Next Article in Journal
A Study on Endogenous Inhibitors of Nitraria roborowskii Kom. Seeds
Previous Article in Journal
Altitudinal Variation in Species Diversity, Distribution, and Regeneration Status of a Secondary Picea Forest in Guandi Mountain, Northern China
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Forests
Volume 15
Issue 5
10.3390/f15050772
forests-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Detection of Phytophthora cinnamomi by RPA-CRISPR/Cas12a-Mediated Isothermal Amplification

by
Xiaoqiao Xu
1,
Tingting Dai
1,2,*,
Qin Xiong
1,
Jing Yang
2,
Jiahui Zang
1 and
Tingli Liu
3
1
South China Sustainable Forestry Co-Innovation Center, Nanjing Forestry University, Nanjing 210037, China
2
Advanced Analytical & Test Laboratory, Nanjing Forestry University, Nanjing 210037, China
3
School of Food Science, Nanjing Xiaozhuang University, 3601 Hongjin Avenue, Nanjing 211171, China
*
Author to whom correspondence should be addressed.
Forests 2024, 15(5), 772; https://doi.org/10.3390/f15050772
Submission received: 8 March 2024 / Revised: 24 April 2024 / Accepted: 24 April 2024 / Published: 28 April 2024
(This article belongs to the Special Issue Recent Scientific Developments in Forest Pathology)
Browse Figures
Review Reports Versions Notes

Abstract

:
Background: Phytophthora cinnamomi is one of the soil-borne pathogens that causes root rot and stem rot in many plants globally. P. cinnamomi has serious economic, social, and environmental impacts, threatening natural ecosystems and biodiversity. Methods: In this study, a molecular detection method based on Recombinant polymorphic amplification (RPA) combined using the CRISPR/Cas12a system was developed for P. cinnamomi. The method was found to be highly specific for P. cinnamomi. Results: The results showed that 10 P. cinnamomi isolates were positive; however, 21 Phytophthora species, 4 Phytopythium species, 18 fungal species, and 2 Bursaphelenchus species were negative. In total, 10 pg·µL−1 of P. cinnamomi genomic DNA can be detected. The detection process is performed within 20 min at 37 °C, which makes it fast and convenient for use. Discussion: In conclusion, the RPA-CRISPR/Cas12a system in this study is a promising tool for the rapid and sensitive detection of P. cinnamomi in plant samples.

1. Introduction

Phytophthora cinnamomi is a soil-borne plant pathogen with a global distribution, and is listed as one of the 100 worst invasive alien species in the global invasive species database [1,2]. It infects nearly 5000 species of plants, including many plants important in agriculture, forestry, and horticulture [3]. P. cinnamomi is one of the most important pathogenic fungi in forest disease control, threatening natural ecosystems and biodiversity [4]. P. cinnamomi causes the decline of chestnuts and oaks in the Mediterranean region of Europe and the United States [5].
The first known species of P. cinnamomi, was described by Rands in 1922. Phytophthora cinnamomi var. cinnamomi (Rands) was found to cause stripe ulcer disease in camphor plants in Sumatra [6]. P. cinnamomi is widely distributed in America, Europe, Oceania, and Southeast Asia, and has been reported in more than 70 countries and regions. The host range is extremely broad, and 182 strains have been isolated from more than 3000 species of forest trees, agricultural crops, and other host plants. In China, the hosts of P. cinnamomi include pine needles, camphor, bromeliads, avocado, cedar, chili pepper, acacia, papaya, cinchona, tobacco, etc. [7].
The detection and analysis of P. cinnamomi has evolved with the development of molecular techniques, while its precision is being challenged by new agents [8]. Conventional PCR (real-time PCR) methods have been developed for the identification of P. cinnamomi using molecular detection tests based on isothermal amplification. Manisha B et al. (2019) developed a P. cinnamomi qPCR assay for detecting P. cinnamomi, which has high sensitivity [9]. However, these analytical methods rely on thermocycling devices and other specialized equipment to prepare samples and provide results [10]. This also presents challenges, including primer interference, signal interference, and the complexity of system optimization. Furthermore, these traditional molecular assays have limited utility for disease diagnosis because they require centralized laboratory resources, expensive equipment, and complex sample preparation [11,12,13,14].
CRISPR-Cas (clusters of regularly spaced short palindromic repeats and their associated protein systems) technology has revolutionized the field of gene editing and has also shown great potential for various biological applications, including pathogen detection [15,16]. The CRISPR-Cas system is a powerful tool for detecting specific nucleic acid sequences with high sensitivity and specificity, making it an attractive option for the rapid and accurate diagnosis of diseases [17]. Researchers have developed CRISPR-Cas-based nucleic acid detection technology that is fast, accurate, and sensitive, making it ideal for next-generation rapid and sensitive on-site nucleic acid detection. The technology was recognized by Science as one of the top ten breakthroughs in science and technology in 2018 [18]. CRISPR-Cas has been successfully used for detecting pathogenic microorganisms, genetic diseases, tumor mutations, small molecules, etc. [19,20]. It was an ideal next-generation technology for the rapid and sensitive on-site detection of nucleic acids [21]. The use of CRISPR-Cas for pathogen detection offers several advantages over conventional methods such as PCR [22]. One of the main advantages is the speed of the assay. CRISPR-Cas systems can be designed to detect multiple targets simultaneously, reducing the time required for sample processing and analysis. Additionally, the system can be adapted for use in portable devices, enabling the on-site testing and real-time monitoring of infectious agents. Another advantage of CRISPR-Cas technology is its versatility [23,24,25]. The system can be programmed to target a wide range of pathogens. This makes it suitable for use in various settings, from clinical diagnostics to environmental monitoring [26]. Moreover, CRISPR-Cas technology has the potential to improve the accuracy of detection by reducing the chances of false positives and false negatives. The system can be designed to recognize specific sequences that are unique to a particular pathogen, minimizing the risk of cross-reactivity with other microorganisms [27,28]. In conclusion, CRISPR-Cas technology has shown great promise in the field of pathogen detection, offering advantages such as speed, versatility, and accuracy. As technology continues to evolve, it has the potential to transform the way we diagnose and manage infectious diseases, ultimately contributing to improved public health outcomes [29].
In this study, an RPA-CRISPR/Cas12a assay based on a novel target Pcinn204169 using a comparative genomics approach was developed to detect P. cinnamomi, a devastating plant pathogen. This method was designed to provide fast results with a high accuracy, which is crucial for managing plant diseases effectively. Overall, this RPA-CRISPR/Cas12a assay offers a significant improvement in speed and convenience over traditional PCR-based methods for detecting P. cinnamomi. The ability to perform the entire process from sample to result in just 30 min makes it a valuable tool for rapid disease diagnosis and management, especially in forestry settings where timely intervention can prevent significant forest losses.

2. Materials and Methods

2.1. Maintenance of Isolates and DNA Extraction

The isolates of fungi and oomycetes tested in this study are listed in Table 1. The isolates were stored at the Department of Plant Pathology, Nanjing Forestry University (NFU), China. P. cinnamomi and other oomycetes were isolated and grew on a 10% concentration V8 vegetable juice agar on 70-mm Petri dishes at an optimum temperature of 18–25 °C. The fungi were isolated and grew on a potato dextrose agar (PDA) on 90-mm Petri dishes at an optimum temperature of 20 °C. Both were incubated in the dark. For 3–5 d, the genomic DNA (gDNA) of the test strain was extracted using the DNA secure Plant Kit (Tiangen Biotech, Beijing, China) and quantified using a Nanodrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). All DNA samples were stored in a refrigerator at −20 °C.

2.2. Designing RPA Primers, CRISPR RNA, and ssDNA Reporter Genes

To select the candidate target genes for the P. cinnamomi-specific RPA–CRISPR reaction, the annotated genomic sequence of P. cinnamomi at https://genome.jgi.doe.gov/Phyci1/Phyci1.home.html (accessed on 7 March 2024) was retrieved. To identify the target genes unique to P. cinnamomi, we initially retrieved all the publicly available genome sequences of the Phytophthoa species. Then, all the 26,131 gene sequences of P. cinnamomi were used as the queries to blast against the above genomes (e-value cutoff: 1 × 10−5), and the genes without any hit were treated as unique to P. cinnamomi [30]. The Pcinn204169 gene (scaffold_174: 124989-125344) was selected as the target for the design of gene-specific RPA primers. The RPA primer was constructed according to the recommendation of the DNA sequencing kits manuals (Figure 1) using Primer Premier 6.0 (Premier Biosoft, Palm Alto, CA, USA). For the construction of the CRISPR RNA (crRNA) and ssDNA reporter, the CHOPCHOP web tool (http://chopchop.cbu.uib.no/, accessed on 26 May 2023) was employed. The crRNA was designed not to duplicate the sequence of the RPA primers and targeted the conservative region in the RPA amplification (crRNA: UAAUUUCUACUAAGUGUAGAUAGGCCAAUGCCGCCAAUGAC) (Figure 1). The 5′ terminus of the ssDNA reporter was labeled using 6-FAM, whereas the 3′ terminus was labeled using the BHQ-1 transcription factor quencher (5′-6-FAM-TTATT-BHQ-1-3′). The crRNA and ssDNA reporters were prepared by GenScript (Nanjing, China). They were maintained at −80 °C until the assay was carried out.

2.3. RPA–CRISPR/Cas12a Assays

The 20 min test consisted of two steps: 10 min for the RPA reaction and 10 min for the detection of CRISPR/Cas12a. Firstly, P. cinnamomi DNA was amplified in 10 min using a pair of RPA primers (Pcinn204169 RPA-F/-R). Then, the amplified product was detected and visualized within 10 min using the CRISPR/Cas12a system. The flow of the assay for the analysis of RPA-CRISPR/Cas12a is illustrated in Figure 2. The assays were conducted according to the manufacturer’s recommendations using the Test Strip Kit (LeShang Ltd., WuXi, China) in a 50 µL reaction mixture. Initially, the reactions consisted of 2 µL of each forward or backward primer (Pcinn204169 RPA-F/-R, 10 µM), 25 µL of the supplied buffer, 2 µL of gDNA (100 ng/µL), and 16 µL of doubly distilled water (ddH2O) (47 µL total). Each sample was centrifuged at 4000× g for 5 s, and then 3 µL of initiator was added to the cap of the reaction tube. The tube was covered and centrifuged at 4000 rpm for 5 s after multiple rounds of mixing, and the reaction was performed at 37 °C for 20 min. We spent 20 min on the detection test. To eliminate false positives, each set of reactions included a no-template control (NTC) and a positive control (PTC). The CRISPR/Cas12a system was used to analyze RPA products. RPA amplification products were used as templates and various concentrations of crRNA (40, 300, and 500 nM and 1, 2, 5, as well as 10 µM) and ssDNA (40 and 300 nM and 2, 1, 5, as well as 10 µM) were tested for optimum combinations of concentrations. The optimization of the reaction time of the RPA treatment and cleavage of Cas12a was tested at eight different times (5, 10, 15, 20, 25, 30, 35 and 40 min). The CRISPR/Cas12a expression was carried out using a 50 μL volume containing 38 μL ddH2O, 5 μL reaction buffers, 3 μL crRNA, 1 μL of Cas12a, 1 μL of ssDNA, and 2 μL of RPA products. The tube was then vortexed for 5 s at 4000 rpm and the reaction was performed at 37 °C. There are two methods for detecting the outcome of the RPA-CRISPR/Cas12a test. The multifunctional microplate reader detects a strong fluorescent signal or a visibly emitted green, fluorescent light under a transmitted blue LED light at about 470 nm, while no fluorescent signals or visibly emitted green, fluorescent light are observed for the negative controls. At least three replicates were performed for all RPA-CRISPR/Cas12a reactions. The STDEV function was used to calculate the standard deviation for the three CRISPR/Cas12a analysis results (1, 2, and 3). Statistical analysis was performed using GraphPad Prism 8 software (GraphPad software Inc., San Diego, CA, USA). For the analysis of variance, the experimental group was analyzed against the control group and a p-value was calculated. The difference of p < 0.05 (*) was considered statistically significant.

2.4. RPA–CRISPR/Cas12a Assay Specificity and Sensitivity

To evaluate the specificity of the RPA-CRISPR/Cas12a assay for P. cinnamomi, closely related Phytophthora species, such as P. parvispora, P. hibernalis, P. sojae, P. pini, P. cactorum, and P. nicotianae, were tested to evaluate the specificity. Intergeneric species such as P. ittorale, P. helicoides, P. aphanidermatum, P. dissotocum, F. oxysporium, and F. solani were also tested to further validate the accuracy of the specificity. Each set of reactions consisted of purified gDNA samples (100 ng) as the template, positive control (100 ng P. cinnamomi isolate), and ddH2O as NTC. We employed seven serial dilutions of P. cinnamomi genomic DNA (e.g., 10 ng, 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, and 10 fg) as templates for both the conventional PCR and RPA-CRISPR/Cas12a assays to evaluate the sensitivity of this assay. In both techniques, we incorporated an NTC into each reaction set and executed three replicates for all template concentrations. The STDEV function was used to analyze and calculate standard deviation. GraphPad Prism 8 software was used for statistical analyses. An analysis of variance was performed by comparing the experimental group with the control group and calculating the p-values. The difference of p < 0.05 (*) was considered statistically significant.

2.5. RPA-CRISPR/Cas12a to Detect P. cinnamomi from Artificially Inoculated Pine Needles

On the campus of Nanjing Forestry University, healthy pine needle plants were cut, rinsed with water for approximately 20 min, and placed on a piece of sterilized filter paper for the surface sterilization of pine needle blades. Pine needle stalks were inoculated with P. cinnamomi, incubated wet, and observed daily. On day 1, there was no significant change in pine needle stems. On day 2, pine needle stems were slightly blackened, and on days 3 and 4, the discoloration of the plant stems was more pronounced. The diseased pine needle stalks were cut into small pieces of approximately one cubic centimeter. Specimens were ground for 1 min using a grinder. To extract DNA, 1 mL of sodium hydroxide lysate and 100 mg of inoculated sample were mixed vigorously in liquid nitrogen powder for 10 min at room temperature (25 °C). During incubation, the samples were tapped three times. RPA (100 ng·µL−1) and ddH2O were used as PTC and NTC, respectively, and 2 µL of lysate was used as a template for the RPA assay. At least three repetitions of the experiment were performed. The STDEV function was used for the analysis and calculation of the standard deviation. GraphPad Prism 8 software was used for statistical analyses. The experimental group was analyzed against the control group and a p-value was calculated for the analysis of variance. The difference was p < 0.05 (*), which is statistically significant.

3. Results

3.1. Optimization of the RPA-CRISPR/Cas12a-Based Test for the Detection of P. cinnamomi

Overall, 10 μM crRNA and 10 μM ssDNA reporters were optimized for the expression of RPA-CRISPR/Cas12a, as shown by the intensity of green fluorescence and fluorescence (Figure 3A,B). The optimal concentrations were tested to determine the optimal RPA reaction time (assessed at 5, 10, 15, 20, 25, 30, 35, and 40 min). After 10 min, a considerable amount of green fluorescent emission could be detected under the blue light LED illuminator (Figure 4A,B). The optimal response time for RPA was 10 min. The optimal cleavage time (5, 10, 15, 20, 25, 30, 35, and 40 min) of Cas12a was evaluated using the 10 min RPA reaction product, and the results showed that the optimum clearing time was at 10 min (Figure 4C,D). In summary, the green fluorescent protein is visible after only 20 min (10 min for the RPA and 10 min for the Cas12a cleavage) (Figure 4).

3.2. The Specificity of P. cinnamomi Was Rapidly Detected with RPA-CRISPR/Cas12a

P. cinnamomi was used as the template DNA, with primers Pcinn204169 RPA-F/-R. Interspecific DNAs are shown from left to right: P. parvispora, P. hibernalis, P. sojae, P. pini, P. cactorum, and P. nicotianae (Figure 5A,C). Intergeneric DNAs are shown from left to right: P. litorale, P. helicoides, P. aphanidermatum, P. dissotocum, F. oxysporium, F. solani, and the blank control NC (Figure 5B,D). When testing the specificity of the RPA–CRISPR/Cas12a test, the multi-functional microtiter plate readers demonstrated a high fluorescent response to the P. cinnamomi gDNA, while the gDNA from the other oomycetes and fungi did not fluoresce.

3.3. The Sensitivity of P. cinnamomi Was Rapidly Detected with the RPA-CRISPR/Cas12a Assay

To determine the sensitivity of the RPA-CRISPR/Cas12a rapid assay for detecting P. cinnamomi, different concentrations of P. cinnamomi gDNA were sequentially diluted, and different concentrations of P. cinnamomi gDNA (10, and 1 ng; 100, 10, and 1 pg; and 100 fg) were extracted for the experiments. Concentrations of gDNA ranging between 10 ng, 1 ng, 100 pg, and 10 pg showed a visible green, fluorescent emission, while other levels of gDNA and the NC showed no visual evidence of fluorescence (Figure 6). Consistent values were obtained in three replications. This indicates that 10 pg is the minimum detectable concentration of gDNA.

3.4. Experimental Detection of P. cinnamomi-Infested Pine Needle Plants Using the RPA-CRISPR/Cas12a Approach

The crude DNA from inoculated pine needle stems of 1, 2, and 3 d and non-inoculated pine needle stems was extracted by NaOH lyes. For the RPA-CRISPR/Cas12a assay, the extracted DNA was used as a template. Purified gDNA (100 ng/µL) was used as the positive control and dd H2O was used as the negative control. P. cinnamomi was detected, as confirmed by the green fluorescence of the RPA-CRISPR/Cas12a rapid assay, in crude DNA samples from the positive controls and plants inoculated with P. cinnamomi (Figure 7A–C). Thus, RPA–CRISPR/Cas12a can effectively detect artificially inoculated P. cinnamomi.

4. Discussion

The RPA-CRISPR/Cas12a rapid diagnostic test for P. cinnamomi is reported here for the first time. The overall reaction times were 20 min (10 min for the RPA reactions and 10 min for the CRISPR/Cas12a assay), and the assay results could be visualized using UV lighting and fluorescence reading. The RPA-CRISPR/Cas12a assay was strongly influenced by the concentration of crRNA and ssDNA. Therefore, we screened various combinations of crRNA and ssDNA reporter gene concentrations, with both at a concentration of 10 μM. Our specificity evaluation confirms that the novel RPA-CRISPR/Cas12a system accurately detected P. cinnamomi gDNA and was negative for gDNA from other species. The method specifically detects P. cinnamomi at a minimum gDNA content of 10 pg using an RPA-CRISPR/Cas12a assay. The pine needle samples collected from P. cinnamomi-infected needles were used to evaluate the feasibility of the assay.
To date, for the detection of P. cinnamomi by nucleic acids, the characteristics of these methods are summarized as follows: qPCR is highly sensitive for the detection of P. cinnamomi but requires thermal cycling conditions and temperatures above 95 °C [9]. The detection of P. cinnamomi by qPCR can be performed in the field by using a portable qPCR instrument, which can be used in the field. Although portable qPCR instruments can be used in the field, the high temperatures and thermal cycling temperatures provided by high-power batteries or automobile batteries affect their feasibility in field testing [29,30]. LAMP is an efficient isothermal nucleic acid technique, but the need for high-power batteries affects its application in field testing due to the need for reaction temperatures in the 55 to 60 °C range [31].
The RPA-CRISPR/Cas12a method has many advantages over traditional techniques. On the one hand, the reaction is able to be completed in a stable temperature range at a fairly constant level of 37 °C. Such conditions can be easily achieved using human body temperature, a USB-powered incubator, or a thermostatic heater, this eliminates the need to use specialized and expensive instruments like temperature cycling devices. On the other hand, it is possible to perform the diagnostic procedure in ~20 min, whereas PCR-based tests require at least 2.5 h, with the PCR procedure taking 90 min and the gel electrophoresis 30 min [32,33,34,35]. And third, some RPA reaction components interfere with the antibodies on the test paper, which can lead to an inappropriate dilution, non-specific bindings, and incorrectly diluted false-positive reactions. The RPA binding with CRISPR-Cas12a allows for the dual detection of the target: once for identifying the RPA primer and then for identifying the RPA amplification product by CRISPR/Cas12a during the RPA reaction. This effectively circumvents the problem of false positives during RPA amplification [36,37]. RPA-CRISPR/Cas12a detection systems have many advantageous features, such as multiplexing capabilities, low requirement for complicated instrumentation and specialized personnel, and superior detection accuracy [38,39,40,41,42]. In contrast to the RPA-LFD approach, RPA-CRISPR/Cas12a allows for the isothermal, label-free target gene detection through the design of RPA primer sets and amplification of the products as amplified reporter genes [43,44,45]. The resulting CRISPR/Cas12a cleavage products provide a precise, cost-effective, and easy-to-use platform for the development of instant CRISPR-based diagnostic applications [46,47].
The specific primers were designed to amplify the Pcinn204169 putative gene, a new target identified from genomic sequence data. This Pcinn204169 RPA-CRISPR/Cas12a assay has been demonstrated to have specificity for Pcin. It also has several other advantages compared to PCR-based detection assays. The assay is convenient and transportable, without the need for costly equipment. However, this study did not examine continuous base changes or deletions, leaving considerable opportunity to investigate the ability of RPA-CRISPR/Cas12a to distinguish individual differences in bases. The CRISPR/Cas12a assay developed here can be used in the laboratory to detect and characterize P. cinnamomi, and the accuracy of this assay was verified using pine needle samples collected at Nanjing Forestry University. In addition, RPA-CRISPR/Cas12a rapidly detected P. cinnamomi in <30 min at 37 °C, greatly reducing the detection time.

5. Conclusions

In this study, a CRISPR/Cas12a-mediated isothermal amplification technique was established to detect P. cinnamomi that did not cross-react with other interspecies and intergeneric DNAs during specificity experiments and had good specificity. The method established in this study is highly sensitive and capable of detecting 10 pg of the P. cinnamomi genome DNA in 20 min of incubation to 37 °C. The method is sensitive, efficient, and convenient, and the results are clearly visible under UV light, which is favorable for the early detection of P. cinnamomi.

Author Contributions

X.X.: Investigation, Data curation, Formal analysis, Writing—review and editing; Q.X.: Formal analysis; J.Y.: Data curation; J.Z.: Formal analysis; T.D.: Supervision, Project administration, Writing; T.L.: Funding acquisition, review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This work had support from China national key R&D program (2023YFD1401304), natural sciences funding from Jiangsu province (BK20231291), Jiangsu University Natural Science Research Major Project (21KJA220003), and the Priority Academic Program Development of Jiangsu Higher Education Institutions.

Data Availability Statement

All data from this investigation are the subject of this article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Burgess, T.I.; Scott, J.K.; Mcdougall, K.L.; Stukely, M.J.; Crane, C.; Dunstan, W.A.; Brigg, F.; Andjic, V.; White, D.; Rudman, T.; et al. Current and projected global distribution of Phytophthora cinnamomi, one of the world’s worst plant pathogens. Glob. Chang. Biol. 2017, 23, 1661–1674. [Google Scholar] [CrossRef] [PubMed]
  2. Lowe, S.; Browne, M.; Boudjelas, S.; De Poorter, M. 100 of the World’s Worst Invasive Alien Species: A Selection from the Global Invasive Species Database. 2000. Available online: http://www.issg.org (accessed on 1 November 2023).
  3. Hardham, A.R.; Blackman, L.M. Phytophthora cinnamomi. Mol. Plant Pathol. 2018, 19, 260–285. [Google Scholar] [CrossRef] [PubMed]
  4. de Andrade Lourenço, D.; Branco, I.; Choupina, A. Phytopathogenic oomycetes: A review focusing on Phytophthora cinnamomi and biotechnological approaches. Mol. Biol. Rep. 2020, 47, 9179–9188. [Google Scholar] [CrossRef] [PubMed]
  5. Brasier, C.M. Phytophthora cinnamomi and oak decline in southern Europe: Environmental constraints including climate change. Ann. Sci. 1996, 53, 347–358. [Google Scholar] [CrossRef]
  6. Rands, R.D. Streepkanker van Kaneel, Veroorzaakt Door Phytophthora Cinnamomi n. sp.; Drukkerij Ruygrok & Company: Ruygrok, Batavia, 1922. [Google Scholar]
  7. Dai, T.; Wang, A.; Yang, X.; Yu, X.; Tian, W.; Xu, Y.; Hu, T. PHYCI_587572: An RxLR Effector Gene and New Biomarker in A Recombinase Polymerase Amplification Assay for Rapid Detection of Phytophthora cinnamomi. Forests 2020, 11, 306. [Google Scholar] [CrossRef]
  8. Kong, P.; Hong, C.X.; Richardson, P.A. Rapid detection of Phytophthora cinnamomi using PCR with primers derived from the Lpv putative storage protein genes. Plant Pathol. 2003, 52, 681–693. [Google Scholar]
  9. Kunadiya, M.B.; Dunstan, W.D.; White, D.; Hardy, G.E.; Grigg, A.H.; Burgess, T.I. A qPCR Assay for the Detection of Phytophthora cinnamomi Including an mRNA Protocol Designed to Establish Propagule Viability in Environmental Samples. Plant Dis. 2019, 103, 2443–2450. [Google Scholar] [CrossRef] [PubMed]
  10. Negahban, H.; Bolboli, Z.; Ghalamfarsa, M.R. Development of PCR-based assays for the detection of the evident and latent infection with Stilbocrea banihashemiana, the causal agent of fruit tree cankers. Crop Prot. 2024, 59, 89–101. [Google Scholar] [CrossRef]
  11. Hosseini, B.; Voegele, R.T.; Link, T.I. Establishment of a quadruplex real-time PCR assay to distinguish the fungal pathogens Diaporthe longicolla, D. caulivora, D. eres, and D. novem on soybean. PLoS ONE 2021, 16, e0257225. [Google Scholar] [CrossRef]
  12. Lees, A.K.; Cullen, D.W.; Sullivan, L.; Nicolson, M.J. Development of conventional and quantitative real-time PCR assays for the detection and identification of Rhizoctonia solani AG-3 in potato and soil. Plant Pathol. 2002, 51, 293–302. [Google Scholar] [CrossRef]
  13. Filion, M.; St-Arnaud, M.; Jabaji-Hare, S.H. Direct quantification of fungal DNA from soil substrate using real-time, PCR. J. Microbiol. Methods 2003, 53, 67–76. [Google Scholar] [CrossRef] [PubMed]
  14. Zhu, X.Y.; Yang, H.; Wang, M.; Wu, M.H.; Khan, M.R.; Luo, A. Label-free detection of transgenic crops using an isothermal amplification reporting CRISPR/Cas12 assay. ACS Synth. Biol. 2021, 11, 317–324. [Google Scholar] [CrossRef] [PubMed]
  15. Chen, J.S.; Ma, E.; Harrington, L.B.; Da Costa, M.; Tian, X.; Palefsky, J.M.; Doudna, J.A. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science 2018, 360, 436–439. [Google Scholar] [CrossRef] [PubMed]
  16. Cullen, D.W.; Lees, A.K.; Toth, I.K.; Duncan, J.M. Conventional PCR and Real-time Quantitative PCR Detection of Helminthosporium Solani in Soil and on Potato Tubers. Eur. J. Plant Pathol. 2001, 107, 387–398. [Google Scholar] [CrossRef]
  17. Schena, L.; Duncan, J.M.; Cooke, D.E.L. Development and application of a PCR-based “molecular tool box” for the identification of Phytophthora species damaging forests and natural ecosystems. Plant Pathol. 2008, 57, 64–75. [Google Scholar] [CrossRef]
  18. Mendoza, B.J.; Zheng, X.; Clements, J.C.; Cotter, C.; Trinh, C.T. Potency of CRISPR-Cas Antifungals Is Enhanced by Cotargeting DNA Repair and Growth Regulatory Machinery at the Genetic Level. ACS Infect. Dis. 2023, 6, 39–98. [Google Scholar] [CrossRef] [PubMed]
  19. Zhao, G.; Wang, J.; Yao, C.; Xie, P.; Li, X.; Xu, Z.; Xian, Y.; Lei, H.; Shen, X. Alkaline lysis-recombinase polymerase amplification combined with CRISPR/Cas12a assay for the ultrafast visual identification of pork in meat products. Food Chem. 2022, 383, 132318. [Google Scholar] [CrossRef] [PubMed]
  20. Yang, S.; Rothman, R.E. PCR-based diagnostics for infectious diseases: Uses, limitations, and future applications in acute-care settings. The Lancet. Infect. Dis. 2004, 4, 337–348. [Google Scholar] [CrossRef] [PubMed]
  21. Weissleder, R.; Lee, H.K.J.; Pittet, M.J. COVID-19 diagnostics in context. Sci. Transl. Med. 2020, 3, 12. [Google Scholar] [CrossRef]
  22. Dong, J.; Du, Y.; Zhou, L. Research progress of CRISPR/Cas systems in nucleic acid detection of infectious diseases. iLABMED 2023, 1, 58–74. [Google Scholar] [CrossRef]
  23. Bodulev, O.L.; Sakharov, I.Y. Isothermal Nucleic Acid Amplification Techniques and Their Use in Bioanalysis. Biochem. 2020, 85, 147–166. [Google Scholar] [CrossRef] [PubMed]
  24. Karmakar, S.; Das, P.; Panda, D.; Xie, K.; Baig, M.J.; Molla, K.A. A detailed landscape of CRISPR-Cas-mediated plant disease and pest management. Plant Sci. 2022, 323, 111376. [Google Scholar] [CrossRef] [PubMed]
  25. Kostyusheva, A.; Brezgin, S.; Babin, Y.; Vasilyeva, I.; Glebe, D.; Kostyushev, D.; Chulanov, V. CRISPR-Cas systems for diagnosing infectious diseases. Methods 2022, 203, 431–446. [Google Scholar] [CrossRef] [PubMed]
  26. Qing, M.; Chen, S.L.; Sun, Z.; Fan, Y.; Luo, H.Q.; Li, N.B. Universal and Programmable Rolling Circle Amplification-CRISPR/Cas12a-Mediated Immobilization-Free Electrochemical Biosensor. Anal. Chem. 2021, 93, 7499–7507. [Google Scholar] [CrossRef] [PubMed]
  27. Xu, W.; Jin, T.; Dai, Y.; Liu, C.C. Surpassing the detection limit andaccuracy of the electrochemical DNA sensor through the application of CRISPR Cas systems. Biosens. Bioelectron. 2020, 155, 112100. [Google Scholar] [CrossRef] [PubMed]
  28. Cullen, D.W.; Lees, A.K.; Toth, I.K.; Duncan, J.M. Detection of Colletotrichum coccodes from soil and potato tubers by conventional and quantitative real-time PCR. Plant Pathol. 2002, 51, 281–292. [Google Scholar] [CrossRef]
  29. Masikane, S.; Jolliffe, J.; Swart, L.; McLeod, A. Novel approaches and methods for quantifying Phytophthora cinnamomi in avocado tree roots. FEMS Microbiol. Lett. 2019, 366, fnz199. [Google Scholar] [CrossRef] [PubMed]
  30. Mora-Sala, B.; Berbegal, M.; Abad-Campos, P. The Use of qPCR Reveals a High Frequency of Phytophthora quercina in Two Spanish Holm Oak Areas. Forests 2018, 9, 697. [Google Scholar] [CrossRef]
  31. Tingting, D.; Xiao, Y.; Tao, H. A Novel LAMP Assay for the Detection of Phytophthora cinnamomi Utilizing a New Target Gene Identified From Genome Sequences. Plant Dis. 2019, 103, 3101–3107. [Google Scholar]
  32. Wang, H.; Qi, M.; Cutler, A.J. A simple method of preparing plant samples for PCR. Nucleic Acids Res. 1993, 17, 4152–4154. [Google Scholar] [CrossRef]
  33. Li, S.Y.; Cheng, Q.X.; Wang, J.M.; Li, X.Y.; Zhang, Z.L.; Gao, S.; Cao, R.B.; Zhao, G.P.; Wang, J. CRISPR-Cas12a-assisted nucleic acid detection. Cell Discov. 2018, 4, 20. [Google Scholar] [CrossRef] [PubMed]
  34. Lei, R.; Li, Y.; Li, L.M.; Wang, J.Y.; Cui, Z.H.; Ju, R. A CRISPR/Cas12a-based portable platform for rapid detection of Leptosphaeria maculans in brassica crops. Front Plant Sci. 2022, 13, 976510. [Google Scholar] [CrossRef] [PubMed]
  35. He, Q.; Yu, D.; Bao, M. High-throughput and all-solution phase African Swine Fever Virus (ASFV) detection using CRISPR-Cas12a and fluorescence based point-of-care system. Biosens. Bioelectron. 2020, 154, 112068. [Google Scholar] [CrossRef] [PubMed]
  36. Luque, G.M.; Bellard, C.; Bertelsmeier, C. The 100th of the world’s worst invasive alien species. Biol. Invasions 2014, 16, 981–985. [Google Scholar] [CrossRef]
  37. Scott, P.; Burgess, T.; Hardy, G. Globalization Phytophthora. In Phytophthora: A Global Perspective; Lamour, K., Ed.; C A B International: Wallingford, UK, 2013; pp. 223–226. [Google Scholar] [CrossRef]
  38. Kleinstiver, B.P.; Sousa, A.A.; Walton, R.T. Engineered CRISPR-Cas12a variants with increased activities and improved targeting ranges for gene, epigenetic and base editing. Nat. Biotechnol. 2019, 37, 276–282. [Google Scholar] [CrossRef] [PubMed]
  39. Chen, Y.; Shi, Y.; Chen, Y.; Yang, Z.; Wu, H.; Zhou, Z.; Li, J.; Ping, J.; He, L.; Shen, H.; et al. Contamination-free visual detection of SARS-CoV-2 with CRISPR/Cas12a: A promising method in the point-of-care detection. Biosens. Bioelectron. 2020, 169, 112642. [Google Scholar] [CrossRef]
  40. Coelho, A.C.; Cravador, A.; Bollen, A.; Ferraz, F.P.; Moreira, A.C.; Fauconnier, A.; Godfroid, E. Highly specific and sensitive non-radioactive molecular identification of Phytophthora cinnamomi. Mycol. Res. 1997, 101, 1499–1507. [Google Scholar] [CrossRef]
  41. Williams, N.; Hardy, G.E.S.J.; O’Brien, P.A. Analysis of the distribution of Phytophthora cinnamomi in soil at a disease site in Western Australia using nested PCR. For. Pathol. 2009, 39, 95–109. [Google Scholar] [CrossRef]
  42. Colquhoun, I.J.; Hardy, G.E.S.J. Managing the Risks of Phytophthora Root and Collar Rot During Bauxite Mining in the Eucalyptus marginata (Jarrah) Forest of Western Australia. Plant Dis. 2000, 84, 116–127. [Google Scholar]
  43. Deng, F.; Li, Y.; Yang, B. Topological barrier to Cas12a activation by circular DNA nanostructures facilitates autocatalysis and transforms DNA/RNA sensing. Nat. Commun. 2024, 15, 1818. [Google Scholar] [CrossRef]
  44. Katzmeier, F.; Aufinger, L.; Dupin, A.; Quintero, J.; Lenz, M.; Bauer, L.; Klumpe, S.; Sherpa, D.; Dürr, B.; Honemann, M.; et al. A low-cost fluorescence reader for in vitro transcription and nucleic acid detection with Cas13a. PLoS ONE 2019, 14, e0220091. [Google Scholar] [CrossRef] [PubMed]
  45. Choi, J.H.; Lim, J.; Shin, M.; Paek, S.H.; Choi, J.W. CRISPR-Cas12a-Based Nucleic Acid Amplification-Free DNA Biosensor via Au Nanoparticle-Assisted Metal-Enhanced Fluorescence and Colorimetric Analysis. Nano Lett. 2021, 21, 693–699. [Google Scholar] [CrossRef] [PubMed]
  46. Park, D.H.; Haizan, I.; Ahn, M.J.; Choi, M.Y.; Kim, M.J.; Choi, J.H. One-Pot CRISPR-Cas12a-Based Viral DNA Detection via HRP-Enriched Extended ssDNA-Modified Au@Fe3O4 Nanoparticles. Biosensors 2024, 14, 26. [Google Scholar] [CrossRef]
  47. Wu, H.; Qian, C.; Wu, C. End-point dual specific detection of nucleic acids using CRISPR/Cas12a based portable biosensor. Biosens. Bioelectron. 2020, 157, 112153. [Google Scholar] [CrossRef] [PubMed]
Forests 15 00772 g001
Figure 1. Sequence analysis of Pcinn204169 from Phytophthora cinnamomi. Nucleotides targeted by the forward (Pcinn204169 RPA-F) and reverse (Pcinn204169 RPA-R) primers; the crRNA sequences are shown below the respective arrows. The arrows indicate the direction of amplification.
Figure 1. Sequence analysis of Pcinn204169 from Phytophthora cinnamomi. Nucleotides targeted by the forward (Pcinn204169 RPA-F) and reverse (Pcinn204169 RPA-R) primers; the crRNA sequences are shown below the respective arrows. The arrows indicate the direction of amplification.
Forests 15 00772 g001
Forests 15 00772 g002
Figure 2. Schematic diagram of the RPA-CRISPR/Cas12a assay used for the detection of Phytophthora cinnamomi. (A) Recombinase polymerase amplification (RPA). (B) Cas12a protein can bind to any amplicon and target-specific CRISPR RNA (crRNA) to form a complex. The complex has indiscriminate ssDNA cleavage activity. The FAM-labeled ssDNA reporter is cleaved. When excited at 470 nm, the reporter emits visible green fluorescence. (C) Positive result: green fluorescence is visible. Negative result: green fluorescence is not visible.
Figure 2. Schematic diagram of the RPA-CRISPR/Cas12a assay used for the detection of Phytophthora cinnamomi. (A) Recombinase polymerase amplification (RPA). (B) Cas12a protein can bind to any amplicon and target-specific CRISPR RNA (crRNA) to form a complex. The complex has indiscriminate ssDNA cleavage activity. The FAM-labeled ssDNA reporter is cleaved. When excited at 470 nm, the reporter emits visible green fluorescence. (C) Positive result: green fluorescence is visible. Negative result: green fluorescence is not visible.
Forests 15 00772 g002
Forests 15 00772 g003
Figure 3. Optimization of the RPA-CRISPR/Cas12a assay for the detection of Phytophthora cinnamomi. The crRNA and ssDNA reporter concentrations were set to the following values: 1: 40 nM crRNA, 40 nM ssDNA reporter; 2: 300 nM crRNA, 40 nM ssDNA reporter; 3: 500 nM crRNA, 300 nM ssDNA reporter; 4: 1 µM crRNA, 1 µM ssDNA reporter; 5: 1 µM crRNA, 2 µM ssDNA reporter; 6: 2 µM crRNA, 1 µM ssDNA reporter; 7: 5 µM crRNA, 1 µM ssDNA reporter; 8: 1 µM crRNA, 5 µM ssDNA reporter; 9: 10 µM crRNA, 5 µM ssDNA reporter; and 10: 10 µM crRNA, 10 µM ssDNA reporter. NC, negative control (double-distilled H2O). (A) Fluorescence detection using a multifunctional microplate reader (λex: 485 nm, λem: 520 nm). (B) Visible green fluorescence detection under a blue LED transilluminator at 470 nm. The one-way ANOVA of the fluorescence readings with those of the negative control showed that p < 0.0001 (****). “****” shows a significant difference between fluorescent and non-fluorescent signals.
Figure 3. Optimization of the RPA-CRISPR/Cas12a assay for the detection of Phytophthora cinnamomi. The crRNA and ssDNA reporter concentrations were set to the following values: 1: 40 nM crRNA, 40 nM ssDNA reporter; 2: 300 nM crRNA, 40 nM ssDNA reporter; 3: 500 nM crRNA, 300 nM ssDNA reporter; 4: 1 µM crRNA, 1 µM ssDNA reporter; 5: 1 µM crRNA, 2 µM ssDNA reporter; 6: 2 µM crRNA, 1 µM ssDNA reporter; 7: 5 µM crRNA, 1 µM ssDNA reporter; 8: 1 µM crRNA, 5 µM ssDNA reporter; 9: 10 µM crRNA, 5 µM ssDNA reporter; and 10: 10 µM crRNA, 10 µM ssDNA reporter. NC, negative control (double-distilled H2O). (A) Fluorescence detection using a multifunctional microplate reader (λex: 485 nm, λem: 520 nm). (B) Visible green fluorescence detection under a blue LED transilluminator at 470 nm. The one-way ANOVA of the fluorescence readings with those of the negative control showed that p < 0.0001 (****). “****” shows a significant difference between fluorescent and non-fluorescent signals.
Forests 15 00772 g003
Forests 15 00772 g004
Figure 4. Optimization of the recombinase polymerase amplification (RPA) reaction time and Cas12a cleavage time for the RPA–CRISPR/Cas12a assay. (A,B) RPA reaction times: 5, 10, 15, 20, 25, 30, 35, and 40 min; NC (negative control, ddH2O). (C,D) Cas12a cleavage times: 5, 10, 15, 20, 25, 30, 35, and 40 min; NC (negative control, ddH2O). (A,C) Fluorescence detection using a multifunctional microplate reader (λex: 485 nm, λem: 520 nm). (B,D) Detection of green fluorescence in the visible range under a blue LED transmitted light illuminator with a wavelength of 470 nm. The one-way ANOVA of the fluorescence readings with those of the negative control showed that p < 0.0001 (****). “****” shows a significant difference between fluorescent and non-fluorescent signals.
Figure 4. Optimization of the recombinase polymerase amplification (RPA) reaction time and Cas12a cleavage time for the RPA–CRISPR/Cas12a assay. (A,B) RPA reaction times: 5, 10, 15, 20, 25, 30, 35, and 40 min; NC (negative control, ddH2O). (C,D) Cas12a cleavage times: 5, 10, 15, 20, 25, 30, 35, and 40 min; NC (negative control, ddH2O). (A,C) Fluorescence detection using a multifunctional microplate reader (λex: 485 nm, λem: 520 nm). (B,D) Detection of green fluorescence in the visible range under a blue LED transmitted light illuminator with a wavelength of 470 nm. The one-way ANOVA of the fluorescence readings with those of the negative control showed that p < 0.0001 (****). “****” shows a significant difference between fluorescent and non-fluorescent signals.
Forests 15 00772 g004
Forests 15 00772 g005
Figure 5. The specificity of Phytophthora cinnamomi was rapidly detected with the RPA-CRISPR/Cas12a assay. (A,B) Evaluation using genomic DNA isolated from P. cinnamomi, P. parvispora, P. hibernalis, P. sojae, P. pini, P. cactorum, P. nicotianae, and negative control (NC; no template). (C,D) Evaluation using genomic DNA from P. cinnamomi, P. litorale, P. helicoides, P. aphanidermatum, P. dissotocum, F. oxysporium, F. solani, and the negative control (NC; no template). The one-way ANOVA of the fluorescence readings with those of the negative control showed that p < 0.0001 (****). “****” shows a significant difference between fluorescent and non-fluorescent signals.
Figure 5. The specificity of Phytophthora cinnamomi was rapidly detected with the RPA-CRISPR/Cas12a assay. (A,B) Evaluation using genomic DNA isolated from P. cinnamomi, P. parvispora, P. hibernalis, P. sojae, P. pini, P. cactorum, P. nicotianae, and negative control (NC; no template). (C,D) Evaluation using genomic DNA from P. cinnamomi, P. litorale, P. helicoides, P. aphanidermatum, P. dissotocum, F. oxysporium, F. solani, and the negative control (NC; no template). The one-way ANOVA of the fluorescence readings with those of the negative control showed that p < 0.0001 (****). “****” shows a significant difference between fluorescent and non-fluorescent signals.
Forests 15 00772 g005
Forests 15 00772 g006
Figure 6. The sensitivity of Phytophthora cinnamomi was rapidly detected with the RPA-CRISPR/Cas12a assay. The pathogen was detected at a minimum genomic DNA concentration of 10 pg using (A) a multifunctional microplate reader (λex: 485 nm, λem: 520 nm) or (B) a blue LED transilluminator at 470 nm. 1–8: 10 ng, 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg, and NC (negative control, double-distilled H2O). The one-way ANOVA of the fluorescence readings with those of the negative control showed that p < 0.0001 (****); 0.001 < p < 0.01 (***); p < 0.05 (*), “****”; “***”; “*” shows a significant difference between fluorescent and non-fluorescent signals.
Figure 6. The sensitivity of Phytophthora cinnamomi was rapidly detected with the RPA-CRISPR/Cas12a assay. The pathogen was detected at a minimum genomic DNA concentration of 10 pg using (A) a multifunctional microplate reader (λex: 485 nm, λem: 520 nm) or (B) a blue LED transilluminator at 470 nm. 1–8: 10 ng, 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg, and NC (negative control, double-distilled H2O). The one-way ANOVA of the fluorescence readings with those of the negative control showed that p < 0.0001 (****); 0.001 < p < 0.01 (***); p < 0.05 (*), “****”; “***”; “*” shows a significant difference between fluorescent and non-fluorescent signals.
Forests 15 00772 g006
Forests 15 00772 g007
Figure 7. Experimental detection of Phytophthora cinnamomi-infested pine needle plants using the RPA-CRISPR/Cas12a approach. (A) Artificially inoculated pine needles (1: healthy pine needle stems; 2–4: Samples of naturally infected pine needle stems). (B) Strong fluorescence signals were detected by a multifunctional microplate reader (λex: 485 nm, λem: 520 nm). 1: Positive control (P. cinnamomi gDNA), PTC; 2–4: samples of naturally infected pine needle stems; 5: healthy pine needle stems; NC: negative control. (C) Visible green fluorescence was detected under a blue LED transilluminator at 470 nm. 1: Positive control (P. cinnamomi gDNA); 2–4: samples of naturally infected pine needle stems; 5: healthy pine needle stems; NC: negative control. The one-way ANOVA of the fluorescence readings with those of the negative control showed that p < 0.0001 (****). “****” shows a significant difference between fluorescent and non-fluorescent signals.
Figure 7. Experimental detection of Phytophthora cinnamomi-infested pine needle plants using the RPA-CRISPR/Cas12a approach. (A) Artificially inoculated pine needles (1: healthy pine needle stems; 2–4: Samples of naturally infected pine needle stems). (B) Strong fluorescence signals were detected by a multifunctional microplate reader (λex: 485 nm, λem: 520 nm). 1: Positive control (P. cinnamomi gDNA), PTC; 2–4: samples of naturally infected pine needle stems; 5: healthy pine needle stems; NC: negative control. (C) Visible green fluorescence was detected under a blue LED transilluminator at 470 nm. 1: Positive control (P. cinnamomi gDNA); 2–4: samples of naturally infected pine needle stems; 5: healthy pine needle stems; NC: negative control. The one-way ANOVA of the fluorescence readings with those of the negative control showed that p < 0.0001 (****). “****” shows a significant difference between fluorescent and non-fluorescent signals.
Forests 15 00772 g007
Table 1. Information and results of CRISPR-Cas12a detection in the Phytophthora, other oomycete isolates, and fungal isolates used in this investigation.
Table 1. Information and results of CRISPR-Cas12a detection in the Phytophthora, other oomycete isolates, and fungal isolates used in this investigation.
Number(Sub)CladeSpeciesIsolateOriginCrisp-Cas12a Deteciton Results
Host/SubstrateSource
1OomycetePhytophthora cinnamomiPci1Pinus sp.AH, China+
2P. cinnamomiPci2Rhododendron simsiiJS, China+
3P. cinnamomiPci3Cedrus deodaraJS, China+
4P. cinnamomiPci4Camellia oleifera Abel.JS, China+
5P. cinnamomiPci5Pinus sp.JS, China+
6P. cinnamomiPci6Rhododendron simsiiAH, China+
7P. cinnamomiPci7Rhododendron simsiiSD, China+
8P. cinnamomiPci8Cedrus deodaraSD, China+
9P. cinnamomiPci9Cedrus deodaraAH, China+
10P. cinnamomiPci10Pinus sp.SD, China+
11P. sojaePs1Glycine maxJS, China-
12P. sojaePs2Glycine maxJS, China-
13P. sojaePs3Glycine maxJS, China-
14P. sojaePs4Glycine maxJS, China-
15P. sojaePs5Glycine maxJS, China-
16P. sojaePsf1Glycine maxFJ, China-
17P. sojaePsf2Glycine maxFJ, China-
18P. sojaePsf3Glycine maxFJ, China-
19P. sojaePsf4Glycine maxFJ, China-
20p. medicaginisCBS 117685lucerneHolland-
21p. medicaginisCBS 117689lucerneHolland-
22P. parvisporaCBS132771Arbutus unedoItaly-
23P. parvisporaCBS132772Arbutus unedoItaly-
24P. cactorumC1Malus pumilaJS, China-
25P. cactorumC2Malus pumilaJS, China-
26P. cactorumC3Rosa chinensisJS, China-
27P. nicotianaePnlNicotiana tabacumFJ, China-
28P. nicotianaePn2Lycopersicum sp.JS, China-
29P. piniPpinilRhododendron pulchrumJS, China-
30P. piniPpini2R. pulchrumJS, China-
31P. hibernalisCBS 270.31Cirrus sinensisUSA-
32Phytopythium litoralePC-dj1Rhododendron simsiiJS, China-
33P. helicoidesPH-CRhododendron simsiiJS, China-
34P. helicoidesPF-he2Rhododendron simsiiJS, China-
35P. helicoidesPF-he3Rhododendron simsiiJS, China-
36FungiFusarium. proliferatumFprlPinus sp.JS, China-
37F. oxysporumBMZ12185Cucumber RootstocksJS, China-
38F. lateritiumBMZ51357Freesia lanceolataJS, China-
39F. incarnatumIL3HQMedicago sativaJS, China-
40F. acuminatumFaclRhizophora apiculataSC, China-
41F. asiaticumFaslTriticum aestivumJS, China-
42F. avenaceumFavlGlycine maxJS, China-
43F. culmorumFculGlycine maxSC, China-
44F. communeFcolSoilHLJ, China-
45F. equisetiFeq1SoilJS, China-
46F. lateritiumFlatlSoilJS, China-
47F. moniformeFmolOryza sativaJS, China-
48F. redolensBMZ103188litterJS, China-
49NematodeColletotrichum gloeosporioidesBMZ51334Camellia japonicaJS, China-
50Bursaphelenchus xylophilusJs-1Pinus thunbergiiJS, China-
51B. mucronatusBmucroPinus sp.JS, China-
52Endothia parasiticaEpalCastanea mollissimaJS, China-
53Bremia lactucaeBlalLactuca sativaJS, China-
54Gibberella avenaceaBMZ105417oatmealJS, China-
55Gibberella tricinctaBMZ102862rotten woodJS, China-
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Xu, X.; Dai, T.; Xiong, Q.; Yang, J.; Zang, J.; Liu, T. Molecular Detection of Phytophthora cinnamomi by RPA-CRISPR/Cas12a-Mediated Isothermal Amplification. Forests 2024, 15, 772. https://doi.org/10.3390/f15050772

AMA Style

Xu X, Dai T, Xiong Q, Yang J, Zang J, Liu T. Molecular Detection of Phytophthora cinnamomi by RPA-CRISPR/Cas12a-Mediated Isothermal Amplification. Forests. 2024; 15(5):772. https://doi.org/10.3390/f15050772

Chicago/Turabian Style

Xu, Xiaoqiao, Tingting Dai, Qin Xiong, Jing Yang, Jiahui Zang, and Tingli Liu. 2024. "Molecular Detection of Phytophthora cinnamomi by RPA-CRISPR/Cas12a-Mediated Isothermal Amplification" Forests 15, no. 5: 772. https://doi.org/10.3390/f15050772

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop