Next Article in Journal
Usefulness of ß-d-Glucan Assay for the First-Line Diagnosis of Pneumocystis Pneumonia and for Discriminating between Pneumocystis Colonization and Pneumocystis Pneumonia
Next Article in Special Issue
Nephroprotective Effects of Two Ganoderma Species Methanolic Extracts in an In Vitro Model of Cisplatin Induced Tubulotoxicity
Previous Article in Journal
Bioinformatics Analysis and Functional Characterization of the CFEM Proteins of Metarhizium anisopliae
Previous Article in Special Issue
Isolation and Characterization of a Novel Hydrophobin, Sa-HFB1, with Antifungal Activity from an Alkaliphilic Fungus, Sodiomyces alkalinus
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JoF
Volume 8
Issue 7
10.3390/jof8070662
jof-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Multigene Phylogeny, Beauvericin Production and Bioactive Potential of Fusarium Strains Isolated in India

by
Shiwali Rana
1,2,
Sanjay Kumar Singh
1,2,* and
Laurent Dufossé
3,*
1
National Fungal Culture Collection of India, Biodiversity and Palaeobiology Group, MACS’ Agharkar Research Institute, G.G. Agarkar Road, Pune 411004, India
2
Faculty of Science, Savitribai Phule Pune University, Ganeshkhind Road, Ganeshkhind, Pune 411007, India
3
Chembiopro Chimie et Biotechnologie des Produits Naturels, ESIROI Département Agroalimentaire, Université de la Réunion, F-97490 Sainte-Clotilde, Ile de La Réunion, France
*
Authors to whom correspondence should be addressed.
J. Fungi 2022, 8(7), 662; https://doi.org/10.3390/jof8070662
Submission received: 17 May 2022 / Revised: 21 June 2022 / Accepted: 21 June 2022 / Published: 24 June 2022
(This article belongs to the Special Issue Fungi and Fungal Metabolites for the Improvement of Human and Animal Life, Nutrition and Health 2.0)
Browse Figures
Versions Notes

Abstract

:
The taxonomy of the genus Fusarium has been in a flux because of ambiguous circumscription of species-level identification based on morphotaxonomic criteria. In this study, multigene phylogeny was conducted to resolve the evolutionary relationships of 88 Indian Fusarium isolates based on the internal transcribed spacer region, 28S large subunit, translation elongation factor 1-alpha, RNA polymerase second largest subunit, beta-tubulin and calmodulin gene regions. Fusarium species are well known to produce metabolites such as beauvericin (BEA) and enniatins. These identified isolates were subjected to fermentation in Fusarium-defined media for BEA production and tested using TLC, HPLC and HRMS. Among 88 isolates studied, 50 were capable of producing BEA, which varied from 0.01 to 15.82 mg/g of biomass. Fusarium tardicrescens NFCCI 5201 showed maximum BEA production (15.82 mg/g of biomass). The extract of F. tardicrescens NFCCI 5201 showed promising antibacterial activity against Staphylococcus aureus MLS16 MTCC 2940 and Micrococcus luteus MTCC 2470 with MIC of 62.5 and 15.63 µg/mL, respectively. Similarly, the F. tardicrescens NFCCI 5201 extract in potato dextrose agar (40 µg/mL) exhibited antifungal activity in the food poison technique against plant pathogenic and other fungi, Rhizoctonia solani NFCCI 4327, Sclerotium rolfsii NFCCI 4263, Geotrichum candidum NFCCI 3744 and Pythium sp. NFCCI 3482, showing % inhibition of 84.31, 49.76, 38.22 and 35.13, respectively. The antibiotic effect was found to synergize when Fusarium extract and amphotericin B (20 µg/mL each in potato dextrose agar) were used in combination against Rhizopus sp. NFCCI 2108, Sclerotium rolfsii NFCCI 4263, Bipolaris sorokiniana NFCCI 4690 and Absidia sp. NFCCI 2716, showing % inhibition of 50.35, 79.37, 48.07 and 76.72, respectively. The extract also showed satisfactory dose-dependent DPPH radical scavenging activity with an IC50 value of 0.675 mg/mL. This study reveals the correct identity of the Indian Fusarium isolates based on multigene phylogeny and also throws light on BEA production potential, suggesting their possible applicability in the medicine, agriculture and industry.

1. Introduction

Members of the genus Fusarium are ubiquitous and found in soil, air and on plants [1]. Fusarium is an important group of plant-pathogenic fungi which affect a vast diversity of crops in all climatic zones across the globe [2]. Being a genus of great concern, accurate and correct identification of its species becomes a necessity. However, its taxonomy has been in flux due to ambiguous circumscription based on morphotaxonomic criteria. Over the past two decades, many phylogenetic studies have established that morphological species recognition frequently fails to distinguish many Fusarium species [3]. Phylogenetic studies have revealed that nuclear ribosomal DNA (nrDNA) is nearly useless for species-level recognition in the case of Fusarium and related genera; these markers are useful only in the discrimination of Fusarium species complexes [4]. Discordance on using the nuclear rDNA internal transcribed spacer 2 (ITS2) gene region is because of the highly divergent ITS2 rDNA xenologs or paralogs discovered in many species’ complexes [5,6]. Many protein-coding genes have been explored for identification and taxonomic purposes in Fusarium and related genera. The two primary genes commonly used nowadays for identification that offer high discriminatory power and are well represented in public databases are translation elongation factor 1-alpha (tef-1α) and RNA polymerase second largest subunit (rpb2). Tef1-α is the most common marker, which has very good resolution power for most species [7], and Rpb2 provides enhanced discrimination between closely related species [8,9,10]; however, PCR amplification and sequencing success rate is better for Tef1-α than for Rpb2. In multigene phylogenetic analyses, additional genetic markers are often used with the previously mentioned genes, including β-tub, CaM and Rpb1; these markers vary in resolution depending on species complexes [11].
Fusarium spp. are known to produce several secondary metabolites including beauvericin (BEA) and enniatins. BEA is a cyclic hexadepsipeptide that consists of alternating D-2-hydroxyisovaleric acid and N-methylphenylalanine [12]. BEA is a potent bioactive compound that exhibits very effective anticancer, cytotoxic, antiplatelet aggregation, antimicrobial, leishmanicidal and insecticidal activities [13]. These activities are primarily due to its ionophoric properties that generally disrupt the normal physiological concentration of cations across the plasma membrane [14,15,16]. It releases Ca2+ from internal Ca2+ stores of the endoplasmic reticulum [17].
Studies prove that BEA can exhibit promising antibacterial activity against gram-positive or gram-negative bacteria, for example, Agrobacterium tumefaciens, Bacillus cereus, B. pumilus, B. sphaericus, B. subtilis, B. mycoides, Bifidobacterium adolescentis, Clostridium perfringens, Escherichia coli, Eubacterium biforme, Mycobacterium tuberculosis, Paenibacillus azotofixans, P. alvei, P. pulvifaciens, P. validus P. macquariensis, Peptostreptococcus productus, P. anaerobius, Pseudomonas lachrymans, Salmonella typhimurium, Staphylococcus haemolyticus, Vibrio fisheri and Xanthomonas vesicatoria are inhibited by BEA [18,19,20,21,22,23].
There has been public concern about certain opportunistic fungi that can cause infections; particularly, cases of Candida albicans are greater than before. Patients with compromised immune systems, such as those receiving organ transplants and cancer chemotherapy or those infected by human immunodeficiency virus (HIV), are more prone to such opportunistic infections [24]. BEA alone does not exhibit any antifungal activity; however, it has been found to enhance miconazole activity against C. albicans (wild and fluconazole-resistant) [25]. The activity of azole antifungals becomes enhanced against azole-resistant Candida isolates by BEA via inhibition of multidrug efflux [26]. The BEA with ketoconazole is known to synergize the antifungal effect against Candida albicans and C. tropicalis, signifying BEA’s possible use as a co-drug for antifungal infections [23,27,28]. A promising strategy using BEA, which involves simultaneous targeting drug resistance and morphogenesis, can boost antifungal efficacy against human fungal pathogens to combat life-threatening fungal infections.
In this study, 88 isolates of Fusarium and related genera from various substrates were identified by multigene phylogeny based on the internal transcribed spacer region, translation elongation factor 1-alpha, 28S large subunit, RNA polymerase second largest subunit, beta-tubulin and calmodulin gene regions. Further, these isolates were screened for beauvericin production. The isolate which showed maximum BEA production was subjected to large-scale fermentation, and its extract was used to study antibacterial, antifungal and antioxidant potential.

2. Materials and Methods

2.1. Isolates and Fungarium Specimens

First, 64 fungal strains identified as Fusarium based on morphology were procured from the National Fungal Culture Collection of India (NFCCI-WDCM 932) Table 1. The bacterial isolates used in this study, Escherichia coli MTCC 739, Bacillus subtilis MTCC 121, Micrococcus luteus MTCC 2470, Raoultella planticola MTCC 530, Pseudomonas aeruginosa MTCC 2453, Staphylococcus aureus MLS16 MTCC 2940 and Staphylococcus aureus MTCC 96, were procured from Microbial Type Culture Collection (MTCC). Additionally, fungal pathogens Pythium sp. NFCCI 3482, Geotrichum candidum NFCCI 3744, Rhizoctonia solani NFCCI 4327, Rhizopus sp. NFCCI 2108, Sclerotium rolfsii NFCCI 4263, Bipolaris sorokiniana NFCCI 4690 and Absidia sp. NFCCI 2716 were also procured from the National Fungal Culture Collection of India (NFCCI) to study the antifungal activity.

2.2. Collection, Isolation and Morphological Identification

During the course of this study, Fusarium and other related fungi were isolated from various substrates collected from different regions of India. Table 2 enlists the 24 isolates which were isolated afresh in this study along with details of their host, place of collection, date of collection and date of isolation. Pure cultures of all 24 isolates were raised using a single spore isolation technique.
Colony characteristics of all Fusarium isolates were studied on multiple media, such as potato dextrose agar (PDA), malt extract agar (MEA), potato carrot agar (PCA), oatmeal agar (OMA), cornmeal agar (CMA) and synthetic nutrient agar (SNA). Microscopic structures of these isolates were observed using lactophenol-cotton blue under a Carl Zeiss Image Analyzer 2 (Germany) microscope. Measurements and photomicrographs of the fungal structures were recorded using Axiovision Rel 4.8 software and Digi-Cam with an attached Carl Zeiss Image Analyzer 2 microscope (Figure 1 and Figure 2). The pure cultures are deposited and accessioned in the National Fungal Culture Collection of India (NFCCI 5189-5212) (Table 2).

2.3. DNA Extraction, PCR Amplification and DNA Sequencing

Genomic DNA was isolated from pure colonies of all 88 isolates growing on Potato Dextrose Agar (PDA) petri-plates, incubated for a week’s time using a simple and rapid DNA extraction protocol using FastPrep®24 tissue homogenizer (MP Biomedicals GmbH, Eschwege, Germany) [29]. Partial gene sequences of isolates were determined for six gene markers, i.e., ITS, tef1-α, LSU, rpb2, β-tub and CaM. The primer sets used to amplify particular gene region are summarized in Table 3.
PCR was carried out in a 25 μL reaction using 12.5 μL 2X Invitrogen Platinum SuperFi PCR Mastermix, 2 μL template DNA (10–20 ng), 1.5 μL 10 pmol primer, 5 μL 5X GC enhancer and H2O (Sterile Ultra-Pure Water, Sigma, St. Louis, MO, USA), with the volume made to 25 μL. The conditions of the thermo-cycling involved:
An initial denaturation at 94 °C for 5 min, 35 cycles of 1 min at 94 °C, 30 s at 52 °C, 1 min at 72 °C and a final extension at 72 °C for 8 min for ITS gene region;
An initial denaturation of 5 min at 94 °C, 30 cycles of 45 s at 94 °C, 30 s at 57 °C and 1 min at 72 °C followed by a final 7 min extension at 72 °C for Tef1-α;
5 min denaturation at 94 °C, 35 cycles of 1 min at 94 °C, 50 s at 52 °C and 1.2 min at 72 °C with a final 8 min extension at 72 °C for LSU;
5 min denaturation at 95 °C, 35 cycles of 45 s at 95 °C, 1 min at 52 °C and 1.5 min at 72 °C with a final 10 min extension at 72 °C for Rpb2;
2 min denaturation at 94 °C, 40 cycles of 35 s at 94 °C, 55 s at 52 °C and 2 min at 72 °C with a final 10 min extension at 72 °C for β-tub;
An initial denaturation of 5 min at 94 °C, 30 cycles of 1 min at 94 °C, 30 s at 55 °C and 2 min at 72 °C followed by a final 7 min extension at 72 °C for CaM.
The PCR amplicons were purified with a FavorPrep™ PCR purification kit as per the manufacturer’s instructions. Purified PCR products of all marker genes were checked on 1.2% agarose electrophoresis gels stained with ethidium bromide and were further subjected to a sequencing PCR reaction using a BigDye®Terminator v3.1 Cycle Sequencing Kit, as per manufacturer’s instructions.
The sequencing PCR reaction of 20 µL included 4 µL of 5× sequencing buffer, 2 µL of BigDye™ Terminator premix, 4 µL of primer (5 pmol), 4 µL of the purified amplicon and H2O (Sterile Ultra-Pure Water, Sigma), with the volume made to 20 μL. Thermal cycling conditions consisted of an initial denaturing at 96 °C for 3 min, followed by 30 cycles of 94 °C for 10 s, 50 °C for 40 s and 60 °C for 4 min. The BigDye® terminators and salts were removed from using The BigDye Xterminator® Purification Kit (Thermo Fisher Scientific, Waltham, MA, USA) as per the manufacturer’s instructions. The purified sequencing products were transferred into a 96-well microplate. The sequence was elucidated on Applied Biosystems SeqStudio Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). Sequences obtained were submitted in the NCBI GenBank (accession numbers in Table S1).

2.4. Phylogenetic Analysis

To determine the phylogenetic status of all 88 isolates, the Internal transcribed spacer region of the nrDNA (ITS), translation elongation factor 1-alpha (tef1-α), 28S large subunit of the nrDNA (LSU), RNA polymerase second largest subunit (rpb2), beta-tubulin (β-tub) and calmodulin (CaM) loci were used to compare the isolates used in this study with already known authentic strains in the genus Fusarium. The sequences of the type/reference strains were retrieved from NCBI. A total of 186 isolates of Fusarium and related genera were used in the phylogenetic analysis (Table S1). Atractium stilbaster CBS 410.67 was selected as the outgroup taxon. The chosen strains used in the construction of the phylogenetic tree, along with their accession numbers and other related details, are listed in Table S1. Each gene region was individually aligned using MAFFT v. 6.864b [37]. The alignments were checked and adjusted manually using Aliview [38]. Further, alignments were concatenated and subjected to phylogenetic analyses. The best substitution model out of 286 DNA models was figured using ModelFinder [39]. Additionally, windows version IQ-tree tool v.1.6.11 [40] was used to construct the phylogenetic tree. The reliability of the tree branches was assessed and tested based on 1000 ultrafast bootstrap (UFBoot) support replicates and a SH-like approximate likelihood ratio test (SH-like aLRT) with 1000 replicates. The constructed phylogenetic tree was visualized in FigTree v.1.4.4 (http://tree.bio.ed.ac.uk/software/figtree/, accessed on 20 February 2022).

2.5. Fermentation for Beauvericin Production

Fusarium isolates were subcultured onto PDA and incubated at 25 °C for a week. Once the cultures were mature enough, spore suspensions were prepared separately for all isolates. Then, 10 µL of Tween 20 was added to 10 mL of normal saline (0.89%) and mixed adequately, saline solution was added to the culture and the spores were harvested carefully with the help of a sterile cotton swab and vortexed. The spore suspension’s optical density (OD) was adjusted between 0.08 and 0.1 at 530 nm [41]. Next, 1 mL of this spore suspension was added to 100 mL of Fusarium defined media (FDM) (Sucrose 25 g, Sodium nitrate (NaNO3) 4.25 g, Sodium chloride (NaCl) 5 g, Magnesium sulfate heptahydrate (MgSO4·7H2O) 2.5 g, Potassium dihydrogen phosphate (KH2PO4) 1.36 g, Ferrous sulphate heptahydrate (FeSO4·7H2O) 0.01 g, Zinc sulfate heptahydrate (ZnSO4·7H2O) 0.0029 g/L; pH 5.5) [42] in a 250 mL Erlenmeyer flask and was incubated in a shaking incubator at 25 °C at 150 rpm for 7 days (Figure S1).

2.6. Extraction of Beauvericin

Beauvericin was extracted from the fermented broth as per the protocol described earlier, with slight modification [43]. The fermented broth was filtered using Whatman filter paper no. 4. Biomass was collected, washed twice with distilled water and was allowed to dry at 50 °C. Dried biomass was extracted overnight in 25 mL of acetonitrile:water 90:10 (v/v). Further, the mixture was sonicated twice for 15 min. The mixture was filtered; filtrate was extracted with 25 mL of heptane and separated using a separating funnel. The bottom layer was evaporated to dryness in a rotary evaporator (Heidolph, Schwabach, Germany). The dry residue was dissolved in 25 mL of methanol:water, 60:40 (v/v) and extracted twice with 25 mL of dichloromethane. The dichloromethane phase containing beauvericin (BEA) was collected and evaporated to dryness in a rotary evaporator. The evaporated extract containing beauvericin was dissolved in 1 mL of Acetonitrile.

2.7. Detection of Beauvericin

The presence of beauvericin was initially qualitatively analyzed by thin-layer chromatography (TLC) and quantitatively by high-performance liquid chromatography (HPLC). In addition, high-resolution mass spectrometry (HRMS) was carried out for a few samples for further confirmation.

2.7.1. Thin-Layer Chromatography (TLC)

About 5 to 10 µL of the extracts were spotted onto TLC Silica gel plates (TLC Silica gel 60 F254; Merck life science Pvt. Ltd., Bengaluru, Karnataka, India) along with standard Beauvericin (BEA) (500 mg/mL) (Sigma) with the help of glass capillary tube. TLC plates were developed in petroleum ether:ethyl acetate (1:1) as a solvent system. The plates were air-dried, and consequently, the spots formed on the TLC plates were detected using iodine vapours. Retention factor (Rf) values for the standard and extracts were measured as described earlier [44,45]. The extracts were further subjected to high-performance liquid chromatography (HPLC).

2.7.2. High-Performance Liquid Chromatography (HPLC)

The amount of BEA in the extracts was determined by HPLC (Waters Corporation, Milford, MA, USA) using a C18 column and acetonitrile: H2O (85:15 v/v) as the mobile phase at a flow rate of 1 mL/min under isocratic conditions and U.V. detection at 210 nm [46]. A stock solution of standard beauvericin with a concentration of 1 mg/mL was prepared in acetonitrile and was further diluted to 15.6 µg/mL, 31.25 µg/mL, 62.5 µg/mL, 125 µg/mL, 250 µg/mL and 500 µg/mL. The retention time for BEA was found to be 9.1 min. The injection volume was 20 µL. The peak area was calibrated to the amount of BEA standard (Sigma). The amount of BEA produced was calculated with respect to the area under the peak.

2.7.3. High-Resolution Mass Spectrometry (HRMS)

The mass of beauvericin was determined in selected extracts; high-resolution product ion spectra were acquired using ESI-UHR-Q-TOF (Bruker Impact II Ultra-High Resolution-TOF) to confirm the presence of Beauvericin. The system ionization source type was ESI with positive ion polarity. The instrument was run in the full-scan mode (m/z 150–1200). Nitrogen was used for drying (200 °C; 7 L/min), and the nebulizer gas pressure was 1.7 Bar. Other typical operating parameters were set as capillary voltage—4500 V, end plate offset—500 V, and charging voltage—2000 V.

2.8. Large Scale Fermentation and Extraction of Beauvericin from Fusarium tardicrescens NFCCI 5201

Among the 88 tested isolates, the highest beauvericin producer, F. tardicrescens NFCCI 5201, was subjected to flask scale fermentation in a total of 3.5 L of Fusarium defined medium (FDM). Each flask was inoculated with 1% spore suspension of O.D. 0.08–0.1, as described earlier in Section 2.5, and incubated at 25 °C with 150 rpm for one week. Extraction of beauvericin was carried out as described in Section 2.6. The final dry residue was dissolved in 36 mL of acetonitrile. This extract was used for further study.

2.9. Determination of the Antibacterial Activity

The Fusarium tardicrescens NFCCI 5201 extract containing BEA dissolved in acetonitrile (500 µg/mL) was used to check antimicrobial activity. The antibacterial activity was tested against a panel of test organisms, including Escherichia coli MTCC 739, Bacillus subtilis MTCC 121, Micrococcus luteus MTCC 2470, Raoultella planticola MTCC 530, Pseudomonas aeruginosa MTCC 2453, Staphylococcus aureus MLS16 MTCC 2940 and Staphylococcus aureus MTCC 96. Cultures were grown on nutrient agar plates and incubated at 37 °C for 48 h. After incubation, one to two pure colonies of each culture were transferred to 10 mL Muller hinton broth (MHB) and incubated for 4–5 h at 37 °C. Further, optical density was adjusted to 1 using broth. The cultures were diluted to a cell density of 1 × 106 cells/mL. The test was carried out using a resazurin-based turbidometric assay in a 96-well microtiter plate. All wells of rows (A–G) were filled with 100 µL Muller hinton broth. The first well of each row was filled with 100 µL of Fusarium tardicrescens NFCCI 5201 extract containing BEA (500 µg/mL), which was mixed well, and then 100 µL of the mixture from the first well was transferred to the second well of the vertical row. This serial dilution was continued until the tenth well; lastly, 100 µL of the mixture was discarded from the tenth well. The final concentration of the extract was half of the original concentration in each well. Ten µL of each bacterial suspension was added in vertical rows individually, except for the twelfth well (sterility control). One hundred µL of antibiotic ampicillin (10 µg/50 µL) was used, except Pseudomonas aeruginosa MTCC 2453, in which neomycin (30 µg/50 µL) was added in the eleventh well of each row (positive control). After 48 hrs of incubation at 37 °C, 25 µL of resazurin (0.01%) was added to all wells and incubated at 37 °C for 75 min in the dark. Color changes were observed and recorded. The lowest concentration before the color change was considered as the minimum inhibitory concentration for that particular test organism [47,48].

2.10. Determination of the Individual and Combined Effect of Fusarium tardicrescens NFCCI 5201 Extract Containing Beauvericin and Amphotericin B on Pathogenic Fungi of Agricultural Importance

The antifungal potential of the individual and combined effect of F. tardicrescens NFCCI 5201 extract containing beauvericin and amphotericin B on agriculturally important pathogenic fungi was carried out using the poisoned food technique as described earlier [49]. Fungal pathogens Pythium sp. NFCCI 3482, Geotrichum candidum NFCCI 3744, Rhizoctonia solani NFCCI 4327, Rhizopus sp. NFCCI 2108, Sclerotium rolfsii NFCCI 4263, Bipolaris sorokiniana NFCCI 4690 and Absidia sp. NFCCI 2716 were selected for the antifungal study. These pathogenic fungi were grown on PDA and incubated at 25 ± 2 °C for 5–7 days.
Agar discs with mycelia (5 mm in diameter) were cut out from the actively growing regions of the 5–7 days old pure cultures using a sterile cork borer and aseptically inoculated at the center of four different Petri plates, as follows:
  • Control plate containing PDA;
  • PDA supplemented with amphotericin B (40 µg/mL);
  • PDA supplemented with F. tardicrescens NFCCI 5201 extract containing beauvericin (40 µg/mL);
  • PDA supplemented with amphotericin B (20 µg/mL) and F. tardicrescens NFCCI 5201 extract containing beauvericin (20 µg/mL).
The growth of fungal colonies on different media was measured between 3 and 7 days depending upon the growth of fungi. Each treatment was repeated thrice, and the plates were incubated at 25 °C. The diameter of the fungal colony was measured after 3 and 7 days of incubation. The percentage inhibition of the mycelial growth of the test fungi was calculated using the formula described earlier [50]. Inhibition of mycelial growth (%) = (dc−dt)/dc × 100, where dc is the mean diameter (in mm) of the colony in the control sample and dt is the diameter (in mm) of the colony in the treatment.

2.11. Antioxidant Activity of Extract of Fusarium tardicrescens NFCCI 5201 Containing Beauvericin

The extract was tested for in vitro antioxidant activity using the 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging method.
The concentration of the extract as well as standard solutions (control) glucose (Himedia) (negative) and ascorbic acid (Sigma) (positive) used were 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2 and 0.1 mg/mL in acetonitrile. The extract or standard solution (10 µL) was added to DPPH in acetonitrile solution (200 µL, 100 µM) in a 96-well microtiter plate (Tarsons Products (P) Ltd., Kolkata, India). After incubation at 37 °C for 30 min, the absorbance of each solution was determined at 517 nm using a Synergy HT Multi-detection microplate reader (BioTek, Winooski, VT, USA).
The radical scavenging activity was calculated by the following formula:
Radical scavenging activity (%) = (OD control − OD sample)/OD control × 100 [51,52]. Three replicates were maintained for each treatment.

3. Results

3.1. Phylogenetic Analysis

The nrDNA (ITS), translation elongation factor 1-alpha (Tef1-α), 28S large subunit of the nrDNA (LSU), RNA polymerase second largest subunit (Rpb2), beta-tubulin (β-tub) and calmodulin (CaM) loci sequence alignments were together used to confirm the resolution of the isolates used in this study. The concatenated file contained sequence data of 186 taxa. Alignment contained 6944 columns, 3815 distinct patterns, 2049 parsimony-informative, 950 singleton sites and 3944 constant sites. TIM2e + R4 was found to be the best-fit model of 286 models tested and was chosen based on the Bayesian Information Criterion (BIC). The phylogeny was inferred using the Maximum Likelihood Method based on the model mentioned above. The log-likelihood of the consensus tree was –59368.419. Rate parameters: A-C: 1.27988, A-G: 2.69656, A-T: 1.27988, C-G: 1.00000, C-T: 5.18110, G-T: 1.00000; Base frequencies: A: 0.250, C: 0.250, G: 0.250, T: 0.250; Site proportion and rates: (0.587, 0.115) (0.171, 1.101) (0.200, 2.369) (0.042, 6.470) (Figure 3).
Of the isolates, 88 were found to belong to Fusarium and related genera, i.e., Albonectria and Neocosmospora. Strains used in this study were found to represent 35 species, including Albonectria rigidiuscula, Fusarium acutatum, F. annulatum, F. brachygibbosum, F. caatingaense, F. carminascens, F. commune, F. compactum, F. cugenangense, F. duoseptatum, F. fabacearum, F. glycines, F. gossypinum, F. grosmichelii, F. irregulare, F. lacertarum, F. lumajangense, F. mangiferae, F. microconidium, F. nanum, F. nirenbergiae, F. oxysporum, F. pernambucanum, F. proliferatum, F. sacchari, F. spinosum, F. sulawesiense, F. tardichlamydosporum, F. tardicrescens, F. verticillioides, Neocosmospora metavorans, N. oblonga, N. solani, N. suttoniana and N. vasinfecta.
Fusarium isolates were found to represent six species complexes. The species falling into a particular species complex are included in brackets, viz. Fusarium sambucinum species complex [F. brachygibbosum], Fusarium chlamydosporum species complex [F. microconidium, F. spinosum], Fusarium incarnatum-equiseti species complex [F. caatingaense, F. compactum, F. irregulare, F. lacertarum, F. nanum, F. pernambucanum, F. sulawesiense], Fusarium oxysporum species complex [F. carminascens, F. cugenangense, F. duoseptatum, F. fabacearum, F. glycines, F. gossypinum, F. grosmichelii, F. nirenbergiae, F. oxysporum, F. tardichlamydosporum, F. tardicrescens], Fusarium nisikadoi species complex [F. commune] and Fusarium fujikuroi species complex [F. acutatum, F. annulatum, F. lumajangense, F. mangiferae, F. proliferatum, F. sacchari, F. verticillioides].
Interestingly, out of 35 species reported in this study, 17 species, Fusarium caatingaense, F. carminascens, F. compactum, F. cugenangense, F. duoseptatum, F. fabacearum, F. glycines, F. gossypinum, F. grosmichelii, F. lumajangense, F. microconidium, F. nanum, F. nirenbergiae, F. sulawesiense, F. tardichlamydosporum, F. tardicrescens, Neocosmospora oblonga and N. suttoniana, were found to be new records from India [53,54], most of them being reported for the first time from a new host in this study (Table 4).

3.2. Detection of Beauvericin Produced

3.2.1. Thin Layer Chromatography

Thin layer chromatography analysis of fungal extracts along with the standard beauvericin showed spots at the same retention factor as the standard beauvericin, depicting the possible presence of beauvericin in the fungal extracts (Figure 4).

3.2.2. High-Performance Liquid Chromatography

There was a linear correlation between the concentration of the standard beauvericin and the areas of the peak in HPLC chromatogram. The retention time of standard beauvericin was found to be 9.1 min (Figure 5). Biomass produced by various isolates varied from 4.41 to 14.17 g/L of FDM. Among 88, 50 isolates (56%) were found to be capable of beauvericin production which varied from 0.01 to 15.82 mg/g of biomass. Table 5 shows the mycelial biomass, BEA content of mycelial biomass and final medium pH after a week’s fermentation of different Fusarium isolates in Fusarium defined medium. F. tardicrescens NFCCI 5201 showed maximum beauvericin production of 15.82 mg/g of biomass. F. carminascens NFCCI 5204 and F. fabacearum NFCCI 5200 also produced a significant amount of beauvericin: 13.54 and 14.25 mg/g of biomass, respectively (Figure 6). The final pH of the fermented broth varied from 6.38 to 8.96 for different isolates. The correlation coefficient between biomass produced and the beauvericin produced was 0.2692; that between the pH of the fermented broth and the beauvericin produced was 0.16, indicating very weak and/or no association in both cases.

3.2.3. High-Resolution Mass Spectrometry (HRMS)

The HRMS results showed molecular ion peaks at 806.3999 (m/z) [M + Na]+,indicating the presence of beauvericin (C45H57N3O9) in the fungal extracts (Figure 7). Similar (m/z) [M + Na]+ 806.3956 have been reported for beauvericin (C45H57N3O9) [71]. It was observed that the fungal extract contains, majorly, beauvericin, as maximum ion intensity was observed with m/z 806.3999.

3.3. Large Scale Fermentation

Fermentation of 3.5 liters of Fusarium defined medium resulted in 36.27 gms of biomass which, on extraction, resulted in 144 mg of crude which was dissolved in 36 mL of acetonitrile, making the final concentration 4 mg/mL. This extract was subjected to HPLC; it was found that beauvericin is the major compound in the extract, as the area covered by it was found to be nearly 64–68%. This stock was diluted as per requirement for further studies.

3.4. Antimicrobial and MIC of Crude Extract of Fusarium tardicrescens NFCCI 5201

The extract showed promising results against Staphylococcus aureus MLS16 MTCC 2940 and Micrococcus luteus MTCC 2470. The MIC of the crude extract of F. tardicrescens NFCCI 5201 was found to be 15.63 µg/mL against Micrococcus luteus MTCC 2470 and 62.5 µg/mL against Staphylococcus aureus MLS16 MTCC 2940 (Figure 8). The extract did not show any antimicrobial activity against Escherichia coli MTCC 739, Bacillus subtilis MTCC 121, Raoultella planticola MTCC 530, Pseudomonas aeruginosa MTCC 2453 and Staphylococcus aureus MTCC 96.

3.5. Individual and Combined Effect of Extract of Fusarium tardicrescens NFCCI 5201 Containing Beauvericin and Amphotericin B on Pathogenic Fungi

The antifungal activity was observed as a reduction in the mycelial growth of pathogenic fungi in poisoned plates when compared to the control plates (Figure 9). The extract of F. tardicrescens NFCCI 5201 containing beauvericin (40 µg/mL) showed good antifungal activity against plant pathogenic fungi, Rhizoctonia solani NFCCI 4327, Sclerotium rolfsii NFCCI 4263, Geotrichum candidum NFCCI 3744 and Pythium sp. NFCCI 3482 showed a % inhibition of 84.31, 49.76, 38.22 and 35.13. Amphotericin B (40 µg/mL) inhibited Geotrichum candidum NFCCI 3744, Rhizoctonia solani NFCCI 4327, Sclerotium rolfsii NFCCI 4263 and Absidia sp. NFCCI 2716, showing % inhibition of 71.76, 55.72, 56.82 and 48.68. Interestingly, the results were remarkable when the extracts of F. tardicrescens NFCCI 5201 containing beauvericin (20 µg/mL) and amphotericin B (20 µg/mL) were used in combination against Rhizopus sp. NFCCI 2108, Sclerotium rolfsii NFCCI 4263, Bipolaris sorokiniana NFCCI 4690 and Absidia sp. NFCCI 2716, showing % inhibition of 50.35, 79.37, 48.07 and 76.72%, respectively. Individually, extract of F. tardicrescens NFCCI 5201 containing beauvericin (40 µg/mL) showed % inhibition of 1.68, 49.76, 2.56 and 7.9 against Rhizopus sp. NFCCI 2108, Sclerotium rolfsii NFCCI 4263, Bipolaris sorokiniana NFCCI 4690 and Absidia sp. NFCCI 2716. Individually, amphotericin B (40 µg/mL) showed % inhibition of 11.51, 56.82, 1.28 and 48.67 against Rhizopus sp. NFCCI 2108, Sclerotium rolfsii NFCCI 4263, Bipolaris sorokiniana NFCCI 4690 and Absidia sp. NFCCI 2716. The extract of F. tardicrescens NFCCI 5201 containing beauvericin (40 µg/mL) showed better results than amphotericin B in the case of Pythium sp. NFCCI 3482 and Rhizoctonia solani NFCCI 4327 (Figure 10).

3.6. Antioxidant Effect of Extract of Fusarium tardicrescens NFCCI 5201 Containing Beauvericin

Figure 11 shows the free radical scavenging activity of the extract of F. tardicrescens NFCCI 5201 containing beauvericin and the standard ascorbic acid when tested for in vitro antioxidant activity. The extract of F. tardicrescens NFCCI 5201 containing beauvericin showed good satisfactory dose-dependent DPPH radical scavenging activity with an IC50 value of 0.675 mg/mL when tested with standard ascorbic acid, which showed IC50 value of 0.146 mg/mL.

4. Discussion

One of the greatest hindrances in studying Fusarium has been the ambiguous nomenclature or incorrect species names of the isolates because of the limitations in recognition of the species based on morphology [72]. Being the world’s most important pathogens, its prophylaxis and management needs correct and rapid identification [73]. As mentioned earlier, ITS and LSU frequently fail to distinguish at the species level and, preferably, Tef1-α and Rpb2 can be used to distinguish isolates at the species level. Literature reveals that Indian Fusarium isolates have been mostly identified on the basis of morphology. Very few studies were found where the Fusarium isolates had been identified using molecular studies. Wherever molecular studies were performed, they were based on the ITS gene region; very limited studies used either Tef1-α or Rpb2 or both of these gene regions [74]. To our knowledge, this is the first study from India where Fusarium isolates have been identified on the basis of six gene regions, nrDNA (ITS), translation elongation factor 1-alpha (Tef1-α), 28S large subunit of the nrDNA (LSU), RNA polymerase second largest subunit (Rpb2), beta-tubulin (β-tub) and calmodulin (CaM). Interestingly, in this study, 17 species, Fusarium caatingaense, F. carminascens, F. compactum, F. cugenangense, F. duoseptatum, F. fabacearum, F. glycines, F. gossypinum, F. grosmichelii, F. lumajangense, F. microconidium, F. nanum, F. nirenbergiae, F. sulawesiense, F. tardichlamydosporum, F. tardicrescens, Neocosmospora oblonga and N. suttoniana were found to be new records for India, most of them being reported from new hosts [53,54].
BEA is a potent bioactive compound possessing antimicrobial, anti-insecticidal, antitumor and antiplatelet activities at extremely low concentration and with unique uncharacterized active mechanisms. A review of the literature indicates that no study was undertaken in India on BEA production from Indian species of Fusarium, except [43] who had reported BEA production from two isolates of Fusarium viz., F. anthophilum (Host: Sugarcane; 1300 µg/g) and F. nygamai (Host: Cajanus indicus; 3 µg/g) [43]. This work was undertaken in Bari, Italy. This suggests that Indian Fusarium isolates have remained unexplored for their capability of BEA production and its applicability.
Albonectria rigidiuscula, F. acutatum, F. annulatum, F. brachygibbosum, F. caatingaense, F. carminascens, F. compactum, F. cugenangense, F. fabacearum, F. glycines, F. gossypinum, F. grosmichelii, F. irregulare, F. lacertarum, F. lumajangense, F. nirenbergiae, F. oxysporum, F. pernambucanum, F. proliferatum, F. sacchari, F. tardichlamydosporum, F. tardicrescens, N. metavorans, N. solani, N. suttoniana and N. vasinfecta were found to be the positive producers of BEA in this study, many of them being reported as BEA producers for the first time in this study. Fusarium tardicrescens NFCCI 5201 showed maximum beauvericin production of 15.82 mg/g of biomass. Fusarium carminascens NFCCI 5204 and F. fabacearum NFCCI 5200 also produced a significantly ample amount of beauvericin, 13.54 and 14.25 mg/g of biomass, respectively, all three of them being reported for the first time as significant BEA producers in this study.
In earlier reports, BEA was detected in cultures of Fusarium moniliforme, F. semitectum [75], F. subglutinans, F. thapsinum [76], F. sambucinum, F. acuminatum, F. equiseti, F. longipes, F. anthophilum, F. oxysporum, F. poae, F. avenaceum, F. beomiforme, F. dlamini, F. bulbicola, F. nygamai [43], F. chlamydosporum, F. solani, F. proliferatum and F. sacchari [77].
The crude extract of F. tardicrescens NFCCI 5201 showed promising results against Staphylococcus aureus MLS16 MTCC 2940 and Micrococcus luteus MTCC 2470, with MIC values of 15.63 µg/mL against Micrococcus luteus MTCC 2470 and 62.5 µg/mL against Staphylococcus aureus MLS16 MTCC 2940. BEA from F. oxysporum had a potent inhibitory effect on the growth of pathogenic Staphylococcus aureus with a MIC of 3.91 µM [23]. Earlier reports reveal that inhibitory concentration (IC50) values of BEA against Bacillus subtilis, Staphylococcus haemolyticus, Pseudomonas lachrymans, Agrobacterium tumefaciens, Escherichia coli and Xanthomo vesicatoria by a 96-well microplate broth dilution–MTT assay ranged between 18.45 and 70.41 µg/mL [78]. BEA has been known to inhibit bacteria, including Bacillus pumilus (0.1 µg of BEA per disk), several other species of Bacillus and Paenibacillus (1 µg of BEA per disk), P. validus, Bifidobacterium adolescentis, Clostridium perfringens, Eubacterium biforme, Peptostreptococcus anaerobius and P. productus (25 µg of BEA per disk) [18]. Strong antimicrobial activity has been reported against Staphylococcus aureus, Salmonella typhimurium and Bacillus cereus with MIC values of 3.91 µM, 6.25 and 3.12 µg/mL, respectively [19,23].
With BEA being a high score ABC inhibitor, it has been reported to show strong synergy with some azole compounds (miconazole, ketoconazole) against Candida albicans and Candida parapsilosis (in vitro as well as in vivo). It has been reported that BEA individually fails to show antifungal activity, but it was found to synergize the effect of ketoconazole [25].
In this study, the antifungal activity was observed as a reduction in the mycelial growth of pathogenic fungi of agricultural importance in poisoned plates when compared to the control plates. The extract of F. tardicrescens NFCCI 5201 containing beauvericin (40 µg/mL) showed good antifungal activity against pathogenic fungi Rhizoctonia solani NFCCI 4327, Sclerotium rolfsii NFCCI 4263, Geotrichum candidum NFCCI 3744 and Pythium sp. NFCCI 3482 showing % inhibition of 84.31, 49.76, 38.22 and 35.13. Interestingly, when the extract of F. tardicrescens NFCCI 5201 containing beauvericin (20 µg/mL) and amphotericin B (20 µg/mL) were used in combination, they produced a synergized antifungal effect against Rhizopus sp. NFCCI 2108, Sclerotium rolfsii NFCCI 4263, Bipolaris sorokiniana NFCCI 4690 and Absidia sp. NFCCI 2716, showing % inhibition of 50.35, 79.37, 48.07 and 76.72%, respectively. Individually, the extract of F. tardicrescens NFCCI 5201 containing beauvericin (40 µg/mL) showed a % inhibition of 1.68, 49.76, 2.56 and 7.9 against Rhizopus sp. NFCCI 2108, Sclerotium rolfsii NFCCI 4263, Bipolaris sorokiniana NFCCI 4690 and Absidia sp. NFCCI 2716, and amphotericin B (40 µg/mL) showed a % inhibition of 11.51, 56.82, 1.28 and 48.67 against Rhizopus sp. NFCCI 2108, Sclerotium rolfsii NFCCI 4263, Bipolaris sorokiniana NFCCI 4690 and Absidia sp. NFCCI 2716. The extract of F. tardicrescens NFCCI 5201 containing beauvericin (40 µg/mL) showed better results than amphotericin B in the case of Pythium sp. NFCCI 3482, Rhizoctonia solani NFCCI 4327. This is the first report on the testing of BEA against filamentous, agriculturally important fungal pathogens. The synergistic effect of BEA along with amphotericin B against filamentous agriculturally important pathogens has also been studied for the first time. Earlier studies focused on the synergistic effect of BEA and azoles (miconazole, ketoconazole) on yeast (Candida albicans and Candida parapsilosis). This study focuses on the synergistic effect of fungal extracts and polyene (amphotericin B) on agriculturally important filamentous fungal pathogens. Moreover, the extract of F. tardicrescens NFCCI 5201 containing beauvericin showed good dose-dependent DPPH radical scavenging activity with an IC50 value of 0.675 mg/mL. Antioxidant activity has been reported from metabolites produced by Fusarium oxysporum [79]. The DPPH-radicals’ scavenging activity has been reported from F. solani with IC50 value of 24 µg/mL [80].

5. Conclusions

Fusarium spp. have been known globally for centuries for their pathogenic behavior; however, they can prove to be a treasure trove because of their capability to produce other interesting metabolites of great applicability in various sectors such as food, agriculture and medicine. As shown in this study, the antifungal activity became synergized when a half dosage of the fungal extract and amphotericin B was used. Therefore, this study indicates that concerted efforts are required, in which high-throughput screening needs to be carried out with dosage of the BEA and the other antifungal compound, which can possibly be used at a large scale for calculating the optimum dosage required. Similar studies can be carried out in the field of medicine where the dosage is optimized and the delivery of the drug combinations is also targeted.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/jof8070662/s1, Figure S1: Fermentation of different isolates in Fusarium defined media after a week’s fermentation (a) Control (Uninnoculated FDM medium) (b) Fusarium fabacearum NFCCI 5200 (c) F. annulatum NFCCI 3300 (d) F. sulawesiense NFCCI 4919 (e) F. sacchari NFCCI 4889 (f) F. annulatum NFCCI 5212 (g) F. nirenbergiae NFCCI 5189 (h) F. tardicrescens NFCCI 5201 (i) F. lacertarum NFCCI 4792 (j) F. lumajangense NFCCI 4180 (k) F. pernambucanum NFCCI 5203 (l) F. duoseptatum NFCCI 681 (m) F. tardichlamydosporum NFCCI 1895 (n) Neocosmospora solani NFCCI 2315 (o) F. mangiferae NFCCI 2885 (p) F. annulatum NFCCI 2964 (q) F. sacchari NFCCI 3147 (r) F. grosmichelii NFCCI 3243; Table S1: GenBank Accession No. and other details of the isolates used in the phylogenetic study.

Author Contributions

Conceptualization, S.R. and S.K.S.; methodology, S.R. and S.K.S.; formal analysis, S.R. and S.K.S.; investigation, S.R.; resources, S.K.S.; writing—original draft preparation, S.R.; writing—review and editing, S.R., S.K.S. and L.D.; supervision, S.K.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

We thank Prashant Dhakephalkar, Director MACS-Agharkar Research Institute, Pune for providing the necessary facilities and encouragement to carry out the research work. Shiwali Rana acknowledges the University Grants Commission (U.G.C.), New Delhi for granting a Senior Research Fellowship (SRF), and S.P. Pune University, Pune for registering for the Ph.D. degree. We acknowledge technical support and help by Deepak Kumar Maurya and Subhash Gaikwad of Agharkar Research Institute, Pune. Laurent Dufossé deeply acknowledges the strong financial support from Conseil Régional de Bretagne and Conseil Régional de La Réunion for research activities dedicated to microbial biotechnology.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Gupta, A.K.; Baran, R.; Summerbell, R.C. Fusarium infections of the skin. Curr. Opin. Infect. Dis. 2000, 13, 121–128. [Google Scholar] [CrossRef]
  2. Summerell, B.A. Resolving Fusarium: Current status of the genus. Annu. Rev. Phytopathol. 2019, 57, 323–339. [Google Scholar] [CrossRef]
  3. Taylor, J.W.; Jacobson, D.J.; Kroken, S.; Kasuga, T.; Geiser, D.M.; Hibbett, D.S.; Fisher, M.C. Phylogenetic species recognition and species concepts in fungi. Fungal Genet. Biol. 2000, 31, 21–32. [Google Scholar] [CrossRef] [Green Version]
  4. Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Robert, V.; Spouge, J.L.; Levesque, C.A.; Chen, W.; Bolchacova, E.; Voigt, K.; Crous, P.W.; et al. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc. Natl. Acad. Sci. USA 2012, 109, 6241–6246. [Google Scholar] [CrossRef] [Green Version]
  5. Odonnell, K.; Cigelnik, E. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Mol. Biol. Evol. 1997, 7, 103–116. [Google Scholar] [CrossRef]
  6. O’Donnell, K.; Cigelnik, E.; Nirenberg, H.I. Molecular systematics and phylogeography of the Gibberella fujikuroi species complex. Mycologia 1998, 90, 465–493. [Google Scholar] [CrossRef]
  7. O’Donnell, K.; Sutton, D.A.; Rinaldi, M.G.; Gueidan, C.; Crous, P.W.; Geiser, D.M. Novel multilocus sequence typing scheme reveals high genetic diversity of human pathogenic members of the Fusarium incarnatum-F. equiseti and F. chlamydosporum species complexes within the United States. J. Clin. Microbiol. 2009, 47, 3851–3861. [Google Scholar] [CrossRef] [Green Version]
  8. O’Donnell, K. Molecular phylogeny of the Nectria haematococca-Fusarium solani species complex. Mycologia 2000, 92, 919–938. [Google Scholar] [CrossRef]
  9. Nalim, F.A.; Samuels, G.J.; Wijesundera, R.L.; Geiser, D.M. New species from the Fusarium solani species complex derived from perithecia and soil in the Old-World tropics. Mycologia 2011, 103, 1302–1330. [Google Scholar] [CrossRef]
  10. Herron, D.A.; Wingfield, M.J.; Wingfield, B.D.; Rodas, C.A.; Marincowitz, S.; Steenkamp, E.T. Novel taxa in the Fusarium fujikuroi species complex from Pinus spp. Stud. Mycol. 2015, 80, 131–150. [Google Scholar] [CrossRef] [Green Version]
  11. Crous, P.W.; Lombard, L.; Sandoval-Denis, M.; Seifert, K.A.; Schroers, H.J.; Chaverri, P.; Gene, J.; Guarro, J.; Hirooka, Y.; Bensch, K.; et al. Fusarium: More than a node or a foot-shaped basal cell. Stud. Mycol. 2021, 98, 100116. [Google Scholar] [CrossRef]
  12. Zhang, T.; Jia, X.P.; Zhuo, Y.; Liu, M.; Gao, H.; Liu, J.T.; Zhang, L.X. Cloning and characterization of a novel 2-ketoisovalerate reductase from the beauvericin producer Fusarium proliferatum LF061. BMC Biotechnol. 2012, 12, 55. [Google Scholar] [CrossRef] [Green Version]
  13. Sood, S.; Sandhu, S.S.; Mukherjee, T.K. Pharmacological and therapeutic potential of beauvericin: A Short Review. J. Proteom. Bioinform. 2017, 10, 18–23. [Google Scholar] [CrossRef]
  14. Hilgenfeld, R.; Saenger, W. Structural chemistry of natural and synthetic ionophores and their complexes with cations. Top. Curr. Chem. 1982, 101, 1–82. [Google Scholar]
  15. Ovchinnikov, Y.A.; Ivanov, V.T.; Evstratov, A.E.; Mikhaleva, I.I.; Bystrov, V.F.; Portnova, S.L.; Balashova, T.A.; Meshcheryakova, E.N.; Tulchinsky, V.M. The enniatins ionophores, conformation and ion binding properties. Int. J. Pept. Protein Res. 1974, 6, 465–498. [Google Scholar] [CrossRef]
  16. Steinrauf, L.K. Beauvericin and the other enniatins. Met. Ions Biol. Syst. 1985, 19, 139–171. [Google Scholar]
  17. Lin, H.I.; Lee, Y.J.; Chen, B.F.; Tsai, M.C.; Lu, J.L.; Chou, C.J.; Jow, G.M. Involvement of Bcl-2 family, cytochrome c and caspase 3 in induction of apoptosis by beauvericin in human non-small cell lung cancer cells. Cancer Lett. 2005, 230, 248–259. [Google Scholar] [CrossRef]
  18. Castlebury, L.A.; Sutherland, J.B.; Tanner, L.A.; Henderson, A.L.; Cerniglia, C.E. Short Communication: Use of a bioassay to evaluate the toxicity of beauvericin to bacteria. World J. Microbiol. Biotechnol. 1999, 15, 131–133. [Google Scholar] [CrossRef]
  19. Dzoyem, J.P.; Melong, R.; Tsamo, A.T.; Maffo, T.; Kapche, D.; Ngadjui, B.T.; McGaw, L.J.; Eloff, J.N. Cytotoxicity, antioxidant and antibacterial activity of four compounds produced by an endophytic fungus Epicoccum nigrum associated with Entada abyssinica. Rev. Bras. Farmacogn. 2017, 27, 251–253. [Google Scholar] [CrossRef]
  20. Fotso, J.; Smith, J.S. Evaluation of beauvericin toxicity with the bacterial bioluminescence assay and the Ames mutagenicity bioassay. J. Food Sci. 2003, 68, 1938–1941. [Google Scholar] [CrossRef]
  21. Meca, G.; Sospedra, I.; Soriano, J.M.; Ritieni, A.; Moretti, A.; Manes, J. Antibacterial effect of the bioactive compound beauvericin produced by Fusarium proliferatum on solid medium of wheat. Toxicon 2010, 56, 349–354. [Google Scholar] [CrossRef]
  22. Nilanonta, C.; Isaka, M.; Kittakoop, P.; Trakulnaleamsai, S.; Tanticharoen, M.; Thebtaranonth, Y. Precursor-directed biosynthesis of beauvericin analogs by the insect pathogenic fungus Paecilomyces tenuipes BCC 1614. Tetrahedron 2002, 58, 3355–3360. [Google Scholar] [CrossRef]
  23. Zhang, H.W.; Ruan, C.F.; Bai, X.L.; Zhang, M.; Zhu, S.S.; Jiang, Y.Y. Isolation and identification of the antimicrobial agent beauvericin from the endophytic Fusarium oxysporum 5-19 with NMR and ESI-MS/MS. Biomed Res. Int. 2016, 2016, 1084670. [Google Scholar] [CrossRef] [Green Version]
  24. Wu, X.F.; Xu, R.; Ouyang, Z.J.; Qian, C.; Shen, Y.; Wu, X.D.; Gu, Y.H.; Xu, Q.; Sun, Y. Beauvericin ameliorates experimental colitis by inhibiting activated T Cells via downregulation of the PI3K/Akt signaling pathway. PLoS ONE 2013, 8, e83013. [Google Scholar] [CrossRef] [Green Version]
  25. Fukuda, T.; Arai, M.; Tomoda, H.; Omura, S. New beauvericins, potentiators of antifungal miconazole activity, produced by Beauveria sp FKI-1366-II. Structure elucidation. J. Antibiot. 2004, 57, 117–124. [Google Scholar] [CrossRef] [Green Version]
  26. Shekhar-Guturja, T.; Tebung, W.A.; Mount, H.; Liu, N.N.; Kohler, J.R.; Whiteway, M.; Cowen, L.E. Beauvericin potentiates azole activity via inhibition of multidrug efflux, blocks Candida albicans morphogenesis, and is effluxed via Yor1 and circuitry controlled by Zcf29. Antimicrob. Agents Chemother. 2016, 60, 7468–7480. [Google Scholar] [CrossRef] [Green Version]
  27. Zhang, L.X.; Yan, K.Z.; Zhang, Y.; Huang, R.; Bian, J.; Zheng, C.S.; Sun, H.X.; Chen, Z.H.; Sun, N.; An, R.; et al. High-throughput synergy screening identifies microbial metabolites as combination agents for the treatment of fungal infections. Proc. Natl. Acad. Sci. USA 2007, 104, 4606–4611. [Google Scholar] [CrossRef] [Green Version]
  28. Campos, F.F.; Sales, P.A.; Romanha, A.J.; Araujo, M.S.S.; Siqueira, E.P.; Resende, J.M.; Alves, T.M.A.; Martins, O.A.; dos Santos, V.L.; Rosa, C.A.; et al. Bioactive endophytic fungi isolated from Caesalpinia echinata Lam. (Brazilwood) and identification of beauvericin as a trypanocidal metabolite from Fusarium sp. Mem. Inst. Oswaldo Cruz 2015, 110, 65–74. [Google Scholar] [CrossRef]
  29. Aamir, S.; Sutar, S.; Singh, S.K.; Baghela, A. A rapid and efficient method of fungal genomic DNA extraction, suitable for PCR based molecular methods. Plant Pathol. Quar. 2015, 5, 74–81. [Google Scholar] [CrossRef]
  30. White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innes, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: Cambridge, MA, USA, 1990; pp. 315–322. [Google Scholar]
  31. O’Donnell, K.; Kistler, H.C.; Cigelnik, E.; Ploetz, R.C. Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proc. Natl. Acad. Sci. USA 1998, 95, 2044–2049. [Google Scholar] [CrossRef] [Green Version]
  32. Vilgalys, R.; Sun, B.L. Ancient and recent patterns of geographic speciation in the oyster mushroom Pleurotus revealed by phylogenetic analysis of ribosomal DNA-sequences. Proc. Natl. Acad. Sci. USA 1994, 91, 7832. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Vilgalys, R.; Hester, M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J. Bacteriol. 1990, 172, 4238–4246. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Liu, Y.J.J.; Whelen, S.; Benjamin, D.H. Phylogenetic relationships among ascomycetes: Evidence from an RNA polymerase II subunit. Mol. Biol. Evol. 1999, 16, 1799–1808. [Google Scholar] [CrossRef] [PubMed]
  35. Watanabe, M.; Yonezawa, T.; Lee, K.; Kumagai, S.; Sugita-Konishi, Y.; Goto, K.; Hara-Kudo, Y. Molecular phylogeny of the higher and lower taxonomy of the Fusarium genus and differences in the evolutionary histories of multiple genes. BMC Evol. Biol. 2011, 11, 322. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Peterson, S.W. Multilocus DNA sequence analysis shows that Penicillium biourgeianum is a distinct species closely related to P. brevicompactum and P. olsonii. Mycol. Res. 2004, 108, 434–440. [Google Scholar] [CrossRef]
  37. Katoh, K.; Standley, D.M. MAFFT Multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Green Version]
  38. Larsson, A. AliView: A fast and lightweight alignment viewer and editor for large data sets. Bioinformatics 2014, 30, 3276–3278. [Google Scholar] [CrossRef]
  39. Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587. [Google Scholar] [CrossRef] [Green Version]
  40. Nguyen, L.T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef]
  41. Aberkane, A.; Cuenca-Estrella, M.; Gomez-Lopez, A.; Petrikkou, E.; Mellado, E.; Monzón, A.; Rodriguez-Tudela, J.L. Comparative evaluation of two different methods of inoculum preparation for antifungal susceptibility testing of filamentous fungi. J. Antimicrob. Chemother. 2002, 50, 719–722. [Google Scholar] [CrossRef] [Green Version]
  42. Lee, H.; Kang, J.; Kim, B.; Park, S.; Lee, C. Statistical optimization of culture conditions for the production of enniatins H, I, and MK1688 by Fusarium oxysporum KFCC 11363P. J. Biosci. Bioeng. 2011, 111, 279–285. [Google Scholar] [CrossRef] [PubMed]
  43. Logrieco, A.; Moretti, A.; Castella, G.; Kostecki, M.; Golinski, P.; Ritieni, A.; Chelkowski, J. Beauvericin production by Fusarium species. Appl. Environ. Microbiol. 1998, 64, 3084–3088. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Touchstone, J.C. Practice of Thin Layer Chromatography, 3rd ed.; John Wiley and Sons, Inc.: Hoboken, NJ, USA, 1992; pp. 1–14. [Google Scholar]
  45. Fessenden, R.J.; Fessenden, J.S.; Feist, P. Organic Laboratory Techniques, 3rd ed.; Cengage Learning: Boston, MA, USA; Brooks/Cole Thomson Leaning, Inc.: Belmont, CA, USA, 2001; pp. 133–138. [Google Scholar]
  46. Xu, L.J.; Liu, Y.S.; Zhou, L.G.; Wu, J.Y. Optimization of a liquid medium for beauvericin production in Fusarium redolens Dzf2 mycelial culture. Biotechnol. Bioprocess Eng. 2010, 15, 460–466. [Google Scholar] [CrossRef]
  47. Teh, C.H.; Nazni, W.A.; Nurulhusna, A.; Norazah, A.; Lee, H.L. Determination of antibacterial activity and minimum inhibitory concentration of larval extract of fly via resazurin-based turbidometric assay. BMC Microbiol. 2017, 17, 36. [Google Scholar] [CrossRef] [Green Version]
  48. Foerster, S.; Desilvestro, V.; Hathaway, L.J.; Althaus, C.L.; Unemo, M. A new rapid resazurin-based microdilution assay for antimicrobial susceptibility testing of Neisseria gonorrhoeae. J. Antimicrob. Chemother. 2017, 72, 1961–1968. [Google Scholar] [CrossRef]
  49. Adjou, E.S.; Kouton, S.; Dahouenon-Ahoussi, E.; Sohounhloue, C.K.; Soumanou, M.M. Antifungal activity of Ocimum canum essential oil against toxinogenic fungi isolated from peanut seeds in post-harvest in Benin. Int. Res. J. Biol. 2012, 1, 20–26. [Google Scholar]
  50. Philippe, S.; Soua¨ıbou, F.; Guy, A.; Sébastien, D.T.; Boniface, Y.; Paulin, A.; Issaka, Y.; Dominique, S. Chemical composition and antifungal activity of essential oil of fresh leaves of Ocimum gratissimum from Benin against six mycotoxigenic fungi isolated from traditional cheese wagashi. Res. J. Biol. Sci. 2012, 1, 22–27. [Google Scholar]
  51. Jinesh, V.K.; Jaishree, V.; Badami, S.; Shyam, W. Comparative evaluation of antioxidant properties of edible and non-edible leaves of Anethum graveolens Linn. Indian J. Nat. Prod. Reso. 2010, 1, 168–173. [Google Scholar]
  52. Elizabeth, K.; Rao, M.W.A. Oxygen radical scavenging activity of Curcumin. Int. J. Pharmaceu. 1990, 58, 237–240. [Google Scholar]
  53. Jamaluddin; Goswami, M.S.; Ojha, B.M. Fungi of India 1989–2001; Scientific Publishers: Jodhpur, India, 2004; pp. 1–326. [Google Scholar]
  54. Manoharachary, C.; Atri, N.S.; Devi, T.P.; Kamil, D.; Singh, S.K.; Singh, A.P. Bilgrami’s Fungi of India List and References (1988–2020); Today & Tomorrow’s Printers and Publishers: New Delhi, India, 2022; pp. 1–475. [Google Scholar]
  55. Santos, A.C.D.; Trindade, J.V.C.; Lima, C.S.; Barbosa, R.D.; da Costa, A.F.; Tiago, P.V.; Oliveira, N. Morphology, phylogeny, and sexual stage of Fusarium caatingaense and Fusarium pernambucanum, new species of the Fusarium incarnatum-equiseti species complex associated with insects in Brazil. Mycologia 2019, 111, 244–259. [Google Scholar] [CrossRef]
  56. Lombard, L.; Sandoval-Denis, M.; Lamprecht, S.C.; Crous, P.W. Epitypification of Fusarium oxysporum—Clearing the taxonomic chaos. Persoonia 2019, 43, 1–47. [Google Scholar] [CrossRef] [Green Version]
  57. Vanwyk, P.S.; LOS, O.; Palterl, G.D.C.; Marasas, W.F.O. Geographic distribution and pathogenicity of Fusarium species associated with crown rot of wheat in the orange free state, South Africa. Phytophylactica 1987, 19, 271–274. [Google Scholar]
  58. Matic, S.; Tabone, G.; Gullino, M.L.; Garibaldi, A.; Guarnaccia, V. Emerging leafy vegetable crop diseases caused by the Fusarium incarnatum-equiseti species complex. Phytopathol. Mediterr. 2020, 59, 303–317. [Google Scholar] [CrossRef]
  59. Sever, Z.; Ivić, D.; Kos, T.; Miličević, T. Fusarium rot in stored apples in Croatia Arh. Hig. Rada. Toksikol. 2012, 63, 463–470. [Google Scholar] [CrossRef]
  60. Frisullo, S.; Logrieco, A.; Moretti, A.; Grammatikaki, G.; Bottalico, A. Banana Corm and Root Rot by Fusarium compactum, in Crete. Phytopathol. Mediterr. 1994, 33, 78–82. [Google Scholar]
  61. Mazhar, M.A.; Jahangir, A.Z.; Banihashemi, Z.; Izadpanah, K. First report of isolation and pathogenicity of Fusarium compactum on safflower. Iran. J. Plant Pathol. 2013, 49, 277. [Google Scholar]
  62. Brizuela, A.M.; De la Lastra, E.; Marin-Guirao, J.I.; Galvez, L.; de Cara-Garcia, M.; Capote, N.; Palmero, D. Fusarium consortium populations associated with Asparagus crop in Spain and their role on field decline syndrome. J. Fungi 2020, 6, 336. [Google Scholar] [CrossRef]
  63. Maryani, N.; Lombard, L.; Poerba, Y.S.; Subandiyah, S.; Crous, P.W.; Kema, G.H.J. Phylogeny and genetic diversity of the banana Fusarium wilt pathogen Fusarium oxysporum f. sp. cubense in the Indonesian centre of origin. Stud. Mycol. 2019, 92, 155–194. [Google Scholar] [CrossRef]
  64. Ujat, A.; Vadamalai, G.; Hattori, Y.; Nakashima, C.; Wong, C.; Zulperi, D. Current classification and diversity of Fusarium species complex, the causal pathogen of Fusarium wilt disease of banana in Malaysia. Agronomy 2021, 11, 1955. [Google Scholar] [CrossRef]
  65. Maryani, N.; Sandoval-Denis, M.; Lombard, L.; Crous, P.W.; Kema, G.H.J. New endemic Fusarium species hitch-hiking with pathogenic Fusarium strains causing Panama disease in small-holder banana plots in Indonesia. Persoonia 2019, 43, 48–69. [Google Scholar] [CrossRef] [Green Version]
  66. Wang, M.M.; Chen, Q.; Diao, Y.Z.; Duan, W.J.; Cai, L. Fusarium incarnatum-equiseti complex from China. Persoonia 2019, 43, 70–89. [Google Scholar] [CrossRef] [Green Version]
  67. Lu, Y.A.; Qiu, J.B.; Wang, S.F.; Xu, J.H.; Ma, G.Z.; Shi, J.R.; Bao, Z.H. Species diversity and toxigenic potential of Fusarium incarnatum-equiseti species complex isolates from rice and soybean in China. Plant Dis. 2021, 105, 2628–2636. [Google Scholar] [CrossRef]
  68. Yi, R.H.; Lian, T.; Su, J.J.; Chen, J. First report of internal black rot on Carica papaya fruit caused by Fusarium sulawesiense in China. Plant Dis. 2022, 106, 319. [Google Scholar] [CrossRef]
  69. Lu, M.; Zhang, Y.; Li, Q.; Huang, S.; Tang, L.; Chen, X.; Guo, T.; Mo, J.; Ma, L. First report of leaf blight caused by Fusarium pernambucanum and Fusarium sulawesiense on Plum in Sichuan, China. Plant Dis. 2022. [Google Scholar] [CrossRef]
  70. Araújo, M.B.M.; Moreira, G.M.; Nascimento, L.V.; Nogueira, G.D.; Nascimento, S.R.D.; Pfenning, L.H.; Ambrosio, M.M.D. Fusarium rot of melon is caused by several Fusarium species. Plant Pathol. 2021, 70, 712–721. [Google Scholar] [CrossRef]
  71. Urbaniak, M.; Stepien, L.; Uhlig, S. Evidence for naturally produced beauvericins containing N-Methyl-Tyrosine in Hypocreales fungi. Toxins 2019, 11, 182. [Google Scholar] [CrossRef] [Green Version]
  72. Geiser, D.M.; Jimenez-Gasco, M.D.; Kang, S.C.; Makalowska, I.; Veeraraghavan, N.; Ward, T.J.; Zhang, N.; Kuldau, G.A.; O’Donnell, K. FUSARIUM-ID v. 1.0: A DNA sequence database for identifying Fusarium. Eur. J. Plant Pathol. 2004, 110, 473–479. [Google Scholar] [CrossRef]
  73. Wingfield, M.J.; De Beer, Z.W.; Slippers, B.; Wingfield, B.D.; Groenewald, J.Z.; Lombard, L.; Crous, P.W. One fungus, one name promotes progressive plant pathology. Mol. Plant Pathol. 2012, 13, 604–613. [Google Scholar] [CrossRef]
  74. Aiyaz, M.; Thimmappa Divakara, S.; Mudili, V.; George Moore, G.; Kumar Gupta, V.; i Yli-Mattila, T.; Chandra Nayaka, S.; Ramachandrappa Niranjana, S. Molecular diversity of seed-borne Fusarium species associated with maize in India. Curr. Genom. 2016, 17, 132–144. [Google Scholar] [CrossRef] [Green Version]
  75. Gupta, S.; Krasnoff, S.B.; Underwood, N.L.; Renwick, J.A.A.; Roberts, D.W. Isolation of beauvericin as an insect toxin from Fusarium semitectum and Fusarium moniliforme var. subglutinans. Mycopathologia 1991, 155, 185–189. [Google Scholar] [CrossRef]
  76. Moretti, A.; Logrieco, A.; Bottalico, A.; Ritieni, A.; Fogliano, V.; Randazzo, G. Diversity in beauvericin and fusaproliferin production by different populations of Gibberella fujikuroi (Fusarium section Liseola). Sydowia 1997, 48, 44–56. [Google Scholar]
  77. Azliza, I.N.; Hafizi, R.; Nurhazrati, M.; Salleh, B. Production of major mycotoxins by Fusarium species isolated from wild grasses in peninsular Malaysia. Sains Malays. 2014, 43, 89–94. [Google Scholar]
  78. Xu, L.; Wang, J.; Zhao, J.; Li, P.; Shan, T.; Wang, J.; Li, X.; Zhou, L. Beauvericin from the endophytic fungus, Fusarium redolens, isolated from Dioscorea zingiberensis and its antibacterial activity. Nat. Prod. Commun. 2010, 5, 811–814. [Google Scholar] [CrossRef] [Green Version]
  79. Caicedo, N.H.; Davalos, A.F.; Puente, P.A.; Rodriguez, A.Y.; Caicedo, P.A. Antioxidant activity of exo-metabolites produced by Fusarium oxysporum: An endophytic fungus isolated from leaves of Otoba gracilipes. Open Microbiol. J. 2019, 8, e903. [Google Scholar] [CrossRef] [Green Version]
  80. Menezes, B.S.; Solidade, L.S.; Conceição, A.A.; Santos Junior, M.N.; Leal, P.L.; de Brito, E.S.; Canuto, K.M.; Mendonça, S.; de Siqueira, F.G.; Marques, L.M. Pigment production by Fusarium solani BRM054066 and determination of antioxidant and anti-inflammatory properties. AMB Express 2020, 10, 117. [Google Scholar] [CrossRef]
Jof 08 00662 g001 550
Figure 1. Fusarium isolates with phialides bearing conidia (a,b) Fusarium nirenbergiae NFCCI 5189 (c,d) Neocosmospora solani NFCCI 2315 (e,f) F. mangiferae NFCCI 2885 (g,h) F. annulatum NFCCI 2962 (i,j) F. microconidium NFCCI 3020 (k,l) F. sacchari NFCCI 3147 (m,n) N. oblonga NFCCI 2150 (o,p) Albonectria rigidiuscula NFCCI 5202 (q,r) F. irregulare NFCCI 2460 (s,t) Neocosmospora suttoniana NFCCI 2961 (u,v) F. annulatum NFCCI 2964 (w,x) Neocosmospora vasinfecta NFCCI 2972. Scale bars: b, d, f, h, j, l, p, r, t, v, x = 20 μm; n = 10 μm.
Figure 1. Fusarium isolates with phialides bearing conidia (a,b) Fusarium nirenbergiae NFCCI 5189 (c,d) Neocosmospora solani NFCCI 2315 (e,f) F. mangiferae NFCCI 2885 (g,h) F. annulatum NFCCI 2962 (i,j) F. microconidium NFCCI 3020 (k,l) F. sacchari NFCCI 3147 (m,n) N. oblonga NFCCI 2150 (o,p) Albonectria rigidiuscula NFCCI 5202 (q,r) F. irregulare NFCCI 2460 (s,t) Neocosmospora suttoniana NFCCI 2961 (u,v) F. annulatum NFCCI 2964 (w,x) Neocosmospora vasinfecta NFCCI 2972. Scale bars: b, d, f, h, j, l, p, r, t, v, x = 20 μm; n = 10 μm.
Jof 08 00662 g001
Jof 08 00662 g002 550
Figure 2. Fusarium tardicrescens (NFCCI 5201) culture grown on (a) Potato dextrose agar (b) Malt extract agar (c) Cornmeal agar (d–j) Phialides arising from mycelial hyphae producing micro and macroconidia (k) Micro and macroconidia. Scale bars: d, f, j = 20 μm; e, g, h, i, k = 10 μm.
Figure 2. Fusarium tardicrescens (NFCCI 5201) culture grown on (a) Potato dextrose agar (b) Malt extract agar (c) Cornmeal agar (d–j) Phialides arising from mycelial hyphae producing micro and macroconidia (k) Micro and macroconidia. Scale bars: d, f, j = 20 μm; e, g, h, i, k = 10 μm.
Jof 08 00662 g002
Jof 08 00662 g003a 550Jof 08 00662 g003b 550
Figure 3. Maximum-likelihood (IQ-TREE-ML) consensus tree inferred from the combined ITS, LSU, Rpb2, β-tub, CaM and Tef-1α multiple sequence alignment of genus Fusarium and related genera. Numbers at the branches indicate statistical support values (UFBS and SH-aLRT). The scale bar indicates expected changes per site. The tree is rooted to Atractium stilbaster (CBS 410.67). Isolates used in this study are shown in blue bold.
Figure 3. Maximum-likelihood (IQ-TREE-ML) consensus tree inferred from the combined ITS, LSU, Rpb2, β-tub, CaM and Tef-1α multiple sequence alignment of genus Fusarium and related genera. Numbers at the branches indicate statistical support values (UFBS and SH-aLRT). The scale bar indicates expected changes per site. The tree is rooted to Atractium stilbaster (CBS 410.67). Isolates used in this study are shown in blue bold.
Jof 08 00662 g003aJof 08 00662 g003b
Jof 08 00662 g004 550
Figure 4. Thin layer chromatography developed in petroleum ether: Ethyl acetate (1:1) showing spots of beauvericin detected using iodine vapours. Black arrow shows spots of beauvericin (1) Standard beauvericin (500 µg/mL) (2) Fusarium tardicrescens NFCCI 5201 (3) F. cugenangense NFCCI 2872 (4) Neocosmospora vasinfecta NFCCI 2960 (5) Fusarium annulatum NFCCI 2962.
Figure 4. Thin layer chromatography developed in petroleum ether: Ethyl acetate (1:1) showing spots of beauvericin detected using iodine vapours. Black arrow shows spots of beauvericin (1) Standard beauvericin (500 µg/mL) (2) Fusarium tardicrescens NFCCI 5201 (3) F. cugenangense NFCCI 2872 (4) Neocosmospora vasinfecta NFCCI 2960 (5) Fusarium annulatum NFCCI 2962.
Jof 08 00662 g004
Jof 08 00662 g005 550
Figure 5. HPLC chromatograms of (a) standard beauvericin (500 µg/mL) (b) Fusarium fabacearum NFCCI 5200 extract (c) F. sacchari NFCCI 4889 extract (d) F. carminascens NFCCI 5204 extract (e) F. tardicrescens NFCCI 5201 extract (f) F. cugenangense NFCCI 2872 extract.
Figure 5. HPLC chromatograms of (a) standard beauvericin (500 µg/mL) (b) Fusarium fabacearum NFCCI 5200 extract (c) F. sacchari NFCCI 4889 extract (d) F. carminascens NFCCI 5204 extract (e) F. tardicrescens NFCCI 5201 extract (f) F. cugenangense NFCCI 2872 extract.
Jof 08 00662 g005
Jof 08 00662 g006 550
Figure 6. Mycelial biomass and BEA content produced by different Fusarium isolates in the Fusarium defined medium (on day 7).
Figure 6. Mycelial biomass and BEA content produced by different Fusarium isolates in the Fusarium defined medium (on day 7).
Jof 08 00662 g006
Jof 08 00662 g007 550
Figure 7. HRMS spectra from higher-collision dissociation of the [M + Na]+ ions of fungal extract, (a) Fusarium sacchari NFCCI 4889 (b) F. tardicrescens NFCCI 5201.
Figure 7. HRMS spectra from higher-collision dissociation of the [M + Na]+ ions of fungal extract, (a) Fusarium sacchari NFCCI 4889 (b) F. tardicrescens NFCCI 5201.
Jof 08 00662 g007
Jof 08 00662 g008 550
Figure 8. Microtiter plate showing MIC of crude extract of F. tardicrescens NFCCI 5201 against Staphylococcus aureus MLS16 MTCC 2940 (Rows a–c) and Micrococcus luteus MTCC 2470 (Rows d–f).
Figure 8. Microtiter plate showing MIC of crude extract of F. tardicrescens NFCCI 5201 against Staphylococcus aureus MLS16 MTCC 2940 (Rows a–c) and Micrococcus luteus MTCC 2470 (Rows d–f).
Jof 08 00662 g008
Jof 08 00662 g009 550
Figure 9. Antifungal activity of individual and combined effect of extract of F. tardicrescens NFCCI 5201 containing beauvericin and amphotericin B on various pathogenic fungi (a) Pythium sp. NFCCI 3482 (b) Rhizopus sp. NFCCI 2108 (c) Rhizoctonia solani NFCCI 4327 (d) Sclerotium rolfsii NFCCI 4263 (e) Geotrichum candidum NFCCI 3744 (f) Bipolaris sorokiniana NFCCI 4690. PDA: Potato dextrose agar (Control); Ab: Potato dextrose agar containing amphotericin B (40 µg/mL); BEA: Potato dextrose agar having extract of F. tardicrescens NFCCI 5201 containing beauvericin (40 µg/mL); Ab + BEA: Potato dextrose agar having amphotericin B (20 µg/mL) and extract of F. tardicrescens NFCCI 5201 containing beauvericin (20 µg/mL).
Figure 9. Antifungal activity of individual and combined effect of extract of F. tardicrescens NFCCI 5201 containing beauvericin and amphotericin B on various pathogenic fungi (a) Pythium sp. NFCCI 3482 (b) Rhizopus sp. NFCCI 2108 (c) Rhizoctonia solani NFCCI 4327 (d) Sclerotium rolfsii NFCCI 4263 (e) Geotrichum candidum NFCCI 3744 (f) Bipolaris sorokiniana NFCCI 4690. PDA: Potato dextrose agar (Control); Ab: Potato dextrose agar containing amphotericin B (40 µg/mL); BEA: Potato dextrose agar having extract of F. tardicrescens NFCCI 5201 containing beauvericin (40 µg/mL); Ab + BEA: Potato dextrose agar having amphotericin B (20 µg/mL) and extract of F. tardicrescens NFCCI 5201 containing beauvericin (20 µg/mL).
Jof 08 00662 g009
Jof 08 00662 g010 550
Figure 10. Inhibition of mycelial growth (%) of individual and combined effect of extract of F. tardicrescens NFCCI 5201 containing beauvericin and amphotericin B on various pathogenic fungi using food poison technique.
Figure 10. Inhibition of mycelial growth (%) of individual and combined effect of extract of F. tardicrescens NFCCI 5201 containing beauvericin and amphotericin B on various pathogenic fungi using food poison technique.
Jof 08 00662 g010
Jof 08 00662 g011 550
Figure 11. The free radical scavenging activity of the extract of F. tardicrescens NFCCI 5201 containing beauvericin (mg/mL) and the standard ascorbic acid (mg/mL) when tested for in vitro antioxidant activity.
Figure 11. The free radical scavenging activity of the extract of F. tardicrescens NFCCI 5201 containing beauvericin (mg/mL) and the standard ascorbic acid (mg/mL) when tested for in vitro antioxidant activity.
Jof 08 00662 g011
Table
Table 1. Sixty-four Fusarium isolates procured from the National Fungal Culture Collection of India (NFCCI), along with other details such as host, place of collection and date of isolation, are listed.
Table 1. Sixty-four Fusarium isolates procured from the National Fungal Culture Collection of India (NFCCI), along with other details such as host, place of collection and date of isolation, are listed.
NFCCI No.HostPlace of CollectionDate of
Isolation
NFCCI 680Azadirachta indica (Endophyte)Maharashtra25 September 2006
NFCCI 681Azadirachta indica (Endophyte)Maharashtra20 December 2006
NFCCI 1127Jatropha curcus (Phyloplane)Durg, Chhattisgarh23 May 2007
NFCCI 1788SoilImphal, Manipur23 June 2009
NFCCI 1895SoilMahabaleshwar, Maharashtra25 August 2009
NFCCI 2053Wilted Guava plant (Root)Rajasthan9 February 2010
NFCCI 2150SoilArctic Tundra25 June 2010
NFCCI 2315PotatoGoa15 June 2009
NFCCI 2460Zanthooxylum armatumUdhampur, Jammu and Kashmir13 June 2011
NFCCI 2467Bottle GourdDapoli, Maharashtra16 June 2011
NFCCI 2470Coconut leavesVellayani, Thiruvananthapuram, Kerala22 June 2011
NFCCI 2491SoilBangalore, Karnataka8 July 2012
NFCCI 2696Coleus sp.Puthenthope, Kerala19 March 2012
NFCCI 2871Wilted tomato plant (Root)Manipur25 September 2012
NFCCI 2872Wilted tomato plant (Root)Manipur25 September 2012
NFCCI 2885Azadirachta indica (Endophyte)Chandravati, Rajasthan9 April 2012
NFCCI 2886Azadirachta indica (Endophyte)Chikkamagaluru, Karnataka15 July 2012
NFCCI 2904Aegle marmelosKarnataka28 November 2009
NFCCI 2945SoilTiruchirappalli, Tamil Nadu 7 January 2012
NFCCI 2946Aegle marmelosKarnataka25 November 2010
NFCCI 2949Cotton field Shirpur, Maharashtra9 October 2012
NFCCI 2953Cotton fieldShirpur, Maharashtra6 August 2015
NFCCI 2956Cotton fieldShirpur, Maharashtra19 October 2012
NFCCI 2959Pigeon pea (Root)Amravati, Maharashtra30 October 2012
NFCCI 2960Pigeon pea (Root)Amravati, Maharashtra30 October 2012
NFCCI 2961Pigeon pea (Root)Beed, Maharashtra26 October 2012
NFCCI 2962Pigeon pea (Root)Kalamb, Osmanabad, Maharashtra26 October 2011
NFCCI 2964Pigeon pea (Root)Latur, Maharashtra30 August 2012
NFCCI 2972Pigeon pea (Root)Ahmednagar, Maharashtra30 October 2012
NFCCI 3020SoilKarnataka24 December 2010
NFCCI 3031Piper betle (Leaf-endophyte) Tamil Nadu26 December 2011
NFCCI 3038Wilted cumin plantGujarat24 February 2013
NFCCI 3044Wilted cumin plantGujarat24 February 2013
NFCCI 3048Wilted cumin plantGujarat24 February 2013
NFCCI 3049Wilted cumin plantGujarat24 February 2013
NFCCI 3051Wilted cumin plantGujarat24 February 2013
NFCCI 3065Ocimum sanctumMaharashtra20 August 2012
NFCCI 3072Barleria prionitis (Stem) Maharashtra24 September 2012
NFCCI 3074Barleria prionitisMaharashtra20 September 2012
NFCCI 3091Textile sludgeTamil Nadu14 September 2012
NFCCI 3092Textile sludgeTamil Nadu 8 September 2012
NFCCI 3093Textile sludgeTamil Nadu15 September 2012
NFCCI 3147Rotten sugarcaneDapoli, Maharashtra5 January 2013
NFCCI 3239Marigold (Seeds) Mumbai, Maharashtra8 February 2013
NFCCI 3243Cow peaThiruvananthapuram, Kerala20 June 2012
NFCCI 3264Cow peaThiruvananthapuram, Kerala12 September 2012
NFCCI 3270Dead woodMumbai, Maharashtra29 March 2013
NFCCI 3282SoilAmarkantak, Madhya Pradesh26 September 2012
NFCCI 3300Cathranthus roseusRaipur, Chhattisgarh12 August 2012
NFCCI 3475Ocimum sanctum (Endophyte)Amaravati, Maharashtra21 July 2013
NFCCI 3703OnionNanded, Maharashtra14 September 2014
NFCCI 3706Castor sp. (Root)Aanand, Gujarat20 December 2014
NFCCI 4095SoilPune, Maharashtra2 April 2014
NFCCI 4180 SoilChandigarh19 June 2018
NFCCI 4759Anaphalis contorta (Root-endophyte)Imphal, Manipur18 February 2019
NFCCI 4792Chickpea (Root)Pratapgarh, Uttar Pradesh21 January 2018
NFCCI 4830Cotton (Root)Madurai, Tamil Nadu5 September 2018
NFCCI 4859Dillenia indicaArunachal Pradesh15 October 2016
NFCCI 4885Cucumber (Twig and leaf)Jobner, Jaipur, Rajasthan3 May 2020
NFCCI 4888Cucumber (Twig)Jobner, Jaipur, Rajasthan02 June 2020
NFCCI 4889Unknown insectVishakhapatnum Andhra Pradesh30 October 2020
NFCCI 4919SoilPathanamthitta, Kerala15 September 2020
NFCCI 4963Plant litterRaiganj, Uttar dinajpur, West Bengal25 March 2019
NFCCI 4972Sugarcane bagasseDharur, Beed, Maharashtra22 December 2020
Table
Table 2. Twenty-four isolates isolated in this study along with their accession nos., host, place of collection, date of collection and date of isolation details.
Table 2. Twenty-four isolates isolated in this study along with their accession nos., host, place of collection, date of collection and date of isolation details.
NFCCI No.HostPlace of
Collection		Date of
Collection		Date of
Isolation
NFCCI 5189SoilHaridwar, Uttarakhand2 July 201812 July 2018
NFCCI 5190GingerPune, Maharashtra27 August 201708 September 2017
NFCCI 5191PomegranatePune, Maharashtra7 September 201915 September 2019
NFCCI 5192Zingiber officinaleAurangabad, Maharashtra9 March 201710 March 2017
NFCCI 5193SoilJalgaon, Maharashtra10 October 201714 October 2017
NFCCI 5194Forest litterMahabaleshwar, Maharashtra12 October 201714 October 2017
NFCCI 5195SoilChandigarh1 April 201919 April 2019
NFCCI 5196Wilted sugarcane plantGorakhpur, Uttar Pradesh2 July 202117 July 2021
NFCCI 5197Chrysanthemum roseumMahabaleshwar, Maharashtra25 September 201827 September 2018
NFCCI 5198SoilPune, Maharashtra5 March 202016 March 2020
NFCCI 5199SoilJalgaon, Maharashtra8 October 201714 October 2017
NFCCI 5200PeaPune, Maharashtra15 April 201921 April 2019
NFCCI 5201Dead barkSimbal, Himachal Pradesh14 December 201725 December 2017
NFCCI 5202Wilted Cashew plantPilcode, Kerala6 August 201920 August 2019
NFCCI 5203Rotten mushroomSimbal, Himachal Pradesh19 May 201925 May 2019
NFCCI 5204PotatoPune, Maharashtra28 December 201812 January 2019
NFCCI 5205Aloe vera (Leaf)Pune, Maharashtra5 October 201916 October 2019
NFCCI 5206SoilVadodara, Gujarat3 October 201915 October 2019
NFCCI 5207CoconutGoa15 October 201829 October 2018
NFCCI 5208Zingiber officinaleAurangabad, Maharashtra5 October 201812 March 2018
NFCCI 5209Carrot rhizospherePithoragarh, Uttarakhand3 October 20197 October 2019
NFCCI 5210Chilli (Fruit)Simbal, Himachal Pradesh5 February 201912 February 2019
NFCCI 5211Damping-off Onion Udaipur, Rajasthan19 September 201927 September 2019
NFCCI 5212Grape (Leaf)Nashik, Maharashtra16 March 202017 April 2020
Table
Table 3. PCR primer sets used in this study for amplification as well as sequencing.
Table 3. PCR primer sets used in this study for amplification as well as sequencing.
Name of the Gene RegionPrimerDirectionSequence (5′-3′)Reference
Internal transcribed spacer
region of the nrDNA (ITS)		ITS-5ForwardGGAAGTAAAAGTCGTAACAAGG[30]
ITS-4ReverseTCCTCCGCTTATTGATATGC[30]
Translation elongation factor 1-alpha (tef1-α)EF-1ForwardATGGGTAAGGARGACAAGAC[31]
EF-2ReverseGGARGTACCAGTSATCATG[31]
28S large subunit of the nrDNA (LSU)LR-ORForwardACCCGCTGAACTTAAGC[32]
LR-7ReverseTACTACCACCAAGATCT[33]
RNA polymerase second largest subunit (rpb2)fRPB2-5fForwardGAYGAYMGWGATCAYTTYGG[34]
fRPB2-7cRReverseCCCATRGCTTGYTTRCCCAT[34]
Beta-tubulin (β-tub)βtuFFo1ForwardCAGACCGGTCAGTGCGTAA[35]
βtuFRo1ReverseTTGGGGTCGAACATCTGCT[35]
Calmodulin (CaM)CF-1ForwardGCCGACTCTTTGACYGARGAR[36]
CF-4ReverseTTTYTGCATCATRAGYTGGAC[36]
Table
Table 4. New records of Fusarium from India along with their host detail.
Table 4. New records of Fusarium from India along with their host detail.
IdentityThis StudyEarlier Reports
NFCCI No.HostHostReference
Fusarium caatingaenseNFCCI 5191PomegranateDactylopius opuntiae[55]
Fusarium carminascensNFCCI 5204PotatoZea mays[56]
Fusarium compactumNFCCI 2946Aegle marmelosPoa annua
Soil
Spinach
Wild rocket
Cultivated rocket
Lettuce
Quercus suber
Wheat
Apple fruit cultivar Idared and Pink lady
Banana corm and root rot
Safflower (Carthamus tinctorius L.)
Wheat soil
Grasses		[https://www.ncbi.nlm.nih.gov/nuccore accessed on 29 April 2022, [57,58,59,60,61,62]]
NFCCI 2904
NFCCI 5208Zingiber officinale
Fusarium cugenangenseNFCCI 2872Wilted tomato plant (Root)Crocus sp.
Gossypium barbadense
Human toe nail
Vicia faba
Musa sp. var. Pisang Kepok
Gossypium sp.		[56,63]
Fusarium duoseptatumNFCCI 681Azadirachta indica (Endophyte)Musa sapientum cv. Pisang Ambon
Musa sp. var. Pisang Rastali
M. acuminata var. Dwarf Cavendish
M. acuminata var. Pisang Ambon
Musa sp. var. Pisang Raja
Musa sp. var. Pisang Hawa
Musa sp. var. Pisang Awak
Musa sp. var. Pisang Susu
Musa sp. var. Pisang Keling		[56,63]
Fusarium fabacearumNFCCI 3239Marigold seedsZea mays
Glycine max		[56]
NFCCI 3706Castor root
NFCCI 5200Pea
Fusarium glycinesNFCCI 3048Wilted cumin plantLinum usitatissium
Ocimum basilicum
Glycine max		[56]
NFCCI 1788Soil
Fusarium gossypinumNFCCI 2467Bottle gourdGossypium hirsutum[56]
Fusarium grosmicheliiNFCCI 3243Cow peaBanana corm
M. acuminata var. Pisang Ambon
Musa sp. var. Pisang Awak
M. acuminata var. Pisang Ambon Lumut
M. acuminata var. Cavendish
Musa sp. var. Pisang Siem Jumbo
M. acuminata var. Pisang Ambon Kuning
Musa sp. var. Pisang Kepok		[63,64]
Fusarium lumajangenseNFCCI 4180SoilMusa sp. var. Pisang Raja Nangka
Musa acuminata var. Pisang Mas Kirana		[65]
Fusarium microconidiumNFCCI 3020SoilUnknown[11]
Fusarium nanumNFCCI 5192Zingiber officinaleMusa nana (Leaves)
Solanum lycopersicum
Musa acuminata
Oat
Soil
Triticum sp.
Sorghum sp.		[[66], https://www.ncbi.nlm.nih.gov/nuccore accessed on 29 April 2022]
Fusarium nirenbergiaeNFCCI 5189SoilSecale cereale
Musa sp.
S. tuberosum
Solanum lycopersicum
Passiflora edulis
Chrysanthemum sp.
Bouvardia longiflora
Dianthus caryophyllus
Agathosma betulina
Tulip roots
Amputated human toe
Human leg ulcer		[56]
NFCCI 4859Dillenia indica
Fusarium sulawesienseNFCCI 2956Cotton fieldMusa acuminata var. Pisang Cere (AAA)
Oryza sp.
Smilax corbularia
Acalypha insulana
Alocasia odora
Ipomoea batatas
Musa nana
Musa paradisiacal
Plum leaf
Triticum aestivum
Soil
Oryza sativa
Aleurocanthus woglumi
Phaseolus lunatus
Eucalyptus
Carica papaya
Prosopis sp.
Cucumis melo
Galia melon
Bixa orellana
Gossypium hirsutum
Sorghum vulgare
Musa sampientum var. Robusta
Mango leaf
Rhizosphere soil (Bromus tectorum)
Soybean		[[11,67,68,69,70],
https://www.ncbi.nlm.nih.gov/nuccore accessed on 29 April 2022]
NFCCI 2886Azadirachta indica (Endophyte)
NFCCI 3031Piberbettle leaf (endophyte)
NFCCI 4919Soil
Fusarium tardichlamydosporumNFCCI 3051Wilted cumin plantM. sapientum cv. Pisang Awak Legor
Musa sp. var. Monthan
M. acuminata var. Pisang Barangan
Musa sp. var. Bluggoe
M. acuminata var. Lady finger
Musa sp. var. Ney Poovan
Musa sp. var. Pisang Awak Legor		[56,63]
NFCCI 1895Soil
NFCCI 2491
Fusarium tardicrescensNFCCI 680Azadirachta indica (Endophyte)Musa sp. var. Harare
Cicer sp.
Raphanus sp.		[63]
NFCCI 5201Dead bark
Neocosmospora oblongaNFCCI 2150SoilHuman eye
Carbonatite		[[11],
https://www.ncbi.nlm.nih.gov/nuccore accessed on 29 April 2022]
Neocosmospora suttonianaNFCCI 5190GingerHuman wound
Equine eye
Soil
Homo sapiens
Gossypium hirsutum
Podocnemis unifilis
Human cornea
Human skin leukemic
Human blood leukemia
Human blood		[[11],
https://www.ncbi.nlm.nih.gov/nuccore accessed on 29 April 2022]
NFCCI 2961Pigeon pea root (Wilted)
NFCCI 5210Chilli fruit
NFCCI 4830Cotton rot
NFCCI 5211Onion plants (Damping-off)
Table
Table 5. Mycelial biomass and BEA content of Fusarium isolates and their pH in the Fusarium defined medium (on day 7).
Table 5. Mycelial biomass and BEA content of Fusarium isolates and their pH in the Fusarium defined medium (on day 7).
IdentityNFCCI No.Biomass
(g/L)		BEA Content
(mg/g)		Final pH of Medium
Fusarium nirenbergiaeNFCCI 51896.61 ± 0.262.93 ± 0.127.73 ± 0.32
Fusarium annulatumNFCCI 32646.72 ± 0.370.97 ± 0.147.48 ± 0.18
Fusarium lacertarumNFCCI 30448.07 ± 0.520.66 ± 0.147.65 ± 0.24
Neocosmospora suttonianaNFCCI 51907.14 ± 0.08-7.63 ± 0.22
Fusarium fabacearumNFCCI 32396.22 ± 0.31-7.77 ± 0.4
Fusarium sacchariNFCCI 31476.34 ± 0.10-7.6 ± 0.06
Fusarium caatingaenseNFCCI 51919.26 ± 0.260.33 ± 0.037.63 ± 0.03
Neocosmospora solaniNFCCI 23158.06 ± 0.650.34 ± 0.077.61 ± 0.12
Fusarium annulatumNFCCI 30726.83 ± 0.09-7.75 ± 0.15
Fusarium glycinesNFCCI 30485.64 ± 0.122.00 ± 0.447.39 ± 0.24
Fusarium annulatumNFCCI 33007.10 ± 0.340.66 ± 0.057.62 ± 0.54
Fusarium annulatumNFCCI 29647.07 ± 0.191.11 ± 0.187.5 ± 0.13
Fusarium mangiferaeNFCCI 28857.97 ± 0.28-7.8 ± 0.15
Fusarium grosmicheliiNFCCI 32436.37 ± 0.591.44 ± 0.0837.57 ± 0.21
Fusarium annulatumNFCCI 29627.42 ± 0.063.26 ± 0.237.49 ± 0.17
Fusarium nanumNFCCI 51926.40 ± 0.18-7 ± 0.14
Fusarium sacchariNFCCI 30938.61 ± 0.832.31 ± 0.587.32 ± 0.22
Fusarium sulawesienseNFCCI 29566.44 ± 0.37-7.44 ± 0.29
Neocosmospora metavoransNFCCI 51936.25 ± 0.46-7.34 ± 0.17
Fusarium sulawesienseNFCCI 28865.89 ± 0.27-7.34 ± 0.12
Fusarium annulatumNFCCI 29596.13 ± 0.49-7.29 ±0.18
Fusarium sulawesienseNFCCI 30318.99 ± 0.67-7.31 ± 0.48
Fusarium compactumNFCCI 29468.89 ± 0.110.08 ± 0.047.44 ± 0.42
Neocosmospora vasinfectaNFCCI 29606.64 ± 0.414.11 ± 0.177.44 ± 0.13
Fusarium brachygibbosumNFCCI 37035.74 ± 0.320.15 ± 0.068.79 ± 0.04
Fusarium irregulareNFCCI 51946.58 ± 0.481.88 ± 0.068.5 ± 0.20
Neocosmospora oblongaNFCCI 21505.06 ± 0.19-8.67 ± 0.37
Neocosmospora metavoransNFCCI 34756.51 ± 0.22-8.64 ± 0.06
Fusarium communeNFCCI 28718.15 ± 0.18-8.67 ± 0.18
Neocosmospora metavoransNFCCI 40956.71 ± 0.37-8.96 ± 0.28
Fusarium spinosumNFCCI 51959.15 ± 0.64-8.9 ± 0.07
Fusarium microconidiumNFCCI 30208.52 ± 0.13-8.82 ± 0.08
Fusarium cugenangenseNFCCI 28727.01 ± 0.074.47 ± 0.518.69 ± 0.15
Fusarium irregulareNFCCI 24609.04 ± 0.13-8.84 ± 0.03
Fusarium annulatumNFCCI 30656.22 ± 0.420.20 ± 0.068.93 ± 0.17
Fusarium tardicrescensNFCCI 6807.12 ± 0.340.47 ± 0.078.87 ± 0.05
Fusarium sacchariNFCCI 51969.18 ± 0.180.60 ± 0.067.87 ± 0.05
Fusarium lacertarumNFCCI 51977.79 ± 2.10.49 ± 0.178.03 ± 0.02
Fusarium irregulareNFCCI 519811.30 ± 4.8-8.36 ± 0.15
Fusarium annulatumNFCCI 247010.71 ± 0.29-7.87 ± 0.13
Fusarium sacchariNFCCI 30915.68 ± 0.17-7.28 ± 0.05
Neocosmospora metavoransNFCCI 51995.35 ± 0.57-7.42 ± 0.17
Fusarium brachygibbosumNFCCI 30747.80 ± 0.690.01 ± 0.057.72 ± 0.21
Neocosmospora suttonianaNFCCI 296110.24 ± 0.70.67 ± 0.078.17 ± 0.45
Fusarium lacertarumNFCCI 30497.22 ± 0.512.39 ± 0.397.19 ± 0.16
Fusarium sacchariNFCCI 30925.79 ± 0.14-7.26 ± 0.15
Fusarium annulatumNFCCI 11275.56 ± 0.61-6.92 ± 0.09
Fusarium fabacearumNFCCI 37067.30 ± 0.471.00 ± 0.208.6 ± 0.05
Fusarium compactumNFCCI 29046.45 ± 0.183.33 ± 0.517.02 ± 0.04
Fusarium lacertarumNFCCI 30387.59 ± 0.090.16 ± 0.068.07 ± 0.15
Fusarium annulatumNFCCI 29537.38 ± 0.152.21 ± 0.127.85 ± 0.17
Fusarium tardichlamydosporumNFCCI 30517.99 ± 0.122.19 ± 0.187.92 ± 0.13
Fusarium duoseptatumNFCCI 6816.37 ± 0.28-6.86 ± 0.12
Fusarium annulatumNFCCI 32705.14 ± 0.194.84 ± 0.367.24 ± 0.17
Fusarium verticillioidesNFCCI 29455.43 ± 1.2-7.18 ±0.3
Neocosmospora vasinfectaNFCCI 29727.61 ± 2.1-7.32 ± 0.02
Fusarium annulatumNFCCI 20534.64 ± 0.093.78 ± 0.557.73 ± 0.5
Fusarium proliferatumNFCCI 32826.51 ± 3.20.16 ± 0.197.55 ± 0.12
Fusarium fabacearumNFCCI 520010.07 ± 0.1714.25 ± 0.288.11 ± 0.16
Fusarium tardicrescensNFCCI 520111.23 ± 0.3815.82 ± 0.548.2 ± 0.11
Fusarium sacchariNFCCI 488914.17 ± 2.75.95 ± 0.618.23 ± 0.04
Albonectria rigidiusculaNFCCI 520214.03 ± 0.070.16 ± 0.047.39 ± 0.13
Fusarium tardichlamydosporumNFCCI 18957.80 ± 1.80.12 ± 0.057.27 ± 0.24
Fusarium pernambucanumNFCCI 52039.90 ± 0.151.04 ± 0.118.09 ± 0.15
Fusarium carminascensNFCCI 520411.15 ± 2.413.54 ± 0.628.44 ± 0.19
Fusarium nirenbergiaeNFCCI 48596.52 ± 0.08-7.5 ± 0.32
Fusarium irregulareNFCCI 52059.32 ± 1.6-7.59 ± 0.27
Fusarium brachygibbosumNFCCI 497211.03 ± 0.15-7.66 ± 0.21
Fusarium brachygibbosumNFCCI 52068.52 ± 2.9-7.66 ± 0.51
Fusarium pernambucanumNFCCI 52079.80 ± 2.61.43 ± 0.167.22 ± 0.18
Fusarium oxysporumNFCCI 47597.69 ± 0.142.22 ± 0.437.12 ± 0.16
Fusarium verticillioidesNFCCI 496310.55 ± 3.7-7.55 ± 0.14
Fusarium verticillioidesNFCCI 269611.05 ± 2.7-7.85 ± 0.05
Fusarium compactumNFCCI 52084.41 ± 0.131.146 ± 0.136.67 ± 0.07
Fusarium gossypinumNFCCI 24674.59 ± 0.170.27 ± 0.088.29 ± 1.5
Fusarium acutatumNFCCI 52094.69 ± 0.150.29 ± 0.066.38 ± 0.7
Neocosmospora suttonianaNFCCI 52107.50 ± 3.70.90 ± 0.087.86 ± 0.36
Neocosmospora metavoransNFCCI 48857.12 ± 2.50.86 ± 0.077.94 ± 0.59
Fusarium glycinesNFCCI 178811.20 ± 0.131.05 ± 0.108.04 ± 0.16
Fusarium tardichlamydosporumNFCCI 249113.59 ± 0.191.38 ± 0.118 ± 0.08
Albonectria rigidiusculaNFCCI 488813.77 ± 0.271.09 ± 0.088.13 ± 0.8
Neocosmospora suttonianaNFCCI 48304.67 ± 2.61.01 ± 0.057.65 ±0.02
Neocosmospora suttonianaNFCCI 52118.56 ± 3.1-8 ± 0.07
Fusarium annulatumNFCCI 521210.94 ± 1.2-8.14 ± 0.4
Fusarium lumajangenseNFCCI 41808.26 ± 2.71.07 ± 0.398.18 ±0.05
Fusarium lacertarumNFCCI 47929.66 ± 1.8-8.23 ± 0.1
Fusarium annulatumNFCCI 29496.70 ± 0.27-8.16 ± 0.02
Fusarium sulawesienseNFCCI 49198.72 ± 0.44-8.25 ± 0.14
- Not Detected; All values represent means ± S.E.M.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Rana, S.; Singh, S.K.; Dufossé, L. Multigene Phylogeny, Beauvericin Production and Bioactive Potential of Fusarium Strains Isolated in India. J. Fungi 2022, 8, 662. https://doi.org/10.3390/jof8070662

AMA Style

Rana S, Singh SK, Dufossé L. Multigene Phylogeny, Beauvericin Production and Bioactive Potential of Fusarium Strains Isolated in India. Journal of Fungi. 2022; 8(7):662. https://doi.org/10.3390/jof8070662

Chicago/Turabian Style

Rana, Shiwali, Sanjay Kumar Singh, and Laurent Dufossé. 2022. "Multigene Phylogeny, Beauvericin Production and Bioactive Potential of Fusarium Strains Isolated in India" Journal of Fungi 8, no. 7: 662. https://doi.org/10.3390/jof8070662

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop