Multi-Gene Phylogeny and Taxonomy of Hydnellum (Bankeraceae, Basidiomycota) from China
Abstract
:1. Introduction
2. Materials and Methods
2.1. Morphological Studies
2.2. Molecular Procedures and Phylogenetic Analyses
3. Results
Phylogenetic Analyses
4. Taxonomy
Key to species of Hydnellum from China | |
1. Basidiocarps fleshy | 2 |
1.→ Basidiocarps woody | 4 |
2. Pileal surface not scaled | H. coactum |
2.→ Pileal surface scaled | 3 |
3. Pileal surface with ascend squama | H. grosselepidotum |
3.→ Pileal surface with appressed squama | H. lidongensis |
4. Context tissue olivaceous in KOH | 5 |
4.→ Context tissue blue-green in KOH | H. peckii |
5. Hyphae with clamp-connections in the context | 6 |
5.→ Hyphae without clamp-connections in the context and spines | 8 |
6. Basidiocarps with dark violet spines underneath pileus | H. atrospinosum |
6.→ Basidiocarps with different colored spines underneath pileus | 7 |
7. Pileal surface fibrillose, rugose when dry, spines up to 1.5 mm long | H. fibulatum |
7.→ Pileal surface pitted, colliculose when dry, spines up to 6 mm long | H. caeruleum |
8. Inflated hyphae present from the context | 9 |
8.→ Inflated hyphae absent in the context | 10 |
9. Generative hyphae mostly inflated in the context, pileal surface scrobiculate when dry | H. inflatum |
9.→ Generative hyphae occasionally inflated in the context, pileal surface granulose when dry | H. granulosum |
10. Stipe thin, rhizomorphs-like | Hydnellum sp 1 |
10.→ Stipe cylindrical to flattened | 11 |
11. Pileal surface colored brownish orange to brownish red | H. brunneorubrum |
11.→ Pileal surface differently colored | 12 |
12. Pileal margin involute and wavy, sometimes lobed or rimose | 13 |
12.→ Pileal margin even or effused, sometimes lobed or eroded | 14 |
13. Pileal surface glabrescent | Hydnellum sp 4 |
13.→ Pileal surface not glabrescent | 15 |
14. Pileal surface azonate and spongy | 16 |
14.→ Pileal surface obsurely concentrically zonate to zonate and not spongy | 17 |
15. Pileal surface floccose to squamulose when fresh, context corky | H. squamulosum |
15.→ Pileal surface tomentose and scrupose when fresh, context woody | H. bomiense |
16. Basidiocarps single to gregarious and stipe single and long | H. spongiosipes |
16.→ Basidiocarps coalescent and stipe connate and short | Hydnellum sp 2 |
17. Stipe context with a dark line at centre | 18 |
17.→ Stipe context without a dark line at centre | 19 |
18. Pileus and spines grayish red | H. yunnanense |
18.→ Pileus brown and spines reddish brown | Hydnellum sp 3 |
19. Spines up to 3 or 3.5 mm long | 20 |
19.→ Spines up to 1 or 1.5 mm long | 21 |
20. Pileus light brown to dark ruby | H. atrorubrum |
20.→ Pileus reddish brown | H. rubidofuscum |
21. Basidiocarps gregarious or multiple pilei overlapping and pileal surface often grooved, scabrous to fibrous | H. sulcatum |
21.→ Basidiocarps solitary and pileal surface velutinous and strigose | Hydnellum sp 5 |
5. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Maas Geesteranus, R.A. Die terrestrischen Stachelpilze Europas. Verh. K. Ned. Akad. van Wet. Afd. Nat. Tweede Reeks 1975, 65, 1–127. [Google Scholar]
- Baird, R.E.; Khan, S.R. The stipitate hydnums (Thelephoraceae) of Florida. Brittonia 1986, 38, 171–184. [Google Scholar] [CrossRef]
- Agerer, R. Ectomycorrhizae of Hydnellum peckii on Norway spruce and their chlamydospores. Mycologia 1993, 85, 74–83. [Google Scholar] [CrossRef]
- Stalpers, J.A. The aphyllophoraceous fungi I. Keys to the species of the Thelephorales. Stud. Mycol. 1993, 35, 1–168. [Google Scholar]
- Pegler, D.N.; Roberts, P.J.; Spooner, B.M. British Chanterelles and Tooth Fungi; Royal Botanic Gardens: Kew, UK, 1997; p. 114. [Google Scholar]
- Arnolds, E. De Stekelzwammen en Pruikzwammen van Nederland en Belgie. Coolia 2003, 46, 1–96. [Google Scholar]
- Arnolds, E. The fate of hydnoid fungi in the Netherlands and northwestern Europe. Fungal Ecol. 2010, 3, 81–88. [Google Scholar] [CrossRef]
- Arnolds, E. E. Former and present distribution of stipitate hydnaceous fungi (Basidiomycetes) in the Netherlands. Nova Hedwig. 1989, 48, 107–142. [Google Scholar]
- Bergelson, J.M.; Crawley, M.J. Mycorrhizal infection and species diversity. Nature 1998, 334, 202. [Google Scholar] [CrossRef]
- Van der Heijden, M.; Klironomos, J.; Ursic, M.; Moutoglis, P.; Streitwolf-Engel, R.; Boller, T.; Wiemken, A.; Sanders, I. Mycorrhizal fungal diversity determines plant biodiversity, ecosystem variability and productivity. Nature 1998, 396, 69–72. [Google Scholar] [CrossRef]
- Wu, F.; Zhou, L.W.; Yang, Z.L.; Bau, T.; Li, T.H.; Dai, Y.C. Resource diversity of Chinese macrofungi: Edible, medicinal and poisonous species. Fungal Divers. 2019, 98, 1–76. [Google Scholar] [CrossRef]
- Lee, D.; Boo, K.H.; Lee, J.M.; Viet, C.D.; Quyen, N.; Unno, T.; Cho, M.; Riu, K.Z.; Lee, D.S. Anti-viral activity of Hydnellum concrescens, a medicinal mushroom. Afr. J. Biotechnol. 2012, 11, 15241–15245. [Google Scholar] [CrossRef]
- Farzaneh, V.; Carvalho, I.S. A review of the health benefit potentials of herbal plant infusions and their mechanism of actions. Ind. Crop. Prod. 2015, 65, 247–258. [Google Scholar] [CrossRef]
- Lizon, P. Decline of macrofungi in Europe: An overview. Trans. Mycol. Soc. Repub. China 1993, 8, 21–48. [Google Scholar]
- Newton, A.C.; Holden, E.; Davy, L.M.; Ward, S.D.; Fleming, L.V.; Watling, R. Status and distribution of stipitate hydnoid fungi in Scottish coniferous forests. Biol. Conserv. 2002, 107, 181–192. [Google Scholar] [CrossRef]
- Van der Linde, S.; Alexander, I.J.; Anderson, I.C. A PCR-based method for detecting the mycelia of stipitate hydnoid fungi in soil. J. Microbiol. Methods 2008, 75, 40–46. [Google Scholar] [CrossRef]
- Jansen, E.J.; Van Dobben, H.F. Is decline of Cantharellus cibarius in the Netherlands due to air pollution? Ambio 1987, 16, 211–213. [Google Scholar]
- Arnolds, E. A preliminary Red Data List of macrofungi in the Netherlands. Persoonia 1989, 14, 77–125. [Google Scholar]
- Arnolds, E. Decline of ectomycorrhizal fungi in Europe. Agric. Ecosyst. Environ. 1991, 35, 209–244. [Google Scholar] [CrossRef]
- Termorshuizen, A.J.; Schaffers, A.P. The decline of sporocarps of ectomycorrhizal fungi in stands of Pinus sylvestris L. in The Netherlands: Possible causes. Nova Hedwig. 1991, 53, 267–289. [Google Scholar]
- Wallenda, T.; Kottke, I. Nitrogen deposition and ectomycorrhizas. New Phytol. 1998, 139, 169–187. [Google Scholar] [CrossRef]
- Lizon, P. Macrofungi reported as extinct or threatened with extinction in European Red Data Lists. Fungi Conserv. Newsl. 1995, 3, 3–4. [Google Scholar]
- Senn-Irlet, B.; Bieri, G.; Egli, S. Rote Liste Grosspilze. Rote Liste der Gefährdeten Arten der Schweiz; BAFU: Bern, Switzerland, 2007; Volume 18, p. 92. [Google Scholar]
- Smith, J.H.; Suz, L.M.; Ainsworth, A.M.; Smith, J.H.; Suz, L.M.; Ainsworth, A.M. Red List of Fungi for Great Britain: Bankeraceae, Cantharellaceae, Geastraceae, Hericiaceae and Selected Genera of Agaricaceae (Battarrea, Bovista, Lycoperdon & Tulostoma) and Fomitopsidaceae (Piptoporus); Jodrell Laboratory, Royal Botanic Gardens: Kew, UK, 2016; p. 90. [Google Scholar]
- Anon. UK Biodiversity Group. Tranche 2 Actions Plans—Volume III: Plants and Fungi; English Nature: Peterborough, UK, 1999; pp. 24–27. [Google Scholar]
- Maas Geesteranus, R.A. Hydnaceous fungi of the eastern old world. Vehr. K. Ned. Akad. van Wet. Afd. Nat. 1971, 60, 1–176. [Google Scholar]
- Baird, R.; Wallace, L.E.; Baker, G.; Scruggs, M. Stipitate hydnoid fungi of the temperate southeastern United States. Fungal Divers. 2013, 62, 41–114. [Google Scholar] [CrossRef]
- Binder, M.; Hibbett, D.S.; Larsson, K.H.; Larsson, E.; Langer, E.; Langer, G. The phylogenetic distribution of resupinate forms across the major clades of mushroom-forming fungi (Homobasidiomycetes). Syst. Biodivers. 2005, 3, 113–157. [Google Scholar] [CrossRef]
- Matheny, P.B.; Curtis, J.M.; Hofstetter, V.; Aime, M.C. Major clades of Agaricales: A multilocus phylogenetic overview. Mycologia 2006, 98, 982–995. [Google Scholar] [CrossRef]
- Tedersoo, L.; May, T.W.; Smith, M.E. Ectomycorrhizal lifestyle in fungi: Global diversity, distribution, and evolution of phylogenetic lineages. Mycorrhiza 2010, 20, 217–263. [Google Scholar] [CrossRef]
- Larsson, K.H.; Svantesson, S.; Miscevic, D.; Kljalg, U.; Larsson, E. Reassessment of the generic limits for Hydnellum and Sarcodon (thelephorales, basidiomycota). MycoKeys 2019, 54, 31–47. [Google Scholar] [CrossRef]
- Banker, H.J. A contribution to a revision of the North American Hydnaceae. Mem. Torrey Bot. Club 1906, 12, 99–194. [Google Scholar]
- Harrison, K.A. New or little known North American stipitate hydnums. Can. J. Bot. 1964, 42, 1205–1233. [Google Scholar] [CrossRef]
- Baird, R.E. Study of the stipitate hydnums from the southern Appalachian Mountains—Genera: Bankera, Hydnellum, Phellodon, Sarcodon. Bibl. Mycol. 1986, 104, 1–156. [Google Scholar]
- Koljalg, U.; Renvall, P. Hydnellum gracillipes—A link between stipitate and resupinate Hymenomycetes. Karstenia 2000, 40, 71–77. [Google Scholar] [CrossRef] [Green Version]
- Loizides, M.; Alvarado, P.; Assyov, B.; Arnolds, E.; Moreau, P.A. Hydnellum dianthifolium sp nov. (Basidiomycota, Thelephorales), a new tooth-fungus from southern Europe with notes on H. concrescens and H. scrobiculatum. Phytotaxa 2016, 280, 23–35. [Google Scholar] [CrossRef]
- Dai, Y.C. A revised checklist of corticioid and hydnoid fungi in China for 2010. Mycoscience 2011, 52, 69–79. [Google Scholar] [CrossRef]
- Mu, Y.H.; Hu, Y.P.; Wei, Y.L.; Yuan, H.S. Hydnaceous fungi of China 8. morphological and molecular identification of three new species of Sarcodon and a new record from southwest China. MycoKeys 2020, 66, 83–103. [Google Scholar] [CrossRef] [Green Version]
- Rayner, R.W. A Mycological Colour Chart; Commonweath Mycological Institute and British Mycological Society: Kew, UK, 1970. [Google Scholar]
- Munsell, A.H. Munsell Soil-Color Charts with Genuine Munsell Color Chips; Munsell Color: Grand Rapids, MI, USA, 2015. [Google Scholar]
- Stöger, A.; Schaffer, J.; Ruppitsch, W. A rapid and sensitive method for direct detection of Erwinia amylovora in symptomatic and asymptomatic plant tissues by polymerase chain reaction. J. Phytopathol. 2006, 154, 469–473. [Google Scholar] [CrossRef]
- Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Green Version]
- Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef] [PubMed]
- Stamatakis, A.; Hoover, P.; Rougemont, J. A rapid bootstrap alogarithm for the RAxML webservers. Syst. Biol. 2008, 75, 758–771. [Google Scholar] [CrossRef] [PubMed]
- Cannatella, D. Xenopus in space and time: Fossils, node calibrations, tip-dating, and paleobiogeography. Cytogenet. Genome Res. 2015, 145, 283–301. [Google Scholar] [CrossRef] [PubMed]
- Posada, D.; Crandall, K.A. MODELTEST: Testing the model of DNA substitution. Bioinformatics 1998, 14, 817–818. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nylander, J. MrModeltest v2. Program Distributed by the Author; Evolutionary Biology Centre, Uppsala University: Uppsala, Sweden, 2004. [Google Scholar]
- Vilgalys, R.; Hester, M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J. Bacteriol. 1990, 172, 4238–4246. [Google Scholar] [CrossRef] [Green Version]
- White, T.; Bruns, T.; Lee, S.; Taylor, F.; White, T.; Lee, S.H.; Taylor, L.; Shawetaylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protoc. Guide Methods Appl. 1990, 18, 315–322. [Google Scholar]
- Liu, Y.J.; Whelen, S.; Hall, B.D. Phylogenetic relationships among ascomycetes: Evidence from an RNA polymerse II subunit. Mol. Biol. Evol. 1999, 16, 1799–1808. [Google Scholar] [CrossRef]
- Baird, R.E. Type studies of North American and other related taxa of stipitate hydnums: Genera Bankera, Hydnellum, Phellodon, Sarcodon. Bibl. Mycol. 1986, 103, 1–89. [Google Scholar]
- Rubio Casas, L.; Rubio Roldán, L.; Català, S. Sarcodon amygdaliolens, a new species of Sarcodon Quél. ex P. Karst. found in the Iberian Peninsula. Boletín Soc. Micológica Madr. 2011, 35, 43–56. [Google Scholar]
- Nitare, J.; Ainsworth, A.M.; Larsson, E.; Parfitt, D.; Suz, L.M.; Svantesson, S.; Larsson, K.H. Four new species of Hydnellum (Thelephorales, Basidiomycota) with a note on Sarcodon illudens. Fungal Syst. Evol. 2021, 7, 233–254. [Google Scholar] [CrossRef]
- Hahn, C.; Friebes, G.; Krisai-Greilhuber, I. Sarcodon fennicus, a boreo-montane stipitate hydnoid fungus with a remarkable smell. Austrian Mycol. Soc. 2018, 27, 43–52. [Google Scholar]
- Otto, P. Die Terrestrischen Stachelpilze der DDR—Taxonomie, Ökologie, Verbreitung und Rückgang. Doctoral Dissertation, Martin-Luther-Universität, Halle-Wittenberg, 1990. [Google Scholar]
- Hrouda, P. Hydnaceous fungi of the Czech Republic and Slovakia. Czech Mycol. 1999, 51, 99–155. [Google Scholar] [CrossRef]
- Van der Linde, S.; Alexander, I.J.; Anderson, I.C. Spatial distribution of sporocarps of stipitate hydnoid fungi and their belowground mycelium. FEMS Microbiol. Ecol. 2009, 69, 344–352. [Google Scholar] [CrossRef] [Green Version]
- Thompson, G.W.; Medwe, R.J. Effects of aluminimum and manganese on the growth of ectomycorrhizal fungi. Appl. Environ. Microbiol. 1984, 48, 556–560. [Google Scholar] [CrossRef] [Green Version]
- Jahn, H. Der “Satanspilzhang” bei Glesse (Ottenstein), Siid-Niedersachsen. Westffilische Pilzbr. 1986, 10–11, 289–351. [Google Scholar]
- Termorshuizen, A.J.; Schaffers, A.P. Occurrence of carpophores of mycorrhizal fungi in selected stands of Pinus sylvestris in the Netherlands in relation to stand vitality and air pollution. Plant Soil 1987, 104, 209–217. [Google Scholar] [CrossRef]
- Arnolds, E. The changing macromycete flora in the Netherlands. Trans. Br. Mycol. Soc. 1988, 90, 391–406. [Google Scholar] [CrossRef]
- Hrouda, P. Bankeraceae in central Europe. 1. Czech Mycol. 2005, 57, 57–78. [Google Scholar] [CrossRef]
- Hrouda, P. Bankeraceae in central Europe. 2. Czech Mycol. 2005, 57, 279–297. [Google Scholar] [CrossRef]
- Arnolds, E.; Veerkamp, M. Basisrapport Rode Lijst Paddenstoelen; Ministry of Agriculture, Nature and Food Safety: The Hague, The Netherlands, 2008. [Google Scholar]
- Maas Geesteranus, R.A. Notes on Hydnums–VII. Persoonia 1967, 5, 1–13. [Google Scholar]
- Mleczko, P.; Zubek, S.; Kozak, M. Description of ectomycorrhiza and a new Central European locality of the rare hydnoid species Sarcodon leucopus (Pers.) Maas Geest. et Nannf. (Thelephorales, Basidiomycota). Nova Hedwig. 2011, 92, 257–272. [Google Scholar] [CrossRef]
- Pérez-De-Gregorio, M.A.; Macau, N.; Carbó, J. Sarcodon quercinofibulatum, una nueva especie del género con hifas fibulíferas. Rev. Catalana Micol. 2011, 33, 25–30. [Google Scholar]
Species | Geographic Origin | Voucher Number | GenBank Accessions No. | |||
---|---|---|---|---|---|---|
SSU | ITS | nLSU | RPB2 | |||
Amaurodon aquicoeruleu Agerer | Australia | UK452 | – | AM490944 | AM490944 | – |
A. sumatranus Miettinen & Kõljalg | Indonesia | O. Miettinen5877 | – | AM490943 | – | – |
A. viridis (Alb. & Schwein.) J. Schröt. | Norway | KHLarsson14947b | – | MK602707 | MK602707 | – |
A. viridis | Russia | TAA149664 | – | AM490942 | AY586625 | – |
Bankera fuligineoalba (J.C. Schmidt) Coker & Beers ex Pouzar | Sweden | ELarsson400-13 | – | MK602708 | MK602708 | – |
B. fuligineoalba | Estonia | TAA152454 | – | – | AY586635 | – |
B. violascens (Alb. & Schwein.) Pouzar | Finland | MVijanen130902 | – | MK602709 | MK602709 | – |
B. violascens | – | RGC14-033 | – | MH310793 | – | – |
Boletopsis grisea (Peck) Bondartsev & Singer | Sweden | UPS F-120382 | – | MN536751 | MN535646 | – |
B. grisea | Spain | AH 42971 | – | MN536747 | MN535642 | – |
B. leucomelaena (Pers.) Fayod | Sweden | Krikorev140912 | – | MK602710 | MK602710 | – |
B. nothofagi J.A. Cooper & P. Leonard | New Zealand | PDD:96007 | – | JQ417193 | – | – |
Hydnellum amygdaliolens (Rubio Casas, Rubio Roldán & Català) E. Larss., K.H. Larss. & Kõljalg | Iberian Peninsula | SC-2011 | – | JN376763 | – | – |
H. atrorubrum | China | Wei8315 | – | MW579937 | – | – |
H. atrorubrum | China | Wei8261 | MW579910 | MW579936 | MW579884 | – |
H. atrospinosum | China | Yuan6495 | MW579911 | MW579938 | MW579885 | – |
H. atrospinosum | China | Yuan6514 | MW579913 | MW579940 | MW579886 | – |
H. atrospinosum | China | Yuan6520 | MW579912 | MW579939 | – | – |
H. aurantiacum (Batsch) P. Karst. | Norway | EBendiksen177-07 | – | MK602712 | MK602712 | – |
H. aurantiacum | Norway | OF29502 | – | MK602713 | MK602713 | – |
H. auratile (Britzelm.) Maas Geest. | Norway | OF242763 | – | MK602715 | MK602715 | – |
H. auratile | Norway | OF294095 | – | MK602714 | MK602714 | – |
H. bomiense | China | Yuan 13759 | MW579914 | MW579941 | MW579887 | OK254206 |
H. bomiense | China | Yuan 13767 | MW579915 | MW579942 | – | – |
H. bomiense | Estonia | TUF100611 | – | UDB003287 | – | – |
H. bomiense | Costa Rica | TUF100057 | – | UDB003286 | – | – |
H. brunneorubrum | China | Yuan12997 | MW579917 | MW579944 | MW579889 | OK254217 |
H. brunneorubrum | China | Yuan14339 | MW579916 | MW579943 | MW579888 | OK254216 |
H. brunneorubrum | China | Yuan14668 | MW579918 | MW579945 | MW579890 | OK254218 |
H. caeruleum (Hornem.) P. Karst. | Norway | EBendiksen584-11 | – | MK602719 | MK602719 | – |
H. caeruleum | Norway | EBendiksen575-11 | – | MK602718 | MK602718 | – |
H. caeruleum | China | Wei1474a | – | MW579965 | – | – |
H. chrysinum K.A. Harrison | – | SC071 | – | KJ534291 | – | – |
H. coactum Y.H. Mu & H.S. Yuan | China | Wei8094 | – | MN846278 | MN846287 | – |
H. coactum | China | Shi181 | – | MN846279 | MN846288 | – |
H. complicatum Banker | USA | REB-71 | – | KC571711 | – | – |
H. complicatum | USA | REB-329 | – | KC571712 | – | – |
H. concrescens (Pers.) Banker | USA | SEW 88 | – | AY569025 | – | – |
H. concrescens | Mexico | GO-2009-204 | – | KC152116 | – | – |
H. cristatum (Bres.) Stalpers | USA | REB-169 | – | JN135174 | – | – |
H. cristatum | USA | REB-88 | – | KC571718 | – | – |
H. cumulatum K.A. Harrison | Finland | TU115384 | – | UDB011871 | UDB011871 | – |
H. cumulatum | Estonia | TU111191 | – | UDB032402 | – | – |
H. cyanopodium K.A. Harrison | USA | SEW 85 | – | AY569027 | – | – |
H. diabolus Banker | Canada | KAH13873 | – | AF351863 | – | – |
H. dianthifolium Loizides | Cyprus | ML61211HY | – | KX619419 | – | – |
H. dianthifolium | Italy | ML902162HY | – | KX619420 | – | – |
H. earlianum Banker | USA | REB-75 | – | KC571724 | – | – |
H. earlianum | USA | REB-375 | – | JN135179 | – | – |
H. fagiscabrosum A.M. Ainsw. & Nitare | Sweden | GB-0195621 | – | MW144293 | MW144293 | – |
H. fagiscabrosum | Sweden | GB-0195622 | – | MW144296 | MW144296 | – |
H. fennicum (P. Karst.) E. Larss, K.H. Larss. & Kõljalg | Norway | OF242833 | – | MK602738 | MK602738 | – |
H. fennicum | Norway | OF294087 | – | MK602737 | MK602737 | – |
H. ferrugineum (Fr.) P. Karst. | Norway | OF297319 | – | MK602720 | MK602720 | – |
H. ferrugineum | Sweden | ELarsson197-14 | – | MK602722 | MK602722 | – |
H. ferrugipes Coker | USA | REB-176 | – | KC571727 | – | – |
H. ferrugipes | USA | REB-68 | – | JN135176 | – | – |
H. fibulatum | China | Yuan14646 | MW579926 | MW579957 | – | – |
H. fibulatum | China | Yuan14656 | MW579927 | MW579958 | – | – |
H. fuligineoviolaceum (Kalchbr.) E. Larss., K.H. Larss. & Kõljalg | Sweden | BNylen130918 | – | MK602741 | MK602741 | – |
H. fuligineoviolaceum | Sweden | LA120818 | – | MK602740 | MK602740 | – |
H. fuscoindicum (K.A. Harrison) E. Larss., K.H. Larss. & Kõljalg | USA | OSC 113641 | – | EU669230 | EU669280 | – |
H. fuscoindicum | USA | OSC 107844 | – | EU669229 | EU669279 | – |
H. glaucopus (Maas Geest. & Nannf.) E. Larss., K.H. Larss. & Kõljalg | Sweden | JNitare060916 | – | MK602744 | MK602744 | – |
H. glaucopus | Sweden | Edvinson110926 | – | MK602745 | MK602745 | – |
H. geogenium (Fr.) Banker | – | AFTOL-ID 680 | AY752971 | DQ218304 | AY631900 | DQ408133 |
H. geogenium | Norway | OF296213 | – | MK602724 | MK602724 | – |
H. gracilipes (P. Karst.) P. Karst. | Sweden | ELarsson219-11 | – | MK602726 | MK602726 | – |
H. gracilipes | Sweden | GB-0113779 | – | MK602727 | MK602727 | – |
H. granulosum | China | Yuan12213a | MW579921 | MW579948 | MW579893 | OK254213 |
H. granulosum | China | Yuan12213b | MW579920 | MW579947 | MW579892 | OK254212 |
H. grosselepidotum Y.H. Mu & H.S. Yuan | China | Wei8120 | – | MN846274 | MN846283 | – |
H. grosselepidotum | China | Wei8075 | – | MN846276 | MN846285 | – |
H. illudens (Maas Geest.) Nitare | Sweden | GB-0195819 | – | MW144341 | MW144341 | – |
H. illudens | Norway | O-F-242769 | – | MW144335 | MW144335 | – |
H. inflatum | China | Wang80 | MW579922 | MW579949 | MW579894 | OK254210 |
H. inflatum | China | Shi506 | MW579923 | MW579950 | MW579895 | OK254211 |
H. joeides (Pass.) E. Larss., K.H. Larss. & Kõljalg | Sweden | KHjortstam17589 | – | MK602750 | MK602750 | – |
H. joeides | Sweden | Nitare110829 | – | MK602751 | MK602751 | – |
H. lepidum (Maas Geest.) E. Larss., K.H. Larss. & Kõljalg | Sweden | JNitare110829 | – | MK602754 | MK602754 | – |
H. lepidum | Sweden | RGCarlsson10-065 | – | MK602752 | MK602752 | – |
H. lidongensis Y.H. Mu & H.S. Yuan | China | We8365 | – | MN846280 | MN846289 | – |
H. lidongensis | China | Wei8329 | – | MN846281 | MN846290 | – |
H. lundellii (Maas Geest. & Nannf.) E. Larss., K.H. Larss. & Kõljalg | Norway | OF242639 | – | MK602759 | MK602759 | – |
H. lundellii | Norway | OF295814 | – | MK602760 | MK602760 | – |
H. martioflavum (Snell, K.A. Harrison & H.A.C. Jacks.) E. Larss., K.H. Larss. & Kõljalg | Norway | OF242435 | – | MK602762 | MK602762 | – |
H. martioflavum | Norway | OF242872 | – | MK602761 | MK602761 | – |
H. mirabile (Fr.) P. Karst. | Sweden | SLund140912 | – | MK602730 | MK602730 | – |
H. mirabile | Sweden | ELarsson170-14 | – | MK602729 | MK602729 | – |
H. nemorosum A.M. Ainsw. & E. Larss. | Norway | O-F-242352 | – | MW144372 | MW144372 | – |
H. nemorosum | Sweden | GB-0195631 | – | MW144373 | MW144373 | – |
H. parvum Banker | USA | REB-131 | – | JN135187 | – | – |
H. parvum | USA | REB-392 | – | KC571717 | – | – |
H. peckii Banker | Norway | SSvantesson328 | – | MK602731 | MK602731 | – |
H. peckii | Sweden | ELarsson174-14 | – | MK602732 | MK602732 | – |
H. peckii | China | Yuan13708 | MW579931 | MW579966 | MW579905 | OK254214 |
H. peckii | China | Yuan13720 | MW579932 | MW579967 | MW579906 | OK254215 |
H. pineticola K.A. Harrison | USA | REB-49 | – | KC571733 | – | – |
H. pineticola | USA | REB-43 | – | JN135175 | – | – |
H. piperatum Coker ex Maas Geest. | USA | REB-332 | – | JN135173 | – | – |
H. piperatum | USA | REB-304 | – | KC571723 | – | – |
H. regium K.A. Harrison | USA | SEW 93 | – | AY569031 | – | – |
H. roseoviolaceum Nitare | Sweden | GB-0195936 | – | MW144374 | MW144374 | – |
H. roseoviolaceum | Sweden | GB-0195687 | – | MW144375 | MW144375 | – |
H. rubidofuscum | China | Yuan14561 | MW579924 | MW579951 | MW579896 | OK254207 |
H. rubidofuscum | China | Yuan14587 | MW579925 | MW579952 | MW579897 | OK254208 |
H. rubidofuscum | China | Yuan14654 | – | MW579953 | MW579898 | OK254209 |
H. scabrosum (Fr.) E. Larss., K.H. Larss. & Kõljalg | Norway | OF360777 | – | MK602765 | MK602765 | |
H. scabrosum | Norway | OF292320 | – | MK602766 | MK602766 | |
H. scabrosellum Nitare | Sweden | GB-0195792 | – | MW144380 | MW144380 | – |
H. scabrosellum | Sweden | GB-0195807 | – | MW144381 | MW144381 | – |
H. scleropodium K.A. Harrison | USA | REB-3 | – | JN135186 | – | – |
H. scleropodium | USA | REB-352 | – | KC571740 | – | – |
H. scrobiculatum (Fr.) P. Karst. | USA | REB-78 | – | JN135181 | – | – |
H. spongiosipes (Peck) Pouzar | USA | REB-107 | – | KC571743 | – | – |
H. spongiosipes | USA | REB-52 | – | JN135184 | – | – |
H. spongiosipes | China | Yuan14517 | MW579933 | MW579968 | MW579907 | OK254219 |
H. squamulosum | China | Yuan13615 | – | MW579954 | – | – |
H. squamulosum | China | Yuan13625 | – | MW579956 | MW579899 | OK254204 |
H. squamulosum | China | Yuan13743 | – | MW579955 | – | OK254203 |
H. suaveolens (Scop.) P. Karst. | Sweden | ELarsson8-14 | – | MK602735 | MK602735 | – |
H. suaveolens | Norway | SSvantesson877 | – | MK602736 | MK602736 | – |
H. subsuccosum K.A. Harrison | USA | SEW 55 | – | AY569033 | – | – |
H. subsuccosum | USA | REB-10 | – | JN135178 | – | – |
H. sulcatum | China | Yuan14521 | MW579930 | MW579961 | MW579902 | OK254202 |
H. sulcatum | China | Yuan14649 | MW579929 | MW579960 | MW579901 | – |
H. sulcatum | China | Yuan14660 | MW579928 | MW579959 | MW579900 | OK254201 |
H. yunnanense | China | Yuan14386 | – | MW579962 | MW579903 | OK254199 |
H. yunnanense | China | Yuan14396 | – | MW579963 | MW579904 | OK254200 |
H. yunnanense | China | Shi212 | – | MW579964 | – | – |
H. underwoodii (Banker) E. Larss., K.H. Larss. & Kõljalg | USA | REB-358 | – | JN135189 | – | – |
H. underwoodii | USA | REB-119 | – | KC571782 | – | – |
H. versipelle (Fr.) E. Larss., K.H. Larss. & Kõljalg | Sweden | RGCarlsson13-057 | – | MK602771 | MK602771 | – |
H. versipelle | Sweden | RGCarlsson11-08 | – | MK602772 | MK602772 | – |
Hydnellum sp 1 | China | Shi164 | – | MW579969 | – | – |
Hydnellum sp 2 | China | Yuan14387 | MW579934 | MW579970 | MW579908 | – |
Hydnellum sp 3 | China | Yuan14388 | – | MW579971 | – | – |
Hydnellum sp 4 | China | Wang295 | – | MW579972 | – | – |
Hydnellum sp 5 | China | Yuan14594 | MW579935 | MW579973 | MW579909 | OK254205 |
Lenzitopsis daii L.W. Zhou & Kõljalg | China | Yuan 2959 | – | JN169799 | JN169795 | – |
L. daii | China | Yuan2952 | – | JN169798 | JN169794 | – |
L. oxycedri Malençon & Bertault | Spain | KHLarsson15304 | – | MK602774 | MK602774 | – |
L. oxycedri | – | UK 635 | – | JN169800 | JN169796 | – |
Odontia fibrosa (Berk. & M.A. Curtis) Kõljalg | China | TU115028 | – | MK602775 | MK602775 | |
O. fibrosa | China | LL_17 | – | MT678878 | – | – |
O. sparsa Yuan, Y.C. Dai & H.S. Yuan | China | Yuan10718 | – | MG719980 | – | – |
O. sparsa | China | Yuan10780 | – | MG719979 | – | – |
Phellodon cf. niger | Sweden | ELarsson35-14 | – | MK602782 | MK602782 | – |
P. tomentosus (L.) Banker | Norway | EBendiksen11-810 | – | MK602781 | MK602781 | – |
P. tomentosus | – | BG Thesis | – | – | AF518637 | – |
Polyozellus mariae Voitk & Kõljalg | Canada | TU117348 | – | MF100831 | MF100831 | – |
P. mariae | Canada | TU117235 | – | MF100826 | – | – |
P. multiplex (Underw.) Murrill | USA | TU117350 | – | MF100830 | MF100830 | – |
P. multiplex | China | TU115049 | – | MF100812 | MF100812 | – |
Pseudotomentella abundiloba Svantesson | Norway | OF110312 | MK290731 | MK290731 | ||
P. flavovirens (Höhn. & Litsch.) Svrček | Finland | KHLarsson16190 | – | MK602780 | MK602780 | – |
P. rotundispora Svantesson | Sweden | SS394 | – | MK290728 | MK290728 | – |
P. rotundispora | Sweden | SS413 | – | MK290674 | – | – |
P. umbrinascens Svantesson | Sweden | SS335 | – | MK290697 | MK290697 | – |
Sarcodon aspratus (Berk.) S. Ito | – | – | – | DQ448877 | – | – |
S. aspratus | – | – | – | AF335110 | – | – |
S. imbricatus (L.) P. Karst. | Norway | SSvantesson355 | – | MK602748 | MK602748 | – |
S. imbricatus | Sweden | ELarsson384-10 | – | MK602747 | MK602747 | – |
S. leucopus (Pers.) Maas Geest. & Nannf. | Norway | OF296099 | – | MK602755 | MK602755 | – |
S. leucopus | Sweden | PHedberg080811 | – | MK602757 | MK602757 | – |
S.quercinofibulatus Pérez-De-Greg., Macau & J. Carbó | Italy | JC-20090718.2 | – | JX271818 | MK602773 | – |
S. quercinofibulatus | USA | TENN | – | MG663244 | – | – |
S. scabripes (Peck) Banker | Mexico | FCME:23240 | – | EU293829 | – | – |
S. scabripes | USA | REB-351 | – | JN135191 | – | – |
S.squamosus (Schaeff.) P. Karst. | Norway | OF295554 | – | MK602769 | MK602769 | – |
S. squamosus | Norway | OF177452 | – | MK602768 | MK602768 | – |
Steccherinum murashkinskyi (Burt) Maas Geest. | Russia | X449 | – | JN710588 | JN710588 | – |
S. ochraceum (Pers. ex J.F. Gmel.) Gray | Sweden | KHL11902 | – | JQ031130 | JQ031130 | – |
Thelephora ganbajun M. Zang | China | GDGM 48899 | – | MF593267 | MH620355 | – |
T. ganbajun | China | GDGM 48891 | – | MF593266 | MH620354 | – |
T. iqbalii Nasir & Hanif | Pakistan | MH810 | – | JX241471 | – | – |
T. terrestris Ehrh. | Denmark | DMS-9327942 | – | MT644883 | MT644883 | – |
T. terrestris | Norway | ELarsson295-13 | – | MK602777 | MK602777 | – |
Tomentella fuscocrustosa H.S. Yuan, X. Lu & Y.C. Dai | China | Yuan11399 | – | MK211712 | MK446366 | – |
T. fuscocrustosa | China | Yuan11420 | – | MK211713 | MK446367 | – |
T.patagonica Kuhar & Rajchenb. | Argentina | BAFC52372 | – | KT032090 | KT032102 | – |
T. patagonica | Argentina | BAFC52373 | – | KT032091 | KT032103 | – |
Tomentellopsis bresadoliana (Sacc. & Trotter) Jülich & Stalpers | Sweden | JEH 031011 | – | EU118674 | EU118674 | – |
T. pulchella Kõljalg & Bernicchia | Norway | KHLarsson16366 | – | MK602779 | MK602779 | – |
Genes | Primers | Primer Sequences (5’-3’) | References |
---|---|---|---|
nLSU | LROR | ACCCGCTGAACTTAAGC | Vilgalys & Hester 1990 [48] |
LR7 | TACTACCACCAAGATCT | Vilgalys & Hester 1990 [48] | |
ITS | ITS1-F | CTTGGTCATTTAGAGGAAGTAA | White et al. 1990 [49] |
ITS4 | TCCTCCGCTTATTGATATGC | White et al. 1990 [49] | |
nSSU | NS1 | GTAGTCATATGCTTGTCTC | White et al. 1990 [49] |
NS4 | CTTCCGTCAATTCCTTTAAG | White et al. 1990 [49] | |
RPB2 | bRPB2-6F | TGGGGYATGGTNTGYCCYGC | Liu et al. 1999 [50] |
bRPB2-7.1R | CCCATRGCYTGYTTMCCCATDGC | Liu et al. 1999 [50] |
Group | Subgenus | Species | Pileus | Spines | References |
---|---|---|---|---|---|
I | Croceum | Hydnellum aurantiacum | simple-septa | simple-septa | Maas Geesteranus 1975 [1] |
H. auratile | simple-septa | simple-septa | Maas Geesteranus 1971 [26] | ||
H. brunneorubrum | simple-septa | simple-septa | In this study | ||
H. chrysinum | simple-septa | simple-septa | Baird 1986 [51] | ||
H. earlianum | simple-septa | simple-septa | Baird et al. 2013 [27] | ||
Inflatum | H. cristatum | simple-septa | simple-septa | Baird et al. 2013 [27] | |
H. granulosum | simple-septa | simple-septa | In this study | ||
H. inflatum | simple-septa | simple-septa | In this study | ||
H. piperatum | simple-septa | simple-septa | Baird et al. 2013 [27] | ||
H. mirabile | simple-septa | simple-septa | Maas Geesteranus 1975 [1] | ||
Rhizomorphum | H. gracilipes | simple-septa | simple-septa | Koljalg & Renvall 2000 [35] | |
Hydnellum sp 1 | simple-septa | simple-septa | In this study | ||
Scabrosum | H. amygdaliolens | simple-septa | simple-septa | Rubio Casas et al. 2011 [52] | |
H. coactum | simple-septa | simple-septa | Mu et al. 2020 [38] | ||
H. fagiscabrosum | simple-septa | simple-septa | Nitare et al. 2021 [53] | ||
H. fennicum | simple-septa | simple-septa | Hahn et al. 2018 [54] | ||
H. grosselepidotum | simple-septa | simple-septa | Mu et al. 2020 [38] | ||
H. illudens | simple-septa | simple-septa | Nitare et al. 2021 [53] | ||
H. lepidum | simple-septa | simple-septa | Maas Geesteranus 1975 [1] | ||
H. lidongensis | simple-septa | simple-septa | Mu et al. 2020 [38] | ||
H. nemorosum | simple-septa | simple-septa | Nitare et al. 2021 [53] | ||
H. scabrosellum | simple-septa | simple-septa | Nitare et al. 2021 [53] | ||
H. scabrosum | simple-septa | simple-septa | Baird et al. 2013 [27] | ||
H. underwoodii | simple-septa | simple-septa | Baird et al. 2013 [27] | ||
Spongiosum | H. ferrugineum | simple-septa | simple-septa | Baird et al. 2013 [27] | |
H. pineticola | simple-septa | simple-septa | Baird et al. 2013 [27] | ||
H. spongiosipes | simple-septa | simple-septa | Baird et al. 2013 [27] | ||
Hydnellum sp 2 | simple-septa | simple-septa | In this study | ||
Violaceum | H. fuligineoviolaceum | simple-septa | simple-septa | Maas Geesteranus 1971 [26] | |
H. fuscoindicum | simple-septa | simple-septa | Maas Geesteranus 1967 [65] | ||
H. glaucopus | simple-septa | simple-septa | Maas Geesteranus 1975 [1] | ||
H. joeides | simple-septa | simple-septa | Baird et al. 2013 [27] | ||
H. roseoviolaceum | simple-septa | simple-septa | Nitare et al. 2021 [53] | ||
Zonatum | H. atrorubrum | simple-septa | simple-septa | In this study | |
H. bomiense | simple-septa | simple-septa | In this study | ||
H. concrescens | simple-septa | simple-septa | Baird et al. 2013 [27] | ||
H. dianthifolium | simple-septa | simple-septa | Loizides et al. 2016 [36] | ||
H. parvum | simple-septa | simple-septa | Baird et al. 2013 [27] | ||
H. rubidofuscum | simple-septa | simple-septa | In this study | ||
H. scrobiculatum | simple-septa | simple-septa | Baird et al. 2013 [27] | ||
H. squamulosum | simple-septa | simple-septa | In this study | ||
H. subsuccosum | simple-septa | simple-septa | Baird et al. 2013 [27] | ||
H. sulcatum | simple-septa | simple-septa | In this study | ||
H. yunnanense | simple-septa | simple-septa | In this study | ||
Hydnellum sp 3 | simple-septa | simple-septa | In this study | ||
Hydnellum sp 4 | simple-septa | simple-septa | In this study | ||
Hydnellum sp 5 | simple-septa | simple-septa | In this study | ||
Others | H. complicatum | simple-septa | simple-septa | Baird et al. 2013 [27] | |
H. cumulatum | simple-septa | simple-septa | Baird et al. 2013 [27] | ||
H. lundellii | simple-septa | simple-septa | Maas Geesteranus 1975 [1] | ||
H. martioflavum | simple-septa | simple-septa | Baird et al. 2013 [27] | ||
II | Subindufibulatum | H. caeruleum | simple-septa, occasionally with clamp-connections | simple-septa | Baird & Khan 1986 [2]; In this study |
H. ferrugipes | simple-septa, occasionally with clamp-connections | simple-septa | Baird et al. 2013 [27] | ||
H. fibulatum | simple-septa, occasionally with clamp-connections | simple-septa | In this study | ||
III | Others | H. peckii | mostly with clamp-connections, minority of simple-septa | mostly with clamp-connections, minority of simple-septa | Baird et al. 2013 [27]; In this study |
H. versipelle | mostly with clamp-connections, minority of simple-septa | mostly with clamp-connections, minority of simple-septa | Baird et al. 2013 [27] | ||
IV | Others | H. diabolus | clamp-connections | simple-septa | Baird et al. 2013 [27] |
V | Hydnellum | H. atrospinosum | clamp-connections | clamp-connections | In this study |
H. suaveolens | clamp-connections | clamp-connections | Baird et al. 2013 [27] | ||
Caesispinosum | H. cyanopodium | clamp-connections | clamp-connections | Baird 1986 [51] | |
H. scleropodium | clamp-connections | clamp-connections | Harrison 1964 [33] | ||
Others | H. geogenium | clamp-connections | clamp-connections | Baird et al. 2013 [27] | |
Sarcodon | Sarcodon aspratus | clamp-connections | clamp-connections | Maas Geesteranus 1971 [26] | |
S. imbricatus | clamp-connections | clamp-connections | Baird et al. 2013 [27] | ||
S. leucopus | clamp-connections | clamp-connections | Mleczko et al. 2011 [66] | ||
S. quercinofibulatus | clamp-connections | clamp-connections | Pérez-De-Gregorio et al. 2011 [67] | ||
S. scabripes | clamp-connections | clamp-connections | Baird et al. 2013 [27] | ||
S. squamosus | clamp-connections | clamp-connections | Baird 1986 [34] | ||
Others | H. regium | hyphae with few simple-septa and with a few clamp-connections | Harrison 1964 [33] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mu, Y.-H.; Yu, J.-R.; Cao, T.; Wang, X.-H.; Yuan, H.-S. Multi-Gene Phylogeny and Taxonomy of Hydnellum (Bankeraceae, Basidiomycota) from China. J. Fungi 2021, 7, 818. https://doi.org/10.3390/jof7100818
Mu Y-H, Yu J-R, Cao T, Wang X-H, Yuan H-S. Multi-Gene Phylogeny and Taxonomy of Hydnellum (Bankeraceae, Basidiomycota) from China. Journal of Fungi. 2021; 7(10):818. https://doi.org/10.3390/jof7100818
Chicago/Turabian StyleMu, Yan-Hong, Jia-Rui Yu, Ting Cao, Xiang-Hua Wang, and Hai-Sheng Yuan. 2021. "Multi-Gene Phylogeny and Taxonomy of Hydnellum (Bankeraceae, Basidiomycota) from China" Journal of Fungi 7, no. 10: 818. https://doi.org/10.3390/jof7100818