Ubiquitination of CLIP-170 family protein restrains polarized growth upon DNA replication stress

Wang, Xi; Zheng, Fan; Yi, Yuan-yuan; Wang, Gao-yuan; Hong, Li-xin; McCollum, Dannel; Fu, Chuanhai; Wang, Yamei; Jin, Quan-wen

doi:10.1038/s41467-022-33311-y

Download PDF

Article
Open access
Published: 22 September 2022

Ubiquitination of CLIP-170 family protein restrains polarized growth upon DNA replication stress

Nature Communications volume 13, Article number: 5565 (2022) Cite this article

1814 Accesses
1 Altmetric
Metrics details

Subjects

Abstract

Microtubules play a crucial role during the establishment and maintenance of cell polarity. In fission yeast cells, the microtubule plus-end tracking proteins (+TIPs) (including the CLIP-170 homologue Tip1) regulate microtubule dynamics and also transport polarity factors to the cell cortex. Here, we show that the E3 ubiquitin ligase Dma1 plays an unexpected role in controlling polarized growth through ubiquitinating Tip1. Dma1 colocalizes with Tip1 to cortical sites at cell ends, and is required for ubiquitination of Tip1. Although the absence of dma1⁺ does not cause apparent polar growth defects in vegetatively growing cells, Dma1-mediated Tip1 ubiquitination is required to restrain polar growth upon DNA replication stress. This mechanism is distinct from the previously recognized calcineurin-dependent inhibition of polarized growth. In this work, we establish a link between Dma1-mediated Tip1 ubiquitination and DNA replication or DNA damage checkpoint-dependent inhibition of polarized growth in fission yeast.

IFT88 controls NuMA enrichment at k-fibers minus-ends to facilitate their re-anchoring into mitotic spindles

Article Open access 16 July 2019

Elongator stabilizes microtubules to control central spindle asymmetry and polarized trafficking of cell fate determinants

Article 27 October 2022

Fission yeast Dis1 is an unconventional TOG/XMAP215 that induces microtubule catastrophe to drive chromosome pulling

Article Open access 26 November 2022

Introduction

Cell polarization in eukaryotic cells is essential for many cellular and organismal functions. The fission yeast Schizosaccharomyces pombe is a rod-shaped unicellular organism that grows by polar extension at both cell poles, and thus represents a unique genetically tractable organism for studying fundamental principles of polarized growth¹. The activation, maintenance, and inactivation of polarized growth in fission yeast are cell cycle-regulated, and cell division and polar growth seem to antagonize each other, as once cells double their original volume and reach a constant cell length (around 14 μm), they enter mitosis and bipolar cell growth stops until the division is complete and growth then restarts² (reviewed in refs. 3,4). Cell polarity is regulated by evolutionarily conserved polarity factors (at least 50 in fission yeast) that function primarily at the cortex of cell ends^4,5,6,7. Among these factors, three conserved microtubule plus-end tracking proteins (+TIPs) including CLIP-170 homolog Tip1, the kinesin-7 family protein Tea2, and the EB1 homolog Mal3 transport the Tea1-Tea4 landmark protein complex along microtubules to cell tips^{8,9,10,11,12,13,14,15,16,17,18}. How polarized growth is coordinated with cell cycle regulation and the role of post-translational modifications of +TIP proteins is still not well understood. One hint was provided by a previous study showing ubiquitination-dependent proteolysis of Tip1¹⁹, though the ubiquitin E3 ligase involved has not been determined.

In this work, we identified the cell end-localized Dma1 as the E3 ubiquitin ligase responsible for Tip1 ubiquitination. This modification on Tip1 is required to restrain polar growth in fission yeast when cells are under DNA replication stress, and this signaling acts in a distinct manner from the previously recognized calcineurin-dependent inhibition of polarized growth.

Results

Dma1 physically interacts with Tip1 and localizes at cell ends

Fission yeast Dma1 contains a ring-finger (RF) domain at its C terminus and it has been shown that Dma1 regulates mitotic exit and cytokinesis by acting as an E3 ubiquitin ligase on the SIN scaffold protein Sid4²⁰. Ubiquitination of Sid4 prevents recruitment of the Polo-like kinase Plo1 during a mitotic checkpoint arrest²⁰. In order to search for more potential substrates of Dma1 E3 ubiquitin ligase, we performed Dma1 affinity purifications with various versions of Dma1, which either lacked ubiquitin ligase activity due to deletion of the RF domain (Dma1^ΔRF) or were fused to lysine-less ubiquitin (i.e. all 7 lysines (7K) mutated to arginines (7R)) with a five tandem glycine linker (5xGly) lying in between (Supplementary Fig. 1a). The rationale for these constructs was that Dma1^ΔRF could bind but not ubiquitinate its substrates, and that the Dma1-5xGly-Ub(7KR) fusions might be self-conjugated to target substrates. To further enrich the potential substrates, we also introduced mutations of mts3-1 (proteasome subunit) or dnt1Δ to slow down the degradation of ubiquitinated proteins or enhance possible target protein ubiquitination, respectively^21,22 (Supplementary Fig. 1b). Interestingly, one major protein, the CLIP-170 homolog Tip1¹⁴, was identified repeatedly (Supplementary Fig. 1b and Supplementary Data 1). The physical interaction between Dma1 and Tip1 was verified by co-immunoprecipitation and pull-down experiments (Fig. 1a, b). The FHA-containing region in Dma1 and the C-terminal half of Tip1 (245-461aa), respectively, were narrowed down as the fragments bridging their interaction (Fig. 1b, c). We noticed that, although Dma1-5xGly-Ub(7KR) fusion failed to self-conjugate to Tip1 as expected, it indeed co-immunoprecipitated significantly more Tip1 than unmodified Dma1 did for unknown reasons (Supplementary Fig. 1c). Nevertheless, this explains why Tip1 was enriched in our series of TAP-Dma1 purifications.

**Fig. 1: Dma1 physically interacts with Tip1 through its FHA domain and localizes at cell ends during vegetative phases.**

In previous studies, Dma1-GFP or Dma1-mNeonGreen has been observed most intensively at SPB and cell division site^20,23,24. To gain further insight into the Dma1 connection with Tip1, we closely scrutinized the possible subcellular localization of Dma1-mNeonGreen in regions other than SPB and cell division site. Indeed, we could observe faint but clearly visible punctate Dma1-mNeonGreen signals at cell ends (Fig. 1d). Those signals were more easily discernable in separating cells, newly separated small cells and in elongating cells before early anaphase when more Dma1 started to accumulate at cell division site (Fig. 1d). Interestingly, Dma1-mNeonGreen displayed similar localization pattern at cell ends with Ags1-RFP along the cell cycle, which labeled sites of actively assembled α-(1-3)glucan in cell wall and septum²⁵ (Fig. 1d and enlarged images in Supplementary Fig. 2), indicating Dma1 is enriched specifically at actively growing cell ends. It has been previously reported that Tip1 localizes at the microtubule tips and cell tips as dots¹⁴. Intriguingly, punctate Dma1-mNeonGreen signals occasionally colocalized with Tip1-tdTomato at cell ends (Fig. 1e). These data suggested that Dma1 may regulate Tip1 directly at the actively growing cell ends.

Ubiquitination of Tip1 is mediated by Dma1 in vivo

The RF domain in Dma1 confers E3 ubiquitin ligase activity towards Sid4²⁰. To test the possibility that Dma1 is involved in ubiquitination of Tip1, Tip1-6HA was detected by western blotting in immune-precipitates enriched by tagged ubiquitin and it showed multiple high molecular weight bands, which were abolished in dma1Δ cells (Fig. 2a). This is consistent with the earlier study showing that Tip1 is likely ubiquitinated¹⁹. When cells arrested at different stages in the cell cycle using a drug (hydroxyurea, HU) (S-phase arrest) or various temperature-sensitive mutants (cdc10-v50 G1 arrest, cdc25-22 G2 arrest, or nda3-KM311 prometaphase arrest) were examined, those lower mobility Tip1 bands were detected most strongly in HU-treated cells (Fig. 2b), suggesting that Tip1 is probably strongly ubiquitinated during S phase when the septum is forming or when the DNA replication checkpoint is activated (see below). Furthermore, when Tip1-6HA was immunoprecipitated from HU-treated cells, it also revealed that the high molecular weight bands were largely abrogated by a deubiquitinating enzyme (DUB) USP2, which shows activity towards multiple types of ubiquitin chains²⁶, but not by calf-intestinal alkaline phosphatase (CIAP) treatment (Fig. 2c and Supplementary Fig. 3), ruling out that these bands represented phosphorylated Tip1. Also, we found that both wild-type and dma1Δ cells were well arrested in S phase by HU, therefore the significantly reduced ubiquitination of Tip1 in HU-treated dma1Δ cells was not due to failed S phase arrest in these mutant cells (Supplementary Fig. 4). Thus, we conclude that Dma1 is required for Tip1 ubiquitination, especially upon DNA replication arrest.

To further assess the role of Dma1 in Tip1 ubiquitination, we examined whether Dma1 mutants with compromised Tip1 binding capability (R64A mutation) (Fig. 1b) or E3 ligase activity (I194A mutation)²⁰ would eliminate Tip1 ubiquitination. The mts3-1 mutation was used to block the degradation of ubiquitinated Tip1 proteins. Strikingly, Tip1 ubiquitination was abolished in both dma1 mutants (Fig. 2d), demonstrating that both functional FHA and RF domains in Dma1 are required for Tip1 ubiquitination in vivo.

Extensive studies have well established that the fate of polyubiquitinated proteins can be quite different depending on the ubiquitin linkage types, in which Lys48-linked chains target proteins for proteasomal degradation but Lys63-linked chains typically have nonproteolytic functions in cell signaling (reviewed in refs. 27, 28). The in vitro studies indicated that Dma1 forms polyubiquitin chains on Sid4 passed from E2 enzyme complex, Ubc13-Uev1a, which specifically forms K63-linked chains²⁰. To test whether Tip1 ubiquitination by Dma1 affects its protein stability or is only involved in degradation-independent signaling, we first examined the protein levels and relative half-life of Tip1 in dma1 mutants before and after the addition of protein translation inhibitor cycloheximide (CHX), respectively. We found that Tip1 was more stable in dma1 mutants (Fig. 2e). And we also found that the half-life of Tip1 was unusually long, which was consistent with the previous observation¹⁹, and the rate of Tip1 proteolysis in dma1Δ, dma1(R64A) and dma1(I194A) mutants was reduced when the protein synthesis was blocked (Fig. 2f). However, when we used ubiquitin mutants K48 or K63 (all Lys residues except Lys48 or Lys63 mutated to Arg, respectively) to examine the Dma1-mediated ubiquitin-conjugation of Tip1, we found that Tip1 was more prominently conjugated by K63 linkage than K48 linkage, though Dma1 catalyzed ubiquitin chain formation of both linkages on Tip1 (Fig. 2g). Together, the long half-life of Tip1 and the preponderance of K63 linkages on Tip1 suggest that Dma1 ubiquitination may primarily serve a regulatory function, although Dma1 does seem to promote Tip1 degradation.

Cell tip-localized Tip1 is ubiquitinated by cell end-targeted Dma1

Based on our observations that Dma1 facilitates Tip1 ubiquitination and these two proteins colocalize at cell tips, it is plausible to surmise that cell ends are the most likely loci for Tip1 ubiquitination to occur. To test this notion, we first examined whether the absence of Mal3 or Tea2, two other TIP+ components, affected Tip1 ubiquitination. It has been shown that Tea2 is responsible for moving Tip1 and Tea1 to the microtubule plus end¹⁶, and Mal3 is necessary for the proper association of Tea2 with the microtubule^12,29. Consistent with previous observations, the association of Tip1 with microtubule plus end was abolished in both mal3Δ and tea2Δ mutants^15,16 (Fig. 3a). However, Tip1 at cell ends remained largely unaltered in mal3Δ but almost completely absent in tea2Δ cells (Fig. 3a). Consistent with Tip1 ubiquitination occurring at cell ends, Tip1 ubiquitination in mal3Δ was comparable to wild-type cells, but significantly reduced in tea2Δ cells (Fig. 3b).

Next, we tested whether the forced accumulation of Dma1 at cell ends by fusing to the polarity factor Mod5³⁰ could possibly allow more Tip1 to be ubiquitinated (Fig. 3c). The engineered Dma1-CFP-Mod5 fusion strongly localized at cell tips but not to SPBs even when Dma1 carried an R64A mutation, which itself failed to localize at cell ends (Fig. 3c, d and Supplementary Fig. 5). Expression of Mod5-fusion protein with wild-type Dma1 (Dma1-CFP-Mod5), but not with Dma1^I194A, strongly promoted Tip1 ubiquitination (Fig. 3e). It is noteworthy that Dma1^R64A-CFP-Mod5 but not Dma1^R64A-CFP fusion promoted Tip1 ubiquitination to a degree similar to wild-type Dma1-CFP alone, though not as much as Dma1-CFP-Mod5, indicating that targeting Dma1 at cell tips by Mod5 could partially compensate for the loss of binding between Dma1 and Tip1. Our measurement of the Tip1-tdTomato intensity demonstrated that the absence of Dma1 did not affect the abundance of Tip1 at cell ends upon HU treatment (Fig. 3f), which is consistent with our data showing that Dma1 ubiquitinates Tip1 mainly through K63 linkages (Fig. 2g). Taken all together, although it is clear that Dma1 affects the overall levels and stability of Tip1, the preponderance of K63 linkages on Tip1 suggest the possibility that its ubiquitination by Dma1 may also have a regulatory function at cell ends.

Dma1 restrains bipolar growth upon defective DNA replication

Since Dma1 mediates Tip1 ubiquitination, we would expect that the absence of dma1⁺ could lead to polar growth defects. Surprisingly, we did not observe any significant difference in the percentage of bipolar cells and cell length in vegetatively growing dma1Δ mutant and wild-type populations (Fig. 4a, b), or in G₂ phase-arrested cdc25-22 and cdc25-22 dma1Δ cells (Supplementary Fig. 6a, b), when cells undergo a marked transition from monopolar to bipolar growth that is referred to as NETO². However, deletion of dma1⁺ removed the inhibition of bipolar growth posed by HU treatment and led to increased cell length (Fig. 4a, b), though HU treatment caused equally efficient arrest at S phase in both wild-type and dma1Δ cells (Supplementary Fig. 4). It has been previously shown that the DNA replication-defective mutant pol1-1546 undergoes monopolar growth at restrictive temperature³¹. Interestingly, dma1Δ also allowed pol1-1546 to show increased cell elongation (Fig. 4b), likely due to its switch from monopolar to bipolar growth (Supplementary Fig. 7). These data suggested that Dma1 is required to inhibit untimely bipolar growth upon DNA damage or replication defects.

**Fig. 4: Dma1 is required to restrain active bipolar growth upon defective DNA replication.**

We noticed that cells with defective DNA replication caused by HU treatment or pol1-1546 mutation promoted the accumulation of Dma1 at cell ends (Fig. 4c and Supplementary Fig. 8), but not in cells arrested at G₂ phase (Supplementary Fig. 6c), this is consistent with our above result that Tip1 ubiquitination became more evident when wild-type cells were treated with HU (Fig. 2b). To further investigate how Dma1 is actively involved in polar growth delay on perturbation of DNA replication, we monitored the localization of some cell-polarity landmarks, such as Cdc42 and Tea4. The Rho family GTPase Cdc42 polarity module is one of the key effectors and regulators of polarized growth³², and fluorescent-protein fusions with CRIB (Cdc42/Rac interactive binding motif)-containing domains of Cdc42 are widely used as reporters of active (GTP-bound) Cdc42 localization in vivo³³. Tea4 is the major linking factor between microtubule- and actin cable-mediated establishment of cell polarity⁹. Strikingly, upon HU treatment, deletion of dma1⁺ led to the enrichment of not only active Cdc42 but also Tea4 at cell ends, whereas the overall intracellular levels of these proteins remained unaltered (Fig. 4d, e and Supplementary Figs. 9 and 10). More interestingly, in the presence of HU, the binding between Tea4 and Tip1 was elevated in dma1Δ cells and in wild-type cells treated with deubiquitinating enzyme USP2 to remove Tip1 ubiquitination (Fig. 4f), this is consistent with increased polar growth in dma1Δ cells (Fig. 4b).

Targeted deubiquitination of Tip1 promotes cell polar growth

Our above results suggested that modification of Tip1 by Dma1-mediated ubiquitination is most likely responsible for polar growth inhibition upon DNA replication stress. To further test this possibility, we examined whether deubiquitination of Tip1 affects polar growth by using approaches involving an in cis and an in trans deubiquitinating enzyme (DUB)-fusion, respectively. First, by adopting an established method^34,35, targeted deubiquitination of Tip1 was achieved by its fusing with the catalytic domain of deubiquitinating enzyme UL36 (Fig. 5a). The Tip1-UL36 fusion but not its catalytically DUB-defective counterpart Tip1-UL36(C40S) suppressed Tip1 hyper-ubiquitination upon HU treatment (Fig. 5b). Accordingly, the presence of Tip1-UL36 but not Tip1-UL36(C40S) led to higher proportion of cells with bipolar growth and increased cell length (Fig. 5c and Supplementary Fig. 11a). As an alternative strategy to achieve targeted deubiquitination of Tip1, Tip1 was fused with the PYL domain (residues 33-209) of the regulatory component of abscisic acid (ABA) receptor PYL1 and the catalytic domain (residues 201-875) of fission yeast deubiquitinating enzyme Ubp7 was fused with the ABI domain (residues 126-423) of ABI1 (Fig. 5d). In the presence of the plant hormone ABA, the PYL and ABI domains are sufficient to form a tight complex^36,37, which should promote the formation of complexes of Tip1-PYL and Ubp7-ABI and their efficient recruitment to cell ends (Fig. 5e, f). As expected, ABA-induced in trans proximity between Ubp7 and Tip1 suppressed Tip1 hyper-ubiquitination and led to increased bipolar growth and cell length to a similar degree to dma1Δ cells (Fig. 5g, h and Supplementary Fig. 11f). These effects required the DUB enzymatic activity of Ubp7, as the presence of ABI fusion with the enzymatically inactive version of Ubp7 carrying C217S mutation³⁴ failed to deubiquitinate Tip1 or promote bipolar growth upon HU treatment (Supplementary Fig. 11b–f). These data firmly supported the idea that the unrestrained bipolar growth in dma1Δ cells is a consequence of loss of Tip1 ubiquitination which leads to the accumulation of major polar growth-promoting factors at cell ends.

**Fig. 5: Targeted deubiquitination of Tip1 suppresses Tip1 hyper-ubiquitination and promotes cell polar growth.**

Dma1 cooperates with calcineurin in inhibition of polar growth

One previous study has established a link between the type 2B protein phosphatase calcineurin-mediated Tip1 dephosphorylation and +TIPs-dependent NETO delay in the presence of DNA replication stress³¹. To examine whether Dma1 functions together or in parallel with calcineurin in inhibition of polar growth, we first tested whether calcineurin is involved in Tip1 ubiquitination. We found that Tip1 was efficiently ubiquitinated in the absence of the calcineurin catalytic subunit Ppb1, with a similar degree of modification to that of wild-type cells (Fig. 6a). We also measured cell length of pol1-1546 dma1Δ ppb1Δ cells, and found that dma1Δ caused an additive effect to deletion of ppb1⁺ on cell length at both permissive and restrictive temperatures (Fig. 6b and Supplementary Fig. 12). Furthermore, viability of the dma1Δ ppb1Δ cells was more severely dropped than that of either single mutant (Fig. 6c, d and Supplementary Fig. 13). These results suggest that Dma1 and calcineurin regulate polar growth by distinct modifications of Tip1, and both pathways redundantly contribute to the maintenance of viability under the DNA replication checkpoint activation.

**Fig. 6: Dma1 functions in parallel with phosphatase calcineurin in inhibition of polar growth in the presence of DNA replication stress.**

Discussion

In summary, our current study has unveiled an unexpected functional connection between Tip1 ubiquitination and DNA integrity checkpoint-induced polarized growth delay in fission yeast (Fig. 6e). As an E3 ubiquitin ligase, Dma1 seems to have multiple substrates for modifications. During a mitotic checkpoint arrest, Dma1 restrains mitotic exit and cytokinesis by targeting SIN scaffold protein Sid4 for ubiquitination and subsequently impeding Plo1 kinase recruitment at SPBs²⁰. When fission yeast cells experience DNA replication or damage stresses during S phase, Dma1 mediates ubiquitination of Tip1 specifically at cell ends to set brakes to inhibit untimely bipolar growth (this study). Although it is clear that Dma1 affects the overall levels and stability of Tip1 (Fig. 2e, f), which is similar to that reported by the previous study¹⁹, the preponderance of K63 over K48 linkages on Tip1 (Fig. 2g) suggests the possibility that its ubiquitination by Dma1 may also have a regulatory function. We favor the notion that Dma1-mediated Tip1 ubiquitination likely affects nonproteolytic functions of Tip1 in polar growth by inhibiting its association with Tea4 at cell ends also based on two other important observations. First, the absence of dma1⁺ does not affect the abundance of Tip1 measured by its intensity at cell ends with or without HU treatment (Fig. 3f), this indicates that the Tip1 ubiquitinated by Dma1 at cell ends is likely not targeted for degradation. Second, deletion of tip1⁺ does not rescue the increased growth phenotype of HU-treated dma1∆ cells (Supplementary Fig. 14), this suggests that Dma1 may be working through regulating Tip1 through K63 ubiquitination, which cannot be mimicked by deletion of Tip1. Thus, fission yeast has evolved at least two parallel mechanisms involving Dma1 and calcineurin phosphatase respectively to minimize energy expenditure to cell growth on perturbation of DNA replication.

Although a functional interaction of their homologs has not yet been observed in higher eukaryotes, our study sheds light on a potentially conserved connection between ubiquitination of Tip1 homolog CLIP-170 and factors involved in cell polarity and directional cell migration in human tumor cells. It has been reported that CLIP-170 is highly expressed in human breast tumor cells and involved in migration of vascular endothelial cells to promote tumor angiogenesis³⁸, and phosphorylation of CLIP-170 by AMP-activated protein kinase is essential for human epithelial cell polarity and directional cell migration³⁹. Dma1 belongs to a small class of proteins carrying both FHA and RF domains and has two homologs in humans, a tumor suppressor CHFR and RNF8^40,41. The RF domain confers E3 ubiquitin ligase activity to these proteins^20,42. Very interestingly, both CHFR and RNF8 are also checkpoint proteins, CHFR delays the cell cycle before prophase upon microtubule stress, whereas RNF8 halts the cell cycle at G₂/M transition when double-strand DNA breaks are detected^{40,41,43,44,45,46} (reviewed in ref. 47). Thus, CLIP-170, CHFR, and RNF8 all have pathological functions in cancer, and the potential interaction between CLIP-170 ubiquitination and CHFR or RING8 E3 ligases might have clinical implications, such as the therapeutic treatment of cancers.

Methods

Yeast methods

S. pombe strains used and created in this study are listed in Supplementary Table 1. Liquid cultures or solid agar plates consisting of rich medium (YE5S) or synthetic minimal media (EMM2) with appropriate supplements were used, and genetic crosses and general yeast techniques were performed as described previously^48,49. Adenine, histidine, leucine, uracil, and lysine hydrochloride were added in YE5S or EMM2 media at a final concentration at 75 mg/L in cell length measurement assays. Fission yeast cells were transformed using a lithium acetate-based procedure⁵⁰. Expression of NTAP-Dma1, NTAP-Dma1^ΔRF, or NTAP-Dma1-5xGly-ubiquitin^(7K→7R) was controlled by the thiamine-repressible nmt41 promoter of pREP41. Expression of wild-type or mutant 6xHis-myc-ubiquitin was controlled by the thiamine-repressible nmt1 promoter of pREP1. Expression from these nmt promoters was kept off by the addition of 5 mg/mL thiamine to the medium, and expression was induced by washing and culturing in medium lacking thiamine for 12–24 h. G418 disulphate (Sigma-Aldrich), hygromycin B (Sangon Biotech), and Phloxine B (Sigma-Aldrich, P4030) were added in solid YE5S plates to generate final concentrations of 100 or 5 μg/mL, respectively, where appropriate. 5-FOA (5-fluoroorotic acid) (Fermentas) was added in solid YE5S plates to get a final concentration of 0.2% for counterselection of ura4⁺. HU (hydroxyurea) (Sangon Biotech), ABA (Sangon Biotech), and CHX (Sigma-Aldrich) were added in liquid cultures at final concentrations of 12 mM (for HU), 250 μM (for ABA) or 100 μg/mL (for CHX) respectively. For nda3-KM311 arrests, cultures were shifted to 18 °C for 8 h before harvesting. For cdc25-22 or mts3-1 arrests, cultures were shifted to 37 °C for 4 h before analysis.

Plasmid and yeast strain construction

To construct expression vector pREP41-NTAP-dma1^ΔRF, the fragment containing dma1^ΔRF (1–573 bp of dma1⁺ coding sequence) was amplified by PCR using yeast genomic DNA as template and primers containing NdeI and BamHI sites, and then PCR products were digested with NdeI and BamHI and cloned into a similarly digested pREP41-NTAP vector⁵¹.

To construct expression vector pREP41-NTAP-dma1-5xGly-ubiquitin^(7K→7R), the full-length dma1⁺ coding sequence was first amplified by PCR using yeast genomic DNA as template and primers containing NdeI and BamHI sites and then cloned into pREP41-NTAP vector⁵¹, this resulted in the construction of pREP41-NTAP-dma1⁺ vector. A fragment carrying ubiquitin coding sequence with all seven lysines mutated to arginines (ubiquitin^(7K→7R)) was amplified from a plasmid (a kind gift from Ning Zheng) and cloned into pREP41-NTAP-dma1⁺ using BamHI site to obtain pREP41-NTAP-dma1-ubiquitin^(7K→7R). Sequence of five tandem glycine codons (GGT GGA GGC GGG GGT) was then introduced between dma1⁺ and mutated ubiquitin sequences via site-directed mutagenesis to finally get pREP41-NTAP-dma1-5xGly-ubiquitin^(7K→7R).

To generate the vectors for recombinant fusion protein production of MBP-Dma1(full-length), MBP-Dma1(1-173aa), MBP-Dma1(167-267aa), MBP-Dma1(R64A), and MBP-Tea4, a gene fragment was amplified by PCR using plasmids carrying the genes^22,23 or directly yeast genomic DNA as templates and then inserted into pMAL-2c (New England BioLabs, Ipswich, MA) or pET28a(+) (Novagen) as described previously²². Integrity of cloned DNA was verified by sequencing analysis.

Carboxy-terminal mNeonGreen epitope tagging of endogenous Dma1 was done by PCR-based gene targeting⁵².

To construct the strains expressing FHA domain (1-173aa) of Dma1 fused with GFP, a dma1⁺ gene fragment corresponding to 1-173aa was amplified by PCR using plasmids carrying the genes^22,23 as templates and then inserted into pHBKA11-CFP (a kind gift from Yoshinori Watanabe) using SalI and BamHI sites. The CFP in the resultant vector pHBKA11-dma1⁽^1-173aa)-CFP was replaced by GFP using the “T-type” enzyme-free cloning method⁵³ to get the vector pHBKA11-dma1⁽^1–173aa)-GFP. This vector was then linearized by ApaI and integrated ectopically at lys1⁺ locus using the hyg^R marker after transformation.

To make the Dma1-CFP, CFP-Mod5, and chimeric Dma1-CFP-Mod5 fusions under the control of P_adh21 promoter, the vector pHBKA21-CFP was first generated by mutating the promoter from P_adh11 to P_adh21 using pHBKA11-CFP as a starting template via site-directed mutagenesis as described previously⁵⁴. A short sequence containing restriction cutting sites KpnI, NheI, and XmaI was introduced into the vector pHBKA21-CFP right behind the CFP sequence using Quikgene site-directed mutagenesis⁵⁵. Then full-length dma1⁺ or mod5⁺ fragment was cloned into this modified pHBKA21-CFP vector using SalI/BamHI sites or KpnI/XmaI sites respectively. Point mutations of FHA domain (R64A) or RF domain (I194A) were introduced into these vectors as desired using Quikgene site-directed mutagenesis⁵⁵. These procedures resulted in the construction of a series of CFP-fusion vectors including pHBKA21-Dma1-CFP, pHBKA21-Dma1^R64A-CFP, pHBKA21-Dma1^I194A-CFP, pHBKA21-CFP-Mod5, pHBKA21-Dma1-CFP-Mod5, pHBKA21-Dma1^R64A-CFP-Mod5, pHBKA21-Dma1^I194A-CFP-Mod5, pHBKA21-Dma1^R64A;I194A-CFP-Mod5. All these vectors were finally linearized by ApaI and integrated ectopically at lys1⁺ locus in dma1Δ::ura4⁺ background using the hyg^R marker after transformation.

To make strains expressing full-length or truncations of tip1 with C-terminal 6HA tag from a so-called “Z locus” (named after its neighboring zfs1⁺ gene) on chromosome 2⁵⁶, a vector (pUC119-P_adh11-6HA(C)-hphMX6-lys1*) was first constructed by switching the GBP-mCherry fragment in vector pUC119-P_adh11-GBP-mCherry(C)-hphMX6-lys1*⁵⁴ to 6HA derived from pFA6a-6HA-kanMX4⁵⁷ using the “T-type” enzyme-free cloning method⁵³. A fragment from a Z locus adjacent to the zfs1⁺ gene together with kanMX6 cassette was released from a vector pKANZA21-CFP-TEV⁵⁶ cut with BglII and EcoRI and subcloned into pUC119-P_adh11-6HA(C)-hphMX6-lys1* to replace hphMX6-lys1*. This generated a vector pUC119-P_adh11-6HA(C)-kanMX6-Z which carried a Z locusadjacent sequence. Then sequences corresponding to full-length or desired truncations of tip1 were cloned into the above vector by “T-type” enzyme-free cloning method⁵³, resulting in a series of vectors including pUC119-P_adh11-tip1^{(full length)}-6HA-kanMX6-Z, pUC119-P_adh11-tip1^(1-134aa)-6HA-kanMX6-Z, pUC119-P_adh11-tip1^(1-244aa)-6HA-kanMX6-Z, pUC119-P_adh11-tip1^(135-244aa)-6HA-kanMX6-Z, pUC119-P_adh11-tip1^(135-461aa)-6HA-kanMX6-Z, pUC119-P_adh11-tip1^(245-314aa)-6HA-kanMX6-Z and pUC119-P_adh11-tip1^(315-461aa)-6HA-kanMX6-Z.

To make strains expressing full-length tip1 with C-terminal fusions of DUB module of herpes simplex virus 1 UL36 protein, the sequences corresponding to catalytically active or dead versions of UL36 (residues 15-260) were amplified from plasmids pDUAL-P_nmt41-Nbr1-mCherry-UL36 or pDUAL-P_nmt41-Nbr1-mCherry-UL36(C40S)³⁴ and inserted behind 6HA tag in pUC119-P_adh11-tip1^{(full length)}-6HA-kanMX6-Z by “T-type” enzyme-free cloning method⁵³. This generated vectors of pUC119-P_adh11-tip1^{(full length)}-6HA-UL36-kanMX6-Z and pUC119-P_adh11-tip1^{(full length)}-6HA-UL36(C40S)-kanMX6-Z.

To create strains expressing full-length tip1 with C-terminal fusion of PYL domain, the sequence corresponding to residues 33-209 of the regulatory component of ABA receptor PYL1 was amplified from Arabidopsis thaliana cDNA (a gift from Dr Yi Tao) and inserted behind 3HA tag in pUC119-P_adh21-tip1^{(full length)}-3HA-kanMX6-Z by “T-type” enzyme-free cloning method⁵³. To create strains expressing fusion of DUB module of Ubp7 with ABI domain, the sequences corresponding to catalytic domain (residues 201-875) of Ubp7 and ABI domain (residues 126-423) of ABI1 were amplified from yeast genomic DNA and Arabidopsis thaliana cDNA (a gift from Dr Yi Tao), respectively, and inserted in front of and behind GFP tag in pHBKA21-GFP by “T-type” enzyme-free cloning method⁵³. These procedures generated vectors of pUC119-P_adh21-tip1^{(full length)}-3HA-PYL1(33-209aa)-kanMX6-Z and, pHBKA21-ubp7(201-875aa)-GFP-ABI1(126-423aa). Point mutation C217S was introduced into pHBKA21-ubp7(201-875aa)-GFP-ABI1(126-423aa) using Quikgene site-directed mutagenesis⁵⁵ to generate pHBKA21-ubp7(201-875aa, C217S)-GFP-ABI1(126-423aa).

All of these vectors were linearized by ApaI digestion and integrated at Z or lys1 locus using the kan^R or hyg^R marker after transformation.

Wild-type and mutants of ubiquitin fused with both 6His and myc (i.e., 6xHis-myc-ubiquitin) were expressed under the control of nmt1 promoter (P_nmt1) at the leu1⁺ locus. To make these strains, a pREP1-6His-myc-ubiquitin vector was originally constructed in which a sequence corresponding to myc (AACGGTGAACAAAAGCTAATCTCCGAGGAAGACTTGGGATCC) was inserted into pREP1-6His-ubiquitin (a kind gift from Kathy Gould) behind 6His using Quikgene site-directed mutagenesis⁵⁵. Then, the PstI-SacI fragment containing nmt1 promoter (P_nmt1), 6His-myc-ubiquitin and nmt terminator (T_nmt) sequences from the above vector was cloned into the pJK148 vector⁵⁰ after being similarly digested with PstI and SacI, this resulted in the construction of the vector pJK148-P_nmt1-6His-myc-ubiquitin::leu1⁺. Ubiquitin mutations in which all Lys residues except K48 or K63 mutated to Arg (K48 and K63 respectively), or all Lys residues mutated to Arg (K0) were then introduced via site-directed mutagenesis, this generated a series of vectors pJK148-P_nmt1-6His-myc-ubiquitin(K48)::leu1⁺, pJK148-P_nmt1-6His-myc-ubiquitin(K63)::leu1⁺ and pJK148-P_nmt1-6His-myc-ubiquitin(K0)::leu1⁺.

To construct yeast strains carrying genomically integrated P_nmt41-NTAP-dma1⁺ and P_nmt41-NTAP-dma1-5xGly-ubiquitin^(7K→7R), the inserts from vectors pREP41-NTAP-dma1⁺ and pREP41-NTAP-dma1-5xGly-ubiquitin^(7K→7R) were cloned into pJK148-based vectors using “T-type” enzyme-free cloning method as previously described^53,54. This generated pJK148-P_nmt41-NTAP-dma1⁺::leu1⁺ and pJK148-P_nmt41-NTAP-dma1-5xGly-ubiquitin^(7K→7R)::leu1⁺.

All these pJK148-based vectors were finally linearized by NruI and integrated at leu1⁺ locus after transformation.

All yeast transformation was performed using the lithium acetate method^50,58. Transformants were selected on YE5S plates containing G418 or hygromycin B (for pFA6a- or pUC119-based vectors) or 0.2% 5-FOA (for replacement of ura4⁺), or EMM2 plates lacking leucine (for pREP1/41- or pJK148-based vectors) or uracil (for pBluescript SK-ura4⁺-based vectors). Correct tagging and integration was verified by using a colony PCR method as described previously⁵⁴ or western blotting.

DNA oligonucleotides/primers used for construction of plasmids in this study were synthesized by GENEWIZ, Inc. or Sangon Biotech, and their sequences are shown in Supplementary Table 2.

Purification of TAP-Dma1 complexes and analysis by mass spectrometry

To prepare TAP complexes for mass spectrometry analyses, we purified NTAP-Dma1-5xGly-ubiquitin^(7K→7R) or NTAP-Dma1^ΔRF from 8- to 10-L cultures as previously described^22,59. Briefly, yeast cells were grown at 32 °C overnight or first grown at 25 °C overnight, then shifted to 37 °C for 4 h (for mts3-1 strains) before being collected and lysed with a bead-beater in NP-40 buffer (6 mM Na₂HPO₄, 4 mM NaH₂PO₄, 1% NP-40, 150 mM NaCl, 2 mM EDTA, 50 mM NaF, 0.1 mM Na₃VO₄) containing protease inhibitor cocktail (Roche, Cat. No. 04693132001). Following the first affinity purification step on 500 μL IgG Sepharose beads (GE Healthcare; 17-0969-01) in NP-40 buffer, the cleavage reaction with 300 U TEV (Invitrogen, Cat. No. 10127-017) added was performed at 16 °C for 2 h. After the second affinity purification with 300 μL calmodulin resin (Stratagene, Cat. No. 214303-52), a single 1 mL aliquot of 20 mM EGTA-containing buffer was applied for elution. Eluates were precipitated by 25% TCA, followed by washing with cold acetone.

Purifications of NTAP-Dma1-5xGly-ubiquitin^(7K→7R) complexes from dma1Δ and mts3-1 dnt1Δ dma1Δ backgrounds respectively, and NTAP-Dma1^ΔRF complexes from mts3-1 dnt1Δ dma1Δ background, were each conducted one time and consequently subjected to mass spectrometry analysis. For mass spectrometry analysis, proteins were digested and analyzed by two-dimensional liquid chromatography tandem MS as previously described⁶⁰. Briefly, proteins were resuspended in 100 mM NH₄HCO₃ and 8 M urea, reduced and alkylated with Tris (2-carboxyethyl) phosphine and iodoacetamide, and digested with sequencing-grade trypsin (Promega, V5111) after decreasing to 2 M urea. Peptides were loaded onto columns with a pressure cell and were separated and analyzed by three-phase multidimensional protein identification technology on a linear trap quadrupole instrument (Thermo Electron). An autosampler (FAMOS) was used for 12 salt elution steps, each with 2 μL ammonium acetate. Each injection was followed by elution of peptides with a 0–40% acetonitrile gradient except the first and last injections, in which a 0–90% acetonitrile gradient was used. Eluted ions were analyzed by one full precursor MS scan (400–2000 mass-to-charge ratio) and four tandem MS scans of the most abundant ions detected in the precursor MS scan under dynamic exclusion. MS spectra were extracted from raw files and converted to DTA files using Scansifter software (version 2.1.25). Spectra with less than 20 peaks were excluded and the remaining spectra were searched using the SEQUEST algorithm (TurboSequest, version 2.7) against a target-decoy (reversed) version of the S. pombe proteome sequence database (UniProt; downloaded 9/2010; 9.954 entries of forward and reverse protein sequences) with a precursor mass tolerance of 2.5 Da and a fragment ion mass tolerance of 0.00 Da (because of rounding in SEQUEST, this results in 0.5 Da tolerance). Peptide identifications were assembled and filtered in DTASelect software (version 1.9) using the following criteria: minimum of 99.9% protein identification probability; minimum of 2 unique peptides; minimum of 95% peptide identification probability; minimum peptide length of five amino acids; minimum number of one tryptic terminus; minimum DeltaCN 0.01 or 0.08; and Xcorr minimum threshold values of 1.6, 2.3, 3.5, and 4.5 for charge states 1, 2, 3, and 4, respectively. All proteins meeting the above criteria were sorted and exported as HTML text documents.

Immunoblotting, immunoprecipitation, and antibodies

For immunoprecipitation and western blot experiments, cells were lysed by bead disruption using FastPrep24 homogenizer (MP Biomedical) and whole-cell lysates were prepared in NP-40 buffer (6 mM Na₂HPO₄, 4 mM NaH₂PO₄, 1% NP-40, 150 mM NaCl, 2 mM EDTA, 50 mM NaF, 0.1 mM Na₃VO₄). To remove the potential ubiquitin or phosphorylation modifications of target proteins, cell lysates were incubated with recombinant human USP2 (R&D Systems, Cat. No. E-504) at a final concentration 50 nM for 2 h at 4 °C or 15 U of CIAP (ThermoFisher Scientific, Cat. No. 18009027) for 45 min at 37 °C, respectively, before being proceeded for immunoprecipitation. Proteins were immunoprecipitated by IgG Sepharose beads (GE Healthcare; 17-0969-01) (for NTAP-Dma1), mouse monoclonal anti-GFP (clone 7.1/13.1; Roche, Cat. No. 11814460001) or rat monoclonal anti-HA (clone 3F10; Roche, Cat. No. 11867423001) antibodies. Immunoblot analysis of cell lysates and immunoprecipitates was performed using peroxidase–anti-peroxidase soluble complex (Sigma-Aldrich; P1291) (1:800), rabbit polyclonal anti-Myc (GeneScript, A00172-40) (1:1000), mouse monoclonal anti-GFP (clone ME11; Beijing Ray Antibody Biotech, RM1008) (1:1000), rat monoclonal anti-HA (clone 3F10; Roche, Cat. No. 11867423001) (1:1000) or mouse monoclonal anti-Cig2 (clone 3A11/5; Santa Cruz Biotechnology, sc-53223) (1:1000) primary antibodies. Cdc2 was detected using rabbit polyclonal anti-PSTAIRE (Santa Cruz Biotechnology, sc-53) (1:1000 dilution) as loading controls. Secondary antibodies used were goat anti-mouse or goat anti-rabbit polyclonal IgG (H+L) HRP conjugates (ThermoFisher Scientific; #31430 or #32460) (1:5000–10,000). Information on the commercially available antibodies used in this study is also provided in Supplementary Table 3.

In vitro binding and deubiquitination assay

The in vitro binding assays were performed as previously described²². Briefly, tip1-6HA cells were lysed and whole-cell lysates were prepared in NP-40 buffer as above. To remove the ubiquitin modifications of Tip1, cell lysates were incubated with recombinant human USP2 (R&D Systems, Cat. No. E-504) at a final concentration 50 nM for 2 h at 4 °C prior to in vitro binding. All bacterially produced recombinant MBP-fusion proteins of full-length or truncated Dma1 or Tea4 were expressed in Escherichia coli BL21(DE3) cells and purified on amylose resin (MBP; New England BioLabs) according to the manufacturer’s instructions. Purified MBP-Dma1 or MBP-Tea4 proteins were incubated with clarified whole yeast-cell lysates (treated with or without USP2) for 1–2 h at 4 °C, followed by SDS-PAGE, Coomassie blue staining or western blot analysis to examine the association between full-length or truncated Dma1 and Tip1.

In vivo Tip1 ubiquitination assay

The in vivo Tip1 ubiquitination assay was performed as previously described⁶¹, except using the vector pREP1-6His-myc-ubiquitin instead of pREP1-6His-ubiquitin for expressing ubiquitin-fusion proteins. Briefly, Tip1-6HA strains transformed with pREP1-6His-myc-ubiquitin were grown in the absence of thiamine for 20–24 h to induce 6His-myc-ubiquitin expression. Samples were collected and extracts were prepared in lysate buffer (8 M urea, 300 mM NaCl, 50 mM Na₃PO4, 0.5% NP-40, 4 mM imidazole). Ubiquitin conjugates were purified on Ni-NTA beads and washed by washing buffer (8 M urea, 300 mM NaCl, 50 mM Na₃PO4, 0.5% NP-40, 20 mM imidazole) for four times, separated on SDS-PAGE, and immunoblotted with rabbit polyclonal anti-Myc (GeneScript, A00172-40) (1:1000) to detect ubiquitin and rat monoclonal anti-HA (clone 3F10; Roche, Cat. No. 11867423001) (1:1000) to detect ubiquitinated Tip1-6HA.

Flow cytometry analyses

DNA content was analyzed with fluorescence-activated cell sorting (FACS). For the FACS analysis, the cells were first fixed with cold 70% ethanol and kept on ice for >30 min before pelleting at 12,000 rpm. Cells were then resuspended in 50 mM sodium citrate with 10 µg/mL RNase A for over 3 h. DNA was then stained with 2 μg/mL propidium iodide (PI) (Beyotime Biotechnology, ST511) before brief sonication. At least 20,000 cells were acquired per sample on a Quanteon flow cytometer (ACEA Biosciences) for PI detection (FL2-A). DNA content is shown on a linear scale after gating for single cells in FlowJo (version 10) software.

Microscopy methods

To determine cell length at division, the yeast strains were grown in EMM5S medium with or without HU treatment to an A₆₀₀ of <0.5, and cells without clear septa under DIC microscopy were selected for measurement. A minimum of 80 unseptated cells were scored for each strain.

GFP-, CFP-, mNeonGreen-, RFP-, or tdTomato-fusion proteins were observed in live or cold methanol-fixed cells. For calcofluor staining, cells were fixed with 3.7% formaldehyde followed by staining with 5–10 μg/mL calcofluor (Sigma-Aldrich). Photomicrographs were obtained using a Nikon 80i fluorescence microscope or a Perkin Elmer spinning-disk confocal microscope (UltraVIEW VoX) with a 100× NA 1.49 TIRF oil immersion objective (Nikon) coupled to a cooled CCD camera (9100-50 EMCCD; Hamamatsu Photonics) and spinning disk head (CSU-X1, Yokogawa). Signals of Dma1-mNeonGreen, Dma1-CFP fusions, Tip1-tdTomato, CRIB-3xGFP, Tea4-GFP, and Ubp7(201-875aa, WT or C217S)-GFP-ABI1(126-423aa) were defined as being localized at cell tips when they appeared as smooth or punctate foci in a 4-µm crescent region at cortex of cell end. Fluorescence intensities of Tip1-tdTomato, Dma1-mNeonGreen, CRIB-3xGFP, or Tea4-GFP were measured along a 4-µm-long line on the cell tip on maximum projection images and the intensity ratio was calculated after background deduction. Image processing and analysis was performed using Element software (Nikon, version 2.34), Metamorph software (Molecular Devices, version 7.1), iQ software (Andor, version 3.6), ImageJ software (National Institutes of Health, versions 2.0.0-rc-69), and Adobe Photoshop (Adobe Systems, version cs6).

Statistical analyses and reproducibility

No statistical methods were used to predetermine the sample size. The experiments were randomized and the investigators were not blinded to allocation during experiments and outcome assessment. All experiments were independently repeated two to four times with similar results obtained. For quantitative analyses of protein level, cell polar growth pattern, fluorescence intensity, and cell length of each experiment, at least 75 cells were counted or measured for each time point or sample. No data were excluded from our studies. Data collection and statistical analyses were performed using Microsoft Office Excel (Microsoft, version 2017) or GraphPad Prism (GraphPad Software Inc., version 6.0) software. Each individual measurement of fluorescence intensity or cell length is represented as a circle in the graphs. Statistical data are expressed as mean values with error bars representing ±standard deviation and were compared using two-tailed unpaired Student’s t-tests unless indicated otherwise. Differences were considered to be statistically significant at p < 0.05.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this article.

Data availability

The mass spectrometry raw data are not available anymore. The list of potential Dma1-interacting proteins identified by mass spectrometry in this study is provided as Supplementary Data 1. All remaining data supporting the findings of this study are available within the article and its supplementary information files. Source Data are provided with this paper.

References

Martin, S. G. & Chang, F. New end take off—regulating cell polarity during the fission yeast cell cycle. Cell Cycle 4, 1046–1049 (2005).
Article CAS PubMed Google Scholar
Mitchison, J. M. & Nurse, P. Growth in cell length in the fission yeast Schizosaccharomyces pombe. J. Cell Sci. 75, 357–376 (1985).
Article CAS PubMed Google Scholar
Hachet, O., Bendezu, F. O. & Martin, S. G. Fission yeast: in shape to divide. Curr. Opin. Cell Biol. 24, 858–864 (2012).
Article CAS PubMed Google Scholar
Martin, S. G. Microtubule-dependent cell morphogenesis in the fission yeast. Trends Cell Biol. 19, 447–454 (2009).
Article CAS PubMed Google Scholar
La Carbona, S., Le Goff, C. & Le Goff, X. Fission yeast cytoskeletons and cell polarity factors: connecting at the cortex. Biol. Cell 98, 619–631 (2006).
Article PubMed Google Scholar
Dodgson, J. et al. Spatial segregation of polarity factors into distinct cortical clusters is required for cell polarity control. Nat. Commun. 4, 1834 (2013).
Article ADS PubMed Google Scholar
Huisman, S. M. & Brunner, D. Cell polarity in fission yeast: a matter of confining, positioning, and switching growth zones. Semin. Cell Dev. Biol. 22, 799–805 (2011).
Article CAS PubMed Google Scholar
Chang, F. & Martin, S. G. Shaping fission yeast with microtubules. Cold Spring Harb. Perspect. Biol. 1, a001347 (2009).
Article PubMed PubMed Central Google Scholar
Martin, S. G., McDonald, W. H., Yates, J. R. & Chang, F. Tea4p links microtubule plus ends with the formin For3p in the establishment of cell polarity. Dev. Cell 8, 479–491 (2005).
Article CAS PubMed Google Scholar
Mata, J. & Nurse, P. tea1 and the microtubular cytoskeleton are important for generating global spatial order within the fission yeast cell. Cell 89, 939–949 (1997).
Article CAS PubMed Google Scholar
Tatebe, H., Shimada, K., Uzawa, S., Morigasaki, S. & Shiozaki, K. Wsh(3)/Tea4 is a novel cell-end factor essential for bipolar distribution of Tea1 and protects cell polarity under environmental stress in S-pombe. Curr. Biol. 15, 1006–1015 (2005).
Article CAS PubMed Google Scholar
Browning, H., Hackney, D. D. & Nurse, P. Targeted movement of cell end factors in fission yeast. Nat. Cell Biol. 5, 812–818 (2003).
Article CAS PubMed Google Scholar
Browning, H. et al. Tea2p is a kinesin-like protein required to generate polarized growth in fission yeast. J. Cell Biol. 151, 15–28 (2000).
Article CAS PubMed PubMed Central Google Scholar
Brunner, D. & Nurse, P. CLIP170-like tip1p spatially organizes microtubular dynamics in fission yeast. Cell 102, 695–704 (2000).
Article CAS PubMed Google Scholar
Busch, K. E. & Brunner, D. The microtubule plus end-tracking proteins mal3p and tip1p cooperate for cell-end targeting of interphase microtubules. Curr. Biol. 14, 548–559 (2004).
Article CAS PubMed Google Scholar
Busch, K. E., Hayles, J., Nurse, P. & Brunner, D. Tea2p kinesin is involved in spatial microtubule organization by transporting Tip1p on microtubules. Dev. Cell 6, 831–843 (2004).
Article CAS PubMed Google Scholar
Beinhauer, J. D., Hagan, I. M., Hegemann, J. H. & Fleig, U. Mal3, the fission yeast homologue of the human APC-interacting protein EB-1 is required for microtubule integrity and the maintenance of cell form. J. Cell Biol. 139, 717–728 (1997).
Article CAS PubMed PubMed Central Google Scholar
Bieling, P. et al. Reconstitution of a microtubule plus-end tracking system in vitro. Nature 450, 1100–1105 (2007).
Article ADS CAS PubMed Google Scholar
Martin-Garcia, R. & Mulvihill, D. P. Myosin V spatially regulates microtubule dynamics and promotes the ubiquitin-dependent degradation of the fission yeast CLIP-170 homologue, Tip1. J. Cell Sci. 122, 3862–3872 (2009).
Article CAS PubMed Google Scholar
Johnson, A. E. & Gould, K. L. Dma1 ubiquitinates the SIN scaffold, Sid4, to impede the mitotic localization of Plo1 kinase. EMBO J. 30, 341–354 (2011).
Article CAS PubMed Google Scholar
Gordon, C., McGurk, G., Wallace, M. & Hastie, N. D. A conditional lethal mutant in the fission yeast 26 S protease subunit mts3+ is defective in metaphase to anaphase transition. J. Biol. Chem. 271, 5704–5711 (1996).
Article CAS PubMed Google Scholar
Wang, Y. et al. Dnt1 acts as a mitotic inhibitor of the spindle checkpoint protein dma1 in fission yeast. Mol. Biol. Cell 23, 3348–3356 (2012).
Article CAS PubMed PubMed Central Google Scholar
Guertin, D. A., Venkatram, S., Gould, K. L. & McCollum, D. Dma1 prevents mitotic exit and cytokinesis by inhibiting the septation initiation network (SIN). Dev. Cell 3, 779–790 (2002).
Article CAS PubMed Google Scholar
Jones, C. M. et al. Relief of the Dma1-mediated checkpoint requires Dma1 autoubiquitination and dynamic localization. Mol. Biol. Cell 29, 2176–2189 (2018).
Cortes, J. C. et al. Fission yeast Ags1 confers the essential septum strength needed for safe gradual cell abscission. J. Cell Biol. 198, 637–656 (2012).
Article CAS PubMed PubMed Central Google Scholar
Komander, D. et al. Molecular discrimination of structurally equivalent Lys 63-linked and linear polyubiquitin chains. EMBO Rep. 10, 466–473 (2009).
Article CAS PubMed PubMed Central Google Scholar
Chen, Z. J. & Sun, L. J. Nonproteolytic functions of ubiquitin in cell signaling. Mol. Cell 33, 275–286 (2009).
Article CAS PubMed Google Scholar
Komander, D. & Rape, M. The ubiquitin code. Annu Rev. Biochem. 81, 203–229 (2012).
Article CAS PubMed Google Scholar
Browning, H. & Hackney, D. D. The EB1 homolog Mal3 stimulates the ATPase of the kinesin Tea2 by recruiting it to the microtubule. J. Biol. Chem. 280, 12299–12304 (2005).
Article CAS PubMed Google Scholar
Snaith, H. A. & Sawin, K. E. Fission yeast mod5p regulates polarized growth through anchoring of tea1p at cell tips. Nature 423, 647–651 (2003).
Article ADS CAS PubMed Google Scholar
Kume, K., Koyano, T., Kanai, M., Toda, T. & Hirata, D. Calcineurin ensures a link between the DNA replication checkpoint and microtubule-dependent polarized growth. Nat. Cell Biol. 13, 234–242 (2011).
Article CAS PubMed Google Scholar
Rincon, S. A., Estravis, M. & Perez, P. Cdc42 regulates polarized growth and cell integrity in fission yeast. Biochem Soc. Trans. 42, 201–205 (2014).
Article CAS PubMed Google Scholar
Tatebe, H., Nakano, K., Maximo, R. & Shiozaki, K. Pom1 DYRK regulates localization of the Rga4 GAP to ensure bipolar activation of Cdc42 in fission yeast. Curr. Biol. 18, 322–330 (2008).
Article CAS PubMed PubMed Central Google Scholar
Liu, X. M. et al. ESCRTs cooperate with a selective autophagy receptor to mediate vacuolar targeting of soluble cargos. Mol. Cell 59, 1035–1042 (2015).
Article CAS PubMed Google Scholar
Stringer, D. K. & Piper, R. C. A single ubiquitin is sufficient for cargo protein entry into MVBs in the absence of ESCRT ubiquitination. J. Cell Biol. 192, 229–242 (2011).
Article CAS PubMed PubMed Central Google Scholar
Liang, F. S., Ho, W. Q. & Crabtree, G. R. Engineering the ABA plant stress pathway for regulation of induced proximity. Sci. Signal 4, rs2 (2011).
Article PubMed PubMed Central Google Scholar
Miyazono, K. et al. Structural basis of abscisic acid signalling. Nature 462, 609–614 (2009).
Article ADS CAS PubMed Google Scholar
Sun, X. et al. Regulation of tumor angiogenesis by the microtubule-binding protein CLIP-170. Protein Cell 4, 266–276 (2013).
Article CAS PubMed PubMed Central Google Scholar
Nakano, A. et al. AMPK controls the speed of microtubule polymerization and directional cell migration through CLIP-170 phosphorylation. Nat. Cell Biol. 12, 583–590 (2010).
Article CAS PubMed Google Scholar
Scolnick, D. M. & Halazonetis, T. D. Chfr defines a mitotic stress checkpoint that delays entry into metaphase. Nature 406, 430–435 (2000).
Article ADS CAS PubMed Google Scholar
Kolas, N. K. et al. Orchestration of the DNA-damage response by the RNF8 ubiquitin ligase. Science 318, 1637–1640 (2007).
Article ADS CAS PubMed PubMed Central Google Scholar
Lorick, K. L. et al. RING fingers mediate ubiquitin-conjugating enzyme (E2)-dependent ubiquitination. Proc. Natl Acad. Sci. USA 96, 11364–11369 (1999).
Article ADS CAS PubMed PubMed Central Google Scholar
Matsusaka, T. & Pines, J. Chfr acts with the p38 stress kinases to block entry to mitosis in mammalian cells. J. Cell Biol. 166, 507–516 (2004).
Article CAS PubMed PubMed Central Google Scholar
Huen, M. S. et al. RNF8 transduces the DNA-damage signal via histone ubiquitylation and checkpoint protein assembly. Cell 131, 901–914 (2007).
Article CAS PubMed PubMed Central Google Scholar
Mailand, N. et al. RNF8 ubiquitylates histones at DNA double-strand breaks and promotes assembly of repair proteins. Cell 131, 887–900 (2007).
Article CAS PubMed Google Scholar
Wang, B. & Elledge, S. J. Ubc13/Rnf8 ubiquitin ligases control foci formation of the Rap80/Abraxas/Brca1/Brcc36 complex in response to DNA damage. Proc. Natl Acad. Sci. USA 104, 20759–20763 (2007).
Article ADS CAS PubMed PubMed Central Google Scholar
Brooks, L. III, Heimsath, E. G. Jr., Loring, G. L. & Brenner, C. FHA-RING ubiquitin ligases in cell division cycle control. Cell Mol. Life Sci. 65, 3458–3466 (2008).
Article CAS PubMed PubMed Central Google Scholar
Forsburg, S. L. & Rhind, N. Basic methods for fission yeast. Yeast 23, 173–183 (2006).
Article CAS PubMed Google Scholar
Moreno, S., Klar, A. & Nurse, P. Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol. 194, 795–823 (1991).
Article CAS PubMed Google Scholar
Keeney, J. B. & Boeke, J. D. Efficient targeted integration at leu1-32 and ura4-294 in Schizosaccharomyces pombe. Genetics 136, 849–856 (1994).
Article CAS PubMed PubMed Central Google Scholar
Tasto, J. J., Carnahan, R. H., McDonald, W. H. & Gould, K. L. Vectors and gene targeting modules for tandem affinity purification in Schizosaccharomyces pombe. Yeast 18, 657–662 (2001).
Article CAS PubMed Google Scholar
Bahler, J. et al. Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast 14, 943–951 (1998).
Article CAS PubMed Google Scholar
Yang, R. B., Bi, L. J. & Zhang, X. E. A novel T-type overhangs improve the enzyme-free cloning of PCR products. Mol. Biotechnol. 55, 10–16 (2013).
Article PubMed Google Scholar
Chen, Y. H. et al. Facile manipulation of protein localization in fission yeast through binding of GFP-binding protein to GFP. J. Cell Sci. 130, 1003–1015 (2017).
CAS PubMed Google Scholar
Mao, Y. et al. Quikgene: a gene synthesis method integrated with ligation-free cloning. Anal. Biochem. 415, 21–26 (2011).
Article CAS PubMed Google Scholar
Tada, K., Susumu, H., Sakuno, T. & Watanabe, Y. Condensin association with histone H2A shapes mitotic chromosomes. Nature 474, 477–483 (2011).
Article CAS PubMed Google Scholar
Janke, C. et al. A versatile toolbox for PCR-based tagging of yeast genes: new fluorescent proteins, more markers and promoter substitution cassettes. Yeast 21, 947–962 (2004).
Article CAS PubMed Google Scholar
Bahler, J. & Pringle, J. R. Pom1p, a fission yeast protein kinase that provides positional information for both polarized growth and cytokinesis. Genes Dev. 12, 1356–1370 (1998).
Article CAS PubMed PubMed Central Google Scholar
Gould, K. L., Ren, L., Feoktistova, A. S., Jennings, J. L. & Link, A. J. Tandem affinity purification and identification of protein complex components. Methods 33, 239–244 (2004).
Article CAS PubMed Google Scholar
Chen, J. S. et al. Comprehensive proteomics analysis reveals new substrates and regulators of the fission yeast clp1/cdc14 phosphatase. Mol. Cell Proteom. 12, 1074–1086 (2013).
Article CAS Google Scholar
Wolfe, B. A. & Gould, K. L. Fission yeast Clp1p phosphatase affects G2/M transition and mitotic exit through Cdc25p inactivation. EMBO J. 23, 919–929 (2004).
Article CAS PubMed PubMed Central Google Scholar

Download references

Acknowledgements

We thank Li-lin Du, Kathy Gould, Yoshinori Watanabe, Iain Hagan, Daniel P. Mulvihill, Fred Chang, Damian Brunner, Kazunori Kume, Juan Carlos G Cortés and Ning Zheng for kindly providing the yeast strains or plasmids, and Yi Tao for Arabidopsis thaliana cDNA. We also thank Qing-feng Liu and Xin Chen for their kind help with the confocal microscope imaging. This work was supported by the National Natural Science Foundation of China [grant numbers 31371360, 31171298, and 31671411 to Q.J.].

Author information

These authors contributed equally: Xi Wang, Fan Zheng.

Authors and Affiliations

State Key Laboratory of Cellular Stress Biology, School of Life Sciences, Faculty of Medicine and Life Sciences, Xiamen University, Xiamen, 361102, Fujian, China
Xi Wang, Yuan-yuan Yi, Gao-yuan Wang, Yamei Wang & Quan-wen Jin
School of Life Sciences, University of Science and Technology of China, Hefei, 230026, Anhui, China
Fan Zheng & Chuanhai Fu
State Key Laboratory of Cellular Stress Biology, School of Medicine, Faculty of Medicine and Life Sciences, Xiamen University, Xiamen, 361102, Fujian, China
Li-xin Hong
Department of Biochemistry and Molecular Pharmacology, University of Massachusetts Medical School, Worcester, MA, 01605, USA
Dannel McCollum

Authors

Xi Wang
View author publications
You can also search for this author in PubMed Google Scholar
Fan Zheng
View author publications
You can also search for this author in PubMed Google Scholar
Yuan-yuan Yi
View author publications
You can also search for this author in PubMed Google Scholar
Gao-yuan Wang
View author publications
You can also search for this author in PubMed Google Scholar
Li-xin Hong
View author publications
You can also search for this author in PubMed Google Scholar
Dannel McCollum
View author publications
You can also search for this author in PubMed Google Scholar
Chuanhai Fu
View author publications
You can also search for this author in PubMed Google Scholar
Yamei Wang
View author publications
You can also search for this author in PubMed Google Scholar
Quan-wen Jin
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

X.W. and F.Z. performed all microscopy experiments with the help of L.H. X.W., Y.Y., and G.W. performed all immunoblotting, co-immunoprecipitation experiments, and in vitro binding assays. G.W. first observed and confirmed that Dma1 is involved in Tip1 ubiquitination. Q.J. and Y.W. conceived the study. D.M., C.F., Y.W., and Q.J. designed the experiments and supervised the research. Y.W. and Q.J. wrote the paper with the inputs from F.Z., D.M., and C.F.

Corresponding authors

Correspondence to Chuanhai Fu, Yamei Wang or Quan-wen Jin.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks the anonymous reviewers for their contribution to the peer review of this work. Peer reviewer reports are available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Peer Review File

Description of Additional Supplementary Files

Supplementary Data 1

Reporting Summary

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Wang, X., Zheng, F., Yi, Yy. et al. Ubiquitination of CLIP-170 family protein restrains polarized growth upon DNA replication stress. Nat Commun 13, 5565 (2022). https://doi.org/10.1038/s41467-022-33311-y

Download citation

Received: 11 January 2022
Accepted: 12 September 2022
Published: 22 September 2022
DOI: https://doi.org/10.1038/s41467-022-33311-y

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.