Biodiversitas vol. 13, no. 2, April 2012 by Biodiversitas Unsjournals

ISSN: 1412-033X E-ISSN: 2085-4722

Journal of Biological Diversity V o l u m e

1 3

–

N u m b e r

–

A p r i l

2 0 1 2

ISSN/E-ISSN: 1412-033X (printed edition) 2085-4722 (electronic)

EDITORIAL BOARD (COMMUNICATING EDITORS): Abdel Fattah N.A. Rabou (Palestine), Alan J. Lymbery (Australia), Bambang H. Saharjo (Indonesia), Daiane H. Nunes (Brazil), Edi Rudi (Indonesia), Guofan Shao (USA), Hassan Pourbabaei (Iran), Hwan Su Yoon (USA), I Made Sudiana (Indonesia), Joko R. Witono (Indonesia), Katsuhiko Kondo (Japan), Livia Wanntorp (Sweden), Mahendra K. Rai (India), María La Torre Cuadros (Peru), Mochamad A. Soendjoto (Indonesia), Shahabuddin (Indonesia), Sugiyarto (Indonesia)

EDITOR-IN-CHIEF: Sutarno

EDITORIAL MEMBERS: English Editors: Suranto, Wiryono (wiryonogood@yahoo.com); Technical Editor & Banking: Solichatun (solichatun_s@yahoo.com) Distribution & Marketing: Rita Rakhmawati (oktia@yahoo.com); Webmaster: Ari Pitoyo (aripitoyo@yahoo.com)

MANAGING EDITORS: Ahmad Dwi Setyawan (unsjournals@gmail.com)

PUBLISHER: The Society for Indonesian Biodiversity

CO-PUBLISHER: Department of Biology, Faculty of Mathematics and Natural Sciences, Sebelas Maret University, Surakarta

ADDRESS: Jl. Ir. Sutami 36A Surakarta 57126. Tel. +62-271-7994097, Tel. & Fax.: +62-271-663375, Email: unsjournals@yahoo.com

BANKING: Solichatun, BNI KC Sebelas Maret, Acc. No. 0033691646

ONLINE: biodiversitas.mipa.uns.ac.id

EXPERTISE AND CORRESPONDING EMAIL OF THE COMMUNICATING EDITORS: GENETIC DIVERSITY: Alan J. Lymbery (a.lymbery@murdoch.edu.au), Hwan Su Yoon (hsyoon@bigelow.org), Mahendra K. Rai (pmkrai@hotmail.com). SPECIES DIVERSITY: Joko R. Witono (jrwitono@yahoo.com), Katsuhiko Kondo (k3kondo@nodai.ac.jp), Livia Wanntorp (livia.wanntorp@nrm.se). ECOSYSTEM DIVERSITY: Abdel Fattah N.A. Rabou (arabou@iugaza.edu), Bambang H. Saharjo (bhsaharjo@gmail.com), Daiane H. Nunes (nunesdaiane@gmail.com), Edi Rudi (edirudi@yahoo.com), Guofan Shao (shao@purdue.edu), Hassan Pourbabaei (hassan_pourbabaei@yahoo.com), I Made Sudiana (sudianai@yahoo.com), Mochamad A. Soendjoto (masoendjoto@gmail.com), Shahabuddin (shahabsaleh@gmail.com), Sugiyarto (sugiyarto_ys@yahoo.com). ETHNOBIOLOGY: María La Torre Cuadros (angeleslatorre@lamolina.edu.pe).

Society for Indonesia Biodiversity

Sebelas Maret University Surakarta

B I O D I V E R S IT A S Volume 13, Number 2, April 2012 Pages: 53-58

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d130201

The conservation of mitochondrial genome sequence in Leucadendron (Proteaceae) MADE PHARMAWATI1,â&#x2122;Ľ, GUIJUN YAN2, PATRICK M. FINNEGAN2 1

Department of Biology, Faculty of Mathematic and Natural Sciences, Udayana University, Kampus Bukit Jimbaran, Bali, Indonesia. Tel.: +62-361-703137, Fax.: +62-361-703137, â&#x2122;Ľemail: pharmawati@hotmail.com 2 School of Plant Biology, Faculty of Natural and Agricultural Sciences, The University of Western Australia, 35 Stirling Highway, Crawley WA, 6009, Australia Manuscript received: 26 February 2012. Revision accepted: 27 March 2012.

ABSTRACT Pharmawati M, Yan G, Finnegan PM. 2012. The conservation of mitochondrial genome sequence in Leucadendron (Proteaceae). Biodiversitas 13: 53-58. Mitochondrial DNA (mtDNA) is useful for developing molecular markers and for studying plant phylogeny. However, its usefulness depends on the degree of detectable sequence variation. In seven species of the genus Leucadendron, PCRRFLP failed to reveal any polymorphisms in seven separate regions of the mtDNA. Sixty-two primer pair - enzyme combinations were used to assay at least 248 restriction sites, resulting in the direct sampling of a minimum of 992 bp across 17,500 bp of mt DNA. The highly conserved nature of the mtDNA sequence in the genus Leucadendron was confirmed by the absence of sequence variation in the 1434 bp mtDNA nad1/B-C intron across these species. Mitochondrial DNA sequences are more highly conserved than the chloroplast DNA sequences in Leucadendron and the mtDNA sequences in many other plant genera. Phylogenetic analysis using this intron sequence was consistent with other phylogenetic analyses in regard to the position of Proteaceae. Key words: Leucadendron, mtDNA, nad1/B-C, PCR-RFLP

INTRODUCTION Leucadendron is a genus of South African Proteaceae that comprises 85 species and 11 subspecies (Williams 1972). Members of the genus have been classified into two sections (Alatosperma and Leucadendron) by Williams (1972) based on fruit characteristics. Leucadendron are successfully cultivated in a number of countries including the United States of America, Australia and New Zealand. In Australia, these plants are popular garden plants and are grown commercially for both the domestic and export cutflower industries. The availability of molecular markers for assessing variation and relatedness of Leucadendron species would greatly aid the development of new hybrids. A thorough understanding on the phylogenetic relationships within Leucadendron requires information from all three genomes. Leucadendron phylogeny has been inferred from sequence analysis of the internal transcribed spacer (ITS) regions of the nuclear rRNA genes (Barker et al. 2004). Chloroplast DNA (cpDNA) variation has also been used to evaluate interspecific relationships in Leucadendron (Pharmawati et al. 2004). Both ITS- and cpDNA- derived phylogenies disagree substantially with the previous morphological classification of Leucadendron species (Williams 1972). The phylogenies based on molecular evidence also differ from one another. To further define the phylogeny of Leucadendron, information from mtDNA would be beneficial.

The use of cytoplasmic DNA sequences as breeding, phylogenetic or phylogeographic markers requires knowledge of the mode of inheritance and the level of sequence variation. In the genus Leucadendron, the chloroplast genome is maternally inherited and contains useful amounts of sequence variation (Pharmawati et al. 2004). In contrast, the mode of inheritance of mtDNA in Leucadendron, as well as the phylogenetic information contained within it, has not yet been examined. In this study, universal primers specific to land plant mitochondrial genomes (Demesure 1995; DumolinLapegue et al. 1997) were tested for their ability to amplify specific mtDNA fragments from seven Leucadendron species. The resulting fragments were subjected to RFLP analysis to evaluate the applicability of this method to the detection of mtDNA sequence variation in Leucadendron.

MATERIALS AND METHODS Plant materials Leaf tissue from Leucadendron discolor Buek ex Meisn, L. eucalyptifolium Buex ex Meisn, L. gandogeri Schinz ex Gandoger, L. laureolum (Lam.) Fourcade, L. procerum (Salisb. ex Knight) Williams, L. salignum Berg and L. uliginosum R.Br were collected from the living collection of the Leucadendron Breeding Program, University of Western Australia (Perth, Australia). Voucher specimens were lodged to Australian National Herbarium, Centre for

B I O D I V E R S IT A S 13 (2): 53-58, April 2012

Australian National Biodiversity Research with voucher number CANB668317, CANB668319, CANB668324, CANB668332, CANB668337, CANB668342 respectively to samples stated above. DNA extraction and electrophoresis DNA was extracted from 0.1 g of leaf tissue using a commercial kit (DNeasy plant mini kit, Qiagen, Clifton Hill, VIC, Australia) according to manufacturer’s instructions. Genomic DNA and DNA fragments were size fractionated by electrophoresis on agarose gels and visualized by ethidium bromide staining (Sambrook et al. 1989). To determine DNA concentration, the ethidium bromide staining intensity of specific bands was compared to that of a range of co-fractionated lambda DNA mass standards (MBI, Fermentas, Hanover, MD, USA). PCR-RFLP analysis Each 25 µL polymerase chain reaction (PCR) assay contained 20 ng DNA template, 16 mM (NH4)2SO4, 67 mM Tris-HCl, pH 8.8, 0.01% (v/v) Tween-20, 1.5 mM MgCl2, 0.3µM each primer (Table 1, synthesized by Invitrogen Life Technologies, Mount Waverley, VIC, Australia), 200 µM each standard dNTP and 1 unit of Taq DNA polymerase (Bioline, Alexandria, NSW, Australia). The program for the thermal cycler (iCycler, Bio-Rad, Regents Park, NSW, Australia) had an initial denaturation step of 4 min at 94 oC, followed by 30 cycles of 45 sec at 94 oC, 45 sec at 47oC to 59 oC (depending on the primers used, Table 1) and 2 to 4 min (depending on the product length, Table 1) at 72 oC, with a final extension step of 10 min at 72 oC. Aliquots of each amplification product were digested singly with AluI, CfoI, HaeIII, MaeI, NdeII, RsaI, TaqI, ThaI (Promega, Annandale, NSW, Australia), HindfI, MspI or MvaI (Roche Diagnostic, Castle Hill, NSW, Australia), but not every fragment was digested with every enzyme. Digestion was for 3 h at 37 oC in 10 µl 1 x buffer (supplied by enzyme manufacturer) containing 2 units of enzyme. DNA sequencing and analysis The PCR-amplified nad1/B-C intron was sequenced directly with dideoxynucleotide chain termination chemistry (BigDye v3.1, ABI, Western Australia) using nad1 exon B-C primer pair (Table 1). The products were separated and analysed by The West Australian Genome Resource Centre. The sequences were deposited in GenBank (Accession numbers L. discolor, DQ250042; L.

eucalyptifolium, DQ250043; L. gandogeri, DQ250044; L. laureolum, DQ250045; L. procerum, DQ250046; L. salignum, DE250047; L. uliginosum, DQ250048). The sequencing data was assembled using AssemblyLIGN (Accelrys, Sydney, Australia) and aligned using ClustalW (MacVector 8.0, Accelrys) software. Multiple sequence alignments generated with ClustalW were used to generate phylogenetic trees using DNApars-PHYLIP (Felsenstein 1989). Sequence diversity was calculated using MEGA4 (Tamura et al. 2007). For comparison, diversity of nad1/BC sequences from Actinidia species was calculated by extracting sequences from GenBank (AJ536471.1; AJ536472.1; AJ536470.1; AJ536469.1; AJ536467.1; AJ536468.1).

RESULTS AND DISCUSSION Seven ‘universal’ PCR primer pairs designed to amplify mtDNA fragments from land plants (Demesure et al. 1995; Domulin-Lapegue et al. 1997) were used in this study. The mtDNA regions evaluated were six introns from the genes encoding subunits 1, 4, 5 and 7 of NADH dehydrogenase and the intergenic region between the rps14 and cob genes (Table 1). After optimizing the reaction conditions, each primer pair robustly amplified a single fragment (Table 1) of 1,500 to 4,500 bp, depending on the primer pair, from Leucadendron genomic DNA. Amplification products from seven Leucadendron species using the nad7/2-3r mtDNA primer pair are shown in Figure 1. The fragments amplified from Leucadendron were similar in size to those amplified from other plants using these primer pairs (Demesure et al. 1995; DumolinLapegue et al. 1997; Vaillancourt et al. 2004). The seven amplified fragments totaled about 17,500 bp of Leucadendron mtDNA, but no length polymorphisms were detected among the seven species. Intergenic and intronic regions were chosen for analysis because these regions of mtDNA are less constrained than their adjacent exons for both overall number of substitutions per site and indels (Laroche et al. 1997), and therefore demonstrate higher rates of polymorphism than the very well conserved exonic regions (Duminil et al. 2002). It was therefore surprising that polymorphisms were not detected.

Table 1. Primers and primer pairs used in this study Primer pair nad1 exon B nad1 exon C nad4 exon 1 nad4 exon 2 rps14 cob nad5/1 nad5/2r nad1/4 nad1/5r nad7/2 nad7/3r nad4/2c nad4/3r Note: aDetermined empirically

Annealing o Temperature ( C) a 57.5 59 59 57.5 47 57 53.5

Extension Time (min)a 2 2 2 3 3 2 4

Approximate product size in this study (bp) 1700 2000 1500 2600 3500 1700 4500

References Demesure et al. 1995 Demesure et al. 1995 Demesure et al. 1995 Dumolin-Lapegue et al. 1997 Dumolin-Lapegue et al. 1997 Dumolin-Lapegue et al. 1997 Dumolin-Lapegue et al. 1997

PHARMAWATI et al. â&#x20AC;&#x201C; Mitochondrial genome of Leucadendron

Figure 1. Amplification of the PCR products from seven Leucadendron species using the nad7/2-3r mtDNA primer pair. The PCR products were separated on a 1.2% agarose gel electrophoresis and stained with ethidium bromide. The lane containing a 1 kb ladder (Promega) is indicated, as are the sizes of selected marker fragments.

In an attempt to reveal mtDNA sequence polymorphisms across species, each PCR product was digested with a battery of restriction endonucleases having four-base recognition sequences. Sixty-two primer pair - enzyme combinations were tested, revealing a total of 248 discernable restriction sites for each species, directly assaying variation at 992 positions within the mtDNA sequence of each species. Despite this level of sampling, no sequence variations or length polymorphisms were detected. The monomorphic profiles of the mtDNA fragments obtained with the nad1 exon B-C - MvaI and nad7/2-3r - HaeIII primer pair - enzyme combinations are representative (Figure 2). The extreme conservation of Leucadendron mtDNA sequence is in sharp contrast to the cpDNA in this genus. In the same species examined here, polymorphisms were

detected in cpDNA with 14 of 33 primer pair - enzyme combinations when a sequence space of 16,800 bp was sampled (Pharmawati et al. 2004). At least 120 restriction sites representing 480 bp of cpDNA sequence were evaluated across the 16,800 bp region, resulting in the identification of seven restriction site polymorphisms and 33 indels. Across the seven species, this is a site polymorphism rate of 1 per 480 bp assayed. In contrast, at least 248 restriction sites, representing 992 bp of sequence across a sequence space of approximately 17,500 bp, were examined in Leucadendron mtDNA by PCR-RFLP. The lack of polymorphism suggests that mtDNA sequences are highly conserved among Leucadendron species, a conclusion that is supported by no polymorphisms within the 1,434 bp nad1/B-C sequence that was determined directly for all seven species of this study. This contrasts strongly to the situation found in other plants. For example, PCR-RFLP analysis of mtDNA intronic regions has been used successfully to detect interspecific polymorphisms in Actinidia (Testolin and Cipriani 1997), Elymus (Sun 2002), Musa (Nwakanma et al. 2003), Vasconcellea (Van Droogenbroeck et al. 2004) and Houttuynia (Wei et al. 2005), and even intraspecific polymorphisms in Quercus robur (Dumolin-Lapegue et al. 1995), Actinidia deliciosa (Testolin and Cipriani 1997), Picea abies (Grivet et al. 1999), Solanum tuberosum (Bastia et al. 2001), Eucalyptus globulus (Vaillancourt et al. 2004) and Buchloe dactyloides (Gulsen et al. 2005). In a study of eight genotypes of Eucalyptus globulus, a mtDNA polymorphism was detected within 7960 bp of sequence space after screening only 36 primer pair-enzyme combinations (Vaillancourt et al. 2004). The number of polymorphisms is expected to be higher when mtDNA evaluation is done across species. For

Figure 2. PCR-RFLP patterns of mtDNA from seven Leucadendron species. Patterns were generated using the primer pair - enzyme combinations of nad1/B-C and MvaI (A), and nad7/2-3r and HaeIII (B). The digestion products were separated on a 3% agarose gel electrophoresis and stained with ethidium bromide. Sizes of selected fragments of the 100 bp ladder (Promega) are indicated.

B I O D I V E R S IT A S 13 (2): 53-58, April 2012

PHARMAWATI et al. – Mitochondrial genome of Leucadendron

example, among 13 Elymus species analysed, polymorphisms were detected within 1600 bp of mtDNA sequence space with two of seven primer-enzyme combinations tested (Sun 2002). The complete inability to detect site variation or indels among seven Leucadendron species with 62 primer pair-enzyme combinations indicates the extreme conservation of mtDNA sequence in this genus. Since mtDNA polymorphisms were not found, the inheritance of mtDNA could not be determined by examining the progeny produced by interspecific crosses. To further investigate the level of sequence conservation in Leucadendron mtDNA, the DNA sequence of the 1.5 kb fragment amplified using the nad1 exon B-C primer pair was determined for each of the seven species. All seven sequences were identical, demonstrating that the mtDNA sequence is very highly conserved across Leucadendron species. The Leucadendron sequence was 95% identical to that of the intron located between exons 2 and 3 of the mitochondrial NADH dehydrogenase subunit 1 gene of Lamprocapnos spectabilis (AY674682), confirming the sequence identity of nad1/B-C. Comparison of the Leucadendron and Lamprocapnos spectabilis sequences revealed that the length of the intron in the seven Leucadendron species tested was 1,434 bp. Each Leucadendron nad1/B-C intron had characteristics typical of plant group II introns. There was a GCGCG motif near the 5’ splicing site and a domain V sequence (GAGCCACATGCAGGGAAACTTGCACGTGTGGTT) near the 3’ splicing site (Chapdelaine and Bonen 1991). Direct sequencing of the nad1/B-C intron showed complete conservation among the seven Leucadendron species examined. The nucleotide diversity (π) among samples was 0 and the over all main distance between samples was also 0. In contrast, the mtDNA nad1B/C sequences from Actinidia species extracted from GeneBank showed nucleotide diversity of 0.312 and the over all main distance between samples was 0.313. The mtDNA nad1/BC intron showed sufficient sequence variation to distinguish among the Cucurbita species and allow the construction of a phylogenetic tree (Sanjur et al. 2002). Moreover, intraspecific sequence variation was detected between C. pepo subspecies, as well as within C. moschata and C. sororia (Sanjur et al. 2002). Leucadendron is a genus which is much younger than other genera in Proteaceae. Using molecular dating, it was reported that Leucadendron evolved 40 millions year ago. (Barker et al. 2007). Actinidia is dated even younger, approximately 20-26 million year ago (Qian and Yu 1991). However, polymorphism in mtDNA of Actinidia was higher. Several repeated motifs within nad1B/C were detected (Chat et al. 2004). This was predicted due to hybridization or introgression event as well as high polyploidization in Actinidia (Chat et al. 2004). Extensive studies on mtDNA of Leucadendron have not been available. This report is the first report on exploration of mtDNA in Leucadendron which shows extreme mitochondrial DNA sequence conservation. The Leucadendron nad1/B-C sequence was compared to that of other plants (Figure 5.3). The most parsimonious

phylogenetic tree shows that Leucadendron (Proteaceae) is most closely related to Lamprocapnos spectabilis (Fumariaceae) and Liriodendron tulipifera (Magnoliaceae). The most parsimonious phylogenetic tree obtained using the nad1/B-C intron sequence showed that Leucadendron is closely allied to Lamprocapnos spectabilis (Fumariaceae) and Liriodendron tulipifera (Magnoliaceae) and is part of a clade that contains the Platanaceae (Platanus occidentalis). Phylogenetic analyses based on rbcL cpDNA sequence data (Chase et al. 1993) and combined rbcL and atpB cpDNA sequences (Drinnan et al. 1994) revealed that Proteaceae was sister to Platanaceae. The result from this study demonstrated that Leucadendron and Platanus are not sister to one another. However, Leucadendron and Platanus are part of the same clade and consensus tree of bootstrapped trees showed that the grouping of Leucadendron to a clade consisting of Laurus, Platanus and Liriodendron was 979.4 times out of 999.99 tress. Thus, this preliminary analysis of phylogeny based on mtDNA sequence data supports the suggestion that the Proteaceae is placed in a clade with Platanaceae as suggested by Chase et al. (1993) and Drinnan et al. (1994). This placement of the Proteaceae differs from the classification by Johnson and Briggs (1975) based on morphological, anatomical and developmental studies which suggested that the Proteaceae were not closely related to any of the major dicotyledonous orders. Further studies using other markers are required to resolve the position of Proteaceae within the angiosperm lineage.

CONCLUSION Evaluation of organellar DNA variation showed that no variation could be detected in mtDNA of seven Leucadendron species tested using PCR-RFLP and sequence analysis. This indicates that mtDNA is extremely well conserved. Comparison with nad1/B-C sequences from other plants with high homology to that of Leucadendron resulted in a phylogenetic tree which shows that Leucadendron is clade to Platanus.

ACKNOWLEDGEMENTS The first author thanks AUSAID for providing a Ph.D. scholarship. We thank Dr. Ralph Sedgley and Ben Croxford (The University of Western Australia) for assistance in plant material collection.

REFERENCES Barker NP, Vanderpoorten A, Morton CM, Rourke JP. 2004. Phylogeny, biogeography, and the evolution of life-history traits in Leucadendron (Proteaceae). Mol Phyl Evol 33: 845-860, Barker NP, Weston PH, Rutschmann F, Sauquet H. 2007. Molecular dating of the ‘Gondwanan’ plant family Proteaceae is only partially congruent with the timing of the break-up of Gondwana. J Biogeogr 34: 2012-2027,

B I O D I V E R S IT A S 13 (2): 53-58, April 2012

Bastia T, Scotti N, Cardi T. 2001. Organelle DNA analysis of Solanum and Brassica somatic hybrids by PCR with ‘universal primers’. Theor Appl Genet 102: 1265-1272. Chapdelaine Y, Bonen L. 1991. The wheat mitochondrial gene for subunit I of the NADH dehydrogenase complex: a trans-splicing model for this gene-in pieces. Cell 65: 465-472, Chase MW, Soltis DE, Olmstead RG, Morgan D, Les DH, Mishler BD, Duvall MR, Price RA, Hill HG, Qui Y, Kron KA, Rettig JH, Conti E, Palmer JD, Manhart JR, Sytsma KJ, Michaels HJ, Kress WJ, Karol KG, Clark WD, Hedren M, Gaut BS, Jansen RK, Kim KJ, Wimpee CF, Smith JF, Furnier GR, Strauss SH, Xiang QY, Plunkett GM, Soltis PS, Swenson SM, Williams SE, Gadek PA, Quinn CJ, Eguiarte LE, Golenberg E, Learn Jnr GH, Graham SW, Barrett SCH, Dayanandan S, Albert VA. 1993. Phylogenetics of seed plants: an analysis of nucleotide sequences from the plastid gene rbcL. Annals Miss Bot Garden 80: 528-580, Chat J, Jáuregui B, Petit RJ, Nadot S. 2004. Reticulate evolution in kiwifruit (actinidia, Actinidiaceae) identified by comparing their maternal and paternal phylogenies. Am J Bot 91: 736-747, Demesure B, Sodzi N, Petit RJ. 1995. A set of universal primers for amplification of polymorphic non-coding regions of mitochondrial and chloroplast DNA in plants. Mol Ecol 4: 129-131. Drinnan AN, Crane PR, Hoot SB. 1994. Patterns of floral evolution in the early diversification of non-magnoliid dicotyledons (eudicots). Plant Syst Evol 8: 93-122, Duminil J, Pemonge MH, Petit J. 2002. A set of 35 consensus primer pairs amplifying genes and introns of plant mitochondrial DNA. Mol Ecol 2: 428-430. Dumolin S, Demesure B, Petit RJ. 1995. Inheritance of chloroplast and mitochondrial genomes in pedunculate oak investigated with an efficient PCR method. Theor Appl Genet 91: 1253-1256, Dumolin S, Pemonge M, Petit R. 1997. An enlarge set of consensus primers for the study of organelle DNA in plants. Mol Ecol 6: 393397. Felsenstein J. 1989. PHYLIP - Phylogeny Inference Package (Version 3.2). Cladistics 5: 164-166. Grivet D, Jeandroz S, Favre JM. 1999. Nad1 b/c intron polymorphism reveals maternal inheritance of the mitochondrial genome in Picea abies. Theor Appl Genet 99: 346-349. Gulsen O, Shearman RC, Vogel KP, Lee DJ, Heng-Moss T. 2005. Organelle DNA diversity among Buffalograsses from the Great Plains

of North America Determined by cpDNA and mtDNA RFLP. Crop Sci 45: 186-192. Johnson LAS, Briggs BG. 1975. On the Proteaceae-the evolution and classification of a southern family. Bot J Linn Soc 70: 83-182 Laroche J, Li P, Maggia L, Bousquet J. 1997. Molecular evolution of angiosperm mitochondrial introns and exons. Proc Natl Acad Sci USA 94: 5722-5727 Nwakanma DC, Pillay M, Okoli BE, Tenkouano A. 2003. Sectional relationships in the genus Musa L. inferred from the PCR-RFLP of organelle DNA sequences. Theor Appl Genet 107: 850-856 Pharmawati M, Yan G, Sedgley R, Finnegan PM. 2004. Chloroplast DNA inheritance and variation in Leucadendron species (Proteaceae) as revealed by PCR-RFLP. Theor Appl Genet 109: 1694-1701. Qian YQ, Yu DP. 1991).Advances in Actinidia research in China. Acta Hort 297: 51-55. Sanjur OI, Piperno DR, Andres TC, Wessel-Beaver L. 2002. Phylogenetic relationships among domesticated and wild species of Cucurbita (Cucurbitaceae) inferred from a mitochondrial gene: Implications for crop plant evolution and areas of origin. Proc Natl Acad Sci USA 99: 535-540. Sun G. 2002. Interspecific polymorphism at non-coding regions of chloroplast, mitochondrial DNA and rRNA IGS region in Elymus species. Hereditas 137: 119-124. Tamura K, Dudley J, Nei M, Kumar, S. 2007. MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 24: 1596-1599, Testolin R, Cipriani G. 1997. Paternal inheritance of chloroplast DNA and maternal inheritance of mitochondrial DNA in the genus Actinidia. Theor Appl Genet 94: 897-903. Vaillancourt RE, Petty A, McKinnon GE. 2004. Maternal inheritance of mitochondria in Eucalyptus globulus. J Hered 95: 353-355. Van Droogenbroeck B, Kyndt T, Maertens I, Romeijn-Peeters E, Scheldeman X, Romero-Motochi J., Van Damme P, Goetghebeur P, Gheysen G. 2004. Phylogenetic analysis of the highland papayas (Vasconcellea) and allied genera (Caricaceae) using PCR-RFLP. Theor Appl Genet 108: 1473-1486 Wei W, Youliang Z, Li C, Yuming W, Zehong Y, Ruiwu Y. 2005. PCRRFLP analysis of cpDNA and mtDNA in the genus Houttuynia in some areas of China. Hereditas 142: 24-32. Williams IJM. 1972. A Revision of The Genus Leucadendron (Proteaceae). Contribution from the Bolus Herbarium No.3. The Bolus Herbarium University of Cape Town, South Africa.

B I O D I V E R S IT A S Volume 13, Number 2, April 2012 Pages: 59-64

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d130202

Isolation and phylogenetic relationship of orchid-mycorrhiza from Spathoglottis plicata of Papua using mitochondrial ribosomal large subunit (mt-Ls) DNA SUPENI SUFAATIâ&#x2122;Ľ, VERENA AGUSTINI, SUHARNO Department of Biology, Faculty of Mathematics and Natural Sciences, University of Cenderawasih (UNCEN), Jayapura 99358, Papua, Indonesia. Tel. +62-967-572116. email: ď&#x201A;Špenisufaati@yahoo.com; verena_agustini@yahoo.com, harn774@yahoo.com Manuscript received: 26 June 2011. Revision accepted: 16 April 2012.

ABSTRACT Sufaati S, Agustini V, Suharno. 2012. Isolation and phylogenetic relationship of orchid-mycorrhiza from Spathoglottis plicata of Papua using mitochondrial ribosomal large subunit (mt-Ls) DNA. Biodiversitas 13: 59-64. All terrestrial mycorrhiza have mutual symbiotic with mycorrhizal fungi in order to gain nutrient from surrounding environment. This study was done to isolate and to identify mycorrhiza orchid that associates with Spathoglottis plicata and were collected from Cagar Alam Pegunungan Cycloops (CAPC), Jayapura. Isolation of mycorrhizal orchid came after the modified method of Manoch and Lohsomboon (1992). The result showed that based on the morphological characteristic, there were presumably 14 isolations. However, only 2 isolations have been known, namely Rhizoctonia sp. and Tulasnella sp., while the rest were not identified yet. Among them, the DNA of the 11 isolations were able to be extracted for further analysis. The constructed phylogenetic tree performed that those species could be grouped into 4 major clusters. Two species, Rhizoctonia sp. and Tulasnella sp. were in different clusters. Key words: Spathoglottis plicata, orchid-mycorrhiza, Rhizoctonia, Tulasnella, Papua

INTRODUCTION Spathoglottis plicata Blume (ground orchid) is one of the orchid species that is widely distributed in the world, including in the area of New Guinea (Papua New Guinea, PNG and Papua, Indonesia). According to Agustini et al. (2008, 2009) Cycloop Mountains Nature Reserve (CAPC) is one of the conservation area in Papua. This species of orchid is also found here. One of buffer zone areas of this nature reserve is a University of Cenderawasih (Uncen) campus forest in Waena, Jayapura. It has plenty of S. plicata orchids. This orchid is easy to grow and has purplewhite flowers and bloom throughout the year. In nature, for the germination and early growth of orchid seed and its development, it needs an association of orchid roots and mycorrhizal fungi (orchid-mycorrhiza) (Warcup 1981; Cameron et al. 2006; Suarez et al. 2006; Agustini et al. 2009). This is because orchid seeds are very small, smooth and soft and have no cotyledon which is a food reserve in the early growth of seeds (Sarwono 2002; Agustini and Kirenius 2002). The association to mycorrhizal fungi helps the orchid in providing the nutrients needed for the process of germination of its seeds (Agustini and Kirenius 2002; Agustini 2003). The hyphae of mycorrhizal fungi penetrate to the cell walls of roots and then will be developed in the root cortex as dense coiled called peloton. Mycorrhizal hyphae are very delicate;

therefore they will absorb water and certain minerals (Suarez et al. 2006; Agustini et al. 2009). The role of mycorrhizal fungi is very interesting in the life cycle of orchids. In the early growth, all orchid species are heterotrophic, so it requires association with mycorrhizal fungi to obtain the needed nutrients (Brundrett et al. 2003; Taylor et al. 2004; Wu et al. 2010). Orchids that have low levels of heterotrophic are dependants on the presence of mycorrhizae. Based on morphological characteristics, most of the fungi associated with orchids are members of the form of anamorphic (asexual)-genus Rhizoctonia (Athipunyakom et al. 2004) and generally come from families of Basidiomycetes. Several studies of terrestrial orchid-mycorrhiza in temperate-climate areas have been done a lot, but the studies on the tropics are very few (Otero et al. 2002). In Papua, researches and publications on ground orchid-mycorrhiza, especially S. plicata are very small in number. Therefore, there is a need for the study on the diversity of orchid-mycorrhiza associated with ground orchids S. plicata. Furthermore, according to Kristiansen et al. (2001) to find out the phylogenetic of the obtained isolates, the DNA sequencing analysis is required. Therefore, the purpose of this study was to isolate and to find out the phylogenetic relationship of the orchid-mycorrhiza of S. plicata species using mitochondrial sequences of ribosomal large subunit (mtLs) DNA.

B I O D I V E R S IT A S 13 (2): 59-64, April 2012

MATERIALS AND METHODS Time and area study The research was carried out for 10 months in 2008. The isolation of orchid-mycorrhiza was done in the laboratory of Plant Tissue Culture and Laboratory of Microbiology, Department of Biology, Faculty of Mathematics and Natural Sciences, University of Cenderawasih (Uncen), Jayapura, Papua, Indonesia. The maintenance and regeneration of the isolates were carried out at the same place. Isolation of orchid-mycorrhiza According to Manoch and Lohsomboon (1992), isolation of orchid-mycorrhiza was done by the modified method of Masuhara and Katsuya (1989). The roots of S. plicata was cut for about 1 cm, and sterilized with 10% of Clorox for 30 seconds, and then washed with aquadest and rinsed with distilled water, then sterilized again with 70% alcohol. The sterilized pieces of roots were sliced transversely using a sterile knife (razor blade) in the LAF (Laminar Air Flow). The thickness of the slice was ± 200300 m or 3-4 pieces in 1 mm slice. The slices then were planted in the media of potato dextrose agar (PDA) in petri dish. Each dish were filled with 1-3 pieces of roots and then incubated at 28oC. Mycorrhizal mycelia start to appear within 2-3 days. After mycorrhizae grew, isolation was conducted if, through a morphology observation, there was a difference in shapes and growth patterns, to separate each of these groups, because there possibly was more than one species of media. In the same medium, the isolation was carried out again if in the growing up process, the different shape and growth patterns can still be found, until finally a really pure and free from contamination-free isolate was obtained (each mycorrhizal was cultured separately). In 2-3 times of isolation, the isolates obtained were really pure. Identification of orchid-mycorrhiza The identification of the species of orchid-mycorrhiza was done by looking at the morphological and microscopic characteristics. Morphological features, including the diameter of colony growth, mycelia morphology and other characteristics. Microscopic characteristics include presence or absence of septum and spores shape or conidia. Some of the literatures used in the identification of orchidmycorrhiza were Athipunyakom et al. (2004) and KarlFranzens (2006). Isolates of orchid-mycorrhiza and phylogenetic relationship The isolates culture and DNA extraction The mycelia of each isolate was dissolved in 2 µL of aquadest and transferred into 0.5 mL Eppendorf tubes containing 6 µL of dd H2O and 2 µL of 10X PCR (polymerase chain reaction) buffer (0.35 M Sorbitol, 0.1 M Tris, 5 mM EDTA pH 7.5). The solution was then heated at 95 oC for 10 minutes in a water bath. The DNA of these isolates was extracted using the method of hexadecyltrimethylammonium bromide (CTAB) (Gardes and Bruns 1993). The DNA quality was checked by electrophoresis.

DNA amplification by PCR Of the extracted Isolates, 8 µL was used as a template for PCR amplification. ML5/ML6 regions of the genes of mitochondrial large submit (mt-Lr) RNA was amplified with a PCT100 thermocycler (MJ Research Inc.., MA). PCR solution which was used for each isolates contains 2 µL of 10X PCR Buffer, 2 µL (mM) for each primer, 6 µL ddH2O, 8 µL dNTPs (2 mM) and 0.1 µL Taq polymerase. PCR was conditioned according to the method of Gardes and Bruns (1993): initial denaturation at temperature of 95oC for 1 minute 35 second, followed by 13 cycles of denaturation for 35 seconds, temperature 94 oC, primer annealing for 55 seconds at a temperature of 55 oC, and polymerization for 45 seconds at 72. The addition of nine cycles of the polymerization was done by extending to 2 minutes. The 9 cycles consisting of 3 min of extension, and ending with 10 min of polymerization at a temperature of 72oC. Primer used was ML5 (CTCGGCAAATTATCCTCATAAG), MLIN3 (CGACACAGGTTCGTAGGTAG) and MI6 (CAGTAGAAGCTGCATAGGGTC). DNA sequencing The results of PCR amplification was purified with QIA Quick PCR extraction kit (Qiagen GmbH GE). DNA was dissolved in 30 µL of sterile H2O and was being sequenced with a primer ML5/ML6 using ABI 377 automatic sequencer (Perkin Elmer) (Kristiansen et al. 2001). The sequencing uses the dideoxy chain termination procedure (Sanger et al. 1977).

RESULTS AND DISCUSSION Isolation of orchid-mycorrhiza The results of orchid-mycorrhiza isolation associated with S. plicata on eight sites are 13 isolates. Of these 13, 2 of them morphologically are identified as Rhizoctonia sp. and Tulasnella sp., while 11 other species of orchidmycorrhiza, namely sp.1, sp.2, sp.3, sp.6, sp.7, sp.8, sp.9, sp.10, sp.11, sp.12, and sp.13 isolates are associated with S. plicata which is only from 1 different location (Table 1) not all of them can be identified based on differences in morphological features (Figure 1). However, the results of phylogenetic analysis (Table 2, Figure 2) shows that there are 4 clusters that are likely encountered two other species of orchid-mycorrhiza. The results of this isolation adds the data of isolation result of the initial survey conducted by Agustini et al. (2009) in the campus of Faculty of Mathematics and Natural Sciences, Cenderawasih University, located in the buffer zone of CAPC. In her research, she discovered two species of orchid-mycorrhiza, namely Rhizoctonia sp. and Tulasnella sp which are isolated from orchids S. plicata and several other species of orchids. In this research, at least there are two unknown species of orchid-mycorrhiza. Both species are different from Rhizoctonia sp. and Tulasnella sp.

SUFAATI et al. – Orchid-mycorrhiza from Spathoglottis plicata

In a study, Athipunyakom et al. (2004) isolated orchid-mycorrhiza of S. plicata obtained from Chiang Mai, Chanthaburi, Nakhon Ratchasima and Bangkok and found three genera and four species of orchid-mycorrhiza which has successfully been identified based on morphological characteristics, namely Epulorhiza repens, Rhizoctonia globularis, Rhizoctonia sp., and Sebacina sp. Table 1 show that S. plicata can be associated with more than one species of mycorrhiza-orchid. Kristiansen et al. (2001) showed that the orchid can be associated with more than one species of mycorrhizal fungi. In addition, Handayanto and Hairiah (2007) also said that some mycorrhizal fungi can colonize one root of the plant. This is because identification of orchid- mycorrhiza fungi in conventional way is still difficult to conduct. According to Rasmussen (2004), Hollick et al. (2004) and Kristiansen et al. (2001) the characteristic of the fungus which never reach sexual phase or sterile in a culture condition made it difficult for identification process so that the identification with molecular techniques needs to be done.

Figure 1. Morphology of some isolates of orchid mycorrhiza isolated from S. plicata. A-B: Isolates sp7., C-D: Isolate sp.2., E-F: Tulasnella sp., and G-H: Rhizoctonia sp. Table 1. Species of orchid-mycorrhiza from S. plicata in the Campus area Cenderawasih University, Waena, Jayapura. Code of sampling location Isolates of orchidL1 L2 L3 L4 L5 L6 L7 L8 mycorrhiza Rhizoctonia sp. √ √ √ √ √ √ √ √ Tulasnella sp. √ sp.1 √ sp.2 √ sp.3 √ sp.6 √ sp.7 √ sp.8 √ sp.9 √ sp.10 √ sp.11 √ sp.12 √ sp.13 5 2 1 1 3 4 2 1 Note: √ = found; - = not found; L1 to L8 = sites in Waena, Jayapura

Description of orchid-mycorrhiza species Orchid-mycorrhiza orchids isolated from S. plicata, showing the development of a variety. The most rapid growth of the colony diameter reached by isolates sp.2 with a diameter of 9 cm in 3 days, followed by Rhizoctonia sp., Tulasnella sp., sp.12 and sp.1. While other species of orchid- mycorrhiza with colony growth of more than 15 days showed a very slow growth, whereas the optimum diameter of colony growth for orchid-mycorrhiza is 15 days. The growth rapidity of this colony affects the speed of nutrients absorption in nature. According to Smith and Read (2008), the growth rapidity of mycelia/hyphae potentially increased the extent of nutrients absorption surface in the soil during symbiosis process with the plant root system. Thus, the plants quickly obtained nutrients needed through hyphae.

B I O D I V E R S IT A S 13 (2): 59-64, April 2012

Table 2. Description of the morphology of orchid-mycorrhiza species associated with S. plicata. Mycorrhiza (isolates) species Rhizoctonia sp.

Growth on PDA

Morphology

 The growth of the colony very fast, within 4 days.  Mycelia are translucent white and thin. There is a set of dark green granules forming a round shape in the middle.

 Branched hyphae, less dense  At the end of hyphae branch, it is formed small sphereshaped granules, which in turn form a collection of granules. The presence of globulus oil is found around it. 

Tulasnella sp.

 Growth of colonies is rather slow, 8 days.  Mycelia are white and thicker. 

Branched hyphae with dense septate. The presence of conidia, in a group or scattered, and with a magnification of 1000x, the conidia seems like bananas, in sectional.

sp.1

   

sp.2

 The colony growth is very fast, within 3 days  Blurred white mycelia

sp.3

 The colony growth is very fast, within 5 days  Mycelia are white to yellow and have tree-like branches when mature.

sp.6

 Colony growth is very slow, reaching only Ø 9 cm in 22 days  Mycelia are yellowish green, thick and form concentric zones. On the edge side, mycelia are thin and white.  Slow colony growth, 15 days  Mycelia are white with dark brown sides that form a circle in the middle and thick.



 Branched hyphae, more than 1core, dense septate.  Spores are brown and on the tip of hyphae.  The hyphae are long and round and in the shape of chain, and the conidia are round, semi round, ramiform (like kidney shapes), allantoidal (like cashew nut shape with nosharp edge), and crystal look-like.

Colony growth is slow. Achieving a diameter of 9 cm in 12 days. Mycelia are whitish-green brown. Mycelia are thick and round.



 Mycelia are rather thick and the granules are yellow to green and are scattered in a circle in the middle and edge.  Microscopically, hyphae are branched with long septet. There are dispersed small oval-shaped spores. 

 The hyphae are septate and dense. At the tip of the hyphae, there are round and brown spores, and also in “V” like shape in brown color with parallel lines in it. 

sp.7

 Branched hyphae with dense septate.  Spores are clustered and dispersed small round shape. Some tips of hyphae form many branches covered by the collection of spores. 

 The hyphae are branched with non-close septate.  Conidia’s shape are like crystals and resembles a figure of number eight are scattered and there is a chain composed ellipse. 

sp.8

 Colony growth is slow, 17 days  Mycelia are white with brown color in the middle, and appear thicker

 Hyphae are long with septate.  Conidia are round and crystals-shaped with elongated dots which are arranged like a chain.  The presence of large round-shaped spores is found on the tip of hyphae.

sp.9

 Colony growth is very slow 20 days  At the beginning, Mycelia grow clearly white and thin. As the growth continues, white mycelia appear thicker in the middle.

 branched hyphae with non-close septate. With 400x magnification, the hyphae look like spiral.  Some hyphae appear thickened and the presence of spiny conidia is visible and scattered round.

sp.10

 Growth of colony is very slow, 24 days.  Mycelia are white with blackish brown in the middle and it looks thicker.

 There are branched hyphae and close septate.  The shapes of conidia are like crystals, and there is much globular oil which is attached to the hyphae.

sp.11

 Slow growth colony, 16 days.  Mycelia are thick and concentric zone.

 Hyphae are septate and branched.  Some hyphae appear thickened and there are many globular attached to the hyphae. Among hyphae, there are conidia in crystal shape.



white

forming

sp.12

 Colony growth is rather slow, 8 days  Mycelia are blackish green and thick.

 Hyphae are branched with non-close septate.  Many spores are black round-shaped and are found on the tip of hyphae. Some hyphae are coil-shaped.

sp.13

 Growth of colonies is very slow; it needs more than a month to reach a diameter of 9 cm.  Mycelia are white and thick.

 Hyphae have long septate and a lot of branches.  There are many scattered elliptical conidia and are attached to the hyphae.  In addition, there is presence of globular attached to the hyphae 

SUFAATI et al. â&#x20AC;&#x201C; Orchid-mycorrhiza from Spathoglottis plicata

Table 3. Phylogenetic relationship of 11 isolates of orchid orchid-mycorrhiza based on molecular approach (DNA) isolated from orchid S. plicata. Isolate 1 2 3 4 5 6 7 8 9 10 11

1 **** 0.4055 1.0986 1.0986 1.0986 0.4055 0.0000 0.4044 0.4055 1.0986 1.0986

2 0.6667 **** 0.4055 0.4055 0.4055 0.0000 0.4055 0.0000 0.0000 0.4055 0.4055

3 0.3333 0.6667 **** 1.0986 0.0000 0.4055 1.0986 0.4055 0.4055 1.0986 0.0000

4 0.3333 0.6667 0.3333 **** 1.0986 0.4055 1.0986 0.4055 0.4055 0.0000 1.0986

5 0.3333 0.6667 1.0000 0.3333 **** 0.4055 1.0986 0.4055 0.4055 1.0986 0.0000

Phylogenetic relationship of orchid-mycorrhiza of Spathoglottis plicata In Table 2, the isolates number of mycorrhizal orchid which were isolated from Spathoglottis plants are 13 species, but only 11 species that can be isolated their DNA. Therefore, phylogenetic analysis (Table 3) would only be done on these 11 species that have been successfully analyzed. The results of DNA analysis shows that there are four major groups (clusters) of 11 species of orchidmycorrhiza isolated from S. plicata (Figure 2). With the method of UPGMA (unweighted pair group method with arithmetic mean), cluster 1 shows the phylogenetic ties among sp.1 and sp.7 isolates. Cluster 2 shows the relationship among the four species, namely, sp.2, sp.6, sp.8 and sp.9 isolates. Cluster 3 shows that there are 3 isolates having a very close relationship, namely sp.3 isolates, Tulasnella (Tul) and sp.11 isolates. Whereas cluster 4 shows that there are two species of isolates having a close relationship ties i.e. the species of Rhizoctonia (Rhi) and sp.10 isolates. And also, the results show that each isolates of those four clusters have the same index value of relationship. Rhizoctonia has a relationship index equal to 100% to isolates sp.10, Tulasnella to isolates sp.3 and sp.11, so it can be said that these isolates have the same species. The growth rate of the colonies did not affect the nearby distant phylogenetic relationship in one cluster. It can be seen from the Tulasnella, which grows slowly (8 days/9 cm), is different from sp.11, which has a diameter of colony growth on PDA medium for up to 16 days/9 cm, although morphologically the relationship among species and isolates within a cluster is very close. It is similar with Rhizoctonia case, morphologically, it grows very fast (4 days) on PDA medium, whereas sp.10 grows very slow and it takes about 24 days to reach a diameter of 9 cm. However, microscopically both are similar in its morphology (Table 1). The same thing occurs in clusters 1 and 2. For the species group of the two clusters, the DNA relationship is closer to cluster 3 of Tulasnella sp. and is further to Rhizoctonia sp. group.

6 0.6667 1.0000 0.6667 0.6667 0.6667 **** 0.4055 0.0000 0.0000 0.4055 0.4055

7 1.0000 0.6667 0.3333 0.3333 0.3333 0.6667 **** 0.4055 0.4055 1.0986 1.0986

8 0.6667 1.0000 0.6667 0.6667 0.6667 1.0000 0.6667 **** 0.0000 0.4055 0.4055

9 0.6667 1.0000 0.6667 0.6667 0.6667 1.0000 0.6667 1.0000 **** 0.4055 0.4055

10 0.3333 0.6667 0.3333 1.0000 0.3333 0.6667 0.3333 0.6667 0.6667 **** 1.0986

11 0.3333 0.6667 1.0000 0.3333 1.0000 0.6667 0.3333 0.6667 0.6667 0.3333 ****

Figure 2. Dendrogram showing the phylogenetic relationship of several species and isolates of orchid-mycorrhiza isolated from S. plicata with UPGMA method.

CONCLUSION Based on morphological and microscopic character, there were 13 isolates of orchid mycorrhizal fungi has been isolated from S. plicataâ&#x20AC;&#x2122;s root. Among them, isolates has been known as Rhizoctonia sp and sp Tulasnella. The constructed phylogenetic tree of 11 isolates performed that those species could be grouped into 4 major clusters. Two species, Rhizoctonia sp. and Tulasnella sp. were in different clusters.

ACKNOWLEDGEMENTS The authors gratefully thank Maria Imco, Ira Ardila Putri, and Dewi Katemba, which has helped the research at the Laboratory of Biological Science University of Cenderawasih, Papua; to the General Director of Higher Education that has funded this research through Fundamentals Grant of 2008. To Prof. Zamir K. Punja

B I O D I V E R S IT A S 13 (2): 59-64, April 2012

(Simon Fraser University, Burnaby, Canada), thanks for the help during the discussion of this matter.

REFERENCES Agustini V, Kirenius M. 2002. The effect of mycorrhiza on early growth and development of Dendrobium sp. Sains 2 (2): 55-60. [Indonesia] Agustini V, Sufaati S, Suharno. 2008. Terrestrial orchid in Mt. Cycloops Nature Reserve, Jayapura-Papua. The 9th New Guinea Biology Conference. Jayapura, 24-26 July 2008. Agustini V, Sufaati S, Suharno. 2009. Mycorrhizal association of terrestrial orchids of Cycloops Nature Reserve, Jayapura. Biodiversitas 10 (4): 175-180. Agustini V. 2003. The role of orchid-mycorrhiza on growth of Dendrobium sp. Sains 3 (2): 39-42. [Indonesia] Athipunyakom P, Manoch L, Piluek C. 2004. Isolation and identification of mycorrhizal fungi from eleven terrestrial orchids. Nat Sci 38 (2): 216-228. Brundrett MC, Scade A, Batty AL, Dixon KW, Sivasithamparam K. 2003. Development of in situ and ex situ seed baiting techniques to detect mycorrhizal fungi from terrestrial orchid habitats. Mycol Res 107 (10): 1210-1220. Cameron DD, Leake JR, Read DJ. 2006. Mutualistic mycorrhiza in orchids. Evidence from plant-fungus carbon nitrogen transfers in the green-leaved terrestrial orchid Goodyera repens. New Phytol 171: 405-416. Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes: Application to the identify cation of mycorrhizae and rusts. Mol Ecol 2: 113-118. Handayanto E, Hairiyah K. 2007. Soil Biology: Healthy Soil Management Platform. Pustaka Adipura, Yogyakarta. [Indonesia] Hollick PS, Taylor RJ, McComb JA, Dixon KW, Krauss SL. 2004. Optimisation of DNA extraction for AFLP analysis of mycorrhizal

fungi of terrestrial orchids Caladeniimae and Drakaeinae. Pl Mol Biol Rep 22: 307a-307h. Karl-Franzens. 2006. Mycorrhizal fungi of terrestrial orchids. Institute of Botany, University Graz, Germany. Kristiansen KA, Taylor DL, Kjoller R, Ramussens HN, Rosendahl S. 2001. Identification of mycorrhizal fungi from single pelotons of Dactylorhiza majalis (Orchidaceae) using single-stand conformation polymorphism and mitochondrial ribosomal large subunit DNA sequences. Mol Ecol 10: 2089-2093. Manoch L, Lohsomboon P. 1992. Isolation of mycorrhizal fungi from orchid roots. Chiang Mai University Regional Training Course on Biology and Technology of Mycorrhiza 2: 5, SEAMEO BIOTROP, Bogor. Masuhara G, Katsuya K. 1989. Effects of mycorrhizal fungi on seed germination and early growth of three Japanese terrestrial orchids. Scientia Horticulturae 37: 331-337. Otero JT, Ackerman JD, Bayman P. 2002. Diversity and host specificity of endophytic Rhizoctonia-like fungi from tropical orchids. Am J Bot 89 (11): 1852-1858. Rasmussen HN. 2004. Recent developments in study of orchid mycorrhiza. Plant and Soil 244 (2): 149-163. Sanger F, Nicklen S, Coulson AR. 1977. DNA sequencing with chainterminating inhibitors. Biotechnology 24: 104-8. Sarwono B. 2002. Identify and making hybrid orchids. PT Agro Media Pustaka. Jakarta. [Indonesia] Smith SE, Read D. 2008. Mycorrhizal symbiosis. 3rd ed. Academic Press, New York. Suarez JP, WeiÎ˛ M, Abele A, Garnica S, Oberwinkler F, Kottke I. 2006. Diverse tulasnelloid fungi from mycorrhizas with epiphytic orchids in an Andean cloud forest. Mycol Res 110: 1257-1270. Taylor DL, Bruns TD, Hodges SA. 2004. Evidence for mycorrhizal races in a cheating orchid. Proc Biol Sci 271 (1534): 35-43. Warcup JH. 1981. The mycorrhizal relationship of Australian orchids. New Phytol 87 (2): 371-381. Wu J, Ma H, Lu M, Han S, Zhu Y, Jin H, Liang J, Liu L, Xu J. 2010. Rhizoctonia fungi enhance the growth of the endangered orchid Cymbidium goeringii. Botany 88: 20-29.

B I O D I V E R S IT A S Volume 13, Number 2, April 2012 Pages: 65-71

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d130203

Diversity of macrofungal genus Russula and Amanita in Hirpora Wildlife Sanctuary, Southern Kashmir Himalayas SHAUKET AHMED PALA♥, ABDUL HAMID WANI♥♥, RIYAZ AHMAD MIR Section of Mycology and Plant Pathology, Department of Botany, Faculty of Biological Sciences, University of Kashmir, Hazratbal, Srinagar 190006, Jammu and Kashmir , India. Tel.: +99- 9419010336; Fax.: +99-942421357; email: ♥sapala29@gmail.com; ♥ahamidwani@yahoo.com Manuscript received: 11 January 2012. Revision accepted: 30 March 2012.

ABSTRACT Pala SA, Wani AH, Mir RA. 2012. Diversity of macrofungal genus Russula and Amanita in Hirpora Wildlife Sanctuary, Southern Kashmir Himalayas. Biodiversitas 13: 65-71. The Hirpora Wildlife Sanctuary that extends over an area of 114 km2 lies in the Pir Panjal range at a distance of 70 km in south-west of summer capital Srinagar. It is rich in biodiversity including macrofungal diversity. The Sanctuary has been subjected to high ecological and anthropogenic disturbance due to the construction of Mughal road which is major threat for its biodiversity. Since there is hardly any report of documentation of macrofungi from this sanctuary. In this back drop a survey was carried out during the year 2010 and 2011 to explore and invetorise macrofungal diversity of the sanctuary. During the survey a no of macrofungi were documented, among which Amanita and Russula were dominant genus represented by 7 species each. All the 14 species viz. Amanita ceciliae (Berk. & Broome) Bas. Amanita flavoconia G.F. Atk., Amanita muscaria var. formosa Pers., Amanita pantherina (Fr.) Krombh., Amanita phalloides (Fr.) Link., Amanita vaginata (Bull. ex Fr.) Vitt., Amanita virosa (Fr.) Bertillon, Russula aeruginea Fr., Russula atropurpurea (Krombh.) Britz., Russula aurea Pers., Russula cyanoxantha (Schaeff.) Fr., Russula delica Fr. Russula emetica (Schaeff. ex Fr.) Gray. and Russula nobilis Velen. are ectomycorrhizal in nature and among them Russula aeruginea Fr. is reported first time from the Kashmir. Key words: Russula, Amanita, Hirpora, macrofungi, Kashmir

INTRODUCTION Mushroom is regarded as a macrofungus with a distinctive fruiting body that can be either epigeous or hypogenous and large enough to be seen with the naked eye and to be picked by hand (Chang and Miles 1992). Mushrooms belong to the kingdom fungi, which constitutes the most diverse group of organisms after insects on this biosphere. Defining the exact number of fungi on the earth has always been a point of discussion and several studies have been focused on enumerating the world’s fungal diversity (Crous 2006). Current studies estimate that out of 1.5 million species of fungi existing on this biosphere, 140,000 species may be considered as mushrooms, but only 14,000 species are known to man, which accounts for 10% of the estimated mushroom species (Chang and Miles 2004). Only a fraction of total fungal biodiversity has been subjected to scientific scrutiny and mycologists continue to unravel the unexplored, hidden and fascinating fungal biodiversity as many macro-fungi are becoming extinct or facing threat of extinction because of habitat destruction and global climate change (Swapana et al. 2008). There are about 7750 macrofungal species known to have ectomycorrhizal nature (Rinaldi et al. 2008). The genus Amanita contains about 500 species, including some of the most toxic known mushrooms found worldwide (Zhang et al. 2004). This genus is responsible for approximately 95% of the fatalities resulting from mushroom poisoning, with death cap accounting for about 50% on its own. There are

around 750 worldwide species of mycorrhizal mushrooms which compose the genus Russula (Miller et al. 2006). The state Jammu and Kashmir is rich in macrofungal diversity due to wide agro-climatic variations diverse physiography and undulating topography, but understanding of the macro-fungal flora of the Kashmir is still in an exploratory stage and undoubtfully there are many more species to be recorded (Watling and Abraham 1992). The present communication describes the brief morphological description, macro and microscopic details, seasonal occurrence and edibility of the 14 species of macrofungi belonging to genus Russula and Amanita collected from Hirpora wild life sanctuary.

MATERIALS AND METHODS Regular field trips were carried to document the macrofungal diversity of Hirpora wildlife sanctuary (Figure 1) dominated by conifer forests. Usually 4-5 trips were carried out per month to cover as much species as possible. These field trips were organized according to the method given by Hailing (1996). Standard method of collection, preservation, macro and microscopic studies were followed (Kumar et al. 1990; Atri et al. 2003) and the shape, size, color of fresh specimen, time of collection and their edibility were recorded on the field notebook before b r o u g h t to t he laboratory for further observations

B I O D I V E R S IT A S 13 (2): 65-71, April 2012

Figure 1. Map showing the collection site, Hirpora Wildlife Sanctuary, Southern Kashmir Himalayas of Jammu and Kashmir State, India.

and preservation for herbarium purposes. The spore prints were taken according to the guidelines given by Michel Kuo (2001), then their morphology, such as shape, size of spores, surface features of spores, presence or absence of oil drops and starch granules were recorded under the trinocular microscope at USIC (University Scientific Instrumentation centre) in Kashmir University. Reagents used for preparation of spore slides were 3% KOH, cotton blue, lactophenol and Melzerâ&#x20AC;&#x2122;s reagent. To elicit the necessary information regarding their edibility local people were consulted. Photographs were taken in field using Cyber shot Sony 10.1 megapixel Camera. The fungal specimens were also preserved in formalin solution for

herbarium purposes, in fungal collection of KASH Herbarium of Plant Taxonomy, Division of Botany Kashmir University, Kashmir.

RESULTS AND DISCUSSION During the survey to different places of Hirpora Wildlife Sanctuary, 14 ectomycorrhizal macrofungal species belonging to genus Amanita and Russula were collected and identified (Figure 2). Their detailed description along with photographs is as:

PALA et al. â&#x20AC;&#x201C; Russula and Amanita of Hirpora, Kashmir

Amanita ceciliae (Berk. & Br.) Bas Synonym (s). Amanita inaurata Secr., Amanita strangulata (Fr.) Quel., Agaricus ceciliae Berk & Br. Common name (s). Snakeskin grisette Description Cap. 5-10 cm in diameter, initially convex, expanding to planoconvex or flat with a shallow umbo, brown in color with slightly darker centre, usually covered with grayish patches, margins deeply lined at maturity. Gills. Free, crowded, entire, white in color. Stipe. 6-15 cm long, 0.7 1.5 cm thick, tapers towards the apex, whitish, finely hairy, brownish colored volva or patches of volva remnants dotted around stipe base. Annulus (ring) is absent. Flesh. Thick, soft, white, not changing when sliced. Spores. Globose, smooth, non-amyloid, 9-12 microns; Spore print white. Habit and habitat. Mycorrhizal, growing alone or scattered under conifer trees. Season. Summer Edibility: Inedible, considered to be poisonous. Amanita flavoconia G.F. Atk. Synonym (s). Amplariella flavoconia (Atk.) Gilbert, Venenarius flavoconius (G.F. Atk.) Murill Common name (s). Orange Amanita or Yellow-dust Amanita Description Cap. 3 to 8 cm in diameter, initially ovoid, but with maturity becomes convex and finally flattened, orange to bright yellow-orange in color. The young specimens are covered with chrome yellow warts that may be easily rubbed off or washed away with rain, Gills. Free, crowded, white to cream colored and initially covered with a yellowish partial veil. Stipe. 4-12 cm long, 0.5 to 1.3 cm thick, equal or slightly tapered upward (bulbous), white to yellowish orange in color, mostly smooth sometimes covered with small scales. The persistent skirt-like ring (annulus) is present on the upper portion of stipe 1-2 cm below the cap and partially underground powdery yellow volva is present at the base. Flesh. Thick, brittle, white in color. Spores. Elliptical to globose, smooth, amyloid, 7-9 x 58 microns; Spore print white. Habit and habitat. Mycorrhizal, growing either solitary or in groups under conifer trees. Season. Summer and early autumn Edibility. Inedible (poisonous) Amanita muscaria var. formosa Pers. Synonym (s). Amanita muscaria var. guessowii Veesely Common name (s). Fly agaric Description Cap. 5-11 cm in diameter, initially oval to convex or campanulate, but fattens or curve upward with maturity, yellowish to tannish with concentrically arranged white scales on entire cap surface Gills. Free, broad, crowded, white in color.

Stipe. 4-12cm long, 1-2cm thick, white, bulbous with a ring on the upper half. Volva consisting of 2-3 concentric rings is present at the base of stipe. Flesh. Thick, white in color. Spores. Oval, smooth, non-amyloid, 9-13 x 6.5-9 microns; Spore print white. Habit and habitat. Mycorrhizal, growing solitary or scattered under conifer trees. Season. Late summer Edibility. Inedible Amanita pantherina (Fr.) Krombh. Synonym (s). Amanitaria pantherina (DC.) Krombh, Agaricus pantherinus DC. Common name (s). Panther cap Description Cap. 4-12 cm in diameter, initially hemispherical but turns convex to plano-convex at maturity, color dark brown to yellowish brown, veil remnants forming pointed white warts on upper surface. Gills. Free, crowded, white in color. Stipe. 6-10 cm long, 0.8-2 cm thick, unequal, tapers towards the tip, white in color. The partial membranous veil is leaving a white ring at the upper portion of stipe and universal veil forms a single roll or collar on the basal bulb. Flesh. Thick, white not discoloring on exposure or bruising. Spores. Globose, smooth, non-amyloid, 8-12 x 6-8 microns; Spore print white. Habit and habitat. Mycorrhizal, growing singly, scattered, or gregariously under pine trees. Season. Summer and early autumn especially in rainy season. Edibility. Inedible, poisonous but not deadly poisonous. Amanita phalloides (Fr.) Link. Synonym (s). Agaricus phalloides Fr., Amanita viridis Pers., Amanitina phalloides (Fr.) Gilbert Common name (s). Death cap Description Cap. 4-14 cm broad, initially oval, becoming convex, then broadly convex to flat with age, smooth, sticky when wet, shiny when dry; color ranging from olive-brown to yellowish-brown Gills. Free, crowded, moderately broad, white to cream colored. Stipe. 4-15 cm in length, 1-2 cm thick, more or less equal or tapering towards apex, smooth, white or with tints of the cap color; ring present in the upper part but is often lost; white volva encases the base. Flesh. Thick near the disc, soft, white in color. Spores. Globose, amyloid, 7-12 x 6-9 microns; Spore print white. Habit and habitat. Mycorrhizal, growing singly or in small groups on the ground under coniferous trees. Season. Summer and early autumn Edibility. Deadly poisonous. It has been estimated that 30 gms or half a cap of this mushroom is enough to kill a human (Gopinath et al. 2011).

B I O D I V E R S IT A S 13 (2): 65-71, April 2012

Amanita vaginata (Bull. ex Fr.) Vitt. Synonym (s). Amanitopsis vaginata (Bull. Ex Fr.) Roze, Amanita vaginata var. plumbea (Bull.) Quel. & Bataille, Agaricus plumbeus Schaeff. Common name (s). Grisette Description Cap. 4-10 cm broad, initially oval then convex and eventually flattens as it matures, sticky when wet, gray to grayish brown in color, mostly with a few scattered white to grayish patches on the surface. The margin is prominently lined or grooved that duplicate the gill pattern underneath. Gills. Free or slightly attached to stipe, crowded, edges are minutely fringed, white in color. Stipe. 7-14 cm long, 1-2. cm thick, more or less equal or bulbous, smooth or with a few grayish scales, ring absent. White sack-like volva encloses the base of the stem. Flesh. Thin, white, and does not change color upon bruising or injury. Spores. Globose, smooth, non-amyloid, 8-12 microns; Spore print white. Habit and habitat. Mycorrhizal, growing singly or scattered in coniferous trees as well as on road side of Mughal road under broad leaved trees like Populous, Salix etc. Season. Late spring and summer. Edibility. Edible Amanita virosa (Fr.) Bertillon Synonym (s). Agaricus virosus Fr. Common name (s). Destroying angel Description Cap. 5-10 cm across, initially oval, becoming convex then expanded flat with age, white, smooth, margins not lined, viscid when moist. Gills. Free, crowded, white in color Stipe. 6-18 cm long, 0.6-2 cm thick, tapering towards the tip, white with surface often disrupted into shaggy fibrils, white sac like volva encases the base or collapses at early stage, ring collapses very early. Flesh. Thick, soft, white in color Spores. Globose, smooth, amyloid, 8-10 microns; Spore print white. Habit and habitat. Mycorrhizal, growing, singly or scattered under broad leaved trees near road sides of Mughal road. Season. Late spring and summer. Edibility. Deadly poisonous, its poisonings are common in the area because of its resemblance with Agaricus sps Russula aeruginea Fr. Synonym (s). Russula graminicolor (Gillet) Quel. Common name (s). Grass-green Russula Description Cap. 4-8 cm in diameter, initially convex, becoming broadly convex to flat with a shallow depression, smooth, grayish green to yellowish green to pale green, margin often lined at maturity. Gills. Almost free, crowded, forked, creamy to light yellow.

Stem: 4-6 cm long, 0.8-1.8 cm thick, cylindrical, smooth, white Flesh. Thick, brittle, white in color, color does not change on bruising. Spores. Globose, warty, 6-8 microns; Spore print creamy to light yellow. Habit and habitat. Mycorrhizal, growing scattered, or gregariously under conifer trees or under Salix near roadsides of Mughal road. Season. Summer to early autumn Edibility. Edible Russula atropurpurea (Krombh.) Britz. Synonym (s). Russula krombholzii Shaffer, Russula undulate Velen. Common name (s). Blackish purple Russula or Purple brittlegill Description Cap. 4-9 in diameter, convex to flat with a shallow depression in centre or turns upward, smooth, purple violet in color with dark centre. Gills. Adnexed, crowded, cream or pale straw in color. Stipe. 2-7 cm long, 0.8-2 cm thick, cylindrical, brittle, smooth, white often becoming gray with age. Flesh. Thick, brittle, white, with an odour of apple fruit. Spores. Globose, warty, 6-8 microns; Spore print creamy to light yellow. Habit and habitat. Mycorrhizal, growing singly or scattered under conifer trees. Season. Summer Edibility. Inedible Russula aurea Pers. Synonym (s). Agaricus auratus With., Russula aurata (With.) Fr. Common name (s). Golden Russula or Gilded brittlegill Description Cap. 5-9 cm in diameter, initially convex but flattens with age with a slight depression in the centre, reddish orange with yellow tinge near the margin, smooth, margin sulcate when mature, cuticle peeling halfway to center. Gills. Free to adnexed, broad, fairly distant, yellow in color. Stipe. 3-7 cm tall, 1-2 cm thick, cylindrical, smooth, light yellow in color. Flesh. Thick, brittle, yellow in color. Spores. Echinate, 7-9 microns; Spore print ochraceous. Habit and habitat. Mycorrhizal, growing solitary or scattered under pine trees. Season. Summer to autumn. Edibility. Edible. Russula cyanoxantha (Schaeff.) Fr. Synonym (s). Agaricus cyanoxanthus Schaeff., Russula cutefracta Cook, Russula furcata Sensu Auct. Common name (s). Charcoal burner Description Cap. 5-12 cm in diameter, initially globose, becomes convex to flat at maturity with a central depression in the

PALA et al. â&#x20AC;&#x201C; Russula and Amanita of Hirpora, Kashmir

centre, grayish purple to dark violet, slimy when moist. Cuticle can be separated up to half to the centre. Gills. Subdecurrent to adnexed, intermediately spaced, flexible, greasy to touch, white. Stipe. 4-7 cm long, 0.7-1.5 cm thick, cylindrical or slightly bulbous, smooth, white. Flesh. Thick, brittle, white. Spores. Ellipsoid, warty, 7-8 x 6-7 microns; spore print white. Habit and habitat. Mycorrhizal, growing scattered to gregariously under conifer trees. Season. Summer Edibility. Edible Russula delica Fr. Synonym (s). Agaricus exsuccus (Pers.) Anon., Lactarius exsuccus (Pers.) Sm. Local name (s): Milk-white brittlegill Description Cap. 5-13 cm in diameter, initially convex with a depression in the centre or infundibuliform at maturity, margins inrolled, whitish often developing brownish discolorations, mostly contains leaf debris on the upper surfaces. Cuticle cannot be peeled off. Gills. Decurrent, crowded, often forked, white. Stipe. 2-4 cm long, 1.5-3 cm thick, cylindrical, smooth, white. Flesh. Thick, brittle, white, not changing color on bruising. Spores. Ovoid, warty, 8-11 x 7-9 microns; Spore print white. Habit and habitat. Mycorrhizal, growing scattered on ground under Pine trees. Season. Early autumn. Edibility. Edible Russula emetica (Schaeff. ex Fr.) Gray. Synonym. Agaricus emeticus Schaeff.: Fr., Agaricus linnaei var. emeticus (Schaeff.) Fr., Russula clusii Fr. Common name (s). Sickener Description Cap. 3-8 cm in diameter, convex when young latter on flattened, sticky, bright scarlet to cherry red or blood red in color with finely ridged margins. The cuticle is readily peeled from the cap. Gills. Free, crowded, cream or pale straw in color. Stipe. 2-9 cm in length, cylindrical, brittle, smooth, white. Flesh. Thick, brittle, white in color. Spores. Roughly spherical, covered with small spines, 6-8 microns; Spore print white Habit and habitat. Mycorrhizal, growing singly or scattered under conifer trees. Season. Summer Edibility. Inedible Russula nobilis Velen. Synonym (s). Russula mairei Singer, Russula emetica Schaeff., Russula fagetorum Bon Common name (s). Beechwood sickener

Description Cap. 4-9 cm in diameter, initially globular, becoming flattened and finally slightly depressed or sometimes turns upward, red to pink colored, sticky, very often damaged by slugs at places. Gills. Adnexed, intermediately spaced, broad, creamy white Stipe. 3-6 cm long, 1-1.5 cm thick, cylindrical, smooth, white Flesh. Thick, brittle, white but pink beneath the cuticle. Spores. Ovoid with warts, 7-8 x 6-7 microns; Spore print white Habit and habitat. Mycorrhizal, scattered near the roadsides of Mughal road under broad leaved trees. Season. Summer and autumn Edibility. Poisonous, but some people use after cooking. Discussion A wide variety of ectomycorrhizal fungi are symbionts of many tree species in temperate climatic zones. In the recent years, however, anthropogenic activity has made different countries all over the world to show serious concern about the dwindling biodiversity of ectomycorrhizal macrofungal species being last at the rate never known before. The present study confirms the remarkable species richness of the macrofungal genus Amanita and Russula in Hirpora Wild Life sanctuary. Fourteen species, seven of each Russula and Amanita were recorded from the selected area. Watling and Gregory (1980) recorded 119 taxa of macrofungi from Kashmir including many species Russula and Amanita. Watling and Abraham (1992) reported about 77 species of ectomycorrhizal macrofungi from coniferous forests of Kashmir with Amanita and Russula as dominant genus. Dar et al. (2009, 2010) pointed out that coniferous forest of Jammu and Kashmir harbors some 260 species of macrofungi. They reported Russula delica, Russula aurea, Russula atropurpurea and Russula paludosa first time from coniferous forests of Kashmir. Lakhanpal (1996, 1997); Atri et al. (2000); Beig (2008) have also documented many species of Russula and Amanita from conifer forests of Kashmir. Gardezil and Ayoub (2003a) described eight species of Russula first time from Azad Kashmir. Gardezil and Ayoub (2003b) reported Amanita muscaria var. alba, A. ceciliae, A. pantherina and Amanita virosa from Azad Kashmir. Boda (2009) reported 44 different species of mushrooms from southern part of the Kashmir including Russula emetica, and Amanita muscaria. Russula and Amanita represent two major genera having multifarious medicinal properties besides their mycorrhizal role. They have been found to live in symbiotic association with a wide variety of coniferous and deciduous trees. The compounds derived from these mushrooms avert diseases and boost up immune system thereby improving human health (Wasser 2002). Different species of Russula are known to possess antiviral, antibacterial, antiparasitic, anti-inflammatory, antioxidant, hepatoprotective, antidiabetic and anticancer activities (Turkoglu et al. 2009; Wasser 2010).

B I O D I V E R S IT A S 13 (2): 65-71, April 2012

Figure 2. Diversity of Russula and Amanita in Hirpora, Kashmir. A. Amanita ceciliae (Berk. & Br.) Bas, B. Amanita flavoconia G.F. Atk., C. Amanita muscaria var. formosa Pers, D. Amanita pantherina (Fr.) Krombh., E. Amanita phalloides (Fr.) Link., F. Amanita vaginata (Bull. ex Fr.) Vitt., G. Amanita virosa (Fr.) Bertillon, H. Russula aeruginea Fr., I. Russula atropurpurea (Krombh.) Britz., J. Russula aurea Pers., K. Russula cyanoxantha (Schaeff.) Fr., L. Russula delica Fr. M. Russula emetica (Schaeff. ex Fr.) Gray., N. Russula nobilis Velen.

PALA et al. â&#x20AC;&#x201C; Russula and Amanita of Hirpora, Kashmir

CONCLUSION Since the wild macrofungi play an important ecological role for the healthy maintenance of the ecosystem particularly that of forest ecosystems, besides their tremendous medicinal value, therefore it becomes quite necessary to explore, document and conserve this natural wealth. Also the area is ecologically fragile, but has been subjected to high magnitude of disturbance due to construction of National highway through the wild life sanctuary which is a major threat for its biodiversity; therefore it becomes quite imperative to document its biodiversity. The present communication reports the fourteen species of ectomycorrhizal macrofungus from the area among which Russula aeruginea Fr. is reported first time from the Jammu and Kashmir.

ACKNOWLEDGEMENTS The authors are highly thankful to Head Department of Botany, University of Kashmir, Prof. Zaffar Ahmed Reshi for providing necessary support to carry out the work and Prof. N.S. Atri from Punjabi University, Patiala, India for their help in identification of specimens.

REFERENCES Atri NS, Kaur A, Kaur H. 2003. Wild Mushrooms Collection and Identification. Mushroom Res 14: 56-59 Atri NS, Kaur A, Saini SS. 2000. Taxonomic studies on Agaricus from Punjab plains. Indian J Mushroom 18: 6-14. Beig MA, Dar GH, Ganai NA, Khan NA. 2008. Mycorrhizal biodiversity in Kashmir forests and some new records of macro-fungi from J & K state. Appl Biol Res 10: 26-30. Boda RH. 2009. Studies on the mushroom flora of Western Kashmir. [Ph.D. Thesis]. Department of Botany, University of Kashmir. Chang ST, Miles PG. 1992. Mushroom biology - a new discipline. Mycologist 6: 64-65. Chang ST, Miles PG. 2004. Mushrooms: Cultivation, Nutritional Value, Medicinal Effect, and Environmental Impact. 2nd ed. CRC Press, New York.

Crous PW. 2006. How many species of fungi are there in tip of Africa. Stud Mycol 55: 13. Dar GH, Beig MA, Qazi NA, Ganai NA. 2009. Hitherto Unreported Agaricales from Jammu and Kashmir. J Mycol Pl Pathol 39 (1): 3537. Dar GH, Ganai NA, Beigh MA, Ahanger FA, Sofi TA. 2010. Biodiversity of macro-fungi from conifer dominated forests of Kashmir, India. J Mycol Pl Patho 40 (2): 169-171. Gardezil SRA, Ayoub N. 2003a. Mushrooms of Kashmir VII. Asian Journal of plant sciences 2 (8): 644-652. Gardezil, SRA, Ayoub, N. 2003b. Mushrooms of Kashmir VI. Asian Journal of plant sciences 2 (10): 804-810. Gopinath S, Kumar SV, Sasikala M, Ramesh R. 2011. Mushroom poisoning and its clinical management: an overview. International Journal of Pharmacy and Therapeutics 2 (1): 6-15. Hailing RE. 1996. Recommendations for collecting mushrooms for scientific study. Pp. 135-141. In: Alexiades MN, Sheldon JW (eds.). Selected Guidelines for Ethnobotanical Research: A field manual, the New York Botanical Garden Press, Bronx, NY. Kumar A, Bhatt RP, Lakhanpal TN. 1990. The Amanitaceae of India. Bishan Singh, Mahendra Pal Singh, Dehradun, Uttarachal, India. Kuo M. 2001. Making spore prints. Retrieved from www.bluewillopages.com/mushroomexpert/herbarium.html. Lakhanpal TN. 1996. Mushrooms of Indian Boletaceae. In: Mukherji KG (ed). Studies in Cryptogamic Botany Vol. I. APH Publishing Corp. New Delhi. Lakhanpal TN. 1997. Diversity of mushroom mycoflora in the NorthWest Himalaya. In: Sati SC, Saxena J, Dubey RC (ed). Recent researches in ecology, environment and pollution. Today and Tomorrowâ&#x20AC;&#x2122;s. New Delhi. Miller SL, Larsson E, Larsson KH, Verbeken A, Nuytink J. 2006. Perspectives in the new Russulales. Mycologia 98: 960-970. Rinaldi AC, Comandino O, Kuyper TW. 2008. Ectomycorrhizal fungal diversity: separating the wheat from chaff. Fungal Diversity 33: 1-45. Swapana S, Syed A, Krishnappa M. 2008. Diversity of Macrofungi in Semi Evergreen and Moist Deciduous Forests of Shimoga DistrictKarnatka, India. J Mycol Pl Pathol 38 (1): 21-26 Turkoglu A, Duru ME, Mercan N. 2009. Antioxidant and antimicrobial activity of Russula delica Fr.: An edidle wild mushroom. Eurasian Journal of Analytical Chemistry 2 (1): 54-67. Wasser SP. 2002. Medicinal mushrooms as a source of antitumor and immunomodulating polysaccharides. Appl Microbiol Biotechnol 60: 258-274. Wasser SP. 2010. Medicinal mushroom science: History, current status, future trends, and unsolved problems. Inter J Med Mushr 12 (1): 1-16. Watling R, Abraham SP. 1992. Ectomycorrhizal fungi of Kashmir forests. Mycorrhiza 2: 81-87. Watling R, Gregory NM. 1980. Larger fungi from Kashmir. Nova Hedwigia 32: 494-564. Zhang L, Yang J, Yang Z. 2004. Molecular phylogeny of eastern Asian species of Amanita (Agaricales, Basidiomycota): Taxonomic and biogeogrhaphic implications. Fungal Divers 17: 219-138.

B I O D I V E R S IT A S Volume 13, Number 2, April 2012 Pages: 72-78

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d130204

Effect of plantations on plant species diversity in the Darabkola, Mazandaran Province, North of Iran HASSAN POURBABAEI1,♥, FATEMEH ASGARI1, ALBERT REIF2, ROYA ABEDI1 1

Department of Forestry, Faculty of Natural Resources, Somehsara, University of Guilan, Islamic Republic of Iran. P.O. Box 1144, Tel.: +98-1823220895, Fax.: +98-182-3223600, ♥email: H_pourbabaei@guilan.ac.ir 2 Department of Vegetation Classification, Waldbau Institute, Faculty of Forest and Environment, Albert-Ludwigs University, Freiburg, Germany Manuscript received: 18 December 2011. Revision accepted: 2 April 2012.

ABSTRACT Pourbabaei H, Asgari F, Reif A, Abedi R. 2012. Effect of plantations on plant species diversity in the Darabkola, Mazandaran Province, North of Iran. Biodiversitas 13: 72-78. In this study, the effect of plantations on plant species diversity was investigated in Darabkola, Mazandaran province, north of Iran. To conduct the study, a natural mixed forest, a broad–leaved plantation (Alnus subcordata-Acer velutinum) and a coniferous plantation (Cupressus sempervirens var. horizontalis-Pinus brutia) were selected. 35 sampling plots were taken in systematic random method in each area. Data analysis was carried out using Simpson, Hill's N2, Shannon-Wiener and Mc Arthur's N1 diversity indices, Smith and Wilson evenness index and species richness. Results revealed that there were 32 plant species in natural forest and 30 plant species were found in each plantation. Rosaceae and Lamiaceae were the main families in the studied areas. Diversity and evenness indices of all vegetation layers had the most values in the natural forest. Richness of woody plants had the highest value in the natural forest, while herbaceous richness was the highest in coniferous plantation. Mc Arthur's N1 had the highest value among diversity indices and followed by Hill's N2, Shannon-Wiener and Simpson indices, respectively. In addition, results showed that there were significant differences among diversity, evenness and richness indices in all vegetation layers in the three studied areas. Key words: plantation, plant species diversity, Darabkola, Mazandaran.

INTRODUCTION Afforestation and replanting programs have helped reverse the decline of forest cover. Currently 3% of the world’s forests are plantations, comprised of 60 million hectares in developed nations and 55 million hectares in developing nations (Hartley 2002). Forest plantations that achieve yields corresponding to site potential are part of the economic growth of forest resources; such economic growth should not be hampered by a lack of ecological information. Conservation and enhancement of biological diversity is a key component of sustainable forest management in vegetation communities (Jobidon et al. 2004). Conservation of ecological services, prevent a lack of special species and aesthetics values, attention to principles of forest management, promote social and commercial of medical and industrial plants are the most important components of biodiversity conservation in forest plans (Pilehvar 2000). Biodiversity has been an important objective of forest management, because it provides a broader array of ecosystem services (Wang and Chen 2010). There is a common belief that forest management negatively influences biodiversity (Wagner et al. 1998). Plantations are often viewed unfavorably compared to natural forests by the public and conservation biologists, because of the lack of biodiversity (Perley 1994; Potton 1994; Freedman et al. 1996). Plantations usually include exotic and non-native species, or native species in pure stands. Plantations contribute to biodiversity conservation

variously. Most directly, plantations can contain substantial components of biotic diversity across many taxa (Ferns et al. 1992; Allen et al. 1995; Michelsen et al. 1996; Chey et al. 1997; Estades and Temple 1999), including rare species in some cases (Norton 1998; Tucker et al. 1998; Wilson and Watts 1999). Even exotic plantations can help to restore native biota to degraded sites by stabilizing soil and creating site conditions suitable for native animals and plants to recolonize (Lugo 1997). Plantations are most likely to contribute positively to biodiversity conservation when used to reforest degraded or deforested areas (Moss et al. 1979; Evans 1982; Moore and Allen 1999). In addition, plantations can benefit landscape composition (Estades and Temple 1999). It may seem that the best use of all plantations would be to maximize fiber production while minimizing costs (Moore and Allen 1999), but this assumes that plantations will increase the amount of natural forests that are taken out of production or harvested minimally. Replacement of native forest with exotic tree plantation could cause important changes in diversity and composition of community in local and regional scale (Brockerhoff et al. 2001). The most disputed of plantation management is extensive use of exotic species in plantations (Potton 1994; Tucker et al. 1998). Most studies suggested that polyculture plantations have abundant and diverse flora and fauna more than monocultures (Baguette et al. 1994; Donald et al. 1997; Khanna 1997; Twedt et al. 1999;

POURBABAEI et al. – Plant species diversity in plantation forest of North Iran

Humphrey et al. 2002; Carnus et al. 2006), especially where native species are planted. Poly-culture plantations are generally host of many animal species because of the strong relationship between native plant diversity and animal diversity within a divers forest stand (Braganc et al. 1998; Donald et al. 1998). Using native fast growing species such as Alnus subcordata and Acer velutinum increase the yield potential in short rotations caused by decreasing timber harvesting in natural forest in the north of Iran; on the other hand, these forests could play their environmental roles. Also, using native species in plantations could decrease the concern of adaptation and being infected the pests and diseases. The study on plantation in Iran and the other part of the world was extended in recent decades (Abdy and Mayhead 1992; Allen et al. 1995; Menalled et al. 1998; Ferris et al. 2000; Coroi et al. 2004; Lindenmayer and Hobbs 2004; Yamashita et al. 2004; Lee et al. 2005; Lemenih and Teketay 2005; Pourbabaei et al. 2005; Corney et al. 2006; Ginsberg 2006; Mosayeb Neghad et al. 2007; Pourbabaei and Roostami Shahraji 2007; Poorbabaei and Poorrahmati 2009). The study on herbaceous species diversity in Lajim, Mazandaran province in Iran showed that herbaceous species diversity in natural broad–leaved forest was significantly more than coniferous plantation (Ghelichnia 2003). In addition, comparison of plant biodiversity in Alnus subcordata and Acer velutinum-Fraxinus excelsior plantations in Guilan province of Iran indicated that diversity indices (Shannon-Wiener and Mc Arthur's N1), evenness index and species richness in Acer velutinumFraxinus excelsior was more than Alnus subcordata plantation and there was no significant difference between plantations in diversity and evenness indices, but there was a significant difference in richness (Pourbabaei et al. 2005). The investigation of biodiversity indices (Simpson, Menhinick richness and Peet’s evenness) of woody species

in mixed coniferous stand of Pinus nigra-Picea abies and natural broad-leaved coppice stand revealed that the most number of native species was recorded in natural broadleaved coppice stand, but richness and evenness indices had lower value in natural forest (Memarian et al. 2007). Comparison of vegetation diversity in forest floor and fauna diversity in coniferous and broad–leaved plantations showed that flora and fauna diversity was lower in coniferous plantation. Therefore, the forest floor diversity could be a criterion to realize the effect of plantation on wildlife diversity (Magurran 1996). Considering the necessity of plantation and importance of biodiversity conservation in all life forms (tree, shrub, herb and regeneration) in the north forests of Iran, the objective of this study was the investigation and comparison of the effects of plantation on plant species diversity in Darabkola’s region, Mazandaran province, north of Iran. MATERIALS AND METHODS Study area Three areas were selected including broad–leaved plantation consist of Acer velutinum and Alnus subcordata (parcel No. 30), coniferous plantation of Cupressus sempervirens var. horizontalis and Pinus brutia (parcel No. 40) and natural broad-leaved mixed forest (parcel No. 29), which located in district No. 1 of Drarabkola region in Mazandaran province, north of Iran and had 11, 14 and 15 ha area, respectively. These areas located in 36º 28′ 00″ N latitude and 52º 31′ 00″ E longitude in watershed No.74. Average altitude is 300 m asl. in broad-leaved plantation, 270 m asl. in coniferous plantation and 450 m asl. in natural forest. Average slope in the most parts of all regions was 30℅ and general aspect was northern (Figure 1).

Figure 1. Location of the study area, Darabkola, Sari district, Mazandaran Province in northern Iran. Parcel no. 29. Natural stand, parcel no. 30. Broad leaved plantation, parcel no. 40. Coniferous plantation.

B I O D I V E R S IT A S 13 (2): 72-78, April 2012

Procedures The sampling method was systematic random. 35 sampling plots were surveyed in each area. All tree species (diameter at breast height, DBH ≥ 10 cm) were identified and measured, and shrub species and seedlings (DBH < 10 cm) were identified and counted in 400 m2 (20 m × 20 m) sampling plots. Cover percentage of herbaceous species were estimated according to Braun-Blanquet criterion in 64 m2 (8 m × 8 m) circular plots obtained minimal area method (Poorbabaei and Poorrahmati 2009; Eshaghi Rad et al. 2009). Simpson (1-D) and Hill's N2 diversity indices were used due to more sensitivity to the most frequent plant species. Shannon-Wiener (H′) and Mc Arthur's N1 diversity indices were used due to more sensitivity to frequency of rare species. Smith and Wilson evenness index (Evar) was used to study the distribution of individual among species. Diversity and evenness indices of each plot were calculated using Ecological Methodology software. Species richness (S) was number of species per plot (Krebs 1999). Finally, Jaccard's similarity index was used to find similarity among regions (Pourbabaei 2004): JI 

a abc

JI: Jaccard's index, a: number of common species in samples or communities, b: number of species that exist just in first sample or community, c: number of species that exist just in second sample or community. Three studied areas were compared using one-way ANOVA and Tukey’s test.

RESULTS AND DISCUSSION Results Results showed that natural forest has 32 plant species, which consist of 10 trees, 4 shrubs and 18 herbaceous species. 30 plant species were recorded in Alnus subcordata-Acer velutinum broad–leaved plantation including 7 trees, 5 shrubs and 18 herbaceous species, and 30 plant species including 8 trees, 4 shrubs and 18 herbaceous species were presented in Cupressus

sempervirens var. horizontalis-Pinus brutia coniferous plantation (Table 1). Values of biodiversity indices in tree, shrub, herbaceous and regeneration layers had higher values in the natural forest (Table 2). Natural forest had the highest value of evenness in all vegetation layers and coniferous plantation had the lowest value (Table 3). Natural forest had the highest value of species richness in all vegetation layers other than herbaceous layer (this layer had the most value in broad– leaved plantation) (Table 4). ANOVA test indicated that there were significant differences among diversity, evenness indices and richness in all vegetation layers in the three studied areas (P < 0.05) (Table 5). In tree layer, the results of Tukey test (P < 0.05) revealed that there was no significant difference between natural forest and broad–leaved plantation in Simpson, Shannon–Wiener and evenness indices. While, natural forest and coniferous plantation had significant difference in all diversity indices. Also, broad–leaved and coniferous plantations had significant differences in all diversity indices in this layer. In shrub layer, Tukey test revealed that there was no significant difference between natural forest and broad– leaved plantation in all diversity indices. In addition, broad–leaved and coniferous plantations had significant difference in species richness. There was significant difference between natural forest and coniferous plantation in all indices in this layer. In herbaceous layer, Tukey test indicated that there was no significant difference between natural forest and broad– leaved plantation, but there was significant difference between natural forest and coniferous plantation in all indices. In addition, broad–leaved and coniferous plantations had significant differences in all indices except evenness index. In regeneration layer, Tukey test showed that there was no significant difference between natural forest and broad– leaved plantation, but natural forest and coniferous plantation and also two plantations had significant differences in all indices. Jaccard's similarity index revealed that natural forest and broad–leaved plantation had the most similarity in woody and herbaceous layers, and the lowest value was between natural forest and coniferous plantation (Table 6).

Table 2. Mean and standard errors values of diversity indices in different vegetation layers in the studied areas Vegetation layers

1-D

Tree 0.32 ± 0.03 1.47 ± 0.10 0.76 ± 0.07 1.68 ± 0.11 Shrub 0.21± 0.03 0.91 ± 0.13 0.46 ± 0.07 1.03 ± 0.15 Herb 0.56 ± 0.04 2.94 ± 0.25 1.96 ± 0.12 3.53 ± 0.27 Regeneration 0.40 ± 0.03 1.75 ± 0.08 0.92 ± 0.06 1.94 ± 0.08 Tree 0.24 ± 0.04 1.01 ± 0.16 0.52 ± 0.08 1.07 ± 0.17 Broad–leaved plantation Shrub 0.15 ± 0.03 0.66 ± 0.13 0.33 ± 0.07 0.73 ± 0.15 Herb 0.55 ± 0.03 2.73 ± 0.19 1.61 ± 0.09 3.34 ± 0.22 Regeneration 0.34 ± 0.03 1.50 ± 0.13 0.81 ± 0.08 1.68 ± 0.14 Tree 0.05 ± 0.01 0.31± 0.08 0.12 ± 0.03 0.34 ± 0.09 Coniferous plantation Shrub 0.09 ± 0.02 0.35 ± 0.09 0.17 ± 0.04 0.37 ± 0.10 Herb 0.18 ± 0.04 0.81 ± 0.18 0.47 ± 0.10 0.94 ± 0.21 Regeneration 0.19 ± 0.04 0.80 ± 0.17 0.41 ± 0.09 0.87 ± 0.18 Note: 1-D = Simpson diversity index, N2 = Hill's diversity index, H′ = Shannon-Wiener diversity index, N1 = Mc Arthur's diversity index Natural forest

POURBABAEI et al. – Plant species diversity in plantation forest of North Iran

Table 3. Mean values of evenness in different vegetation layers in the studied areas Vegetation layers Tree Shrub Herbaceous Regeneration

Natural forest 0.56 ± 0.05 0.35 ± 0.05 0.55 ± 0.04 0.62 ± 0.03

Broad–leaved plantation 0.43 ± 0.07 0.28 ± 0.06 0.42 ± 0.04 0.51 ± 0.05

Coniferous plantation 0.11 ± 0.03 0.15 ± 0.04 0.25 ± 0.05 0.28 ± 0.06

Table 4. Mean values of species richness in different vegetation layers in the studied areas Vegetation layers Tree Shrub Regeneration Herbaceous

Natural forest 2.26 ± 0.13 1.83 ± 0.16 2.51 ± 0.12 5.43 ± 0.44

Broad–leaved plantation 1.71 ± 0.13 1.37 ± 0.14 2.43 ± 0.21 6.17 ± 0.49

Coniferous plantation 1.71 ± 0.07 0.88 ± 0.14 1.46 ± 0.23 1.57 ± 0.34

Table 5. Results of ANOVA analysis of diversity, evenness indices and richness in different vegetation layers Vegetation Biodiversity Mean df F P-Value layers indices square Tree 1-D 0.665 2 17.021 0.000 N2 12.061 2 18.419 0.000 H′ 3.609 2 17.918 0.000 N1 15.890 2 21.286 0.000 Evar 1.906 2 15.474 0.000 S 10.314 2 23.483 0.000 Shrub 1-D 0.130 2 2.914 0.059 N2 2.814 2 4.179 0.018 H′ 0.783 2 4.146 0.019 N1 3.782 2 4.739 0.011 Evar 0.381 2 3.164 0.046 S 8.267 2 10.890 0.000 Herb 1-D 1.666 2 26.453 0.000 N2 48.317 2 19.534 0.000 H′ 16.312 2 27.282 0.000 N1 73.398 2 23.602 0.000 Evar 0.823 2 8.307 0.000 S 213.438 2 33.905 0.000 Regeneration 1-D 0.426 2 7.432 0.000 N2 8.453 2 8.663 0.000 H′ 2.486 2 7.957 0.000 N1 10.946 2 9.751 0.000 Evar 1.072 2 9.391 0.000 S 12.067 2 9.185 0.000 Note: 1-D = Simpson diversity index, N2 = Hill's diversity index, H′ = Shannon-Wiener diversity index, N1 = Mc Arthur's diversity index, Evar = Smith and Wilson evenness index, S = species richness.

Table 6. Percentage of Jaccard's similarity index of woody and herbaceous species in the studied areas HerbaWoody Study area ceous species species Natural forest-Broad–leaved plantation 0.63 0.50 0.37 0.40 Natural forest-Coniferous plantation Broad–leaved plantation-Coniferous 0.50 0.38 plantation

Discussion There is no single or simple answer to the question of whether planted forests are good or bad for biodiversity. Plantations can have either positive or negative impacts on biodiversity of the tree, stand or landscape level (Hartley 2002; Zerbe 2002; Lindenmayer and Hobbs 2004; Ginsberg 2006; Paritsis and Aizen 2007). It has been argued that plantation may protect natural biodiversity indirectly by enabling greater wood production from smaller, intensively managed areas, thus sparing remaining natural forests harvesting pressure (Carnus et al. 2006). In our study, the number of tree species recorded in the natural forest, broad–leaved and coniferous plantations were 10, 8 and 7, respectively. Grazing, collection of litter and dry branches may be most likely reduced in woody species number in plantations (Yirdaw and Luukkanen 2003), and forest managers should pay attention to the natural composition of forest communities (Eshaghi Rad et al. 2009). In this study, species of shrubs was higher in broad–leaved plantation. Plantation management studies have shown that shrub species are more resistant and recover more easily than tall tree species (Nagaike 2002) We found that number of plant species in natural forest were significantly higher than plantations. Single species plantations have often been criticized for being associated with a low level of biodiversity in the ecosystems (Montagnini et al. 1995; Lindenmayer and Hobbs 2004). High biological diversity at the landscape level could bring about many benefits from forests including wood production, water and environmental conservation, carbon stocking, education and science recreation. To achieve this objective, it is essential to retain some natural forests in the reforestation area, avoiding large scale clear-cutting (Kamo et al. 2002). Tree species richness and evenness were the lowest values in coniferous plantation. It seems that due to lack of attention to the mix structure and presence of many individuals of two species include Cupressus sempervirens var. horizontalis and Pinus brutia reduced evenness in this site. It was stated that species richness and evenness were the most in natural forest and the least in Acer velutinum and Pinus taeda plantations in the north of Iran (Baktash 2003). Also, we found that diversity of herbaceous species in natural forest is more than plantations. Ghelichnia (2003) showed the same results in the comparison of diversity in natural hardwood stand and softwood plantation in Mazandaran province, north of Iran. Investigation on the relation of plant diversity, planting distance and soil types in native and exotic pine plantations showed that more planting distance caused more richness, less woody species abundant and more coverage of herbaceous species. Also, light absorption of pine's needles and their fallings had negative impact on plant diversity (Newmaster et al. 2006). Broad–leaved deciduous species increase the organic matter of soil and caused soil productivity (Jalali et al. 2007). Results of this study revealed that seedling had been established in broad–leaved plantation. The growth of under storey is influenced by various factors, including

B I O D I V E R S IT A S 13 (2): 72-78, April 2012

competition for light and nutrients, Table 1. List of plant species in the studied areas pattern tree regeneration, soil and Broad– microclimatic effects and past stand Natural Coniferous Scientific name Family name leaved conditions (disturbance) (Kamo et al. forest plantation plantation 2002). It remains to be determined Acer velutinum Boiss. Aceraceae + + which factors were most important in Alnus subcordata C. A. Mey Betulaceae + + our study stands. Many studies Artemisia annua L. Asteraceae + considered that plantations should be Asplenium trichomanes L. Aspleniaceae + + + managed to produce natural Atropa belladonna L. Solanaceae + + regeneration instead of clear cut Bromus benekenii (L.) Triman Poaceae + (Kamo et al. 2002; Nagaike 2002; Carex stenophylla Wahlenb. Cyperaceae + + + Carpinus betulus L. Betulaceae + + + Nagaike et al. 2006; Koonkhunthod Chenopodium album L. Chenopodiaceae + et al. 2007). Increasing structural Cornus australis C.A. Mey. Cornaceae + complexity could attract seed Crataegus microphylla C.Koch Rosaceae + + + dispersing wildlife and thus increase Cupressus sempervirens var. Cupressaceae + seed inputs from neighboring native horizontalis G. forest (Koonkhunthod et al. 2007). Diospyros lotus L. Ebenaceae + Natural forests as a seed source, the Equisetum sp. Equisetaceae + forest plantations should be Fagus orientalis Lipsky. Fagaceae + established contiguous to natural + Geum urbanum L. Rosaceae + Gleditsia caspica Desf. Caesalpinaceae + + forest stands or, if that is not Hedera pastuchovii Woren.ex. Grossh. Araliaceae + possible, plantation corridors may be Hypericum perforatum L. Hypericaceae + + established (Yirdaw and Luukkanen Lamium album L. Lamiaceae + + + 2003). Different plant and animal Lamium amplexicaule L. Lamiaceae + species that guaranty the Mentha pulegium L. Lamiaceae + + + environmental health, adapted to Mespilus germanica L. Rosaceae + + + native trees thus native tree species Morus nigra L. Moraceae + should accompany exotic tree species Nepeta micrantha Bge. Lamiaceae + in plantations (Hartley 2002). Oplismenus undulatifolius (Ard) P.Beauv. Gramineae + + Oxalis corniculata L. Oxalidaceae + + + Investigation of stand structure and Parrotia persica (DC.) C.A. Mey. Hammamelidaceae + + + species diversity of Notofagus Phyllitis scolopendrium(L.) Newm. Aspleniaceae + + + dombeyi and pine plantations showed Picris pauciflora Willd. Asteraceae + that plantation of exotic pine species Pinus brutia Ten.* Pinaceae + had significant effect on reduction of Plagiomnium cuspidatum L. Mniaceae + + biodiversity and species richness and Potentilla reptans L. Rosaceae + changed vegetation structure (Paritsis Poterium sanguisorba M. Rosaceae + and Aizen 2007). Prunus divaricata Ledeb. Rosaceae + + + + Natural forest had the most value Pteris cretica L. Pteridaceae + + Punica granatum L. Punicaceae + of richness in regeneration layer in Quercus castaneifolia C. A. Mey Fagaceae + + + our study, and minimum regeneration Robinia pseudoacacia L.* Papilionaceae + was considered in coniferous Rubus hyrcanus Juz. Rosaceae + + + plantation because of closed canopy Rumex acetosa L. Polygonaceae + cover and litter in forest floor. Also, Ruscus hyrcanus Woron. Liliaceaea + + silvicultural treatments (especially Salvia nemorosa L. Lamiaceae + releasing in broad–leaved plantation) Scutellaria nepetifolia Benth. Lamiaceae + caused the growth of invasive species Smilax excelsa L. Liliaceaea + + such as Rubus hyrcanus that Sorghum sp. Poaceae + Ulmus glabra Hudson. Ulmaceae + prevented regeneration growth in Veronica persica Poir. Scrophulariaceae + broad–leaved plantation, but this Viola alba L. Violaceae + + + problem was less in natural forest Zelkova carpinifolia (Pall.) Dipp. Ulmaceae + + + due to the canopy coverage of seed Note: (+: presence,-: absence, *: Exotic species) trees that are the best shelter of lighting conditions to survival of natural regeneration. Nevertheless, total number of regeneration was low in natural forest (Jobidon et al. 2004). Plantation management practices, because of the forest degradation and the less abundance of such as weeding, salvage logging and thinning effectively regeneration of Fagus orientalis and Quercus castaneifolia, set the plant community back to a previous stage of in contrast regeneration of Parrotia persica was high. It succession (Nagaike et al. 2003) There were higher similarity between natural forest and seems that thinning could help increase structural diversity. broad–leaved plantation in woody and herbaceous species Then, structural diversity maintains plant diversity layers (63 and 50% respectively), while coniferous

POURBABAEI et al. – Plant species diversity in plantation forest of North Iran

plantation and natural forest have the lowest similarity in woody species layer (37%). Poorbabaei and Poorrahmati (2009) considered high similarity in species composition between plantation and adjacent natural forest due to the natural forest was the main source of seed in plantation. Neighboring of plantation and natural forest has been resulted in dispersion of hardwood trees seeds within the plantation.

CONCLUSION In conclusion, we found that the natural mixed forest had the most plant diversity and plantations reduced species diversity in this area. Also, we found that coniferous species could diminish the biodiversity especially in herbaceous layer more than broad–leaved species in plantations.

REFRENCES Abdy EM, Mayhead GJ. 1992. The ground vegetation in upland spruce plantation in North Wales. Asp Appl Biol 29: 73-81. Allen R, Platt K, Wiser S. 1995. Biodiversity in New Zealand plantations. New Zealand Forest 39 (4): 26-29. Baguette M, Deceuninck B, Muller Y. 1994. Effects of spruce afforestation on bird community dynamics in a native broad–leaved forest area. Acta Oecology, 15: 275-288. Baktash L. 2003. Effect of plantation on plant diversity in the east of Guilan province, north of Iran. [Dissertation]. Guilan University, Somehsara. [Iran]. Braganc M, De Souza O, Zanuncio JC. 1998. Environmental heterogeneity as a strategy for pest management in Eucalyptus plantations. Forest Ecol Manag 102: 9-12. Brockerhoff E, Ecroyd C, Longer E. 2001. Biodiversity in New Zealand plantation forests: policy trends, incentives, and state of our knowledge. N Z Forest 46: 31-37. Carnus JM, Parrotta J, Brockerhoff E, Arbez M, Jactel H, Kremer A, Lamb D, O'hara K, Walters B. 2006. Planted forests and biodiversity. J Forestry 104 (2): 65-77. Chey VK, Holloway JD, Speight MR. 1997. Diversity of moths in forest plantations and natural forests in Sabah. Bull Ent Res 87: 371-385. Corney PM, Le Duc MG, Smart SM, Kirby KJ, Bunce RGH, Marrs RH. 2006. Relationships between the species composition of forest fieldlayer vegetation and environmental drivers assessed using a national scale survey. J Ecol 94: 383-401. Coroi M, Sheehy Skeffington M, Giller P, Smith C, Gormally M, O’Donovan G. 2004. Vegetation diversity and stand structure in streamside forests in the south of Ireland. Forest Ecol Manag 202: 3957. Donald PF, Haycock D, Fuller RJ. 1997. Winter bird communities in forest plantations in western England and their response to vegetation, growth stage and grazing. Bird Study 44: 206-219. Donald PF, Fuller RJ, Evans AD, Gough SJ. 1998. Effects of forest management and grazing on breeding bird communities in plantations of broadleaved and coniferous trees in western England. Biological Conservation 85: 183-197. Eshaghi Rad J, Manthey M, Mataji A. 2009. Comparison of plant species diversity with different plant communities in deciduous forests. Int J Environ Sci Tech 6 (3), 389-394. Estades CF, Temple SA. 1999. Deciduous-forest bird communities in a fragmented landscape dominated by exotic pine plantations. Ecol Application 9: 573-585 Evans J. 1982. Plantation forestry in the tropics. Oxford University Press, New York. Ferns PN, Cowie RJ, Weir AG. 1992. Managing conifer plantations for the benefit of granivorous birds and mammals. Aspects Application Biology 29: 83-88.

Ferris R, Peace AJ, Humphrey JW, Broome AC. 2000. Relationships between vegetation, site type and stand structure in coniferous plantations in Britain. Forest Ecol Manag 136: 35-51. Freedman B, Zelazny V, Beaudette D, Fleming T, Flemming S, Forbes G, Gerrow JS, Johnson G, Woodley S. 1996. Biodiversity implications of changes in the quantity f dead organic matter in managed forests. Environ Rev 4: 238-265. Ghelichnia H. 2003. Comparison of diversity and abundance in flora plants natural hardwood and plantation softwood in Lajim in Mazandaran. Pajuhesh & Sazandegi 58: 37-41. Ginsberg P. 2006. Restoring biodiversity to pine afforestations in Israel. J Nat Conserv 14: 207-216. Hartley MJ. 2002. Rational and methods for conserving biodiversity in plantation forests. Forest Ecol Manag 155: 81-95. Humphrey JW, Ferris R, Jukes MR, Peace AJ. 2002. The potential contribution of conifers plantations to the UK biodiversity action plan. Botanical Journal of Scotland 54(1), 49-62. Jalali CA, Hosseini SM, Akbarnia M, Ashkaki RB. 2007. Comparison of pure and mixed stands of Populus deltoides. Pajuhesh & Sazandegi 58: 82-88. Jobidon R, Guillaume C, Thiffault N. 2004. Plant species diversity and composition along an experimental gradient of Northern hardwood abundance in picea mariana plantation. Forest Ecol Manag 198: 209221. Kamo K, Vacharangkura T, Tiyanon S, Viriyabuncha C, Nimpila S, Doangsrisen B. 2002. Plant species diversity in tropical planted forests and implication for restoration of forest ecosystems in Sakaerat, Northeastern Thailand. JARQ, 36 (2): 111-118. Khanna PK. 1997. Comparison of growth and nutrition of young monocultures and mixed stands of Eucalyptus globulus and Acacia mearnsii. Forest Ecol Manag 94: 105-113. Koonkhunthod N, Sakurai K, Tanaka S. 2007. Composition and diversity of woody regeneration in a 37–year–old teak (Tectona grandis L.) plantation in northern Thailand. Forest Ecol Manag 247: 246-254. Krebs CJ. 1999. Ecological methodology. Benjamin Cummings, Menlo Park, California. Lee EWS, Hau BCH, Corlett RT. 2005. Natural regeneration in exotic tree plantations in Hong Kong, China. Forest Ecol Manag 212: 358-366. Lemenih M, Teketay D. 2005. Effect of prior land use on the recolonization of native woody species under plantation forests in the highlands of Ethiopia. Forest Ecol Manag 218: 60–73. Lindenmayer DB, Hobbs RJ. 2004. Fauna conservation in Australian plantation forests, a review. Biological Conservation 119: 151-168. Lugo AE. 1997. The apparent paradox of re-establishing species richness on degraded lands with tree monocultures. Forest Ecol Manag 99: 919. Magurran AE. 1996. Ecological diversity and its measurement. Chapman and Hall. Memarian F, Tabari M, Hosseini S, Banj Shafei A. 2007. Comparison of woody species diversity in coniferous stand and broad–leaved coppice stand in Kelardasht region. Journal of environmental studies 42: 103108. Menalled FD, Kelty MJ, Ewel JJ. 1998. Canopy development in tropical tree plantations: a comparison of species mixtures and monocultures. Forest Ecol Manag 104: 249-263. Michelsen A, Lisanework N, Friis I, Holst N. 1996. Plantations and adjacent natural forests in the Ethiopian highlands. Jour Appl Ecol 33: 627-642. Montagnini F, Gonzalez E, Porras C, Rheingans R. 1995. Mixed and pure forest plantations in the humid neotropics: A comparision of early growth, past damage, and establishment costs. Commonw. For Rev 74: 306-314. Moore SE, Allen HL. 1999. Plantation forestry. In: Hunter ML Jr. (eds), Maintaining Biodiversity in Forest Ecosystems. Cambridge University Press, New York. Mosayeb Neghad I, Rostami Shahraji T, Kahneh E, Porbabaii H. 2007. Evaluation of native broadleaved forest plantations in east of Guilan province. Iranian Journal of Forest and Poplar Research 15 (4): 311319. Moss D, Taylor PN, Easterbee N. 1979. The effects on song-bird populations of upland afforestation with spruce. Forestry 52: 129-150. Nagaike T. 2002. Differences in plant species diversity between conifer (Larix kaempferi) plantations and broad – leaved (Quercus crispula) secondary forests in central Japan. Forest Ecol Manag 168: 111-123.

B I O D I V E R S IT A S 13 (2): 72-78, April 2012

Nagaike T, Hayashi A, Abe M, Arai N. 2003. Differences in plant species diversity in Larix kaempferi plantations of different ages in central Japan. Forest Ecol Manag 183: 177-193. Nagaike T, Hayashi A, Kubo M, Abe M, Arai N. 2006. Plant species diversity in a managed forest landscape composed of Larix kaempferi plantations and abandoned coppice forests on central Japan. Forest science 52 (3): 324-332. Newmaster SG, Bell FW, Roosenboom CR, Cole HA, Towill WD. 2006. Restoration of flora diversity through plantations on abandoned agricultural land. Forest Ecol Manag 36: 1218-1235. Norton DA. 1998. Indigenous biodiversity conservation and plantation forestry: options for the future. New Zealand For 43 (2): 34-39. Paritsis J, Aizen MA. 2007. Effect of exotic conifer plantations on the biodiversity of under-story plants, epigeal beetles and birds in Notofagus dombeyi forest. Forest Ecol Manag 255: 1575 – 1583. Perley C. 1994. Biodiversity, sustainability and a land ethic. New Zealand For 39 (1): 2-3. Pilehvar B. 2000. Determination of reserved area for biodiversity conservation by suitable pattern in Vaz forest, west of Iran. [Dissertation] University of Tarbiat Modares, Noor. [Iran]. Poorbabaei H, Poorrahmati G. 2009. Plant species diversity in loblolly pine (Pinus taeda L.) and sugi (Cryptomeria japonica D. Don.) plantations in the Western Guilan, Iran. International Journal of Biodiversity and Conservation 1(2): 38-44. Potton C. 1994. A public perception of plantation forestry. New Zealand For 39 (2): 2-3. Pourbabaei H. 2004. Statistical ecology: a primer on methods and computing (By Ludwig JL, Reynold JF), Guilan University Press, Iran. (Translated in Persian).

Pourbabaei H, Roostami shahraji T. 2007. Study of vegetation diversity in loblolly pine (Pinus taeda L.) plantations in the Azizkian and Lakan areas, Rasht. Journal of environmental studies 33 (41): 85-96. Pourbabaei H, Shadram S, Khorasani M. 2005. Comparison of plant biodiversity in Alnus subcordata L. and mixed Fraxinus coriariifolia and Acer insigne plantations, Tanian region, Someasara, Guilan. Iranian Journal of Biology 17 (4): 357-368. Tucker JW, Hill GE, Holler NR. 1998. Managing mid-rotation pine plantations to enhance Bachman’s sparrow habitat. Wildlife Soc. Bull 26: 342-348. Twedt DJ, Wilson RR, Henne-Kerr JL, Hamilton RB. 1999. Impact of forest type and management strategy on avian density in the Mississippi Alluvial Valley, USA. Forest Ecol Manag 123: 261-274. Wagner RG, Flynn J, Gregory R, Mertz CK, Slovic P. 1998. Acceptable practices in Ontario’s forests: differences between the public and forestry professionals. New Zealand For 16: 139-154. Wang S, Chen HYH. 2010. Diversity of northern plantations peaks at intermediate management intensity. Forest Ecol Manag 259: 360-366. Wilson MD, Watts BD. 1999. Response of brown-headed nuthatches to thinning of pine plantations. Wilson Bull 111: 56-60. Yamashita T, Kasuya N, Nishimura S, Takeda H. 2004. Comparison of two coniferous plantations in central Japan with respect to forest productivity, growth phenology and soil nitrogen dynamics. Forest Ecol Manag 200: 215-226. Yirdaw E, Luukkanen O. 2003. Indigenous woody species diversity in Eucalyptus globulus Labill. ssp. globulus plantations in the Ethiopian highlands. Biodiversity and Conservation 12: 567-582. Zerbe S. 2002. Restoration of natural broad – leaved woodland in central Europe on sites with coniferous forest plantations. Forest Ecol Manag 167: 27-42.

B I O D I V E R S IT A S Volume 13, Number 2, April 2012 Pages: 79-85

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d130205

Determination of long-tailed macaque’s (Macaca fascicularis) harvesting quotas based on demographic parameters YANTO SANTOSA1, KUSMARDIASTUTI2, AGUS PRIYONO KARTONO1, DEDE AULIA RAHMAN1,♥ 1

Wildlife Ecology Laboratory, Department of Forest Resource Conservation and Ecotourism, Faculty of Forestry, Bogor Agricultural University, IPB Campus at Darmaga, Bogor 16680, P.O. BOX 168, West Java, Indonesia, Tel. +62-251-8629150, Fax. +62-251-8629150, ♥email: dede_fahutanipb@mail.com 2 Department of Forestry, Natural Resources Conservation Center of Central Java, Semarang, Central Java, Indonesia. Manuscript received: 15 November 2011. Revision accepted: 28 March 2012.

ABSTRACT Santosa Y, Kusmardiastuti, Kartono AP, Rahman DA. 2012. Determination of long-tailed macaque’s (Macaca fascicularis) harvesting quotas based on demographic parameters. Biodiversitas 13: 79-85. Harvesting quota of long-tailed macaques for breeding purpose should be set up based on demographic parameters. The objectives of this research were to determine demographic parameters affecting the set up of harvesting quota and the sustainable harvesting quotas of long-tailed macaque in Indonesia. This study was expected to provide useful information for consideration of setting up harvesting quotas for long-tailed macaque in Indonesia. This study was conducted in November 2009-Januari 2010 using the equation of Q = Nt-MVP. The results showed varied harvesting quotas for different age classes of long-tailed macaque with an average number of 5 for infant males, 3 for infant females, 5 for juvenile males, 4 for juvenile females, 6 for sub-adult males, 8 for sub-adult females and 2 for adult males. The dominant variable determining quota was survival rate. Key words: fecundity, harvesting quota, long-tailed macaque, survival.

INTRODUCTION Indonesia is one of the largest exporters of long- tailed macaques in the world, besides Malaysia and the Philippines (MacKinnon 1983). The demands of the species are growing due to the development of technology and products used by humans, where long-tailed macaque has significant role as animal model for biomedical research (Eudey 2008). While most wildlife is traded locally and the majority nationally (that is within the political borders of a country or state), long tailed-macaque is also traded internationally (Stoett 2002; Blundell and Mascia 2005; Schlaepfer et al. 2005; Nijman and Shepherd 2007). Long-tailed macaques may be taken from the wild to meet the needs of domestic market, while export demands should come from captive breeding. This is in line with the Decree No.26/Kpts-II/94 concerning the utilization of long-tailed macaque (Macaca fascicularis) and southern pig-tailed monkey (Macaca nemestrina) for export, that exported animals must come from captive breeding. To ensure the sustainable population of longtailed macaque, harvesting quota was used. The number of long-tailed macaques captured from the wild should follow the catch quotas issued by the Director General of Forest Protection and Nature Conservation (PHKA), Ministry of Forestry as the Management Authority in accordance to the recommendation from the Indonesian Institute of Sciences (LIPI) as the Scientific Authority. For example the number of harvesting quota for long-tailed monkeys from the wild in 2006 was 2,000, which increases to 4,100 in 2007, 5,100

in 2008, 15,100 in 2009 but dropped to 5,000 in 2010 (Ditjen PHKA 2011). Special Province of Yogyakarta (DIY) is one of the locations where long-tailed macaques were harvested. Until 2009, long-tailed macaques were captured from Paliyan Wildlife Sanctuary and Kaliurang Recreation Forest. The harvesting quotas for long-tailed macaque in these areas were 200 animals in 2006 and 2007, zero in 2008 and 1200 animals in 2009 (BKSDA Yogyakarta 2007-2010). Previously, based on the export statistics compiled by the Directorate of Protection and Nature Conservation (BKSDA Yogyakarta 2002), a total of more than 86,332 long-tailed macaques were exported between the periods of 1992-1997. Currently, the harvest quotas issued by PHKA contain only the figures for allowable catch, and have not considered detailed classification of the species’s sex and age classes. This has raised a concern that such quotas will threaten the sustainability of the macaque’s population (Santosa and Desi 2010). Numerous studies have concluded that regulation of wildlife trade laws within Asia, be it in relation to international or domestic trade, are insufficient (Davies 2005; Lee et al. 2005; Giles et al. 2006; Nijman 2006; Nekaris and Nijman 2007; Shepherd and Nijman 2007a, b; Eudey 2008; Zhang et al. 2008; Chen et al. 2009), furthermore, wildlife in Southeast Asia such as a long tailed-macaque is under attack due to habitat loss and degradation, global climate change, commercial hunting and competition with introduced species (McNeely et al. 2009; Sodhi et al. 2004). Therefore, there is an urgent need

B I O D I V E R S IT A S 13 (2): 79-85, April 2012

for a more effective wildlife trading regulatory mechanisms, particularly in Indonesia. Santosa (1996) says that harvesting quota is determined by demographic parameters including birth rates, mortality, sex ratio and size of population. These parameters are important components for the development of wildlife population. Thus, the planning and determination of harvesting quotas requires information on demographic parameters of the population in question (Santosa 1993). Based on the above, research on the determination of longtailed macaque harvesting quotas based on demographic parameters was conducted in order to determine the harvest quota of long-tailed macaques based on number and sex ratio, in Paliyan Wildlife Sanctuary and Kaliurang Recreation Forest, both in Yogyakarta, Indonesia. It is expected that such results would become a model for the determination of long-tailed macaques harvesting quotas in other places and identification of variables that affect the demographic parameters of quotas.

f  f Xi Bi Px Lx Lx +1 Lx

 Xi  Bi = crude birth rate/fecundity = number of infants in ith group = number of reproductive adult females in i-group = Lx+1 = 1 -Mortality = number of individuals in X +1age class = number of individuals in age class

Population growth To determine the population growth (Nt +1) in each group was used a modified of matrix Leslie not adrift density (Priyono 1998) where only the female part of the populations would be considered, while the male populations were determined using sex ratio. The calculation was made using Powersim 2.0. The matrix formula for the calculation was: M x Nt = Nt+1

MATERIALS AND METHODS Time and location The study was conducted from November 2009 to January 2010 in Yogyakarta Special Province, precisely in Paliyan Wildlife Sanctuary of Gunungkidul District which is a karts region with an area of 434.60 hectares and in Kaliurang Recreation Forest of Sleman District which is a montane forest. Data collection Data on demographic parameters of long-tailed macaque (Macaca fascicularis) were collected using concentration count method based on preliminary information. Observations were carried out twice daily, in the morning (6-9 a.m) and afternoon (3-6 p.m). Data recorded include number of individuals in each group, number of individuals based on sex, age and class. The numbers of individuals were recorded based on the encountered/directly observed individuals within the observation trail. Individuals were classified based on age as infants, juvenile, sub-adult and adults after Napier and Napier (1967), i.e. infant (0-18 months/ still breast feeding), juvenile (18 months-4 years old), sub-adult (4-9 years old), and adult (9-21 years). Classification of age classes based on Napier and Napier (1967) was more likely to be applied in a study in nature, related to the difficulty to distinguish individual age classes if age is classified into infant, weaning, juvenile, sub-adult and sexual maturity (male and female) by Rowe (1996) which further allows for a controlled study such as in captivity. Data analysis Demographic parameters Numbers of individuals in each group, as well as numbers of individuals based on sex and age classes were used to calculate the crude birth rate / fecundity, and survival rate for each age class. The formula used to calculate fecundity is as follows:

Fxm Fxd Xd δ0 P1 δ1 P2 δ2 P2 δ3

δ0

N0,t

δ1

δ2

N2,t

δ3

N3,t

Nt =

N1,t

= sub-adult fecundity = adult fecundity = adult age class = proportion of infant age class = probability of infant survival = proportion of juvenile age class = probability of juvenile survival = proportion of sub-adult age class = probability of sub-adult survival = proportion of adult age class

Minimum Viable Population (MVP)

Minimum viable population (MVP) is the smallest population size that will ensure a species survival in the long term (Shaffer 1981). MVP is important when decisions are made which can alter the available habitat, and consequently the species population and risk of catastrophic extinction (Harcourt 2002). Similar to the population growth, MVP was also calculated for each age class and sex based on females’ population only, whereas males’ populations were obtained based on sex ratio. The analysis used two algebraic equations, i.e. B = D and Nt, where the intersection value between the two equations determined the MVP value. The formula used was: B=D B D

= birth (birth) = death (mortality)

Further described by the following equation:

SANTOSO et al. – Harvesting quotas of Macaca fascicularis Fxm. Xm + Fxd. Xd = mb. Xb + ma. Xa + mm. Xm + δmd.Xd. .....( i) Fxm = sub-adult fecundity Xm = number of individuals of sub-adult age class Fxd = adult fecundity Xd = number of individuals of adults age class with maximum breeding age of 12 years mb = infant mortality Xb = number of individuals of infant age class ma = juvenile mortality Xa = number of individuals of juvenile age class mm = sub-adult mortality Xm = number of individuals of sub-adult age class δmd = proportion of adult mortality Xd = number of individuals of adult age class

Nt value used N1 value as constant for Powersim, thus if translated in algebraic form became: Nt = (Xm + Fxd Fxm.. Xd + δb. Xb) + (XB + δa Pxb.. Xa) + (Xa + δm Pxa.. Xm) + (Xm + δd Pxm.. Xd) ..... .. (ii) Nt = population size in year-t Fxm = sub-adult fecundity Xm = number of individuals of sub-adult age class Fxd = adult fecundity Xd = number of individuals adult age class with maximum breeding age of 12 years δb = proportion of infants Xb = number of individuals of infant age class Pxb = infant survival rate δa = proportion of juvenile Xa = number of individuals of juvenile age class PXA = juvenile survival rate δm = proportion of sub-adult Xm = number of individual of sub-adult age class Pxm = sub-adult survival rate δd = proportion of adult Xd = number of individual of adult

The two equations above were combined to produce the following intersection: Fxm. Xm + Fxd. Xd-mb. Xb + ma. Xa + mm. Xm + δmd.Xd = Nt-Fxm. Xm + Fxd. Xd + δb. Xb) + (XB + δa Pxb.. Xa) + (Xa + δm Pxa.. Xm) + (Xm + δd Pxm.. Xd).........( iii) Nt = population size in year-t Fxm = sub-adult fecundity Xm = number of individuals of sub-adult age class Fxd = adult fecundity Xd = number of individuals of adult age class with maximum breeding age of 12 years mb = infant mortality Xb = number of individual of infant age class ma = juvenile mortality Xa = the number of individuals of juvenile age class mm = sub-adult mortality Xm = number of individuals of sub-adult age class δmd = proportion of adult mortality Xd = number of individuals of adult age class δb = proportion of infants Pxb = infant survival rate δa = proportion of juvenile

PXA δm Pxm δd

= juvenile survival rate = proportion of sub-adult = sub-adult survival rate = proportion of adult

Value of harvesting quota Value of harvesting quota represented the difference between the numbers of existing individuals with the minimum viable population (MVP). The harvesting quota was calculated for each age class and sex, using the following formula: Qij

= Ntij-MVPi

Qi = harvesting quota of i-age class to j-sex Ntij = number of individuals of i-age class with j-sex on year-t MVPij = minimum viable population of i-age class with j-sex

Analysis of demographic variables that determine quota Based on the matrix equation of population growth and MVP, the variables affecting demographic parameters were survival quota (Px) and fecundity. To determine the dominant variables affecting the quotas, a regression test was done using the following equation: Y = b1X1 + b2X2 + ε b1 1 X2

= regression coefficient = average fecundity = average survival rate

Sensitivity analysis of dominant quota determinant variables Sensitivity test was conducted for the dominant variables determining the quota, which was done by addition and subtraction of 10% to 30% of the dominant variables to observe the extent of the impacts on the value of the quota.

RESULTS AND DISCUSSION Long-tailed macaque group characteristics During the observation periods, three groups of longtailed macaques were encountered in Paliyan Wildlife Sanctuary and four groups in Kaliurang forest. Although Paliyan Wildlife Sanctuary has been disturbed by human activities, nevertheless the number of individuals within each group was higher than those in Kaliurang forest. Group size referred to the number of individuals contained in a group (Priyono 1998). In Kaliurang forest, the group size ranged from 20-45 animals, whereas in Paliyan Wildlife Sanctuary it ranged between 48-68 animals (Table 1). This was in line with Bismark’s (1986) finding where formation and size of groups varies according to habitat types. In primary forest, one group of long-tailed macaque comprised of 10 individuals, in mangrove forest about 15 individuals, and more than 40 individuals in disturbed forest.

B I O D I V E R S IT A S 13 (2): 79-85, April 2012

Table 1. Long-tailed macaques groups characteristics Juvenile M F Paliyan Wildlife Sanctuary 1. 12 7 11 2. 10 6 8 3. 9 4 9 Kaliurang Forest 1. 6 3 5 2. 9 4 7 3. 5 2 5 4. 4 3 3 Note: M = male, F = female Group

Infant

Sub-adult M F

Adult M F

8 8 6

16 17 9

3 3 4

11 5 7

68 57 48

5 5 4 2

9 9 7 3

3 4 3 2

5 7 4 3

36 45 30 20

Total

There were four groups of long-tailed macaque groups observed in Kaliurang forest with a total of 131 individuals, which indicated an increased from previous research results. Ningrum finds as many as 63 individuals in 2002, which later developed into 2 sub-groups with 80 individuals (Fallah 2005) and again into 3 sub-groups in 2009 (Raharjo 2009). Demographic parameters Age structure and sex ratio Age structure is the ratio of individuals of a population in each age class. Table 2 showed the age structure of longtailed macaques in Paliyan Wildlife Sanctuary and Kaliurang forest based on age classification by Napier and Napier (1967). Table 2. Age structure of long tailed macaque group Group size Number of individuals (individuals) Infant: juvenile: sub-adult: adult Paliyan Wildlife Sanctuary 1 68 12: 18: 24: 14 2 57 10: 14: 25: 8 3 48 9: 13: 15: 11 Kaliurang Forest 1 36 6: 8: 14: 8 2 45 9: 13: 14: 11 3 30 5: 7: 11: 7 4 20 4: 6: 5: 5 Group

In almost all groups, the highest number of individuals was found within the sub-adult age class and the lowest within the infant age class. These results were similar to those found in PT. Musi Hutan Persada Forest Concession

(Priyono 1998). The weakness of a qualitative grouping is that time interval between age classes was not the same and that there would be accumulation of individuals in particular age class. Priyono (1998) states that this condition would result in the emergence of a declining population structure (regressive population). The development of population in such age structure would continue to decline if the environmental conditions stayed the same, which after some time, would result in the extinction of the population (Peres 2001). To overcome the inequality of age interval of age class, a population structure was developed within the same age class by dividing the population into age-class intervals. This was done to obtain an increased age structure where the infant age class would be higher than other age classes (progressive populations). Figure 1 showed the graph for group size of each age class with its range of class. Age structure can be used to measure the success of wildlife development and hence to assess its sustainability prospects. Figure 1 indicated sustainable populations of each group of long-tailed macaque in both Paliyan Wildlife Sanctuary and Kaliurang forest shown by the greater number of infants as compared to adults, thus possible future regeneration could occur properly. Sex ratio is the ratio of males to females. Sex ratio of each group of long-tailed macaques in Paliyan Wildlife Sanctuary and Kaliurang forest were given in Table 3. In general, the long-tailed macaque groups in both Paliyan Wildlife Sanctuary and Kaliurang forest had a sex ratio of 1: 2 (Table 3), which was similar to research results by Sularso (2004) in Alas Purwo National Park and by Triprajawan (2007) in Pangandaran Forest Recreation Park. Table 3 Sex ratio of each group of long-tailed macaque Group

Number of females

Number of males

Paliyan Wildlife Sanctuary 1 18 2 17 3 14 Kaliurang Forest 1 11 2 13 3 9 4 7

Sex ratio

38 30 25

1: 2.11 1: 1.76 1: 1.79

19 23 16 9

1: 1.73 1: 1.77 1: 1.78 1: 1.29

Figure 1. Age structure of long-tailed macaque group in (A) Paliyan Wildlife Sanctuary and (B) Kaliurang recreation forest

SANTOSO et al. – Harvesting quotas of Macaca fascicularis

Natality and mortality Natality is the ratio between the number of infants with the number of productive females in sub-adult and adult age classes. The natality of all groups in both study sites showed similar values, i.e., between 0.44-0.67. These suggested that on the average, half of the productive females were able to produce offspring under the assumption that the number of birth is 1 individual (Lavieren 1982). Mortality or death rate is an important determinant of wildlife preservation. High mortality would threaten the wildlife sustainability. Estimation of population mortality rate of long-tailed macaques in the wild was based on the survival rate of each age class. The survival rate of each age class and birth rate of each long-tailed macaque groups in the study sites were tabulated in Table 4. Table 4. Natality and survival rates of each long-tailed macaque’s group Group Natality Pxb_a Pxa_m Pxm_d Paliyan Wildlife Sanctuary 1. 0.44 0.90 0.67 0.24 2. 0.45 0.84 0.89 0.13 3. 0.56 0.87 0.58 0.31 Kaliurang Forest 1. 0.43 0.80 0.87 0.24 2. 0.56 0.73 0.64 0.33 3. 0.45 0.84 0.79 0.27 4. 0.67 0.90 0.42 0.32 Note: Pxb_a: survival rate of infant to juvenile age class; Pxa_m: survival rate of juvenile to sub-adult age class; Pxm_d: survival rate of sub-adult to adult age class

The lowest survival rate was found in sub-adult and adult age classes. The assumption made was based on the presence of competitions for social status that caused the release of individual adult male resulting in fewer numbers of adult males. Meanwhile, infant deaths were usually caused by accidents or eaten by predators (Priyono 1998). However, in general, natural death of long-tailed macaque was very rare. Death was often caused by hunting, capturing to meet quotas and killing by local people as long-tailed macaques are considered as pests in some areas (Thoisy et al. 2000). Population growth The results of analysis using Powersim 2.0 on population growth showed that each long-tailed macaque group experienced an average increase of 20-30% annually. Group 1 in Paliyan Wildlife Sanctuary had an initial number of 68 individuals, and during year 1 increased to 89 and in year 2 to 108 individuals; group 2 initially had 57 individuals, then increased to 71 in year 1 and to 89 in year 2; group 3 with initial total individuals of 48 and increased to 72 in year 1 and to 69 in year 2. Analysis on population growth in Kaliurang forest resulted the following figures: group 1 with an initial total number of 36 individuals, increased to 44 in year 1 and to 53 in year 2; group 2 with an initial number of 45 individuals, increased to 57 in year 1 and 69 in years 2; group 3 started with 30 individuals,

became 36 in year 1 and 44 in year 2; group 4 with starting number of 20, increased to 23 in year 1 and 29 in year 2. Minimum Viable Population (MVP) The results showed that the MVP values varied between each long-tailed macaque groups. The highest MVP was found in group 1 of Paliyan Wildlife Sanctuary with 86 individuals and the lowest was found in group 3 of Kaliurang forest with 37 individuals (Table 5) . Table 5. The MVP values of each group of long-tailed macaque. Infant Juvenile M F M F Paliyan Wildlife Sanctuary 1. 10 19 7 14 2. 7 14 9 17 3. 8 3 3 6 Kaliurang Forest 1. 4 8 5 9 2. 5 10 4 8 3. 3 6 2 4 4. 6 6 4 4 Group

Sub-adult M F

Adult M F

Total

5 3 16

10 5 6

7 6 6

14 12 11

86 73 59

2 4 3 5

4 8 5 5

4 5 5 9

7 10 9 9

43 54 37 48

Harvest quota Analysis of both, population growth and MVP values suggested that MVP for each group should be obtained in year 1 so that harvesting could be done in year 2. The harvest quota itself was calculated for each age class and sex to avoid over-exploitation of certain sex and age class that could threaten group’s sustainability. The value of the harvest quota was determined based on consideration of sex ratio, where a male can mate with more than 2 females, even up to 1:7 for the purpose of reproduction (Rowe 1996). Results of this research showed that harvests for subadult age class were found greater in group 2 of Paliyan Wildlife Sanctuary, which comprised of 11 sub-adult males and 18 sub-adult females, while the lowest was found in group 4 of Kaliurang forest that comprised of only 2 subadult males and 1 sub-adult female. For infant age class, the largest harvesting quota was found in group 2 of Paliyan Wildlife Sanctuary and Kaliurang forest, while the largest harvesting quota for juvenile age class was found in group 3 of Paliyan Wildlife Sanctuary. On the other hand, the largest harvesting quota for adult age class was found in group 1 of Paliyan Wildlife Sanctuary. The average harvest quotas for the seven groups in year-2 comprised of 5 infant males, 3 infant females, 5 juvenile males, 4 juvenile females, 6 sub-adult males, 8 sub-adult females and 2 for adult males. The harvesting quotas for each age class and sex in each group studied were tabulated in Table 6. Based on the calculation, for the next 11 year, harvesting quotas for each age class and sex would experienced annual increase with an average of 20% per year, as shown in Figure 2. This figure showed the increase in harvest quotas for female infant age class. The calculation was made based on population growth data without harvesting quota. With the increasing number of population, the harvest quota would also increase.

B I O D I V E R S IT A S 13 (2): 79-85, April 2012

Table 6. Harvesting quotas for each long-tailed macaque group Infant Juvenile M F M F Paliyan Wildlife Sanctuary 1. Size 11 22 9 18 MVP 3 19 2 14 Quota 8 3 7 4 2. Size 10 19 6 12 MVP 2 14 3 17 Quota 7 5 3 0 3. Size 7 13 8 15 MVP 3 16 1 6 Quota 4 0 7 9 Kaliurang Forest 1. Size 6 11 4 7 MVP 2 8 2 9 Quota 4 3 2 0 2. Size 8 16 6 12 MVP 2 10 2 8 Quota 6 6 4 4 3. Size 4 7 4 8 MVP 1 6 1 4 Quota 3 1 3 4 4. Size 4 8 6 11 MVP 1 6 1 4 Quota 3 2 5 7 Average 5 3 5 4 Group

Sub-adult M F

Adult F

11 2 9

21 10 11

6 2 4

11 14 0

12 1 11

23 5 18

3 2 1

5 12 0

6 1 5

12 6 6

4 2 2

7 11 0

6 1 5

12 4 8

3 1 2

5 7 0

6 2 4

12 8 4

4 2 2

7 10 0

5 1 4

9 5 7

2 2 0

4 9 0

3 1 2 6

6 5 1 8

2 2 0 2

3 9 0 0

Analysis of demographic variables determining quota The survival rate and fecundity were analyzed using linear regression. The average value of survival rate was found to be 0.60, while the average fecundity was 0.16. Regression results showed that the dominant survival variable determining the harvest quotas was the equation Y = 0.0885 X + 0.7873, meaning that independent variables (X) significantly affected dependent variables (Y). This was indicated by the analysis of variance regression equation, which had a value of R2 = 0.8174, which signified that overall, all independent variables (X) were significantly affecting dependent variables (Y) and more than 81% of the quota frequency was described by the existing variables. Harvesting quota would increase with the increased value of survival rate. Sensitivity analysis of dominant variables affecting quotas Sensitivity analysis (Table 7) of survival probability showed that an increase and a decrease by 10% would affect the size of quotas, by an increase and decrease of Âą 15%. Table 7. Sensitivity analysis survival chance on quota. No. 1 2 3 4 5 6 7

Scenarios Early survival rate Survival rate decreased by 10 % Survival rate decreased by 20 % Survival rate decreased by 30 % Survival rate increased by 10 % Survival rate increased by 20 % Survival rate increased by 30 %

Average quota (individuals) 26 22 19 16 30 35 39

Table 7 signified that increasing survival rate would increase the harvest quotas. One effort to increase survival rate was through population management such as harvesting (Novaro et al. 2000) apart from habitat management through planting of dietary vegetation, cover and providing sufficient space. This will facilitate protection of primates and provide opportunities for improving the sustainable use of other forest species (Thoisy et al. 2005).

CONCLUSION AND RECOMENDATIONS

Figure 2. The size of harvest quota for infant females up to year11

Harvesting is one of strategy in maintaining a natural balance. According to Bailey (1984), populations that are not harvested rarely showed increased in population, thus harvest increased the population growth.

The size of harvesting quotas for each long-tailed macaque group varied depending on the survival rate and fecundity. The average harvest quotas for the seven groups studied in year 2 composed of 2 infant males, 3 infant females, 2 juvenile males, 4 juvenile females, 4 sub-adult males and 8 sub-adult females. The determinant dominant variable of the harvesting quota was survival rate. As a scientific study, results of this research can be used for considerations in setting up quota in Indonesia, specifically within the Special Region of Yogyakarta. To balance the growth in demands for long-tailed macaques, it is necessary to establish intensive ex-situ breeding program to reduce the pressure of wild-caught animals.

SANTOSO et al. â&#x20AC;&#x201C; Harvesting quotas of Macaca fascicularis

REFERENCES Bismark M. 1986. Habitat and behavioural studies of proboscis monkey in Kutai National Park , East Kalimantan. Buletin Penelitian Hutan 474: 67-79. BKSDA Yogyakarta. 2002. Report on monitoring of potentials and problems of long-tailed macaque. Natural Resource Conservation Agency, D.I.Yogyakarta, Yogyakarta. BKSDA Yogyakarta. 2007-2010. Statistical Report of Forestry in BKSDA Yogyakarta. Unit of Natural Resource Conservation D.I.Yogyakarta, Yogyakarta. Blundell AG, Mascia MB. 2005. Discrepancies in reported levels of international wildlife trade. Conserv Biol 19: 2020-2025. Chen TH, Chang HC, Lue KY. 2009. Unregulated trade in turtle shells for Chinese Traditional Medicine in East and Southeast Asia: the case of Taiwan. Chelonian Conserv Biol 8: 11-18. Davies B. 2005. Black market: inside the endangered species trade in Asia. Earth Aware Editions, San Rafael, USA. Ditjen PHKA. 2011. Harvesting quota of long-tailed macaque from natural habitat in 2006-2010. Ditjen PHKA-Ministry of Forestry, Jakarta. Eudey AA. 2008. The crab-eating macaque (Macaca fascicularis): widespread and rapidly declining. Primate Conserv 23: 129-132. Fallah M. 2005. Density and structure population of long-tailed macaque (Macaca fascicularis) in Plawangan Turgo recreation forest, Kaliurang recreation area. [Hon. Thesis]. Faculty of Forestry, Gadjah Mada University, Yogyakarta. Giles BG, Truong SK, Do HH, Vincent ACJ. 2006. The catch and trade of seahorses in Vietnam. Biodiv Conserv 15: 2497-2513 Harcourt AH. 2002. Empirical estimates of minimum viable population sizes for primates;tens to tens of thousand? Anim Conserv 5: 237-244 Lavieren V. 1982. Management of conservation areas. School of Environmental Conservation Management. Ciawi, Bogor. Lee RJ, Gorog AJ, Dwiyahreni A et al. 2005. Wildlife trade and implications for law enforcement in Indonesia: a case study from North Sulawesi. Biol Conserv 123: 477-488. MacKinnon K. 1983. WHO Primate Resources Programme, feasibility study. Phase II. Bogor. McNeely JA, Kapoor-Vijay P, Zhi L et al. 2009. Conservation biology in Asia: the major policy challenges. Conserv Biol 23: 805-810. Napier JR, Napier PH. 1967. A handbook of living primates: morphology, ecology, and behaviour of non human primates. Academic Press, New York. Nekaris KAI, Nijman V. 2007. CITES proposal highlights rarity of Asian nocturnal primates (Lorisidae: Nycticebus). Folia Primatol 78 (3): 211-214. Nijman V, Shepherd CR. 2007. Trade in non-native, CITES-listed, wildlife in Asia, as exemplified by the trade in freshwater turtles and tortoises (Chelonidae) in Thailand. Contrib Zool 76 (3): 207-211. Novaro AJ, Redford KH.Bodmer RE.. 2000. Effects of hunting in source-sink systems in the Neotropics. Conserv Biol 14: 73-721. Nijman V. 2006. In situ and ex-situ status of the Javan gibbon and the role of zoos in conservation of the species. Contrib Zool 75 (3-4): 161-168 Ningrum WNW. 2002. Behavioral Long Tailed Macaques (Macaca fascicularis) in. Recreation Forest of Kaliurang. [Hon. Thesis]. Faculty of Forestry, Gadjah Mada University, Yogyakarta. Novaro AJ, Redford KH, Bodmer RE. 2000. Effect of hunting in sourcesink systems in the neotropics. Conserv Biol 14: 713-721.

Peres CA. 2001. Synergetic effects of subsistence hunting and habitat fragmentation on Amazonian forest vertebrates. Conserv Biol 15: 1490-1505. Priyono A. 1998. Determination of optimum population number of longtailed macaque (Macaca fascicularis Raffles) in captivity with breeding system at natural habitat: Case study in PT. Musi Hutan Persada. [Thesis]. Graduate Program, Bogor Agricultural University, Bogor. Raharjo A. 2009. Habitat selection by long-tailed macaque (Macaca fascicularis) in use zone Plawangan Turgo recreation forest, Kaliurang recreation area, Gunung Merapi National Park. [Hon. Thesis]. Faculty of Forestry, Gadjah Mada University, Yogyakarta. Rowe N. 1996. The pictorial guide to living primates. Proc R Soc London. B 271: 1135-1141. Santosa Y, Desi I. 2010. Policy evaluation for setting up quota for longtailed macaque (Macaca fascicularis) in Indonesia. Media Konservasi Special edition 2010. Faculty of Forestry, Bogor Agricultural University, Bogor Santosa Y. 1993. The final report of quantitative strategies for estimating some demographic parameters and population of wildlife harvesting quotas based approach of behavioural ecology: a case study of longtailed macaque populations (Macaca fascicularis) on the island Tinjil. Faculty of Forest, Bogor Agricultural University, Bogor. Santosa Y. 1996. Significant bio-ecological importance in long-tailed macaque (Macaca fascicularis) business. Media Konservasi 5 (1): 2529. Schlaepfer MA, Hoover C, Dodd CK. 2005. Challenges in evaluating the impact of the trade in amphibians and reptiles on wild populations. BioScience 55: 256-264 Shaffer M.L. 1981. Minimum population sizes for species conservation. BioScience 31: 131-134. Shepherd CR, Nijman V. 2007a. An overview of the regulation of the freshwater turtle and tortoise pet trade in Jakarta, Indonesia. TRAFFIC Southeast Asia, Kuala Lumpur Shepherd CR, Nijman V. 2007b. An assessment of wildlife trade at Mong La market on the Myanmar-China border. TRAFFIC Bull 21: 85-88 Sodhi NS, Koh LP, Brook BW, Ng PKL. 2004. Southeast Asian biodiversity: an impending disaster. Trends Ecol Evol 19: 654-660 Stoett P. 2002. The international regulation of trade in wildlife: institutional and normative considerations. Int Environ Agreem Pol Law Econ 2: 195-210 Sularso E. 2004. Population study of long-tailed macaque (Macaca fascicularis) and the constituent habitat vegetation structure at the Resort Rowobendo Alas Purwo National Park, Banyuwangi, East Java. [Hon. Thesis]. Faculty of Forestry, Gadjah Mada University, Yogyakarta. Thoisy B. de, Francois R,Catherine J. 2005. Hunting in northern French Guiana and its impact on primate communities. Oryx 39 (2): 149-157. Thoisy B. de, Massemin D, Dewynter M. 2000. Hunting impact on a neotropical primate community: a preliminary case study in French Guiana. Neotropical Primates 8: 141-144. Triprajawan, T. 2007. Population size and Home Range of Long Tailed Macaques (Macaca fascicularis) in TWA Pangandaran, Ciamis District, West Java. [Hon. Thesis]. Faculty of Forestry, Gadjah Mada University, Yogyakarta. Zhang L, Ning H, Sun S. 2008. Wildlife trade, consumption and conservation awareness in southwest China. Biodiv Conserv 17: 1493-1516.

B I O D I V E R S IT A S Volume 13, Number 2, April 2012 Pages: 86-91

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d130206

The population condition and availability of feed of cuscus in the Arfak Mountain Nature Reserve, West Papua ANTON SILAS SINERY1,♥, CHANDRADEWANA BOER2, WARTIKA ROSA FARIDA3, ♥♥ 1

Faculty of Forestry, State University of Papua, Jl. Gunung Salju, Amban, Manokwari 98314, West Papua, Indonesia. Tel. +62-986-211065, Fax. +62986-211065, email: anton_sineri@yahoo.com 2 Faculty of Forestry, Mulawarman University, Samarinda 75123, East Kalimantan, Indonesia. 3 Zoology Division, Research Center for Biology, Indonesian Institute of Sciences (LIPI), Cibinong-Bogor 16911, West Java, Indonesia. email: wrfarida@indo.net.id Manuscript received: 21 February 2011. Revision accepted: 28 March 2012.

ABSTRACT Sinery AS, Boer C, Farida WR. 2012. The population condition and availability of feed of cuscus in the Arfak Mountain Nature Reserve, West Papua. Biodiversitas 13: 86-91. The cuscus is a pouched marsupial grouped in the Phalangeridae family, which is nocturnal, arboreal, herbivore, and in most cases the tail is prehensile. The animals are legally protected due to low reproduction, limited distribution area, and high rate of illegal hunting. The illegal hunting happened not only in the production forest areas but also in the reserve areas such as Nature Reserve of Arfak Mountain, directly or indirectly, affects the life quality of the ecosystem, mainly cuscuses population. Therefore, it is necessary to do efforts to have a better management of the region to ensure the sustenance of many components in it. This research is aimed to know the population density of cuscus in Arfak Mountain Nature Reserve and carried out for two months. The method used was descriptive by using direct and indirect observation. The result shows that cuscuses existing in the Arfak Mountain conservation area were northern common cuscus (Phalanger orientalis), ground cuscus (Phalanger gymnotis) and common spotted cuscus (Spilocuscus maculatus). The biggest individual number is of P. orientalis with 39 individuals consisting of 18 males and 21 females, the second is of P. gymnotis with 10 individuals consisting of 4 males and 6 females, and the smallest is of S. maculatus with 9 individuals consisting of 4 males and 5 females. From the total of 58 cuscuses, there are 38 adult and 20 young cuscuses. There are 20 forest plant species identified as feed resources of cuscus in Arfak Mountain Nature Reserve. The parts of forest plant consumed by cuscus are fruits and young leaves. P. gymnotis also consumes small insects such as grasshopper. The cuscuses spread from lowland forest to highland forest (2,900 m asl.) Key words: cuscus, population, forest plant species, Arfak Mountain

INTRODUCTION Papua and West Papua as an integral part of Indonesia has the region's natural wealth and tremendous biodiversity in South East Asia. The diversity includes the richness of fauna such as mammals and the terrestrial ecosystem diversity from the coastal to the high mountain ecosystems. Approximately 200 species of land mammals have been found in this region, and 154 species of which form a large population including the endemic species and the introduction one (Petocz 1987). This abundance is a human life support but its existence cannot be confirmed for sure, because of the lack of information, the uneven distribution and excessive exploitation. According to the International Union for the Conservation of Nature and Natural Resources (IUCN 2000), Indonesian wildlife threatened with extinction are 128 species of mammals, 104 species of birds, 19 species of reptiles, 60 species of fishes, and 29 species of invertebrates (Anon 2004). When linked to deforestation rate, which according to Greenpeace was 2.8 million hectares per year, it is expected to lead to more extinction in the future.

Cuscus is a marsupial mammal (marsupials) which is arboreal, nocturnal, and herbivore. Menzies (1991), Petocz (1994) and Flannery (1994), each states that the deployment of cuscus includes the islands of Indonesia (Papua, Sulawesi, Maluku, and Timor Island), Papua New Guinea, New Britain, Solomon Islands, Cape York Australia, and Queensland. In New Guinea (PNG and Papua) there are 11 species of cuscus from the genus of Spilocuscus (spotted cuscus) to the genus of Phalanger. In Papua, there are seven species of cuscus, namely common spotted cuscus (Spilocuscus maculatus), black spotted cuscus (S. rufoniger), Waigeo cuscus (S. papuensis), northern common cuscus (Phalanger orientalis), ground cuscus (P. gymnotis), silk hair cuscus (P. vestitus), and hilly forest cuscus (P. permixtio). Cuscus is protected by the Decree of the Minister of Agriculture No. 247/KPTS/UM/4/1979 and Government Regulation No. 7 of 1999 on the preservation of plants and animals. Globally this species is listed in Appendix II of Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES 2011). The Arfak Mountain Nature Reserve is one of the conservation area in Papua with an area of 68.325 ha

SINERY et al. – Cuscus of the Arfak Mountain Nature Reserve, West Papua

according to the Minister of Forestry Decree No. 783/KptsII/1992 with a high biodiversity (Anon. 2003). The explorations done by Lesson (1824-1827) and d'Albertis and Beccari (1872-1873) found at least 320 species of birds, 350 species of butterflies, and 110 species of mammals. Aside from being a center of diversity of butterfly wings (Ornithoptera spp.), it also serves as a habitat for many plants such as matoa, nyatoh, gaharu, rattan, bamboo, various species of orchids and a number of endemic animals like paradise birds (cenderawasih), tree kangaroos, porcupines, skunks and various other species of animals (Laksono et al. 2001). According to Menzies (1991) and Flannery (1994), Arfak Mountains is one of distribution areas of spotted cuscus. According to Sinery (2010), in the southern part of Arfak Mountains exist some populations of cuscus. Petocz (1994) mentioned that unspotted cuscus have a large population allegedly spreads in almost all mainland of New Guinea, including Arfak Mountains. The results of interviews with one of the staff of Natural Resources Conservation Center of West Papua and several communities around the nature reserve of Arfak Mountains show that there are at least three species of cuscus in the region. It is also known that cuscus is often hunted in the surrounding region as a source of food, but scientific things about the population and other aspects of the animals have not been widely known. This study aims to determine the condition of cuscus population and the carrying capacity of habitat based on the availability of food in Arfak Mountains Nature Reserve. The results are expected as one of the information and consideration for all parties in wildlife management efforts both in-situ and ex-situ and the development of the Arfak Mountains Nature Reserve area in the future.

MATERIALS AND METHODS The research was conducted in the area of Arfak Mountains Nature Reserve, Manokwari, West Papua Province, Indonesia. The method used in this research is descriptive with the technique of direct and indirect observations and interviews. The duration of the study was 2 months from July to August 2007. Equipments used in the study were the Global Positioning System (GPS), binoculars, dissecting set, thermo-hygrometer, clinometers, thirst meter, compass, scales, tape measure, camera trapping, phi band, scissor cuttings, gloves, flashlights, timer, stopwatch, machetes, cage/plastic bags, plastic bracelets, tally sheet, a key of Identification of the type of cuscus, camping equipment, location map (scale 1: 350,000) and 2004 Landsat imagery cotton, alcohol 70% and plastic rope. The plot of the study was determined in accordance with the presence of cuscus from the previous survey results, namely the information from the regular cuscus hunters. The area of the study site was 420 ha with a baseline parallel to the shoreline and transects direction parallel to the contours which is perpendicular to baseline.

The study began by creating a baseline that was pioneering parallel of 1,200 m along the shoreline. The baseline was divided into six point transects perpendicular to the baseline and proportionally placed at the point of 01,200 m with the distance transects of 200 m. Each transect length is 3,500 m so that the length of transect was 21,000 m and the width corresponding to the minimum sight distance (50 m). The data collected consists of primary data that is the data of observations and field interviews and the secondary data that is data obtained from the relevant authorities. Primary data collected consists of: cuscus population (the description of the population and the type of cuscus), species of feed and the general condition of cuscus’ habitat. Secondary data collected includes data on climate and the general state of the study site. The morphological data of the cuscus were tabulated from the measurement results, direct identification, and documentation via camera trapping. Cuscus population density analysis was made using the equation according to Sugianto (1994) which was as follows: N = n(2n-1)A 2LΣr N = density of population, n = number of individuals encountered, A = Area of the region (plot observations), L = length of line / transect, Σr = Distance of the points where the cuscus were found with a track point / transect Determination of the diversity of feed types as indicators of habitat carrying capacity to the existence of cuscus is done by using species diversity indices (H) with the formula from Shannon and Wiener, (1949) in Odum, (1993):

H = diversity index (Shannon Index), ni = number of individuals of each species N=Number of individuals of all species Determination of the individuals which are more concentrated in one or several species in the study site was conducted by using the dominance index (D) according to the formula Simpson (Odum 1993) as follows:

C = dominance index, ni = number of individuals of each species, N = Number of individuals of all species Determination of individual distribution of each species in the region carried out by using the evenness index (e) of Pielou (Odum (1993) with the following formula:

B I O D I V E R S IT A S 13 (2): 86-91, April 2012

88 e=. Ȟ . logS

E = the evenness index, Ȟ = the diversity index S = number of species that was present Data related to the climatic condition of the study site consisting of rainfall, temperature, and humidity will be analyzed in the tabulation.

RESULTS AND DISCUSSIONS The results show that there are 3 species of cuscus in the Nature Reserve of Arfak Mountains which were captured, namely northern common cuscus (P. orientalis), ground cuscus (P. gymnotis) and the common spotted cuscus (S. maculatus) (Figure 1). Communities surrounding the Arfak Mountains Nature Reserve group cuscus into several distinct species based on morphological characters such as coat color, body size, and habitat. The Hatam people who were the majority in the Arfak Mountains Nature Reserve recognizes three species of cuscus in the region, namely mengrep (plain brown cuscus, that is P. orientalis), minyam (ground cuscus, that is P. gymnotis) and mbrat and mifan (common spotted cuscus, males and females, that is S. maculatus). Description of species and number of cuscus The identification of six samples of P. orientalis from Arfak Mountains Nature Reserve shows that this type of male has a body length and weight that range from 400 mm to 445 mm and 2,200 grams to 2,800 grams. Female’s body size is smaller than the male’s, namely body length ranges from 385 mm to 425 mm and body weight ranges from 2,000 grams to 2,500 grams. The males and females of P. orientalis have similar hair dominated by brown, along the middle dorsal stripe that extends from the base of the nose (anterior) through the inter-parietal bone, dorsal and to the rear (posterior) to the base of the tail. The females’ fur is dark (dark brown) when compared with males who have lighter fur (grayish brown). The head of both is more elongated with a protruding ear condition. The identification of six samples of the captured P. gymnotis of both male and female adults from the area of Arfak Mountains Nature Reserve showed that males of this species has body length and body weight ranged from 405 mm to 446 mm and 2,200 grams to 2,800 grams. The size of the female body’s length and weight ranges from 385 mm to 425 mm and 2,000 grams to 2,500 grams. There are white patches behind the ear which is clearly visible because it is not covered with feathers in it. The color of the dorsal of the males is like the head which is brown with silvery effect on the tip of the feather. Finer hairs similar to wools spread from the dorsal to ventral and ends on the outer side of the wrist and leg. Based on the observation on S. maculatus in the region of Arfak Mountains Nature Reserve, there are two

variations of cuscus, namely the plain white and spotty brown. The identification of six examples of this type of the captured cuscus showed that males from this region have body length and body weight ranged from 515 mm to 555 mm and 4,000 grams to 4,800 grams. The female body’s length and weight range from 485 mm to 525 mm and 3,000 grams to 4,100 grams. The head of the male is yellowish brown and spread out from the base of the nose through the inter-parietal bone toward the back (posterior). The dorsal feathers with yellowish brown spots are spread from the base toward the back of the head spotted with the darker color (dark brown). This color is spread toward the side of the body until the outer part of arms and legs and ventral borders. Estimated population of cuscus Based on the results of monitoring, it is known that in the area of 14,780 m2 or 1.4 ha there are as many as 58 individuals. From that number, 39 individuals or 67.2% is the type of P. orientalis with the highest individual spread compared with the other two cuscus species found at the sites. P. gymnotis consist of 10 individuals or 17.2% and S. maculatus consist of 9 individuals, or 15.5%. P. orientalis has a larger population so its existence is predicted to be able to continue even improved in the future when compared to P. gymnotis and S. maculatus. This is because P. orientalis has a higher reproductive capacity than the two other species (Farida et al. 2001; Sinery 2006, 2010). But this is not true in general, because to this date on their population has not been known. The results of observation indicate that two of the three samples found each having 2 and 1 young aged about 1 to 3 months in the pouch. Body length of the young ranges 5085 mm. Based on these results it can be concluded that the litter size of P. orientalis is one or more infants. This is consistent with the statement of Menzies (1991) stating that the genus of Phalanger usually gives more than one infant in one birth so this type of cuscus has a large population compared to the genus of Spilocuscus. But the statement did not say how many individuals of cuscus were in a specific scale area. According to Sinery (2010), in their natural habitat and in the captivity cuscus deliver 1 or 2 infants in each birth with the reproductive phase of 1-2 times per year. The life span of cuscus ranges from 10 years to13 years in the wild. The young cuscus aged less than a week is not covered with fur. The body length of young cuscus just weaned ranges from 100 mm to125 mm. Its body is covered with fine hairs evenly on the dorsal, ventral, head, hands and feet. Based on the number of individuals in the population documented, there are 44.83% male and 55.17% female. These conditions indicate the existence of equilibrium in reproduction pair because cuscus is not monogamous. This fact indicates that the regeneration cuscus population in the region is expected to continue in the future. Table 1 shows that total population of cuscus in an area of 105 ha is 95 individuals. Population distribution of cuscus is as follows: P. orientalis 67 individuals, P. gymnotis 17 individuals, and S. maculatus 11 individuals. The estimation of cuscus population at the study site is 317

SINERY et al. – Cuscus of the Arfak Mountain Nature Reserve, West Papua

individuals in the area of 420 ha or approximately one individual per ha. Therefore, the cuscus population is potential to be pursued as one of the objects in the development of the area of Arfak Mountains Nature Reserve in the future. Tabulated results show effective population size of cuscus can be managed, because population density reached 317 individuals, or approximately 105 cuscuses for each species. The number of 317 is considered to comply the effective population size of the threat of local extinction in the northern region of Arfak Mountains Nature Reserve. According to Franklin (1980) in Maturbongs (1999) it is required at least 50 individuals to maintain genetic diversity in captivity. The number is determined accordance to the experience that the stock of animals in captivity can be

maintained if the loss of biodiversity as much as 2-3% per year, while for the 50 individuals will only lose 1% of genetic diversity. Table 1. Population density of cuscus in the Arfak Mountains Nature Reserve Number of individuals

Species of cuscus

(ni)

P. orientalis P. gymnotis S. maculatus Total

39 10 9 58

Distance between cuscus and transect (r) 1131 276 341 1748

Population density (N) 67 17 11 95

Note: r = m ; transect’s length (L) = 21 000 m transect’s area (A) = 105 ha

Figure 1. A. Phalanger orientalis, B. Phalanger gymnotis, C. The male (left) and D. female (right) of Spilocuscus maculatus found in the Arfak Mountains Nature Reserve, Manokwari.

B I O D I V E R S IT A S 13 (2): 86-91, April 2012

Based on these assumptions, the size of the open population such as cuscus population in Arfak Mountains Nature Reserve will be able to survive in the future because of the flexibility activities (feeding, mating, and other activities) and the abundant of feed resources. The estimation results if connected with home range per individual cuscus which is between 1,225 m2 and 2,400 m2, then the population of 317 cuscuses will require a minimum area of 388,325 m2 (38 ha) and a maximum of 760,800 m2 (76 ha). The analyzes indicate that the carrying capacity of cuscus habitat at the site of this study is sufficient because the cuscus in the region has a larger effective area compared to its population. The food of the cuscus The species of forest plants consumed by cuscus as a feed resource in Arfak Mountains Nature Reserve is quite varied, consisting of fruit and leaves. There are 17 types of forest plants consumed by cuscus in the region. The analysis showed that the pole stage vegetation has the largest number of 87 individuals consisting of 16 species. Ten species of them are the main feed of cuscus which are dominant and spread evenly over the study site. They are Sterculia parkinsonii, Dracontomelon edule, Pometia sp., Myristica sp., Syzygium sp., Ficus spp., Lansium domesticcum, Hernandia peltata, Cerbera floribunda and Intsia bijuga, respectively. On the other side, saw timber stage vegetation has 81 individuals consisting of 15 species. Ten species of them are the main feed of cuscus which are dominant and spread evenly on the observed location. They are Cerbera floribunda, Intsia bijuga, Gnetum gnemon, Hernandia peltata, Ficus spp., Syzygium sp., Lansium domesticum, Myristica sp., Pometia sp., and Sterculia parkinsonii, respectively. Sinery (2002, 2006) states that any species of cuscus is fruit eater (frugivores). However Phalanger gymnotis is also carnivores, especially against insects and other small animals. Analysis of the level of diversity, dominance, and evenness showed that species diversity index was 0.301. Regarding the criteria of diversity index or the degree of species diversity, Shannon in Sugianto (1994) considered that species diversity is high when H > 3, moderate when 1 < H < 3, and low when H < 1. Therefore, Arfak Mountains Nature Reserve has a low diversity of vegetation species for the cuscus’ feed (H < 1). The high diversity of species within a vegetation community is characterized by an abundance of many species with the same or nearly the same. The analysis of the dominance level shows that the dominance index of the vegetation which is cuscus’ feed at the study site was 0.501. This condition illustrates that the distribution of cuscus’ feed according to each type is low. Distribution of individuals of each species is not balanced, and only a few species have the number of individuals that is dominant. The analysis of the level of evenness shows that evenness index of vegetation which are cuscus’ feed in the study site was 0.253. This figure illustrates that the distribution of cuscus’ feed according to the species is not well spread. According to Santosa (1995), evenness index indicates the proportion size of individuals number in each

species found in a particular community. When each type has the same number of individuals then the community is said to have a maximum value of evenness index. The value of species evenness ranges from 0 to 1 according to Krebs (1989). Estimated availability of cuscus’ feed as an illustration of habitat carrying capacity is as follows: the basic assumption that the average feed requirement is 0.5 to 1 kg per head per day. Individual density is 1 head per ha. When a tree (e.g. Ficus septica or Syzygium sp.) produces 30-50 kg of fruit per season with a frequency of at least 2 times a year then the estimated availability of food is abundant at the sites. According to Sinery (2010), of all species of cuscus’ feed in the forest, Ficus septica or Syzygium sp. is a key species for wildlife frugivore like cuscus because it can bear fruit throughout the year.

CONCLUSION Of the seven species of cuscus found in Papua and West Papua, three species are found in the area of Arfak Mountains Nature Reserve, especially in the southern region. The three species of cuscus are northern common cuscus (Phalanger orientalis), ground cuscus (P. gymnotis), and the common spotted cuscus (Spilocuscus maculatus). The number of cuscus found during the study period was 58 with an estimated density of 95 cuscus per 105 ha, then it is predicted only one cuscus is found in 1 ha. P. orientalis has the biggest number of individuals with the highest level of dominance compared to others species because this species has higher reproductive capacity. There are 17 species of forest plants consumed by cuscus as feed resources consisting of 16 species of pole stage vegetation and 15 species of saw timber stage vegetation. In term of quantity, the amount of feed available is abundance for the needs of cuscus in the region.

REFERENCES Anon. 2003. Recognize of the Arfak Mountains Nature Reserve. Balai Penelitian dan Pengembangan Kehutanan Manokwari Irian Jaya, Manokwari [Indonesia] CITES. 2011. Convention on International Trade in Endangered Species of Wild Fauna and Flora. 9th edition – 2011. Appendices I, II and III (27/04/2011). Geneva, Switzerland. http://www.cites.org Farida W. 2001. Cuscus (Phalanger sp.) utilization by West Timorese community, East Nusa Tenggara. J Biota 6 (2): 84-85 [Indonesia]. Flannery T. 1994. Cuscus of the world. A monograph of the Phalangeroidea. Geo Production Pty Ltd, Australia. IUCN. 2000. IUCN Red List of Threatened Animals. International Union for the Conservation Nature and Natural Resources (IUCN), Cambridge. Krebs CJ. 1989. Ecological Methodology. Harper Collins, New York. Laksono PM, Rianti A, Hendrijani AB, Gunawan, Mandacan A, Mansoara N. 2001. Igya Ser Hanjop; Arfak community and the concept of conservation, ecological-anthropology studies in the Arfak Mountains, Irian Jaya. KEHATI, PSAP-UGM, YBLBC, Yogyakarta [Indonesia]. Maturbongs RA. 1999. Conservation of flora and fauna. [a textbook]. Faculty of Agriculture, University of Cenderawasih, Manokwari. [Indonesia]

SINERY et al. â&#x20AC;&#x201C; Cuscus of the Arfak Mountain Nature Reserve, West Papua Menzies JI. 1991. A handbook of New Guinea marsupials and monotremes. Kristen Press inc., Madang, Papua New Guinea. Odum P. 1993. Fundamentals of ecology. 3rd ed. Gajah Mada Univ. Press, Yogyakarta. [Indonesia] Petocz RG. 1987. Nature conservation and development in Irian Jaya. Pustaka Grafitipers. Jakarta [Indonesia] Petocz RG. 1994. Terrestrial mammals of Irian Jaya. PT Gramedia Pustaka Utama, Jakarta. [Indonesia]. Santosa Y. 1995. Wildlife diversity measurement techniques. Department of Forest Resources Conservation, Faculty of Forestry, Bogor Agricultural University, Bogor. [Indonesia]

Sinery A. 2002. Exploration cuscus species in Numfor island, Biak Numfor District. [Honorary Thesis]. Faculty of Forestry, Papua State University, Manokwari. [Indonesia] Sinery A. 2006. Species of cuscus in Taman Wisata Gunung Meja Manokwari Regency, West Irian Jaya. Biodiversitas 7 (2): 1 75-180. [Indonesia] Sinery A. 2010. Cuscus species of Arfak Mountains Nature Reserve, Manokwari District, West Papua Province. J Agrifor Ilmu Pertanian dan Kehutanan 9 (2): 78-88. [Indonesia] Sugianto. 1994. Quantitative ecology: Analysis methods of population and community. Usaha Nasional, Surabaya. [Indonesia]

B I O D I V E R S IT A S Volume 13, Number 2, April 2012 Pages: 92-97

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d130207

Vegetation stands structure and aboveground biomass after the shifting cultivation practices of Karo People in Leuser Ecosystem, North Sumatra T. ALIEF ATHTHORICK1,2,♥, DEDE SETIADI3, YOHANES PURWANTO4, EDI GUHARDJA3 1

Department of Biology, Faculty of Mathematics and Natural Sciences, North Sumatra University (USU), Medan 20155, North Sumatra, Indonesia. Jl. Bioteknologi No.1 Kampus USU Medan, Tel.: 061-8223564, Fax.: 061-8214290, ♥email: talief@lycos.com 2 Post Graduate School, Bogor Agricultural University (IPB), Bogor 16680, West Java, Indonesia 3 Department of Biology, Faculty of Mathematics and Natural Sciences, Bogor Agricultural University (IPB), Bogor 16680, West Java, Indonesia 4 Laboratory of Ethnobotany, Research Center for Biology, Indonesian Institute of Sciences (LIPI), Cibinong-Bogor 16911, West Java, Indonesia Manuscript received: 8 February 2012. Revision accepted: 29 March 2012.

ABSTRACT Aththorick TA, Setiadi D, Purwanto Y, Guhardja E. 2012. Vegetation stands structure and aboveground biomass after the shifting cultivation practices of Karo People in Leuser Ecosystem, North Sumatra. Biodiversitas 13: 92-97. Vegetation stands structure and aboveground biomass after the shifting cultivation practices of Karo People in Leuser Ecosystem, North Sumatra. Shifting cultivation has been practiced by Karo People in Leuser Ecosystem for a very long time and caused a mosaic of patches that shift over time between traditional agriculture and secondary forest. The objectives of this study were to investigate the recovery of vegetation stands structure and aboveground biomass in four age classes of secondary forest, i.e. 5-years old, 10-years old, 20-years old, 30-years old and primary forest as a control. In total, 496 subplots were surveyed. Saplings contributed 62.82% of basal area in 5-years forest and still important in 10 and 20-years forest, but density decreased in 30-years and primer forest whereas tree stands dominated in 30-years and primary forest and shared basal area of 96.36% and 97.03%, respectively. Aboveground biomass of trees achieved its highest values in primary forest, i.e. 659.22 t/ha and contributed to total aboveground biomass of 99.38%. Key words: Leuser ecosystem, traditional agriculture, secondary forest

INTRODUCTION Agricultural encroachment by shifting cultivation occupies a central position in the debate on tropical deforestation. Shifting cultivators are often seen as the primary agents of deforestation in developing countries; estimates of their share range as high as 45% (UNEP 1992) to 60% (Myers 1992). Shifting cultivation could be considered as an early stage in the evolution of agricultural systems. The system is based on cutting and burning the vegetation in the dry season, and planting crops in the wet season. The field eventually grows into secondary forest, before the cycle is repeated. The length of this fallow period varies considerably 5-20 years is common (FAO 1974). Fallow duration and cultivation periodicity may be influenced by multiple factors, including ecological factors such as precipitation, soil conditions and topography, as well as socio-economic factors (Mertz 2002). Abandoned fields are distributed worldwide and therefore allow comparison of secondary succession from various geographical regions (Osboronova et al. 1990). A number of studies on these old-field successions have been conducted in many countries (Osboronova et al. 1990; Wilson and Tilman 1991; Lee, 2002). Secondary forests, which comprise a large area of tropical forests (ITTO, 2002), are forests in the process of recovery following natural or anthropogenic disturbance, such as agriculture, logging, or ranching (Brown and Lugo

1990; Chazdon 2003). Secondary forests can serve as carbon sinks (Fearnside and Guimaraes 1996), as well as enhance regional biodiversity, environmental services, and forest-based economies (Brown and Lugo 1990; Finegan 1996; FAO 2005). Forests at different stages of succession differ in total biomass, net primary production, and species composition, which affects their relative contribution to regional and global carbon cycles (Fearnside and Guimaraes 1996). As the population depending on shifting cultivation increases, the system increasingly fails to satisfy the requirements for higher production per unit area. This may result in shorter fallow and longer cropping periods, initiating an accelerating and self-reinforcing process of land degradation (FAO 1974). Studies of succession after cessation of shifting cultivation in tropical region have also indicated that the diversity of woody species gradually increases with time since abandonment of fallow (Lawrence 2004; Lebrija-Trejos et al. 2008). Tropical secondary forests play an essential role in the global carbon cycle and in determining a country’s carbon storage for the REDD (reducing emissions from deforestation and degradation in developing countries) scheme (Gibbs et al. 2007) due to the degradation of large areas of tropical rain forest (Brown and Lugo 1990; Wright 2005). Accurate estimation of biomass changes in secondary forests after degradation contributes to calculating forest carbon storage in the region, because uncertainties in the rate of biomass accumulation in

ATHTHORICK et al. â&#x20AC;&#x201C; Vegetation stand of Karo people homeland

secondary forests create critical data gaps limiting our understanding of the role of tropical forests as sources and sinks of atmospheric carbon (Kauffman et al. 2009). In Southeast Asia, tropical secondary forests constituted 63% of the total forest cover in 2005 (Kettle 2010). However, knowledge of biomass changes after forest degradation in Southeast Asia is still limited compared with that of the neotropical region, particularly for belowground components (Brown and Lugo 1990). Quantifying the initial few decades of biomass changes in secondary forests after degradation will decrease these uncertainties since biomass accumulation during the initial stage is usually very large and shows complex changes (Brown and Lugo 1990). For example, many tropical secondary forests show rapid rates of aboveground production during the initial stage of succession (Ewel 1971; Ewel et al. 1983; Uhl and Jordan 1984; Lugo 1992; Jepsen 2006; Kendawang et al. 2007). Shifting cultivation has been practiced by Karo People in Leuser Ecosystem for a very long time and caused a mosaic of patches that shift over time between traditional agriculture and secondary forest. As such, many forests in the Leuser Ecosystem are secondary forests at various stages of succession following crop cultivation. However, little attention has been given to long term forest recovery after abandonment of shifting cultivation so little is known regarding how abandoned fallow fields have changed over

time. The objectives of this study were to investigated the recovery of vegetation stands structure and aboveground biomass in four age classes of secondary forest, i.e. 5-years old, 10-years old, 20-years old, 30-years old and primary forest as a control.

MATERIALS AND METHODS Study area Our study was carried out in secondary forests abandoned after traditional shifting cultivation by the Karo People at Telaga village in Leuser Ecosystem of North Sumatra (Figure 1). Vegetation in the study area is generally of the submontane forest type (800-1400 m asl) as proposed by Laumonier (1997). The area has a moist tropical climate. The average annual rainfall is 2777 mm, ranging from 2044 to 4022 mm over a 10-year period (measured from 2000 to 2009). The last cultivated crop and stand age of each site were recorded based on information from elderly villagers who were born in the village. Information on stand age, however, was credible until for 20years old, whereas 30-years old villagers did not remember the exact year when they had opened up the field.

Figure 1. Study area at Telaga village in Leuser Ecosystem of North Sumatra. Dotted circle = study area

B I O D I V E R S IT A S 13 (2): 92-97, April 2012

Data collection and analysis In this study, we analyzed forest stands and aboveground biomass for sapling with diameters at breast height (DBH) 2-9.99 cm and tree with DBH â&#x2030;Ľ 10 cm. Formulas and definitions were compiled from Mueller-Dombois and Ellenberg (1974), Greig-Smith (1983) and Schreuder et al. (1993). The number of subplot for each stage of secondary forest (5, 10, 20 and 30 years old) was 32 subplots for tree (10x10 m) and sapling (5x5 m) whereas primer forest was comprised 120 subplots for both stages. In total, 496 subplots were surveyed. Height, stem height, density, DBH, basal area and biomass for each stand age were measured with the purpose of characterizing forest stands in a quantitative basis. The analysis of aboveground biomass used two allometric equations. For trees, the equation given by Brown (1997) was used: Y = exp{2.134+2.530*ln (D)}. For saplings, the equation given by Honzak et al. (1996) was used: Y = exp[-3.068 + 0.957 ln (D2 * H)]; where Y = biomass (t/ha), D = diameter and H = height. Finally, analysis of variance (ANOVA) was used as a statistical technique designed to determine whether or not a particular classification of the data is meaningful. RESULTS AND DISCUSSION Stands structure Saplings In 5 years secondary forest, species was dominated by pioneers such as light-demanding herbaceous plants, grasses, vines, seedlings, and saplings. These species have a short life cycle, high growth rate and high reproductive resource allocation (Gomez-Pompa and Vasquez-Yanes 1981). An important characteristic of this stage is the much higher density (1,425.00 individuals/ha) compared to the density of trees (64.06 individuals/ha). High sapling competition was expressed by its highest basal area compared to tree stands. Saplings contributed 62.82% of basal area in this stage indicated that saplings were very important at this stage of re-growth. In 10 and 20 years forest, saplings are still important for the stand as a whole

(density of 2,175 and 2,725 individuals/ha, respectively) but density decreased in 30 years and primer forest (Table 1). DBH of saplings in all classes age are constant relatively causing the classification of age stages is not meaningful (p<0.41). These indicated the closer values of DBH from 5 years forest to primer forest and mainly at the succession stages. For saplings, although total height did not increase distinctly, the difference between all variables for all classes is statistically significant (p<0.00). Figure 2 illustrate the distribution of stand structure variables in density, DBH, basal area and total height of saplings in all classes. DBH in 5 and 10 years forest have many outliers indicating the variance of DBH in many individuals. This phenomenon was found too in total height especially in 10 years forest. These indicated the high competition in vertical and horizontal growth in saplings phase. Density and basal area have the similar trend of distribution, the values increase from 5 years up to 20 years forest and then decrease to primer forest. Ecologically, these trends are explained by the competition for light within the vegetation community. The growth of saplings was limited in 30 years and primer forest caused by covering canopy layers. Trees Density of trees in 5 years forest is lower (64.06 individuals/ha) indicating the early vegetation has soon recovered. In general, the density of trees increased from 5 years up to primary forest, except in 20 years forest where its density (218.75 individuals/ha) is lower than in 10 years forest (279.69 individuals/ha). This phenomenon also was applied to basal area, where 10 years forest has 10.49 m2/ha, whereas 20 years forest has 9.34m2/ha. This result indicated the recovery process in 10 years forest more intensive compared to 20 years forest. Besides that, 20 years forest is close to village and forest was often disturbed by the people for harvesting the construction materials and fire woods. DBH increased significantly from 5 years up to primary forest indicating the success competition of horizontal growth.

Table 1. Stand structure variables for each age classes of forest in study area Stand structure variables Density of saplings (individuals/ha) Density of trees (individuals/ha) DBH of saplings (cm) DBH of trees (cm) Basal area of saplings (m2/ha) Basal area of trees (m2/ha) Total basal area (m2/ha) Saplings contribution to basal area (%) Trees contribution to basal area (%) Total height of saplings (m) Total height of trees (m) Biomass of sapling (t/ha) Biomass of trees (t/ha) Total biomass Sapling contribution to biomass (%) Tree contribution to biomass (%)

5 years 1,425 64.06 4.28 15.80 2.45 1.45 3.9 62.82 37.18 4.25 7.57 5.79 10.73 16.52 35.05 64.95

10 years 2,175 279.69 4.15 20.79 3.57 10.49 14.06 25.39 74.61 4.03 14.66 8.24 113.27 121.51 6.78 93.22

Forest type 20 years 2,725 218.75 4.00 21.17 4.18 9.34 13.52 30.92 69.08 4.65 14.19 10.88 86.62 97.50 11.16 88.84

30 years 687.50 329.69 3.97 26.78 .96 25.43 26.39 3.64 96.36 4.58 18.52 2.43 289.33 291.76 0.0083 99.17

Primary forest 850 544.17 4.29 25.40 1.45 47.42 48.87 2.97 97.03 5.10 22.30 4.10 659.22 663.32 0.0062 99.38

F. 19.37 68.94 0.99 6.61 14.32 35.91 13.22 65.70 10.69 26.09 -

Sig. 0.00 0.00 0.41 0.00 0.00 0.00 0.00 0.00 0.00 0.00 -

ATHTHORICK et al. â&#x20AC;&#x201C; Vegetation stand of Karo people homeland

Figure 2. Distribution of density, DBH, basal area and total height of saplings in all classes.

Figure 3. Distribution of density, DBH, basal area and total height of trees in all classes

B I O D I V E R S IT A S 13 (2): 92-97, April 2012

Tree stands dominated in 30 years and primary forest and shared basal area of 96.36% and 97.03%, respectively but saplings still have a higher density (687.50 and 850 individuals/ha). A closer canopy alters the microclimate, improving conditions for shade-tolerant tree species and creating an unsuitable environment for pioneer species. This reality sets the path to a more advanced stage of vegetation re-growth. Figure 3 illustrates the distribution of stand structure variables in density, DBH, basal area and total height of trees in all classes. The trend increased in all variables from 5 years forest up to primary forest, except 20 years forest. Same with saplings, DBH and total height of trees stage have many outliers indicating the big variance in many individuals, especially in primary forest. Total height of individuals is an important parameter indicating the stage of recovery. Height described the competition for light within the vegetation community. Primary forest indicates the greatest range for all variables distinctly and has long whisker compared to the other classes age. This explains the recovery process of trees from 5 years forest to primary forest was a long way off. Saldarriaga et al. (1988) estimated that 190 years would be taken by a previously cultivated site to reach mature forest basal area and biomass values. Also, the number of tree species present after 40 years of succession is less than half the number in mature forests. In general terms, soil fertility and land-use history emerge as the critical factors influencing the rate of forest re-growth (Tucker et al. 1998). Uhl et al. (1982) found that the time of recovery depends on land use following removal. Slashburn-agriculture-abandon cycles have increasing secondary succession duration. Large cleared patches, where seed sources are far away, may take hundreds of years to return to primary forest. Aboveground biomass Aboveground biomass of saplings increased from 5 years to 20 years forest, but decreased for 30 years and primary forest, due to the lower importance of saplings in closed tropical forest environments. As a function of DBH and height, the trends of aboveground biomass from 5 years to primary forest are affected by those variables. Aboveground biomass of trees achieved its highest values in primary forest, i.e. 659.22 t/ha and contributed to total aboveground biomass of 99.38% (Table 1). However, this result indicated that aboveground biomass of primary forest in this study was higher than in primary rain forests in Southeast Asia, which ranged from approximately 300 t/ha to 500 t/ha (Yamakura et al. 1986; Laumonier et al. 2010; Niiyama et al. 2010).

CONCLUSION In the early stage of vegetation recovery, saplings have the important role expressed by the higher density and basal area compared to trees. In the next stage (in 30 years time), the growth of saplings was limited caused by

covering canopy layers of trees. Trees taken over the role and forest developed to reach mature forest basal area and biomass values. Although vegetation recovery process was taking place in the study area, secondary forest need long time to develop to primary forest. The time of recovery depends on land use type, duration of cycles and large cleared patches.

ACKNOWLEDGEMENTS We would like to express gratitude to Irwansyah Sembiring, the Head of Perteguhan Subvillage, Telaga Village, Sei Bingei Subdistrict, Langkat District, North Sumatra for fully assistance along the fieldwork.

REFERENCES Brown S, Lugo AE. 1990. Tropical secondary forests. J Trop Ecol 6: 1-32. Chazdon RL. 2003. Tropical forest recovery: Legacies of human impact and natural disturbances. Perspect Pl Ecol Evol Syst 6 (1-2): 51-71. Ewel JJ, Chai P, Tsai LM. 1983. Biomass and floristics of three young second growth forests in Sarawak. Malay For 46: 347-364. Ewel JJ. 1971. Biomass changes in early tropical succession. Turrialba 21: 110-112. FAO. 1974. Shifting Cultivation and Soil Conservation in Africa. Food and Agriculture Organization of the United Nations, Rome. FAO. 2005. State of the Worldâ&#x20AC;&#x2122;s Forests. Food and Agriculture Organization of the United Nations, Rome. Fearnside PM, Guimaraes WM. 1996. Carbon uptake by secondary forests in Brazilian Amazonia. Forest Ecology and Management 80 (1-3): 3546. Finegan B. 1996. Pattern and process in neotropical secondary rain forests: The first 100 years of succession. Trends Ecol Evol 11 (3): 119-124. Gibbs HK, Brown S, Niles JO, Foley JA. 2007. Monitoring and estimating tropical forest carbon stocks: making REDD a reality. Environ Res Lett 2, 045023 (13 pp.). Greig-Smith P. 1983. Quantitative plant ecology. Vol. 9. Studies in Ecology. Blackwell, Oxford, UK. Honzak M, Foody G, Lucas RM, Curran PJ, do Amaral L, Amaral S. 1996. Estimation of the leaf area index and total biomass of tropical secondary forests: A comparison of methodologies. In: Gash JHC, Nobre CA, Roberts JM, Victoria RL. (eds). Amazonian Deforestation and Climate. John Wiley & Sons, Chichester. ITTO. 2002. Guidelines for the restoration, management and rehabilitation of degraded and secondary tropical forests. ITTO Policy Development Series no. 13. International Tropical Timber Organization, Yokohama, Japan. Jepsen MR. 2006. Above-ground carbon stocks in tropical fallows, Sarawak, Malaysia. For Ecol Manag 225: 287-295. Kauffman JB, Hughes RF, Heider C. 2009. Carbon pool and biomass dynamics associated with deforestation, land use, and agricultural abandonment in the neotropics. Ecol Appl 19: 1211-1222. Kendawang JJ, Ninomiya I, Kenzo T, Ozawa T, Hattori D, Tanaka S, Sakurai K. 2007. Effects of burning strength in shifting cultivation on the early stage of secondary succession in Sarawak, Malaysia. Tropics 16: 309-321. Kettle CJ. 2010. Ecological considerations for using dipterocarps for restoration of lowland rainforest in Southeast Asia. Biol Conserv 19: 1137-1151. Laumonier Y, Edin A, Kanninen M, Munandar AW. 2010. Landscapescale variation in the structure and biomass of the hill dipterocarp forest of Sumatra: implications for carbon stock assessments. For. Ecol. Manage. 259: 505-513. Lawrence D. 2004. Erosion of tree diversity during 200 years of shifting cultivation in Bornean Rain Forest. Ecol Appl 14: 1855-1869.

ATHTHORICK et al. – Vegetation stand of Karo people homeland Lebrija-Trejos E, Bongers F, Garcia EAP, Meave JA. 2008. Successional change and resilience of a very dry tropical deciduous forest following shifting agriculture. Biotropica 40: 422-431. Lugo AE. 1992. Comparison of tropical tree plantations with secondary forests of similar age. Ecol Monog 62: 1-41. Mertz O. 2002. The relationship between length of fallow and crop yields in shifting cultivation: a rethinking. Agrofor Syst 55 (2): 149-159. Mueller-Dombois D, Ellenberg H. 1974. Aims and Methods of Vegetation Ecology. John Wiley and Sons, New York. Myers N. 1992. Tropical forests; The policy challenge. Environmentalist 12 (1): 15-27. Niiyama K, Kajimoto T, Matsuura Y, Yamashita T, Matsuo N, Yashiro Y, Ripin A, Kassim AR, Noor NS. 2010. Estimation of root biomass based on excavation of individual root systems in a primary dipterocarp forest in Pasoh Forest Reserve, Peninsular Malaysia. J Trop Ecol 26: 271-284. Osboronova J, Kovarova M, Leps J, Prach K. 1990. Succession in Abandoned Fields, Studies in Central Bohemia, Czechoslovakia. Geobotany vol. 15. Kluwer Academic Publishers, Dordrecht.

Saldarriaga JG, West DC, Tharp ML, Uhl C. 1988. Long-term chronosequence of forest succession in the upper Rio Negro of Colombia and Venezuela. J Ecol 76: 938-958. Schreuder HT, Gregoire TG, Wood GB. 1993. Sampling Methods for Multi-Resource Forest Inventory. New York: John Wiley and Sons. Tucker JM, ES Brondizio, DEF Moran. 1998. Rates of forest regrowth in eastern Amazônia: a comparison of Altamira and Bragantina regions, Pará State, Brazil. Interciencia 23 (2):64-73. Uhl C, Jordan CF. 1984. Succession and nutrient dynamics following forest cutting and burning in Amazonia. Ecology 65: 1476-1490. UNEP. 1992. The World Environment 1972-1992. The United Nations Development Programme (UNEP), Nairobi. Wilson SD, Tilman D. 1991. Interactive effects on fertilization and disturbance on community structure and resource availability in an old-field plant community. Oecologia 88: 61-71. Wright SJ. 2005. Tropical forests in a changing environment. Trends Ecol Evol 20: 553-560. Yamakura T, Hagihara A, Sukardjo S, Ogawa H. 1986. Aboveground biomass of tropical rain forest stands in Indonesian Borneo. Vegetation 68: 71-82.

B I O D I V E R S IT A S Volume 13, Number 2, April 2012 Pages: 98-106

ISSN: 1412-033X E-ISSN: 2085-4722 DOI: 10.13057/biodiv/d130208

The wild plants used as traditional medicines by indigenous people of Manokwari, West Papua OBED LENSE♥ Faculty of Forestry, State University of Papua, Jl. Gunung Salju, Amban, Manokwari 98314, West Papua, Indonesia. Tel. +62-986-211065, Fax. +62986-211065, ♥email: obedlense@yahoo.com Manuscript received: 12 December 2010. Revision accepted: 24 April 2012.

ABSTRACT Lense O. 2012. The wild plants used as traditional medicines by indigenous people of Manokwari, West Papua. Biodiversitas 13: 98106. The aims of the research were to identify the main plant species which are used as traditional medicines by native people in Manokwari District, West Papua Province and also to describe the method of preparation and uses of some of the medicinal plants. This research was conducted in seven sub-districts, ie. Manokwari, Ransiki, Kebar, Wasior, Mimyambouw, Merdey and Anggi-Sururey subDistrict. Information recorded including methods of diagnosis and treatment of diseases, tribal name of a plant they used for treating disease (s), part of the plant used, preparation and mode of application, and whether the plant is used alone or in combination with other plants. Results indicate that the indigenous people in Manokwari District have been using at least 99 plant species (93 genera and 59 families) as sources of medicines. Most of these traditional medicinal plants are commonly gathered from the local tropical rainforest communities. At least 40 kinds of sickness and injuries such as malaria, fever, and wounds can be treated by using traditional medicinal plants from Manokwari District. Research also found that all parts of plants used, but leaf extracts are the most common part of the plant used for treating medical condition. Key words: wild plants, traditional medicines, indigenous people, Manokwari.

INTRODUCTION As modern worldviews and lifestyles reach rural indigenous communities through technology and personal contact, centuries-old traditional cultures are changing. Change takes place daily, nothing remains the same. Every day the world is becoming smaller due to the development of travel and communication technologies, and hardly a group of peoples on the planet remain untouched by forces of “progress.” However, through this process a great store of knowledge held by native peoples is threatened with extinction. Historically, modern societies have regarded indigenous people and traditions as less progressive and, as a result, many groups of indigenous peoples, especially their younger generations, are encouraged to devalue their native culture and to adopt new lifestyles and technologies. The knowledge of traditional medicinal plants, accumulated over centuries, may disappear in only a couple of generations if the current pace of cultural change continues to occur amongst the tribes in Manokwari District. Preliminary field visits (interviews) have indicated that transferring the traditional knowledge of the use of plant-based preparations in the primary health care of these people is under threat. There were a small number of young people (3 younger than 45) who have inherited a traditional knowledge of medicinal plants from their old generation in each village visited. The process of transferring traditional knowledge appears to be the main factor leading to the decline of knowledge of traditional medicine. There is no

formal school or traditional institution involved in passing on this knowledge. Transferring knowledge only happens amongst family groups when they are engaged in other activities. At that time, many young people are not interested in following their parents, and the number of people who have a good knowledge of traditional medicinal plants is declining. It is possible that in next couple of decades, the knowledge of medicinal plant within these ethnic groups may disappear completely. The aims of this research were to identify the plant species that are used as traditional medicines by the native people of Manokwari District, West Papua, and to describe their methods of preparation and use of the medicinal plants. The study represents the first step to documenting significant aspects of the local medicinal plant knowledge before it disappears.

MATERIALS AND METHODS The location of this project was in Manokwari District in the province of Papua, Indonesia. This research was held in seven sub-districts, i.e. Manokwari, Ransiki, Kebar, Wasior, Mimyambouw, Merdey and Anggi-Sururey subDistrict. The plants were collected for botanical identification from several location/villages (Mandopy, Merdey, Sururey, Jandurau, Dembek, Siwi, Wasior, Tandia, Minyambouw, Indabri, and Inambuari) and each plant allotted a TMHM

LENSE – The wild medicinal plants of Manokwari, West Papua

(Traditional Medicine Herbarium Manokwariense). Plant specimens were labelled based on the date, locality, altitude, latitude, tribal name, collector, and collection number. In addition, as plants are located and identified their use and method of preparation were documented and photographs were taken. The herbarium specimens were identified with the assistance of Marthen Jitmau and lodged in the Herbarium Manokwariense (MAN), Manokwari, West Papua, Indonesia, and were preserved for reference voucher at the Traditional Medicine Research Unit. Several aspects of the medicinal plants were recorded including methods of diagnosis and treatment of medical conditions; tribal name of a plant used for treating the conditions; part of the plant used; preparation and mode of application; whether the plant is used alone or in combination with other plants. Interviews were conducted in order to record relevant ethnobotanical data. These interviews were conducted, as recommended by Chhabra and Mahunnah (1994). In each village two older persons whose empirical knowledge was respected by everyone in the area, and two traditional healers who prescribed local herbs were interviewed. Interview data were recorded in an ethnobotanical notebook (Martin 1995).

RESULTS AND DISCUSSION Plants used for traditional medicine In the Manokwari District, 99 plant species were documented as traditional medicinal plants. They are widely distributed among 94 genera and 59 families, ten of which are members of the Araceae family, widespread in the rainforests of the District. This indicates the diversity of traditional medicinal plants in Manokwari District. Except for cultivated species such as Cocos nucifera L., Carica papaya L. and Musa x paradisiaca L., traditional medicinal plants were most commonly gathered from the local vegetation communities.

Figure 1. Plant families most commonly used for traditional medicine by Indigenous people from Manokwari District.

Plants used to treat more than 40 different medical conditions were grouped into several categories according to use by indigenous people: gastrointestinal disorders, dermatological conditions, illnesses associated with pain and/or fever, respiratory illnesses, women’s medicines, plants used to counteract bites by venomous animals, eye remedies, wounds and burns, and other uses (Ankli et al. 1999). The category with the largest number of species was that used to treat illnesses associated with pain and/or fever, and the next largest group consisted of plants used to treat gastrointestinal disorders, whereas only one species was documented as being used to counteract venomous animal bites. The cause of some of the sickness and injuries were attributed to ‘supernatural powers’. Even minor accidents to such as cuts and body pains were sometimes attributed by tribal people such outside influences. The number of medicinal plants found in the present study was higher than that found in previous studies in West Papua, and other regions of eastern Indonesia: the Dani people in the Baliem Valley in Jayawijaya District used 30 plant species to treat a number of local diseases (Purwanto and Waluyo 1992), and the Tangma people in Kurima Sub-District used 26 medicinal plants in their daily health care (Alhamid and Sumarliani 1996). Roemantyo and Wiriadinata (1991) reported that indigenous people in Kupang, West Timor, recognize and use 37 species as medicinal plants. However, the number of species found in the present study is less than the 164 traditional medicinal plants used by indigenous people in Tanimbar-Kai Island, south-east Maluku, Indonesia (Purwanto and Waluyo 1992). Unpublished data from local health authorities suggest that illnesses associated with pain and/or fever (frequently malaria, ear pain, and headaches) and gastrointestinal disorders (diarrhea, dysentery, and stomach-aches) are the major health problems in Manokwari District. Infected wounds, inflammatory skin diseases, and chronic and infectious eye diseases are also common. Although bites from poisonous snakes are feared, only a few cases have been recorded. The numbers of traditional medicinal plant species, which are used simultaneously to treat a medical condition appears to depend on the nature of the condition. Tribal people will use several medicinal plant species to treat a particular illness if they consider the illness to be dangerous. The people of the present study used at least ten plant species to treat malaria, since malaria is one of the primary medical conditions that often result in death. However, to cure influenza the people often use one only medicinal plant species. The people at all the study sites believed that there are several reasons why someone suffers from certain illnesses. These medical conditions include diarrhea, dysentery, influenza, and malaria, all known to be caused by microorganisms. For these conditions, a combination of modern medicines and traditional medicinal plants are very popular choices. The local people also believe that certain ailments may be caused by a person or a group entering an area which does not belong to the group. The symptoms of

100

B I O D I V E R S IT A S 13 (2): 98-106, April 2012

this illness are stomach-pains, swollen navel, diarrhea, pale appearance, and a feeling of general debility. They believe that these conditions are related to the “supernatural” and can be healed using traditional medicinal plants only. Native people in Manokwari District, especially people from the Big Arfak tribe (Sough, Hatam, Meyah, and Moile sub-tribes), also believe that their members may suffer from certain medical conditions due to a curse from an ancestor. The main symptoms of this illness are swollen parts of the body such as the eyebrows, eyelids, and stomach, and they believe that both hands and legs shrink and may not be able to move easily. Medical conditions, caused by “suanggi” (a member of the group who is able to kill another member using magic; tribal communities consider this magical) are though to be incapable being healed by either modern or traditional medicines. The major symptoms of this sickness are darkening of the entire body of the affected person and immobility of hands, legs, and fingers. Based on the field interviews, the only way to treat conditions caused by both an ancestor curse and “suanggi” is by applying traditional medicinal plants. However, this medicine cannot cure the illness completely, as the person who suffers from the illness will die at the later stage. During the present study, no information has been recorded regarding the species of medicinal plants which may be used to treat medical conditions caused by both curses from ancestors or “suanggi”. The study also indicated that there were some similarities and differences amongst the tribes in using medicinal plants in their daily health care. Some species used as traditional medicines were used to treat similar medical conditions throughout the region. Alstonia scholaris, widely distributed throughout Manokwari District, has been used by the native people in Siwi and Dembek village (Ransiki), Jandurau village (Kebar), Tandia village (Wasior), and Mandopi village in Manokwari sub-District to treat malaria and fever. Field observations indicated that Laportea interrupta, Alstonia scholaris, Pipturus repandus, Costus speciosus, and Cordyline fruticosa occurred at all of the study sites. Particular species of traditional medicinal plants were found in two or more study sites to treat different medical conditions. For example Cordyline fruticosa was used by the community in Ransiki sub-District to treat dysentery, whereas in Mimyambouw sub-District the species was used to treat menstruation problems. There were also some similarities in medicine preparation and in the ways to apply the potions. It may be that frequent visits of the members of particular tribes, including the older person or traditional healers, to meet their extended families or to attend the traditional ceremonies may be one possible factor that produced these similarities. Plants used for pain and/ or fever Forty species were documented for illnesses associated with pain and/or fever in which fever and malaria were the frequent conditions (Table 1). In general, traditional medicines were prepared as decoctions or infusions, or sometimes applied or rubbed on to the part of the body affected. For example, in treating fever, a potion may be

prepared as an infusion to be drunk and the solid parts applied to the forehead. Malaria and fever are the most frequently treated medical conditions. This group includes diseases associated with chest pain, headaches, muscular pain, and influenza. Of the 40 species recorded to treat pain and/or fever, 21 species were used by the people in the District specifically to treat malaria (Table 1). Alstonia scholaris and Pipturus repandus were the most common plants used in four different sub-districts to treat fever. Cerbera manghas, Casuarina equisetifolia, Flagellaria indica, Freycinetia sp., Lansium domesticum, Loranthus sp., Senna alata, and Solanum sp. were used in only one sub-District. However, these species are widely distributed and seen in all four areas. Nevertheless, each tribe in the region has their own traditional plants to treat local medical conditions. Nettles, Laportea interrupta (L.) Chew. are widely recognized by almost all communities in the region as a medicinal plant to combat muscular pains and fatigue. The method of use was to rub the fresh, hairy leaves on the skin to produce a very hot and itchy feeling. Several species found in the present study to treat pain and fever are also used by traditional communities around the world to treat similar medical conditions. People in Aceh (Erdelen et al.1999) and East Lombok, Indonesia (Hadi and Bremner 2001), Malaysia (Salleh 1997), and Karnataka Province, India (Shankar et al. 1999) use the species Alstonia scholaris to combat malaria and fever. Carica papaya L. (leaves, stem, roots, and flowers) is used to treat malaria in West Lombok, Indonesia (Hadi and Bremer 2001). The leaves of Bidens pilosa L. are made into a decoction and then used as a gargle in Dominican Republic and Papua New Guinea (Morobe Province) for treating toothaches (Taylor 1998; Woodley 1991). The Fijians use this plant as a traditional medicine but for different diseases: the young shoots are used as an internal remedy for influenza, and the leaves are used to treat infective hepatitis (Cambie and Ash 1994). Some species recorded to treat pain and fever are also known to contain phytochemical compounds. Some of these compounds have been tested in order to establish their efficacy in treating particular medical conditions. Bidens pilosa has been the subject of recent clinical studies which have supported many of its uses in herbal medicine (Taylor 1998). As early as 1979, scientists demonstrated that specific chemicals found in this species were phototoxic to bacteria and fungi (Wat et al. 1979; Arnason et al. 1980). Subsequently, Swiss scientists isolated several known phytochemical compounds with anti-microbial and anti-inflammatory properties which led them to believe that the presence of these compounds may rationalize the use of this plant in traditional medicine in the treatment of wounds, against inflammation and against bacterial infection of the gastrointestinal tracts (Geissberger and Sequin 1991). In the same year, scientists in Egypt documented the antimicrobial activity of Bidens pilosa L. (Sarg et al. 1991), and another research group reported that the species has anti-inflammatory properties (Chih et al. 1995). New bioactive phytochemicals were also discovered

LENSE â&#x20AC;&#x201C; The wild medicinal plants of Manokwari, West Papua

101

Table 1. Manokwari traditional medicinal plants used for illnesses associated with pain and/or fever. Plant name Alpinia purpurata (Vieill.) K.Chum. Alstonia scholaris R.Br. Bidens pilosa L Blumea saxatilis Zoll. & Mor. Carica papaya L. Casuarina equisetifolia L. Cerbera manghas L. Cinnamomum culilawan Blume Coelogyne asperata Lindl. Costus speciosus Sm. Cyathea contaminans L. Cyrtosperma sp. Diplazium esculentum (Retz.) Sw. Dysoxylum arborescens Miq. Dryopteris filix-max (L.) Scott. Ficus sp1. Ficus sp2. Flagellaria indica L. Freycinetia sp. Homalomena aromaticum (Roxb.) Schott. Kalanchoe pinnata Pers. Lansium domesticum Jack. Laportea interrupta (L.) Chew. Loranthus sp. Macaranga mappa Muell. Arg. Macaranga tanarius Muell. Arg. Mucuna novo-guineensis Scheff. Octomeles sumatrana Miq. Palmeria sp. Pentaphalangium pachycarpum A.C. Smith Philodendron sp. Pimelodendron amboinicum Hassk. Pipturus repandus (Bl). Wedd. Pisonia sp. Platycerium sp. Ricinus communis L. Scindapsus hederaceus Schott. Senna alata L. Smilax sp. Solanum sp.

Family Zingiberaceae Apocynaceae Asteraceae Asteraceae Caricaceae Casuarinaceae Apocynaceae Lauraceae Orchidaceae Zingiberaceae Cyatheaceae Araceae Athyriaceae Meliaceae Dryopteridaceae Moraceae Moraceae Flagellariaceae Pandanaceae Araceae Crassulaceae Meliaceae Urticaceae Loranthaceae Euphorbiaceae Euphorbiaceae Fabaceae Datiscaceae Monimiaceae Clusiaceae Araceae Euphorbiaceae Urticaceae Nyctaginaceae Polypodiaceae Euphorbiaceae Araceae Caesalpiniaceae Smilacaceae Solanaceae

Medical conditions Earaches Fever, malaria Toothaches Cold, influenza Malaria Malaria Fever Toothaches and muscular pains Chest pain Ear pain Fever Chest pain Headaches Fever and Malaria Fever Fever Toothaches Fever Fever Muscular pain Fever Malaria Muscular pain Fever in babies Chest pain Chest pain, malaria Malaria, fever Fever Back pains Joint pain Rheumatic and joint pains Headaches Fever Headaches Malaria, fever Malaria Colds of babies Fever Headaches Malaria

Plant parts used Stem Bark Leaves Leaves Leaves Bark Latex Bark Bulbs Stem Stem Tubers Leaves Bark Leaves Bark, shoot Leaves, roots Stem juices Stem juices Bulbs Leaves Bark Leaves Leaves Leaves Leaves Stem Bark Stem Bark Stem Leaves, Latex Bark Roots Leaves Leaves Leaves Leaves Stem Leaves

Table 2. Manokwari traditional medicinal plants used for gastrointestinal disorders. Plant name Acorus calamus L. Adenanthera microsperma Teisjsm.&Binn. Aquilaria malacensis Lam. Artocarpus altilis (Park.) Fosb. Canarium sp. Canna indica L. Cinnamomum culilawan Blume Cocculus carolinus (L.) DC. Commelina diffusa Burm. F. Cordyline fruticosa A. Cheval. Costus speciosus Sm. Crinum asiaticum L. Homalanthus nutans Guill. Homalonema aromaticum (Roxb.) Schott. Horsfieldia sp. Intsia palembanica L. Morinda citrifolia L. Mucuna nova-guineensis Scheff. Piper sp. Pipturus repandus (Bl). Wedd. Planchonella sp. Polygonum sp3. Pothos scandens L. Pterocarpus indicus Willd. Senna alata L. Wollastonia biflora DC.

Family Araceae Mimosaceae Thymelaeaceae Moraceae Burseraceae Cannaceae Lauraceae Menispermaceae Commelinaceae Dracaenaceae Zingiberaceae Amaryllidaceae Euphorbiaceae Araceae Myristicaceae Caesalpiniaceae Rubiaceae Fabaceae Piperaceae Urticaceae Sapotaceae Polygonaceae Araceae Fabaceae Caesalpiniaceae Asteraceae

Medical conditions Dysentery Diarrhea Dysentery Diarrhea/dysentery Liver problems Dysentery Stomach-aches Stomach-aches Dysentery Dysentery Stomach-aches, food poisoning Stomach-aches Stomach-aches Stomach-aches Stomach complaint Dysentery Stomach-aches Diarrhea Stomach-aches Diarrhea Dysentery Dysentery Diarrhea Dysentery Stomach-aches Diarrhea

Plant parts used Rhizomes Leaves Leaves Sap, bark Bark Stem Bark Water from stem Leaves Leaves Stem Tubers Leaves Bulbs Bark Bark Leaves Stem Leaves Leaves Bark Leaves Leaves Bark Leaves Leaves and flowers

102

B I O D I V E R S IT A S 13 (2): 98-106, April 2012

in 1996 which indicated that B. pilosa was effective against normal and transformed human cell lines (Alvarez et al. 1996). The plant extract was shown to possess prostaglandin-synthesis inhibitory activity, a process linked to headaches and inflammatory diseases (Jager et al. 1996). Subsequently, a research group in Taiwan documented its hepatoprotective (liver protecting) activity, and showed that the species can protect liver injuries from various hepatotoxins, and suggested that it has the potential as a broad-spectrum anti-hepatic agent (Chin et al. 1996). In addition, Rabe and Staden (1997) reported that the species showed antibacterial activity against gram-positive bacteria. Plants used for gastrointestinal disorders Twenty-six species from the Manokwari District were documented for treating gastrointestinal disorders (Table 2). Majority of the species of traditional medicinal plants recorded in this group were used to treat stomach-aches and dysentery; other illnesses treated included diarrhea, liver diseases and poisoning. Unpublished data from the Manokwari District community health centre show that stomach-aches and dysentery are important medical conditions throughout the region and they have caused many deaths amongst these communities. The â&#x20AC;&#x153;way of lifeâ&#x20AC;?, the officer said, was the primary reason. Treatments consist mostly of circular massages of the medicinal plants around the navel as well as drinking a decoction or infusion made from various plant parts. Some species used to cure these medical conditions were used by more than one tribe. Homalanthus nutans was widely used by the sub-tribes in four different sub- districts (Ransiki, Anggi-Sururey, Wasior, and Kebar) to treat stomach-aches. The shrubs are easy to access, growing mostly in secondary forest and previously cultivated area surroundings the villages. The tribes also used similar methods of preparation as a decoction or cold infusion, followed by rubbing the prepared plants on the affected areas. Some of the species found under this section have also been reported as treatments for similar medical conditions in different parts of the world. Artocarpus altilis is recognized in Java and other Indonesian areas, (root bark, sap, and sometimes stem-bark), Samoa and Tonga (roots), and in Papua New Guinea (latex) to treat diarrhea and dysentery (Perry 1980; Dittmar 1998). Another study also

reported that a decoction of leaves and rhizomes of Cordyline fruticosa is used to cure diarrhea and dysentery in Central Lombok (Puyung), Indonesia (Hadi and Bremner 2001), and Samoa (Dittmar 1998). In Malaysia, Acorus calamus (Jerangau) is used to cure fevers, dysentery, and to improve the appetite (Salleh 1997). A decoction of bark of Artocarpus altilis and the leaves and bark of Morinda citrifolia were also used in the Philippines and Tonga to treat stomach-aches (Perry 1980; Singh 1984). A phytochemical study of the latex of Artocarpus altilis has shown that it contains cardenolides (Qujano and Arango 1979; Wong 1976) and cerotic acid (Perry 1980), but no pharmacological information relating to indigenous uses is available. Plants used for dermatological conditions In this group, eight plant species from the Manokwari District have been reported to be used to treat a variety of dermatological conditions such as scabies and abscesses (Table 3). Treatments mostly consist of preparing a decoction or cold diffusion and applying it to the affected skin. Bark and roots were the most common parts of the plant used. To treat measles, the roots of Imperata cylindrica and Metroxylon rumphii were boiled, filtered, cooled, and the solution is swallowed twice per day until the patient is healed. The native people in Wasior, Kebar, and Merdey have used the bark of the stem of Ficus sp. and Leea aculeata as well as the leaves of Polygonum sp. to treat abscesses. Treatment is mainly by drinking a decoction or cold infusion of the potion followed by application of prepared plants whereas to cure ringworm, these communities applied the crushed bark and leaves directly to affected skin. Some of the species found under this category have been using as medicinal plants worldwide. In West Lombok, Indonesia, Cocos nucifera (leaves, stem, and roots) is used for fever and dysentery (Hadi and Bremner 2001). People in the Marshall Islands used the leaf sheath of this species to support broken limbs (Spennemann 2000). Elsewhere in Indonesia, the roots of Imperata cylindrica are used to treat blood pressure, fever, coughs, and hepatitis (Erdelen et al. 1999). In Sri Lanka, a decoction of rhizomes is used to relieve the retention of urine and passing of blood in the urine (Jayaweera 1999).

Table 3. Manokwari traditional medicinal plants used to treat dermatological conditions. Plant name

Family

Medical conditions

Plant parts used

Cocos nucifera L. Ficus sp1. Imperata cylindrica L. Leea aculeata Blume Lithocarpus brassii Soepadmo Metroxylon rumphii Mart. Polygonum sp1. Polygonum sp2.

Arecaceae Moraceae Poaceae Leeaceae Fagaceae Arecaceae Polygonaceae Polygonaceae

Measles Abscesses Measles Abscess Ringworm Measles Scabies Abscesses

Milk from young coconut Bark, shoot Roots Bark Bark Roots Roots Leaves

LENSE – The wild medicinal plants of Manokwari, West Papua

103

Table 4. Manokwari traditional medicinal plants used for respiratory illnesses. Plant name

Family

Medical conditions

Plant parts used

Alstonia scholaris R.Br. Endospermum moluccanum Becc. Euodia sp. Horsfieldia sp.

Apocynaceae Euphorbiaceae Rutaceae Myristicaceae

Coughs, asthma Bronchitis Asthma Asthma

Bark, roots Bark Bark Bark

Table 5. Manokwari traditional medicinal plants used as women’s medicines. Plant name

Family

Medical conditions

Plant parts used

Ageratum conyzoides L. Biophytum petersianum Klotzsch Centella asiatica L. Colocasia sp. Cordyline fruticosa A. Cheval. Cyathea contaminans L. Musa x paradisiaca L. Nauclea orientalis L. Physalis angulata L. Ricinus communis L.

Asteraceae Oxalidaceae Umbelliferae Araceae Dracaenaceae Cyatheaceae Musaceae Rubiaceae Solanaceae Euphorbiaceae

Eases birth, decoction after delivering a baby Fertility Problems of menstruation Childbirth Problems of menstruation Problems of menstruation Easy birth Easy birth Prevent pain during menstruation Decoction before delivering a baby

Leaves Whole plant Leaves Bulbs Leaves Stem Stem Bark Leaves Leaves

Plants used for respiratory illnesses Four species of Manokwari medicinal plants were locally used for coughs, bronchitis, and asthma (Table 4). Bark from the stem was usually prepared as a decoction and infusion to treat these medical conditions in Merdey, Ransiki, Kebar, and Manokwari sub-districts. Results indicated that species Alstonia scholaris was used widely in different tribes in Ransiki, Kebar, Wasior, and Manokwari to combat coughs and asthma. The number of species recorded to treat these medical conditions was lower than the number of species found to treat diseases in any other category. This may be because respiratory illnesses are not considered as primary medical conditions in the Manokwari District. Some of the species have been reported to be used for similar medical conditions in different countries. For example, the bark of Alstonia scholaris was used to treat diseases from malaria and epilepsy to skin conditions and asthma (Shankar et al. 1999); also, in Malaysia, the species is used for cases of fevers and coughs (Salleh 1997). Plants used as women’s medicines Plants used during delivery and menstruation problem are the most prominent group in this category (Table 5). Treatments for these medical conditions were mostly prepared as decoctions and were sometimes followed by applying or rubbing the prepared plants on to the stomach, so the mother would not feel pain during the delivery of a baby. The indigenous people in Mimyambouw sub-District used at least six species of traditional medicinal plants to treat childbirth and menstruation problems. The bark and leaves were the most preferred plant parts. However, for species Biophytum petersianum, the whole plant was used as fertility medicine. Based on the personal interviews of the present study, the indigenous people of Kebar subDistrict believed that a decoction of this species can increase the fertility of a couple, but clinical investigations

are needed in order to support such a view. The species also has been traded locally. Sometimes people from outside the tribe buy a couple of kilograms of the whole plant of Biophytum petersianum as a fertility-enhancing drug. There have been no previous reports of the species listed in Table 6 being used for medical conditions associated with women elsewhere in Indonesia, but some of them are used in other countries. The species Ageratum conyzoides L. is used in most African countries as a contraceptive, whereas in Trinidad, the species was used as an abortifacient (Durodola 1977). A similar use was reported for the species Physalis angulata, in Papua New Guinea (Kurtachi, Northern Bougainville) where the seeds of this species are used as a contraceptive in women (Cambie and Brewis 1997). People in Central America and Jamaica have used a tea prepared from the whole plant of Physalis angulata to prevent an abortion after a fall during pregnancy (Cambie and Brewis 1997). Plants used for eye conditions In this group, six species have been documented as being used to treat eye complaints including inflammation, irritation, and infection of the surface of the eye (Table 6). Treatments generally consist of dropping the potions into the eye. Table 7 shows that native people in Wasior subDistrict used several plant species to treat these medical conditions, whereas people in Kebar used one species only to treat similar complaints. Often drops are prepared by extracting liquids from the squashed leaves and/or stems of the plants and they are applied topically. When people in the Wasior sub-District use Calophyllum inophyllum to treat eye problems, the leaves are first soaked in a bucket of water for about 30-45 minutes prior to washing the eyes with the extracted water for approximately 1-2 minutes; the eyes are opened and closed several times during this process. Leaves were the preferred plant part used to treat eye ailments, possibly because leaves are easier to prepare as drops.

104

B I O D I V E R S IT A S 13 (2): 98-106, April 2012

Table 6. Manokwari traditional medicinal plants used for eye complaints Plant name Ageratum conyzoides L. Calamus spp. Calophyllum inophyllum L. Cordyline fruticosa A. Cheval. Dischidia sp. Ficus sp2.

Family Asteraceae Arecaceae Clusiaceae Dracaenaceae Asclepiadaceae Moraceae

Medical conditions Irritated eyes Inflamed eyes Inflamed eyes Irritated eyes Irritated eyes Eye infection

Plant parts used Leaves Stem liquid Leaves Leaves Leaves Leaves

Table 7. Manokwari traditional medicinal plants species used to treat wounds and burns. Plant name Ageratum conyzoides L. Artocarpus altilis (Park.) Fosb. Cyathea contaminans L. Cyperus rotundus L. Diplazium esculentum (Retz.) Sw. Bambusa vulgaris Schrad. Melastoma malabathricum L. Merremia peltata Merr. Mucuna novo-guineensis Scheff. Paspalum conjugatum L. Pometia pinnata Forst. Axonopus compressus (SW.) P. Spathoglottis papuana F.M. & Bailey

Family Asteraceae Moraceae Cyatheaceae Cyperaceae Athyriaceae Poaceae Melastomataceae Convolvulaceae Fabaceae Poaceae Sapindaceae Araceae Orchidaceae

Medical conditions Wounds Wounds Burns Wounds Wounds Wounds Wounds Wounds Old wounds Wounds Burns and wounds Wounds Wounds

Plant parts used Leaves Sap, bark Juvenile stem Leaves Leaves Outer bark Leaves Leaves, twigs Stem Leaves Juvenile bark Leaves Bulbs

Table 8. Manokwari traditional medicinal plants used for other medical conditions Plant name Amomum sp. Artocarpus altilis (Park.) Fosb. Canarium sp. Drimys beccariana L.S. Gibbs. Ficus benjamina L. Gnetum gnemon L. Litsea sp. Palaquium sp. Pimelodendron amboinicum Hassk. Pipturus repandus (Bl). Wedd. Platycerium sp. Pometia pinnata Forst. Epipremnum pinnatum (L.) Engl. Schismatoglottis calyptrata Zoll. & Mor. Selaginella Palisot de Beauvois Spathodea campanulata Beauv.

Family Zingiberaceae Moraceae Burseraceae Winteraceae Moraceae Gnetaceae Lauraceae Sapotaceae Euphorbiaceae Urticaceae Polypodiaceae Sapindaceae Araceae Araceae Selaginellaceae Bignoniaceae

Medical conditions Sexually transmitted diseases in men Gonorrhea Hepatitis Lethargy Bone fracture Hepatitis Gonorrhea Sexually transmitted diseases in men Sexually transmitted diseases in men Epilepsy Hepatitis Lethargy Hepatitis, sexually transmitted diseases in men Bone fracture Broken legs Tonic

Similar traditional uses of some species recorded in this group have also been reported in different countries. In Samoa, the leaves of Cordyline fruticosa was used to cure eye inflammation (Dittmar 1998), and in Tonga, leaves were used for eye complaints, eye infections, as well as toothache, gum infections, and gum abscesses (Weiner 1971). The leaves of this species contain thymidine and the flowers contain chelidonic acid (Wong 1976). Plants used for wounds and burns Extracts from 13 species of Manokwari medicinal plants (Table 7) were used to treat wounds and burns. Cuts and wounds may be bathed with potions of certain medicinal plants made simply by crushing the leaves, stem, or bulbs of specific plants, or by heating those parts before crushing and applying the juices. Sap of the stem of Artocarpus altilis may also be applied. Excessive bleeding may be stopped by applying the outer bark of Bambusa vulgaris or the juices of Ageratum conyzoides.

Plant parts used Leaves Sap Bark Bark Bark Bark Bark Latex Leaves, bark Leaves Leaves Bark Leaves Leaves Stem juices Bark

Burns may be treated by applying crushed stems of Cyathea contaminans and masticated juvenile bark of Pometia pinnata. The potion of the Cyathea contaminans was prepared by crushing the juvenile part of the stem to a gel and applying directly on burns. P. pinnata is commonly used throughout the Manokwari District. Furthermore, the medicinal plants recorded in this group also have been reported to be used to treat similar medical conditions worldwide. Ageratum conyzoides is used in Java, Indonesia, to cure similar ailments. In Malaysia and the Philippines it is used to treat cuts, boils, and wounds, and is thought to have anti-tetanus properties (Salleh 1997). In Central Africa, Cameroon and Congo, and elsewhere in Africa (Durodola 1977), A. conyzoides is used to cure pneumonia, but the most common use is to heal wounds and burns. The species is reputed to be a quick and effective cure for burns and is recommended by the Brazilian Drugs Central as an antirheumatic (Ming 1999). Pharmacological investigations by Ming (1999) have

LENSE â&#x20AC;&#x201C; The wild medicinal plants of Manokwari, West Papua

confirmed that Ageratum conyzoides has an effective analgesic action in rats when an aqueous extract of leaves (100 to 400 mg/kg) is used. Trials in Kenya, using aqueous extracts of the whole plant, have demonstrated musclerelaxing activities, confirming its popular use as an antipasmotic (Achola et al. 1994). Similar results were obtained in experiments conducted by State University of Campinas and Paraiba Federal University, Brazil. In clinical trials on patients with arthritis who were given an aqueous extract of the whole A. conyzoides plant, 66% of patients reported a decrease in pain and inflammation and 24% reported increased mobility; no side effects were apparent after a week of treatment (Ming 1999). In Samoa and Hawaii, the twigs and fruits of Artocarpus altilis are used as a cure for wounds (Dittmar 1998), whereas the people in Langkawi, Malaysia used the juvenile stem of Cyathea contaminans L. (Salleh 1997;Woodley 1991). Other uses (OTH) The 16 species in this group have diverse applications. Medical treatment ranges from treating sexual diseases of men, lethargy, hepatitis, and bone fractures (Table 8). Of these, only a few species stand out as being of some importance. Medical conditions related to sexually transmitted diseases in men are the most common conditions treated. Preparations of medicinal plants are applied to affected areas. Table 8 indicates that many of the species listed can produce exudates (latex or sap) that are applied directly, whereas the bark of Artocarpus altilis, Litsea sp., Palaquium sp., and Pimelodendron amboinicum was crushed and then applied. There is no supporting information regarding the efficacy of these species in treating similar conditions in different regions. Hence, further phytochemical studies, as well as clinical investigations, are needed in order to prove their efficacy. The species Drimys beccariana (akuai) has become a very popular medicinal plant in Mimyambouw area and surroundings. The stem-bark of this species is normally used by the indigenous people, especially the Hatam tribe, as a tonic. In general, the bark is chewed or some it can be prepared as a decoction to drink to strengthen people and to provide energy for long distance travel, such as visiting family in different villages or visiting the capital city of Manokwari District. Crushed bark of Ficus benjamina is used for broken bones as a hard gypsum-like plaster bandage. Parts of plants used and preparation The indigenous people in Manokwari District have been shown to use almost all the parts of medicinal plants for treating a wide range of sickness, accidents, and injuries. Leaves and leaf extracts are the most common parts of the plant used by traditional healers and all the materials are collected from the rainforest (Figure 2). In most cases plant preparation is minimal: crushing fresh material and applying directly to the affected part of the body; or brewing a tea or infusion for drinking. For example, for treating coughs and malaria, the bark of Alstonia scholaris is scraped, boiled, cooled, filtered, and then drunk. A small amount of cold or hot water is usually added to the

105

concoction, especially to make liquid medicine more palatable. Some traditional medicines are applied directly to the patient without initial preparation. For example, to cure wounds and sexually transmitted diseases in men, the latex of Artocarpus altilis is applied to the wounds or genital organs.

Figure 2. Plant parts are commonly used for traditional medicine by indigenous people from Manokwari District.

Although each traditional plant has its own dosage and frequency of use, most indigenous people in Manokwari District will continue to use the traditional medicines twice a day until the patient is totally healed. They do not recognize contra-indications during the healing process, except where the plants are used to heal particular diseases, which are related to the â&#x20AC;&#x153;supernaturalâ&#x20AC;?. Local preservation of plant knowledge Recently, with greater movement of young people away from the villages, a significant decrease in the plant knowledge of the younger generations has been noticed in many parts of the region. While one of the original intentions of this study was to determine the extent to which a similar trend is occurring in the Manokwari District area, this was difficult to assess because of the relatively small number of permanent residents less than 60 years of age. However, it was found that when members of the younger generation returned to visit their villages, many spent time with their parents and older relatives asking about plants, animals, and cultural traditions. Knowledge of the medicinal uses of plants is an individually developed skill that is regarded as a person's particular interests or gift. Certain individuals are recognized as special authorities on healing, and are consulted on a regular basis for remedies for serious and/or persistent illnesses. It appears that most sick people first attempt to cure themselves, and if unsuccessful, they will then visit a traditional healer. If the healer's remedies also fail, only then will the person seek the help of a distant medical doctor. In most cases, when the indigenous people of the Manokwari District felt malaise or have aches, they called upon the services of a traditional healer.

B I O D I V E R S IT A S 13 (2): 98-106, April 2012

106

Quite often returning villagers who have established permanent residences elsewhere also turned to the traditional healers for natural herbal remedies. Many villagers expressed strong distrust and/or disbelief in “[western] medical knowledge,” and only when desperate would they visit the area doctor in another village or travel to a city hospital. Many people simply refused to consult doctors at all. The main factors contributing to such attitudes seem to be the equating of pills of undetermined origin and content with potent poisons, and to abhorrence for invasive surgical procedures. Such beliefs have arisen from failed medical treatment of close relatives who have suffered a chronic or serious disease or have died. Undoubtedly, the frequency of such failed treatments may be due to the fact that most diseases were in advanced stages before patients subjected themselves to treatment. Cost is another factor, and traditional healers were readily accessible, whereas medical treatment often involved great financial expense and arduous travel.

CONCLUSION The indigenous people in Manokwari have been using at least 99 plant species as sources of medicines; the plats are widely distributed among 93 genera and 59 families. Most of these traditional plants are commonly gathered from the local rainforest communities. The plants have been used by the native people to treat medical conditions grouped into several categories namely gastrointestinal disorders, dermatological conditions, illnesses associated with pain and/or fever, respiratory illnesses, women’s medicines, plants used to counteract bites by venomous animal, wounds, burn, and eye remedies, and other uses. The indigenous people in Manokwari have used almost part of the plants for treating several medical conditions, but leaf extract are the most common part used by traditional healers. Plant parts are prepared either by crushing down or apply fresh material and by direct application to the affected part of the body or brewing a tea of infusion for drinking.

REFFERENCES Achola KJ, Munenge RW, Mwaura AM. 1994. Pharmacological properties of root and aerial parts extracts of Ageratum conyzoides. Fitoterapia 65: 322-325. Alhamid H, Sunarliani N. 1996. Inventory of the putative medicinal plants in Tangma (Kurima) tribe, Jayawijaya District. Research and Development, Forestry Department of Indonesia, Manokwari, West Papua. [Indonesian] Ankli A, Sticher O, Heinrich M. 1999. Medical Ethnobotany of the Yucatec Maya: Healers’ Consensus as a Quantitative Criterion. Econ Bot 53 (2): 144-160. Alvarez L, Marquina S, Villarreal ML, Alonso D, Aranda E, Delgado G. 1996. Bioactive polyacetylenes from Bidens pilosa L. Planta Medica 62 (4): 355-357 Arnason T, Wat CK, Downum K, Yamamoto E, Graham E, Towers GH. 1980. Photosensitization of Escherichia coli and Saccharomyces cerevisiae by phenylheptatriyne from Bidens pilosa. Canadian J Microbiol 26 (6): 698-705.

Cambie RC, Ash J. 1994. Fijian medicinal plants. CSIRO, Collingwood. Cambie RC, Brewis AA. 1997. Anti-fertility plants of the Pacific. CSIRO, Collingwood. Chhabra SC, Mahunnah RLA. 1994. Plants used in traditional medicine by hayas of the Kagera region, Tanzania. Econ Bot 48 (2): 121-129. Chih HW, Lin,CC, Tang KS. 1995. Anti-inflammatory activity of Taiwan folk medicine "ham-hong-chho" in rats. Amer J Chinese Med 23 (34): 273-278. Chin HW, Lin CC, and Tang KS. 1996. The hepatoprotective effects of Taiwan folk medicine ham-hong-chho in rats. Amer J Chinese Med 24 (3-4): 231-240. Dittmar A. 1998. Traditional medicinal plants of Samoa. [Dissertation] University of Frankfurt, Germany. [Deutsche] Durodola JJ. 1977. Antibacterial property of crude extracts from herbal wound healing remedy: Ageratum conyzoides L. Planta Medica 32: 388-390. Erdelen WR, Adimihardja K, Moesdarono H. 1999. Biodiversity, traditional medicine and the sustainable use of indigenous medicinal plants in Indonesia. Indig Knowled Dev Monit 7: 3-6. Geissberger P, Sequin U. 1991. Constituents of Bidens pilosa L.: do the components found so far explain the use of this plant in traditional medicine?. Acta Tropica 48 (4): 251-261. Hadi S, Bremner JB. 2001. Initial studies on alkaloids from Lombok Medicinal Plants. Molecules 6: 117-129. Jager AK, Hutchings A, van Staden J. 1996. Screening of Zulu medicinal plants for prostaglandin-synthesis inhibitors. J Ethnopharmacol 52 (2): 95-100. Jayaweera DMS. 1999. The medicinal plants of Ceylon. Ceylon Institute of Scientific & Industrial Research, Colombo, Sri Lanka. Martin GJ. 1995. Ethnobotany: A people and plants conservation manual. Chapman & Hall., London. Ming LC. 1999. Ageratum conyzoides: A tropical source of medicinal and agricultural products. p. 469-473. In: Janick J (eds.), Perspectives on new crops and new uses. ASHS Press, Alexandria, VA. Perry LM. 1980. Medicinal plants of East and Southeast Asia: attributed properties and uses. MIT Press, Cambridge, MA. Purwanto Y, Waluyo EB. 1992. Etnobotani suku Dani di Lembah Baliem, Irian Jaya: suatu telaah tentang pengetahuan dan pemamfaatan sumberdaya alam tumbuhan. In: proceeding of national seminar and workshop on Ethnobotany I. Indonesia Institute of Sciences, Jakarta, 19-20 February 1992. [Indonesian] Qujano J, Arango GJ. 1979. The breadfruit from Colombia. Econ Bot 33 (2): 199-202. Rabe T, van Staden J. 1997. Antibacterial activity of South African plants used for medicinal purposes. J Ethnopharmacol 56 (1): 81-87 Roemantyo HS, Wiriadinata H. 1991. Utilisation of medicinal plants species in Kupang Region, West Timor, Indonesia. In: Zuhud EAM (ed) Conservation of utilization of medicinal Plant of tropical Forest of Indonesia; proceeding of national seminar on medicinal plant. In collaboration between Forest Conservation Department, Bogor Institute of Agriculture, Bogor and Yayasan Pembinaan Suaka Alam dan Margasatwa Indonesia, Bogor, 30-31 Mei 1990. [Indonesian] Salleh. 1997. Ethnobotany, Ethnopharmacognasy and documentation of Malaysia Medicinal and Aromatic Plants. University Kebangsaan Malaysia, Malaysia. Sarg TM, Ateya AM, Farrag NM, Abbas FA. 1991. Constituents and biological activity of Bidens pilosa L. grown in Egypt. Acta Pharm Hung 61 (6): 317-323. Shankar D, Hafeel A, Suma TS. 1999. Cultural richness of green pharmacy. Compass Newslett Indig Dev 2: 10-11. Singh VN. 1984. Folk medicine in Tonga. J Ethnopharmacol 15: 57-88. Spennemann DHR. 2000. Plants and their uses in the Marshalls-Medicinal Plants. Albury: URL: http: /marshall.csu.edu.au/Marshalls/html/plants/medicine.html Taylor L. 1998. Herbal Secrets of the Rainforest: the healing power of over 50 medicinal plants you should know about. Prima Publishing, California. Woodley E. 1991. Medicinal plants of Papua New Guinea. Wau Ecology Institute, Papua New Guinea. Wat CK, Biswas RK, Graham EA, Bohm L, Towers GH, Waygood ER. 1979. Ultraviolet-mediated cytotoxic activity of phenylheptatriyne from Bidens pilosa L. J Nat Prod 42 (1): 103-111. Weiner MA. 1971. Ethnomedicine in Tonga. Econ Bot 25: 422-451. Wong W. 1976. Folk medicinal plants from Trinidad. Econ Bot 30: 10342.

GUIDANCE FOR AUTHORS Aims and Scope ”Biodiversitas, Journal of Biological Diversity” or Biodiversitas encourages submission of manuscripts dealing with all biodiversity aspects of plants, animals and microbes at the level of gene, species, and ecosystem. Article types The journal seeks original full-length research papers, reviews, and scientific feedback (short communication) about material previously published. Acceptance The only articles written in English (U.S. English) are accepted for publication. Manuscripts will be reviewed by managing editor, communicating editor and invited peer review according to their disciplines. Authors will generally be notified of acceptance, rejection, or need for revision within 2 to 3 months of receipt. Manuscript is rejected if the content is not in line with the journal scope, dishonest, does not meet the required quality, written in inappropriate format, has incorrect grammar, or ignores correspondence in three months. The primary criteria for publication are scientific quality and biodiversity significance. The accepted papers will be published in a chronological order. This journal periodically publishes in January, April, July, and October. Uncorrection proofs will be sent to the corresponding author by e-mail as .doc or .docx files for checking and correcting of typographical errors. To avoid delay in publication, proofs should be returned in 7 days. A charge The cost of each manuscript is IDR 250,000,- plus postal cost or IDR 150,000,- for SIB members. There is free of charge for non Indonesian author(s), but need to pay postal cost for hardcopy. Reprints Two copies of journal will be supplied to authors; reprint is only available with special request. Additional copies may be purchased by order when sending back the uncorrection proofs by e-mail. Submission The journal only accepts online submission, through e-mail to the managing editor at unsjournals@gmail.com; better to forward to one of the communicating editor for accelerating evaluation.. The manuscript must be accompanied with a cover letter containing the article title, the first name and last name of all the authors, a paragraph describing the claimed novelty of the findings versus current knowledge, and a list of five suggested international reviewers (title, name, postal address, email address). Reviewers must not be subject to a conflict of interest involving the author(s) or manuscript(s). The editor is not obligated to use any reviewer suggested by the author(s). Copyright Submission of a manuscript implies that the submitted work has not been published before (except as part of a thesis or report, or abstract); that it is not under consideration for publication elsewhere; that its publication has been approved by all co-authors. If and when the manuscript is accepted for publication, the author(s) agree to transfer copyright of the accepted manuscript to Biodiversitas. Authors shall no longer be allowed to publish manuscript without permission. For the new invention, authors suggested to manage its patent before publishing in this journal. Open access The journal is committed to free open access that does not charge readers or their institutions for access. Users are entitled to read, download, copy, distribute, print, search, or link to the full texts of the articles, as long as not for commercial purposes. For the new invention, authors are suggested to manage its patent before published. Preparing the Manuscript Manuscript is typed at one side of white paper of A4 (210x297 mm2) size, in a single column, double space, 12-point Times New Roman font, with 2 cm distance step aside in all side. Smaller letter size and space can be applied in presenting table. Word processing program or additional software can be used, however, it must be PC compatible and Microsoft Word based. Names of sub-species until phylum should be written in italic, except for italic sentence. Scientific name (genera, species, author), and cultivar or strain should be mentioned completely at the first time mentioning it, especially for taxonomic manuscripts. Name of genera can be shortened after first mentioning, except generating confusion. Name of author can be eliminated after first mentioning. For example, Rhizopus oryzae L. UICC 524, hereinafter can be written as R. oryzae UICC 524. Using trivial name should be avoided, otherwise generating confusion. Mentioning of scientific name completely can be repeated at Materials and Methods. Biochemical and chemical nomenclature should follow the order of IUPAC-IUB, while its translation to Indonesian-English refers to Glossarium Istilah AsingIndonesia (2006). For DNA sequence, it is better used Courier New font. Symbols of standard chemical and abbreviation of chemistry name can be applied for common and clear used, for example, completely written butilic hydroxytoluene to be BHT hereinafter. Metric measurement use IS denomination, usage other system should follow the value of equivalent with the denomination of IS first mentioning. Abbreviation set of, like g, mg, mL, etc. do not follow by dot. Minus index (m-2, L-1, h-1) suggested to be used, except in things like “per-plant” or “per-plot”. Equation of mathematics does not always can be written down in one column with text, for that case can be written separately. Number one to ten are expressed with words, except if it relates to measurement, while values above them written in number, except in early sentence. Fraction should be expressed in decimal. In text, it should be used “%” rather than “gratuity”. Avoid expressing idea with complicated

sentence and verbiage, and used efficient and effective sentence. Manuscript of original research should be written in no more than 25 pages (including tables and picture), each page contain 700-800 word, or proportional with article in this publication number. Invited review articles will be accommodated. Title of article should be written in compact, clear, and informative sentence preferably not more than 20 words. Name of author(s) should be completely written. Running title is about five words. Name and institution address should be also completely written with street name and number (location), zip code, telephone number, facsimile number, and e-mail address. Manuscript written by a group, author for correspondence along with address is required. First page of the manuscript is used for writing above information. Abstract should not be more than 200 words, written in English. Keywords is about five words, covering scientific and local name (if any), research theme, and special methods which used. Introduction is about 400600 words, covering background and aims of the research. Materials and Methods should emphasize on the procedures and data analysis. Results and Discussion should be written as a series of connecting sentences, however, for manuscript with long discussion should be divided into sub titles. Thorough discussion represents the causal effect mainly explains for why and how the results of the research were taken place, and do not only re-express the mentioned results in the form of sentences. Concluding sentence should preferably be given at the end of the discussion. Acknowledgments are expressed in a brief. Figures and Tables of maximum of three pages should be clearly presented. Title of a picture is written down below the picture, while title of a table is written in the above the table. Colored picture and photo can be accepted if information in manuscript can lose without those images. Photos and pictures are preferably presented in a digital file. JPEG format should be sent in the final (accepted) article. Author could consign any picture or photo for front cover, although it does not print in the manuscript. There is no appendix, all data or data analysis are incorporated into Results and Discussions. For broad data, it can be displayed in website as Supplement. Citation in manuscript is written in “name and year” system; and is arranged from oldest to newest and from A to Z. The sentence sourced from many authors, should be structured based on the year of recently. In citing an article written by two authors, both of them should be mentioned, however, for three and more authors only the family (last) name of the first author is mentioned followed by et al., for example: Saharjo and Nurhayati (2006) or (Boonkerd 2003a, b, c; Sugiyarto 2004; El-Bana and Nijs 2005; Balagadde et al. 2008; Webb et al. 2008). Extent citation as shown with word “cit” should be avoided. Reference to unpublished data and personal communication should not appear in the list but should be cited in the text only (e.g., Rifai MA 2007, personal communication; Setyawan AD 2007, unpublished data). In the reference list, the references should be listed in an alphabetical order. Names of journals should be abbreviated according to the ISSN List of Title Word Abbreviations (www.issn.org/2-22661-LTWA-online.php). APA style in double space is used in the journal reference as follow: Journal: Saharjo BH, Nurhayati AD (2006) Domination and composition structure change at hemic peat natural regeneration following burning; a case study in Pelalawan, Riau Province. Biodiversitas 7: 154-158. Book: Rai MK, Carpinella C (2006) Naturally occurring bioactive compounds. Elsevier, Amsterdam. Chapter in book: Webb CO, Cannon CH, Davies SJ (2008) Ecological organization, biogeography and the phylogenetic structure of rainforest tree communities. In: Carson W, Schnitzer S (eds) Tropical forest community ecology. Wiley-Blackwell, New York. Abstract: Assaeed AM (2007) Seed production and dispersal of Rhazya stricta. 50th annual symposium of the International Association for Vegetation Science, Swansea, UK, 23-27 July 2007. Proceeding: Alikodra HS (2000) Biodiversity for development of local autonomous government. In: Setyawan AD, Sutarno (eds) Toward mount Lawu national park; proceeding of national seminary and workshop on biodiversity conservation to protect and save germplasm in Java island. Sebelas Maret University, Surakarta, 17-20 July 2000. [Indonesian] Thesis, Dissertation: Sugiyarto (2004) Soil macro-invertebrates diversity and inter-cropping plants productivity in agroforestry system based on sengon. [Dissertation]. Brawijaya University, Malang. [Indonesian] Information from internet: Balagadde FK, Song H, Ozaki J, Collins CH, Barnet M, Arnold FH, Quake SR, You L (2008) A synthetic Escherichia coli predator-prey ecosystem. Mol Syst Biol 4: 187. www.molecularsystemsbiology.com

ISSN: 1412-033X E-ISSN: 2085-4722

GENETIC DIVERSTY The conservation of mitochondrial genome sequence in Leucadendron (Proteaceae) MADE PHARMAWATI, GUIJUN YAN, PATRICK M. FINNEGAN Isolation and phylogenetic relationship of orchid-mycorrhiza from Spathoglottis plicata of Papua using mitochondrial ribosomal large subunit (mt-Ls) DNA SUPENI SUFAATI, VERENA AGUSTINI, SUHARNO

53-58 59-64

ECOSYSTEM DIVERSTY Diversity of macrofungal genus Russula and Amanita in Hirpora Wildlife Sanctuary, Southern Kashmir Himalayas SHAUKET AHMED PALA, ABDUL HAMID WANI, RIYAZ AHMAD MIR Effect of plantations on plant species diversity in the Darabkola, Mazandaran Province, North of Iran HASSAN POURBABAEI, FATEMEH ASGARI, ALBERT REIF, ROYA ABEDI Determination of long-tailed macaqueâ&#x20AC;&#x2122;s (Macaca fascicularis) harvesting quotas based on demographic parameters YANTO SANTOSA, KUSMARDIASTUTI, AGUS PRIYONO KARTONO, DEDE AULIA RAHMAN The population condition and the food availability of cuscus in the Arfak Mountains Nature Reserve, West Papua ANTON SILAS SINERY, CHANDRADEWANA BOER, WARTIKA ROSA FARIDA ETHNOBIOLOGY Vegetation stands structure and aboveground biomass after the shifting cultivation practices of Karo People in Leuser Ecosystem, North Sumatra T. ALIEF ATHTHORICK, DEDE SETIADI, YOHANES PURWANTO, EDI GUHARDJA The wild plants used as traditional medicines by indigenous people of Manokwari, West Papua OBED LENSE

65-71

72-78

79-85

86-91

92-97

98-106

Front cover: Leucadendron salignum (PHOTO: SEAN PRIVETT)

Published four times in one year

PRINTED IN INDONESIA ISSN: 1412-033X

E-ISSN: 2085-4722