Next Article in Journal
Diterpenes Specially Produced by Fungi: Structures, Biological Activities, and Biosynthesis (2010–2020)
Next Article in Special Issue
Multigene Phylogeny Reveals Endophytic Xylariales Novelties from Dendrobium Species from Southwestern China and Northern Thailand
Previous Article in Journal
Study of Dimorphism Transition Mechanism of Tremella fuciformis Based on Comparative Proteomics
Previous Article in Special Issue
Current Insight into Traditional and Modern Methods in Fungal Diversity Estimates
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Taxonomic Reappraisal of Periconiaceae with the Description of Three New Periconia Species from China

by
Er-Fu Yang
1,2,3,4,5,
Rungtiwa Phookamsak
4,6,7,
Hong-Bo Jiang
4,8,9,
Saowaluck Tibpromma
1,4,6,7,
Darbhe J. Bhat
10,
Samantha C. Karunarathna
1,4,6,7,
Dong-Qin Dai
1,*,
Jian-Chu Xu
4,6,7 and
Itthayakorn Promputtha
2,3,*
1
Center for Yunnan Plateau Biological Resources Protection and Utilization, College of Biological Resource and Food Engineering, Qujing Normal University, Qujing 655011, China
2
Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200, Thailand
3
Research Center in Bioresources for Agriculture, Industry and Medicine, Chiang Mai University, Chiang Mai 50200, Thailand
4
Honghe Center for Mountain Futures, Kunming Institute of Botany, Chinese Academy of Sciences, Honghe 654400, China
5
Master of Science Program in Applied Microbiology (International Program), Faculty of Science, Chiang Mai University, Chiang Mai 50200, Thailand
6
CIFOR-ICRAF China Program, World Agroforestry (ICRAF), Kunming 650201, China
7
Centre for Mountain Futures (CMF), Kunming Institute of Botany, Kunming 650201, China
8
Center of Excellence in Fungal Research, Mae Fah Luang University, Chiang Rai 57100, Thailand
9
School of Science, Mae Fah Luang University, Chiang Rai 57100, Thailand
10
No. 128/1-J, Azad Housing Society, Curca, P.O. Box, Goa Velha 403108, India
*
Authors to whom correspondence should be addressed.
J. Fungi 2022, 8(3), 243; https://doi.org/10.3390/jof8030243
Submission received: 27 January 2022 / Revised: 19 February 2022 / Accepted: 23 February 2022 / Published: 28 February 2022
(This article belongs to the Special Issue Polyphasic Identification of Fungi)

Abstract

:
As a result of an ongoing research survey of microfungi in Yunnan, China, several saprobic ascomycetes were collected from various host substrates. Preliminary morphological analyses identified a few of these taxa as Periconia species. We obtained DNA sequence data of the Periconia species from pure cultures and investigated their phylogenetic affinities. Phylogenetic analyses of a combined LSU, ITS, SSU and tef1-α sequence dataset demonstrated that five isolates of Periconia formed well-resolved subclades within Periconiaceae. Accordingly, three new Periconia species are introduced viz. P. artemisiae, P. chimonanthi and P. thysanolaenae, and new host and geographical records of P. byssoides and P. pseudobyssoides, are also reported from dead branches of Prunus armeniaca and Scrophularia ningpoensis. Periconia celtidis formed a monophyletic clade with P. byssoides in the present phylogenetic analyses. Results of the pairwise homoplasy index (PHI) test indicated significant recombination between P. byssoides and P. celtidis. Therefore, P. celtidis has been synonymized under P. byssoides. In addition, we re-illustrated and studied the type specimen of the sexual genus Bambusistroma. As a type species of Bambusistroma, B. didymosporum features similar morphology to the sexual morph of Periconia homothallica and P. pseudodigitata. We therefore synonymize Bambusistroma under Periconia based on morphological and phylogenetic evidence. Furthermore, our new isolates produced brown conidia of asexual morph in agar media typical of the genus Noosia. Based on morphological comparison with Periconia in vitro and phylogenetic status of Noosia, we also treat Noosia as a synonym of Periconia. Detailed descriptions and illustrations of three novel taxa and two new records of Periconia byssoides and P. pseudobyssoides as well as the illustration of P. didymosporum comb. nov. are provided. An updated phylogenetic tree of Periconiaceae using maximum likelihood and Bayesian inference analyses is constructed. Generic circumscription of Periconia is amended.

1. Introduction

Periconiaceae Nann. was introduced by Nannizzi [1] and is typified by Periconia Tode. The family is classified as the suborder Massarineae, order Pleosporales, class Dothideomycetes in Ascomycota [2]. Taxa in this family are well known as saprobes occurring on various hosts worldwide [2,3]. Only a few species, such as Flavomyces fueloephazae D.G. Knapp et al., Periconia circinata (L. Mangin) Sacc. and D. Sacc., P. digitata (Cooke) Sacc. and P. macrospinosa Lefebvre and Aar. G. Johnson, were reported as endophytes and pathogens [2,4,5,6]. Some Periconia species such as P. atropurpurea (Berk. and M.A. Curtis) M.A. Litv., P. byssoides Pers. and P. macrospinosa also produce valuable bioactive compounds that possess powerful pharmacological activities [2,7,8,9,10,11].
Periconiaceae is poorly studied and has long been neglected in modern taxonomic treatment [12]. Saccardo [13] initially assigned ‘Periconieae Sacc.’ to accommodate dematiaceous hyphomycetes, forming macronematous conidiophores with conidial heads and 1-celled, pigmented conidia. Later, Nannizzi [1] raised ‘Periconieae’ to the familial rank as Periconiaceae and accommodated Periconia and Stachybotrys Corda in this family. Stachybotrys is currently accommodated in its own family Stachybotryaceae (as ‘Stachybotriaceae’) [14]. Tanaka et al. [12] emended the family Periconiaceae (=Periconieae) and re-circumscribed the modern taxonomic description of the family in the suborder Massarineae based on molecular data coupled with morphological characteristics of the sexual-asexual morph.
Four genera, including Bambusistroma D.Q. Dai and K.D. Hyde [15], Flavomyces D.G. Knapp et al. [4], Noosia Crous, R.G. Shivas and McTaggart [16] and Periconia were accepted in the family Periconiaceae based on phylogenetic analyses [2,12,17]. However, the monotypic genera Bambusistroma, Flavomyces and Noosia are always cladded with Periconia species [18,19,20,21,22]. Tanaka et al. [12] mentioned that Periconia might be polyphyletic, although the generic type of Periconia, P. lichenoides Tode lacks the necessary molecular data to confirm phylogenetic affinities. Hence, the phylogenetic statuses of Bambusistroma, Flavomyces and Noosia require further study.
Taxa in Periconiaceae are mainly reported by their noosia-like or periconia-like asexual morphs that are characterized by macronematous, mononematous, pigmented, septate, branched, or unbranched, smooth to echinulate, thick-walled conidiophores, or sometimes lacking conidiophores; conidiophores bearing monoblastic to polyblastic, integrated or discrete conidiogenous cells on stipe and branches, with ovoid to clavate or spherical conidial heads, with small, pimple-like buds and catenated or solitary, golden brown to dark brown, globose to subglobose, or fusoid-ellipsoidal, aseptate, smooth-walled or verruculose, or echinulate conidia, sometimes with a minute, unthickened pore at the base [2,12].
The sexual morphs of Periconiaceae have only been reported for Bambusistroma and some species of Periconia such as P. homothallica Kaz. Tanaka and K. Hiray. and P. pseudodigitata Kaz. Tanaka and K. Hiray. The sexual morph of Periconiaceae is characterized by immersed to erumpent, scattered to grouped, subglobose to globose ascomata, with central, periphysate ostiolar neck, thin-walled of peridium, 8-spored, bitunicate, fissitunicate, oblong to cylindrical, short-pedicellate asci, with the well-developed ocular chamber, embedded in cellular pseudoparaphyses and hyaline, fusiform, septate, smooth-walled ascospores with an entire sheath [2,12,15].
The genus Periconia, introduced by Tode [23], is typified by P. lichenoides that was found on stems of herbaceous plants. Unfortunately, the type specimen was lost and only Tode’s drawings were left as the iconotype for morphological studies [24]. Currently, the genus has 206 epithets available in Index Fungorum (http://www.indexfungorum.org/Names/Names.asp; accessed on 20 January 2022). However, about 36 species previously placed in Periconia have been transferred to other genera in Dothideomycetes, Pezizomycetes, Sordariomycetes and Ascomycota genera incertae sedis as well as synonymized to other Periconia species [13,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39]. To date, Periconia comprises 117 morphological species [39], of which only 24 species have so far been confirmed of phylogenetic affinities based on molecular data [2,40]. Species of Periconia are usually known as saprobes on a variety of plant substrates and have a wide distribution across temperate and tropical regions [3,24,41].
A monotypic genus Bambusistroma typified by B. didymosporum D.Q. Dai and K.D. Hyde was invalidly (art. F.5.1, Shenzhen) introduced by Adamčík et al. [15] but it was validated by Index Fungorum [42]. The genus was introduced to accommodate a sexual bambusicolous taxon from Thailand and is characterized by stromatic, uni-loculate, subglobose to conical, immersed to erumpent ascomata, with a minute papillate ostiole, 8-spored, bitunicate, cylindrical asci, and hyaline, fusiform, 1-septate ascospores, surrounded by distinct mucilaginous sheath [15]. An asexual morph of Bambusistroma has not yet been reported. Adamčík et al. [15] treated the genus in Massarinaceae, while Tanaka et al. [12] placed the genus in Periconiaceae based on phylogenetic evidence. Currently, only a putative species, B. didymosporum, is accommodated in this genus. Bambusistroma always formed a clade with Flavomyces and other Periconia species in Periconiaceae [12,20,21,22,43]. The phylogenetic status of Bambusistroma, therefore, remains questionable.
The asexual genus Noosia was introduced by Crous et al. [16] to accommodate the putative species N. banksiae Crous, R.G. Shivas and McTaggart, associated with leaf spots of Banksia aemula in Australia. The genus is characterized by hyaline to brown, smooth, branched mycelium, becoming verruculose and aggregated into hyphal strands with age, solitary, integrated, inconspicuous, lateral or terminal conidiogenous cells, with small, pimple-like pores, and dimorphic conidia, borne solitary or in short chains. The conidial type I is aseptate, globose, subhyaline, smooth, becoming fusoid-ellipsoidal, brown, verruculose, solitary or in short, branched chains. The conidial type II is arising as phragmoconidia from disarticulating hyphal cells, brown, verruculose apex obtuse, truncate base, with minute, unthickened pore [16]. Noosia often forms a clade with other Periconia species, and thus, the phylogenetic status of the genus also remains unclarified [12,20,21,43].
The aims of this study are to introduce three novel species, two new host and geographical records of Periconia based on multigene phylogenetic analyses and morphological characteristics. In addition, a taxonomic revision of two monotypic genera, Bambusistroma and Noosia, is resolved with these two genera being treated as synonyms of Periconia based on typical morphological characteristics and phylogenetic evidence.

2. Materials and Methods

2.1. Sample Collection, Morphological Characterization, Isolation and Preservation

Fungal specimens were collected from Chuxiong, Kunming and Xishuangbanna in Yunnan Province, China, and stored in disposable plastic Zip-loc bags. The specimens were observed and examined after 1–2 days incubation at room temperature in the laboratory. The microscopic morphological features (e.g., conidiophores, conidiogenous cells, conidia) were examined with an OLYMPUS SZ61 stereomicroscope and Nikon ECLIPSE Ni compound microscope equipped with a Canon DS126311 digital camera. In addition, Bambusistroma didymosporum and Noosia banksiae were re-illustrated. Morphological features viz. ascomata, peridium, pseudoparaphyses, asci, ascospores (sexual morph); conidiophores, conidiogenous cells and conidia (asexual morph) were measured using Tarosoft (R) Image Frame Work (IFW) version 0.9.7, and the photographic plates were processed with Adobe Photoshop CS6 Extend version 10.0 software (Adobe systems, San Jose, CA, USA).
Pure cultures of the new isolates were obtained by single spore isolation [44]. The conidial masses on the surface of fungal hosts were picked up using a sterilized surgical needle and soaked in sterilized water droplets for spore suspension. The spore suspension was spread onto the surface of potato dextrose agar plates (PDA) and incubated overnight at room temperature. Germinated conidia were singularly transferred to two new PDA plates (five conidia in each plate) and incubated at room temperature in normal day/night-light cycle. The colony developed of single conidium was transferred to new PDA plates and incubated at room temperature for one week. Culture characteristics and growth were recorded at one week and after four weeks. The in vitro sporulation was observed after three months. The pure cultures were preserved in PDA, sterilized 10% glycerol, and double-distilled water (ddH2O) for short- and long-term storage.
Herbarium specimens were deposited at the herbarium of Cryptogams Kunming Institute of Botany Academia Sinica (KUN-HKAS), Yunnan, China, while the pure cultures were deposited at Kunming Institute of Botany Culture Collection (KUMCC), Kunming, China. The novel taxa were registered in Index Fungorum (http://www.indexfungorum.org/names/IndexFungorumRegisterName.asp; accessed on 10 December 2021).

2.2. DNA Extraction and PCR Amplification

Fresh mycelia (50–100 mg) were scraped from pure colonies growing on PDA after 4 weeks and stored in 1.5 mL sterilized microcentrifuge tubes for the genomic DNA extraction. The genomic DNA was extracted using Biospin Fungus Genomic DNA Extraction Kit–BSC14S1 (BioFlux®, Hangzhou, China), following the protocol in the manufacturer. The genomic DNA solution was stored at 4 °C for the PCR amplification and maintained at −20 °C for long-term storage.
Genomic DNA was amplified by polymerase chain reaction (PCR) for four gene regions, including the partial 28s large subunit nuclear ribosomal DNA (LSU), the 18s small subunit nuclear ribosomal DNA (SSU), the internal transcribed spacers (ITS) and the translation elongation factor 1-alpha (tef1-α). The primer pairs LR0R/LR5 [45], NS1/NS4 [46], ITS5/ITS4 [46] and EF1-983F/EF1-2218R [47] were used to amplify the sequence fragments of LSU, SSU, ITS and tef1-α, respectively.
The reactions of PCR amplification were performed in a 25 µL total volume, containing 8.5 µL of sterilized double-distilled water (ddH2O), 12.5 µL of 2 × Power Taq PCR MasterMix (mixture of EasyTaqTM DNA Polymerase, dNTPs, and optimized buffer, Beijing Bio Teke Corporation (Bio Teke, Wuxi, China), 1 μL of each forward and reverse primers (10 μM) and 2 μL of DNA template (50 ng/μL). The polymerase chain reaction (PCR) thermal cycle program for ITS, LSU, SSU and tef1-α followed Tibpromma et al. [48]. The amplified PCR products were purified and sequenced by a commercial sequencing provider (TsingKe Biological Technology Co., Beijing, China). Newly generated sequences were deposited in GenBank (Table 1).

2.3. Sequence Alignment and Phylogenetic Analyses

The generated consensus sequences were obtained via BioEdit v. 7.0.9.0 [49] and subjected to a basic local alignment search tool (nucleotide BLAST; https://blast.ncbi.nlm.nih.gov/Blast.cgi; accessed on 11 June 2021) for delineating closely related taxa. Based on the nucleotide BLAST search, new isolates belong to the genus Periconia, and a corresponding sequence dataset of newly generated taxa and other closely related taxa in Periconiaceae (Table 1) was generated for further phylogenetic analyses based on recent publications [6,43,50,51,52].
Individual sequence datasets were aligned separately via MAFFT online version 7.475 using default settings (http://mafft.cbrc.jp/alignment/server; accessed on 25 June 2021) [53] and improved where necessary using BioEdit v. 7.0.9.0 [49]. Individual sequence datasets were prior analyzed by maximum likelihood (ML) criterion for checking the congruence of tree topologies and further phylogenetic analyses of the concatenated LSU, SSU, ITS and tef1-α sequence dataset were performed by maximum likelihood (ML) and Bayesian inference (BI) criteria.
Maximum likelihood (ML) was analyzed by RAxML-HPC2 on XSEDE (8.2.10) [54,55] via the CIPRES science Gateway V.3.3 web server [56] using default settings, but with adjustments by setting up the substitution evolution model as GTRGAMMAI and 1000 replicates of rapid bootstrap. The evolutionary model of nucleotide substitution was selected independently for each locus (LSU, SSU, ITS and tef1-α) using MrModeltest 2.3 [57]. The best-fit model is the GTR + I + G substitution model for each locus under the Akaike Information Criterion (AIC).
Bayesian inference (BI) was performed by MrBayes on XSEDE (3.2.7a) via the CIPRES science Gateway V.3.3 web server [56]. Bayesian posterior probabilities (BYPP) [58,59] were evaluated by Markov Chain Monte Carlo sampling (MCMC). Parameters were set as defaults, but with the adjustments as two parallel runs of six simultaneous Markov chains. Starting random tree topology was run with 3,000,000 generations for a combined dataset, and trees were sampled every 100 generations (resulting in 30,000 total trees). The effective sampling sizes (ESS) and the stable likelihood plateaus and burn-in value were determined by Tracer version 1.7.1 software [60]. The first 6000 sampled trees (20%) representing the burn-in were discarded and the remaining trees were used to calculate the Bayesian posterior probabilities (BYPP) in a 50% majority rule consensus tree. The final alignment and phylogram were submitted to TreeBASE (https://www.treebase.org/, accessed on 22 February 2022, submission ID: 29297). Phylogram was visualized in FigTree v. 1.4.0 (http://tree.bio.ed.ac.uk/software/figtree/; accessed on 22 February 2022) and reorganized in Microsoft Office PowerPoint 2017 (Microsoft Inc., Redmond, WA, USA).

2.4. Genealogical Concordance Phylogenetic Species Recognition (GCPSR) Analysis

The recombination level within phylogenetically closely related species of newly generated strains KUMCC 20-0263 and KUMCC 20-0264 with Periconia byssoides Pers. (MAFF 243869, MFLUCC 18-1548, MFLUCC 18-1553, MFLUCC 17-2292), P. celtidis Tennakoon, C.H. Kuo and K.D. Hyde (MFLUCC 20-0172, NCYUCC 19-0314), P. pseudobyssoides Markovsk. and A. Kačergius (DUCC 0850, MAFF 243868, MAFF 243874) and P. salina Dayarathne and E.B.G. Jones (MFLU 19-1235) was determined by a pairwise homoplasy index (PHI) test [61] performed in SplitsTree4 [62,63], using the GCPSR model [64]. The combined ITS, LSU, SSU and tef1-α sequence dataset of these phylogenetically closely related species was applied for the test to refine incompatibility between pairs of sites regarding a genealogical history does not involve recurrent or convergent mutations that can be parsimoniously inferred [61]. The split graph showing relationships between newly generated strains KUMCC 20-0263, KUMCC 20-0264 and other closely related species was visualized and constructed in LogDet transformation and splits decomposition options. The pairwise homoplasy index resulted in a threshold lower than 0.05 (Φw < 0.05), indicating significant recombination in the dataset.

3. Results

3.1. Phylogenetic Analyses

The concatenated ITS, LSU, SSU and tef1-α sequence dataset consisted of 69 strains of representative taxa in Periconiaceae, and the other two related families, Didymosphaeriaceae and Massarinaceae, included five new generated strains (Periconia artemisiae KUMCC 20-0265, P. byssoides KUMCC 20-0264, P. chimonanthi KUMCC 20-0266, P. pseudobyssoides KUMCC 20-0263 and P. thysanolaenae KUMCC 20-0262), with Morosphaeria ramunculicola (K.D. Hyde) Suetrong et al. (KH 220) and M. velatispora (K.D. Hyde and Borse) Suetrong et al. (KH 221) as the outgroup taxa. The concatenated sequence matrix comprises 4005 total characters, including gaps (651 characters for ITS, 906 characters for LSU, 1405 characters for SSU, 1043 characters for tef1-α). Phylogenetic investigation based on maximum likelihood analysis conducted the best RAxML tree with a final likelihood value of −17,280.650596, presented in Figure 1. The matrix had 1095 distinct alignment patterns, with 43.72% undetermined characters or gaps. Estimated base frequencies were as follows: A = 0.238246, C = 0.255371, G = 0.267517, T = 0.238865; substitution rates AC = 1.513277, AG = 2.455316, AT = 1.810928, CG = 1.226908, CT = 9.347925, GT = 1.000000; gamma distribution shape parameter α = 0.201661. The final average standard deviation of split frequencies at the end of total MCMC generations was calculated as 0.009307 in BI analysis.
Phylogenetic analyses of the concatenated ITS, LSU, SSU and tef1-α sequence dataset based on ML and BI were similar in overall tree topologies. Periconia artemisiae sp. nov. (KUMCC 20-0265) formed a distinct clade with Periconia sp. (strains Otu0123, G1782 and C75) with high support (100% ML, 1.00 PP; Figure 1). Periconia artemisiae also formed a well-resolved clade with P. alishanica Tennakoon, C.H. Kuo and K.D. Hyde, P. pseudobyssoides, P. salina, P. byssoides and P. celtidis with high support (100% ML, 1.00 PP). Periconia chimonanthi sp. nov. shared the same branch length with Periconia sp. CY137 (isolated from the nest of Cyphomyrmex wheeleri in Texas, USA) and is sister to P. cortaderiae Thambug. and K.D. Hyde with high support in BI analysis but shows insignificant support in ML analysis (62% ML, 0.99 PP; Figure 1). While P. thysanolaenae sp. nov. formed a separate branch sister to P. minutissima Corda strain MUT 2887 with insignificant support in ML and BI analyses (67%, 0.80 PP) and clustered with P. homothallica and Noosia banksiae.
The other two newly generated strains KUMCC 20-0263 and KUMCC 20-0264 clustered with P. pseudobyssoides and P. byssoides, respectively. The new isolate KUMCC 20-0264 grouped with P. byssoides (MAFF 243869, MFLUCC 17-2292, MFLUCC 18-1548, MFLUCC 18-1553), P. celtidis (MFLUCC 20-0172, NCYUCC 19-0314) and P. salina (MFLU 19-1235) with low support (Figure 1). Based on phylogenetic analyses, KUMCC 20-0264 is identified as P. byssoides. While the isolate KUMCC 20-0263 clustered with other isolates of P. pseudobyssoides, and the isolate KUMCC 20-0263 is thus identified as P. pseudobyssoides. Furthermore, Bambusistroma didymosporum formed a separate branch with Sporidesmium tengii W.P. Wu (HKUCC 10837), while Noosia banksiae is sister to Periconia homothallica (KT 916) with insignificant support (Figure 1).

3.2. Genealogical Concordance Phylogenetic Species Recognition (GCPSR)

Twelve representative strains of Periconia byssoides, P. celtidis, P. pseudobyssoides and P. salina were implied in a pairwise homoplasy index (PHI) test for determining the recombination level of these four species. The results of PHI test indicated no significant recombination among P. byssoides, P. pseudobyssoides and P. salina in ITS (Φw = 0.2398), LSU (Φw = 0.6534), tef1-α (Φw = 0.4152), and a combined ITS, LSU, SSU and tef1-α sequence dataset (Φw = 0.654) while SSU showed that there are too few informative characters to implemented; however, it is significant recombination between P. byssoides and P. pseudobyssoides in LSU region. PHI results of single gene ITS, LSU, tef1-α and a combined ITS, LSU, SSU, tef1-α sequence dataset indicated significant recombination between P. byssoides and P. celtidis. Therefore, these two species are shown to be conspecific and thus, P. celtidis is treated as a synonym of P. byssoides (Figure 2).

3.3. Taxonomy

Periconia Tode, Fung. mecklenb. sel. (Lüneburg) 2: 2, emend.
Synonym:
Bambusistroma D.Q. Dai and K.D. Hyde, Index Fungorum 225: 1 (2015)
Noosia Crous, R.G. Shivas and McTaggart, in Crous, Groenewald, Shivas, Edwards, Seifert, Alfenas, Alfenas, Burgess, Carnegie, Hardy, Hiscock and Hübe, Persoonia 26: 139 (2011).
Sexual morph: Ascomata solitary to gregarious, sometimes with pseudostromatic or clypeus-like basal structure on host, scattered to clustered, immersed to erumpent, dark brown to black, globose to subglobose, or conical, ostiolate, papillate; ostiolar canal filled with hyaline periphyses. Peridium composed of several layers of thin- or thick-walled, brown to dark brown pseudoparenchymatous cells of textura angularis to textura prismatica. Hamathecium composed of numerous, cellular, hyaline, septate, branched, anastomosed pseudoparaphyses, embedded in a gelatinous matrix. Asci 8-spored, bitunicate, fissitunicate, cylindrical, with short, rounded or furcate pedicel, apically rounded with a shallow ocular chamber. Ascospores overlapping 1–2-seriate, hyaline, fusiform, 1-septate, with guttules, smooth-walled, with an entire sheath. Asexual morph: Conidiophores macronematous, mononematous, sometimes lacking, erect, straight or slightly flexuous, branched or unbranched, pale brown to dark brown, septate, smooth-walled, or slightly echinulate, sometimes swollen near the base, with spherical conidial heads on main stipe and/or apical branches. Conidiogenous cells monoblastic or polyblastic, terminal, integrated or discrete, ovoid to subglobose, or subspherical, lightly pigmented, branched, smooth to slightly echinulate, sometimes with small, pimple-like pores. Conidia solitary or catenate, in acropetal chains, globose to subglobose, aseptate, occasionally ellipsoidal to cylindrical, pale brown to dark brown, smooth-walled or verruculose. In vitro: Mycelium hyaline to brown, branched, smooth to verruculose with age, frequently aggregating into hyphal strands. Conidiophores sometimes reduced to conidiogenous cells; when present, macronematous, erect, single, sometimes in pairs, pigmented, septate, thick-walled. Conidiogenous cells mono- to polyblastic, solitary, discrete or integrated, determinate, or inconspicuous, lateral and terminal, pigmented, ellipsoidal, ovoid to clavate, aseptate, sometimes with small, pimple-like pores, or with percurrent proliferations. Conidia dimorphic; primary conidia globose to subglobose, or fusoid-ellipsoidal, subhyaline to brown or dark brown, smooth to verruculose, solitary or in short, branched chains, sometimes with minute, unthickened basal pores; secondary conidia phragmoconidia, brown, verruculose, arising from disarticulating hyphal cells (adopted from Crous et al. [16], Calvillo-Medina et al. [51]).
Type species: Periconia lichenoides Tode.
Notes: Periconia was recognized as a polyphyletic genus in Periconiaceae due to the other three monotypic genera that always clade with other Periconia species [12,18,19,20,21,22]. However, morphological study of Bambusistroma and Noosia demonstrated that these two genera resemble the sexual morph of Periconia homothallica and P. pseudodigitata as well as the sporulation in the culture of P. artemisiae, P. chimonanthi and P. pseudobyssoides. Bambusistroma always clustered with Flavomyces in previous studies [12,20,21,22,43]. In this study, we include more taxon sampling in Periconiaceae, and the phylogenetic analyses indicated that B. didymosporum is sister to Sporidesmium tengii (HKUCC 10837), clustering with other Periconia species with insignificant support. There is only one LSU sequence available for the non-type strain HKUCC 10837 of S. tengii, and therefore, the phylogenetic status of S. tengii remains unclarified and is pending further study. Crous et al. [16] introduced the genus Noosia due to the lack of conspicuous conidiophores, which is different from other Periconia in nature. However, we were able to induce the sporulation of P. artemisiae, P. chimonanthi and P. pseudobyssoides on PDA after three months. Morphologically, sporulation in the cultures of P. artemisiae, P. chimonanthi and P. pseudobyssoides resembles Noosia banksiae. Hence, in the present study, we treated Bambusistroma and Noosia as synonyms of Periconia based on morphological characteristics and phylogenetic analyses.
Periconia artemisiae E.F. Yang, H.B. Jiang and Phookamsak, sp. nov. Figure 3.
Index Fungorum number: IF559495.
Etymology: Name reflects the host genus, Artemisia, from which the holotype was collected.
Holotype: KUN-HKAS 10738.
Sexual morph: Undetermined. Asexual morph: Colonies superficial, numerous, effuse, hairy, dark brown to black. Conidiophores 240–385 μm long, 13.5–18.5 μm wide, macronematous, mononematous, solitary or gregarious (1−3 together on stroma), arising from stromatic base, straight to slightly flexuous, dark brown, slightly paler towards the apex, 3−5-septate, sometimes branched at the apex, forming conidial heads at apex, spherical, up to 110 μm diam. Conidiogenous cells 11.5–13.5 × 9–11 μm ( x ¯ = 12.5 × 9.7 μm, n = 15), polyblastic, brown to dark brown, spherical, obovate or subglobose, terminal, verruculose, discrete, located at nodose apices of conidiophores, with hyaline and sympodial conidiogenous loci (Figure 3f). Conidia 16–19 × 14–18 μm ( x ¯ = 17.2 × 16 μm, n = 20), catenate, globose, initially faint yellow or light brown, becoming brown to dark brown at maturity, aseptate, verruculose. In vitro: Culture sporulated in PDA after three months. Mycelium immersed, consisted of 1–2 μm diam., branched, septate, smooth to slightly verruculose, hyaline to brown hyphae. Conidiophores reduced to conidiogenous cells. Conidiogenous cells 2.5–4 × 1–2 μm ( x ¯ = 3 × 1.5 μm, n = 15), mono- to polyblastic, with 1–2 conidiogenous loci, lateral, or integrated, lateral and terminal, brown to dark brown, inconspicuous, giving rise to solitary conidia, or in short chains. Conidia 5–8 × 4–5 μm ( x ¯ = 6.7 × 4.3 μm, n = 20), globose, brown to dark brown, aseptate, smooth to slightly verruculose.
Culture characteristics: Conidia germinated on PDA within 24 h. Colonies on PDA reaching 20 mm diam in one week at room temperature (10–25 °C), dense, circular, flattened, dull, cottony, surface smooth with entire edge, hairy at the margin, pale grey at the margin and pale brown to white at the middle from the above; greenish-brown at the margin and dark brown to black at the middle in reverse; not producing pigmentation on agar medium.
Material examined: CHINA, Yunnan Province, Kunming City, Xiehong Dam (25°8′31″ N, 102°44′15″ E, altitude 1918 msl), saprobic on dead branches of Artemisia apiacea Hance (Asteraceae), 11 July 2019, E.F. Yang, DY9 (KUN-HKAS 107384, holotype), ex-type living culture, KUMCC 20-0265.
Distribution: China (Yunnan).
Host and habitat: Saprobic on Artemisia apiacea (Asteraceae) in a terrestrial environment.
Notes: Periconia artemisiae matches the typical morphology of Periconia in forming macronematous, mononematous conidiophores, with a spherical conidial head, polyblastic conidiogenous cells, and catenate, globose, brown to dark brown, aseptate, verruculose conidia. Phylogenetic analyses based on combined ITS, LSU, SSU and tef1-α sequence data also supported the placement of the species in Periconia (Figure 1). Based on the nucleotide BLAST results of the ITS region, P. artemisiae is similar to the Periconia sp. isolate G1782 and Periconia sp. isolate Otu0123 with 99.80% similarity, and Periconia sp. isolate C75 with 99.79% similarity. Periconia artemisiae is also similar to P. alishanica (MFLUCC 19-0145, NCYU 19-0347 and NCYUCC 19-0186) with 97.65% similarity. Phylogenetic analyses based on combined ITS, LSU, SSU and tef1-α sequence data (Figure 1) indicated that P. artemisiae forms a separate branch sister to Periconia sp. (G1782, Otu0123, and C75) with high support and constituted basal to P. alishanica, P. pseudobyssoides, P. salina and P. byssoides. Based on a nucleotide pairwise comparison of ITS and tef1-α [65], P. artemisiae differs from P. alishanica strain MFLUCC 19-0145 (type strain) in 14/507 bp (2.76% of ITS) and 23/817 bp (2.82% of tef1-α), differs from P. byssoides strain MLFUCC 18-1553 in 16/501 bp (3.19% of ITS) and 24/920 bp (2.61% of tef1-α), differs from P. pseudobyssoides strain MAFF 243868 in 14/509 bp (2.75% of ITS) and 23/929 bp (2.48% of tef1-α), and differs from P. salina strain MFLU 19-1235 (type strain) in 15/509 bp (2.95% of ITS). A nucleotide base comparison of ITS regions also indicated Periconia sp. (G1782, Otu0123, and C75) is conspecific with P. artemisiae (less than 1.5% difference). Therefore, these three strains are identified as P. artemisiae in this study. Morphologically, P. artemisiae can be distinguished from P. alishanica by having wider and shorter conidiophores, with branched at the apex and smaller conidia [40]. Periconia alishanica was isolated from many host plants in Taiwan viz. Ficus septica (Moraceae), Macaranga tanarius (Euphorbiaceae) and Morus australis (Moraceae), whereas P. artemisiae was found as a saprobe on Artemisia apiacea (Asteraceae) in Yunnan, China. Morphological characteristics of P. artemisiae (Otu0123, G1782 and C75) are not available. Therefore, P. artemisiae (KUMCC 20-0265) and P. artemisiae (Otu0123, G1782 and C75) could not be compared.
Periconia banksiae (Crous, R.G. Shivas and McTaggart) H.B. Jiang, Bhat and Phookamsak, comb. nov.
Index Fungorum number: IF559496.
Basionym: Noosia banksiae Crous, R.G. Shivas and McTaggart, in Crous, Groenewald, Shivas, Edwards, Seifert, Alfenas, Alfenas, Burgess, Carnegie, Hardy, Hiscock and Hübe, Persoonia 26: 139 (2011).
Type information: AUSTRALIA, Queensland, Noosa, S 26°34′14.0″ E 153°4′21.6″, on leaves of Banksia aemula, 13 July 2009, P.W. Crous, R.G. Shivas and A.R. McTaggart, CBS H-20587 (holotype), ex-type living culture CPC 17282 = CBS 129526.
Detailed description and illustration: see Crous et al. [16]
Notes: Noosia banksiae was introduced by Crous et al. [16] as the type species of the monotypic genus Noosia. The species was isolated from leaf spots of Banksia aemula in Australia. Crous et al. [16] introduced the genus in Pleosporales but did not classify the genus to any family in Pleosporales. According to Crous et al. [16], the nucleotide BLAST search of ITS and LSU sequence data showed that N. banksiae had a close relationship with Periconia species, Sporidesmium tengii (HKUCC 10837, GenBank no. DQ408559), Periconia igniaria E.W. Mason and M.B. Ellis (as Massarina igniaria (C. Booth) Aptroot, GenBank no. DQ810223), Byssothecium circinans Fuckel (CBS 675.92, GenBank no. AY016357) and Corynespora smithii (Berk. and Broome) M.B. Ellis (CABI 5649b, GenBank no. GU323201). Noosia shared some morphological resemblances to Conioscypha Höhn., Periconiella sensu lato and Trichobotrys Penz. and Sacc., but differed from these genera in many morphological aspects [16]. Consequently, Tanaka et al. [12] resurrected family Periconiaceae in the suborder Massarineae (Pleosporales) and included Noosia in this family. However, Tanaka et al. [12] suggested that the taxonomic revision of Noosia along with Periconia species should be revisited.
In the present study, the LSU nucleotide BLAST result indicated that Noosia banksiae is most closely related to Periconia neobrittanica Crous strain CPC 37903 (identities = 877/883 bp (99.3%), without gap) and is also similar to P. homothallica KT916 (identities = 834/846 bp (98.6%), without gap). Phylogenetic analyses also supported that Noosia banksiae has a close relationship with P. homothallica KT916 (Figure 1). Noosia banksiae can be distinguished from other asexual morphs of Periconia species in vivo due to the conidiophores being reduced to conidiogenous cells as well as conidia forming dimorphic characteristics [16]. However, Noosia banksiae morphologically resembles the asexual morphs of Periconia artemisiae, P. chimonanthi and P. pseudobyssoides that sporulated on PDA after 3 months in this study (Table 2). Therefore, we synonymize Noosia banksiae under Periconia as P. banksiae based on morphological resemblances and phylogenetic support.
Periconia byssoides Pers., Syn. meth. fung. (Göttingen) 2: 686 (1801) Figure 4.
Index Fungorum number: 144538.
Synonym: Periconia celtidis Tennakoon, C.H. Kuo and K.D. Hyde, in Tennakoon, Kuo, Maharachchikumbura, Thambugala, Gentekaki, Phillips, Bhat, Wanasinghe, de Silva, Promputtha and Hyde, Fungal Diversity: 10.1007/s13225-021-00474-w, [35] (2021).
Sexual morph: Undetermined. Asexual morph: Colonies superficial on the host substrate, effuse, hairy, dark brown. Conidiophores 355–635 μm long, 12.5–17 μm wide, macronematous, mononematous, solitary, rarely 1−2 together on stroma, arising from inconspicuous stromatic base, straight or slightly flexuous, 1−3-septate, dark brown to black at the base, paler brown towards the apex, with spherical conidial head, rarely branched at the apex, slightly constricted near conidial head and knot-like near the base, smooth or slightly rough, thick-walled. Conidiogenous cells 6–9 × 5–8 μm ( x ¯ = 7.2 × 6.7 μm, n = 15), polyblastic, discrete, terminal, subglobose to ellipsoidal, light brown, located at nodose apices of conidiophores. Conidia 13–15 × 12.5–14.5 μm ( x ¯ = 14 × 13.6 μm, n = 20), solitary or catenate, globose to subglobose, orangish brown to brown, aseptate, echinulate or verruculose.
Culture characteristics: Conidia germinated on PDA within 18 h. Colonies on PDA fast-growing, reaching 25 diam in one week at room temperature (10–25 °C), medium dense, circular, flattened, dull, surface smooth, with standing white hyphal turfs, edge entire, with well-defined margin, white to yellowish at the middle, white grey at the margin from the above; dark brown to black at the center, light yellowish at the middle, yellowish grey at the margin in reverse. Mycelium immersed in PDA, branched, septate, smooth-walled, brown hyphae.
Material examined: CHINA, Yunnan Province, Kunming City, Kunming Botanical Garden (25°8′32″ N, 102°44′214″ E, altitude 1918 msl), saprobic on dead stems of Prunus armeniaca L. (Rosaceae), 7 September 2019, E.F. Yang, DY8 (KUN-HKAS 107383), living culture, KUMCC 20-0264.
Distribution (based on molecular data): China (Taiwan, Yunnan), Japan, Lithuania, Netherlands, Thailand [12,21,24,40,66,67].
Hosts and habitat (based on molecular data): Saprobic on Ampelopsis brevipedunculata (Vitaceae) [12], Angelica sylvestris (Apiaceae) [24], Benthamidia japonica (Cornaceae) [12], Celtis formosana (Cannabaceae) [40], Conium maculatum (Apiaceae) [24], Heracleum sosnowskyi (Apiaceae) [24], Macaranga tanarius (Euphorbiaceae) [40], Magnolia grandiflora (Magnoliaceae) [21], Peltophorum sp. (Fabaceae) [21], Prunus armeniaca (this study), P. verecunda (Rosaceae) [12].
Notes: Based on ITS nucleotide BLAST search, the isolate KUMCC 20-0264 is most similar to Periconia byssoides H4853 (GenBank no. MW444854) with 99% similarity (535/536 bp). A nucleotide base comparison of the ITS and tef1-α sequences between the new isolate KUMCC 20-0264 and other representative strains of P. byssoides also revealed nucleotide differences less than 1.5% (Table 3), indicating that the new isolate is conspecific with P. byssoides [65]. Phylogenetic analyses demonstrated that the new isolate KUMCC 20-0264 is basal to other P. byssoides and P. celtidis, with 68% ML and 0.71 PP support (Figure 1) and most closely related with P. byssoides strains MFLUCC 18-1548 and MFLUCC 18-1553, which were isolated from decaying pods of Peltophorum sp. (Fabaceae) in Thailand [21]. Based on Farr and Rossman [3], P. byssoides is reported as a saprobe on Prunus armeniaca in Yunnan, China for the first time.
Tennakoon et al. [40] introduced Periconia celtidis as a saprobe on dead leaves of Celtis formosana and Macaranga tanarius from Taiwan. Their phylogenetic analyses showed that P. celtidis form a distinct lineage and clustered with P. byssoides, P. pseudobyssoides and P. alishanica with 90% ML and 1.00 PP support (Tennakoon et al. [40] (p. 37)). In the present phylogenetic analyses, P. celtidis grouped with other P. byssoides, and this result was also supported by PHI results of ITS, LSU, and a combined ITS, LSU, SSU and tef1-α sequence dataset (Figure 2). Therefore, we treat P. celtidis as a synonym of P. byssoides in this study. Morphological characteristics of the new isolate KUMCC 20-0264 are slightly different from other representative isolates of P. byssoides and P. celtidis in size of conidiophores and conidia which is detailed in Table 4.
Periconia chimonanthi E.F. Yang, H.B. Jiang and Phookamsak, sp. nov. Figure 5.
Index Fungorum number: IF559497.
Etymology: The specific epithet “chimonanthi” refers to the host genus, Chimonanthi, from which the fungus was collected.
Holotype: KUN-HKAS 107380.
Saprobic on dead stems of Chimonanthi praecox (L.) Link. Sexual morph: Undetermined. Asexual morph: Colonies on the substrate superficial, numerous, effuse, dark brown to black, hairy. Conidiophores 410–635 μm long, 8.5–12 μm wide, broader at the base, 14–18 μm wide, macronematous, mononematous, arising usually singly, rarely 2–3 together on stroma, erect or slightly flexuous, swollen at the 3rd cell from the apex, branched at apex, with spherical conidial head, dark brown, septate, smooth to verruculose, thick-walled. Conidiogenous cells 7.5–9.5 × 5–6 μm ( x ¯ = 8.6 × 5.7 μm, n = 20), mono- to polyblastic, brown to dark brown, ovoid to subglobose, terminal, proliferating, with 1–2 conidiogenous loci. Conidia 7–8 × 6–7 μm ( x ¯ = 7.3 × 6.6 μm, n = 20), catenated, globose, initially hyaline greenish-brown, becoming yellowish brown to brown at maturity, aseptate, verruculose. In vitro: sporulated on PDA after 4 months. Mycelium 2–3 μm wide ( x ¯ = 2.5 μm, n = 15), branched, hyaline to brown, with well-developed small, granular, oil droplets, aggregated in hyphal strands. Conidiophores reduced to conidiogenous cells. Conidiogenous cells 7–10 × 4.5–6 μm ( x ¯ = 8.8 × 4.9 μm, n = 20), polyblastic, solitary, erect, lateral and terminal, cylindrical to irregular, luteous to brown, discrete or integrated, determinate, or inconspicuous, percurrent proliferations, with 1–3 conidiogenous loci. Conidia 6–8 × 6–8 μm ( x ¯ = 7.1 × 6.9 μm, n = 20), globose to oblong, or ellipsoidal, subhyaline to brown or dark brown, smooth to verruculose, solitary or in short chains.
Culture characteristics: Conidia germinated within 18–20 h on PDA. Colonies reaching 15 mm diam in one week at 20–25 °C in normal light, dense, circular, flattened to slightly raised, surface slightly rough, with entire edge, floccose to cottony, radially furrowed at the margin, pale greenish grey at the margin, dark greenish towards the center from above and below; not producing pigmentation on medium.
Material examined: CHINA, Yunnan Province, Kunming City, Kunming Institute of Botany (25°8′7″ N, 102°44′17″ E, altitude 1908.6 msl), on dead branches of Chimonanthi praecox (Calycanthaceae), 20 July 2019, C.F. Liao, CP05 (KUN-HKAS 107380, holotype), ex-type living culture, KUMCC 20-0266.
Distribution: China (Yunnan).
Host and habitat: Saprobic on dead branches of Chimonanthi praecox (Calycanthaceae).
Notes: The nucleotide BLAST result of ITS sequence indicated that Periconia chimonanthi sp. nov. (KUMCC 20-0266) is closest to P. macrospinosa strain DUCC4111, Periconia sp. strain EPU33CB and Periconia sp. strain DUCC4151, with 100% similarities and closely related to Periconia sp. CY137 (99.82% similarity). Phylogenetic analyses showed that P. chimonanthi (KUMCC 20-0266) forms a single branch with Periconia sp. CY137 (100% ML, 1.00 PP; Figure 1) and clusters with P. cortaderiae, distancing from P. macrospinosa (Figure 1). Rodrigues et al. [68] isolated Periconia sp. CY137 from the ant’s nest (Cyphomyrmex wheeleri) in Central Texas, USA based on culture-dependent methods for studying microfungal diversity in attine gardens. Hence, the proper morphological description and identification of Periconia sp. CY137 have not been provided. In our phylogenetic analyses, Periconia sp. CY137 was shown to be conspecific with P. chimonanthi. Therefore, we identify Periconia sp. CY137 as P. chimonanthi in this study. Periconia chimonanthi can be distinguished from P. cortaderiae in having shorter conidiophores (410–635 × 8.5–12 μm vs. 400–800 × 4–9.4 μm), mono- to polyblastic, brown to dark brown, ovoid to subglobose, terminal, proliferating, with 1–2 conidiogenous loci and larger conidia (7–8 × 6–7 μm vs. 4–6.6 × 4.1–7.1 μm). On the other hand, P. cortaderiae formed monoblastic conidiogenous cells that were discrete on stipe [19]. A nucleotide base comparison of ITS and tef1-α indicated that P. chimonanthi differs from P. cortaderiae strain MLFUCC 15-0457 (ex-type strain) in 52/526 bp of ITS (9.89%) and 36/830 bp of tef1-α (4.34%). Based on Farr and Rossman [3], this is the first report of a Periconia species occurring on Chimonanthi praecox in Yunnan, China.
Periconia didymosporum (D.Q. Dai and K.D. Hyde) D.Q. Dai and Phookamsak, comb. nov. Figure 6.
Index Fungorum number: IF559498.
Basionym: Bambusistroma didymosporum D.Q. Dai and K.D. Hyde, Index Fungorum 225: 1 (2015).
Type information: THAILAND, Chiang Rai Province, Doi Mae Salong, temple side, on decaying culm of bamboo, 15 August 2013, D.-Q. Dai, DDQ00276 (MFLU 15-0057, holotype), ex-type living culture, MFLUCC 13-0862.
Detailed description and illustration: see Adamčík et al. [15].
Notes: Bambusistroma didymosporum was introduced by Adamčík et al. [15] as type species of the monotypic genus Bambusistroma and treated in the family Massarinaceae. Consequently, Tanaka et al. [12] treated the genus in Periconiaceae. Bambusistroma didymosporum resembles the sexual morphs of Periconia homothallica and P. pseudodigitata in having solitary or grouped ascomata, immersed in a clypeus-like basal stroma, 8-spored, bitunicate, fissitunicate, cylindrical, short pedicellate asci, with well-developed ocular chamber, embedded in anastomosed, cellular pseudoparaphyses, and hyaline, fusiform, 1-septate ascospores, with an entire sheath. Bambusistroma didymosporum can be distinguished from Periconia homothallica and P. pseudodigitata in having larger, subglobose to conical ascomata as well as in having larger asci and ascospores [12,15]. Based on morphological resemblances coupled with phylogenetic analyses, we hence synonymize the genus Bambusistroma under Periconia, and the new combination P. didymosporum is proposed in this study.
The LSU nucleotide BLAST results indicated that Bambusistroma didymosporum is highly similar to Periconia cyperacearum Crous strain CPC 32138 (identity = 859/875 bp (98%), with two gaps). Phylogenetic analyses demonstrated that B. didymosporum clusters with the non-type strain of Sporidesmium tengii (HKUCC 10837), distant from Periconia cyperacearum strain CPC 32138. Sporidesmium tengii was introduced by Wu and Zhuang [68] and is characterized by partly immersed, partly superficial mycelium, composed of branched, septate, brown to dark brown, smooth-walled hyphae, macronematous, mononematous, erect, unbranched, 4–6-septate, brown to dark brown conidiophores, with triangular base, monoblastic, integrated, determinate, terminal, brown, cylindrical, smooth-walled conidiogenous cells without proliferations and holoblastic, acrogenous, solitary, obclavate, 8-septate conidia, tapering towards the apex, brown, paler brown to hyaline at the apex, [68]. The type specimen (WU 1930b) was obtained from unidentified dead leaves in Guangdong Province, China in 1998, and molecular data are unavailable for the type. Shenoy et al. [69] provided molecular data for Sporidesmium tengii (HKUCC 10837), which was obtained from the Culture Collection in Novozymes, Beijing, China and indicated that S. tengii (HKUCC 10837) is affiliated basal to Melanommataceae, Pleosporales based on the LSU phylogeny. However, morphological characteristics of S. tengii (HKUCC 10837) were not examined by Shenoy et al. [69]. Tanaka et al. [12] included S. tengii (HKUCC 10837) in Periconiaceae and suggested that the taxonomic status of S. tengii and Noosia should be re-evaluated in the light of Periconia being subdivided into several morphologically similar genera and the polyphyletic status of Periconia.
Periconia pseudobyssoides Markovsk. and Kačergius, Mycol. Progr. 13(2): 293 (2013) [2014] Figure 7.
Index Fungorum number: IF804763.
Type information: Lithuania, Vilnius, 54°45′10″ N, 25°16′04″ E, on dead stalks of Heracleum sosnowskyi, 28 October 2011, leg. S. Markovskaja, BILAS 50334 (holotype), ex- holotype culture, BILAS 50334 (S1-11P).
Saprobic on dead branch of Scrophularia ningpoensis Hemsl. Sexual morph: Undetermined. Asexual morph: Colonies on the substrate superficial, hairy, effuse. Conidiophores 665–755 μm long, 19–21 μm wide, macronematous, mononematous, arising singly on stroma, erect or slightly flexuous, solitary, septate, unbranched, tapering towards the apex, reddish brown to dark brown at the lower part and gradually pale brown toward the apex, with spherical conidial head, smooth to minutely verruculose, thick-walled. Conidiogenous cells 7–9 × 6.5–8 μm ( x ¯ = 8.1 × 7.3 μm, n = 20), mono- to polyblastic, light brown to brown, ovoid to subglobose, terminal, discrete, determinate, proliferating, thick-walled. Conidia 12–14 × 10–13 μm ( x ¯ = 13 × 12 μm, n = 20), catenate in short chains, globose, hyaline to reddish brown at immature stage, becoming brown to dark brown with age, aseptate, verruculose. In vitro: Culture sporulated on PDA after six months and also produced immersed, brown, globose stroma on MEA. Mycelium 3–6 μm wide, septate, pale brown, thick-walled. Conidiophores reduced to conidiogenous cells. Conidiogenous cells 4–6 × 2.5–4 μm ( x ¯ = 5.1 × 3.2 μm, n = 15), monoblastic, solitary, terminal, with small, pimple-like pores, arising from brown and verruculose hyphae. Conidia 13–16 × 12–15 μm ( x ¯ = 15 × 14 μm, n = 20), solitary, globose, reddish-brown, aseptate, verruculose.
Culture characteristics: Conidia germinated within 18–20 h on PDA, colonies on PDA reaching 25 mm diam in one week at 20–25 °C in normal light, medium dense, flattened to raised, circular, surface smooth, with edge entire, cottony to fluffy, colonies from above, cream to pale yellowish at the margin, white in the middle, with granular, packed, pale yellowish at the center, colonies from below, yellowish brown at the margin, brown to dark brown towards the center; not produced pigmentation on PDA.
Material examined: CHINA, Yunnan Province, Chuxiong Yi Autonomous Prefecture, Daguokou Town (24°88′8″ N, 101°16′2″ E, altitude 2016 msl), on dead branch of Scrophularia ningpoensis (Scrophulariaceae), 14 August 2019, E.F. Yang, DY6 (KUN-HKAS 107382), living culture, KUMCC 20-0263.
Distribution (based on molecular data): China (Yunnan), Japan, Korea, Lithuania [12,20,24].
Host and habitat (based on molecular data): Berchemia racemosa (Rhamnaceae) in terrestrial habitat [12], decaying wood submerged in stream [20], Heracleum sosnowskyi (Apiaceae) in terrestrial habitat [24], Rodgersia podophylla (Saxifragaceae) in terrestrial habitat [12], Scrophularia ningpoensis (Scrophulariaceae) in terrestrial habitat [this study].
Notes: In the ITS and tef1-a nucleotide BLAST search, the newly generated strain KUMCC 20-0263 is identical to Periconia pseudobyssoides (strain DUCC 0850) with 99.60% and 98.73% similarities and is also closely related to P. pseudobyssoides (strains H4151/MAFF 243868, and H 4790/MAFF 243874). Phylogenetic analyses indicated that the generated strain KUMCC 20-0263 clustered with P. pseudobyssoides strains DUCC 0850, MAFF 243868 and MAFF 243874 with 58% ML, 0.86 PP support (Figure 1). A nucleotide base comparison of the ITS and tef1-α sequences between the new isolate KUMCC 20-0263 and other representative strains of P. pseudobyssoides also revealed nucleotide differences of less than 1.5% (Table 5). Moreover, the ITS nucleotide base comparison between KUMCC 20-0263 and the ex-type strain of P. pseudobyssoides (BILAS 50334) also revealed the conspecific status of KUMCC 20-0263 with P. pseudobyssoides (3/562 bp of ITS (0.53%, <1.5%)). Thus, we identified our newly generated strain KUMCC 20-0263 as P. pseudobyssoides, which is reported from Scrophularia ningpoensis in Yunnan, China for the first time.
Periconia pseudobyssoides was introduced by Markovskaja and Kacergius [24]. The species was found to be a saprobe on dead stalks of Heracleum sosnowskyi in Lithuania. Periconia pseudobyssoides (KUMCC 20-0263) is morphologically similar to the type of P. pseudobyssoides (BILAS 50334) and P. pseudobyssoides (DUCC 0850) in producing macronematous, brown, septate, unbranched, verruculose conidiophores, mono- to polyblastic, light brown to brown, ovoid to subglobose, discrete, determinate conidiogenous cells, and globose, brown, aseptate, verruculose conidia, which are borne singly or catenate in short chains. However, these collections vary slightly in size of conidiophores and conidia, likely depending on environmental factors and host associations [20,24].
Periconia thysanolaenae E.F. Yang, H.B. Jiang and Phookamsak, sp. nov. Figure 8.
Index Fungorum number: IF559499.
Etymology: The specific epithet “thysanolaenae” refers to the host genus, Thysanolaena, from which the species was collected.
Holotype: KUN-HKAS 107381.
Saprobic on dead culms of Thysanolaena latifolia (Roxb. ex Hornem.) Honda. Sexual morph: Undetermined. Asexual morph: Colonies on the substrate, superficial, numerous, hairy, effuse. Conidiophores 425–550 μm long, 8–13.5 μm wide, 16.5–22.5 μm wide at the base, macronematous, mononematous, erect or slightly flexuous, solitary, septate, reddish brown to dark brown, and gradually pale brown toward the apex, smooth to minutely verruculose, thick-walled, branched at the apex (the apex of ultimate cells of the primary conidiophores proliferate, producing 2–3 secondary conidiophores). Conidiogenous cells 5.5–7 × 4–5 μm ( x ¯ = 6 × 4.4 μm, n = 20), polyblastic, ovoid to subglobose, light brown to brown, terminal, proliferating. Conidia 4.5–6 × 4–6 μm ( x ¯ = 5.3 × 5 μm, n = 20), catenate, globose, hyaline to reddish brown at immature stage, becoming brown to dark brown at maturity, aseptate, rough-walled, verruculose.
Culture characteristics: Conidia germinated within 18–20 h on PDA. Colonies growing on PDA reaching 25 mm diam in one week at 20–25 °C, colonies moderately dense, circular, flattened, surface smooth, with edge entire, forming white to grey mycelial turfs on surface with age, velvety to fluffy, colonies from above white greyish to pale brown, yellowish brown, with small black dots in reverse; producing yellowish to greenish pigmentation in PDA.
Material examined: CHINA, Yunnan Province, Xishuangbanna Dai Autonomous Prefecture, Mengla County, Bubeng Village, on dead culms of Thysanolaena latifolia (Poaceae), 23 January 2019, E.F. Yang, DY5 (KUN-HKAS 107381, holotype), ex-type living culture, KUMCC 20-0262.
Distribution: China (Yunnan).
Host and habitat: Saprobic on Thysanolaena latifolia in terrestrial habitat.
Notes: Results from the ITS nucleotide BLAST search indicated that the newly generated strain KUMCC 20-0262 is most similar to Periconia minutissima strain MUT 2887 (GenBank. no. MG813227) with 98.73% similarity and is similar to P. macrospinosa isolate UFMG PEZ8 (GenBank no. KY364630) with 98.41% similarity. Phylogenetic analyses demonstrated that KUMCC 20-0262 is sister to P. minutissima with 67% ML, 0.80 PP support and clustered with P. homothallica (KT 916) and P. banksiae (CBS 129526) with low support, distancing from P. macrospinosa (Figure 1). Based on a nucleotide pairwise comparison of ITS and tef1-α sequences, P. thysanolaenae sp. nov. (KUMCC 20-0262) differs from P. minutissima strain MUT 2887 in 5/458 bp of ITS (1.09%), differs from P. homothallica strain KT 916 (type strain) in 25/530 bp of ITS (4.72%), and differs from P. banksiae strain CBS 129526 (type strain) in 48/602 bp of ITS (7.97%). Periconia minutissima strain MUT 2887 formed a distinct clade with P. minutissima strain MFLUCC 15-0245 in this study. Bovio et al. [70] isolated P. minutissima strain MUT 2887 from Sycon ciliatum in the Atlantic Ocean using a culture method and identified the strain as P. minutissima based on a high percentage of homologies, with sequences available in GenBank. However, P. minutissima strain MFLUCC 15-0245 remains unpublished. Our new isolate KUMCC 20-0262 is not significantly different from P. minutissima strain MUT 2887 based on the ITS nucleotide base comparison (1.09%); however, P. minutissima strain MUT 2887 has no morphological support for species identification. Unfortunately, the ex-type strain of P. minutissima is unavailable. We, therefore, introduced our new collection as P. thysanolaenae sp. nov.
Morphological characteristics of Periconia thysanolaenae align with described Periconia species in having erect or flexuous, faint to reddish brown, or dark brown, conidiophores, with spherical conidial head at the apex, polyblastic, ovoid to subglobose, light brown to brown, terminal conidiogenous cells, and catenate, globose, and brown to dark brown aseptate conidia. However, P. thysanolaenae can be distinguished from other phylogenetically related species in having proliferating, 2–3 secondary conidiophores. Periconia minutissima is characterized by effuse, brown, colonies, with dark brown, loose, very slender, few septate, translucent conidiophores, divided above into very short branches, with botrytis-like apex and globose, colorless conidia [71], while P. homothallica is represented by its sexual morph, and P. banksiae formed an asexual morph in vitro that lack conspicuous conidiophores [12,16].

4. Discussion

Tanaka et al. [12] resurrected the family Periconiaceae in the suborder Massarineae (Pleosporales, Dothideomycetes) based on morphological and phylogenetic approaches and updated the taxonomic treatment of Periconiaceae in modern fungal systematics. They accepted Bambusistroma, Flavomyces, Noosia and Periconia in the family, while a single lineage of “Sporidesmium tengii” was also included in Periconiaceae [12]. However, Bambusistroma, Flavomyces and Noosia represented as monotypic genera always grouped with Periconia species. Moreover, Periconia species did not form a single clade within Periconiaceae, indicating that Periconia may be polyphyletic [2,12,18,19,20,21,22,40]. Thus, Tanaka et al. [12] suggested that Periconia probably can be subdivided into several morphologically similar genera or that the taxonomic status of the monotypic genera and “Sporidesmium tengii” should be re-evaluated.
In this study, we re-evaluate the taxonomic status of Bambusistroma and Noosia based on morphological and multigene phylogenetic approaches. Morphological comparison of Bambusistroma and the sexual morphs of Periconia species (viz. P. homothallica and P. pseudodigitata) showed that Bambusistroma has similar morphology with the sexual morph of Periconia species (see notes of P. didymosporum), while P. artemisiae, P. chimonanthi and P. pseudobyssoides sporulated in vitro are not significantly different from Noosia (see notes of P. banksiae). Therefore, these two monotypic genera are treated as synonyms of Periconia in this study. Knapp et al. [4] introduced a monotypic genus Flavomyces to accommodate the root endophytic species, F. fueloephazae (as F. fulophazii), isolated from the root of Festuca vaginata in Hungary based on culturable and phylogenetic approaches. Morphological characteristics of Flavomyces are undescribed. In this study, F. fueloephazae formed an independent clade basal to Periconia prolifica Anastasiou, P. citlaltepetlensis Calvillo, Cobos-Villagrán and Raymundo, P. igniaria, P. epilithographicola Coronado-Ruiz et al., P. caespitosa Cantillo, Gusmão and Madrid, P. variicolor S.A. Cantrell, Hanlin and E. Silva, P. minutissima and P. macrospinosa with significant support in ML analyses (73% ML; Figure 1). Since morphology is poorly known, the generic status of Flavomyces may need to be clarified.
Phylogenetic relationships of many Periconia species are not well-resolved, such as the relationships of P. cookei E.W. Mason and M.B. Ellis, P. delonicis Jayasiri, E.B.G. Jones and K.D. Hyde, P. elaeidis T. Sunpapao and K.D. Hyde, P. palmicola J.F. Li and Phookamsak and P. verrucosa Phukhams. et al. These species are grouped together with significant support in ML analyses (98%; Figure 1); however, the interspecific relationships of these species could not be resolved. These species may be conspecific and contain a high degree of genetic variation. The conspecific status of these ambiguous species should be re-evaluated. Moreover, phylogenetic relationships of P. byssoides, P. celtidis, P. pseudobyssoides and P. salina are not well-resolved in this study and it is in agreement with previous studies [18,51,72]. We re-evaluated the conspecific status of P. byssoides, P. celtidis, P. pseudobyssoides and P. salina based on the pairwise homoplasy index (PHI) test. The PHI test of the individual gene (ITS, LSU, and tef1-α) and the combined ITS, LSU, SSU and tef1-α sequence dataset resulted in no significant recombination among P. byssoides, P. pseudobyssoides and P. salina (Figure 2), indicating that P. byssoides, P. pseudobyssoides and P. salina are not conspecific. In contrast, the PHI test resulted in significant recombination between P. byssoides and P. celtidis, and polymorphic nucleotide comparison between P. byssoides and P. celtidis (Table 2) also supported that P. celtidis is conspecific with P. byssoides. Hence, P. celtidis is synonymized under P. byssoides in this study.
Out of 121 morphologically accepted species, only 28 species (including three new species and two novel combinations provided in this study) have molecular data to clarify their phylogenetic placements in Periconiaceae [2,40]. Most available sequences of Periconia species are limited to ITS and LSU gene regions. Sixteen species have sequence data of a protein-coding gene (tef1-α), but most species do not have useful phylogenetic markers (i.e., mtSSU, rpb1, rpb2 and tub2) to identify them to the species level in Periconiaceae. Moreover, some Periconia species show an intraspecific variation, such as P. byssoides, P. cortaderiae, P. prolifica and P. pseudobyssoides. More reliable phylogenetic markers may be required to support their conspecific status. In addition, two strains of P. minutissima (MUT 2887 and MFLUCC 15-0245) and two strains of P. igniaria (CBS 379.86 and CBS 485.96) form a distinct clade separated from each other within Periconiaceae. These strains are not represented by the ex-type strains. Therefore, the phylogenetic status of P. minutissima and P. igniaria remain in doubt. The epitypification of P. minutissima and P. igniaria are in urgent need of clarification regarding their phylogenetic status within Periconiaceae.
Nevertheless, the type specimens of Periconia lichenoides have been lost while, the DNA sequence data of this type species are also unavailable in GenBank. Tanaka et al. [12] judged Periconia to be a member of Dothideomycetes due to the morphological resemblance of Periconia sensu stricto (e.g., P. byssoides, P. cookei, P. igniaria, and P. digitata) with P. lichenoides. The taxonomic treatment proposed by Tanaka et al. [12] was followed by various subsequent authors [2,6,17,18,19,20,21,22,43,51,52,72]. However, this taxonomic status is somewhat questionable due to the lack of information from the type species of Periconia. Neotypification or designation of reference specimens of P. lichenoides is urgently needed to clarify the taxonomic status of Periconia in Dothideomycetes.

Author Contributions

Conceptualization, E.-F.Y., H.-B.J. and R.P.; methodology, E.-F.Y., H.-B.J., R.P. and S.T.; software, H.-B.J. and S.T.; validation, R.P., D.-Q.D. and D.J.B.; formal analysis, H.-B.J., R.P. and S.T.; investigation, R.P.; resources, E.-F.Y.; data curation, H.-B.J. and R.P.; writing—original draft preparation, E.-F.Y., H.-B.J. and R.P.; writing—review and editing, S.C.K., R.P., D.J.B., D.-Q.D. and I.P.; supervision, R.P., S.T. and J.-C.X.; project administration, R.P.; funding acquisition, J.-C.X., S.C.K., D.-Q.D. and I.P. All authors have read and agreed to the published version of the manuscript.

Funding

The research was supported by the National Science Foundation of China (NSFC) under projects 31760013, 31851110759, 31750110478 and 31850410489 (grant no. Y81I982211), High-Level Talent Recruitment Plan of Yunnan Provinces (Young Talent Program), CAS President’s International Fellowship Initiative (PIFI) young staff (project no. 2020FYC0002, 2019FY0003, 2020PC0009 and 2018PC0006), Key Research Project Agroforestry Systems for Restoration and Bio-industry Technology Development (grant no. 2017YFC0505101), Ministry of Sciences and Technology of China (grant no. 2017YFC0505100), Chiang Mai University, Thailand, Postdoctoral Exchange Fellowship Program (number Y9180822S1), China Postdoctoral Science Foundation and the Yunnan Human Resources, and Social Security Department Foundation.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

The authors acknowledge the Biology Experimental Center, Germplasm Bank of Wild Species, Kunming Institute of Botany, Chinese Academy of Sciences for providing the molecular laboratory facilities. Shaun Pennycook at Manaaki Whenua—Landcare Research, New Zealand, is thanked for assistance in naming the new species in the genus Periconia. Chunfang Liao at School of Science, Mae Fah Luang University, Thailand, is thanked for collecting fungal specimen of Periconia chimonanthi. Austin G. Smith at World Agroforestry (ICRAF), Kunming Institute of Botany, China, is thanked for checking the English grammar. E.-F.Y. thanks Chiang Mai University, Thailand for his M.Sc. scholarship. H.-B.J. would like to thank Mae Fah Luang University, Thailand for his Ph.D. scholarship.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Nannizzi, A. Repertorio Sistematico dei Miceti dell’ Uomo e degli Animali; SA Poligrafica Meinik Siena: Siena, Italy, 1934; Volume 4, pp. 1–557. [Google Scholar]
  2. Hongsanan, S.; Hyde, K.D.; Phookamsak, R.; Wanasinghe, D.N.; McKenzie, E.H.C.; Sarma, V.V.; Boonmee, S.; Jeewon, R.; Wijayawardene, N.; Devadatha, B.; et al. Refined families of Dothideomycetes: Dothideomycetidae and Pleosporomycetidae. Mycosphere 2020, 11, 1553–2107. [Google Scholar] [CrossRef]
  3. Farr, D.F.; Rossman, A.Y. Available online: https://nt.ars-grin.gov/fungaldatabases/ (accessed on 20 January 2022).
  4. Knapp, D.G.; Kovács, G.M.; Zajta, E.; Groenewald, J.Z.; Crous, P.W. Dark septate endophytic pleosporalean genera from semiarid areas. Persoonia 2015, 35, 87–100. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Sarkar, T.; Chakraborty, P.; Karmakar, A.; Saha, A.; Saha, D. First report of Periconia macrospinosa causing leaf necrosis of pointed gourd in India. J. Plant Pathol. 2019, 101, 1281. [Google Scholar] [CrossRef] [Green Version]
  6. Samarakoon, B.C.; Phookamsak, R.; Karunarathna, S.C.; Jeewon, R.; Chomnunti, P.; Xu, J.C.; Li, Y.J. New host and geographic records of five pleosporalean hyphomycetes associated with Musa spp. (Banana). Stud. Fungi 2021, 6, 92–115. [Google Scholar] [CrossRef]
  7. Kim, S.; Shin, D.S.; Lee, T.; Oh, K.B. Percinicins, two new fusicoccane diterpenes produced by an endophytic fungus Periconia sp. with antibacterial activity. J. Nat. Prod. 2004, 67, 448–450. [Google Scholar] [CrossRef] [PubMed]
  8. Harnpicharnchai, P.; Champreda, V.; Sornlake, W.; Eurwilaichitr, L. A thermotolerant β-glucosidase isolated from an endophytic fungi, Periconia sp., with a possible use for biomass conversion to sugars. Protein Expr. Purif. 2009, 67, 61–69. [Google Scholar] [CrossRef]
  9. Zhang, D.; Tao, X.; Chen, R.; Liu, J.; Li, L.; Fang, X.; Yu, L.Y.; Dai, J. Pericoannosin A, a polyketide synthase–nonribosomal peptide synthetase hybrid metabolite with new carbon skeleton from the endophytic fungus Periconia sp. Org. Lett. 2015, 17, 4304–4307. [Google Scholar] [CrossRef]
  10. Zhang, D.; Tao, X.; Liu, J.; Chen, R.; Zhang, M.; Li, L.; Fang, X.M.; Yu, L.; Dai, J. Periconiasin G, a new cytochalasan with unprecedented 7/6/5 tricyclic ring system from the endophytic fungus Periconia sp. Tetrahedron Lett. 2016, 57, 796–799. [Google Scholar] [CrossRef]
  11. Azhari, A.; Supratman, U. The Chemistry and Pharmacology of Fungal Genus Periconia: A Review. Sci. Pharm. 2021, 89, 34. [Google Scholar] [CrossRef]
  12. Tanaka, K.; Hirayama, K.; Yonezawa, H.; Sato, G.; Toriyabe, A.; Kudo, H.; Hashimoto, A.; Matsumura, M.; Harada, Y.; Kurihara, Y.; et al. Revision of the Massarineae (Pleosporales, Dothideomycetes). Stud. Mycol. 2015, 82, 75–136. [Google Scholar] [CrossRef] [Green Version]
  13. Saccardo, P.A. Sylloge Hyphomycetum. Sylloge Fungorum 1886, 4, 1–807. [Google Scholar]
  14. Crous, P.W.; Shivas, R.G.; Quaedvlieg, W.; van der Bank, M.; Zhang, Y.; Summerell, B.A.; Guarro, J.; Wingfield, M.; Wood, A.; Alfenas, A.; et al. Fungal planet description sheets: 214–280. Persoonia 2014, 32, 184–306. [Google Scholar] [CrossRef] [PubMed]
  15. Adamčík, S.; Cai, L.; Chakraborty, D.; Chen, X.H.; Cotter, H.V.T.; Dai, D.Q.; Dai, Y.C.; Das, K.; Deng, C.; Ghobad-Nejhad, M.; et al. Fungal biodiversity profiles 1–10. Cryptogam. Mycol. 2015, 36, 121–166. [Google Scholar] [CrossRef]
  16. Crous, P.W.; Groenewald, J.Z.; Shivas, R.G.; Edwards, J.; Seifert, K.A.; Alfenas, A.C.; Alfenas, R.F.; Burgess, T.; Carnegie, A.; Hardy, G.; et al. Fungal Planet description sheets: 69–91. Persoonia 2011, 26, 108–156. [Google Scholar] [CrossRef] [PubMed]
  17. Wijayawardene, N.N.; Hyde, K.D.; Al-Ani, L.K.T.; Tedersoo, L.; Haelewaters, D.; Kunhiraman, C.; Rajeshkumar, K.C.; Zhao, R.L.; Aptroot, A.; Leontyev, D.V.; et al. Outline of Fungi and fungi-like taxa. Mycosphere 2020, 11, 1060–1456. [Google Scholar] [CrossRef]
  18. Liu, N.G.; Hongsanan, S.; Yang, J.; Bhat, D.J.; Liu, J.K.; Jumpathong, J.J.; Liu, Z. Periconia thailandica (Periconiaceae), a new species from Thailand. Phytotaxa 2017, 323, 253–263. [Google Scholar] [CrossRef]
  19. Thambugala, K.M.; Wanasinghe, D.N.; Phillips, A.J.L.; Camporesi, E.; Bulgakov, T.S.; Phukhamsakda, C.; Ariyawansa, H.A.; Goonasekara, I.D.; Phookamsak, R.; Dissanayake, A.; et al. Mycosphere notes 1–50: Grass (Poaceae) inhabiting Dothideomycetes. Mycosphere 2017, 8, 697–796. [Google Scholar] [CrossRef]
  20. Hyde, K.D.; Chaiwan, N.; Norphanphoun, C.; Boonmee, S.; Camporesi, E.; Chethana, K.W.T.; Dayarathne, M.C.; de Silva, N.; Dissanayake, A.J.; Ekanayaka, A.H.; et al. Mycosphere notes 169–224. Mycosphere 2018, 9, 271–430. [Google Scholar] [CrossRef]
  21. Jayasiri, S.C.; Hyde, K.D.; Jones, E.B.G.; McKenzie, E.H.C.; Jeewon, R.; Phillips, A.J.L.; Bhat, D.J.; Wanasinghe, D.N.; Liu, J.K.; Lu, Y.Z.; et al. Diversity, morphology and molecular phylogeny of Dothideomycetes on decaying wild seed pods and fruits. Mycosphere 2019, 10, 1–186. [Google Scholar] [CrossRef]
  22. Phookamsak, R.; Hyde, K.D.; Jeewon, R.; Bhat, D.J.; Jones, E.B.G.; Maharachchikumbura, S.S.N.; Raspé, O.; Karunarathna, S.C.; Wanasinghe, D.; Hongsanan, S.; et al. Fungal diversity notes 929–1035: Taxonomic and phylogenetic contributions on genera and species of fungi. Fungal Divers. 2019, 95, 1–273. [Google Scholar] [CrossRef] [Green Version]
  23. Tode, H.J. Fungi Mecklenburgenses Selecti. Fasc. II, Generum Novorum Appendicem; Kessinger Publishing, LLC.: Lüneburg, Germany, 1791; Volume 2, pp. 1–67. [Google Scholar]
  24. Markovskaja, S.; Kacergius, A. Morphological and molecular characterisation of Periconia pseudobyssoides sp. nov. and closely related P. byssoides. Mycol. Prog. 2014, 13, 291–302. [Google Scholar] [CrossRef]
  25. Saccardo, P.A. Fungi Gallici lecti a cl. viris P. Brunaud, Abb. Letendre, A. Malbranche, J. Therry, vel editi in Mycotheca Gallica C. Roumeguèri. Series II. Michelia 1880, 2, 39–135. [Google Scholar]
  26. Hughes, S.J. Revisiones Hyphomycetum aliquot cum appendice de nominibus rejiciendis. Can. J. Bot. 1958, 36, 727–836. [Google Scholar] [CrossRef]
  27. Benjamin, C.R.; Hesseltine, C.W. Studies on the genus Phycomyces. Mycologia 1959, 51, 751–771. [Google Scholar] [CrossRef]
  28. Malloch, D.W. Scopinella sphaerophila. Fungi Canadenses 1976, 83, 1–2. [Google Scholar]
  29. Hawksworth, D.L. Three new genera of lichenicolous fungi. Bot. J. Linn. Soc. 1977, 75, 195–209. [Google Scholar] [CrossRef]
  30. Illman, W.I.; White, G.P. The synnematous hyphomycete Morrisographium pilosum (Earle) Moreletsynonymous with a ‘Coelomycete’, ‘Cornulariapersicae’ (Schw.) Sacc. Mycotaxon 1984, 19, 145–150. [Google Scholar]
  31. Aptroot, A. A world revision of Massarina (Ascomycota). Nova Hedwig. 1998, 66, 89–162. [Google Scholar] [CrossRef]
  32. Okada, G.; Jacobs, K.; Kirisits, T.; Louis-Seize, G.W.; Seifert, K.A.; Sugita, T.; Takematsu, A.; Wingfield, M.J. Epitypification of Graphium penicillioides Corda, with comments on the phylogeny and taxonomy of graphium-like synnematous fungi. Stud. Mycol. 2000, 45, 169–188. [Google Scholar]
  33. Partridge, E.C.; Morgan-Jones, G. Notes on hyphomycetes LXXXVIII: New genera in which to classify Alysidium resinae and Pycnostysanus azaleae, with a consideration of Sorocybe. Mycotaxon 2002, 83, 335–352. [Google Scholar]
  34. Schubert, K.; Braun, U.; Groenewald, J.Z.; Crous, P.W. Cladosporium leaf-blotch and stem rot of Paeonia spp. caused by Dichocladosporium chlorocephalum gen. nov. Stud. Mycol. 2007, 58, 95–104. [Google Scholar] [CrossRef]
  35. Chlebicki, A. Cephalotrichum stemonitis as a biofilm inhabitant in the gold mine in Poland. Acta Mycol. 2008, 43, 67–70. [Google Scholar] [CrossRef]
  36. Kiyuna, T.; An, K.D.; Kigawa, R.; Sano, C.; Miura, S. Molecular assessment of fungi in “black spots” that deface murals in the Takamatsuzuka and Kitora Tumuli in Japan: Acremonium sect. Gliomastix including Acremonium tumulicola sp. nov. and Acremonium felinum comb. nov. Mycoscience 2011, 52, 1–17. [Google Scholar] [CrossRef]
  37. Videira, S.I.R.; Groenewald, J.Z.; Nakashima, C.; Braun, U.; Barreto, R.W.; de Wit, P.J.G.M.; Crous, P.W. Mycosphaerellaceae—Chaos or clarity? Stud. Mycol. 2017, 87, 257–421. [Google Scholar] [CrossRef]
  38. Yin, M.L.; Wingfield, M.J.; Zhou, X.D.; de Beer, Z.W. Phylogenetic re-evaluation of the Grosmannia penicillata complex (Ascomycota, Ophiostomatales), with the description of five new species from China and USA. Fungal Biol. 2020, 124, 110–124. [Google Scholar] [CrossRef]
  39. Species Fungorum. Available online: http://www.speciesfungorum.org/Names/Names/Names.asp (accessed on 20 January 2022).
  40. Tennakoon, D.S.; Kuo, C.H.; Maharachchikumbura, S.S.N.; Thambugala, K.M.; Gentekaki, E.; Phillips, A.J.L.; Bhat, D.J.; Wanasinghe, D.N.; de Silva, N.I.; Promputtha, I.; et al. Taxonomic and phylogenetic contributions to Celtis formosana, Ficus ampelas, F. septica, Macaranga tanarius and Morus australis leaf litter inhabiting microfungi. Fungal Divers. 2021, 108, 1–215. [Google Scholar] [CrossRef]
  41. Carmarán, C.C.; Novas, M.V. A review of Spegazzini taxa of Periconia and Sporocybe after over 115 years. Fungal Divers. 2003, 14, 67–76. [Google Scholar]
  42. Index Fungorum. Bambusistroma Didymosporum D.Q. Dai & K.D. Hyde. 2015. Available online: http://www.indexfungorum.org/Names/NamesRecord.asp?RecordID=551028 (accessed on 12 January 2022).
  43. Hyde, K.D.; Dong, Y.; Phookamsak, R.; Jeewon, R.; Bhat, D.J.; Jones, E.B.G.; Liu, N.G.; Abeywickrama, P.D.; Mapook, A.; Wei, D.; et al. Fungal diversity notes 1151–1276: Taxonomic and phylogenetic contributions on genera and species of fungal taxa. Fungal Divers. 2020, 100, 5–277. [Google Scholar] [CrossRef] [Green Version]
  44. Dai, D.Q.; Phookamsak, R.; Wijayawardene, N.N.; Li, W.J.; Bhat, D.J.; Xu, J.C.; Taylor, J.E.; Hyde, K.D.; Chukeatirote, E. Bambusicolous fungi. Fungal Divers. 2017, 82, 1–105. [Google Scholar] [CrossRef]
  45. Vilgalys, R.; Hester, M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J. Bacteriol. 1990, 172, 4238–4246. [Google Scholar] [CrossRef] [Green Version]
  46. White, T.J.; Bruns, T.; Lee, S.J.W.T.; Taylor, J.W. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Academic Press: Cambridge, MA, USA, 1990; Volume 18, pp. 315–322. [Google Scholar]
  47. Rehner, S. Primers for Elongation Factor 1-Alpha (EF1-Alpha). 2001. Available online: http://ocid.NACSE.ORG/research/ (accessed on 23 September 2021).
  48. Tibpromma, S.; Hyde, K.D.; Jeewon, R.; Maharachchikumbura, S.S.N.; Liu, J.K.; Bhat, D.J.; Jones, E.B.G.; McKenzie, E.H.C.; Camporesi, E.; Bulgakov, T.; et al. Fungal diversity notes 491–602: Taxonomic and phylogenetic contributions to fungal taxa. Fungal Divers. 2017, 83, 1–261. [Google Scholar] [CrossRef]
  49. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar] [CrossRef]
  50. Crous, P.W.; Wingfield, M.J.; Lombard, L.; Roets, F.; Swart, W.J.; Alvarado, P.; Carnegie, A.J.; Moreno, G.; Luangsa-Ard, J.; Thangavel, R.; et al. Fungal Planet description sheets: 951–1041. Persoonia 2019, 43, 223–425. [Google Scholar] [CrossRef]
  51. Calvillo-Medina, R.P.; Cobos-Villagran, A.; Raymundo, T. Periconia citlaltepetlensis sp. nov. (Periconiaceae, Pleosporales): A psychrotolerant fungus from high elevation volcanic glacier (Mexico). Phytotaxa 2020, 459, 235–247. [Google Scholar] [CrossRef]
  52. Phukhamsakda, C.; McKenzie, E.H.C.; Phillips, A.J.L.; Jones, E.B.G.; Bhat, D.J.; Stadler, M.; Bhunjun, C.S.; Wanasinghe, D.N.; Thongbai, B.; Camporesi, E.; et al. Microfungi associated with Clematis (Ranunculaceae) with an integrated approach to delimiting species boundaries. Fungal Divers. 2020, 102, 1–203. [Google Scholar] [CrossRef]
  53. Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. 2019, 20, 1160–1166. [Google Scholar] [CrossRef] [Green Version]
  54. Stamatakis, A.; Hoover, P.; Rougemont, J. A rapid bootstrap algorithm for the RAxML web servers. Syst. Biol. 2008, 57, 758–771. [Google Scholar] [CrossRef]
  55. Stamatakis, A. RAxML Version 8: A tool for Phylogenetic Analysis and Post-Analysis of Large Phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef]
  56. Miller, M.A.; Pfeiffer, W.; Schwartz, T. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In Proceedings of the 2010 Gateway Computing Environments Workshop (GCE), New Orleans, LA, USA, 14 November 2010; pp. 1–8. [Google Scholar]
  57. Nylander, J.A.A. MrModeltest v2. Program Distributed by the Author; Evolutionary Biology Centre, Uppsala University: Uppsala, Sweden, 2004. [Google Scholar]
  58. Rannala, B.; Yang, Z. Probability distribution of molecular evolutionary trees: A new method of phylogenetic inference. J. Mol. Evol. 1996, 43, 304–311. [Google Scholar] [CrossRef]
  59. Zhaxybayeva, O.; Gogarten, J.P. Bootstrap, Bayesian probability and maximum likelihood mapping: Exploring new tools for comparative genome analyses. Genomics 2002, 3, 1–15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  60. Rambaut, A.; Drummond, A.J.; Xie, D.; Baele, G.; Suchard, M.A. Posterior summarisation in Bayesian phylogenetics using Tracer 1.7. Syst. Biol. 2018, 67, 901–904. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  61. Bruen, T.C.; Philippe, H.; Bryant, D. A simple and robust statistical test for detecting the presence of recombination. Genetics 2006, 172, 2665–2681. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  62. Huson, D.H. SplitsTree: Analyzing and visualizing evolutionary data. Bioinformatics 1998, 14, 68–73. [Google Scholar] [CrossRef]
  63. Huson, D.H.; Bryant, D. Application of phylogenetic networks in evolutionary studies. Mol. Biol. Evol. 2006, 23, 254–267. [Google Scholar] [CrossRef]
  64. Quaedvlieg, W.; Binder, M.; Groenewald, J.Z.; Summerell, B.A.; Carnegie, A.J.; Burgess, T.I.; Crous, P.W. Introducing the Consolidated Species Concept to resolve species in the Teratosphaeriaceae. Persoonia 2014, 33, 1–40. [Google Scholar] [CrossRef] [Green Version]
  65. Jeewon, R.; Hyde, K.D. Establishing species boundaries and new taxa among fungi: Recommendations to resolve taxonomic ambiguities. Mycosphere 2016, 7, 1669–1677. [Google Scholar] [CrossRef]
  66. Vu, D.; Groenewald, M.; de Vries, M.; Gehrmann, T.; Stielow, B.; Eberhardt, U.; Al-Hatmi, A.; Groenewald, J.Z.; Cardinali, G.; Houbraken, J.; et al. Large-scale generation and analysis of filamentous fungal DNA barcodes boosts coverage for kingdom fungi and reveals thresholds for fungal species and higher taxon delimitation. Stud. Mycol. 2019, 92, 135–154. [Google Scholar] [CrossRef]
  67. Rodrigues, A.; Mueller, U.G.; Ishak, H.D.; Bacci, M.; Pagnocca, F.C. Ecology of microfungal communities in gardens of fungus-growing ants (Hymenoptera: Formicidae): A year-long survey of three species of attine ants in Central Texas. FEMS Microbiol. Ecol. 2011, 78, 244–255. [Google Scholar] [CrossRef] [Green Version]
  68. Wu, W.P.; Zhuang, W.Y. Sporidesmium, Endophragmiella and related genera from China. Fungal Divers. Res. Ser. 2005, 15, 1–351. [Google Scholar]
  69. Shenoy, B.D.; Jeewon, R.; Wu, W.P.; Bhat, D.J.; Hyde, K.D. Ribosomal and RPB2 DNA sequence analyses suggest that Sporidesmium and morphologically similar genera are polyphyletic. Mycol. Res. 2006, 110, 916–928. [Google Scholar] [CrossRef] [PubMed]
  70. Bovio, E.; Garzoli, L.; Poli, A.; Prigione, V.; Firsova, D.; McCormack, G.P.; Varese, G.C. The culturable mycobiota associated with three Atlantic sponges, including two new species: Thelebolus balaustiformis and T. spongiae. Fuse 2018, 1, 141–167. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  71. Corda, A.C.J. Icones fungorum hucusque cognitorum. J. Nat. Hist. 1837, 1, 1–32. [Google Scholar]
  72. Dayarathne, M.C.; Jones, E.B.G.; Maharachchikumbura, S.S.N.; Devadatha, B.; Sarma, V.V.; Khongphinitbunjong, K.; Chomnunti, P.; Hyde, K.D. Morpho-molecular characterization of microfungi associated with marine based habitats. Mycosphere 2020, 11, 1–188. [Google Scholar] [CrossRef]
Figure 1. Phylogram generated from maximum likelihood analysis based on combined ITS, LSU, SSU and tef1-α sequence data. Bootstrap values for maximum likelihood equal to or greater than 70% and Bayesian posterior probabilities equal to or greater than 0.95 are placed above the nodes as ML/PP. An asterisk (*) indicates insignificant support values corresponding with the newly generated strains and discussed species in this study. Ex-type strains are in bold, and the newly generated species and combination species are indicated in red.
Figure 1. Phylogram generated from maximum likelihood analysis based on combined ITS, LSU, SSU and tef1-α sequence data. Bootstrap values for maximum likelihood equal to or greater than 70% and Bayesian posterior probabilities equal to or greater than 0.95 are placed above the nodes as ML/PP. An asterisk (*) indicates insignificant support values corresponding with the newly generated strains and discussed species in this study. Ex-type strains are in bold, and the newly generated species and combination species are indicated in red.
Jof 08 00243 g001
Figure 2. Split graphs showing the results of the pairwise homoplasy index (PHI) tests of closely related taxa using LogDet transformation and split decomposition. PHI test results (Φw) ≤ 0.05 indicate significant recombination within the dataset.
Figure 2. Split graphs showing the results of the pairwise homoplasy index (PHI) tests of closely related taxa using LogDet transformation and split decomposition. PHI test results (Φw) ≤ 0.05 indicate significant recombination within the dataset.
Jof 08 00243 g002
Figure 3. Periconia artemisiae (KUN-HKAS 107384, holotype). (a) Colonies on the host substrate; (b) close-up of colonies on substrate; (c,d) conidiophores; (e,f) conidial heads bearing conidiogenous cells and conidia. (g) conidia sporulated on PDA after three months. (h,i) colony on PDA ((h) = from above, (i) = from below)); (j) germinating conidium; (ko) conidia. Scale bars: (c,d) = 100 μm, (e,f) = 30 μm, (j) = 20 μm, g, (lo) = 15 μm, (k) = 10 μm.
Figure 3. Periconia artemisiae (KUN-HKAS 107384, holotype). (a) Colonies on the host substrate; (b) close-up of colonies on substrate; (c,d) conidiophores; (e,f) conidial heads bearing conidiogenous cells and conidia. (g) conidia sporulated on PDA after three months. (h,i) colony on PDA ((h) = from above, (i) = from below)); (j) germinating conidium; (ko) conidia. Scale bars: (c,d) = 100 μm, (e,f) = 30 μm, (j) = 20 μm, g, (lo) = 15 μm, (k) = 10 μm.
Jof 08 00243 g003
Figure 4. Periconia byssoides (KUN-HKAS 107383). (a) Colonies on the host substrate; (b) closed up conidiophores on host; (c,d) conidial heads bearing conidiogenous cells and conidia; (e,f) conidiogenous cells with attached conidia; (g,h) conidiophores with spherical conidial heads; (i,j,m,n) conidia; (k) germinated conidia; (l) forward and reverse colonies on PDA. Scale bars: (g,h) = 100 μm, (c,d) = 50 μm, (e,f) = 20 μm, (ik,m,n) = 15 μm.
Figure 4. Periconia byssoides (KUN-HKAS 107383). (a) Colonies on the host substrate; (b) closed up conidiophores on host; (c,d) conidial heads bearing conidiogenous cells and conidia; (e,f) conidiogenous cells with attached conidia; (g,h) conidiophores with spherical conidial heads; (i,j,m,n) conidia; (k) germinated conidia; (l) forward and reverse colonies on PDA. Scale bars: (g,h) = 100 μm, (c,d) = 50 μm, (e,f) = 20 μm, (ik,m,n) = 15 μm.
Jof 08 00243 g004
Figure 5. Periconia chimonanthi (KUN-HKAS 107380, holotype). (a) Located fungal colonies on host substrate; (b) closed up of conidiophores on host surface; (c) conidiophore with spherical conidial head; (d,e) conidiogenous cells bearing conidia in short chains; (f) germinated conidium; (g) colony from above and below; (hj) conidia; (kn) conidiogenous cells bearing conidia sporulated in vitro. Scale bars: (c) = 100 μm, (d) = 30 μm, (f) = 20 μm, (e,h,k) =15 μm, (i,j,l,n) = 10 μm, (m) = 5 μm.
Figure 5. Periconia chimonanthi (KUN-HKAS 107380, holotype). (a) Located fungal colonies on host substrate; (b) closed up of conidiophores on host surface; (c) conidiophore with spherical conidial head; (d,e) conidiogenous cells bearing conidia in short chains; (f) germinated conidium; (g) colony from above and below; (hj) conidia; (kn) conidiogenous cells bearing conidia sporulated in vitro. Scale bars: (c) = 100 μm, (d) = 30 μm, (f) = 20 μm, (e,h,k) =15 μm, (i,j,l,n) = 10 μm, (m) = 5 μm.
Jof 08 00243 g005
Figure 6. Periconia didymosporum (MFLU 15-0057, holotype of Bambusistroma didymosporum). (ac) Ascomata developing on bamboo culm; (d,e) vertically section of ascomata; (f) section through peridium; (gj) immature and mature asci; (k) pseudoparaphyses; (l) an apical ascus; (mr) ascospores. Scale bars: (d,e) = 100 μm, (fk) = 30 μm, (ln) = 10 μm. Photo credit by D.Q. Dai.
Figure 6. Periconia didymosporum (MFLU 15-0057, holotype of Bambusistroma didymosporum). (ac) Ascomata developing on bamboo culm; (d,e) vertically section of ascomata; (f) section through peridium; (gj) immature and mature asci; (k) pseudoparaphyses; (l) an apical ascus; (mr) ascospores. Scale bars: (d,e) = 100 μm, (fk) = 30 μm, (ln) = 10 μm. Photo credit by D.Q. Dai.
Jof 08 00243 g006
Figure 7. Periconia pseudobyssoides (KUN-HKAS 107382). (a) Standing hairy-like conidiophores of P. pseudobyssoides on host substrate; (b) close-up of conidiophores on substrate (c,d) conidiophores bearing spherical, conidial heads; (e,f) spherical conidial heads bearing conidiogenous cells and conidia; (g,i,j) conidia; (h) germinated conidia; (k) colony on PDA from above and below; (l) close-up conidial masses on PDA; (m,n) conidia sporulated in vitro. Scale bars: (c,d) = 200 μm, (e) = 50 μm, (g,m) = 30 μm, (f,n) = 20 μm, (hj) = 15 μm.
Figure 7. Periconia pseudobyssoides (KUN-HKAS 107382). (a) Standing hairy-like conidiophores of P. pseudobyssoides on host substrate; (b) close-up of conidiophores on substrate (c,d) conidiophores bearing spherical, conidial heads; (e,f) spherical conidial heads bearing conidiogenous cells and conidia; (g,i,j) conidia; (h) germinated conidia; (k) colony on PDA from above and below; (l) close-up conidial masses on PDA; (m,n) conidia sporulated in vitro. Scale bars: (c,d) = 200 μm, (e) = 50 μm, (g,m) = 30 μm, (f,n) = 20 μm, (hj) = 15 μm.
Jof 08 00243 g007
Figure 8. Periconia thysanolaenae (KUN-HKAS 107381, holotype) (a) Dead culms of Thysanolaena latifolia (Poaceae); (b) close-up of conidiophores on host substrate; (c) apical branch conidiophores with conidial head; (d) polyblastic conidiogenous cells bearing catenate conidia; (e) a conidiophore; (f) close-up base of the conidiophores; (g) germinated conidium; (h) conidiogenous cell with developing conidium on upper fertile part; (j) single conidia; (k,l) catenate conidia; (i,m) colony from above and below. Scale bars: (e) = 100 μm, (c) = 30 μm, (f,d) = 20 μm, (j) = 10 μm, (g,h,k,l) = 5 μm.
Figure 8. Periconia thysanolaenae (KUN-HKAS 107381, holotype) (a) Dead culms of Thysanolaena latifolia (Poaceae); (b) close-up of conidiophores on host substrate; (c) apical branch conidiophores with conidial head; (d) polyblastic conidiogenous cells bearing catenate conidia; (e) a conidiophore; (f) close-up base of the conidiophores; (g) germinated conidium; (h) conidiogenous cell with developing conidium on upper fertile part; (j) single conidia; (k,l) catenate conidia; (i,m) colony from above and below. Scale bars: (e) = 100 μm, (c) = 30 μm, (f,d) = 20 μm, (j) = 10 μm, (g,h,k,l) = 5 μm.
Jof 08 00243 g008
Table 1. Species names, strain numbers and corresponding GenBank accession numbers of taxa used in the present phylogenetic analyses.
Table 1. Species names, strain numbers and corresponding GenBank accession numbers of taxa used in the present phylogenetic analyses.
Species NameStrain/Voucher No.GenBank Accession Numbers
ITSLSUSSUtef1
Flavomyces fulophazaeCBS 135664KP184000KP184039KP184081/
Flavomyces fulophazaeCBS 135761NR_137960NG_058131NG_061191/
Lentithecium aquaticumCBS 123099NR_160229NG_064211NG_016507GU349068
Lentithecium clioninumKT 1149ALC014566AB807540AB797250AB808515
Lentithecium clioninumKT 1220LC014567AB807541AB797251AB808516
Massarina cistiCBS 266.62/AB807539AB797249AB808514
Massarina eburneaCBS 473.64/GU301840GU296170GU349040
Morosphaeria ramunculicolaKH 220/AB807554AB797264AB808530
Morosphaeria velatisporaKH 221LC014572AB807556AB797266AB808532
Periconia alishanicaKUMCC 19-0174MW063167MW063231/MW183792
Periconia alishanicaMFLUCC 19-0145MW063165MW063229/MW183790
Periconia alishanicaNCYUCC 19-0186MW063166MW063230/MW183791
Periconia aquaticaMFLUCC 16-0912KY794701KY794705/KY814760
Periconia artemisiaeKUMCC 20-0265MW448657MW448571MW448658MW460898
Periconia banksiae (as Noosia banksiae)CBS 129526/NG_064279//
Periconia byssoidesKUMCC 20-0264MW444854MW444855MW444856MW460895
Periconia byssoidesMAFF 243869LC014582AB807569AB797279AB808545
Periconia byssoidesMFLUCC 17-2292MK347751MK347968MK347858MK360069
Periconia byssoidesMFLUCC 18-1548MK347794MK348013MK347902MK360070
Periconia byssoidesMFLUCC 18-1553MK347806MK348025MK347914MK360068
Periconia byssoides (as Periconia celtidis)MFLUCC 20-0172MW063162MW063226//
Periconia byssoides (as Periconia celtidis)NCYUCC 19-0314MW063163MW063227//
Periconia caespitosaLAMIC 110 16MH051906MH051907//
Periconia chimonanthiKUMCC 20-0266MW448660MW448572MW448656MW460897
Periconia citlaltepetlensisIOM 325319.1MH890645MT625978//
Periconia citlaltepetlensisIOM 325319.2MT649221MT649216//
Periconia cookeiMFLUCC 17-1399MG333490MG333493/MG438279
Periconia cookeiMFLUCC 17-1679/MG333492/MG438278
Periconia cortaderiaeMFLUCC 15-0451KX965734KX954403KX986346KY429208
Periconia cortaderiaeMFLUCC 15-0453KX965733KX954402/KY320574
Periconia cortaderiaeMFLUCC 15-0457KX965732KX954401KX986345KY310703
Periconia cyperacearumCPC 32138NR_160357NG_064549//
Periconia delonicisMFLUCC 17-2584/NG_068611NG_065770MK360071
Periconia didymosporum
(as Bambusistroma didymosporum)
MFLU 15-0058KP761734KP761731KP761738KP761728
Periconia digitataCBS 510.77LC014584AB807561AB797271AB808537
Periconia elaeidisMFLUCC 17-0087MG742713MH108552MH108551/
Periconia epilithographicolaCBS 144017NR_157477///
Periconia homothallicaKT 916AB809645AB807565AB797275/
Periconia igniariaCBS 379.86LC014585AB807566AB797276AB808542
Periconia igniariaCBS 845.96LC014586AB807567AB797277AB808543
Periconia macrospinosaCBS 135663KP183999KP184038KP184080/
Periconia macrospinosaREF144JN859364JN859484//
Periconia minutissimaMFLUCC 15-0245KY794703KY794707//
Periconia minutissimaMUT 2887MG813227///
Periconia neobrittanicaCPC 37903NR_166344NG_068342//
Periconia palmicolaMFLUCC 14-0400/NG_068917MN648319MN821070
Periconia prolificaDBOF23JQ724384///
Periconia prolificaDBOF74JQ724435///
Periconia prolificaDBOF129JQ724490///
Periconia prolificaDBOF153JQ724513///
Periconia pseudobyssoidesDUCC 0850MG333491MG333494/MG438280
Periconia pseudobyssoidesKUMCC 20-0263MW444851MW444852MW444853MW460894
Periconia pseudobyssoidesMAFF 243868LC014587AB807568AB797278AB808544
Periconia pseudobyssoidesMAFF 243874LC014588AB807560AB797270AB808536
Periconia pseudodigitataKT 644LC014589AB807562AB797272AB808538
Periconia pseudodigitataKT 1395NR_153490NG_059396NG_064850AB808540
Periconia salinaMFLU 19-1235MN047086MN017846MN017912/
Periconia sp.C75MK304380///
Periconia sp.CY 137HQ607981///
Periconia sp.G1782MK247789///
Pericona sp.KT 1825/AB807573AB797283AB808549
Pericona sp.KT 1820A/AB807572AB797282AB808548
Pericona sp.Out0123MT908499///
Periconia submersaMFLUCC 16-1098KY794702KY794706/KY814761
Periconia thailandicaMFLUCC 17-0065KY753887KY753888KY753889/
Periconia thysanolaenaeKUMCC 20-0262MW442967MW444850MW448659MW460896
Periconia variicolorSACCR-64DQ336713///
Periconia verrucosaMFLUCC 17-2158MT310617MT214572MT226686MT394631
Sporidesmium tengiiHKUCC 10837/DQ408559//
* The newly generated sequences are indicated in red, and the ex-type strains are in bold. Abbreviations: CBS: Culture Collection of the Westerdijk Fungal Biodiversity Institute, Utrecht, Netherlands; CPC: Culture Collection of Pedro Crous, Netherlands; DBOF: DNA Barcoding Ocean Fungi; DUCC: Dali University Culture Collection, Yunnan, China; HKUCC: The University of Hong Kong Culture Collection, Hong Kong, China; IOM: Instituto de Oftalmología “Fundación Conde de Valenciana” IAP Mexico Culture Collection; KH: K. Hirayama; KT: Kaz. Tanaka; KUMCC: Kunming Institute of Botany Culture Collection, Kunming, China; LAMIC: Laboratorio de Micologia, Universidade Estadual de Feira de Santana, Brazil; MAFF: Ministry of Agriculture, Forestry and Fisheries, Japan; MFLU: Herbarium of Mae Fah Luang University, Chiang Rai, Thailand; MFLUCC: Mae Fah Luang University Culture Collection, Chiang Rai, Thailand; MUT: Mycotheca Universitatis Taurinensis, Department of Life Sciences and Systems Biology, University of Turin, Turin, Italy; NCYUCC: National Chiayi University Culture Collection, Taiwan.
Table 2. Synopsis of Periconia artemisiae, P. banksiae (≡ Noosia banksiae), P. chimonanthi and P. pseudobyssoides.
Table 2. Synopsis of Periconia artemisiae, P. banksiae (≡ Noosia banksiae), P. chimonanthi and P. pseudobyssoides.
Species NameMorphological Characteristics In Vitro
Conidiogenous CellsConidia
Periconia artemisiae
(KUN-HKAS 107384)
2.5–4 × 1–2 μm, mono- to polyblastic, with 1–2 conidiogenous loci, lateral, or integrated, lateral and terminal, brown to dark brown, inconspicuous, giving rise to solitary conidia, or in short chains.5–8 × 4–5 μm globose, brown to dark brown, aseptate, smooth to slightly verruculose.
Periconia banksiae
(≡ Noosia banksiae, CBS H-20587)
Solitary, lateral, or integrated, inconspicuous, lateral and terminal, with small, pimple-like pores of up to 0.5 µm diam.Dimorphic: primary conidia (4–)7–10(–13) × (3.5–)4(–5) µm, aseptate, globose to fusoid-ellipsoidal, subhyaline to brown, smooth to verruculose with age, solitary or in short, branched chains. Secondary conidia 5–15 × 4–5 µm, phragmosporous, brown, verruculose, arising from disarticulating hyphal cells, initially in short chains, forming directly on conidiogenous cells when mature.
P. chimonanthi
(KUN-HKAS 107380)
7–10 × 4.5–6 μm, polyblastic, solitary, erect, lateral and terminal, cylindrical to irregular, luteous to brown, discrete or integrated, determinate, or inconspicuous, percurrent proliferations, with 1–3 conidiogenous loci.6–8 × 6–8 μm, globose to oblong, or ellipsoidal, subhyaline to brown or dark brown, smooth to verruculose, solitary or in short chains.
P. pseudobyssoides
(KUN-HKAS 107382)
4–6 × 2.5–4 μm, monoblastic, solitary, terminal, inconspicuous, with small, pimple-like pores, arising from brown and verruculose hyphae.13–16 × 12–15 μm, solitary, globose, reddish-brown, aseptate, verruculose.
Notes: Conidiophores reduced to conidiogenous cells for all of these species. The morphological characteristics of Periconia banksiae (≡ Noosia banksiae) are adopted from Crous et al. [16].
Table 3. Polymorphic nucleotides from the LSU, ITS and tef1-α sequence data of Periconia byssoides and P. celtidis.
Table 3. Polymorphic nucleotides from the LSU, ITS and tef1-α sequence data of Periconia byssoides and P. celtidis.
Species NameStrain NumberNucleotide Base Differences
LSU (Base Position)ITS (Base Position)tef1-α (Base Position)
361431432468485633424845949569105237309328336426435567660723915
Periconia byssoidesKUMCC 20-0264TGAATC-TTTTTTTGTGCTTGT
Periconia byssoidesMAFF 243869TTTGTC-CCCTCTTGCGTTTGT
Periconia byssoidesMFLUCC 17-2292TTTATT-CCCTCTTGCGTTGGT
Periconia byssoidesMFLUCC 18-1548TGAATC-TTCTTCCATGTCTAC
Periconia byssoidesMFLUCC 18-1553CGAATCATTCCTTTGTATCTGT
Periconia celtidisMFLUCC 20-0172TTTGCC-CCCSequence unavailable
Periconia celtidisNCYUCC 19-0314TTTGCC-CCCSequence unavailable
Table 4. Morphological comparison of Periconia byssoides strains isolated from different hosts based on available molecular data.
Table 4. Morphological comparison of Periconia byssoides strains isolated from different hosts based on available molecular data.
TaxaMorphological CharacteristicsReferences
Periconia byssoides
Strain No.
ConidiophoresConidiogenous CellsConidia
KUMCC 20-0264355–635 × 12.5–17 μm, macronematous, mononematous, solitary, rarely 1−2 together on stroma, 1−3-septate, dark brown to black at the base, paler brown towards the apex, unbranched, rarely branched at the apex, knot-like near the base, smooth or slightly rough, thick-walled.6–9 × 5–8 μm, polyblastic, discrete, terminal, subglobose to ellipsoidal, light brown, located at nodose apices of conidiophores.13–15 × 12.5–14.5 μm, solitary or catenate, globose to subglobose, orangish brown to brown, aseptate, echinulate or verruculoseThis study
BILAS 50335/
culture S2-11P
(Sporulated on MEA)
Variable in length, simple, micro- or semi-macronematous, unbranched and branched, initially subhyaline to brownish, becoming dark brown at maturity, subhyaline or hyaline at the apex, septate, verruculose, formed singly or in small groups pushing through the weft of mycelium.Mono- and polyblastic, discrete, determinate, terminal or lateral, subglobose, smooth to verruculose, pale brown, formed on an apical cell and in the collar region around the septa.(11.5–)12.5–15(−17) μm diam., globose, pale brown to brown, verruculose or verrucose, in acropetal chains (3–4 in number).[24]
MFLUCC 17-2292350–420 × 4.5–5.5 μm, macronematous, mononematous, single or rarely 2–3 together on stroma, brown to dark brown, erect, or bent, septate, smooth, thick-walled.Monoblastic, discrete on stipe.9–12 × 8–12 μm, catenate, globose, brown to dark brown, aseptate, verruculose.[21]
MFLUCC 19-0134300–370 × 4–5 μm, macronematous, mononematous, unbranched, erect, single, light brown to dark brown, septate, smooth to minutely verruculose, thick-walled.Monoblastic, proliferating, hyaline, terminal, blunt end, ovoid to globose, thick-walled.11–13 × 10–12 μm, solitary, subglobose to globose, light brown to dark brown, aseptate, finely verruculose.[40]
MFLUCC 20-0172 (as P. celtidis)300–380 × 3.5–4.8 μm, macronematous, mononematous, unbranched, erect, single, greyish brown to dark brown, septate, smooth to minutely verruculose, thick-walled.Monoblastic, proliferating, hyaline, terminal, blunt end, ovoid to globose, thick-walled.8–10 × 9–10 μm diam., solitary, subglobose to globose, light brown to dark brown, aseptate, verruculose.[40]
Table 5. Polymorphic nucleotides from the ITS, LSU, and tef1-α sequence data of Periconia pseudobyssoides. The newly generated strain is indicated in bold black and the type strain is indicated as superscript “T”.
Table 5. Polymorphic nucleotides from the ITS, LSU, and tef1-α sequence data of Periconia pseudobyssoides. The newly generated strain is indicated in bold black and the type strain is indicated as superscript “T”.
Species NameStrain NumberNucleotide Base Differences
ITS (Base Position)LSU (Base Position)tef1-α (Base Position)
76419522371331405471564570579648720725764
Periconia pseudobyssoidesTBILAS 50334-TGSequence unavailableSequence unavailable
Periconia pseudobyssoidesDUCC 0850-TGCGTCTTCCTGC
Periconia pseudobyssoidesKUMCC 20-0263ACATACCCTTTTAC
Periconia pseudobyssoidesMAFF 243868-TGCATTCTCTCAG
Periconia pseudobyssoidesMAFF 243874-TGCGTCCCCCTAC
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Yang, E.-F.; Phookamsak, R.; Jiang, H.-B.; Tibpromma, S.; Bhat, D.J.; Karunarathna, S.C.; Dai, D.-Q.; Xu, J.-C.; Promputtha, I. Taxonomic Reappraisal of Periconiaceae with the Description of Three New Periconia Species from China. J. Fungi 2022, 8, 243. https://doi.org/10.3390/jof8030243

AMA Style

Yang E-F, Phookamsak R, Jiang H-B, Tibpromma S, Bhat DJ, Karunarathna SC, Dai D-Q, Xu J-C, Promputtha I. Taxonomic Reappraisal of Periconiaceae with the Description of Three New Periconia Species from China. Journal of Fungi. 2022; 8(3):243. https://doi.org/10.3390/jof8030243

Chicago/Turabian Style

Yang, Er-Fu, Rungtiwa Phookamsak, Hong-Bo Jiang, Saowaluck Tibpromma, Darbhe J. Bhat, Samantha C. Karunarathna, Dong-Qin Dai, Jian-Chu Xu, and Itthayakorn Promputtha. 2022. "Taxonomic Reappraisal of Periconiaceae with the Description of Three New Periconia Species from China" Journal of Fungi 8, no. 3: 243. https://doi.org/10.3390/jof8030243

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop