Multi-Locus Phylogenetic Analysis Revealed the Association of Six Colletotrichum Species with Anthracnose Disease of Coffee (Coffea arabica L.) in Saudi Arabia
1
Department of Arid Land Agriculture, College of Agricultural and Food Sciences, King Faisal University, Al-Ahsa 31982, Saudi Arabia
2
Pests and Plant Diseases Unit, College of Agricultural and Food Sciences, King Faisal University, Al-Ahsa 31982, Saudi Arabia
3
Department of Soil, Plant and Food Sciences, University of Bari A. Moro, 70126 Bari, Italy
4
Institute of Sciences of Food Production (ISPA), National Research Council (CNR), 70126 Bari, Italy
*
Authors to whom correspondence should be addressed.
J. Fungi 2023, 9(7), 705; https://doi.org/10.3390/jof9070705
Submission received: 30 May 2023
/
Revised: 20 June 2023
/
Accepted: 26 June 2023
/
Published: 27 June 2023
Abstract
:Several Colletotrichum species are able to cause anthracnose disease in coffee (Coffea arabica L.) and occur in all coffee production areas worldwide. A planned investigation of coffee plantations was carried out in Southwest Saudi Arabia in October, November, and December 2022. Various patterns of symptoms were observed in all 23 surveyed coffee plantations due to unknown causal agents. Isolation from symptomatic fresh samples was performed on a PDA medium supplemented with streptomycin sulfate (300 mg L−1) and copper hydroxide (42.5 mg L−1). Twenty-seven pure isolates of Colletotrichum-like fungi were obtained using a spore suspension method. The taxonomic placements of Colletotrichum-like fungi were performed based on the sequence dataset of multi-loci of internal transcribed spacer region rDNA (ITS), chitin synthase I (CHS-1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), actin (ACT), β-tubulin (TUB2), and partial mating type (Mat1–2) (ApMat) genes. The novel species are described in detail, including comprehensive morphological characteristics and colored illustrations. The pathogenicity of the isolated Colletotrichum species was assessed on detached coffee leaves as well as green and red fruit under laboratory conditions. The multi-locus phylogenetic analyses of the six-loci, ITS, ACT, CHS-1, TUB2, GAPDH and ApMat, revealed that 25 isolates were allocated within the C. gloeosporioides complex, while the remaining two isolates were assigned to the C. boninense complex. Six species were recognized, four of them, C. aeschynomenes, C. siamense, C. phyllanthi, and C. karstii, had been previously described. Based on molecular analyses and morphological examination comparisons, C. saudianum and C. coffeae-arabicae represent novel members within the C. gloeosporioides complex. Pathogenicity investigation confirmed that the Colletotrichum species could induce disease in coffee leaves as well as green and red fruits with variations. Based on the available literature and research, this is the first documentation for C. aeschynomenes, C. siamense, C. karstii, C. phyllanthi, C. saudianum, and C. coffeae-arabicae to cause anthracnose on coffee in Saudi Arabia.
1. Introduction
The genus Coffea is a member of the family Rubiaceae and is indigenous to the African continent, specifically Ethiopia [1]. Under this genus, there are two subgenera, Coffea and Baracoffea, which together comprise about 103 species [2]. Among all the species, the two most common and economically grown commercial species worldwide are C. canephora (Robusta) and C. arabica L. (Arabica). Historically, the coffee species could be traced to the Kaffa region of Ethiopia, and were later introduced to other parts of the world by traders from Yemen in the 15th century [1]. From a geographical perspective, Saudi Arabia is located in close proximity to Ethiopia, where the coffee cultivation and spread started a few centuries ago, especially in the southwest of the Arabian Peninsula (Yemen and the southwest of Saudi Arabia) [3]. Coffee is grown in Jazan, Al Baha, Asir, and Najran regions of Saudi Arabia. Based on the statistics of the Fyfa Development Authority (FDA, government organization), approximately 78,000 coffee trees are cultivated in Saudi Arabia, with 84% located in the Addayer district of the Jazan region. The annual coffee bean production from these trees in Saudi Arabia is estimated to be around 500 tons [4].
Coffee berry disease, or coffee anthracnose, is caused by several Colletotrichum species and is a widespread issue affecting coffee plants in production areas globally [5]. The disease was first reported in 1922 in Kenya [6,7], causing losses of up to 75% [1], which later spread quickly to Angola, Ethiopia, Malawi, Cameroon, Uganda, and Tanzania [1,8,9]. The causal agent responsible for causing that disease was known as C. coffeanum var. virulans [10]. Later on, pathogenicity and morphological investigations conducted by various authors between the 1960s and 1990s led to the reclassification of C. coffeanum var. virulans as C. kahawae [11]. Hindorf’s [12,13,14] studies on the Colletotrichum population within coffee resulted in the description of three distinct species occurring on coffee berries: C. coffeanum, C. gloeosporioides, and C. acutatum. Thus far, 68 strains of Colletotrichum, comprising 35 distinct species, seems to cause coffee berry disease [15], leading to total crop losses of 50–80% [16]. Among the Colletotrichum species causing coffee berry disease, C. fructicola, C. siamense, and C. asianum have been specifically reported in northern Thailand [16]. In Vietnam, C. boninense, C. truncatum, C. acutatum, C. gloeosporioides, C. gigasporum, C. karstii, C. walleri, and C. vietnamense have been identified [17,18], while C. gigasporum, C. gloeosporioides, C. siamense, C. theobromicola, and C. karstii were documented in Mexico [19]. In China, eight species of C. karstii, C. ledongense, C. fructicola, C. endophytica, C. tropicale, C. siamense, C. gigasporum, and C. brevisporum were associated with anthranconse symptoms on leaves and fruit [20].
From a taxonomic point of view, Colletotrichum genus is considered cryptic and has undergone numerous taxonomic investigations in recent years [18,20,21,22,23,24,25]. These investigations have relied mainly on the data of different molecular markers’ multi-locus sequence analyses, where morphological characters alone are often insufficient for delineating several species. The frequently used markers, comprising internal transcribed spacer region rDNA (ITS), chitin synthase I (CHS-1), calmodulin (CAL), actin (ACT), β-tubulin (TUB), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), translation elongation factor 1- α (EF1α), and the large subunit of RNA polymerase II (RPB2) [8,20,26,27] have been demonstrated to be consistent for resolving the difficulties involved in identifying different species of the Colletotrichum genus. Additional molecular markers, such as APN2/MAT-IGS, GAP-IGS, and ApMat, were proposed as potential markers for delineating species of the C. gloeosporioides complex [20,28,29]. For separable Colletotrichum species complexes, some genomic markers like ApMat may be increasingly effective for certain species like those within the gloeosporioides complex. However, these markers may be less effective in distinguishing between species in other complexes. [30].
Regrettably, coffee trees in southwest Saudi Arabia are threatened primarily due to unknown fungal diseases and other potential pathogens. Considering the recently published work [31], limited information on fungi reported on coffee in Saudi Arabia is available. Keeping this in view, the current research is dedicated to monitor and subsequently characterize the Colletotrichum fungi accompanied with coffee trees, which could contribute to potential losses in the quantity and quality of coffee in Saudi Arabia. This study used a combination of phylogenetic analysis, morphological examination, and pathogenicity assessments to define and describe Colletotrichum species related to coffee trees in Saudi Arabia.
2. Materials and Methods
2.1. Sampling and Isolation
Coffee plantations were surveyed during October, November, and December 2022 in Jazan, Al Baha, Najran, and Asir regions (Table 1). Eighty-five vegetative samples from various tree parts, including fruits, leaves, and twigs, showing anthracnose symptoms were collected. Isolation from plant samples was made after surface disinfection through successive washing in 70 % ethanol for 30 s, followed by a 1 min wash in household bleach containing 1% NaOCl, and finally rinsed in distilled sterilized water and were dried using sterile filter paper [20]. Small pieces measuring 2–5 mm2, located between the infected and healthy tissues, were placed on potato dextrose agar medium (PDA) supplemented with streptomycin sulfate (300 mg/L−1) and copper hydroxide (42.5 mg/L−1) to inhibit bacterial and some fungal contamination [32]. Under dark conditions, the plates were incubated at 25 °C until the growth of fungi became visible. To obtain purified cultures, a hyphal tip was excised from the margins of the colonies that had developed from the tissue fragments and placed onto a new PDA medium. The new PDA medium was then incubated under the same conditions. Subsequently, single spore isolates were obtained using a spore suspension method [33].
2.2. Molecular Characterization
2.2.1. DNA Extraction, PCR Amplification, and Sequencing
The total genomic DNA was obtained from the harvested fresh mycelium of 7-day old cultures of Colletotrichum-like isolates grown on a PDA medium using the Dellaporta protocol for genomic DNA isolation [34]. Six gene regions, comprising the 5.8S nuclear ribosomal gene with two flanking internal transcribed spacers (ITS), chitin synthase (CHS-1), actin (ACT), beta-tubulin (TUB2), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), as well as partial mating type (Mat1–2) (ApMat) genes were amplified and sequenced. These gene regions were amplified with the primer pairs ITS1 + ITS4 for ITS [35], ACT-783R + ACT-512F for ACT act [36], T1 [37] + Bt2b [38] for TUB2, GDF + GDR for GAPDH [39], and AMF1 and AMR1 for ApMat [29], respectively. The primers that were utilized to amplify and sequence the DNA of Colletotrichum isolates in this study are shown in Table 2. The PCR reaction was carried out in 25 µL reaction volume, comprising 10 µL PCR Master Mix (amaR OnePCR, GeneDirex, Inc., Las Vegas, NV, USA), 1 µL of template DNA, 1.5 µL from each primer, and 11 µL of ddH2O. The PCR was carried out using a 2720 Thermal Cycler (Applied Biosystems, Foster City, CA, USA), and the amplification conditions for ITS, CHS-1, ACT, GAPDH, and TUB2 were identical to those outlined by Damm et al. [27]. For the ApMat gene, we followed the PCR amplification conditions outlined by Silva et al. [29]. The generated PCR products underwent bidirectional sequencing via Macrogen (Seoul, Republic of Korea) in accordance with the manufacturer’s guidelines.
2.2.2. Phylogenetic Analyses
All obtained sequences underwent nucleotide BLAST search engine via the NCBI (https://www.ncbi.nlm.nih.gov/ (accessed on 22 February 2022)) to check the potential similarity with the closely related taxa. The new released sequences were aligned with the nucleotide sequences of reference strains of Colletotrichum (Table 3) belonging to the same complex retrieved from the NCBI GenBank database (http://www.ncbi.nlm.nih.gov (accessed on 28 February 2022)), based on recent publications [23,40,41,42]. The taxonomic identity of the strains was investigated by phylogenetic analysis of combined gene regions. For the C. boninense species complex, the ACT, ITS, TUB2, and CHS-1 were utilized, while ITS, ACT, CHS-1, TUB2, GAPDH, and ApMat combined gene regions were employed for the C. gloesporioides species complex. MEGA XI v.11.0.8 was utilized for trimming and concatenating the multi-sequence alignment. The C. gloesporioides complex alignment has 113 taxa with 2905 characters, 681 parsimony-informative, 1535 distinct patterns, 527 constant sites, and 1697 singleton sites. The C. boninense complex alignment has 36 taxa with 1448 characters, 478 distinct patterns, 224 parsimony-informative, 214 singleton sites, and 1010 constant sites. IQ-TREE multicore version 2.2.0 [43] was employed to calculate the best-fit evolution model based on BIC by ModelFinder [44] and to infer the phylogenetic tree Maximum likelihood (ML) relying upon 10,000 ultrafast bootstrap support replicates [45] on the partitioned dataset [46].
The combined partitioned dataset with adapted substitution models was subjected to Bayesian analysis using MrBayes v3.2.6 on Cipres Science Gateway (www.phylo.org) (accessed on 22 February 2022), adapted by the previously ModelFinder calculation. The analysis was conducted in duplicate using four Markov chain Monte Carlo (MCMC) chains for 10,000,000 generations, and random trees sampling for every 1000 generations. During the Bayesian analysis, a temperature value of 0.10 and a burn-in of 0.25 were used. The analysis was set to stop automatically once the split frequencies’ average standard deviation became less than 0.01. For the C. boninense complex, we used 1210 samples from two runs, each of which yielded 806 samples, from which 605 were selected for the final analysis. For the C. gloesporioides complex, we used 6894 samples from two runs, each of which yielded 4596 trees, from which 3447 were sampled. The ML and Bayesian phylogenetic trees were viewed in FigTree v. 1.4.4 (http://tree.bio.ed.ac.uk/software/figtree (accessed on 15 March 2022)).
2.3. Morphological Characterization
Morphological characterization of Colletotrichum species was carried out as previously published [8,27]. For each characteristic isolate, the shape and sizes of 50 conidia were documented. In addition, the conidiophores, seta, and appressoria measurements were made for at least 30 at 100×magnification using Leica DM2500 LED light microscope with interference contrast (DIC). Appressoria was produced by dropping approximately 50 μL of conidial suspension on a glass slide, fixing the cover slip, and incubating for 5 days at 25 °C within a moist chamber. The results are presented as the minimum and maximum values along with the mean value ± its corresponding standard deviation (SD) for all measurements. Description and illustrations of novel species of Colletotrichum were deposited in MycoBank [47].
2.4. Pathogenicity Tests
Koch’s postulates were applied, and pathogenicity was carried out under controlled laboratory conditions on detached leaves and fruits of Coffea arabica [20]. Selected isolates representing six Colletotrichum species were first grown for 7 days on a PDA medium at 25 °C. Leaves and fruits that were of equal size and age and in good health were chosen for the inoculation process. Leaves and fruits were subjected to surface disinfection with household bleach (NaOCl 1%) for a 2 min period before washing in sterile distilled water and air-drying. To ensure the accuracy of the experiment, six replicates were carried out for each isolate. Each replicate involved three leaves and five fruits. The leaves were gently punctured at three points on the midrib’s upper surface utilizing a sterile needle tip. Coffee fruits were wounded by pinpricking the fruit wall to approximately 1 mm depth. Using the actively growing margins of each isolate, 5 mm of mycelium plug was extracted and positioned onto the wounded sites. The control leaves were subjected to inoculation using solely sterile PDA plugs. After inoculation, the leaves and fruits were then transferred into plastic boxes with lining of wetted paper towels to maintain high relative humidity. These were then incubated for 5–7 days at 25 °C, while being observed every day to detect the development of any symptoms. This experiment was repeated twice.
2.5. Data Analysis
Statistical analysis of variance [48] was achieved through employing SPSS 16.0 statistical package (SPSS Inc., Chicago, IL, USA) to delineate the mean size ± SD (standard deviation) of lesion diameters. Discrepancies in lesions diameters were documented after performing one-way-ANOVA at p < 0.05 and 95% confidence level. The mean of the measured values was compared utilizing the Least Significant Difference (LSD) test (p < 0.05).
3. Results
3.1. Symptoms Observation and Isolation
The coffee trees’ young leaves exhibited visible symptoms of anthracnose in the form of randomly scattered minor, irregular brown to black lesions. These lesions could expand and merge, leading to the formation of necrotic black patches (Figure 1A,B), which gave leaves a scorched appearance. The necrotic tissues were usually cracked forming holes on the leaf blade and finally detached from branches. On the twigs, black speaks initially starting from the apical portion and extended along the twig surface, leading to the death of the apical and lateral shoots (Figure 1C). Upon observing the semi-immersed fruiting structures (acervuli), orange masses of conidia were detected on the necrotic tissues that were released. Prominent, sunken dark decay lesions could extend deeply into the fruit, ultimately leading to the decay of fruit pulp of green and red berries (Figure 1D–F). In total, 27 Colletotrichum-like isolates were obtained; 18 from leaves, 6 from fruit, and 3 from branches (Table S1). The phylogenetic study comprised all the isolates obtained.
3.2. Molecular Characterization
The identification of all Colletotrichum-like isolates began with their classification up to the genus level, which relies upon their ITS sequences. Identity of isolates was further confirmed at the species level, based on the multi-locus phylogenetic analysis of the six-loci (ITS, ACT, CHS-1, TUB2, ApMat, and GAPDH) for our 27 sequences of Colletotrichum isolates along with reference sequences retrieved from GenBank (Table 3). This analysis revealed that 27 isolates were assigned into two species complexes, the C. gloeosporioides complex and C. boninense complex. Among the 27 isolates, 25 allocated within the C. gloeosporioides complex, and the remaining two belonged to the C. boninense complex. In the phylogenetic tree (Figure 2) of the six-loci ITS, ACT, CHS-1, TUB2, ApMat, and GAPDH, 25 isolates within the C. gloeosporioides complex clustered in four clades, eight of them with C. siamense and single isolate with C. aeschynomenes. Furthermore, two discrete clades were positioned far apart from all recognized species within the complex, and thus, they were recognized as new species and named C. saudianum and C. coffeae-arabicae (Figure 2). In the C. boninense complex phylogenetic tree (Figure 3), each of the two isolates were grouped in distinct clade. The phylogenetic analysis strongly supported the placement of PPDU41K in a clade with CBS129833, VPRI43652, and CBS126532 of C. karstii, as indicated by the high BS/BPP values (100%/1.0). This clade was recognized as C. karstii on the phylogenetic tree (Figure 3). The second isolate, PPDU36S, was grouped with the isolate CBS175.67 of C. phyllanthi within a clade highly supported with BS/BPP values (90%/1.0). Therefore, PPDU36S was identified as the known species C. phyllanthi.
3.3. Taxonomy
The morphological characteristics and multi-locus phylogeny helped designate the 27 isolates attained in this study into six distinct species. Four species, C. aeschynomenes, C. siamense, C. karstii, and C. phyllanthi, were firstly documented from coffee in Saudi Arabia, and a further two species were newly described.
Colletotrichum saudianum Alhudaib and A.M. Ismail., sp. nov. MycoBank 848994; Figure 4.
Etymology: The name refers to the country of origin, Saudi Arabia.
Sexual morph not observed. Asexual morph on PDA. Conidiomata acervular, semi-immersed or superficial, globose, black, solitary, or gregarious, oozing white or buff conidial masses. Setae and chlamydospores not observed. Conidiophores hyaline, thin-walled, smooth, 1–3 branched, 1–2 septate. Conidiogenous cells hyaline, thin-walled, smooth, cylindrical to inflated at the base, 13.5–19.2 × 1.9–4.1 μm, mean ± SD = 15.3 ± 3.2 × 3.1 ± 0.57 μm. Conidia hyaline, thin-walled, smooth, aseptate, cylindrical to oblong, granular contents, and small guttules, rounded at apex, slightly obtuse at base, 11.6–14.5 × 3.9–5.2 mean ± SD = 12.8 ± 0.93 × 4.5 ± 0.38 μm, L/W ratio = 2.8. Appressoria dark brown, irregular in shape, sometimes roundish with undulate margins, 7.1–9.7 × 5.1–7.3 µm, mean ± SD = 7.9 ± 0.85 × 5.8 ± 0.65 µm, L/W ratio = 1.3.
Culture characteristics: the colonies grown on PDA were sparse and dense, with effuse mycelium mats that were initially white and became olivaceous buff to greenish olivaceous on the upper surface. On the reverse side, the colonies had iron grey to olivaceous grey color. The color darkened with age. Following 10 days of dark incubation at 25 °C, the colonies grown to the Petri plate edge, measuring 85 mm. Conidia were observed as orange masses released from semi-immersed acervuli.
Materials examined: SAUDI ARABIA, Asir Region, from leaves of Coffea arabica (Rubiaceae), 17 November 2022, A.M. Ismail, culture ex-type PPDU38H (holotype KSA-38H-2023); from leaves of Coffea arabica (Rubiaceae), 17 November 2022, A.M. Ismail (PPDU38B). Additional examined materials: SAUDI ARABIA, Al Baha Region from leaves lesions of Coffea arabica (Rubiaceae), 14 September 2022, A.M. Ismail (PPDU31M); SAUDI ARABIA, Jazan Region from fruit lesions of Coffea arabica (Rubiaceae), 13 October 2022 (PPDU28E).
Notes: According to the multi-locus phylogenetic analysis of the combined six genes, ITS, ACT, TUB2, CHS-1, GAPDH, and ApMat, 12 strains of C. saudianum formed an independent clade in the gloeosporioides complex (Figure 2). Colletotrichum saudianum is discerned from all species of the genus based upon its morphology, as it produces short conidia (mean ± SD = 12.8 ± 0.93 × 4.5 ± 0.38 μm) compared to those of C. tainanense (16–22 × 4.5–5 μm) [23], and C. salsolae (av. 15.3 × 5.8 μm) [8]. Furthermore, the conidia shape of C. saudianum is cylindrical, while those of C. salsolae are subglobose to long cylindrical. In addition, the conidiogenous cells of C. salsolae are wider (4–6.5 μm) than those of C. saudianum (1.9–4.1 μm). Furthermore, a BLASTn searching on the NCBI GenBank utilizing the ex-type strain PPDU38H’ ITS sequences revealed the closest matches to be 100% C. gloeosporioides (GenBank JX902431), 99.8% C. aenigma (GenBank OQ184880), and 99.8% C. siamense (GenBank OQ184036). In contrast, based on the ACT sequence, the closest matches found were 99.5% Colletotrichum sp. (GenBank KC790648) and 99% with C. siamense (GenBank OQ023904 and OQ023903). BLASTn search using TUB2 sequence yielded closest matches 100 % with C. siamense (GenBank MF143931), 99% with C. salsolae (GenBank MN746330), and 99% with C. fructicola (GenBank OP660827). However, the closest similarities using the CHS-1 sequence were 100% C. gloeosporioides (GenBank MF554932), 100% Colletotrichum sp. (GenBank KF451982), and 100% with C. fructicola (GenBank OQ702521). Based on the GAPDH sequence, the closest matches found were 95.7 % C. siamense (GenBank MF110883, MF110873) and 95.7% C. dianesei (GenBank KX094166). Additionally, the closest matches of the ApMat were 99.8% Colletotrichum sp. (GenBank KC790698), 97.4% C. siamense (GenBank OM816816, OM816807). The morphological comparisons and molecular analyses confirm that C. saudianum denotes a novel species within the C. gloeosporioides complex.
Colletotrichum coffeae-arabicae Alhudaib and A.M. Ismail., sp. nov. MycoBank 848995; Figure 5.
Etymology: The name refers to the host plant (Coffea Arabica) from where the fungus was originally collected.
Sexual morph not observed. Asexual morph on PDA. Conidiomata are mostly solitary or in aggregates, semi-immersed in the mycelium, oozing orange masses of conidia. Setae are light to dark brown, thick-walled, mostly straight or slightly flexuous, cylindrical, sometimes inflated in the middle, slightly inflated or conical at the base, acute to slightly rounded at the tip, 2–3 septate, 40–118 × 3–5 μm. Conidiophores are hyaline, thin-walled, smooth, 2–4 branched, and 1–2 septate. Conidiogenous cells are hyaline, thin-walled, smooth, cylindrical to swollen, 13–24 × 3–6 μm, mean ± SD = 19 ± 3.2 × 5 ± 1 μm. Conidia hyaline, thin-walled, smooth, cylindrical to ellipsoid, aseptate, somewhat constricted at the middle, guttulate with some small guttules, rounded at apex, obtuse at base, 15.5–18.7 × 5.8–7.4 μm, mean ± SD = 17.3 ± 0.7 × 6.4 ± 0.5 μm, L/W ratio = 2.7. Appressoria medium to dark brown, thick-walled, irregular in shape, but often elliptical shaped, 6.9–11.8 × 4.6–7.8 µm, mean ± SD = 8.6 ± 1.56 × 6.1 ± 0.96 µm, L/W ratio = 1.4.
Culture characteristics: the colonies on PDA are fluffy with white raised cottony mycelia, turned dark mouse-grey in the center, pale grey with an entire margin. The reverse of the colonies is iron grey to olivaceous grey. Following a 7-day incubation at 25 °C in the dark, the colonies grown to the Petri plate edge, measuring 85 mm. The conidia appear as pinkish-orange masses released from semi-immersed acervuli.
Materials examined: SAUDI ARABIA, Jazan Region, from leaves of Coffea arabica (Rubiaceae), 12 October 2022, A.M. Ismail, culture ex-type PPDU26B (holotype KSA-26B-2023); from branches and leaves lesions of Coffea arabica (Rubiaceae), 12 October 2022, A.M. Ismail (PPDU27D, PPDU29F).
Notes: The C. gloeosporioides species complex is characterized by cylindrical conidia that have rounded ends and taper slightly towards the base, which is similar to the conidial morphology observed in C. coffeae-arabicae [8,25]. However, the multi-locus phylogenetic analysis revealed that the four C. coffeae-arabicae strains formed a discrete clade and were phylogenetically distinct from the current recognized species within the gloeosporioides complex. Furthermore, BLASTn search of the ex-type strain PPDU26B of C. coffeae-arabicae sequences revealed a variable sequence resemblance with other sequences within the NCBI GenBank from different species. The closest matches using the ITS had a 100% similarity to C. siamense (GenBank MT450691, MT450690, and MT450689). Furthermore, the closest ACT sequence match showed 100% similarity to C. aenigma (GenBank OQ698783 and OQ698782) and 100% to C. siamense (OQ698755). However, TUB2 showed the highest similarity 100% to C. siamense (GenBank OP660847; OP660836 and OP660829). However, the CHS-1 sequence revealed homology of 99.5% to C. gloeosporioides (GenBank MF554932 and ON723793) and 99% to C. fructicola (GenBank OQ703570). Moreover, the GAPDH sequences demonstrated 100% to C. siamense (GenBank MF110865; MN228537 and MN228536). Additionally, the ApMat sequences had 96.7% similarity with C. siamense (GenBank KX578771), 96.3 % with C. siamense (GenBank MW557490), and 96.1% with C. siamense (GenBank OM816816). The morphological comparisons and phylogenetic analyses ascribed C. coffeae-arabicae as a novel taxon within the C. gloeosporioides complex.
3.4. Pathogenicity Tests
Pathogenicity test results demonstrated that all the tested Colletotrichum isolates were able to induce disease symptoms similar to that recognized in the field on coffee leaves and fruits (Figure 6 and Figure 7). After 5 days, small brown lesions appeared nearby the inoculation site, which then grew and developed into large necrotic brown lesions with black margins (Figure 7A–D). Orange conidial masses have been recognized on the surface of necrotic lesions on leaves as well as on red fruit after 12 days (Figure 7D,F). No symptoms developed on the control leaves and fruits. The tested isolates of C. saudianum and C. siamense developed lesions 3 days earlier than the two isolates of C. karstii and C. phyllanthi, which developed lesions after 8 days. The LSD test revealed significant (p < 0.05) differences in lesion diameter induced by the tested isolates, of which C. saudianum PPDU38H caused the largest lesion diameter (1.63 cm), followed by C. saudianum PPDU28E, which produced lesion that reached 1.48 cm. Conversely, the remaining Colletotrichum isolates produced lesions that insignificantly (p < 0.05) varied in size from each other (Figure 6A). The majority of isolates produced larger lesion sizes on red fruit than green ones (Figure 7E, F), with the largest lesions caused by C. siamense PPDU27M (1.8 cm), C. saudianum PPDU38H (1.68 cm), C. saudianum PPDU28E (1.5 cm), and C. coffeae-arabicae PPDU29F (1.48 cm). In contrast, the smallest lesion sizes were caused by isolates C. aeschynomenes PPDU28A (0.88 cm), C. siamense PPDU40G (0.8 cm), C. karstii PPDU41K (0.5 mm), and C. phyllanthi PPDU36S (0.4 cm). On the other hand, the two isolates C. coffeae-arabicae PPDU29F and C. saudianum PPDU38H showed equal virulence on green fruit by producing similar lesion lengths (0.93, 0.9 cm, respectively), which were significantly (p < 0.05) larger than those of other isolates (Figure 6B). Contrariwise, both C. karstii PPDU41K and C. phyllanthi PPDU36S revealed much lowered lesion expansion rate around the inoculation site over the experimental progress either on leaves or green as well as red fruits (Figure 6A,B and Figure 7). The differences in lesion diameters among Colletotrichum species and even isolates of the same species attributed to their geographical origin or the plat part where they were isolated. It was also observed that mature fruits were more sensitive than green ones and exhibited larger lesions diameters. The artificial inoculation of Colletotrichum species onto detached coffee leaves and fruits resulted in the successful recovery of the fungi, fulfilling Koch’s postulates.
4. Discussion
Colletotrichum is a genus that comprises economically significant pathogenic species with numerous host plants worldwide. Few efforts have been made to assess the disease problems of Coffea arabica in Saudi Arabia. Therefore, this study represents the initial attempt to evaluate the occurrence and the diversity of Colletotrichum species that are linked to different symptom patterns recognized in coffee trees. During a planned survey carried out in October, November, and December 2022, various patterns of symptoms were observed in all 23 surveyed coffee plantations due to unknown causal agents. The well-known anthracnose symptoms were often observed on the leaves as minute black to dark brown lesions with asymmetrical margins. Infections on the twigs and branches typically start from the apical portion along the twig surface, leading to the death of the apical and lateral shoots. Green and red berries exhibited dark, sunken, prominent lesions that deeply extended into the fruit, causing the fruit pulp to decay. These observed symptoms coincided with those previously reported [19,49].
Accurate delineation of the causal organisms responsible for Colletotrichum infections is crucial, given the significant economic losses experienced by coffee plantations and the restricted knowledge of growers in this regard. In the present study, the ITS sequence data aided in placing the 27 isolates in the C. gloeosporioides and C. boninense species complexes, approving the usefulness of ITS sequencing for categorizing Colletotrichum isolates [24,50]. Furthermore, extensive phylogenetic inference depending upon multi-locus analyses of ITS, ACT, TUB2, CHS-1 GAPDH, and ApMat provided a firm resolution and allocated all Colletotrichum isolates associated with Coffea arabica into two distinct species complexes and additionally ascribed them into six species. Among the six species identified, four were already known, C. siamense, C. aeschynomenes, C. karstii, and C. phyllanthi, while two novel species, C. saudianum and C. coffeae-arabicae, were also identified. It was not easy to discriminate species of C. gloeosporioides complex depending upon the data of the five loci including, ITS, ACT, CHS-1, TUB2, and GAPDH. Interestingly, relying on the sequence data of the single gene ApMat adequately provided a robust separation between the species of the C. gloeosporioides complex, and the resulting tree has topology resembling the tree obtained by the six loci. It also aided in the confirmation of the identity of two newly described species in this study, namely C. saudianum and C. coffeae-arabicae. Our results are supported by those published by de Silva et al. [29], who confirmed that the ApMat marker solely was ultimately useful in disentangling species of the C. gloeosporioides complex isolated from C. arabica and other coffee species. Other studies have confirmed these findings. For example, Liu et al. [41] verified that the ApMat marker, along with GS, offers significant phylogenetic information and successfully separated 22 species in the C. gloeosporioides complex when compared to other used loci ITS, ACT, CHS-1, TUB2, GS, and GAPDH. In addition, the research of Khodadadi et al. [24] revealed that the ApMat, when combined with ITS and TUB2, could efficiently allocate the new species C. noveboracense to a discrete clade that was highly supported with Bayesian posterior probability and bootstrap values. Crouch et al. [51] first introduced the Apn2-Mat1 locus for differentiating species in the C. graminicola complex. This ApMat marker was subsequently used to separate species in the C. gloeosporioides complex [28,52,53,54]. Both GAPDH and TUB2 markers are widely considered highly effective barcodes for most Colletotrichum complexes and are widely used. However, complex-specific barcodes must still be utilized in conjunction with them to achieve accurate species delimitation [8,28,29]. In our case study, GAPDH and TUB2 sequence did not consistently delineate species within the cryptic species of gloeosporioides complex. Accordingly, using ApMat sequence data approved the affordability and reliability of this marker for differentiating species of C. gloeosporioides complex. Therefore, we recommend combining ApMat with other markers as a sufficient technique for classifying species within the C. gloeosporioides complex.
Based on the results of this study, the most frequently reported species belonging to the C. gloeosporioides complex were C. siamense, C. aeschynomenes, C. saudianum, and C. coffeae-arabicae. Only two isolates representing two species, C. karstii and C. phyllanthi, belonged to the C. boninense species complex, and these were separated at much lowered frequency (one isolate for each). Among the species of C. gloeosporioides isolated from coffee, Colletotrichum saudianum (12 isolates) was the most frequently isolated, followed by C. siamense (8 isolates) and C. coffeae-arabicae (4 isolates). In contrast, only a single isolate of C. aeschynomenes was recovered. The presence of six species of Colletotrichum associated with anthracnose disease on coffee indicates that more than one Colletotrichum species can colonize a single host, which is consistent with the conclusion of previous studies [16,19,25,27,55]. The compositions of Colletotrichum species from coffee appeared to differ according to the geographical origin, host, and species complex. For example, C. kahawae also appears to be host-specific to Coffea species and geographically restricted and widespread in the African continent or in low altitudes [8,11,15]. However, C. kahawae has been reported to cause anthracnose disease on different hosts in Australia, Europe, South Africa, and USA [8,56]. Furthermore, other members of the C. gloeosporioides complex, such as C. siamense and C. fructicola, are widely reported in coffee in several countries and are known to have a broader host range. Although several species have been reported to cause infection in coffee, the association of C. aeschynomenes and C. phyllanthi and the newly described species C. saudianum and C. coffeae-arabicae is considered the first report in Saudi Arabia and worldwide. The low incidence of C. karstii and C. phyllanthi and the fact that the only two isolates of these species induced the smallest lesions on coffee leaves and fruit indicate that these species are of little importance and do not contribute significantly to anthracnose disease. Previous studies have reported that Colletotrichum karstii is a causal agent of anthracnose disease on coffee in Vietnam and Mexico, but in low frequencies [18,19,20], which supports our results. Colletotrichum phyllanthi, on the other hand, has not been previously reported on coffee, and we report for the first time its association with anthracnose symptoms.
Koch’s postulates were fulfilled, indicating that all isolates were pathogenic to detached coffee leaves as well as green and red fruit with significant p < 0.05 variations in infection degree. Variations were also among isolates of the same species, with the most virulent species being C. saudianum, C. siamense, and C. coffeae-arabicae, which frequently recovered from coffee. On the other hand, the lowest dominant species, C. aeschynomenes, C. karstii, and C. phyllanthi, provoked the smallest lesions either on detached leaves or on fruit (Figure 6). According to the statistical analysis, there were significant differences between isolates. These differences could be attributed to the geographical origin of isolates or/and plant part where it was isolated. The leaf lesions caused by the six Colletotrichum species were similar; however, the symptoms development and lesion sizes varied among species. For example, leaves and fruit inoculated with C. saudianum and C. siamense developed lesions 5 days earlier and larger than the other species, whereas the two isolates of C. karstii and C. phyllanthi developed lesions after 8 days. Similar results were also reported, in which the C. siamense was faster in developing lesions on coffee leaves and C. karstii was the slowest species, which produced lesions after 30 days of inoculation [19]. Additionally, Cao et al. [20] found out that among tested Colletotrichum species; C. siamense, C. gigasporum and C. karstii were the most virulent on both Arabica and Robusta coffee red fruits and recorded the same infection incidence 100 %. While on green fruit, the infection incidence was lower and registered 50, 0, and 25 %, respectively. Moreover, Nguyen et al., [57], indicated that C. fructicola and C. siamense can induce lesions on detached green berries after inoculation; however, the efficacious infection rate was low. In a similar study, Prihastuti et al. [16] demonstrated that C. fructicola was the most virulent species in producing higher infection percentage (89.93 %) on red fruit than C. asianum (63.06%) and C. siamense (50.19%). Similarly, Waller et al., [11] indicated that C. gloeosporioides isolates from coffee are capable of causing disease only on ripe berries, leaves, and are not able to cause the infection of green berries. These findings were also confirmed in laboratory trials in Papua New Guinea, of which C. gloeosporioides only infected ripe red berries [58]. These results supported our findings, of which the red fruits were more severely affected than green ones. The reasons behind this could be the onset of senescence, which are characterized by reduced defensive systems, weakened tissues, and increased ethylene production.
5. Conclusions
Understanding the taxonomy and the pathogenicity of Colletotrichum is fundamental in coffee production regions in order to manage this economically important disease and secure the profitability of the coffee industry in Saudi Arabia. Knowing the distribution of Colletotrichum species could help to propose a suitable control program based on their sensitivity to fungicides. In this study, ITS, TUB2, ACT, CHS-1 were sufficient to distinguish C. karstii and C. phyllanthi within the C. boninense complexes. In contrast, ITS, TUB2, ACT, CHS-1, GADPH, and ApMat regions were fundamental to differentiate species within the C. gloeosporioides complex. Therefore, using GADPH and ApMat gene regions confirmed the reliability and affordability of these markers to differentiate between species of C. gloeosporioides complex. Although C. siamense has been previously reported on Coffea arabica and many host species, this is the first report of C. siamense causing anthracnose on coffee in Saudi Arabia. This was also the first report of C. aeschynomenes on coffee in Saudi Arabia and worldwide. In addition, the two novel species; C. saudianum and C. coffeae-arabicae were new additions to the Colletotrichum species causing anthracnose on coffee in Saudi Arabia and worldwide. Furthermore, the dominance of C. saudianum makes it an appropriate model for addressing questions of population structure and dispersal at broad geographical and landscape level. Hence, additional collections from coffee growing regions across the southwest of Saudi Arabia would therefore aid us characterize the population structure of this important pathogen and to confirm whether this species is indeed the dominant Colletotrichum species.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/jof9070705/s1, Table S1: Source, origin and date of collection of the 27 isolates obtained in this study
Author Contributions
Conceptualization, A.M.I. and K.A.; methodology, A.M.I. and D.M.; software, A.M.I. and D.M.; writing—original draft preparation, A.M.I. and D.M.; writing—review and editing, K.A. and A.M.I. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by the Deputyship for Research and Innovation; Ministry of Education in Saudi Arabia, grant number [INST123].
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
All the data related to this study are mentioned in the manuscript and Supplementary Materials.
Acknowledgments
The authors extend their appreciation to the Deputyship for Research and Innovation, Ministry of Education in Saudi Arabia, for funding this research work (Project number INST123). We would like to acknowledge the technical staff Mustafa I. Almaghasla for his assistance in the molecular analyses.
Conflicts of Interest
There are no conflict of interest among the authors.
References
- Hindorf, H.; Omondi, C.O. A Review of Three Major Fungal Diseases of Coffea arabica L. in the Rainforests of Ethiopia and Progress in Breeding for Resistance in Kenya. J. Adv. Res. 2011, 2, 109–120. [Google Scholar] [CrossRef] [Green Version]
- Al-Asmari, K.; Abu Zeid, I.; Al-Attar, A. Coffee Arabica in Saudi Arabia: An Overview. Int. J. Pharm. Phytopharm. Res. 2020, 10, 71–78. [Google Scholar]
- Eskes, A. Identification, Description, and Collection of Coffee Types in P. D. R. Yemen; IPGRI: Rome, Italy, 1989. [Google Scholar]
- Tounekti, T.; Mosbah, M.; Al-Turki, T.; Khemira, H. Genetic Diversity Analysis of Coffee (Coffea arabica L.) Germplasm Accessions Growing in the Southwestern Saudi Arabia Using Quantitative Traits. Nat. Resour. 2017, 8, 321–336. [Google Scholar] [CrossRef] [Green Version]
- Avelino, J.; Allinne, C.; Cerda, R.; Willocquet, L.; Savary, S. Multipledisease System in Coffee: From Crop Loss Assessment to Sustainable Management. Annu. Rev. Phytopathol. 2018, 56, 611–635. [Google Scholar] [CrossRef]
- McDonald, J. A Preliminary Account of a Disease of Green Coffee Berries in Kenya Colony. Trans. Br. Mycol. Soc. 1926, 11, 145–154. [Google Scholar] [CrossRef]
- Waller, J.M.; Bigger, M.; Hillocks, R. Coffee Pests, Diseases and Their Management; CABI: Wallingford, UK, 2007; 434p, ISBN 978-1-84593-209-1. [Google Scholar]
- Weir, B.; Johnston, P.; Damm, U. The Colletotrichum gloeosporioides Species Complex. Stud. Mycol. 2012, 73, 115–180. [Google Scholar] [CrossRef] [Green Version]
- Alemu, F. Assessment of the Current Status of Coffee Diseases at Gedeo and Sidama Zone, Ethiopia. Int. J. Adv. Res. 2013, 1, 192–202. [Google Scholar]
- Rayner, R. Coffee Berry Disease—A Survey of Investigations Carried Out Up to 1950. East Afr. Agric. J. 1952, 17, 130–158. [Google Scholar] [CrossRef]
- Waller, J.M.; Bridge, P.D.; Black, R.; Hakiza, G. Characterization of the Coffee Berry Disease Pathogen, Colletotrichum kahawae sp. Nov. Mycol. Res. 1993, 97, 989–994. [Google Scholar] [CrossRef]
- Hindorf, H. Colletotrichum–Population Auf Coffea arabica L. in Kenya: II. Qualitative and Quantitative Unterschiede in Der Colletotrichum–Population. J. Phytopathol. 1973, 77, 216–234. [Google Scholar] [CrossRef]
- Hindorf, H. Colletotrichum–Populationen Auf Coffea arabica L. in Kenia: III. Verbreitung von Colletotrichum-Arten Auf Den Einzelnen Organen Des Kaffeestrauches. J. Phytopathol. 1973, 77, 324–338. [Google Scholar] [CrossRef]
- Hindorf, H. Colletotrichum-Population Auf Coffea arabica L. in Kenia: I. Eine Methode Zur Systematischen Trennung von Pilzpopulationen. J. Phytopathol. 1973, 77, 97–116. [Google Scholar] [CrossRef]
- Lu, L.; Tibpromma, S.; Karunarathna, S.C.; Jayawardena, R.S.; Lumyong, S.; Xu, J.; Hyde, K.D. Comprehensive Review of Fungi on Coffee. Pathogens 2022, 11, 411. [Google Scholar] [CrossRef] [PubMed]
- Prihastuti, H.; Cai, L.; Chen, H.; McKenzie, E.; Hyde, K.D. Characterization of Colletotrichum Species Associated with Coffee Berries in Northern Thailand. Fungal Divers. 2009, 39, 89–109. [Google Scholar]
- Nguyen, P.T.H.; Pettersson, O.V.; Olsson, P.; Liljeroth, E. Identification of Colletotrichum Species Associated with Anthracnose Disease of Coffee in Vietnam. Eur. J. Plant Pathol. 2010, 127, 73–87. [Google Scholar] [CrossRef] [Green Version]
- Liu, F.; Cai, L.; Crous, P.W.; Damm, U. The Colletotrichum gigasporum Species Complex. Pers. Mol. Phylogeny Evol. Fungi 2014, 33, 83–97. [Google Scholar] [CrossRef] [Green Version]
- Cristóbal-Martínez, A.L.; de Jesús Yáñez-Morales, M.; Solano-Vidal, R.; Segura-León, O.; Hernández-Anguiano, A.M. Diversity of Colletotrichum Species in Coffee (Coffea arabica) Plantations in Mexico. Eur. J. Plant Pathol. 2017, 147, 605–614. [Google Scholar] [CrossRef]
- Cao, X.R.; Xu, X.M.; Che, H.Y.; West, J.S.; Luo, D.Q. Characteristics and Distribution of Colletotrichum Species in Coffee Plantations in Hainan, China. Plant Pathol. 2019, 68, 1146–1156. [Google Scholar] [CrossRef]
- Damm, U.; Sato, T.; Alizadeh, A.; Groenewald, J.Z.; Crous, P. The Colletotrichum dracaenophilum, C. magnum and C. orchidearum Species Complexes. Stud. Mycol. 2019, 92, 1–46. [Google Scholar] [CrossRef]
- Cannon, P.F.; Damm, U.; Johnston, P.R.; Weir, B.S. Colletotrichum-Current Status and Future Directions. Stud. Mycol. 2012, 73, 181–213. [Google Scholar] [CrossRef] [Green Version]
- de Silva, D.D.; Groenewald, J.Z.; Crous, P.W.; Ades, P.K.; Nasruddin, A.; Mongkolporn, O.; Taylor, P.W.J. Identification, Prevalence and Pathogenicity of Colletotrichum Species Causing Anthracnose of Capsicum annuum in Asia. IMA Fungus 2019, 10, 8. [Google Scholar] [CrossRef]
- Khodadadi, F.; González, J.B.; Martin, P.L.; Giroux, E.; Bilodeau, G.J.; Peter, K.A.; Doyle, V.P.; Aćimović, S.G. Identification and Characterization of Colletotrichum Species Causing Apple Bitter Rot in New York and Description of C. noveboracense sp. nov. Sci. Rep. 2020, 10, 11043. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.-W.; Manawasinghe, I.; Liao, X.-N.; Mao, J.; Dong, Z.; Jayawardena, R.; Wanasinghe, D.; Shu, Y.-X.; Luo, M. Endophytic Colletotrichum (Sordariomycetes, Glomerellaceae) Species Associated with Citrus grandis cv. “Tomentosa” in China. MycoKeys 2023, 95, 163–188. [Google Scholar] [CrossRef]
- Guevara-Suarez, M.; Cárdenas, M.; Jiménez, P.; Afanador-Kafuri, L.; Restrepo, S. Colletotrichum Species Complexes Associated with Crops in Northern South America: A Review. Agronomy 2022, 12, 548. [Google Scholar] [CrossRef]
- Damm, U.; Cannon, P.F.; Woudenberg, J.H.C.; Johnston, P.R.; Weir, B.S.; Tan, Y.P.; Shivas, R.G.; Crous, P.W. The Colletotrichum boninense Species Complex. Stud. Mycol. 2012, 73, 1–36. [Google Scholar] [CrossRef] [Green Version]
- dos Santos Vieira, W.A.; Bezerra, P.A.; da Silva, A.C.; Veloso, J.S.; Câmara, M.P.S.; Doyle, V.P. Optimal Markers for the Identification of Colletotrichum Species. Mol. Phylogenet. Evol. 2020, 143, 106694. [Google Scholar] [CrossRef] [PubMed]
- de Silva, D.; Talhinhas, P.; Várzea, V.; Cai, L.; Paulo, O.; Batista, D. Application of the Apn2/MAT Locus to Improve the Systematics of the Colletotrichum gloeosporioides Complex: An Example from Coffee (Coffea spp.) Hosts. Mycologia 2012, 104, 396–409. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Manova, V.; Stoyanova, Z.; Rodeva, R.; Boycheva, I.; Korpelainen, H.; Vesterinen, E.; Wirta, H.; Bonchev, G. Morphological, Pathological and Genetic Diversity of the Colletotrichum Species, Pathogenic on Solanaceous Vegetable Crops in Bulgaria. J. Fungi 2022, 8, 1123. [Google Scholar] [CrossRef]
- Al-Faifi, Z.; Alsolami, W.; Abada, E.; Khemira, H.; Almalki, G.; Modafer, Y. Fusarium oxysporum and Colletotrichum musae Associated with Wilt Disease of Coffea arabica in Coffee Gardens in Saudi Arabia. Can. J. Infect. Dis. Med. Microbiol. 2022, 2022, 3050495. [Google Scholar] [CrossRef]
- Agostini, J.P.; Timmer, L.W. Selective Isolation Procedures for Differentiation of Two Strains of Colletotrichum gloeosporioides from Citrus. Plant Dis. 1992, 76, 1176–1178. [Google Scholar] [CrossRef]
- Senanayake, I.C.; Rathnayaka, A.R.; Marasinghe, D.S.; Calabon, M.S.; Gentekaki, E.; Lee, H.B.; Hurdeal, V.G.; Pem, D.; Dissanayake, L.S.; Wijesinghe, S.N. Morphological Approaches in Studying Fungi: Collection, Examination, Isolation, Sporulation and Preservation. Mycosphere 2020, 11, 2678–2754. [Google Scholar] [CrossRef]
- Dellaporta, S.L.; Wood, J.; Hicks, J.B. A Plant DNA Minipreparation: Version II. Plant Mol. Biol. Report. 1983, 1, 19–21. [Google Scholar] [CrossRef]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics. PCR Protoc. A Guid. Methods Appl. 1990, 18, 315–322. [Google Scholar]
- Carbone, I.; Kohn, L.M. A Method for Designing Primer Sets for Speciation Studies in Filamentous Ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef]
- O’Donnell, K.; Cigelnik, E. Two Divergent Intragenomic RDNA ITS2 Types within a Monophyletic Lineage of the Fungus Fusarium are Non-orthologous. Mol. Phylogenet. Evol. 1997, 7, 103–116. [Google Scholar] [CrossRef]
- Glass, N.L.; Donaldson, G.C. Development of Primer Sets Designed for Use with the PCR to Amplify Conserved Genes from Filamentous Ascomycetes. Appl. Environ. Microbiol. 1995, 61, 1323–1330. [Google Scholar] [CrossRef] [Green Version]
- Templeton, M.D.; Rikkerink, E.H.A.; Solon, S.L.; Crowhurst, R.N. Cloning and Molecular Characterization of the Glyceraldehyde-3-Phosphate Dehydrogenase-Encoding Gene and CDNA from the Plant Pathogenic Fungus Glomerella cingulata. Gene 1992, 122, 225–230. [Google Scholar] [CrossRef]
- Qiao, Y.-H.; Zhang, C.-N.; Li, M.; Li, H.; Mao, Y.-F.; Chen, F.-M. Species of the Colletotrichum spp., the Causal Agents of Leaf Spot on European Hornbeam (Carpinus betulus). J. Fungi 2023, 9, 489. [Google Scholar] [CrossRef]
- Liu, F.; Weir, B.S.; Damm, U.; Crous, P.W.; Wang, Y.; Liu, B.; Wang, M.; Zhang, M.; Cai, L. Unravelling Colletotrichum Species Associated with Camellia: Employing ApMat and GS Loci to Resolve Species in the C. gloeosporioides Complex. Pers. Mol. Phylogeny Evol. Fungi 2015, 35, 63–86. [Google Scholar] [CrossRef] [Green Version]
- Liu, F.; Ma, Z.Y.; Hou, L.W.; Diao, Y.Z.; Wu, W.P.; Damm, U.; Song, S.; Cai, L. Updating Species Diversity of Colletotrichum, with a Phylogenomic Overview. Stud. Mycol. 2022, 101, 1–56. [Google Scholar] [CrossRef]
- Minh, B.Q.; Schmidt, H.A.; Chernomor, O.; Schrempf, D.; Woodhams, M.D.; Von Haeseler, A.; Lanfear, R. IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Mol. Biol. Evol. 2020, 37, 1530–1534. [Google Scholar] [CrossRef] [Green Version]
- Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; Von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast Model Selection for Accurate Phylogenetic Estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hoang, D.T.; Chernomor, O.; Von Haeseler, A.; Minh, B.Q.; Vinh, L.S. UFBoot2: Improving the Ultrafast Bootstrap Approximation. Mol. Biol. Evol. 2018, 35, 518–522. [Google Scholar] [CrossRef] [PubMed]
- Chernomor, O.; Von Haeseler, A.; Minh, B.Q. Terrace Aware Data Structure for Phylogenomic Inference from Supermatrices. Syst. Biol. 2016, 65, 997–1008. [Google Scholar] [CrossRef] [Green Version]
- Crous, P.W.; Gams, W.; Stalpers, J.A.; Robert, V.; Stegehuis, G. MycoBank: An Online Initiative to Launch Mycology into the 21st Century. Stud. Mycol. 2004, 50, 19–22. [Google Scholar]
- Snedecor, G.W.; Cochran, W.G. Statistical Methods, 7th ed.; Iowa State University Press: Ames, IA, USA, 1980. [Google Scholar]
- Batista, D.; Silva, D.N.; Vieira, A.; Cabral, A.; Pires, A.S.; Loureiro, A.; Guerra-Guimaraes, L.; Pereira, A.P.; Azinheira, H.; Talhinhas, P. Legitimacy and Implications of Reducing Colletotrichum kahawae to Subspecies in Plant Pathology. Front. Plant Sci. 2017, 7, 2051. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hu, M.-J.; Grabke, A.; Schnabel, G. Investigation of the Colletotrichum gloeosporioides Species Complex Causing Peach Anthracnose in South Carolina. Plant Dis. 2015, 99, 797–805. [Google Scholar] [CrossRef] [Green Version]
- Crouch, J.A.; Clarke, B.; Hillman, B. What Is the Value of ITS Sequence Data in Colletotrichum Systematics and Species Diagnosis? A Case Study Using the Falcate-Spored Graminicolous Colletotrichum Group. Mycologia 2009, 101, 648–656. [Google Scholar] [CrossRef]
- Sharma, G.; Kumar, N.; Weir, B.S.; Hyde, K.D.; Shenoy, B.D. The ApMat Marker Can Resolve Colletotrichum Species: A Case Study with Mangifera indica. Fungal Divers. 2013, 61, 117–138. [Google Scholar] [CrossRef]
- Sharma, G.; Pinnaka, A.K.; Shenoy, B.D. Resolving the Colletotrichum siamense Species Complex Using ApMat Marker. Fungal Divers. 2014, 71, 247–264. [Google Scholar] [CrossRef]
- Vieira, W.A.S.; Michereff, S.J.; de Morais, M.A.; Hyde, K.D.; Câmara, M.P.S. Endophytic Species of Colletotrichum Associated with Mango in Northeastern Brazil. Fungal Divers. 2014, 67, 181–202. [Google Scholar] [CrossRef]
- Wu, J.; Hu, S.; Ye, B.; Hu, X.; Xiao, W.; Yu, H.; Chuanqing, Z. Diversity and Resistance to Thiophanate-Methyl of Colletotrichum spp. in Strawberry Nursery and the Development of Rapid Detection Using LAMP Method. Agronomy 2022, 12, 2815. [Google Scholar] [CrossRef]
- Ismail, A.M.; Cirvilleri, G.; Yaseen, T.; Epifani, F.; Perrone, G.; Polizzi, G. Characterization of Colletotrichum Species Causing Anthracnose Disease of Mango in Italy. J. Plant Pathol. 2015, 97, 167–171. [Google Scholar] [CrossRef]
- Nguyen, T.H.P.; Säll, T.; Bryngelsson, T.; Liljeroth, E. Variation among Colletotrichum gloeosporioides Isolates from Infected Coffee Berries at Different Locations in Vietnam. Plant Pathol. 2009, 58, 898–909. [Google Scholar] [CrossRef]
- Kenny, M.; Galea, V.; Price, T. Germination and Growth of Colletotrichum acutatum and Colletotrichum gloeosporioides Isolates from Coffee in Papua New Guinea and Their Pathogenicity to Coffee Berries. Australas. Plant Pathol. 2012, 41, 519–528. [Google Scholar] [CrossRef]
Figure 1.
Anthracnose symptoms detected in the surveyed coffee plantations. Small lesions with irregular margins merging to develop large necrotic black patches starting from the leaf margins and moving to the middle of the leaf blade (A); close focus on the necrotic area showing the semi-immersed acervuli (B); dark necrotic patches result in the death of both the lateral and apical shoots (C); dark to brown sunken and depressed lesion on the green and red fruit berries (D–F).
Figure 1.
Anthracnose symptoms detected in the surveyed coffee plantations. Small lesions with irregular margins merging to develop large necrotic black patches starting from the leaf margins and moving to the middle of the leaf blade (A); close focus on the necrotic area showing the semi-immersed acervuli (B); dark necrotic patches result in the death of both the lateral and apical shoots (C); dark to brown sunken and depressed lesion on the green and red fruit berries (D–F).
Figure 2.
Maximum likelihood tree obtained through heuristic searches of the six-loci ITS, ACT, CHS-1, TUB2, GAPDH, and ApMat of the C. gloeosporioides complex. Values of Bayesian posterior probability (BPP) and support values of Bootstrap (BS) (1000 replicates) are provided at the nodes. Branches that are unsupported with BS or BPP are denoted by –. Colletotrichum truncatum CBS 151.35 is treated as an outgroup. The sequences obtained in the current study are indicated in black boldface. The novel species are indicated in blue.
Figure 2.
Maximum likelihood tree obtained through heuristic searches of the six-loci ITS, ACT, CHS-1, TUB2, GAPDH, and ApMat of the C. gloeosporioides complex. Values of Bayesian posterior probability (BPP) and support values of Bootstrap (BS) (1000 replicates) are provided at the nodes. Branches that are unsupported with BS or BPP are denoted by –. Colletotrichum truncatum CBS 151.35 is treated as an outgroup. The sequences obtained in the current study are indicated in black boldface. The novel species are indicated in blue.
Figure 3.
Maximum likelihood tree obtained through heuristic searches of the four loci ITS, ACT, CHS-1, and TUB2 sequences of the C. boninense complex. Values of Bayesian posterior probability (BPP) and support values of Bootstrap (BS) (1000 replicates) are provided at the nodes. Branches that are unsupported with BPP or BS are denoted with –. Colletotrichum truncatum CBS 151.35 is treated as an outgroup. The sequences obtained in the current study are indicated in black boldface.
Figure 3.
Maximum likelihood tree obtained through heuristic searches of the four loci ITS, ACT, CHS-1, and TUB2 sequences of the C. boninense complex. Values of Bayesian posterior probability (BPP) and support values of Bootstrap (BS) (1000 replicates) are provided at the nodes. Branches that are unsupported with BPP or BS are denoted with –. Colletotrichum truncatum CBS 151.35 is treated as an outgroup. The sequences obtained in the current study are indicated in black boldface.
Figure 4.
Colletotrichum saudianum (from ex-holotype strain PPDU38H). Colony morphology (A); pinkish orange masses of conidia releases from acervuli (B); hyaline conidiophores (C–E); appressoria (F–I); hyaline conidia (J). - Scale bars; (C–J) = 10 µm.
Figure 4.
Colletotrichum saudianum (from ex-holotype strain PPDU38H). Colony morphology (A); pinkish orange masses of conidia releases from acervuli (B); hyaline conidiophores (C–E); appressoria (F–I); hyaline conidia (J). - Scale bars; (C–J) = 10 µm.
Figure 5.
Colletotrichum coffeae-arabicae (from ex-holotype strain PPDU26B). Colony morphology (A); orange masses of conidia releases from acervuli (B); seta (C); hyaline conidiophores (D,E); appressoria (F–I); hyaline conidia with guttules (J). - Scale bars; (C–J) = 10 µm.
Figure 5.
Colletotrichum coffeae-arabicae (from ex-holotype strain PPDU26B). Colony morphology (A); orange masses of conidia releases from acervuli (B); seta (C); hyaline conidiophores (D,E); appressoria (F–I); hyaline conidia with guttules (J). - Scale bars; (C–J) = 10 µm.
Figure 6.
Lesions diameters (y-axis) released from 12 Colletotrichum isolates (x-axis) inoculated on detached coffee leaves (A), red and green fruit (B) after 10 days of incubation at 25 °C. Each isolate’s values represent the mean of six replicates ± (SD). Means designated with similar letters in these columns did not vary significantly according to the LSD test (p < 0.05).
Figure 6.
Lesions diameters (y-axis) released from 12 Colletotrichum isolates (x-axis) inoculated on detached coffee leaves (A), red and green fruit (B) after 10 days of incubation at 25 °C. Each isolate’s values represent the mean of six replicates ± (SD). Means designated with similar letters in these columns did not vary significantly according to the LSD test (p < 0.05).
Figure 7.
Symptoms reproduced by tested Colletotrichum species on detached coffee leaves (A–D); necrotic lesions developed on red and green fruits after 8 days of incubation at 25 °C (E,F); small lesions developed by the C. krastii PPDU41K showing the weakness of the fungus to reproduce the symptoms observed in the field (C,G); orange masses of conidia released from semi-immersed acervuli (arrows) observed on the necrotic tissues of leaves and red fruit produced by the virulent isolate of C. saudianum PPDU38H (D,F).
Figure 7.
Symptoms reproduced by tested Colletotrichum species on detached coffee leaves (A–D); necrotic lesions developed on red and green fruits after 8 days of incubation at 25 °C (E,F); small lesions developed by the C. krastii PPDU41K showing the weakness of the fungus to reproduce the symptoms observed in the field (C,G); orange masses of conidia released from semi-immersed acervuli (arrows) observed on the necrotic tissues of leaves and red fruit produced by the virulent isolate of C. saudianum PPDU38H (D,F).
Table 1.
Geographical sites of surveyed coffee plantations in four regions in the southwest of Saudi Arabia.
Table 1.
Geographical sites of surveyed coffee plantations in four regions in the southwest of Saudi Arabia.
| District | No. of Farms | Longitude (E) | Latitude (N) | Altitude (m) |
|---|---|---|---|---|
| Jazan | 1 | 43°8′19.9″ | 17°22′14.3″ | 785 |
| 2 | 43°8′20.4″ | 17°22′22.8″ | 803 | |
| 3 | 43°8′20.4″ | 17°22′27.9″ | 812 | |
| 4 | 43°8′19.9″ | 17°22′14.3″ | 1043 | |
| 5 | 43°8′34.9″ | 17°17′13.5″ | 861 | |
| Asir | 6 | 42°24′39″ | 18°9′41″ | 1880 |
| 7 | 42°22′10″ | 18°11′43″ | 1360 | |
| 8 | 42°23′3″ | 18°11′32″ | 1500 | |
| 9 | 42°38′3″ | 18°13′17″ | 2120 | |
| 10 | 40°18′45″ | 18°11′21″ | 1396 | |
| 11 | 42°19′8″ | 18°12′45″ | 1510 | |
| 12 | 42°6′4″ | 18°49′38″ | 1660 | |
| 13 | 42°5′57″ | 18°49′32″ | 1580 | |
| 14 | 42°4′17″ | 19°9′30″ | 1320 | |
| 15 | 43°10′47″ | 17°40′46″ | 1200 | |
| 16 | 43°10′50″ | 17°40′50″ | 1210 | |
| Najran | 17 | 44°10′20″ | 17°29′5″ | 1290 |
| 18 | 44°3′36″ | 17°26′30″ | 1340 | |
| Al Baha | 19 | 41°25′55.1″ | 19°47′27.5″ | 1100 |
| 20 | 41°21′35″ | 19°45′1.3″ | 1084 | |
| 21 | 41°22′36.1″ | 19°43′35.3″ | 1258 | |
| 22 | 41°21′16.5″ | 19°45′36″ | 1204 | |
| 23 | 41°26′25.7″ | 20°2′9.8″ | 2187 |
Table 2.
A list of primers utilized in the current study for PCR amplification and sequencing.
| Locus | Product Name | Primer | Sequence (5′–3′) | Reference |
|---|---|---|---|---|
| ITS | Internal transcribed spacer | ITS-1F | CTT GGT CAT TTA GAG GAA GTA A | [35] |
| ITS-4R | TCC TCC GCT TAT TGA TAT GC | |||
| ACT | Actin | ACT-512F | ATG TGC AAG GCC GGT TTC GC | [36] |
| ACT-783R | TAC GAG TCC TTC TGG CCC AT | |||
| CHS-1 | Chitin synthase | CHS-79F | TGG GGC AAG GAT GCT TGG AAG AAG | [36] |
| CHS-345R | TGG AAG AAC CAT CTG TGA GAG TTG | |||
| GAPDH | Glyceraldehyde-3-phosphate dehydrogenase | GDF | GCC GTC AAC GAC CCC TTC ATT GA | [39] |
| GDR | GGG TGG AGT CGT ACT TGA GCA TGT | |||
| TUB2 | β-Tubulin 2 | T1F | AAC ATG CGT GAG ATT GTA AGT | [37] |
| Bt2bR | ACC CTC AGT GTA GTG ACC CTT GGC | [38] | ||
| ApMat | Mat1–2 | AMF1 | TCATTCTACGTATGTGCCCG | [29] |
| AMR1 | CCAGAAATACACCGAACTTGC |
Table 3.
A list of sequences of C. gloeosporioides and C. boninense species complexes retrieved from the GenBank and the obtained sequences in this study.
Table 3.
A list of sequences of C. gloeosporioides and C. boninense species complexes retrieved from the GenBank and the obtained sequences in this study.
| Species Identity | Culture No. | Host | Country | GenBank Accession Numbers | |||||
|---|---|---|---|---|---|---|---|---|---|
| ITS | ACT | TUB2 | CHS-1 | GAPDH | ApMat | ||||
| C. aenigma | ICMP 18608 * | Persea americana | Israel | JX010244 | JX009443 | JX010389 | JX009774 | JX010044 | KM360143 |
| C. aeschynomenes | ICMP 17673; ATCC 201874 * | Aeschynomene virginica | USA | JX010176 | JX009483 | JX010392 | JX009799 | JX009930 | KM360145 |
| C. aeschynomenes | PPDU28A | Coffea arabica | Saudi Arabia | OR048775 | OR050686 | OR050783 | OR050738 | OR050756 | OR050711 |
| C. alatae | ICMP 17919 * | Dioscorea alata | India | JX010190 | JX009471 | JX010383 | JX009837 | JX009990 | KC888932 |
| C. alienum | ICMP 12071 * | Malus domestica | New Zealand | JX010251 | JX009572 | JX010411 | JX009882 | JX010028 | KM360144 |
| C. analogum | YMF 1.06943 | Unknown | China | OK030860 | OK513599 | OK513629 | OK513559 | OK513663 | - |
| C. annellatum | CBS 129826 * | Hevea brasiliensis | Colombia | JQ005222 | JQ005570 | JQ005656 | JQ005396 | - | - |
| C. aotearoa | ICMP 18537 * | Coprosma sp. | New Zealand | JX010205 | JX009564 | JX010420 | JX009853 | JX010005 | KC888930 |
| C. arecicola | CGMCC 3.19667 | Areca catechu | China | MK914635 | MK935374 | MK935498 | MK935541 | MK935455 | MK935413 |
| C. artocarpicola | MFLUCC 18–1167 * | Artocarpus heterophyllus | Thailand | MN415991 | MN435570 | MN435567 | MN435569 | MN435568 | - |
| C. asianum | ICMP 18580; CBS 130418 * | Coffea arabica | Thailand | FJ972612 | JX009584 | JX010406 | JX009867 | JX010053 | FR718814 |
| C. australianum | VPRI 43074; UMC001 | Citrus reticulata | Australia | MG572137 | MK473452 | MG572148 | MW091986 | MG572126 | MG572170 |
| C. australianum | VPRI 43075; UMC002 * | Citrus sinensis | Australia | MG572138 | MN442109 | MG572149 | MW091987 | MG572127 | MG572171 |
| C. beeveri | CBS 128527 * | Brachyglottis repanda | New Zealand | JQ005171 | JQ005519 | JQ005605 | JQ005345 | - | - |
| C. boninense | ICMP 17904; CBS 123755 * | Crinum asiaticum var. sinicum | Japan | JQ005153 | JQ005501 | JQ005588 | JQ005327 | - | - |
| C. brasiliense | CBS 128501 * | Passiflora edulis | Brazil | JQ005235 | JQ005583 | JQ005669 | JQ005409 | - | - |
| C. brassicicola | CBS 101059 | Brassica oleracea var. gemmifera | New Zealand | JQ005172 | JQ005520 | JQ005606 | JQ005346 | - | - |
| C. bromeliacearum | LC0951 | Bromeliad | China | MZ595832 | MZ664130 | MZ673956 | MZ799267 | - | - |
| C. camelliae | ICMP 10643 * | Camellia williamsii | United Kingdom | JX010224 | JX009540 | JX010436 | JX009891 | JX009908 | KJ954625 |
| C. camelliae-japonicae | CGMCC 3.18118 *, LC6416 | Camellia japonica | China | KX853165 | KX893576 | KX893580 | MZ799271 | - | - |
| C. cangyuanense | YMF1.05001 | Unknown | China | OK030864 | OK513603 | OK513633 | OK513563 | OK513667 | |
| C. catinaense | CBS 142417; CPC 27978 * | Citrus reticulata | Italy | KY856400 | KY855971 | KY856482 | KY856136 | - | - |
| C. chamaedoreae | LC13868, NN052885 | Chamaedorea erumpens | China | MZ595890 | MZ664188 | MZ674008 | MZ799274 | - | - |
| C. changpingense | MFLUCC 15-0022 | Fragaria ananassa | China | KP683152 | KP683093 | KP852490 | KP852449 | KP852469 | - |
| C. chongqingense | CS0612 | Camellia sinensis | China | MG602060 | MT976107 | MG602044 | MT976117 | - | - |
| C. chrysophilum | CMM4268 *, CMM 4352 | Musa sp. | Brazil | KX094252 | KX093982 | KX094285 | KX094083 | KX094183 | KX094326 |
| C. cigarro | ICMP 18534 | Kunzea ericoides | New Zealand | JX010227 | JX009473 | JX010427 | JX009765 | JX009904 | HE655657 |
| C. citricola | CBS 134228 * | Citrus unchiu | China | KC293576 | KC293616 | KC293656 | KY856140 | - | - |
| C. clidemiae | ICMP 18658 * | Clidemia hirta | USA | JX010265 | JX009537 | JX010438 | JX009877 | JX009989 | KC888929 |
| C. cobbittiense | BRIP 66219 | Cordyline fruticosa | Australia | MH087016 | MH094134 | MH094137 | MH094135 | MH094133 | - |
| C. coffeae-arabicae | PPDU26B | Coffea arabica | Saudi Arabia | OR048779 | OR050690 | OR050787 | OR050742 | OR050760 | OR050715 |
| C. coffeae-arabicae | PPDU27D | Coffea arabica | Saudi Arabia | OR048777 | OR050688 | OR050785 | OR050740 | OR050758 | OR050713 |
| C. coffeae-arabicae | PPDU29F | Coffea arabica | Saudi Arabia | OR048768 | OR050679 | OR050776 | OR050731 | OR050749 | OR050704 |
| C. coffeae-arabicae | PPDU32A | Coffea arabica | Saudi Arabia | OR048764 | OR050675 | OR050772 | OR050727 | OR050745 | OR050700 |
| C. colombiense | CBS 129818 * | unknown | Colombia | JQ005174 | JQ005522 | JQ005608 | JQ005348 | - | - |
| C. condaoense | CBS 134299 | Ipomoea pescaprae | Vietnam | MH229914 | - | MH229923 | MH229926 | - | - |
| C. conoides | CAUG17; MYL24 | Actinidia deliciosa | China | KY995389 | KY995510 | KY995473 | KY995436 | KY995340 | MG198007 |
| C. constrictum | CBS 128504 | Citrus limon | New Zealand | JQ005238 | JQ005586 | JQ005672 | JQ005412 | - | - |
| C. cordylinicola | MFLUCC 090551; ICMP 18579 * | Cordyline fruticosa | Thailand | JX010226 | HM470235 | JX010440 | JX009864 | JX009975 | JQ899274 |
| C. cymbidiicola | IMI 347923 * | Cymbidium sp. | Australia | JQ005166 | JQ005514 | JQ005600 | JQ005340 | - | - |
| C. dacrycarpi | CBS 130241 * | Unknown | New Zealand | JQ005236 | JQ005584 | JQ005670 | JQ005410 | - | - |
| C. dimorphum | YMF1.07309 | Unknown | China | OK030867 | OK513606 | OK513636 | OK513566 | OK513670 | - |
| C. diversum | LC11292, CQ775 | Philodendron selloum | China | MZ595844 | MZ664142 | MZ673965 | MZ799272 | - | - |
| C. doitungense | MFLUCC 14-0128 | Dendrobium sp. | Thailand | MF448524 | MH376385 | MH351277 | - | - | - |
| C. dracaenigenum | MFLUCC 19-0430 | Dracaena sp. | Thailand | MN921250 | MT313686 | - | MT215575 | MT215577 | - |
| C. endophyticum | CAUG28; YTJB1 | Capsicum sp. | China | KP145441 | KP145329 | KP145469 | KP145385 | KP145413 | MH305548 |
| C. feijoicola | CBS 144633, CPC 34245 | Acca sellowiana | Portugal | MK876413 | MK876466 | MK876507 | MK876471 | - | - |
| C. fructicola | ICMP 18581; CBS 130416 * | Coffea arabica | Thailand | JX010165 | FJ907426 | JX010405 | JX009866 | JX010033 | JQ807838 |
| C. fructicola | VPRI 43079; UMC006 | Citrus reticulata | Australia | MG572142 | MK473454 | MG572153 | MW091991 | MG572131 | MG572175 |
| C. fructivorum | CBS 133125 * | Vaccinium macrocarpon | USA | JX145145 | MZ664126 | JX145196 | MZ799259 | MZ664047 | JX145300 |
| C. gloeosporioides | IMI 356878; ICMP 17821; CBS 112999 * | Citrus sinensis | Italy | JX010152 | JX009531 | JX010445 | JX009818 | JX010056 | JQ807843 |
| C. gloeosporioides | VPRI 43076; UMC003 | Citrus sinensis | Australia | MG572139 | MN442110 | MG572150 | MW091988 | MG572128 | MG572172 |
| C. gloeosporioides | VPRI 10312; A01-10312 | Citrus sinensis | Australia | MK469996 | MK470086 | MK470050 | MW091972 | MK470014 | MK470068 |
| C. gracile | YMF1.06939 | Unknown | China | OK030868 | OK513607 | OK513637 | OK513567 | OK513671 | - |
| C. grevilleae | CBS 132879 * | Grevillea sp. | Italy | KC297078 | KC296941 | KC297102 | KC296987 | KC297010 | - |
| C. grossum | CGMCC3.17614T; CAUG7; INIFAT 4145 | Capsicum sp. | China | KP890165 | KP890141 | KP890171 | KP890153 | KP890159 | MG826119 |
| C. hebeiense | MFLUCC13-0726 * | Vitis vinifera | China | KF156863 | KF377532 | KF288975 | KF289008 | KF377495 | KF377562 |
| C. hederiicola | MFLU 15-0689 | Hedera helix | Italy | MN631384 | MN635795 | MN635794 | ON971378 | - | |
| C. helleniense | CPC 26844; CBS 142418; CBS 142419 | Poncirus trifoliata | Greece | KY856446 | KY856019 | KY856528 | KY856186 | KY856270 | MW368907 |
| C. henanense | LC3030; CGMCC 3.17354; LF238 * | Camellia sinensis | China | KJ955109 | KM023257 | KJ955257 | MZ799256 | KJ954810 | KJ954524 |
| C. hippeastri | CBS 125376 * | Hippeastrum vittatum | China | JQ005231 | JQ005579 | JQ005665 | JQ005405 | - | - |
| C. hippeastri | CBS 241.78 | Hippeastrum vittatum | China | JX010293 | JX009485 | JQ005666 | JX009838 | - | - |
| C. horii | ICMP 10492 * | Diospyros kaki | Japan | GQ329690 | JX009438 | JX010450 | JX009752 | GQ329681 | JQ807840 |
| C. hystricis | CPC 28153; CBS 142411 * | Citrus hystrix | Italy | KY856450 | KY856023 | KY856532 | KY856190 | KY856274 | - |
| C. jiangxiense | LF687 *, CGMCC 3.17361 | Camellia sinensis | China | KJ955201 | KJ954471 | KJ955348 | MZ799257 | KJ954902 | KJ954607 |
| C. kahawae | IMI 319418; ICMP 17816 * | Coffea arabica | Kenya | JX010231 | JX009452 | JX010444 | JX009813 | JX010012 | JQ894579 |
| C. karstii | CBS 126532 | Citrus sp. | South Africa | JQ005209 | JQ005557 | JQ005643 | JQ005383 | - | - |
| C. karstii | CBS 129833 | Musa sp. | Mexico | JQ005175 | JQ005523 | JQ005609 | JQ005349 | - | - |
| C. karstii | VPRI 43652; UMC016 | Citrus sinensis | Australia | MW081179 | MW081187 | MW081183 | MW081191 | - | - |
| C. karstii | PPDU41K | Coffea arabica | Saudi Arabia | OR048754 | OR050665 | OR050762 | OR050717 | - | - |
| C. limonicola | CBS 142410; CPC 31141 * | Citrus limon | Malta | KY856472 | KY856045 | KY856554 | KY856213 | - | - |
| C. makassarense | CBS 143664, CPC 28612, CPC 28556 | Capsicum annuum | Indonesia | MH728812 | MH781477 | MH846560 | MH805847 | MH728821 | MH728831 |
| C. musae | ICMP 19119; CBS 116870 * | Musa sp. | USA | JX010146 | JX009433 | HQ596280 | JX009896 | JX010050 | KC888926 |
| C. nanhuaense | YMF1.04993 | Unknown | China | OK030870 | OK513609 | OK513639 | OK513569 | OK513673 | - |
| C. novae-zelandiae | CBS 128505 * | Capsicum annuum | New Zealand | JQ005228 | JQ005576 | JQ005662 | JQ005402 | - | - |
| C. noveboracense | AFKH109 | Malus domestica | USA | MN646685 | MN640565 | MN640569 | MN640567 | MN640564 | |
| C. nullisetosum | YMF1.06946 | Unknown | China | OK030872 | OK513611 | OK513641 | OK513571 | OK513675 | |
| C. nupharicola | ICMP 18187 * | Nuphar polysepala | USA | JX010187 | JX009437 | JX010398 | JX009835 | JX009972 | JX145319 |
| C. oblongisporum | YMF1.06938 | Unknown | China | OK030874 | OK513643 | OK513573 | OK513677 | - | |
| C. oncidii | CBS 129828 * | Oncidium sp. | Germany | JQ005169 | JQ005517 | JQ005603 | JQ005343 | - | - |
| C. pandanicola | MFLUCC 17-0571 | Pandanaceae | Thailand | MG646967 | MG646938 | MG646926 | MG646931 | MG646934 | - |
| C. pandanicola | SAUCC200204 | Unknown | China | MW786641 | MW883694 | MW888969 | MW883685 | MW846239 | - |
| C. pandanicola | SAUCC201152 | Unknown | China | MW786746 | MW883702 | MW888977 | MW883693 | MW876478 | - |
| C. parsonsiae | CBS 128525 * | Parsonsia capsularis | New Zealand | JQ005233 | JQ005581 | JQ005667 | JQ005407 | - | - |
| C. parvisporum | YMF1.06942 | Unknown | China | OK030876 | OK513613 | OK513645 | OK513575 | OK513679 | - |
| C. perseae | CBS 141365 *, GA100, GA 170 | Persea americana | Israel | KX620308 | KX620145 | KX620341 | MZ799260 | KX620242 | KX620180 |
| C. petchii | CBS 378.94 * | Dracaena marginata | Italy | JQ005223 | JQ005571 | JQ005657 | JQ005397 | - | - |
| C. phyllanthi | CBS 175.67 * | Phyllanthus acidus | India | JQ005221 | JQ005569 | JQ005655 | JQ005395 | - | - |
| C. phyllanthi | PPDU36S | Coffea arabica | Saudi Arabia | OR048762 | OR050673 | OR050770 | OR050725 | - | - |
| C. proteae | CBS 132882 * | Protea sp. | South Africa | KC297079 | KC296940 | KC297101 | KC296986 | KC297009 | - |
| C. pseudotheobromicola | MFLUCC 18–1602 | Prunus avium | China | MH817395 | MH853681 | MH853684 | MH853678 | MH853675 | - |
| C. psidii | ICMP 19120 * | Psidium sp. | Italy | JX010219 | JX009515 | JX010443 | JX009901 | JX009967 | KC888931 |
| C. queenslandicum | ICMP 1778 * | Carica papaya | Australia | JX010276 | JX009447 | JX010414 | JX009899 | JX009934 | KC888928 |
| C. rhexiae | Coll1026, CBS 133134 * | Rhexia virginica | USA | JX145128 | MZ664127 | JX145179 | MZ799258 | MZ664046 | JX145290 |
| C. salsolae | ICMP 19051 * | Salsola tragus | Hungary | JX010242 | JX009562 | JX010403 | JX009863 | JX009916 | KC888925 |
| C. saudianum | PPDU28C | Coffea arabica | Saudi Arabia | OR048774 | OR050685 | OR050782 | OR050737 | OR050755 | OR050710 |
| C. saudianum | PPDU28E | Coffea arabica | Saudi Arabia | OR048773 | OR050684 | OR050781 | OR050736 | OR050754 | OR050709 |
| C. saudianum | PPDU28J | Coffea arabica | Saudi Arabia | OR048772 | OR050683 | OR050780 | OR050735 | OR050753 | OR050708 |
| C. saudianum | PPDU28L | Coffea arabica | Saudi Arabia | OR048771 | OR050682 | OR050779 | OR050734 | OR050752 | OR050707 |
| C. saudianum | PPDU29A | Coffea arabica | Saudi Arabia | OR048770 | OR050681 | OR050778 | OR050733 | OR050751 | OR050706 |
| C. saudianum | PPDU29B | Coffea arabica | Saudi Arabia | OR048769 | OR050680 | OR050777 | OR050732 | OR050750 | OR050705 |
| C. saudianum | PPDU31I | Coffea arabica | Saudi Arabia | OR048766 | OR050677 | OR050774 | OR050729 | OR050747 | OR050702 |
| C. saudianum | PPDU31M | Coffea arabica | Saudi Arabia | OR048765 | OR050676 | OR050773 | OR050728 | OR050746 | OR050701 |
| C. saudianum | PPDU38B | Coffea arabica | Saudi Arabia | OR048761 | OR050672 | OR050769 | OR050724 | - | OR050698 |
| C. saudianum | PPDU38F | Coffea arabica | Saudi Arabia | OR048760 | OR050671 | OR050768 | OR050723 | - | OR050697 |
| C. saudianum | PPDU38H* | Coffea arabica | Saudi Arabia | OR048759 | OR050670 | OR050767 | OR050722 | - | OR050696 |
| C. saudianum | PPDU38I | Coffea arabica | Saudi Arabia | OR048758 | OR050669 | OR050766 | OR050721 | - | OR050695 |
| C. siamense | VPRI 43077; UMC004 | Citrus limon | Australia | MG572140 | MK473453 | MG572151 | MW091989 | MG572129 | MG572173 |
| C. siamense | CPC 30209, UOM 13 | Capsicum annuum | Indonesia | MH707471 | MH781464 | MH846547 | MH805834 | MH707452 | MH713897 |
| C. siamense | CPC 30210, UOM14 | Capsicum annuum | Indonesia | MH707472 | MH781465 | MH846548 | MH805835 | MH707453 | MH713896 |
| C. siamense | CPC 30212, UOM16 | Capsicum annuum | Indonesia | MH707474 | MH781467 | MH846550 | MH805837 | MH707455 | MH713894 |
| C. siamense | CPC 30221, UOM25 | Capsicum annuum | Thailand | MH707475 | MH781468 | MH846551 | MH805838 | MH707456 | MH713893 |
| C. siamense | CPC 30222, UOM26 | Capsicum annuum | Thailand | MH707476 | MH781469 | MH846552 | MH805839 | MH707457 | MH713892 |
| C. siamense | CPC 30223, UOM27 | Capsicum annuum | Indonesia | MH707477 | MH781470 | MH846553 | MH805840 | MH707458 | MH713891 |
| C. siamense | ICMP 18578 CBS 130417 * | Coffea arabica | Thailand | JX010171 | FJ907423 | JX010404 | JX009865 | JX009924 | JQ899289 |
| C. siamense | BRIP 54270b; VPRI 43029; A10-43029 | Citrus australasica | Australia | MK469995 | MK470085 | MK470049 | MW091971 | MK470013 | MK470067 |
| C. siamense syn. C. endomangiferae | CMM 3814a | Mangifera indica | Brazil | KC702994 | KC702922 | KM404170 | KC598113 | KC702955 | KJ155453 |
| C. siamense syn. C. hymenocallidis | CBS 125378, ICMP 18642, LC0043a | Hymenocallis americana | China | JX010278 | JX009441 | JX010410 | GQ856730 | JX010019 | JQ899283 |
| C. siamense syn. C. hymenocallidis | CBS 112983, CPC 2291 | Protea cynaroides | Zimbabwe | KC297065 | KC296929 | KC297100 | KC296984 | KC297007 | KP703761 |
| C. siamense syn. C. hymenocallidis | CBS 113199. CPC 2290 | Protea cynaroides | Zimbabwe | KC297066 | KC296930 | KC297090 | KC296985 | KC297008 | KP703763 |
| C. siamense syn. C. hymenocallidis | CBS 116868 | Protea cynaroides | Zimbabwe | KC566815 | KC566961 | KP703429 | KC566382 | KC566669 | KP703764 |
| C. siamense syn. C. jasmini-sambac | CBS 130420; ICMP 19118 | Jasminum sambac | Viet Nam | HM131511 | HM131507 | JX010415 | JX009895 | HM131497 | JQ807841 |
| C. siamense | PPDU26A | Coffea arabica | Saudi Arabia | OR048780 | OR050691 | OR050788 | OR050743 | OR050761 | OR050716 |
| C. siamense | PPDU27B | Coffea arabica | Saudi Arabia | OR048778 | OR050689 | OR050786 | OR050741 | OR050759 | OR050714 |
| C. siamense | PPDU27M | Coffea arabica | Saudi Arabia | OR048776 | OR050687 | OR050784 | OR050739 | OR050757 | OR050712 |
| C. siamense | PPDU29H | Coffea arabica | Saudi Arabia | OR048767 | OR050678 | OR050775 | OR050730 | OR050748 | OR050703 |
| C. siamense | PPDU32B | Coffea arabica | Saudi Arabia | OR048763 | OR050674 | OR050771 | OR050726 | OR050744 | OR050699 |
| C. siamense | PPDU39D | Coffea arabica | Saudi Arabia | OR048757 | OR050668 | OR050765 | OR050720 | - | OR050694 |
| C. siamense | PPDU39E | Coffea arabica | Saudi Arabia | OR048756 | OR050667 | OR050764 | OR050719 | - | OR050693 |
| C. siamense | PPDU40G | Coffea arabica | Saudi Arabia | OR048755 | OR050666 | OR050763 | OR050718 | - | OR050692 |
| C. subhenanense | YMF1.06865 | Unknown | China | OK030883 | OK513618 | OK513647 | OK513581 | OK513684 | - |
| C. syzygicola | DNCL021; MFLUCC 10-0624 *, DU-2013c | Syzygium samarangense | Thailand | KF242094 | KF157801 | KF254880 | KJ947226 | KF242156 | KP743473 |
| C. tainanense | UOM 1119, Coll 1290 | Capsicum annuum | Taiwan | MH728805 | MH781487 | MH846570 | MH805857 | MH728819 | MH728824 |
| C. tainanense | CBS 143666, CPC30245, | Capsicum annuum | Taiwan | MH728818 | MH781475 | MH846558 | MH805845 | MH728823 | MH728836 |
| C. temperatum | CBS 133122 * | Vaccinium macrocarpon | USA | JX145159 | MZ664125 | JX145211 | MZ799254 | MZ664045 | JX145298 |
| C. theobromicola | ICMP 18649; CBS 124945 * | Theobroma cacao | Panama | JX010294 | JX009444 | JX010447 | JX009869 | JX010006 | KC790726 |
| C. ti | ICMP 4832 * | Cordyline sp. | New Zealand | JX010269 | JX009520 | JX010442 | JX009898 | JX009952 | KM360146 |
| C. torulosum | CBS 128544 * | Solanum melongena | New Zealand | JQ005164 | JQ005512 | JQ005598 | JQ005338 | - | - |
| C. tropicale | ICMP 18653; CBS 124949 * | Theobroma cacao | Panama | JX010264 | JX009489 | JX010407 | JX009870 | JX010007 | KC790728 |
| C. truncatum | CBS 151.35 * | Phaseolus lunatus | USA | GU227862 | GU227960 | GU228156 | GU228352 | - | - |
| C. truncatum | CBS 151.35 * | Phaseolus lunatus | USA | GU227862 | GU227960 | GU228156 | GU228352 | - | - |
| C. viniferum | GZAAS 5.08601; GC9 | Vitis vinifera | China | JN412804 | JN412795 | JN412813 | MW684718 | JN412798 | MT648530 |
| C. watphraense | MFLUCC 14-0123 | Dendrobium sp. | Thailand | MF448523 | MH376384 | MH351276 | - | - | - |
| C. wuxiense | CGMCC 3.17894 * | Camellia sinensis | China | KU251591 | KU251672 | KU252200 | KU251939 | KU252045 | KU251722 |
| C. xanthorrhoeae | BRIP 45094; ICMP 17903; CBS 127831 * | Xanthorrhoea sp. | Australia | JX010261 | JX009478 | JX010448 | JX009823 | JX009927 | KC790689 |
| C. xishuangbannaense | MFLUCC 19-0107 | Magnolia liliifera | China | MW346469 | MW652294 | - | MW660832 | MW537586 | - |
| C. yuanjiangensis | YMF1.04996 | Unknown | China | OK030885 | OK513620 | OK513649 | OK513583 | OK513686 | - |
| C. yulongense | CFCC 50818 | Vaccinium dunalianum | China | MH751507 | MH777394 | MK108987 | MH793605 | MK108986 | - |
| Colletotrichum sp. | CBS 123921, MAFF 238642 | Dendrobium kingianum | Japan | JQ005163 | JQ005511 | JQ005597 | JQ005337 | - | - |
* Represent ex-type isolates. The isolates obtained in this study are boldfaced.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Alhudaib, K.; Ismail, A.M.; Magistà, D. Multi-Locus Phylogenetic Analysis Revealed the Association of Six Colletotrichum Species with Anthracnose Disease of Coffee (Coffea arabica L.) in Saudi Arabia. J. Fungi 2023, 9, 705. https://doi.org/10.3390/jof9070705
AMA Style
Alhudaib K, Ismail AM, Magistà D. Multi-Locus Phylogenetic Analysis Revealed the Association of Six Colletotrichum Species with Anthracnose Disease of Coffee (Coffea arabica L.) in Saudi Arabia. Journal of Fungi. 2023; 9(7):705. https://doi.org/10.3390/jof9070705
Chicago/Turabian StyleAlhudaib, Khalid, Ahmed Mahmoud Ismail, and Donato Magistà. 2023. "Multi-Locus Phylogenetic Analysis Revealed the Association of Six Colletotrichum Species with Anthracnose Disease of Coffee (Coffea arabica L.) in Saudi Arabia" Journal of Fungi 9, no. 7: 705. https://doi.org/10.3390/jof9070705
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
