeptides occurred. Whether they represented plant or fungal actin 

or both was not possible to conclude. The presence of four actin polypeptides 

in Pinus root tissues is in agreement with the occurrence of a similar number 

of actin polypeptides in Vicia faba roots (Janssen et al. 1996), while in the 

roots of Phaseolus vulgaris one and two actin polypeptides were detected in 

symbiotic root nodules and in uninfected roots, respectively (Pérez et al. 

1994). 

In the immunoblots of 2-D gels of the vegetative hyphae of S. bovinus two 

actin polypeptides occurred that were also detected in ectomycorrhiza (Niini 

et al. 1996). Recently, two actin-encoding genes, Sbact1 and Sbact2,were isolated 

from S. bovinus nonsymbiotic hyphae (Tarkka et al. 2000). Northern 

hybridization with specific probes for each actin gene of S. bovinus indicated 

that both actins are expressed in vegetative hyphae and ectomycorrhiza. In 

vegetative hyphae, the expression rate and protein level of Sbact1 was tenfold 

higher than that of Sbact2. A ten times higher accumulation of Sbact1 than 

Sbact2 mRNA was also observed in ectomycorrhizal hyphae, although the

298 


analyzed sample represented a pool of young and mature ectomycorrhizal 

roots. In the future, the analysis of different developmental stages of ectomycorrhiza 

might improve our understanding of the expression pattern of the S. 

bovinus actin genes in symbiosis. From S. commune, a nonectomycorrhizal 

homobasidiomycete closely related to S. bovinus, two actin-encoding genes 

were also isolated (Tarkka et al. 2000), which indicates that filamentous 

homobasidiomycetes differ from filamentous deutero- and ascomycetes, having 

only a single actin gene. Recently, two actin-encoding genes have also 

been identified in the genome sequence of Schizosaccharomyces pombe 

(Wood et al. 2002). 

3 Organization of Cytoskeleton in Endomycorrhiza 

3.1 Root Cells 

Indirect immunofluorescence (IIF) microscopy and related methods have been 

used to study the structure of the cytoskeleton in nonmycorrhizal and 

endomycorrhizal root cells of tobacco (Genre and Bonfante 1997, 1998), 

Asparagus (Matsubara et al. 1999), Medicago truncatula (Blancaflor et al. 

2001), and in protocorms of orchid seeds (Uetake et al. 1997; Uetake and 

Peterson 1997,1998). Protocorms develop at the base of germinating orchid 

seeds and invasion of the parenchyma cells by a symbiotic fungus is necessary 

for the further development of the embryo. Several common features were 

observed in the reorganization of MT cytoskeleton in roots and protocorms 

after invasion of the symbiotic fungus into the plant cells. In all three cases the 

fungus invades differentiated parenchyma cells containing mainly transversely 

orientated cortical (below the plasma membrane) MTs connected with 

a few cytoplasmic MTs to the nucleus. After hyphal penetration, the plasma 

membrane separating the fungal hyphae from the plant cell cytoplasm, the 

perifungal membrane (Uetake and Peterson 1998), expands to follow the 

branching of the fungal hyphae. The growth of the hyphae in the intracellular 

space leads to formation of an arbuscule in endomycorrhiza and a peloton of 

hyphal coils in orchid mycorrhiza. The hyphal growth is associated with profound 

reorganization of MT cytoskeleton in the plant cell (Uetake et al. 1997; 

Uetake and Peterson 1997; Genre and Bonfante 1997, 1998; Matsubara et al. 

1999; Blancaflor et al. 2001). During fungal invasion the cortical MTs of the 

plant cell disappear probably through depolymerization, and new MTs, less 

well orientated, reappear at the plasma membrane surrounding the intracellular 

hyphae. 

The signals and mechanisms behind the observed reorganization of MT 

cytoskeleton in plant cells colonized by endomycorrhizal fungi are not yet 

known. However, it can be speculated that the invasion and proliferation of 

fungal hyphae in the space between cell wall and plasma membrane of a dif-


ferentiated plant parenchyma cell with full turgor pressure could cause 

mechanical stress (Ko and McCulloch 2000; Stamatas and McIntire 2001) at 

the plant cell membrane, perhaps associated with chemical signals from the 

fungus to the plant cell. These signals could cause the depolymerization of 

MTs at the plasma membrane surrounding the cell and direct MT repolymerization 

at the expanding plasma membrane surrounding the growing hyphae, 

together with altered gene expression of the invaded parenchyma cells. In line 

with this idea is the observation that in transgenic tobacco the GUS expression 

under the promoter of the maize tubulin gene Tuba3 increased in differentiated 

cortical cells infected by endomycorrhizal fungus (Bonfante et al. 

1996). The accumulation of Tuba3 transcripts was similarly observed to 

increase in maize cortical cells during the invasion of the cells by an endomycorrhizal 

fungus. Cell wall material is deposited into the extracellular space 

between the plant cell membrane and fungal hyphae (Peterson et al. 1996), 

which could require the presence of MTs as these are required for cell plate 

formation in meristems (Lloyd and Hussey 2001), primary wall formation in 

elongating cells (Wasteneys 2000), and secondary wall thickenings in differentiating 

cells (Chaffey et al. 2000). In addition, proteins necessary for the 

nutrient exchange between the symbionts probably are synthesized and 

transported to the perifungal membrane (Rosewarne et al.1999; Hahn and 

Mendgen 2001), which could also require transport along the MTs. 

The distribution of MFs has also been studied in endomycorrhiza formed 

in tobacco roots (Genre and Bonfante 1998) and in protocorm cells (Uetake 

and Peterson 1997). In noninfected cells, MFs appeared to have the distribution 

reported for parenchyma cells in a large number of plants investigated 

(Staiger 2000), with thin and thick MF cables crossing the cell cytoplasm. At 

fungal invasion, reorganization of MFs were observed in cortical cells of 

tobacco, in which the cables disappeared and MFs seemed to become tightly 

associated with the plasma membrane surrounding the arbuscular branches 

(Genre and Bonfante 1998). In protocorm cells, no clear reorganization of 

MFs was observed, but the distribution of MFs was comparable to that in 

uninfected cells (Uetake and Peterson 1997), which was a result quite different 

from the reorganization of MTs in the protocorm cells at fungal invasion. The 

different behavior of MFs in tobacco and protocorm cells at fungal invasion is 

suggested to be due to the physiological difference between the endomycorrhizal 

and orchid endosymbiotic fungus (Genre and Bonfante 1997), or it 

could result from differences in the processing of the cells for confocal microscopic 

investigation (Uetake and Peterson 1997). In tobacco root cells, the 

accumulation of MFs in close association with the plasma membrane surrounding 

the fungus is suggested to be due to the involvement of the actin 

cytoskeleton in localization of proteins necessary for membrane transport 

and signal transduction between symbionts (Genre and Bonfante 1997). Noteworthy 

is that at the invasion of the plant cell by the endomycorrhizal fungus, 

the plant cell nucleus moves from the periphery of the cell to the center and

300 


the central vacuole becomes fragmented (Bonfante and Perotto 1995). These 

processes could also be controlled by rearrangements of MTs or MFs, or by 

both cytoskeletal elements. 

3.2 Fungal Hyphae 

In the research of cytoskeleton in endomycorrhiza, the structure and function 

of fungal MTs and MFs have gained less attention than those of plant cells. In 

the IIF microscopical investigation of nonsymbiotic hyphae of Glomus 

mossae, the MTs were visualized with tubulin and MFs with actin antibodies 

in the multinucleate hyphae originating from germinated spores (Åström et 

al. 1994). MTs extended in the cortical and central parts of the hyphae to the 

extreme hyphal tip, continued from the main hypha into a branch and the 

position of nuclei appeared to follow the MT tracks. Long MFs were also visualized 

in the hyphae (Åström et al. 1994). MTs and MFs could be involved in 

the intra- and intercellular nuclear movements and cytoplasmic streaming, 

respectively, recorded in living nonsymbiotic hyphae of different endomycorrhizal 

fungi (Bago et al. 1998; Giovannetti et al. 1999). The presence of both 

MTs and MFs in nonsymbiotic hyphae suggests that these structures could 

also play a significant role in hyphal morphogenesis associated with the formation 

of endomycorrhiza, such as the differentiation of the appressorium at 

the root surface at the beginning of the symbiosis and the formation of vesicular 

and arbuscular structures in the plant cell after the establishment of the 

symbiosis. 

4 Organization of Cytoskeleton in Ectomycorrhiza 

4.1 Root Cells 

The effect of ectomycorrhiza formation on the plant cell cytoskeleton is more 

difficult to investigate than that of endomycorrhiza or orchid mycorrhiza. In 

the ectomycorrhizal symbiosis, the fungal hyphae grow between the cortical 

cells of the host plant, forming a hyphal network for nutrient exchange called 

the Hartig net. The plant cells of the Hartig net have thick cell walls and accumulations 

of secondary metabolites such as phenols and starch. The thick cell 

walls inhibit rapid penetration of fixatives necessary for preservation of 

cytoskeletal elements, which is seen as lack of MTs or MFs from the published 

ultrastructural studies of ectomycorrhiza. Autofluorescence of secondary 

metabolites hampers the recording of cytoskeletal structures when they have 

been preserved during fixation. In spite of these difficulties, some knowledge 

of cytoskeletal structure has been obtained in Pinus sylvestris–Suillus bovinus 

ectomycorrhiza (Timonen et al. 1993; Niini and Raudaskoski 1998).


P. sylvestris has a root system consisting of three morphologically and 

anatomically different root types, which is also found in other pines as well as 

in eucalypts and beeches (Smith and Read 1997). The primary root or the 

main root has an undetermined capacity for continuous growth, the lateral 

roots have a somewhat limited ability to elongate, and the so-called short 

roots have a very limited ability to grow. In order to survive, they have to be 

colonized by a symbiotic fungus (Robertson 1954; Wilcox 1968). In some 

pines, i.e., P. sylvestris and P. strobus, the mycorrhiza only forms in the short 

roots (Piché et al. 1983). In Scots pine seedlings, two types of short roots are 

distinguished: one type consists of long and slender roots with a high number 

of root hairs, the other of truncated, robust roots with a round apex and only 

a few root hairs. The majority of the short roots of pine seedlings belong to the 

latter type and mycorrhiza is only formed in this root type (Niini and Raudaskoski 

1998). 

The IIF microscopical studies on the MT cytoskeleton in nonmycorrhizal 

and mycorrhizal short roots have indicated some common features. The most 

prominent MT cytoskeleton is detected in meristematic and vascular tissue. 

In the meristems of truncated short roots the MTs are often vertical in interphase 

cells and mitotic spindles are horizontally oriented. These features suggest 

that in the meristem the cells elongate and divide horizontally which 

probably is the reason for the blunt form of the tip in the truncated short roots 

(Niini and Raudaskoski 1998). Almost next to the meristem in short roots 

occur xylem elements with cell wall thickenings and cortical cells with amyloplasts, 

which indicates that cell differentiation takes place very close to the 

short root tip. In the topmost cell layer of the meristem the direction of cell 

divisions is no longer horizontal, but oblique or vertical. From the central part 

of this layer originate vertically elongated cells with horizontally orientated 

MTs, and from the borders cells with amyloplasts representing differentiating 

vascular and cortical tissue, respectively. Thus, in short roots divisions in only 

one cell layer seem to provide initials for the elongation and differentiation 

zones while in lateral roots the transition zone between the meristem and 

elongation zone appears to consist of four to five cell layers with vertical cell 

divisions producing initials for cell elongation and differentiation. This must 

affect the growth rate of the roots and could explain why the elongation of the 

short roots is retarded and tissue maturation occurs closer to the meristem in 

the short roots than in the laterals. 

In nonmycorrhizal short roots, very few MTs are detected in the cortical 

cells for which a high number of amyloplasts is typical (Fig. 1A). In ectomycorrhizal 

roots, MT fluorescence is only observed in association with the 

nucleus in cortical cells (Fig. 1B). The low number or absence of MTs from 

cortical cells seems to be a specific feature of Pinus short roots. Although the 

tubulin expression in cortical cells of Arabidopsis (Villemur et al. 1994), and 

maize (Joyce et al. 1992), roots is low, MTs are always detected at the inner 

face of the plasma membrane in uninfected cortical cells of these plants. It

302 

Marjatta Raudaskoski, Mika Tarkka and Sara Niini


is possible that the antibody used for IIF microscopical detection of MTs in 

Pinus is not able to recognize the MTs of cortical cells although it visualizes 

well MTs in meristem and vascular tissue. The MT cytoskeleton of cortical 

cells of Pinus could also be more sensitive to the processing of the samples 

for IIF microscopy than the MTs in meristem and vascular tissue. Interestingly, 

it has not been possible to visualize MFs in the cortical cells of short 

roots although plenty of MFs are seen in vascular tissue, where they were 

already visualized in the early days of the study of MFs in plant cells (Pesacreta 

et al. 1982). 

The structure of cell wall and cytoskeleton in differentiating cortical cells 

in short roots of pine is of special interest, since this is the region of the short 

root in which the ectomycorrhizal fungus invades and establishes the Hartig 

net. When root morphogenesis and ectomycorrhiza formation in Scots pine 

was studied (Niini et al. 1996; Tarkka et al. 1998), a group of polypeptides with 

molecular weight slightly above 43 kDa were observed to be short root-specific. 

By using peptide sequencing, it was shown that the polypeptides represented 

a group of peroxidases. By reverse genetics a full-length cDNA of one 

of the peroxidases, Psyp1, was cloned and sequenced (Tarkka et al. 2001). The 

signal sequence suggests that Psyp1 is secreted and could be involved in cell 

wall formation. In ectomycorrhiza Psyp1 expression is downregulated, which 

agrees with the idea that the growth of the fungal hyphae in the intercellular 

space might inhibit the cortical cell wall differentiation (Niini 1998). There 

may be signalling or linkages between adjacent plant cells that can regulate 

the organization of their cytoskeletal structures. This exchange of information 

might be mediated through plasmodesmata, or alternatively, through the 

intervening cell wall (Canut et al. 1998; Overall et al. 2001). 

Fig. 1. Microtubule cytoskeleton visualized with indirect immunofluorescence technique 

with a-tubulin antibody and viewed with laser scanning confocal microscopy in 

Pinus sylvestris short root (A) and ectomycorrhiza with Suillus bovinus (B). A In cortex 

only few microtubules are distinguished in the cortical cells with numerous round amyloplasts. 

In stele microtubules with mainly transverse orientation are abundant in elongating 

cells differentiating to vascular tissue. Strong vertical bands represent wall thickenings 

in a xylem cell. B Microtubules are hardly seen in pine cortical cells, but they are 

clearly distinguished as long tracks in hyphae forming the fungal sheath and penetrating 

into the root cortex. A,B Bars 20 mm. C–E Cytoskeletal elements in Suillus bovinus 

hyphae visualized with rhodamine-phalloidin staining of actin (C, D) and indirect 

immunofluorescence microscopy with a-tubulin antibody (E). C A strong actin signal at 

hyphal tip, D an actin ring at the site of the future septum. E Microtubule tracks in a 

hyphal branch. C–E Bars 10 mm

304 



An extensive MT cytoskeleton with strictly axial orientation is observed in the 

long polarized apical cells of ectomycorrhiza-forming and other filamentous 

fungi (Salo et al. 1989; Raudaskoski et al. 1991; Niini and Raudaskoski 1998; 

Raudaskoski et al. 2001). In the dikaryotic hyphae of these fungi the longitudinally 

running MTs (Fig. 1E) appear to keep the two nuclei with different 

mating type genes close to each other by forming a cage of crossing MTs 

around the nuclear pair (Runeberg et al. 1986; Salo et al. 1989).Actin is visualized 

as a cap in the hyphal tips (Fig. 1C), as small plaques along the apical cell 

and as a ring (Fig. 1D) at the site where the cross wall will be formed (Salo et 

al. 1989; Raudaskoski et al. 1991; Gorfer et al. 2001). 

Comparison of the structure/organization of actin cytoskeleton in the taxonomically 

closely related slow-growing ectomycorrhiza-forming S. bovinus 

and fast-growing wood-decaying S. commune reveals several differences. In 

the slow-growing hyphae of S. bovinus the actin cap is more extensive than in 

S. commune, and the cap can be easily visualized with fluorochrome-labeled 

phalloidin that binds only to filamentous actin (Barak et al. 1980). In contrast, 

the visualization of the actin cap at the hyphal tips of S. commune succeeds 

only with an actin antibody, which visualizes actin monomers in addition to 

actin filaments. These differences suggest that the structure of MFs is more 

stable and their number is higher at the hyphal tip in the slow-growing ectomycorrhizal 

than in the fast-growing wood-decay fungus. In the hyphae of S. 

bovinus, it is also possible to distinguish occasionally actin filaments (Gorfer 

et al. 2001) comparable to those seen at a specific growth phase in budding 

yeast cells of S. cerevisiae (Kilmartin and Adams 1984).Actin filaments are not 

observed in the hyphae of fast-growing filamentous fungi, such as S. commune 

(Runeberg et al. 1986; Raudaskoski et al. 1991) or Neurospora crassa 

(Heath et al. 2000). These observations suggest that there probably are some 

basic differences in the structure of the actin cytoskeleton between slowgrowing 

and fast-growing filamentous fungi. The question whether these differences 

are associated with the ability of S. bovinus to form ectomycorrhiza 

with P. sylvestris root cells and whether these specific features occur in all 

ectomycorrhiza-forming fungi has to be answered the in the future. 

The use of drugs against polymerized tubulin and actin has given insights 

into their roles in hyphal growth. The depolymerization of the MT cytoskeleton 

with an anti-MT drug leads to strong branching of the hyphae in ectomycorrhizal 

fungi such as Amanita muscaria, Hebeloma cylindrosporum, Paxillus 

involutus, and S. bovinus (Niini and Raudaskoski 1993). In contrast, the 

depolymerization of actin filaments from the hyphae of S. bovinus with 

cytochalasin D leads to swelling of the hyphal tip cells and loss of the polarized 

growth pattern (Niini 1998; Raudaskoski et al. 2001). Nonpolarized 

growth and strong branching of hyphae are also observed when an ectomycorrhizal 

fungus is associated with the plant root cells (Kottke and Oberwin-


kler 1987; Timonen et al. 1993; Niini 1998; Raudaskoski et al. 2001). The similar 

morphology of nonsymbiotic hyphae treated with inhibitors and of the 

hyphae grown in association with the root cells have led us to the hypothesis 

that the change in the hyphal morphology is due to a signal from root cells, 

the recognition and transduction of which leads to a reorganization of the 

actin cytoskeleton. 

5 Regulation of Actin Cytoskeleton Organization in Fungal 

Hyphae and Plant Cells 

Recently, several GTPases known to play an important role in linking extracellular 

signals to reorganization of actin cytoskeleton in yeasts and mammalian 

cells (Johnson 1999) have been isolated from S. bovinus and S. commune. 

The GTPases are conserved molecular switches that are normally 

anchored to the plasma membrane by a C-terminally attached farnesyl tail. In 

the active form the protein is bound to GTP, in the inactive one to GDP (Nuoffer 

and Balch 1994). 

Until now, a Ga,aCdc42 and a rac cDNA and two ras cDNAs have been isolated 

and characterized from S. bovinus and three Ga cDNAs, a Cdc42, a ras 

and a rho3 cDNA from S. commune (Gorfer et al. 2001; Raudaskoski et al. 

2001). Out of these genes only ras had been isolated before from an ectomycorrhizal 

fungus Laccaria laccata (Sundaram et al. 2001). The GTPases cloned 

from S. bovinus are expressed in vegetative hyphae, but also during ectomycorrhiza 

formation (Gorfer et al. 2001; Raudaskoski et al. 2001). SbCdc42 cDNA 

is able to complement the temperature-sensitive S. cerevisiae cdc42 mutation 

causing disruption of actin cytoskeleton (Johnson and Pringle 1990), which 

suggests that SbCdc42 is also involved in regulating the organization of actin 

cytoskeleton as it is in yeast and animal cells (Gorfer and Raudaskoski, 

unpubl. data). 

The small GTPases were chosen as the target for research in the ectomycorrhizal 

fungus S. bovinus on the basis of the following previous results: (1) 

IIF microscope analyses show rearrangement of cytoskeletal elements in S. 

bovinus hyphae at the formation of ectomycorrhiza (Timonen et al. 1993; 

Niini 1998; Raudaskoski et al. 2001). (2) The reorganization of the cytoskeleton 

in fungal hyphae occurs without differential expression of fungal tubulin 

or actin genes (Niini et al. 1996; Tarkka et al. 2000). (3) In S. commune, closely 

related to S. bovinus, the mating interaction necessary for sexual reproduction 

is regulated by the signal transduction pathway starting from the pheromone- 

G-protein-coupled receptor (GPCR) interaction (Wendland et al. 1995; Vaillancourt 

et al. 1997; Raudaskoski 1998; Raudaskoski et al. 1998; Fowler et al. 

1999). In animal cells (Schmidt and Hall 1998), and in the yeast S. cerevisiae 

(Johnson 1999), the effect of small GTPases (e.g., Cdc42, Rac and Rho) on the 

organization of the actin cytoskeleton is initiated by the binding of a signal

306 


molecule to a G-protein coupled receptor, which is the receptor-type shown to 

mediate the signalling between haploid hyphae at the mating interaction in S. 

commune. 

A high number of different types of ligands/signals are recognized by the 

members of the GPCR superfamily in animal cells (Neer 1995). Recently, it has 

been shown that a set of GPCRs may function in fungi as well, since a distinct 

GPCR system from the one recognizing the pheromones senses glucose in 

yeasts (Versele et al. 2001). It could thus be speculated that in ectomycorrhizaforming 

fungi a GPCR originally involved in sexual reproduction is able to 

interact with signal molecules produced by plant roots, due to a mutational 

change in its structure. The contact with the plant would be signalled into the 

hyphal cells where it might lead to a change in the organization of actin 

cytoskeleton from highly polarized to a more relaxed form via a pathway 

involving the small GTPases Cdc42 and Rac1 (Gorfer et al. 2001). This could 

then lead to the development of a hyphal morphology suitable for the symbiotic 

growth. Perhaps it is meaningful that the majority of ectomycorrhizaforming 

fungi belong to homobasidiomycetes. This group of filamentous 

fungi includes species, such as S. commune and Coprinus cinereus, in which 

sexual reproduction is regulated by the signal transduction pathway starting 

from pheromone-GPCR interaction (Fowler et al. 1999; Olesnicky et al. 1999). 

In endomycorrhizal fungi, the characteristic changes in hyphal morphology, 

the formation of the appressorium on the root surface at the beginning of 

colonization and the strong branching of hyphae at arbuscule formation, may 

require the reorganization of actin cytoskeleton. It may be speculated that the 

different hyphal morphologies are due to the perception of plant signals, 

which could be mediated to the actin cytoskeleton through the small GTPases 

belonging to the Rho subfamily. 

Small GTPases of the Rho subfamily exist also in plants, where they are 

addressed as Rac or Rop proteins. In Arabidopsis 11 Rac/Rop genes have been 

identified (Kost et al. 1999a; Li et al. 2001). The expression analysis of the constitutively 

active mutant form of Rac/Rop proteins unable to hydrolyse GTP or 

the dominant negative mutant form unable to exchange GDP to GTP has 

shown that the GTPases are involved in the regulation of apical growth and 

organization of MFs in pollen tubes (Kost et al. 1999a; Zheng and Yang 2000; 

Fu et al. 2001), and in root hairs (Molendijk et al. 2001). Rac/Rop proteins 

appear also to be involved in the regulation of organization of the actin 

cytoskeleton during stomatal closure in response to abscisic acid (Lemichez et 

al. 2001). The expression of constitutively active and dominant negative forms 

of Rac/Rop under the 35S universal promoter indicated that these proteins 

participate in multiple distinct signalling pathways that control plant growth, 

development and responses to the environment (Li et al. 2001).

6 Actin Binding Proteins 


In eukaryotic cells, a high number of actin binding proteins (ABPs) regulate 

polymerization and depolymerization, bundling and cross-linking of MFs, 

and movement of cargo along the MFs. In animal cells, many of the ABP 

encoding genes have been isolated and the function of the corresponding 

proteins has been characterized. In plants and filamentous fungi, the 

ABP research is just beginning. In Arabidopsis, the members of the gene 

families encoding ADF proteins (actin depolymerizing factor/cofilin; Dong 

et al. 2001), profilins (Ramachandran et al. 2000), Arp2 (Klahre and Chua 

1999), villins (Klahre et al. 2000), and myosins (Reddy and Day 2001) have 

been cloned and their expression patterns in different plant organs characterized. 

ADF protein family members interact with actin monomers and filaments 

in a pH-sensitive manner. When ADF/cofilin binds to filamentous (F) actin it 

accelerates the dissociation of subunits from the pointed ends of actin filaments 

(Bamburg 1999; Cooper and Schafer 2000). The properties of maize 

cofilins have been analysed by using recombinant ZmADF1 and ZmADF3 

proteins (Hussey et al. 1998). ZmADF3 has the ability to bind monomeric (G) 

actin and F-actin and to decrease the viscosity of polymerized actin solutions, 

indicating an ability to depolymerize actin filaments (Lopez et al. 1996). 

ZmADF3 is phosphorylated on Ser6 by a calcium-stimulated protein kinase in 

plant extracts (Smertenko et al. 1998), which suggests that phosphorylation 

regulates cofilin’s actin binding activity and affects the stability of the actin 

cytoskeleton in a manner shown in animal cells (Daniels and Bokoch 1999). 

Profilin is a G-actin binding protein known to interact in animal and yeast 

cells with proline-rich motifs of other proteins and with polyphosphoinositides. 

The interaction of profilin with G-actin provides a mechanism to 

sequester actin monomers and promote actin depolymerization. It appears 

that profilin may also be involved in promoting actin polymerization. This 

might take place by binding to proline-rich motifs in proteins that convey 

intra- or extracellular signals to reorganization of actin cytoskeleton (Mullins 

2000). In Arabidopsis,thePFN-1 gene, from profilin gene family with eight to 

ten members, is expressed in root and root hairs, and in a ring of cells in the 

elongating zone of the root (Ramachandran et al. 2000), in which the profilin 

levels could be involved in the regulation of cell elongation as a rate-limiting 

factor. 

Plants have also several genes with high homology to animal villin (Klahre 

et al. 2000). The first plant villin was isolated from pollen tubes as a 135-kDa 

actin-bundling protein (Yokota et al. 1998; Yokota and Shimmen 1999). Its 

identity as a villin-gelsolin family member (Vidali et al. 1999) was confirmed 

by partial amino acid sequencing and by isolating the corresponding cDNA 

from a pollen grain cDNA expression library. Immunodetection of villin 

revealed its co-localization with actin bundles in pollen tubes. Due to the gel-

308 


solin-like headpiece, villin may also act as an actin-severing protein, although 

this activity has not yet been demonstrated for plant villins. 

In Arabidopsis, 17 myosin encoding genes have been identified, which on 

the basis of phylogenetic analysis, fall into plant-specific myosin classes VIII 

(4 genes) and XI (13 genes). The three cloned myosins from maize and four 

from Helianthus annuus also fall into these classes (Reddy and Day 2001). The 

true structure, enzymatic properties, intracellular localization and physiology 

of plant myosin are not yet known. 

The structure and function of actin binding proteins in association with 

the reorganization of the actin cytoskeleton in plant cells at mycorrhiza formation 

has not yet been studied, but seems to require attention. In endomycorrhiza, 

rearrangement of actin cytoskeleton was observed at the colonization 

of tobacco cortical cells by endomycorrhizal fungus (Genre and Bonfante 

1997). Actin cables, typical for noncolonized cortical root cells, disappeared 

and MF polymerized to a network at the plasma membrane surrounding the 

arbuscule branches. The observed changes may be hypothesized to require 

both the activation and function of proteins involved in the reorganization of 

the actin cytoskeleton as a consequence of the perception of signals from the 

intruding fungus. 

The research on actin binding proteins in filamentous fungi seems to be 

restricted to myosin (McGoldrick et al. 1995), in Aspergillus nidulans and to 

actin-related proteins Arp1 (Plamann et al. 1994) in Neurospora crassa, 

although in yeast, Saccharomyces cerevisiae, most actin binding proteins previously 

described in plants are present and have been studied in detail 

(Ayscough 1998). In A. nidulans, the myosin I encoding gene myoA has been 

cloned and different mutational studies have indicated that MYOA is necessary 

for the maintenance of polarized growth, secretion and endocytosis 

(McGoldrick et al. 1995; Osherov et al. 1998; Yamashita and May 1998). The 

yeast S. cerevisiae and Schizosaccharomyces pombe, similar to animal cells, 

contain myosins from classes II and V in addition to those belonging to class 

I which predicts that additional myosins will be detected in future from filamentous 

fungi. 

7 Microtubule-Associated Proteins 

7.1 Plant Cells 

Microtubule-associated proteins (MAPs) are divided into structural and 

motor proteins. Several genes encoding structural plant MAPs have been isolated 

in the last few years. One of the MAP encoding genes was isolated from 

Arabidopsis, where its heat-sensitive mutation resulted in the disintegration of 

cortical microtubules in leaf, hypocotyl and root cells. The gene was named


MOR1 (Whittington et al. 2001), its product is homologous to animal MAPs 

belonging to class TOGp-XMAP215, and in plant cells, the MOR1 protein is 

essential for cortical microtubule organization (Wasteneys 2002). Proteins 

with a MW of 60–68 kDa which associate in vitro with MTs, cause their polymerization 

and bundling and induce cross-bridges between them, have been 

biochemically purified from tobacco BY-2 cells (Jiang and Sonobe 1993) and 

carrot tissue culture cells (Chan et al. 1996, 1999). These proteins are called 

MAP-65 proteins and screening of a tobacco BY-2 cell cDNA library with an 

antiserum raised against them led to the isolation of a cDNA clone named 

NtMAP65–1a. The clone encodes a 580 amino acid polypeptide with no 

homology with any known animal MAPs. Further screening of the same 

library led to the isolation of two other similar cDNA clones, NtMAP65–1b 

and NtMAP65–1c (Smertenko et al. 2000). NtMAP65–1a protein induces polymerization, 

but not bundling of the MTs in vitro, and it is localized to areas of 

overlapping microtubules in spindle and phragmoplast and on a certain subpopulation 

of stable cytoplasmic MTs (Smertenko et al. 2000; Lloyd and 

Hussey 2001). The isolation of genes encoding NtMAP65 proteins and characterization 

of the properties of the proteins in vitro and in vivo have clearly 

shown that there are plant-specific MAPs whose ability to interact and bind to 

microtubules is different from that of animal MAPs. 

The group of motor MAPs consists of kinesins and dyneins. Kinesins are 

mainly plus end-directed MT-dependent motor molecules, but minus enddirected 

kinesins are also known (Miki et al. 2001). The heavy chains of 

kinesins are formed of a motor domain with ATP and MT binding regions and 

ATP hydrolyzing activity; stalk domain with coiled-coil structure and a cargobinding 

domain. Recently, it has become obvious that kinesin and myosin 

share a common core structure in the ATP-binding region that converts 

energy from ATP into protein motion, using a similar conformational strategy 

(Vale and Milligan 2000). Kinesins are monomeric, homodimeric or homotetrameric 

(Kim and Endow 2000). Several small polypeptides can be associated 

with kinesins and they regulate the activity and function of these motor 

proteins. The position of the ATP binding domain, whether on the N- or C-terminus 

of the polypeptide, makes the protein either a plus or a minus enddirected 

motor. 

The kinesin superfamily is divided into various subfamilies including conventional 

kinesins and several kinesin-related proteins (KRPs; Kim and 

Endow 2000). Conventional kinesins are mainly involved in the (inter) intracellular 

transport of membranous organelles, whereas most KRPs function in 

nuclear division. Genes encoding KRPs have been isolated from tobacco (Mitsui 

et al. 1996; Asada et al. 1997), potato (Reddy et al. 1996b), and Arabidopsis 

(Mitsui et al. 1993; Liu et al. 1996; Reddy et al. 1996a). Of these, the best studied 

is TKRP125 (Asada et al. 1997), which is a plus end-directed motor molecule 

with an ATP hydrolyzing domain at the N-terminus. Structurally, it is a 

BimC-type kinesin that functions as a homotetramer (Kim and Endow 2000).

310 


TKRP125 is located in anaphase spindle and phragmoplast.A similar location 

has been recently shown for a TKRP125 homologue and a KRP slightly deviating 

from TKRP125 isolated from carrot tissue culture (Barroso et al. 2000). 

In plants, a subfamily of kinesin-like genes encodes proteins with a calmodulin-binding 

domain. Genes encoding members of this subfamily have been 

isolated from Arabidopsis (AKCBP; Reddy et al. 1996a), potato (PKCBP; Reddy 

et al. 1996b), and tobacco (TCK1; Wang et al. 1996). The genes encode minus 

end-directed motor proteins with the calmodulin-binding region in the 

motor domain at the very C-terminus of the polypeptide, suggesting that calcium/calmodulin 

may be involved in the regulation of the microtubule-based 

movements in plants. Genes encoding other types of minus end-directed 

motor molecules are also present in Arabidopsis and they have been named 

katA to katE (Mitsui et al. 1993, 1994). The production of minus end-directed 

KatB and KatC kinesins increases during M-phase of the cell cycle in tobacco 

BY-2 cell cultures, suggesting that mitotic spindle and phragmoplast may also 

be their site of action (Mitsui et al. 1996). Dyneins are large minus enddirected 

motors. Until now, no dynein heavy chain encoding gene has been 

detected in expressed sequence tag (EST) databases from flowering plants or 

in the recently sequenced Arabidopsis genome (Lawrence et al. 2002). 

In endomycorrhiza, the organization of MT cytoskeleton changes when the 

fungus colonizes the plant cell (Genre and Bonfante 1997). In addition, in P. 

sylvestris ectomycorrhiza cortical cells surrounded by the Hartig net seem to 

contain less cortical MTs than the noninfected cortical cells (Niini 1998). The 

reorganization of the MT cytoskeleton takes place not only in the colonized 

endomycorrhizal plant cells, but also in the cells adjacent to the colonized 

ones, and when the arbuscules have completely collapsed, the transversely 

oriented cortical MTs next to the plasma membrane reappear (Blancaflor et 

al. 2001). The reorganization of the MT cytoskeleton observed in connection 

with symbiosis requires destabilization (depolymerization) of existing cortical 

MTs, polymerization of new MT areas at the plasma membrane next to the 

colonizing fungus, and repolymerization of cortical MTs after the senescence 

of the arbuscular structure. The observed changes present a very dynamic 

behavior of MT cytoskeleton in endomycorrhiza, which probably involves the 

function of both structural and motor MAPs in plant cells. 


In filamentous fungi, the genes encoding MT-associated motor proteins 

kinesins and dyneins have caught more attention than structural MAPs. The 

first kinesin-related protein was cloned from ascomycete Aspergillus nidulans 

(Enos and Morris 1990) as a temperature-sensitive mutation that blocked 

mitosis in germinating conidia. Later studies have shown that this bimC 

(blocked in mitosis) gene encodes a protein with amino-terminal motor and


coiled-coil tail domains. The protein forms homotetramers and it is required 

for nuclear division. A motor protein has been biochemically characterized 

from Neurospora crassa (Steinberg and Schliwa 1996) and the zygomycete 

Syncephalastrum racemosum (Steinberg 1997), and the production of an antibody 

against the N. crassa protein helped to isolate the first fungal conventional 

kinesin encoding gene, Nkin (Steinberg and Schliwa 1995). Using 

probes derived from conserved regions of kinesins and screening existing 

genomic databases, has led to the isolation of conventional kinesins from 

Ustilago maydis (Lehmler et al. 1997), S. racemosum (Grummt et al. 1998), 

Nectria haematococca (Wu et al. 1998), and A. nidulans (Requena et al. 2001). 

Conventional kinesins belong to the fastest kinesins known in eukaryotic 

cells, moving as dimers on MTs with a velocity of 2.5 µm/s in in vitro gliding 

experiments, which is three- to fivefold faster than that of their animal counterparts 

(Steinberg 1997; Grummt et al. 1998). The structural features responsible 

for the high gliding velocity of fungal kinesins are not yet well understood, 

but under active investigation (Kallipolitou et al. 2001). 

The deletion of the conventional kinesin-encoding gene from any of the filamentous 

fungi investigated leads to a reduction of polarized growth and the 

size of Spitzenkörper, the secretory vesicle aggregation at the hyphal tip 

(Lehmler et al. 1997; Seiler et al. 1997; Wu et al. 1998; Seiler et al. 1999; Requena 

et al. 2001). These observations support the idea that conventional kinesin is 

involved in the transportation of components necessary for hyphal growth 

along the MTs towards the hyphal tip. It is noteworthy that in no case the 

mutation of the conventional kinesin gene has led to a complete cessation of 

growth, which implies the existence of other hyphal transportation systems, 

either based on other less efficient kinesins, or on the actin – myosin system. 

In A. nidulans, the deletion of kinesin also caused disturbance in nuclear distribution 

in the germ tube and hyphae suggesting that conventional kinesin 

plays a role in nuclear migration (Requena et al. 2001). In addition, the functional 

analysis suggested that the conventional kinesin of A. nidulans is 

involved in destabilization of MTs (Requena et al. 2001). 

The MT-associated motor cytoplasmic dynein is generally proposed to 

provide the motive force for nuclear movement in filamentous fungi (Morris 

et al. 1995; Fischer 1999; Suelmann and Fischer 2000). The heavy chain of 

cytoplasmic dynein is a large polypeptide with a region for dimerization at 

the N-terminal and globular motor domain with four ATP binding and MTbinding 

sites at the C-terminal portion of the polypeptide. In association with 

the N-terminus of the dynein heavy chain, smaller polypeptides called intermediate 

and light chains occur, which are involved in the regulation of dynein 

heavy chain activity and function (Steinberg 1998, 2000). A multi-subunit 

complex dynactin is also required for efficient MT-associated transport by 

cytoplasmic dynein. In the dynactin complex actin-related protein ARP1 is 

the most abundant and p150 Glued the largest subunit. The dynactin complex 

also includes several other polypeptides that play an important role both in

312 


the activation of the dynein motor molecule and in the binding of dynein to 

membranes (King and Schroer 2000). 

Dynein heavy chain encoding genes have been characterized from A. nidulans 

with the help of a temperature-sensitive mutation nudA that affects 

nuclear distribution, and from N. crassa as a morphological mutation with 

curly hyphae named ro-1. In the temperature-sensitive mutation of the nudA 

gene the nuclear movement from conidia into the germ tube failed and small 

hyphal colonies were formed at restrictive temperature (Xiang et al. 1994). In 

the ro-1 mutant of N. crassa, nuclear aggregates formed in the hyphae at some 

distance from the hyphal tip (Plamann et al. 1994). The cloning and sequencing 

of the nudA and ro-1 genes revealed that they both encode the cytoplasmic 

dynein heavy chains with ATP-binding motor domain at the C-terminus. 

Later, the dynein heavy chains have been identified from N. haematococca 

(Inoue et al. 1998), and U. maydis (Straube et al. 2001), by using degenerate 

oligonucleotide primers. Interestingly, this approach has led to the identification 

of a dynein with split motor domain in U. maydis, in which the N-terminus 

of the motor domain including the four ATP binding regions is encoded 

by dyn1 and the MT-binding part by dyn2 gene. Some of the ro-1-like phenotypic 

N. crassa mutants carry mutations in genes encoding subunits of the 

dynactin complex (Bruno et al. 1996). This has facilitated the isolation of ro-4 

and ro-3 genes encoding the actin-related protein,Arp1 (Plamann et al. 1994), 

and p150 Glued (Tinsley et al. 1996). Several other ro genes, such as ro-2, ro-7 and 

ro-12, encoding different subunits of the dynactin complex have been identified 

(Lee et al. 2001). 

By comparing the effects of the deletion of kinesin (Nkin), or dynein (ro-1), 

and both proteins on nuclear distribution, vesicle transport, secretion and 

vacuole formation in N. crassa hyphae, it was concluded that conventional 

kinesin indeed is responsible for the apical transport of vesicles destined for 

secretion, whereas dynein is responsible for nuclear movements and transport 

of vacuole precursors in the opposite direction. The latter phenomenon 

is suggested to support the formation of vacuoles in the basal part of N. crassa 

hyphae (Seiler et al. 1999), while conventional kinesin encoded by kin2 was 

shown to be responsible for the accumulation of vacuoles to the basal part of 

in U. maydis dikaryotic hyphae (Steinberg et al. 1998). These results indicate 

that mutations in different motor molecules may result in the same phenotype 

in fungi belonging to different taxa, the phenotype in this case being the 

vacuolation of the basal part of a hypha. Interestingly, in a dynein-deficient 

mutant of N. haematococca, astral-like arrays of cytoplasmic MTs radiating 

from nuclear spindle pole bodies were missing, which probably causes the 

clustered nuclear distribution in the mutant hyphae. In filamentous fungi, the 

astral MTs are suggested to be responsible for post-mitotic nuclear migration 

and anchoring of the interphase nuclei to membrane structures (Aist and 

Bayles 1988; Salo et al. 1989; Raudaskoski et al. 1991; Morris et al. 1995; Inoue 

et al. 1998; Raudaskoski 1998).


Recent observations on living nonsymbiotic hyphae of endomycorrhizal 

fungi (Bago et al. 1998) have revealed active nuclear movements. This phenomenon 

has been observed in anastomosing hyphae before the establishment 

of symbiosis (Giovannetti et al. 1999), and between hyphae growing out 

from infected roots (Giovannetti et al. 2001). The nuclear movements was 

shown to be accompanied by cytoplasmic flow. These observations have 

awoken interest in the mechanism responsible for the nuclear movements, 

e.g., whether it is MT- or actin cytoskeleton-dependent. In ectomycorrhizal 

hyphae mobility of vacuoles has been observed in and between adjacent cells 

of young dikaryotic hyphae of Pisolithus tinctorius (Shepherd et al. 1993), as 

well as in hyphae growing out from the Eucalyptus pilularis–P. tinctorius ectomycorrhiza 

(Allaway and Ashford 2001). The vacuole motility includes tubule 

extensions and retractions, undulating movements, projections of tubules 

from spherical vacuoles and fusions of tubules with spherical vacuoles and 

other tubules (Cole et al. 1998). The motile vacuolar system has a high phosphorus, 

nitrogen and potassium content. A comparable content of ions also 

occurs in the hyphal vacuoles of the mycorrhizal sheath and the Hartig net 

(Ashford et al. 1999). This suggests that the tubular vacuolar system is perhaps 

involved in the transfer of phosphorus and nitrogen, both in short distance 

transport from cell to cell and in long distance transport from hyphal tips to 

the plant/fungal interface (Cole et al. 1998). Interestingly, the motility of tubular 

vacuolar system is dependent on an intact MT cytoskeleton (Hyde et al. 

1999). 

8 Cell Cycle and Cytoskeleton in Mycorrhiza 

In P. sylvestris ectomycorrhiza, an increase in the number of short roots was 

observed in the root region that was in contact with the fungus (Niini and 

Raudaskoski 1998). Similarly, in Eucalyptus grandis- Pisolithus ectomycorrhiza, 

the number of root tips increased in seedlings inoculated with the symbiotic 

fungus (Burgess et al. 1995). In the colonized short roots of P. sylvestris 

the fungus also activates the cell divisions in the root tip leading to the formation 

of dichotomous and coralloid mycorrhiza (Niini 1998), unique for 

pines. The increase in short root number and the formation of dichotomous 

and coralloid short roots suggests that the presence of fungal mycelium activates 

the cell cycle in the pericycle for short root production and in the root 

tip meristem at the formation of dichotomous and coralloid short roots. In 

contrast, in endomycorrhiza the plant cell cycle appears not to be activated, 

but the chromatin of the plant nucleus in the root cortical cells decondensates 

which leads to nuclear hypertrophy (Berta et al. 1990). 

Activation of the cell cycle in the root cortex occurs when root nodules are 

formed in the legume plants associated with Rhizobium bacteria (Mylona et 

al. 1995), or in the roots of woody plants at actinorhizal nodule formation

314 


(Berg 1999). The integration of T-DNA from an unmodified Ti-plasmid of 

Agrobacterium tumefaciens into the plant genome induces tumor formation 

in plants by activating the plant cell cycle. Agrobacterium T-DNA is known to 

encode enzymes necessary for cytokinin and auxin synthesis, which in turn 

promote tumor formation via reactivation of the cell cycle in Agrobacteriuminfected 

plants (Sheng and Citovsky 1996). In Rhizobium it has been shown 

that the Nod-factors, the signal molecules produced by Rhizobium,are necessary 

for reactivation of the cell cycle. Nod factors are shown to elicit local 

reduction in plant auxin transport and auxin accumulation, which probably 

stimulates root cortical cell division (Mathesius et al. 1998; Boot et al. 1999). 

Formation of a nodule-like structure can also be induced by treatment with 

auxin transport inhibitors (Hirsch and Fang 1994). 

Early experiments by Slankis (1949) using isolated P. sylvestris roots and 

exogenous auxin (IAA) treatment showed that it was possible to obtain mycorrhiza-like 

dichotomous branching without the fungus. Some ectomycorrhizal 

fungi including S. bovinus have been shown to be able to produce IAA 

or cytokinin (Beyrle 1995). The effect of auxin on root branching and on the 

formation of dichotomous and coralloid short roots has been recently reinvestigated 

in several pine species by using auxin and auxin transport 

inhibitors (Kaska et al. 1999). This research indicated that auxin induces a 

marked increase in the formation of lateral roots while the treatment with 

auxin transport inhibitors induced dichotomous and coralloid short roots. 

The relationship between the hormone treatments or the effect of the fungal 

hyphae on the expression of cell cycle regulating genes in Pinus has not 

been investigated. In plants as in other eukaryotic organisms, the cyclins and 

cyclin-dependent kinases (CDKs) are key regulators of cell cycle (Mironov et 

al. 1999). Both A- and B-type cyclins are expressed during mitosis, the A-type 

cyclins being also active during S-phase progression. D-type cyclins have an 

important role in the G1 to S phase transition. Transcription of D-type cyclins 

can be induced by the phytohormone cytokinin or by sucrose, which means 

that mitogenic signals stimulate transcription of D-cyclins and modulate cell 

cycle activity. Recently, a new D-type cyclin has been identified in Arabidopsis 

that is expressed during lateral root formation and the expression of which is 

stimulated by sucrose (De Veylder et al. 1999). 

In higher-plant cells, the MT organization is regulated during the cell cycle 

(Vantard et al. 2000). Especially G2-phase and mitosis are accompanied by 

changes in the distribution of MTs. In early G2 the cortical interphase MTs 

accumulate to form the preprophase band (PPB) which precisely marks the 

future site for the cell plate formation. The breakdown of the nuclear envelope 

leads to the PPB disassembly and polymerization of spindle MTs. After 

karyokinesis the phragmoplast is formed at the site marked at G2 phase by the 

PPB. The phragmoplast consists of a ring of anti-parallel, inter-digitating 

microtubules and actin filaments, which are thought to transport the vesicles 

containing the material for cell plate construction. A close relationship

etween the function of cell cycle and MT cytoskeleton is suggested by the 

association of cell cycle-regulating components with specific MT arrays in 

dividing plant cells. B-cyclins and cyclin-dependent kinase Cdc2a are 

immunolocalized to preprophase band, mitotic spindle and chromosomes, 

while A1 cyclin is detected at cytokinesis in association with phragmoplast 

MTs. At interphase, Cdc2a kinase and A cyclin are localized in the nucleus 

(John et al. 2001). 

In ectomycorrhiza, the association of plant root cells with the fungus leads 

probably to mitogenic stimuli that activate the cell cycle in pericycle and root 

meristematic tissue, seen in Pinus as production of short roots with dichotomous 

and coralloid tips. Cell cycle activation involves the regulation of MT 

dynamics so that the transition of one MT array to another is achieved during 

different cell cycle phases and also at cellular differentiation. 

The Nobel Prize in Physiology or Medicine 2001 was awarded to L.H. 

Hartwell, R.T. Hunt and Sir Paul M. Nurse for their discoveries of key regulators 

of the cell cycle. The yeasts Schizosaccharomyces pombe and Saccharomyces 

cerevisiae were important model organisms for the prize winning 

research. In spite of this, very little is known about cell cycle regulation in filamentous 

fungi. The central genes have only been isolated and their function 

studied in the filamentous fungus, A. nidulans (Ye et al. 1999). In future, the 

isolation and characterization of the genes involved in regulation of the cell 

cycle (Tarkka 2001) and the cytoskeleton from both symbiotic partners, tree 

roots and fungal hyphae, will provide us with new insight about the development 

of the ectomycorrhizal association. 

9 Cytoskeletal Research Methods 


In the previous sections the use of in situ hybridization (Uribe et al. 1998), and 

GUS-reporter gene constructs (An et al. 1996a, b; Chu et al. 1998; Kandasamy 

et al. 2001), were described in localization transcripts of actin and tubulin 

gene products or for visualization of their activity in different plant tissues, 

even in endomycorrhiza (Bonfante et al. 1996). The application of these methods 

requires that the genes encoding tubulin or actin, and a transformation 

system are available. When actins or tubulins are detected at the protein level 

by Western blotting (Raudaskoski et al. 1987), commercially produced antibodies 

are applied. When commercial antibodies are used, the possibility 

always exists that some of the tubulin or actin proteins are not recognized. 

Therefore, efforts have been made to produce antibodies specific for the different 

actin or tubulin proteins (McLean et al. 1990). The availability of such 

antibodies would also be helpful for investigating the distribution of the different 

cytoskeletal proteins in plant and fungal cells by immunocytochemical 

methods.

316 


9.1 Indirect Immunofluorescence Microscopy 

Most antibodies that lead to signal detection in immunoblots can also be used 

to visualize the intracellular structure of actin filaments or MTs by indirect 

immunofluorescence (IIF) microscopy (Fig. 1A, B, E) as discussed in previous 

sections. IIF is based on the use of two antibodies, primary and secondary. 

The primary antibody is raised against a cytoskeletal protein or its peptide 

while the fluorochrome-labeled secondary antibody is able to recognize the 

primary antibody. If the primary antibody is monoclonal, it binds to a single 

epitope of the target protein.A polyclonal primary antibody binds several epitopes 

of the target protein. The immunocytochemical methods can also be 

applied at the electron microscopic level, although then the secondary antibody 

has to be labeled with gold particles. MFs are often visualized by fluorochrome-labeled 

phallotoxins which bind specifically to filamentous actin 

(Barak et al. 1980). 

The successful visualization of MFs and MTs in root cells and fungal 

hyphae requires a fixative that penetrates quickly into the plant tissue and stabilizes 

the cytoskeletal elements in the polymerized form. A method that 

stops the metabolism of the cell even more quickly than chemical fixative and 

preserves the structure of MTs and MFs in fungal and plant cells is cryo-fixation 

(Raudaskoski et al. 1987, 1991, 1994; Åström et al. 1994; Lancelle et al. 

1997; Bourett et al. 1998). Pretreatment of plant cells with an MF-stabilizing 

agent MBS (3-maleimidobenzoiz acid N-hydroxysuccinimide) ester has also 

been used (Sonobe and Shibaoka 1989; Miller et al. 1999; de Ruijter et al. 

2001). Although the method leads to well-preserved MFs, the MBS pretreatment 

may also cause redistribution of the target molecules and the pretreatment 

may lead to less flexible images of actin cytoskeleton. 

The penetration of the antibody into the plant or fungal cell requires enzymatic 

digestion of the cell wall and permeabilization of the plasma membrane 

with a detergent after fixation. During the enzymatic digestion, the protease 

activity in the enzyme preparation has to be reduced by protease inhibitors 

and/or by adding 1 % bovine serum albumin in the digestion buffer. For enzymatic 

treatment and for labeling with the antibodies, cells or cell rows can be 

isolated or cut manually from the fixed material (Uetake et al. 1997; Uetake 

and Peterson 1997, 1998), which can also be embedded in 15 % agar (Genre 

and Bonfante 1997, 1998) or cyanoacrylate (Blancaflor et al. 2001) for sectioning. 

The visualization of cytoskeletal elements also succeeds well when the 

fixed plant roots are embedded in Steedsman’s wax and then sectioned 

(Baluška et al. 1992, 1995, 1997, 2001; Olinevich et al. 2001). Before labeling 

with the primary antibody the sections are dewaxed in ethanol, passed 

through a graded ethanol series diluted with PBS and either treated with a cell 

wall-degrading enzyme (Baluška et al. 1992), or not (Balu_ka et al. 2001).With 

these methods good preservation and visualization of cytoskeletal components 

is achieved in the roots of herbaceous plants, even with endomycor-

hiza. Cells with well-preserved cytoskeletal structures can then be examined 

either by a regular fluorescence microscope or by a laser scanning confocal 

microscope. 

In ectomycorrhiza, the thick hydrophobic sheath around the root formed 

by fungal hyphae inhibits the penetration of the fixative or rapid freezing of 

the fungal and plant cells. The fixation of ectomycorrhizal root in situ under 

vacuum facilitates and speeds up the penetration of the fixative into the ectomycorrhizal 

root (Timonen et al. 1993; Niini and Raudaskoski 1998). In ectomycorrhiza 

it is necessary to prepare sections from the fixed roots and until 

now, the best results in immunolocalization of cytoskeletal elements have 

been achieved by using cryosections (Fig. 1A, B; Niini and Raudaskoski 1998). 

No success in the visualization of MTs or MFs has yet been achieved by 

embedding the Pinus short roots or ectomycorrhizal roots in wax. 

9.2 Microinjection Method 

Microinjection of fluorescent-labeled phalloidin or tubulin has been used to 

visualize MFs (Schmit and Lambert 1990; Zhang et al. 1993; Cleary 1995; Kim 

et al. 1995; Miller et al.1996) and MTs (Zhang et al. 1990; Yuan et al. 1994) in 

living plant cells. However, the visualization of cytoskeletal elements succeeds 

with microinjection only in a few plant cell types, such as stamen hair cells of 

Tradescantia (Zhang et al. 1993), or epidermal cells of leaves (Yuan et al. 1994), 

while cytoskeletal elements in narrow fungal hyphae are not easily studied 

with this method. 

9.3 Green Fluorescence Protein Technique 


The MFs and MTs in plant and fungal cells have been successfully visualized 

with the help of green fluorescence protein (GFP) fused to actin, tubulin or to 

a cytoskeleton-associated protein. In plant cells, tubulin-GFP fusion protein 

has been used to visualize MTs in different Arabidopsis tissues (Ueda et al. 

1999; Whittington et al. 2001). Transient expression of the MT binding 

domain of mammalian MAP4 labeled with GFP and transgenic plants with 

the same construct have been used for visualization of the MT organization in 

epidermal cells of fava bean (Marc et al.1998) and in Arabidopsis root cells 

(Bao et al. 2001). Fusion of GFP to the actin-binding domain of talin has led to 

visualization of actin cytoskeleton transiently in tobacco BY-2 suspension 

cells (Kost et al. 1998) and pollen tubes (Kost et al. 1998, 1999a, b; Fu et al. 

2001). Constitutive expression of the same construct visualized actin 

cytoskeleton in different tissues of Arabidopsis including root hairs (Kost et 

al. 1998; Baluška et al. 2000; Baluška and Volkmann 2002). Recently, both MTs 

and MFs were visualized in living onion epidermal cells by using the MT

318 


binding domain of MAP4 and actin binding domain of talin fused with different 

spectral variants of GFP (Blancaflor 2002). 

MTs (Straight et al. 1997) and actin (Doyle and Botstein 1996) of yeast have 

also been successfully visualized by GFP-tubulin and -actin fusions as well as 

the MTs in the hyphae of Aspergillus nidulans (Han et al. 2001). Recently, it has 

been shown that GFP can be used as a reporter of a gene function in the 

hyphae of filamentous basidiomycetes (Lugones et al. 1999; Ma et al. 2001), 

although no fungal protein has yet been localized by fusion to GFP in these 

fungi. In future it seems possible, at least in endomycorrhiza forming plants, 

to visualize the effect of fungal growth on the plant cytoskeleton in living root 

cells by GFP-fusion proteins. The application of GFP for visualization of 

cytoskeletal elements in endo- and ectomycorrhizal fungi during vegetative 

or symbiotic growth requires the development of an efficient transformation 

system for these fungi (Pardo et al. 2002). 

Acknowledgements. The authors thank Erja Laitiainen (M.Sc.) for technical help in 

preparing the manuscript. The work was supported by a grant from the Academy of Finland 

to M.R. 


Aist JR, Bayles CJ (1988) Video motion analysis of mitotic events in living cells of the 

fungus Fusarium solani. Cell Motil Cytoskel 9:325–336 

Allaway WG, Ashford AE (2001) Motile tubular vacuoles in extramatrical mycelium and 

sheath hyphae of ectomycorrhizal systems. Protoplasma 215:218–225 

An Y-Q, McDowell JM, Huang S, McKinney EC, Chambliss S, Meagher RB (1996a) Strong, 

constitutive expression of the Arabidopsis ACT2/ACT8 actin subclass in vegetative tissues. 

Plant J 10:107–121 

An Y-Q, Huang S, McDowell JM, McKinney EC, Meagher RB (1996b) Conserved expression 

of the Arabidopsis ACT1 and ACT3 actin subclass in organ primordia and mature 

pollen. Plant Cell 8:15–30 

Asada T, Kuriyama R, Shibaoka H (1997) TKRP125, a kinesin-related protein involved in 

the centrosome-independent organization of the cytokinetic apparatus in tobacco 

BY-2 cells. J Cell Sci 110:179–189 

Ashford AE, Vesk PA, Orlovich DA, Markovina A-L, Allaway WG (1999) Dispersed 

polyphosphate in fungal vacuoles in Eucalyptus pilularis/Pisolithus tinctorius ectomycorrhizas. 

Fungal Genet Biol 28:21–33 

Åström H, Giovannetti M, Raudaskoski M (1994) Cytoskeletal components in the arbuscular 

mycorrhizal fungus Glomus mosseae. Mol Plant-Microb Interact 7:309–312 

Ayscough KR (1998) In vivo functions of actin-binding proteins. Curr Opin Cell Biol 

10:102–111 

Bago B, Zipfel W, Williams RM, Chamberland H, Lafontaine JG, Webb WW, Piché Y 

(1998) In vivo studies on the nuclear behavior of the arbuscular mycorrhizal fungus 

Gigaspora rosea grown under axenic conditions. Protoplasma 203:1–15 

Baluška F,Volkmann D (2002) Pictures in cell biology.Actin-driven polar growth of plant 

cells. Trends Cell Biol 12:14


Baluška F, Parker JS, Barlow PW (1992) Specific patterns of cortical and endoplasmic 

microtubules associated with cell growth and tissue differentiation in roots of maize 

(Zea mays L.). J Cell Biol 103:191–200 

Baluška F, Barlow PW, Hauskrecht M, Kubica Š, Parker JS, Volkmann D (1995) Microtubule 

arrays in maize root cells. Interplay between the cytoskeleton, nuclear organization 

and post-mitotic cellular growth patterns. New Phytol 130:177–192 

Baluška F, Kreibaum A, Vitha S, Parker JS, Barlow PW, Sievers A (1997) Central root cap 

cells are depleted of endoplasmic microtubules and actin microfilament bundles: 

implications for their role as gravity-sensing statocytes. Protoplasma 196:212–223 

Baluška F, Salaj J, Mathur J, Braun M, Jasper F, Samaj J, Chua N-H, Barlow PW,Volkmann 

D (2000) Root hair formation: F-actin-dependent tip growth is initiated by local 

assembly of profilin-supported F-actin meshworks accumulated within expansinenriched 

bulges. Dev Biol 227:618–632 

Baluška F, Jasik J, Edelmann HG, Salajová T, Volkmann D (2001) Latrunculin B-induced 

plant dwarfism: plant cell elongation is F-actin-dependent. Dev Biol 231:113–124 

Bamburg JR (1999) Proteins of the ADF/cofilin family: essential regulators of actin 

dynamics. Annu Rev Cell Dev Biol 15:185–230 

Bao Y, Kost, B, Chua N-H (2001) Reduced expression of a-tubulin genes in Arabidopsis 

thaliana specifically affects root growth and morphology, root hair development and 

root gravitropism. Plant J 28:145–157 

Barak LS,Yocum RR, Nothnagel EA,Webb WW (1980) Fluorescence staining of the actin 

cytoskeleton in living cells with 7-nitrobenz-2-oxa-1,3-diazolephallacidin. Proc Natl 

Acad Sci USA 77:980–984 

Barlow PW, Baluška F (2000) Cytoskeletal perspectives on root growth and morphogenesis. 

Annu Rev Plant Physiol Plant Mol Biol 51:289–322 

Barroso C, Chan J, Allan V, Doonan J, Hussey P, Lloyd C (2000) Two kinesin-related proteins 

associated with the cold-stable cytoskeleton of carrot cells: characterization of a 

novel kinesin, DcKRP120–2. Plant J 24:859–868 

Berg HR (1999) Cytoplasmic bridge formation in the nodule apex of actinorhizal root 

nodules. Can J Bot 77:1351–1357 

Berta G, Sgorbati S, Soler V, Fusconi A, Trotta A, Citterio A, Bottone MG, Sparvoli E, Scannerini 

S (1990) Variations in chromatin structure in host nuclei of a vesicular arbuscular 

mycorrhiza. New Phytol 114:199–203 

Beyrle H (1995) The role of phytohormones in the function and biology of mycorrhizas. 

In: Varma A, Hock B (eds) Mycorrhiza. Structure, function, molecular biology and 


Blancaflor EB (2002) The cytoskeleton and gravitropism in higher plants. J Plant Growth 

Regul 21:120–135 

Blancaflor EB, Zhao L, Harrison MJ (2001) Microtubule organization in root cells of 

Medicago truncatula during development of an arbuscular mycorrhizal symbiosis 

with Glomus versiforme. Protoplasma 217:154–165 

Bonfante P, Perotto S (1995) Strategies of arbuscular mycorrhizal fungi when infecting 

host plants. New Phytol 130:3–21 

Bonfante P, Bergero R, Uribe X, Romera C, Rigau J, Puigdomènech P (1996) Transcriptional 

activation of a maize a-tubulin gene in mycorrhizal maize and transgenic 

tobacco plants. Plant J 9:737–743 

Boot KJM, Van Brussel AAN, Tak T, Spaink HP, Kijne JW (1999) Lipochitin oligosaccharides 

from Rhizobium leguminosarum bv.viciae reduce auxin transport capacity in 

Vicia sativa subsp. nigra roots. Mol Plant-Microb Interact 12:839–844 

Bourett TM, Czymmek KJ, Howard RJ (1998) An improved method for affinity probe 

localization in whole cells of filamentous fungi. Fungal Gen Biol 24:3–13

320 


Bruno KS, Tinsley JH, Minke PF, Plamann M (1996) Genetic interactions among cytoplasmic 

dynein, dynactin, and nuclear distribution mutants of Neurospora crassa. 

Proc Natl Acad Sci USA 93:4775–4780 

Burgess T, Laurent P, Dell B, Malajczuk N, Martin F (1995) Effect of fungal-isolate aggressivity 

on the biosynthesis of symbiosis-related polypeptides in differentiating eucalypt 

ectomycorrhizas. Planta 195:408–417 

Bütehorn B, Gianinazzi-Pearson V, Franken P (1999) Quantification of b-tubulin RNA 

expression during asymbiotic and symbiotic development of the arbuscular mycorrhizal 

fungus Glomus mosseae. Mycol Res 103:360–364 

Canut H, Carrasco A, Galaud J-P, Cassan C, Bouyssou H, Vita N, Ferrara P, Pont-Lezica R 

(1998) High affinity RGD-binding sites at the plasma membrane of Arabidopsis 

thaliana links the cell wall. Plant J 16:63–71 

Chaffey N, Barlow P, Barnett J (2000) A cytoskeletal basis for wood formation in 

angiosperm trees: the involvement of microfilaments. Planta 210:890–896 

Chan J, Rutten T, Lloyd C (1996) Isolation of microtubule-associated proteins from carrot 

cytoskeletons: a 120 kDa map decorates all four microtubule arrays and the 

nucleus. Plant J 10:251–259 

Chan J, Jensen CG, Jensen LCW, Bush M, Lloyd CW (1999) The 65-kDa carrot microtubule-associated 

protein forms regularly arranged filamentous cross-bridges 

between microtubules. Pro Natl Acad Sci USA 96:14931–14936 

Chu B, Wilson TJ, McCune-Zierath C, Snustad DP, Carter JV (1998) Two b-tubulin genes, 

TUB1 and TUB8, ofArabidopsis exhibit largely nonoverlapping patterns of expression. 


Cleary AL (1995) F-actin redistributions at the division site in living Tradescantia stomatal 

complexes as revealed by microinjection of rhodamine-phalloidin. Protoplasma 

185:152–165 

Cole L, Orlovich DA, Ashford AE (1998) Structure, function, and motility of vacuoles in 

filamentous fungi. Fungal Genet Biol 24:86–100 

Cooper JA, Schafer DA (2000) Control of actin assembly and disassembly at filament 

ends. Curr Opin Cell Biol 12:97–103 

Daniels RH, Bokoch GM (1999) p21-activated protein kinase: a crucial component of 

morphological signaling? TIBS 24:350–355 

de Ruijter NCA, Esseling JJ, Emons AMC (2001) The roles of calcium and the actin 

cytoskeleton in regulation of root hair tip growth by rhizobial signal molecules. In: 

Geitmann A, Cresti M, Heath IB (eds) Cell biology of plant and fungal tip growth. IOS 

Press, NATO Sci Ser 328:55–67 

De Veylder L, de Almeida Engler J, Burssens S, Manevski A, Lescure B, van Montagu M, 

Engler G, Inze D (1999) A new D-type cyclin of Arabidopsis thaliana expressed during 

lateral root primordial formation. Planta 208:453–462 

Diaz EC, Martin F, Tagu D (1996) Eucalypt a-tubulin: cDNA cloning and increased level 

of transcripts in ectomycorrhizal root system. Plant Mol Biol 31:905–910 

Dong C-H, Kost B, Xia G, Chua N-H (2001) Molecular identification and characterization 

of the Arabidopsis AtADF1, AtADF5 and AtADF6 genes. Plant Mol Biol 45:517–527 

Doyle T, Botstein D (1996) Movement of yeast cortical actin cytoskeleton visualized in 

vivo. Proc Natl Acad Sci USA 93:3886–3891 

Dutcher SK (2001) The tubulin fraternity: alpha to eta. Curr Opin Cell Biol 13:49–54 

Enos AP, Morris NR (1990) Mutation of a gene that encodes a kinesin-like protein blocks 

nuclear division in A. nidulans. Cell 60:1019–1027 

Euteneuer U, McIntosh JR (1980) Polarity of midbody and phragmoplast microtubules. 

J Cell Biol 87:509–515 

Fischer R (1999) Nuclear movement in filamentous fungi. FEMS Microbiol Rev 

23:38–69


Fowler TJ, Desimone SM, Mitton MF, Kurjan J, Raper CA (1999) Multiple sex pheromones 

and receptors of a mushroom-producing fungus elicit mating in yeast. Mol Biol Cell 

10:2559–2572 

Franken P, Lapopin L, Meyer-Gauen G, Gianinazzi-Pearson V (1997) RNA accumulation 

and genes expressed in spores of the arbuscular mycorrhizal fungus, Gigaspora rosea. 

Mycol 89:293–297 

Fu Y,Wu G,Yang Z (2001) Rop GTPase-dependent dynamics of tip-localized F-actin controls 

tip growth in pollen tubes. J Cell Biol 152:1019–1032 

Genre A, Bonfante P (1997) A mycorrhizal fungus changes microtubule orientation in 

tobacco root cells. Protoplasma 199:30–38 

Genre A, Bonfante P (1998) Actin versus tubulin configuration in arbuscule-containing 

cells from mycorrhizal tobacco roots. New Phytol 140:745–752 

Giovannetti M, Azzolini D, Citernesi AS (1999) Anastomosis formation and nuclear and 

protoplasmic exchange in arbuscular mycorrhizal fungi. Appl Environ Microbiol 

65:5571–5575 

Giovannetti M, Fortuna P, Citernesi AS, Morini S, Nuti MP (2001) The occurrence of 

anastomosis formation and nuclear exchange in intact arbuscular mycorrhizal networks. 

New Phytol 151:717–724 

Goode BL, Drubin DG, Barnes G (2000) Functional cooperation between the microtubule 

and actin cytoskeletons. Curr Opin Cell Biol 12:63–71 

Gorfer M, Tarkka MT, Hanif M, Pardo AG, Laitiainen E, Raudaskoski M (2001) Characterization 

of small GTPases Cdc42 and Rac and the relationship between Cdc42 and 

actin cytoskeleton in vegetative and ectomycorrhizal hyphae of Suillus bovinus. 

MPMI 14:135–144 

Grummt M, Pistor S, Lottspeich F, Schliwa M (1998) Cloning and functional expression 

of a ‘fast’ fungal kinesin. FEBS Lett 427:79–84 

Hahn M, Mendgen K (2001) Signal and nutrient exchange at biotrophic plant-fungus 

interfaces. Curr Opin Plant Biol 4:322–327 

Han G, Liu B, Zhang J, Zuo W, Morris NR, Xiang X (2001) The Aspergillus cytoplasmic 

dynein heavy chain and NUDF localize to microtubule ends and affect microtubule 

dynamics. Curr Biol 11:719–724 

Heath IB, Gupta G, Bai S (2000) Plasma membrane-adjacent actin filaments, but not 

microtubules, are essential for both polarization and hyphal tip morphogenesis in 

Saprolegnia ferax and Neurospora crassa. Fungal Genet Biol 30:45–62 

Hepler PK, Vidali L, Cheung AY (2001) Polarized cell growth in higher plants. Annu Rev 

Cell Dev Biol 17:159–187 

Hirsch AM, Fang Y (1994) Plant hormones and nodulation: what’s the connection? Plant 

Mol Biol 26:5–9 

Huang S, An Y-Q, McDowell JM, McKinney EC, Meagher RB (1997) The Arabidopsis 

ACT11 actin gene is strongly expressed in tissues of the emerging inflorescence, 

pollen, and developing ovules. Plant Mol Biol 33:125–139 

Hussey PJ, Haas N, Hunsperger J, Larkin J, Snustad DP, Silflow CD (1990) The b-tubulin 

gene family in Zea mays: two differentially expressed b-tubulin genes. Plant Mol Biol 

15:957–972 

Hussey PJ,Yuan M, Calder G, Khan S, Lloyd CW (1998) Microinjection of pollen-specific 

actin-depolymerizing factor, ZmADF1, reorientates F-actin strands in Tradescantia 

stamen hair cells. Plant J 14:353–357 

Hyde GJ, Davies D, Perasso L, Cole L, Ashford AE (1999) Microtubules, but not actin 

microfilaments, regulate vacuole motility and morphology in hyphae of Pisolithus 

tinctorius. Cell Motil Cytoskel 42:114–124 

Inoue S, Turgeon BG, Yoder OC, Aist JR (1998) Role of fungal dynein in hyphal growth, 

microtubule organization, spindle pole body motility and nuclear migration. J Cell 

Sci 111:1555–1566

322 


Janssen M, Hunte C, Schulz M, Schnabl H (1996) Tissue specification and intracellular 

distribution of actin isoforms in Vicia faba L. Protoplasma 191:158–163 

Jiang C-J, Sonobe S (1993) Identification and preliminary characterization of a 65 kDa 

higher-plant microtubule-associated protein. J Cell Sci 105:891–901 

Jiang C-J,Weeds AG, Hussey PJ (1997) The maize actin-depolymerizing factor, ZmADF3, 

redistributes to the growing tip of elongating root hairs and can be induced to 

translocate into the nucleus with actin. Plant J 12:1035–1043 

John PCL, Mews M, Moore R (2001) Cyclin/Cdk complexes: their involvement in cell 

cycle progression and mitotic division. Protoplasma 216:119–142 

Johnson DJ (1999) Cdc42: an essential rho-type GTPase controlling eukaryotic cell 

polarity. Microbiol Mol Biol Rev 63:54–105 

Johnson DJ, Pringle JR (1990) Molecular characterization of CDC42, a Saccharomyces 

cerevisiae gene involved in the development of cell polarity. J Cell Biol 111:143–152 

Joshi HC, Palevitz, BA (1996) g-Tubulin and microtubule organization in plants. Trends 

Cell Biol 6:41–44 

Joshi HC, Palacios MJ, McNamara L, Cleveland DW (1992) g-Tubulin is a centrosomal 

protein required for cell cycle-dependent microtubule nucleation. Nature 356:80–83 

Joyce CM, Villemur R, Snustad DP, Silflow CD (1992) Tubulin gene expression in maize 

(Zea mays L.). Change in isotype expression along the developmental axis of seedling 

root. J Mol Biol 227:97–107 

Kallipolitou A, Deluca D, Majdic U, Lakämper S, Cross R, Meyhöfer E, Moroder L, Schliwa 

M, Woehlke G (2001) Unusual properties of the fungal conventional kinesin neck 

domain from Neurospora crassa. EMBO J 20:6226–6235 

Kandasamy MK, Gilliland LU, McKinney EC, Meagher RB (2001) One plant actin isovariant, 

ACT7, is induced by auxin and required for normal callus formation. Plant 

Cell 13:1541–1554 

Kaska DD, Myllylä R, Cooper JB (1999) Auxin transport inhibitors act through ethylene 

to regulate dichotomous branching of lateral root meristems in pine. New Phytol 

142:49–58 

Kerr GP, Carter JV (1990a) Tubulin isotypes in rye roots are altered during cold acclimation. 


Kilmartin JV,Adams AEM (1984) Structural rearrangements of tubulin and actin during 

the cell cycle of the yeast Saccharomyces. J Cell Biol 98:922–933 

Kim AJ, Endow SA (2000) A kinesin family tree. J Cell Sci 113:3681–3682 

Kim M, Hepler PK, Eun S-O, Ha KS, Lee Y (1995) Actin filaments in mature guard cells are 

radially distributed and involved in stomatal movement. Plant Physiol 109:1077–1084 

King SJ, Schroer TA (2000) Dynactin increases the processivity of the cytoplasmic 

dynein motor. Nat Cell Biol 2:20–24 

Klahre U, Chua N (1999) The Arabidopsis actin-related protein 2 (AtARP2) promoter 

directs expression in xylem precursor cells and pollen. Plant Mol Biol 41:65–73 

Klahre U, Friederich E, Kost B, Louvard D, Chua N-H (2000) Villin-like actin-binding 

proteins are expressed ubiquitously in Arabidopsis. Plant Physiol 122:35–47 

Ko KS, McCulloch CA (2000) Partners in protection: interdependence of cytoskeleton 

and plasma membrane in adaptations to applied forces. J Membr Biol 174:85–95 

Kopczak SD, Haas NA, Hussey PJ, Silflow CD, Snustad DP (1992) The small genome of 

Arabidopsis contains at least six expressed a-tubulin genes. Plant Cell 4:539–547 

Kost B, Spielhofer P, Chua N-H (1998) A GFP-mouse talin fusion protein labels plant 

actin filaments in vivo and visualizes the actin cytoskeleton in growing pollen tubes. 

Plant J 16:393–401 

Kost B, Lemichez E, Spielhofer P, Hong Y, Tolias K, Carpenter C, Chua N-H (1999a) Rac 

homologues and compartmentalized phosphatidylinositol 4,5-bisphosphate act in a 

common pathway to regulate polar pollen tube growth. J Cell Biol 145:317–330


Kost B, Mathur J, Chua N-H (1999b) Cytoskeleton in plant development. Curr Opin Cell 

Biol 2:462–470 

Kottke I, Oberwinkler F (1987) The cellular structure of the Hartig net: coenocytic and 

transfer cell-like organization. Nord J Bot 7:85–95 

Lancelle SA, Cresti M, Hepler PK (1997) Growth inhibition and recovery in freeze-substituted 

Lilium longiflorum pollen tubes: structural effects of caffeine. Protoplasma 

196:21–33 

Lawrence CJ, Malmberg RL, Muszynski MG, Dawe RK (2002) Maximum likelihood 

methods reveal conservation of function among closely related kinesin families. J Mol 

Evol 54:42–53 

Lee IH, Kumar S, Plamann M (2001) Null mutants of the Neurospora actin-related protein 

1 pointed-end complex show distinct phenotypes. Mol Biol Cell 12:2195–2206 

Lehmler C, Steinberg G, Snetselaar KM, Schliwa M, Kahmann R, Bölker M (1997) Identification 

of a motor protein required for filamentous growth in Ustilago maydis. 

EMBO J 16:3464–3473 

Lemichez E, Wu Y, Sanchez J-P, Mettouchi A, Mathur J, Chua N-H (2001) Inactivation of 

AtRac1 by abscisic acid is essential for stomatal closure. Genes Dev 15:1808–1816 

Li H, Shen J-J, Zheng Z-L, Lin Y, Yang Z (2001) The Rop GTPase switch controls multiple 

developmental processes in Arabidopsis. Plant Physiol 126:670–684 

Liu B, Marc J, Joshi HC, Palevitz BA (1993) A g-tubulin-related protein associated with 

the microtubule arrays of higher plants in a cell cycle-dependent manner. J Cell Sci 

104:1217–1228 

Liu B, Cyr RJ, Palevitz BA (1996) A kinesin-like protein, KatAp, in the cells of Arabidopsis 

and other plants. Plant Cell 8:119–132 

Lloyd C, Hussey P (2001) Microtubule-associated proteins in plants – why we need a 

map. Nat Rev Mol Cell Biol 2:40–47 

Lopez I, Anthony RG, Maciver SK, Jiang C-J, Khan S, Weeds AG, Hussey PJ (1996) Pollen 

specific expression of maize genes encoding actin depolymerizing factor-like proteins. 


Lugones LG, Scholtmeijer K, Klootwijk R, Wessels JGH (1999) Introns are necessary for 

mRNA accumulation in Schizophyllum commune. Mol Microbiol 32:681–689 

Ma B, Mayfield MB, Gold MH (2001) The green fluorescent protein gene functions as a 

reporter of gene expression in Phanerochaete chrysosporium.Appl Environ Microbiol 

67:948–955 

Marc J, Granger CL, Brincat J, Fisher DD, Kao T-H, McCubbin AG, Cyr RJ (1998) A GFP- 

MAP4 reporter gene for visualizing cortical microtubule rearrangements in living 

epidermal cells. Plant Cell 10:1927–1939 

Mathesius U, Schlaman HRM, Spaink HP, Sautter C, Rolfe BG, Djordjevic MA (1998) 

Auxin transport inhibition precedes root nodule formation in white clover roots and 

is regulated by flavonoids and derivatives of chitin oligosaccharides. Plant J 14:23–34 

Matsubara Y, Uetake Y, Peterson RL (1999) Entry and colonization of Asparagus officinalis 

roots by arbuscular mycorrhizal fungi with emphasis on changes in host microtubules. 

Can J Bot 77:1159–1167 

McGoldrick CA, Gruver C, May GS (1995) myoA of Aspergillus nidulans encodes an 

essential myosin I required for secretion and polarized growth. J Cell Biol 128:577– 

587 

McLean BG, Eubanks S, Meagher RB (1990) Tissue-specific expression of divergent 

actins in soybean root. Plant Cell 2:335–344 

Meagher RB, McKinney EC,Vitale AV (1999) The evolution of new structures: clues from 

plant cytoskeletal genes. Trends Genet 15:278–284 

Mews M, Sek FJ, Moore R, Volkmann D, Gunning BES, John PCL (1997) Mitotic cyclin 

distribution during maize cell division: implications for the sequence diversity and 

function of cyclins in plants. Protoplasma 200:128–145

324 


Miki H, Setou M, Kaneshiro K, Hirokawa N (2001) All kinesin superfamily protein, KIF, 

genes in mouse and human. Pro Natl Acad Sci USA 98:7004–7011 

Miller DD, Lancelle SA, Hepler PK (1996) Actin microfilaments do not form a dense network 

in Lilium longiflorum pollen tube tips. Protoplasma 195:123–132 

Miller DD, de Ruijter NCA, Bisseling T, Emons AMC (1999) The role of actin in root hair 

morphogenesis: studies with lipochito-oligosaccharide as a growth stimulator and 

cytochalasin as an actin perturbing drug. Plant J 17:141–154 

Mironov V, de Veylder L, van Montagu M, Inze D (1999) Cyclin-dependent kinases and 

cell division in plants – the nexus. Plant Cell 11:509–521 

Mitsui H, Yamaguchi-Shinozaki K, Shinozaki K, Nishikawa K, Takahashi H (1993) Identification 

of a gene family (kat) encoding kinesin-like proteins in Arabidopsis 

thaliana and the characterization of secondary structure of KatA. Mol Gen Genet 

238:362–368 

Mitsui H, Nakatani K, Yamaguchi-Shinozaki K, Shinozaki K, Nishikawa K, Takahashi H 

(1994) Sequencing and characterization of the kinesin-related genes katB and katC of 

Arabidopsis thaliana. Plant Mol Biol 25:865–876 

Mitsui H, Hasezawa S, Nagata T, Takahashi H (1996) Cell cycle-dependent accumulation 

of a kinesin-like protein, KatB/C, in synchronized tobacco BY-2 cells. Plant Mol Biol 

30:177–181 

Molendijk AJ, Bischoff F, Rajendrakumar CSV, Friml J, Braun M, Gilroy S, Palme K (2001) 

Arabidopsis thaliana Rop GTPases are localized to tips of root hairs and control polar 

growth. EMBO J 20:2779–2788 

Montoliu L, Rigau J, Puigdomènech P (1989) A tandem of a-tubulin genes preferentially 

expressed in radicular tissues from Zea mays. Plant Mol Biol 14:1–15 

Morris NR, Xiang X, Beckwith SM (1995) Nuclear migration advances in fungi. Trends 

Cell Biol 5:278–282 

Mullins RD (2000) How WASP-family proteins and the Arp2/3 complex convert intracellular 

signals into cytoskeletal structures. Curr Opin Cell Biol 12:91–96 

Mylona P, Pawlowski K, Bisseling T (1995) Symbiotic nitrogen fixation. Plant Cell 

7:869–885 

Neer EJ (1995) Heterotrimeric G proteins: organizers of transmembrane signals. Cell 

80:249–257 

Niini S (1998) Growth pattern and cytoskeleton in Suillus bovinus hyphae, Pinus 

sylvestris roots and in Pinus sylvestris–Suillus bovinus ectomycorrhiza. Dissertationes 

Biocentri Viikki Universitatis Helsingiensis 16 

Niini S, Raudaskoski M (1998) Growth patterns in non-mycorrhizal and mycorrhizal 

short roots of Pinus sylvestris. Symbiosis 25:101–114 

Niini SS, Tarkka MT, Raudaskoski M (1996) Tubulin and actin protein patterns in Scots 

pine (Pinus sylvestris) roots and developing ectomycorrhiza with Suillus bovinus. 

Physiol Plant 96:186–192 

Nuoffer C, Balch WE (1994) GTPases: multifunctional molecular switches regulating 

vesicular traffic. Annu Rev Biochem 63:949–990 

Oakley BR, Oakley CE, Yoon Y, Jung MK (1990) g-Tubulin is a component of the spindle 

pole body that is essential for microtubule function in Aspergillus nidulans. Cell 

61:1289–1301 

Olesnicky NS, Brown AJ, Dowell SJ, Casselton LA (1999) A constitutively active G-protein-coupled 

receptor causes mating self-compatibility in the mushroom Coprinus. 

EMBO J 18:2756–2763 

Olinevich OV, Khokhlova LP, Raudaskoski M (2001) Effect of abscisic acid and cold acclimation 

on the cytoskeletal and phosphorylated proteins in different cultivars of 

Triticum aestivum L. Cell Biol Int 24:365–373 

Osherov N, Yamashita RA, Chung YS, May GS (1998) Structural requirements for in vivo 

myosin I function in Aspergillus nidulans. J Biol Chem. 273:27017–27025


Overall RL, Dibbayawan TP, Blackman LM (2001) Intercellular alignments of the plant 

cytoskeleton. J Plant Growth Regul 20:162–169 

Pardo AG, Hanif M, Raudaskoski M, Gorfer M (2002) Genetic transformation of ectomycorrhizal 

fungi mediated by Agrobacterium tumefaciens. Mycol Res 106:132–137 

Pérez HE, Sánchez N, Vidali L, Hernández JM, Lara M, Sánchez F (1994) Actin isoforms 

in non-infected roots and symbiotic root nodules of Phaseolus vulgaris L. Planta 

193:51–56 

Pesacreta TC, Carley WW, Webb WW, Parthasarathy MV (1982) F-actin in conifer roots. 


Peterson RL, Bonfante P, Faccio A, Uetake Y (1996) The interface between fungal hyphae 

and orchid protocorm cells. Can J Bot 74:1861–1870 

Piché Y, Peterson RL, Ackerley CA (1983) Early development of ectomycorrhizal short 

roots of pine. Scan Electron Microsc III:1467–1474 

Plamann M, Minke PF, Tinsley JH, Bruno KS (1994) Cytoplasmic dynein and actinrelated 

protein Arp1 are required for normal nuclear distribution in filamentous 

fungi. J Cell Biol 127:139–149 

Ramachandran S, Christensen HEM, Ishimaru Y, Dong C-H, Chao-Ming W, Cleary AL, 

Chua N-H (2000) Profilin plays a role in cell elongation, cell shape maintenance, and 

flowering in Arabidopsis. Plant Physiol 124:1637–1647 

Raudaskoski M (1998) The relationship between B-mating-type genes and nuclear 

migration in Schizophyllum commune. Fungal Genet Biol 24:207–227 

Raudaskoski M, Åström H, Penttilä K, Virtanen I, Louhelainen J (1987) Role of microtubule 

cytoskeleton in pollen tubes: an immunocytochemical and ultrastructural 

approach. Biol Cell 61:177–188 

Raudaskoski M, Rupe_ I, Timonen S (1991) Immunofluorescence microscopy of the 

cytoskeleton in filamentous fungi after quick-freezing and low-temperature fixation. 

Exp Mycol 15:167–173 

Raudaskoski M, Mao W-Z, Yli-Mattila T (1994) Microtubule cytoskeleton in hyphal 

growth. Response to nocodazole in a sensitive and a tolerant strain of the homobasidiomycete 

Schizophyllum commune. Eur J Cell Biol 64:131–141 

Raudaskoski M, Färdig M, Uuskallio M (1998) The structure of pheromone and receptor 

gene transcripts in Ba1 and Bb1 mating-type loci of Schizophyllum commune.In:Van 

Griensven LJLD,Visser J (eds) Proceedings of the fourth meeting on the genetics and 

cellular biology of basidiomycetes. Mushroom Experimental Station, Horst, Netherlands, 

pp 119–124 

Raudaskoski M, Pardo AG, Tarkka MT, Gorfer M, Hanif M, Laitiainen E (2001) Small 

GTPases, cytoskeleton and signal transduction in filamentous homobasidiomycetes. 

In: Geitmann A, Cresti M, Heath IB (eds) Cell biology of plant and fungal tip growth. 

IOS Press, NATO Sci Ser 328:123–136 

Reddy ASN, Day IS (2001) Analysis of the myosins encoded in the recently completed 

Arabidopsis thaliana genome sequence. Genome Biol 2:research0024.1–0024.17 

Reddy ASN, Safadi F, Narasimhulu SB, Golovkin M, Hu X (1996a) A novel plant calmodulin-binding 

protein with a kinesin heavy chain motor domain. J Biol Chem 271: 

7052–7060 

Reddy ASN, Narasimhulu SB, Safadi F, Golovkin M (1996b) A plant kinesin heavy chainlike 

protein is a calmodulin-binding protein. Plant J 10:9–21 

Requena N,Alberti-Segui C,Winzenburg E, Horn C, Schliwa M, Philippsen P, Liese R, Fischer 

R (2001) Genetic evidence for a microtubule-destabilizing effect of conventional 

kinesin and analysis of its consequences for the control of nuclear distribution in 

Aspergillus nidulans. Mol Microbiol 42:121–132 

Robertson NF (1954) Studies on the mycorrhiza of Pinus sylvestris. I. The pattern of 

development of mycorrhizal roots and its significance for experimental studies. New 

Phytol 53:253–283

326 


Rosewarne GM, Barker SJ, Smith SE, Smith FA, Schachtman DP (1999) A Lycopersicon 

esculentum phosphate transporter (LePT1) involved in phosphorus uptake from a 

vesicular-arbuscular mycorrhizal fungus. New Phytol 144:507–516 

Runeberg P,Virtanen I, Raudaskoski M (1986) Cytoskeletal elements in the hyphae of the 

homobasidiomycete Schizophyllum commune visualized with indirect immunofluorescence 

and NBD-phallacidin. Eur J Cell Biol 41:25–32 

Russo P, Juuti JT, Raudaskoski M (1992) Cloning, sequence and expression of a b-tubulin-encoding 

gene in the homobasidiomycete Schizophyllum commune. Gene 

119:175–182 

Salo V, Niini SS, Virtanen I, Raudaskoski M (1989) Comparative immunocytochemistry 

of the cytoskeleton in filamentous fungi with dikaryotic and multinucleate hyphae. J 

Cell Sci 94:11–24 

Schmit A-C, Lambert A-M (1990) Microinjected fluorescent phalloidin in vivo reveals 

the F-actin dynamics and assembly in higher plant mitotic cells. Plant Cell 2:129–138 

Schmidt A, Hall MN (1998) Signaling to the actin cytoskeleton. Annu Rev Cell Dev Biol 

14:305–338 

Seiler S, Nargang FE, Steinberg G, Schliwa M (1997) Kinesin is essential for cell morphogenesis 

and polarized secretion in Neurospora crassa. EMBO J 16:3025–3034 

Seiler S, Plamann M, Schliwa M (1999) Kinesin and dynein mutants provide novel 

insights into the roles of vesicle traffic during cell morphogenesis in Neurospora.Curr 

Biol 9:779–785 

Sheng J, Citovsky V (1996) Agrobacterium-plant cell DNA transport: Have virulence proteins, 

will travel. Plant Cell 8:1699–1710 

Shepherd VA, Orlovich DA,Ashford AE (1993) Cell-to-cell transport via motile tubules in 

growing hyphae of a fungus. J Cell Sci 105:1173–1178 

Slankis V (1949) Wirkung von alpha-indolylessigsäure auf die dichotomische Verzweigung 

isolierter wurzeln von Pinus sylvestris. Sven Bot Tidskr 43:603–607 

Smertenko AP, Jiang C-J, Simmons NJ,Weeds AG, Davies DR, Hussey PJ (1998) Ser6 in the 

maize actin-depolymerizing factor, ZmADF3, is phosphorylated by a calcium-stimulated 

protein kinase and is essential for the control of functional activity. Plant J 

14:187–193 

Smertenko A, Saleh N, Igarashi H, Mori H, Hauser-Hahn I, Jiang C-J, Sonobe S, Lloyd CW, 

Hussey P (2000) A new class of microtubule-associated proteins in plants. Nat Cell 

Biol 2:750–753 

Smith SE, Read DJ (1997) Mycorrhizal symbiosis. Second edition. Academic Press, San 

Diego, CA 

Snustad DP, Haas NA, Kopczak SD, Silflow CD (1992) The small genome of Arabidopsis 

contains at least nine expressed b-tubulin genes. Plant Cell 4:549–556 

Sonobe S, Shibaoka H (1989) Cortical fine actin filaments in higher plant cells visualized 

by rhodamine-phalloidin after pretreatment with m-maleimidobenzoyl N-hydroxysuccinimide 

ester. Protoplasma 148:80–86 

Staiger CJ (2000) Signaling to the actin cytoskeleton in plants. Annu Rev Plant Physiol 


Stamatas GN, McIntire LV (2001) Rapid flow-induced responses in endothelial cells. 

Biotechnol Prog 17:383–402 

Steinberg G (1997) A kinesin-like mechanoenzyme from the zygomycete Syncephalastrum 

racemosum shares biochemical similarities with conventional kinesin from 

Neurospora crassa. Eur J Cell Biol 73:124–131 

Steinberg G (1998) Organelle transport and molecular motors in fungi. Fungal Genet 

Biol 24:161–177 

Steinberg G (2000) The cellular roles of molecular motors in fungi. Trends Microbiol 

8:162–168


Steinberg G, Schliwa M (1995) The Neurospora organelle motor: a distant relative of conventional 

kinesin with unconventional properties. Mol Biol Cell 6:1605–1618 

Steinberg G, Schliwa M (1996) Characterization of the biophysical and motility properties 

of kinesin from the fungus Neurospora crassa. J Biol Chem 271:7516–7521 

Steinberg G, Schliwa M, Lehmler C, Bölker M, Kahmann R, McIntosh JR (1998) Kinesin 

from the plant pathogenic fungus Ustilago maydis is involved in vacuole formation 

and cytoplasmic migration. J Cell Sci 111:2235–2246 

Straight AF, Marshall WF, Sedat JW, Murray AW (1997) Mitosis in living budding yeast: 

anaphase a but no metaphase plate. Science 277:574–578 

Straube A, Enard W, Berner A, Wedlich-Söldner R, Kahmann R, Steinberg G (2001) A 

split motor domain in a cytoplasmic dynein. EMBO J 20:5091–5100 

Suelmann R, Fischer R (2000) Nuclear migration in fungi – different motors at work. Res 


Sundaram S, Kim SJ, Suzuki H, Mcquattie CJ, Hiremah ST, Podila GK (2001) Isolation and 

characterization of a symbiosis-regulated ras from the ectomycorrhizal fungus Laccaria 

bicolour. MPMI 14:618–628 

Tarkka MT (2001) Developmentally regulated proteins in Scots pine roots and ectomycorrhiza. 

PhD Thesis, University of Helsinki, Finland. Yliopistopaino, Helsinki, Finland. 

ISBN 951–45–9645–5 

Tarkka MT, Niini SS, Raudaskoski M (1998) Developmentally regulated proteins during 

differentiation of root system and ectomycorrhiza in Scots pine (Pinus sylvestris) 

with Suillus bovinus. Physiol Plant 104:449–455 

Tarkka MT, Vasara R, Gorfer M, Raudaskoski M (2000) Molecular characterization of 

actin genes from homobasidiomycetes: two different actin genes from Schizophyllum 

commune and Suillus bovinus. Gene 251:27–35 

Tarkka MT, Nyman TA, Kalkkinen N, Raudaskoski M (2001) Scots pine expresses shortroot-specific 

peroxidases during development. Eur J Biochem 268:86–92 

Timonen S, Finlay RD, Söderström B, Raudaskoski M (1993) Identification of cytoskeletal 

components in pine ectomycorrhizas. New Phytol 124:83–92 

Timonen S, Söderström B, Raudaskoski M (1996) Dynamics of cytoskeletal proteins in 

developing pine ectomycorrhiza. Mycorrhiza 6:423–429 

Tinsley JH, Minke PF, Bruno KS, Plamann M (1996) p150 Glued , the largest subunit of the 

dynactin complex, is nonessential in Neurospora but required for nuclear distribution. 

Mol Biol Cell 7:731–742 

Ueda K, Matsuyama T, Hashimoto T (1999) Visualization of microtubules in living cells 

of transgenic Arabidopsis thaliana. Protoplasma 206:201–206 

Uetake Y, Peterson RI (1997) Changes in actin filament arrays in protocorm cells of the 

orchid species, Spiranthes sinensis, induced by the symbiotic fungus Ceratobasidium 

cornigerum. Can J Bot 75:1661–1669 

Uetake Y, Peterson RI (1998) Association between microtubules and symbiotic fungal 

hyphae in protocorm cells of the orchid species, Spiranthes sinensis. New Phytol 

140:715–722 

Uetake Y, Farquhar ML, Peterson RL (1997) Changes in microtubule arrays in symbiotic 

orchid protocorms during fungal colonization and senescence. New Phytol 135:701– 

709 

Uribe X, Torres MA, Capellades M, Puigdomènech P, Rigau J (1998) Maize a-tubulin 

genes are expressed according to specific patterns of cell differentiation. Plant Mol 

Biol 37:1069–1078 

Vaillancourt LJ, Raudaskoski M, Specht CA, Raper CA (1997) Multiple genes encoding 

pheromones and a pheromone receptor define the Bb1 mating-type specificity in 

Schizophyllum commune. Genetics 146:541–551 

Vale RD, Milligan RA (2000) The way things move: looking under the hood of molecular 

motor proteins. Science 288:88–95

328 


Vantard M, Cowling R, Delichere C (2000) Cell cycle regulation of the microtubular 

cytoskeleton. Plant Mol Biol 43:691–703 

Versele M, Lemaire K, Thevelein JM (2001) Sex and sugar in yeast: two distinct GPCR 

systems. EMBO Rep 2:574–579 

Vidali L,Yokota E, Cheung AY, Shimmen T, Hepler PK (1999) The 135 kDa actin-bundling 

protein from Lilium longiflorum pollen is the plant homologue of villin. Protoplasma 

209:283–291 

Villemur R, Joyce CM, Haas NA, Goddard RH, Kopczak SD, Hussey PJ, Snustad DP, Silflow 

CD (1992) Alpha-tubulin gene family of maize (Zea mays L.). Evidence for two 

ancient alpha-tubulin genes in plants. J Mol Biol 227:81–96 

Villemur R, Haas NA, Joyce CM, Snustad DP, Silflow CD (1994) Characterization of four 

new b-tubulin genes and their expression during male flower development in maize 

(Zea mays L.). Plant Mol Biol 24:295–315 

Wang W, Takezawa D, Narasimhulu SB, Reddy ASN, Poovaiah BW (1996) A novel kinesinlike 

protein with a calmodulin-binding domain. Plant Mol Biol 31:87–100 

Wasteneys GO (2000) The cytoskeleton and growth polarity. Curr Opin Plant Biol 

3:503–511 

Wasteneys GO (2002) Microtubule organization in the green kingdom: chaos or selforder? 

J Cell Sci 115:1345–1354 

Wendland J, Vaillancourt LJ, Hegner J, Lengeler KB, Laddison KJ, Specht CA, Raper CA, 

Kothe E (1995) The mating-type locus Ba1of Schizophyllum commune contains a 

pheromone receptor gene and putative pheromone genes. EMBO J 14:5271–5278 

Whittington AT, Vugrek O, Wei KJ, Hasenbein NG, Sugimoto K, Rashbrooke MC, 

Wasteneys GO (2001) MOR1 is essential for organizing cortical microtubules in 

plants. Nature 411:610–613 

Wilcox HE (1968) Morphological studies of the roots of red pine, Pinus resinosa. II. Fungal 

colonization of roots and the development of mycorrhizae. Am J Bot 55:688–700 

Wood V, Gwilliam R, Rajandream MA, Lyne M, Lyne R, Stewart A, Sgouros J, Peat N, 

Hayles J, Baker S, Basham D, Bowman S, Brooks K, Brown D, Brown S, Chillingworth 

T, Churcher C, Collins M, Connor R, Cronin A, Davis P, Feltwell T, Fraser A, Gentles S, 

Goble A, Hamlin N, Harris D, Hidalgo J, Hodgson G, Holroyd S, Hornsby T, Howarth 

S, Huckle EJ, Hunt S, Jagels K, James K, Jones L, Jones M, Leather S, McDonald S, 

McLean J, Mooney P, Moule S, Mungall K, Murphy L, Niblett D, Odell C, Oliver K, 

O’Neil S, Pearson D, Quail MA, Rabbinowitsch E, Rutherford K, Rutter S, Saunders D, 

Seeger K, Sharp S, Skelton J, Simmonds M, Squares R, Squares S, Stevens K, Taylor K, 

Taylor RG, Tivey A, Walsh S, Warren T, Whitehead S, Woodward J,Volckaert G, Aert R, 

Robben J, Grymonprez B,Weltjens I,Vanstreels E, Rieger M, Schafer M, Muller-Auer S, 

Gabel C, Fuchs M, Fritzc C, Holzer E, Moestl D, Hilbert H, Borzym K, Langer I, Beck A, 

Lehrach H, Reinhardt R, Pohl TM, Eger P, Zimmermann W, Wedler H, Wambutt R, 

Purnelle B, Goffeau A, Cadieu E, Dreano S, Gloux S, Lelaure V, Mottier S, Galibert F, 

Aves SJ, Xiang Z, Hunt C, Moore K, Hurst SM, Lucas M, Rochet M, Gaillardin C, Tallada 

VA, Garzon A, Thode G, Daga RR, Cruzado L, Jimenez J, Sanchez M, del Rey F, Benito 

J, Dominguez A, Revuelta JL, Moreno S, Armstrong J, Forsburg SL, Cerrutti L, Lowe T, 

McCombie WR, Paulsen I, Potashkin J, Shpakovski GV, Ussery D, Barrell BG, Nurse P 

(2002) The genome sequence of Schizosaccharomyces pombe. Nature 415:871–880 

Wu Q, Sandrock TM, Turgeon BG, Yoder OC, Wirsel SG, Aist JR (1998) A fungal kinesin 

required for organelle motility, hyphal growth, and morphogenesis. Mol Biol Cell 

9:89–101 

Xiang X, Beckwith SM, Morris NR (1994) Cytoplasmic dynein is involved in nuclear 

migration in Aspergillus nidulans. Proc Natl Acad Sci USA 91:2100–2104 

Yamashita RA, May GS (1998) Constitutive activation of endocytosis by mutation of 

myoA, the myosin I gene of Aspergillus nidulans. J Biol Chem 273:14644–14648


Ye XS, McGuire SL, Wolkow T, Tang A, Fincher R, Hamer JE, Osmani SA (1999) Interaction 

between developmental and cell cycle regulators is required to morphogenesis in 

Aspergillus nidulans. EMBO J 18:6994–7001 

Yokota E, Shimmen T (1999) The 135-kDa actin-bundling protein from lily pollen tubes 

arranges F-actin into bundles with uniform polarity. Planta 209:264–266 

Yokota E, Takahara K, Shimmen T (1998) Actin-bundling protein isolated from pollen 

tubes of lily: biochemical and immunocytochemical characterization. Plant Physiol 

116:1421–1429 

Yuan M, Shaw PJ, Warn RM, Lloyd CW (1994) Dynamic reorientation of cortical microtubules, 

from transverse to longitudinal, in living plant cells. Proc Natl Acad Sci USA 

91:6050–6053 

Zhang DH, Callaham DA, Hepler PK (1990) Regulation of anaphase chromosome 

motion in Tradescantia stamen hair cells by calcium and related signalling agents. J 

Cell Biol 111:171–182 

Zhang D, Wadsworth P, Hepler PK (1993) Dynamics of microfilaments are similar, but 

distinct from microtubules during cytokinesis in living, dividing plant cells. Cell 

Motil Cytoskeleton 24:151–155 

Zheng Z-L, Yang Z (2000) The Rop GTPase switch turns on polar growth in pollen. 

Trends Plant Sci 5:298–303

19 Functional Diversity of Arbuscular Mycorrhizal 

Fungi on Root Surfaces 



Arbuscular mycorrhizal (AM) fungi can promote host plant growth by 

increasing phosphorus (P) uptake from soil while simultaneously obtaining 

carbon (C) from the photosynthate of the host plant. However, reductions in 

plant growth associated with AM fungi have also been recorded (e.g. Graham 

and Eissenstat 1998; Graham and Abbott 2000) which can be linked to carbon 

and phosphorus exchange (Koide and Elliott 1989). Both growth promotion 

and reduction depend upon the particular plant–fungal combination (Johnson 

et al. 1997) and soil conditions. P and C exchange between the host plant 

and mycorrhizal fungus also depends on environmental and biological variables 

(Jakobsen 1998). The combined effects of P uptake and transfer to the 

plant and C release to the fungus are important considerations for the functioning 

of arbuscular mycorrhizas. While the mechanisms of nutrient 

exchange between AM fungi and the host plant remain speculative (Schwab et 

al. 1991; Saito 2000; Smith et al. 2001), more is known about the plant genes 

involved in P transfer (Harrison 1999) than the fungal genes (Rausch et al. 

2001). Symbiotic exchange of nutrients in arbuscular mycorrhizas, especially 

transport along hyphae and transfer to the host plant, has been reviewed 

(Saito 2000; Smith et al. 2001) and it has been pointed out that the mechanisms 

of symbiotic nutrient exchange may be more diverse than originally 

expected (Saito 2000). 

AM fungi occur in soil and in association with roots as communities of 

organisms that may simultaneously interact with the roots of one or several 

co-existing plant species. Species of AM fungi differ in their mode of colonisation 

and their capacity to form hyphae in soil and within the root (Abbott et 

al. 1992). 

Although hyphal characteristics may be distinctive for some fungi (Dodd 

et al. 2000), they are not usually present as discrete organisms and are difficult 

to distinguish from one another within and on the surface of roots. Although 

the fungi may have markedly different characteristics, they appear to function 




332 


in a similar manner, but with different levels of efficiency depending on their 

abundance as well as their intrinsic characteristics. Furthermore, their symbiotic 

response depends on environmental conditions and the relative abundance 

of other AM fungi associated with the roots of the same plant. 

The purpose of this review is to discuss the functional diversity of AM 

fungi and its significance in the context of interactions at root surfaces and 

the potential consequences of this for plant growth and plant community 

structure. 

2 Mycorrhiza Formation and Ecological Specificity 

Arbuscular mycorrhizal fungi live symbiotically with the roots of approximately 

60 % of terrestrial plants (Brundrett and Abbott 2002). About 200 

species of AM fungi have been described so far in the Glomales, but unequivocal 

evidence of their capacity to form mycorrhizas is not available for many 

species (Walker and Trappe 1993). A putative zygosporic stage has only been 

reported for the life cycle of Gigaspora decipiens (Tommerup and Sivasithamparam 

1990). Knowledge of genetic diversity of AM fungi is poorly defined. 

Associations between hosts and symbionts are usually non-specific in AM 

symbiosis (Mosse 1975). Most of the evidence for non-specificity in these 

associations has been demonstrated by inoculating roots with propagules of 

species of AM fungi in separate pot cultures (Smith and Read 1997). However, 

it may be possible for a plant grown in field soil to be preferentially colonised 

by one of the species of the AM fungi present. This could result from differences 

in the infectivity and/or quantity of propagules of each species, or from 

differences in the susceptibility of roots to colonisation by each fungus. This 

phenomenon has been defined as ‘ecological specificity’ by McGonigle and 

Fitter (1990). 

Arbuscular mycorrhizal fungi are obligate symbionts and they depend on 

the formation of mycorrhizas to take up carbon from the root for completing 

their life cycles. Fungal growth does not continue much in axenic culture in 

the absence of the host plant. The obligate status of AM fungi, the coenocytic 

nature of their spores (Becard and Pfeffer 1993) and the lack of demonstration 

of recombination (Rosendahl and Taylor 1997) limit the opportunities 

for fundamental research on their interactions with plant roots. Molecular 

techniques based on DNA analysis provide a number of possibilities to 

develop specific probes for AM fungi for determining phylogenetic relationships 

and diversity and for their identification in soil and plant roots (Jacquot 

et al. 2000).

19 Functional Diversity of Arbuscular Mycorrhizal Fungi on Root Surfaces 333 

2.1 Establishment of the Symbiosis 

The establishment of a functional symbiosis between AM fungi and host 

plants involves a sequence of recognition events between the fungus and the 

plant (Giovanetti et al. 1993a; Giovannetti and Sbrana 1998). Mycorrhizal 

colonisation has several phases (Tester et al. 1987; Gianinazzi-Pearson and 

Gianinazzi 1989) including spore germination, hyphal growth in soil, hyphal 

attachment to roots, appressorium formation, intraradical penetration and 

intraradical growth involving the formation of arbuscules and coils (Smith 

and Read 1997; Wegel et al. 1998). The developmental stages of fungal interaction 

with the plant are associated with plant signals inducing gene expression 

and recognition between the two partners of the symbiosis (Giovanetti and 

Sbrana 1998). 

2.2 Spore Germination and Hyphal Growth 

Spores of AM fungi can germinate under appropriate storage and environmental 

conditions. A host signal is not necessary for this step in the life cycle. 

The first response of a fungus to a host root is stimulation of hyphal growth. 

It is well documented that host roots can promote hyphal growth of AM fungi 

and induce changes in hyphal growth pattern and morphology by stimulating 

branching and inducing the formation of hyphal fans (Giovannetti et al. 

1993b). Hyphal contact with the surface of the host root occurs at random and 

the increased branching of a fungus near the root surface would increase the 

probability of root interception. Root architecture and root density also influence 

the likelihood of root and hypha interception (Abbott and Robson 1984). 

2.3 Role of Plant Root Exudates 

Although hyphal growth can be increased in response to root exudates from 

host plants (Mosse 1962, 1988; Koske and Gemma 1992), there is no direct evidence 

for the release of inhibitory compounds from non-host roots. Indirect 

evidence has raised this as a possibility (Ocampo et al. 1980; Holliday 1989). 

The exudates from non-hosts appeared to lack factors which induced hyphal 

growth (Giovannetti and Sbrana 1998; Nagahashi 2000). 

Hyphal elongation of G. fasciculatus was enhanced by exudates from Trifolium 

repens when the plants were grown under phosphate-deficient conditions 

(Elias and Safir 1987). This effect was reduced when phosphorus was 

added. Root exudates from both non-mycorrhizal and mycorrhizal peas 

inhibited hyphal growth of Gigaspora margarita (Balaji et al. 1994). In contrast, 

mycorrhizal Pisum sativum and its non-mycorrhizal isogenic mutant 

did not form root exudates that had different effects on Glomus mossae (Gio-

334 


vanetti et al. 1993a). Generally, the amount, type and form of root exudates 

have the potential to influence fungal growth before the fungus meets the root 

as well as after the hyphae contact the root. In addition, the formation of 

appressoria and hyphal penetration of the root surface may involve recognition 

processes (Koske and Gemma 1992). 

3 Functioning of Arbuscular Mycorrhizas in Nutrient 

Exchange 

Nutrient exchange in arbuscular mycorrhizas can occur between the hyphae 

and host root cells. External hyphae penetrate the root surface and proceed 

into the root cortex forming arbuscules and coils (Saito 2000). The arbuscule 

is a complex intracellular hyphal structure formed in Arum-type mycorrhizas 

(Smith and Smith 1997). It has been assumed that the arbuscule is a likely site 

for symbiotic nutrient transfer in Arum-type mycorrhizas (Bonfante-Fasolo 

1987; Smith and Smith 1997), but carbon exchange may also occur across 

walls of non-arbuscular hyphae (Smith and Read 1997). Variation in arbuscule 

development in Arum-type mycorrhizas could reflect different characteristics 

of roots and fungi (Smith and Dickson 1991). 

Arbuscular mycorrhizal fungi with a range in demand for phosphorus have 

been isolated from south-western Australia. In particular, an isolate of S. 

calospora either increased or decreased plant growth depending on the phosphate 

status of the soil (Thomson et al. 1986). This fungus has a high demand 

for carbon from the plant relative to P transfer (Pearson et al. 1994), and forms 

considerably more external hyphae than some other fungi that are highly 

effective at enhancing P uptake across a range of P supply (Abbott and Robson 

1985). Indeed, under some circumstances, it can be inefficient in P transfer 

(Smith et al. 2000). In addition, S. calospora can interact with Glomus invermaium 

during colonisation of roots, restricting growth of G. invermaium in 

other parts of the same root system during some stages of its colonisation 

(Pearson et al. 1993). However, colonisation and activity of S. calospora can be 

stopped once sporulation has taken place (Pearson and Schweiger 1994), 

resulting in resumption of colonisation (and presumably P uptake and transfer) 

by G. invermaium. This example demonstrates the dynamics of activities 

of two AM fungi on root surfaces, but the extent to which this occurs generally 

for all isolates of these or other species is not known. Unfortunately, relatively 

few isolates have been investigated for most species of AM fungi in any environment 

so the extent to which generalisations can be made, even for species, 

is unknown (Morton and Bentivenga 1994). 

In field soils, as several species of AM fungi would generally be involved in 

co-colonisation of roots, P uptake and transfer into the plant might be 

affected if one fungus interfered with colonisation by another. The outcome 

would depend on the functional diversity of the species present, i.e. their effi-


ciency in P uptake and transfer. Circumstantial evidence of seasonal variation 

in the function of different species of AM fungi present in a woodland environment 

has been clearly demonstrated (Merryweather and Fitter 1998b). 

There have been few direct measurements of P uptake by communities of AM 

fungi (Jakobsen et al. 2001), but it is difficult to attribute P transferred to the 

activity of a particular fungus within a community. 

The relative abundance of AM fungi in field-grown plants can be manipulated 

by environmental and management processes that occur in the field, 

where dual AM fungal occupancy of roots is the norm (Merryweather and Fitter 

1998a). With manipulation of P supply, the important observations of 

Thomson et al. (1986) can be used to identify the P status of the plant at which 

there is a point of transition from growth enhancement to growth depression 

in plants colonised by S. calospora. In contrast, G. invermaium did not display 

such a physiological transition in this study. 

3.1 Metabolic Activity During Mycorrhiza Formation 

Changes in metabolic activities during mycorrhiza formation provide evidence 

for hypotheses related to biochemical mechanisms of C and P exchange 

between symbionts (Saito 2000). These have mostly been examined by comparing 

mycorrhizal and non-mycorrhizal roots, but without identifying the 

mechanisms of nutrient exchange. Changes in quantity and concentration of 

soluble carbohydrates in roots have not shown consistent trends with mycorrhizal 

colonisation (Pakovsky 1989; McArthur and Knowels 1993; Pearson et 

al. 1994; Solaiman and Saito 1997). 

The localisation of alkaline phosphatase (ALPase) in arbuscular hyphae 

was observed by histochemical study (Saito 1995). ALPase has also been 

located in vacuoles in intraradical hyphae of AM fungi (Gianinazzi et al. 

1979), and its activity varied with environmental conditions (Jabaji-Hare et al. 

1990). A correlation between the number of ALPase-active arbuscules and P 

uptake by mycorrhizal plants indicates that arbuscular ALPase plays a significant 

role in phosphorus transformation from the AM fungus to the host plant 

(Tijssen et al. 1983). Histochemical observation of intraradical hyphae has 

located lipid and polyphosphate (polyP) granules in hyphae. Although polyP 

molecules are likely to play an important role in P translocation, their existence 

has been contradicted. Recently, a successive extraction method showed 

that a granular fraction of polyP was contained in hyphae of Gigaspora margarita 

(Solaiman et al. 1999). The contribution of polyP was calculated from 

these data and it has been concluded that the contribution is not significant 

(Smith et al. 2001).

336 


3.2 Gene Expression During Mycorrhiza Formation 

A phosphate (Pi) transporter GvPT was isolated from the AM fungus Glomus 

versiforme that resembles the yeast high-affinity Pi transporter PHO84 and 

the plant Pht1 transporter (Harrison and van Buuren 1995). This transporter 

gene is thought to be active in P uptake by fungal hyphae outside roots. The 

molecular mechanisms at the fungus–root interface involved in Pi efflux from 

the fungus into the apoplastic space and subsequently, into the cortical cells of 

the root are not well understood. It would be interesting to know whether 

these transporters comprise new protein families and to identify their site of 

expression. Observations so far are not conclusive. For example, Liu et al. 

(1998) concluded that the expression patterns of MtPT1 and MtPT2 cloned 

from Medicago truncatula roots are not consistent with their involvement at 

the symbiotic interface. Similarly, expression of the tomato Pi transporter 

gene LePT1 has been observed in cortical cells having arbuscules and it was 

thought to be involved in the uptake of Pi by the plant from the fungus (Rosewarne 

et al. 1999). However, LePT1 transcript levels were less in mycorrhizal 

compared to non-mycorrhizal plants.A Pi transporter (MtPT1) from M. truncatula 

roots was consistent with its role in P transport at the root/soil interface 

(Chiou et al. 2001). 

The expression of a plant H + -ATPase gene was increased in barley roots 

colonised by G. intraradices (Murphy et al. 1997). This demonstrated the presence 

of a high H + -ATPase activity in the periarbuscular membrane of mycorrhizal 

roots. The isolated hexose transporter was of host origin, and in situ 

hybridisation showed it was expressed in cortical cells in the area colonised by 

the AM fungus (Harrison 1996). Therefore, the efflux of sugar from the host 

cell to the apoplast may be mediated by the transporter. Gene expression has 

been demonstrated for P transporters (Harrison and van Buuren 1995, Rosewarne 

et al. 1999), but the genes involved in carbon flows have not been identified. 

A model for the pathways and regulation of P uptake in mycorrhizal 

plants was proposed by Rosewarne et al. (1999) based upon expression of P 

transporters in uncolonised roots (Liu et al. 1998), mycorrhizal roots (Rosewarne 

et al. 1999) and mycorrhizal fungi (Harrison and van Buuren 1995). 

According to the proposed model, cloning of the arbuscule-specific Pi transporter 

genes is required to investigate the mechanisms of P transfer in arbuscules 

in comparison with other parts of the symbiosis (such as intraradical 

and external hyphae), but phosphate can alter expression of the Pi transporter 

gene (Maldonado-Mendoza et al. 2001). 

3.3 Nutrient Exchange Mechanisms in Arbuscular Mycorrhizas 

Isolation of the fungus from host tissue in mycorrhizas has assisted in identifying 

the location of biochemical activities in nutrient exchange (Saito 2000).


Intraradical hyphae were first isolated from host roots by enzymic digestion 

with cellulase and pectinase and hand-sorted under a dissecting microscope 

(Capaccio and Callow 1982). This is a time-consuming process which might 

reduce the metabolic activity of the hyphae (McGee and Smith 1990). Subsequently, 

a more suitable method was developed for isolating metabolically 

active intraradical hyphae from onion roots colonised by an AM fungus with 

only 1 h of enzymic digestion (Saito 1995). The metabolic activity of the isolated 

hyphae was not affected by this technique (Saito 1995; Solaiman and 

Saito 1997). The isolated arbuscules remained functional in membrane transport 

for at least 4 h. This corresponded with the in vivo NMR study by 

Shachar-Hill et al. (1995). Using this isolation technique, polyphosphate 

metabolism in isolated intraradical hyphae (Solaiman et al. 1999) and P efflux 

from the isolated intraradical hyphae have been observed (Solaiman and 

Saito 2001). P efflux from intraradical hyphae was coupled with polyP hydrolysis. 

A hyperarbuscule-forming plant mutant was screened from a large collection 

of nodulation mutants in model legume Lotus japonicus (Senoo et al. 

2000; Solaiman et al. 2000). The characteristic features of this mutant are: (1) 

it produces a higher number of arbuscules per unit length of roots compared 

to the wild-type plant, (2) the individual arbuscules formed in this mutant are 

well developed, and (3) metabolic activity of these arbuscules is higher than 

of those formed in the wild-type plant. Furthermore, a method of intact 

arbuscule isolation from the hyperarbuscule-forming mutant was developed 

without using enzymic digestion of colonised roots. The isolated arbuscules 

were metabolically active when tested with succinate dehydrogenase (SDH; 

Solaiman et al. 2000), alkaline phosphatase (ALP) and acid phosphatase 

(ACP) histochemical staining. This mutant is suitable for molecular genetic 

study and for further investigation of the exchange of P and C between the 

symbionts. 

Phosphorus in soil solution is absorbed by external hyphae through the Pi 

transporter, and the absorbed phosphate is condensed into polyP and translocated 

into the intraradical hyphae by protoplasmic streaming (Cooper and 

Tinker 1981; Harrison and van Buuren 1995). The factors potentially regulating 

the uptake, transport and transfer of phosphate from the fungus have 

been summarised by Saito (2000) as: (1) expression and regulation of the Pi 

transporter, (2) protoplasmic streaming of motile vacuoles, (3) synthesis and 

decomposition of polyP, and (4) release of Pi across the fungal membrane in 

the arbuscule. There has been no other information on the fungal Pi transporter 

in arbuscular mycorrhizas since the reports of Harrison and van 

Buuren (1995) and Maldonado-Mendoza et al. (2001). Synthesis and degradation 

of polyP in extraradical and intraradical hyphae (Solaiman et al. 1999; 

Ezawa et al. 2001) and an efflux of Pi from the intraradical hyphae have been 

demonstrated (Solaiman and Saito 2001). In spite of these advances, current 

knowledge is still based upon a limited number of host – fungus combina-

338 


tions. Demonstrations of morphological and genetic diversity of AM fungi 

imply that the mechanism of symbiotic nutrient exchange might be diverse 

(Smith and Smith 1996), but the taxonomic diversity found might not necessarily 

be linked to the functional role of the AM fungi. Both inter- and intraspecific 

variation in the effectiveness of AM fungi has been reported (Franke- 

Snyder et al. 2001). Studies are required that show whether fungal diversity 

reflects quantitative rather than qualitative differences in functioning. The 

current understanding of functional diversity is that plants can respond differently 

to different AM fungi, not only at the level of colonisation, nutrient 

uptake, growth, but also at the level of gene expression (Burleigh et al. 2002). 

4 Functional Diversity of Arbuscular Mycorrhizal Fungi in 

Root and Hyphal Interactions 

Functional diversity of AM fungi associated with roots of plants in different 

ecosystems is not well understood. The dynamics of interactions between 

roots and hyphae provide a framework for predicting how diversity of AM 

fungi might be related to mycorrhiza function, but it is difficult to measure. It 

is almost impossible to predict the functional diversity of AM fungi at an 

ecosystem level based simply on what fungi are present in soil. On a theoretical 

basis, the functional diversity of AM fungi under field conditions cannot 

be assumed to be directly correlated with a measure of diversity of AM fungi, 

even if the fungi present differ in P uptake and transfer under controlled conditions. 

This is because of differences in processes such as rate of root colonisation, 

interactions between fungi during colonisation and other strategies 

that include shutting down of hyphal infectivity in association with sporulation, 

as can occur for both S. calospora and A. laevis (Jasper et al. 1993; Pearson 

and Schweiger 1993). 

There is increasing interest in the potential role of AM fungi in influencing 

plant community structure (Read 1990; van der Heijden et al. 1998a, b; 

Klironomos 2002; Franke-Snyder et al. 2001). However, as yet there is little evidence 

to support the hypothesis that the diversity of AM fungi is an important 

factor influencing plant community structure under natural field conditions. 

This would require extensive quantification of AM fungi within roots for 

time-intervals that are of significance to plant and fungal growth cycles following 

an appropriate approach (Merryweather and Fitter 1998a, b). On the 

contrary, there is considerable potential for the plant communities to influence 

the fungal community structure through preferential effects on colonisation 

by particular fungi and influences on sporulation (Sanders and Fitter 

1992).


4.1 Diversity of Arbuscular Mycorrhizal Fungi Inside Roots 

The benefit to plants through enhanced P uptake is expected to be markedly 

altered according to the effectiveness of dominant AM fungi inside roots. 

However, species diversity of AM fungi has generally been examined from the 

perspective of presence or absence of fungi in soil, not in roots (van der Heijden 

et al. 1998a; Bever et al. 2001). There is little evidence of a simple relationship 

between the relative abundance of morphotypes of AM fungi inside roots 

and spores in soil (Scheltema et al. 1987; Merryweather and Fitter 1998a). The 

effectiveness of AM fungi in taking up P in these studies is generally not considered, 

but neither is it easy to determine, particularly as effectiveness can 

change for the same fungus depending on the P status of the soil and plant 

(Thomson et al. 1986). The diversity of AM fungi needs to be investigated further 

in relation to their relative abundance inside the roots (Abbott and Gazey 

1994). In addition, the methods applied to selecting combinations of species 

of AM fungi in studies of the role of species diversity need to be considered 

carefully (Wardle 1999). Another consideration is that AM fungi form associations 

with plants that differ markedly in their growth habits and susceptibility 

to colonisation, and this makes assessment of the impact of diversity of 

AM fungi even more difficult to predict or measure at an ecosystem level. 

The diversity of AM fungi could be relevant to communities of AM fungi in 

the same way that high plant species diversity may help stabilise plant community 

structure and ecosystem processes (Klironomos et al. 2000; Tilman 

1996). However, high diversity can also lead to competitive exclusion and 

cause a reduction in the number of co-existing species (Huston 1994). For AM 

fungi, this may only reduce the abundance of some species below levels of 

detection (Bever et al. 2001). The competitive ability of species of AM fungi in 

roots is likely to be an important factor in determining the dominance of AM 

fungi inside roots as well as in soil. This is compounded by seasonal changes 

in infectivity of AM fungi (Merryweather and Fitter 1998b), which is influenced 

by fungal life cycles (Abbott and Gazey 1994) such as sporulation and 

associated changes in infectivity of the hyphae (Pearson and Schweiger 1993). 

As AM fungi occur as communities in soil and in roots, the extent to which 

they are likely to collectively contribute to P uptake (Jakobsen et al. 2001; 

Solaiman and Abbott 2003) depends on the mycorrhiza dependency of the 

host plant (van der Heijden et al. 1998b). Although there have been intensive 

studies of single AM fungus function, there have been few investigations of 

the contributions of communities of AM fungi. Reconstructed communities 

of AM fungi in soil can promote plant growth (Daft 1983; Daft and Hogart 

1983), or have no effect on plant growth (Sylvia et al. 1993). A correlation 

between the occurrence of AM fungal morphotypes and seasonal P uptake for 

AM fungi in a natural ecosystem was observed (Merryweather and Fitter 

1998b), which may be related to differences among fungi in the functional 

characteristics of hyphae they form in soil (Smith et al. 2000).

340 


4.2 Relationship Between Hyphae in the Root and in the Soil 

The quantity of hyphae in the vicinity of roots associated with mycorrhizal 

roots can vary greatly (Sylvia 1986) and change with time (Bethlenfalvay et al. 

1982). Hyphae of AM fungi play key roles in the formation and functioning of 

mycorrhizas (Abbott et al. 1992). Hyphae in soil, originating from either an 

established hyphal network or from other propagules (spores, vesicles and 

root fragments), lead to the recognition and subsequent colonisation of roots. 

The distribution of hyphae and associated sporulation will determine where 

propagules are located in relation to newly formed roots. The roles of the 

hyphae in both P uptake and soil stabilisation are dependent on their distribution 

within the soil matrix and their interaction with the root surface. 

Abbott and Robson (1984) hypothesised for G. invermaium that low initial 

levels of infective hyphae in the soil would lead to small amounts of hyphae in 

soil relative to the amount formed inside the root. For high initial densities of 

infective hyphae of this fungus in soil, the exponential phase of colonisation 

of roots was expected to occur in parallel with extensive development of 

hyphae in the soil. In contrast, there was no similar relationship between the 

formation of hyphae in soil and within the root expected for S. calospora 

which consistently produced large amounts of hyphae in soil, irrespective of 

the density of hyphae within the root. 

There is relatively little information about the longevity of hyphae in soil 

(Sylvia 1988; Hamel et al. 1990). This would be important for predicting the 

activities of hyphae for both colonisation and P uptake. The majority of studies 

of mycorrhizas measure the extent of colonisation of roots at one point in 

time. This measure is of little value for understanding functional diversity of 

AM fungi because the AM fungi within the root may either be highly active or 

have ceased activity for some time. Most routine techniques for assessing 

mycorrhizas do not assess any functional attribute of the fungus. Therefore, 

care is required in extrapolating from levels of mycorrhizal root colonised to 

functional diversity of communities of AM fungi present in soil. 

5 Role of Arbuscular Mycorrhizal Fungi Associated with 

Roots in Soil Aggregation 

The AM fungal hyphae can enhance soil aggregation by using more than one 

mechanism. In clayey soils, entanglement of soil particles by hyphae can 

occur (Tisdall and Oades 1982; Oades 1984). There is insufficient hyphal 

length to extend around particles of sand and a more likely mechanism is 

cross-linking of particles by hyphae in sandy soils (Degens 1997). AM fungal 

hyphae may bind soil aggregates by exuding a glycoprotein (Wright et al. 

1996; Wright and Upadhyaya 1998). Some information on species differences 

in soil aggregation is available which indicates that AM fungi commonly pro-


duce glomalin, but the amount varies considerably for different species 

(Wright and Upadhaya 1998). If AM fungal communities differ in their sensitivity 

to disturbance, the capacity of the species present to form hyphae as 

well as their ability to produce glomalin should influence the degree of soil 

aggregation. 

6 Environmental Influence on Functional Diversity of 

Arbuscular Mycorrhizal Fungi 

The soil environment includes many physical and chemical properties that 

are continuously being modified by dynamic biological processes. Rhizosphere 

soil is influenced by plant root exudates and microbial activity and the 

AM fungi that live in this habitat have adapted to a wide range of environmental 

conditions (Stahl and Christensen 1991; Giovannetti and Gianinazzi- 

Pearson 1994). Environmental stresses on AM fungi could include: (1) high or 

low levels of nutrients, (2) waterlog and drought, (3) soil acidity, (4) salinity, 

(5) high levels of toxic metals, (6) biotic factors (e.g. fauna that feed on 

hyphae), and (7) absence of suitable host plants for long periods. AM fungi 

can adapt to both low and high levels of soil nutrients (Solaiman and Hirata 

1997). As they are aerobic, waterlogging has a considerable impact on their 

diversity and on their functioning. One of the most important soil factors 

influencing the distribution of species of AM fungi is soil pH (Robson and 

Abbott 1989). AM fungi show considerable diversity in their response to soil 

pH and changes in soil pH can affect the relative abundance of species inside 

roots (Sano et al. 2002). This has potential to influence the structure of communities 

of AM fungi in soil. There is also evidence that agricultural practices 

such as pesticide applications, cropping sequences and soil disturbance can 

affect diversity of AM fungi in soil (Dodd and Jeffries 1989; Sieverding 1991; 

Johnson et al. 1997). 

7 Role of Plant Mutants in Studying the Interactions 

Between Arbuscular Mycorrhizal Fungi and Roots 

In symbiotic associations between AM fungi and plant roots, genetic control 

imposed by each symbiont is poorly understood. Understanding of the 

genetic and molecular basis of this symbiosis has been prevented by the 

obligate nature of the fungal symbiont and by the lack of mycorrhiza formation 

on the model plant Arabidopsis thaliana. Recently, Medicago truncatula 

and Lotus japonicus have been chosen as model plants for research of plant – 

microbe symbioses (Sagan et al. 1995; Jiang and Gresshoff 1997; Bonfante et 

al. 2000; Senoo et al. 2000). The use of molecular genetic approaches in model 

legumes will rapidly increase knowledge of host genetic determinants of

342 


arbuscular mycorrhizas. An essential step in this process has been the generation, 

screening and analysis of mycorrhizal mutants (Marsh and Schultze 

2001). 

Plant mutants are valuable tools in unravelling complex events that occur 

during cell and tissue differentiation in plants that show impaired formation 

of arbuscular mycorrhizas (Peterson and Guinel 2000). Since the first description 

of myc – mutants (Duc et al. 1989), there has been increasing interest in 

using them to address questions related to various key steps in the colonisation 

process (Senoo et al. 2000; Wyss et al. 1990). As these fungi are obligate 

symbionts, it has been difficult to study the interaction between the symbionts 

during colonisation. The interaction in early colonisation phases of 

Allium porrum L. (leek) roots by the AM fungus Glomus versiforme have been 

described (Garriock et al. 1989) and reviewed (Giovanetti et al. 1994). Mutants 

of pea (Pisum sativum L.) and faba bean (Vicia faba L.) were not colonised by 

AM fungi (Duc et al. 1989). These mycorrhizal (myc – ) mutants were also 

unable to form functional root nodules (nod – ). The myc – mutants have 

aborted infections (Gianinazzi-Pearson et al. 1991). In contrast, nod – mutants 

of soybean were colonised by Glomus mossae to the same extent as wild-type 

(nod + ) soybean plants (Wess et al. 1990). The myc – mutants should be 

screened against different AM fungi in a range of soils to see whether resistance 

is horizontal or if some fungi can overcome resistance as in the case of 

certain nod – plants in the presence of different Rhizobium populations (Lie 

and Timmermans 1983). Recently, it has been shown that some AM fungi can 

colonise the mutant of tomato, rmc, demonstrating that the fungi can overcome 

resistance to successful colonisation (Gao et al. 2001). This new tool 

would help exploration of genetic variability in AM fungi. It would also open 

the possibility of controlling plant – fungus specificity in the presence of communities 

of AM fungi in field soils. 

Mycorrhizal mutants were screened from the model plant Lotus japonicus 

(Senoo et al. 2000) after inoculation with Glomus sp. R-10. These mutants were 

characterized and categorized into mcbep (mycorrhizal colonisation blocked 

at epidermis) and mcbex (mycorrhizal colonisation blocked at exodermis) 

based on the detailed assessment of colonisation and microscopic observation 

(Senoo et al. 2000). Isolation and cloning of the gene will facilitate understanding 

of its function, and it could be used to probe a range of hosts to 

determine its distribution and expression. It is essential to expand the collection 

of mutants in order to build up a comprehensive description of the molecular 

genetic basis of successful mycorrhization.


8 Conclusion and Future Research Needs 

Research is needed that integrates knowledge of ecological and genetic characteristics 

of arbuscular mycorrhizas for predicting P-related functions of 

AM fungi in soil communities. For example, the diversity among Arum-type 

AM fungi in arbuscule formation in roots in relation to the intensity of mycorrhizal 

colonisation and function is not known for fungi that differ in colonisation 

aggressiveness and response to P supply. Neither are the relationships 

understood between arbuscule formation and P/C exchange for AM fungi 

that differ in arbuscular, intraradical and external hyphal growth characteristics. 

It would be interesting to compare Pi transporter gene expression in 

arbuscules, intraradical and external hyphae in mycorrhizas formed by AM 

fungi that differ in (1) arbuscular and other colonisation characteristics, and 

(2) functional response to phosphate supply and the presence of co-colonising 

AM fungi that have different C demands. Finally, clarification is required 

of the actual roles of AM fungi in natural environments. The importance of 

AM fungal diversity is currently of considerable interest, but the limited evidence 

available is not yet sufficient to support claims that diversity of these 

potentially symbiotic organisms is of wide-scale significance in regulating the 

structure of plant communities. 


Abbott LK, Robson AD (1984) The effect of root density, inoculum placement and infectivity 

of inoculum on the development of vesicular-arbuscular mycorrhizas. New 

Phytol 97:285–299 

Abbott LK, Robson AD (1985) Formation of external hyphae in soil by four species of 

vesicular-arbuscular mycorrhizal fungi. New Phytol 99:245–255 

Abbott LK, Gazey C (1994) An ecological view of the formation of VA mycorrhizas. Plant 

Soil 159:69–78 

Abbott LK, Robson AD, Jasper DA, Gazey C (1992) What is the role of VA mycorrhizal 

hyphae in soil? In: Read DJ, Lewis DH, Fitter AH, Alexander IJ (eds) Mycorrhizas in 

ecosystems. CAB International, Wallingford, pp 37–41 

Balaji B, Ba AM, LaRue TA, Tepfer D, Piche Y (1994) Pisum sativum mutants insensitive 

to nodulation are also insensitive to invasion in vitro by the mycorrhizal fungus 

Gigaspora margarita. Plant Sci 102:195–203 

Becard G, Pfeffer PE (1993) State of nuclear division in arbuscular mycorrhizal fungi 

during in vitro development. Protoplasma 194:62–68 

Bethlenfalvay GJ, Brown MS, Pakovsky RS (1982) Relationships between host and endophyte 

development in mycorrhizal soybeans. New Phytol 90:537–543 

Bever JD, Schultz PA, Pringle A, Morton JB (2001) Arbuscular mycorrhizal fungi: more 

diverse than meets the eye, and the ecological tale of why. BioSci 51:923–931 

Bonfante-Fasolo P (1987) Vesicular arbuscular mycorrhizae: fungus-plant interactions 

at the cellular level. Symbiosis 3:249–268

344 


Bonfante P, Genre A, Faccio A, Martin I, Schauser L, Stougaard J,Web J, Parniske M (2000) 

The Lotus japonicus Ljsym4 gene is required for the successful symbiotic infection of 

root epidermis cells. Mol Plant-Microbe Interact 13:1109–1120 

Brundrett MC, Abbott LK (2002) Arbuscular mycorrhizas in plant communities. In: Sivasithamparam 

K, Dixon KW, Barrett RL (eds) Microorganisms in Plant Conservation 

and Biodiversity. Kluwer, Dordrecht, pp 151–193 

Burleigh SH, CavagnaroT, Jakobsen I (2002) Functional diversity of arbuscular mycorrhizas 

extends to the expression of plant genes involved in P nutrition. J Exp Bot 

53:1593–1601 

Capaccio LCM, Callow JA (1982) The enzymes of polyphosphate metabolism in vesicular-arbuscular 

mycorrhizas. New Phytol 91:81–91 

Chiou TJ, Liu H, Harrison MJ (2001) The spatial expression patterns of a phosphate 

transporter (MtPT1) from Medicago truncatula indicate a role in phosphate transport 

at the root/soil interface. Plant J 25:281–293 

Cooper KM, Tinker PB (1981) Translocation and transfer of nutrients in vesicular-arbuscular 

mycorrhizas. IV. Effect of environmental variables on movement of phosphorus. 


Daft MJ (1983) The influence of mixed inocula on endomycorrhizal development. Plant 

Soil 71:331–337 

Daft MJ, Hogart BG (1983) Competitive interactions amongst four species of Glomus on 

maize and onion. Trans Br Mycol Soc 80:339–345 

Degens BP (1997) Macroaggregation of soils by biological bonding and binding mechanisms 

and factors affecting this: a review. Aust J Soil Res 35:431–446 

Dodd JC, Jeffries P (1989) Effects of herbicides on three vesicular-arbuscular mycorrhizal 

fungi associated with winter wheat (Triticum aestivum L.). Biol Fertil Soils 

7:113–119 

Dodd JC, Boddington CL, Rodriguez A, Gonzalez-Chavez C, Mansur I (2000) Mycelium 

of arbuscular mycorrhizal fungi (AMF) from different genera: form, function and 

detection. Plant Soil 226:131–151 

Duc G, Trouvelot A, Gianinazzi-Pearson V, Gianinazzi S (1989) First report of non-mycorrhizal 

plant mutants (myc – ) obtained in pea (Pisum sativum L.) and faba bean 

(Vicia faba L.). Plant Sci 60:215–222 

Elias KS, Safir GR (1987) Hyphal elongation of Glomus fasciculatus in response to root 

exudates. Appl Environ Microbiol 53:1928–1933 

Ezawa T, Smith SE, Smith FA (2001) Differentiation of polyphosphate metabolism 

between the extra- and intraradical hyphae of arbuscular mycorrhizal fungi. New 

Phytol 149:555–563 

Franke-Snyder M, Douds Jr DD, Galvez L, Phillips JG, Wagoner P, Drinkwater L, Morton 

JB (2001) Diversity of communities of arbuscular mycorrhizal (AM) fungi present in 

conventional versus low-input agricultural sites in eastern Pennsylvania, USA. Appl 


Gao L-L, Delp G, Smith SE (2001) Colonization patterns in a mycorrhiza-defective 

mutant tomato vary with different arbuscular-mycorrhizal fungi. New Phytol 151: 

477–491 

Garriock ML, Peterson RL, Ackerley CA (1989) Early stages in colonization of Allium 

porrum (leek) roots by the vesicular-arbuscular mycorrhizal fungus, Glomus versiforme. 


Gianinazzi S, Gianinazzi-Pearson V, Dexheimer J (1979) Enzyme studies on the metabolism 

of vesicular-arbuscular mycorrhiza. 3. Ultrastructural localization of acid and 

alkaline phosphatase in onion roots infected by Glomus mosseae (Nicol. and Gerd.). 


Gianinazzi-Pearson V, Gianinzzi S (1989) Cellular and genetical aspects of interactions 

between host and fungal symbionts in mycorrhizae. Genome 31:336–341


Gianinazzi-Pearson V, Gianinazzi S, Guillemin JP, Trouvelot A, Duc G (1991) Genetic and 

cellular analysis of resistance of vesicular-arbuscular mycorrhizal fungi in pea 

mutants. In: Hennecke, H, Varma DPS (eds) Advances in molecular genetics of plant 

– microbe interactions. Kluwer, Dordrecht, pp 336–342 

Giovannetti M, Gianinazzi-Pearson V (1994) Biodiversity in arbuscular mycorrhizal 

fungi. Mycol Res 98:705–715 

Giovannetti M, Sbrana S, Logi C (1994) Early processes involved in host recognition by 

arbuscular mycorrhizal fungi. New Phytol 127:703–709 

Giovannetti M, Sbrana C (1998) Meeting a non-host: the behaviour of AM fungi. Mycorrhiza 

8:123–130 

Giovannetti M, Sbrana C, Avio L, Citernesi AS, Logi C (1993a) Differential hyphal morphogenesis 

in arbuscular mycorrhizal fungi during preinfection stages. New Phytol 

125:587–593 

Giovanetti M, Avio L, Sbrana L, Citernesi AS (1993b) Factors affecting appressorium 

development in the vesicular-arbuscular mycorrhizal fungus Glomus mosseae (Nicol. 

and Gerd.) Gerd. and Trape. New Phytol 123:114–122 

Graham JH, Eissenstat DM (1998) Field evidence for the carbon cost of citrus mycorrhizas. 

New Phytol 140:103–110 

Graham JH, Abbott LK (2000) Wheat responses to aggressive and non-aggressive arbuscular 

mycorrhizal fungi. Plant Soil 220:207–218 

Hamel C, Fyles H, Smith DL (1990) measurement of development of endomycorrhizal 

mycelium using three different vital stains. New Phytol 115:297–302 

Harrison MJ (1996) A sugar transporter from Medicago truncatula: altered expression 

pattern in roots during vesicular-arbuscular (VA) mycorrhizal associations. Plant J 

9:491–503 

Harrison MJ (1999) Molecular and cellular aspects of the arbuscular mycorrhizal symbiosis. 

Ann Rev Plant Physiol Plant Mol Biol 50:361–389 

Harrison MJ, van Buuren ML (1995) A phosphate transporter from the mycorrhizal fungus 

Glomus versiforme. Nature 378:626–629 

Holliday P (1989) A dictionary of plant pathology. Cambridge University Press, Cambridge, 

pp 369 

Huston MA (1994) Biological diversity: the coexistence of species on changing landscapes. 

Cambridge University Press, Cambridge, pp 1–681 

Jabaji-Hare SH, Therien J, Charest PM (1990) High resolution cytochemical study of the 

vesicular-arbuscular mycorrhizal association, Glomus clarum-Allium porrum. New 

Phytol 114:481–496 

Jakobsen I (1998) Transport of phosphorus and carbon in arbuscular mycorrhizas. In: 

Varma A, Hock B (eds) Mycorrhiza: structure, function, molecular biology and 


Jakobsen I, Gazey C, Abbott LK (2001) Phosphate transport by communities of arbuscular 

mycorrhizal fungi in intact soil cores. New Phytol 149:95–103 

Jacquot E, van Tuinen D, Gianinazzi S, Gianinazzi-Pearson V (2000) Monitoring species 

of arbuscular mycorrhizal fungi in planta and in soil by nested PCR: application to 

the study of the impact of sewage sludge. Plant Soil 226:179–188 

Jasper DA, Abbott LK, Robson AD (1993) The survival of infective hyphae of vesiculararbuscular 

mycorrhizal fungi in dry soil: an interaction with sporulation. New Phytol 

124:473–479 

Jiang Q, Gresshoff PM (1997) Classical and molecular genetics of the model legume 

Lotus japonicus. Mol Plant-Microbe Interact 10:59–68 

Johnson NC, Graham JH, Smith FA (1997) Functioning of mycorrhizal associations along 

the mutualism-parasitism continuum. New Phytol 135:575–585 

Klironomos JN (2002) Feedback with soil biota contributes to plant rarity and invasiveness 

in communities. Nature 417:67–70

346 


Klironomos JN, McCune J, Hart M, Neville J (2000) The influence of arbuscular mycorrhizae 

on the relationship between plant diversity and productivity. Ecol Lett 

3:137–141 

Koide R, Elliott G (1989) Cost, benefit and efficiency of the vesicular-arbuscular mycorrhizal 

symbiosis. Funct Ecol 3:252–255 

Koide RT, Schreiner RP (1992) Regulation of the vesicular-arbuscular mycorrhizal symbiosis. 


Koske RE, Gemma JN (1992) Fungal reactions to plants prior to mycorrhiza formation. 

In: Allen MF (ed) Mycorrhizal functioning. Routledge, Chapman and Hall, New York, 

pp. 3–36 

Lie TA, Timmermans PCJM (1983) Host-genetic control of nitrogen fixation in the 

legume-Rhizobium symbiosis: complication in the genetic analysis due to material 

effects. Plant Soil 75:449–453 

Liu H, Trieu AT, Blaylock LA, Harrison MJ (1998) Cloning and characterization of two 

phosphate transporters from Medicago truncatula roots: regulation in response to 

phosphate and to colonisation by arbuscular mycorrhizal (AM) fungi. Mol Plant- 


Maldonado-Mendoza IE, Dewbre GR, Harrison MJ (2001) A phosphate transporter gene 

from the extra-radical mycelium of an arbuscular mycorrhizal fungus Glomus 

intraradices is regulated in respect to phosphate in the environment. Mol Plant- 


Marsh JF, Schultze M (2001) Analysis of arbuscular mycorrhizas using symbiosis-defective 

plant mutants. New Phytol 150:525–532 

McArthur DAJ, Knowels NR (1993) Influence of vesicular-arbuscular mycorrhizal fungi 

on the response of potato to phosphorus deficiency. Plant Physiol 101:147–160 

McGee PA, Smith SE (1990) Activity of succinate dehydrogenase in vesicular-arbuscular 

mycorrhizal fungi after enzymic digestion from roots of Allium porrum. Mycol Res 

94:305–308 

McGonigle T, Fitter AH (1990) Ecological specificity of vesicular-arbuscular mycorrhizal 

associations. Mycol Res 94:120–122 

Merryweather JW, Fitter AH (1998a) The arbuscular mycorrhizal fungi of Hyacinthoides 

non-scripta-I. Diversity of fungal taxa. New Phytol 138:117–129 

Merryweather JW, Fitter AH (1998b) The arbuscular mycorrhizal fungi of Hyacinthoides 

non-scripta-II. Seasonal and spatial patterns of fungal populations. New Phytol 

138:131–142 

Morton JB, Bentivenga SP (1994) Levels of diversity in endomycorrhizal fungi (Glomales, 

Zygomycetes) and their role in defining taxonomic and non-taxonomic groups. 


Mosse B (1962) The establishment of vesicular-arbuscular mycorrhiza under aseptic 

conditions. J Gener Microbiol 27:509–520 

Mosse B (1975) Specificity in VA mycorrhizas. In: Sanders FE, Mosse B, Tinker PB (eds) 

Endomycorrhizas. Academic Press, London, pp 469–484 

Mosse B (1988) Some studies relating to “independent growth of vesicular-arbuscular 

endophytes”. Can J Bot 66:2533–2540 

Murphy PJ, Langridge P, Smith SE (1997) Cloning plant genes differentially expressed 

during colonisation of roots of Hordeum vulgare by the vesicular-arbuscular mycorrhizal 

fungus Glomus intraradices. New Phytol 135:291–301 

Nagahashi G (2000) In vitro and in situ techniques to examine the role of roots and root 

exudates during AM fungus-host interactions. In: Kapulnik Y, Douds Jr DD (eds) 

Arbuscular mycorrhizas: physiology and function. Kluwer, Dordrecht, pp 287–300 

Oades JM (1984) Soil organic matter and structural stability: Mechanisms and implications 

for management. Plant Soil 76:319–337


Ocampo JA, Martin J, Hayman DS (1980) Influence of plant interactions on vesiculararbuscular 

mycorrhizal infections. I. Host and non-host plants grown together. New 

Phytol 84:27–35 

Pakovsky RS (1989) Carbohydrate, protein amino acid status of Glycine-Glomus- 

Bradyrhizobium symbiosis. Physiol Plant 72:733–746 

Pearson JN, Schweiger P (1993) Scutellospora calospora (Nicol. and Gerd.) Walker and 

Sanders associated with subterranean clover: dynamics of colonisation, sporulation 

and soluble carbohydrates. New Phytol 124:215–219 

Pearson JN, Schweiger P (1994) Scuttelospora calospora (Nicol. and Gerd.) Walker and 

Sanders associated with subterranean clover produces non-infective hyphae during 

sporulation. New Phytol 127:697–701 

Pearson JN, Abbott LK, Jasper DA (1993) Mediation of competition between two colonizing 

VA mycorrhizal fungi by the host plant. New Phytol 123:93–98 

Pearson JN,Abbott LK, Jasper DA (1994) Phosphate, soluble carbohydrates and the competition 

between two arbuscular mycorrhizal fungi colonizing subterranean clover. 

New Phytol 127:101–106 

Peterson RL, Guinel FC (2000) The use of plant mutants to study regulation of colonization 

by AM fungi. In: Kapulnik Y, Douds Jr DD (eds) Arbuscular mycorrhizas: physiology 

and function. Kluwer, Dordrecht, pp 147–171 

Rausch C, Daram P, Brunner S, Jansa J, Laloi M, Leggewie G,Amrhein N, Bucher M (2001) 

A phosphate transporter expressed in arbuscule-containing cells in potato. Nature 

414:462–466 

Read DJ (1990) Mycorrhizas in ecosystems – Nature’s response to the ‘Law of the minimum’. 

In: Hawksworth DL (ed) Frontiers in mycology. CAB International, Wallingford, 

pp 101–130 

Robson AD, Abbott LK (1989) The effect of soil acidity on microbial activity in soil. In: 

Robson AD (ed) Soil acidity and plant growth. Academic Press, Sydney, pp 139–165 

Rosendahl S, Taylor JW (1997) Development of multiple genetic markers for studies of 

genetic variation in arbuscular mycorrhizal fungi using AFLP. Mol Ecol 6:821–829 

Rosewarne GM, Barker SJ, Smith SE, Smith FA, Schachtman DP (1999) A Lycopersicon 

esculentum phosphate transporter (LePT1) involved in phosphorus uptake from a 

vesicular-arbuscular mycorrhizal fungus. New Phytol 144:507–516 

Sagan M, Morandi D, Tarenghi E, Duc G (1995) Selection of nodulation and mycorrhizal 

mutants in the model plant Medicago truncatula (Gaertn.) after g-ray mutagenesis. 

Plant Sci 111:63–71 

Saito M (1995) Enzyme activities of the internal hyphae and germinated spores of an 

arbuscular mycorrhizal fungus, Gigaspora margarita Becker and Hall. New Phytol 

129:425–431 

Saito M (2000) Symbiotic exchange of nutrients in arbuscular mycorrhizas: Transport 

and transfer of phosphorus. In: Kapulnik Y, Douds Jr DD (eds) Arbuscular mycorrhizas: 

physiology and function. Kluwer, Dordrecht, pp 85–105 

Sanders IR, Fitters AH (1992) Evidence for differential responses between host-fungus 

combinations of vesicular-arbuscular mycorrhizas from a grassland. Mycol Res 

96:415–419 

Sano SM, Abbott LK, Solaiman MZ, Robson AD (2002) Influence of liming, inoculum 

level and inoculum placement on root colonization of subterranean clover. Mycorrhiza 

12:285–290 

Scheltema MA, Abbott LK, Robson AD (1987) Seasonal variation in infectivity of VA 

mycorrhizal fungi in annual pastures in a Mediterranean environment. Aust J Agric 

Res 38:707–715 

Schwab SM, Menge JA, Tinker PB (1991) Regulation of nutrient transfer between host 

and fungus in vesicular mycorrhizas. New Phytol 117:387–398

348 


Senoo K, Solaiman MZ, Kawaguchi M, Imaizumi-Anraku H, Akao S, Tanaka A, Obata H 

(2000) Isolation of two different phenotypes of mycorrhizal mutants in the model 

legume plant Lotus japonicus after EMS-treatment. Plant Cell Physiol 41:726–732 

Shachar-Hill Y, Pfeffer PE, Douds D, Osman SF, Doner LW, Ratcliffe RG (1995) Partitioning 

of intermediary carbon metabolism in vesicular-arbuscular mycorrhizal leek. 


Sieverding E (1991) Vesicular-arbuscular mycorrhiza management in tropical agroecosystems. 

Deutsche Gesellschaft für Technische Zusammenarbeit. Eschborn, Germany, 

pp 371 

Smilauer P (2001) Communities of arbuscular mycorrhizal fungi in grassland: seasonal 

variability and effects of environment and host plants. Folia Geobot 36:243–263 

Smith FA, Smith SE (1997) Structural diversity in (vesicular)-arbuscular mycorrhizal 

symbioses. New Phytol 137:373–388 

Smith FA, Jakobsen I, Smith SE (2000) Spatial differences in acquisition of soil phosphate 

between two arbuscular mycorrhizal fungi in symbiosis with Medicago truncatula. 

New Phytol 147:357–366 

Smith SE, Dickson S (1991) Quantification of active vesicular-arbuscular mycorrhizal 

infection using image analysis and other techniques. Aust J Plant Physiol 18:737–648 

Smith SE, Smith FA (1996) Mutualism and parasitism: diversity in function and structure 

in the “arbuscular” (VA) mycorrhizal symbiosis. Adv Bot Res 22:1–43 

Smith SE, Read DJ (1997) Mycorrhizal symbiosis. Academic Press, London, pp 1–605 

Smith SE, Dickson S, Smith FA (2001) Nutrient transfer in arbuscular mycorrhizas: how 

are fungal and plant processes integrated? Aust J Plant Physiol 28:683–694 

Solaiman MZ, Hirata H (1997) Effect of arbuscular mycorrhizal fungi inoculation of rice 

seedlings at the nursery stage upon performance in the paddy field and greenhouse. 


Solaiman MZ, Saito M (1997) Use of sugars by intraradical hyphae of arbuscular mycorrhizal 

fungi revealed by radiorespirometry. New Phytol 136:533–538 

Solaiman MZ, Saito M (2001) Phosphate efflux from the intraradical hyphae of an arbuscular 

mycorrhizal fungus, Gigaspora margarita, in vitro and its implication to phosphorus 

translocation in the hyphae. New Phytol 151:525–533 

Solaiman MZ,Abbott LK (2003) Phosphorus uptake by a community of arbuscular mycorrhizal 

fungi in jarrah forest. Plant Soil 248:313–320 

Solaiman MZ, Ezawa T, Kojima T, Saito M (1999) Polyphosphates in intraradical and 

extraradical hyphae of arbuscular mycorrhizal fungi. Appl Environ Microbiol 

65:5604–5606 

Solaiman MZ, Senoo K, Kawaguchi M, Imaizumi-Anraku H, Akao S, Tanaka A, Obata H 

(2000) Characterization of mycorrhizas formed by Glomus sp. on roots of hypernodulating 

mutants of Lotus japonicus. J Plant Res 113:443–448 

Sylvia DM (1986) Spatial and temporal distribution of vesicular-arbuscular mycorrhizal 

fungi associated with Uniola paniculata in Florida foredunes. Mycologia 78:728–734 

Sylvia DM (1988) Activity of external hyphae vesicular arbuscular mycorrhizal fungi. 


Stahl PD, Christensen M (1991) Population variation in the mycorrhizal fungus Glomus 

mosseae: breath of environmental tolerance. Mycol Res 95:300–3007 

Sylvia DM, Wilson DO, Graham JH, Maddox JJ, Millner P, Morton JB, Skipper HD, Wright 

SF, Jarstfer AG (1993) Evaluation of vesicular arbuscular mycorrhizal fungi in diverse 

plants and soils. Soil Biol Biochem 25:705–713 

Tester M, Smith SE, Smith FA (1987) The phenomenon of non-mycorrhizal plants. Can J 

Bot 65:419–431 

Thomson BD, Robson AD, Abbott LK (1986) Effects of phosphorus on the formation of 

mycorrhizas by Gigaspora margarita and Glomus fasciculatum in relation to root carbohydrates. 

New Phytol 103:751–765


Tijssen JPF, Dubbelman TMAR, Van Steveninak J (1983) Isolation and characterization 

of polyphosphate from the yeast cell surface. Biochem Biophysics Acta 760:143–148 

Tilman D (1996) Biodiversity: population versus ecosystem stability. Ecology 77:350–363 

Tisdall JM, Oades JM (1982) Organic matter and water-stable aggregates in soils. J Soil 

Sci 33:141–163 

Tommerup IC, Sivasithamparam K (1990) Zygospores and asexual spores of Gigaspora 

decipiens, an arbuscular mycorrhizal fungus. Mycol Res 94:897–900 

Van der Heijden MGA, Klironomos JN, Ursic M, Moutoglis P, Streitwolf-Engel, Boller T, 

Wiemken A, Sanders IR (1998a) Mycorrhizal fungal diversity determines plant biodiversity, 

ecosystem variability and productivity. Nature 396:69–72 

Van der Heijden MGA, Boller T, Wiemken A, Sanders IR (1998b) Different arbuscular 

mycorrhizal fungal species are potential determinants of plant community structure. 

Ecology 79:2082–2091 

Walker C, Trappe JM (1993) Names and epithets in the glomales and endogonales. Mycol 

Res 97:339–344 

Wardle DA (1999) Is “sampling effect” a problem for experiments investigating biodiversity 

– ecosystem function relationships? Oikos 87:403–407 

Wegel E, Schauser L, Sandal N, Stougaard J, Parniske M (1998) Mycorrhiza mutants of 

Lotus japonicus define genetically independent steps during symbiotic infection. Mol 


Wright SF, Upadhyaya A (1998) A survey of soils for aggregate stability and glomalin, a 

glycoprotein produced by hyphae of arbuscular mycorrhizal fungi. Plant Soil 198:97– 

107 

Wright SF, Franke-Snyder M, Morton JB, Upadhyaya A (1996) Time-course study and 

partial characterization of a protein on hyphae of arbuscular mycorrhizal fungi during 

active colonization of roots. Plant Soil 181:193–203 

Wyss P, Mellor RB, Wiemken A (1990) Vesicular-arbuscular mycorrhizas of wild-type 

soybean and non-nodulating mutants with Glomus mossae contain symbiosis-specific 

polypeptides (mycorrhizins), immunologically cross-reactive with nodulins. 

Planta 182:22–26

20 Mycorrhizal Fungi and Plant Growth Promoting 

Rhizobacteria 

José-Miguel Barea, Rosario Azcón 

and Concepción Azcón-Aguilar 


Soil microbial communities are crucial in maintaining a biological balance in 

soil, a key issue for the sustainability of either natural ecosystems or agroecosystems 

(Kennedy and Smith 1995). When provided with available carbon 

substrates, soil microorganisms are able to develop a range of activities in the 

microhabitats where they flourish and some of these activities are of great relevance 

for plant growth and health and for soil quality (Bowen and Rovira 

1999). Soil-borne microbes are found bound to the surface of soil particles or 

in the soil aggregates, while others interact specifically with plant roots (Glick 

1995). Particularly important from the point of view of plant surface microbiology 

are the interactions at the root – soil interface where microorganisms, 

plant roots and soil constituents interact (Lynch 1990; Azcón-Aguilar and 

Barea 1992; Linderman 1992; Kennedy 1998; Bowen and Rovira 1999; Barea 

2000; Gryndler 2000) to develop a dynamic environment what is known as the 

rhizosphere (Hiltner 1904). The rhizosphere, therefore, is the zone of influence 

of plant roots on the soil microbiota; a microcosm with physical, chemical 

and biological properties different from those of the root-free bulk soil 

(Bowen and Rovira 1999; Gryndler 2000; Barea 2000). A characteristic of the 

rhizosphere is that microbial diversity is altered and that the activity and 

number of microorganisms is increased (Kennedy 1998). 

The supply of photosynthates and decaying plant material to the root-associated 

microbiota is a key issue for rhizosphere formation and functioning. 

The release of organic material is known to occur mainly as root exudates, 

acting as either signals or growth substrates (Werner 1998). However, once 

the microbial population is established, rhizosphere developments are 

affected by microbially induced changes on rooting patterns and by the supply 

of available nutrients to plants, which in turn modify the quality and 

quantity of root exudates (Bowen and Rovira 1999; Barea 2000; Gryndler 

2000). Microbial interactions in the rhizosphere are known to markedly influence 

plant fitness and soil quality (Lynch 1990; Bethlenfalvay and Schüepp 




352 

José-Miguel Barea et al. 

1994). In particular, microorganisms associated with plant roots help the host 

plant adapt to stress conditions concerning water and mineral nutrition, and 

soil-borne plant pathogens (Jeffries and Barea 2001). 

From the point of view of plant surface microbiology, the compartmentalization 

of the rhizosphere (broad sense) is important. Kennedy (1998) suggested 

that there are three separate, but interacting components, namely the 

rhizosphere (soil), the rhizoplane, and the root itself. The rhizosphere is the 

zone of soil influenced by roots through the release of substrates that affect 

microbial activity. The rhizoplane is actually the root surface, but also 

includes the strongly adhering soil particles. The root itself is a part of the system 

because certain microorganisms, the endophytes, are able to colonize 

root tissues. Microbial colonization of the rhizoplane and/or the root tissues 

is known as root colonization, while the colonization of the adjacent volume 

of soil under the influence of the root is known as rhizosphere colonization 

(Kloepper et al. 1991). 

2 Main Types of Rhizosphere Microorganisms 

In spite of several very different types of microorganisms living in the root – 

soil interface microhabitats, most studies on rhizosphere microbiology refer 

to only bacteria and fungi (Bowen and Rovira 1999; Gryndler 2000). Two main 

groups of microorganisms can be distinguished: saprophytes and symbionts. 

Both of them comprise detrimental, neutral and beneficial bacteria and fungi. 

Detrimental microbes include the major plant pathogens, as well as minor 

parasitic and nonparasitic, deleterious rhizosphere organisms, either bacteria 

or fungi, (Weller and Thomashow 1994; Nehl et al. 1996). Beneficial microorganisms 

are known to play fundamental roles in agroecosystem and natural 

ecosystem sustainability, and some of them can be used as inoculants to benefit 

plant growth and health (Alabouvette et al. 1997; Barea et al. 1997; Cordier 

et al. 1999; Barea 2000; Dobbelaere et al. 2001; Probanza et al. 2002). 

Saprophytic bacteria and fungi colonize subterranean plant surfaces. Root 

colonization by rhizosphere bacteria has been extensively studied. It appears 

to be a strain-specific, active process that is exhibited by a subset of the total 

rhizosphere bacterial community, termed rhizobacteria, which is known to 

display a specific ability for root colonization (Kloepper 1994, 1996). The beneficial 

root colonizing rhizosphere bacteria, the so-called plant growth promoting 

rhizobacteria (PGPR), carry out important activities in the root/soil 

interfaces (Probanza et al. 2002). 

The endophytic microorganisms colonizing the root tissues develop activities 

involved in plant growth promotion and plant protection (Kloepper 

1994; Chanway 1996; Sturz et al. 2000; Sturz and Novak 2000). Even nonsymbiotic 

microorganisms may be endophytes and colonize the root tissues (Duijff 

et al. 1997; Van Loon et al. 1998). Piriformospora indica (Basidiomycota) has

een described as a plant-growth-promoting root endophyte (Varma et al. 

1999). However, because this chapter deals only with rhizobacteria, these, and 

other fungal endophytes, will not be dealt with further. 

Plant symbiotic bacteria and fungi are recognized and can either include 

pathogens or mutualistic organisms. Mycorrhizal fungi and nitrogen (N 2)-fixing 

bacteria are the main mutualistic symbionts (Barea 1997). This chapter 

will focus only on mycorrhizal fungi and PGPRs. 

3 Mycorrhizal Fungi 

20 Mycorrhizal Fungi and Plant Growth Promoting Rhizobacteria 353 

The roots of most plant species associate with certain soil fungi and establish 

what are known as mycorrhiza (Smith and Read 1997). Mycorrhizal functions 

include improvement of plant establishment, enhancement of nutrient 

uptake, protection against cultural and environmental stresses, and the 

improvement of soil structure (Barea et al. 1997). 

Mycorrhizal symbiosis can be found in nearly all types of ecological situations, 

and most plant species are able to form this symbiosis naturally, the 

most common type involved in the normal cropping systems is the arbuscular 

mycorrhizal (AM) type (Smith and Read 1997). The responsible AM fungi 

belong to the order Glomales in the Zygomycetes (Morton and Redecker 

2001), and are a very common group of soil-borne fungi whose origin and 

divergence date back 100–400 million years ago (Simon et al. 1993; Morton 

2000; Redecker et al. 2000). However, a new fungal phylum, the Glomeromycota 

have recently been proposed (Schübler et al. 2001). Because this chapter 

focuses only on arbuscular mycorrhizas, the term “AM fungi” will be used to 

refer to “arbuscular mycorrhizal fungi”. 

During the process of AM formation (Giovannetti 2000), in which the plant 

“accepts” the fungal colonization without any significant rejection reaction 

(Dumas-Gaudot et al. 2000), a series of root–fungus interactions allows the 

integration of both organisms. The establishment of the symbiosis is the 

result of a continuous molecular “dialogue” between plant and fungus, as 

exerted through the exchange of both recognition and acceptance signals 

(Vierheilig and Piché 2002). The result of this dialogue will finally depend on 

the genome expression of both partners (Gianinazzi-Pearson et al. 1996; 

Franken and Requena 2001). 

After the biotrophic colonization of the root cortex, AM fungi develop an 

external mycelium which is a bridge connecting the root with the surrounding 

soil microhabitats. Such mycorrhizal (fungal-root) symbiosis is critical in 

nutrient cycling in soil–plant systems (Smith and Read 1997). In cooperation 

with other soil organisms, the external AM fungal mycelium forms water-stable 

aggregates necessary for good soil tilth (Miller and Jastrow 2000; Requena 

et al. 2001). The AM symbiosis also improves plant health through increased 

protection against biotic and abiotic stresses (Bethlenfalvay and Linderman

354 


1992; Azcón-Aguilar and Barea 1996; Linderman 2000; Miller and Jastrow 

2000; Augé 2001; Requena et al. 2001; Werner et al. 2002). 

Recent developments in molecular biology are being applied to the genetic 

characterization of AM fungi based on PCR-based approaches (Sanders et al. 

1996; Helgason et al. 1998; Ferrol et al. 2000). During the last few years, the 

analysis of ribosomal genes (rRNA) has demonstrated the polymorphism of 

these genes in AM fungi, particularly those corresponding to the small ribosomal 

subunit 18S, therefore permitting phylogeny and diversity studies 

(Clapp et al. 1995; Redecker et al. 1997; van Tuinen et al. 1998; Redecker et al. 

2000; Daniell et al. 2001; Schübler et al. 2001). Novel techniques currently 

developed for microbial molecular ecology studies, such as PCR-single-strand 

conformation polymorphism (SSCP) and PCR-temperature gradient gel electrophoresis 

(TGGE), are being adapted for the characterization of different 

ecotypes of AM fungi, both in soil and in roots (Kjoller and Rosendahl 2000). 

Since AM fungi are obligate symbionts, they must multiply on living roots. 

This is a limitation for inocula production (Azcón-Aguilar and Barea 1997). 

However, several substrates and procedures have been described for inoculum 

production and application in horticulture/fruit culture/forestry (Gianinazzi 

et al. 1990; Vestberg and Estaun 1994; Lobato et al. 1995; Varma and 

Schüepp 1995; Calvet et al. 1996; Sylvia 1998; Azcón-Aguilar et al. 2000; 

Mohammad et al. 2000). The Federation of European Mycorrhizal Inoculum 

Producers has been established. 

4 Plant Growth Promoting Rhizobacteria 

The beneficial root colonizing rhizosphere bacteria, the so-called plant 

growth promoting rhizobacteria (PGPR), are defined by three intrinsic characteristics: 

(1) they must have the ability to undergo root colonization, (2) 

they must survive and multiply in microhabitats associated with the root surface, 

in competition with native microbiota, at least for the time needed to 

express their plant promotion activities, and (3) they must have the ability to 

promote plant growth (Kloepper 1994). The PGPR are known to carry out 

many important ecosystem processes, such as those involved in the biological 

control of plant pathogens, nutrient cycling and/or seedling establishment 

(Haas et al. 1991; Kloepper et al. 1991; Lugtenberg et al. 1991; Lemanceau and 

Alabouvette 1993; O’Gara et al. 1994; Weller and Thomashow 1994; Broek and 

Vanderleyden 1995; Glick 1995; Bashan and Holguin 1998; Barea 2000; 

Probanza et al. 2002). Many bacterial taxa include PGPR strains with 

Pseudomonas and Bacillus as the most commonly described genera possessing 

PGPR ability, and some strains from these and other genera are used as 

seed inoculants (Kloepper 1994; Bertrand et al. 2001; Probanza 2002). 

Azospirillum sp. are considered PGPR (Bashan 1999; Bashan and Gonzalez 

1999) and are used as seed inoculants under field conditions (Dobbelaere et


al. 2001). The main activity of these bacteria is associated with the production 

of auxin-type phytohormones (Dobbelaere et al. 1999). The production and 

significance of auxins have been investigated at the molecular level (van de 

Broek et al. 1999; Lambrecht et al. 2000). 

Several systems for studying rhizosphere colonization by PGPR have been 

proposed, the one described by Simons et al. (1996) appears interesting, not 

only for testing the PGPR ability, but also to investigate PGPR/plant root interactions. 

It is known that several bacterial cell surface properties could be involved 

in the adhesion of PGPR to roots that may be either nonspecific based on electrostatic 

forces, or involve specific recognition between the surfaces. In this 

context, root surface glyco-proteins and several different bacterial exo-polysaccharides 

could be involved (Weller and Thomashow 1994). In some PGPR, 

fimbriae (pili) may function in the adherence of cells to roots, but the contribution 

of flagella to the colonization process apparently depends on the PGPR 

strain, plant species and type of soil (Kloepper 1994).A sugar-binding protein 

system has been described in Azospirillum related to chemostaxis and root 

colonization (van Bastelaere et al. 1999). 

Novel techniques for microbial community fingerprinting are being developed 

(Kozdroj and van Elsas, 2000), and these are being adapted for the 

genetic characterization of PGPR. For example, the approach used by Zinniel 

et al. (2002), based on the 16S rRNA gene amplification and sequencing, has 

been proposed for the genetic characterization of endophytic bacteria, while 

Bertrand et al. (2001) identify PGPR 16S rDNA sequence analysis. The molecular 

bases of rhizosphere colonization have recently been reviewed (Lugtenberg 

et al. 2001). Siciliano and Germida (1998) proposed the use of BIOLOG 

analysis and fatty acid methyl ester profiles to study PGPR behavior after 

inoculation, particularly the effects on root-associated microbial populations. 

Confocal laser scanning microscopy is being used for studying the 

microorganisms/plant root interactions, for example, to detect a currently 

used marker such as the green fluorescent protein (Lagopodi et al. 2002) or to 

localize colonizing bacteria by fluorescence and in situ hybridization, after 

staining with the fluorescent Live/Dead BacLight dye (Bianciotto et al. 2000, 

2001). 

The molecular bases of the biocontrol ability of these rhizobacteria have 

been investigated in the last few years (Keel et al. 1992; O’Gara et al. 1994; 

Cook et al. 1995; Tomashow and Weller 1995; Chin-A-Woeng et al. 2001; 

Moenne-Loccos et al. 2001), and systemic induced resistance has been argued 

as a mechanism of disease suppression by endophytes (Duijff et al. 1998), or 

other PGPR (Defago and Keel 1995; Chin-A-Woeng et al. 2001).

356 


5 Reasons for Studying Arbuscular Mycorrhizal Fungi and 

Plant Growth Promoting Rhizobacteria Interactions and 

Main Scenarios 

Since they share common habitats, i.e., the root surface, and common functions, 

the AM fungi and PGPR have to interact during their processes of root 

colonization or functioning as root-associated microorganisms. In fact, just 

like any soil other inhabitant, the AM fungi are immersed in the framework of 

microbial interactions characteristic of soil microbiota relationships (Barea 

1997). Soil microorganisms, particularly PGPR, can influence AM formation 

and function and, conversely, mycorrhizas can affect the microbial populations, 

particularly PGPR in the rhizosphere (Azcón-Aguilar and Barea 1992; 

Linderman 1992, 1994; Fitter and Garbaye 1994; Barea 1997, 2000). The analysis 

of microbe – microbe interactions is crucial to an understanding of the 

events which occur at the root – soil interface and, particularly, to those 

related to the microbial colonization of the root surface, or the processes of 

root infection/colonization by pathogens or mutualistic symbionts (Lynch 

1990). 

These interactions must be taken into consideration when trying to manage 

AM fungi and PGPR for the biological control of plant pathogens or for 

the biogeochemical cycling of plant nutrients (Barea et al. 1997, 2002). 

Information is accumulating with regard to cell-to-cell interactions 

between AM fungi and PGPR. Bianciotto et al. (1996a, b, 2000, 2001) and Bonfante 

and Perotto (2000) investigated whether PGPR attach to the structures 

of the AM fungi by means of a direct cell-to-cell interaction. Attachment of 

rhizobia and pseudomonads to the spores and fungal mycelium of Gigaspora 

margarita was visualized by a combination of electron and confocal microscopy. 

The results showed that both rhizobia and pseudomonads adhere to 

spores and hyphae of AM fungi germinated in vitro, although the degree of 

attachment depended upon the strain. Bianciotto et al. (1996b) showed that 

extracellular material of bacterial origin containing cellulose, which was produced 

around the attached bacteria, may mediate fungal/bacterial interactions. 

They also support the fact that AM fungi could act as a vehicle for the 

colonization of plant roots by PGPR, as previously suggested (Boddey et al. 

1991). 

Bianciotto et al. (1996b) demonstrated that there were no specific receptors 

for the bacteria on the fungal structures and that physicochemical factors 

govern attachment to fungal surfaces. Electrostatic interactions may, therefore, 

play a key role in the early stages of adhesion and cellulose fibrils may be 

later involved to guarantee a stable attachment. The complex interactions 

involving the tripartite system composed by AM fungi/bacteria/plant have 

recently being reviewed (Bonfante and Perotto 2000).


6 Effect of Plant Growth Promoting Rhizobacteria on 

Mycorrhiza Formation 

Microbial populations in the rhizosphere are known to either interfere with or 

benefit AM establishment (Germida and Walley 1996; Vosátka and Gryndler 

1999). Deleterious rhizosphere bacteria (Nehl et al. 1996) and mycoparasitic 

relationships (Jeffries 1997), have been found to interfere with AM formation, 

while many microorganisms can improve AM formation and/or functioning 

(Barea 1997). One example of the beneficial effects is that of the so-called 

mycorrhiza-helper-bacteria which are known to stimulate mycelial growth of 

mycorrhizal fungi and/or enhance mycorrhizal formation (Garbaye 1994; 

Azcón-Aguilar and Barea 1995; Barea 1997; Frey-Klett et al. 1997; Gryndler 

and Hrselova 1998; Gryndler 2000; Gryndler et al. 2000). Soil microorganisms 

can produce compounds that increase root cell permeability and are able to 

increase the rates of root exudation. This, in turn, would stimulate mycorrhizal 

fungal mycelia in the rhizosphere or facilitate root penetration by the 

fungus. Plant hormones, as produced by soil microorganisms, are known to 

affect mycorrhiza establishment (Azcón-Aguilar and Barea 1992, 1995; Barea 

1997, 2000). 

Rhizosphere microorganisms are also known to affect the pre-symbiotic 

stages (Giovannetti 2000) of mycorrhizal developments, like spore germination 

rate and mycelial growth (Azcón-Aguilar and Barea, 1992, 1995). 

It is noteworthy that antibiotic-producing Pseudomonas sp. (Barea et al. 

1998; Vazquez et al. 2000) did not interfere with mycorrhiza formation or 

functioning. 

7 Effect of Mycorrhizas on the Establishment of Plant 

Growth Promoting Rhizobacteria in the Rhizosphere 

The establishment of the AM fungus in the root cortex is known to change 

many key aspects of plant physiology. These include the mineral nutrient 

composition in plant tissues, the hormonal balance and the patterns of C allocation 

(Harley and Smith 1983; Azcón-Aguilar and Bago 1994; Smith et al. 

1994). Therefore, the AM symbiotic status changes the chemical composition 

of root exudates while the development of an AM soil mycelium introduces 

physical modifications into the environment surrounding the roots. The AM 

soil mycelium represents a carbon source to microbial communities which is 

an important contribution through interactions with components of the 

microbiota to improve plant growth and health, and soil quality (Bethlenfalvay 

and Schüepp 1994). 

Arbuscular mycorrhizal-induced changes in plant physiology affect, both 

quantitatively and qualitatively, the microbial populations in either the rhizosphere 

and/or the rhizoplane (Azcón-Aguilar and Barea 1992; Linderman

358 


1992; Barea 1997; Cordier et al. 1999; Barea 2000; Gryndler 2000). This situation 

creates the “rhizosphere of a mycorrhizal plant”. However, there are specific 

modifications in the environment surrounding the AM mycelium itself, 

which develop what it known as the mycorrhizosphere (Linderman 1992; 

Barea 2000; Grynler 2000). In addition to this term, the soil space affected by 

extraradical hyphae is also called the mycosphere (Linderman 1988) or 

hyphosphere as an analogy to the term rhizosphere (Gryndler 2000). Large 

numbers of bacteria (including actinomycetes) and fungi can be associated 

with AM fungal structures (Filippi et al. 1998; Budi et al. 1999). Since the AM 

mycelium releases energy-rich organic compounds, an increased growth and 

activity of microbial saprophytes are expected to occur in the mycorrhizosphere. 

However, the enrichment of this particular environment with organic 

compounds is much lower than that of the rhizosphere, which corresponds to 

lower counts of bacteria in mycorrhizospheric soil, compared to those in the 

rhizosphere (Andrade et al. 1997).Apparently, there is a preferential establishment 

of Gram-negative bacteria in the hyphosphere (Vosátka 1996). 

It has been demonstrated that mycorrhizal colonization changes some 

morphological parameters in developing root systems (Atkinson et al. 1994; 

Berta et al. 1995), with a greater root branching as the most commonly 

described effect. Undoubtedly these changes must affect the establishment 

and activity of microorganisms in the mycorrhizosphere environment. 

The establishment of PGPR inoculants in the rhizosphere can be affected 

by AM fungal co-inoculation (Christensen and Jakobsen 1993; Puppi et al. 

1994; Barea 1997; Andrade et al. 1998; Ravnskov et al. 1999). In particular, AM 

inoculation improved the establishment of both inoculated and indigenous 

phosphate-solubilizing rhizobacteria (Toro et al. 1997; Barea et al. 2002). 

Interestingly, mycorrhizal fungi improved rhizosphere colonization by 

Pseudomonas sp. and root colonization by Azospirillum sp. (Klyuchnikov and 

Kozhevin 1990). Moreover, several experiments, reviewed by Nehl et al. (1996), 

suggest that mycorrhizal colonization may affect whether a given rhizobacterium 

functions as a PGPR, or as a DRB. 

In spite of the fact that most of the reports support the beneficial effects of 

mycorrhizas on the establishment of PGPR inoculants, detrimental effects 

have also been found (Waschkies et al. 1994; Marschner and Crowley 1996a, b; 

Barea et al. 1997). 

As indicated previously, an extreme case of close interactions is that of 

Burkholderia-like bacteria as endosymbionts in AM fungi of the Gigasporaceae 

(Bianciotto et al. 2000; Ruiz-Lozano and Bonfante 2000).


8 Interactions Involved in Nutrient Cycling and Plant 

Growth Promotion 

It is well known that soil microorganisms are able to change the bioavailability 

of mineral plant nutrients, and this ability has been shown by soil bacteria 

probed to have PGPR activity and, in some cases, be used as plant inoculants 

(Barea et al. 1997; Probanza et al. 2002). Several experiments have described 

the improvement of plant growth and nutrition by means of synergistic interactions 

between PGPR and AM fungi (Barea 2000). It has also been suggested 

that a certain level of selectivity (“specificity”) is involved in these interactions 

(Azcón 1989). From the perspective of sustainability, the re-establishment 

of nutrient cycles after any process of soil degradation is of interest, as 

is the understanding of the microbial interactions responsible for the subsequent 

management of such natural resources, either for a low-input agricultural 

technology (Bethlenfalvay and Linderman 1992; Gianinazzi and 

Schüepp 1994; Jeffries and Barea 2001), or for the re-establishment of the natural 

vegetation in a degraded area (Miller and Jastrow 1994, 2000; Requena et 

al. 2001). Most of the information on this topic concerns N and P cycling 

(Barea 2000). 

In spite of this, Rhizobium sp. (general term) are not considered among the 

PGPR types; due to the relevance of their interaction with AM fungi, it would 

be interesting to make some comments on this. A great deal of work has been 

carried out on the tripartite symbiosis legume (general term) – mycorrhiza- 

Rhizobium (Azcón-Aguilar and Barea 1992; Barea et al. 1992; Barea 2000). The 

inoculation of AM fungi has been shown to improve nodulation and N 2 fixation. 

Using the isotope 15 N has made it possible to ascertain and quantify the 

amount of N which is actually fixed in a particular situation, and measure the 

contribution of the AM symbiosis to the process (Barea et al. 1992). The physiological 

and biochemical mechanisms underlying the AM fungi x Rhizobium 

interactions to improve legume productivity have also been discussed. In 

spite of the main AM effect in enhancing Rhizobium activity mediated by a 

generalized stimulation of host nutrition, more localized effects may occur at 

the root or nodule level (Barea et al. 1992). Interactions can also take place at 

either the pre-colonization stages, when both microorganisms interact as rhizosphere 

inhabitants, or during the development of the tripartite symbiosis 

(Azcón-Aguilar and Barea 1992). The influence of host and/or bacterial genotypes 

in these interactions has also been discussed, suggesting a certain level 

of specificity (Azcón et al. 1991; Ruiz-Lozano and Azcón 1993; Monzón and 

Azcón 1996). 

Multimicrobial interactions including AM fungi, Rhizobium sp. and PGPR 

have also been tested (Requena et al. 1997). Target microorganisms were isolated 

from a representative area of a desertification-threatened semi-arid 

ecosystem in the south-east of Spain. Microbial isolates were characterized 

and screened for effectiveness in soil microcosms. Anthyllis cytisoides L., an

360 


AM-dependent pioneer legume, dominant in the target Mediterranean 

ecosystem, was the test plant. Several microbial cultures from existing collections 

were also included in the screening process. In general, the results support 

the importance of physiological and genetic adaptation of microbes to 

the environment, thus the use of efficient local isolates is recommended. Several 

microbial combinations were effective in improving plant development, 

nutrient uptake, N 2 -fixation ( 15 N) and root system quality. 

The interactions between AM fungi and Rhizobium have been demonstrated 

to be beneficial under drought conditions (Goicoechea at al. 1997, 

1998; Ruiz-Lozano et al. 2001). 

There is also evidence that Rhizobium strains are able to colonize the rhizosphere 

of nonlegume hosts where they establish positive interactions with 

AM fungi and behave as PGPR (Schloter et al. 1997; Galleguillos et al. 2000). 

In spite of the fact that Azospirillum are known to benefit plant development, 

N acquisition and yield under appropriate conditions (Okon 1994; 

Bashan 1999; Dobbelaere et al. 2001), it has been demonstrated that these bacteria 

mainly act by influencing the morphology, geometry and physiology of 

the root system. Interactions between AM fungi and Azospirillum have been 

reviewed by Volpin and Kapulnik (1994) and it has been demonstrated that 

Azospirillum could enhance mycorrhizal formation and response while AM 

fungi may improve Azospirillum establishment in the rhizosphere. 

Since some PGPR may improve nodulation by Rhizobium sp. (Halverson 

and Handelsman 1991; Staley et al. 1992; Azcón 1993), certain PGPR-Rhizobium 

interactions could be relevant to mycorrhizosphere interactions. 

The interactions related to P-cycling have also received much attention. 

These are based on the fact that phosphate ions solubilized by free-living 

microorganisms from sparingly soluble inorganic and organic P compounds 

(Whitelaw 2000) increase the soil phosphate pools available for the extraradical 

AM mycelium to benefit plant nutrition (Smith and Read 1997). Several 

experiments have demonstrated synergistic microbial interactions involving 

phosphate-solubilizing rhizobacteria (PSB) and mycorrhizal fungi (Barea et 

al. 1997; Kim et al. 1998). The interactive effect of PSB and mycorrhizal fungi 

on plant use of soil P sources of low bioavailability was evaluated by using 32 P 

isotopic dilution approaches (Toro et al. 1997, 1998). The PSB behaved as mycorrhiza-helper-bacteria, 

promoting mycorrhiza establishment by both the 

indigenous and the inoculated mycorrhiza. Conversely, mycorrhiza formation 

increased the size of the PSB population. Because the bacteria did not change 

root weight, length or specific root length, they probably acted by improving 

the pre-colonization stages of mycorrhiza formation. The dual inoculation 

treatment significantly increased biomass and N and P accumulation in plant 

tissues and these dually inoculated plants displayed lower specific activity 

( 32 P/ 31 P) than their comparable controls, suggesting that the mycorrhizal and 

bacterized plants were using P sources (endogenous or added as rock phosphate) 

otherwise unavailable to the plant. It, therefore appears that these rhi-


zosphere/mycorrhizosphere interactions contributed to the biogeochemical P 

cycling, thereby promoting plant nutrition. The interactive effect of PSB, AM 

fungi and Rhizobium with regard to improving the agronomic efficiency of 

rock phosphate for legume crops (Medicago sativa), was evaluated by using 

isotopic techniques under controlled conditions, and further validated under 

field conditions (Barea et al. 2002). It was demonstrated that the microbial 

interactions tested improved plant growth and N and P acquisition under 

normal cultivation. Similar results were obtained by using Medicago arborea, 

a woody legume of interest for revegetation and biological reactivation of 

desertified semi-arid Mediterranean ecosystems (Valdenegro et al. 2001). 

9 Interactions for the Biological Control of Root Pathogens 

Once the AM status has been established in plant roots, reduced damage 

caused by soil-borne plant pathogens has been shown. To account for this, 

several mechanisms have been suggested to explain the enhancement of plant 

resistance/tolerance in mycorrhizal plants (Linderman 1994, 2000; Azcón- 

Aguilar and Barea 1992, 1996). One of the proposed mechanisms is based on 

the microbial changes produced in the mycorrhizosphere. In this context, 

there is strong evidence that these microbial shifts occur, and that the resulting 

microbial equilibria could influence the growth and health of the plants. 

Although this effect has not been assessed specifically as a mechanism for 

AM-associated biological control, there are indications that such a mechanism 

could be involved (Azcón-Aguilar and Barea 1992, 1996; Linderman 

1994, 2000). In any case, it has been demonstrated that such an effect is dependent 

on the AM fungus involved, as well as the substrate and host plant 

(Azcón-Aguilar and Barea 1996; Linderman 2000). 

Since specific PGPR antagonistic to root pathogens are being used as biological 

control agents (Alabouvette et al. 1997), it has been proposed to try to 

exploit the prophylactic ability of AM fungi in association with these antagonists 

(Linderman 1994, 2000; Azcón-Aguilar and Barea 1996; Barea et al. 1998; 

Budi et al. 1999). Experimental evidence is accumulating, but the information 

is still too scarce to make general conclusions. 

Several studies have demonstrated that microbial antagonists of fungal 

pathogens, either fungi or PGPR, do not exert any anti-microbial effect 

against AM fungi (Calvet et al. 1993; Barea et al. 1998; Edwards et al. 1998; 

Vazquez et al. 2000; Werner et al. 2002). This is a key point to exploit the possibilities 

of dual (AM fungi and PGPR) inoculation in plant defense against 

root pathogens. 

In particular, Barea et al. (1998) carried out a series of experiments to test 

the effect of Pseudomonas spp. producing 2,4-diacetylphloroglucinol (DAPG) 

on AM formation and functioning. Three Pseudomonas strains were tested for 

their effects on AM fungi: a wild type (F113) producing the antifungal com-

362 


pound DAPG; the genetically modified strain (F113G22), a DAPG-negative 

mutant of F113; and another genetically modified strain [F113 (pCU203)], a 

DAPG-overproducer. The results from in vitro and in soil experiments 

demonstrate no negative effects of these Pseudomonas strains on spore germination, 

and a stimulation of hyphal growth of the AM fungus Glomus 

mosseae. Concentrations of the antifungal compound DAPG which were far in 

excess of those reached in the rhizosphere of Pseudomonas-inoculated plants 

exhibited negative effects on germination of AM fungal spores, but more realistic 

concentrations of DAPG did not affect AM fungal development. A soil 

microcosm system was also used to evaluate the effect of these bacteria on the 

process of AM formation. No significant difference in AM formation on 

tomato plants between F113, F113G22 and F113 (pCU203) was observed, with 

the F113 and F113G22 strains resulting in a significant increase in the percentage 

of the root system becoming mycorrhizal. Therefore, these strains 

behaved as MHB. In a field experiment, none of these Pseudomonas strains 

affected: (1) number and diversity of AM fungal native population; (2) the 

percentage of root length that became mycorrhizal; (3) AM performance. Furthermore, 

the antifungal Pseudomonas improved plant growth and nutrient 

(N and P) acquisition by the mycorrhizal plants (Barea et al. 1998). 

Acknowledgements. This work was supported by CICyT (REN2000–1506 project), Spain, 

and GENOMYCA (QLK5–2000–01319 project), ECO-SAFE (QLK3–2000–31759 project), 

and INCO-DEV (ICA4-CT-2001–10057) UE. 


Alabouvette C, Schippers B, Lemanceau P, Bakker PAHM (1997) Biological control of 

fusarium-wilts: towards development of commercial product. In: Boland GJ, Kuykendall 

LD (eds) Plant microbe interactions and biological control. Marcel Dekker, 




192:71–79 

Andrade G, Mihara KL, Linderman RG, Bethlenfalvay GJ (1998) Soil aggregation status 

and rhizobacteria in the mycorrhizosphere. Plant Soil 202:89–96 

Atkinson S, Berta G, Hooker JE (1994) Impact of mycorrhizal colonisation on root architecture, 

root longevity and the formation of growth regulators. In: Gianinazzi S, 

Schüepp H (eds) Impact of arbuscular mycorrhizas on sustainable agriculture and 

natural ecosystems. ALS, Birkhäuser, Basel, Switzerland, pp 47–60 

Augé RM (2001) Water relations, drought and vesicular-arbuscular mycorrhizal symbiosis. 

Mycorrhiza 11:3–42 

Azcón R (1989) Selective interaction between free-living rhizosphere bacteria and vesicular-arbuscular 

mycorrhizal fungi. Soil Biol Biochem 21:639–644 

Azcón R (1993) Growth and nutrition of nodulated mycorrhizal and non-mycorrhizal 

Hedysarum coronarium as a result of treatments with fractions from a plant growthpromoting 

rhizobacteria. Soil Biol Biochem 25:1037–1042


Azcón R, Rubio R, Barea JM (1991) Selective interactions between different species of 

mycorrhizal fungi and Rhizobium meliloti strains, and their effects on growth, N 2 -fixation 

( 15 N) and nutrition of Medicago sativa L. New Phytol 117:399–404 

Azcón-Aguilar C, Barea JM (1992) Interactions between mycorrhizal fungi and other 

rhizosphere microorganisms. In: Allen MJ (eds) Mycorrhizal functioning.An integrative 

plant-fungal process. Routledge, Chapman and Hall, New York, pp 163–198 

Azcón-Aguilar C, Bago B (1994) Physiological characteristics of the host plant promoting 

an undisturbed functioning of the mycorrhizal symbiosis. In: Gianinazzi S, 


natural ecosystems. ALS, Birkhäuser, Basel, Switzerland, pp 47–60 

Azcón-Aguilar C, Barea JM (1995) Saprophytic growth of arbuscular-mycorrhizal fungi. 

In: Hock B, Varma A (eds) Mycorrhiza structure function, molecular biology and 


Azcón-Aguilar C, Barea JM (1996) Arbuscular mycorrhizas and biological control of 

soil-borne plant pathogens. An overview of the mechanisms involved. Mycorrhiza 

6:457–464 

Azcón-Aguilar C, Barea JM (1997) Applying mycorrhiza biotechnology to horticulture: 

significance and potentials. Sci Hortic 68:1–24 

Azcón-Aguilar C, Palenzuela EJ, Barea JM (2000) Substrato para la producción de inóculos 

de hongos formadores de micorrizas. Patente N. 9901814, Spain, CSIC 

Barea JM (1997) Mycorrhiza/bacteria interactions on plant growth promotion. In: 

Ogoshi A, Kobayashi L, Homma Y, Kodama F, Kondon N, Akino S (eds) Plant growthpromoting 

rhizobacteria, present status and future prospects. OECD, Paris, pp 

150–158 

Barea JM (2000) Rhizosphere and mycorrhiza of field crops. In: Toutant JP, Balazs E, 

Galante E, Lynch JM, Schepers JS, Werner D, Werry PA (eds) Biological resource management: 

connecting science and policy (OECD). INRA, Editions and Springer, Berlin 


Barea JM, Azcón R, Azcón-Aguilar C (1992) Vesicular-arbuscular mycorrhizal fungi in 

nitrogen-fixing systems. In: Norris JR, Read DJ,Varma AK (eds) Methods in microbiology. 

Academic Press, London, pp 391–416 

Barea JM, Azcón-Aguilar C, Azcón R (1997) Interactions between mycorrhizal fungi and 

rhizosphere microorganisms within the context of sustainable soil-plant systems. In: 

Gange AC, Brown VK (eds) Multitrophic interactions in terrestrial systems. Blackwell 

Science, Oxford, pp 65–77 

Barea JM, Andrade G, Bianciotto V, Dowling D, Lohrke S, Bonfante P, O’Gara F, Azcón- 

Aguilar C (1998) Impact on arbuscular mycorrhiza formation of Pseudomonas strains 

used as inoculants for the biocontrol of soil-borne plant fungal pathogens. Appl Environ 

Microbiol 64:2304–2307 

Barea JM, Toro M, Orozco MO, Campos E,Azcón R (2002) The application of isotopic ( 32 P 

and 15 N) dilution techniques to evaluate the interactive effect of phosphate-solubilizing 

rhizobacteria, mycorrhizal fungi and Rhizobium to improve the agronomic efficiency 

of rock phosphate for legume crops. Nutr Cycl Agroecosyst 63:35–42 

Bashan Y (1999) Interactions of Azospirillum spp. in soils: a review. Biol Fertil Soils 

29:246–256 

Bashan Y, Holguin G (1998) Proposal for the division of plant growth-promoting rhizobacteria 

into two classifications: biocontrol-PGPB (plant growth-promoting bacteria) 

and PGPB. Soil Biol Biochem 30:1225–1228 

Bashan Y, Gonzalez LE (1999) Long-term survival of the plant-growth-promoting bacteria 

Azospirillum brasilense and Pseudomonas fluorescens in dry alginate inoculant. 

Appl Microbiol Biotechnol 51:262–266

364 


Berta G, Trotta A, Fusconi A, Hooker JE, Munro M, Arkinson D, Giovannetti M, Morini S, 

Fortuna P, Tisserant B, Gianinazzi-Pearson V, Gianinazzi S (1995) Arbuscular mycorrhizal 

induced changes to plant growth and root system morphology in Prunus 

cerasifera. Tree Physiol 15:281–293 

Bertrand H, Nalin R, Bally R, Cleyet-Marel JC (2001) Isolation and identification of the 

most efficient plant growth-promoting bacteria associated with canola (Brassica 

napus). Biol Fertil Soils 33:152–156 

Bethlenfalvay GJ, Linderman RG (1992) Mycorrhizae in sustainable agriculture. ASA 

Special publication No. 54, Madison, Wisconsin 

Bethlenfalvay GJ, Schüepp H (1994) Arbuscular mycorrhizas and agrosystem stability. 

In: Gianinazzi S, Schüepp H (eds) Impact of arbuscular mycorrhizas on sustainable 

agriculture and natural ecosystems. Birkhäuser, Basel, pp 117–131 

Bianciotto V, Bandi C, Minerdi D, Sironi M, Tichy HV, Bonfante P (1996a) An obligately 

endosymbiotic mycorrhizal fungus itself harbors obligately intracellular bacteria. 


Bianciotto V, Minerdi D, Perotto S, Bonfante P (1996b). Cellular interactions between 

arbuscular mycorrhizal fungi and rhizosphere bacteria. Protoplasma 193:123–131 

Bianciotto V, Lumini E, Lanfranco L, Minerdi D, Bonfante P, Perotto S (2000) Detection 

and identification of bacterial endosymbionts in arbuscular mycorrhizal fungi 

belonging to the family Gigasporaceae. Appl Environ Microbiol 66:4503–4509 

Bianciotto V, Andreotti S, Balestrini R, Bonfante P, Perotto S (2001) Mucoid mutants of 

the biocontrol strain Pseudomonas fluorescens CHA0 show increased ability in 

biofilm formation on mycorrhizal and nonmycorrhizal carrot roots. Mol Plant 


Boddey RM, Urquiaga S, Reis V, Döbereiner J (1991). Biological nitrogen fixation associated 

with sugar cane. Plant Soil 137:111–117 

Bonfante P, Perotto S (2000) Outside and inside the roots: cell-to-cell interactions among 

arbuscular mycorrhizal fungi, bacteria and host plants. In: Podila GK, Douds DD Jr 

(eds) Current advances in mycorrhizae research. APS Press, St. Paul, MN, pp 141–155 

Bowen GD, Rovira AD (1999) The rhizosphere and its management to improve plant 

growth. Adv Agron 66:1–102 

Broek AV,Vanderleyden J (1995) Genetics of the Azospirillum-plant root association. Crit 

Rev Plant Sci 14:445–466 

Budi SW,Van Tuinen D, Martinotti G, Gianinazzi S (1999) Isolation from Sorghum bicolor 

mycorrhizosphere of a bacterium compatible with arbuscular mycorrhiza development 

and antagonistic towards soilborne fungal pathogens. Appl Environ Microbiol 

65:5148–5150 

Calvet C, Pera J, Barea JM (1993) Growth response of marigold (Tagetes erecta L.) to inoculation 

with Glomus mosseae, Trichoderma aureoviride and Phythium ultimum in a 

peat-perlite mixture. Plant Soil 148:1–6 

Calvet C, Camprubi A, Rodriguez-Kabana R (1996) Inclusion of arbuscular mycorrhizal 

fungi in alginate films for experimental studies and plant inoculation. Hortscience 

31:285 

Chanway CP (1996) Endophytes: they’re not just fungi! Can J Bot 74:321–322 

Chin-A-Woeng TFC, Thomas-Oates JE, Lugtenberg BJJ, Bloemberg GV (2001) Introduction 

of the phzH gene of Pseudomonas chlororaphis PCL 1391 extends the range of 

biocontrol ability of phenazine-1 carboxylic acid producing Pseudomonas. Mol Plant- 


Christensen H, Jakobsen I (1993) Reduction of bacterial growth by a vesicular-arbuscular 

mycorrhizal fungus in the rhizosphere of cucumber (Cucunis sativus L). Biol Fertil 

Soils 15:253–258 

Clapp JP, Young JPW, Merryweather JW, Fitter AH (1995) Diversity of fungal symbionts 

in arbuscular mycorrhizas from a natural community. New Phytol 130:259–265


Cook RJ, Thomashow LS, Weller DM, Fujimoto D, Mazzola M, Bangera G, Kim DS (1995) 

Molecular mechanisms of defense by rhizobacteria against root disease. Proc Natl 

Acad Sci USA 92:4197–4201 

Cordier C, Lemoine MC, Lemanceau P, Gianinazzi-Pearson V, Gianinazzi S (1999) The 

beneficial rhizosphere: a necessary strategy for microplant production. Acta Hortic 

530:259–265 

Daniell TJ, Husband R, Fitter AH, Young JPW (2001) Molecular diversity of arbuscular 

mycorrhizal fungi colonising arable crops. FEMS Microbiol Ecol 36: 203–209 

Defago G, Keel C (1995) Pseudomonads as biocontrol agents of diseases caused by soilborne 

pathogens In: Hokkanen HMT, Lynch JM (eds) Benefits and risks of introducing 

biocontrol agents. University Press, Cambridge 

Dobbelaere S, Croonenborghs A, Thys A, Vande Browk A, Vanderleyden J (1999) Phytostimulatory 

effect Azospirillum brasilense strains and auxins on wheat. Plant Soil 

212:155–164 

Dobbelaere S, Croonenborghs A, Thys A, Ptacek D, Vanderleyden J, Dutto P, Labandera- 

Gonzalez C, Caballero-Mellado J, Aguirre JF, Kapulnik Y, Brener S, Burdman S, 

Kadouri D, Sarig S, Okon Y (2001) Response of agronomically important crops to 

inoculation with Azospirillum. Aust J Plant Physiol 28:1–9 

Duijff BJ, Gianinazzi-Pearson V, Lemanceau P (1997) Involvement of the outer membrane 

lipopolysaccharides in the endophytic root colonization of tomato roots by 

biocontrol Pseudomonas fluorescens strain WCS417r. New Phytol 135:325–334 

Duijff BJ, Pouhair D, Olivain C, Alabouvette C, Lemanceau P (1998) Implication of systemic 

induced resistance in the suppression of fusarium wilt of tomato by 

Pseudomonas fluorescens WCS417r and nonpathogenic Fusarium oxysporum Fo47. 

Eur J Plant Pathol. 104:903–910 

Dumas-Gaudot E, Gollotte A, Cordier C, Gianinazzi S, Gianinazzi-Pearson V (2000) Modulation 

of host defence systems In: Kapulnick Y, Douds Jr DD (eds) Arbuscular mycorrhizas: 

physiology and functions. Kluwer, Dordrecht, pp 121–140 

Edwards SG,Young JPW, Fitter AH (1998) Interactions between Pseudomonas fluorescens 

biocontrol agents and Glomus mosseae, an arbuscular mycorrhizal fungus, within the 

rhizosphere. FEMS Microbiol Lett 116:297–303 

Ferrol N, Barea JM, Azcón-Aguilar C (2000) The plasma membrane H + -ATPase genes 

family in the arbuscular mycorrhizal fungus Glomus mosseae. Curr Genet 37:112–118 

Filippi C, Bagnoli G, Citernesi AS, Giovannetti M (1998) Ultrastructural spatial distribution 

of bacteria associated with sporocarps of Glomus mosseae. Symbiosis 24:1–12 

Fitter AH, Garbaye J (1994). Interactions between mycorrhizal fungi and other soil 

organisms. Plant Soil 159: 123–132 

Franken P, Requena N (2001) Analysis of gene expression in arbuscular mycorrhizas: 

new approaches and challenges. New Phytol 150:517–523 

Frey P, Frey-Klett P, Garbaye J, Berge O, Heulin T (1997) Metabolic and genotypic fingerprinting 

of fluorescent Pseudomonads associated with the Douglas Fir-Laccaria biocolor 

mycorrhizosphere. Appl Environ Microbiol 63:1852–1860 

Galleguillos C, Aguirre C, Barea JM, Azcón R (2000) Growth promoting effect of two 

Sinorhizobium meliloti strains (a wild type and its genetically modified derivative) on 

a non-legume plant species in specific interaction with two arbuscular mycorrhizal 

fungi. Plant Sci 159:57–63 

Garbaye J (1994) Helper bacteria: A new dimension to the mycorrhizal symbiosis. New 

Phytol 128:197–210 

Germida JJ, Walley FL (1996) Plant growth-promoting rhizobacteria alter rooting patterns 

and arbuscular mycorrhizal fungi colonization of field-grown spring wheat. 

Biol Fertil Soils 23:113–120 

Gianinazzi S, Schüepp H (1994) Impact of arbuscular mycorrhizas on sustainable agriculture 

and natural ecosystems. ALS, Birkhäuser, Basel

366 


Gianinazzi S, Gianinazzi-Pearson V, Trouvelot A (1990) Potentialities and procedures for 

the use of endomycorrhizas with special emphasis on high value crops. In: Whipps 

JM, Lumsden B (eds) Biotechnology of fungi for improving plant growth. Cambridge 

University Press, Cambridge, pp 41–54 

Gianinazzi-Pearson V, Dumas-Gaudot E, Gollotte A, Tahiri-Alaoui A, Gianinazzi S (1996) 

Cellular and molecular defence-related root responses to invasion by arbuscular mycorrhizal 

fungi. New Phytol 133:45–57 

Giovannetti M (2000) Spore germination and pre-symbiotic mycelial growth In: Kapulnick 

Y, Douds DD Jr (eds) Arbuscular mycorrhizas: physiology and functions. Kluwer, 

Dordrecht, pp 47–68 


41:109–117 

Goicoechea N, Antolín MC, Sánchez-Díaz M (1997) Influence of arbuscular mycorrhizae 

and Rhizobium on nutrient content and water relations in drought stressed alfalfa. 

Plant Soil 192:261–268 

Goicoechea N, Szalai G, Antolín MC, Sánchez-Díaz M, Paldi E (1998) Influence of arbuscular 

mycorrhizae and Rhizobium on free polyamines and proline levels in waterstressed 

alfalfa. J Plant Physiol 153:706–711 

Gryndler M (2000) Interactions of arbuscular mycorrhizal fungi with other soil organisms 

In: Kapulnick Y, Douds Jr DD (eds) Arbuscular mycorrhizas: physiology and 

functions. Kluwer, Dordrecht, pp 239–262 

Gryndler M, Hrselova H (1998) Effect of diazotrophic bacteria isolated from a mycelium 

of arbuscular mycorrhizal fungi on colonization of maize roots by Glomus fistulosum. 

Biol Plant 41:617–621 

Gryndler M, Hrselová H, Stríteská D (2000) Effect of soil bacteria on growth of hyphae 

of the arbuscular mycorrhizal (AM) fungus Glomus claroideum. Folia Microbiol 

45:545–551 

Haas D, Keel C, Laville J, Maurhofer M, Oberliansli T, Schnider U,Voisard C, Wüthrich B, 

Defago G. (1991) Secondary metabolites of Pseudomonas fluorescens strain CHA0 

involved in the suppression of root diseases. In: Hennecke H, Verma DPS (eds) 

Advances in molecular genetics of plant-microbe interactions. Kluwer, Dordrecht, pp 

450–456 

Halverson LJ, Handelsman J (1991) Enhancement of soybean nodulation by Bacillus 

ceresus UW95 in the field and in a growth chambers. Appl Environ Microbiol 

57:2767–2770 

Harley JL, Smith SE (1983) Mycorrhizal symbiosis. Academic Press, New York 

Helgason T, Daniell TJ, Husband R, Fitter AH,Young JPW (1998) Ploughing up the woodwide 

web? Nature 394:431 

Hiltner L (1904) Über neuere Erfahrungen und Probleme auf dem Gebiet der Bodenbakteriologie 

und unter besonderer Berücksichtigung der Gründüngung und Brache. 

Arb Dtsch Landwirtsch Ges 98:59–78 

Jeffries P (1997) Mycoparasitism. In: Wicklow DT, Södertröm BE (eds) The Mycota IV. 

Environmental and microbial relationships. Springer, Berlin Heidelberg New York, pp 

149–164 

Jeffries P, Barea JM (2001) Arbuscular mycorrhiza – a key component of sustainable 

plant-soil ecosystems. In: Hock B (ed) The Mycota. vol. IX. Fungal Associations. 


Keel C, Schnider U, Maurhofer M, Vorsand C, Laville J, Burger U, Wirthuer P, Hass D, 

Defago G (1992) Suppression of root diseases by Pseudomonas fluorescens CHAO: 

Importance of the bacterial secondary metabolite 2,4-diacetylphloroglucinol. Mol 

Plant-Microbe Interact 5:4–13


Kennedy AC (1998) The rhizosphere and spermosphere In: Sylvia DM, Fuhrmann JJ, 

Hartel PG, Zuberer DA (eds) Principles and applications of soil microbiology. Prentice 

Hall, Upper Saddle River, New Jersey, pp 389–407 

Kennedy AC, Smith KL (1995) Soil microbial diversity and the sustainability of agricultural 

soils. Plant Soil 170:75–86 

Kim KY, Jordan D, McDonald GA (1998) Effect of phosphate-solubilizing bacteria and 

vesicular-arbuscular mycorrhizae on tomato growth and soil microbial activity. Biol 


Kjoller R, Rosendahl S (2000) Detection of arbuscular mycorrhizal fungi (Glomales) in 

roots by nested PCR and SSCP (single stranded conformation polymorphism). Plant 

Soil 226:189–196 

Kloepper JW (1994) Plant growth-promoting rhizobacteria (other systems) In: Okon Y 

(ed) Azospirillum/plant associations. CRC Press, Boca Raton, pp 111–118 

Kloepper JW (1996) Host specificity in microbe-microbe interactions. BioScience 

46:406–409 

Kloepper JW, Zablotowick RM, Tipping EM, Lifshitz R (1991) Plant growth promotion 

mediated by bacterial rhizosphere colonizers. In: Keister DL, Cregan PB (eds) The rhizosphere 

and plant growth. Kluwer, Dordrecht, pp 315–326 

Klyuchnikov AA, Kozhevin PA (1990). Dynamics of Pseudomonas fluorescens and 

Azospirillum brasiliense populations in the formation of vesicular arbuscular mycorrhiza. 

Microbiologia 59:651–655 

Kozdrój J, Elsas JD van (2000) Application of polymerase chain reaction-denaturing gradient 

gel electrophoresis for comparison of direct and indirect extraction methods of 

soil DNA used for microbial community fingerprinting. Biol Fertil Soils 31:372–378 

Lagopodi AL, Ram AFJ, Lamers GEM, Punt PJ, Van den Hondel CAMJJ, Lugtenberg BJJ, 





Lambrecht M, Okon Y,Vande Broek A,Vanderleyden J (2000) Indole-3-acetic acid, a reciprocal 

signalling molecule in bacteria-plant interactions. Trends Microbiol 8:298– 

300 

Lemanceau P, Alabouvette C (1993). Suppression of fusarium-wilts by fluorescent 

pseudomonads: mechanisms and applications. Biocontrol Sci Technol 3:219–234 

Linderman RG (1988) Mycorrhizal interactions with the rhizosphere microflora. The 

mycorrhizosphere effects. Phytopathology 78:366–371 

Linderman RG (1992) Vesicular-arbuscular mycorrhizae and soil microbial interactions. 

In: Bethlenfalvay GJ, Linderman RG (eds) Mycorrhizae in sustainable agriculture. 

ASA Spec, Madison, Wisconsin, pp 45–70 

Linderman RG (1994) Role of VAM fungi in biocontrol. In: Pfleger FL, Linderman RG 

(eds) Mycorrhizae and plant health. APS Press, St Paul, pp 1–26 

Linderman RG (2000) Effects of mycorrhizas on plant tolerance to diseases. In: Kapulnik 

Y, Douds DD Jr (eds) Arbuscular mycorrhizas: physiology and function. Kluwer, Dordrecht, 

pp 345–365 

Lovato PE, Schüepp H, Trouvelot A, Gianinazzi S (1995) Application of arbuscular mycorrhizal 

fungi (AMF) in orchard and ornamental plants. In: Varma A, Hock B (eds) 

Mycorrhiza structure, function, molecular biology and biotechnology. Springer, 


Lugtenberg BJJ, Weger de LA, Bennett JW (1991) Microbial stimulation of plant growth 

and protection from disease. Curr Opin Microbiol 2:457–464 

Lugtenberg BJJ, Dekkers L, Bloemberg GV (2001) Molecular determinants of rhizosphere 

colonization by bacteria. Annu Rev Phytopathol 39:461–490

368 


Lynch JM (1990) The rhizosphere. Wiley, New York, p 462 

Marschner P, Crowley DE (1996a) Root colonization of mycorrhizal and nonmycorrhizal 

pepper (Capsicum annuum) by Pseudomonas fluorescens 2–79RL. New Phytol 

134:115–122 

Marschner P, Crowley DE (1996b) Physiological activity of a bioluminescent 

Pseudomonas fluorescens (strain 2–79) in the rhizosphere of mycorrhizal and nonmycorrhizal 

pepper (Capsicum annuum L). Soil Biol Biochem 28:869–876 

Miller RM, Jastrow JD (1994) Vesicular-arbuscular mycorrhizae and biogeochemical 

cycling. In: Pfleger FL, Linderman RG (eds) Mycorrhizae and plant health. APS Press, 

St. Paul, MN, pp 189–212 

Miller RM, Jastrow JD (2000) Mycorrhizal fungi influence soil structure. In: Kapulnik Y, 

Douds DD Jr (eds) Arbuscular mycorrhizas: physiology and functions. Kluwer, Dordrecht, 

pp 3–18 

Moenne-Loccos Y, Tichy HV, O’Donnell A, Simon R, O’Gara F (2001) Impact of 2,4diacetylphloroglucinol-producing 

biocontrol strain Pseudomonas fluorescens F113 

on intraspecific diver of resident culturable fluorescent pseudomonads associate with 

the roots of field-grown sugar beet seedlings. Appl Environ Microbiol 67:3418–3425 

Mohammad A, Khan AG, Kuek C (2000) Improved aeroponic culture of inocula of arbuscular 

mycorrhizal fungi. Mycorrhiza 9:337–339 

Monzón A, Azcón R (1996) Relevance of mycorrhizal fungal origin and host plant genotype 

to inducing growth and nutrient uptake in Medicago species. Agric Ecosyst Environ 

60:9–15 

Morton J.B. (2000) Evolution of endophytism in arbuscular mycorrhizal fungi of Glomales. 

In: Bacon CW, White Jr JE (eds) Microbial endophytes. Marcel Dekker, New York, 

pp 121–140 

Morton JB, Redecker D (2001) Two new families of Glomales, Archaeosporaceae and 

Paraglomaceae, with two new genera Archaeospora and Paraglomus, based on concordant 

molecular and morphological characters. Mycologia 93:181–195 

Nehl DB, Allen SJ, Brown JF (1996) Deleterious rhizosphere bacteria: an integrating perspective. 


O’Gara F, Dowling DN, Boesten B (1994) Molecular ecology of rhizosphere microorganisms.VCH, 

Weinheim, p 173 

Okon Y (1994) Azospirillum/Plant associations. CRC Press, Boca Raton, p 175 

Probanza A, Lucas García JA, Ruiz Palomino M, Ramos B, Gutiérrez Mañero FJ (2002) 

Pinus pinea L. seedling growth and bacterial rhizosphere structure after inoculation 

with PGPR Bacillus (B. licheniformis CECT 5106 and B. pumillus CECT 5105). Appl 


Puppi G, Azcón R, Höflich G (1994) Management of positive interactions of arbuscular 

mycorrhizal fungi with essential groups of soil microorganisms. In: Gianinazzi S, 


natural ecosystems. ALS, Birkhäuser, Basel, pp 201–215 

Ravnskov S, Nybroe O, Jakobsen I (1999) Influence of an arbuscular mycorrhizal fungus 

on Pseudomonas fluorescens DF57 in rhizosphere and hyphosphere soil. New Phytol 

142:113–122 

Redecker D, Thierfelder H, Walker C, Werner D (1997) Restriction analysis of PCRamplified 

internal transcribed spacers of ribosomal DNA as a tool for species identification 

in different genera of the order Glomales. Appl Environ Microbiol 

63:1756–1761 

Redecker D, Morton JB, Bruns TD (2000) Ancestral lineages of arbuscular mycorrhizal 

fungi (Glomales). Mol Phylogenet Evol 14:276–284 

Requena N, Jimenez I, Toro M, Barea JM (1997) Interactions between plant-growth- promoting 

rhizobacteria (PGPR), arbuscular mycorrhizal fungi and Rhizobium spp. in


the rhizosphere of Anthyllis cytisoides, a model legume for revegetation in Mediterranean 

semi-arid ecosystems. New Phytol 136:667–677 

Requena N, Perez-Solis E, Azcón-Aguilar C, Jeffries P, Barea JM (2001) Management of 

indigenous plant-microbe symbioses aids restoration of desertified. Appl Environ 


Ruiz-Lozano JM, Azcón R (1993) Specificity and functional compatibility of VA mycorrhizal 

endophytes in association with Bradyrhizobium strains in Cicer arietinum. 

Symbiosis 15:217–226 

Ruiz-Lozano JM, Bonfante P (2000) A Burkholderia strain living inside the arbuscular 

mycorrhizal fungus Gigaspora margarita possesses the vacB gene, which is involved 

in host cell colonization by bacteria. Microbial Ecol 39:137–144 

Ruiz-Lozano JM, Collados C, Barea JM, Azcón R (2001) Arbuscular mycorrhizal symbiosis 

can alleviate drought-induced nodule senescence in soybean plants. New Phytol 

151:493–502 

Sanders IR, Clapp JP,Wiemken A (1996) The genetic diversity of arbuscular mycorrhizal 

fungi in natural ecosystems – A key to understanding the ecology and functioning of 

the mycorrhizal symbiosis. New Phytol 133:123–134 

Schloter M, Wiehe W, Assmus B, Steindl H, Becke H, Höflich G, Hartmann A (1997) Root 

colonization of different plants by plant-growth-promoting Rhizobium leguminosarum 

bv. trifolii R39 studied with monospecific polyclonal antisera. Appl Environ 

Microbiol 63:2038–2046 

Schübler A, Schwarzott D, Walker C (2001) A new fungal phylum, the Glomeromycota: 

phylogeny and evolution. Mycol Res 105:1413–1421 

Siciliano SD, Germida JJ (1998) BIOLOG analysis and fatty acid methyl ester profiles 

indicate that pseudomonad inoculants that promote phytoremediation alter the rootassociated 

microbial community of Bromus biebersteinii. Soil Biol Biochem 

30:1717–1723 

Simon L, Bousquet J, Lévesque RC, Lalonde M (1993). Origin and diversification of 

endomycorrhizal fungi and coincidence with vascular land plants. Nature 363:67–69 

Simons M, van der Bij AJ, Brand I, de Weger LA, Wijffelman CA, Lugtenberg BJJ (1996) 



Smith SE, Read DJ (1997) Mycorrhizal symbiosis. Academic Press, London 

Smith SE, Gianinazzi-Pearson V, Koide R, Cairney JWG (1994) Nutrient transport in 

mycorrhizas: structure, physiology and consequences for efficiency of the symbiosis. 

In: Robson AD, Abbott LK, Malajczuk N (eds) Management of mycorrhizas in agriculture, 

horticulture and forestry. Kluwer, Dordrecht, pp 103–113 

Staley TW, Lawrence EG, Nance EL (1992) Influence of a plant growth-promoting 

pseudomonad and vesicular-arbuscular mycorrhizal fungus on alfalfa and birdsfoot 

trefoil growth and nodulation. Biol Fertil Soils 14:175–180 

Sturz AV Nowak J (2000) Endophytic communities of rhizobacteria and the strategies 

required to create yield enhancing associations with crops. Appl Soil Ecol 15:183–190 

Sturz AV, Christie BR, Nowak J (2000) Bacterial endophytes: potential role in developing 

sustainable systems of crop production. Crit Rev Plant Sci 19:1–30 

Sylvia DM (1998) Mycorrhizal symbioses. In: Sylvia DM, Fuhrmann JJ, Hartel PG, 

Zuberer DA (eds) Principles and applications of soil microbiology. Prentice Hall, 

Upper Saddle River, New Jersey, pp 408–426 

Thomashow LS,Weller DM (1995) Current concepts in the use of introduced bacteria for 

biological control: mechanisms and antifungal metabolites. In: Stacey G, Keen N (eds) 

Plant-microbe interactions. Chapman and Hall, New York, pp 187–235 

Toro M,Azcón R, Barea JM (1997) Improvement of arbuscular mycorrhizal development 

by inoculation with phosphate-solubilizing rhizobacteria to improve rock phosphate 

bioavailability ( 32 P) and nutrient cycling. Appl Environ Microbiol 63: 4408–4412

370 


Toro M,Azcón R, Barea JM (1998) The use of isotopic dilution techniques to evaluate the 

interactive effects of Rhizobium genotype, mycorrhizal fungi, phosphate-solubilizing 

rhizobacteria and rock phosphate on nitrogen and phosphorus acquisition by Medicago 

sativa. New Phytol 138:265–273 

Tuinen D van, Jacquot E, Zhao B, Gollotte A, Gianinazzi-Pearson V (1998) Characterization 

of root colonization profiles by a microcosm community of arbuscular mycorrhizal 

fungi using 25S rDNA-targeted nested PCR. Mol Ecol 7:879–887 

Valdenegro M, Barea JM,Azcón R (2001) Influence of arbuscular-mycorrhizal fungi, Rhizobium 

meliloti strains and PGPR inoculation on the growth of Medicago arborea 

used as model legume for re-vegetation and biological reactivation in a semi-arid 

Mediterranean area. Plant Growth Regul 34:233–240 

Van Bastelaere E, Lambrecht M, Vermeiren H, Keijers V, de Wilde P, Proost P, Van Dommelen 

A, Varderleyden J (1999) Characterization of a sugar-binding protein from 

Azospirillum brasilense mediating chemotaxis to and uptake of sugars. Mol Microbiol 

32:703–714 

Van de Broek A, Lambrecht M, Vanderleyden J (1999) Auxins upregulate expression of 

the indole-3-pyruvate decaboxylase gene from Azospirillum brasilense. J Bacteriol 

181:1338–1342 

Van Loon LC, Bakker PAHM, Pieterse CMJ (1998) Systemic resistance induced by rhizosphere 

bacteria. Annu Rev Phytopathol 36:453–483 

Varma A, Schüepp H (1995) Mycorrhization of the commercially important micropropagated 

plants. Crit Rev Biotechnol 15:313–328 

Varma A,Verma S, Sudha, Sahay N, Bütehorn B, Franken P (1999) Piriformospora indica, 

a cultivable plant-growth-promoting root endophyte. Appl Environ Microbiol 

65:2741–2744 

Vázquez MM, Cesar S, Azcón R, Barea JM (2000) Interactions between arbuscular mycorrhizal 

fungi and other microbial inoculants (Azospirillum, Pseudomonas, Trichoderma) 

and their effects on microbial population and enzyme activities in the rhizosphere 

of maize plants. Appl Soil Ecol 15:261–272 

Vierheilig H, Piché Y (2002) Signalling in arbuscular mycorrhiza: facts and hypotheses 

In: Buslig B, Manthey J (eds) Flavonoids in cell functions. Kluwer Academic/Plenum 

Publishers, New York, pp 23–29 

Vestberg M, Estaún V (1994) Micropropagated plants, an opportunity to positively manage 

mycorrhizal activities. In: Gianinazzi S, Schüepp H (eds) Impact of arbuscular 

mycorrhizas on sustainable agriculture and natural ecosystems. Birkhäuser, Basel, pp 

217–226 

Volpin H, Kapulnik Y (1994) Interaction of Azospirillum with beneficial soil microorganisms. 

In: Okon Y (ed) Azospirillum/plant associations. CRC Press, Boca Raton, pp 

111–118 

Vosátka M (1996) Soil bacteria – a component of plant, soil and arbuscular mycorrhizal 

fungal interactions. In: Azcon-Aguilar C, Barea JM (Eds) Mycorrhizas in integrated 

systems – from genes to plant development. (pp 613–618). European Commission 

Report EUR 16728, Brussels, Luxembourg 

Vosátka M, Gryndler M (1999) Treatment with culture fractions from Pseudomonas 

putida modifies the development of Glomus fistulosum mycorrhiza and the response 

of potato and maize plants to inoculation. Appl Soil Ecol 11:245–251 

Waschkies C, Schropp A, Marschner H (1994). Relations between grapevine replant disease 

and root colonization of grapevine (Vitis sp.) by fluorescent pseudomonads and 

endomycorrhizal fungi. Plant Soil 162:219–227 

Weller DM, Thomashow LS (1994) Current challenges in introducing beneficial microorganisms 

into the rhizosphere. In: O’Gara F, Dowling DN, Boesten B (eds) Molecular 

ecology of rhizosphere microorganisms biotechnology and the release of GMOs. 

VCH, Weinheim, pp 1–18



Varanini Z, Nannipieri P (eds) The rhizosphere: biochemistry and organic substances 

at the soil-plant interfaces. Marcel Dekker, New York 

Werner D, Barea J-M, Brewin NJ, Cooper P, Katinakis P, Lindström K, O’Gara F, Spaink 

HP, Truchet G, Müller P (2002) Symbiosis and defence in the interaction of plants with 

microorganisms. Symbiosis 32:83–104 

Whitelaw MA (2000) Growth promotion of plants inoculated with phosphate-solubilizing 

fungi. Adv Agron 69:99–151 

Zinniel DK, Lambrecht P, Harris NB, Feng Z, Kuczmarski D, Higley P, Ishimaru CA, 

Arunakumari A, Barletta RG, Vidaver AK (2002) Isolation and characterization of 

endophytic colonizing bacteria from agronomic crops and prairie plants. Appl Environ 

Microbiol 68:2198–2208

21 Carbohydrates and Nitrogen: Nutrients and 

Signals in Ectomycorrhizas 

Uwe Nehls 


Due to plant litter, forest soil is rich in complex carbohydrates (e.g., cellulose 

and lignin). Nevertheless, these carbohydrates are only slowly degraded by 

specialized microorganisms and thus forest soils are rather poor in readily 

cleavable carbohydrates that are necessary for the growth of the majority of 

microbes including ectomycorrhizal fungi. 

Basidiomycetes are able to transfer nutrients and metabolites over long distances. 

Exploring a rich source of readily utilizable carbohydrates would thus 

favor the colonization of other soil areas, too. The association with fine roots 

of woody plants forming ectomycorrhizas is a way that secures exclusive 

access to such a rich carbohydrate source for ectomycorrhizal fungi. 

Organic compounds contained in root exudates are candidates for the carbon 

transfer from the host to the mycorrhizal fungus. Low-molecular-weight 

root exudates comprise soluble sugars, carboxylic acids and amino acids 

(Marschner 1995; Smith and Read 1997; Hampp and Schaeffer 1999). The best 

growth of ectomycorrhizal fungi (ECM) fungi occurs on the hexoses glucose, 

fructose, and mannose. Sucrose, which is the preferred transport sugar in 

most host plants cannot be used by ECM investigated so far (e.g., Salzer and 

Hager 1991), Laccaria bicolor being possibly an exception (Tagu et al. 2000). 

Even if plant-derived hexoses are most important for ectomycorrhizal 

fungi, there is ample evidence that soil carbon sources are also intensively 

used. Among these are starch, dextrins, glucans, oligosaccharides or sugar 

alcohols (Palmer and Hacskaylo 1970; Cao and Crawford 1993; Berredjem et 

al. 1998), proteins (Abuzinadah and Read 1986), or even cellulose or lignin 

(Norkrans 1950; Trojanowski et al. 1984; Taber and Taber 1987; Haselwandter 

et al. 1990). 




374 

Uwe Nehls 

2 Trehalose Utilization by Ectomycorrhizal Fungi 

Trehalose is a nonreducing disaccharide that is found in a wide variety of 

organisms including bacteria, fungi, protozoa, nematodes, insects and plants 

(Elbein 1974; Mellor 1992, Müller et al. 1994). Trehalose has been shown to be 

a good carbon source for a number of ectomycorrhizal fungi (Lewis and 

Harley 1965; Palmer and Hacskaylo 1970). 

Amanita muscaria hyphae excrete an acid trehalase into the growth 

medium to break down external trehalose (Wisser et al. 2000).With its apparent 

molecular mass of 165 kDa, a pI of 3.7, a pH optimum of about 4.0 and an 

apparent Km value for trehalose of 0.38 mM, it is comparable to that of other 

fungi. 

Excreted acid trehalases, in general, are very stable. Owing to the low Km 

value of the enzyme, and the acidic pH optimum, trehalose hydrolysis in 

acidic forest soils should be very efficient. The resulting monosaccharides are 

then taken up by the highly efficient monosaccharide import system of A. 

muscaria (Chen and Hampp 1993; Nehls et al. 1998, see below). 

Carbohydrate-starved mycelia excreted about four times more acid trehalase 

into the growth medium than mycelia that were well supported with 

sugar (Wisser 2000), indicating an up-regulated expression of acid trehalase 

with regard to poor carbon nutrition. 

Trehalose is one of the main storage carbohydrates of basidiomycetes, but 

is also found in bacteria in large quantities. The utilization of trehalose by 

ectomycorrhizal fungi might thus be important for two reasons: 

1. The availability of an additional carbon source would improve ectomycorrhizal 

fungal growth in soil. 

2. By utilization of a soil carbon source that otherwise could be used by other 

microorganisms, ectomycorrhizal fungi could reduce the growth of their 

putative competitors for other nutrients (e.g., nitrogen or phosphate). 

3 Carbohydrate Uptake 

A prerequisite for a rapid uptake of monosaccharides are membrane transport 

systems. Experiments with suspension-cultured hyphae of ectomycorrhizal 

fungi (Salzer and Hager 1991) and with protoplasts (Chen and Hampp 

1993) indicated that most basidiomycotic ectomycorrhizal fungi have no system 

for sucrose import or hydrolysis, but for the uptake of glucose and fructose 

(Palmer and Hacskaylo 1970; Salzer and Hager 1991). 

To date, only two hexose transporter genes from A. muscaria (Fig. 1), 

AmMst1 (Nehls et al. 1998) encoding a protein of 520 amino acids and 

AmMst2 encoding a protein of 519 amino acids, and one hexose transporter 

gene from Tuber borchii (Agostini and Stocchi, pers. comm.) have been identified. 

While AmMst1 reveals the highest sequence homology with Hxt1 from

21 Carbohydrates and Nitrogen: Nutrients and Signals in Ectomycorrhiza 375 

Fig. 1. Dendrogram of the alignment of the deduced protein sequence of AmMST1 and 

AmMst2 with known fungal monosaccharide transporters. The relationship of the 

deduced protein sequence of AmMST1 and AmMst2 to other fungal monosaccharide 

transporters was determined by multiple alignment using ClustalW (version 1.8) 

Uromyces fabae, AmMst2 has the best homologies to Stl1 of S. cerevisiae.The 

homology between both deduced Amanita proteins is low (33.3 % identity, 

56.8 % similarity). Interestingly, the noncoding region of the cDNAs revealed 

a higher identity (approx. 60 %) than the coding region (approx. 50 %). The 

expression patterns with regard to carbon and nitrogen nutrition are identical 

for both genes (Nehls, unpublished). When expressed in yeast, AmMst1 

revealed K M values of 0.46 mM for glucose and 4.2 mM for fructose, indicating 

a strong preference for glucose (Wiese et al. 2000). Also, A. muscaria hyphae 

strongly favored glucose uptake even in the presence of a large excess of fructose 

(20 mM vs. 1 mM; Nehls et al. 2001 c). A similar preference for glucose 

uptake was also observed for the ectomycorrhizal ascomycete Cenococcum 

geophilum (Stülten et al. 1995), indicating that this behavior might be com-

376 

Uwe Nehls 

mon to ectomycorrhizal fungi. Since A. muscaria revealed only one type of 

hexose uptake kinetic, mostly resembling that of AmMst1 when expressed in 

yeast, it is very likely that AmMst1 and AmMst2 have similar transport properties. 

The investigated A. muscaria hyphae are heterocaryotic, containing 

nuclei of two different origins. It could thus be questioned whether AmMst1 

and AmMst2 are encoding different genes from one nucleus or both genes 

belong to different nuclei. 

4 Carbohydrate Metabolism 

As in other organisms phosphofructokinase (ATP-dependent) is the rate-limiting 

step in fungal glycolysis (Kowallik et al. 1998). In A. muscaria, this 

enzyme is activated by fructose 2,6-bisphosphate (F26BP; k a about 30 nM; 

Schaeffer et al. 1996) which is similar to the properties of the corresponding 

enzyme from yeast or animal cells, but differs from plant phosphofructokinases. 

It has been shown that A. muscaria mycelia grown in the presence of 

high hexose concentrations as well as mycorrhizal roots have increased 

amounts of F26BP (Schaeffer et al. 1996; Hoffmann et al. 1997). This could 

indicate increased rates of glycolysis in hyphae under elevated hexose supply, 

e.g., hyphae of the Hartig net (Hampp and Schaeffer 1999). 

In yeast cells, levels of fructose-2,6 bisphosphate, and thus the predominance 

of glycolysis over gluconeogenesis, are controlled by the formation of 

cyclic AMP (cAMP). Increased glucose supply causes an increase of activity of 

adenylate cyclase (Thevelein 1991) and thus of the cAMP content in hyphae. 

cAMP activates a cAMP-dependent protein kinase (PKA) which, via phosphorylation, 

activates F26BP formation while inhibiting F26BP degradation 

(Thevelein 1991; d’Enfert 1997; RadisBaptista et al. 1998). 

At least the initial steps of glucose-dependent regulation of glycolysis also 

exist in A. muscaria. Changes in pool sizes of cAMP were detected in relation 

to glucose supply (Hoffmann et al. 1997). When suspension cultures of A. 

muscaria were transferred from medium containing low (1 mM) to high 

(40 mM) glucose concentrations, both cAMP pools as well as rates of activity 

of protein kinase A increased (Nehls et al. 2001 c). 

5 Carbohydrate Storage 

In addition to their relevance for carbon storage, storage carbohydrates have 

additional functions in fungi,e.g.,the rapid conversion of carbohydrates that are 

taken up (to maintain a carbon sink) or membrane and protein protection (e.g., 

trehalose). Two different pools of storage carbohydrates can be distinguished in 

ectomycorrhizal fungi: short chain carbohydrates (trehalose) or polyols (mannitol,arabitol,erythritol),and 

the long chain carbohydrate glycogen.


Hexoses that are taken up by ectomycorrhizal fungi are either introduced 

into glycolysis (e.g., formation of amino acids) or converted into short chain 

carbohydrates and polyols (Martin et al. 1985, 1987, 1988, 1998). Growth of A. 

muscaria (suspension culture) on glucose as a carbon source resulted in an 

increase in the trehalose content until the external glucose concentration was 

below 4 mM, followed by a depletion of trehalose concentration over time. In 

contrast, the glycogen content was stable during the investigation (4 weeks; 

Wallenda 1996). In Lactarius sp. the glycogen content was high during winter, 

declined until summer and was restored during the autumn (Genet et al. 

2000). Thus, trehalose and polyols are presumably short term storage compounds, 

revealing high fluctuation rates, while glycogen is the long term storage 

carbohydrate of hyphae that is only mobilized when the short term pools 

are empty. 

Ectomycorrhizal fungal colonies could become quite large, and support 

from plant-derived carbohydrates has been shown to be necessary for fungal 

growth in soil (Leake et al. 2001). Thus, long-distance transport of carbon is of 

great interest for fungal physiology. In P. involutus ectomycorrhizas, glycogen 

particles were observed in the Hartig net and the inner and outer hyphal layers 

of the fungal sheath (Jordy et al. 1998). Since glycogen is stored in the cytoplasm 

as large, nonmobile granules it is rather likely that glycogen is not the 

long-distance transport form of carbohydrates. Polyols and trehalose are, in 

addition to glucose, present in large quantities in fungal hyphae, and are thus 

good candidates for long-distance transport carbohydrates between different 

parts of the fungal colony. 

6 Carbohydrates as Signal, Regulating Fungal Gene 

Expression in Ectomycorrhizas 

Sugar-regulated gene expression was mainly investigated in saprophytic 

ascomycetes (Jennings 1995). Here, the external monosaccharide concentration 

regulates fungal gene expression, e.g., that of monosaccharide transporters 

at the transcriptional as well as the posttranscriptional (protein 

degradation rate) level. Two different transcriptional control mechanisms, 

induction/enhancement or repression of gene expression were described 

(Felenbok and Kelley 1996; Özcan et al. 1996). 

In A. muscaria, the expression of the hexose transporter genes is up-regulated 

by a threshold response mechanism depending on the extracellular concentration 

of monosaccharides (Nehls et al. 1998). In A. muscaria hyphae 

grown in the presence of glucose concentrations up to 2 mM, the glucose 

transporter genes AmMst1 and AmMst2 are expressed at a basal level, while 

monosaccharide concentrations above that threshold triggered at least a fourfold 

increase in the transcript levels. This up-regulation could not be further 

enhanced by hexose concentrations of up to 100 mM. Since the increase of

378 

Uwe Nehls 

monosaccharide transporter gene expression is a slow process, it could be 

interpreted as an adaptation to the elevated hexose concentrations usually 

only found at the plant/fungus interface, but not in the soil. 

In yeast, sugar dependent induction/enhancement of gene expression is 

controlled by two monosaccharide transporter-like proteins, RGT2 and SNF3, 

sensing the external sugar concentration (Celenza et al. 1988; Özcan et al. 

1996). These transporters have a C-terminal extension containing a conserved 

amino acid motive thought to be involved in the transduction of the external 

sugar signal. Due to their different glucose affinities, SNF3 senses low external 

glucose concentrations while RGT2 senses high concentrations. In contrast to 

yeast, the putative monosaccharide transporter RCO3 (Madi et al. 1997) that is 

presumably also acting as monosaccharide sensor in Neurospora crassa,does 

not contain any extension. The signal cascade, transforming the sugar signal 

into modified gene expression, is not fully understood. To date, two elements 

have been identified, the transcription factor RGT1 (Özcan et al. 1996) and a 

signal transduction mediator, the SCF complex (Özcan and Johnston 1999). 

Without the sugar signal, RGT1 is a repressor for glucose-induced genes while 

activation via the SCF complex (in response to a sugar signal) modifies RGT1 

function to that of a transcriptional activator (Johnston 1999). 

The signal regulating the hexose-dependent, enhanced AmMst1 expression 

is still unknown, but in contrast to yeast, it seems to be transmitted by an 

internal and not an external sensor. Glucose analogues that are imported by 

AmMst1 and phosphorylated, but not further metabolized, did not increase 

the AmMst1 transcript level as glucose did (Wiese et al. 2000). Furthermore, 

the result of these experiments makes it rather likely that the signal must be 

generated downstream of hexokinase activity, in glycolysis or carbon storage 

pathways. 

While AmMst1 expression is an example of sugar-dependent enhancement 

of gene expression in A. muscaria, a second gene (AmPAL) was identified that 

revealed sugar-dependent gene repression (Nehls et al. 1999a). PAL is a key 

enzyme of secondary metabolism and thus of the production of phenolic 

compounds. ECM-forming fungi have been reported to use phenolic compounds 

for both their own protection and that of their host against bacterial 

or fungal attacks (Marx 1969; Chakravarty and Unestam 1987; Garbaye 1991). 

In A. muscaria, the transcript of AmPAL was abundant in hyphae grown at 

low external glucose concentrations, but exhibited a significant decrease in 

hyphae cultured at glucose concentrations of above 2 mM (less than 1/30 of 

the transcript level at low glucose). Unlike AmMst1, AmPAL-expression is 

probably regulated by sugar phosphorylation via hexokinase as sugar sensor 

(Nehls et al. 1999a). 

Also in saprophytic ascomycetes the monosaccharide-dependent gene 

repression is regulated via a hexokinase-dependent signaling pathway (Ronne 

1995; Gancedo 1998). The molecular mechanism of signal initiation is still 

unclear, but a hexokinase (in yeast mainly hex2) initiates the signal in


response to the C-flux through the enzyme. Whether hexokinase phosphorylation 

or its association with other proteins is responsible for signal generation 

is still a mater of debate, but it is rather likely that the conformational 

changes of the enzyme during its enzymatic activity are sensed and not the 

generated hexose phosphates per se. The signaling pathways involve the activation/deactivation 

of the SNF1 protein complex that is presumably mediated 

by phosphorylation/dephosphorylation (AMPK kinase and REG1/GLC7 

phosphatase complex, respectively; Lesage et al. 1996; Johnston 1999). The 

sugar-dependent gene repression is mediated by a DNA-binding protein like 

MIG1 (yeast) or CREA (Aspergillus, Neurospora; Felenbok and Kelly 1996), 

acting as repressors. 

While in the pure fungal culture AmMst1 was induced and AmPAL 

repressed by elevated hexose concentrations, both genes were strongly 

expressed in entire mycorrhizas (Nehls et al. 1998, 1999a). It could thus be 

concluded that in mycorrhizas the sugar-dependent regulation of both genes 

is either modified by developmental events, or different in the sheath and Hartig 

net hyphae. To address this question, ectomycorrhizas were dissected and 

gene expression was investigated separately for hyphae of the fungal sheath 

and the Hartig net (Nehls et al. 2001a). Similar to low external hexose concentrations 

in pure fungal culture, AmMst1 was expressed only at the basal level 

in hyphae of the fungal sheath. In contrast, AmPAL revealed a high transcript 

level in this fungal structure. For Hartig net hyphae the opposite expression 

pattern was observed. As for hyphae in pure culture in the presence of high 

external hexose concentrations, the transcript level of AmMst1 was sixfold 

enhanced while the expression of AmPAL was only barely detectable. 

Owing to the opposite regulation of both genes in hyphae of fungal sheath 

and Hartig net that resembles the hexose-dependent expression of these 

genes in pure culture, different hexose concentrations in the apoplast of the 

fungus/plant interface (hexose concentration >2 mM) and the apoplast of the 

fungal sheath (hexose concentration 2 mM) could be assumed in 

the Hartig net that would trigger the observed hexose-dependent fungal gene 

expression. Fructose withdrawal from the apoplast presumably takes place 

mainly within the innermost one or two layers of the fungal sheath since fructose 

uptake by A. muscaria hyphae is rather efficient when the glucose concentration 

is

380 

Uwe Nehls 

Fig. 2. Spatial distribution of hexose uptake by fungal hyphae in ectomycorrhizas: a 

model. Sucrose hydrolysis in the apoplast of the Hartig net results in high glucose and 

fructose concentrations.We assume that here glucose is taken up preferentially, since the 

uptake of fructose is inhibited (by glucose concentrations above 0.5 mM). In the innermost 

one or two layers of the fungal sheath glucose concentration is low, due to efficient 

uptake by fungal hyphae of the Hartig net. Thus, most probably fructose is taken up. In 

the apoplast of the majority of the fungal sheath, glucose as well as fructose concentrations 

are low due to the efficient hexose uptake by hyphae of the Hartig net and the inner 

layers of the sheath 

sion of AmMst1 and a repression of AmPAL) are present in the apoplast of the 

majority of fungal sheath hyphae. 

“Metabolic zonation” and “physiological heterogeneity” have already been 

discussed as important concepts for a functional understanding of ectomycorrhizal 

symbiosis (Martin et al. 1992; Cairney and Burke 1996; Timonen and 

Sen 1998). Differences in the apoplastic hexose concentration at the Hartig 

net vs. fungal sheath could thus be supposed to generate a signal that might 

regulate fungal physiological heterogeneity in ectomycorrhizas, in addition to 

the developmental program. 

7 Nitrogen 

The ability of ectomycorrhizal fungi to take up inorganic nitrogen is well 

established (Melin and Nilsson 1952; France and Reid 1983; Plassard et al.


1986; Finlay et al. 1988; Chalot and Brun 1998). In accordance with the predominant 

occurrence of ammonium as inorganic nitrogen source in the soil, 

most ectomycorrhizal fungi grow better on ammonium than on nitrate in 

pure culture (France and Reid 1984; Finlay et al. 1992). Nevertheless, even in 

mature forests nitrate could be present in large amounts as a result of bacterial 

activity (e.g., open forest areas) or as a result of fertilization in areas with 

extensive agriculture (Gessler et al. 1998). 

In many forest ecosystems, rates of nitrogen mineralization of litter are low 

and consequently, the supply of inorganic nitrogen is often limited (Read 

1991). In addition, nitrification is usually slow and the poorly mobile ammonium 

ion (Keeney 1980) predominates together with organic nitrogen (e.g., 

amino acids or protein). Important for the establishment of forest ecosystems 

is thus, the capability of ectomycorrhizal fungi to exploit (in collaboration 

with other soil organisms) organic debris (e.g., litter) as a nutrient source 

(Nasholm and Persson 2001). 

8 Utilization of Inorganic Nitrogen 

For a number of ectomycorrhizal fungi growth on nitrate as sole nitrogen 

source (France and Reid 1984; Littke et al. 1984; Plassard et al. 1986) as well 

as the presence of nitrate reductase activity (Wagner et al. 1989; Sarjala 

1990) have been shown. In saprophytic ascomycetes, the expression of 

nitrate reductase is repressed in the presence of a reduced nitrogen source 

(e.g., ammonium) and induced only the presence of nitrate. In contrast, 

nitrate reductase activity of the ectomycorrhizal fungus Hebeloma cylindrosporum 

was similar for nitrate and ammonium-fed hyphae (Scheromm et 

al. 1990), indicating a different type of regulation. A nitrate transporter gene 

has been identified so far only from H. cylindrosporum (Marmeisse, pers. 

comm.). 

Two ammonium transporter genes of H. cylindrosporum (HcAMT2 and 

HcAMT3) were isolated and functionally characterized in yeast (Javelle et al. 

2001). HcAMT2 revealed a K M value of 58 mM and HcAMT3A of 260 mM. 

When the fungus was grown under optimal nitrogen conditions (ammonium 

concentration >2 mM) the expression of both transporter genes was only 

barely detectable while gene expression strongly increases under nitrogen 

starvation. Similar results were found in Paxillus involutus, where N starvation 

triggered a fourfold increase in methylamine transport after 2 h incubation 

in nitrogen-free media (Javelle et al. 1999). 

In addition, one ammonium transporter gene (TbAMT1) was isolated from 

the ascomycete Tuber borchii (Montanini et al. 2002). Heterologous expression 

in yeast revealed a K M value of 2 mM. When exposed to ammonium or nitrate, 

the gene was expressed at a basal level while nitrogen depletion resulted in a 

slow and only slight increase in gene expression. This expression profile is

382 

Uwe Nehls 

quite untypical for fungi where good nitrogen nutrition usually results in a 

strong repression of ammonium transporter genes. 

9 Utilization of Organic Nitrogen 

Important for the establishment of forest ecosystems is the capability of ectomycorrhizal 

fungi to exploit (in collaboration with other soil organisms) 

organic debris (e.g., litter) as a nutrient source (Nasholm and Persson 2001). 

10 Proteolytic Activities of Ectomycorrhizal Fungi 

Ericoid fungi (Bajwa et al. 1985; Leake and Read 1990), but also some ectomycorrhizal 

fungi (Abuzinadah and Read 1986; El-Badaoui and Botton 1989; Zhu 

1990; Spägele 1992; Zhu et al. 1994; Bending and Read 1996) are able to utilize 

protein not only as a nitrogen, but also as a carbon source (for a review, see 

Smith and Read 1997). 

Two proteins with proteolytic activities and molecular masses of about 

45 kDa (AmProt1) and 100 kDa (AmProt2) are excreted by A. muscaria (Nehls 

et al. 2001b). AmProt1 was mainly released at pH-values up to pH 5.4 and 

revealed a narrow pH-optimum around 3.0. It resembles thus, proteases 

released by H. crustuliniforme (Zhu 1990) and the ericoid fungus Hymenoscyphus 

ericea (Leake and Read 1990). AmProt2 was only excreted at pH-values 

between 5.4 and 6.3 and reveals a broad pH-optimum between 3 and 6. A. 

muscaria is mainly growing in the litter layer of both acidic and less acidic 

forest soils. Since forest litter layers are, in addition to fungi, intensively colonized 

by biofilm-forming bacteria (Berg et al. 1998), where the microenvironment 

is adapted to bacterial growth (e.g., pH 5–6; Fletcher 1996), expression 

of a protease that is active at a less acidic pH would favor the mobilization of 

bacteria-derived proteins by ectomycorrhizal fungi. 

A cDNA presumably encoding AmProt1 was identified in an EST project 

(Nehls et al. 2001b). AmProt1 was not only regulated by the external pH, but 

also by carbon as well as nitrogen availability. Nitrogen starvation alone 

increased AmProt1 expression by a factor of 3 to 4. However, the absence of a 

carbon source increased the transcript level of the gene by a factor of approximately 

12, independent of the presence or absence of nitrogen. The expression 

of AmProt1 reflects thus the nutritional status of fungal hyphae with 

respect to carbon (major regulatory effect) and nitrogen (minor regulatory 

effect).


11 Uptake of Amino Acids 

Amino acids (as a result of protein degradation) are frequently found in forest 

soils and are thus of great importance for nitrogen nutrition. The ability to 

take up amino acids with high efficiency has been frequently shown for ectomycorrhizal 

fungi (Abuzinadah and Read 1988; Chalot et al. 1995, 1996; Wallenda 

and Read 1999). 

Fungal amino acid importer genes have been isolated to date from A. muscaria 

(AmAAP1; Nehls et al. 1999b) and H. cylindrosporum (Wipf et al. 2002). 

As determined by heterologous expression in yeast, these genes encode high 

affinity H + /amino acid symporter with a broad amino acid spectrum. 

AmAAP1 has a higher affinity to basic and aromatic amino acids compared to 

acidic or neutral amino acids. These differences in affinity might reflect the 

fact that basic amino acids are present in soil in significantly lower concentrations 

(8–30 mM) than neutral amino acids (70–80 mM; Scheller 1996). 

In contrast to AmProt1 (Nehls et al. 2001b, see above), carbon catabolite 

repression is not involved in regulation of AmAAP1 expression (Nehls et al. 

1999b). This is in agreement with results obtained for the ectomycorrhizal 

fungus P. involutus (Chalot et al. 1995). 

Good nitrogen support of fungal hyphae by amino acids as well as ammonium 

(not imported by AmAAP1) resulted in a low, constitutive AmAAP1 

expression (Nehls et al. 1999b). In contrast, AmAAP1 expression increased 

tenfold at low external nitrogen concentrations. It could thus be concluded 

that AmAAP1 expression is regulated by the endogenous nitrogen status of 

fungal cells, and not by the nitrogen source. 

As shown for a yeast mutant lacking arginine uptake activity, the reduced 

re-import capacity for this amino acid resulted in a net arginine loss of the 

cells (Grenson 1973). The strongly enhanced expression of AmAAP1 under 

nitrogen starvation conditions (even in the absence of amino acids) could 

also indicate that AmAAP1, in addition to amino acid uptake for nitrogen 

nutrition, might be important in the reduction of amino acid loss by hyphal 

leakage. 

12 Regulation of Fungal Nitrogen Export in Mycorrhizas by 

the Nitrogen-Status of Hyphae 

The nitrogen-dependent expression profile of nitrogen importer genes of 

ectomycorrhizal fungi (A. muscaria: Nehls et. al. 1999; H. cylindrosporum: 

Javelle et al. 2001; Wipf et al. 2002) resembles that of ascomycetes (yeast: Ter 

Schure et. al. 1998; Aspergillus: Sophianopoulou and Diallinas 1995). Here, 

nitrogen importer gene expression is regulated at the transcriptional level by 

two mechanisms: nitrogen repression in the presence of a good nitrogen 

source (ammonium or glutamine) and the induction of genes necessary for

384 

Uwe Nehls 

the utilization of alternative nitrogen sources under nitrogen limitation (e.g., 

Tazebay 1997). Nitrogen-dependent gene repression is presumably regulated 

by the internal nitrogen status of cells, and not the external nitrogen availability. 

Either, the intracellular ammonium concentration (Ter Schure et. al. 

2000) and/or the activity of the glutamine synthetase (Sophianopoulou and 

Diallinas 1995) are supposed to sense the endogenous nitrogen status. 

In ectomycorrhizal fungi, nitrogen importer gene expression is presumably 

also regulated by the internal nitrogen status of the hyphae (Nehls et. al. 1999; 

Javelle et al. 2001; Wipf et al. 2002). This could indicate how nitrogen uptake by 

soil-growing hyphae and nitrogen export by hyphae of the Hartig net might 

be managed (Fig. 3). Since the nitrogen content of forest soil is quite low and 

part of the nitrogen is transported to other parts of the growing fungal colony 

(e.g., mycorrhizas), soil-growing hyphae are presumably nitrogen-limited, 

resulting in a low endogenous nitrogen status and a strong expression of 

nitrogen importer genes. On the other hand, mycorrhizas are well supplied 

with nitrogen by soil-growing hyphae, thus revealing a high nitrogen status 

and a strongly reduced nitrogen importer gene expression. This nitrogen- 

Fig. 3. Regulation of fungal nitrogen uptake from soil and nitrogen excretion at the 

plant/fungus interface: a model. Nitrogen export to other parts of the fungal colony 

together with a low nitrogen content in soil results in a low endogenous nitrogen state in 

soil growing hyphae. In consequence, nitrogen importer genes are highly expressed and 

nitrogen uptake capacity is high. Nitrogen import from soil growing hyphae causes a 

high endogenous nitrogen status in hyphae of the Hartig net. This results in a repression 

of nitrogen importer gene expression and, together with posttranslational inactivation 

processes, in a low nitrogen uptake capacity. Together with export mechanisms, this 

leads to a net export of nitrogen at the plant/fungus interface


dependent repression of amino acid transporter gene expression (indicated 

by AmAAP1), together with posttranslational events (e.g., increased degradation 

of plasma membrane transport proteins) that are described for yeasts 

(Springael and Andre 1998), could thus result in a highly reduced fungal 

capacity for re-uptake of amino acids at the plant/fungus interface. In combination 

with efflux mechanisms (e.g., nitrogen leakage), this would thus result 

in a net export of nitrogen. 

13 Carbohydrate and Nitrogen-Dependent Regulation of 

Fungal Gene Expression 

Carbohydrates as well as nitrogen are essential components of biological molecules 

(e.g., amino acids or nucleotides), and obviously have a great impact on 

fungal gene expression (e.g., Gonzales et al. 1997). 

With regard to carbon and nitrogen nutrition, four different patterns of 

regulation have been observed in A. muscaria. The amino acid importer gene 

AmAAP1 is only regulated by nitrogen nutrition, while the hexose transporters 

AmMst1 and AmMst2 (Nehls et al. 1998) are only regulated by carbohydrate 

nutrition. On the other hand, AmProt1 (protease; Nehls et al. 2001b) 

and AmTPS1 (trehalose-6-phosphate synthase) are regulated by both nitrogen 

as well as carbon nutrition. Nevertheless, the impact of carbon and nitrogen 

nutrition differs significantly for both genes. While AmProt1 is mainly 

regulated by nitrogen, AmTPS1 is mainly regulated by carbon availability. 

Comparable gene expression patterns have been described for fungi (Gonzales 

et al. 1997) as well as plants (Coruzzi and Zhou 2001), revealing a universal 

and phylogenetically old regulation strategy. 


Since large EST projects of ectomycorrhizal model systems are currently 

under progress (Tagu and Martin 1995; Johansson et al. 2000; Voiblet et al. 

2001; Wipf et al. 2003), macro- and micro-array hybridization will enable an 

overview of the general impact of carbon and nitrogen nutrition on gene 

expression for different ectomycorrhizal fungi. 

Present data suggest that carbon- and nitrogen-dependent gene repression 

in ectomycorrhizal fungi is presumably similar to that of saprophytic 

ascomycetes (yeast, Neurospora). Ascomycotic model organisms could thus 

help to develop working models for ectomycorrhizal function (e.g., nitrogen 

uptake from soil and release at the plant/fungus interface; see Fig. 3) that 

could be investigated in turn in an ectomycorrhizal model system. In addition, 

differences, e.g., in carbon-dependent gene regulation for an ectomycorrhizal 

fungus (A. muscaria) and saprophytic ascomycetes (yeast, Neurospora)

386 

Uwe Nehls 

have been described. They might thus reveal adaptation processes that are 

necessary for ectomycorrhizal function. 

Acknowledgements I am indebted to Magret Ecke and Andrea Bock for excellent technical 

assistance and to Dr. Mika Tarkka and Dr. Rüdiger Hampp for critical reading of the 

manuscript. This work was supported by the Deutsche Forschungsgemeinschaft (DFG- 

Schwerpunkt Mykorrhiza). 


Abuzinadah RA, Read DJ (1986) The role of proteins in the nitrogen nutrition of ectomycorrhizal 

plants. I. Utilization of peptides and proteins by ectomycorrhizal fungi. 

New Phytol 103:481–493 

Abuzinadah RA, Read DJ (1988) Amino acids as nitrogen sources for ectomycorrhizal 

fungi: utilisation of individual amino acids. Transact Br Mycol Soc 91:473–479 

Bajwa R, Abuarghub S, Read DJ (1985) The biology of mycorrhiza in the Ericaceae. X. 

The utilization of proteins and the production of proteolytic enzymes by the mycorrhizal 

endophyte and by mycorrhizal plants. New Phytol 101:469–486 

Bending GD, Read DJ (1996) Nitrogen mobilization from protein-polyphenol complex 

by ericoid and ectomycorrhizal fungi. Soil Biol BioChem 28:1603–1612 

Berg MP, Kniese JP,Verhoef HA (1998) Dynamics and stratification of bacteria and fungi 

in the organic layers of a Scots pine forest soil. Biol Fertil Soils 26:313–322 

Berredjem A, Garnier A, Putra DP, Botton B (1998) Effect of nitrogen and carbon sources 

on growth and activities of NAD and NADP dependent isocitrate dehydrogenases of 

Laccaria bicolor. Mycol Res 4:427–434 

Cairney JWG, Burke RM (1996) Physiological heterogeneity within fungal mycelia: an 

important concept for a functional understanding of the ectomycorrhizal symbiosis. 

New Phytol 134:685–695 

Cao W, Crawford DL (1993) Carbon nutrition and hydrolytic and cellulolytic activities in 

the ectomycorrhizal fungus Pisolithus tinctorius. Can J Microbiol 39:529–535 

Celenza JL, Marshall-Carlson L, Carlson M (1988) The yeast SNF3 gene encodes a glucose 

transporter homologous to the mammalian protein. Proc Natl Acad Sci USA 

85:2130–2134 

Chakravarty P, Unestam T (1987) Differential influence of ectomycorrhizae on plant 

growth and disease resistance of Pinus sylvestris seedlings. J Phytopathol 120:104–120 

Chalot M, Brun A (1998) Physiology of organic nitrogen acquisition by ectomycorrhizal 

fungi and ectomycorrhizas. FEMS Microbiol Rev 22:21–44 

Chalot M, Kytöviita MM, Brun A, Finlay RD, Söderström B (1995) Factors affecting 

amino acid uptake by the ectomycorrhizal fungus Paxillus involutus. Mycol Res 

99:1131–1138 

Chalot M, Brun A, Botton B, Soderstrom B (1996) Kinetics, energetics and specificity of a 

general amino acid transporter from the ectomycorrhizal fungus Paxillus involutus. 

Microbiol 142:1749–1756 

Chen XY, Hampp R (1993) Sugar uptake by protoplasts of the ectomycorrhizal fungus, 

Amanita muscaria (L. ex fr.) Hooker. New Phytol 125:601–608 

Coruzzi GM, Zhou L (2001) Carbon and nitrogen sensing and signaling in plants: emerging 

‘matrix effects’. Curr Opin Plant Biol 4:247–253 

d’Enfert C (1997) Fungal spore germination: insights from the molecular genetics of 

Aspergillus nidulans and Neurospora crassa. Fungal Genet Biol 21:163–172


El-Badaoui K, Botton B (1989) Production and characterization of exocellular proteases 

in ectomycorrhizal fungi. Annales des Sciences Foréstières 46:728–730 

Elbein A (1974) The metabolism of a,a-trehalose. Adv Carb Chem BioChem 30:227–256 

Felenbok B, Kelley JM (1996) Regulation of carbon metabolism in mycelial fungi. In: 

Brambl R, Marzluf GA (eds) The Mycota III. Biochemistry and molecular biology. 


Finlay R, Ek H, Odham G, Söderström B (1988) Mycelial uptake, translocation and assimilation 

of nitrogen from 15 N labelled ammonium by Pinus sylvestris plants infected 

with four different ectomycorrhizal fungi. New Phytol 110:59–66 

Finlay RD, Frostegärd Ä, Sonnerfeldt A-M (1992) Utilisation of organic and inorganic 

nitrogen sources by ectomycorrhizal fungi in pure culture and in symbiosis with 

Pinus contorta Dougl. ex Loud. New Phytol 120:105–111 

Fletcher M (1996) Bacterial adhesion: Molecular and ecological diversity. Wiley-Liss, 

New York 

France RC, Reid CPP (1983) Interactions of nitrogen and carbon in the physiology of 

ectomycorrhizas. Can J Bot 61:964–984 

France RC, Reid CPP (1984) Pure culture growth of ectomycorrhizal fungi on inorganic 

nitrogen sources. Microbiol Ecol 10:187–195 

Garbaye J (1991) Biological interactions in the mycorrhizosphere. Experientia 47: 

370–375 

Genet P, Prevost A, Pargney JC (2000) Seasonal variations of symbiotic ultrastructure 

and relationships of two natural ectomycorrhizae of beech (Fagus sylvatica/Lactarius 

blennius var. viridis and Fagus sylvatica/Lactarius subdulcis). Trees 14:465–474 

Gessler A, Schneider S, von Sengbusch D, Weber P, Hanemann U, Huber C, Rothe A, 

Kreutzer K, Rennenberg H (1998) Field and laboratory experiments on net uptake of 

nitrate and ammonium by the roots of spruce (Picea abies) and beech (Fagus sylvatica) 

trees. New Phytol 138:275–285 

Gonzalez R, Gavrias V, Gomez D, Scazzocchio C, Cubero B (1997) The integration of 

nitrogen and carbon catabolite repression in Aspergillus nidulans requires the GATA 

factor AreA and an additional positive-acting element, ADA. EMBO J 16:2937–2944 

Grenson M (1973) Specificity and regulation of the uptake and retention of amino acids 

and pyrimidines in yeast. In: Vanek Z, Hostalek Z, Culdin J (eds) Genetics of industrial 

microorganisms. Academica, Prague, pp 179–193 

Hampp R, Schaeffer C (1999) Mycorrhiza-carbohydrate and energy metabolism. In: 

Varma A, Hock B (eds) Mycorrhiza: structure, function, molecular biology and 


Haselwandter K, Bobleter O, Read DJ (1990) Degradation of carbon-14 labelled lignin 

and dehydropolymer of coniferyl alcohol by ericoid and ectomycorrhizal fungi. Arch 


Hoffmann E, Wallenda T, Schaeffer C, Hampp R (1997) Cyclic AMP, a possible regulator 

of glycolysis in the ectomycorrhizal fungus Amanita muscaria. New Phytol 137:351– 

356 

Javelle A, Chalot M, Soderstrom B, Botton B (1999) Ammonium and methylamine transport 

by the ectomycorrhizal fungus Paxillus involutus and ectomycorrhizas. FEMS 


Javelle A, Rodriguez-Pastrana BR, Jacob C, Botton B, Brun A,Andre B, Marini AM, Chalot 

M (2001) Molecular characterization of two ammonium transporters from the ectomycorrhizal 

fungus Hebeloma cylindrosporum. FEBS Lett 505:393–398 

Jennings DJ (1995) The physiology of fungal nutrition. Cambridge University Press, 

Cambridge 

Johansson A, Le Quéré A, Ahrén D, Lundeberg J, Erlandsson R, Uhlèn M, Söderström B, 

Tulind A (2000) Transcript profiling during ectomycorrhizal development. In: Tran-

388 

Uwe Nehls 

script profiling during ectomycorrhizal development. Philipps University of Marburg, 

Marburg, pp 95 

Johnston M (1999) Feasting, fasting and fermenting: glucose sensing in yeast and other 

cells. TIGS 15:29–33 

Jordy MN, AzemarLorentz S, Brun A, Botton B, Pargney JC (1998) Cytolocalization of 

glycogen, starch, and other insoluble polysaccharides during ontogeny of Paxillus 

involutus–Betula pendula ectomycorrhizas. New Phytol 140:331–341 

Keeney DR (1980) Prediction of soil nitrogen availability in forest ecosystems: a literature 

review. For Sci 26:159–171 

Kowallik W, Thiemann M, Huang Y, Mutumba G, Beermann L, Broer D, Grotjohann N 

(1998) Complete sequence of glycolytic enzymes in the mycorrhizal basidiomycete, 

Suillus bovinus. Z Naturforsch 53:818–827 

Leake JR, Read DJ (1990) Proteinase activity in mycorrhizal fungi. I. The effect of extracellular 

pH on the production and activity of proteinase by ericoid endophytes from 

soil of contrasted pH. New Phytol 115:243–250 

Leake JR, Donnelly DP, Saunders EM, Boddy L, Read DJ (2001) Rates and quantities of 

carbon flux to ectomycorrhizal mycelium following 14C pulse labeling of Pinus 

sylvestris seedlings: effects of litter patches and interaction with a wood-decomposer 

fungus. Tree Physiol 21:71–82 

Lesage P, Yang X, Carlson M (1996) Yeast SNF1 protein kinase interacts with SIP4, a C 6 

zink cluster transcriptional activator: a new role for SNF1 in the glucose response. 

Mol Cell Biol 16:1921–1928 

Lewis DH, Harley JL (1965) Carbohydrate physiology of mycorrhizal roots of beech. I. 

Identity of endogenous sugars and utilization of exogenous sugars. New Phytol 

64:224–237 

Littke WR, Bledsoe CS, Edmonds RL (1984) Nitrogen uptake and growth in vitro by 

Hebeloma crustuliniforme and other Pacific Northwest mycorrhizal fungi. Can J Bot 

62:647–652 

Madi L, McBridge SA, Bailey LA, Ebbole DJ (1997) Rco-3, a gene involved in glucose 

transport and conidiation in Neurospora crassa. Genet 146:499–508 

Marschner H (1995) Mineral nutrition of plants. 2nd edn. Academic Press, London 

Martin F, Canet D, Marchal JP (1985) 13 C nuclear magnetic resonance study of mannitol 

cycle and trehalose synthesis during glucose utilization by the ectomycorrhizal 

ascomycete Cenococcum geophilum. Plant Physiol 77:499–502 

Martin F, Ramstedt M, Söderhall K (1987) Carbon and nitrogen metabolism in ectomycorrhizal 

fungi and ectomycorrhizas. Biochimie 69:569–581 

Martin F, Ramstedt M, Söderhall K, Canet D (1988) Carbohydrate and amino acid metabolism 

in the ectomycorrhizal ascomycete Sphaerosporella brunnea during glucose 

utilization a 13 C NMR study. Plant Physiol 86:935–940 

Martin F, Chalot M, Brun A, Lorillou S, Botton B, Dell B (1992) Spatial distribution of 

nitrogen assimilation pathways in ectomycorrhizas. In: Read DJ, Lewis DH, Fitter A, 

Alexander I (eds) Mycorrhizas in ecosystems. CAB International, Wallingford, pp 

311–315 

Martin F, Boiffin VV, Pfeffer PE (1998) Carbohydrate and amino acid metabolism in the 

Eucalyptus globulus–Pisolithus tinctorius ectomycorrhiza during glucose utilization. 


Marx DH (1969) The influence of ectotrophic ectomycorrhizal fungi on the resistance of 

pine roots to pathogenic infections. I.Antagonism of mycorrhizal fungi to pathogenic 


Melin E, Nilsson H (1952) Transport of labelled nitrogen from an ammonium source to 

pine seedlings through mycorrhizal mycelium. Svensk Bot Tidskr 46:281–285 

Mellor R (1992) Is trehalose a symbiotic determinant in symbioses between higher 

plants and microorganisms? Symbiosis 12:113–129


Montanini B, Moretto N, Soragni E, Percudani R, Ottonello S (2002) A high-affinity 

ammonium transporter from the mycorrhizal ascomycete Tuber borchii. Fungal 

Genet Biol 36:22–34 

Müller J, Xie ZP, Staehelin C, Mellor RB, Boller T, Wiemken A (1994) Trehalose and trehalase 

in root nodules from various legumes. Physiolog Plant 90:86–92 

Nasholm T, Persson J (2001) Plant acquisition of organic nitrogen in boreal forests. Physiol 

Plant 111:419–426 

Nehls U, Wiese J, Guttenberger M, Hampp R (1998) Carbon allocation in ectomycorrhizas: 

identification and expression analysis of an Amanita muscaria monosaccharide 

transporter. Mol Plant Microbiol Interact 11:167–176 

Nehls U, Ecke M, Hampp R (1999a) Sugar- and nitrogen-dependent regulation of an 

Amanita muscaria phenylalanine ammonium lyase gene. J Bacteriol 181:1931–1933 

Nehls U, Kleber R, Wiese J, Hampp R (1999b) Isolation and characterization of a general 

amino acid permease from the ectomycorrhizal fungus Amanita muscaria.New Phytol 

144:343–349 

Nehls U, Bock A, Ecke M, Hampp R (2001a) Differential expression of hexose-regulated 

fungal genes within Amanita muscaria/Populus tremula x tremuloides ectomycorrhizas. 

New Phytol 150:583–589 

Nehls U, Bock A, Einig W, Hampp R (2001b) Excretion of two proteases by the ectomycorrhizal 

fungus Amanita muscaria. Plant Cell Environ 24:741–747 

Nehls U, Mikolajewski S, Magel E, Hampp R (2001 c) The role of carbohydrates in ectomycorrhizal 

functioning: gene expression and metabolic control. New Phytol 

150:533–541 

Norkrans B (1950) Studies in growth and cellolytic enzymes of Tricholoma.Symb Bot 

Upsal 11:1–126 

Özcan S, Johnston M (1999) Function and regulation of yeast hexose transporters. 

Microbiol Mol Biol Rev 63:554–569 

Özcan S, Dover J, Rosenwald AG, Woelfl S, Johnston M (1996) Two glucose transporters 

in Saccharomyces cerevisiae are glucose sensors that generate a signal for induction of 

gene expression. Proc Natl Acad Sci USA 93:12428–12432 

Palmer JG, Hacskaylo E (1970) Ectomycorrhizal fungi in pure culture. I. Growth on single 

carbon sources. Physiol Plant 23:1187–1197 

Plassard C, Scheromm P, Llamas H (1986) Nitrate assimilation by maritime pine and 

ectomycorrhizal fungi in pure culture. In: Gianinazzi-Pearson V, Gianinazzi S (eds) 

Physiological and genetical aspects of mycorrhizae. INRA, Paris, pp 383–388 

RadisBaptista G,Valdivia DNU,AbrahaoNeto J (1998) Fructose 2,6-bisphosphate biosynthesis 

and regulation of carbohydrate metabolism in Aspergillus oryzae. Can J Microbiol 

44:6–11 

Read DJ (1991) Mycorrhizas in ecosystems. Experientia 47:376–391 

Ronne H (1995) Glucose repression in fungi. Trends Genet 11:12–17 

Salzer P, Hager A (1991) Sucrose utilization of the ectomycorrhizal fungi Amanita muscaria 

and Hebeloma crustuliniforme depends on the cell wall-bound invertase activity 

of their host Picea abies. Bot Acta 104:439–445 

Sarjala T (1990) Effect of nitrate and ammonium concentration on nitrate reductase 

activity in five species of mycorrhizal fungi. Physiolog Plant 79:65–70 

Schaeffer C,Wallenda T, Guttenberger M, Hampp R (1995) Acid invertase in mycorrhizal 

and non-mycorrhizal roots of Norway spruce (Picea abies [L.] Karst.) seedlings. New 

Phytol 129:417–424 

Schaeffer C, Johann P, Nehls U, Hampp R (1996) Evidence for an up-regulation of the 

host and a down-regulation of the fungal phosphofructokinase activity in ectomycorrhizas 

of Norway spruce and fly agaric. New Phytol 134:697–702

390 

Uwe Nehls 

Scheller E (1996) Aminosäuregehalte von Ap- und Ah-Horizonten verschiedener Böden 

und deren Huminsäuren- und Fulvosäuren-Fraktion. Mitt Dtsch Bodenkd Ges 

81:201–204 

Scheromm PS, Plassard C, Salsac L (1990) Regulation of nitrate reductase in the ectomycorrhizal 

basidiomycete, Hebeloma cylindrosporum Romagn., cultured on nitrate or 

ammonium. New Phytol 114:441–448 

Smith SE, Read DJ (1997) Mycorrhizal symbiosis. Academic Press, London 

Sophianopoulou V, Diallinas G (1995) Amino acid transporters of lower eukaryotes: regulation, 

structure and topogenesis. FEMS Microbiol Rev 16:53–75 

Spägele S (1992) Charakterisierung der intra- und extrazellulären Proteasenaktivitäten 

des Fliegenpilzes (Amanita muscaria [L. ex Fr.] Hooker). Eberhard-Karls-Universität, 

Tübingen 

Springael JY, Andre B (1998) Nitrogen-regulated ubiquitination of the Gapl permease of 

Saccharomyces cerevisiae. Mol Biol Cell 9:1253–1263 

Stülten C, Kong FX, Hampp R (1995) Isolation and regeneration of protoplasts from the 

ectomycorrhizal ascomycete Cenococcum geophilum Fr. Mycorrhiza 5:259–266 

Taber WA, Taber RA (1987) Carbon nutrition and respiration of Pisolithus tinctorius. 

Transact Brit Mycol Soc 89:13–26 

Tagu D, Martin F (1995) Expressed sequence tags of randomly selected cDNA clones 

from Eucalyptus globulus–Pisolithus tinctorius ectomycorrhiza. Mol Plant Microbiol 

Interact 8:781–783 

Tagu D, Lapeyrie F, Ditengou F, Lagrangem H, Laurent P, Missoum N, Nehls U, Martin F 

(2000) Molecular aspects of ectomycorrhiza development. In: Poldila G, Douds Jr DD 

(eds) Current advances in mycorrhizal research. Am Phytopathol Soc, pp 69–90 

Tazebay UH, Sophianopoulou V, Scazzocchio C, Diallinas G (1997) The gene encoding 

the major proline transporter of Aspergillus nidulans is upregulated during conidiospore 

germination and in response to proline induction and amino acid starvation. 

Mol Microbiol 24:105–117 

Ter Schure EG, Sillje HHW,Vermeulen EE, Kalhorn JW,Verkleij AJ, Boonstra J,Verrips CT 

(1998) Repression of nitrogen catabolic genes by ammonia and glutamine in nitrogen-limited 

continuous cultures of Saccharomyces cerevisiae. Microbiol Reading 

144:1451–1462 

Ter Schure EG, van Riel NA,Verrips CT (2000) The role of ammonia metabolism in nitrogen 

catabolite repression in Saccharomyces cerevisiae. FEMS Microbiol Rev 24:67–83 

Thevelein JM (1991) Fermentable sugars and intracellular acidification as specific activators 

of the RAS-adenylate cyclase signalling pathway in yeast: the relationship to 

nutrient-induced cell cycle control. Mol Microbiol 5:1302–1307 

Timonen S, Sen R (1998) Heterogeneity of fungal and plant enzyme expression in intact 

Scots pine-Suillus bovinus and -Paxillus involutus mycorrhizospheres developed in 

natural forest humus. New Phytol 138:355–366 

Trojanowski J, Haider K, Huttermann A (1984) Decomposition of 14 C-labelled lignin, 

holocellulose and lignocellulose by mycorrhizal fungi. Arch Microbiol 139:202–206 

Voiblet C, Duplessis S, Encelot N, Martin F (2001) Identification of symbiosis-regulated 

genes in Eucalyptus globulus–Pisolithus tinctorius ectomycorrhiza by differential 

hybridization of arrayed cDNAs. Plant J 25:181–191 

Wagner F, Gay G, Debaud JC (1989) Genetic variation of nitrate reductase activity in 

monokaryotic and dikaryotic populations of the ectomycorrhizal fungus, Hebeloma 

cylindrosporum Romagnesi. New Phytol 113:259–264 

Wallenda T (1996) Untersuchungen zur Physiologie der Pilzpartner von Ektomykorrhizen 

der Fichte (Picea abies [L.] Karst.). Eberhard-Karls-Universität, Tübingen 

Wallenda T, Read DJ (1999) Kinetics of amino acid uptake by ectomycorrhizal roots. 

Plant Cell Environ 22:179–187


Wiese J, Kleber R, Hampp R, Nehls U (2000) Functional characterization of the Amanita 

muscaria monosaccharide transporter AmMst1. Plant Biol 2:1–5 

Wipf D, Benjdia M, Tegeder M, Frommer WB (2002) Characterization of a general amino 

acid permease from Hebeloma cylindrosporum. FEBS Lett 528:119–124 

Wipf D, Benjdia M, Rikirsch E, Zimmermann S, Tegeder M, Frommer WB (2003) An 

expression cDNA library for suppression cloning in yeast mutants, complementation 

of a yeast his4 mutant, and EST analysis from the symbiotic basidiomycete Hebeloma 

cylindrosporum. Genome 46(2):177–181 

Wisser G (2000) Isolation und Charakterisierung von Trehalasen aus Amanita muscaria 

[L. ex Fr.] Hooker, einem Ektomykorrhizapilz. PhD-thesis, Eberhard-Karls-Universitaet 

Tuebingen, Germany 

Wisser G, Guttenberger M, Hampp R, Nehls U (2000) Identification and characterization 

of an extracellular acid trehalase from the ectomycorrhizal fungus Amanita muscaria. 

New Phytol 146:169–175 

Zhu H (1990) Purification and characterization of an extracellular acid proteinase from 

the ectomycorrhizal fungus Hebeloma crustuliniforme. Appl Environ Microbiol 

56:837–843 

Zhu H, Dancik BP, Higginbotham KO (1994) Regulation of extracellular proteinase production 

in an ectomycorrhizal fungus Hebeloma crustuliniforme. Mycologia 86:227– 

234

22 Nitrogen Transport and Metabolism in 

Mycorrhizal Fungi and Mycorrhizas 

Arnaud Javelle, Michel Chalot, Annick Brun 

and Bernard Botton 


1.1 Ecological Significance of Ectomycorrhizas 

Unlike most other organisms, plants and fungi are restricted to their habitats, 

creating potential problems when nutritional conditions become limited. To 

cope with nutrient deficiencies, they have developed a variety of adaptations 

that enable them to respond to their internal nutritional status as well as to 

the external availability of nutrients.A strategy for plants is mycorrhizal association, 

in which expanding mycorrhizal mycelia that grow outward from the 

mantle into the surrounding soil is a very efficient nitrogen scavenger owing 

to (1) its capacity to explore a larger soil volume than roots alone (Smith and 

Read 1997), (2) its ability to provide access to nitrogenous reserves contained 

in organic horizons (Chalot and Brun 1998) and (3) its greater capacity for 

uptake of nitrogenous compounds (Javelle et al. 1999; Wallanda and Read 

1999). 

This interconnected network of hyphae (or specialized aggregates, i.e., rhizomorphs) 

forms a supracellular compartment for the transport of nutrients 

from sites of nutrient capture to sites of nutrient utilization and transfer. It 

has been estimated that the external mycelium makes, by far, the greatest contribution 

to the overall potential absorbing surface area of pine seedlings 

inoculated with Pisolithus tinctorius or Cenococcum geophilum (Rousseau et 

al. 1994). Fungal hyphae have a number of advantages compared with roots; 

(1) hyphae have a low ratio of biomass to absorptive surface area and can easily 

be regenerated (Harley 1989; Rousseau et al. 1994), (2) they have been 

shown to rapidly colonize nutrient-rich sites (Carleton and Read 1991; Bending 

and Read 1995) and (3) because of their small diameter, they can exploit 

small pores inaccessible to roots. The symbiotic association of higher plants 

with mycorrhizal fungi is considered to have been responsible for the colonization 

of land by plants (Taylor and Osborn 1995). 




394 

A. Javelle et al. 

1.2 Nitrogen Uptake and Translocation by Ectomycorrhizas 

Nitrogen plays a critical role in plant and microorganism biochemistry, being 

needed for the synthesis of many compounds, including amino acids, purines, 

pyrimidines, some carbohydrates and lipids, enzyme cofactors and proteins, 

all of which are essential for growth processes. Ammonium and nitrate are 

believed to be the principal sources of nitrogen in forest soil. When the two 

compounds are supplied to plants at similar concentrations, ammonium is 

generally taken up more rapidly than nitrate (Marschner et al. 1991; Kronzucker 

et al. 1996; Howitt and Udvardi 2000).Attention has also been paid to 

the utilization of organic nitrogen forms from more complex substrates (Smith 

and Read 1997; Perez-Moreno and Read 2000),and to the direct mobilization of 

nutrients from minerals (for a review, see Landeweert et al. 2001). The two 

processes involved in ammonium assimilation,namely transport and metabolism, 

have been studied in various ectomycorrhizal models. Increases in nitrogen 

content of ectomycorrhizal plants,often connected with a growth increase, 

are well documented (Smith and Read 1997). Studies have demonstrated that 

the ectomycorrhizal partner plays an integral role in ammonium metabolism 

in trees (Chalot et al. 1991; Botton and Chalot 1995; Plassard et al. 1997). 

Nutrient uptake and transport by extraradical mycelium is suggested to be 

an important factor for improved nutrient acquisition. The contribution of 

extraradical mycelium to N nutrition of mycorrhizal Norway spruce was 

investigated. The addition of N to the hyphal compartment markedly 

increased dry weight, N concentration and N content in mycorrhizal plants. 

Calculating the uptake, based on the difference in input and output of nutrients 

in solution, confirmed a hyphal contribution of 73 % to total N uptake in 

Picea abies seedlings under nitrogen and phosphorus starvation (Brandes et 

al. 1998). In further studies, Jentschke et al. (2001) have demonstrated in Picea 

abies/Paxillus involutus ectomycorrhizas that hyphal N uptake (NH 4 + +NO3 – ) 

contributed 17 % to total N uptake in mycorrhizal seedlings. Moreover, 

ammonium is the major source of mineral nitrogen in forest soils (Marschner 

and Dell 1994), and consequently, ammonium assimilation by extraradical 

mycelium plays a crucial role for nitrogen transfer in ectomycorrhizal symbiosis. 

Melin and Nilsson (1952) showed that the mycelia phase of Suillus variegatus 

was capable of absorption and translocation to Pinus mycorrhizal 

seedlings of nitrogen from a labelled ammonium source. Disrupting the 

external mycelium from ectomycorrhizas greatly decreased [ 15 N]ammonium 

uptake by birch seedlings (Javelle et al. 1999).Ammonium is incorporated into 

a range of amino acids and these accumulate in fungal mycelium at considerable 

distances from plant roots (Finlay et al. 1988). Therefore, external hyphae 

can be considered as the absorbing structure of ectomycorrhizal roots. These 

results confirmed the function of extraradical mycelium in translocating N 

from sources to roots and that it can, therefore, be considered as a nutrient 

channel (Smith and Read 1997).

22 Nitrogen Transport and Metabolism in Mycorrhizal Fungi and Mycorrhizas 395 

2 Nitrate and Nitrite Transport 

2.1 Uptake Kinetics 

Nitrate uptake rates were estimated in a few ectomycorrhizal fungi and ectomycorrhizas. 

In the basidiomycete Rhizopogon roseolus, NO 3 – uptake measured 

after incubation of mycelia in 0.05 mM nitrate occurred at the same rate 

in the absence or presence of NO 3 – in the culture medium, suggesting that no 

inducible nitrate transporter exists in this species (Gobert and Plassard 2002). 

These results are in agreement with those of Jargeat (1999) who observed that 

the mRNA of a high-affinity transport system in the ectomycorrhizal basidiomycete 

Hebeloma cylindrosporum, was found in mycelia grown in N-free 

medium or in media containing low nitrate concentrations. Km estimates, 

around 12 mM in Rhizopogon roseolus (Gobert and Plassard 2002), and 67 mM 

in Hebeloma cylindrosporum (Plassard et al. 1994) are close to the Michaelis 

constants found in nonmycorrhizal fungi, with values of 23 mM in Aspergillus 

nidulans (Zhou et al. 2000) and 25 mM in Neurospora crassa (Blatt et al. 1997). 

In nonmycorrhizal Pinus pinaster roots, rates of NO 3 – uptake were 

enhanced by exposure to external nitrate, as usually found in higher plant 

species. In the association Pinus pinaster/Rhizopogon roseolus, NO 3 – uptake 

was not modified by external nitrate, but was constantly higher than that 

measured in nonmycorrhizal roots (Gobert and Plassard 2002). According to 

these authors, the fungal uptake of nitrate may confer to the mycorrhiza a 

greater ability to use low and fluctuating concentrations of nitrate in the soil. 

However, in Fagus-Laccaria mycorrhizas, mycorrhization led to reduced rates 

of NO 3 – net uptake, this effect being caused by reduced influx, plus enhanced 

efflux of NO 3 – as compared with nonmycorrhizal beech roots (Kreuzwieser et 

al. 2000). 

2.2 Characterization of Nitrate and Nitrite Transporters 

Kinetically, two groups of nitrate transporters have been characterized: one 

with a high affinity, Km in the mM nitrate range, found in filamentous fungi, 

yeasts, algae and plants (Crawford and Glass 1998; Forde 2000), and one low 

affinity group, Km in the mM nitrate range, found mainly in plants, although 

there is indirect evidence of its presence in yeasts and algae (Machin et al. 

2000; Navarro et al. 2000). 

Aspergillus nidulans possesses two high-affinity nitrate transporters, 

encoded by the nrtA (formerly designated crnA) and the nrtB genes (Unkles 

et al. 1991; 2001). Whereas mutants expressing either gene grew normally on 

nitrate as sole nitrogen source, the double mutant was unable to grow even if 

the nitrate concentration was increased to 200 mM. This indicates that NRTA 

and NRTB are the only nitrate transporters in Aspergillus nidulans. Both

396 


genes were regulated identically under an extensive range of conditions; nevertheless, 

the transporters revealed different Km and V max values for nitrate. 

Flux analysis of single gene mutants using 13 NO 3 – showed that Km values for 

the NRTA and NRTB proteins were about 100 and 10 mM, respectively, while 

V max values were approximately 600 and 100 nmol/mg DW/h, respectively 

(Unkles et al. (2001). This kinetic differentiation may provide the physiological 

plasticity to acquire sufficient nitrate despite highly variable external concentrations. 

In Hansenula polymorpha, the genomic DNA containing the nitrate reductase-(YNR1) 

and nitrite reductase-(YNI1) encoding genes, revealed an open 

reading frame of 1524 nucleotides (named YNT1, yeast nitrate transporter 

gene) encoding a putative protein of 508 amino acids with great similarity to 

the nitrate transporters from Aspergillus nidulans and Chlamydomonas reinhardtii 

(Perez et al. 1997). Disruption of the chromosomal YNT1 copy resulted 

in an incapacity to grow in nitrate and a significant reduction in the rate of 

nitrate uptake. The disrupted strain was still sensitive to chlorate and, in the 

presence of 0.1 mM nitrate, the expression of YNR1 and YNI1, as well as the 

activity of nitrate reductase and nitrite reductase, were significantly reduced 

compared to the wild type. Northern-blot analysis showed that YNT1 was 

expressed when the yeast was grown in nitrate and nitrite, but not in ammonium 

solution (Perez et al. 1997). 

In Hansenula polymorpha, the YNT1 gene encodes a high affinity nitrate 

transporter (Km 2–3 mM) which constitutes quantitatively the main nitrate 

transporter activity in the fungus. The existence of a second nitrate transporter 

has been inferred from different experimental pieces of evidence, but 

the gene has not yet been identified (Machin et al. 2000). The protein Ynt1 also 

transports nitrite with high affinity and belongs to the proposed NNP (nitrate 

nitrite porter) family involved in nitrate and nitrite transport (Forde 2000). 

This family, in turn belongs to the major facilitator superfamily (MFS), constituted 

by transmembrane proteins in which 12 membrane spanning helices 

connect cytosolic N-terminal and C-terminal domains (Pao et al. 1998). However, 

in Hansenula polymorpha, it is not clear whether nitrite enters through a 

specific transport system, or if it shares a nitrate transport.Ynt1 presents similarity 

in sequence with the Aspergillus nidulans nitrate transporter NRTA 

(CRNA) and the high affinity nitrate transporters in plants (Siverio 2002). 

In the field of endomycorrhizas, PCR amplifications using tomato DNA 

and degenerate oligonucleotide primers allowed the identification of a new 

putative nitrate transporter, named NRT2 (Hildebrandt et al. 2002). Its 

sequence showed typical motifs of a high affinity nitrate transporter of the 

MFS. The formation of its mRNA was positively controlled by nitrate, and 

negatively by ammonia, but not by glutamine. In situ hybridization experiments 

showed that this transporter was mainly expressed in rhizodermal 

cells. In roots colonized by the arbuscular mycorrhizal fungus Glomus 

intraradices, transcript formation of NRT2 extended to the inner cortical cells


where the fungal structures, arbuscules and vesicles, were concentrated. 

Northern analyses indicated that the expression of the transporter was higher 

in mycorrhized tomato roots than in noncolonized controls. In addition, mycorrhization 

caused a significant expression of a nitrate reductase gene of Glomus 

intraradices. According to the authors mentioned above, the results sug- 

AAT ALAT 

2-oxo Glu 2-oxo 

2-oxo 

NO 3 - 

Nrt2 

Asp oaa pyr Ala 

NR 

NO 3 - 

Amt1 

C metabolism 

Glu 

Glu 

GDH GS 

NIR 

NO 2 - 

NH 4 + 

Amt2 

NH 4 + 

2-oxo 

GOGAT 

Inhibition (?) 

- 

Amt3 

Gln 

Gap1 

Gln 

- 

transcription 

AMT1 

AMT2 

AMT3 

GDHA 

NAR1 

GLNA 

mRNA 

Fig. 1. A model describing the regulation of nitrogen transport and assimilation in 

Hebeloma cylindrosporum. This ectomycorrhizal fungus is able to use nitrate, ammonium 

and amino acids as nitrogen sources. Under low ammonium status, AMT1, AMT2, 

AMT3, GDHA and GLNA are transcribed, which results in elevated ammonium uptake 

and metabolism capacities. Under ammonium excess, AMT1, AMT2 and GDHA are efficiently 

repressed, which results in reduced ammonium assimilatory capacities. Under 

these conditions, AMT3 and GLNA would ensure the maintenance of a basal level of 

ammonium assimilation. AMT1 and AMT2 transcript levels are controlled through the 

effect of intracellular glutamine, whereas the GDHA and NAR1 mRNA level is controlled 

by ammonium (bold dotted lines). Ammonium uptake activity may be controlled by 

intracellular NH 4 + through a direct effect (dotted lines). 2-oxo 2-oxoglutarate, oaa 

oxaloacetate, pyr pyruvate, GOGAT glutamate synthase, Aat aspartate aminotransferase, 

Alat alanine aminotransferase, NR nitrate reductase, NIR nitrite reductase, Nrt2 nitrate 

transporter, GAP1 general amino acid transporter

398 


gest that mycorrhization positively affects nitrate uptake from soil and nitrate 

allocation to the plant partner, probably mediated preferentially by the transporter. 

In addition, part of the nitrate taken up is very likely reduced by the 

fungal partner itself and may then be transferred, when in excess, as glutamine 

to the plant’s symbiotic partner. 

Nitrate transporters have not yet been fully characterized in ectomycorrhizal 

fungi. A gene has been isolated in Hebeloma cylindrosporum by Jargeat 

et al. (2000; Fig. 1), but the molecular mechanism of its regulation is unknown. 

However, in this fungus, Jargeat et al. (2003) has shown more recently that the 

nitrate transporter polypeptide is characterized by 12 transmembrane 

domains and presents both a long putative intracellular loop and a short Cterminal 

tail, two structural features which distinguish fungal high-affinity 

transporters from their plant homologues. In addition, in Hebeloma cylindrosporum, 

transcription of the nrt2 gene (as well as the gene encoding a 

nitrite reductase) was repressed by ammonium and stimulated, not only in 

the presence of nitrate, but also in the presence of organic nitrogen sources or 

under nitrogen deficiency (Jargeat et al. 2003). 

3 Ammonium Transport 

3.1 Physico-Chemical Properties of Ammonium: Active Uptake Versus 

Diffusion 

Using [ 14 C]methylammonium as an analogue of ammonium, the kinetics and 

the energetics of NH 4 + transport were studied in the ectomycorrhizal fungus 

Paxillus involutus (Javelle et al. 1999) and ammonium transporters were first 

cloned in Hebeloma cylindrosporum (AMT2 and AMT3; Javelle et al. 2001) and 

Tuber borchii (AMT1; Montanini et al. 2002). Although the process of ammonium 

uptake is often considered as a rate-limiting step in its acquisition 

(Jongbloed et al. 1991; Javelle et al. 1999) it has received relatively little attention 

(Burgstaller 1997). 

Ammoniac (NH 3) is a weak base (pK a of 9.25), with a dipole moment of 

1.47D. The neutral molecule, NH 3, dissolves much more rapidly in organic solvents 

than its ionic counterpart, NH 4 + . Consequently, the permeability of NH3 

across lipid bilayers is three orders of magnitude greater than that of NH 4 + . 

Whilst diffusion of NH 3 across the lipid portion of membranes is believed to 

be of biological significance, diffusion of NH 4 + is not. Reported permeability 

values for ammoniac, ranging from 2.6 mmol/s (Ritchie and Gibson 1987) to 

47 mmol/s (Yip and Kurtz 1995), were found in biomembranes. Therefore, 

previous investigations have supported the hypothesis that ammonia is transported 

as a small, uncharged and lipophilic compound across the plasma 

membrane, a process which does not require specific transporters. However, 

rates of diffusion do not seem to be sufficient to account for the requirements


of plant growth (Burgstaller 1997). At a neutral pH typical of cell cytosol, 

approximately 99 % of ammonium is present as the cation NH 4 + . By definition, 

a decrease of one pH unit is accompanied by a tenfold increase of the 

ratio NH 4 + :NH3 . Therefore, in spite of the general acceptance that NH 3 can 

readily diffuse across natural membranes, it was postulated that ammonium 

uptake in cells could also be mediated by other mechanisms. 

3.2 Physiology of Ammonium Transport in Ectomycorrhizas 

The first evidence that a specific ammonium transport system acts in fungi 

came from the works of Hackette et al. (1970). They used the ammonium-analogue 

tracer [ 14 C]methylammonium and suggested that an ammonium transporter 

acts in the fungus Penicillium chrysogenum. The radioactive ammonium 

analogue [ 14 C]methylammonium has been widely used to assay uptake. 

Roon et al. (1975) measured an uptake in Saccharomyces cerevisiae which 

resulted in a 1000-fold accumulation. In a further study, Dubois and Grenson 

(1979) showed that the uptake of ammonium/methylammonium in S. cerevisiae 

is mediated by at least two functionally distinct systems, but this study 

was hampered by the lack of molecular characterization of the transport systems. 

The first ammonium transporter genes characterized were MEP1 

cloned in S. cerevisiae (Marini et al. 1994), and AMT1 cloned in Arabidopsis 

thaliana (Ninnemann et al. 1994). They belong to a multigenic family, the socalled 

Mep/Amt family. 

Ammonium mobilization by mycelium from soil sources is directly linked 

to hyphal uptake capacities. Using [ 14 C]methylamine, kinetics of ammonium/methylammonium 

transport in ectomycorrhizal fungi have been characterized 

(Jongbloed et al. 1991; Javelle et al. 1999). A saturable mediated 

uptake was obtained, which conformed to simple Michaelis-Menten kinetics, 

and was consistent with a carrier-mediated transport. Both pH dependence 

and inhibition by protonophores indicate that methylamine transport in P. 

involutus is dependent on the electrochemical H + -gradient (Javelle et al. 

1999). These results suggest that ammonium uptake is an active (energyrequiring) 

process. Comparing the ammonium uptake capacity of the two 

partners separately or in symbiosis, it was found that mycelia have much 

higher capacities for ammonium uptake than nonmycorrhizal roots and ectomycorrhizal 

fungi increase ammonium uptake capacities of their host roots 

(Plassard et al. 1997; Javelle et al. 1999). 

Nitrogen starvation increased methylamine transport in P. involutus 

(Javelle et al. 1999) and similarly, N-starved plants usually showed a faster 

NH 4 + net uptake than N-fed plants (Howitt and Udvardi 2000). However, these 

studies were hampered by the lack of molecular characterization of the transport 

systems involved and their regulation at the molecular level remains to 

be clarified.

400 


3.3 Isolation of Ammonium Transporter Genes 

Molecular studies of ammonium transporters in ectomycorrhizal fungi are 

still scarce and concern only the ectomycorrhizal fungus Hebeloma cylindrosporum. 

Three ammonium transporters, HcAmt1, HcAmt2 and HcAmt3 

(Ammonium transporter) were cloned in H. cylindrosporum. Both Southern 

blot experiments and cDNA library screening indicate that H. cylindrosporum 

has only three ammonium transporters, like the yeast S. cerevisiae (Marini et 

al. 1997; Javelle et al. 2001; Javelle et al. 2003b). The hydropathy profiles of 

HcAmt1, HcAmt2 and HcAmt3 generated with the Kyte and Doolittle algorithm, 

consist of 11 hydrophobic domains of sufficient length to be considered 

as potential membrane-spanning domains. 

The function of HcAmts in ammonium transport was further characterized 

by yeast mutant complementation, as previously described for ammonium 

transporters from plants and animals. S. cerevisiae possesses three 

ammonium transporters, namely Mep1, Mep2 and Mep3 (Methylammonium 

permease). The yeast strain 31019b, mep1D mep2D mep3D, was unable to 

grow on media containing less than 1 mM ammonium as sole nitrogen 

source (Marini et al. 1997). Functional expression of HcAmt1, HcAmt2 or 

HcAmt3 in this triple mutant resulted in complementation of growth defects 

in the presence of less than 1 mM ammonium as sole nitrogen source. Thus, 

HcAMTs cDNA encode functional NH 4 + transporters. Kinetic parameters 

were determined using [ 14 C]methylammonium as a tracer in the transformed 

yeast strain 31019b. Previous works with mycorrhizal fungi reported 

Km values in the range 110–180 mM when using methylamine as substrate 

(Javelle et al. 1999). However, such data could be the result of multiple transporter 

expressions. In H. cylindrosporum, as well as in other organisms 

(Marini et al. 1997; Gazzarrini et al. 1999; Howitt and Udvardi 2000), multiple 

Amt transporters with complementary affinities probably allow the fungus 

to maintain a steady ammonium uptake over a wide range of concentrations. 

Indeed, in forest soils the quality and quantity of nitrogen sources 

can vary considerably. 

3.4 Regulation of the Ammonium Transporters 

Expression levels of the three ammonium transporter (AMT1, AMT2, AMT3) 

genes were studied by Northern blot analysis under different nitrogen conditions. 

AMT1 and AMT2 are high affinity transporters (for example, Km: 

58 mM for methylammonium at pH 6.1 for AMT2), while AMT3 is a low affinity 

transporter (Km: 260 mM for methylammonium at pH 6.1; Javelle et al. 

2001). In response to exogenously supplied ammonium or Gln, AMT1 and 

AMT2 were down-regulated, while they were up-regulated upon nitrogen 

deprivation or in the presence of nitrate. This indicates that these genes are


subjected to nitrogen repression in H. cylindrosporum (Fig. 2). AMT3 was 

poorly regulated at this level. 

Expression of AMT1 only in ammonium-limiting conditions is consistent 

with a role for the high-affinity ammonium transporter in scavenging low 

concentrations of ammonium. The low-affinity ammonium transporter Amt3 

would be required for growth in ammonium-sufficient conditions. 

In order to identify the effector(s) for nitrogen regulation in H. cylindrosporum, 

the correlation coefficient for the relationship between AMT1, 

AMT2, AMT3, transcript levels and N-compound amounts were calculated. 

This transcriptional control is driven by intracellular Gln. Indeed, an intracel- 

Fig. 2. AMT1,AMT2,AMT3,GDHA and GLNA mRNA levels in Hebeloma cylindrosporum. 

Fungal colonies were grown for 10 days on cellophane-covered agar medium containing 

3.78 mM ammonium as sole nitrogen source (T 0 ) and transferred to a N-free liquid medium 

for 12 h (–N).Some colonies were further transferred to a 0.1,1 or 10 mM ammonium-containing 

medium. Total RNA was extracted at 3, 6, 12 and 24 h from 100 mg of mycelium and 

20 mg/lane were separated on 1.5 % agarose-formaldehyde gel and hybridized to the 

[a- 32 P]dCTP labelled cDNA probes or 5.8S rRNA probe as loading control

402 


lular Gln amount higher than 2 nmol/mg DW seems to be sufficient to promote 

AMT1 repression in H. cylindrosporum (Javelle et al. 2003b). Ammonium 

influx is inhibited by intracellular ammonium which agrees with other 

findings from A. bisporus (Kersten et al. 1999), and A. thaliana (Rawat et al. 

1999), but mechanisms responsible for this regulation remain unclear. 

3.5 Other Putative Functions of Ammonium Transporters 

In addition to their role in ammonium uptake and retrieval, ammonium 

transporters may have a third putative role. A diploid wild-type strain of the 

yeast S. cerevisiae undergoes a dimorphic transition to filamentous growth in 

response to nitrogen starvation. Mep2 is one of three related ammonium per- 

HcAmt3 

AAK82417 

ScMep3 

P53390 

AnMeaa 

AAL73117 

ScMep1 

P40260 

NcMep3 

Contig 3.17 

CaAmt2 

Contig 6.2476 

HcAmt1 

AY094982 

0.00 

0.05 

0.10 

0.15 

0.20 

ScMep2 

P41948 

HcAmt2 

AAK82416 

AnMepa 

AAL73118 

MvAmta 

AAD40955 

TbAmt1 

AAL11032 

UmMep1 

AAL08424 

NcMepa 

CAD21326.1 

Fig. 3. Phylogenetic relationships among fungal Mep/Amt proteins. Complete amino 

acid sequences derived from full-length cDNA predicted using TMHMM algorithm were 

aligned with Clustalw and the tree was constructed by the neighbor-joining method 

using Mega 2.1. p-distances were estimated between all pairs of sequences using the 

complete deletion option. Gene names and GenBank accession numbers are indicated. 

Proteins in bold belong to the high affinity ammonium transporter and sensor family 

(TC 2A 49 3 2), according to the TC classification. Organisms are as follows. An 

Aspergillus nidulans, Ca Candida albicans, Hc Hebeloma cylindrosporum, Mv Microbotryum 

violaceum, Nc Neurospora crassa, Sc Saccharomyces cerevisiae, Tb Tuber borchii, 

Um Ustilago maydis


meases which plays a unique role as a nitrogen sensor in the transduction 

pathway of pseudohyphal differentiation in S. cerevisiae not shared with the 

related Mep1 and Mep3. Interestingly, in the ectomycorrhizal fungus H. cylindrosporum, 

two ammonium transporters (Amt1 and Amt2) are able to complement 

the pseudohyphal growth defect of a homozygotous mep2D yeast 

mutant, whereas the third ammonium transporter (Amt3) is unable to do so 

(Javelle et al. 2001, 2003b).According to the classification of the transport system 

available at http://www-biology.ucsd.edu/~msaier/transport/ (TC system), 

the HcAmts can be divided into two groups. HcAmt1, HcAmt2 and 

Mep2 belong to the high affinity ammonium transporter and sensor family 

(TC 2A 49 3 2), whereas HcAmt3 belongs to the low affinity ammonium transporter 

family (TC 2A 49 3 1; Fig. 3). 

We have recently hypothesized that high affinity ammonium transporters 

from mycorrhizal fungi sense the environment and induce via signal transduction 

cascades a switch of the fungal growth mode observed during mycorrhiza 

formation. Upon entering the root depletion zone, mycorrhizal fungi 

may receive a signal through this sensing mechanism which induces hyphal 

proliferation around roots, corresponding to the primary events in ectomycorrhiza 

formation (Javelle et al. 2003a). 

4 Amino Acid Transport 

4.1 Utilization of Amino Acids by Ectomycorrhizal Partners 

It has been well established that ectomycorrhizal fungi can use amino acids as 

nitrogen and carbon sources (Abuzinadah and Read 1988; Näsholm et al. 

1998). Using 14 C-labelled compounds, Wallenda and Read (1999) determined 

the kinetics of uptake of amino acids by excised ectomycorrhizal roots from 

beech, spruce, and pine. All mycorrhizal types took up amino acids via highaffinity 

transport systems with Km values ranging from 19 to 233 mM.A comparative 

analysis for the uptake of amino acids and the ammonium analogue 

methylammonium showed that ectomycorrhizal roots have similar or even 

higher affinities for the amino acids, indicating that absorption of these N 

organic forms can contribute significantly to total N uptake by ectomycorrhizal 

plants. 

Transport of amino acids was investigated in the mycorrhizal fungi Paxillus 

involutus (Chalot et al. 1996), and Amanita muscaria (Nehls et al. 1999), 

which demonstrated their ability to take up a variety of amino acids. In the 

latter fungus, the uptake characteristics of the encoded transporter protein, as 

analysed by heterologous expression in yeast, identified the protein as a highaffinity, 

general amino acid permease (Km: 22 mM for histidine and up to 

100 mM for proline). The uptake of amino acids showed characteristic features 

of active transport.

404 


In Paxillus involutus, the apparent Km derived from the Eadie-Hofstee 

plots ranged from 7 mM for alanine to 27 mM for glutamate. Maximal velocities, 

expressed as mmol (g dry weight) –1 min –1 , were between 0.24 for alanine 

and 0.71 for glutamine. In this fungus, the uptake of amino acids markedly 

depended on the pH and was optimal at pH 3.9–4.3 for glutamate and glutamine, 

and at pH 3.9–5.0 for alanine and aspartate. 

Both pH dependence and inhibition by protonophores, such as 2,4-dinitrophenol 

(DNP) and carbonyl cyanide m-chlorophenylhydrazone (CCCP), were 

consistent with a proton symport mechanism for amino acid uptake by Paxillus 

involutus. Competition studies indicated a broad substrate recognition by 

the uptake system, which resembles the general amino acid permease of yeast 

(Chalot et al. 1996, 2002). 

The impact of birch mycorrhization with Paxillus involutus led to a profound 

alteration of the metabolic fate of exogenously supplied amino acids 

(Blaudez et al. 2001). Inoculation increased [ 14 C]glutamate and [ 14 C]malate 

uptake capacities by up to 8 and 17 times, respectively, especially in the early 

stages of mycorrhiza formation. In addition, it was demonstrated that Gln was 

the major 14 C-sink in mycorrhizal roots and in the free-living fungus. In contrast, 

citrulline and insoluble compounds were the major 14 C compounds in 

nonmycorrhizal roots (Blaudez et al. 2001). 

In order to study how amino acid transport characteristics were affected by 

mycorrhization, Sokolovsky et al. (2002) used an electrophysiological 

approach in Calluna vulgaris associated or not with the ericoid fungus 

Hymenoscyphus ericae. Both the V max and Km parameters of amino acid 

uptake were affected by fungal colonization in a manner consistent with an 

increased availability of amino acid to the plant. Indeed, the transport capacity 

for asparagine, histidine, ornithine and lysine, in particular, was increased 

after colonization. Interestingly, a-aminobutyric acid led to a large depolarization 

only in colonized cells. This implies that mycorrhization triggers a 

capacity to transport a broader range of substrates, including amino acids 

that are not metabolized. 

4.2 Molecular Regulation of Amino Acid Transport 

In Amanita muscaria, only a low, constitutive expression of the amino acid 

transporter was detected in the presence of amino acids and ammonium, 

which are both sources of N for the fungus (Nehls et al. 1999). By contrast, 

under N starvation, or in the presence of nitrate or phenylalanine, not utilized 

by the fungus as N sources, expression of the gene was considerably 

enhanced. Therefore, in Amanita muscaria, as in S. cerevisiae or Aspergillus 

nidulans (Sophianopoulou and Diallinas 1995), gene expression of amino 

acid transporters is regulated at the transcriptional level by N repression. In 

addition to amino acid uptake for nutrition, the enhanced expression of the


gene under conditions of N starvation, suggests that the transporter can also 

be involved in the prevention of amino acid loss by hyphal leakage in the 

absence of a suitable N source (Nehls et al. 1999). 

A gene named HcBap1 has recently been isolated from H. cylindrosporum 

by functional complementation of a yeast strain deficient in amino acid transporters 

(Wipf et al. 2002). 

5 Reduction of Nitrate to Nitrite and Ammonium 

5.1 Reduction of Nitrate to Nitrite 

Nitrate assimilation in fungi follows the same pathway as that described for 

yeasts and plants. After transport into the cells, nitrate is converted to ammonium 

by two successive reductions catalysed respectively by nitrate reductase 

and nitrite reductase. Although nitrate is one of the most abundant nitrogen 

sources in nature, numerous fungi more readily use ammonium, especially 

ectomycorrhizal fungi which live predominantly in forest soils where a high 

organic material content maintains an acidic pH. Under these circumstances, 

nitrification is inhibited and ammonium is usually the main form of mineral 

nitrogen (Vitousek and Matson 1985). However, it has been shown that ectomycorrhizal 

fungi are also able to utilize NO 3 – which, for a few species, is capable 

of promoting better growth than ammonium (Scheromm et al. 1990; 

Anderson et al. 1999). 

The enzyme complex nitrate reductase which is a molybdoflavoprotein catalyzes 

the reduction of NO 3 – to NO2 – by reduced pyridine nucleotides. The 

enzyme of higher plants has a high molecular weight, varying from 220 to 

600 kDa, depending on the organisms in which it occurs (Notton and Hewitt 

1978). In fungi, nitrate reductase has been extensively studied in Neurospora 

crassa where it is found as a 228-kDa homodimer (Garrett and Nason 1969) 

and in Aspergillus nidulans where the enzyme has a molecular mass of 

180 kDa (Minagawa and Yoshimoto 1982). In plants and fungi, the polypeptide 

is located in the cytosolic soluble fraction, but is weakly bound to the 

plasmalemma and tonoplast in Neurospora crassa (Roldan et al. 1982). 

Nitrate reductase generally appears to be unstable and,due to the difficulties 

experienced in purifying the enzyme, information on its properties in mycorrhizal 

fungi is very scarce. However, nitrate reduction by partially purified 

enzyme preparations has been investigated in Hebeloma cylindrosporum by 

Plassard et al. (1984a). The Michaelis constants for nitrate, NADPH and FAD 

were found to be 152, 0.185, and 22.7 mM,respectively.In Pisolithus tinctorius, 

nitrate reductase exhibited less affinity for nitrate (Km: 328 mM) and for 

NADPH (Km: 49.6mM; Aouadj et al. 2000), but the enzyme was similar to those 

found in nonmycorrhizal fungi. Such values are in the same range as those 

found in higher plant tissues and suggest that ectomycorrhizal fungi have

406 


capabilities of reducing NO 3 – similar to those of most higher plants. However, 

nitrate reductase activity varies greatly between mycorrhizal species and isolates.For 

example,in Rhizopogon vulgaris,nitrate reductase was 32-fold higher 

in the S-251 isolate than in the S-219 isolate (Ho and Trappe 1987). 

In the ectomycorrhizal basidiomycete Suillus bovinus, nitrate reductase 

proved to be substrate-induced and activity could only be measured after 

exposure of the mycelia to exogenous nitrate (Grotjohann et al. 2000). Similar 

results were found in Scleroderma verrucosum (Prima Putra et al. 1999), and 

Pisolithus tinctorius (Aouadj et al. 2000), where both nitrate reductases were 

strongly induced in the presence of nitrate and repressed by ammonium. 

5.2 Reduction of Nitrite to Ammonium 

Nitrite reductase from the ectomycorrhizal basidiomycete Hebeloma cylindrosporum 

is specific for NADPH and was found to be very unstable (Plassard 

et al. 1984b). The saturation curve of the enzyme for NO 2 – was biphasic with 

two apparent Km values at 13 and 350 mM. This suggests that the enzyme of 

Hebeloma cylindrosporum has two types of binding sites for NO 2 – which could 

make the reaction continuously responsive to concentration changes over a 

wide range. Nitrite reductase activity measured in Hebeloma cylindrosporum 

was similar to the nitrate reductase activity, ranging from 10 to 30 mmol h –1 g –1 

fresh weight, which is considerably higher than the in vivo NO 3 – uptake capacity 

of the mycelium (Plassard et al. 1984b). Consequently, nitrite does not 

accumulate in the fungal cells, and this indicates that nitrite reductase is obviously 

not a limiting step of NO 3 – assimilation in this ectomycorrhizal fungus. 

5.3 Molecular Characterization of Nitrate Reductase and Nitrite 

Reductase 

Genes encoding proteins involved in nitrate assimilation are usually induced 

by nitrate and subjected to nitrogen catabolite repression. Cloning of two 

nitrate reductase (NR) genes has been carried out in the ectomycorrhizal fungus 

Hebeloma cylindrosporum (Jargeat et al. 2000). One of these genes (nar1) 

is transcribed and codes for a 908 amino acid polypeptide, while the other 

gene (nar2) for which no mRNA transcripts were detected, is considered to be 

an ancestral, nonfunctional duplication of nar1. It is well known that high 

nitrate reductase activities are found in mycelia of Hebeloma cylindrosporum 

cultivated in ammonium-containing media, sometimes higher than those 

exhibited in the presence of nitrate (Plassard et al. 1986). However, Northern 

analyses showed that nar1 in Hebeloma cylindrosporum was strongly 

repressed by ammonium, while low nitrogen concentrations or high levels of 

nitrate, urea, glycine or serine sustained a high level of transcription (Jargeat


et al. 2000). The authors have put forward the hypothesis that the nitrate 

reductase enzyme of the fungus might be extremely stable in vivo and progressively 

accumulates in the cells growing on ammonium. In addition, such 

results indicate that in Hebeloma cylindrosporum, expression of the nitrate 

reductase gene is regulated primarily by the availability of ammonium, but 

not by the presence of nitrate in the medium. This regulation pattern clearly 

distinguishes this fungus from the other saprophytic and pathogenic species 

previously studied. 

Assimilatory nitrate reductase of higher plants is subjected to a complex regulation 

of its expression and catalytic properties (Kaiser and Huber 2001).The 

NR protein is inactivated by phosphorylation combined with a link with a 

dimeric protein,which may cause a change in NR conformation that interrupts 

electron transport between the heme and the molybdenum-cofactor domains 

(Kaiser and Huber 2001).It is known that light as well as CO 2 and oxygen availability 

are the major external triggers for a rapid and reversible modulation of 

NR activity, and that sugars and/or sugar phosphates are the internal signals 

which regulate the protein kinase(s) and phosphatase. In ectomycorrhizal 

fungi, there is no evidence, so far, for a specific post-translational inactivation 

of the NR protein. In Hebeloma cylindrosporum, the main NR protein named 

NAR1,like all other fungal NR polypeptides,lacks the short motifs found in the 

N-terminal and hinge 1 domains of plant NRs,which are both necessary for the 

post-translational inactivation of these enzymes in response to changes in 

light or CO 2 status (Su et al. 1996; Jargeat et al. 2000). 

Indeed, in Neurospora crassa the structural genes that encode nitrogen 

catabolic enzymes are subject to nitrogen metabolite repression, mediated by 

the positive-acting NIT2 protein and by the negative-acting NMR protein (for 

“nitrogen metabolite repression”; Pan et al. 1997). NIT2, a globally acting factor, 

(or AREA in Aspergillus nidulans, or GLN3 in Saccharomyces cerevisiae) is 

a member of the GATA family of regulatory proteins and has a single 

Cys 2/Cys 2 zinc finger DNA-binding domain. Deletions or certain amino acid 

substitutions within this zinc finger and the carboxy-terminal tail resulted in 

a loss of nitrogen metabolite repression (Marzluf 1997). Those mutated forms 

of NIT2 that were insensitive to nitrogen repression had also lost one of the 

NIT2-NMR protein–protein interactions. These results provide compelling 

evidence that the specific NIT2–NMR interactions have a regulatory function 

and play a central role in establishing nitrogen metabolite repression (Pan et 

al. 1997). 

The different genes involved in nitrate assimilation, as well as putative 

nitrate transport systems, have been cloned from various saprophytic and 

pathogenic filamentous ascomycetes; all of these genes are single-copy genes 

and their transcription is subject to ammonium/glutamine repression and 

nitrate induction (Kinghorn and Unkles 1994). In the yeast Hansenula polymorpha, 

the genes YNT1, YNR1 and YNI1, encoding respectively nitrate transport, 

nitrate reductase and nitrite reductase (NiR), have been cloned, as well

408 


as two other genes encoding transcriptional regulatory factors. Transcriptional 

regulation is the main regulatory mechanism that controls the levels of 

the enzymes involved in nitrate metabolism (Siverio 2002). The genetic and 

molecular bases of repression and induction have been studied in detail in 

Aspergillus nidulans and Neurospora crassa (Scazzocchio and Arst 1989; Caddick 

et al. 1994; Marzluf 1997). 

In both species, nitrate induction is mediated by a pathway-specific regulatory 

gene (nirA and nit-4 in, respectively Aspergillus nidulans and Neurospora 

crassa), whose product binds to the promoters of the nitrate pathway genes 

when NO 3 – is present in the culture medium. Similarly, derepression is mediated 

by a wide-domain regulatory gene (respectively areA and nit-2), which 

encodes a GATA DNA-binding protein. Both areA and nit-2 are responsible, at 

least in part, for the derepression, when ammonium is absent, of several other 

genes involved in the use of other nitrogen sources, such as several amino 

acids or proteins. 

In Neurospora crassa and Aspergillus nidulans, glutamine appears to be the 

critical metabolite which exerts nitrogen catabolite repression (Chang and 

Marzluf 1979; Premakumar et al. 1979). Ammonia leads to strong nitrogen 

repression in these fungi, but is not itself active, since it does not cause repression 

in mutants lacking glutamine synthetase (Premakumar et al. 1979). Intracellular 

glutamine, or possibly a metabolite derived from it, leads to repression, 

but the cellular location of the glutamine pool responsible for this 

control response, e.g., cytoplasmic or vacuolar, is unknown. An extremely 

important, but still unknown feature is the identity of the element or signal 

pathway system that senses the presence of repressing levels of glutamine. It is 

conceivable that the AREA, NIT2, GLN3, and similar global regulators themselves 

bind glutamine or that a complex such as a NIT2-NMR heterodimer 

recognizes the amino acid. However, it is also possible that an as yet unidentified 

factor detects glutamine and conveys the repression signal to the global 

activating proteins. Thus, an important goal for future research is the creative 

use of genetic and biochemical approaches to identify the signalling system 

that recognizes and processes environmental nitrogen cues. 

In the ectomycorrhizal fungus Hebeloma cylindrosporum, transcription of 

nar1 coding for the NR protein, was repressed in the presence of ammonium, 

suggesting that the organism might possess a gene homologous to nit-2 in 

Neurospora crassa. According to Jargeat et al. (2000), inspection of the 

sequences flanking the NR genes cloned from Hebeloma cylindrosporum 

revealed that they contain several GATA elements to which regulatory GATA 

proteins could bind. 

In Neurospora crassa, expression of structural genes which encode the 

nitrate assimilatory enzymes also has an absolute requirement for nitrate 

induction mediated by a pathway-specific factor, NIT4 (or NIRA in 

Aspergillus nidulans; Marzluf, 1997). The Neurospora crassa NIT4 protein is 

composed of 1090 amino acids and contains at its amino terminus a Cys 6 /Zn 2


binuclear zinc cluster followed by a spacer region and a coiled-coil motif that 

mediates the formation of a homodimer, the form that is responsible for 

sequence-specific DNA binding. 

In Hebeloma cylindrosporum, supply of nitrate is not necessary for the 

transcription of the NR gene (Jeargeat et al. 2000), suggesting that in this fungus 

there is no transcription factor such as NIT4 capable of promoting transcription 

in the presence of nitrate. In agreement with this hypothesis, no 

motifs resembling the binding sites for NIT4 or NIRA were detected in the 

promoter regions of the genes cloned in the ectomycorrhizal fungus (Jeargeat 

et al. 2000). 

In the yeast Hansenula polymorpha the YNT1 gene encoding the nitrate 

transporter is clustered with the structural genes which encode nitrate reductase 

and nitrite reductase (Perez et al. 1997). Clustering of these three assimilation 

genes was previously reported in Aspergillus nidulans (Johnstone et al. 

1990), and more recently in the ectomycorrhizal fungus Hebeloma cylindrosporum 

(Jargeat, Gay, Debaud and Marmeisse, pers. comm.; gene accession 

number: AJ 238664), which might represent a cell strategy to make the regulation 

of this important pathway efficient. 

The role of arbuscular mycorrhizal fungi in assisting their host plant in 

nitrate assimilation was studied in the association Glomus intraradices/Zea 

mays by Kaldorf et al. (1998). With PCR technology, part of the gene coding 

for the nitrate reductase apoprotein from either the fungus or from the hostplant 

was specifically amplified and subsequently cloned and sequenced. 

Northern blot analysis with these probes indicated that the mRNA level of the 

maize gene was lower in roots and shoots of mycorrhizal plants than in noncolonized 

controls, whereas the fungal gene was highly transcribed in roots of 

mycorrhizal plants. 

In agreement with these data, the specific nitrate reductase activity of 

leaves was significantly lower in endomycorrhizal maize than in the controls. 

Nitrite formation catalyzed by nitrate reductase was mainly NADPH-dependent 

in roots of mycorrhizal plants, but not in those of the controls, which is 

consistent with the fact that these enzymes of fungi preferentially utilize 

NADPH as reductant. In addition, it has been shown that the fungal nitrate 

reductase mRNA is detected in arbuscules, but not in vesicles by in situ RNA 

hybridization experiments (Kaldorf et al. 1998). There is obviously a differential 

formation of transcripts of a gene coding for the same function in both 

symbiotic partners. 

6 Assimilation of Ammonium 

Once inside the cell, NH 4 + can be incorporated into the key nitrogen donors 

Glu and Gln for biosynthetic reactions. Glutamate dehydrogenase (NADP- 

GDH, EC 1.4.1.4) catalyses the reductive amination of 2-oxoglutarate to form

410 


Glu. Glutamine synthetase (GS, EC 6.3.1.2) incorporates ammonium into the 

carboxyl group of Glu to form Gln. In turn, the Glu and Gln formed serve as 

donors in transamination and amido nitrogen transfer reactions. Glu is an 

essential amino N donor for many transaminases and Gln amide nitrogen is 

used to synthesize many essential metabolites, such as nucleic acids, amino 

sugars, His, Tyr, Asn, and various cofactors. Both Glu and Gln are essential for 

protein synthesis. Glutamate synthase (GOGAT) is responsible for the reductive 

transfer of amide N to a-ketoglutarate for the generation of two molecules 

of glutamate, one of which is recycled for glutamine biosynthesis. The 

net result of the combined action of GS and GOGAT is the synthesis of glutamate 

from ammonium and a-ketoglutarate, frequently referred to as the 

GS/GOGAT cycle. 

6.1 Role and Properties of Glutamate Dehydrogenase 

Most of the ascomycete and basidiomycete fungi possess two glutamate dehydrogenases 

(GDH), each specific for one of the two cofactors. A catabolic role 

has been assigned to the NAD-specific enzyme (EC 1.4.1.2), whereas the 

NADP-specific enzyme (EC 1.4.1.4) has been involved in glutamate biosynthesis 

(Ferguson and Sims 1971). This was confirmed in the ectomycorrhizal 

fungus Laccaria laccata where both enzymes were purified and characterized 

(Brun et al. 1992; Botton and Chalot 1995; Garnier et al. 1997). Both enzymes 

revealed biphasic kinetics with two different Km values for glutamate, the 

NADP-GDH exhibiting a positive cooperativity, and the NAD-GDH a negative 

cooperativity. At all tested concentrations of glutamate, NAD-GDH showed a 

higher affinity for this amino acid than the NADP-specific enzyme. This was 

especially true at low glutamate concentrations where the affinity of NADP- 

GDH was very low (Km value: 100 mM), while the affinity of NAD-GDH was 

maximal (Km value: 0.24 mM). In addition, NADP-GDH was found to have a 

considerably higher affinity for ammonium than the NAD-dependent 

enzyme and was not calcium-dependent for its activity, contrary to what was 

found with the latter enzyme. The native NADP-GDHs purified from Cenococcum 

geophilum (Martin et al. 1983), and Laccaria bicolor (Ahmad and 

Hellebust 1991), revealed properties roughly similar to those of the Laccaria 

laccata NADP-GDH. 

Activities of glutamate dehydrogenase in conjunction with glutamine synthetase 

in the free-living Pezizella ericae, Cenococcum geophilum (Martin et 

al. 1983), and Laccaria laccata (Lorillou et al. 1996), were found to be high and 

sufficient to sustain high rates of nitrogen assimilation. In cultured Cenococcum 

geophilum,NH 4 + is assimilated via the glutamate dehydrogenase pathway 

and the glutamate formed is rapidly used to synthesize glutamine. Ammonium 

ion assimilation leads to the synthesis of large amounts of glutamine, 

alanine and arginine (Martin et al. 1987). These amino acids represent the


bulk of the free amino acids found in mycelia of ectomycorrhizal fungi. It was 

suggested that polyphosphate, an impermeant macromolecule, traps the large 

pool of arginine in the vacuole (Martin 1985), and then reduces the osmotic 

pressure of the basic amino acid. 

The derepression of NADP-GDH specific activity has been observed on 

nitrate, on low ammonium concentrations, or on nitrogen-free media in Laccaria 

bicolor (Ahmad et al. 1990; Lorillou et al. 1996), and in a wide range of 

other fungal species such as Aspergillus nidulans, Neurospora crassa, 

Stropharia semiglobata (Pateman, 1969; Schwartz et al. 1991). The transfer of 

Laccaria bicolor from a NH 4 + -rich medium to either NO3 – or N-free media 

caused a rapid, several fold increase in enzyme concentration detected by 

immunological analysis (Lorillou et al. 1996). These results showed that the 

changes in NADP-GDH activity were not related to the activation of a constitutive 

inactive precursor of the enzyme, but to de novo accumulation of newly 

synthesized GDH. The latter claim was supported by in vivo 35 S-labelling 

experiments which showed that steady-state synthesis of the enzyme 

increased several fold in mycelia grown in the presence of nitrate or in nitrogen-deficient 

media (Lorillou et al. 1996). 

In the ectomycorrhizal basidiomycete Suillus bovinus, cultivated in the 

presence of ammonium, NADH-dependent glutamate dehydrogenase exhibited 

high aminating and low deaminating activities, suggesting that this 

enzyme might also be involved in ammonium assimilation (Grotjohann et al. 

2000). 

NADP-GDH was found to be located in the cytosol as determined by 

immunogold labelling carried out in Cenococcum geophilum (Chalot et al. 

1990) and Laccaria laccata (Brun et al. 1993). 

GDHA, the gene encoding the NADP-GDH has been cloned and characterized 

from various fungi (Table 1), including mycorrhizal fungi. In the 

ectomycorrhizal fungi Laccaria bicolor (Lorillou et al. 1996), and Tuber 

borchii (Vallorani et al. 2002), the increased activity of GDH was correlated 

with its increased synthesis, suggesting that an increased expression of 

mRNA encoding NADP-GDH occurs under derepressing growth conditions. 

Quantification of mRNA using a cDNA probe encoding the Laccaria bicolor 

NADP-GDH confirmed that the growth of mycelia on NO 3 – and N-free 

media, resulted in an increased accumulation of NADP-GDH transcripts 

(Lorillou et al. 1996). However, the two processes were studied independently 

in different ectomycorrhizal models and the data obtained until now give 

only a fragmentary view of ammonium assimilation and its regulation in 

ectomycorrhizal fungi. 

More recently, GDHA has been cloned and characterized from Hebeloma 

cylindrosporum and expression of the enzyme was studied in this fungus 

(Fig. 1; Javelle et al. 2003a). Transfer of the fungus from a 3 mM ammonium to 

a N-free medium resulted in a 12-fold increase in the GDH transcript level 

(Fig. 2), corresponding to a similar increase of enzyme activity. On the con-

412 


Table 1. Relationships among fungal NADP-dependent GDH (E.C.1.4.1.4) and GS 

(E.C.6.3.1.2). Organism, GenBank accession number, sequence length (aa) and molecular 

weight (MW) are indicated. Sequence identity (ID) using H. cylindrosporum GDH or 

GS sequence as a reference (100 %) is indicated. A. bisporus, Agaricus bisporus; A. muscaria, 

Amanita muscaria; A. nidulans, Aspergillus nidulans; B. graminis, Blumeria 

graminis; F. neoformans, Filobasidiella neoformans; G. fujikuroi, Gibberella fujikuroi, G. 

cingulata, Glomerella cingulata; L. bicolor, Laccaria bicolor; N. crassa, Neurospora crassa; 

S. cerevisiae, Saccharomyces cerevisiae; S. pombe, Schizosaccharomyces pombe; S. commune, 

Schizophyllum commune; S. occidentalis, Schwanniomyces occidentalis; T. borchii, 

Tuber borchii 

Organism Accession no. aa MW ID 

NADP-dependent glutamate dehydrogenase 

N. crassa CAD21426 454 48.8 60.9 

A. nidulans S04904 459 49.6 69.2 

T. borchii AAG2878 457 50.1 56.9 

S. pombe T41492 451 48.8 55.6 

S. occidentalis S17907 459 49.8 57.6 

S. cerevisiae (GDH1) A25275 454 49.6 56.4 

S. cerevisiae (GDH3) AAC04972 457 49.6 56.7 

A. bisporus P54387 457 49.6 83.1 

L. bicolor AAA82936 450 48.5 84.9 

H. cylindrosporum 

Glutamine synthetase 

AAL06075 450 48.3 100 

A. bisporus O00088 354 39.5 90.7 

H. cylindrosporum AAK96111 354 39,2 100 

A. muscaria CAD22045 378 41.9 87.0 

S. commune AAF27660 348 38.3 84.2 

F. neoformans CAD10037 358 39.5 72.0 

S. cerevisiae NP015360 370 41.4 68.4 

S. pombe Q09179 359 40.0 63.8 

A. nidulans AAK70354 345 38.5 64.1 

G. cingulata Q12613 360 40.0 64.1 

G. fujikuroi CAC27836 353 39.4 63.4 

B. graminis AAK69535 487 54.1 12.1 

trary, feeding the mycelium with ammonium resulted in a rapid decrease of 

GDH transcripts, which correlated with a decline in GDH-specific activity. 

Addition of methionine sulfoximine (MSX), an inhibitor of the GS enzyme, to 

the ammonium-containing medium led to a depletion of glutamine and an 

accumulation of ammonium in the cells, while a significant decrease of GDH 

transcript occurred simultaneously (Javelle et al. 2003a). This result strongly 

suggests that in Hebeloma cylindrosporum, GDH repression is controlled by 

ammonium and not by glutamine, which is obviously different from what was 

found in Neurospora crassa (Chang and Marzluf 1979; Premakumar et al. 

1979), and very likely in Agaricus bisporus (Kersten et al. 1999), where gluta-


mine or metabolites derived from this amino acid exerted nitrogen catabolite 

repression. 

In Pleurotus ostreatus, NADP-dependent glutamate dehydrogenase and 

glutamate synthase were not detected (Mikes et al. 1994). NAD-GDH was 

derepressed by ammonia and repressed by high concentrations of L-glutamate. 

This suggests that this enzyme obviously plays an active role in ammonium 

assimilation in Pleurotus ostreatus. However, a catabolic role of NAD- 

GDH in the deamination of L-glutamate, due to its very low Km for 

L-glutamate is not excluded (Mikes et al. 1994). 

6.2 Role and Properties of Glutamine Synthetase 

Glutamine synthetase (GS; EC 6.3.1.2) is the key enzyme involved in ammonium 

assimilation in plants (Lea et al. 1990). GS catalyses the ATP-dependent 

condensation of NH 4 + with glutamate to produce glutamine. Plant GS is an 

octameric isozyme with a native molecular mass of approximately 320 or 

380 kDa depending on whether it is localized in the cytosol (GS 1 ) or in plastids/chloroplasts 

(GS 2; Lea et al.1990). 

The in vivo function of GS 2 has been elucidated using genetically modified 

barley plants (Wallsgrove et al. 1987). The main role is assimilation of NH 4 + 

derived from nitrate reduction and photorespiration. The in vivo role of GS 1 

depends on the organ in which it is localized. In roots, GS 1 constitutes nearly 

all GS activity and the main role is assimilation of NH 4 + for translocation and 

biosynthesis (Lea et al. 1990). 

In gymnosperms, except in the nonconiferous gymnosperm Ginkgo, only 

cytosolic isoforms of GS (GS 1) have been identified (Suarez et al. 2002). The 

chloroplastic isoform (GS 2) has not yet been detected by using a number of 

different molecular approaches including separation of isoforms by ionexchange 

chromatography. This implies that in conifers, ammonium is assimilated 

in the cytosol and therefore, glutamine and glutamate biosynthesis 

occurs in separate compartments, the GOGAT enzyme being located within 

chloroplasts. Recent studies indicate the existence of a translocator in the 

chloroplast membranes of Pinus pinaster that may be responsible for the 

import of glutamine into the organelle, in antiport with glutamate (Suarez et 

al. 2002). 

It is generally assumed that GS activity in plants is regulated at the transcriptional 

level, and many reports have focused on this aspect (Lam et al. 

1996; Oliveira et al. 1997). The dramatic light induction of mRNA for GS 2 is 

mediated in part by phytochrome and in part by light-induced changes in 

levels of sucrose (Oliveira and Coruzzi 1999), whereas the transcription of 

GS 1 in roots depends on the external nitrogen supply level ( Finnemann and 

Schjoerring 2000). Recent work suggests that GS 1 is not only regulated transcriptionally, 

but also post-translationally by reversible phosphorylation

414 


catalysed by protein kinases and microcystin-sensitive serine/threonine protein 

phosphatase (Finneman and Schjoerring 2000). The more active form is 

phosphorylated, while the dephosphorylated enzyme is less active and is 

much more susceptible to degradation. Once phosphorylated, GS reaches its 

maximal activity through interaction with 14–3–3 proteins, a large group of 

binding proteins with multiple functions in all eukaryotes (Finneman and 

Schjoerring 2000). Such a post-translational modulation is similar to that 

found with nitrate reductase (Kaiser and Huber 2001). However, the activities 

of NR and GS 1 are oppositely affected by the reversible phosphorylation, 

as dephosphorylation activates NR, but deactivates GS 1. In addition, phosphorylated 

NR is an initial step in NR degradation, whereas phosphorylated 

GS 1 is more protected against degradation than dephosphorylated GS 1 .The 

phosphorylated status of GS 1 changes during light/dark transitions and 

depends in vitro on the ATP/AMP ratio. However, in leaves of Brassica napus, 

the phosphorylation level increased in darkness and decreased in light, suggesting 

that the enzyme plays a role in nitrogen remobilization (Finnemann 

and Schjoerring 2000). 

The enzyme was purified and studied from Douglas fir roots (Bedell et al. 

1995). The native enzyme had a molecular mass of 460 kDa and was composed 

of two different subunits of 54 and 64 kDa. The enzyme exhibited a negative 

cooperativity for ammonium with two Km values which were 11 and 

75 mM in the presence of ammonium concentrations lower and higher than 

1.3 mM, respectively (Bedell et al. 1995). This possibility for the enzyme to 

adjust its affinity to the level of ammonium is obviously a very efficient way to 

assimilate NH 4 + at different concentrations. However, the enzyme was not 

investigated after mycorrhization of the Douglas fir roots. 

In the fungus Pleurotus ostreatus, GS was derepressed by ammonium and 

L-glutamate, while repression of the enzyme was observed in the presence of 

L-glutamine (Mikes et al. 1994). This indicates a strong involvement of the 

enzyme in ammonium assimilation. 

GLNA, the gene encoding GS has been cloned and characterized from various 

fungi (Table 1), including mycorrhizal fungi. Moreover, GS has been purified 

from the ectomycorrhizal fungus Laccaria laccata (Brun et al. 1992). The 

native enzyme had a molecular weight of approximately 380 kDa and was 

composed of eight identical subunits of 42 kDa. The enzyme revealed a high 

affinity for NH 4 + (24 mM), contrasting with the low affinity of NADP-GDH for 

this cation (5 mM) in the same fungus. The GS enzyme also represented about 

3 % of the total soluble protein pool, which was considerably higher than 

NADP-GDH, which represented only 0.15 % (Brun et al. 1992).All these results 

strongly suggest that GS is likely to be the main route of ammonium assimilation 

in this fungus, especially at low NH 4 + concentrations. 

In ectomycorrhizal fungi, localization studies are more limited than in 

higher plants. However, immunogold labelling of GS revealed a uniform distribution 

of the enzyme in the cytosol of Laccaria laccata cultivated in pure


culture (Brun et al. 1993). In the association Douglas fir-Laccaria laccata,the 

fungal GS was uniformly detected over the entire section of the ectomycorrhizas 

where the fungal cells were present and no particular accumulation 

was detected in the mantle, or in the Hartig net fungal cells (Botton and 

Chalot 1995). The similar patterns of GS distribution observed in the free-living 

mycelia and in the ectomycorrhizal tissues suggest that the fungal enzyme 

plays an active role in the primary assimilation of ammonium in ectomycorrhizas. 

The expression level of the GS enzyme was studied by Javelle et al. (2003b) 

in the ectomycorrhizal fungus Hebeloma cylindrosporum, where a single 

mRNA of about 1.2 kb was detected. Transfer of the organism from ammonium-containing 

media to nitrogen-free media resulted in an increase of GS 

transcripts, correlating with an increase of GS activity. However, when the culture 

media were resupplemented with ammonium, up to the concentration of 

10 mM, GS transcripts remained almost unchanged or decreased very slowly, 

indicating that GS in this fungus is not highly regulated, although highly 

expressed (Javelle et al. 2003b; Fig. 2). Such a regulatory process at the transcriptional 

level has also been found in Agaricus bisporus (Kersten et al. 1997), 

while in Saccharomyces cerevisiae, the enzyme seems to be highly regulated at 

the post-transcriptional level (ter Schure et al. 1995). 

6.3 Role and Properties of Glutamate Synthase 

Three classes of glutamate synthases (GOGAT) have been defined, based on 

their amino acid sequences and the nature of the electron donor (Vanoni and 

Curti, 1999). (1) Bacterial NADPH-dependent GOGAT consists of two different 

subunits, the a-subunit of about 150 kDa and the b-subunit of about 

50 kDa; (2) Ferredoxin-dependent GOGAT found in photosynthetic cells 

(higher plants, algae and cyanobacteria) is monomeric and shares considerable 

homology throughout its sequence with the a-subunit of bacterial 

GOGAT; (3) plants (especially nonphotosynthetic cells) and fungi including 

yeasts, as well as lower animals contain a monomeric NAD(P)H-dependent 

GOGAT of about 200 kDa which results from the fusion of two fragments similar 

to the a and b-subunits of bacterial GOGAT. 

In plants, both enzymes (NADH-GOGAT: EC 1.4.1.14. and ferredoxin (Fd)- 

GOGAT: EC 1.4.7.1) display different physico-chemical, immunological and 

regulatory properties and are encoded by separate genes (Ireland and Lea 

1999). Fd-GOGAT is an iron-sulphur monomeric flavoprotein, plastid-located 

and represents the predominant molecular form in photosynthetic tissues 

although its presence has also been reported in roots and nodules (Temple et 

al. 1998). In most plants analysed, Fd-GOGAT is encoded by a single gene, 

however, in Arabidopsis, two genes have been characterized (Coschigano et al. 

1998). GLU1 is exclusively expressed in the leaf and is light-regulated, whereas

416 


GLU2 is expressed in leaves and roots and is not regulated by light. The 

expression pattern of the genes and the physiological characterization of 

defective mutants support a role of GS 2 and Fd-GOGAT in the assimilation of 

ammonium derived from the reduction of nitrate and from photorespiration 

(Coschigano et al. 1998). NADH-GOGAT, also an iron-sulphur monomeric 

flavoprotein, is present at a low level in leaves, but is more abundant in nonphotosynthetic 

tissues such as roots and nodules, where it is located in 

nonchlorophyllous plastids (Temple et al. 1998). The structure of the alfalfa 

gene encoding NADH-GOGAT has been reported by these authors, and its 

expression is restricted to root nodules where it plays a significant role in the 

assimilation of ammonium derived from symbiotic N 2 fixation (Trepp et al. 

1999). The localization of GS 1 and NADH-GOGAT proteins in the root vascular 

bundles of rice, and very likely in many other plants, supports the possibility 

of a co-ordinated function in the assimilation of ammonium in roots 

(Ishiyama et al. 1998). 

In fungi, NADH-GOGAT was purified and studied in Neurospora crassa 

where the enzyme was found as a single polypeptide of 200 kDa (Hummelt 

and Mora 1980) and in Saccharomyces cerevisiae where the enzyme is 

trimeric, composed of three identical 199-kDa subunits (Cogoni et al. 1995). 

In ectomycorrhizal fungi, very little is known about this enzyme. An 

NADH-dependent GOGAT was, however, detected in Laccaria bicolor by Vézina 

et al. (1989). In Pisolithus tinctorius, the kinetics of 15 N labelling and the 

effects of enzyme inhibitors have given evidence that ammonium assimilation 

occurs through the GS/GOGAT cycle (Kershaw and Stewart 1992). In 

agreement with these data, Botton and Dell (1994) failed to detect NADP- 

GDH in this fungus. In Scleroderma verrucosum, glutamine synthetase and 

NAD-glutamate synthase activities were clearly detected, while NADP-GDH 

was almost undetectable (Prima Putra et al. 1999). This is consistent with the 

view that ammonium assimilation occurs through the GS/GOGAT cycle in 

this fungus. In Cenococcum geophilum, a number of results based on the use 

of enzyme-specific inhibitors, enzyme assays and estimation of the amino 

acid pools are also consistent with the operation of the GS/GOGAT cycle (A. 

Khalid and B. Botton, unpublished results). 

The results obtained by Chalot et al. (1994a) with Paxillus involutus, also 

emphasize a GS/GOGAT cycle in this fungus. Indeed, feeding the fungus with 

[ 14 C]-glutamine resulted in a significant labelling of glutamate, while addition 

of azaserine, an inhibitor of the GOGAT enzyme, led to both an accumulation 

of 14 C-glutamine and a reduced pool of labelled glutamate. Interestingly, in 

these experiments, 14 C-aspartate and 14 C-alanine did not accumulate under 

azaserine treatment where 14 C-glutamine degradation was inhibited, thus 

indicating that aspartate and alanine synthesis depends on the carbon skeletons 

from glutamine (Chalot et al.1994a). In addition, feeding Paxillus involutus 

with 14 C-glutamate resulted in a significant accumulation of 14 C-glutamine 

under azaserine treatment, suggesting that the supplied glutamate is used for


glutamine synthesis. These results are consistent with the existence of two 

pools of glutamate in the fungal cells, as previously demonstrated by 

[ 15 N]amino acid analysis in Cenococcum geophilum (Martin et al. 1988). It was 

thus suggested that newly absorbed glutamate, as well as glutamate synthetized 

by NADP-GDH are converted to glutamine, whereas glutamate produced 

by the GOGAT enzyme is utilized by the aminotransferases (Martin et 

al. 1988; Botton and Chalot 1995). 

The glutamine synthetase–glutamate synthase pathway was shown to be 

the main assimilatory route in beech ectomycorrhizas and glutamate dehydrogenase 

plays only a minor role, if any, in these tissues (Martin et al. 1986). 

Glutamine synthetase and glutamate synthase which share immunological 

similarities with higher plant enzymes were detected in beech ectomycorrhizas 

by means of Western immunoblotting, whereas a fungal glutamate 

dehydrogenase could not be detected (Martin, unpubl. results). The absorption 

of NH 4 + is associated with glutamine synthesis in beech ectomycorrhizas 

so that 60–80 % of the nitrogen absorbed is present as this amide after a few 

hours of absorption (Martin et al. 1986). In addition, there is a rapid and very 

high 15 N-labelling in alanine over the time course of the experiment performed 

with beech (Martin et al. 1986). These data, together with the measurement 

of high alanine aminotransferase activity in ectomycorrhizal fungi 

(Dell et al. 1989), suggest that glutamine and alanine might be the major forms 

of combined nitrogen exported to the root cells. 

7 Amino Acid Metabolism 

7.1 Utilization of Proteins by Ectomycorrhizal Fungi and 

Ectomycorrhizas 

As investigated primarily by Lundeberg (1970), it is generally accepted that 

most ectomycorrhizal fungal strains are unable to metabolize and use humusbound 

nitrogen. Several ectomycorrhizal and ericaceous fungi in pure culture 

are, however, able to grow in nutrient media containing proteins as the sole 

nitrogen source (Bajwa et al. 1985; Abuzinadah and Read 1986a), and this correlated 

with the production of exocellular proteinase activities (Botton and 

Chalot 1991; Leake and Read 1991). In the presence of exogenous proteins 

(casein, gelatin, albumin, soil proteins), Cenococcum geophilum was able to 

secrete active proteases into the nutrient medium, and ammonia strongly 

repressed the induction and secretion of these proteases (El-Badaoui and Botton 

1989). This capacity of the mycorrhizal fungus to use amino acids as 

nitrogen sources is retained in the symbiotic state. Melin and Nilsson (1953) 

have shown that 15 N from [ 15 N]glutamate is transferred to Pinus sylvestris 

roots and aerial parts through the mycelia of Suillus granulatus. The ability of 

several ectomycorrhizal fungi to assimilate proteins and to transfer its nitro-

418 


gen to plants of Pinus contorta was also clearly demonstrated (Abuzinadah 

and Read 1986a, b; Abuzinadah et al.1986). The use of nitrogen sources not 

available to nonmycorrhizal plants contributes, therefore, to an increased 

uptake of nitrogen by infected roots. 

7.2 Amino Acids Used as Nitrogen and Carbon Sources 

Utilization of amino acids by ectomycorrhizal symbionts and ectomycorrhizas 

may have important implications, not only for their nitrogen metabolism, 

but also for the overall carbon economy of the plant. Axenic mycelia of 

the ectomycorrhizal basidiomycete Suillus bovinus have been grown in liquid 

media in the presence of glucose as the only carbohydrate source and under 

such conditions, they produced similar amounts of dry weight with ammonia, 

with nitrate or with alanine, 60–80 % more with glutamate or glutamine, but 

about 35 % less with urea as the only exogenous nitrogen source (Grotjohann 

et al. 2000). 

Recently, the fate of carbon derived from alanine, glutamate and glutamine 

was investigated in the ectomycorrhizal fungus Paxillus involutus (Chalot et 

al. 1994a, b). The result of the 14 C tracer experiments suggested that the carbon 

skeletons derived from newly absorbed glutamate were mainly used for 

the synthesis of glutamine. The accumulation of [ 14 C]glutamate and the 

marked decrease of [ 14 C]glutamine under MSX treatment were consistent 

with a rapid utilization of glutamate by the glutamine synthetase (GS) 

enzyme. The newly absorbed, as well as the newly synthesized [ 14 C]glutamine 

were degraded into [ 14 C]glutamate, suggesting the operation of the glutamate 

synthase (GOGAT) enzyme. This was confirmed by the striking accumulation 

of [ 14 C]glutamine when the fungus was cultivated in the presence of azaserine, 

an inhibitor of GOGAT. In addition, a strong inhibition of glutamine utilization 

by aminooxyacetate indicated that glutamine catabolism in Paxillus 

involutus might involve a transamination process as an alternative pathway to 

GOGAT for glutamine degradation (Chalot et al. 1994a). 

The use of 14 C-labelled amino acids also showed a direct involvement of 

glutamate and glutamine in the respiration pathways, these amino acids being 

obviously channelled through the tricarboxylic acid (TCA) cycle and oxidized 

to CO 2. Feeding the fungus with [ 14 C]alanine resulted in a rapid labelling of 

pyruvate, citrate, succinate, fumarate and CO 2. Further labelling was detected 

in glutamate, glutamine and aspartate. The presence of aminooxyacetate completely 

suppressed 14 CO 2 evolution and decreased the flow of carbon to the 

Krebs cycle intermediates and amino acids, suggesting that alanine aminotransferase 

plays a key role in metabolizing alanine in Paxillus involutus 

(Chalot et al. 1994b). 

It has been shown by measuring enzyme capacities and metabolite pools 

that mycorrhization causes a re-arrangement of the main metabolic pathways


in the very early stages following contact between the two partners (Blaudez 

et al. 1998), which correlates with the observed structural changes (Brun et al. 

1995). The impact of inoculation with Paxillus involutus on the utilization of 

organic carbon compounds by birch roots was studied by feeding [ 14 C]glutamate 

or [ 14 C]malate to the partners of the symbiosis, separately or in association, 

and by monitoring the subsequent distribution of 14 C (Blaudez et al. 

2001). Inoculation increased [ 14 C]glutamate and [ 14 C]malate absorption 

capacities by up to 8 and 17 times, respectively. This heterotrophic carbon 

assimilation by mycorrhizal birch has been estimated using 14 C-labelled proteins 

(Abuzinadah and Read 1989). The authors calculated that 9 % of plant C 

may be derived from proteins. Moreover, our results demonstrated that inoculation 

strongly modified the fate of [ 14 C]glutamate and [ 14 C]malate. It was 

demonstrated that exogenously supplied glutamate and malate might serve as 

C skeletons for amino acid synthesis in mycorrhizal birch roots and in the 

free-living fungus. Glutamine was the major 14 C-sink in mycorrhizal roots 

and in the free-living P. involutus (Blaudez et al. 2001). In contrast, citrulline 

and insoluble compounds were the major 14 C sinks in nonmycorrhizal roots, 

whatever the 14 C source. Thus, it is obvious that mycorrhiza formation leads to 

a profound alteration of the metabolic fate of exogenously supplied C compounds. 

Translocation through the hyphal network and further transfer of nutrients 

from fungus to host root has also been discussed in detail (Smith and 

Read 1997), but the intimate anatomical connections between fungal and root 

cells presents considerable technical difficulties for unambiguous experimental 

investigations of nutrient transfer between fungus and host. 

8 Conclusion and Future Prospects 

After many decades of investigating the anatomical, physiological and biochemical 

features of ectomycorrhizas, recent years have brought new insights 

at the molecular level. Considerable knowledge has been gained over the last 

10 years on the molecular characteristics and molecular regulation of the 

transporters and the nitrogen-assimilating enzymes in higher plants and 

fungi, as well as in ectomycorrhizas. This research has greatly contributed to 

our understanding of how organic and inorganic nitrogen is taken up by the 

cells and assimilated in the organisms. However, the available information is 

still limited and efforts should be made to increase basic research on nitrogen 

metabolism and to integrate new advances in biotechnology. 

A current focus in plant improvement is the modification of the expression 

of genes involved in metabolism. Recent studies have shown that important 

characteristics can be introduced in transgenic herbaceous plants by the 

expression of heterologous GS isoenzymes. Thus, a higher capacity for photorespiration 

(Migge et al. 2000), and increase in tolerance to salt stress

420 


(Hoshida et al. 2000), have been reported using engineered plants which overexpress 

chloroplastic GS 2 . Furthermore, an increase in growth has been 

observed in leguminous plants, which overexpress cytosolic GS 1 (Limami et 

al. 1999). The modification of N assimilation efficiency has recently been 

approached in trees by the overexpression of pine GS 1 in a hybrid poplar (Gallardo 

et al. 1999). Poplar is considered as a model in molecular investigations 

because of its small genome size, easy vegetative propagation and the possibility 

of in vitro culture, and its amenability to transformation via Agrobacterium 

tumefaciens (Gallardo et al. 1999). 

Considerable knowledge has been gained over the last decade on the molecular 

characteristics and molecular regulation of N-assimilating enzymes in 

woody plants, including angiosperm and gymnosperm species. This research 

has greatly contributed to our understanding of how inorganic N is assimilated 

and utilized in trees. However, the available information is still limited 

and efforts should be made to increase basic research on N metabolism and to 

integrate new advances in biotechnology to improve growth and development 

of economically important woody species. Although all new studies will contribute 

to this goal, the concentration of efforts in model trees, such as poplar 

for angiosperms and pine for gymnosperms, is advisable. In future years, the 

availability of new molecular tools for biological studies of trees will permit 

characterization of new genes involved in N metabolism and determination 

of their specific physiological roles. Functional studies are now possible in 

woody plants because routine transformation protocols via Agrobacterium 

are available for poplar and rapid progress has been reported in the last few 

years for conifers. The use of somatic embryogenic cell lines is critical for the 

generation of transgenic trees. For example, genomic technologies have 

recently been used to study the effect of a variety of N regimes on plant 

metabolism (Wang et al. 2000). Results from this study indicate that changes 

in N supply influence not only expression of genes involved in N assimilation, 

but also those involved in other metabolic pathways. Similar studies of gene 

expression at the organ or tissue levels are now feasible in tree models with 

the existence of EST databases from poplar. 

Another promising line of research will be to study at the molecular level, 

the genetic basis of important traits, such as N use efficiency and growth efficiency 

in the presence of the mycorrhizal fungus. Genetic maps for poplar 

and pine have been established and now genes involved in N metabolism can 

be localized in the genome. The possible association of specific genes with 

quantitative trait loci (QTL) are currently being investigated in a number of 

laboratories. This will allow molecular characterization of gene clusters 

involved in traits of interest in forestry and tree management. 

Transformation of ectomycorrhizal fungi is more limited. Indeed, the 

assignment of functions to genes and their products has been limited to 

deduction based on sequence homologies, subcellular localization studies 

and expression in heterologous hosts, since transformation techniques for the


vast majority of ectomycorrhizal basidiomycetes have not been readily available. 

Exceptions are Laccaria laccata (Barret et al. 1990), and Hebeloma cylindrosporum 

(Marmeisse et al. 1992), which have been transformed by the protoplast 

method, and Paxillus involutus (Bills et al. 1995), and Laccaria bicolor 

(Bills et al. 1999), which have been transformed by particle bombardment. 

Since the first report on successful genetic transfer from Agrobacterium tumefaciens 

to the yeast Saccharomyces cerevisiae (Bundock et al. 1995), a number 

of ascomycetous filamentous fungi were also shown to be amenable to this 

transformation system (Abuodeh et al. 2000; Chen et al. 2000). 

Our understanding of metabolite regulation of gene expression supports 

the notion that ammonium and N-assimilation products such as amino acids 

might act as signals whose levels are sensed as an indicator for a high internal 

N status. Along these lines, putative sensors of glutamate in plants, glutamate 

receptor genes, have been identified in Arabidopsis (Lam et al. 1998). The 

emerging tools of genomics and bioinformatics should allow us, in the near 

future, to identify the interacting pathways that control gene expression in 

response to mycorrhization. 


Abuodeh RO, Orbach MJ, Mandel MA, Das A, Galgiani JN (2000) Genetic transformation 

of Coccidioides immitis facilitated by Agrobacterium tumefaciens. J Infect Dis 

181:2106–2110 

Abuzinadah RA, Read DJ (1986a) The role of proteins in the nitrogen nutrition of ectomycorrhizal 

plants. I. Utilization of peptides and proteins by ectomycorrhizal fungi. 

New Phytol 103:481–493 

Abuzinadah RA, Read DJ (1986b) The role of proteins in the nitrogen nutrition of ectomycorrhizal 

plants. III. Protein utilization by Betula pendula and Pinus mycorrhizal 

association with Hebeloma cylindrosporum. New Phytol 103:506–514 

Abuzinadah RA, Read DJ (1988) Amino acids as nitrogen sources for ectomycorrhizal 

fungi: utilization of individual amino acids. Trans Br Mycol Soc 91:473–479 

Abuzinadah RA, Read DJ (1989) Carbon transfer associated with assimilation of organic 

nitrogen sources by silver birch (Betula pendula Roth.). Trees 3:17–23 

Abuzinadah RA, Finlay RD, Read DJ (1986) The role of proteins in the nitrogen nutrition 

of ectomycorrhizal plants. II. Utilization of proteins by mycorrhizal plants of Pinus 

contorta. New Phytol 103:495–506 

Ahmad I, Hellebust JA (1991) Enzymology of nitrogen assimilation in mycorrhiza. In: 

Norris JR, Read DJ,Varma AK (eds) Methods in microbiology no 23, Academic Press, 


Ahmad I, Carleton TJ, Malloch DW, Hellebust JA (1990) Nitrogen metabolism in the 

ectomycorrhizal fungus Laccaria bicolor (R. Mre) Orton. New Phytol 116:431–441 

Anderson IC, Chambers SM, Cairney JWG (1999) Intra- and interspecific variation in 

patterns of organic and inorganic nitrogen utilisation by three Australian Pisolithus 

species. Mycol Res 103:1579–1587 

Aouadj R, Es-Sgaouri A, Botton B (2000) Etude de la stabilité et de quelques propriétés de 

la nitrate réductase du champignon ectomycorrhizien Pisolithus tinctorius.Cryptog 

Mycol 21:187–202

422 


Bajwa R, Abuarghub S, Read DJ (1985) The biology of mycorrhiza in the Ericaceae. X. 

The utilization of proteins and the production of proteolytic enzymes by the mycorrhizal 

endophyte and by mycorrhizal plants. New Phytol 101:469–486 

Barret V, Dixon RK, Lemke PA (1990) Genetic transformation of a mycorrhizal fungus. 

Appl Microbiol Biotechnol 33:313–316 

Bedell J-P, Chalot M, Brun A, Botton B (1995) Purification and properties of glutamine 

synthetase from Douglas-fir roots. Physiol Plant 94:597–604 

Bending GD, Read DJ (1995) The structure and function of the vegetative mycelium of 

ectomycorrhizal plants. V. Foraging behaviour and translocation of nutrients from 

exploited litter. New Phytol 130:401–409 

Bills SN, Richter DL, Podila GK (1995) Genetic transformation of the ectomycorrhizal 

fungus Paxillus involutus by particle bombardment. Mycol Res 99:557–561 

Bills SN, Podila GK, Hiremath ST (1999) Genetic engineering of the ectomycorrhizal fungus 

Laccaria bicolor for use as a biological control agent. Mycologia 91:237–242 

Blatt MR, Maurousset L, Meharg A (1997) High-affinity NO 3 – H + co-transport in the fungus 

Neurospora: induction and control by pH and membrane voltage. J Membr Biol 

160:59–76 

Blaudez D, Chalot M, Dizengremel P, Botton B (1998) Structure and function of the ectomycorrhizal 

association between Paxillus involutus and Betula pendula. II. Metabolic 

changes during mycorrhiza formation. New Phytol 138:543–552 

Blaudez D, Botton B, Dizengremel P, Chalot M (2001) The fate of [ 14 C]glutamate and 

[ 14 C]malate in birch roots is strongly modified under inoculation with Paxillus involutus. 

Plant Cell Environ 24:449–457 

Botton B, Chalot M (1991) Techniques for the studies of nitrogen metabolism in ectomycorrhiza. 

In: Norris JR, Read DJ,Varma AK (eds) Methods in microbiology no 23,Academic 


Botton B, Dell B (1994) Expression of glutamate dehydrogenase and aspartate aminotransferase 

in Eucalypt ectomycorrhizas. New Phytol 126:249–257 

Botton B, Chalot M (1995) Nitrogen assimilation: enzymology in ectomycorrhizas. In: 

Varma AK, Hock B (eds) Mycorrhiza, structure, function, molecular biology and biotechnology. 


Brandes B, Godbold DL, Kuhn AJ, Jentschke G (1998) Nitrogen and phosphorus acquisition 

by the mycelium of the ectomycorrhizal fungus Paxillus involutus and its effect 

on host nutrition. New Phytol 140:735–743 

Brun A, Chalot M, Botton B, Martin F (1992) Purification and characterization of glutamine 

synthetase and NADP-glutamate dehydrogenase from the ectomycorrhizal fungus 

Laccaria laccata. Plant Physiol 99:938–944 

Brun A, Chalot M, Botton B (1993) Glutamate dehydrogenase and glutamine synthetase 

of the ectomycorrhizal fungus Laccaria laccata: occurrence and immunogold localization 

in the free living mycelium. Life Sci Adv Plant Physiol 12:53–60 

Brun A, Chalot M, Finlay RD, Söderström B (1995) Structure and function of the ectomycorrhizal 

association between Paxillus involutus (Batsch) Fr. and Betula pendula 

(Roth.). I. Dynamics of mycorrhiza formation. New Phytol 129:487–493 

Bundock P, den Dulk-Ras A, Beijersbergen A, Hoykaas PJJ (1995) Trans-kingdom T-DNA 

transfer from Agrobacterium tumefasciens to Saccharomyces cerevisiae. EMBO J 

14:3206–3214 

Burgstaller W (1997) Transport of small ions and molecules through the plasma membrane 

of filamentous fungi. Crit Rev Microbiol 23:1–46 

Caddick MX, Peters D, Platt A (1994) Nitrogen regulation in fungi.Antonie van Leeuwenhoek 

65:169–177 

Carleton TJ, Read DJ (1991) Ectomycorrhizas and nutrient transfer in conifer-feather 

moss ecosystems. Can J Bot 69:778–785


Chalot M, Brun A (1998) Physiology of organic nitrogen acquisition by ectomycorrhizal 

fungi and ectomycorrhizas. FEMS Microbiol Rev 22:21–44 

Chalot M, Brun A, Botton B (1990) Occurrence and distribution of the fungal NADPdependent 

glutamate dehydrogenase in spruce and beech ectomycorrhizas. In: 

Werner D, Müller P (eds) Fast growing trees and nitrogen fixing trees. Gustav Fischer 

Verlag, Jena, Germany, pp 324–327 

Chalot M, Stewart GR, Brun A, Martin F, Botton B (1991) Ammonium assimilation by 

spruce-Hebeloma sp. ectomycorrhizas. New Phytol 119:541–550 

Chalot M, Brun A, Finlay RD, Söderström B (1994a) Metabolism of [ 14 C]glutamate and 

[ 14 C]glutamine by the ectomycorrhizal fungus Paxillus involutus. Microbiology 

140:1641–1649 

Chalot M, Brun A, Finlay RD, Söderström B (1994b) Respiration of [ 14 C]alanine by the 

ectomycorrhizal fungus Paxillus involutus. FEMS Microbiol Lett 121:87–92 

Chalot M, Brun A, Botton B, Söderström B (1996) Kinetics, energetics and specificity of 

the general amino acid transporter from the ectomycorrhizal fungus Paxillus involutus. 

Microbiology 142:1749–1756 

Chalot M, Javelle A, Blaudez D, Lambilliote R, Cooke R, Sentenac H, Wipf D, Botton B 

(2002) An update on nutrient transport processes in ectomycorrhizas. Plant Soil 

244:165–175 

Chang L, Marzluf GA (1979) Nitrogen regulation of uricase synthesis in Neurospora 

crassa. Mol Gen Genet 176:385–392 

Chen X, Stone M, Schlagnhaufer C, Romaine CP (2000) A fruiting body tissue method for 

efficient Agrobacterium-mediated transformation of Agaricus bisporus.Appl Environ 

Microbiol 66:4510–4513 

Cogoni C, Valenzuela L, Gonzales-Halphen D, Oliveira H, Macino G, Ballario P, Gonzalez 

A (1995) Saccharomyces cerevisiae has a single glutamate synthase gene coding for a 

plant-like high-molecular-weight polypeptide. J Bacteriol 177:792–798 

Coschigano KT, Melo-Oliveira R, Lim J (1998) Arabidopsis glts mutants and distinct Fdx- 

GOGAT genes: implications for photorespiration and primary nitrogen assimilation. 

Plant Cell 10:741–752 

Crawford NM, Glass AD (1998) Molecular and physiological aspects of nitrate uptake in 

plants. Trends Plant Sci 3:389–395 

Dell B, Botton B, Martin F, Le Tacon F (1989) Glutamate dehydrogenases in ectomycorrhizas 

of spruce (Picea excelsa L.) and beech (Fagus sylvatica L.). New Phytol 111: 

683–692 

Dubois E, Grenson M (1979) Methylamine ammonia uptake systems in Saccharomyces 

cerevisiae. Multiplicity and regulation. Mol Gen Genet 175:67–76 

El-Badaoui K, Botton B. 1989. Production and characterization of exocellular proteases 

in ectomycorrhizal fungi. Ann Sci For 46:728–730 

Fergusson AR, Sims AP (1971) Inactivation in vivo of glutamine synthetase and NADspecific 

glutamate dehydrogenase: its role in the regulation of glutamine synthesis in 

yeasts. J Gen Microbiol 69:423–427 

Finlay RD, Ek H, Odham G, Söderström B (1988) Mycelial uptake, translocation and 

assimilation of nitrogen from 15 N-labelled ammonium by Pinus sylvestris plants 

infected with four different ectomycorrhizal fungi. New Phytol 110:59–66 

Finnemann J, Schjoerring JK (2000) Post-translational regulation of cytosolic glutamine 

synthetase by reversible phosphorylation and 14–3–3 protein interaction. Plant J 

24:171–177 

Forde B (2000) Nitrate transporters in plants: structure, function and regulation. 

Biochim Biophys Acta 1465:219–235 

Gallardo F, Fu J, Cantón FR, García-Gutiérrez A, Cánovas FM, Kirby EG (1999) Expression 

of a conifer glutamine synthetase gene in transgenic poplar. Planta 210:19–26

424 


Garnier A, Berredjem A, Botton B (1997) Purification and characterization of the NADdependent 

glutamate dehydrogenase in the ectomycorrhizal fungus Laccaria bicolor 

(Maire) Orton. Fungal Genet Biol 22:168–176 

Garrett RH, Nason A (1969) Further purification and properties of Neurospora nitrate 

reductase. J Biol Chem 244:2870–2882 

Gazzarrini S, Lejay L, Gojon A, Ninnemann O, Frommer WB, von Wiren N (1999) Three 

functional transporters for constitutive, diurnally regulated, and starvation-induced 

uptake of ammonium into Arabidopsis roots. Plant Cell 11:937–947 

Gobert A, Plassard C (2002) Differential NO 3 – dependent patterns of NO3 – uptake in 

Pinus pinaster, Rhizopogon roseolus and their ectomycorrhizal association. New Phytol 

154:509–516 

Grotjohann N, Kowallik W, Huang Y, Schulte in den Baumen A (2000) Investigations into 

enzymes of nitrogen metabolism of the ectomycorrhizal basidiomycete, Suillus bovinus. 

Z Naturforsch C, 55:203–212 

Guan C, Ribeiro A, Akkermans ADL, Jing Y, van Kammen A, Bisseling T, Pawlowski K 

(1996) Nitrogen metabolism in actinorhizal nodules of Alnus glutinosa: expression of 

glutamine synthetase and acetylornithine transaminase. Plant Mol Biol 32:1177–1184 

Hackette SL, Skye GE, Burton C, Segel IH (1970) Characterization of an ammonium 

transport system in filamentous fungi with methylammonium- 14 C as the substrate. J 

Biol Chem 245:4241–4250 

Harley JL (1989) The significance of mycorrhizas. Mycol Res 92:129–139 

Hildebrandt U, Schmelzer E, Bothe H (2002) Expression of nitrate transporter genes in 

tomato colonized by an arbuscular mycorrhizal fungus. Physiol Plant 115:125–136 

Ho I, Trappe JM (1987) Enzymes and growth substances of Rhizopogon species in relation 

to mycorrhizal host and infrageneric taxonomy. Mycologia 79:553–558 

Hoshida H, Tanaka Y, Hibino T, Hayashi Y, Tanaka A, Takabe T, Takabe T (2000) Enhanced 

tolerance to salt stress in transgenic rice that overexpresses chloroplast glutamine 

synthetase. Plant Mol Biol 43:103–111 

Howitt SM, Udvardi MK (2000) Structure, function and regulation of ammonium transporters 

in plants. Biochim Biophys Acta 1465:152–170 

Hummelt G, Mora J (1980) Regulation and function of glutamate synthase. Biochem Biophys 

Res Commun 96:1688–1694 

Ireland RJ, Lea PJ (1999) The enzymes of glutamine, glutamate, asparagine, and aspartate 

metabolism. In: Singh BK (ed) Plant amino acids, biochemistry and biotechnology. 


Ishiyama K, Hayakawa T, Yamaya T (1998) Expression of NADH-dependent glutamate 

synthase protein in the epidermis and exodermis of rice root in response to the supply 

of ammonium ions. Planta 204:288–294 

Jargeat P (1999) Caractérisation et manipulation génétique de la voie d’assimilation du 

nitrate du champignon symbiotique Hebeloma cylindrosporum. PhD Thesis, University 

Claude-Bernard, Lyon I, Lyon 

Jargeat P, Gay G, Debaud JC, Marmeisse R (2000) Transcription of a nitrate reductase 

gene isolated from the symbiotic basidiomycete fungus Hebeloma cylindrosporum 

does not require induction by nitrate. Mol Gen Genet 263:948–956 

Jargeat P, Rekangalt D, Verner MC, Gay G, Debaud JC, Marmeisse R, Fraissinet-Tacher L 

(2003) Characterisation and expression analysis of a nitrate transporter and nitrite 

reductase genes, two members of a gene cluster for nitrate assimilation from the symbiotic 

basidiomycete Hebeloma cylindrosporum. Curr Genet 43:199–205 

Javelle A, Chalot M, Söderström B, Botton B (1999) Ammonium and methylamine transport 

by the ectomycorrhizal fungus Paxillus involutus and ectomycorrhizas. FEMS 

Microbiol Ecol 30:355–366


Javelle A, Rodriguez-Pastrana BR, Jacob C, Botton B, Brun A,André B, Marini AM, Chalot 

M (2001) Molecular characterization of two ammonium transporters from the ectomycorrhizal 

fungus Hebeloma cylindrosporum. FEBS Lett 505:393–398 

Javelle A, André B, Marini A, Chalot M (2003a) High affinity ammonium transporters 

and nitrogen sensing in mycorrhizas. Trends Microbiol 11:53–55 

Javelle A, Morel M, Rodriguez-Pastrana BR, Botton B, André B, Marini AM, Brun A, 

Chalot M (2003b) Molecular characterization, function and regulation of ammonium 

transporters (Amt) and ammonium-metabolizing enzymes (GS, NADP-GDH) in the 

ectomycorrhizal fungus Hebeloma cylindrosporum. Mol Microbiol 47:411–430 

Jentschke G, Brandes B, Kuhn AJ, Schröder WH, Godbold DL (2001) Interdependence of 

phosphorus, nitrogen, potassium and magnesium translocation by the ectomycorrhizal 

fungus Paxillus involutus. New Phytol 149:327–338 

Johnstone IL, McCabe PC, Greaves P, Gurr SJ, Cole GE, Brow MAD, Unkles SE, Clutterbuck 

AJ, Kinghorn JR, Innis MA (1990) Isolation and characterisation of the crnAniiA-niaD 

gene cluster for nitrate assimilation in Aspergillus nidulans. Gene 

90:181–192 

Jongbloed RH, Clement JMAM, Borst-Pauwels GWFH (1991) Kinetics of NH 4 + and K + 

uptake by ectomycorrhizal fungi. Effect of NH 4 + on K + uptake. Physiol Plant 83:427– 

432 

Kaiser WM, Huber SC (2001) Post-translational regulation of nitrate reductase: mechanism, 

physiological relevance and environmental triggers. J Exp Bot 363:1981–1989 

Kaldorf M, Schmelzer E, Bothe H (1998) Expression of maize and fungal nitrate reductase 

genes in arbuscular mycorrhiza. Mol Plant Microbe Interact 11:439–448 

Kershaw JC, Stewart GR (1992) Metabolism of 15 N-labelled ammonium by the ectomycorrhizal 

fungus Pisolithus tinctorius (Pers), Coker & Couch. Mycorrhiza 1:71–77 

Kersten MA, Muller Y, Op den Camp HJ,Vogels GD,Van Griensven LJ,Visser J, Schaap PJ 

(1997) Molecular characterization of the glnA gene encoding glutamine synthetase 

from the edible mushroom Agaricus bisporus. Biochim Biophys Acta 1428:260–272 

Kersten MA, Arninkhof MJ, Op den Camp HJ, Van Griensven LJ, van der Drift C (1999) 

Transport of amino acids and ammonium in mycelium of Agaricus bisporus. Biochim 

Biophys Acta 1428:260–272 

Kinghorn JR, Unkles SE (1994) Inorganic nitrogen assimilation: molecular aspects. In: 

Martinelli SD, Kinghorn JR (eds) Aspergillus: 50 years on. Elsevier, Amsterdam, pp 

181–194 

Kreuzwiezer J, Stulen I, Wiersema P,Vaalburg W, Rennenberg H (2000) Nitrate transport 

in Fagus-Laccaria mycorrhiza. Plant Soil 220:107–117 

Kronzucker HJ, Siddiqi MY, Glass ADM (1996) Kinetics of NH4 + uptake in spruce. Plant 

Physiol 110:773–779 

Lam HM, Coschigano KT, Oliveira IC, Melo-Oliveira R, Coruzzi GM (1996) The molecular-genetics 

of nitrogen assimilation into amino acids in higher plants.Ann Rev Plant 

Physiol Plant Mol Biol 47:569–593 

Lam HM, Chiu J, Hsieh M, Meisel L, Oliveira I, Shin M, Coruzzi GM (1998) Glutamatereceptor 

genes in plants. Nature 396:125–126 

Landeweert R, Hoffland E, Finlay RD, Kuyper TW, van Breemen N (2001) Linking plants 

to rocks: ectomycorrhizal fungi mobilize nutrients from minerals. Trends Ecol Evol 

16:248–254 

Lea PJ, Blackwell RD, Chen FL, Hecht U (1990) Enzymes of nitrogen assimilation. In: Dey 

PM, Harborne JB (eds) Methods in plant biochemistry().Academic Press, London, pp 

257–276 

Leake JR, Read D (1991) Proteinase activity in mycorrhizal fungi. III. Effects of protein, 

protein hydrolysate, glucose and ammonium on production of extracellular proteinase 

by Hymenoscyphus ericae Read Korf and Kernan. New Phytol 117:309–318

426 


Limami A, Phillipson B, Ameziane R, Pernollet N, Jiang Q, Roy R, Deleens E, Chaumont- 

Bonnet M, Gresshoff PM, Hirel B (1999) Does root glutamine synthetase control plant 

biomass production in Lotus japonicus L.? Planta 209:495–502 

Lorillou S, Botton B, Martin F (1996) Nitrogen source regulates the biosynthesis of 

NADP-glutamate dehydrogenase in the ectomycorrhizal basidiomycete Laccaria 

bicolor. New Phytol 132:289–296 

Lundeberg G (1970) Utilization of various nitrogen sources, in particular bound soil 

nitrogen, by mycorrhizal fungi. Studia Forestalia Suecica 79:1–95 

Machin F, Perdomo G, Pérez MD, Brito N, Siverio JM (2000) Evidence for multiple nitrate 

uptake systems in Hansenula polymorpha. FEMS Microbiol Lett 194:171–174 

Marini AM, Vissers S, Urrestarazu A, André B (1994) Cloning and expression of the 

MEP1 gene encoding a transporter of ammonium in Saccharomyces cerevisiae. 

EMBO J 13:3456–3463 

Marini AM, Soussi-Boudekou S,Vissers S, André B (1997) A family of ammonium transporters 

in Saccharomyces cerevisiae. Mol Cell Biol 17:4282–4293 

Marschner H, Dell B (1994) Nutrient uptake in mycorrhizal symbiosis. Plant Soil 

159:89–102 

Marschner H, Haussling M, George E (1991) Ammonium and nitrate rates and rhizosphere 

pH in non-mycorrhizal roots of Norway spruce [Picea abies (L.) Karst]. Plant 

Soil 178:239–245 

Martin F (1985) 15 N-NMR studies of nitrogen assimilation and amino acid biosynthesis 

in the ectomycorrhizal fungus Cenococcum geophilum. FEBS Lett 182:350–354 

Martin F, Msatef Y, Botton B (1983) Nitrogen assimilation in mycorrhizas. I. Purification 

and properties of the nicotinamide adenine dinucleotide phosphate-specific glutamate 

dehydrogenase of the ectomycorrhizal fungus Cenococcum graniforme. New 

Phytol 93:415–422 

Martin F, Stewart GR, Genetet I, Le Tacon F (1986) Assimilation of 15 NH 4 by beech (Fagus 

sylvatica L.) ectomycorrhizas. New Phytol 102:85–94 

Martin F, Ramstedt M, Söderhäll K (1987) Carbon and nitrogen metabolism in ectomycorrhizal 

fungi and ectomycorrhizas. Biochimie 69:569–581 

Martin F, Stewart GR, Genetet I, Mourot B (1988) The involvement of glutamate dehydrogenase 

and glutamine synthetase in ammonia assimilation by the rapidly growing 

ectomycorrhizal ascomycete Cenococcum geophilum Fr. New Phytol 110:541–550 

Marmeisse R, Gay G, Debaud JC, Casselton LA (1992) Genetic transformation of the 

symbiotic basidiomycete fungus Hebeloma cylindrosporum. Curr Genet 22:41–45 

Marzluf GA (1997) Genetic regulation of nitrogen metabolism in the fungi. Microbiol 

Mol Biol Rev 61:17–32 

Melin E, Nilsson H (1952) Transport of labelled nitrogen from an ammonium source to 

pine seedling through mycorrhizal mycelium. Sven Bot Tidkr 46:281–285 

Melin E, Nilsson H (1953) Transfer of labelled nitrogen from glutamic acid to pine 

seedlings through the mycelium of Boletus variegatus (Sw.) Fr. Nature 171:134 

Migge A, Carrayol E, Hirel B, Becker TW (2000) Leaf-specific overexpression of plastidic 

glutamine synthetase stimulates the growth of transgenic tobacco seedlings. Planta 

210:252–260 

Mikes V, Zofall M, Chytil M, Fulnecek J, Schanel L (1994) Ammonia-assimilating 

enzymes in the basidiomycete fungus Pleurotus ostreatus. Microbiology 140:977–982 

Minagawa N, Yoshimoto A (1982) Purification and characterization of the assimilatory 

NADH-nitrate reductase of Aspergillus nidulans. J Biochem 91:761–774 

Montanini B, Moretto N, Soragni E, Percudani R, Ottonello S (2002) A high-affinity 

ammonium transporter from the mycorrhizal ascomycete Tuber borchii. Fungal 

Geneti Biol 36:22–34 

Näsholm T, Ekblad A, Nordin A, Giesler R, Högberg M, Högberg P (1998) Boreal forest 

plants take up organic nitrogen. Nature 392:914–916


Navarro MT, Guerra E, Fernandez E, Galvan A (2000) Nitrite reductase mutants as an 

approach to understanding nitrate assimilation in Chlamydomonas reinhardtii. Plant 

Physiol 122:283–290 

Nehls U, Kleber R, Wiese J, Hampp R (1999) Isolation and characterization of a general 

amino acid permease from the ectomycorrhizal fungus Amanita muscaria.New Phytol 

144:343–349 

Ninnemann O, Jauniaux JC, Frommer W (1994) Identification of a high affinity ammonium 

transporter from plants. EMBO J 13:3464–3471 

Notton BA, Hewitt EJ (1978) Structure and properties of higher plant nitrate reductase, 

especially Spinacea oleracea. In: Hewitt EJ, Cuttings CV (eds) Nitrogen assimilation of 

plants. Academic Press, New York, pp 227–244 

Oliveira IC, Coruzzi GM (1999) Carbon and amino acids reciprocally modulate the 

expression of glutamine synthetase in Arabidopsis. Plant Physiol 121:301–309 

Oliveira IC, Lam HM, Coschigano K, Melo-Oliveira R, Corruzi GM (1997) Moleculargenetic 

dissection of ammonium assimilation in Arabidopsis thaliana. Plant Physiol 

Biochem 35:185–198 

Pan H, Feng B, Marzluf GA (1997) Two distinct protein-protein interactions between the 

NIT2 and NMR regulatory proteins are required to establish nitrogen metabolite 

repression in Neurospora crassa. Mol Microbiol 26:721–729 

Pao SS, Paulsen IT, Saier MH (1998) Major facilitator superfamily. Microbiol Mol Biol Rev 

62:1–34 

Pateman JA (1969) Regulation of synthesis of glutamate dehydrogenase and glutamine 

synthetase in micro-organisms. Biochem J 115:769–775 

Perez MD, Gonzales C, Avila J, Brito N, Siverio JM (1997) The YNT1 gene encoding the 

nitrate transporter in the yeast Hansenula polymorpha is clustered with genes YNI1 

and YNR1 encoding nitrite reductase and nitrate reductase, and its disruption causes 

inability to grow in nitrate. Biochem J 321:397–403 

Perez-Moreno J, Read DJ (2000) Mobilization and transfer of nutrients from litter to tree 

seedlings via the vegetative mycelium of ectomycorrhizal plants. New Phytol 145: 

301–309 

Plassard C, Mousain D, Salsac L (1984a) Mesure in vitro de l’activité nitrate réductase 

dans les thalles de Hebeloma cylindrosporum, champignon basidiomycète. Physiol 

Vég 22:67–74 

Plassard C, Mousain D, Salsac L (1984b) Mesure in vivo and in vitro de l’activité nitrite 

réductase dans les thalles de Hebeloma cylindrosporum, champignon basidiomycète. 

Physiol Vég 22:147–154 

Plassard C, Martin F, Mousain D, Salsac L (1986) Physiology of nitrogen assimilation by 

mycorrhiza. In: Gianinazzi S, Gianinazzi-Pearson V (eds) Les mycorhizes: physiologie 

et génétique. INRA, Paris, pp 111–120 

Plassard C, Barry D, Eltrop L, Mousain D (1994) Nitrate uptake in maritime pine (Pinus 

pinaster) and the ectomycorrhizal fungus Hebeloma cylindrosporum: effect of ectomycorrhizal 

symbiosis. Can J Bot 72:189–197 

Plassard C, Chalot M, Botton B, Martin F (1997) Le rôle des ectomycorhizes dans la nutrition 

azotée des arbres forestiers. Rev For Fr 49:82–98 

Premakumar RG, Sorger J, Gooden D (1979) Nitrogen metabolite repression of nitrate 

reductase in Neurospora crassa. J Bacteriol 137:1119–1126 

Prima Putra D, Berredjem A, Chalot M, Dell B, Botton B (1999) Growth characteristics, 

nitrogen uptake and enzyme activities of the nitrate-utilizing ectomycorrhizal fungus 

Scleroderma verrucosum. Mycol Res 103:997–1002 

Rawat SR, Silim SN, Kronzucler HJ, Siddiqi MY, Glass AD (1999) AtAMT1 gene expression 

and NH 4 + uptake in roots of Arabidopsis thaliana: evidence for regulation by 

root glutamine levels. Plant J 19:143–52

428 


Ritchie RJ, Gibson J (1987) Permeability of ammonia and amines in Rhodobacter 

sphaeroides and Bacillus firmus. Arch Biochem Biophys 258:332–341 

Roldan JM,Verbelen J, Waren LB, Tokuiyasu K (1982) Intracellular localization of nitrate 

reductase in Neurospora crassa. Plant Physiol 70:872–874 

Roon RJ, Even HL, Dunlop P, Larimore FL (1975) Methylamine and ammonia transport 

in Saccharomyces cerevisiae. J Bacteriol 122:502–509 

Rousseau JVD, Sylvia DM, Fox AJ (1994) Contribution of ectomycorrhiza to the potential 

nutrient-absorbing surface of pine. New Phytol 128:639–644 

Scazzocchio C, Arst HN Jr (1989) Regulation of nitrate assimilation in Aspergillus nidulans. 

In: Wray JL, Kinghorn JR (eds) Molecular and genetic aspects of nitrate assimilation. 

Oxford University Press, Oxford, pp 314–363 

Scheromm P., Plassard C., Salsac L (1990) Effect of nitrate and ammonium nutrition on 

the metabolism of the ectomycorrhizal fungus Hebeloma cylindrosporum.New Phytol 

114:227–234 

Schwartz T, Kusnan MB, Fock HP (1991) The involvement of glutamate dehydrogenase 

and glutamine synthetase/glutamate synthase in ammonia assimilation by the basidiomycete 

fungus Stropharia semiglobata. J Gen Microbiol 137:2253–2258 

Siverio JM (2002) Assimilation of nitrate by yeasts. FEMS Microbiol Rev 26:277–284 

Smith SE, Read DJ (1997) Mycorrhizal symbiosis. Academic Press, London, 521 pp 

Sokolovski SG, Meharg AA, Maathuis FJM (2002) Calluna vulgaris root cells show 

increased capacity for amino acid uptake when colonized with the mycorrhizal fungus 

Hymenoscyphus ericae. New Phytol 155:525–530 

Sophianopoulou V, Diallinas G (1995) Amino acid transporters of lower eucaryotes: regulation, 

structure and topogenesis. FEMS Microbiol Rev 16:53–75 

Su W, Huber SC, Crawford NM. 1996. Identification in vitro of a post-translational regulatory 

site in the hinge 1 region of Arabidopsis nitrate reductase. Plant Cell 8, 519–527 

Suarez MF, Avila C, Gallardo F, Canton FR, Garcia-Gutiérrez A, Claros MG, Canovas FM 

(2002) Molecular and enzymatic analysis of ammonium assimilation in woody 

plants. J Exp Bot 370:891–904 

Taylor TM, Osborn JM (1995) The importance of fungi in shaping the paleoecosystem. 

Rev Palaeobot Palynol 90:249–262 

Temple SJ, Vance CP, Gantt JS (1998) Glutamate synthase and nitrogen assimilation. 

Trends Plant Sci 3:51–56 

ter Schure EG, Sillje HH, Raeven LJ, Boonstra J, Verkleij AJ, Verrips CT (1995) Nitrogenregulated 

transcription and enzyme activities in continuous cultures of Saccharomyces 

cerevisiae. Microbiology 141:1101–1108 

Trepp GB, Plank DW, Gantt S,Vance CP (1999) NADH-glutamate synthase in alfalfa root 

nodules. Immuno-cytochemical localization. Plant Physiol 119:829–837 

Unkles SE, Hawker C, Grieve EI, Campbell EI, Montague P, Kinghorn JR (1991) crnA 

encodes a nitrate transporter in Aspergillus nidulans. Proc Natl Acad Sci USA 

88:204–208 

Unkles SE, Zhou D, Siddiqi MY, Kinghorn JR, Glass ADM (2001) Apparent genetic redundancy 

facilitates ecological plasticity for nitrate transport. EMBO J 20:6246–6255 

Vallorani L, Polidori E, Sacconi C, Agostini D, Pierleoni R, Piccoli G, Zepa S, Stocchi V 

(2002) Biochemical and molecular characterization of NADP-glutamate dehydrogenase 

from the ectomycorrhizal fungus Tuber borchii. New Phytol 154:779–790 

Vanoni MA, Curti B (1999) Glutamate synthase: a complex iron-sulfur flavoprotein. Cell 

Mol Life Sci 55:617–638 

Vézina LP, Margolis HA, McAfee BJ, Delanay S(1989) Changes in the activity of enzymes 

involved with primary nitrogen metabolism due to ectomycorrhizal symbiosis on 

jack pine seedlings. Physiol Plant 75:55–62 

Vitousek PM ., Matson PA (1985) Causes of delayed nitrate production in two Indiana 

forests. Forest Sci 31:122–131


Wallenda T, Read DJ (1999) Kinetics of amino acid uptake by ectomycorrhizal roots. 

Plant, Cell Environ 22:179–187 

Wallsgrove RM, Turner JC, Hall NP, Kendall AC, Bright SWJ (1987) Barley mutants lacking 

chloroplast glutamine synthetase. Biochemical and genetic analysis. Plant Physiol 

83:155–158 

Wang R, Guegler K, LaBrie ST, Crawford N (2000) Genomic analysis of a nutrient 

response in Arabidopsis reveals diverse expression patterns and novel metabolic and 

potential regulatory genes induced. Plant Cell 12:1491–1509 

Wipf D, Benjdia M, Tegeder M, Frommer WB (2002) Characterization of a general amino 

acid permease from Hebeloma cylindrosporum. FEBS Lett 528:119–24 

Yip KP, Kurtz I (1995) NH 3 permeability of principal cells and intercalated cells measured 

by confocal fluorescence imaging. Am J Physiol 269:545–50 

Zhou JJ, Trueman LJ, Boorer KJ, Theodoulou FL, Fordes BG, Miller AJ (2000) A high 

affinity fungal nitrate carrier with two transport mechanisms. J Biol Chem 

275:39894–39899

23 Visualisation of Rhizosphere Interactions of 

Pseudomonas and Bacillus Biocontrol Strains 

Thomas F.C. Chin-A-Woeng, Anastasia L. Lagopodi, 

Ine H.M. Mulders, Guido V. Bloemberg and Ben J.J. Lugtenberg 


This chapter provides hands-on protocols as well as theoretical background 

information for the selection of Pseudomonas and Bacillus strains from the 

rhizosphere antagonistic to phytopathogens. These strains can be evaluated 

in a bioassay for their beneficial properties. The strains can be marked with a 

reporter gene after selection and used to study cellular and molecular interactions 

between one or more beneficial strains and a soil-borne phytopathogen 

in the rhizosphere of a host plant.Autofluorescent proteins can be 

used for the non-invasive study of rhizosphere interactions using epifluorescence 

and confocal laser scanning microscopy (CLSM). Autofluorescent proteins 

have become an outstanding and convenient tool for studying rhizosphere 

and other in situ environmental interactions and have allowed 

microbiologists to visualise the spatial distribution of various microorganisms. 

Intricate molecular mechanisms and relationships in the rhizosphere 

can now be studied. Methods to mark rhizosphere bacteria as well as fungi are 

provided. 

2 Tomato Foot and Root Rot and the Need for Biological 

Control 

Tomato (Esculentum lycopersicum) foot and root rot caused by the fungus 

Fusarium oxysporum Schlechtend.:Fr. f. sp. radicis-lycopersici W.R. Jarvis and 

Shoemaker (F.o.r.l.) is a disease which causes considerable losses to tomato 

crops. The disease differs from fusarium wilt caused by Fusarium oxysporum 

Schlechtend.:Fr. f. sp. lycopersici (Sacc.) W.C. Snyder & H.N. Hans. Plants with 

Fusarium foot and root rot show yellowing along the margin of the oldest 

leaves, followed by necrosis. Dry brown lesions develop in the cortex of the tap 

or main lateral roots. Necrotic lesions may also develop on the surface of the 

stem from the soil line to 10–30 cm above it. Infected plants may be stunted 




432 

Thomas F.C. Chin-A-Woeng et al. 

and wilted. Cool soil temperatures favour the disease. The fungus lives over 

winter and survives for many years in the soil as chlamydospores. Long distance 

spread is caused by transplants and by soil on farm machinery. Spores 

are air-borne in greenhouses. The disease causes losses in tomato cropping in 

agricultural fields, glasshouses, and hydroponic growth. The fungus forms a 

problem for hydroponic tomato growth in glasshouses in the Netherlands. In 

the southwest of Florida it is one of the most important tomato diseases and 

it is emerging at new locations in the United States. Until now only partially 

resistant varieties have been identified and preplant fumigation with, e.g. 

methylbromide, which is a management practice often used for many soilborne 

diseases, does not completely control the fungus. This practice is also 

deprecated in view of sustainable agricultural practices. Hence, an efficient 

way to control the disease is important. 

An alternative to chemical control of plant diseases is the use of bacteria 

(biocontrol). They have the potential to displace or antagonise phytopathogenic 

or deleterious microorganisms in the rhizosphere. Biocontrol bacteria 

also produce chemicals, but these are degradable and only produced in low 

amounts at targeted locations. The latter approach fits well in the worldwide 

strategy to grow healthier plants in a sustainable way and, therefore produce 

high quality food. 

To use biocontrol strains efficiently, the molecular interactions between 

plant, biocontrol agent, pathogen and their environment need to be understood. 

Genetic engineering is an important tool in helping us to define the 

molecular basis of pathogenicity and is also useful in helping us to identify 

the mechanisms in the action of biocontrol strains. Molecular genetic modification 

of microorganisms requires the development of plasmid-mediated 

transformation systems that include: (1) introduction of exogenous DNA into 

recipient cells, (2) expression of transformed genes, and (3) stable maintenance 

and replication of the inserted DNA leading to expression of the 

desired phenotypic trait. In this chapter, a practical approach to the analysis 

of biocontrol strains including the isolation, testing, and tagging of these 

strains, and transformation systems for pathogenic fungi to express reporter 

genes to track and visualise them in the rhizosphere, are discussed in relation 

to the pathogenic fungus Fusarium oxysporum f. sp. radicis-lycopersici. 

3 Selection of Antagonistic Strains 

3.1 Selection of Antagonistic Pseudomonas and Bacillus sp. 

Pseudomonas and Bacillus species constitute, together with Streptomyces 

species, a substantial fraction of the bacterial community isolated from the 

rhizosphere. Their presence is sometimes correlated with disease suppression. 

These beneficial bacteria can be exploited as biological pesticides to be

23 Visualisation of Rhizosphere Interactions 433 

used either as an alternative to, or in combination with chemicals to reduce 

the dose of these chemicals. Pseudomonas and Bacillus spp. are often abundantly 

present in the rhizosphere and surrounding soil of many crop plants. 

Many of these species produce secondary metabolites that inhibit growth of, 

or kill, soil-borne phytopathogens. These antagonistic bacteria can either be 

isolated from the rhizosphere or from the soil in which plants have been 

grown. 

In the following isolation procedure, tomato plants harvested at the end of 

the growing season were picked randomly. Plant roots (0.3–0.4 g fresh weight) 

were vigorously shaken in phosphate buffer saline (PBS) for 1 h to detach the 

rhizosphere bacteria from the roots. The resulting bacterial suspensions from 

individual root systems were diluted and plated on one tenth strength tryptic 

soy agar (TSA) supplemented with the fungicide cycloheximide (50 mg/ml). 

The use of a nutrient-poor medium was reported to yield the highest numbers 

of isolates.After an incubation period of 2–7 days at 28 °C, a large variety 

of colonies with different morphologies were observed. 

The number of fluorescent pseudomonads found in the rhizosphere is very 

often variable. In some studies they were reported to be a dominant group, 

whereas other studies report that their numbers did not exceed 1 % of the 

total rhizosphere population isolated. The variations may be due to differences 

in plant species or cultivars, soil type, age of the plant roots, or the isolation 

method. Recently, it was also found that the percentage of antagonistic 

pseudomonads from a maize rhizosphere grown without chemical pesticides 

in Totontepec, Oaxaca State, Mexico, was 20 times higher than that from a rhizosphere 

grown in a commercial tomato field treated with chemicals in 

Andalusia, Spain (van den Broek et al., unpubl. data). No single medium is 

definitely suited for an unbiased selection of all culturable rhizosphere bacteria. 

Pseudomonas isolation (PI) agar can be used to specifically favour the 

growth of pseudomonads. One should also keep in mind that only the culturable 

part of the rhizosphere population will be obtained. 

Putative Bacillus strains are isolated by heating root samples at 80 °C for 

10 min prior to washing the bacteria from the roots. The bacterial solution is 

plated on Luria-Bertani (LB) agar plates supplemented with cycloheximide 

(50 mg/ml) and incubated for 2–5 days at 28 °C. Colonies with a Bacillus-like 

morphology are then compared to Bacillus-type strains. To determine 

whether one is dealing with Gram-positive or Gram-negative organisms, a 

first identification of colonies can be performed by determining the ability to 

form mucoid threads after pulling a toothpick out of a bacterial suspension in 

3 % KOH, which is indicative for Gram-negative organisms. A definite determination 

requires a standard Gram stain. Further characterisation methods 

include the use of Biolog, which is based on the ability of a strain to oxidise 

particular carbon sources, amplified ribosomal DNA restriction analysis 

(ARDRA), or PCR amplification of 16S ribosomal DNA fragments with specific 

primers followed by nucleotide sequencing and homology studies. In the

434 


Biolog method, data sets derived from the carbon source utilisation patterns 

can be analysed with an appropriate software program (depending on the 

Gram character of the strain) and compared to known patterns of species 

present in commercially available databases. The latter two methods are 

based on specific sequences conserved between closely related species in the 

ribosomal rRNA gene fragments encompassing the 16S rDNA, the 16S–23S 

spacer region, and part of the 23S rDNA. 

3.2 In Vitro Antifungal Activity Test 

A simple in vitro assay to determine the activity against fungi can be performed 

by growing single bacterial colonies on agar medium in the presence 

of the fungus. The fungus is stab-inoculated in the centre of a Petri dish and 

bacterial strains are spot-inoculated at 2–2.5 cm distance from the fungus. 

The bacteria and fungus are allowed to grow concentrically and the formation 

of an inhibitory zone around the bacterial colony is an indication that the 

strain secretes a diffusible compound which inhibits growth of the fungus. 

A large scale identification of antifungal activity in growth supernatants of 

bacterial cultures can be performed in 96-well microtiter plates in the presence 

of F.o.r.l. The assay allows the convenient screening of a large number of 

strains in a reproducible and quantitative way. Strains to be tested are grown 

in a 96-well microtiter plate in a volume of 200 ml. After growth, the cells are 

sedimented by centrifugation at 5000 rpm for 10 min and the culture supernatants 

are passed through a 0.45 or 0.22-mm pore size filter.A volume of 75 ml 

supernatant is mixed with an equal volume of an agarose-spore suspension 

(2x malt extract broth, 1.3x10 4 spores/ml, 1.5 % (w/v) agarose). The final concentration 

of the spores in the wells is 1000 spores/well. The wells are sealed 

either with 75 ml paraffin oil (filter-sterile), with an oxygen-permeable plate 

seal, or with a piece of Saran wrap. Germination and mycelium growth is followed 

by measuring optical density (OD 620) of the wells using a microtiter 

plate reader (every hour) for approximately 72 h during growth at 28 °C. 

When an automated stack reader is used, many plates can be screened simultaneously 

in this way. 

4 In Vivo Biocontrol Assays 

4.1 Fusarium oxysporum–Tomato Biocontrol Assay in a Potting Soil 

System 

Biocontrol of Pseudomonas and Bacillus rhizosphere isolates can be tested in 

a bioassay in which tomato seedlings grown from seeds coated with biocontrol 

bacteria are grown in potting soil infected with F.o.r.l. spores. Spores are


obtained from liquid cultures and mixed with the soil prior to planting the 

seeds. 

To isolate spores, F.o.r.l. is stab-inoculated onto potato dextrose agar 

medium and grown at 24 °C until the fungal mycelium covers the entire plate 

after a few days. One third of a PDA agar plate with F.o.r.l. is minced and used 

for inoculation of 200 ml Czapek-Dox medium in a 1-l Erlenmeyer flask. The 

fungus is grown for 2–3 days at room temperature under shaking at 110 rpm. 

Fungal mycelium and spore growth should be clearly visible at this stage. The 

F.o.r.l. inoculum is passed through Miracloth (Calbiochem-Novabiochem 

Corporation, La Jolla, CA, USA) or glass wool to remove the mycelium. The 

spore concentration is determined with a haemocytometer (with a depth of 

100 mm). 

The spore suspension is diluted in water to 1x10 6 spores/ml and added to 

potting soil to a final concentration of 6x10 6 spores/kg of soil. Spores are thoroughly 

mixed through the potting soil and the pots are filled with the infected 

soil. Seeds are sown in 8 plots of 12 pots, one seed per pot at a depth of 1–2 cm. 

Plants are watered from below to prevent disturbance of the root colonisation 

process. 

Bacterial strains are coated onto the tomato seeds in a simple procedure 

using methylcellulose. Pseudomonas strains are grown overnight in 3 ml 

King’s medium B at 28 °C. Bacilli are grown in 3 ml tryptic soy broth (TSB) for 

3 days at 28 °C. The overnight culture of bacteria is washed with PBS to 

remove the growth medium and diluted to a concentration of 2x10 9 CFU/ml. 

For bacilli the concentration is adjusted to 2x10 7 CFU/ml. Then equal volumes 

of the bacterial suspension and a 2.0 % (w/v) methylcellulose solution are 

mixed (methylcellulose is dissolved in water by vigorous stirring or by using 

a blender). Seeds are dipped into the mixture and dried in a sterile air stream 

on a filter paper. The coated seeds can be sown directly or kept at 4 °C for 1 or 

2 days. The number of bacteria recovered from tomato seeds after coating is 

approximately 10 4 CFU/seed. Seedling germination is determined 1 week 

after sowing. Between 2–3 weeks after sowing, depending upon the disease 

pressure, the percentage of diseased plants is determined.A percentage of diseased 

plants of approximately 60 % is preferred to perform statistical analyses. 

4.2 Gnotobiotic Fusarium oxysporum–Pythium ultimum and 

Rhizoctonia solani–Tomato Bioassays 

The gnotobiotic system used for this bioassay has been extensively used to 

study root colonisation. Briefly, tomato seeds are surface-sterilised in a 5 % 

household sodium hypochlorite solution for 3 min, followed by four thorough 

rinses with 20 ml sterile water for 2 h. Incubation of sterilised tomato seeds on 

KB medium, in our hands, shows that this method consistently yields seeds

436 


free of contamination.After incubation for 24 h on agar-solidified plant nutrient 

solution (PNS) medium at 4 °C, seeds are allowed to germinate at 28 °C. 

Seedlings are inoculated 2 days later. A F.o.r.l. spore suspension, prepared as 

described previously, is added to the plant nutrient solution to a final concentration 

of 5x10 2 spores/ml, which is than mixed through the sterile sand to 

10 % (v/w) PNS. 

Rhizoctonia solani was grown on 2 % water agar for 5 days. Discs of approximately 

4 mm in diameter were cut from the edge of a growing colony and 

blended in PNS. P. ultimum was grown for 3–4 weeks in clarified V8 medium 

or hemp seed extract in water for 1–2 weeks. Oospores were collected free of 

the mycelium by washing them three times with sterile water and blending in 

0.1 M sucrose. The blended culture was incubated for 2 h on a shaker 

(130 rpm) at 28 °C, sedimented, and resuspended in 1 M sucrose. To kill the 

mycelium fragments, the suspension was incubated at –20 °C for 12 h. The culture 

was washed, layered over 1 M sucrose and centrifuged at 2300 rpm. 

Oospores were added in a final concentration of 5–25 oospores/g of sand. 

Germinated tomato seeds were incubated in a bacterial suspension with a 

concentration of 10 7 CFU/ml (Pseudomonas) or 10 9 CFU/ml (Bacillus) for 

10 min, after which the germinated seeds were planted in the sand at a depth 

of approximately 5 mm. Seed inoculation is preferred above inoculation from 

soil since commercial biocontrol of tomato pathogens is also based on seed 

coating while the pathogen is already present in the soil. This form of inoculation 

also results in more reproducible experimental data. Plants were grown 

in a growth chamber or a greenhouse for 7 days and the disease index was 

determined by scoring the plants according a fixed disease index (Table 1). 

The data can be analysed statistically using a standard c 2 analysis. 

To confirm the presence of the fungus on plants, suspected diseased root 

parts can be placed in 0.005 % household bleach for 30 s, thoroughly rinsed 

with sterile water, and placed on a rich (LC or PDA) medium. Plates are 

inspected for fungal growth after incubation at 28 °C for 2 days. 

Table 1. Example of Pythium ultimum disease indices 

Disease symptoms Disease index 

No visible symptoms 0 

Small brown spots on the main root and/or the crown 1 

Brown spots on the central root and extensive discoloration of crown 2 

Damping-off 3 

Dead 4

5 Microscope Analysis of Infection and Biocontrol 

5.1 Marking Fungi with Autofluorescent Proteins 

5.1.1 Transformation of Pathogenic Fungi 

5.1.1.1 Growth of Fungal Mycelium 

Protoplasts are usually used for transformations of fungi. The removal of the 

cell wall is achieved by treating mycelia or germlings in the presence of lytic 

enzymes. The osmotic balance of protoplasts in a suspension is usually maintained 

using sugars such as sucrose and sorbitol and salts such as magnesium 

chloride, potassium chloride, and ammonium sulphate. 

The following polyethylene/CaCl 2-mediated transformation procedure has 

been successfully applied to mycelium of F.o.r.l. Growing mycelium is prepared 

by inoculation of 100 ml potato dextrose broth in a 300-ml Erlenmeyer 

flask with a 5x4 mm size inoculum of mycelium. Depending on the particular 

F.o.r.l. strain, the fungus is grown between 2 and 5 days at 28 °C and 160 rpm. 

For example, F. oxysporum Fo47 is grown for 5 days, F. oxysporum f. sp. radicis-lycopersici 

ZUM2407 (IPO-DLO, Wageningen, The Netherlands) is grown 

for 2 days. Subsequently, the culture is passed through two layers of Miracloth 

and the filtrate is collected and sedimented by centrifugation at 5000 rpm for 

10 min. The supernatant is immediately discarded and washed three times 

with 50 ml of sterile water and sedimented. The characteristic purple upper 

layer is discarded and the pellet is resuspended in 2–5 ml of sterile water. The 

spore concentration is determined with a haemocytometer. From this spore 

suspension, a number of 5x10 8 conidia is inoculated into 40 ml potato dextrose 

broth and grown at 25 °C and 300 rpm for approximately 18 h or until 

the length of the germ tubes is at least ten times the size of a spore. The overall 

percentage of germinated spores should be higher than 95 %. 

5.1.1.2 Preparation of Protoplasts 


Germlings to be converted into protoplasts are sedimented by centrifugation 

at 2000 rpm for 10 min, after which the supernatant is carefully removed and 

the pellet resuspended in 25 ml magnesium sulphate solution (1.2 M MgSO 4 , 

50 mM sodium citrate, pH 5.8). The suspension is then passed through three 

layers of Miracloth. The mycelium trapped in the Miracloth is washed twice 

with magnesium sulphate solution and then transferred to a new tube with a 

cotton swab. The mycelium is then incubated in a protoplasting mix (10 mg/l 

Lysing Enzyme (Sigma L-2265, Sigma Chemicals Co., St. Louis, MO, USA), 

15 mg/ml Driselase (Sigma Chemicals Co., St. Louis, MO, USA) in magnesium 

sulphate solution). The enzyme solution should be centrifuged to remove any 

solid particles prior to use. The mixture is incubated for 24 h at 30 °C on a 

shaker (65 rpm). The conversion of cells into protoplasts can be followed by

438 


phase contrast microscopy and, when the protoplastation nears completion, 

the protoplasts are collected on three layers of Miracloth, transferred to a new 

tube and washed with a sterile cold sorbitol solution (1 M sorbitol, 50 mM 

CaCl 2 , 10 mM Tris-HCl, pH 7.4). The protoplasts are sedimented by centrifugation 

at 850xg (2100 rpm) at 4 °C and the number of protoplasts is determined 

with a haemocytometer. 

5.1.1.3 Transformation of Protoplasts 

Protoplast are transformed by addition of up to 15 mg of DNA to 200 ml of protoplast 

suspension and incubated on ice for 15 min, or stored at 4 °C.A volume 

of 1.0 ml PEG solution (60 % (w/v) polyethylene glycol 6000, 50 mM CaCl 2, 

10 mM Tris-HCl, pH 7.4) is slowly added while shaking gently. The mixture is 

incubated on ice for 30 min after which the protoplasts are washed with a 

magnesium sulphate/potato dextrose broth solution at 4 °C. The protoplasts 

are sedimented by centrifugation at 2500 rpm at 4 °C for 10 min and resuspended 

in the remaining fluid after discarding the supernatant. The protoplasts 

are incubated 30 min at room temperature and portions (50–1200 ml) 

are plated onto selective media containing 0.8 M sucrose, 10 mM Tris-HCl pH 

7.4, 100 mg/ml hygromycin, and 1.5 % (w/v) agar. Plates are incubated for 2 or 

3 days at the appropriate growth temperature. 

5.2 Marking Rhizosphere Bacteria with Autofluorescent Proteins 

The green fluorescent protein (GFP) of the jellyfish Aequorea victoria has 

been rapidly and successfully adopted as an important marker for investigating 

processes in the rhizosphere. GFP is a 27-kDa polypeptide which converts 

the blue chemiluminescence of the Ca 2+ -sensitive photoprotein 

aequorin into green light. The active chromophore is a tripeptide, the formation 

of which is oxygen-dependent and occurs gradually after translation 

by undergoing an autocatalytic reaction. GFP emits bright green light 

(l max =510 nm) when excited with ultraviolet (UV) or blue light 

(l max=395 nm) in vivo and in vitro. 

GFP allows the non-destructive localisation and monitoring of individual 

cells on the root surface and does not require, unlike other biomarkers, exogenously 

added substrates, energy sources, or cofactors other than molecular 

oxygen. GFP fluorescence is stable, species-independent, requires no processing 

by the cells and fixing or staining is not necessary so artefacts cannot be 

introduced. However, if required, GFP allows fixation since it is unaffected by 

paraformaldehyde treatment. It is also stable under many other denaturing 

conditions such as the presence of denaturants or proteolytic enzymes, high 

temperatures (65 °C), and pH levels (6–12). Expression can be easily detected 

using epifluorescence or confocal laser scanning microscopy. Other optical


methods that can be used to detect GFP-marked bacteria include the use of 

charge couple device (CCD) microscopy and cell sorting by fluorescent-activated 

cell sorters (FACS), which allows the sampling and identification of subpopulations 

of bacteria in a non-destructive way at the single cell level. Autofluorescently 

labelled colonies on agar plates can be detected under a 

hand-held UV-lamp or a low-resolution binocular microscope equipped with 

a UV lamp. 

Since gfp is eukaryotic in origin, optimised constructs for the expression of 

gfp in bacteria have been constructed and successfully applied. This was 

achieved by expression of gfp under the control of strong constitutive promoters 

or using red-shifted and UV-optimised mutant derivates. These GFP 

variants provide an increased fluorescent signal intensity in bacteria, faster 

rates of oxidative chromophore formation, resistance to photobleaching and 

excitation maximums better suited to conventional detection instruments. 

GFPuv emits bright green light (maximum at 509 nm) when exposed to UV or 

blue light (395 or 470 nm). Mutant proteins GFPmut2 and GFPmut3 have 

emission maximums of 507 and 511 nm when excited by blue light (481 and 

501 nm, respectively). 

Stable plasmid vectors (multicopy) and transposon vectors (single copy) 

for marking with fluorescent proteins are available for use in Gram-negative 

as well as Gram-positive bacteria. They can be used for tagging bacteria with 

a biomarker, construction of fusion proteins, assaying gene activity, or promoter 

probing. Plasmids pGB5, carrying gfp driven by a tac promoter, was 

shown to be 100 % stably maintained in Pseudomonas in the tomato rhizosphere 

and resulted in constitutive expression in Pseudomonas without addition 

of an inducer. Dandie et al. (2001) constructed transposon-based tagging 

vectors using a gfp marker gene under control of either constitutive or 

inducible promoters. 

Plasmids pFPV1 and pFPV2 direct high levels of gfp expression in E. coli, 

Salmonella typhimurium, and Yersinia pseudotuberculosis and in different 

mycobacterial species. The high levels of gfp expression were achieved by 

expression under control of the lacZpo and hsp60 heat-shock promoters, 

respectively. They have been used to visualise the infection process of mammalian 

cells by the three species. Transposon plasmid Tn5GFP1 was successfully 

used to follow Pseudomonas putida cells during water transport 

through a sand matrix. To study the colonisation pattern of P. chlororaphis 

MA342 on barley seeds, the strain was tagged using a plasmid pUTgfp2X 

harbouring gfp. 

For many applications, such as the analysis of chromosomal genes under 

physiological (monocopy) conditions using transcriptional fusions, stable 

integration of the reporter, or reduction of the risk of transfer of the genetic 

marker to other microorganisms, it is necessary to integrate the gfp transcriptional 

fusion into the chromosome of target bacteria by site-specific 

recombination or by random insertion, e.g. by means of transposons. A gfp

440 


cloning cassette vector, pGreenTIR, was designed specifically for use in the 

construction of prokaryotic transcriptional fusions. The cassette confers sufficient 

fluorescence to recipient cells to be used in low copy-number plasmids 

with promoters conferring low levels of transcription in E. coli and 

Pseudomonas. The bacterial transposon Tn7 inserts at a high frequency into a 

specific intergenic site attTn7 on the chromosome in a number of Gram-negative 

bacteria. Tn7-based systems allow stable single-copy insertion of marker 

genes and insertion of transcriptional fusions in a single copy on the chromosome 

for gene expression studies at a neutral, intergenic site. Koch et al. 

developed a panel of flexible mini-Tn7 delivery vectors, including cloning 

vectors with an increased number of unique cloning sites, the lack of which 

has limited the use of Tn7 systems so far. A Tn10-based transposon was successfully 

used for fluorescence tagging of marine bacteria. 

Based on mini-Tn5 transposon derivatives, a gfp containing promoterprobe 

mini transposon was constructed for use in Pseudomonas species. 

Another set of vectors containing a mutated gfp gene was constructed for use 

with Gram-negative bacteria other than E. coli. pTn3gfp can be used for making 

random promoter probe gfp insertions into cloned DNA in E. coli for subsequent 

introduction into host strains. pUTmini-Tn5gfp can be used for making 

random promoter probe insertions directly into host strains. Plasmids 

p519gfp and p519nfp are broad host range mobilisable plasmids with gfp 

expressed from a lac and an npt2 promoter, respectively. 

Fluorescent markers can also be used to study viability and metabolic 

activity of bacteria in the rhizosphere. Normander et al. used gfpmut3b (Ser- 

64 Gly) to visualise the effect of indigenous populations on the distribution 

and activity of inoculated P. fluorescens DR54-BN14 in the barley rhizosphere. 

Using gfp-marked strains, they demonstrated that microcolonies of 

the inoculant strain were closely associated with cells of indigenous populations 

and that the majority of the cells have properties similar to those of 

starved cells. 

Mutagenesis and protein engineering of the original GFP from the jellyfish 

Aequorea has yielded variants with different excitation and emission 

spectra that can be used for dual colour imaging. Many engineered variants 

also appear to be improved in other aspects such as photostability, codon 

usage, and thermosensitivity. The first dual colour imaging of bacteria in a 

mixed population of E. coli cells was achieved by selective excitation of 

wild-type GFP and mutant derivatives with a red-shift in the excitation spectrum. 

Fluorescent proteins can also be successfully combined with the use of 

other biomarkers such as luciferase. To monitor cell numbers and metabolic 

activity of specific bacterial populations in liquid cultures and soil samples, a 

dual gfp-luxAB under control of the psbA promoter was integrated into the 

chromosomes of E. coli DH5a and P. fluorescens SBW25. Since luciferase output 

from luxAB-tagged bacteria decreases during starvation, lux expression


was used as a marker for metabolic activity, while the much more stable gfp 

expression was used as an indicator for biomass. Alternatively, unstable variants 

of autofluorescent proteins with shorter half-lives can be used. 

Variants, fluorescent in colours ranging from blue to yellow, namely blue 

fluorescent protein (BFP), yellow fluorescent protein (YFP), and cyan fluorescent 

protein (CFP), and optimised counterparts of EGFP and EBFP were created 

by mutagenesis. By labelling microorganisms differently, these variants 

can be used to track multiple microorganisms simultaneously. The major 

problem with using GFP variants to label strains for simultaneous detection is 

the complicated separation of the spectral overlap of the different GFP-isoforms. 

Recently, red fluorescent protein (drFP583 or DsRed), isolated from the 

tropical Indo Pacific reef coral Discosoma sp., has been cloned. With an emission 

maximum at 583 nm, DsRed is suitable for almost crossover-free dual 

colour labelling in combination with EGFP (emission 509 nm) upon simultaneous 

excitation. Similarly, combination of cells tagged with ECFP and EGFP 

or a mixture of cells labelled with ECFP and EYFP allows them to be clearly 

distinguished from each other in the tomato rhizosphere. In addition, DsRed 

can be combined with any other autofluorescent protein since the emission 

spectrum of DsRed does not overlap that of the others. Using different colours 

of fluorescent proteins, up to three labels (e.g. EGFP, ECFP and DsRed) can be 

simultaneously traced in the rhizosphere. These variants have also been used 

to visualise interactions of a DsRed-labelled biocontrol bacterium P. chlororaphis 

PCL1391 with gfp-labelled F.o.r.l. strain in the tomato rhizosphere 

(Lagopodi et al., unpubl. data). Bacteria were dually labelled merely to localise 

them in the rhizosphere. 

The gfp genes can also be used as reporters for gene expression in the rhizosphere 

or for genes involved in quorum sensing. The estimated half-life of 

wild-type GFP is estimated to be at least 1 day. Since fluorescent proteins are 

extremely stable, they cannot be used for transient (real time) gene expression 

studies. Less stable variants have been constructed that can be used for 

analysis of transient gene expression in bacteria and, hence, promoter activity 

in the rhizosphere. Unstable variants of fluorescent proteins can be produced 

by addition of C-terminal degradation domains to the protein that are targets 

of natural protein degradation systems in cells. One such system exploits the 

action of intracellular tail-specific protein via the ssrA-mediated peptide 

degradation of prematurely terminated polypeptides at the C-terminal end. 

Homologues of ssrA have been identified in both Gram-negative and Grampositive 

bacteria. Gfpmut3 derivatives carrying these degradation domains 

have half-lives between 40 min and 2 h, while the estimated half-life of wild 

gfpmut3 is estimated to be at least 1 day. 

GFP can also be used and expressed in Gram-positive species such as Bacillus 

spp. pAD213 was constructed as a promoter-trap plasmid for Bacillus 

cereus. It allows screening of large libraries for identifying regulatory 

sequences and screening using flow cytometry and cell sorting. Plasmid vec-

442 


tors have been described that enable routine production of GFP,YFP and CFP 

fusions in Gram-positive bacteria. 

One disadvantage of the use of fluorescent proteins is the maturation time 

of the protein, particularly that of DsRed. Although EGFP requires ~ 4 h for 

efficient microscopic visualisation, visualisation of DsRed requires longer 

periods. This delay is not due to inefficient expression of the DsRed protein 

since the protein can be detected in high quantities very soon, but it is rather 

due to an extended maturation time of the protein (20–48 h). DsRed is in fact 

brighter than first reported, but the fluorescence matures very slowly and the 

protein naturally forms a tetramer. More rapidly maturing and soluble variants 

of DsRed have been generated by mutagenesis (Brooke and Glick 2002). 

Furthermore, E. coli cells expressing DsRed protein are in general smaller 

than cells expressing EGFP or untransformed bacteria, indicating that DsRed 

might have a toxic effect. Another problem with the use of fluorescent proteins 

is the variability of expression in different bacterial species. GFP 

expressed from the same constructs is two to ten times higher expressed in E. 

coli than in pseudomonads. Interference by other fluorescent particles, bacteria, 

or root autofluorescence may also introduce artefacts or complicate the 

observations. 

5.3 Confocal Laser Scanning Microscopy of Rhizosphere Interactions 

The advent of fluorescent proteins offers a broad range of applications to 

track bacteria and study gene expression in the rhizosphere. By labelling different 

strains with different flavours of fluorescent proteins such as green, red, 

blue, or yellow fluorescent protein, multiple bacterial strains and their interactions 

with pathogens can be tracked simultaneously in the rhizosphere. 

To express gfpin F.o.r.l., pGFDGFP on which the sgfp gene is cloned between 

the A. nidulans gpdA promoter and the trpC terminator sequences was transformed 

to F.o.r.l.. The fungus was transformed by the previously described 

polyethyleneglycol/CaCl 2 -mediated transformation of protoplasts in the presence 

of pAN7–1, which allows selection for hygromycin B resistance 

(100 mg/ml). The level of gfp expression was high in the mycelium, micro- and 

macroconidia, and chlamydospores. The labelled isolates were equally pathogenic 

to tomato as the wild type. The marked fungus was introduced into the 

gnotobiotic sand system by mixing spores with sand. First, the interactions 

between fungal pathogens and the tomato root were studied. CLSM observations 

show that after 2 days the main root is surrounded by hyphae, which are 

interwoven with the root hairs. The contact between hyphae and the root was 

initiated at or via the root hairs.After 3 days,spot attachments of hyphae to the 

root surface are observed, predominantly at the crown and hyphae grow along 

the junctions of the epidermal cells after attachment. The first infection events 

take place 4 days after inoculation, as observed by penetration of epidermal

cells by hyphae. No penetration structures are observed except for swollen 

hyphae at the penetration site.Five days after planting,at which the first disease 

symptoms can be observed, a tight network of hyphae has grown around the 

root surface and epidermal cells are intercellularly colonised by hyphae. After 

complete destruction of the root system, the fungus forms macroconidia and 

starts colonising the cotyledons. 

After introduction of biocontrol bacteria to the test system, observations 

show that in the F.o.r.l. -tomato biocontrol system Pseudomonas bacteria not 

only colonise the tomato root surface, but also fungal hyphae (Bolwerk and 

Lagopodi, unpublished). These are indications that biocontrol bacteria not 

only protect the roots against fungi by niche exclusion and production of 

antibiotics, but that they actively attack the pathogen. Still, there is much to be 

discovered from these rhizosphere studies. The use of autofluorescent proteins 

has shown to be a promising way of visualising and understanding the 

interactions taking place in the rhizosphere between Pseudomonas and Bacillus 

biocontrol strains and fungal pathogens. 

6 Conclusions 

The whole procedure of isolation, screening for antifungal activity, and determining 

disease suppression in bioassays allows fast isolation of potential biocontrol 

strains. The gnotobiotic test system has proven to be a valuable test 

system to study interactions between biocontrol bacteria, phytopathogen, and 

host plant. Combined with the use of autofluorescent proteins, it provides us 

with an extraordinary opportunity to study the intricate cellular and molecular 

interactions that the key players use to mediate their actions in the rhizosphere. 



Alabouvette C (1986) Fusarium wilt suppressive soils from the Chateaurenard region: 

reviews of a 10 year study. Agronomie 6:273–284 

Alexeyev MF, Shokolenko IN, Croughan TP (1995) New mini-Tn5 derivatives for insertion 

mutagenesis and genetic engineering in gram-negative bacteria. Can J Microbiol 

41:1053–1055 

Andersen JB, Sternberg C, Poulsen LK, Bjorn SP, Givskov M, Molin S (1998) New unstable 

variants of green fluorescent protein for studies of transient gene expression in 

bacteria. Appl Environ Microbiol 64:2240–2246 

Anderson M, Pollitt CE, Roberts IS, Eastgate JA (1998) Identification and characterization 

of the Erwinia amylovora rpoS gene: RpoS is not involved in induction of fireblight 

disease symptoms. J Bacteriol 180:6789–6792 

Baird GS, Zacharias DA, Tsien RY (2000) Biochemistry, mutagenesis, and oligomerization 

of DsRed, a red fluorescent protein from coral. Proc Natl Acad Sci USA 

97:11984–11989

444 


Ballance DJ, Buxton FP, Turner G (1983) Transformation of Aspergillus nidulans by the 

orotidine-5¢-phosphate decarboxylase gene of Neurospora crassa. Biochem Biophys 

Res Commun 112:284–289 

Beckman CH (1987) The nature of wilt diseases of plants. The American Phytopathological 

Society Press, Saint Paul, MN 

Bloemberg GV, O’Toole GA, Lugtenberg BJJ, Kolter R (1997) Green fluorescent protein as 

a marker for Pseudomonas spp. Appl Environ Microbiol 63:4543–4551 

Bloemberg GV,Wijfjes AH, Lamers GE, Stuurman N, Lugtenberg BJ (2000) Simultaneous 

imaging of Pseudomonas fluorescens WCS365 populations expressing three different 

autofluorescent proteins in the rhizosphere: new perspectives for studying microbial 

communities. Mol Plant-Microbe Interact 13:1170–1176 

Bochner BR (1989) Sleuthing out bacterial identities. Nature 339:157–158 

Brooke JB, Glick BS (2002) Rapidly maturing variants of the Discosoma red fluorescent 

protein (DsRed). Nat Biotechnol 20:83–87 

Brown JW, Hunt DA, Pace NR (1990) Nucleotide sequence of the 10Sa RNA gene of the 

beta-purple eubacterium Alcaligenes eutrophus. Nucleic Acids Res 18:2820 

Burlage RS, Yang ZK, Mehlhorn T (1996) A transposon for green fluorescent protein 

transcriptional fusions: application for bacterial transport experiments. Gene 

173:53–58 

Chalfie M, Tu Y, Euskirchen G, Ward WW, Prasher DC (1994) Green fluorescent protein 

as a marker for gene expression. Science 263:802–805 

Chin-A-Woeng TFC, Bloemberg GV, van der Bij AJ, van der Drift KMGM, Schripsema J, 

Kroon B, Scheffer RJ, Keel C, Bakker PAHM, Tichy HV, de Bruijn FJ, Thomas-Oates JE, 

Lugtenberg BJJ (1998) Biocontrol by phenazine-1-carboxamide-producing Pseudomonas 

chlororaphis PCL1391 of tomato root rot caused by Fusarium oxysporum f. sp. 

radicis-lycopersici. Mol Plant-Microbe Interact 11:1069–1077 

Chiu WL, Niwa Y, Zeng W, Hirano T, Kobayashi H, Sheen J (1996) Engineered GFP as a 

vital reporter in plants. Curr Biol 6:325–330 

Cody CW, Prasher DC, Westler WM, Prendergast FG, Ward WW (1993) Chemical structure 

of the hexapeptide chromophore of the Aequorea green-fluorescent protein. Biochemistry 

32:1212–1218 

Cormack BP, Valdivia RH, Falkow S (1996) FACS-optimized mutants of the green fluorescent 

protein (GFP). Gene 173:33–38 

Cowan SE, Gilbert E, Khlebnikov A, Keasling JD (2000) Dual labeling with green fluorescent 

proteins for confocal microscopy. Appl Environ Microbiol 66:413–418 

Craig NL (1989) Transposon Tn7. In: Berg DE, Howe MM (eds) Mobile DNA. American 

Society for Microbiology, Washington, pp 211–225 

Crameri A, Whitehorn EA, Tate E, Stemmer WP (1996) Improved green fluorescent protein 

by molecular evolution using DNA shuffling. Nat Biotechnol 14:315–319 

Cuppers HGAM, Oomes S, Brul S (1997) A model for the combined effects of temperature 

and salt concentration on growth rate of food spoilage molds. Appl Environ 

Microbiol 63:3764–3769 

Dandie CE, Thomas SM, McClure NC (2001) Comparison of a range of green fluorescent 

protein-tagging vectors for monitoring a microbial inoculant in soil. Lett Appl Microbiol 

32:26–30 

Daubner SC, Astorga AM, Leisman GB, Baldwin TO (1987) Yellow light emission of Vibrio 

fischeri strain Y-1: purification and characterization of the energy-accepting yellow 

fluorescent protein. Proc Natl Acad Sci USA 84:8912–8916 

de Lorenzo V, Timmis KN (1994) Analysis and construction of stable phenotypes in 

gram-negative bacteria with Tn5- and Tn10-derived minitransposons. Methods 

Enzymol 235:386–405


de Lorenzo V, Herrero M, Jakubzik U, Timmis KN (1990) Mini-Tn5 transposon derivatives 

for insertion mutagenesis, promotor probing, and chromosomal insertion of 

cloned DNA in Gram-negative Eubacteria. J Bacteriol 172:6568–6572 

Dekkers LC, Mulders IH, Phoelich CC, Chin AWT, Wijfjes AH, Lugtenberg BJ (2000) The 

sss colonization gene of the tomato-Fusarium oxysporum f. sp. radicis-lycopersici biocontrol 

strain Pseudomonas fluorescens WCS365 can improve root colonization of 

other wild-type Pseudomonas spp. bacteria. Mol Plant Microbe Interact 13:1177–1183 

Dunn AK, Handelsman J (1999) A vector for promoter trapping in Bacillus cereus.Gene 

226:297–305 

Emmert EAB, Handelsman J (1999) Biocontrol of plant disease: a (Gram-) positive perspective. 

FEMS Microbiol Lett 171:1–9 

Feucht A, Lewis PJ (2001) Improved plasmid vectors for the production of multiple fluorescent 

protein fusions in Bacillus subtilis. Gene 264:289–297 

Geels FP, Schippers G (1983) Selection of antagonistic fluorescent Pseudomonas spp. and 

their root colonization and persistence following treatment of seed potatoes. Phytopath 

Z 108:193–206 

Glandorf DCM, Sluis I, Anderson AJ, Bakker PAHM, Schippers B (1994) Agglutination, 

adherence, and root colonization by fluorescent pseudomonads.Appl Environ Microbiol 

60:1726–1733 

Gutterson N (1990) Microbial fungicides: recent approaches to elucidating mechanisms. 

Crit Rev Biotechnol 10:69–91 

Haidinger W, Szostak MP, Beisker W, Lubitz W (2001) Green fluorescent protein (GFP)dependent 

separation of bacterial ghosts from intact cells by FACS. Cytometry 

44:106–112 

Halebian S, Harris B, Finegold SM, Rolfe RD (1981) Rapid method that aids in distinguishing 

gram-positive from gram-negative anaerobic bacteria. J Clin Microbiol 

13:444–448 

Handelsman J, Raffel SJ, Mester EH, Wunderlich L, Grau CR (1999) Biological control of 

damping-off of alfalfa seedlings with Bacillus cereus UW85. Appl Environ Microbiol 

56:713–718 

Heim R, Prasher DC, Tsien RY (1994) Wavelength mutations and posttranslational 

autoxidation of green fluorescent protein. Proc Natl Acad Sci USA 91:12501–12504 

Hoffland E, Findenegg GR, Nelemans JA (1989) Solubilization of rock phosphate by rape. 

Plant Soil 113:161–165 

Inouye S, Tsuji FI (1994) Evidence for redox forms of the Aequorea green fluorescent 

protein. FEBS Lett 351:211–214 

Johnstone IL, Hughes SG, Clutterbuck AJ (1985) Cloning an Aspergillus nidulans developmental 

gene by transformation. EMBO J 4:1307–1311 

Jakobs S, Subramaniam V, Schonle A, Jovin TM, Hell SW (2000) EFGP and DsRed expressing 

cultures of Escherichia coli imaged by confocal, two-photon and fluorescence 

lifetime microscopy. FEBS Lett 479:131–135 

Karatani H,Wilson T, Hastings JW (1992) A blue fluorescent protein from a yellow-emitting 

luminous bacterium. Photochem Photobiol 55:293–299 

Keiler KC,Waller PR, Sauer RT (1996) Role of a peptide tagging system in degradation of 

proteins synthesized from damaged messenger RNA. Science 271:990–993 

King EO, Ward MK, Raney DE (1954) Two simple media for the demonstration of 

pyocyanin and fluorescein. J Lab Clin Med 44:301–307 

Kistler HC, Benny UK (1988) Genetic transformation of the fungal wilt pathogen, Fusarium 

oxysporum. Curr Genet 13:145–149 

Koch B, Jensen LE, Nybroe O (2001) A panel of Tn7-based vectors for insertion of the gfp 

marker gene or for delivery of cloned DNA into Gram-negative bacteria at a neutral 

chromosomal site. J Microbiol Methods 45:187–195

446 


Kremer RJ, Begonia MFT, Stanley L, Lanham ET (1990) Characterization of rhizobacteria 

associated with weed seedlings. Appl Environ Microbiol 56:1649–1655 

Lagopodi AL, Ram AFJ, Lamers GEM, Punt PJ, van den Hondel CAMJJ, Lugtenberg BJJ, 





Lambert B, Leyns F, Rooyen L, Gossele F, Papon Y, Swings J (1987) Rhizobacteria of maize 

and their antifungal activities. Appl Environ Microbiol 53:1866–1871 

Lambert B, Meire P, Joos H, Lens P, Swings J (1990) Fast-growing, aerobic, heterotrophic 

bacteria from the rhizosphere of young sugar beet plants. Appl Environ Microbiol 

56:3375–3381 

Lewis PJ, Errington J (1996) Use of green fluorescent protein for detection of cell-specific 

gene expression and subcellular protein localization during sporulation in Bacillus 

subtilis. Microbiology 142(Pt 4):733–740 

Lewis PJ, Marston AL (1999) GFP vectors for controlled expression and dual labelling of 

protein fusions in Bacillus subtilis. Gene 227:101–110 

Macheroux P, Schmidt KU, Steinerstauch P, Ghisla S, Colepicolo P, Buntic R, Hastings JW 

(1987) Purification of the yellow fluorescent protein from Vibrio fischeri and identity 

of the flavin chromophore. Biochem Biophys Res Commun 146:101–106 

Matthysse AG, Stretton S, Dandie C, McClure NC, Goodman AE (1996) Construction of 

GFP vectors for use in gram-negative bacteria other than Escherichia coli. FEMS 

Microbiol Lett 145:87–94 

Matz MV, Fradkov AF, Labas YA, Savitsky AP, Zaraisky AG, Markelov ML, Lukyanov SA 

(1999) Fluorescent proteins from nonbioluminescent Anthozoa species. Nat Biotechnol 

17:969–973 

Mess JJ,Wit R, Testerink CS, de Groot F, Haring MA, Cornelissen BJC (1999) Loss of avirulence 

and reduced pathogenicity of a gamma-irradiated mutant of Fusarium oxysporum 

f. sp. lycopersici. Phytopathology 89:1131–1137 

Miller DM III, Desai NS, Hardin DC, Piston DW, Patterson GH, Fleenor J, Xu S, Fire A 

(1999) Two-color GFP expression system for C. elegans. BioTechniques 26:914–916 

Miller HJ, Henken G, van Veen JA (1989) Variation and composition of bacterial populations 

in the rhizospheres of maize, wheat, and grass cultivars. Can J Microbiol 

35:656–660 

Miller HJ, Liljeroth E, Henken G, van Veen JA (1990) Fluctuations in the fluorescent 

pseudomonad and actinomycete populations of the rhizosphere and rhizoplane during 

growth of spring wheat. Can J Microbiol 36:254–258 

Miller WG, Lindow SE (1997) An improved GFP cloning cassette designed for prokaryotic 

transcriptional fusions. Gene 191:149–153 

Normander B, Hendriksen NB, Nybroe O (1999) Green fluorescent protein-marked 

Pseudomonas fluorescens: localization, viability, and activity in the natural barley rhizosphere. 


Oakley BR, Rinehart JE, Mitchell BL, Oakley CE, Carmona C, Gray GL, May GS (1987) 

Cloning, mapping and molecular analysis of the pyrG (orotidine-5¢- phosphate decarboxylase) 

gene of Aspergillus nidulans. Gene 61:385–399 

Osmani SA, May GS, Morris NR (1987) Regulation of the mRNA levels of nimA,a gene 

required for the G2-M transition in Aspergillus nidulans. J Cell Biol 104:1495–1504 

Pusey PL (1999) Use of Bacillus subtilis and related organisms as biofungicides. Pestic 

Sci 27:133–140 

Pusey PL, Wilson CL (1984) Postharvest biological control of stone fruit brown rot by 

Bacillus subtilis. Plant Dis 68:753–756 

Scher FM, Baker R (1980) Mechanism of biological control in a fusarium-suppressive 

soil. Phytopathology 72:1567–1573


Silo-suh LA, Lethbridge BJ, Raffel SJ, He H, Clardy J, Handelsman J (1994) Biological 

activities of two fungistatic antibiotics produced by Bacillus cereus UW85. Appl Environ 

Microbiol 60:2023–2030 

Simons M, van der Bij AJ, Brand J, de Weger LA, Wijffelman CA, Lugtenberg BJJ (1996) 



Steidle A, Sigl K, Schuhegger R, Ihring A, Schmid M, Gantner S, Stoffels M, Riedel K, 

Givskov M, Hartmann A, Langebartels C, Eberl L (2001) Visualization of N-acylhomoserine 

lactone-mediated cell-cell communication between bacteria colonizing the 

tomato rhizosphere. Appl Environ Microbiol 67:5761–5770 

Stretton S, Techkarnjanaruk S, McLennan AM, Goodman AE (1998) Use of green fluorescent 

protein to tag and investigate gene expression in marine bacteria. Appl Environ 

Microbiol 64:2554–2559 

Stutz EW, Defago G, Kern H (1986) Naturally occurring fluorescent pseudomonads 

involved in the suppression of black root rot of tobacco. Phytopathology 76:181–185 

Stuurman N, Bras CP, Schlaman HR, Wijfjes AH, Bloemberg G, Spaink HP (2000) Use of 

green fluorescent protein color variants expressed on stable broad-host-range vectors 

to visualize rhizobia interacting with plants. Mol Plant Microbe Interact 13:1163–1169 

Suarez A, Guttler A, Stratz M, Staendner LH, Timmis KN, Guzman CA (1997) Green fluorescent 

protein-based reporter systems for genetic analysis of bacteria including 

monocopy applications. Gene 196:69–74 

Tilburn J, Scazzocchio C, Taylor GG, Zabicky-Zissman JH, Lockington RA, Davies RW 

(1983) Transformation by integration in Aspergillus nidulans. Gene 26:205–221 

Tombolini R, Unge A, Davey ME, deBruijn FJ, Jansson JK (1997) Flow cytometric and 

microscopic analysis of GFP-tagged Pseudomonas fluorescens bacteria. FEMS Microbiol 

Ecol 22:17–28 

Tombolini R, van der Gaag DJ, Gerhardson B, Jansson JK (1999) Colonization pattern of 

the biocontrol strain Pseudomonas chlororaphis MA 342 on barley seeds visualized by 

using green fluorescent protein. Appl Environ Microbiol 65:3674–3680 

Tyagi JS, Kinger AK (1992) Identification of the 10Sa RNA structural gene of Mycobacterium 

tuberculosis. Nucleic Acids Res 20:138 

Unge A, Tombolini R, Davey ME, de Bruijn FJ, Jansson JK (1998) GFP as a marker gene. 

In: Akkermans AD, van Elsas JD, de Bruijn FJ (eds) Molecular microbial ecology manual. 

Kluwer, Dordrecht, pp 1–16 

Unge A, Tombolini R, Molbak L, Jansson JK (1999) Simultaneous monitoring of cell 

number and metabolic activity of specific bacterial populations with a dual gfpluxAB 

marker system. Appl Environ Microbiol 65:813–821 

Ushida C, Himeno H, Watanabe T, Muto A (1994) tRNA-like structures in 10Sa RNAs of 

Mycoplasma capricolum and Bacillus subtilis. Nucleic Acids Res 22:3392–3396 

Valdivia RH, Falkow S (1996) Bacterial genetics by flow cytometry: rapid isolation of Salmonella 

typhimurium acid-inducible promoters by differential fluorescence induction. 

Mol Microbiol 22:367–378 

Valdivia RH, Hromockyj AE, Monack D, Ramakrishnan L, Falkow S (1996) Applications 

for green fluorescent protein (GFP) in the study of host–pathogen interactions. Gene 

173:47–52 

Vaneechoutte M, Boerlin P, Tichy HV, Bannerman E, Jager B, Bille J (1998) Comparison of 

PCR-based DNA fingerprinting techniques for the identification of Listeria species 

and their use for atypical Listeria isolates. Int J Syst Bacteriol 48:127–139 

Ward DM (1989) Molecular probes for analysis of microbial communities. In: Characklis 

WG, Wilderer PA (eds) Structure and function of biofilms. Wiley, New York, pp 

145–155

448 


Waterhouse RN, Buhariwalla H, Bourn D, Rattray EAS, Glover LA (1996) CCD detection 

of lux-marked Pseudomonas syringae pv. phaseolicola forms associated with Chinesecabbage 

and the resulting disease protection against Xanthomonas campestris. Lett 

Appl Microbiol 22:262–266 

Weller DM, Cook RJ (1983) Suppression of take-all of wheat by seed treatments with fluorescent 

pseudomonads. Phytopathology 73:463–469 

Weller DM, Zhang BX, Cook RJ (1985) Application of a rapid screening test for selection 

of bacteria suppressive to take-all of wheat. Plant Dis 69:710–713 

Williams JG, Kubelik AR, Livak KJ, Rafalski JA, Tingey SV (1990) DNA polymorphisms 

amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res 

18:6531–6535 

Yang TT, Kain SR, Kitts P, Kondepudi A,Yang MM,Youvan DC (1996a) Dual color microscopic 

imagery of cells expressing the green fluorescent protein and a red-shifted 

variant. Gene 173:19–23 

Yang TT, Cheng L, Kain SR (1996b) Optimized codon usage and chromophore mutations 

provide enhanced sensitivity with the green fluorescent protein. Nucleic Acids Res 

24:4592–4593 

Yang TT, Sinai P, Green G, Kitts PA, Chen YT, Lybarger L, Chervenak R, Patterson GH, Piston 

DW, Kain SR (1998) Improved fluorescence and dual color detection with 

enhanced blue and green variants of the green fluorescent protein. J Biol Chem 

273:8212–8216 

Yelton MM, Hamer JE, Timberlake WE (1984) Transformation of Aspergillus nidulans by 

using a trpC plasmid. Proc Natl Acad Sci USA 81:1470–1474

24 Microbial Community Analysis in the 

Rhizosphere by in Situ and ex Situ Application of 

Molecular Probing, Biomarker and Cultivation 

Techniques 

Anton Hartmann, Rüdiger Pukall, Michael Rothballer, 

Stephan Gantner, Sigrun Metz, Michael Schloter 

and Bernhard Mogge 


It is well known that the bacterial diversity in soil habitats is much greater 

compared to the artificial cultivation techniques (Torsvik et al. 1996; 

Chatzinotas et al. 1998). It is generally accepted that only a combination of 

methods including cultivation and several cultivation-independent techniques 

is able to provide a more representative picture of the microbial diversity 

in environmental habitats (Wagner et al. 1993; Liesack et al. 1997). This is 

also true for the plant/soil compartment, although the degree of culturability 

is thought to be higher on the root surface. Supposedly, rhizosphere microbes 

respond to the presence of easily consumable substrates on the root surface 

with fast growth rates, which is indicative for r-strategy; successful colonization 

of the rhizosphere is the final result of this behavior. 

In-depth characterization of bacterial communities residing in environmental 

habitats has been greatly stimulated by the application of molecular 

phylogenetic tools, such as 16S ribosomal RNA-directed oligonucleotide 

probes derived from extensive 16S rDNA sequence analysis. These phylogenetic 

probes can be successfully applied in diverse microbial habitats using 

the fluorescence in situ hybridization (FISH) technique (Giovannoni et al. 

1988; Amann et al. 1995; Tas and Lindström 2001). In addition, the application 

of the immunofluorescence techniques to detect specific subpopulations of 

enzymes and of fluorescence marker-tagged bacteria or reporter constructs 

enables a highly resolving population and functional analysis (Hartmann et 

al. 1997; Unge et al. 1999). Phylogenetic in situ studies of the population structure 

can thus be supplemented with functional or phenotypic in situ investigation 

approaches. 




450 

Anton Hartmann et al. 

The rhizosphere is defined as the soil compartment which is greatly influenced 

by plant roots (Campbell and Greaves 1990a). The rhizosphere microbial 

community is shaped by the effect of root exudates (Brimecomb et al. 

2001). Several methodological approaches are available to study the rhizosphere 

carbon flow and the microbial population dynamics induced by rootborn 

carbon sources (Morgan and Whipps 2001). In addition, multiple communicative 

links exist between the rhizosphere microflora and the roots on 

the basis of highly specific organic signals (Werner 2001). It is appropriate to 

distinguish the root itself (with the endorhizosphere and the root surface, the 

rhizoplane) from the soil compartment surrounding the root (bulk soil and 

ectorhizosphere). In the following sections, two experimental approaches to 

investigate root-associated bacterial communities are presented. Figure 1 

provides a flow diagram of the separation of the rhizosphere compartments 

and the various in situ and ex situ methods applied. On one hand, population 

and functional studies can be conducted directly in the rhizoplane (in situ) by 

combining specific fluorescence probing with confocal laser scanning microscopy 

yielding detailed information about the localization and small scale 

distribution of bacterial cells and their activities on the root surface (Sect. 2). 

On the other hand, the separated rhizosphere compartments and the bacteria 

extracted from these different compartments allow a variety of subsequent ex 

situ-studies (Sect. 3). Studies, such as cultivation of bacteria on plates and 

microscopic counting of bacteria on filters after FISH analysis provide quan- 

Plants 

Roots with 

adhering soil 

Shaking, 

washing 

Root free soil 

(Compartment I) 

Ectorhizosphere soil 

(Compartment II) 

Roots: Rhizoplane 

and endorhizosphere 

(Compartment III) 

ISS ESS 

Fixation Extraction 

In situ-studies (ISS): 

FISH, Immunolabeling, monitoring 

of fluorescence tagged bacteria and 

constructs 

ISS ESS 

Ex situ-studies (ESS): 

DNA-extraction, PCR-amplification of 

phylogenetic marker regions / TGGE 

PLFA-biomarker,CSLP-techniques 

Fig. 1. Flow diagram of separation of rhizosphere compartments and overview of in situ 

and ex situ analyses using molecular probing, biomarker and cultivation techniques

titative data about the community composition. In addition, the bacterial 

diversity can be investigated using PCR-amplification of phylogenetic marker 

genes combined with subsequent electrophoretic fingerprint analysis or 

cloning and sequencing studies. These approaches can be supplemented by a 

general microbial structural and functional diversity analysis using community 

phospholipid fatty acid and substrate utilization pattern analysis, respectively. 

2 In Situ Studies of Microbial Communities Using Specific 

Fluorescence Labeling and Confocal Laser Scanning 

Microscopy 

A detailed understanding of the ecology of bacterial populations requires in 

situ information about the localization of the colonization sites at specific 

areas on root surfaces and also about neighboring populations. Therefore, 

true in situ studies need to be performed and these must include an identification 

of the bacteria on a phylogenetic level and also information about their 

in situ activity. Since soil and plant surfaces are very complex in microstructure 

and optical appearance, special microscopic techniques have to be 

applied. Confocal laser scanning microscopy enables us to circumvent to a 

great degree disturbing autofluorescence from out-of-focus-planes by performing 

optical sections (xy and xz scans) through the sample (Hartmann et 

al. 1998). It has been demonstrated that CSLM studies combined with the 

application of specific fluorescent probes considerably improve microbial 

ecology studies in the rhizosphere (Schloter et al. 1993; Aßmus et al. 1995). 

The confocal pinhole cuts off all out-of-focus fluorescence to reach the amplifiers. 

The application of several lasers with different excitation wavelengths in 

combination with differently fluoro-labeled probes allow the simultaneous 

analysis of different populations and/or activities (Amann et al. 1995; Stoffels 

et al. 2001). If possible, nested approaches with overlapping probe specificities 

should be used to improve the fidelity of the in situ identification, e.g., by fluorescence 

in situ hybridization. In addition, the use of the green fluorescent 

protein (GFP) as a structural and functional autofluorescence marker has 

successfully lightened up the biology and ecology of diverse biota, including 

bacteria, fungi, protozoa and plants (Lorang et al. 2001). 

2.1 Fluorescence in Situ Hybridization 

24 Microbial Community Analysis in the Rhizosphere 451 

Root samples are fixed overnight at 4 °C in 3 % paraformaldehyde containing 

PBS (phosphate-buffered saline, composed of 0.13 M NaCl, 7 mM Na 2HPO 4 

and 3 mM NaH 2 PO 4 [pH 7.2]). Root pieces are washed in PBS, mixed with 

0.3 % agarose, dropped onto glass slides and dried at room temperature.

452 

Table 1. Phylogenetic oligonucleotide probes for fluorescence in situ hybridization (FISH) and dot blot hybridization 

Probe Probe sequence (5¢–3¢) Target site, rRNA position a Specificity Reference 


EUB338 GCTGCCTCCCGTAGGAGT 16S rRNA, 338–355 Bacteria Amann et al. (1990) 

EUB788b CTACCAGGGTATCTAATCC 16S rRNA, 785–803 Bacteria Lee et al. (1993) 

EUB927b ACCGCTTGTGCGGGCCC 16S rRNA, 927–942 Bacteria Giovannoni et al. (1988) 

EUB1055b CACGAGCTGACGACAGCCAT 16S rRNA, 1055–1074 Bacteria Lee et al. (1993) 

EUB1088b GCTCGTTGCGGGACTTAACC 16S rRNA, 1088–1107 Bacteria Lee et al. (1993) 

ALF1b CGTTCG(C/T)TCTGAGCCAG 16S rRNA, 19–35 Alpha subclass of Proteobacteria Manz et al. (1992) 

BET42ac GCCTTCCCACTTCGTTT 23S rRNA, 1027–1043 Beta subclass of Proteobacteria Manz et al. (1992) 

CF319a TGGTCCGTGTCTCAGTAC 16 SrRNA, 319–336 Cytophaga-Flavobacterium cluster Manz et al. (1996) 

GAM42ac GCCTTCCCACATCGTTT 23S rRNA, 1027–1043 Gamma subclass of Proteobacteria Manz et al. (1992) 

Rhi1247 TCGCTGCCCACTGTC 16S rRNA, 1247–1261 Rhizobium, Ochrobactrum Ludwig et al. (1998) 

GPd TCATCATGCCCCTTATG 16S rRNA, 1199–1215 Gram-positive bacteria Rheims et al. (1996) 

HMd CCCTGAGTTATTCCGAAC 16S rRNA, 142–159 Hyphomicrobium, methylotrophs Tsien et al. (1990) 

PLAd GGC(GA)TGGATTAGGCATGC 16S rRNA, 41–58 Planctomycetaceae Liesack and Stackebrandt 

(1992) 

PS-MGd CCTTCCTCCCAACTT 16S rRNA, 440–454 Pseudomonas aeruginosa Braun-Howland et al. 

(1993) 

a E. coli numbering, Brosius et al. (1981) 

b Used in combination with probe EUB338 and three other domain-specific probes for quantification of bacterial cells on filters (EUB-MIX) 

c Used with an equimolar amount of unlabeled competitor oligonucleotide GAM42a or BET42a, respectively 

d Used for dot blot hybridization only


These glass slides are immersed in 50, 80 and 96 % ethanol for 3 min each and 

stored at room temperature. Oligonucleotide probes (Table 1) labeled with 

Cy3, Cy5 or 5(6)-carboxyfluorescein-N-hydroxysuccinimide ester (FLUOS) at 

the 5¢¢-end are used. The oligonucleotides are stored in distilled water at a 

concentration of 50 ng/ml (Amann et al. 1990). 

FISH was performed as described in detail, e.g., by Wagner et al. (1993) at 

46 °C for 90 min in hybridization buffer (20 mM Tris-HCl, pH 7.2, 0.01 % SDS 

and 5 mM EDTA) containing 0.9 M NaCl and formamide at the percentages 

shown in Table 1. Hybridization was followed by a stringent washing step at 

48 °C for 15 min. The washing buffer was removed by rinsing the slides with 

distilled water. Counterstaining with DAPI and mounting in Citifluor AF1 

(Citifluor Ltd., London, UK) was performed as described previously (Aßmus 

et al. 1995). 

The microscopic in situ analysis can be performed using an LSM 410 or 

LSM 510 inverted confocal laser scanning microscope (Zeiss, Jena, Germany), 

equipped with two lasers (Ar-ion UV; Ar-ion visible; HeNe) supplying excitation 

wavelengths at 365, 488, 543 and 633 nm, respectively. Sequentially 

recorded images are assigned to the respective fluorescence color and then 

merged into a true color display. All image combining and processing is performed 

with the standard software provided by Zeiss. 

Using the general cell/DNA staining with DAPI and FISH with probes specific 

for the domain bacteria and group-specific probes (Table 1),bacteria can simultaneously 

be localized and identified at the rhizoplane.In addition to the groupspecific 

probes, in situ binding genus- and species-specific oligonucleotide 

probes are available for a number of root-associated and symbiotic bacteria 

(Ludwig et al. 1998; Hartmann et al. 2000). Figure 2A shows the localization of 

Azospirillum brasilense in the wheat rhizosphere by FISH (combination of two 

differently labeled oligonucleotide probes Eub338-Cy3 and Abras1420-Cy5) 

and CSLM. The application software “orthogonal view” of the LSM 510 (Zeiss, 

Germany) allows the display of optical cuts through the sample in xz and yz sections 

(Fig.2B).The localization within the tissue is clearly visible. 

2.2 Immunofluorescence Labeling Combined with Fluorescence in Situ 

Hybridization 

The combination of FISH, which allows a phylogenetic identification of bacteria 

from the phylum down to the species level, with immunological 

approaches extends the in situ identification to the individual strain level, if 

strain-specific antisera or special monoclonal antibodies are applied. Antibodies 

directed against bacterial surface antigens can be created by using, 

e.g., UV-inactivated bacteria as antigens (Schloter et al. 1995; Hartmann et al. 

1997). In addition, antibodies can also be created to identify specific enzymes, 

e.g., denitrifying enzymes (Bothe et al. 2000) and thus add a phenotypic or

454 


B 

D


expression level approach to organismic identification.As a basic protocol for 

combining FISH with immunofluorescence labeling, the procedure in Aßmus 

et al. (1997) can be used with some modifications in specific cases. 

After fixation of the sample and FISH analysis (see Sect. 2.1), the immunolabeling 

is performed with solutions containing 0.9 M NaCl. The presence of 

NaCl is necessary for the stability of the rRNA-oligonucleotide probe complex 

(Metz 2002). In addition, all incubation steps are performed at 4 °C. As usual, 

the immunolabeling procedure starts with a 1-h incubation of the slides carrying 

the samples with 3 % BSA (Frac. V) in 1/10 PBS+0.9 M NaCl to block 

unspecific binding of the antibody. After rinsing in washing solution (0.5 % 

BSA, 0.5 % Tween 80, 1/10 PBS, 0.9 M NaCl), the slides are incubated for 2.5 h 

at 4 °C with the specific antibody to be applied. After two washing steps, the 

second antibody (e.g., antimouse-FLUOS-Fab-Fragment) is applied at 4 °C for 

1.5 h. After washing, the slides are mounted in Citifluor AF1 (Citifluor Ltd., 

London, UK). It has to be noted that not all monoclonal antibodies or polyclonal 

antisera are applicable to this protocol, because the antigen–antibody 

complex may not be stable at 0.9 M NaCl. Alternatively, the original protocol 

of Aßmus et al. (1997) can be applied, using the antibody treatment first and 

the fixation and FISH analysis second. Using this approach, strain-specific 

monoclonal antibodies against a specific Azospirillum brasilense strain were 

applied in situ together with the FISH analysis (Aßmus et al. 1997). Thus, the 

Fig. 2. In situ identification of bacteria in the rhizosphere using fluorescence-labeling 

techniques and CLSM. A Rhizosphere of wheat (Brazilian cultivar PF839197) inoculated 

with Azospirillum brasilense strain Sp245 (rgb-laser scanning image). Roots of inoculated, 

soil-grown wheat plants were harvested 4 weeks after inoculation. After thorough 

washing in PBS, the root was cut manually, fixation by heat was performed for 30 min at 

70 °C and fixation in 3 % paraformaldehyde was done for 2 h at room temperature. Fluorescence 

in situ hybridization (FISH) was performed using 45 % formamide and the 

probes Eub338Mix-Cy3 and Abras1420-Cy5. A. brasilense Sp245 cells appear violet, 

because they bind two probes (red and blue emission color code) simultaneously. Plant 

cell walls have a different emission light, giving a green color code. B Same picture as A, 

but in the “orthogonal view”, providing insight into optical sections of the sample; zscan 

density: 21 mm. C In situ localization of GFP-labeled Serratia liquefaciens MG44 on 

root hairs of tomato plants. Using 488-nm excitation wavelength, the GFP-labeled bacteria 

are clearly visible in the bright field picture. D Laser scanning microscopic picture of 

the same sample as C, but here two excitation wavelengths (488 and 560 nm) were used 

simultaneously, making the RFP-labeled Pseudomonas putida IsoF also visible. E Laser 

scanning microscopic picture of bacteria extracted from roots of Medicago sativa,inoculated 

with Sinorhizobium meliloti L33. The bacteria were treated as described and 

finally concentrated on polycarbonate filters. The fluorescence-labeled probes 

EuB338Mix-FLUOS and Rhi1247-TRITC were used in FISH analysis. Active bacteria 

with high ribosome content were labeled green (green arrow), while Rhizobia – obviously 

bacteroids released from nodules – appear yellow (yellow arrow), binding both 

probes simultaneously

456 


root surface colonization by a particular bacterial strain could be investigated 

in a background of other members of this species, identified by using rRNAtargeting 

probes and FISH. 

2.3 Application of Fluorescence Tagging and Reporter Constructs 

The fate of particular bacterial inocula in the rhizosphere can also be monitored 

using molecular-tagged bacteria. In addition to the use of the visually 

detectable lux- and gus-markers (Lux: luciferase, Gus: b-glucuronidase), the 

exploitation of the green fluorescent protein (GFP) from the jellyfish 

Aequorea victoria has brought further progress into the field. GFP is a protein 

that contains a fluorescent cyclic tripeptide sequence. It requires only molecular 

oxygen for fluorescence, which means that GFP will fluoresce in virtually 

any aerobic organism (Lorang et al. 2001). Therefore, GFP-labeled bacteria 

can be observed by CLSM or by regular fluorescence microscopy. Figure 2C, D 

shows a localization of GFP-labeled Serratia liquefaciens MG44 in the rhizoplane 

of tomato. Furthermore, the application of DsRed from Discosoma sp. 

provides a red fluorescing molecular marker (Christensen et al. 1999; Tolker- 

Nielsen et al. 2000). In addition, a mutated form of GFP (ASV) with a short 

half-life enables real-time in situ expression studies (Andersen et al. 1998; 

Ramos et al. 2000). 

The application of GFP-labeling in expression studies using promotor-gfp 

fusions and GFP fusion proteins has revolutionized the in situ activity studies, 

because of the relative ease of recording the fluorescence microscopically. 

The bacteria carrying the gene constructs either on a plasmid or integrated 

into the chromosome are applied to sense or report conditions in the microhabitat 

they have been introduced. As in the case of simple tagging of organisms, 

not only lux- and gus-reporter (Kragelund et al. 1997) were used, but 

also constructs using the ice-nucleation gene (Loper and Henkels 1997), or 

the ferrichrom iron receptor (FhuA; Stubner et al. 1994). These constructs 

allowed the in situ sensing of N-, P- and C-starvation response (Kragelund et 

al. 1997; Koch et al. 2001), expression of nitrogen fixation genes (Egener et al. 

1999), presence of oxygen (Hojberg et al. 1999), availability of iron (Loper and 

Henkels 1997) general activity and cell number (Unge et al. 1999), genotoxic 

effects (Stubner et al. 1994) or the presence of quorum-sensing signal molecules 

of the N-acylhomoserine lactone type (Steidle et al. 2001). Figure 2C 

provides an example of in situ localization of GFP-labeled Serratia liquefaciens 

MG44 on root hairs in the rhizosphere of tomato as a bright field picture 

with 488-nm excitation wavelength, while Fig. 2D shows the same sample as 

CLSM-picture with two excitation wavelengths (560 and 488 nm) making the 

RFP-labeled Pseudomonas putida isoF also visible. 

In some of these studies, bacterial cells with reporter constructs need to 

be extracted from the habitat for analysis (Koch et al. 2001). Although these


reporter cells monitor in situ conditions, the tests are performed ex situ. For 

this purpose, a separation of the bacteria from the soil was accomplished by 

applying formaldehyde (1 %)-fixed extracts to density gradient centrifugation 

with Nycodenz (Nycomed Pharma, Oslo, Norway) with a density of 

1.3 g/ml. After a centrifugation step (10,000xg, 30 min, 4 °C) the bacteria on 

the top of the Nycodenz layer were used for further analysis (Unge et al. 

1999). 

Monitoring of in situ bacterial growth activity in the plant rhizosphere is 

suggested by Ramos et al. (2001) using ribosome content and synthesis rate 

measurements. 

3 Ex Situ Studies of Microbial Communities After 

Separation of Rhizosphere Compartments 

For the desorption of bacteria from surfaces, Campbell and Greaves (1990b) 

recommended the use of a stomacher. Sodium cholate and the ion exchange 

resin beads Dowex A1 or Chelex 100 were recommended for the treatment of 

soil particles or root pieces by Macdonald (1986) or Hopkins et al. (1991), 

respectively, to obtain the bacteria adsorbed. Herron and Wellington (1990) 

developed a method to extract streptomycete spores from soil particles and 

used polyethylene glycol (PEG) 6000 for reducing hydrophobic interactions. 

Each extraction protocol for root-associated bacteria has to be optimized for 

the system under investigation with the appropriate controls to prove its success. 

Mogge et al. (2000) described a standardized protocol for the differentiation 

of the rhizosphere compartments ectorhizosphere and rhizoplane/ 

endorhizosphere and the extraction of the adsorbed bacteria from the rhizoplane 

of Medicago sativa europae. This procedure used the recommendations 

by Macdonald (1986) and Herron and Wellington (1990) in a modified form. 

FISH in combination with CLSM was applied for the proof of desorption efficiency 

in root surface studies. 

3.1 Recovery of Bacteria from Bulk Soil, Ecto- and Endorhizosphere 

Roots are carefully separated from the soil using sterile tweezers. The soil 

should be rather dry at the time of harvest to facilitate the separation of roots 

from the adhering soil. All steps are conducted with sterile solutions on ice. 

Bulk soil (compartment I) and root-attached soil particles which have been 

collected by shaking the roots (ectorhizosphere: compartment II) are suspended 

1:9 (w/v) in 0.01 M phosphate buffer (Na 2HPO 4/KH 2PO 4, pH 7.4) and 

dispersed for 1 min at the highest speed in a Stomacher 80 (Seward Medical, 

UK). To extract rhizoplane and endorhizosphere bacteria (compartment III), 

1 g (fresh weight) of roots that have been cleaned from adhering soil particles

458 


(see above) and washed in phosphate buffer is suspended in 20 ml 0.1 % 

sodium-cholate buffer (Macdonald 1986). The suspension is treated in a 

Stomacher 80 at the highest speed for 4 min to disrupt polymers. After transfer 

into Erlenmeyer flasks, 0.5 g of polyethylene glycol 6000 (Sigma, Deisenhofen) 

and 0.4 g of cation change polystyrene beads (chelex 100: Sigma, 

Deisenhofen) are added and the suspension is stirred at 50 rpm/min for 1 h at 

4 °C. The stomacher/stirring procedure is repeated three times, whereby the 

roots are transferred to “fresh” 0.1 % sodium cholate buffer with PEG 6000 

and chelex 100 after each extraction step (compartment IIIa-c). Finally, 

aliquots of the obtained suspensions are combined. Root and soil particles are 

removed by filtration through gauze (40-mm mesh width) and subsequent filtration 

through 5-mm syringe filters (Sartorius No. 17549, Göttingen, Germany). 

In the case of Medicago sativa grown in sandy loam, this approach yielded 

total counts of 3.3x10 9 to 6.5x10 8 /g root dry weight from the first to the third 

treatment, while hybridizing bacteria remained constant at 1.5x10 8 /g root dry 

weight (Mogge et al. 2000). It was calculated that about 88 % of the bacteria 

had been desorbed from the rhizoplane by this technique. This result was confirmed 

by in situ studies of roots applying confocal laser scanning 

microscopy. The roots usually harbor large numbers of phylogenetically different 

bacteria, belonging, e.g., to the a-, b- and g-subclasses of proteobacteria. 

However, after the third extraction step, no bacteria could be detected any 

more on the root surface (20 root pieces of 2–3 cm length were scanned). 

The suspensions obtained from bulk soil (I), ectorhizosphere (II), and rhizoplane/endorhizosphere 

(IIIa-c: merged suspension) can be used for cultivation 

and dot blot-hybridizations (see Sect. 3.2). DAPI-staining and FISH can 

be applied for counting total and hybridizing bacteria in the three compartments 

collected on polycarbonate filters (see Sect. 3.3). PCR-amplification of 

16S rDNA and subsequent electrophoretic fingerprinting of the amplification 

products as well as clone bank studies can be performed with these fractions 

too (see Sect. 3.4). In addition, these compartments can be investigated for 

structural and functional microbial diversity by community fatty acid analysis 

and community level physiological profiling (see Sect. 3.5). 

3.2 Community Analysis by Cultivation and Dot Blot Studies 

Serial dilutions (0.85 % NaCl) from bulk soil (compartment I), ectorhizosphere 

(compartment II), and rhizoplane/endorhizosphere (compartment III) 

suspensions (Fig. 1) were plated onto agar media containing different nutritional 

levels (Table 2). The selection of media used for the isolation of soil and 

ectorhizosphere-associated bacteria was made to allow the growth of oligotrophic, 

slow growing strains as well as fast growers. Minimal media were 

suggested because of the sensitivity of soil bacteria to salts (NaCl) or organic


compounds (yeast extracts, casamino acids) as described by Hattori and Hattori 

(1980). On the other hand, depending on the lower growth rate and a 

longer incubation period, exuberant growth of the fast growers was reduced, 

giving the slow growing strains a chance to develop (Gorlach et al. 1994; Mitsui 

et al. 1997). In addition, minimal media like M9, were supplemented with 

compounds described as root exudates, and with soil or root extracts 

(Table 2). Plates were incubated at 20 °C for up to 4 weeks. Cell and colony 

morphology was recorded and Gram-test, oxidase and catalase tests performed 

according to Gerhardt et al. (1994). Genomic DNA of these isolates 

was extracted and purified as described previously (Pukall et al. 1998). The 

primer pair 27f and 1500r can be used for the amplification of the almost 

complete 16S rRNA gene of the bacterial isolates (Lane 1991). PCR-amplification 

of a part of the 23S rDNA was performed using the primer pair 2053r and 

990 f. 

Using this approach, about 70 % of the bacterial isolates from bulk soil and 

ectorhizosphere were identified as Gram-positive bacteria using the oligonucleotide 

GP (Rheims et al. 1996), whereas their numbers were reduced to 17 % 

in the rhizoplane/endorhizosphere compartment of Medicago sativa (Mogge 

et al. 2000). A similar result was obtained by Lilley et al. (1996) and Mahaffee 

and Kloepper (1997). On the other hand, the numbers of isolates belonging to 

the a-, b-, and g-subclasses of proteobacteria were increased in the rhizoplane 

Table 2. Composition of media used to retrieve bacteria from bulk soil, ectorhizosphere 

and rhizoplane/endorhizosphere samples 

Medium Company or reference 

King’s B agar; R2A agar; Actinomycete isolation Difco 

agar; nutrient agar 

CASO agar Merck 

Yeast extract mannitol agar Dunger and Fiedler (1997) 

Starch agar with and without root extract Dunger and Fiedler (1997) 

Cellulose agar supplemented with soil extract Stotzky et al. (1993) 

Planctomyces isolation agar(+N-acetylglucosamin) Schlesner (1994) 

Hyphomicrobium isolation agar Moore and Marshall (1981) 

Caulobacter isolation agar Poindexter (1964) 

Glucose-yeast extract malt agar (GYM) Shirling and Gottlieb (1966) 

M9 minimal medium a (+ carbon source b / Sambrook et al. (1989, modified) 

+ trace elements c ) 

a Composed of Na2 HPO 4 10.2, KH 2 PO 4 3.0, NaCl 0.6, and NH 4 Cl 1.2 g/l 

b 5 g/l carbohydrates (glucose, glucose and vitamin solution No.6 (Staley 1968), fructose, 

sucrose, arabinose) or 2 g/l organic acids (fumaric acid, oxal acetic acid) 

c 1 ml of sterile filtered trace element stock solution composed of CaCl2 x6 H 2 O 2.7 g, 

MgSO 4 x7 H 2 O 15 g, FeCl 3 0.02 g/l

460 


to 13, 26 and 35 % as compared to 4.2, 8.5 and 0.8 % respectively in the ectorhizosphere 

as was shown by using the probes ALF1b, BET42a and GAM42 

respectively to group the isolates obtained. No differences were found for isolates 

of the Cytophaga-Flavobacteria group, which were only a minor portion 

in both compartments (3.5 %). 

Quantitative population analyses in soil and rhizosphere environments 

were also conducted by using strains carrying unique selectable markers. This 

was aimed to enumerate one particular introduced strain in the presence of a 

large excess of other microbes. Since the usually suitable selectable markers 

are missing in wild-type strains, spontaneous or transposon-induced 

mutants, which are, e.g., resistant to an antibiotic, are frequently used for 

selective plating assays. However, these mutants may be less fit than the wild 

type and, therefore, the results of the surveys are biased. De Leij et al. (1998) 

demonstrated such effects on environmental fitness in several mutants of 

Pseudomonas fluorescens SBW25, constructed by site-directed genomic insertions 

of marker genes. Recently, Hirano et al. (2001) selected a site in the gacScysM 

intergenic region in Pseudomonas syringae pv. syringae B728, in which 

the insertion of an antibiotic resistance marker cassette did not affect the fitness 

of the bacterium in the field. They concluded that carefully selected 

intergenic regions, which are suitable for the integration of specific marker 

cassettes, exist in any bacterium. 

3.3 Community Analysis by Fluorescence in Situ Hybridization on 

Polycarbonate Filters 

Bacterial suspensions (extract of the rhizosphere compartments, Fig. 1) are 

fixed overnight at 4 °C with 3 % formaldehyde and concentrated in three parallels 

onto 0.2-mm polycarbonate filters (100-ml aliquots). Dehydration of cells 

is performed with 50, 80 and 96 % ethanol for 3 min each. For details on the 

FISH protocol see Sect. 2.1. The slides are finally mounted with Citifluor AF1 

to reduce photobleaching. A Zeiss Axiophot 2 epifluorescence microscope 

(Zeiss, Jena, Germany) equipped with filter sets F31–000, F41–001 and 

F41–007 (Chroma Tech. Corp., Battleboro, VT, USA) can be used for the enumeration 

of bacteria on filters. Total cell counts (DAPI) and hybridizing bacteria 

using a set of domain-specific probes (Table 1) are determined by evaluating 

at least 10 microscopic fields with 20–100 cells per field. 

In the case of the M. sativa roots, the extraction method was also applied to 

the rhizoplane/endorhizosphere of roots inoculated with Sinorhizobium 

meliloti as well as to inoculated roots after the nodules had been removed 

with a sterile scalpel. During the three repeated stomacher/stirring-treatments, 

nodules cracked and S. meliloti-bacteroids were released (Mogge et al. 

2000). Figure 2E shows a representative photomicrograph of bacteria concentrated 

on polycarbonate filters after extraction of roots with nodules. Large


(up to 10-mm long) pleomorphic cells hybridized with a set of FLUOS-labeled 

oligonucleotide probes directed against the domain Bacteria and the TRITClabeled 

oligonucleotide probe Rhi1247 directed against Rhizobium (Table 1). 

Obviously, these large cells were bacteroids originating from crushed nodules 

and were missing when the nodules had been removed before the application 

of the extraction procedure. 

3.4 Community Analysis by (RT) PCR-Amplification of Phylogenetic 

Marker Genes, D/TGGE-Fingerprinting and Clone Bank Studies 

The differentiated rhizosphere compartments can also be used to isolate 

rRNA and genomic DNA following previously described protocols (Felske et 

al. 1996; Miethling et al. 2000).A further purification of the DNA extracts, e.g., 

with the Wizard DNA clean-up (Promega, Madison, WI), may be necessary, 

before PCR can be applied. For amplification, the highly conserved bacterial 

16S rRNA primers U968-GC and L1346 are used.Amplification of 16S rDNA is 

performed as described by Felske et al. (1996) using the following PCR-program: 

1 cycle at 94 °C for 5 min, 35 cycles at 94 °C for 90 s (denaturation), 61 °C 

for 40 s (annealing), 70 °C for 40 s (extension), and a single final extension at 

70 °C for 5 min. Amplification of 16S rRNA as well as denaturing temperature 

gradient gel electrophoretic (D/TGGE) separation of the PCR-products of 

DNA and RNA is performed as described by Miethling et al. (2000). 

D/TGGE profiles represent the frequency distribution of PCR-amplified 

segments of rDNA or rRNA separated due to their melting behavior in the 

electric field of a temperature gradient gel. The resulting profiles represent the 

frequency distribution of the most prominent community members in a first 

approximation (Muyzer and Smalla 1998). Since the ratio of 16S rDNA and 

16S rRNA is dependent on cellular activity (Wagner 1994), comparisons of 

TGGE patterns derived from 16S rRNA and 16S rDNA amplicons can provide 

interesting information about the active members of the community. Variations 

in the relation of band intensities (rRNA/rDNA) indicated shifts in the 

relative activity of the respective dominant DNA sequences. In particular, the 

composition of the communities are changing along the gradient from bulk 

soil to the rhizoplane/endorhizosphere (Mogge et al. 2000, Wieland et al. 

2001). Additional sequences show higher evenness visible by larger band formation 

in the rhizoplane/endorhizosphere compartment, which is clearly different 

from all the other examined habitats. In this compartment, a larger 

fraction of the community seems to be active, as deduced from the fraction of 

bands common to the rDNA and rRNA patterns of the communities. Using 

the same methodological approach, Wieland et al. (2001) have demonstrated 

recently that the TGGE-patterns of 16S rRNA did not change during the plant 

development in the bulk soil, whereas some pattern variation could be correlated 

to plant development in the rhizosphere and rhizoplane habitats. On the

462 


root surface of different plants and plants growing in different soils, more 

apparent differences in the complete TGGE-pattern was obvious. The frequency 

distribution of target sequences from the total and active community 

members appeared to be mostly identical at the rhizoplane/endorhizosphere 

where the most prominent bands of the rRNA-derived pattern are also dominant 

in the DNA pattern. However, it has to be taken into account that a high 

ribosome content does not always indicate a high physiological activity of 

bacterial cells, because different bacteria inherently contain different ribosome 

numbers (Fegatella et al. 1998). It is likely that both phenomena play a 

role, and this may be different for different bacterial groups (Duarte et al. 

1998). Duineveld et al. (2001) applied a similar 16S rDNA/rRNA PCR-amplification 

approach followed by DGGE analysis in the Chrysantemum rhizosphere, 

but found very little difference between the bacterial community of 

root-adhering soil and bulk soil. Heuer et al. (2002) used not only general 

PCR-primers for the amplification of bacterial 16S rDNA (between positions 

968 and 1401, E. coli numbering according to Brosius et al. 1981), but also the 

taxon-specific primers F203alpha for alpha-proteobacteria and F964b for bproteobacteria. 

Using this approach, these authors revealed a more differentiated 

fingerprint for rhizosphere bacterial communities in DGGE-electrophoresis. 

A PCR approach targeting the ribosomal 16S–23S rDNA 

intergenic spacer region, called ribosomal intergenic spacer analysis (RISA), 

can also reveal insight into the bacterial diversity, because this spacer region 

varies considerably in different species. Baudoin et al. (2001) applied this 

approach for the assessment of the bacterial community structure along 

maize roots and in different growth stages. Weidner et al. (1996) applied 

restriction fragment length polymorphism (RFLP) analysis of cloned 16S 

rDNA from the roots of the seagrass Halophila stipulacea to investigate unculturable 

bacterial rhizosphere communities. Finally, a strain-specific detection 

of certain bacterial strains in the rhizosphere based on a highly specific PCRamplification 

of the 16S–23S intergenic spacer (IGS) region was recently 

developed by Tan et al. (2001). The sequence variability in this region was 

used to differentially identify Bradyrhizobium and Rhizobium strains colonizing 

rice roots by a nested PCR approach and analysis of the amplification 

products on simple agarose gels. 

The genomic DNA extracted from the rhizosphere compartments I–III 

(Fig. 2) can also be used to create 16S rDNA clone banks or dot blot experiments 

with 16S rDNA fragments or probing with specific oligonucleotides. 

When the oligonucleotide GP (Rheims et al. 1996) was used, a reduced number 

of 16S rDNA clones related to Gram-positive bacteria was detected in the 

library generated from the rhizoplane/endorhizosphere of Medicago sativa 

(12 %) as compared to the library generated from the bulk soil fraction (26 %; 

Mogge et al. 2002). Thus, the results of community analysis using cultivation 

techniques and FISH analysis (see Sects. 3.2 and 3.3) were, in general, confirmed 

by this PCR-based cultivation independent technique.

3.5 Community Analysis by Fatty Acid Pattern and Community Level 

Physiological Profile Studies 

The overall microbial diversity in environmental habits can be assessed by 

cultivation independent biomarker analysis, different from the phylogenetic 

ribosomal genes or other genetic markers. As is the case in chemotaxonomic 

studies, the fatty acid patterns are used for this purpose. In one type of analysis, 

the fatty acid methyl esters (FAME) are obtained from the fatty acids after 

saponification of 5 g of soil or root with adhering soil in methanoic NaOH (at 

100 °C, 30 min; Dunfield and Germida 2001). Alternatively, the lipids are 

extracted from 5 g of soil with methanol:chloroform (2:1), the phospholipids 

are separated by chromatography, and finally hydrolyzed to liberate the phospholipid 

fatty acids (PLFA; White and Ringelberg 1998). The PLFA analysis 

has the advantage of giving insight into the living community, because PFLA 

are efficiently hydrolyzed in dead biomass, while the direct FAME analysis 

may contain fatty acids from dead organisms too. The GC-MSanalysis finally 

provides much information on the diversity of this biomarker (Zelles 1997; 

White and Ringelberg 1998). Using the FAME analysis, Germida et al. (1998) 

investigated the diversity of root-associated bacterial communities in canola 

and wheat, and Dunfiled and Germida (2001) compared the bacterial communities 

in the rhizosphere and endorhizosphere of field-grown genetically 

modified varieties of canola (Brassica napus).An example of a recent application 

of the PFLA approach in rhizosphere studies is the investigation of the 

microbial community response in the rhizosphere of Spartina alterniflora to 

changing environmental conditions by Lovell et al. (2001). 

An investigation targeting the analysis of the functional abilities of a complex 

community is the substrate utilization profile assays using the Biolog R - 

plates. Baudoin et al. (2001) applied this approach recently to characterize the 

functional microbial diversity in different rhizosphere compartments of 

maize plants. The differences between the rhizosphere and nonrhizosphere 

soil samples were more pronounced in 4-week-old compared to 2-week-old 

plants. In addition, adhering soil from different root zones (ramification, root 

hair-elongation, root tip) revealed dissimilar community level physiological 

profiles (CLPP). However, this approach needs to be regarded as reflecting the 

potential rather than the in situ-activity of most culturable microbes, because 

these are known to respond and contribute most to the activity at the incubation 

conditions of the CLPP-assay (Garland et al. 1997). 

4 Conclusions 


Using a polyphasic approach including cultivation-dependent and different 

cultivation-independent methods, it could be shown that a high proportion of 

culturable bacteria is present in the rhizoplane when a variety of appropriate

464 


media are applied. This corroborates the findings of Hengstmann et al. (1999), 

who reported similar results in their studies on the microbial community of 

the rice rhizosphere. The separation into the three compartments, bulk soil, 

ectorhizosphere and rhizoplane/endorhizosphere has to be performed with 

great care and actually needs an optimization for each plant and soil type 

under study. The degree to which adhering soil particles (ectorhizosphere) 

are included in the rhizosphere studies considerably influences the outcome 

of the study, since these soil particles are carrying a microbial community 

resembling, to a varying extent, the soil situation compared to the root surface 

or rhizoplane situation. The microbial population colonizing the root surface 

should be approached only after washing the roots free of adhering soil particles. 

In conclusion, the way “rhizosphere” is defined by the experimental protocol 

is of crucial importance for the results of root colonization studies. 

Certainly, in situ and ex situ studies (with the separated rhizosphere compartments) 

both complement each other to give a more comprehensive picture. 

Although the microscopic in situ approach has the great advantage of 

providing detailed spatial information about root surface colonization, quantitative 

and qualitative data about the structural and functional diversity of 

root colonization can be obtained by a variety of complementary ex situ 

approaches. 


Amann RI, Binder BJ, Olson RJ, Chisholm SW, Devereux R, Stahl DA (1990) Combination 

of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing 

mixed microbial populations. Appl Environ Microbiol 56:1919–1925 

Amann RI, Ludwig W, Schleifer KH (1995) Phylogenetic identification and in situ detection 

of individual microbial cells without cultivation. Microbiol Rev 59:143–169 

Andersen JB, Sternberg C, Poulsen LK, Bjorn SP, Givskov M, Molin S (1998) New unstable 

variants of green fluorescent protein for studies of transient gene expression in 

bacteria. Appl Environ Microbiol 64:2240–2246 

Aßmus B, Hutzler P, Kirchhof G, Amann RI, Lawrence JR, Hartmann A (1995) In situ 

localization of Azospirillum brasilense in the rhizosphere of wheat with fluorescently 

labeled, rRNA-targeted oligonucleotide probes and scanning confocal laser microscopy. 


Aßmus B, Schloter M, Kirchhof G, Hutzler P, Hartmann A (1997) Improved in situ tracking 

of rhizosphere bacteria using dual staining with fluorescence-labeled antibodies 

and rRNA-targeted oligonucleotides. Microbial Ecol 33:32–40 

Baudoin E, Benizri E, Guckert A (2001) Impact of growth stage on the bacterial community 

structure along maize roots, as determined by metabolic and genetic fingerprinting. 


Braun-Howland EB, Vescio PA, Nierzwicki-Bauer SA (1993) Use of a simplified cell blot 

technique and 16S rRNA-directed probes for identification of common environmental 

isolates. Appl Environ Microbiol 59:3219–3224 

Beringer JE (1974) R factor transfer in Rhizobium leguminosarum. J Gen Microbiol 

84:188–198


Bothe H, Jost G, Schloter M, Ward BB, Witzel KP (2000) Molecular analysis of ammonia 

oxidation and denitrification in natural environments. FEMS Microbiol Rev 24: 

673–690 

Brimecombe MJ, De Leij FA, Lynch JM (2001) The effect of root exudates on rhizosphere 

microbial populations. In: Pinton R, Varanini Z, Nannipieri P (eds) The rhizosphere. 


Brosius J, Dull TJ, Sleeter DD, Noller HF (1981) Gene organization and primary structure 

of a ribosomal RNA operon from Escherichia coli. J Mol Biol 148:107–127 

Campbell R, Greaves MP (1990a) Anatomy and community structure of the rhizosphere. 

In: Lynch JM (ed) The rhizosphere. Wiley, Chichester, pp 11–34 

Campbell R, Greaves MP (1990b) Methods for studying the microbial ecology of the rhizosphere. 

Meth Microbiol 22:447–477 

Chatzinotas A, Sandaa RA, Schönhuber W,Amann R, Daae FL, Torsvik V, Zeyer J, Hahn D 

(1998) Analysis of broad-scale differences in microbial community composition of 

two pristine forest soils. Syst Appl Microbiol 21:579–587 

Christensen BB, Sternberg C, Andersen JB, Palmer Jr RJ, Nielsen JJ, Givskov M, Molin S 

(1999) Molecular tools for study of biofilm physiology. Meth Enzymol 310:20–42 

De Leij FAAM, Thomas CE, Bailey MJ, Whipps JM, Lynch JM (1998) Effect of insertion 

site and metabolic load on the environmental fitness of a genetically modified 

Pseudomonas fluorescens isolate. Appl Environ Microbiol 64:2634–2638 

Duarte GF, Rosado AS, Seldin L, Keijzer-Wolter AC, Van Elsas JD (1998) Extraction of 

ribosomal RNA and genomic DNA from soil for studying the diversity of the indigenous 

bacterial community. J Microbiol Meth 32:21–29 

Duineveld BM, Kowalchuk GA, Keijzer A, van Elsas JD, van Veen J (2001) Analysis of bacterial 

communities in the rhizosphere of Chrysanthemum via denaturing gradient gel 

electrophoresis of PCR-amplified 16S rRNA as well as DNA fragments coding for 16S 

rRNA. Appl Environ Microbiol 67:172–178 

Dunfield KE, Germida JJ (2001) Diversity of bacterial communities in the rhizosphere 

and root interior of field-grown genetically modified Brassica napus. FEMS Microbiol 

Rev 38:1–9 

Dunger W, Fiedler HJ (1997) Methoden der Bodenbiologie. Gustav Fischer-Verlag, Jena, 

pp 89–107 

Egener T, Hurek T, Reinhold-Hurek B (1999) Endophytic expression of nif genes of 

Azoarcus sp. strain BH72 in rice roots. Mol Plant-Microbe Interact 12:813–819 

Fegatella F, Lim J, Kjelleberg S, Cavicchiolli R (1998) Implications of rRNA operon copy 

number and ribosome content in the marine oligotrophic ultramicrobacterium 

Sphingomonas sp. strain RB2256. Appl Environ Microbiol 64:4433–4438 

Felske A, Engelen B, Nübel U, Backhaus H (1996) Direct ribosome isolation from soil to 

extract bacterial rRNA for community analysis. Appl Environ Microbiol 62:4162– 

4167 

Garland JL, Cook KL, Loader CA, Hungate BA (1997) The influence of microbial community 

structure and function on community-level physiological profiles. In: Insam 

H, Rangger A (eds) Microbial communities: functional versus structural approaches. 


Gerhardt P, Murray RGE,Wood WA, Krieg NR (1994) Methods for general molecular bacteriology. 

American Society for Microbiology, Washington, DC 

Germida JJ, Siciliano SD, de Freitas JR, Seib AM (1998) Diversity of root-associated bacteria 

associated with field-grown canola (Brassica napus L.) and wheat (Triticum aestivum 

L.) FEMS Microbiol Ecol 26:43–50 

Giovannoni SJ, DeLong EF, Olsen GJ, Pace NR (1988) Phylogenetic group-specific 

oligodeoxynucleotide probes for identification of single microbial cells. J Bacteriol 

170:720–726

466 


Gorlach K, Shingaki R, Morisaki H, Hattori T (1994) Construction of eco-collection of 

paddy field soil bacteria for population analysis. J Gen Microbiol 40:509–517 

Hartmann A, Aßmus B, Kirchhof G, Schloter M (1997) Direct approaches to study soil 

microflora. In: van Elsas JD, Trevors JT, Wellington EMH (eds) Modern soil microbiology. 


Hartmann A, Lawrence JR, Aßmus B, Schloter M (1998) Detection of microbes by laser 

confocal microscopy. In: Akkermans ADL, van Elsas JD, de Bruijn FJ (eds) Molecular 

microbial ecology manual, Supplement 3. Kluwer, Dordrecht, Chap. 4.1.10 

Hartmann A, Stoffels M, Eckert B, Kirchhof G, Schloter M (2000) Analysis of the presence 

and diversity of diazotrophic endophytes. In: Triplett EW (ed) Prokaryotic nitrogen 

fixation: A model system for analysis of a biological process. Horizon Scientific Press, 

Wymondham, USA, pp 727–736 

Hattori R, Hattori T (1980) Sensitivity to salts and organic compounds of soil bacteria 

isolated on diluted media. J Gen Appl Microbiol 26:1–14 

Hengstmann U, Chin KJ, Janssen PH, Liesack W (1999) Comparative phylogenetic 

assignment of environmental sequences of genes encoding 16S rRNA and numerically 

abundant culturable bacteria from an anoxic rice paddy soil. Appl Environ 

Microbiol 65:5050–5058 

Herron PR, Wellington EMH (1990) New method for extraction of streptomycete spores 

from soil and application to the study of lysogene in sterile amended and nonsterile 

soil. Appl Environ Microbiol 56:1406–1412 

Heuer H, Kroppenstedt RM, Lottmann J, Berg G, Smalla K (2002) Effects of T4 lysozyme 

release from transgenic potato roots on bacterial rhizosphere communities are negligible 

relative to natural factors. Appl Environ Microbiol 68:1325–1335 

Hirano SS, Willis DK, Clayton MK, Upper CD (2001) Use of an intergenic region in 

Pseudomonas syringae pv. syringae B728a for site-directed genomic marking of bacterial 

strains for field experiments. Appl Environ Microbiol 67:3735–3738 

Hojberg O, Schnider U, Winteler HV, Sorensen J, Haas D (1999) Oxygen-sensing reporter 

strain of Pseudomonas fluorescens for monitoring the distribution of low-oxygen 

habitats in soil. Appl Environ Microbiol 65:4085–4093 

Hopkins DW, MacNaughton SJ, O’Donnell AG (1991) A dispersion and differential centrifugation 

technique for representatively sampling microorganisms from soil. Soil 

Biol Biochem 23:217–225 

Koch B, Worm J, Jensen LE, Hojberg O, Nybroe O (2001) Carbon limitation induces sigma 

s -dependent gene expression in Pseudomonas fluorescens in soil. Appl Environ 

Microbiol 67:3363–3370 

Kragelund L, Hosbond C, Nybroe O (1997) Distribution of metabolic activity and phosphate 

starvation response of lux-tagged Pseudomonas fluorescens reporter bacteria in 

the barley rhizosphere. Appl Environ Microbiol 63:4920–4928 

Lane DJ (1991) 16S/23S rRNA sequencing. In: Stackebrandt E, Goodfellow M (eds) 

Nucleic acid techniques in bacterial systematics. Wiley, Chichester, pp 125–175 

Lee S, Malone C, Kemp PF (1993) Use of multiple 16S rRNA-targeted fluorescent probes 

to increase signal strength and measure cellular RNA from natural planktonic bacteria. 

Mar Ecol Prog Ser 101:193–201 

Liesack W, Stackebrandt E (1992) Occurrence of novel groups of the domain bacteria as 

revealed by analysis of genetic material isolated from an Australian terrestrial environment. 

J Bacteriol 174:5072–5078 

Liesack W, Janssen PH, Rainey FA, Ward-Rainey N, Stackebrandt E (1997) Microbial 

diversity in soil: the need for a combined approach using molecular and cultivation 

techniques. In: van Elsas JD, Trevors JT, Wellington EMH (eds) Modern soil microbiology. 

Marcel Dekker, New York, pp 375–439


Lilley AK, Fry JC, Bailey MJ, Day MJ (1996) Comparison of aerobic heterotrophic taxa 

isolated from four root domains of mature sugar beet (Beta vulgaris). FEMS Microbiol 

Ecol 21:231–242 

Loper JE, Henkels MD (1997) Availability of iron to Pseudomonas fluorescens in rhizosphere 

and bulk soil evaluated with an ice nucleation reporter gene. Appl Environ 

Microbiol 60:2944–2948 

Lorang JM, Tuori RP, Martinez JP, Sawyer TL, Redman RS, Rollins JA, Wolpert TJ, Johnson 

KB, Rodriguez RJ, Dickman MB, Ciuffetti LM (2001) Green fluorescent protein is 

lighting up fungal biology. Appl Environ Microbiol 67:1987–1994 

Lovell CR, Bagwell CE, Czákó M, Márton L, Piceno YM, Ringelberg DB (2001) Stability of 

a rhizosphere microbial community exposed to natural and manipulated environmental 

variability. FEMS Microbiol Ecol 38:69–76 

Ludwig W, Amann R, Martinez-Romero E, Schönhuber W, Bauer S, Neef A, Schleifer KH 

(1998) rRNA based identification and detection systems for rhizobia and other bacteria. 


Macdonald RM (1986) Sampling soil microfloras: dispersion of soil by ion exchange and 

extraction of specific microorganisms from suspension by elutriation. Soil Biol 

Biochem 18:399–406 

Mahaffee WF, Kloepper JW (1997) Temporal changes in the bacterial communities of 

soil, rhizosphere, and endorhiza associated with field-grown cucumber (Cucumis 

sativus L.). Microb Ecol 34:210–223 

Manz W, Amann R, Ludwig W, Wagner M, Schleifer KH (1992) Phylogenetic oligodeoxynucleotide 

probes for the major subclasses of proteobacteria: problems and 

solutions. System Appl Microbiol 15:593–600 

Manz W, Amann R, Ludwig W, Vancanneyt M, Schleifer KH (1996) Application of a suite 

of 16S rRNA-specific oligonucleotide probes designed to investigate bacteria of the 

phylum cytophaga-flavobacter-bacteroides in the natural environment. Microbiology 

142:1097–1106 

Metz S (2001) Herstellung von monoklonalen Antikörpern gegen die Cu-abhängige dissimilatorische 

Nitritreduktase und deren Anwendung zum in situ-Nachweis der Denitrifikationsaktivität 

von Bakterien. Doctoral Thesis, Ludwig-Maximilians-Universität 

München, Fakultät für Biologie 

Miethling R, Wieland G, Backhaus H, Tebbe CC (2000) Variation of microbial rhizosphere 

communities in response to crop species, soil origin and inoculation with the 

marker gene-tagged Sinorhizobium meliloti L33. Microb Ecol 40:43–56 

Mitsui H, Gorlach K, Lee HJ, Hattori R, Hattori T (1997) Incubation time and media 

requirements of culturable bacteria from different phylogenetic groups. J Microbiol 

Methods 30:103–110 

Mogge B, Lebhuhn M, Schloter M, Stoffels M, Pukall R, Stackebrandt E, Wieland G, Backhaus 

H, Hartmann A (2000) Erfassung des mikrobiellen Populationsgradienten vom 

Boden zur Rhizoplane von Luzerne (Medicago sativa). In: Hartmann A (ed) Biologische 

Sicherheit: Biomonitor und Molekulare Mikrobenökologie. Projektträger BEO, 

Jülich, pp 217–224 

Moore RL, Marshall KC (1981) Attachment and rosette formation by hyphomicrobia. 


Morgan JAW, Whipps JM (2001) Methodological approaches to the study of rhizosphere 

carbon flow and microbial population dynamics. In: Pinton R,Varanini Z, Nannipieri 

P (eds) The rhizosphere. Marcel Dekker, New York, pp 373–409 

Muyzer G, Smalla K (1998) Application of denaturing gradient gel electrophoresis 

(DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology. 

Antonie van Leuwenhook 73:127–141

468 


Poindexter JS (1964) Biological properties and classification of the Caulobacter group. 

Bacteriol Rev 28:231–295 

Pukall R, Brambilla E, Stackebrandt E (1998) Automated fragment length analysis of fluorescently-labeled 

16S rDNA after digestion with 4-base cutting restriction enzymes. 

J Micobiol Meth 32:55–63 

Ramos C, Molbak L, Molin S (2000) Bacterial activity in the rhizosphere analyzed at the 

single-cell level by monitoring ribosome contents and synthesis rates. Appl Environ 


Ramos C, Licht TR, Sternberg C, Krogfelt KA, Molin S (2001) Monitoring bacterial 

growth activity in biofilms from laboratory flow-chambers, plant rhizosphere and 

animal intestine. Methods Enzymol 337:21–42 

Rheims H, Sproer C, Rainey FA, Stackebrandt E (1996) Molecular biological evidence for 

the occurrence of uncultured members of the actinomycete line of descent in different 

environments and geographical locations. Microbiology 142:2863–2870 

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning. A laboratory manual, 2nd 

edn. Cold Spring Harbor Laboratory Press, New York 

Schlesner H (1994) Development of media suitable for the microorganisms morphologically 

resembling Planctomycetes spp., Pirellula spp., other Planctomycetales from 

various aquatic habitats using dilute media. System Appl Microbiol 17:135–145 

Schloter M, Borlinghaus R, Bode W, Hartmann A (1993) Direct identification, and localization 

of Azospirillum in the rhizosphere of wheat using fluorescence-labelled monoclonal 

antibodies and confocal scanning laser microscopy. J Microsc 171:173–176 

Schloter M, Assmus B, Hartmann A (1995) The use of immunological methods to detect 

and identify bacteria in the environment. Biotechnol Adv 13:75–90 

Shirling EB, Gottlieb D (1966) Methods for characterization of Streptomyces species. Int 

J Syst Bacteriol 16:313–340 

Staley JT (1968) Prosthecomicrobium and Ancalomicrobium: new prosthecate freshwater 

bacteria. J Bacteriol 95:1921–1942 

Steidle A, Sigl K, Schuhegger R, Ihring A, Schmid M, Gantner S, Stoffels M, Riedel K, 

Givskov M, Hartmann A, Langebartels C, Eberl L (2001) Visualization of N-acylhomoserine 

lactone-mediated cell-cell communication between bacteria colonizing the 

tomato rhizosphere. Appl Environ Microbiol 67:5761–5770 

Stoffels M, Castellanos T, Hartmann A (2001) Design and application of new 16S rRNAtargeted 

oligonucleotide probes for the Azospirillum-Skermanella-Rhodocista-cluster. 

Syst Appl Microbiol 24:83–97 

Stotzky G, Broder MW, Doyle JD, Jones RA (1993) Selected methods for the detection and 

assessment of ecological effects resulting from the release of genetically engineered 

microorganisms to the terrestrial environment. Adv Appl Microbiol 38:1–98 

Stubner S, Schloter M, Moeck GS, Coulton JW, Ahne F, Hartmann A (1994) Construction 

of umu-fhuA operon fusions to detect genotoxic potential by an antibody-cell surface 

reaction. Environ Tox Water Qual 9:285–291 

Tan Z, Hurek T, Vinuesa P, Müller P, Ladha JK, Reinhold-Hurek B (2001) Specific detection 

of Bradyrhizobium and Rhizobium strains colonizing rice (Oryza sativa) roots by 

16S-23S ribosomal DNA intergenic spacer-targeted PCR. Appl Environ Microbiol 

67:3655–3664 

Tas É, Lindström K (2001) Identification of bacteria by their intrinsic sequences: Probe 

design and testing of their specificity. In: Akkermans ADL,Van Elsas JD, De Bruijn FJ 

(eds) Molecular microbial ecology manual, Suppl. 5, Kluwer Academic Press, Dordrecht 

Tolker-Nielsen T, Brinch UC, Ragas PC, Andersen JB, Jacobsen CS, Molin S (2000) Development 

and dynamics of Pseudomonas sp. biofilms. J Bacteriol 182:6482–6489


Torsvik V, Sorheim R, Goksoyr J (1996) Total bacterial diversity in soil and sediment 

communities: a review. J Industr Microbiol 17:170–178 

Tsien HC, Bratina BJ, Tsuji K, Hanson RS (1990) Use of oligodeoxynucleotide signature 

probes for identification of physiological groups of methylotrophic bacteria. Appl 


Unge A, Tombolini R, Molbak L, Jansson JK (1999) Simultaneous monitoring of cell 

number and metabolic activity of specific bacterial populations with a dual gfpluxAB 

marker system. Appl Environ Microbiol 65:813–821 

Wagner M, Amann R, Lemmer H, Schleifer KH (1993) Probing activated sludge with 

oligonucleotides specific for proteobacteria: inadequacy of culture-dependent methods 

for describing microbial community structure. Appl Environ Microbiol 

59:1520–1525 

Wagner R (1994) The regulation of ribosomal rRNA synthesis and bacterial cell growth. 

Arch Microbiol 161:100–106 

Weidner S, Arnold W, Pühler A (1996) Diversity of uncultured microorganisms associated 

with the seagrass Halophila stipulacea estimated from restriction fragment 

length polymorphism analysis of PCR-amplified 16S rRNA genes. Appl Environ 



Varanini Z, Nannipieri P (eds) The rhizosphere. Marcel Dekker, New York, pp 197–222 

White DC, Ringelberg DB (1998) Signature lipid biomarker analysis. In: Burlage RS,Atlas 

R, Stahl D, Geesey G, Sayler G (eds) Techniques in microbial ecology. Oxford University 


Wieland G, Neumann R, Backhaus H (2001) Variation of microbial communities in soil, 

rhizosphere, and rhizoplane in response to crop species, soil type, and crop development. 


Zelles L (1997) Phospholipid fatty acid profiles in selected members of soil microbial 

communities. Chemosphere 35:275–294

25 Methods for Analysing the Interactions Between 

Epiphyllic Microorganisms and Leaf Cuticles 



The plant cuticle forms the solid surface environment for epiphyllic microorganisms. 

This chapter presents newly developed techniques for analysing the 

interactions between epiphyllic microorganisms and leaf cuticles. The methods 

take into account the unique physical, chemical and functional characteristics 

of the cuticular interface of leaves. Furthermore, a new experimental 

approach simulating leaf surface microbe interactions on the basis of isolated 

cuticular membranes (CM) will be presented. Changes in cuticular properties 

in relation to microbial growth can be assessed in vitro under controlled conditions. 

2 Physical Characterisation of Cuticle Surfaces by Contact 

Angle Measurements 

Surface wetting can be determined quantitatively by measuring the contact 

angle s of an aqueous droplet applied to a surface. The contact angle s is 

defined by the angle (°) between the flat leaf surface and the line tangent to a 

water droplet through the point of contact as demonstrated in Fig. 1. The size 

of the contact angle s is directly related to the hydrophobic properties of a 

surface. Low contact angles indicate well wettable surfaces (left-hand side of 

Fig. 1), whereas high contact angles indicate little wettable surfaces (righthand 

side of Fig. 1). Generally, advancing contact angles are measured with 

the aid of a goniometer within the first minute after application of a droplet 

onto the surface. The droplet volume may vary from 1 to 10 ml, since it has 

been previously shown that contact angles were independent of the droplet 

size (Schreiber 1996). However, contact angles can be significantly dependent 

on the pH values of the buffered aqueous solutions. So-called contact angle 

titration measuring contact angles at different pH values ranging between pH 




472 

Contactangle 


 

Waterdroplet 

Contactangle 

Waterdroplet 

Leaf surface Leaf surface 

Fig. 1. A scheme of contact angles from aqueous droplets on surfaces of different 

hydrophobicity. The contact angle s is related to wetting properties of surfaces. Low contact 

angles indicate well wettable surfaces (left), whereas high contact angles indicate 

rarely wettable surfaces (right) 

3.0 and 11.0 can reveal important additional information about the chemical 

nature of interfacial molecules. 

Contact angles can be measured on leaf surfaces and a variety of different 

model surfaces (Knoll and Schreiber 1998, 2000). Prior to the contact angle 

measurement on leaf surfaces, leaves have to be immersed in deionised water 

for 10 s and carefully blotted with filter paper. This washing step removes any 

deposits and dust particles weakly adsorbed to the leaf surface, which might 

dissolve in the aqueous drops used for the contact angle measurements. Leaf 

strips are cut out from the leaf avoiding central veins and necrotic lesions. 

Then leaf strips are attached to microscope slides that are placed in the 

goniometer to measure the contact angle of the applied droplet. Contact 

angles can be measured on leaf surfaces that are naturally or artificially 

colonised in different degrees with microorganisms. 

In order to analyse the impact of cuticular waxes and of epiphytic microorganisms 

on wetting properties of leaf surfaces, both components can be isolated 

and applied separately to microscope slides as artificial supports. Isolated 

wax is recrystallised from the melt on chloroform-washed microscope 

slides. For details about wax extraction, refer to the second part of this chapter. 

Wetting properties of different species of epiphytic microorganisms can 

be determined after cell adherence to artificial glass supports (Fig. 2).Washed 

cell suspensions are incubated with hydrophilic chloroform-washed glass 

slides and with highly hydrophobic slides that were obtained by chemical 

silanisation of the slides (Leibnitz and Struppe 1984).Washed cell suspensions 

(25 ml) are transferred onto sterilised microscope slides in sterile tissue culture 

dishes. After incubation for 24 h at 25 °C, microscope slides are carefully 

washed using a gentle stream of sterile deionised water and remaining 

amounts of water are allowed to evaporate. Contact angles are measured 

immediately after drying of the surfaces. In order to measure contact angles 

as a function of cell density glass slides are incubated at 25 °C with different 

cell concentrations for 6 and 48 h, respectively.

25 Analysing Interactions between Microorganisms and Cuticles 473 

Fig. 2. Contact angles of aqueous solutions of different pH values measured on 

colonised glass surfaces of different hydrophobicity. Untreated, polar and silanised, 

unpolar glass surfaces were inoculated with various microbial cell suspensions for 24 h 

at 25 °C. As a control, glass and silanised glass surfaces were incubated with PBS buffer. 

Values are means with 95 % confidence intervals (ci) from at least 20 contact angle measurements 

with 10 mM citric buffer (pH 3.0) and 10 mM borate buffer (pH 9.0) 

3 Chemical Characterisation of Cuticle Surfaces 

The chemical composition of cutin and cuticular waxes is determined via gas 

chromatography coupled with flame ionisation, infrared or mass spectrometric 

detectors. Further information on chemical wax and cutin chemistry can 

be obtained from a series of reviews (Kolattukudy 1996; Holloway 1982; Walton 

1990; Riederer and Markstädter 1996). In the following, a brief outline of 

the principal steps necessary for wax analysis is given. Sample preparation for

474 


chemical analysis generally includes extraction with organic solvents, concentration 

of the samples by solvent evaporation, derivatisation of alcoholic 

and carboxylic groups and analysis by gas chromatography. 

Cuticular waxes can be easily extracted from plant surfaces using organic 

solvents like chloroform. Brief extractions of fresh foliage of around 10 s have 

been shown to be sufficient to remove all of the surface wax and most of the 

embedded wax (Schreiber and Schönherr 1993). After evaporation of the 

chloroform, the wax concentration is adjusted to 1 mg/ml and 100 ml of the 

extract is transferred into 1-ml reactivials for chemical analysis. In order to 

quantify wax components, known amounts of highly pure alkane standards 

(e.g., 5 mg Dotriacontane) are added to the sample. Derivatisation is necessary 

in order to convert free hydroxyl and carboxyl groups into their corresponding 

trimethylsilyl ethers and esters. This is done by treating the dried extracts 

with 10–30 ml of pyridine and of N,N-trimethylsilyl-trifluoroacetamide 

(BSTFA) at 70 °C for 30 min. Of the silylated samples, 1 µl is then injected into 

a gas chromatograph equipped with a flame ionisation detector. Optimised 

temperature and pressure programs as well as special fused silica capillary 

columns gain the best separation of the larger-molecular-weight aliphatic 

components based on their different C-carbon chain lengths.An example of a 

wax amount [µg cm -2 ] intensity 

200000 ISTD 

175000 

150000 

125000 

100000 

75000 

50000 

25000 

0 

C 24 AN 

C 31 AN 

10 15 20 25 30 35 40 45 50 55 

3 

2,5 

2 

1,5 

1 

0,5 

0 

alkanes 

alcohols 

aldehydes 

acids 

esters 

triterpenoids 

C22 C24 C25 C26 C27 C28 C29 C30 C31 C32 C33 C34 C38 C40 C42 C44 C46 C48 C50 Tri2 Tri3 Tri4 Tri5 Tri6 Tri7 Tri8 

substances 

time [min] 

Fig. 3. Gas chromatographic analysis of the leaf surface wax of strawberry (Fragaria x 

ananassa cv. Elsanta). A Example of an original gas chromatogram of the strawberry 

wax analysed on a gas chromatograph equipped with a flame ionisation detector: ISTD 

internal standard, C 24 AN tetracosane, C 31 AN untriacontane). B Chain lengths distribution 

and quantitative wax coverage of the leaf surface of strawberry 

A 

B


gas chromatogram is shown in Fig. 3. The qualitative wax analysis is performed 

by gas chromatography combined with a mass spectrometric detector. 

Identification of wax components relies on the specific mass spectra of the 

molecules. The wax coverage and the wax composition is usually given per 

unit area of plant surface. Therefore, the total area of extracted leaves or cuticles 

needs to be determined after wax extraction. 

4 A New in Vitro System for the Study of Interactions 

Between Microbes and Cuticles 

4.1 Isolated Cuticles as Model Surfaces for Phyllosphere Studies 

This new experimental system for in vitro studies of leaf surface–microbe 

interactions is based on isolated cuticles as colonisation surfaces. Isolated 

cuticles are ideal model surface for simulation of the phylloplane habitat as 

the special interfacial character of the phyllosphere is retained. Surfaces of 

cuticular membranes reflect the topography of epidermal cells with anticlinal 

cell wall depressions and the course of leaf veins like an reverse imprint of the 

Fig. 4. Scanning electron microscope picture of an isolated cuticular membrane of ivy 

(Hedera helix L.). View of the physiological inner side of the cuticle. The pattern of epidermal 

cell walls and leaf veins is clearly visible

476 


leaf surface (Fig. 4). Furthermore, isolated cuticles have a functionally intact 

wax layer that leads to an extreme high surface hydrophobicity and a reduction 

of solute transport across the cuticle. However, cuticular membranes are 

still permeable to a lesser extent for water and for anorganic as well as polar 

organic molecules. Thus, a boundary layer with higher humidity is formed 

above the cuticle surface and the naturally occurring leaching process of minerals 

or sugars through the cuticle is simulated. Important properties of the 

plant cuticle, like the cuticular permeability or the barrier function against 

microbial penetration, can be measured directly in relation to colonisation of 

the cuticle by microorganisms under strictly controlled conditions during 

incubation. This allows deeper insight into the mechanisms of possible interactions. 

In parallel, microbial population densities can be monitored by determining 

the colony forming units (cfu) and by microscope visualisation of the 

colonised cuticle surface. All methods were established with a strain of the 

commonly found epiphyllic leaf bacteria Pseudomonas fluorescens and can be 

adapted easily for the studies of other species. 

4.2 Enzymatic Isolation of Plant Cuticles 

Cuticular membranes are enzymatically isolated from astomatous leaf sides 

according to the method of Schönherr and Riederer (1986). Punched leaf 

disks with a diameter of 20 mm are vacuum-infiltrated with an enzyme solution 

containing 2 % (v/v) cellulase (Celluclast, Novo Nordisk, Bagsvaerd, Denmark) 

and 2 % (v/v) pectinase (Trenolin Super DF, Erbslöh, Geisenheim) dissolved 

in 10 –2 M citric buffer. 10 –3 M NaN 3 (Sigma, Deisenhofen, Germany) is 

added in order to inhibit microbial aerobic growth. After an incubation 

period of several days at room temperature, cuticles can be completely separated 

from adhering leaf tissue by washing carefully with deionised water. 

Subsequently, isolated cuticles are air-dried and stored at room temperature. 

For still unknown reasons the enzymatic isolation of cuticular membranes is 

limited to a certain number of plant species to which Prunus laurocerasus L., 

Hedera helix L. and Juglans regia L. belong. 

4.3 The Experimental Set-Up of the System 

The experimental set-up of the system consists of stainless steel chambers 

(Fig. 5A) that were originally designed to measure cuticular permeability of 

volatile chemicals (Bauer 1991). Isolated cuticles are placed on the top of the 

chamber and fixed with a metal ring sealing the cuticle/steel interfaces with 

high-vacuum silicone grease (Wacker Chemie, Burghausen, Germany). Prior 

to assembly, chambers and rings coated with silicone grease at the chamber/ring 

interfaces are sterilised by dry hot air at 180 °C for 3 h. Cuticles are


sterilised by UV radiation for 30 min on each side. Sterilised cuticles are then 

mounted in the chambers under sterile conditions. Care is taken that the 

physiological outer side of the cuticles is orientated to the outside. The physiological 

inner side of the cuticle faces 800 ml of a highly concentrated nutrition 

solution consisting of 20 % (w/v) glucose and 5 % (w/v) yeast extract or 

simply water. The inner volume of the chamber is accessible by sampling 

ports that can be closed by metal stoppers. Using a sterile plastic syringe, the 

solution inside the chamber can be replaced several times during the course 

of the experiment. Chambers were incubated upside down on a metal grid in 

a climate-controlled incubation box for some hours at 25 °C before the inoculation 

with microbial cells. Incubation boxes are 10x20 cm in size and can be 

closed with an air-tight lid. Boxes are sterilised with 70 % (v/v) ethanol and 

with UV radiation. Sterile pressurised air is conducted through the incubation 

box. Air humidity is set by simply changing the temperature of the water 

reservoir. At a temperature of 25 °C, the air has a humidity of 100 %. Lower 

moisture levels can be set in the incubation box by reducing the temperature 

of the water reservoir under 25 °C as the saturation vapour pressure of water 

in air is dependent on temperature (Nobel 1991). One incubation box is 

equipped with a hygrometer and a temperature sensor in order to verify the 

actual climate conditions inside the box. 

4.4 Inoculation of Cuticular Membranes with Epiphytic Microorganisms 

A cell culture of P. fluorescens is cultivated in glucose-yeast-medium overnight 

at 25 °C. Cells are harvested by centrifugation (2120xg, 20 min), resuspended 

and washed twice in 10 –2 M phosphate buffered saline (PBS, pH 7.4; Sigma 

Chemicals). Prior to inoculation the cell suspension is adjusted to an optical 

density of 1.0 that corresponds to 2.5◊10 8 cfu/ml. The outer cuticle surface is 

inoculated with bacteria by spreading 200 ml of a washed cell suspension of P. 

fluorescens evenly over the entire exposed cuticle surface (Fig. 5B). Chambers 

are incubated for 6 h at 25 °C in a sterile glass Petri dish containing PBSbuffer-moistened 

filter papers at the bottom in order to avoid evaporation of 

water from the inoculation solution. During the inoculation period, bacterial 

cells adhere to the cuticle. After 6 h the suspension is withdrawn and the surface 

is carefully washed five times with 200 ml sterile deionised water to 

remove unbound bacteria. Chambers are left in a laminar flow hood until dry. 

Immediately after the drying of the washed cuticle surface, the chambers are 

transferred upside down in the incubation box (Fig. 5C). Furthermore, two 

control experiments are performed. One control is necessary for checking 

sterile conditions during the course of experiment. Therefore, cuticles are 

incubated with 200 ml of sterile PBS and treated in the same way as described 

above.Another control is to verify that during the inoculation period bacteria 

are not able to pass through the silicone grease from the outer cuticle surface

478 

A 

cuticle 

B 


sterilization experimental setup 

UV-light 

stainless steel 

chamber 

inoculation washing 

C 

bacteria 

pressurised air 

water 

reservoir 

stainless steel 

chamber 

metal ring 

sampling port 

stopper 

measurement 

lid 

filter incubation box metal grid 

nutrient 

solution 

or water 

50 µl 

petri dish 

Fig. 5. Scheme of the experimental set-up for the in vitro study of microorganisms–leaf 

cuticle interactions. A Enzymatic isolated cuticular membranes are sterilised by UV 

radiation and mounted in a stainless steel chamber. The chamber is filled with nutrient 

solution or water. B The physiological outer side of the cuticle is inoculated with a microbial 

cell suspension for 6 h at 25 °C. Microbial cells not bound to the cuticle surface are 

removed by washing the cuticle with deionised water. Samples of the solution inside the 

chamber can be taken with a sterile syringe via closable sampling ports. C Inoculated 

cuticles are incubated up-side down on a metal grid in sterile incubation boxes at 25 °C. 

Pressurised air of the desired moisture level is conducted through the incubation box

into the nutrition solution inside the chamber volume. Therefore, round glass 

cover slips that definitely cannot be breached by bacteria are mounted in 

place of cuticles in the chambers and inoculated with 200 ml of the cell solution. 

4.5 Measurement of Changes in Cuticular Transport Properties 

4.5.1 Determination of Cuticular Water Permeability 

Cuticular water permeability is measured according to a gravimetric method 

of Schönherr und Lendzian (1981). The permeability coefficients P (m/s) for 

water are calculated using the equation: 

P= F 

A¥DC 25 Analysing Interactions between Microorganisms and Cuticles 479 

where F is the water flow across the cuticular membrane (g/s), A is the area of 

the exposed cuticle surface (m 2 ) and DC represents the difference in the water 

concentration between the aqueous phase inside the chamber and the outer 

atmosphere of the incubation box. The water flow across the cuticular membrane 

can be measured by weighing the chambers at periodic intervals on an 

electronic balance with an accuracy of ±0.1 mg. The weight loss from the 

chambers is plotted against the incubation time and the water flow is calculated 

by linear regression analysis (Fig. 6). The sampling ports of the cham- 

Fig. 6. Effect of 

Corynebacterium fascians 

on the cuticular water permeability 

of Prunus laurocerasus. 

The flow of water 

through the cuticular 

membrane was increased 

by a factor of 2 after treatment 

with bacteria, 

whereas treatment with 

PBS did not significantly 

change the cuticular water 

flow

480 


bers are additionally sealed with adhesive tape to avoid diffusion of water 

through the sampling ports. Chambers are incubated upside down on dried 

silica gel in an air-tight polyethylene box at 25 °C. The silica gel adsorbs all 

free water of the air resulting in a water concentration inside the polyethylene 

box constantly held at 0 %. Thus, the driving force DC for the water flow across 

the cuticle corresponds to the density of water (10 3 kg m –3 ). The salt and sugar 

concentration of the nutrition solution can be neglected as it does not affect 

significantly the water activity a w. Control experiments showed that there was 

no significant change in cuticular water permeability when using deionised 

water or nutrition solution as the aqueous solution inside the chamber volume. 

Sterilisation of cuticles by UV radiation also did not significantly change 

water permeability. 

4.5.2 Effect of Bacteria on Cuticular Water Permeability 

Isolated cuticles are mounted in stainless steel chambers and permeability 

coefficients P1 for water are determined for each sample as described above. 

Cuticular permeability coefficients P1 determined after UV radiation ranged 

between 1.44◊10 –10 m/s for Vinca major leaf cuticles and 10.8x10 –9 m/s for 

Lycopersicon esculentum fruit cuticles (Table 1). Then cuticles are inoculated 

with bacteria and incubated for 12 days in the incubation box at 25 °C at air 

humidity close to 100 %. Control experiments are conducted by inoculating 

the cuticles with 200 ml PBS in place of the bacterial cell solution. After incubation 

with bacteria chambers are again transferred onto dried silica gel and 

cuticular water permeability coefficients P2 are determined after an equilibrium 

period of 1 day. The effects of bacteria on water permeability of the 

respective cuticular membrane are calculated from the permeance of the cuticle 

after treatment with bacteria (P2) divided by the initial permeance (P1). 

Effect = P2 

P1 

Table 1. Cuticular permeability coefficients for water P water (m/s) from different plant 

species. Values are arithmetic means with 95 % confidence intervals (ci) of 14 measured 

permeability coefficients for each plant species 

Species P water ¥10 –10 (m/s) ci 95 %x10 –10 (m/s) 

Vinca major 1.44 1.26–1.64 

Hedera helix can. 2.16 1.76–2.65 

Prunus laurocerasus 2.93 2.34–3.68 

Citrus aurantium 4.53 2.97–6.92 

Lycopersicon esculentum 10.80 8.85–13.17

An example for the change in water permeability of one cuticular membrane 

before and after treatment with bacteria is shown in Fig. 6. The effects 

on water permeability for an entire sample unit consisting of at least 12 cuticles 

are given as mean values of the effects measured for individual membranes. 

Some results are presented in the chapter “Interactions between Epiphyllic 

Microorganisms and Leaf Cuticles” by Schreiber et al. (Chap. 9, this 

Vol.). 

The effects on water permeability need not necessarily be measured before 

and after treatment with bacteria, but can also be measured during the incubation 

with bacteria by lowering the air humidity inside the incubation box 

to, e.g. 90 %. As the driving force for the water flow across the cuticle is 

reduced to 1/10, periodical intervals in between weighing the chamber are 

increased to 4 days in order to measure a significant weight loss. 

4.6 Measuring Penetration of Microorganisms Through Cuticular 

Membranes 

Penetration of microorganisms through cuticular membranes can be measured 

as well using the described in vitro system. The outer side of the cuticle 

is inoculated with bacterial cells, whereas the inner side faces a sterile nutrition 

solution. If the cuticle, located between microbial cells and nutrition 

solution inside the chamber, is penetrated by bacterial cells, microbial growth 

will be detectable in the nutrition solution. Thus, penetration of isolated cuticles 

by bacteria can be easily monitored by transferring 50 ml of the nutrition 

solution inside the chamber onto glucose-supplemented yeast extract agar 

plates using a sterile syringe. Subsequent microbial growth on the agar plates 

indicates that a penetration event through the cuticular membrane has 

occurred. In that way, the amount of cuticles penetrated is determined in daily 

intervals. The amount of cuticles penetrated after different periods of incubation 

is given in percent of the total amount of inoculated membranes. 

%CM = 

penetrated 


Number of CMpenetrated 

Number of CMtotal 

¥100 

An example for a penetration kinetic is shown in Fig. 7. The amount of penetrated 

cuticular membranes increased over the incubation period of 12 days. 

Some typical characteristics of a penetration kinetic can be used to describe 

the barrier function of cuticles quantitatively: (1) at the end of the incubation 

period there was a steady increase of penetrated cuticular membranes versus 

incubation time. Rates of penetration (% CM penetrated/day) can be calculated 

from the slopes of the linear regression. (2) Another meaningful parameter is 

the time needed by the microorganisms to penetrate 50 % of inoculated membranes 

(T 50 %). High rates of penetration and small T 50 % values indicate low

482 


Fig. 7. Penetration of 

Pseudomonas fluorescens 

through cuticular membranes 

of Vinca major.The 

amount of penetrated cuticles 

increases with incubation 

time. After 9.5 days 

50 % of the inoculated cuticles 

are penetrated by P. 

fluorescens. At the end of 

the kinetic there is a linear 

increase of penetrated cuticles 

with a rate of 6.1 % 

penetrated CM per day in 

relation to the total amount 

of inoculated cuticles 

barrier functions of the cuticle for microbial penetration. Once these values 

are known, barrier properties of cuticles of different plant species that differ 

in their morphology like cuticle thickness or chemistry like wax composition 

can be compared. Another attractive application is to measure penetration of 

different microbial strains or mutants that differ in their array of extracellular 

enzymes like cutinase activity. 

Several control experiments need to be conducted to ensure bacterial penetration 

through isolated cuticles. (1) When glass slides are mounted into the 

chambers in place of cuticles there was never any bacterial growth detectable 

in the nutrition solution. This gives evidence that bacteria are not able to 

bypass the glass surface via the silicone grease seal. (2) In addition, no bacterial 

growth was detected in the nutrition solution when cuticles were inoculated 

with sterile PBS indicating that the system itself is sterile and no other 

origins for bacterial growth are possible except from the inoculus on the outer 

cuticle surface. (3) Finally, a third control consists of applying 200 ml of dead 

bacteria. Cells are cultivated as described above and subsequently killed with 

paraformaldehyde and stained with the fluorescent dye DAPI. It was checked 

that all bacterial cells were killed.After the inoculation period of 6 h the nutrition 

solution is checked for the presence of DAPI-stained cells with fluorescence 

microscopy. A fraction of about 10 % of the inoculated cuticles was 

apparently leaky for dead cells. This might be due to mechanical injuries to 

the cuticular membranes during the process of isolation or during the mounting 

of cuticular membranes in the chambers. Those membranes were sorted 

out and not considered any further. Furthermore, cuticular water permeability 

measured prior to inoculation with bacterial cells was very low (Table 1), 

indicating that the membranes form high effective barriers for the transport 

of water on the molecular level. This also suggests that they build intact barriers 

for microbial cells as well. Basically, all control experiments confirmed


that after the inoculation period of 6 h bacterial cells are solely present on the 

inoculated outer cuticle surface. 

4.7 Determination of the Viable Cell Number on the Cuticle Surface 

In order to document the microbial development on isolated cuticular membranes, 

the cfu is determined. The initial cfu on isolated cuticles is determined 

directly after inoculation of membranes with microorganisms. As an example, 

the initial cfu of P. fluorescens attached to cuticles of V. major was 

2.85x10 5 ±0.98x10 5 cfu/CM. Then cfu measurements are done in daily intervals 

during the incubation period. First, the nutrition solution inside the 

chamber is totally removed with a sterile syringe and kept in sterile glass 

tubes to check for microbial growth (see below). After having removed the 

nutrition solution, the membrane is cut out of the chamber with a sterile 

scalpel blade and transferred in a 1.5-ml tube containing 0.05 g of sterile sand. 

The cuticle is ground in 100 ml PBS with a micropestle for 2 min. After 

homogenisation of the cuticle, 900 ml PBS is added and the tube contents 

mixed. Serial dilutions of 100 µl are incubated on glucose yeast extract agar 

plates at 25 °C for 2 days before colonies have been counted. 

In order to determine the microbial cfu exclusively on the outer cuticle surface, 

it is very important to check the nutrition solution inside the chamber 

for microbial growth. Therefore, the nutrition solution removed from the 

inner chamber volume is simply incubated at 25 °C for 2 days. Only if there is 

no microbial growth detectable, is the cfu determined for that cuticle considered 

to describe the microbial development on the outer cuticle surface. 

4.8 Microscope Visualisation of Microorganisms on the Cuticle 

Microscopic detection of microbial cells on isolated cuticles gives information 

about the colonisation pattern and development. The fluorescent dyes acridine 

orange and DAPI are used to stain bacteria. Both dyes are polar substances 

with a very high affinity to bind nucleic acids. Thus, microbial cells 

adhering to the cuticle surface are specifically stained, whereas the hydrophobic 

cuticle surface itself is not stained. 0.02 % (w/v) acridine orange and 

0.001 % (w/v) DAPI are dissolved in deionised water and filtered through 

0.2 mm membrane filters to remove dye crystals and dust particles. Care is 

taken that staining solutions are protected from daylight. For better handling 

cuticles are left mounted in the chambers for staining of bacterial cells. Staining 

solution (200 µl) is evenly distributed over the outer cuticle surface. 

Chambers are incubated in the dark at room temperature on a horizontal 

shaker (30 rpm). After different staining times of 5, 20, 40 and 60 min, respectively, 

the cuticle surfaces are washed twice with 200 ml of sterile-filtered

484 


deionised water to remove unbound dye molecules. Cuticles are left over silica 

gel until dry. The dried cuticle surfaces are excised from the chambers 

with a scalpel blade and cut into four parts. Cuticle pieces are transferred onto 

a thin hydrophobic layer of silicon grease on a microscopic slide. A cover slip 

together with one drop of immersion oil is put on the top of the cuticle prior 

to microscopic examination. Due to the hydrophobic layer of silicon grease 

and the immersion oil, the entire surfaces of the cuticle pieces are spread 

totally flat minimising problems with depth focus. Furthermore, the refraction 

of light is markedly reduced allowing fluorescence microscopy with isolated 

cuticles. Samples can be viewed with a Zeiss Axioplan microscope 

(Zeiss, Oberkochen, Germany) equipped with a 50 W mercury high pressure 

bulb, a 40x objective (Zeiss, Plan-Neofluar) and a Zeiss filter set No. 09 (excitation: 

450–490 nm; dichroic beamsplitter ≥510 nm; emission ≥520 nm). One 

examples of a fluorescence microscopy micrograph of a colonised cuticle surface 

is shown in Fig. 8. The surface coverage of the cuticle colonised by bacte- 

Fig. 8. Epifluorescent microscope image of an isolated cuticular membrane of Prunus 

laurocerasus artificially colonised with Pseudomonas fluorescens (magnification ¥400). 

Bacterial cells are stained with acridine orange and viewed at an excitation of 

450–490 nm.Approximately 27.4 % of the cuticle surface is covered by bacteria. Bacterial 

cells are accumulated in small clusters over the entire cuticle surface


rial cells can be quantified by digital image analysis. Digitised video images 

are analysed for the pixel size of stained bacterial cells using Adobe Photoshop 

software. Percentage coverage of bacterial cells is calculated as follows: 

No. of pixel of bacterial cells of digitized image 

% coverage = ¥100 

No. of total pixel size of digitized image 

Percentage coverage by bacteria is given as the mean value of 12 analysed 

digitised images at 400x magnification from randomly chosen sites of at least 

three cuticles per sampling point. The influence of staining time with acridine 

orange on the area coverage can be seen in Fig. 9A. The optimal staining time 

is 20 m. An adhesion kinetic of cells of P. fluorescensto cuticle surfaces of P. 

Fig. 9. Surface coverage of cuticles from Prunus laurocerasus with Pseudomonas fluorescens. 

A Dependence of the surface coverage by bacterial cells on the staining time 

with acridine orange. The optimal staining time was 20 min. B Adhesion of bacterial cells 

to the cuticle surface over time. Maximal adhesion of 46.9 % occurred after 6 h of inoculation. 

Percentage coverage by bacterial cells is given as the mean value with 95 % confidence 

intervals of 12 analysed digitised images at x400 magnification from randomly 

chosen sites of each of three examined cuticles. Only two membranes could be analysed 

for the 60-min time sample

486 


laurocerasus is shown in Fig. 9B. Maximal surface coverage of 46.9 % was 

reached after 6 h of inoculation with bacterial cell solution. 

5 Conclusions 

The presented methods allow a detailed analysis of a variety of microbe–cuticle 

interactions combining physicochemical, ecophysiological and microbial 

ecological aspects. Isolated cuticles are excellent model surfaces to study the 

mechanisms of such interactions. Using the presented in vitro system, even 

minor changes in cuticular wax composition or permeability can be examined 

in relation to microbial growth. When working with entire leaves, such 

changes would probably be masked by the physiological influence of the leaf. 

Therefore, this new approach might be very helpful to reveal possible mechanisms 

of interactions that occur in reality only in the scale of microhabitats. 

The impact of cuticular features will help us to understand the observed heterogeneous 

colonisation of the leaf habitat and the formation of microcolonies. 

Vice versa, the capacity of microbial cells to change cuticular properties 

might be of crucial importance for a successful colonisation of the leaf 

surfaces and could contribute substantially to the microbial fitness of individual 

epiphyllic species. 

Acknowledgements. The authors gratefully acknowledge financial support of this work 

by the Deutsche Forschungsgemeinschaft and the FCI. 


Bauer H (1991) Mobilität organischer Moleküle in der pflanzlichen Kutikula. PhD Thesis, 

Technical University of Munich, Germany 

Holloway PJ (1982) The chemical constitution of plant cutins. In: Cutler DF, Alvin KL, 

Price CE (eds) The plant cuticle. Academic Press, London 

Knoll D (1998) Die Bedeutung der Kutikula bei der Interaktion zwischen epiphyllen 

Mikroorganismen und Blattoberflächen. PhD Thesis, University of Würzburg, Germany 

Knoll D, Schreiber L (1998) Influence of epiphytic micro-organisms on leaf wettability: 

wetting of the upper leaf surface of Juglans regia and of model surfaces in relation to 

colonization by microorganisms. New Phytol 140:271–282 

Knoll D, Schreiber L (2000) Plant-microbe interactions: wetting of ivy (Hedera helix L.) 

leaf surfaces in relation to colonization by epiphytic microorganisms. Microb Ecol 

41:33–42 

Kolattukudy PE (1996) Biosynthetic pathways of cutin and waxes. In: Kerstiens G (ed) 

Plant cuticles: an integrated functional approach. BIOS Scientific Publishers, Oxford, 

pp 83–108 

Leibnitz E, Struppe HG (1984) Handbuch der Gaschromatographie. Akademische Verlagsgesellschaft, 

Leipzig


Nobel PS (1991) Physicochemical and environmental plant physiology. Academic Press, 

San Diego 

Riederer M, Markstädter C (1996) Cuticular waxes: a critical assessment of current 

knowledge. In: Kerstiens G (ed) Plant cuticles: an integrated functional approach. 

BIOS Scientific Publishers, Oxford, pp 189–200 

Schönherr J, Lendzian K (1981) A simple and inexpensive method of measuring water 

permeability of isolated plant cuticular membranes. Z Pflanzenphysiol 102:321–327 

Schönherr J, Riederer M (1986) Plant cuticles sorb lipophilic compounds during enzymatic 

isolation. Plant Cell Environ 4:459–466 

Schreiber L (1996) Wetting of the upper needle surface of Abies grandis: influence of pH, 

wax chemistry and epiphyllic microflora on contact angles. Plant Cell Environ 

19:455–463 

Schreiber L, Schönherr J (1993) Mobilities of organic compounds in reconstituted cuticular 

wax of barley leaves: Determination of diffusion coefficients. Pestic Sci 38:353– 

361 

Walton TJ (1990) Waxes, cutin and suberin. Meth Plant Biochem 4:105–158

26 Quantifying the Impact of ACC Deaminase- 

Containing Bacteria on Plants 



In 1994, we reported that the bacterium, Pseudomonas putida GR12–2 (Lifshitz 

et al. 1986), a well-known plant growth promoting strain, contained the 

enzyme, 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase (Jacobson 

et al. 1994). This enzyme hydrolyzes ACC, the immediate precursor of ethylene, 

in plant tissues (Yang and Hoffman 1984). Ethylene is required for seed 

germination by many plant species and the rate of ethylene production 

increases during germination and seedling growth (Abeles et al. 1992). 

Although low levels of ethylene appear to enhance root initiation and growth, 

and promote root extension, high levels of ethylene produced by fast growing 

roots can lead to inhibition of root elongation (Mattoo and Suttle 1991; Ma et 

al. 1998). We have proposed a model that suggests that ACC deaminase-containing 

plant growth promoting bacteria can lower ethylene levels and thus 

stimulate plant growth (Glick et al. 1998). It is quite likely that much of the 

ACC produced during ethylene biosynthesis is taken up by the bacterium and 

subsequently hydrolyzed to a–ketobutyrate and ammonia by ACC deaminase. 

The uptake and cleavage of ACC by ACC deaminase would decrease the 

amount of ACC, as well as ethylene. 

2 Selection of Bacterial Strains that Contain ACC Deaminase 

We developed a rapid and novel procedure for the isolation of ACC deaminase-containing 

bacteria and used this technique to identify and isolate seven 

plant growth promoting strains based on their ability to utilize ACC as the 

sole source of nitrogen (Glick et al. 1995). These bacterial strains were isolated 

from soil samples collected during late summer in Waterloo, Ontario, Canada 

and various locations in California, USA from the rhizosphere of seven different 

plants (Table 1). Originally, these strains were designated as Pseudomonas 

sp., but were re-classified following fatty acid analysis (Shah et al. 1997). 




490 


Table 1. ACC-utilizing bacterial strains isolated from Waterloo, Ontario, Canada and 

California, USA 

Genus and species Strain Soil location Plant source 

Pseudomonas putida UW1 Waterloo, Ontario, Canada Bean 

Enterobacter cloacae UW2 Waterloo, Ontario, Canada Clover 

Pseudomonas putida UW3 Waterloo, Ontario, Canada Maize 

Enterobacter cloacae UW4 Waterloo, Ontario, Canada Reeds 

Pseudomonas fluorescens CAL1 San Benito, California, USA Oats 

Enterobacter cloacae CAL2 King City, California, USA Tomato 

Enterobacter cloacae CAL3 Fresco, California, USA Cotton 

Our method of isolating bacteria entails screening soil bacteria for the ability 

to use ACC as a sole nitrogen source, a trait that is a consequence of the 

presence of the activity of the enzyme, ACC deaminase. One gram of soil is 

added to 50 ml of sterile medium containing 10 g proteose peptone, 10 g 

casein hydrolysate, 1.5 g anhydrous MgSO 4 , 1.5 g K 2 HPO 4 and 10 ml glycerol 

(PAF medium) in a 250-ml flask. The flask and its contents are incubated in a 

shaking water bath (200 rpm) at either 25 or 30 °C depending on the geographic 

location of the soil samples, i.e., the samples collected in the cooler 

Canadian climate of Waterloo, Ontario were grown at 25 °C and those from 

the warmer weather of California, USA were grown at 30 °C.After 24-h, a 1-ml 

aliquot is removed from the growing culture, transferred to 50 ml of sterile 

PAF medium in a 250-ml flask and incubated at 200 rpm in a shaking water 

bath for 24 h, at either 25 or 30 °C, the same temperature as the first incubation. 

Following these two incubations, the population of pseudomonads is 

enriched and the number of fungi in the culture is reduced. 

A 1-ml aliquot is removed from the second culture and transferred to a 

250-ml flask containing 50 ml of sterile minimal medium, DF salts (Dworkin 

and Foster 1958; per litre): 4.0 g KH 2 PO 4 , 6.0 g Na 2 HPO 4 , 0.2 g MgSO 4 ·7H 2 O, 

2.0 g glucose, 2.0 g gluconic acid and 2.0 g citric acid with trace elements: 1 mg 

FeSO 4·7H 2O, 10 mg H 3BO 3, 11.19 mg MnSO 4·H 2O, 124.6 mg ZnSO 4·7H 2O, 

78.22 mg CuSO 4·5H 2O, 10 mg MoO 3, pH 7.2 and 2.0 g (NH 4) 2SO 4 as a nitrogen 

source. In our lab the DF minimal medium is prepared as follows: (1) the trace 

elements (10 mg H 3BO 3, 11.19 mg MnSO 4◊H 2O, 124.6 mg ZnSO 4◊7H 2O, 

78.22 mg CuSO 4◊5H 2O, and 10 mg MoO 3) are dissolved in 100 ml of sterile distilled 

water and then stored in the refrigerator for up to several months; (2) 

FeSO 4 ◊7H 2 O (1 mg) is dissolved in 10 ml of sterile distilled water and is stored 

in the refrigerator for up to several months; (3) all of the other ingredients 

including 4.0 g KH 2PO 4, 6.0 g Na 2HPO 4, 0.2 g MgSO 4·7H 2O, 2.0 g glucose, 2.0 g 

gluconic acid, 2.0 g citric acid, 2.0 g (NH 4) 2SO 4 and 0.1 ml of each of the solutions 

of trace elements and FeSO 4◊7H 2O are dissolved in 1 l of distilled water

26 Quantifying the Impact of ACC Deaminase-Containing Bacteria on Plants 491 

and autoclaved for no more than 20 min. If this medium is prepared by dissolving 

one ingredient at a time, i.e., by not adding another ingredient until 

the previous one is completely dissolved, this medium should not contain a 

precipitate. Following an incubation of 24 h in a shaking water bath at 

200 rpm at either 25 or 30 °C, the same temperature as the first incubation, a 

1-ml aliquot is removed from this culture and transferred to 50 ml of sterile 

DF salts minimal medium in a 250-ml flask containing 3.0 mM ACC (instead 

of (NH 4) 2SO 4) as the source of nitrogen. A 0.5 M-solution of ACC (Calbiochem-Novobiochem 

Corp., La Jolla, CA, USA), which is very labile in solution, 

is filter-sterilized through a 0.2 mm membrane and the filtrate collected, 

aliquoted and frozen at –20 °C. Just prior to inoculation, the ACC solution is 

thawed and a 300-ml aliquot added to 50 ml of sterile DF salts minimal 

medium; following inoculation, the culture is placed in a shaking water bath 

at 200 rpm and grown for 24 h at either 25 or 30 °C, the same temperature as 

the previous incubation. 

Dilutions of this final culture are plated onto solid DF salts minimal 

medium and incubated for 48 h at either 25 or 30 °C, the same temperature as 

the previous incubations. These plates are prepared with 1.8 % Bacto-Agar 

(Difco Laboratories, Detroit, MI, USA), which has a very low nitrogen content, 

and are spread with ACC (30 mmol/plate) just prior to use. Before streaking 

with either a loopful of bacterium or an individual colony, the ACC is allowed 

to dry fully. The inoculated plates are incubated at the appropriate temperature 

– no higher than 35 °C because all of the known ACC deaminases are 

inhibited above this temperature – for 3 days and the growth on the plates is 

checked daily. Even when apparently nitrogen-free agar is used, and no additional 

source of nitrogen is included in the medium, it is almost impossible to 

obtain plates with absolutely no growth, but it is possible to obtain plates with 

very, very light growth. 

The colonies isolated from each of the seven soil samples displayed a similar 

colony morphology and rate of growth. In order to avoid isolating multiple 

copies of the same bacterium, only a single colony from each soil sample 

is selected for further testing. Each selected colony is tested for the synthesis 

of siderophores, antibiotics and indole acetic acid, as well as for plant growth 

stimulation and ACC deaminase activity. It is interesting to note that Belimov 

et al. (submitted for publication) used a variant of the procedure described 

above to isolate ACC deaminase-containing strains of Bacillus. 

3 Culture Conditions for the Induction of Bacterial ACC 

Deaminase Activity 

The assessment of bacterial ACC deaminase activity and root growth 

enhancement both require growth conditions that favor the induction of ACC 

deaminase. The bacteria are cultured first in rich medium and then trans-

492 


ferred to minimal medium with ACC as the sole source of nitrogen. Bacterial 

cells are grown to mid- up to late-log phase in 15 ml of rich medium, e.g., 

tryptic soybean broth (TSB; Difco Laboratories, Detroit, MI, USA) divided 

between two culture tubes: each tube is inoculated with 5 ml of the appropriate 

strain. Cultures are incubated overnight in a shaking water bath at 200 rpm 

at either 25 or 30 °C – the temperature most suitable for the bacterial strain. 

The accumulated biomass is harvested by centrifugation of the contents of the 

combined tubes at 8000xg for 10 min at 4 °C in a Sorvall RC5B/C centrifuge 

using an SS34 rotor. The supernatant is removed and the cells are washed with 

5 ml of DF salts minimal medium. Following an additional centrifugation for 

10 min at 8000xg in the same rotor at 4 °C, the cells are suspended in 7.5 ml of 

DF salts minimal medium, in a fresh culture tube. Just prior to incubation, the 

frozen 0.5 M ACC solution (prepared as described in Sect. 2) is thawed, and an 

aliquot of 45 ml is added to the cell suspension; the final ACC concentration is 

3.0 mM. The bacterial cells are returned to the shaking water bath to induce 

the activity of ACC deaminase – at 200 rpm for 24 h at the same temperature 

as the overnight incubation, either 25 or 30 °C. The bacteria are harvested by 

centrifugation at 8000xg for 10 min at 4 °C in an SS34 rotor in a Sorvall 

RC5B/C centrifuge. The supernatant is removed, and the cells are washed by 

suspending the cell pellet in 5 ml of either 0.1 M Tris-HCl, pH 7.6 if the cells 

are to be assayed for ACC deaminase activity, or 0.03 M MgSO 4 if they are to 

be used as a bacterial treatment in the gnotobiotic root elongation assay or 

the high performance liquid chromatography (HPLC) protocol for measuring 

ACC. Following centrifugation at 8000xg at 4 °C for 10 min in the same rotor 

and centrifuge, the supernatant is discarded. The washing procedure is 

repeated twice to ensure that the pellet is free of medium. The pelleted cells 

are stored at either –20 °C for measurement of ACC deaminase activity, or at 

4 °C for seed treatment in the gnotobiotic root elongation assay or HPLC measurement 

of ACC. 

4 Gnotobiotic Root Elongation Assay 

The gnotobiotic root elongation assay is used as a method of assessing the 

effect of various bacterial strains on the growth of canola seedlings. Each of 

the seven strains of ACC deaminase-containing soil bacteria isolated in our 

lab was assayed by the root elongation assay and was shown to promote 

canola seedling growth under gnotobiotic conditions. The protocol described 

below is a modification of the procedure developed by Lifshitz et al. (1987) 

and is used to measure the elongation of canola roots from seeds treated with 

different strains of bacteria or chemical ethylene inhibitors. The bacterial cell 

pellet, prepared as described in Section 3, is suspended in 0.5 ml of sterile 

0.03 M MgSO 4 and then placed on ice. A 0.5-ml sample is removed from the 

cell suspension and diluted eight to ten times in 0.03 M MgSO 4; the


absorbance of the sample is measured at 600 nm. This measurement is used to 

adjust the absorbance at 600 nm, of the bacterial suspension, to 0.15 with sterile 

0.03 M MgSO 4. 

Seed-pack growth pouches (Northrup King Co., Minneapolis, MN, USA) 

are prepared for the gnotobiotic assay of canola root elongation. Following 

the addition of 12 ml of distilled water to each one, the growth pouches are 

wrapped in aluminum foil in groups of ten, placed in an upright position to 

prevent water loss, and autoclaved at 121 °C for 15 min. 

Canola seeds (Brassica campestris) are disinfected immediately before use. 

(Tomato seeds may also be used in this assay.) The seeds (approximately 

0.2 g/treatment) are soaked in 70 % ethanol for 1 min in glass Petri dishes 

(60¥15 mm); the ethanol is removed and replaced with 1 % sodium hypochlorite 

(household bleach). After 10 min the bleach solution is suctioned off and 

the seeds are thoroughly rinsed with sterile distilled water at least five times, 

sterile distilled water is added to the dish of seeds, swirled and removed by 

suction. Each dish is incubated at room temperature for 1 h with the appropriate 

treatment: sterile 0.03 M MgSO 4 (used as a negative control) or bacterial 

suspensions in sterile 0.03 M MgSO 4. Following incubation with each treatment, 

the seeds are placed in growth pouches with sterilized forceps: six seeds 

are set in each growth pouch and ten pouches are used for each treatment. 

The pouches are grouped together according to treatment and placed upright 

in a rack (Northrup King Co., Minneapolis, MN, USA) ensuring that the 

pouches are not touching. Two empty pouches are placed at the ends of each 

rack. Racks are placed in a clean plastic bin containing sterile distilled water, 

to a depth of approximately 3 cm, and covered loosely with clear plastic wrap 

to prevent dehydration. Pouches are incubated in a growth chamber (Conviron 

CMP 3244, Controlled Environments Ltd., Winnipeg, MB, Canada) which 

is maintained at 20±1 °C with a cycle beginning with 12 h of dark followed by 

12 h of light (18 mmol m –1 s –1 ). Each rack is positioned such that the center of 

the row of pouches is 8in. below and 5 in. lateral to the light source. The primary 

root lengths are measured on the fifth day of growth and the data are 

analyzed. Seeds that fail to germinate 2 days after they were sown are marked 

and the roots that subsequently develop from these seeds are not measured. 

5 Measurement of ACC Deaminase Activity 

ACC deaminase activity is assayed according to the method of Honma and 

Shimomura (1978) which measures the amount of a-ketobutyrate when the 

enzyme, ACC deaminase, cleaves ACC. The number of mmoles of a-ketobutyrate 

produced by this reaction is determined by comparing the absorbance 

at 540 nm of a sample to a standard curve of a-ketobutyrate ranging between 

0.1 and 1.0 mmol (Fig. 1). A stock solution of 100 mM a-ketobutyrate (Sigma- 

Aldrich Co.) is prepared in 0.1 M Tris-HCl pH 8.5 and stored at 4 °C. Just prior

494 

Absorbance at 540 nm 

1.6 

1.4 

1.2 

1 

0.8 

0.6 

0.4 

0.2 


0 

0 0.2 0.4 0.6 0.8 1 

-ketobutyrate, moles 

to use, the stock solution is diluted with the same buffer to make a 10-mM 

solution from which a standard concentration curve is generated. Each in a 

series of known a-ketobutyrate concentrations is prepared in a volume of 

200 ml and transferred to a glass test tube (100x13 mm); each point in the 

series is assayed in duplicate. Three hundred ml of the 2,4-dinitrophenylhydrazine 

reagent (0.2 % 2,4-dinitrophenyl-hydrazine in 2 N HCl; Sigma- 

Aldrich Co.) is added to each glass tube and the contents are vortexed and 

incubated at 30 °C for 30 min during which time the a-ketobutyrate is derivatized 

as a phenylhydrazone. The color of the phenylhydrazone is developed by 

the addition of 2.0 ml of 2 N NaOH; after mixing, the absorbance of the mixture 

is measured at 540 nm. 

5.1 Assay of ACC Deaminase Activity in Bacterial Extracts 

Fig. 1. Standard curve of 

a-ketobutyrate versus 

absorbance at 540 nm 

5.1.1 Preparation of Bacterial Extracts 

ACC deaminase activity is measured in bacterial extracts prepared in the following 

manner. Bacterial cell pellets, prepared as described in Section 3, are 

each suspended in 1 ml of 0.1 M Tris-HCl, pH 7.6 and transferred to a 1.5-ml 

microcentrifuge tube. The contents of the 1.5-ml microcentrifuge tube are 

centrifuged at 16,000xg for 5 min in a Brinkmann microcentrifuge and the 

supernatant is removed with a fine-tip transfer pipette. The pellet is suspended 

in 600 ml of 0.1 M Tris-HCl, pH 8.5. Thirty ml of toluene is added to the 

cell suspension and vortexed at the highest setting for 30 s.At this point, a 100ml 

aliquot of the “toluenized cells” is set aside and stored at 4 °C for protein 

assay at a later time. The remaining toluenized cell suspension is immediately 

assayed for ACC deaminase activity.


5.1.2 Measurement of ACC Deaminase Activity 

All sample measurements are carried out in duplicate. Two hundred ml of the 

toluenized cells is placed in a fresh 1.5-ml microcentrifuge tube; 20 ml of 0.5 M 

ACC is added to the suspension, briefly vortexed, and then incubated at 30 °C 

for 15 min. Following the addition of 1 ml of 0.56 N HCl, the mixture is vortexed 

and centrifuged for 5 min at 16,000xg in a Brinkmann microcentrifuge 

at room temperature. One ml of the supernatant is vortexed together with 

800 ml of 0.56 N HCl in a clean glass tube (100x13 mm). Thereupon, 300 ml of 

the 2,4-dinitrophenylhydrazine reagent (0.2 % 2,4-dinitrophenylhydrazine in 

2 N HCl) is added to the glass tube, the contents vortexed and then incubated 

at 30 °C for 30 min. Following the addition and mixing of 2 ml of 2 N NaOH, 

the absorbance of the mixture is measured at 540 nm. 

The absorbance of the assay reagents including the substrate, ACC, and the 

bacterial extract are taken into account. After the indicated incubations, the 

absorbance at 540 nm of the assay reagents in the presence of ACC is used as 

a reference for the spectrophotometric readings; it is subtracted from the 

absorbance of the bacterial extract plus the assay reagents in the presence of 

ACC. The contribution of the extract, i.e., the absorbance at 540 nm of extract 

and the assay reagents without ACC, is determined and subtracted from the 

absorbance value calculated above. This value is used to calculate the amount 

of a-ketobutyrate generated by the activity of ACC deaminase. 

6 Measurement of ACC in Plant Roots, Seed Tissues and Seed 

Exudates 

In order to be able to test the model described earlier, we required a method 

of measuring ACC in plant tissues. Since all of the available methods for ACC 

quantification had problems and limitations associated with their use, we 

adapted the Waters AccQ•Tag Method, designed to measure amino acids, for 

ACC analysis. This procedure is simple and relatively sensitive. ACC, which is 

an amino acid, is derivatized with the Waters AccQ•Fluor reagent; the ACC 

derivatives are separated by reversed phase HPLC and quantified by fluorescence.We 

have used this procedure to quantify the amount of ACC in extracts 

of germinating canola seeds, seedling roots, and seed exudate (Penrose et al. 

2001; Penrose and Glick 2001). 

6.1 Collection of Canola Seed Tissue and Exudate During Germination 

Canola seed tissue and exudate is collected from 200-seed samples exposed to 

various treatments and then incubated in the dark for up to 50 h. The seeds 

are disinfected immediately before use. Two hundred seeds (0.400±0.008 g)

496 


are measured into an aluminum weigh boat and soaked in 5 ml of 10 % hydrogen 

peroxide at room temperature (Bayliss et al. 1997).After 2 min, the hydrogen 

peroxide solution is removed by suction and the seeds are rinsed with 

sterile distilled water at least four times. Each dish is then incubated at room 

temperature for 1 h with 5 ml of the appropriate treatment: 0.03 M MgSO 4, 

(used as a negative control) or bacterial cells (grown as described in Sect. 3) 

suspended in 0.03 M MgSO 4 and diluted to an absorbance of 0.15 at 600 nm. 

Following incubation, the solution used for seed treatment (0.03 M MgSO 4 or 

bacterial suspension) is removed from the seeds and they are rinsed twice 

with sterile distilled water.After the water is removed by suction, the seeds are 

transferred to a 100-mm nylon sterile cell strainer (Becton Dickinson Labware, 

Franklin Lakes, NJ, USA) set into a sterile disposable polypropylene 

Petri plate (60x15 mm). One ml of autoclaved distilled water is added to each 

Petri dish and the Petri plates are placed in loosely covered plastic containers. 

The containers are incubated in the dark at 20±1 °C. After 20 h of incubation, 

1 ml of sterile water is added to the remaining Petri dishes and following 44 h 

of incubation, another1 ml of water is added to the samples. 

At specified times after seed treatment, duplicate Petri plates are removed 

from the growth chamber. The cell sieve is removed from each Petri plate and 

the seeds transferred by sterile forceps to autoclaved screw-capped 1.5-ml 

microcentrifuge tubes (VWR Canlab, Canada). The tubes are immediately 

placed in liquid nitrogen and the frozen seeds stored at –80 °C. 

After the germinating seedlings have been gathered from the strainers at 

each time point, the seedling exudate is removed from the Petri plate (and any 

clinging to the cell strainer) with a 1-ml sterile disposable syringe fitted with 

a #20 gauge needle (Becton Dickinson Labware, Franklin Lakes, NJ, USA). The 

exudate is filtered through a 0.2-mm sterile syringe filter (Gelman Sciences, 

Ann Arbour, MI, USA), pre-wetted with sterile distilled water. The filtrate is 

collected into 1.5-ml glass vials (12x32 mm) capped with silicon septa (75/10) 

and polypropylene open top lids (Chromatographic Specialities Inc., Brockville, 

ON, Canada) and immediately frozen at –80 °C. 

6.2 Preparation of Plant Extracts 

We used a modification of the protocol described by Siefert et al. (1994) to 

make extracts of the canola seed-samples and the roots of the 4.5-day-old 

seedlings grown for the root elongation assay. Roots excised from the approximately 

60 seedlings grown for the root elongation assay, are set in aluminum 

weigh boats, immediately frozen in liquid nitrogen and stored at –80 °C.All of 

the glassware used in the preparation of crude plant extracts, i.e., mortars and 

pestles, solution bottles, centrifuge tubes, pipettes, Pasteur pipets, and glass 

vials and silicon septa, is heated overnight at 275 °C and cooled to room temperature 

just prior to use. Each of the frozen tissue samples is ground in a pre-


chilled mortar and pestle, suspended in 2.5 ml of 0.1 M sodium acetate pH 5.5 

and kept on ice for 15 min. The contents of the mortar are scraped into a 15ml 

glass centrifuge tube and the mortar and pestle are rinsed with 0.5 ml of 

the same buffer. The ground tissue suspension, together with the rinses, is 

centrifuged in an SS34 rotor at 17,500xg in a Sorvall R5C/B centrifuge for 

15 min at 4 °C to remove cell debris. The supernatant is collected and clarified 

by centrifugation in a Beckman L8–70 ultracentrifuge at 100,000¥g in a 70.1 

Ti rotor for 1 h at 4 °C and then, if necessary, by an additional centrifugation 

at 100,000xg for 15 min. The clarified supernatant is collected and distributed 

into 1-ml aliquots, some of which are stored at –80 °C in glass vials for ACC 

determination by HPLC, and the remainder stored in 1.5-ml microcentrifuge 

tubes at 4 °C for protein determination. 

6.3 Protein Concentration Assay 

The protein concentrations are measured according to a protocol based on 

the method of Bradford (1976) and BSA (bovine serum albumin) is used as 

the standard protein. Each point on the standard curve and all of the samples 

are assayed in triplicate. 

6.3.1 Protein Concentration Assay of Bacterial Extracts 

The 100-ml aliquots of toluenized cell suspensions, which have been set aside 

and stored at 4 °C during the preparation of crude bacterial cell extracts, are 

each mixed with 100 ml of 0.1 N NaOH and incubated for 10 min at 100 °C. 

After the mixtures have cooled, between 20 and 50 ml of each sample is transferred 

to a clean glass test tube (100x13 mm); the volume is adjusted to 100 ml 

with 0.1 M Tris-HCl pH 8.5, and 5 ml of the diluted dye reagent is added to the 

tube. The contents of the tube are vortexed and incubated for 5–20 min at 

room temperature. The absorbance of the samples is measured at 595 nm. 

6.3.2 Protein Concentration Assay of Plant Extracts 

Aliquots of the plant extracts, set aside and stored at 4 °C, are each transferred 

to clean glass test tubes (100x13 mm) and the volume is adjusted to 100 ml 

with 0.1 M sodium acetate pH 5.5. Varying amounts of the different extracts 

are transferred to the tubes, depending on the concentration of the extract: 

routinely, 30 ml of seed extract and 100 ml of root extract are used. Sufficient 

buffer is added to each tube to bring the volume up to 100 mL.After 5 ml of the 

diluted dye reagent are added to each test tube, it is vortexed and incubated at 

room temperature between 5 and 20 min. The absorbance of each sample is 

measured at 595 nm.

498 


6.4 Measurement of ACC by HPLC 

6.4.1 Chemicals 

The Waters AccQ •Fluor Reagent Kit, AccQ•Tag eluent A concentrate (a premixed 

concentrated acetate-phosphate buffer) and the amino acid standard, a 

mixture of 17 amino acids (tryptophan, glutamine, and asparagine not 

included) each at a concentration of 2.5 mM with the exception of cysteine 

which is 1.25 mM, are supplied by Waters Limited. The Waters AccQ•Fluor 

Reagent Kit contains the chemicals for derivatization: AccQ•Fluor reagent 

powder (6-aminoquinolyl-N-hydroxysuccinimidyl carbamate; AQC), AccQ• 

Fluor reagent borate buffer and AccQ•Fluor reagent diluent (acetonitrile). 

ACC, b- and g-aminobutyric acid are purchased from Calbiochem- 

Novabiochem Corp. (La Jolla, CA, USA), HPLC grade acetonitrile from Caledon 

Laboratories (Georgetown, ON, Canada), a-aminobutyric acid from 

Fisher Scientific, and L-a-(2-amino-ethoxyvinyl) glycine hydrochloride 

(AVG) from Sigma-Aldrich Co. All water used is purified by a Milli-Q Water 

System (Millipore Co. Bedford, MA, USA), autoclaved and then filtered 

through a 0.45-mm HA filter (Millipore Co. Bedford, MA, USA). 

6.4.2 Treatment of Glassware 

All glassware used in this procedure is washed and then flushed at least six 

times with tap water, twice with deionized water and twice more with distilled 

water. Just prior to use, the cleansed glassware is wrapped in aluminum foil, 

heated overnight at 275 °C and cooled to room temperature. Solutions and 

samples are stored in heat-treated bottles and vials (including septa and lids). 

6.4.3 Preparation of Standard Solutions 

Stock 2.5-mM solutions of ACC,a-aminobutyric acid,b-aminobutyric acid,gaminobutyric 

acid, and a mixture of 17 amino acids are prepared in 25 ml of 

0.1 N HCl in a 25-ml volumetric flask. These solutions are diluted with sterile 

distilled water to yield a concentration of 0.1 mM. The 2.5-mM and 0.1-mM 

stock solutions are divided into 0.5-ml aliquots, frozen at –20 °C, thawed once 

when needed and then discarded.With the exception of ACC,the 0.1-mM solutions 

are further diluted with sterile distilled water to generate concentrations 

between 5 and 25 pmol/20 ml injection. Dilutions of the 0.1-mM solutions of 

ACC yield between 1 and 25 pmol ACC/20 ml injection. Standard mixtures of 

ACC,a-,b-,and g - aminobutyric acids are prepared in sterile distilled water to 

yield 12.5 pmol/20 ml injection. The amino acid standard is diluted such that 

each 20-ml injection included 25 pmol of each of the 17 amino acids with the 

exception of the amount of cysteine which was 12.5 pmol.Aliquots of the standard 

solutions are frozen at –20 °C, and when required, thawed once and used.


6.4.4 Derivatization Procedure 

Standard solutions of ACC; ACC, a-, b- and g -aminobutyric acids; the amino 

acids and plant extracts are coupled with ACQ according to the directions in the 

Waters AccQ•Fluor Reagent Kit Instruction Manual.The AccQ•Fluor derivatization 

reagent, once reconstituted, is stable for 1 week. The derivatization reagent 

is reconstituted by adding 1 ml of acetonitrile (vial 2B) to the AccQ•Fluor 

reagent powder, vortexing for 10 s, and heating on top of a 55 °C heating block 

for no more than 10 min to dissolve the powder.The concentration of the reconstituted 

AccQ•Fluor reagent is approximately 10 mM in acetonitrile; amino acid 

derivatization is optimal when the reconstituted AccQ•Fluor reagent is in excess 

and the pH is between pH 8.2 and 10. The derivatization reactions are carried 

out in duplicate in 6x55 mm glass sample tubes (Waters Limited).Ten ml of standard 

or sample solution is placed in each tube; 70 ml of AccQ•Fluor borate buffer 

is added to it and the mixture is immediately vortexed for several seconds. Following 

the addition of 20 ml of reconstituted AccQ•Fluor, the mixture is briefly 

vortexed again,allowed to stand at room temperature for 1 min and then heated 

at 55 °C for 2 min in a heating block. Once cooled to room temperature 

(5–10 min) the solution may be injected immediately or sometime during the 

next week.Amino acids derivatized by this procedure are quite stable and can be 

stored at room temperature for at least 1 week. 

6.4.5 HPLC Determination of ACC Content 

The AccQ•Tag Column, a high-efficiency 4 mm Nova-Pak C 18 column specifically 

certified for use with the AccQ•Tag Method (Waters Limited) is used to 

separate the amino acid derivatives produced by the AccQ•Fluor derivatization 

reaction, and a Hewlett Packard column heater is used to maintain the 

column temperature at 37 °C. Amino acid derivatives are detected and measured 

by using a Hewlett Packard HPLC system which consists of a 1050 

Series Quaternary Pump and a 104a Programmable Fluorescence Detector. A 

PC computer system (DTK 3300 386/33) is used to run the supporting computer 

software, i.e., Hewlett Packard’s ChemStation (DOS Series). 

The solvent system includes eluent A, a diluted solution of Waters AccQ•Tag 

acetate-phosphate buffer concentrate prepared daily, (50 ml concentrate 

diluted with 500 ml 18 Megohm Milli–Q water), eluent B, HPLC-grade acetonitrile, 

and eluent C, 18 Megohm Milli-Q water. The solvents are continuously 

sparged with helium and the solvent lines are purged for at least 60 s 

prior to use to remove any air bubbles present. The AccQ•Tag column is conditioned 

with 60 % eluent B/40 % eluent C at a flow rate of 1 ml/min for 30 min 

and then equilibrated with 100 % eluent A for 10 min at a flow rate of 1 ml/min 

before injection of the first sample. The gradient recommended by Waters 

Limited for separation of the AccQ•Tag-labelled amino acids was modified to 

enhance resolution of the ACC peak (Table 2).

500 


Table 2. Gradient table for Waters AccQ•Tag system modified for ACC elution 

Time (min) Flow rate (ml/min) A (%) B (%) C (%) 

0 1.0 100.0 0 0 

0.5 1.0 99.0 1.0 0 

3.0 1.0 91.0 9.0 0 

13.0 1.0 88.0 12.0 0 

14.0 1.0 83.0 17.0 0 

16.0 a 1.0 0 60 40 

18.0 1.0 100.0 0 0 

23.0 1.0 100.0 0 0 

Abbreviations: A, Waters AccQ•Tag acetate-phosphate buffer concentrate (50 ml diluted 

with 500 ml 18 Megohm Milli-Q water); B, HPLC-grade acetonitrile; C, 18 Megohm Milli- 

Q water 

a From this point in the gradient, the column is washed and conditioned for the next 

sample 

The Hewlett Packard 104a Programmable Fluorescence Detector is set up 

according to the Waters AccQ•Tag Amino Acid Analysis Method and is turned 

on at least 40 min prior to sample injection. The settings are as follows: excitation 

wavelength, 250 nm; emission wavelength, 395 nm; response time, 4; 

pmt gain, 15, and lamp setting, 3–5 W/220 Hz. 

Once the column is conditioned and equilibrated, and the detector is 

warmed up, a standard solution, containing 12.5 pmol of a-, b-, and g - 

aminobutyric acid, is injected. Following the injection of standard solutions, 

samples are injected and analyzed; the run time for each sample is 23 min and 

includes washing and re-equilibrating the column following the separation of 

the derivatized amino acids. Duplicates of each standard and sample are 

derivatized and injected. The needle port is rinsed with eluent A prior to each 

injection in order to reduce contamination from previously injected samples. 

The injection volume of all samples including blanks, standards and plant 

extracts is 20 ml. Plant tissue extracts are diluted just prior to derivatization. 

The quantity of sample hydrolyzed and derivatized in 20 ml is estimated to be 

0.1–1.0 mg (4–40 pmol) of protein, based on a protein average molecular 

weight of 25,000 Daltons. 

6.4.6 Quantification of ACC 

The amount of ACC in samples is quantified by using an ACC standard curve 

that is linear between 1 and 25 pmol of ACC per sample (Fig. 2). The ACC standard 

curve is prepared from a fresh stock solution of ACC (0.1 mM) diluted 

with sterile distilled water to yield between 1 and 25 pmol of ACC/20-ml injection. 

The ACC dilutions are derivatized, and following injection, are eluted


Fig. 2. Standard curve of 

ACC measured in fluorescence 

units 

Fluorescence units 

20000 

15000 

10000 

5000 

from the AccQ•Tag column at approximately 7.6 min. Similar standard curves 

may be prepared for a-, b- and g- aminobutyric acid, metabolites of ACC, 

which are eluted from the AccQ•Tag column at 8.2, 8.7 and 9.2 min, respectively. 


0 5 10 15 20 25 

ACC, pmoles 

Abeles FB, Morgan PW, Saltveit ME Jr (1992) Ethylene in plant biology, 2nd edn. Academic 

Press, New York 

Bayliss C, Bent E, Culham DE, MacLellan S, Clarke AJ, Brown GL, Wood JM (1997) Bacterial 

genetic loci implicated in the Pseudomonas putida GR12–2R3 – canola mutualism: 

identification of an exudate-inducible sugar transporter. Can J Microbiol 

43:809–818 

Bradford M (1976) A rapid and sensitive method for the quantitation of microgram 

quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 

73:248–258 

Dworkin M, Foster J (1958) Experiments with some microorganisms which utilize 

ethane and hydrogen. J Bacteriol 75:592–601 

Glick BR, Karaturovíc DM, Newell PC (1995) A novel procedure for rapid isolation of 

plant growth promoting pseudomonads. Can J Microbiol 41:533–536 

Glick BR, Penrose DM, Li J (1998) A model for the lowering of plant ethylene concentrations 

by plant growth-promoting bacteria. J Theor Biol 190:63–68 

Honma M, Shimomura T (1978) Metabolism of 1-aminocyclopropane-1-carboxylic acid. 

Agric Biol Chem 42:1825–1831 

Jacobson CB, Pasternak JJ, Glick BR (1994) Partial purification and characterization of 1aminocyclopropane-1-carboxylate 

deaminase from the plant growth promoting rhizobacterium 

Pseudomonas putida GR12–2. Can J Microbiol 40:1019–1025 

Lifshitz R, Kloepper JW, Scher FM, Tipping EM, Laliberté M (1986) Nitrogen-fixing 

Pseudomonads isolated from roots of plants grown in the Canadian High Arctic.Appl 

Environ Microbiol 51:251–255

502 


Lifshitz R, Kloepper JW, Kozlowski M, Simonson C, Carlson J, Tipping EM, Zaleska I 

(1987) Growth promotion of canola (rapeseed) seedlings by a strain of Pseudomonas 

putida under gnotobiotic conditions. Can J Microbiol 33:390–395 

Ma J-H, Yao J-L, Cohen D, Morris B (1998) Ethylene inhibitors enhance in vitro formation 

from apple shoot cultures. Plant Cell Rep. 17:211–214 

Mattoo AK, Suttle CS (1991) The plant hormone ethylene. CRC Press, Boca Raton, FL, p 

337 

Penrose DM, Glick BR (2001) Levels of 1-aminocyclopropane-1-carboxylic acid (ACC) in 

exudates and extracts of canola seeds treated with plant growth-promoting bacteria. 

Can J Microbiol 47:368–372 

Penrose DM, Moffatt BA, Glick BR (2001) Determination of 1-aminocyclopropane-1-carboxylic 

acid (ACC) to assess the effects of ACC deaminase-containing bacteria on 

roots of canola seedlings. Can J Microbiol 47:77–80 

Shah S, Li J, Moffatt BA, Glick BR (1997) ACC deaminase genes from plant growth promoting 

bacteria. In: Ogoshi A, Kobayashi K, Homma Y, Kodama F, Kondo N, Akino S 

(eds) Plant growth-promoting rhizobacteria: present status and future prospects. 

OECD, Paris, pp 320–324 

Siefert F, Langebartels C, Boller T, Grossmann K (1994) Are ethylene and 1-aminocyclopropane-1-carboxylic 

acid involved in the induction of chitinase and b-1,-3-glucanase 

activity in sunflower cell-suspension cultures? Planta 192:431–440 

Yang SF, Hoffman NE (1984) Ethylene biosynthesis and its regulation in higher plants. 

Annu Rev Plant Physiol 35:155–189

27 Applications of Quantitative Microscopy in 

Studies of Plant Surface Microbiology 



“Sometimes what counts can’t be counted, 

and what can be counted doesn’t count.” 

(Albert Einstein) 

Whereas the animal carries its major community of indigenous microflora 

(generally of a beneficial kind) on the moist warm walls of its peristaltic gut, 

the plant does likewise, but on its entire exposed surfaces, from apical tip to 

root cap. These plant surfaces represent an oozing, flaking layer of integument 

which discharges a wide range of substances that support a vast number of 

spatially discrete and specialized microbial communities, including parasites 

and symbionts that can have a major impact on plant growth and development. 

A modern view of the plant surface is now seen as a dynamic adaptable 

envelope, flexible in both its import and export of materials, forming a 

plant–microbe ecosystem in its own right and the first barrier between the 

moist, concentrated, balanced plant cell and a hostile ever-changing external 

environment. 

Manipulation of the plant surface microflora to improve its health is a longstanding 

goal in plant microbiology. However, efforts to exploit this type of 

biological control have frequently been impeded because of major technical 

difficulties that must be overcome to fully understand the microbial ecology 

of this ecosystem, especially the lack of ability to extract in situ data that are 

both informative and quantifiable at spatial scales relevant to the ecological 

niches of the microorganisms involved. 

Most of this chapter describes the author’s development and utilization of 

quantitative microscopy in studies of plant surface microbiology. The majority 

of this work has been done to gain a better understanding of the Rhizobium-legume 

root-nodule symbiosis. Various types of microscopy have been 

employed, including brightfield, phase-contrast, Nomarski-interference contrast, 

polarized light, real-time and time-lapse video, darkfield, conventional 

and laser scanning confocal epifluorescence, scanning electron, transmission 




504 


electron, and field-emission scanning/transmission electron microscopies 

combined with visual counting techniques and manual interactive applications 

of image analysis. More recently, the author has led a team of scientists 

to develop a new generation of innovative, customized image analysis software 

designed specifically to analyze digital images of microbial populations 

and communities and extract all the informative, quantitative data of in situ 

microbial ecology from them at spatial scales relevant to the microbes themselves. 

We have begun to apply this new computer-assisted imaging technology 

to the fascinating field of plant surface microbiology. The chapter 

includes many figures that exemplify how the awesome resolving power of the 

microscope has significantly enhanced our understanding of plant surface 

microbiology, and richly illustrates how this topic area is even more enhanced 

with the added dimension of quantitation using computer-assisted digital 

image analysis. 


Rhizobium and Legumes by Visual Counting Techniques 

2.1 The Modified Fåhraeus Slide Culture Technique for Studies of the 

Root–Nodule Symbiosis 

The slide culture technique of Fåhraeus (1957) was the single, most important 

method developed to facilitate the microscopical examination of the infection 

process in the Rhizobium-legume symbiosis, especially with small-seeded 

legumes like white clover in symbiosis with its root-nodule endosymbiont, R. 

leguminosarum bv. trifolii. This simple method of culturing the symbionts 

under microbiologically controlled conditions made it possible to examine 

the interactions between the plant and microbial symbionts by various types 

of microscopy, including a classic time-lapse cinema depicting the developmental 

morphology of clover root hair infection (Nutman et al. 1973). Phase 

contrast microscopy using this slide culture technique also revealed the paramount 

importance of host specificity in the infection process at the stage of 

infection thread formation within host root hairs (Li and Hubbell 1969). 

The original Fåhraeus slide method involved vertical cultivation of a 

seedling on a microscope slide within a large enclosed tube containing an isotonic 

nitrogen-free plant culture medium, and with its root inoculated with 

rhizobia embedded in an agar medium beneath a large cover slip (Fåhraeus 

1957).Various modifications of this slide culture technique have been made to 

further facilitate detailed microscopical examinations of the infection 

process. For instance, the embedding agar was found unnecessary even for 

cultivation of two seedlings per slide. Elimination of the embedding agar permitted 

the symbionts to interact unimpeded by this fibrous matrix, the roots 

to be processed more consistently and efficiently after an appropriate period

27 Applications of Quantitative Microscopy in Plant Surface Microbiology 505 

of incubation, and more detailed microscopy to be performed with a cleaner, 

phase-transparent background. These added features have significantly 

improved the signal-to-noise ratio of image quality, making it possible to 

accurately quantify many of the pre-infection and post-infection events 

occurring on root hairs in vivo at single bacterial cell resolution, including 

rhizobial attachment to root hairs (phenotype Roa) of constant length by 

phase-contrast microscopy (Dazzo et al. 1976; Dazzo 1982). The results of 

studies using this quantitative microscopical counting technique revealed 

important spatio-temporal aspects of the Roa phenotype, including its distinct 

cellular orientations/patterns/phases of adhesion, the positive relationship 

of certain patterns of attachment to host specificity, the importance of 

cell-surface glycoconjugates and saccharide-binding host lectins to symbiont 

recognition, the inhibition of symbiont recognition and infection by combined 

nitrogen, and the manipulation of rhizobial genes affecting cell surface 

components and rhizobial attachment to host root hairs (Dazzo and Hubbell 

1975; Dazzo et al. 1976, 1978, 1984; Dazzo and Brill 1978, Sherwood et al. 1984; 

Rolfe et al. 1996). This same modification of the slide culture technique also 

made it possible to quantitate clover root hair infection. Thus, quantitative 

microscopy of the infection process resulted in the discovery of potent, stimulating 

infection-related biological activities of various purified rhizobial 

components required for primary host infection by R. leguminosarum bv. 

trifolii, including its clover lectin-binding acidic heteropolysaccharides and 

corresponding oligosaccharide repeat unit fragments which retained their 

affinity for the clover lectin, its clover lectin-binding lipopolysaccharide glycoform, 

and its diverse family of membrane chitolipooligosaccharides that 

modulate cell wall architecture and growth physiology of these target differentiated 

host cells (Abe et al. 1984; Dazzo et al. 1991, 1996). Further applications 

of this modified Fåhraeus slide technique to study the R. leguminosarum 

bv. trifolii-white clover symbiosis have utilized real-time video 

microscopy and digital image analysis of track-reconstructions to define the 

quantitative influence of root secretions on rhizobial motility in situ in the 

aqueous, external clover root environment (Dazzo and Petersen 1989), and of 

cells and purified lectin-binding lipopolysaccharide of Rhizobium on cytoplasmic 

streaming in root hairs indicating activation of their cytoskeleton 

activity (Dazzo and Petersen 1989, Dazzo et al. 1991).Another modification of 

the Fåhraeus slide technique was to culture seedlings vertically and flat on 

small agarose-solidified plates with a portion of their roots covered with the 

same nitrogen-free medium and small coverslips. This modification plus the 

customized construction of a “horizontal growth station” created the opportunity 

to perform real-time and time-lapse video microscopy of seedling 

roots grown axenically and geotropically with as little as 10 ml volumes of bacterial 

test solutions. Applications of this technique resulted in the detection 

and quantitation of symbiosis-related growth responses of clover root hairs to 

minute quantities of several different types of bioactive metabolites made by

506 


the microsymbiont, R. leguminosarum bv. trifolii under strict microbiologically 

controlled conditions (Dazzo et al. 1987, 1996; Dazzo and Petersen 1989, 

Hollingsworth et al. 1989, Philip-Hollingsworth et al. 1991; Orgambide et al. 

1994, 1996). This technique was also used in conjunction with engineered rhizobia 

containing reporter gene fusions to locate attached rhizobial cells 

expressing pSym nod genes in situ on root hair tips (Dazzo et al. 1988). 

2.2 Attachment of Rhizobia to Legume Root Hairs 

Although attachment of rhizobia to legume root hairs (Roa [Root attachment] 

phenotype) has often been described as a simple, one-step event lacking any 

form of specificity, this is a gross oversimplification of the real case. Instead, 

quantitative time-resolved microscopy at single bacterial-cell resolution 

reveals that Roa is a dynamic, multiphase process including distinct nonspecific 

and host-specific events. Figure 1 summarizes a unified view of this 

dynamic sequence of events involved in attachment of encapsulated rhizobia 

to host legume root hairs (Dazzo et al. 1984). This model culminates in the 

development of the specific Roa-3 pattern of R. leguminosarum bv. trifolii 

attachment to white clover root hairs in modified Fåhraeus slide cultures prepared 

with a relatively small, defined size inoculum of fully encapsulated cells 

(Dazzo et al. 1984). This pattern of rhizobial attachment to root hairs (an 

immobilized aggregate of cells at the root hair tip and individual polarly 

attached cells along the shaft of the same root hair) requires the intervention 

of bacterial proteins and polysaccharides, host lectin, and enzymes that 

Fig. 1. Diagram of the 

dynamic phases of rhizobial 

attachment to 

host root hairs (Roa), 

based on studies using 

phase contrast light 

microscopy, scanning 

electron microscopy, 

and transmission electron 

microscopy. Cell 

sizes are approximately 

proportional. Reprinted 

with permission from 

the American Society 

for Microbiology


Fig. 2. Phase contrast microscopy (A, C, E) and scanning electron microscopy (B, D, F) 

of distinct patterns of attachment of R. leguminosarum bv. trifolii to white clover root 

hairs. A, B Phase 1A=Roa-1, C, D phase 1C=Roa-2, E phase 1A+1C=Roa-3, F phase 2 with 

associated microfibrils. Scale bar A and C 20 mm, B 2 mm, D, F 1 mm, E 15 mm

508 


degrade the bacterial polysaccharides; it exhibits host-selectivity and is found 

on approximately 95 % of successfully infected root hairs in the Rhizobiumwhite 

clover symbiosis (Dazzo and Hubbell 1975; Dazzo et al. 1976, 1982, 1984; 

Dazzo and Brill 1979; Sherwood et al. 1984; Rolfe et al. 1996; Smit et al. 1992). 

The Phase 1A pattern of randomly oriented attachment occurs within 15 min 

of inoculation, and involves an initial nonhost-specific interaction of a rhizobial 

surface protein “rhicadhesin” on individual bacteria with the root hair tip 

(Smit et al. 1992), followed within the first hour by a more host-specific aggregation 

of bacterial cells immobilized at the root hair tip and mediated by an 

excreted, multivalent host lectin. Cells that have not yet attached to the host 

root become polarly encapsulated in the external root environment during 

the next 4–8 h (Phase 1B), due to the combined action of “polarase” enzymes 

in root exudate and de novo synthesis of a new capsule at one cell pole (Dazzo 

et al. 1982; Sherwood et al. 1984). Beginning approximately 4 h after inoculation, 

these polarly encapsulated cells attach “end-on”, i.e., perpendicular to 

the surface along the sides of the same root hair (phase 1C). Phase 1 attachment 

is distinguished from phase 2 adhesion by the significantly increased 

strength of adhesion of attached cells detected approximately 12 h after inoculation, 

concurrent with the elaboration of extracellular microfibrils that 

increase the degree of contact of the attached bacteria to the root hair surface 

(Dazzo et al. 1984). Indeed, this strength of Phase 2 rhizobial adhesion to 

legume host root hairs is immense, exceeding that which anchors some root 

hairs onto the root itself! Figure 2A–F is a series of phase contrast light micrographs 

and scanning electron micrographs that illustrate each of these distinct 

patterns of rhizobial attachment to white clover root hairs (Dazzo and 

Brill 1979; Dazzo et al. 1984). 

2.3 Rhizobium-Induced Root Hair Deformations 

Root hairs on axenic seedlings are straight, but become deformed (Had [Hair 

deformation] phenotype) during growth in response to various bioactive 

metabolites made by rhizobia. Four different morphotypes of white clover 

Had are induced under axenic conditions by minute quantities of purified 

bioactive Nod metabolites made by R. leguminosarum bv. trifolii. These are 

root hair distortions, tip swellings, branches, and corkscrews induced by rhizobial 

membrane chitolipooligosaccharides, N-acetylglutamic acid, and 

diglycosyl diacylglycerol glycolipids (Philip-Hollingsworth et al. 1991; 

Orgambide et al. 1994, 1996; Dazzo et al. 1996a, b;). Collectively called moderate 

Had, these various types of root hair deformations are less symbiont-specific 

than marked curling of the root hair tip (commonly referred to as the 

“Shepherd’s crook” Hac [Hair curling] phenotype). This Hac morphotype is 

illustrated in Fig. 3 and requires close proximity of viable cells of the homologous 

symbiont (Li and Hubbell 1969; Yao and Vincent 1976). This figure is a


Fig. 3. Portion of a white clover root hair that 

has undergone a markedly curled deformation 

induced by Rhizobium leguminosarum 

bv. trifolii. This optisection obtained using 

laser scanning confocal microscopy and 

immunofluorescence staining with a strainspecific 

monoclonal antibody to the bacterial 

LPS provides direct evidence that the center of 

the shepherd’s crook overlap contains a clump 

of rhizobia. Scale bar 7.5 mm 

laser scanning confocal epifluorescence micrograph that elegantly provides 

direct evidence that the overlap of the shepherd’s crook entraps a clump of 

rhizobial cells, as has long been predicted, but not convincingly shown before. 

In this case, the confocal image is an optisection located at the optical median 

plane of the curled root hair cell, and it definitively shows the immunofluorescent 

rhizobia detected by using a fluorescent monoclonal antibody to their 

lipopolysaccaride (LPS) somatic O-antigen. It has been predicted that the 

confining morphological structure of the shepherd’s crook serves to concentrate 

in a localized region the metabolic events of microsymbiont penetration 

while preventing lysis of the root hair during primary host infection (Napoli 

et al. 1975a; Napoli and Hubbell 1976; Dazzo and Hubbell 1982). 

2.4 Primary Entry of Rhizobia into Legume Roots 

Figure 4 illustrates a rhizobial-induced infection thread in white clover root 

hairs. Successful infections of this type typically exhibit a bright refractile 

spot in the center overlap of markedly curled root hair tips, and infection 

threads that have elongated through the root hair to its base.A central event of 

this infection process in the Rhizobium-legume symbiosis is the modification 

of the host cell wall barrier to form a portal of entry large enough for bacterial 

penetration. Transmission electron microscopy indicates that rhizobia 

enter the legume root hair through a completely eroded hole that is slightly 

larger than the bacterial cell (generally 2–3 mm in diameter) and is presumably 

created by localized enzymatic hydrolysis of the host cell wall (Napoli 

and Hubbell 1976; Callaham and Torrey 1981). Time-lapse cinema microscopy 

(Nutman et al. 1973) has elegantly shown that the root hair ceases to

510 


Fig. 4. Phase contrast micrograph of primary 

host infection in the Rhizobium–legume symbiosis. 

Note the prominent infection thread 

(arrow) within the deformed root hair cell. 

Scale bar 10 mm 

elongate during the inward growth of the infection thread, which proceeds at 

approximately the same elongation rate. This inward growth of the infection 

thread is led by a mobile nucleus and a flurry of cytoplasmic streaming within 

the root hair (Nutman et al. 1973). Successful infections are best quantitated 

by visual counting while viewed by phase contrast microscopy; light staining 

of the infection thread with methylene blue can enhance contrast to detect 

them. Distinctions of successful vs. unsuccessful infections can be made by 

detailed microscopical examination to assess whether the infection thread 

has grown to the root hair base and penetrated into the underlying subepidermal 

cortical cell. Infective rhizobia engineered with Gus or green fluorescent 

protein reporter genes can facilitate the detection of infected root hairs, 

but this is overkill for skilled microscopists. 

An alternate primitive route of primary host infection of legumes leading 

to effective nodule formation is the crack entry of rhizobia into natural 

wounds of the host plant epidermis. This commonly occurs in many tropical 

legumes (Napoli et al. 1975b) and some temperate legumes, but can also occur 

infrequently in anomalous ineffective nodulations by rhizobia outside their 

normal cross-inoculation group (Hrabak et al. 1985). In the aquatic legume 

Neptunia natans where root hairs do not normally develop, the natural splitting 

of the epidermis during development of the spongy aerenchyma and 

emergence of adventitious and lateral roots create openings that allow “crack 

entry” of the rhizobial symbiont, Allorhizobium undicola, Rhizobium undicola, 

or Devosia neptuniae, as the normal mode of primary host infection 

(Subba-Rao et al. 1995). 

Recently, an interesting novel combination of infection events has been 

found to occur in development of the root-nodule symbiosis of rhizobia with 

tagasaste (Chamaecytisus proliferus L.), a legume indigenous to the Canary 

Islands near the west coast of Africa. In this symbiosis, primary host infection 

initially involves rhizobial deformation and penetration of host root hairs, but 

all these primary host infections abort and the rhizobia then revert to a crack 

entry mode of invasion directly into the emerging root nodules without 

development of infection threads (Vega-Hernandez et al. 2001). Quite a 

remarkable, unique mode of plant infection by surface rhizobia!


2.5 In Situ Molecular Interactions Between Legumes Roots and Surface- 

Colonizing Rhizobia 

Microscopy has played a central role in elucidating molecular events important 

to the development of the Rhizobium-legume root-nodule symbiosis. The 

use of various molecular probes combined with the awesome resolving power 

of the microscope has made it possible to dissect and locate key molecules 

that participate in primary host infection, including the cell surface interfaces 

during symbiotic recognition, attachment, deformation, and root hair penetration, 

and also in root nodule development. Various types of microscopy 

that can view intact living cells noninvasively have added new dimensions to 

unraveling the symbiotic interactions of potent rhizobial signal molecules 

with host cells, including the precise localization of specific binding receptor 

sites on the host root surface, the rapid internalization of certain rhizobial signal 

communication molecules within root hairs and their transfer to underlying 

cortical cells, and various other infection-related host cell responses. The 

significance of all of these studies is improved when the various microscopical 

techniques are accompanied by quantitative methods of data acquisition. 

Some examples of in situ “molecular microscopy” in studies of plant surface 

microbiology are illustrated here. 

2.6 Cross-Reactive Surface Antigens and Trifoliin A Host Lectin 

Rhizobium leguminosarum bv. trifolii and white clover roots share related 

surface components that are antigenically cross-reactive (Dazzo and Hubbell 

1975; Dazzo and Brill 1979). Quantitative immunofluorescence microscopy 

indicates that these cell-surface antigens are transient, symbiont-specific, 

infection-related, and participate in the host lectin-mediated stage of symbiont 

recognition on the clover root hair surface (Dazzo and Hubbell 1975; 

Dazzo and Brill 1979; Dazzo et al. 1979). Transformation of Azotobacter 

vinelandii with DNA from R. leguminosarum bv. trifolii resulted in hybrid 

recombinants that expressed these symbiotic cross-reactive antigens (Bishop 

et al. 1977), and these recombinants gained the ability to carry out the phase 

1A pattern of bacterial cell attachment to white clover root hair tips (Dazzo 

and Brill 1979). The cell surface location of these epitopes plus their infection-related 

symbiont-specificity, interaction with the multivalent white 

clover root lectin, and role in cell attachment formed the basis for proposing 

their involvement as cell-surface receptors in a lectin cross-bridging model 

of symbiont recognition during early stages of primary host infection 

(Dazzo and Hubbell 1975; Dazzo and Brill 1979). Recent studies using plant 

molecular biology techniques have provided substantial evidence supporting 

the validity of this cross-bridging model (van Rhijn et al. 1998; Hirsch 

1999).

512 


Fig. 5. Symbiont-specific interaction of trifoliin A white clover lectin and R. leguminosarum 

bv. trifolii. A, B Transmission electron microscopy, C–F conventional immunofluorescence 

microscopy using antibody to purified trifoliin A. A The historical micrograph 

which suggested the involvement of a particulate cross-bridging clover lectin in 

the attachment of encapsulated R. leguminosarum bv. trifolii cells to host root hairs. 

B Negatively stained particles of purified trifoliin A white clover lectin. C Distribution of 

trifoliin A on root hair tips of white clover seedlings. D Intense binding of root-derived 

trifoliin A to R. leguminosarum bv. trifolii. E In situ binding of trifoliin A to the polar 

capsule of R. leguminosarum bv. trifolii cultured in the external clover root environment. 

F Direct detection of trifoliin A at the contact interface (arrow) of rhizobial cells polarly 

attached to a white clover root hair. Scale bar A 1 mm, B 25 nm, C 50 mm, D, E F 2 mm. 

Reprinted with permission from the American Society for Microbiology


The ultrastructure of the docking stage of rhizobial attachment to the 

clover root hair surface is illustrated in Fig. 5A. This transmission electron 

micrograph revealed the electron-dense granules accumulated on the outer 

face of the hair wall that interact with the fibrillar capsule of R. leguminosarum 

bv. trifolii (Dazzo and Hubbell 1975). Since this granular material 

also occurred on the surface of axenic root hairs, it was presumably of host 

origin and predictably a carbohydrate-binding lectin (Dazzo and Hubbell 

1975). In follow-up studies, a lectin was purified from white clover seed, 

shown to exist as an aggregated particle of glycoprotein and to accumulate on 

white clover root hairs, especially at their tips, as shown by transmission electron 

microscopy and immunofluorescence microscopy (Dazzo et al. 1978; 

Gerhold et al. 1985; Fig. 5B, C). This white clover lectin displayed symbiontspecificity 

in agglutination of R. leguminosarum bv. trifolii and was named 

trifoliin A (Dazzo et al. 1978). The intense, saccharide-inhibitable binding of 

root trifoliin A to encapsulated cells of R. leguminosarum bv. trifolii cells is 

illustrated in the immunofluorescence micrograph of Fig. 5D. Subsequently, it 

was shown that most of the trifoliin A glycoprotein synthesized de novo in 

roots of white clover seedlings was excreted into the external root environment 

where it interacted in situ with encapsulated cells of R. leguminosarum 

bv. trifolii (Dazzo and Hrabak 1981, Dazzo et al. 1982; Sherwood et al. 1984; 

Truchet et al. 1986; Fig. 5E). Direct evidence indicating that trifoliin A accumulated 

at the contact interface between polarly attached R. leguminosarum 

bv. trifolii cells and the surface of the white clover root hair wall was shown by 

conventional immunofluorescence microscopy viewed with the pre-confocal 

optics of a high magnification objective having a narrow depth of focus 

(Dazzo et al. 1984; Fig. 5F). Quantitative immunofluorescence microscopy 

indicated that hybrid recombinants of R. leguminosarum bv. viciae carrying 

multicopy plasmids of cloned pSym nod genes of R. leguminosarum bv. trifolii 

controlling clover host specificity acquired the ability to bind trifoliin A in 

situ in the external white clover root environment (Philip-Hollingsworth et al. 

1989b).All of these findings contributed to the proposal that host lectin mediates 

symbiont recognition during host-specific events that precede primary 

host infection in the Rhizobium-legume symbiosis. Subsequent elegant plant 

molecular biology studies by Kijne and colleagues (Diaz et al. 1989), and more 

recently Hirsch and colleagues (van Rhijn et al. 1998; Hirsch 1999), have confirmed 

that the host-encoded lectins play a crucial role in microsymbiont 

recognition and host specificity in the Rhizobium-legume symbiosis, as originally 

predicted. 

2.7 Rhizobium Acidic Heteropolysaccharides 

Rhizobium leguminosarum bv. trifolii normally produces a profound true 

capsule that is revealed by ruthenium red staining and transmission electron

514 


microscopy. The bulk of this capsule consists of a large acidic heteropolysaccharide 

(Dazzo and Hubbell 1975). Bioassays scored by quantitative phase 

contrast microscopy indicate that oligosaccharide fragments produced by 

enzymatic depolymerization of this polysaccharide are biologically active in 

promoting root hair infectibility in white clover seedlings inoculated with R. 

leguminosarum bv. trifolii (Abe et al. 1984; Hollingsworth et al. 1984). The 

complete structures of the acidic heteropolysaccharides of several strains of 

R. leguminosarum bv. trifolii have been elucidated and shown to consist of 

repeated octasaccharide units of 5Glc:2GlcA:1Gal containing a tetrasaccharide 

backbone of 2Glc:2GlcA substituted with O-acetate and a tetrasaccharide 

sidechain of 3Glc:1Gal bearing pyruvyl substitutions on the terminal Gal and 

penultimate Glc, and a O-hydroxybutyrate substitution on the terminal Gal 

(Hollingsworth et al. 1988; Philip-Hollingsworth et al. 1989a). Trifoliin A 

binds selectively to this acidic heteropolysaccharide, and the symbiont-specificity 

in this protein–carbohydrate interaction involves recognition of the 

sites of linkage and stoichiometry of noncarbohydrate substitutions in the 

octasaccharide repeat unit (Abe et al. 1984; Hollingsworth et al. 1984, 1988; 

Philip-Hollingsworth et al. 1989b). Subsequent biochemical studies revealed 

host-range related structural features of R. leguminosarum bv. trifolii acidic 

heteropolysaccharides that distinguish these cell surface polymers and those 

of the closely related pea symbiont, R. leguminosarum bv. viciae, based on 

subtle differences in molar stoichiometry and positions of attachment of 

these noncarbohydrate substitutions (Philip-Hollingsworth et al. 1989a, b). 

Other studies have shown a link between rhizobial genes involved in determining 

the acidic heteropolysaccharide structures and the legume host-range 

in R. leguminosarum and Rhizobium sp. (Acacia; Philip-Hollingsworth et al. 

1989b; Lopez-Lara et al. 1993, 1995). This relationship is expressed in some, 

but not all genetic backgrounds of R. leguminosarum (Orgambide et al. 1992). 

Recently, we have presented a micrograph of a portion of an isolated molecule 

of the R. leguminosarum bv. trifolii acidic polysaccharide acquired using a 

field-emission scanning/transmission electron microscope at extremely high 

magnification (Dazzo and Wopereis 2000). Image analysis of the branches 

projecting perpendicular to the main polymer backbone in that micrograph 

indicate that they are within the same size range as the predicted 20±2 

angstrom length of the substituted tetrasaccharide side-chain. Molecular 

microscopy! 

A role of the capsular polysaccharide from R. leguminosarum bv. trifolii in 

symbiotic recognition was clearly shown by labeling this polymer with the 

fluorochrome FITC and documenting its direct interaction with white clover 

roots using epifluorescence microscopy (Dazzo and Brill 1977). Figure 6A 

illustrates the result, providing direct evidence for the existence and distribution 

of receptor sites on clover root hairs that specifically recognized the capsular 

polysaccharide of this rhizobial microsymbiont. Further studies using 

fluorescence microscopy indicated that these receptor sites are saturable,


Fig. 6. Role of Rhizobium 

acidic heteropolysaccharide 

in symbiotic development 

with legumes. A 

Direct detection of symbiont-specific 

receptor 

sites for R. leguminosarum 

bv. trifolii acidic heteropolysaccharide 

on root 

hairs of white clover 

seedlings. B Quantitative 

microscopy of symbiotic 

phenotypes of an R. leguminosarum 

bv. trifolii 

ANU437 Exo – mutant relative 

to its Exo + wild-type 

ANU794 parent scored on 

the white clover host. The 

significant requirement of 

the bacterial acidic heteropolysaccharide 

in 

expression of its important 

Roa-3, Hac, and Inf symbiotic 

phenotypes is clearly 

indicated. Reprinted with 

permission from the 

American Society for 

Microbiology 

match the cellular distribution of trifoliin A on the root surface, and are 

specifically hapten-inhibitable, thus implicating an involvement of this root 

hair lectin in recognition of the rhizobial acidic heteropolysaccharide (Dazzo 

and Brill 1977; Dazzo et al. 1978). 

Further symbiotic roles of the acidic heteropolysaccharide from R. leguminosarum 

bv. trifolii in clover root nodulation were shown by detailed 

microscopy of the phenotypes exhibited by mutants blocked in its synthesis. 

A common symbiotic phenotype of “exo-minus” mutants of many fast-growing 

rhizobia is their defective ability to invade nodules on their respective 

host plant (Leigh et al. 1987; Lopez-Lara et al. 1993, 1995; Rolfe et al. 1996; 

Sanchez et al. 1997). Figure 6B summarizes the results of detailed, quantitative 

microscopical analysis of symbiotic phenotypes in exo-minus mutants of R. 

leguminosarum bv. trifolii scored on white clover seedling roots prior to nodule 

invasion (Rolfe et al. 1996). These quantitative microscopy results clearly 

indicate that the acidic heteropolysaccharide of R. leguminosarum bv. trifolii 

plays a crucial role in several early events of the infection process, including

516 


the rhizobial expression of the symbiont-specific (Roa-3) pattern of attachment 

to root hairs, the induction of markedly curled shepherd’s crooks at root 

hair tips (Hac), and the formation of successful infection threads in root hairs 

(Inf), but not the induction of moderate root hair deformations (Had) or root 

nodule primordia (Noi). Thus, the acidic heteropolysaccharide of R. leguminosarum 

bv. trifolii is a very important cell surface component needed to 

accomplish symbiont recognition, Roa-3, Hac, and Inf events crucial to primary 

host infection in the Rhizobium-clover symbiosis, as predicted (Dazzo 

and Hubbell 1975; Dazzo and Brill 1977, 1979; Dazzo et al. 1984; Sherwood et 

al. 1984; Philip-Hollingsworth et al. 1989a, b; Orgambide et al. 1992; Rolfe et al. 

1996). In concurrence with our earlier findings using R. leguminosarum bv. 

trifolii and white clover, detailed microscopy has more recently revealed the 

importance and essential requirement of extracellular acidic heteropolysaccharide 

from wild-type Rhizobium leguminosarum bv. viciae and Sinorhizobium 

meliloti in successful root hair infection of their corresponding hosts, 

vetch and alfalfa (van Workum et al. 1998; Cheng and Walker 1998; Pellock et 

al. 2000). 

2.8 Rhizobium Lipopolysaccharides 

The lipopolysaccharide (LPS) is another cell surface component of R. leguminosarum 

bv. trifolii that was predicted to play a role in symbiotic infection 

when it was found to bind trifoliin A and contain the glycosyl component 

quinovosamine (2-amino-2,6-dideoxyglucose) in its structure, which turned 

out to be a potent saccharide hapten inhibitor of trifoliin A-Rhizobium polysaccharide 

interactions (Dazzo and Brill 1979; Hrabak et al. 1981; Sherwood et 

al. 1984; Dazzo et al. 1991). Quantitative bioassays of root hair infections on 

white clover scored directly by phase contrast microscopy indicated a role of 

a transient, trifoliin A-binding glycoform (K90) of R. leguminosarum bv. trifolii 

LPS in activating the infection process (Dazzo et al. 1991). This infectionrelated 

biological activity significantly increased the frequency of successful 

infection threads that grew the entire length of the root hair and penetrated 

into the underlying cortical cells (Dazzo et al. 1991). Further studies using 

immunofluorescence and immunoelectron microscopy revealed the direct 

interaction between this bioactive LPS glycoform and white clover root hairs 

(Dazzo et al. 1991), including its localized binding to root hair tips where trifoliin 

A accumulates (Fig. 7A, B), and its uptake and internalization within the 

root hair cell (Fig. 7C). Real-time video microscopy and quantitative image 

analysis revealed that this specific interaction of the trifoliin A-binding glycoform 

of R. leguminosarum bv. trifolii LPS and white clover root hairs induced 

rapid changes in cytoplasmic streaming indicative of altered cytoskeleton 

activity, and 2-D gel electrophoresis revealed changes in levels of several specific 

root hair proteins made in response to LPS exposure (Dazzo et al. 1991).


Fig. 7. Direct interaction of Rhizobium lipopolysaccharide with host root hairs.Adsorption 

of the trifoliin A-binding glycoform of LPS from R. leguminosarum bv. trifolii to the 

tips of white clover root hairs, and their internalization of this bioactive Rhizobium signal 

molecule are shown by immunofluorescence microscopy (A), conventional transmission 

electron microscopy (B), and immunoelectron microscopy (C). Scale bar A 

10 mm, B, C 3 mm. Reprinted with permission from the American Society for Microbiology

518 


In contrast, quantitative microscopy revealed that similar treatment of 

white clover roots with LPS from heterologous wild-type rhizobia (e.g., R. 

leguminosarum bv. viciae or S. meliloti) resulted in very incompatible root 

hair responses (Dazzo et al. 1991). These included a reduction in frequency of 

successful infections made by wild-type R. leguminosarum bv. trifolii, a corresponding 

increase in proportion of aborted infections accompanied by accumulation 

of intensely autofluorescent material at the arrested infection thread 

within the root hairs, and the suppression in levels of some of the newly synthesized 

root hair proteins plus elevation in levels of other specific root hair 

proteins (Dazzo et al. 1991). These results indicate that Rhizobium LPS is a 

potent signal molecule that rapidly communicates with host root hairs before 

bacterial penetration, triggering signal transduction of various molecular 

and physiological changes in these host cells that modulate infection thread 

development and compatibility/incompatibility events during primary host 

infection (Dazzo et al. 1991). 

2.9 Chitolipooligosaccharide Nod Factors 

Microscopy has played a major role in showing that chitolipooligosaccharides 

(CLOS), first described by Lerouge et al. in S. meliloti (Lerouge et al. 

1990), are one group of several different types of Nod factor molecules made 

by R. leguminosarum bv. trifolii capable of inducing Had and Ccd/Noi on 

white clover roots (Hollingsworth et al. 1989; Philip-Hollingsworth et al. 

1991, 1997; Orgambide et al. 1994, 1995, 1996; Dazzo et al. 1996a; Dazzo et al. 

1996b; ). Consistent with their amphiphilic physicochemistry, CLOSs of true 

wild type (i.e., not genetically manipulated) R. leguminosarum bv. trifolii 

accumulate three log cycles higher in their cellular membranes rather than 

in the extracellular milieu, and comprise a diverse family of at least 23 different 

types of CLOS that vary in O-acetyl and N-fattyacyl substitution, and 

in degree of oligomerization (Orgambide et al. 1995; Philip-Hollingsworth et 

al. 1995). 

Because these wild-type Nod factors are primarily associated with membranes 

rather than secreted extracellularly (contrary to dogma), it was important 

to establish if they represent the symbiotically relevant forms. Quantitative 

microscopy bioassays on axenic seedlings showed that this was definitely 

the case. The family of wild-type membrane CLOSs from R. leguminosarum 

bv. trifolii was fully active in its ability to induce Had, Ccd and Noi in white 

clover roots at subnanomolar concentrations (Orgambide et al. 1996). Furthermore, 

these symbiotic activities of R. leguminosarum bv. trifolii membrane 

CLOSs were host-specific in that they elicited no mitogenic Ccd or Noi 

activity in hairy vetch or alfalfa roots (heterologous legumes of different 

cross-inoculation groups), no Had in alfalfa at any concentration tested, and 

only elicited a weak Had response in hairy vetch requiring a 10 4 -fold higher


threshold concentration than in the homologous host white clover (Orgambide 

et al. 1996). 

We combined organic chemical synthesis and quantitative microscopy 

approaches to dissect the molecular structural features of wild-type CLOS 

molecules required for their Had and Ccd/Noi symbiotic activities. A variety 

of small analog molecules bearing various motifs of CLOS glycolipids were 

chemically synthesized and bioassayed on axenic legume plants (Philip- 

Hollingsworth et al. 1997). The results of this study were straightforward and 

very informative. Quantitative brightfield microscopy indicated that 

nanomolar concentrations of a single glucosamine residue bearing a longchain 

fatty N-acyl substitution were required and sufficient to induce Had 

and Ccd/Noi activity on both white clover and alfalfa, without any structural 

requirements for sulfation, O-acetylation, oligomerization of the glucosamine 

backbone, or unsaturation of the N-acyl fatty acid moiety of 

CLOSs (Philip-Hollingsworth et al. 1997). Further molecular dissection of 

the polar head group (e.g., removal of the C5 and C6 groups from the pyranose 

ring) rendered the amphiphilic CLOS analog inactive in these Had and 

Ccd/Noi bioassays (Philip-Hollingsworth et al. 1997). Contrary to “dogma”, 

these studies on the molecular determinants of CLOS action showed that the 

minimal portion of the native CLOS molecule that is both essential and sufficient 

for these symbiotic activities resides simply at the nonreducing glucosamine 

terminus substituted with an N-acylated long-chain fatty acid, and 

the remaining variations in components of the CLOS molecule leading to 

their native diverse family restrict which host (white clover or alfalfa) will 

respond to them rather than serve as required, positive effectors of their Had 

and Noi bioactivities per se (Philip-Hollingsworth et al. 1997). These key 

results which show that N-fatty acyl polyunsaturation and sulfation (for 

alfalfa) are not essential components of the minimal active structural component 

of CLOS for Ccd/Noi in legumes have been independently confirmed 

(Vernoud et al. 1999; Diaz et al. 2000). Consistent with these findings, other 

related studies show that perception of NodRm CLOS factors by membrane 

fractions of alfalfa have no significant structural requirement for N-fatty 

acyl polyunsaturation nor sulfation (Bono et al. 1995). Collectively, these significant 

findings have profound impact on the validity of models that assign 

the physiological location of CLOS in rhizobia, as well as their structural 

requirements for perception and symbiotic bioactivities in legume hosts like 

white clover, alfalfa, and vetch. 

In this same study (Philip-Hollingsworth et al. 1997), we developed various 

fluorescent molecular probes to investigate the in vivo fate and uptake of 

bioactive CLOS molecules into living root cells of intact white clover 

seedlings. By chemically labeling the reducing N-acetylglucosamine terminus 

of wild-type R. leguminosarum bv. trifolii CLOSs with NBD fluorochrome, we 

were able to produce a family of fluorescent NBD-CLOS derivatives with minimal 

molecular perturbation that retained their Had and Ccd/Noi inducing

520 


biological activities on white clover roots (Philip-Hollingsworth et al. 1997). 

This approach is far superior to conjugation of CLOSs with certain alternative 

fluorochromes, e.g., biodipi, whose relatively large and hydrophobic molecular 

structure could significantly perturb the physiological bioactivity of the 

CLOS molecules. This NBD-CLOS molecular probe was applied to axenic 

seedling roots under microbiologically controlled conditions. At various time 

points thereafter, the specimens were rinsed free of unbound conjugate and 

examined in vivo by laser scanning confocal microscopy, with results 

acquired in real time at subcellular resolution (Philip-Hollingsworth et al. 

1997). Figure 8A–H illustrates the key in vivo results of these studies, providing 

direct microscopical evidence that the NBD-CLOSs made by wild-type R. 

leguminosarum bv. trifolii interact rapidly with clover root hairs, traverse 

their cell walls, absorb to their cell membrane, and within minutes are then 

internalized within these living cells, where they migrate to the base of the 

root hairs and translocate to underlying cortical cells in a discrete region of 

the root. Quantitative fluorescence microscopy indicated that NBD-CLOSs 

from wild-type R. leguminosarum bv. trifolii were internalized by a significantly 

higher proportion of root hairs from the host legume white clover than 

from the nonhost legume alfalfa (Philip-Hollingsworth et al. 1997). As predicted, 

the structural requirements for internalization of NBD-CLOS analogs 

in living root hairs matched those required for Had and Noi bioactivities of 

CLOSs in white clover and alfalfa as described above. In contrast, the fluorescent 

analog NBD-chitotriose (without a linked lipid) was not taken up by living 

clover root hairs or cortical cells, indicating that in vivo internalization of 

Fig. 8. Laser scanning confocal microscopy of the direct, dynamic interaction of chitolipooligosaccharides 

(CLOSs) from wild-type R. leguminosarum bv. trifolii ANU843 

with living cells of white clover roots. Purified CLOSs were conjugated with the fluorochrome 

NBD to produce a fluorescent molecular probe with minimal molecular perturbation 

that retained Had and Noi bioactivities on white clover roots. A When applied 

to roots, these labeled Nod factors rapidly adsorbed to the root hairs. Closer examination 

of a time-series sequence of images showed that the NBD-tagged CLOSs adsorbed 

to the root hair cell membrane, and then within minutes were internalized within these 

epidermal cells (B–F), some migrating to the base of the root hair cell (B–D) and others 

remaining on the cell membrane or inside the root hair nucleus (E, F). Within 30 min, 

some NBD-CLOSs were translocated to a discrete region of the underlying root cortex 

and internalized within selected cortical cells (G, H). Arrowheads in the paired micrographs 

of (E, F) point to the root hair nucleus that internalized some labeled CLOSs. The 

NBD-CLOSs of ANU843 were internalized by a significantly higher proportion of the 

root hairs on white clover than alfalfa roots. Further studies using synthetic CLOS 

analogs and axenic seedling bioassays evaluated by these microscopy techniques established 

the minimal structural features of these Nod factor molecules that are required 

and sufficient for uptake and Had/Noi-inducing activities on both white clover and 

alfalfa roots. Scale bar A 50 mm, B–D 15 mm, E, F 10 mm, H 100 mm. Reprinted with permission 

from Lipid Research, Inc.

27 Applications of Quantitative Microscopy in Plant Surface Microbiology 521

522 


NBD-labeled CLOSs and CLOS analogs by these host cells require the long 

chain N-acyl fatty acid moiety, but it does not have to be polyunsaturated. 

These results also indicated that the observed fluorescence was not due to autofluorescence 

of root cells, nor to uptake of a cleavage product of NBD-CLOSs 

degraded by plant chitinases, and that the root epidermis of seedlings used in 

these experiments had no open cracks through which NBD-CLOSs could passively 

diffuse into the root.Another interesting finding was that the interior of 

the clover root hair nucleus was a specific target reached rapidly by some of 

the internalized fluorescent NBD-CLOSs applied to white clover roots, as 

illustrated in the paired images of a root hair using phase contrast light 

microscopy (Fig. 8E) and the corresponding, longitudinal epifluorescence 

optisection obtained by laser scanning confocal microscopy that samples 

through the fluorescent nucleoplasm of its nucleus (Fig. 8F). These findings 

(Philip-Hollingsworth et al. 1997) impact profoundly on our understanding of 

the very early fate of rhizobial CLOS molecules before primary infection and 

nodule induction, and on the nature, location, and molecular specificity of 

putative host receptor sites for these Nod factors in the host legume root. 

2.10 Epidermal Pit Erosions 

Recently, we used various types of microscopy and enzymology to further 

clarify how rhizobia modify root epidermal cell walls in order to shed new 

light on the mechanism of primary host infection in the Rhizobium-legume 

symbiosis (Mateos et al. 2001). A thorough scanning electron microscope 

(SEM) examination of the epidermal surface of white clover roots inoculated 

with R. leguminosarum bv. trifolii revealed a nonuniform distribution of 

eroded pits that follow the contour of the Rhizobium cell (Fig. 9A). Their localized 

structure suggested that rhizobia have cell-bound wall-degrading 

enzymes, and indeed, follow-up biochemical studies confirmed that rhizobia 

produce multiple cell-bound isozymes of cellulase and polygalacturonase 

(Mateos et al. 1992, 1996; Jiminez-Zurdo et al. 1996). Quantitative SEM indi- 

Fig. 9. Epidermal eroded pits induced by Rhizobium leguminosarum bv. trifolii on white 

clover roots. A Scanning electron micrograph of the root epidermis pitted by attached 

cells of rhizobia (arrows). B Transmission electron micrograph showing ultrastructural 

details of the pitted interface between an attached cell of rhizobia and the clover epidermal 

root cell wall. Note that the localized erosion is restricted to amorphous regions and 

not the ordered microfibrillar wall layer (arrows). C (control), E, G Phase contrast 

microscopy and D, F Nomarski interference contrast microscopy of the Hot (Hole on the 

tip) reaction representing the complete erosion of a transmuro hole made by purified 

cellulase from R. leguminosarum bv. trifolii through the noncrystalline wall at root hair 

tips (arrows). Reprinted with permission from the Canadian National Research Council

27 Applications of Quantitative Microscopy in Plant Surface Microbiology 523

524 


cated that the spatial density of these rhizobia-associated eroded pits was significantly 

higher on the root epidermis of host rather than nonhost legume 

combinations, was inhibited by high nitrate supply, and was not induced by 

immobilized wild-type R. leguminosarum bv. trifolii chitolipooligosaccharide 

Nod factors reversibly adsorbed to latex beads. Transmission electron microscope 

(TEM) examination of these highly localized epidermal pits indicated 

that they were only partially eroded, i.e., only the outer amorphous region of 

the plant wall in direct contact with the bacterial cell was disrupted, whereas 

the underlying highly ordered portion(s) of the wall remained ultrastructurally 

intact (Fig. 9B). Further studies using phase contrast and polarized 

light microscopy indicated that (1) the structural integrity of clover root hair 

walls is dependent on wall polymers that are valid substrates for the purified 

cell-bound polysaccharide-degrading enzymes (e.g., C2 cellulase isozyme) 

from rhizobia (Fig. 9C–G); (2) the major site where these rhizobial cell-bound 

enzymes can completely erode through the root hair wall is highly localized at 

the isotropic, noncrystalline apex of the root hair tip (Fig. 9C–G), and (3) the 

degradability of clover root hair walls by these rhizobial polysaccharidedegrading 

enzymes is enhanced by modifications induced during growth in 

the presence of CLOS Nod factors from wild-type clover rhizobia. These 

results suggest that these eroded plant structures represent incomplete 

attempts of bacterial penetration that had only progressed through isotropic, 

noncrystalline layers of the plant cell wall, and that the rhizobial cell-bound 

glycanases and chitolipooligosaccharides participate in complementary roles 

that ultimately create the localized transmuro portal of entry for successful 

primary host infection (Munoz et al. 1998; Mateos et al. 2001). 

2.11 Elicitation of Root Hair Wall Peroxidase by Rhizobia 

Many investigators have proposed that successful infection of legumes by rhizobia 

may depend on the microsymbiont’s ability to escape, suppress, or avoid 

host defense responses that normally protect plants against invasive microorganisms 

(Vance 1983; Djordjevic et al. 1987; Parniske et al. 1990, 1991). To test 

this hypothesis, we performed in situ enzyme cytochemistry at subcellular 

resolution using brightfield microscopy followed by in vitro enzyme assays to 

detect changes in activity of plant wall-bound peroxidase as an indication of 

a localized host defense response following inoculation of white clover and 

pea roots with compatible and incompatible combinations of rhizobial symbionts 

(R. leguminosarum biovars trifolii and viciae; Salzwedel and Dazzo 

1993). For compatible combinations, elevated peroxidase activity was initially 

delayed, but subsequently located precisely at infection-related sites: the center 

of markedly deformed shepherd’s crooks and at penetration sites of incipient 

infection thread formation, but not elsewhere on the infected root hairs 

including the intracellular infection thread itself. In contrast, the incompati-


ble combinations rapidly elicited elevated plant peroxidase activity over 

larger areas of the uninfected root hairs corresponding to their entire irregularly 

deformed root hair tips. Studies using various pSym nod mutant strains 

(provided by B. Rolfe, Australian National University) indicated a role of 

extracellular factors and the host-specific nodulation genes nodEL in this 

Rhizobium-controlled modulation of root hair peroxidase activity (Salzwedel 

and Dazzo 1993). Thus, active suppression of host defense responses by compatible 

rhizobia prior to primary host infection are implicated by these studies. 

Induction of white clover root peroxidase by compatible and incompatible 

rhizobial symbionts has been independently confirmed by differential display 

plant molecular biology techniques (Crockard et al. 1999). 

2.12 In Situ Gene Expression 

Reporter strains of Rhizobium with gene fusions encoding b-galactosidase, bglucuronidase, 

and green fluorescent protein are expanding the contribution 

of microscopy in unraveling many mysteries of the fascinating infection 

process in the Rhizobium-legume symbiosis. A common application of this 

technology is the use of reporter strains to locate primary host infections 

since they occur infrequently. Another informative application is the use of 

merodiploid reporter strains to locate at single cell resolution where, and at 

what stage of infection do rhizobia express symbiotic genes in situ with minimal 

risk of disturbing their symbiotic phenotypes. This application was used 

in quantitative microscopy studies that documented the in situ expression of 

pSym nodA by R. leguminosarum bv. trifolii cells during their early interaction 

with the root surface of the white clover host, especially those bacterial 

cells that have been clumped together on white clover root hair tips by trifoliin 

A during the first few hours of phase 1 attachment (Dazzo et al. 1988). 

Several methods have been used to detect expression of host symbiotic 

genes during early interactions of rhizobia with their legume host. One 

approach has been to use darkfield microscopy with in situ hybridization of 

DNA probes to specific mRNAs in plant tissue to locate which legume root 

cells express early nodulins [“Enods”] in response to inoculation with rhizobia 

(McKhann and Hirsch 1993). Such in situ localization studies can be 

enhanced even further if accompanied by immunofluorescence microscopy at 

single cell resolution (Dazzo and Wright 1996; McDermott and Dazzo 2002), 

to determine if the antigenic gene product of interest remains with the same 

cell(s) expressing the gene and/or is redistributed to other cells in the tissue. 

A second method to examine the cellular location and timing of expression of 

symbiotically important host genes induced by rhizobia makes use of 

chimeric fusions of the Gus-reporter gene in transgenic plants. For instance, 

recent microscopical examination of transgenic alfalfa plants stained for GUS 

activity has shown that nod mutants of S. meliloti although blocked in ability

526 


to introduce polyunsaturation of the N-acyl fatty acid moiety, in O-acetylation 

and in sulfation of CLOS Nod factors, are still capable of inducing 

ENOD20 (a marker of cortical cell activation) and (most importantly) eliciting 

cortical cell divisions in this legume host (Vernoud et al. 1999). This result 

is fully consistent with our studies described earlier that defined the minimal 

structural requirements for uptake and bioactivity of rhizobial CLOS analogs 

in legume roots, including induction of alfalfa and white clover cortical cell 

divisions (Philip-Hollingsworth et al. 1997), contrary to the dogma indicating 

that those structural features of CLOS dictate host specificity in the S. 

meliloti-alfalfa symbiosis. Finally, a third powerful approach to detect target 

mRNA is based on staining tissue sections for in situ PCR-amplified antisense 

riboprobes. This approach has recently been used to detect a novel 

Enod [dd23b] in white clover roots induced within 6 h after inoculation with 

wild-type R. leguminosarum bv. trifolii or the corresponding purified wildtype 

CLOS (Crockard et al. 2002). 


Rhizobium and Legumes by Image Analysis 

The value of quantitative microscopy for plant surface microbiology can be 

enhanced even further when coupled with computer-assisted digital image 

analysis (Hollingsworth et al. 1989; Orgambide et al. 1996). This fast-growing 

technology utilizes the digital computer to derive numerical information 

regarding selected image features. Although image analysis technology cannot 

add anything that is not already present, its ability to extract the maximum 

amount of data from the image, as well as to quickly store, retrieve, and 

electronically transmit that data makes it an invaluable research tool for the 

microscopist. Computer-assisted microscopy has been used to enhance developmental 

morphology studies of the Rhizobium-legume symbiosis since 1989 

(Dazzo and Petersen 1989). Here, I highlight a few examples of new information 

on the Rhizobium-legume symbiosis derived from microscopical studies 

utilizing digital image analysis, and later illustrate how we have opened new 

ground in plant surface microbiology by development and implementation of 

innovative image analysis software tailored to studies of in situ microbial 

ecology. 

3.1 Definitive Elucidation of the Nature of Rhizobium Extracellular 

Microfibrils 

The extracellular microfibrils made by R. leguminosarum bv. trifolii in pure 

culture were isolated and shown by chemical analysis to consist of microcrystalline 

cellulose (Napoli et al. 1975a). However, the nature of the microfibrils


associated with rhizobia that highlight the beginning of their Phase 2 firm 

adhesion to the legume root epidermis (Fig. 2F) was more difficult to define. 

The combined use of scanning electron microscopy, enzyme cytochemistry, 

and computer-assisted digital image analysis provided direct in situ evidence 

of the cellulosic nature of the extracellular microfibrils extending from R. 

leguminosarum bv. trifolii cells colonized on the white clover root epidermis 

(Mateos et al. 1995). 

3.2 Rhizobial Modulation of Root Hair Cytoplasmic Streaming 

Many studies have shown that rhizobia influence the cytoplasmic streaming 

of host root hairs (beginning with the classic microscopical studies of root 

hair infection by Fåhraeus (1957) and Nutman et al. (1973), but very few have 

gone the extra mile to quantitate the changes in velocity of this early host 

cytoskeletal event in vivo. We utilized high resolution, phase-contrast video 

microscopy and play-back digital image analysis in real time to establish that 

the velocity of cytoplasmic streaming within living root hairs of white clover 

is increased by 35 and 63 % soon after exposure to cells or isolated clover 

lectin-binding lipopolysaccharide of R. leguminosarum bv. trifolii, respectively 

(Dazzo and Petersen 1989; Dazzo et al. 1991). 

3.3 Motility of Rhizobia in the External Root Environment 

Rhizobium leguminosarum bv. trifolii is peritrichously flagellated. How fast 

does it swim in the external root environment of its host, white clover? By 

focusing the phase objective lens just below the coverslip in modified 

Fåhraeus slide cultures without the agar matrix, it is possible to record 

enough examples of long swimming runs of individual cells within the depth 

of focus to perform image analysis on track reconstructions of real-time 

video recorded images played back in slow motion. Quantitation of this activity 

by digital image analysis showed that R. leguminosarum bv. trifolii swims 

in this external clover root environment at an average velocity of 52 mm/s 

(around 40 times its cell length, compared to around 60 body lengths for E. 

coli under ideal testing conditions), and cells tethered by their lateral flagella 

to the underside of the coverslip rotate at a frequency of 5–6 Hz/s in this slide 

culture environment (Dazzo and Petersen 1989). 

When Fåhraeus slide cultures of white clover seedlings and R. leguminosarum 

bv. trifolii are prepared using 0.4 % agarose, two zones of bacterial 

chemotropic swarming can be visualized by darkfield illumination. Digital 

image analysis indicates that one of these bacterial chemotropic responses 

forms a hollow sphere whose center is at the root tip and an intercept of 

radius approximately 4 mm above the root tip. The second chemotropic

528 


response is less structured, but accumulates in a cylindrical zone surrounding 

the root 2–4 mm from the root tip. These microscopical observations suggest 

that Rhizobium responds chemotactically in situ to different, multiple chemical 

gradients in the external environment surrounding the clover root. 

3.4 Root Hair Alterations Affecting Their Dynamic Growth Extension 

and Primary Host Infection 

Quantitative microscopy has played a major role in analyzing the developmental 

morphology of white clover root hairs to elucidate the mechanisms of 

rhizobial CLOS action in modulating the growth dynamics and symbiont 

infectibility of these target host cells (Dazzo et al. 1996a).We performed timelapse 

video microscopy of axenic seedling roots treated with nanomolar concentrations 

of wild-type R. leguminosarum bv. trifolii CLOSs and grown geotropically 

under microbiologically controlled conditions, followed by a 

quantitative time-series image analysis of individual root hair growth in the 

acquired video-recorded images at 4-s resolution (Dazzo et al. 1996a). This 

analysis indicated that the earliest discernible root hair deformations occur 

within 2.12±0.65 h after application of the wild-type CLOS, and that the morphological 

basis of the dominant type of CLOS-induced Had is a short-range 

alteration in direction of polar extension growth of the root hair tip rather 

than distortion of an already elongated root hair wall, resulting in a redirection 

of tip growth that deviates from the medial axis of the root hair cylinder. 

Further studies of quantitative microscopy indicated that CLOS action 

extends the growing period of active root hair elongation for ~ 5.2 h beyond 

its normal duration without affecting the elongation rate per se (~19 mm/h), 

resulting in mature root hairs that are on average about 100 mm longer. This 

extended growth period predictably increases the duration in which the root 

hair’s “window of infectibility” remains open before cessation of growth. Consistent 

with this hypothesis, CLOS action was shown by polarized light 

microscopy to induce localized isotropic alterations in the otherwise 

anisotropic, ordered crystalline architecture of root hair walls and shown by 

phase contrast light microscopy to significantly increase the number of 

potential infection sites and promote their infectibility by wild-type R. leguminosarum 

bv. trifolii (Dazzo et al. 1996a). These studies gave new information 

on the mechanisms of CLOS action that participate in activating root hair 

infectibility in the Rhizobium-legume symbiosis.


4 A Working Model for Very Early Stages of Root Hair 

Infection by Rhizobia 

These various studies that capitalize on the added dimension of quantitative 

microscopy at cellular and subcellular resolution (Abe et al. 1984; Dazzo et al. 

1982, 1991, 1996; Mateos et al. 1992, 1996, 2001; Salzwedel and Dazzo 1993; 

Rolfe et al. 1996; Sanchez et al. 1997) have led to a working model for primary 

infection of white clover root hairs by the N 2-fixing symbiont, R. leguminosarum 

bv. trifolii. This model includes a transient, rapid nodEL-dependent 

suppression of host peroxidase activity during the initial period in which root 

hair infectibility is activated by trifoliin A-binding CPS oligosaccharides and 

K90 LPS, and CLOS-induced growth extension and disruptions in crystalline 

architecture of the growing root hair wall. The infection-related pattern of 

rhizobial attachment allows for the short-range combined action of these 

bioactive molecules to result in an increased localized susceptibility of this 

host wall barrier to a highly controlled degradation by cell-bound rhizobial 

enzymes that eventually form a small, but complete transmuro erosion site 

that ultimately becomes the primary portal of bacterial entry while still 

enclosed within the center overlap of the root hair shepherd’s crook. An 

increased flurry of cytoplasmic streaming within the root hair stimulated by 

the rhizobial symbiont is proposed to facilitate the delivery of new host cell 

components involved in initiation and continued inward growth of the walled 

tubular infection thread, while simultaneously directing the traffic of internalized 

membrane-associated CLOS signal molecules to the root hair nucleus. 

Later, a localized host wound response at the site of incipient bacterial penetration 

elevates peroxidase activity that cross-links structural polymers of the 

eroded wall in order to avoid lysis of the root hair protoplast after bacterial 

entry and infection thread formation. In contrast, rapid elicitation of clover 

peroxidase activity in the incompatible combinations (rhizobia with heterologous 

nodEL) may represent a localized discriminating host defense response 

that rapidly increases cross-linking of wall polymers, thus making the primary 

host barrier of the root hair wall more resistant to bacterial penetration. 

This unifying model assigns the ability of Rhizobium to modulate the plasticity 

(i.e., the summation of softening and hardening processes) of the root hair 

wall as a major symbiotic event controlling successful host infection. 

5 Improvements in Specimen Preparation and Imaging 

Optics for Plant Rhizoplane Microbiology 

Residual rhizosphere soil remaining on plant roots after gentle washing significantly 

obscures the underlying rhizoplane microflora. We have addressed 

this major limitation in plant surface microbiology using very young white 

clover seedlings (£2 days old) grown in a sandy loam soil. By empirically opti-

530 


mizing the gyrorotary angular velocity and duration of gentle washing of 

excavated roots of white clover in isotonic Fåhraeus medium, we have largely 

solved this technical problem to expose the underlying pioneer microflora 

that develops rapidly on root surfaces of seedlings germinated in soil. The 

optimal conditions to solve this problem vary with the density and length of 

root hairs, hence the plant species used. Quantitative image analysis of the 

white clover seedling roots indicate that this optimized washing procedure 

uncovers the vast majority (≥80 %) of the rhizoplane surface for viewing 

microbes without fragmentation of the root hairs. 

A major limitation of conventional epifluorescence microscopy used to 

examine the natural rhizoplane microflora that develops on soil-grown roots 

stained with fluorochromes is the background of blurred fluorescence outside 

the plane of focus used to produce the image. In this case, useful morphological 

information can only be extracted from images of cells lacking a background 

of out-of-focus fluorescence. A significant development in microscopy 

is the use of laser scanning confocal microscopy (LSCM) combined 

with digital image processing techniques. The unique feature of LSCM is that 

it utilizes pinholes at the laser light source and at the detection of the object’s 

image. This optical design eliminates the stray and out-of-focus light that 

interferes with the formation of the object’s image (a major limitation of the 

conventional fluorescence microscope), thereby only allowing signals from 

the focused plane to be detected (McDermott and Dazzo 2002). This optical 

design also improves the resolution and contrast of microbial cells in natural 

environments by greatly diminishing objectionable background fluorescence 

arising from plant tissue, soil particles, or organic debris. Because light from 

outside the plane of focus is not included in image formation, the 2-D (x–y) 

image becomes an accurate optidigital thin section with a thickness 

approaching the theoretical 0.2-mm resolution of the light microscope. Also, 

by digitizing a sequential series of 2-D images while focusing through the 

specimen in the third (z) dimension, a 3-D computer-reconstructed digital 

image can be produced, rotated,‘resectioned’ in another plane, displayed, and 

quantitatively analyzed. 

Because LSCM imaging technology solves so many problems inherent in 

conventional fluorescence microscopy, it is receiving wide application for in 

situ studies of microbial ecology. The first LSCM examination of the general 

rhizoplane microflora in situ was done with acridine orange-stained roots of 

white clover seedlings grown in soil (Dazzo et al. 1993). This approach eliminated 

the major background fluorescence due to dye absorption into the 

root interior, which makes conventional epifluorescence microscopy impossible 

for this type of specimen. Subsequently, Schloter et al. (1993) demonstrated 

the usefulness of LSCM for immunofluorescence examination of 

Azospirillum on wheat roots. They used a dual laser system to produce the 

green autofluorescence of the root background upon which the distinctive 

red immunofluorescence of Azospirillum (probed with tetramethylrho-


damine isothiocyanate-labeled monoclonal antibodies) could be easily seen. 

They also utilized the noninvasive optical sectioning ability of the confocal 

microscope to locate the Azospirillum cells within the root mucigel layer. 

More recently, we have used optical sectioning by LSCM to document the 

entry of neptunia-nodulating rhizobia into crevices at lateral root emergence 

of the aquatic legume Neptunia natans (Subba-Rao et al. 1995), and azorhizobia 

colonized on the root surface and within cortical cells of intact rice 

roots (Reddy et al. 1997). 

6 CMEIAS: A New Generation of Image Analysis Software for 

in Situ Studies of Microbial Ecology 

6.1 CMEIAS v. 1.27: Major Advancements in Bacterial Morphotype 

Classification 

A major challenge in microbial ecology is to develop reliable methods of 

computer-assisted microscopy that can analyze digital images of microbial 

populations and complex microbial communities at single cell resolution, 

and compute useful ecological characteristics of their organization and 

structure in situ without cultivation. To address this challenge, we are developing 

customized semi-automated image analysis software capable of 

extracting the full information content in digital images of actively growing 

microbial populations and communities. This analytical tool, called CMEIAS 

(Center for Microbial Ecology Image Analysis System) consists of plug-in 

files for the free downloadable program UTHSCSA ImageTool (Wilcox et al. 

1997) operating in a personal computer running Windows NT 4.0/2000. The 

first release version of CMEIAS was developed primarily to perform morphotype 

classification of bacteria in segmented digital images of complex 

microbial communities (Liu et al. 2001). This CMEIAS version 1.27 uses pattern 

recognition algorithms optimized by us to recognize bacterial morphotypes 

with an overall classification accuracy of 97 %, and a sensitivity that 

can classify morphotypes present in the community at a frequency as low as 

~0.1 % (Liu et al. 2001). CMEIAS v. 1.27 can recognize 11 major morphotypes, 

including cocci, spirals, curved rods, U-shaped rods, regular straight 

rods, clubs, ellipsoids, prosthecates, unbranched filaments, rudimentary 

branched rods, and branched filaments, representing a complexity level of 

morphological diversity equivalent to 98 % of the genera described in the 9th 

edition of Bergey’s Manual of Determinative Bacteriology (Holt et al. 1994). 

An interactive edit feature is included in CMEIAS v. 1.27 to revise the output 

of automatic classification data if necessary (occurring at a 3 % error rate), 

and add up to five additional morphotypes not included in the automatic 

classification routine (Liu et al. 2001). Our first major application of CMEIAS 

v. 1.27 was to contribute data on dynamic changes in community structure,

532 


including its resistance, resilience, and ecological succession in a polyphasic 

taxonomy study of microbial community responses to nutrient perturbation, 

using complex anaerobic bioreactors as the model system (Fernandez et al. 

2000; Hashsham et al. 2000). CMEIAS v. 1.27 will soon be released for free 

Internet download at a website linked to the Michigan State University Center 

for Microbial Ecology (http://cme.msu.edu/cmeias). 

6.2 CMEIAS v. 3.0: Comprehensive Image Analysis of Microbial 

Communities 

A significantly upgraded version of CMEIAS is being developed with several 

new analytical modules designed to extract four ecologically relevant, in situ 

features of microbial communities in digital images: (1) morphotype classification 

and diversity,(2) microbial abundance for both filamentous and nonfilamentous 

morphotypes, (3) in situ studies of microbial phylogeny/autecology/metabolism, 

and (4) in situ spatial distribution analysis of microbial 

colonization on various surfaces. Significant new features will include an 

advanced morphotype classifier that incorporates default size and shape 

dimensional borders that are taxonomically relevant and has user-defined 

flexibility to discriminate any customized level of morphological diversity; 

various computations of cell density, biovolume, biomass carbon, biosurface 

area, and filamentous length; color recognition of foreground objects stained 

with fluorescent molecular probes; various measurement features of plot-less, 

plot-based,and georeferenced patterns of spatial distribution analysis; spreadsheet 

macros for automatic data preparation, sampling statistics and spatial 

statistics analyses; and automated image editing routines (Reddy et al.2002a,b; 

see http://lter.kbs.msu.edu/Meetings/2003_All_inv_Meeting/Abstracts.dazzo. 

htm). Data extracted from images by CMEIAS can be used in other advanced 

ecological statistics programs, e.g., EcoStat (Towner 1999), and GS+Geostatistics 

(Robertson 2002), to compute numerous other statistical indices that further 

characterize microbial community structure. Our vision is for CMEIAS to 

become an accurate, robust and user-friendly software tool that can analyze 

microbial communities without cultivation, thereby creating many new 

approaches to study microbial ecology in situ at spatial scales physiologically 

relevant to the individual microbes. 

To illustrate some of the awesome computational power of CMEIAS that 

can be applied to in situ studies of plant surface microbiology, examples of 

analyses have been performed on (1) the abundance and spatial distribution 

of Rhizobium leguminosarum bv. trifolii cells colonized on a white clover 

seedling root in gnotobiotic culture; (2) a comparison of the morphological 

diversity and distribution of abundance in natural microbial communities 

that colonize the phylloplane leaf surface of two different varieties of fieldgrown 

corn, and (3) the in situ spatial patterns of root colonization by the pio-


neer microflora that develop on the white clover seedling rhizoplane during 

their first 2 days of growth in soil, and (4) the spatial scale of quorum sensing 

of signal molecules by rhizobacteria colonized on the root surface. 

6.3 CMEIAS v. 3.0: Plotless and Plot-Based Spatial Distribution Analysis 

of Root Colonization 

For this first example, CMEIAS image analysis was performed on a scanning 

electron micrograph of a region of the white clover seedling root surface colonized 

by cells of Rhizobium leguminosarum bv. trifolii wild-type strain 

ANU843 to extract many different types of quantitative data relevant to plant 

surface microbiology (Fig. 10A). Figure 10B illustrates the frequency distribution 

of their first and second nearest neighbor distances (distance between 

object centroids), as two examples of their spatial distribution in a plot-less 

analysis. Table 1 lists 15 quantitative features relevant to plant surface micro- 

Fig. 10. Colonization 

of the white clover 

root surface by wildtype 

R. leguminosarum 

bv. trifolii ANU843 in 

gnotobiotic culture. 

A Scanning electron 

micrograph of a region 

of the root surface colonized 

by the bacteria. 

Bar scale 1 mm. 

B CMEIAS plot-less 

spatial distribution 

analysis of bacterial 

cells in (A) measured 

as the frequency distribution 

of each cell’s 

first and second nearest 

neighbor distance

534 


Table 1. Quantitative data relevant to plant surface microbiology extracted from 

Fig. 10A by CMEIAS image analysis 

Measurement feature Type of analysis Value 

Number of cells Microbial abundance 138 

Avg. cell biovolume (mm 3 ) Microbial abundance 0.17 

Avg. cell biomass C (fg) Microbial abundance 34.66 

Avg. cell biosurface area (mm 2 ) Microbial abundance 1.72 

Cumulative bacterial biovolume (mm 3 ) Microbial abundance 23.91 

Cumulative bacterial biomass C (fg) Microbial abundance 4783.18 

Cumulative bacterial biosurface area (mm 2 ) Microbial abundance 237.86 

Cumulative area covered by bacteria (mm 2 ) Microbial abundance 60.25 

Avg. first nearest neighbor distance (mm) Plotless spatial 0.84±0.30 

distribution 

Avg. second nearest neighbor distance (mm) Plotless spatial 1.10±0.32 

Average aggregation (cluster) index (mm –1 ) Plotless spatial 1.31±0.38 

distribution 

Holgate’s A value of spatial randomness Plotless spatial 0.622 

distribution =clumped 

Significance value of Holgate’s A (p) Plotless spatial 0.001 

distribution 

Spatial density of bacteria (cells/mm 2 ) Plot-based spatial 427,245 

distribution 

Microbial cover (%) Plot-based spatial 18.7 

distribution 

Uncovered root surface area (%) Plot-based spatial 81.3 

distribution 

biology that were extracted from this same image, eight features that measure 

microbial abundance, and seven (four plot-less plus three plot-based) features 

that measure their spatial distribution. The Aggregation (Cluster) Index is a 

plot-less spatial distribution measurement feature that we have introduced, 

equal to the inverse of the first nearest neighbor distance (Dazzo et al. 2003). 

The Holgate’s method for plot-less spatial analysis is a statistical test for spatial 

randomness requiring that n random points be selected and that the distance 

to the two nearest individuals be measured. This method computes Holgate’s 

A, a measure of aggregation. Values of A are 0.5 for randomly spaced 

populations, >0.5 for clumped populations, and 0.5, their spatial distribution is clumped, and the Z-test for spatial 

randomness is rejected at the statistically significant level of 99.9 %. Definitive 

quantitative spatial distribution data acquired by computer-assisted microscopy!


6.4 CMEIAS v. 3.0: In Situ Analysis of Microbial Communities on Plant 

Phylloplanes 

In the second example, CMEIAS was used to perform an in situ image analysis 

of the microbial communities that developed on phylloplane surfaces of 

two corn varieties grown under field conditions: one was a genetically modified 

corn genotype engineered to express the insecticide protein made by the 

bacterium Bacillus thuriengensis (BT-corn variety Pioneer 3573), and the second 

was a control corn (non-BT variety Pioneer 36N05) receiving no insecticide. 

Corn leaf disks (4 mm in diameter) were sampled in July, 1999 from 

mature field-grown plants cultivated in an Long-Term Ecological Research 

[LTER] experimental site at the Michigan State University Kellogg Biological 

Station (KBS). Adjacent quadrats (n=26) of digital images were acquired by 

scanning electron microscopy at ¥1000 and at ¥100 to resolve the prokaryotic 

Fig. 11. Scanning electron 

micrographs of the phylloplane 

microflora developing 

on the leaf surface of 

field-grown corn. Images 

were acquired at 1000x (A) 

and 100x (B) to locate and 

analyze the prokaryotic 

(bacteria) and eukaryotic 

(fungi) microorganisms in 

the phylloplane community, 

respectively. Scale bar 

1 mm in A and 100 mm in B

536 


and eukaryotic components of the microbial communities, respectively, on 

the upper corn leaf surfaces (Fig. 11A, B), and then analyzed by CMEIAS to 

characterize their community structures in situ. Figure 12 compares the morphological 

diversity of the prokaryotic microorganisms in these two communities, 

with data presented in a rank-order pareto plot of their richness and 

percent numerical abundance of operational morphological units (OMU utilizing 

both shape and size classification schemes), plus a table insert of their 

morphological diversity index (based on Shannon’s Diversity Index H’ using 

nearly equivalent community sample sizes and OMUs rather than species), J 

evenness distribution of OMUs, and a proportional similarity index that is 

weighted according to OMU dominance. The latter three indices are derived 

from computations of the CMEIAS data in EcoStat. These results indicate that 

the prokaryotic component of the phylloplane communities developed on 

these two corn varieties had quite similar values of OMU richness, morphological 

diversity indices, and J evenness in distribution of OMUs, but deeper 

CMEIAS data mining indicate that they have a proportional similarity index 

in prokaryotic morphological diversity of only 64.2 % due to major differ- 

Fig. 12. Rank-abundance diversity plots of CMEIAS morphotype classification data 

among prokaryotic microorganisms that colonize the phylloplane surface of control 

(non-BT) corn and BT-corn expressing the bacterial insecticide. The insert table reports 

the similarities and differences in indices of community structure based on morphological 

analyses using CMEIAS


ences in relative abundance of various sized regular rods, cocci, and ellipsoid 

OMUs (Fig. 12). One should be able to readily appreciate from this example 

how CMEIAS can augment other methods of polyphasic taxonomy (e.g., 16S 

rDNA sequence analysis) to analyze and quantitatively compare complex 

microbial communities in situ without cultivation. 

CMEIAS offers several different algorithms to compute microbial biovolume, 

with the most accurate overall being adaptive to shape, i.e., CMEIAS first 

classifies the cell shape and then applies the most appropriate formula to 

compute its volume based on that particular shape. Figure 13 summarizes the 

CMEIAS analysis of total abundance and relative distribution of biovolume 

among the various prokaryotic morphotypes in these two different corn phylloplane 

communities. The results clearly indicate a significantly greater abundance 

of prokaryotic biovolume per unit of phylloplane surface area for the 

Pioneer 36NO5 (control) variety than the Pioneer 3573 (BT-corn) variety 

(Fig. 13A), and substantial differences in relative distribution of prokaryotic 

biovolume for certain dominant morphotypes in these communities 

(Fig. 13B). 

Fig. 13. CMEIAS analysis 

of biovolume abundance 

in microbial communities 

developed on the phylloplane 

of field-grown control 

corn and BT-corn. 

Above Total standing crop 

of prokaryotic biovolume. 

Below Distribution of 

community biovolume 

among different prokaryotic 

morphotypes

538 


Table 2. In situ plot-based spatial distribution analysis of corn phyllosphere prokaryotic 

microbial communities 

Parameter Control BT corn Interpretation 

corn (Pioneer 

(Pioneer 3573) 

36N05) 

Spatial density (cells/mm 2 ) 214,615 172,692 Higher on control corn 

Morista dispersion value 1.3086 1.7805 Clumped distribution 

Variance/mean ratio 7.7346 13.6624 Clumped distribution 

Negative binomial K distribution 1.9238 0.6779 Clumped distribution 

Lloyd’s patchiness value 1.3144 1.7931 Clumped distribution 

Nonfilamentous microbial cover (%) 2.2 0.4 Higher on control corn 

The spatial distribution of prokaryotic microorganisms on the phylloplane 

surface of these two corn varieties was compared by analyzing several CMEIAS 

in situ plot-based measurement features on a sample set of 104 quadrat images 

(52 quadrats each). The mean values of their spatial density (cells/unit of surface 

area) and percent nonfilamentous microbial cover indicated a significantly 

higher level of bacterial colonization on the phylloplane of the Pioneer 

36N05 (control corn) variety (Table 2). An ascending sort plot of the entire 

range of spatial density for each image quadrat provided further insight into 

the basis for this difference in spatial distribution,with clear indication that the 

overall density of bacteria on the BT-corn phylloplane was lower because that 

habitat contained more image quadrats with no bacterial cover (Fig. 14). 

Table 2 lists several other computations that define the patterns of spatial 

distribution for microbes that colonize these plant leaf surfaces, all derived 

from in situ plot-based data extracted from image quadrats by CMEIAS and 

computed in EcoStat. The Morista Index measures the degree of dispersion, 

with values 1 for a clumped pattern. The variance/mean ratio from the 

observed pattern of frequencies (proportion of quadrats that contain organisms) 

to those predicted by a Poisson distribution is approximately 1 for randomly 

spaced populations, significantly >1 for clumped spacing, and


Fig. 14. CMEIAS spatial 

density analysis of 

prokaryotic microorganisms 

colonized on the 

phylloplane of fieldgrown 

control corn 

(36N05) and BT-corn 

(3573) 

Table 3. Spatial abundance of filamentous fungi on the phylloplane of field-grown corn. 

Values reported are per mm 2 phylloplane surface area 

Spatial abundance parameter Control (36N05) corn BT (3573) corn 

Filamentous hyphae cover (%) 12.7 6.4 

Cumulative hyphal length (mm) 1737 803 

Hyphal biosurface area (mm 2 ) 4244 2035 

Hyphal biovolume (mm 3 ) 816 439 

Hyphal biomass carbon (fg) 163 88 

Table 3 summarizes the CMEIAS-based analyses of spatial abundance for 

the filamentous fungi on these corn phylloplanes. CMEIAS recognizes filamentous 

microorganisms in digital images based on their shape characteristic 

of a length/width ratio >16 without wave form periodicity, and classifies 

unbranched and branched filaments separately based on whether they have 

more than two cell poles (Liu et al. 2001).All five CMEIAS measurement parameters 

indicated an approximate 99 % higher spatial abundance of filamentous 

fungi biomass on the Pioneer 36N05 control corn variety. 

These results illustrated in this second example indicate that CMEIAS performs 

admirably in the in situ analysis of phylloplane microbial communities. 

One could definitively conclude from the results that different microbial communities 

developed on the phylloplane sampled from field-grown Pioneer 

36N05 and Pioneer 3573 varieties of corn, but more thorough studies would 

be necessary before reaching any firm conclusion regarding the possible

540 


involvement of the BT insecticide itself in influencing how these microbial 

communities developed to these different states. 

6.5 CMEIAS v. 3.0: In Situ Geostatistical Analysis of Root Colonization 

by Pioneer Rhizobacteria 

In the third example, CMEIAS was used to analyze the pattern of spatial distribution 

for the pioneer rhizobacterial community that first colonizes 

seedling roots grown in soil. For this study, Dutch white clover seeds were 

planted in a wetted sandy loam soil sampled at the KBS-LTER field site. 

Seedling roots were harvested after 2 days of germination, then gently washed 

free of rhizosphere soil by optimized gyrorotary rotation in Fåhraeus 

medium, stained briefly with a 1:10,000 aqueous solution of acridine orange, 

rinsed in 1 % Na pyrophosphate, and mounted in Vectashield photobleaching 

retardant reagent. Fluorescent micrographs of the natural pioneer rhizobacterial 

communities that developed on the clover rhizoplane were acquired as a 

series of optisection, grayscale images georeferenced to the root tip landmark 

using laser scanning confocal microscopy with the 63x oil immersion objective 

and direct through-the-ocular confocal viewing. These digital images 

were segmented and used to produce a large continuous montage in Adobe 

Photoshop. The montage images were analyzed by CMEIAS to locate the x, y 

Cartesian coordinates of each individual microbial cell on the rhizoplane and 

compute its Cluster index (inverse of first nearest neighbor distance) in situ as 

the z variate. These CMEIAS data were then analyzed by the spatial geostatistics 

modeling techniques of semivariogram autocorrelation and kriging 

analyses (Murray 2002) using GS+ software (Robertson 2002). 

The variogram of Fig. 15 is the first of its kind in showing that an isotropic 

exponential model best fits the semivariance autocorrelation data of spatial 

dependence for pioneer root colonization by microorganisms in soil. It further 

clearly indicates that there is a spatial dependence in the nearest neighbor 

distribution of rhizoplane colonization for microorganisms, with a spatial 

scale of influence up to a separation distance of ~52 mm. Thus, microbes separated 

from each other by distances up to this spatial limit do influence each 

other’s root colonization pattern. Such information is fundamentally new in 

that it provides a real world perspective of the in situ spatial scales that are 

truly relevant to microbial colonization of plant root surfaces in soil. A first 

for in situ microbial ecology!


Fig. 15. CMEIAS/GS+ analysis of spatial geostatistics (autocorrelation semivariogram) 

for rhizobacteria during pioneer colonization of white clover seedlings grown in soil. 

This graph indicates the highly significant, fundamentally new finding that pioneer colonization 

of seedling roots by bacteria in soil has an in situ spatial dependence over a 

spatial scale up to 52 mm 

6.6 CMEIAS v. 3.0: Quantitative Autecological Biogeography of the 

Rhizobium–Rice Association 

In the fourth example, CMEIAS is being used to study the biogeography of R. 

leguminosarum bv. trifolii strain E11, a plant growth-promoting endocolonizer 

of rice roots isolated in the Nile delta where rice and berseem clover 

have been rotated since antiquity (Yanni et al. 1997). We are using this strain 

in a model study designed to define the autecological biogeography of rhizobial 

PGPR endophytes of rice at two spatial scales, one relevant to the organisms 

(its colonization of rice roots), and second relevant to the rice farmer 

who would be using such strains as rice biofertilizer inoculants to enhance 

rice production with less dependence on chemical fertilizer N (Yanni et al. 

2001). Figure 16A is an SEM image quadrat of the rice root surface after gnotobiotic 

cultivation with strain E11. Note that the root hair cells above the 

plane of focus have obscured some of the root surface, and therefore the full 

distribution of bacteria in this sampled area cannot be examined directly. 

This problem in microbial biogeography is solved by a geostatistical analysis 

of the spatial distribution data acquired by CMEIAS using a kriging analysis 

to interpolate spatial dependence information on a continuous scale even in 

areas not sampled. Figure 16B shows the 2-D krig map that provides a statistically 

defendable interpolation of the spatial density of bacteria in a continuous 

mode, even in these areas obscured by the overlying root hairs (Fig. 16B). 

The power of CMEIAS geostatistical analysis!

542 


Fig. 16. Geostatistical analysis of the spatial distribution of a plant growth-promotive 

strain of Rhizobium leguminosarum bv. trifolii colonized on the rice root surface. A Typical 

colonization pattern as shown by scanning electron microscopy. Scale bar 10 mm. B 

2-D interpolation kriging map of the spatial density of bacterial cells in A


6.7 CMEIAS v. 3.0: Spatial Scale Analysis of in Situ Quorum Sensing by 

Root-Colonizing Bacteria 

In the fifth example, CMEIAS is being used to extract information that sheds 

new light on the spatial scale at which cell-cell communication of quorum 

sensing occurs in situ during bacterial colonization of roots. This work is 

being done in a collaboration of the author with Prof. Anton Hartmann, 

Stephan Gantner and Christine Duerr in Germany. Confocal fluorescence 

images of roots are acquired to locate the positions of the red fluorescent protein 

reporter strain of bacteria that produces and secretes the acyl homoserine 

lactone quorum signal (source cells) and the green GFP-reporter strain of 

bacteria that cannot produce these signal molecules, but is nevertheless activated 

by them (sensor cells). The range of distances between each green sensor 

cell and its nearest red source cell neighbor then becomes a measure of the 

spatial scale at which the cell-to-cell communication of quorum-sensing signal 

molecules occurs in situ during root colonization. Early indications are 

that this spatial scale is close to the same range found for spatial dependence 

in root colonization as described in Fig. 15 above. Figure 17 further illustrates 

Fig. 17. CMEIAS/GS+ 

spatial geostatistical 

analysis of in situ 

quorum sensing 

among neighboring 

bacteria colonizing 

the root surface. A 

Dot map indicating 

the location of bacteria 

that provide the 

source of the extracellular 

quorum signal 

molecule (N-acyl 

homoserine lactone). 

Scale bar 10 mm. B 2- 

D interpolation kriging 

map of the predicted 

gradients of 

the quorum sensing 

molecule in situ on 

the root surface based 

on the localized cluster 

indices of colonized 

bacteria

544 


the power of geostatistical kriging as a spatial modeling technique that can 

provide a statistically defendable graphical display of the predicted gradients 

of quorum sensing signals that would diffuse from aggregates of “source cell” 

bacteria colonized on the root surface. Figure 17A shows the sample point 

location of signal source bacteria in an image quadrat and Fig. 17B is a 2-D 

kriging map of their cluster index on a continuous scale. This new technique 

in computer-assisted quantitative microscopy made possible by CMEIAS 

image analysis will undoubtedly impact on our understanding of plant surface 

microbiology and rhizoplane microbial ecology. 

7 Conclusions 

This chapter has illustrated with many examples from the author’s work on 

the Rhizobium–legume symbiosis how quantitative microscopy can make 

important contributions to the field of plant surface microbiology. In addition, 

numerous examples illustrate how our CMEIAS software can “count 

what really counts” to enhance the quantitative analysis of microbial communities 

and populations in situ without cultivation. This opportunity created by 

development of CMEIAS will undoubtedly yield fundamentally new information 

on plant–microbe interactions, and by so doing, expand our understanding 

of this fascinating subject of plant surface microbiology. 

Acknowledgments. Funds to support portions of the research reported in this chapter 

were provided by the Michigan State University Center for Microbial Ecology (National 

Science Foundation Grant NO. DEB-91–20006 and the MSU Research Excellence Fund), 

the MSU Kellogg Biological Station Long-Term Ecological Research project, the 

US–Egypt Science and Technology Joint Fund (projects BI02–001–017–98 and BI05– 

001–015), and the Michigan Agricultural Experiment Station. The author thanks Jim 

Tiedje, Phil Robertson, Rawle Hollingsworth, Youssef Yanni, Howard Towner, Dominic 

Trione, and Edward Marshall for advice and assistance, and the MSU Center for 

Advanced Microscopy for use of their facilities. 


Abe M, Sherwood JE, Hollingsworth RI, Dazzo FB (1984) Stimulation of clover root hair 

infection by lectin-binding oligosaccharides from the capsular and extracellular 

polysaccharides of Rhizobium trifolii. J Bacteriol 160:517–520 

Bishop P, Dazzo FB, Applebaum E, Maier R, Brill W (1977) Intergeneric transfer of symbiotic 

genes from Rhizobium trifolii to Azotobacter vinelandii. Science 198:938–940 

Bono JJ, Riond J, Nicolaou KC, Bockovich NJ, Estevez VA, Cullimore JV, Ranjeva R (1995) 

Characterization of a binding site for chemically synthesized lipo-oligosaccharidic 

NodRm factors in particulate fractions prepared from roots. Plant J 7:253–260 

Callaham D, Torrey J (1981) The structural basis for infection of root hairs of Trifolium 

repens by Rhizobium. Can J Bot 59:1647–1664


Cheng HP, Walker GC (1998) Succinoglycan is required for initiation and elongation of 

infection threads during nodulation of alfalfa by Rhizobium meliloti. J Bacteriol 

180:5183–5191 

Crockard MA, Bjourson AJ, Cooper JE (1999) A new peroxidase cDNA from white clover: 

Its characterization and expression in root tissue challenged with homologous rhizobia, 

heterologous rhizobia or Pseudomonas syringae. Mol Plant-Microbe Interact 

12:825–828 

Crockard MA, Bjourson AJ, Dazzo FB, Cooper JE (2002) A white clover nodulin gene, 

dd23b, encoding a cysteine cluster protein (CCP), is expressed in roots during the 

very early stages of interaction with Rhizobium leguminosarum biovar trifolii and 

after treatment with chitolipooligosaccharide Nod factors. J Plant Res 115:439–447 

Dazzo FB (1982) Leguminous root nodules. In: Burns R, Slater J (eds) Experimental 

microbial ecology. Blackwell, Cambridge, pp 431–446 

Dazzo FB, Hubbell DH (1975) Cross-reactive antigens and lectin as determinants of 

symbiotic specificity in the Rhizobium-clover association. Appl Microbiol 30:1017– 

1033 

Dazzo FB, Brill WJ (1977) Receptor sites on clover and alfalfa roots for Rhizobium.Appl 


Dazzo FB, Brill W (1978) Regulation by fixed nitrogen of host-symbiont recognition in 

the Rhizobium-clover symbiosis. Plant Physiol 62:18–21 

Dazzo FB, Brill W (1979) Bacterial polysaccharide which binds Rhizobium trifolii to 

white clover root hairs. J Bacteriol 137:1362–1373 

Dazzo FB, Hrabak EM (1981) Presence of trifoliin A, a Rhizobium-binding lectin, in 

clover root exudate. J Supramol Struct Cell Biochem 16:133–138 

Dazzo F, Hubbell DH (1982) Control of root hair infection. In: Broughton W (ed) Ecology 

of nitrogen fixation: vol II. Rhizobium. Oxford University Press, Oxford, pp 274–310 

Dazzo FB, Petersen MA (1989) Applications of computer-assisted image analysis for 

microscopic studies of the Rhizobium-legume symbiosis. Symbiosis 7:193–210 

Dazzo FB, Wright SF (1996) Production of anti-microbial antibodies and their use in 

immunofluorescence microscopy. In: Akkermans A, van Elsas J, de Bruijn F (eds) Molecular 

microbial ecology manual. vol 4.12. Kluwer, Dordrecht, pp 1–27 

Dazzo FB, Wopereis J (2000) Unraveling the infection process in the Rhizobium-legume 

symbiosis by microscopy. In: Triplett E (ed) Prokaryotic nitrogen fixation: a model 

system for the analysis of a biological process. Horizon Scientific Press,Wymondham, 

UK, pp 295–347 

Dazzo FB, Napoli C, Hubbell DH (1976) Adsorption of bacteria to roots as related to host 

specificity in the Rhizobium-clover symbiosis. Appl Environ Microbiol 32:166–177 

Dazzo FB,Yanke W, Brill W (1978) Trifoliin: a Rhizobium recognition protein from white 

clover. Biochim Biophys Acta 536:276–286 

Dazzo FB, Urbano MR, Brill WJ (1979) Transient appearance of lectin receptors on Rhizobium 

trifolii. Curr Microbiol 2:15–20 

Dazzo FB, Truchet GL, Sherwood JE, Hrabak EM, Gardiol AE (1982) Alteration of the trifoliin 

A-binding capsule of Rhizobium trifolii 0403 by enzymes released from clover 

roots. Appl Environ Microbiol 44:478–490 

Dazzo FB, Truchet G, Sherwood J, Hrabak E, Abe M, Pankratz HS (1984) Specific phases 

of root hair attachment in the Rhizobium trifolii-clover symbiosis. Appl Environ 

Microbiol 48:1140–1150 

Dazzo FB, Hollingsworth RI, Abe M, Smith KB, Welsch M, Morris PJ, Philip-Hollingsworth 

S, Salzwedel JL, Castillo RM (1987) Rhizobium trifolii polysaccharides, 

oligosaccharides, and other metabolites affecting development and symbiotic infection 

of clover root hairs. In: Steffens G, Rumsey T (eds) Biomechanisms regulating 

growth and development: keys to progress. Beltsville Symposium XII on Agricultural 

Research. Kluwer, Dordrecht, pp 343–355

546 


Dazzo FB, Hollingsworth R, Philip-Hollingsworth S, Robeles M, Olen T, Salzwedel J, 

Djordjevic M, Rolfe B (1988) Recognition processes in the Rhizobium trifolii-white 

clover symbiosis. In: Bothe H, de Bruijn F, Newton W (eds) Nitrogen fixation: hundred 

years after. Gustav Fischer, Stuttgart, Germany, pp 431–436 

Dazzo F, Truchet G, Hollingsworth R, Hrabak E, Pankratz H, Philip-Hollingsworth S, 

Salzwedel J, Chapman K, Appenzeller L, Squartini A, Gerhold D, Orgambide G (1991) 

Rhizobium lipopolysaccharide modulates infection thread development in white 

clover root hairs. J Bacteriol 173:5371–5384 

Dazzo FB, Mateos P, Orgambide G, Philip-Hollingsworth S, Squartini A, Subba-Rao NS, 

Pankratz HS, Baker D, Hollingsworth R,Whallon J (1993) The infection process in the 

Rhizobium-legume symbiosis and visualization of rhizoplane microorganisms by 

laser scanning confocal microscopy. In: Guerrero R, Pedros-Alio C (eds) Trends in 

microbial ecology. Spanish Society for Microbiology, Barcelona, pp 259–262 

Dazzo FB, Orgambide G, Philip-Hollingsworth S, Hollingsworth RI, Ninke K, Salzwedel 

JL (1996a) Modulation of development, growth dynamics, wall crystallinity, and 

infection thread formation in white clover root hairs by membrane chitolipooligosaccharides 

from Rhizobium leguminosarum bv. trifolii. J Bacteriol 178:3621–3627 

Dazzo FB, Orgambide G, Philip-Hollingsworth S, Hollingsworth RI, Ninke K, Smith D, 

Mateos PF, Squartini A, Bjourson AJ, Cooper JE, Wopereis J (1996b) Involvement of 

membrane chitolipo-oligosaccharides in the Rhizobium-white clover symbiosis. In: 

Chordi-Corbo A, Martinez-Molina E, Mateos P, Carpio-Santos M (eds) Advances in 

the investigation on biological nitrogen fixation. Excma Diputacion Provincal De 

Salamanca, Salamanca, Spain, pp 29–33 

Dazzo FB, Joseph AR, Gomma AB, Yanni YG, Robertson GP (2003) Quantitative indices 

for the autecological biogeography of a Rhizobium endophyte of rice at macro and 

micro spatial scales. Symbiosis 35:147–158 

Diaz CL, Melchers LS, Hooykaas PJ, Lugtenberg BJ, Kijne JW (1989) Root lectin as a 

determinant of host-plant specificity in the Rhizobium-legume symbiosis. Nature 

338:579–581 

Diaz CL, Spaink HP, Kijne JW (2000) Heterologous rhizobial lipochitin and chitin 

oligomers induced cortical cell divisions in red clover roots transformed with the pea 

lectin gene. Molec Plant-Microbe Interact 13:268–276 

Djordjevic MA, Gabriel DW, Rolfe BG (1987) Rhizobium: the refined parasite of legumes. 

Annu Rev Phytopathol 25:145–168 

Fåhraeus G (1957) The infection of clover roots by nodule bacteria studied by a simple 

glass slide technique. J Gen Microbiol 16:374–381 

Fernandez A, Hashsham S, Dollhopf D, Raskin L, Glagoleva O, Dazzo FB, Hickey R, Criddle 

C, Tiedje JM (2000) Flexible community structure correlates with stable community 

function in methanogenic bioreactor communities perturbed by glucose. Appl 


Gerhold DL, Dazzo FB, Gresshoff PM (1985) Selective removal of seedling root hairs for 

studies of the Rhizobium-legume symbiosis. J Microbiol Meth 4:95–102 

Hashsham S, Fernandez A, Dollhopf S, Dazzo FB, Hickey R, Tiedje JM, Criddle CS (2000) 

Parallel processing of substrate correlates with greater functional stability in 

methanogenic bioreactor communities perturbed by glucose. Appl Environ Microbiol 

66:4050–4057 

Hirsch A (1999) Role of lectins (and rhizobial exopolysaccharides) in legume nodulation. 

Curr Opin Plant Biol 2:320–326 

Hollingsworth RI, Abe M, Sherwood JE, Dazzo FB (1984) Bacteriophage-induced acidic 

heteropolysaccharide lyases that convert acidic heteropolysaccharides of Rhizobium 

trifolii into oligosaccharide units. J Bacteriol 160:510–516


Hollingsworth RI, Dazzo FB, Hallenga K, Musselman B (1988) The complete structure of 

the trifoliin A lectin-binding capsular polysaccharide of Rhizobium trifolii 843. Carbohydr 

Res 172:97–112 

Hollingsworth RI, Squartini A, Philip-Hollingsworth S, Dazzo FB (1989) Root hair 

deforming and nodule initiating factors from Rhizobium trifolii. In: Lugtenberg B 

(ed) Signal molecules in plants and plant-microbe interactions. Springer, Berlin Heidelberg 


Holt JJ, Krieg NR, Sneath PH, Staley JT, Williams ST (1994) Bergey’s manual of determinative 

bacteriology 9th edn. Williams and Wilkins, Baltimore, 787 pp 

Hrabak EM, Urbano MR, Dazzo FB (1981) Growth-phase dependent immunodeterminants 

of Rhizobium trifolii lipopolysaccharide which bind trifoliin A, a white clover 

lectin. J Bacteriol 148:697–711 

Hrabak EM, Truchet GL, Dazzo FB, Govers F (1985) Characterization of the anomalous 

infection and nodulation of subterranean clover roots by Rhizobium leguminosarum 

1020. J Gen Microbiol 131:3287–3302 

Jiminez-Zurdo J, Mateos P, Dazzo FB, Martinez-Molina E (1996) Cell-bound cellulase 

and polygalacturonase production by Rhizobium and Bradyrhizobium species. Soil 

Biol Biochem 28:917–921 

Leigh J, Reed J, Hanks J, Hirsch A, Walker G (1987) Rhizobium meliloti mutants that fail 

to succinylate their calcofluor-binding exopolysaccharide are defective in nodule 

invasion. Cell 51:579–587 

Lerouge P, Roche P, Faucher C, Maillet F, Truchet G, Prome J, Denarie J (1990) Symbiotic 

host-specificity of Rhizobium meliloti is determined by a sulfated and acylated glucosamine 

oligosaccharide signal. Nature 344:781–784 

Li D, Hubbell DH (1969) Infection thread formation as a basis for nodulation specificity 

in Rhizobium-strawberry clover associations. Can J Microbiol 15:1133–1136 

Liu J, Dazzo FB, Glagoleva O, Yu B, Jain A (2001) CMEIAS „ : a computer-aided system for 

image analysis of microbial communities. Microbial Ecology 41:173–194, 42:215 

Lopez-Lara I, Orgambide G, Dazzo FB, Olivares J, Toro N (1993) Characterization and 

symbiotic importance of acidic extracellular polysaccharides of Rhizobium sp. strain 

GRH2 isolated from Acacia nodules. J Bacteriol 175:2826–2832 

Lopez-Lara I, Orgambide G, Dazzo FB, Olivares J, Toro N (1995) Surface polysaccharide 

mutants of Rhizobium sp. (Acacia) strain GRH2: major requirement of lipopolysaccharide 

and acidic exopolysaccharide for successful invasion of Acacia nodules and 

host range determination. Microbiology (UK) 141:573–581 

Mateos P, Jiminez J, Chen J, Squartini A, Martinez-Molina E, Hubbell DH, Dazzo FB 

(1992) Cell-associated pectinolytic and cellulolytic enzymes in Rhizobium trifolii. 


Mateos P, Baker D, Philip-Hollingsworth S, Squartini A, Peruffo A, Nuti M, Dazzo FB 

(1995) Direct in situ identification of cellulose microfibrils associated with Rhizobium 

leguminosarum biovar trifolii attached to the root epidermis of white clover. 

Can J Microbiol 41:202–207 

Mateos PF, Zurdo J, Molina-Blanco J, Velazquez A, Dazzo FB, Martinez-Molina E (1996) 

Implication of cellulase production by Rhizobium in the establishment of the symbiosis 

with legumes. In: Chordi-Corbo A, Martinez-Molina E, Mateos P, Capri-Santos 

M (eds) Advances in the investigation on biological nitrogen fixation, Excma Diputacion 

Provincal De Salamanca, Salamanca, Spain, pp 45–48 

Mateos P, Baker DL, Petersen M, Velázquez E, Jiménez-Zurdo JI, Martínez-Molina E, 

Squartini A, Orgambide G, Hubbell DH, Dazzo FB (2001) Erosion of root epidermal 

cell walls by Rhizobium polysaccharide-degrading enzymes as related to primary 

host infection in the Rhizobium-legume symbiosis. Can J Microbiol 47:475–487 

McDermott TR, Dazzo FB (2002) Use of fluorescent antibodies for studying the ecology 

of soil- and plant-associated microbes. In: Hurst C, Crawford RC, Knudsen GR, McIn-

548 


erney MJ, Stetzenbach LD (eds), Manual of environmental microbiology, Chap. 28, 

American Society for Microbiology Press, Washington, DC, pp 615–626 

McKhann HI, Hirsch AM (1993) In situ localization of specific mRNAs in plant tissues. 

In: Thompson J, Glick B (eds) Methods in plant molecular biology and biotechnology. 

CRC Press, Boca Raton, pp 173–205 

Munoz J, Coronado C, Perez-Hormeache J, Kondorosi A, Ratet P, Palomares AJ (1998) 

MsPG3, a Medicago sativa polygalacturonase gene expressed during the alfalfa-Rhizobium 

meliloti interaction. Proc Natl Acad Sci USA 95:9686–9692 

Murray CJ (2002) Sampling and data analysis for environmental microbiology. In: Manual 

of environmental microbiology, American Society for Microbiology Press, Washington, 

DC, pp 166–177 

Napoli C, Hubbell DH (1976) Ultrastructure of Rhizobium-induced infection threads in 

clover root hairs. Appl Microbiol 30:1003–1009 

Napoli C, Dazzo FB, Hubbell DH (1975a) Production of cellulose microfibrils by Rhizobium. 

Appl Microbiol 30:123–131 

Napoli CA, Dazzo FB, Hubbell DH (1975b) Ultrastructure of infection and common antigen 

relationships in the Rhizobium-Aeschynomene symbiosis. In: Vincent J (ed) Proceedings 

of the 5th Australian Legume Nodulation Conference. Brisbane, Australia, 

pp 35–37 

Nutman P, Doncaster C, Dart P (1973) Infection of Clover by Root-Nodule Bacteria. 

British Film Institute, London 

Orgambide G, Philip-Hollingsworth S, Cargill L, Dazzo FB (1992) Evaluation of acidic 

heteropolysaccharide structures in Rhizobium leguminosarum biovars altered in 

nodulation genes and host range. Mol Plant-Microbe Interact 5:482–488 

Orgambide GG, Philip-Hollingsworth S, Hollingsworth RI, Dazzo FB (1994) Flavoneenhanced 

accumulation and symbiosis-related biological activity of a diglycosyl diacylglycerol 

membrane glycolipid from Rhizobium leguminosarum biovar trifolii. J 

Bacteriol 176:4338–4347 

Orgambide G, Lee J, Hollingsworth R, Dazzo FB (1995) Structurally diverse chitolipooligosaccharide 

Nod factors accumulate primarily in membranes of wild type 

Rhizobium leguminosarum bv. trifolii. Biochemistry 34:3832–3840 

Orgambide G, Philip-Hollingsworth S, Mateos P, Hollingsworth RI, Dazzo FB (1996) Subnanomolar 

concentrations of membrane chitolipooligosaccharides from Rhizobium 

leguminosarum biovar trifolii are fully capable of eliciting symbiosis-related 

responses on white clover. Plant Soil 186:93–98 

Parniske M, Zimmermann C, Cregan PB, Werner D (1990) Hypersensitive reaction of 

nodule cells in the Glycine max sp./Bradyrhizobium japonicum symbiosis occurs at 

the genotype-specific level. Botanica Acta 103:143–148 

Parniske M, Ahlborn B, Werner D (1991) Isoflavonoid inducible resistance to the phytoalexine 

glyceollin in soybean rhizobia. J Bacteriol 173:3432–3439 

Pellock BJ, Cheng HP, Walker GC (2000) Alfalfa root nodule invasion efficiency is dependent 

on Sinorhizobium meliloti polysaccharides. J Bacteriol 182:4310–4318 

Philip-Hollingsworth S, Hollingsworth RI, Dazzo FB (1989a) Host-range related structural 

features of the acidic extracellular polysaccharides of Rhizobium trifolii and 

Rhizobium leguminosarum. J Biol Chem 264:1461–1466 

Philip-Hollingsworth S, Hollingsworth RI, Dazzo FB, Djordjevic M, Rolfe BG (1989b) 

The effect of interspecies transfer of Rhizobium host-specific nodulation genes on 

acidic polysaccharide structure and in situ binding by host lectin. J Biol Chem 

264:5710–5714 

Philip-Hollingsworth S, Hollingsworth RI, Dazzo F (1991) N-acetylglutamic acid: an 

extracellular Nod signal of Rhizobium trifolii ANU843 which induces root hair 

branching and nodule-like primordia in white clover roots. J Biol Chem 266:16854– 

16858


Philip-Hollingsworth S, Orgambide G, Bradford J, Smith D, Hollingsworth R, Dazzo FB 

(1995) Mutation or increased copy number of nodE has no effect on the spectrum of 

chitolipooligosaccharide Nod factors made by Rhizobium leguminosarum bv. trifolii. 

J Biol Chem 270:20968–20977 

Philip-Hollingsworth S, Hollingsworth RI, Dazzo FB (1997) Structural requirements of 

chitolipooligosaccharides from Rhizobium leguminosarum bv. trifolii for uptake and 

mitogenic activity in legume roots as revealed by synthetic analogs and bioreactive 

fluorescent probes. J Lipid Res 38:1229–1241 

Reddy PM, Ladha JK, So R, Hernandez R, Dazzo FB, Angeles O, Ramos M, de Bruijn F 

(1997) Rhizobial communication with rice: induction of phenotypic changes, mode 

of invasion and extent of colonization. Plant Soil 194:81–98 

Reddy C, Liu J, Wadekar M, Prabhu A, Trione D, Marshall E, Zurdo J, Liu F-I, Urbance J, 

Dazzo FB (2002a) New features of CMEIAS innovative software for computer-assisted 

microscopy of microorganisms and their ecology. 2002 Ann. Mtg., Long-Term Ecological 

Research in Row-Crop Agriculture, KBS-LTER Site. Abstract at 

Reddy C, Liu F-I, Zurdo J, Dazzo FB (2002b) A new CMEIAS color recognition program 

for digital microbial ecology. 2002 Ann. Mtg., Long-Term Ecological Research in Row- 

Crop Agriculture, KBS-LTER Site. Abstract at 

Robertson P (2002) GS+ Geostatistics for the environmental sciences. Gamma Design 

Software, http://www.gammadesign.com 

Rolfe BG, Carlson RW, Ridge RW, Dazzo FB, Mateos PF, Pankhurst CE (1996) Defective 

infection and nodulation of clovers by exopolysaccharide mutants of Rhizobium leguminosarum 

bv. trifolii. Aust J Plant Physiol 23:285–303 

Salzwedel J, Dazzo FB (1993) pSym nod gene influence on elicitation of peroxidase activity 

from white clover and pea roots by Rhizobia and their cell-free supernatants. Mol 


Sanchez B, Coronado C, Philip-Hollingsworth S, Dazzo FB, Palomares A (1997) Structure 

and role in symbiosis of the exoB gene of Rhizobium leguminosarum bv. trifolii. Mol 

Gen Genet 255:131–140 

Schloter M, Borlinghaus R, Bode W, Hartmann A (1993) Direct identification and localization 

of Azospirillum in the rhizosphere of wheat using fluorescence-labeled monoclonal 

antibodies and confocal scanning laser microscopy. J Microsc 171:173–177 

Sherwood JE, Truchet GL, Dazzo FB (1984a) Effect of nitrate supply on in vivo synthesis 

and distribution of trifoliin A, a Rhizobium-trifolii binding lectin, in Trifolium repens 

seedlings. Planta 162:540–547 

Sherwood JE, Vasse JM, Dazzo FB, Truchet GL (1984b) Development and trifoliin Abinding 

ability of the capsule of Rhizobium trifolii. J Bacteriol 159:145–152 

Smit G, Swart S, Lugtenberg B, Kijne JW (1992) Molecular mechanisms of attachment of 

bacteria to plant roots. Mol Microbiol 6:2897–2903 

Subba-Rao NS, Mateos PF, Baker D, Pankratz HS, Palma J, Dazzo FB, Sprent JI (1995) The 

unique root-nodule symbiosis between Rhizobium and the aquatic legume, Neptunia 

natans (L. f.) Druce. Planta 196:311–320 

Towner H (1999) EcoStat ecological analysis program for windows, Ver. 1.03, Trinity 

Software,Campton,NH 

Truchet GL, Sherwood JE, Pankratz HS, Dazzo FB (1986) Clover root exudate contains a 

particulate form of the lectin, trifoliin A, which binds Rhizobium trifolii. Physiol Plant 

66:575–582 

Vance CP (1983) Rhizobium infection and nodulation: A beneficial plant disease? Annu 

Rev Microbiol 37:399–424 

van Rhijn P, Goldberg R, Hirsch A1 (1998) Lotus corniculatus nodulation specificity is 

changed by the presence of a soybean lectin gene. Plant Cell 10:1233–1249

550 


van Workum WAT, van Slogeren S, van Brussel AA, Kijne JW (1998) Role of exopolysaccharides 

of Rhizobium leguminosarum bv. viciae as host-specific molecules required 

for infection thread formation during nodulation of Vicia sativa. Molec Plant- 


Vega-Hernández MC, Pérez-Galdona R, Dazzo FB, Jarabo-Lorenzo A,Alfayate MC, León- 

Barrios M (2001) Novel infection process in the indeterminate root nodule symbiosis 

between tagasaste (Chamaecytisus proliferus) and Bradyrhizobium sp. (Chamaecytisus). 

New Phytol 150:707–721 

Vernoud V, Journet EP, Barker DG (1999) MtENOD20, a Nod factor-inducible molecular 

marker for root cortical cell activation. Mol Plant-Microbe Interact 12:604–614 

Wilcox CD, Dove SB, Doss-McDavid W, Greer DB (1997) UTHSCSA ImageTool „ Ver. 1.27, 

http://www.uthscsa.edu/dig/itdesc.html, Univ. Texas Health Science Center, San Antonio, 

TX 

Yanni Y, Rizk R, Corich V, Squartini A, Ninke K, Philip-Hollingsworth S, Orgambide G, 

deBruijn F, Stoltzfus J, Buckley D, Schmidt T, Mateos P, Ladha JK, Dazzo FB (1997) Natural 

endophytic association between Rhizobium leguminosarum bv. trifolii and rice 

roots and assessment of its potential to promote rice growth. Plant Soil 194:99–114 

Yanni YG, Rizk RY, Abd El-Fattah FK, Squartini A, Corich V, Giacomini A, de Bruijn F, 

Rademaker J, Maya-Flores J, Ostrom P, Vega-Hernandez M, Hollingsworth RI, Martinez-Molina 

E, Mateos P,Velazquez E,Wopereis J, Triplett E, Umali-Garcia M,Anarna 

JA, Rolfe BG, Ladha JK, Hill J, Mujoo R, Ng PK, Dazzo FB (2001) The beneficial plant 

growth-promoting association of Rhizobium leguminosarum bv. trifolii with rice 

roots. Aust J Plant Physiol 28:845–870 

Yao Y,Vincent JM (1976) Factors responsible for the curling and branching of clover root 

hair by Rhizobium. Plant Soil 45:1–16

28 Analysis of Microbial Population Genetics 

Emanuele G. Biondi, Alessio Mengoni and Marco Bazzicalupo 


The knowledge of genetic diversity in bacterial population has increased considerably 

over the last 15 years, due to the application of molecular techniques 

to microbial ecological studies. Quantitative resolution has improved as a 

large number of haplotypic markers are found within each sample and as a 

large number of samples can be simultaneously investigated. 

Among the molecular methods, the PCR-based techniques provide a powerful 

and high throughput approach for the study of genetic diversity in bacterial 

populations. PCR fingerprinting methods for the analysis of biodiversity 

are numerous and usually very effective. Some of the most commons are 

the PCR-RFLP of specific sequences (16S rDNA, intergenic transcribed 

spacer, ITS) (Laguerre et al. 1996), the Repetitive Extragenic Palindromic-PCR 

(Woods et al. 1992) and the BOX-PCR (Louws et al. 1994) based on the presence 

of repetitive elements within the bacterial genome, the DNA amplification 

fingerprintings (DAF; Caetano-Anollés and Bassam 1993), RAPDs (random 

amplified polymorphic DNA; Williams et al. 1990,Welsh and McClelland 

1990) and AFLPs (amplified fragment length polymorphism; Vos et al. 1995). 

Each method has advantages and disadvantages and the choice of the appropriate 

one depends on the expected degree of polymorphism within the population, 

the selection of the specific genomic region and the possibility of 

automation for screening of large samples. ITS, RAPD and AFLP have been 

shown to be particularly relevant for the study of genetic diversity within 

populations of bacteria belonging to the same or closely related species. 




552 

Emanuele G. Biondi 

2 Materials for RAPD, AFLP and ITS 

Equipment: 

– Thermal cycler 

– Gel electrophoresis apparatus with power supply, agarose and polyacrylamide 

(sequencing) 

– Automated sequencer for capillary electrophoresis equipped with discrete 

band analysis software 

– UV transilluminator and gel documentation system 

Caution: UV rays are dangerous. Protect eyes with a plastic shield 

Reagents and solutions: 

– double distilled water (ddH 2 O) sterilised by autoclaving. Prepare 100 ml 

aliquots before sterilisation and keep at –20 °C. Discard the aliquot after 

each use 

– 50 mM MgCl 2 stock solution usually supplied with the Taq enzyme 

– dNTPs stock solution (2 mM of each dNTP in ddH 2O) 

– Taq DNA polymerase 

– Restriction enzymes: EcoRI and MseI, a single restriction buffer compatible 

with both enzymes 

– T4 DNA ligase and specific ligation buffer, 5x stock solution supplied with 

the ligase enzyme 

– Double-stranded adapters for AFLP (use 50 pmol for each adapter in the 

ligation mixture). The sequence of two single stranded oligonucleotides 

(5¢–3¢) corresponding to double-stranded adapters are reported. To prepare 

the double-strand molecule, incubate 100 pmol/ml of each oligonucleotide 

at 94 °C for 10 min and then slowly decrease the temperature down 

to 4 °C. Keep at –20 °C 

EcoRI adapter oligonucleotides: 

5¢–CTC GTA GAC TGC GTA CC–3¢ 

5¢–AAT TGG TAC GCA GTC TAC–3¢ 

EcoRI double stranded adapter: 

5¢–CTC GTA GAC TGC GTA CC–3¢ 

5¢–AAT TGG TAC GCA GTC TAC–3¢ 

MseI adapter oligonucleotides: 

5¢–GAC GAT GAG TCC TGA G–3¢ 

5¢–TAC TCA GGA CTC AT–3¢ 

MseI double stranded adapter: 

5¢–GAC GAT GAG TCC TGA G–3¢ 

5¢–TC TCA GGA CTC TA–3¢ 

– Primers for AFLP (without selective bases): pEcoRI-T (5¢–GAC TGC GTA 

CCA ATT C-T–3¢), 5¢ labelled with 6-carboxifluorescein (6-FAM); pMseI-A 

(5¢–GAT GAG TCC TGA GTA-A–3¢), 5¢ labelled with 4,7,2¢,4¢,5¢,7¢-hexachloro-6-carboxyfluorescein 

(HEX). Prepare 10 mM stock solution

– Primers for ITS amplification: FGPS1490 (5¢–TGCGGCTGGATCACCTC- 

CTT–3¢) and FGPS132¢ (5¢–CCGGGTTTCCCCATTCGG–3¢), 10 mM stock 

solution in ddH 2O. These primers are selected for Rhizobia and may apply 

to other bacterial groups, however specific primers for particular genera 

can be designed on known 16S and 23S sequences retrieved from GenBank 

or Ribosomal Database (RDP) 

– 10-base random primers for RAPD (series OP from Operon Technologies), 

80 mM stock solution in ddH 2O. The choice of the primers is highly relevant 

for the usefulness of the results obtained (see the RAPD principles section 

for details) 

– DNA size marker: good examples are a 100-bp ladder for agarose gel electrophoresis 

and TAMRA 500 (Applied Biosysem, PE) for capillary electrophoresis 

– Genomic DNA: for RAPD and ITS concentrations at 10 ng/ml in ddH 2 O. For 

the AFLP, use concentrations at 50 ng/ml. For general extraction protocols, 

see Bazzicalupo and Fancelli (1997).Alternatively, use BIO 101 DNA extraction 

kit 

Note: All the above reagents should be kept at –20 °C 

– TAE buffer: 40 mM Tris/Acetate, 1 mM EDTA, pH 8. Prepare a 50x stock 

solution 

– ethidium bromide stock solution: 10 mg/ml; store in a dark bottle 

– agarose 

– 10x loading buffer: 70 % (w/v) glycerol, 0.5 % (w/v) bromophenol blue; 

store at 4 °C 

Caution: Ethidium bromide is a powerful mutagen: wear gloves when handling 

this compound; wear mask when weighing it 

3 RAPD 

28 Analysis of Microbial Population Genetics 553 

Principle 

The RAPD assay (Welch and McClelland 1990; Williams et al. 1990) is a PCR 

amplification performed on genomic DNA template using a single short, arbitrary 

oligonucleotide primer and low annealing temperature, conditions that 

ensure the generation of several discrete DNA products. Each of these fragments 

is derived from a region of the genome that contains two primer binding 

sites on opposite strands and at an amplifiable distance. Polymorphism 

between strains results from sequence differences which inhibit or enhance 

primer binding or otherwise affect amplification. Single base mutations, 

insertions and deletions are molecular events that produce RAPD polymorphism. 

The large number of bands amplified with a single arbitrary primer 

generates a complex fingerprinting that can be utilised to detect relative differences 

in the random amplified DNA sequences from two different 

genomes. RAPDs have been applied to bacterial population genetics for sev-

554 


eral species which live in association with plants, such as Sinorhizobium 

meliloti (Paffetti et al. 1996; Carelli et al. 2000), Burkholderia cepacia (Di Cello 

et al. 1997) and Pseudomonas (Picard et al. 2000). 

Although the sequence of RAPD primers is arbitrarily chosen, two basic 

criteria must be met: a minimum of 40 % G+C content (50–80 % G+C content 

is generally used) and the absence of palindromic sequences. Primers can also 

be purchased as a specific set for RAPD reactions from Operon Technologies 

(http://www.operon.com/). 

Experimental procedure 

In order to minimise the risk of contamination, the reaction should be prepared 

with a set of pipettes and tips used exclusively for this purpose 

in a clean environment (laminar flow hood being optimal) and wearing 

gloves. 

1. Prepare a master mix in ice of those reagents common to all the programmed 

reactions, i.e. dNTPs, MgCl 2 , primer, buffer and Taq DNA polymerase. 

Mix all reagents well. Prepare a quantity sufficient for the samples 

and for control reactions in which template DNA is omitted. Usually RAPD 

reactions are carried out in 25 ml total volume in the 0.2-ml PCR tube. The 

following concentrations are required: 

– Template DNA: 1 ng/ml 

– dNTPs: 200 mM 

– Primer: 6.4 mM 

– MgCl 2 :3mM 

– Taq buffer: 1x strength 

– Taq DNA polymerase: 0.032 U/ml 

For 10 samples, 11 reactions should be prepared using the following volumes: 

– ddH 2O: 149.6 ml 

– 10x Taq buffer: 27.5 ml 

– 2 mM dNTPs: 27.5 ml 

– 80mM primer: 22 ml 

– 50 mM MgCl 2: 16.5 ml 

– 2 U/ml Taq DNA polymerase: 4.4 ml 

2. Aliquot the DNA (25 ng=2.5 ml) in the PCR tubes and then add the required 

volume of master mix (22.5 ml per tube) 

3. Place the tubes in the thermal cycler and perform an initial denaturation 

step at 94 °C for 5 min 

4. Cycle the reactions 45 times with the following temperature profile: denaturation 

at 94 °C for 1 min, annealing at 36 °C for 1 min and extension at 

72 °C for 2 min. After the last cycle perform an extension step of 10 min 

5. Store samples at 4 °C for a few hours (or –20 °C if longer) 

6. Prepare a 2 % agarose gel in TAE buffer with 1 mg/ml of ethidium bromide. 

It is advisable to use a comb with teeth as thin as possible: the thinner the


teeth, the sharper the bands will appear. Caution: ethidium bromide is a 

mutagen! Wear gloves when handling 

7. Add 1 ml of 10x loading buffer to 9 ml of each sample 

8. Load the samples and the required amount of size marker 

9. Run the gel at 10 V/cm for 1 h 30 min 

10. Document the gel on UV transilluminator 

Results and Comments 

RAPD is a fast, cheap and powerful technique, which generates a high amount 

of polymorphism, being able to distinguish among isolates of the same populations 

in a very effective manner. The RAPD assay, according to the described 

protocol, generates reproducible fingerprints. Usually the size of RAPD products 

ranges from a few hundreds to about 2000 bp (Fig. 1). As a rule, the highest 

and lowest bands should be avoided as they are less reproducible. Before 

starting the analysis, a collection of primers, usually 20–30, should be tested 

on a selected subsample of strains in order to choose those that appear more 

suitable for the purpose and exclude those that did not show polymorphism. 

In general, four to six primers with different degrees of polymorphism are 

used for population analysis. 

Troubleshooting 

– Low polymorphism: use different primers. 

– Reproducibility: use the same enzyme brand, the same thermal cycler for 

all the experiments. Poor quality or insufficient amounts of template DNA 

are most likely involved for low reproducibility. Perform RAPD reactions 

twice on at least some of the samples to check the reproducibility of all the 

recorded bands. 

– Smearing: an excessive amount of template or primer or Taq DNA polymerase 

has most likely been used. Perform test reaction with reduced 

amount of each of these components at a time. 

Fig. 1. RAPD pattern of different isolates of Sinorhizobium meliloti. M Ladder 100 bp 

(Life Technologies)

556 

– Low intensity of the bands: insufficient amount of primer or dNTPs. Try 

increasing the amount of each one of these components at a time. 

3 AFLP 


Principle 

Amplified Fragment Length Polymorphism (AFLP) is a recently developed 

technique based on restriction and amplification (Zabeau et al, 1993; Vos et al. 

1995; Fig. 2). Using this method it is possible to generate up to 100 genomic 

markers with a single combination of restriction enzyme and primers. In particular, 

the application to microbial population analysis has been used to differentiate 

bacteria at strain and species levels from the taxonomic, phylogenetic 

or the population genetics point of view (Biondi et al. 2003). Moreover, 

adapter 

GAATT 

C 

GAATT 

C 

primer 

genomic DNA 

EcoRI MseI 

GAATTC 

CTTAAG 

C 

TTAAG 

C 

TTAAG 

GAATTC 

CTTAAG 

AATT 

TTAA 

Digestion with EcoRI and MseI 

T 

AAT 

Ligation with Adapters 

T 

AAT 

TTAA 

AATT 

TAA 

T 

TAA 

T 

Annealing of Selective primers 

adapter adapter 

Amplification 

primer 

adapter 

Fig. 2. Outline of AFLP technique. In dark grey the EcoRI restriction site and in light 

grey the MseI restriction site. See text for details


the AFLP analysis can be applied to map phenotypic traits in eukaryotic 

organisms. 

The genomic DNA is digested with restriction enzymes chosen to obtain 

fragments whose size is less than 1 Kb. After the digestion, all the fragments 

are ligated with adapters which recognise the digested ends. During this passage 

all DNA molecules acquire the same sequence at the ends. The ligated 

DNA is used as a template for PCR amplification; the primers used in this 

amplification are complementary to the adapter’s sequence. Moreover, by 

adding one or two bases to the 3¢ end of the primers sequence, it is possible to 

obtain different numbers of genetic markers: more selective bases result in 

the reduction of the number of amplified fragments. Finally, the detection of 

the amplified fragments and the estimation of their size can be obtained by 

two methods: polyacrylamide gel electrophoresis and capillary electrophoresis. 

This second method is more powerful and easier to handle and, therefore 

we will discuss only this method to analyse AFLP results. 

Experimental procedures 

1. Prepare the DNA using an extraction method that preserves the integrity of 

high molecular weight molecules (see material for reference) 

2. Digest 200 ng aliquots of extracted genomic DNA in 25 ml final volume with 

5U ofEcoRI and 5 U of MseI using as enzyme buffer the MseI buffer supplied 

by the manufacturer, incubate 2 h at 37 °C. Heat-inactivate the 

enzymes at 70 °C for 15 min 

3. Ligate the adapters to the restriction products by adding 25 ml of the 2x ligation 

solution (1 unit of T4 DNA ligase, 50 pmoles of each adapter) to the 

digestion mixture (50 ml final volume) using double-stranded adapters 

with single-stranded overhang complementary to 5¢ and 3¢ ends generated 

during digestion. The ligation solution is incubated for 2 h at 20 °C 

4. Perform the amplification reactions in a 50 ml total volume containing, 10x 

reaction buffer, 2.5 mM MgCl 2, 0.2 mM of each dNTP, 1.6 U of Taq DNA 

polymerase, 10 pmoles of each primer, 1 ml of template DNA (corresponding 

to approximately 4 ng of digested and ligated genomic DNA). For example: 

for 10 samples, consider a master mix solution for 11 single PCR reactions; 

add 1ml of template derived from the AFLP ligation to a 0.2-ml PCR 

tube; prepare a master mix (MM) with 408.1 ml of ddH 2 O, 11ml of each 

primer solution, 55ml PCR buffer 10x, 27.5 ml of a 50 mM MgCl 2 solution 

and finally 9.9 ml of Taq DNA polymerase solution (3.5 U/ml); mix gently 

and aliquot 50 ml of the MM solution in each tube. The PCR conditions have 

been optimised in a Perkin-Elmer 9600 thermocycler (Perkin-Elmer, Norfolk, 

CT, USA), using the following amplification program: (94 °C for 30 s + 

65 °C for 30 s’ + 72 °C for 60 s) repeated for 13 cycles, decreasing the annealing 

temperature by 0.7 °°C each cycle and 23 cycles as follows: 94 °C for 30 s 

+ 56 °C for 30 s + 72 °C for 60 s. Several combinations of primers can be 

selected, but good results were obtained with: pEcoRI-T (5¢–GAC TGC GTA

558 


CCA ATT CT–3¢), labelled with 5¢-6-carboxifluorescein (6-FAM) and 

pMseI-A (5¢–GAT GAG TCC TGA GTA AA–3¢), labelled with 5¢- 

4,7,2¢,4¢,5¢,7¢-hexachloro-6-carboxyfluorescein (HEX) (in bold the selective 

bases) 

5. Check the amplification by running a 5 ml aliquot in a 1.5 % agarose gel 

6. Size the product on an automatic capillary electrophoresis sequencer 

(Perkin-Elmer ABI 310 analyser). Load the capillary with 1.5 ml volume of 

AFLP PCR product and 0.5 ml of GenScan internal size standard TAMRA- 

500 (PE Biosystems) with 12.5 ml of deionised formamide and perform the 

electrophoresis as recommended by the manufacturer for fragment sizing. 

Results and Comments 

The AFLP technique usually produces a large amount of data (up to 100 different 

molecular markers) and for this reason it is recommended to use a 

computer-based system to manage the results. In this section we will discuss 

only the DNA sequencer output data analysis which gives data corresponding 

to fragments between 50 and 500 bp (range of TAMRA 500 molecular 

marker). The first step is the selection of useful data from the raw results. 

First, reject all peaks derived from single fluorochromes and analyse only the 

signals derived from both fluorochromes. After that, a threshold has to be 

introduced in order to continue only with real amplification signals. Usually 

only peaks having an intensity higher than 50 Fluorescence Units will be 

selected.After the selection, signals will be used to compute a distance matrix 

from which the genetic structure of the population can be analysed. 


– Low intensity of the amplified AFLP bands: check the purity and the 

amount of DNA (100–300-ng range), try a different extraction method and 

different amount of DNA, test the reagents and the procedure with control 

DNA and control primers. Check that the primers used are correctly 

labelled. For the PCR reaction try a different amount of ligated DNA 

(1–4 ml) as template. Magnesium chloride concentration and annealing 

temperature are most likely involved in poor amplification, perform test 

reactions modifying the amount/value of these variables. Load different 

amounts of the PCR product on the automatic sequencer to optimise the 

fluorescent signal. 

– Too many or too few bands: test different combinations of primers. If the 

bands are fewer than expected, remove the extra bases from the adapter 

complementary primers. On the contrary, if the bands are too many, add 

selective bases of up to two for each primer.

6 ITS-RFLP analysis 


Principle 

The 16S–23S rRNA intergenic transcribed spacer (Fig. 3; ITS, the spacer 

sequence between 16S and 23S rRNA bacterial genes synonymous with IGS, 

inter genic spacer) is a sequence that exhibits large variability useful in identifying 

genomic groups at the intraspecific level (Barry et al. 1991; Jensen et al. 

1993; Laguerre et al. 1996; Doignon-Bourcier et al. 2000). The genetic variability 

of this particular region derives from: (1) the presence of t-RNA genes 

inside the ITS and (2) the mutation rate of ITS higher than that of ribosomal 

genes. Restriction fragment length polymorphism of PCR-amplified ITS 

(ITS-RFLP) is a fingerprinting method for the characterisation of bacterial 

strains with a higher discriminating power than the 16S rDNA RFLP (ARDRA 

method). For the amplification of the ITS, different primer pairs, designed on 

the coding regions of 16SrRNA and 23SrRNA genes, can be chosen depending 

on the bacterial group to be analysed. In general, the forward primer corresponds 

to the internal region of the 16S gene while the reverse primer corresponds 

to the beginning of the 23S gene. Information on primers for specific 

bacterial groups can be retrieved from the specific literature or from Gen- 

Bank or RibosomalDataBase (http://www.ncbi.nlm.nih.gov/ or http://rdp. 

cme.msu.edu/html/). For the amplification of the ITS region of rhizobia we 

used primers FGPS1490 (Navarro et al., 1992) and FGPS132¢ (Ponsonnet and 

Nesme 1994). FGPS1490 is designed on conserved sequences of the 3¢ end of 

the 16S rRNA gene (corresponding to Eschericha coli numbering positions 

1525–1541), and reverse primer FGP132¢ is designed on the 5¢ end of the 23S 

rRNA gene (corresponding to the E. coli numbering positions 115–132). For 

ITS-RFLP the amplified intergenic region is digested with four-base recognition 

site restriction enzymes in order to generate specific patterns of bands. 

Depending on the type of the samples and on the aim of the study, from two 

to five or more different restriction enzymes are used. The more enzymes 

used, the higher the number of bands, i.e. molecular markers produced. The 

restriction of the amplification product should be performed using enzymes 

which cut several times in the intergenic spacer, thus, before starting to 

analyse the IGS of a particular species, a number of enzymes should be tested 

to select the best combination. Some restriction enzymes frequently used are: 

AluI, MseI, HhaI, TaqI, Sau3A. 

16S rDNA ITS/IGS 

23S rDNA 

Fig. 3. Structure of the bacterial ribosomal operon showing the position of ITS region. 

Primers are indicated by arrows

560 


Experimental procedures: 

1. Perform a PCR amplification reaction in a 50 ml total volume containing, 

10x reaction buffer, 2.5 mM MgCl 2, 0.2 mM of each dNTP, 1.6 U of Taq DNA 

polymerase, 10 pmoles of each primer (FGPS1490 and FGPS132¢), 25 ng of 

template DNA concentrated to 25 ng/ml. For nine samples consider a master 

mix solution for ten single PCR reactions with the following volumes: 

– ddH 2O: 337ml 

– 10x Taq buffer: 50 ml 

– 2 mM dNTPs: 50 ml 

– 10mM primer FGPS1490 : 10 ml 

– 10mM primer FGPS132¢:10ml 

– 50 mM MgCl 2 :25ml 

– 2U/ml Taq DNA polymerase: 8 ml 

– 1ml of template in each tube before aliquoting 49 ml of the master mix 

2. Cycle the reactions through the following temperature profiles: initial melting 

at 94 °C for 5 min followed by 35 cycles at 94 °C for 1 min, 55 °C for 55 s, 

72 °C for 2 min. Perform a final extension step at 72 °C for 10 min 

3. Analyse 5 ml of each amplification mixture by agarose gel (1.2 % w/v) electrophoresis 

in TAE buffer containing 1 mg/ml (w/v) of ethidium bromide. 

Caution: ethidium bromide is mutagenic: wear gloves when handling. The 

result of the electrophoresis will ensure that amplification has been successful 

and will also help to quantify the amount of amplified DNA 

4. Digest approximately 500–600 ng (5–6 ml) of the amplified IGS, with 2 units 

of the restriction enzyme in a total volume of 15 ml for 2 h. Use the buffer 

and incubation conditions recommended by the manufacturer of the 

restriction enzyme. Inactivate the enzyme. Make a separate digestion for 

each restriction enzyme to be used 

5. Resolve the reaction products (15 ml) by agarose gel (2.5 % w/v) electrophoresis 

in TAE buffer run at 10 V/cm and stained with 1 mg/ml (w/v) of 

ethidium bromide. 

Caution: ethidium bromide is mutagenic: wear gloves when handling 


– Low intensity of the amplified ITS: check PCR reaction conditions. Magnesium 

chloride concentration and annealing temperature are most likely 

involved, perform test reactions modifying these variables. 

– Partially digested products: excessive amount of amplified ITS, low restriction 

enzyme concentration, incubation time too short. Perform test reactions 

with a reduced amount of DNA, or add more restriction enzyme or 

incubate for a longer time.

7 Statistical analysis 


Introduction 

The studies of microbial population genetics with molecular methods are 

often characterised by an extremely high number of samples and by a high 

number of molecular markers. As a consequence, an immediate interpretation 

of the results can be difficult unless powerful statistical techniques are 

used in order to describe the structure of the populations and to highlight the 

contributions of its components (Mengoni and Bazzicalupo 2002). 

Methods and Procedure 

Statistical treatment of data in microbial population genetics include at least 

four different levels of analysis: 

1. Quantification of the genetic diversity within the population 

2. Measurement of genetic distances between strains 

3. Analysis of the genetic structure 

4. Analysis of the genetic relationships among populations. 

Several methods can be used to address each of these points. Here, a brief 

summary of the principal parameters and software used is provided. 

The molecular data obtained from RAPD,AFLP, and ITS-RFLP analyses are 

usually bands in a gel or peaks in a chromatogram. These data are transformed 

into a matrix of state binary vectors (molecular haplotype) for each 

individual isolate using a compiler such as Microsoft Excel or similar. Bands 

and peaks of equal sizes are interpreted as identical and intensity is not considered 

as a difference. The molecular haplotype of each isolate is expressed 

as a vector of zeroes (for the absence of the band) or ones (for its presence), 

assuming that bands represent independent loci. 

1. The quantification of genetic diversity within the population can be done 

using several parameters. The most commonly used are the gene diversity, 

the average gene diversity over loci and the mean number of pairwise differences 

between haplotypes. 

The gene diversity is equivalent to the expected heterozygosity for diploid 

data. It is defined as the probability that two randomly chosen molecular 

haplotypes are different in the sample. 

The average gene diversity over loci is defined as the probability that two 

individuals are different for a randomly chosen locus. These two parameters 

vary from 0 (all isolates identical) to 1 (maximum diversity). 

The mean number of pair-wise differences simply calculates the mean 

number of differences between all pairs of molecular haplotypes in the 

population. The computation of these three parameters is performed with 

Arlequin software (Schneider et al. 1997). 

2. For the measurement of the genetic distances between strains, several 

methods can be applied. The basic principle is the ratio of bands shared by

562 


two strains with respect to the total ones. One commonly used parameter is 

the Euclidean distance whose formalisation is E=n(1–2n xy /2n), where n is 

the total number of bands of strain x and y and n xy the number of bands 

shared by strains x and y. Another widely used parameter is the Nei’s 

distance which, using the same notation, can be formalised as 

D=1–[2n xy/(n x+n y)], where n x and n y are the number of bands present in the 

strains x and y,respectively. 

3. Examples of techniques for ordering the genetic diversity to analyse the 

genetic structure of a population are the analysis of molecular variance 

(AMOVA) and the principal component analysis (PCA). The AMOVA is a 

methodology for the analysis of variance which makes use of molecular 

data. AMOVA allows us to uncover the structure of the population and to 

test the validity of the hypotheses on the subdivision of the analysed population. 

AMOVA was designed by Excoffier, Smouse and Quattro in 1992 

(Excoffier et al. 1992) as “an alternative methodology that makes use of 

available molecular information gathered in population surveys, while 

remaining flexible enough to accommodate different types of assumptions 

about the evolutionary genetic system” (Excoffier et al. 1992). Assuming 

that a set of samples belongs to different populations and that these populations 

could be arranged in genetically distinguishable groups, the aim of 

AMOVA is to perform statistical tests on the hypothesised genetic structure.A 

hierarchical analysis of variance splits the total genetic variance into 

components due to intra-population differences among individual samples, 

inter-population differences and inter-group differences. 

The PCA is an analysis in which a data set is searched for some significant 

independent variables, with respect to all possible variables. These variables 

are termed ‘components’ and interest attaches especially to the principal, 

or most important, components, hence the name ‘principal component 

analysis’. The output of the analysis is a plot in which the samples are 

dispersed in a two- or three-dimensional space allowing the recognition of 

the clusterisation pattern with respect to one of the dimensions (components). 

4. The genetic relationships among populations can be estimated as the 

results of AMOVA with respect to the variance between populations. The 

parameter of the genetic separation between populations is F ST (Wright 

1965) which derives directly from the analysis of variance. The F ST values 

can be used to construct a matrix of distances whose representation takes 

the form of a dendrogram or tree. Two tree-building methods are applicable 

to the distance matrix: UPGMA and Neighbor-Joining (Saitou and Nei 

1987). The UPGMA is based on a simple mathematical algorithm in which 

a step-wise clusterisation is made. The Neighbor-Joining method is a simplified 

version of a minimal evolution method; a star-like tree is made and 

then the topology is reconstructed on the basis of the minimisation of the 

overall length of the tree.

Software requirements 

– Scoring of the bands: MICROSOFT EXCEL or similar. 

– Quantification of genetic diversity within population: ARLEQUIN (Schneider 

et al. 1997). 

– Measurement of the genetic distances between strains: ARLEQUIN 

(Schneider et al. 1997); 

NTSYS-pc (Rohlf 1990) 

RAPDistance (freely downloaded from http://life.anu.edu.au/molecular/ 

software/rapd.html) 

– Analysis of the genetic structure: 

(1) AMOVA: ARLEQUIN (Schneider et al. 1997); 

(2) PCA: NTSYS-pc (Rohlf 1990) 

– Estimation of genetic relationships among populations: ARLEQUIN 

(Schneider et al. 1997) 

MEGA (Kumar et al. 1993) 

NTSYS-pc (Rohlf 1990) 

PHYLIP (Freely downloaded from 

http://evolution.genetics.washington.edu/phylip.html) 

Many of these softwares exist either as DOS/Windows and as Mac versions. 

For ARLEQUIN a Linux version also has been developed. 

8 Concluding Remarks 


Several techniques for the analysis of genetic diversity of bacterial populations 

have been proposed. RAPD, ITS and AFLP are effective technologies able 

to show intra-population polymorphism and to detect phylogenetic relationships 

among strains belonging to the same or closely related bacterial species. 

RAPD is a suitable technique in that it is fast, cheap and the amount of polymorphism 

displayed is high. RAPD has the disadvantage of requiring accurate 

setting up of the conditions to obtain high reproducibility. ITS-RFLP analysis 

on the contrary, shows less polymorphism, which is linked to a defined DNA 

region, being more suitable to define phylogenetic relationships among 

strains. 

AFLP shows some advantages over the other methods: (1) the high stringency 

of the PCR conditions gives robust reproducibility; (2) easy application 

to plant, animal and bacterial genomic DNA. AFLP requires more DNA than 

RAPD and ITS-RFLP and a more laborious procedure. Nevertheless,AFLP has 

a high informational content per single reaction, in fact, up to 100 different 

bands can be displayed in a single lane and the scoring can be done with an 

automatic sequencer.

564 



Barry T, Colleran G, Glennon M, Dunican LK, Gannon F (1991) The 16 S/23 S ribosomal 

spacer region as a target for DNA probes to identify eubacteria. PCR Methods Appl 

1:51–56 

Bazzicalupo M, Fancelli S (1997) DNA extraction from bacterial colonies. In: Micheli 

MR, Bova R (eds) Fingerprinting methods based on arbitrary primed PCR. Springer, 


Biondi EG, Pilli E, Giuntini E, Roumiantseva ML, Andronov EE, Onichtchouk OP, Kurchak 

ON, Simarov BV, Dzyubenko NI, Mengoni A, Bazzicalupo M (2003) Evolutionary 

relationship of Sinorhizobium meliloti and Sinorhizobium medicae strains isolated 

from Caucasian region. FEMS Lett 220:207–213 

Caetano-Anollés G, Bassam BJ (1993) DNA amplification fingerprinting using arbitrary 

oligonucleotide primers. Appl Biochem Biotech 42:189–200 

Carelli M, Gnocchi S, Fancelli S, Mengoni A, Paffetti D, Scotti C, Bazzicalupo M (2000) 

Genetic diversity and dynamics of Sinorhizobium meliloti populations nodulating 

different alfalfa varieties in Italian soils. Appl Environ Microbiol 66:4785–4789 

Di Cello F, Bevivino A, Chiarini L, Fani R, Paffetti D, Tabacchioni S, Dalmastri C (1997) 

Biodiversity of a Burkholderia cepacia population isolated from the maize rhizosphere 

at different plant growth stages. Appl Environ Microbiol 63:4485–4493 

Doignon-Bourcier F, Willems A, Coopman R, Laguerre G, Gillis M, De Lajudie P (2000) 

Genotypic characterization of Bradyrhizobium strains nodulating small Senegalese 

legumes by 16S-23S rRNA intergenic gene spacers and amplified fragment length 

polymorphism fingerprint analyses. Appl Environ Microbiol 66:3987–3997 

Ellsworth DL, Rittenhouse KD, Honeycutt EL (1993) Artifactual variation in randomly 

amplified polymorphic DNA banding patterns. BioTechniques 14:214–217 

Excoffier L, Smouse PE, Quattro JM (1992) Analysis of molecular variance inferred from 

metric distances among DNA haplotypes: application to human mitochondrial DNA 

restriction data. Genetics 131:479–491 

Jensen MA, Webster JA, Strauss N (1993) Rapid identification of bacteria on the basis of 

polymerase chain reaction-amplified ribosomal DNA spacer polymorphisms. Appl 


Kumar S, Tamura K, Nei M (1993) MEGA: Molecular Evolutionary Genetics Analysis, 

version 2.0. The Pennsylvania State University, University Park, PA 16802. Freely 

downloadable from: http://www.megasoftware.net/ 

Laguerre G, Mavingui P, Allard MR, Charnay MP, Louvrier P, Mazurier SI, Rigottier-Gois 

L,Amarger N (1996) Typing of rhizobia by PCR DNA fingerprinting and PCR-restriction 

fragment length polymorphism analysis of chromosomal. Appl Environ Microbiol 

62:2029–2036 

Louws FJ, Fulbright DW, Stephens CT, de Bruijn FJ (1994) Specific genomic fingerprints 

of phytopathogenic Xanthomonas and Pseudomonas pathovars and strains generated 

with repetitive sequences and PCR. Appl Environ Microbiol 60:2286–2295 

Mengoni A, Bazzicalupo M (2002) The statistical treatment of data and the analysis of 

molecular variance (AMOVA) in molecular microbial ecology. Ann Microbiol 

52:95–101 

Navarro E, Simonet P, Normand P, Bardi R (1992) Characterization on natural populations 

of Nitrobacter spp. Using PCR/RFLP analysis of the ribosomal intergenic spacer. 

Arch Microbiol 157:107–115 

Paffetti D, Scotti C, Gnocchi S, Fancelli S, Bazzicalupo M (1996) Genetic diversity of an 

Italian Rhizobium meliloti population from different Medicago sativa varieties. Appl 

Environ Microbiol 62:2279–85


Paffetti D, Daguin F, Fancelli S, Gnocchi S, Lippi F, Scotti C, Bazzicalupo M (1998) Influence 

of plant genotype on the selection of nodulating Sinorhizobium meliloti strains 

by Medicago sativa. Antonie Van Leeuwenhoek 73:3–8 

Picard C, Di Cello F, Ventura M, Fani R, Guckert A (2000) Frequency and biodiversity of 

2,4-diacetylphloroglucinol-producing bacteria isolated from the maize rhizosphere 

at different stages of plant growth. Appl Environ Microbiol 66:948–955 

Ponsonnet C, Nesme X (1994) Identification of Agrobacterium strains by PCR-RFLP 

analysis of pTi and chromosomal regions. Arch Microbiol 161:300–309 

Rohlf FJ (1990) NTSYS-pc. Numerical Taxonomy and Multivariate Analysis System. Version 

2.0. Exeter Software, New York 

Saitou N, Nei M (1987) The neighbour-joining method: A new method for reconstructing 

phylogenetic trees. Molec Biol Evol 4:406–425 

Schneider S, Kueffer JM, Roessli D, Excoffier L (1997) ARLEQUIN: a software for population 

genetics data analysis. Version 1.1. University of Geneva. Freely downloadable 

from http://lgb.unige.ch/arlequin/ 

Vos P, Hogers R, Bleeker M, Reijans M, van de Lee T, Hornes M, Frijters A, Pot J, Peleman 

J, Kuiper M, Zabeau M (1995) AFLP: a new technique for DNA fingerprinting. Nucleic 

Acids Res 23:4407–4414 

Welsh J, McClelland M (1990) Fingerprinting genomes using PCR with arbitrary 

primers. Nucleic Acids Res 18:7213–7218 

Williams JGK, Kubelik AR, Livak KJ, Rafalski JA, Tingey SV (1990) DNA polymorphism 

amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res 

18:6531–6535 

Woods CR Jr, Versalovic J, Koeuth T, Lupski JR (1992) Analysis of relationships among 

isolates of Citrobacter diversus by using DNA fingerprints generated by repetitive 

sequence-based primers in the polymerase chain reaction. J Clin Microbiol 30:2921– 

2929 

Wright S (1965) The interpretation of population structure by F-statistics with special 

regards to systems of mating. Evolution 19:395–420 

Zabeau M, Vos P (1993) Selective restriction fragment amplification: a general method 

for DNA fingerprinting. Publication no. 0 534 858 A1. European Patent Office, Munich, 

Germany

29 Functional Genomic Approaches for Studies of 

Mycorrhizal Symbiosis 



Mycorrhizal fungi, one of the principal biological components of the rhizosphere, 

interact with the roots of about 90 % of land plants to form different 

types of symbiotic associations (Smith and Read 1997). On the basis of the 

colonization pattern of host cells, two main types of mycorrhizas can be identified: 

ectomycorrhizas and arbuscular mycorrhizas. In the ectomycorrhizas, 

the fungus does not penetrate the host cells, whereas in endomycorrhizas the 

fungal hyphae form intracellular structures like coils or arbuscules (Smith 

and Read 1997). Mycorrhizal fungi are commonly beneficial due to a wide 

network of external hyphae that extend beyond the depletion zone, allowing 

host plants to have improved access to limited soil resources. On the other 

hand, mycorrhizal fungi receive carbon compounds from host plants to sustain 

their metabolism and complete the life cycle and this may lead to reductions 

in plant growth under some circumstances (Graham and Eissenstat 

1998; Graham 2000). 

While there is a considerable amount of knowledge based on the ecology 

and physiology of mycorrhizal fungi and their uses, the knowledge about cellular 

and molecular aspects leading to the growth and the development of a 

mycorrhizal fungus as well as the establishment of a functioning symbiosis is 

still limited (Harrison 1999; Martin et al. 2001; Podila et al. 2002). The development 

of molecular techniques has offered new opportunities: automatic highthroughput 

sequencing methods has made it possible to determine the complete 

sequence of even eucaryotic genomes. While many ectomycorrhizal 

fungal genomes are supposedly of reasonable size (Doudrick 1995),some mycorrhizal 

fungi including arbuscular mycorrhizal fungi (AMF), have a large 

genome size (Bianciotto and Bonfante 1992; Hosny et al. 1998; for a review 

Gianinazzi-Pearson 2001). The presence of repetitive DNA, regulative regions 

and introns makes the analysis of genomic sequences relatively complex. The 

sequencing of complete genomes for mycorrhizal fungi is still years away until 

better methods for application towards mycorrhizal fungi are available. 




568 


An appropriate approach to the study of mycorrhizal fungi is to understand 

the molecular process leading to the host recognition, development and 

functioning of mycorrhiza through the analysis of expressed sequences. With 

the advent of many high throughput techniques that have been successfully 

applied to the functional analysis of genes from many organisms, it is now 

possible to apply similar strategies to study the various aspects of the mycorrhizal 

symbiosis. In this chapter, we describe protocols leading to (1) 

expressed sequence tags (EST) and (2) macroarray techniques. 

The EST methods allow for rapid identification of sequences through single-run 

sequencing of 250–700 bases on randomly picked cDNA clones. Comparisons 

with sequence databases frequently allow the assignation of potential 

functions to the corresponding gene products. Since its introduction 

(Adams et al. 1991), this technique has been successfully applied to several 

organisms to provide an overview of the gene repertoire expressed in a particular 

stage of development or in a particular tissue (Hofte et al. 1993; Nelson 

et al. 1997; Kamoun et al. 1999; Lee et al. 2002). The macroarray or membrane 

array methods allows the study of genome-wide expression patterns. 

Macroarrays require considerably less RNA for target preparation compared 

to microarrays and do not involve costly set-ups.With more refined protocols 

macroarrays can be as sensitive as microarrays and also are more easily accessible 

for academic laboratories (see Bertucci et al. 1999; Jordan 1998). 

Macroarrays are also more suitable for gene expression studies, where only 

small subsets of genes (unigene sets) need to be tested for their expression, for 

example, genes involved in carbon or nitrogen metabolism, signal transduction, 

ion transport, etc. 

In this chapter,we describe the experimental procedures for the establishment 

of EST collections from mycorrhizal fungi and also macroarray-based techniques 

for gene expression profiling of symbiosis process.These procedures can 

be applied even in cases of limited amount of biological starting material. 

2 Material and Methods 

2.1 Equipment 

Micro-centrifuge and high-speed centrifuge with proper rotors 

Sterile hood 

Chemical hood 

–20 and –80 °C freezers 

VP scientific 384 pin multiblot replicator 

Thermal Cycler with a heated lid (Hybaid or Eppendorf Master Cycler or similar) 

37 °C shaking incubator 

37 °C gravity convection incubator

29 Functional Genomic Approaches for Studies of Mycorrhizal Symbiosis 569 

Boekel cooler or similar to maintain 16 °C temperature 

Gel electrophoresis equipment and power supplies 

Hybridization oven (Amersham or Fisher biotech or similar) 

Variable volume pipettes 

High resolution scanner with transparency adapter 

Phosphorimager (Bio-Rad Personal Imager FX) 

2.2 Biological Material 

Biological material used for the RNA extraction is collected as quickly as possible, 

immediately frozen in liquid nitrogen and stored at –80 °C. 

2.3 RNA Extraction 

The protocol is modified from the one described by Chomoczynski and Sacchi 

(1987). 

Reagents 

Extraction buffer: 

4 M Guanidinium thiocyanate 

25 mM Na-citrate pH 7 

0.5 % Na-laurylsarcosine 

0.1 M b-mercaptoethanol (added just prior to use) 

2 M Na-acetate pH 4 

Phenol water-saturated 

Chloroform:isoamylalcohol (49:1, v/v) 

Isopropanol 

8M LiCl 

80 % ethanol 

Procedure 

Grind the material (100 mg) in liquid nitrogen (with a pestle in a microfuge 

tube or in a mortar) 

1. Add 200 ml of extraction buffer and place on ice. 

2. Add 40 ml of 2 M Na-acetate pH 4, mix thoroughly by inversion. 

3. Add 400 ml of phenol and mix by inversion. 

4. Add 150 ml of chloroform/isoamylalcohol, mix by inversion and place on 

ice 10 min. Centrifuge at 10,000 g for 20 min at 4 °C. 

5. Transfer the aqueous phase into a new tube and extract with an equal volume 

of chloroform/isoamylalcohol. 

6. Transfer the aqueous phase into a new tube and add 1 volume of isopropanol.

570 


7. Incubate 2 h at –20 °C. 

8. Centrifuge at 10,000 g for 20 min at 4 °C. Remove the supernatant. 

9. Wash the pellet with 80 % ethanol. 

10. Resuspend in 50–100 ml of sterile water and store at –80 °C. 

Note: As an alternative to the RNA extraction protocol explained above, commercial 

kits from several companies are available. These usually have no need 

of phenol:chloroform manipulations and are relatively rapid. RNA obtained 

with these kits often needs to be treated with RNase-free DNase to remove DNA. 

DNase Treatment 

Incubate the RNA sample in DNase 1¥ buffer (100 mM Tris-HCl pH 7.5, 

10 mM MgCl 2 , 1 % BSA) with units of DNase (RNase-free; Promega, Madison, 

WI, USA) for 30 min at 37 °C.Add EDTA for 2 mM final concentration. Extract 

with an equal volume of phenol/chloroform/isoamylalcohol (25/24/1; v/v/v). 

Precipitate the RNA with Na-acetate (0.3 M final concentration) and ethanol 

(2.5 volumes). As an alternative, to remove contaminant DNA, a precipitation 

with LiCl (final concentration 2 M, overnight at 4 °C) can be performed. 

3 RNA Quantification 

RNA quantification can be determined with a spectrophotometer (A 260/280) 

or fluorometer (Amersham Pharmacia Biotech). The quality of RNA should 

be checked on a denaturing agarose gel (Sambrook and Russel 2001) to make 

sure that the integrity of RNA is good. 

3.1 Construction of a cDNA Library 

There are many kits available for the construction of a cDNA library. If there 

is plenty of total RNA available to purify poly-A RNA, standard cDNA synthesis 

kits can be used such as lambda zap kits (Stratagene, CA, USA). However, 

if the availability of the amounts of RNA is limited, it is advisable to use a kit 

that can use either a small amount of total RNA or poly-A RNA to synthesize 

the cDNA library. Because the amount of tissue and RNA available from mycorrhizal 

tissues or mycorrhizal fungi is often limited, we describe here the 

method of synthesizing a cDNA library using the SMART cDNA library construction 

kit (Clontech, CA, USA). This kit can work on as little as 50 ng of 

total RNA since it uses an amplification step after the first strand cDNA synthesis 

that compensates for small amounts of starting RNA material.


3.1.1 cDNA Synthesis (Total volume: 10 ml) 

1. Combine the following reagents: 

1–3 ml of RNA (50 ng–1 mg) 

1 ml SMART III Oligonucleotide (10 mM) 

5¢AAGCAGTGGTATCAACGCAGAGTGGCCATTATGGCCGGG 3¢ 

1 ml CDS III/3¢ PCR Primer (10 mM) 

5¢¢ATTCTAGAGGCCGAGGCGGCCGACATG –d(T) 30 N*N 3¢ 

(N*:A, G or C; N: A, G, C or T) 

2. Incubate at 70 °C for 2 min, snap cool the tube on ice for 2 min 

3. Add 

2 ml x5 First strand buffer 

(250 mM Tris-HCl pH 8.3, 30 mM MgCl 2 , 375 mM KCl) 

1 ml DTT (20 mM) 

1 ml SuperScript II 200 U/ml (Invitrogen, CA, USA) 

4. Incubate at 42 °C for 1 h 

5. First strand cDNA can be stored at –20 °C for up to 3 months 

3.1.2 Long-Distance PCR and Synthesis of Double-Stranded cDNA 

1. Combine the following reagents: 

2 ml first strand cDNA 

80 ml sterile H 2O 

10 ml cDNA PCR buffer 

2 ml dNTPs (10 mM) 

2 ml 5¢PCR Primer (10 mM) 5¢ AAGCAGTGGTATCAACGCAGAGT 3¢ 

2 ml CDS/3¢ PCR primer 

2 ml 50x Advantage cDNA Polymerase Mix (Clontech, CA, USA) 

100 ml total volume 

2. Run a PCR program on a thermal cycler (Perkin Elmer 2400/9600 with a 

heated lid) following these parameters: 

1 cycle: 5 °C 20 s 

18–26 cycles: 

95 °C 5 s 

68 °C 6 min 

Note: The number of cycles depends on the amount of RNA starting material. If 

1 mg of RNA is used, usually 10–15 cycles should be enough. If you start with 

0.05–0.25 mg total RNA, 25 cycles are recommended. It is critical not to overcycle 

in order to retain the proportion of rare cDNAs. Over-cycling will result in 

a disproportionate amplification of abundant cDNAs. 

3. Check an aliquot (5 ml) of the PCR product (double-stranded cDNA) on a 

1 % agarose gel: a smear of DNA fragments of molecular weight between 

0.1 and 4 kbp should appear (Fig. 1). At this stage, the ds cDNA can be 

stored at –20 °C up to 3 months.

572 

Kbp 

5.1 - 

2 - 

1.3 - 


MW dscDNA 

Fig. 1. Analysis of double stranded cDNA synthesis products. 

Lane MW is molecular weight markers in kilobase 

pairs. The bright smear ranging from 4–1 kb in lane 

dscDNA shows a good spread of cDNA fragment sizes 

3.1.3 Reparation of cDNAs for Ligation: Proteinase K Treatment and SfiI 

Digestion 

1. Transfer 50 ml of the ds cDNA into a new tube, add 

2 ml of proteinase K (20 mg/ml) 

Incubate at 45 °C for 20 min. 

2. Add 50 ml of H 2O. 

3. Mix contents and spin the tube briefly. 

4. Incubate at 45 °C for 20 min. Spin the tube briefly. 

5. Add 50 ml of deionized H 2O to the tube. 

6. Add 100 ml of phenol:chloroform:isoamyl alcohol (25:24:1;v/v/v) and mix 

by continuous gentle inversion for 1–2 min. 

7. Centrifuge at 10,000 g for 5 min to separate the phases. 

8. Remove the top (aqueous) layer to a clean 0.5-ml tube. 

9. Add 100 ml of chloroform:isoamylalcohol (24:1, v/v) to the aqueous layer. 

Mix by continuous gentle inversion for 1–2 min. 

10. Centrifuge at 10,000 g for 5 min to separate the phases. 

11. Remove the top (aqueous) layer to a clean 0.5-ml tube. 

12. Add 10 ml of 3 M sodium acetate, 1.3 ml of glycogen (20 mg/ml) and 260 ml 

of room-temperature 95 % ethanol. Immediately centrifuge at 10,000 g for 

20 min at room temperature. 

13. Carefully remove the supernatant with a pipette. Do not disturb the pellet. 

14. Wash pellet with 100 ml of 80 % ethanol. 

15. Air-dry the pellet (~10 min) to evaporate residual ethanol. 

16. Add 79 ml of deionized H 2 O to resuspend the pellet. 

Note: Proteinase K treatment is necessary to inactivate the DNA polymerase 

activity.


17. SfiI I digestion 

Combine the following components in a fresh 0.5-ml tube: 

79 ml cDNA (Step 15, above) 

10 ml 10x SfiI I buffer 

10 ml SfiI I enzyme 

1 ml 100x BSA 

100 ml total volume 

18. Mix well. Incubate the tube at 50 °C for 2 h. 

Note: SfiI I-digested cDNA should be fractionated to remove small fragments 

which would otherwise compromise the quality of the cDNA library. 

3.1.4 cDNA Size Fractionation by CHROMA SPIN-400 

1. Label 16 1.5-ml tubes and arrange them in a rack in order. 

2. Prepare the CHROMA SPIN-400 column (Clontech, CA, USA) for drip 

procedure: 

CHROMA SPIN column should be warmed to room temperature before 

use. Invert the column several times to completely resuspend the gel 

matrix. Remove air bubbles from the column. Use a 1000-ml pipette to 

resuspend the matrix gently; avoid generating air bubbles. Remove the 

bottom cap and let the column drip. 

3. Attach the column to a ring stand. Let the storage buffer drain through the 

column by gravity flow until you can see the surface of the gel beads in the 

column matrix. The top of the column matrix should be at the 1.0-ml 

mark on the wall of the column. The flow rate should be approximately 1 

drop/40–60 s. The volume of 1 drop should be approximately 40 ml. 

4. When the storage buffer stops dripping out, carefully and gently (along 

the column inner wall) add 700 ml of column buffer to the top of the column 

and allow it to drain out. 

5. When this buffer stops dripping (~15–20 min), carefully and evenly apply 

~100 ml mixture of SfiI I-digested cDNA mixed with 2 ml xylene cyanol 

dye (1 %) to the top-center surface of the matrix. 

6. Allow the sample to be fully absorbed into the surface of the matrix (i.e., 

there should be no liquid remaining above the surface). 

7. With 100 ml of column buffer, wash the tube that contained the cDNA and 

gently apply this material to the surface of the matrix. 

8. Allow the buffer to drain out of the column until there is no liquid left 

above the resin. 

9. Place the rack containing the collection tubes under the column, so that 

the first tube is directly under the column outlet. 

10. Add 600 ml of column buffer and immediately begin collecting singledrop 

fractions in tubes #1–16 (approximately 35 ml per tube). Cap each 

tube after each fraction is collected. Recap the column after fraction #16 

has been collected.

574 

Kbp 

5.1 - 

2 - 

0.9 - 


MW 1 2 3 4 5 6 7 8 9 10 11 12 13 14 

Fig. 2. Analysis of cDNA fractions on an agarose gel. In this particular case, fractions 6, 

7, and 8 are collected as they seem to represent a good spread of cDNA sizes. Lane MW 

is the molecular weight markers in kilobase pairs. 

11. Check the profile of the fractions before proceeding with the experiment 

on a 1.1 % agarose/EtBr gel; run 3 ml of each fraction in adjacent wells, 

alongside a 1-kb DNA size marker (0.1 mg). Run the gel at 150 V for 10 min 

(running the gel longer will make it difficult to see the cDNA bands). 

Determine the peak fractions by visualizing the intensity of the bands 

under UV (see Fig. 2). 

12. Collect the fractions containing cDNA fraction that matches your desired 

size distribution. Pool the above fractions in a clean 1.5-ml tube. 

13. Add the following reagents to the tube with 3–4 pooled fractions containing 

the cDNA: (105–140 ml, respectively): 

1/10 vol sodium acetate (3 M; pH 4.8) 

1.3 ml glycogen (20 mg/ml) 

2.5 vol 95 % ethanol (–20 °C) 

14. Mix by gently rocking the tube back and forth. 

15. Store the tube at –20 °C overnight. 

16. Centrifuge the tube at 10,000 g for 20 min at room temperature. 

17. Carefully remove the supernatant with a pipette. Do not disturb the pellet. 

18. Briefly centrifuge the tube to bring all remaining liquid to the bottom. 

19. Carefully remove all liquid and allow the pellet to air-dry for ~10 min. 

20. Resuspend the pellet in 7 ml of deionized H 2O and mix gently. The SfiI Idigested 

cDNA is now ready to be ligated to the SfiI I-digested, dephosphorylated 

lTriplEx2 vector provided with the kit or the cDNA can be 

stored at –20 °C until the ligation step. 

3.1.5 Ligation of cDNA to lTriplEx2 vector 

Note: The ratio of cDNA to vector in the ligation reaction is a critical factor in 

determining transformation efficiency, and ultimately the number of independent 

clones in the library. The optimal ratio of cDNA to vector in ligation reactions 

must be determined empirically for each vector/cDNA combination. To


ensure that you obtain the best possible library from your cDNA, set up three 

parallel ligations using three different ratios of cDNA to vector, as shown below. 

1. Label three 0.5-ml tubes and add the indicated reagents. Mix the reagents 

gently; avoid producing air bubbles. Spin tubes briefly to bring contents to 

the bottom of the tube. 

Ligations using three different ratios of cDNA to phage vector 

Component 1st ligation 2nd ligation 3rd ligation 

cDNA 0.5 1.0 1.5 

Vector (500 ng/ml) 1.0 1.0 1.0 

10¥ Ligation buffer* 0.5 0.5 0.5 

ATP (10 mM) 0.5 0.5 0.5 

T4 DNA Ligase 0.5 0.5 0.5 

Deionized H 2O 2.0 1.5 1.0 

Total volume (ml) 5.0 5.0 5.0 

*x10 ligation buffer: 300 mM Tris-HCl, pH 7.8, 100 mM MgCl 2, 100 mM 

DTT 

2. Incubate tubes at 16 °C overnight. 

3.1.6 Packaging of Ligated cDNA and Preparation of cDNA Library 

Perform a separate, l-phage packaging reaction for each of the ligations as 

per manufacturer’s instructions.We used Gigapack packaging extracts (Stratagene, 

CA, USA) and also MaxPlaq packaging extracts (Epicenter, WI, USA) 

with very good success. 

1. Thaw three packaging extracts (50 ml per extract) on ice. 

2. Immediately after the extracts have thawed, add 5 ml of each ligation mixture 

to one tube, mix gently. 

3. Incubate at 22 °C for 4 h and add phage buffer (20 mM Tris-HCl, pH 7.4; 

100 mM NaCl; 10 mM MgSO 4) to 250 ml and 10 ml of chloroform. Gently mix 

well and allow the chloroform to settle down. This packaged mix can be 

stored at 4 °C up to 4 weeks. 

4. Titer each of the resulting libraries. From the three ligations combined, you 

should obtain 1–2x10 6 independent clones. 

Note:Ifyou obtained

576 


1. To recover the frozen cells, streak a small portion (~5 ml) of the frozen 

stock onto an LB agar plate containing the appropriate antibiotic. This is 

the primary streak plate. Use LB/tet for XL1-Blue stock plates. 

2. Incubate at 37 °C overnight.Wrap plate in Parafilm and store at 4 °C for up 

to 2 weeks. 

To prepare a working stock plate, pick a single isolated colony from the 

primary streak plate and streak it onto another LB/MgSO 4 agar plate 

(with antibiotics). 

3. Inoculate one colony into 5 ml of LB medium supplemented with 50 ml of 

20 % maltose (filter-sterilized) and 50 ml of 1 M MgSO 4 solution. Shake at 

160 rpm at 37 °C for 6–9 h or until OD 600=0.6. 

4. Dilute each packaged library sample 1000¥, 5000¥, or 10,000¥ with phage 

buffer. 

5. Add 20 ml of MgSO 4 solution and 2.8 ml of melted top agar to sterile glass 

tubes in a sterile laminar flow hood. Cap the tubes and keep them in a 

water bath at 50 °C for at least 30 min. 

6. Mix 0.1 ml of the diluted phage with 0.1 ml of fresh bacterial cells in a 

microfuge tube and allow the phage to adsorb to the cells in an incubator 

at 37 °C for 30 min. 

7. After incubation add the phage/bacterial mixture to the specified tubes of 

top agar in the water bath. Vortex gently to mix the contents and pour 

immediately onto LB agar plates. Rotate the plates and gently spread the 

top agar uniformly on the surface of LB agar. 

8. Cool the plates at room temperature for 10 min to allow the top agar to 

harden. Invert the plates and incubate them at 37 °C for 6–18 h. Periodically 

check the plates to ensure that plaques are developing. 

9. Count the plaque forming units (pfu) and calculate the titer of the phage 

pfu / ml = number of plaques per plate¥ dilution factor ¥10 

Determining the percentage of recombinant clones 

10. In lTriplEx2, as in many other l expression vectors, the cloning site is 

embedded in the coding sequence for the a-polypeptide of b-galactosidase 

(lacZ). This makes it possible to use lacZ a-complementation (Sambrook 

and Russel 2001) to easily identify insert-containing phage by 

transducing an appropriate host strain (such as E. coli XL1-Blue) and 

screening for blue on medium containing IPTG and X-gal. 

11. To perform blue/white screening in E. coli XL1-Blue, follow the procedure 

for titering on LB/MgSO 4 plates, but add IPTG and X-gal to the melted top 

agar before plating the phage + bacteria mixtures. For every 2 ml of 

melted top agar, use 50 ml each of the IPTG (10 mM stock) and X-gal (2 % 

stock). Aim for 500–1000 plaques/90-mm plate. Incubate plates at 37 °C 

for 6–18 h, or until plaques and blue color develop.


12. The ratio of white (recombinant) to blue (nonrecombinant) plaques will 

give a quick estimate of recombination efficiency. A successful ligation 

will result in at least 80 % recombinants. 

13. Single plaques are isolated in 500 ml of SM buffer+20 ml of chloroform and 

stored at 4 °C. 

Note: lTriplEx2 phages from isolated single plaques can be converted into 

pTriplEx2 plasmids by in vivo excision using the E. coli strain BM25.8 and following 

the manufacturer’s instructions (Clontech, CA, USA). A brief protocol is 

given below. 

4 Conversion Protocol 

1. Pick a single, isolated colony from the working stock plate of BM25.8 host 

cells (prepared similarly to XL-blue cells as described in phage titration 

protocol above) and use it to inoculate 10 ml of LB broth in a 50-ml test 

tube or Erlenmeyer flask. Incubate at 31 °C overnight with shaking (at 

150 rpm) until the OD 600 of the culture reaches 1.1–1.4. 

2. Add 100 ml of 1 M MgCl 2 to the 10-ml overnight culture of BM25.8 (10 mM 

final concentration of MgCl 2). 

3. Pick each well-isolated plaque from the titration plates and place it in 

350 ml of phage buffer in 96-well plates. Mix the contents thoroughly using 

an 8 or 12 channel pipette and allow phage to elute at 4 °C overnight. 

4. In a deep 96-well plate combine 100 ml of overnight cell culture with 100 ml 

of the eluted plaque from each well. (Save the remainder of the eluted 

plaques in case you need to repeat the conversion.) 

5. Incubate at 31 °C for 30 min without shaking. 

6. Add 200 ml of LB broth and cover the plate with the lid provided. 

7. Incubate at 31 °C for an additional 1 h with shaking (225 rpm). 

8. Using a multichannel pipette transfer 1–5 ml of infected cell suspension 

into a 96-well LB/carbenicillin plate to obtain colonies and grow at 31 °C. 

9. Pick bacterial growth from each clone and prepare plasmid DNA. For high 

throughput processing use Qiagen (Qiagen, CA, USA) or Eppendorf 

(Eppendorf, MA, USA) 96 format plasmid Miniprep kits. The isolated plasmid 

DNA should be pure enough for direct sequencing. The pTriplEx2 

sequencing primers provided may be used with standard ds-DNAsequencing 

protocols. 

4.1 Evaluation of the Quality of the cDNA Library 

To check the quality of the cDNA library two factors must be considered: (1) the 

number of primary recombinants (at least 10 5 –10 6 ) and (2) the insert length. 

Insert size can be estimated by PCR with primers flanking the insertion site.

578 


1. Insert DNAs can be PCR-amplified directly from bacterial colonies with 

oligonucleotides designed on sequences flanking the cloning site 5T (5¢ 

CTCGGGAAGCGCGCCATTGTGTTGG 3¢) and 3T (5¢ ATACGACTCAC- 

TATAGGGCGAATTGGCC 3¢). PCR reactions carried out in a final volume 

of 50 ml containing 10 mM Tris-HCl pH 8.3, 50 mM KCl, 1.1 mM MgCl 2, 

0.01 % gelatin, 200 mM dNTPs, 50 pmol of each primer and 2 U of RedTaq 

DNA polymerase (Sigma, St. Louis, MO, USA). The following amplification 

program is run in a Hybaid thermal cycler: 3 min at 95 °C (1 cycle); 45 s at 

92 °C, 45 s at 55 °C, 2 min at 72 °C (30 cycles). 

2. PCR products should be separated by gel electrophoresis (Sambrook and 

Russel 2001). 

5 Troubleshooting 

Possible contaminations by ribosomal sequences (18S and 28S rRNAs might 

contain stretches of A that can complement oligo d-T). 

Remedial actions: when a sufficient amount of total RNA is available, purify the 

poly-A RNA by using oligo d-T affinity columns (Sambrook and Russel 2001). 

Inserts with small size 

Remedial actions: enrichment of high molecular weight cDNAs through fractionation 

into a column. 

6 Sequencing Strategies 

Single run sequences of 250–700 bases are determined in most cases using an 

automated sequencer such as ABI Prism or Beckman CEQ 8 or other 

sequencers, whose accuracy has been estimated to be greater than 95 %. 

Because of the large number of sequences that needs to be processed in a relatively 

short time, it is advisable to outsource the sequencing process (private 

companies can do the service for a high number of sequences for a relatively 

low price). For people who have access to their own automated sequencers, we 

found Big Dye cycle sequencing kit from ABI (ABI, Foster City, CA, USA) or 

the DynamicET cycle sequencing kit from Amersham (Amersham Pharmacia 

Biotech, Piscataway, NJ, USA) give very good results. Both kits can be used to 

scale down the reactions to quarter reactions and still produce very good 

sequence reads, and makes it very economical. Since cDNAs are cloned into 

the pTriplex vector in a defined orientation, it is advisable to carry out the 

sequencing from the 5¢-end first so as to obtain coding region information 

from each EST. 

Note: If you use quarter reactions, purity of plasmid DNA and quantity are 

critical. Sequencing of the 3¢-end could help to identify cDNAs derived from the 

same mRNA, but which are truncated at different positions at the 5¢-end.


6.1 Data Analysis 

Sequence similarity of each EST can be detected by BLASTX alignment 

(Altschul et al. 1997) of amino acid translations of the six possible open reading 

frames against the NCBI (National Center for Biotechnology Information) 

databank. Sequences of less than 100 bp should be removed from data analysis 

as these are usually not very useful in finding matches. Also, vector 

sequences or linker sequences should be filtered from the EST sequence 

before performing a similarity analysis. There are many programs such as 

DNA sequencher (Gene Codes, Ann Arbor, MI, US) that can automatically 

remove vector or linker sequences and clean up the EST sequences before 

thorough analysis. 

6.2 Sequence Homology Comparisons 

Organize all EST sequences into batches in Microsoft Word (Microsoft Corp., 

CA) in FASTA format. Batch nucleotide-protein searches can be done using 

BLASTX against all protein databases at GenomeNet http://www.blast. 

genome.ad.jp (Japan). cDNA sequences yielding an E value=10 –5 can be considered 

to classify known genes or have partial similarity to known genes. 

BLAST scores should be further analyzed visually to confirm significant similarity 

and not solely determined by numerical value. In order to remove 

redundancies from EST sequences analysed, one can use Multalin, a multiple 

sequence alignment with hierarchical clustering, http://www.prodes.toulose. 

inra.fr/multalin/multalin.html (Corpet 1988). DNA sequences with approximately 

90 % identity to another clone may be eliminated as redundant 

sequences. The sequence with the most accurate information should be kept 

for further analysis. All nonredundants (sequences or ESTs) may be then submitted 

to GenBank at the National Center for Biotechnology Information 

(http://www.ncbi.nih.gov/Genbank). 

6.3 Examples of Expressed Sequence Tag Data Analysis 

6.3.1 Expressed Sequence Tags from the Asymbiotic Phase of an 

Arbuscular Mycorrhizal Fungus 

A cDNA library was constructed from about 100 germinated spores of the 

endomycorrhizal fungus Gigaspora margarita (BEG 34). Insert lengths 

ranged from 100 to 800 bp with an average of 500 bp. Randomly selected 

cDNAs were characterized by sequencing at the 5¢ end and comparison with 

databases. BLASTX searches were performed through the NCBI and clones 

were grouped on the basis of the E value (Table 1; Fig. 3).

580 


Table 1. Selected list of EST clones from G. margarita and their similarity to known 

genes and E values to indicate the level of similarity. 

Clone BLASTX similarity Species E value 

1 14–3-3 Protein Lentinula edodes e –101 

2 Endopeptidase Arabidopsis thaliana 1e –88 

3 Heat shock protein HSS1 Puccinia graminis 1e –71 

4 Cell cycle switch protein Medicago sativa 7e –68 

5 Protein involved in phosphate metabolism Saccharomyces cerevisiae 2e –52 

6 Cu-Zn Superoxide dismutase Ovis aries 7e –51 

7 Pre-mRNA cleavage factor Homo sapiens 4e –49 

8 Spliceosome-associated protein Schizosaccharomyces pombe 6e –47 

9 Aldehyde dehydrogenase Caenorhabditis elegans 3e –46 

10 Polyubiquitine Neurospora crassa 5e –44 

11 Histone H4 Styela plicata 3e –39 

12 Maleylacetate isomerase 2 Drosophila melanogaster 1e –37 

13 Cytidindeaminase Homo sapiens 1e –30 

14 Glutathione S transferase Naegleria fowleri 7e –24 

15 Ornithine carbamoyltransferase Aspergillus terreus 7e –21 

16 Transcriptional factor StuA Aspergillus nidulans 4e –21 

17 Subunit G of vacuolar ATP synthase Neurospora crassa 5e –20 

18 Isocitrate lyase Dendrobium crumenatum 1e –20 

Fig. 3. Distribution of G. margarita EST clones based on the level of BLASTX similarity 

ESTs presenting an E value


Fig. 4. Distribution of G. margarita EST clones based on matches to various organisms 

Fig. 5. Distribution of G. margarita EST clones based on similarity to functional groups 

using BLASTX analysis 

showed similarity to proteins involved in defence responses to stresses. This 

result could suggest that the in vitro growth conditions are not favorable and 

could mimic a stress situation. 

6.3.2 Expressed Sequence Tags from Early Symbiotic Interactions Between 

the Ectomycorrhizal Fungus Laccaria bicolor and Red Pine 

Over 500 random EST clones from a cDNA library made from pooled RNA 

samples from various stages of interaction were sequenced. Out of these, over 

400 nonredundant clones were obtained based on sequence analysis. Based on 

the BLAST analysis (Altschul et al. 1997), 33 % of the clones showed no significant 

similarity to any sequences in the NCBI database. The sequences of the

582 


remaining 67 %,however,suggested that they were homologues of genes previously 

identified in other systems. These were classified into groups based on 

their probable function.About 13 % were related to signal transduction,15 % to 

metabolism, 10 % to cellular protein synthesis/processing and turnover, 9 % to 

transport and movement of ions/peptides and amino acids, 7 % to structural 

proteins, 5 % to RNA/DNA processing, 6 % to transcriptional regulation, and 

about 10 % to hypothetical proteins with no known function. In addition, one 

clone sequence suggested it was related to apoptosis. The majority of the 

matches for L. bicolor ESTs came from animal systems rather than fungi. 

7 Macroarrays 

7.1 PCR Amplification of cDNA Inserts 

cDNA inserts from plasmid templates of EST clones need to be amplified, 

purified and quantified before used for printing macroarrays. The following 

protocol describes the general methods to obtain PCR products for printing 

macroarrays. Due to the large numbers of clones to be amplified, it is best to 

use 96-well formatted PCR plates, which will also facilitate printing macroarrays 

using either 96 or 384 pin manual or robotic arrayer. Conversely, 8 or 12 

PCR strip tubes can also be used for rapid manipulation in setting up the PCR 

reactions. 

1. For each 96-well plate to be amplified, prepare a PCR reaction mixture containing 

the following ingredients: 

1000 ml 10¥ PCR buffer 

20 ml dATP (100 mM) 

20 ml dGTP (100 mM) 

20 ml dCTP (100 mM) 

20 ml dTTP (100 mM) 

5 ml forward primer* (1 mM) 

5 ml reverse primer* (1 mM) 

100 ml Red-Taq polymerase (1 U/ml) 

8800 ml H 2O 

Note: * primers used for PCR amplification depend on the vector in which the 

cDNA inserts are. Keep all reagents on ice and return the enzyme tube promptly 

to the freezer. 

2. Label 96-well PCR plates and aliquot 100 ml of PCR reaction mix to each 

well. Gently tap plates to insure that no air bubbles are trapped at the bottom 

of the wells. 

3. Add 1 ml (10 ng) of purified EST plasmid template to each well. Mix well 

with pipette. 

Note: Mark the donor and recipient plates at the corner near the A1 well to facilitate 

correct orientation during transfer of the template. It is important to watch


that the pipette tips are all submerged in the PCR reaction mix when delivering 

the template. Mixing the liquid is easier when multi-channel pipettes are used. 

Always use sterile filtered tips to avoid contamination. 

4. Replace PCR plate covers and centrifuge the plates at 2700 rpm for 1 min. 

5. Place the PCR plates in a thermal cycler (such as Eppendorf Master Cycler) 

and run the following cycling program. 

Initial denaturation 96 °Cx¥2min 

Denaturation 94 °Cx30 s¥30 cycles 

Primer annealing 55 °Cx30 s¥30 cycles 

Primer extension 72 °Cx2 min¥30 cycles 

Final extension 72 °Cx5 min 

Note: After PCR, plates can be held at 4 °C while quality controls are performed 

on PCR products. To check the quality of the amplified products, analyze 2 ml 

each of PCR products on 2% TAE agarose gel as described (Sambrook and Russel 

2001). Take a digital photo of the gel on a UV table and store the image for future 

reference. The gels should show bands of fairly uniform brightness distributed in 

size between 600 and 2000 base-pairs depending on the sizes of cDNAs amplified. 

Further computer analysis of such images can be carried out with image 

analysis packages to provide a list of the number and size of bands. Ideally this 

information can be made available during analysis of the data from hybridizations 

involving these PCR products 

7.2 Purification and Quantification of PCR Products 

1. Spin down PCR reaction plates and then transfer the PCR products (100 ml) 

to a Multiscreen filter plate and place the filter on a vacuum manifold filtration 

system (e.g., Millipore; Cat # MAVM0960R). 

2. Apply a vacuum pressure of approx. 10–15 in. Hg (250–380 mm Hg) for 

10 min or until plate is dry. 

3. Remove plate from manifold filtration system and add 100 ml of MilliQ 

water to each well. Place filter plate on a shaker and shake vigorously for 

20 min to resuspend the DNA. 

4. Pipette the purified PCR product to a new U-bottom 96 well plate. Seal PCR 

storage plates with a plastic cap mat or adhesive foil lid and store at –20 °C 

until needed for printing macroarrays. 

7.3 Printing of Macroarrays 

1. Transfer PCR products to 384-well source plate at a concentration of 

100 ng/ml. 

Note: The concentration of the source plate is critical, we have shown spot intensity 

is directly related to source plate concentrations.

584 


2. Include a group of negative and positive control clones with the other 

clones to be printed onto the membrane. 

3. Denature the PCR products in 5¥ denaturation solution (2 N NaOH, 50 mM 

EDTA) diluted to 1x final concentration at 37 °C for 30 min (Jordan 1998). 

4. Presoak Hybond N+ nylon membrane filters (Amersham Pharmacia 

Biotech, Piscataway, NJ, USA) in 0.1 M NaOH for 1 min, then place on 3-mm 

filter paper. 

Note: When using a manual arrayer, one layer of filter paper on top of a mouse 

pad seems to be an optimal surface for printing. Spotting can be done with a 

384-pin dot-blot tool (V&P Scientific, San Diego, CA, USA) with 0.9–0.5 mm 

diameter flat tip pins. If you are going to print many copies, use a multi-print 

replication device (V&P Scientific, San Diego, CA, USA) to give consistent 

alignment between membranes and to allow spacing for printing up to 4x384 

spots on the same membrane (Schummer et al. 1997). 

5. Dip the pins into the 384-well plate containing the denatured DNA. The 

pins will deliver ~50 nl of sample yielding spots consisting of approximately 

5 ng (the linearity of delivery can be tested by using different concentrations 

of PCR products in the same volume). 

6. Cross-link membranes for 30 s in UV-crosslinker at optimal setting (Fisher 

Scientific, Pittsburgh, PA). 

7. Neutralize the array for 5 min in a solution of 0.5 M Tris pH 7.8, 1.5 M NaCl 

followed by rinsing in ddH 2O for 5 min. 

8. Air dry the arrays on filter paper and wrap in Saran wrap until use. 

7.4 Generation of Exponential cDNA Probes from RNA for Macroarrays 

and Hybridization Analysis 

We found the protocols described by Gonzalez et al. (1998) work very well.We 

use components from SMART cDNA synthesis kit (Clontech, CA, USA) for 

this purpose. 

1. Assemble the following in a 0.2-ml PCR tube 

0.5–1 mg RNA 1 ml 

10 mM oligo dT primer (CDS from SMART cDNA kit) 1 ml 

10 mM of SMART IV oligonucleotide 1 ml 

ddH 2O 2ml 

Heat the mixture to 70 °C for 2 min, spin briefly and cool at room temperature 

to anneal the primers. 

2. Add 

5x Reverse transcription buffer 2 ml 

20 mM DTT 1 ml 

10 mM dNTPs 1 ml 

Powerscript Reverse Transcriptase 200 U (Clontech, USA) 1 ml 

Total volume 10 ml


Incubate at 42 °C for 1 h. 

Add 40 ml of TE buffer (10 mM Tris-HCl, pH 7.2, 1 mM EDTA) to stop the 

reaction. All reactions can be done in a PCR machine. 

3. To determine the number of cycles required to obtain a population of representative 

dscDNAs, 1 ml from each sscDNA reaction should be amplified 

following the protocol given below. 

sscDNA 1 ml 

ddH 2O 41ml 

10¥ PCR buffer 5 ml 

10 mM PCR anchor primer 1 ml 

10 mM dNTPs 1 ml 

Advantage Taq 2 U (Clontech, USA) 1 ml 

Total volume 50 ml 

4. Set up three reactions and amplify for 17, 20, and 23 cycles (95 °C for 15 s, 

65 °C for 30 s, and 68 °C for 6 min). 

5. Run aliquots from each reaction on an agarose gel and stain with ethidium 

bromide. Select the cycle number before the reaction’s plateau. 

7.5 Exponential Amplification of the sscDNAs 

1. Amplify 2 ml of sscDNA from the RT reactions using the number of cycles 

selected from above. Use same conditions for amplification. 

2. Clean the PCR products using QIAquick columns (Qiagen, Chatsworth, 

CA, USA) into a final volume of 50 ml. 

8 Generation of Radiolabeled Probes 

1. Denature the dscDNAs prepared above by heating the tube in boiling water 

for 5 min and snap-cool the tube on ice. 

2. Add to Prime-A-Gene (Promega, Madison,WI, USA) random primer labeling 

mixture containing 50 mCi each of 32 P-dATP and 32 Pd-CTP in a 50 ml 

reaction volume with twice as much Klenow DNA polymerase than the kit 

recommends. 

3. Incubate at 37 °C for 2 h and purify the probes using Qiagen nucleotide 

removal kit (Qiagen, Chatsworth, CA, USA) as per manufacturer’s instructions. 

Note: The double labelling with 32 P-dATP and 32 P-dCTP not only helps in getting 

high specific activity targets, but also eliminates problems associated with 

labeling GC-rich sequences.

586 


9 Hybridization of Macroarrays to Radiolabeled Probes 

1. Prehybridize membranes in 10 ml of prehybridization solution (5¥SSC, 

10¥Denhardt’s solution, 0.5 % SDS, 100 mg/ml sheared salmon sperm 

DNA), at 65 °C for 4 h. 

2. Add denatured probe and continue incubation for 22 h at 65 °C. 

3. Wash the hybridized membranes successively for 3x5 min in 2xSSC at room 

temperature, 2x20 min in 2¥SSC containing 0.5 % SDS, 2x20 min in 1xSSC 

containing 0.1 % SDS, and 2x20 min in 0.1xSSC containing 0.1 % SDS, all at 

65 °C. 

Note: All washes are recommended even if signal intensity seems to drop. 

4. Wrap the membranes in Saran wrap and expose to X-ray film (Kodak Biomax 

MR) at –80 °C for varying periods (7 h to 3 days). 

Note: Exposing membranes to film without an intensifying screen yields clearer 

spots. 

5. Alternatively, capture the image on a Kodak storage phosphor screen (Eastman 

Kodak Company, Rochester, NY, USA) and scan the screens using a 

Bio-Rad FX Phosphorimager (Bio-Rad, Hercules, CA) at 100 mM resolution. 

Note: It is preferable to use a Phosphorimager as it produces better resolution 

and automates the acquisition of data from macroarrays for downstream processing. 

10 Data Analysis 

Using Phosphorimager: 

1. Transfer the raw image data obtained with the phosphorimager imaging 

system into a computer. 

2. Define each spot on the image by making a grid using QUANTITY ONE 

software (Bio-Rad, Hercules, CA, USA). 

3. For each image, determine the average pixel intensity (representing the 

hybridized DNA) within each spot in each grid square. 

4. Generate a data table using QUANTITY ONE and export the data to Excel 

worksheet (Microsoft Corporation, Redmond, WA, USA). 

5. Calculate background for each membrane by averaging over ten positions 

on the image where there are no DNA spots. 

6. Calculate net signal for each spot by subtracting the average background 

value from the spot intensity. 

Note: If any spot values fall below the set threshold value (twofold less than the 

background) assign a arbitrary value of 0.1. 

7. Probe to probe variance can be filtered out using signal intensities of positive 

or negative controls used in the macroarray. In addition, to take into 

account experimental variations in specific activity of the cDNA probe


preparations or exposure time that might alter the signal intensity, normalize 

the data obtained from different hybridizations by dividing the intensity 

for each spot by the average of the intensities of all the spots present on 

the filter, to obtain a centered, normalized value (Eisen et al. 1998). 

8. It is important to take average values from multiple experiments to reduce 

the variation from experiment to experiment. The final data can be analyzed 

using Cluster and Treeview software (http://rana.lbl.gov) to obtain 

more normalized data. 

Note: You can also use k-means analysis and hierarchical clustering on the net 

via the website: http://ep.ebi.ac.uk/EP/EPCLUST/ dedicated to statistical analysis 

of gene expression data from macroarrays. 

10.1 Data Analysis Autoradiography Images on X-ray Films 

Note: If X-ray film is used to capture the image, it is important to do multiple 

time exposures to obtain more reliable spot intensities for further analysis. It is 

also important not to overexpose the X-ray film where the signal intensities are 

not saturated. This will prevent the calculation of any subtle differences in the 

expression levels. 

1. Scan X-ray films at high resolution (1200x1200 dpi) using a scanner with 

transparency adapter and save the images as TIFF files. 

Note: These images take up a substantial amount of hard disk space (on average 

25–30 MB). 

2. Open the image in a quantification program such as One D-scan (Scanalytics 

Inc., Fairfax,VA, USA). 

3. Scale down the image to fit the screen using the scale and rotate option. 

4. Draw a grid over the image using a preset size of 16 rows x 24 columns and 

a numbering scheme to match the EST database. 

5. Place the grid such that all spots are in the center of each cell. It is possible 

to remove segments if artifacts or defects or over-intensity occur on 

the image where the neighboring spots may overlap. 

6. Calculate the spot intensity values using the volumes option in the analyzing 

tool bar. 

7. Calculate background using the boundary of each segment option, this 

takes a value from each pixel bordering the cell and averages them to yield 

the background value. 

8. Using the volumes tool create a spread sheet of the data containing the 

segment number with it’s background value and volume, along with high 

and low values found within each cell. 

9. Calculate the volume, or intensity, by adding the intensity of each pixel 

within a given segment. 

10. Transfer these data to Microsoft Excel (Microsoft Corp., CA) for further 

manipulation.

588 


11. Calculate a normalized value for each segment by dividing each spot by 

the average intensity of all spots on the film to account for probe–probe 

variance (Eisen et al. 1998). 

12. Correct all values by subtracting the average intensity of the four negative 

controls on the membrane. 

13. Calculate fold increase or decrease in expression and create another column 

for these data. 

14. Now the data can be incorporated into a graphical form between the control 

and treatments by giving the control a value of 1. Data for a treatment 

can then be combined into one spreadsheet along with control data and 

imported into GeneCluster at: 

http://www-genome.wi.mit.edu/cancer/software/software.html. 

This output shows genes that are expressed at approximately the same 

ratios, thus creating a cluster of genes that are most likely to be linked in some 

biochemical pathway or genes that are relevant to interaction response. 

11 Example of Laccaria bicolor Macroarrays 

We examined quantitative changes in the expression of ESTs from L. bicolor 

using the membrane array technique. We prepared a membrane array consisting 

of 384 EST clones selected from L. bicolor interaction cDNA library 

(Kim et al. 1999) and probed it with control free-living mycelium mRNA 

probes and mRNA probes prepared from various time points of preinfection 

stage interaction with red pine. A typical membrane array image obtained 

after hybridization with control mRNA and 72-h interaction mRNA probes is 

A B 

Fig. 6. Example of L. bicolor EST macroarray prepared using the 384 pin manual unit 

and expression profiling of interaction-related gene expression in L. bicolor. Macroarrays 

were printed using 0.9-mm diameter pins containing 384 ESTs and hybridized to 

probes prepared from RNA from free living L. bicolor (A) or from 72 h interaction (B). 

Image obtained from X-ray films exposed to the hybridized membrane. Image is captured 

using Saphir high-resolution scanner (Linotype-Hell, Heidelberg Inc. NY. USA) at 

1200x1200 dpi. Quantification of signal intensities from spots and gene expression levels 

is determined using Mac 1-D software (Scanalytics,VA, USA)


Fig. 7. Histogram showing 

clustering of genes from 

macroarray analysis based 

on levels of expression. The 

interaction (72 h)-related 

expression is shown on the 

x-axis and the number of 

genes that are upregulated 

at a given expression ratio 

is shown on the y-axis.Only 

genes that are upregulated 

are shown from the 

macroarray in Fig. 6A. For 

identification of some of 

the genes upregulated by 

interaction see Table 2 

Fig. 8. Scatter plot analysis of interaction-specific genes between free-living Laccaria 

bicolor and L. bicolor interacted 72 h with Pinus resinosa seedling roots. For each gene, 

transcript levels were calculated for the free-living mycelium and the mycelium that 

interacted with red pine seedling root signals. Solid lines indicate an expression level of 

onefold or above the free-living mycelium, dashed lines 2.5–6-fold increase and dotted 

line eightfold or higher levels of expression. Only nonredundant clones are represented 

in the plot. Selected clones that showed significant differential expression are highlighted

590 


Table 2. Differential expression of selected interaction clones from L. bicolor. Clones are 

selected from macroarray analysis. The E ratio was calculated by comparing the expression 

levels in the interacted fungal tissue with those in the free-living fungus using 

macroarrays 

GenBank no. E value Database match Expression 

ratio 

BI094576 3e –69 BiP protein (Aspergillus nidulans) 4.10 

BI094582 2e –69 PF6.2.1 (Laccaria bicolor) 8.00 

BI094583 2e –48 a-tubulin (Ustilago maydis) 4.51 

BI094587 1e –10 Homeobox genes Hox-2.6 (Mus musculus) 3.30 

BI094592 2e –10 PEP carboxykinase (Mus musculus) 4.33 

BI094601 2e –63 LbAut7 (L. bicolor) 3.73 

BI094606 3e –09 b-importin (Schizosaccharomyces pombe) 4.43 

BI094612 2e –35 Malate synthase (L. bicolor) 3.82 

BI094615 9e –36 TEF (EF1a) (Schizophyllum commune) 3.61 

BI094619 1e –06 IRS 1-like protein (Xenopus laevis) 3.13 

BI094621 1e –31 Ras related protein (L. bicolor) 3.81 

BI094622 3e –86 AAD (Phanerochate. chrysosporium) 2.61 

BI094623 1e –06 LZK protein kinase (Homo sapiens) 2.90 

BI094629 7e –13 Lactonohydrolase (Fusarium oxysporum) 3.91 

BI094632 9e –27 E-MAP-115 (H. sapiens) 4.21 

BI094635 1e –26 SUG1 subunit 8 (S. cerevisiae) 4.61 

BI094639 1e –16 Septin Spn3 (S. pombe) 3.92 

BI094653 5e –62 Rho GTPase (S. cerevisiae) 3.21 

BI094657 1e –10 Clathrin adapter protein (A. thaliana) 2.08 

BI094660 6e –21 AcetylCoA acetyltransferase (L. bicolor) 4.25 

BI094667 1e –20 b-transducin (S. pombe) 4.11 

BI094676 2e –37 Chitin synthase I (U. maydis) 3.71 

shown in Fig. 6.An E ratio that indicates the relative increase in the expression 

of each gene in the interaction over the free-living state is used to quantitate 

differential expression. There is an overall increase in levels of expression of 

several clones tested (Fig. 7). The scatter plot of the normalized data from signal 

analysis of the membranes is presented in Fig. 8, which shows global 

changes in the expression of interaction related genes. Levels of expression of 

selected genes from 72-h interaction are listed in Table 2. 


The EST and macroarray approaches provide efficient tools for mycorrhizal 

symbiosis research. These approaches have the resolution and ability to 

obtain a more comprehensive view of various stages of mycorrhiza development 

or treatment effects due to nutritional changes or differences due to host


responses. In addition, since they require a relatively modest budget, compared 

to genome sequencing or microarray-based methods, they are easily 

accessible for many academic research groups. With increased use of these 

techniques using a variety of mycorrhizal symbiosis models, data can be 

exchanged and compared between different laboratories and eventually will 

provide a platform to understand the key players (genes) that are markers for 

ectomycorrhizal or AM fungal symbioses. In the last couple of years, several 

laboratories have begun using these approaches to unravel the mycorrhizal 

symbiosis (Martin et al. 2001; Voiblet et al. 2001; Podila et al. 2002; Polidori et 

al. 2002). 


Adams MD, Kelley JM, Gocayne JD, Dubnick M, Polymeropoulos M, Xiao H, Merril C, 

Wu A, Olde B, Moreno R (1991) Complementary DNA sequencing, expressed 

sequence tags and humane genome project. Science 252:1651–1656 

Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) 

Gapped Blast and PSI-BLAST: a new generation of protein database search programs. 

Nucl Acids Res 25:3389–3402 

Bertucci F, Bernard K, Loriod B, Chang YC, Granjeaud S, Birnbaum D, Nguyen C, Peck K, 

Jordan BR. (1999) Sensitivity issues in DNA array-based expression measurements 

and performance of Nylon microarrays for small samples. Hum Mol Genet 8(9):1715– 

22 

Bianciotto V, Bonfante P (1992) Quantification of the nuclear content of two arbuscular 

mycorrhizal fungi. Mycol Res 96:1071–1076 

Chomoczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium 

thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159 

Corpet F (1988) Multiple sequence alignment with hierarchical clustering. Nucleic Acids 

Res 16:10881–10890 

Doudrick RL, Raffle VL, NelsonCD, Fournier GR (1995) Genetic analysis of homokaryons 

from a basidiome of Laccaria bicolor using random amplified polymorphic 

DNA (RAPD) markers. Mycol Res 99:1361–1365 

Eisen MB, Spellman PT, Brown PO, Botstein D (1998) Cluster analysis and display of 

genome-wide expression patterns. Proc Natl Acad Sci USA 95:14863–14868 

Gianinazzi-Pearson V, van Tuinen D, Dumas-Gaudot E, Dulieu H (2001) Exploring the 

genome of Glomalean fungi. In: Hock B (ed) The Mycota, vol IX. Fungal Associations. 


Gonzalez P, Zigler S, Epstein DL, Borras T (1998) Identification and isolation of differentially 

expressed genes from very small tissue samples. Biotechniques 26:884–892 

Graham JH (2000) Assessing costs of arbuscular mycorrhizal symbiosis in agroecosystems. 

In: Podila GK, Douds DD (eds) Current advances in mycorrhizae research. APS 

Press, St. Paul, MN, pp 127–140 

Graham JH, Eissenstat DM (1998) Field evidence for carbon costs of citrus mycorrhizas. 

New Phytol 140:103–110 

Harrison MJ (1999) Molecular and cellular aspects of the arbuscular mycorrhizal symbiosis. 


Hofte H, Desprez T, Amselem J, et al. (1993) An inventory of 1152 expressed sequence 

tags obtained by partial sequencing of cDNA from Arabidopsis thaliana. Plant J 

4:1051–1061

592 


Hosny M, Gianinazzi-Pearson, V, Dulieu H (1998) Nuclear DNA contents of 11 fungal 

species in Glomales. Genome 41:422–429 

Jordan BR (1998) Large-scale expression measurement by hybridization methods: from 

high-density membranes to “DNA chips”. J Biochem (Tokyo) 124(2):251–258 

Kamoun S, Hraber P, Sobral B, Nuss D, Govers F (1999) Initial assessment of gene diversity 

for the oomycete pathogen Phytophthora infestans based on expressed sequence 

tags. Fungal Genet Biol 28:94–106 

Lee SH, Kim BG, Kim KJ, Lee JS, Yun DW, Hahn JH, Kim GH, Lee KH, Suh DS, Kwon ST, 

Lee CS, Yoo YB (2002) Comparative analysis of sequences expressed during the liquid-cultured 

mycelia and fruit body stages of Pleurotus ostreatus. Fungal Genet Biol 

35(2):115–134 

Martin F, Duplessis S, Ditengou F, Lagrange H,Voiblet C, Lapeyrie F (2001) Development 

of cross talking in the ectomycorrhizal symbiosis: Signals and communication genes. 

New Phytol 151:145–154 

Nelson MA, Kang S, Braun EL, Crawford ME, Dolan PL, Leonard PM, Mitchell J, Armijo 

AM et al. (1997) Expressed sequences from conidial, mycelial and sexual stages of 

Neurospora crassa. Fungal Genet Biol 21:348–363 

Podila GK, Zheng, J, Balasubramanian S, Sundaram S, Hiremath S, Brand J, Hymes M 

(2002) Molecular interactions in ectomycorrhizas: identification of fungal genes 

involved in early symbiotic interactions between Laccaria bicolor and red pine. Plant 

Soil 244:117–128 

Polidori E,Agostini D, Zeppa S, Potenza L, Palms F, Sisti D, Stocchi V (2002) Identification 

of differentially expressed cDNA clones in Tilia platyphyllos – Tuber borchii ectomycorrhizae 

using a differential screening approach. Mol Gen Genomics 266:858–864 

Sambrook J, Russel DW (2001) Molecular Cloning. A Laboratory Manual. 3rd Edition. 

Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York 

Schummer M, Ng, WL, Nelson PS, Bumgarner RB, Hood L (1997) A simple high-performance 

DNA arraying device for comparative expression analysis of a large number of 

genes. BioTechniques 23:1087–1092 

Smith SE, Read DJ (1997) Mycorrhizal symbiosis, 2nd edn. Academic Press, London 

Voiblet C, Duplessis D, Encelot N, Martin F (2001) Identification of symbiosis-regulated 

genes in Eucalyptus globulus-Pisolithus ectomycorrhiza by differential hybridization 

of arrayed cDNAs. Plant J 25:181–191

30 Axenic Culture of Symbiotic Fungus 

Piriformospora indica 

Giang Huong Pham, Rina Kumari, Anjana Singh, Rajani Malla, 

Ram Prasad, Minu Sachdev, Michael Kaldorf, François Buscot, 

Ralf Oelmüller, Rüdiger Hampp, Anil Kumar Saxena, 

Karl-Heinz Rexer, Gerhard Kost and Ajit Varma 


A large number of media compositions are available in the literature for the 

cultivation of various groups of fungi, but almost no literature is available for 

axenic cultivation of symbiotic fungi. In this chapter, we have made efforts to 

provide the documentary evidence for growth and multiplication of Piriformospora 

indica (see Chap. 15, this Vol. for characteristic features of the fungus). 

This new fungus named P. indica, due to its characteristic spore morphology, 

improves the growth and overall biomass production of different 

plants, herbs and trees, etc., and can easily be cultivated on a number of complex 

and synthetic media (Varma et al. 1999, 2001; Singh An et al. 2003a, b). 

Significant quantitative and morphological changes were detected when the 

fungus was grown on different nutrient compositions with no apparent negative 

effect on plants. It is relevant to mention here that different media can be 

used to understand the morphological and functional properties, or to test 

possible biotechnological applications. 

2 Morphology 

Young mycelia were white and almost hyaline, but inconspicuous zonations 

were recorded in other cultures. The mycelium was mostly flat and submerged 

into the substratum. Hyphae were thin-walled and of different diameters 

ranging from 0.7 to 3.5 mm. The hyphae were highly interwoven, often 

adhered together and gave the appearance of simple intertwined cords. The 

hyphae often showed anastomoses and were irregularly septated. They often 

intertwined and overlapped each other. In older cultures and on the root surface, 

hyphae were often irregularly inflated, showing a nodose to coralloid 




594 


Fig. 1. An overall view of P. indica, grown on solidified MYP medium for 7 days. Note 

the distinct hyphal coils (h) and pear-shaped chlamydospores (c) Bar = 20 µm. By courtesy 

of Oliver Blechert 

Fig. 2. P. indica colonized 

maize root segment 

covered by numerous 

chlamydospores on 

the surface and scattering 

away from the root. 

Enlarged view of 

chlamydospores showing 

nuclei. Chlamydospores 

were stained 

with DAPI and observed 

in epifluorescence. Different 

optical planes 

were assembled in one 

picture using the 

IMPROVISION software 

package (IMPROVI- 

SION, Govenny, UK)


shape and granulated dense bodies were observed. Many cells contained more 

than one nucleus. Chlamydospores were formed from thin-walled vesicles at 

the tips of the hyphae. The chlamydospores appeared singly or in clusters and 

were distinctive due to their pear-shaped appearance (Fig. 1). The chlamydospores 

were (14-) 16–25 (-33) mm in length and (9-) 10–17 (-20) mm in 

width. Figure 2 shows the maize root colonization. The cytoplasm of the 

chlamydospores was densely packed with granular material and usually contained 

8–25 nuclei (Fig. 2, inset).Very young spores had thin, hyaline walls. At 

maturity, these spores had walls up to 1.5 mm thick, which appeared two-layered, 

smooth and pale yellow. Neither clamp connections nor sexual structures 

could be observed. 

3 Taxonomy of the Fungus 

Different kinds of substrates were tested to induce sexual development, such 

as young and mature leaves of Cynodon dactylon and pollen grains, oat meal, 

potato, carrot or tomato dextrose agar and soil-on-agar culture methods. No 

apparent adverse affect was seen on cultivation in light. It is not necessary to 

grow the fungus in the dark. Growth under light and dark conditions did not 

promote sexuality. May be the fungus is heterothallic in nature and one has to 

work for compatible strains. Since all these efforts did not lead to the desired 

results, there were only a few features to characterize the fungus morphologically 

and group it according to the classical species concept. In order to obtain 

more information about the systematic position of the new fungus, the ultrastructures 

of the septal pore and the cell wall were examined. The cell walls 

were very thin and multilayered structures. The septal pores consisted of 

dolipores with continuous parenthosomes. The dolipores were very prominent, 

with a multilayered cross wall and a median swelling mainly consisting 

of electron-transparent material. The electron-transparent layer of the cross 

walls extended deep into the median swellings, but did not fan out. In median 

sections of the septal pores, the parenthosomes were always straight and had 

the same diameter as the corresponding dolipore. Parenthosomes were flat 

discs without any detectable perforation. The parenthosomes consisted of an 

electron-dense outer layer, which showed an inconspicuous dark line in the 

median region. The parenthosomes were in contact with the ER membranes, 

which were mostly found near the dolipore (Verma et al. 1998). 

The ultrastructural data proof that P. indica is a menber of the Hymenomycetes 

(Basidiomycota). Studies on the moleclar phylogeny will help to 

reveal the closest relatives of this species (Fig. 3). 

Interestingly, immunological characterization showed a strong cross-reactivity 

with the members of Zygomycota (Glomerales) instead of species of 

Basidiomycota (Table 1). This aspect needs further critical appraisal.

596 


Table 1. Cross-reactivities of polyclonal antisera raised against P. indica (total hyphal 

homogenate) as determined by ELISA. Optical density (OD 405 nm ) values are given as the 

mean of three replicates after correction of control (OD 405 nm )±SD. Statistical analysis 

was done by ANOVA. (n.d., not detectable) 

Antigens OD 405 nm Source 

1:1600 

Piriformospora indica 

Nonmycorrhizal fungi 

0.49±0.005 Ajit Varma, JNU, New Delhi 

Agaricus bisporus 0.08±0.002 AK Sarbhoy, IARI, New Delhi 

Beauvaria sp. 0.003±n.d. AK Sarbhoy, IARI, New Delhi 

Candida albicans 0.11±0.004 R Prasad, JNU, New Delhi 

Cladosporium sp. 0.004±n.d. AK Sarbhoy, IARI, New Delhi 

Cunninghamella echinulata 0.03±0.001 G Kost, Marburg, Germany 

Fusarium solani 0.03±0.002 AK Sarbhoy, IARI, New Delhi 

Rhizoctonia bataticola 0.04±0.002 G Kost, Marburg, Germany 

Rhizoctonia solani 0.013±0.001 A K Sarbhoy, IARI, New Delhi 

Rhizopus sp. 0.06±0.001 AK Sarbhoy, IARI, New Delhi 

Saccharomyces cerevisiae 0.17±0.020 R Prasad, JNU, New Delhi 

Schizophyllum commune 0.005±0.004 G Kost, Marburg, Germany 

Sclerotinia sclerotiorum 0.16±0.006 AK Sarbhoy, IARI, New Delhi 

Sclerotium solani 0.05±0.001 G Kost, Marburg, Germany 

Ustilago maydis 0.08±0.007 AK Sarbhoy, IARI, New Delhi 

Ectomycorrhizal fungi 

Amanita muscaria 0.18±0.007 T Satyanarayana, South Campus, Delhi University 

Lactarius torminosus 0.03±0.004 Erika Kothe, Jena, Germany 

Lentinus edodes 0.02±0.001 T Satyanarayana, South Campus, Delhi University 

Paxillus involutus 0.02±0.001 T Satyanarayana, South Campus, Delhi University 

Pisolithus tinctorius 0.15±0.007 Erika Kothe, Jena, Germany 

Rhizopogon roseolus 0.12±0.019 T Satyanarayana, South Campus, Delhi University 

Rhizopogon vulgaris 0.01±0.001 T Satyanarayana, South Campus, Delhi University 

Suillus variegatus 

Endomycorrhizal fungi 

0.003±0.004 Erika Kothe, Jena, Germany 

Gigaspora margarita 0.41±0.005 Alok Adholeya, TERI, New Delhi 

Gi. gigantia 0.46±0.002 KVBR Tilak, IARI, New Delhi 

Glomus caledonium 0.20±0.039 François Buscot, Jena, Germany 

G. coronatium 0.07±0.011 François Buscot, Jena, Germany 

G. geosporura 0.16±0.019 François Buscot, Jena, Germany 

G. intraradices 0.003±0.003 François Buscot, Jena, Germany 

G. lamellosum 0.02±0.004 François Buscot, Jena, Germany 

G. mosseae 0.15±0.010 François Buscot, Jena, Germany 

G. mosseae 376 0.10±0.027 François Buscot, Jena, Germany 

G. proliferum 0.24±0.023 François Buscot, Jena, Germany 

Scutellospora gilmorei 

AMF-like 

0.40±0.002 Ajay Shanker, JNU, New Delhi 

Sebacina vermifera var sensu 0.39±0.049 Karl-Hein Rexer, Marburg, Germany 

Sebacina sp. 0.23±0.013 Karl-Hein Rexer, Marburg, Germany 

Statistical analysis of the data shows the P values, which are significant (P


Fig. 3. An overall view of the molecular taxonomic position of P. indica (modified 

after Schüßler et al. 2001) 

4 Chlamydospore Formation and Germination 

The fungus produces chlamydospores at the apex of hyphae, which were 

mostly irregular undulated in shape. These chlamydospores can be easily germinated 

on various synthetic media (Verma et al. 1998). On solidified agar 

(2 %) medium, a tendency for cluster formation of chlamydospores was 

observed. Temperature (low to high and/or vice versa), pH (alkaline to acid or 

vice versa), and shock treatment also induced excessive sporulation. These 

spores were viable for over a year when preserved at room temperature. Loss 

in viability of the dormant spores was the least when germinated after 1 year. 

Dormant spores germinated within 1 day of their placement on nutrient agar 

medium and incubated at 40 °C under high humidity (>90 %). The first step of 

germination was the formation of germ tubes at the protruded zone of the 

spore, followed by hyphal emergence. Most of the nuclei followed the hyphae 

and seldom were one or two nuclei left behind in the spore. Soon branching 

appeared with a short and long branch (Fig. 4). 

5 Cultivation 

Fungi are heterotrophic for carbon compounds and these serve two essential 

functions in fungal metabolism. The first function is to supply the carbon 

needed for the synthesis of compounds which comprise living cells. Proteins,

598 


nucleic acids, reserve and food materials, etc., would be included here. Second, 

the oxidation of carbon compounds produces appreciable amounts of 

energy. Fungi can utilize a wide range of carbon sources such as monosaccharides, 

disaccharides, oligosaccharides, polysaccharides, organic acids and 

lipids. Carbon dioxide can be fixed by some fungi, but cannot be used as an 

exclusive source of carbon for metabolism. P. indica can be successfully cultivated 

on a wide range of synthetic solidified and broth media, e.g., MMN1/10, 

modified aspergillus, M4N, MMNC, MS, WPM, MMN, Malt-Yeast Extract, 

MYP, PDA and aspergillus (Fig. 5). Among the tested media, aspergillus (Kae- 

Fig. 4. Chlamydospores of P. 

indica. a Germinating chlamydospore 

showing initial branching 

after 12 h, b mature chlamydospores 

were germinated on a 

glass slide coated with thin 

nutrient agar, photographed 

after 24 h, c scattered spores and 

thin, irregular, undulating 

hyphae


fer 1977) was the best. However, other media were helpful in carrying out several 

physiological and molecular experiments (see Chap. 15, this Vol.). 

Figure 6 shows typical growth on solidified aspergillus medium after 28 days. 

Rhythmic growth was often recorded. The mycelium stopped its growth for 

some time and produced a large number of chlamydospores of different 

dimensions. After 24–48 h, the mycelium started its growth again, producing 

normal amount of chlamydospores. This resulted in the formation of rythmic 

rings. The physiological reason for this phenomenon is not yet known, 

although this tendency has been recorded for several other members of 

Basidiomycetes. The fungus grows profusely upon shaking broth aspergillus 

medium. The temperature range of the fungal growth is 25–35 °C; the optimum 

temperature and pH being 30 °C and 5.8 (4.8–6.8), respectively. Figure 7 

gives a view of the cultivation on broth media. Colonies were large and small 

depicting sea urchin-like radial growth. The maximum surface growth was 

recorded after 10 days. The colony diameter is indicated in Fig. 8. The fungal 

biomass is indicated in Table 2. The optimum growth was recorded after 5 

Fig. 5. P. indica was 

grown on the following 

solidified media. a MS, 

b WPM, c MMN, d M4N, 

e PDA, f aspergillus

600 


days with a gradual decrease in fresh and dry biomass after prolong incubation. 

Linear growth of the fungus on different solidified agar media is represented 

in Table 3. On modified Melin-Norkrans (MMN) medium sparsely 

running hyaline hyphae on the agar surface were seen, while on Potato Dextrose 

Agar deep furrows with strong adhesion to the agar surface were apparent. 

This sharp mode of growth was not observed when fortified with malt 

extract and normal aspergillus medium. In contrast to aspergillus medium, 

shaking conditions on MMN broth medium invariably inhibited the growth. 

The explanation for this observation is not known. Fungal growth acidifies 

the medium within 10 days to pH 4.4. Buffered medium prevented the reduction 

of pH (Table 4). 2-(N-morpholine) ethane sulfonic acid (MES) in the 

range of 25–100 mM was used. 

6 Carbon and Energy Sources 

Fig. 6. An overall view of P. 

indica grown on solidified 

aspergillus medium. Inset 

shows enlarged view of a small 

portion. On an agar concentration 

of 2 % w/v concentric rings 

often appeared (arrows) indicating 

the rhythmic growth of 

the fungus. The black arrows 

point on the regions with slow 

growth and high amount of 

chlamydospores, the white 

arrows point on thin mycelial 

mats resulting from fast growth 

of the hyphae 

Individual sugars were uniformly added to the minimal broth at a rate of 1.0 % 

(w/v) in all treatments.They were included in the medium separately after sterilization. 

In all the sugar-supplied media, growth was better than the control 

(Table 5). There were not many changes in the growth except for rafinose and 

fructose.There were no changes in the color of the mycelium.Good growth was 

recorded in media containing maltose followed by xylose, sucrose, rhamnose, 

arabinose, glucose, lactose and mannose, respectively. The final pH was not 

altered significantly, but was lower than that of the control (Table 5). 

In a further study, fungal growth was best when glucose (1 % w/v) was 

used as a carbon source as compared to sucrose, and followed by fructose. A


Table 2. The data represent an average of P. indica biomass of 5 replicates grown in 100 

ml aspergillus broth medium in 250 ml capacity Erlenmeyer flasks. Incubation was done 

on a rotary shaker (GFL 3.19, Germany) at 144 rpm at 30 °C 

Days Biomass (g) 

Fresh Dry 

5 3.67±0.84 0.06±0.02 

7 2.99±0.38 0.06±0.01 

10 2.39±0.01 0.07±0.01 

Fig. 7. Growth of P. indica on aspergillus broth medium under constant shaking condition 

at 25 °C for 7 days. Colonies of different developmental stages were shown. Mature 

colonies have the appearance of sea urchins 

5 7 10 

5 7 10 

LM A LM A LM A 

3.6 ± 0.15 10.2 5.4 ± 0.36 22.9 7.5 ± 0.16 43.9 

Fig. 8. A comparative linear growth of P. indica on aspergillus solidified medium. Measurements 

were made after 5, 7 and 10 days, respectively. Incubation was conducted in 

dark at 25 °C. Parameter selected was the diameter of 5 replicates of the linear measurement 

(LM). Readings are given in cm standard deviation and area (A) on agar medium. 

Statistical analysis of the data showed P

602 


Table 3. Comparative linear growth of P. indica on different 

solidified agar media. The data represent an average 

colony diameter of five replicates, measured after 

5 days of incubation 

Media Linear measurement of the growth (cm) 

MMN 4.2±0.05 

M4N 2.8±0.09 

PDA 3.5±0.11 

aspergillus 3.6±0.15 

Table 4. Change of pH of the aspergillus broth medium incubated with P. indica 

Medium conditions (pH) Incubation days 

0 3 5 7 10 

Unbuffered 6.5 6.0 5.7 5.1 4.4 

Buffered 6.5 6.5 6.5 6.5 6.3 

Initial pH was adjusted to 6.5. 25–100 mM MES was used as buffering agent 

Table 5. End pH and biomass of P. indica grown on minimal 

aspergillus broth medium containing different sugars (each 1 % 

w/v) 

Sugars End pH Biomass (mg/10 ml) 

Control (no addition) 5.18 7.5 

Glucose 4.39 10.0 

Fructose 5.25 8.0 

Maltose 4.46 12.0 

Rhamnose 4.60 10.3 

Mannose 4.30 9.5 

Lactose 4.44 10.0 

Sucrose 4.39 10.0 

Xylose 4.31 11.0 

Arabinose 4.28 10.0 

Raffinose 4.43 9.0 

One agar disc (1 cm in diameter loaded with hyphae and 

chlamydospores) was transferred to individual test tubes containing 

10 ml minimal broth. Sterile sugar solution (microsyringe-filtered, 

0.22 mm Schleicher & Schuell) was included. Incubation 

was done under constant shaking conditions (GFL, 3026, 

Germany) for 7 days at 25 °C. Fungal biomass was removed and 

end pH was measured


Table 6. Growth of P. indica on unbuffered aspergillus broth medium supplemented 

with different carbon sources 

Sugars (w/v) Fresh weight Remarks 

(g/l) 

Sucrose(0.5 %) 148.8 Compact and numerous chlamydospores 

Glucose (1 %) 184.8 Loose, peg-like bodies, few chlamydospores 

Fructose (1 %) 78.0 Compact, numerous tiny chlamydospores 

Glucose + fructose 109.6 Loose, a few chlamydospores, turned slimy 

(0.5 % each) 

Data represent an average of three replicates; biomass measured after 7 days. 

combination of glucose and fructose (each 0.5 % w/v) led to a medium 

increase in the biomass of P. indica (Table 6). On supplementation of glucose 

by a mixture of glucose, fructose and sucrose (each 0.5 % w/v), the former 

was consumed completely and then the sucrose was metabolized by production 

of invertase. This led to an increase of the fructose concentration of the 

medium. After the complete consumption of free glucose there was a slow 

utilization of fructose. 

Fig. 9. P. indica colonies produced in aspergillus broth medium fortified with glucose, 

sucrose or fructose. An enlarged view of a colony showing protuberances and peg-like 

structures on glucose medium

604 


The morphology of the colonies differed according to the sugar supply. In 

fructose and sucrose, the colonies were roundish and compact, in glucose they 

were large and irregular with short and long protrusions (Fig. 9). 

7 Biomass on Individual Amino Acids 

The addition of glycine, methionine, serine, alanine promoted fungal growth 

to different extents (Table 7). Not much difference in mycelial growth was 

observed in media containing glutamine, asparagine and histidine, although a 

substantial difference in the end pH of these amino acid-fortified culture 

broths was recorded (Table 7). 

8 Growth on Complex Media 

P. indica grown in minimal broth was transferred onto one set of fresh minimal 

media containing agar. In the minimal broth, the complex mixtures such as 

soil-extract, malt-extract, peptone, beef-extract, yeast-extract and caseinhydrolysate 

were added individually to an amount of 1 % (w/v). Before autoclaving, 

the pH of the media was adjusted to 6.5. Compared to all other media 

used,excellent growth of mycelium was recorded in the incubation broth fortified 

with casamino hydrolysate-HCl. Growth in beef, yeast, malt extracts and 

peptone was moderate. Soil extracts did not support fungal growth (Table 8). 

Table 7. End pH and fungal biomass grown on minimal broth medium supplemented 

with amino acids (each 0.5 % w/v) 

Amino acids End pH Biomass (mg/10 ml) 

Control (no addition) 5.14 3.8 

Alanine 6.94 6.2 

Phenyl alanine 4.31 5.8 

Methionine 4.71 7.0 

Serine 5.82 6.9 

Asparagine 5.86 4.2 

Glutamine 4.76 4.3 

Cysteine 1.90 3.8 

Glycine 5.01 7.8 

Aspartic acid 2.91 3.8 

Arginine 8.93 3.8 

Histidine 7.05 4.0 

pH was re-adjusted after the addition of microsyringe-filtered amino acids to 6.5. Incubation 

was done under constant shaking condition (GFL, 3026, Germany) for 7 days at 

25 °C. Fungal biomass was removed and end pH was measured

9 Phosphatic Nutrients 


Phosphorus is an essential mineral for the growth of P. indica. Optimum 

growth was obtained on supplementing the modified aspergillus medium 

with Di-potassium hydrogen phosphate in equimolar concentrations (Table 

9). Interestingly, the fungus utilized tri-poly phosphate and solubilized insoluble 

calcium-hydrogen phosphate. Acid phosphatases were observed to be 

active in P. indica mycelium (Varma et al. 2001). The fungus was able to utilize 

a variety of inorganic and organic phosphate sources which is in accordance 

with the broad range of the substrates utilized by the acid phosphatases of 

many fungi. Moreover, phosphate starvation of P. indica led to an overall 

(27 %) increase in the intracellular acid phosphatase activity. This increase 

was probably due to the appearance of a P-repressible isoform of acid phos- 

Table 8. Mycelial biomass of P. indica grown on complex modified aspergillus medium 

Complexes Mycelial biomass (mg/10 ml) 

Control (no addition) 10 

Soil-extract 6 

Malt-extract 8 

Peptone 9 

Beef-extract 12 

Yeast-extract 11.5 

Casein hydrolysate 5 

Complex chemicals (obtained from Difco or Hi media) were included at the rate of 1 % 

(w/v); and soil-extract 15 % v/v. pH was readjusted to 6.5. Incubation conditions were the 

same as described earlier 

Table 9. Biomass of P. indica after 24 days of growth on modified aspergillus medium 

supplemented with equimolar (10 mM) concentrations of phosphatic nutrient sources 

Phosphate source Dry biomass Final pH of the 

g/1000 ml medium 

Control (P-) 2.9±0.001 4.10±0.013 

Di-hydrogen potassium phosphate 6.9±0.009 4.62±0.05 

Di-potassium hydrogen phosphate 7.9±0.002 4.59±0.024 

Calcium-hydrogen phosphate 4.8±0.003 4.17±0.008 

Di-hydrogen sodium phosphate 6.3±0.005 4.47±0.068 

Di-potassium hydrogen phosphate 6.8±0.003 4.34±0.053 

Di-hydrogen ammonium phosphate 5.5±0.004 4.36±0.056 

Tetra-hydrogen ammonium phosphate 5.2±0.003 4.26±0.04 

Tri-polyphosphate 7.9±0.002 5.49±0.074 

Tri-metaphosphate 5.8±0.001 4.40±0.008 

Aspergillus medium was modified by reducing the concentration of peptone, yeast 

extract and casein hydrolysate to ten times the normals

606 

phatase in addition to the constitutive one observed in the enzyme staining of 

the native polyacrylamide gels. The significance of these enzymes in the phosphate 

transport needs to be further substantiated by the studies on the plant 

roots colonized with P. indica. 

10 Composition of Media 

a Aspergillus (Kaefer 1977) 

Composition (g/l) 

Glucose 20.0 

Peptone 2.0 

Yeast extract 1.0 

Casein hydrolysate 1.0 

Vitamin stock solution 1.0 ml 

Macro-elements from stock 50.0 ml 

Micro-elements from stock 2.5 ml 

Agar 10.0 

CaCl2 0.1 M 1.0 ml 

FeCl3 0.1 M 1.0 ml 

pH 

Macro-elements 

6.5 

(Major elements) Stock (g/l) 

NaNO3 120.0 

KCl 10.4 

MgSO . 

4 7H2O 10.4 

KH2PO4 Micro-elements 

30.4 

Trace elements Stock (g/l) 

ZnSO . 

4 7H2O 22.0 

H 3 BO 3 


11.0 

MnCl 2 . 4H2O 5.0 

FeSO 4 . 7H2O 5.0 

CoCl 2 . 6H2O 1.6 

CuSO 4 . 5H2O 1.6 

(NH 4) 6 Mo 7O 27 4H 2O 1.1 

Na 2EDTA 50.0 

Vitamins % (w/v) 

Biotin 0.05 

Nicotinamide 0.5 

Pyridoxal phosphate 0.1 

Amino benzoic acid 0.1 

Riboflavin 0.25 

The pH was adjusted to 6.5 with 1 N HCl. All the stocks were stored at 4 °C 

except the vitamins which were stored at –20 °C

Modified aspergillus medium (Varma et al. 2001) 

The media composition was the same, except that yeast extract, peptone and 

casein hydrolysate were reduced to 1/10 in quantity 

c M4N (Mukerji et al. 1998) 


D-Glucose 10.0 

(NH4) 2HPO4 0.25 

KH 2 PO 4 

0.50 

MgSO 4 . 7H2O 0.15 

CaCl 2 . 2H2O 0.05 

Ferric citrate 

(2 % Ferric citrate, 

2 % Citric acid w/v) 7.0 ml 

NaCl 0.025 

Thiamine HCl 100.0 mg 

MES 2.5 

Malt extract 1.5 


Agar 15.0 

pH 5.6 

d Malt Extract (Galloway and Burgess 1952) 



Mycological peptone 5.0 

Agar 15.0 

pH 5.4 

e MMN (Modified Melin-Norkrans) (Johnson et al. 1957) 


NaCl 0.025 

KH2PO4 0.5 

(NH4) 2HPO4 0.25 

CaCl2 0.05 

0.15 

MgSO4 FeCl3 30 Axenic Culture of Symbiotic Fungus Piriformospora indica 607 

0.001 

Thiamine HCl 83.0 ml 

Tryticase peptone 0.1 % (w/v) 

Glucose monohydrate 1.0 % (w/v) 

Malt extract 5.0 % (w/v) 

Trace elements from stock 10.0 ml/l 

Trace elements (stock) (g/l) 

KCl 3.73

608 

H3BO3 1.55 

MnSO . 

4 H2O 0.85 

ZnSO4 0.56 

CuSO4 0.13 

pH adjusted to 5.8 with 1 N HCl/NaOH. All stocks were stored at 4 °C except 

thiamine hydrochloride which was stored at –20 °C 

f MMN 1/10 (Herrmann et al. 1998) 


CaCl 2 . 2H2O 0.07 

MgSO 4 . 7H2O 0.15 

NaCl 0.03 

(NH4) 2HPO4 0.03 

KH2PO4 0.05 

Trace elements (stock) (mg/l) 

(NH 4 ) 6 Mo 7 O 24 . 4H2 O 0.09 

H 3BO 4 

1.55 

CuSO 4 . 5H2O 0.13 

KCl 3.73 

MnSO 4 . H2 O 0.84 

ZnSO 4 . 7H2O 0.58 

Fe-EDTA (mg/l) 

FeSO4 8.50 

EDTA 1.50 

Agar 20.0 g/l 

g MMNC (Marx 1969; Kottke et al. 1987) 


Glucose 10.0 

CaCl 2 . 2H2O 0.07 

MgSO 4 . 7H2O 0.15 

NaCl 0.03 

(NH4) 2HPO4 0.25 

KH2PO4 0.5 

Casein hydrolysate 1.0 


Trace elements (mg/l) 

(NH 4 ) 6 Mo 7 O 24 . 4H2 O 0.02 

H 3BO 4 


1.55 

CuSO 4 . 5H2 O 0.13 

KCl 3.73 

MnSO 4 . H2 O 0.85 

ZnSO 4 . 7H2O 0.58 

Fe-EDTA (mg/l)


FeSO4 8.5 

EDTA 1.5 

Vitamins (mg/l) 

Thiamine HCl 0.1 

Riboflavin 0.1 

pH 5.6 

Agar 20.0 g/l 

h Moser b (modified after Moser 1960) 

Macro-elements (g/l) 

Glucose 10 

Sucrose 10 

Maltose 10 

Malt extract 10 

Peptone 2 

K2HPO4 0.15 

KH2PO4 0.35 

NH4NO3 1 

0.3 

NaNO3 MgSO . 

4 7H2O 0.5 

CaCl2 0.1 

Micro-elements mg/l 

Thiamine 50 

Biotine 1 

Inositol 50 

ZnSO4 1 

FeCl3 10 

MnSO4 5 

Agar 20 g/l 

i MS (Murashige and Skoog 1962) 

Composition 

Macro-nutrients 

(mg/l) 

NH4NO3 0.5 

KNO3 1650.0 

CaCl . 

2 2H2O 900.0 

MgSO . 

4 7H2O 440.0 

KH2PO4 Micro-nutrients 

370.0 

KI 170.0 

H3BO3 0.83 

MnSO . 

4 H2O 6.20 

ZnSO . 

4 7H2O 15.60 

NaMoO . 

4 2H2O 8.60

610 

CuSO 4 . 5H2 O 0.25 

CoCl 2 . H2O 0.025 

Iron source 

Na 2EDTA 0.025 

FeSO 4 . 7H2O 37.30 

Vitamins 

Nicotinic acid 27.8 

Pyridoxine HCl 0.5 

Thiamine HCl 0.1 

Glycine 2.0 

Myo-inositol 100.0 

Agar 0.7 % (w/v) 

Sucrose 3.0 % (w/v) 

pH, 5.6–5.7 

Each chemical was dissolved in bidistilled water. The pH of the medium 

was adjusted using 1 N NaOH/HCl before autoclaving at 121 °C, for 20 min. 

Stock solutions were stored at 4 °C except organic supplements, which were 

stored at –20 °C 

j MYP (Bandoni 1972) 


Malt extract 7 

Soytone (Difco) 1 


Agar 15 

k Potato Dextrose Agar (PDA) (Martin 1950) 


Potato peel 200.0 

Dextrose 20.0 

Agar 15.0 

The periderm (skin) of potatoes (200 g) was peeled-off, cut into small 

pieces and boiled in 500 ml of water, until they were easily penetrated by a 

glass rod. After filtration through cheese cloth, dextrose was added. Agar was 

dissolved and the required volume (1 l) was made up by the addition of water. 

The medium was autoclaved at 121 °C for 20 min. 

l WPM (“Woody Plant Medium” for Populus) (Ahuja et al. 1986) 


Sucrose 20.0 

K 2SO 4 


1.00 

Ca (NO . 

3) 2 4H2O 0.73 

NH4NO3 0.40


MgSO 4 . 7H2 O 0.37 

Myo-inositol 0.10 

Agar 7.00 

Add 700 ml H 2O, adjust pH to 5.8 using 3.7 % HCl (ca. 9.5 ml), 

Add after autoclaving sterile phosphate solution (0.17 g KH 2PO 4 dissolved in 

270 ml H 2 O+15 ml NaOH (saturated). 

10 ml of trace element stock solution (see below) 

10 ml Fe-EDTA (see below) 

10 ml glycine stock solution (100x: dissolve 20 mg in 100 ml) 

1 ml thiamine – stock solution (1000x: dissolve 10 mg in 100 ml) 

1 ml nicotinic acid – stock solution (1000x: dissolve 50 mg in 100 ml) 

1ml CaCl 2 – stock solution (1000¥: dissolve 3.6 g in 50 ml) 

250 ml Pyridoxine – stock solution (4000x: dissolve 40 mg in 100 ml) 

100 ml CuSO 4 – stock solution (10,000x: dissolve 25 mg in 100 ml) 

sterilize by filtration before adding 100¥ trace element stock solution (autoclave, 

store at 4 °C) 

MnSO . 

4 H2O 2.23 

ZnSO . 

4 7H2O 0.86 

H3BO4 0.62 

Ammonium molybdate 0.10 

KI 0.09 

100x Fe-EDTA stock solution: dissolve 0.128 g FeSO4 and 0.172 g EDTA at 

60 °C in 100 ml H2O, store at 4 °C 

CaCl . 

2 2H2O 0.07 

MgSO . 

4 7H2O 0.15 

NaCl 0.03 

(NH4) 2HPO4 0.03 

KH2PO4 0.05 

Trace elements (mg/l) 

(NH4 ) 6Mo7O . 

24 4H2O 0.018 

H3BO4 0.62 

The fungus grew on a wide range of synthetic and complex media. Significant 

quantitative and morphological changes were detected when the fungus 

was challenged to grow on different media. Shaking during incubation 

retarded growth in MMN broth cultures (7–12 g fresh wt./l, after 2 weeks at 

30 °C), whereas no such negative effect was ever observed during cultivation 

on any other substrates. There was practically no growth when mycelia were 

incubated under shaking conditions, whereas in stationary conditions, normal 

growth was obtained. Hyphae did not adjust to even a slow rate of shaking. 

In fact, the fungal biomass was considerably enhanced on shaking cultures 

with aspergillus medium, sometimes up to 50 g fresh wt./l after 2 weeks 

at 30 °C. On aspergillus and Moser b media, the colonies appeared compact,

612 


wrinkled with furrows and constricted. The mycelium produced fine zonation 

and a great amount of white aerial hyphae. Hyphae were highly interwoven, 

often adhered together and gave the appearance of simple cords. New 

branches emerged irregularly and the hyphal walls showed some external 

deposits at regular intervals, which stained deeply with toluidine blue. Since 

septation was irregular, the single compartment could contain more than one 

nucleus. The chlamydospores appeared singly or in clusters at the apex of 

hyphae. They were distinctive due to their pear-shaped habit. 


Mycorrhiza does not always promote the growth of agricultural crops. In 

phosphorus-rich soils, they can parasitize plants such as citrus, wheat and 

maize by tapping sugars from these plants without giving anything back. 

Researchers ignore this darker side of the mycorrhiza. Theoretically, mycorrhiza 

can also harm biodiversity. In the long run, specific mycorrhizas can 

promote the growth of one plant at the expense of another.“What exactly happens 

probably depends on the system itself,” states Van der Heijden (2002). In 

any case, the interaction between plants and mycorrhiza forming fungi clearly 

has at least as great an effect on the ecosystem’s species composition as the 

interaction/competition between plants themselves. 

P. indica, the fungus treated in this chapter, acts as biofertilizer, bioregulator 

and bioprotector, and can be easily mass-multiplied on defined synthetic 

media. It is thus, an interesting model fungus with respect to studies on 

endomycorrhiza. In addition, commercial production of this fungus under 

aseptic conditions could support biological hardening of tissue-cultureraised 

plants as well as plant survival in general on poor soils. 

Acknowledgements. The Indian authors are thankful to DBT, DST, CSIR, UGC, and the 

Government of India for partial financial assistance. 


Ahuja MR (1986) In: Evans DA, Sharp WR and Ammirato PJ (eds) Handbook of plant 

cell culture 4, techniques and applications. Macmillan, New York, pp 626–651 

Badoni RJ (1972) Terrestrial occurrence of some aquatic Hyphomycetes. Can J Bot 

50:2283–2288 

Galloway LD, Burgess R (1952) Applied mycology and bacteriology, 3rd edn. Leonard 

Hill, London, pp 54–57 

Herrmann S, Munch JC, Buscot F (1998) A gnotobiotic culture system with oak microcuttings 

to study specific effects of mycobionts on plant morphology before, and in 

the early phase of, ectomycorrhiza formation by Paxillus involutus and Piloderma 

croceum. New Phytol 138:203–212


Johnson CN, Stout PR, Broyer RC, Carlton AB (1957) Comparative chlorine requirements 

of different plant species. Plant Soil 8:337–353 

Kaefer E (1977) Meiotic and mitotic recombination in Aspergillus and its chromosomal 

aberrations. Adv Genet 19:33–131 

Kottke I, Guttenberger M, Hampp R, Oberwinkler F (1987) An in vitro method for establishing 

mycorrhizae on coniferous tree seedlings. Trees 1:191–194 

Martin JP (1950) Use of acid, rose bengal and streptomycin in the plate method for estimating 

soil fungi. Soil Sci 69:215–232 

Marx, DH (1969) The influence of ectotrophic mycorrhizal fungi on the resistance of 

pine roots to pathogenic infections. I. Antagonism of mycorrhizal fungi to root pathogenic 


Moser M (1960) Die Gattung Phlegmacium. J Klinkhardt, Bad Heilbrunn, Austria 

Mukerji KG, Mandeep, Varma A (1998) Mycorrhizosphere microorganisms: screening 

and evaluation. In: Varma A (ed) Mycorrhiza manual. Springer, Berlin Heidelberg 


Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassay with 

tobacco tissue cultures. Physiol Plant 15:431–487 

Schüßler A, Schwarzott D, Walker C (2001) A new fungal phylum, the Glomeromycota: 

phylogeny and evolution. Mycol Res 105:1413–1421 

Singh An, Singh Ar, Kumari M, Rai MK,Varma A (2003a) Biotechnological importance of 

Piriformospora indica Verma et al. a novel symbiotic mycorrhiza-like fungus: an 

overview. Indian J Biotechnol 2:65–75 

Singh An, Singh Ar, Kumari M, Kumar S, Rai MK, Sharma AP and Varma A (2003b) 

Unmassing the accessible treasures of the hidden unexplored microbial world. In: 

Prasad BN (ed) Biotechnology in sustainable biodiversity and food security. Science 

Publishers, Inc. Enfield, NH, USA, pp 101–124 

Van der Heijden MAG (2002) Arbuscular mycorrhizal fungi as a determinant of plant 

diversity: in search for underlying mechanisms and general principles. In: Van der 

Heijden MGA and Sanders IR (eds) Mycorrhizal ecology. Ecological Studies 157. 


Varma A,Verma S, Sudha, Sahay NS, Franken P (1999) Piriformospora indica,a cultivable 

plant growth promoting root endophyte with similarities to arbuscular mycorrhizal 

fungi. Appl Environ Microbiol 65:2741–2744 

Varma A, Singh A, Sudha, Sahay NS, Sharma J, Roy A, Kumari M, Rana D, Thakran S, Deka 

D, Bharati K, Hurek T, Blechert O, Rexer KH, Kost G, Hahn A, Hock B, Maier W, Walter 

M, Strack D, Kranner I (2001) Piriformospora indica: An axenically culturable 

mycorrhiza-like endosymbiotic fungus. In: Hock B (ed) Mycota IX. Springer, Berlin 


Varma A, Singh A, Sudha, Sahay NS, Kumari M, Bharti K, Sarbhoy AK, Maier W, Walter 

MH, Strack D, Franken P, Singh An, Malla R, Hurek T (2002) Piriformospora indica:A 

plant stimulator and pathogen inhibitor arbuscular mycorrhizal-like fungus. In: 

Markandey DK, Markandey NR (eds) Microorganisms in bioremediation. Capital 

Publishing Company Ltd., New Delhi, pp 71–89 

Verma S, Varma A, Rexer KH, Hassel A, Kost G, Sarbhoy A, Bisen P, Bütehorn B, Franken 

P (1998) Piriformospora indica gen. et sp. nov., a new root-colonizing fungus. Mycologia 

90:895–909

Subject Index 

A 

AAD 590 

Abies (fir) 151 

Abiotic factors 26 

Abrus precatorius 243 

Abscisic acid 88 

ABTS 261 

Acacia sp. 113 

Acacia catechu 243 

A. holoseriaca 201 

A. nilotica 243 

ACC deaminase 133, 489, 494 

Acetobacter 83,198, 200 

Acetyl CoA acetyltransferase 590 

Achnatherum 158 

Acid phosphatase 337, 606 

Acidic heteropolysaccharide 505, 516 

Acremonium 89 

Actin 230 

Actin cap 304 

Actin genes 297 

Actin-GFP 318 

Actinomycetes 59 

Actinomyces 73, 89 

Actinomycetes 127, 203 

Actinorhiza 2, 80 

Adhatoda vasica 77, 243, 247 

Adhesion pad 219 

Aequorea victoria 438 

Aerenchyma 36 

Aerobacter 73 

Aeromaonas 73, 89 

AFLPs 10, 551, 556 

Agaricus 73, 402, 412, 415 

A. bisporus 90, 597 

Agglutination 24 

Agrobacterium 82, 88, 420, 421 

A. tumefasciens 3, 121, 124 

Agrostis hiemalis 163 

Alcaligenes eutrophus 63 

Aldehyde dehydrogenase 580 

Alternaria 73, 89 

Alkaline phosphatase 335, 337 

Allelochemicals 82 

Alnus 81 

AM colonization 78 

AM fungal symbiosis 591 

Amanita gemmata 260 

A. muscaria 5, 7, 203, 260, 597 

A. rubescens 260 

A. spissa 260 

A. strobiliformis 260 

AMF 262 

AMF-like 597 

1-Aminocyclopropane-1-carboxylic acid 

(ACC) 4 

Aminotransferase 397, 417 

Ammonifier 56 

Ammonium transport 399 

AMOVA 562 

Amplifier rDNA restriction analysis 75 

a-Amylase 124 

Amylolytic 128 

Amyloplasts 301 

Anabaena 73 

Anaerobic stress 74 

Anastomoses 593 

Aneura pinguis 242, 243 

Annoxic sites 2 

Antagonists 361 

Anthyllis cytisoides 359 

Antibiotic resistance marker cassette 

460 

Antibiotics 201

616 

Subject Index 

Antifungal activity test 434 

Antiport 413 

Apoplast 165, 380 

Apoplastic space 164 

Apoptosis 582 

Arabidopsis thaliana 3, 243, 256, 399, 

Arabinose 173, 602 

Arbuscular mycorrhiza 60, 185, 567 

Arbuscule 308, 310, 567 

Archaea 41 

Artemisia annua 243, 247 

Arthrobacter globiformis 63, 82, 89 

Arum-type mycorrhizas 334 

Ascomycetes 76 

Asparagine 604 

Aspergillus eutrphus 64 

A. globiformis 64 

A. flavus 240 

A. muscaria 203 

A. nidulans 580, 590 

A. niger 85, 240 

A. sydowii 240 

A. terreus 580 

A. tubingensis 85 

Asymbiotic phase 579 

Atkinsonella hypoxylon 160, 164, 166 

ATP 575 

dATP 582 

32p-dATP 585, 588 

Aureofungin 88 

Autofluorescent proteins 8, 18, 431, 438 

Automated sequencer 579 

Autotrophic organisms 65 

Auxin 4, 88, 315 

Auxin-type phytohormones 355 

Axenically 237 

Azadirachta indica 243, 247 

Azoarcus 83 

Azorhizobium 82, 531 

Azospirillum 73, 83, 200, 239, 355, 360 

A. brasilense 89, 455 

Azotobacter 73, 82, 83, 198 

A. choroococcum 84 

B 

Bacillus 2, 63, 73, 83, 198 

B. cereus 127, 128 

B. geophilum 203 

B. megaterium 127 

B. subtilis 3,127, 239 

B. thuringiensis 4, 121, 535, 540 

B. thuringiensis subsp. Galleriae 127 

B. thuringiensis var kurstaki 126 

Bacteria fungi interaction 197 

Bacopa monniera 243, 247,248 

Bacterial extraction method 457, 460 

Bacterial morphotype 531, 532 

Balansia sp. 158 

Basidiomycetes 76, 260, 267 

Basidiomycota 595 

Beauvaria sp. 597 

Beijerinckia sp. 73, 83 

b-galactosidase 19, 576 

b-1,3-glucanase 82 

b-glucosidase 87 

b-glucuronidase 19 

b-importin 590 

Bi Dye cycle sequencing kit 579 

Biocontrol 432 

Biodegradation 74 

Biofertilizer 613 

Biofilm 154 

Biogeochemical 74 

Biogeochemical cycles 51, 64 

Biogeography 541-542 

Bioindicators 54 

Bio-insecticide protein 4 

Bio-insecticides 121, 122 

Biological control agents 361 

Biological hardening 613 

Biomass production 245 

Bioprotector 613 

Bioregulator 613 

Bioremediation 206 

Biosurfactant 153 

Biotic factors 26 

Biotic signals 2 

Biotin 106 

Biotrophic 159 

Biotrophs 157 

BiP protein 590 

BLAST 579 

BLAST analysis 581 

BLASTX 580, 581 

BLASTX alignment tool 579 

Blue fluorescent protein (BFP) 441 

BM25.8 cells 577 

Boletinus cavipes 260 

B. edulis 260 

B. erythropus 260 

Boletus luridus 260 

B. piperatus 260 

Borrelia burgdorferi 4 

B. burgdorferi B31 3

Botanophila 171 

Bradyrhizobium 73, 82, 238 

B. japonicum 2, 3 

Brassica juncea 255 

B. oleracea 255 

Brassicaceae 76 

Brevibacterium 89 

Brightfield microscopy 510, 519, 524 

Bryophyte 242 

BSA 569 

Bt toxin 181, 184 

BT transgenic plants 4 

Bt-maize 122 

B-transducin 590 

Bt-transgenic plants 121 

Bulk soil 197, 450, 459, 464 

Burkholderia 82, 198, 200, 201 

B. cepacia 201 

Burkholderia-like bacteria 358 

C 

Caenorhabd iris elegans 580 

Calcium oscillations 112 

cAMP 376 

Candida sp. 89 

C. albicans 597 

Capsule 506, 508, 512, 513 

Carboxytates (complexone) 90 

Cassette vector 440 

Cassia angustifolia Vahl 243 

Casuarina sp. 81 

Casuarinaceae 81 

Catabolic diversity 73 

Catabolic response profile (CRP) 73 

Catecholate siderophores 90 

Cauliflower mosaic virus 124 

Caullinite 125 

Cdc2a kinase 316 

Cdc42 306 

Ceanothus 81 

Cell attachment 505, 508 

Cell cycle switch protein 580 

Cell division 314 

Cell motility 505, 527-528 

Cell wall 303 

Cellobiohydrolase 87, 88 

Cellular interaction 267 

Cellulase 54, 80,522 

Cellulolytic fungi 86 

Cellulomonas sp. 82 

Cenococcum sp. 393, 410, 416 

Cephalozia biscuspidata 242 

Subject Index 617 

Cercospora 89 

Chalamydospores 237, 594 

Charge couple device (CCD) 439 

Chemo-heterotrophic 122 

Chenopodiaceae 76 

Chitinase 82 

Chlamydia tracchomatis 3, 4 

Chlamydomonas reinhardtii 239 

Chlorobium sp. 73 

Chlorophytum borivillianum 243, 247 

C. tuberosum Baker 243 

Cholesterol 124 

Chromaspin-400 Columns 573 

Chum synthase I 590 

Cicer arietinum 245 

C. borivillianum 247 

C. purpurea 174 

C. sinensis 158 

Citrobacter sp. 89 

Cladosporium sp. 89, 597 

Clathrin adapter protein 590 

Clavicipitaceae 4, 158 

Clavicipitaleans sp. 157 

Clostridium sp. 73 

CMC-ase 261 

CMEIAS 9, 531, 544 

Co-cultivation 252 

Co-culture 252 

Coffea arabica 243 

Coils 567 

Colacogloea peniophorae 269 

Colacosomes 6, 268 

Collectotrichum 287 

Colonization 149, 242 

Community level physiological profile 

(CLPP) 463 

Competitive colonisation 17 

Computer-assisted microscopy 526, 

528, 530, 544 

Confocal laser scanning microscopy 

(CSLM) 8, 355, 451, 509, 540, 543 

Contact angle 471, 472 

Coprogen 90 

Coralloid 595 

Cordyceps militaris 158 

Cordycipitoideae 158, 159 

Cortical microtubules 298 

Cortinarius varius 260 

Crack entry 510, 531 

cry genes 124 

Cry protein 123, 124 

Cry1Ab toxin 125

618 

Subject Index 

Cryosection 317 

Cultivation 595 

Culturability 449 

Cunninghamella 240 

C. echinulata 597 

Cuticle 211, 221, 471 

Cuticular penetration 481, 482 

Cuticular permeability 149, 153, 479 

Cuticular transport 479 

Cuticular wax 147, 473, 474 

Cu-Zn Superoxide dismutase 580 

Cyan fluorescent protein (CFP) 441 

Cyathus 85 

Cyclic glucans 109 

Cyclic trihydroxamate 90 

Cyclin 315 

Cycloheximide 433, 440 

Cylindrocarpon sp. 201 

Cymbopogon martinii 243 

32p-dCTP 585, 588 

Cynodon dactylon 595 

Cyperaceae 76 

Cysteine-rich proteins 219 

Cytidindeaminase 580 

Cytokinin 88, 89, 170 

Cytoplasmic streaming 300 

Cytoskeletal organization 308 

Cytoskeleton 6, 505, 516, 527, 529 

Czapek-Dox medium 435 

D 

Dactylorhiza majalis 243 

D. incarnata 243 

D. maculata 243 

D. majalis 246 

D. purpurella 243 

D. fuchi 243 

D. purpurella 246 

Dalbergia sissoo 252 

Damping off seedling 157 

DAPI 458, 594 

Darkfield microscopy 525, 527 

Daucus carota 243, 259 

dCTP 582 

Deciduous trees 596 

Decomposer 74 

Decomposition 74 

Dehydrogenisation 54 

Deionized H20 574 

Deleterious rhizosphere organisms 352 

De-mineral 65 

Denaturant gradient gel electrophoresis 

(DGGE) 75 

Dendrobium crumenatum 580 

Denhardt’s solution 586 

Denitrifiers 72 

Denitrifying bateria 72 

Dephosphorylated l TriplEx2 vector 

574 

Depolymerisation 54 

Derxia sp. 83 

Desferriform 89 

Desmostachya sp. 77 

Desulfovibrio sp. 73, 83 

DGGE-finger printing 461, 462 

dGTP 582 

Diazotrophic baterial 157 

Diglycosyl diacylglycerol glycolipid 508 

Dikaryotic hyphae 296 

Di-potassium hydrogen phosphate 606 

Discosoma sp. 441 

Disease index 27 

Diterpenoid acids 88 

Differential expression 590 

cDNA 569, 573 

– clones 568 

– DNA library 569, 577 

– DNA polymerase mix 569 

– DNA probes 584, 585, 588 

– DNA synthesis 569 

DNA concentration 553 

DNA polymerase 572 

DNA sequencher 579 

16s rDNA sequense analysis 8 

DNA-hybridization 75 

DNAse 569 

dNTPs 569, 578, 584 

Dolipores 595 

Double-Stranded adapters 552 

Double-stranded cDNA 569 

Douglas fir 414, 415 

Drosophila melanogaster 580 

Dsc DNA 585 

DsRed 441, 442, 456 

DTT 584 

Dual colour imaging 440 

Dynactin complex 312 

DynamicET cycle sequencing kit 579 

Dynein 310, 312 

E 

Ecological significance 393 

Ecological specificity 332

Ectendomycorrhizas 76 

Ectomycorrhizal fungi 597 

Ectomycorrhiza 5, 185, 211, 295 

Ectomycorrhizal ascomycetes 261 

Ectomycorrhizas 567 

Ectorhizosphere 8, 450, 458, 464 

Elaeagnceae 81 

Eleagnus sp. 81 

Electrophoresis 579 

Electroporation 124 

E-MAP-115 590 

Endo-b-1,6-glucanase 164, 165 

Endocellulase 87 

Endochitinase 164 

Endomycorrhiza 296, 613 

Endomycorrhizal fungi 261, 597 

Endopeptidase 580 

Endophytes 6, 355 

Endophytic hyphae 162 

Endophytic mycelium 160 

Endorrhizosphere 8, 450, 458, 464 

Enterobater sp. 73 

E. agglomerans 84 

Entomopathogenic 164 

Environmental fitness 460 

Enzymatic isolation 476 

Epacridaceae 79 

Ephelidial conidia 169 

Epichloe festucae 158 

E. typhina 157 

E. clarkii 157 

Epicuticular wax 148 

Epidermal eroded pits 522, 524 

Epifluorescence 8, 431, 594 

Epiphyllic microflora 150 

Epiphyllic microorganisms 9, 473, 477 

Epiphyllous mycelium 160 

Epochloe sp.158 

Epolionts 157 

Equimolar concentrations 606 

Ergot alkaloids 168 

Ergovaline 168 

Ericaceous host plant 80 

Ericaceous mycorrhizas 76 

Ericaeae 79 

Ericoid fungi 80 

Ericoid mycorrhizal fungi 73, 80 

Erwinia sp. 73, 89 

Escherichia coli 0157:H7,EDI.933 3 

E. coli 0157:H7, Sakai 3 

E. coli XL-I blue 575 

EST 579, 590 


EST clones 581 

Estrogenic activity 106 

Ethylene 4, 88, 134, 489, 492 

Eurhynchium praelongum 242 

Exoenzymes 58 

Exo-poly-saccharides 110, 355 

Expressed Sequence Tags (ESTs) 10, 568 

Extracellular microfibrils 508, 526, 527 

Extraradical 360 

Extragenic palindromic- PCR 10 

Extramatrical 246 

Extraradical hyphae 78, 358 

Extraradical mycelia 199 

Exudate 197 

F 

Fahraeus slide culture 504, 506 

FASTA format 579 

Fatty acid methyl ester profiling (FAME) 

75 

Fatty acid methyl esters (FAME) 463 

Fatty acid-derived signals 105 

Ferrated siderophore 89 

Ferribacterium 73 

Ferrichrome 90 

Ferricrocin 90 

Festuca arizonica 157 

F. versuta 158 

Fimbriae 355 

Fingerprinting techniques 75 

First strand buffer 569 

Flavanoids 102, 105 

Flavobacterium 73, 82, 89 

Flourescent in situ hybridization (FISH) 

8 

Fluorescent pseudomonads 72 

Fluorescence in situ hybridization (FISH) 

75, 449, 453, 460 

Fluorescence marker-tagged bacteria 

449, 456 

Fluorescence microscopy 510, 520, 525, 

530, 553 

Fluorescent-activated cell sorters (FACS) 

439 

Fluorometers 569 

Frankia sp. 73, 80 

Fructose 374 

Fructose 2,6-bisphophate 376 

Functional Genomic Approaches 567 

Fungal sheath 379 

Fungicide cycloheximide 433 

Fusarinines (fusigens) 90

620 

Subject Index 

Fusarium sp. 73, 89 

F. culmorum 87 

F. moniliforme 201 

F. solani 597 

F. oxysporum 78, 201, 435 

F. oxysporum f.sp radicis-lycopersici 

431 

Fusion mycoparasites 275 

fusion-interaction 275 

G 

Gaeumannomyces sp. 5 

G. graminis 240 

Gametophyte 242 

Gas vascular transport 38 

Gel electrophoresis 569 

Gelatin 578 

Geldanamycin 82 

Gene expression profiling 568 

Gene pool 72 

Gene regulation 385 

Genetically modified plants (GMP) 4, 

179,196 

Genomenet 579 

Genomes 567 

Genomic DNA 10 

Geostatistics 532, 540, 544 

Germination 246 

Gfp half-life 441 

Gibberella 73, 89 

Gibberellins (GA) 88 

Gigaspora decipiens 332 

Gi. margarita 333, 356, 580 

Gi. gigantia 597 

Gliocladium 90 

Glomales 332 

Glomeromycota 353 

Glomus sp. 396, 409 

G. caledonium 597 

G. clarum mycelia 62 

G. clarum 78 

G. coronatum 597- 

G. deserticola 79 

G. etunicatum 26, 261 

G. fasciculatum 78, 333 

G. geosporum 597 

G. intraradices 63, 78, 597 

G. invermaium 334 

G. lamellosum 597 

G. mosseae 63, 248, 376, 597 

G. proliferum 597 

Glucose 602, 604 

Glucosinolates 76 

Glutamate dehydrogenase (GDH) 397, 

409, 410, 414, 416, 417 

Glutamate synthase (GOGAT) 397, 410, 

413, 415, 418 

Glutamine 604 

Glutamine synthetase 397, 408, 410, 

412, 420 

Glutathione S transferase 580 

Glycine max 243, 255 

Glycogen 377, 572, 574 

Glycolysis 376 

Gnotobiotic bioassay 435 

Gnotobiotic system 14 

Gnotobiotic test 8 

G-protein coupled receptor 305 

Gram-positive bacteria 459 

Green fluorescence protein (GFP) 456 

Green fluorescent protein (GFP) 355, 

438 

Griseofulvin 88 

Growth factors 106 

Gymnosporangium 88 

H 

Haemocytometer 435 

Hansenula 396, 407, 409 

Hartig net 221, 379 

Hartig net formation 5 

Haustoria 6, 165 

Heat shock protein HSS1 580 

Hebeloma 395, 397, 398, 415, 421 

H. crustuliniforme 260 

H. edurum 260 

H. hiemale 260 

H. sunapizans 260 

Hedera (ivy) 151, 475 

Helper bacteria 198, 200 

Hemicellulases 80 

Herbaspirillum 83, 198, 200 

Herbicide-resistance 179, 180 

Heterothallic 595 

Heterotrophic 57, 599 

Hexose transporter 375 

Hexose gradient 379 

Hierarchical clustering 579 

High-throughput sequencing 567 

Histidine 604 

Histone H4 580 

Homeobox genes Hox-2.6 590 

Homo sapiens 580, 590 

Homogenous 255

Horizontal gene transfer (HGT) 4, 191 

Horizontal growth station 505 

Host lectin 505, 513 

Hosts 268 

Humus 53 

Hyaline 593 

Hybridization 569 

Hybridization analysis 584 

Hybridization hypothesis 172 

Hydanthocidin 82 

Hydrolytic Enzymes 164, 165 

Hydrophobin 220 

Hydroponics 432 

Hydroxamate 90 

Hydroxamate siderophores 90 

Hydroxyapetite 84 

Hymenomycetes 595 

Hymenoscyphus ericae 79 

Hyperdermium sp. 159 

Hyperdermium bertonii 159 

Hypertrophied 166 

Hypha 238, 269, 593 

Hyphal attachment 218 

Hyphal tip 311 

Hyphosphere 61, 197, 358 

Hypocrella sp. 159 

H. africana 159 

H. gaertneriana 159 

H. schizostachyi 159 

I 

Image analysis 526, 544 

Immunoelectron microscopy 509, 517 

Immunofluorescence labelling 449, 453 

Immunofluorescence microscopy 6 

In situ gene expression 525, 526 

In situ microbial ecology 504, 529, 544 

Incubation 251 

Indigenous microflora 503, 530, 535 

Indirect immunofluorescence 

microscopy 298 

Infection process 504, 529 

Infection-related biological activity 

505, 516, 520 

Inflorescence primordium 166 

Inflorescens 248 

Inhibitory zone 434 

Inoculation 251 

Interface 270 

Intergenic spacer (IGS) region 462 

Intergrin-adhesion-receptor 2 

Internal transcribed spacer (ITS) 75 

Interhyphal spaces 200 

Interwoven 593 

Intracellular 238 

Intracellular acid phosphatase 606 

Intraradical hyphae 335, 337 

Introns 567 

Ion transport 568 

IPTG 576 

IRS 1-like protein 590 

Isocitrate lyase 580 

Isoflavonoids 102 

Isolated cuticle 475, 476 

Isolation of bacillus 434 

Isolation of pseudomonads 433 

ITS 551 

ITS-RFLP 559 

J 

Juglans sp. 146 

Juncaceae 76 


K 

Kanamycin resistance 187, 188 

Kinases 124 

Kinesin 309, 311 

Kinetin 170 

Klebsiella 83, 89 

L 

Laccaria 395, 410, 412, 414, 416, 421 

L. amethystea 212 

L. amethystina 260 

L. bicolor 201, 581, 590 

L. proxima 201 

Lactarius delicious 260 

L. deterrimus 260 

L. necator 260 

L. rufus 260 

L. subdulcis 200 

L. torminosus 260, 597 

L. vellereus 200 

Lac tonohydrolase 590 

Lactose mannose 602 

Lambda zap 569 

Laminar flow hood 576 

Larix decidua 200 

LB agar 576 

LB/Carbenicllin plates 577 

LB/MgSO4 agar 576 

LbAut7 590 

LCO receptor 112 

Leaf surface 145, 471

622 

Subject Index 

Leaf surface colonisation 483, 485, 486 

Leaf surface roughness 148 

Leaf surface wetting 150 

Lecaythidaceae 76 

Leccinum scabrum 260 

L. versipelle 260 

Lectin 124, 505, 508 

Lentinula edodes 580, 597 

Leptothrix sp. 73 

Ligation 572, 574 

Ligninases 80 

Lignin-rich organic 79 

Lignins 287 

Lignocellulolytic enzyme activity 86 

Lignocellulolytic Microorganisms 85 

Lipase 82 

Lipochitooligosaccharides 2 

Lipooligosaccharide Nod factor 505, 

526 

Lipopolysaccharide 110, 505, 509 

Long distance PCR 569 

Long root 212 

Lotus japonicus 337, 339 

Luteolin 104 

Lycopersicon escuslentum 248 

LZK protein kinase 590 

M 

Macroarray mycorrhizal symbiosis 590 

Macroarray techniques 10 

Macrofauna 129 

Malate synthase 590 

MALDI-TOF 203 

Maleylacetale isomerase 2 580 

Maltase 54 

Mangrove plants 76 

Mannitol 199 

MAP 309 

Maturation time 442 

Medicago arborea 361 

M. sativa 361, 580 

M. truncatula 336, 339 

Mesorhizobium sp. 82 

M. loti 2, 3 

M. mediterraneum 854 

Metabolization of flavonoids 104 

Methane cycle 35 

Methane oxidation 37 

Methane production 38 

Methannobacterium thermoautotrophicum 

3 

Methanogens 2, 35, 72 

Methanosarcina mazei 3 

Methanotroph 2, 44 

Methylcellulose 435 

Microaggregates 73 

Microarrays 568, 584, 568 

Microbial communities 202, 503, 541 

Microbial community analysis 449 

Microbial diversity 71 

Microbiota 123, 351 

Micro-centrifuge 568 

Micrococcus sp. 82, 200 

Microcolony 23 

Microcosm 51, 351, 362 

Microfilaments 293 

Microhabitats 2, 72 

Micro-propagated 252 

Microscopic in situ approach 450, 464 

Microsymbiont 2, 504, 526 

Microtubules 293 

Mineralisation 56 

MMN 239 

Mobilisation 56 

Model of nitrogen uptake and release 

384 

Molecular microscopy 511, 514 

Monilia sp. 89 

Monoclonal antibody 509, 531 

Monocots 25 

Monosaccharides 600 

Montmorillonite 125 

Moraxella sp. 200 

Morchella conica 261 

M. elata 261 

M. escuslenta 261 

Morphotypes 339 

Mucilage 23, 255 

Mucor sp. 89 

Multalin 579 

Multi print replication device 584 

Multiblot replicator 568 

Multiscreen filter plate 583 

Mummifying 166 

Mus musculus 590 

Mussoorie rock phosphate 84 

Mutagenesis 440 

Mycelia 255, 593 

Mycelium 599 

Myc - mutants 342 

Mycobacterium sp. 82 

Mycobionts 262 

Mycoparasites 267 

Mycoparasitic 357

Mycoparasitic activity 165 

Mycoparasitism 165, 274 

Mycorrhiza 2, 197, 247, 255, 613 

Mycorrhiza formation 252 

Mycorrhiza-helper-bateria 357, 360 

Mycorrhizal complex 60 

Mycorrhizal symbiosis 567, 591 

Mycorrhizosphere 61, 197, 199, 358, 

Mycorrhizosphere bacteria 199 

Myosin 307 

MYP 256 

Myrica 81 

Myricaceae 81 

Myriogenospora 166 

M. atramentosa 166 

N 

N-acetyl-D-glucosamine 199 

N-acetylglutamic acid 508 

Naegleria fowleri 580 

NCBI 579 

Necrotic lesions 431 

Necrotrophic 259 

Necrotrophied 158 

Neighbor-Joining 562 

Nematophagous 164 

Neotyphodial conidia 169, 170 

Neotyphodium sp. 157, 158, 164 

N. lolii 174 

N. coenophialum 157, 174 

Neurospora sp. 73, 89, 395, 402, 407 

N. crassa 3, 580 

Nicotiana attenuata 243 

N. tabaccum 243, 248 

Nigericin 82 

Nitrate reduction 405–409 

Nitrate transport 394, 407, 409 

Nitrifying bacteria 72 

Nitrogen cycling 381 

Nitrogen metabolism 568 

Nitrogen status 383 

Nitrogen uptake and translocation 394 

Nitrogenase 86 

Nitrosomonas europeae 3 

Nocardia sp. 73, 89 

Nod factors 2, 107, 108 

nodABC genes 109 

Nomarski interference contrast 

Nonmycorrhizal 77 

Nonmycorrhizal fungi 597 

Nonrecombinant plaques 577 

Nonrhizosphere 82, 197 

Nostoc sp. 73 

Nostoc sp. PCC 7120 3 

Notch trafficking 100 

Nuclear movement 300, 313 

Nylon membrane 584 


O 

Oidiodendron sp. 79 

Oligo dT primer 584 

Oligo nuc1eotide 584 

Oligonucleotide probes 8 

Oligosaccharide 505, 514, 529 

Oligotrophic 124, 129 

Oospores 27,436 

Orchidaceous mycorrhizas 76 

Orchids 246 

Organotrophs 74 

Ornithine carbamoyl transferase 580 

Oryza sativa 243 

O. sativa L. ssp. indica 3 

O. sativa L. ssp. japonica 3 

Ovis aries 580 

Oxidases 124 

P 

Paenibacillus sp. 89 

Parafilm 576 

Parasexual recombination 172 

Parasites 1 

Parenthosomes 595 

Particle bombardment 124 

Pathogen attraction 74 

Paxillus involutus 199, 200, 260, 597 

P. involutus 201 

PCR 569, 583 

PCR anchor primer 585, 588 

PCR buffer 585, 588 

PCR products 584 

PCR reaction mix 583 

PCR reactions 582 

PCR-base approaches 354 

PCR-based techniques 10 

PCR-Fingerprinting 551 

PCR-RFLP 551 

PCR-single-strand conformation polymorphism 

(SSCP) 354 

PCR-temperature gradient gel electrophoresis 

(TGGE) 354 

Pectin 222 

Pectinases 80 

Pelotons 247 

Penetration 259, 273

624 

Subject Index 

Penicillium sp. 72,73, 89 

P. bilalii 85 

P. griseofulvum 88 

PEP carboxykinase 590 

Peptidases 54 

Peptide mass fingerprint 205 

Perithecium 168 

Perithiquious flagella 122 

Peroxidase 303, 524, 525, 529 

Pestatoria 89 

Pesticides 113, 122 

Petroselinum crispum 243 

PGPR 82, 355 

Phage buffer 575 

l-phage packaging mix 575 

Phanerochate chrysosporium 590 

Phase-contrast light microscopy 504, 

510, 516, 521, 524, 528 

Phaseolus aureus 245 

pH-dependent regulation 382 

Phenotypes 51,75 

Phenylacetic derivatives 88 

Phenylpropanoids 102 

Phomopsis sp. 287 

Phosphatases 59, 80 

Phosphate 80 

Phosphate-solubilizing microorganisms 

84 

Phosphate-solubilizing rhizobateria 

360 

Phosphate metabolism 580 

Phosphatidylinositol 101 

Phospholipid fatty acid (PLFA) 75 

Phosphor screen 585, 588 

Phosphorimager 569, 585, 588 

Phosphorus-rich soils 613 

Phyllosphere 4, 122, 147, 532, 535, 540 

Phyllosticta 287 

Phylogenetic probes 452 

Phylogenetic relationships 332 

Physiological heterogeneity 380 

Phytoestrogens 105 

Phytohormones 4, 88, 202 

Phytopromotional 245 

Phytotoxins 82 

Picea abies 200, 212 

Piloderma croceum 252 

Pinus pinea 200, 201 

P. resinosa 589 

P. sylvestris 199, 200 

384-Pin dot blot tool 584 

Piriformospora indica 237, 352, 597 

Pisolithus alba 201 

P. tinctorius 201, 220, 261, 597 

Pisum sativum 245, 255, 333 

Plant cell wall architecture 505, 522 

Plant growth promotion 133,137, 489 

Plant litter 373 

Plant survival 613 

Plaque forming units (pfu) 576 

Plasmid miniprep kit 577 

Plasmid vectors 439 

PLFA profiling 75 

Pligotrophic 4 

Poa ampla 164, 174 

Polarized growth 304 

Polarized light microscopy 524, 528 

Poly-A RNA 569 

Polyamies 251 

Polyethylene/CaCl 2 -mediated transformation 

437, 442 

Polygalacturonase 174, 261, 522 

Polymerase chain reaction (PCR) 75 

Polymerises 65 

Polyphenol oxidases 80 

Polyphosphate 335 

Polyubiquitine 580 

Populus tremula 243, 252 

P. tremuloides Michx. (clone Esch5) 243 

Powerscript reverse transcriptase 584 

Prehybridization solution 585, 588 

Pre-mRNA cleavage factor 580 

Primer for RAPD 554 

Primordia 160, 260 

Principal component analysis 562 

Proliferation 248 

Propagules 6 

Prophylactic 361 

Prosopis chilnensis 243 

P. juliflora (Sw.) DC. 243 

Protease 80, 82, 122, 382, 417 

Protease inhibitors 124 

14-3-3 Protein 580 

Proteinase K 572 

Proteobacteria 200 

Proteolytic 67, 128 

Proteome 203 

Protocorm 247, 299 

Protoplasts 79, 437 

Protozoans 56 

Protrusions 604 

Prunus 152 

Pseudomonas 2, 63, 82, 152, 198, 477 

Ps. putida 9, 90, 238, 456

Ps. aeruginosa 3 

Ps. chlororaphis 201 

Ps. fluorescence 2, 198, 238 

Ps. synringae 3 

Ps. chlororaphis 439 

Pseudotsuga menziesii 200 

P-solubilizing bacteria 84 

Puccinia graminis 580 

pVSl 21 

Pyoverdines 90 

Pyoverdine siderophores 90 

Pythium sp. 89 

P. ultimum 435, 436 

Q 

Qiaquick columns 585, 588 

Quantitative microscopy 503, 504 

Quantity one Software 585, 588 

Quercus robur 243, 252 

Quorum sensing 543, 544 

R 

Raffinose 602 

Random primer labeling 585, 588 

RAPD 551, 553 

Ras related protein 590 

Receptor site 514, 522, 529 

Receptor-like kinase 99 

Recombinant plaques 577 

Red fluorescent protein (drFP 583 or 

DsRed) 441 

Red pine 589 

RedTaq DNA polymerase 578, 582 

Regulatory pathways 101 

rep 21 

Reporter constructs 449, 456 

Reporter gene 19 

Restionaceae 76 

Rhamnose 602 

Rhicadhesin 508 

Rhizobacteria sp. 4, 355 

Rhizobium sp. 73, 82, 184, 503, 532,544 

Rhizobium etli 2 

R. meliloti 85, 90 

R. tropici 2 

Rhizobium-legume symbiosis 81, 503, 

529, 533, 534 

Rhizobium-rice association 531,541,542 

Rhizoctonia sp. 73, 85 

R. bataticol 597 

R. solani 157, 256, 597 

Rhizodeposition 67, 126 


Rhizodermal 259 

Rhizodermis 4, 256 

Rhizoids 247 

Rhizoplane 8, 127, 450, 458 

Rhizopogon roseolus 89, 597 

R. vulgaris 597 

Rhizopus sp. 88, 89 

R. microsporus 90 

R. oryzae 240 

R. stolonifer 240 

Rhizosphere 2, 38, 197 

Rhizosphere colonization 352 

Rhizosphere compartments 450, 464 

Rhizosphere interactions 442 

Rhizosphere of a mycorrhizal plant 358 

Rhizosphere/rhizoplane 529, 530, 540 

Rhizosphere-stable plasmid 21 

Rho GTPase590 

Rhythmic 600 

Ribosomal Database 559 

Ribosomal genes (rRNA) 354 

Ribosomal intergenic space analysis 

(RISA) 75 

Ribosomal RNA/DNA 461, 462 

16S ribosomal RNA-directed 8 

16S rRNA gene amplification 355 

Ribosomal sequences 579 

Rice 35 

Rickettsia prowazekii 3 

RNA Extraction buffer 569 

RNAse-fTee DNAse 569 

Robustum 158 

Root 38 

Root colonization 13, 78,450, 533, 540, 

544 

Root exudates 101 

Root exudation 38 

Root hair attachment 505,508, 511, 516 

Root hair deformation 505, 508 

Root hair infection 505, 509, 515, 529 

Root hair infection thread 509, 524, 529 

Root hair tips 111 

Root proliferation 314 

RT reactions 585, 588 

Russula aeruginea 261 

R. foetens 261 

R. violeipes 261 

S 

S238 N 201 

Saccharomyces cerevisiae 3, 580, 597 

S. pombe 590

626 

Subject Index 

Salmon sperm DNA 585, 588 

Salmonella typhimurium 439 

Sapotaceae 76 

Saprobes 69, 287 

Saprophytic fungi 78 

Saprotrophic 79 

Scanning electron microscopy 507, 527 

Scatter plot analysis 589 

Schizophyllum commune 203, 590, 597 

Schizosaccharomayces pombe 3,580, 590 

Scleroderma citrinum 261 

Sclerotinia homeocarpa 158 

S. sclerotiorum 597 

Sc. solani 597 

Scutellospora gilmorei 248, 597 

S. calospora 334 

SDS 586 

Sebacina vermifera 239 

S. vermifera var senu 597 

Secondary metabolites 288 

Seed disinfection 15 

Seed inoculation 17 

Septin Spn3 590 

Serratia 89 

S. liquefaciens 456 

Setaria italica 244, 245 

Sfi I enzyme 573 

Sheered hyphae 162 

Shepherd’s crook 508, 509, 524 

Short root 212, 297 

Short root branching 315 

Siderophores 88, 90, 202, 200 

Signal molecules 106 

Signal perception 111 

Signal transduction 568 

Sinorhizobium sp. 82 

S. meliloti 3, 555 

Small GTPases 305 

SMART cDNA library construction kit 

569 

SMART cDNA synthesis kit 584 

SMART III Oligonucleotide 569 

SMART IV 584 

Sodium alginate 79 

Sodium hypochlorite 15 

Solanum melongena 243, 248 

S. xanthocarpum 77 

Solidification 253 

Sorghum vulgare 243 

Spatial distribution of microbes 

532–544 

Spatial isolation 73 

Specific efflux mechanisms 80 

Spectrophotometer 569 

Spermatia 165 

Spilanthes calva 243, 248 

Spinacia oleracea 255 

Spitzenkörper 311 

Spliceosome-associated protein 580 

Sporocarps 200 

Sporobolus sp. 77 

Sporodochia 169, 170 

Sporulation 255, 598 

sscDNA 585, 588 

sss (site-specific recombinase) 25 

sta 21 

Staphylococcus 200 

S. hycius 90 

Stomates 145 

Straw 40 

Streptomyces sp. 73, 82, 89 

Streptoverticillium cinnamoneum 88 

Styela plicata S 580 

Suberin layer 214 

Substrate utilization profile 463 

Subunit G of vacuolar ATP synthase 

580 

Sucrose 602, 604 

SUG1 subunit 8 590 

Sugar regulation 377, 378 

Suillus bovinus 199, 203 

S. granulatus 201, 261 

S. grevillei 200, 261 

S. luteus 261 

S. variegatus 597 

Sulfate-reducers 72 

Superscript II 569 

Survival 245 

Suspension 256 

Symbionts 1 

Symbiosis 60, 295, 567 

Symbiosis-specific manner 79 

Symbiosome membrane 99 

Symbiotic communication 114 

Symbiotic fungi 60 

Symbiotic hyphal growth 306 

Symptoms 242 

SYMRK 99 

Synchytrium sp. 88 

Synergistic microbial interactions 360 

T 

TAE agarose gel 583 

TAE buffer 583

T4 DNA ligase 575 

Tagetes erecta 243, 248 

Tagging bacteria 439 

TAMRA 558 

Taq DNA polymerase 585 

Tectona grandis 243 

TEF 590 

Tephrosia purpurea 243 

Terminal restriction fragment length 

polymorphism (T-RFLP) 75 

Termnalia arjuna 243, 247 

Thermal cycler 568, 569 

Thiobacillus sp. 73 

Tissue permeabilization 317 

Tissue-culture 613 

Titration 577 

Tn7 440 

TnSlacZ 17 

Tomato foot and root rot 431 

Tomycocol 274 

Transformation 124 

Transcriptional factor StuA 580 

Transcriptional regulation 582 

Transformation of fungi 437 

Transgenic manipulation 79 

Transgenic plants 121, 124 

Transition zone 301 

Trans-Kingdom 158 

Transmission electron microscopy 509, 

512, 522 

Transpiration 149 

Transplants 253 

Transporter 80, 375 

Transposon vectors 439 

Trehalase 199, 374 

Tremelloid haustoria1 cells 275 

Tricalcium phosphate 84 

Tricarboxylic acid cycle 54 

Trichoderma sp. 73, 83 

T. harzianum 85, 86, 164 

T. viride 87 

Tricholoma imbricatum 261 

T. lascivum 261 

T. scaplpturatum 261 

T. subannulatum 261 

T. ustaloides 261 

Trifolium alexandrium 78 

T. repens 85, 333 

Truncated genes 124 

Tryptic soy agar (TSA) 433 

Tryptic soy broth (TSB) 435 

dTTP 582 

Tuber sp. 261 

Tubulin expression 294 

a-Tubulin 590 

Tubulin genes 294 

Tubulin-GFP 318 

Type III secretion systems 113 

U 

Ubiquitinine-1 124 

Ultrastructure 211 

Unstable gfp 441 

UPGMA 562 

Ustilago sp. 88 

U. maydis 590, 597 

Utilization of proteins 417, 418 

UV-crosslinker 584 

V 

Vacuolar motility 313 

Vacuum manifold 583 

Verticillium sp. 89 

Vicia faba 342 

Video microscopy 505, 527, 528 

Vigna radiata 245 

Vip proteins 124 

Viridochromogenes 82 

Virulence factor 123 

Virulent root 240 

Vitamins 106 

W 

Wall-degrading enzymes 262 

Water permeability 480 

Waters AccQ. Tag Method 9 

Well 96-PCR plates 582 

Wetting 472 

Wilcoxon-Mann-Whitney V-test 18 

Withania somnifera 243, 247 

WPM 253 

X 

Xanthomonas campestris 3 

Xenopus laevis 590 

Xerocomus chrysenteron 261 

X. subtomentosus 261 

X-gal 576 

Xylanase 261 

Xylene cyanol 573 

Xylose 173, 602 

Subject Index 627

628 

Subject Index 

Y 

Yellow fluorescent protein (YFP) 441 

Yersinia pseudotuberculosis 439 

Z 

Zea mays 78, 244, 245 

Zizyphus nummularia Burm. fil. 243 

Zoosphere 361 

Zygomycota 596 

Zygomycotina 76 

Zygophylaceae 76

plant surface microbiology.pdf

Create successful ePaper yourself

Delete template?

Save as template?