Next Article in Journal
Enhancing P300-Based Brain-Computer Interfaces with Hybrid Transfer Learning: A Data Alignment and Fine-Tuning Approach
Previous Article in Journal
Effect of Sodium Stearate on the Microstructure and Hydration Process of Alkali-Activated Material
Previous Article in Special Issue
Lactic Acid Bacteria as Biocontrol Agents against Potato (Solanum tuberosum L.) Pathogens
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Applied Sciences
Volume 13
Issue 10
10.3390/app13106282
applsci-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Fungicidal Effect of Essential Oils of Fennel and Hops against Fusarium Disease of Pea

by
Sylwia Barbara Okorska
1,
Joanna Agnieszka Dąbrowska
2,
Katarzyna Głowacka
3,
Agnieszka Pszczółkowska
2,
Krzysztof Józef Jankowski
1,
Jan Paweł Jastrzębski
3,
Tomasz Oszako
4 and
Adam Okorski
2,*
1
Department of Agrotechnology and Agribusiness, University of Warmia and Mazury in Olsztyn, Oczapowskiego 8, 10-719 Olsztyn, Poland
2
Department of Entomology, Phytopathology and Molecular Diagnostics, University of Warmia and Mazury in Olsztyn, Plac Łódzki 5, 10-727 Olsztyn, Poland
3
Department of Plant Physiology, Genetics and Biotechnology, University of Warmia and Mazury in Olsztyn, Oczapowskiego 1a, 10-719 Olsztyn, Poland
4
Department of Forest Protection, Forest Research Institute, ul. Braci Leśnej 3, 05-090 Sękocin Stary, Poland
*
Author to whom correspondence should be addressed.
Appl. Sci. 2023, 13(10), 6282; https://doi.org/10.3390/app13106282
Submission received: 25 April 2023 / Revised: 12 May 2023 / Accepted: 19 May 2023 / Published: 21 May 2023
(This article belongs to the Special Issue New Insights into Biocontrol to Improve Food Quality and Safety)
Browse Figures
Versions Notes

Abstract

:

Featured Application

Authors are encouraged to provide a concise description of the specific application or a potential application of the work. This section is not mandatory.

Abstract

Modern integrated farming systems encourage the search for alternative (non-chemical), highly effective methods of plant protection. In this study, the fungistatic effect of fennel essential oil (FEO) and hop essential oil (HEO) on fungal growth and their ability to treat Fusarium wilt was investigated. The study was conducted in vitro and in pot experiments. The severity of infection was assessed by disease index (DI), presence of Fusarium culmorum gDNA (qPCR) and anatomical analyses of infected plant tissue using an optical (OM) and scanning electron microscope (SEM). Laboratory analyses showed that FEO inhibits mycelial growth of Fusarium fungi (F. avenaceum, F. culmorum, F. equiseti, F. oxysporum, F. poae, F. solani, F. sporotrichioides, F. tricinctum), Botrytis cinerea and Cylindrocarpon destructans more effectively than HEO. FEO at a concentration of 2000 ppm completely inhibited the growth of F. culmorum, F. poae and B. cinerea. Both essential oils reduced the severity of Fusarium wilt caused by F. culmorum in pea plants (DI, OM, SEM). The qPCR shows that both essential oils are also able to reduce the synthesis of trichothecenes in the tissues of infected pea plants. The results of the study suggest that FEO and HEO represent a broad spectrum bio-fungicidal agent that can be applied directly to plants at a concentration of 500 ppm, greatly reducing the level of infection.

1. Introduction

The pea (Pisum sativum L., Fabaceae) is widely cultivated worldwide, mostly as an edible plant. Pea seeds contain biologically valuable protein with a desirable amino acid composition [1]. In 2021, global pea production reached about 12.4 million tons, of which 48% was produced in Europe, 21% in North America and 21% in Asia. In Europe, peas are the leading protein crop, accounting for 55.6% of total legume production. Outside Europe, soybeans are the most important protein crop, with global production exceeding that of pulses by a factor of four. Average pea yields are generally low, equivalent to about 65–70% of global soybean yields (1.72–2.04 versus 2.67–2.86 t/ha) [2]. Pea yields are limited by: (i) low temperatures and soil dryness during seedling emergence; and (ii) biotic factors causing plant diseases, including fungi of the genus Fusarium such as F. avenaceum, F. culmorum, F. solani, F. oxysporum and others, which cause seedling blight and fusarium root and stem rot in the early stages of plant development and fusarium wilt in peas during flowering [3]. These pathogens colonise the seeds and are subsequently transmitted to the plants [4]. Fungi of the genus Fusarium cause the most devastating plant diseases around the world [5,6,7]. Almost all Fusarium species produce mycotoxins that have adverse health effects on humans and animals. Mycotoxins determine the progression of the disease in the early stages of infection, they accumulate in the seeds during maturation and thus affect their quality [8,9,10]. The following Fusarium species are most frequently isolated from cultivated plants in Poland: Fusarium oxysporum, F. avenaceum, F. culmorum, F. equiseti, F. dimerum, F. solani, F. sporotrichioides, F. proliferatum and F. verticillioides [3,11]. Fusarium pathogens are mainly controlled by the use of fungicides, which, however, can have potentially harmful effects on the environment and human and animal health [8,12]. Fusarium species are characterised by high variation within and between species. The widespread use of fungicides has led to their accumulation in food, sometimes beyond the permissible residue levels [13], and it has also triggered mutations that lead to changes in the morphology, physiology and biochemical properties of the fungi. This has contributed to the development of new, highly resistant fungal races with different host plant preferences [14]. Therefore, to protect the environment and consumers, a sustainable approach to crop production is needed that includes natural alternatives that are as effective as chemical fungicides. The secondary metabolites produced by plants, such as essential oils, are generally considered safe, easy to extract, environmentally friendly, biodegradable and largely non-toxic to mammals [15]. From a chemical point of view, essential oils (EOs) are multi-component mixtures of volatile aromatic hydrophobic compounds, mostly monoterpenes, sesquiterpenes and their derivatives [16,17,18]. Due to the considerable differences in their chemical composition, essential oils possess a wide range of physicochemical, sensory, biological and antimicrobial properties [19,20]. Research has shown that some essential oils are as effective or even more effective than fungicides in inhibiting fungal growth [21,22]. The efficacy of essential oils in inhibiting plant pathogens has been confirmed by numerous in vitro studies [23,24]. It is believed that the antifungal activity of essential oils is related to the unique properties of terpenes/terpenoids. Due to their high lipophilicity and low molecular weight, these compounds are able to damage cell walls, lead to cell death or inhibit sporulation and germination of various fungal species [17,25,26]. In recent years, numerous studies (mostly based on in vitro tests) have investigated the antifungal potential of essential oils against various pathogens, including Fusarium species. Recent research has demonstrated the fungistatic effect of rosemary (Rosmarinus officinalis L.) and grain mint (Mentha arvensis L.) essential oils on Fusarium fungi [27], the antifungal activity of clove essential oil (Syzygium aromaticum (L.) Merr. and L.M. Perry) against F. oxysporum f. sp. radicis lycopercisi, F. redolens and F. commune [28,29], the antifungal activity of essential oils from the stems/leaves and flowers of French lavender (Lavandula stoechas L.) against F. oxysporum [30] and the antifungal potential of myrrh essential oil (Commiphora molmol (Engl.) Engl. ex Tschirch) against F. solani, F. oxysporum, Alternaria alternata, Aspergillus flavus and Cladosporium sp. [31]. Sarkhosh et al. [32] found that peppermint (Mentha × piperita L.), savoury (Satureja khuzistanica Jamzad), thyme (Thymus daenensis Celak.), cinnamon (Cinnamomum verum J. Presl., Cinnamomum zeylanicum Blume.), true lavender (Lavandula angustifolia Mill.), eucalyptus (Eucalyptus globulus Labill), myrtle (Mytrus communis L.) and tea tree essential oils are effective inhibitors of F. solani and Phytophthora palmivora.
Hops (Humulus lupulus L., Cannabaceae) and fennel (Foeniculum vulgare Mill., Apiaceae/Umbelliferae) are valuable sources of biologically active compounds, including essential oils. Hops have long been used in traditional medicine [33] and in beer brewing [34]. The female flowers of hop plants (Lupuli flos) are rich in secondary plant metabolites, resins (α- and β-acids) and essential oils [35]. Niknejad [36] demonstrated in vitro the fungistatic and fungicidal (dose-dependent) effects of ethanol extracts from hop flowers on the mycelial growth of five strains of the major food spoilage moulds.
Fennel is an aromatic plant used for both culinary and medicinal purposes [37]. Its biological activity can be attributed to the presence of active compounds in the seeds (Foeniculi fructus), including essential oils containing trans-anethole, fenchone and estragole [38]. Zellagui et al. [39] described the high antimicrobial potential of crude fennel extracts against G(−) and G(+) bacteria and against the fungi Aspergillus versicolor, Aspergillus fumigatus and Penicillium camemberti. Fennel essential oil (FEO) was also characterised by strong antifungal activity against Cladosporium cladosporioides and Puccinia helianthi plant pathogens as well as Trichophyton mentagrophytes dermatophytes [39]. According to Zeng et al. [40], FEO has potent antidermatophytic activity and is more effective than the widely used fluconazole and amphotericin B. Soylu et al. [41] found that FEO inhibits grey mould rot of tomato (Lycopersicon esculentum L.) caused by B. cinerea. According to Perczak et al. [25], FEO reduces the content of ergosterol, a characteristic component of fungal cell walls, and significantly lowers the concentrations of zearalenone and group B trichothecenes (mycotoxins).
The aim of this study was to evaluate the antifungal properties of essential oils from fennel fruits and female hop flowers against selected pathogens of pea under in vitro conditions and against Fusarium wilt disease of pea plants artificially inoculated with F. culmorum spores (isolated in a previous study) in a pot experiment.

2. Materials and Methods

2.1. Plant Materials and Essential Oils Extraction

Essential oils were extracted from fennel fruits (Foeniculum vulgare) and the female flowers of hop plants (Humulus lupulus) cv. Lubelski. The plant material came from the organic farm “Dary Natury” (Korycin, Poland) in north-eastern Poland. Representative plants of H. lupulus and F. vulgare were deposited in the collection of the Department of Agricultural Technology and Agribusiness of the Faculty of Agriculture and Forestry of the University of Warmia and Mazury (Syg. WR/H- II/Z/38 and Syg. WR/H- II/Z/50 for fennel and hop plants, respectively).
The essential oils of fennel and hops (FEO and HOE, respectively) were extracted using the hydrodistillation method described by Deryng [42]. The ratio of plant material to solvent was 1:10 (w/w) for both extraction methods. The water was heated in a heating jacket with temperature control. The extraction time was 4 h from the time the water reached boiling point. The extracted oils were placed in tight containers under a nitrogen atmosphere and were stored at a temperature of 4 °C until analysis.

2.2. Microorganisms

Single-spore fungal cultures (Botritis cinerea, Cylindrocarpon destrurctans, Fusarium avenaceum, Fusarium culmorum, Fusarium equiseti, Fusarium oxysporum, Fusarium poae, Fusarium solani, Fusarium sporotrichioides, Fusarium tricinctum) from the collection of the Department of Entomology, Phytopathology and Molecular Diagnostics of the Faculty of Agriculture and Forestry of the University of Warmia and Mazury in Olsztyn were used for the analyses.

2.3. Chemicals

All chemicals used for the analyses described in Section 2.4, Section 2.5, Section 2.6, Section 2.7 and Section 2.8 were purchased from Merck KGaA (Darmstadt, Germany). The reagents for molecular analysis were purchased from the Thermo Fisher Scientific (Waltham, MA, USA) portfolio. The primers and probes for qPCR analysis were synthesised at Merck KGaA (Darmstadt, Germany).

2.4. Evaluation of Antifungal Activity In Vitro

The influence of FEO and HEO on the linear growth of fungal pathogens on pea was determined in vitro. The fungistatic activity of natural biological extracts were evaluated in a food poisoning method by Ngono et al. [43].
The essential oils were prepared as aqueous extracts (10 mg/mL) containing 1% Tween-80 (polyoxyethylene sorbitan monooleate) to facilitate incorporation of the oil into the culture medium. A solution of EO was added to a sterile potato dextrose agar (PDA) medium at a temperature of 40 °C to obtain a final concentration of 125, 250, 500, 1000 and 2000 ppm essential oil in the medium. Twenty millilitres of the prepared growth medium was poured into Petri dishes with a diameter of 85 mm. After 24 h, discs containing 10-day-old mycelial cultures of each fungal species (with a diameter of 5 mm) were placed in the centre of each plate. Fungal cultures grown on media without FEO or HEO served as controls. To compare the effect of EOs, tebuconazole was used as a control. Fungi were cultured at a temperature of 22 °C for 10 days and linear growth of fungal colonies was measured daily in two perpendicular directions. The fungistatic activity (percentage inhibition of mycelial growth, % MGI) of the essential oils tested was evaluated after 10 days, as the experiment was established [44], with the use of a scale: +30 ˂ MGI- medium growth promotion; +30 < MGI < 0- weak growth promotion; 0–30-weak inhibition; 31–50-medium inhibition; 51–80- strong inhibition; 81–100- bio-fungicide effect. The analyses were carried out in four replicates for each experimental treatment (essential oil vs. fungal species) in two independent series.

2.5. Determination of Antifungal Activity Ex Vitro

Seeds of Pisum sativum cv. Grot were disinfected with 70% ethanol (30 s) and 1% sodium hypochlorite solution (15 min), soaked in distilled water for 12 h and sown 1 cm deep in pots filled with sterilised horticultural soil and sand in a 2:1 ratio. The pots were placed in a climate chamber (GC 600 Nueve, Switzerland) with controlled temperature and light conditions (day 22 °C/night 10 °C; 16 h light/8 h dark cycle). Fourteen-day-old pea seedlings were sprayed with FEO or HEO solution or with water containing 1% Tween-80. For the pot experiment, solutions of FEO and HEO with a concentration of 500 ppm and 2000 pm were used. After 24 h, pea seedlings were inoculated in the soil by spreading F. culmorum spores (111/Fc/2015) at a concentration of 1 × 106/mL. Pea seedlings sprayed with water containing 1% Tween-80 and supplied with water instead of the spore suspension formed the negative control. Experimentally inoculated seedlings that had been sprayed with water instead of FEO or HEO solution 24 h before inoculation constituted the positive control. The experiment was carried out in three replicates in two independent series.

2.6. Disease Index

The health status of pea plants was estimated 14 days after infection using the modified scale of Hillstrand and Auld [45]: 0—no disease symptoms, 1—infection rate (IR) of 1–10%, 2—IR of 11–20%, 3—IR of 21–30%, 4—IR of 31–40%, 5—IR of 41–60%, 6—IR of 61–80%, 7—IR of 81–90%, 8–9—IR of 91–100%. The results were used to calculate the disease index (DI) [46].

2.7. DNA Extraction and qPCR Analysis

DNA was isolated from pure cultures as well as from stems and roots of pea plants. Genomic DNA was extracted from pea tissue (stored at −80 °C prior to analysis) using Maxwell 16 kits (Promega GmbH, Madison, WI, USA) for DNA isolation from plant tissue. Pure cultures of F. culmorum (OlH2014/75) were used for the qPCR assay. The quality and quantity of DNA was determined using the Nanodrop ND 2000C (Thermo Fisher Scientific, Waltham, MA, USA) and the Qubit 2.0 Fluorometer (Thermo Fisher Scientific, Waltham, MA, USA). Genomic DNA was rinsed in TE buffer and stored at 4 °C until further analysis.
High quality gDNA (A260/280 ratio of 1.8 to 2.0) was used for the qPCR assay. The following primers and probes were used to quantify the severity of Fusarium wilt disease in pea plants in the pot experiment: FC _Tri5 forward: TCTTAACAC-TAGCGTGCGCCTTC, FC _Tri5 reverse: CATGCCAACGATTGTTTGGAGGGA, FC _Tri5 probe: fam- AACAAGGCTGCCCACCACTTT GCTCAGCCT—Tamra [47]. The qPCR reactions were performed using the ABI Prism 7500 Fast System (Thermo Fisher Scientific, Waltham, MA, USA). All qPCR reactions were performed in a total volume of 20 μL containing 3 μL genomic DNA solution, 1 × TaqMan Universal PCR Master Mix with ROX (Thermo Fisher Scientific, Waltham, MA, USA), 4 µL of primer mix (160 nM) and 2 μL of probe (100 nM). The following DNA amplification cycle was programmed: initial denaturation at 95 °C for 3 min, followed by 40 cycles of denaturation at 95 °C for 15 s, annealing 60 °C for 15 s and extension 72 °C for 60 s. Each sample was loaded in triplicate onto a single qPCR plate. DNA was quantified using a standard curve generated from samples with known concentrations of F. culmorum gDNA obtained by serial (10-fold) dilution ranging from 10 to 0.001 ng/µL using sterile, deionised water.

2.8. Light Microscopic and Scanning Electron Microscopic Analyses

Control plants and plants treated with FEO, HEO and F. culmorum were viewed under a stereoscopic microscope (M205 C, Leica Microsystems GmbH, Wetzlar, Germany) (magnification 1.5–2x). Samples of stem and root surfaces and tissue sections were also analysed (Eclipse 80i, Nikon Instruments Inc., Tokyo, Japan). Fragments of the root–stem transition area were prepared for analysis using a scanning electron microscope (5310- LV, JEOL Ltd., Akishima, Japan). Fresh tissue samples were fixed overnight at 4 °C (2.5% glutaraldehyde in PBS, pH = 7.4) and dehydrated at room temperature in a graded series of ethanol concentrations. The dehydrated samples were dried at the critical point of CO2 (CPD 030, BAL-TEC AG, Balzers, Liechtenstein) and sputter-coated with gold in an argon atmosphere (JCF-1200, JEOL Ltd., Akishima, Japan) [48]. The prepared samples were viewed with SEM at 15 kV.

2.9. Statistical Analysis

Results were processed in Dell Statistica v. 13 (Dell Inc., Round Rock, TX, USA, 2016) using Tukey’s HSD test for multiple comparisons at p ≤ 0.01. Standard deviation and significant differences between means of homogeneous groups (A, B, C) were determined (means labelled with the same letter are not significantly different at p = 0.01). Linear regression coefficients were calculated to determine the strength of the relationships between the amount of F. culmorum DNA (pg) and the disease index of Fusarium wilt in pea (%). A significant R-value of p-0.05 was assumed.

3. Results and discussion

3.1. Determination of Antifungal Activity In Vitro

The antifungal activity of EOs has been investigated in numerous in vitro studies [32,40,49]. In the present study, in vitro analysis of the linear growth of the fungal species studied showed differences in the antifungal potential of the essential oils investigated. Mycelial growth of all pathogens studied was significantly inhibited only by the two highest concentrations of FEO and HEO (1000 ppm and 2000 ppm) (Figures S1 and S2).
When applied at the highest concentration (2000 ppm), HEO inhibited the growth of fungal pathogens by 60.7–91.5% and FEO by 79.31–100% (Table 1 and Table 2). Tebuconazole inhibited mycelial growth of all species tested in the trial. Fusarium poae (91.5% growth inhibition), followed by F. culmorum (86.6%) and B. cinerea (81.3%) were the most susceptible to HEO. Fusarium tricinctum (76.2%), F. equiseti (76.0%), F. sporotrichioides (73.0%) and F. avenaceum (71.7%) were also effectively inhibited by HEO. Hop essential oil was least effective against C. destructans, F. solani and F. oxysporum, whose mycelial growth was reduced by 65.8%, 61.9% and 60.7%, respectively, at the highest concentration of HEO (2000 ppm) (Table 2).
The present in vitro study showed that higher concentrations of FEO and HEO inhibited mycelial growth of all fungal species studied. The percentage of mycelial growth inhibition (MGI) varied between the essential oils and pathogens tested. Similar observations were made by Palfi et al. [21] who analysed the fungistatic activity of 12 essential oils, including FEO, against F. oxysporum and B. cinerea. The cited authors reported significant differences in MGI between the essential oils studied and their concentrations. In 8-day-old cultures of F. oxysporum, mycelial growth was not significantly inhibited by the four lowest concentrations of FEO (3, 5, 7, 9 and 15 µL/10 mL PDA).
Fusarium solani was one of the least susceptible pathogens, with 79.31% of its growth inhibited by both essential oils. The other Fusarium pathogens were more sensitive to FEO, which reduced fungal activity by 83.8% in F. avenaceum, 89.3% in C. destructans, 91.2% in F. equiseti and 95.7% in F. tricinctum. The antifungal activity of FEO against F. oxysporum and F. sporotrichioides was very high at 99%. Similar to HEO, FEO was most effective against B. cinerea, F. culmorum and F. poae, whose growth was completely (100%) suppressed (Table 1).
The study by Palfi et al. [21] showed that only the higher concentrations of FEO strongly (15, 30, 50 µL/10 mL) or completely (70 µL/10 mL) inhibited the growth of F. oxysporum. Mycelial growth of B. cinerea was not affected by FEO concentrations of 3 to 30 µL/10 mL, and a significant reduction was only observed at FEO concentrations of 50 and 70 µL/10 mL. The highest FEO concentration (70 µL/10 mL) inhibited B. cinerea growth by 100%. Perczak et al. [25] demonstrated in vitro that FEO is an effective antifungal agent against F. culmorum and F. graminearum.
The opposite results were obtained by Wodnicka et al. [49], who investigated the antifungal properties of dill seed essential oil at a concentration of 10 ppm. The analysed oil reduced the mycelial growth of F. graminearum by 48.8%, of F. avenaceum by 13.3% and of F. culmorum by only 6.2%. These results contrast strongly with the results of the current study, in which HEO, which was considered less effective than FEO, was a stronger inhibitor of F. avenaceum (35.3%) and F. culmorum (47.3%) at a concentration of 1000 ppm.
The differences in the antifungal activity of FEO and HEO could be attributed to the specific properties of the pathogenic strains, such as their metabolic capabilities, as well as differences in the chemical composition of the essential oils. The physical and biological properties of essential oils are determined by their composition. Many authors have postulated that the antimicrobial activity of essential oils is closely related to the content of various constituents, especially the major components [50,51]. According to Wodnicka et al. [49], the differences in antifungal activity of essential oils isolated from fennel seeds can be attributed to their chemical polymorphism. The essential oil obtained from the seeds of fennel plants grown in Poland contained the highest levels of trans-anethole (69.95%) and fenchone (18.14%) and showed strong antifungal activity. In contrast, the oil of fennel seeds from Egypt contained mainly estragole (87.49%) and limonene (8.63%) and were characterised by low antifungal activity. The essential oil of fennel seeds grown in Poland completely inhibited the growth of S. sclerotiorum and reduced the growth of R. solani and B. cinerea by 80% and 60%, respectively. In contrast, oil from fennel seeds grown in Egypt had no effect on S. sclerotiorum and inhibited the growth of R. solani and B. cinerea by only 16.6% and 20.0%, respectively. At a concentration of 1000 ppm, both oils had different effects on the growth of three Fusarium species.
The oil extracted from the fruits of F. vulgare grown in Poland was most effective against F. graminearum (MGI of 48.8%), followed by F. avenaceum (13.3%) and F. culmorum (6.2%) [49]. Egyptian fennel essential oil was also most effective against F. graminearum, but the reduction in mycelial growth was only 28.8%. Egyptian fennel oil inhibited the growth of F. culmorum by 14.0% and had no effect on F. avenaceum [49]. According to the literature, the percentage content of essential oil constituents is influenced by: (i) variety, (ii) chemotype, (iii) ontogeny, (iv) plant organs, (v) harvest time, (vi) latitude and environmental conditions, (vii) nutritional status of plants, (viii) harvest date and drying conditions, and (ix) extraction methods and conditions [30,38,52,53]. Essential oils extracted from seeds of 16 wild populations of F. vulgare in Tunisia (subhumid, middle and upper semi-arid and humid climates) contained mainly phenylpropanoids with a dominance of estragole (66.09–85%), but they differed considerably in the content of phenolic compounds [54]. Essential oils from F. vulgare populations growing in different regions of Iran were characterised by different contents of trans-anethole (46.5–84%) and fenchone (9.1–23.8%) [55]. Senatore et al. [56] demonstrated that essential oils isolated from fruits of F. vulgare with different phenological patterns and different origins can show significant differences in the content of trans-anethole, estragole, fenchone and α-phellandrene. Kovačevič and Kač [57] found that the variety has a greater influence on the chemical composition of HEO than the growing conditions or the processing and storage methods. Similar conclusions were formulated by Almaguer et al. [58], who observed correlations between H. lupulus cultivars and plant age as well as hydrocarbon and oxidised compounds. Essential oils extracted from the fruits of three organically grown fennel cultivars (F. vulgare var. azoricum, F. vulgare var. dulce and F. vulgare var. vulgare) in Egypt contained 18 monoterpenoids, with trans-anethole, estragole and fenchone dominating [59]. In the above study, FEO was characterised by similar antimicrobial activity against gram positive and gram negative bacteria, A. niger and C. albicans, despite differences in the chemical composition of the oils extracted from the different varieties. Research has also shown that the overall antifungal activity of essential oils significantly exceeds the individual effects of even the most potent compounds [30,60]. The biological activity of essential oils seems to be determined by the synergistic effect of all ingredients [61,62]. Bocquet et al. [63] found that HEO strongly reduced (85–100%) the mycelial growth of Zymoseptoria tritici, while the three main constituents of HEO (α-humulene, myrcene and trans-caryophyllene) with proven antimicrobial potential showed no significant activity in single tests. These results confirm that the synergistic interactions between the essential oil components significantly enhance the biological activity of the oil. In the current study, the overall effect of the essential oils was investigated rather than their individual components. The plants studied (F. vulgare and H. lupulus) were organically grown in northeastern Poland, which is characterised by a low level of urban and industrial development.
According to Wójcik-Stopczyńska et al. [64], the differences in the sensitivity of Fusarium species to essential oils could be due to the unique properties of these pathogens. The pathogenicity of Fusarium species differs in different hosts and has been linked to the molecular patterns of specific fungal proteins [65]. The metabolic activity of the pathogens could influence their susceptibility to antifungal agents, regardless of the plant species from which the essential oils are derived. An analysis of genome size and the number of coding genes in the genus Fusarium based on NCBI data revealed significant individual differences within the species analysed. These differences could be reflected in the pathogenic potential of isolates of the same species, including their ability to synthesise various mycotoxins and metabolise essential oil components. Watanabe [66] used the maximum likelihood method to show that F. solani is genetically the most distant from the other Fusarium species. Fusarium solani belongs to the clade III, while F. oxysporum belongs to clade V, F. avenaceum and F. tricinctum—to clade VI and F. culmorum, F. equiseti, F. poae and F. sporotrichioides—to clade VII.

3.2. Determination of Antifungal Activity Ex Vitro

3.2.1. Results of the Pot Experiment

The results of the pot experiment in which pea plants were artificially inoculated with F. culmorum spores showed that both FEO and HEO provide protection against Fusarium wilt (Figure 1). The subsequent test was carried out with F. culmorum, as it is an important pathogen under Polish conditions, causing late blight of pea, as well as stem base rot, root rot and Fusarium wilt of pea plants. Disease progression was inhibited in pea plants sprayed with both essential oils 24 h before artificial inoculation. An assessment of the health status of the pea plants 14 days after the fungal spores were applied to the soil also confirmed that both essential oils reduced the severity of Fusarium wilt compared to the positive control. Fennel essential oil was a more potent antifungal than HEO. When applied at a lower concentration (500 ppm), FEO reduced infection by 40.4% (DI = 37.3%) and HEO by 25% (DI = 52%) (Figure 1).
At a concentration of 2000 ppm, HEO inhibited the progression of Fusarium wilt by 43% (DI = 34%) and FEO by 60.4% (DI = 17.3 %), relative to the positive control (DI = 77.7%) (Figure 1). Plants that were not inoculated with F. culmorum were healthy. In other studies, fennel essential oil also inhibited the progression of fungal diseases. Kalleli et al. [67] reported that application of 1 mL FEO at a concentration of 500 μL/mL suppressed Fusarium wilt in tomato plants both one week before and two weeks after artificial inoculation with Fusarium oxysporum f. sp. lycopersici spores. An ex vitro experiment conducted by Soylu et al. [68] showed that essential oils of fennel and Syrian oregano (Origanum syriacum subsp. bevanii (Holmes) Greuter and Burdet) promoted the survival of tomato seedlings grown on soil infected with S. sclerotinum. In the in vitro experiment, FEO was a more effective antifungal agent, while in the ex vitro experiment Syrian oregano oil protected the tomato seedlings better against fungal infection. The survival rate of tomato seedlings increased from 26.6% to 69.8% and 63.3%, respectively, after treatment with Syrian oregano oil and FEO at the highest concentration (3.2 μg/mL) compared to control plants treated with S. sclerotinum spores. The antiviral effect of FEO was also confirmed against courgette yellow mosaic virus and its vector Aphis gossypii [69].
The antifungal activity of essential oils extracted from other plant species has been investigated in numerous studies [49,70,71,72,73,74,75]. Different ways of applying essential oils to plants are also used, e.g., dipping the seeds in the tested essential oils for 24 h reduces the Fusarium wilt and seedling rot and improved the survival of pea plants [76]. Seeds preserved with cumin oil had better aroma and flavour than those treated with a synthetic fumigant [77]. In artificially inoculated wheat grain (Triticum aestivum L.), herbal application of essential oils of fennel, cinnamon tree (Cinnamomum Scheffer), oregano (Origanum vulgare L.), palmarosa leaves (Cymbopogon martini (Roxb.) W. Watson), spearmint (Mentha viridis L.), bitter orange peel (Citrus × aurantium L.), thyme hyemalis leaves and flowers (Lange) and rosewood (Aniba rosaeodora Ducke) inhibited ergosterol production by almost 100% and thus strongly inhibited the growth of F. graminearum and F. culmorum. The essential oils studied also significantly reduced the concentrations of fungal mycotoxins, zearalenone and group B trichothecenes, in wheat grains [71]. The inhibitory effect of essential oils on the biosynthesis of mycotoxins was also described by Xing et al. [78], Kalagatur et al. [79] and Perczak et al. [80].
Mycotoxin contamination was not investigated in the present study, but a significant decrease in the concentration of F. culmorum DNA was observed in pea plants treated with both FEO and HEO. The gDNA of Fusarium culmorum was amplified in the qPCR assay by quantification of the TRI5 gene (Figure 2), which encodes the trichodia synthase that has been shown to catalyse the first step in the trichothecene pathway of Fusarium [81].
The use of the qPCR assay based on the quantification of the TRI5 gene can be used both as a tool to assess the level of infection of plant material, as shown by other studies [8,9], and according to our results in this study, to indicate that the application of FEO and HEO reduces the concentration of DON, a group B trichothecene. The degradation of DON in vitro, with essential oils from other plants was presented in a study by Perczak et al. [82].
The severity of Fusarium wilt was highest in control plants, where the amount of F. culmorum DNA reached 645 pg. The amount of F. culmorum DNA in pea plants grown at a lower concentration (500 ppm) of FEO and HEO was determined to be 48.16 and 108.74 pg, respectively. Both oils had a stronger antifungal effect when applied at a concentration of 2000 ppm, and relatively low levels of F. culmorum DNA were detected in the treated plants. The average amount of F. culmorum DNA was determined to be 13.5 pg in the plants sprayed with FEO, while it was higher at 34.27 pg in the plants treated with HEO (Figure 2). Linear regression analysis showed that the results of the qPCR test were consistent with the disease index of Fusarium wilt. In the greenhouse experiment, a positive correlation was found between the symptoms of Fusarium wilt and the results of the qPCR quantification of F. culmorum (TRI5 gene), which was confirmed by the linear relationship between the variables (y = 0.76x+ 25.5) and the value of Pearson’s R (0.76) (Figure 3).

3.2.2. Microscopic Analysis

The results of microscopic analysis confirmed the effectiveness of HEO and FEO in reducing Fusarium wilt in pea plants. An analysis of the root-stem transition zone showed that the plant tissue was less penetrated by F. culmorum mycelia in seedlings treated with HEO and FEO than in control plants that were not sprayed with essential oils and irrigated with a spore suspension of F. culmorum (Figure 4).
An anatomical analysis (Figure 5 and Figure 6) revealed significantly fewer fungal mycelia in plants sprayed with HEO and FEO (Figure 5C–F, Figure 6C–F and Figure 6C’–F’) than in control plants not treated with essential oils (Figure 5B,B’ and Figure 6B,B’). The severity of pathogenic changes on the surface of roots (Figure 4 and Figure 5) and stems (Figure 4 and Figure 6) was influenced by the applied oil and its concentration. Fennel essential oil was more effective than HEO in reducing the symptoms of infection (Figure 4, Figure 5 and Figure 6), which was confirmed by the disease index of Fusarium wilt. The anatomical analysis of stems demonstrated that FEO was a more potent antifungal agent than HEO (Figure 6).
Analysis of root (Figure 4 and Figure 5) and stem (Figure 4) surfaces and anatomical analysis of stems (Figure 6) confirmed that HEO at a concentration of 2000 ppm strongly inhibited mycelial growth of F. culmorum. The most severe symptoms of fungal infection, including visible mycelia and brown discolouration indicative of tissue damage, were observed in the epidermis, cortex and vascular bundles of the stem (Figure 6C, arrows) in plants treated with 500 ppm HEO. In plants sprayed with 2000 ppm HEO, symptoms of fungal infection were only observed in the epidermis and peripheral vascular bundles (Figure 6D, arrows). The higher concentration of FEO had a similar antifungal effect. Mycelial growth was more effectively inhibited when FEO was applied at a concentration of 2000 ppm than at a concentration of 500 ppm (Figure 6E,F). Although infection symptoms were similar on the surface of the plant tissue (Figure 6E,F), cross-sections of the stems showed infected vascular bundles in plants treated with FEO at a concentration of 500 ppm (Figure 6E, arrow), whereas in plants sprayed with 2000 ppm FEO, symptoms of fungal infection were observed only on the surface of the stems (Figure 6F, arrows). The direct effects of essential oils on the structure of fungal mycelia have been widely reported in the literature [17,25,26], while their contribution to reducing the severity of plant diseases has never been confirmed in anatomical analyses of plant tissues. Essential oils alter the texture, colour and sporulation properties of fungal mycelia [61]. The disadvantage of essential oils is their volatility, which can lead to a loss of their efficacy when used under field conditions [83]. The widespread use in agriculture is opposed by the fact that the approval and registration procedures are very costly, as the evaluation of toxicity and environmental suitability is associated with high costs [84,85]. The number of registered biological control agents based on EO is significantly lower in Europe than in the United States [86]. In Europe, an increasing number of Eos have been approved as biocides for use in agriculture in recent years. Current research shows the potential for using FEO and HEO to protect peas against Fusarium fungi that cause root necrosis, stem base and Fusarium wilt. However, further trial studies need to be conducted to assess their efficacy under natural infection conditions as well as their environmental safety.

4. Conclusions

The results of this study clearly indicate that FEO is a broad-spectrum antifungal agent that is effective in reducing the severity of infections caused by many Fusarium species as well as B. cinerea and C. destructans. The results of the ex vitro trial confirmed the results of the in vitro tests and showed that HOE is a less potent inhibitor of pea pathogens than FEO. The qPCR studies for the detection of the TRI5 gene show that the use of essential oils can probably also reduce the synthesis of trichothecenes. These results suggest that FEO, a natural product, can effectively replace synthetic fungicides and provide an alternative approach for the prevention and treatment of Fusarium wilt in pea. In the future, FEO may be used in integrated pest management programs to control multiple plant pathogens simultaneously.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/app13106282/s1, Figure S1. The effect of FEO at different concentrations (125–2000 ppm) on the linear growth of plant pathogenic fungi (A): B. cinerea; (B): C. destructans; (C): F. avenaceum; (D): F. culmorum; (E): F. equiseti; (F): F. oxysporum; (G): F. poae; (H): F. solani; (I): F. sporotrichiodes; (J): F. tricinctum, (A,B,C—significant at p-0.01); Figure S2. The effect of HEO different concentrations (125–2000 ppm) on linear growth of plant pathogenic fungi (A): B. cinerea; (B): C. destructans; (C): F. avenaceum; (D): F. culmorum; (E): F. equiseti; (F): F. oxysporum; (G): F. poae; (H): F. solani; (I): F. sporotrichiodes; (J): F. tricinctum, (A,B,C—significant at p-0.01).

Author Contributions

Conceptualization A.O.; Methodology, S.B.O., K.G. and A.O.; software S.B.O.; validation, A.O.; investigation, S.B.O., K.G. and J.A.D., formal analysis, S.B.O., J.A.D. and K.G., resources, A.P. and J.P.J.; data curation, S.B.O.; writing—original draft preparation, S.B.O. and A.O.; writing—review and editing, A.O., S.B.O. and T.O.; visualization, S.B.O.; supervision, A.O. and K.J.J.; project administration, A.O.; funding acquisition, A.P., K.J.J. and J.P.J. All authors have read and agreed to the published version of the manuscript.

Funding

This study received financial support from the research project entitled ‘Management of post-production herbal waste for the production of ecological biocides’ (POIR.01.01.01-00-1106/15-01) and from the University of Warmia and Mazury in Olsztyn (grant No. 20.610.020-110). Project financially supported by Minister of Science and Higher Education in the range of the program entitled ‘Regional Initiative of Excellence’ for the years 2019–2022, project No. 010/RID/2018/19, amount of funding 12.000.000 PLN.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

The authors are grateful to Dary Natury and owner, Mirosław Angielczyk, for supporting this study and supplying plant materials for the experiments. The results presented in this paper were obtained as part of a comprehensive study financed by the University of Warmia and Mazury in Olsztyn (grant No. 30.610.013.110 and grant No. 30.610.009.110).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Warkentin, T.D.; Smýkal, P.; Coyne, C.J.; Weeden, N.; Domoney, C.; Bing, D.-J.; Leonforte, A.; Xuxiao, Z.; Dixit, G.P.; Boros, L.; et al. Pea. In Grain Legumes, 10th ed.; De Ron, A.M., Ed.; Handbook on Plant Breeding; Springer Science + Business Media: New York, NY, USA, 2015; pp. 37–83. [Google Scholar]
  2. Faostat. Faostat Agriculture Data. 2022. Available online: http://www.apps.fao.org/ (accessed on 20 March 2023).
  3. Okorski, A.; Olszewski, J.; Głowacka, K.; Okorska, S.; Pszczółkowka, A. The effect of the application of the biological control agent EM1 on gas exchange parameters and productivity of Pisum sativum L. infected with Fusarium oxysporum Schlecht. Acta Agrob. 2010, 63, 105–115. [Google Scholar] [CrossRef]
  4. Okorski, A.; Majchrzak, B. Fungi Colonizing Pea Seeds after Using of Microbiological Control Product EM 1. Prog. Plant Prot. 2009, 49, 242–245. (In Polish) [Google Scholar]
  5. Gopi, R.; Singh, S.; Raj, C. Status of Fusarium diseases of crop plants in North East India. Indian Phytopathol. 2019, 72, 637–646. [Google Scholar] [CrossRef]
  6. Pegg, K.G.; Coates, L.M.; O’Neill, W.T.; Turner, D.W. The Epidemiology of Fusarium Wilt of Banana. Front. Plant Sci. 2019, 10, 1395. [Google Scholar] [CrossRef]
  7. Maymon, M.; Sela, N.; Shpatz, U.; Galpaz, N.; Freeman, S. The orgin and current situation of Fusarium oxysporum f. sp. cubense tropical race 4 in Israel and the Middle East. Sci. Rep. 2020, 10, 1590. [Google Scholar] [CrossRef]
  8. Okorski, A.; Polak-Śliwińska, M.; Karpiesiuk, K.; Pszczółkowska, A.; Kozera, W. Real time PCR: A good tool to estimate mycotoxin contamination in pig diets. World Mycotoxin J. 2017, 10, 219–228. [Google Scholar] [CrossRef]
  9. Okorski, A.; Milewska, A.; Pszczółkowska, A.; Karpiesiuk, K.; Kozera, W.; Dąbrowska, J.A.; Radwińska, J. Prevalence of Fusarium fungi and Deoxynivalenol Levels in Winter Wheat Grain in Different Climatic Regions of Poland. Toxins 2022, 14, 102. [Google Scholar] [CrossRef]
  10. Perincherry, L.; Lalak-Kańczugowska, J.; Stępień, Ł. Fusarium-Produced Mycotoxins in Plant-Pathogen Interactions. Toxins 2019, 11, 664. [Google Scholar] [CrossRef]
  11. Wilman, L.; Fabiańska, I.; Kachlicki, P. Plant-pathogenic fungi in seeds of different pea cultivars in Poland. Arh. Hig. Rada Toksikol. 2014, 65, 329–338. [Google Scholar] [CrossRef]
  12. Chen, M.; Chang, C.-H.; Tao, L.; Lu, C. Residential Exposure to Pesticide During Childhood and Childhood Cancers: A Meta-Analysis. Pediatrics 2015, 136, 719–729. [Google Scholar] [CrossRef]
  13. Ogah, C.O.; Coker, H.B.; Adepoju-Bello, A.A. Organophosphate and Carbamate Pesticide Residues in Beans from Markets in Lagos State, Nigeria. J. Innov. Res. Eng. Sci. 2016, 2, 50–61. [Google Scholar]
  14. Palacios, S.A.; Susca, A.; Haidukowski, M.; Stea, G.; Cendoya, E.; Chulze, S.N.; Farnochi, M.C.; Moretti, A.; Torres, A.M. Genetic variability and fumonisin production by Fusarium proliferatum isolated from durum wheat grains in Argentina. Int. J. Food Microbiol. 2015, 201, 35–41. [Google Scholar] [CrossRef] [PubMed]
  15. Sharifi-Rad, J.; Sureda, A.; Tenore, G.C.; Daglia, M.; Sharifi-Rad, M.; Valussi, M.; Tundis, R.; Sharifi-Rad, M.; Loizzo, M.R.; Ademiluyi, A.O.; et al. Biological Activities of Essential Oils: From Plant Chemoecology to Traditional Healing Systems. Molecules 2017, 22, 70. [Google Scholar] [CrossRef]
  16. Božović, M.; Garzoli, S.; Sabatino, M.; Pepi, F.; Baldisserotto, A.; Andreotti, E.; Romagnoli, C.; Mai, A.; Manfredini, S.; Ragno, R. Essential Oil Extraction, Chemical Analysis and Anti-Candida Activity of Calamintha nepeta (L.) Savi subsp. glandulosa (Req.) Ball-New Approaches. Molecules 2017, 22, 203. [Google Scholar] [CrossRef] [PubMed]
  17. Nazzaro, F.; Fratianni, F.; Coppola, R.; Feo, V. Essential Oils and Antifungal Activity. Pharmaceuticals 2017, 10, 86. [Google Scholar] [CrossRef] [PubMed]
  18. Dosoky, N.S.; Setzer, W.N. Chemical Composition and Biological Activities of Essential Oils of Curcuma species. Nutrients 2018, 10, 1196. [Google Scholar] [CrossRef]
  19. Diao, W.-R.; Hu, Q.-P.; Zhang, H.; Xu, J.-G. Chemical composition, antibacterial activity and mechanism of action of essential oil from seeds of fennel (Foeniculum vulgare Mill.). Food Control 2014, 35, 109–116. [Google Scholar] [CrossRef]
  20. Valdivieso-Ugarte, M.; Gomez-Llorente, C.; Plaza-Díaz, J.; Gil, Á. Antimicrobial, Antioxidant, and Immunomodulatory Properties of Essential Oils: A Systematic Review. Nutrients 2019, 11, 2786. [Google Scholar] [CrossRef]
  21. Palfi, M.; Konjevoda, P.; Vrandečić, K.; Ćosić, J. Antifungal activity of essential oils on mycelial growth of Fusarium oxysporum and Bortytis cinerea. Emir. J. Food Agr. 2019, 31, 544–554. [Google Scholar] [CrossRef]
  22. Krzyśko-Łupicka, T.; Sokół, S.; Piekarska-Stachowiak, A.A. Evaluation of Fungistatic Activity of Eight Selected Essential Oils on Four Heterogeneous Fusarium Isolates Obtained from Cereal Grains in Southern Poland. Molecules 2020, 25, 292. [Google Scholar] [CrossRef]
  23. Waithaka, P.N.; Gathuru, E.M.; Githaiga, B.; Mwaringa, J.D. Control of Ascochyta blight of Chickenpea Using Essential Oils from Thyme (Thymus vulgaris), Sage (Salvia officinalis L.) and Rosemary (Rosmarinus officinalis L.) Plants. J. Antimicrob. Agents 2018, 4, 3. [Google Scholar] [CrossRef]
  24. Pedrotti, C.; da Silva Ribeiro, R.T.; Schwambach, J. Control of postharvest fungal rots in grapes through the use of Baccharis trimera and Baccharis dracunculifolia essential oils. Crop Prot. 2019, 125, 104912. [Google Scholar] [CrossRef]
  25. Perczak, A.; Gwiazdowska, D.; Marchwińska, K.; Juś, K.; Gwiazdowski, R.; Waśkiewicz, A. Antifungal activity of selected essential oils against Fusarium culmorum and F. graminearum and their secondary metabolites in wheat seeds. Arch. Microbiol. 2019, 201, 1085–1097. [Google Scholar] [CrossRef]
  26. Zheng, J.; Liu, T.; Guo, Z.; Zhang, L.; Mao, L.; Zhang, Y.; Jiang, H. Fumigation and contact activities of 18 plant essential oils on Villosiclava virens, the pathogenic fungus of rice false smut. Sci. Rep. 2019, 9, 7330. [Google Scholar] [CrossRef] [PubMed]
  27. Kumar, P.; Mishra, S.; Kumar, A.; Sharma, A.K. Antifungal efficacy of plant essential oils against stored grain fungi of Fusarium spp. J. Food Sci. Technol. 2016, 53, 3725–3734. [Google Scholar] [CrossRef]
  28. Hamini-Kadar, N.; Hamdane, F.; Boutoutaou, R.; Kihal, M.; Henni, J.E. Antifungal activity of clove (Syzygium aromaticum L.) essential oil against phytopathogenic fungi of tomato (Solanum lycopersicum L.) in Algeria. J. Exp. Biol. Agric. Sci. 2014, 2, 447–454. [Google Scholar]
  29. Camele, I.; Gruľová, D.; Elshafie, H.S. Chemical Composition and Antimicrobial Properties of Mentha × piperita cv. ‘Kristinka’ Essential Oil. Plants 2021, 10, 1567. [Google Scholar] [CrossRef]
  30. Angioni, A.; Barra, A.; Coroneo, V.; Dessi, S.; Cabras, P. Chemical Composition, Seasonal Variability, and Antifungal Activity of Lavandula stoechas L. ssp. stoechas Essential Oils from Stem/Leaves and Flowers. J. Agric. Food Chem. 2006, 54, 4364–4370. [Google Scholar] [CrossRef]
  31. Perveen, K.; Bokhari, N.A.; Siddique, I.; Al-Rashid, S.A.I. Antifungal Activity of Essential Oil of Commiphora molmol Oleo Gum Resin. J. Essent. Oil Bear. Plants 2018, 21, 667–673. [Google Scholar] [CrossRef]
  32. Sarkhosh, A.; Schaffer, B.; Vargas, A.I.; Palmateer, A.J.; Lopez, P.; Soleymani, A. In Vitro Evaluation of Eight Plant Essential Oils for Controlling Colletotrichum, Botryosphaeria, Fusarium and Phytophthora Fruit Rots of Avocado, Mango and Papaya. Plant Protect. Sci. 2018, 54, 153–162. [Google Scholar] [CrossRef]
  33. Zanoli, P.; Zavatti, M. Pharmacognostic and pharmacological profile of Humulus lupulus L. J. Ethnopharmacol. 2008, 116, 383–396. [Google Scholar] [CrossRef] [PubMed]
  34. Natarajan, P.; Katta, S.; Andrei, I.; Babu, R.A.V.; Leonida, M.; Hass, G.J. Positive antibacterial co-action between hops (Humulus lupulus L.) constituents and selected antibiotics. Phytomedicine 2008, 15, 94–201. [Google Scholar] [CrossRef] [PubMed]
  35. Hrnčič, M.K.; Španinger, E.; Košir, I.J.; Knez, Ž.; Bren, U. Hop Compounds: Extraction Techniques, Chemical Analyses, Antioxidative, Antimicrobial, and Anticarcinogenic Effects. Nutrients 2019, 11, 257. [Google Scholar] [CrossRef] [PubMed]
  36. Niknejad, F.; Mohammadi, M.; Khomeiri, M.; Razavi, S.H.; Alami, M. Antifungal and Antioxidant Effects of Hops (Humulus lupulus L.) Flower Extracts. Adv. Environ. Biol. 2014, 8, 395–401. [Google Scholar]
  37. Malhotra, S.K. Fennel and seed fennel. In Handbook of Herbs and Species; Peter, K.V., Ed.; Woodhead Publishing: Cambridge, UK, 2012; Volume 2, pp. 275–302. [Google Scholar]
  38. Mímica-Dukić, N.; Kujundzić, S.; Soković, M.; Couladis, M. Essential oil composition and antifungal activity of Foeniculum vulgare Mill obtained by different distillation conditions. Phytother. Res. 2003, 17, 368–371. [Google Scholar] [CrossRef]
  39. Zellagui, A.; Gherraf, N.; Elkhateeb, A.; Hegazy, M.-E.F.; Mohamed, T.; Touil, A.; Shaha, A.A.; Rhouati, S. Chemical constituents from algerian Foeniculum vulgare aerial parts and evaluation of antimicrobial activity. J. Chil. Chem. Soc. 2011, 56, 759–763. [Google Scholar] [CrossRef]
  40. Zeng, H.; Chen, X.; Liang, J. In vitro antifungal activity and mechanism of essential oil from fennel (Foeniculum vulgare L.) on dermatophyte species. J. Med. Microbiol. 2015, 64, 93–103. [Google Scholar] [CrossRef]
  41. Soylu, E.M.; Kurt, S.; Soylu, S. In vitro and in vivo antifungal activities of the essential oils of various plants against tomato grey mould disease agent Botrytis cinerea. Int. J. Food Microbiol. 2010, 143, 183–189. [Google Scholar] [CrossRef]
  42. Deryng, J. A new apparatus for determining oils in plant material. Acta Pol. Pharm. 1951, 8, 121–136. (In Polish) [Google Scholar]
  43. Ngono, N.A.; Biyiti, L.; Amvam, Z.P.H.; Bouchet, P.H. Evaluation of antifungal activity of extracts of two Cameroonian Rutaceae: Zanthoxylum leprieurii Guill. et Perr. and Zanthoxylum xanthoxyloides Waterm. J. Ethnopharmacol. 2000, 70, 335–342. [Google Scholar] [CrossRef]
  44. Abdollahi, A.; Hassani, A.; Ghosta, Y.; Meshkatalsadat, M.H. Screening of antifungal properties of essential oils extracted from sweet basil, fennel, summer savory and thyme against postharvest phytopathogenic fungi. J. Food Safety 2011, 31, 350–356. [Google Scholar] [CrossRef]
  45. Hillstrand, D.S.; Auld, D.J. Comparative evaluation of four techniques for screening winter peas for resistance to Phoma medicaginis var. pinodella. Crop Sci. 1982, 22, 282–287. [Google Scholar] [CrossRef]
  46. Elshafie, H.S.; Sakr, S.; Bufo, S.A.; Camele, I. An Attempt of Biocontrol the Tomato-Wilt Disease Caused by Verticillium dahliae Using Burkholderia gladioli pv. agaricicola and Its Bioactive Secondary Metabolites. Int. J. Plant Biol. 2017, 8, 7263. [Google Scholar] [CrossRef]
  47. Vegi, A.; Wolf-Hall, C.E. Multiplex Real-Time PCR Method for detection and quantification of mycotoxigenic fungi belonging to three different genera. J. Food Sci. 2013, 78, M70–M76. [Google Scholar] [CrossRef] [PubMed]
  48. Głowacka, K.; Olszewski, J.; Sowiński, P.; Kalisz, B.; Najdzion, J. Developmental and Physiological Responses of Pisum sativum L. after Short- and Long-Time Cadmium Exposure. Agriculture 2022, 12, 637. [Google Scholar] [CrossRef]
  49. Wodnicka, A.; Huzar, E.; Dzięcioł, M.; Krawczyk, M. Comparison of the composition and fungicidal activity of essential oils from fennel fruits cultivated in Poland and Egypt. Pol. J. Chem. Technol. 2019, 21, 38–42. [Google Scholar] [CrossRef]
  50. Wang, Y.; Zhang, Y.; Shi, Y.Q.; Pan, X.H.; Lu, Y.H.; Cao, P. Antibacterial effects of cinnamon (Cinnamomum zeylanicum) bark essential oil on Porphyromonas gingivalis. Microb. Pathog. 2018, 116, 26–32. [Google Scholar] [CrossRef] [PubMed]
  51. Sharma, A.; Rajendran, S.; Srivastava, A.; Sharma, S.; Kundu, B. Antifungal activities of selected essential oils against Fusarium oxysporum f. sp. lycopersici 1322, with emphasis on Syzygium aromaticum essential oil. J. Biosci. Bioeng. 2017, 123, 308–313. [Google Scholar] [CrossRef]
  52. Sakkas, H.; Papadopoulou, C. Antimicrobial Activity of Basil, Oregano, and Thyme Essential Oils. J. Microbiol. Biotechnol. 2017, 27, 429–438. [Google Scholar] [CrossRef]
  53. Moutassem, D.; Belabid, L.; Bellik, Y.; Ziouche, S.; Baali, F. Efficacy of essential oils of various aromatic plants in the biocontrol of Fusarium wilt and inducing systemic resistance in chickpea seedlings. Plant Prot. Sci. 2019, 55, 202–217. [Google Scholar] [CrossRef]
  54. Khammassi, M.; Loupassaki, S.; Tazarki, H.; Mezni, F.; Slama, A.; Tlili, N.; Zaouali, Y.; Mighri, H.; Jamoussi, B.; Khaldi, A. Variation in essential oil composition and biological activities of Foeniculum vulgare Mill. populations growing widely in Tunisia. J. Food Biochem. 2018, 42, e12532. [Google Scholar] [CrossRef]
  55. Pouryousef, M. Variation in the essential oil constituents in indigenous populations of Foeniculum vulgare var. vulgare from different locations of Iran. J. Essen. Oil Res. 2014, 26, 441–445. [Google Scholar] [CrossRef]
  56. Senatore, F.; Oliviero, F.; Scandolera, E.; Taglialatela-Scafati, O.; Roscigno, G.; Zaccardelli, M.; De Falco, E. Chemical composition, antimicrobial and antioxidant activities of anethole-rich oil from leaves of selected varieties of fennel (Foeniculum vulgare Mill. ssp. vulgare var. azoricum (Mill.) Thell). Fitoterapia 2013, 90, 214–219. [Google Scholar] [CrossRef] [PubMed]
  57. Kovačevič, M.; Kač, M. Determination and verification of hop varieties by analysis of essential oils. Food Chem. 2002, 77, 489–494. [Google Scholar] [CrossRef]
  58. Almaguer, C.; Schönberger, C.; Gastl, M.; Arendt, E.K.; Becker, T. Humulus lupulus—A story that begs to be told. A review. J. Inst. Brew. 2014, 120, 289–314. [Google Scholar] [CrossRef]
  59. Shahat, A.A.; Ibrahim, A.Y.; Hendawy, S.F.; Omer, E.A.; Hammouda, F.M.; Abdel-Rahman, F.H.; Saleh, M.A. Chemical Composition, Antimicrobial and Antioxidant Activities of Essential Oils from Organically Cultivated Fennel Cultivars. Molecules 2011, 16, 1366–1377. [Google Scholar] [CrossRef]
  60. Terzi, V.; Morcia, C.; Faccioli, P.; Valè, G.; Tacconi, G.; Malnati, M. In vitro antifungal activity of the tea tree (Melaleuca alternifolia) essential oil and its major components against plant pathogens. Lett. Appl. Microbiol. 2007, 44, 613–618. [Google Scholar] [CrossRef]
  61. Roselló, J.; Sempere, F.; Sanz-Berzosa, I.; Chiralt, A.; Santamarina, M.P. Antifungal Activity and Potential Use of Essential Oils Against Fusarium culmorum and Fusarium verticillioides. J. Essen. Oil Bear. Plants 2015, 18, 359–367. [Google Scholar] [CrossRef]
  62. Pedrotti, C.; Ribeiro, R.T.; Schwambach, J. Control of Postharvest Fungal Rots on Grapes Using Essential Oil of Foeniculum vulgare Mill. J. Agric. Sci. 2017, 9, 205–216. [Google Scholar] [CrossRef]
  63. Bocquet, L.; Rivière, C.; Dermont, C.; Samaillie, J.; Hilbert, J.L.; Halama, P.; Siah, A.; Sahpaz, S. Antifungal activity of hop extracts and compounds against the wheat pathogen Zymoseptoria tritici. Ind. Crop. Prod. 2018, 122, 290–297. [Google Scholar] [CrossRef]
  64. Wójcik-Stopczyńska, B.; Jakowienko, P.; Wysocka, G. The estimation of antifungal activity of essential oil and hydrosol obtained from wrinkled-leaf mint (Mentha crispa L.). Herba Pol. 2012, 58, 6–15. [Google Scholar]
  65. Abo-Elnaga, H.I.G.; Amein, K.A. Differentiation in Protein Patterns in Fusarium Sp. Causing Root Rot and Damping off Diseases in Sugar Beet and Wheat and Their Relation to Pathogencity. Aust. J. Basic Appl. Sci. 2011, 5, 683–692. [Google Scholar]
  66. Watanabe, M. Molecular phylogeny and identification of Fusarium species based on nucleotide sequences. Mycotoxins 2013, 63, 133–142. [Google Scholar] [CrossRef]
  67. Kalleli, F.; Salem, I.B.; Boughalleb-M’hamdi, N.; M’hamdi, M. In vitro and in vivo efficiency of fennel essential oil against tomato Fusarium wilt and its promotion effect in plant growth. Int. J. Agric. Environ. Biores. 2019, 4, 180–199. [Google Scholar] [CrossRef]
  68. Soylu, S.; Yigitbas, H.; Soylu, E.M.; Kurt, S. Antifungal effects of essential oils from oregano and fennel on Sclerotinia sclerotiorum. J. Appl. Microbiol. 2007, 103, 1021–1030. [Google Scholar] [CrossRef] [PubMed]
  69. Taglienti, A.; Donati, L.; Dragone, I.; Ferretti, L.; Gentili, A.; Araniti, F.; Sapienza, F.; Astolfi, R.; Fiorentino, S.; Vecchiarelli, V.; et al. In Vivo Antiphytoviral and Aphid Repellency Activity of Essential Oils and Hydrosols from Mentha suaveolens and Foeniculum vulgare to Control Zucchini Yellow Mosaic Virus and Its Vector Aphis gossypii. Plants 2023, 12, 1078. [Google Scholar] [CrossRef]
  70. Mekonnen, M.; Wariyo, A.; Hilu, G. Antifungal Activities of Some Essential Oils Against Fusarium oxysporum of Rosemary and Sage Plants. Adv. Crop Sci. Tech. 2019, 7, 419. [Google Scholar] [CrossRef]
  71. Perczak, A.; Gwiazdowska, D.; Gwiazdowski, R.; Juś, K.; Marchwińska, K.; Waśkiewicz, A. The Inhibitory Potential of Selected Essential Oils on Fusarium spp. Growth and Mycotoxins Biosynthesis in Maize Seeds. Pathogens 2020, 9, 23. [Google Scholar] [CrossRef]
  72. Antonio-Gutiérrez, O.; Alvízar-Martínez, J.A.; Solano, R.; Vásquez-López, A.; Hernández-Valladolid, S.L.; Lustre-Sánchez, H.; Flores-Moctezuma, H.E.; de Jesús de Luna-Santillana, E.; Lagunez-Rivera, L. Microwave-Assisted Hydrodistillation of Essential Oil from Plectranthus amboinicus: Evaluation of Its Antifungal Effect and Chemical Composition. Life 2023, 13, 528. [Google Scholar] [CrossRef]
  73. Ahmed, H.F.A.; Seleiman, M.F.; Mohamed, I.A.A.; Taha, R.S.; Wasonga, D.O.; Battaglia, M.L. Activity of Essential Oils and Plant Extracts as Biofungicides for Suppression of Soil-Borne Fungi Associated with Root Rot and Wilt of Marigold (Calendula officinalis L.). Horticulturae 2023, 9, 222. [Google Scholar] [CrossRef]
  74. Karapetsi, L.; Pratsinakis, E.; Xirakias, F.; Osathanunkul, M.; Vagelas, I.; Madesis, P. ITS Metabarcoding Reveals the Effects of Oregano Essential Oil on Fusarium oxysporum and Other Fungal Species in Soil Samples. Plants 2023, 12, 62. [Google Scholar] [CrossRef] [PubMed]
  75. Medina-Romero, Y.M.; Rodriguez-Canales, M.; Rodriguez-Monroy, M.A.; Hernandez-Hernandez, A.B.; Delgado-Buenrostro, N.L.; Chirino, Y.I.; Cruz-Sanchez, T.; Garcia-Tovar, C.G.; Canales-Martinez, M.M. Effect of the Essential Oils of Bursera morelensis and Lippia graveolens and Five Pure Compounds on the Mycelium, Spore Production, and Germination of Species of Fusarium. J. Fungi 2022, 8, 617. [Google Scholar] [CrossRef]
  76. El-Shennawy, M.; Abozid, M. Chemical composition, antioxidant and antifungal activities of three essential oils against fungal pathogens causing damping-off and root-rot diseases in pea. Der Pharma Chem. 2017, 9, 85–93. [Google Scholar]
  77. Kumar, N. Preservative potential of cumin essential oil for Pisum sativum L. during storage. J. Plant Prot. Res. 2016, 56, 203–210. [Google Scholar] [CrossRef]
  78. Xing, F.; Hua, H.; Selvaraj, J.N.; Yuan, Y.; Zhao, Y.; Zhou, L.; Liu, Y. Degradation of fumonisin B1 by cinnamon essential oil. Food Control 2014, 38, 37–40. [Google Scholar] [CrossRef]
  79. Kalagatur, N.K.; Mudili, V.; Siddaiah, C.; Gupta, V.K.; Natarajan, G.; Sreepathi, M.H.; Vardhan, B.H.; Putcha, V.L.R. Antagonistic activity of Ocimum sanctum L. essential oil on growth and zearalenone production by Fusarium graminearum in maize grains. Front. Microbiol. 2015, 6, 892. [Google Scholar] [CrossRef]
  80. Perczak, A.; Juś, K.; Marchwińska, K.; Gwiazdowska, D.; Waśkiewicz, A.; Goliński, P. Degradation of Zearalenone by Essential Oils Under In vitro conditions. Front. Microbiol. 2016, 7, 1224. [Google Scholar] [CrossRef]
  81. Tretiakova, P.; Voegele, R.T.; Soloviev, A.; Link, T.I. Successful Silencing of the Mycotoxin Synthesis Gene TRI5 in Fusarium culmorum and Observation of Reduced Virulence in VIGS and SIGS Experiments. Genes 2022, 13, 395. [Google Scholar] [CrossRef]
  82. Perczak, A.; Juś, K.; Gwiazdowska, D.; Marchwińska, K.; Waśkiewicz, A. The Efficiency of Deoxynivalenol Degradation by Essential Oils under In Vitro Conditions. Foods 2019, 8, 403. [Google Scholar] [CrossRef]
  83. Raveau, R.; Fontaine, J.; Lounès-Hadj Sahraoui, A. Essential Oils as Potential Alternative Biocontrol Products against Plant Pathogens and Weeds: A Review. Foods 2020, 9, 365. [Google Scholar] [CrossRef]
  84. Lamichhane, J.R.; Dachbrodt-Saaydeh, S.; Kudsk, P.; Messéan, A. Toward a Reduced Reliance on Conventional Pesticides in European Agriculture. Plant Dis. 2016, 100, 10–24. [Google Scholar] [CrossRef] [PubMed]
  85. Czaja, K.; Goralczyk, K.; Struciński, P.; Hernik, A.; Korcz, W.; Minorczyk, M.; Łyczewska, M.; Ludwicki, J.K. Biopesticides—Towards increased consumer safety in the European Union. Pest Manag. Sci. 2015, 71, 3–6. [Google Scholar] [CrossRef] [PubMed]
  86. Olson, S. An Analysis of the Biopesticide Market Now and Where it is Going. Outlooks Pest Manag. 2015, 26, 203–206. [Google Scholar] [CrossRef]
Applsci 13 06282 g001 550
Figure 1. Reduction in Fusarium wilt (Fusarium culmorum) by use different concentrations of essential oils from fennel and hops—disease index (%) (A,B,C,D,E—significant at p-0.01 by Tukey’s HSD test).
Figure 1. Reduction in Fusarium wilt (Fusarium culmorum) by use different concentrations of essential oils from fennel and hops—disease index (%) (A,B,C,D,E—significant at p-0.01 by Tukey’s HSD test).
Applsci 13 06282 g001
Applsci 13 06282 g002 550
Figure 2. The qPCR quantification of gDNA Fusarium culmorum (TRI5 gene) in pea plants treated with different concentrations of essential oils from fennel and hops (pg DNA), (A,B,C,D,E—significant at p-0.01 by Tukey’s HSD test).
Figure 2. The qPCR quantification of gDNA Fusarium culmorum (TRI5 gene) in pea plants treated with different concentrations of essential oils from fennel and hops (pg DNA), (A,B,C,D,E—significant at p-0.01 by Tukey’s HSD test).
Applsci 13 06282 g002
Applsci 13 06282 g003 550
Figure 3. Linear regression analysis between symptoms of fusarium wilt and results of qPCR quantification of TRI-5 gene (R significant at p-0.05).
Figure 3. Linear regression analysis between symptoms of fusarium wilt and results of qPCR quantification of TRI-5 gene (R significant at p-0.05).
Applsci 13 06282 g003
Applsci 13 06282 g004 550
Figure 4. Transition region between stem and root of the pea plants: non-treated (A) and treated with Fusarium culmorum (B), treated Fusarium culmorum with HEO (500 ppm—(C), 2000 ppm—(D)) and FEO (500 ppm—(E), 2000 ppm—(F)). Scale bar: 1 and 2 mm.
Figure 4. Transition region between stem and root of the pea plants: non-treated (A) and treated with Fusarium culmorum (B), treated Fusarium culmorum with HEO (500 ppm—(C), 2000 ppm—(D)) and FEO (500 ppm—(E), 2000 ppm—(F)). Scale bar: 1 and 2 mm.
Applsci 13 06282 g004
Applsci 13 06282 g005 550
Figure 5. The surface of the pea root: non-treated (A,A’) and treated with Fusarium culmorum (B,B’), treated Fusarium culmorum with HEO (500 ppm—C,C’, 2000 ppm—D,D’) and FEO (500 ppm—E,E’, 2000 ppm—F,F’). Brown colour indicates infected cells (arrow) and possible place of fungus penetration (dotted arrows). Scale bar: 100 µm.
Figure 5. The surface of the pea root: non-treated (A,A’) and treated with Fusarium culmorum (B,B’), treated Fusarium culmorum with HEO (500 ppm—C,C’, 2000 ppm—D,D’) and FEO (500 ppm—E,E’, 2000 ppm—F,F’). Brown colour indicates infected cells (arrow) and possible place of fungus penetration (dotted arrows). Scale bar: 100 µm.
Applsci 13 06282 g005
Applsci 13 06282 g006 550
Figure 6. Cross section of the pea stem: non-treated (A,A’) and treated with Fusarium culmorum (B,B’), treated Fusarium culmorum with HEO (500 ppm—C,C’, 2000 ppm—D,D’) and FEO (500 ppm—E,E’, 2000 ppm—F,F’). Abbreviations: e—epidermis, c—cortex, vb—vascular bundle of the stele, o—outer part of a phloem split strand, l—phloem lateral strand. Scale bar: 100 µm, Arrows—description in the text.
Figure 6. Cross section of the pea stem: non-treated (A,A’) and treated with Fusarium culmorum (B,B’), treated Fusarium culmorum with HEO (500 ppm—C,C’, 2000 ppm—D,D’) and FEO (500 ppm—E,E’, 2000 ppm—F,F’). Abbreviations: e—epidermis, c—cortex, vb—vascular bundle of the stele, o—outer part of a phloem split strand, l—phloem lateral strand. Scale bar: 100 µm, Arrows—description in the text.
Applsci 13 06282 g006
Table
Table 1. MGI of selected pea pathogens with different concentration of fennel essential oil [ppm].
Table 1. MGI of selected pea pathogens with different concentration of fennel essential oil [ppm].
TreatmentFungal Species
1*2345678910
125 ppm1.66+2.1+6.72.9+7.10.78.7+9.31.89.5
250 ppm0.23+15.4+13.57.9+22.6+20.810.8+29.4+2.871.6
500 ppm2.2518.4+7.5923.5+6.27.214.8+1.012.519.8
1000 ppm24.7631.3+7.349.012.125.131.717.629.655.8
2000 ppm10089.383.810091.29910079.319995.7
Tebuconazole100100100100100100100100100100
1*—Botrytis cinerea; 2—Cylindrocarpon destructans; 3—Fusarium avenaceum; 4—Fusarium culmorum; 5—Fusarium equiseti; 6—Fusarium oxysporum; 7—Fusarium poae; 8—Fusarium solani; 9—Fusarium sporotrichioides; 10—Fusarium tricinctum.Applsci 13 06282 i001
Table
Table 2. MGI of selected pea pathogens on different concentrations of hop essential oil [ppm].
Table 2. MGI of selected pea pathogens on different concentrations of hop essential oil [ppm].
TreatmentFungal Species
1*2345678910
125 ppm0.7+19.5+8.96.14.5+0.227.9+18.515.619.8
250 ppm0.4+27.9+618.55.5+12.932.8+32.315.829.5
500 ppm4.414.123.441.339.621.945.310.623.534.7
1000 ppm42.435.535.347.356.528.063.124.031.147.8
2000 ppm81.365.871.786.676.060.791.561.973.076.2
Tebuconazole100100100100100100100100100100
1*—Botrytis cinerea; 2—Cylindrocarpon destructans; 3—Fusarium avenaceum; 4—Fusarium culmorum; 5—Fusarium equiseti; 6—Fusarium oxysporum; 7—Fusarium poae; 8—Fusarium solani; 9—Fusarium sporotrichioides; 10—Fusarium tricinctum.Applsci 13 06282 i002
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Okorska, S.B.; Dąbrowska, J.A.; Głowacka, K.; Pszczółkowska, A.; Jankowski, K.J.; Jastrzębski, J.P.; Oszako, T.; Okorski, A. The Fungicidal Effect of Essential Oils of Fennel and Hops against Fusarium Disease of Pea. Appl. Sci. 2023, 13, 6282. https://doi.org/10.3390/app13106282

AMA Style

Okorska SB, Dąbrowska JA, Głowacka K, Pszczółkowska A, Jankowski KJ, Jastrzębski JP, Oszako T, Okorski A. The Fungicidal Effect of Essential Oils of Fennel and Hops against Fusarium Disease of Pea. Applied Sciences. 2023; 13(10):6282. https://doi.org/10.3390/app13106282

Chicago/Turabian Style

Okorska, Sylwia Barbara, Joanna Agnieszka Dąbrowska, Katarzyna Głowacka, Agnieszka Pszczółkowska, Krzysztof Józef Jankowski, Jan Paweł Jastrzębski, Tomasz Oszako, and Adam Okorski. 2023. "The Fungicidal Effect of Essential Oils of Fennel and Hops against Fusarium Disease of Pea" Applied Sciences 13, no. 10: 6282. https://doi.org/10.3390/app13106282

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop