Professional Documents
Culture Documents
CONTENT
ORAL PRESENTATION
WELCOME MESSAGE
It is a great pleasure to invite you to Bogor, Indonesia to participate to the 9th International Flora
Malesiana Symposium. This year’s symposium will be an important and comprehensive forum in
which botanists will gain invaluable experience from the exchange of knowledge, ideas, and opinions
on plant systematics (including fungi, mosses, ferns, and lichens). We will discuss finding new
species, the distribution of the important plant species for health, foods, clothing, etc., anatomy and
morphology of plants of the regions for the purpose of proper identification, understanding habitats of
the floras, and how to protect those plants from over-exploitation and manage them sustainable for the
future generations. We cordially invite you to attend and participate in this significant event.
Sincerely yours,
ORGANIZING COMMITTEE
SYMPOSIUM ADVISORS
Prof. Dr. Lukman Hakim, Chairman of Indonesian Institute of Sciences (LIPI), Indonesia
Dr. Bambang Sunarko, Head of Research Center for Biology, LIPI, Indonesia
Prof. Dr. Dedy Darnaedi, Director of Flora Malesiana International Foundation, Indonesia
Mustaid Siregar M. Si., Head of Center for Plant Conservation Bogor Botanic Gardens-LIPI,
Indonesia
Prof. dr. Erik F Smets, Scientific Director of the Netherlands Center for Biodiversity Naturalis
(NCB Naturalis) and Flora Malesiana International Foundation,
The Netherlands
Dr. Marco C. Roos, The Netherlands Centre for Biodiversity Naturalis (NCB Naturalis) and Flora
Malesiana International Foundation, The Netherlands
Website : Yosman
Yulia A. Kartika, M. Kom.
GENERAL INFORMATION
Symposium Venue
The IPB International Convention Center (IPB ICC), Bogor, West Java, Indonesia
IPB International Convention Center is strategically located in the heart of Bogor city, on the
intersection of Padjajaran Rd. and Otto Iskandar Dinata Rd. IPB ICC is in the same modern
complex with Santika Indonesia Hotel & Resort and Botani Square Mall which augment the
comfort of the facilities.
The venue is within an easy walking distance to the Bogor Botanic Gardens. The Museum of
Ethnobotany is located across the Gardens, connected to the old building of Herbarium
Bogoriense.
IPB ICC is easily accessed from the Soekarno-Hatta, Jakarta International Airport by using
DAMRI BUS which the shelter is just next to the IPB ICC complex. A range of other
accommodation options are within walking distance, such as Permata Hotel and Amaris
Hotel. Other nearby hotels are listed under accommodation.
GUIDED TOURS
All participants will gather at the IPB ICC parking lot at 6:30 am for Tour to the Mt. Gede Pangrango
National Park and Visit Herbarium Bogoriense; and 8.00 am at the Main Gate (Gate I) of Bogor
Botanic Gardens for garden visit. The Committee will prepare snack and lunch with local dishes the
trip. Please feel free to bring your own food if you think it is necessary for your save. The Committee
do not allow you to collect any plant materials during the tour to the Bogor Botanic Gardens and Mt.
Gede Pangrango National Park.
All of you will be grouped based on the destination of your trip, and it will be announced prior to the
trip.
Time Activities
09:00-12:00 Tour at BO
Cibeureum Waterfall
Cibeureum waterfalls is located within the Mt. Gede Pangrango National Park and consist of
the main Cibeureum waterfall and two other smaller, Cidendeng and Cikundul waterfalls. Cibeureum
waterfall is the largest waterfall and the shortest in the region, which is more open and is located near
the shelter so that more mobbed. Cibeureum name comes from Sundanese language meaning the Red
River. The red color comes from the shades of red cliff walls formed by red algae that grow along the
cliff walls.
Cidendeng waterfall, taller but slimmer in size, is located on the right side of Cibeureum
waterfall. Whereas, Cikundul waterfall is situated in the rightmost of Cibeureum waterfall but in the
higher position and somewhat hidden in an alcove between two cliffs. The three waterfalls are
between 40-50 meters tall and are located at an altitude of 1675 m above sea level. The average
rainfall in this area ranges from 3000-4200 mm per year. The average temperature varies between
18°C in Cibodas and less than 10°C in the peak Pangrango.
Time Activities
06:30 - 07:00 Gather at Botani Square Parking Lot (the same as the
symposium venue)
Mts. Halimun-Salak National Park is the largest remaining mountain rainforest in Java. This
area is a natural forest ecosystem with high genetic resources and diversity of plants and animals.
Natural conditions are relatively intact. The natural beauty and its biological diversity make this area
becomes heaven for not only human beings but also for wildlife in it. Besides, this region has a
function as water catchment which is vital for people living in the surroundings. The mountains is
situated in the altitude of 500-1,929 m above sea level, consisted of plain mountains at 1,000-1,400 m
above sea level and slope in about 75% of total mountain areas.
The Mts. Halimun-Salak is a habitat for Javan gibbon (Hylobates moloch) and several other
endangered species, such as the Javan hawk-eagle (Spizaetus bartelsi), leopard (Panthera pardus),
Javan Surili (Presbytis comata), as well as some plant species local endemic such as Dipterocarpus
hasseltii and Neesia altissima. Many rare species of orchids can be found here, such as Bulbophylum
binnendijkii, B. angustifolium, Cymbidium ensifolium and Dendrobium macrophyllum. Very common
species at altitude of 500-1,000 m are rasamala (Altingia excelsa), puspa (Schima wallichii), saninten
(Castanopsis javanica), k iriung anak (Castanopsis acuminatissima) and pasang (Quercus
gemeliflora). Above 1,000 m up to 1,400 m in the sub montane forests we can find Acer laurinum,
ganitri (Elaeocarpus ganitrus), Eurya acuminatissima, banyan (Ficus spp), ki leho (Saurauia
pendula) and ki merak (Weinmannia blumei). At the 1,500 m above the forests are dominated by
Podocarpus spp. and Dacrycarpus spp.
Registration
During on-site registration on either August 26 or August 27, please come to the registration desk to
inform where you are staying. This information is needed for pick-up on September 2, 2013.
The Post Symposium Tour to Mount Halimun-Salak National Park cost USD 600 per person (includes
tranportation, accomodation, guide, meal and snacks)
The workshop aims to bring the understanding of how important both botanical illustration and art to
botanists. The use of illustration is valuable in making clearer the description of species. The presence
of drawings in botanical research articles leads the readers to the right imagination of features meant
by the authors. Ms. Sachs-Jansen who is also founder of the Dutch Society of Botanical Artists will
share her exceptional drawing techniques for revealing details and textures of a plant or parts of a
plant accurately.
The workshop costs USD 75 per person (includes transportation, drawing tools, lunch, certificate and
snacks)
Limited space is applied (30 participants only)
CONFERENCE PROGRAM
OVERVIEW
ORGANIZING COMMITTEE
08.30 – 08.45 WELCOMING MESSAGE
Dr. Joeni S Rahajoe
KEYNOTE LECTURE
09.45 – 10.45
Prof. Emil Salim
KEYNOTE LECTURE
The world is faced with the challenges of the increase of population confronting natural
resources from our only one earth. If today we have more or less 7 billion people, we may have in
2050 approximately 9 billion people. It requires more consumption and production of final goods
derived from the exploitation of natural resources.
But natural resources in our planet are limited and finite. Development as we are used to
conduct cannot be based on natural resource exploitation anymore. There is no sufficient resource
available to support the conventional resource exploitation type of development.
Sustainable Development
The outlook, system and methodology of conventional development must change into
sustainable development with a succinctly different paradigm. First, sustainable development must be
based on sustaining natural resources while in process of development. It emphasizes resource
enrichment rather than resource exploitation. Second, it maintains the intrinsic value of natural
resources while raising its value added by the use of science and technology. Third, in using process,
system and technology of development it chooses those that minimize its ecological footprint, at least
below the capacity to enable the ecological system to sustain its life support system. Fourth, it is not
driven by anthropocentric motivations as such, but rather by the recognition that there is a relatonship
between God and Human, Society and Nature. In Bali it is called “Tri-Hita Karana”, Human living in
harmony with God, Society and Nature. Fifth, taken these factors into account, development becomes
not only economic development as it is commonly understood, raising production and consumption
for the ultimate satisfactions of human needs, but sustainable development raises also the need for
social development to raise human well being in all its dimensions. “Man does not live by bread
alone”. There has to be also other human and social dimensions to be developed, like educaton, health,
mutual cooperation, social inclusion, poverty elaviation, socialequity, etc. Elements that raises the
quality of human beings. But man humans and society are no isolated islands. They live and survive
within an ecological natural system. Therefore sustainable development must take into accounts
humans and society’s impact on the environment. Human and Natural Environment are interlinked in
a “web of life”, the ecosystem. Therefore sustainable development must be taken into account the fact
that development is taking place in a web of ecosystems.
On the basis of these considerations, Sustainable Development that comprises of economic,
sosial and environmental development, goes along three tracks simultaneously to reach for the goals
of “Profit, People and Planet” as the essence of Sustainabale Development.
From this sustaibale development perspective it is clear that natural resources are not
considered as an object of exploitation but of enrichment, to raise value added embodied in resources.
It is in this context that natural resources are not considered as an isolated item, but rather as a
component of an ecosystem, more specifically in Indonesia as a tropical bio terrestrial and marine
natural resources.
A New Approach
Indonesia’s unique position as a archipelago with approximately 14.000 islands situated along
the equator, surrounded by the Pacific and Indian Ocean and the Asian and Australian continents,
make Indonesia’s bioresources become highly diverse and magnificently rich. It is in this context
that Indonesia plays a unique role as ecosystem for Flora Malesiana to flourish.
Malesiana’s Flora, has unique and distinct features. It grows however in countries, which are
developing in economies. As such, we in Indonesia suffers a serious backlog of not knowing what we
have, let alone a complete data of taxonomy. This is clearly lacking, but more seriously are the facts
that we don’t know for sure what we have in the unexploited natural resources of our forests in many
parts of Indonesian forests.
Indonesia population too are rapidly expanding from a current 243 million (2012) to 315
million (2050). And development is rapidly expanding to the unexploited forest and peat-land all
over Indonesia. There is no time to wait until all our flora and fauna are well registered. The process
of Taxonomy takes time and experts that we not have sufficiently. Development cannot wait.
Important here is to adhere to the principles of Sustainable Development and not emphasizing
only economics but to consider also social and environmental development.
It is in this context that our limited experts on taxonomy needs to have the ability to
communicate and provide relevant informartions on Spatial and Economic Development Planners to
indicate the necessary natural reserve areas that may contain crucial data on flora and fauna, which
also have the potentials to be enriched for further development. In the wake of sustainable
development, environmental impact analysis, social accounting matrixes with spatial planning can be
enforced to minimize destructive impacts of development on fauna-flora and ecosystems.
Another approach of development necessary when data on flora are limited is to turn the
thinking upside down and start from “the output” necessary to conserve the relevant data of flora.
Flora, fauna and biological resources in general have the potential to be developed for food, pharmacy,
energy, material and others. Even with limited data of biological resources, certain area can be
designated as protected areas for food, pharmacy, etc. Starting from the “end-product” it is possible
to trace the required biological resources needed to be conserved in the region.
Important also is the need to get local people with local wisdom involved to protect areas
useful for conserving biodiversity. In the Halimun-Salak Mountain area lives an ethnic group,
Kasepuhan, which has the wisdom to grow twenty or so local rice seeds that have different features.
In this context it is important that this wisdom can be spread all over the region and makes possible
conservation of the unique rice plant .
There is the need that Taxonomist “goes down to people” and educate the people on the
ground on the uniqueness and usefulness of flora, fauna and biodiversity. The science on ecology,
taxonomy of flora and fauna needs to be transformed at the people’s and village’ knowledge based
movement. People needs to know the benefit of flora, fauna and ecosystem. They need being involved
in activities “down to earth”, as the Kasepuhan ethnic groups have taught us on the existence of many
rice diversities.
While data collection on flora Malesiana is of crucial importance, it is important to start also a
“Save the Flora Malesiana Movement” by informing the people at the grassroot on the usefulness and
strategies importance of the unique flora Malesiana resources the people have in their villages in the
soils of Indonesia.
May God bless you in your deliberations.
Session 1
TAXONOMY & BIOSYSTEMATIC-1
Convener: Rugayah, Research Center for Biologi, LIPI
Chairperson: Richard MK Saunders, The University of Hong Kong
Venue: Borneo Room
11.45 – 12.00 Chin Cheung Tang et al.: Evaluating rapid evolutionary radiation in
Goniothalamus (Annonaceae)
12.00 – 12.15 Bine Xue et al.: Segregation of the polyphyletic genus Polyalthia (Annonaceae)
12.15 – 12.30 Xing Guo et al.: Molecular phylogenetics of the Dasymaschalon- Desmos-
Friesodielsia-Monanthotaxis lineage (Annonaceae)
Saunders, R.M.K.
School of Biological Sciences, The University of Hong Kong, P. R. China
*e-mail: saunders@hku.hk
Despite the considerable taxonomic diversity of the Annonaceae, floral structure in the family is
remarkably uniform in its underlying ‘Bauplan’: Annonaceae flowers are characterised by three
perianth whorls (sepals, outer petals and inner petals), with three organs per whorl; and a floral
vascular system in which the traces feeding the perianth organs are basally fused. The Annonaceae are
of particular phylogenetic interest as they show several apomorphic characteristics, including a
differentiated (dipartite) perianth of distinct sepals and petals, which is hypothesised to have evolved
independently from that of eudicots. Important evolutionary changes in perianth morphology within
the Annonaceae include: the origin of a dipartite corolla, with morphologically distinct outer and inner
petals; the origin of partially enclosed pollination chambers; the compression of two perianth whorls
into one; the gain or loss of a perianth whorl; and changes in perianth organ identity. Many of these
changes have occurred in parallel on multiple occasions, suggesting that they either provide a major
selective advantage (e.g., affecting pollination ecology or breeding system), or else that they are the
consequence of common causal explanations. The latter is possibly due to the disruption of the
homeotic control of organ identity during floral development, involving MADS-box genes.
Evolutionary relationships among main lineages of the Annonaceae have become much clear in recent
years. The still poorly resolved phylogeny of tribe Miliuseae (subfamily Malmeoideae), however,
represents the largest impediment to understanding broad-scale evolutionary patterns within the
family. The Miliuseae comprises 25 genera and 510 species of trees and shrubs with a centre of
diversity in South East Asia, although the presence of small Central American and African clades
raise questions about its origin. The most recent molecular phylogeny of the Miliuseae distinguished
20 well-supported clades based on chloroplast DNA regions. Relationships among the major clades
were not supported, and the backbone of the phylogeny remains unresolved. Next-generation
sequencing was used to sequence entire chloroplast genomes for 18 Miliuseae species, representing
major clades recovered in previous phylogenies to improve the phylogenetic resolution within the
tribe and to test biogeographical hypotheses. The complete chloroplast sequence is reported for first
time in the Annonaceae. A large inversion in the large single copy (LSC) region of the chloroplast
was detected for all members of the Miliuseae. Preliminary data suggest that the use of full
chloroplast genome alignments increases the number of informative sites and phylogenetic support in
deeper nodes of the phylogeny.
Keywords: Annonaceae, Next generation sequencing, phylogenomics, South-East Asia
Both intrinsic and environmental factors may result in changes in diversificationratein a lineage.
Significant shifts in evolutionary tempo, including rapid evolutionary radiation, are of particular
interest as they are key to understanding how factors such as the timing of diversifications, species
attributes, environmental conditions and the size and complexity of geographical regions have shaped
The circumscription of the species-rich genus Polyalthia (Annonaceae, with ca. 155 species) has long
been recognised to be highly problematic: as previously circumscribed, the genus was a
morphologically heterogeneous assemblage lacking conspicuous synapomorphies, and was one of the
most significant impediments to revisionary and floristic taxonomic research in the family. Recent
molecular phylogenetic analyses have confirmed that Polyalthia is polyphyletic. A broader taxonomic
sampling of Polyalthia species and associated taxa is included in the present phylogenetic analyses to
enable the recognition of monophyletic genera with clearly defined diagnostic morphological
characters. Bayesian, maximum parsimony and maximum likelihood analyses of chloroplast matK,
rbcL and trnL-F sequences consistently gave congruent topologies, with Polyalthia species distributed
in four well-supported clades. Based on molecular and morphological data, existing Polyalthia
species are classified into the following four genera: (1) Hubera: a newly established genus consists
of 27 Polyalthia species; (2) Marsypopetalum: six species, following the transfer of five Polyalthia
species; (3) Monoon: a revived generic name with 56 species, following the transfer of 37 Polyalthia
species, 18 Enicosanthum species, and Woodiellantha sympetala; and (4) Polyalthia s.str.: ca. 86
species, following the transfer of 11 Haplostichanthus species.
Keywords: Annonaceae, Enicosanthum, Haplostichanthus, Hubera, Monoon, Polyalthia,
polyphyletic, Woodiellantha
Session 1
BEGONIACEAE & GESNERIACEAE 1
Convener: Mark Hughes, Herbarium Edinburgh & Deden Girmansyah, Research
Center for Biologi, LIPI
Chairperson: Mark Hughes, Herbarium Edinburgh
Venue: New Guinea Room
11.15 – 11.30 Julia Sang: Diversity of Begonia (Begoniaceae) in Borneo – how many species
are there?
11.45 – 12.00 Wisnu Ardi et al.: Studies on Begonia (Begoniaceae) from the Moluccas
12.00 – 12.15 Harry Wiriadinata & Deden Girmansyah: Notes on Begonia of the Lesser Sunda
Islands
12.15 – 12.30 Chan Yoke Mui: Begonias of Peninsular Malaysia – the lesser known aspects of
reproductive ecology and population dynamics
of un-named Begonia specimens in local herbaria that represent new species, and there are large areas
of Borneo that remain unexplored. In view of the current state of knowledge of habitat diversity and
distribution, the possible size of the Bornean Begonia flora will be discussed.
Keywords: Begonia, diversity, Sarawak, Borneo
Girmansyah, D.
Herbarium Bogoriense, Research Center for Biology, Bogor, Indonesia
e-mail: deden_bo@yahoo.com
The most recent published account of Begonia from Java (Backer & Bakhuizenv.d. Brink Jr.,1968)
recorded 10 native species. Revision by the author shows that this total should be 14, based on
correcting erroneous records, re-instating 3 synonyms to accepted species, 1 new record and 1new
species. Begonia lepida, B. vuijckii and B. repanda are now considered accepted species, having
previously been synonymised with B. bracteata, B. mollis and B. isoptera respectively. Begonia
atricha Miq.was previously recorded only from Sumatra, but specimens from Java have been found.
Begonia hunteriana Girm. sp. nov. is described from Ubrug Waterfall in West Java. Additionally, one
new variety is proposed, Begonia isoptera var. angustifolia (Blume) Girm. Both the new variety and
new species are described and illustrated. Full typification, taxonomic notes and a key to the
identification of the Javanese species are presented. The typification of B. isoptera Dryand is
discussed and an epitype designated. The distribution and ecology of all species will be described.
Keywords: Begonia, Java, Indonesia
Ardi, W.H.*1, Thomas, D.C.2, Ardaka, I.M.3, Kusuma, Y.W.C.1 & Abdo, M.E.4
1
Bogor Botanic Garden, Jl. Ir. H. Juanda No. 13, Bogor, Indonesia
2
Naturalis Biodiversity Center, Leiden, P.O. Box 9514, 2300 RA Leiden, the Netherlands
3
Bali Botanic Garden, Candikuning, Baturiti, Tabanan 82191, Indonesia
4
Florida International University, Dept. of Biological Sciences, 11200 SW 8th St., Miami, FL, 33199, USA
*e-mail: wisn001@lipi.go.id
The Begonia flora of the Indonesian archipelago of the Moluccas is poorly known. Since the
description of B. holosericea (Teijsm. & Binn.) Teijsm. & Binn. c. 150 years ago only one other
endemic Moluccan Begonia species has been described: Begonia sageaensis Wiriad. Only six species
of Begonia have been reported from the islands altogether, but this is certainly a vast underestimate.
The six species reported from the Moluccas comprise two endemic Moluccan species, Begonia
holosericea and B. sageaensis, as well as the more widely distributed B. aptera Blume, which also
occurs on Sulawesi, and three closely related species (B. brachybotrys Merr. & L.M.Perry, B.
pseudolateralis Warb., and B. rieckei Warb.) in the Begonia reickei species complex, which shows a
wide distribution in Malesia east of Huxley’s Line. Botanical expeditions from Bali Botanic Garden to
Seram in 2009 and 2010 and joint expeditions from Bogor Botanic Garden and Fairchild Tropical
Botanic Garden to Halmahera have brought in a total 16 species, of which 13 are putatively identified
as new to science.
Keywords: Begonia, new species, Moluccas
The Lesser Sunda Islands (LSI) to the east of Java are an archipelago composed of Bali, Lombok,
Sumbawa, Flores, Sumba, Timor and many smaller satellite islands. An initial inventory of the
Begonia of the LSI recorded 7 species (Hughes,2008), with 8 eight species sharing their distribution
with Java and one species, B. timorensis, being endemic. Recent botanical exploration in LSI reveals
that there are many new species still to be found: 3 species in Bali and 2 species in Lombok have
recently been published. Two species from West Sumbawa, 2 species from Flores and 2 species from
Sumba are currently being prepared for publication. The discovery of thesenew species on the various
islands and habitats of LSI those holds a lot of potential for giving biogeographic insights into the
evolution of the flora of the archipelago.
Keywords: Begonia, biogeographic, archipelago
Mui, C.Y.
Forest Biodiversity Division, Forest Research Institute Malaysia, Malaysia.
e-mail: yokemui@frim.gov.my
Begonia is one of the biggest genera of Angiosperm with over 1,600 species worldwide. Recent
advances have been made in terms of phylogenetic and systematic research on the genus, but there is
a paucity of knowledge concerning reproductive ecology and population dynamics. As Begonia has
both widely and narrowly distributed species, it is an excellent model for understanding speciation
processes and the causes of rarity. In Peninsular Malaysia, we have initiated studies on the phenology
and demography of three rare and threatened species. Begonia aequilateralis, B. herveyana and B.
tampinica showed continuous flowering and fruiting in their populations. Demographic monitoring
for four to five years showed stable population growth with minor fluctuations in recruitment. We are
now extending the study into population genetics and incorporating a comparison of a widespread and
a rare congener.
Keywords: Begoniaceae, demography, phenology, reproductive biology
Session 1
ZINGIBERACEAE-1
Convener: Jana Leong-Skornickova, Singapore Botanical Gardens & Marlina Ardiyani,
Research Center for Biologi, LIPI
Chairperson: Axel D Poulsen, Natural History Museum, University of Oslo
Venue: Sumatera Room
11.15 – 11.30 Mark Newman & Jane Droop: Towards a new revision of the Zingiberaceae of
Malesia
11.45 – 12.00 Lim Chong Keat: Taxonomic uncertainties in Zingiberaceae: some examples in
the genera Alpinia and Zingiber
The only revision of the Zingiberaceae of Malesia forms part of a world-wide revision in Das
Pflanzenreich, dating from 1904. Since then some regional accounts have appeared, such as the
Zingiberaceae of the Malay Peninsula, and Zingiberaceae of Java. In 2004, a Checklist of the
Zingiberaceae of Malesia was published and, more recently, revisions of Etlingera in Borneo and
Sulawesi. No single taxonomist will revise the Zingiberaceae in an area as large as Malesia so the task
must be broken into manageable pieces to be fitted together later. The example of Amomum in
Sumatra shows how this may be done.
Keywords: Zingiberaceae, Amomum, Sumatra, cooperation, regional accounts
Ardiyani, M.
Herbarium Bogoriense, Research Center for Biology, Indonesian Institute of Sciences
A small genus Haplochorema K. Schum. (Zingiberaceae) was originally known to consist of five
species and one variety distributed in Borneo, and one species in Sumatra. A recent taxonomic
revision of this genus suggests that H. uniflorum, previously synonymized with H. decus-sylvae by
Valeton, should be treated as a separate species. Haplochorema sumatranum is proposed to be
transferred to Boesenbergia, (Boesenbergia sumatrana (Burkill) M. Ardiyani comb. nov.). Six species
and one variety are therefore recognized now in Haplochorema (H. decus-sylvae, H. extensum, H.
magnum, H. pauciflorum, H. pauciflorum var. bullatum, H. latilabrum and H. uniflorum), at least two
species found in West Kalimantan, however, remain yet to be described. Haplochorema is finally
concluded to be an endemic genus to Borneo.
Keywords: Borneo, endemic, ginger, Sumatra, taxonomy, West Kalimantan, Betung Kerihun
Lim, C.K.
FASc Publisher/Editor: Folia malaysiana, Penang, Malaysia
e-mail: foliamy@foliamy.com
Current research to verify nomenclature of Malaysian Zingiberaceae shows that certain taxa are
likely to be wrongly identified, owing to historical errors or assumptions. The presentation
addresses some of the species that are common to Malaysia and Indonesia. Their taxonomic
redetermination may lead to application of fresh names. In this account findings on selected
Alpinia and Zingiber species are included, e.g. A. assimilis Ridl., A. latilabris Ridl., A.
malaccensis (Burman f.) Roscoe, A. capitellata Jack, Z. gracile Jack and Z. griffithii Baker.
Keywords: Alpinia, taxonomy, Zingiber, Zingiberaceae
Wild gingers are common in the understorey of Malesian forests. In addition, many species are useful
as food, medicine or have a potential as ornamentals. At the same time, very little attention has been
made to sort out their taxonomy and clarify their distribution in New Guinea and nearby islands.
Currently at least 200 species and eight genera of Zingiberaceaeare known from New Guinea but new
fieldwork, molecular-based generic circumscriptions and subsequent revisions are likely to increase
the numbers. The majority of the species are endemic or at least confined to areas east of Wallace’s
Line. In the presentation we will focus on the genera Etlingera and Pleuranthodium to exemplify
challenges in achieving the goal of providing a complete account for New Guinea.
Keywords: biogeography, ground herbs, inventory, Papua, species richness, taxonomy, understorey,
Wallace’s Line, Zingiberaceae
Leong-Škorničková, J.*, Khew, G., Gowda, V., Thame, A. & Seah, K.T.
The Herbarium, Singapore Botanic Gardens, Singapore
*e-mail: jana_skornickova@seznam.cz
According to Singapore Checklist, 121 ginger species (sensu Zingiberales) were recorded from
Singapore. However, only 26 species are considered to be native, with 11 species being assigned
status of Presumed Nationally Extinct, and remaining species placed in Critically Endangered,
Endangered or Vulnerable categories. Since January 2011, over 40 surveys of nature reserves and
forested areas have been made with an objective to localise and closely monitor populations of the
remaining native species. The ex situ and in vitro approaches have been employed to propagate
materials for trial re-introductions. So far, 12 species in 6 Nature Reserves and Nature Parks were
involved in trials, while larger scale introductions are under way. Preliminary results from our
observations suggests that bees, flies and birds are engaged in pollination, while rodents and monkeys
facilitate seed dispersal. Numerous Zingiberalean species native to S. America and Africa have been
introduced to Singapore and heavily employed in streetscape greenery. As we have observed, some of
these species easily naturalize, exhibit the behaviour of invasive plants and compete with native
species. Further studies to understand the reproductive biology, combined with active management
approach, is necessary to control the distribution of non-native species in forested areas.
Keywords: Costaceae, Marantaceae, invasive, IUCN categories, native, re-introductions,
Singapore, Zingiberaceae
Session 1
ARECACEAE-1
Convener: Lauren Gardiner, Royal Botanic Gardens Kew & Himmah Rustiami,
Research Center for Biologi, LIPI
Chairperson: Lauren Gardiner, Royal Botanic Gardens Kew
Venue: Sulawesi Room
11.30 – 11.45 John Dransfield & William J Baker: Calamus in New Guinea
12.00 – 12.15 Zumaidar et al.: Salacca acehensis (Arecaceae), A new species from Sumatra,
Indonesia
12.15 – 12.30 Revis Asra et al.: Genetic diversity of threatened species Daemonorops draco
using ISSR markers
Baker, W.J.1, Dransfield, J.1, Gardiner, L.*1, Heatubun, C.D.2, Maturbongs, R.2, Banka, R.3,
Barfod, A.4, Dowe, J.5 & Zona, S.6
1
Royal Botanic Gardens, Kew, United Kingdom; 2Universitas Negeri Papua, Indonesia
3
PNG Forest Research Institute, Papua New Guinea; 4University of Aarhus, Denmark
5
James Cook University, Australia; 6Florida International University, USA
*e-mail: l.gardiner@kew.org
New Guinea is the largest tropical island in the world and the last remaining “black hole” in our
knowledge of global palm diversity. Currently, 34 genera and ca. 250 species are recognised from the
island. This highly endemic species richness is rivalled only by the slightly smaller island of Borneo
(ca. 300 species). However, rates of discovery of new species in New Guinea are high, and may result
in known diversity rising well beyond current estimates. A project to discover, document and describe
the palms of New Guinea was initiated in the late 1990s, drawing in partners from across the globe,
including Indonesia and Papua New Guinea. While the core product, a regional monograph of the
island’s palms, is yet to be produced, numerous taxonomic outputs have been delivered (specimens,
monographs, new species, field guides) and important capacity building has taken place (e.g.
postgraduate training, infrastructural investment). This talk will summarise the current status and
future plans of the Palms of New Guinea project, and will highlight some of the many exciting
discoveries that have been made, for example in rattans, arecoid and coryphoid genera.
Keywords: floristic, monograph, New Guinea, palms, Papua, revision
Calamus, the largest palm genus, is represented in New Guinea by three subgeneric groups. These
groups, based on morphological characters and not fully corroborated with molecular data, are Section
Calamus, Section Phyllanthectus and Section Podocephalus. Within section Calamus there is
substantial variation and several discrete groupings are recognisable, defined by unusual characters
rare elsewhere in the genus. In particular, the ocrea (an extension of the leaf sheath beyond the base of
the petiole) is spectacularly elaborated in some species. In our work towards the account of the genus
for the Palms of New Guinea project, we have recognised 55 taxa. Of the 57 accepted names
recognised before we began our work, eighteen are now included in synonymy, twenty-seven are
accepted and twelve remain incertaesedis; these last are, for the most part, taxa described by Burret
where types were destroyed during the bombing of the Berlin herbarium during the second World
War. In all we have described and named 21 new species, seven already published and 16 in
preparation. We have found the interpretation of variation among the higher montane species
particularly challenging but we have taken a broad approach, with the resulting taxa generally having
good geographic integrity. In this presentation, the astonishing variation in the genus will be
highlighted.
Keywords: Arecaceae, Palmae, rattans, Calamus, Papuasia
Calamus in Sulawesi
Rustiami, H.
Herbarium Bogoriense, Botany Division, Research Center for Biology,
Indonesian Institute of Sciences, Indonesia
A revision of the rattans of Sulawesi was initiated in 2006. The aim was to develop an improved
taxonomy and simultaneously gather information on aspects such as habitat, uses and vernacular
names, to act as an essential basic resource for assessing the conservation status of rattans in Sulawesi
and to safeguard their future as an invaluable non-timber forest product. As a result of the revision
twenty nine species of Calamus are recognized as occurring in Sulawesi with four described as new.
Twenty seven species were recognised by previous authors; however, in this study one species was
treated as a synonym, twenty three species recognised and three species excluded. Several of the
groups recognized by Beccari in his monographs of Calamus are represented in Sulawesi: Group V,
Group XII, Group XIII, Group XIV, and Group XV. His groupings are mainly based on the presence
or absence of a cirrus and a flagellum, armature of the leaf sheath and the structure of inflorescence.
Kramadibrata and Dransfield added two groups – Groups XVII for species which have vestigial
flagella and Group XVIII for Calamus inopsand its relatives. The diversity of Calamus in Sulawesi
will be discussed in this paper.
Keywords: Calamus, Indonesia, rattan, revision, Sulawesi
Zumaidar*1,2, Chikmawati, T. 3, Hartana, A.3, Sobir4, Mogea, J.P.5 & Borchsenius, F.6
1
Plant Biology Graduate Program, Department of Biology, Faculty of Mathematics and Natural Sciences, Bogor
Agricultural University, Indonesia
2
Departement of Biology, Mathematics and Sciences Faculty, Syiah Kuala University, Indonesia
3
Department of Biology, Faculty of Mathematics & Natural Sciences, Bogor Agricultural University, Indonesia
4
Department Agronomy and Horticulture, BogorAgricultural University, Indonesia
5
Herbarium Bogoriense, Botany Division, Research Center for Biology, Indonesian Institute of Sciences,
Indonesia.
6
Science Museums, Aarhus University, Denmark
e-mail: zumaidar@yahoo.com*/ tchikmawati@yahoo.com/ ahartana@indo.net.id/ sobir@ipb.ac.id
finn.borchsenius@biology.au.dk
A study on Indonesian salak (Salacca spp.) has been undertaken, including cultivated and wild salak
material. At present, genus Salacca consists of 22 species in the world, however Indonesia has only 6
species i.e. Salacca sumatrana, S. zalacca, S. affinis, S. dransfieldii, S. vermicularis and S.
wallichiana. The last of these species is only known from the wild, so this study is focused on the
wild and cultivated S. sumatrana and S. zalacca. S. sumatrana is the endemic species of Sumatra,
while S. zalacca is widely distributed from Java, Sumatra, Kalimantan, Sulawesi, Bali, and Ambon.
During this study it is found that S. zalacca has more than 10 cultivars. To study the genetic diversity
of both wild and cultivated S. sumatrana and S. zalacca, AFLP techniques were applied. The analysis
of this study is underway, and it is expected that an illustration of the genetic diversity for all cultivars
can be drawn. Based on the above study, a new wild species was found amongst the specimens which
were named as S. acehensis. These specimens were firstly saw by Mogea and identified as S.
acehensis in 1975, but it never been validly published, so the name is ‘nomennudem’. Therefore, this
wild species is proposed and published as S. acehensis Mogea & Zumaidar. Based on the
morphological characters, this species is closely related to S. rupicola. The differences of both species
will be presented. Further study on the similarity of S. acehensis and S. rupicola need to be continued
both compared with other species of Malesian region.
Keywords: Salacca spp., S. acehensis, new species
The analysis of the genetic diversity in five populations of the Dragon’s Blood (Daemonorops draco
(Willd.) Blume) has been applied by Inter Simple Sequence Repeat (ISSR) markers. The screening
results from 15 ISSR primers are 5 of ISSR primers showed the clear and reproducible bands. It is
based on the result of the data from the matrix binary that has been analyzed with POPGENE version
3.2, the highest number of the Genetic Diversity in Sepintun’s population obtained 0.0969 average
heterozygosis (H) and 0.146 average Shannon Index (I). The heterozygosis calculation of the total
population (HT) is 0.2571. The heterozygosis values within population (HS=0.0704) is smaller than
heterozygosis value between populations (DST=0.1867). By using clustering analysis program Past
version 32 to 43 individuals of D. draco are found that there are three groups of the D. draco. Group A
consists of 8 individuals in the Bengayoan’s population, group B consists of 9 units in the Nunusan’s
population and group C consists of three populations; Tebo, Sepintun and Mandiangin that consist of
10, 8 and 8 individuals. The genetic similarity varied among all populations is between 0.07-0.93.
Keywords: Daemonorops draco, genetic diversity, ISSR markers.
Session 2
TAXONOMY & SYSTEMATICS-2
Convener: Rugayah, Research Center for Biologi, LIPI
Chairperson: Richard Saunders, The University of Hong Kong
Venue: Borneo Room
13.30 – 13.45 T Chaowasku et al.: Molecular phylogenetics of the tribe Miliuseae: insights into
generic delimitations and character evolution
13.45 – 14.00 Pui Sze Li et al.: Generic monophyly of Disepalum (Annonaceae): Correlating
changes in floral morphology with changes in pollination system in Disepalum
14.00 – 14.15 Jasper JA Obico & Grecebio JD Alejandro: Molecular phylogeny of the
Philippine endemic genus Antherostele Bremek. (Rubiaceae) inferred from ITS
data (nrDNA) and its conservation status
14.15 – 14.30 Grecebio JD Alejandro: Molecular phylogeny and taxonomic revision of the
Philippine endemic Villaria Rolfe (Rubiaceae): An update
14.30 – 14.45 Lyn ED Rosa-Paraguison et al.: Two additional genera in Philippine Rubiaceae
from Canthium sensu lato & a new species of Psydrax: evidence from molecular
& morphological data
14.45 – 15.00 Ong Poh Teck: A fruit fly pest as pollinator of Bulbophyllum praetervisum
Chaowasku, T.1,5, Van der Ham, R.W.J.M.1, Smets, E.F.1,3, Mols, J.B.1,
Chatrou, L.W.4 & Thomas, D.C.1,2
1
Naturalis Biodiversity Center (section NHN), LeidenUniversity, The Netherlands
2
School of Biological Sciences, University of Hong Kong, P.R. China
3
Laboratory of Plant Systematics, K. U. Leuven, Belgium
4
Biosystematics group,Wageningen University, The Netherlands
5
Present address: Department of Biology, Faculty of Science, Chiang Mai University, Thailand
Miliuseae (c. 510 species in c. 25 genera) are the largest tribe in the subfamily Malmeoideae, one of
the four subfamilies recently recognized within Annonaceae, and constitute a substantial part of
diversity in the family. The intergeneric relationships within Miliuseae, however, have been very
poorly resolved. In the present study we use seven plastid markers (rbcL exon, trnL intron, trnL-F
spacer, matK exon, ndhF exon, psbA-trnH spacer, and ycf1 exon) constituting c. 7 kb to resolve the
intergeneric relationships and clarify generic delimitations within Miliuseae, as well as understand
patterns of character evolution occurred in this tribe. The results support the establishments of two
new genera, Hubera (segregated from the polyphyletic Polyalthia) and Winitia (segregated from
Stelechocarpus). Besides macromorphology, pollen morphology (especially the different infratectal
types: (a) more or less columellate/coarsely granular or (b) finely and densely granular) also plays an
important role in circum scribing the two new genera. All genera in Miliuseae having two or more
species included in the phylogenetic analyses are monophyletic with strong support except Desmopsis,
which is recovered as paraphyletic with Stenanona nested within. The ancestral character
reconstructions of several generative characters (petal shape and size, maximum ovule number per
ovary, endosperm rumination types, flower sexuality, pollen dispersal unit, pollen infratectal types),
which are generally diagnostically important at generic level, indicate considerable degrees of
homoplasy and thus limited utility for subtribal recognition. Despite c. 7 kb of chloroplast DNAused,
the backbone phylogeny of Miliuseae is still mostly poorly supported, necessitating more DNA
regions (chloroplast or nuclear) with higher rate of evolution.
Keywords: Annonaceae, character evolution, generic delimitations, Malmeoideae, Miliuseae,
molecular phylogenetics, new genera
A taxonomic opinion regarding the delimitation of Disepalum (Annonaceae) has been divided it into:
Disepalum s.l. (characterised by pollen octads and monocarps borne on a ‘carpophore’); and
Disepalum s.str. (restricted to those species with a calyx of only two sepals and a fused corolla).
Three excluded species with typical trimerous floral structure have been placed to another genus
Enicosanthellum. Phylogeny of Disepalum s.l. and its related taxa as a framework have been
reconstructed to clarify the generic delimitation and to test the hypotheses regarding morphological
character evolution and putative shifts of pollination system. Maximum parsimony, maximum
likelihood and Bayesian methods based on sequences of chloroplast regions were used. A well-
resolved and strongly supported topology was resulted that retrieved Disepalum s.str. and
Enicosanthellum as a sister groups. Although this topology is consistent with both the narrow and
broad delimitations of Disepalum, the distribution of morphological synapomorphies provides greater
support to the inclusion of Enicosanthellum within Disepalum s.l. To investigate whether the
morphological changes were possibly adaptive, characters of particular functional importance were
mapped onto the phylogeny using a parsimony approach. Pollination studies on representatives of
each clade are being undertaken to investigate evolutionary shifts of pollination system, and to test
congruency with floral morphology.
Keywords: Annonaceae, Disepalum, phylogeny, floral morphology, synapomorphy, pollination
system
Alejandro, G.J.D.
College of Science, Research Centre for the Natural & Applied Sciences, and The Graduate School, University
of Santo Tomas, Philippines
e-mail: gdalejandro@mnl.ust.edu.ph
The genus Villaria (Rubiaceae) is endemic to the Philippines. Traditionally, it has been placed in the
tribe Gardenieae and later transferred to Octotropideae sensu Robbrecht and Puff. Villaria was placed
among the ‘‘primitive’’ genera of the tribe, characterized by large fruits, horizontal ovules and
numerous seeds. Parsimony and Bayesian analyses of the combined plastid (rps16 and trnT–F)
dataset strongly support the monophyly of Villaria and its placement in Octotropideae. However, the
phylogeny does not confirm the current informal groups in the tribe based on fruit size, ovule position,
number of seeds and exotesta thickenings. Instead, a close relationship between Villaria and two
‘‘central genera’’ (Hypobathrum and Pouchetia) is revealed for the first time. This clade is sister to a
group comprising ‘‘primitive’’ (Fernelia), ‘‘advanced’’ (Kraussia and Polysphaeria) and ‘‘central’’
(Feretia) representatives. Villaria is characterized by unilocular ovaries, parietal placentation and
strictly horizontal ovules, a unique combination in Octotropideae. Diagnostic features of the genus
should be reviewed in light of two unresolved “Randia” species (R. lanceolata and R. stenophylla)
with bilocular ovaries. Analyses of these two “Randia” species using plastid markers show them
nested within the Villaria clade. We also propose a new species (Villaria uniflora Arriola &
Alejandro) distinguished by uniflorous inflorescences, infundibuliform calyx tube, triangular-ovate
calyx lobes, and lanceolate stigmatic lobes. We recognize a total of eight Villaria species.
Keywords: Ixoroideae, Octotropideae, Philippines, rps16 intron, Rubiaceae, trnT–F region, Villaria
Recent molecular and morphological revisions on the highly heterogenous Canthium Lam.
(Vanguerieae), restricted the genus to taxa with supra-axillary spines. The absence of this character
lead to the segregation of the satellite genera Keetia, Pyrostria, Pysdrax, Cyclophyllum and
Afrocanthium. None of the published studies included endemic Philippine species of Canthium. This
raises questions on the generic affinity of Philippine Canthium species since the majority of them are
without supraaxillary spines. In the current study, three Philippine Canthium spp. were collected.
Genomic DNA was extracted, amplified using specific nrDNA and cpDNA markers, sequenced and
aligned with related sequences from GenBank. Cladistic analysis was done using Bayesian inference.
The majority rule consensus tree revealed a well-supported Vanguerieae (PP=1.0). As expected, the
three Philippine Canthium spp. did not group with Canthium sensu stricto. Instead, Canthium wenzelii
nested within Keetia (PP= 0.81), Canthium ramosii with Pyrostria (PP = 0.65), and a probable new
species nested with Psydrax (PP= 0.93). Our molecular results are supported by morphological
features present in the three species. This is the first report of the presence of Keetia, Pyrostria and
Psydrax in the Philippines.
Keywords: ITS, cpDNA, nDNA, Canthium, trnl-F, Vanguerieae
Teck, O.P.
Forest Research Institute Malaysia
e-mail: ongpohteck@frim.gov.my
Six fruit fly species from the genus Bactrocera namely B. caudata, B. cucurbitae, B. dorsalis, B.
hochii, B. tau and B.sp (dorsalis complex) were observed to have visited flowers of Bulbophyllum
praetervisum in Peninsular Malaysia. Bactrocera cucurbitae has been confirmed as a pollinator in
which evidence of this fruit fly species pollinating flowers of Bulbophyllum praetervisum have been
photographed and videoed. A hint that flower of Bulbophyllum praetervisum produces zingerone was
based on the observation of the fruit fly groups (e.g. methyl eugenol-sensitive fruit flies or raspberry
ketone-sensitive fruit flies) that visited the flower. Analyzing the chemical profile of Bulbophyllum
praetervisum flower and comparing the profile to Bulbophyllum patens, a species known to produce
zingerone, further strengthened this hypothesis.
Keywords: Bulbophyllum praetervisum, Bactrocera, fruit fly, pollination
Session 2
BEGONIACEAE & GESNERIACEAE-2
Convener: Mark Hughes, Royal Botanic Gardens Edinburg & Deden Girmansyah,
Research Center for Biologi, LIPI (Begoniaceae)
Ruth Kiew, FRIM & Abdulrokhman Kertonegoro, Research Center for Biologi, LIPI
(Gesneriaceae)
Chairperson: Ruth Kiew, FRIM
Venue: New Guinea Room
13.30 – 13.45 Mark Hughes et al.: The impact of tectonics and typhoons on the colonisation of
the Philippine archipelago by Begonia
13.45 – 14.00 Rosario R Rubite et al.: Evidence for a novel natural Begonia hybrid from Panay
Island, the Philippines
14.00 – 14.15 Ching-I Peng & Yoshiko Kono: Cytological investigations in the genus Begonia
(Begoniaceae)
14.15 – 14.30 Rafidah A Rahman & Ruth Kiew: Towards a revision of Monophyllaea
(Gesneriaceae) from Peninsular Malaysia
14.30 – 14.45 Carmen Puglisi: Phylogenetic studies in the Old World Gesneriaceae: the Boea
group
14.45 – 15.00 Lim Chung Lu & Ruth Kiew.: Sections in Codonoboea – the Peninsular
Malaysian Scenario
Hughes, M.*1, Rubite, R.2, Blanc, P.3, Thomas, D.4 & Peng, C.I.5
1
Royal Botanic Garden Edinburgh, UK
2
University of the Philippines Manila,Padre Faura, Manila, Philippines
3
National Centre for Scientific Research, Paris, France
4
Naturalis Biodiversity Centre, Leiden, The Netherlands
5
Herbarium, Biodiversity Research Centre, Academia Sinica, Taiwan
*e-mail: m.hughes@rbge.ac.uk
Begonia is a mega-diverse genus and has a hotspot of diversity in Malesia. The Malesian region is
heterogenous in terms of the occurrence of large cyclonic weather systems, which are absent from a
ca. 4 degree region north and south of the equator. The Philippines experiences a succession of
tropical cyclones from June to October, some of which bring extremely high winds and engulf the
entire archipelago. In contrast equatorial Sulawesi is never directly exposed to high-energy cyclonic
systems and sustained high winds are rare. The dust-like seeds of Begonia are potentially wind-
dispersed, although current phylogenies of the genus show a dearth of long-distance dispersal events.
Here two dated phylogenies of Begonia are compared, one from the Philippine archipelago and one
from Sulawesi, and contrasting signals of dispersal looked for. The potential for weather patterns to
shape wider patterns of biodiversity within the tropics will be discussed.
Keywords: Begonia, biogeography, Philippines, dispersal
Rubite, R.R.*1, Hughes, M.2, Alejandro, G.J.D.3 , Macabasco, J.V.1, Talana, A.D.1, Kono, Y.4,
Nakamura, K.4 & Peng, C.I.4
1
University of the Philippines Manila, Department of Biology, College of Arts and Sciences, Philippines
2
Royal Botanic Garden Edinburgh, U.K.
3
College of Science and Research Centre for the Natural and Applied Sciences, University of Santo Tomas,
Philippines.
4
Biodiversity Research Center, Academia Sinica, Taiwan.
*e-mail: rosariorubite@yahoo.com
Begonia is a mega-diverse genus and is an ideal model for examining modes of speciation in the
tropics. In the Philippines, many Begonia species are narrow endemics, in particular those restricted to
forest on limestone. However, a small number have wider distributions which increase the potential
for contact between species. Here we report the first account of Philippine Begonia hybridization in
the wild from Bulabog Puti-an Natural Park in Dingle, Iloilo Province, Panay Island. A population
with novel morphology was found growing on moist, coralline slopes at 200 m elevation. Based on a
comparison of morphology, cytology and molecular evidence, we conclude that the Begonia
population represents progeny from natural hybridization between Begonia copelandii Merr. and
Begonia rhombicarpa A. DC.
Keywords: Begonia, natural hybrid, Begonia hybrid, Philippine, Begonia hybridization
The genus Begonia, comprising ca. 1,600 species classified in 66 sections, ranks the 6th largest genus
of flowering plants in the world. In this study we report the chromosome number of over 200 species
of Begonia, mainly from Asia, but also from America and Africa, that are in cultivation in the
experimental greenhouses of Academia Sinica, Taiwan. Our results showed that somatic chromosome
numbers of Begonia range from 2n = 14, 16, 18, 20, 22, 24, 26, 28, 30, 31, 32, 33, 34, 36, 38, 40, 41,
44, 45, 49, 52, 60, 64, 76 to 82. We also report case studies in which natural hybridizations were
documented in part by cytological information, e.g. chromosome number, meiosis, karyotype, and
genomic in situ hybridization (GISH). The original basic chromosome number of Begoniaceae may
be X = 11 and that dysploidization, polyploidization and hybridization play major roles in their
evolution.
Keywords: Begonia, chromosome number, natural hybridization
Seven species and two varieties of Monophyllaea are reported from Peninsular Malaysia of which six
are endemic. Recent field work has enabled the status of the species and varieties to be re-evaluated
and provided more data on the habitats and distribution. This paper provides an overview of
Puglisi, C.
Royal Botanic Garden Edinburgh
e-mail: C.Puglisi@rbge.ac.uk
Since it was first published in 1785 many additional species have been ascribed to the genus Boea
Comm. ex Lam. As the genus grew in size, it also grew in morphological diversity until it was
recircumscribed by Burtt (Notes Roy. Bot. Gard. Edinburgh 41(3): 401-452. 1984). Burtt and other
authors (e.g. Kiew, Weber and Burtt, Beitr. Biol. Pflanzen 70(2-3): 383-403. 1997) also established a
number of new segregate genera. Today, the Boea group (i.e. Boea, the segregate genera and other
close relatives) comprises over 200 species in some 15 genera, found from China to Australia and
throughout Malesia from Sumatra to the Solomon Islands. Previous molecular studies suggested a
much more complex structure to the clade than previously thought. Here we present the most up to
date phylogeny, generated using one nuclear and two chloroplast markers and covering all genera
known to belong to the Boea group. Our results highlight important discrepancies between the current
taxonomy of the group and the inferred phylogeny. In an attempt to establish a natural classification
of Boea and its allies, possible changes in the generic delimitations are proposed.
Keywords: Gesneriaceae, Boea group, phylogeny, ITS, trnL-trnL-trnF, ndhF-rpl32-trnLuag
Codonoboea, the largest genus of Gesneriaceae in Peninsular Malaysia with 88 species, is variable in
habit and morphology of the leaf, inflorescence including bracts, corolla, nectary, stigma and fruit. To
make sense of this diversity and to aid identification, sections have been proposed to group together
species with similar morphology. Sectional names first proposed when Codonoboea species were
included in Didymocarpus are Boeopsis, Codonoboea, Didymanthus, Heteroboea,
Pectinati, Reptantes, Salicini and Venusti, with Glossadenia, being added after these species were
transferred to Henckelia. A preliminary molecular phylogenetic study using ITS and TrnL-
F sequences indicates that most of these sections are paraphyletic. The pros and cons of
grouping Codonoboea species and recognising sections will be discussed.
Keywords: Gesneriaceae, Codonoboea, section, Peninsular Malaysia.
Session 2
ZINGIBERACEAE-2 & GENERAL TAXA
Convener: Jana Leong-Skornickova, Singapore Botanic Gardens & Marlina Ardiyani,
Research Center for Biologi, LIPI
Chairperson: Marlina Ardiyani, , Research Center for Biologi, LIPI
Venue: Sumatera Room
13.30 – 13.45 J Leong-Skornickova & Vinita Gowda: Pollinator diversity and pollination
biology of native gingers of Singapore
13.45 – 14.00 Florfe M Acma et al.: Phytochemical profile of Amomum muricarpum Elm.
(Zingiberaceae), a Philippine native ginger
14.00 – 14.15 Ina Erlinawati et al.: Study of three genera of Araceae in Indonesia
14.15 – 14.30 Rina Ratnasih et al.: The utilization of DNA markers, rcbL and matK to identify
the population of Amorphophallus in Tanggamus Mountain, Lampung
14.30 – 14.45 Rodiyati et al.: Genetic diversity of Amorphophallus muelleri Blume in Java
based on trnL and LEAFY sequences
14.45 – 15.00 Edward Tsen: A generic revision of the myrmecophylic understory tree genus
Ryparosa (Achariaceae) Blume
Tropical forests are known for hosting unique and diverse plant-pollinator interactions. In this study,
we documented pollinator species and pollination strategies in plants within the order Zingiberales
that are native to Singapore. Out of the 26 native gingers recorded from Singapore, we focused on
eight species that were in flower between April 2012-April 2013: Alpinia aquatica, Amomum
xanthophlebium, Hornstedtia scyphifera, H. conica, H. leonurus, Etlingera elatior, Globba leucantha,
and Stachyphyrinium latifolium. We investigated the following aspects of their pollination biology:
flowering phenology, pollinator species, pollinator visitation rates, floral rewards (nectar and scent),
fruit set, and disperser agents. We recorded a diverse group of insect (bees and flies) and bird
(spiderhunters and sunbirds) pollinators visiting gingers. We found no correlation between nectar
volume and pollinator species (r2 = 0.26, p = 0.43), and floral morphology was not helpful in
predicting their pollinator species (r2 = 0.24, p = 0.45). Fruit sets were significantly low in most
species and were highly correlated to pollinator visitation rates (r2 = 0.86, p = 0.0003). Using camera
traps we identified potential fruit dispersers to be either rodents or large mammals, although in most
instances they were also found to be destructive in their activity.
Keywords: birds, insects, mammals, nectar, plant-pollinator interactions, Zingiberales
The study evaluated the phytochemical profile of Amomum muricarpum Elm., a Philippine indigenous
ginger locally known as ‘tugis’. The qualitative phytochemical screening was performed through
histochemical tests to determine the phytochemical content and its localization in different tissues
including leaves, rhizomes and fruits. Ripe seeds gathered from the wild were planted in the Botanical
Garden of Central Mindanao University, Bukidnon, Philippines. 80% successfully germinated and
produced flowers and fruits 12 months after planting. Phytochemical screenings revealed that the
leaves, rhizomes and fruits contain alkaloids, carbohydrates, arbutin (except on the fruit), amygdalin,
fixed oils and fats, saponins, tannins, and proteins, while tests for flavonoids, gums and mucilages
were negative. Among present phytochemicals, alkaloids and arbutin were unevenly distributed in the
leaf, rhizome and fruit extracts. Fats and oils were present in all tissues of the leaf, rhizome and fruit
pericarp and showed that phytochemicals were mostly localized in vascular bundles in all regions of
the leaf, in the ground tissue and vascular bundles of the rhizome, and in the vascular bundles of the
fruit pericarp. Future research should focus on bioassay aspects and quantitative phytochemical
aspects to harness the full potential of this species, which is locally used for curing stomach disorders.
Keywords: Amomum muricarpum, phytochemicals, histochemical, Zingiberaceae, alkaloids, vascular
bundles
Alocasia, Colocasia and Remusatia are among the genera of the Araceae family which have economic
value, for example as food (Colocasia), medicinal plants (Alocasia), and as ornamental plants
(Alocasia, Remusatia). Those three genera were previously treated as all belong to Tribe Colocasieae.
Most recently Nauheimer et al. (2012), using plastid and nuclear DNA, Alocasia is basally sister to
the Colocasieae+Areae. A total number of 295 specimens deposited in Herbarium Bogoriense (BO),
Singapore Herbarium (SING), Bogor Botanical Garden Herbarium and recent collections collected
from several locations in Indonesia such as Mount Wilis (East Jawa), Mount Watuwila and Natural
Forest Ulungolaka (South East Sulawesi), and Gunung Leuser National Park, Ketambe (Aceh,
Sumatera) were examined using morphologically based cladistics. For these three genera 21 species
are recorded from Indonesia, comprising 17 species of Alocasia, three species of Colocasia, and one
species of Remusatia. The presence of Alocasia flemingiana and Remusatia vivipara on several
islands in Indonesia is newly reported. The grouping some species in the Alocasia clade support
Hay’s 1991 and 1998 groups, although these grouping are not well supported. This study will be
expanded using anatomical data from selected species of those three genera in Indonesia.
Keywords: Colocasieae, Alocasia, Colocasia, Remusatia, Indonesia
Titan arum (Amorphophallus titanum), a member of Araceae family, is endemic to the northern part
of on Sumatera. The spectacular titan arum produces the largest recorded unbranched inflorescence,
which can reach 3.5 metres high. Amorphophallus titanum has two distinctive activity stages. This
research was aimed at using genetic approaches to identify vegetative stages of the population
suspected to be A.titanum within the area of Mount Tanggamus, Lampung. The genetic markers used
in this identification process were rbcL and matK, which are highly conserved regions of chloroplast
DNA. The length of the nucleotide markers was 1281 bp and 1075 bp respectively. The
Amorphophallus that we have investigated, including A. titanum from Botanical Garden Cibodas - are
more closely related to A. decus-silvae than to A. titanum. We also found that the suspected
population from Tanggamus Mountain has similar rbcL and matK sequences to the titan arum from
Cibodas Botanical Garden, although they differed slightly from the titan arum sequence on the
GenBank Database. Further studies must be conducted to validate this result, using more markers.
Keywords: Amorphophallus, rbcL ,matK, Tanggamus, Lampung
This research is to investigate genetic diversity of Amorphophallus muelleri Blume (Porang) in Jawa
based on eight populations from East Java, five populations from Central Java, and one population
from the West Java. Sequences were compared by A. variabilis Blume and A. paeoniifolius (Dennst.)
Nicolson as outgroups. DNA was isolated from young leaves of three plants from each population
and amplified using “c” (CGAAATCGGTAGACGCTACG) and “d”
(GGGGATAGAGGGACTTGAAC) primers for trnL gene region and FLint2 F1
(CTTCCACCTCTACGACCAGTG) and FLint2 R1 (TCTTGGGCTTGTTGATGTAGC) primers for
LEAFY gene region. The PCR products were sequenced using the same set of primers. The
phylogenetic tree retrieved by using Neighbour Joining (NJ), Maximum Parsimony (MP), and
Maximum Likelihood (ML) showed that the populations were grouped to four major clades. Porang,
even is known having apomix seed and commonly reproduces vegetatively, has genetic diversity
within a population or between populations with dissimilarity distances reaching 10%. As a tree
having the highest bootstrap, NJ tree indicated that most porang samples in Java were not clustered
according to their population. It could be caused by seed exchange among populations during porang
cultivation. Based on haplotype analysis, all plant samples from Wonogiri occupied at the branch
nearest the outgroups showed that the wild porang population has not been introduced by seeds from
other populations.
Keywords: Amorphophallus muelleri, Java, Porang, LEAFY, trnL
Tsen, E.
The University of Melbourne, Australia
The 26 currently circumscribed tropical trees in the genus Ryparosa Blume. (Achariaceae) are
distributed throughout both the Oriental and Australasian components of the Malesian bioregion. The
sole Australian species has recently risen to attention as a model organism of research in plant-animal
interactions possessing potent cyanogenic chemical defences and multiple animal mutualisms. The
species delineations throughout much of the genus are poorly resolved due to the difficulty and timing
of capturing male and female floral morphologies in specimen collections and the oversight of key
morphological features of ecophysiological significance. Most notably amongst these newly
discovered characters are the production of ant reward food bodies and stem domatia which
encourage myrmecophylic mutualisms to varying extents between species. This generic revision
combines phenetic techniques of agglomerative classification of morphological and ecophysiological
characters in concert with a phylogeny to resolve specific boundaries. The resolution of this important
taxon is vital to extend the interpretation of the multiple animal interactions and defence traits to a
biogeographical scale.
Keywords: Myrmecophylic, Ryparosa, Achariaceae, animal interactions
Session 2
ARECACEAE 2
Convener: Lauren Gardiner, Royal Botanic Gardens Kew & Himmah Rustiami,
Research Center for Biologi, LIPI
Chairperson: Lauren Gardiner, Royal Botanic Gardens Kew
Venue: Sulawesi Room
13.30 – 13.45 Charlie D Heatubun & William J. Baker: The Palms of Raja Ampat Islands
13.45 – 14.00 Melissa Abdo: Preliminary study of Molluccan palms dispersed by Blyth’s
hornbill
14.00 – 14.15 Sarinah et al.: Palms diversity in five habitat types in Bangka Island, Indonesia
14.15 – 14.30 Rudi A Maturbongs: Biodiversity and spatial distributions of rattans in the
Vogelkop area of West Papua Province, Indonesia: A research proposal
14.30 – 14.45 Dian Latifah et al.: Germination strategies of four palm species: Arenga
australasica, Calamus australis, Hydriastele wendlandiana and Licuala ramsayi
The Raja Ampat Islands north west of Western New Guinea are very interesting from a botanical
point of view, especially in terms of their palm diversity. Based on six botanical explorations to that
area, almost forty palms have been encountered, of which more than ten were endemic and rare,
including one new taxa – which is ambiguously placed in Ptychospermatinae, but it may be described
in the genus Adonidia. The geological history and the present position of the islands could be major
factors for the peculiarities of their palm flora. Although this archipelago in general is associated to
the main island of New Guinea, its palm flora is more like that of the Moluccas.
Keywords: Palms, Taxonomy, Biogeography, New Guinea, Raja Ampat Islands
Abdo, M.E.
Fairchild Tropical Botanic Garden & Florida International University
e-mail: mabdo002@gmail.com
The Indonesian province of North Maluku lies between Sulawesi to the west and Papua to the east,
and the largest island in North Maluku is Halmahera. According to Kew’s World Checklist for
Arecaceae, there are about 46 species of palms that occur in the “botanical country” of Maluku, and at
least half of these are believed to occur on Halmahera. Blyth’s hornbill, Aceros plicatus, is a largely
frugivorous bird that ranges from throughout the Molluccan islands into New Guinea and east into the
Solomon Islands, and is relatively common throughout its range. On Halmahera, A. plicatus occurs in
several habitat types including lowland and montane rainforests, agroforests (or kebun campur), and
ecotonal areas at the margins of cleared landscapes or farmlands and forest edges. A preliminary
study was carried out to understand the role that A. plicatus plays in plant dispersal. Findings indicate
that Blyth’s hornbill is an effective disperser of at least 9 palm species on Halmahera, including palms
from varied habitat types.
Keywords: Seed dispersal, tropical ecology, Halmahera
Sarinah1, Alesti, T.1, Fitri1, Zalia1, Rustiami, H.2 & Nurtjahya, E.3
1
Alumni of Bangka Belitung University, Bangka Belitung, Indonesia
2
Herbarium Bogoriense,Research Center for Biology, Indonesian Institute of Sciences,
Bogor, Indonesia
3
Bangka Belitung University, Bangka Belitung, Indonesia
Palm exploration (Arecaceae) in five habitat types – hilly forest, lowland forest, swampy area,
mangrove and coastal forests – in Bangka Island recorded 56 species from 19 genera, namely Arenga,
Areca,Calamus, Caryota, Cyrtostachys, Daemonorops, Eleiodoxa, Korthalsia, Metroxylon,
Myrialevis, Licuala, Livistona, Nenga, Nypa, Oncosperma, Orania, Pinanga, Plectocomia, and
Plectocomiopsis. This is about 41% of 46 palm genera recorded in Indonesia. Palm species most
commonly found in hilly forest habitat, lowland forest, and rarely found in mangrove area. We found
also Calamus manan. This is a species of palm that has high economic value due to flexibility and
strength. Many people have cultivated this species beside Calamus oxleyanus. Eleiodoxa conferta
with a yellow rind found at least in 5 populations and not far from the clump with normal fruit skin
color (red) in the marsh habitat.
Keywords: palms, five habitat types, Bangka Island, Indonesia.
Maturbongs, R.A.
Conservation and Environment Laboratory, Faculty of Forestry, The State University of Papua
e-mail: ra_maturbongs@yahoo.co.id
Rattans belong to the Palm family (Arecaceae). These climbing palm have an important role in wide
range of people lives in Indonesia, including in West Papua. The Papuans have used rattans for
several purposes in their traditional livelyhoods. Since the year 2000, the data-base of rattans in Papua
has been updated due to the progress of taxonomical research on palms, including rattan. During the
time, many herbarium specimen of rattans have been collected from several locations across the
Vogel Kop area, West Papua. Geologically the area is at the junction of a number of tectonic plates,
which are interesting to studythe biodiversity of rattans on the different plates. Some of the specimens
need to be observed deeply to elucidate their status, particularly rattan specimens came from the
Arfak Mountains, Mt. Nenoti, and Sorong-Manokwari lowland. Spatial distribution of rattans based
on habitat elevation in this area is noted. Demography-ecological data of rattans in each habitat
(lowland 0 – 500 m asl., lower mountain > 500 – 1000 m asl., and upper mountain > 1000 m asl) will
be recorded along transects (10 m x 500 m), with ten transects on each type of habitat. Importance
Value Index (IVI) and Multi-variate Analysis of Ordination will be used to analyse the data.
Keywords: Biodiversity, Spacial distribution, Rattans, Vogel Kop, West Papua
Palms (Arecaceae) are important component of many rainforests in tropical region. Many of them
have also been cultivated widely as agricultural commodities with highly economical values; besides
their importance in restoration of disturbed or marginal lands. Knowledge and application on
germination strategies of palms are essential in the cultivation of palms. Many palms have seeds that
do not germinate readily, even when light conditions are favourable. This research aimed to determine
the effects of seed coat, light and temperature on palm germination with study species: Arenga
australasica, Calamus australis, Hydriastele wendlandiana and Licuala ramsayi. Therefore
treatments used in this research were to promote germination or break dormancy: physical treatments
on seed coat as well as light and temperature treatments. The results showed that the hard seed coats
of four palms slowed imbibition. Scarified seeds germinated best in A. australasica, C. australis and L.
ramsayi. The germination of all seeds was inhibited by far red light. The red light requirement
suggests that palm seeds prefer open areas. This implies that in the field, dispersal agents, canopy
gaps or open areas may play important roles in promoting germination of some palms.
Keywords: Germination, palms, Arenga australasica, Calamus australis, Hydriastele wendlandiana
and Licuala ramsayi.
Mien A Rifai
Indonesian Academy of Sciences/AIPI
c/o ‘Herbarium Bogoriense’, Research Center for Biology–LIPI
Plant taxonomy has never been very popular with Indonesian university students, simply because the
way it is presented fails to show clearly its usefulness to their daily life. One can easily appreciate the
students’ reluctance to enjoy the course because more often than not plant taxonomy instruction has
always been stressed on memorizingthe numerous strange Latin plant names, remembering by heart
the position of every taxon in its ‘proper’ systematic classification, making illustrations of flower
analyses, and on the compulsory preparation of meaningless herbarium specimens not very much
different from those practiced in kindergarten. Consequently the course given has not been adequate
enough to build up their understanding of the meaning of biodiversity (including its aspects of study,
utilize, and conserve) as required by the modern world society. It is very likely that the scarcity of
capable Indonesia researchers to actively participate in completing Flora Malesiana project is the
outcome of this unhealthy situation. In an attempt to remedy this embarrassing predicament a new
approach is being taken to present a different taxonomic course based exclusively on cultivated plants,
especially to make the students immediately aware that it has immediate relevant practical value to the
public at large. Towards this end, the taxonomic laboratory practical and other related activities will
be linked up with ethnobotany capable of producing information and data of local interest, and to
ensure that the undergraduate research exercises as well as the postgraduate theses undertaken are
geared to assist the speedy development of superior cultivars with their much needed distinct, uniform,
and stable agronomic characters. A relevant textbook jointly written by numerous students and
lecturers from many Indonesian universities is being prepared.
Session 3
PHYLOGENETICS-1
Convener: Julisasi T Hadiah, Bogor Botanic Gardens & Peter Wilson, Royal Botanic Gardens,
Sydney, Australia
Chairperson: Julisasi T Hadiah, Bogor Botanic Gardens
Venue: Borneo Room
09.30 – 09.45 Sook-Ngoh Phoon & Crayn DM: Phylogeny of Elaeocarpus (Elaeocarpaceae):
insights from four-locus molecular sequences
09.45 – 10.00 Bhanumas Chantarasuwan et al.: The taxonomy and phylogeny of Ficus
subsection Urostigma (Moraceae)
10.00 –10.15 Millard Uy et al.: Taxonomic Revision and molecular phylogeny of the Philippine
endemic Greeniopsis: Implications on natural products research, biodiversity
conservation and education
10.15 – 10.30 Stefan Wanke et al.: A preliminary molecular phylogeny of Aristolochia subgenus
Pararistolochia (Aristolochiaceae)
The genus Elaeocarpus comprises about 350 species of mostly palaeo-tropical rainforest trees.
Previous molecular phylogenetic studies in the genus mainly focused on the Australian species
therefore phylogenetic relationships of the majority of the species are unknown. Furthermore, the
results of these studies question the monophyly of the genus Elaeocarpusin that the genera Aceratium
and Sericolea are weakly nested within its clade. This study uses a much-expanded dataset of plastid
(trnH-psbA, trnL-trnF and trnV-ndhC) and nuclear (Xdh) markers of 113 species to test hypotheses
regarding the monophyly of Elaeocarpus and relationships within it. Analyses of the Xdh sequence
data suggest that Elaeocarpus, Aceratium and Sericoleaare each monophyletic, while both the nuclear
and plastid sequence data confirm that they are closely related. Within Elaeocarpus, molecular
evidence supports the current infrageneric classification, which is based solely on morphology. Eight
clades are resolved, i.e. the Acronodia, Monocera and Polystachyus groups in the West Malesia,
Group V subgroup A and subgroup D, Group VI, Group XI subgroup B in Australasia and one Asian
clade. On the other hand, the basal relationships within Elaeocarpus clade are not well resolved. One
possible explanation is that the genus underwent a rapid diversification after its split from Aceratium
and Sericolea.
Keywords: Elaeocarpus, phylogeny, West Malesia, Australia.
Chantarasuwan, B.*1,4, Berg, C.C.1, Baas, P.1, Rønsted, N.2, Kjellberg, F.3 & van Welzen, P.C.11
Naturalis Biodiversity Center, Sector Botany, The Netherlands
2
Natural History Museum of Denmark, Copenhagen, Denmark
3
CNRS-CEFE, France
4
Thailand Natural History Museum, National Science Museum, Thailand
*e-mail: bhanumas.chantarasuwan@naturalis.nl
Ficus subsect. Urostigma is distributed from West Africa and Madagascar through mainland Asia to
Japan and through Malesia to Australia and the Pacific. Variation in morphology is broad and
confusing because many species share features with others, and some species can show characters
considered to be typical of other sections: deciduous habit, leaves without articulation, dispersed
staminate flowers, and ramiflory. F. rumphii Blume and F. amplissima Sm., previously placed in sect.
Leucogyne by Corner (1959), were transferred to subsect. Urostigma by Berg and Corner (2005) but
molecular phylogenetic research by Rønsted et al. (2005) showed that F. rumphii is embedded in
subsect. Conosycea. Thus, the systematic position of both species is still doubtful. Our study will
provide more data for understanding the taxonomic position of species of Ficus subsection Urostigma,
by combining morphology, leaf anatomy and molecular data in phylogenetic analyses, which will
unravel the evolution of the subsection and clarify relationships between the species, thus improving
the classification and the recognition of taxa. Based on morphology, including leaf anatomy, 27
species could be recognized. Phylogenetic analysis shows that subsect. Urostigma is not
monophyletic; F. rumphii should indeed be placed in the Conosycea clade, while F. amplissima
should remain in Urostigma. F. caulocarpa (Miq.) Miq. and F. virens Aiton are polyphyletic and
these species concepts should be re-evaluated.
Keywords: taxonomy, phylogeny, Ficus subsection Urostigma.
Greeniopsis Merr. is a poorly known genus of Rubiaceae endemic to the Philippines. Based on
morphology, it has been tentatively included in tribe Aleisanthieae but no molecular studies have been
conducted hence its taxonomic position has remained contentious. In the present study, sequences of
cpDNA (rps16, trnT-F) and nrDNA (ITS) regions of all species were generated to evaluate the
monophyly and determine the position of the genus. Field reconnaissance and herbarium studies were
done for the revision, database development (DELTA, INTKEY) and conservation status assessment.
Parsimony and Bayesian analyses of the datasets strongly support the monophyly and inclusion of
Greeniopsis in Aleisanthieae. Moreover, the combined plastid and ITS sequence analysis yielded
similar tree topologies and morphology is very congruent with the latter. Comprehensive
morphological examinations revealed, however, that woolly hairs on the abaxial leaf surface occur in
only one Greeniopsis species and this can no longer be a synapomorphy for the tribe. Finally, most
species were categorized as critically endangered and the adoption of e-taxonomy in the Philippines
could be a good “crutch” to its current biodiversity and taxonomic dilemma, particularly in conserving
and popularizing uncharismatic, cryptic, endemic species such as those in family Rubiaceae.
Keywords: Greeniopsis, uncharismatic, endemic, Rubiaceae, Philippines, ITS, trnT-F, rps16.
Aristolochia s.l. contains about 500 species, subdivided into three clades. Subgenus Pararistolochia
currently comprises 34 species distributed in either tropical central and western Africa (11 species) or
Australasia (23 species). In Australasia, species are found in New Guinea and eastern Australia. A
single species (A. decandra) is known from Borneo. Recent molecular phylogenetic studies, indicated
a sister relationship between African and Australasian species, but only a single species from
Australasia was included. Morphologically the subgenus is characterized by a 3-lobed perianth, a 6 -
24 lobed gynostemium and a berry fruit. All species are lianas or climbers but the latter lack the
typical flattened stem. This study presents a preliminary phylogeny based on the chloroplast trnK-
matK-trnK-psbA region and includes representative sampling from the entire distribution area. The
phylogeny strongly supports subgenus Pararistolochia as monophyletic. Furthermore, two main,
geographically based, clades are recovered: an African and an Australasian clade, both highly
supported. However, relationships within the Australasian clade are not fully resolved. The poorly
sampled New Guinean species are nested amongst the Australian taxa possibly indicating exchange
over former land bridges. Genetic divergence among these species is very low, possibly indicating
recent radiation. However, most Australian species are recovered as monophyletic.
Keywords: Africa, Aristolochia, Australasia, disjunction, Pararistolochia, subgenus, Torres Strait.
Session 3
BEGONIACEAE & GESNERIACEAE-3
Convener: Ruth Kiew, FRIM & Abdulrokhman Kartonegoro, Research Center for Biology,
LIPI (Gesneriaceae)
Chairperson: Abdulrokhman Kartonegoro , Research Center for Biology, LIPI
Venue: New Guinea Room
09.30 – 09.45 Abdulrokhman Kartonegoro & Daniel Potter: The Gesneriaceae of Mekongga Mt
Sulawesi
09.45 – 10.00 Ruth Kiew et al.: Towards a Revision of the Gesneriaceae for the Flora of
Peninsular Malaysia
10.00 – 10.15 David Middleton & Pramote Triboun: The Gesneriaceae for the Flora of Thailand
10.15 – 10.30 Wei Yigang et al.: Gesneriaceae of South China and its Conservation
Field exploration of the flora of the Mekongga Mountains area of Southeast Sulawesi was conducted
from 2009 to 2011. Herbarium specimens were collected for further examination. During this
exploration 22 species in 9 genera of the family Gesneriaceae were discovered. These comprise 2
species of Aeschynanthus, 4 species of Agalmyla, 1 species of Codonoboea, 7 species of Cyrtandra, 1
species of Epithema, 3 species of Monophyllaea, 2 species of Rhynchoglossum, 1 species of
Rhynchotechum and 1 species of Stauranthera. Twelve of these species are endemic to Sulawesi
while the rest are known to occur on neighboring islands or are more widely distributed.
Aeschynanthus crassifolius and Monophyllaea merrilliana, previously known only from the
Philippine Islands, are new records for Sulawesi. A new species of Cyrtandra collected in the
Mekongga area, which resembles C. gorontaloensis from North Sulawesi, will be described.
Keywords: Endemic, Gesneriaceae, Mekongga Mountains, Sulawesi.
Kiew, R.1, Lim, C.L., Rafidah, A.R.1, Yao, T.L. & Middleton, D.J.2
1
Forest Research Institute Malaysia, Kepong, Malaysia
2
Royal Botanic Gardens Edinburgh, England
A multipronged approach has been adopted to expedite the revision of Gesneriaceae. On the one hand,
international collaboration with the Royal Botanic Gardens Edinburgh has through molecular
phylogenetic studies shed light on generic delimitation, for example, in banishing Chirita from
Peninsular Malaysia (its species now being encompassed in Damrongia and the ‘new’ genus
Microchirita); reinstating Loxocarpus as a genus; transferring Henckelia species to Codonoboea and
synonymising Trisepalum into Paraboea. On the other hand, the opportunity of working locally has
facilitated the discovery of new species by the exploration of botanically unknown areas, the
assessment of conservation status is based on actual conditions on the ground, programmes for
artificial propagation and breeding of species identified as critically endangered can be implemented;
and experiments to grow variable species under controlled conditions can be set up. Finally, working
as a team expedites progress.
Keywords: Flora, taxonomic revision, Peninsular Malaysia, Gesneriaceae.
We estimate there are over 220 species of Gesneriaceae in around 30 genera in Thailand. With
concerted field work in many parts of Thailand the number of species known from the country has
increased enormously in recent years. These additional species are mostly newly described but species
previously only known from neighbouring countries, particularly from Malaysia and Burma, have
also been discovered. Some recent finds which could not be accommodated within the existing
generic framework have been described in new genera. On going molecular phylogenetic work has
clarified and substantially altered the previous generic framework. This includes the large genus
Chirita, which has been split into five genera, and the southern Thai and Malesian species of
Henckelia, which have been moved to other genera, mostly Codonoboea. Many of the new species are
locally endemic in limestone areas and many of these are not in protected areas. The taxonomic work
needs to be accompanied by conservation measures.
Keywords: Gesneriaceae, Thailand, new genera, new species.
China is one of the main centers of diversification and differentiation of Old World Gesneriaceae. At
present, 40 genera with more than 480 species are reported from China, of which 70% are endemic.
Conservation assessments have been undertaken: 3 species (2 described) are Extinct in the Wild (EW),
42% are Critically Endangered (CR), 10% are Endangered (EN), 6% are Vulnerable (VU), 2.5% Near
Threatened (NT), 12% Data Deficient (DD), only 27.5% are Least Concern (LC). One result of our
assessments has been to ‘declare a biota in crisis’. More than half the Gesneriaceae of South China are
in need of protection and conservation. To address this issue, the Guangxi Institute of Botany has a
longstanding taxonomic and systematic research link with the Royal Botanic Garden Edinburgh and
has recently signed a Memorandum of Understanding with The Gesneriad Society for this purpose.
This partnership has resulted in the establishment of the Gesneriad Conservation Center of China at
GIB. There are many issues involved in population decline and to better understand some of the
causes. A much more work lies ahead to ensure the survival of the many Gesneriaceae species in
South China.
Keywords: Conservation, Conservation assessments, Gesneriaceae, Gesneriaceae of South China, the
Gesneriad Conservation Center of China.
Tan, J.P.C.
Forest Research Institute Malaysia (FRIM),
e-mail: joannetan@frim.gov.my
Most limestone hills in Peninsular Malaysia are under state land jurisdiction and are subjected to
quarrying. Limestone vegetation is well known for its unique floristic composition; in Peninsular
Malaysia at least 130 endemic species are confined to limestone. Three endemic limestone Gesneriad
species namely Paraboea bakeri, Senyumia minutiflora, Emarhendia bettiana have been pushed to
the brink of extinction due to ongoing and future scheduled quarry activities. Limestone hills
habouring these species were surveyed and living plants were collected for ex-situ conservation in the
Forest Research Institute Malaysia (FRIM). Besides vegetative propagation, seeds were germinated to
produce large number of plants for future conservation programmes. Our conservation efforts include
restoration studies to other similar limestone habitats, maintaining an ex-situ collection in our botanic
garden and domestication of these species as ornamental plants. Finally efforts are made to increase
public awareness of these most endangered species and the importance of conserving limestone hills
that are so important for these unique plants.
Keywords: Paraboea bakeri, Senyumia minutiflora, Emarhendia bettiana, limestone, Gesneriaceae,
ex-situ.
Session 3
BIODIVERSITY INFORMATICS-1
Convener: Campbell O Webb, Arnold Arboretum, Harvard University
Chairperson: Campbell O Webb, Arnold Arboretum, Harvard University
Venue: Sulawesi Room
09.30 – 09.45 Judy West & Michael Preece: World Flora Online – Flora Malesiana participation
09.45 – 10.00 Chuck Miller & Walter Berendsohn: The World Flora Online – Achieving Target
1 of the Global Strategy for Plant Conservation
10.00 – 10.15 Daniel Thomas et al.: Implementation of the e-Flora Malesiana: Demonstration
and evaluation of database backbones and e-taxonomy tools
10.15 – 10.30 Walter Berendsohn: World Flora Online – a chance for establishing a global
network of networks in phytotaxonomy?
10.30 – 10.45 Thomas Hamann & Andreas Müller: Digitalisation and mark-up of published
Flora Malesiana volumes with FlorML for the creation of an e-Flora
Under the Global Strategy for Plant Conservation (GSPC), the CBD at its 10th Conference of the
Parties in November 2010 agreed that the 16 targets of the GSPC will be achieved by the year 2020.
The updated GSPC Target 1 builds on previous work and aims to complete an ambitious target of “an
online flora of all known plants” by 2020. The World Flora Online (WFO) is an international
collaboration involving botanical institutions worldwide, to develop the first-ever comprehensive,
authoritative and accessible online resource for the world’s approximately 400,000 known plant
species. The WFO will improve access to, and analysis and management of critical botanical
information for policy makers, planners, biodiversity conservation practitioners, land managers,
botanists, ecologists, geneticists, other scientists and users of plant data worldwide. How can the
Malesian and Australasian regions and our Flora Malesiana consortium contribute to this target and
the development of the World Flora Online (WFO)? How can the Flora Malesiana project benefit
from the WFO? As one of the countries in Malesia, Australia is well-positioned to participate and
contribute to the WFO project, and to assist neighbouring countries such as those of Malesia and the
southwest Pacific. Australia’s participation in the WFO will be largely through the development,
compilation and management of the Flora of Australia Online (FoA Online) as a collaborative venture
of the Australian botanical community, and will extend to the species in common with Australia’s
northern Malesian neighbours. As a collaboration between regional herbaria and botanists, FoA
Online offers a compelling model for botanical collaboration in the Malesian region. The Australian
National Species Lists (NSL) project supported by the Atlas of Living Australia (ALA) has paved the
way for open and shared nomenclatural and taxonomic data for the FoA Online system using
international information standards in taxonomy and nomenclature. The information architecture
based on the NSL enables the FoA Online to link to the Australian Plant Name Index and the
Australian Plant Census for complete and authoritative nomenclatural and taxonomic information. It
enables links to national and international compilations of biodiversity data such as the Australia’s
Virtual Herbarium (AVH), the Atlas of Living Australia (ALA), the Global Biodiversity Information
Facility (GBIF) and the Encyclopedia of Life (EoL). In return these compilations enable access to
wider pools of botanical data, and sophisticated mapping, spatial and other analyses.
Keywords: World Flora Online, biodiversity databases, information architecture.
The World Flora Online – Achieving Target 1 of the Global Strategy for
Plant Conservation
In its decision X/17, the Convention on Biological Diversity (CBD) adopted a consolidated update of
the Global Strategy for Plant Conservation (GSPC) for the decade 2011–2020 at its 10th Conference of
the Parties held in Nagoya, Japan in October 2010. The updated GSPC includes five objectives and 16
targets to be achieved by 2020. Target 1 aims to complete the ambitious target of “an online flora of
all known plants” by 2020. A widely accessible Flora of all known plant species is a fundamental
requirement for plant conservation and provides a baseline for the achievement and monitoring of
other targets of the Strategy. The previous (GSPC 2010) target 1 aimed to develop “a widely
accessible working list of known plant species as a step towards a complete world flora,” and this
target was achieved at the end of 2010, as The Plant List (www.theplantlist.org). Drawing from the
knowledge gained in producing The Plant List, an online World Flora of all known plant species is
now underway. The structure of the Flora will be a framework capable of accommodating regional
floristic information (at national or lower level) that can provide answers in both regional and global
contexts. Enhancements will include more complete synonymy; geographic distributions to at least
country level, drawing on national floras, checklists, and monographs; habitat data; identification
tools, principally interactive keys, images, and descriptions; conservation status; and other
enhancements as practicable, e.g., vernacular names. Much of these data already exist in digital or
printed format, and they can be used to populate the Flora. However, the World Flora Online is much
more than an information technology project and plant taxonomists will play a crucial role in
resolving taxonomy that differs between geographic regions and in generating new floristic and
monographic work to update old information and fill in the considerable gaps that exist. This
presentation will describe the vision, progress to date and plans for this new and significant project.
Recent pilot projects have initiated a shift of Flora Malesiana (FM) from a purely static printed
account to a dynamic online format:i) XML mark-upof published FM volumes used to populate the
FM Data Portal, and ii) projects testing solutions for online publishing of new taxonomic contents.
Two current projects, Ferns of Sulawesi and the Sulawesi Begonia Data Portal, using state-of-the-art
database backbonesdynamically linked with webpages (Scratchpads and the EDIT Platform), are
presented. The functionality of the underlying databases and associated remote collaboration options,
bulk upload, image viewers and other features, and their suitability for the implementation ofmajor
online florasare evaluated. The results indicate that current tools have reached a maturity that
allowspractical implementation of an online platform not only integrating data from the legacy
literature and other existing resources such as journal articles and specimen repositories, but also
providinga collaborative framework for the creation and online publication of new taxonomic
contents. Effective workflows for preparation and online publishing of taxonomic data, including
preliminary results such as checklists and regional treatments, willenhance data accessibility and
updatability, allow data annotation and peer evaluation, and facilitate the generation of new
taxonomic contents.
Keywords: Common Data Model, e-Flora Malesiana, e-taxonomy, Scratchpads, Taxonomic Editor.
Berendsohn, W.G.
Botanic Garden and Botanical Museum Berlin-Dahlem, Freie Universität Berlin
Taxonomists working on monographs, floras and checklists are traditionally users and members of
networks. Individual authors are relying on the established network of world herbaria and the
knowledge of colleagues about the local distribution of taxa, their help in doing fieldwork, etc. As a
rule, Floras are regional networks of botanists – editorial standards and format have been agreed in
close collaboration and (often) some institutions have taken a coordinating role. The collaborative
character of taxonomic work is fostered by the usual complementarity of subjects implied in the
specialisation of the individual taxonomist. In conclusion, we do have a traditional networking
approach that we can build on for future developments. Increasingly, there are networks being
established using on-line resources like websites and web-accessible databases to produce and to
publish floras and checklists; as we hear there are various plans and concrete developments for floras
in the Malesiana region as well. Another development in this arena is the setting up of networks to
collaboratively create comprehensive global taxonomic treatments; examples include initiatives like
e-Monocots, Palmweb, the Solanum Network, the Cichorieae network and a new initiative to create
an international network for a Synthesis of Caryophyllales. The latter is presented as an example for
the potential interlinking of individual, regional and taxonomic networks to produce the World Flora
Online (WFO), demonstrating both the use of new content created in taxonomic networks and of
published content drawn from existing floras. Called for by the global conservation community, WFO
has been put on the global agenda by decisions of the SBSSTA and COP of the Biodiversity
Convention. This will hopefully bring about increased funding opportunities on national and
international levels. It is important that this funding is used to strengthen the actual taxonomic work
and the networks underlying the WFO.
Keywords: Caryophyllales, Floras, Funding, Monographs, Taxonomy, World Flora Online.
In recent years, 11 of the 22 volumes of Flora Malesiana have been converted to XML to populate the
FM Data Portal. The challenges with regards to mark-up of FM combined with stakeholder
requirements are explained. The resulting custom XML schema used for this task, FlorML, which
allows for very detailed mark-up of legacy taxonomic works, is presented. The development of the
mark-up procedure, evolving from manual mark-up of single volumes to semi-automated mark-up of
multiple volumes at once with Perl scripts, is discussed. The results show that it is possible to
considerably speed up the mark-up process while retaining a high degree of data atomisation.
However, several challenges remain with regards to the legacy data, some of which may require a
reconsideration of stakeholder expectations. These are briefly discussed.
Keywords: legacy literature, e-flora, xml mark-up, automation, FlorML.
Session 3
LAURACEAE
Convener: JG Rohwer, Univ. Hamburg & D Arifiani, Research Center for Biology, LIPI
Chairperson: JG Rohwer, Univ. Hamburg
Venue: Sumatera Room
09.30 – 09.45 JG Rohwer: 30 years of work in the Lauraceae – a preliminary conclusion and a
call for more cooperation
09.45 – 10.00 Rogier de Kok: The genus Cryptocarya (Lauraceae) in Peninsular Malaysia,
Thailand and Indo-China
10.00 – 10.15 Deby Arifiani et al.: Phylogenetic relationships of Endiandra (Lauraceae) inferred
from ITS (Internal Transcribed Spacer) sequences
10.15 – 10.30 Li Lang et al.: Molecular phylogenetic study of Caryodaphnopsis Airy Shaw
(Lauraceae) and its tropical Amphi-Pacific disjunction pattern
10.30 – 10.45 Kuo-Fang Chung et al.: Flower biology and conservation genetics of Taiwan
Sassafras (Lauraceae)
Rohwer, J.G.
Univ. Hamburg, Biozentrum Klein Flottbek und Botanischer Garten, Hamburg, Germany
e-mail: Jens.Rohwer@uni-hamburg.de
The author has been working in the Lauraceae over the past 30 years. During this time span,
considerable progress has been made, in monographic work on minor to medium-sized genera, in
floristic treatments, anatomical work, and in the elucidation of the phylogeny of the family. However,
there are still some serious challenges to be met. Almost all of the major genera are still poorly
understood, mainly because in times of “publish or perish” no single researcher can afford to spend
years of his lifetime attempting to understand a group completely, before he or she can publish thebig
monograph that would be so desperately needed. Therefore, we need a different approach. In other
sciences, e.g. physics, progress is mostly achieved by large international research teams, in which no
single person understands every detail, but everyone contributes to the common goal. Why not in
botany? Couldn’t we build teams of field botanists recording everything about the living plant and its
habitat, documented by high quality photos, researchers working in local floristics, who know their
area and their flora very well, ethnobotanists documenting the local uses, plant morphologists and
anatomists elucidating the structural details and their development, molecular phylogeneticists
retracing the evolutionary lineages, and experienced colleagues bringing all the information into
context? Not only science, but also all participants would benefit from such a network.
Keywords: Lauraceae, phylogeny, monographs, floristic treatments, new media.
de Kok, R.
Royal Botanic Gardens, Kew, Richmond, UK
e-mail: R.deKok@kew.org
The number of species of Cryptocarya R.Br. (Lauraceae) in Peninsular Malaysia and Thailand and
Indo-China is almost same. However, there is only about a 50 % overlap in species composition
between the two areas. While Peninsular Malesia is dominated by species which are common on the
Sunda Plateau, and few endemics, Thailand and Indo-China have many species in common with
South China, and also have a higher percentage of endemic species. The main area of overlap is
Peninsular Thailand, with many species only just crossing the border with Peninsular Malaysia. This
could be an artefact of collecting, as there are significantly fewer specimens of this genus available for
study from Thailand and Indo-China than there are from Peninsular Malesia, and many common
species from both China and Peninsular Malesia are only represented by few specimens or even just
one. An overview of the species from the area is given and their distribution patterns and morphology
are discussed.
Keywords: Cryptocarya, Lauraceae, Peninsular Malaysia, Thailand, Laos, Vietnam, Cambodia.
The two genera Endiandra and Beilschmiedia are morphologically difficult to differentiate when
flowers are unavailable. Within Endiandra, e.g., presence and morphology of the staminal gland is a
floral character that is thought to be good for grouping the species. Here we report the result of a
phylogenetic analysis among Endiandra species based on the ITS region of nrDNA. The present
analysis included more samples of Endiandra than previous studies, and used Cryptocarya as the
outgroup. Twenty-eight samples of Endiandra, Beilschmiedia and Cryptocarya were sequenced in
this study. With some additional sequences from GenBank, a total of 31 taxa were used for
phylogenetic analysis employing the maximum parsimony method. Our data are as yet insufficient to
determine if Beilschmiedia can be separated from Endiandra or not. As expected, the presence of
staminal glands is a plesiomorphic character. Most glandless species examined so far seem to form a
monophyletic group, except E. impressicosta, which was found among the unresolved basal taxa.
Keywords: Beilschmiedia, Endiandra, Internal Transcribed Spacer (ITS) region nrDNA,
phylogenetic analysis, sequences, staminal glands.
Li, L.1, Li, J.1, Madriñán, S.2, van der Werff, H.3
1
Laboratory of Plant Phylogenetics and Conservation, Xishuangbanna Tropical Botanical Garden, P. R. China
2
Departamento de Ciencias Biológicas, Universidad de los Andes, Columbia
3
Missouri Botanical Garden, USA
Caryodaphnopsis is a small genus (~14 species) of the Lauraceae. It has a tropical amphi-pacific
disjunct distribution, 7 species in tropical Asia and 7 species in tropical America. The position of
Caryodaphnopsis within the family is still controversial, and its intercontinental disjunction pattern
has not been investigated with extensive sampling and precise time dating. ITS, RPB2 and LEAFY
sequences of 10 Caryodaphnopsis species and 26 other Lauraceae species were analyzed with
Maximum Parsimony and Bayesian Inference. Divergence time estimation employed Bayesian
Markov chain Monte Carlo method under a relaxed clock. Ancestral distribution reconstruction
employed Reconstruct Ancestral State in Phylogenies. Well-supported phylogenetic tree consists of
four major monophyletic clades. The position of the Caryodaphnopsis clade is between the two top
clades, one composed of Cinnamomeae, Laureae and the Persea group, and the other of
Neocinnamomum and Cassytha species, whereas the basal clade is composed of the Cryptocarya
group species. The divergence between Asian and American species within Caryodaphnopsis is
estimated as mid-Eocene, and its ancestral distribution is on Laurasia. Therefore, we suggest that the
amphi-pacific disjunction of Caryodaphnopsis resulted from the disruption of the boreotropical flora
by climatic cooling during the mid- to late Eocene.
Keywords: amphi-pacific disjunction, biogeography, molecular phylogeny, Caryodaphnopsis,
Lauraceae.
Sassafras randaiense (Taiwan Sassafras), a member of the genus known for its classic Eastern North
American-East Asian disjunction, is vulnerable and found only in isolated patches of small and
declining populations. It is an ecologically and economically importanttree species endemic to Taiwan,
noted as the sole host plant for the highly endangered broad-tailed swallowtail butterfly. Moreover,
this species is one of the five most invaluable broad leaf timber species. To facilitate its effective
conservation, flower biology and conservation genetics of S. randaiense were investigated. By
following the entire flowering periods of four trees in late winter in 2009 and 2010, we confirmed that
S. randaiense is protogynous, as all known hermaphroditic Lauraceae; however, their sexual phases
do not change synchronously as observed in avocado and predicted by earlier studies. Instead the
female phase of each flower lasts for less up to 4 days, followed by the male phase. For each tree,
female phase flowers were present for 8 to 13 days, and at the 7th day, portion of male phase flowers
exceeded those of female phase, indicating that asynchronous dichogamy better characterizes the
sexual system of S. randaiense and geitonogamy is possible with an individual tree. Population
genetic structure and phylogeography investigated based on 17 microsatellite loci and chloroplast
rps16-trnK and psbD-trnTintergenic spacers revealed low allelic diversity and deficit of heterozygotes
within each populations and marked population differentiation, suggesting high level of inbreeding
and limited gene flows among populations. These could have resulted in severe inbreeding depression
manifested by a general low rate of seed germination and high rate of seedling mortality in the species.
Based on species distribution modeling, it is predicted that, under the climatic scenarios projected by
IPCC, S. randaiense would likely go extinct by 2080. Our data suggest actions such as germplasm
preservation from different populations and increasing gene flow among populations to conserve
genetic diversity and mitigate the effect of inbreeding depression.
Keywords: flower behavior, inbreeding depression, microsatellite, phylogeography, population
genetic structure, Sassafras randaeinse, species distribution model.
Session 4
PHYLOGENETICS-2
Convener: Peter Wilson, Royal Botanic Gardens, Sydney, Australia & Julisasi T Hadiah,
Bogor Botanic Gardens
Chairperson: Peter Wilson, Royal Botanic Gardens, Sydney, Australia
Venue: Borneo Room
11.00 – 11.15 Robert Morley: Understanding the evolution of the Malesian Flora using the
interplay between palynology and molecular phylogenies
11.15 – 11.30 Peter G Wilson et al.: Phylogenetic analysis of Xanthostemon (Myrtaceae) with an
emphasis on geography and character evolution
11.30 – 11.45 A Berhaman et al.: Phylogeny of Bornean Tristaniopsis Brongn. & Gris
(Myrtaceae)
11.45 – 12.00 Made Pharmawati & IP Candra.: Low genetic diversity of Patchouli grown in Bali
as detected using ISSR marker
12.00 – 12.15 Yi-Shuo Liang & Jenn-Che Wang: Phylogenetic study of Linderniaceae
Morley, R.J.
Department of Geology, Royal Holloway, University of London, UK and NIKO Asia Ltd, Jakarta, Indonesia
e-mail: pollenpower@palynova.com
Palynology can help in the interpretation of molecular phylogenies in three ways; by 1) providing a
deep time record of vegetation and climate history; 2) providing dated records of pollen types which
can be used to date clades and the timing of migrations and 3) recognising pollen morphological
characters which may suggest the basis for differentiation of clades and identification of new species.
Firstly the paper reviews the climate and vegetation history of the Sunda region for the last 50 Ma
based on pollen records, and suggests the main times at which plants adapted to both perhumid and
seasonal climates were able to disperse into or across Sundaland. It also considers the position and
timing of likely dispersal bottlenecks, which it is believed should be clearly represented in molecular
datasets. Secondly, the timing of dispersals into the region will be discussed with reference to the
Dipterocarpaceae, which dispersed into Sundaland at a very early stage, and also, the Ericaceae, which
were probably much later immigrants. Thirdly, the genus Alangium will be discussed since it is
remarkable in that almost all species can be differentiated on pollen alone. A new perspective of the
origin and dispersal of this genus will be considered based on both palynological and molecular data.
Keywords: palynology, Sundaland, Dipterocarpaceae, Ericaceae, Alangium, climate history.
The genus Xanthostemon comprises around 36 named species that occur in eastern parts of the Flora
Malesia region: the Philippines, New Guinea and eastern parts of Indonesia, as well as in Australia,
the Solomon Islands and New Caledonia. Two small related genera are recognised in New Caledonia.
As presently defined, Xanthostemon can be divided into four groups of species based on placentation.
One goal of the present study is to test the hypothesis that these groups should be recognised at
generic rank. To do this, we used a dataset of plastid (trnH-psbA and trnK/matK) and nuclear (ITS
and ETS) markers for 34 taxa across all morphology-based groups, to test monophyly. Analysis of
these data confirms monophyly of the tribe Xanthostemoneae but gives only limited support for some
morphology based groups. Interestingly, a clade of red-flowered species is sister to all other species in
some analyses but the main clades are geographically based. Almost all New Caledonian species are
in a single, poorly resolved clade suggesting rapid diversification following a dispersal event. The two
Indonesian species sampled, X. verus and X. petiolatus, group with related Australian taxa in analyses
of the nuclear data but resolve separately with chloroplast data.
Keywords: Xanthostemon, Myrtaceae, phylogeny.
The genus Tristaniopsis has a range extending from Australia and New Caledonia, though Malesia to
southern Thailand and Burma. In Borneo, herbarium and field study has recognized of 22 species,
including 11 new to science. Molecular studies using ITS (Internal Transcribe Spacer) nuclear
ribosomal DNA, plus part of 2 plastid coding regions (rbcL and matK) were carried out to assess
relationships between these taxa, plus one species from Singapore and a few from New Caledonia and
Australia, using Whiteodendron as an outgroup. Trees were generated using three methods: Neighbor-
Joining, Maximum Parsimony and Maximum Likelihood. The data resolved Tristaniopsis according
to the two geographic regions, Borneo, and non-Borneo. Each sub-clade received >90% support in all
analyses but resolution was poor due to limited numbers of informative characters, only ITS gave
clear support for the monophyly of the genus. Further work with more variable plastid spacer regions
may greatly enhance resolution. Our analysis also included two samples of one species, T. whiteana,
from disjunct locations. Although a good species morphologically, our sample from Sentosa
(Singapore) was apparently not sister to our sample from Borneo. Although this finding is intriguing,
testing hypotheses of dispersal vs. vicariance, or introgression vs. diversification, would require more
extensive sampling across the geographic range of the genus.
Keywords: Tristaniopsis, Myrtaceae, phylogeny.
Patchouli is a bushy herb with a strong scent. Patchouli's essential oil is extracted from it leaves. The
oil is used in perfumes, incense and traditional medicines. Development of Bali’s spa tourism industry
has created high demand for raw materials including patchouli. The centre of patchouli cultivation in
Bali is in Badung Regency but it is also grown in other areas, such as Buleleng Regency. High quality
patchouli oil comes from Aceh and Patchouli plants from Aceh (Pogostemon cablin (Blanco) Benth.)
are considered high quality; Java patchouli (Pogostemon heyneanus) is of lower quality. Patchouli
cultivated in Bali is believed to be Aceh patchouli. Molecular marker can be used to confirm patchouli
cultivars. Leaf samples of patchouli from 12 areas in Badung and Buleleng Regency were collected.
Patchouli samples of Lhoksumawe, Tapak Tuan, Sidikalang and Java were obtained from Balitro,
Bogor. DNA was extracted in CTAB buffer. Seven ISSR primers were tested and only ISSR 981 and
ISSR 855 showed polymorphism. Results from dendrogram analysis found that Java patchouli was
separated from other patchouli cultivars, indicating that patchouli plants grown in Bali are cultivars
from Aceh. However, all patchouli grown in Bali showed high similarity.
Keywords: ISSR markers, patchouli, Bali, Aceh
The Linderniaceae was previously treated as the tribe Lindernieae in Scrophulariaceae. Based on
cpDNA phylogeny and stamen characteristics, Rahmanzadeh et al. (2005) raised the tribe to the rank
of family. Oxelman et al. (2005) added two additional genera Stemodiopsis and Micranthemum to the
family which was also accepted by Tank et al. (2006). This family is mainly distributed throughout
Southeast Asia, Afrotropical and Neotropical areas. In the largest genus, Lindernia (c. 100 spp.),
several sections have been treated previously as distinct genera. Phylogenetic relationships within
Linderniaceae are confused and unclear based on morphology. The present study aims to reconstruct
the phylogeny of Linderniaceae using the sequences of cpDNA matK, trnL/F, and rps16 and partial
nuclear gene RPB2 from 60 species of 13 genera. For the largest genus, Lindernia, 10 out of 18
sections were sampled. Results show that Stemodiopsis is basal and distinct from other genera of
Linderniaceae. The remaining taxa form a highly supported monophyletic group comprising several
well supported clades. Taxa of Lindernia were spread throughout the clade and clustered with other
genera, strongly suggesting that Lindernia is polyphyletic. Each well supported major clade is
distinguished by autapomorphies. Based on the morphological and molecular evidence, we re-
circumscribe some genera within Linderniaceae and propose upgrading several sections of Lindernia
to generic rank.
Keywords: Linderniaceae, phylogeny, Lindernia, Torenia, RPB2, matK, trnL/F, rps16
Session 4
PANDANACEAE-1
Convener: Ary P Keim, Research Center for Biology, LIPI & Martin Callmander, Missouri
Botanical Garden
Chairperson: Ary P Keim, Research Center for Biology, LIPI
Venue: New Guinea Room
11.00 – 11.15 Ary P Keim & Rugayah: Pandanaceae of Flora Malesiana in the past eight years
(2005-2013): a state of the art
11.15 – 11.30 Martin Callmander et al.: Revisiting the systematics and biogeography of the
Pandanaceae based on new phylogenetic and morphological evidence
11.30 – 11.45 Sven Buerki et al.: Temporal history of the screw-pine genus Benstonea
(Pandanaceae): with an emphasis on Malesian species
11.45 – 12.00 Sri E Rahayu et al.: The genus Freycinetia Gaud. In Java : 41 years after Ben
Stone
12.00 – 12.15 Nursahara Pasaribu & Rahmat: The diversity and distribution of Sumatran species
of Pandanus Stickman
The progress of researches in Pandanaceae conducted in Herbarium Bogoriense (BO) for the past
eight years (2005 to 2013) encompassing various subjects from morphology, anatomy, taxonomy,
ecology, ethnobotany, cytology, germination and seedling to folklore is presented in this synopsis.
The results of explorations proceeded in Sumatra, Java, Borneo, Sulawesi, Molluccas, the Lesser
Sunda Islands, and New Guinea are provided. Studies made on the other areas within Flora Malesiana
such as Malaysia, Singapore, the Philippines, Papua New Guinea, and adjacent areas such as Japan,
India, and Australia are also illustrated. Bioprospecting study of Pandanaceae has been focused on
drugs discovery although the funding on this subject should be taken more seriously. Pandan
association with micro-fungi and bryophytes are studied as well. A special tribute to Rumphius as the
first botanist that introduce pandan to the world of modern science is also induced.
Keywords: Freycinetia, Indonesia, Malesia, Pandanaceae, Pandanus, synopsis, taxonomy
The Paleotropical dioecious monocot family Pandanaceae includes ca. 700 species assigned to five
genera: Pandanus (c. 450 spp.), Freycinetia (c. 200 spp.), Benstonea (c. 60 spp.), Martellidendron (6
spp.) and Sararanga (2 spp.). We present here a new plastid molecular phylogenetic framework based
on c. 300 spp. to assess the monophyly of the family and to test infra-generic classification of its
largest and morphologically variable genus Pandanus. Key morphological characters have evolved
independently several times in Pandanus, leading to a non-natural classification. A review of the
systematics and biogeography of the family is discussed for the first time by emphasizing on the
morphology of staminate and pistillate flowers. This study will ultimately lead to a new infrageneric
classification of its largest genus and serve as a benchmark for future systematics studies on the
Pandanaceae.
Keywords: Pandanaceae, Pandanus, phylogenetic inference, systematics, biogeography
Recent phylogenetic and morphological analyses allowed the description a new genus of screw-pines
(Pandanaceae), Benstonea (ca. 60 species). This genus is distinctly characterized by stigmatic grooves
on the adaxial face of the style and a reduced staminate flower with only 1(-3) stamens. The genus is
distributed from India to Fiji with the centre of species diversity in the Flora Malesiana region (>90%
endemism). Although there is strong morphological and molecular support for the recognition of this
genus, the previous study did not resolve its position within the family. In this study, we propose to
overcome this issue by inferring a new familial phylogenetic hypothesis based on a broader taxon
sampling and additional DNA regions. A species-level phylogeny of Benstonea was produced –
including >80% of the species diversity. This framework is used to infer the spatio-temporal history
of Benstonea through the application of a constrained geographical model. This inference will be used
to assess the effect of palaeogeographical events (e.g. the impact of the creation of SE Asia) on the
diversification of the genus. Furthermore, the effect of climate change on the evolution and modern
distribution of the genus is also discussed.
Keywords: Benstonea, biogeography, fossil evidence, Pandanaceae, SE Asia
Pandan family (Pandananceae) is represented in Java by three genera, Benstonea Callm. & Buerki,
Freycinetia Gaud. and Pandanus Parkins. The genus Freycinetia, commonly called as climbing
pandan, has been known to occur in Java for a long time, however the taxonomy of the species is
presently in a unsatisfactory state. This is to some extents attributed to incomplete collection of
specimens, where the specimens have been collected mainly from the vicinity of Mt. Gede-Pangrango
and Mt. Halimun in West Java and the collection from Central and East Java is extremely meager.
Further intensive collection throughout Java is necessary and may end up in a discovery of
undescribed taxa. Prior to this present study the last taxonomic account on the pandan flora of Java
was Benjamin Stone’s Studies in Malesian Pandanaceae VII, which was published 41 years ago. The
status of some species is still more or less in question. This study was undertaken to have a better
understanding of the morphology of the genus in order to make a better species delimitation,
particularly for species found in Java. The result of this current study shows that as far as the genus
Freycinetia is concerned there has been substantially no difference, except for the presence of F.
sumatrana in Java, which is now confirmed, the placement F. lombokensis into a synonym of F.
javanica, and the dissolution of two varieties within F. imbricata (F. imbricata var. hispidula and F.
imbricata var. kuchinensis) and one variety within F. javanica (F. javanica var. expansa). This paper
constitutes a part of the on-going study of Panndanaceae of Java
Keywords: Freycinetia, Pandanaceae, Java
Pandanus Stickman is one of the four extant genera of Pandanaceae. The genus consists of
approximately 700 species, in which most are trees. It has the broadest distribution of the four genera,
occurring throughout the Old Word Tropics. Despite its stunning diversity in Malesia, the diversity of
the genus in Sumatra is less studied compare to neighbouring areas like the Java, Malay Peninsula and
Borneo. The present study recognizes twenty two species of Pandanus recorded for Sumatra based
their habit, habitat and morphological characters, in which one is proposed as new species, namely
Pandanus riauensis Pasaribu. Species of Pandanus in Sumatra occupy various types of habitats
including, bushes, beaches, swamp areas and primary and secondary forests ranging from 0 to 2000 m
altitudes. Most of the species are well distributed in the lowland areas predominantly along the
streams, riverbanks and other wet areas.
Keywords: Ecology, morphology, Pandanus, Pandanaceae, Sumatra
Session 4
BIODIVERSITY INFORMATICS-2
Convener: Campbell O Webb, Arnold Arboretum, Harvard University
Chairperson: Campbell O Webb, Arnold Arboretum, Harvard University
Venue: Sulawesi Room
11.15 – 11.30 Campbell O Webb et al.: Considerations for decentralized sharing of Malesian
plant information using linked data infrastructure
11.30 – 11.45 Julie Barcelona: Co’s Digital Flora of the Philippines: an online photo-illustrated
checklist of Philippine vascular plants
11.45 – 12.00 Kwek Yan Chong et al.: Towards a Digital Flora of Singapore
12.00 – 12.15 Fitri Y Amandita et al.: DNA barcoding of vascular plants in Jambi, Indonesia
12.15 – 12.30 Ibrahim Djamaluddin et al.: GIS Web Server for Biodiversity information System
E-Monocot
A consortium formed by RBG Kew, the Natural History Museum (London) and Oxford University,
and funded by the Natural Environment Research Council in the UK, eMonocot is an e-taxonomy
initiative that is providing the first web-based treatment for the world’s monocot plants (constituting
approximately 20% of all higher plants, some 70,000 species, and including numerous groups of the
highest conservation, ecological and economic importance). eMonocot has the potential to
revolutionise the way taxonomic data are organised and accessed by both the practitioners and users
of taxonomy, targeted at biodiversity and environmental scientists, but also available to other users
including volunteer biologists, horticulturists, schools and the general public. Available information
will include nomenclature, taxonomic descriptions, images, identification guides and geographical,
ecological, DNA sequence and conservation data, harvested from collaborating source systems,
structured around a taxonomy derived from the World Checklist of Monocotyledons.
Keywords: collaboration, consensus, eTaxonomy, floristic, monograph, taxonomy, web
An increasing amount of information about Malesian plants exists in digital form, including online
revisions, herbarium records, photographs, taxon-specific portals, and ecological plot data.
Theoretically, these data can be reconciled to create checklists, localized field guides, digital keys and
other user-focused products. However, online data are often unstructured, and/or presented with
insufficient metadata to allow either manual or automated ‘stitching together.’ A single, well-funded,
centralized project would make important contributions, but such a solution is unlikely to be
sustainable, or to entice many parties to release and share data, and is contrary to the decentralized
way data grows best on the web. We argue that the most successful long term approach will be to
utilize the decentralized, linked data (‘semantic web’) infrastructure. Standards for useful data models
will be set not by a standards organization, but rather by precedent. We discuss existing ontologies
and vocabularies, and demonstrate our current implementation for field inventory of forest trees in
Indonesia. Major adoption of these technologies will not happen, however, until simple, intuitive tools
have been developed to allow botanists to annotate their data appropriately for publishing on the
Semantic web, and we describe such vital products, some of which are under development.
Keywords: Data integration, interoperability, semantic web, ontologies, forest inventory
Leonardo L. Co, a Philippine plant taxonomist, devoted his life to studying the plant diversity of his
country. His magnum opus was an updated version of Merrill’s An Enumeration of Philippine
Flowering Plants. Sadly, in 2010Co’s life was tragically ended before he could complete this checklist.
In November 2011, we launched the Co's Digital Flora of the Philippines website (CDFP;
www.philippineplants.org) to host Co’s unpublished checklist. Linked to this checklist are thousands
of photos present on PhytoImages (www.phytoimages.siu.edu).The aim of this website is to present a
continuously updated account of all native and naturalized species of vascular plants in the
Philippines with multiple diagnostic photographs for each taxon. In this way, we wish to honor Co’s
contributions to Philippine botany and continue his legacy of freely sharing botanical knowledge to
stimulate biological education, research, and conservation.
In this presentation, we report on our efforts of photo-documenting the Philippine flora for the CDFP
project. We also discuss the role of social media (i.e., Facebook) in involving a diverse range of
CDFP users who use and contribute to this website. We also provide examples of how plant
photography projects can result in the discovery of undescribed species and range extensions.
Keywords: plant conservation, flora, Philippines, Phytoimages
Several checklists have been produced for the flora of Singapore since 1900. In this digital age, the
dissemination of information can be made even more rapid and accessible to scientists and non-
scientists alike through media such as online databases, websites, blogs, and even smart-phone
applications. We will provide an overview of recent developments of such open-access resources for
the vascular plants of Singapore. The authors of these resources are diverseranging from hobbyists,
to botanists, to a government agency. While diversity of interests and specializations is necessary to
maximize the effectiveness of crowd sourcing, a framework for integration and standardization would
help to improve the overall experience of the web-using, amateur botanist. We will show how we
envision this framework to function, and the challenges that believe its implementation. Envolving
beyond conventional methods of communicating scientific outputs will help to bridge the gap between
scientists and the public, and re-invigorate public participation in natural history.
Keywords: digital flora, Singapore, vascular plants, citizen science, bioinformatics
DNA barcoding aims at providinga fast, accurate, and easily accessible species identification system.
The use of DNA barcoding is of particular relevance for the identification of plants in highly diverse
but endangered tropical systems such as in the forests of Indonesia which are facing great threats. This
research is taking place in Jambi Province (Sumatra, Indonesia), where most of the original forest
cover has been converted into oil palm and rubber plantations. We aim to sequence the DNA barcodes
of vascular plant species in logged-over old growth forest and three different transformation systems
(jungle rubber, rubber and oil palm plantations) and then combine it with classic morphological
species identification to establish a barcoding system for vascular plants in the regionand to make the
data available for the scientific community via DNA barcoding databases. Together with specimen
data and high quality photographs of fresh and dried plant material this information should speed up
plant research in tropical transformation systems.
Keywords: DNA barcoding, vascular plants, Jambi, barcoding database, transformation system
Djamaluddin, I.*1, Mitani, Y.1, Indrayani, P.1, Tagane, S.2 & Yahara, T.2
1
Faculty of Engineering, Kyushu University, Japan
2
Faculty of Sciences, Kyushu University, Japan
*e-mail: ibedije@gmail.com
Ecological protection strategies, designed by sharing information and integrating data, play an
important role in defining interconnections and interdependencies in research as well as in increasing
global awareness. The Geographic Information System (GIS) web server is one technology solution to
improve the interoperability and sharing between the biodiversity databases of an organization and the
databases of other research groups. In this paper, we have designed a database system integration
framework based on GIS technology and developed a GIS server using the latest cloud-based
technology to incorporate biodiversity databases. A GIS server is a WebGIS platform integrating
multiple geodatabases and provides data display and query, allowing users to apply internet browsers
to manipulate the functions and query the data, etc. To demonstrate the effectiveness of the GIS web
server, plant survey data from Mt. Gede-Pangrango, West Java in Indonesia, is studied for utilizing
biodiversity information. With the server system, users can query the survey data of each species,
view the location and the photo of the species. Also, other advantages of the GIS web server include
intelligent spatial query functions, and integrating other map services such as remote sensing,
topography and land-use to species distribution map.
Keywords: Biodiversity Information, Database System, Web Server, GIS, Interoperability
Session 4
PTERYDOPHYTE-1
Convener: Dedy Darnaedi, Research Center for Biology, LIPI & Peter Hovenkamp, National
Herbarium of Netherlands
Chairperson: Peter Hovenkamp, National Herbarium of Netherlands
Venue: Sumatera Room
11.00 – 11.15 Atsushi Ebihara et al.: Toward the publication of "Asian fern red list
11.15 – 11.30 Yeachen Liu & Wenliang Chiou: Insights on phylogeographic study of Asian
Athyrium (Athyriaceae, Pteridophyta)
11.30 – 11.45 Michael A Sundue et al.: Phylogenetic of Grammitid Ferns: Impacts for the Flora
Malesiana Region
11.45 – 12.00 Agung Sedayu et al.: The importance of ecophysiological characters in delineating
the niche partition of Cyathea contaminans and C. squamulata (Cyatheaceae,
Pteridophyta)
12.00 – 12.15 Azi Jamaludin & Alastair Culham: Systematics of Malaysian scaly tree ferns
(Cyatheaceae) phylogenetics & computer-aided identification
12.15 – 12.30 Chunxiang Li & Yang Qun: Preliminary interpretations on diversification time of
the fern genus Athyrium from fossil and molecular dating
Ebihara, A.
National Museum of Nature and Science, Japan
While it is well known that cosmopolitan or widely distributed species are present in ferns and
lycophytes, a number of narrowly distributed species, often threatened, are also present. Recently we
compiled a list of narrowly distributed species of ferns and lycophytes in Asia by an international
collaboration of 18 researchers (Ebihara et al., Bull. Nat. Mus. Nat. Sci. B, 38: 93-119, 2012), which
will serve as a prototype for a global red list. The newly compiled list, for which we combined
country-level red lists and knowledge of the specialists, includes a total of 886 taxa (577 in SE Asia,
215 in E Asia and 101 in S Asia). However, information on the flora of countries/areas where
checklists and/or red lists are not yet available is still lacking. The challenge will now be to collect
detailed information on the distribution of the nominated taxa to apply the IUCN criteria to threatened
species as well as to supplement information-poor areas. We are also preparing an integrated checklist
of all the Asian ferns and lycophytes that will help clarify a whole picture of the flora of the Asian
ferns and lycophytes.
Keywords: ferns, pteridophytes, red list, threatened species
The genus Athyrium is mainly distributed in northern temperate and subtropical mountain areas. It is
most diverse in Asia. In the western and south Pacific islands, Athyrium species occur in the
mountainous middle to high elevations and exhibit high ratiosof endemism of this genus. The
phylogenetic studies revealed remarkable relationships among these endemic taxa. The remaining
Athyrium species are disjunctive distributing between the Himalaya and these islands. Their sister
species are sometimes found as the endemic to Himalaya. Based on the geographic evens and species-
diversify time, we proposed that these northern hemisphere plants may have extended their
distributions to equatorial high mountains through Taiwan to the Philippines forward to Borneo and
Java. This hypothesis may explain how these northern temperate species spread to south and tropical
mountain regions.
Keywords: Athyrium, endemism, phylogeography
Sundue, M.A.1, Parris, B.S.2, Ranker, T.A. 3 , Morden, C.W.3 & Fujimoto, E.3
1
The Pringle Herbarium, Dept. of Plant Biology, University of Vermont, VT USA
2
The Fern Research Foundation, New Zealand
3
Dept. of Botany, University of Hawaii at Manoa, HI USA
Grammitid ferns comprise a monophyletic group of ca. 900 species of tropical epiphytes distributed in
humid montane forests of the world. Molecular phylogenetic studies have shown that several large
genera occurring mostly in the Paleotropics (Ctenopteris s.l., Grammitis s.l.) or mostly in the
Cyathea contaminans and C. squamulata are close relative species, reflected by their placement
within a single subgenus, Sphaeropteris. In lowland West Java, they are abundantly found co-
occurred in a single locality, however, there is no data on niche partition available in understanding
the ecology of both species. In a highly deforested habitat as lowland West Java, ecological
understanding is critical for their conservation. We noted only one investigator (Holttum, 1963)
endeavored to distinguish their niche partitioning by defining light environment as their primary niche
partition. This paper tries to follow Holttum’s lead on whether light regime is indeed an ecological
descriptor delineating the two species. We used several indices: LDI (Leaf Dissection Index), SPI
(Stomate Pore Index), and LMA (Leaf Mass per Area) which were proven as traits positively
correlated to light environment. Our observation revealed that LDI and SPI significantly demonstrated
that C. contaminans is a species adapted to open areas while C. squamulata is adapted to shaded areas.
LMA measurements did not signify light regime preference in both species. Along light gradients,
both species behaved similarly to spermatophytes, as shown by their LDI and SPI, but not of LMA.
We conclude that some light-related ecophysiological traits are good descriptor in differing C.
contaminans and C. squamulata habitat preferences; however some traits are probably not clearly
displayed by both species.
Keywords: Conservation, Cyathea contaminans, Cyathea squamulata, light environment, LDI, LMA,
SPI
Scaly tree ferns (Cyatheaceae) have a complex classification history since the understanding of
relationships among the component genera has always been dependent on the scale and indusium
morphologies. Recent studies have led to the suggestion of Cyatheaceae being split into four genera
(Sphaeropteris, Cyathea, Alsophila, and Gymnosphaera+Alsophila capensis) based on DNA sequence
evidence,as opposed to the current classfication (Alsophila, Cyathea, and Sphaeropteris) that is
widely used. In this study, initially two plastid DNA regions (rbcLand trnH-psbA) will be used to
develop identification systems for the scaly tree fern family in Malaysia. In addition, a multi-access
morphological key for field identification will be developed based around taxa recognised by
extensive field sampling of the currently recognised species. It is hoped that this study will update the
current classification of scaly tree ferns family in Malaysia as well as contribute tostabilisingthe
Cyatheaceae classification in general.
Keywords: Cyatheaceae, scaly tree fern, Malaysia, multi-access key, rbcL, trnH-psbA, phylogenetics
The extant Athyrium Roth is a worldwide fern genus of about 200 species, with a distribution center in
the Himalayan and adjacent mountain regions. The oldest fossils assigned to it comprise fronds and
spores preserved in situ from the Lower Cretaceous of northeast Asia. However, the molecular dating
suggests that Athyrium diverged during the Eocene (~42.6 Ma). Athyrium fossils are the first
unequivocal polypodiaceous ferns, while, they have not been accepted as definitely belonging to this
fern lineage, their precise relationships within polypods are uncertain. Here we present some
preliminary interpretations for the disparity in fossil and molecular age estimates, and new insights
into the origin and evolution of the genus. We suggest that characters used to assign the Lower
Cretaceous fossils are not synapomorphies for only the genus Athyrium, but are putatively
plesiomorphic states for the stem group of the whole eupolypods II ferns, so the Early Cretaceous
Athyrium most likely represents a stem-group member, and that lineage extinction during the early
evolutionary stages of the genus resulted in missing nodes.
Keywords: Athyrium, Fossil, Phylogeny, Molecular dating
Session 5
TAXONOMY & SYSTEMATICS-3
Convener: Julisasi T Hadiah, Bogor Botanic Gardens & Peter Wilson, Royal Botanic Gardens,
Sydney, Australia
Chairperson: Yuzammi, Bogor Botanic Gardens
Venue: Borneo Room
14.00 – 14.15 Alexandra Konstantinova et al.: Fruit anatomy of Malesian genus Osmoxylon Miq.
(Araliaceae)
14.15 – 14.30 Seda Segun et al.: 200 year old question: what is Vitex rotundifolia? Is it a species,
or a subspecies, or a variety, or just an ecological cline
14.30 – 14.45 Mikhail Romanov & Bobrov Alexey VFCh: Fruit structure in Myristicaceae
14.45 – 15.00 Tri Harsono et al.: Distributon of germplasm of Bouea (Anacardiaceae) in Malesia
The pollen morphology of 68 species (126 samples) from 10 genera , i.e. Berrya, Brownlowia, Colona,
Diplodiscus, Grewia, Jarandersonia, Microcos, Pentace, Schoutenia, and Trichospermum of
Malvaceae subfam. Grewioideae, Brownlowioideae and Dombeyoideae from Peninsular Malaysia and
Borneo was examined using light microscope (LM), scanning electron microscope (SEM) and
transmission electron microscope (TEM). On the basis of aperture types, exine sculpturing and pollen
shapes, three pollen types, the Tilia-type, Grewia-type and Malva-type are recognised. In the oblate
Tilia-type and prolate Grewia-type, the pollens are colporate while in the spherical Malva-type are
porate. The pollen morphological variation and similarity of the studied genera are discussed.
Keywords: Pollen morphology, Peninsular Malaysia, Borneo, Grewioideae, Brownlowioideae,
Dombeyoideae
Foliar epidermal micro-morphological study on 18 taxa of the genus Gmelina L. from Malesina has
been carried out to determine their taxonomic significance for the first time. The observation reveals
that Gmelina species are hypostomatic and mostly anomocytic. Stomata are somewhat frequent in
most of the species, but much more abundant in G. moluccana, G. palawensis, G. paniculata, G.
philippensis, and in G. racemosa; although they are much less frequent in G. delavayana, G.
hainanensis, G. tomentosa and in G. uniflora. The stomata are not visible in G. hainanensis, G.
lepidota, and G. racemosa as the surfaces are almost completely covered by trichomes. A wide
variety of trichome types have been found in this study. They are very variable both in size and
density. Two main trichome types eglandular and glandular; and basically seven vestiture types viz.
glabrous or glabrescent; glandular; glandular-pilose; glandular-tomentose; lepidote; tomentose; and
stellate occur in Gmelina. Having both surfaces tomentose G. tomentosa is distinctive from all of its
congeners; in contrast, both surfaces are glabrous to glabrescent in G. moluccana, G. palawensis and
in G. schelechteri. Glandular trichomes are absent only from G. tomentosa, whilst eglandular
trichomes are absent from G. asiatica, G. delavayana, G. lepidoata, G. philippensis, G. spectabilis,
and G. uniflora. However, both types of trichomes are observed in G. annamensis, G. arborea, G.
chinensis, G. elliptica, G. hainanensis, G. racemosa, and G. tonkinensis. Uniseriate, multicellular
eglandular trichomes are widespread in almost all taxa examined, though unicellular trichomes were
observed in G. chinensis, G. lepidota and in P. divaricata. G. lepidota is distinctive from all other
species examined because its abaxial surface covers lepidote trichomes with distinct “Patelliform”
multiseriate trichomes or filiform, unicellular eglandular trichomes. G. moluccana differs in having
“Asciiform” glandular trichomes and conspicuous swollen inter-stomatal ridges. The distinct type
“Calvitium” indumentum was observed only in G. spectabilis make these species readily
distinguishable from all other members of the genus. A distinctive type of hyaline, sessile, peltate
glandular trichome with a long central ray occurs in G. schlechter has not been observed in any other
species of Lamiaceae or Verbenaceae; by which it can be easily distinguished from other species.
None of these types have been reported earlier from any member of Lamiaceae or Verbenaceae.
Keywords: Micro-morphology, foliar epidermal anatomy, trichomes, Malesiana, Gmelina
Konstantinova, A.I.
Faculty of Biology, M.V. Lomonosov Moscow State University, Russian Federation
Osmoxylon is the largest genus of Araliaceae in Malesian flora. According to Philipson (1976), 41 of
its 50 species occur in Malesia. These plants possess several traits unusual for this family: peculiar
inflorescences, petals fused at base, unique pollen structure. The genus has been poorly studied with
no recent revision available and fruit anatomy uninvestigated to date. Mature fruits of 6 species (O.
pfeilii, O. serratifolium, O. talaudense, O. trilobatum, O. geelvinkianum, O. mariannense) were
studied. In Osmoxylon, seeds enclosed in pyrenes of endocarpic origin serve as diaspores. The
diaspore releases through destruction of mesocarp layers adjacent to the pyrene. The pyrene is likely
to have been capable of dehiscence and is still dehiscent (O. serratifolium), however, in most species
the dehiscence is lost and only its vestiges can be traced anatomically. Noteworthy, although studied
species are quite similar in pericarp histology, the diaspore (pyrene) shape is a good feature to
diagnose certain species. Species with multilocular fruits (О. geelvinkianum, O. mariannense)
demonstrate some carpological similarities to Schefflera s.l. polymerous groups (Pacific -"Plerandra"
and Asian -"Tupidanthus"): almost or fully sessile discrete stigmata, seedless locules, etc.; – and
differences due to lack of well-developed secretory system in Osmoxylon. Therefore, Osmoxylon
represents quite an independent evolutionary trend in polymery origin within Araliaceae.
Keywords: Osmoxylon, carpology, fruit, diaspore, pericarp histology, morphology and anatomy,
evolutionary trend, secretory system, pyrene
In 1782 Carl Linnaeus described Vitex rotundifolia based on a Thunberg specimen from Japan.
However, since then, different authors placed V. rotundifolia in different taxon as species, variety or
subspecies; or even claimed that it was an ecological cline. Although today most of these names are
Bouea or Marian plum is one of the genus of Anacardiaceae which grow wildly in the Malesian
region. The purpose of this study was to find the distribution and variation of the germplasm of
marian plum. Observations on 105 sheets kept at the Herbarium Bogoriense, and living colections
distributed from Sumatra, Java, Kalimantan, Ambon and Thailand were done. It was found that Bouea
consisted of two species, B. macrophylla Griffit dan B. oppositifolia (Roxb.) Meisn. Based on the leaf
form variation, B. macrophylla has relatively similar leaves for all cultivars, however the fruit colour
is very different and can be divided into 2 groups i.e. light yellow fruits (gandaria cultivar found in in
the city of Ambon and merinya cultivar found in Lhok Sukon dan Lhok Seumawe, Aceh) and the
second group is fruit with brown spotted yellow (which grow in kundang, Bengkalis; Meranti Village,
Padang Island, Riau; Batusangkar, West Sumatra; Jaka Baring, South Sumatra; Banjar Baru and Kota
Baru, South Kalimantan; Bogor, Pantai Carita, Ciboleger, West Java). On the other hand, B.
oppositifolia were consisted of three groups based on their leaves characters, i.e. obovate leaves
known as Ramania pipit cultivar found in Wanariset Research Area East-Kalimantan; elliptic leaves
locally known as Raman discovered at Sultan Syarif Kasim Nat. Park, Riau, and another cultivar
called haramania in Padangbolak, North Sumatra; and linnearis leaves which do not have local name
collected from Mt. Guntung-Sukadana-West Kalimantan. However, this B. oppositifolia can be
grouped into 2 groups of fruit characters i.e., oblong, yellowish green, (found in Padangbolak-Sumut
and Sutan Syarif Kasim-Riau National park); oblong, red fruit (found Bogor which was known being
introduced from Yunan, South China). Among the prominent characteristics of the Bouea, cultivars
grow in Ambon, Merinya Aceh and South Kalimantan are potentially useful for crossing to improve
their quality and characters.
Keywords: Bouea, distribution, species, genetic resources, potential
Session 5
PANDANACEAE-2
Convener: Ary P Keim, Research Center for Biology, LIPI & Martin Callmander, Missouri
Botanical Garden
Chairperson: Martin Callmander, Missouri Botanical Garden
Venue: New Guinea Room
13.45 – 14.00 Altafhusain B Nadaf & Rahul Zanan.: An updated biodiversity status of Indian
Pandanaceae
14.00 – 14.15 Rahul Zanan & Altafhusain B Nadaf: Phylogenetic assesment of the Indian screw-
pine genus Pandanus (Pandanaceae)
14.15 – 14.30 Ruliyana Susanti & Eizi Suzuki: Growth strategy of two congeneric species
Pandanus furcatus and P. Nitidus
Beentje, H.
Herbarium, Royal Botanic Gardens, Kew, UK
e-mail h.beentje@kew.org
Herbarium material of Pandanaceae is often unsatisfactory, and especially older types may just consist
of a few carpels and part of a leaf. Field work is therefore essential – but may not always be very
fruitful either, as many species are only fertile once every few years; especially male flowering
material is very rare, as anthesis may be as short as three days. Despite such problems taxonomists
need to provide usable accounts of this family, which has considerable diversity in Southeast Asia. I
will highlight some of the problems as well as solutions in my treatment of Pandanaceae for the Flora
of Peninsular Malaysia, where three genera are recognized: Freycinetia (8 species), Benstonea (13
species) and Pandanus (28 species).
Keywords: Pandanaceae, taxonomy, Malaysia, Freycinetia, Pandanus, Benstonea
The family Pandanaceae contains five genera Freycinetia, Pandanus, Benstonea, Sararanga and
Martellidendron. Indian Pandanaceae is represented by three genera, Pandanus and Benstonea
distributed in Southern and North-eastern India and Frecynetia restricted to Andaman and Nicobar
Islands with two species. In the present study, the Indian Pandanaceae is revised and synonyms
species are merged to come up with an exact number of species. Our extensive survey throughout
India led in the discovery of 3 new Pandanus species (2 from Western Ghats - P. palakkadensis and P.
mangalorensis and 1 from North East Himalaya - P. martinianus). The present taxonomic revision
confirmed total number of Pandanus species to 14 that are distributed in the Southern India (8
species) and North East Himalayan region (5 species) with one species in Andaman and Nicobar
Islands. The conservation status following IUCN Red list categories and criteria showed that 6 species
are falling under threatened category with sub categories as Critically Endangered (P. palakkadensis
and P. mangalorensis), Endangered (P. unguifer and P. martinianus) and Vulnerable (P. diversus and
B. thwaitesii). 9 other species fall under Least Concern category (P. furcatus, P. canaranus, P.
foetidus, P. odorifer, P. kaida, P. leram, P. nepalensis, B. foetida, F. rigidifolia and F. insignis) and P.
emarginatus comes under Data Deficient category. Remaining two species P. amaryllifolius and P.
dubius are exotic. Based on our study, we recommend including 6 threatened species in the IUCN
Red List.
Keywords: Indian Pandanaceae revision, IUCN criteria, Critically endangered species
Indian Pandanaceae represents three genera viz., Pandanus (14 species), Benstonea (2 species) and
Frecynetia (2 species) with totalling 18 species distributed in Southern and Northeastern India and
Andaman and Nicobar Islands. As per the Stone’s (1974) infrageneric classification system, Buerki et.
al. (2012) phylogenetic analysis, Callmander et. al. (2012) morphological analysis of genus Pandanus,
Indian Pandanus species repressen three subgenera viz., Rykia, Pandanus, and Kurzia. North eastern
Indian Pandanus species represent subgenus Rykia, Southern Indian Pandanus species represent
subgenera Rykia, Pandanus and Kurzia. This infrageneric classification was assessed using 3
chloroplast DNA sequences - trnL (UAA) 5’ - trnL (UAA) 3’, trnL (UAA) 3’ - trnF (GAA) and atpB
- rbcL. In the present study, all Pandanus species from different subgenera were fairly represented in
our analysis. The species from subgenus Rykia grouped together except P. unguifer and P.
martinianus are distinctly grouped and shifting of P. kaida and P. dubius from subgenus Rykia to
subgenus Pandanus. The study confirmed the positions of P. amaryllifolius under the subgenus
Kurzia. Our results also supported subgenus Acrostigma as a separate from genus Pandanus and its
recognition as a separate genus Benstones (B. foetida and B. thwaitesii). The analysis suggested that
the atpB-rbcL, trnL-trnL and trnL-trnF sequences help in better understanding the biodiversity and
evolutionary relationship among the species.
Keywords: Indian screwpines, choloroplast DNA, phylogeny
Pandanus species distributed in the tropical and some subtropical area from coasts to mountains.
Pandanus usually dominated in coastal areas, but rarely on mountains. Two congeneric species, P.
nitidus and P. furcatus, are native in the foothill area of Mt. Gede Pangrango National Park, West
Java, Indonesia. We studied their morphological characteristic and plant growth from stem elongation
to understand their growth strategy. All individuals in transect (850m x 20m) were labeled and
parameters of their morphological characters are measured. Similar numbers of individuals of the two
species were found. Fruits and flowers were rarely found for both species. Seedlings of both species
originated from sprouts but rarely from seeds. The two species had an overlapping distribution; in a
small area they were found in a clump but the distribution tended to be random in a larger area. They
seemed to prefer similar microhabitat. Both species had similar average stem elongation. The former
tended to have stout and vertical stem, the latter had slender stem with many branches. This difference
in morphology may enable their coexistence. In comparison with our previous study of coastal P.
odoratissimus, these two mountain Pandanus had much lower densities, fewer fruits, and lower
percentage of seedling than those of P. odoratissimus, suggesting poor reproduction from seed.
Keywords: Pandanus, plant growth, congeneric species, Mt. Gede Pangrango National Park
Session 5
ORCHIDACEAE
Convener: Lina S Juswara, Research Center for Biology, LIPI & Irawati, Bogor Botanic
Gardens
Chairperson: Irawati, Bogor Botanic Gardens
Venue: Sulawesi Room
13.30 – 13.45 Agustina YS Arobaya et al.: Phylogeny and evolution of the anthelope orchids:
molecular studies to test controversial taxonomic concepts
14.00 – 14.15 Andre Schuiteman et al.: The problematic systematics of Eria (Orchidaceae)
14.30 – 14.45 Lina S Juswara & PA Fuerst: Systematics of subtribe Goodyerinae (Orchidaceae)
inferred by chloroplast and nuclear sequences
14.45 – 15.00 Rusea Go: Advances in orchid diversity assessments in Peninsular Malaysia
Arobaya, A.Y.S.*1,2,6, Field, A.R.1, Crayn, D.M.1,3, Clements, M.4, Gadek, P.2, Schulte K2,5
1
Australian Tropical Herbarium, James Cook University, Cairns;
2
School of Marine and Tropical Biology, James Cook University, Cairns;
3
TESS, James Cook University, Cairns;
4
Centre for Tropical Biodiversity and Climate Change, James Cook University,Townsville;
5
Centre for Australian National Biodiversity Research, Canberra
6
Fakultas Kehutanan, Universitas Negeri Papua, Manokwari, Papua Barat, Indonesia
*e-mail: agustina.arobaya@my.jcu.edu.au
Dendrobium Sw. section Spatulata Lindl., commonly known as the antelope orchids, is a
taxonomically challenging group consisting of about 75 primarily epiphytic species (Clements, 2002).
The section is distributed from the Philippines southward to northern Australia (Queensland) and from
Java eastwards to Samoa with a centre of diversity in New Guinea. Due to the high morphological
variability, both in floral and in vegetative characters, phylogenetic relationships are still poorly
understood and different taxonomic concepts have been proposed. Up to now, no satisfactory
molecular phylogeny for the group exists. Thus molecular studies are needed to clarify phylogenetic
relationships within this section. This project investigates the phylogeny and evolution of the antelope
orchids based on molecular DNA sequence data and morphological data. Plant materials were
obtained from fieldworks in Australia (Queensland) and Indonesia (West Papua) and living
collections at the Australian Tropical Herbarium and Centre for Australian National Biodiversity
Research. For molecular phylogenetic studies, two nuclear markers (ITS and Xdh) and two plastid
markers (ycf1 and matK) are used. The preliminary analyses of the sequence data provide first
insights into the phylogeny and evolution of this charismatic group of orchids.
Keywords: Dendrobium, section Spatulata, molecular phylogeny, nr DNA (ITS and xdh), plastid
DNA (ycf1 and matK)
O’Byrne, P.
Forest Research Institute Malaysia (FRIM) & Singapore Botanic Gardens, Research Associate
Dipodium R.Br. (Orchidaceae), a genus of c. 38 species, should be divided into an Australasian clade
and a Malesian clade, based on morphological and geographic evidence. Dipodium section Dipodium
and section Leopardanthus (Blume) O. Kuntze are re-defined to accommodate this change. An
evolutionary scenario that explains this division is proposed. The lack of diversity of floral structure
in the genus is caused by pollinator-specificity, while the diversity of plant form is caused by long-
term environmental factors. An evolutionary explanation is provided for the complex involving
Dipodium fevrellii J.J.Sm. and D. pandanum Bailey in New Guinea. The existence of a complex in
Java involving D. pictum (Lindl.) Rchb.f. and D. scandens (Bl.) J.J.Sm. is predicted. The taxonomic
difficulties caused by inter-breeding complexes in Borneo are noted.
Keywords: Dipodium, Evolution, inter-specific complex, Orchidaceae, New Guinea, section
Dipodium, section Leopardanthus
In its traditional circumscription, Eria is the third largest orchid genus in Malesia, with approximately
300 species in the region. DNA-based analyses indicate that Eria s.l. comprises three main clades,
which form a polyphyletic group within the tribe Podochileae together with the genera of the former
subtribe Podochilinae (Appendicula, Podochilus and others) and the remainder of the Eriinae (Porpax,
Stolzia, Pseuderia, Ceratostylis, Epiblastus and Mediocalcar). The other main clade in the
Podochileae, the subtribe Thelasiinae, is sister to the Eriinae. The tribe Podochileae occurs only in
Asia, Australasia and the Pacific, except for Stolzia, which is endemic in Africa. Most of the clades
within Eria s.l. as inferred from phylogeny reconstructions agree with previously recognised sections
of the genus. In recent years, many of these have been treated as genera (e.g. Pinalia, Mycaranthes,
Cylindrolobus). In most cases these are ‘resurrected’ genera formerly synonymised under Eria, rather
than newly established ones. Here we compare the traditional sectional classification of Eria s.l. with
the outcomes of our phylogenetic analyses, pointing out why it is problematic simply to raise the
various sections to genus level.
Keywords: Eriinae, Podochileae, Phylogeny, Classification
Phylogenetic analyses using chloroplast and nuclear data of the orchids from the subtribe
Goodyerinae were examined. Two hypotheses were tested the three genes could be used to explain
evolutionary relationships of the subtribe and whether the hypothesis defined the genus Pachyplectron
as sister to the subtribe can be supported. Eighty nine taxa, ca. 650 bps ITS, 49 taxa with 1501bps
rpl16, and 48 taxa with 1142 bps trnL respectively were incorporated in the cladistic parsimony and
Bayesian inference. The number of stigma was assessed its utility in grouping the subtribe into two
and three groups based on Dressler and Szlachetko respectively and the placement of the genus
Pachyplectron as sisters of subtribe Goodyerinae sensu Dressler proposed by Salazar et al. was being
investigated.The results showed that neither the hypotheses based on Dressler and Szlachetkocould be
supported by the three genes used. In contrast, the placement of the genus Pachyplectron as sister to
the subtribe Goodyerinae is supported by the three genes.This study suggested that the delimitation of
the genera within the subtribe needs to be revised due to lack of synapomorphic characters to define
groups within the subtribe.
Keywords: Goodyerinae, Dressler, Szlachetko, Phylogeny, ITS, rpl16, trnL, Pachyplectron
Go, R.1,2, Mustafa, M.1, Tan, M.C.2, Alia, F.1, Ng, Y.J.N. 1, Abdullah, N. P.3 & Abdullah, J.O.4
1
Biology Department, Faculty of Science,
2
Institute of Tropical Forestry and Forest Products
3
Department of Crop Science, Faculty of Agriculture
4
Department of Microbiology, Faculty of Biotechnology and Cell Biomolecular, Universiti Putra Malaysia,
Malaysia
Southeast Asia is one of the world’s richest orchid diversity regions, with more than 10,000 species
and about 3000 are found in Malaysia. The majority of Malaysia’s orchids are found in Sabah and
Sarawak with slightly less thanonethird found in Peninsular Malaysia. Schuiteman (1999) reported a
total of 887 species in 143 genera of orchids found in Peninsular Malaysia, of which 198 species
(22.6%) are endemic to Peninsular Malaysia. Onget al. 2011, however reported 905 speciesin 143
genera. However, our comprehensive study on orchid’s diversity in Genting Highlands (Ng et al.,
2011) and Frasers Hill (Farah Alia et al., 2012) and numerous other botanical expeditions from late
2010 to 2012 has contributed another 28 species and 5 genera as new records. Further scrutiny of
Onget al (2011)’s species lists revealed that 32 species are either new species or new records to
Peninsular Malaysia. Therefore, the combined total of recognised orchid species found in Peninsular
Malaysia is 949 species in 152 genera. As studies of orchid diversity continue, the numbers of species
are doomed to change positively with new survey to unbotanized area or negatively if forested area
are vanishing.
Keywords: wild orchid, species richness, Peninsular Malaysia
Session 5
PTERYDOPHYTE-2
Convener: Dedy Darnaedi, Research Center for Biology, LIPI & Peter Hovenkamp, National
Herbarium of Netherlands
Chairperson: Xian-Chung Zhang, Chinese Academy of Sciences, P.R. China
Venue: Sumatera Room
13.45 – 14.00 Muhammad Efendi et al.: A new cytotype of Pteris ensiformis var victoriae from
the Malesian Region
14.00 – 14.15 Wita Wardani: Spore morphology of the Asplenium tenerum complex
14.30 – 14.45 Wenni S Lestari et al.: Molecular phylogeny of Maidenhair Fern genus Adiantum
(Pteridaceae) from Lesser Sunda Islands Indonesia based on rbcL Gene and trnL-F
IGS
14.45 – 15.00 Paulina Bawingan et al.: Fern diversity, conservation status & distribution pattern
in Mt Santo Thomas, Tuba, Benquet, Philippines
Hybridization, polyploidization, and reticulate evolution are the major mechanisms that shape the
current fern diversity. The combination of these mechanisms eventually obscures the species
circumscription and their phylogenetic relationships especially in a closely related fern species. The
occurrence of hybrids and cultivar has compounded the existing problem in Nephrolepis which is
known as a difficult genus due to intergrading and subtle morphological differentiation among its
species. By integrating the implementation of chloroplast DNA, psbA-trnH, trnG-trnR, and low-copy
nuclear DNA gene, gapCp in the phylogenetic reconstruction, we attempt to clarify the origin of these
hybrids and cultivar in Nephrolepis. Subsequently, the results have confirmed the conjectures on the
hybrid status of N. x hippocrepicis and N. exaltata as well as revealing their progenitors. Two
widespread species, N. biserrata and N. cordifolia were revealed as the central species in the
formation of these hybrids. Nephrolepis x hippocrepicis was the result of interspecific hybridization
between N. cordifolia and N. biserrata whereas N. exaltata derived from the latter two species and N.
brownii. Nephrolepis “bostoniensis” on the other hand was derived from N. cordifolia and N. exaltata.
Keywords: Nephrolepis, hybrids, cultivars, psbA-trnH, trnG-trnR, gapCp
Pteris ensiformis is a weedy fern species widely distributed from Srilanka, India, Nepal and China to
the Malesian region. Based on the chromosome numbers and mode of reproduction P. ensiformis can
be classified as 2x sexual; 3x apogamous; 4x sexual, 4x apogamous, and 5x apogamous type
described from India, China and Malesian region. Green leave Pteris ensiformis var ensiformis
consistently had a basic chromosome numbers x=29. White leave Pteris ensiformis var victoriae was
reported from India and had different basic chromosome numbers with 2n=84 and 2n=168. However,
new cytological records of P. ensiformis var victoriae from Gorontalo, North Celebes had
chromosome numbers with 2n=58 (2x sexual) and from Lombok Island had 2n=87 (3x apogamous).
These two cyto-types of P. ensiformis var victoriae are new record to the regions. In gross
morphology, the diploid type is smaller in size; thinner but with firm stipe, smaller spore size than the
triploid one. Futher study on Pteris ensiformis complex to clarified the species delimitation and it’s
relationship is in progress.
Keywords: Chromosome numbers, new cytotypes, Pteris ensiformis var victoriae
Wardani, W.
Research Center for Biology, Indonesian Institute of Sciences, LIPI
The Asplenium tenerum complex consist of two taxa with a distinct frond form which some authors
tend to include one as an infraspecific taxon of the other. This study was an attempt to document the
spore morphology of the complex and to evaluate its utility in delimiting the two taxa. Spores were
examined using light and scanning electron microscope. The spore shape is monolete and generally
ellipsoidal, with size ranged between 29.9-43.2 X 18.3-27.4 μm where its polar diameter is slightly
different between the two groups. Other characteristic and ornamentation is described.
Keywords: Asplenium, spore morphology, complex
Coritico, F. P.1, Amoroso, V.B.1, Lehnert, M.2,3, Karger, D.K.4,5 & Kessler, M.4
1
Center for Biodiversity Research and Extension in Mindanao (CEBREM), Central Mindanao University,
Philippines
2
Staatliches Museum für Naturkunde Stuttgart, Germany
3
Nees-Institut für Biodiversität der Pflanzen, Rheinische-Friedrich-Wilhelms Universität Bonn, Germany
4
Systematic Botany, University of Zurich, Switzerland
5
Section of Biodiversity and Environmental Research, Department of Biology, University of Turku, Finland
Species richness, distribution and conservation status of the species of Cyatheaceae (the “scaly tree
ferns”) were determined based on field surveys from different places in Mindanao and herbarium data.
A total of twenty species are known from the island belonging to three genera, Alsophila,
Gymnosphaera and Sphaeropteris, with eight species in Alsophila, nine species in Sphaeropteris and
three species in Gymnosphaera. As to the species richness, Mt. Apo has the highest number with 9
species, followed by Mt. Pantaron and Mt. Kitanglad with 8 and 7 species, respectively.
Sphaeropteris glauca and S. Lepifera are common species found at elevations below 500 m asl. The
study obtained the first records of A. Robinsonii and A. Negrosiana for the island of Mindanao.
Assessment of the species revealed eleven Philippine endemics and five Mindanao endemics, viz. A.
apoensis, A. christii, A. rufopannosa, S. suluensis and S. zamboangana. Furthermore, twelve species
are considered nationally threatened, with seven species endangered and five vulnerable.
Keywords: tree ferns, species richness, assessment, Mindanao Island
The Lesser Sunda Islands composed of small islands scattered from Bali to Timor island. A total of 14
species of Adiantum was collected from this region and seven species from Java were used for this
study. Two cpDNA regions (rbcL gene and trnL-F IGS) were chosen as marker and phylogenetic
analysis was conducted using NJ and MP methods for separated data. The tree topology reconstructed
by NJ and MP are congruence where tree divided into four main clades. Clade I is caudatum group
where pinnate frond and prolonged whip-like stolon at the apex are the defining characters. Clade II is
A. capillus-veneris group and sister to clade I. Clade III is pedatum group in which sister to clade I
and II. Clade IV is monophyletic composed of pantropical species.
Keywords: Lesser Sunda, fern, Adiantum, cpDNA
Filipinos love the lady fern as a food delicacy and some would use some ferns for medicinal purposes
like Adiantum philippense to treat diarrhea or Dryopterisas antihelminthiasis. Ferns abound in Mt.
Santo Tomas, Benguet, northern Philippines. For the past thirty years, however, more than half of the
mountain’s forest has been slowly converted to agricultural and residential land resulting to
destruction of the habitat of important flora and fauna. This study aimed to determine the diversity,
conservation status, and distribution of the remaining fern flora of Mt. Santo Tomas. Collection was
undertaken in two forest types of the mountain: pine forest and dipterocarp forest. We identified
nineteen species belonging to twelve families. Using AFCOR to classify abundance of collected
species, we identified five rare, nine occasional, one common, two frequent, and two abundant species.
There were more fern species collected from the dipterocarp forest than in the pine forest. The
abundant species Pteridium aquilinum and the rare species Chingia ferax were collected in the pine
forest; the four rare species belonging to the genera Sphaerostephanos, Polypodium, Goniophlebium,
and Selliguea were collected from the dipterocarp forest. Distribution of the ferns in the mountain is
affected by atmospheric temperature and humidity.The study showed that fern species abundance has
decreased significantly in Mt. Santo Tomas. There is a need, therefore, to advocate for conservation
and protection of the remaining forested area.
Keywords: Fern species abundance, fern diversity, fern distribution, Mt. Santo Tomas
Session 6
TAXONOMY & SYSTEMATICS-4
Convener: Rismita Sari, Bogor Botanic Gardens
Chairperson:Julia Sang, Botanical Research Centre, Semengoh, Sarawak Forestry, Malaysia
Venue: Borneo Room
15.30 – 15.45 Rismita Sari et al.: New record of Rafflesia cantleyi Solms-Laubach in
Kalimantan
15.45 – 16.00 Ridha Mahyuni et al.: Notes on Rafflesia (Rafflesiaceae) in Sumatra with a new
record and some notes on Rafflesia gadutensis
16.00 – 16.15 SM Mat Yunoh: The delimitation of Rafflesia cantleyi species complex
16.30 – 16.45 Connie Geri & Julia Sang: Rafflesia (Rafflesiaceae) in Sarawak Malaysian,
Borneo and its conservation status
16.45 – 17.00 S Syahida-Emiza & Engkik Soepadmo: A revision of the Malaysian Opiliaceae
Rafflesia cantleyi Solms-Laubach was reported found in Temajuk Village, Subdistrict Paloh, District
of Sambas, West Kalimantan in 2012, during Khatulistiwa Expedition which organized by Special
Forces Command of Indonesian Army. This species was previously only recorded in Tioman Island
and mainland of Malay Peninsula. R. cantleyi is the new record from Kalimantan. The habitat is in
the Nature Reserve where the condition of the forest is relatively undisturbed. This species is
characterized by its flower that has 5-6 lobes with pinkish-cream big warts. Compared with R. azlanii
which found in Sabah, this species has less warts. In R. azlanii the whitish warts are scattered over the
surface of the perigone dominantly almost cover all the surface of perigone.
Keywords: Rafflesia cantleyi, West Kalimantan, Malay Peninsula, new record
Pulau Mursala is a small island in west of SibolgaTapanuli Tengah Distr, North Sumatra, Indonesia.
The occurrence of the genus Rafflesia R. Br. (Rafflesiaceae) had never been reported. However,
during a recent a Rafflesia population was detected. Field observations could be made and material
was collected for comparison with that in the Herbarium Bogoriense (BO). It was concluded that they
Rafflesia gadutensis Meijer, which is known from Padang, UluGadut, Tahura Moh. Hatta, Bukit
Tinggi and Batu Berjulang. Notes on its morphology are given.The distribution of species is discussed.
Keywords: Mursala, Rafflesia, Rafflesiaceae, Sumatra
Yunoh, S.M.M.
Forest Research Institute Malaysia, Malaysia
e-mail: sitimunirah@frim.gov.my
H.N Ridley first recorded Rafflesia in Peninsular Malaysia in Temenggor in 1910. Three species
occur in Peninsular Malaysia; Rafflesia azlanii, R. cantleyi and R. kerrii. Both R. azlanii and R.
cantleyi are endemic to Peninsular Malaysia. In recent years, many Rafflesia studies were undertaken
in Peninsular Malaysia. Among them were population and phenological studies. With these studies,
there is now a better understanding of population variation of the species. Of the three species, R.
azlanii and R. cantleyi have overlapping characters. Solms described Rafflesia cantleyi in 1910 and in
2003 Latiff & Wong described R. azlanii. This paper discusses the delimitation of the two species, a
new description of R. azlanii is provided to improve clarity of this species delimitation.
Keywords: Species Delimitation, Rafflesia cantleyi, Rafflesia azlanii, Peninsular Malaysia
Rafflesia plants live entirely within the tissues of their host plants and only emerge to produce their
flowers. Because of this extremely intimate and dependent association, Rafflesia is an excellent
subject for studying the role of host plants in parasite speciation. One aspect of this interaction is host-
specificity. Rafflesia has been reported to exclusively parasitize Tetrastigma (Vitaceae) species;
however, little is known about host-specificity at the species level. Although this might be partially
due to a lack of focus on this aspect of the biology of Rafflesia, difficulties regarding the taxonomic
identification of Tetrastigma plants might also be responsible. For example, there is no revision of the
Malesian species of the genus, most species show large intra-specific variation in vegetative
morphology, and flowering or fruiting Tetrastigma vines are rarely collected at Rafflesia sites. The
Philippines is one of the main centers of Rafflesia diversity and home to ca. 10 species. As part of our
studies on Rafflesia diversity, we sampled host plants at the majority of all known populations of
Philippine Rafflesia. In this presentation, we will outline our molecular phylogenetic approach to
overcome some of the aforementioned species-identification problems inTetrastigma and present the
host-specificity patterns that we obtained.
Keywords: co-evolution, parasitic plants, Tetrastigma, molecular phylogenetics, taxonomy
Three species of Rafflesia (Rafflesiaceae) are currently recognized in Sarawak, Malaysia: R. tuan-
mudae Becc., R. hasseltii Suringar and R. pricei Meijer. We presence an overview of the distribution,
ecology and conservation status of each species in Sarawak based on study of the species carried out
in 2009 – 2013. We also review evidence for the presence of three unconfirmed species recently
documented during our survey.
Keywords: Rafflesia, Sarawak, distribution, ecology, conservation status
A revision of Opiliaceae was conducted for the Documentation and Inventory of Flora Malaysia
Project. Six genera, Cansjera, Champereia, Lepionurus, Melientha, Opilia and Urobotrya, each with
one species are recognised in Malaysia. Melientha suavis subsp. macrocarpa (earlier known endemic
to Borneo) has been assigned to synonymy under Melientha suavis as the fruit size of the two
subspecies is overlapping and no other morphological characters can be used to support the distinction.
Cansjera and Opilia are often occurring in sandy beach and coastal heath forests, have been
categorized as Near Threatened (NT); others are widespread in primary and secondary forest and have
been categorized as Least Concern (LC). An identification key to the genera and species, full
descriptions and geographical distribution and their conservation status are provided. The
conservation assessment follows the guidelines and criteria of the Malaysia Plant Red List (2006).
Keywords: Conservation Status, Descriptions, Malaysia, Opiliaceae
Session 6
BIOGEOGRAPHY-1
Convener: Peter C van Welzen, Naturalis Biodiversity Center, The Netherlands
Chairperson: Peter C van Welzen, Naturalis Biodiversity Center, The Netherlands
Venue: New Guinea Room
15.30 – 15.45 Marc S Appelhans et al.: Phylogeny & phylogeography of Acronychia, Euodia &
Melicope (Rutaceae) & hypotheses for differences in distribution & species
richness
15.45 – 16.00 Fifi Dwiyanti: Phylogeographic structure of the commercially important tropical
tree species, Dryobalanops aromatica Gaertn.f.(Dipterocarpaceae) revealed by
microsatellite markers
16.00 – 16.15 Fabian Brambach: Elevational patterns and phytogeographical context of tree
diversity in mountain rain forests of Central Sulawesi, Indonesia
16.30 – 16.45 Niels Raes et al.: Legume diversity as indicator for overall botanical diversity on
Sundaland, Southeast Asia
Because of their wide distributions, which range from SE Asia, the Malesian region, Australia, to
Pacific islands (and Madagascar in Melicope), the genera Acronychia, Euodia and Melicope
(Rutaceae) are ideal examples to study Asian and Pacific biogeography. The center of species richness
and endemicity of all three genera is New Guinea but the three genera differ greatly in terms of
species richness (Acronychia: 48 spp., Euodia: 7 spp. and Melicope: about 230 spp.). Our molecular
phylogenetic studies show that Melicope and Acronychia are closely related and that Euodia is sister
to both. A number of monotypic or small genera mainly from New Caledonia and New Guinea need
to be included in Melicope (Comptonella, Platydesma, Picrella, and Sarcomelicope), while others are
closely related to Euodia (Brombya, Perryodendron, and Pitaviaster). Our molecular dating analyses
suggest that the Acronychia – Melicope clade and the Euodia clade might have originated in the late
Oligocene to early Miocene. Considering the similar age of the clades, the differences in species
richness are striking and may be explained by differences in seed coat anatomy that enabled dispersal
by endozoochory in Acronychia and Melicope. In this way, Melicope reached distant regions such as
Madagascar, Hawai´i and the Marquesas Islands while Euodia remained restricted to New Guinea,
Northern Australia and nearby archipelagos.
Keywords: biogeography, Melicope, phylogeny, Rutaceae, species richness
Dryobalanops aromatica Gaertn.f. (Kapur) is an economically important timber species that occurs
naturally in Sumatra, the Malay Peninsula, the Lingga Archipelago, and Borneo. In order to better
characterize geographic patterns of genetic variation, seven polymorphic microsatellite markers were
analyzed in 5 populations of D. aromatica (N = 120 individuals) from the Malay Peninsula, Sarawak
and the Lingga Archipelago. Gene diversity (HE) ranged from 0.571 to 0.729. The level of genetic
differentiation among the Malay Peninsula, Sarawak and the Lingga Archipelago was relatively high
and statistically significant (FCT = 0.168, P< 0.001). A neighbor-joining phenogram revealed two
distinct groups: Sarawak and the Malay Peninsula-Lingga Archipelago. A high degree of genetic
differentiation between the Malay Peninsula-Lingga Archipelago and Sarawak suggests that
populations in each geological area might be the consequence of post glacial expansion from one or
few refugia, but gene flow between different glacial refugia were restricted.
Fig. 1. Neighbor-joining (NJ) phenogram based on pairwise FST among the investigated
Dryobalanopsaromatica populations.
Keywords: Dryobalanops aromatica, microsatellite, genetic diversity, genetic differentiation
Brambach, F. *1, Mangopo, H.2, Tjoa, A.3, Leuschner, C.1 & Culmsee, H.3
1
Plant Ecology and Ecosystem Research, Albrecht-von-Haller-Institute for Plant Sciences, University of
Göttingen, Germany
2
Department of Biology, Faculty of Mathematic and Natural Sciences, Bogor Agricultural University, Indonesia
3
CTFM, Agricultural Faculty, Tadulako University, Indonesia
4
Vegetation and Phytodiversity Analysis, Albrecht-von-Haller Institute for Plant Sciences, University of
Göttingen, Germany
*e-mail: fbramba@gwdg.de
Tropical rain forests are well-known for their enormous plant diversity, and in addition to high on-site
diversity, tropical mountain rain forests show high species-turnover along elevational gradients.
Beside ecological factors, the pool of available species influences community composition at a given
site. We studied patterns of tree species diversity along an elevational transect in old-growth moist
tropical forests in Lore Lindu National Park of Central Sulawesi, Indonesia. Diversity was assessed
conducting plot-based inventories at 15 sites (each 0.24 ha-plots) from the submontane to the upper
montane zone (700 - 2400 m a.s.l.). For each species encountered during the inventories we recorded
the geographical distribution within and beyond Malesia to elucidate phytogeographical relationships.
Numerous new occurrence records for (Central) Sulawesi and undescribed species encountered by our
study show that the island remains underexplored. Species diversity generally decreases with
elevation but varies within elevational belts, possibly owing to soil properties. Members of the
families Fagaceae and to a lesser extent Myrtaceae and Lauraceae are important components of the
forests along the whole transect while the upper montane zone was strongly dominated by conifers,
especially of the family Podocarpaceae. Furthermore, we show that phytogeographical affinities of the
tree communities vary among different elevations.
Keywords: environmental gradient, biogeography, tropical montane forest, Malesia, Wallacea,
biodiversity hotspot, Fagaceae, Myrtaceae, tropical conifers
Kinabalu Park is a centre of plant diversity in Borneo. The geologically diverse and isolated Kinabalu
massif arguably has the richest flora globally. However, certain plant taxa such as Timonius remain
poorly studied. The most recent floristic account recognised nine Timonius species whereas recent
ecological collections appeared to represent more species. This study was conceived to revise
Kinabalu Timonius and attempt a rarity assessment. Comparative studies of herbarium specimens and
micromorphological studies of the lower leaf lamina surface were conducted. Species were recognised
based on discontinuous morphological variation. This study recognises 15 Timonius species in
Kinabalu Park, comprising four previously named species and 11 new species. Nine species are likely
to be endemic to Kinabalu Park. Distinct hair types on the lower lamina surface are useful for
distinguishing species. Also, the distribution of some Timonius species is possibly restricted to
ultramafic substrates. Useful perspectives towards potentially understanding speciation on mountain
habitats and reasonable approaches for a wider phylogenetic investigation of Timonius in Borneo are
discussed. This study revealed diagnostic characters for recognising the Kinabalu Timonius and
suggests that tropical plant diversity may be underestimated in areas such as Borneo.
Keywords: Endemism, Mount Kinabalu, rare plants, Rubiaceae, Timonius, ultramafic substrates
Raes, N.*1, Saw, L.G.2, van Welzen, P.C.1 & Yahara, T.3
1
Naturalis Biodiversity Center - Section NHN, Leiden, the Netherlands.
2
Forest Research Institute Malaysia (FRIM), Kuala Lumpur, Malaysia.
3
Center for Asian Conservation Ecology, Kyushu University, Japan.
*e-mail: niels.raes@naturalis.nl
The Global Legume Diversity Assessment (GLDA) proposes the legume family (Fabaceae or
Leguminosae) - one of the largest and economically important plant families - as a target for a global
botanical diversity assessment project. Where in the Neotropics and Africa legumes dominate the rain
forest in terms of diversity and abundance, the Dipterocarpaceae claim this role in South East Asia
and on Sundaland in particular. This raises the question whether legumes are an indicator for overall
botanical diversity on Sundaland? To answer this question we use the largest compiled database of
collection records of the region and species distribution modelling techniques. As a proxy for total
botanical diversity we selected seven other plant families; Dipterocarpaceae, Ericaceae, Fagaceae,
Lauraceae, Moraceae, Myristicaceae, and Sapindaceae. Although the legumes were the most diverse
family, the predictive power of legume diversity for overall botanical diversity was poor. This related
to the fact the other seven selected families largely represent trees, whereas legume species more
equally represent all different growth forms. After assigning individual legume species to different
growth habits (tree, liana, herb, miscellaneous) we were able to predict 78% of the variance in
botanical diversity on Sundaland. The lianas represent the single growth habit that best predicted
(66%) the variance in botanical diversity. The herb and miscellaneous growth habits had an inverse
relationship to botanical diversity. Legumes can be used as a predictor of overall botanical diversity in
tropical and seasonal rain forests, but the relationship should be fitted for different biogeographic
regions individually.
Keywords: Legume, indicator, Sundaland, Global Legume Diversity Assessment (GLDA)
Session 6
TAXONOMY & SYSTEMATICS-5
Convener: Julisasi T Hadiah, Bogor Botanic Gardens & Peter Wilson, Royal Botanic Gardens,
Sydney
Chairperson: Lahiru Wijedasa, Singapore Botanic Garden
Venue: Sulawasi Room
15.30 – 15.45 David Purvis & Peter Wilkie: Making sense of old handwriting: examples from
Sapotaceae
15.45 – 16.00 Joan Pereira et al.: Towards a revision of Payena (Sapotaceae) in Malesia
16.00 – 16.15 Michele Rodda et al.: Towards a revision of the genus Hoya (Apocynaceae –
Asclepiadoideae)
16.15 – 16.30 Sota Yamamoto et al.: Capsicum pubescens in Java and Sumatra islands,
Indonesia
16.30 – 16.45 Tze Leong Yao: A taxonomic revision of Peninsular Malaysian Thottea
(Aristolochiaceae)
16.45 – 17.00 Fernando B Aurigue & Jorge R Sahagun: Why Filipinos are proud of Philippine
Hoyas
A key activity in the production of the Sapotaceae account for Flora Malesiana is the databasing of
herbarium specimens from across the region. One of the most time-consuming aspects of this is
deciphering old hand written collection labels. This presentation will provide examples found in
Sapotaceae, highlight how difficulties have been resolved and provide suggestions on how we can all
make this process more efficient.
Keywords: handwriting, collector, Malesia, databasing
An overview of the genus Payena A. DC. from the Malesian region is provided. This includes a
summary of the taxonomic research undertaken to produce the account for the Tree Flora of Sabah
and Sarawak and current taxonomic and molecular phylogenetic research for the Flora of Peninsular
Malaysia. Future plans to produce a revision of the genus across Malesia will also be outlined.
Keywords: Payena, taxonomy, molecular phylogenetics, Malesia
Hoya R.Br. is one of the larger genera in Apocynaceae s.l. It has a broad distribution area extending
from South Asia, across Southeast Asia, to the Pacific Islands. Highest species-richness has been
observed in the Malesian Region. Since 2006 the authors have started taxonomic investigations on the
genus to update the only available listing of all Hoya species, completed by Decaisne and now 169
years old, with the goal to prepare a modern generic revision. The talk will report the progresses made
so far and the challenges lying ahead, in particular related to: (i) correct species identification, (ii)
species complexes, (iii) taxonomic inflation, and (iv) extent of undescribed diversity.
Keywords: taxonomy, systematics, nomenclature, large genera, species complexes
Capsicum pubescens originated in mid-elevation Bolivia and is still primarily cultivated in Andean
South America and in the Central American highlands; however, its cultivation in the rest of the world
remains unknown. The present study is the detailed report of C. pubescens as a well-utilized crop at
the local level outside the Americas. Literature, specimen, field, and market surveys of C. pubescens
were conducted in Indonesia to investigate its introduction into Indonesia and to reveal its present
distribution and cultivation. Three specimens, which were collected in West Java in 1916 and stored
as Capsicum sp., were re-identified as C. pubescens. Bandung and the surrounding highlands in West
Java and the Dieng Plateau in Central Java are considered the center for C. pubescens cultivation and
distribution on Java Island. Cultivation of C. pubescens was also confirmed in East Sumatra.
Although C. pubescens normally bears purple flowers occasionally with a white center, mutant plants
bearing pure white flowers were found throughout West and Central Java. It is unclear if the white
flower type was introduced into Indonesia at the same time as the purple flower type, or if it has
occurred as a mutation.
Keywords: Bandung, cultivation, Dieng Plateau, ethnobotany, specimen, tropical highlands,
white flower type
Leong, Y.
Forest Research Institute Malaysia, Kepong, Selangor, Malaysia
e-mail: yaotzeleong@frim.gov.my
Thottea (Aristolochiaceae) of Peninsular Malaysia is revised. Distribution maps are provided and
conservation status is assessed. Nine new species, namely T. anthonysamyi, T. kamarudiniana, T.
longipedunculata, T. papilionis, T. piscodora, T. praetermissa, T. reflexa, T. ruthiae, and T.
terengganuensis are described and illustrated. Thottea dependens and T. tricornis are redefined and T.
parviflora is lectotypified. Thottea is now represented by 16 species in Peninsular Malaysia.
Keywords: Thottea, new species, Peninsular Malaysia
The release of Philippine postage stamps featuring eight Hoya species promotes Philippine hoyas to
the world and makes Filipinos proud of their native plant species. The diversity in Philippine hoyas
and variation in color forms of certain species have intensified the interest of Hoya collectors and
increased the demand for planting materials within and outside the Philippines. Filipino collectors of
native hoyas have either turned their hobby into a sporadic small-scale business or ventured into
international trading. Selling well-grown plants in various containers with or without flowers, or
rooted or fresh cuttings, became the livelihood or additional source of income of wild-plant gatherers
and commercial growers. New species and new color forms of old species are most saleable locally
and abroad. Aside from the ornamental value of Hoya, at least three indigenous species have been
recorded with medicinal properties. Their use in traditional medicine is seldom practiced nowadays
but there is a wide potential application of compounds extracted from them for treatment of certain
diseases.
Keywords: Hoya, medicinal property, native plant, ornamental value, Philippines, postage stamp
Session 6
PTERYDOPHYTE-3
Convener: Dedy Darnaedi, Research Center for Biology, LIPI & Peter Hovenkamp, National
Herbarium of Netherlands
Chairperson: Wita Wardani, Research Center for Biology, LIPI
Venue: Sumatera Room
15.30 – 15.45 Peter Hovenkamp: First results of the analysis of Woodsiaceae from Mount
Kinabalu
15.45 – 16.00 Xian-Chung Zhang: Relationships of ferns between Flora of China and Flora
Malesiana
16.00 – 16.15 David Middleton & Stuart Lindsay: The ferns of Thailand, Laos and Cambodia
16.15 – 16.30 Sangeeta Rajbhandary & Rita Thapa: A synopsis of the genus Pteris L. in Nepal
16.30 – 16.45 Titien Ng et al.: Distribution maps and population size of the Golden Chicken
Fern Cibotium barometz (Cibotiaceae) in Sumatra – Indonesia
Hovenkamp, P.
Naturalis Biodiversity Center, section Botany (formerly Nationaal Herbarium of the Netherlands)
The Netherlands
During and after the Naturalis/Sabah Parks 2012 expedition to the Kinabalu-Crocker Range National
Park (Sabah), over 80 specimens of Woodsiaceae ferns were collected in the Kinabalu-Crocker Range
National park and in Kuala Belalong, Brunei. From these collections, barcode markers rbcL and trnL-
F were amplified and sequenced. In combination with morphology, this led to the recognition of at
least 27 taxa, representing 2/3 of the known flora of the area for this family. Analysis of the barcode
markers confirms recent studies on the generic subdivision of the family. I will discuss the utility of
these markers in this group of ferns for the recognition of taxa at species level, and the implications of
a wider comparison for the historical biogeography of this group. In the field, I gave special attention
to collecting the underground parts of the plants, and I will also show the taxonomic utility of
characters of the roots and rhizome in particular in the genus Diplazium.
Keywords: Woodsiaceae, Mount Kinabalu, Barcode markers, Historical biogeography, Morphology
Zhang, X.C.
The Herbarium, Institute of Botany, Chinese Academy of Sciences, China
The fern flora of China and the Malesiana Regions are the richest in Asia with more than 2000 species
respectively. There are about 400 species of lycophytes and ferns are common to both floras. The
families with more than 30 shared species are Polypodiaceae, Thelypteridaceae, Pteridaceae, and
Hymenophyllaceae; and shared species over 20 are Aspleniaceae, Dryopteridaceae, Athyriaceae and
Tectariaceae. Taxonomic revisions are still wanted to estimate correctly the number of shared species
between China and Southeast Asia in some difficult groups.
Keywords: China, Malesia, fern
Ferns are a large and conspicuous component of the plant diversity of Thailand, Laos and Cambodia
but identifying the species is particularly difficult for the non-specialist. The ferns of Thailand were
revised for the Flora of Thailand between 1979 and 1989 but since the completion of that account
more than 70 additional species have been discovered. The last comprehensive revision of the ferns of
Laos and Cambodia was by Tardieu & Christensen in Flore Générale de l’Indo-Chine between 1939
and 1951 since when there have been considerable changes in family and generic delimitation. A
project to provide online information on all of the ferns of these three countries is well under way at
the Royal Botanic Garden Edinburgh with factsheets on all species available at http://rbg-
web2.rbge.org.uk/thaiferns/. Each factsheet has comprehensive nomenclatural information,
descriptions, distribution information, and illustrations and photographs when available. The names of
many species have been updated from previous published accounts of the ferns of these regions and
new species and records can be readily added as they are found. A multi-access key is currently being
developed and will be made freely available online once it is completed. The need for and content of
the website will be discussed and the development of the key outlined.
Keywords: Ferns, Thailand, Laos, Cambodia, website
Pteris L. (Pteridaceae) is a large genus represented by 280 species globally and occupies variety of
habitats. In Nepal 19 species and three subspecies of the genus was reported throughout the tropical,
subtropical and temperate region. But out of 19; two species viz. P. oppositipinna, P. subindivisa are
misapplied names for P. linearis, P. subquinata. Among these P. oppositipinna and P. subindivisa are
not found in Nepal. Present study confirms presence of 20 species and four subspecies of Pteris in
Nepal based on the information about morphology and their distribution patterns. Looking at the
distribution pattern the degree of overlap between the Malesian and Nepalese Pteris was analyzed.
Despite their geographic separation about 40% of Pteris species are common in Nepal and Malesia.
Looking at the morphology some more species may be common. This leads to a comprehensive
revision for taxonomy and phylogeny of Pteris, which is urgently needed, and that could be done by
cooperation between the two flora projects by preparing the account for the Nepalese and the
Malesian Pteris species. This will greatly facilitate knowledge transfer and build scientific network
and expertise in Nepal.
Keywords: Pteris, Nepal, Malesia, distribution
The golden chicken fern Cibotium barometz (Cibotiaceae) is tree fern species that is commonly
recognized as ‘chain fern’ or ‘gouji’ in the medicinal plants trade. This species has been included in
the CITES Appendix II since 1976. The distribution of C. barometz in Indonesia is limited. Sumatra is
the only mainland where the population of this species is abundant. Study on the distribution and
population size of the medicinal fern C. barometz in Sumatra have been conducted from 2005 to 2011.
The objectives of these studies were: (i) To re-inventory and draw the geographical distribution map
of C. barometz in Sumatra; (ii) to assess the status of the populations of C. barometz on the basis of
population size of the adult plant; (iii) to record its ecological characteristics. In this study,
populations were defined as spatially distinct assemblage of plants at certain sites, with no
consideration of genetic structure of the populations. Three varians of C. barometz were recorded. The
maps of geographical distribution of C. barometz with the population size data that includes five
provinces is presented. West Sumatra shows the widest distribution of C. barometz (30 sites) with the
largest population size at Bukit Alang Lauik, Nagari Labuh Gunung, Lareh Sago Halaban Subdistrict,
Lima Puluh Kota District (8,531/Ha). Two populations of C. barometz in Jambi Province are in crital
conditions with only 4 and 7 individuals, respectively, viz.: at Bukit Air Panas (Sungai Medang,
Kawasan Wisata Air Panas Sunngai Medang, Desa Sungai Medang, Kec. Air Hangat, Kab. Kerinci)
and Bukit Tapan (Taman Nasional Kerinci Seblat, Jalan Trans Sungai Penuh-Bengkulu Km 21- Km
22).
Keywords: Conservation, Cibotium barometz, ecology, geographical distribution, medicinal plant,
population size, tree fern
Plenary Address
Mien A Rifai
Plant taxonomy has never been very popular with Indonesian university students,
simply because the way it is presented fails to show clearly its usefulness to their daily life.
One can easily appreciate the students’ reluctance to enjoy the course because more often
than not plant taxonomy instruction has always been stressed on memorizing the numerous
strange Latin plant names, remembering by heart the position of every taxon in its ‘proper’
systematic classification, making illustrations of flower analyses, and on the compulsory
preparation of meaningless herbarium specimens not very much different from those
practiced in kindergarten. Consequently the course given has not been adequate enough to
build up their understanding of the meaning of biodiversity (including its aspects of study,
utilize, and conserve) as required by the modern world society. It is very likely that the
scarcity of capable Indonesia researchers to actively participate in completing Flora
Malesiana project is the outcome of this unhealthy situation. In an attempt to remedy this
embarrassing predicament a new approach is being taken to present a different taxonomic
course based exclusively on cultivated plants, especially to make the students immediately
aware that it has immediate relevant practical value to the public at large. Towards this end,
the taxonomic laboratory practical and other related activities will be linked up with
ethnobotany capable of producing information and data of local interest, and to ensure that
the undergraduate research exercises as well as the postgraduate theses undertaken are geared
to assist the speedy development of superior cultivars with their much needed distinct,
uniform, and stable agronomic characters. A relevant textbook jointly written by numerous
students and lecturers from many Indonesian universities is being prepared.
Session 7
ECOLOGY-1
Convener: Rochadi Abdulhadi & Laode Alhamd, Research Center for Biology, LIPI
Chairperson: Eizi Suzuki, Faculty of Science, Kagoshima University
Venue: Borneo Room
09.45 – 10.00 Sulistijorini et al.: Change of structure and composition of understory plants at
lowland rainforest transformation system
10.00 – 10.15 Freda Wong & Teodora Balangchod: Diversity of nontimber species in a
communal forest in Bayabas, Sablan, Benguet Province, Philippines
10.15 – 10.30 Mahardika P Purba et al.: Population and ecological genetics in tropical forest
ecosystem restoration
10.30 – 10.45 Tetsukazu Yahara et al.: Plant diversity assessments using a standardized transect
method in Cambodia, Indonesia, Malaysia, Thailand and Vietnam
Muhamad, A.1, Tennakoon, K.1, bin Abdul Majid, M.1, Wang, H.C.1, Abd Salam, S.1& Bolin, J.F.2
1
Biology Program, Faculty of Science Universiti Brunei Darussalam, Brunei Darussalam
2
Department of Botany, Smithsonian Institution, Washington, DC & Catawba College, Department of
Biology, Salisbury, North Carolina, USA
associating hosts living under same microhabitat conditions. However, there was no significant
difference in chlorophyll a and b in relation to corresponding host plants. High quantum yield shown
in the flowers of B. coelestis than its reduced leaves and stems indicated the significant role played by
flowers in relation to the overall primary productivity of the plant. High stomata density in B.
coelestis showed the ability of these plants to passively absorb nutrients from the adjacent hosts
through the network of symbiotic mycorrhizas. The natural abundance stable isotope distribution
profiling of δ13C and δ15N provided clear evidence of B. coelestis’ scavenging of organic carbon and
nitrogen form the adjacent hosts living in the immediate microhabitats.
Keywords: mycoheterotrophy, Burmannia, mycorrhizae, stable isotopes, achlorophylly.
Rainforest transformation system is conversion of natural forest into agricultural system or other
function, lead to more open forest canopy and more light into the forest floor. Diversity of understory
plants may be hardly affected by rainforest transformation system since most of the plants are
harbored in shaded habitat of the rainforest. This research aimed to observe the change of structure
and composition of understory plants in lowland rainforest transformation system. Sampling was
conducted in the plots established at three different sites, representing rubber jungle, rubber plantation,
and oil palm plantation at Sarolangun, Jambi, Indonesia. Understory plants investigated within a total
of three 50 m x50 m permanent plots in each site with five subplots of 3 m x 3 m in each plot.
Parameters on the diversity of understory plants in term of species richness and abundance .The
number of species found in rubber jungle (36 species) much more than in the rubber plantation (25
species) and oil palm plantation (23 species). In the rubber jungle and rubber plantation Dicranopteris
linearis was a species with importance value index (IVI) 59.84% and 40.08%) higher than other
species. In the oil palm plantation Clidemia hirta and Nephrolepis sp. with IVI 29.18% and 28.69%
were higher than it other species. Differences in the composition and structure of the understory
vegetation in the three habitats were attributed to shading by trees and cultivation techniques.
Keywords: understory plants, rainforest transformation systems, shade plants, cultivation techniquese.
Establishing a baseline data in a forest provides inventory of the floral composition. This is necessary
for monitoring, sustainability and conservation efforts. The survey of plant species within forests
provides information regarding plant status and allows for allocation of resources. Nontimber species
are economically important especially to indigenous people as source of livelihood and food. In
Benguet Province, Philippines, the Bayabas Communal Forest is one of the six declared communal
forests in the Municipality of Sablan, which is a home for the indigenous group of Ibalois. The forest
serves as source of firewood, food, and medicinal plants. Ecological survey of the Bayabas
Communal Forest is significant for biodiversity studies since there is lack of published literature
regarding its flora and it is one of the remaining forest patch in the Cordillera region. The 13-hectare
communal forest was surveyed through gradsect method to determine the nontimber species in the
area. There were 15 nontimber species identified belonging to two families of nonvascular plants
(Lygodaceae and Pteridaceae) and eight families of vascular plants (Amaranthaceae, Araceae,
Asteraceae, Maranthaceae, Palmae, Piperaceae, Poaceae, and Rubiaceae). Among the species
identified, Donnax cannaeformis (G. Forster) K. Schaumann belonging to Marantaceae has the
highest importance value (38.19%). Donnax cannaeformis (G. Forster) K. Schaumann is commonly
known as bamban or banban in the Philippines and local communities use this as antidote to snake
bites.
Keywords: Benguet Province, communal forest, diversity, forest patch, nontimber, indigenous group,
Ibalois.
The Harapan Rain Forest (HRF) in the Indonesian province of Jambi, Sumatra is one of the few
protected areas in the lowlands of Sumatra. Forest ecosystem restoration on this scale has never been
done before so will require the development of new techniques and approaches. One of the unique
species which can be found in Harapan rainforest is Ironwood (Eusideroxylon zwageri) or locally
known as Bulian or Ulin from the family of Lauraceae. Bulian/ Ulinis native to Sumatra and
Kalimantan. It is the most famous and well known durable hardwood timber tree species which is
classified into Strength and Durability class I. Increase demand for this tree species has caused a high
price and accelerated logging activities, hence, their potency and population decreased significantly.
The information of genetic diversity of Ironwood is still limited therefore this species must be studied
thoroughly using molecular techniques to identify genetic variation within and among populations in
order to conserve the rapidly declining Ironwood populations. The availability of information genetic
diversity of this species is essential for designing an appropriate sampling strategy for genetic
conservation purposes. Genetic markers are needed to study many aspects of forest trees such as
reproduction system, genetic diversity and gene flow. Another idea is to study the reproductive
ecology of the Ironwood species. Focus is on seed dispersal, because this aspect seems to be un-
solved, and the potential role of endangered animals is highly relevant in the conservation context. In
order to clarify, the project will compare populations from Harapan rainforest with populations from
less disturbed areas in national park –based on parentage analysis of seedlings and mature trees based
on DNA markers (to be developed as part of the project).
Keywords: Ironwood, ecosystem restoration, population genetics, genetic diversity, tropical forest,
conservation.
Yahara, T.1, Tagane, S.1, Toyama, H.1, Fuse, K.1, Nagamasu, H.2, Suzuki, E.3, Fujii, S.4, Naiki, A.5,
Phourin, C.6, Darnaedi, D.7, Ardiyani, M.7, Syamsuardi, A.8, Saw, L.G.9, Lim, C. L9, Suddee, S.10,
Rueangruea, S.10, Marod, D.10 & Dang, S.11
1
Kyushu University, Japan, 2Kyoto University, Japan, 3Kagoshima University, Japan, 4University of Human
Environments, Japan, 5Ryukyu University, Japan, 6FA, Cambodia, 7Research Center for Biology-LIPI,
Indonesia, 8Andalas University, Indonesia, 9FRIM, Malaysia, 10Forest Herbarium, Thailand, 11ITB, Vietnam
.
To assess current status of plant diversity in tropical Asia, we are recording all the plant species
including herbs, shrubs, epiphytes, vines and trees within a standardized transect of 100m x 5m. We
placed 15 transects, 10 transects and 7 transects in Gn Gede/Pangrango (Indonesia), Phnom Bokor
(Cambodia) and Doi Inthanon (Thailand), along altitudinal gradients. We also placed additional
transects in lowland Cambodia, SW and SE Thailand, S Vietnam, Malay Peninsula, W Sumatra and
W Kalimantan. We took pictures, made specimens and collect DNA samples for all the species
recorded. Until today, we made 12,603 specimens including sterile vouchers. The highest record of
species richness within a transect was 396 species in W Sumatra, followed by 392 in W Kalimantan.
In Indochina, the highest record was 341 species in Honba, Vietnam followed by 276 species in
Bokor, Cambodia. Proportion of new species may be the highest in Honba, Vietnam. Conservation
efforts in those areas are of primary importance. We are preparing open-resource database for those
collections including pictures and specimen images and we call international collaboration for this
plant diversity assessment using a standardized transect method.
Session 7
BIOGEOGRAPHY-2
Convener: Peter C van Welzen, Naturalis Biodiversity Center, The Netherlands
Chairperson: Fabian Brambach, Gottingen University, Germany
Venue: New Guinea Room
09.45 – 10.00 Chih-Chieh Yu & Chung Kuo-Fang: Out of Asia- the biogeographic origins of
insular clades of Berberis s.s.
10.00 – 10.15 Darren Crayn et al.: The Sahul-Sunda floristic exchange: dated molecular
phylogenies document post-Miocene intercontinental dispersal dynamics
10.15 – 10.30 Charles Cannon et al.: Archipelago wide land-area change during the Quaternary
The Acacia s.s. clade, with over 1000 species, forms a well known dominant element of the
Australian flora; it also includes 18 phyllodinous taxa with distributions outside the continent, in
Malesia and on islands of the Pacific and Indian Oceans. Dating divergences of the Acacia clade will
allow investigation of what were the drivers for the lineage’s diversification and the timing of
biogeographical links between Australia and Malesia (and beyond). In the past, efforts to date
divergences in Acacia have been hampered by difficulties in applying appropriate fossil dating
constraints, in combination with the lack of a well-supported phylogeny. In this study, we use the
extensive Mimosoideae microfossil pollen record to provide reliable age constraints, and apply these
to densely sampled molecular phylogenies to produce a comprehensive divergence dating study of
Acacia and related mimosoid legumes. We describe and provide dating estimates for the major clades
of Acacia, and include those Acacia species found outside Australia. From these results we infer the
timing of diversification and biogeographic links to Malesia and oceanic islands beyond the region.
Keywords: phylogeny, Mimosoideae, legume, molecular dating, Acacia.
Species of Berberis s.s. are distributed widely across temperate, alpine, or semi-arid habitats of the
Northern Hemisphere. In many western Pacific Islands, they are characteristic shrubby species
prevailing in subalpine steppes and montane-temperate forests. However, the biogeographic origins of
these isolated insular species have never been studied in modern phylogenetic context. Based on a
worldwide sampling of Berberis s.s., the phylogenetic relationships of the barberries inhabiting
western Pacific islands were examined using nrITS and six chloroplast markers. As a main result, we
found that most insular lineages are derived from ancestors in continental Asia. Specifically the
Japanese deciduous barberries are closely related to central and northern Asian species while the only
alpine deciduous species in Taiwan is sister to taxa of Himalaya origin. For evergreen barberries that
are represented predominately by sect. Wallichianae, we identify two independent migration events
from southwestern China to Sumatra and toTaiwan and Luzon. Molecular dating indicates that these
migrations had occurred during the late Tertiary to the Quaternary when deteriorating paleo-climate
could have increased the seasonality in the region. The lower average annual temperature could have
also provided more suitable and novel habitats for the colonization and expansion of Berberis s.s.to
these islands.
Keywords: historical biogeography, phylogeny, disjunct distribution, tropical mountain flora.
Since the collision of the Sunda and Sahul shelves in the early Miocene, the Malesian region has been
an important stage on which exchange between Laurasian and Gondwanan floras has played out. The
accumulation of dated molecular phylogenies of diverse Malesian lineages now allows deeper
exploration of the dynamics of this exchange through time than has hitherto been possible.
We undertook a meta-analysis of published dated phylogenies of plant groups represented in Sunda
and Sahul and identified clades that are disjunct across Wallacea. From these we determined rate and
direction of lineage exchange (=migration) through time and related these exchange dynamics to
changing landmass configurations and dispersal ecology. Our results suggest that long distance
dispersal was not an important process contributing to the exchange between and assembly of Sunda
and Sahul floras, because no disjunctions dated to earlier than c. 20 Ma were observed. Subsequently,
despite the two shelves being in close proximity (<100 km) from c. 18 Ma, exchange was slow until
the mid Miocene (c. 12 Ma) when New Guinea orogeny began to intensify. After this time, the
exchange rate increased. The successful migrants were predominantly zoochorous, megathermal
lineages supporting previous hypotheses of the importance of dispersal mechanism and phylogenetic
niche conservatism in the assembly of Sundanian and Sahulian floras.
Keywords: Molecular phylogeny; Wallacea; dispersal; historical biogeography; Malesia; Australasia;
flora; Wallace’s Line; molecular dating.
Cannon, C.
Texas Tech University and Xishuangbanna Tropical Botanical Garden
The effects of sea level change during the last two million years varied dramatically across the
archipelago. While previous work has focused on Sundaland, an archipelago wide study reveals
possible interesting effects on the other islands as well. In this study, I will highlight the major
differences among the islands and the possible implications for connectivity and diversity. Ultimately,
a close correlation between historic land area and plant diversity across the region may provide a
straightforward explanation for diversity.
Keywords: ice ages, sea level, Wallacea, Philippines, Papua.
Raes, N.1, Frenken, M.A.1, Saw, L.G.2, van Loon, E.E.3 & van Welzen, P.C.1
1
Naturalis Biodiversity Center - Section Botany, the Netherlands
2
Forest Research Institute Malaysia (FRIM), Malaysia
3
IBED - UvA, Amsterdam, the Netherlands
The earliest accounts of detrimental deforestation on Java date from 1850 by Junghuhn and Zollinger.
Presently less than 10% of the natural vegetation cover of Java remains. Although vegetation
descriptions and maps with the different forest types of Java do exist, notably the vegetation maps of
van Steenis, Hannibal and Whitmore, these maps are largely based on expert opinion. With the
ongoing digitization of botanical collections a wealth of information on collection localities of
individual species have, and still are becoming available. By relating these specimens per species to
spatial data of abiotic conditions, i.e. temperature, precipitation, soil pH, etc., allows predicting island
wide distributions of individual species based on their abiotic niche conditions. This technique is
known as species distribution modelling. Stacking of these maps results in a predicted
presence/absence matrix for the whole of Java. We analysed this matrix with a partitioning around
medoids (PAM) cluster analysis. We were able to distinguish six distinct vegetation types. We present
the map of the 'Reconstructed flora of Java', identify characteristic species per vegetation type with an
indicator species analysis, and quantitatively compare the results with the above mentioned maps
using the map curves algorithm.
Keywords: Flora reconstruction, Java, species distribution modelling, vegetation types.
Session 7
LOCAL FLORA-1
Convener: Elizabeth A Widjaja, Research Center for Biology, LIPI & David Mabberley,
Royal Botanic Gardens, Sydney
Chairperson: David Mabberley, Royal Botanic Gardens, Sydney
Venue: Sulawesi Room
09.30 – 09.45 Rogier de Kok & Gemma Bramley: Local floras, revisions or neither: what speed
up the prodution of Flora Malesiana treatment?
09.45 – 10.00 Leng Guan Saw et al.: Flora of Malaysia – its challenges and future
10.00 – 10.15 Max van Balgooy & Elizabeth A Widjaja: Towards a flora of Bali, a cheklist
10.15 – 10.30 Elizabeth A Widjaja: Floristic study of Mekongga protected areas: towards
establisment of the Mekongga National Park
10.30 – 10.45 Kwek Yan Chong et al.: The flora of a remnant freshwater swamp forest in
Singapore
The Flora Malesiana (FM) is still far from complete. What might speed up the production of family
accounts? The Lamiaceae is represented by c. 300 species in Malesia; the FM account is now ready
for submission to the Editors. As well as updates to Keng (1978), the Lamiaceae treatment has been
put together using regional revisions, monographs and local flora accounts (The Tree Flora of Sabah
and Sarawak and Flora of Peninsular Malaysia). The process has taken roughly 12 years, initially with
one author, increasing to five core authors over the last five years. Whilst regional revisions and
monographs have sped up production of the family treatment, arguably, writing local flora accounts
has slowed it down. Co-ordinating multi-author accounts is time consuming, as is formatting those
accounts to follow the various different requirements of Editorial Boards. However, local floras
provide a much-needed resource to the scientific community and are often more accessible to users. In
the future, e-taxonomic platforms will be vital to make preliminary information for larger floristic
areas widely available before the official accounts are complete: online species pages are an easy way
to display nomenclatural information and distribution maps, as well as descriptions and images.
Keywords: Lamiaceae, Flora Malesiana, revisions, local flora.
Malaysia has a rich flora of possibly well over 15,000 species of vascular plants. Located on the
Sunda Shelf, its geography straddles over two regions, Peninsular Malaysia connected to mainland
Asia and East Malaysia with the states of Sabah and Sarawak on the island of Borneo. Each region
has its distinct floristic component and phytogeography. Peninsular Malaysia has about 8,300 species
and East Malaysia estimated to have about 12,000 species. The challenges of running a viable Flora of
Malaysia project include the following. The political history of the two regions charted differences in
the documentation of the regional floras. The flora is better covered for Peninsular Malaysia and is
rather poor for Sabah and Sarawak. Historically also, there is no dedicated botanical institution in
Malaysia, most of the botanical research and documentation of our flora has been centred in forestry
research institutions and local universities. The only dedicated botanical institution with active
botanical research is found in the Singapore Botanic Gardens. However, in 1965 Singapore ceded out
of Malaysia that resource was lost. A multi-phase approach has been adopted for the completion of a
modern treatment for the Flora of Malaysia. The accounts started with the Tree Flora of Malaya. This
completed in 1989. This then is followed by the Tree Flora of Sabah and Sarawak in 1991 and Flora
of Peninsular Malaysia in 2005. After the completion of the Tree Flora of Sabah and Sarawak, it is
planned that the Flora of Sabah and Sarawak to be initiated. Following the completion of the regional
floras, the consolidation for a flora of Malaysia will then be considered. Its format and expression (e.g.
print form or digital format or both) can be determined at a later stage. Running the current two flora
accounts, the project faces challenges in manpower capacity, budget constraints, and institutional
priority, needs and demands. The project is also mindful of regional projects such as the Flora of
Thailand, Flora Malesiana and Flora of the Philippines. Our project has tried to tap into the expertise
found in these other projects and we have benefited much by the collaborations given by many
botanical institutions. Making the flora project more pertinent and useful to other stakeholders, our
project has now included strong elements of conservation and conservation biology, we have now
looked into producing other products other than the traditional publications of revision volumes and
taxonomic revisions in journals.
Keywords: national flora, tree flora, Peninsular Malaysia, Sabah and Sarawak.
The flora of Bali is poorly known. To remedy the situation a checklist has been compiled by
Herbarium Bogoriense, Kebun Raya Eka Karya and Naturalis Leiden. The list, based on collections in
the above institutes and literature, is certainly incomplete. We have focused on indigenous plant
species, but naturalized and commonly cultivated species are also included. The distinction between
naturally occurring and alien species is not always easy. The status of some species may have to be
changed in future. Moreover, not all identifications are reliable. Here too changes can be expected.
Therefore the checklist is to be regarded as provisional, but may serve as a basis for a flora of Bali.
Thorough exploration of the island is needed before such a project can be undertaken.
Keywords: Flora Bali, indigenous, naturalized, cultivated.
Mekongga is one of the highest mountains in Southeast Sulawesi. The Mekongga region was
designated as a protected forest in 1994, after logging had been done in this area. A floristic study of
this forest was conducted from 2009 through 2011 by visiting the area twice a year during the dry and
wet seasons to collect flowering and fruiting plant specimens. Other species which was collected
during ecological study were also recorded, but many of them cannot be identified because the plants
were too young or in the steril condition. Specimens of 819 species in 162 families were collected, of
which 5% (39 species) are endemic species and 11% (91 species) are introduced species from China,
South America, India, or even Madagascar. New records for Mekongga were collected also for
species originally known only in Java (50 species), Malaysia (35 species), the Philippines (28 species),
New Guinea (14 species), Sumatra (13 species), Borneo (11 species), Moluccas (4 species), and
Lesser Sunda Islands (3 species). Based on these data, it may be implied that these species apparently
have migrated to Mekongga mostly from Java, then from Malaysia and the Philippines. More than 10
new species of, Poaceae (a bamboo) Orchidaceae, Gesneriaceae, Melastomataceae, Myrtaceae, and
Araliaceae. are proposed from this area. Further study of the floristic account will be undertaken to
provide basic and supporting data in an effort to formulate an urgently needed proposal to designate
the Mekongga area as a national park.
Keywords: Mekongga, floristic, national park, Sulawesi.
Chong, K.Y.1, Koh, C.Y.2, Neo, L.1, Siow, H.J.M-P.2, Tan, S.Y.2 & Tan, H.T.W.1
1
Department of Biological Sciences, National University of Singapore, Singapore
2
Tropical Marine Science Institute, National University of Singapore, Singapore
Periodically or permanently flooded lowland rain forests on peat and non-peat soils are challenging
environments to work in. As a result, they may be under-studied compared to forests on relatively
drier and more solid ground. The area known as the Nee Soon Swamp Forest, located within
Singapore’s Central Catchment Nature Reserve, contains the last remnant of primary freshwater
swamp forest of a significant size for the city-state. This area has recently seen a number of
rediscovered presumed nationally extinct species and new local records. We present the initial results
from a set of nine vegetation plots that compare the flora of dry and wet areas within the Nee Soon
area. Thirty-one more plots will be surveyed over the next year, and these will form the basis for eco-
physiological measurements that aim to understand the vegetation-hydrology dynamics. We anticipate
that the plots will reveal more floristic discoveries despite Singapore being already relatively well-
botanized. Likewise, we expect that more botanical collections and studies in Malesia’s swamp forests
are necessary for a more complete understanding of the regional flora.
Keywords: freshwater swamp forest, floristics, rediscoveries, new records, urbanization, climate
change.
Session 7
FUNGI-1
Convener: Iman Hidayat & Atik Retnowati, Research Center for Biology, LIPI
Chairperson: Iman Hidayat, Research Center for Biology, LIPI
Venue: Sumatera Room
09.30 – 09.45 Edwin R Tadiosa et al.: Occurrence and diversity of fungi in the national park and
protected landsccape of Southern Tagalog Region, Philippines
09.45 – 10.00 József Geml et al.: High-throughput DNA sequencing provides first insights into
the fungal diversity of lowland rainforests and montane cloud forests in Borneo
10.15 – 10.30 Kartini Kramadibrata: Glomeromycota on Pandanus tectorius in Java and Madura
Protected areas in the Philippines are ideal study sites for fungi due to its superb climate, cold weather,
and lush vegetation. Thus, our research study aims to determine the fungi present in the declared
National Park and Protected Landscape in the Philippines’ Southern Tagalog Region (PSTR). Four
transect lines were established in each seven study sites from 100 m to 1050 m asl with 20 m x 50 m
quadrat sampling each transect line (TL) and with an interval of 200 m between quadrats. The fungal
species within the quadrats along the TL’s were collected, identified and recorded. Opportunistic
sampling method was also used during the survey.
A total of 235 species under 99 genera, and 42 families were collected from the study sites, with a
high number of fungi collected in different substrates, i.e 100-105 species, collected from stump. Of
these, 218 belong to Phylum Basidiomycota, and 17 Ascomycota. These be part of Order Agaricales,
Boletales, Cantharellales, Dacrymycetales, Geastrales, Gomphales, Hymenochaetales, Phallales,
Polyporales, Russulales, Tremellales, Pezizales, and Xylariales. Among the collected species,
Hexagonia tenuis, Microporus xanthopus, and Schizophyllum commune were recorded to be the most
abundant. Eight species were noted as rare.
Among the significant findings include Cymatoderma elegans, Ganoderma tsugae, Macrolepiota
rhacodes, Cookeina sulcipes, and Galiella rufa, as the new record fungal species in PSTR, and one
possible new species of the genus Hexagonia. Further field surveys of the protected areas are
anticipated to uncover a rich and diverse fungal flora in the area. Although generally well protected,
the areas are currently experiencing some degree of anthropogenic disturbances such as carabao
logging, minor forest products gathering, and kaingin making or slash-and-burn farming. Fungal
diversity research efforts need to be encouraged to evaluate the effects of these human disruptions on
the ecology of the national park.
Keywords: fungi, protected landscape, species abundance, species distribution, species diversity.
Borneo is one of the world's most biologically diverse areas and is famous for its high endemism.
While the majority of biodiversity studies and conservation efforts have been focused on
vascular plants and vertebrates, fungi, hyperdiverse group with key ecological functions, remain
a largely unexplored. To partly fill this tremendous gap in our knowledge, we carried out
diversity assessment by using next-generation DNA sequencing of soil fungal communities. Soil
samples were taken in Kinabalu and Crocker Range Parks in Sabah, Malaysia along an
altitudinal gradient, from Lowland and Hill Rainforest (150-1,200 m) and Lower Mountain
Forest (1,200-1,900 m), to Upper Mountain Forest (1,900-2,700 m), Ultramafic Rock Forest
(2,700-3,000 m), Lower Granite Boulder Forest (3,000-3,300 m), Upper Granite Boulder Forest
(3,000-3,800 m), and Sub-alpine Meadows (3,200-4,095 m). We found that soil fungi are very
diverse with more than a thousand species-level groups. In addition, fungal communities showed
strong habitat partitioning with many taxa restricted to a certain vegetation type. Our study
provides the first kingdom-wide fungal diversity assessment in Borneo and offers an
unprecedented insight into changes in fungal community structure among the major elevational
vegetation types. In addition, the accummulated data provide baseline information for future
projects, with particular reference to altitudinal patterns in plant-fungal symbioses.
Key words: altitudinal gradient, fungi, ITS rDNA, Kinabalu, next-generation sequencing.
Retnowati, A.
Herbarium Bogoriense, Botany Division-Research Center for Biology-LIPI
aretnowati@hotmail.com
Species of Indonesian Agarics had been reported by foreign mycologists who actively collected and
studied the taxa mostly from Java. Continuing their previous research,“The Agaricales of Java and
Bali” project from 1998 to 2000 was carried out in order to explore the species of agarics in Java and
Bali by Dennis E Desjardin and Egon Horak. Supported by type studies, recently collected specimens,
and molecular data it is currently recognized approximately 15 Balinese species on a number of
genera, Marasmius, Gymnopus, Psilocybe, Lactarius. To accomplish the information of Agaricales in
Bali, a four year project was initiated. The first trip to Bali was conducted in May 2013, and it has
been encountered 59 collections of Agaricales. These colections belong to 22 genera in 8 families,
represent conservatively 53 species, and 3 out of 59 are unidentified due to the ambiguous characters
either microscopic or macroscopic. Approximately 75 % of the species (41 spp.) belong to
Tricholomataceae with the next group being the Entolomataceae (3 spp). Clearly, the most common
agarics in Bali, both in abundance and species diversity, are white-spored and saprotrophic taxa. Some
are ectomycorrhizal fungi, such as Inocybe and Lactarius, which associate with some mycorrhizal
trees. Complete information on the diversity, genera encountered, potential value, and habitat of
Agaricales collected, will be presented.
Keywords: Agaricales, Bali, ectomycorrhizal fungi, saprotrophic.
Kramadibrata, K.
Herbarium Bogoriense, Botany Division-Research Center for Biology-LIPI
E-mail: kkrama05@gmail.com
Glomeromycota is a group of fungi which usually symbiotic with most of terrestrial plants and
produce arbuscular mycorrhiza inside the root. Information on its diversity, particularly in Indonesia
remains underexplored, as a result this study is carried out in order to fill the gap on the information
of Glomeromycata diversity. The soil samples collected from several national parks in West Java,
central production of pandan and villages in West, Central and East Java including Madura island.
Glomeromycota spores were isolated from soils around rhizosphere of Pandanus tectorius, and were
identified using their morphological characters. Eleven species of Glomeromycota were identified that
belong to genera Acaulospora (2 species), Glomus (3 species), Claroideoglomus (1 species),
Funneliformis (1 species), and Sclerocystis (3 species). The record of each species is presented.
Keywords: Arbuscular fungi, rhizosphere, national park, coastal area
Susan, D.
Herbarium Bogoriense, Botany Division-Research Center for Biology-LIPI
Hyphomycetes is a group of microfungi with asexual reproductive structure, and it usually called as
fungi imperfecti. It grows in many natural substrates. Approximately 300 species has been described
in Malesia, and 91 species of them were recorded grow on Pandanaceae. To accomplish the previous
research, this study was carried out. Nine species of Hyphomycetes were found on dead leaves of
Pandanus spp. from Ujung kulon National Park (West Java, Java) and Wawonii Island (South East
Sulawesi). Those are Helicoma state of Lasiosphaeria pezicula (Berk. & Curt.) Sacc., Helicosporium
state of Tubeufia cerea (Berk. & Curt.) Booth, Periconia digitata (Cooke) Sacc., Polytretophora
calcarata Sierra, Veronaea botryosa Cif. & A.M. Corte, Microdochium bolleyi (R. Sprague) de Hoog
& Herm.-Nijh., Dictyosporum pandani Whitton, McKenzie & K.D. Hyde, Drechlera sp. and
Helminthosporium sp. Helicoma state of Lasiosphaeria pezicula (Berk. & Curt.) Sacc., Helicosporium
state of Tubeufia cerea (Berk. & Curt.) Booth, and Microdochium bolleyi (R. Sprague) de Hoog &
Herm.-Nijh. are noted as a new information for the availlable data of the list of fungi associated with
Pandanaceae. All species will be described and presented.
Keywords: Hyphomycetes, Pandanaceae, Java, Wawonii, Indonesia.
Session 8
ECOLOGY-2
Convener: Rochadi Abdulhadi, Research Center for Biology, LIPI & Laode Alhamd,
Research Center for Biology, LIPI
Chairperson: Tukirin Partomihardjo, Research Center for Biology, LIPI
Venue: Borneo Room
13.45 – 14.00 Kamziah A Kudus & Khairul N Ya’akub: A comparison of vegetation of logged
over forest area and unlogged forest area in Ulu Muda Forest Area, Kedah,
Malaysia
14.00 – 14.15 N Shida Saari et al.: Establishment of 10-ha permanent plot in Ayer Hitam Forest
Reserve, Puchong, Selangor, Malaysia: a step towards holistic conservation
14.15 – 14.30 Suzana Sabran et al.: Contribution of the Heart of Borneo (HoB) initiative towards
botanical exploration in Sabah, Malaysia
14.30 – 14.45 Dian Rosleine: The effect of land ue history on natural forest rehabilitation at
corridor area of Gunung Halimun National Park, West Java, Indonesia
Satyanti, A.
Center for Plant Conservation Bogor Botanic Gardens
Indonesian Institute of Sciences
e-mail: a.satyanti@gmail.com; annisa.satyanti@lipi.go.id
Seed polymorphisms are important from an ecological perspective. Seed size is embedded in a
complex of attributes which together define the life history of a plant species. Seed mass,indicates the
resources available to the seedling during establishment, governs the species’ ability to establish
under adverse conditions. It is also correlated with the species rate of growth. Seedling growth of
Vatica pauciflora, and other Dipterocarpaceae members are somewhat delicate, especially when the
seeds are raised in nursery. This paper reports the results of an investigation into seed polymorphism,
c.f. seed mass differences of Vatica pauciflora and seedling establishment. We addressed the
following hypotheses: i) seed mass correlated to germination rate and seedling vigour, ii) seedling
vigour was determined by the seed mass categories. Statistical test used were Kruskal Wallis test, and
regression analysis. Seed mass did not affect the germination percentage. Seed mass, on the other
hand, positively affect seedling length (χ2= 38.564, p=0.00), leaf (χ2= 9.867, p=0.00), aboveground
biomass (χ2= 28.331, p=0.00), belowground biomass (χ2= 34.794, p=0.00), and diameter (χ2= 30.519,
p=0.00). The regression analysis resulted R2 for seedling length, diameter, aboveground and
belowground biomass were 0.214, 0.271, 0.288, and 0.315, respectively. Beyond the pertinence of
plant resource allocation, seed production and seedling fitness shown, the result implies for the
importance of seed size selection for silvicultural practice. Large seeds statistically advantageous for
rapid early growth. This study is also relevant to the special importance of seed information for
nursery planning in restoration projects and ex-situ conservation of endangered species.
Keywords: Dipterocarpaceae, germination ecology, resources allocation, seedling growth, life history.
This study emphasizes on the quantitative analysis of trees between an unlogged hill forest area and a
9-years old logged over forest area in Ulu Muda Forest Reserve. Ulu Muda forest Reserve is a
production forest located in the state of Kedah in Malaysia. Two plots of 1-hectare size were
established within both forest area and divided into 100 10 x 10m quadrats. Only trees with dbh
greater or equal to 5 cm were observed. The species name, dbh and tree height were recorded from the
trees. The two plots were compared. The unlogged forest plot has lower number of individuals
compared to the logged over forest area that has 2180 number of individuals. Family Euphorbiaceae
has the highest FVI for both forest areas. Although the logged over forest area has the higher number
of individuals, the most diverse plot were the unloged forest area with 1825 individuals and 179
species surpassing the logged over forest that only has a total of 152 species.
Keywords: hill forest, IVI, basal area.
Establishment of permanent plot is generally for obtaining long-term data on plant diversity, forest
dynamic and species demographic information. 10-ha permanent plot in Ayer Hitam Forest Reserve
(AHFR) was established to meet these objectives and the establishment completed in October 2012.
AHFR, besides being a plot for comparative studies in urban settings, it was also the least chunk of
the remaining forest left in Klang Valley. It was exceptionally interesting to know and document the
biodiversity of this forest, not only due to the diversity of flora and fauna, but because of the
indigenous people from the Temuan Tribe who co-existing part of the 1176.1 ha forest. Documented
floristic composition of AHFR reveal a total of 370 species of trees, 68 species of herbaceous, 7
species of palms, 4 species of bamboos, 39 species of ferns and fern-allies and 43 species of mosses.
Euphorbiaceae was the diverse tree family with 32 species and 17 genera. Agrostistachys longifolia
var. longifolia (Euphorbiaceae) was recorded as dominance species in terms of stem density. The
earliest published floristic data started in 1998 and classify the AHFR as ‘Kelat-Kedondong-Mixed
Dipterocarp type of lowland forest’. Distribution patterns of tree species in AHFR were reported as
random and clumped. Despite of being the green lung for Klang Valley, AHFR also important to
Temuan Tribe as it plays the significant role in their livelihood as they depend on the forest for food
supplies. AHFR was believed to have been settled by the Temuan tribe 400 years ago and they
perpetuate their legacy by naming important landmarks in the area. AHFR provides great opportunity
for researchers to study and monitor the impacts of isolation, fragmentation and human disturbance on
forest structure, forest dynamics and demographics. Apart from flora studies, a few series of fauna
studies also have been documented for this forest by researchers and scientists from various
disciplines. The establishment of the permanent plot is expected to cater for multi-discipline studies
and expected to be formally designated as long-term Permanent Ecological Plot under Center for
Tropical Forest Science (CTFS) global network of forest research plot.
Key words: Ayer Hitam Forest Reserve, Permanent plot, floristic study, long-term permanent
ecological plot.
Sabran, S.1, Nilus, R.1, Pereira, J.T.1, Sugau, J.B.1 & Kugan, F.2
1
Forest Research Centre, Sabah Forestry Department, Sabah, Malaysia
2
Sabah Forestry Department, Sabah, Malaysia
The Heart of Borneo (HoB) declaration is a conservation agreement initiated by WWF and signed by
three countries, i.e., Brunei Darussalam, Indonesia and Malaysia in Bali, Indonesia on 12th February
2007 to protect more than 20 million hectares of forested region on Borneo Island. These forested
areas could be well protected when conservation management plan is in place. One of the crucial
activities to facilitate the planning and formulation of conservation plan is to conduct scientific
expeditions that include botanical exploration. The primary objective of the expedition is to identify
the key conservation targets within the forest reserves. For the past five years, several expeditions
have been conducted by the Sabah Forestry Department under the auspices of the HoB project to
explore various forest reserves with conservation issues within the Heart of Borneo area. This paper
will present the findings which include plant richness, endemism and plant conservation status in each
forest reserves that has been explored.
Keywords: Heart of Borneo (HoB), botanical exploration, plant richness, endemism and plant
conservation status.
Rosleine, D.
LABTEK XI-SITH
Bandung Instite of Technology
e-mail: drosleine@gmail.com
Economic development and population increase cause serious degradation of natural forests in
Indonesia even in protected areas. Corridor area of Gunung Halimun Salak National Park as important
habitat for endangered animals such as Javan gibbon (Hylobates moloch), Javan leopard (Panthera
pardus melas), and Javan eagle (Spizaetus bartelsi) was degraded and fragmented due to conversion
of natural forest into plantation, settlement, infrastucture development, mining, and illegal logging.
However, little is known about recovery process in tropical degraded forest under different land use
history. To clarify vegetation structure and forest recovery related to land use history we placed
randomly 22 quadrats (11 quadrats each 10 x 10 m2 in abandoned plantation, seven and four quadrats
of 20 x 20 m2 in disturbed and less disturbed forest, respectively). Three community groups can be
distinguished as Swietenia macrophylla – Agathis dammara community in abandoned plantation,
Maesopsis eminii – Cyathea latebrosa in disturbed forest, and Castanopsis accuminatissima - Schima
wallichii in less disturbed forest. Below the plantation canopy, light tolerant species (Clibadium
surinamense, Eupatorium inulifolium, and Melastoma malabathricum), weeds, grasses, and fern of
Dicranopteris linearis were dominant. However, some planted exotic species such as Bellucia
pentamera, M. eminii, and Calliandra chalothyrsus escaped from adjacent plantation to forest. The
distant area from community keeps forest in good condition as indicated by the dominance of old
forest species, such as Castanopsis acuminatissima, Quercus oidocarpa, Schima wallichii, and
Altingia excelsa. Forest regeneration in severe degradation area seems difficult to rely on natural
succession. Therefore, human intervention by planting native species can be suggested to avoid
invasive species occupancy as well as accelerate forest recovery.
Keywords: Gunung Halimun Salak National Park, tropical forest rehabilitation, land use, forest
recovery.
Session 8
BIOGEOGRAPHY-3
Convener: Peter C van Welzen, Naturalis Biodiversity Center, The Netherlands
Chairperson: Charles Cannon, Naturalis Biodiversity Center, Netherlands
Venue: New Guinea Room
13.30 – 13.45 Charles Cannon & David Lohman: Near-sensing forest condition
13.45 – 14.00 Fitmawati et al.: Analysis of genetic diversity and mapping distribution pattern of
Mango (Mangifera L.) in Central Sumatera
14.00 – 14.15 Matti Niissalo: When the fossils and molecular phylogeny do not meet – complex
biogeography of the amphipacific tree genus Sloanea (Elaeocarpaceae)
14.15 – 14.30 Aurea L Feliciano et al.: Migration of Lobelia zeylanica (Campanulaceae) from
Taiwan to the Ryukyu archipelago inferred from chloroplast DNA data
With the rapid development of cheap but powerful handheld digital technology, like smart-phones,
point and shoot cameras, and other digital devices, millions of people globally now have the capacity
to collect detailed and high quality observations of the environment. In contrast to 'remote-sensing',
this type of data can be taken at a wide range of physical scales, from the landscape (kms) to the
macroscopic (mms) and can provide powerful data for monitoring forest change and recovery.
Immediately prior to the FM9 conference, we led a field course jointly funded by the US NSF and
Chinese NSF that brought together 30 graduate students from around the world to explore 'near-
sensing' protocols to capture, store, and disseminate high-quality data collected with widely-available
affordable equipment, including an autonomous drone. We feel that these techniques can greatly
expand both data collection and nature appreciation by the general public and research scientists a like.
Keywords: crowd-sourcing, citizen science, biodiversity, signposts
Genetic diversity and genetic material resources are important for success of mango breeding
programmes. Central Sumatra has a variety of habitat types and a high diversity of mango species.
High deforestation made a serious impact on mango and resulted in genetic erosion. Exploration,
inventory, characterization and pattern mapping of the distribution of wild mango species and mango
cultivars are made to improve safe mango genetic resources. This research aims to describe the
diversity and geographic distribution patterns of mangos. We used exploration and spatial modeling
for this research. The results were 900 collections of mangos that include ten species (M. foetida, M.
indica, M. kemanga, M. laurina, M. odorata, M. quadrifida, M. sumatrana, M. torquendra, M.
zeylanica and Mangifera sp.). Mango does not have the same distributed in three province in Central
Sumatra. In the lowland forest of Riau there are 10 species, five species in West Sumatra, and seven
in Jambi.
Key words: diversity, spatial distribution , mango, Central of Sumatera.
Niissalo, M.A.*1,2, Pennington, R.T.2, Richardson, J.E.2, Pennington, T.D.3, Crayn, D.M.4, Baba, Y.4,
Phoon, S.N. & Rousteau, A.5
1
Applied Plant Ecology Lab, National University of Singapore, Singapore
2
Royal Botanic Garden Edinburgh, UK.
3
Royal Botanic Gardens, Kew, UK.
4
Australian Tropical Herbarium, James Cook University Cairns Campus, Australia.
5
Laboratoire de biologie Végétale in Université des Antilles et de la Guyane, France.
* e-mail: matti.niissalo@iki.fi
Sloanea (Elaeocarpaceae) is a large genus of rainforest trees with a disjunct distribution in the Old
and New World tropics. We completed the first comprehensive molecular analysis of the
biogeographic history of the genus, sampling two genes and 49 samples. We used Bayesian and
parsimony methods to assess relationships of Old World and New World taxa as well as the named
sections in the New World. We used fertile Paleocene fossils to date molecular phylogenies, and
assessed the phylogenies to determine whether the family has gained its peculiar distribution via the
Boreotropics or Antarctica. The fossils strongly suggest a New World origin for the genus and
Boreotropical dispersal, as fossils have only been found from continental North America until the
Eocene.
The genus is strongly supported as monophyletic. Analyses suggest that the old world clade of the
genus is basal, with Asian species sister to the others, and biogeographic analysis suggests a Southern
Hemisphere origin, although support for this remains weak. Our results also indicate a minimum age
of 39 Ma for the diversification of the genus, far earlier than previous estimates. Fossil evidence very
strongly supports Boreotropical dispersal, but no support can be found using molecular evidence. In
future, increased gene coverage, and better sampling from both sides of Wallace’s Line may shed
more light on this dilemma.
Keywords: Sloanea, Elaeocarpaceae, phylogeny, biogeography, fossil dating.
Kokubugata, G.*1, Saito, Y.1, Nakamura, K.2, Lopez-Feliciano, A.3, Labuguen, M.L.4 & Yokota, M.5
1
Department of Botany, Tsukuba Botanical Garden, National Museum of Nature and Science, Japan
2
Biodiversity Research Center, Academia Sinica, Taiwan
3
Isabela State University, Echague, Philippines
4
Community Environment and Natural Resources Office, Philippines
5
Laboratory of Ecology and Systematics, Faculty of Science, University of the Ryukyus, Japan
*e-mail: gkokubu@kahaku.go.jp/ aurea.feliciano@yahoo.com
A molecular phylogenetic analysis of Lobelia zeylanica, broadly distributed in tropical Asia, was
conducted to elucidate its migration route to the northernmost populations in subtropic Yonaguni
Island, the Ryukyu Archipelago of Japan. The present analysis using rbcL gene and trnL-F intergenic
spacer region of chloroplast DNA revealed that all two Yonaguni plants and three of four Taiwanese
plants shared identical sequences for the two markers. They formed a well supported clade with a
Taiwanese remainder and were separated from plants from Malesian regions. The present study
suggests that L. zeylanica likely migrated from Taiwan to Yonaguni Island.
Keywords: Lobelia, migration, phylogeography, Ryukyu, Taiwan.
Session 8
LOCAL FLORA-2 & SYSTEMATICS
Convener: Elizabeth A Widjaja, Research Center for Biology, LIPI & David Mabberley,
Royal Botanic Gardens, Kew
Chairperson: Saw Leng Guan, FRIM
Venue: Sulawesi Room
13.30 – 13.45 Lahiru Wijedasa & Mark Hughes: Memecylaceae of Thailand & Peninsular
Malaysia: A framework for Flora Malesiana account
13.45 – 14.00 Joffre A. Ahmad et al.: The flowering plants endemic to Brunei Darussalam
14.00 – 14.15 Nurul A. Latiff et al.: Nepenthes diversity and abundance in Brunei Darusalam
14.30 – 14.45 David G. Frodin: Should a flora account be taken for granted? A fresh look at
Polyscias serratifolia (Araliaceae)
14.45 – 15.00 Rachel Y. Acil et al.: Effectiveness of the barcoding regions, rbcL and matK, as
well as 18S rDNA Sequences, in distinguishing morphologically distinct endemic
Nepenthes species of the Philippines
Memecylaceae is a pantropical family of plants comprising of six genera and about 600 species. In
Asia it is represented by Memecylon L. and Lijndenia Zoll. & Mortiz. Molecular, taxonomic and
ecological work on the family is limited with no monograph of the family. Through the close study of
flowers and fruits in Thailand and Peninsular Malaysia we have found previously unused characters
that have allowed us to effectively identify species, resolve species complexes and identify potential
relationships between species. Here, we provide a synopsis of Memecylaceae in Malesia through the
Flora accounts for Thailand and Peninsular Malaysia and certain enigmatic species found in the
region. A potential framework is presented for a regional monograph by outlining potential sections
based on floral morphology, distribution and ecology.
Keywords: Memecylaceae, Memecylon, Lijndenia, Peninsular Malaysia, Thailand, Malesia.
The flowering plants known only in Brunei Darussalam up to December 2012 have been verified and
enumerated by reference to relevant scientific publications from 1990 to 2012, queries of online
herbaria databases and correspondence with specialist sof the respective plant families. The findings
have now been published as The Flowering Plants Endemic to Brunei Darussalam 2012 (Henrot et al.
2013). Sixty five flowering plant taxa were maintained in this dossier of endemic Brunei plants: 1 at
the genus level, 56 at the species level, 6 at the subspecies level and 3 at the variety level. The best
represented plant families among the endemics are: Begoniaceae (15 taxa), Araceae (8 taxa),
Gesneriaceae (7 taxa), Orchidaceae (5 taxa), Zingiberaceae (5 taxa), Arecaceae (5 taxa), and
Myristicaceae (3 taxa). Most of the endemics (35 taxa) are herbs and only seven are trees or treelets.
This endemic Brunei plants list can be expected to change in the future, for the following reasons:
entries will be added as new species found restricted to Brunei Darussalam are described (e.g., 2
Bulbophyllum spp. in early 2013); names may be removed if some of the plants are subsequently
found elsewhere. The likely 'anthropogenic endemics', i.e.,taxa that have become restricted to Brunei
Darussalam because of loss of habitat elsewhere, have not been considered in this present list, even if
the taxa are fairly certainly restricted to the Brunei area (Brunei and adjacent localities). Concern for
continuing serious degradation of rain forests in the region includes consideration for how Brunei
Darussalam could continue to serve as a critical refuge for such Bornean plants. Many of the
flowering plants endemic to Brunei Darussalam are very rare or under collected: 15 are known from 1
collection only and 83% are known from 3 sites or less. Three areas of Brunei Darussalam have been
identified which apparently have a distinctly higher density of endemics. In terms of their
conservation: 55 of the endemics have all or at least 1 population in a protected forest: this stresses the
importance of protected forests for their conservation. Ten of the endemics have no population in a
protected area and can be considered as potentially threatened.
Keywords: Brunei Darussalam, conservation, flowering plants, endemic, anthropogenic endemics.
The genus Nepenthes is known to be diverse in Bornean forests, and has been recorded in Brunei
Darussalam in various forest types. We aim to investigate variation in Nepenthes species richness and
abundance at five forest types throughout Brunei Darussalam: open secondary, heath, peat swamp,
white sand and mixed dipterocarp forests. A total of thirty-nine 5 m x 5 m plots were set up in these
forest types. Within each plot, Nepenthes species abundance was quantified, with Nepenthes voucher
specimens collected and identified to determine species richness. No significant differences were
detected either for Nepenthes species richness or abundance between the five forest types, despite
records of Nepenthes in Brunei showing preferences for particular habitat types. We suggest that
average species richness and abundance remained constant regardless of forest types in this study, but
that these results would likely change if sampling intensity is increased in future studies.
Keywords: Borneo, pitcher plants, habitat, tropical forest.
Jinshuang, M.A
Shanghai Chenshan Plant Science Research Center, Chinese Academy of Sciences, China
e-mail: jinshuangma@gmail.com, majinshuang@sibs.ac.cn
In the past few decades, Chinese plant taxonomists have finished their floras twice both in Chinese
(Flora ReipublicaePopularisSinica, FRPS, 1959-2004) and in English (Flora of China, FOC, 1994-
2012), plus more than thirty kinds of various local floras at province and above. These floras, along
with their contents, are fully reviewed,and a comprehensive and detailed analysis, especially with
respect to the literature, specimens accumulation, research personnel, compilation and quality of
floras, the current situation of Chinese plant taxonomy has been fully discussed.
Key words: Chinese, Flora, review.
Frodin, D.G.
Royal Botanic Gardens, Kew, UK
Polyscias serratifolia (Miq.) Lowry & G.M. Plunkett (2010), previously known as Gastonia
serratifolia (Miq.) Philipson and so covered in Flora Malesiana, I, 9(1)(1979), is nominally a
widespread species of small to large trees primarily of infra-maritime Malesia with two markedly
disjunct localities in the Solomon Islands. With the recent breakup of Gastonia and its subsumation
into an enlarged Polyscias, this species, along with P. spectabilis of (mostly) mainland New Guinea,
is now referred to subgen. Tetraplasandra – but only by association with that presumed relative. But
nothing should be taken for granted: further study and additional collections – particularly from
central Malesia – suggest that P. serratifolia s.l. is not one but a complex of twenty or more species.
By way of explanation, I shall examine a range of key morphological characters – notably from leaves,
inflorescences, and fruits – and show that these putatively new and revived taxa represent varying, but
recognisable, assortments of their states. A table of these taxa, with distinguishing features and
presently known distribution, will be presented. It is hoped that this demonstration will stimulate field
studies, formation of additional collections, and the collection of material for genomic analyses by
those most effectively placed to do so. Indeed, many of the proposed taxa have not been re-collected
for decades or – in some cases – more than a century, and there are surely other likely localities to be
explored. I shall also describe how I put together my database, and offer some remarks with respect to
currently available online information.
Keywords: Araliaceae, Polyscias, P. serratifolia, P. spectabilis, taxonomy, geography, collections,
Central Malesia.
Acil, R.Y.*1, Diaz, M.G.Q.2, Amoroso, V.B.3, Laude, R.P.4, Mendioro, M.S.5,& Laurena, A.C.6
1
University of the Philippines Los Baños, Laguna, Philippines; r_acil@yahoo.com
2
UP Los Baños, Laguna, Philippines; genaleen@yahoo.com
3
Central Mindanao University, Bukidnon, Philippines; amorosovic@yahoo.com
4
UP Los Baños, Laguna, Philippines; rplaude@yahoo.com
5
UP Los Baños, Laguna, Philippines; merlynmendioro@yahoo.com
6
UP Los Baños, Laguna, Philippines; aclaurena@yahoo.com
Thirteen endemic species of Nepenthes from different mountains in Mindanao and Luzon (N. alata, N.
bellii, N. ceciliae, N. copelandii, N. hamiguitanensis, N. merrilliana, N. micramphora, N.
mindanaoensis, N. peltata, N. pulchra, N. saranganiensis, N. truncata, and N. ventricosa) were
collected. Major morphological characters of the leaf were described and measured. Numerical
phenetic analysis partitioned the species into seven distinct groupings. Molecular analysis and DNA
barcoding were done using three regions: rbcL, matK, and 18S ribosomal DNA. All samples were
correctly identified to genus level based on the three genes. The 18S sequences had the highest
intergroup genetic divergence, followed by matK while rbcL had the lowest. Phylogenetic analysis,
using Maximum Parsimony plus bootstrap resampling, was done for rbcL and matK respectively. For
18S data, maximum likelihood plus bootstrap was used. Trees were poorly resolved; only the three
individuals of each Nepenthes species formed distinct clades. Although rbcL offers high universality,
easy amplification and alignment, it does not discriminate to species level. Sequence variation in
matK enabled discrimination of only five species: N. bellii, N. micramphora, N. mindanaoensis, N.
peltata, and N. ventricosa. Combining rbcL and matK data gave less resolution. We conclude that the
two recommended barcodes, rbcL and matK, are not powerful enough to discriminate between the
thirteen Nepenthes species.
Keywords: Nepenthes, rbcL, matK, 18s rDNA, diversity, DNA barcoding.
Session 8
ECOLOGY-3
Convener: Rochadi Abdulhadi & Laode Alhamd, Research Center for Biology, LIPI
Chairperson: Laode Alhamd, Research Center for Biology, LIPI
Venue: Sumatera Room
13.30 – 13.45 Eizi Suzuki et al.: Vegetation and its changes in Pangandaran Nature Reserve,
West Java, Indonesia
13.45 – 14.00 Diana Vivanti et al.: Study of succession on Damar (Agathis alba) forest in the
Buyan Lake Bedugul, Bali
14.00 – 14.15 Vera B Lestari et al.: The land use change effect in Anjir Pulang Pisau Village,
Central Kalimantan
14.15 – 14.30 Tri Mulyaningsih et al.: Eaglewood ecology in west Lombok forest
14.30 – 14.45 Suichiro Tagane et al.: Botanical survey in the Taman National Gunung Gede-
Pangrango, West Java, Indonesia
Pangandaran Nature Reserve (7°43' S and 108°40' E) is a mosaic of man-made grasslands and old
secondary forests on a peninsula with 500ha on the southeastern coast of west Java. We made two 1-
ha plots in secondary forests (Pn1 of ca.60yr and Pn2 of ca. 100yr) in 2010. All trees with DBH>=
4.8cm were recorded for species name, DBH, height and position in 2010, and the DBHs were re-
measured in 2011 and 2013. Saplings (1 cm<= DBH < 4.8 cm) were recorded in 100 sub-quadrates of
5m x 5m in 2011 and 2013. A total of 2318 stems (DBH>= 4.8 cm) were recorded with 79 species, 61
genera in 36 families in the two plots. They have some similarity with vegetation on Krakatau Islands.
In both plots, Myrtaceae was most frequent (Pn1: 45 %, Pn2: 28 %). The most dominant species in
BA was Syzygium lineatum in Pn1, Artocarpus elasticus in Pn2. The total basal area (BA) of the trees
in Pn1 and in Pn2 were 23.7m2/ha and 26.0m2/ha in 2010, and 24.0m2/ha and 26.1m2/ha in 2013,
respectively. The vegetation is still in secondary forest, it will be changed gradually.
Keywords: Lowland tropical forest, vegetation, dynamics, Myrtaceae, permanent plot.
Diana Vivanti S*, Miarsyah, M., Anni K.D., Septiany D.H., Ariffianto, I., Savitri, D. & Priska
Biology Department, Faculty of Mathematics and Natural Science, State University of Jakarta, Indonesia.
*e-mail: dianavivanti@yahoo.com
Plantation of Damar (Agathis alba) forest in the site Buyan Lake Bedugul, Bali was done in
supporting the society of Buyan Lake life. Since 1962 this area was abandoned by the society to leave
the forest under succession stage. This study aimed to observe the occurance of natural succession on
Damar forest production in site of Lake Buyan based on species composition, important value, and
species diversity on each growth phase. The method used was a survey method with belt transect
technique using 4800 m2 area. The result of this study was 1) the highest species composition and
diversity index was in the seedling phase, 2) the highest importance value in the seedling phase was
Trevesiasundaica, Ficus sp. in the sapling and pole phase,and in the tree phase wasthe Agathis alba.
3) Dadap (Erythrina sp.), Ficus sp and the introduction plant Agathis alba were found in each growth
phase. These spesies were important species in the successional processes and became a secondary
damar (Agathis alba) forest.
Keywords: Buyan Lake, succession, Damar (Agathis alba).
The natural world provides various benefits through ecosystems. From ecosystems, human population
derive benefits such as goods and products (e.g., fresh water, fuel), regulation of natural processes
(e.g., climate, flooding, erosion), and nonmaterial benefits (e.g., recreation, aesthetic enjoyment).
Land use change is an activity which has a significant impact on the world’s ecosystems. This
research was conducted to find the effects of land use change in the Anjir Pulang Pisau Village,
Central Kalimantan. A field trip was conducted to collect primary data applying in depth interviews
and Focus Group Discussion method. Effects of land use change in the Anjir Pulang Pisau village can
be seen in changes of provisioning services. Provisioning services are the benefits obtained from the
supply of food and other resources from ecosystems.
Keywords: land use change, provisioning services, Anjir Pulang Pisau Village, Central Kalimantan.
Gyrinops spp. (Thymelaeaceae) isagarwood producer, a kind of non-wood product that has high
economic value. Continuous agarwood harvest by cutting trees of agarwood producer in the forest
should not decrease population number, thus we never lost a kind of Gyrinopsspp in tropical forest
before search information on it, such as in India. In managing forestfor sustainable use,particularly for
individual tree species that has commercial and ecological value, such as eaglewood tree species,
population dynamic of the species is needed. Forest sustainable is not only emphasized on sustainable
production, but also on its ecology, socio-economic and service cultural of species that is rare and
threatened to extinct. To obtain sustainable product, regeneration capacity of such species of
eaglewood in West Lombok forest, must be maintained. Forest area of West Lombok is 46,357.86 ha
in wide, including primary and secondary forests, and then it is conducted delineation of ecological
units by overlaying of five map kinds: 1) Map of West Lombok forest area height, 2) Map of West
Lombok forest area elevation, 3) Map of West Lombok forest soil observation, 4) Map of West
Lombok forest rainfall, and 5) Map of vegetation from air photograph of Data SPOT 2/4 LAPAN.
Research population is intact natural ecosystem that has random vegetation distribution and
relationship between eaglewood ecosystem and biotic and abiotic factors that influence them, such as
kind of vegetation that contiguously live, air humidity and temperature, land slope and character of
soil physic and chemical. Determination of sampling unit must be clear about the coordinate, hence it
will be easily to be traced and determinate in field using GPS tool. There are 5 varieties of Gyrinops
versteeghii spread out in west Lombok forest, e.g.: variety of beringin, buaya, Madu, pantai dan
Soyun. Each variety has natural habitat which has specific on biotic and abiotic association on each
growth level. Vegetation distribution patron in west Lombok forest is cluster, even on Seedling level,
Sampling level, Poles level or Trees level. The degree of cluster is relative low, that is shown by
Green’s Index value low among 0.001-1.032.Importance value (I.V.) and Index of species diversity or
The Shannon index (H’) are relative low for all growth level from all varieties of eaglewood trees
which are found e.g. Trees level: I. V.= 0.5- 3.1 and H’ = 0,002-0,01, Poles level: I. V.= 3.4-7.3 and
H’ = 0.01-0.02, Sampling level: I. V.= 5.9-15.1 and H’ = 0.02-0.05, Seedling level: I. V.= 8.5-15.6
and H’ = 0.03-0.05.
Keywords: West Lombok, eaglewood, Gyrinops versteeghii.
Tagane, S.1, Ashari, A.J.2, Toyama, H.1, Nagamasu, H.3, Naiki, A.4, Ichihashi, R.1, Djamaluddin, I.1,
Hidayat, A.2, Sadili, A.2, Ardiyani, M.2, Darnaedi, D.2, Yahara, T.1
1
Kyushu University, Japan
2
Research Center for Biology-LIPI, Indonesia
3
Kyoto University, Japan
4
Ryukyu University, Japan
To survey general flora and obtain quantitative data of species distribution in Gede-Pangrango
National Park, West Java, Indonesia, we conducted botanical field survey using line-transect methods
(100 x 4m: We divided each transect to ten sections of 10m x 4m). Fourteen transects were placed
along mountain trails and at the altitude of from 1,400 to 3,03 m (near entrance gate to the summit of
Gn. Pangrango). All vascular plant species including trees, herbs and epiphytes were recorded in each
section, photographed, and collected as voucher specimens. In addition to these occurrence records,
trees higher than 4m tall were measured their height and DBH. Totally 1,181 specimen were collected
from 14 transects. Species richness was the highest in T2 at 1,470m (229 species) and the lowest in
T9 at 2,959m (28 species). The results showed inverse relationship between species richness and the
elevation, which decline rate was almost constant (-2 species per 100m). For tree species higher than
4m tall, totally 1,598 trunks consisting 143 species were recorded (8-53 species in one transect).
Keywords: botanical survey, Gede-Pangrango, Indonesia, transect.
Session 9
ECOLOGY-4
Convener: Rochadi Abdulhadi & Laode Alhamd, Research Center for Biology, LIPI
Chairperson: Julie Barcelona, School of Biological Sciences, University of Canterbury
Venue: Borneo Room
15.30 – 15.45 Kryssa D Balangcod et al.: Chrysopogon zizanoides (Vetiver Grass) as a potential
plant for landslides bioengineering in Atok, Benquet, Philippines
15.45 – 16.00 Orlando G Apostol et al.: Use of plants as a common practice of mitigating
landslides in Atok, Benquet, Philippines
16.00 – 16.15 Nahid I Afifi et al.: Soil stabilization of a landslide scar through revegetation
using indigenous species such as Thysanolaena maxima in Poblacion, Atok,
Benguet
16.15 – 16.30 Teodora Balangcod et al.: Slope stabilization using locally available Bamboo
species and Morus alba in Benguet Province, Philippines
16.30 – 16.45 Jose Abucay: Physico-chemical properties of soil as related to vegetation pattern
in a Natural Landslide Scar in Poblacion, Atok, Benguet, Philippines
Balangcod, K.D.*1, Balangcod, T.D.1, Wong, F.M.1, San Luis, G.D.2, Abucay, J.B.Jr.2, Afifi, N.I.G.1
1
Department of Biology, College of Science, University of the Philippines Baguio, Philippines
2
Department of Physical Sciences, College of Science, University o the Philippines Baguio, Philippines
*e-mail: balangcodkryssa@yahoo.com.ph
It has been popularized worldwide that Chrysopogon zizanioides, more commonly known as vetiver
grass, is being used for bioengineering to stabilize the soil. It has a fast growing rate and can hold the
soil which indicates its ability to grow in steep slopes. Atok, Benguet which is found in northern
Philippines is an area which is very prone to landslides due to its steep slopes which are exacerbated
by heavy rain and typhoons. The objective of this study is to be able to use vetiver grass for the
stabilization of a model landslide area in Atok, Benguet, and to monitor its growth performance under
nursery conditions. A nursery has been established in Atok, Benguet for the propagation of the vetiver
grass and other species that can be used to stabilize landslides. Three sample plots were chosen
randomly, having 30 pots per plot. The number of new shoots and their length were measured every
month from planting. Results have shown that during the early stages of growth, vetiver grass has
been able to develop new shoots. The longest shoot measured so far was 39 cm and the average
number of new shoots is three per pot.
Keywords: vetiver grass, landslide, bioengineering, Atok.
Apostol, O.G.*1, Balangcod, T.D.2, Abucay, J.1, San Luis, G.1, Wong, F.2 & Balangcod, K.2
1
Department of Physical Sciences, College of Science, University of the Philippines Baguio,
2
Department of Biology, College of Science, University of the Philippines Baguio,
e-mail: orlan_apostol@yahoo.com
The municipality of Atok is prone to landslide due to its topography and anthropogenic activities like
swidden farming that affects soil quality. The research site is focused in Poblacion Atok, Benguet
which is one of the selected program sites of UN-World Food Program for the disaster risk reduction
and management. Fifty farmers or local residents were interviewed in three different barangays of the
municipality to identify common practices of the local community in mitigating landslides. The
experiences of the local community illustrate how indigenous knowledge can be used to cope up and
contribute to disaster risk reduction. Findings show that the majority of the respondents (74%) use
local trees and shrubs such as alnus, pine tree, coffee, Chinese bamboo, local sunflower “marapait”,
trumpet plant and other grasses to conserve soil is traditionally planted to conserve soil, not only in
their sayote swidden farms but also along the slide-prone areas such as roadsides. The choice of these
plant species was identified mostly by local residents to facilitate the mitigation of landsides since
they are fast growing and abundant in the area.
Keywords: Atok, Benguet, Ibaloi and Kankanaey tribes, disaster risk reduction, indigenous
knowledge.
Afifi, N.I. *1, Balangcod, T.D.1, Wong, F.M..1, San Luis, G.D.1,
Abucay, Jose B. Jr. & Balangcod, K.D.1
1
University of the Philippines Baguio, Philippines
*e-mail: ana.afifi@rocketmail.com
Thysanolaena maxima or the tiger grass is a perennial plant from the Graminae family. It is
commonly known as the broom grass since its inflorescences are valued for making brooms. In
addition, tiger grass is infamous for its potential in soil stabilization, capable of conserving soil and
water. It also improves soil fertility in addition to the prevention of soil erosion. It grows faster on
higher elevations and on steep slopes which is the characteristics of the study area in Atok, Benguet.
The occurrence of landslides in Barangay Poblacion, Atok was initiated by typhoons specifically
Pepeng (internationally named as Parma) in 2009 and also due to the steep slopes in the area. The
study focuses on the evaluation of tiger grass as a potential species for soil stabilization to be used in a
selected landslide in Atok, Benguet province, Philippines. More than 8,500 tiger grass seedlings were
planted in the nursery in Atok, Benguet. Preliminary data shows that as early as the third week after
plantation, new shoots are arising from each seedling with an average of two shoots per pot with the
longest shoot measured at 42 cm. Measurement was done in three groups with thirty pots in each
group, representing all the seedlings. The growth performance of tiger grass is being monitored
monthly.
Benguet province, is one of six provinces in the northernmost part of the Philippines. Because of its
topographic characteristics and geographic location, Benguet province is one of the most vulnerable
areas to disasters in the Philippines. During the rainy season, many steep slopes in Benguet are prone
to erosion. Consequently, the occurrences of gigantic landslides has a strong impact on the lives of
local communities. When landslides occur, most of the roads are closed for long periods of time
making the farmers unable to transport their agricultural produce to the market. Plant species play a
key role in rehabilitation of landslide scars to stabilize the soil and prevent further erosion. In Atok,
Benguet, indigenous plant species such as bamboo and Morus alba were evaluated based on their
growth performance and potential to stabilize the soil on steep slopes and mitigate the occurrences of
landslides. Four bamboo species namely: Dendrocalamus merrillianus, commonly called bayog;
Dendrocalamus asper, giant bamboo; Bambusa blumeana, kawayang tinik; Phyllostachys aurea or
Chinese bamboo; and Morus alba are potential species for soil bioengineering because of their fast
growth from cuttings and rooting strategy. Additionally, bamboo and mulberry can also help mitigate
climate change through carbon sequestration.
Keywords: Benguet province, Bioengineering, landslides, revegetation, soil erosion
Abucay, J.B*.1, Balangcod, T.D.2, Wong, F.M.2, San Luis, G. D.1, Balangcod, K.D.2, Afifi, N.I.2
1
Department of Physical Sciences, College of Science, University of the Philippines Baguio,
Philippines
2
Department of Biology, College of Science, University of the Philippines Baguio, Philippines
*e-mail: joseabucay@yahoo.com / +639175064680
Benguet is a landslide prone province of Cordillera due to its mountainous topography and several
factors such as typhoons, heavy rainfalls, earthquakes and human intervention (e.g. road construction).
Landslides greatly affect the vegetation pattern of an area. It washes off all the plant species along the
slides leaving a nude land. Then, through the years, the landslide scar is revegatated by colonizing
species. In this study, we examined the vegetation pattern and the physico-chemical characteristics of
an old landslide scar, which was instigated by the 1990 earthquake and pronounced by typhoons
Ondoy (Ketsana) and Pepeng (Parma) in 2009. The landslide with an area of 700 m2 and a slope of
60° is located in Poblacion, Atok, Benguet, Philippines. We used transect and quadrat method to
determine relative frequency of plants and to know dominant plant species. The soil physical
properties, pH, moisture, organic matter, phosphorus and potassium were determined using the
standard methods. The relationship of the physico-chemical properties with the vegetation was also
examined. Among the plant species in the site, the Moss spp., Paspalum longifolium and Eupatorium
sp. are the three most dominant species with an importance value of 30.365, 22.597 and 11.704
respectively. Mosses are most dominant for the reason that they are pioneer species for succession.
Correlation analysis shows that the soil pH, moisture, organic matter and potassium were positively
correlated with the plant frequency while phosphorus shows negative correlation which shows a
dynamic interaction of the plant cover with the soil physico-chemical properties of the area.
Keywords: vegetation analysis, Benguet Province, Natural Landslides, soil properties
Session 9
PLANT CONSERVATION
Convener: Rochadi Abdulhadi & Laode Alhamd,Research Center for Biology, LIPI
Chairperson: Dian Latifah, Bogor Botanic Gardens
Venue: New Guinea Room
15.30 – 15.45 Christopher P Dunn: Considering Biological and cultural diversity in the context
of botanical garden conservation strategies
15.45 – 16.00 Colin R Maycock et al.: Using high resolution species distribution models to
identify the critical habitat of rare, threatened and endemic plant species in Sabah,
Malaysia
16.30 – 16.45 John B Sugau et al.: Conservation status of the endemic dipterocarps species
within the Heart of Borneo (HoB) in Sabah, Malaysia
16.45 – 17.00 Eyen Khoo et al.: IUCN Red Lists Assessment of endemic plants In Sabah,
Malaysia
Dunn, C.P.
Harold L. Lyon Arboretum and Center for Biocultural Studies, University of Hawai‘i at Mānoa, Hawai‘i, USA
e-mail: cpdunn@hawaii.edu
Over the millennia, peoples and cultures across the world have developed deep relationships to the
land and have discovered many valuable uses of plants. However, concerns continue to mount
regarding impacts of global climate change, habitat loss, and other environmental changes on the
world’s flora. Just as floristic diversity is eroding, so too are cultural and linguistic diversity.
UNESCO estimates that 50% of all languages are endangered, with one language being lost every 2
weeks. As plants become increasingly rare, and ultimately extinct, the cultural values and significance
they represent disappear. Thus, cultures risk losing critical elements of their identity. By the same
token, as cultures and languages are lost, we lose traditional knowledge about plants, unique
perceptions of time and of nature, and intellectual wisdom. Consequently, botanical gardens and other
conservation organizations should consider including both biological and cultural diversity within
their conservation programs. It is not enough to consider solely the effects of environmental change
on plant life within the current context of the GSPC and CBD (particularly Article 8(j)). Rather, we
must actively engage in understanding the broader impacts of environmental change to “biocultural”
diversity.
Keywords: Biocultural conservation, Botanical Gardens, CBD, GSPC, Languages
Maycock, C.R.*1, Pereira, J.T.2, Khoo, E.2, Sugau, J.B.2, Chen, T.E.2, Nilus, R.2 & Burslem, D.F.R.P.3
1
School of International Tropical Forestry, University Malaysia Sabah
2
Forest Research Centre, Sabah Forestry Department, Sabah, Malaysia
3
School of Biological Science, University of Aberdeen.
*e-mail: sepilokdata@gmail.com
One of the goals of Target 12 of the Strategic Plan on Biodiversity 2010-2020, is an improvement in
the conservation status of those species that are most at risk by the Year 2020. To address this target,
we require information on which species are most at risk of extinction and knowledge on their
distribution. In this study we use high resolution species distribution models (SPMs) to reconstruct the
“historic” distribution of rare, threatened and endemic plant species in Sabah. The SPMs are then
weighted based on the species level of endangerment determined by the Sabah Plant Red List working
group, as an initial attempt to identify critical habitat and priority areas for plant conservation in the
State. Our results suggest that lowland forests in the north of the State contain the highest number of
species of conservation concern, and should receive the highest priority for conservation and
restoration efforts if we aim to achieve Target 12.
Amoroso, V.B.*1, Acma, F.M.1, Lumista, H.P.1, Lubos, L.C.2, Alava, C.G.3 & Coritico, F.P.1
Central Mindanao University, Musuan, Bukidnon, Philippines1, Liceo de Cagayan University, Cagayan de Oro
City, Philippines2, Bukidnon State University, Malaybalay, Bukidnon, Philippines3
*e-mail: amorosovic@yahoo.com
A study was conducted to assess and determine the distribution of threatened, endemic and rare
vascular plants in the Philippines. Collected specimens were identified using taxonomic keys from
Floras and Monographs while the assessment of status was based on the Threatened Plants of the
Philippines (Fernando et al., 2008), Framework for Philippine Plant Conservation Strategy and Action
Plan (DENR, 2006) and International Union for Conservation of Nature (2007). Moreover, the
distribution of threatened species was taken from the labels of herbarium specimens deposited in
Philippine Herbaria and from our botanical fieldworks. Field investigations and database of threatened
plants from the Herbaria revealed 510 taxa of threatened vascular plants. Of these threatened taxa, 386
(76%) are Philippine endemics. The Philippine threatened plants include 109 pteridophytes, 15
gymnosperms and 386 angiosperms. There are 112 (22%) taxa in the Critically Endangered (CR)
species category, 203 (40%) taxa in Endangered (EN) species category, and 190 (38%) taxa in the
Vulnerable (VU) species category. The families Orchidaceae, Dipterocarpaceae, Arecaceae and
Cyatheaceae have the most number of threatened taxa. Regardless of the endemism status, the island
of Luzon is the habitat of 349 (68%) species of threatened plants, followed by Mindanao with 237
(47%) and Visayas with 137 (27%) species. Some conservation initiatives for these threatened plants
are discussed.
Keywords: threatened, angiosperms, gymnosperms, pteridophytes, database.
Wilkie, P.
Royal Botanic Gardens, Edinburg, UK
Current taxonomic, phylogenetic and biogeographical studies in Sapotaceae are helping us understand
this ecologically and economically important family better. Progress on the Sapotaceae account for
the Flora of Peninsular Malaysia and Flora Malesiana will be discussed as will the utility of the large
amount of distribution data gathered in the delivery of IUCN conservation assessments and the Aichi
Biodiversity Targets.
Keywords: Sapotaceae, taxonomy, conservation.
Sugau, J.B.*1, Pereira, J.T.1, Nilus, R.1, Maycock, C.R.2, Ong, R.C.1, Jumian, J.1, Miun, P.1,
Dawat, J.1, Majapun, R.1 & Khoo, E.1
1
Forest Research Centre, Sabah Forestry Department, Sabah, Malaysia
2
School of International Tropical Forestry, Universiti Malaysia Sabah, Sabah, Malaysia
*e-mail: John.Sugau@sabah.gov.my
Of the 196 taxa of dipterocarps found in Sabah, five of Sabah’s endemic species were found within
the Heart of Borneo (HoB) area. The conservation status of these five species, namely Dipterocarpus
ochraceus, Hopea ovoidea, Shorea micans, Shorea symingtonii and Shorea waltonii were assessed
using the standard IUCN assessment tools based on estimating range from the extent of occurrence
(EOO) and area of occupancy (AOO) and also using predictive model such as ecological niche
models (ENM). The assessment determined that D. ochraceus as Critically Endangered B2a, H.
ovoidea as Critically Endangered A2c (possibly extinct) and Data deficient, Shorea micans as Least
Concerned, Shorea symingtonii as Vulnerable and S. waltonii as Endangered.
Keywords: Sabah, conservation status, Dipterocarpaceae, IUCN Red List, Heart of Borneo (HoB).
Khoo, E.*1, Maycock, C.R.2, Pereira, J.T.1, Nilus, R.1, Majapun, R.1 & Sugau, J.B.1
1
Forest Research Centre,Sabah Forestry Department, Sabah, Malaysia
2
School of International Tropical Forestry, Universiti Malaysia Sabah, Sabah, Malaysia
*e-mail: Eyen.Khoo@sabah.gov.my
In order to achieve the Aichi Biodiversity Targets, especially in terms of preventing the extinction of
species and improving species conservation status, much ground work such as assessment of the
species current conservation status has to be performed. Therefore, initial effort has been made in
generating an up-to-date review on the conservation status of some of the endemic indigenous species
in Sabah. Data sets collected through extensive surveys and expeditions are used to generate a
preliminary IUCN status assessment of the indigenous species, with the initial focus on plant species
which are endemic to Sabah. Aside from utilizing the IUCN Red List and Criteria 3.1 assessment
guidelines, predictive model such as ENMs (Ecological Niche Models) is applied to generate an
overview of population distribution based on biogeographical and environmental parameters. This
exercise will assist in enhancing the IUCN Red List assessment by providing preliminary information
on species’ habitat availability, such as total habitat lost, estimation of remaining habitats that are
located within protection forests and those in production forests. To date, a total of 36 species, derived
from 19 families of flowering plants have been assessed, and the assessment work is still on going.
Keywords: IUCN Red List, biodiversity, conservation
Session 9
LOCAL FLORA-3
Convener: Elizabeth A Widjaja, Research Center for Biology, LIPI & Rogier de Kok,
Royal Botanic Gardens, Kew
Chairperson: Rogier de Kok, Royal Botanic Gardens, Kew
Venue: Sulawesi Room
15.30 – 15.45 Péter Poczai & Jaakko Hyvönen: Diversification of the kangaroo apples (Solanum
sect. Archaesolanum) in Papua New Guinea
15.45 – 16.00 Laura Jennings: Towards a “Generic Flora” of New Guinea tress
16.00 – 16.15 Gary W. Wilson & Fanie Venter.: Studies of Nepenthes in Austro-Papua
16.15 – 16.30 Barry Conn et al.: Morphological variation in Polyosma (Escalloniaceae) in Papua
New Guinea and Australia
16.30 – 16.45 Thomas Starnes.: Identifying biodeiversity hotspots on the island of New Guinea:
a case study using the keystone genus, Ficus (Moraceae)
16.45 – 17.00 Gavin Lee, Edi Permana, Bilal Sau, Iska Gusilman & Tjut Fatisa: Flora inventory
program in PT. Weda Bay Nickel, Halmahera, North Maluku
Kangaroo apples, subgenus Archaesolanum, are a unique and still poorly known group within the
genus Solanum. It is composed of eight species occurring only in the SW Pacific region (Australia,
Tasmania, New Zealand, Papua New Guinea). The group is characterized by its unique chromosome
number (x = 23), possibly resulting from an aneuploid loss from a polyploid (x = 24) ancestor.
Interestingly, species have generated a further secondary polyploid series. Consequently, these
diploids (x = 46, e.g. S. aviculare) could be better regarded as “tetraploids” – in terms of the x = 12,
typical basic chromosome number of the genus – while tetraploids of the group (x = 92, e.g. S.
multivenosum) are therefore better understood as “octoploids”. In other words, it is presumed that the
early ancestor of this group has gone through a simple ploidy increase accompanied by a chromosome
loss and then the duplication has been repeated. This unique feature makes Archaesolanum
particularly interesting from an evolutionary standpoint. However, genetic relationships and how this
interesting chromosome number has developed are unknown. Here we aimed to reveal phylogeny,
historical biogeography and age of diversification of Archaesolanum with implications on their
hybridization. We sampled all recognized species of the group and sequenced the trnT-trnF
chloroplast region, and calibrated a molecular clock to estimate the age of the group. For polyploid
evolutionary assessment we searched for paralogous copies of internal transcribed spacers of the
rDNA region based on a qPCR approach. Distributional data was combined with the results of
phylogenetic analysis to track the historical processes responsible for the current range of the group.
Our analysis supported the monophyly of the kangaroo apples and the biogeographical disjunction
between the two subclades within the group. Based on the divergence time estimates the most recent
common ancestor of the kangaroo apples is from the late Miocene (~ 9 MY). Based on the age
estimate the common ancestors of the kangaroo apples are presumed to have arrived in Australia by
long-distance dispersal. The two distinct lineages within the group are assumed to have separated
during the aridification of the continent and further speciated in the brief resurgence of rainforests in
the Pliocene.
Keywords: Archaesolanum, biogeography, phylogeny, kangaroo apples, Solanum, Solanaceae
Jennings, L.
Royal Botanic Gardens Kew
e-mail: l.jennings@kew.org
New Guinea is one of the most problematic areas of the Flora Malesiana region for botanists writing
treatments because it is so biologically diverse and has a history of under-collection. We are writing a
user-friendly, genus-level guide to help botanists, ecologists and conservationists wanting to identify
the trees of the New Guinea region. I will outline the structure of our project, the format of the book
and what our research has enabled us to learn about the diversity of tree species in New Guinea and
how this compares to other areas in the Flora Malesiana region.
Keywords: Indonesia, Papua New Guinea, identification, rainforests, APG3, genera, keys,
illustrations.
We report on the occurrence and ecology of species of Nepenthes in Austro-Papua. They include the
widespread and generalist N. mirabilis and several endemics restricted to Cape York, Queensland. We
describe resource and habitat partitioning and novel associations in species. We report on the
discovery of two new species, one restricted to rain forest about mid-altitude karst formations in the
Central District of Papua New Guinea and the other to lowland swamps on Cape York Peninsula,
Queensland, Australia. We discuss the conservation of Austro-Papuan pitcher plants and curation of
collections of them in the study area.
Polyosma Blume is a genus of sub-canopy trees, consisting of 60 species extending from southern
China, through South East Asia, Papuasia to Australia and New Caledonia.
This initial study aims to clarify morphological variation within the genus so that species, or species
groups, can be better circumscribed using morphological features. Once the morphological variation
is clarified, these concepts will be further tested using nucleotide sequence data.
Morphological variation of 30 species that occur in Papua New Guinea and Australia was assessed by
way of a multivariate analysis of 27 characters (16 vegetative; 11 reproductive) from 105 samples.
Eleven major species-groups were recovered from cluster and SSH analyses. Two species-groups
were mono-specific, whereas, nine other groups had one or more species fused together based on
morphological similarities. The five most useful features (Kruskal-Wallis values >50%), for
circumscribing taxa were all vegetative and included indumentum and prominence of tertiary veins.
Variation within two widespread species, P. cunninghmaii (Australia) and P. integrifolia (PNG),
revealed two morphological sub-groupings in each. Within Polyosma integrifolia, two sub-groups
were distinguished by degree of hairiness of the inflorescence and occurred at different elevations.
The two morphological sub-groups within P. cunninghamii were distinguished by differences in leaf
size, but were not correlated with distribution.
Keywords: Polyosma, Escalloniaceae, morphology, multivariant analysis, Papua New Guinea,
Australia.
Starnes, T.
Royal Botanic Gardens Kew, UK
The Island of New Guinea is floristically one of the most bio-diverse regions on earth, with an
estimated 15,000 - 25,000 plant species, many of which are threatened or endangered. One genus of
particular ecological interest is Ficus (Moraceae). Of the 367 species known from the Flora Malesiana
region, 151 occur in New Guinea and c. 70% of these species are endemic. Figs are often described as
'keystone' species in tropical forests, providing a year-round food source for birds and mammals.
Economic uses include cooking, textiles, dyes and medicine. With the ever-growing threat of
deforestation, it is more important than ever to discover the areas which are likely to support the
highest diversity of such species. This information can ultimately be used to direct conservation effort,
or in the meantime to highlight areas in need of further botanical exploration. We used ecological
niche modelling techniques on data gathered from >2000 Ficus herbarium specimens at the Royal
Botanic Gardens, Kew to predict species' potential distributions. By then combining distribution
models for all of the Ficus, can we then attempt to highlight areas of species richness for the genus?
This is part of a wider project by the South East Asia & Pacific Regional Team at Kew looking at the
biodiversity of New Guinea flora as a whole.
Keywords: Ficus, New Guinea, ecological niche modelling, Maxent, species distribution, sampling
bias, biodiversity hotspots.
Halmahera Island lies in the north of the Wallacea bioregion and remains a hotspot for biodiversity,
the flora of the region not with standing. The Island’s geographical history, its remote location and the
lack of extensive scientific surveys (both biological and physical) have conspired to create an area of
both scientific and natural resource interest. The Weda Bay Nickel Project is a large Nickel and
Cobalt development, with a resource potential of over 50 years and located in the central part of the
island.
Baseline floristic studies combined with the lack of secondary data, has indicated the potential for
localized endemism. In line with PT Weda Bay Nickel’s commitment to ‘No Net Loss and where
necessary Net Gain of Biodiversity’, the company has launched a Flora Inventory Program, as part the
first step in the development of a Flora Biodiversity Management Plan. The paper details the
challenges faced through the early implementation of FIP how the FIP will be used as a tool for
Management of Flora Biodiversity at the Weda Bay Nickel Project and future opportunities the FIP
presents to both the company and its stakeholders in the Project. A few examples of the interesting
discoveries made to date are presented.
Keywords: flora inventory, Weda Bay, Halmahera.
Session 9
BRYOPHYTE-1
Convener: Benito Tan, NUS, Singapore & Ida Haerida, Research Center for Biology,
LIPI
Chairperson: Sri S. Tjitrosoedirdjo, SEAMEO BIOTROP
Venue: Sumatera Room
15.30 – 15.45 Benito Tan & Sri S Tjitrosoedirdjo: A decade of SEAMEO BIOTROP
contributions to the Malesian bryology and lichenology (2001-2011)
15.45 – 16.00 Andrea G Azuelo et al.: Species richness of Bryophyte flora in Mt. Kalatungan,
Bukidnon, Philippines
16.15 – 16.30 Nunik S Ariyanti et al.: Diversity of epiphytic Bryophytes at three tea plantations
in West Java, Indonesia
16.30 – 16.45 Rindita & Lisdar I Sudirman: Study of corticolous Macrolichens diversity on
Canarium trees in Bogor City, West Java
16.45 – 17.00 Saiful Bachri et al.: Bryophytes diversity of Mount Merbabu National Park,
Central Java, Indonesia
The contributions of the SEAMEO BIOTROP biological program on the documentation and
conservation of Malesian bryophytes and lichens are reviewed and discussed. For a long decade
starting in 2001, the BIOTROP Institution at Bogor of Indonesia has organized at every two years
interval an extensive and comprehensive 10-days workshop aiming to arouse the interest of and
educate the nature workers and biology teachers on the regional biodiversity and ecological
importance of these two groups of little known organisms. The lecturing topics and laboratory
activities of the training workshop on local bryophytes and lichens are also presented. The SEAMEO
BIOTROP program has held over the years a total of six workshops and trained and produced many
who are now the active bryologists in a number of SE Asian countries. A great number of the
workshop participants have been motivated to move on to study and complete their Ph D degree
program from universities doing a research thesis on bryophyte systematics and ecology. The
workshops also produced and published a good number of technical papers on the floristic inventory
of the species diversity, especially for selected national parks in Indonesia and a book of Guide to the
Liverworts and Hornworts of Java. This workshop started by the SEAMEO BIOTROP appears to be a
useful model for training the future generation of specialists on a certain group of plants in the region.
Keywords: Bryophytes, lichens, training workshop, SEAMEO BIOTROP.
Azuelo, A.G.*, Sariana, L.G., Magday, E.R.J., Montecillo, R.G.G., Pabualan, M., Ora, R.P., Manual,
A.A., Segumpan, W.C., Salinasal, R.L., Yorong, A.P. & Valiente, E.B.
Central Mindanao University, Musuan, Maramag, Bukidnon, Philippines
*e-mail: azuelonenecmu@yahoo.com
The study inventories the species richness of bryophytes on Mt. Kalatungan, Bukidnon. Specifically,
it aimed to: 1) identify the bryophytes species in the mountain sites of Mt. Kalatungan; 2) determine
the species richness, composition and assess the ecological status of the bryophyte flora in relation to
vegetation types; and 3) recognize the species collected as to their conservation status in terms of
rarity, widespread, endemicity and vulnerability. A floristic survey was employed by recording all the
species within the study area. The bryophytes were collected through transect walk (alpha taxonomy)
along the three vegetation types namely: dipterocarp, montane and mossy forests. Site validation was
employed to establish one sample plot with a 20 x 20 m quadrat. Each species were classified,
identified and described according to its diagnostic characters using field lens and microscopy
examinations. The habitat preference for each species and their corresponding vegetation type was
also assessed. Results of the study revealed a total of 218 species of bryophytes. Of these, 149 species,
58 genera and 21 families of mosses were documented. The liverwort showed 62 species, 20 genera
and 12 families. Taxonomic characters based on habit, leaf arrangement and orientation, stem
structure and sporophyte characters were used to identify the bryophytes into families, genera and
species. Several species were found to dominate at dipterocarp, montane and mossy vegetation, and
were found growing at different substrates such as on tree trunks, decayed logs, litters, rocks and soil.
Local assessment for the species was observed as rare and widespread. Five (5) species of bryophytes
were listed as endemic, two (2) are endangered based from IUCN red listing criteria.
Keywords: floristic survey, conservation status, ecological distribution, nonvascular flora, bryoflora.
Secondary forest can be a habitat type for epiphytic liverwort. This study aims to record the diversity
of epiphytic liverworts in secondary forest. Sampling was conducted in two secondary forest sites.
This exploratory study obtained 26 species, represent 15 genera. One species (Frullania tamarisci) is
new record for the Indonesian flora, while one other species (Lepidozia borneensis) is new records for
the flora of Java. This shows that knowledge of bryophyte flora in Indonesia is not yet complete.
From research conducted in secondary forests we can still obtain a new record.
Keywords: Epiphytic, liverwort, secondary forest, new record, Java, Indonesia.
Tea plantations provide substrates and microclimate for epiphytic bryophytes. An inventory of
epiphytic bryophytes was conducted in three tea plantations in West Java, Indonesia, at 600, 1150,
and 1600 m asl. At each plantation study site, three 30 m line transects that are 50 m apart were set
along the contour of the plantation. The epiphytic bryophytes were observed at trunk and primary
branches of five tea plants along each line transect at an interval of 5 m. Species diversity and
abundance of epiphytic bryophytes were examined. A total of 90 species, including 42 liverworts and
48 mosses, were recorded in the plantations. Species richness and diversity of the epiphytic bryophyte
communities increase with elevation. The abundance of bryophytes that expressed by percentage of
trunk surface covered by all bryophytes species on each host plant did not show any clear elevation
trend, though the percentage of trunk surface covered by bryophytes tends to increase with diameter
of host plant canopy.
Keywords: bryophyte, epiphyte, tea plantation, altitudinal gradient, line transect.
Many studies about lichens and pollution have been carried out especially in northern hemisphere for
over 40 years. But, the lichen research in South-East Asia is poorly known. Study about corticolous
macrolichens diversity on Canarium trees in Bogor City was conducted during March 2012 until June
2013. Purposive sampling method was done in 3 sites with different pollution levels, inside and
outside Bogor Botanical Garden. There were 9 macrolichens genera found, that are: Canoparmelia,
Coccocarpia, Dirinaria, Heterodermia, Leptogium, Parmotrema, Physcia, and Pyxine. Cyanolichens
Coccocarpia and Leptogium are sensitive genera that found only in the central of Bogor Botanical
Garden, suggest that this area still in a good condition. Dirinaria referred as a tolerant genus, found in
every site, but dominant in Botanical Garden side that adjacent to main road. Pyxine abundant on
Canarium trees along busy road, while Parmotrema abundant inside the Botanical Garden. The
diversity of macrolichens genera in Bogor city can be used for environmental bimonitoring. Pollution
data from Goodyear Indonesia and Bogor City Environmental Institution showed that SO2 content is
far below the quality standard limit (14 – 55 µg/m3). Biomonitoring using these genera can be applied
in another city in Indonesia.
Keywords: biomonitoring, Canarium trees, corticolous, macrolichens diversity.
Mount Merbabu, with a height of 3 124 m asl, is a dormant strato volcano in Central Java, Indonesia,
and closely located to the famous Mount Merapi. In 2004, an area of 57 km 2 within the mountain has
been declared as a national park considering the flora diversity therein including bryophytes. The
exploration study we conducted on the bryophyte diversities at Selo and Tekelan track of Mt.
Merbabu in June 2010 revealed the presence of 57 species. These species represent 39 genera and 25
families consisting of hornworts, liverworts and mosses, with Dicranaceae (15 species) were the
largest family. Forty species of the bryophytes found in the study sites are terrestrial growing on the
soil and stones and 15 species are epiphytes growing on barks or tree trunks, and two species are
terrestrial and epiphytic.
Keywords: bryophyte diversities, Mount Merbabu National Park, Central Java, Indonesia,
Dicranaceae.
Plenary Address
W John Kress
For hundreds of years taxonomists have compiled information on species into floristic
treatments of communities, states, nations, and regions of the world. These floras have made
extensive contributions to our knowledge and understanding of the diversity of plant life on
the planet and in many cases serve as the basic documentation for phylogenetic,
biogeographic, ecologic, and conservation investigations. In a world where rampant
degradation of habitats by humans is leading to the decline and possible extinction of plant
species, the role of floras, and the taxonomists who are responsible for producing them, must
expand. The information in floras can no longer be restricted to lists, inventories, descriptions,
illustrations, and identification keys that often take years or even decades to publish. New
technological tools can now be used to magnify the scope, use, and audience of floristic data
as well as assist botanists in speeding up the process of species discovery and
description. Open access publishing, universal on-line internet access, advanced image
recognition capabilities, DNA barcoding, genomic resources, and rapid generation of mega-
phylogenies will soon be added to the taxonomist’s palette to compile the next generation of
tropical floras.
Session 10
TAXONOMY & SYSTEMATICS-6
Convener: Julisasi T Hadiah, Bogor Botanic Gardens & Peter Wilson, Royal Botanic
Gardens, Sydney
Chairperson: Harry Wiriadinata, Research Center for Biology, LIPI
Venue: Sulawesi Room
15.30 – 15.45 Gwynne Lim: Species limits and reproductive biology of Tacca (Dioscoreaceae)
15.45 – 16.00 Lim Chong Keat: The apomixis of Musaceae: field evidence from Malaysia, and
taxonomic and phytological issues
16.00 – 16.15 Fitmawati et al.: Reinstatement of Mangifera laurina Blumea and the related
species
16.15 – 16.30 Ivan A Savinov: Taxonomic revision of Asian genus Glyptopetaum Thwaites
16.30 – 16.45 Purnomo et al.: Variability & intra specific classification of Dioscorea esculenta
(Lour.) Burk. based on morphological characrters
Lim, G.
Department of Plant Biology, Cornell University
Commodore Matthew Perry Graduate Studies Program, the New York Botanical Garden
The genus Tacca, commonly known as bat lilies, comprises a group of pantropically distributed
perennial acaulescent understorey herbs, with high diversity in Malesia. Representatives of the genus
are easily recognized by their umbelliform displays of flowers subtended by dark purple, green or
white showy bracts. They comprise 15 widely accepted species, but it is likely that current species
limits may have subsumed multiple species, and more remain undescribed. They have minor value in
agriculture and horticulture, as well as ethnomedicine. Existing published research and literature
suggests that Tacca may be sapromyiophilous or selfing, however some field and experimental
observations raise intriguing questions for our understanding of the reproductive biology and indicate
that at least in some species, Tacca may be midge pollinated. The complex suite of behaviours
exhibited by the inflorescence of Tacca will be discussed with respect to my hypothesis on the
mechanism of potential pollinator attraction.
Keywords: midge pollination, scent volatiles, Tacca, taxonomy, sapromyiophily.
Lim, C.K.
Fellow, Academy of Sciences, Malaysia [FASc], Penang, Malaysia
e-mail: foliamy@foliamy.com
The relationship between M. laurina Blumea and its related species were studied. Parsimony analysis
of morphological data and sequences of the intergenic spacer trnL-F were carried out separately. The
morphological analysis showed a strong support for two sister groups and four species as
monophyletic groups. According to the flowers characters, M. rubropetala Kosterm. is considered as
synonymous with M. indica L. However, M. laurina Blume, M. aplanata Kosterm., and M. lalijiwa
Kosterm. are considered separated from M. indica L. Among the four species, DNA sequences of
trnL-F intergenic spacer are identical. Based on E-RAPD, M. laurina Blume and its related species
could not be grouped, but in combination with morphological characters form four groups separated
from the species. Morphological characters were considered important for defining species and infra-
species taxa of Mangifera.
Keywords: M. indica, M. laurina, M. aplanata, M. rubropetala, M. lalijiwa, morphology, trnL-
F, Enhanced-RAPD
Savinov, I.A.
Moscow State University of Food Production, Moscow, Russia
e-mail: savinovia@mail.ru
Glyptopetalum is one of smaller genera of the family Celastraceae, comprises about 30 species similar
morphological view from S and SE Asia. This taxonomic treatment founded on critical study of
herbarium materials in E, K, P, C, BKF, CMU, PNH, HN, PE, CDBI, KUN, IBSC, and also on field
trips in different countries of Southeastern Asia. 32 species taxa of Glyptopetalum are accepted here:
India and Sri Lanka (3 endemics species), Bangladesh?, Myanmar (3 species), Thailand (6 species, 1-
endemic), Indochina (12 species, 6 - endemics), China (11 species, 8 - endemics), Philippines and
Indonesia (6 endemic species), Malaysia (2 species, 1 endemic subspecies). One new species, G.
vidalii I. Savinov, from Laos and Thailand is described; one new record of G. tonkinensis Pitard from
China (Yunnan) is determined. Glyptopetalum is closely related (and very similar) to genus Euonymus
Tournef. ex L. The genus differs from Euonymus by one ovule per cell (against at least 2 in
Euonymus), columella in capsule (its morphological nature unclear) and raphe branches on the seed.
Species of Glyptopetalum are differs from each other by form and surface character of loculicidal
capsule, and also by seed form, its size and peculiarities of its covered by aril and raphe branches.
The species of Glyptopetalum are not to use in medicine or as food (their fruits are poisonous!). But
because it taxon is closely allied to Euonymus, it may be use as source of bark latex (guttaperca) and
some other biological active substances. This question to need in future studies.
Keywords: Glyptopetalum, Celastraceae, Asia, taxonomic treatment.
Species of gembili (Dioscorea esculenta (Lour.) Burk.) is one of climber plant producing tubers
belong to Dioscoreaceae. This plant species has morphological variation on its vegetative organs i.e.
stems, leaves, and tubers. 18 accessions were collected from Karst ecosystems in Yogyakarta, Klaten,
and Purworejo Indonesia. Tuber samples were collected using survey methods and cultivated as a
living collection. Morphological observation based on IPGRI plant descriptor list for Dioscorea,
tubers, stems, leaves, flowers, and fruits were scored and analyzed using UPGMA method. The result
shows that, diversity of gembili is quite high, ranging from 0.64-1.00 similarity values. Those
accessions are divided into two cultivar groups: the first cultivar group has densely thorns roots,
oblong to cylindrical tuber shapes with white to yellowish white tuber flesh. Those characters are
similar to D. esculenta (Lour.) Burk. var. Spinosa (Lour.) Burk., whereas the second group shows
rarely thorn roots, irregularly tuber shape, violet tuber flesh color, and the characters are similar to D.
esculenta (Lour.) Burk. var. fasciculata(Lour.) Burk. This result revealed that variability of D.
esculenta in Indonesia has high morphological characters variation.
Keywords: Dioscorea esculenta, morphology, variation, intra-species classification.
As account on the diversity of the genus Merremia in Sumatra have given. There are nine species (M.
cissoides, M. dissecta, M. emarginata, M. hirta, M. peltata, M. quinquefolia, M. tridentata and M.
tuberosa), two subspecies (M. umbellata ssp. orientalis and M. tridentata ssp. hastata), one variety
(M. boisiana var. sumatrana) and two forma (M. hederaceae f. pubescens and M. hederaceae f.
barbata) are recognized in this study. One species variety (Merremia boisiana var. sumatrana) is
endemic in Sumatra. Merremia emarginata is a new record in Sumatra and Merremia cissoides is new
record in Indonesia. One species (M. tridentata) and one subspecies (M. tridentata ssp. hastata) are
excluded from the genus Merremia in this study. Key to the species and alphabetical species list are
presented.
Keywords: Merremia, Convolvulaceae, Sumatra.
Session 10
ECOLOGY-5
Convener: Rochadi Abdulhadi, Research Center for Biology, LIPI & Laode Alhamd,
Research Center for Biology, LIPI
Chairperson: Ruliyana Susanti, Research Center for Biology, LIPI
Venue: New Guinea Room
09.00 – 09.15 Siria Biagioni et al.: Long-term vegetation dynamics of mountain rainforests in
Central Sulawesi (Indonesia)
09.15 – 09.30 Damayanti Buchori: Ecological and socioeconomic functions of tropical lowland
rainforest transformation systems (Sumatra, Indonesia)
09.30 – 09.45 Yusi Rosalina et al.: Floristic composition and structure of a peat swamp forest in
the conservation area of PT National Sago Prima, Kepulauan Meranti, Riau,
Indonesia
09.45 – 10.00 Natalie Breidenbach et al.: Plant genetic diversity in tropical lowland
transformation systems
10.00 – 10.15 Katja Rembold et al.: Vascular epiphyte diversity in different transformation
systems in Sumatra, Indonesia
1 1 2 1
Biagioni, S.* , Lembcke, P. , Wang, L.C. , & Behling, H.
1
Department of Palynology and Climate Dynamics – Albrecht von Haller Institute for PlantSciences – Georg
August University Goettingen, Germany
2
Department of Life Science, National Taiwan University, Taiwan
*e-mail: d95b44001@ntu.edu.tw
represented. The climate of the area is best described by rainfall pattern with humidity increasing
towards higher elevation. The interannual conditions are influenced by the occurrence of El Niño
event which can lead to severe reduction in rainfall. The coring sites are located at different altitudes:
1) Rore Katimbu (1˚16’44’’ S, 120˚18’34’’ E) situated at about 2400 m a.s.l. within the upper
montane forest, 2) Lake Kalimpaa (1°19’35’’S, 120°18’32’’E) at 1700 m a.s.l., within the mid-
montane forest and 3) Lake Lindu (1˚19’16’’S, 120˚04’36’’E) at 1000 m a.s.l. surrounded by sub-
montane forest. The three sites differ in level of human impact and the records span through the
Holocene with similar temporal resolution. The multi-sites palaeoecological study allows us to test the
following hypotheses: I) The response of the vegetation communities to climate change and ENSO
events were different along the altitudinal and moisture gradients; II) The montane rainforest was
impacted by human activities in the area only in recent times. The comparative study will lead to a
better understanding of sensitivity/resilience of the LLNP vegetation towards long term stressed as a
consequence of human activities and climate variability.
Keywords: palynology, charcoal analysis, human impact, climate change.
Buchori, D.1, Siregar, I.Z.1, Alamsyah, Z.2, Aiyen3, Scheu, S.4, Rembold, K.4 & Fauzi, A.M.1
1
Bogor Agricultural University
2
Jambi University
3
Tadulako University
4
Georg August University of Goettingen, Germany
Around the world, the expansion of agriculture and the extraction of natural resources are increasingly
competing with natural ecosystems. In many tropical areas, rainforests are cleared in order to exploit
timber and other forest products as well as plant crops for food, feed, and fuel use. Surprisingly, the
determinants of different patterns of deforestation and the roles of resulting transformation systems of
tropical rainforests for conserving biodiversity as well as ecological and socioeconomic functions
have received little attention in scientific research so far. The EFF or TS Project (Ecological and
Socioeconomic Functions of Tropical Lowland Rain Forest Transformation Systems) is an
international, interdisciplinary research program which aims at providing knowledge-based guidelines
on how to protect and enhance the ecological functions and services of tropical forests and
agricultural transformation systems, while improving human welfare at the same time. The results are
expected to contribute to the development of strategies for sustainable management of forest reserves
and major rainforest transformation systems of the lowland tropics of Southeast Asia. Here, we would
like to introduce this new project which are carried out in Jambi Province in Sumatra, one of the
regions with the fastest and most complete transformation of tropical lowland rainforest worldwide.
The Project is run by a consortium of Indonesian universities (IPB, Universitas Jambi and Universitas
Tadulako) in collaboration with University of Goettingen, Germany. It is projected to be a 12-year
research collaboration funded through DFG and the Government of Indonesia.
Keywords: Transformation system, international research collaboration, biodiversity, landscape
ecology.
Study of the floristic composition and structure of apeat swamp forest in the conservation area within
the sago plantation of the PT National Sago Prima of PT Sampoerna Agro Tbk. group, aims to get the
latest information of the subject as a basis for future management of the conservation area. The study
was conducted in January - February 2012 using the 25 quadrats of 20 x 20 m each, laid out
systermatically, thus covering a total area of one hectare. The results showed that the regeneration of
peat swamp forests in the study site is relatively high in species diversity. The total number of species
found in the study area was 73 species of 38 families, consisting of 50 species (30 families) of trees,
42 species (24 families) of saplings, and 41 species (27 families) seedlings and ground cover. The tree
density was 550 individuals/ha with a total basal area of 18.32 m2. The species diversity was high as
indicated by the Shannon-Wiener’s Diversity Index of 3.05. Tree species with the highest Importance
Values (IV) was Pandanus atrocarpus (IV= 45.86). The tree families with the highest IV were
Pandanaceae (45.86), Myrtaceae (40.37), and Dipterocarpaceae (39.20). Structurally the forest was
dominated by trees with diameters below 20 cm amounting to 408 trees/ha (74.05%). Vertically the
forest canopy was dominated by trees in D and E strata with height of less than 20m, and density of
431 trees/ha(78.36%). Based on Jaccard Similarity index among all species, the forest could be
considered as a Pandanus atrocarpus-Blumeodendron subrotundifolium association. Primary species
with high economic values were still present in this forest. Eleven species found in the study area are
listed in IUCN Redlist including Shorea rugosa (Critically Endangered), Shorea tesymanniana
(Endangered), and Gonystylus bancanus (Vulnerable).
Tropical rainforests are converted to other types of land use throughout the globe. The transformation
of natural ecosystems to managed systems frequently results in a loss of species diversity. In Jambi
Province, Sumatera (Indonesia) tropical lowland rainforests are transformed into oil palm plantations,
rubber plantations and ‘jungle rubber’. This project explores intraspecific genetic diversity of vascular
plants in reference forests and the three mentioned transformation systems. In 32 plots (50 x 50 m) of
these four different ecosystems, 10 individuals of 10 dominant species are sampled. Based on
anonymous AFLP markers we aim to assess the consequences of land use changes on the genetic
diversity of plants caused by the different species composition in each system.
Key words: Plant genetic diversity, AFLP, transformation system.
The worldwide loss and degradation of tropical rainforests caused by deforestation and transformation
into agricultural land also affects epiphyte communities. Due to their arboreal habitat, epiphytes are
very sensitive towards changes in microclimatic conditions, making them an excellent model group to
study the consequences of land cover change. Therefore, we investigated the consequences of
transformation from lowland rainforest into monocultures for vascular epiphyte diversity in Jambi
Province (Sumatra, Indonesia). In total 90 study plots (20 x 20 m) were established in Bukit Duabelas
National Park and surrounding oil palm and rubber plantations (30 plots per transformation system).
Each plot contained one main phorophyte which was investigated for vascular epiphytes. Additionally
all vascular epiphytes growing within a 2 m zone above the base of each tree within the plot were
recorded. We found a total of 54 epiphyte species belonging to 18 different families. While oil palm
plantations contain the highest number of individuals (1806 individuals, 80%), forest plots had a
much higher species diversity (45 species, 83%) compared to oil palm and rubber plantations. Further,
epiphyte communities in plantations showed higher rates of generalists while forest epiphyte
communities are rather composed by specialists. Thus, even if epiphytes are very abundant in oil palm
plantations, forest transformation clearly causes a loss of epiphyte diversity.
Keywords: vascular epiphytes, Sumatra, forest transformation, land cover change.
Session 10
FUNGI-2
Convener: Iman Hidayat & Atik Retnowati, Research Center for Biology, LIPI
Chairperson: Iman Hidayat, Research Center for Biology, LIPI
Venue: Sumatera Room
09.30 – 09.45 Nani Radiastuti et al.: Phylogenetic study of endophytic Phomopsis (fungi,
anamorphic Diaporthales) from Cinchona ledgeriana
09.45 – 10.00 Iman Hidayat et al.: Diversity of Oxydothis (Fungi, Ascomycota) on Palms in
Indonesia
10.00 – 10.15 Gayuh Rahayu et al.: Species of endophytic Colletotrichum from wild
Zingiberaceae
10.15 – 10.30 Israwati Harahap et al.: The first phylogenetic study of Kiliophora (fungi,
anamorphic Ascomycetes)
10.30 – 10.45 Kaylene Bransgrove et al.: Biodiversity and host specificity of the fungal
endophytes of the wet tropics of North-East Queensland, Australia
Phomopsis (Sacc.) Bubák, (teleomorph: Diaporthe Nitschke), lives as plant pathogens, saprobes or
endophytes. This genus is characterized by having two types of conidia called α–conidia (fusiform)
and β–conidia (filiform). In this study, a combination of morphological and molecular analyses
involving sequence of ITS (Internal Transcribed Spacer) and EF α–1 (Elongation Factor α–1)
generated several Phomopsis from leaf, petiole, fruit, and branch of C. ledgeriana collected from
Gambung (West Java, Indonesia) the analyses reveals four distinct lineages. The first lineage was D.
endophytica isolated from leaf, the second lineage was D. musigena from fruit, and the third lineage
was D. hongkongensis from branch. The fourth lineage contained three Phomopsis isolates from
branch and petiole were not included in the cluster from all other species of Phomopsis. Based on
morphological, and molecular analyses to estimate the variation of the Diaporthe (Phomopsis) species
occurring on C. Ledgeriana from Cinchona plantation in Gambung (West Java, Indonesia). This study
showed that more than one species of endophytic fungi from the same genus can occupy the same
host plant.
Keywords: Cinchona, Diaporthales, endophyte, phylogeny, taxonomy, Indonesia
Oxydothis Penz. & Sacc. (Xylariales) is a common saprobic fungi found on monocotyledonous plants,
in particular palms. Currently, 75 species have been described worldwide. Taxonomy status of
Oxydothis within Xylariales is still confusing as several authors placed this genus within
Amphisphaeriaceae, Hyponectriaceae, or Clypeosphaeriaceae based on morphological characteristic.
In order to clarify the taxonomy status of the genus Oxydothis, molecular phylogenetic analyses based
on sequence of 28S rDNA was carried out. Eleven species of Oxydothis associated with 15 species of
palms collected from Bogor Botanical Garden (Indonesia) were described and illustrated. Those
species are reported here as new records for Indonesia. Phylogenetic analyses based on 28S rDNA
sequences of several species of Oxydothis with closely related genera retrieved from GenBank
database showed that this genus is best placed in the family Amphisphaeriaceae, rather than
Clypeosphaeriaceae or Hyponectriaceae.
Key words: Fungi, Indonesia, Oxydothis, palmae, taxonomy
Information on endophytic fungi from cultivated Zingiberaceae was easily found, yet those from wild
Zingiberaceae has not been reported. Three isolates of endophytic Colletotrichum spp. were isolated
from two species of wild Zingiberaceae (Alpinia malaccensis and Etlingera punicea). Molecular
analysis of their ITS (Internal Transcribed Spacer) sequence indicated that two isolates belonged to C.
gloeosporoiodes complex and one isolate closed to C. crassipes. Of the two isolates in the C.
gloeosporoiodes complex, one isolate each belonged to the musae subclade and kahawae subclade.
Further analysis using other markers is needed for accurate identification to species level.
Key words: Colletotrichum, endophytes, Zingiberaceae, ITS
Kiliophora Kuthub. & Nawawi (Type: K. fusispora Kuthub. & Nawawi) was firstly described based
on conidiophores bearing spindle-shaped conidia. Only two species, viz, K. fusispora and K. ubiensis,
have been described worldwide. During the study of fungal diversity on Shorea spp. in Indonesia,
Kiliophora ubiensis was found on decaying leaves of Shorea spp., and this is the first report of K.
ubiensis from Indonesia. Since the taxonomy placement of this genus in the kingdom Fungi is
unknown, phylogenetic analyses was carried out based on its Internal Transcribed Spacer (ITS) rDNA
sequence. Phylogenetic tree generated from Maximum Parsinomy (MP) analyses suggested that
Kiliophora should taxonomically be placed in the Amphisphaeriaceae (Xylariales).
Keywords: Amphisphaeriaceae, Anamorphic Fungi, Phylogenetic, ITS, Kiliophora
Fungal endophytes live inside all plants and contribute to plant health, disease and insect resistance
and drought tolerance. They also produce potentially useful secondary metabolites and antibiotics, but
have not been investigated in the Australian tropics. To address this, the biodiversity, host specificity
and mycogeography of the fungal endophytes of the rainforest of north-eastern Queensland, Australia
are being investigated. This is being done with respect to a biogeographic corridor, the Black
Mountain Corridor, situated north of Cairns.
Endophytes were isolated from leaves of the three haplotypes of Elaeocarpus carolinae from across
the Wet Tropics and the Black Mountain Corridor. The haplotype of each host tree is being confirmed
and the fungal isolates are being identified by molecular and morphological techniques. Preliminary
results indicate that up to one hundred fungal taxa have been isolated from inside the leaves and that
they are from a range of distantly related fungal genera. Patterns of host specificity and
mycogeography will be elucidated as the taxon lists are finalised and species of fungi that are new to
science will be described.
Keywords: Fungi, endophyte, rainforest, tropics, Elaeocarpus, Australia.
Session 10
BRYOPHYTE-2
Convener: Benito Tan, NUS, Singapore & Ida Haerida, Research Center for Biology,
LIPI
Chairperson: Sri S Tjitrosoedirdjo, SEAMEO BIOTROP
Venue: Sumatera Room
09.30 – 09.45 Miftahul Jannah et al.: Taxonomy & distribution of crustose lichens in the forest
of Tahura R Soeryo, Batu, East Java
10.00 – 10.15 Etti S Siregar et al.: Radula (Hepaticae) of Mount Sibayak, North Sumatra,
Indonesia
Hepaticae of Bali
Haerida, I.
Herbarium Bogoriense, Research Center for Biology-LIPI
A preliminary Hepaticae inventory of Bali reports 18 genera of liverworts. Epiphyllous liverworts are
abundant, most of them members of Lejeuneaceae family. One species is expected as new record for
Bali i.e. Cololejeunea indosinica Tixier. Other new records or new species are expected to be found
after identification process is completed.
Keywords: Bali, Cololejeunea indosinica, Hepaticae, Lejeuneaceae, new record.
This study was conducted to explore the diversity of Radula on Mount Sibayak of North Sumatra,
Indonesia. There are ten species of Radula on Mount Sibayak in North Sumatra, three of the species
are new records for Sumatra (R. gedena, R. lingulata and R. loriana). An identification key of the
species of genus Radula from Mount Sibayak, North Sumatra is provided.
Keywords: Radula, Mount Sibayak, North Sumatra.
Session 11
TAXONOMY & SYSTEMATICS-7
Convener: Julisasi T Hadiah, Bogor Botanic Gardens
Chairperson: Deden Girmansyah, Research Center for Biology, LIPI
Venue: Borneo Room
11.00 – 11.15 Jun Wen: A revised classification of Vitaceae in the Malesian region
11.15 – 11.30 A Latiff Mohamad: Completing the taxonomic revision of Vitaceae for Flora
Malesiana
12.00 – 12.15 Ana R Simoes & GW Staples: Clearing the Borneo mist: a revision of woody
lianas (Convolvulaceae)
12.15 – 12.30 Yee Wen Low: On the scent trail: Taxonomic revisions in Malesian Gardenia
(Rubiaceae)
Wen, J.
Department of Botany, Smithsonian Institution, Washington, U.S.A.
e-mail: wenj@si.edu
Vitaceae (the grape family) consists of about 15 genera and 900 species, with the Malesian region as
an important center of diversity (165 species). Recent phylogenetic analyses suggested the need to
redefine several genera. Cayratia is paraphyletic with Tetrastigma and Cyphostemma nested within it.
Pterisanthes is nested within Ampelocissus. A clade including Ampelopsis, the African Rhoicissus
Planch., the Australian Clematicissus Planch. and five species of Cissus L. from South America has
been resolved as the first diverged lineage within Vitaceae, but Ampelopsis is paraphyletic. The
phylogenetic evidence supports the recognition often genera from the Malesian region: Ampelocissus
(60 spp., including 20 species of Pterisanthes, and the type species of Nothocissus), Ampelopsis (1
sp.), Cayratia (10 spp.), Causonis Raf. (9 spp., a segregate of Cayratia), Cissus (30 spp.),
Austrocissus gen. nov. (4 spp.), Leeampelopsis gen. nov. (1 sp., a segregate of Ampelopsis),
Parthenocissus (1 sp.), Tetrastigma (45 spp.), and Vitis (1 sp. native and 1 sp. cultivated). The new
genus Austrocissus exhibits an intercontinental disjunct distribution, including four recently treated
species of Nothocissus from New Guinea and Australia, plus a species formerly included in Cissus
from the Neotropics.
Key words: Vitaceae, classification, Austrocissus, Causonis, Leeampelopsis.
Latiff, M.A.
Universiti Kebangsaan Malaysia, Bangi, Selangor, Malaysia
e-mail: latiff@ukm.my
An overview of the family Vitaceae in the Malesian area with the current status of the revision for
Flora Malesiana and the known number of genera and species is given. The Vitaceae is a family of
14-15 genera and over 1000 species in tropical to temperate regions of both hemispheres and in
Malesia there are 9 genera (excluding Leea) with ca. 203 species. The genera Vitis (1 species, 1
introduced), Ampelocissus (34 species) and Cissus (19 species, 2 introduced) are circumtropical and
the genera Ampelopsis (2 species) and Parthenocissus (2 species) are centred in North America and
Central Asia. The genera Cayratia (16 species) and Tetrastigma (35 species) are confined to tropical
and subtropical Old World. Only the genera Nothocissus (4 species) and Pterisanthes (20 species) are
truly Malesian. They are woody climber; dioecious, monoecious, climb by means of leaf-opposed
tendrils. Leaves simple or compound. Inflorescence oppposite the leaves, axillary or seemingly
terminal, frequently cirrhiferous, dichotomous or umbellate cymes, racemose, thyrse or a panicle of
flattened lamellae. Flowers 4 or 5- merous. Ovary superior, 2-locular, each locule with 2 erect ovules.
Fruits a berry; pisiform, pyriform to oblong, pulpy, cerebriform, 1- to 4-seeded. Seeds obovate or
elliptical in outline, smooth or rugulose; carinate; endosperm ruminate, simple to complex with lateral
meristematic in growths. The generic delimitation and some specific taxonomic problems are
discussed.
Keywords: taxonomic revision, Vitaceae, Flora Malesiana.
Phyllanthus section Urinaria is distributed worldwide with the distribution centre in the Southeast
Asia region. In a previous systematic revision, three subsections are classified in the section, which
contain six species and one subspecies. In this study, light microscopy, scanning electron microscopy
as well as transmission electron microscopy were used for comparing pollen and seed morphology
and anatomical structures. As a result, seven additional taxa are recognized to be members of section
Urinaria, and are grouped into subsections. The subsection Urinaria has been morphologically
divided into two groups, one with spiral ornamentation on the seed surface and the other with radial
ornamentation on the seed surface. Each group contains both diploid and tetraploid species. Markers
of nuclear DNA (ITS and PHYC) and chloroplast DNA (accD-psal and trnS-trnG) will be used for
reconstructing the phylogeny to discuss the relationship among subsections or species. Based on the
differences in maternal effects in different organelles, clues hidden in the molecular data will be
discussed to understand the possible evolutionary processes between diploids and tetraploids.
Keywords: Euphorbiaceae, Phyllanthus, Phyllanthaceae, phylogeny, polyploid formation, section
Urinaria, taxonomic revision.
Ganesan, S.K.
National Parks Board, Singapore Botanic Gardens, 1 Cluny Road, Singapore 259569
A monograph of the ornamental and commercially important Asian tree genus Pterospermum Schreb.
is currently being undertaken. In this paper I will present the taxonomic history of the genus, highlight
new taxonomic and phylogenetic data, provide a summary of ecological observations and discuss the
potential uses of Malesian species in urban forestry.
Keywords: Pterospermum, Malvaceae, Malesia, taxonomy, phylogeny, urban forestry
The tribal classification in Convolvulaceae has been the subject of debate for over 100 years. The
advances of molecular techniques allowed a clarification of the main phylogenetic relationships
within the family but the classification of one particular tribe, "tribe Merremieae", could not be
resolved. It was found to form a paraphyletic grade and no clear morphological characters were found
to support it. Merremia, the largest genus in the "tribe Merremieae" (c. 100 species), was also
resolved as paraphyletic. The genus has no monograph and no synapomorphies, much like the tribe,
and through time has become an agglomeration of questionably related species (a "dustbin"). More
recent molecular phylogenetic analyses addressing specifically the classification of this complicated
tribe and its largest genus have shown with greater confidence that the tribe is not monophyletic and
neither is Merremia. However, several clades within Merremia were found to be well supported and
highly congruent with morphology and geography, and are now being taxonomically revised in order
to help recircumscribe Merremia into a more natural gathering of species. One of the clades resolved
by this new molecular phylogeny comprises large woody lianas with broad cordate leaves and
corymbiform inflorescences. Although genus Merremia is pantropical, this particular clade is mostly
distributed in SE Asia, with a significant number of species being endemic to Borneo. The clade is
robustly supported in the molecular phylogenetic analyses (89/94/100) and by several morphological
characters, such as the habit, the leaf shape, calyx shape and pollen morphology, leaving no doubt that
this species are closely related and form a strongly supported natural group. My presentation will
discuss the newly proposed taxonomic revision of this complex of species from Borneo and
surrounding areas, in the context of the molecular and morphological data that I have recently
analysed.
Keywords: molecular systematics, pollen morphology, taxonomy, Convolvulaceae, Merremi, Borneo
Yee, W.L.
The Herbarium, Singapore Botanic Gardens, Singapore
Gardenia J.Ellis (Rubiaceae) consists of about 200 species of mostly shrubs and trees. Found in the
Old World tropics, extending from Africa into India, the Ryukyu Islands, Taiwan, Southeast China,
through Indochina, the Malay Archipelago, Australia, and the Pacific Islands, about 30 species are
estimated to occur in Malesia, occupying various habitats, such as freshwater swamp forests,
limestone forests, montane forests, peatswamp forests, and even ultramafic forests. Reassessment of
the genus for Malesia is much needed as various disparate taxa with strongly divergent morphological
characters have been reclassified by various authors since the 1950s under other genera, including
Catunaregam, Kailarsenia, Porterandia, Rothmannia, etc., leaving a much smaller and apparently
better defined genus. Current revisions pertinent to the region include the clarification of the G. elata /
G. tubifera complex and descriptions of some West Malesian taxa, as well as a revision of the genus
for the Philippines. Current revisionary progress is discussed, firming up features that could be further
tested using straightforward molecular approaches, including a stricter morphological generic
delimitation, as well as useful features for distinguishing taxa and recognising members of apparently
vicariant pairs. A continuing, island-by-island approach to the enumeration of Wallacean and East
Malesian Gardenia also seems feasible, as indicated by largely different taxa from the various islands
or island groups in preliminary assessments conducted so far.
Keywords: diversity, Gardenia, Malesia, molecular phylogeny, Rubiaceae, taxonomy.
Session 11
ECOLOGY-6
Convener: Rochadi Abdulhadi & Laode Alhamd, Research Center for Biology, LIPI
Chairperson: Tukirin Partomihardjo, Research Center for Biology, LIPI
Venue: New Guinea Room
11.00 – 11.15 Tukirin Partomihardjo: Landscape, vegetation and floristic diversity of Nusa
Kambangan Island-Cilacap, Central Java
11.15 – 11.30 Julisasi T Hadiah: Plant diversity and vegetation structure of Batur Agung
Cultural Heritage Site, Central Java
11.30 – 11.45 Corazon Alava: Ecosystematic studies of trees and Pteridophytes in two forests in
Mindanao
11.45 – 12.00 Adi Susilo & Titi Kalima: The abundance and habitat of Taxus sumatrana
(Miquel) de Laub. at Mt Kerinci, Kerinci Seblat National Park
Partomihardjo, T.
Botanical Division, Research Center for Biology-Indonesian Institute of Sciences
The Nuskambangan Island is a unique small island, in particular for its biological and ecological
aspects. The island supports the largest expanse of a Lowland Dipterocarp forest remaining in Java,
providing a good picture of the original Javan lowland forest. The most interesting feature from the
phytogeography point of view is the presence of a giant tree species Dipterocarpus littoralis of the
Dipterocarp family, which to date dominates the lowland forests of Sumatra and Kalimantan. The
species is endemic on the island with extremely rare population. Currently the population of this
endemic species is seriously threatened by illegal felling and its habitat destruction. Other rare and
unique species growing on this island include Amorphophalus discus-silvae, Gonystylusmacrophyllus,
Lithocarpus platycarpus, Rafflesia patma, Rafolvia serpentine, Anysoptera costata, Hopea sangal,
Shorea javanica and Sindora javanica. Recent exploration recorded at least 767 species of vascular
plants occurring on Nusakambangan. The island supports at least nine vegetation types i.e. (1)
mangroves, (2) sandy beach vegetation, (3) coastal mixed forests on steep slopes, (4) mixed forests
on hilly limestone, (5) lowland mixed dipterocarp forests, (6) old secondary forests, (7) scrub
vegetation, (8) tree plantations (teak, Paraserianthes, coconut and rubber) and (9) gardens and paddy
field. A number of caves on the limestone hills have considerable biological and ecological
significance, hence need special protection. In addition the Portuguese fort, old light-house and
beautiful beaches are of high touristic values, requiring worthy and appropriate management system.
There are four gazetted nature reserves on the island, i.e. a tiny offshore island of Majetito protect
“WijayaKusuma” (Pisoniagrandis); the KarangBolong Caves , covering 0.3 ha; and natural lowland
forest areas of about 200 ha on the eastern tip and about 700 ha on the southwest corner of the island.
Keywords: Small island, flora, vegetation, endemic and rare species, conservation, tourism
Hadiah, J.T.
Bogor Botanic Gardens, Indonesia
The diversity of the flora and vegetation structure of BaturAgung Cultural Heritage Site (Batur Agung,
Baseh Village, Kedung Banteng District, Banyumas Regency, Central Java, Indonesia) were
investigated. The 1.8 ha natural forest was sampled using a line transect sampling of ten plots. A total
of 68 species belonging to 56 genera and 40 families were documented. Based on the Importance
Value Indexes, the dominating plants for each forest stratum are as follows: the canopy layer of the
forest was dominated by trees of Pasang (Lithocarpus sp.), Janitri (Elaeocarpus sp.), Nangkahan
(Artocarpus sp.), Matoa (Pometia pinnata), and Angsana (Pterocarpus indicus); the sapling was
dominated by Wunen (Antidesma sp.) and Umbel-umbelan (Saurauia cauliflora); and the ground
cover was dominated by Homalomena sp., Keji Beling (Chloranthus elatior) and a member of the
Malvaceae (Sterculioideae).
Keywords: Batur Agung Cultural Heritage Site, flora exploration, plant diversity, vegetation analyses,
vegetation structure.
Alava, C.
Bukidnon State University University, Malaybalay, Bukidnon,Philippines
Inventory of trees and Pteridophytes in two forests in Mindanao in Mt. Mayapay, Butuan City,
Agusan del Norte and Mt. Nabalabag, Talakag, Bukidnon was conducted at the Western, Northeastern
and Southern sides on established trails, and assessed using the belt transect method. Field sampling
resulted to a total of 1,607 tree individuals belonging to 63 species, 55 genera and 39 families; for
Pteridophytes, a total of 5,613 individuals belonging to 104 species, 80 genera and 36 families. The
dominant species for trees in Mt. Nabalabag is Pentacme contorta, a Dipterocarp while in Mt.
Mayapay, Ficus sp., a species of Family Moraceae. For pteridirophytes, the dominant species in Mt.
Nabalabag is Nephrolepis biserrata (Oleandraceae) while in Mt. Mayapay, Dicranopteris lineares
(Gleicheniaceae). Local assessment for trees showed 1 common species, 8 rare species, 3 depleted, 39
indeterminate and 6 unidentified. For pteridophytes, 13 common species, 16 rare species, and 33
indeterminate species. Species diversity is observed most at the upper portion of the mountains in the
Northeastern side, the Southern and Western side for both study sites follow this. Species similarity in
both mountains is greatest in sites 1 and 3. Of all species found in the study sites, seven (7) species of
trees and fourteen (14) species of pteridophytes showed significant differences with some ecological
factors. Statistical analysis showed significant differences between mountains, sites and locations.
Keywords: ecosystematic studies, trees and pteridophytes, biodiversity.
The study of Taxus sumatrana was conducted in the area of Kerinci Mountain, at Kerinci Seblat
National Park, in April 2012. The research objective was to obtain data and information on abundance
and habitat preference of T. sumatrana. Line plot systematic sampling method was used on the habitat
of T. sumatrana. Two line plots of 20 x 120 m was laid at an altitude of 1400-1500 m asl and at
altitude of 1800-1900 asl respectively. Another 20 x 100 m line plot was laid at 1800-1900 m asl.
Each line plot was divided into 20 x 20 sub plots for tree enumeration sub plots of 10 x 10 m for pole
stage enumeration, 5 x 5 m for sapling enumeration, and 2 x 2 m for seedling enumeration by nested
system. The results revealed that the highest abundance of T. sumatrana was at the altitude of 1900-
2000 m asl for tree stage by 62.50 individual/ha, for pole stage by 30 individuals/ha, for sapling stage
by 120 individuals/ha and for seedling stage by 500 individuals/ha. Species diversity at the study site
was relative low as shown by Shannon diversity index of less than 1.5 ( H’ < 1.5). The value of
diversity index is influenced by the number of species present in a community, thus the lower index
diversity of the related area, indicate the more unstable community. For the ecological and
economical value, T. sumatrana need to be protected through conservation in-situ, ex-situ, including
cultivation and genetic conservation for sustainable use.
Keywords: Taxus sumatrana, abundance, Mount Kerinci, Kerinci Seblat National Park.
Session 11
ETHNOBOTANY-1
Convener: Eko Baroto Walujo, Research Center for Biology, LIPI
Chairperson:Terry Sunderland, CIFOR Indonesia
Venue: Sulawesi Room
11.00 – 11.15 Wawan Sujarwo et al.: Conservation status of food plants based on local
knowledge in Bali
11.15 – 11.30 Jayson Gayo & Teodora Balangcod: Most utilized plants for construction purposes
among the local community of Sitio Beckes, Barangay Bayabas, Sablan, Benguet,
Philippines
11.30 – 11.45 Carmelita G Hansel & N Mambering: Ethnomedicinal plant use in a Maranao
village in Lanao del Sur, Mindanao Island, in Southern Philippines
11.45 – 12.00 N Husna Zaidi et al.: Utilization of the medicinal and aromatic plants by selected
Orang Asli (OA) communities in Peninsular Malaysia
Sujarwo, W.* 1,2, Arinasa, I.B.K.1, Salamone, F.2, Peneng, I.N.1 & Caneva, G.2
1
“Eka Karya” Bali Botanic Garden - Indonesian Institute of Sciences, Baturiti, Bali, Indonesia
2
Department of Science, the University Roma Tre, Italy
*e-mail: wawan.sujarwo@lipi.go.id; wawan.sujarwo@uniroma3.it
A recent global analysis of extinction risk for the world's plants has revealed that the world’s plants
are as threatened as mammals, with one in five of the world’s plant species threatened with extinction.
This study provides an overview and critical discussion of food plants perceived by informants in Bali.
The study was conducted in 13 Bali Aga villages of the Bali Island, Indonesia. Bali Aga refers the
village where the descendents of the traditional inhabitants of Bali live. Data was obtained
ethnobotanically by field observations, focus group discussions, and interviews. 381 food plants were
identified; 180 species least concern, 4 species near threatened, 172 species vulnerable, 23 species
endangered, and 2 species critically endangered. Amongst endangered species are those of: Aleurites
moluccana (L.) Willd., Basella rubra L., Bauhinia tomentosa L., Bambusa ooh Widjaja & Astuti,
Caesalpinia sappan L., Carmona retusa (Vahl) Masamune, Citrus amblycarpa (Hassk.) Ochse, Citrus
grandis (L.) Osbeck, Dinochloa sepang Widjaja & Astuti, Dioscorea nummularia Lamk, Elaeocarpus
oxypiren K. & V., Garcinia balica Miq., Garcinia dulcis (Roxb.) Kurz, Garcinia parvifolia (Miq.)
Miq., Gossypium herbaceum L., Gigantochloa baliana Widjaja & Astuti, Manilkara kauki (L.)
Dubard, Myrmecodia armata DC., Myrmecodia tuberosa (non Jack) Bl., Nypa fruticans Wurmb.,
Pinanga arinasae J.R.Witono, Santalum album L., Schizostachyum castaneum Widjaja. Critically
endangered species attributed to food plants by the informants are Coleus parviflorus Bth. and
Corypha utan Lamk.
Keywords: conservation status, food plants, local knowledge, Bali Aga.
Ethnobotany is the study of the relationship between plants and people in a society. In the Philippines,
most ethnobotanical studies were focused on larger tribes, i.e. the Ifugaos and Negritos, and
concentrated on topics about medicine and food. This study aimed to document the traditional
knowledge of the local community in Sitio Beckes on plants that are used for construction purposes,
which can be used for further researches. Two fieldworks were conducted in 2012 to gather data from
a sample of 16 respondents, mostly farmers, through the use of questionnaires. The study site is
delimited at Sitio Beckes, of Barangay Bayabas, Sablan in Benguet. The results yielded three most
utilized plants for construction purposes. First is the Adaan, Wallaceodendron celebicum commonly
used for building houses and furnitures, second is the Kawayan, Bambusa vulgaris Linn. commonly
used for building animal cages or fence, and third is the Mahogany, Swietenia macrophylla King
commonly used for furnitures. The traditional knowledge and practices of utilizing these plants for
construction purposes were used and tested by the former generations. These plants can produce a
product that lasts for years making them able to preserve their abundant resources, rich environment
and traditional knowledge for the next generation.
Keywords: ethnobotany, Sitio Beckes, construction purposes, Barangay Bayabas, Sablan, Benguet.
Wallaceodendron celebicum, Bambusa vulgaris, Swietenia macrophylla, traditional knowledge.
The Maranaos are a Muslim ethnolinguistic group concentrated in the provinces of Lanao del Sur and
Lanao del Norte on Mindanao Island in southern Philippines. Ethnobotanical field work was
conducted in the Maranao village of Barangay Ambari, Pagayawan, Lanao del Sur from October 17,
2010 to November 6, 2010. Interviews and transect walks were done with 30 informants representing
the household heads in the village. This led to to a listing and collection of 104 plant species that were
used for medicinal purposes in treating 79 diseases. Eighty-five species were subsequently identified
scientifically, distributed across 81 genera and 54 families. Family Asteraceae was the most
represented plant family. As to habit, herbs made up 39.4% of the total medicinal plants used. The
largest percentage of the medicinal plants was used to treat respiratory disorders (15.4%), followed by
fever and aches and gastrointestinal illness (14.2%), and lastly by gynecological problems (11.9%).
The leaf was the most common used plant part (62%) while decoction was the most common method
of preparation (33.3%). Oral administration was the most common way of administering the
traditional medicine (77.4%). Comparison of the plant listing in the present study with a prior study
on medicinal plants used by the Maranaos by Flores et al. and with Quisumbing’s comprehensive
work on Philippine medicinal plants reveal previously unrecorded plant species. This increases the
database for species that could be screened and tested for potential drug development.
Keywords: ethnobotany, traditional medicine, herbal medicine.
Nurul Husna, Z., N.H.*, Tan, A.L., Nurnida, M.K., Norshakila, Y., Intan Nurulhani, B., Lim, H.F.,
Nik Musaadah, M. , Fadzureena, J. & Norini, H.
Forest Research Institute Malaysia, Selangor, Malaysia
*e-mail: nurulhusna@frim.gov.my
A study had been conducted at nine selected Orang Asli (OA) communities in Peninsular Malaysia
which involved ten sub-ethnics; Semelai, Jahut, Jakun and Che Wong (Pahang), Jahai, Temiar and
Semai (Perak), Bateq (Kelantan), Semoq Beri (Terengganu), Temuan (Selangor) and Kanaq (Johor).
The aim of this study is to document their knowledge and utilization of medicinal and aromatic plants
in their daily practices. It also aims to compare the diversity of the plant used and its usage among the
communities. A socio-economic survey and two capacity buildings were carried out on each
community to document and compile the knowledge from community on the medicinal and aromatic
plants used. A total of 1096 plant samples (163-Semelai, 106-Jahut, 138-Jakun, 85- Che Wong, 98-
Jahai and Temiar, 87- Semai, 114- Bateq, 101- Semoq beri, 124- Temuan and 50- Kanaq) were
documented from the ten sub-ethnics. Families that were commonly utilized by the communities were
from Zingiberaceae, Fabaceae, Arecaceae, Poaceae, Asteraceae and Rubiaceae. Majority of the plants
collected from the communities were used for post-partum, wound healing, aphrodisiac and fever.
The plant parts that were commonly used were the roots in the form of decoction and leaves made
into poultice.
Keywords: utilization, medicinal plants, Orang Asli, sub-ethnic.
Session 12
GENERAL SUBJECT
Convener: Rugayah, Research Center for Biology, LIPI
Chairperson: Rismita Sari, Bogor Botanic Gardens
Venue: Borneo Room
13.30 – 13.45 Metilistina Sasinggala & Harry Wiriadinata: Begonias as a model to stimulate
students to learn plant taxonomy
14.00 – 14.15 Graziel DS Luis: Phytochemical screening and antimicrobial study of indigenous
medicinal plant species in Atok, Benguet, Philippines
14.15 – 14.30 Lusia B Moses: Development of antioxidant herbal tea from leaves of
Clinacanthus nutans (Burm. F.) Lindau
Indonesia is a mega diversity country, being extremely rich in plant species. In contrast, there are
relatively few plant taxonomists in comparison to this species richness. Many universities in
Indonesia do not have a herbarium with a complete sampling of their local flora, and many students
are not interested in studying plant taxonomy. Begonias are an interesting large group of plants with
many species that can be found in the wild, as well as having many species in cultivation. The genus
has very unique characters, being easily recognized by the asymmetric leaf blade and unisexual
flowers. There are many exotic species of Begonia around Tondano campus, Manado State University,
as well as wild species outside the campus, which can be used to teach students about morphology,
species descriptions, scientific names and classification, fenology, ecology and biogeography, plant
conservation, etc. Furthermore, Begonia can also be used to broaden students’knowledge of the
economic potential of their native flora for ornamental purposes. The genus Begonia is proposed as a
teaching model to stimulate interest in plant taxonomy in Manado University.
Keywords: Begonia, plant taxonomy, lesson model, Manado University
Williams, C.
NParks, Jacob Ballas Children’s Garden, Singapore Botanic Gardens
e-mail: craig_williams@nparks.gov.sg
As part of our survival instinct, we are programmed to notice things that move. The small group of
plants that exhibit this behavior have a strong attraction for children and the gruesome allure of
carnivorous plants, the fauna of a children’s garden has a strong role to play. In highly urbanized
Singapore, where casual contact with nature has been reduced, insects, including those that some
adults might perceive as plant pests, evoke fascination, and an excited mix of attraction, fascination
fear and repulsion in the young visitors to the Jacob Ballas Children’s Garden. Experiences with many
of these bugs would once have been part and parcel of the unconscious exploration that is part of
growing up. Offering intimate encounters with these creatures at an early age may go some way to
reducing the fear of the natural unknown which is apparent some of JBCG’s visitors. Capturing any
visitor’s imagination is a powerful first step to education, and highlighting herbivores and their
predators in this setting, can offer a memorable introduction to plants foundation stone role in eco-
systems.
Keywords: education, interpretation, garden ecology, plant/animal interactions, urbanisation
San Luis, G.*1, Balangcod, T.1, Abucay, Jr, J.1, Wong, F.1, Balangcod, K.1, Afifi, N.I.1, Apostol, O.1
1
College of Science, University of the Philippines
*e-mail: grdelrosario@yahoo.com
Atok, Benguet is a municipality located in the Northeast of the Philippines and is known for being
highly susceptible to landslide. Selected indigenous plant species from Atok, Benguet were collected
and tested for phytochemical screening and antimicrobial activity. Some of these are coffee (Coffea
sp.), Angel’s trumpet (Datura arborea) and what is commonly known as Ceylon tea (Camellia
sinensis). These plants were selected mainly because they were found thriving in the municipality.
Based on a separate study, these plant species can be used to revegetate landslide which are abundant
in the area meaning that these plant species can adapt to the soil conditions even after landslide
occurrence and can still be beneficial and valuable to the community. This study was conducted to test
the plant species, which can be used for revegetation, for their phytochemical content and
antimicrobial potential. Five hundred grams of air dried plant materials were macerated using
methanol. The concentrated methanol extracts were then subjected for phytochemical screening and
microbial activity. Based on the results, Camellia sinensis was found to have the most number of
metabolites. It provided positive results for flavonoids, saponins, tannins, alkaloids, steroids and
cyanogenic glycoside. For antimicrobial activity, the plant extracts were tested against four
microorganisms namely Streptococcus typhimurium, Bacillus cereus, Escherichia coli,
Staphylococcus aureus, and Pseudonomonas aeruginosa using disc-diffusion method. The extract
from Camellia sinensis leaves was active against all the strains and is comparable to the results of the
four antibiotics (Chloramphenicol, Vancomycin, Kanamycin and Streptomycin) used as positive
controls. It was 30% - 87% as effective as the antibiotics against all strains. The presence of the
different metabolites can be responsible for the good microbial activity of the Camelli sinensis extract.
Keywords: antimicrobial activity, Atok, disc-diffusion, indigenous, phytochemical screening
Moses, L.B.1, Abdul Aziz, Z.2, Mamat, H.3 & Abu Bakar, M.F.1
1
Institute for Tropical Biology and Conservation, Universiti Malaysia Sabah, Malaysia
2
School of Science and Technology, Universiti Malaysia Sabah, Malaysia
3
School of Food Science and Nutrition, Universiti Malaysia Sabah, Malaysia
Clinacanthus nutans (Burm. f.) Lindau (Family: Acanthaceae) or commonly known as ‘Sabah Snake
Grass’ in Malaysia is traditionally used for its medicinal properties. Despite all the studies on its
pharmaceutical properties, there is no study has been performed to investigate the antioxidant activity
on herbal tea from C.nutans leaves. This present study was conducted to develop herbal tea
(fermented and unfermented) from leaves of C. nutans and investigate the phytochemicals and
antioxidant properties in vitro. Total phenolics content (TPC), total flavonoids content (TFC),
catechin content (CC) and antioxidant activities were determined in both freeze dried and microwave
dried of unfermented and fermented leaves tea with different infusion time. Unfermented microwave
dried leaves tea of C. nutans showed the highest content of TPC and TFC. All tea infusions showed
effective reducing power and free radical scavenging activity when tested using DPPH (2,2-diphenyl-
2-picrylhydrazyl) and ABTS (2,2'-azino-bis (3-ethylbenzothiazoline-6-sulphonic acid) free radical
scavenging assays as well as FRAP (Ferric reducing/antioxidant potential) assay. However,
antioxidant property is not significantly dependent with the increasing time of infusion (P>0.05). The
free radical scavenging and reducing activities may be attributed by the presence of phenolic and
flavonoid compounds in the infusions. The results obtained in the present study indicate that herbal
tea from leaf of C. nutans has a potential as natural antioxidant for the protection of oxidative damage.
Jasminum in Thailand
AFG Kerr, an Irish surgery doctor who served in the Royal Thai Government during 1907 – 1932,
held a highest frequency survey expedition and the largest amount of specimen collection for the
native Jasminum Thai species. In 1932, there were 45 Jasminum species native to Thailand which
were recorded by W.G. Craib, in the book Florae Siamensis Enumeratio. Later on P.S. Green’s
revised it and published in the Flora of Thailand (2000). According to him, the native Jasminum
species remained 31 species. In 2004, Jasminum rufohirtum Gapnep. was recorded as the latest native
Jasminum species found. Recently a new species was found and name after H.M. King Bhumibhol of
Thailand on the 65th Anniversary Celebrations of his Accession to the Throne, as J. bhumibholianum
Chalermglin in 2013. Then, it was suggested that there are 32 woody climbers and one small shrub of
J. siamense Craib. Based on its distribution condition, there were seven species endemic to Thailand,
namely, J. annamense (Wernham) subsp. Kerrii (Bhatnagar) P.S. Green, J. bhumibolianum
Chalermglin, J. calcicola Kerr, J. craibianum Kerr, J. funale Decne subsp. sootepense (Craib) P.S.
Green, J siamense Craib, and J. stellipilum Kerr. The most popular species grown in Thailand as
economic crop was J. sambac (L.) Aiton, but its seeding had been imported from aboard.
Keywords: Jasminum, Thailand.
Session 12
ECOLOGY-7
Convener: Rochadi Abdulhadi & Laode Alhamd, Research Center for Biology, LIPI
Chairperson: Edy N Sambas, Research Center for Biology, LIPI
Venue: New Guinea Room
13.30 – 13.45 Erizal Mukhtar & Tsuyoshi Yoneda: Growth rate of several important tree species
in relation to climate change during three decades in a tropical rain forest, West
Sumatra
13.45 – 14.00 Diny Hartiningtias et al.: Phenological pattern analysis and community structure
of Dipterocarpaceae in Way Canguk Research Center, Bukit Barisan Selatan
National Park, Lampung
14.00 – 14.15 Lai Simin: Reconnecting biodiversity: The Kheam Hock Road Project
14.15 – 14.30 Moh Azani A et al.: Assessment of Shorea bentongensis Foxw. (Meranti
mengkai) diversity as an endemic species and vegetation analysis in tropical
lowland forest of Malaysia
Growth rate of several important tree species during three decades were analysed in relation to climate
change in a foothill rain forest in Ulu Gadut, West Sumatra, Indonesia. The growth rate were
calculated for dbh measument between 1981-1989, 1989-1996, 1996-2004 and 2004-2012. Relative
Growth Rate of Diameter (RGRD) were various between emergent (Swintonia schwenkii), canopy
(Hopea dryobalanoides, Shorea maxwelliana and Mastixia trichotoma), subcanopy (Calophyllum
soulattri, Gonystylus forbesii, Grewia florida and Cleistanthus glandulosus) and pioneer tree
(Macaranga pruinosa). The highest of growth rate was observed for pioner tree species (Macaranga
pruinosa) but their growth trend to decreased during three decades. Between canopy tree species
Mastixia trichotoma showed the higher growth rate. Growth rate trend of Hopea dryobalanoides was
decreased. Between subcanopy tree species Grewia florida was showed higher growth rate. Growth
rate of Gonystylus forbesii was decreased. The emergent tree species (Swintonia schwenkii) was
showed lower growth rate. Furthermore, between canopy tree species, Hopea dryobalanoides and
Shorea maxwelliana showed positive relation with rainfall but Mastixia trichotoma showed negative
relation. Growth rate of all subcanopy tree species showed positive relation. Both emergent tree
species and pioneer tree species were showed positive relation between their growth rate and rainfall.
The relationship between their performances in the forest stand was also discussed in this paper.
Keywords: growth rate, emergent tree, canopy tree, subcanopy tree, Ulu Gadut, West Sumatra
Research about phenology and community structure of Dipterocarpaceae in the forest of Way Canguk
Research Station (WCRS) had been conducted. The research aimed to acknowledge phenological
pattern and community structure of Dipterocarpaceae in WCRS and also the effect of phenological
pattern to community structure of Dipterocarpaceae in WCRS. This research used phenological data
provided by the Wildlife Conservation Society Indonesia Program (WCS-IP) during 1998—2011.
Phenological observation of blooming, fruiting, and appearance of new leaves was conducted visually
by binocular at every early month since February 1998. Observations were made in 100 plot of 10 x
50 m size each. Pattern analysis is based on diagram of each phenophase. Community structure data
collection conducted on July to October 2012 by the transect line method with varying path length,
which is 1200 m, 2000 m, and 2200 m long in accordance with the fixed transect of WCRS. Each line
created plots 200 x 20 m with 200 m spacing of each plot. Total plot of the entire transect was 108
plots. Phenological patterns depicted in diagram form, while the community structure in the form of
tables and maps. The results showed that the phenological pattern of blooming is sub-annual,
Dipterocarpaceae is dominated by genus Dipterocarpus, and phenologycal pattern did not affect
community structure of Dipterocarpaceae
Keywords: Bukit Barisan Selatan National Park, community structure, Dipterocarpaceae, phenology
analysis
Simin, L.
National Parks Board, Singapore Botanic Gardens
Much of Singapore’s original vegetation has been lost even before British colonization began. Efforts
to safeguard Singapore’s last remaining biodiversity via gazettement of nature reserves and
reintroduction of species into urban settings have been initiated in the last few decades. The Kheam
Hock Road Project was conceived in 2012 and launched in February 2013 to create a biodiversity
corridor between two key nature areas – Central Catchment Nature Reserve and the Singapore
Botanic Gardens. The Singapore Botanic Gardens, in collaboration with Horticulture and Community
Gardening, Streetscape, National Biodiversity Centre and Conservation divisions, coordinated this
project with the Singapore Chinese Girls School and residents of the Kheam Hock Road area. More
than 60 species of trees and shrubs such as Cratoxylum cochinchinense, Flacourtia inermis,
Melastoma malabathricum and Syzygium zeylanicum, have been planted by schools and residents
since its initiation, creating habitats for species of butterflies, dragonflies and birds. Parents and
students were trained in horticultural practices such as planting and plant propagation. Post-launch
surveys conducted between March and May 2013 indicated an increase in bird species. Continuous
efforts to enhance the greenery and biodiversity are on-going.
Keywords: Biodiversity, gardening, urban development, nature reserves, Singapore Botanic Gardens
Mohamad Azani, A.*, Contesa, S., Firdaus, M.N., Nazre, M. & Zaki, H.
Department of Production, Faculty of Forestry, Universiti Putra Malaysia, Malaysia
*e-mail : azani@upm.edu.my
The study was conducted to assess diversity of Shorea bentongensis as an endemic species in tropical
lowland forest, Malaysia. Belt Transect Method was used to collect data of all trees that having
greater than 10 cm dbh in Compartments 13 and 14, Lentang Forest Reserve, Bentong, Pahang. Data
collected were subjected to determined species richness, species diversity, similarity and rank
abundance. The composition of the six hectare area study plots revealed the presence of 1979
individual trees representing 114 species and 36 families. 51 individuals belong to S. bentongensis.
Species with highest relative abundance were Syzygium cerinum (0.8), Syzygium chloranthum (0.7)
and Syzygium syzygioides (0.5). The most diverse plot was Plot 1 with 855 individuals and 91 species.
The Jackknife estimate of species richness in Plot 1, Plot 2 and Plot 3 were 111.9, 99, and 90.9,
respectively. Comparison of the three plots in the study area showed the highest species diversity
index was H’=5.668 in Plot 1 where Plot 3 showed the lowest species diversity index with H’=5.216.
The average of diversity index for Shannon-Wiener’s index was 5.492 (greater than 5.0) which
indicates high diversity. High value of Shannon-Wiener’s index means that there was many (51
individuals) S. bentongensis scattered in six hectares area with a diameter of 10 cm to 90 cm. As S.
bentongensis is an endemic species, we should conserve the species as mother trees that will provide
wildings and seedlings in enrichment planting projects or ex-situ conservations in the future.
Keywords: Species richness, species diversity, species evenness, Important Value Index (IVI),
endemic species, Shorea bentongensis, tropical lowland forest
Session 12
ETHNOBOTANY-2
Convener: Eko B Walujo, Research Center for Biology, LIPI
Chairperson:Terry Sunderland, CIFOR Indonesia
Venue: Sulawesi Room
13.30 – 13.45 M Elena Ragragio: Diversity of use and local knowledge of plant food resources
of three Aeta communities in Pampanga Province, Luzon Island, Philippines
13.45 – 14.00 Aziah Muhamad: Use of plants in postpartum treatment: perceptions and practices
among the indigenous tribes in Brunei Darussalam
14.00 – 14.15 Mohammad F Royyani & Joeni S Rahajoe: Behind the sacred tree: local people
and natural resources sustainability
14.15 – 14.30 Taulana Sukandi & Titi Kalima: Tree species of peat swamp forest in Central
Kalimantan (Indonesia): Diversity and utilization by local people
14.30 – 14. 45 Muhammad Zafar et al.: Medicinal plant biodiversity in salt range region of
Punjab, Pakistan
Ragragio, E.M
Department of Biology
College of Arts and Sciences, University of the Philippines, Manila
The plants used as food by the Aeta communities has changed after the eruption of Mt. Pinatubo in
1991. The ethnobotanical study of the plant food resources and traditional plant knowledge was
conducted in three barangays (villages) of the Mag-indi and Mag-anchi enthnolinguistic groups of the
Aeta. The 3 barangays (Camias, Villa Maria and Inararo) are located at the foothills of Mt. Pinatubo.
A free, prior and informed consent was allowed by the community leaders. Sixty-nine
informants/participants were interviewed from the 3 barangays. A total of 106 plants were used as
food and for commercial crops. This is much less than the plants listed in the study of Fox (The
Pinatubo Negritos in 1952). Most of the plants were available in the local markets. Some were planted
by the Aeta as source of income to buy rice and other necessities. An analysis of the results showed
that the local knowledge is held mainly by the elders although some young people were also familiar
with the plants. Likewise, the erosion of the plant knowledge may be due to habitat destruction,
continuing commerce and interaction with the local people, and ease in procurement of rice and other
food plants from the local markets. There is also a level of acculturation due to the incursion and
influence of media in local TV.
People in Southeast Asia are widely reported to use plants in postpartum treatment which significantly
involves herbal bath, body care and herbal decoctions. This study focuses on the use of plants as an
ingredient in the preparation of postpartum treatment rituals by the indigenous tribes of Brunei
Darussalam, specifically the Malays, Kedayans and the Muruts. Data collection is carried out in the
three districts of Brunei Darussalam: Brunei Muara, Tutong and Temburong. Methodologically, in
depth interview was conducted among individuals of age between 26 to 84 years old comprises of
older generation, traditional healers, postpartum caregivers and parents. Unknown plants species are
collected for identification purposes. There are about 93 plant species found during the study in which
Muruts are utilizing about 13 plants species, Malays are utilizing 69 while Kedayans are utilizing 61
plant species in their postpartum treatment. Malays and Kedayans are found to mostly utilize the same
plant species in their treatment. This study provides a novel insight that despite the vast modernization
of healthcare in Brunei, the indigenous tribes are still using plants in the preparation of their
postpartum treatment rituals.
Keywords: traditional medicine, postpartum, indigenous tribes, plants
Behind the sacred tree: local people and natural resources sustainability
Local communities have their own means of maintaining their traditional knowledge and sustaining
production system of natural resources by designating the resources sacred. Without the state
influence, local people have their own strategies to conserve the environment and resources, which
are more effective than those enforced by state. A study using the interview, participation observation,
and ethnographic methods revealed that local people recognized two models of natural resources
conservation. The firts model is the designation of a forest as a sacred site, aiming at maintaining the
sustainabiliyu of sustaining ecosystem and the second model refers to adoption of a species as a
sacred entity to sustain production system. Dynamic processes are operating in the sacredness of both
forest and species.
Keywords: conservation, local people, sacred site, production system
Many peat swamp forests have been degraded due to overlogging and deforestation for other purposes.
The objective of this study was to identify the composition, diversity, and utilization by local people
of tree species in a peat swamp forest. The study was conducted in the forest had been degraded in
Mantangai Sub-District (Central Kalimantan Province). A method of quadrats established in lines was
applied for vegetation analysis. The Shannon-Wiener (H’) and the Importance Value (IV) indices
were used for analyzing the species diversity and the species importance respectively. Utilization of
trees species by local people was identifiedby interviewing respondents in villages surrounding the
forest area. The result showed that there were 2,564 individual specieson 1.28 ha area, consisting of
99 tree species and 10 non-tree species, 72 genus, and 46 families. The diversity of tree stage was
moderate (H’=1.37) with the dominant species of Calophyllum nodusum Vesque (IV=66.29% and
H’=0.14), and that of pole stage was also moderate (H’=1.69) with the dominant species of
Palaquium cochlearifolium P.Royen (IV=22.06% and H’=0.08%). There were at least 15 tree species
and three non-tree species currently used by local people for house construction, boat, furniture,
handicraft, medicine, and mosquito repellent.
Keywords: species composition, species importance, degraded forest
The Salt Range is a hills system in the Punjab province of Pakistan, deriving its name from its
extensive deposits of rock salts. The Salt Range is one of the most important and largest ranges of its
type in Pakistan, Asia and the world as a whole with the average height 1000 m. Communities use
different plants for protecting their houses, cultivated land and other plants to feed their roaming goats
and sheep in the pastures and to protect some grass land in the range. Many plants are uprooted and
many are heavily collected due to their medicinal uses at a local and national level. Land ownership
conflicts are one of the reasons for the non-existence of positive developmental work in the area.
human populations have long caused local extinctions of organisms (better documented for animals
than plants), suffered periodic shortages of natural resources (for example, as demonstrated by
recurrent famines) and been responsible for local environmental degradation (such as deforestation
and soil erosion). The root cause of plant loss is the huge and growing size of the human population,
creating pressure to destroy natural habitats, expand and intensify agriculture, and collect more
resources from wild plants. Intensive farms contain little botanical diversity compared to their more
traditional counterparts. This study was conducted in remote areas of Salt Range, Punjab, Pakistan.
Area is unique with wild life biodiversity and diverse communities who heavily dependent on
medicinal plant wealth of this range. Main emphasis of this study was to document indigenous uses of
medicinal flora by interviewing native communities including men, women, herbalists and resource
persons. The methodology comprised questionnaire methods to document indigenous knowledge of
local communities who are the main user of plant resources in this region. In total of 40 medicinal
plants were reported to be used as herbal medicines for various ailments. It is observed from this
study that Salt Range medicinal flora currently faced the problems of threats including unscientific
collection of medicinal plants by herbal sellers, herbalists and outsiders. It is suggested that
conservation of medicinal wealth of Salt rang is given priority by ecologists, taxonomists and policy
makers in order to intact and conserve this national heritage for future generation.
Keywords: Medicinal plants, salt range, Punjab, Pakistan
POSTER TITLES
CODE POSTER TITLES AUTHOR
Tuber morphological variations of Dioscorea spp. cultivars from Fauziah & Lia Hapsari
P-013
Pasuruan, East Java
Systematic significance of the leaf venation in Genus Ficus L. B Ummu-Hani &
P-014
(Moraceae) Affina E Aznal
MAA Ahmad Juhari et
P-015 Trichomes morphology in flower petal of Acanthaceae species
al.
P-016 Systematic study of Tacca leontopetaloides in Indonesia Rugayah et al.
Notes on the morphological characteristics of Eurycoma spp. observed Tan Ai Lee et al.
P-017
and its status in Peninsular Malaysia
Floral and leaf characters of some wild gingers (Zingiberaceae: Florfe M Acma et al.
P-018
Alpinioideae) in Mindanao, Philippines
Mophological diversity of Kemukus (Piper cubeba L.) in Java based on Niken Kusumarini
P-019
Herbarium Bogoriense specimen
Eva K Putri & T
P-020 Leaf flushing as taxonomic evidence of some Diospyros species
Chikmawati
Noor C Noor-Alam & I
P-021 Pollen morphology of underutilised fruit species
Salma,
Preliminary study of morphological variation of Kapulasan (Nephelium Nina R Djuita et al.
P-022
ramboutan-ake)
Sri Hartati, Wahyu
P-023 Seeking character-stated of Cassava’s tuber Nirwanto & Andi
Salamah
Orchid diversity and conservation assessment in Gunung Tahan Heath Siti F Md Isa & R Go
P-024
Forest Reserve Pahang (Peninsular Malaysia)
Orchid diversity in Gunung Api Purba Nglanggeran, Yogyakarta, Septy A Puspitasari et
P-025
Indonesia al.
Orchid diversity in Mekongga Mountainous Area, South - East Sulawesi, Diah Sulistiarini &
P-026
Indonesia Daniel Potter
The diversity of lowland orchids of Papua Verena Agustini et al.
P-027
P-028 Distributions of Vandaceous Orchids in Peninsular Malaysia Wee Nee Wong et al.
Dwi M Puspitaningtyas
P-029 Orchid inventory in Bantimurung-Bulusaraung National Park
& Siti R Ariati
Orchidaceae rescued from Bakun Hydroelectric Project (HEP) Dam, Ling Chea Yiing
P-030
Belaga, Sarawak, Borneo
P-031
Optimization of seed germination of an Indonesian threatened orchid Siti Nurfadilah et al.
P-032 Dendrobium laxiflorum J. J. Sm.: A perspective of in vitro orchid
conservation
Diah H Apriyanti & P
P-033 Applying extreme learning machine to orchid species identification
Normakristagaluh
Janna Ong-Abdullah et
P-034 Potential fragrance production and release sites of Vanda mimi Palmer
al.
Flowering phenology of Pinang gajah (Nenga gajah J. Dransf.) at Bogor Inggit P Astuti et al.
P-035
Botanic Gardens
Preliminary study on artificial pollination of Bidang (Borassdendron Inggit P Astuti et al.
P-036
borneense J. Dransf.) at Bogor Botanic Gardens
The phylogeny and biogeography of the Rattan Calamus javensis Blume Mega Atria et al.
P-037
complex (Arecaceae, Calamoideae)
The unique characters of coconut (Cocos nucifera L, Arecaceae) in Bali, Eniek Kriswiyanti
P-038
Indonesia.
Amorphophallus titanum Becc.: Seed germination with mini flower Dian Latifah & S
P-039
phenomenon Purwantoro
Variations of Durio in Central Bangka Regency, Bangka Belitung Dian Akbarini &
P-040 Province based on morphological characters Priyanti
Diversity of Ramin (Gonystylus spp.) non bancanus in East Kalimantan, Muhammad Mansur et
P-051
Indonesia al.
Siti Sunarti & D Potter
P-052 Myrtaceae: The diversity in Mekongga, South-East Sulawesi, Indonesia
Climate change impact assessment on species distribution and genetic Hsu Cheng-Te &
P-076 diversity of Alpine plants of Taiwan—Insights from Oreomyrrhis Clade Chung Kuo Fang
of Chaerophyllum
Potential local trees selecting for high carbon sequestration in low land Titut Yulistyarini et al.
P-077
ecosystem
Characteristics of stomata on five species of low land trees with high Setyawan A Danarto &
P-078
carbon sequestration AP Fiqa
Carbon stock of trees in coal mining concession forest at Sendawar, East Destario Metusala
P-079
Kalimantan
Study of edaphic factors to Bamboo in Mount Baung Natural Park, Siti Sofiah et al.
P-080
Pasuruan, East Java
M. Kotowska, Yasmin
Hydraulic architecture of tree species on tree cacao agroforest:
P-081 A Rajab, B Schuldt &
Abovegrount growth peformance and xylem anatomic properties
D Hertel
Soil nutrient dynamic at three defined elevation in relation to host plant Nasihah Mokhtar et al.
P-082
of Rafflesia kerrii in Highland of Kelantan, Malaysia
New record of Bryophytes family from Giam Siak Kecil-Bukit Batu Fandri Sofiana et al.
P-083
Biosphere Reserve, Riau Province
Bryophytes diversity of Merapi Mountain National Park Central Java, Musyarofah et al.
P-084
Indonesia
Bryophytes diversity of Cemoro Sewu Track of Mount Lawu East Java, Romawati et al.
P-085
Indonesia
Preliminary study Bryophyta in forest conservation area of Mount Eno, Medi Hendra et al.
P-086
Linggang Bigung West Kutai District.
P-087 Adaptation of ferns to epilithic mode of life Nina Derzhavina
Titien Ng
P-088 Chromosome numbers of some species of Pteris (Pteridaceae) in Java Praptosuwiryo &Mugi
Mumpuni
A preliminary molecular phylogeny of Selaginellacceae of Peninsular Nurfarahain Zainal et
P-089
Malaysia based on RBCL and ATB markers al.
Edwin R Tadiosa &
P-090 The wood-rotting fungi of the Philippines
NM Pampolina
Y Takashima, K
Arbuscular Mycorrhiza colonization status of Huperzia spp. in Mt.
P-091 Narisawa, I Hidayat &
Pangrango, West Java, Indonesia
G Rahayu
Preservation of Nostoc spp. (Cyanobacteria) isolated from Indonesia Regy I Ridart & Dian
P-092
paddy fields using freezing method. Hendrayanti
P-103 The use of plants from Moraceae & Urticaceae in traditional medicine DIS Utomo et al.
JH Paik, DIS Utomo, F.
Useful plants diversity in Pakuli and Toro village, near Lore Lindu Juniarti, W Nirmanto,
P-104
National Park, Central Sulawesi ASD Irsyam & A
Maruzy
The traditional medicinal uses of the Euphorbiaceae & Phyllanthaceae Doddy Irawan et al.
P-105
families
Potency and distribution of Tacca leontopetaloides as a local food Wardah & Edy N.
P-106 ingredient for wheat flour substitute in Southern Garut, West Java, Sambas
Indonesia
Plant diversity and its ethnobotanical potential of Wawonii Island, South Rugayah et al.
P-107
East Sulawesi
Medical plant used by the Atinggola healers, North Gorontalo, Sulawesi, Novri Y. Kandowangko
P-108
Indonesia et al.
The Utilization of ‘Sapupadang’ Baeckea frutescens L. locally in Yulian Fakhrurrozi
P-109
Bangka-Belitung Islands
P-001
Molecular phylogenetic study of Sumatran Impatiens (Balsaminaceae)
using Internal Transcribed Spacer (its) sequences
Impatiens L. (Balsaminaceae) is a large subcosmopolitan genus, comprising ca. 850 species with its
main center of diversity in the old world tropics and subtropics. The genus was revised for Sumatra by
Grey Wilson (1989) who recognized 29 species, of which 20 taxa were new. Recently, over the last
ten years, increasing numbers of Impatiens species from Sumatra have been discovered as further
exploration has been carried out. In this study, 25 samples of Impatiens, representing 17 species,
were sequenced for the Internal Transcribed Spacer region from nuclear ribosomal DNA and the
chloroplast atpB–rbcL intergenic spacer. These samples represent 16 endemic Impatiens species from
Sumatra and one common species. Parsimony analyses were done with the addition of additional
Impatiens sequences from GenBank. The results showed that Sumatran Impatiens species are
distributed in several separate clades indicating multiple origins of the species in Sumatra.
Keywords: Impatiens, Balsaminaceae, biogeography, endemic, ITS, phylogeny.
P-002
A taxonomic and phylogenetic study of Limnophila (Plantaginaceae)—
toward resolving relationship between sections
The aquatic genus Limnophila (Plantaginaceae) is mainly distributed in Old World tropics and
subtropics with the center of diversity in Southeast Asia. Former ly, taxonomists recognized 47
species divided into five sections based on leaf morphology. However, the aquatic habit often leads to
high phenotypic plasticity, so using vegetative characters for distinguishing sections may lead to
misunderstanding relationships within the genus. In our taxonomic study, leaf morphology, seed
surfaces and stem transection of aerial parts were examined. For phylogenetic construction, we used
cpDNA markers ndhF, trnL/F, and trnG from 22 species of four sections. Our analysis reveals that the
genus is a highly supported monophyletic group. Except the first branch, all taxa form a well-
supported clade comprising two main clades, one formed by members of sections Connatae and
Limnophila (CL clade), the other includes sections Striatae and partial Integrifolieae (SI clade). The
CL clade consists of two well-supported clades corresponding to the two sections. The section
Integrifolieae is polyphyletic because one taxon of this section is at the first branch while the other
taxon is sister to section Striatae. Morphological characters including venation, blade shape, calyx
striation and seed morphology are found to be congruent with the major clades. Based on this
evidence, we discuss infrageneric classification and sectional circumscriptions.
Keywords: aquatic plants, heterophylly, Limnophila, ndhF, phylogeny, trnG, trnL/F.
P-003
Phylogenetic studies in the Cryptocarya group (Lauraceae):
more taxa needed from the Flora Malesiana region
Rohwer, J.G.1, de Moraes, P.L.R.2, Rudolph, B.1 & van der Werff, H.3
1
Universität Hamburg, Germany
2
Universidade Estadual Paulista "Júlio de Mesquita Filho", Instituto de Biociências,
Departamento de Botânica, Brazil
3
Missouri Botanical Garden, U.S.A.
The Cryptocarya group is the first major clade separating from the rest of the Lauraceae. It is
estimated at some 500-700 species, of which a large proportion occurs in the Flora Malesiana area. A
phylogenetic analysis based on 83 nuclear ITS and chloroplast trnK intron sequences of 62 species
helped to identify the main clades within the group. Among the taxa from the Flora Malesiana region,
Triadodaphne inaequitepala is nested within Endiandra, which otherwise appears to be monophyletic.
Cryptocarya is clearly monophyletic as well, whereas Beilschmiedia is paraphyletic with respect to (at
least) Potameia from Madagascar and Yasunia from South America, possibly also with respect to
Endiandra. Both Beilschmiedia sensu lato and Cryptocarya originated in the Old World, and have
reached the Americas more than once. Unfortunately, our analyses so far include only very little
material from the FM region, although it may have played a key role in the initial radiation of the core
Cryptocarya group (Beilschmiedia s.lat., Cryptocarya, and Endiandra). Therefore, we are looking for
cooperation partners from this region.
Keywords: phylogeny, ITS, trnK intron, Lauraceae, Beilschmiedia, Cryptocarya, Endiandra,
Eusideroxylon, Potoxylon, Sinopora, Triadodaphne.
P-004
Phylogenetic position of the endemic Philippine species
of Bikkia reinw. (Rubiaceae) inferred from DNA sequence data including
a new inland forest species
Alejandro, G.J.D.
College of Science, Research Centre for the Natural & Applied Sciences, and The Graduate School, University
of Santo Tomas, Philippines
e-mail:gdalejandro@mnl.ust.edu.ph
Based on molecular data, the genus Bikkia Reinw. (coffee family) was formerly subdivided into two
groups with contrasting habitat and corolla shape. Subsequently, one group was transferred to a genus
of its own the Thiollierea Montrouz. (inland forest) leaving the Bikkia (coastal habitats) with about 10
species worldwide. In the Philippines, only Bikkia philippinensis Valeton is found in the coastal areas
of Cebu and Siargao Islands. Recent observation of herbarium specimens at Central Mindanao
University Herbarium (CMUH) revealed a diverging Bikkia species collected in the inland forest of
Mt. Redondo, Dinagat Island. Comparative evaluation was conducted using morphology and nuclear
rDNA (ITS region) and cpDNA (rps16 &trnL-F regions) was sequenced and analyzed from two
isolates of B. philippinensis and four isolates of the Bikkia species from Mt. Redondo. The separate
and combined most parsimonious trees showed that the inland forest Bikkia species from Mt.
Redondo was nested within a group of purely coastal species of Bikkia (BS=90%) but not with B.
philippinensis. The two Philippine Bikkia species also differ morphologically mainly in reproductive
features. Therefore, we proposed the name Bikkiaredondoensis provided with botanical illustration as
well as a discussion of the conservation status of the two Philippine Bikkia. Finally, Bikkia should not
be restricted to include only coastal species.
Keywords: Bikkia, conservation, cpDNA, nrDNA, Philippine endemic.
P-005
Phylogenetic relationships and associated hosts of
Balanophora laxiflora (Balanophoraceae) and allied taxa
Balanophora laxiflora is a dioecious species, distributed in southern China, Vietnam, and Taiwan.
Morphology of female B. laxiflora is similar with that of B. japonica and B. yakushimensis. No male
individuals have been found for the latter two taxa, and the agamospermy of B. japonica has been
confirmed in previous studies. We speculate that B. japonica and B. yakushimensis were probably
derived from the female ancestor of B. laxiflora. This study increased sampling of B. laxiflora
individuals, using DNA data to examine whether the two allied taxa were derived from B. laxiflora.
The result of this study reveals that, in Taiwan, B. laxiflora, B. japonica and B. yakushimensis each
forms a monophyletic group, and B. laxiflora is a sister group to the clade composed of the other two
taxa. By analyzing the phylogenetic relationships with the chosen intraspecific genetic variation of B.
laxiflora, we found that a subset of populations forms a highly supported monophyletic group.
We also examined the host diversity of B. laxiflora by using PCR amplification of DNA markers from
the associated roots. The results showed that hosts of B. laxiflora include Elatostema, Acer, Morus,
Ficus, Alnus, Rubus, and Ardisia.
Keywords: Balanophora, parasitic plants, phylogeny, agamospermy, host, molecular identification
P-006
Molecular phylogenetics of root-holoparasitic Balanophora
(Balanophoraceae) and their associated insects
P-007
The phylogenetic analysis of Malesian Hornstedtia Retz. (Zingiberaceae)
based on ITS sequences
An preliminary analysis to clarify the phylogenetic relationships of Malesian Hornstedtia has been
conducted by the DNA sequences with ITS markers. Forty five samples representing 23 Malesian
species (1-6 accessions per species) were analyzed in this study and supplemented with sequences of
additional Hornstedtia species from GenBank. The outgroups consisted of six Alpinia spp., four
Amomum spp., Burbidgea nitida, Elettariopsis stenosiphon, four Etlingera spp., Geocharis fusiformis,
Geostachys sp., Leptosolena haenkei, Siliquamomum tonkinense and Vanoverberghia sepulcheri of
which sequences were obtained from GenBank. Two groups of Hornstedtia can be recognized,
supported by high value of bootstrap. Group I was supported by bootstrap values of 98% for all
methods. Group II has bootstrap values at 94% for MP, 89% for ML and 71% for NJ method. Group
I consists of Hornstedtia species only, while the Group II consists of a grade with other genera.
Keywords: ITS, Hornstedtia, phylogeny, Zingiberaceae
P-008
Marker assisted selection characters for high productivity of Sago Palm
(Metroxylon sagu rottb.)
In sago plantations, high production plants are preferred, and then the selection of seedlings is done to
sustain productivity. This paper reports a study of the correlation between some of the vegetative
characters with the productivity of sago palms. This study’s aim is to determine the best characters for
marker assisted selection of sago plants with high productivity. Twenty-five morphological and
agronomic characters of spiny and spineless sago were analyzed. The results show that several
characters were correlated to each other. One of these characters, the color of the shoot of sago
seedlings, was positively correlated with length of trunk and number of leaflets. We conclude that the
color of the shoots of sago seedlings is likely to be a selection marker for superior sago in the future.
Keywords: Marker Assisted Selection, Metroxylon sagu Rottb., Sago Palm, Spineless Sago, Spiny
Sago, the color of sago seedlings.
P-009
Identification and cloning of partial curcin gene sequences in Jatropha
podagrica Hook. and Jatropha pandurifolia Andr.
P-010
Do cuticle characters support the recognition of Alseodaphne,
Nothaphoebe and Dehaasia as distinct genera?
The Asian members of the Persea group sensu Li et al. (2011) are divided among the genera
Alseodaphne, Apollonias, Dehaasia, Machilus, Nothaphoebe and Phoebe. A recent phylogenetic
analysis (Li et al. 2011) has shown that Machilus and Phoebe are supported as monophyletic genera
but evidence that the closely related genera Alseodaphne, Dehaasia and Nothaphoebe are
monophyletic or not was equivocal. In this study we analyzed cuticle characters of 95 collections
belonging to the Asian members except for Apollonias. We anticipated two possible outcomes. If the
genera were not monophyletic, we expected that the groups based on cuticle characters would consist
of species belonging to different genera. If the genera were monophyletic, we expected that the groups
based on cuticle characters would consist of species belonging to the same genus. We found 17
groups based on cuticles. Of these, 13 consisted of species of a single genus (one group included a
single species and thus a single genus). The four mixed groups included mostly species of one genus
with 1 or 2 species of a different genus. Our results support the recognition of Alseodaphne, Dehaasia,
Machilus, Nothaphoebe and Phoebe as distinct genera.
Keywords: Alseodaphne, cuticle, Dehaasia, Lauraceae, Machilus, Nothaphoebe
P-011
Is there any obligate apomixis in plants? A case study
in Elatostema (Urticaceae)
Apomixis, the asexual reproduction by seeds, has evolved independently several times in over 400
angiosperm taxa from at least 40 families. Most apomictic plant species are facultative, which are able
to produce sexual seeds, but it may be questioned if there exist any 100% obligate apomicts. Among
400 species in Elatostema (Urticaceae), nine possible apomictic species have been found. In Taiwan,
there are fifteen Elatostema species, including taxa with monoecious, dioecious, monoecious and
dioecious in same species, and female only species. In this study, two of female only species in
Taiwan, E. herbaceifoium and E. rivulare, were examined to provide primary investigation into the
potential evolution and mechanisms of apomixis. The phylogentic analysis shows that these two
species evolved independently in different lineages in Elatostema. Compared with sexual counterpart
(2n = 2x = 26), both species are polyploidy, triploid for E. herbaceifolium (2n = 3x = 39) and
tetraploid for E.rivulare (2n = 4x = 52). Based on flow cytometric seed screen and embryogenesis,
there is no any male contribution during the development of seed and endosperm. Therefore, these
species should belong to an infrequent case of apomictic species-obligate autonomous apomixis.
Keywords: apomixis, Elatostema, Taiwan, obligate apomixis, polyploidy, flow cytometry
P-012
An illustration of Phytocrene macrophylla in Bogor Botanic Garden
Wong, V.
Botanical Artist and Independent Researcher, Vancouver, Canada
e-mail: lowii@shaw.ca
Morphological characteristics of the tropical woody liana Phytocrene macrophylla have been studied
by many researchers. A series of bibliographic research on its taxonomic literature has been searched
and it seems that special characters need to be drawn for taxonomical studies. Based on the multiple
trips conducted for specimen study and photographic evaluation of the spongy stem of P. macrophylla,
a botanical illustration of the species can be drawn. Its appearance was caused by what Timmermans
termed “an anomalous secondary growth”. In addition, an exhaustive examination of the plant
components will help to arrive at a scientific evaluation by an accurate botanical illustration. The
outcome represents a feasible and realistic iconographic watercolour sample of the dioecious liana.
The usability of the work is targeted to the educational field as a referential resource for instructors,
scientific and botanical specialists. This botanical illustration will provide the scientific and botanical
data which will be useful as a realistic tool of instruction and educational resource for the audience.
Keywords: Phytocrene macrophylla, spongy stem, education resource, botanical illustration
P-013
Tuber morphological variations of Dioscorea spp. cultivars from
Pasuruan, East Java
Dioscorea spp., the edible tubers of family Dioscoreaceae, which have heterogeneous perennials with
many shared morphological, physiological and chemical contains. Dioscorea is also an important crop
serves as a staple food and medicine, but it is also become an income for many smallscale farmers in
the developing countries. Discoreaceae exploration collecting missions has been conducted in 4
Districts of Pasuruan, East Java. During the exploration it can be obtained 29 accessions of
Dioscorea spp. It comprises of 4 species and 21 cultivars i.e. 12 cultivars of Dioscorea alata L. (Uwi
Kelopo, Uwi Sego, Uwi Legi, Uwi Putih, Uwi Bangkulit, Uwi Jaran, Uwi Ungu, Uwi Ulo, Uwi Perti,
Uwi Beras, Uwi Jaran Ungu and Uwi Elos; 6 cultivars of Dioscorea hispida Dennst. (Gadung,
Gadung Jahe, Gadung Ketan, Gadung Kuning, Gadung Keripik and Gadung Lumut); 2 cultivars of
Dioscorea esculenta (Lour.) Burkill. (Gembili and Gembolo) and 1 cultivar of Dioscorea pentaphylla
L. (Uwi Soso’an). This paper presents the results of Dioscorea inventory by looking at the
morphological characterization of Dioscorea spp. tubers. The characters which observed based on
IPGRI Descriptors list for Yam (Dioscorea spp.) including its potential utilization by local farmers
and its organoleptics test results. The results showed that morphological characteristic features of
Dioscorea spp. tubers were broadly varied among species and even within cultivars at the same
species. Dioscorea spp. cultivars originated from Pasuruan were mostly differentted by its tuber shape,
tuber flesh colour and cooked tuber flesh texture. From the interviews to local farmers, it showed that
D. alata and D. hispida cultivars were still widely grown because of its high tuber yields and its taste
are the most acceptable than other Dioscorea species. They used as alternative food source for
scarcity time and used as personal consumption and low economically valued for local trade.
Keywords: morphological, variation, tuber, Dioscorea, Pasuruan
P-014
Systematic significance of the leaf venation in genus Ficus L. (Moraceae)
A study was undertaken on 15 Ficus species in Peninsular Malaysia. The objective of this study is to
determine taxonomic value of leaf venation that could be useful as additional data in classification and
species identification i.e; veinlet, ultimate marginal and areolar venation. Based on these characters,
the 15 Ficus species can be classified into eight groups. The presence of swollen veinlet on the leaf
lamina can also be used as additional tool for species differentiation. This study has shown that the
leaf venation has systematic value in the genus Ficus respectively especially in species identification
and differentiation purposes.
Keywords: Moraceae, Ficus, leaf venation, leaf anatomy
P-015
Trichomes morphology in flower petal of Acanthaceae species
Ahmad Juhari, M.A.A, Noraini, T.*, Nurul-Aini, C.A.C. & Ruzi, A.R.
School of Environmental and Natural Resource Sciences
Faculty of Science and Technology. Universiti Kebangsaan Malaysia
*e-mail: ntalip@yahoo.com
A preliminary taxonomic study was carried out on seven Acanthaceae species namely as
Andrographis paniculata, Pseuderanthemum graciliflorum, P. carruthersii, Asystacia gangetica ssp
micrantha, Ruellia repens, Justicia comata and J. betonica. The study was undertaken to investigate
the morphology of trichomes present on the surfaces of flower petal. Variations found in this study are
in their types and density. Based on observation two forms of trichomes are present in all species
study which is glandular and non-glandular trichomes. There are six types of trichomes found in this
study. Trichomes types is shown to have systematic significance that can be used to differentiate and
identify certain Acanthaceae species studied.
Keywords: trichomes; floral anatomy; Acanthaceae
P-016
Systematic study of Tacca leontopetaloides in Indoenesia
Tacca leontopetaloides is a monotypic genus belongs to the family Taccaceae. The species as a pan-
tropical species is widely distributed in Old and New World, from West Africa through S. E. Asia
including Malesia, N. Australia to Polynesia. It is included one of tuber plant which has important
value for food source, in which the tuber contain 90 % of carbohydrate. A series of integrated
research activities have been conducted by Biology Research Center – LIPI in order to create
alternative food especially for local community at littoral area. A part of the activities such as
exploration (in several locations in Java and Bangka-Belitung-Sumatra), morphology, anatomy, and
cytological studies have been carried out. Two variants, green and black, are recognized based on
morphological observations: petiole, leaves venation, as well as receptacle colors. It is also supported
by its leaf anatomy especially on the occurrence of palisade cells in black variants and none in the
green ones. The chromosome number of the two variants is similar and confirms with that reported
from Africa 2n=30.
Keywords: Tacca leontopetaloides, systematic, morphology, anatomy, cytology.
P-017
Notes on the morphological characteristics of Eurycoma spp. observed
and its status in Peninsular Malaysia
A study has been carried out on the genus Eurycoma Jack in Peninsular Malaysia that aims to
ascertain the diagnostic characteristics of the two species that occur in Peninsular Malaysia.
Collections had been made at 15 localities comprising of forest reserves and plantations throughout
Peninsular Malaysia covering the 5 regions (i.e. northern, western, eastern, southern & central). The
sampling is done in that manner to capture the morphological variations from different habitat.
Generally, both Eurycoma species were noted to be very similar. They could be clearly distinguished
using their fertile parts. E. longifolia Jack have long drooping inflorescences or infructescences while
in E. apiculata A.W. Benn, they are usually short, pointed upwards. It was also noted that there were
small differences on the leaflet of E. apiculata where the apex of the leaflet was often abruptly
pointed and the leaflet base was rounded with inconspicuous petiolule. On the other hand, E.
longifolia leaflet apex was usually subacute while the leaflet base was slightly asymmetrical with
short petiolule. Results from the leaflet cross-section showed the abundance occurrence of unicell
trichomes on both adaxial and abaxial surface. This characteristic is absent in E. longifolia. The
abundancy of Eurycoma spp. has decreased.
Keywords: Eurycoma, morphological characteristics, Peninsular Malaysia
P-018
Floral and leaf characters of some wild gingers
(zingiberaceae: Alpinioideae) in Mindanao, Philippines
Acma, F.M.*1, Gruezo, W.S.2, Dalisay, T.U.2, Buot, I.E.2 & Florece, L.M.2
1
Department of Biology, College of Arts and Sciences, Central Mindanao University, Philippines
2
University of the Philippines at Los Baños (UPLB), College, Laguna, Philippines
*e-mail: flmacma@yahoo.com.ph
This study focuses on morphology of six wild gingers (Zingiberaceae) in selected areas of Mindanao,
Philippines. All six species were previously classified as members of the genus Amomum, but are
currently recognized as members of four different genera, i.e. Amomum maximum Roxb., A.
muricarpum Elm., Etlingera dalican (Elm.) Poulsen, Etlingera philippinense (Ridl.) R.M. Smith,
Geocharis fusiformis (Ridl.) R.M. Smith, and Hornstedtia conoidea Ridl. The species thrive in forest
edges, inside forest areas having partial shade, steep to flat areas and along river banks and were
collected from Mt. Kitanglad, Bukidnon; Impalutao Forest Reserve, Bukidnon; Mt. Malambo,
Marilog District, Davao City; Mt. Hamiguitan, Davao Oriental; Bislig Experimental Forest, Surigao
del Sur and Bigaan Forest, Surigao del Sur.
Gross morphological studies, floral studies as well as leaf epidermal examinations were conducted.
The shape, texture and length of ligule, length of petiole, texture and size of floral bracts, and
characteristic of the labellum and calyx are diagnostic characters which can be used to separate the
different species. Anatomical observations on the leaf epidermis have shown that Amomum have
broad subsidiary cells and most of its stomata are located near the veins.
Keywords: Alpinioideae, Amomum, Hornstedtia, ligule, labellum, stomata, Mindanao.
P-019
Morphological diversity of Kemukus (Piper cubeba L.)
in java based on Herbarium Bogoriense specimen
Kusumarini, N.
Plant Biology, Biology Department, Faculty of Mathematics and Natural Science, Bogor Agricultural University
e-mail: niken.kusumarini23@gmail.com
Some cultivars of kemukus (Piper cubeba L.) ever known in West Java are true cubebs (‘Rinu
katuncur’ and ‘Rinu cengke’) and false cubebs (‘Rinu badak’, ‘Rinu carulang’, ‘Rinu pedes’ and
‘Rinu tembaga’). Taxonomic informations about these cultivars are not clear and not available. The
aim of this research is to describe the diversity of kemukus in Java as a preliminary research based on
the Herbarium Bogoriense (BO) speciments. Characterization was based on Radford (1986) and
Vogel (1987). Characters were observed and used to distinguish the variations are leaf shape, leaf
base shape, leaf tip shape, colour of upper-lower leaf surface, and type of vein leaf. There are six
variations found in Java (Group I-VI). Identification key is constructed in order to differentiate each
variation.
Keywords: Piper cubeba, morphology, Java
P-020
Leaf flushing as taxonomic evidence of some Diospyros Species
People tend to use generative structures for plant identification. Nevertheless, generative structure
availibility limits the identification practice for a plant with once-a-year fruit-bearing phase, such as
Diospyros L. (Ebenaceae). On the other hand, leaf flushing characters are rarely used for plant
identification. The unique leaf flushing characters of Diospyros have not been explored as a
taxonomic evidence yet. Leaf flushing and its taxonomic implication were observed from eight
species of Diospyros in Ecopark Cibinong Science Center LIPI. Routine observations and
morphological characterization were done for three twigs, which have three flushing sets and an
apical dormant bud, from each 22 individual trees of Diospyros. Morphological development
observation showed that bud rhythmic growth produce flushing sets that were usually distinguishable
from the previous sets. Leaf flushing time after a period of dormancy and small reduced leaf in some
species indicated an arrested growth in the bud. Leaf flushing can be found every few months or all
year around with a period of 40-55 days for the formation of mature leaves. Leaf flushing provided
39 characters as taxonomic evidence of Diospyros observed.
Keywords: Diospyros, leaf flushing, taxonomic evidence.
P-021
Pollen morphology of underutilised fruit species
In this study, pollen from 12 underutilised fruit species were obtained from collection at MARDI
Headquarters in Serdang and Universiti Putra Malaysia, Serdang, Selangor. The collection was done
on February 2012 in flowering season with the objectives to determine pollen morphological
characters of 12 species of underutilised fruit species and to determine the closely related fruit species
for the breeding programme. The species obtained were Lepisanthes fruticosa, Eugenia uniflora L.,
Phyllanthus emblica, Erioglossum rubiginosum, Pouteria campechiana, Tamarindus indica, Syzygium
cumini, Syzygium polyanthum, Spondias dulcis, Ardisia crenata, Ardisia elliptica, Carissa carandas.
Pollen from fresh flowers were collected and dried in 50-60ºC oven for about 2 days. The pollens
were acetolysed using method by Erdtman, 1970 and observed under the light microscope to measure
polar diameter, equatorial diameter, wall thickness and P/E.100 ratio to obtain pollen shape. A
dendogram was constructed by using all the characters. The study revealed that the similarity between
Syzygium cumini (Kerian), Syzygium polyanthum (Serai Kayu) and Ardisia crenata (Mata Pelanduk)
clustered in group V in the dendrogram was found to be the highest among the 12 underutilised fruit
species. These species can be considered as the best candidate for the crop improvement programme.
Keywords: dendrogram, breeding, closely related, flowering season, acetolysis.
P-022
Preliminary study of morphological variation of Kapulasan
(Nephelium ramboutan-ake)
2-3 ovaries, and 2-3 stigmas. The stigmas had a curved a form in common, but some plants were V
shaped. The fruit skin bulges varied between solitary and grouped.
Keywords: Nephelium ramboutan-ake, morphological variation, leaf, flower.
P-023
Seeking character stated of Cassava’s tuber
Study about determination of stated-character of cassava’s tuber has been conducted. We investigate
five genotype of cassava. We used morphological characterization and isozyme to analyze some
morphological of tuber characterization and want to know whether on cassava’s tuber has stated-
character or not. The dendrogram showed that through we couldn’t determine stated-character through
morphology’s tuber. Eventhough, we found that isozyme banding pattern showed their own banding
pattern of each cassava.
Keywords: cassava; dendrogram; tuber.
P-024
Orchid diversity and conservation assessment in Gunung Tahan Heath
Forest Reserve Pahang ( Peninsular Malaysia)
Heath forest (also known as Kerangas forest) is a type of tropical moist forest occurs on acidic sandy
soil often poor in nutrient. A study was conducted in Gunung Tahan, Pahang montane heath forest
reserve to look into how especially the orchid species morphologically modified themselves to survive
and thrive in the nutrient deprived heath forest. Thus, this study aims (i) to record orchid species
diversity in heath forest Gunung Tahan, Peninsular Malaysia as well as to recognize their endemic
species, (ii) to investigate orchid morphological modification that enables the species to thrive in
heath forest environment, (iii) to evaluate their conservation status and issues of natural habitat
conservation and natural change and (iv) to propose conservation strategies in order to sustain the
orchids population in heath forests in Peninsular Malaysia. Ridley (1912) recorded 68 species with 8
species endemic to Gunung Tahan. Though many botanical explorations have been conducted in the
area in recent years, none of the data has been published; therefore there is no new record of orchid
species from Gunung Tahan after almost 100 years from the earliest exploration. We believe there
would be big changes on the recorded number of species owing to the rapid global climate change that
affected the mountainous region significantly. This study would definitely give us further insight in
how to conserve orchid species threatened by the global change or alterations caused by human
activities or naturally.
Keywords: morphological modification; conservation, orchid; heath forest; Peninsular Malaysia.
P-025
Orchid diversity in Gunung Api Purba Nglanggeran,
Yogyakarta, Indonesia
Puspitasari, S.A.*1,2, Holle, M.J.M.1,2, Wijaya, I.M.S.1,2, Laksana, P.1,2, WE Muriyanto, W.E.1,2 &
Wardhana, H.2
1
Biology Orchid Study Club (BiOSC), Fakultas Biologi Universitas Gadjah Mada;
2
Faculty of Biology Universitas Gadjah Mada
*e-mail: biosc.biogama@gmail.com
Gunung Api Purba Nglanggeran, Yogyakarta is one of the National Geopark in Indonesia. This area is
an interesting site to be studied because of the richness of its flora. This area also have a high human
activities so it potential to threatened orchids. This research was conducted to inventory and identify
of orchids species on Gunung Api Purba Nglanggeran. This research was used explorative method at
the site with altitude 200 – 700 m above sea level. Through the intensive exploration 19 species of
orchids have been identified. 11 species are determined as terrestrial orchid, namely Zeuxine gracilis
(Breda) Blume., Zeuxine odorata Fukuy , Crepidium koordersii (J.J. Sm) Szlach, Malaxis sp. 1,
Malaxis sp. 2, Liparis sp., Peristylus goodyeroides (D.Don) Lindl., dan Nervilia plicata (Andrews)
Schltr., Geodorum densiflorum (Lam.) Schltr., Goodyera sp., Pecteilis sp. . Three species live as
epiphyte, namely Rhyncostylis retusa (L.) Blume, Polystachya sp. dan Eria retusa (Blume) Rchb.f. .
Five species as litophyte, namely Luisia zollingeri Rchb.f., Coelogyne trinervis Lindl., Pholidota
imbricata (Roxb) Lindl. Bulbophyllum sp. and Dendrobium crumenatum Swartz.. All these species
can find in the rain season, but in dry season only 8 orchids species.
Keywords: exploration, Gunung Api Purba Nglanggeran, orchid diversity.
P-026
Orchid diversity in the Mekongga Mountainous Area,
South – East Sulawesi, Indonesia
Mekongga is the highest mountain in South-east Sulawesi Province, which was formed from an atoll
raised several hundred million years ago. This phenomenon has created the possibility for specific and
perhaps endemic flora and fauna to occur in this area. Until now, the account of the flora of Sulawesi,
especially orchid species, is very limited. During field explorations done from 2009 – 2011 in the
Mekongga area, 33 orchid species were collected. Three species are endemic to Sulawesi: Notheria
diaphana, Dendrobium alderwereltianum and Bulbophyllum falculicorne. There are also some new
records found for Sulawesi of species originally only reported from New Guinea, such as Glomera
manicata, Phreatia calcarata, Cryptostylis carinata, and Epiblastus ornithidioides. Dendrochilum
curranii var. serratoi, was originally described from the Philippines, whereas Goodyera reticulate
was originally reported only from Java and North Borneo. Dendrobium acinaciforme is also new for
Sulawesi, although this species has been reported inform the Moluccas. More than 50% of the
recorded orchids remain unidentified, and are proposed to be new species in several genera such as
Eria, Dendrobium and Coelogyne.
Keywords: orchid, mekongga, endemic, new records, new species.
P-027
The diversity of lowland orchids of Papua
Tropical orchids constitute the greater part of orchids diversity that can be found in anywhere in the
world. More than 25,000 species were identified and 5000 species were found in Indonesia, from
lowland to highland. In Papua, exploration of orchids has not been completed due to a complicated
geographic mosaic. The study on diversity of orchids at lowland area of south and north Papua (not
including Papua Barat Province) showed that there were approximately 139 species of 45 genera. The
survey found Bulbophyllum 13 species, Dendrobium 52 species, Grammatophyllum 5 species,
Agrostophyllum 4 species, Coelogyne 4 species, Eria 4 species, Papiopedillum 3 species, Phaius 3
species, Phreatia 3 species, Plocoglottis 3 species, whereas other genera were only found less than 3
species each. Data of species from other areas remained unknown. Further exploration still needed in
regard to increase the number of orchid species and also possibility to find new species of orchids
from area of Papua region. Beside that, the establishment of new regencies all around Papua in recent
years gives adverse impact to the plant habitats including orchids species. It is an urgent task to study
and document these species in the wild before it is too late.
Keywords: diversity, orchids, lowland, Papua.
P-028
Distributions of Vandaceous Orchids in Peninsular Malaysia
Vandaceous orchids are represented by 83 genera and about 1200 species worldwide. Their
distributions are mainly fall in tropical Asia region. These groups of orchids are represented by 44
genera with 172 species in Peninsular Malaysia which included the following common known genus,
namely Acampe, Aerides, Arachnis, Ascocentrum, Papilionanthe, Phalaenopsis, Renanthera,
Rhynchostylis, Vanda and Vandopsis. Some of the Aerides, Renanthera and Vanda species are used in
generating hybrids with ornamental and fragrant properties. Vanda helvola is currently the only
Vanda species in Peninsular Malaysia. It has both ornamental and fragrant characteristics. However,
the status and distribution of vandaceous orchids are not updated due to the difficulties in discovering
these mostly epiphytic orchids in the wild. Due to their great potential in commercial field, we
reviewed the distribution of the vandaceous orchids in Peninsular Malaysia. This review may
contribute to the rediscovering of more vandaceous orchids for their ornanmental and fragrant
characteristics for commercial uses.
Keywords: distributions; vandaceous orchids; Peninsular Malaysia; Vanda; fragrant characteristics;
ornamental values.
P-029
Orchid inventory in Bantimurung-Bulusaraung National Park
Bantimurung Bulusaraung National Park (or abbreviated as Babul National Park), is located in South
Sulawesi, covers an area of 43.750 hectares. Geographically, this area lies between 119o34'17" -
119o55'13" East longitude and 4o42;49" - 5o06'42" South latitude. Located in the transition area of
Asia and Australia zone, the National Park has many unique flora and fauna.
Inventory of orchid species in Babul National Park has been conducted to study the orchid diversity in
that area. There were approximately 60 orchid species found which consist of 33 genera, including 44
species of epiphytic orchids and 16 species of terrestrial orchids. The findings show that Habenaria
medusa is very common terrestrial orchid whilst Aerides inflexa is very common epiphytic orchid in
this area. The latter species has known as an endemic orchid of Sulawesi. The diversity of orchids in
this area will aslo be presented and discussed.
Keywords: orchid, inventory, Babul National Park, South Sulawesi
P-030
Orchidaceae rescued from Bakun Hydroelectric Project (HEP) Dam,
Belaga, Sarawak, Borneo
Ling, C.Y.
Botanical Research Centre, SARAWAK FORESTRY Corporation, Malaysia
e-mail: cyling@sarawakforestry.com
The Bakun HEP is located on the Balui River about 37 km upstream of Belaga town, Sarawak. The
reservoir of the dam covers an area of approximately 695 km2, spanning over the Sg. Balui, Sg.
Murum, Sg. Bahau and Sg. Linau. Most of the areas were covered by forests on mountainous terrain
and steep slopes, while the reminder has lower slopes affected by shifting cultivation or covered by
secondary forests. A Wildlife Rescue and Monitoring Plan (WiMOR) was carried out in order to save
as many flora and fauna affected by the impoundment. Areas affected by the impoundment were all
forests below 228 m a.s.l., where most of the rescue works were done from 2009 till 2011. More than
400 specimens of Orchidaceae were rescued, comprising likely more than 200 species from about 48
genera. The most abundant genus is Bulbophyllum with 81 specimens rescued, consisting of at least
40 species. To date, only 88 species have been identified. Of these, 12 species are endemic to Borneo
and one species [Dendrochilum rufum (Rolfe) J.J.Sm.)] has only been recorded from Sarawak before.
Some of the species rescued were rare and some have yet to be identified even with flowering
materials. The rescued orchids were then planted back at Bakun sites as well as for ex-situ
conservation at Semenggoh. These records are valuable as the original localities and habitats were
flooded forever, and probably some of the species are new to science.
Keywords: Bakun HEP, Orchidaceae, Bulbophyllum
P-031
P-032
Optimization of seed germination of an Indonesian threatened orchid
Dendrobium laxiflorum J. J. Sm.:
A perspective of in vitro orchid conservation
Dendrobium laxiflorum is nationally listed as one of Indonesian threatened orchid species and is in the
priority of conservation. One of conservation programs of this species is propagation through in vitro
seed culture to generate a large number of seedlings with the first key step is seed germination. This
paper highlighted optimization of seed germination of this orchid on media KC in three experiments
(i) various inorganic nitrogen source and concentration (nitrogen sources: ammonium, nitrate, and
ammonium nitrate; nitrogen concentrations: 0 mg/l; 63,75 mg/l; 127,50 mg/l; 255,00 mg/l; 382,50
mg/l; and 510,00 mg/l) (ii) vitamins and their concentration (vitamins: niacin, pyridoxine, and
thiamine; vitamin concentrations: 0; 0,1 mg/l; 0,3 mg/l; and 0, 5 mg/l) (iii) and plant growth
regulators 2,4-D (0 mg/l ; 0,1 mg/l ; 0,3 mg/l and 0,5 mg/l) and BA (0 mg/l ; 0,5 mg/l ; 1 mg/l ; 1,5
mg/l and 2 mg/l). The results of the experiments showed that ammonium nitrate with total nitrogen
concentration 63,75 mg/l induced the highest percentage of seed germination. Thiamine was the best
vitamin for seed germination of D. laxiflorum, and the highest percentage of seed germination was on
thiamine with a concentration of 0,1 mg/l. 0,1 mg/l 2,4-D and 2 mg/l BA was also found significantly
increased the percentage of seed germination. The results of these experiments were compiled to
assess nutritional and cultural requirements for the efficient seed germination in in vitro propagation
of this orchid that is vital in the conservation of this threatened orchid.
Keywords: Dendrobium laxiflorum; threatened orchid, seed germination, optimization.
P-033
Applying extreme learning machine to orchid species identification
In recent years, information technologies have been introduced into biological sciences. Some have
focused on plant taxonomy to help the deficiency of people’s classification ability. In this paper, we
proposed the new method for orchid species identification using image processing and pattern
recognition. We use orchid flower image as input for the system, extract on the shape and color
feature, and identify species by applying the one of soft computing method called Extreme Learning
Machine (ELM). The comparative study on system performance is conducted between ELM and the
method from the previous research-Probabilistic Neural Network (PNN). Results show that ELM
method can recognize orchid species with accuracy 85.47%. The identification accuracy of ELM
method is higher than PNN method.
Keywords: orchid species identification, extreme learning machine, image processing, shape and
color feature.
P-034
Potential fragrance production and release sites of Vanda mimi Palmer
Ong Abdullah, J.*1, Toh, C.2, Mohd Ain, N.1, Go, R.3, Namasivayam, P.2, Psyquay Abdullah, N.A.4,
& Ong Abdullah, M.5
1
Department of Microbiology, Faculty of Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia
2
Department of Cell and Molecular Biology, Faculty of Biotechnology and Biomolecular Sciences, Universiti
Putra Malaysia; 3Department of Biology, Faculty of Science, Universiti Putra Malaysia
4
Department of Crops Science, Faculty of Agriculture, Universiti Putra Malaysia
5
Malaysian Palm Oil Board, Malaysia.
*e-mail: janna@upm.edu.my
Vanda Mimi Palmer (VMP) is commercially viable for its strong but sweet fragrance. However, little
is known regarding the fragrance production and emission sites on the flowers. The anatomy of VMP
flower was studied using scanning electron microscopy (SEM) and light microscopy, and the
fragrance production glands and release sites were identified by histochemical assays and stainings.
Examination of dissected floral parts using the human nose detected fragrance emission only from the
petals and sepals. Fresh sepal and petal tissues were found to contain dense distribution of stomata
and trichomes, concentrated mostly around the outer margins. The epidermal and sub-epidermal
layers of these tissues contain rich deposits of starch that can be correlated as the fragrance production
site. Neutral red (NR) staining revealed the edges of the petals and sepals stained stronger than the
rest of the tissues indicating more intense fragrance is being perceived. Knowledge of the fragrance
production and secretion sites complemented our earlier molecular and biochemical work on VMP
scent and this may have economic value for tapping the sites in bulk production of essential oils.
Availability of the morphological information can be of taxonomical value for the identification of
Vanda species.
Keywords: Orchid, morphology, trichome, stomata.
P-035
Flowering phenology of Pinang Gajah (Nenga gajah J. Dransf.)
at Bogor Botanic Gardens
Pinang gajah (Nenga gajah J. Dransf.) is a species of palm, grown in the collections at the Bogor
Botanic Gardens, and categorized as vulnerable according to IUCN criteria (2012). This is due to the
destruction of the natural habitat of this species, caused by high rate of deforestation. Nenga gajah
grows naturally in Sumatra only, with a very limited distribution area in West Sumatra, Bengkulu,
Jambi and Riau, in areas adjacent to the stream of water in forest and forest edges, up to 800 m above
sea level. This flowering phenology study aims to determine flowering timings for the species, and the
factors that influence the development of flowering, pollination and fruiting formation. Material
observed comprises 7 collections from the Bogor Botanic Gardens and 1 collection from the Gardens’
nursery, of varying ages. Nenga gajah flowering proceeds as follows: (1) initiation to bud
inflorescences phase (flowers still covered by bract inside to bract opening) 8–9 months, (2) anthesis
phase (flowers arranged in 2-4 rachillae to male flowers falling) 20 – 25 days, and (3) young fruit
phase (female flowers anthesis until young fruit produced), 15 – 20 days. Trigona sp. is the only
insect visitor and might be a pollinator during flower anthesis. The insect visits the flowers between
the following hours: 07.00 – 09.00 and 15.00 – 15.00. In this study, development of flowering,
pollination and fruit production were not directly affected by a number of environmental factors.
Keywords: Nenga gajah, flowering phenology, collection, Bogor Botanic Gardens
P-036
Preliminary study on artificial pollination of Bidang
(Borassodendron borneense J. Dransf.) at Bogor Botanic Gardens
Bidang (Borassodendron borneense J. Dransf.) is an endemic and dioecious palm species found in
Borneo, and growing Bogor Botanic Gardens. This species grows naturally in lowland Dipterocarp
forest. Preliminary studies on artificial pollination aims to obtain fruit, because male and female
individuals are not located on adjacent sites. The collection was observed is one female individual of
11 years old located in II.F. 140. and two male individuals of 23 years located in XII.E.190 and 33
years located in II.F. 108. The pollen used for pollination were fresh pollen and stored pollen. On
using fresh materials, pollen were attached to receptive female flowers, whereas when using
previously stored pollen, pollen was spread directly onto the stigma of female flowers. The
inflorescences phase on female and male as follows: (1) initiation phase, (2) bud phase, (3) receptive
phase, and (4) fruit phase (only for female flowers). In female inflorescence, duration of initiation
phase about 2 months, bud phase 10 – 15 days, 7 days of receptive phase and phase of young fruit 10
days. In male inflorescences, 2 months for initiation phase, bud phase 10 – 15 days, and 4 – 5 days for
receptive phase. Female flowers that were successfully pollinated showed progress after 10 days. The
use of fresh pollen for artificial pollination gave better results than using stored pollen.
Keywords : Borassodendron borneense, collection, Bogor Botanic Gardens, Artificial pollination.
P-037
The phylogeny and biogeography of the rattan Calamus javensis Blume
complex (Arecaceae, Calamoideae)
Atria, M.1, Thomas, D.C.1, Baker, W.J.2, Dransfield, J.2, & van Welzen, P.C.1
1
Naturalis Biodiversity Center, The Netherlands
2
Herbarium, Royal Botanic Gardens, Kew, United Kingdom
Calamus javensis Blume is known as a polymorphic taxon. It is widely distributed in South-East Asia
from Southern Thailand to Sumatra, Java, Borneo and the Philippines. The leaves, spines and
inflorescences show considerable variation within the distribution area. In an attempt to disentangle
the species complex, several new species and varieties have been described, but all lack
comprehensive information. A variety of apparently distinct taxa that are clearly related to C. javensis
are presented, some of which occur sympatrically with typical C. javensis. Several have been
described as separate species. Inadequate understanding of both the limits between closely related
taxa and relationships among them have attributed to a growing problem in the field of taxonomy that
P-038
The unique characters of coconut (Cocos nucifera L, Arecaceae)
in Bali, Indonesia.
Kriswiyanti, E.
Department of Biology, Mathematic and Basic Science Faculty, Udayana University, Indonesia
e-mail: eniek_kriswiyanti@yahoo.co.id
Coconut is one of important plant In Balim, beside of its economic value, it also used for religious
related and medicinal purposes. Morphologically, some coconut plants differ in some characters,
which is very unique and specific to its individual plant. Based on the unique characters, there were
more than twenty unique coconuts identified that differ individually. Some of them are the ancak
which has branched stems, the be julit has plicated lamina leaves, the bingin has the root growth from
nodes stem, the Bojog has fruit husk colored like the hair of long tailed monkey. Differences in fruit
color such as white, green, yellow and red were used to distinguish between the bulan, gadang,
gading and surya coconuts respectively. Inflorenscentia spicata was characteristic of bluluk, while the
udang and mulung were characterized by red mesocarpium. The Rangda coconut has petiole and the
apex of the stem were twisted, the menjangan coconut has branched spikelet as in deer horn, the
sangket has hoked primordial tip leaves. The coconut fruit with predominance husk and little seed is
the kebo. The sudamala was characterized by many kinds of unique characters, which some of them
are double spatha, and flat apex of male spikelet.
Keywords: specific morphology, tranditional medicine, unique coconut.
P-039
Amorphophallus titanum (Becc.) Becc. ex Arcang.:
seed germination with mini flower phenomenon
Amorphophallus titanum (Becc.) Becc. ex Arcang. is famous as the gigantic inflorescense. It is also a
prospective plant with 20% glucomanan contents (Ananto, 2000). Various cultivation techniques have
been conducted such as how to germinate the seeds. Previous studies by Roemantyo (1991) and
Latifah et al. (2001) have not produced a faster and better germination rate. Therefore this research
was aimed to test the following hypotheses: (1) Fruit epidermis and the pericarp inhibited the
germination, (2) testa/seed coat inhibited germination, (3) GA3 hormone promoted the germination
rate. The germination pattern was also monitored. The experiments consisted of: (1) Experiment 1:
sowing the fruit with the seeds inside and (2) Experiment 2 with two treatments: testa peeling and
GA3 hormone treatments.
The results of Experiment 1 showed that the fruit epidermis and the pericarp inhibited the germination
for 124 days on the final day of the experiment. Experiment 2 resulted in: (1) the delay of the
germination for 7-35 days caused by the testa/seed coat, (2) GA3 hormone promoted the germination
rate 2,19 coefficient of germination rate. In this experiment, there was a phenomenon of the initiation
of four mini inflorescense at seedling stage that may be stimulated by the application of 1000 ppm
GA3 hormone; however further research was required. We also recorded developmental stages from
the seed germination, first-leaf emergence and tuber development in series of photographs overtime
during the experimental period referred to Kikuta et al. (1938) in another species of Aroid.
Keywords: germination, Amorphophallus titanum, GA3 hormone, mini inflorescense.
P-040
Variations of Durio in Central Bangka Regency,
Bangka Belitung Province Based on Morphological Characters
Many species of Durio (Bombacaceae) produce edible fruits. A few species have been already
cultivated in agricultural lands and back-yard gardens in Bangka Belitung Province, especially in the
Central Bangka Regency, which is well known as the Durian centre. This study aimed to explore and
observe the morphological characters of Durio cultivated by local people in Desa (Village) Namang,
Desa Air Mesu, and Desa Teru. The result showed that two species of Durio, were found in the above
villages, i.e. Durio zibethinus and D. kutejensis, sixteen landraces of D. zibethinus were also planted
in those villages. They could be identified by the crown shape, leaf shape, and fruit shape. The tree
crown varies in shape from pyramidal, oblong, to semi circular. The leaf shape varies from oblong,
ovate to lanceolate. The fruit may be oblong, globose or globose with 5-lobes in shape. .
Keywords: Durio, Central Bangka Regency, morphological character, cultivated.
P-041
Comparative leaf anatomy of Pandanus, Freycinetia and Sararanga
(Pandanaceae) and their diagnostic value
Study in leaf anatomy of 33 sample of the species classified under genus Pandanus, Freycinetia and
Sararanga of Pandanaceae had been undertaken to unravel generic relationship among of these taxa
with a view to provide a set of diagnostic characters for taxonomic identification. Four anatomical
diagnostic characters had been identified at the generic level such as present and absent of papillae,
stomatal arrangement type, present and absent of bundle sheath extension and hypodermal thickness
and shape. Pandanus had papillae present, stomata amphistomatous, bundle sheath extension present
and thin and rectangular hypodermis; Freycinetia lacked of papillae, stomata hypostomatous or
amphistomatous, bundle sheath extension absent and hypodermis thick and hexagonal or rounded;
meanwhile Sararanga poses papillae absent, stomata amphistomatous, bundle sheath extension absent
and hypodermis thin and flatten. An identification key to the genera based on anatomical diagnostic
characters is provided.
Keywords: leaf anatomy, Pandanus, Freycinetia, Sararanga, Pandanaceae.
P-042
Petiole anatomy of some species in Schefflera Spreng. (Araliaceae)
A study was undertaken on petiole anatomy of five Schefflera Spreng species, namely as S.
obovatilimba, S. opacus, S. lineamentorum, S. lanata and S. Kinabaluensis. The genus Schefflera is
belonging to the family Araliaceae. The objective of this study is to determine variations in the petiole
anatomical characteristics that can be used to construct a dichotomy identification key of species in
the genus Schefflera. Leaves samples were collected from various forest reserves in Peninsular
Malaysia, then were fixed in AA (Acetic acid: Alcohol, in a ratio of 1:3), the petiole part then were
sectioned using sliding microtome and were stained using safranin and alcian blue, mounted using
Canada balsam and observed under light microscope. Findings in this study have shown that all
species studied are having similar anatomical characteristics in the shape of petiole outline, in the
presence of mucilaginous canal and in the petiole vascular bundles structure (distally form two
concentric circles with the inner consists of vascular bundles with an inverse orientation). The
variations are observed in the arrangement and number of vascular bundles. The occurrence of starch
grains, crystals and schlerenchyma cells are some diagnostic anatomical characteristic that can be
used in direct species identification. As a conclusion, the variations in the petiole anatomical
characteristics is outstanding and can contribute in direct authentification of species and definitely has
taxonomic value in the genus Schefflera respectively.
Keywords: Araliaceae, Schefflera, petiole anatomy, vascular bundle.
P-043
Leaf architecture of the Daphniphyllum (Daphniphyllaceae)
P-044
Flowering and fruiting times of four species Annona (Annonaceae)
in Purwodadi Botanic Gardens
Annona is a genus belongs to Annonaceae family, consisting of numerous species that produce edible
fruit. Four species namely A.glabra, A. montana, A. muricata and A. squamosa collections of
Purwodadi Botanic Garden were recorded on its flowering and fruiting times, since November 2010
to April 2013. The data were scored and complemented with climate data (temperature, rainfall
intensity, humidity) then analyzed using multiple linear regression analysis. The result showed that,
humidity was the most climate factors that affected on the flowering and fruiting times of those
species. Specifically, rainfall intensity (0-550 mm) affected to Annona muricata, temperature (25,56-
28,33 °C) and humidity (66,83-85,02%) to Annona squamosa, and humidity to A. glabra (71,62-
85,02% ) and A. montana (71,62 to 82,94 %) as well. Flowering time of Annona muricata occur
throughout the year and fruiting twice a year in wet month, while in A. montana and A. squamosa
recorded once a year during the wet month. Annona glabra is in flowers and in fruits in wet and dry
month, however, it flower three times a year and in fruit only twice a year.
Keywords: flowering and fruiting times, climatic factor, Annona, Purwodadi Botanic Garden.
P-045
Bud development and flowering phenology of Rafflesia kerrii in Lojing
Highlands, Kelantan, Peninsular Malaysia.
Qayyum Nadia, W.A.1, Siti-Munirah, M.Y.1,2, Zulhazman, H.1, & Razak, W.1
1
Faculty of Agro Industry and Natural Resources, University Malaysia Kelantan, Malaysia
2
Forest Research Institute Malaysia (FRIM), Malaysia
e-mail: eeya_nadia@yahoo.com
Rafflesia holds the record of the biggest flowers in the world and generates income for Malaysian
eco-tourism industry. Extensive knowledge on the ecology of Rafflesia is required to develop
strategies for conserving the interesting plant and providing information for tourist. Unfortunately,
the lack of information about this plant is one of the main obstacles in its study. Fieldwork on
Rafflesia is also difficult and takes a long time. Therefore, a study on bud development and
flowering phenology of Rafflesia were carried out in Lojing Highlands, Gua Musang, Kelantan. A
total of 17 populations were marked and monitored for a period of about 19 months (May 2011-
November 2012). One taxa of Rafflesia was recognized namely; Rafflesia kerrii. A total of 519
Rafflesia buds from 17 populations were observed. A total of 49.5% (257 buds) died before
reached anthesis point. The highest mortality rates occurred in February when 39.4% (43 buds)
died compared with April where is only 9.9% (10 buds) died. The mortality rates were highest at
Population 12 where is about 100% of buds were found damaged. An average of 18 buds of
Rafflesia died in each population. About 239 flowers bloomed from May 2011 until November
2012. An average diameter size of the flower was range between 50 cm and 90 cm in length. The
buds with diameter between 8.0 cm and 9.0 cm took approximately 260 days to bloom. The most
active host that was produced blooming flower, has stems between 10 cm and 15 cm diameter,
consists of 50% out of all blooming flowers. The status of Rafflesia population in Lojing
Highlands is more threatened and considered endangered because it is a species occur mainly just
outside of protected areas. Conservation program should be introduced to protect the population
of Rafflesia in this area.
Keywords: anthesis, bud development, mortality, Lojing Highlands, Rafflesia kerrii.
P-046
Phenology pattern of four Purwodadi Botanic Garden figs species
(Ficus benjamina, F. hispida, F. racemosa and F. virens)
collection during three years period
Ficus, as one of Moraceae family which has high interval of adaptive life range. Some of the species
from the genus of Ficus have known for their big role as conservation plant. This research was held to
know the phenology pattern of four species of Ficus (F. benjamina, F. hispida, F. racemosa dan F.
virens) as their respon of the macro climate in Purwodadi Botanic i.e; temperature, rainfall and
humidity. Phenology activities observations on four Ficus species were carried out once a week for
three years (2010-2012) by scoring (0-4) method on the abundance of leaves and fruits. Data were
analyzed statistically and descriptively. Analysis result showed that phonological activities of four
Ficus were closely related to rainfall. Falling leaves activity of F.benjamina, F. virens and F.
racemosa increased by the decreasing of rainfall. However, those three trees did not experience in
total fall leaves, while F. hispida did not show the same respon. The formation of young fruits on
three trees (F. hispida, F. virens and F. racemosa) also related with the rainfall, whereas F. racemosa
produce fruits throughout the year. On the other hand, the formation of young fruits on F. benjamina
was related with the fluctuation of relative humidity.
Keywords: phenology activity, Ficus, climate factors, Purwodadi Botanic Garden
P-047
Do pollen morphology, diameter, viability and germination capacity of
some wild bananas differ to cultivated bananas?
Rachman, E.
Research Center for Biology-LIPI, Indonesia
The study was conducted using twenty banana varieties grown at the experimental garden of Botany
Division of The Research Center for Biology LIPI to know if pollen morphology, diameter, viability
and germination capacity of some wild bananas differ to cultivated bananas. Pollen of those banana
varieties were freshly collected and prepared by an acetolysis preparation procedure to observe its
morphology and diameter. The image of acetolyzed pollen preparation was captured by Nikon Eclipse
80i accommodated with monitor and the diameter of pollen was digitally measured by ‘Motic Image
Plus 2.05’ computer program. Pollen viability was checked freshly by an acetocarmine test while its
pollen germination capacity was by Sarfatti pollen germination solution. The result showed that
though morphological aspects of pollen of those banana varieties were almost the same, pollen
diameter of wild banana varieties tend to be lesser than cultivated bananas one. No specific
relationship between the pollen diameter and pollen viability as well as pollen germination capacity.
Pollen of wild varieties generally tended to be more viable and more able to germinate than cultivated
varieties. Possible scientific implication of present study that should be traced in the genomic aspects
of those banana varieties is also described.
Keywords: wild banana, cultivated banana, pollen, pollen diameter, viability, germination capacity.
P-048
Diversity and characteristic of pisang raja cultivars
(Musa x paradisiaca L.) collection of Purwodadi Botanic Garden
Being part of the center of bananas diversity, Southeast Asia region including Indonesia posseses
great wealth of banana diversity. Pisang Raja is a well-known clone in Indonesia, Malaysia and the
Phillippines. It characterized by its large fruit with thick coarse skin, orange; flesh creamy-orange,
coarse texture and sweet tastes. It is big and vigorous clone resistant to Panama disease and Leaf spot
but its fruits though sweet are not very attractive. Morphological observations have been conducted at
Musa germplasm collections of Purwodadi Botanic Garden subjected to 17 different types of Pisang
Raja cultivars originated from Yogyakarta, Central Java and East Java i.e. Raja Lumut, Raja Talun,
Raja Ketan, Raja Siem, Raja Buntet, Raja Warangan, Raja Marto, Raja Bandung, Raja Mantri, Raja
Pulut, Raja Nangka, Raja Dengkul, Raja Gintung, Raja Prentel, Raja Lingi, Raja Kenanga and Raja
Wesi. Pisang Raja, is such a hybrid and should correctly be written as Musa x paradisiaca L. since it is
a triploid hybrid with 3 sets of genomes contributed by M. acuminata (A genome) and M. balbisiana
(B genome), with possible genome configurations AAB and/or ABB. Taxonomic scoring results show
that mostly Pisang Raja cultivars were grouped into AAB genome and five cultivars were grouped
into ABB genome i.e. Raja Siem, Raja Bandung, Raja Mantri, Raja Prentel and Raja Wesi. An
exception for Pisang Raja Kenanga was grouped into AAA genome. Their morphological
characteristics were varies, mostly they have intermediate characters from their ancestral parents. This
work is a part of a longer-term systematic evaluation of all Musa collection of Purwodadi Botanic
Garden. It may provide a base for judging the rich local genetic variety of Indonesian bananas.
Keywords: Banana, characteristic, cultivar, diversity, Musa x paradisiaca, Pisang Raja, Purwodadi
Botanic Garden.
P-049
An account of Sulawesi wild banana
Many expeditions have been conducted to enumerate flora diversity in Sulawesi but few of them
addressed the wild bananas. Only three Musa species (Musa acuminata Colla, M. celebica Warb. ex K.
Schum. and M. textilis Née) have been reported from this island by Nasution. By examining 110
sheets specimens deposited in BO and several field works conducted in Sulawesi, six Musa species
have been recognized. One species collected from Donggala, Central Sulawesi is considered as a new
species. Two species (M. balbisiana Colla and M. itinerans Cheesman) are newly recorded and two
species (M. acuminata var. tomentosa (K. Sch.) Nasution and M. celebica Warb. ex K. Schum.) are
already known as endemic to Sulawesi. Circumscriptions for each species is delineated and
identification key is formulated.
Keywords: Musa, new records, new species, Sulawesi, wild banana.
P-050
Diversity of Indigofera in Java and Madura
The objective of this research was to know diversity Indigofera spp. in Java and Madura based on
morphological characters. A total of 56 samples Indigofera plants used in this study were collected
from Java and Madura which cover 5 province: Gunung Kidul, Bantul, Kulonprogo (Yogyakarta);
Kebumen, Purworejo, Temanggung (Central Java), Pacitan, Tuban, Bangkalan, Pamekasan, Sampang
(East Java); Cirebon, Pelabuhan Ratu, and Bogor (West Java); Serang, Cisimut, Sajira (Banten). The
sample collection was conducted on July 2012 to September 2013. Identification of morphological
characters was done by direct observation of all parts of the Indigofera plant (leaves, stems, flowers,
fruits, seeds, trichome, etc.). Eigh species of Indigofera has been identified as I. tinctoria, I.
suffruticosa, I. arrecta, I. hirsuta, I. zollingeriana, I. trifoliata, I. linifolia, and I. galegoides.
Morphological characters that distinguish 8 species of Indigofera of 111 characters include: habit,
leaves or leaflets, stipule shape, peduncle length of inflorescences, inflorescence type, bracts, flower
size, dried foliage, calyx lobe length, calyx indumentum, calyx vexillary lobes, standard, wing petals,
keel, anther, ends of staminal filaments, style, stigma, pod position with pedicel, remnant in base pod,
pod valves, pod surface, pod shape, seed number, seed colour, seed size and trichome shape in all
parts.
Keywords: diversity, Indigofera, Java and Madura.
P-051
Diversity of ramin (Gonystylus spp.) non bancanus
in East Kalimantan, Indonesia
Study of Gonystylus spp. diversity in East Kalimantan was conducted from June until December 2009 at five
locations, i.e: PT. Inhutani II Concession Forest, Malinau in June 2009, Sungai Wain Protected Forest, Bukit
Bangkirai and Wanariset-Samboja-Balikpapan in August 2009, PT. ITCI Forest Concession and Gunung
Lumut Protected Forest-Paser District in December 2009. There are six Gonystylus species were found from this
study, namely; Gonystylus affinis, Gonystylus brunnescens, Gonystylus consanguineus, Gonystylus forbesii,
Gonystylus keithii and Gonystylus velutinus. The species grown in primary forest with flat to hilly topography
with altitude ranges from 20 to 500 m above sea level, on sand clay soil with pH between 5.1-6.8, soil moisture
between 20%-75%. Gonystylus brunnescens was found abundant with the good natural regeneration, especially
in Sungai Wain Protected Forest, Bukit Bangkirai and PT.ITCI Forest Concession, the other five species were
found in small population, from 1 to 5 individuals in all locations visited.
Keywords: diversity, Gonystylus spp, East Kalimantan.
P-052
Myrtaceae: The diversity in Mekongga, South-East Sulawesi, Indonesia
Myrtaceae (Jambu-jambuan) included a member of plant that known as a produces of essential oils,
wood and fruits. In Indonesia there are about 30 genera and approximately 450 species.
In 2010-2012, inventory and exploration have been comes out in Mekongga. Mekongga is a mountain
located on the island of Sulawesi, Indonesia Islands. This mountainous region stretches along the
western province of Southeast Sulawesi and territory covers three districts namely North Kolaka,
Kendari and Kolaka District. The highest peak reaches 2620 m asl.
From the results of the inventory and exploration in the mountainous region Mekongga have been
collected by 7 genera, 25 species, including one species thought to be new species (Syzygium nsp.),
tree species as new record (Tristaniopsis microcarpa ssp. corymbosa; Eugenia sibuyanensis, E.
burubidensis).
Keywords: Myrtaceae, species, Mekongga, South-East Sulawesi.
P-053
Hoya and Dischidia (Apocynaceae–Asclepiadoideae)
of Papua New Guinea
The majority of Hoya and Dischidia species described from Papua New Guinea (PNG) are based on
collections obtained during several general botanical explorations from the end of 19 th century until
the First World War. Key contributions in the knowledge of Asclepiadoideae in PNG were by
German botanist Rudolph Schlechter.
Significant collections of PNG’s Asclepiadoideae were not made again until the 1990's, when Paul
Forster and David Liddle discovered some new species and brought others into cultivation. With their
contribution the number of Hoya species in PNG reached 75, a number comparable to that of areas
much more thoroughly investigated such as the Philippines.
Available herbarium collections are geographically concentrated around major towns in Morobe and
Madang Provinces. New collections from unexplored areas are thus likely to reveal novel taxa.
Due to the rapid loss of primary habitat in PNG by logging activities and by the needs of an
expanding population, a decision was made to conduct extensive fieldwork throughout PNG for
several years, aimed at collecting herbarium specimens and living plants of Hoya and Dischidia for
cultivation in ex situ collections.
By the end of the second year, 36 field trips gained at least 54 Hoya and eight Dischidia, of which 14
are being described as new. Ten of the collected identified species were earlier known only from the
type specimen, and about 50% of the overall collected taxa were never photographed before.
Keywords: endemism, new species, field exploration.
P-054
Diversity of Pandanus and Sararanga in Cyclop Nature Reserve and
its surrounding area
Zebua, L.I.
Department of Biology, Faculty of Math and Sciences, Cenderawasih University, Indonesia
e-mail: lis_pandanus@yahoo.com
An exploration and inventory of Pandanus and Sararanga have been carried out around Base-G
beach, Hamadi beach, and Cyclops Nature Reserve. The results recorded 1 species of Sararanga
(Sararanga sinuosa Hemsley) and 16 species of Pandanus (P. leptocaulis Merr. & Perry, P. odoardi
Martelli, P. leiophyllus Martelli, P. congregatus St. John, P.tectorius Parkinson, P. daymanensis St.
John, P. dolichopodus Merr. & Perry, P. conoideus Lam., P. polycepalus Lam., P. dubius Spreng, P.
galore Stone, P. iwen Stone, P. brosimus Merr & Perry and the other three still unidentified
Pandanus sp. 1, Pandanus sp. 2, Pandanus sp. 3). Identification key, description and its distribution
will be presented in the paper.
Keywords : Base-G beach, Cyclop Nature Reserve, Diversity, Hamadi beach, Pandanus, Sararanga.
P-055
Acanthaceae of Gunung Baung, East Java
A study on ground cover vegetation at the Gunung Baung Natural Recreational Park in Pasuruan, East
Java was conducted with the aim to investigate the species richness, abundance and morphological
variations of species of Acanthaceae. Five study sites were established in the area. A combination of
transect and quadrat methods was used, where 50 quadrats of 2 x 2 m each was systematically
distributed along 5 parallel transects in each of the five study sites. Four species of Acanthaceae were
recorded, i.e. Hypoestes polythyrsa, Sericocalyx crispus, Thunbergia alata and Thunbergia erecta.
Most of the species were found in the study site on the southeastern part of the Gunung Baung NRP.
They were considered insignificant components of the ground cover vegetation since their importance
values were small (IV < 10 %). The ground cover vegetation was instead dominated by other species,
such as Tithonia diversifolia (IV=45.26 %) and Mikania macrantha (IV=21.86 %).
Keywords: Acanthaceae, ground cover vegetation, Gunung Baung, East Java.
P-056
The diversity of Syzygium species at Gunung Baung
Syzygium is a genus in Myrtaceae that contains a large number of species. They are very diverse and
have a wide distribution. The Gunung Baung Natural Recreational Park (GBNRP) in Pasuruan, East
Java, is one of so many places where a relatively abundant species of Syzygium may be encountered.
A study of diversity, distribution and morphology of Syzygium species was undertaken in the GBNRP.
The inventory using the method of exploration and species characterization revealed the occurrence
of six species in the area, i.e. S. cumini, S. littorale, S. pycnanthum, S. polyanthum, S. racemosum, and
S. samarangense. The most abundant and frequent species encountered in the area was S. pycnanthum.
Cluster analysis resulted in three grouping of species, reflecting the differences in morphology and
field characters. Only S. polyanthum and S. samarangense that have been well known and cultivated
by local people living in the vicinity of Mt. Baung. The other four species are considered wild whose
potential uses are yet to be uncovered.
Keywords: Syzygium, diversity, Gunung Baung, East Java.
P-057
Diversity of Durio kutejensis in Indonesia
The tropical fruit plants native from Indonesia which are starting rapidly to cultivation is Durio
kutejensis or Lai. This species has superior characters than D. zibethinus that had already been widely
cultivated in Indonesia, Malaysia, and Thailand. They are tree less than 8 m, fruiting 5-7 years old,
blunt spines, aril strikingly colored, ripe fruit not odour, and storage time 7-8 after harvest. This study
aimed to observe the morphology and trichome shape variations of D. kutejensis which collected from
cultivation centers, such as: East Kalimantan Province (3 locations), North Kalimantan Province (5
locations), South Kalimantan Province (2 locations), Bangka Belitung Islands Province (1 location),
West Java Province (4 locations), and Banten Province (1 location). Based on 145 collection numbers,
they were identified into 24 landraces. The landraces can be distinguished based on canopy shape
(pyramidal, oblong, semi-circular, umbrella), branching forms (erect and spreading), leaf shape
(oblong, oboblong, lanceolate), flower color (dark red, pink), fruit shape (globose, globose with 5-
lobed, ovate, ovate with 5-lobed, oblong, oblong with 5-lobed), spine shape (pyramidal, caudate),
flesh texture (soft, fibrous), flesh color (dark yellow, orange), fruit flesh thickness (0.5-1.5 cm), and
the taste of sweet fruit like papaya flesh. The trichome shape covers the twig (complex peltate scale),
leaf (complex peltate scale, cushion stellate hairs, flate stellate hairs, four-armed stellate trichomes
with a central cushion), sepal (complex peltate scale, flate stellate hairs), petal (cushioned stellate
hairs, simple hairs), and the skin fruit (stellate hair cushioned, four-armed stellate hairs).
Keywords: tropical fruit plant, D. kutejensis, superior character, morphology, trichome shape.
P-058
Diversity Orthosiphon in indonesia
P-059
The ginger flora of the Lore Lindu National Park is very poorly known based on lack of collection
and historical factors affected to Zingiberaceae collection from Sulawesi. An exploration and
examination of Lore Lindu National Park in 2012 documented eight wild species (2 Etlingera sp., 2
Amomum sp., and 4 Alpinia sp.). One of the Alpinia species is indicated as new species. Taxonomic
notes, ecology and geographical distribution of the recognized species are provided.
Keywords: Lore Lindu National Park, Zingiberaceae, Sulawesi.
P-060
Floral biodiversity in Melanesia: digitization and discovery
James, S.A.*, Richard Pyle, R., Whitton, R., Kennedy, B., Imada, C., Shun, N., Brown, B., Tsuda, R.,
& Magoon, V.
Bishop Museum, Honolulu
*e-mail: sajames@bishopmuseum.org
The islands of Melanesia, consisting of the countries and territories of Fiji, New Caledonia, Vanuatu,
Solomon Islands, Papua New Guinea (PNG), and the Indonesian provinces of Papua and West Papua,
comprise more than 95% of the land area of the tropical Pacific Basin and are host to most of the
region’s biodiversity. Melanesian biodiversity greatly exceeds that of North America and rivals that
of the Amazon Basin, comprising some 10% of all the world’s species. However, there remains
considerable speculation as to the size of the vascular flora, especially with published estimates for
the largest island, New Guinea, ranging from 11,000 to 25,000 species. In addition, ~40% of the
Melanesian biota has yet to be scientifically named and the geographic ranges of most species remain
unknown, making the region one of the most poorly documented regions on planet Earth. As a first
step to fully understanding the extent of biodiversity in the region, an online species checklist is being
systematically developed from published scientific literature, online resources, taxonomic experts, and
cross-correlated with specimen collections. Bishop Museum’s Herbarium Pacificum (BISH) is
actively digitizing floral and algal collections from Melanesia, databasing collection label data,
georeferencing locality data, imaging specimens, and making this information available online via the
natural sciences collections portal (nsdb.bishopmuseum.org). Biodiversity surveys in PNG are being
undertaken in remote, under-explored regions to document the flora. Other projects at the Bishop
Museum, such as the Global Names Architecture and BiSciCol (Biological Science Collections
Tracker) projects are developing online tools to further increase accessibility and manageability of
biodiversity data. Making this baseline biodiversity data available to conservation and spatial planners
in Melanesia will better enable effective on-the-ground conservation action in the face of global
climate change, including temperature and precipitation changes, ocean acidification, and sea level
rise, and anthropogenic activities such as forestry, mining, and population expansion.
Keywords: Melanesia, online databases, vascular flora, algae, hotspot, botanical collections,
biodiversity conservation, data management.
P-061
Berendsohn, W.G.1, Miller, C.2 and the JSTOR Global Plants Development Team
1
Botanic Garden and Botanical Museum Berlin-Dahlem, Freie Universität Berlin
2
Missouri Botanical Garden, St. Louis
Global Plants (plants.jstor.org) is a community-contributed database that features more than two
million high resolution plant type specimen images and other foundational materials from the
collections of more than 270 herbaria in 70 countries. Complementing the high resolution specimen
images are extensive flora and other reference materials, collectors’ correspondence and diaries, and
tens of thousands of paintings, photographs, drawings, and other images. Global Plants strives to be a
comprehensive resource for aggregating and exploring the world’s botanical resources, thereby
dramatically improving access for students, scholars, and scientists around the globe.
Global Plants is the outcome of the Global Plants Initiative (GPI). The Andrew W. Mellon Foundation,
along with leading experts in the field, had developed the idea of creating a digital library of type
specimen images and related material and as a result funded the initial digitisation activities in the
Global Plants Initiative. Over 10 years, GPI has grown into an international partnership wherein
herbaria work together to create a shared database of information and images of plants worldwide. In
partnership with JSTOR, GPI is building a sustainable resource that the international scientific
community can rely upon. JSTOR is committed to the preservation of this work for future generations.
The Global Plants Initiative includes more than 270 contributing herbaria in 70 countries. The
complete list of GPI partners is available at http://plants.jstor.org/action/community. Based on the
subscription model successfully developed by JSTOR for digital holdings of print literature, the plans
for long-term maintenance and sustainability of Global Plants are currently being finalized.
Keywords: Specimen images, Digitisation, Virtual herbarium, Type specimen, JSTOR, GPI, Global
Plants.
P-062
Diversity of climbing plants in an isolated forest of Ayer Hitam Forest
Reserve, Malaysia.
Ayer Hitam Forest Reserve (AHFR) is one of remaining once large area of lowland forest in western
part of Peninsular Malaysia. The forest with an area of only 1,176.1 hectares is surrounded by the
housing development. This study was done to assess the diversity of climbing plants ranging from
lianas, orchids, aroids, rattans and epiphytic climbers. In order to do that, a transect line were set up
and all climbing plants were recorded and identified. The result revealed that a total of 47 families and
98 genera of climbers were recorded with the largest families is Fabaceae with 17 species from 7
genera, followed by Annonaceae with 15 species from 7 genera, Vittaceae with 12 species from 6
genera and Rubiaceae with 11 species from 6 genera. Agelaea is the most abundant species recorded
during the study.
Keywords: Ayer Hitam Forest Reserve, climbers, lowland forest, climber diversity.
P-063
The mangroves of Raja Ampat, West Papua, Indonesia
2
)Integrated Research Center, The Field Museum, 1400 Lake Shore Drive, Chicago, IL 60605, USA
We studied the floristic compostion and structure of mangrove forests and mangrove species
distribution at the Raja Ampat Regency, West Papua. We sampled the forests using (10x10 m)
quadrats laid out contiguously along 9 transects of 60-450 m long, perpendicular to the coastlines. The
transects were establishedon the islands of Batanta (6), Salawati(2). and Waigeo (1). Within quadrats
and transects we recorded 17 mangrove species of trees with density of 768 stems/ha and basal area of
37.82 m2/ha and tree height of 10 – 30 m. Overall, however, we registered 109species of 52 families
occurring on the islands both within and ouside the quadrats, and each island contained a set of
species with restricted distribution to each island. Two species possessed the highest importance
value (IV), frequency, density and basal area, i.e. Rhizophoraapiculata (IV=168.06 %) and
Bruguieragymnorrhiza (IV=67.18). They also showed the highest similarity (100 %) in their
distribution, indicating highest degree of association. The mangrove at Raja Ampat may, therefore,
be designated as Rhizophoraapiculata-Bruguieragymnorrhiza Association. Other species with highest
degree of distributional similarity (100 %) but with low density, basal area and importance values
P-064
Evaluation of mangrove forest timber resource and charcoal operation
activity in Marudu Bay, Sabah
Eswani*, N., Abd Kudus, K., Sarah, S., Awang Noor, A.G., Nazre, M. & Ainuddin, A.N.
Faculty of Forestry, Universiti Putra Malaysia, Malaysia
*e-mail: aja_eswani@yahoo.com
Mangrove Forest at Marudu Bay was rich with resources such as timber, fisheries and others. It has
also provided an important resource for coastal communities. Timber is one of the major components
of mangrove forest. Due to the richness of the forest, the actual value of the forest usually
underestimated. A study was conducted to evaluate the timber resource at Marudu Bay, Sabah. In
particular, the objective of this study attempt to estimate the stumpage volume, and its relation with
the charcoal production and to determine the most dominant species in Marudu bay. The data source
was based on the survey conducted with 10 charcoal operators and the 1-ha inventory conducted in
Marudu Bay. The volume equation of Rhizophora and Non-Rhizophora were combined with a
diameter of species to calculate the stumpage volume. Several calculations on stumpage volume were
carried out to determine the relation between species and species group. Result showed the most
dominant species was Rhizophora apiculata with density 757m2/ha, followed by Rhizophora
mucronata 511m2/ha. Though the area was dominated by Rhizophora apiculata, the highest estimated
stumpage volume was conquered by Rhizophora mucronata with total volume 51.029m3/ha and
Rhizophora apiculata was 33.42m3/ha. Total stumpage volume in the study area was 110.2426m3/ha.
For charcoal production, Rhizophora species were utilized and found in the Bangkita Forest
(Rhizophora Forest) with the total area was 5,485.83 ha. The estimated stumpage volume for trees
with a diameter greater than 12 (>12cm) was 65005.46m3. There were 40 kilns in Marudu with the
total burning of charcoal production were 76 times per year with stumpage volume about
220.87m3/year. Therefore, the Bangkita Forest in Marudu bay possibly will be last until 154 years if
the number of kiln and total production remain the same for 154 years. Further research is needed to
estimate the lifetime of the Bangkita Forest if the charcoal operation is increase or decrease.
Keywords: charcoal, stumpage volume, Rhizophora, Marudu.
P-065
Notes on tree species for restoration of five national parks
Desitarini1, Wiriadinata, H.2, Rugayah2, Partomihardjo, T.2, Prawiroatmodjo, S.2, Ismail2, Sulistiono1,
& Miyakawa, H.1
1
JICA Project on capacity building for restoration of ecosystem in conservation areas, Jakarta, Indonesia
2
Botany Division, Research Centre for Biology – LIPI, Indonesia
Five National Parks (Sembilang, Cermai, Merapi, Bromo-Tengger and Manupeu) in Indonesia have
been chosen for a JICA project to develop a model of park restoration A total of 200 tree species
have been selected and included in the publication of a field guide to park restoration. Species
selection was based on such criteria that species are locally abundant, easily planted, critically
endangered, threatened to extinction, endemic and economically, ecologically and environmentally
valuable. In 2012-2013 botanical explorations have been carried in the Sembilang National Park with
special focus on mangrove species, in Ceremai, Merapi and Bromo-Tengger National Parks with
special study on mountane rain forest species and in the Manupeu National Park on dry monsoon
species. Some interesting species were collected and recorded. It was noted that Tristiropsis
canarioides was endemic to Manupeu, Kandelia candel was classified as an endangered mangrove
species in Sembilang, Dipterocarpus hasseltii, Magnolia montana, Kibatalia arborea were rare
species, in Ceremai. Several species that were widely distributed in the 5 National Parks were
Engelhardia spicata, Dodonaea viscosa, Dysoxylum densiflorum, Macaranga tanarius, Schima
wallichii, Ficus spp., Antidesma bunius, Magnolia glauca, etc. New species of Begonia, and Calamus
were recorded in the Manupeu National Park and will be published soon.
It is hope that the data of flora collected during the explorations could contribute to a better
knowledge on the flora of the above-mentioned National Parks, and could be used as the basis for
National Park Management, Conservation, Education and Recreation purposes.
Keywords: Restoration, field guide, National Parks.
P-066
Conservation of Indonesian Hoya (Apocynaceae: Asclepiadoideae):
in Bogor Botanical Gardens
Rahayu, S.
Centre for Plant Conservation- Bogor Botanical Gardens, Indonesian Institute of Sciences (LIPI)
e-mail: srirahayukrb@yahoo.com
The genus Hoya (Apocynaceae: Asclepiadoideae) has become popular as exotic ornamental plant in
Europe, USA and Australia, while in Indonesia as the home country of many Hoya species is still
neglected. Several species are become rare due to deforestation, mainly as Hoya species are epiphyte
which depend on the present of trees as phorophyte (host). Since 1995, an ex-situ conservation
strategy has been conducted in Bogor Botanic Gardens. There are three main activities have been
done: (1) Inventory of Indonesian Hoya species, (2) Living collection management, (3) Sustainable
Utilization. Based on the herbarium observation at BO and literature study, there are about 60 Hoya
species occurred in Indonesia. Unfortunately, the revision of this genus has not finalized and is still
incomplete. Forty four species have been collected and grown in Bogor Botanical Gardens, which
consists of 19 species from Sumatra of 27 species, Java 13 species of 22 species, Kalimantan 16
species, Sulawesi 9 species, Moluccas 4 species, Papua 4 species, Lesser Sunda Island 3 (including 1
from Bali). only one endemic species from Sumatra has been conserved. The preliminary
conservation status of these species was assessed based on the frequency of collecting by the Bogor
Botanical Exploration teams and herbarium sheets observation at BO. Notes were made on the
survivorship and in relation to the propagation technique of each species. A promotion of Hoya as an
ornamental plant has been put as the priority on the utilization on Indonesian Hoya species, beside
that a study on the revision of Hoya is also important to be promoted. A new Bogor Botanic Garden’s
variety from Hoya diversifolia had been obtained from mutation treatment. The new variety has
different color in flower, i.e. corolla and corona. The previous species has pink color, and the new
variety has white color. Registration for Plant Variety Protection is awarded to the Plant Variety
Committee in Indonesia.
Keywords: Hoya (Apocynaceae: Asclepiadaceae), conservation, Botanic Garden.
P-067
Survey and conservation assessment of the flora
of the Northern Territory, Australia
Cowie, I.
Northern Territory Herbarium (DNA), Department of Land Resource Management, Australia
e-mail: ian.cowie@nt.gov.au
The adequacy of survey of the Northern Territory (NT) flora for both floristic inventory and
assessment of species against IUCN criteria was examined using herbarium collections and survey
data. Knowledge of the flora and its distribution has improved dramatically over the past 60 years.
However, substantial areas of land and many species remain poorly surveyed. Some 23% of the native
flora is known from 10 records or less and a similar percentage is currently coded as IUCN Data
Deficient or is not evaluated. The intensity of herbarium collections of native species is 13.2
specimens / 100 km across the NT, but ranged from to 4 to 72 specimens / 100 km2 for individual
2
bioregions. To record 70% of the predicted maximum number of species for a one degree by one
degree cell, 57 collections / 100 km2 would be needed in the wet-dry tropical zone. The implications
for conservation coding of the flora are discussed.
Keywords: conservation assessment, floristic inventory, IUCN criteria, Northern Territory, Northern
Australia.
P-068
Conservation status of the Javan endemic plant species
Amorphophallus discophorus Backer & Aldew. (Araceae)
Amorphophallus discophorus Backer & Alderw. is one of the javan endemic plant species. This
species is locally endemic to the slopes of Mt Wilis in Kediri Regency (East Java) at between 600 -
1300 m altitude. Poorly known species such as A. discophorus could be easily become extinct in the
wild due to misharvesting of A. muelleri for commercial purposes and land converted in the last
decade. Several fieldworks have been done. First fieldwork conducted in 1998–1999 in Kediri
Regency failed to find A. dicophorus. A Second round of fieldwork in 2009–2011 at the type locality
on Mount Wilis and surrounding areas in East Java also fail to find the species. Most recently
fieldwork was conducted in April 2013 in Madiun Regency (East Java) and most of the forest is
converted to timber and cassava plantations. Based on the field observations, it is predicted that A.
discophorus presumably extinct in the wild.
Keywords:Amorphophallus discophorus, Araceae, extinct, Mount Wilis, East Java.
P-069
Vegetation analysis in the forest of Tesso Nilo National Park,
Riau Province, Sumatra, Indonesia
A vegetation study was carried out in the Tesso Nilo National Park, Riau. The total area of the
National Park is 190.000 ha, including lowland forests located at the altitude of 100-200 m. Currently,
most of the the lowland forest has been destroyed. The research sites were situated at the Setugal
village, Kuantan Senggigi district. The general land use in the region include Acascia and rubber
plantations, scrubs, secondary forests, and remnants of primary forest. The region has a very wet
climate with annual rainfall of 2000-3000 mm, and its topography is relatifely flat and slightly
undulating with a slope of 10-15⁰.
This study, using the quadrat method, attempts to reveal the composition and structure of the
vegetation at the Park. The result shows that the diversity of species in one-hectare area of the
lowland forest was high. Is was supported by the data that recorded 212 species of trees belonging to
118 genera and 48 families. It was noted that the saplings consisted of 304 species of 144 genera and
55 families. At tree level, the dominant species were Sloetia elongata (IV=17.14), Xylopia caudata
(IV=7.56), Pimelodendron griffithianum (IV=7), Artocarpus elasticus (IV=6,45). Tree species
dominating the sapling stage were Sloetia elongata (IV= 11.63), Pimelodendron griffithianum
(IV=6.98), Barringtonia macrostachya (IV=6.16), and Saraca declinata (IV=6.09).
Keywords lowland forests, species diversity, Tesso Nilo National Park, Sumatra.
P-070
Structure and composition of communities of herbs, epiphytes and
seedlings in a coastal forest of the Sempu Island Nature Reserve, Malang,
East Java
Sadili, A.
Herbarium Bogoriense, Research Center for Biology, Indonesian Institute of Sciences (LIPI)
e-mail: asep.sadili@gmail.com
A study on structure and composition of herbs, epiphytes and seedlings was undertaken at the Waru-
Waru area. in the Sempu Island Nature Reserve, East Java Two plots of 1x50 m each were
established in two sites, located at a distance of ± 0.5 km. A total of 67 species, 57 genera and 41
familys were recorded, with a high species index diversity (3.84 (H'). The number of species
categorized as tree seedlings was higher than that of herbs and epiphytes. The families containing the
highest number of species were Euphorbiaceae (6 species) and Fabaceae (5 species). The dominant
species at site I was Rungia sp and at site II Pterospermum diversifolium. The plant communities at
the two sites were very dissimilar having a Similarity Index of only 21%. Among ten species with the
highest importance values in site I Piper sp - Syzigium sp and Ficus sp-Knema laurina showed a
highsest degree of association (± 98%), while in site II the species showing highest degree of
association were Ilex cymosa-Antidesma bunius (± 95%) and Microcos argentata-Knema sp (± 90%.).
Keywords: structure, composition, herbs, epiphytes, seedlings, Sempu Nature Reserve, East Java.
P-071
Tree species composition of one-hectare sub-montane forest
at Mount Salak, Bogor, Indonesia
Sambas, E.N., Polosakan, R., Pratama, B.A., Rahajoe, J.S. & Alhamd, L.
Botany Division, Research Center for Biology – LIPI
e-mail: edynas.sambas@gmail.com
Mount Salak, formerly a protection forest mainly functioning as a water resource area, was designated
as a part of the Gunung Halimun-Salak National Park in 2003. At high elevation, Mount Salak has a
rugged and inaccessible topography with the first peak at the altitude of 2,211 m (Mt. Salak 1) and
the second peak (Mt, Salak 2) at 2,180 m. A study on floristic composition was carried out in the
relatively accessible sub-montane forest at the altitude of 1,200 m. The forest was sampled using a
plot of 100 m x 100 m ( 1 ha), divided into 100 sub-plots of 10 m x 10 m. Each tree having girth at
breast height ≥ 15 cm was, recorded for its species identity, girth/diameter, height to the first branch,
and total height. The result shows that within the studied forest, 65 species belonging to 47 genera
and 29 families were recorded. Trees having highest Important Values were Arthrophyllum
diversifolium, Schefflera aromatica, Schima wallichii, Macaranga triloba, and Acronichia
pedunculata. The important families occurring in the forest were Araliaceae, Rubiaceae, and
Euphorbiaceae.
Keywords: Tree species, sub-montane forest, Mount Salak
P-072
Floristic and structural characteristics of a lowland forest of the
Karimunjawa National Park
Larashati, I.
Research Center for Biology, Indonesian Institute of Sciences
e-mail: ingels@ymail.com
The Karimunjawa National Park is located on the Island Karimunjawa, a small island situated
northwest of the town of Jepara, Central Java., The Park covers a variety of marine and terrestrial
ecosystems, including the lowland tropical rain forest ecosystem. The lowland forest, which is also
a protection zone, covers an area of 1282.20 hectares. The area has undulating topography,
consiststing of low plains with the altitudes of 65-506 m above sea level. Information on the
biodiversity of the area, especially the ecology of plants, is still meager. In view of this situation a
study was, therefore, undertaken in the lowland forest within the Park with the aim to find and reveal
the diversity of plant species. It was initiated with a reconnaissance to determine the study sites,
followed by the establishment of three permanent plots of 0.4 hectare each at the altitudes of 100 m,
200 m and 300 m. Each permanent plot was divided into 10 x 10 m quadrats for enumerating trees
(DBH ≥ 10 cm) and a 5 x 5 m subquadrat was nested in each 10x10 m quadrat for recording saplings
(DBH = 2-9.9 cm). Thus altogether 120 quadrata and 120 sub-quadrats were established. The results
showed that Polyosma integrifolia was the dominant tree species in the study site. In permanent plot 1
at 300 m asl. at the tree stage Polyosma integrifolia had an important value (IV) of 12.76 % with basal
area (BA) of 2.43 m2/ha , while in the sapling stage the IV was 51.6 % with BA of 19.3 m2./ ha In
plot 2 at 200 m asl at the tree stage it had IV of 7.16 % with BA of 1.69 m2/ ha and at the sapling
stage the IV was 12.8 % with BA of 3.48 m2/ ha. The trees and saplings of Polyosma integrifolia
were not found in plot 3. As whole, at tree stage 26 species were recorded in plot 1, 26 species in
plot 2 and 25 species in plot 3 . Whereas at the sapling stage 30 species were recorded in plot 1, 28
species in plot 2 and only one species in plot 3.
Keywords: Polyosma integrifolia, Karimunjawa National Park, Central Java.
P-073
The diversity and abundance of ground herbs in a lowland mixed
Dipterocarp forest and a heath forest in Brunei Darussalam
Herbaceous plants are important components of total plant species richness in tropical forests. Ground
herb diversity and abundance were studied in a lowland Mixed Dipterocarp forest (Andulau) and a
heath forest (Bukit Sawat) in Brunei Darussalam, Borneo. At each site, all ground herbs in twenty
randomly selected 10 x 10 m subplots within a one hectare permanent plot were censused and
identified. The study recorded a total of 20 families and 32 genera of ground herbs, with the family
Zingiberaceae most abundant at both sites. Thirteen genera were recorded only at Andulau and 7
genera were exclusive to Bukit Sawat, with twelve genera common to both sites. Ground herb species
richness appear higher at Andulau than Bukit Sawat (37 vs. 29), but this difference was not
statistically significant. However, ground herb abundance and density were significantly higher at
Bukit Sawat than Andulau (n = 846 vs. 385; 4230 vs. 1925 individuals ha -1). The more open canopy
at Bukit Sawat may provide higher light availability here than at Andulau, which is characterised by a
closed canopy. We suggest that light availability is the most important environmental factor
influencing ground herb density and abundance at these sites.
Keywords: Borneo, tropical forests, species richness, Zingiberaceae, light availability.
P-074
Germination and growth of tropical pioneers in Brunei Darussalam: The
effects of temperature and seed size
The effects of temperature and seed size on germination of tropical pioneer species have received
little attention. This study aims to study the effects of temperature and seed size on germination of
five common tropical pioneer species in Brunei Darussalam; Melastoma malabathricum, M.
beccarianum, Rhodomyrtus tomentosa, Dillenia suffruticosa and invasive Acacia mangium. The
species were grouped into small-seeded (seed mass ≤ 1 mg) and large-seeded (seed mass > 1 mg)
species and we determined the germination responses (number of days for seeds to start germination
and reach 50% germination), final germination percentages and relative growth rates (RGR) in
different temperature using incubator chambers with 12 h-photoperiod. All species were treated with
constant temperatures of 20◦C, 25◦C, 30◦C, 35◦C and 40◦C, and alternating temperatures of 30/25◦C,
35/25◦C and 40/25◦C. Results demonstrated the possible influence of temperature on the germination
of large-seeded A. mangium (13.86 ± 1.17 mg) as shown by its fastest time to germination and 50%
germination across all temperature treatments, and its highest mean cumulative germination
percentage (88 ± 2.8%) and fastest RGR in constant temperature of 30◦C. The abilities of A. mangium
to have faster germination and higher RGR than other native plants are the possible traits that made
non-native A. mangium invasive in the secondary and degraded forests of Brunei. This study also
shows the importance of understanding the effects of different environmental factors on seed
germination that might contribute to the establishment and growth of pioneers.
Keywords: germination, tropical pioneers, seed mass, temperature and relative growth rates (RGR).
P-075
Analysis of gross primary productivity (GPP) in Bali Botanic Garden
using landsat data
Mukaromah, L.1 and As-syakur, A.R.2
1
Purwodadi Botanic Garden-LIPI, Pasuruan, Jawa Timur
2
Center for Remote Sensing and Ocean Science (CReSOS), Udayana University, Bali
Most models of ecosystem carbon exchange that are based on remote sensing use some form of the
light use efficiency (LUE) model. The aim of this work is to analyze the distribution of annual Gross
Primary Productivity (GPP) in the Bali Botanic Garden, Bedugul, Bali, using remote sensing imagery
(Landsat 5 TM and 7 ETM+ on 1997 and 2002). The annual GPP at Bali Botanic Garden were
estimated based on biophysical parameters derived from Normalized Difference Vegetation Index
(NDVI) extracted from remote sensing data, incoming solar radiation and light-use-efficiency
coefficient. The result showed annual GPP estimated using Landsat 1997 varied from 1282.50 gCm−2
yr−1 to 2843.97 gCm−2 yr−1, while the Landsat 2002 estimate varied from 657.40 gCm−2 yr−1 to
2755.55 gCm−2 yr−1. Total carbon assimilated by vegetation was also analyzed by summing up all
pixels in study area for each year and by multiplying them with the width of the pixel to eliminate
square meters. We found that total GPP (carbon assimilated by vegetation) in Bali Botanic Garden
measured by Landsat 1997 was 27719.40 gC yr-1, while in 2002 decreased to 25473.06 gC yr-1. Using
vegetation index retrieved from reflectance Landsat data, we found that the medium spatial resolution
Landsat Imagery is potentially usable to estimate Gross Primary Productivity (annual photosynthetic
productivity) in small forest garden.
Keywords: Gross Primary Production (GPP), Bali Botanic Garden, landsat imagery.
P-076
Climate change impact assessment on species distribution and genetic
diversity of Alpine plants—insights from Oreomyrrhis Clade of
Chaerophyllum in Taiwan
Studies have predicted that alpine plants will be forced to migrate into higher elevations as current
trend of global warming continues, resulting in drastic deduction in their distribution range.
Consequently alpine vegetation is regarded as one of the most vulnerable ecosystems by global
climate changes (GCC). However, species’ survivorship and evolvability to cope with environmental
changes also depend on genetic diversity. Therefore it is important to realize how the fluctuation of
species habitat impacts genetic diversity at population level. Based on coordinates of collecting data
and climate data of WORLDCLIM, we employed the program MAXENT to construct the distribution
models of two endemic species of Apiaceae in high elevation of Taiwan, Chaerophyllum
involucratum and C. taiwanianum, and used the models to project their past and future distributions
during the last glacial maximum (LGM) and under the future climatic scenarios (i.e. B2B and A2A)
predicted by Intergovernmental Panel on Climate Change (IPCC). Changes of projected distribution
were used to evaluate the vulnerability of the species. The distributions were also integrated with
phylogeographic data to predict the loss of genetic diversity under B2B and A2A. Based on the
projections, distributions of both species were much wider during LGM compare to their present
distributions. Under B2B and A2A, 18–497 m upward migration and 44.7-85.8% shrinking in
distribution are projected in C. involucratum, while 17–476 m and 42.2-99.9% in C. taiwanianum are
estimated. Populations in the northeastern part of the island are most vulnerable, with vulnerability
decreasing southward. Based on deduction of distribution range, C. involucratum is projected to lose
5.3-21.1% of haplotypes in the chloroplast atpB-rbcL spacer, while 0-80% loss was predicted in C.
taiwanianum. Because the northeastern populations also present hotspots of genetic diversity, their
high vulnerability urges attention to monitor whether populations there would have shrunk as
predicted. Furthermore, ex situ conservation such as germplasm preservation in seedbank should
focus on populations harboring haplotypes that are projected to go extinct in the near future. For the
reason that Taiwan is in Malesian region optionally, this case in Taiwan plays a important role in
studies of Malesian region.
Keywords: species distribution model, global warming, conservation genetics, Oreomyrrhis,
vulnerability, Apiaceae, MAXENT.
P-077
Potential local trees selecting for high carbon sequestration
in low land ecosystem
One way to control climate change is to reduce CO2 emissions by conserving natural forests and
increasing the trees population in degraded forests. Planting introduction tree species in degraded
lands affected ecosystem imbalance. In contrast, revegetation with local tree species diversities
would increase ecosystem services. This study aims to select local tree species that potentially high
carbon sequestration, mainly in the dry lowland ecosystem. Selection of local trees was conducted
in the local trees collection of Purwodadi Botanic Garden with measurement of diameter increment,
biomass, carbon stock and CO2 absorption. In addition, the propagation method and useful of local
tree species also were collected. The results showed that 40 species of local trees stored high carbon
above 10 kg.th-1.tree-1. From these tree species, 13 species (32,5%) belonging to legumes (Fabaceae)
family. Kesambi (Schleichera oleosa), Cempaka (Michelia alba), Kedawung (Parkia timoriana),
Angsana (Pterocarpus indicus), Kedoya (Dysoxylum gaudichaudianum), Nyatuh (Madhuca
longifolia), Saga (Peltophorum pterocarpum) and Kedondong hutan (Spondias malayana) were 8
species of local trees that had high carbon sequestration (above 50 kg.th-1.tree-1). From the above 40
species, 16 species (40%) were easily propagated while the rest required seed dormancy breaking
treatment.
Keywords: local trees, carbon, sequestration.
P-078
Characteristics of stomata on five species of low land trees
with high carbon sequestration
The increase of CO2 concentration in the air has greatly raised world attention on trees with high
carbon sequestration ability. Stomata is a vital part of a plant facilitating the absorbtion of
atmospheric CO2, making it inseparable to carbon sequestration ability. The present study, carried out
at the Purwodadi Botanic Garden, aims to study stomata characteristics of selected five low land
tree species in relation to their high carbon sequestration ability. The stomata characteristics
investigated include density, area and type of stomata of Schleichera oleosa, Michelia alba,
P-079
Carbon stock of trees in coal mining concession forest at Sendawar,
East Kalimantan, Indonesia
Metusala, D.
Purwodadi Botanic Garden,
e-mail: metusala.destario@gmail.com
Many research showed that the rapid change of future global environment due to increasing of
atmospheric carbon has become one of main threats to human life. Forest is known to have many
important functions in mitigating those threats by providing protection and enhancement of water
resources, sustainable place for many species, source of fresh air, and function for
atmospheric carbon sequestration. A research to observe the potential of forest characteristic
related to its function as carbon stock is urgently needed, especially for forest located in
mining concession. This research is aimed to identify species composition of tress which
have dominant role for carbon stock in a forest which is located in mining concession of PT.
Bharinto Ekatama, Sendawar-East Kalimantan. Field research has been conducted in 2012
and we have used sample plot method for trees category. The result showed that the
estimation of carbon stock potential for tress was 71.25 ton/ha, with eight (8) highest
contributor species: Syzygium sp (12.19 %), Shorea parfivolia (6.54 %), Eusideroxylon zwageri
(5.17 %), Canarium sp (3.86 %), Shorea cf. sarawakensis (3.69 %), Shorea fallax (3.63 %), Shorea
palembanica (3.33 %), and Shorea leprosula (3.24 %). This result is important to be used in
determining species recommendation for reclamation stage that has potential in carbon stock by using
local trees species.
Keywords: carbon stock, mining, Kalimantan.
P-080
Study of edaphic factors of bamboo population
in Mount Baung Natural Park, Pasuruan, East Java
Bamboo is one member of the Poaceae family. There are 1250 bamboo species in the world, an
estimated 161 of them are in Indonesia. One of the bamboo forests in East Java is found at a
conservation area namely Mount Baung Natural Tourist Park (MBNTP). The purposed of the research
was to study the influence of edaphic factors to bamboo’s growth. This research was carried out from
September 2011 to Mei 2012. The edaphic data collected consist of texture and chemical properties.
The principal component analysis (PCA) was performed to determine relationships between edaphic
components and bamboo’s occurrences. There were seven species of bamboo in MBNTP, namely,
Bambusa blumeana, Bambusa vulgaris, Dendrocalamus asper, Schizostachyum iraten, Gigantochloa
atter, Gigantochloa apus, and Dinochloa matmat (amount < 1%). Based on that edaphic factors data,
it was showed that the edaphic factors affected the presence of bamboo in MBNTP. Phosphor (P) is
one of the edaphic factors which contributing significantly to B. blumeana, B. vulgaris, D. asper and S.
iraten presence in MBNTP. The result of PCA analysis showed that the angle was formed by the
elements P and five of bamboo is an acute angle with an Eigenvalue > 1. From the analysis in the field
it showed that the five bamboos grow in soil with high levels of P (reaching 27 me 100 g -1). On
Poaceae, phosphor is required for the cell elongation, stem diameter development and strengthening
stem which make the stem stronger. Among the seven species bamboo in MBNTP, the presence of G.
apus influenced by elements of Manganese (Mn) and Sodium (Na). In soil, element of manganese was
dissolved at low soil acidity. When the soil pH is increasing, the solubility of manganese was
decreased. Soil acidity in MBNTP is slightly acid (5.6 to 6.5), that can be one factor leading to the
high solubility of Mn in the soil which are favored by G. apus. This bamboo in this area more
commonly found in soil environments with low levels of Na (< 0.02%) and Mn (≤ 24 mg 100 kg-1).
Keywords: edaphic, bamboo, Mount Baung.
P-081
Hydraulic architecture of tree species in cacao agroforests: Aboveground
growth performance and xylem anatomic properties
Wood density and xylem anatomical properties are usually regarded as core functional traits of tree
aboveground growth performance. Since vessel size affects sapwood-specific conductivity to the
fourth power, a strong positive correlation to plant growth is to be expected.
Here, we examined hydraulic properties of branch, root and stem tissue of Theobroma cacao and five
common shading tree species (Leucaena leucocephala, Gliricidia sepium, Gnetum gnemon, Erythrina
subumbrans, Durio zibethinus) from an agroforesty system in Sulawesi, Indonesia.
Our results show that there are significant differences in specific hydraulic conductivity and
hydraulically weighted vessel diameter between species as well as between the root, branch and stem
xylem within a given species. Distinct patterns due to biogeographical origin of the species are visible.
Contrary to recently published results from primary forests in the same region, wood density showed
a negative relationship to hydraulic conductivity. On the other hand across all investigated species
basal stem increment was positively correlated with hydraulic conductivity underlining the
importance of hydraulic conductivity for tree growth performance.
We conclude that (i) growth performance is strongly dependant on hydraulic conductivity; (ii) xylem
anatomical patterns reflect species biogeographical origin and seem not to be modified due to habitat
adaptation.
Keywords: tropical agroforestry, shade trees, hydraulic conductivity, wood density, stem increment.
P-082
Soil nutrient dynamic at three defined elevation in relation to host plant
of Rafflesia Kerii in the highland of Kelantan, Malaysia.
Nasihah, M.*1, Zulhazman, H.1, Siti-Munirah, M.Y.2, Razak, W.1, Amir Husni, M.S.,1 & Qayyum
Nadia, W.A.1
1
Faculty of Earth Science, Universiti Malaysia Kelantan
2
Forest Research Institute Malaysia (FRIM).
*e-mail: nasihah5656@yahoo.com.my
Host of Rafflesia kerii belongs to Tetrastigma species wildly grows in Lojing highland forest. The
genus Tetrastigma is best known for its association with Rafflesia spp. Tetrastigma need nutrient to
make photosynthesis and the nutrient is absorbed from soil to live. The number of R. kerii bud
P-083
New record of Bryophytes Family from Giam Siak Kecil-Bukit Batu
Biosphere Reserve, Riau Province
Riau province has the largest peatland in Sumatra island, as shown in the Giam Siak Kecil-Bukit Batu
biosphere reserve. This area plays an important role for conservation due to its high biodiversity. One
of the important flora occurring in this region is moss. This lower plant groups can maintain the
stability of micro climate. Research and publication of moss plants in this region have never been
reported, therefore the study of Bryophytes in this conserved area is important. This study aims to
determine the family of moss plants found at Giam Siak Kecil-Bukit Batu Biosphere Reserve. This
study used exploration method. All of the samples were collected from three zones at the biosphere
reserve, i.e. transition zone, buffer zone and core zone. A total of 17 moss families were recorded
from study sites. 7 families of Marchantiophyta, i.e, Calypogeiaceae, Pallaviniaceae, Ricciaceae,
Jungermaniaceae, Lepidoziaceae, Frullaniaceae, Lejeuneaceae, and 10 families of Bryophyta, i.e.,
Bryaceae, Dicranaceae, Sematophyllaceae, Calymperaceae, Fissidentaceae, Hookeriaceae, Hypnaceae,
Leucobryaceae, Rhizogoniaceae and Thuidiaceae.
Keywords: Giam Siak Kecil-Bukit Batu Biosphere Reserve, exploration, moss, peatland.
P-084
Bryophytes diversity of Merapi Mountain National Park
in Central Java, Indonesia
Merapi Mountain is an active volcano, its latest eruption occurred in October of 2010.
Merapi Mountain National Park is characterized by tropical rain forest on the southern slopes of
Merapi Mountain. Eruption of the volcano in October 2010 spread hot clouds and caused forest fires
that damaged most of the vegetation where the bryophytes inhabited. This study aims to record the
species diversity sixteen months after the latest eruption. Sampling was conducted at three locations;
Pronojiwo Hill, Kinahrejo, and Gandok. A total of 68 bryophyte species, representing 45 mosses, 20
liverworts and three hornworts. Epiphytic bryophytes were found in locations where trees still left
(Pronojiwo Hill). The most abundant terrestrial bryophyte species found in bare areas was
Trematodon conformis.
Keywords: Bryophyta, liverworts, mosses, Merapi Mountain, volcano eruption, Trematodon.
P-085
Bryophytes diversity at cemoro sewu track of Mount Lawu
in East Java, Indonesia*
Mountain areas have a high diversity of bryophytes. The exploration study we conducted on the
bryophyte diversities at Cemoro Sewu Track of Mt. Lawu (3265 m asl) in April of 2012 revealed the
presence of 91 species. These species represent 56 genera and 34 families consisting of one hornworts
species, 30 species of leafy liverworts (15 families, 18 genera), one thaloid liverworts, and 59 species
of mosses (17 families, 36 genera). Two families with the highest diversity on Mt. Lawu were
Dicranaceae (21 species, eight genera), and Bryaceae (eight species, four genera). Bryophytes were
found mostly terrestrial growing on rock substrate. Leafy liverworts have a higher diversity in the
mountainous zone (2000-3000 m asl) than in sub-alpine zone (3000-3265 m asl). Diversity of mosses
was high in the higher mountain zones as well as in the sub-alpine zone.
Keywords: Mount Lawu, tropical forests, biodiversity, bryophytes, liverworts, mosses, hornworts.
P-086
Preliminary study of Bryophyta in forest conservation area
of Mount Eno, Linggang Bigung West Kutai District.
This research was conducted at the Mount Eno’s Conservation Forest, Linggang Melapeh Village,
Linggang Bigung Subdistrict, West Kutai District and at Herbarium Bogoriense the Research Center
for Biology-LIPI Cibinong, and the Laboratory of Physiology, Faculty of Mathematics and Natural
Sciences, Mulawarman University, Samarinda.
The forest is a local community conservation area and has been declared as a protection forest by
government of West Kutai Regency at 2012. The methodology of this research was the cruising
method (exploration and description). Research process involves: collecting the samples, creating
herbarium collections, and then identifying the samples.
The results obtained 32 types of mosses (Musci class) and leafy liverworts (Hepatic class). Musci
class consists of 4 orders, 6 family and 24 species. Hepatic class consists of 2 orders, 4 family and 8
species. Order Hypnales is the most dominant order among Musci which consists of 2 family
(Sematophyllaceae and Hypnaceae) with 10 species members. The dominant substrates of Musci class
and Hepatic class are the decayed wood, stone and soil.
Keywords: Mosses, Mount Eno.
P-087
Adaptations of ferns to epilithic mode of Life
Derzhavina, N.
Department of Botany, Physiology and Biochemistry, Orel State University, Russia
e-mail: d-nm@mail.ru
The objects of the study are epilithic ferns from different families. Their sporophytes have the
following adaptations: Biomorphological level: nanism; tussock biomorphs; intermittent leaf fall;
regulation of developmental rhythm according to the climate. Organ and tissue level (fronds):
relatively thick leathery and thin carved fronds; reduction of leaf blades and ability to perform
xerotropic movements; abscission layer and structures with shielding properties; heliomorphy; high
density of mesophyll; succulentization; dense reticulum of areoles. Cellular and subcellular levels:
collenchyma-like thickenings of cell walls in palisade tissue and epidermis; poikilochlorophytism;
small cells; large intercellular spaces in high-mountain and arctic species; presence of hypodermis and
water-retaining substances; polyploidy; apogamy. Functional level: thermodynamism; poikilohydry;
tolerance in respect of рН value of the substrate; intensification of the processes of photosynthesis and
respiration; oligotrophy.
Two groups of morphofunctional types are distinguished: 1) preadapted to life on stony substrates.
Their preadaptive mechanisms: biomorphs - long- and short-rhizomatous; plagiotropic, orthotropic
and anisotropic; small- and large-rosette, rosetteless, diffuse-rosette; facultative and obligate
bryophylly; poikilohygry; 2) adapted to epilithic mode of life. Their preadaptive mechanisms:
facultative and obligate bryophylly, short-rhizomatous biomorphs; poikilohygry; adaptive
mechanisms – tussock biomorphs; nanism; long branched root systems; intraprothallial self-
fertilization, apogamy and apospory; thermodynamism.
Some example of tropical Malesian species will be discussed in this presentation.
Key words: platylithophytes, chasmophytes, nanism, geophytization, poikilohygry.
P-088
Chromosome numbers of some species of Pteris (Pteridaceae)
in Java
On going research on the cytology of some species of ferns genus Pteris L. (Pteridaceae) in Jawa are
reported. Pteris biaurita and P. tripartita are diploid (2n=58). Pteris ensiformis var ensiformis shows
the chromosome number of 2n = 87 (triploid) and 2n = 116 (tetraploid), while P. ensiformis var.
victroriae reveals 2n = 58 (diploid). Pteris fauriei is apogamus triploid (2n=87). Pteris multifida and
P. vittata are sexual tetraploid (2n=116).
Keywords: chromosome, ploidy, Pteris, Java.
P-089
A preliminary molecular phylogeny of Selaginellacceae of Peninsular
Malaysia based on RBCL and ATPB markers.
Selaginellaceae is a heterosporus ferns family where the evolution and classification is still poorly
understood. The old classification using morphological data, place all taxa in a single genus,
Selaginella. This study was carried out to construct phylogenetic tree and observe
relationship between species of Selaginellaceae in Peninsular Malaysia by using molecular data
from chloroplast genome (rbcL and atpB). A total of 16 taxa were used in this study are: Selaginella
argentea, S. frondosa, S. plana, S. ornata, S. roxburghii var. roxburghii, S. intermedia var. intermedia,
S. intermedia var. dolichocentrus, S. mayeri, S. alutacia, S. minutifolia, S. morganii, S. pubescens, S.
repanda, S willdenowii, S. stipulata and S. wallichii. Two species were used as outgroups are
Huperzia lucidula and Isoetes laosiensis. Phylogenetic analysis of combined dataset including indel-
coded information was formed under parsimony inference. The results show all species of
Selaginellaceae studied were divided into four groups which are Group A, Group B, Group C and
Group D with highly supported (bootstrap values > 90 %). Group A includes S. roxburghii var.
roxburghii, S. intermedia var. intermedia and S. intermedia var. dolichocentrus while Group B
includes S. ornata, S. pubescens, S. repanda. Group C divided to two subgroups (namely C1 and C2
with highly supported bs = 100 %). The first group (C1) contains S. minutifolia, S. morganii and S.
alutacia which have close relationships of bilateral strobili. The second subgroup (C2) contains S.
stipulata and S. wallichii, S. frondosa, S. plana, S. willdenowii and S. mayeri while the last group is
Group D with S. argentea. The results support a monophyletic of the Selaginellaceae.
Keywords: Selaginellaceae, molecular study, rbcL region, atpB region.
P-090
The wood-rotting fungi of the Philippines
The wood-rotting fungi are large group of eukaryotic, achlorophyllous and spore-bearing organisms
that constitute an abundant element of terrestrial biota in the Philippines. They are best known for the
temporary shelf-like or bracket-like sporophore bearing sexual spores. This paper attempts to
preliminary document all the macroscopic wood-rotting fungi occur in the different regions of the
Philippines by preparing taxonomic accounts based on an extensive systematic collection and by
facilitating the identification or recognition of each fungal species.
Using transect line (TL) method, more than 20 transect lines were established in the Philippines with
20m x 50m quadrat sampling each transect line. All in all, 400 quadrats were laid out. The fungal
species within the quadrats along the TLs were identified and recorded. Simpson’s Index was used in
assessing diversity measured in terms of fungal species richness, abundance or evenness of spread of
the species in the habitat.
Field sampling of wood-rotting fungi was resulted to 150 species, 33 genera and 21 families. Each
species is described including substrata/ hosts, synonymies and habitats. Taxonomic keys are
provided for the identification of the families, genera and species. Highest diversity in terms of the
number of species belongs to the family Polyporaceae, which is composed of 32 bearing basidiocarps
that vary from leathery to woody. They are chiefly characterized by species bearing deep pores or
tubes. Some of these species, being the most destructive fungi, are largely responsible for the decay of
living trees.
Some of the important wood-rotting fungi that affect timbers are Hexagonia tenuis, Trametes
corrugata, Ganoderma applanatum, Microporus xanthopus, Cymatoderma elegans, Daedalea
ambigua, Fomes pachyphloeus, Polyporus hirsutus, Pycnoporus sanguineus, and Daldinia
concentrica. This is the first report of wood-rotting fungi in the Philippines.
Keywords: wood-rotting fungi, eukaryotic, basidiocarps, taxonomic, decay.
P-091
Arbuscular Mycorrhiza colonization status of Huperzia spp.
in Mt. Pangrango, West Java, Indonesia
Mycoheterotrophic plants, such as Huperzia spp. (Lycopodiaceae), are partly or entirely non-
photosynthetic plants that obtain nutrients from fungal symbiont (Arbuscular Mycorrhizal Fungi–
AMF). Huperzia spp.–AMF association are poorly studied as compared to other mycoheterotrophic
plant (e.g. Orchidiceae). Here, AMF colonization status of sporophytes of H. selago and H. serrata in
Mt. Pangrango is described in order to provide useful information for the conservation purposes.
Sporophytes of H. selago were collected from Pangrango Summit (PS) and Near the Summit (NS),
and H. serrata were collected from Kandang Badak (KB) and near the Cibereum Water Fall (CF).
The percentage of AMF colonization on roots of H. selago and H. serrata was determined by the
gridline intersect method. The results showed that the percentage of AMF colonization (Avg±SD %)
was varied among individuals at each site. Highest AMF colonization was found on Huperzia spp.
collected from KB (14.4±8.60 %), followed by CF (11.6±10.7 %), and NS (9.77±7.96 %).
Remarkably, characteristic of knobby vesicles were observed in H. selago from NS.
P-092
Preservation of Nostoc spp. (Cyanobacteria) isolated from Indonesian
paddy fields using freezing method
The algae preservation method is important step in order to maintain the sustainability of algal stock
cultures. Sustainability means the cultures are always viable in terms of physiologically and
genetically. Cryopreservation, lyophilization, and freeze-drying are several methods of preservation
used for microorganism. Amongst all methods, freezing had been widely used in the preservation of
Nostoc (Cyanobacteria). In the present study we investigated the application of deep freezer to
preserve eight Nostoc strains. All strains Nostoc was collected from several paddy fields in Java, Bali,
and Celebes, Indonesia. Before preservation, samples were added with protectant of 5% DMSO and
combination of 5%DMSO+5%Trehalose. Samples were kept in -800C for 7 days (short term) and 3
months (long terms). The result showed that except strain GIA13a, all strains retained their growth.
Scanning microscope electron showed that filaments of strain GIA13a were come apart, becoming
single cells. Colony of strains preserved in long term preservation grew up slower compare to those in
short term preservation. Light microscopic examination showed that filaments of preserved strains
become shorter compare to the normal ones.
Keywords: DMSO, freezing, growth, Nostoc, preservation.
P-093
Antioxidative and anti-Alzheimer’s potential of Canarium
odonthophyllum (Kembayau), an edible fruit from Borneo island.
Canarium odonthophyllum or locally known as “Kembayau” or “dabai” is a nutritious fruit but remain
underutilized. This study was conducted to determine the antioxidant activity, phytochemicals (total
phenolic, total flavonoid, total anthocyanin and total carotenoid contents) and acetylcholinesterase
inhibitor potential of flesh and seed of the fruits extracts. All samples were freeze-dried and extracted
using 80% methanol and distilled water. Antioxidants were analyzed using DPPH and ABTS free
radical scavenging activity as well as FRAP assays. Anti-Alzheimer’s potential was determined using
acetylcholinesterase enzyme inhibition assay. The results showed that the total phenolic and total
flavonoid contents were higher in the flesh with the values of 11.96 ± 0.05 mg gallic acid equivalent
(GAE)/g and 10.11 ± 1.54 mg rutin equivalent (RU)/g, respectively. Total anthocyanin and carotenoid
content were also higher in the flesh of the fruit with the values of 12.75 ± 0.28 mg/100g and 2.84 ±
0.11 mg/100g. The flesh of the fruit also showed higher antioxidant activity as assessed using DPPH,
FRAP and ABTS assays. However, anti-cholinesterase activity was higher in the seed part of C.
odonthophyllum which showed that other phytochemical content (besides phenolic and flavonoid)
might be the major factor to the observed effects. The same trend of phytochemicals, antioxidant and
anti-cholinesterase activity were also observed in the distilled water extract. These findings suggested
that C. odonthophyllum is not only nutritious but also displayed pharmacological properties.
Keywords: Canarium odonthophyllum, phytochemicals, antioxidant, acetylcholinesterase inhibition
properties.
P-094
Phytochemicals and antioxidant properties of Schistochilla aligera and
Schistochilla blumei from Mount Kinabalu, Sabah
Bryophytes have been commonly used as herbal medicines in China, India and America since ancient
times to treat cardiovascular diseases, tonsillitis, bronchitis, tympanitis, cystitis and skin burns. The
purpose of this research is to determine the phytochemical contents and antioxidant properties of
Schistochilla aligera and Schistochilla blumei. The total phenolic and total flavonoid contents were
determined using spectrophotometry analysis while the antioxidant properties were assessed by 1,1-
diphenyl-2-picridyl-hydrazyl (DPPH) free radical scavenging activity assay, ferric reducing ability of
plasma (FRAP) assay and ABTS radical cation decolorization assay. The results from this study
showed that the total phenolic contents of Schistochilla aligera ranging from 4.02 to 21.18 mg gallic
acid equivalent/g of dry sample whereas the total phenolic contents of Schistochilla blumei were in
the range of 4.49 to 24.24 mg gallic acid equivalent/g of dry sample. On the other hand, the total
flavonoid contents of Schistochilla aligera were in the range of 3.59 to 17.55 mg catechin
equivalent/g of dry sample and for Schistochilla blumei the total flavonoid contents 3.99 to 22.09 mg
catechin equivalent/g of dry sample. The antioxidant activities of the selected bryophytes extracts
were highly correlated with the phytochemical contents. Hence, the results from this study indicate
that Schistochilla aligera and Schistochilla blumei have potential health benefits due to their
phytochemicals and antioxidant properties.
Keywords: Schistochilla aligera, Schistochilla blumei, phytochemicals, antioxidant properties.
P-095
Phytochemical and antioxidant activity of Garcinia dulcis,
a fruit from Borneo Island
The genus Garcinia belongs to the family of Clusiacea. Some Garcinia species have been used
extensively as traditional medicines to treat diseases. Garcinia dulcis or locally known as ‘mundu’ is
an underutilized fruits indigenous to Borneo and its nutritional values are yet to be explored. The
purpose of this research is to determine the phytochemicals content (total phenolic and total
flavonoid) and antioxidant activity of G. dulcis based on its parts: peel, flesh and seed. The total
phenolic and flavonoid contents of the fruit were tested using Folin-Ciocalteu’s and Aluminium
Colorimetric methods, respectively. The antioxidant assessment was conducted using 2,2-diphenyl-1-
pycryl-hydrazyl (DPPH) free radical scavenging assay, Ferric Reducing Antioxidant Power (FRAP)
and ABTS decolourization assays. The results showed that the peel of G. dulcis contained the highest
total phenolic content (27.80 ± 5.01 µg GAE/g dry sample) followed by seed (26.2 ± 3.12 µg GAE/g
dry sample) and flesh (18.49 ± 2.26 µg GAE/ g dry sample). For the total flavonoid content, the peel
showed the highest value (16.45 ± 2.20 µg CE/g dry sample) and followed by flesh (12.11 ± 1.03 µg
GAE/dry sample) and seed (9.51 ± 0.85 µg GAE/dry sample). The antioxidant activity was highest in
the peel, followed by the seed and flesh. As a conclusion, it is suggested that all parts of G. dulcis may
serve as a potential source of antioxidant.
Keywords: Garcinia dulcis, total phenolic content, total flavonoid content, antioxidant activity.
P-096
Antioxidant activity, total phenolic and flavonoid content of selected
commercial seaweeds of Sabah, Malaysia
Seaweeds, either fresh or dried have been consumed as food in Asian diet over centuries especially
among people who live in the coastal area. There are many types of commercial seaweeds in Sabah
market. The most popular is Kappaphycus alvarezii, an edible type of seaweed which is classified
under division of Rhodophyta (red algae). This study aims to evaluate the phytochemicals and
antioxidant activity of selected seaweeds commercially available in Sabah market. Three varieties of
Kappaphycus alvarezii (‘tambalang hijau’, ‘giant’ and ‘green flower’ seaweeds) were used in this
study. The extract was prepared using 80% methanol. The antioxidant activities were determined by
three methods; DPPH radical scavenging assay, FRAP (Ferric reducing antioxidant power assay) and
ABTS free radical decolorization assay. The total flavonoid content (TFC) of the extract was
determined using Aluminium Chloride Calorimetric method and the results were expressed as
catechin equivalents (CE) whereas the total phenolic content (TPC) of the extract was determined
using Folin-Ciocalteu method and the results were expressed as gallic acid equivalents (GAE). Giant
seaweed was found to have the highest TPC and TFC with the values of 49.04±6.05mg GAE/100g
dried sample and 15.54±1.68mg CE/100g dried sample; respectively. Tambalang hijau and green
flower displayed lower TPC and TFC. Tambalang hijau had 30.96±1.34mg GAE/100g dried sample
of TPC and 7.72±2.89mg CE/100g dried sample of TFC, while green flower had 16.47±4.96mg
GAE/100g dried sample of TPC and 4.64±1.18mg CE/100g dried sample of TFC. Giant seaweed also
displayed the highest antioxidant activities as compared to tambalang hijau and green flower. As a
conclusion, Sabah commercial seaweeds contained high phytochemical contents and displayed high
antioxidant activity in vitro.
Keywords: Commercial Kappaphycus alvarezii, total phenolic and flavonoid contents, antioxidant
activity.
P-097
The allelopathic potential of an invasive Acacia in Brunei Darussalam
Acacia auriculiformis is one of the invasive plant species in Brunei Darussalam. The allelopathic
effects of aqueous extracts of its phyllodes were investigated and measured in terms of the percentage
seed germination and seedling growth (radicle and plumule lengths) of selected crops, native and
invasive plants in Brunei Darussalam. In the preliminary study, the selected target species included
two native shrubs; Melastoma malabathricum and Rhodomyrtus tomentosa, two invasive plants;
Acacia mangium and A. auriculiformis, and two Oryza sativa (rice paddy) varieties; ‘Laila’ and
‘Pusu’. Different concentrations of aqueaous extracts of A. auriculiformis were prepared by soaking
different amount of phyllodes in distilled water for five days. The seeds of the target species were
germinated in sterile petri dishes for 30 days, except for R. tomentosa (60 days) in seed germination
chamber at 35oC/25°C (day/night) over a 12-h photoperiod. In comparison to the control treatment
(using distilled water), increasing phyllode leachates concentrations of A. auriculiformis decreased
percentage germination, germination time and seedling growth of M. malabathricum and R.
tomentosa but not both Acacias. No results for rice seeds yet, as experiments are still ongoing. This
study provides information on the negative allelopathic effects of invasive Acacia on native plants.
Currently, the study is extended to investigate the allelopathic effects of these aqueous extracts on the
seedlings growth and physiology of the selected plants.
Keywords: Acacia auriculiformis, allelopathy, aqueous extract, seed germination, seedling growth.
P-098
The future prospect of the use of rattan as food resources
in Central Kalimantan
Rattan plays an important role in the culture of the Dayak communities living near forest areas,,
because their rattan as food resources . Young rattan shoot is cooked as a vegetable to make a dish
"sayur umbut rotan". Stir-fried young rattan shoot cuisine is served at Dayak traditional ceremonies.
The aims of this study is to identify and inventory rattan species used in Dayak food. The study was
carried out at the villages of Katunjung and Kalumpang, Sei Ahaz, Katimpun, Mantangai Hulu,
Kapuas by interviewing local community, making field observation and sample collection of rattan
herbarium. The study recorded eight species of rattan use in Dayak food i.e. Calamus caesius, C.
trachycoleus, C. ornatus, Daemonorops crinitus, D. angustifolia, dan Plectocomiopsis geminiflora.
To prepare this beneficial utilization, it is recommended that these eight rattan species are cultivated
in their garden.
Keywords: Rattan plant, traditional food, local communities.
P-099
The botany economy of the dusun people in Tikolod village, Tambunan
district, Sabah, Malaysia.
Kulip, J.
Senior Lecturer. Institute for Tropical Biology and Conservation, Universiti Malaysia Sabah, Malaysia.
e-mail: julkulip@ums.edu.my
The ethnobotanical studies of the Dusun people in Tikolod village, Tambunan district, Sabah,
Malaysia were conducted in July 25-30th, 2011 and in March 9-10, 2012. The result shows that there
were160 species in 62 families of plants used. Among them, there were 83 speciesof vegetable plants
(in 36 families), 75 species were medicines (in 44 families), 12 species (in 9 families) were used for
constructions and handicraft and eight species (in 6 families)were for musical instruments and animal
traps. There were 24 species of plants which have two or more uses. About 87 species or 54% of them
were native or from the natural forest nearby and 73 species or 45% of these plants were exotic
(introduced plants). The most commonly usedplant families were from Poaceae (Gramineae) with
fourteen species followed by Moraceae and Zingiberaceae with eight species each and Arecaceae
(Palmae), Cucurbitaceae, Euphorbiaceae, Rutaceae and Solanaceae with seven species each.
Keywords: Ethnobotany, Dusun, Tambunan, Sabah, Malaysia.
P-100
Ethnobotany of Tacca leontopetaloides (L.) O. Kuntze as a food in
Belitung and Bangka Islands, Bangka Belitung Province, Indonesia
Susiarti, S.
Botany Division, Research Centre for Biology, Indonesian Institute of Sciences
e-mail:susi.etno@yahoo.com
Ethnobotanical study of Tacca leontopetaloides was conducted on Bangka Belitung Province using
open-ended interview methods, field observations, purposive sampling. Tacca leontopetaloides very
little known and utilized by the local people in certain areas in Bangka Belitung Province, namely in
Membalong and Simpang Pesak district. The plant has different local names in each region, such as in
Belitung island known as "nubong" and "genubong", while in Bangka island, known as "keladi
kecubung" but not known as food plant. In Belitung island, local people utilized tuber of the species
to extract the flour in certain process. The tuber flour as a substitute for wheat flour used as an
ingredient in the form of snacks, for example: cakes “rintak” and “chips”. “Rintak cake” is celebrate
cake after fasting month. In the research locations, the species commonly grown in wild near the
beach, also pick up from the small islands in surrounding.
Keywords: Ethnobotany, Tacca leontopetaloides, Food, Flour, Bangka Belitung Province.
P-101
Ethnobotanical study of Brangkuah community in Moyo Island,
West Nusa Tenggara
An ethonobotanical study at Moyo Island, West Nusa Tenggara has been carried out to record the
traditional knowledge and utilization of plant based on their traditional knowledge. It is expected that
the traditional knowledge can play a role on the natural resource management system which can be
used on conservation program. This research was conducted with observational methods in the Moyo
forest and interviews with local people that has knowledge about utilization of plants. Based on this
study it was recorded that there are 45 species used by Brangkuah cummmunity at Moyo Island, most
of them are collecting from the forest, only food plant 37,5% (18 species) are cultivated. Beside as
food, the local people also used plant for medicine 41,7% (20 Species) and building material 12,5%
(7 species). The Brangkuah has started to cultivate several plants which used as building materiasl and
food plants although they have been collected from the forest before. It can be concluded that
Brangkuah community has conserved the useful plants for their daily life and also to protect
harvesting from the wild. So it is expected that the flora will be sustained in the forest..
Keywords: Ethnobotany,Burangkuah, Moyo Island, West Nusa Tengggara.
P-102
Useful plants diversity in Alas Purwo National Park (APNP)
A research was conducted in Alas Purwo National Park (APNP), East Java to collect and document
useful plants used by local people. 147 plant species distributed in 51 families were collected. Of the
total plant species 52 % were trees, 17 % shrubs, 4 % palms, 24 % herbs, and 2 % ferns. Several
species are categorized as endangered species (Alstonia scholaris (L.) R. Br., Arcangelisia flava (L.)
Merr., Merremia mammosa (Lour.) Hallier f., Parkia roxburghii G.Don, Piper retrofractum Vahl).
Among the species collected, 101 species were used by local people including 98 of medicinal plant.
Some of commonly used medicinal plants were Blumea lacera (Burm.f.) DC., Elephantopus scaber L.,
Gmelina elliptica Sm, Harrisonia perforata (Blanco) Merr., Mallotus paniculatus (Lam.) Müll.Arg,
and Parkia roxburghii G. Don. 9 different plant parts were used separately or combined together by
local people. The medicinal plants were mainly used for treatment of stomachache, diarrhea, skin
diseases and wounds. After combination with previous data total 537 plant species have been
documented from APNP for the first time.
Keywords: Alas Purwo National Park, useful plant, local people.
P-103
The use of plants from the Moraceae & Urticaceae traditional medicine
Utomo, D.I.S. 1; Juniarti, F. *1; Nizar1, Paik, J.H.2, Arifin, S.D.2; Malik, C. 2;
Pitopang2, & Rahmadanil3;
1
CJRBIB, Korea Research Institute of Bioscience and Biotechnology (KRIBB), Republic of Korea
2
Badan PengkajiandanPenerapanTeknologi (BPPT), Indonesia
3
Faculty of Mathematics and Natural Sciences, University of Tadulako, Indonesia
*e-mail: fifit.juniarti@bppt.go.id/ juniarti17@yahoo.com
Moraceae and Urticaceae are widely distributed in tropical areas, including Indonesia. Many species
from these families were used as medicine, food crops, vegetables, ornamental plants, edible fruits,
forages, spices, fibre, and timber. This study study was conducted to record the use of these families
as traditional medicine. Field surveys were carried out by interviewing the tribals, i.e. Sando, elderly
people, and herbal healers in West Java, Central java, East Java and Central Sulawesi. Some members
of Moraceae and Urticaceae were used to treat headache, ulcer, stomachache, skin care, diarrhea,
dysentery, tuberculosis, post-natal care, liver disease, cancer, cataract, breast tumor, and wounds.
Keywords: Moraceae, Urticaceae, traditional medicine
P-104
Useful plants diversity in Pakuli and Toro village, near Lore Lindu
National Park, Central Sulawesi
A research was conducted in Toro and Pakuli village, near Lore Lindu National Park, Center of
Sulawesi to collect and document useful plants used by local people. In Pakuli village 178 plant
species were collected and documented. Most of them were traditionally used to cure 71 ailments. The
main ailments were cancer, head ache, influenza and wound. In Toro 219 species were found and
recorded. 75 medicinal plants species were used to heal 33 ailments. The most common ailments were
wound and fever.
Keywords: Pakuli village, Toro village, Lore Lindu National Park, useful plants.
P-105
The traditional medicinal uses of the
Euphorbiaceae & Phyllanthaceae families
Euphorbiaceae, the Spurge family, is a large family of flowering plants consisting of a wide variety of
vegetative forms, composed of over 300 genera and 8,000 species. Phyllanthaceae are a
morphologically diverse pantropical family of about 2000 species in c. 60 genera, which has been
segregated from the Euphorbiaceae sensu lato (s.l.) along with Pandaceae, Picrodendraceae, and
Putranjivaceae, following recent molecular work. Field survey information was gathered by making
repeated queries time to time through interviewing the tribals, i.e. Sando, elderly people, and herbal
healer. The field survey took place in Java (Halimun and Salak National Park, Gede Pangrango
National Park, Ujung Kulon National Park, Alas Purwo National Park, Pangandaran National
Preserve, Slamet Mount National Preserve, Baluran National Park, Meru Betiri National Park) and
Central Sulawesi (Lore Lindu National Park). Euphorbiaceae and Phyllanthaceae are used as
traditional medicine for wound, headache, antiviral, fever, cancer, antimicrobial, thyroid, appendicitis,
itch, hair lice, malaria, ear ache, fracture, eye cleaner, etc.
Keywords: Euphorbiaceae, Phyllanthaceae, traditional medicine.
P-106
Potency and distribution of Tacca leontopetaloides as a local food
ingredient for wheat flour substitute in Southern Garut,
West Java, Indonesia
In Indonesia, local food from the various types of tubers are not considered in proportion as the
carbohydrate source that can replace rice or wheat flour. Therefore , government started to re-
program nationally the development and utilization of tubers as food after the monetary crisis which
affected on the food crisis occurring in the year 1997/1998. Ethnobotany research on potency and
distribution of Tacca leontopetaloides as local food substitute for wheat flour in South Garut was
done by June 2012. The method of this study was survey. Primary data was collected by direct
observation in the field and interview with local communities. The field data was collected by random
at 9 villages of 2 subdistricts (Pameungpeuk and Cikelet) of Garut Regency, West Java. Secondary
data was collected by literature study in the library and internet. The results showed that
Pameungpeuk and Cikelet Subdistricts are the distribution area of Tacca leontopetaloides, especially
at Cikelet subdistrict . Distribution of Tacca leontopetaloides was at 6 - 10 m altitude, ambient
temperature of 30-32 °C (shady place) and 34 °C (open area), and relative humidity of 57-73 %. At
Cikelet Subdistrict, local people use the starch of Tacca leontopetaloides tuber for producing various
food supplement to substitute wheat flour. The result of this research is expected to contribute in
taking policy in the framework of development and conservation of a local plant for supporting of
food sovereignty of local people.
Keywords: Tacca leontopetaloides, distribution, potency, local food resources, West Java.
P-107
Wawonii island is one of the small island located in Shout East Sulawesi, with an area of 650 km2.
Exploration and inventory activities in eight locations (Wawolaa, Langsilowo, Lampeapi,
Wungkolo, Bobolio, Munse, Waworete, Dompo-Dompo) have been carried out. Approximately 980
species (belongs to 137 families and 559 genera) included fern and cultivated plant have been
identified and then evaluated to their taxonomical status and its distributions. Fifty three species of
them were new record for Sulawesi, 10 species need more taxonomical studied, nine species as
endemic in Sulawesi. The distribution pattern of those species indicated that, only 3 % were common
found in the whole areas, and more than 50 % distributed only in certain location. The richest
species diversity occur in Lampeapi followed Waworete, Wawola, Munse, Wungkolo, Lansilowo,
Bobolio and Dompo-Dompo Jaya, with 417, 302, 230, 206, 197, 179, 165, and 116 species
respectively. From etnobotanical point of view, more than 150 species recorded have important
value for many purposes such: food, traditional medicine, spice, cosmetic, mat materials, etc.
Keywords: plant diversity, economic potential, Wawonii island, S.E. Sulawesi.
P-108
Medicinal plants used by the Atinggola Healers, North Gorontalo,
Sulawesi, Indonesia
Kandowangko, N.Y.*1, Lamangantjo, C.J.1, Hasan, H.2, Adam, R.3, Yunus, R.4, Angio, M.1,
Tampilang, E.1, & Pomanto, H.1
1
)Jurusan Biologi Fakultas MIPA Universitas Negeri Gorontalo,
2)
Jurusan Farmasi, Fakultas Ilmu Kesehatan, Universitas Negeri Gorontalo
3
) Dinas Kesehatan, Kabupaten Gorontalo Utara, Provinsi Gorontalo
4)
Jurusan Sejarah, Fakultas Ilmu Sosial, Universitas Negeri Gorontalo
*e-mail : novri1968@gmail.com
The present study was done to determine the medicinal plants used by traditional healers of the
Atinggola Community who lives in the North Gorontalo, Gorontalo, Sulawesi. Data has been
collected by survey method, and analyzed using the descriptive qualitative method. Based on this
study, it was shown that there were 42 species (25 families) medicinal plants that can be used to cure
some diseases by the healers, comprising: 13 species used to cure fever, 2 species to treat toothache, 2
species to treat malaria, 6 species for the treatment of urinary stone disease, 3 species to treat
gastrointestinal diseases, 2 species to treat liver disease, 1 species to treat tonsillitis, 1 species for
treating cancer, 1 species for treating allergies, 2 species to treat skin diseases (ulcers), 2 species to
treat cough, 1 species to treat eye irritation, 1 to treat wound infections, 2 species of thrush, 2 species
to restore power, 1 species of snake poison antidote. For example, to treat fever disease, sarampah
used Jatropha curcas L., Averrhoa carambola L , Averrhoa bilimbi L., Zingiber purpureum Roxb.,
Euodia redlevi., Flueggea leucopyrus. On the other hand, to treat toothaches use Acalypha indica
and Hyptis capitata. Furthermore Imperata cylindrica and Centella asiatica was used for the urinary
stone disease treatment. Physalis peruvianawas also used for treating diabetes. Unidentified species of
Cyperaceae called diata in local name, was used to cure cancer. This medicinal plants were mostly
used by boiling, squeeze, and scrape to thepart where it will be cured. Most of those species used for
medicinal plant are still collected from the forest (23 species, 54,76%) and 19 species (45,24%)
collected from cultivated plant. To preserve those species collected sustainably, it is necessary to
propagate the species which is harvested from the forest.
Keywords: medicinal plant, Atinggola community.
P-109
The utilization of ‘sapupadang’ Baeckea frutescens L. locally
in Bangka-Belitung Islands
Fakhrurrozi, Y.
Dept. of Biology, Fac. of Agricultur, Fishery & Biology, Univ. of Bangka Belitung
e-mail: yulianfakhrurrozi@yahoo.com
This purpose of the present study is to record the recent utilization of ‘sapupadang’, Baeckea
frutescens, at Bangka Belitung Islands. The study/observation took place at a forest, people’s
resident and traditional market. The interviews are done to the broom maker, seller,
traditional healer, and the elder people in the villages. It is know that there are four groups
utilization of ‘sapupadang’ in Bangka Belitung Islands. The main uses for fuel wood,
household appliances, ornamental plant and traditional medicine. The most common
utilization are household appliances (garden broom) and ornamental plant (bonsai). There are
changes on the land cover which have been used as plantation, mining, housing and industry
recently. This action make the sapupadang habitat as well as the utilization of this plant
become declining. The utilization of ‘sapupadang’ declines on their frequency as well as
their quantity. The development are needed in the future so that the preservation of its habitat
could be maintained as well as the preservation of its utilization can be benefit for the local
people.
Keywords: Baeckea frutescens L., utilization, local people, Bangka-Belitung Islands
MISCELLANEOUS
FIRST FLOOR
SECOND FLOOR
Angkot
Route Places passed by ANGKOT
Number
CIPINANG GADING –
01 CIPAKU – MERDEKA Train Station, Royal Hotel, Sahira Hotel
PP
SUKASARI –
Train Station, Main Gate Bogor Botanic Gardens, Hotel
02 TERMINAL BUBULAK
Sahira, Hotel Royal
PP
CIPARIGI –
Wisma Sudirman, Efita Hotel, Wisma Bogor Permai,
07 TERMINAL
Salak Hotel, Mirah Sartika Hotel
MERDEKA PP
Angkot
Route Places passed by ANGKOT
Number
PASAR ANYAR –
07A Wisma Sudirman, Efita Hotel, Wisma Bogor Permai
PONDOK RUMPUT PP
BANTAR KEMANG –
Train Station, Main Gate of Bogor Botanic Gardens, Hotel
10 SUKASARI –
Sahira, Hotel Royal
MERDEKA PP
PAJAJARAN INDAH –
11 Amarossa Hotel, Hotel Ririn, Bus Station
PASAR BOGOR PP
CIMANGGU – PASAR Train Station, Efita Hotel, Wisma Bogor Permai, Wisma
12
ANYAR PP Sudirman
PASAR ANYAR –
16 Efita Hotel, Wisma Bogor Permai, Wisma Sudirman.
SELABENDA PP
Another public transportation which will take you from Bogor to another district such as to Cibinong
(where the Herbarium Bogoriense is) is a small bus. There are two bus routes which will go to
Herbarium Bogoriense in Cibinong from Bogor, i.e.:
Route Bogor-Depok
Route Bogor-Kampung Rambutan
You can always take a taxi from your Hotels to go anywhere you need.
BANKING INFORMATION
To exchange your money to Indonesian Rupiah (IDR) you may go to money changers and any banks.
Below is list of Money Changers and Banks nearby the Symposium Venue
No. Name
BOGOR MAP
LIST OF PARTICIPANS
Anthony Lamb - -
AUTHOR INDEX