ISTA Rules 2018

International Rules for Seed Testing, Full Issue i–19-8 (298)
https://doi.org/10.15258/istarules.2018.F
International Rules for

Seed Testing
2018
Introduction to the ISTA Rules

Chapters 1–19
Including changes and editorial corrections adopted at the

Ordinary General Meeting 2017, Denver, USA
Effective from 1 January 2018

International Rules for Seed Testing
Note on the use of the translations
The electronic version of the International Rules for Seed Testing includes the English,
French and German versions. If there are any questions on interpretation of the ISTA
Rules, the English version is the definitive version.
Published by
The International Seed Testing Association (ISTA)
Zürichstr. 50, CH-8303 Bassersdorf, Switzerland
©2018 International Seed Testing Association (ISTA)
Online ISSN 2310-3655
All rights reserved. No part of this publication may be reproduced, stored in any retrieval
system or transmitted in any form or by any means, electronic, mechanical, photocopying,
recording or otherwise, without prior permission in writing from ISTA.

ii Effective 1 January 2018

International Rules for Seed Testing Contents
Contents
Preface to the 2018 Edition of the ISTA Rules ............... xiii 1.5.2.15 Weighed replicates ..................................... 1-9
1.5.2.16 X-ray test ................................................... 1-9
Introduction to the ISTA Rules ....................................... I-1 1.5.2.17 Seed vigour test ........................................ 1-9
I-1 General information .................................................. I-1 1.5.2.17.1 Conductivity test ................................. 1-9
I-2 Guidelines for ISTA Rules proposals ........................ I-2 1.5.2.17.2 Accelerated ageing test ...................... 1-10
I-2.1 Proposals concerning test methods .................... I-2 1.5.2.17.3 Controlled deterioration test .............. 1-10
I-2.2 Proposals for new species ................................. I-2 1.5.2.17.4 Radicle emergence test ...................... 1-10
I-2.3 Other proposals ................................................. I-3 1.5.2.17.5 Tetrazolium vigour test ...................... 1-10
Thousand-seed weight of small-seeded varieties 1.5.2.18 Size and grading of seeds ........................ 1-10
of Poa pratensis .................................................. I-3 1.5.2.19 Weighted average test for seed lots
Form 1: Proposal for inclusion of new species in the transported loose in bulk containers ................... 1-10
ISTA Rules .................................................................. I-4 1.5.2.20 Seed mixtures .......................................... 1-11
1.5.2.20.1 Purity and component analysis .......... 1-11
Chapter 1: ISTA Certificates ........................................... 1-1 1.5.2.20.2 Determination of other seeds by
1.1 Object ....................................................................... 1-1 number ........................................................... 1-11
1.2 Definitions ................................................................ 1-1 1.5.2.20.3 Germination, seed viability, seed
1.2.1 Orange International Seed Lot Certificate ......... 1-1 vigour and other tests using replicates of 100
1.2.2 Blue International Seed Sample Certificate ....... 1-1 seeds ................................................................ 1-11
1.2.3 Original certificate .............................................. 1-1 1.5.2.20.4 Weight determination ........................ 1-11
1.2.4 Duplicate certificate ........................................... 1-1 1.5.2.21 Genetically modified organisms .............. 1-11
1.2.5 Provisional certificate ......................................... 1-1 1.5.2.21.1 Qualitative test results ....................... 1-12
1.2.6 Accredited laboratory ......................................... 1-1 1.5.2.21.2 Quantitative results obtained by
1.3 Conditions for issuance of ISTA Certificates ........... 1-2 multiple qualitative tests of individuals or
1.4 Completing ISTA Certificates ................................... 1-3 groups of seeds or seedlings .......................... 1-12
1.4.1 General ............................................................... 1-3 1.5.2.21.3 Quantitative measurements of GMO
1.4.2 Orange International Seed Lot Certificate ......... 1-3 in bulk samples .............................................. 1-12
1.4.3 Blue International Seed Sample Certificate ....... 1-3 1.5.2.22 Reporting of results of tests not covered
1.4.4 Duplicate certificate ........................................... 1-4 by the Rules ........................................................ 1-12
1.4.5 Provisional certificate ......................................... 1-4 1.5.3 Reporting of uncertainty of measurement on
1.5 Reporting results ....................................................... 1-4 ISTA Certificates .................................................... 1-12
1.5.1 Sampling and testing .......................................... 1-4 1.5.4 Statement referring to compliance with
1.5.2 Certificates ......................................................... 1-4 legislative requirements ......................................... 1-12
1.5.2.1 Sampling: heterogeneity testing for seed 1.6 Validity of ISTA Certificates ................................... 1-13
lots in multiple containers .................................... 1-4 1.7 Disputed results ...................................................... 1-13
1.5.2.1.1 The H value heterogeneity test .............. 1-4
1.5.2.1.2 The R value heterogeneity test .............. 1-4 Chapter 2: Sampling ....................................................... 2-1
1.5.2.2 Purity ........................................................... 1-4 2.1 Object ....................................................................... 2-1
1.5.2.3 Purity tests on coated seeds ......................... 1-5 2.2 Definitions ................................................................ 2-1
1.5.2.4 Determination of other seeds by number ..... 1-5 2.2.1 Seed lot ............................................................... 2-1
1.5.2.5 Determination of other seeds by number 2.2.2 Sublot ................................................................. 2-1
on coated seeds ..................................................... 1-6 2.2.3 Primary sample .................................................. 2-1
1.5.2.6 Germination ................................................. 1-6 2.2.4 Composite sample .............................................. 2-1
1.5.2.7 Germination of coated seeds ........................ 1-7 2.2.5 Subsample .......................................................... 2-1
1.5.2.8 Tetrazolium test ........................................... 1-7 2.2.6 Submitted sample ............................................... 2-1
1.5.2.9 Tetrazolium test on coated seeds ................. 1-7 2.2.7 Duplicate sample ................................................ 2-1
1.5.2.10 Seed health test .......................................... 1-8 2.2.8 Working sample ................................................. 2-1
1.5.2.11 Species and variety testing ......................... 1-8 2.2.9 Sealed ................................................................. 2-1
1.5.2.11.1 Results of examination of individual 2.2.10 Self-sealing containers ..................................... 2-1
seeds or seedlings .............................................. 1-8 2.2.11 Marked/labelled ................................................ 2-1
1.5.2.11.2 Results of a field plot examination ...... 1-8 2.2.12 Treated seed ..................................................... 2-2
Contents
1.5.2.12 Moisture content ........................................ 1-9 2.2.13 Coated seeds ..................................................... 2-2

1.5.2.13 Weight determination ................................. 1-9 2.2.14 Small seed lots ................................................. 2-2
1.5.2.14 Excised embryo ......................................... 1-9 2.3 General principles ..................................................... 2-2
Effective 1 January 2018 iii

Contents International Rules for Seed Testing
2.4 Apparatus .................................................................. 2-2 2.9.1.4 Use of Table 2D ......................................... 2-36

2.5 Procedures ............................................................... 2-2 2.9.1.5 Reporting results ........................................ 2-36
2.5.1 Procedures for sampling a seed lot .................... 2-2 2.9.2 The R value test ................................................ 2-36
2.5.1.1 Preparation of a seed lot and conditions 2.9.2.1 Definitions of terms and symbols .............. 2-36
for sampling ......................................................... 2-2 2.9.2.2 Sampling the lot ......................................... 2-36
2.5.1.2 Minimum sampling intensity ....................... 2-3 2.9.2.3 Testing procedure ....................................... 2-36
2.5.1.3 Taking primary samples ............................... 2-3 2.9.2.4 Use of tables .............................................. 2-37
2.5.1.4 Obtaining the composite sample .................. 2-5 2.9.2.5 Reporting results ........................................ 2-37
2.5.1.5 Obtaining the submitted sample .................. 2-5 2.9.3 Interpretation of results .................................... 2-37
2.5.1.6 Dispatch of the submitted sample ................ 2-5
2.5.1.7 Storage of submitted samples before Chapter 3: The purity analysis ........................................ 3-1
testing ................................................................... 2-5 3.1 Object ....................................................................... 3-1
2.5.2 Procedures for obtaining the submitted and 3.2 Definitions ................................................................ 3-1
working sample ........................................................ 2-5 3.2.1 Pure seed ............................................................ 3-1
2.5.2.1 Minimum size of working sample ............... 2-5 3.2.2 Other seeds ......................................................... 3-1
2.5.2.2 Sample reduction methods ........................... 2-5 3.2.3 Inert matter ......................................................... 3-1
2.5.2.2.1 Mechanical divider method ................... 2-6 3.3 General principles ..................................................... 3-2
2.5.2.2.2 Modified halving method ...................... 2-7 3.4 Apparatus .................................................................. 3-2
2.5.2.2.3 Spoon method ........................................ 2-7 3.4.1 Magnifiers, reflected light and sieves ................. 3-2
2.5.2.2.4 The hand halving method ...................... 2-7 3.4.2 Seed blowers ...................................................... 3-2
2.5.3 Storage of samples after testing ......................... 2-8 3.4.2.1 Calibration of the seed blower ..................... 3-3
2.5.4 Conditions for issuing Orange International 3.4.2.2 Determination of the equivalent air
Seed Lot Certificates ............................................... 2-8 velocity ................................................................. 3-3
2.5.4.1 Seed lot size ................................................ 2-8 3.4.2.3 Anemometer type ......................................... 3-3
2.5.4.2 Large seed lots of Poaceae ......................... 2-8 3.4.2.4 Calibration of the anemometer .................... 3-3
2.5.4.2.1 Definitions ............................................. 2-8 3.5 Procedure .................................................................. 3-3
2.5.4.2.2 Approval ................................................ 2-9 3.5.1 Working sample ................................................. 3-3
2.5.4.2.3 Check sampling and testing .................. 2-9 3.5.2 Separation .......................................................... 3-4
2.5.4.2.4 Withdrawal of approval ......................... 2-9 3.5.2.1 All families except Poaceae ....................... 3-4
2.5.4.2.5 Responsibility ........................................ 2-9 3.5.2.2 Poaceae ...................................................... 3-4
2.5.4.3 Marking/labelling and sealing of Caryopses ............................................................. 3-4
containers ............................................................. 2-9 Sterile florets ........................................................ 3-4
2.5.4.4 Sampling from the seed lot .......................... 2-9 3.5.2.3 Damaged seed .............................................. 3-4
2.5.4.5 Submitted sample ..................................... 2-11 3.5.2.4 Indistinguishable species ............................. 3-5
2.5.4.6 Sample reduction ...................................... 2-11 3.5.2.5 Poa pratensis, Poa trivialis and Dactylis
2.5.4.7 Storage of submitted samples after glomerata ............................................................ 3-5
testing ................................................................. 2-11 3.5.2.5.1 Separation of the heavy fraction ........... 3-5
2.6 Calculation and expression of results ..................... 2-11 3.5.2.5.2 Separation of the light fraction .............. 3-6
2.7 Reporting of results ................................................ 2-11 3.5.2.5.3 Alternative procedure for other Poa
2.8 Tables for lot size and sample sizes ........................ 2-12 spp. classified as other seed in Poa pratensis
Table 2A Part 1. Lot sizes and sample sizes: or Poa trivialis ................................................. 3-6
agricultural and vegetable seeds ..................... 2-13 3.5.2.5.4 Procedure for chemically treated
Table 2A Part 2. Lot sizes and sample sizes: seeds of species for which blowing is the
tree and shrub seeds ........................................ 2-20 prescribed method for the purity test ................ 3-6
Table 2A Part 3. Lot sizes and sample sizes: 3.5.2.6 Multiple seed units (MSU) .......................... 3-6
flower, spice, herb and medicinal species ....... 2-25 3.5.2.7 Procedure when individual impurities
Table 2B Part 1. Sample sizes (numbers of have an undue effect on results ............................ 3-6
seeds) for pelleted seeds, encrusted seed and 3.5.2.8 Attached appendages ................................... 3-6
seed granules ................................................... 2-33 3.5.2.9 Winged seed ................................................. 3-6
Table 2B Part 2. Sample sizes (number of 3.6 Calculation and expression of results ....................... 3-7
seeds) for seed tapes and mats ........................ 2-33 3.6.1 One whole working sample ............................... 3-7
2.9 Heterogeneity testing for seed lots in multiple 3.6.1.1 Test for weight gain or loss during
containers .................................................................. 2-34 analysis ................................................................. 3-7
3.6.1.2 Calculation of component percentages ........ 3-7
Contents
2.9.1 The H value test ............................................... 2-34

2.9.1.1 Definitions of terms and symbols .............. 2-34 3.6.1.3 Rounding procedure .................................... 3-7
2.9.1.2 Sampling the lot ......................................... 2-35 3.6.2 Two half working samples ................................. 3-7
2.9.1.3 Testing procedure ....................................... 2-35
iv Effective 1 January 2018

3.6.2.1 Test for weight gain or loss during 5.2.7.3 Secondary infection ..................................... 5-3
analysis ................................................................. 3-7 5.2.8 Abnormal seedlings ............................................ 5-3
3.6.2.2 Calculation of component percentages ........ 3-7 5.2.8.1 Seedling abnormalities ................................ 5-3
3.6.2.3 Test for variation between the two half 5.2.9 Multigerm seed units .......................................... 5-6
working samples ................................................... 3-7 5.2.10 Ungerminated seeds ......................................... 5-6
3.6.2.4 Rounding procedure .................................... 3-8 5.2.10.1 Hard seeds .................................................. 5-6
3.6.3 Two or more whole working samples ................ 3-8 5.2.10.2 Fresh seeds ................................................. 5-6
3.6.3.1 Procedure ..................................................... 3-8 5.2.10.3 Dead seeds ................................................. 5-6
3.6.3.2 Test for variation between samples .............. 3-8 5.2.10.4 Other categories ......................................... 5-6
3.6.3.3 Calculation and rounding procedure ............ 3-8 5.2.11 Additional definitions ....................................... 5-6
3.6.4 Calculation for species difficult to separate ....... 3-8 5.3 General principles ..................................................... 5-8
3.6.5 Calculation for individual impurities having 5.4 Growing media ......................................................... 5-8
an undue effect on results ........................................ 3-8 5.4.1 Definition ........................................................... 5-8
3.6.6 Chaffy seed structures ....................................... 3-9 5.4.2 Specifications ..................................................... 5-8
3.7 Reporting results ....................................................... 3-9 5.4.3 Growing media characteristics ........................... 5-8
3.8 Pure seed definitions ............................................... 3-10 5.4.3.1 Paper growing media ................................... 5-8
Table 3B Part 1. Pure seed definition numbers 5.4.3.2 Sand growing media .................................... 5-9
and chaffiness of seeds, listed by genus .......... 3-10 5.4.3.3 Organic growing media ............................... 5-9
Table 3B Part 2. Numbered pure seed 5.4.4 Water .................................................................. 5-9
definitions ........................................................ 3-15 5.4.4.1 General specifications .................................. 5-9
Table 3B Part 3. Glossary ................................... 3-22 5.4.5 Quality control ................................................... 5-9
3.9 Tolerance tables ...................................................... 3-24 5.5 Material and apparatus ............................................. 5-9
5.5.1 Containers .......................................................... 5-9
Chapter 4: Determination of other seeds by number ...... 4-1 5.5.2 Counting equipment ........................................... 5-9
4.1 Object ....................................................................... 4-1 5.5.2.1 Counting boards ........................................... 5-9
4.2 Definitions ................................................................ 4-1 5.5.2.2 Vacuum counters ........................................ 5-10
4.2.1 Other seeds ......................................................... 4-1 5.5.3 Germination apparatus ..................................... 5-10
4.2.2 Complete test ..................................................... 4-1 5.5.3.1 The bell jar or Jacobsen apparatus
4.2.3 Limited test ........................................................ 4-1 (Copenhagen tank) ............................................. 5-10
4.2.4 Reduced test ....................................................... 4-1 5.5.3.2 The germination incubator and the room
4.2.5 Reduced-limited test .......................................... 4-1 germinator .......................................................... 5-10
4.3 General principles ..................................................... 4-1 5.6 Procedure ................................................................ 5-10
4.4 Apparatus .................................................................. 4-1 5.6.1 Working sample ............................................... 5-10
4.5 Procedure .................................................................. 4-1 5.6.2 Test conditions ................................................. 5-11
4.5.1 Working sample ................................................. 4-1 5.6.2.1 Growing media .......................................... 5-11
4.5.2 Determination .................................................... 4-2 5.6.2.1.1 Methods using paper ........................... 5-11
4.5.3 Determination of Orobanche species ................. 4-2 5.6.2.1.2 Methods using sand or organic
4.5.3.1 Background .................................................. 4-2 growing media ................................................ 5-11
4.5.3.2 Submitted subsample ................................... 4-2 5.6.2.1.3 Methods using a combination of
4.5.3.3 Working sample ........................................... 4-2 paper and sand ................................................ 5-11
4.5.3.4 Visual analysis ............................................ 4-3 5.6.2.1.4 Soil ...................................................... 5-12
4.6 Calculation and expression of results ....................... 4-3 5.6.2.2 Moisture and aeration ................................ 5-12
4.7 Reporting results ....................................................... 4-3 5.6.2.3 Temperature ............................................... 5-12
4.8 Tolerance tables ........................................................ 4-4 5.6.2.4 Light ........................................................... 5-12
5.6.2.5 Choice of method ....................................... 5-12
Chapter 5: The germination test ..................................... 5-1 5.6.3 Procedures for promoting germination of
5.1 Object ....................................................................... 5-1 dormant seed .......................................................... 5-12
5.2 Definitions ................................................................ 5-1 5.6.3.1 Procedures for breaking physiological
5.2.1 Germination ....................................................... 5-1 dormancy ............................................................ 5-13
5.2.2 Double test ......................................................... 5-1 5.6.3.2 Procedures for removing
5.2.3 Parallel tests ....................................................... 5-1 hardseededness ................................................... 5-14
5.2.4 Germination percentage ..................................... 5-1 5.6.3.3 Procedures for removing inhibitory
5.2.5 Essential seedling structures .............................. 5-1 substances ........................................................... 5-14
5.2.6 The 50 % rule ..................................................... 5-1
Contents
5.6.3.4 Disinfection of the seed ............................. 5-14

5.2.7 Normal seedlings ............................................... 5-2 5.6.4 Duration of the test ........................................... 5-14
5.2.7.1 Intact seedlings ............................................ 5-2 5.6.5 Evaluation ........................................................ 5-15
5.2.7.2 Slight defects ............................................... 5-2 5.6.5.1 Seedlings .................................................... 5-15
Effective 1 January 2018 v

5.6.5.2 Multigerm seed units ................................. 5-15 7.2.3 Seed treatment .................................................... 7-1

5.6.5.3 Ungerminated seeds ................................... 5-15 7.2.4 ISTA Seed Health Method Validation
5.7 Retesting ................................................................. 5-15 Programme ............................................................... 7-1
5.8 Calculation and expression of results ..................... 5-16 7.3 General principles ..................................................... 7-1
5.8.1 Tolerances ........................................................ 5-16 7.4 Procedures ................................................................ 7-1
5.8.2 Rounding results .............................................. 5-17 7.4.1 Working sample ................................................. 7-1
5.9 Reporting results ..................................................... 5-17 7.4.2 Seed treatment .................................................... 7-2
5.10 Germination methods ........................................... 5-20 7.4.3 Sample storage ................................................... 7-2
Table 5A Part 1. Detailed methods for 7.4.4 Specific directions .............................................. 7-2
germination tests: agricultural and vegetable 7.5 Calculation and expression of results ....................... 7-2
seeds ................................................................ 5-21 7.6 Reporting results ....................................................... 7-2
Table 5A Part 2. Detailed methods for Table 7A. ISTA official seed health testing
germination tests: Tree and shrub seeds ......... 5-32 methods ............................................................. 7-3
Table 5A Part 3. Detailed methods for
germination tests: Flower, spice, herb and Chapter 8: Species and variety testing ........................... 8-1
medicinal species ............................................ 5-42 8.1 Object ....................................................................... 8-1
5.11 Tolerance tables .................................................... 5-53 8.2 Definitions ................................................................ 8-1
8.2.1 Authentic standard sample ................................. 8-1
Chapter 6: Biochemical test for viability: the 8.2.2 Standard reference .............................................. 8-1
topographical tetrazolium test ........................................ 6-1 8.2.3 Allele .................................................................. 8-1
6.1 Object ....................................................................... 6-1 8.2.4 Microsatellite ..................................................... 8-1
6.2 Definition .................................................................. 6-1 8.2.5 Semi-performance-based approach .................... 8-1
6.3 General principles ..................................................... 6-1 8.2.6 Allele profile ....................................................... 8-1
6.4 Reagent ..................................................................... 6-1 8.3 General principles ..................................................... 8-1
6.4.1 Tetrazolium solution ........................................... 6-1 8.3.1 Field of application ............................................ 8-1
6.4.2 Buffer solution .................................................... 6-2 8.3.2 Testing principles ............................................... 8-1
6.5 Procedures ................................................................ 6-2 8.3.3 Semi-performance-based approach for DNA-
6.5.1 Working sample ................................................. 6-2 based testing ............................................................ 8-2
6.5.2 Preparation and treatment of the seed ................ 6-2 8.4 Personnel and equipment .......................................... 8-2
6.5.2.1 Premoistening the seed ................................ 6-2 8.5 Procedures ................................................................ 8-2
6.5.2.1.1 Slow moistening .................................... 6-2 8.5.1 Submitted sample ............................................... 8-2
6.5.2.1.2 Soaking in water .................................... 6-2 8.5.2 Working sample ................................................. 8-2
6.5.2.2 Exposure of tissues prior to staining ............ 6-2 8.5.3 Examination of seeds ......................................... 8-3
6.5.2.2.1 Piercing the seed ................................... 6-3 8.5.4 Examination of seedlings ................................... 8-3
6.5.2.2.2 Longitudinal cutting .............................. 6-3 8.5.5 Examination of plants in glasshouse or
6.5.2.2.3 Transverse cutting ................................. 6-3 growth chamber ....................................................... 8-3
6.5.2.2.4 Transverse incision ................................ 6-3 8.5.6 Examination of plants in field plots ................... 8-3
6.5.2.2.5 Excision of the embryo ......................... 6-3 8.6 Calculation and expression of results ....................... 8-3
6.5.2.2.6 Removal of the seed coat ...................... 6-3 8.6.1 Examination of individual seeds, seedlings
6.5.2.3 Low pressure ................................................ 6-3 or plants ................................................................... 8-4
6.5.3 Staining .............................................................. 6-3 8.6.2 Tests for traits of bulk samples ........................... 8-4
6.5.4 Evaluation .......................................................... 6-4 8.7 Reporting results ....................................................... 8-4
6.6 Calculation, expression of results and tolerances ..... 6-4 8.7.1 Examination of individual seeds or seedlings .... 8-4
6.7 Reporting results ....................................................... 6-5 8.7.2 Field plot examinations ...................................... 8-4
6.8 Standard procedures for tetrazolium testing ............. 6-5 8.8 Conventional methods .............................................. 8-4
Table 6A Part 1. Standard procedures for 8.8.1 Cereals ................................................................ 8-4
tetrazolium testing: agricultural and 8.8.2 Fabaceae and Poaceae ..................................... 8-5
horticultural seeds ............................................. 6-6 8.9 Protein-based methods ............................................. 8-5
Table 6A Part 2. Standard procedures for 8.9.1 Hordeum (barley) ............................................... 8-5
tetrazolium testing: tree and shrub seeds ........ 6-14 8.9.1.1 Principle ....................................................... 8-5
6.9 Tolerance tables ...................................................... 6-25 8.9.1.2 Apparatus and equipment ............................ 8-5
8.9.1.2.1 Apparatus ............................................... 8-5
Chapter 7: Seed health testing ........................................ 7-1 8.9.1.2.2 Chemicals .............................................. 8-5
7.1 Object ....................................................................... 7-1 8.9.1.2.3 Solutions ................................................ 8-5
Contents
7.2 Definitions ................................................................ 7-1 8.9.1.3 Procedure ..................................................... 8-6

7.2.1 Seed health ......................................................... 7-1 8.9.1.3.1 Protein extraction .................................. 8-6
7.2.2 Pretreatment ....................................................... 7-1 8.9.1.3.2 Gel preparation ...................................... 8-6
vi Effective 1 January 2018

8.9.1.3.3 Electrophoresis ...................................... 8-6 8.9.6.5 Extraction ................................................... 8-17

8.9.1.3.4 Fixing and staining ................................ 8-6 8.9.6.5.1 Extraction (option 1) ........................... 8-17
8.9.1.4 Nomenclature of hordein bands ................... 8-6 8.9.6.5.2 Extraction (option 2) ........................... 8-17
8.9.2 Pisum and Lolium ............................................. 8-6 8.9.6.6 Gel preparation and buffer tank
8.9.2.1 Principle ....................................................... 8-6 solutions ............................................................. 8-17
8.9.2.2 Apparatus and equipment ............................ 8-7 8.9.6.6.1 Gel preparation (option 1) ................... 8-17
8.9.2.2.1 Apparatus ............................................... 8-7 8.9.6.6.2 Gel preparation (option 2) ................... 8-18
8.9.2.2.2 Chemicals .............................................. 8-7 8.9.6.7 Loading samples ........................................ 8-18
8.9.2.2.3 Solutions ................................................ 8-7 8.9.6.8 Electrophoresis .......................................... 8-18
8.9.2.3 Procedure ..................................................... 8-7 8.9.6.8.1 Electrophoresis (option 1) ................... 8-18
8.9.2.3.1 Pisum .................................................... 8-7 8.9.6.8.2 Electrophoresis (option 2) ................... 8-18
8.9.2.3.2 Lolium .................................................. 8-8 8.9.6.9 Fixing and staining .................................... 8-18
8.9.2.3.3 Gel preparation ...................................... 8-8 8.9.6.9.1 One-step fixing and staining
8.9.2.3.4 Electrophoresis ...................................... 8-9 (option 1) ......................................................... 8-18
8.9.2.3.5 Fixing and staining ................................ 8-9 8.9.6.9.2 One-step fixing and staining
8.9.2.4 Evaluation of results .................................... 8-9 (option 2) ......................................................... 8-19
8.9.3 Zea mays (maize) ............................................... 8-9 8.9.6.9.3 Two-step fixing and staining
8.9.3.1 Principle ....................................................... 8-9 (option 3) ......................................................... 8-19
8.9.3.2 Apparatus and equipment ............................ 8-9 8.9.6.10 Destaining ................................................ 8-19
8.9.3.2.1 Apparatus ............................................... 8-9 8.9.6.11 Storage of the gels ................................... 8-19
8.9.3.2.2 Chemicals .............................................. 8-9 8.9.7 Triticum and ×Triticosecale (wheat and
8.9.3.2.3 Solutions .............................................. 8-10 triticosecale) ........................................................... 8-19
8.9.3.3 Procedure ................................................... 8-10 8.9.7.1 Principle ..................................................... 8-19
8.9.3.3.1 Protein extraction ................................ 8-10 8.9.7.2 Equipment .................................................. 8-19
8.9.3.3.2 Gel preparation .................................... 8-10 8.9.7.3 Chemicals .................................................. 8-19
8.9.3.3.3 Electrophoresis .................................... 8-11 8.9.7.4 Sample preparation .................................... 8-19
8.9.3.3.4 Fixing and staining .............................. 8-11 8.9.7.5 Extraction ................................................... 8-20
8.9.3.4 Evaluation of results .................................. 8-11 8.9.7.5.1 Extraction buffer .................................. 8-20
8.9.4 Avena sativa (oats) ........................................... 8-13 8.9.7.5.2 Extraction procedure ........................... 8-20
8.9.4.1 Principle ..................................................... 8-13 8.9.7.6 Gel preparation .......................................... 8-20
8.9.4.2 Apparatus and equipment .......................... 8-13 8.9.7.6.1 Stacking gel ......................................... 8-20
8.9.4.2.1 Apparatus ............................................ 8-13 8.9.7.6.2 Resolving gel ....................................... 8-20
8.9.4.2.2 Chemicals ........................................... 8-13 8.9.7.6.3 Tank buffer .......................................... 8-20
8.9.4.2.3 Solutions .............................................. 8-13 8.9.7.7 Loading samples ........................................ 8-20
8.9.4.3 Procedure ................................................... 8-14 8.9.7.8 Electrophoresis .......................................... 8-20
8.9.4.3.1 Protein extraction ................................ 8-14 8.9.7.9 Fixing and staining .................................... 8-20
8.9.4.3.2 Gel preparation .................................... 8-14 8.9.7.10 Destaining ................................................ 8-21
8.9.4.3.3 Electrophoresis .................................... 8-14 8.9.7.11 Storage of the gels ................................... 8-21
8.9.4.3.4 Fixing and staining .............................. 8-14 8.10 DNA-based methods ............................................ 8-21
8.9.4.4 Nomenclature of avenin bands .................. 8-14 8.10.1 Principles of DNA-based methods ................. 8-21
8.9.5 Helianthus annuus (sunflower) ........................ 8-14 8.10.2 Triticum (wheat) ............................................. 8-21
8.9.5.1 Principle ..................................................... 8-14 8.10.2.1 Microsatellite markers ............................. 8-21
8.9.5.2 Apparatus and equipment .......................... 8-15 8.10.2.2 Recommended DNA extraction
8.9.5.2.1 Apparatus ............................................. 8-15 protocol .............................................................. 8-21
8.9.5.2.2 Chemicals ............................................ 8-15 8.10.2.3 Recommended PCR procedures .............. 8-22
8.9.5.2.3 Solutions .............................................. 8-15 8.10.2.3.1 Reaction components ........................ 8-23
8.9.5.3 Procedure ................................................... 8-15 8.10.2.3.2 Thermal cycling profile ..................... 8-23
8.9.5.3.1 Protein extraction ................................ 8-15 8.10.2.4 Evaluation of results ................................ 8-23
8.9.5.3.2 Gel preparation .................................... 8-15 8.10.3 Zea mays (maize) ........................................... 8-24
8.9.5.3.3 Electrophoresis .................................... 8-16 8.10.3.1 Microsatellite markers ............................. 8-24
8.9.5.3.4 Fixing and staining .............................. 8-16 8.10.3.2 Recommended DNA extraction
8.9.5.4 Evaluation of results .................................. 8-16 protocol .............................................................. 8-24
8.9.6 Triticum (wheat) ............................................... 8-17 8.10.3.3 Recommended PCR procedures .............. 8-24
Contents
8.9.6.1 Principle ..................................................... 8-17 8.10.3.3.1 Reaction components ........................ 8-24

8.9.6.2 Equipment .................................................. 8-17 8.10.3.3.2 Thermal cycling profile ..................... 8-25
8.9.6.3 Chemicals .................................................. 8-17 8.10.3.4 Evaluation of results ................................ 8-25
8.9.6.4 Sample preparation .................................... 8-17 8.11 Examination of seedlings ..................................... 8-25
Effective 1 January 2018 vii

8.11.1 Cereals ............................................................ 8-25 9.2.1.5.2 Calibration sample ................................ 9-9

8.11.2 Beta spp. ......................................................... 8-26 9.2.1.5.3 Working sample from calibration
8.11.4 Lolium spp. ..................................................... 8-26 sample ............................................................. 9-10
8.11.5 Festuca spp. .................................................... 8-26 9.2.1.5.4 Weighing ............................................. 9-10
8.12 Examination of plants in field plots ...................... 8-26 9.2.1.5.5 Prescribed methods ............................. 9-10
8.12.1 Cereals, legumes and oil plants ...................... 8-26 9.2.1.6 Calculation and expression of results ........ 9-10
8.12.2 Herbage plants ............................................... 8-27 9.2.1.6.1 Reference oven method ....................... 9-10
8.12.3 Root and other crops grown spaced in rows ... 8-27 9.2.1.6.2 Moisture meters ................................... 9-10
9.2.1.6.3 Maximum permissible differences ...... 9-10
Chapter 9: Determination of moisture content ............... 9-1 9.2.1.7 Calibration results ...................................... 9-11
9.0 Basic reference method for determination of 9.2.2 Determination of moisture content (moisture
moisture content .......................................................... 9-1 meters) ................................................................... 9-11
9.0.1 Test necessity for grinding ................................. 9-1 9.2.2.1 Object ......................................................... 9-11
9.0.2 Test for acceptance of the high-constant- 9.2.2.2 General principles ...................................... 9-11
temperature method ................................................. 9-1 9.2.2.3 Apparatus ................................................... 9-11
9.0.3 Test for acceptance of the low-constant- 9.2.2.4 Procedures ................................................. 9-11
temperature method ................................................. 9-1 9.2.2.4.1 Precautions .......................................... 9-11
9.1 Determination of moisture content by the 9.2.2.4.2 Working sample ................................... 9-11
constant-temperature oven method ............................ 9-1 9.2.2.4.3 Weighing ............................................. 9-11
9.1.1 Object ................................................................. 9-1 9.2.2.5 Calculation and expression of results ........ 9-11
9.1.2 Definition ........................................................... 9-1 9.2.2.6 Tolerances ................................................. 9-11
9.1.3 General principles .............................................. 9-1 9.2.2.7 Reporting of moisture meter results .......... 9-12
9.1.4 Apparatus ........................................................... 9-1 9.2.2.8 Routine checking of moisture meter and
9.1.4.1 Grinding mill ............................................... 9-2 oven moisture content results ............................. 9-12
9.1.4.2 Constant-temperature oven .......................... 9-2 9.2.2.9 Checking of results from different
9.1.4.3 Containers .................................................... 9-2 moisture meters ................................................. 9-12
9.1.4.4 Desiccator .................................................... 9-2
9.1.4.5 Balance ........................................................ 9-2 Chapter 10: Weight determination ................................ 10-1
9.1.4.6 Sieves ........................................................... 9-2 10.1 Object ................................................................... 10-1
9.1.4.7 Cutting tool ................................................. 9-2 10.2 Definition .............................................................. 10-1
9.1.5 Procedures .......................................................... 9-2 10.3 General principles ................................................. 10-1
9.1.5.1 General directions and precautions .............. 9-2 10.4 Apparatus .............................................................. 10-1
9.1.5.2 Working sample ........................................... 9-2 10.5 Procedure .............................................................. 10-1
9.1.5.3 Weighing ...................................................... 9-3 10.5.1 Working sample ............................................. 10-1
9.1.5.4 Grinding ....................................................... 9-3 10.5.2 Counting the entire working sample by
9.1.5.5 Cutting ......................................................... 9-3 machine .................................................................. 10-1
9.1.5.6 Predrying ..................................................... 9-3 10.5.3 Counting replicates ........................................ 10-1
9.1.5.7 Prescribed methods ...................................... 9-4 10.6 Calculation and expression of results ................... 10-2
Table 9A Part 1. Details of methods for 10.7 Reporting results ................................................... 10-2
moisture determination: agricultural and
vegetable seeds ................................................. 9-4 Chapter 11: Testing coated seeds .................................. 11-1
Table 9A Part 2. Details of methods for 11.1 Object ................................................................... 11-1
moisture determination: tree and shrub seeds ... 9-6 11.1.1 Definitions ...................................................... 11-1
9.1.6 Calculation and expression of results ................. 9-8 11.2 Sampling ............................................................... 11-1
9.1.6.1 Constant-temperature oven methods ........... 9-8 11.2.5 Procedures ...................................................... 11-1
9.1.6.2 Tolerances .................................................... 9-8 11.2.5.1 Procedures for sampling a seed lot .......... 11-1
9.1.7 Reporting of results ............................................ 9-8 11.2.5.1.2 Sampling intensity ............................. 11-1
9.2 Determination of moisture content by moisture 11.2.5.1.3–1.6 Drawing and disposal of
meters .......................................................................... 9-9 submitted sample ............................................ 11-1
9.2.1 Calibration of moisture meters ........................... 9-9 11.2.5.2 Procedure for obtaining the working
9.2.1.1 Object ........................................................... 9-9 sample ................................................................ 11-1
9.2.1.2 Definition ..................................................... 9-9 11.2.5.2.1 Minimum size of working sample ..... 11-2
9.2.1.3 General principles ........................................ 9-9 11.2.5.4 Conditions for issuing Orange
9.2.1.4 Apparatus ..................................................... 9-9 International Seed Lot Certificates ..................... 11-2
Contents
9.2.1.5 Procedures ................................................... 9-9 11.2.5.4.1 Seed lot size ....................................... 11-2

9.2.1.5.1 Precautions ............................................ 9-9 11.2.5.4.4 Submitted sample .............................. 11-2
viii Effective 1 January 2018

11.3 Purity analysis ...................................................... 11-2 Chapter 12: Excised embryo test for viability .............. 12-1
11.3.1 Object ............................................................. 11-2 12.1 Object ................................................................... 12-1
11.3.2 Definitions for pelleted seed ........................... 11-2 12.2 Definitions ............................................................ 12-1
11.3.2.1 Pure pellets ............................................... 11-2 12.3 General principles ................................................. 12-1
11.3.2.2 Unpelleted seed ........................................ 11-2 12.4 Apparatus .............................................................. 12-1
11.3.2.3 Inert matter ............................................... 11-3 12.5 Procedure .............................................................. 12-1
11.3.3 General principles .......................................... 11-3 12.5.1 Working sample ............................................. 12-1
11.3.4 Verification of species .................................... 11-3 12.5.2 Preparation .................................................... 12-1
11.3.5 Procedure ........................................................ 11-3 12.5.3 Soaking ......................................................... 12-1
11.3.5.1 Working sample ....................................... 11-3 12.5.4 Excision ......................................................... 12-1
11.3.5.2 Separation ................................................ 11-3 12.5.5 Incubation ..................................................... 12-2
11.3.5.3 Procedures for purity tests on depelleted 12.5.6 Evaluation ..................................................... 12-2
seeds and seeds removed from tapes .................. 11-3 12.6 Calculation and expression of results .................. 12-2
11.3.6 Calculation and expression of results ............. 11-4 12.7 Reporting results .................................................. 12-2
11.3.7 Reporting results ............................................ 11-4 12.8 Specific directions ................................................ 12-2
11.4 Determination of number of other seeds .............. 11-4 12.8.1 Acer spp. excluding A. negundo and A.
11.4.1 Object ............................................................. 11-4 palmatum .............................................................. 12-2
11.4.2 Definitions ...................................................... 11-4 12.8.2 Euonymus spp. .............................................. 12-2
11.4.3 General principles .......................................... 11-4 12.8.3 Fraxinus spp. ................................................. 12-2
11.4.5 Procedure ........................................................ 11-4 12.8.4 Malus spp. and Pyrus spp. ............................ 12-3
11.4.5.1 Working sample ....................................... 11-4 12.8.5 Pinus monticola, P. peuce and P. strobus ...... 12-3
11.4.5.2 Determination .......................................... 11-4 12.8.6 Pinus cembra, P. coulteri, P. heldreichii, P.
11.4.6 Calculation and expression of results ............. 11-5 jeffreyi, P. koraiensis and P. parviflora ................. 12-3
11.4.7 Reporting results ............................................ 11-5 12.8.7 Prunus spp. ................................................... 12-3
11.5 The germination test ............................................. 11-5 12.8.8 Pyrus spp.: see Malus spp. ............................ 12-3
11.5.1 Object ............................................................. 11-5 12.8.9 Sorbus spp. .................................................... 12-3
11.5.2 Definitions ...................................................... 11-5 12.8.10 Tilia spp. ...................................................... 12-3
11.5.3 General principles .......................................... 11-5
11.5.4 Growing media ............................................... 11-5 Chapter 13: Testing seeds by weighed replicates ......... 13-1
11.5.6 Procedure ........................................................ 11-5 13.1 Object ................................................................... 13-1
11.5.6.1 Working sample ....................................... 11-5 13.2 Definitions ............................................................ 13-1
11.5.6.2 Test conditions ......................................... 11-6 13.3 General principles ................................................. 13-1
11.5.6.2.2 Moisture and aeration ........................ 11-6 13.4 Apparatus .............................................................. 13-1
11.5.6.3 Special treatments for breaking 13.5 Procedure .............................................................. 13-1
dormancy ............................................................ 11-6 13.5.1 Submitted and working samples .................... 13-1
11.5.6.4 Duration of the test .................................. 11-6 13.5.2 Physical examination of the working
11.5.6.5 Evaluation ................................................ 11-6 sample .................................................................... 13-1
11.5.6.6 Multiple seed structures ........................... 11-6 13.5.3 Obtaining the weighed replicates ................... 13-2
11.5.7 Calculation and expression of results ............. 11-6 13.5.4 Germination tests ........................................... 13-2
11.5.8 Reporting results ............................................ 11-7 13.6 Calculation and expression of results ................... 13-2
11.6 The tetrazolium test .............................................. 11-7 13.7 Reporting results ................................................... 13-2
11.6.1 Object ............................................................. 11-7 13.8 Tables of germination methods for specific
11.6.2 Definitions ...................................................... 11-7 species ....................................................................... 13-2
11.6.3 General principles .......................................... 11-7 13.9 Tolerance tables .................................................... 13-4
11.6.4 Reagents ......................................................... 11-7
11.6.5 Procedure ........................................................ 11-7 Chapter 14: X-ray test .................................................. 14-1
11.6.6 Calculation, expression of results and 14.1 Object ................................................................... 14-1
tolerances ............................................................... 11-7 14.2 Definitions ............................................................ 14-1
11.6.7 Reporting results ............................................ 11-8 14.2.1 Radiograph ..................................................... 14-1
11.10 Weight determination and size grading of 14.2.2 X-rays ............................................................. 14-1
pelleted seed .............................................................. 11-8 14.3 General principles ................................................. 14-1
11.10.1 Object ........................................................... 11-8 14.4 Apparatus .............................................................. 14-2
11.10.2 Principles ...................................................... 11-8 14.5 Procedures ............................................................ 14-2
14.5.1 Loading the film, preparing the seed and
Contents
11.10.3 Apparatus ...................................................... 11-8
11.10.4–6 Procedure .................................................. 11-8 developing the image ............................................. 14-2
14.5.2 Evaluating the image ...................................... 14-2
14.6 Calculations and expression of results ................. 14-2
Effective 1 January 2018 ix

14.7 Reporting results ................................................... 14-2 15.8.2.8 Reporting results ...................................... 15-8

15.8.3 Controlled deterioration test for Brassica
Chapter 15: Seed vigour testing ................................... 15-1 spp. ......................................................................... 15-8
15.1 Object ................................................................... 15-1 15.8.3.1 Principle ................................................... 15-8
15.2 Definitions ............................................................ 15-1 15.8.3.2 Scope ....................................................... 15-8
15.2.1 Seed vigour .................................................... 15-1 15.8.3.3 Apparatus ................................................. 15-8
15.2.2 Seed vigour test .............................................. 15-1 15.8.3.4 Controlled deterioration procedure .......... 15-9
15.2.3 Acceptable germination .................................. 15-1 15.8.3.4.1 Raising and equilibration of seed
15.2.4 Additional definitions .................................... 15-1 moisture content .............................................. 15-9
15.3 General principles ................................................. 15-1 15.8.3.4.2 Deterioration of the seed ................. 15-10
15.4 Apparatus .............................................................. 15-2 15.8.3.4.3 Testing for response to
15.5 Procedures ............................................................ 15-2 deterioration .................................................. 15-10
15.5.1 Working sample ............................................. 15-2 15.8.3.5 Calculation and expression of results .... 15-10
15.5.2 General directions .......................................... 15-2 15.8.3.6 Reporting results .................................... 15-11
15.5.3 Test conditions ............................................... 15-2 15.8.4 Radicle emergence (RE) test ........................ 15-11
15.5.4 Control samples ............................................. 15-2 15.8.4.1 Principle ................................................. 15-11
15.6 Calculation and expression of results ................... 15-2 15.8.4.2 Scope .................................................... 15-11
15.7 Reporting of results .............................................. 15-2 15.8.4.3 Apparatus ............................................... 15-11
15.8 Detailed methods .................................................. 15-2 15.8.4.4 Radicle emergence test procedure ......... 15-12
15.8.1 Conductivity test ............................................ 15-2 15.8.4.4.1 Setting up the radicle emergence
15.8.1.1 Principle ................................................... 15-2 test ................................................................. 15-12
15.8.1.2 Scope and field of application ................. 15-3 15.8.4.4.2 Temperature for the test ................... 15-12
15.8.1.3 Apparatus ................................................ 15-3 15.8.4.4.3 Timing of radicle emergence
15.8.1.4 Preparation of the sample ........................ 15-3 counts ............................................................ 15-12
15.8.1.5 Checking equipment and materials .......... 15-4 15.8.4.5 Calculation and expression of results .... 15-12
15.8.1.5.1 Calibrating the dip cell ...................... 15-4 15.8.4.6 Reporting results .................................... 15-12
15.8.1.5.2 Checking the cleanliness of 15.8.5 Tetrazolium vigour test ................................ 15-13
equipment ........................................................ 15-4 15.8.5.1 Principle ................................................. 15-13
15.8.1.5.3 Checking the temperature ................. 15-4 15.8.5.2 Scope and field of application ............... 15-13
15.8.1.6 Conductivity measurement ...................... 15-4 15.8.5.3 Reagent .................................................. 15-13
15.8.1.6.1 Preparing the test samples ................. 15-4 15.8.5.4 Procedures ............................................. 15-13
15.8.1.6.2 Preparing the containers .................... 15-4 15.8.5.4.1 Working samples ............................. 15-13
15.8.1.6.3 Soaking the seeds .............................. 15-5 15.8.5.4.2 Preparation and treatment of the
15.8.1.6.4 Preparing for the conductivity seed ............................................................... 15-13
readings ........................................................... 15-5 15.8.5.4.3 Staining the seeds ............................ 15-13
15.8.1.6.5 Measuring the conductivity of the 15.8.5.4.4 Preparation of the seeds for
solution ............................................................ 15-5 evaluation ...................................................... 15-13
15.8.1.6.6 Accounting for the conductivity of 15.8.5.4.5 Evaluation ....................................... 15-13
the original water source ................................. 15-5 15.8.5.5 Calculation, expression of results and
15.8.1.7 Calculation and expression of results ...... 15-5 tolerances ......................................................... 15-16
15.8.1.8 Reporting results ...................................... 15-6 15.8.5.6 Reporting results .................................... 15-16
15.8.2 Accelerated ageing (AA) test for Glycine 15.9 Tolerance tables .................................................. 15-16
max ........................................................................ 15-6
15.8.2.1 Principle ................................................... 15-6 Chapter 16: Rules for size and grading of seeds .......... 16-1
15.8.2.2 Scope and field of application ................. 15-6 16.1 For Beta seeds and pelleted seeds ........................ 16-1
15.8.2.3 Apparatus ................................................. 15-6
15.8.2.4 Preparation of the sample ........................ 15-7 Chapter 17: Rules for the issue of Orange
15.8.2.5 Checking equipment and materials .......... 15-7 International Seed Lot Certificates on seed lots
15.8.2.5.1 Checking the temperature in the exceeding the maximum lot size prescribed in Table
ageing chamber ............................................... 15-7 2A being transported loose in bulk containers ............. 17-1
15.8.2.5.2 Cleanliness of equipment ................. 15-7 17.1 Object ................................................................... 17-1
15.8.2.6 Accelerated ageing procedure .................. 15-7 17.2 Field of application ............................................... 17-1
15.8.2.6.1 Preparing the plastic AA boxes and 17.3 Principle ................................................................ 17-1
seed sample ..................................................... 15-7 17.4 Procedure .............................................................. 17-1
Contents
15.8.2.6.2 Ageing the seed ................................. 15-7 17.5 Calculation and expression of results ................... 17-2

15.8.2.6.3 Testing for germination .................... 15-8 17.6 Reporting results ................................................... 17-2
15.8.2.7 Calculation and expression of results ...... 15-8 17.7 Species for which these rules apply ..................... 17-2
x Effective 1 January 2018

17.8 Tolerance tables .................................................... 17-2 19.5.2.3 Enzyme-linked immunosorbent assay ..... 19-6

19.5.3 Bioassays ....................................................... 19-6
Chapter 18: Seed mixture analysis ............................... 18-1 19.5.3.1 General principles of bioassays ............... 19-6
18.1 Object ................................................................... 18-1 19.5.3.2 Scoring of GMO presence ....................... 19-6
18.2 Definitions ............................................................ 18-1 19.6 Calculation and expression of results ................... 19-6
18.3 Sampling ............................................................... 18-1 19.6.1 Consideration of the testing objective ............ 19-6
18.3.1 Size of the submitted sample ......................... 18-1 19.6.2 Units of measurement .................................... 19-6
18.3.2 Sample reduction .......................................... 18-1 19.6.3 ISTA tools for calculation of results .............. 19-7
18.4 Purity and composition analysis ........................... 18-1 19.7 Reporting results ................................................... 19-7
18.4.1 Working sample ............................................. 18-2 19.7.1 Qualitative test results .................................... 19-7
18.4.2 Separation ...................................................... 18-2 19.7.2 Quantitative results obtained by multiple
18.5 Determination of other seeds by number ............. 18-2 qualitative tests of individuals or groups of seeds
18.6 Germination test, seed viability test, seed or seedlings ........................................................... 19-7
vigour test and other tests using replicates of 19.7.3 Quantitative measurements of GMO in bulk
100 seeds ................................................................ 18-2 samples ................................................................. 19-8
18.7 Weight determination ........................................... 18-2 19.8 References ......................................................... 19-8
18.8 Reporting results ................................................... 18-2
18.8.1 Purity and component analysis ...................... 18-2
18.8.2 Determination of other seeds by number ...... 18-3
18.8.3 Germination, seed viability, seed vigour
and other tests using replicates of 100 seeds ......... 18-3
18.8.4 Weight determination ..................................... 18-3
Chapter 19: Testing for seeds of genetically modified

organisms ...................................................................... 19-1
19.1 Object ................................................................... 19-1
19.2 Definitions ............................................................ 19-1
19.2.1 Adventitious presence .................................... 19-1
19.2.2 Analyte ........................................................... 19-1
19.2.3 Certified reference material ............................ 19-1
19.2.4 Genetically modified organism ...................... 19-1
19.2.5 GMO event ..................................................... 19-1
19.2.6 GMO trait ....................................................... 19-1
19.2.7 Limit of detection ........................................... 19-1
19.2.8 Limit of quantification ................................... 19-1
19.2.9 Performance-based approach ......................... 19-1
19.2.10 Proficiency test ............................................. 19-2
19.2.11 Seed bulk ...................................................... 19-2
19.2.12 Seed group ................................................... 19-2
19.2.13 Transgenic .................................................... 19-2
19.2.14 Reference material ....................................... 19-2
19.3 General principles ................................................. 19-2
19.4 Procedure .............................................................. 19-3
19.4.1 Sample size ................................................... 19-4
19.4.2 Personnel and equipment ............................... 19-4
19.4.3 Test conditions ............................................... 19-4
19.5 Testing approaches ............................................... 19-4
19.5.1 DNA-based methods ...................................... 19-4
19.5.1.1 General principles of DNA-based
testing ................................................................. 19-4
19.5.1.2 End-point qualitative PCR ....................... 19-5
19.5.1.3 Real-time PCR ......................................... 19-5
19.5.1.4 Other technologies .................................. 19-5
19.5.2 Protein-based methods ................................... 19-5
Contents
19.5.2.1 General principles of protein-based

testing ................................................................. 19-5
19.5.2.2 Lateral flow strip test .............................. 19-6
Effective 1 January 2018 xi

International Rules for Seed Testing Preface to the 2018 Edition of the ISTA Rules
Preface to the 2018 Edition of the ISTA Rules
Since 2014, the International Rules for Seed Testing (ISTA Details of changes
Rules) are primarily available in electronic form only. The
ISTA Rules can be downloaded as a complete PDF file or The 2018 changes are editorial corrections or Rules
as individual chapters from: changes adopted at the Ordinary General Meeting held at
http://www.ingentaconnect.com/content/ista/rules Denver, USA, in June 2017. Edits were made in Adobe
If required, users of the ISTA Rules can print their own InDesign by Vanessa Sutcliffe of HeartWood Editorial
copies. For further information on the ISTA Rules, see: (www.heartwoodeditorial.co.uk).
http://www.seedtest.org/rules The changes in the text content from the previous
The electronic version includes the English, French and edition of the ISTA Rules are listed below. They can be
German versions of the ISTA Rules. If there are any displayed as yellow highlighted text as a ‘layer’ within
questions on interpretation of the ISTA Rules, the English the electronic copy with comments on what has changed.
version is the definitive version. For the previous history of amendments to the ISTA
Rules, see the Prefaces for 2003 to 2017 on the ISTA web
site.
Seed health testing methods
Dr. Steve Jones, ISTA Rules Committee Chair
Previously, the seed health testing methods were published
as a separate Annexe to Chapter 7 of the ISTA Rules. They Ernest Allen, ISTA Rules Committee Vice-Chair
are now available as separate method sheets from the
ISTA web site at: ISTA Secretariat
http://www.seedtest.org/seedhealthmethods
Effective 1 January 2018 xiii

Preface to the 2018 Edition of the ISTA Rules International Rules for Seed Testing
Changes to the ISTA Rules for 2018

General editorial: Change to British English as a house Chapter 5
style, e.g., ‘authorization’ to ‘authorisation’ 5.2.7.2: Minimum number of secondary roots consid-
ered for Glycine max when primary root is defective
Introduction 5.6.4: Update to wording of conditions for extending
I-2: Clarification that external proposals need to be germination test duration; change in number of days
submitted by 1 November for tests in sand, organic growing media or soil
Table 5A Part 1: Brassica carinata A. Braun added
Chapter 1 Table 5F: Errors corrected in Germination Tolerance
1.4.2 o): Requirement for job position or ‘Author- table to make consistent with Tolerance and Confi-
ised signatory’ on the Orange International Seed Lot dence Interval Calculator for Germination Tests
Certificate
1.4.3 h): Requirement for job position or ‘Author- Chapter 7
ised signatory’ on the Blue International Seed Sample 7.2.3: Seed treatment link to 2.2.11 renumbered to
Certificate 2.2.12
1.5.2.2 and 1.5.2.4: Reporting of species impossible to Editorial modifications to ensure consistency in meth-
identify to species level must be done to the most pre- od structures
cise taxon possible Method 7-004: New version of method
1.5.2.2: Percentage of broken pure seed can be report- Method 7-015: Pathogen names updated according to
ed under ‘Other determinations’ information provided by Index Fungorum
1.5.2.20: Updates to reporting results for ‘Seed mix- Method 7-031: Addition of new method
tures’ made as a result of revision of Chapter 18 Method 7-032: Addition of new method
Chapter 2 Chapter 8
2.5.2.2: Simplification in the production of working 8.3.2: Wording of ‘Testing principles’ updated
samples under ‘Sample reduction methods’ 8.10.3: Addition of DNA-based method for variety
2.5.4.1 b): Deletion of last sentence in ‘Seed lot size’ verification in Zea mays
for consistency on Orange International Certificate
requirements
2.9.1.1 and 2.9.2.1: Number of seeds tested from each Chapter 11
independent container-sample reduced to 2 500 11.2.5.4.1: Removal of ‘encrusted seed’ in description
Table 2A Part 1: Brassica carinata A. Braun added; of maximum seed lot size; deletion of last sentence
Beta vulgaris L. divided to make provision for differ- for consistency on Orange International Certificate
ent sample sizes for multi- and mono-germ seed requirements
Chapter 3 Chapter 13

3.2.1: Clarification that seed partially transformed into 13.6: Update to wording for checking the reliability of
ergot bodies should be counted as ergot a test result, for consistency with Table 13C
3.5.1: Changes to procedure for preparing representa-
tive working samples in purity analysis Chapter 15
3.7: Reporting of species impossible to identify to 15.8.2.5.2: Revision of concentration of sodium hy-
species level must be done to the most precise taxon pochlorite solution used to clean equipment
possible
3.7: Percentage of broken pure seed can be reported Chapter 18
under ‘Other determinations’ Revision of entire Chapter with a clearer and more
logical structure, as proposed by the Bulking and Sam-
Chapter 4 pling Committee
4.7: Reporting of species impossible to identify to
species level must be done to the most precise taxon
possible
xiv Effective 1 January 2018

International Rules for Seed Testing Introduction to the ISTA Rules
I-1 General information Each of the 17 chapters on test methods includes sec-
tions on the Object (of the test), Definitions (of terms used
The International Seed Testing Association (ISTA) was in the chapter), General Principles (for the test), Apparatus
established in 1924 to work towards a vision of uniformity (required for the test), Procedure (how to conduct the test),
in seed testing internationally. ISTA’s current mission is to Calculation and Expression of Results (specific to each
develop, adapt and publish standard procedures for sam- test), Reporting Results (how to report results correctly
pling and testing seeds, and to promote uniform applica- on an ISTA Certificate), and Tolerances (statistical tables
tion of these procedures for evaluation of seeds moving in for use in determining whether test results are acceptable
international trade. The need for seed testing methods that or not acceptable). Note that where, to provide adequate
are reliable and reproducible among its accredited mem- guidance, it has been necessary in the Apparatus section
ber laboratories is therefore a basic need for ISTA. This to refer to a particular manufacturer’s piece of equipment,
is achieved through the publication of the International this should not be construed that ISTA endorses that piece
Rules for Seed Testing (hereafter ‘ISTA Rules’).The pri- of equipment in preference to, or to the exclusion of,
mary aim of the ISTA Rules is to provide testing methods equivalent products from other manufacturers.
for seeds designated for growing of crops or production of The ISTA Rules are designed for the principal crop
plants. In addition, most of the testing methods can also be species of the world. Species are broadly classified as ag-
applied for evaluation of the quality of seeds used as food ricultural and vegetable, tree and shrub, and flower, spice,
or for technical purposes. herb and medicinal. ISTA encourages proposals for the
ISTA’s seed sampling and testing methods have been addition of new species to the ISTA Rules.
developed by its members since its formation in 1924. ISTA Certificates can only be issued by ISTA accredit-
Methods have gone through appropriate validation studies ed laboratories. For seed quality test results to be reported
to ensure that test procedures give reliable and reproduc- on an ISTA Certificate, it is mandatory that all the require-
ible results. Following agreement between ISTA’s mem- ments of the ISTA Rules are strictly followed.
ber countries, the validated methods have been included ISTA also recommends that the ISTA Rules be used
in the ISTA Rules. by all seed testing laboratories (including non-ISTA mem-
Seed quality testing therefore requires test methods ber laboratories) when testing seed for trade transactions
and equipment that have been tested to ensure they are fit which do not require the use of an ISTA Certificate (e.g.
for purpose, i.e. validated. The ISTA Method Validation within a country), and for the enforcement of national
Programme (see Section I-2) provides the mechanism for laws for the control of seed quality.
the inclusion of test methods in the ISTA Rules. For further information on the ISTA Rules and their
Seed is a living biological product, and its behaviour use, please contact:
cannot be predicted with the certainty that characterises
the testing of inert or non-biological material. The test ISTA Secretariat
methods used must be based on scientific knowledge and Zürichstrasse 50
the accumulated experience of those working in seed test- CH-8303 Bassersdorf
ing and quality control. This expertise is provided largely Switzerland
by the members of ISTA’s Technical Committees. Phone +41 44 838 6000
The ISTA Rules contain 19 chapters, 17 of which pro- Fax +41 44 838 6001
vide internationally accepted test methods for various at-

tributes of seed quality. Chapter 2 (Sampling) provides or visit the ISTA website: www.seedtest.org
the required methods for sampling of seed lots, because
for ISTA, a direct connection between the seed lot from
which the sample was drawn and the results of quality
tests conducted on that seed lot must always be evident.
The ‘end product’ for an accredited ISTA laboratory fol-
lowing quality tests on a seed lot is an ISTA Certificate.
Information on how to use ISTA Certificates is presented
in Chapter 1.
Effective 1 January 2018 I-1

Introduction to the ISTA Rules International Rules for Seed Testing
I-2 Guidelines for ISTA Rules I-2.2 Proposals for new species
proposals
For a proposal to introduce a new species, Form 1 on pag-
Proposals to amend the ISTA Rules or to introduce new es 5–9 may be used.
species are welcomed from any source. ISTA operates The following information must be supplied by the
an open system, and proposals are not restricted to ISTA applicant:
members only. Any external proposal needs to have been
submitted to the ISTA Secretariat by 1 November. 1. Names of species. The scientific name (including
Following receipt, the ISTA Secretariat may send the author) plus common names and synonyms must be
proposal to the relevant ISTA Technical Committee or di- given. The common names will be used by the ISTA
rectly to the ISTA Rules Committee, which will review Nomenclature Committee to update the Multilingual
all the proposals received. The ISTA Executive Commit- Glossary of Common Plant Names. The ISTA Nomen-
tee will then either approve a proposal for consideration clature Committee will stabilise the scientific name for
by the ISTA membership or request further work on the at least six years so that laws and trade agreements do
proposal. All approved Rules proposals are then sent to not have to be altered frequently. For assistance in de-
the ISTA membership two months before the Ordinary termining the correct scientific name and its author, the
Meeting. At the Ordinary Meeting, the ISTA voting del- ISTA Nomenclature Committee may be contacted.
egates may vote to accept a proposal (which will then be
implemented in the ISTA Rules, effective 1 January of the 2. Maximum lot size and sample sizes. Proposals for
following year), to withdraw a proposal (for further con- maximum lot size should take into account the general
sideration), or to reject a proposal. principles that have been applied to species already in
the ISTA Rules and to the feasibility of achieving rea-
sonably homogenous seed lots. Seed size is generally
I-2.1 Proposals concerning test methods the significant factor in determining maximum lot size,
but this is also influenced by whether the species is
All seed quality test methods proposed for inclusion in for agriculture or horticulture use, a tree or shrub spe-
the ISTA Rules must have gone through the ISTA Method cies, or a flower, spice, herb or medicinal species. This,
Validation Programme. This is required for both new test in turn, will determine whether the species should be
methods (i.e. not currently in the ISTA Rules) and modifi- placed in Part 1, 2 or 3, respectively, of Table 2A. Pro-
cations to existing methods already included in the ISTA posals for maximum lot size and submitted sample
Rules. A four-step process is involved: size should then be based on those already to be found
1) method selection and development; in the corresponding part of Table 2A. For agricultural
2) validation through comparative testing; and horticultural species, the submitted sample is larg-
3) review of comparative test results and preparation of er in relation to the purity working sample, based on
a Method Validation Report; the weight of 2500 seeds, than for the other species,
4) approval of validation status by the relevant ISTA to allow for determination of other species by number
Technical Committee and preparation and of an ISTA based on 10 times the purity weight.
Rules proposal for the method.
3. Pure Seed Definition. The ISTA Rules and the Hand-
Final acceptance of the proposal by vote of the ISTA book of Pure Seed Definitions already list many pure
membership at an Ordinary Meeting will allow publica- seed definitions. The appropriate one should be given.
tion of the validated method in the ISTA Rules. If none of them apply, a proposal for a new definition
Further information on the ISTA Method Validation should be submitted.

Programme can be obtained from the ISTA Secretariat.
I-2 Effective 1 January 2018

4. Validated germination test methods. The methods I-2.3 Other proposals

proposed must have been validated, either by multi-
laboratory collaborative testing or peer validation (see Within a chapter of the ISTA Rules, a change to the exist-
ISTA Method Validation Programme). Advice as to ing text (e.g. amendment of a definition) or introduction
requirements can be obtained from the ISTA Germina- of new text (e.g. introduction of a new definition) may
tion Committee. Please specify the data as required for be proposed. Providing the proposal does not directly in-
insertion in Table 5A. volve a test method or new species, it should be sent di-
rectly to the ISTA Secretariat.
5. Validated tetrazolium test procedures. Procedures
for tetrazolium testing should be given if known. A
proposal to amend Chapter 6 may be submitted fol- Thousand-seed weight of small-seeded
lowing the appropriate method validation. varieties of Poa pratensis
6. Validated moisture content determination meth- Before a small-seeded variety can be included in Table
ods. A validated method for moisture determination 3A, a determination of the thousand-seed weight must be
must be provided if the method is different to the refer- performed on at least 20 samples from different seed lots,
ence (i.e. low-constant-temperature) method. representing seeds grown either in two different harvest
years or in two different countries.
7. Thousand-seed weight The determination of the thousand-seed weight must
be carried out on pure seeds, obtained by blowing a 1 g
8. Varietal identification. Using current techniques, it is sample of Poa pratensis using the standard blower setting
possible to verify a descriptor to check varietal purity (factor 1.00). Only seed remaining in the heavy fraction
in some species. Please indicate validated techniques. may be used for the thousand-seed weight. See Chapter 10
of the ISTA Rules for the weight determination procedure.
9. Seed health tests. The methods proposed must have Results should be submitted to the ISTA Purity Com-
been validated, either by multi-laboratory collabora- mittee with a request to change the ISTA Rules.
tive testing or peer validation (see ISTA Method Vali-
dation Programme). Advice as to requirements can be
obtained from the ISTA Seed Health Committee.

Form 1: Proposal for inclusion of new species in the ISTA Rules

Note: this form is also available on the ISTA web site (www.seedtest.org/mv-prog)
1. Scientific name of proposed species

(Family) Genus Species (Nominated Authority)
Genus and species names appear in List of Stabilised Plant Names: Yes/No
Known synonyms: _______________________________________________________
Common plant name: ________________________ in __________________________ (Member country)
(required for Multilingual Glossary)
2. Lot and sample weights
(Information as it should appear in Table 2A)
Species Maximum weight of Minimum submitted Minimum working samples (g)

lot (kg) sample (g)
Purity analysis Count of other species
(3.5.1) (4.5.1)
3. Pure Seed Definition
(Table 3B Part 1)
The following Pure Seed Definition (PSD) covers the proposed species:
Genus Family PSD number Chaffiness
No existing definition covers this species:

Distinguishing characteristics of this species:
(List distinguishing characteristics. Attach drawings, if available, and be prepared to send to the Secretariat
five seed samples from well-processed, as well as from incompletely cleaned, seed.)

4. Validated germination test method(s)
Species Prescriptions for: Additional directions incl. recommendations

for breaking dormancy
Substrate Temperature First count Final count
(°C) (d) (d)
5. Validated tetrazolium test procedure
Species Pretreatment: Preparation Staining Optimum Preparation Permitted non- Remarks

type/minimum before staining solution staining for evaluation viable tissue
time (h) (%) time (h)
(If no existing drawings apply, attach if available)
6. Validated moisture test methods
Specify appropriate methods or details for inclusion in Table 9A Part 1 or 2:
Species Grinding/cutting High Drying at high Predrying Remarks

(9.1.5.4, 9.1.5.5) temperature temperature (h) requirement
(9.1.5.6)
(Part 1) (Not applicable)
(Not (Not (Not

(Part 2)
applicable) applicable) applicable)

7. Thousand-seed weight = ___________ g
8. Validated varietal identification method (attach separate sheet, if necessary)
_____________________________________________________________________
Supporting evidence for proposal

9. Number of national seed analysis certificates issued per year:
___________
10. Other countries or laboratories testing the proposed species:
______________________________ ______________________________
______________________________ ______________________________
Submitted by:
Signature:
Date:

International Rules for Seed Testing Chapter 1: ISTA Certificates
Chapter 1: ISTA Certificates
1.1 Object 1.2.2 Blue International Seed Sample

Certificate
The object is to prescribe rules for the issue of ISTA Cer-
tificates for seed analysis. The completed certificates are A Blue International Seed Sample Certificate is issued
available only from accredited member laboratories of when sampling from the lot is not under the responsibil-
ISTA and must only be issued in accordance with the ISTA ity of an accredited laboratory. The accredited laboratory
Rules currently in force. is responsible only for testing the sample as submitted. It
is not responsible for the relationship between the sample
and any seed lot from which it may have been derived.
1.2 Definitions The certificate is coloured blue.
The results reported on a Blue International Seed Sam-
Blank ISTA Certificates for seed analysis are produced by ple Certificate refer strictly to the sample at the time of
ISTA, and only provided to accredited laboratories (see receipt.
1.2.6) for reporting the results of tests. These completed
certificates are the property of ISTA and may only be is-
sued under the authority of ISTA. 1.2.3 Original certificate
An original certificate is an ISTA Certificate issued after

1.2.1 Orange International Seed Lot the completion of a test or tests. It is marked ORIGINAL.
Certificate
An Orange International Seed Lot Certificate is issued 1.2.4 Duplicate certificate
when both sampling from the lot and testing of the sample
are carried out under the responsibility of an accredited A duplicate certificate is an exact printed copy, not a pho-
laboratory, or when sampling from the lot and testing of tocopy, of a completed original ISTA Certificate, marked
the sample are carried out under the authority of different DUPLICATE.
accredited laboratories. Where the accredited laboratory
carrying out the sampling is different to the one carrying
out the testing, this must be stated (see 1.4.2). The pro- 1.2.5 Provisional certificate
cedure followed links the Orange International Seed Lot
Certificate with the seed lot. The certificate is coloured A provisional certificate is an ISTA Certificate issued be-
orange. fore the completion of a test or tests. It is marked PRO-
An Orange International Seed Lot Certificate may also VISIONAL, and must include a statement under ‘Other
be issued, without further sampling or testing, for a por- determinations’ that a final original certificate will be
tion (sublot) of a seed lot which has been sampled and issued upon completion.
tested and for which an Orange International Seed Lot
Certificate has been issued. The certificate for the sublot
must carry the same test results as reported for the original 1.2.6 Accredited laboratory
seed lot.
The results reported on an Orange International Seed An accredited laboratory is an ISTA-accredited member
Lot Certificate refer strictly to the lot as a whole at the laboratory authorised by the ISTA Executive Committee
time of sampling. under Article 4(i) of the Articles of ISTA to sample and
test seeds and to issue ISTA Certificates.
Effective 1 January 2018 1-1

Chapter 1: ISTA Certificates International Rules for Seed Testing
1.3 Conditions for issuance of ISTA e) To report results of tests which are in the ISTA Rules,
Certificates the laboratory must be accredited for these tests, either
directly or through subcontracting to another labora-
ISTA Certificates must be issued only on forms obtained tory accredited for these tests.
from the ISTA Secretariat and approved by the ISTA Ex- f) The assessment of any attribute reported on a certifi-
ecutive Committee. There are two kinds of certificates: cate must be calculated from tests carried out on one
Orange International Seed Lot Certificates and Blue Inter- submitted sample.
national Seed Sample Certificates, as defined in 1.2. g) In the case of Orange International Seed Lot
On request of the applicant, duplicate and provisional Certificates:
certificates as defined in 1.2 may be issued. – the seed lot must comply with the requirements
A duplicate certificate may be issued for an original prescribed in 2.5.4;
certificate. More than one duplicate certificate may be – the submitted sample must be drawn and dealt with
issued. in accordance with 2.5.4.
A provisional certificate may be issued for any ISTA h) For an Orange International Seed Lot Certificate,
test result(s) that are later combined onto an original each container in the lot must be marked, labelled and
certificate. More than one provisional certificate may be sealed in accordance with 2.5.4.3.
issued. i) For an Orange International Seed Lot Certificate to be
If an applicant cancels testing, an ISTA Certificate issued for a sublot, the sublot must represent a mini-
does not need to be issued. mum size of 20 % of the weight of the original seed
An ISTA Certificate may be issued only by the seed lot. A maximum of five Orange International Seed Lot
testing laboratory which either carried out all the tests to Certificates may be issued for sublots of any one origi-
be reported, or subcontracted sampling and/or some of the nal seed lot.
tests to be reported (see 1.4.2 and 1.4.3), and under the j) For an Orange International Seed Lot Certificate, the
conditions listed below: submitted sample must be tested by an accredited
laboratory. The issuing laboratory must ensure that
a) The issuing laboratory must be currently authorised to sampling, sealing, identification, testing and issuance
do so by the Executive Committee. of the certificate is in accordance with the ISTA Rules,
b) The seed tested must be of a species listed in Table 2A although subcontracting of sampling and/or testing to
(Lot and sample weights) of the ISTA Rules. Where in another accredited laboratory is permissible. The labo-
other tables, such as Table 5A and Table 6A, methods ratory which carries out sampling must provide all the
are prescribed for a group of species, only those spe- information that is necessary to complete the Orange
cies specifically listed in Table 2A may be considered International Seed Lot Certificate.
to be covered. The seed lot identification (‘Marks of the lot’; see
Consequently, no certificates may be issued for species 2.2.10) may take the form of a sequential series of
not listed in Table 2A of the current ISTA Rules, ex- characters or a single reference character. Each con-
cept in the case of seed mixtures, where for the species tainer within the lot or sublot must be identified in such
tested it is shown as ‘Seed mixture’. a way that the containers can be readily recognised
c) The tests must be carried out in accordance with the by the information provided on the certificate issued.
ISTA Rules. However, additionally and on request, Each container of a sublot must be marked with the
results of tests not covered by these Rules may be re- identification of the original seed lot. A sublot-specific
ported on an ISTA Certificate (see 1.5.2.22). identification is not necessary.
Results of analyses not covered by the current ISTA When the seed lot is located in a different country to
Rules may be included on a certificate only if results the sampling laboratory, the country where the seed lot
of at least one test covered by the ISTA Rules are also has been sampled must be reported either under ‘Sam-
being reported. pling by’ or under ‘Additional observations’.
d) For the result of a determination of moisture content to
be reported on an ISTA Certificate, the sample must be
submitted in an intact, moisture-proof container from
which as much air as possible has been excluded (see
9.1.5.1).
1-2 Effective 1 January 2018

1.4 Completing ISTA Certificates b) name and ISTA member code of laboratory responsi-
ble for sampling;
1.4.1 General c) seed lot identification (i.e. marks of lot);
d) Under ‘Seal of lot’: the method of sealing (e.g. stitch-
ISTA Certificates must be completed using a typewriter ing, metal seal) and/or the authority (e.g. ISTA labora-
or machine-printer and can be completed in any language. tory, Ministry).
No certificate may be issued that shows signs of amend- e) either the number of containers for which the certifi-
ment, alteration or erasure. cate is issued; or ‘N/A’ for ‘not applicable’;
A completed certificate must show the following f) date of sampling;
information: g) date that the sample was received by the testing
a) The name and address of the issuing laboratory; the laboratory;
laboratory must be on the ISTA list of accredited mem- h) date test was concluded;
ber laboratories. i) place, country and date of issue of the certificate;
b) Dates, written in the ISO 8601 format: year in full – j) test or sample number of the testing laboratory;
month – day, with two figures for both month and day k) analysis results;
(e.g. 2007-07-25). l) In the case of certificates for sublots, under ‘Other de-
c) The scientific name of the species tested, as listed in terminations’: ‘The results reported represent the sam-
the current ISTA Rules and (in most cases) also the ple drawn from the original seed lot of … kg.’
ISTA List of Stabilised Plant Names. Where it is im- m) country where the seed lot was sampled, when the seed
possible to determine the species with certainty on the lot is located in a different country to the sampling lab-
basis of seed characters, only the genus name must be oratory, reported under either ‘Sampling by’ or ‘Ad-
stated (example: Malus sp.). In the case of seed mix- ditional observations’;
tures, for the species tested ‘Seed mixture’ must be n) the signature of the Head of the issuing laboratory or
entered. their assignee which confirms the statement on the
d) The name and address of the applicant. Other informa- back of the certificate as true;
tion stated by the applicant, such as country of origin, o) under the signature it must state at least, the job posi-
species, cultivar, weight of lot or sublot, certification tion of the person signing or “Authorised signatory”.
category and applicant’s lot reference must be entered
as stated by the applicant.
Note: at the request of the applicant the name and ad- 1.4.3 Blue International Seed Sample
dress of the applicant may be omitted. Certificate
e) The signature of the Head of the issuing laboratory or
their assignee. It may be either a physical or an elec- The Blue International Seed Sample Certificate refers
tronic signature, the use of which is authorised by the only to the sample submitted for testing.
Head of the issuing laboratory. It is stated on the back of the Blue International Seed
f) Under ‘Status of certificate’, the word ‘ORIGINAL’, Sample Certificate:
‘PROVISIONAL’ or ‘DUPLICATE’, as appropriate. ‘I certify that testing has been carried out in accord-
ance with the International Rules for Seed Testing of the
ISTA and that the tests have been made at a laboratory ac-
1.4.2 Orange International Seed Lot credited by the International Seed Testing Association to
Certificate issue International Seed Analysis Certificates.’
The completed certificate must show the following
It is stated on the back of the Orange International Seed information:
Lot Certificate: a) name, address, ISTA member code and stamp (seal) of
‘I certify that sampling, sealing and testing have been issuing laboratory;
carried out in accordance with the International Rules b) date that the sample was received by the testing
for Seed Testing of the ISTA and that the tests have been laboratory;
made at a laboratory accredited by the International Seed c) date test was concluded;
Testing Association to issue International Seed Analysis d) place, country and date of issue of the certificate;
Certificates.’ e) test or sample number of the testing laboratory;
The completed Orange International Seed Lot Certifi- f) results of tests;
cate must show the following information: g) the signature of the Head of the issuing laboratory,
a) name, address, ISTA member code and stamp (seal) of or their assignee which confirms the statement on the
issuing laboratory; back of the certificate as true;

h) under the signature it must state at least, the job posi- – No: number of containers in the lot;
tion of the person signing or “Authorised signatory”. – the calculated H value;
– the statement: ‘This H value does/does not indicate
significant heterogeneity.’
1.4.4 Duplicate certificate
Note: the H value must not be calculated or reported if X
A duplicate ISTA Certificate may be issued on request of is outside the following limits:
the applicant. – purity components: above 99.8 % or below 0.2 %;
– germination: above 99.0 % or below 1.0 %;
– number of specified seeds: below two per sample.
1.4.5 Provisional certificate
A provisional ISTA Certificate may be issued on request 1.5.2.1.2 The R value heterogeneity test
of the applicant.
The result of the R value heterogeneity test for seed lots in
multiple containers must be reported under ‘Other deter-
1.5 Reporting results minations’, as follows:
– X: mean of all X values determined for the lot in
1.5.1 Sampling and testing respect of the adopted attribute;
– N: number of independent container samples;
From one sampling operation, only one sample may be – No: number of containers in the lot;
submitted for testing. The sample may be subjected to one – the calculated R value;
or more of the tests described in the ISTA Rules as re- – the statement: ‘This R value does/does not indicate
quested by the applicant. However, in certain situations significant heterogeneity.’
(see 2.5.1.6) the submission of separate moisture-proof-
packed subsample(s) from the same sampling operation
attached to the submitted sample is required. 1.5.2.2 Purity
The results of a purity test must be reported in the spaces

1.5.2 Certificates provided as follows:
– The scientific name of the species of pure seed, in
The results of tests may be reported on one or more ISTA accordance with Table 2A (e.g. Triticum aestivum).
Certificates, separately or combined. Where it is impossible to determine the species with
Test results must be reported in accordance with the certainty on the basis of seed characteristics, reporting
rules for calculating, expressing and reporting results in must be done to the most precise taxon possible.
the appropriate chapter of the ISTA Rules. If there is a – The percentage by weight of pure seed, inert matter
space on the certificate for certain determinations which and other seeds, given to one decimal place. The per-
are not made or applicable, ‘N’ for ‘not tested’ must be centage of all components must total 100 %. Compo-
placed in the space. nents amounting to less than 0.05 % must be reported
as ‘Trace’ or ‘TR’ (for ‘Trace’). If no inert matter or
other seeds are found, this must be reported as ‘0.0’.
1.5.2.1 Sampling: heterogeneity testing for – The kind of inert matter.
seed lots in multiple containers – The scientific name of every species of other seeds
found, in accordance, where applicable, with the cur-

1.5.2.1.1 The H value heterogeneity test rent ISTA List of Stabilised Plant Names, available at
www.seedtest.org/stablist (e.g. Elytrigia repens).
The result of the H value heterogeneity test for seed lots in – When the weight of the working sample tested for pu-
multiple containers must be reported under ‘Other deter- rity equals or is no more than 10 % higher than the
minations’, as follows: weight specified in Table 2A, column 4 (Purity analy-
– X: mean of all X values determined for the lot in sis), no statement regarding the weight of the working
respect of the adopted attribute; sample is required on the ISTA Certificate.
– N: number of independent container samples;

– When the weight of the working sample tested for pu- 1.5.2.3 Purity tests on coated seeds
rity deviates from that specified in Table 2A, column
4, the actual weight of the working sample weighed The result of a purity test on coated seeds must be reported
according to 3.5.1 must be reported on the ISTA Cer- as follows:
tificate using one of the following, as applicable: – Following the species name, the words ‘seed pellets’,
a) When testing a weight that exceeds by 10 % the ‘encrusted seeds’, ‘seed granules’, ‘seed tapes’ or
weight specified in Table 2A, column 4, report un- ‘seed mats’, as applicable, must be clearly entered.
der other determinations as: – The results must be reported to one decimal place, and
‘Purity: ... g’ the percentage of all components must total 100 %.
b) When testing a weight estimated to contain 2500 Components amounting to less than 0.05 % must be
seed units, report under other determinations as: reported as ‘Trace’ or ‘TR’ (for ‘Trace’). If no inert
‘Purity: …g (approx. 2500 seeds)’ matter or other seeds are found, this must be reported
c) When the submitted sample received for purity as ‘0.0’.
testing weighs less than the weight in Table 2A, – In the case of pelleted seeds only, the percentages of
column 4, report under other determinations and pure pelleted seeds, inert matter and unpelleted seeds
use the current statement, according to 2.5.4.5: must be reported in the spaces provided for ‘Pure
‘The submitted sample weighed only … g and is seeds’, ‘Inert matter’, and ‘Other seeds’, respectively.
not in accordance with the International Rules for – The name and number of the seeds of each species
Seed Testing.’ found in the examination of the 100 seeds removed
– The percentage of winged seed (as defined in Pure from the pellets or tapes must be reported under ‘Other
Seed Definitions 47 and 51), if winged seeds are found. determinations’.
Upon request, the following information must be reported Upon request, the following information may be reported
under ‘Other determinations’ as follows: under ‘Other determinations’ as follows:
– The percentage by weight of a specified species, en- – Purity test on depelleted seeds. The component parts
tered immediately after the name of the species to the (pure seed, other seeds and inert matter) may be re-
nearest 0.1 %. Species for which the percentage by ported as percentages of their total weight, ignoring
weight has been requested are listed first. the pelleting material. The percentage of pelleting ma-
– Other seeds may be divided into ‘other crop seeds’ terial must be reported separately only on request. The
and ‘weed seeds’. In this case, the words ‘Other crop result of this test is to be reported: ‘weight of … mate-
seeds’ must be entered, followed by the percentage rial excluded’.
by weight of other crop seeds and the name(s) of the – Purity of seeds removed from tapes. The component
species found. This procedure must also be used for parts (pure seed, other seeds, and inert matter) may be
‘Weed seeds’. reported as percentages of their total weight, ignoring
– Multiple seed units must be reported as ‘% MSU’. the tape material. The result of this test is to be re-
– Seeds with appendages attached must be reported as ported: ‘weight of … material excluded’.
‘% seeds with appendages attached’.
– The kinds of inert matter, together with the percent-
age by weight of any particular kind (to one decimal 1.5.2.4 Determination of other seeds by
place). number
– The percentage by weight of broken pure seed.
The result of a determination of other seeds by number
The percentages may be reported to more than one deci- must be reported under ‘Other determinations’ as follows:
mal place if requested. – The actual weight of seed examined to the minimum
number of decimal places indicated in Table 4.1.
– The scientific name and number of seeds of each spe-
cies sought and found in this weight. If no other seeds
are found, this must be indicated on the certificate.
– Where it is impossible to determine with certainty on
the basis of seed characteristics, reporting must be
done to the most precise taxon possible.

– If the full weight prescribed in Table 2A was examined 1.5.2.6 Germination
for all other species present, then the words ‘Complete
test’ must be entered, alongside the weight of seed The result of a germination test must be reported in the
examined. spaces provided as follows:
– If the examination was for only a limited range of other – the actual duration of the test (in days, excluding the
species, then the words ‘Limited test’ must be entered. period of special treatment or method used for promot-
– If the weight examined for all other species was less ing germination);
than the prescribed weight, then the words ‘Reduced – the percentages, calculated to the nearest whole num-
test’ must be entered. ber (5.8.2), of normal seedlings, hard seeds, fresh
– If the weight examined was less than the weight pre- seeds, abnormal seedlings and dead seeds. If the result
scribed in Table 2A, and only a limited range of other for any of these categories is found to be zero, it must
species was examined, then the words ‘Reduced-limit- be reported as ‘0’.
ed test’ must be entered. – If an applicant requests that the test be terminated
– If a sample of at least 25 000 seeds was examined, when the sample reaches a predetermined germination
and this sample was below the weight prescribed in percentage, before the final count, then only the per-
Table 2A, then the weight of seed examined and the centage of normal seedlings is reported. The results of
statement ‘Test based on at least 25 000 seeds’ must be the other categories (abnormal seedlings, hard seeds,
entered. fresh seeds and dead seeds) must be reported as ‘N’,
because they have not been determined.
Upon request, the results may in addition be expressed in
some other way, such as ‘weight of seeds found’ or ‘num- The following additional information must be reported
ber of seeds per kilogram’. under ‘Other determinations’:
Upon request, the presence of Orobanche species can – the number of seeds tested, if less than 400 seeds;
only be reported on a Blue International Seed Sample Cer- – the germination method using the abbreviations used in
tificate (see 1.2.2) and must be reported as: Test for pres- Table 5A, including at least substrate and temperature;
ence of Orobanche species: ‘… seeds of Orobanche spp. – any special treatment or method used for promoting
were found in … g of seed examined.’ germination (5.6.3);
If no seeds were found it can be reported as: ‘No seeds – the duration in days of any special treatment or method
of Orobanche spp. were found in … g of seed examined.’ used for promoting germination, except in the case of
The sample weight examined must be reported accord- prestorage;
ing to the minimum number of decimals indicated in Table – the germination percentage obtained within the pre-
4.1. scribed time, if the germination period was extended
beyond the period indicated in Table 5A. The state-
ment must be entered as follows: ‘After the prescribed
1.5.2.5 Determination of other seeds by period of … days, there were … % normal seedlings.’
number on coated seeds – the method for evaluating fresh seeds (dissection, tetra-
zolium or excised embryo – see paragraph 5.6.5.3.)
The result of a determination of other seeds by number on when 5 % or more of fresh seeds are believed to be
coated seeds must be reported as follows: present.
– Following the species name, the words ‘seed pellets’, – If an applicant requests that the germination test be ter-
‘encrusted seeds’, ‘seed granules’, ‘seed tapes’ or minated when the sample reaches a predetermined ger-
‘seed mats’, as applicable, must be clearly entered. mination percentage, the following statement: ‘Upon
– Under ‘Other determinations’, the actual weight (or request of the applicant, the germination test was ter-
length of tape, or area of mat) and approximate num- minated after … days. The prescribed test period is …
ber of pelleted seeds examined must be entered, to- days.’
gether with the scientific name and number of seeds of
each species sought and found in this weight, length or When double tests are prescribed in Table 5A Part 2, the
area. result of the first test, with treatment for breaking dor-
mancy, is reported in the appropriate space on the ISTA
Upon request, the result may in addition be expressed in Certificate, and the result of the second test, without treat-
some other way, such as number of seeds per kilogram, ment for breaking dormancy, is reported under ‘Other
per metre or per square metre. determinations’.

Upon request, the following information may be re- concentration, staining temperature or staining time.
ported as follows: Precise prescriptions about the limitation of the vari-
– the result of parallel tests or any additional test; ations are given in 6.5.
– the viability of ungerminated seeds and the method – If individual seeds are tested at the end of the germi-
used to determine it; nation test, the result must be reported in accordance
– the categories of ungerminated seeds (as listed in with 1.5.2.6 and 5.9.
5.6.5.3) and the method used to determine them;
– in the case of multigerm seed units: the number of nor- In addition, in the case of species of Fabaceae, one of the
mal seedlings produced by 100 units, the number of following, and only one, must be reported:
units which have produced one, two or more than two either (in cases where the viability percentage of the hard
normal seedlings, or the proportion of units producing seed is not determined) ‘Tetrazolium test: ...% of seeds
one, two or more than two normal seedlings. The pro- were viable, ...% of hard seeds found in the test.’
portion is expressed as a percentage of the total num- or (in cases where the viability percentage of the hard
ber of units which have produced at least one normal seed is determined) ‘Tetrazolium test: ...% of seeds
seedling. were viable, ...% of hard seeds included in the percent-
age of viable seed’
1.5.2.7 Germination of coated seeds At the discretion of the seed testing laboratory, further in-
formation may be reported, e.g. percentage of seeds that
The result of a germination test on coated seeds must be were empty, with larvae, broken or decayed.
reported as follows:
– Following the species name, the words ‘seed pellets’,
‘encrusted seeds’, ‘seed granules’, ‘seed tapes’ or 1.5.2.9 Tetrazolium test on coated seeds
‘seed mats’, as applicable, must be clearly entered in
the space provided. The result of a tetrazolium test on coated seeds must be
– The percentage of pellets or seed in tapes with nor- reported as follows:
mal seedlings, with abnormal seedlings and without – Following the species name, the words ‘seed pellets’,
seedlings. ‘encrusted seeds’, ‘seed granules’, ‘seed tapes’ or
– The duration of the test. ‘seed mats’, as applicable, must be clearly entered.
The following additional information must also be report- The following additional information must be reported
ed under ‘Other determinations’: under ‘Other determinations’:
– The method used for the germination test. – The statement ‘Number of seeds (of the species stated
– For seed tapes or mats: the number of normal seed- by the applicant) included in 100 seed pellets’ (or ‘en-
lings per metre of tape or square metre of mat. crusted seeds’, or ‘seed granules’);
– or the statement ‘Number of seeds (of the species
Seedlings that are obviously not of the species stated by stated by the applicant) included in one metre of seed
the applicant, even if otherwise normal, must not be in- tape’;
cluded in the germination result, but their number must be – or the statement ‘Number of seeds (of the species stat-
reported separately. ed by the applicant) included in one seed mat or in one
square metre of seed mat’.
– The statement ‘Tetrazolium test: …% were viable’
1.5.2.8 Tetrazolium test must be entered.
– In cases where the testing procedure deviates from that

The result of a tetrazolium test must be reported under prescribed in Table 6A, any deviating procedure must
‘Other determinations’ as follows: also be reported. The only areas where variations from
– The statement ‘Tetrazolium test: …% of seeds were procedures given in Table 6A are permitted are for
viable’ must be entered. premoistening time, tetrazolium concentration, stain-
– In cases where the testing procedure deviates from that ing temperature and staining time. For precise guid-
prescribed in Table 6A, any deviating procedure must ance about the limitation of the variations permitted,
also be reported. see 6.5.
The only variations permitted from procedures given
in Table 6A are for premoistening time, tetrazolium

– If individual seeds are tested at the end of the germi- e) the number of seeds, seedlings or plants examined.
nation test, the result must be reported in accordance When it is difficult to determine the total number of
with 5.9. plants examined in field plots, the mass of seed sown
must be reported.
In addition, in the case of species of Fabaceae, one of the
following, and only one, must be reported:
either (in cases where the percentage of the viability of 1.5.2.11.1 Results of examination of individual seeds
hard seed is not determined) ‘Tetrazolium test: ...% of or seedlings
seeds were viable, ...% of hard seeds found in the test’
or (in cases where the percentage of the viability of hard Suggested phrases for reporting divergent seeds or seed-
seed is determined) ‘Tetrazolium test: ...% of seeds lings depending upon the result are as follows:
were viable, ...% of hard seeds included in the percent-
age of viable seed’ a) if none was found: ‘The test performed revealed noth-
ing to indicate that the species (and/or variety) stated
by the applicant is incorrect.’
1.5.2.10 Seed health test
b) if non-conforming seeds were found: ‘Out of … seeds
The results of a test for seed health must be reported under examined, … seeds do not conform to the authentic
‘Other determinations’ as follows: standard sample of the species (and/or variety) stated
– either qualitative or quantitative results, as specified in by the applicant.’
the individual methods;
– negative and positive results, as specified in the indi- c) if non-conforming seedlings were found: ‘Out of ....
vidual methods; seeds producing normal seedlings, …% do not con-
– the scientific name of the pathogen detected; form to the authentic standard sample of the species
– the percentage of infected seeds; (and/or variety) stated by the applicant.’
– the method used, including any pretreatment (7.2.2);
– the size of the sample or fraction examined; d) if the total working sample was found to be of a spe-
– any additional permitted procedure used. cies and/or variety other than that stated by the appli-
cant: ‘The sample does not conform to the authentic
The absence of a statement concerning the health condi- standard sample of the species (and/or variety) stated
tion of the seed does not necessarily imply that the health by the applicant.’
condition is satisfactory.
1.5.2.11.2 Results of a field plot examination

1.5.2.11 Species and variety testing
The result of a field plot examination must, whenever
The results of species and variety testing must be reported possible, be reported as a percentage of each other spe-
under ‘Other determinations’, and in addition the follow- cies, other variety or aberrant found. When the expression
ing information must be given: of the result as a percentage is not possible, appropriate
comments regarding the conformity of the sample may be
a) the request of the applicant; reported.
If nothing worthy of special comment was found the
b) the trait(s) and the method(s) used; following statement is suggested: ‘The results of a field
plot examination of this sample revealed nothing to indi-

c) the kind of preparation of the working sample (e.g. the cate that the species (and/or variety) stated by the sender
whole working sample excluding the inert matter or is (are) incorrect.’
only the pure seed fraction, washing);
d) whether an authentic standard sample or a standard

reference was used; if a standard reference was used,
its origin must be indicated;

1.5.2.12 Moisture content 1.5.2.15 Weighed replicates
This Rule is applicable to both the oven method (9.1.7) The result of a weighed replicates test must be reported in
and the moisture meter method (9.2.2.7). the space provided as follows:
The result of a moisture content test must be reported – The result of the purity test (if requested), in the spaces
in the space provided to the nearest 0.1 %. provided for purity tests.
The following additional information must also be re- – ‘N’ must be entered in all the spaces provided for re-
ported under ‘Other Determinations’: porting the percentages of the components of the ger-
– For the oven method (9.1.7), the method (i.e. duration mination tests.
and temperature) must be reported.
– For the moisture meter method (9.2.2.7), the state- The following additional information must also be report-
ment: ‘A moisture meter was used’ must be entered. ed under ‘Other determinations’:
– If germinating seeds were present in the sample, the – average weight of four replicates;
following statement must be entered: ‘Germinating – average number of normal seedlings in four
seeds were found in the submitted moisture sample.’ replicates;
– If mouldy seeds were present in the sample, the fol- – number of normal seedlings per kilogram;
lowing statement must be entered: ‘Mouldy seeds – other information as specified in 1.5.2.6 and 5.9.
were found in the submitted moisture sample.’
– In the case of pelleted seeds (see Chapter 11), the fol- Upon request, other seeds found to be present in the
lowing statement must be entered: ‘The seeds of the weighed replicates may be reported, giving the scientific
submitted moisture sample were pelleted, and the name(s) and number(s) of seeds found.
moisture content reported is the average of seed and
pelleting materials.’
– For Arachis hypogaea, one of the following statements 1.5.2.16 X-ray test
must be entered: ‘The submitted sample for moisture
determination consisted of seeds in their pod’ or ‘The The results of an X-ray test must be reported under ‘Other
submitted sample for moisture determination consist- determinations’ as percentages of filled, empty, insect-
ed of seeds with the pod removed (shelled seeds)’. damaged or physically damaged seeds, as follows:
‘X-ray test results:
……% filled
1.5.2.13 Weight determination ……% empty
……% insect-damaged
The result of a weight determination test must be reported ……% physically damaged’.
under ‘Other determinations’ to the number of decimal
places used in the determination (10.5.3).
The method used (‘Counting the entire working sam- 1.5.2.17 Seed vigour test
ple’ or ‘Counting replicates’) and the result as calcu-
lated according to 10.6 must be reported under ‘Other 1.5.2.17.1 Conductivity test
Determinations’.
The result of a seed vigour test using the conductivity test
method must be reported under ‘Other determinations’ as
1.5.2.14 Excised embryo follows:
– The result must be expressed in μS cm−1 g−1 to the
The result of an excised embryo test must be reported un- nearest 0.1 μS cm−1 g−1.
der ‘Other determinations’ as follows: ‘Excised embryo – The seed moisture content before the test must be re-
test: ……% of seeds had viable embryos’ ported. Where the moisture content has been adjusted
Further details may be given at the discretion of the before the test, both the initial moisture content and the
seed testing laboratory, e.g. percentages of seeds that were calculated moisture content after adjustment must be
empty, insect-damaged or physically damaged. reported.
– The results must be accompanied by a statement of the
specific variables used in the test (soaking time and
temperature)

1.5.2.17.2 Accelerated ageing test 1.5.2.17.4 Radicle emergence test
The result of a seed vigour test using the accelerated aging The result of a seed vigour test using the radicle emer-
(AA) method must be reported under ‘Other determina- gence test must be reported under ‘Other Determinations’
tions’ as follows: as follows:
– Results are expressed as a percentage, calculated to – Results are reported as a percentage of seeds with
the nearest whole number (5.8.1) of normal seedlings, emerged radicles calculated to the nearest whole num-
abnormal seedlings, hard seeds, fresh seeds and dead ber (5.8.1). If the result is found to be nil, it must be
seeds. If the result for any of these categories is found entered as ‘0’.
to be zero, it must be reported as ‘0’. – The results must be accompanied by a statement of the
– The seed moisture content before the test must be re- temperature used for the test and the time of the radicle
ported. Where the moisture content has been adjusted emergence counts in hours, e.g. ‘Radicle emergence
before the test, both the initial moisture content and the test 90 % with emerged radicles after 66 h at 20 °C.’
calculated moisture content after adjustment must be
reported.
– The results must be accompanied by a statement of 1.5.2.17.5 Tetrazolium vigour test
the specific variables used in the test (seed weight per
AA box both before and after ageing, ageing time and The result of a seed vigour test using the TZ method must
temperature) be reported under ‘Other determinations’. Results are ex-
pressed as a percentage, calculated to the nearest whole
number of vigorous seeds, e.g.: “Tetrazolium vigour tests
1.5.2.17.3 Controlled deterioration test using 0.1 % TZ solution for 3 h at 35 °C: 90 % vigorous
seeds.”
The result of a seed vigour test using the controlled dete-
rioration test method must be reported under ‘Other deter-
minations’ as follows for the two alternative methods of 1.5.2.18 Size and grading of seeds
assessing deterioration in 15.8.3.4.3:
The result of a screening analysis test for size and grading
a) CD germination test of seeds must be reported under ‘Other determinations’ as
the average of two screening analyses falling within the
– Results are expressed as a percentage, calculated to the permitted tolerance limits.
nearest whole number (5.8.1), and stated as ‘Total ger-
minated seeds (normal plus abnormal seedlings) … %’
and ‘Normal seedlings … %’. If the result for either of 1.5.2.19 Weighted average test for seed lots
these is found to be zero, it must be reported as ‘0’. transported loose in bulk containers
specific variables used in the test (method used to raise The result of a weighted average test performed on seed
seed moisture content, raised seed moisture content, lots, as described in Chapter 17, must be reported in the
deterioration period and temperature). normal way, except that:
b) Conductivity test after deterioration a) across the date of sampling, date sample received,
date test concluded and test number boxes insert the
– The result must be expressed in μS cm–1 g–1 to the near- statement: ‘Seed loose in bulk container(s) – see under
est 0.1 μS cm–1 g–1. Other determinations.’

specific variables used during deterioration (method b) Under ‘Other determinations’, list the test number,
used to raise seed moisture content, raised seed mois- date of sampling and date test concluded of all constit-
ture content, deterioration period and temperature) and uent lots together with the statement: ‘The test results
in the conductivity test (soaking time and temperature). reported represent the weighted average of the results
reported on these certificates which were not signifi-
cantly different from each other.’

1.5.2.20 Seed mixtures 1.5.2.20.3 Germination, seed viability, seed vigour and
other tests using replicates of 100 seeds
The results of tests on seed mixtures can only be report-
ed on a Blue International Seed Sample Certificate (see Test results are reported only for those species for which
1.2.2). methods are given in the appropriate Chapter of the ISTA
For the species tested, ‘Seed mixture’ together with the Rules. The results of these tests must be reported under
mixture composition according to the declaration of the ‘Other determinations’.
applicant, must be entered. Germination test results are not reported in the ‘Ger-
mination’ section of the certificate (an ‘N’ must be entered
there), but under ‘Other determinations’. When 100 or
1.5.2.20.1 Purity and component analysis more seeds are tested, the percentage results of the test for
each mixture component tested are reported to the nearest
The results of the purity analysis are reported according whole number. The number of seeds tested is also report-
to Chapter 3. ed. Tolerances as described in the appropriate Chapters
The actual weight of sample examined to the minimum are applied to tests of 400, 300, 200 and 100 seeds.
number of decimal places indicated in Table 4.1 must be When fewer than 100 seeds are tested, the actual num-
reported under ‘Other determinations’, i.e. ‘Purity and ber of seeds in each category (e.g. normal seedlings or
composition analysis: … g of seed examined.’ viable seeds) is reported, together with the total number
The mixture composition is reported under ‘Other de- of seeds tested.
terminations’ in one of the following formats, as requested The method used in the test must be reported on the
by the applicant: certificate according to the appropriate Chapter for each
1. The percentage by weight of the pure seeds of the component species tested.
mixture components using the total weight of the pure
seed fraction. In addition, if applicable, the percentage
by weight of the ‘inert material according to declara- 1.5.2.20.4 Weight determination
tion’ referred to the sum of the weights of all mixture
components (pure seeds and inert material according The results as calculated according to 18.7 must be re-
to declaration) must be given to one decimal place un- ported under ‘Other determinations’.
der ‘Other determinations’.
2. The percentage by weight of mixture components,
pure seeds or inert material according to declaration 1.5.2.21 Genetically modified organisms
using the sum of the weights of the pure seed fraction
and the declared inert material. The result of a genetically modified organism test must be
3. The percentage by number of the pure seeds of the reported under ‘Other determinations’ as follows:
mixture components using the total number of seeds – the request of the applicant;
of the pure seed fraction. – the name and scope (with reference to the target) of the
In addition, if applicable, the percentage by weight of the method(s) used;
‘inert material according to declaration’ using the sum of – a description of the working sample (e.g. pure seed
the weights of all mixture components must be given to fraction, inert matter present, other seeds present,
one decimal place under ‘Other determinations’. washed seed);
– the number of seeds in the working sample;
– a description and the source of the reference material
1.5.2.20.2 Determination of other seeds by number used (e.g. certified reference material, provider);
– the limit of detection of the method (when testing seed

The results of a determination of other seeds by number groups or seed bulk);
on a seed mixture must be reported according to 4.7. – the limit of quantification of the method (when testing
seed bulk with a quantitative method).

1.5.2.21.1 Qualitative test results a) If the test target was not detected (no signal or below
the limit of detection): ‘The test target was not detect-
Suggested phrases for reporting the detection of test tar- ed at a level above the limit of detection.’
gets depending upon the result are as follows:
b) If the test target was detected at a level above the limit
a) If the test target(s) was(were) not detected: ‘The test of detection and below the limit of quantification: ‘The
target was not detected.’ test target was detected at a level below the limit of
quantification of the method used.’
b) If the test target(s) was (were) detected: ‘The test tar-
get was detected.’ c) If seeds showing the test target were found at a level
above the limit of quantification: ‘The test target(s)
percentage in the seed lot was determined to be …%
1.5.2.21.2 Quantitative results obtained by multiple by mass or number of copies, with a 95 % confidence
qualitative tests of individuals or groups of seeds or interval of […%, …%]’
seedlings or
‘For the test target(s) specified by the applicant, the
Results should be reported relative to the percentage of seed lot meets the specification of ...% (maximum or
seeds or seedlings showing the test target specified by the minimum) by mass or number of copies with …%
applicant. The total number of seeds tested, the number confidence.’
of groups, and the number of seeds per group must be re-
ported. Suggested phrases for reporting such results de- If the results do not show evidence that the seed lot meets
pending upon the result are as follows: a given specification with some confidence, then the ap-
plicant will report the point estimate with the 95 % confi-
a) If the test target(s) was (were) not detected: ‘The test dence interval.
target(s) was (were) not detected.’
b) If the test target(s) was (were) detected: ‘The % of 1.5.2.22 Reporting of results of tests not
seeds in the lot with the test target(s) was determined covered by the Rules
to be …%, with a 95 % confidence interval of […%,
…%].’ Results must be reported under ‘Other determinations’.
or The test method must be reported and followed by:
‘For the test target(s) specified by the applicant, the ‘(This method is not covered by the International Rules
seed lot meets the specification of ...% (maximum or for Seed Testing).’
minimum) with …% confidence.’
If the results do not show evidence that the seed lot meets 1.5.3 Reporting of uncertainty of
a given specification with some confidence, then the ap- measurement on ISTA Certificates
dence interval. Uncertainties of measurements associated with test results
are accessible through the tolerance tables in the ISTA
Rules and are not reported on the ISTA Certificates.
1.5.2.21.3 Quantitative measurements of GMO in
bulk samples
1.5.4 Statement referring to compliance

Results should be reported relative to the percentage of with legislative requirements
the test target specified by the applicant by mass or num-
ber of DNA copies. The testing plan (e.g. number of rep- In addition to results of tests carried out, it is permissible,
licate seed samples, number of replicate flour samples per at the issuing laboratory’s own risk, to make a statement
seed sample, number of extracts per flour sample, number that the seed lot tested meets particular legislative stand-
of replicate measurements per extract) must be indicated. ards. ISTA takes no responsibility for such statements.
Required phrases for reporting depending upon the re-
sults are as follows:

1.6 Validity of ISTA Certificates for the same sample and the same particular test(s), pro-
vided that the same sample is re-tested. If a new sample is
The results on an original ISTA Certificate are valid until submitted and tested, it must be regarded as independent
superseded, or partly superseded, by new results on an- from the previous sample, and the results on the previous
other valid original ISTA Certificate, issued, for the same certificate are not superseded.
particular test(s). Previously issued certificates do not need to be re-
If an original certificate is re-issued because of new or turned to the issuing laboratory.
amended test results, it must carry a statement indicating The reference dates are (in order of priority) the date
that the new results replace previous results, and refer- of sampling, the date the test was concluded, and the date
ring to the Reg. No. of the superseded certificate. In this of issuing the certificate.
case, the date entered on the certificate is the new date of
issuing.
If an original, duplicate or provisional certificate is 1.7 Disputed results
lost, a replacement certificate can be issued. In this case,
the date entered on the certificate is the same as on the lost If the results reported on an ISTA Certificate are contra-
certificate. dicted by subsequent test results at another accredited
A new original Orange International Seed Lot Certifi- laboratory and the problem cannot readily be resolved, the
cate may be issued to supersede a previous certificate for laboratory issuing the certificate should contact the ISTA
the same seed lot or sublot under the same reference (i.e. Secretariat to determine the correct course of action.
seed lot seal and identification) and the same particular
test(s), provided that a new submitted sample from that lot
or sublot is taken and tested. The new certificate is only
valid for the particular lot or sublot that was re-sampled. If
a sublot is re-sampled it becomes a new seed lot and must
be given a new seed lot identification mark.
A new original Blue International Seed Sample Cer-
tificate may be issued to supersede a previous certificate

International Rules for Seed Testing Chapter 2: Sampling
Chapter 2: Sampling
2.1 Object 2.2.7 Duplicate sample
The object of sampling is to obtain a sample of a size suit- A duplicate sample is another sample obtained for submis-
able for tests, in which the probability of a constituent be- sion from the same composite sample and marked ‘Dupli-
ing present is determined only by its level of occurrence cate sample’.
in the seed lot.
2.2.8 Working sample

2.2 Definitions
The working sample is the whole of the submitted sample
2.2.1 Seed lot or a subsample thereof, on which one of the quality tests
described in these ISTA Rules is made and must be at least
A seed lot is a specified quantity of seed that is physically the weight prescribed by the ISTA Rules for the particular
and uniquely identifiable. test.
2.2.2 Sublot 2.2.9 Sealed
A sublot is a portion of not less than 20 % of the seed lot. Sealed means that a container in which seed is held is
Each container of a sublot must be marked with the iden- closed in such a way, that it cannot be opened to gain ac-
tification of the seed lot. cess to the seed and closed again, without either destroy-
ing the seal or leaving evidence of tampering. This defini-
tion refers to the sealing of seed lots, as well as of seed
2.2.3 Primary sample samples.
A primary sample is a portion taken from the seed lot dur-

ing one single sampling action. 2.2.10 Self-sealing containers
The ‘valve-pack’ bag is a specific type of self sealing con-

2.2.4 Composite sample tainer. It is filled through a sleeve-shaped valve which is
automatically closed by the completion of filling the bag.
The composite sample is formed by combining and mix-
ing all the primary samples taken from the seed lot.
2.2.11 Marked/labelled
2.2.5 Subsample A container of a seed lot can be considered as marked or

labelled when there is a unique identification mark on the
A subsample is a portion of a sample obtained by reducing container, which defines the seed lot to which the container
a sample. belongs. All containers of a seed lot must be marked with
the same unique seed lot designation (numbers, characters
or combination of both). Should the unique identification
2.2.6 Submitted sample mark be indicated on a label attached to the container, it
Chapter 2: Sampling
must not be possible to remove the label and replace it

A submitted sample is a sample that is to be submitted to with another label without showing signs of tampering.
the testing laboratory and may comprise either the whole Marking of samples and subsamples must ensure that
of the composite sample or a subsample thereof. The sub- there is always an unambiguous link between the seed lot
mitted sample may be divided into subsamples packed and the samples and subsamples.
in different material meeting conditions for specific tests
(e.g. moisture or health).

Chapter 2: Sampling International Rules for Seed Testing
2.2.12 Treated seed 2.3 General principles

‘Seed treatment’ is a generic term which indicates that a A composite sample is obtained from the seed lot by tak-
seed lot has been subjected to: ing primary samples from different positions in the whole
a) the application of a compound including chemicals, seed lot and combining them. From this composite sam-
nutrients or hormones ple, subsamples are obtained by sample reduction proce-
b) the application of a biological product including dures at one or more stages forming the submitted sample
micro-organisms and finally the working samples for testing. For issuing
c) a process including wetting and drying ISTA Certificates, specific requirements have to be ful-
d) an energy form including heat, radiation, electricity or filled as given under 2.5.4. Further information on seed
magnetism sampling can be found in the current ISTA Handbook on
but does not specify the application method. Seed Sampling.
Seed treatment does not significantly change the size,
shape or add to the weight of the seeds in the lot.
2.4 Apparatus
2.2.13 Coated seeds Sampling and sample reduction must be performed using
appropriate techniques and equipment that is clean and in
Coated seeds are seeds covered with material that may good condition as described in 2.5.1 and 2.5.2.2.
contain pesticides, fungicides, dyes or other additives. Containers used to collect primary samples, composite
The following types of coated seeds are defined: samples and during mixing and dividing must be static-
free to avoid chaff or small seeds adhering to the inside of
Seed pellets. More or less spherical units, usually incor- the containers.
porating a single seed with the size and shape of the
seed no longer readily evident.
2.5 Procedures
Encrusted seed. Units more or less retaining the shape of
the seed with the size and weight changed to a measur- 2.5.1 Procedures for sampling a seed lot
able extent.
2.5.1.1 Preparation of a seed lot and
Seed granules. Units more or less cylindrical, including conditions for sampling
types with more than one seed per granule.
At the time of sampling, the seed lot must be as uniform as
Seed tapes. Narrow bands of material, such as paper or practicable. If the seed lot is found to be obviously hetero-
other degradable material, with seeds spaced random- geneous, sampling must be refused or stopped. In cases of
ly, in groups or in a single row. doubt heterogeneity can be determined as described under
2.9.
Seed mats. Broad sheets of material, such as paper or Seed may be sampled in containers or when it enters
other degradable material, with seeds placed in rows, containers. The containers must be fit for purpose, i.e.
groups or at random throughout the sheets. must not damage the seed, and must be clean to avoid
cross contamination. The containers must be labelled or
marked before or just after sampling is completed.
2.2.14 Small seed lots The seed lot must be so arranged that each part of the
seed lot is conveniently accessible.
Small seed lots are seed lots of high-value seed, where
obtaining a submitted sample of standard size could have
Chapter 2: Sampling
a substantial effect on the quantity of the remaining seed

lot. High-value seed includes, but is not limited to, hy-
brid vegetable seeds that are sold per seed, or seed that is
not commercially available and is used for research or for
higher generation multiplication.

2.5.1.2 Minimum sampling intensity When sampling a seed lot of up to 15 containers, regard-
less of their size, the same number of primary samples
For seed lots in containers holding up to and including must be taken from each container.
100 kg, the minimum sampling intensity is the following: Sampling intensity for coated seeds is as described in
Tables 2.1 and 2.2.
a) For containers holding between 15 kg and 100 kg (in-
clusive) of seed, the number of primary samples ac-
cording to Table 2.1. 2.5.1.3 Taking primary samples
b) For containers holding less than 15 kg of seed, con-
tainers must be combined into sampling units not ex- When defining the number and/or the size of primary
ceeding 100 kg, e.g. 20 containers of 5 kg, 33 contain- samples, the seed sampler needs to ensure (besides meet-
ers of 3 kg or 100 containers of 1 kg. The sampling ing the minimum sampling intensity) that the minimum
units must be regarded as containers as described in amount of seed required for the requested test(s) is sent to
Table 2.1. the testing laboratory and enough seed remains available
c) For seed pellets, seed granules, seed tapes and seed for obtaining duplicate samples if requested.
mats, containers of less than 300 000 seed units Primary samples of approximately equal size must be
must be combined to sampling units not exceeding taken from a seed lot, irrespective of where in the lot or
2 000 000 seeds. The sampling units must be regarded container the primary sample is taken.
as containers as described in Table 2.1. When the seed lot is in containers, the containers to
be sampled must be selected at random or according to a
Table 2.1. Minimum sampling intensity for seed lots in systematic plan throughout the seed lot. Primary samples
containers holding up to and including 100 kg seed must be drawn from the top, middle and bottom of con-
tainers, but not necessarily from more than one position
Number of Minimum number of primary samples to be taken in any container, unless so specified in Tables 2.1 and 2.2.
containers
When the seed is in bulk or in large containers, the
1–4 3 primary samples from each container
primary samples must be drawn from random positions.
5–8 2 primary samples from each container
Containers must be opened or pierced for abstraction
9–15 1 primary sample from each container
16–30 15 primary samples, one each from 15 different of primary samples. The sampled containers must then be
containers closed or the contents transferred to new containers.
31–59 20 primary samples, one each from 20 different When seed is to be packed in special types of contain-
containers ers (e.g. small, not penetrable, or moisture-proof contain-
60 or more 30 primary samples, one each from 30 different ers), it should be sampled, if possible, either before or dur-
containers
ing the filling of the containers.
Sampling seed lots of seed tapes and seed mats should
When sampling seed in containers holding more than be done by taking packets or pieces of tape or mat.
100 kg of seed, or from streams of seed entering contain- The instruments being used must neither damage the
ers, the sampling intensity according to Table 2.2 must be seed nor select according to seed size, shape, density,
regarded as the minimum requirement. chaffiness or any other quality trait. All sampling appara-
tus must be clean before use to prevent cross contamina-
Table 2.2. Minimum number of primary samples to be tions. Triers must be long enough so that the opening at
taken from seed lots in containers holding more than the tip reaches at least half of the diameter of the con-
100 kg of seed, or from seed streams tainer. When the container is not accessible from opposite
sides, the trier must be long enough to reach the opposite
Seed lot size Number of primary samples to be taken side. Sampling seed lots may be done by one of the meth-
Up to 500 kg At least five primary samples ods listed below.
501–3 000 kg One primary sample for each 300 kg,
Chapter 2: Sampling
but not less than five

3 001–20 000 kg One primary sample for each 500 kg,
but not less than 10
20 001 kg and One primary sample for each 700 kg,
above but not less than 40

a) Automatic sampling from a seed stream. Seed may When using the Nobbe trier, insert it at an angle of
be sampled by automatic sampling devices, provided about 30° to the horizontal plane with the opening fac-
that the instrument uniformly samples the cross sec- ing down, push the trier until it reaches the required
tion of the seed stream and the material entering the position and revolve it through 180°. Withdraw it with
instrument does not bounce out again. It may be op- decreasing speed from the container, gently agitating
erated either under manual or automatic control. The the trier to help maintain an even flow of seed, and col-
intervals between taking primary samples should be lect the seed sample coming from the trier in a suitable
constant. container.
b) Manual sampling from a seed stream. Seed streams e) Cargo sampler. The cargo sampler (bulk sampler)
may also be sampled by using manual instruments consists of a special type of chamber that is fixed to
when fulfilling the requirements listed under a). a shaft. The lower part of the chamber is cone-shaped
with a pointed end. To reach a greater depth, the shaft
c) Sampling stick. The sampling stick (e.g. stick trier, may be lengthened by screwing on successive exten-
sleeve type trier, spiral trier) consists of two parts, sions. There is a closing system in the chamber that
one of which fits loosely inside the other, but tightly may be a collar on the outside of the instrument, a wing
enough so that seed or impurities do not slip between connected to a door or a valve with a spring. Some car-
them. The outer part has a solid pointed end. Both go samplers can be closed before they are drawn back
parts have slots in their walls so that the cavity of the from the sampling position; others cannot be closed,
inner part can be opened and closed by moving the two so that the filled chamber is open during withdrawal.
parts against each other by either a twisting or a push- For all species, the minimum inside diameter can be
pull motion. about 35 mm and the depth 75 mm. When using the
The sampling stick may be used horizontally, diago- cargo sampler, insert it in the closed position into the
nally or vertically. The spiral trier has slots in a spiral container, gently push it vertically into the seed so
arrangement for their subsequent opening from the tip that the point reaches the required position, pull the
to the handle and may only be used for seeds of a size cargo sampler back about 10 cm or turn it (depending
smaller than Triticum aestivum. on the closing system), agitate it slightly to allow it to
However, when used vertically or diagonally down- fill completely, gently close if possible and withdraw
wards, the sampling stick must either have partitions it and empty the primary sample into a container. Care
dividing the instrument into a number of compart- should be exercised in closing the cargo sampler, so
ments or have slots in a spiral arrangement. The mini- that the seeds are not damaged.
mum inside diameter should be wide enough to allow
the smooth and free flow of seed and contaminants f) Sampling by hand. This method can be used for all
into the sampling stick. species and may be the most suitable method for seed
When using the sampling stick, insert it in the closed that may be damaged by the use of triers, seeds with
position into the container, gently push it so that the wings, seeds with low moisture content, seed tapes and
point reaches the required position, open the sampling seed mats.
stick, agitate it slightly to allow it to fill completely, For hand sampling seed in containers, all positions
gently close and withdraw it and empty the primary inside the containers must be accessible. Containers
sample into a container. Care should be exercised with layers which are not accessible from the regular
in closing the sampling stick so that seeds are not opening may have to be cut open, sampled and repack-
damaged. aged. Containers may also be partially or completely
emptied during the sampling process to gain access to
d) Nobbe trier. The Nobbe trier (dynamic spear) is a all positions in the containers. For sampling by hand,
pointed tube with an opening near the pointed end. clean the hand and roll the sleeve up if necessary, in-
Seed passes through the tube and is collected in a con- sert the open hand into the container to the required
Chapter 2: Sampling
tainer. The minimum internal diameter of the Nobbe position, close and withdraw the hand, taking great
trier should be wide enough to allow the smooth and care that the fingers remain tightly closed about the
free flow of seed and contaminants through the trier. seeds so none may escape, and empty the hand into a
receiving pan.

2.5.1.4 Obtaining the composite sample 2.5.1.7 Storage of submitted samples before
testing
Where possible, the primary samples are compared with
each other during sampling. The primary samples can Every effort must be made to start testing a submitted
only be combined to form the composite sample if they sample on the day of receipt. Storage of orthodox seeds,
appear to be uniform. If not, the sampling procedure must when necessary, should be in a cool, well-ventilated room.
be stopped. When primary samples are collected directly Non-orthodox (i.e. recalcitrant or intermediate) seeds
into one container, the content of this container may be should be tested as soon as possible after obtaining the
regarded as the composite sample only if it appears uni- submitted sample from the composite sample without any
form. If not, it must not be used for obtaining a submitted storage. Handling of the submitted sample and, if neces-
sample. sary, storage should be done under species specific opti-
mum conditions.
2.5.1.5 Obtaining the submitted sample

2.5.2 Procedures for obtaining the
The submitted sample must be obtained by reducing the submitted and working sample
composite sample to an appropriate size by one of the
methods referred to in 2.5.2.2. In the case of very large 2.5.2.1 Minimum size of working sample
composite samples, a method according to 2.5.1.3 may
also be used. Obtaining subsamples such as for moisture Minimum sizes of working samples are prescribed in the
testing must be carried out in such a way that changes in appropriate chapter for each test. The working sample
moisture content are minimal. weights for purity analyses given in Table 2A are calcu-
The composite sample can be submitted to the seed lated to contain at least 2 500 seeds. These weights are
testing laboratory if it is of appropriate size or if it is dif- recommended for normal use in purity tests, see 3.5.1.
ficult to mix and reduce the composite sample properly The sample weights in column 5 of Table 2A, Part 1,
under warehouse conditions. for counts of other species are 10 times the weights in col-
Duplicate samples, which were requested not later umn 4, subject to a maximum of 1000 g.
than at the time of sampling, must be prepared in the same Working samples of all coated seeds except those de-
way as the submitted sample. fined as treated seed in 2.2.11 must contain at least the
number of pellets, seeds or granules indicated in column
3 of Table 2B, Part 1 and Part 2. If a smaller sample is
2.5.1.6 Dispatch of the submitted sample used, the actual number of pellets, seeds or granules in the
sample must be reported.
The submitted sample must be marked with the same
identification as the seed lot. For an Orange International
Seed Lot Certificate, the sample must be sealed. The ad- 2.5.2.2 Sample reduction methods
ditional information required according to 1.4.2 as well
as the name of any chemical treatment applied must be If the seed sample needs to be reduced to a size equal to
provided. or greater than the size prescribed, the seed sample must
Submitted samples must be packed so as to prevent first be thoroughly mixed. The submitted/working sample
damage during transit. Submitted samples should be must then be obtained either by repeated halving or by
packed in breathable containers. abstracting and subsequently combining small random
Subsamples for moisture testing, and samples from portions. The apparatus and methods for sample reduction
seed lots which have been dried to low moisture content, are described in 2.5.2.2.1 to 2.5.2.2.4. One, two or more
must be packed in moisture-proof containers which con- of these methods may be used in one sample reduction
tain as little air as possible. Submitted samples for germi- procedure. When using one of the dividers described for
Chapter 2: Sampling
nation tests, viability tests and health tests may only be seed pellets the distance of fall must not exceed 250 mm.
packed in moisture-proof containers if suitable storage After obtaining a working sample the remainder must
conditions can be assured. be re-mixed before a second working sample is obtained.
Submitted samples must be dispatched to the seed test-
ing laboratory without delay.

Except in the case of seed health, the method of hand a) Conical divider. The conical divider (Boerner type)
halving must be restricted to certain genera listed in consists of a hopper, cone, and series of baffles direct-
2.5.2.2.4. Only the spoon method and the hand halving ing the seed into two spouts. The baffles form alternate
method may be used in the laboratory to obtain working channels and spaces of equal width. They are arranged
samples for seed health testing where other samples or in a circle and are directed inward and downward, the
equipment may be contaminated by spores or other propa- channels leading to one spout and the spaces to an op-
gating material. posite spout. A valve or gate at the base of the hopper
For seed tapes and mats take pieces of tape or mat at retains the seed. When the valve is opened the seed
random, to provide sufficient seeds for the test. falls by gravity over the cone where it is evenly distrib-
To obtain the submitted sample for moisture content uted to the channels and spaces, then passes through
determination (2.5.4.5 c), subsamples must be taken in the spouts into the seed pans.
the following way: first, mix the composite sample. Then, Dividers with more than 18 channels have been found
take a minimum of three samples from different positions to be suitable. Channels must be wide enough to allow
and combine them to create the subsample for moisture the smooth free flow of seed and contaminants.
of the required size. The subsample for moisture must be
taken as soon as possible to avoid changes in moisture b) Soil divider. The soil divider (riffle divider) consists
content. of a hopper with about 18 attached channels or ducts
To obtain the working sample for moisture content de- alternately leading to opposite sides. Channels must be
termination (9.1.5.2) subsamples must be taken in the fol- wide enough to allow the smooth free flow of seed and
lowing way: before taking the subsample, mix the sample contaminants.
by either stirring the sample in its container with a spoon In using the divider the seed is placed evenly into a
or by placing the opening of the original container against pouring pan and then poured in the hopper at approxi-
the opening of a similar container and pour the seed back mately equal rates along the entire length. The seed
and forth between the two containers. Take a minimum passes through the channels and is collected in two
of three subsamples with a spoon from different positions receiving pans.
and combine them to create the subsample of the required
size. The seed must not be exposed to the air during sam- c) Centrifugal divider. In the centrifugal divider
ple reduction for more than 30 s. (Gamet type) the seed flows downward through a hop-
per onto a shallow cup or spinner. Upon rotation of the
spinner by an electric motor the seeds are thrown out
2.5.2.2.1 Mechanical divider method by centrifugal force and fall downward. The circle or
area where the seeds fall is equally divided into two
This method is suitable for all kinds of seeds except some parts by a stationary baffle so that approximately half
very chaffy seeds. The apparatus divides a sample passed the seeds fall in one spout and half in the other spout.
through it into two or more approximately equal parts. The centrifugal divider tends to give variable results
The submitted sample can be mixed by passing it through unless the spinner is operated after having poured the
the divider, recombining the parts and passing the whole seed centrally into the hopper.
sample through a second time, and similarly, a third time
if necessary. The sample is reduced by passing the seed d) Rotary divider. The rotary divider comprises a rotat-
through repeatedly and removing parts on each occasion. ing crown unit with 6 to 10 attached subsample con-
This process of reduction is continued until a working tainers, a vibration chute and a hopper. In using the di-
sample of approximately, but not less than, the required vider the seed is poured into the hopper and the rotary
size is obtained. divider is switched on so that the crown unit with the
containers rotates with approx. 100 rpm and the vibra-
tion chute starts to feed the seed into the inlet cylinder
of the rotating crown. The feeding rate and therefore
Chapter 2: Sampling
the duration of the dividing operation can be adjust-

ed by the distance between the funnel of the hopper
and the chute and the vibration intensity of the chute.

There are two principles: (i) The inlet cylinder feeds mixing, pour the seed evenly over the tray; do not shake
the seed centrally onto a distributor within the rotating the tray thereafter. With the spoon in one hand, the spatula
crown distributing the seed to all containers simultane- in the other, and using both, remove small portions of seed
ously. (ii) The inlet cylinder feeds the seed de-centrally from not less than five random places. Sufficient portions
into the inlets of the containers rotating underneath the of seed are taken to constitute a subsample of the required
inlet cylinder so that the seed stream is subdivided into size.
a lot of subsamples.
e) Variable sample divider. The variable sample divid- 2.5.2.2.4 The hand halving method
er consists of a pouring hopper and a tube underneath
that rotates with about 40 rpm. The tube distributes the This method is restricted to the following genera of chaffy
seed stream from the pouring hopper onto the inner seeds:
surface of a further hopper, which is well fitted into a Agrimonia, Andropogon, Anthoxanthum, Arrhenath
third hopper all being concentric. In the second and the erum, Astrebla, Beckmannia, Bouteloua, Brachiaria,
third hopper there are slots that comprise 50 % of the Briza, Cenchrus, Chloris, Dichanthium, Digitaria,
perimeter of the hoppers. 50 % of the seed will pass Echinochloa, Ehrharta, Elymus, Eragrostis, Gomphrena,
through the two hoppers into a collecting pan. The Gossypium (linted seed only), Melinis, Oryza, Pennisetum
other 50 % will stay within the hoppers and will then (non glaucum), Psathyrostachys, Scabiosa, Sorghastrum,
go into a second collecting pan. The two hoppers can Stylosanthes (non guianensis), Trisetum;
be twisted against each other resulting in more narrow
slots. The effect is that a smaller percentage will pass to the following genera of easily damaged fragile seeds:
through the slots. Either the smaller sample outside the Arachis, Glycine and Phaseolus;
hoppers or the bigger sample inside the hoppers can be
used as the required sample. The position of the two and to the following genera and species of tree and shrub
hoppers in relation to each other can be adjusted ac- seeds:
curately, resulting in pre-determined subsample sizes. Acer, Aesculus, Ailanthus, Castanea, Cedrela, Corylus,
Fagus, Fraxinus, Juglans, Liriodendron, Pinus cembra,
Pinus pinea, Platanus, Populus, Quercus, Salix, Tectona,
2.5.2.2.2 Modified halving method Ulmus.
The apparatus comprises a tray into which fits a grid of The hand halving method can also be used with the spe-
equal-sized cubical cells, open at the top and every al- cies where all other dividing methods are extremely dif-
ternate one having no bottom. After preliminary mixing, ficult or impossible to use.
the seed is poured evenly over the grid. When the grid is For all other species it can be used only to obtain work-
lifted, approximately half the sample remains on the tray. ing samples in the laboratory for seed health tests (7.4.1).
The submitted sample is successively halved in this way For applying the hand halving method, pour the sam-
until a working sample, of approximately but not less than ple evenly onto a smooth clean surface, thoroughly mix
the required size, is obtained. the seed into a mound with a flat-edged spatula, divide
the mound into half and halve each half again – giving
four portions – and halve each portion again – giving
2.5.2.2.3 Spoon method eight portions, arrange the portions in two rows of four,
combine and retain alternate portions: e.g. combine the
The spoon method is recommended for sample reduction first and third portions in the first row with the second and
for seed health testing (7.4.1). For other tests it is restrict- fourth in the second row, remove the remaining four por-
ed to species with seeds smaller than Triticum spp., to the tions. Repeat the procedure using the retained portions
genera Arachis, Glycine and Phaseolus, and to tree genera until obtaining the required sample size.
Chapter 2: Sampling
Abies, Cedrus and Pseudotsuga. A tray, a spatula and a

spoon with a straight edge are required. After preliminary

2.5.3 Storage of samples after testing contain is 1 000 000 000 (10 000 units of 100 000) ex-
cept that the weight of the seed lot, including the coat-
The primary aim of storage of samples after testing is to ing material may not exceed 40 000 kg subject to a tol-
be able to repeat the original tests carried out on the sub- erance of 5 % (42 000 kg).
mitted sample. Therefore, storage conditions should be
such that changes in the seed quality traits tested are mini- c) seed lots of species of Poaceae produced in a seed
mal. For example, in the case of the purity test or other company that has been approved to make larger seed
seed count, the sample should be stored in such a way lots. The conditions under which this may be permitted
that the physical identity is kept. In the case of germina- are laid down in 2.5.4.2.
tion, viability or health test of orthodox seeds the sample
should be stored under cool and dry conditions. For such d) seed lots of species of Poaceae produced in a seed
tests in recalcitrant and intermediate seeds of tropical and company that has applied for approval to make larger
subtropical species, long term storage is not possible. For seed lots according to 2.5.4.2. The heterogeneity of the
such seed of temperate species storability depends on the seed lot must be tested according to 2.9 and the seed lot
fungal status and to some extent whether the seed is dor- must not show significant heterogeneity.
mant or not. All factors pertaining to storage need to be
determined on a species basis. Protection against insects Maximum lot size for treated and encrusted seeds is de-
and rodents may be necessary. fined by applying the quantities indicated in Table 2A to
To provide for re-testing by the original or by anoth- the seeds without coating material.
er seed testing laboratory, samples on which ISTA Cer- A seed lot in excess of the prescribed quantity must
tificates have been issued must be stored at least for one be subdivided into seed lots not larger than the prescribed
year from the receipt of the sample. Submitted samples quantity, each of which must be labelled or marked with a
in moisture proof containers, and samples of recalcitrant separate seed lot identification.
or intermediate species, must be stored under appropriate
conditions for as long as it can be expected that the results
of a re-test are not affected by the storage. 2.5.4.2 Large seed lots of Poaceae
When a re-test in a different testing laboratory is re-
quired, a portion must be drawn from the stored sample 2.5.4.2.1 Definitions
in accordance with 2.5.2.2, and submitted to the desig-
nated testing laboratory. The remainder must be retained Large seed lots of Poaceae species may have a maximum
in store. size of 25 000 kg (with a 5 % tolerance), if produced by an
approved production plant.
For the purposes of large seed lots of Poaceae species,
2.5.4 Conditions for issuing Orange the following species with similar characteristics are re-
International Seed Lot Certificates garded as two species groups:
The sampling methods laid down in the ISTA Rules must Species group 1:
be followed when seed samples are drawn for the issue of Lolium perenne, Lolium multiflorum, Lolium ×hybri-
Orange International Seed Lot Certificates. Further condi- dum (previously Lolium ×boucheanum), ×Festulolium,
tions have to be fulfilled as listed below. Festuca pratensis, Festuca arundinacea and Phleum
pratense.
2.5.4.1 Seed lot size Species group 2:

Festuca rubra, Festuca ovina, Festuca filiformis, Fes-
The seed lot must not exceed the quantity indicated in col- tuca heterophylla, Dactylis glomerata, Poa pratensis and
umn 2 of Table 2A, subject to a tolerance of 5 % with the Poa trivialis.
Chapter 2: Sampling
exception of:
Approval which was granted following heterogeneity test-
a) seed being transported loose in bulk containers. The ing of any species of a group is also valid for all other
conditions under which this exception may be permit- species of the same group.
ted are laid down in Chapter 17. For all other species of Poaceae, approval must be
requested and granted separately for each individual
b) seed pellets, seed granules, seed tapes or seed mats. species.
The maximum number of seeds that a seed lot of seed
pellets, seed granules, seed tapes or seed mats may

2.5.4.2.2 Approval – ensuring that the testing is done by an ISTA-accredited

laboratory;
Approval is granted after heterogeneity testing of six large – the check-sampling programme.
seed lots of the species group or individual species for
which the approval is requested. Heterogeneity testing
must be carried out according to 2.9, and must as a mini- 2.5.4.3 Marking/labelling and sealing of
mum be based on purity and other seed count. At least five containers
of the six tested seed lots must have a non-significant level
of heterogeneity. The seed lot must be in marked/labelled containers which
are self-sealing, sealed (or capable of being sealed) or un-
der the control of the seed sampler.
2.5.4.2.3 Check sampling and testing Where the seed lot is already marked/labelled and
sealed before sampling, the seed sampler must verify the
After approval, the large seed lots of a production plant marking/labelling and sealing on the containers. Oth-
must be monitored by check sampling and further hetero- erwise the sampler has to mark/label the containers and
geneity testing, according to 2.9, and as a minimum based must seal every container before the seed lot leaves their
on purity and other seed count. control.
Of the first 100 large seed lots per species group, 4 The samplers are personally responsible for the seals,
are randomly selected (4 % check sampling) and tested labels and bags supplied to them and it is their duty to
for heterogeneity. If none of these are heterogeneous, the ensure that primary, composite or submitted samples must
check-sampling rate is reduced to 3 % for the following never be left in the hands of persons not authorised by the
100 lots, and to 2 % for subsequent lots. seed testing laboratory unless they are sealed in such a
However, if a check sample is found to show signifi- way that they cannot be tampered with.
cant heterogeneity, the check-sampling rate must remain
at 4 %, or again be increased from 3 to 4 % or from 2 to
3 %, as applicable (Fig. 2.1). 2.5.4.4 Sampling from the seed lot
In six consecutive check samples tested, a maximum
of one sample may show significant heterogeneity. For sampling from the seed lot methods listed under 2.5.1
Hence, a heterogeneous sample must be followed by must be used. Automatic seed samplers must be approved
at least five non-heterogeneous samples in order for ap- by the ISTA seed testing laboratory according to the “Pro-
proval to be retained (Fig. 2.1). tocol for the approval of automatic seed samplers” as ap-
proved by the ISTA membership and published on the
ISTA website.
2.5.4.2.4 Withdrawal of approval An Orange International Seed Lot Certificate issued on
a seed lot (see 2.2.1) is still valid after re-packaging the
If more than one of the last six consecutive check samples seed lot in new containers provided that:
tested shows significant heterogeneity, approval must be
withdrawn for the species or species group and produc- a)
The identity of the seed in the initial seed lot is
tion plant concerned, and the company must re-apply for preserved.
approval (Fig. 2.1).
b) The seed lot designation (see 2.2.10) is not changed.
2.5.4.2.5 Responsibility c) The moving of the seed into the new containers is done
under the control of an ISTA seed sampler.
The Certifying or Designated Authority in a country is re-
sponsible for: d) There is no processing of the seed during filling of the
Chapter 2: Sampling
– the decision of approval of the seed company (produc- new containers.

tion plant);
– ensuring that each production plant is approved sepa-
rately, if a seed company has more than one production
plant;

START
6 large seed lots are tested for

heterogeneity
Yes
At least 5 lots acceptable? No Reapply for approval? No END
Yes
Approval granted
Check sample Check sample

No
APPROVAL
Homogeneous? Homogeneous? No
WITHDRAWN
Yes Yes
(4 random samples from 100 large lots)
Check sample No Check sample

4 % check sampling
APPROVAL
WITHDRAWN
Yes Yes
APPROVAL
WITHDRAWN
Yes Yes
APPROVAL
WITHDRAWN
Yes Yes
No
Check sample Check sample APPROVAL
WITHDRAWN
No
Check sample
Homogeneous? Homogeneous?
(3 random samples from 100 large lots)
APPROVAL
Yes Yes Homogeneous? No
WITHDRAWN
3 % check sampling
No Yes
Check sample APPROVAL RETAINED Check sample
APPROVAL
WITHDRAWN
Yes Yes
APPROVAL
WITHDRAWN
Yes Yes

(2 random samples from 100 large
APPROVAL
Homogeneous? No Homogeneous? No
2 % check sampling
WITHDRAWN
Chapter 2: Sampling
Yes Yes

lots)
APPROVAL
Homogeneous? No Homogeneous? No
WITHDRAWN
Yes Yes
APPROVAL RETAINED
Figure 2.1. Flow chart describing the approval procedure and check-sampling programme with regard to large seed lots
of Poaceae species (2.5.4.2.2–4).

2.5.4.5 Submitted sample 2.5.4.6 Sample reduction
The minimum sizes of submitted samples are as follows: For sample reduction, methods listed under 2.5.2.2 must
– If a determination of other seeds by number is re- be used.
quired: the weight prescribed in Table 2A, column 3;
or
– if a determination of other seeds by number is not re- 2.5.4.7 Storage of submitted samples after
quired: the weight prescribed for the working sample testing
for purity analysis in Table 2A, column 4, or in 3.5.1.
Submitted samples on which ISTA Certificates have been
For certain tests or under certain conditions, the following issued must be stored. In the case of small seed lots (see
exceptions apply: 2.2.14), the remainder of the submitted sample, minus 25
seeds for assurance of identity, may be sent back to the ap-
a) For coated seeds, if a determination of other seeds plicant. The seed testing laboratory cannot be held respon-
by number or size grading is required: the number of sible for any deterioration of the sample during storage.
seeds indicated in Table 2B, Parts 1 and 2, column 2.
b) For coated seeds, if a determination of other seeds by 2.6 Calculation and expression of
number or size grading is not required: the number results
of seeds indicated for the working sample for purity
analysis in Table 2B, Parts 1 and 2, column 3. No specific calculation or expression of results required
except under 2.9 for heterogeneity tests.
c) For moisture determination of species that must be
ground (see Table 9A): 100 g. For all other species:
50 g. 2.7 Reporting of results
When moisture meters are to be used for testing, a No specific calculation or expression of results required
larger sample size may be necessary. Contact the ac- except under 2.9 for heterogeneity tests.
credited ISTA laboratory for specific instructions.
d) For verification of species and variety: as prescribed in

Chapter 8.
e) For germination or viability tests of small seed lots

(2.2.14): the number of seeds required to complete one
of these tests plus 25 seeds for identity assurance.
f) For determination of other seeds of small seed lots

(2.2.14): the amount necessary to complete this test
according to Chapter 4.
If the submitted sample is smaller than prescribed above,

the sampler must be notified accordingly and analysis
withheld until sufficient seed is received in a single sub-
mitted sample.
The submitted sample must be sealed and labelled or
Chapter 2: Sampling
marked.

2.8 Tables for lot size and sample Note 1: Names with an asterisk are not included in the
sizes ISTA List of Stabilised Plant Names. Names without
an asterisk are included in the ISTA List of Stabilised
Table 2A is referred to in various chapters of the ISTA Plant Names (but not the synonym which follows
Rules and indicates weights of lots and samples for differ- some of these names), or, in the case of generic names
ent species, and the specific names to be used in reporting (e.g. Pyrus spp.) conserved by the International Bo-
test results. Each sample size is derived from a nominal tanical Congress and listed in the International Code of
thousand-seed weight (TSW) for each species which, on Nomenclature. Changes in the stabilised list agreed at
the available evidence, is expected to be adequate for the the 2013 ISTA Congress are included in this version of
majority of samples tested. Table 2A. Where plant names have been changed, the
Where a weight is not given in the table and a count old name is included with a cross reference to the new
of other species is requested, the submitted sample must name. This applies only to 2013 Congress changes;
contain a minimum of 25 000 seeds. previous cross references have been removed.
Note 2: For all species the maximum seed lot size stated
can be exceeded by no more than 5 %, except for:
a) seed being transported loose in bulk containers. The

conditions under which this exception may be per-
mitted are stated in Chapter 17;
b) seed pellets, seed granules, seed tapes or seed mats

(see 2.5.4.1);
c) species of Poaceae listed in Table 2A Part 1 (see

2.5.4.2).

For production plants approved under 2.5.4.2, the
maximum seed lot weight for Poaceae species listed
in Table 2A Part 1 is 25 000 kg (with a 5 % tolerance).
Chapter 2: Sampling

Table 2A Part 1. Lot sizes and sample sizes: agricultural and vegetable seeds
Species Maximum Minimum Minimum working samples (g)

weight of lot (kg) submitted
(except see 2.8 sample (g)
Note 2) Purity Other seeds by
analysis number (4.5.1)
(3.5.1)
1 2 3 4 5
Abelmoschus esculentus (L.) Moench 20 000 1 000 140 1 000
Achillea millefolium L. 10 000 5 0.5 5
Aeschynomene americana L. 10 000 120 12 120
Agropyron cristatum (L.) Gaertn. 10 000 40 4 40
Agropyron desertorum (Fisch. ex Link) Schult. 10 000 60 6 60
Agrostis canina L. 10 000 5 0.25 2.5
Agrostis capillaris L. 10 000 5 0.25 2.5
Agrostis gigantea Roth 10 000 5 0.25 2.5
Agrostis stolonifera L. (includes A. palustris Hudson) 10 000 5 0.25 2.5
Allium cepa L. 10 000 80 8 80
Allium fistulosum L. 10 000 50 5 50
Allium porrum L. 10 000 70 7 70
Allium schoenoprasum L. 10 000 30 3 30
Allium tuberosum Rottler ex Spreng. 10 000 100 10 100
Alopecurus pratensis L. 10 000 30 3 30
Alysicarpus vaginalis (L.) DC. 10 000 40 4 40
Andropogon gayanus Kunth 10 000 80 8 80
Andropogon gerardi Vitman 10 000 70 7 70
Andropogon hallii Hack. 10 000 100 10 100
Anethum graveolens L. 10 000 40 4 40
Anthoxanthum odoratum L. 10 000 20 2 20
Anthriscus cerefolium (L.) Hoffm. 10 000 60 6 60
Anthyllis vulneraria L. 10 000 60 6 60
Apium graveolens L. 10 000 10 1 10
Arachis hypogaea L. 30 000 1 000 1 000 1 000
Arctium lappa L. 10 000 50 5 50
Arrhenatherum elatius (L.) P.Beauv. ex J.Presl & C.Presl 10 000 80 8 80
Asparagus officinalis L. 20 000 1 000 100 1 000
Astragalus cicer L. 10 000 90 9 90
Astrebla lappacea (Lindl.) Domin 10 000 200 20 200
Atriplex hortensis L. 5 000 10 2.5 –
Atropa belladonna L. 10 000 30 3 30
Avena nuda L. 30 000 1 000 120 1 000
Avena sativa L. 30 000 1 000 120 1 000
Avena strigosa Schreb. 30 000 500 50 500
Axonopus compressus (Sw.) P.Beauv. 10 000 10 1 10
Axonopus fissifolius (Raddi) Kuhlm. 10 000 10 1 10
Beckmannia eruciformis (L.) Host 10 000 20 2 20
Beta vulgaris L. (multi-germ varieties) 20 000 500 50 500
Beta vulgaris L. (mono-germ varieties) 20 000 500 30 300
Borago officinalis L. 10 000 450 45 450
Bothriochloa insculpta (Hochst. ex A.Rich.) A.Camus 10 000 20 2 20
Chapter 2: Sampling
Bothriochloa pertusa (L.) A.Camus 10 000 10 1 10

Bouteloua gracilis (Kunth) Lag. ex Griffiths 10 000 60 6 60
Brachiaria brizantha (Hochst. ex A.Rich) Stapf 10 000 100 10 100
Brachiaria decumbens Stapf 10 000 100 10 100
Brachiaria humidicola (Rendle) Schweick. 10 000 100 10 100
Brachiaria mutica (Forssk.) Stapf 10 000 30 3 30
Brachiaria ramosa (L.) Stapf 10 000 90 9 90
Brachiaria ruziziensis R.Germ. & C.M.Evrard 20 000 150 15 150
Brassica carinata A. Braun 10 000 100 10 100
Brassica juncea (L.) Czern. 10 000 40 4 40

Table 2A Part 1. Lot sizes and sample sizes: agricultural and vegetable seeds (continued)

(3.5.1)
1 2 3 4 5
Brassica napus L. 10 000 100 10 100
Brassica napus L. var. napobrassica (L.) Rchb.* 10 000 100 10 100
Brassica nigra (L.) W.D.J.Koch 10 000 40 4 40
Brassica oleracea L. (all varieties) 10 000 100 10 100
Brassica rapa L. (includes B. campestris L. and species 10 000 70 7 70
previously known as B. chinensis, B. pekinensis and B.
perviridis)
Bromus arvensis L. 10 000 60 6 60
Bromus carinatus Hook. & Arn. 10 000 200 20 200
Bromus catharticus Vahl 10 000 200 20 200
Bromus erectus Huds. 10 000 100 10 100
Bromus hordeaceus L. 10 000 50 5 50
Bromus inermis Leyss. 10 000 90 9 90
Bromus marginatus Steud. 10 000 200 20 200
Bromus riparius Rehmann 10 000 90 9 90
Bromus sitchensis Trin. 10 000 200 20 200
Cajanus cajan (L.) Huth 20 000 1 000 300 1 000
Calopogonium mucunoides Desv. 20 000 400 40 400
Camelina sativa (L.) Crantz 10 000 40 4 40
Cannabis sativa L. 10 000 600 60 600
Capsicum spp. 10 000 150 15 150
Carthamus tinctorius L. 25 000 900 90 900
Carum carvi L. 10 000 80 8 80
Cenchrus ciliaris L. (fascicles) 10 000 60 6 60
Cenchrus setiger Vahl 20 000 150 15 150
Centrosema molle Mart. ex Benth. (previously Centrosema 20 000 600 60 600
pubescens Benth.)
Centrosema pascuorum Mart. ex Benth. 20 000 550 55 550
(Centrosema pubescens Benth. see Centrosema molle Mart.
ex Benth.)
Chamaecrista rotundifolia (Pers.) Greene 10 000 100 10 100
Chloris gayana Kunth 10 000 10 1 10
Cicer arietinum L. 30 000 1 000 1 000 1 000
Cichorium endivia L. 10 000 40 4 40
Cichorium intybus L. 10 000 50 5 50
Citrullus lanatus (Thunb.) Matsum. & Nakai 20 000 1 000 250 1 000
Claytonia perfoliata Donn ex Willd. 10 000 20 2 20
Corchorus capsularis L. 10 000 150 15 150
Corchorus olitorius L. 10 000 150 15 150
Coriandrum sativum L. 10 000 400 40 400
Crambe abyssinica Hochst. ex R.E.Fr. 10 000 200 20 200
Crotalaria brevidens Benth. (includes Crotalaria intermedia 10 000 150 15 150
Chapter 2: Sampling
Kotschy)
Crotalaria juncea L. 10 000 700 70 700
Crotalaria lanceolata E.Mey. 10 000 70 7 70
Crotalaria pallida Aiton 10 000 150 15 150
Crotalaria spectabilis Roth 10 000 350 35 350
Cucumis melo L. 10 000 150 70 –
Cucumis sativus L. 10 000 150 70 –
Cucumis spp. 10 000 150 70 –
Cucurbita maxima Duchesne 20 000 1 000 700 1 000


(3.5.1)
1 2 3 4 5
Cucurbita moschata Duchesne 10 000 350 180 –
Cucurbita pepo L. 20 000 1 000 700 1 000
Cucurbita spp. 10 000 350 180 –
Cucurbita hybrids 10 000 350 180 –
Cuminum cyminum L. 10 000 60 6 60
Cyamopsis tetragonoloba (L.) Taub. 20 000 1 000 100 1 000
Cynara cardunculus L. 10 000 900 90 900
Cynodon dactylon (L.) Pers. 10 000 10 1 10
Cynosurus cristatus L. 10 000 20 2 20
Dactylis glomerata L. 10 000 30 3 30
Daucus carota L. 10 000 30 3 30
Deschampsia cespitosa (L.) P.Beauv. 10 000 10 1 10
Deschampsia flexuosa (L.) Trin. 10 000 10 1 10
Desmodium intortum (Mill.) Urb. 10 000 40 4 40
Desmodium uncinatum (Jacq.) DC. 20 000 120 12 120
Dichanthium aristatum (Poir.) C.E.Hubb. 10 000 30 3 30
Dichondra micrantha Urb. (previously Dichondra repens 10 000 50 5 50
J.R.Forst. & G.Forst.)
Digitaria eriantha Steud. (includes Digitaria decumbens 10 000 12 1.2 12
Stent)
Echinochloa crus-galli (L.) P.Beauv. 10 000 80 8 80
Ehrharta calycina Sm. 10 000 40 4 40
Eleusine coracana (L.) Gaertn. 10 000 60 6 60
Elymus lanceolatus (Scribn. & J.G.Sm.) Gould 10 000 80 8 80
Elymus trachycaulus (Link) Gould ex Shinners 10 000 80 8 80
Elytrigia elongata (Host) Nevski 10 000 200 20 200
Elytrigia intermedia (Host) Nevski 10 000 150 15 150
Elytrigia repens (L.) Desv. ex Nevski 10 000 100 10 100
Eragrostis curvula (Schrad.) Nees 10 000 10 1 10
Eragrostis tef (Zuccagni) Trotter 10 000 10 1 10
Eruca sativa Mill. 10 000 40 4 40
Fagopyrum esculentum Moench 10 000 600 60 600
Festuca arundinacea Schreb. 10 000 50 5 50
Festuca filiformis Pourr. 10 000 25 2.5 25
Festuca heterophylla Lam. 10 000 60 6 60
Festuca ovina L. (all varieties) 10 000 25 2.5 25
Festuca pratensis Huds. 10 000 50 5 50
Festuca rubra L. s.l. (all varieties) 10 000 30 3 30
Festuca trachyphylla (Hack.) Krajina (synonym Festuca 10 000 25 2.5 25
brevipila R.Tracey)
×Festulolium Asch. & Graebn. 10 000 60 6 60
Foeniculum vulgare Mill. 10 000 180 18 180
Chapter 2: Sampling
Fragaria spp. 10 000 10 1 10

Galega orientalis Lam. 10 000 200 20 200
Glycine max (L.) Merr. 30 000 1 000 500 1 000
Gossypium spp. 25 000 1 000 350 1 000
Hedysarum coronarium L. (fruit) 10 000 300 30 300
Hedysarum coronarium L. (seed) 10 000 120 12 120
Helianthus annuus L. 25 000 1 000 200 1 000
Hibiscus cannabinus L. 10 000 700 70 700
Holcus lanatus L. 10 000 10 1 10


(3.5.1)
1 2 3 4 5
Hordeum vulgare L. 30 000 1 000 120 1 000
Ipomoea aquatica Forssk. 20 000 1 000 100 1 000
Koeleria macrantha (Ledeb.) Schult. 10 000 10 1 10
Kummerowia stipulacea (Maxim.) Makino 10 000 50 5 50
Kummerowia striata (Thunb.) Schindl. 10 000 40 4 40
Lablab purpureus (L.) Sweet 20 000 1 000 600 1 000
Lactuca sativa L. 10 000 30 3 30
Lagenaria siceraria (Molina) Standl. 20 000 1 000 500 1 000
Lathyrus cicera L. 20 000 1 000 140 1 000
Lathyrus hirsutus L. 10 000 700 70 700
Lathyrus sativus L. 20 000 1 000 450 1 000
Lens culinaris Medik. 30 000 600 60 600
Lepidium sativum L. 10 000 60 6 60
Lespedeza juncea (L. f.) Pers. 10 000 30 3 30
Leucaena leucocephala (Lam.) de Wit 20 000 1 000 100 1 000
Linum usitatissimum L. 10 000 150 15 150
Listia bainesii (Baker) B.-E. van Wyk & Boatwr. (previously 10 000 10 1 10
Lotononis bainesii Baker)
Lolium ×hybridum Hausskn. (previously Lolium 10 000 60 6 60
×boucheanum Kunth)
Lolium multiflorum Lam. 10 000 60 6 60
Lolium perenne L. 10 000 60 6 60
Lolium rigidum Gaudin 10 000 60 6 60
(Lotononis bainesii Baker see Listia bainesii (Baker) B.-E.
van Wyk & Boatwr.)
Lotus corniculatus L. 10 000 30 3 30
Lotus tenuis Waldst. & Kit. ex Willd. 10 000 30 3 30
Lotus uliginosus Schkuhr 10 000 20 2 20
Luffa acutangula (L.) Roxb. 20 000 1 000 400 1 000
Luffa aegyptiaca Mill. 20 000 1 000 250 1 000
Lupinus albus L. 30 000 1 000 450 1 000
Lupinus angustifolius L. 30 000 1 000 450 1 000
Lupinus luteus L. 30 000 1 000 450 1 000
(Lycopersicon esculentum Mill. see Solanum lycopersicum
L.)
(Lycopersicon spp. see Solanum (sect. Lycopersicon) spp.)
(Lycopersicon hybrids see Solanum (sect. Lycopersicon)
hybrids)
Macroptilium atropurpureum (DC.) Urb. 20 000 350 35 350
Macroptilium lathyroides (L.) Urb. 20 000 200 20 200
Macrotyloma axillare (E.Mey.) Verdc. 20 000 250 25 250
Macrotyloma uniflorum (Lam.) Verdc. 20 000 800 80 800
Medicago arabica (L.) Huds. (in burr) 10 000 600 60 600
Chapter 2: Sampling
Medicago arabica (L.) Huds. (out of burr) 10 000 50 5 50
Medicago italica (Mill.) Fiori (includes Medicago tornata (L.) 10 000 100 10 100
Mill.)
Medicago littoralis Rohde ex Loisel. 10 000 70 7 70
Medicago lupulina L. 10 000 50 5 50
Medicago orbicularis (L.) Bartal. 10 000 80 8 80
Medicago polymorpha L. 10 000 70 7 70
Medicago rugosa Desr. 10 000 180 18 180
Medicago sativa L. 10 000 50 5 50


(3.5.1)
1 2 3 4 5
Medicago scutellata (L.) Mill. 10 000 400 40 400
Medicago truncatula Gaertn. 10 000 100 10 100
Melilotus albus Medik. 10 000 50 5 50
Melilotus indicus (L.) All. 10 000 50 5 50
Melilotus officinalis (L.) Lam. 10 000 50 5 50
Melinis minutiflora P.Beauv. 10 000 5 0.5 5
Momordica charantia L. 20 000 1 000 450 1 000
Mucuna pruriens (L.) DC. (includes species previously 20 000 1 000 1 000 1 000
known as M. aterrima (Piper & Tracy) Holland, M.
cochinchinensis (Lour.) A.Chev. and Stizolobium
deeringianum Bort.)
Nasturtium officinale R.Br. 10 000 5 0.5 5
Neonotonia wightii (Wight & Arn.) J.A.Lackey 10 000 150 15 150
Nicotiana tabacum L. 10 000 5 0.5 5
Ocimum basilicum L. 10 000 40 4 40
Oenothera biennis L. 10 000 10 1 10
Onobrychis viciifolia Scop. (fruit) 10 000 600 60 600
Onobrychis viciifolia Scop. (seed) 10 000 400 40 400
Origanum majorana L. 10 000 5 0.5 5
Origanum vulgare L. 10 000 5 0.5 5
Ornithopus compressus L. 10 000 120 12 120
Ornithopus sativus Brot. 10 000 90 9 90
Oryza sativa L. 30 000 700 70 700
Panicum antidotale Retz. 10 000 20 2 20
Panicum coloratum L. 10 000 20 2 20
Panicum maximum Jacq. 10 000 20 2 20
Panicum miliaceum L. 10 000 150 15 150
Panicum virgatum L. 10 000 30 3 30
Papaver somniferum L. 10 000 10 1 10
Pascopyrum smithii (Rydb.) Barkworth & D.R.Dewey 10 000 150 15 150
Paspalum dilatatum Poir. 10 000 50 5 50
Paspalum notatum Flüggé 10 000 70 7 70
Paspalum plicatulum Michx. 10 000 40 4 40
Paspalum scrobiculatum L. 10 000 80 8 80
Paspalum urvillei Steud. 10 000 30 3 30
Paspalum virgatum L. (previously Paspalum wettsteinii 10 000 30 3 30
Hack.)
Pastinaca sativa L. 10 000 100 10 100
Pennisetum clandestinum Hochst. ex Chiov. 10 000 70 7 70
Pennisetum glaucum (L.) R.Br. 10 000 150 15 150
Petroselinum crispum (Mill.) Fuss 10 000 40 4 40
Phacelia tanacetifolia Benth. 10 000 50 5 50
Chapter 2: Sampling
Phalaris aquatica L. 10 000 40 4 40

Phalaris arundinacea L. 10 000 30 3 30
Phalaris canariensis L. 10 000 200 20 200
Phaseolus coccineus L. 30 000 1 000 1 000 1 000
Phaseolus lunatus L. 30 000 1 000 1 000 1 000
Phaseolus vulgaris L. 30 000 1 000 700 1 000
Phleum nodosum L. 10 000 10 1 10
Phleum pratense L. 10 000 10 1 10
Physalis pubescens L. 10 000 20 2 20
Pimpinella anisum L. 10 000 70 7 70


(3.5.1)
1 2 3 4 5
Piptatherum miliaceum (L.) Coss. 10 000 20 2 20
Pisum sativum L. s.l. 30 000 1 000 900 1 000
Plantago lanceolata L. 10 000 60 6 60
Poa annua L. 10 000 10 1 10
Poa bulbosa L. 10 000 30 3 30
Poa compressa L. 10 000 5 0.5 5
Poa nemoralis L. 10 000 5 0.5 5
Poa palustris L. 10 000 5 0.5 5
Poa pratensis L. 10 000 5 1 5
Poa secunda J.Presl (includes Poa ampla Merr.) 10 000 15 1.5 15
Poa trivialis L. 10 000 5 1 5
Portulaca oleracea L. 10 000 5 0.5 5
Psathyrostachys juncea (Fisch.) Nevski 10 000 60 6 60
Pseudoroegneria spicata (Pursh) Á.Löve 10 000 80 8 80
Psophocarpus tetragonolobus (L.DC. 20 000 1 000 1 000 1 000
Pueraria lobata (Willd.) Ohwi 10 000 350 35 350
Pueraria phaseoloides (Roxb.) Benth. 20 000 300 30 300
Raphanus sativus L. 10 000 300 30 300
Rheum rhaponticum L. 10 000 450 45 450
Ricinus communis L. 20 000 1 000 500 1 000
Rosmarinus officinalis L. 10 000 30 3 30
Rumex acetosa L. 10 000 30 3 30
Sanguisorba minor Scop. 10 000 250 25 250
Satureja hortensis L. 10 000 20 2 20
Schizachyrium scoparium (Michx.) Nash 10 000 50 5 50
Scorzonera hispanica L. 10 000 300 30 300
Secale cereale L. 30 000 1 000 120 1 000
Securigera varia (L.) Lassen 10 000 100 10 100
Sesamum indicum L. 10 000 70 7 70
Setaria italica (L.) P.Beauv. 10 000 90 9 90
Setaria sphacelata (Schumach.) Stapf & C.E.Hubb. 10 000 30 3 30
Sinapis alba L. 10 000 200 20 200
Solanum (sect. Lycopersicon) spp. (previously Lycopersicon 10 000 15 7 –
spp.)
Solanum (sect. Lycopersicon) hybrids (previously 10 000 15 7 –
Lycopersicon hybrids)
Solanum lycopersicum L. (previously Lycopersicon 10 000 15 7 –
esculentum Mill.)
Solanum melongena L. 10 000 150 15 150
Solanum nigrum L. 10 000 25 2.5 25
Solanum tuberosum L. 10 000 25 10 –
Sorghastrum nutans (L.) Nash 10 000 70 7 70
Chapter 2: Sampling
Sorghum ×almum Parodi 30 000 200 20 200

Sorghum bicolor (L.) Moench 30 000 900 90 900
Sorghum bicolor (L.) Moench × S. sudanense (Piper) Stapf 30 000 300 30 300
Sorghum halepense (L.) Pers. 10 000 90 9 90
Sorghum sudanense (Piper) Stapf 10 000 250 25 250
Spergula arvensis L. 10 000 40 4 40
Spinacia oleracea L. 10 000 250 25 250
Stylosanthes guianensis (Aubl.) Sw. 10 000 70 7 70
Stylosanthes hamata (L.) Taub. 10 000 70 7 70


(3.5.1)
1 2 3 4 5
Stylosanthes humilis Kunth 10 000 70 7 70
Stylosanthes scabra Vogel 10 000 80 8 80
Taraxacum officinale F.H.Wigg., s.l. 10 000 30 3 30
Tetragonia tetragonoides (Pall.) Kuntze 20 000 1 000 200 1 000
Thymus vulgaris L. 10 000 5 0.5 5
Tragopogon porrifolius L. 10 000 400 40 400
Trifolium alexandrinum L. 10 000 60 6 60
Trifolium campestre Schreb. 10 000 5 0.5 5
Trifolium dubium Sibth. 10 000 20 2 20
Trifolium fragiferum L. 10 000 40 4 40
Trifolium glomeratum L. 10 000 10 1 10
Trifolium hirtum All. 10 000 70 7 70
Trifolium hybridum L. 10 000 20 2 20
Trifolium incarnatum L. 10 000 80 8 80
Trifolium lappaceum L. 10 000 20 2 20
Trifolium michelianum Savi (includes Trifolium balansae 10 000 20 2 20
Boiss.)
Trifolium pratense L. 10 000 50 5 50
Trifolium repens L. 10 000 20 2 20
Trifolium resupinatum L. 10 000 20 2 20
Trifolium semipilosum Fresen. 10 000 20 2 20
Trifolium squarrosum L. 10 000 150 15 150
Trifolium subterraneum L. 10 000 250 25 250
Trifolium vesiculosum Savi 10 000 30 3 30
Trigonella foenum-graecum L. 10 000 450 45 450
Trisetum flavescens (L.) P.Beauv. 10 000 5 0.5 5
×Triticosecale Wittm. ex A.Camus 30 000 1 000 120 1 000
Triticum aestivum L. 30 000 1 000 120 1 000
Triticum dicoccon Schrank 30 000 1 000 270 1 000
Triticum durum Desf. 30 000 1 000 120 1 000
Triticum spelta L. 30 000 1 000 270 1 000
Urochloa mosambicensis (Hack.) Dandy 10 000 30 3 30
Valerianella locusta (L.) Laterr. 10 000 70 7 70
Vicia benghalensis L. 30 000 1 000 120 1 000
Vicia ervilia (L.) Willd. 30 000 1 000 120 1 000
Vicia faba L. 30 000 1 000 1 000 1 000
Vicia narbonensis L. 30 000 1 000 600 1 000
Vicia pannonica Crantz 30 000 1 000 120 1 000
Vicia sativa L. (includes V. angustifolia L.) 30 000 1 000 140 1 000
Vicia villosa Roth (includes V. dasycarpa Ten.) 30 000 1 000 100 1 000
Vigna angularis (Willd.) Ohwi & H.Ohashi 30 000 1 000 250 1 000
Vigna marina (Burm.) Merr. 30 000 800 80 800
Chapter 2: Sampling
Vigna mungo (L.) Hepper 30 000 1 000 700 1 000

Vigna radiata (L.) R.Wilczek 30 000 1 000 120 1 000
Vigna subterranea (L.) Verdc. 30 000 1 000 500 1 000
Vigna unguiculata (L.) Walp. 30 000 1 000 400 1 000
Zea mays L. 40 000 1 000 900 1 000
Zoysia japonica Steud. 10 000 10 1 10

Table 2A Part 2. Lot sizes and sample sizes: tree and shrub seeds
Species Maximum weight Minimum submit- Minimum working sample for

of lot (kg) (except ted sample (g) purity analysis (3.5.1) (g)
see 2.8 Note 2)
1 2 3 4
Abies alba Mill. 1 000 240 120
Abies amabilis Douglas ex J.Forbes 1 000 200 100
Abies balsamea (L.) Mill. 1 000 40 20
Abies cephalonica Loudon 1 000 360 180
Abies cilicica (Antoine & Kotschy) Carrière 1 000 1 000 500
Abies concolor (Gordon & Glend.) Lindl. ex Hildebr. 1 000 160 80
Abies firma Siebold & Zucc. 1 000 200 100
Abies fraseri (Pursh) Poir. 1 000 40 20
Abies grandis (Douglas ex D.Don) Lindl. 1 000 100 50
Abies homolepis Siebold & Zucc. 1 000 80 40
Abies lasiocarpa (Hook.) Nutt. 1 000 50 25
Abies magnifica A.Murray 1 000 400 200
Abies nordmanniana (Steven) Spach 1 000 360 180
Abies numidica de Lannoy ex Carrière 1 000 500 250
Abies pinsapo Boiss. 1 000 320 160
Abies procera Rehder 1 000 160 80
Abies sachalinensis (F.Schmidt) Mast. 1 000 60 30
Abies veitchii Lindl. 1 000 40 20
Acacia spp. 1 000 70 35
Acer campestre L. 1 000 400 200
Acer negundo L. 500 200 100
Acer palmatum Thunb. 500 100 50
Acer platanoides L. 500 700 350
Acer pseudoplatanus L. 500 600 300
Acer rubrum L. 500 100 50
Acer saccharinum L. 500 1 000 500
Acer saccharum Marshall 500 360 180
Aesculus hippocastanum L. 5 000 500 seeds 500 seeds
Ailanthus altissima (Mill.) Swingle 1 000 160 80
Alnus cordata (Loisel.) Duby 1 000 12 6
Alnus glutinosa (L.) Gaertn. 1 000 8 4
Alnus incana (L.) Moench 1 000 4 2
Alnus rubra Bong. 1 000 4 2
Amorpha fruticosa L. 1 000 1 000 150
Berberis aquifolium Pursh (previously Mahonia aquifolium 1 000 60 30
(Pursh) Nutt.)
Betula papyrifera Marshall 300 10 3
Betula pendula Roth 300 10 1
Betula pubescens Ehrh. 300 10 1
Calocedrus decurrens (Torr.) Florin 300 160 80
Caragana arborescens Lam. 1 000 160 80
Carica papaya L. 1 000 100 50
Carpinus betulus L. 1 000 500 250
Castanea sativa Mill. 5 000 500 seeds 500 seeds
Chapter 2: Sampling
Catalpa spp.* 1 000 120 60

Cedrela spp. 1 000 80 40
Cedrus atlantica (Endl.) G.Manetti ex Carrière 1 000 400 200
Cedrus deodara (Roxb. ex D.Don) G.Don 1 000 600 300
Cedrus libani A.Rich. 1 000 400 200
Chamaecyparis lawsoniana (A.Murray) Parl. 1 000 20 6
Chamaecyparis nootkatensis (D.Don) Spach 1 000 20 10
Chamaecyparis obtusa (Siebold & Zucc.) Endl. 1 000 12 6
Chamaecyparis pisifera (Siebold & Zucc.) Endl. 1 000 10 3
Chamaecyparis thyoides (L.) Britton et al. 1 000 10 3

Table 2A Part 2. Lot sizes and sample sizes: tree and shrub seeds (continued)

see 2.8 Note 2)
1 2 3 4
Cornus mas L. 1 000 1 000 600
Cornus sanguinea L. 1 000 300 150
Corylus avellana L. 5 000 500 fruits 500 fruits
Corymbia citriodora (Hook.) K.D.Hill & L.A.S.Johnson 1 000 40 15
(previously Eucalyptus citriodora Hook.)
Corymbia ficifolia (F.Muell.) K.D.Hill & L.A.S.Johnson 1 000 40 15
(previously Eucalyptus ficifolia F.Muell.)
Corymbia maculata (Hook.) K.D.Hill & L.A.S.Johnson 1 000 40 15
(previously Eucalyptus maculata Hook.)
Cotoneaster spp.* 1 000 40 20
Crataegus monogyna Jacq. 1 000 400 200
Cryptomeria japonica (L. f.) D.Don 1 000 20 10
Cupressus arizonica Greene 1 000 60 30
Cupressus macrocarpa Hartw. 1 000 40 20
Cupressus sempervirens L. 1 000 40 20
Cydonia oblonga Mill. 1 000 50 25
Cytisus scoparius (L.) Link 1 000 40 20
Elaeagnus angustifolia L. 1 000 800 400
Eucalyptus astringens (Maiden) Maiden 1 000 40 15
Eucalyptus botryoides Sm. 1 000 15 5
Eucalyptus bridgesiana R.T.Baker 1 000 30 10
Eucalyptus camaldulensis Dehnh. 1 000 15 5
Eucalyptus cinerea F.Muell. ex Benth. 1 000 30 10
(Eucalyptus citriodora Hook. see Corymbia citriodora
(Hook.) K.D.Hill & L.A.S.Johnson)
Eucalyptus cladocalyx F.Muell. 1 000 40 15
Eucalyptus cloeziana F.Muell. 1 000 40 15
Eucalyptus cypellocarpa L.A.S.Johnson 1 000 30 10
Eucalyptus dalrympleana Maiden 1 000 30 10
Eucalyptus deanei Maiden 1 000 15 5
Eucalyptus deglupta Blume 1 000 10 2
Eucalyptus delegatensis R.T.Baker 1 000 40 15
Eucalyptus elata Dehnh. 1 000 40 15
Eucalyptus fastigata H.Deane & Maiden 1 000 40 15
(Eucalyptus ficifolia F.Muell. see Corymbia ficifolia
(F.Muell.) K.D.Hill & L.A.S.Johnson)
Eucalyptus glaucescens Maiden & Blakely 1 000 40 15
Eucalyptus globulus Labill. (includes E. maidenii F.Muell. 1 000 60 20
and E. saint-johnii (R.T.Baker) R.T.Baker)
Eucalyptus grandis W.Hill ex Maiden 1 000 15 5
Eucalyptus gunnii Hook. f. 1 000 15 5
Eucalyptus largiflorens F.Muell. 1 000 15 5
Eucalyptus leucoxylon F.Muell. 1 000 30 10
Eucalyptus macrorhyncha F.Muell. ex Benth. 1 000 40 15
(Eucalyptus maculata Hook. see Corymbia maculata
Chapter 2: Sampling
(Hook.) K.D.Hill & L.A.S.Johnson)

Eucalyptus mannifera Mudie 1 000 15 5
Eucalyptus melliodora A.Cunn. ex Schauer 1 000 30 10
Eucalyptus microtheca F.Muell. 1 000 15 5
Eucalyptus moluccana Roxb. 1 000 30 10
Eucalyptus muelleriana A.W.Howitt 1 000 60 20
Eucalyptus nitens (H.Deane & Maiden) Maiden 1 000 30 10
Eucalyptus pauciflora Sieber ex Spreng. (includes E. 1 000 60 20
niphophila Maiden & Blakely)


see 2.8 Note 2)
1 2 3 4
Eucalyptus pilularis Sm. 1 000 60 20
Eucalyptus polybractea R.T.Baker 1 000 60 20
Eucalyptus radiata Sieber ex DC. 1 000 40 15
Eucalyptus regnans F.Muell. 1 000 30 10
Eucalyptus resinifera Sm. 1 000 30 10
Eucalyptus robusta Sm. 1 000 15 5
Eucalyptus rudis Endl. 1 000 15 5
Eucalyptus saligna Sm. 1 000 15 5
Eucalyptus sideroxylon A.Cunn. ex Woolls 1 000 30 10
Eucalyptus sieberi L.A.S.Johnson 1 000 40 15
Eucalyptus smithii R.T.Baker 1 000 30 10
Eucalyptus tereticornis Sm. 1 000 15 5
Eucalyptus viminalis Labill. 1 000 30 10
Euonymus europaeus L. 1 000 200 100
Fagus sylvatica L. 5 000 1 000 600
Fraxinus spp. 1 000 400 200
Ginkgo biloba L. 5 000 500 seeds 500 seeds
Gleditsia triacanthos L. 1 000 800 400
Ilex aquifolium L. 1 000 200 90
Juniperus communis L. (berries) 1 000 300 150
Juniperus communis L. (seeds) 1 000 40 20
Juniperus scopulorum Sarg. 1 000 70 35
Juniperus virginiana L. 1 000 100 50
Koelreuteria paniculata Laxm. 1 000 800 400
Laburnum alpinum (Mill.) J.Presl 1 000 140 70
Laburnum anagyroides Medik. 1 000 140 70
Larix decidua Mill. 1 000 35 17
Larix ×eurolepis A.Henry 1 000 35 16
Larix gmelinii (Rupr.) Rupr. 1 000 25 10
Larix kaempferi (Lamb.) Carrière 1 000 24 10
Larix laricina (D.Roi) K.Koch 1 000 25 10
Larix occidentalis Nutt. 1 000 25 10
Larix sibirica Ledeb. 1 000 25 10
Ligustrum vulgare L. 1 000 100 50
Liquidambar styraciflua L. 300 30 15
Liriodendron tulipifera L. 1 000 180 90
(Mahonia aquifolium (Pursh) Nutt. see Berberis aquifolium
Pursh)
Malus spp. (except M. sargentii, M. sylvestris) 1 000 50 25
Malus sargentii Rehder 1 000 24 12
Malus sylvestris (L.) Mill. 1 000 160 80
Malva sylvestris L. 5 000 30 15
Morus spp. 1 000 20 5
Nothofagus alpina (Poepp. & Endl.) Oerst. 1 000 50 25
Chapter 2: Sampling
Nothofagus obliqua (Mirb.) Blume 1 000 60 30

Picea abies (L.) H.Karst. 1 000 40 20
Picea engelmannii Parry ex Engelm. 1 000 16 8
Picea glauca (Moench) Voss 1 000 10 5
Picea glehnii (F.Schmidt) Mast. 1 000 25 9
Picea jezoensis (Siebold & Zucc.) Carrière 1 000 25 7
Picea koyamae Shiras. 1 000 25 9
Picea mariana (Mill.) Britton et al. 1 000 6 3
Picea omorika (Pančić) Purk. 1 000 25 8
Picea orientalis (L.) Link 1 000 30 15


see 2.8 Note 2)
1 2 3 4
Picea polita (Siebold & Zucc.) Carrière 1 000 80 40
Picea pungens Engelm. 1 000 30 15
Picea rubens Sarg. 1 000 25 9
Picea sitchensis (Bong.) Carrière 1 000 12 6
Pinus albicaulis Engelm. 1 000 700 350
Pinus aristata Engelm. 1 000 100 50
Pinus banksiana Lamb. 1 000 25 9
Pinus brutia Ten. 1 000 100 50
Pinus canariensis C.Sm. 1 000 60 30
Pinus caribaea Morelet 1 000 100 50
Pinus cembra L. 1 000 1 000 700
Pinus cembroides Zucc. 1 000 1 000 700
Pinus clausa (Chapm. ex Engelm.) Vasey ex Sarg. 1 000 40 20
Pinus contorta Douglas ex Loudon 1 000 25 9
Pinus coulteri D.Don 1 000 1 000 900
Pinus densiflora Siebold & Zucc. 1 000 60 30
Pinus echinata Mill. 1 000 50 25
Pinus edulis Engelm. 1 000 1 000 700
Pinus elliottii Engelm. 1 000 160 80
Pinus flexilis E.James 1 000 500 250
Pinus glabra Walter 1 000 80 40
Pinus halepensis Mill. 1 000 100 50
Pinus heldreichii Christ 1 000 120 60
Pinus jeffreyi Balf. 1 000 600 300
Pinus kesiya Royle ex Gordon ('khasya') 1 000 80 40
Pinus koraiensis Siebold & Zucc. 1 000 2 000 1 000
Pinus lambertiana Douglas 1 000 1 000 500
Pinus merkusii Jungh. & de Vriese 1 000 120 60
Pinus monticola Douglas ex D.Don 1 000 90 45
Pinus mugo Turra 1 000 40 20
Pinus muricata D.Don 1 000 50 25
Pinus nigra J.F.Arnold 1 000 100 50
Pinus oocarpa Schiede ex Schltdl. 1 000 70 35
Pinus palustris Mill. 1 000 500 250
Pinus parviflora Siebold & Zucc. 1 000 500 250
Pinus patula Schltdl. & Cham. 1 000 40 20
Pinus peuce Griseb. 1 000 240 120
Pinus pinaster Aiton 1 000 240 120
Pinus pinea L. 1 000 1 000 1 000
Pinus ponderosa P.Lawson & C.Lawson 1 000 200 100
Pinus pumila (Pall.) Regel 1 000 40 20
Pinus radiata D.Don 1 000 160 80
Pinus resinosa Aiton 1 000 50 25
Pinus rigida Mill. 1 000 40 20
Pinus strobus L. 1 000 90 45
Pinus sylvestris L. 1 000 40 20
Chapter 2: Sampling
Pinus tabuliformis Carrière 1 000 100 50

Pinus taeda L. 1 000 140 70
Pinus taiwanensis Hayata 1 000 100 50
Pinus thunbergii Parl. 1 000 70 35
Pinus virginiana Mill. 1 000 50 25
Pinus wallichiana A.B.Jacks. 1 000 250 125
Platanus spp. 1 000 25 6
Platycladus orientalis (L.) Franco 1 000 120 60
Populus spp. 50 5 2


see 2.8 Note 2)
1 2 3 4
Prunus avium (L.) L. 1 000 900 450
Prunus padus L. 1 000 360 180
Prunus persica (L.) Batsch 5 000 500 seeds 500 seeds
Prunus serotina Ehrh. 1 000 500 250
Prunus spp. (TSW ≤ 200 g 1 000 1 000 500
Prunus spp. (TSW > 200 g 1 000 500 seeds 500 seeds
Pseudotsuga menziesii (Mirb.) Franco 1 000 60 30
Pyrus spp. 1 000 180 90
Quercus spp. 5 000 500 seeds 500 seeds
Robinia pseudoacacia L. 1 000 100 50
Rosa spp. 1 000 50 25
Salix spp. 50 5 2
Sequoia sempervirens (D.Don) Endl. 1 000 25 12
Sequoiadendron giganteum (Lindl.) J.Buchholz 1 000 25 12
Sorbus spp. 1 000 25 10
Spartium junceum L. 1 000 40 20
Styphnolobium japonicum (L.) Schott 1 000 100 50
Syringa spp. 1 000 30 15
Taxodium distichum (L.) Rich. 300 500 250
Taxus spp. 1 000 320 160
Tectona grandis L. f. 1 000 2 000 1 000
Thuja occidentalis L. 1 000 25 4
Thuja plicata Donn ex D.Don 1 000 10 3
Tilia cordata Mill. 1 000 180 90
Tilia platyphyllos Scop. 1 000 500 250
Tsuga canadensis (L.) Carrière 1 000 25 7
Tsuga heterophylla (Raf.) Sarg. 1 000 10 4
Ulmus americana L. 1 000 30 15
Ulmus parvifolia Jacq. 1 000 20 8
Ulmus pumila L. 1 000 30 15
Viburnum opulus L. 1 000 160 80
Zelkova serrata (Thunb.) Makino 1 000 60 30
Chapter 2: Sampling

Table 2A Part 3. Lot sizes and sample sizes: flower, spice, herb and medicinal species
Species Maximum weight Minimum submit- Minimum working sam-

of lot (kg) ted sample (g) ple for purity analysis
(except see 2.8 (3.5.1) (g)
Note 2)
1 2 3 4
Abutilon ×hybridum hort. ex Voss 5 000 40 10
Achillea clavennae L. 5 000 5 0.5
Achillea filipendulina Lam. 5 000 5 0.5
Achillea ptarmica L. 5 000 5 0.5
Achillea umbellata Sm. 5 000 5 0.5
Adonis vernalis L. 5 000 20 5
Ageratum houstonianum Mill. 5 000 5 0.5
Agrimonia eupatoria L. 5 000 200 50
Alcea rosea L. 5 000 80 20
Althaea hybrids 5 000 80 20
Althaea officinalis L. 5 000 80 20
Alyssum argenteum All. 5 000 10 3
Alyssum montanum L. 5 000 10 3
Amaranthus caudatus L. 5 000 10 2
Amaranthus cruentus L. 5 000 10 2
Amaranthus hybridus L. 5 000 10 2
Amaranthus tricolor L. 5 000 10 2
Amberboa moschata (L.) DC. 5 000 40 10
Ammobium alatum R.Br. 5 000 5 1
Anagallis arvensis L. 5 000 10 2
Anchusa azurea Mill. 5 000 100 25
Anchusa capensis Thunb. 5 000 40 10
Anemone coronaria L. 5 000 10 3
Anemone pulsatilla L. 5 000 10 3
Anemone sylvestris L. 5 000 10 3
Angelica archangelica L. 5 000 40 10
Antirrhinum majus L. 5 000 5 0.5
Aquilegia alpina L. 5 000 20 4
Aquilegia canadensis L. 5 000 20 4
Aquilegia chrysantha A.Gray 5 000 20 4
Aquilegia ×cultorum Bergmans 5 000 20 4
Aquilegia vulgaris L. 5 000 20 4
Arabis alpina L. 5 000 10 2
Arabis ×arendsii H.R.Wehrh. 5 000 10 2
Arabis blepharophylla Hook. & Arn. 5 000 10 2
Arabis caucasica Willd. 5 000 10 2
Arabis procurrens Waldst. & Kit. 5 000 10 2
Arabis scopoliana Boiss. 5 000 10 2
Arctotis stoechadifolia P.J.Bergius 5 000 20 4
Armeria maritima (Mill.) Willd. 5 000 20 5
Artemisia absinthium L. 5 000 5 0.5
Artemisia dracunculus L. 5 000 5 0.5
Chapter 2: Sampling
Artemisia maritima L. 5 000 5 0.5

Artemisia vulgaris L. 5 000 5 0.5
Asclepias tuberosa L. 5 000 130 13
Asparagus aethiopicus L. (previously Asparagus densiflorus 10 000 200 60
(Kunth) Jessop)
Asparagus plumosus L. (previously Asparagus setaceus (Kunth) 10 000 200 50
Jessop)
Aster alpinus L. 5 000 20 5
Aster amellus L. 5 000 20 5
Aster dumosus L. 5 000 20 5

Table 2A Part 3. Lot sizes and sample sizes: flower, spice, herb and medicinal species (continued)

(except see 2.8 (3.5.1) (g)
Note 2)
1 2 3 4
Aubrieta deltoidea (L.) DC. (includes A. graeca Griseb.) 5 000 5 1
Aurinia saxatilis (L.) Desv. 5 000 10 3
Bassia scoparia (L.) A.J.Scott (previously Kochia scoparia (L.) 5 000 10 3
Schrad.)
Begonia Semperflorens-Cultorum Group 5 000 5 0.1
Begonia ×tuberhybrida Voss 5 000 5 0.1
Bellis perennis L. 5 000 5 0.5
Brachyscome iberidifolia Benth. 5 000 5 0.3
Briza maxima L. 5 000 40 10
Browallia viscosa Kunth 5 000 5 0.5
Brunnera macrophylla (Adams) I.M.Johnst. 5 000 40 10
Calceolaria ×herbeohybrida Voss 5 000 5 0.1
Calceolaria polyrrhiza Cav. 5 000 5 0.1
Calendula officinalis L. 5 000 80 20
Callistephus chinensis (L.) Nees 5 000 20 6
Campanula carpatica Jacq. 5 000 5 0.2
Campanula fragilis Cirillo 5 000 5 1
Campanula garganica Ten. 5 000 5 0.5
Campanula glomerata L. 5 000 5 0.2
Campanula lactiflora M.Bieb. 5 000 5 1
Campanula medium L. 5 000 5 0.6
Campanula persicifolia L. 5 000 5 0.2
Campanula portenschlagiana Schult. 5 000 5 0.5
Campanula pyramidalis L. 5 000 5 1
Campanula rapunculus L. 5 000 5 1
Celosia argentea L. 5 000 10 2
(Centaurea americana Nutt. see Plectocephalus americana
(Nutt.) D.Don)
Centaurea benedicta (L.) L. (previously Cnicus benedictus 5 000 300 75
L.)
Centaurea cyanus L. 5 000 40 10
(Centaurea dealbata Willd. see Psephellus dealbatus (Willd.)
K.Koch)
Centaurea gymnocarpa Moris & D.Not. 5 000 40 10
Centaurea imperialis Hausskn. ex Bornm. 5 000 40 10
Centaurea macrocephala Muss. Puschk. ex Willd. 5 000 40 10
Centaurea montana L. 5 000 40 10
Centaurea ragusina L. 5 000 40 10
Cerastium tomentosum L. 5 000 10 2
Chelidonium majus L. 5 000 5 1
Chrysanthemum indicum L. 5 000 30 8
Clarkia amoena (Lehm.) A.Nelson & J.F.Macbr. 5 000 5 1
Clarkia pulchella Pursh 5 000 5 1
Chapter 2: Sampling
Clarkia unguiculata Lindl. 5 000 5 1

Cleome hassleriana Chodat 5 000 20 5
(Cnicus benedictus L. see Centaurea benedicta (L.) L.)
Cobaea scandens Cav. 5 000 200 50
Coix lacryma-jobi L. 5 000 600 150
Coleostephus multicaulis (Desf.) Durieu 5 000 30 8
(Coleus blumei Benth. see Plectranthus scutellarioides (L.) R.Br.)
Consolida ajacis (L.) Schur 5 000 30 8


(except see 2.8 (3.5.1) (g)
Note 2)
1 2 3 4
Consolida regalis Gray 5 000 30 8
Convolvulus tricolor L. 5 000 100 25
Coreopsis basalis (A.Dietr.) S.F.Blake (includes C. drummondii 5 000 20 5
(D.Don) Torr. & A.Gray)
Coreopsis lanceolata L. 5 000 20 5
Coreopsis maritima (Nutt.) Hook. f. 5 000 5 1
Coreopsis tinctoria Nutt. 5 000 5 1
Cosmos bipinnatus Cav. 5 000 80 20
Cosmos sulphureus Cav. 5 000 80 20
Cyclamen persicum Mill. 5 000 100 30
Cymbalaria muralis G.Gaertn. et al. 5 000 5 0.2
Cynoglossum amabile Stapf & J.R.Drumm. 5 000 40 10
Dahlia pinnata Cav. 5 000 80 20
Datura metel L. 5 000 100 25
Datura stramonium L. 5 000 100 25
Delphinium ×belladonna hort. ex Bergmans 5 000 20 4
Delphinium cardinale Hook. 5 000 20 4
Delphinium ×cultorum Voss 5 000 20 4
Delphinium formosum Boiss. & A.Huet 5 000 20 4
Delphinium grandiflorum L. 5 000 20 4
Dianthus barbatus L. 5 000 10 3
Dianthus caryophyllus L. 5 000 20 5
Dianthus chinensis L. 5 000 10 3
Dianthus deltoides L. 5 000 20 0.5
Dianthus plumarius L. 5 000 20 5
Digitalis lanata Ehrh. 5 000 5 1
Digitalis purpurea L. 5 000 5 0.2
Dimorphotheca pluvialis (L.) Moench 5 000 40 10
Dimorphotheca tragus (Aiton) B.Nord. 5 000 40 10
Doronicum orientale Hoffm. 5 000 10 2
Dorotheanthus bellidiformis (Burm. f.) N.E.Br. 5 000 5 0.5
Echinacea purpurea (L.) Moench 5 000 20 5
Echinops ritro L. 5 000 80 20
Echium candicans L. f. 5 000 40 10
Echium plantagineum L. 5 000 40 10
Erigeron speciosus (Lindl.) DC. 5 000 5 0.5
Erysimum cheiri (L.) Crantz 5 000 10 3
Erysimum ×marshallii (Henfr.) Bois 5 000 10 3
Eschscholzia californica Cham. 5 000 20 5
Fatsia japonica (Thunb.) Decne. & Planch. 5 000 60 15
Freesia refracta (Jacq.) Klatt 5 000 100 25
Gaillardia aristata Pursh 5 000 30 8
Gaillardia pulchella Foug. 5 000 20 6
Chapter 2: Sampling
Galega officinalis L. 5 000 80 20

Galeopsis segetum Neck. 5 000 20 4
Gazania rigens (L.) Gaertn. 5 000 20 5
Gentiana acaulis L. 5 000 5 0.7
Geranium hybrids 5 000 40 10
Gerbera jamesonii Adlam 5 000 40 10
Geum coccineum Sm. 5 000 20 5
Geum quellyon Sweet 5 000 20 5
Gilia tricolor Benth. 5 000 5 1


(except see 2.8 (3.5.1) (g)
Note 2)
1 2 3 4
Glandularia canadensis (L.) Nutt. 5 000 20 6
Glebionis carinata (Schousb.) Tzvelev 5 000 30 8
Glebionis coronaria (L.) Cass. ex Spach 5 000 30 8
Glebionis segetum (L.) Fourr. 5 000 30 8
Gomphrena globosa L. 5 000 40 10
Goniolimon tataricum (L.) Boiss. 5 000 20 5
Grevillea robusta A.Cunn. ex R.Br. 5 000 80 20
Gypsophila elegans M.Bieb. 5 000 10 2
Gypsophila paniculata L. 5 000 10 2
Gypsophila repens L. 5 000 10 2
Helenium autumnale L. 5 000 5 0.9
Helianthemum nummularium (L.) Mill. 5 000 20 5
Helianthus debilis Nutt. 10 000 150 40
(Helichrysum bracteatum (Vent.) Andrews see Xerochrysum
bracteatum (Vent.) Tzvelev)
Heliopsis helianthoides (L.) Sweet 5 000 40 10
Heliotropium arborescens L. 5 000 5 1
(Helipterum humboldtianum (Gaudich.) DC. see Rhodanthe
humboldtiana (Gaudich.) Paul G.Wilson)
(Helipterum manglesii (Lindl.) F.Muell. ex Benth. see Rhodanthe
manglesii Lindl.)
(Helipterum roseum (Hook.) Benth. see Rhodanthe chlorocephala
(Turcz.) Paul G.Wilson)
Hesperis matronalis L. 5 000 20 5
Heteranthemis viscidehirta Schott 5 000 30 8
Heuchera sanguinea Engelm. 5 000 5 0.1
Hibiscus trionum L. 5 000 40 10
Hippeastrum hybrids 5 000 80 20
Hypericum perforatum L. 5 000 5 0.3
Hyssopus officinalis L. 5 000 10 3
Iberis amara L. 5 000 20 6
Iberis gibraltarica L. 5 000 10 3
Iberis sempervirens L. 5 000 10 3
Iberis umbellata L. 5 000 10 3
Impatiens balsamina L. 5 000 100 25
Impatiens walleriana Hook. f. 5 000 10 2
Inula helenium L. 5 000 20 4
Ipomoea alba L. 10 000 400 100
Ipomoea purpurea (L.) Roth 10 000 400 100
Ipomoea quamoclit L. 10 000 200 50
Ipomoea tricolor Cav. 10 000 400 100
Jacobaea maritima (L.) Pelser & Meijden (previously Senecio 5 000 5 0.5
cineraria DC.)
Chapter 2: Sampling
Kalanchoe blossfeldiana Poelln. 5 000 5 0.1

Kalanchoe crenata (Andrews) Haw. 5 000 5 0.1
Kalanchoe globulifera H.Perrier 5 000 5 0.1
Kniphofia uvaria (L.) Oken 5 000 10 3
(Kochia scoparia (L.) Schrad. see Bassia scoparia (L.) A.J.Scott)
Lathyrus latifolius L. 10 000 400 100
Lathyrus odoratus L. 10 000 600 150
Lavandula angustifolia Mill. 5 000 10 2
Lavatera trimestris L. 5 000 40 10


(except see 2.8 (3.5.1) (g)
Note 2)
1 2 3 4
Legousia speculum-veneris (L.) Chaix 5 000 5 1
Leontopodium nivale (Ten.) Hand.-Mazz. (previously 5 000 5 0.1
Leontopodium alpinum Cass.)
Leonurus cardiaca L. 5 000 10 2
Leucanthemum maximum (Ramond) DC. 5 000 20 5
Leucanthemum vulgare Lam. 5 000 20 5
Levisticum officinale W.D.J.Koch 5 000 30 8
Liatris pycnostachya Michx. 5 000 30 8
Liatris spicata (L.) Willd. 5 000 30 8
Lilium regale E.H.Wilson 5 000 40 10
Limonium bellidifolium (Gouan) Dumort. 5 000 20 5
Limonium bonduellei (T.Lestib.) Kuntze 5 000 200 50
Limonium gerberi Soldano 5 000 20 5
Limonium sinuatum (L.) Mill. (heads) 5 000 200 50
Limonium sinuatum (L.) Mill. (seeds) 5 000 20 6
Linaria bipartita (Vent.) Willd. 5 000 5 0.2
Linaria maroccana Hook. f. 5 000 5 0.4
Linaria vulgaris Mill. 5 000 5 0.2
Linum flavum L. 5 000 20 5
Linum grandiflorum Desf. 5 000 40 10
Linum narbonense L. 5 000 20 5
Linum perenne L. 5 000 20 5
Lobelia cardinalis L. (includes L. fulgens Humb. & Bonpl. ex 5 000 5 0.1
Willd.)
Lobelia erinus L. 5 000 5 0.2
Lobularia maritima (L.) Desv. 5 000 5 1
Lomelosia caucasica (M.Bieb.) Greuter & Burdet (previously 5 000 80 20
Scabiosa caucasica M.Bieb.)
Lonas annua (L.) Vines & Druce 5 000 5 0.6
Lunaria annua L. 5 000 80 20
Lupinus hartwegii Lindl. 10 000 200 60
Lupinus hybrids 10 000 200 60
Lupinus nanus Douglas ex Benth. 10 000 200 60
Lupinus polyphyllus Lindl. 10 000 200 60
Malcolmia maritima (L.) R.Br. 5 000 10 3
Malope trifida Cav. 5 000 20 5
Marrubium vulgare L. 5 000 10 2
Matricaria chamomilla L. (previously Matricaria recutita L.) 5 000 5 0.5
Matthiola incana (L.) R.Br. 5 000 20 4
Matthiola longipetala (Vent.) DC. 5 000 10 2
Melissa officinalis L. 5 000 10 2
Mentha ×piperita L. 5 000 5 0.5
Mimosa pudica L. 5 000 40 10
Chapter 2: Sampling
Mimulus cardinalis Douglas ex Benth. 5 000 5 0.2

Mimulus cupreus hort. ex Dombrain 5 000 5 0.2
Mimulus ×hybridus hort. ex Voss 5 000 5 0.2
Mimulus luteus L. 5 000 5 0.2
Mirabilis jalapa L. 10 000 800 200
Moluccella laevis L. 5 000 100 25
Myosotis hybrids 5 000 10 2
Myosotis scorpioides L. 5 000 10 2
Myosotis sylvatica Hoffm. 5 000 10 2


(except see 2.8 (3.5.1) (g)
Note 2)
1 2 3 4
Nemesia strumosa Benth. 5 000 5 1
Nemesia versicolor E.Mey. ex Benth. 5 000 5 1
Nemophila maculata Benth. ex Lindl. 5 000 20 5
Nemophila menziesii Hook. & Arn. 5 000 20 5
Nepeta cataria L. 5 000 10 2
Nicotiana alata Link & Otto 5 000 5 0.2
Nicotiana ×sanderae W.Watson 5 000 5 0.2
Nicotiana suaveolens Lehm. 5 000 5 0.5
Nierembergia hippomanica Miers 5 000 5 0.5
Nigella damascena L. 5 000 20 6
Nigella hispanica L. 5 000 20 6
Nigella sativa L. 5 000 40 10
Oenothera macrocarpa Nutt. 5 000 40 10
Osteospermum ecklonis (DC.) Norl. 5 000 40 10
Papaver alpinum L. 5 000 5 0.5
Papaver glaucum Boiss. & Hausskn. 5 000 5 0.5
Papaver nudicaule L. 5 000 5 0.5
Papaver orientale L. 5 000 5 1
Papaver rhoeas L. 5 000 5 0.5
Pelargonium Zonale Group 5 000 80 20
Penstemon barbatus (Cav.) Roth 5 000 10 2
Penstemon hartwegii Benth. 5 000 10 2
Penstemon hybrids 5 000 10 2
Pericallis cruenta (Masson ex L’Hér.) Bolle (previously Senecio 5 000 5 0.5
cruentus (Masson ex L’Hér.) DC.)
Perilla frutescens (L.) Britton 5 000 10 3
Petunia ×atkinsiana (Sweet) D.Don ex W.H.Baxter (previously 5 000 5 0.2
Petunia ×hybrida hort. ex E.Vilm.)
Phacelia campanularia A.Gray 5 000 10 2
Phlox drummondii Hook. 5 000 20 5
Phlox paniculata L. 5 000 20 5
Phlox subulata L. 5 000 20 5
Pholistoma auritum (Lindl.) Lilja 5 000 20 5
Physalis alkekengi L. 5 000 20 4
Pimpinella major (L.) Huds. 5 000 20 5
Pimpinella saxifraga L. 5 000 20 5
Plectocephalus americana (Nutt.) D.Don (previously Centaurea 5 000 100 35
americana Nutt.)
Plectranthus scutellarioides (L.) R.Br. (previously Coleus blumei 5 000 10 2
Benth.)
Portulaca grandiflora Hook. 5 000 5 0.3
Primula auricula L. 5 000 5 1
Primula denticulata Sm. 5 000 5 0.5
Chapter 2: Sampling
Primula elatior (L.) Hill 5 000 10 2

Primula japonica A.Gray 5 000 5 1
Primula ×kewensis W.Watson 5 000 5 0.5
Primula malacoides Franch. 5 000 5 0.5
Primula obconica Hance 5 000 5 0.5
Primula praenitens Ker Gawl. 5 000 5 1
Primula veris L. 5 000 5 1
Primula vulgaris Huds. 5 000 5 1


(except see 2.8 (3.5.1) (g)
Note 2)
1 2 3 4
Psephellus dealbatus (Willd.) K.Koch (previously Centaurea 5 000 40 10
dealbata Willd.)
Psylliostachys suworowii (Regel) Roshkova 5 000 20 5
Ranunculus asiaticus L. 5 000 5 1
Reseda odorata L. 5 000 10 3
Rheum palmatum L. 5 000 100 30
Rhodanthe humboldtiana (Gaudich.) Paul G.Wilson (previously 5 000 30 8
Helipterum humboldtianum (Gaudich.) DC.)
Rhodanthe manglesii Lindl. (previously Helipterum manglesii 5 000 30 8
(Lindl.) F.Muell. ex Benth.)
Rhodanthe chlorocephala (Turcz.) Paul G.Wilson (includes 5 000 30 8
Helipterum roseum (Hook.) Benth.)
Rudbeckia fulgida Aiton 5 000 10 2
Rudbeckia hirta L. 5 000 5 1
Ruta graveolens L. 5 000 20 6
Saintpaulia ionantha H.Wendl. 5 000 5 0.1
Salpiglossis sinuata Ruiz & Pav. 5 000 5 1
Salvia coccinea Buc’hoz ex Etl. 5 000 30 8
Salvia farinacea Benth. 5 000 20 5
Salvia officinalis L. 5 000 30 20
Salvia patens Cav. 5 000 30 8
Salvia pratensis L. 5 000 30 8
Salvia sclarea L. 5 000 80 20
Salvia splendens Sellow ex Schult. 5 000 30 8
Salvia viridis L. 5 000 20 5
Sanvitalia procumbens Lam. 5 000 10 2
Saponaria calabrica Guss. 5 000 20 5
Saponaria ocymoides L. 5 000 20 5
Saponaria officinalis L. 5 000 20 5
Scabiosa atropurpurea L. 5 000 60 15
(Scabiosa caucasica M.Bieb. see Lomelosia caucasica (M.Bieb.)
Greuter & Burdet)
Schefflera elegantissima (hort. Veitch ex Mast.) Lowry & Frodin 5 000 20 6
Schizanthus pinnatus Ruiz & Pav. 5 000 10 2
(Senecio cineraria DC. see Jacobaea maritima (L.) Pelser &
Meijden)
(Senecio cruentus (Masson ex L’Hér.) DC. see Pericallis cruenta
(Masson ex L’Hér.) Bolle)
Senecio elegans L. 5 000 5 0.5
Silene chalcedonica (L.) E.H.L.Krause 5 000 5 1
Silene coronaria (L.) Clairv. 5 000 20 5
Silene pendula L. 5 000 10 2
Silybum marianum (L.) Gaertn. 5 000 200 50
Chapter 2: Sampling
Sinningia speciosa (Lodd. et al.) Hiern 5 000 5 0.2

(Solanum diflorum Vell. see Solanum pseudocapsicum L.)
Solanum giganteum Jacq. 5 000 20 5
Solanum laciniatum Aiton 5 000 20 5
Solanum marginatum L. f. 5 000 20 5
Solanum pseudocapsicum L. (previously Solanum diflorum 5 000 20 5
Vell.)
Stachys macrantha (K.Koch) Stearn 5 000 20 5
Tagetes erecta L. 5 000 40 10


(except see 2.8 (3.5.1) (g)
Note 2)
1 2 3 4
Tagetes patula L. 5 000 40 10
Tagetes tenuifolia Cav. 5 000 20 5
Tanacetum achilleifolium (M.Bieb.) Sch. Bip. 5 000 30 8
Tanacetum cinerariifolium (Trevir.) Sch. Bip. 5 000 10 3
Tanacetum coccineum (Willd.) Grierson 5 000 30 8
Tanacetum parthenium (L.) Sch. Bip. 5 000 20 5
Thunbergia alata Bojer ex Sims 5 000 200 50
Thymus serpyllum L. 5 000 5 0.5
Torenia fournieri Linden ex E.Fourn. 5 000 5 0.2
Tripleurospermum inodorum (L.) Sch. Bip. (previously 5 000 5 0.5
Tripleurospermum perforatum (Mérat) M.Laínz)
Tripleurospermum maritimum (L.) W.D.J.Koch 5 000 5 0.5
(Tripleurospermum perforatum (Mérat) M.Laínz see
Tripleurospermum inodorum (L.) Sch. Bip.)
Tropaeolum majus L. 10 000 1 000 350
Tropaeolum peltophorum Benth. 10 000 1 000 350
Tropaeolum peregrinum L. 10 000 1 000 350
Vaccaria hispanica (Mill.) Rauschert 5 000 20 5
Valeriana officinalis L. 5 000 10 2
Verbascum densiflorum Bertol. 5 000 5 0.3
Verbascum phlomoides L. 5 000 5 0.5
Verbascum thapsus L. 5 000 5 0.5
Verbena bonariensis L. 5 000 20 6
Verbena Hybrida Group 5 000 20 6
Verbena rigida Spreng. 5 000 10 2
Vinca minor L. 5 000 20 5
Viola cornuta L. 5 000 10 3
Viola odorata L. 5 000 10 3
Viola tricolor L. 5 000 10 3
Xeranthemum annuum L. 5 000 10 3
Xerochrysum bracteatum (Vent.) Tzvelev (previously Helichrysum 5 000 10 2
bracteatum (Vent.) Andrews)
Zinnia elegans Jacq. 5 000 80 20
Zinnia haageana Regel 5 000 20 6
Chapter 2: Sampling

Table 2B Part 1. Sample sizes (numbers of seeds) for pelleted seeds, encrusted seed and seed granules
Determinations Minimum submitted Minimum working

sample sample
Purity analysis (including verification of 2 500 2 500
species)
Weight determination 2 500 Pure pellet fraction
Germination 2 500 400
Determination of other seeds 10 000 7 500
Determination of other seeds (encrusted 25 000 25 000
seeds and seed granules)
Size grading 5 000 1 000
Table 2B Part 2. Sample sizes (number of seeds) for seed tapes and mats
Determinations Minimum submitted Minimum working

sample sample
Verification of species 300 100
Purity analysis (if required) 2 500 2 500
Determination of other seeds 10 000 7 500
Chapter 2: Sampling

2.9 Heterogeneity testing for seed Mean of all X values determined for the lot in respect of
lots in multiple containers the adopted attribute:
The object of heterogeneity testing is to detect the pres- ∑X

X =
ence of heterogeneity which makes the seed lot techni- N
cally unacceptable for sampling according to the object as
defined in 2.1. Acceptable variance of independent container-samples in
respect of purity or germination percentages:
2.9.1 The H value test X · (100 – X )

W= ·f
n
2.9.1.1 Definitions of terms and symbols
Acceptable variance of independent container-samples in
The testing of predominantly in-range heterogeneity of an respect of number of other seeds:
attribute adopted as an indicator involves a comparison be-
tween the observed variance and the acceptable variance W = X · f
of that attribute. The container-samples of a seed lot are
samples drawn independently of each other from differ- Observed variance of independent container-samples
ent containers. The examinations of container-samples for based on all X values in respect of the adopted attribute:
the indicating attribute must also be mutually independ-
ent. Since there is only one source of information for each N ∑ X2 – ( ∑ X )2
V=
container, heterogeneity within containers is not directly N(N–1)
involved. The acceptable variance is calculated by mul-
tiplying the theoretical variance caused by random vari- H value:
ation with a factor f for additional variation, taking into
account the level of heterogeneity which is achievable in V
H= –f
good seed production practice. The theoretical variance W
can be calculated from the respective probability distri-
butions, which is the binomial distribution in the case of Negative H values are reported as zero.
purity and germination, and the Poisson distribution in the
case of the other seed count. Table 2C. Factors for additional variation in seed lots to be
used for calculating W and finally the H value
No number of containers in the lot
Attributes Non-chaffy seeds Chaffy seeds
N number of independent container-samples Purity 1.1 1.2
Other seed count 1.4 2.2
Germination 1.1 1.2
n number of seeds tested from each container-sample
(1 000 for purity, 100 for germination and 2 500 for
other seed count, see 2.9.1.3) Remarks:
– For purity and germination calculate to two decimal
X test result of the adopted attribute in a container-sample places if N is less than 10 and to three decimal places
if N is 10 or more.
∑ symbol for sum of all values – For the number of other seeds, calculate to one decimal
place if N is less than 10, and to two decimal places if
f factor for multiplying the theoretical variance to obtain N is 10 or more.
the acceptable variance (see Table 2C) – For definition of non-chaffy and chaffy seeds see 3.6.6
Chapter 2: Sampling
of the ISTA Rules. The chaffiness of various genera is

listed in Table 3B Part 1.

Table 2D. Sampling intensity and critical H values. Number of independent container samples to be drawn as depend-
ing on the number of containers in the lot and critical H values for seed lot heterogeneity at a significance level of 1 %
probability
Number of Number of inde- Critical H value for purity and Critical H value for other seed
containers in pendent container germination attributes count attributes
the lot samples
non-chaffy seeds chaffy seeds non-chaffy seeds chaffy seeds
5 5 2.55 2.78 3.25 5.10
6 6 2.22 2.42 2.83 4.44
7 7 1.98 2.17 2.52 3.98
8 8 1.80 1.97 2.30 3.61
9 9 1.66 1.81 2.11 3.32
10 10 1.55 1.69 1.97 3.10
11–15 11 1.45 1.58 1.85 2.90
16–25 15 1.19 1.31 1.51 2.40
26–35 17 1.10 1.20 1.40 2.20
36–49 18 1.07 1.16 1.36 2.13
50 or more 20 0.99 1.09 1.26 2.00
2.9.1.2 Sampling the lot In the laboratory, a working sample is drawn from each
container-sample and tested independently of any other
The number of independent container samples must be not sample for the chosen attribute.
less than presented in Table 2D.
Sampling intensity has been chosen such that in a a) The percentage by weight of any component may be
lot containing about 10 % deviating containers, at least used, provided it can be separated as in the purity
one deviating container is selected with a probability of analysis, e.g. pure seed, other seeds, or empty seeds of
p = 90 %. Since the detection of a deviating container is grasses. The working sample should be of such weight
conditional on selection, the power of both tests to detect as is estimated to contain 1000 seeds counted from
heterogeneity is at best close to equal, but usually lower each container-sample. Each working sample is sepa-
than the chosen selection probability. (Reference: Steiner, rated into two fractions: the selected component and
A. M. and Meyer, U. (1990), H value and R value hetero- the remainder.
geneity testing of seed lots; properties, sampling intensity
and precision. Agribiological Research 43, 103–114.) b) Any kind of seed or seedling determinable in a stand-
The containers to be sampled are chosen strictly at ard germination test may be used, e.g. normal seed-
random. The sample taken from the container must ad- lings, abnormal seedlings or hard seeds. From each
equately represent the whole contents, e.g. the top, middle container-sample a germination test of 100 seeds is set
and bottom of a bag. The weight of each container-sample up simultaneously and completed in accordance with
must be not less than half that specified in the Table 2A, conditions specified in Table 5A.
column 3.
c) The seed count may be of any component that can be
counted, e.g. a specified seed species, or all other seeds
2.9.1.3 Testing procedure together. Each working sample must be of a weight
estimated to contain about 2500 seeds and a count is
The attribute adopted to indicate heterogeneity may be: made in it of the number of seeds of the kind selected
a) percentage by weight of any purity component, (i.e. other seed count).
b) percentage of any germination test component, or
Chapter 2: Sampling
c) the total number seeds or the number of any sin-

gle species in the determination of other seeds by
number.

2.9.1.4 Use of Table 2D in the case of purity and germination, and to the Poisson
distribution in the case of the other seed count, multiplied
Table 2D shows the critical H values which would be ex- by the square root of the factor f given in Table 2C, respec-
ceeded in only 1 % of tests from seed lots with an ac- tively. The spread between containers is characterised by
ceptable distribution of the attribute adopted as indica- the calculated range to be compared with the correspond-
tor. If the calculated H value exceeds the critical H value ing tolerated range.
belonging to the sample number N, the attribute and the
chaffiness in Table 2D, then the lot is considered to show
significant heterogeneity in the in-range, or possibly also 2.9.2.1 Definitions of terms and symbols
the off-range sense. If, however, the calculated H value is
less than or equal to the tabulated critical H value, then the No number of containers in the lot
lot is considered to show no heterogeneity in the in-range,
or possibly off-range sense with respect to the attribute N number of independent container-samples
being tested.
n number of seeds tested from each container-sample
(1 000 for purity, 100 for germination and 2 500 for
2.9.1.5 Reporting results other seed count, see 2.9.1.3)
The result of the H value heterogeneity test for seed lots in X test result of the adopted attribute in a container-sample
multiple containers must be reported under ‘Other deter-
minations’, as follows: ∑ symbol for sum of all values
– X: mean of all X values determined for the lot in
respect of the adopted attribute; Mean of all X values determined for the lot in respect of
– N: number of independent container samples; the adopted attribute:
– No: number of containers in the lot;
– the calculated H value; ∑X
X =
– the statement: ‘This H value does/does not indicate N
significant heterogeneity.’
Range found as maximum difference between independ-
Note: the H value must not be calculated or reported if X ent container samples of the lot in respect of the adopted
is outside the following limits: attribute:
– purity components: above 99.8 % or below 0.2 %;
– germination: above 99.0 % or below 1.0 %; R = Xmax – Xmin
– number of specified seeds: below two per sample.
Note: for precision of X for the R value test, see 2.9.1.1
‘Remarks’ to the H value test.
2.9.2 The R value test
The object of this test is to detect off-range heterogeneity 2.9.2.2 Sampling the lot
of the seed lot using the attribute adopted as an indicator.
The test for off-range heterogeneity involves comparing Sampling for the R value test is the same as for the H
the maximum difference found between samples of simi- value test (see 2.9.1.2); the same samples must be used.
lar size drawn from the lot with a tolerated range. This tol-
erated range is based on the acceptable standard deviation,
which is achievable in good seed production practice. 2.9.2.3 Testing procedure
Each independent container-sample is taken from a
Chapter 2: Sampling
different container, so that heterogeneity within containers The same testing procedures of purity, germination and
is not directly involved. Information about heterogeneity the other seed count are used for the R value test as are
within containers is contained, however, in the acceptable used for the H value test (see 2.9.1.3). For calculations,
standard deviation which is in fact incorporated into the the same set of data must be used.
tabulation of tolerated ranges. The acceptable standard
deviation was calculated by the standard deviation due to
random variation according to the binomial distribution

2.9.2.4 Use of tables 2.9.2.5 Reporting results
Seed lot off-range heterogeneity is tested by using the ap- The result of the R value heterogeneity test for seed lots in
propriate table for tolerated, i.e. critical range: multiple containers must be reported under ‘Other deter-
– Table 2E for components of pure seed analyses, minations’, as follows:
– Table 2F for germination determinations, and
– Table 2G for numbers of other seeds. – X: mean of all X values determined for the lot in
respect of the adopted attribute;
Find the value X in the ‘Average’ columns of the appropri- – N: number of independent container samples;
ate table. When entering the table, round averages follow- – No: number of containers in the lot;
ing the usual procedure; read off the tolerated range which – the calculated R value;
would be exceeded in only 1 % of tests from seed lots with – the statement: ‘This R value does/does not indicate
an acceptable distribution of the attribute: significant heterogeneity.’
– in columns 5–9 for cases when N = 5 to 9,
– in columns 10–19 for cases when N = 10 to 19, or
– in column 20 when N = 20. 2.9.3 Interpretation of results
If the calculated R value exceeds this tolerated range, then Whenever either of the two tests, the H value test or the R
the lot is considered to show significant heterogeneity in value test, indicates significant heterogeneity, then the lot
the off-range sense. If, however, the calculated R value is must be declared heterogeneous. When, however, neither
less than or equal to the tabulated tolerated range, then the of the two tests indicates significant heterogeneity, then
lot is considered to show no heterogeneity in the off-range the lot must be adopted as non-heterogeneous, having a
sense with respect to the attribute being tested. non-significant level of heterogeneity.
When using the tables, round averages to the next tab-
ulated value (if in the middle, then downwards).
Chapter 2: Sampling

Table 2E Part 1. Maximum tolerated ranges for the R Table 2E Part 2. Maximum tolerated ranges for the R
value test at a significance level of 1 % probability using value test at a significance level of 1 % probability using
components of purity analyses as the indicating attribute in components of purity analyses as the indicating attribute in
non-chaffy seeds chaffy seeds
Average % of the compo- Tolerated range for number of Average % of the compo- Tolerated range for number of
nent and its complement independent samples (N) nent and its complement independent samples (N)
5–9 10–19 20 5–9 10–19 20
99.9 0.1 0.5 0.5 0.6 99.9 0.1 0.5 0.6 0.6
99.8 0.2 0.7 0.8 0.8 99.8 0.2 0.7 0.8 0.9
99.7 0.3 0.8 0.9 1.0 99.7 0.3 0.9 1.0 1.1
99.6 0.4 1.0 1.1 1.2 99.6 0.4 1.0 1.1 1.2
99.5 0.5 1.1 1.2 1.3 99.5 0.5 1.1 1.3 1.4
99.4 0.6 1.2 1.3 1.4 99.4 0.6 1.2 1.4 1.5
99.3 0.7 1.3 1.4 1.6 99.3 0.7 1.3 1.5 1.6
99.2 0.8 1.4 1.5 1.7 99.2 0.8 1.4 1.6 1.7
99.1 0.9 1.4 1.6 1.8 99.1 0.9 1.5 1.7 1.8
99.0 1.0 1.5 1.7 1.9 99.0 1.0 1.6 1.8 1.9
98.5 1.5 1.9 2.1 2.3 98.5 1.5 1.9 2.2 2.4
98.0 2.0 2.1 2.4 2.6 98.0 2.0 2.2 2.5 2.7
97.5 2.5 2.4 2.7 2.9 97.5 2.5 2.5 2.8 3.1
97.0 3.0 2.6 2.9 3.2 97.0 3.0 2.7 3.0 3.3
96.5 3.5 2.8 3.1 3.4 96.5 3.5 2.9 3.3 3.6
96.0 4.0 3.0 3.4 3.7 96.0 4.0 3.1 3.5 3.8
95.5 4.5 3.2 3.5 3.9 95.5 4.5 3.3 3.7 4.1
95.0 5.0 3.3 3.7 4.1 95.0 5.0 3.5 3.9 4.3
94.0 6.0 3.6 4.1 4.5 94.0 6.0 3.8 4.2 4.6
93.0 7.0 3.9 4.4 4.8 93.0 7.0 4.1 4.6 5.0
92.0 8.0 4.1 4.6 5.1 92.0 8.0 4.3 4.8 5.3
91.0 9.0 4.4 4.9 5.4 91.0 9.0 4.6 5.1 5.6
90.0 10.0 4.6 5.1 5.6 90.0 10.0 4.8 5.4 5.9
89.0 11.0 4.8 5.4 5.9 89.0 11.0 5.0 5.6 6.1
88.0 12.0 5.0 5.6 6.1 88.0 12.0 5.2 5.8 6.4
87.0 13.0 5.1 5.8 6.3 87.0 13.0 5.4 6.0 6.6
86.0 14.0 5.3 5.9 6.5 86.0 14.0 5.5 6.2 6.8
85.0 15.0 5.4 6.1 6.7 85.0 15.0 5.7 6.4 7.0
84.0 16.0 5.6 6.3 6.9 84.0 16.0 5.8 6.6 7.2
83.0 17.0 5.7 6.4 7.0 83.0 17.0 6.0 6.7 7.4
82.0 18.0 5.9 6.6 7.2 82.0 18.0 6.1 6.9 7.5
81.0 19.0 6.0 6.7 7.4 81.0 19.0 6.3 7.0 7.7
80.0 20.0 6.1 6.8 7.5 80.0 20.0 6.4 7.1 7.8
78.0 22.0 6.3 7.1 7.8 78.0 22.0 6.6 7.4 8.1
76.0 24.0 6.5 7.3 8.0 76.0 24.0 6.8 7.6 8.4
74.0 26.0 6.7 7.5 8.2 74.0 26.0 7.0 7.8 8.6
72.0 28.0 6.9 7.7 8.4 72.0 28.0 7.2 8.0 8.8
70.0 30.0 7.0 7.8 8.6 70.0 30.0 7.3 8.2 9.0
68.0 32.0 7.1 8.0 8.7 68.0 32.0 7.4 8.3 9.1
66.0 34.0 7.2 8.1 8.9 66.0 34.0 7.5 8.5 9.3
64.0 36.0 7.3 8.2 9.0 64.0 36.0 7.6 8.6 9.4
62.0 38.0 7.4 8.3 9.1 62.0 38.0 7.7 8.7 9.5
Chapter 2: Sampling
60.0 40.0 7.5 8.4 9.2 60.0 40.0 7.8 8.8 9.6
58.0 42.0 7.5 8.4 9.2 58.0 42.0 7.9 8.8 9.7
56.0 44.0 7.6 8.5 9.3 56.0 44.0 7.9 8.9 9.7
54.0 46.0 7.6 8.5 9.3 54.0 46.0 7.9 8.9 9.8
52.0 48.0 7.6 8.6 9.4 52.0 48.0 8.0 8.9 9.8
50.0 50.0 7.6 8.6 9.4 50.0 50.0 8.0 8.9 9.8

Table 2F Part 1. Maximum tolerated ranges for the R Table 2F Part 2. Maximum tolerated ranges for the R
value test at a significance level of 1 % probability using value test at a significance level of 1 % probability using
components of germination tests as the indicating attribute components of germination tests as the indicating attribute
in non-chaffy seeds in chaffy seeds
Average % of the compo- Tolerated range for number of Average % of the compo- Tolerated range for number of
nent and its complement independent samples (N) nent and its complement independent samples (N)
5–9 10–19 20 5–9 10–19 20
99 1 5 6 6 99 1 6 6 7
98 2 7 8 9 98 2 8 8 9
97 3 9 10 11 97 3 9 10 11
96 4 10 11 12 96 4 10 12 13
95 5 11 12 13 95 5 11 13 14
94 6 12 13 15 94 6 12 14 15
93 7 13 14 16 93 7 13 15 16
92 8 14 15 17 92 8 14 16 17
91 9 14 16 17 91 9 15 17 18
90 10 15 17 18 90 10 16 17 19
89 11 16 17 19 89 11 16 18 20
88 12 16 18 20 88 12 17 19 21
87 13 17 19 20 87 13 17 20 21
86 14 17 19 21 86 14 18 20 22
85 15 18 20 22 85 15 18 21 23
84 16 18 20 22 84 16 19 21 23
83 17 19 21 23 83 17 19 22 24
82 18 19 21 23 82 18 20 22 24
81 19 19 22 24 81 19 20 23 25
80 20 20 22 24 80 20 21 23 25
79 21 20 23 25 79 21 21 24 26
78 22 20 23 25 78 22 21 24 26
77 23 21 23 25 77 23 22 24 27
76 24 21 24 26 76 24 22 25 27
75 25 21 24 26 75 25 22 25 27
74 26 22 24 26 74 26 23 25 28
73 27 22 25 27 73 27 23 26 28
72 28 22 25 27 72 28 23 26 28
71 29 22 25 27 71 29 23 26 29
70 30 23 25 28 70 30 24 26 29
69 31 23 26 28 69 31 24 27 29
68 32 23 26 28 68 32 24 27 29
67 33 23 26 28 67 33 24 27 30
66 34 23 26 29 66 34 24 27 30
65 35 24 26 29 65 35 25 27 30
64 36 24 26 29 64 36 25 28 30
63 37 24 27 29 63 37 25 28 30
62 38 24 27 29 62 38 25 28 31
61 39 24 27 29 61 39 25 28 31
60 40 24 27 30 60 40 25 28 31
59 41 24 27 30 59 41 25 28 31
58 42 24 27 30 58 42 25 28 31
Chapter 2: Sampling
57 43 24 27 30 57 43 25 28 31
56 44 24 27 30 56 44 26 29 31
55 45 25 27 30 55 45 26 29 31
54 46 25 27 30 54 46 26 29 31
53 47 25 28 30 53 47 26 29 31
52 48 25 28 30 52 48 26 29 31
51 49 25 28 30 51 49 26 29 31
50 50 25 28 30 50 50 26 29 31

Table 2G Part 1. Maximum tolerated ranges for the R value test at a significance level of 1 % probability using compo-
nents of other seed count analyses as the indicating attribute in non-chaffy seeds
Average count Tolerated range for number of Average count Tolerated range for number of
of other seeds independent samples (N) of other seeds independent samples (N)
5–9 10–19 20 5–9 10–19 20
1 6 7 7 51 39 44 48
2 8 9 10 52 40 45 49
3 10 11 12 53 40 45 49
4 11 13 14 54 40 45 50
5 13 14 15 55 41 46 50
6 14 15 17 56 41 46 51
7 15 17 18 57 42 47 51
8 16 18 19 58 42 47 51
9 17 19 21 59 42 47 52
10 18 20 22 60 43 48 52
11 19 21 23 61 43 48 53
12 19 22 24 62 43 49 53
13 20 23 25 63 44 49 54
14 21 23 26 64 44 49 54
15 22 24 26 65 44 50 54
16 22 25 27 66 45 50 55
17 23 26 28 67 45 50 55
18 24 26 29 68 45 51 56
19 24 27 30 69 46 51 56
20 25 28 30 70 46 52 56
21 25 28 31 71 46 52 57
22 26 29 32 72 47 52 57
23 27 30 33 73 47 53 58
24 27 30 33 74 47 53 58
25 28 31 34 75 48 53 58
26 28 32 35 76 48 54 59
27 29 32 35 77 48 54 59
28 29 33 36 78 49 54 60
29 30 33 37 79 49 55 60
30 30 34 37 80 49 55 60
31 31 34 38 81 49 55 61
32 31 35 38 82 50 56 61
33 32 36 39 83 50 56 61
34 32 36 39 84 50 56 62
35 33 37 40 85 51 57 62
36 33 37 41 86 51 57 62
37 34 38 41 87 51 57 63
38 34 38 42 88 52 58 63
39 34 39 42 89 52 58 64
40 35 39 43 90 52 58 64
41 35 40 43 91 52 59 64
42 36 40 44 92 53 59 65
43 36 41 44 93 53 59 65
Chapter 2: Sampling
44 37 41 45 94 53 60 65
45 37 41 45 95 54 60 66
46 37 42 46 96 54 60 66
47 38 42 46 97 54 61 66
48 38 43 47 98 54 61 67
49 39 43 47 99 55 61 67
50 39 44 48 100 55 62 67

5–9 10–19 20 5–9 10–19 20
101 55 62 68 121 60 68 74
102 55 62 68 122 61 68 74
103 56 62 68 123 61 68 75
104 56 63 69 124 61 68 75
105 56 63 69 125 61 69 75
106 57 63 69 126 62 69 76
107 57 64 70 127 62 69 76
108 57 64 70 128 62 70 76
109 57 64 70 129 62 70 76
110 58 65 71 130 63 70 77
111 58 65 71 131 63 70 77
112 58 65 71 132 63 71 77
113 58 65 72 133 63 71 78
114 59 66 72 134 64 71 78
115 59 66 72 135 64 71 78
116 59 66 73 136 64 72 78
117 59 67 73 137 64 72 79
118 60 67 73 138 64 72 79
119 60 67 73
120 60 67 74
For higher other seed counts, tolerances (R) are calculated by using the following formula and rounding up to the next
whole number:
For N = 5–9: R = √(average count of other seed) × 5.44
For N = 20: R = √(average count of other seed) × 6.69
Chapter 2: Sampling

Table 2G Part 2. Maximum tolerated ranges for the R value test at a significance level of 1 % probability using compo-
nents of other seed count analyses as the indicating attribute in chaffy seeds
5–9 10–19 20 5–9 10–19 20
1 7 8 9 51 49 55 60
2 10 11 12 52 50 56 61
3 12 14 15 53 50 56 62
4 14 16 17 54 51 57 62
5 16 18 19 55 51 57 63
6 17 19 21 56 52 58 63
7 19 21 23 57 52 58 64
8 20 22 24 58 52 59 64
9 21 23 26 59 53 59 65
10 22 25 27 60 53 60 65
11 23 26 28 61 54 60 66
12 24 27 30 62 54 61 66
13 25 28 31 63 55 61 67
14 26 29 32 64 55 62 68
15 27 30 33 65 56 62 68
16 28 31 34 66 56 63 69
17 29 32 35 67 56 63 69
18 29 33 36 68 57 64 70
19 30 34 37 69 57 64 70
20 31 35 38 70 58 65 71
21 32 36 39 71 58 65 71
22 33 36 40 72 58 65 72
23 33 37 41 73 59 66 72
24 34 38 42 74 59 66 73
25 35 39 42 75 60 67 73
26 35 40 43 76 60 67 74
27 36 40 44 77 60 68 74
28 37 41 45 78 61 68 75
29 37 42 46 79 61 69 75
30 38 42 46 80 62 69 75
31 38 43 47 81 62 69 76
32 39 44 48 82 62 70 76
33 40 44 49 83 63 70 77
34 40 45 49 84 63 71 77
35 41 46 50 85 63 71 78
36 41 46 51 86 64 71 78
37 42 47 51 87 64 72 79
38 43 48 52 88 65 72 79
39 43 48 53 89 65 73 80
40 44 49 54 90 65 73 80
41 44 50 54 91 66 74 80
42 45 50 55 92 66 74 81
43 45 51 55 93 66 74 81
Chapter 2: Sampling
44 46 51 56 94 67 75 82
45 46 52 57 95 67 75 82
46 47 52 57 96 67 75 83
47 47 53 58 97 68 76 83
48 48 54 59 98 68 76 83
49 48 54 59 99 68 77 84
50 49 55 60 100 69 77 84

5–9 10–19 20 5–9 10–19 20
101 69 77 85 121 76 85 93
102 69 78 85 122 76 85 93
103 70 78 86 123 76 85 93
104 70 79 86 124 76 86 94
105 70 79 86 125 77 86 94
106 71 79 87 126 77 86 95
107 71 80 87 127 77 87 95
108 71 80 88 128 78 87 95
109 72 80 88 129 78 87 96
110 72 81 88 130 78 88 96
111 72 81 89 131 79 88 96
112 73 81 89 132 79 88 97
113 73 82 90 133 79 89 97
114 73 82 90 134 79 89 98
115 74 83 90 135 80 89 98
116 74 83 91 136 80 90 98
117 74 83 91 137 80 90 99
118 75 84 92 138 81 90 99
119 75 84 92
120 75 84 92
For higher other seed counts, tolerances (R) are calculated by using the following formula and rounding up to the next
whole number:
For N = 20: R = √(average count of other seed) × 8.38
Chapter 2: Sampling

International Rules for Seed Testing Chapter 3: The purity analysis
Chapter 3: The purity analysis
3.1 Object f) for certain genera appendages are left on the seed
but reported according to 3.5.2.8.
The object of the purity analysis is to determine:
a) The percentage composition by weight of the sample
being tested and by inference the composition of the 3.2.2 Other seeds
seed lot
b) The identity of the various species of seeds and inert Other seeds must include seed units of any plant species
particles constituting the sample. other than that of pure seed. With respect to classification
as other seeds or inert matter the distinguishing character-
istics described in the pure seed definitions (Table 3B Part
3.2 Definitions 2) must also be applicable except that:
3.2.1 Pure seed 1. Seed units of species for which a uniform blowing pro-
cedure applies are evaluated without blowing.
The pure seed must refer to the species stated by the ap-
plicant, or found to predominate in the test, and must in- 2. Multiple seed units (MSU) must be separated and the
clude all botanical varieties and cultivars of that species single units classified according to the general princi-
including: ples in 3.2.
1. The following structures (even if immature, under-
sized, shrivelled, diseased or germinated, providing 3.
Cuscuta spp. seed units which are fragile or ashen grey
they can be definitely identified as of that species) un- to creamy white in colour are classified as inert matter.
less transformed into partially or fully ergotised vis-
ible fungal sclerotia, smut balls or nematode galls (see 4. For schizocarps with two or more seeds, the individual
3.5.2.5.1 for exceptions when the uniform blowing seeds (mericarps) contained in a schizocarp are to be
method is used): counted separately.
1. Intact seed units (= commonly found dispersal
units i.e. achenes and similar fruits, schizocarps, For species and genera without pure seed definitions in
florets etc.) as defined for each genus or species in Table 3B Part 2 the definitions in 3.2.1 must apply. Mul-
the Pure Seed Definitions (PSDs) in Table 3B Part tiple structures, capsules, pods are opened and the seeds
2. are removed and the non-seed material placed in the inert
In Poaceae: matter, except for certain species or genera as indicated in
a) florets with an obvious caryopsis containing the Pure Seed Definitions (Table 3B Part 2).
endosperm,
b) free caryopses.
2. Pieces of seed units larger than one-half their 3.2.3 Inert matter
original size.
Inert matter must include seed units and all other matter
2. From the above main principles, exceptions are made and structures not defined as pure seed or other seed as
for certain genera of Poaceae (Table 3B Part 2): follows:

a) a minimum size of caryopsis is required (3.5.2.2);
b) the presence of caryopses in spikelets and florets 1. Seed units in which it is readily apparent that no true
is not always obligatory; seed is present.
c) the separation of pure seed and inert matter
is done by a uniform blowing procedure (see 2. Florets of those species listed in 3.5.2.2 with a cary-
3.5.2.5); opsis less than the minimum size prescribed. Sterile
d) multiple seed units (MSU) are left intact in the florets attached to a fertile floret are to be removed,
pure seed fraction; except in certain genera listed in 3.5.2.2.
e) attached sterile florets are not removed (3.5.2.2);

Chapter 3: The purity analysis International Rules for Seed Testing
3. Pieces of broken or damaged seed units half or less 3.4.1 Magnifiers, reflected light and
than half the original size. sieves
4. Those appendages not classed as being part of the pure Hand lenses and binocular microscopes are quite often
seed in the pure seed definitions for the species (Table necessary aids for an accurate identification and separa-
3B Part 2). Appendages not mentioned in the pure seed tion of small seed units and fragments.
definitions must be removed and included in the inert Reflected light is very useful for separating sterile flo-
matter. rets of grasses from fertile ones and may also be used for
the detection of nematode galls and fungal bodies.
5. Seeds of Berberidaceae, Brassicaceae, Cupressaceae, Sieves can be used as an aid for the purity analysis in
Fabaceae, Pinaceae, Taxaceae and Taxodiaceae with separating trash, soil and other small particles from the
the seed coat entirely removed. In Fabaceae, separated working sample.
cotyledons are regarded as inert matter, irrespective of
whether or not the radicle-plumule axis and/or more
than half of the testa may be attached. 3.4.2 Seed blowers
6. Seeds of Cuscuta spp. which are fragile or ashen grey Seed blowers can be used to separate light-weight mate-
to creamy white in colour. rial such as chaff and empty florets from the heavier seeds
for all species as a tool for purity analysis.
7. Unattached sterile florets, empty glumes, lemmas, Blowers that will give the most accurate separations
paleas, chaff, stems, leaves, cone scales, wings, bark, normally handle only small samples (up to 5 g). A good
flowers, nematode galls, fungus bodies such as ergot, blower should provide a uniform flow of air, be capable
sclerotia and smut balls, soil, sand, stones and all other of standardisation and retain all the particles which it
non seed matter. separates.
For certain species and varieties of Poaceae, seed
8. All material left in the light fraction when the separa- blowers must be used by the uniform blowing method
tion is made by the uniform blowing method (3.5.2.5) (3.5.2.5) to separate light-weight material such as chaff
except other seeds (as defined in 3.2.2). and empty florets from the heavier seeds.
In the heavy fraction, broken florets, and caryopses In order to maintain a uniform flow of air the blower
half or less than half the original size, and all other should have one or more air compression chambers and
matter except pure seed (3.2.1) and other seed (3.2.2). a fan driven by a uniform speed motor. The diameter of
the blowing tube should be in proportion to the size of
the working sample and the tube should be long enough
3.3 General principles to allow satisfactory separation of the sample. The valve
or air gate that regulates the air flow should be capable
The working sample is separated into the following three of precise adjustment, should be calibrated and marked
component parts: pure seed, other seeds, inert matter, and to permit easy reading, and its construction and location
the percentage of each part is determined by weight. All should prevent areas of strong and weak currents in the
species of seed and each kind of inert matter present must blowing tube.
be identified as far as possible and, if required for report- A seed blower to be used for the uniform blowing
ing, its percentage by weight must be determined. method must be capable of:
a) blowing at different air velocities (determined by the

3.4 Apparatus use of the calibration samples) to suit different species;
Aids such as magnifiers, reflected light, sieves and blow- b) maintaining a uniform flow of air at the velocity re-
ers may be used in separating the working sample into its quired by the crop species under test;
component parts.
c) rapid adjustment to any velocity likely to be required.
The setting to provide each velocity should be checked

annually by blowing a calibration sample issued under If the anemometer indicates 2.3 m/s most frequently
the authority of ISTA; and fluctuates between 2.2 and 2.4 m/s, the EAV value
of that specific air-gate opening would be recorded as
d) accurate time setting. 2.3 ±0.1 m/s.
Once the optimum air velocity has been measured, the

3.4.2.1 Calibration of the seed blower seed blower can be recalibrated using the anemometer, by
adjusting the blower setting until the optimum air velocity
The air gate openings and the equivalent air velocity for the blower and species or variety is reached. The EAV
(EAV) value (see 3.4.2.2) of the optimum blowing point for one blower is not transferable to another blower.
for a General-type seed blower are determined by using The optimum blowing point must be verified using
the uniform calibration samples. Calibration samples are the ISTA uniform calibration sample after major servic-
issued under the authority of ISTA and are available for ing of the blower, such as changing parts of the motor or
Dactylis glomerata and Poa pratensis. Prior to calibra- the glass column. In general, it is strongly recommended
tion, the calibration samples must be exposed to room that the blowing point be verified annually using the ISTA
conditions overnight. uniform calibration sample.
For those not having a General-type seed blower, Laboratories that can not, or do not, use the EAV to de-
please contact the ISTA Secretariat. termine the blowing point must calibrate the blower with
The air gate opening for the varieties of Poa pratensis the ISTA uniform calibration sample.
listed in Table 3A, with an average thousand-seed weight
less than 0.35 g, and for Poa trivialis is obtained by multi- Note: Frequent use of the ISTA uniform calibration sam-
plying the value of the air gate setting for Poa pratensis by ple can cause a shift in blowing point due to deteriora-
0.82 (applies only for General-type seed blowers). tion and monitoring the blowing point simply by air
gate opening may be reliable in some blowers and not
in others.
3.4.2.2 Determination of the equivalent air
velocity
3.4.2.3 Anemometer type
After a General-type seed blower has been calibrated ac-
cording to 3.4.2.1, the EAV of the air gate opening must be Any suitable anemometers can be used as long as the an-
measured using an anemometer. The following procedure emometer fits in the sample cup holder compartment of
must be used: the blower and has a scale calibrated in metres per second
for reading the air velocity value.
1. Set the blower at the optimum blowing point, i.e. the
air gate opening, obtained with the ISTA uniform cali-
bration sample for the relevant species, e.g. Dactylis 3.4.2.4 Calibration of the anemometer
glomerata or Poa pratensis. Do not change that air
gate opening. The anemometer should be calibrated at intervals set by
the laboratory. In addition, the batteries should be replaced
2. Remove the sample cup from the cup holder, insert the at least once a year.
anemometer with digital display facing up, and align
the fan of the anemometer over the blower opening
where the air flows from the chamber into the sample 3.5 Procedure
cup holder.
3. Turn on the anemometer and select metres per second
(m/s), hold the anemometer in a steady position and The purity analysis must be made on a working sample
then turn on the blower. taken from the submitted sample in accordance with 2.5.2,
the submitted sample having been received in accordance
4. Read the air velocity value after the digital display of with 2.5.1. Except for species of Poaceae for which the
the anemometer reaches a steady reading (typically uniform blowing method is to be used, the size of the
about 30 s after the blower was turned on). Example: working sample must be:

either a weight estimated to contain at least 2500 seed 3.5.2.1 All families except Poaceae
units,
or not less than the weight indicated in column 4 of Achenes, schizocarps and mericarps, other fruits and
Table 2A. seeds are to be examined superficially only, without the
use of pressure, a diaphanascope or other special equip-
The analysis may be made on one working sample of this ment. If it is obvious on such an examination that there is
weight or on two representative subsamples of at least half no seed in the structure, it is to be regarded as inert matter.
this weight.
The working sample (or each subsample) must be
weighed in grams to the minimum number of decimal 3.5.2.2 Poaceae
places necessary to calculate the percentage of its compo-
nent parts to one decimal place, as indicated below. Caryopses
Weight of working sample or Minimum number of decimal In Lolium, Festuca, ×Festulolium and Elytrigia repens a
subsample (g) places
floret with a caryopsis one third or more of the length of
Less than 1.000 4
the palea measured from the base of the rachilla is regard-
1.000–9.999 3
ed as pure seed or other seed, but a floret with a caryopsis
10.00–99.99 2
100.0–999.9 1 less than one third the length of palea is regarded as inert
1000 or more 0 matter. In other genera or species a floret with any en-
dosperm in the caryopsis is regarded as pure seed.
3.5.2 Separation Sterile florets
1. The working sample (or subsample) after weighing, In the following genera a sterile floret attached to a fertile
must be separated into its component parts as defined floret is not removed, but left attached and included in the
in 3.2. In general, the separation must be based on an pure seed fraction: Arrhenatherum, Avena, Bromus, Chlo-
examination of each particle in the sample, but in cer- ris, Dactylis, Festuca, ×Festulolium, Holcus, Koeleria,
tain cases special procedures are obligatory, such as Lolium, Poa, Sorghum, Triticum dicoccon and Triticum
uniform blowing. spelta.
2. The separation of the pure seed must be on such a basis

that it can be made by visible seed characteristics, me- 3.5.2.3 Damaged seed
chanical aids or using pressure without impairing the
capacity for germination. If the seed units mentioned in 3.2.1 show no evident dam-
age to the testa or pericarp, they are regarded as pure seed
3. When it is difficult or impossible to distinguish be- or other seed, irrespective of whether they are empty or
tween species, one of the procedures described in full, but difficulty may arise when there is an opening in
3.5.2.4 must be followed. Furthermore, for methods the testa or pericarp. If possible, the analyst must decide
which may be used for clearly distinguishing species whether the remaining solid portion of the seed unit is
and cultivars, but are not permissible in the purity larger than one-half the original size and apply this rule
analysis, follow Chapter 8. accordingly. If such a determination cannot be readily
made, the seed unit will be classed as pure seed or other

4. After separation, each component part (3.3) and any seed. It is not necessary for individual seed units to be
species of seed or kind of other matter for which a per- turned over to determine the presence or absence of holes
centage is to be reported, must be weighed in grams to or other damaged areas on the underside.
the minimum number of decimal places necessary to Broken florets and caryopses are classed as pure seed
calculate the percentage to one decimal place (3.5.1). or other seed if the piece is larger than half the original
After weighing, the other seeds components must be size (3.2.1.1.2).
retained and stored for reference until sample disposal
(see 2.5.3 and 2.5.4.7).

3.5.2.4 Indistinguishable species Table 3A. List of varieties of Poa pratensis with an average
thousand-seed weight of less than 0.35 g.
When it is difficult or impossible to distinguish between
species, one of the two following procedures may be Variety Thousand-seed weight (g)
followed: Balin 0.34
Compact 0.34
Julia 0.33
a) Only the genus name is reported on the analysis Cer-
Limousine 0.33
tificate, all seeds of that genus (e.g. both awned and
Enprima 0.32
awnless seeds of Lolium) being classed as pure seed; Oxford 0.32
additional information may be reported under ‘Other Ikone 0.31
Determinations’, or Sobra 0.31
Pegasus 0.29
b) The similar seeds are separated from the other compo- Platini 0.29
nents and weighed together. From this mixture at least Slezanka 0.28
400 seeds, and preferably about 1000, are taken at Mardona 0.27
random; a final separation is made on this portion and Tommy 0.26
the proportion of each species determined by weight. Lato 0.24
Harmony 0.23
From this proportion the percentage of each species in
the entire sample can be calculated (3.6).
If this procedure is followed, the details must be reported

including the number of seeds examined. 3.5.2.5.1 Separation of the heavy fraction
The procedures are applicable when the seed is de-
scribed by the sender as a species of Agrostis, Brassica, 1. All seed units of the species under analysis remaining
Lolium, Poa, and Festuca rubra or F. ovina, and in other in the cup after blowing (i.e. the heavy fraction) are to
cases at the discretion of the analyst. be classified as pure seed including:
1. Intact single florets. For Dactylis glomerata refer
to Table 3B Part 2
3.5.2.5 Poa pratensis, Poa trivialis and Dactylis 2. All intact multiple florets of Poa pratensis and Poa
glomerata trivialis and multiple seed units of Dactylis glom-
erata (3.2.1.2.2)
For Poa pratensis, Poa trivialis and Dactylis glomerata, 3. Florets with fungus bodies, such as ergot, entirely
the uniform blowing method (see 3.4.2) is obligatory. enclosed within lemma and palea
The working sample size is 1 g for Poa pratensis and 4. Florets and free caryopses (lemma and palea miss-
Poa trivialis, and 3 g for Dactylis glomerata. ing) that are insect-damaged or diseased, includ-
The optimum blower settings for Poa pratensis and ing caryopses which are spongy, corky, white or
Dactylis glomerata are determined by means of a uniform crumbly
calibration sample issued under the authority of ISTA 5. Broken florets and caryopses larger than half the
(see 3.4.2.1). The optimum blower setting for the varie- original size
ties of Poa pratensis listed in Table 3A, with an average
thousand-seed weight less than 0.35 g, and for Poa trivi- 2.
Classify the following Poa pratensis, Poa trivialis
alis is obtained by multiplying the value of the optimum or Dactylis glomerata florets and caryopses as inert
blower setting for Poa pratensis by 0.82 (applies only for matter:
General-type seed blowers). 1. Florets with ergot exserted from the tip of the
For those not having a General-type seed blower, floret
please contact the ISTA Secretariat. 2. Broken florets and caryopses, half or less than half
For blowing samples, set the seed blower to the opti- the original size
mum blower setting, obtained with the ISTA uniform cali-
bration sample or the anemometer (see 3.4.2.1). 3. Other seeds (including other Poa spp.), sticks, stems,
Place the working sample into the cup and blow for sand etc. must be classified in accordance with 3.2.2
exactly 3 min. and 3.2.3.
Prior to blowing, the working sample must be exposed
to room conditions to equilibrate with ambient conditions.

3.5.2.5.2 Separation of the light fraction is required, then the Certificate must be endorsed with
the words: ‘Because of the chemical treatment, the pure
The light fraction comprises seed units and other material seed used for the germination was obtained by the hand
removed by blowing at the uniform blowing point. method’.
1. All Poa pratensis, Poa trivialis or Dactylis glomerata

florets and caryopses contained in the light fraction 3.5.2.6 Multiple seed units (MSU)
must be considered as inert matter.
On the request of the applicant in the genera covered by
2. Other seeds (including other Poa spp. in P. pratensis PSD 33: multiple seed units are to be weighed separately
and P. trivialis), sticks, stems, sand etc. must be clas- and reported according to 3.7.
sified in accordance with 3.2.2 and 3.2.3. When fer-
tile florets of some Poa spp. (e.g. Poa compressa) are
present in a sample of Poa pratensis or Poa trivialis it 3.5.2.7 Procedure when individual impurities
is necessary to examine the entire light fraction under have an undue effect on results
magnification. If seeds of these species are present in
minor amounts (1–3 %) in a sample it is generally eas- Impurities which deviate considerably in size or weight
ier to remove all florets from the heavy and light frac- from the seed size of the sample being tested may unduly
tions and determine the percentage of other seed on the affect test results. Such cases may arise with stones, large
basis of the total weight. When seeds of other Poa spp. cereal kernels etc. in a small-seeded crop. If they are rela-
are present in a sample of Poa pratensis or Poa trivi- tively easy to eliminate, for example by sieving, remove
alis in larger amounts (3–5 %) the analyst may use the these impurities from the entire submitted sample (or a
alternative method described in 3.5.2.5.3. sample of at least 10 times the weight used for purity anal-
ysis) and perform a normal analysis on the cleaned mate-
rial, in working samples of the usual weight. Such impuri-
3.5.2.5.3 Alternative procedure for other Poa spp. ties must be reported and calculations must be made in
classified as other seed in Poa pratensis or Poa trivialis accordance with 3.6.5.
Fertile florets of other cultivated Poa spp. are removed

from the light fraction and thoroughly mixed with the flo- 3.5.2.8 Attached appendages
rets of the heavy fraction. At least 400 florets, and prefer-
ably 1000, must be taken at random from this mixture (or In certain genera (those covered by PSD 15, 38, 46 and 62)
from the florets in the heavy fraction if no other Poa spp. seeds/fruits may have various appendages (awns, stalk,
were present in the light fraction). These are separated un- etc.) attached. Such appendages must be left attached to
der magnification into the different Poa spp. present. The the seeds, but on the request of the applicant the content of
percentage of each is then determined by weight (3.6). seeds with appendages longer than the greatest dimension
must be reported according to 3.7.
3.5.2.5.4 Procedure for chemically treated seeds of

species for which blowing is the prescribed method 3.5.2.9 Winged seed
for the purity test
For seeds with PSD 47, winged seeds are those which re-
Where such chemical treatment affects the blowing char- tain an integument, either with or without wing or a por-
acteristics of the seed, the purity of the sample must be tion thereof. For seeds with PSD 51, winged seeds are
determined using the hand method and the Certificate en- those which retain the wing or a portion thereof. When-
dorsed with the words: ‘Because of the chemical treatment ever present, such appendages must be left attached to the
the purity test has been carried out by the hand method’. seed and the content of ‘winged’ seed reported according
Where the seed lot has been tested before the treatment to 3.7.
was applied and only a germination result after treatment

3.6 Calculation and expression of against gain or loss. If there is a discrepancy of more than
results 5 % of the initial weight, a retest on two half working sam-
ples is required. The result of the retest is then reported.
3.6.1 One whole working sample

3.6.2.2 Calculation of component percentages
3.6.1.1 Test for weight gain or loss during
analysis For each half working sample, calculate the percentage
by weight of each component (3.3) to at least two deci-
Add together the weights of all the component fractions mal places. Percentages must be based on the sum of the
from the working sample. This sum must be compared weights of the components in each half working sample,
with the original weight as a check against gain or loss. not on the original weights of the working samples. Add
If there is a discrepancy of more than 5 % of the initial the appropriate percentages together from each half work-
weight, a retest must be made. The result of the retest is ing sample and calculate the average percentage by weight
then reported. for each component. (If desired, the percentages may now
be rounded off to a minimum of two decimal places; but
do not correct to 100.00 %). Check against tolerances and
3.6.1.2 Calculation of component percentages round off according to 3.6.2.3 and 3.6.2.4, respectively.
The percentage of seed of any particular species other
The percentage by weight of each of the component parts than the pure seed, or of any particular kind of inert mat-
to be reported on the analysis certificate (3.7) must be giv- ter need not be calculated except as required by 3.7. To
en to one decimal place. Percentages must be based on the determine the final reported percentages, add together the
sum of the weights of the components, not on the original weights of pure seed, inert matter and other seeds in each
weight of the working sample. replicate and recalculate the percentages based on the total
The percentage of seed of any particular species other weight of each fraction in the purity test.
than the pure seed, or of any particular kind of inert matter
need not be calculated except as required by 3.7.
3.6.2.3 Test for variation between the two half
working samples
3.6.1.3 Rounding procedure
The difference for each component of the two half work-
Fraction percentages must be rounded to one decimal ing samples must not be in excess of the tolerance given
place. After rounding, add together the percentages of all in Table 3C. Use the average of a component to find the
fractions. Fractions that are to be reported as a ‘trace’ (see relevant range of percentages in columns 1 or 2; columns
3.7) are excluded from this calculation; the other fractions 3 or 4 will give maximum permitted difference between
must then together total 100.0 %. If the sum does not equal the two values of the particular component. For the defini-
100.0 % (either 99.9 or 100.1 %), add or subtract 0.1 % tion of chaffy, refer to 3.6.6.
from the largest value (normally the pure seed fraction). Repeat this for all components. If all components are
within tolerance, calculate the average for each compo-
Note: If a correction of more than 0.1 % is necessary, nent as prescribed in 3.6.2.2 and 3.6.2.4.
check for a calculation error. If any of the components are out of tolerance, employ
the following procedure:
a) Analyse further pairs (but not more than four pairs

3.6.2 Two half working samples in all) until a pair is obtained which has its members
within tolerance.
3.6.2.1 Test for weight gain or loss during b) Discard any pair in which the difference between its
analysis members exceeds twice the tolerance.
c) The percentage of a component finally recorded must
Add together the weights of all the component fractions be calculated from the weighted average of all remain-
independently for each half working sample. These sums ing pairs.
must be compared with the original weight as a check

It is advisable to try to find the cause of the variation 3.6.3.3 Calculation and rounding procedure
encountered, especially if additional tests also show too
much difference. In such cases use the procedure as out- For each of the samples to be included in the final result
lined in 3.5.2.7. add the weights of each fraction together and perform the
calculation according to 3.6.1.2 and round according to
3.6.1.3. Average the results and again round according to
3.6.2.4 Rounding procedure 3.6.1.3.
If all replicates of all fractions are within tolerance, add

the weights of the corresponding fractions together, calcu- 3.6.4 Calculation for species difficult to
late percentages and round the figures off to one decimal separate
place. Refer to 3.6.1.3 for the correction procedure.
When two or more species which are difficult to separate
are in the sample being tested and a final separation is
3.6.3 Two or more whole working made on 400 to 1000 seeds as described in 3.5.2.4 and
samples 3.5.2.5.3, the following calculation is made for calculat-
ing the percentage by weight of one of the contaminant
There are occasions when it is necessary to test a second species.
whole working sample. When a second test is carried out Calculate the percentage of the seeds of that species
the following procedure should be followed. (A) on the basis of their weight in relation to the total
weight of the 400 to 1000 seeds and the initial pure seed
percentage (P1):
3.6.3.1 Procedure
Weight of species A seeds
A % = × P1
Perform the analysis in accordance with 3.5 and the calcu- Total weight of 400 to 1000 seeds
lation as prescribed in 3.6.1.
This percentage is then added to the percentage of the oth-
er seeds component (as it was determined in the purity test
3.6.3.2 Test for variation between samples disregarding these difficult to separate species); the pure
seed percentage is decreased by the same amount to return
When two complete tests have been carried out, pro- the total for the purity test to 100.0 %.
ceed as with duplicate analysis on half working samples
(3.6.2), but use column 5 or 6 to determine the maximum
permitted difference between the two values of the par- 3.6.5 Calculation for individual impurities
ticular component for finding the appropriate tolerance. If having an undue effect on results
an ISTA Certificate has been issued already on the basis of
the first test, refer to 1.6. In the procedure as given in 3.5.2.7, if m (g) have been
If the difference between the results exceeds the toler- removed from a sample of M (g), and if the subsequent
ance, analyse one or two more working samples until a purity test on the cleaned material has given P1 (%) pure
pair is obtained which has its components within tolerance seed, I1 (%) inert matter, and OS1 (%) other seeds, then the
(not more than four samples in all). Report the weighted final purity result must be calculated as follows:
average of the samples for which the highest and lowest
results do not differ by more than twice the tolerance (ac- M−m
Pure seed: P2 = P1 ×
cording to 3.6.3.3), unless it is apparent that one or more M
of these results are due to an error and not to random sam-
ple variation. In that case, discard the test(s) with errors. If Where
no pair of results is within tolerance, it is advisable to find M = initial weight of seed from which impurities having
the cause of the variation encountered (3.5.2.7). an undue effect on results are taken and
m = the weight of the impurity having an undue effect on
the results.

M−m + D1 nents amounting to less than 0.05 % must be reported

Inert matter: I2 = I1 ×
M as ‘Trace’ or ‘TR’ (for ‘Trace’). If no inert matter or
other seeds are found, this must be reported as ‘0.0’.
Where – The kind of inert matter.
D1 = (m1 /M) • 100 and – The scientific name of every species of other seeds
m1 = weight of impurities having an undue effect, removed found, in accordance, where applicable, with the cur-
and classified as inert matter. rent ISTA List of Stabilised Plant Names, available at
www.seedtest.org/stablist (e.g. Elytrigia repens).
M−m – When the weight of the working sample tested for pu-
Other seed: OS2 = OS1 × + D2
M rity equals or is no more than 10 % higher than the
weight specified in Table 2A, column 4 (Purity analy-
Where sis), no statement regarding the weight of the working
D2 = (m2 /M) • 100 and m2 = weight of impurities having sample is required on the ISTA Certificate.
an undue effect, removed and classified as other seed. – When the weight of the working sample tested for pu-
rity deviates from that specified in Table 2A, column
(Check that P2 + I2 + OS2 = 100.0 %) 4, the actual weight of the working sample weighed
according to 3.5.1 must be reported on the ISTA Cer-
tificate using one of the following, as applicable:
3.6.6 Chaffy seed structures a) When testing a weight that exceeds by 10 % the
weight specified in Table 2A, column 4, report un-
Chaffy dispersal units are units which, due to their struc- der other determinations as: ‘Purity: ………g’
ture or texture: b) When testing a weight estimated to contain 2500
seed units, report under other determinations as:
1. are likely to adhere to each other or to other objects ‘Purity: ………g (approx. 2500 seeds)’
(woven bags, sampling equipment, dividers, etc.); c) When the submitted sample received for purity
testing weighs less than the weight in Table 2A,
2. may cause other seeds to become trapped or otherwise column 4, report under other determinations and
caught on the crop seeds; use the current statement, according to 2.5.4.5:
‘The submitted sample weighed only … g and is
3. cannot easily be cleaned, mixed or sampled. not in accordance with the International Rules for
Seed Testing.’
A sample is to be regarded as chaffy if the total of all – The percentage of winged seed (as defined in Pure
chaffy structures (including chaffy inert matter) is one Seed Definitions 47 and 51), if winged seeds are found.
third or more. Chaffiness is indicated in Table 3B Part 1
by a ‘C’ in column 4. Upon request, the following information must be reported
under ‘Other determinations’ as follows:
3.7 Reporting results – The percentage by weight of a specified species, en-

tered immediately after the name of the species to the
The results of a purity test must be reported in the spaces nearest 0.1 %. Species for which the percentage by
provided as follows: weight has been requested are listed first.
– Other seeds may be divided into ‘other crop seeds’
– The scientific name of the species of pure seed, in and ‘weed seeds’. In this case, the words ‘Other crop
accordance with Table 2A (e.g. Triticum aestivum). seeds’ must be entered, followed by the percentage
Where it is impossible to determine the species with by weight of other crop seeds and the name(s) of the
certainty on the basis of seed characteristics, reporting species found. This procedure must also be used for
must be done to the most precise taxon possible. ‘Weed seeds’.
– The percentage by weight of pure seed, inert matter – Multiple seed units must be reported as ‘ % MSU’.
and other seeds, given to one decimal place. The per- – Seeds with appendages attached must be reported as
centage of all components must total 100 %. Compo- ‘ % seeds with appendages attached’.

– The kinds of inert matter, together with the percent- 3.8 Pure seed definitions
age by weight of any particular kind (to one decimal
place). The pure seed definition (PSD) number for each genus is
– The percentage by weight of broken pure seed. listed in Table 3B Part 1. Genera regarded as chaffy are in-
dicated with a ‘C’, for the purpose of applying the correct
The percentages may be reported to more than one deci- column of the tables of tolerances (Tables 3C–E, column
mal place if requested. 4; see also 3.6.2.3 and 3.6.6).
The detailed pure seed definitions are listed in Table
3B Part 2. The structures described in the definitions in
Part 2 are to be classed as pure seed. Appendages are not
to be classed as pure seed, unless specifically referred to
in Table 3B Part 2.
A glossary of terms listed in Table 3B Part 2 can be
found in Table 3B Part 3.
Table 3B Part 1. Pure seed definition numbers and chaffiness of seeds, listed by genus
Genus Family PSD Chaffi- Genus Family PSD Chaffi-

no. ness no. ness
Abelmoschus Malvaceae 10 Antirrhinum Scrophulariaceae 10 C
Abies Pinaceae 51 C Apium Apiaceae 15 C
Abutilon Malvaceae 16 Aquilegia Ranunculaceae 10
Acacia Fabaceae 50 Arabis Brassicaceae 11
Acer Aceraceae 52 C Arachis Fabaceae 21 C
Achillea Asteraceae 1 Arctium Asteraceae 4
Adonis Ranunculaceae 4 Arctotis Asteraceae 4 C
Aeschynomene Fabaceae 23 C Armeria Plumbaginaceae 2 C
Aesculus Hippocastanaceae 10 Arrhenatherum Poaceae 35 C
Ageratum Asteraceae 4 C Artemisia Asteraceae 1
Agrimonia Rosaceae 3 C Asclepias Asclepiadaceae 10 C
Agropyron Poaceae 28 C Asparagus Asparagaceae 10
Agrostis Poaceae 34 C Aster Asteraceae 4
Ailanthus Simaroubaceae 52 C Astragalus Fabaceae 11
Alcea Malvaceae 16 C Astrebla Poaceae 41 C
Allium Alliaceae 10 Atriplex Chenopodiaceae 2
Alnus Betulaceae 53 C Atropa Solanaceae 10
Alopecurus Poaceae 34 C Aubrieta Brassicaceae 11
Althaea Malvaceae 16 C Aurinia Brassicaceae 11 C
Alysicarpus Fabaceae 20 Avena Poaceae 33 C
Alyssum Brassicaceae 11 C Axonopus Poaceae 36 C

Amaranthus Amaranthaceae 10 Bassia Chenopodiaceae 2 C
Amberboa Asteraceae 4 C Beckmannia Poaceae 34 C
Ammobium Asteraceae 1 Begonia Begoniaceae 10
Amorpha Fabaceae 22 Bellis Asteraceae 1
Anagallis Primulaceae 10 Berberis Berberidaceae 50
Anchusa Boraginaceae 18 C Beta Chenopodiaceae 46 C
Andropogon Poaceae 42 C Betula Betulaceae 53 C
Anemone Ranunculaceae 4 C (see also Chapter 13)
Anethum Apiaceae 15 C Borago Boraginaceae 18 C
Angelica Apiaceae 15 C Bothriochloa Poaceae 42 C
Anthoxanthum Poaceae 29 C Bouteloua Poaceae 42 C
Anthriscus Apiaceae 15 C Brachiaria Poaceae 36 C
Anthyllis Fabaceae 11 Brachyscome Asteraceae 5

Table 3B Part 1. Pure seed definition numbers and chaffiness of seeds, listed by genus (cont.)

no. ness no. ness
Brassica Brassicaceae 11 Corymbia Myrtaceae 60 C
Briza Poaceae 34 C (see also Chapter 13)
Bromus Poaceae 33 C Cosmos Asteraceae 4 C
Browallia Solanaceae 10 Cotoneaster Rosaceae 56
Brunnera Boraginaceae 18 C Crambe Brassicaceae 23
Cajanus Fabaceae 11 Crataegus Rosaceae 56
Calceolaria Scrophulariaceae 10 Crotalaria Fabaceae 11
Calendula Asteraceae 1 C Cryptomeria Taxodiaceae 49 C
Callistephus Asteraceae 1 Cucumis Cucurbitaceae 10
Calocedrus Cupressaceae 49 C Cucurbita Cucurbitaceae 10
Calopogonium Fabaceae 11 Cuminum Apiaceae 15 C
Camelina Brassicaceae 11 Cupressus Cupressaceae 49 C
Campanula Campanulaceae 10 Cyamopsis Fabaceae 11
Cannabis Cannabaceae 4 Cyclamen Primulaceae 10
Capsicum Solanaceae 10 Cydonia Rosaceae 10
Caragana Fabaceae 11 Cymbalaria Scrophulariaceae 10 C
Carica Caricaceae 10 C Cynara Asteraceae 4
Carpinus Betulaceae 57 C Cynodon Poaceae 28 C
Carthamus Asteraceae 4 Cynoglossum Boraginaceae 18 C
Carum Apiaceae 15 Cynosurus Poaceae 28 C
Castanea Fagaceae 57 Cytisus Fabaceae 50
Catalpa Bignoniaceae 48 C Dactylis Poaceae 33 C
Cedrela Meliaceae 48 C Dahlia Asteraceae 9 C
Cedrus Pinaceae 51 C Datura Solanaceae 10
Celosia Amaranthaceae 10 Daucus Apiaceae 15 C
Cenchrus Poaceae 43 C Delphinium Ranunculaceae 10 C
Centaurea Asteraceae 4 C Deschampsia Poaceae 28 C
Centrosema Fabaceae 11 Desmodium Fabaceae 11 C
Cerastium Caryophyllaceae 10 Dianthus Caryophyllaceae 10 C
Chamaecrista Fabaceae 11 Dichanthium Poaceae 42 C
Chamaecyparis Cupressaceae 49 C Dichondra Convolvulaceae 10
Chelidonium Papaveraceae 13 C Digitalis Scrophulariaceae 10
Chloris Poaceae 42 C Digitaria Poaceae 36 C
(see also Chapter 13) Dimorphotheca Asteraceae 8 C
Chrysanthemum Asteraceae 1 C Doronicum Asteraceae 4 C
Cicer Fabaceae 11 Dorotheanthus Aizoaceae 10
Cichorium Asteraceae 4 C Echinacea Asteraceae 1 C
Citrullus Cucurbitaceae 10 Echinochloa Poaceae 36 C
Clarkia Onagraceae 10 Echinops Asteraceae 26 C
Claytonia Portulacaceae 10 Echium Boraginaceae 18 C
Cleome Capparidaceae 10 Ehrharta Poaceae 29 C
Cnicus Elaeagnus Elaeagnaceae 57
(see Centaurea) Eleusine Poaceae 61
Cobaea Polemoniaceae 14 C Elymus Poaceae 28 C
Coix Poaceae 37 C Elytrigia Poaceae 28 C
Coleostephus Asteraceae 1 C Eragrostis Poaceae 28
Coleus (see Erigeron Asteraceae 4 C
Plectranthus) Eruca Brassicaceae 11
Consolida Ranunculaceae 10 C Erysimum Brassicaceae 11
Convolvulus Convolvulaceae 10 Eschscholzia Papaveraceae 10
Corchorus Tiliaceae 10 Eucalyptus Myrtaceae 60 C
Coreopsis Asteraceae 8 C (see also Chapter 13)
Coriandrum Apiaceae 15 Euonymus Celastraceae 10
Cornus Cornaceae 55 Fagopyrum Polygonaceae 2 C
Corylus Betulaceae 57 Fagus Fagaceae 57 C
Fatsia Araliaceae 10 C


no. ness no. ness
Festuca Poaceae 33 C Kummerowia Fabaceae 22
×Festulolium Poaceae 33 C Lablab Fabaceae 11
Foeniculum Apiaceae 15 C Laburnum Fabaceae 11
Fragaria Rosaceae 1 Lactuca Asteraceae 4 C
Fraxinus Oleaceae 52 C Lagenaria Cucurbitaceae 10
Freesia Iridaceae 10 Larix Pinaceae 51 C
Gaillardia Asteraceae 4 C Lathyrus Fabaceae 11 C
Galega Fabaceae 11 Lavandula Lamiaceae 18
Galeopsis Lamiaceae 18 Lavatera Malvaceae 16
Gazania Asteraceae 4 C Legousia Campanulaceae 10
Gentiana Gentianaceae 10 C Lens Fabaceae 11
Geranium Geraniaceae 17 Leontopodium Asteraceae 1 C
Gerbera Asteraceae 4 C Leonurus Lamiaceae 18
Geum Rosaceae 4 C Lepidium Brassicaceae 11
Gilia Polemoniaceae 10 Lespedeza Fabaceae 22
Ginkgo Ginkgoaceae 10 Leucaena Fabaceae 11
Glandularia Verbenaceae 18 Leucanthemum Asteraceae 1 C
Glebionis Asteraceae 1 C Levisticum Apiaceae 15 C
Gleditsia Fabaceae 11 Liatris Asteraceae 4 C
Glycine Fabaceae 11 Ligustrum Oleaceae 10 C
Gomphrena Amaranthaceae 2 C Lilium Liliaceae 10 C
Goniolimon Plumbaginaceae 27 C Limonium Plumbaginaceae 27 C
Gossypium Malvaceae 12 C Linaria Scrophulariaceae 10 C
Grevillea Proteaceae 14 C Linum Linaceae 10
Gypsophila Caryophyllaceae 10 Liquidambar Hamamelidaceae 48 C
Hedysarum Fabaceae 23 C Liriodendron Magnoliaceae 52 C
Helenium Asteraceae 4 C Listia Fabaceae 11
Helianthemum Cistaceae 10 Lobelia Campanulaceae 10 C
Helianthus Asteraceae 4 Lobularia Brassicaceae 11 C
Helichrysum (see Lolium Poaceae 33 C
Xerochrysum) Lomelosia Dipsacaceae 6 C
Heliopsis Asteraceae 1 Lonas Asteraceae 4 C
Heliotropium Boraginaceae 18 C Lotononis (see Listia)
Helipterum (see Lotus Fabaceae 11
Rhodanthe) Luffa Cucurbitaceae 10
Hesperis Brassicaceae 11 Lunaria Brassicaceae 11
Heteranthemis Asteraceae 1 C Lupinus Fabaceae 11
Heuchera Saxifragaceae 10 C Lycopersicon (see
Hibiscus Malvaceae 10 Solanum)
Hippeastrum Amaryllidaceae 10 Macroptilium Fabaceae 11
Holcus Poaceae 35 C Macrotyloma Fabaceae 11
Hordeum Poaceae 62 Mahonia
Hypericum Hypericaceae 10 (see Berberis)

Hyssopus Lamiaceae 18 Malcolmia Brassicaceae 11
Iberis Brassicaceae 11 Malope Malvaceae 16
Ilex Aquifoliaceae 56 Malus Rosaceae 10
Impatiens Balsaminaceae 10 Malva Malvaceae 16
Inula Asteraceae 4 C Marrubium Lamiaceae 18
Ipomoea Convolvulaceae 10 Matricaria Asteraceae 1 C
Jacobaea Asteraceae 4 C Matthiola Brassicaceae 11 C
Juniperus Cupressaceae 11 Medicago Fabaceae 11
Kalanchoe Crassulaceae 10 C Melilotus Fabaceae 21
Kniphofia Asphodelaceae 10 C Melinis Poaceae 36 C
Kochia (see Bassia) Melissa Lamiaceae 18
Koeleria Poaceae 33 C Mentha Lamiaceae 18
Koelreuteria Sapindaceae 10 Mimosa Fabaceae 11


no. ness no. ness
Mimulus Scrophulariaceae 10 Poa bulbosa Poaceae 63 C
Mirabilis Nyctaginaceae 1 Populus Salicaceae 12 C
Moluccella Lamiaceae 18 Portulaca Portulacaceae 10
Momordica Cucurbitaceae 10 Primula Primulaceae 10
Morus Moraceae 57 Prunus Rosaceae 56
Mucuna Fabaceae 11 Psathyrostachys Poaceae 28 C
Myosotis Boraginaceae 18 Psephellus Asteraceae 4 C
Nasturtium Brassicaceae 11 Pseudoroegneria Poaceae 28 C
Nemesia Scrophulariaceae 10 C Pseudotsuga Pinaceae 51 C
Nemophila Hydrophyllaceae 10 C Psophocarpus Fabaceae 11
Neonotonia Fabaceae 11 Psylliostachys Plumbaginaceae 27 C
Nepeta Lamiaceae 18 Pueraria Fabaceae 11
Nicotiana Solanaceae 10 Pyrus Rosaceae 10
Nierembergia Solanaceae 10 C Quercus Fagaceae 57
Nigella Ranunculaceae 10 Ranunculus Ranunculaceae 4 C
Nothofagus Fagaceae 57 C Raphanus Brassicaceae 23
Ocimum Lamiaceae 18 raphanistrum
Oenothera Onagraceae 10 Raphanus (all other Brassicaceae 11
Onobrychis Fabaceae 21 C species)
Origanum Lamiaceae 18 Reseda Resedaceae 10
Ornithopus Fabaceae 23 C Rheum Polygonaceae 2 C
Oryza Poaceae 38 C Rhodanthe Asteraceae 4 C
Osteospermum Asteraceae  8 C Ricinus Euphorbiaceae 13
Panicum Poaceae 36 C Robinia Fabaceae 11
Papaver Papaveraceae 10 Rosa Rosaceae 57
Pascopyrum Poaceae 28 C Rosmarinus Lamiaceae 18
Paspalum Poaceae 36 C Rudbeckia Asteraceae 1 C
Pastinaca Apiaceae 15 C Rumex Polygonaceae 2 C
Pelargonium Geraniaceae 17 Ruta Rutaceae 10
Pennisetum Poaceae 43 C Saintpaulia Gesneriaceae 10
Penstemon Scrophulariaceae 10 C Salix Salicaceae 12 C
Pericallis Asteraceae 4 C Salpiglossis Solanaceae 10
Perilla Lamiaceae 18 Salvia Lamiaceae 18
Petroselinum Apiaceae 15 C Sanguisorba Rosaceae 3 C
Petunia Solanaceae 10 Sanvitalia Asteraceae 5 C
Phacelia Hydrophyllaceae 10 C Saponaria Caryophyllaceae 10
Phalaris Poaceae 29 C Satureja Lamiaceae 18
Phaseolus Fabaceae 11 Scabiosa Dipsacaceae 6 C
Phleum Poaceae 28 C Schefflera Araliaceae 10
Phlox Polemoniaceae 10 Schizachyrium Poaceae 42 C
Pholistoma Hydrophyllaeae 10 C Schizanthus Solanaceae 10
Physalis Solanaceae 10 Scorzonera Asteraceae 4 C
Picea Pinaceae 47 C Secale Poaceae 40

Pimpinella Apiaceae 15 C Securigera Fabaceae 21
Pinus I (P. palustris, P. Pinaceae 51 C Senecio Asteraceae 4 C
rigida) Sequoia Taxodiaceae 49 C
Pinus II (all other Pinaceae 47 Sequoiadendron Taxodiaceae 49 C
species) Sesamum Pedaliaceae 10
Piptatherum Poaceae 31 C Setaria Poaceae 36 C
Pisum Fabaceae 11 Silene Caryophyllaceae 10
Plantago Plantaginaceae 10 Silybum Asteraceae 4
Platanus Platanaceae 58 C Sinapis Brassicaceae 11
Platycladus Cupressaceae 49 C Sinningia Gesneriaceae 10
Plectocephalus Asteraceae 4 C Solanum Solanaceae 10
Plectranthus Lamiaceae 18 Solanum (sect. Solanaceae 10 C
Poa (non bulbosa) Poaceae 41 C Lycopersicon)


no. ness no. ness
Sorbus Rosaceae 10 ×Triticosecale Poaceae 40
Sorghastrum Poaceae 42 C Triticum (excluding T. Poaceae 40
Sorghum Poaceae 42 C spelta and T. dicoccon)
Spartium Fabaceae 11 Triticum (only T. spelta Poaceae 33 C
Spergula Caryophyllaceae 10 and T. dicoccon)
Spinacia Chenopodiaceae 2 C Tropaeolum Tropaeolaceae 16
Stachys Lamiaceae 18 Tsuga Pinaceae 51 C
Stylosanthes Fabaceae 24 C Ulmus Ulmaceae 52 C
Styphnolobium Fabaceae 20 Urochloa Poaceae 36 C
Syringa Oleaceae 48 C Vaccaria Caryophyllaceae 10
Tagetes Asteraceae 4 C Valeriana Valerianaceae 7 C
Tanacetum Asteraceae 1 C Valerianella Valerianaceae 25 C
Taraxacum Asteraceae 4 C Verbascum Scrophulariaceae 10
Taxodium Taxodiaceae 11 C Verbena Verbenaceae 18
Taxus Taxaceae 50 Viburnum Adoxaceae 55
Tectona Verbenaceae 54 Vicia Fabaceae 11
Tetragonia Aizoaceae 19 Vigna Fabaceae 11
Thuja Cupressaceae 49 C Vinca Apocynaceae 10
Thunbergia Acanthaceae 10 Viola Violaceae 13
Thymus Lamiaceae 18 Xeranthemum Asteraceae 4 C
Tilia Tiliaceae 57 C Xerochrysum Asteraceae 4 C
Torenia Scrophulariaceae 10 Zea Poaceae 40
Tragopogon Asteraceae 4 C Zelkova Ulmaceae 59 C
Trifolium Fabaceae 11 Zinnia Asteraceae 9 C
Trigonella Fabaceae 11 Zoysia Poaceae 39 C
Tripleurospermum Asteraceae 1 C
Trisetum Poaceae 28 C

Table 3B Part 2. Numbered pure seed definitions
For the sake of brevity, several genera which have similar 5. Achene, with or without wing and/or pappus or bristle,
pure seed definitions have been combined under the same unless it is obvious that no seed is present.
number. Exceptions to the general definition have been Piece of achene larger than one-half the original size,
given in brackets. For more detailed individual definitions unless it is obvious that no seed is present.
for agricultural and vegetable, and flower, spice, herb and Seed, with the pericarp/testa partially or entirely

medicinal plant seeds, refer to the ISTA Handbook of Pure removed.
Seed Definitions. Piece of seed larger than one-half the original size,
with the pericarp/testa partially or entirely removed.
1. Achene, unless it is obvious that no seed is present.
Piece of achene larger than one-half the original size, 6. Achene, with or without involucel, calyx or beak, un-
unless it is obvious that no seed is present. less it is obvious that no seed is present.
Seed, with the pericarp/testa partially or entirely
Piece of achene larger than one-half the original size,
removed. unless it is obvious that no seed is present.
Piece of seed larger than one-half the original size, Seed, with the pericarp/testa partially or entirely

with the pericarp/testa partially or entirely removed. removed.
Piece of seed larger than one-half the original size,
2. Achene or cluster, with or without perianth or pedicel, with the pericarp/testa partially or entirely removed.
unless it is obvious that no seed is present.
Piece of achene or cluster larger than one-half the orig- 7. Achene, with or without feathery calyx, unless it is ob-
inal size, unless it is obvious that no seed is present. vious that no seed is present.
removed. unless it is obvious that no seed is present.

with the pericarp/testa partially or entirely removed. removed.
Gomphrena: Achene with or without hairy perianth, Piece of seed larger than one-half the original size,
unless it is obvious that no seed is present. with the pericarp/testa partially or entirely removed.
3. Achene, with or without hypanthium, unless it is obvi- 8. Achene, with or without wing, unless it is obvious that
ous that no seed is present. no seed is present.
Piece of achene larger than one-half the original size, Piece of achene larger than one-half the original size,
unless it is obvious that no seed is present. unless it is obvious that no seed is present.

removed. removed.
Piece of seed larger than one-half the original size, Piece of seed larger than one-half the original size,
with the pericarp/testa partially or entirely removed. with the pericarp/testa partially or entirely removed.
4. Achene, with or without beak, pappus or bracts, in-

cluding achenes where two or more seed units are
joined together by fused pericarps, unless it is obvious
that no seed is present.


removed.

Table 3B Part 2. Numbered pure seed definitions (cont.)
9. Achene, with or without bristles, unless it is obvious iece of seed larger than one-half the original size,
P
that no seed is present. with the pericarp partially or entirely removed.
Piece of achene larger than one-half the original size, Fruits with pieces of pedicel longer than the length of
unless it is obvious that no seed is present. the schizocarp/mericarp are reported according to 3.7
(see also 3.5.2.8).
removed.
Piece of seed larger than one-half the original size, 16. Mericarp, unless it is obvious that no seed is present.
with the pericarp/testa partially or entirely removed. Piece of mericarp larger than one-half the original size,
10. Seed, with or without testa. Seed, with the pericarp/testa partially or entirely

Piece of seed larger than one-half the original size, removed.
with or without testa. Piece of seed larger than one-half the original size,
Allium: Pairs of Allium seeds adhering together do not with the pericarp/testa partially or entirely removed.
need to be separated.
17. Mericarp, with or without beak, unless it is obvious
11. Seed, provided a portion of the testa is attached. that no seed is present.
Piece of seed larger than one-half the original size, Piece of mericarp larger than one-half the original size,
provided a portion of the testa is attached. unless it is obvious that no seed is present.
Fabaceae: cotyledons that are broken apart but held Seed, with the pericarp/testa partially or entirely

together within the testa. removed.
Seeds and pieces of seed entirely without testa are re- Piece of seed larger than one-half the original size,
garded as inert matter. with the pericarp/testa partially or entirely removed.
Fabaceae: separated cotyledons are regarded as inert
matter, irrespective of whether the radicle-plumule 18. Nutlet, unless it is obvious that no seed is present.
axis and/or more than half of the testa is attached. Piece of nutlet larger than one-half the original size,
12. Seed, with or without testa, testa with or without hairs. Seed, with the pericarp/testa partially or entirely

13. Seed, with or without testa, with or without strophiole/
caruncle. 19. Nut-like fruit, with enclosing perianth, unless it is ob-
Piece of seed larger than one-half the original size, vious that no seed is present.
with or without testa. Piece of fruit larger than one-half the original size, un-
less it is obvious that no seed is present.
14. Seed, with or without testa, with or without wing. Seed, with the pericarp/testa partially or entirely

15. Schizocarp/mericarp, with or without pedicel (of any
length), unless it is obvious that no seeds are present.

Piece of mericarp larger than one-half the original size,
Seed, with the pericarp partially or entirely removed.

20. Pod, or portion of pod with one seed. abaceae: separated cotyledons are regarded as inert
F
Seed, provided a portion of the testa is attached. matter irrespective of whether the radicle-plumule axis
Piece of seed larger than one-half the original size, and/or more than half of the testa is attached.
provided a portion of the testa is attached.
Cotyledons that are broken apart but held together 24. Pod, with or without beak, unless it is obvious that no
within the testa. seed is present.
Seeds and pieces of seed without testa are regarded as Seed, provided a portion of the testa is attached.
inert matter. Separated cotyledons are regarded as in- Piece of seed larger than one-half the original size,
ert matter, irrespective of whether the radicle-plumule provided a portion of the testa is attached.
axis and/or more than half of the testa is attached. Cotyledons that are broken apart but held together
within the testa.
21. Pod, with or without calyx, with seed(s). Seeds and pieces of seed without testa are regarded as
Seed, provided a portion of the testa is attached. inert matter. Separated cotyledons are regarded as in-
Piece of seed larger than one-half the original size, ert matter, irrespective of whether the radicle-plumule
provided a portion of the testa is attached. axis and/or more than half of the testa is attached.
Cotyledons that are broken apart but held together
within the testa. 25. Dry, indehiscent fruit with 1–3 loculi, with or without
Seeds and pieces of seed without testa are regarded as calyx or pedicel or stalk fragment, unless it is obvious
inert matter. Separated cotyledons are regarded as in- that no seed is present.
ert matter, irrespective of whether the radicle-plumule Seed, with or without testa.
axis and/or more than half of the testa is attached. Piece of seed larger than one-half the original size,
with or without testa.
22. Pod, with or without calyx or bracts, with one seed.
Seed, provided a portion of the testa is attached. 26. One-flowered capitulum, unless it is obvious that no
Piece of seed larger than one-half the original size, achene is present.
provided a portion of the testa is attached. Achene, with or without pappus, unless it is obvious
Cotyledons that are broken apart but held together that no seed is present.
within the testa. Piece of achene larger than one-half the original size,
Seeds and pieces of seed without testa are regarded as unless it is obvious that no seed is present.
inert matter. Separated cotyledons are regarded as in- Seed, with the pericarp/testa partially or entirely

ert matter, irrespective of whether the radicle-plumule removed.
axis and/or more than half of the testa is attached. Piece of seed larger than one-half the original size,
23. One-seeded segment of pod or siliqua, with or without
stalk or terminal beak, unless it is obvious that no seed 27. Flower head, with or without pedicel, unless it is obvi-
is present. ous that no achenes are present.
Seed, provided a portion of the testa is attached. Achene, with or without perianth, unless it is obvious
Piece of seed larger than one-half the original size, that no seed is present.
provided a portion of the testa is attached. Piece of achene larger than one-half the original size,
Ornithopus compressus: one-seeded pod segment, unless it is obvious that no seed is present.
with or without attached empty pod segments or par- Seed, with the pericarp/testa partially or entirely
tial segments. removed.
Fabaceae: cotyledons that are broken apart but held Piece of seed larger than one-half the original size,
together within the testa. with the pericarp/testa partially or entirely removed.
Seeds and pieces of seed without testa are regarded as
inert matter.

28. Floret, with lemma and palea enclosing a caryopsis, – one fertile floret with one attached fertile or sterile
with or without awn. floret that extends to or beyond the tip of the fertile
Caryopsis. floret, excluding the awns (Fig. 3.1, 8–12).
Piece of caryopsis larger than one-half the original – one fertile floret with two or more attached fertile
size. or sterile florets of any length (Fig. 3.1, 5–7).
Elytrigia repens: floret with lemma and palea enclos- – one fertile floret with basally attached sterile floret
ing a caryopsis at least one-third the length of the palea or glumes of any length (Fig. 3.1, 13–15).
measured from the base of the rachilla, with or without MSUs are left intact and included in the pure seed frac-
awn. tion. However, the applicant may request that they be
weighed and the percentage reported (see 3.5.2.6).
29. Floret, with lemma and palea enclosing a caryopsis, For Triticum dicoccon and Triticum spelta only: with
plus attached sterile lemmas, with or without awn. or without rachis segment attached.
Floret, with lemma and palea enclosing a caryopsis. In Triticum dicoccon and Triticum spelta, combina-
Caryopsis. tions of MSUs may be found. These are not to be sepa-
Piece of caryopsis larger than one-half the original rated in the purity analysis.
size. MSUs of Avena of the type of structure 13 (Fig. 3.1),
Phalaris: including protruding anthers if present. where the lemma of the basal floret envelops the inner
fertile floret, need not be reported as MSUs. All other
30. (Deleted 1 January 2012) structures (Fig. 3.1, 5–12, 14–15) are to be considered
MSU.
31. Floret, with lemma and palea enclosing a caryopsis,
with or without awn. 34. Spikelet, with glumes, lemma and palea enclosing a
Piece of floret containing a caryopsis larger than one- caryopsis, with or without awn.
half the original size. Floret, with lemma and palea enclosing a caryopsis,
Caryopsis. with or without awn.
Piece of caryopsis larger than one-half the original Caryopsis.
size. Piece of caryopsis larger than one-half the original
size.
32.(Deleted 1 July 1993; see PSD 33) Alopecurus: palea absent.
33. Floret, with lemma and palea enclosing a caryopsis 35. Spikelet, with lemma and palea enclosing a caryopsis,
with or without awn. plus attached staminate floret, with or without awn.
Festuca, Lolium, ×Festulolium: size of caryopsis at Floret, with lemma and palea enclosing a caryopsis,
least one-third the length of the palea, measured from with or without awn.
the base of the rachilla. Caryopsis.
Caryopsis. Piece of caryopsis larger than one-half the original
Piece of caryopsis larger than one-half the original size.
size. Holcus: spikelet with glumes, lemma and palea en-
The floret may be with or without attached single fer- closing a caryopsis, plus attached staminate floret,
tile or sterile floret, provided that the attached floret with or without awn.
does not extend to the tip of the fertile floret, excluding

the awn (Fig. 3.1, 1–4). 36. Spikelet, with or without pedicel, with glumes, lemma
Where a uniform blowing method is prescribed, see and palea enclosing a caryopsis, plus attached sterile
3.5.2.5. lemma.
Floret, with lemma and palea enclosing a caryopsis.
Multiple seed units Caryopsis.
Seed units may consist of spikelets or parts of spike- Piece of caryopsis larger than one-half the original
lets with more than one floret. Such structures with or size.
without glumes are called multiple seed units (MSUs) Axonopus: spikelet, with single glume, lemma and
when formed by the following structures: palea enclosing a caryopsis, plus attached sterile
lemma.

Figure 3.1. Classification of single and multiple seed units. The stippled portion represents fertile florets and the clear
portion sterile florets.
chinochloa and Melinis: attached sterile lemma with

E 40. Caryopsis.
or without awn. Piece of caryopsis larger than one-half the original
Panicum and Digitaria: no need to check for the pres- size.
ence of a caryopsis.
41. Spikelet, with lemma and palea enclosing a caryopsis,
37. Spikelets (one fertile*, two sterile) enclosed in a bead- with or without awn, plus attached sterile floret.
like involucre. Floret, with lemma and palea enclosing a caryopsis,
Caryopsis. with or without awn.
Piece of caryopsis larger than one-half the original Caryopsis.
size. Piece of caryopsis larger than one-half the original
*The fertile spikelet consists of glumes, lemma and size.
palea enclosing a caryopsis, plus attached sterile Astrebla: spikelet and floret with or without caryopsis.
lemma. Where a uniform blowing method is prescribed (Poa
pratensis, P. trivialis) see 3.5.2.5.
38. Spikelet, with glumes, lemma and palea enclosing a
caryopsis, including the awn irrespective of its size. 42. Spikelet, with glumes enclosing a caryopsis with or
Floret, with or without sterile lemmas, with lemma without hyaline palea or lemmas, rachis segment(s),
and palea enclosing a caryopsis, including the awn ir- pedicel(s), awn(s), attached sterile or fertile floret(s).
respective of its size. Floret, with lemma and palea, with or without awn.
Floret with lemma and palea enclosing a caryopsis, in- Caryopsis.
cluding the awn irrespective of its size. Piece of caryopsis larger than one-half the original
Caryopsis. size.
Piece of caryopsis larger than one-half the original Bouteloua, Chloris: no need to check for the presence
size. of a caryopsis.
Seeds with awns longer than the length of the floret are
reported according to 3.7 (see also 3.5.2.8). 43. Fascicle or burr with involucre of bristles and 1–5
spikelets, each comprising glumes, lemma and palea
39. Spikelet, with one glume*, lemma and palea enclosing enclosing a caryopsis, plus attached sterile lemma.
a caryopsis. Floret, with lemma and palea enclosing a caryopsis.
Caryopsis. Caryopsis.
Piece of caryopsis larger than one-half the original Piece of caryopsis larger than one-half the original
size. size.
*First glume absent, second glume completely infold- Cenchrus: burr or fascicle, with or without caryopsis.
ing the thin lemma and palea, the palea sometimes
obsolete.

44.(Deleted 1 July 1993; see PSD 42) 49. Seed, with or without wing(s), provided a portion of
the testa is attached.
45. (Deleted 1 July 1993; see PSD 42) Piece of seed larger than one-half the original size,
provided a portion of the testa is attached.
46. Cluster, or piece of cluster, with or without stalk, with Seeds are normally winged, are not weighed separate-
or without pieces of leaf, unless it is obvious that no ly and are therefore all pure seed.
seed is present.
50. Seed, provided a portion of the testa is attached, with
removed. or without aril.
Piece of seed larger than one-half the original size with Piece of seed larger than one-half the original size,
the pericarp/testa partially or entirely removed. provided a portion of the testa is attached.
Clusters with pieces of stalk or leaf protruding more
than the largest dimension of the cluster are reported 51. Seed, without wing, with (but occasionally without)
according to 3.7 (see also 3.5.2.8). integument, provided a part of the testa is attached.
47. Seed, without wing or integument, provided a portion without wing, with (but occasionally without) integu-
of the testa is attached. ment, provided a portion of the testa is attached.
Piece of seed larger than one-half the original size, ‘Integument’ refers to the tissue attaching the wing to
without wing or integument, provided a portion of the the seed. In Pinaceae with PSD 51, the integument
testa is attached. is fused to or intimately associated with the seed, is
‘Integument’ refers to the tissue attaching the wing to rarely removed in processing, and is impossible to
the seed. In Pinaceae with PSD 47, the integument consistently remove without causing damage. Hence,
is not intimately associated with the seed and is usu- seed with fused or intimately associated integument
ally removed in processing, thus removing the wing. attached is considered to be ‘pure seed’. Winged seed
However, if an integument (with or without wing) is (i.e. seed with an integument plus wing still attached)
still attached to any seed during the purity analysis, must be weighed and reported as a separate percent-
such seed will be regarded as ‘winged seed’ and must age from ‘pure seed’ according to paragraphs 3.5.2.9
be left intact; neither the integument nor wing should and 3.7. After weighing, the winged seed and pure
be deliberately removed. Winged seed (i.e. seed with seed fractions should be recombined and used in rep-
an attached integument with or without a wing of resentative proportions for counting out the germina-
any size) must be weighed and reported as a separate tion replicates.
percentage from ‘pure seed’ according to paragraphs
3.5.2.9 and 3.7. After weighing, the winged seed and 52. Samara (winged fruit), with or without wing(s).
pure seed fractions should be recombined and used in Piece of samara larger than one-half the original size.
representative proportions for counting out the germi- Seed with the pericarp/testa partially or entirely

nation replicates. removed.
48. Seed, with or without wing(s), unless it is obvious that with the pericarp/testa partially or entirely removed.
no embryo is present, with or without testa. Samaras are normally winged, are not weighed sepa-
Piece of seed larger than one-half the original size, un- rately and are therefore all pure seed.
less it is obvious that no embryo is present, with or

without testa. 53. Samara (winged fruit), with or without wing(s), with
Seeds are normally winged, are not weighed separate- or without attached styles.
ly and are therefore all pure seed. Piece of samara larger than one-half the original size.

removed.
Samaras are normally winged, are not weighed sepa-
rately and are therefore all pure seed.

54. Fruit with or without calyx. 59. Nut, with or without perianth, unless it is obvious that
Piece of fruit, unless it is obvious that no seed is no seed is present.
present. Piece of nut larger than one-half the original size, un-
Seed, with or without testa. less it is obvious that no seed is present.

with or without testa. removed.
55. Drupe, containing a pyrene (kernel, stone). with the pericarp/testa partially or entirely removed.
Pyrene, unless it is obvious that no seed is present.
Piece of pyrene larger than one-half the original size, 60. Seed, with or without testa.
unless it is obvious that no seed is present. Piece of seed more than one-half the original size, with
or without testa.
removed. In many species of Eucalyptus it is impossible to dif-
Piece of seed larger than one-half the original size, ferentiate with certainty between seed and ovulodes
with the pericarp/testa partially or entirely removed. (= unfertilised or inhibited ovules that did not develop
into mature seed). In these cases, and upon request also
56. Pyrene (kernel, stone), unless it is obvious that no seed for the species where one can make the distinction, a
is present. simplified procedure as described in Chapter 13 can be
Piece of pyrene larger than one-half the original size, followed. Appropriate information on the method fol-
unless it is obvious that no seed is present. lowed should be given on the Certificate.

removed. 61. Floret, with lemma and palea enclosing a caryopsis.
Piece of seed larger than one-half the original size, Caryopsis, with or without pericarp.
with the pericarp/testa partially or entirely removed. Piece of caryopsis larger than one-half the original
size, with or without pericarp.
57. Nut, unless it is obvious that no seed is present.
Piece of nut larger than one-half the original size, un- 62. Floret, with lemma and palea enclosing a caryopsis,
less it is obvious that no seed is present. with or without awn or with or without rachis segment,
Seed with the pericarp/testa partially or entirely
irrespective of their length.
removed. Piece of floret containing a caryopsis larger than one-
Piece of seed larger than one-half the original size, half the original size.
with the pericarp/testa partially or entirely removed. Caryopsis.
Piece of caryopsis larger than one-half the original
58. Nut, with or without hairs, unless it is obvious that no size.
seed is present. Florets with awn or rachis segment longer than the
Piece of nut larger than one-half the original size, un- length of the floret are reported according to 3.7 (see
less it is obvious that no seed is present. also 3.5.2.8).

removed. 63. Bulbil.
Piece of seed larger than one-half the original size, Piece of bulbil larger than one-half the original size.

Table 3B Part 3. Glossary
achene, achenium a dry, indehiscent, one-seeded fascicle a tuft of branches arising from about the same
fruit, formed from one free carpel (e.g. Ranunculace- place
ae, Geum) with the seed coat distinct from the fruit
coat; occasionally consisting of more than one carpel fertile with functional sex organs; (for grass florets:
(Asteraceae) having a caryopsis)
anther the pollen-producing part of the stamen, borne at floret the lemma and palea with enclosed pistil and sta-
the top of the filament or stalk mens or the mature caryopsis in Poaceae; for the pur-
pose of the Rules, the term floret refers to the fertile
aril, arillus (pl. arilli) a fleshy, often coloured covering floret with or without additional sterile lemmas
or appendage of a seed growing out from the funicle or
base of the ovule (see also caruncle, strophiole) glume one of the two usually sterile bracts at the base of
a grass spikelet
awn, arista slender, straight or bent bristle. In grasses:
usually a continuation of the mid-nerve of lemmas or hair a uni- or multicellular outgrowth of the epidermis
glumes
hypanthium a ring-like, cup-like or tubular structure
beak (-ed) a long, pointed prolongation of a fruit which surrounds the ovary and on which sepals, petals
and stamens are borne
bract a reduced leaf or scale-like structure subtending a
flower or a grass spikelet in its axil indehiscent not opening; fruits which do not open at
maturity
bristle a stiff hair; sometimes applied to the upper part
of an awn, when the latter is bent integument the envelope of an ovule which becomes
the seed coat or testa (generally two integuments pre-
bulbil a small bulb, usually axillary or appearing in- sent). In coniferous seeds integument also refers to the
stead of flowers as in Poa bulbosa, also a bulblet tissue attaching the wing to the seed
calyx (pl. calyces) the outer floral envelope composed involucel a secondary involucre; often around a cluster
of the sepals of flowers
capitulum a dense inflorescence of usually sessile involucre ring of bracts or bristles surrounding the base
flowers of an inflorescence
caruncle small outgrowth of the micropylar region (see lemma the outer (lower) bract of a grass floret, some-
also aril, strophiole) times referred to as the flowering glume or the lower or
outer palea. Bract enclosing the caryopsis on the outer
caryopsis naked grass-fruit in which the testa is united (dorsal) side
with the pericarp
locule, loculus (pl. loculi) compartment of the ovary

cluster a densely crowded inflorescence or, in Beta, part containing the seeds
of an inflorescence
mericarp part of the schizocarp
drupe indehiscent, one-seeded fruit with stony endo-
carp and fleshy outer layers nutlet a small nut
embryo the young plant enclosed in a seed

Table 3B Part 3. Glossary (cont.)
palea the upper (inner) bract of a grass floret, sometimes schizocarp a dry fruit which separates into two or more
called the inner or upper palea. Bract enclosing the units (mericarps) at maturity
caryopsis on the inner ventral side
sessile without a stalk or pedicel
pappus a ring of fine, sometimes feathery hairs or
scales, crowning an achene siliqua dehiscent, dry, two-valved fruit derived from
two carpels, e.g. Brassicaceae.
pedicel the stalk of each single flower in an inflorescence
spikelet the unit of a grass inflorescence comprising
perianth the two floral envelopes (calyx and corolla) or one or more florets subtended by one or two sterile
any one of them glumes. For the purposes of the Rules, the term spike-
let includes, as well as a fertile floret, either one or
pericarp (fruit coat) the wall of the mature ovary or more additional fertile or completely infertile florets,
fruit or glumes
pod dehiscent dry fruit, especially of Fabaceae stalk the stem of any plant organ
pyrene seed enclosed by the hard endocarp from a drupe staminate flower with stamens only
(or similar structures from multi-seeded fruits)
sterile without functional sex organs (for grass florets:
rachilla, rhachilla a secondary rachis. In particular in without caryopsis)
grasses the axis that bears the floret
strophiole small aril, wartlike outgrowth (see also aril,
rachis, rhachis (pl. rachides) the main axis of an caruncle)
inflorescence
testa seed coat
seed unit commonly found dispersal unit, i.e. achenes
and similar fruits, schizocarps, florets etc., as defined wing a flat membranous outgrowth from a fruit or seed
for each genus or species in the Pure Seed Definitions
in Table 3B Parts 1 & 2

3.9 Tolerance tables Table 3C. Tolerances for purity tests on the same submit-
ted sample in the same laboratory (two-way test at 5 %
Table 3C gives tolerances for comparing purity results significance level)
on duplicate samples from the same submitted sample
analysed in the same laboratory. It can be used for any Average of the two test Tolerances for differences
results between
component of a purity test. The table is used by enter-
ing it at the average of the two test results (columns 1 or Half working Whole working
samples samples
2). The appropriate tolerance is found in one of columns
Non- Chaffy Non- Chaffy
3 to 6, determined as to whether the seeds are chaffy or chaffy seeds chaffy seeds
non-chaffy and half or whole working samples have been seeds seeds
analysed. 1 2 3 4 5 6
The tolerances in columns 5 and 6 are extracted from 99.95–100.00 0.00–0.04 0.20 0.23 0.1 0.2
Miles (1963), Table P11, columns C and F respectively, 99.90–99.94 0.05–0.09 0.33 0.34 0.2 0.2
and rounded to one decimal place. Those for half working 99.85–99.89 0.10–0.14 0.40 0.42 0.3 0.3
samples, columns 3 and 4, are calculated from Table P11, 99.80–99.84 0.15–0.19 0.47 0.49 0.3 0.4
columns C and F in Miles (1963) by multiplication with 99.75–99.79 0.20–0.24 0.51 0.55 0.4 0.4
the square root of two. 99.70–99.74 0.25–0.29 0.55 0.59 0.4 0.4
Table 3D gives the tolerances for purity results made 99.65–99.69 0.30–0.34 0.61 0.65 0.4 0.5
on two different submitted samples each drawn from the 99.60–99.64 0.35–0.39 0.65 0.69 0.5 0.5
same lot and analysed in the same or a different labora- 99.55–99.59 0.40–0.44 0.68 0.74 0.5 0.5
99.50–99.54 0.45–0.49 0.72 0.76 0.5 0.5
tory. It can be used for any component of a purity test
99.40–99.49 0.50–0.59 0.76 0.82 0.5 0.6
when the result of the second test is poorer than that
99.30–99.39 0.60–0.69 0.83 0.89 0.6 0.6
of the first test. The table is used by entering it at the 99.20–99.29 0.70–0.79 0.89 0.95 0.6 0.7
average of the two test results (columns 1 or 2). The ap- 99.10–99.19 0.80–0.89 0.95 1.00 0.7 0.7
propriate tolerance is found in columns 3 or 4, determined 99.00–99.09 0.90–0.99 1.00 1.06 0.7 0.8
as to whether the seeds are chaffy or non-chaffy. 98.75–98.99 1.00–1.24 1.07 1.15 0.8 0.8
columns D and G respectively of Table P1 in Miles (1963). 98.25–98.49 1.50–1.74 1.29 1.37 0.9 1.0
Table 3E gives the tolerances for purity results made 98.00–98.24 1.75–1.99 1.37 1.47 1.0 1.0
on two different submitted samples each drawn from the 97.75–97.99 2.00–2.24 1.44 1.54 1.0 1.1
97.50–97.74 2.25–2.49 1.53 1.63 1.1 1.2
same lot and analysed in the same or a different labora-
97.25–97.49 2.50–2.74 1.60 1.70 1.1 1.2
tory. It can be used for any component of a purity test to
97.00–97.24 2.75–2.99 1.67 1.78 1.2 1.3
decide whether two estimates are compatible. The table 96.50–96.99 3.00–3.49 1.77 1.88 1.3 1.3
is used by entering it at the average of the two test re- 96.00–96.49 3.50–3.99 1.88 1.99 1.3 1.4
sults (columns 1 or 2). The appropriate tolerance is found 95.50–95.99 4.00–4.49 1.99 2.12 1.4 1.5
in columns 3 or 4, determined by whether the seeds are 95.00–95.49 4.50–4.99 2.09 2.22 1.5 1.6
chaffy or non-chaffy. 94.00–94.99 5.00–5.99 2.25 2.38 1.6 1.7
columns D and G, respectively, of Table P7 in Miles 92.00–92.99 7.00–7.99 2.59 2.73 1.8 1.9
(1963). 91.00–91.99 8.00–8.99 2.74 2.90 1.9 2.1
90.00–90.99 9.00–9.99 2.88 3.04 2.0 2.2
88.00–89.99 10.00–11.99 3.08 3.25 2.2 2.3
86.00–87.99 12.00–13.99 3.31 3.49 2.3 2.5

84.00–85.99 14.00–15.99 3.52 3.71 2.5 2.6
82.00–83.99 16.00–17.99 3.69 3.90 2.6 2.8
80.00–81.99 18.00–19.99 3.86 4.07 2.7 2.9
78.00–79.99 20.00–21.99 4.00 4.23 2.8 3.0
76.00–77.99 22.00–23.99 4.14 4.37 2.9 3.1
74.00–75.99 24.00–25.99 4.26 4.50 3.0 3.2
72.00–73.99 26.00–27.99 4.37 4.61 3.1 3.3
70.00–71.99 28.00–29.99 4.47 4.71 3.2 3.3
65.00–69.99 30.00–34.99 4.61 4.86 3.3 3.4
60.00–64.99 35.00–39.99 4.77 5.02 3.4 3.6
50.00–59.99 40.00–49.99 4.89 5.16 3.5 3.7

Table 3D. Tolerances for purity tests on two different sub- Table 3E. Tolerances for purity tests on two different sub-
mitted samples from the same lot when a second test is mitted samples from the same seed lot when a second test
made in the same or a different laboratory (one-way test at is made in the same or a different laboratory (two-way test
1 % significance level) at 1 % significance level).
Average of the two test results Tolerance Average of the two test results Tolerance
50–100 % Less than 50 % Non-chaffy Chaffy 50–100 % Less than 50 % Non-chaffy Chaffy
seeds seeds seeds seeds
1 2 3 4 1 2 3 4
99.95–100.00 0.00–0.04 0.2 0.2 99.95–100.00 0.00–0.04 0.2 0.2
99.90–99.94 0.05–0.09 0.3 0.3 99.90–99.94 0.05–0.09 0.3 0.4
99.85–99.89 0.10–0.14 0.3 0.4 99.85–99.89 0.10–0.14 0.4 0.5
99.80–99.84 0.15–0.19 0.4 0.5 99.80–99.84 0.15–0.19 0.4 0.5
99.75–99.79 0.20–0.24 0.4 0.5 99.75–99.79 0.20–0.24 0.5 0.6
99.70–99.74 0.25–0.29 0.5 0.6 99.70–99.74 0.25–0.29 0.5 0.6
99.65–99.69 0.30–0.34 0.5 0.6 99.65–99.69 0.30–0.34 0.6 0.7
99.60–99.64 0.35–0.39 0.6 0.7 99.60–99.64 0.35–0.39 0.6 0.7
99.55–99.59 0.40–0.44 0.6 0.7 99.55–99.59 0.40–0.44 0.6 0.8
99.50–99.54 0.45–0.49 0.6 0.7 99.50–99.54 0.45–0.49 0.7 0.8
99.40–99.49 0.50–0.59 0.7 0,8 99.40–99.49 0.50–0.59 0.7 0.9
99.30–99.39 0.60–0.69 0.7 0.9 99.30–99.39 0.60–0.69 0.8 1.0
99.20–99.29 0.70–0.79 0.8 0.9 99.20–99.29 0.70–0.79 0.8 1.0
99.10–99.19 0.80–0.89 0.8 1.0 99.10–99.19 0.80–0.89 0.9 1.1
99.00–99.09 0.90–0.99 0.9 1.0 99.00–99.09 0.90–0.99 0.9 1.1
98.75–98.99 1.00–1.24 0.9 1.1 98.75–98.99 1.00–1.24 1.0 1.2
98.50–98.74 1.25–1.49 1.0 1.2 98.50–98.74 1.25–1.49 1.1 1.3
98.25–98.49 1.50–1.74 1.1 1.3 98.25–98.49 1.50–1.74 1.2 1.5
98.00–98.24 1.75–1.99 1.2 1.4 98.00–98.24 1.75–1.99 1.3 1.6
97.75–97.99 2.00–2.24 1.3 1.5 97.75–97.99 2.00–2.24 1.4 1.7
97.50–97.74 2.25–2.49 1.3 1.6 97.50–97.74 2.25–2.49 1.5 1.7
97.25–97.49 2.50–2.74 1.4 1.6 97.25–97.49 2.50–2.74 1.5 1.8
97.00–97.24 2.75–2.99 1.5 1.7 97.00–97.24 2.75–2.99 1.6 1.9
96.50–96.99 3.00–3.49 1.5 1.8 96.50–96.99 3.00–3.49 1.7 2.0
96.00–96.49 3.50–3.99 1.6 1.9 96.00–96.49 3.50–3.99 1.8 2.1
95.50–95.99 4.00–4.49 1.7 2.0 95.50–95.99 4.00–4.49 1.9 2.3
95.00–95.49 4.50–4.99 1.8 2.2 95.00–95.49 4.50–4.99 2.0 2.4
94.00–94.99 5.00–5.99 2.0 2.3 94.00–94.99 5.00–5.99 2.1 2.5
93.00–93.99 6.00–6.99 2.1 2.5 93.00–93.99 6.00–6.99 2.3 2.7
92.00–92.99 7.00–7.99 2.2 2.6 92.00–92.99 7.00–7.99 2.5 2.9
91.00–91.99 8.00–8.99 2.4 2.8 91.00–91.99 8.00–8.99 2.6 3.1
90.00–90.99 9.00–9.99 2.5 2.9 90.00–90.99 9.00–9.99 2.8 3.2
88.00–89.99 10.00–11.99 2.7 3.1 88.00–89.99 10.00–11.99 2.9 3.5
86.00–87.99 12.00–13.99 2.9 3.4 86.00–87.99 12.00–13.99 3.2 3.7
84.00–85.99 14.00–15.99 3.0 3.6 84.00–85.99 14.00–15.99 3.4 3.9
82.00–83.99 16.00–17.99 3.2 3.7 82.00–83.99 16.00–17.99 3.5 4.1
80.00–81.99 18.00–19.99 3.3 3.9 80.00–81.99 18.00–19.99 3.7 4.3
78.00–79.99 20.00–21.99 3.5 4.1 78.00–79.99 20.00–21.99 3.8 4.5
76.00–77.99 22.00–23.99 3.6 4.2 76.00–77.99 22.00–23.99 3.9 4.6
74.00–75.99 24.00–25.99 3.7 4.3 74.00–75.99 24.00–25.99 4.1 4.8
72.00–73.99 26.00–27.99 3.8 4.4 72.00–73.99 26.00–27.99 4.2 4.9
70.00–71.99 28.00–29.99 3.8 4.5 70.00–71.99 28.00–29.99 4.3 5.0
65.00–69.99 30.00–34.99 4.0 4.7 65.00–69.99 30.00–34.99 4.4 5.2
60.00–64.99 35.00–39.99 4.1 4.8 60.00–64.99 35.00–39.99 4.5 5.3
50.00–59.99 40.00–49.99 4.2 5.0 50.00–59.99 40.00–49.99 4.7 5.5

International Rules for Seed Testing Chapter 4: Determination of other seeds by number
Chapter 4: Determination of other seeds by number
4.1 Object 4.2.4 Reduced test
The object of the determination is to estimate the num- In a reduced test, less than the whole working sample
ber of seeds of other species stated by the applicant either seed weight is examined for all other seeds present except
generally (e.g. all other species) or by reference to one for Orobanchaceae species.
category of seeds (e.g. species scheduled as noxious in In the case of very expensive seed (see 2.5.4.5), a
a certain country), or specifically (e.g. Elytrigia repens). reduced test can be performed.
In international trade this analysis is used mainly to
determine the presence of seeds of noxious or undesirable
species. 4.2.5 Reduced-limited test
In a reduced-limited test, less than the whole working

4.2 Definitions sample weight is examined for stated species only.
If a species under test is difficult to identify, a mini-
4.2.1 Other seeds mum of one fifth of the prescribed working sample weight
only need be examined, i.e. a reduced-limited test can be
Other seeds refer to species other than those under test as performed.
defined in Rule 3.2.2.
In determining the numbers of other seeds, the defini-
tions prescribed in 3.2 must be observed. The extent of 4.3 General principles
the determination of other seeds by number is for either
all species or a selection of species in a working sample The determination is made by count and expressed as
(see 4.5.1). number of seeds found in the quantity examined. When
Determinations of numbers of dust-like seeds of seeds found cannot be identified with certainty to the spe-
Orobanchaceae species, such as Orobanche or Striga, is cies level it is permitted to report the genus name only.
only completed upon request of the applicant (see 4.5.3).
4.4 Apparatus

4.2.2 Complete test
Sieves, blowers and other mechanical devices can be used
In a complete test, the whole working sample weight to aid the analyst in examining the sample and reducing
is examined for all other seeds present except for the work involved.
Orobanchaceae species. Testing for Orobancheaceae spe-
cies is only completed upon request of the applicant.
4.5 Procedure
4.2.3 Limited test 4.5.1 Working sample
In a limited test, the whole working sample weight is ex- a) The size of the working sample must be either a weight
amined, but for stated species only, as requested by the estimated to contain at least 25 000 seed units or not
applicant. less than the weight prescribed in Table 2A Part 1, col-
umn 5.
b) If a species under test is difficult to identify, a mini-
mum of one fifth of the prescribed working sample
weight only need be examined, i.e. a reduced-limited
test can be performed.

Chapter 4: Determination of other seeds by number International Rules for Seed Testing
4.5.2 Determination 4.5.3.2 Submitted subsample
The working sample is searched either for seeds of all The Orobanche determination requires a separate sealed
other species or of certain stated species, as required by submitted subsample or the whole of the composite sam-
the applicant. The number of seeds found of each species ple to be submitted. The submitted subsample can be ob-
sought is counted. tained from the composite sample by stirring the compos-
If the search is limited to certain stated species, the ite sample with a spoon, then take at a minimum three
examination may be stopped when one or more seeds of subsamples with a spoon from different positions and
one or all of the stated species (as appropriate to the ap- combine them to create the subsample of the required size.
plicant’s requirements) has been found. If the whole of the composite sample is submitted then the
Seeds of the other species found must be retained and submitted subsample must be obtained by the laboratory
stored for reference until sample disposal (see 2.5.3 and from the composite sample.
2.5.4.7). The size of the submitted subsample must either be
a weight estimated to contain at least 25 000 seed units
or not less than the weight prescribed in Table 2A Part 1,
4.5.3 Determination of Orobanche column 5 (Other seeds by number) for the crop species
species under test.
The submitted subsample tested must be weighed in
On request of the applicant, a determination for the pres- grams to the minimum number of decimal places indicat-
ence of Orobanche spp. will be completed, allowing the ed in Table 4.1.
number of Orobanche spp. found in a specified weight of
a submitted subsample to be reported.
4.5.3.3 Working sample
4.5.3.1 Background The working sample for visual analysis for the presence of
Orobanche species is obtained by either: a) washing and
Orobanche spp. are root parasites and can cause very filtration or b) dry sieving the whole weight of the submit-
significant reduction in crop yield of the host plants. The ted subsample.
flowering shoots produce large numbers of very fine, dust-
like seeds. Seed size, shape, colour and surface markings a) Washing and filtration
vary somewhat with each Orobanche species but all are The whole submitted subsample is washed in water con-
basically similar. The seeds of all species of Orobanche taining a detergent and filtered, and the residue collected
are usually pear-shaped, under 0.5 mm long, often 0.2 to on the surface of the filter paper analysed. The seed weight
0.3 mm long with a smaller width, seed width varies by to water volume ratio should be 1:2, e.g. 250 g of seed
species and seeds tend to adhere to the crop seed and other added to 500 mL of water containing one or two drops
surfaces. of surfactant. Large submitted samples may require wash-
The determination requires microscopic analysis of the ing of small batches but the whole submitted subsample
working sample and visual recognition of Orobanche spe- is tested.
cies by the analyst. The working sample is obtained from
the submitted or composite sample either by: a) washing b) Dry sieving
and filtration, or b) dry sieving. The laboratory must de- The whole submitted subsample is sieved ‘dry’ using a
cide on the most appropriate method to use to obtain the sieve and a bottom collecting tray which are shaken by
working sample, both have been proved to be satisfactory a mechanical shaker (e.g. Syntron shaker) or manually.
but effectiveness can vary with the size of the crop species The diameter of the hole in the screen-sieve should be ad-
seed under test. For crop species which have very small equate to retain the crop seed on top and allow the finer
seeds either method is difficult but when a seed lot is very dust-like material to go through to the collection pan, e.g.
expensive, or needs to be returned to the customer, then for Trifolium pratense a suitable diameter of the sieve
the dry method is more appropriate. mesh (round holes) is 0.5 mm. Other combinations of
sieves can be used depending on the size of the crop seed
being tested.

Large submitted samples may require sieving of small – Where it is impossible to determine with certainty on
batches to avoid overloading/plugging the holes of the the basis of seed characteristics, reporting must be
sieve. The size of loading in every batch depends on the done to the most precise taxon possible.
size of the crop seed, the diameter of the sieves and the – If the full weight prescribed in Table 2A was examined
number of holes in every square inch of sieve. For each for all other species present, then the words ‘Complete
sieving operation the sample should be shaken for at least test’ must be entered, alongside the weight of seed
1 minute if a mechanical shaker is used. If the shaking examined.
is manual, the sample should be shaken vigorously for a – If the examination was for only a limited range of other
longer period until the finer material is fully separated. species, then the words ‘Limited test’ must be entered.
The sievings collected in the bottom collecting tray from – If the weight examined for all other species was less
the whole submitted sample are then examined visually. than the prescribed weight, then the words ‘Reduced
test’ must be entered.
– If the weight examined was less than the weight pre-
4.5.3.4 Visual analysis scribed in Table 2A, and only a limited range of other
species was examined, then the words ‘Reduced-limit-
Analysts must search the surface of the filter paper or dry ed test’ must be entered.
sievings for Orobanche seeds using a microscope with at – If a sample of at least 25 000 seeds was examined,
least ×10 magnification. The number of Orobanche seeds and this sample was below the weight prescribed in
present is determined and reported according to 4.7. Table 2A, then the weight of seed examined and the
statement ‘Test based on at least 25 000 seeds’ must be
entered.
4.6 Calculation and expression of
results Upon request, the results may in addition be expressed in
some other way, such as ‘weight of seeds found’ or ‘num-
The result is expressed as the number of seeds belong- ber of seeds per kilogram’.
ing to each stated species or category found in the actual Upon request, the presence of Orobanche species can
quantity examined. In addition the number per unit weight only be reported on a Blue International Seed Sample Cer-
(e.g. per kilogram) may be calculated. tificate (see 1.2.2) and must be reported as: Test for pres-
If a second or more tests are carried out on the same ence of Orobanche species: ‘… seeds of Orobanche spp.
sample, then the result must be expressed as the total num- were found in … g of seed examined.’
ber of seeds found in the total weight examined. If no seeds were found it can be reported as: ‘No seeds
To decide whether two determinations, made in the of Orobanche spp. were found in … g of seed examined.’

same laboratory or in different laboratories, are signifi- The sample weight examined must be reported accord-
cantly different, use Table 4A. The two samples compared ing to the minimum number of decimals indicated in Table
must be of approximately the same weight. 4.1.
Table 4.1. Minimum number of decimal places for report-

4.7 Reporting results ing weights of samples examined
The result of a determination of other seeds by number Weight of sample (g) Minimum number of decimal
places for reporting
must be reported under ‘Other determinations’ as follows:
Lower than 1.000 4
– The actual weight of seed examined to the minimum
1.000–9.999 3
number of decimal places indicated in Table 4.1.
10.00–99.99 2
– The scientific name and number of seeds of each spe- 100.0–999.9 1
cies sought and found in this weight. If no other seeds 1000 or greater 0
are found, this must be indicated on the certificate.

Chapter 4: Determination of other seeds by number International Rules for Seed Testing
4.8 Tolerance tables Table 4B gives the tolerances for counts of number of oth-
er seeds, made on two different submitted samples each
Table 4A gives the maximum difference in the numbers drawn from the same lot and analysed in the same or a dif-
of other seeds, used to decide if two test results are com- ferent laboratory. Both samples are to be of approximately
patible. The tests are to be made on the same or a differ- the same weight. The table can be used when the result
ent submitted sample in the same or a different labora- of the second test is poorer than that of the first test. The
tory. Both samples have to be of approximately the same table is used by entering it at the average of the two test
weight. The table is used by entering it at the average of results (column 1), and the maximum tolerated difference
the two test results (column 1), and the maximum toler- is found in column 2.
ated difference is found in column 2. The tolerances appeared in the Report of the Rules
The tolerances are extracted from Table F1b (foreign Committee, International Seed Testing Association:
seeds) in Miles (1963):
ISTA (1962). Revision of International Rules for Seed
Miles, S. R. (1963). Handbook of Tolerances and Meas- Testing. Proceedings of the International Seed Testing
ures of Precision for Seed Testing. Proceedings of the Association, 27, 291–304.
International Seed Testing Association, 28 (3), 644.
Table 4A. Tolerances for the determination of other seeds by number when tests are made on the same or a different
submitted sample in the same or a different laboratory (two-way test at 5 % significance level)
Average of the two test Tolerance Average of the two test Tolerance Average of the two test Tolerance
results results results
1 2 1 2 1 2
3 5 76–81 25 253–264 45
4 6 82–88 26 265–276 46
5–6 7 89–95 27 277–288 47
7–8 8 96–102 28 289–300 48
9–10 9 103–110 29 301–313 49
11–13 10 111–117 30 314–326 50
14–15 11 118–125 31 327–339 51
16–18 12 126–133 32 340–353 52

19–22 13 134–142 33 354–366 53
23–25 14 143–151 34 367–380 54
26–29 15 152–160 35 381–394 55
30–33 16 161–169 36 395–409 56
34–37 17 170–178 37 410–424 57
38–42 18 179–188 38 425–439 58
43–47 19 189–198 39 440–454 59
48–52 20 199–209 40 455–469 60
53–57 21 210–219 41 470–485 61
58–63 22 220–230 42 486–501 62
64–69 23 231–241 43 502–518 63
70–75 24 242–252 44 519–534 64

Table 4B. Tolerances for the determination of other seeds by number when tests are made on different submitted sam-
ples, the second being made in the same or in a different laboratory (one-way test at 5 % significance level)
Average of the two test Tolerance Average of the two test Tolerance Average of the two test Tolerance
results results results
1 2 1 2 1 2
3–4 5 80–87 22 263–276 39
5–6 6 88–95 23 277–290 40
7–8 7 96–104 24 291–305 41
9–11 8 105–113 25 306–320 42
12–14 9 114–122 26 321–336 43
15–17 10 123–131 27 337–351 44
18–21 11 132–141 28 352–367 45
22–25 12 142–152 29 368–386 46
26–30 13 153–162 30 387–403 47
31–34 14 163–173 31 404–420 48
35–40 15 174–186 32 421–438 49
41–45 16 187–198 33 439–456 50
46–52 17 199–210 34 457–474 51
53–58 18 211–223 35 475–493 52
59–65 19 224–235 36 494–513 53
66–72 20 236–249 37 514–532 54
73–79 21 250–262 38 533–552 55

International Rules for Seed Testing Chapter 5: The germination test
Chapter 5: The germination test
5.1 Object 5.2.4 Germination percentage
The object of the germination test is to determine the ger- The germination percentage reported on the ISTA Cer-
mination potential of a seed lot, which can then in turn tificate indicates the proportion by number of seeds which
be used to compare the quality of different lots and also have produced seedlings classified as normal under the
estimate the field planting value. conditions and within the period specified in Table 5A,
Testing under field conditions is normally unsatisfac- i.e. the percentage of normal seedlings.
tory, as the results cannot be repeated with reliability. Lab-
oratory methods have, therefore, been evolved in which
the external conditions are controlled to give the most reg- 5.2.5 Essential seedling structures
ular, rapid and complete germination for the majority of
samples of a particular species. The conditions have been A seedling, depending on the species being tested, con-
standardised to enable the test results to be reproduced sists of a specific combination of some of the following
within limits as near as possible to those determined by structures which are essential for its further development
random sample variation. into a satisfactory plant:
Further information on germination can be found in – root system (primary root; in certain cases seminal
the current ISTA Handbook on Seedling Evaluation. roots);
– shoot axis (hypocotyl; epicotyl; in certain Poaceae
mesocotyl; terminal bud);
5.2 Definitions – cotyledons (one to several);
– coleoptile (in all Poaceae).
5.2.1 Germination
For further details see 5.2.11.
Germination of a seed in an ISTA test is the emergence
and development of the seedling to a stage where the as-
pect of its essential structures indicates whether or not it 5.2.6 The 50 % rule
is able to develop further into a satisfactory plant under
favourable conditions in the field. The 50 % rule is used in the evaluation of cotyledons and
primary leaves.
5.2.2 Double test Cotyledon tissue:

– Seedlings are considered normal as long as half or
A double test is where two tests are prescribed for certain more of the total cotyledon tissue is functional.
tree and shrub seed species, and the results of both tests – Seedlings are abnormal when more than half of the
are reported. cotyledon tissue is missing, necrotic, decayed or
discoloured.
5.2.3 Parallel tests Primary leaves:
– Primary leaves need to be evaluated in species such
Parallel tests are where more than one test method from as Phaseolus.
those prescribed is applied to a sample at the same time – Seedlings are considered normal as long as half or
and the best result reported. more of the primary leaf tissue is functional.
– Seedlings are abnormal when more than half of the
primary leaf tissue is missing, necrotic, decayed or
discoloured.

Chapter 5: The germination test International Rules for Seed Testing
The 50 % rule does not apply if the two points of attach- – a well-developed epicotyl in seedlings showing
ment of the cotyledons to the seedling axis or the termi- hypogeal germination,
nal bud itself is necrotic or decayed; such seedlings are – both an elongated hypocotyl and epicotyl in some
abnormal irrespective of the condition of the cotyledons genera with epigeal germination,
or primary leaves. It does not apply also if one point of – an elongated mesocotyl in certain genera of the
attachment of one cotyledon is necrotic or decayed and if Poaceae;
the other cotyledon is not intact; such seedlings are also
considered as abnormal. c) a specific number of cotyledons, i.e.:
Further details of how the 50 % rule is applied can be – one cotyledon in monocotyledons or exceptionally
found in the ISTA Handbook on Seedling Evaluation. in dicotyledons (it may be green and leaf-like or
modified and remaining wholly or partly within the
seed),
5.2.7 Normal seedlings – two cotyledons in dicotyledons (in species with
epigeal germination: green and leaf-like, the size
Normal seedlings show the potential for continued de- and form varying with the species being tested; in
velopment into satisfactory plants when grown in good seedlings with hypogeal germination: hemispheri-
quality soil and under favourable conditions of moisture, cal and fleshy and remaining within the seed coat),
temperature and light. To be classified as normal a seed- – a varying number of cotyledons (2–18) in coni-
ling must conform with one of the following categories: fers (usually green, long and narrow);
intact seedlings: seedlings with all their essential struc- d) green, expanding primary leaves:
tures well developed, complete, in proportion and – one primary leaf, sometimes preceded by a few
healthy; scale leaves in seedlings with alternating leaves, or
– two primary leaves in seedlings with opposite
seedlings with slight defects: seedlings showing certain leaves;
slight defects of their essential structures, provided
they show an otherwise satisfactory and balanced de- e) a terminal bud or shoot apex, the development of
velopment comparable to that of intact seedlings of the which varies with the species being tested;
same test;
f) a well-developed, straight coleoptile in Poaceae, con-
seedlings with secondary infection: seedlings which taining a green leaf extending to the tip and eventually
it is evident would have conformed with one of the emerging through it;
above, but which have been affected by fungi or bacte-
ria from sources other than the parent seed. g) in seedlings of tree species with epigeal germination:
when the primary root and hypocotyl together exceed
four times the length of the seed, provided all struc-
5.2.7.1 Intact seedlings tures which have developed are intact.
An intact seedling, depending on the species being tested,

shows a specific combination of some of the following 5.2.7.2 Slight defects
essential structures:
The following defects are considered slight and therefore

a) a well-developed root system, consisting of: seedlings are classified as normal:
– a long and slender primary root, usually covered – primary root with limited damage (e.g. not affecting
with numerous root hairs and ending in a fine tip, the conductive tissue) or slight growth retardation;
– secondary roots when produced within the pre- – primary root defective but with sufficiently well-de-
scribed test period, veloped secondary roots (in specific genera of Fabace-
– several seminal roots instead of one primary root in ae, especially large-seeded genera such as Phaseolus,
certain genera, including Avena, Hordeum, Secale, Pisum and Vicia, and Poaceae, e.g. Zea, and in all
Triticum, ×Triticosecale, Cyclamen; genera of Cucurbitaceae, e.g. Cucumis, Cucurbita and
Citrullus, and Malvaceae, e.g. Gossypium. For a com-
b) a well-developed shoot axis, consisting of: plete list see the current ISTA Handbook on Seedling
– a straight and usually slender and elongated hy- Evaluation);
pocotyl in seedlings showing epigeal germination,

– at least three secondary roots, each of which is greater under favourable conditions of moisture, temperature and
than or equal to half the length of the hypocotyl, in light. The following seedlings are classified as abnormal:
Glycine max, when the primary root is defective;
– only one strong seminal root in Avena, Hordeum, damaged: seedlings with any of the essential structures
Secale, Triticum and ×Triticosecale, and two in missing or so badly and irreparably damaged that bal-
Cyclamen; anced development cannot be expected;
– hypocotyl, epicotyl or mesocotyl with limited damage
(e.g. not affecting the conductive tissue); deformed or unbalanced: seedlings with weak develop-
– cotyledons with limited damage (if half or more of ment or physiological disturbances or in which essen-
the total tissue area is left functioning normally [i.e. tial structures are deformed or out of proportion;
the 50 % rule; see 5.2.6] and if there is no evidence
of damage or decay to the shoot apex or surrounding decayed: seedlings with any of their essential structures
tissues); so diseased or decayed as a result of primary infection
– only one normal cotyledon in dicotyledons (if there is (see 5.2.11) that normal development is prevented.
no evidence of damage or decay to the shoot apex or
surrounding tissues);
– three or more cotyledons instead of two (provided that 5.2.8.1 Seedling abnormalities
they comply with the 50 % rule; see 5.2.6);
– fused cotyledons (provided that they comply with the One or more of the following defects in the seedling ren-
50 % rule; see 5.2.6); ders it abnormal.
– primary leaves with limited damage (if half or more
of the total tissue area is left functioning normally [the 0 Overall abnormalities
50 % rule; see 5.2.6]); 00 The seedling:
– only one normal primary leaf, e.g. in Phaseolus (if 00/01 is deformed
there is no evidence of damage or decay to the terminal 00/02 is fractured
bud); 00/03 releases the cotyledons before the primary root
– primary leaves of Phaseolus which are properly from the seed coat
formed but reduced in size, as long as they are larger 00/04 consists of fused twin seedlings
than a quarter of the normal size; 00/05 bears an endosperm collar
– three or more primary leaves instead of two, e.g. in 00/06 is yellow or white
Phaseolus (provided that they comply with the 50 % 00/07 is spindly
rule; see 5.2.6); 00/08 is glassy
– coleoptile with limited damage; 00/09 is decayed as a result of primary infection
– coleoptile with a split from the tip extending down- 00/10 shows phytotoxic symptoms
ward not more than one third of the length (for Zea 00/11 is unbalanced
mays; seedling with coleoptile defects described in 00/12 in Poaceae, detached endosperm
Figure 5.1 may be classed as normal if the first leaf is
intact or only slightly damaged, as defined in Figure 1 Abnormalities of the root system
5.2); 11 The primary root:
– coleoptile loosely twisted or forming a loop (because it 11/01 is stunted
is trapped under the lemma and palea or fruit coat); 11/02 is stubby
– coleoptile with a green leaf not extending to the tip but 11/03 is retarded Chapter 5: The germination test
reaching at least half-way up the coleoptile. 11/04 is missing
11/05 is deeply cracked or broken
11/06 is split from the tip or split right through
5.2.7.3 Secondary infection 11/07 is trapped in the seed coat
11/08 shows negative geotropism
Seedlings which are seriously decayed by fungi or bacte- 11/09 is constricted
ria are classified as normal, if it is evident that the parent 11/10 is spindly
seed is not the source of infection, and if it can be deter- 11/11 is glassy
mined that all the essential structures were present. 11/12 is decayed as a result of primary infection
Note: secondary roots showing one or more of the above

5.2.8 Abnormal seedlings defects are abnormal and cannot replace an abnormal
primary root in cases where the presence of several
Abnormal seedlings do not show the potential to develop secondary roots (e.g. Cucumis) determines the value
into a normal plant when grown in good quality soil and of a seedling.

Split more than one third Coleoptile bent over Tip missing Split at the base Split at the back
Figure 5.1. Evaluation of maize seedlings with coleoptile defects. Seedlings are normal if the primary leaf is intact or only
slightly damaged, as defined in Figure 5.2. Seedlings are abnormal if primary leaf is damaged, as defined in Figure 5.2.
Intact leaf Slightly damaged Damaged Damaged Damaged Damaged Damaged

Seedlings with Fig. 5.1a defects Seedlings with Fig. 5.1a defects classed as abnormal
Seedlings with Fig.
classed 5.1 defects
as normal Seedlings with Fig. 5.1 defects classed as abnormal
classed as normal
Figure 5.2. Evaluation of maize seedlings with coleoptile defects. Definition of intact, slightly damaged and damaged
primary leaf.
12 The seminal roots: 2 Abnormalities of the shoot system

12/01 are stunted 21 The hypocotyl, epicotyl or mesocotyl:
12/02 are stubby 21/01 is short and thick (except Cyclamen)

12/03 are retarded 21/02 does not form a tuber (only in Cyclamen)
12/04 are missing 21/03 is deeply cracked or broken
12/05 show negative geotropism 21/04 is split right through
12/06 are glassy 21/05 is missing
12/07 are decayed as a result of primary infection 21/06 is bent over or forms a loop
21/07 forms a spiral
Note: at least one strong seminal root (e.g. Triticum), or 21/08 is tightly twisted
two strong seminal roots (i.e. Cyclamen) are required 21/09 is constricted
for a normal seedling. 21/10 is spindly
21/11 is glassy
21/12 is decayed as a result of primary infection
21/13 shows negative phototropism

22 The terminal bud and surrounding tissues: 4 Abnormalities of the coleoptile and primary leaf:
22/01 are deformed 41 The coleoptile:
22/02 are damaged 41/01 is stubby or otherwise deformed
22/03 are missing 41/02 is broken
22/04 are necrotic 41/03 is missing
22/05 are decayed as a result of primary infection 41/04 is defective or has no tip
41/05 is strongly bent over or forms a loop
Note: irrespective of the presence of auxiliary buds 41/06 forms a spiral
(e.g. Phaseolus) or auxiliary shoots (e.g. Pisum) aris- 41/07 is tightly twisted
ing from the axils of the cotyledons or of the primary 41/08 is split for more than one-third of the length
leaves, the seedling is considered abnormal if the main from the tip
shoot fails to develop normally. 41/09 is spindly
41/10 is decayed as a result of primary infection
3 Abnormalities of the cotyledons and primary leaves 41/11 is split other than from the tip
31 The cotyledons (apply the 50 % rule; see 5.2.6): 41/12 is trapped under the lemma or the testa.
31/01 are swollen or curled
31/02 are deformed Note: a seedling with its coleoptile trapped under the
31/03 are broken or otherwise damaged lemma or seed coat is considered normal, if develop-
31/04 are separate or missing ment is otherwise normal. If the growth of such a seed-
31/05 are discoloured or necrotic ling is stunted, it must be evaluated as abnormal.
31/06 are glassy
31/07 are decayed as a result of primary infection Note: for Zea mays only: the seedling is abnormal if the
31/08 are fused on both sides coleoptile has any of the following defects together
with damage to the primary leaf as defined in Figure
Note: damage or decay of the cotyledons at the two points 5.1:
of attachment of the cotyledons to the seedling axis or 1 if the primary leaf has emerged at time of evaluation:
near the terminal bud renders a seedling abnormal, ir- a. coleoptile split for more than one-third of the
respective of the 50 % rule. The 50 % rule also does length from the tip
not apply if one point of attachment of one cotyledon b. coleoptile strongly bent over
is necrotic or decayed and the other cotyledon is not c. coleoptile tip damaged or missing
intact; such seedlings are also considered as abnormal. d. coleoptile split at any location below the tip
2 if the primary leaf has not emerged at time of
32 In Allium spp., the cotyledon: evaluation:
32/01 is short and thick a. tip of coleoptile damaged or missing
32/02 is bent over or forms a loop b. coleoptile split for more than one-third of the
32/03 forms a spiral length from the tip
32/04 does not show a definite ‘knee’ c. leaf protruding below the tip of the coleoptile
32/05 is constricted
32/06 is spindly 42 The primary leaf:
42/01 extends less than halfway up the coleoptile
33 The primary leaves (apply the 50 % rule; see 5.2.6): 42/02 is missing Chapter 5: The germination test
33/01 are deformed 42/03 is shredded or otherwise deformed
33/02 are damaged 42/04 protrudes from the lower part of the coleoptile
33/03 are missing 42/05 is yellow or white (no chlorophyll)
33/04 are discoloured 42/06 is decayed as a result of primary infection
33/05 are necrotic
33/06 are of normal shape, but less than one-quarter
normal size (only in Phaseolus)
33/07 are decayed as a result of primary infection

5.2.9 Multigerm seed units 5.2.10.1 Hard seeds
Several types of seed units can produce more than one Hardseededness is a form of dormancy. It is common in
seedling: many species of the Fabaceae but may also occur in other
– units containing more than one true seed (e.g. multiple families. These seeds are not able to imbibe water under
seed units in Dactylis, Festuca, ×Festulolium and Lo- the conditions set out in Table 5A and remain hard.
lium; unseparated schizocarps of Apiaceae; clusters of
Beta vulgaris, and fruits of Tectona grandis);
– true seeds containing more than one embryo. This may 5.2.10.2 Fresh seeds
occur normally in certain species (polyembryony) or
exceptionally in other species (twins). In this case, fre- Fresh seeds are able to imbibe water when provided with
quently one of the seedlings is weak or spindly, but the conditions set out in Table 5A, but the germination
occasionally both are of nearly normal size; process is blocked.
– fused embryos. Occasionally two seedlings which are
fused together are produced from one seed.
5.2.10.3 Dead seeds
When a unit produces more than one seedling, these are
evaluated separately. One normal seedling is considered Dead seeds absorb water, are usually soft or discoloured
sufficient to classify the unit as normal. If a unit produces or frequently mouldy, and show no sign of seedling
more than one normal seedling, only one is counted for development.
determining the germination percentage.
5.2.10.4 Other categories

5.2.10 Ungerminated seeds
Ungerminated seeds may be further subdivided into:
Seeds which have not germinated by the end of the test
period, when tested under the conditions given in Table empty seeds: seeds which are completely empty or con-
5A, are classified as follows: tain only some residual tissue;
hard seeds: seeds which remain hard at the end of the embryoless seeds: seeds which contain fresh endosperm
test period, because they have not absorbed water; or gametophytic tissue in which there is apparently no
embryonic cavity nor embryo;
fresh seeds: seeds, other than hard seeds, which because
of dormancy have failed to germinate under the condi- insect-damaged seeds: seeds which contain insect lar-
tions of the germination test, but which remain clean vae, frass, or show other evidence of insect attack af-
and firm and have the potential to develop into a nor- fecting the ability of the seed to germinate.
mal seedling;
These categories may appear in all species of seeds, but
dead seeds: seeds which at the end of the test period are are found more commonly in tree species.
neither hard nor fresh nor have produced any part of a
seedling;
5.2.11 Additional definitions

other categories: in some circumstances empty and un-
germinated seeds may be further categorised accord- coleoptile the sheath enclosing and protecting the apex
ing to classes described in 5.2.10.4. of the axis of the embryo and young seedling in certain
monocotyledons (e.g. Poaceae)
cotyledon the first leaf or pair of leaves of an embryo
and seedling (see primary leaf)
decay break-down of organic tissue, usually associated
with the presence of micro-organisms

discoloration alteration or loss of colour monocotyledons a group of plants so classified be-

dicotyledons a group of plants so classified because the embryo usually has one cotyledon (see
cause the embryo usually has two cotyledons (see dicotyledons)
monocotyledons) phototropism growth and response to a light stimulus
diseased showing the effect of the presence and activity positive phototropism growth towards light
of micro-organisms or of chemical deficiency negative phototropism growth away from light
embryo rudimentary plant contained in a seed, usually phytotoxic poisonous to plants
consisting of a more or less differentiated axis and at- primary infection see ‘infection’
tached cotyledon(s) primary leaf the first leaf or pair of leaves found after
endosperm nutritive tissue originating from fertilisa- the cotyledons (see cotyledon)
tion and retained at maturity in some seeds as a storage primary root main root of the seedling, developing
tissue for food reserves from the radicle of the embryo (see radicle)
epicotyl the part of the seedling axis immediately above radicle the rudimentary root of the embryo, developing
the cotyledons and below the primary leaf or pair of into the primary root after emergence through the seed
leaves coat during germination (see primary root)
epigeal germination a type of germination in which retarded root a root usually with an intact tip but much
cotyledons and shoot are carried above soil level by too short and weak to be in balance with the other
the elongating hypocotyl (see hypogeal germination) structures of the seedling
gametophytic tissue the nutritive tissue occurring root hair a fine tubular outgrowth of a surface cell of
within conifer seeds (it serves a function similar to the root
endosperm) scutellum a shield-shaped structure that is part of the
geotropism plant growth response to gravity cotyledon in some Poaceae and through which nutri-
positive geotropism downward growth (e.g. normal ents are absorbed from the endosperm into the embryo
primary root) secondary infection see infection
negative geotropism upward growth (e.g. normal secondary root used in seed testing to mean any root
shoot) other than the primary root
hypocotyl the part of the seedling axis immediately seedling a young plant developing from the embryo in
above the primary root and below the cotyledons a seed
hypogeal germination a type of germination in which seminal roots the primary root and a number of second-
the cotyledon(s) or comparable structure (e.g. scutel- ary roots arising from the embryo axis and forming the
lum) remain in the soil and within the seed. The shoot seedling root system in cereals
is carried above soil level by the elongating epicotyl in shoot apex terminal portion of the shoot, that contains
dicotyledons, or by the mesocotyl in some monocoty- the main growing point
ledons (see epigeal germination) stubby root the kind of root characteristic for seed-
infection entrance and spread of disease organisms in lings with phytotoxic symptoms; usually short and
living material (e.g. seedling structures), not necessar- club-shaped, though often with an intact root tip (see
ily but often causing disease symptoms and decay stunted root)
primary infection disease organism present and ac- stunted root root with a missing or defective root tip,
tive in the seed itself irrespective of the length of the root (see stubby root)
secondary infection disease organism spreading terminal bud the shoot apex enveloped by several more
from other seeds or seedlings or less differentiated leaves Chapter 5: The germination test
looped structure seedling structure (e.g. hypocotyl, co- twisted structure seedling structure (e.g. hypoco-
leoptile) which completes a loop or circle instead of tyl, coleoptile) which twists around its main axis of
being more or less straight elongation
mesocotyl in some highly specialised monocotyledons loosely twisted turns completed over a long section
(e.g. certain Poaceae) the part of the seedling axis be- of the structure
tween the point of attachment of the scutellum and the tightly twisted turns completed over a short section
coleoptile of the structure

5.3 General principles Water retention characteristics: when the appropriate

amount of water is added, the particles of the grow-
Germination tests must be made with pure seeds, except ing medium should have the capacity to hold sufficient
where testing of seed by weighed replicates is allowed. water to provide continuous movement of water to the
The pure seed definition for the species must be ap- seeds and seedlings, but also provide sufficient pore
plied. The pure seed can be taken from either the pure seed space for aeration required for optimal germination
fraction of a purity test carried out as prescribed in Chap- and root growth. The water content of the growing
ter 3, or from a representative fraction of the submitted medium should be adjusted to correspond to the needs
sample. When the seed lot has been coated, the pure pellet of the species being tested, based on the maximum wa-
definition must be used, except in the case of tapes or mats ter-holding capacity of the medium. The water reten-
where the seeds are tested without removing the seed. tion is then expressed as a percentage of the maximum
Prescribed procedures for promoting germination are retention.
given in 5.6.3. Parallel testing is permitted. The rules for
reporting parallel and double testing are defined in 5.9. If pH: the growing medium must have a pH value within
additional tests are undertaken after any procedure other the range 6.0–7.5 when checked in the substrate.
than those given in 5.6.3, the test is not covered by the Measurements of pH can be replaced by biological
Rules, and the result and procedure must be reported un- tests (see 5.4.5).
der ‘Other determinations’ on the ISTA Certificate (see
1.5.2.22). Conductivity: the salinity must be as low as possible
The seeds, arranged in replicates, are tested under fa- and no more than 40 millisiemens per metre. Measure-
vourable moisture conditions and in accordance with the ments of conductivity can be replaced by biological
methods prescribed in Table 5A. After the period indicat- tests (see 5.4.5).
ed in Table 5A, the replicates are examined and counts
made of the seedlings and seeds in the various categories Cleanness and freedom from toxicity: the growing me-
required for reporting (5.9). dium must be free from seeds, fungi, bacteria or toxic
substances, which may interfere with the germination
of seeds or the growth or evaluation of seedlings.
5.4 Growing media
Re-use of substrates: it is strongly recommended that
5.4.1 Definition the growing medium is only used once.
Growing media used for germination tests are products Alternative measurements: it may be difficult to check
which provide sufficient pore space for air and water, for all the specifications or to get growing media from
the growth of the root system and for contact with solu- suppliers with the requested specifications. It is per-
tions (water) needed for plant growth. missible to replace the measure of conductivity with
With paper as the base medium (see 5.6.2.1.1), any biological tests such as phytotoxicity. If not, all the
combination of growing media prescribed in Table 5A for characteristics described in 5.4.2 must be verified.
that species is allowed, provided that each growing me-
dium is verified and meets the specifications prescribed
in 5.4.2. 5.4.3 Growing media characteristics
5.4.3.1 Paper growing media

5.4.2 Specifications
The paper must be wood, cotton or other purified vegeta-
The following general specifications apply for all growing ble cellulose. The paper may take the form of filter papers,
media and must be verified. blotters or towels. The paper should be such that:
– the roots of the seedlings will grow on and not into it;
Composition: the growing medium can be paper, pure – it possesses sufficient strength to enable it to resist
sand or mixtures of organic compounds with added tearing when handled during the test.
mineral particles.

5.4.3.2 Sand growing media 5.4.5 Quality control
At least 90 % of the particles must pass through a sieve New deliveries of growing media must meet the require-
with holes or meshes of 2.0 mm width. If the particle size ments for the principal physical characteristics and be
characteristics given by the supplier are in accordance free of negative effects due to toxic substances or noxious
with these specifications then the laboratory does not need micro-organisms.
to perform a quality check of the sand particle size. In The characteristics composition, water retention,
the absence of a supplier’s specification sheet, the labora- pH, cleanness and innocuity (freedom from phytotoxic
tory must check the particle size for each batch of sand effects and negative effects due to micro-organisms) must
received. be checked.
Alternative measurements: it may be difficult to check

5.4.3.3 Organic growing media all the specifications or to get growing media from sup-
pliers with the requested specifications. It is permissible
Organic growing media are defined as containing the fol- to replace the measurements of pH and conductivity with
lowing elements in known proportions and fitting the re- biological tests, such as a test for phytotoxicity.
quirements of 5.4.2: Examples of media quality control tests are given in
the ISTA Handbook on Seedling Evaluation. Quality con-
Organic compounds: fibres such as peat, coconut fibres trol tests can be performed by the seed testing laboratory
or wood fibres, with a recommended size less than or subcontracted to laboratories specialising in soil analy-
5 mm; ses or microbiology tests.
Mineral particles: for example sand, perlite, dolomite

or vermiculite. The proportion should be between 15 5.5 Material and apparatus
and 30 % in volume. It is recommended that 90 % of
the particles should pass through a sieve with holes or 5.5.1 Containers
meshes of 3 mm width.
All kinds of plastic, glass, metal or pottery containers can
Any other mixture of organic compounds and mineral par- be used, provided that they have no toxic effects, and are
ticles, fitting the specifications included in 5.4.2, can be clean and free from micro-organisms.
used. The media composition must be clearly described.
5.5.2 Counting equipment

5.4.4 Water
Planting using counting boards or vacuum counters is
Demineralised water, deionised water, tap water and permissible, as long as using these tools does not influ-
spring water are commonly used and permitted. ence the germination result or cause replicate results to
be biased.
Examples of how to use the counting equipment are
5.4.4.1 General specifications given in the ISTA Handbook on Seedling Evaluation.
Cleanness: the water used to moisten the substrate
should be reasonably free from organic or inorganic 5.5.2.1 Counting boards
impurities.
Counting boards are often used for large seeds such as
pH: the pH value must be within the range 6.0–7.5 when Zea, Phaseolus and Pisum.
checked in the substrate, unless there is evidence that
the pH outside this range does not have a negative in-
fluence on the germination test results.

5.5.2.2 Vacuum counters using humidifiers in germination rooms. Tests can also be
enclosed in moisture-proof containers.
Vacuum counters can in principle be used for all species,
but are mostly used for species with regularly shaped and
relatively smooth seeds such as cereals or species of Bras- 5.6 Procedure
sica or Trifolium.
5.5.3 Germination apparatus Four hundred seeds are taken at random from the well-
mixed pure seed (5.3) and spaced uniformly and adequate-
5.5.3.1 The bell jar or Jacobsen apparatus ly apart on the moist substrate. Care must be taken to en-
(Copenhagen tank) sure that there is no selection of seeds thus causing biased
results. Replicates of 100 seeds are normally used, spaced
This apparatus usually consists of a germination plate sufficiently far apart on the seed bed to minimise the ef-
upon which filter paper substrates with seeds are placed. fect of adjacent seeds on seedling development. To ensure
The substrate is kept continuously moist by means of a adequate spacing, split replicates of 50 or even 25 seeds
wick, which extends down through slits or holes in the may be necessary, particularly where there are seed-borne
germination plate into the underlying waterbath. pathogens or saprophytes present. When seeds grown on
To prevent drying out, the substrate is covered with paper substrates are heavily infected, it may be necessary
a bell jar provided with a hole which allows for ventila- at an intermediate count to transfer remaining seeds and
tion without undue evaporation. The temperature is con- seedlings to fresh media.
ditioned either indirectly by heating/cooling the water in Multigerm seed units, except for Arachis, are not bro-
the waterbath, or directly by conditioning the germination ken up for the germination test but are tested as though
plate, and is usually automatically regulated. The appara- they were single seeds.
tus may be used for all prescribed constant or alternating For Arachis, although a pod is a pure seed unit, seed
temperatures. must be removed from the pod before use in a germina-
tion test.
The ISTA germination test is based on 400 seeds. In
5.5.3.2 The germination incubator and the certain circumstances (see 2.5.4.5) it may be necessary to
room germinator test fewer than 400 seeds. In such cases, at least 100 seeds
must be tested in replicates of 25 or 50.
The incubator is used for germinating seeds in darkness At the request of the applicant, a germination test can
or light, or providing seeds with pretreatments to break be carried out on 200 seeds, for issuance on a Blue In-
dormancy, such as prechilling. The room germinator is a ternational Seed Sample Certificate only. In this case, the
modification of the incubator, but is large enough to per- number of seeds tested is less than 400 and must be re-
mit workers to enter and place the tests within it. Germi- ported under ‘Other Determinations’ (see 5.9).
nation incubators and room germinators are well insulated When due to counting errors more than 5 seeds are lost
and are equipped with both heating and cooling systems or found during a germination test (i.e. ±1.25 % for a total
to ensure the maintenance of required temperatures. The of 400 seeds), then the test must be repeated.
temperature must be evenly distributed to ensure that all If there are up to 5 seeds lost or found as extra in the
samples placed in the incubator/room have a tempera- test, then each replicate must be adjusted to 100 by cal-
ture within the prescribed temperature limits for the test culation. For example, if one replicate had 80 normal
(±2 °C) or pretreatment. If the incubator/room does not seedlings, 10 abnormal seedlings and 9 dead seeds, with
have a system capable of providing alternating tempera- one seed missing, then the result must be adjusted to 100
tures, samples can be transferred from one incubator/room with the following proportional calculation: 80 × 100 : 99
to another running at a different temperature to achieve normal seedlings, 10 × 100 : 99 abnormal seedlings and
the desired alternative temperature cycle. Tests must be 9 × 100 : 99 dead seeds. Rounding follows the principles
supplied with sufficient water for germination and must described in 5.8.2.
not be allowed to dry out. This can be achieved through
maintaining a high humidity by using ‘wet’ incubators or

Note: if the submitted sample is smaller than prescribed, he substrates are kept in closed boxes, wrapped in
T
the sampler must be notified accordingly and analy- plastic bags or placed directly on trays in a cabinet ger-
sis withheld until sufficient seed is received in a sin- minator, provided the relative humidity in the germi-
gle submitted sample, except that in the case of very nator can be maintained very near saturation.
expensive seed, the analysis may be completed to the
extent possible, and the following statement inserted Pleated paper (PP): the seeds are placed in a pleated,
on the certificate: accordion-like paper strip with 50 pleats, usually two
‘The sample submitted weighed only ... g and is not to a pleat. The pleated strips are kept in boxes or di-
in accordance with the International Rules for Seed rectly in a ‘wet’ cabinet, with a flat strip often wrapped
Testing.’ around the pleated paper to ensure uniform moisture
Or, in the case of pelleted seeds: conditions. This method may be used as an a alterna-
‘The sample submitted contained only ... pellets tive where TP or BP are prescribed.
(seeds) and is not in accordance with the International
Rules for Seed Testing.’
5.6.2.1.2 Methods using sand or organic growing
media
5.6.2 Test conditions
Sand and organic growing media are used as follows:
Permitted substrates, temperatures, duration of tests and
additional directions, including recommended procedures Top of sand (TS), top of organic growing medium
for breaking dormancy, are indicated in Table 5A. Sub- (TO): the seeds are pressed into the surface of the
strates, temperatures and duration of test indicated are pre- sand or the organic growing medium.
scriptive and no others may be used.
Sand (S), organic growing medium (O): the seeds are
planted on a level layer of moist sand or the organic
5.6.2.1 Growing media growing medium and covered with 10–20 mm of un-
compressed substrate, depending on the size of the
5.6.2.1.1 Methods using paper seed. To ensure good aeration it is recommended that
the bottom layer be loosened by raking before sowing.
Top of paper (TP): the seeds are germinated on top of
one or more layers of paper which are placed: Sand or organic growing media may be used instead of
– on the Jacobsen apparatus (5.5.3.1); paper, even if not prescribed in Table 5A:
– into transparent boxes or Petri dishes. The appro- – when the evaluation of a diseased sample proves im-
priate quantity of water is added at the beginning practicable because of the spread of infection between
of the test and evaporation may be minimised by a seeds and seedlings on paper substrate;
tightly fitting lid or by enclosing the dishes in plas- – for investigative purposes and to confirm evaluation
tic bags; of seedlings in cases of doubt;
– directly on trays in germination incubators. The – when seedlings show phytotoxic symptoms.
relative humidity in the incubators must then be
maintained at a level that prevents tests drying out.
Moistened porous paper or absorbent cotton can be 5.6.2.1.3 Methods using a combination of paper and Chapter 5: The germination test
used as a base for the substrates. sand
Between paper (BP): the seeds are germinated between Top of paper covered with sand (TPS): the seeds are
two layers of paper. This may be achieved: germinated on top of a moistened sheet of crêpe cel-
– by loosely covering the seeds with an additional lulose paper which is covered with a 2 cm layer of dry
layer of filter paper; sand. Crêpe cellulose paper is a multi-layered paper
– by placing the seeds into folded envelopes which pad, e.g. Versa-Pak®.
may be placed in a flat or upright position;
– by placing the seeds in rolled paper towels (the
rolls must be placed in an upright position).

5.6.2.1.4 Soil is generally recommended, as better developed seedlings,

which are more easily evaluated are produced. Seedlings
Soil is generally not recommended as a primary grow- grown in complete darkness are etiolated and white and
ing medium. However, it may be used as an alternative to therefore more sensitive to attack by micro-organisms.
organic growing media when seedlings show phytotoxic Besides, certain defects, such as chlorophyll deficiency,
symptoms or if evaluation of seedlings is in doubt on pa- cannot be detected.
per or sand. If soil is used it must meet the specifications In certain cases (e.g. some tropical and subtropical
given in 5.4.2. grasses), light may promote germination of dormant sam-
ples (5.6.3.1). In such cases, the light should be between
750 and 1250 lux from cool white lamps. There are also
5.6.2.2 Moisture and aeration a few species (e.g. Phacelia tanacetifolia) which must be
germinated in darkness, as light may be inhibitory. Spe-
Precautions must be taken to ensure that the medium can- cific recommendations for light or darkness are given in
not dry out and contains sufficient water for the whole test the last column of Table 5A.
period. Subsequent watering should be avoided wherever
possible, as it is likely to increase variability between rep-
licates and between tests. However, it may be necessary to 5.6.2.5 Choice of method
add water at intermediate counts.
Special measures for aeration are not necessary for TP When alternative methods are indicated in Table 5A, one
and PP tests enclosed in boxes or Petri dishes. For BP, of them (any combination of substrate and temperature)
however, care must be taken that envelopes and rolled must be used. The choice of method will depend largely
paper towels are loose enough to allow for sufficient air on the facilities and experience of the testing laboratory
around the seeds. For the same reason, sand and organic and to some extent on the provenance and condition of
growing media must not be compressed. the sample.
5.6.2.3 Temperature 5.6.3 Procedures for promoting

germination of dormant seed
The temperatures prescribed in Table 5A for the germina-
tion of a species are those to which the seed is exposed For various reasons (e.g. physiological dormancy, hard-
on or inside the substrate. They should be as uniform as seededness, inhibitory substances) a considerable number
possible throughout the germination apparatus, incubator of hard or fresh seeds may remain at the end of the ger-
or room germinator. For any test, whether in darkness or mination test. If dormancy is suspected, more complete
under artificial light or in indirect daylight, variation from germination may be obtained by retesting after one or a
the prescribed temperature must not be more than ±2 °C. combination of dormancy-breaking procedures. For some
Where alternating temperatures are indicated, the species, recommended procedures are indicated in column
lower temperature should be maintained for 16 h and the 6 of Table 5A, but these and all other procedures listed in
higher for 8 h. A gradual changeover lasting no more than 5.6.3.1, 5.6.3.2 and 5.6.3.3 can be used for any species
3 h may be satisfactory, but a sharp changeover lasting without restriction. The period of treatment is not included
one hour or less may be necessary for breaking dormancy. in the germination test period. Precise details and duration
Where a temperature range is given, no tolerances may of the dormancy-breaking procedure must be reported on
be applied to the upper or lower temperatures. For exam- the ISTA Certificate.
ple, when a prechilling temperature of 5 to 10 °C is pre- For some tree and shrub seeds, where it is known from
scribed, this means that the allowed temperature range is experience that a proportion of the seeds will not germi-
5 to 10 °C, and not 5 ±2 °C to 10 ±2 °C. nate because of dormancy, a second test incorporating a
special dormancy-breaking procedure is prescribed which
preferably should run concurrently with the normal test
5.6.2.4 Light (double test).
Disinfection of the seed prior to the test is permitted
Seeds of most of the species in Table 5A will germinate and described in 5.6.3.4.
either in light or in darkness. However, illumination of the
substrate from an artificial source or by indirect daylight

5.6.3.1 Procedures for breaking physiological Sealed polyethylene envelopes: Where a high propor-
dormancy tion of fresh ungerminated seeds is found at the end
of the standard test (e.g. in Trifolium spp.), retesting in
Prechilling: The replicates for germination are placed in a sealed polyethylene envelope, of just sufficient size
contact with the moist substrate and kept at a low tem- to hold the test satisfactorily, will usually induce these
perature for an initial period before they are moved to seeds to germinate.
the temperature indicated in Table 5A column 3. Ag-
ricultural, vegetable, flower, spice, herb and medicinal Gibberellic acid (GA3): The GA3 treatment is recom-
seeds are usually kept at a temperature of 5 to 10 °C mended mainly for Avena sativa, Hordeum vulgare,
for an initial period of up to 7 days. In some cases it Secale cereale, ×Triticosecale, Triticum aestivum
may be necessary to extend the prechilling period or and Valerianella locusta. The germination substrate
to rechill. is moistened with 0.05 % solution of GA3, prepared
Tree and shrub seeds are usually prechilled at a tem- by dissolving 500 mg GA3 in 1 litre of water. When
perature of 1 to 5 °C for a period, ranging with the spe- dormancy is weaker, 0.02 % may be enough; when it
cies, from 2 weeks to 12 months prior to the germina- is stronger, up to 0.1 % may be used routinely. If it
tion test, but care must be taken to avoid freezing. For is necessary to use concentrations higher than 0.1 %,
seeds where a long period of prechilling is required care must be taken to ensure that the development of
and a germination test cannot be completed within two seedlings is not adversely affected. When a concentra-
months, quick viability tests are recommended (e.g. tion higher than 0.08 % is required, dissolving the GA3
tetrazolium test: see Chapter 6; excised embryo test: in a phosphate buffer solution is recommended. The
see Chapter 12). For some tree and shrub species with buffer solution is prepared by dissolving 1.7799 g of
a varying degree of dormancy, duplicate tests with and Na2HPO4� 2H2O and 1.3799 g of NaH2PO4� H2O in 1 L
without prechilling are prescribed (‘double tests’), as of distilled water.
indicated in Table 5A Part 2, which should if possible
be set to germinate at the same time. Potassium nitrate (KNO3): Instead of water, 0.2 %
KNO3 solution, prepared by dissolving 2 g KNO3 in
Preheating: The non-imbibed seeds of the replicates for 1 L of water, is used to saturate the germination sub-
germination are heated at a temperature of 30 to 35 °C strate at the beginning of the test. Water is used for
with free air circulation for a period of up to 7 days moistening thereafter.
before they are placed under the prescribed germina-
tion conditions. In some cases it may be necessary to Acid scarification: The seeds are soaked in concentrated
extend the preheating period. sulphuric acid (H2SO4) until the seed coat becomes
For certain tropical and subtropical species, preheating pitted. Digestion may be rapid, or take more than one
temperatures of 40 to 50 °C may be used (e.g. Arachis hour, but the seeds should be examined every few
hypogaea: 40 °C; Oryza sativa: 50 °C). minutes. After digestion, seeds must be thoroughly
washed in running water before the germination test
Prestorage: For some temperate herbage grass species, is commenced (e.g. Brachiaria spp.). In the case of
the seed submitted for testing is stored at a temperature Oryza sativa, scarification may be performed by soak-
of 15 to 25 °C with free air circulation before they are ing the seed in 1 M nitric acid (HNO3) for 24 h (after
tested. A prestorage period of up to one year can be preheating at 50 ±2 °C).
used. Chapter 5: The germination test
Mechanical scarification: The seed is cut, pierced, filed
Light: The tests should be illuminated during at least 8 h or sandpapered to improve permeability to moisture
in every 24 h cycle and during the high temperature and gasses. Care must be taken to scarify the seed coat
period when the seeds are germinated at alternating at a suitable place in order to avoid damaging the em-
temperatures. The quality and intensity of light may bryo and the resulting seedling. The best places are ei-
be important. The light intensity should be between ther immediately above the tips of the cotyledons or to
750 and 1250 lux from cool white lamps. Illumina- the sides of the cotyledons.
tion is recommended especially for certain tropical
and subtropical grasses (e.g. Chloris gayana, Cynodon
dactylon).

5.6.3.2 Procedures for removing For samples of other species, laboratory-applied fun-
hardseededness gicide treatments are not covered by the ISTA Rules (see
1.5.2.22). Germination test results for other species treated
For many species where hard seeds occur, no attempt is with laboratory-applied fungicide must be reported under
made to germinate them and the percentage found is re- ‘Other determinations’ and followed by: ‘This method is
ported. Where a fuller assessment is required on the re- not covered by the International Rules for Seed Testing’.
quest of the customer, some special procedure for remov- In addition, a test without applying a laboratory fungicide
ing hardseededness is essential. This procedure may be treatment must also be conducted and the results reported
applied prior to the commencement of the germination under ‘Germination’ in the spaces provided.
test, or, if it is suspected that the procedure may adversely When a fungicide pretreatment is used, the name of
affect non-hard seeds, it should be carried out on the hard the chemical, the percentage of active ingredients and the
seeds remaining after the prescribed test period. method of treatment must be reported on the ISTA Certifi-
cate under ‘Other determinations’.
Soaking: Seeds with hard seed coats may germinate
more readily after soaking for up to 24–48 h in water,
or, for Acacia spp., after plunging seeds in about three 5.6.4 Duration of the test
times their volume of near boiling water until it cools.
The germination test is commenced immediately after The duration of the test for individual species is indicated
soaking. in Table 5A. The duration of the treatment required to
break dormancy (5.6.3) before or during the test is not
Mechanical scarification: Careful piercing, chipping, taken as part of the germination test period.
filing or sandpapering of the seed coat may be suffi- If it seems advisable, when for example some seeds
cient (see 5.6.3.1). have just started to germinate, the prescribed test period
may be extended:
Acid scarification: This procedure is effective with some a) by 7 days;
species (e.g. Desmodium spp., Macroptilium spp., Sty- b) by up to half the prescribed period;
losanthes guianensis) (see 5.6.3.1). c) up to 21 days for Lolium spp.;
d) up to 32 days for Festuca spp. (except F. arundinacea
and F. pratensis);
5.6.3.3 Procedures for removing inhibitory e) up to 42 days for Poa spp. (except P. bulbosa);
substances f) up to 54 days for Poa bulbosa.
Prewashing: Naturally occurring substances in the peri- If, on the other hand, the maximum germination of the
carp or seed coat which act as inhibitors of germina- sample has been obtained before the end of the prescribed
tion may be removed by washing the seeds in running test period, a test may be terminated. At the request of the
water at a temperature of 25 ±2 °C before the germi- applicant the germination test may be terminated when the
nation test is made. After washing, the seeds must be sample reaches a predetermined germination percentage.
dried at a temperature of 20 to 25 °C (e.g. Beta vul- The time of the first count is approximate but must be
garis). Pelleted seed must not be prewashed. sufficient to permit the seedlings to reach a stage of devel-
opment which allows for accurate evaluation. The times
Removal of outer structures: Germination of certain indicated in Table 5A refer to the highest temperatures. If
species is promoted by removing outer structures such a lower temperature is chosen, the first count may have to
as involucre of bristles or lemma and palea of certain be postponed. For tests in sand, organic growing media or
Poaceae. soil lasting not more than 14 days, the first count may be
omitted. Intermediate counts to remove seedlings which
are sufficiently well developed are recommended in order
5.6.3.4 Disinfection of the seed to make counting easier and to prevent them from affect-
ing the development of other seedlings. Number and date
For samples of Arachis hypogaea and Beta vulgaris only, of intermediate counts may be left to the discretion of the
a fungicide treatment may be applied by the laboratory analyst, but should be kept at a minimum to reduce the
before planting the seed for germination, when the seed risk of damaging any seedlings which are not sufficiently
lot is known not to have received such a treatment. Results developed. When samples are tested on paper, unger-
are reported under ‘Germination’ in the spaces provided. minated seed and seedlings requiring additional time to

reach the stage of development that allows for accurate to have the potential to germinate are reported as dead.
evaluation, can be transferred to fresh substrate at inter- After this determination, if there is any doubt as to
mediate counts. In doing so, care must be taken to ensure whether the seed is fresh or dead, it must be classified
the integrity of replicates and to avoid any damage to the as dead. If not already applied, measures described in
transferred seeds and seedlings. 5.6.3 must be taken to break dormancy if 5 % or more
of fresh ungerminated seeds are found.
5.6.5 Evaluation Dead seeds: Obviously dead (soft, mouldy) seeds are

counted and reported as such on the ISTA Certificate.
Every seedling must be evaluated in accordance with the If it can be seen that a seed has produced any part of a
general principles laid down in 5.2.5–5.2.8. For evalua- seedling (e.g. the tip of the primary root) even though
tion, the essential structures must be sufficiently devel- decayed at the time of assessment, it is counted as an
oped to permit detection of any abnormality. abnormal seedling and not as a dead seed.
At the end of the germination test, the classification of
ungerminated seeds must be determined as prescribed in Other categories: Upon request of the customer, the
5.6.5.3. number of empty, embryoless or insect-damaged seeds
may be determined and reported under ‘Other Deter-
minations’ on the ISTA Certificate.
5.6.5.1 Seedlings
To detect these other categories of seeds, the following
Seedlings which have reached a stage when all essential methods may be used:
structures can be accurately assessed must be removed
from the test at the first and any other intermediate counts. a) Before the germination test:
Badly decayed seedlings should be removed in order to – X-ray test, which is conducted on the replicates
reduce the risk of secondary infection, but doubtful seed- used for the germination test;
lings with other defects must be left on the substrate until – cutting test, which is performed on four separate
the final count, unless it is obvious that they will never replicates of 100 seeds, soaked for up to 24 h at
develop into normal seedlings, e.g. broken seedlings and room temperature. Each seed is cut along its lon-
white seedlings. gitudinal axis and the content examined and classi-
fied as full, empty, embryoless or insect-damaged;
5.6.5.2 Multigerm seed units b) After the germination test:

– cutting test or X-ray test of apparently fresh unger-
When a unit produces more than one normal seedling, minated seeds.
only one is counted for determining the germination per-
centage. On request, the number of normal seedlings pro- When a tetrazolium test is performed, the percentage of
duced by 100 units, or the number of units which have empty and insect-damaged seeds can also be determined
produced one, two or more than two normal seedlings, or during preparation and evaluation.
the proportion of units producing one, two or more than
two normal seedlings, may also be determined.
5.7 Retesting Chapter 5: The germination test
5.6.5.3 Ungerminated seeds The result of a test must be considered unsatisfactory and
must not be reported, and a second test must be made by
Hard seeds: At the end of a germination test, hard the same or an alternative method, under the following
seeds are counted and reported as such on the ISTA circumstances:
Certificate. a) When dormancy is suspected (fresh ungerminated
seeds), any procedure to break dormancy indicated in
Fresh seeds: When 5 % or more of fresh seeds are be- column 6 of Table 5A or in 5.6.3.1 may be applied in
lieved to be present, their potential to germinate must one or more additional tests. The best result achieved
be determined by dissection, tetrazolium or excised must be reported and the procedure must be indicated
embryo. Those determined to have the potential to on the ISTA Certificate.
germinate are reported as fresh. Those determined not

b) When the result may not be reliable because of phyto- g) When due to counting errors more than 5 seeds are lost
toxicity or spread of fungi or bacteria, retests must be or found during a germination test (i.e. ±1.25 % for a
made using one or more alternative methods as indi- total of 400 seeds), then the test must be repeated.
cated in Table 5A, or in sand, organic growing media,
or soil. If necessary, the distance between the seeds
must be increased. The best result achieved must be 5.8 Calculation and expression of
reported, and the method used must be indicated on the results
ISTA Certificate.
The result of the germination test is expressed as percent-
c) When there is difficulty in deciding the correct evalu- ages by number of normal and abnormal seedlings and
ation of a number of seedlings, retests must be made hard, fresh and dead seeds. The percentages are rounded
using one or more alternative methods as prescribed to the nearest whole number. The sum of the percentages
in Table 5A, or in sand, organic growing media, or of normal and abnormal seedlings and hard, fresh and
soil. The best result achieved must be reported and the dead seeds must be 100 (see 5.8.2 Rounding results).
method used must be indicated on the ISTA Certificate. For multigerm seed units, only one normal seedling
per unit is counted to calculate the result of the germi-
d) When there is evidence of errors in test conditions, nation test. On request, the number of normal seedlings
seedling evaluation or counting, a retest must be made produced by 100 units; the number of units producing one,
using the same method or an alternative method as de- two or more than two normal seedlings; or the proportion
scribed in Table 5A, and the result of the retest must be of units producing one, two or more than two normal seed-
reported on the ISTA Certificate. lings, may also be reported. The proportion is expressed
as a percentage of the total number of units which have
e) If a sample does not respond satisfactorily to the meth- produced at least one normal seedling.
od selected, it will be necessary to retest it by one or
more of the alternative methods. When seedlings occur
which cannot be easily evaluated or show phytotoxic 5.8.1 Tolerances
symptoms, a retest should be made in sand, organic
growing media, or soil at the temperature prescribed in The result of a germination test can be relied upon only
Table 5A. Planting another sample of the same culti- if the difference between the highest and the lowest repli-
var, known to germinate satisfactorily, alongside, may cates is within accepted tolerances. To check the reliabil-
provide a useful guide to evaluation of this retest. The ity of a test result, the average percentage of the replicates
best result achieved must be reported and the method is rounded to the nearest whole number and compared
used must be indicated on the ISTA Certificate. with Table 5B. The result is considered reliable, if the dif-
ference between the highest and the lowest replicate does
f) When the range for the replicates exceeds the maxi- not exceed the tolerance indicated. Tolerances are applied
mum tolerated range in Table 5B, a retest must be to at least the category of normal seedlings.
carried out using the same test method or an alterna- If the range of the replicates exceeds the maximum
tive method. If the results of the retest using the same tolerated range in Table 5B, a retest must be made. If the
method are compatible with the first (i.e. the difference second result, using the same method, is in tolerance with
does not exceed the tolerance indicated in either Table the first (i.e. the difference between the two test results
5C, 5D or 5E), the average of the test results must be does not exceed the tolerance indicated in Table 5C), the
reported on the ISTA Certificate (see 5.8.1 Toleran average of the two test results must be reported on the
ces). If an alternative method is used and if the results ISTA Certificate.
are better and within accepted tolerances, then these If the second result is not in tolerance with the first
results must be reported on the ISTA Certificate (see (i.e. the difference between the two test results exceeds
5.8.1 Tolerances) and must not be averaged with the the tolerance indicated in Table 5C), a third test must be
previous test results. made. If the three test results are in tolerance (i.e. the dif-
When retesting is carried out under the circumstances ference between the three test results does not exceed the
a), b), c) or e), the best results achieved must be indi- tolerance indicated in Table 5D), the average of the three
cated on the ISTA Certificate. The results of the other test results, using the same method, must be reported. If
tests do not have to be reported on the ISTA Certifi- the three test results are not in tolerance (i.e. the difference
cate, except on specific request by the applicant. between the three test results exceeds the tolerance indi-
cated in Table 5D), the highest compatible result obtained

from comparison of the two test pairs of the three tests is In the case of equal decimal parts, the priority order is
reported (i.e. comparison of tests 1 and 3 and tests 2 and 3, abnormal seedlings — hard seeds — fresh seeds — dead
tests 1 and 2 having already been found to be out of toler- seeds.
ance). If after carrying out the second retest no compatible
result is obtained, a fourth test is carried out.
The average of the four test results, using the same 5.9 Reporting results
method, must be reported if the four test results are in
tolerance (i.e. the difference between the four test results The result of a germination test must be reported in the
does not exceed the tolerance indicated in Table 5E). If spaces provided as follows:
the four test results are not in tolerance (i.e. the difference – the actual duration of the test (in days, excluding the
between the four test results exceeds the tolerance indi- period of special treatment or method used for promot-
cated in Table 5E), the highest compatible result obtained ing germination);
from comparison of the three test trios of the four tests is – the percentages, calculated to the nearest whole num-
reported (i.e. comparison of tests 1, 2 and 4; tests 1, 3 and ber (5.8.2), of normal seedlings, hard seeds, fresh
4; and tests 2, 3 and 4). If after carrying out the compari- seeds, abnormal seedlings and dead seeds. If the result
son of trios of tests no compatible result is obtained, the for any of these categories is found to be zero, it must
highest compatible result obtained from comparison of the be reported as ‘0’.
three pairs of the four tests is reported (i.e. comparison – If an applicant requests that the test be terminated
of tests 1 and 4; tests 2 and 4; and tests 3 and 4). If after when the sample reaches a predetermined germination
carrying out the comparison of these three pairs of tests percentage, before the final count, then only the per-
no compatible result is obtained, no test result is reported, centage of normal seedlings is reported. The results of
and the customer is informed that the sample appears to the other categories (abnormal seedlings, hard seeds,
have unacceptable variation in germination. fresh seeds and dead seeds) must be reported as ‘N’,
Figure 5.3 illustrates, in the form of a flow chart, the because they have not been determined.
retesting procedure to obtain compatible results within
tolerance. The following additional information must be reported
When the germination percentage is reported on the under ‘Other determinations’:
ISTA Certificate, the method used must be given. The – the number of seeds tested, if less than 400 seeds;
ISTA germination test is based on 400 seeds. In cases – the germination method using the abbreviations used in
where less than 400 seeds are tested, the number tested Table 5A, including at least substrate and temperature;
must be reported. – any special treatment or method used for promoting
germination (5.6.3);
– the duration in days of any special treatment or method
5.8.2 Rounding results used for promoting germination, except in the case of
prestorage;
First, round the percentage of normal seedlings up or down – the germination percentage obtained within the pre-
to the nearest whole number (xx.0 and xx.25 are rounded scribed time, if the germination period was extended
down to xx; xx.50 and xx.75 are rounded up to xx + 1). beyond the period indicated in Table 5A. The state-
Add up the integer parts of the remaining percentages. ment must be entered as follows: ‘After the prescribed
If the sum is 100, the procedure ends; otherwise, con- period of … days, there were … % normal seedlings.’
tinue with the following steps: – the method for evaluating fresh seeds (dissection, tetra- Chapter 5: The germination test
zolium or excised embryo – see paragraph 5.6.5.3.)
1. Find the value with the greatest decimal part among when 5 % or more of fresh seeds are believed to be
the remaining percentages (abnormal seedlings, hard present.
seeds, fresh seeds and dead seeds) and round this per- – If an applicant requests that the germination test be ter-
centage to the upper whole number; keep this value as minated when the sample reaches a predetermined ger-
a final result. mination percentage, the following statement: ‘Upon
request of the applicant, the germination test was ter-
2. Add up the integer parts of the remaining percentages. minated after … days. The prescribed test period is …
days.’
3. If the sum is 100, the procedure ends; otherwise con-
tinue with further steps 1. and 2.

Test 1
Results of
Report result
replicates within tolerance YES
(Table 5B)?
NO
Retest, different Test 2

OR
method Retest, same method
Report result
Results of tests Average of tests
1 & 2 within tolerance YES
1 and 2
(Table 5C)?
NO

OR
Report result
Results of tests
Average of tests
1, 2 and 3 within tolerance YES
1, 2 & 3
(Table 5D)?
NO
Any pair Report result

(1 and 3) or (2 and 3) Average of highest
of test results within YES
compatible pair
tolerance (Table
5C)?
NO
OR
(Continued on following page)
Figure 5.3. Flow chart to illustrate the retesting procedure when test replicates and repeat tests are out of tolerance.

(Continued from previous page)
Test 4
Retest, same method
Report result
Results of tests
Average of tests
1, 2, 3 and 4 within YES
1, 2, 3 and 4
tolerance (Table 5E)?
NO
Any trio (1, 2 and 4), Report result

(1, 3 and 4), or (2, 3 and 4) of Average of highest
YES
test results within tolerance compatible trio
(Table 5D)?
NO
Any pair (1 and 4), Report result

(2 and 4) or (3 and 4) of test Average of highest
YES
results within tolerance compatible pair
(Table 5C)?
NO
No results reported. Chapter 5: The germination test

Unacceptable variations
in the germination tests.
Inform customer.
Figure 5.3. (Cont.) Flow chart to illustrate the retesting procedure when test replicates and repeat tests are out of
tolerance.

When double tests are prescribed in Table 5A Part 2, the First count: The time for the first count is approximate
result of the first test, with treatment for breaking dor- and refers to the highest temperature alternative in
mancy, is reported in the appropriate space on the ISTA paper substrates. If a lower temperature alternative is
Certificate, and the result of the second test, without treat- chosen or when the test is made in sand, the first count
ment for breaking dormancy, is reported under ‘Other may have to be delayed. For tests in sand with a final
determinations’. count after 7–10 (14) days the first count may be omit-
Upon request, the following information may be re- ted altogether.
ported as follows:
– the result of parallel tests or any additional test; Light: Illumination of the tests is generally recommend-
– the results of other tests made when retesting is ed for better developed seedlings. If in certain cases
necessary; light is required to promote germination of dormant
– the viability of ungerminated seeds and the method samples, this is indicated in column 6. If light is inhibi-
used to determine it; tory to germination and the substrates should be kept
– the categories of ungerminated seeds (as listed in in darkness, this is indicated in column 7.
5.6.5.3) and the method used to determine them; If tests are illuminated during an alternating tempera-
– in the case of multigerm seed units: the number of nor- ture regime it is usually, at a minimum, for the duration
mal seedlings produced by 100 units, the number of of the higher of the two temperatures, i.e. for 8 h in a
units which have produced one, two or more than two 20<=>30 alternating temperature regime.
normal seedlings, or the proportion of units producing
one, two or more than two normal seedlings. The pro- Dormancy-breaking methods: Where more than one
portion is expressed as a percentage of the total num- dormancy breaking method is indicated, the sequence
ber of units which have produced at least one normal of alternative methods does not indicate any prefer-
seedling. ence, and any method or combination of methods can
be used. However, if predrying or H2SO4 is used in
combination with any other method, they must be used
5.10 Germination methods prior to the other methods.
Table 5A indicates the prescribed substrates, temperatures Abbreviations

and test durations, recommended procedures for break-
ing dormancy, additional directions and additional advice. For further details see 5.6.2 and 5.6.3.
Where methods are prescribed for a group of species, only
those species specifically listed in Table 2A may be con- BP between paper
sidered to be covered. PP pleated paper
For certain species in Table 5A Part 2, ‘double tests’ TP top of paper
(with and without prechilling) are mandatory, as indicated TPS top of paper covered with sand
in column 6. Less desirable methods are placed in brack-
ets, e.g. TTZ (or EET). S sand
TS top of sand
Substrates: The sequence of alternative substrates does
not indicate any preference: TP; BP; TPS; S; O. O organic growing media
BP and TP may be replaced by PP (pleated paper). TO top of organic growing media
Temperatures: The sequence of alternative temperatures EET excised embryo test

is the same throughout and does not indicate any pref- GA3 Use solution of gibberellic acid instead of water.
erence: alternating temperatures, highest first; constant HNO3 Soak seeds in 1 M nitric acid prior to the germi-
temperatures, highest first. Alternating temperature nation test.
regimes are indicated by the symbols ‘<=>’ between H2SO4 Soak seeds in concentrated sulphuric acid prior
temperatures; for example, 20<=>30 is an alternating to the germination test.
temperature regime of 20 °C for 16 h and 30 °C for KNO3 Use solution of 0.2 % potassium nitrate instead
8 h. of water.
TTZ tetrazolium test

Table 5A Part 1. Detailed methods for germination tests: agricultural and vegetable seeds
Species Substrate Temperature* First Final Recommendations for breaking dormancy Additional Additional advice
(°C) count (d) count (d) directions
1 2 3 4 5 6 7 8
Abelmoschus esculentus TP; BP; S 20<=>30 4 21 – – –
Achillea millefolium TP 20<=>30 5 14 – – –
Effective 1 January 2018

Aeschynomene americana TP 20<=>35; 20<=>30 4 14 – – –
Agropyron cristatum TP 20<=>30; 15<=>25 5 14 KNO3; prechill – –
Agropyron desertorum TP 20<=>30; 15<=>25 5 14 KNO3; prechill – –
Agrostis canina TP 20<=>30; 15<=>25; 7 21 KNO3; prechill – –
10<=>30
Agrostis capillaris TP 20<=>30; 15<=>25; 7 28 KNO3; prechill – –
10<=>30
Agrostis gigantea TP 20<=>30; 15<=>25; 5 10 KNO3; prechill – –
10<=>30
Agrostis stolonifera TP 20<=>30; 15<=>25; 7 28 KNO3; prechill – –
10<=>30
Allium cepa TP; BP; S 20; 15 6 12 Prechill – –
Allium fistulosum TP; BP; S 20; 15 6 12 Prechill – –
Allium porrum TP; BP; S 20; 15 6 14 Prechill – –
Allium schoenoprasum TP; BP; S 20; 15 6 14 Prechill – –
Allium tuberosum TP 20<=>30; 20 6 14 Prechill – –
Alopecurus pratensis TP 20<=>30; 15<=>25; 7 14 KNO3; prechill – –
10<=>30
Alysicarpus vaginalis BP 35 4 21 Pierce seed coat of swollen seeds at 21 d and con- – –
tinue test until 35 d. Swollen seeds may be placed at
20 °C for 2 d, then at 35 °C for 3 d
Andropogon gayanus TP 20<=>35 7 14 KNO3; light – –

Andropogon gerardi TP 20<=>30 7 28 KNO3; prechill – –
Andropogon hallii TP 20<=>30 7 28 KNO3; prechill – –
Anethum graveolens TP; BP 20<=>30; 10<=>30 7 21 Prechill – –
Anthoxanthum odoratum TP 20<=>30 6 14 – – –
Anthriscus cerefolium TP; BP 20<=>30 7 21 Prechill – –
Anthyllis vulneraria TP; BP 20 5 10 Prechill – –
Apium graveolens TP 20<=>30 10 21 KNO3; prechill, light – –
Arachis hypogaea BP; S 20<=>30; 25 5 10 Remove shells; preheat at 40 ±2 °C – –
*The symbols ‘<=>’ indicate alternating temperature regimes. 1st temperature: 16 h; 2nd temperature: 8 h
5-21

Table 5A Part 1. Detailed methods for germination tests: agricultural and vegetable seeds (continued)
5-22
1 2 3 4 5 6 7 8
Arctium lappa BP; TP 20<=>30; 20 14 35 Prechill – For deeply dor-
mant seed TTZ
advisable
Arrhenatherum elatius TP 20<=>30 6 14 Prechill – –
Asparagus officinalis TP; BP; S 20<=>30 10 28 – – –
Astragalus cicer BP; TP 15<=>25; 20 10 21 – – –

Astrebla lappacea TP 32 7 14 KNO3 – –
Atriplex hortensis TP; BP 20<=>30 7 28 – – –
Atropa belladonna TP; BP 20<=>30 10 28 Prechill – –
Avena nuda BP; S 20 5 10 Preheat at 30 to 35 °C; prechill – –
Avena sativa BP; S 20 5 10 Preheat at 30 to 35 °C; prechill – –
Avena strigosa BP; S 20 5 10 GA3; prechill – –
Axonopus compressus TP 20<=>35 10 21 KNO3; light – –
Axonopus fissifolius TP 20<=>35 10 21 KNO3; light – –
Beckmannia eruciformis TP 20<=>30 7 21 – – –
Beta vulgaris TP; BP; S 20<=>30; 4 14 Prewash (multigerm: 2 h; genetic monogerm: 4 h). Dry – –
15<=>25; 20 at max. 25 °C
Borago officinalis TP; BP 20<=>30; 20 5 14 – – –
Bothriochloa insculpta TP 20<=>35 3 21 KNO3; light – –
Bothriochloa pertusa TP 20<=>35 3 21 KNO3; light – –
Bouteloua gracilis TP 20<=>30; 15<=>30 7 28 KNO3 – –
Brachiaria brizantha TP 20<=>35 7 21 Preheat; KNO3 – –
Brachiaria decumbens TP 20<=>35 7 21 H2SO4; KNO3; light – –
Brachiaria humidicola TP 20<=>35 7 21 KNO3 – –
Brachiaria mutica TP 20<=>35 7 21 H2SO4; KNO3 – –
Brachiaria ramosa BP 20<=>30 4 14 Preheat; KNO3 – –
Brachiaria ruziziensis TP 20<=>35 7 21 H2SO4; KNO3 – –
Brassica carinata BP 20; 20<=>30 5 7 – – –
Brassica juncea TP 20<=>30; 20 5 7 KNO3; prechill – –
Brassica napus BP; TP 20<=>30; 20 5 7 KNO3; prechill – –
Brassica napus var. BP; TP 20<=>30; 20 5 14 Prechill – –
napobrassica
Brassica nigra BP; TP 20<=>30; 20 5 10 KNO3; prechill – –
Brassica oleracea BP; TP 20<=>30; 20 5 10 KNO3; prechill – –
Brassica perviridis BP; TP 20<=>30; 20 5 7 Prechill – –

1 2 3 4 5 6 7 8
Brassica rapa BP; TP 20<=>30; 20 5 7 KNO3; prechill – –
Bromus arvensis TP 20<=>30; 15<=>25 7 21 KNO3; prechill – –

Bromus carinatus TP 20<=>30; 15<=>25; 7 14 KNO3; prechill – –
10<=>30
Bromus catharticus TP 20<=>30 7 28 KNO3; prechill – –
Bromus erectus TP 20<=>30; 15<=>25 7 14 KNO3; prechill – –
Bromus hordeaceus TP 20<=>30 7 14 Prechill – –

Bromus inermis TP 20<=>30; 15<=>25 7 14 KNO3; prechill – –
Bromus marginatus TP 20<=>30; 15<=>25 7 14 KNO3; prechill – –
Bromus riparius TP 20<=>30; 15<=>25 7 14 KNO3; prechill – –
Bromus sitchensis TP 20<=>30; 15<=>25 7 21 Prechill – –
Cajanus cajan BP; S 20<=>30; 25 4 10 – – –
Calopogonium mucunoides TP 25; 20 3 10 – – –
Camelina sativa TP 20<=>30 4 10 – – –
Cannabis sativa TP; BP 20<=>30; 20 3 7 – – –
Capsicum spp. TP; BP; S 20<=>30 7 14 KNO3 – –
Carthamus tinctorius TP; BP; S 20<=>30; 25 4 14 – – –
Carum carvi TP 20<=>30 7 21 – – –
Cenchrus ciliaris TP; S 20<=>35; 20<=>30 7 28 Preheat; KNO3; prechill – –
Cenchrus setiger TP 20<=>35 3 14 Preheat at 40 ±2 °C; KNO3 – –
Centrosema pascuorum TP 35 3 7 – – –
Centrosema molle TP 20<=>35 4 10 – – –
Chamaecrista rotundifolia TP 20<=>30 4 14 – – –
Chloris gayana TP 20<=>35; 20<=>30 7 14 KNO3; prechill; light – Testing by weighed
replicates also
allowed (Chapter
13 Table 13B)
Cicer arietinum BP; S 20<=>30; 20 5 8 – – –

Cichorium endivia TP 20<=>30; 20 5 14 KNO3 – –
Cichorium intybus TP 20<=>30; 20 5 14 KNO3 – –
Citrullus lanatus BP; S 20<=>30; 25 5 14 – – PP advisable
Claytonia perfoliata BP 10 7 21 – – –
Corchorus capsularis TP; BP 30 3 5 – – –
Corchorus olitorius TP; BP 30 3 5 – – –
5-23

5-24
1 2 3 4 5 6 7 8
Coriandrum sativum TP; BP 20<=>30; 20 7 21 – – –
Crambe abyssinica TP; BP 20<=>30; 20 4 7 KNO3 – –
Crotalaria brevidens BP 20<=>30 4 10 – – –
Crotalaria juncea BP; S 20<=>30 4 10 – – –
Crotalaria lanceolata BP 20<=>30 4 10 – – –

Crotalaria pallida BP 20<=>30 4 10 – – –
Crotalaria spectabilis BP 20<=>30 4 10 – – –
Cucumis melo BP; S 20<=>30; 25 4 8 – – PP advisable
Cucumis sativus TP; BP; S 20<=>30; 25 4 8 – – PP advisable
Cucumis spp. BP; S 20<=>30; 25 4 8 – – PP advisable
Cucurbita maxima BP; S 20<=>30; 25 4 8 – – PP advisable
Cucurbita moschata BP; S 20<=>30; 25 4 8 – – PP advisable
Cucurbita pepo BP; S 20<=>30; 25 4 8 – – PP advisable
Cucurbita spp. BP; S 20<=>30; 25 4 8 – – PP advisable
Cucurbita hybrids BP; S 20<=>30; 25 4 8 – – PP advisable
Cuminum cyminum TP 20<=>30 5 14 – – –
Cyamopsis tetragonoloba BP 20<=>30 5 14 – – –
Cynara cardunculus BP; S 15<=>20; 20 7 21 – – –
Cynodon dactylon TP 20<=>35; 20<=>30 7 21 KNO3; prechill; light – –
Cynosurus cristatus TP 20<=>30 10 21 KNO3; prechill – –
Dactylis glomerata TP 20<=>30; 15<=>25 7 21 KNO3; prechill – –
Daucus carota TP; BP 20<=>30; 20 7 14 – – –
Deschampsia cespitosa TP 20<=>30; 20 7 16 KNO3; prechill – –
Deschampsia flexuosa TP 20<=>30; 20 7 16 KNO3; prechill – –
Desmodium intortum TP 20<=>30 4 10 H2SO4 – –
Desmodium uncinatum TP 20<=>30 4 10 H2SO4 – –
Dichanthium aristatum TP 20<=>35 7 21 KNO3 – –
Dichondra micrantha TP 20<=>30 7 21 – – –
Digitaria eriantha TP 20<=>30 4 10 – – –
Echinochloa crus-galli TP 20<=>30; 25 4 10 Preheat (40 ±2 °C) – –
Ehrharta calycina TP 20 7 21 Prechill – –
Eleusine coracana TP 20<=>30 4 8 KNO3 – –
Elymus trachycaulus TP 20<=>30; 15<=>25 5 14 KNO3; prechill – –
Elytrigia elongata TP 20<=>30; 15<=>25 5 21 KNO3; prechill – –

1 2 3 4 5 6 7 8
Elytrigia intermedia TP 20<=>30; 15<=>25 5 28 KNO3; prechill – –
Elytrigia repens TP 20<=>30; 15<=>25 7 21 KNO3; prechill – –

Eragrostis curvula TP 20<=>35; 15<=>30 6 10 KNO3; prechill – –
Eragrostis tef TP 20<=>30 4 10 KNO3; prechill – –
Eruca sativa TP; BP 20 4 7 – – –
Fagopyrum esculentum TP; BP 20<=>30; 20 4 7 – – –
Festuca arundinacea TP 20<=>30; 15<=>25 7 14 KNO3; prechill – –

Festuca filiformis TP 20<=>30; 15<=>25 7 14 KNO3; prechill – –
Festuca heterophylla TP 20<=>30; 15<=>25 7 14 KNO3; prechill – –
Festuca ovina TP 20<=>30; 15<=>25 7 14 KNO3; prechill – –
Festuca pratensis TP 20<=>30; 15<=>25 7 14 KNO3; prechill – –
Festuca rubra TP 20<=>30; 15<=>25 7 14 KNO3; prechill – –
Festuca trachyphylla TP 20<=>30; 15<=>25 7 14 KNO3; prechill – –
×Festulolium spp. TP 20<=>30; 5 14 KNO3; prechill – –
15<=>25; 20
Foeniculum vulgare TP; BP; 20<=>30 7 14 – – –
TS
Fragaria spp. TP 20<=>30; 20 7 28 – – –
Galega orientalis TP; BP 20 5 14 – – –
Glycine max BP; TPS; 20<=>30; 25 5 8 – – –
S
Gossypium spp. BP; S 20<=>30; 25 4 12 – – –
Hedysarum coronarium TP; BP 20<=>30; 20 7 14 – – –
Helianthus annuus BP; TPS; 20<=>30; 25; 20 4 10 Preheat; prechill – –
S; O
Hibiscus cannabinus BP; S 20<=>30 4 8 – – –
Holcus lanatus TP 20<=>30 6 14 KNO3; prechill – –
Hordeum vulgare BP; S 20 4 7 Preheat at 30 to 35 °C; GA3; KNO3; prechill – –
Ipomoea aquatica BP; S 30 4 10 – – –
Koeleria macrantha TP 20<=>30 5 14 Prechill at 8 to 10 °C for 5 d; light – –
Kummerowia stipulacea BP 20<=>35 5 14 – – –
Kummerowia striata BP 20<=>35 7 14 – – –
Lablab purpureus BP; S 20<=>30; 25 4 10 – – –
Lactuca sativa TP; BP 20 4 7 Prechill – –
Lagenaria siceraria BP; S 20<=>30 4 14 – – PP advisable
5-25

5-26
1 2 3 4 5 6 7 8
Lathyrus cicera S 20 5 10 – – –
Lathyrus hirsutus BP; S 20 7 14 – – –
Lathyrus sativus BP; S 20 5 14 – – –
Lens culinaris BP; S 20 5 10 Prechill – –
Lepidium sativum TP 20<=>30; 20 4 10 Prechill – –

Lespedeza juncea BP 20<=>35 7 21 – – –
Leucaena leucocephala TP; BP 25 4 10 Cut seed – –
Linum usitatissimum TP; BP 20<=>30; 20 3 7 Prechill – –
Listia bainesii TP 20<=>30 7 21 – – –
Lolium ×hybridum TP 20<=>30; 5 10 KNO3; prechill – –
15<=>25; 20
Lolium multiflorum TP 20<=>30; 5 10 KNO3; prechill – –
15<=>25; 20
Lolium perenne TP 20<=>30; 5 10 KNO3; prechill – –
15<=>25; 20
Lolium rigidum TP 20<=>30; 15<=>25 5 14 KNO3; light; prechill at 5 to 10 °C for 7 d; if necessary – –
prechill for 3 d and continue test at 15<=>25 °C for ad-
ditional 4 d
Lotus corniculatus TP; BP 20<=>30; 20 4 12 Prechill – –

Lotus tenuis TP; BP 20<=>30; 20 4 12 Prechill – –
Lotus uliginosus TP; BP 20<=>30; 20 4 12 Prechill – –
Luffa acutangula BP; S 30 4 14 – – –
Luffa aegyptiaca BP; S 20<=>30; 30 4 14 – – –
Lupinus albus BP; S 20 5 10 Prechill – –
Lupinus angustifolius BP; S 20 5 10 Prechill – –
Lupinus luteus BP; S 20 10 21 Prechill – –
Macroptilium atropurpureum TP 25 4 10 H2SO4 – –
Macroptilium lathyroides TP 25 4 10 H2SO4 – –
Macrotyloma axillare BP 25 4 10 H2SO4 or cut seed – –
Macrotyloma uniflorum TP; S 20<=>30; 25 4 10 Cut seed – –
Medicago arabica TP; BP 20 4 14 – – –
Medicago italica TP; BP 20; 15 4 14 – – –
Medicago littoralis TP 20 4 14 – – –
Medicago lupulina TP; BP 20 4 10 Prechill – –

1 2 3 4 5 6 7 8
Medicago orbicularis TP; BP 20 4 10 Prechill – –
Medicago polymorpha TP; BP 20 4 14 – – –

Medicago rugosa TP; BP 20 4 14 – – –
Medicago sativa TP; BP 20 4 10 Prechill – –
Medicago scutellata TP; BP 20 4 14 – – –
Medicago truncatula TP; BP 20 4 10 – – –
Melilotus albus TP; BP 20 4 7 Prechill – –

Melilotus indicus TP; BP 20 3 14 – – –
Melilotus officinalis TP; BP 20 4 7 Prechill – –
Melinis minutiflora TP 20<=>30 7 21 KNO3; prechill – –
Momordica charantia BP; S 20<=>30; 30 4 14 – – –
Mucuna pruriens TP; S 20<=>30; 30 3 14 Cut seed – –
Nasturtium officinale TP; BP 20<=>30 4 14 – – –
Neonotonia wightii TP 20<=>30; 10<=>35 4 10 – – –
Nicotiana tabacum TP 20<=>30 7 16 KNO3 – –
Ocimum basilicum TP 20<=>30 4 14 KNO3 – –
Oenothera biennis TP 20<=>30; 20 7 21 KNO3 – –
Onobrychis viciifolia TP; BP; S 20<=>30; 20 4 14 Prechill – –
Origanum majorana TP 20<=>30; 20 7 21 – – –
Origanum vulgare TP 20<=>30; 20 7 21 – – –
Ornithopus compressus TP 15 7 21 – – –
Ornithopus sativus TP; BP 20 7 14 – – –
Oryza sativa TP; BP; S 20<=>30; 25 5 14 Preheat (50 ±2 °C); soak in water or HNO3 for 24 h – –
Panicum antidotale TP 20<=>30 7 28 – – –

Panicum coloratum TP 20<=>35 7 28 – – –
Panicum maximum TP 20<=>30; 15<=>35 10 28 KNO3; prechill – –
Panicum miliaceum TP; BP 20<=>30; 25 3 7 – – –
Panicum virgatum TP 15<=>30 7 28 KNO3; prechill – –
Papaver somniferum TP 20 5 10 Prechill – –
Pascopyrum smithii TP 20<=>30; 15<=>25 7 28 KNO3; prechill – –
Paspalum dilatatum TP 20<=>35 7 28 KNO3; light – –
Paspalum notatum TP 20<=>35; 20<=>30 7 28 H2SO4; KNO3 – –
Paspalum plicatulum TP 20<=>35 7 28 KNO3; light – –
5-27

5-28
1 2 3 4 5 6 7 8
Paspalum scrobiculatum TP 20<=>30 7 20 KNO3 – –
Paspalum urvillei TP 20<=>35 7 21 KNO3 – –
Paspalum virgatum TP 20<=>35 7 28 KNO3 – –
Pastinaca sativa TP; BP 20<=>30 6 28 – – –
Pennisetum clandestinum TP 20<=>35; 20<=>30 7 14 KNO3; prechill – –

Pennisetum glaucum TP; BP 20<=>35; 20<=>30 3 7 – – –
Petroselinum crispum TP; BP 20<=>30; 20 10 28 – – –
Phacelia tanacetifolia TP; BP 20<=>30; 20; 15 5 14 Prechill No light –
Phalaris aquatica TP 20<=>30; 20 7 21 KNO3; prechill – –
Phalaris arundinacea TP 20<=>30 7 21 KNO3; prechill – –
Phalaris canariensis TP; BP 20<=>30; 15<=>25 7 21 KNO3; prechill – –
Phaseolus coccineus BP; S 20<=>30; 20 5 9 – – –
Phaseolus lunatus BP; S 20<=>30; 25 5 9 – – –
Phaseolus vulgaris BP; TPS; 20<=>30; 25; 20 5 9 – – –
S
Phleum nodosum TP 20<=>30; 15<=>25 7 10 KNO3; prechill – –
Phleum pratense TP 20<=>30; 15<=>25 7 10 KNO3; prechill – –
Physalis pubescens TP 20<=>30 7 28 KNO3 – –
Pimpinella anisum TP; BP 20<=>30 7 21 – – –
Piptatherum miliaceum S 15 7 42 Prechill – –
Pisum sativum BP; TPS; 20 5 8 – – –
S
Plantago lanceolata TP; BP 20<=>30; 20 4–7 21 – – –
Poa annua TP 20<=>30; 15<=>25 7 21 KNO3; prechill – –
Poa bulbosa TP 15<=>25 10 35 KNO3 – –
Poa compressa TP 15<=>25; 10<=>30 10 28 KNO3; prechill – –
Poa nemoralis TP 20<=>30; 15<=>25; 10 21 KNO3; prechill – –
10<=>30
Poa palustris TP 20<=>30; 15<=>25; 10 21 KNO3; prechill – –
10<=>30
Poa pratensis TP 20<=>30; 15<=>25; 10 21 KNO3; prechill – –
10<=>30
Poa secunda TP 20<=>30; 15<=>25; 7 28 KNO3; prechill – –
10<=>30
Poa trivialis TP 20<=>30; 15<=>25 7 21 KNO3; prechill – –

1 2 3 4 5 6 7 8
Portulaca oleracea TP; BP 20<=>30 5 14 Prechill – –
Psathyrostachys juncea TP 20<=>30 5 14 Prechill – –

Pseudoroegneria spicata TP 20<=>30; 15<=>25 7 21 KNO3; prechill – –
Psophocarpus tetragonolobus BP; S 20<=>30; 30 4 14 – – –
Pueraria lobata BP 20<=>30 5 14 – – –
Pueraria phaseoloides TP 25 4 10 H2SO4 – –
Raphanus sativus TP; BP; S 20<=>30; 20 4 10 Prechill – –

Rheum rhaponticum TP 20<=>30 7 21 – – –
Ricinus communis BP; S 20<=>30 7 14 – – –
Rosmarinus officinalis TP 20<=>30; 20 7 28 – – –
Rumex acetosa TP 20<=>30 3 14 Prechill – –
Sanguisorba minor TP; BP 20<=>30; 20 7 28 – – –
Satureja hortensis TP 20<=>30 5 21 – – –
Schizachyrium scoparium TP 20<=>30 7 28 KNO3; prechill – –
Scorzonera hispanica TP; BP; S 20<=>30; 20 4 8 Prechill – –
Secale cereale TP; BP; S 20 4 7 GA3; prechill – –
Securigera varia TP; BP 20 7 14 – – –
Sesamum indicum TP 20<=>30 3 6 – – –
Setaria italica TP; BP 20<=>30 4 10 – – –
Setaria sphacelata TP 20<=>35 7 21 KNO3 – –
Sinapis alba BP; TP 20<=>30; 20 3 7 Prechill – –
Solanum lycopersicum TP; BP; S 20<=>30 5 14 KNO3 – –
Solanum (sect. Lycopersicon) TP; BP; S 20<=>30 5 14 KNO3 – –
spp.
Solanum (sect. Lycopersicon) TP; BP; S 20<=>30 5 14 KNO3 – –
hybrids
Solanum melongena TP; BP; S 20<=>30 7 14 – – –
Solanum nigrum TP 20<=>30 7 14 – – –
Solanum tuberosum TP 20<=>30 3 14 Imbibe in 1.5 % GA3 for 24 h – –
Sorghastrum nutans TP 20<=>30 7 28 KNO3; prechill – –
Sorghum ×almum TP; BP 20<=>35; 20<=>30 5 21 Prechill – –
Sorghum bicolor TP; BP 20<=>30; 25 4 10 Prechill – –
Sorghum bicolor × TP; BP 20<=>30 4 10 Prechill – –
S. sudanense
Sorghum halepense TP; BP 20<=>35; 20<=>30 7 35 – – –
5-29

5-30
1 2 3 4 5 6 7 8
Sorghum sudanense TP; BP 20<=>30 4 10 Prechill – –
Spergula arvensis TP 20 4 10 – – –
Spinacia oleracea TP; BP 15; 10 7 21 Prechill – –
Stylosanthes guianensis TP 20<=>35; 20<=>30 4 10 H2SO4 – –
Stylosanthes hamata TP 20<=>35; 10<=>35 4 10 Cut seed – –

Stylosanthes humilis TP 20<=>30; 10<=>35 2 5 Cut seed – –
Stylosanthes scabra TP 20<=>35 4 10 Cut seed – –
Taraxacum officinale TP 20<=>30; 20 7 21 – – –
Tetragonia tetragonoides BP; S 20<=>30; 20 7 35 Remove pulp; soak in water for 24 h – –
Thymus vulgaris TP 20<=>30; 20 7 21 – – –
Tragopogon porrifolius TP; BP 20 5 10 Prechill – –
Trifolium alexandrinum TP; BP 20 3 7 – – –
Trifolium campestre TP; BP 20 4 14 – – –
Trifolium dubium TP; BP 20 5 14 Prechill – –
Trifolium fragiferum TP; BP 20 3 7 – – –
Trifolium glomeratum TP; BP 20 4 10 – – –
Trifolium hirtum TP; BP 20 4 10 – – –
Trifolium hybridum TP; BP 20 4 10 Sealed polythene envelope; prechill – –
Trifolium incarnatum TP; BP 20 4 7 Sealed polythene envelope; prechill – –
Trifolium lappaceum TP; BP 20 3 7 Prechill – –
Trifolium michelianum TP 20; 15 4 10 Prechill – –
Trifolium pratense TP; BP 20 4 10 Prechill – –
Trifolium repens TP; BP 20 4 10 Sealed polythene envelope; prechill – –
Trifolium resupinatum TP; BP 20 4 7 – – –
Trifolium semipilosum BP; S 20; 15 3 7 – – –
Trifolium squarrosum TP; BP 20; 15 4 14 Prechill – –
Trifolium subterraneum TP; BP 20; 15 4 14 – No light –
Trifolium vesiculosum TP; BP 20; 15 4 10 – – –
Trigonella foenum-graecum TP; BP 20<=>30; 20 5 14 – – –
Trisetum flavescens TP 20<=>30 7 21 KNO3; prechill – –
×Triticosecale TP; BP; S 20 4 8 Preheat at 30 to 35 °C; GA3; prechill – –
Triticum aestivum TP; BP; S 20 4 8 Preheat at 30 to 35 °C; GA3; prechill – –
Triticum dicoccon TP; BP; S 20 4 8 Preheat at 30 to 35 °C; GA3; prechill – –
Triticum durum TP; BP; S 20 4 8 Preheat at 30 to 35 °C; GA3; prechill – –

1 2 3 4 5 6 7 8
Triticum spelta BP; S 20 4 8 Preheat at 30 to 35 °C; GA3; prechill – –
Urochloa mosambicensis TP 20<=>35 7 21 GA3; KNO3 – –

Valerianella locusta TP; BP 20; 15 7 28 GA3; prechill – –
Vicia benghalensis BP 20 5 10 – – –
Vicia ervilia BP; S 20 5 8 – – –
Vicia faba BP; S; O 20 4 14 Prechill – –
Vicia narbonensis BP; S 20 5 10 – – –

Vicia pannonica BP; S 20 5 10 Prechill – –
Vicia sativa BP; S 20 5 14 Prechill – –
Vicia villosa BP; S 20 5 14 Prechill – –
Vigna angularis BP; S 20<=>30 4 10 – – –
Vigna marina BP 20<=>30 4 8 – – –
Vigna mungo BP; S 20<=>30; 25; 20 4 7 – – –
Vigna radiata BP;S 20<=>30; 25 5 7 – – –
Vigna subterranea BP; S 20<=>30; 30; 25 5 10 – – –
Vigna unguiculata BP; S 20<=>30; 25 5 8 – – –
Zea mays BP; TPS; 20<=>30; 25; 20 4 7 – – –
S
Zoysia japonica TP 20<=>35 10 28 KNO3 – –
5-31

Table 5A Part 2. Detailed methods for germination tests: Tree and shrub seeds
5-32
For certain species, ‘double tests’ (with and without prechilling) are mandatory (see column 7). Methods and procedures in brackets are less desirable.
Species Substrate Temperature* First Final Recommendation for breaking dormancy Additional directions Additional advice
(°C) count (d) count (d)
1 2 3 4 5 6 7 8
Abies alba, TP 20<=>30 7 28 Prechill 21 d – –
Abies balsamea,
Abies cilicica,
Abies firma,
Abies fraseri,
Abies homolepis,
Abies lasiocarpa,
Abies magnifica,
Abies numidica,
Abies sachalinensis
Abies amabilis, TP 20<=>30 7 28 – Double test: no prechill and –
Abies cephalonica, prechill 21 d
Abies concolor,
Abies grandis,
Abies nordmanniana,
Abies pinsapo,
Abies procera,
Abies veitchii
Acacia spp. TP 20<=>30; (20) 7 21 1. Pierce seed; or chip or file off fragment – –
of testa at cotyledon end; then soak for 3 h
2. (Soak seed for 1 h in concentrated
H2SO4, then wash seed thoroughly in run-
ning water)
Acer campestre – – – – – Use TTZ –

Acer negundo, S; TP 20 7 21 Prechill 2 months. It is advantageous to – –
Acer platanoides, remove pericarp before testing. Newly
Acer pseudoplatanus, harvested undried seeds are usually more
Acer saccharum dormant than dried and/or stored
Acer palmatum S; TP 20 7 21 Prechill 4 months. It is advantageous to – TTZ (or EET)

remove pericarp before testing advisable

Table 5A Part 2. Detailed methods for germination tests: Tree and shrub seeds (continued)
1 2 3 4 5 6 7 8
Acer rubrum, S; (TP) 20 7 21 – – –
Acer saccharinum

Aesculus hippocastanum TS; (S) 20<=>30; (20) 7 21 Soak in water for 48 h; cut off scar end of – –
seed. Do not remove testa from sown por-
tion. Fresh nuts may require prechill
Ailanthus altissima TP 20<=>30 7 21 Removal of pericarp after soaking for 24 h – –

in water may speed up germination
Alnus cordata, TP 20<=>30 7 21 – – –

Alnus glutinosa,
Alnus incana,
Alnus rubra
Amorpha fruticosa TP 20<=>30 10 28 Light – –
Berberis aquifolium – – – – – Use TTZ –
Betula papyrifera TP 20<=>30 7 21 – – –
Betula pendula TP 20<=>30 7 21 – Double test: no prechill and Testing by weighed
prechill 21 d. replicates also allowed
(Chapter 13)
Betula pubescens TP 20<=>30 7 21 – – Testing by weighed

replicates also allowed
(Chapter 13)
Calocedrus decurrens TP 20<=>30 7 28 Prechill 28 d – For deeply dormant

seed TTZ (or EET)
advisable
Caragana arborescens TP 20<=>30 7 21 Pierce seed; or chip or file off fragment – –
of testa from cotyledon end; then soak in
water for 3 h
Carica papaya S 20<=>30 12 28 Soak in water for 16 h; soak in GA3 0.05 % – –

for 16 h
Carpinus betulus S 20 14 42 Incubate in moist substrate for 1 month at – TTZ advisable
20 °C followed by 4 months at 1 to 5 °C
5-33

5-34
1 2 3 4 5 6 7 8
Castanea sativa TS; (S) 20<=>30 7 21 Soak in water for 48 h; cut off at scar end – –
and remove testa
Catalpa spp. TP 20<=>30 7 21 – – –

Cedrela spp. TP 20<=>30 7 28 – – –

Cedrus atlantica, TP 20; (20<=>30) 7 21 Prechill 21 d – –
Cedrus deodora,
Cedrus libani
Chamaecyparis TP 20; (20<=>30) 7 28 – – –
lawsoniana
Chamaecyparis TP 20; (20<=>30) 7 28 Prechill 21 d – –
nootkatensis
Chamaecyparis obtusa TP 20<=>30 7 21 – – –
Chamaecyparis pisifera TP 20<=>30 7 21 – – –

Chamaecyparis thyoides TP 20 7 28 Prechill 90 d – TTZ advisable
Cornus sanguinea – – – – – Use TTZ –
Corylus avellana S 20; 20<=>30 14 35 Remove pericarp and prechill 2 months – TTZ advisable
Corymbia spp. – – – – – All Corymbia spp. tested by –

weighed replicates method
(see Ch. 13, Table 13A)
Cotoneaster spp. – – – – – Use TTZ –

Crataegus monogyna S 20<=>30 7 28 Incubate in moist substrate 3 months at – TTZ advisable
25 °C followed by 9 months prechill
Cryptomeria japonica TP 20<=>30 7 28 – – –
Cupressus arizonica TP 20<=>30 7 28 – Double test: no prechill and –
prechill 21 d
Cupressus macrocarpa TP 20<=>30 14 35 – – –

Cupressus sempervirens TP 20 7 28 – – –
Cydonia oblonga – – – – – Use TTZ –

1 2 3 4 5 6 7 8
Cytisus scoparius TP 20<=>30 7 28 Pierce seed; or chip or file off fragment of – –
testa at cotyledon end; then soak in water

for 3 h
Elaeagnus angustifolia – – – – – Use TTZ –

Eucalyptus spp. – – – – – All Eucalyptus spp. tested by –
weighed replicates method

(see Ch. 13, Table 13A)
Euonymus europaeus TP 20<=>30 7 28 Prechill 45 d – TTZ advisable

Fagus sylvatica TP 5 – – Duration of the test depends on dormancy, – For deeply dormant
and in an extreme case could require seed TTZ advisable
about 24 weeks
Fraxinus spp. TP 20<=>30 14 56 Pretreat seed 2 months at 20 °C followed – TTZ (or EET)
by 7 months at 1 to 5 °C advisable
Ginkgo biloba TP; BP 20<=>30; 20 10 30 Remove seed coat – –
Gleditsia triacanthos TP 20 7 21 1. Pierce seed; or chip or file off fragment – –
of testa at cotyledon end; then soak in
water for 6 h
2. (Soak whole seed in concentrated
H2SO4 for as long as necessary to pit
surface of testa, then wash thoroughly in
running water)
Ilex aquifolium – – – – – Use TTZ –

Juniperus communis TP; S 20 14 28 Prechill 90 d – TTZ advisable
Juniperus scopulorum TP; S 15 14 42 Pretreat 60 d at 20 °C followed by 40 d at – TTZ advisable
1 to 5 °C
Juniperus virginiana TP; S 15 14 28 Pretreat 60 d at 20 °C followed by 45 d at – TTZ advisable
1 to 5 °C
Koelreuteria paniculata – – – – – Use TTZ –
5-35

5-36
1 2 3 4 5 6 7 8
Laburnum alpinum, TP 20<=>30 7 21 1. Pierce seed; or chip or file off fragment – –
Laburnum anagyroides of testa at cotyledon end; then soak in
water for 3 h

running water)
Larix decidua, TP 20<=>30 7 21 – – –

Larix ×eurolepis,
Larix gmelinii,
Larix laricina,
Larix sibirica
Larix kaempferi, TP 20<=>30 7 21 – Double test: no prechill and –
Larix occidentalis prechill 21 d
Ligustrum vulgare – – – – – Use TTZ –

Liquidambar styraciflua TP 20<=>30 7 21 Sensitive to drying in test – –
Liriodendron tulipifera TP 20<=>30 7 28 Prechill 60 d – TTZ advisable
Malus spp. (except M. – – – – – Use TTZ (or EET) –
sylvestris, M. sargentii)
Malus sargentii, – – – – – Use TTZ –
Malus sylvestris
Malva sylvestris TP 20<=>30; 20 7 21 – – –
Morus spp. TP 20<=>30 14 28 – – –
Nothofagus obliqua TP 20<=>30 7 28 – Double test: no prechill and –
prechill 28 d
Nothofagus procera TP 20<=>30 7 28 – – –


1 2 3 4 5 6 7 8
Picea abies, TP 20<=>30 7 21 – – –
Picea engelmannii,

Picea koyamai,
Picea mariana,
Picea omorika,
Picea orientalis,
Picea polita,
Picea pungens,
Picea rubens
Picea glauca, TP 20<=>30 7 21 – Double test: no prechill and –
Picea glehnii, prechill 21 d
Picea jezoensis,
Picea sitchensis
Pinus albicaulis TP 20<=>30 7 28 Prechill 28 d – –
Pinus aristata TP 20<=>30 7 14 – – –
Pinus banksiana TP 20<=>30 7 14 – – –
Pinus bruita TP 20 7 28 – – –
Pinus canariensis TP 20 7 28 – – –
Pinus caribaea TP 20<=>30 7 21 – – –
Pinus cembra S 20<=>30 7 28 Prechill 6–9 months – TTZ (or EET)
advisable
Pinus cembroides S 20 7 28 Prechill 21 d – –
Pinus clausa TP; (TS) 20 7 21 – – Sensitive to excess
moisture
Pinus contorta TP 20<=>30 7 21 – Double test: no prechill and –
prechill 21 d
Pinus coulteri S 20<=>30 7 28 Prechill 60–90 d – TTZ (or EET)

advisable
Pinus densiflora TP 20<=>30 7 21 Prechill 14 d – –
Pinus echinata TP 20<=>30 7 28 – – –
Pinus edulis TP 20<=>30 7 28 Light for 16 h or more – –
Pinus elliottii TP 20<=>30; 22 7 28 – Double test: no prechill and –
prechill 14 d
Pinus flexilis TP 20<=>30 7 21 Prechill 21 d – –

5-37

5-38
1 2 3 4 5 6 7 8
Pinus glabra TP 20<=>30 7 21 Prechill 21 d – –
Pinus halepensis TP 20 7 28 – – –
Pinus heldreichii TP 20<=>30 7 28 Prechill 42 d – TTZ (or EET)
advisable
Pinus jeffreyi TP; (S) 20<=>30 7 28 Prechill 28 d – For deeply dormant

seeds use TTZ (or
EET)
Pinus kesiya TP 20<=>30 7 21 – – –
Pinus koraiensis S 20<=>30 7 28 Pretreat 2 months at 25 °C followed by 3 – TTZ (or EET)
months at 1 to 5 °C advisable
Pinus lambertiana TP; (S) 20<=>30 7 28 Prechill 60–90 d – TTZ (or EET)
advisable
Pinus merkusii TP 20<=>30 7 21 – – –
Pinus monticola TP 20<=>30 7 28 Prechill 60–90 d – TTZ (or EET)
advisable
Pinus mugo TP 20<=>30 7 21 – – –
Pinus muricata TP 20<=>30 7 21 – – –
Pinus nigra TP 20<=>30 7 21 – – Seedlings may be suf-
ficiently developed to
finalise test at a 14-day
intermediate count
Pinus oocarpa TP 20<=>30 7 21 – – –

Pinus palustris S; (TP) 20 7 21 – – –
Pinus parviflora TP; (S) 20<=>30 7 28 Prechill 6–9 months TTZ (or EET)
advisable
Pinus patula TP 20; (20<=>30) 7 21 – – –
Pinus peuce TP; (S) 20<=>30 7 28 Prechill 6 months – TTZ (or EET)
advisable
Pinus pinaster TP 20 7 35 – Double test: no prechill and For deeply dormant
prechill 28 d. Light for max. seed TTZ advisable
16 h per day
Pinus pinea TP 20 7 28 Soak in water for 24 h – –


1 2 3 4 5 6 7 8
Pinus ponderosa TP 20<=>30 7 21 – Double test: no prechill and –
prechill 28 d

Pinus pumila S 20<=>30 7 21 Prechill 4 months – TTZ advisable
Pinus radiata TP 20 7 28 – – –
Pinus resinosa TP 20<=>30; (25) 7 14 – – –
Pinus rigida TP 20<=>30 7 14 – – –

Pinus strobus TP 20<=>30; 20 7 28 – Double test: no prechill and For deeply dormant
prechill 28 d seed TTZ advisable
Pinus sylvestris TP 20<=>30; (20) 7 21 Eastern and Mediterranean provenances – –

may require prechill 21 d
Pinus tabuliformis TP 20<=>30 7 14 – – –

Pinus taeda TP 20<=>30; 22 7 28 – Double test: no prechill and –
prechill 28 d
Pinus taiwanensis TP 20<=>30 7 21 – – –

Pinus thunbergii TP 20<=>30 7 21 – – –
Pinus virginiana TP 20<=>30 7 21 – – –
Pinus wallichiana TP 20<=>30 7 28 – – –
(P. excelsa)
Platanus spp. TP 20<=>30 7 21 – – –
Platycladus orientalis TP 20 7 21 – – –
Populus spp. TP 20<=>30 3 10 – – –
Prunus avium, S 20<=>30; (20) 7 28 Prechill 3–4 months – TTZ (or EET)
Prunus padus, advisable
Prunus serotina
Pseudotsuga menziesii TP 20<=>30 7 21 – Double test: no prechill and –
prechill 21 d
Pyrus spp. S 20<=>30 7 28 Prechill 3–4 months – TTZ (or EET)

advisable
Quercus spp. TS; (S) 20 7 28 Soak seed in water for 48 h, cut off at scar – –
end of seed and remove pericarp
5-39

5-40
1 2 3 4 5 6 7 8
Robinia pseudoacacia TP 20<=>30 7 14 1. Pierce seed; or chip or file off fragment – –
of testa at cotyledon end; then soak in
water for 3 h

running water)
Rosa spp. (except R. S 20 35 70 Prechill for 12 months – TTZ advisable

multiflora)
Rosa multiflora T 10<=>30 7 28 Prechill 28 d – TTZ advisable
Salix spp. TP 20<=>30 7 14 – – –
Sequoia sempervirens TP 20<=>30 7 21 – – –
Sequoiadendron TP 20<=>30 7 28 – – –
giganteum
Sorbus spp. S 20<=>30 7 28 Prechill 4 months – TTZ advisable
Spartium junceum TP 20 7 14 Pierce seed; or chip or file off fragment of – –
testa at cotyledon end; then soak in water
for 3 h
Styphnolobium japonica – – – – – Use TTZ –

Syringa reflexa TP 20 7 21 – Double test: no prechill and –
prechill 27 d
Syringa villosa TP 20<=>30 7 21 – – –

Syringa vulgaris TP 20 7 21 – – –
Taxodium distichum S 20<=>30 (20) 7 28 Prechill 30 d – For deeply dormant
seeds TTZ advisable
Taxus spp. S 20<=>30 7 28 Prechill 9 months – TTZ advisable

Tectona grandis S 30 14 28 Soak in water and allow to dry for 3 d. – –
Repeat this 6 times
Thuja occidentalis TP 20<=>30 7 21 – – –
Thuja plicata TP 20<=>30 7 21 – – –
Tilia cordata, S 20<=>30 7 28 Prechill 6–9 months – TTZ (or EET)
Tilia platyphyllos advisable

1 2 3 4 5 6 7 8
Tsuga canadensis TP 15 7 28 Prechill 28 d – –
Tsuga heterophylla TP 20 7 35 – Double test: no prechill and –

prechill 21 d
Ulmus americana, TP 20<=>30; (20) 7 14 Pericarp may be removed – –

Ulmus parviflora,
Ulmus pumila
Viburnum opulus – – – – – Use TTZ –
Zelkova serrata TP 10<=>30 7 28 – Double test: no prechill and –
prechill 14 d
5-41

Table 5A Part 3. Detailed methods for germination tests: Flower, spice, herb and medicinal species
5-42
Species Substrate Temperature* First count (d) Final count (d) Recommendations for breaking dormancy
(°C)
1 2 3 4 5 6
Abutilon ×hybridum TP; BP 20<=>30; 20 5–7 21 –
Achillea clavennae TP; BP 20<=>30; 20 5 14 Light
Achillea filipendulina TP; BP 20<=>30; 20 5 14 Light
Achillea ptarmica TP; BP 20<=>30; 20 5 14 Light
Achillea umbellata TP; BP 20<=>30; 20 5 14 Light
Adonis vernalis TP; BP 15; 10 7–14 35 KNO3; prechill

Ageratum houstonianum TP 20<=>30; 20 3–5 14 –
Agrimonia eupatoria TP 20<=>30 7–14 60 Soak in water for 24 h; chip or file off fragment of testa
Alcea rosea TP; BP 20<=>30; 20 4–7 21 Pierce seed; or chip or file off fragment of testa at cotyledon end
Althaea hybrids TP; BP 20<=>30; 20 4–7 21 Pierce seed; or chip or file off fragment of testa at cotyledon end
Althaea officinalis TP; BP 20<=>30; 20 4–7 21 –

Alyssum argenteum TP 20<=>30; 20; 15 4–7 21 KNO3; prechill
Alyssum montanum TP 20<=>30; 20; 15 4–7 21 KNO3; prechill
Amaranthus caudatus TP 20<=>30; 20 4–5 14 KNO3; prechill
Amaranthus cruentus TP 20<=>30; 20 4–5 14 KNO3; prechill
Amaranthus hybridus TP 20<=>30; 20 4–5 14 KNO3; prechill
Amaranthus tricolor TP 20<=>30; 20 4–5 14 KNO3; prechill
Amberboa moschata TP; BP 20<=>30; 20; 15 4–7 21 Prechill
Ammobium alatum TP; BP 20<=>30; 20 5–7 14 –
Anagallis arvensis TP 20<=>30; 15 7–10 21 KNO3; prechill
Anchusa azurea TP; BP 20<=>30; 20 5–7 21 –
Anchusa capensis TP; BP 20<=>30; 15 5–7 21 –
Anemone coronaria TP 20; 15 7–14 28 Prechill
Anemone pulsatilla TP 20; 15 7–14 28 Prechill
Anemone sylvestris TP 20; 15 7–14 28 Prechill
Angelica archangelica TP; BP 20<=>30 7–10 28 Prechill; light
Antirrhinum majus TP 20<=>30; 20 5–7 21 KNO3; prechill
Aquilegia alpina TP; BP 20<=>30; 15 7–14 28 Prechill; light
Aquilegia canadensis TP; BP 20<=>30; 15 7–14 28 Prechill; light
Aquilegia chrysantha TP; BP 20<=>30; 15 7–14 28 Prechill; light
Aquilegia ×cultorum TP; BP 20<=>30; 15 7–14 28 Prechill; light
Aquilegia vulgaris TP; BP 20<=>30; 15 7–14 28 Prechill; light
Arabis alpina TP 20<=>30; 15 5–7 21 KNO3; prechill
Arabis ×arendsii TP 20<=>30; 15 5–7 21 KNO3; prechill

Table 5A Part 3. Detailed methods for germination tests: Flower, spice, herb and medicinal species (continued)
(°C)
1 2 3 4 5 6
Arabis blepharophylla TP 20<=>30; 15 5–7 21 KNO3; prechill
Arabis caucasica TP 20<=>30; 15 5–7 21 KNO3; prechill
Arabis procurrens TP 20<=>30; 15 5–7 21 KNO3; prechill

Arabis scopoliana TP 20<=>30; 15 5–7 21 KNO3; prechill
Arctotis stoechadifolia TP; BP 20<=>30; 20; 15 7 21 Light
Armeria maritima TP; BP 20<=>30; 15 4–7 21 KNO3
Artemisia absinthium TP 20<=>30 4–7 21 –
Artemisia dracunculus TP 20<=>30 4–7 21 –

Artemisia maritima TP 20<=>30 4–7 21 –
Artemisia vulgaris TP 20<=>30 4–7 21 –
Asclepias tuberosa TP 20<=>30 7 28 –
Asparagus aethiopicus TP; BP; S 20<=>30; 20 7–14 35 Soak in water for 24 h
Asparagus plumosus TP; BP; S 20<=>30; 20 7–14 35 Soak in water for 24 h
Aster alpinus TP 20<=>30; 20 3–5 14 Prechill
Aster amellus TP 20<=>30; 20 3–5 14 Prechill
Aster dumosus TP 20<=>30; 20 3–5 14 Prechill
Aubrieta deltoidea TP 20; 15; 10 7 21 Prechill
Aurinia saxatilis TP 20<=>30; 20; 15 4–7 21 KNO3; prechill
Bassia scoparia TP; BP 20<=>30; 20 3–5 14 GA3; prechill
Begonia Semperflorens-Cul- TP 20<=>30; 20 7–14 21 Prechill
torum Group
Begonia ×tuberhybrida TP 20<=>30; 20 7–14 21 Prechill
Bellis perennis TP 20<=>30; 20 4–7 14 Prechill
Brachyscome iberidifolia TP 20<=>30; 15 4–7 14 –
Briza maxima TP 20<=>30; 20 4–7 21 Prechill
Browallia viscosa TP; BP 20<=>30; 20 7 21 –
Brunnera macrophylla TP; BP 20<=>30; 20 7 21 –
Calceolaria ×herbeohybrida TP 20<=>30; 15 7 21 KNO3; prechill
Calceolaria polyrrhiza TP 20<=>30; 15 7 21 KNO3; prechill
Calendula officinalis TP; BP 20<=>30; 20 4–7 14 Prechill; KNO3; light
Callistephus chinensis TP 20<=>30; 20 4–7 14 Light
Campanula carpatica TP; BP 20<=>30; 20 4–7 21 Prechill; light
Campanula fragilis TP; BP 20<=>30; 20 4–7 21 Prechill; light
Campanula garganica TP; BP 20<=>30; 20 4–7 21 Prechill; light
Campanula glomerata TP; BP 20<=>30; 20 4–7 21 Prechill; light
Campanula lactiflora TP; BP 20<=>30; 20 4–7 21 Prechill; light
5-43

5-44
(°C)
1 2 3 4 5 6
Campanula medium TP; BP 20<=>30; 20 4–7 21 Prechill; light
Campanula persicifolia TP; BP 20<=>30; 20 4–7 21 Prechill; light
Campanula portenschlagiana TP; BP 20<=>30; 20 4–7 21 Prechill; light
Campanula pyramidalis TP; BP 20<=>30; 20 4–7 21 Prechill; light
Campanula rapunculus TP; BP 20<=>30; 20 4–7 21 Prechill; light
Celosia argentea TP 20<=>30; 20 3–5 14 Prechill

Centaurea benedicta TP; BP; S 20<=>30 7 21 Prechill
Centaurea cyanus TP; BP 20<=>30; 20; 15 4–7 21 Prechill; light
Centaurea gymnocarpa TP; BP 20<=>30; 20; 15 4–7 21 Prechill; light
Centaurea imperialis TP; BP 20<=>30; 20; 15 4–7 21 Prechill; light
Centaurea macrocephala TP; BP 20<=>30; 20; 15 4–7 21 Prechill; light
Centaurea montana TP; BP 20<=>30; 20; 15 4–7 21 Prechill; light
Centaurea ragusina TP; BP 20<=>30; 20; 15 4–7 21 Prechill; light
Cerastium tomentosum TP; BP 20<=>30; 20 4–7 21 KNO3
Chelidonium majus TP 20<=>30 7–14 28 Prechill
Chrysanthemum indicum TP; BP 20<=>30; 20 4–7 21 Prechill; light
Clarkia amoena TP; BP 20<=>30; 15 4–7 14 Prechill; light
Clarkia pulchella TP 20<=>30; 15 3–5 14 Prechill; light
Clarkia unguiculata TP 20<=>30; 15 3–5 14 Prechill; light
Cleome hassleriana TP 20<=>30; 20 7 28 KNO3
Cobaea scandens TP; BP 20<=>30; 20 4–7 21 –
Coix lacrymajobi BP 20<=>30 7–10 21 –
Coleostephus multicaulis TP; BP 20<=>30; 20 4–7 21 Prechill; light
Consolida ajacis TP; BP 20; 15; 10 7–10 21 Prechill
Consolida regalis TP; BP 20; 15; 10 7–10 21 Prechill
Convolvulus tricolor TP; BP 20<=>30; 20 4–7 14 Pierce seed; or chip or file off fragment of testa
Coreopsis basalis TP; BP 20<=>30; 20 4–7 14 KNO3; prechill; light
Coreopsis lanceolata TP; BP 20<=>30; 20 4–7 14 KNO3; prechill; light
Coreopsis maritima TP; BP 20<=>30; 20 4–7 14 KNO3; prechill; light
Coreopsis tinctoria TP 20<=>30; 20 4–7 14 KNO3; prechill
Cosmos bipinnatus TP; BP 20<=>30; 20 3–5 14 KNO3; prechill; light
Cosmos sulphureus TP; BP 20<=>30; 20 3–5 14 KNO3; prechill; light
Cyclamen persicum TP; BP; S 20; 15 14–21 35 KNO3; soak in water for 24 h
Cymbalaria muralis TP 15; 10 4–7 21 Prechill
Cynoglossum amabile TP; BP 20<=>30; 20 4–7 14 KNO3; prechill; light

(°C)
1 2 3 4 5 6
Dahlia pinnata TP; BP 20<=>30; 20; 15 4–7 21 Prechill
Datura metel TP; BP; S 20<=>30; 20 5–7 21 File hard seeds; prechill
Datura stramonium TP; BP; S 20<=>30; 20 5–7 21 File hard seeds; prechill

Delphinium ×belladonna TP; BP 20<=>15; 10 7–10 21 Prechill; light
Delphinium cardinale TP; BP 20; 15; 10 7–10 21 Prechill
Delphinium ×cultorum TP; BP 20; 15; 10 7–10 21 Prechill; light
Delphinium formosum TP; BP 20<=>15; 10 7–10 21 Prechill; light
Delphinium grandiflorum TP; BP 20; 15; 10 7–10 21 Prechill; light

Dianthus barbatus TP; BP 20<=>30; 20 4–7 14 Prechill
Dianthus caryophyllus TP; BP 20<=>30; 20 4–7 14 Prechill
Dianthus chinensis TP; BP 20<=>30; 20 4–7 14 Prechill
Dianthus deltoides TP; BP 20<=>30; 20 4–7 14 Prechill
Dianthus plumarius TP; BP 20<=>30; 20 4–7 14 Prechill
Digitalis lanata TP 20<=>30; 20 4–7 14 Prechill
Digitalis purpurea TP 20<=>30; 20 4–7 14 Prechill
Dimorphotheca pluvialis TP; BP 20<=>30; 15 4–7 14 KNO3; prechill; light
Dimorphotheca tragus TP; BP 20<=>30; 20; 15 4–7 14 KNO3; prechill; light
Doronicum orientale TP 20<=>30; 20 4–7 21 KNO3; prechill
Dorotheanthus bellidiformis TP; BP 20; 15 5–7 35 KNO3; prechill
Echinacea purpurea TP; BP 20<=>30; 20 4–7 21 Prechill; light
Echinops ritro TP; BP 20<=>30 7–14 21 –
Echium candicans TP; BP 20<=>30; 20 4–7 14 –
Echium plantagineum TP; BP 20<=>30; 20 4–7 14 –
Erigeron speciosus TP 20<=>30; 20 7 28 –
Erysimum cheiri TP 20<=>30; 20; 15 4–5 14 KNO3; prechill; light
Erysimum ×marshallii TP 20<=>30; 20; 15 4–7 14 KNO3; prechill
Eschscholzia californica TP; BP 15; 10 4–7 14 KNO3
Fatsia japonica TP 20<=>30; 20 7–14 28 –
Freesia refracta TP; BP 20; 15 7–10 35 Pierce seed; or chip or file off fragment of testa; prechill
Gaillardia aristata TP; BP 20<=>30; 20 4–7 21 Prechill; light

Gaillardia pulchella TP; BP 20<=>30; 20 4–7 21 Prechill; light
Galega officinalis TP; BP 20<=>30; 20 3–5 14 Soak in water for 24 h
Galeopsis segetum TP; BP 20<=>30; 20 7 21 Prechill; file hard seeds
Gazania rigens TP; BP 20<=>30; 15 4–7 21 Prechill
Gentiana acaulis TP 20<=>30; 20 7–14 28 Prechill
5-45

5-46
(°C)
1 2 3 4 5 6
Geranium hybrids TP; BP 20<=>30 7 28 Pierce seed; chip or file off fragment of testa
Gerbera jamesonii TP 20<=>30; 20 4–7 14 –
Geum coccineum TP; BP 20<=>30; 20 7–10 21 Light
Geum quellyon TP; BP 20<=>30; 20 7–10 21 Light
Gilia tricolor TP; BP 20<=>30; 15 4–7 14 –
Glandularia canadensis TP 20<=>30; 15 7–10 28 KNO3; prechill

Glebionis carinata TP; BP 20<=>30; 15 4–7 21 Prechill; light
Glebionis coronaria TP; BP 20<=>30; 15 4–7 21 Prechill; light
Glebionis segetum TP; BP 20<=>30; 15 4–7 21 Prechill
Gomphrena globosa TP; BP 20<=>30; 20 4–7 14 KNO3
Goniolimon tataricum TP; BP 15; 10 5–7 21 Soak in water for 24 h
Grevillea robusta TP 20<=>30 7–10 28 KNO3; prechill
Gypsophila elegans TP; BP 20; 15 4–7 14 Light
Gypsophila paniculata TP; BP 20; 15 4–7 14 Light
Gypsophila repens TP; BP 20; 15 4–7 14 Light
Helenium autumnale TP; BP 20<=>30; 20 5 14 –
Helianthemum nummularium TP; BP 20<=>30; 20 5–7 28 KNO3
Helianthus debilis TP; BP; S 20<=>30; 20 3–5 14 Prechill
Heliopsis helianthoides TP; BP 20<=>30 4–7 21 Soak in water for 24 h; KNO3
Heliotropium arborescens TP 20<=>30; 20 7 21 –
Hesperis matronalis TP 20<=>30; 20 4–7 14 KNO3; prechill
Heteranthemis viscidehirta TP; BP 20<=>30; 20 4–7 21 Prechill
Heuchera sanguinea TP 20<=>30; 20 7 21 KNO3; prechill
Hibiscus trionum TP; BP 20<=>30 4–7 21 –
Hippeastrum hybrids TP; BP 20<=>30 7–10 28 –
Hypericum perforatum TP 20<=>30; 20 4–7 21 –
Hyssopus officinalis TP; BP 20<=>30; 20 4–7 14 Light
Iberis amara TP; BP 20<=>30; 20; 15 4–7 14 KNO3; prechill
Iberis gibraltarica TP; BP 20<=>30; 20; 15 4–7 14 KNO3; prechill
Iberis sempervirens TP; BP 20<=>30; 20; 15 4–7 14 KNO3; prechill
Iberis umbellate TP; BP 20<=>30; 20; 15 4–7 14 KNO3; prechill
Impatiens balsamina TP; BP 20<=>30; 20 4–7 21 KNO3; prechill; light
Impatiens walleriana TP; BP 20<=>30; 20 4–7 21 KNO3; prechill; light
Inula helenium TP 20<=>30; 20 7–10 28 –
Ipomoea alba TP; BP; S 20<=>30; 20 4–7 21 Pierce seed; or chip or file off fragment of testa

(°C)
1 2 3 4 5 6
Ipomoea purpurea TP; BP; S 20<=>30; 20 4–7 21 Pierce seed; or chip or file off fragment of testa
Ipomoea quamoclit TP; BP; S 20<=>30; 20 4–7 21 Pierce seed; or chip or file off fragment of testa
Ipomoea tricolor TP; BP; S 20<=>30; 20 4–7 21 Pierce seed; or chip or file off fragment of testa

Jacobaea maritima TP 20<=>30; 20 4–7 21 Prechill
Kalanchoe blossfeldiana TP 20<=>30; 20 7–14 21 –
Kalanchoe crenata TP 20<=>30; 20 14 21 –
Kalanchoe globulifera TP 20<=>30; 20 7–14 21 –
Kniphofia uvaria TP 20<=>30 4–7 21 –

Lathyrus latifolius TP; BP; S 20 7–10 21 Pierce seed; or chip or file off fragment of testa at cotyledon end; prechill
Lathyrus odoratus TP; BP; S 20 5–7 14 Prechill

Lavandula angustifolia TP; BP; S 20<=>30; 20 7–10 21 GA3; prechill
Lavatera trimestris TP; BP 20<=>30; 20 4–7 21 Prechill
Legousia speculum-veneris TP; BP 20<=>30; 20 4–7 21 Prechill; light
Leontopodium nivale TP 20<=>30; 20 5 14 Prechill
Leonurus cardiaca TP 20<=>30 5–7 42 Prechill
Leucanthemum maximum TP; BP 20<=>30; 20 4–7 21 Prechill; light
Leucanthemum vulgare TP; BP 20<=>30; 20 4–7 21 Prechill; light
Levisticum officinale TP; BP 20<=>30; 20 10 21 –
Liatris pycnostachya TP 20<=>30 5–7 28 –
Liatris spicata TP 20<=>30 5–7 28 –
Lilium regale TP; S 20<=>30; 20 7 28 –
Limonium bellidifolium TP; BP 15; 10 5–7 21 Soak in water for 24 h
Limonium bonduellei TP; BP; S 20; 15 5–7 21 Soak in water for 24 h
Limonium gerberi TP; BP 15; 10 5–7 21 Soak in water for 24 h
Limonium sinuatum TP; BP; S 15; 10 5–7 21 Soak in water for 24 h
Linaria bipartita TP 15; 10 4–7 21 Prechill
Linaria maroccana TP 15; 10 4–7 21 Prechill
Linaria vulgaris TP 15; 10 4–7 21 Prechill
Linum flavum TP; BP 20<=>30; 15 4–7 21 KNO3
Linum grandiflorum TP; BP 20; 15; 10 4–7 21 KNO3
Linum narbonense TP; BP 20<=>30; 20; 15 4–7 21 KNO3
Linum perenne TP; BP 20; 15; 10 4–7 21 KNO3
Lobelia cardinalis TP 20<=>30; 20 7–14 21 KNO3; prechill
Lobelia erinus TP 20<=>30; 20 7–14 21 KNO3; prechill
Lobularia maritima TP 20<=>30; 20; 15 4–7 21 KNO3; prechill
5-47

5-48
(°C)
1 2 3 4 5 6
Lomelosia caucasica TP; BP 20<=>30; 20; 15 4–7 21 Prechill
Lonas annua TP 20<=>30 4–5 14 –
Lunaria annua TP; BP 20; 15 7 21 KNO3; prechill
Lupinus hartwegii TP; BP; S 20<=>30; 20 4–7 21 Pierce seed; or file fragment off testa at cotyledon end; prechill
Lupinus hybrids TP; BP; S 20<=>30; 20 4–7 21 –

Lupinus nanus TP; BP; S 20<=>30; 20 4–7 21 –
Lupinus polyphyllus TP; BP; S 20<=>30; 20 4–7 21 –
Malcolmia maritima TP 20<=>30; 20; 15 4–5 14 KNO3; prechill; light
Malope trifida TP; BP 20<=>30; 20 4–7 14 Prechill
Marrubium vulgare TP 20<=>30 5–7 21 Prechill
Matricaria chamomilla TP 20<=>30; 20 4–7 14 Prechill
Matthiola incana TP 20<=>30; 20 4–7 14 KNO3; prechill
Matthiola longipetala TP 20<=>30; 20; 15 4–7 14 KNO3; prechill
Melissa officinalis TP 20<=>30; 20 4–7 21 Prechill
Mentha ×piperita TP 20<=>30 7–14 21 KNO3; prechill
Mimosa pudica TP; BP 20<=>30; 20 4–7 28 Soak in water for 24 h
Mimulus cardinalis TP 20<=>30; 20 4–7 21 Prechill
Mimulus cupreus TP 20<=>30; 20 4–7 21 Prechill
Mimulus ×hybridus TP 20<=>30; 20 4–7 21 Prechill
Mimulus luteus TP 20<=>30; 20 4–7 21 Prechill
Mirabilis jalapa TP; BP; S 20<=>30; 20 4–7 14 Prechill; light
Moluccella laevis TP; BP 20<=>30; 20 5–7 21 Prechill; light
Myosotis hybrids TP; BP 20<=>30; 20; 15 5–7 21 Prechill; light
Myosotis scorpioides TP; BP 20<=>30; 20; 15 5–7 21 Prechill; light
Myosotis sylvatica TP; BP 20<=>30; 20; 15 5–7 21 Prechill; light
Nemesia strumosa TP; BP 20; 15 5–7 21 Prechill; light
Nemesia versicolor TP; BP 20; 15 5–7 21 Prechill; light
Nemophila maculata TP; BP 15; 10 5–7 21 Prechill
Nemophila menziesii TP; BP 15; 10 5–7 21 Prechill
Nepeta cataria TP; BP 20<=>30; 20 7–14 28 Prechill
Nicotiana alata TP 20<=>30; 20 5–7 14 KNO3
Nicotiana ×sanderae TP 20<=>30; 20 5–7 14 KNO3
Nicotiana suaveolens TP 20<=>30; 20 5–7 14 KNO3
Nierembergia hippomanica TP 20<=>30; 20 5–7 21 –
Nigella damascena TP; BP 20<=>30; 20; 15 7–10 21 KNO3; prechill; 15 °C dark for 14 d then 20<=>30 °C

(°C)
1 2 3 4 5 6
Nigella hispanica TP; BP 20<=>30; 20; 15 7–10 21 KNO3; prechill; 15 °C dark for 14 d then 20<=>30 °C
Nigella sativa TP; BP 20<=>30; 20 7–10 21 KNO3; prechill
Oenothera macrocarpa TP; BP 20<=>30; 20 4–7 21 KNO3

Osteospermum ecklonis TP; BP 20<=>30; 20 4–7 14 KNO3; prechill; light
Papaver alpinum TP 15; 10 4–7 14 KNO3
Papaver glaucum TP 15; 10 4–7 14 KNO3; light
Papaver nudicaule TP 15; 10 4–7 14
KNO3; light
Papaver orientale TP 20<=>30; 20 4–7 14 KNO3; prechill
Papaver rhoeas TP 20<=>30; 20; 15 4–7 14 KNO3; prechill; light
Pelargonium Zonale Group TP; BP 20<=>30; 20 7 28 Pierce seed; or file off fragment of testa
Penstemon barbatus TP 20<=>30; 15 7 21 Prechill
Penstemon hartwegii TP 20<=>30; 15 7 21 Prechill
Penstemon hybrids TP 20<=>30; 15 7 21 Prechill
Pericallis cruenta TP 20<=>30; 20 4–7 21 Prechill
Perilla frutescens TP; BP 20<=>30; 20 5–7 21 Prechill
Petunia ×atkinsiana TP 20<=>30; 20 5–7 14 KNO3; prechill
Phacelia campanularia TP; BP 15; 10 3–5 21 KNO3; prechill
Phlox drummondii TP; BP 20<=>30; 20; 15 5–7 21 KNO3; prechill
Phlox paniculata TP; BP 20; 15 5–7 21 KNO3; prechill
Phlox subulata TP; BP 20; 15 5–7 21 KNO3; prechill
Pholistoma auritum TP; BP 15; 10 5–7 21 Prechill
Physalis alkekengi TP 20<=>30 4–7 28 KNO3; prechill; light
Pimpinella major TP; BP 20<=>30 7–10 21 Prechill
Pimpinella saxifraga TP; BP 20<=>30 5–7 21 –
Plectocephalus americana TP; BP 20<=>30; 20; 15 4–7 21 Soak in water for 24 h; prechill; light
Plectranthus scutellarioides TP; BP 20<=>30; 20 5–7 21 Light
Portulaca grandiflora TP; BP 20<=>30; 20 4–7 14 KNO3; prechill; light
Primula auricula TP 20<=>30; 20; 15 7–14 28 KNO3; prechill
Primula denticulata TP 20<=>30; 20; 15 7–14 28 KNO3; prechill
Primula elatior TP 20<=>30; 20; 15 7–14 28 KNO3; prechill
Primula japonica TP 20<=>30; 20; 15 7–14 28 KNO3; prechill
Primula ×kewensis TP 20<=>30; 20; 15 7–14 28 KNO3; prechill
Primula malacoides TP 20<=>30; 20; 15 7–14 28 KNO3; prechill
Primula obconica TP 20<=>30; 20; 15 7–14 28 KNO3; prechill
Primula praenitens TP 20<=>30; 20; 15 7–14 28 KNO3; prechill
5-49

5-50
(°C)
1 2 3 4 5 6
Primula veris TP 20<=>30; 20; 15 7–14 28 KNO3; prechill
Primula vulgaris TP 20<=>30; 20; 15 7–14 28 KNO3; prechill
Psephellus dealbatus TP; BP 20<=>30; 20; 15 4–7 21 Prechill; light
Psylliostachys suworowii TP; BP 15; 10 5–7 21 Soak in water for 24 h
Ranunculus asiaticus TP; S 20; 15 7–14 28 –
Reseda odorata TP; BP 20<=>30; 15 4–7 14 Light

Rheum palmatum TP; BP 20<=>30; 20 7 21 –
Rhodanthe humboldtiana TP; BP 20<=>30; 15 7–14 21 Prechill
Rhodanthe manglesii TP; BP 20<=>30; 15 7–14 21 Prechill
Rhodanthe chlorocephala TP; BP 20<=>30; 15 7–14 21 Prechill
Rudbeckia fulgida TP; BP 20<=>30; 20 4–7 21 Prechill; light
Rudbeckia hirta TP; BP 20<=>30; 20 4–7 21 Prechill; light
Ruta graveolens TP; BP 20<=>30; 20 7 28 Prechill
Saintpaulia ionantha TP 20<=>30; 20 7–14 28 –
Salpiglossis sinuata TP; BP 20<=>30; 20 4–7 21 KNO3; prechill; light
Salvia coccinea TP 20<=>30; 20 4–7 21 Prechill
Salvia farinacea TP 20<=>30; 20 4–7 21 Prechill
Salvia officinalis TP 20<=>30; 20 4–7 21 Prechill
Salvia patens TP 20<=>30; 20 4–7 21 Prechill
Salvia pratensis TP 20<=>30; 20 4–7 21 Prechill
Salvia sclarea TP; BP 20<=>30; 20 4–7 21 Prechill
Salvia splendens TP 20<=>30; 20 4–7 21 Prechill
Salvia viridis TP 20<=>30; 20 4–7 21 Prechill
Sanvitalia procumbens TP; BP 20<=>30; 20 3–5 14 Prechill
Saponaria calabrica TP; BP 15; 10 4–7 21 Prechill; light
Saponaria ocymoides TP; BP 15; 10 4–7 21 Prechill; light
Saponaria officinalis TP; BP 15; 10 4–7 21 Prechill; light
Scabiosa atropurpurea TP; BP 20<=>30; 20 4–7 21 Prechill
Schefflera elegantissima TP; BP 20<=>30 7–14 28 –
Schizanthus pinnatus TP; BP 15; 10 4–7 14 Prechill
Senecio elegans TP 20<=>30; 20 4–7 21 Prechill
Silene chalcedonica TP 20<=>30; 20 5–10 21 Light
Silene coronaria TP 20<=>30 5–10 21 –
Silene pendula TP; BP 20<=>30; 20 7–14 28 KNO3
Silybum marianum TP; BP 20<=>30; 20 5–7 21 Prechill

(°C)
1 2 3 4 5 6
Sinningia speciosa TP 20<=>30; 20 7–14 28 Prechill
Solanum pseudocapsicum TP; BP 20<=>30; 20 5–7 28 KNO3; light
Solanum giganteum TP; BP 20<=>30; 20 5–7 28 KNO3; light

Solanum laciniatum TP 20<=>30; 20 5–7 28 KNO3
Solanum marginatum TP; BP 20<=>30; 20 5–7 28 KNO3; light
Stachys macrantha TP 20 7 14 –
Tagetes erecta TP; BP 20<=>30; 20 3–5 14 Light
Tagetes patula TP; BP 20<=>30; 20 3–5 14 Light

Tagetes tenuifolia TP; BP 20<=>30; 20 3–5 14 Light
Tanacetum achilleifolium TP; BP 20<=>30; 15 4–7 21 Prechill; light
Tanacetum cinerariifolium TP; BP 20<=>30; 20 4–7 21 Prechill
Tanacetum coccineum TP; BP 20<=>30; 15 4–7 21 KNO3; prechill; light
Tanacetum parthenium TP; BP 20<=>30; 20 4–7 21 Prechill; light
Thunbergia alata TP; BP 20<=>30; 20 4–7 21 –
Thymus serpyllum TP; BP 20<=>30; 20; 15 7 21 Light
Torenia fournieri TP 20<=>30 5–7 14 KNO3
Tripleurospermum maritimum TP 20<=>30; 20 4–7 14 Prechill
Tripleurospermum inodorum TP 20<=>30; 20 4–7 14 Prechill
Tropaeolum majus TP; BP; S 20<=>30; 20; 15 4–7 21 Prechill
Tropaeolum peltophorum TP; BP; S 20; 15 4–7 21 Prechill
Tropaeolum peregrinum TP; BP; S 20; 15 4–7 21 Prechill
Vaccaria hispanica TP; BP 15<=>10 4–7 21 Prechill; light
Valeriana officinalis TP 20<=>30; 20 5–7 21 Prechill
Verbascum densiflorum TP 20<=>30 4–7 21 Prechill
Verbascum phlomoides TP 20<=>30 4–7 21 Prechill
Verbascum thapsus TP 20<=>30 4–7 21 Prechill
Verbena bonariensis TP 20<=>30; 15 7–10 28 KNO3; prechill
Verbena Hybrida Group TP 20<=>30; 20; 15 7–10 28 KNO3; prechill
Verbena rigida TP 20<=>30; 15 7–10 28 KNO3; prechill
Vinca minor TP 20<=>30; 20 4–7 14 –
Viola cornuta TP 20<=>30; 20 4–7 21 KNO3; prechill
Viola odorata TP 20; 10 4–7 21 KNO3; prechill
Viola tricolor TP 20<=>30; 20 4–7 21 KNO3; prechill
Xeranthemum annuum TP; BP 20<=>30; 20 4–7 14 –
Xerochrysum bracteatum TP; BP 20<=>30; 15 4–7 14 KNO3; prechill; light
5-51

5-52
(°C)
1 2 3 4 5 6
Zinnia elegans TP; BP 20<=>30; 20 3–5 10 Prechill; light
Zinnia haageana TP; BP 20<=>30; 20 3–5 10 Prechill; light

5.11 Tolerance tables To determine whether tests are compatible, calculate

the average of the test results to the nearest whole num-
Table 5B gives the maximum tolerated differences be- ber. Locate this in the appropriate part of the table for the
tween the highest and lowest germination percentages of number of seeds tested, and read off the tolerance in the
the replicates of a germination test, allowing only for ran- adjoining column. If the difference between the highest
dom sampling variation at a probability of 0.025. and lowest results of the tests does not exceed the toler-
To determine whether a test is reliable, calculate the ance, the tests are compatible.
average germination percentage over all replicates, to the The sources for tolerances are as follows:
nearest whole number. If necessary, in tests of 400 or 200 – tests with 2 × 400 seeds: extracted from Table G2,
seeds, four or two replicates, respectively, of 100 seeds column L, in Miles (1963);
each can be formed by combining the subreplicates of 50 – tests with 2 × 200 and 2 × 100 seeds: derived from
or 25 seeds which were closest together in the germina- Miles (1963);
tor. In tests of 100 seeds, two replicates of 50 seeds each – tests with 3 × 400 seeds: extracted from Table G2,
can be formed by combining the subreplicates of 25 seeds column H, in Miles (1963);
which were closest together in the germinator, and mul- – tests with 3 × 200 and 3 × 100 seeds: derived from
tiplying the results of each of the two replicates by 2 to Miles (1963);
obtain an average germination percentage. – tests with 4 × 400 seeds: extracted from Table G2,
Locate the average germination percentage in the ap- column D, in Miles (1963);
propriate part of the table for the number of seeds tested, – tests with 4 × 200 and 4 × 100 seeds: derived from
and read off the tolerance in the adjoining column. If the Miles (1963).
difference between the highest and lowest replicates does
not exceed this tolerance, the test is reliable. Miles, S. R. (1963). Hand book of Tolerances and of
The tolerances for tests with 400 and 200 seeds are Measures of Precision for Seed Testing. Proceedings of
extracted from Table G1, columns D and L respectively, in the International Seed Testing Association, 28 (3).
Miles (1963). The tolerances for tests with 100 seeds are
calculated in accordance to Miles (1963).
Tables 5C–5E give the tolerances for percentages of
normal seedlings, abnormal seedlings, dead seeds, hard
seeds, fresh seeds or any combination of these, when tests
are made on the same or a different submitted sample in
the same laboratory. For two tests, use Table 5C, for three,
Table 5D, and for four, Table 5E.
Table 5F gives the tolerances for percentages of nor-
mal seedlings, abnormal seedlings, dead seeds, hard
seeds, fresh seeds or any combination of these, when tests
are made on the same or a different submitted sample in
two different laboratories. For tolerances between results
of more than two laboratories or on tests of less than 400
seeds, see the Germination tolerances calculator in the
Germination Committee Toolbox on the ISTA website.

Table 5B. Tolerances between highest and lowest germi- Table 5B Part 3. 2 replicates of 50 seeds
nation percentages of replicates in one germination test
(two-way test at the 2.5 % significance level) Average germination percentage of test Tolerance
51–100 % 0–50 %
Table 5B Part 1. 4 replicates of 100 seeds 99 2 5
98 3 7
Average germination percentage of test Tolerance 97 4 8
51–100 % 0–50 % 96 5 9
99 2 5 95 6 10
98 3 6 94 7 11
97 4 7 92–93 8–9 12
96 5 8 90–91 10–11 13
95 6 9 89 12 14
93–94 7–8 10 86–88 13–15 15
91–92 9–10 11 84–85 16–17 16
89–90 11–12 12 81–83 18–20 17
87–88 13–14 13 78–80 21–23 18
84–86 15–17 14 74–77 24–27 19
81–83 18–20 15 70–73 28–31 20
78–80 21–23 16 63–69 32–38 21
73–77 24–28 17 51–62 39–50 22
67–72 29–34 18
56–66 35–45 19
51–55 46–50 20
Table 5B Part 2. 2 replicates of 100 seeds
Average germination percentage of test Tolerance

51–100 % 0–50 %
99 2 4
98 3 5
96–97 4–5 6
95 6 7
93–94 7–8 8
90–92 9–11 9
88–89 12–13 10
84–87 14–17 11
81–83 18–20 12
76–80 21–25 13
69–75 26–32 14
55–68 33–46 15
51–54 47–50 16

Table 5C. Tolerances between results of two tests on the Table 5D. Tolerances between results of three tests on the
same or a different submitted sample when tests are made same or a different submitted sample when tests are made
in the same laboratory (two-way test at the 2.5 % signifi- in the same laboratory (two-way test at the 2.5 % signifi-
cance level) cance level)
Table 5C Part 1. 2 tests of 400 seeds Table 5D Part 1. 3 tests of 400 seeds
Average germination percentage of 2 tests Tolerance Average germination percentage of 3 tests Tolerance
51–100 % 0–50 % 51–100 % 0–50 %
98–99 2–3 2 99 2 2
95–97 4–6 3 97–98 3–4 3
91–94 7–10 4 94–96 5–7 4
85–90 11–16 5 90–93 8–11 5
77–84 17–24 6 85–89 12–16 6
60–76 25–41 7 78–84 17–23 7
51–59 42–50 8 66–77 24–35 8
51–65 36–50 9
Table 5C Part 2. 2 tests of 200 seeds
Table 5D Part 2. 3 tests of 200 seeds
Average germination percentage of 2 tests Tolerance
51–100 % 0–50 % Average germination percentage of 3 tests Tolerance
99 2 2 51–100 % 0–50 %
98 3 3 99 2 3
96–97 4–5 4 97–98 3–4 4
94–95 6–7 5 96 5 5
91–93 8–10 6 94–95 6–7 6
87–90 11–14 7 91–93 8–10 7
82–86 15–19 8 88–90 11–13 8
75–81 20–26 9 84–87 14–17 9
64–74 27–37 10 79–83 18–22 10
51–63 38–50 11 72–78 23–29 11
60–71 30–41 12
51–59 42–50 13
Table 5C Part 3. 2 tests of 100 seeds
Average germination percentage of 2 tests Tolerance Table 5D Part 3. 3 tests of 100 seeds
51–100 % 0–50 %
99 2 4 Average germination percentage of 3 tests Tolerance
98 3 5 51–100 % 0–50 %
96–97 4–5 6 99 2 4
95 6 7 98 3 5
93–94 7–8 8 97 4 6
90–92 9–11 9 96 5 7
88–89 12–13 10
95 6 8
84–87 14–17 11 93–94 7–8 9
81–83 18–20 12 91–92 9–10 10
76–80 21–25 13 89–90 11–12 11
69–75 26–32 14 87–88 13–14 12
55–68 33–46 15 84–86 15–17 13
51–54 47–50 16 81–83 18–20 14
77–80 21–24 15
71–76 25–30 16
64–70 31–37 17
51–63 38–50 18

Table 5E. Tolerances between results of four tests on the Table 5F. Tolerances between results of two tests made
same or a different submitted sample when tests are made in different laboratories on the same or different samples
in the same laboratory (two-way test at the 2.5 % signifi- from the same seed lot (two-way test at 5 % significance
cance level) level) on 400 seed tests. Updated by ISTA Statistics Tech-
nical Committee, based on Miles (1963) Table G5, column
Table 5E Part 1. 4 tests of 400 seeds C, 400 seed tests.
Average germination percentage of 4 tests Tolerance Average germination percentage of 2 tests Tolerance
51–100 % 0–50 % 51–100 % 0–50 %
99 2 2 99 2 2
97–98 3–4 3 98 3 3
95–96 5–6 4 96–97 4–5 4
92–94 7–9 5 94–95 6–7 5
88–91 10–13 6 91–93 8–10 6
82–87 14–19 7 88–90 11–13 7
74–81 20–27 8 84–87 14–17 8
60–73 28–41 9 79–83 18–22 9
51–59 42–50 10 74–78 23–27 10
68–73 28–33 11
60–67 34–41 12
Table 5E Part 2. 4 tests of 200 seeds
51–59 42–50 13
51–100 % 0–50 %
99 2 3
98 3 4
97 4 5
95–96 5–6 6
93–94 7–8 7
90–92 9–11 8
87–89 12–14 9
83–86 15–18 10
78–82 19–23 11
72–77 24–29 12
61–71 30–40 13
51–60 41–50 14
Table 5E Part 3. 4 tests of 100 seeds

51–100 % 0–50 %
99 2 5
98 3 6
97 4 7
96 5 8
95 6 9
93–94 7–8 10
91–92 9–10 11
89–90 11–12 12
87–88 13–14 13
84–86 15–17 14
81–83 18–20 15
78–80 21–23 16
73–77 24–28 17
68–72 29–33 18
56–67 34–45 19
51–55 46–50 20

International Rules for Seed Testing Chapter 6: The tetrazolium test
Chapter 6: Biochemical test for viability: the

topographical tetrazolium test
6.1 Object 6.3 General principles

The objects of biochemical tests are: In the topographical tetrazolium test a colourless solution
a) To make a quick estimate of the viability of seed sam- of 2,3,5-triphenyl tetrazolium chloride or bromide is used
ples in general and those showing dormancy in particular. as an indicator to reveal the reduction processes which
b) In the case of particular samples which at the end of take place within living cells. The indicator is imbibed by
a germination test reveal a high percentage of dormant the seed. Within the seed tissues it interacts with the reduc-
seeds (5.6.5), to determine the viability of individual dor- tion processes of living cells and accepts hydrogen from
mant seeds or the viability of a working sample. the dehydrogenases. By hydrogenation of the 2,3,5-triph-
enyl tetrazolium chloride a red, stable and non-diffusible
substance, triphenyl formazan, is produced in living cells.
6.2 Definition This makes it possible to distinguish the red-coloured liv-
ing parts of seeds from the colourless dead ones.
The Topographical Tetrazolium Test is a biochemical test In addition to completely stained viable seeds and
that may be used to make a rapid assessment of seed vi- completely unstained non-viable seeds, partially stained
ability: when seeds have to be sown shortly after harvest; seeds may occur. Varying proportions of necrotic tissue
in seeds with deep dormancy; in seeds showing slow are found in different zones of these partially stained
germination; or in cases where a very quick estimate of seeds. The position and size of the necrotic areas, and not
germination potential is required. It can also be used: to necessarily the intensity of the colour, determine whether
determine the viability of individual seeds at the end of a such seeds are classified as viable or non-viable. However,
germination test, especially where dormancy is suspected colour differences along with tissue soundness are to be
(see 5.6.3); to detect the presence of sprouting and vari- considered decisive mainly to the extent that they permit
ous types of harvesting and/or processing damage (heat recognition and location of sound, weak or dead tissue.
damage, mechanical damage, insect damage); and to solve
problems encountered in a germination test, e.g. when rea-
sons for abnormals are not clear, treatment with pesticides 6.4 Reagent
is suspected, etc.
A viable seed should show staining in all those tissues 6.4.1 Tetrazolium solution
whose viability is necessary for normal seedling devel-
opment. Depending on the species, small unstained areas An aqueous solution of 2,3,5-triphenyl tetrazolium chlo-
in some parts of these tissues can be accepted. For the ride or bromide of pH 6.5–7.5 is used. The concentration
purposes of the test, a viable seed should show by its bio- normally used should be 1.0 %; however, lower or higher
chemical activity the potential to produce a normal seed- percentages are permissible. Distilled/deionised water
ling. A non-viable seed shows deficiencies and/or abnor- should be used in the preparation, and the tetrazolium so-
malities of such a nature as to prevent its development into lution should have a pH of between 6.5 and 7.5. If neces- Chapter 6: The tetrazolium test
a normal seedling. sary to ensure the pH is within the required range, a phos-
The test is valid for all species for which a method is phate buffer, as described in 6.4.2, should be used.
described in Table 6A. If the result is to be reported on an When using buffer the correct amount of tetrazolium
ISTA Certificate, the test must be carried out strictly in salt (either chloride or bromide) is dissolved in the buffer
accordance with the methods described in this Chapter. to obtain a solution of the correct concentration, e.g. 1 g
The tetrazolium test is a versatile tool, which may have tetrazolium salt per 100 mL buffer gives a 1 % solution.
applications other than in the issue of an ISTA Certificate. The tetrazolium solution can be stored in the dark at
Further information on such applications may be found 5–10 °C for up to one year.
in the Handbook on Tetrazolium Testing and in the ISTA
Working Sheets on Tetrazolium Testing.

Chapter 6: The tetrazolium test International Rules for Seed Testing
6.4.2 Buffer solution than that recommended, then the premoistening period
must be adjusted accordingly, and any variation in pre-
To achieve the correct pH range it may be necessary to premoistening time or temperature must be reported on the
pare the tetrazolium solution in phosphate buffer solution. ISTA Certificate.
The buffer solution should be made up as follows, us-
ing distilled/deionised water.
Prepare two solutions: 6.5.2.1.1 Slow moistening
Solution 1: dissolve 9.078 g KH2PO4 in 1000 mL dis- The seed is allowed to imbibe on top of or between paper
tilled/deionised water according to the method used for germination testing (see
Table 5A). The technique should be used for those species
Solution 2: dissolve 9.472 g Na2HPO4 in 1000 mL dis- that are inclined to fracture if immersed directly in water.
tilled/deionised water, or dissolve 11.876 g Na2HPO4 ∙ Old and dry seeds of many species may also benefit from
2H2O in 1000 mL distilled/deionised water slow moistening.
In some species, slow moistening will not result in full
Mix two parts of solution 1 with three parts of solution imbibition and a further period of soaking in water will be
2 and check the pH, which must be between 6.5 and 7.5. necessary.
6.5 Procedures 6.5.2.1.2 Soaking in water
6.5.1 Working sample Seeds should be fully immersed in water and left until
completely imbibed. If the soaking period is more than
A full test must be carried out on four replicates of 100 24 h, the water should be changed.
pure seeds drawn at random from either the pure seed frac- If the percentage of hard seeds of the Fabaceae is to be
tion of a purity test carried out as prescribed in Chapter 3, determined for the purpose of issuing an ISTA Certificate,
or from a representative fraction of the submitted sample. the seed should be soaked in water at 20 °C for 22 h. Other
The pure seed fraction must be mixed thoroughly and due procedures may lead to excessive variability in results.
care should be taken when drawing the seeds to ensure
that there is no selection of seeds that would cause biased
results (see Chapter 5 for methods of counting seeds). A 6.5.2.2 Exposure of tissues prior to staining
test may also be carried out on individual ungerminated
seeds that are found at the end of a germination test. See Figure 6.1 for details.
In many species (see Table 6A) it is necessary to ex-
pose the tissues prior to staining to allow easier penetra-
6.5.2 Preparation and treatment of the tion of the tetrazolium solution and to facilitate evalua-
seed tion. Tissues that must be critically examined to establish
the viability of a seed are considered to be ‘essential’ tis-
The seeds must be prepared in order to facilitate penetra- sues while those that are less essential for this diagnosis
tion of the tetrazolium solution. are ‘non-essential’. Procedures for exposing the internal
tissues have been standardised so that unavoidable inju-
Chapter 6: The tetrazolium test
ries caused by the preparation technique can be easily rec-

6.5.2.1 Premoistening the seed ognised as such during the evaluation.
Seed coats can be opened or removed using a variety
Premoistening is a necessary preliminary step to stain- of different preparation techniques as described below.
ing for some species and a highly recommended one for Once prepared, seeds should be kept moist until the whole
others. Imbibed seeds are generally less fragile than dry replicate has been completed. Only then should the repli-
seeds and can be cut or punctured more readily. In addi- cate be immersed in the tetrazolium solution.
tion, staining of premoistened seed is more even in colour During premoistening some kinds of seeds produce
and this facilitates evaluation. If the seed coat hampers sticky mucilage that hampers further preparation. The mu-
imbibition, the coat must be punctured (e.g. Fabaceae). cilage can be reduced either by drying the surface, rubbing
The minimum premoistening period is indicated in Table the seeds in cloth or between sheets of paper, or by soak-
6A. If a higher (40 ±2 °C) or lower temperature is used ing the seeds in a 1–2 % solution of aluminium potassium

sulphate (AlK(SO4)2 ∙ 12H2O) for 5 min after premoisten- 6.5.2.2.5 Excision of the embryo
ing for the appropriate period.
Embryo excision may be used for Hordeum, Secale and
Triticum.
6.5.2.2.1 Piercing the seed The embryo is excised with a dissecting lancet that is
thrust through the endosperm just above the scutellum and
Premoistened or hard seeds should be pierced at a non- a little off centre and then twisted slightly so that the en-
essential part of the seed using a needle or sharp scalpel. dosperm bursts lengthwise. The embryo (with scutellum)
becomes loosened from the endosperm and can be picked
up and transferred to the tetrazolium solution.
6.5.2.2.2 Longitudinal cutting
– For all cereals and grass seeds the size of Festuca spp. 6.5.2.2.6 Removal of the seed coat
or larger, a longitudinal cut should be made through
the middle of the embryonic axis and approximately When cutting techniques are inappropriate, the whole
three quarters of the length of the endosperm. seed coat (and any other covering tissues) must be re-
– For seeds of dicotyledonous species without en- moved. If the outer coverings of the seed are hard, as in
dosperm and with a straight embryo a longitudinal cut nuts and drupes (stone fruits) they can be split open or
should be made through the middle of the distal half of cracked either when the seed is dry or after premoisten-
the cotyledons, leaving the embryo axis uncut. ing, care being taken to avoid embryo damage. Leathery
– In seeds where there is an embryo surrounded by liv- seed coats can be removed after premoistening by slitting
ing tissue, a longitudinal cut can be safely made along- them carefully with a sharp scalpel or dissecting needle
side the embryo. and peeling them off.
6.5.2.2.3 Transverse cutting 6.5.2.3 Low pressure
Transverse cutting is made through non-essential tissue The low pressure method utilises subatmospheric pressure
using scalpels, razor blades, dog nail clippers or similar to quickly infiltrate seed tissues with tetrazolium solution.
devices. The dry seeds are prepared as described in Table 6A,
– Grass seeds: make a transverse cut immediately above placed in a 1 % tetrazolium solution and degassed to a
the embryo and immerse the embryo end in the tetra- subatmospheric pressure of about 18662 Pa (140 Torr) for
zolium solution. 10 min. The pressure is then increased slowly for 1 min
– Dicotyledonous seeds with a straight embryo and with- to normal atmospheric level. This treatment is repeated
out endosperm: cut off and discard a fragment of one three times.
third to two fifths of the distal end of the cotyledons.
– Coniferous seeds: cut a small fraction from both ends,
big enough to ensure that the embryo cavity is opened 6.5.3 Staining
without causing major injury to the embryo.
The prepared seeds or embryos should be completely im-
mersed in tetrazolium solution. Small seeds, which are Chapter 6: The tetrazolium test
6.5.2.2.4 Transverse incision difficult to handle, may be premoistened and prepared on
a strip of paper, which is then folded or rolled up and im-
A transverse incision may be used as a substitute for a mersed in the tetrazolium solution.
transverse cut and is the preferred method for small grass The solution should not be exposed to direct light as
seeds the size of Agrostis, Phleum and Poa. this brings about a reduction of the tetrazolium salt. Ta-
ble 6A gives details of optimum temperatures and staining
times.

Staining temperatures used may deviate from those In order to evaluate seeds properly, it is necessary to
given in Table 6A, but must be in the range of 20–40 °C. expose the embryo and other essential structures. Appro-
If the optimum staining temperature of 30 °C is not used, priate light and magnification are indispensable for proper
then suitable adjustments in staining duration must be examination. Most seeds contain essential and non-essen-
made, as an increase/decrease of 5 °C from the optimum tial tissues. Essential structures are the meristems and all
of 30 °C reduces/increases staining time by one half. structures recognised as necessary for the development
Staining periods should not be taken as absolute, because of normal seedlings. Well-developed and differentiated
they may vary according to the condition of the seed. As seeds may have the ability to repair small necroses. In this
experience is gained it may be possible to make evalua- case, superficial necrosis, of limited extent, may be toler-
tion at an earlier or later stage of staining. The staining ated even within essential tissue. Careful evaluation may
period may be prolonged if the seeds are incompletely also make it possible to distinguish different categories of
stained in order to verify if the lack of staining is due to viable and non-viable seeds.
slow uptake of tetrazolium salt rather than an indication Viability, as measured by the tetrazolium test, is a dis-
of defects within the seed. However, over staining should tinct and unique quality characteristic of a resting seed.
be avoided as this may hide differential staining patterns, Viability is clearly independent of realisation in a germi-
which are indicative of weak seed and specific damage nation test. However, there will be no significant differ-
such as that caused by frost. ence between viability and germination percentages only
For some species trace amounts of fungicides or antibi- in the case where a seed:
otics may be added to the tetrazolium solution to avoid the – is not dormant nor hard-seeded or has been properly
development of a frothy solution with a dark precipitate. pre-treated for breaking dormancy and hard-seededness;
At the end of the staining period the solution is de- – is not infected or has been properly disinfected;
canted and the seed rinsed with water and examined. – has not been sprayed in the field nor dressed during
processing or fumigated during storage with harmful
chemicals;
6.5.4 Evaluation – has not sprouted;
– has not been deteriorated during germination tests of
The main purpose of the tetrazolium test is to distinguish normal or extended duration;
viable and non-viable seeds. – has been germinated under optimal conditions.
Each seed is examined and evaluated as viable or
non-viable on the basis of the staining patterns and tis-
sue soundness revealed. Procedures for preparation, treat- 6.6 Calculation, expression of
ment and evaluation of each approved species are given in results and tolerances
6.5.2.1, Table 6A and Figures 6.1–6.3.
Whether a seed is rated viable or non-viable is derived In testing a sample, the number of seeds considered viable
directly from the importance of the different seed tissues is determined in each replicate. To check the reliability
responsible for the emergence and development of a nor- of a test result, the average percentage of the replicates
mal seedling, which is species specific. Viable seeds are is calculated to the nearest whole number and compared
those that show the potential to produce normal seedlings. with Table 6B. The result is considered reliable, if the dif-
Such seeds stain completely, or if only partly stained, the ference between the highest and the lowest replicate does
staining patterns indicate that the essential structures are not exceed the tolerance indicated. Maximum tolerated
viable. ranges for replicate differences are the same as for germi-
Non-viable seeds are those that do not meet these re- nation tests.
quirements and in addition include seeds that reveal un- To decide whether two tests, which were performed
characteristic colouring and/or flaccid essential structures. independently in the same laboratory are compatible, use
Seeds with obviously abnormal development of the em- Table 6C. When the two tests were performed in different
bryo or other essential structures must be regarded as non- laboratories, use Table 6D. For both situations the aver-
viable whether stained or not. Rudimentary embryos of age percentage viability of the two tests is calculated. The
coniferous seeds are non-viable. tests are compatible if the difference between the two re-
Hard seeds are seeds with water-impermeable seed sults does not exceed the tolerance indicated for the calcu-
coats (e.g. Fabaceae) and remain hard even after premois- lated average in the respective table.
tening. If the viability of these seeds needs to be deter-
mined, follow the instructions in Table 6A Column 8.

6.7 Reporting results 6.8 Standard procedures for

tetrazolium testing
The result of a tetrazolium test must be reported under
‘Other determinations’ as follows: Table 6A contains procedures as follows:
– The statement ‘Tetrazolium test: … % of seeds were
viable’ must be entered. Column 1: Species Where methods are described for a
– In cases where the testing procedure deviates from that group of species, only those species specifically listed
prescribed in Table 6A, any deviating procedure must in Table 2A Part 1 may be considered to be covered.
also be reported. The only variations permitted from
procedures given in Table 6A are for premoistening Column 2: Pretreatment Preparation of dry seeds, or
time, tetrazolium concentration, staining temperature premoistening at 20 °C in water (W), or between wet
or staining time. Precise prescriptions about the limita- paper (BP), or in sand (S). In the case of two possible
tion of the variations are given in 6.5. pretreatments in Table 6A Part 1, they are separated by
– If individual seeds are tested at the end of the germi- a semicolon.
nation test, the result must be reported in accordance
with 1.5.2.6 and 5.9. Column 3: Preparation before staining In some cas-
es two different preparation methods can be used. In
In addition, in the case of species of Fabaceae, one of the some cases the low-pressure method can be used to fa-
following, and only one, must be reported: cilitate the infiltration of seed tissues with tetrazolium
either (in cases where the viability percentage of the hard (TZ) solution.
seed is not determined): ‘Tetrazolium test: ... % of
seeds were viable, ... % of hard seeds found in the test.’ Column 4: Staining solution Concentration of the
or (in cases where the viability percentage of the hard tetrazolium solution (percentage).
seed is determined): ‘Tetrazolium test: ... % of seeds
were viable, ... % of hard seeds included in the per- Column 5: Optimum staining time Optimum staining
centage of viable seed’ time in hours based on a temperature of 30 ±2 °C.
At the discretion of the seed testing laboratory, further in- Column 6: Preparation for evaluation Preparation for
formation may be reported, e.g. percentage of seeds that evaluation and tissue to be observed.
were empty, with larvae, broken or decayed.
Column 7: Permitted non-viable tissue Normally all
seeds with a completely stained embryo and those
with unstained, flaccid and/or necrotic parts as noted
in column 7 are viable. The area of tissue mentioned
is the maximum area of unstained, flaccid and/or ne-
crotic tissue permitted to evaluate a seed as viable. For
some species the true endosperm, perisperm and/or
gametophyte tissue must also be completely stained.
For evaluation note that the whole seed structure has
to be taken into account, so if a portion is removed
during preparation before staining, it is considered as Chapter 6: The tetrazolium test
fully stained or as a part of the maximum area that can
be unstained.
Column 8: Remarks Additional information.

Table 6A Part 1. Standard procedures for tetrazolium testing: agricultural and horticultural seeds
6-6
Species Pretreatment: type/ Preparation before staining Staining Optimum Preparation for evaluation Permitted non-viable tissue Remarks
minimum time (h) solution staining
(%) time (h)
1 2 3 4 5 6 7 8
Agropyron spp. BP/16; W/3 Remove glumes, cut trans- 1 18 Observe external embryo ⅓ radicle –
versely near embryo surface
BP/16; W/3 Cut longitudinally 1 2 Observe cut surface ⅓ radicle –

through embryo and ¾ of

endosperm
Agrostis spp. BP/16; W/2 Pierce near embryo 1 18 Remove lemma to expose ⅓ radicle –
embryo
BP/16; W/2 Transverse incision 1 18 Remove lemma to expose ⅓ radicle –
embryo
Allium spp. W/18 Cut off thin slice at linear 1 18 Cut longitudinally from flat None, including endosperm, –
side of seed and longitudin side through endosperm to except small superficial
ally ⅔ into endosperm near expose embryo necrosis on outer part of
middle of seed between endosperm, not in connec-
radicle and cotyledons tion with embryo cavity
Alopecurus spp. BP/18; W/2 Remove glumes, cut trans- 1 18 Observe external embryo ⅓ radicle –
BP/18; W/2 Cut longitudinally 1 18 Observe external embryo ⅓ radicle –

through embryo and ¾ of surface
endosperm
Anthoxanthum BP/18 Remove glumes, cut trans- 1 18 Observe external embryo ⅓ radicle –
spp. versely near embryo surface
Arctium spp. W/18 Cut longitudinally through 1 6 Observe embryo None –

seed coat; open wide and
extract embryo
Arrhenatherum BP/16; W/3 Remove glumes, cut trans- 1 18 Observe external embryo ⅓ radicle –

endosperm

Table 6A Part 1. Standard procedures for tetrazolium testing: agricultural and horticultural seeds (cont.)
(%) time (h)
1 2 3 4 5 6 7 8
Avena spp. Remove glumes Cut seeds transversely near 1 18 Extract embryo and ob- Root area except one root * Unstained tissue at centre of
before premois- embryo serve embryo surface in- initial, ⅓ of extremities of scutellum is indicative of heat

tening BP/18; cluding back of scutellum* scutellum damage
W/18
Remove glumes Cut longitudinally 1 2 Observe external embryo Root area except one root * Unstained tissue at centre of
before premois- through embryo and ¾ of surface, cut surface, back initial, ⅓ of extremities of scutellum is indicative of heat
tening BP/18; endosperm of scutellum* scutellum damage
W/18
Brachiaria spp. BP/18; W/6 Remove glumes, cut trans- 1 18 Observe external embryo ⅓ radicle –

endosperm
Brassica spp. W/18 Incise seed coat crosswise 1 3 Observe embryo ⅓ radicle, measured from –
at one of the outer cotyle- radicle tip, ⅓ superficial
dons, avoid damaging hypo necrosis on the cotyledons
cotyl or radicle. Remove not in connection with the
seed coat by gently pressing hypocotyls
Bromus spp. BP/16; W/3 Remove glumes, cut trans- 1 18 Observe external embryo ⅓ radicle –

endosperm
Chloris gayana Remove Cut transversely near 1 6 Observe surface of em- ⅓ radicle, measured from Empty florets without caryopses
glumes before embryo bryo and scutellum radicle tip; in total ⅓ of are non-viable
premoistening extremities of scutellum
BP/16 at 10 °C;
W/3
6-7

6-8
(%) time (h)
1 2 3 4 5 6 7 8
Cucumis spp. W/18 Cut off transversally a small 1 6 Observe embryo ⅓ radicle, measured from –
part of seed at distal end. radicle tip, ½ of distal end of
Cut lateral longitudinally cotyledons
through seed coat. Remove
seed coat and thin inner

skin
Cynosurus spp. BP/16; W/3 Remove glumes, cut trans- 1 18 Observe external embryo ⅓ radicle –

endosperm
Dactylis spp. BP/18; W/2 Remove glumes, cut trans- 1 18 Observe external embryo ⅓ radicle –
Deschampsia BP/18; W/2 Remove glumes, cut trans- 1 18 Observe external embryo ⅓ radicle –
Elymus spp. BP/16; W/3 Remove glumes, cut trans- 1 18 Observe external embryo ⅓ radicle –

endosperm
Elytrigia spp. BP/16; W/3 Remove glumes, cut trans- 1 18 Observe external embryo ⅓ radicle –

endosperm
Eragrostis spp. BP* at ≤ 7 °C/18 Cut transversely near 1 18 Observe external embryo ⅓ radicle * Temperature of ≤7 °C is
embryo surface needed to avoid germination

(%) time (h)
1 2 3 4 5 6 7 8
Festuca spp. BP/16; W/3 Remove glumes, cut trans- 1 18 Observe external embryo ⅓ radicle –

endosperm
Helianthus spp. W/18 Remove pericarp and seed 1 3 Cut longitudinally through ⅓ radicle measured from –
coats from the seed cotyledons and the radicle- radicle tip, ½ of distal end of
hypocotyl axis. Observe cotyledons if superficial, ⅓
both sides of the seed of distal end of cotyledons if
pervading
Holcus spp. BP/16; W/3 Remove glumes, cut trans- 1 18 Observe external embryo ⅓ radicle –

endosperm
Hordeum vulgare W/4 Excise embryo with 1 3 Observe external embryo Root area except one root * Unstained tissue at centre of
scutellum surface, back of scutellum* initial, ⅓ of extremities of scutellum is indicative of heat
scutellum damage
W/18 Cut longitudinally 1 3 Observe external embryo Root area except one root * Unstained tissue at centre of
through embryo and ¾ of surface, cut surface, back initial, ⅓ of extremities of scutellum is indicative of heat
endosperm of scutellum* scutellum damage
Lactuca spp. Prepare dry seed, Expose the embryo by gen- 1 3 Observe embryo ⅓ radicle, measured from –
cut longitudinally tly pressing the seed coat radicle tip; ½ of distal end of
¼ through cotyledons,if superficial; ⅓
distal end of fruit at distal end, if pervading
(achene). W/18
6-9

6-10
(%) time (h)
1 2 3 4 5 6 7 8
Lolium spp. BP/16; W/3 Remove glumes, cut trans- 1 18 Observe external embryo ⅓ radicle –


endosperm
Lotus spp. W/18 Leave seed intact* 1 18 Remove seed coat to ⅓ radicle, ⅓ distal area of * If the viability of hard seeds is
expose embryo cotyledons, ½ if superficial to be determined, the seed coat
can be incised at distal end of
cotyledons and soaked (W/4)
Medicago spp. W/18 Leave seed intact* 1 18 Remove seed coat to ⅓ radicle, ⅓ distal area of * If the viability of hard seeds is
Melilotus spp. W/18 Leave seed intact* 1 18 Remove seed coat to ⅓ radicle, ⅓ distal area of * If the viability of hard seeds is
Ocimum spp. W/18 Cut longitudinally along the 1 4 Observe embryo ⅓ radicle, small superficial If slime develops, soak seeds
side of the fruit and seed necrosis at distal end of 15–20 min in 1 % alunite solu-
coat; open wide and extract cotyledons tion; blot gently with filter paper
embryo
Onobrychis spp. W/18 Leave seed intact* 1 18 Remove seed coat to ⅓ radicle, ⅓ distal area of * If the viability of hard seeds is
Ornithopus spp. W/18 Leave seed intact* 1 18 Remove seed coat to ⅓ radicle, ⅓ distal area of * If the viability of hard seeds is
expose embryo cotyledons, ½ if superficial to be determined; the seed coat

(%) time (h)
1 2 3 4 5 6 7 8
Oryza sativa W/18 Cut longitudinally 1 2 Observe cut surfaces ⅔ radicle * If necessary remove lemma

endosperm*
Panicum spp. BP/18; W/6 Remove glumes, cut trans- 1 18 Expose embryo and ob- ⅓ radicle, ¼ distal parts of Empty florets without caryopses
versely near embryo serve external surface scutellum are non-viable
BP/18; W/6 Cut longitudinally through 1 18 Expose embryo and ob- ⅓ radicle, ¼ distal parts of Empty florets without caryopses
distal ½ of endosperm serve external surface scutellum are non-viable
Pascopyrum BP/16; W/3 Remove glumes, cut trans- 1 18 Observe external embryo ⅓ radicle –

endosperm
Phalaris spp. BP/18; W/6 Remove glumes, cut trans- 1 18 Expose embryo and ob- ⅓ radicle, ¼ distal parts of –
versely near embryo serve external surface scutellum
BP/18; W/6 Cut longitudinally through 1 18 Expose embryo and ob- ⅓ radicle, ¼ distal parts of –
distal ½ of endosperm serve external surface scutellum
Phleum spp. BP/16; W/2 Pierce near embryo 1 18 Remove lemma to expose ⅓ radicle –
embryo
BP/16; W/2 Transverse incision 1 18 Remove lemma to expose ⅓ radicle –

embryo
Poa spp. BP/16; W/2 Pierce near embryo 1 18 Remove lemma to expose ⅓ radicle –
embryo
BP/16; W/2 Incision 1 18 Remove lemma to expose ⅓ radicle –

embryo
6-11

6-12
(%) time (h)
1 2 3 4 5 6 7 8
Pseudoroegneria BP/16; W/3 Remove glumes, cut trans- 1 18 Observe external embryo ⅓ radicle –


endosperm
Secale cereale W/4 Excise embryo with 1 3 Observe external embryo Root area except one root * Unstained tissue at centre of
scutellum damage
Setaria spp. Remove lemma Cut transversely near 1 16 Observe external embryo, ⅓ radicle measured from * Temperature of 7 °C is needed
and palea before embryo cut longitudinally through radicle tip, ¼ distal part of to decrease sprouting during
premoistening. embryo, cut surface scutellum premoistening
W* at 7 °C/5
Solanum (sect. W/18 Cut between radicle 1 18 Cut the seed at flat side None Sometimes 42 h staining gives
Lycopersicon) and cotyledons ⅓ into into two halves; observe clearer and darker staining. Size
spp. and hybrids endosperm cut surfaces of embryo must be more than ½
normal size
Sorghum spp. W* at 7 °C/18 Cut longitudinally 1 3 Observe cut surface ⅓ radicle measured from * Temperature of 7 °C is needed
through embryo and ¼ of radicle tip to decrease sprouting during
endosperm premoistening
Trifolium spp. W/18 Leave seed intact* 1 18 Remove seed coat to ⅓ radicle, ⅓ distal area of * If the viability of hard seeds is
Trisetum spp. BP/18; W/2 Remove glumes, cut trans- 1 18 Observe external embryo ⅓ radicle –

(%) time (h)
1 2 3 4 5 6 7 8
×Triticosecale W/4 Excise embryo with 1 3 Observe external embryo Root area except one root * Unstained tissue at centre of

scutellum damage
Triticum spp. W/4 Excise embryo with 1 3 Observe external embryo Root area except one root * Unstained tissue at centre of
scutellum damage
W/ 18 Cut longitudinally 1 3 Observe external embryo Root area except one root * Unstained tissue at centre of
Zea mays W/18 Cut longitudinally 1 2 Observe cut surfaces* Primary root, ⅓ extremities * Unstained tissue at centre of
through embryo and ¾ of of scutellum scutellum is indicative of heat
endosperm damage
6-13

Table 6A Part 2. Standard procedures for tetrazolium testing: tree and shrub seeds
6-14
Species Pretreatment: Preparation before staining Staining Optimum Preparation for evaluation Permitted non-viable tissue Remarks
type/min. time (h) solution staining
(%) time (h)
1 2 3 4 5 6 7 8
Abies spp. Prepare the dry Cut transversely at both 1 18 Cut longitudinally through None, except small superficial Old and dry seeds may
seeds or W/18 ends, to open embryo endosperm and expose embryo; necrosis on outer part of endo give more consistent re-
cavity. Treat TZ-imbibed remove seed coat sperm, not in connection with sults if imbibed for 48 h
seeds with low pressure embryo cavity
(optional)
W/18 Cut longitudinally beside 1 12 Expose embryo; remove seed None, except small superficial Old and dry seeds may
embryo coat necrosis on outer part of en- give more consistent re-
dosperm, not in connection with sults if imbibed for 48 h
embryo cavity
Acer campestre W/18 Cut pericarp along 3 sides 1 18 – Radicle tip Old and dry seeds may
except at the connect- give more consistent
ing link between the 2 results with prechill. BP; S
fruits; remove pericarp. 14 days at 3–5 °C
Cut small piece of seed
coat and resoak for 3 h.
Remove seed coat
Acer ginnala W/18* Cut 1/6 of the fruit from the 1 24 Extract embryo from pericarp Radicle tip, small necrosis at Old and dry seeds may
wing’s end and seed coat distal end of cotyledons give more consistent
results with prechill.
* Optional: S; BP. Prechill
10–14 days at 3–5 °C
W/18* Remove pericarp and slit 1 18 Split cotyledons apart to expose Radicle tip, small necrosis at Old and dry seeds may
through seed coat along embryo axis distal end of cotyledons give more consistent
edge of cotyledon results with prechill.
* Optional: S; BP. Prechill
10–14 days at 3–5 °C

Table 6A Part 2. Standard procedures for tetrazolium testing: tree and shrub seeds (continued)
(%) time (h)
1 2 3 4 5 6 7 8
Acer palmatum W/18* Cut pericarp along 3 sides 1 18 Extract embryo from pericarp Radicle tip, small necrosis of Old and dry seeds may
except at the connecting and seed coat cotyledons if superficial give more consistent

link between the 2 fruits; results with prechill.
remove pericarp * Optional: S; BP. Prechill
10–14 days at 3–5 °C
W/18 Cut pericarp along 3 sides 1 18 – Radicle tip, small necrosis of Old and dry seeds may
except at the connecting cotyledons if superficial give more consistent
link between the 2 fruits; results with prechill
remove pericarp. Cut
small piece of seed coat
and resoak for a few
hours. Remove seed coat
Acer plata- W/18* Remove pericarp. Cut 1 8 Observe embryo Radicle tip, small necrosis of Old and dry seeds may
noides and A. small piece of seed coat cotyledons if superficial except give more consistent
pseudoplatanus and resoak for a few near radicle/hypocotyl results with prechill.
only hours, remove seed coat * Optional: S; BP. Prechill
10–14 days at 3–5 °C
Acer, all other Remove wings Remove pericarp, cut 1 18 Observe embryo Radicle tip, small necrosis of Old and dry seeds may
species and soak W/18* seed coat opposite radi- cotyledons if superficial except give more consistent
cle; resoak for about 3 h. near radicle/hypocotyl results with prechill.
Remove seed coat * Optional: S; BP. Prechill
10–14 days at 3–5 °C
Amorpha W/24 Cut off ⅓ end of seed. 1 18 Remove seed coat (None) –
fruticosa Do not remove testa from
lower portion
6-15

6-16
(%) time (h)
1 2 3 4 5 6 7 8
Berberis spp. W/18 Cut transversely ⅓ from 1 18 Cut longitudinally through en- None, including endosperm –
distal end dosperm and expose embryo
W/18 Cut longitudinally 2 pieces 1 18 Cut longitudinally through en- None, including endosperm –
of endosperm; at least dosperm and expose embryo

one cut should open
embryo cavity
Calocedrus spp. Prepare the dry Cut transversely at both 1 18 Cut longitudinally through None, except small superficial Old and dry seeds may
seeds or W/18 ends to open embryo endosperm and expose embryo; necrosis on outer part of endo give more consistent re-
cavity. Treat TZ imbibed remove seed coat sperm, not in connection with sults if imbibed for 48 h
seeds with low pressure embryo cavity
W/18 Cut longitudinally beside 1 12 Expose embryo; remove seed None, except small superficial Old and dry seeds may
embryo coat necrosis on outer part of en- give more consistent re-
dosperm, not in connection with sults if imbibed for 48 h
embryo cavity
Carpinus spp. W/18* Cut transversely ⅓ from 1 18 Extract embryo from pericarp None * Cutting before soaking
distal end and seed coat can sometimes avoid
preparation damage
Chamaecyparis Prepare the dry Cut transversely ⅓ from 1 18 Cut longitudinally through None, including endosperm –
spp. seeds or W/18 distal end to open embryo endosperm and expose embryo,
cavity remove seed coat
Prepare the dry Cut longitudinally beside 1 18 Expose embryo; remove seed None, including endosperm –
seeds or W/18 embryo coat
Cornus mas Prepare the dry Cut transversely ⅓ from 1 48* Extract embryo None, including endosperm as * Low pressure can be
seed or W/48 distal end to open embryo far as visible helpful to shorten staining
cavity time to 18 h
Cornus spp. Prepare the dry Cut transversely ¼ from 1 18 Extract embryo and endosperm None, including endosperm –
seed or W/48 distal end

(%) time (h)
1 2 3 4 5 6 7 8
Corylus spp. Crack the nuts. Cut 1–2 mm of cotyledons 1 18 Spread cotyledons apart and Radicle tip, superficial necrosis ‘Hollow hearts’ may disap-
and soak W/18 at distal end, split longi- cut, especially through unstained at distal end of cotyledons; cen- pear if nuts are moistened

tudinally between them parts tre of ventral side of cotyledon, BP 7 days at 20 °C before
(should not fall to pieces) if not exceeding ⅓ of diameter cracking
Cotoneaster Prepare the dry Cut transversely ⅓ from 1 18 Extract embryo Radicle tip, ⅓ distal area of –
spp. seed or W/18 distal end cotyledons, ½ if superficial
Crataegus spp. Prepare the dry Cut transversely ⅓ from 1 18 Extract embryo Radicle tip, ⅓ distal area of * Cutting before soaking
seed or W/18* distal end cotyledons, ½ if superficial can sometimes avoid
preparation damage
Elaeagnus spp. W/18 Cut transversely ⅓ from 1 18 Cut longitudinally through en- Radicle tip, ⅓ distal area of –
distal end, opposite to dosperm and expose embryo cotyledons, ½ if superficial
the stalk base, to open
embryo cavity
W/18 Cut longitudinally along 1 18 Observe embryo Radicle tip, ⅓ distal area of –
side embryo, expose em- cotyledons, ½ if superficial
bryo, imbibe 1 h in water,
remove seed coat
Euonymus spp. W/18 Cut transversely ⅓ from 1 18 Cut longitudinally through en- None, including endosperm –
distal end dosperm and expose embryo
W/18 Cut longitudinally 2 pieces 1 18 Cut longitudinally through en- None, including endosperm –
of endosperm; at least 1 dosperm and expose embryo
cut should open embryo
cavity
Fagus spp. Remove Remove seed coat 1 18 Open cotyledons Radicle tip, ⅓ distal area of * Pericarp of very dry
pericarp of dry cotyledons if superficial seeds is easier to remove
seeds* and after soaking for a few
W/18 hours
6-17

6-18
(%) time (h)
1 2 3 4 5 6 7 8
Fraxinus spp. Remove Cut a small piece off lon- 1 18* Expose embryo by splitting None, except small necrosis on * Freshly harvested seeds
pericarp of dry gitudinally on both sides, endosperm into two halves endosperm away from embryo need only 8 h
seeds and soak to open embryo cavity
W/18
Ginkgo biloba Crack the dry Cut longitudinally through 1 18 Open endosperm, expose None, including endosperm –
seeds the middle of the en- embryo
dosperm to open embryo
cavity
Ilex spp. W/18 Cut transversely ⅓ from 1 18 Expose embryo and endosperm None, including endosperm Use binocular as embryo
distal end and cut longitu- is very small
dinally towards embryo
W/18 Cut longitudinally through 1 18 Expose embryo and endosperm None, including endosperm Use binocular as embryo
seed coat and into is very small
endosperm
Juniperus spp. Prepare the dry Cut transversely ⅓ from 1 18 Cut longitudinally through None, including endosperm * If necessary remove
seed or W/18* distal end to open embryo endosperm and expose embryo, seeds from surrounding
cavity remove seed coat structures
W/18* Cut longitudinally beside 1 18 Expose embryo; remove seed None, including endosperm * If necessary remove
embryo coat seeds from surrounding
structures
Koelreuteria Cut dry seeds Remove pericarp, soak 1 18 – Radicle tip, ⅓ distal area of –
spp. at base of stalk additionally for about 3 h. cotyledons; ½ if superficial
and soak W/18 Remove seed coat
Ligustrum spp. W/18 Cut transversely ¼ from 1 18 Cut longitudinally through em- None, including endosperm –
distal end bryo and endosperm
W/18 Cut longitudinally a piece 1 18 Expose embryo; remove seed None, including endosperm –
of endosperm on both coat
sides
Liriodendron W/18 Cut transversely opposite 1 18 Cut longitudinally through en- None, including endosperm –
spp. to wing’s end a piece of dosperm and expose embryo
pericarp and endosperm
W/18 Cut longitudinally into 1 18 Expose embryo; remove seed None, including endosperm –
endosperm coat

(%) time (h)
1 2 3 4 5 6 7 8
Malus spp. W/18 Remove seed coat 1 18 Observe embryo Radicle tip, ⅓ distal area of –
cotyledons, ½ if superficial

Malva spp. W/18 Cut transversely a thin 1 18 Remove seed coat None Embryo can become brittle
slice off from reverse side if swelling occurs quickly
of the seed
Pinus, hard- Crack the dry Cut transversely ⅓ from 1 18 Cut longitudinally through None, including endosperm, Embryos shorter than ⅓
shelled species* seeds or W/18 distal end of endosperm endosperm and expose embryo; except small superficial necrosis embryo cavity are non-
to open embryo cavity remove seed coat on outer part of endosperm, viable
not in connection with embryo * E.g. Pinus cembra, Pinus
cavity coulteri, Pinus koraiensis
Pinus, thin- Prepare the dry Cut transversely ⅓ from 1 18 Extract embryo and endosperm None, including endosperm, Embryos shorter than ⅓
skinned seeds or W/18 distal end of endosperm from seed coat except small superficial necrosis embryo cavity are non-
species* to open embryo cavity on outer part of endosperm, viable
not in connection with embryo * E.g. Pinus nigra, Pinus
cavity mugo
Prepare the dry Cut longitudinally beside 1 18 Extract embryo and endosperm None, including endosperm, Embryos shorter than
seeds or W/18 embryo from seed coat except small superficial necrosis ⅓ embryo cavity are
on outer part of endosperm, non-viable
not in connection with embryo
cavity
Prunus spp.* Crack stones Remove seed coat ** 1 18 Spread cotyledons apart Radicle tip, ⅓ distal area of * Large-seeded species
and soak W/18, cotyledons if superficial need longer staining time
change water if (24 h)
necessary (i.e. ** Open cotyledons care
if smells of bitter fully in Prunus persica,
almonds) Prunus domestica
6-19

6-20
(%) time (h)
1 2 3 4 5 6 7 8
Pseudotsuga Prepare the dry Cut transversely ⅓ from 1 18 Cut longitudinally through None, except small superficial –
spp. seeds or W/18 distal end of endosperm endosperm and expose embryo; necrosis on endosperm at distal
to open embryo cavity remove seed coat end
Prepare the dry Cut longitudinally beside 1 12 Expose embryo; remove seed None, except small superficial –
seed or W/18 embryo coat necrosis on endosperm at distal
end
Pyrus spp. W/18 Remove seed coat 1 18 Observe embryo Radicle tip, ⅓ distal area of –
cotyledons, ½ if superficial
Rosa spp. Prepare the dry Cut transversely ⅓ from 1 18 Extract embryo Radicle tip, ⅓ distal area of * Cutting before soaking
seed or W/18* distal end cotyledons, ½ if superficial can sometimes prevent
preparation damage
Styphnolobium Prepare the dry Cut transversely a thin 1 18 Remove seed coat Radicle tip, ½ distal area of –
spp. seeds or W/24 slice off from distal end cotyledons
Sorbus spp. W/18 Cut transversely ⅓ from 1 18 Extract embryo Radicle tip, ⅓ distal area of –
distal end cotyledons, ½ if superficial
Taxodium Prepare the dry Cut transversely ¼ at 1 18 Cut longitudinally through None, including endosperm –
distichum seed or W/18 both ends to open embryo endosperm and expose embryo;
cavity remove seed coat
Prepare the dry Cut longitudinally beside 1 18 Expose embryo; remove seed None, including endosperm –
seed or W/18 embryo coat
Taxus spp. W/18 Cut transversely ¼ from 1 24 Cut longitudinally through en- None including endosperm –
distal end (including a dosperm and expose embryo
piece of endosperm)
W/18 Cut longitudinally beside 1 24 Expose embryo; remove seed None, including endosperm –
embryo coat

(%) time (h)
1 2 3 4 5 6 7 8
Tilia spp. Remove peri- Remove seed coat 1 18 Open endosperm with a small None, except small necrosis –
carp, cut off incision and expose embryo on endosperm at distal end, if

stalk base and superficial
soak W/18
Viburnum spp. W/18 Cut seed coat along 3 1 18 Cut longitudinally flat through None, except small necrosis –
sides (distal and long endosperm and expose embryo, on endosperm opposite to the
sides); remove seed coat begin at the region of embryo embryo
6-21

a b c d
Figure 6.1. Preparation procedure
The figures show the position of different cuts for preparation before staining.
a Longitudinal bisection through embryo and approximately ¾ of the en-
dosperm of cereals and grass seeds.
b Transverse cut of Avena and grass seeds.
c Longitudinal cut through distal part of the endosperm of grass seeds.
d Piercing through endosperm of grass seeds.
e Longitudinal cut through distal half of cotyledons, i.e. seeds of Lactuca and
g h
others of the Asteraceae.
f Longitudinal section showing the position of the scalpel when making a cut
as in 5.
g Longitudinal cut alongside the embryo. (Species of Apiaceae and other spe-
cies with a straight embryo).
h Longitudinal cut alongside the embryo of coniferous seeds.
i Transverse cut at both ends to open embryo cavity by removing fractions of
endosperm.
i
Acer Carpinus Chamaecyparis thyoides

Cornus Corylus Cotoneaster, Crataegus, Rosa and

Sorbus
Figure 6.2. Preparation and evaluation procedure for tree and shrub seeds.
All examples shown are viable seeds (continued on following page).
Position of a cut going all through the tissue.
Position of a cut going into the endosperm.

Elaeagnus Euonymus Fagus
Fraxinus Juniperus Libocedrus
Ligustrum Liriodendron tulipifera Malus and Pyrus
Pinus (hard-shelled) Pinus (thin-skinned) Prunus
Taxodium distichum Taxus Tilia
Figure 6.2. (Cont.) Preparation and evaluation procedure for tree and shrub seeds.
All examples shown are viable seeds.
Position of a cut going all through the tissue.
Position of a cut going into the endosperm.

I II III IV V
B
Figure 6.3a. Evaluation guide for cere-
als: viable seeds.
The figures in column I are all completely

stained and viable. Columns II–V show
C the maximum area of unstained, flaccid or
necrotic tissue permitted in viable seeds.
A The figures are representative for Triti-

cum, ×Triticosecale, Secale, Hordeum
and Avena when prepared by bisection
D or bisected for evaluation
B Avena prepared by transverse cutting
C Hordeum prepared by the excised em-
bryo method
D Secale prepared by the excised embryo
E method
E Triticum and ×Triticosecale prepared by
the excised embryo method
I II III IV V
Figure 6.3b. Evaluation guide for

cereals: non-viable seeds.
A
A Figures are representative for

Triticum, ×Triticosecale, Secale,
Hordeum and Avena when pre-
pared by bisection or bisected for
evaluation
B Triticum prepared by excised em-
B bryo method
B II: Triticum scutellum seen from
back

6.9 Tolerance tables Table 6C. Tolerances for tetrazolium viability tests on the
same or a different submitted sample when tests are made
Table 6B indicates the maximum range (i.e. difference in the same laboratory each on 400 seeds (two-way test at
between highest and lowest) in percentage of viable seeds 2.5 % significance level)
tolerable between replicates, allowing for random sam-
pling variation only at 0.025 probability. To find the max- Average viability (%) Maximum range
imum tolerated range in any case calculate the average 1 2 3
percentage, to the nearest whole number, of the four rep- 98–99 2–3 2
licates: if necessary, form 100-seed replicates by combin- 96–97 4–5 3
ing the subreplicates of 50 or 25 seeds which were closest 93–95 6–8 4
together in the incubator. Locate the average in column 1 89–92 9–12 5
or 2 of the table and read off the maximum tolerated range 83–88 13–18 6
opposite in column 3. 75–82 19–26 7
The tolerances are based on Table G1, column D, in 58–74 27–43 8
Miles (1963). 51–57 44–50 9
In Table 6C, the tolerances take into account the ex-
perimental error within a laboratory as described in the
TEZ Committee Report 1998–2001 and are not extracted
from Miles (1963). Table 6D. Tolerances for tetrazolium viability tests on two
In Table 6D, the tolerances take into account the ex- different submitted samples in different laboratories each
perimental error between the laboratories as described in on 400 seeds (one-way test at 5 % significance level)
the TEZ Committee Report 1998–2001 and are not ex-
tracted from Miles (1963). Average viability (%) Maximum range
1 2 3
Miles, S.R. (1963). Hand book of Tolerances and of 99 2 4
Measures of Precision for Seed Testing. Proceedings of 98 3 5
the International Seed Testing Association, 28 (3), 644.
97 4 6
95–96 5–6 7
Table 6B. Maximum tolerated range between four repli- 93–94 7–8 8

cates of 100 seeds in one tetrazolium test (two-way test at 91–92 9–10 9
2.5 % significance level) 89–90 11–12 10
86–88 13–15 11
Average viability (%) Maximum range
82–85 16–19 12
1 2 3 78–81 20–23 13
99 2 5 73–77 24–28 14
98 3 6
65–72 29–36 15
97 4 7
96 5 8 51–64 37–50 16
95 6 9
93–94 7–8 10
91–92 9–10 11
89–90 11–12 12
87–88 13–14 13
84–86 15–17 14
81–83 18–20 15
78–80 21–23 16
73–77 24–28 17
67–72 29–34 18
56–66 35–45 19
51–55 46–50 20

International Rules for Seed Testing Chapter 7: Seed health testing
Chapter 7: Seed health testing
7.1 Object 7.2.4 ISTA Seed Health Method Validation

Programme
The object of a seed health test is to determine the health
status of a seed sample, and by inference that of the seed Before publication in the International Rules for Seed
lot. Testing, the ISTA seed health testing methods (new or
Health testing of seed is important for four reasons: equivalent) are validated. The principles and factors which
a) Seed-borne inoculum may give rise to progressive should be considered in the validation of methods for the
disease development in the field and reduce the detection of seed-borne pathogens are described in the
commercial value of the crop. ISTA Handbook of Method Validation for the Detection of
b) Imported seed lots may introduce diseases into new Seed-borne Pathogens.
regions. Tests to meet quarantine requirements may
therefore be necessary.
c) Seed health testing may elucidate seedling evaluation 7.3 General principles
and causes of poor germination or field establishment
and thus supplement germination testing. Seed health testing should be performed using methods
d) Seed health test results can/may indicate the necessity and equipment which have been tested to ensure they
to carry out/perform seed lot treatment(s) in order to are fit for purpose. Different methods of testing are
eradicate seed-borne pathogens or to reduce the risk of available, varying in sensitivity and reproducibility and
disease transmission. in the amount of training and equipment required. The
method used will depend on the pathogen or condition to
be investigated, the species of the seed, and the purpose
7.2 Definitions of the test. Selection of the method and evaluation of the
results requires knowledge and experience of the methods
7.2.1 Seed health available. The presence or absence of disease organisms,
pests and deleterious physiological conditions specified
Health of seed refers primarily to the presence or absence by the sender is estimated as accurately as the method
of disease-causing organisms, such as fungi, bacteria used permits.
and viruses, and animal pests, including nematodes and
insects, but physiological conditions such as trace element
deficiency may be involved. 7.4 Procedures
7.2.2 Pretreatment
The entire submitted sample, or a proportion of it,
Any physical or chemical laboratory treatment of the depending on the test method, may be used as a working
working sample preceding incubation, given solely to sample. The sample should be packaged and submitted in
facilitate testing. a manner which will not alter its seed health status.
Exceptionally, a submitted sample larger than that
prescribed in 2.8 may be required and in such cases the

7.2.3 Seed treatment sampler must be instructed accordingly.
When a portion of the submitted sample is required
See 2.2.12. For seed health testing, a seed lot may be as a working sample, the reduction must be carried out in
treated for the purpose of controlling plant pathogens or accordance with 2.5.2, taking appropriate precautions to
insect pests, or correcting trace element deficiencies. avoid cross-contamination.
Normally the working sample must not be less than
that specified in the method description.
Replicates containing a specified number of seeds, if
required, must be taken at random from a subsample after
thorough mixing.

Chapter 7: Seed health testing International Rules for Seed Testing
7.4.2 Seed treatment 7.5 Calculation and expression of

results
Test results may be influenced by treatment applied to the
seed lot. Seed health tests on treated seeds will generally Results are expressed either qualitatively or quantitatively
deliver unreliable test results caused by masking or as specified in the individual prescribed methods.
inhibition of the growth of the target organism. Individual
Method Sheets will determine whether the testing of
treated seeds is acceptable. 7.6 Reporting results
The results of a test for seed health must be reported under
7.4.3 Sample storage ‘Other determinations’ as follows:
The microflora of seed, in the lot or the sample, may – either qualitative or quantitative results, as specified in
change considerably during storage in conditions in which the individual methods;
seed viability is satisfactorily maintained. The selection of – negative and positive results, as specified in the
the appropriate storage conditions must take into account individual methods;
the optimal storage temperature and container in order to – the scientific name of the pathogen detected;
maintain sample integrity. – the percentage of infected seeds;
Abundant development of saprophytic moulds – the method used, including any pretreatment (7.2.2);
including ‘storage fungi’ in tests can be an indication – the size of the sample or fraction examined;
that the seed is not of good quality due to unfavourable – any additional permitted procedure used.
harvesting, processing or storage conditions, or to ageing.
Some fungi (such as Rhizopus spp.) spread rapidly over The absence of a statement concerning the health
tests on blotters and may rot originally healthy seedlings condition of the seed does not necessarily imply that the
or may interfere with outgrowth of the pathogen from the health condition is satisfactory.
plated infected seeds. Pretreatment as described in the
specific method may be advisable.
7.4.4 Specific directions
Specific seed health testing methods are published online

on the ISTA web site at:
www.seedtest.org/seedhealthmethods
Seed health methods are normally based on one host,

and one pathogen, but multi-pathogen methods may be
included. Before publication, all seed health test methods
must be validated through the ISTA Seed Health Method
Validation Programme. Methods validated in this way
at the time of printing are listed in Table 7A. Additions,
updates and deletions to this list can be found on the
ISTA web site (www.seedtest.org/seedhealthmethods).

The definitive list is held by the ISTA Secretariat. It is
the responsibility of the laboratory using the method to
consult this list.

Table 7A. ISTA official seed health testing methods
7‑001a: Detection of Alternaria dauci in Daucus carota 7‑004: Detection of Leptosphaeria maculans and
(Carrot) seed by blotter method Plenodomus biglobosus on Brassica spp. seed
Host: Daucus carota L. Host: Brassica spp.
Pathogen(s): Alternaria dauci (J.G.Kühn) J.J.Groves & Pathogen(s): Leptosphaeria maculans (Tode ex Fr.) Ces.
Skolko, syn. A. porri f.sp. dauci (J.G.Kühn) Neerg., syn. & de Not (previously Phoma lingam) or Plenodomus
A. carotae (Ellis & Langlois) Stevenson & Wellman biglobosus (Shoemaker & H. Brun) (previously
Date approved: 2012 Leptosphaeria biglobosa)
Review due: 2017 Date approved: 2017
Review due: 2022
7‑001b: Detection of Alternaria dauci in Daucus carota
(Carrot) seed by malt agar method 7‑005: Detection of Ascochyta pisi in Pisum sativum (Pea)
Host: Daucus carota L. seed
Pathogen(s): Alternaria dauci (J.G.Kühn) J.J.Groves & Host: Pisum sativum L.s.l.
Skolko, syn. A. porri f.sp. dauci (J.G.Kühn) Neerg., syn. Pathogen(s): Ascochyta pisi Lib.
A. carotae (Ellis & Langlois) Stevenson & Wellman Date approved: 2011
Date approved: 2012 Review due: 2016
Review due: 2017
7‑006: Detection of Colletotrichum lindemuthianum in
7‑002a: Detection of Alternaria radicina in Daucus carota Phaseolus vulgaris (Bean) seed
(Carrot) seed by blotter method Host: Phaseolus vulgaris L.
Host: Daucus carota L. Pathogen(s): Colletotrichum lindemuthianum (Sacc. &
Pathogen(s): Alternaria radicina Meier, Drechsler & Magn.) Briosi & Cav.
E.D.Eddy, syn. Stemphylium radicinum (Meier, Date approved: 2011
Drechsler & E.D.Eddy) Neergaard Review due: 2016
Date approved: 2012
Review due: 2017 7‑007: Detection of Alternaria linicola, Botrytis cinerea and
Colletotrichum lini in Linum usitatissimum (Flax) seed
7‑002b: Detection of Alternaria radicina in Daucus carota Host: Linum usitatissimum L.
(Carrot) seed by malt agar method Pathogen(s): Alternaria linicola J.W.Groves & Skolko;
Host: Daucus carota L. Botrytis cinerea Pers. ex Pers. (Perfect state
Pathogen(s): Alternaria radicina Meier, Drechsler & Botryotinia fuckeliana (de Bary) Whetzel, syn.
E.D.Eddy, syn. Stemphylium radicinum (Meier, Sclerotinia fuckeliana (de Bary) Fuckel.); Colletotrichum
Drechsler & E.D.Eddy) Neergaard lini (Westerd.) Tochinai, syn. C. linicola Pethybr. & Laff.
Date approved: 2012 Date approved: 2012
Review due: 2017 Review due: 2017
7‑003: Detection of Botrytis cinerea in Helianthus annuus 7‑008: Detection of Caloscypha fulgens in Picea
(Sunflower) seed engelmannii and P. glauca (Spruce) seed
Host: Helianthus annuus L. Host: Picea engelmannii Parry ex Engelm.; Picea glauca
Pathogen(s): Botrytis cinerea Pers. ex Pers. (Perfect (Moench) Voss
state Botryotinia fuckeliana (de Bary) Whetzel, syn. Pathogen(s): Caloscypha fulgens (Pers.) Boud. (Imperfect
Sclerotinia fuckeliana (de Bary) Fuckel.) state Geniculodendron pyriforme Salt)

Table 7A. ISTA official seed health testing methods (cont.)
7‑009: Detection of Gibberella circinata on Pinus spp. 7‑013b: Detection of Ustilago nuda in Hordeum vulgare
(Pine) and Pseudotsuga menziesii (Douglas-fir) seed (Barley) seed by dehulling and embryo extraction
Host: Pinus spp.; Pseudotsuga menziesii (Mirb.) Franco Host: Hordeum vulgare L.
Pathogen(s): Gibberella circinata Nirenberg & O’Donnell Pathogen(s): Ustilago nuda (Jens.) Rostr.
(Imperfect state Fusarium circinatum Nirenberg & Date approved: 2011
O’Donnell, syn. F. subglutinans f. sp. pini Hepting, syn. Review due: 2016
F. lateritium f. sp. pini Hepting)
Date approved: 2011 7‑014: Detection of Stagonospora nodorum in Triticum
Review due: 2016 aestivum (Wheat) seed
Host: Triticum aestivum L.
7‑010: Detection of Drechslera oryzae in Oryza sativa Pathogen(s): Stagonospora nodorum Berk., syn. Septoria
(Rice) seed nodorum Berk. (Perfect state Leptosphaeria nodorum
Host: Oryza sativa L. Mailer)
Pathogen(s): Drechslera oryzae (Breda de Haan) Date approved: 2011
Subram. & Jain, syn. Bipolaris oryzae (Breda de Haan) Review due: 2016
Shoem., syn. Helminthosporium oryzae Breda de Haan
(Perfect state Cochliobolus miyabeanus (Ito & Kurib.) 7‑015: Detection of Epichloë coenophiala in Festuca spp.
Drechsler ex Dastur, syn. Ophiobolus miyabeanus Ito & (Fescue) and of Neotyphodium lolii in Lolium spp.
Kuribayashi) (Ryegrass) seed
Date approved: 2011 Host: Festuca spp., Lolium spp.
Review due: 2016 Pathogen(s): Epichloë coenophiala (Morgan-Jones &
W. Gams) C.W. Bacon & Schardl; Neotyphodium lolii
7‑011: Detection of Pyricularia oryzae in Oryza sativa (Latch, M.J.Chr. & Samuels) Glenn, C.W.Bacon &
(Rice) seed Hanlin
Host: Oryza sativa L. Date approved: 2012
Pathogen(s): Magnaporthe grisea (Hebert) Barr (Imperfect Review due: 2017
state Pyricularia oryzae Cavara, syn. P. grisea)
Date approved: 2011 7‑016: Detection of Phomopsis complex in Glycine max
Review due: 2016 (Soybean, Soya bean) seed
Host: Glycine max (L.) Merr.
7‑012: Detection of Alternaria padwickii in Oryza sativa Pathogen(s): Phomopsis longicolla Hobbs, Diaporthe
(Rice) seed phaseolorum var. sojae (Lehm.) Wehm. (Imperfect
Host: Oryza sativa L. state P. phaseoli (Desm.) Sacc., syn. P. sojae
Pathogen(s): Alternaria padwickii (Ganguly) M.B.Ellis, Lehmann); Diaporthe phaseolorum (Cke. & Ell.) Sacc.
syn. Trichoconis padwickii Ganguly, syn. Trichoconiella f. sp. caulivora (DPC), syn. D. phaseolorum var.
padwickii (Ganguly) Jain caulivora Athow & Caldwell
7‑013a: Detection of Ustilago nuda in Hordeum vulgare 7‑017: (Replaced by 7‑007)

(Barley) seed by embryo extraction
Host: Hordeum vulgare L. 7‑018: (Replaced by 7‑007)

Pathogen(s): Ustilago nuda (Jens.) Rostr.
Date approved: 2011 7‑019a: Detection of Xanthomonas campestris pv.
Review due: 2016 campestris on Brassica spp. seed
Host: Brassica spp.
Pathogen(s): Xanthomonas campestris pv. campestris
(Pammel) Dowson
Date approved: 2014
Review due: 2019

7‑019b: Detection of Xanthomonas campestris pv. 7‑024: Detection of Pea early browning virus and Pea
campestris in disinfested/disinfected Brassica spp. seed-borne mosaic virus in Pisum sativum (Pea) seed
seed Host: Pisum sativum L.s.l.
Host: Brassica spp. Pathogen(s): Pea early browning virus (PEBV) and Pea
Pathogen(s): Xanthomonas campestris pv. campestris seed-borne mosaic virus (PSbMV)
(Pammel) Dowson Date approved: 2012
Date approved: 2012 Review due: 2017
Review due: 2017
7‑025: Detection of Aphelenchoides besseyi in Oryza
7‑020: Detection of Xanthomonas hortorum pv. carotae in sativa (Rice) seed
Daucus carota (Carrot) seed Host: Oryza sativa L.
Host: Daucus carota L. Pathogen(s): Aphelenchoides besseyi Christie
Pathogen(s): Xanthomonas hortorum pv. carotae Date approved: 2013
(Kendrick) Vauterin, Hoste, Kersters & Swings, syn. X. Review due: 2018
campestris pv. carotae (Kend) Dye
Date approved: 2010 7‑026: Detection of Squash mosaic virus, Cucumber green
Review due: 2015 mottle mosaic virus and Melon necrotic spot virus in
cucurbit seed
7‑021: Detection of Xanthomonas axonopodis pv. phaseoli Host: Cucurbits
and X. axonopodis pv. phaseoli var. fuscans in Pathogen(s): Squash mosaic virus (SqMV); Cucumber
Phaseolus vulgaris (Bean) seed green mottle mosaic virus (CGMMV); Melon necrotic
Host: Phaseolus vulgaris L. spot virus (MNSV)
Pathogen(s): Xanthomonas axonopodis pv. phaseoli Date approved: 2014
(Smith) Vauterin, Hoste, Kersters & Swings, syn. X. Review due: 2019
campestris pv. phaseoli (Smith) Dye; Xanthomonas
axonopodis pv. phaseoli var. fuscans Vauterin, Hoste, 7‑027: Detection of Pyrenophora teres and P. graminea on
Kersters & Swings, syn. X. campestris pv. phaseoli var. Hordeum vulgare (Barley) seed
fuscans (Burkholder) Starr & Burkholder Host: Hordeum vulgare L.
Date approved: 2011 Pathogen(s): Pyrenophora teres Drechsler (Imperfect
Review due: 2016 state Drechslera teres (Sacc.) Shoem.); Pyrenophora.
graminea Ito & Kurib. (Imperfect state D. graminea
7‑022: Detection of Microdochium nivale and M. majus in (Rabenh. Ex Schlecht.) Shoem.)
Triticum spp. (Wheat) seed Date approved: 2011
Host: Triticum spp. Review due: 2016
Pathogen(s): Microdochium nivale Samuels & Hallett,
syn. Fusarium nivale (Fr.) Rabenh. (Perfect state 7‑028: Detection of infectious Tobacco mosaic virus
Monographella nivalis (Schaff.) Müller); M. majus and Tomato mosaic virus in Solanum lycopersicum
(Wollenw.) Glynn & S.G.Edwards, syn. M. nivale var. (Tomato) seed by the local lesion assay (indexing) on
majus (Wollenw.) Samuels & I.C.Hallett Nicotiana tabacum plants
Date approved: 2012 Host: Solanum lycopersicum L.
Review due: 2017 Pathogen(s): Tobacco mosaic virus (TMV); Tomato
mosaic virus (ToMV)
7‑023: Detection of Pseudomonas savastanoi pv. Date approved: 2012
phaseolicola in Phaseolus vulgaris (Bean) seed Review due: 2017
Host: Phaseolus vulgaris L.
Pathogen(s): Pseudomonas savastanoi pv. phaseolicola 7‑029: Detection of Pseudomonas syringae pv. pisi in
(Burkh.) Gardan, Bollet, Abu, Ghorrah, Grimont & Pisum sativum (Pea) seed
Grimont, syn. P. syringae pv. phaseolicola (Burkh.) Host: Pisum sativum L.s.l.
Young, Dye & Wilkie Pathogen(s): Pseudomonas syringae pv. pisi (Sack.)
Date approved: 2012 Young, Dye & Wilkie
Review due: 2017 Date approved: 2012
Review due: 2017

7‑030: Detection of Acidovorax valerianellae in Valerianella

locusta (corn salad) seed
Host: Valerianella locusta (L.) Laterr.
Pathogen(s): Acidovorax valerianellae sp. nov.
Date approved: 2014
Review due: 2019
7‑031: Filtration method for detection of Ditylenchus

dipsaci on Medicago sativa; Ditylenchus dipsaci and
Ditylenchus gigas on Vicia faba
Host: Medicago sativa L. and Vicia faba L.
Pathogen(s): Ditylenchus dipsaci Kuhn, 1857; Ditylenchus
gigas n. sp.
Date approved: 2017
Review due: 2022
7‑032: Detection of Verticillium dahliae on Spinacia

oleracea (spinach) seed
Host: Spinacia oleracea L.
Pathogen(s): Verticillium dahliae Kleb.
Date approved: 2017
Review due: 2022

International Rules for Seed Testing Chapter 8: Species and variety testing
Chapter 8: Species and variety testing
8.1 Object different individuals due to differences in the number of

times the motif is repeated.
The object of species and variety verification is to deter-
mine the extent that the submitted sample conforms to
the species or variety as requested by the applicant, us- 8.2.5 Semi-performance-based approach
ing methods not permissible in a purity test according to
Chapter 3. The semi-performance-based approach (SPBA) is an ap-
proach to testing in which individual laboratories can
choose some components of the test method, as long as
8.2 Definitions those components have been validated as fit for purpose
and comply with given performance standards, while
8.2.1 Authentic standard sample one or more other components of the test method are
prescribed.
An authentic standard sample is a seed sample of a known
species or variety or a sample with a known specific trait.
It is recommended that this sample is of a known origin, 8.2.6 Allele profile
e.g. a certified reference sample or a sample taken by an
official or another person who can ensure the sample iden- An allele profile is the combination of alleles determined
tity and characteristics. This sample will be used for ob- for a specific set of DNA markers examined within a sam-
taining enzymatic, protein or DNA profiles. ple, individual or variety. It is sometimes referred to as a
DNA ‘fingerprint’.
8.2.2 Standard reference

8.3 General principles
A standard reference is a valid descriptive attribute of a
species or variety, e.g. zygosity, or an isozyme, protein 8.3.1 Field of application
or DNA banding pattern produced by gel electrophoresis
or similar techniques, or an allelic profile or nucleotide The determination of a species or variety is valid only
sequence or a molecular weight standard (MWS) for pro- if the species or variety is stated by the applicant and
tein or DNA. This trait should be obtained by a validated an authentic standard sample of the species or variety is
method and should be from an authentic standard sample available for comparison to ensure the certainty of the de-
or obtained from a reliable source as for MWS. termination. The traits compared may be morphological,
physiological, cytological or chemical.

8.2.3 Allele
8.3.2 Testing principles
An allele is one of several alternate forms of a DNA se-
quence that may occur at a particular gene or other spe- The determination is carried out, depending on the species
cific location within an organism’s genome. or variety in question on seeds, seedlings or more mature
plants grown in a laboratory, a glasshouse, a growth cham-
ber or a field plot.
8.2.4 Microsatellite The working sample will be compared with the au-
thentic standard sample. Whenever possible, the working
A microsatellite is a repetitive DNA element, also known sample and the authentic standard sample must be handled
as a simple sequence repeat (SSR), consisting of a short, in the same way, e.g. in field plots they must be grown
tandemly repeated motif of one to a few DNA subunits contemporaneously, near each other and in identical envi-
(nucleotides). For example, CTGCTGCTGCTGCTGCT- ronmental conditions, and the evaluation must be done at
GCTGCTG is a microsatellite with a “CTG” repeat motif. the same stage of development.
A given microsatellite at a particular location within an When a standard reference is used in a test, the inter-
organism’s genome may vary in size when examined in pretation of the result is done by comparing the traits of

Chapter 8: Species and variety testing International Rules for Seed Testing
the seeds, seedlings or plants of the working sample with In the laboratory: apparatus and reagents for morpho-
the standard reference. logical, physiological, cytological or bio-molecular
In the case of species or variety that are sufficiently examinations, chemical tests and germination of seeds
uniform in one or more traits (e.g. in self-pollinated spe- as appropriate;
cies), the conformity of the working sample with an au- In glasshouses and growth chambers: provision of
thentic standard sample can be determined and if possible, controlled environmental conditions adequate to in-
the degree of conformity may be quantified. If the species duce the development of the trait;
or variety is not sufficiently uniform (e.g. in cross-polli- In field plots: climatic, soil and cultural conditions to
nated species), the proportion of any obvious off-types is permit normal development of the trait to be tested and
calculated and the conformity of the working sample is sufficient protection against pests and diseases.
expressed.
8.5 Procedures
8.3.3 Semi-performance-based approach
for DNA-based testing 8.5.1 Submitted sample
The technologies associated with DNA analysis are con- The testing laboratory must ensure that the size of the
tinuously evolving, and an assortment of instrumentation submitted sample is sufficient to perform the tests as re-
and procedures exist that may yield equivalent results. In- quested by the applicant.
dividual laboratories have invested in varied instrumenta- The guiding values for the size of the submitted sam-
tion according to their circumstances, and it is not practi- ple for tests covered by this chapter are shown in Table
cal to require standardised use of specific technologies. 8A.
Therefore, in order to establish a harmonised approach Depending on the method and the degree of precision
that both provides guidance to laboratories and facilitates required, more seeds or fewer seeds than the amount listed
processes for laboratories seeking accreditation for these above may be necessary.
types of tests, an SPBA has been instituted. Specific mo-
lecular markers are prescribed, but the analytical proce- Table 8A. Sample sizes for the species and variety test
dures used to interrogate those markers are at the discre-
tion of individual laboratories, so long as those procedures Laboratory Field plot and
only (g) laboratory (g)
have been evaluated as fit for purpose, and the end result
Glycine, Lupinus, Phaseolus, 1000 2000
meets acceptable standards as set by ISTA.
Pisum, Vicia, Zea and species of
other genera with seeds of similar
size
8.4 Personnel and equipment Avena, Hordeum, Secale, Triticum 500 1000
and species of other genera with
seeds of similar size
Determinations must be made by a specialist familiar with
Beta and species of other genera 250 500
the morphological, physiological, biomolecular or other with seeds of similar size
traits of seeds. The specialist must possess specific knowl- All smaller seeded species 100 250
edge of procedures, apparatus and equipment required for

determining species and variety. It may be necessary to
consult the international scientific literature, official gov-
ernment documents, other laboratories or other resources
for guidance. 8.5.2 Working sample
Appropriate facilities and equipment must be available
as specified in detail in 8.8 for testing species and variety The size of the working sample and the number and size
as follows: of replicates will depend on the object, the method to be
used and the degree of precision as requested by the appli-
cant. If technically possible and justified, replicates should
be tested to improve the reliability of the test result. Prepa-
ration of the working sample and the replicates must be
done according to the procedures described under 2.5.2.

8.5.3 Examination of seeds 8.5.6 Examination of plants in field plots
There may be different procedures for examining seeds. When plants are tested in field plots, each working sam-
For testing morphological traits, the seeds must be ex- ple must be sown in at least two replicate plots. As in-
amined with the aid of a suitable magnifying apparatus surance against failure, the replicates should be situated
when necessary. For testing colour traits, the seeds may be in different fields or different parts of the same field. The
examined under full daylight or light of limited spectrum, plots may be of any convenient size that will provide
e.g. ultra-violet. For testing chemical traits, the seeds must enough plants for the determination to be of the accuracy
be treated with the appropriate reagent and the reaction of required. If the seed is sown in situ, it must be sown in
each seed must be noted. For testing bio-molecular traits, rows, mechanically if possible. Spacing between rows and
DNA, RNA, protein or other specific metabolic products between plants must be sufficient to allow development
are extracted from the seeds and the traits may be detect- of the traits. Both transplanting and thinning are possible
ed, elucidated and quantified. sources of error and the sowing rate must be adjusted to
Standardised methods for examining seeds listed under produce approximately the same number of plants in the
8.8 are applicable to both objects according to 8.1. For the plots produced from the working sample and the authentic
application of performance approved methods see 8.2.3. standard sample. When absolutely necessary, thinning or
transplanting of seedlings from elsewhere into the plot is
permitted.
8.5.4 Examination of seedlings Observations must be made during the whole grow-
ing period, but particularly at the times indicated in 8.10.
The seeds must be germinated on an appropriate medium. Plants showing the traits must be counted and recorded.
When the seedlings have reached a suitable stage of de- When practical, either an actual count or an estimate of
velopment, they are examined in whole or in part, with or the number of plants in the plot must be made, preferably
without further treatment. For testing biomolecular traits, at the time the plants are examined.
DNA, RNA, protein or other specific metabolic products Standardised methods for examining plants listed un-
are extracted from the seedlings and the traits may be de- der 8.10 are applicable to both objects according to 8.1.
tected, elucidated and quantified. In bioassays, seeds may For the application of performance approved methods see
be treated before germination or the seedlings may be 8.2.3.
treated to induce the expression of the traits if present.
Standardised methods for examining seedlings listed
under 8.9 are applicable to both objects according to 8.1. 8.6 Calculation and expression of
For the application of performance approved methods see results
8.2.3.
The calculation and expression of results depends on the
object, the method used, the testing plan and whether a
8.5.5 Examination of plants in qualitative or quantitative result is requested by the appli-
glasshouse or growth chamber cant. The mean and other statistics may be calculated and
reported when results of replicates are within the range of

The seeds must be sown in suitable containers and main- expected variability. Methods for determining tolerances
tained in environmental conditions necessary for the de- may be found in the ISTA Handbook of Variety Testing
velopment of the traits. When the plants have reached a (Electrophoresis Testing) as well as in the ISTA Handbook
suitable stage of development, the traits must be observed on Statistics in Seed Testing (Appendix II). In the case of
on each plant and noted. For testing bio-molecular traits, verification of species and variety, the determined propor-
DNA, RNA, protein or other specific metabolic products tion of other species, other varieties or aberrant (e.g. fat-
are extracted from the plants and the traits may be detect- uoid oats, speltoid wheat) is calculated and expressed.
ed, elucidated and quantified. In bioassays, seeds may be
treated before germination or the seedlings or plants may
be treated directly to induce the expression of the traits if
present.
For the application of performance approved methods
see 8.2.3.

8.6.1 Examination of individual seeds, 8.7.1 Examination of individual seeds or

seedlings or plants seedlings
Whenever possible, the number of divergent seeds, seed- Suggested phrases for reporting divergent seeds or seed-
lings or plants or those with the trait under test must be lings are as follows, depending upon the result:
calculated as a percentage of the number of seeds, seed- a) if none was found: “The test performed revealed noth-
lings or plants examined. ing to indicate that the species (and/or variety) stated
When testing seedlings, the result is expressed as the by the applicant is incorrect.”
proportion of the number of normal seedlings (as defined b) if non-conforming seeds were found: “Out of … seeds
in Chapter 5). If the applicant requests reporting in a dif- examined, … seeds do not conform to the authentic
ferent way, it must be in addition to the above. standard sample of the species (and/or variety) stated
When testing plants in field plots in rows without wide by the applicant.”
spacing, it may be difficult to estimate the total number c) if non-conforming seedlings were found: “Out of ....
of plants examined per plot. The result may be expressed seeds producing normal seedlings, … % do not con-
as the number of divergent plants or plants with the trait form to the authentic standard sample of the species
under test produced by the mass of seed sown. (and/or variety) stated by the applicant.”
d) if the total working sample was found to be of a spe-
cies and/or variety other than that stated by the appli-
8.6.2 Tests for traits of bulk samples cant: “The sample does not conform to the authentic
standard sample of the species (and/or variety) stated
For bulk samples, tests may be done by measuring traits by the applicant.”
that do not allow a reference to individual seeds, seedlings
or plants. There are various principles for calculation and
expression of test results of such measurements. The re- 8.7.2 Field plot examinations
sult must be expressed as agreed with the applicant.
The results of a field plot examination must, whenever
possible, be reported as a percentage of each other spe-
8.7 Reporting results cies, other variety or aberrant found. When the expression
of the result as a percentage is not possible, appropriate
Results must be reported under ‘Other determinations’, comments regarding the conformity of the sample may be
and in addition the following information must be given: reported.
a) the request of the applicant; If nothing worthy of special comment was found the
b) the trait(s) and the method(s) used; following statement is suggested: “The results of a field
c) the kind of preparation of the working sample (e.g. the plot examination of this sample revealed nothing to indi-
whole working sample excluding the inert matter or cate that the species (and/or variety) stated by the sender
only the pure seed fraction, washing); is (are) incorrect.”
d) whether an authentic standard sample or a standard
reference was used; if a standard reference was used,
its origin must be indicated; 8.8 Conventional methods

e) the number of seeds, seedlings or plants examined.
When it is difficult to determine the total number of 8.8.1 Cereals
plants examined in field plots, the mass of seed sown
must be reported. Morphological characters of cereal grains can be ob-
served by direct visual examination or with suitable
magnification.
In Hordeum, the most useful characters are shape of
the grain, base of the lemma, colour, hairs in the ventral
crease, opening of the ventral crease, rachilla hairs, denta-

tion of the lateral dorsal nerves, wrinkling of the lemma to identify unknown samples and mixtures, by single seed
and palea, and shape and hairiness of the lodicules. analysis.
In Avena a useful character is grain colour, which may As a guideline it is recommended that 100 seeds are
be white, yellowish grey or black. used. Very precise estimates of varietal purity may re-
In Avena and Hordeum, the colour of the grain under quire a larger sample. If a comparison is being made with
ultra-violet light is sometimes diagnostic. a standard value, sequential testing using batches of 50
Colour reaction in dilute phenol is a useful character, seeds can be undertaken in order to minimise the work-
especially in Triticum. Soak the grains in distilled water load. A simple check on the identity of a single major con-
overnight. Drain and place them on filter paper in petri stituent of a seed lot can be done using less than 50 seeds.
dishes and add a few drops of approximately 1 % phenol.
Classify the grains according to depth of colour. Varieties
develop a characteristic brown colour varying from pale 8.9.1.2 Apparatus and equipment
to very dark.
8.9.1.2.1 Apparatus
8.8.2 Fabaceae and Poaceae Any suitable vertical electrophoresis apparatus with a
cooling system and power supply may be used.
In some species of Fabaceae (e.g. of Pisum and Lupinus)
and species of Poaceae (e.g. Festuca spp.), diagnostic dif-
ferences in colour, size and shape can be observed by di- 8.9.1.2.2 Chemicals
rect visual examination under daylight or ultraviolet light.
In Lupinus spp., the presence or absence of alkaloids All chemicals should be of ‘Analytical Reagent’ grade or
is a diagnostic feature. Soak the seeds singly in water equivalent.
(2.5–5.0 mL for each seed) for at least 2 h in transparent
dishes or other suitable equipment. Scarify or pierce each – Acrylamide (‘specially purified for electrophoresis’)
seed with an appropriate tool (scalpel, needle, pliers) to – Bisacrylamide (‘specially purified for
remove hardseededness and to allow a release of alkaloids electrophoresis’)
into the water. Soak the seeds for a further 5–24 h. Add – Urea
1–3 drops of freshly prepared 1 % Lugol’s solution (1.0 g – Glacial acetic acid
iodine + 2.0 g potassium iodide, made up with water to – Glycine
100 mL) to each seed. A distinct brown-red precipitate in- – Ferrous sulphate
dicates the presence of alkaloids. Doubtful cases can be – Ascorbic acid
easily resolved by adding further drops of the Lugol’s so- – Hydrogen peroxide (or ammonium persulphate and
lution. Evaluation can be done on either a white surface or TEMED)
a luminescent screen. – Monothioglycerol (or 2-mercaptoethanol)
– Pyronine G (or methyl green)
– Trichloroacetic acid
8.9 Protein-based methods – Ethanol

– 2-Chloroethanol
8.9.1 Hordeum (barley) – PAGE Blue G-90 (or PAGE Blue 83)(or any reagent
equivalent to the ‘Coomassie Blue’ series of dyes)
8.9.1.1 Principle
The standard reference method for verifying varieties 8.9.1.2.3 Solutions

of Hordeum is by polyacrylamide gel electrophoresis
(PAGE). The alcohol-soluble proteins (hordeins) are ex- a)
Extraction solution: pyronine G (or methyl green)
tracted from the seeds and separated by PAGE at pH 3.2. (0.05 %) in 2-chloroethanol (20 %) containing urea
The pattern of protein bands produced (electropherogram) (18 %) and monothioglycerol (or 2-mercaptoethanol)
is related to genetic constitution and can be considered as (1 %)(keep cold or prepare fresh)
a ‘fingerprint’ of a variety. The ‘fingerprints’ can be used

b) Stock tank buffer solution: glacial acetic acid (4 mL) 8.9.1.3.3 Electrophoresis
and glycine (0.4 g), made up to 1 L with water; keep
cold The acrylic comb is removed from the gel and the sample
c) Stock gel buffer solution: glacial acetic acid (20 mL) wells washed with tank buffer. The tank is filled with an
and glycine (1.0 g), made up to 1 L with water; keep appropriate volume of buffer (depending on the equip-
cold ment used). Samples (10–20 µL) are loaded into the wells
d) Staining solutions: and the gel placed in the tank, ensuring that the sample
– trichloroacetic acid (100 g) in 1 L of water wells are completely filled. Electrophoresis is carried out
– PAGE Blue G-90 (or PAGE Blue 83)(1 g) in etha- at 500 V (constant voltage) for twice the time taken for
nol (100 mL). the pyronine G marker dye to leave the gel, or three times
if methyl green is used as a tracking dye. Water should
be circulated through the buffer tank to maintain the tem-
8.9.1.3 Procedure perature at 15–20 °C.
8.9.1.3.1 Protein extraction

8.9.1.3.4 Fixing and staining
Single seeds are crushed with pliers and transferred to
1.5 mL polypropylene centrifuge tubes. Extraction solu- The gel cassette is removed from the tank, opened and
tion (0.3 mL) is added, the contents of the tubes are thor- the gel placed in a plastic box containing 5–10 mL of 1 %
oughly mixed and the tubes are allowed to stand over- PAGE G90 (or PAGE Blue 83) in 200 mL of 10 % trichlo-
night at room temperature. The tubes are centrifuged at roacetic acid. Staining is complete in 1–2 days and de-
18 000 × g and the supernatants used for electrophoresis. staining is not usually needed. Precipitated stain should
Extracts can normally be stored at 4 °C for 3–4 days. be scraped from the surface of the gel. The gel is washed
in water to enhance the stain and can then be examined
or photographed. Any blue background in the gel is re-
8.9.1.3.2 Gel preparation moved by washing in 10 % trichloroacetic acid. Gels can
be stored in polythene bags at 4 °C for many months with-
Clean and dry gel cassettes are assembled, according to out deterioration.
the design of the equipment. Treating the glass plates with
silicon prior to assembly can facilitate subsequent removal
of the gel. The gel cassettes can incorporate a plastic back- 8.9.1.4 Nomenclature of hordein bands
ing sheet (e.g. ‘Gel Bond PAG’, FMC Corporation). This
supports the gel during subsequent operations. To make Hordein bands can be identified either by measuring their
100 mL of gel medium, stock gel buffer (approx 60 mL) relative mobilities (Wrigley, C.W., Autran, J.C. & Bushuk,
is taken and acrylamide (10 g), bisacrylamide (0.4 g), urea W. (1982). Advances in Cereal Science and Technology, 5,
(6 g), ascorbic acid (0.1 g), ferrous sulphate (0.005 g) are 211–259), by means of an electrophoretic formula (Kon-
added. The solution is stirred and made up to 100 mL with arev, V.B., Gavrilyuk, I.P., Gubareva, N.K. & Peneva, T.I.
stock gel buffer solution. Freshly prepared 0.6 % hydrogen (1979). Cereal Chemistry 56, 272–278) or by designation
peroxide solution (0.35 mL per 100 mL of gel medium) is of patterns (Shewry, P.R., Pratt, H.M., Faulks, A.J., Par-
added and mixed quickly and the gel poured. Note that the mar, S. & Miflin, B.J. (1979). Journal of the National In-
gel mixture can be cooled to near freezing prior to the ad- stitute of Agricultural Botany, 15, 5–40).
dition of the peroxide. Polymerisation should be complete
in 5–10 min. An acrylic ‘comb’ is placed in the top of the
cassette, to make wells in the gel. The gel mixture should 8.9.2 Pisum and Lolium
over-fill the cassette, or be overlaid with water, to ensure
satisfactory polymerisation of the upper surface. 8.9.2.1 Principle
Note that as an alternative to the hydrogen perox-
ide catalyst, it is possible to use ammonium persulphate The standard reference method for the verifying varieties
(0.1 mL of 10 % solution, freshly prepared) and TEMED of Pisum and Lolium is by polyacrylamide gel electropho-
(0.3 mL) added to the gel mixture prior to pouring the gel. resis (PAGE). Seed proteins are extracted from individual
Pisum seeds or from a meal of Lolium seeds, treated with

SDS and separated using a discontinuous SDS-PAGE pro- 8.9.2.2.3 Solutions

cedure. The pattern of protein bands found on the gel is
characteristic of a variety. a) Stock gel buffer (main or resolving gel): 1 M Tris HCl,
As a guideline for Pisum, it is recommended that 100 pH 8.8. 121.1 g of Tris is dissolved in about 750 mL
individual seeds are used. Very precise estimates of vari- of distilled water, adjusted to pH 8.8 with hydrochloric
etal purity may require a larger sample. If a comparison acid (use 1 M [approximately 90 mL concentrated HCl
is made with a standard value, sequential testing using per L distilled water] solution added dropwise; this
batches of 50 seeds can be undertaken in order to mini- will require about 15 mL) and made up to 1 L. This
mise the workload. A simple check on the identity of a can be stored at 4 °C.
single major constituent of a seed lot can be done using b) Stock gel buffer (stacking gel): 1 M Tris HCl, pH 6.8.
less than 50 seeds. 30.3 g of Tris is dissolved in 200 mL of distilled water,
For Lolium, a bulk sample of seeds is analysed. In adjusted to pH 6.8 with hydrochloric acid (use con-
most cases, whilst this will serve to verify seed lots, it centrated at first [approx. 8 mL, added dropwise], then
will not permit the detection of admixtures of two or more 1 M solution) and made up to 250 mL. This can be
varieties. stored at 4 °C.
c) Stock SDS solution: 10 g of SDS is dissolved in dis-
tilled water (this requires gentle stirring and heating)
8.9.2.2 Apparatus and equipment and made up to 100 mL. This should be stored at room
temperature. If the SDS comes out of solution, it can
8.9.2.2.1 Apparatus be re-dissolved by gentle heating.
d) 1 % ammonium persulphate solution: 0.1 g of am-
Any suitable vertical electrophoresis apparatus with a monium persulphate is dissolved in 10 mL of distilled
cooling system and power supply may be used. water. This must be prepared freshly on each occasion,
immediately prior to use.
e) Stock sample extraction buffer solution: To 12.5 mL
8.9.2.2.2 Chemicals of stacking gel buffer (see 8.9.2.2.3b) is added 20 mL
glycerol, 24.1 mL of distilled water, 4 g of SDS and
All chemicals should be of ‘Analytical Reagent’ grade or 12 mg bromophenol blue (optional). This is mixed and
equivalent. stored at room temperature. If the SDS comes out of
solution, it can be re-dissolved by gentle heating.
– Acrylamide (‘specially purified for electrophoresis’) f) Gel fixing solution: To 400 mL methanol, 100 mL gla-
– Bisacrylamide (‘specially purified for electrophore- cial acetic is added and made up to 1 L with water.
sis’) (BIS) About 200 mL is needed per gel. (Note that it is pos-
– Tris (Tris [hydroxymethyl] methylamine) sible to use TCA at a final concentration of 15–20 %
– Glycine [2.3 g] in place of glacial acetic acid).
– Hydrochloric acid g) Gel staining solution:
– Sodium dodecyl sulphate (SDS) (1) 15 % trichloroacetic acid (TCA) (375 g made up to
– Glycerol 2.5 L with water)

– 2-mercaptoethanol (2) 1 % PAGE Blue or equivalent in methanol (1 g in
– Dimethylformamide 100 mL of methanol)
– Ammonium persulphate (APS) (or riboflavin) 200 mL of (1) plus 10 mL of (2) is sufficient for stain-
– NNN'N'-tetramethylethylenediamine (TEMED) ing one gel.
– Methanol
– Glacial acetic acid
– Trichloroacetic acid (TCA) 8.9.2.3 Procedure
– PAGE Blue G-90 (or PAGE Blue 83), (or any reagent
equivalent to the ‘Coomassie Brilliant Blue’ G or R 8.9.2.3.1 Pisum
series of dyes)
– Bromophenol Blue Finely ground Pisum cotyledon material is prepared from
individual seeds using an electric blender. A pestle and
mortar (or similar device) can be used if preferred. Diluted
sample extraction buffer is prepared by diluting the stock
sample extraction buffer (section 8.9.2.2.3e) in the ratio
17 buffer : 3 mercaptoethanol : 40 distilled water (make

up only a volume of the diluted extractant sufficient to be After careful mixing (do not cause ‘foaming’) the gel is
used within a day). slowly poured. If appropriate to the type of equipment, a
The finely ground seed meal is extracted with diluted 25 mL disposable syringe and needle can be used to pour
sample extraction buffer in the ratio 40 mg/1.0 mL, us- the gel mixture into the cassette. The gel should be poured
ing 1.5 mL polypropylene micro-centrifuge tubes. The to a height which leaves room for a 3–4 cm layer of stack-
samples are left for about 1 h at room temperature, re- ing gel. The gel surface is carefully overlaid with a 1 cm
suspended using a vortex mixer and heated for 10 min in a layer of distilled water (or isopropanol) using a Pasteur
boiling water bath. (A small slit can be made in the caps of pipette or syringe, and the gel is then left to polymerise
the tubes to prevent build-up of pressure.) After cooling, (about 1 h).
the tubes are centrifuged at 18 000 × g for 5 min and the Note that if de-gassing of the gel mixture is a problem,
clarified supernatants used for electrophoresis. it is possible to eliminate this step and use a three times
higher concentration of APS (i.e. 3.75 mL of a 3 % solu-
tion [0.3 g dissolved in 10 mL of distilled water]).
8.9.2.3.2 Lolium
8.9.2.3.3.2 Stacking gel
Seed meals for analysis are prepared by passing 0.5–2.0 g The overlaid water (or isopropanol) is removed from the
of seed through a hammer mill. If preferred, a rotor-type surface of the main gel with a Pasteur pipette and the gel
electric coffee grinder or other blender can be used. Di- surface is rinsed briefly with diluted stacking gel buffer
luted extraction buffer is prepared by diluting the stock (see 8.9.2.2.3b, stock buffer diluted 1:8) and then care-
sample extraction buffer (see 8.9.2.2.3e) in the ratio fully drained and dried using filter paper.
17 buffer : 6 mercaptoethanol : 10 dimethylformamide : To make sufficient stacking gel for 4 gels, as above,
17 distilled water (make up only a volume of this extract- the following is required:
ant sufficient to be used within a day). – 10 mL 1 M Tris buffer pH 6.8 (see 8.9.2.2.3b)
The seed meal is extracted with diluted sample extrac- – 67.2 mL gel solution (4.0 g of acrylamide + 0.07 g
tion buffer in the ratio of 80 mg/1.0 ml and subsequently BIS, made up to 67.2 mL with distilled water)
treated exactly as above (see 8.9.2.3.1).
De-gas (in a Buchner flask) and then add:
– 3.0 mL 1 % APS (see 8.9.2.2.3d)
8.9.2.3.3 Gel preparation – 0.8 mL 10 % SDS (see 8.9.2.2.3c)
– 80 µL TEMED (full strength, straight out of the
The clean and dry gel cassettes are assembled according bottle).
to the type of equipment in use. Note that if adhesive seal-
ing tape is used in the system, it is advisable to prepare the The stacking gel is poured (using a syringe, as before, if
cassettes at least one day in advance to allow the tape to appropriate) to the top of the gel cassette and an acrylic
‘age’ and adhere more tightly. Many types of vertical elec- well-forming ‘comb’ is inserted, ensuring that no air-bub-
trophoresis equipment have been found to be suitable. It is bles are trapped beneath the ‘teeth’. The gel is allowed to
strongly recommended that a gel of thickness of 1.5 mm polymerise (about 1 h). Again, de-gassing can be omitted
or less is used, as this seems to give better results. The if a higher concentration of APS is used. 3.0 mL of a 2 %
following instructions are for the preparation of a 12.5 % solution (0.2 g in 10 mL of distilled water) is sufficient.
acrylamide main gel and a 5 % stacking gel. As an alternative polymerisation system for the stack-
ing gel, it is possible to use a 0.008 % riboflavin solu-
8.9.2.3.3.1 Main (resolving) gel tion (freshly prepared), in place of APS. Polymerisation
To make 4 slab gels (180 × 140 × 1.5 mm), the following should occur if the gels are left in the light, but it may be
is required: necessary to use an ultraviolet lamp. The precise volume
– 56.4 mL 1 M Tris pH 8.8 (see 8.9.2.2.3a) to use should be determined by experimentation, to give a
– 86.25 mL gel solution (19.6 g acrylamide + 0.26 g polymerisation time of 30–60 min. However, as a guide,
BIS, made up to 90 mL with distilled water) about 7.5 mL of riboflavin should be used per 50 mL of
stacking gel mixture.
De-gas (in a Buchner flask) and then add:
– 3.75 mL 1 % APS (see 8.9.2.2.3d)
– 1.5 mL 10 % SDS (see 8.9.2.2.3c)
– 75 µL TEMED (full strength, straight out of the
bottle).

8.9.2.3.4 Electrophoresis 8.9.2.4 Evaluation of results
The electrophoresis tank buffer (or running buffer) com- This method is mostly used comparatively, i.e.: is the pro-
prises 3.0 g tris, 14.1 g glycine and 1.0 g SDS made up to tein pattern of the sample identical to that of the authentic
1 L with distilled water (it may be necessary to warm the reference variety? It is also useful to include on each gel
solution gently to dissolve the SDS). A sufficient volume a sample of a known variety with a well-described and
to fill the electrophoresis apparatus in use (top and bottom established protein banding pattern. This can serve as a
chambers) should be freshly prepared. quality standard for gels - if the banding pattern of the
The acrylic comb is removed from the stacking gel reference variety is clearly observed, then the gel can be
(with care; this gel is rather soft) and the resultant wells analysed to provide useful information. In addition, gels
are washed and partially filled with tank buffer (as above). can be ‘calibrated’ by the inclusion of standard proteins
The samples are loaded into the wells, using a syringe. of known molecular weights on each gel, which allows
The gel thickness and the size of the wells largely deter- the calculation of the molecular weights of protein bands
mine the volume of extract which is loaded. As a guide, of interest.
between 5 and 15 µL is appropriate in most cases. If re-
quired, bromophenol blue (5 µL of a 1 % aqueous solution
containing 10 % glycerol) can be added to a few wells 8.9.3 Zea mays (maize)
to act as a marker (this can also be incorporated into the
sample extraction buffer, see 8.9.2.2.3e). If the gel cas- 8.9.3.1 Principle
sette is sealed with adhesive tape, this is removed from
the lower (bottom) side only. The wells are filled with tank The standard reference method for the measuring hybrid
buffer (as above), taking care not to disturb the samples. purity and verifying varieties of Zea mays (maize) is by
The gel is placed in the tank. Electrophoresis is carried ultrathin-layer isoelectric focusing (UTLIEF). The alco-
out at 25 mA per gel until the tracking dye has migrated hol-soluble proteins (zeins) or water soluble proteins are
through the stacking gel and then at 45 mA per gel until extracted from individual maize seeds and separated by
the bromophenol blue is at the bottom of the gel. The tem- isoelectric focusing (IEF) in ultrathin-layer gels. The pat-
perature should be maintained at 15–20 °C, if possible, by tern of protein bands found on the gel is characteristic for
circulating tap-water (or coolant) through the tank buffer. a variety or an inbred line. Also, it is generally possible
to estimate the purity of hybrid samples by finding one or
more zein bands in the male parent that are lacking in the
8.9.2.3.5 Fixing and staining female parent (and present in the hybrid). These bands can
be used as marker bands for the verification of hybrids and
Several different approaches can be used for fixing and as a means of estimating hybrid purity.
staining the proteins. If results are not required very rap- Ultrathin gels can be run at higher voltages with short-
idly, then at the end of electrophoresis, the gel is removed er running times, and stain more quickly than convention-
from the tank, taken from the cassette and incubated in al gels.
fixing solution (see 8.9.2.2.3f), with slow shaking, for at
least 1 h. The gel is rinsed in distilled water (5 min), then

stained by incubation (at least 2 h, usually overnight) in gel 8.9.3.2 Apparatus and equipment
staining solution (see 8.9.2.2.3g). When properly stained,
the gel is rinsed in distilled water for 2–3 h (TCA can be 8.9.3.2.1 Apparatus
added if the background is very blue) and then sealed in a
polythene bag for examination or photography. Gels can Any suitable horizontal electrophoresis apparatus with a
be stored for many months at 4 °C, if sealed properly. cooling system and high voltage power supply may be
For more rapid staining, the gel can be fixed and stained used.
at a higher temperature (80 °C) in an oven for 30 min and
then, following cooling, de-stained in a solution contain-
ing 10 % glacial acetic acid and 35 % ethanol for a further 8.9.3.2.2 Chemicals
30–60 min, with shaking.
All chemicals should be of ‘Analytical Reagent’ grade or
equivalent.

– 2-Chloroethanol g) Gel destaining solution - ethanol (750 mL) and ace-

– Acrylamide (‘specially purified for electrophoresis’) tic acid (125 mL), made up to 2500 ml with distilled
– Bisacrylamide (BIS) (‘specially purified for water.
electrophoresis’)
– Ampholytes: pH 2–4, pH 4–6, pH 5–8 and pH 4–9
– Ammonium peroxydisulphate (APS) 8.9.3.3 Procedure
– N,N,N',N'-Tetramethylethylenediamine (TEMED)
– Urea 8.9.3.3.1 Protein extraction
– L-Aspartic acid
– L-Glutamic acid Either a single dry seed is bisected longitudinally and one
– L-Arginine (base) half crushed to a fine ‘semolina’ by hand (with pliers or
– L-Lysine pestle and mortar), or a whole single seed is taken and
– Ethylenediamine crushed.
– Trichloroacetic acid (TCA) Approximately 50 mg of the seed meal is extracted
– Coomassie Brilliant Blue G 250 (or equivalent) with 0.2 mL of extraction solution (8.9.3.2.3a) in a micro-
– Coomassie Brilliant Blue R 250 (or equivalent) titre plate or a microcentrifuge tube. The samples are left
– Ethanol (96 %) for about 1 h at 20 °C. After this time, the microtitre plate
– Acetic acid (99 %) or microtube is treated with ultrasound for 30 s and then
– ‘Gel-Slick’ (or ‘Repelsilane’, or equivalent) centrifuged at 2000 × g for 5 min. The clarified super-
natant is used for electrophoresis. Frozen at –20 °C, the
remaining extract will keep for up to 3 months.
8.9.3.2.3 Solutions
a) Extraction solution: 30 % (v/v) 2-chloroethanol 8.9.3.3.2 Gel preparation

(30 mL 2-chloroethanol made up to 100 mL with dis-
tilled water). This solution can be stored for at least Gels are made up either directly between two thin glass
two weeks at room temperature. Optional extraction plates or between a polyester carrier sheet held on glass
solution: distilled water. and a glass plate. The plates or sheets must be treated be-
b) Anode solution: L-aspartic acid (0.83 g) and L-glu- fore use, one (carrier) with a silylating reagent to make the
tamic acid (0.92 g) are dissolved in hot distilled water gel adhere and one (cover) with ‘Gel-Slick’ (or equiva-
and diluted to 250 mL. This solution can be stored for lent) to prevent gel adhesion. Commercially available pre-
two weeks at 4 °C. prepared gel carrier sheets (e.g. ‘Gel-Bond’) can also be
c) Cathode solution: L-arginine (base) (1.18 g), L-lysine used.
(0.91 g) and ethylenediamine (30.00 mL) are dissolved The clean and dry gel cassettes are assembled, accord-
in distilled water and diluted to 250 mL. This solution ing to the type of equipment in use. A gel thickness of
can be stored for two weeks at 4 °C. 0.12 mm is recommended, which can be achieved by the
d) Stock gel solution: acrylamide (16.57 g) and bisacryla- use of a defined thickness of adhesive tape) as a spacer.
mide (0.43 g) are dissolved in distilled water and di- The following are taken and mixed:
luted to 250 mL. This solution can be stored for up to – 50 mL stock gel solution (8.9.3.2.3d)
two weeks at 4 °C. – 16 g urea
e) Gel fixing solution: trichloroacetic acid (TCA)(approx. – 0.55 mL ampholytes (pH 2–4)
12 % (w/v) solution). Stock solution: 1 kg TCA dis- – 0.55 mL ampholytes (pH 4–6)
solved in 450 mL distilled water. Before use, 120 mL – 1.40 mL ampholytes (pH 5–8)
stock solution is diluted with 880 mL distilled water, – 1.90 mL ampholytes (pH 4–9)
to give an approximately 12 % TCA solution. About
400 mL is needed for one gel, and the solution can be Optional gel solution:
used up to three times. – 50 mL stock gel solution (8.9.3.2.3d)
f) Gel staining solution: Coomassie Blue R 250 (0.45 g), – 16 g urea
Coomassie Blue G 250 (1.35 g), acetic acid (330 mL) – 1.5 g taurin
and ethanol (540 mL) are mixed and made up to – 2.90 mL ampholytes (pH 5–8)
3000 mL with distilled water; 400 mL is sufficient for – 1.50 mL ampholytes (pH 2–11)
staining one gel.
Note: dissolve taurin first into the stock gel solution be-
cause of the slow solubility.

For polymerisation, 0.35 mL APS (20 % (w/v) solution 8.9.3.4 Evaluation of results
freshly prepared) and 0.05 mL TEMED (full strength) are
added carefully, to avoid introducing excessive amounts At present, the method is best used to verify varieties in a
of air. comparative way, by examining whether or not the protein
This will be sufficient for 10 gels of the dimensions pattern of the sample is identical to that of the authentic
240 × 180 × 0.12 mm (one gel requires 6.5 mL). After reference variety, analysed at the same time.
careful mixing, the gel is poured onto the carrier plate/ For hybrid seed, it is possible to determine hybrid pu-
sheet, the cover plate is carefully lowered and the gel ‘cas- rity (selfing rate). It is assumed that both parental lines
sette’ left to polymerise for at least 45 min. Gels not im- are homogeneous. When comparing the protein patterns
mediately used can be stored wrapped at 4 °C for at least of the female and male parents with the hybrid, one or
one week. more marker bands (present in the male only) need to be
found in the hybrid (Fig. 8.1). Given the presence of such
markers, hybrid purity can be determined by examining a
8.9.3.3.3 Electrophoresis suitable number of single seeds of a seed lot. Seeds with
a protein pattern identical to the female parent are judged
The gel is placed on the pre-cooled (10 °C) cooling plate to be self-pollinations (‘sibs’). Foreign pollinated seeds
of the horizontal electrophoresis apparatus. To ensure show a different pattern, mostly a protein band at an un-
better gel adhesion and cooling, a thin layer of water is expected place in the variety pattern. Seeds with a differ-
placed between the gel and the plate. The electrode wicks ent pattern may also occur if there is contamination with
are soaked in the appropriate solution (see 8.9.3.2.3b or another variety.
8.9.3.2.3c) and placed at either end of the gel. Samples With respect to the different types of hybrids, the eval-
(approx. 22 µL) are loaded in the applicator strip 0.5 cm uation is as follows:
below the bufferwick of the anode and focusing carried
out at 2500 V, 15 mA, 40 W for about 70 min until com- a) single cross hybrid (Fig. 8.2): only one banding pattern
pletion (for one gel). is characteristic for the hybrid, with bands inherited
from both male and female parents;
Notes:
a) Double-focusing is possible with this method and it is b) three-way cross hybrid (Fig. 8.3): The female parent is
then necessary to place the cathode wick in the centre a cross, and so contains protein bands from two lines.
of the gel, with anode wicks at both ends. Thus in the hybrid, there are two possible banding pat-
terns (male band plus one of two female bands) which
b) The precise conditions and times required for focusing are characteristic. However, experience shows that
will vary depending on the dimensions of the gel, the most hybrids exhibit only one banding pattern;
type of maize hybrid, inbred line etc., and may need to
be determined empirically. c) Double cross hybrid (Fig. 8.4): Both parents used in
hybrid production derive from single crosses, and
therefore four different banding patterns can occur in
8.9.3.3.4 Fixing and staining the hybrid seeds.

At the end of the electrophoresis, the gel is removed and The number of seeds to be tested for hybrid purity deter-
incubated in fixing solution (see 8.9.3.2.3e) with slow mination depends on the acceptable confidence intervals,
shaking, for at least 20 min. The gel is then stained by established for each individual case. It is suggested that
shaking in gel staining solution (see 8.9.3.2.3f) for 50 min. normally 200 single seeds are analysed, as a compromise
Destaining takes (solution 8.9.3.2.3g) about 15 min, fol- between precision of results and working time needed (see
lowed by brief rinsing in distilled water. The gel is dried Chapter 4, ‘Handbook of Variety Testing – Electrophoresis
overnight at room temperature or in an oven at 70 °C for Testing’, ISTA, 1992). For reports and issue of ISTA Cer-
20 min and can then be sealed with adhesive film. Gels tificates, analysis of 400 single seeds is required.
can be stored for many years at room temperature.

Fig 1:
Female
Female
Male
Male
Hybrid
Hybrid
Hybrid
Hybrid
Hybrid
Hybrid
Female
Female
Male
Male
Figure 8.1. Evaluation of different hybrid types. Detection of a marker band (grey) present in the male parent line but not
in the female.
Fig 2:
Female
Female
Male
Male
Hybrid
Hybrid
Self-pollination
Self-pollination
Figure 8.2. Evaluation of a single cross hybrid. Only one banding pattern characterises the hybrid; other patterns arise
from self-pollination (same patterns as female) or from contamination.
Fig 3:
Female
Female
Male
Male
Hybrid
Hybrid
Hybrid
Hybrid
Self-pollination
Self-pollination
Self-pollination
Self-pollination
Figure 8.3. Evaluation of a three way cross hybrid. The female line is itself a cross, and so according to Mendelian rules,
two hybrid banding patterns can occur (but most varieties show only one).

Fig 4:
Female
Female
Male
Male
Hybrid
Hybrid
Hybrid
Hybrid
Hybrid
Hybrid
Hybrid
Hybrid
Self-pollination
Self-pollination
Self-pollination
Self-pollination
Figure 8.4. Evaluation of a double cross hybrid. Both parental lines derive from crosses and so according to Mendelian
rules, four hybrid banding patterns can occur.
8.9.4 Avena sativa (oats) – Bisacrylamide (‘specially purified for

electrophoresis’)
8.9.4.1 Principle – Urea
– Glacial acetic acid
The standard reference method for verifying varieties of – Glycine
Avena sativa (oats) is by polyacrylamide gel electropho- – Ferrous sulphate
resis (PAGE). The urea/ethylene glycol-soluble proteins – Ascorbic acid
(primarily avenins) are extracted from seeds and separated – Hydrogen peroxide
by PAGE at pH 3.2. The pattern of protein bands can be – Pyronin G or Pyronin Y
considered as a ‘fingerprint’ of a variety. The ‘fingerprints’ – Trichloroacetic acid
can be used to identify (to verify the identity of) unknown – Ethylene glycol
samples and mixtures, by single seed analysis. – Methanol
As a guideline, it is recommended that 100 seeds are – Coomassie Brilliant Blue G 250 or Serva Blue G (or
used. Very precise estimates of varietal purity may require equivalent)
a larger sample. If a comparison is being made with a
standard sample, sequential testing using subsamples of
50 seeds can be undertaken in order to minimise the work- 8.9.4.2.3 Solutions
load. A simple check of the identity of a single major con-
stituent of a seed lot can be done using less than 50 seeds. a) Extraction solution: Pyronin G (or Pyronin Y) (0.05 %
(w/v) in 3M urea (18 % w/v) in a 75:25 (v/v) mix-

ture of ethylene glycol and water (keep cold or prepare
8.9.4.2 Apparatus and equipment fresh).
8.9.4.2.1 Apparatus b) Stock tank buffer solution: glacial acetic acid (4 mL)
Any suitable vertical electrophoresis apparatus with a cold.
cooling system and power supply may be used.
c) Stock gel buffer solution: glacial acetic acid (20 mL)
8.9.4.2.2 Chemicals cold.
All chemicals should be of ‘Analytical Reagent’ grade or d) Fixing and staining solution: Coomassie Blue G 250
equivalent. or Serva Blue G (1 g) in methanol (250 mL) + 100 g
trichloroacetic acid dissolved in 800 mL water.
– Acrylamide (‘specially purified for electrophoresis’)

8.9.4.3 Procedure ple wells are completely filled. Electrophoresis is carried

out 10 min at 200 V and then at 500 V (constant voltage)
8.9.4.3.1 Protein extraction for twice the time taken for the pyronine G marker dye
to leave the gel. Water should be circulated through the
The lemma and palea are removed, then samples are buffer tank to maintain the temperature at 15–20 °C.
crushed with pliers and milled to a fine powder using a
pestle and mortar (an electric blender may be used).The
meal is extracted in 1.5 mL polypropylene centrifuge 8.9.4.3.4 Fixing and staining
tubes. Extraction solution (8.9.4.2.3a)(0.1 mL per ground
seed) is added, the contents of the tubes are thoroughly The gel cassette is removed from the tank, opened and
mixed with a vortex mixer and the tubes are allowed to the gel placed in a plastic box containing about 200 mL
stand for 2 h or overnight at room temperature. The tubes fixing and staining solution. Staining is complete in one
are centrifuged for 15 min at 14 000 × g and the superna- day. When properly stained, the gel is rinsed in distilled
tants used for electrophoresis. water for 2–3 h, and can then be photographed. Any blue
background in the gel is removed by rinsing in 10 % TCA
solution.
8.9.4.3.2 Gel preparation
Clean and dry cassettes are assembled, according to the 8.9.4.4 Nomenclature of avenin bands
design of the equipment. Treating the glass plates with sil-
icon prior to assembly can facilitate subsequent removal The method is best used comparatively, i.e., by compar-
of the gel. The gel cassettes can incorporate a plastic back- ing the avenin profile of an unknown sample with that of
ing sheet (e.g. ‘Gel Bond PAG’, FMC Corporation). This authentic reference samples extracted and analysed at the
supports the gel during subsequent operations. same time. There is no internationally agreed system of
To make 2 slab gels (160 × 180 × 1.5 mm), the follow- nomenclature for avenins, and bands are usually num-
ing is required: bered sequentially or their relative mobilities measured.
stock gel buffer (approx. 60 mL) and the following
added- acrylamide (12.5 g), bisacrylamide (0.4 g), urea
(6.0 g), ascorbic acid (0.1 g), ferrous sulphate (0.005 g). 8.9.5 Helianthus annuus (sunflower)
The solution is stirred and made up to 100 mL with stock
gel buffer solution. Freshly prepared 0.6 % (v/v) hydrogen 8.9.5.1 Principle
peroxide solution (0.2 mL per 100 mL of gel solution) is
added, mixed quickly and the gel poured. Note that the gel The standard reference method for the measuring hy-
mixture can be cooled to near freezing prior to the addi- brid purity and verifying varieties of Helianthus annuus
tion of the peroxide. An acrylic ‘comb’ is placed in the top (sunflower) is by ultrathin-layer isoelectric focusing (UT-
of the cassette, to make wells in the gel. LIEF). The alcohol-soluble proteins are extracted from
The gel mixture should over-fill the cassette, or be individual seeds and separated by IEF in ultrathin-layer
overlaid with water, to ensure satisfactory polymerisation gels. The pattern of protein bands found on the gel is char-
of the upper surface. Polymerisation should be complete acteristic for a variety or an inbred line. Also, it is gener-
in 5–10 min. ally possible to estimate the purity of hybrid samples by
finding one or more bands in the male parent that are lack-
ing in the female parent (and present in the hybrid). These
8.9.4.3.3 Electrophoresis bands can be used as marker bands for the verification of
hybrids and as a means of estimating hybrid purity.
The acrylic comb is removed from the gel and the sample Ultrathin gels can be run at higher voltages with short-
wells filled with tank buffer. The tank is filled with an ap- er running times, and stain more quickly than convention-
propriate volume of buffer (depending on the equipment al gels.
used). Samples (18 µL) are loaded into the wells and the
gel cassettes are placed in the tank, ensuring that the sam-

8.9.5.2 Apparatus and equipment d) Stock gel solution: Acrylamide (16.57 g) and bisacryl
amide (0.43 g) are dissolved in distilled water and di-
8.9.5.2.1 Apparatus luted to 250 mL. This solution can be stored for up to
two weeks at 4 °C.
Any suitable horizontal electrophoresis apparatus with a
cooling system and high voltage power supply may be e) Gel fixing solution: trichloroacetic acid (TCA) (ap-
used. prox. 12 % (w/v) solution). Stock solution: 1 kg
TCA dissolved in 450 mL distilled water. Before use,
120 mL stock solution is diluted with 880 mL distilled
8.9.5.2.2 Chemicals water, to give an approximately 12 % TCA solution.
About 400 mL is needed for one gel, and the solution
All chemicals should be of ‘Analytical Reagent’ grade or can be used up to three times.
equivalent.
f) Gel staining solution: Coomassie Blue R 250 (0.45 g),
– 2-Chloroethanol Coomassie Blue G 250 (1.35 g), acetic acid (330 mL)
– Acrylamide (‘specially purified for electrophoresis’) and ethanol (540 mL) are mixed and made up to
– Bisacrylamide (BIS) (‘specially purified for 3000 mL with distilled water; 400 mL is sufficient for
electrophoresis’) staining one gel.
– Ampholytes: pH 5–8 and pH 2–11 (or “Seed Mix pH
5–8/2–11” from SINUS) g) Gel destaining solution: ethanol (750 mL) and acetic
– Ammonium peroxydisulphate (APS) acid (125 mL), made up to 2500 mL with distilled
– N,N,N',N'-Tetramethylethylenediamine (TEMED) water.
– Urea
– Taurin
– L-Aspartic acid 8.9.5.3 Procedure
– L-Glutamic acid
– L-Arginine (base) 8.9.5.3.1 Protein extraction
– L-Lysine
– Ethylenediamine Either a single dry seed with or without seedcoat or one
– Trichloroacetic acid (TCA) half is crushed to fine pieces by hand (with pliers or pestle
– Coomassie Brilliant Blue G 250 (or equivalent) and mortar).
– Coomassie Brilliant Blue R 250 (or equivalent) The seed meal is extracted with 0.225 mL of extraction
– Ethanol (96 %) solution (8.9.5.2.3a) in a microtitre plate or a microcen-
– Acetic acid (99 %) trifuge tube. The samples are left for about 1 h at 20 °C.
– ‘Gel-Slick’ (or ‘Repelsilane’, or equivalent) After this time, the microtitre plate or microtube is treated
with ultrasound for 30 s and then centrifuged at 2000 × g
for 5 min. The clarified supernatant is used for electropho-
8.9.5.2.3 Solutions resis. Frozen at –20 °C, the remaining extract will keep for

up to 3 months.
a)
Extraction solution: 30 % (v/v) 2-chloroethanol,
i.e. 30 mL 2-chloroethanol made up to 100 mL with
distilled water. This solution can be stored at room 8.9.5.3.2 Gel preparation
temperature.
Gels are made up either directly between two thin glass
b) Anode solution: L-aspartic acid (0.83 g) and L-glu- plates or between a polyester carrier sheet held on glass
tamic acid (0.92 g) are dissolved in hot distilled water and a cover glass plate. The plates or sheets must be treat-
and diluted to 250 mL. This solution can be stored for ed before use, one (carrier) with a silylating reagent to
two weeks at 4 °C. make the gel adhere and one (cover) with ‘Gel-Slick’ (or
equivalent) to prevent gel adhesion. Commercially avail-
c) Cathode solution: L-arginine (base) (1.18 g), L-lysine able pre-prepared gel carrier sheets can also be used.
(0.91 g) and ethylenediamine (30.00 mL) are dissolved The clean and dry gel cassettes are assembled, accord-
in distilled water and diluted to 250 mL. This solution ing to the type of equipment in use. A gel thickness of
can be stored for two weeks at 4 °C. 0.12 mm is recommended, which can be achieved by the
use of a defined thickness of adhesive tape as a spacer.

The following components are taken and mixed: 8.9.5.3.4 Fixing and staining
– 50 mL stock gel solution (8.9.3.2.3d)
– 16 g urea At the end of the electrophoresis, the gel is removed and in-
– 1.5 g taurin cubated in fixing solution (see 8.9.5.2.3e) with slow shak-
– 2.90 mL ampholytes (pH 5–8) ing, for at least 20 min. The gel is then stained by shak-
– 1.50 mL ampholytes (pH 2–11) ing in gel staining solution (see 8.9.5.2.3.f) for 45 min.
Destaining takes (solution 8.9.5.2.3g) about 15 min, fol-
Note: dissolve taurin first into the stock gel solution be- lowed by brief rinsing in distilled water. The gel is dried
cause of the slow solubility. overnight at room temperature and can then be sealed with
adhesive film. Gels can be stored for many years at room
Optional gel solution: temperature.
– 50 mL stock gel solution (8.9.3.2.3d)
– 16 g urea
– 0.55 mL ampholytes (pH 2–4) 8.9.5.4 Evaluation of results
– 0.55 mL ampholytes (pH 4–6)
– 1.40 mL ampholytes (pH 5–8) At present, the method is best used to verify varieties in a
– 1.90 mL ampholytes (pH 4–9) comparative way, by examining whether or not the protein
pattern of the sample is identical to that of the authentic
For polymerisation, 0.35 mL APS (20 % (w/v) solution reference variety, analysed at the same time.
freshly prepared) and 0.05 mL TEMED (full strength) are For hybrid seed, it is possible to determine hybrid pu-
added carefully, to avoid introducing excessive amounts rity (selfing rate). It is assumed that both parental lines are
of air. homogeneous. When comparing the protein patterns of
This will be sufficient for 10 gels of dimensions 240 × the female and male parents with the hybrid, one or more
180 × 0.12 mm (one gel requires 6.5 mL). After careful marker bands (present in the male only) need to be found
mixing, the gel is poured onto the carrier plate/sheet, the in the hybrid (8.9.3.4, Fig. 8.1). Given the presence of
cover plate is carefully lowered and the gel ‘cassette’ left such markers, hybrid purity can be determined by exam-
to polymerise for at least 45 min. Gels not immediately ining a suitable number of single seeds of a seed lot. Seeds
used can be stored wrapped in cellophane at 4 °C for at with a protein pattern identical to the female parent are
least 14 days. judged to be self-pollinations (‘sibs’). Foreign pollinated
seeds show a different pattern, mostly a protein band at
an unexpected place in the variety pattern. Seeds with a
8.9.5.3.3 Electrophoresis different pattern may also arise due to contamination with
another variety.
The gel is placed on the precooled (10 °C) cooling plate The number of seeds to be tested for hybrid purity de-
of the horizontal electrophoresis apparatus. To ensure termination depends on the acceptable confidence inter-
better gel adhesion and cooling, a thin layer of water is vals, established for each individual case. It is suggested
placed between the gel and the plate. The electrode wicks that normally 192 single seeds are analysed, working with
are soaked in the appropriate solution (see 8.9.5.2.3b or 2 × 96 titre plates, as a compromise between precision of
8.9.5.2.3c) and placed at either end of the gel. Samples results and working time needed (see Chapter 4, ‘Hand-
(approx. 4 µL) are loaded in the applicator strip 0.5 cm book of Variety Testing – Electrophoresis Testing’, ISTA,
below the bufferwick of the anode and focusing carried 1992). For reports and issue of ISTA Certificates, analysis
out at 2500 V, 15 mA, 40 W for about 70 min until com- of 400 single seeds, working with 4 × 96 titre plates, is
pletion (for one gel). required.
Notes:
a) Double-focusing is possible with this method, and it is
then necessary to place the cathode wick in the centre
of the gel, with anode wicks at both ends.
b) The precise conditions and times required for focusing

will vary according to the dimensions of the gel and
the type of sunflower, inbred line etc., and may need to
be determined empirically.

8.9.6 Triticum (wheat) – Urea: 6 M

– Acetic acid: 25 mM
8.9.6.1 Principle – Pyronine G: 0.05 %
The standard reference method for verifying varieties of Add water to the final volume. Keep the solutions at room
Triticum is by acetic acid urea polyacrylamide gel elec- temperature.
trophoresis (A-PAGE). The alcohol-soluble proteins (glia-
dins) are extracted from seeds and separated by A-PAGE 8.9.6.5.1.2 Procedure
at pH 3.2. The pattern of protein bands produced (electro- Add 70 % ethanol at 200 µL per seed or per 50–60 mg
pherogram) is related to genetic constitution and can be flour. When using microcentrifuge tubes, mix the samples
considered as a ‘fingerprint’ of a variety. The ‘fingerprints’ with e.g. a vortex. With microtitre plates, mixing is not
can be used to identify unknown samples and mixtures, by necessary. Leave the sample in the dark at room tempera-
single seed analysis. ture for 1 h. Centrifuge, recover the clarified supernatant
in 1.5 mL tubes, then add 1 mL acetone stored at room
temperature. Proteins will precipitate in a few minutes
8.9.6.2 Equipment (keep at 4 °C if not used). Centrifuge, discard the acetone,
dry the pellet under the hood for 5 min. Add 150 µL of
– Any suitable vertical electrophoresis system sample buffer. The extraction is finished in about 2 h.
– Cooling system Extracts can be stored at 4 °C for some weeks.
– Power supply
– Hood
– Mixer 8.9.6.5.2 Extraction (option 2)
– Centrifuge
– Shaker 8.9.6.5.2.1 Solution
– Transilluminator – 2-Chlorethanol: 25–30 %
– Oven or drying equipment (gel dryer or glass plates – Pyronine G or methyl green: 0.05 %
and cellophane sheets)
Add water to the final volume. Keep the solution cold
(4 °C).
8.9.6.3 Chemicals
8.9.6.5.2.2 Procedure
All chemicals must be of ‘analytical reagent’ grade or bet- Add 150–200 µL extraction buffer. When using micro-
ter (acrylamide and bisacrylamide specially purified for centrifuge tubes, mix the samples with e.g. a vortex. With
electrophoresis). microtitre plates, mixing is not necessary. Incubate the
samples overnight at room temperature (approx. 20 °C).
If necessary, before loading the gel, centrifuge the
8.9.6.4 Sample preparation samples at 13 000 rpm for 15 min.
Extracts can be stored at 4 °C for some days.

Seeds can be ground, crushed or halved with pliers or
a razor blade and transferred to microcentrifuge tubes
(1.5 mL) or microtitre plates (200 µL). 8.9.6.6 Gel preparation and buffer tank
solutions
8.9.6.5 Extraction 8.9.6.6.1 Gel preparation (option 1)
8.9.6.5.1 Extraction (option 1) 8.9.6.6.1.1 Gel mix

– Acrylamide: 12 % (from 40 % solution)
8.9.6.5.1.1 Solutions – Bisacrylamide: 0.4 % (from 2 % solution)
a) Extraction solution – Acetic acid: 0.75 %
– Ethanol: 70 % prepared immediately before use – Urea: 12 %
– Acetone: concentrated – Ferrous sulphate: 0.0014 %
b) Sample buffer – Ascorbic acid: 0.1 %
– Glycerol: 30 % w/v

Add water to final volume (for example 80 mL for 2 gels 8.9.6.6.2.3 Buffer tank solution
of 16 cm × 18 cm × 1.5 mm thick). Mix until complete Only one buffer: 0.4 % glacial acetic acid (v/v) + 0.04 %
dissolution. glycine (w/v) + water to final volume
8.9.6.6.1.2 Polymerisation starter

– Hydrogen peroxide: 100 vol, 0.001 % (v/v), final gel 8.9.6.7 Loading samples
concentration.
5–20 µL, depending on the equipment used.
Gel preparation should be done quickly because polymeri- Loading can be performed using a syringe, a multichannel
sation is very rapid. Cooling the cassettes to 4 °C before syringe, a pipette or a multichannel pipette.
filling with the gel mix helps to delay the polymerisation.
8.9.6.6.1.3 Buffer tank solutions 8.9.6.8 Electrophoresis

– Upper tank buffer: 700 mL water + 1 mL acetic acid
(0.143 % v/v) 8.9.6.8.1 Electrophoresis (option 1)
– Lower tank buffer: 4000 mL water + 10 mL acetic acid
(0.25 % v/v) – Constant voltage: 500 V for the chamber.
Water should be circulated through the buffer tank to

8.9.6.6.2 Gel preparation (option 2) maintain the buffer temperature at 18 °C.
8.9.6.6.2.1 Gel mix – Running time: 2 times the time required for the dye to
– Acrylamide: 10 % final concentration (from solution leave the gel.
or powder)
– Bisacrylamide: 0.4 % Final concentration (from solu-
tion or powder). 8.9.6.8.2 Electrophoresis (option 2)
Or use a pre-prepared gel mix of acrylamide and – Constant current: 40 mA for each gel.
bisacrylamide.
Water should be circulated through the buffer tank to
Note: The powder forms of acrylamide and bisacryla- maintain the buffer temperature at 10–20 °C.
mide are much more readily inhaled, as they are very
light and highly electrostatic, so the powder floats in – Running time: 2 times the time required for the dye to
the air as soon as the bottle is opened. Handle in a leave the gel.
fume hood.
– Urea: 6 % 8.9.6.9 Fixing and staining

– Ferrous sulphate: 0.005 %
– Ascorbic acid: 0.005– 0.1 % 8.9.6.9.1 One-step fixing and staining (option 1)
Add the following buffer: 0.1 % glycine (w/v), 2 % gla- – Stock Coomassie: Coomassie Blue R 250 1 g/100 mL
cial acetic acid (v/v) and water to final volume. Mix until ethanol. Store this solution at 4 °C in a dark bottle.
complete dissolution. – Fixing and staining solution: 2.5 % stock Coomassie
Blue R 250 (v/v) + 6.25 % trichloroacetic acid (TCA)
8.9.6.6.2.2 Polymerisation starter (w/v), water to 400 mL, or use a pre-prepared solution.
– Hydrogen peroxide: 100 vol, 0.002–0.003 % (v/v),
30 %, final gel concentration. This solution is enough for 2 gels 16 × 18 cm × 1.5 mm
thick. Shake overnight with orbital shaker. The solution
Gel preparation should be done quickly because polymeri- can be used once only.
sation is very rapid. Cooling the cassettes to 4 °C before
filling with the gel mix helps to delay the polymerisation.

8.9.6.9.2 One-step fixing and staining (option 2) 8.9.7 Triticum and ×Triticosecale (wheat
and triticosecale)
– Stock Coomassie: 0.25 % (w/v) Coomassie Blue
G 250 + 0.75 % (w/v) Coomassie Blue R 250 + water 8.9.7.1 Principle
to complete volume, or use a pre-prepared solution.
– Fixing and staining solution: 8.3 % (w/v) trichloro- The standard reference method for verifying varieties of
acetic acid (TCA) + 5.8 (v/v) acetic acid + 12.5 % Triticum and ×Triticosecale is by sodium dodecyl sul-
(v/v) ethanol + 2 % (v/v) stock Coomassie. phate polyacrylamide gel electrophoresis (SDS-PAGE).
Seed proteins are extracted from individual seeds, treated
Staining is complete after 1 day, but at the earliest after with SDS and separated using a discontinuous SDS-PAGE
4 h. The solution can be used six times. procedure. The pattern of protein bands found on the gel is
characteristic of a variety.
As a guideline, it is recommended that 100 individual
8.9.6.9.3 Two-step fixing and staining (option 3) seeds are used. Very precise estimates of varietal purity
may require a larger sample. If a comparison is being made
– Stock Coomassie: 0.25 % (w/v) Coomassie Blue G 250 with a standard value, sequential testing using batches of
+ 0.25 % (w/v) Coomassie Blue R 250, complete vol- 50 seeds can be undertaken in order to minimise the work-
ume with ethanol 100 %, or use a pre-prepared solu- load. A simple check on the identity of a single major con-
tion. Store the solution at 4 °C in a dark bottle. stituent of a seed lot can be done using less than 50 seeds.
– Fixing solution: 10 % TCA. Store at room temperature
under hood.
– Staining solution: 20 % stock Coomassie (v/v) + 8 % 8.9.7.2 Equipment
acetic acid (v/v). Add water to complete volume. Store
under hood at room temperature in a dark bottle. Any suitable vertical electrophoresis system may be used.
1. Fix gels in TCA 10 % for 1 h. Gels can be saved in this
solution for few days. 8.9.7.3 Chemicals
2. Stain the gels for approx. 3 h or overnight.
All chemicals must be of ‘analytical reagent’ grade or bet-
The fixing and staining solutions can be used six times. ter (acrylamide and bisacrylamide specially purified for
electrophoresis).
8.9.6.10 Destaining – Acrylamide 40 % solution

– Bisacrylamide 2 % solution
Destaining with tap water: rinse the gels 1–2 times (30 min – Urea
each). For slow destaining, use a 10 % TCA solution. – Glycine
– Ammonium persulphate (APS) and TEMED
– 2-Mercaptoethanol

8.9.6.11 Storage of the gels – Sodium dodecyl sulphate (SDS) (10 % stock solution)
– Tris
Gels can be kept in either 10 % TCA solution or in a glyc- – Pyronine G/bromophenol Blue
erol solution (3 %), and then dried between two cello- – Coomassie Blue R 250
phane sheets, photographed or scanned. – Coomassie Blue G 250
In polyethylene bags gels can be stored at 4 °C for – Purified water
months without deterioration. After drying, gels can be
stored for years.
8.9.7.4 Sample preparation
Single seeds crushed with pliers or alternatively 50–70 mg

of flour are transferred to 1.5 mL polypropylene centri-
fuge tubes or microtitre plates.

8.9.7.5 Extraction Or use a pre-prepared gel mix of acrylamide and

bisacrylamide.
8.9.7.5.1 Extraction buffer
– Tris-HCl 1 M pH 8.8: 30 mL
– Urea: 4.5 M, 3 % – SDS 10 %: 0.8 mL
– 2-Mercaptoethanol: 10 % SDS – Water: 20.8 mL
For polymerisation:
8.9.7.5.2 Extraction procedure – APS: 1 % 2 mL
– TEMED: 40 µL
Add 150–500 µL (depending on the equipment used)
of the extraction buffer and thoroughly mix the sample. Add the reagents to a 76.80 mL of resolving gel solution.
Leave to stand overnight at room temperature. With mi-
crotitre plates, mixing is not necessary.
Heat the samples in a boiling water bath for 10 min 8.9.7.6.3 Tank buffer
and allow to cool. Before the gel is loaded, the tubes are
centrifuged at 18 000 × g. With microtitre plates, heating – Tank buffer stock solution: tris 0.0250 M, glycine
is not necessary. 0.187 M, SDS 1 %, pH 8.3
– Glycine: 141.1 g
– Tris: 30.0 g
8.9.7.6 Gel preparation – SDS: 10.0 g
Two gels, 16 × 18 cm, 1.5 mm thickness, depending on the Make up to 1000 mL with water. Dilute the stock solution
equipment used. 1:10 before use.
8.9.7.6.1 Stacking gel 8.9.7.7 Loading samples
– Stacking gel: acrylamide 3 %, 0.125 M Tris-HCl, 10–15 µL, depending on the equipment used. Loading can
pH 6.8. be performed using a syringe, a multichannel syringe, a
– Acrylamide 40 % solution: 1.5 mL pipette or a multichannel pipette.
– Bisacrylamide 2 % solution: 0.43 mL
Or use a pre-prepared gel mix of acrylamide and 8.9.7.8 Electrophoresis

bisacrylamide.
Two gels, 16 × 18 cm, 1.5 mm thickness, depending on the
– Tris-HCl 1 M pH 6,8: 2.5 mL equipment used.
– SDS 10 %: 0.16 mL
– Water: 14.87 mL – Stacking gel: constant voltage at 100 V (about 40 mA)

– Running gel: 80 mA (max. 400 mA)
For polymerisation:
– APS 1 %: 0.75 mL Water should be circulated through the buffer tank to
– TEMED: 20 µL maintain the temperature at 15–20 °C.
Stop the run 40 min after the tracking dye has reached
Add the reagents to a 19.46 mL of stacking gel solution. the bottom of the gel.
8.9.7.6.2 Resolving gel 8.9.7.9 Fixing and staining
– Resolving gel: acrylamide 10 %, 0.375 M Tris-HCl, Fixing:

pH 8.8 – TCA 15 %, approx. 30 min
– Acrylamide 40 % solution: 20 mL
– Bisacrylamide 2 % solution: 5.2 mL Staining, solution A:
– Coomassie Blue G 250 0.25 g
– Coomassie Blue R 250 0.75 g

Made up to 100 mL with water, or use a pre-prepared not be sufficient to provide unique allele profiles for all of
solution. the varieties that may be encountered. In such cases the
analysis may be enhanced through the addition of recom-
Staining, solution B: mended supplementary microsatellite markers, or other
– TCA: 27.5 g suitable microsatellites markers.
– Acetic acid: 32.5 mL
– Ethanol: 90 mL
– Solution A: 12.5 mL 8.10.2 Triticum (wheat)
Water to 400 mL. Stain overnight at room temperature. The standard reference DNA-based method for verifying
varieties of Triticum is by analysis of a minimum of eight
microsatellite markers. Verification of the identity of a
8.9.7.10 Destaining single-constituent seed lot may be achieved using pooled
seed samples or analysis of a small number of individual
Destaining with tap water: rinse the gels 1–2 times (30 min seeds. Estimates of varietal purity will require analysis of
each). For slow destaining, use a 10 % TCA solution. larger numbers of individual seeds; sample sizes of great-
er than 100 may be required for precise estimates.
8.9.7.11 Storage of the gels

8.10.2.1 Microsatellite markers
Gels can be kept in either 10 % TCA solution or in a glyc-
erol solution (3 %), and then dried between two cello- Table 8.5 contains prescribed microsatellite markers re-
phane sheets, photographed or scanned. quired for reports and issuance of ISTA Certificates.
In polyethylene bags gels can be stored at 4 °C for Addition of 5′-tail sequences for labelling using a
months without deterioration. After drying gels can be universal primer approach, or direct labelling through
stored for years. the addition of a fluorophore, are the only modifications
permitted to PCR primers of the prescribed microsatellite
markers.
8.10 DNA-based methods Table 8.6 contains recommended supplementary mi-
crosatellite markers. Their use is optional.
8.10.1 Principles of DNA-based methods
DNA is extracted from seeds and a minimum number of 8.10.2.2 Recommended DNA extraction
microsatellite markers are amplified by the polymerase protocol
chain reaction (PCR). The amplified DNA fragments are
separated according to size using electrophoresis and de- The following procedure is suitable for extraction of DNA
tected using an appropriate technique. Generally, electro- from individual seeds or pools of up to 10 seeds. Portions
phoresis and fragment detection are accomplished concur- (400 mg) of finely ground bulk samples may also be used

rently by the same instrument. Alleles are defined by length as starting material, in which case the initial pulverisation
(number of base pairs). Allele profiles are characteristic step may be omitted.
of variety and can be used to identify unknown samples. To make one litre of extraction buffer, the following
Mixtures may be assessed by single seed analysis. are combined and mixed well:
The procedure consists of several stages, including – 200 mL 1 M Tris-HCl (pH 7.5)
DNA extraction, PCR amplification, fragment separation – 16.8 g NaCl
and detection, and evaluation of results. Although recom- – 50 mL 0.5 M EDTA (pH 8.0)
mended protocols are provided, in line with the principles – 5 g SDS
of a SPBA, testing may be carried out using any suitable – ultrapure water to 1 L final volume
procedure for each stage of the process so long as the pro-
cedures have been validated as fit for purpose and the end For each kernel or pool of seeds to be extracted, a sin-
result meets acceptable standards as set by ISTA. A core gle grinding bead (such as a Qiagen 5 mm stainless steel
set of microsatellite markers is prescribed; its use is re- bead) is placed in a 2 mL round-bottom microcentrifuge
quired for reports and issuance of ISTA Certificates. In tube. Individual seeds are crushed with needle-nose pli-
some circumstances, the prescribed set of markers may ers as they are placed into the tubes. The seeds are then

Table 8.5. Prescribed microsatellite markers and PCR primers for verification of wheat varieties
Marker Forward primer Reverse primer Source

DuPw167 cggagcaaggacgatagg caccacaccaatcaggaacc a
DuPw217 cgaattacacttccttcttccg cgagcgtgtctaacaagtgc a
DuPw004 ggtctggtcggagaagaagc tgggagcgtacgttgtatcc a
DuPw115 tgtttcttcctcgcgtaacc cctcgaatctcccagttatcg a
DuPw205 atccagatcacaccaaacgg cttccgcttcatcttcttgc a
Xgwm155 caatcatttccccctccc aatcattggaaatccatatgcc b
Xgwm413 tgcttgtctagattgcttggg gatcgtctcgtccttggca b
Xgwm003 gcagcggcactggtacattt aatatcgcatcactatccca b
a
Eujayl et al. (2002). Isolation of EST-derived microsatellite markers for genotyping the A and B genomes of wheat. Theoretical
and Applied Genetics 104, 399–407
b
Röder et al. (1998). A microsatellite map of wheat. Genetics 149, 2007–2023
Table 8.6. Recommended supplementary microsatellite markers and PCR primers for verification of wheat varieties
Marker Forward primer Reverse primer Source

Xgwm372 aatagagccctgggactggg gaaggacgacattccacctg b
Xbarc347 gcgcacctctcctcaccttct gcgaacatggaaatgaaaactatct a
Xbarc184 ttcggtgatatcttttccccttga ccgagttgactgtgtgggcttgctg a
Xbarc074 gcgcttgccccttcaggcgag cgcgggagaaccaccagtgacagagc a
Xgwm052 ctatgaggcggaggttgaag tgcggtgctcttccattt b
Xgwm095 gatcaaacacacacccctcc aatgcaaagtgaaaaacccg b
a
Song et al. (2005). Development and mapping of microsatellite (SSR) markers in wheat. Theoretical and Applied Genetics 110,
550–560
b
Röder et al. (1998). A microsatellite map of wheat. Genetics 149, 2007–2023
pulverised for 1 min at 30 Hz in a mixer mill (such as a 8.10.2.3 Recommended PCR procedures
Qiagen TissueLyser II). The tubes are then tapped on the
countertop to settle the contents and 1.25 mL extraction The microsatellite markers comprising the prescribed and
buffer is added to each, followed by agitation at 30 Hz for recommended supplementary marker sets were selected in
30 seconds in a mixer mill. Solids are pelleted by centrifu- part because they are compatible in multiplexed analyses;
gation for 5 minutes at ~5800 × g. each set is amenable to amplification in a single PCR.
For each extract, 750 μL of supernatant is transferred Fluorescent labelling can be accomplished using a uni-
to a 1.5 mL microcentrifuge tube containing an equal versal primer approach (Oetting et al., Genomics. 1995
volume of isopropanol. Mixing is accomplished through Dec 10;30(3):450–8) in which the M13 sequence 5′-CAC-
repeated inversion. Precipitated DNA is then pelleted by GACGTTCTAAAACGAC-3′ is added to the 5′ end of
centrifugation for 2 min at ~ 4000 × g. The supernatant is each forward primer and a single fluorescently labelled
poured off; the remaining liquid is collected at the tube M13 primer having the identical sequence is included in
bottom by brief centrifugation and then removed with a the reaction mixture. During PCR, this universal fluores-
pipette. cent primer hybridises with complementary sequences
Pellets are allowed to air-dry for about 15 min before generated in early amplification cycles, resulting in the
resuspension in 200 μL ultrapure water, assisted by agi- synthesis of fluorescent products for all of the microsatel-
tation for 15 seconds at 30 Hz in a mixer mill. Immedi- lite markers in the reaction.
ately prior to use in PCR, any remaining solids should be
pelleted by centrifugation for at least 5 min at maximum
speed in a microcentrifuge. Single-seed extracts can be
used directly in PCR; for preparations from seed pools, a
1:10 dilution in ultrapure water should be used.

Table 8.7. Recommended reaction composition for multiplexed PCR amplification of microsatellite markers for verifica-
tion of wheat varieties
Amount per reaction (µL) Component Final concentration

Xa Ultrapure H2O
1 10 × PCR buffer b 1×
0.6 c 25 mM MgCl2 1.5 mM
0.25 d Each forward primer (2 µM stock) 0.05 µM
0.25 Each reverse primer (2 µM stock) 0.05 µM
0.25 Labelled M13 primer (2 µM) 0.05 µM
0.8 dNTP mix (2.5 mM each dNTP) 0.2 mM each
0.1 Taq DNA polymerase (5 U/µL) 0.05 U/µL
a
Determined as the amount required to achieve a reaction volume of 9 µL (prior to addition of template DNA) and is dependent
upon the total number of PCR primers included.
b
Generally, the buffer should be as supplied with the DNA polymerase.
c
Amount shown assumes the PCR buffer does not contain MgCl2. If this is not the case, the amount of MgCl2 added should be
adjusted accordingly.
d
This is a suggested starting point. Concentrations in multiplexed reactions may require adjustment (generally within a range of
0.03 µM to 0.10 µM) for some markers depending upon relative product intensities observed. For a given microsatellite marker,
forward and reverse primers should be adjusted equally.
8.10.2.3.1 Reaction components Table 8.8. Recommended thermal cycling profile for PCR
amplification of microsatellite markers for verification of
A master mix with all reaction components except the wheat varieties
template DNA should be set up and aliquoted into reaction
tubes or plate wells. Table 8.7 contains a list of reagents Number of cycles Temperature Duration
for a single 10 µL reaction. 1 94 °C 3 min
When preparing a master mix, component quantities 58 °C 1 min
72 °C 1 min
are determined by multiplying the amounts indicated per
34 94 °C 30 s
reaction by the number of samples to be tested, plus one
58 °C 30 s
extra to accommodate pipetting inaccuracies. The com- 72 °C 30 s
ponents should be combined in a microcentrifuge tube in 1 (final extension) 72 °C 5 min
the order listed. The mixture should be gently vortexed, 1 (hold) 20 °C indefinitely
briefly centrifuged to collect contents at the bottom of the
tube and then distributed into reaction tubes or wells (9 µL
each). Lastly, 1 µL template DNA (prepared as described 8.10.2.4 Evaluation of results
in 8.10.2.3) is added to each, resulting in a final reaction
volume of 10 µL. This method is best used to verify varieties in a compara-

tive manner, i.e., to determine whether the allele profile
of a sample is identical to that of an authentic reference
8.10.2.3.2 Thermal cycling profile variety. It can be useful, particularly in gel-based analy-
sis systems, to include samples of known varieties with
The following thermal cycling profile (Table 8.8) has been known allele profiles to assist in the determination of sam-
used successfully with the prescribed and recommended ple allele sizes.
supplementary microsatellite markers. The total number Microsatellite variation may occur among seeds
of cycles may require alteration based on product intensi- within a variety of wheat. If analyses are performed on
ties achieved. individual seeds, reference profiles should be determined
using a sufficient number of individual authentic refer-
ence variety seeds to ensure that variation within a vari-
ety is adequately represented. If analyses are performed
on pooled samples, it is recommended that the reference
profiles used should also be based upon pooled seeds of
authentic reference varieties.

8.10.3 Zea mays (maize) quality can be verified by means of a 1 % agarose gel or
spectrophotometry. The quantity of the DNA may also be
The standard reference DNA-based method for verifying verified on an agarose gel or by using fluorometry or spec-
varieties of maize is by analysis of a minimum of eight trophotometry. Once the extraction procedure has been
microsatellite markers. Verification of the identity of a validated for the matrix, verification of DNA quality and
single-constituent seed lot may be achieved using pooled quantity may not be necessary for all samples.
seed samples or analysis of a small number of individual
seeds. Estimates of varietal purity will require analysis of
larger numbers of individual seeds; sample sizes of great- 8.10.3.3 Recommended PCR procedures
er than 100 may be required for precise estimates.
The microsatellite markers set was selected based on per-
formance in three comparative tests. The performance of
8.10.3.1 Microsatellite markers these markers in multiplex PCR has not been investigated.
Fluorescent labelling can be accomplished using a uni-
Use of the eight prescribed microsatellite markers versal primer approach (Oetting et al., 1995) in which the
(Table 8.9) is required for reports and issuance of ISTA M13 sequence 5′-CACGACGTTCTAAAACGAC-3′ is
Certificates. If these markers do not provide sufficient dis- added to the 5′ end of each forward primer and a single
crimination among the varieties for the purpose at hand, fluorescently labelled M13 primer having the identical se-
they may be supplemented with additional microsatellite quence is included in the reaction mixture. During PCR,
markers of the laboratory’s choosing. Addition of 5′-tail this universal fluorescent primer hybridises with com-
sequences for labelling, using a universal primer approach plementary sequences generated in early amplification
or direct labelling through the addition of a fluorophore, cycles, resulting in the synthesis of fluorescent products.
are the only modifications permitted to PCR primers of Fluorescent labelling can also be achieved through the ad-
the prescribed microsatellite markers. dition of fluorophores.
8.10.3.3.1 Reaction components

8.10.3.2 Recommended DNA extraction
protocol For each marker, a master mix with all reaction compo-
nents except the template DNA should be set up and ali-
DNA can be extracted using column-based kits; manual quoted into reaction tubes or plate wells. Reagents for a
procedures such as those based on CTAB are also ade- single 10 µL reaction are listed in Table 8.10.
quate for extraction of DNA from maize seeds. The DNA
Table 8.9. Prescribed microsatellite markers and PCR primersa for verification of maize varieties.
Marker Forward primer Reverse primer Approximate allele

size range (bp)
umc1545 gaaaactgcatcaacaacaagctg attggttggttcttgcttccatta 66–81

umc1448 atcctctcatctttaggtccaccg catatacagtctcttctggctgctca 165–180
umc1117 aattctagtcctgggtcggaactc cgtggccgtggagtctactact 140–168
umc1061 agcaggagtacccatgaaagtcc tatcacagcacgaagcgatagatg 99–108
phi109275 cggttcatgctagctctgc gttgtggctgtggtggtg 123–138
phi102228 attccgacgcaatcaaca ttcatctcctccaggagcctt 123–129
phi083 caaacatcagccagagacaaggac attcatcgacgcgtcacagtctact 123–135
phi015 gcaacgtaccgtacctttccga acgctgcattcaattaccgggaag 81–102
a
Source: www.maizegdb.org/data_center/ssr.

Table 8.10. Recommended reaction composition for PCR Table 8.11. Recommended thermal cycling profile for PCR
amplification of microsatellite markers for verification of amplification of microsatellite markers for verification of
maize varieties. maize varieties.
Amount per Master mix components Final concentration Number of cycles Temperature Duration
reaction (µL) 1 94 °C 10 min
1.95 ultrapure H2O to com- – 10 94 ºC 30 s
plete 6 µL 64 °C (decreasing 30 s
1 10 × PCR buffer a 1×
by 1 °C per cycle)
1.2 b 25 mM MgCl2 3 mM
72 °C 30 s
0.25 c forward primer 0.25 µM 30 94 ºC 30 s
(10 µM)
55 °C 30 s
0.25 reverse primer 0.25 µM
72 °C 30 s
(10 µM)
1 (final extension) 72 ºC 10 min
1.25 dNTP mix (10 mM) 0.125 mM
1 (hold) 10 °C indefinitely
0.1 Taq DNA polymerase 0.05 U
(5 U/µL)
a
Generally, the buffer should be as supplied with the DNA
polymerase. 8.10.3.4 Evaluation of results
b
Amount shown assumes the PCR buffer does not contain
MgCl2. If this is not the case, the amount of MgCl2 added This method is best used to verify varieties in a compara-
should be adjusted accordingly. tive manner, i.e., to determine whether the allele profile
c
This is a suggested concentration. For a given microsatel-
lite marker, forward and reverse primers should be adjusted of a sample is identical to that of an authentic reference
equally. variety. It can be useful, particularly in gel-based analy-
sis systems, to include samples of known varieties with
When preparing a master mix, component quantities are known allele profiles to assist in the determination of sam-
determined by multiplying the amounts indicated per re- ple allele sizes.
action by the number of samples to be tested, plus one If analyses are performed on individual seeds, refer-
extra to accommodate pipetting inaccuracies. The com- ence profiles should be determined using a sufficient
ponents should be combined in a microcentrifuge tube in number of individual authentic reference variety seeds to
the order listed. The mixture should be gently vortexed, ensure that variation within a variety is adequately repre-
briefly centrifuged to collect contents at the bottom of the sented. If analyses are performed on pooled samples, it
tube and then distributed into reaction tubes or wells (6 µL is recommended that the reference profiles used should
each). Lastly, 4 µL (approximately 2.5 ng/µL) of template also be based upon pooled seeds of authentic reference
DNA is added to each reaction tube, resulting in a final varieties.
reaction volume of 10 µL.
8.10.3.3.2 Thermal cycling profile 8.11 Examination of seedlings

A “Touchdown” program, where the annealing tempera- 8.11.1 Cereals
ture is decreased 1 °C per cycle from 64 °C until reach-
ing 55 °C, is recommended. The thermal cycling profile Certain varieties can be classified by the colour of their
presented in Table 8.11 has been used successfully with coleoptiles. Germinate the seeds on damp filter paper in
the prescribed markers in comparative tests, thus it is rec- dishes covered with glass plates. The colour of the co-
ommended for verification of maize varieties. The total leoptile can vary from green to violet and is determined
number of cycles may require alteration based on product when the seedlings have reached a suitable stage of de-
intensities achieved. velopment. It can be intensified by moistening the filter
paper with a 1 % solution of NaCl or HCl, or by illuminat-
ing the seedlings with ultra-violet light for 1–2 h before
examination.

8.11.2 Beta spp. showing fluorescent root traces should be pulled off the
filter paper while under the ultra-violet light in order to de-
Some varieties can be distinguished by seedling colour, tect fluorescence from roots which may have grown into
which may be white, yellow, pale red, or red. Sow the the paper. The numbers of fluorescent and non-fluorescent
seeds in damp sand in dishes placed in subdued daylight seedlings and the number of normal seedlings are record-
at room temperature. After seven days the seedlings are ed for each replicate. The results should be reported in
examined for hypocotyl colour. For sugar beet and white whole numbers.
fodder beet, the proportion of white to pale-red seedlings Reference: Dales, H. (1953). Technique of the Gentner
gives some indication of the genuineness of the cultivar. fluorescence test, a suggested modification. Proc. Int.
Seed Test. Ass., 18, 263–266.
8.11.3 Brassica spp.

8.11.5 Festuca spp.
In swede and turnip, white-fleshed varieties can be distin-
guished from yellow-fleshed varieties by the colour of the Festuca rubra L. and Festuca ovina L. can be distin-
cotyledons, which are lemon-coloured in white-fleshed guished in the same way as Lolium spp. The roots them-
varieties and orange-coloured in yellow-fleshed varieties. selves show fluorescence in an atmosphere containing am-
Germinate the seeds in darkness at 20<=>30 °C. After five monia; those of F. rubra are yellow-green in ultra-violet
days the cotyledons are transferred to Petri dishes con- light while the roots of F. ovina are bluish green.
taining alcohol (85–96 %) and placed on a white surface. The seeds are germinated using the method described
After 4 h the colour is determined. for Lolium spp. in 8.9.4 with the count being made after
14 days or 21 days if development is not sufficient at 14
days. While under UV light the roots on the substratum
8.11.4 Lolium spp. are treated with ammonia gas produced from a plastic
bottle (‘spraying bottle’) partially filled with a solution of
In most varieties of Lolium multiflorum the root traces ammonia in water. A weak solution (producing enough am-
of the majority of the seedlings show fluorescence under monia to smell) is adequate for this purpose.
ultra-violet light, whereas in most varieties of Lolium per- Reference: Linder, H. (1958). Eine einfache und si-
enne the root traces of the majority of the seedlings do not chere Methode zur serienmässigen Unterscheidung der
show fluorescence. The fluorescence test alone, however, Spelzfrüchte von Festuca rubra und ovina. Z.-landw.
is not always a sufficient basis for the identification of a Vers. -u. Unters. Wes., 4, 411–416.
species or a cultivar, because many of the varieties grown
contain a certain number of plants which do not give the
typical reaction for the species. Further, several of the hy- 8.12 Examination of plants in field
brid forms between the two species may give an interme- plots
diate reaction.
For determination of the reaction of seedling root If the germination of the samples being sown varies sig-
traces to ultra-violet light, the seeds are placed on suitable nificantly, the weight of seed sown should be adjusted ac-
non-fluorescent white filter paper moistened with water cordingly to ensure that approximately equal numbers of
for germination within the 20–30 °C range using either plants are established in all plots of the same species.
an alternating or constant 20 °C temperature, in darkness If a seed drill is used, it must be carefully checked to
or weak light (not more than 250 lux), under conditions ensure that it contains no seed of a previous sample before
where no drying occurs; the seeds are spaced and arranged another sample is poured into it.
so as to prevent entwining of the roots and confusion of
the fluorescent traces. For other germination conditions
(pre-chilling etc.) see Chapter 5. The examination should 8.12.1 Cereals, legumes and oil plants
be made only when the roots are sufficiently well devel-
oped, which may not be until the fourteenth, or in the case Each sample should be sown in plots of a convenient num-
of dormant seed the eighteenth day. The seedlings are ex- ber of rows. Distances of 200–250 mm between rows for
amined under ultra-violet light from a lamp transmitting cereals and flax, and 400–500 mm for the other species
radiations between 300 nm and 400 nm, with maximum listed below are recommended. Table 8B shows the opti-
radiation between 360 nm and 370 nm, and a trace of vis- mum numbers of plants per metre of row.
ible light. The examination must be made in such a man-
ner that all seedlings, whose roots produce traces which
fluorescence to any degree can be detected. Seedlings not

Table 8B. Optimum number of plants per metre of row 8.12.2 Herbage plants
Species Number of plants Rows of about 15 m total length with a distance of 300–
Linum 100 450 mm between the rows are recommended.
Cereals 60 A spaced plant technique should be used where there
Brassica 30
is a possibility of distinguishing between two or more
Vicia faba 10
varieties by the study of single plants. Single plants are
Other Vicia spp. 30
Papaver 50
normally obtained by sowing the seeds separately in the
Pisum 30 laboratory or greenhouse. When the plants have grown to
Lupinus 30 suitable size they are transplanted into field plots. Sowing
Glycine 30 of seed in situ may be possible under favourable condi-
tions, in which case seedlings are thinned to single plants.
The distance between plants should be at least 600 mm in
It is possible to distinguish between different varieties of both directions. For comparison, single plants of standard
the young plants of many species to the extent that mix- samples must also be planted out. The number of plants
tures of varieties or large admixtures of other varieties can will depend on the replication and on the statistical treat-
be determined. However, it is during the time after earing ment to be applied.
(cereals) or the beginning of flowering (other species) that Dissimilarities in plants of different varieties become
the most distinct differences between plants of individual visible throughout the entire growing period. Consequent-
varieties become apparent; consequently it is during these ly, the examination must extend over this entire period.
periods that each individual plant should be examined. However, it is the period from the beginning of flowering
In certain species, admixture of other varieties can be (clovers) or earing (grasses) to the conclusion of growth
determined by laboratory methods (8.5.3). Such admix- that offers the best opportunities for evaluating the sam-
tures should be removed and recorded prior to sowing the ples. The plants must be inspected several times during
sample. this period.
For further details of the current OECD Seed Schemes, For further details see report of the ISTA Variety Com-
see: mittee presented at the Washington Congress in 1971
http://www.oecd.org/agriculture/code/seeds.htm (Proc. Int. Seed Test. Ass., 37, 441, 1972).
8.12.3 Root and other crops grown

spaced in rows
Each plot should consist of two or more rows of sufficient
total length to provide at least 400 plants for examination.
Examination must be carried out during the entire peri-
od of growth. In the case of root crops, however, the prin-
cipal examination must be made at completion of growth,

after the roots have been lifted and placed in rows, so that
differences in shape and colour can be clearly seen.

International Rules for Seed Testing Chapter 9: Determination of moisture content
Chapter 9: Determination of moisture content
9.0 Basic reference method for Further information and details on the procedures used
determination of moisture content to introduce new species are given in the current ISTA
Handbook on Moisture Determination.
The basic reference method for the introduction of a new
species and methods into the Rules is the low-constant-
temperature oven method, i.e. 17 h at 103 °C. Com- 9.1 Determination of moisture
parative testing must be completed to validate that the content by the constant-
moisture determination for the new species can be done
accurately and reproducibly between laboratories using temperature oven method
17 h at 103 °C.
9.1.1 Object
9.0.1 Test necessity for grinding The object is to determine the moisture content of seeds
by an oven method for routine use.
The necessity for grinding depends on factors such as seed
size and seed coat permeability to water. However, if the
seed size is too small to meet the requirements for fine 9.1.2 Definition
grinding then testing for the effect of grinding is not nec-
essary. Testing the effect of grinding is compulsory before The moisture content of a sample is the loss in weight
a new species can be introduced into these Rules. when it is dried in accordance with the methods described
Characteristics of the seed, such as high moisture or an in this chapter. It is expressed as a percentage of the weight
extremely hard seed coat, may prevent grinding. In these of the original sample.
circumstances, breaking or cutting the seed into pieces no
larger than 7 mm across is permissible.
9.1.3 General principles
9.0.2 Test for acceptance of the high- The methods prescribed are designed to reduce oxida-
constant-temperature method tion, decomposition or the loss of other volatile substanc-
es while ensuring the removal of as much moisture as
The test for acceptance of the high-constant-temperature possible.
method, i.e. 1, 2, 3 or 4 h at 130 °C, is not compulsory

and is only required when a request for the inclusion of
the high-constant-temperature method is made. It involves 9.1.4 Apparatus
comparing the reference method with the high-constant-
temperature method in a comparative test. The following apparatus is required, depending on the
Further information and details on the procedures used method used:
to introduce new species are given in the current ISTA – a grinding mill;
Handbook on Moisture Determination. – an electrically heated oven;
– containers;
– a desiccator;
9.0.3 Test for acceptance of the low- – a balance;
constant-temperature method – sieves;
– a cutting tool.
The test for acceptance of the low-constant-temperature
method, i.e. 17 h at 103 °C, is required where the high-
constant-temperature method is the method in the Rules. It
involves comparing the low-constant-temperature method
with the high-constant-temperature method in a compara-
tive test.

Chapter 9: Determination of moisture content International Rules for Seed Testing
9.1.4.1 Grinding mill 9.1.4.5 Balance
The grinding mill must: The balance must be capable of weighing to an accuracy
– be made of material which does not absorb moisture, of at least ±0.001 g.
– be easy to clean and have as little dead space as
possible,
– enable grinding to be carried out rapidly and uniform- 9.1.4.6 Sieves
ly, without appreciable development of heat and, as far
as possible, without contact with the outside air, Wire sieves with meshes of 0.50, 1.00, 2.00 and 4.00 mm
– be adjustable so as to obtain particles of the dimen- are required.
sions indicated in 9.1.5.4.
9.1.4.7 Cutting tool

9.1.4.2 Constant-temperature oven
Where cutting is required according to Table 9A Parts 1
The oven must be electrically heated, and capable of be- and 2, any suitable cutting instrument can be used, for ex-
ing controlled in such a way that during normal opera- ample a knife, a scalpel or pruning secateurs.
tion the temperature of the air and of the shelves is 103 or
130 °C in the area where the samples are being dried. The
oven must have a heat capacity such that, when initially 9.1.5 Procedures
adjusted to a temperature of 103 or 130 °C, it can regain
this temperature in less than 30 minutes after insertion of 9.1.5.1 General directions and precautions
the maximum number of test samples that can be dried
simultaneously. See Table 9A Parts 1 and 2 for directions for individual
The drying capacity of the oven must be determined species.
using a species that requires high temperature and a dry- The submitted sample (see 2.5.1.5–2.5.1.7 and 2.5.4.4)
ing time less than or equal to 2 h. may be accepted for moisture determination only if it is in
The ventilation must be such that after drying (2 h at an intact, moisture-proof container (or, if issuing a Blue
130 °C or 17 h at 103 °C), cooling and re-drying (1 h at International Seed Sample Certificate, apparently mois-
130 °C or 2 h at 103 °C) the maximum number of test por- ture-proof) from which as much air as possible has been
tions, the results from the individual test portions do not excluded.
differ by more than 0.15 % (for either temperature). The determination must be started as soon as possi-
ble after receipt. Prior to testing, the temperature of the
sample must be equilibrated to that of the testing labora-
9.1.4.3 Containers tory while the sample is still intact in the moisture-proof
container.
Containers must be metal dishes, non-corrodible under the During the determination, exposure of the sample to
test conditions, or, failing this, glass dishes, with lids and the atmosphere of the laboratory must be reduced to the
an effective surface area enabling the test sample to be absolute minimum, and, in the case of species that do not
distributed so as to give a mass per unit area of not more require grinding, no more than two minutes may elapse
than 0.3 g/cm2. between the time the sampling of the submitted moisture
sample begins and the time the replicates for the moisture
test are weighed.
9.1.4.4 Desiccator The remaining submitted sample after determination
of moisture must be stored under controlled conditions
The desiccator should be fitted with a perforated metal in a moisture-proof container for a period defined by the
plate to promote rapid cooling of the containers and must laboratory, but long enough to ensure the possibility for
contain an effective desiccant. re-testing in case of errors.
9.1.5.2 Working sample
The determination must be carried out in duplicate on two

independently drawn working samples, each of the fol-

lowing weight, depending on the diameter of the contain- 9.1.5.4 Grinding

ers used:
Diameter >5 cm and <8 cm: 4.5 ±0.5 g Large seeds and seeds with seed coats that impede water
Diameter ≥8 cm: 10.0 g ±1.0 g loss from the seeds must be ground before drying, unless
their high oil content makes them difficult to grind or (par-
For large-seeded tree and shrub seeds that have to be cut ticularly in seed such as Linum with oil of a high iodine
(see Table 9A Part 2), a different working sample size may number) liable to gain in weight through oxidation of the
be required. For cut seed, the working sample must be suf- ground material.
ficient to draw two replicates of approximately 5 g each by If grinding is not possible, then cutting is allowed. See
cutting at least ten intact seeds (see 9.1.5.5). 9.1.5.5 for details.
Before the working sample is drawn, the submitted It is obligatory to grind seed of a particular species if
sample must be thoroughly mixed by one of the following this is indicated in Table 9A Part 1 or Part 2.
methods: The grinding mill should be adjusted so that particles
either stir the sample in its container with a spoon, of the required dimensions are obtained. For those species
or place the opening of the original container against the requiring fine grinding (Table 9A Part 1), at least 50 %
opening of a similar container and pour the seed back of the ground material should pass through a wire sieve
and forth between the two containers. with meshes of 0.50 mm, and not more than 10 % should
remain on a wire sieve with meshes of 1.00 mm. For those
Take at minimum three subsamples with a spoon from dif- species requiring coarse grinding (Table 9A Parts 1 and 2),
ferent positions and combine them to form the subsample at least 50 % of the ground material should pass through
of the required size. The seed may not be exposed to the a sieve with meshes of 4.00 mm, and not more than 55 %
air during sample reduction for more than 30 s. should pass through a wire sieve with meshes of 2.00 mm.
The total time of the grinding process must not exceed
In the case of cutting or grinding, one working sample 2 min.
must be drawn for cutting or grinding and from the cut/ When using a grinder ensure that there is no contami-
ground material two replicates must be obtained. nation from one sample to the other.
9.1.5.3 Weighing 9.1.5.5 Cutting
Weighing must be in accordance with 3.5.1 and must be in Large tree seeds (thousand-seed weight >200 g and if pre-
grams to at least three decimal places. scribed in Table 9A Part 2) and tree seeds with very hard
Containers and their lids are weighed before and after seed coats, such as those of Fabaceae, and seeds with high
filling. oil contents should be cut into small pieces of less than
After weighing, containers should be covered with 7 mm instead of being ground. The cutting must be carried

their lids to prevent possible contamination or loss of sam- out on a working sample from the submitted sample of at
ple, if they are not placed directly into the oven. least ten intact seeds, to arrive at approximately 10 g (two
Open containers and their lids are placed rapidly into replicates of approximately 5 g each).
an oven maintained at the required temperature for the The subsamples are quickly cut, recombined and
species being tested (Table 9A Parts 1 and 2). The dry- mixed with a spoon prior to dividing into two replicates.
ing period begins at the time the oven returns to the re- The replicates are placed in weighed containers. Exposure
quired temperature after the placement of the containers. to the atmosphere should not exceed 4 min.
At the end of the prescribed period, containers have their
lids replaced before cooling to ambient temperature in a
desiccator. 9.1.5.6 Predrying
After cooling, the containers, with lids and dried con-
tents, are weighed. If the species is one for which grinding is necessary
and the moisture content is higher than indicated in Ta-
ble 9A Part 1, predrying is obligatory. Two subsamples,
each weighing 25 ±1 g are placed in weighed containers.
The two subsamples, in their containers, are then dried at
130 °C for 5 to 10 min, depending on the moisture con-

tent, to reduce the moisture content to below that required 9.1.5.7 Prescribed methods
in Tables 9A Part 1. The partly dried material is then kept
exposed in the laboratory for at least 2 h. a) The working sample, drawn according to 9.1.5.2, must
In the case of very moist seed of Zea mays (above be evenly distributed over the surface of the container.
25 % moisture content) the seed is spread in a layer not b) Weigh the container and its cover before and after
deeper than 20 mm and dried at 65–75 °C for 2–5 h, de- filling.
pending on the initial water content. In the case of other c) Place the container rapidly, on top of its cover or next
species with a moisture content exceeding 30 %, samples to its cover, in an oven.
should be dried overnight in a warm place. d) See Table 9A Parts 1 and 2 for additional details regard-
After predrying, the subsamples are reweighed in their ing grinding, temperature and duration per species.
containers to determine the loss in weight. Immediately e) Tolerances for the temperatures and durations are:
thereafter the two partly dried subsamples are separately 101–105 °C (low temperature): 17 ±1 h,
ground. One working sample is drawn from each sub- 130–133 °C (high temperature): 1 h ±3 min, 2 h
sample. Drawing of the working sample should be in ac- ±6 min or 4 h ±12 min.
cordance with 9.1.5.2. The moisture is determined as pre- f) The drying period begins at the time the oven returns
scribed in 9.1.5.3. to the required temperature.
Predrying is not obligatory for any seeds that are cut g) At the end of the prescribed period, cover the con-
(Table 9A Part 2). tainer and place it in a desiccator to cool at ambient
temperature.
h) After cooling, weigh the container with its cover and
contents.
Table 9A Part 1. Details of methods for moisture determination: agricultural and vegetable seeds
The low-temperature method (low) or high temperature (high) method must be used as specified for the species in this
Table.
Species Grinding/cutting Method to Drying at high Predrying requirement (9.1.5.6)

(9.1.5.4, 9.1.5.5) be used temperature (h)
1 2 3 4 5
Agrostis spp. No High 1 –
Allium spp. No Low – –
Alopecurus pratensis No High 1 –
Anethum graveolens No High 1 –
Anthoxanthum odoratum No High 1 –
Anthriscus spp. No High 1 –
Apium graveolens No High 1 –
Arachis hypogaea Cut Low – To 17 % moisture content or less
Arrhenatherum spp. No High 1 –
Asparagus officinalis No High 1 –
Avena spp. Coarse High 2 To 17 % moisture content or less
Beta vulgaris No High 1 –
Brachiaria spp. No High 1 –
Brassica spp. No Low – –
Bromus spp. No High 1 –
Camelina sativa No Low – –
Cannabis sativa No High 1 –
Capsicum spp. No Low – –
Carum carvi No High 1 –
Cenchrus spp. No High 1 –

Table 9A Part 1. Details of methods for moisture determination: agricultural and vegetable seeds (continued)

1 2 3 4 5
Chloris gayana No High 1 –
Cicer arietinum Coarse High 1 To 17 % moisture content or less
Cichorium spp. No High 1 –
Citrullus lanatus Coarse High 1 To 17 % moisture content or less
Cucumis spp. No High 1 –
Cucurbita spp. No High 1 –
Cuminum cyminum No High 1 –
Cynodon dactylon No High 1 –
Cynosurus cristatus No High 1 –
Dactylis glomerata No High 1 –
Daucus carota No High 1 –
Deschampsia spp. No High 1 –
Elytrigia spp. No High 1 –
Fagopyrum esculentum Fine High 2 To 17 % moisture content or less
Festuca spp. No High 1 –
Galega orientalis No High 1 –
Glycine max Coarse Low – To 12 % moisture content or less
Gossypium spp. Fine Low – To 17 % moisture content or less
Helianthus annuus No Low – –
Holcus lanatus No High 1 –
Hordeum vulgare Fine High 2 To 17 % moisture content or less
Lactuca sativa No High 1 –
Lathyrus spp. Coarse High 1 To 17 % moisture content or less
Lepidium sativum No High 1 –
Linum usitatissimum No Low – –
Lolium spp. No Low 2 –
or high
Lotus spp. No High 1 –
Lupinus spp. Coarse High 1 To 17 % moisture content or less
Macroptilium atropurpureum Coarse High 1 To 17 % moisture content or less
Medicago spp. No High 1 –

Melilotus spp. No High 1 –
Nicotiana tabacum No High 1 –
Onobrychis viciifolia No High 1 –
Ornithopus sativus No High 1 –
Oryza sativa Fine High 2 To 13 % moisture content or less
Panicum spp. No High 2 –
Papaver somniferum No High 1 –
Paspalum spp. No High 1 –
Pastinaca sativa No High 1 –
Petroselinum crispum No High 1 –
Phacelia tanacetifolia No High 1 –
Phalaris spp. No High 1 –
Phaseolus spp. Coarse High 1 To 17 % moisture content or less
Phleum spp. No High 1 –
Pisum sativum Coarse High 1 To 17 % moisture content or less
Poa spp. No High 1 –
Raphanus sativus No Low – –
Ricinus communis Cut Low – To 17 % moisture content or less
Scorzonera hispanica No High 1 –
Secale cereale Fine High 2 To 17 % moisture content or less
Sesamum indicum No Low – –


1 2 3 4 5
Setaria spp. No High 1 –
Sinapis spp. No Low – –
Solanum lycopersicum No High 1 –
Solanum melongena No Low – –
Sorghum spp. Fine High 2 To 17 % moisture content or less
Spinacia oleracea No High 1 –
Trifolium spp. No High 1 –
Trisetum flavescens No High 1 –
Triticum spp. Fine High 2 To 17 % moisture content or less
×Triticosecale Fine High 2 To 17 % moisture content or less
Valerianella locusta No High 1 –
Vicia spp. Coarse High 1 To 17 % moisture content or less
Vigna spp. Coarse High 1 To 17 % moisture content or less
Zea mays Fine High 4 To 17 % moisture content or less;
see also 9.1.5.6
Table 9A Part 2. Details of methods for moisture determination: tree and shrub seeds
The low-temperature method must be used for all species in Table 9A Part 2.
Species Grinding/cutting Remarks

(9.1.5.4, 9.1.5.5)
Abies spp. (TSW ≤200 g) No –
Abies spp. (TSW >200 g) Cut High oil content
Acacia spp. Coarse –
Acer spp. Coarse Because of heterogeneity
Aesculus hippocastanum Cut –
Ailanthus altissima Coarse –
Alnus spp. No –
Amorpha fruticosa Coarse Moved from Table 9A Part 1

Berberis aquifolium No –
Betula spp. No –
Calocedrus decurrens Coarse –
Caragana arborescens Coarse –
Carpinus betulus Coarse –
Castanea sativa Cut –
Catalpa spp. Coarse –
Cedrela spp. No –
Cedrus spp. Cut High oil content
Chamaecyparis spp. No –
Cornus spp. (TSW ≤200 g) Coarse Hard integument
Cornus spp. (TSW >200 g) Coarse –
Corylus avellana Cut –
Corymbia spp. No –
Cotoneaster spp. No –
Crataegus monogyna Coarse –
Cryptomeria japonica No –
Cupressus spp. No –
Cydonia oblonga No –
Cytisus scoparius Coarse –
Elaeagnus angustifolia Coarse –

Table 9A Part 2. Details of methods for moisture determination: tree and shrub seeds (continued)
Species Grinding/cutting Remarks

(9.1.5.4, 9.1.5.5)
Eucalyptus spp. No –
Euonymus europaeus Coarse –
Fagus sylvatica Cut –
Fraxinus spp. Coarse –
Ginkgo biloba Cut –
Gleditsia triacanthos Coarse –
Ilex aquifolium Coarse –
Juniperus spp. Coarse –
Koelreuteria paniculata Coarse –
Laburnum spp. Coarse –
Larix spp. No –
Larix ×eurolepis No –
Ligustrum vulgare Coarse –
Liquidambar styraciflua No High oil content
Liriodendron tulipifera Coarse –
Malus spp. (except M. sylvestris) No –
Malus sylvestris Coarse –
Malva sylvestris No –
Morus spp. No –
Nothofagus spp. No –
Picea spp. No –
Pinus spp. (TSW ≤200 g) No –
Pinus spp. (TSW >200 g) No –
Platanus spp. No –
Populus spp. No –
Prunus spp. Coarse –
Pseudotsuga menziesii No –
Pyrus spp. No –
Quercus spp. Cut –
Robinia pseudoacacia Coarse –
Rosa spp. No –
Salix spp. No –
Sequoia sempervirens No –

Sequoiadendron giganteum No –
Styphnolobium japonicum Coarse –
Sorbus spp. No –
Spartium junceum Coarse –
Syringa spp. No –
Taxodium distichum Cut –
Taxus spp. Coarse –
Tectona grandis Cut –
Thuja spp. No –
Tilia spp. (TSW ≤200 g) No –
Tilia spp. (TSW >200 g) Coarse –
Tsuga spp. No –
Ulmus spp. No –
Viburnum opulus Coarse –
Zelkova serrata No –

9.1.6 Calculation and expression of Table 9B. Tolerance levels for differences between the two
results duplicate determinations of moisture content of tree and
shrub seeds (significance level not defined).
9.1.6.1 Constant-temperature oven methods
Seed size Average initial moisture content
The moisture content as a percentage by weight must be <12 % 12–25 % >25 %
calculated to three decimal places for each replicate by 1 2 3 4
means of the following formula: Small: TSW <200 g 0.3 % 0.5 % 0.5 %
Large: TSW ≥200 g 0.4 % 0.8 % 2.5 %
Loss of weight M2 – M3
∙ 100 = ∙ 100 (Source: F.T. Bonner (1984). Tolerance limits in measurement of
Initial weight M2 – M1 tree seed moisture. Seed Science and Technology 12, 789–794,
1984. [Table 3])
Where
M1 is the weight in grams (to a minimum of three decimal If the results of the duplicate determinations are out of
places) of the container and its cover, tolerance, repeat the test beginning at 9.1.5.2. For repeated
M2 is the weight in grams (to a minimum of three decimal tests, report the result of the second test if its replicates are
places) of the container, its cover and its contents be- within tolerance. If the replicates of the second determina-
fore drying, and tion are out of tolerance as well, check if the averages of
M3 is the weight in grams (to a minimum of three decimal the two tests are in tolerance (0.2 % or Table 9B). If so,
places) of the container, its cover and its contents after report this average. If replicates of both tests are out of
drying. tolerance and the average results of the repeat tests are out
of tolerance discard the results, check the equipment, the
If the material is predried, the moisture content is calcu- laboratory procedure and start again.
lated from the results obtained in the first (predrying) and
second stages of the procedure. If S1 is the moisture lost
in the first stage, and S2 is the moisture lost in the second 9.1.7 Reporting of results
stage, each calculated as above and expressed as a per-
centage, then the original moisture content of the sample The result of a moisture content test must be reported in
calculated as a percentage is: the space provided to the nearest 0.1 %.
The method must be reported (duration and
S1 × S2 temperature).
(S1 + S2) –
100 The following additional information must also be re-
ported under ‘Other Determinations’:
– If germinating seeds were present in the sample, the
9.1.6.2 Tolerances following statement must be entered: ‘Germinating
seeds were found in the submitted moisture sample.’

The difference must be calculated to three decimal places – If mouldy seeds were present in the sample, the fol-
and then rounded off to one decimal place. The maximum lowing statement must be entered: ‘Mouldy seeds
difference between the two replicates must not exceed were found in the submitted moisture sample.’
0.2 % after rounding from three to one decimal place. – In the case of pelleted seeds (see Chapter 11), the fol-
Otherwise, repeat the determination in duplicate. The re- lowing statement must be entered: ‘The seeds of the
ported result is the arithmetic mean of the results for two submitted moisture sample were pelleted, and the
working samples (see 9.1.7). For tree and shrub species moisture content reported is the average of seed and
(Table 9A Part 2) it has been found impossible to meet a pelleting materials.’
0.2 % tolerance, and tolerances ranging from 0.3 to 2.5 % – For Arachis hypogaea, one of the following statements
are prescribed. These are related to seed size and initial must be entered: ‘The submitted sample for moisture
moisture content (Table 9B). determination consisted of seeds in their pod’ or ‘The
To use Table 9B, in column 1, select the relevant row submitted sample for moisture determination consist-
depending on seed size. Then select the correct column ed of seeds with the pod removed (shelled seeds)’.
(2, 3 or 4) depending on the initial moisture content of the
sample.

9.2 Determination of moisture pressed as a percentage) and not to the reading given
content by moisture meters on the conventional scale of the moisture meter.
– The scale interval should be such that moisture content
can be read to at least one decimal place.
9.2.1 Calibration of moisture meters – The housing of the moisture meters must be robust
and so constructed that the main components of the in-
9.2.1.1 Object strument are inaccessible and protected from dust and
moisture.
The object is to prepare check samples to be used for the
calibration of moisture meters, and to check the calibra- Containers, airtight.
tion of moisture meters.
Sieves: appropriate for the species in question, to remove
impurities from the check sample that might interfere
9.2.1.2 Definition with the measurement.
See 9.1.2. Grinder: where the operating manual of the electronic

moisture meter specifies grinding, a subsample from
the submitted sample must be ground. The fineness of
9.2.1.3 General principles the grinding must be according to the specific moisture
meter manual. If it is not specified in the manual it
The methods described are designed for the comparison should be according to 9.1.5.4.
of the results from moisture meters, with those obtained
by the oven method (see 9.1). All moisture meters can be Balance: appropriate for the meter in question (see 3.5.1).
used, as long as the calibration requirements and the re-
quirements of the determination are fulfilled. See 9.1.4 for apparatus needed for the reference oven
Calibration must be carried out at least once every method.
year.
A calibration report is required for each species ana-
lysed by means of a moisture meter. 9.2.1.5 Procedures
A monitoring programme of the moisture meter must
be implemented. Check samples must be measured on the 9.2.1.5.1 Precautions
moisture meter by using the normal procedure (9.2.2), and
the moisture content must be determined once by using The calibration of moisture meters may be affected by
the oven method (9.1). many variables, including species, variety, ripeness, hu-
midity, temperature, and level of impurities.

The moisture meter and the samples should be equili-
9.2.1.4 Apparatus brated to the same temperature before the assessments are
made. During the determination, exposure of the sample
The following apparatus is necessary, depending on the to the atmosphere of the laboratory should be reduced to
method used: the absolute minimum.
Moisture meter:
– Where the moisture meter indicates the moisture con- 9.2.1.5.2 Calibration sample
tent directly, the name of the selected species should
be indicated clearly. Five samples should be obtained from each of a minimum
– Where the moisture meter does not indicate the mois- of two varieties of the species for which the moisture
ture content directly, conversion table(s) should be meter is being calibrated. The samples from each variety
available for each species tested. Where conversion should have a range of moisture contents evenly covering
tables are used the requirements regarding the scale the required measurement range of the moisture meter be-
interval (see 3) and the maximum permissible differ- ing checked. If the full range is not available from natural
ences (see 9.2.1.6.3) apply to the results of the mois- samples, samples may be conditioned.
ture content obtained from the conversion tables (ex-

If there is evidence that varieties of a species give The calibration sample is then thoroughly mixed prior to
significantly different results, a calibration per variety, or drawing the next working sample (see 9.2.1.5.3). Where
group of varieties, is necessary. the determination is destructive, the measurements should
The samples selected should be free of mustiness, fer- be carried out on three independent working samples.
mentation and sprouted seed. The moisture content of the calibration samples should
If samples contain impurities that might interfere with be rechecked after the measurement, using the reference
the measurement, they should be cleaned by hand, using oven method (see 9.1).
sieves or a mechanical separator.
Calibration sample containers should be moisture
proof and filled to at least two-thirds of their capacity. If 9.2.1.6 Calculation and expression of results
the container is too full, the sample cannot be mixed thor-
oughly. If the container is not filled sufficiently there can 9.2.1.6.1 Reference oven method
be hygrometric exchanges between the seeds and the air
that is present in the container, and this can result in a For each test sample two reference results are available: x1,
modification of the moisture content of the sample in the obtained before measuring the moisture content with the
period prior to testing. The containers should be sealed moisture meter, and x2, obtained after measuring the mois-
and stored at 5 ±2 °C. The sealed containers must be ture content with the moisture meter. The mean of these
moved to the room containing the moisture meter at least two values is taken as the true value (xt) of the moisture
24 h prior to use to ensure that the temperature of the seed content, provided that the difference between the readings
has equilibrated with the temperature of the meter. is no greater than 0.3 %. If the difference is greater than
0.3 %, the calibration must be repeated.
9.2.1.5.3 Working sample from calibration sample

9.2.1.6.2 Moisture meters
Working samples should be drawn after thoroughly mix-
ing them using one of the following methods: For each calibration sample three results are available (y1,
either stir the sample in its container with a spoon, y2, y3).
or place the opening of the original container against the Calculate the mean result yx [yx = (y1 + y2+ y3)/3] and zi
opening of a similar container and pour the seed back (the difference of yx from the true value xt of the moisture
and forth between the two containers. content [see 9.2.1.6.1]): zi = yx – xt.
Each working sample must be drawn in such a manner

that the sample is not exposed to the air for more than 30 s. 9.2.1.6.3 Maximum permissible differences
A moisture meter is considered to be within calibration

9.2.1.5.4 Weighing when zi (the difference between yx and the true value xt)
is lower than the following maximum permissible differ-
Weighing, when required, should be in accordance with ences (Table 9C).
3.5.1.
Table 9C. Permissible differences from the true value
9.2.1.5.5 Prescribed methods True value Maximal permissible difference

(reference
Non-chaffy seeds Chaffy seeds
method)
The moisture content of the calibration samples is as- <10.0 % ±0.4 % ±0.5 %
sessed using the oven method (see 9.1), which is the refer- ≥10.0 % ±0.04 × moisture ±0.05 × moisture
ence method. content content
Three successive measurements are made on each cali-
bration sample, using the moisture meter according to the
manufacturer’s instructions. For the comparison the average result of the replicates af-
After each measurement, the sample tested is recom- ter rounding to one decimal place must be used.
bined with the calibration sample from which it was drawn.

9.2.1.7 Calibration results operated, there is a risk of condensation. Before testing,

samples should therefore be equilibrated to the required
The results of calibrations must be recorded and retained room temperature.
for at least 6 years.
9.2.2.4.2 Working sample

9.2.2 Determination of moisture content
(moisture meters) The determination must be carried out in duplicate on two
independently drawn working samples each of the weight/
9.2.2.1 Object volume required for the specified meter.
Before the working sample is drawn, the submitted
The object is to determine the moisture content of speci- sample must be thoroughly mixed by one of the following
fied species of seed using a calibrated moisture meter. methods:
either stir the sample in its container with a spoon,
or place the opening of the original container against the
9.2.2.2 General principles opening of a similar container and pour the seed back
and forth between the two containers.
The moisture content of a sample of seed affects its physi-
ochemical and electrical properties. These can be meas- Each working sample must be drawn in such a manner
ured, and meters are available for the routine determina- that the sample is not exposed to the air for more than 30 s.
tions of the moisture content.
9.2.2.4.3 Weighing
9.2.2.3 Apparatus
Weighing, when required, should be in accordance with
The following apparatus is necessary, depending on the 3.5.1.
method used:
– moisture meter;
– containers, airtight; 9.2.2.5 Calculation and expression of results
– grinder;
– balance. The moisture content as a percentage by weight must be
calculated to one decimal place by means of the following
Details of this equipment are given in 9.2.1.4. formula:
M 1 + M2

9.2.2.4 Procedures 2
Where M1 and M2 are the readings of replicates 1 and 2
9.2.2.4.1 Precautions from the meter.
The submitted sample (see 2.5.1.5–2.5.1.7 and 2.5.4.4)

may be accepted for moisture determination only if it is 9.2.2.6 Tolerances
in an intact, moisture-proof container from which as much
air as possible has been excluded. The result is the arithmetic mean of the duplicate meas-
The determination must be started as soon as possi- urements, if the difference between the two does not ex-
ble after receipt. Prior to testing, the temperature of the ceed 0.2 %.
sample must be equilibrated to that of the testing labora- If the results of the duplicate measurements are out of
tory, while the sample is still intact in the moisture-proof tolerance, repeat the test. For repeated tests, report the re-
container. sult of the second test if its replicates are in tolerance. If
During the determination, exposure of the sample to the replicates of the second measurement of tolerance as
the atmosphere of the laboratory must be reduced to the well, check whether the averages of the two tests are in
absolute minimum. tolerance (0.2 % or Table 9B). If so, report this average. If
When the temperature of the sample is very different replicates of both tests are out of tolerance and the average
from the room temperature where the moisture meter is results of the repeat tests are out of tolerance, discard the

results, check the equipment and the laboratory procedure, Table 9D. Tolerance limits for differences between
and start again. constant-temperature oven moisture measurements and
The reported result is rounded to one decimal place. moisture meter measurements.
Oven measurement average Tolerance

(average; %)
9.2.2.7 Reporting of moisture meter results
Chaffy seeds
The result of a moisture content test must be reported in <10.9 % 0.5

the space provided to the nearest 0.1 %. 11–12.9 % 0.6
13–14.9 % 0.7
The following additional information must also be report-
15–16.9 % 0.8
ed under ‘Other Determinations’:
17.0–18.0 % 0.9
– The following statement must be entered: ‘A moisture
Non-chaffy seeds
meter was used.’
<11.3 % 0.4
– If germinating seeds were present in the sample, the
11.3–13.7 % 0.5
following statement must be entered: ‘Germinating 13.8–16.2 % 0.6
seeds were found in the submitted moisture sample.’ 16.3–18.0 % 0.7
– If mouldy seeds were present in the sample, the fol-
lowing statement must be entered: ‘Mouldy seeds
were found in the submitted moisture sample.’ 9.2.2.9 Checking of results from different
– In the case of pelleted seeds (see Chapter 11), the fol- moisture meters
lowing statement must be entered: ‘The seeds of the
submitted moisture sample were pelleted, and the Table 9E should be used when checking two moisture me-
moisture content reported is the average of seed and ters against each other.
pelleting materials.’
Table 9E. Tolerance limits for differences between mois-
ture determinations conducted using different moisture
9.2.2.8 Routine checking of moisture meter meters
and oven moisture content results
Moisture content (average of 2 meters; %) Tolerance
Table 9D should be used when checking moisture meters Chaffy seeds
against oven results. <10.5 % 1.0
For check samples, a maximum of 5 % may have a dif- 10.5–11.4 % 1.1
ference greater than the maximum permissible difference. 11.5–12.4 % 1.2
If more than 5 % of the samples have differences greater 12.5–13.4 % 1.3
than this, a new calibration is required (see 9.2.1). 13.5–14.4 % 1.4
14.5–15.4 % 1.5
15.5–16.4 % 1.6
16.5–17.4 % 1.7
17.5–18.0 % 1.8
Non-chaffy seeds
<10.7 % 0.8
10.7–11.8 % 0.9
11.9–13.1 % 1.0
13.2–14.3 % 1.1
14.4–15.6 % 1.2
15.7–16.8 % 1.3
16.9–18.0 % 1.4

International Rules for Seed Testing Chapter 10: Weight determination
Chapter 10: Weight determination
10.1 Object 10.5.2 Counting the entire working

sample by machine
The object is to determine the weight per 1000 pure seeds
of the sample as submitted. Put the whole working sample through the machine, and
read the number of seeds on the indicator. After counting,
weigh the sample in grams to the same number of decimal
10.2 Definition places as in the purity analysis (3.5.1).
The number of seeds in a weighed quantity of pure seed is

counted, and the weight per 1000 calculated. 10.5.3 Counting replicates
From the working sample count out at random, by hand or

10.3 General principles with a germination counter, eight replicates, each of 100
seeds. Weigh each replicate in grams to the same number
Only pure seeds are counted and weighed using the proce- of decimal places as in the purity analysis (3.5.1), i.e.
dures outlined in Chapter 3: The Purity Analysis.
Weight of working sample (g) Decimal places (minimum)
Less than 1.0000 4
10.4 Apparatus 1.000–9.999 3
10.00–99.99 2
100.0–999.9 1
Seeds can be counted manually, or a suitable counting
machine, or counting equipment for germination tests, i.e. 1000 or more 0
vacuum planting head (5.5) may be used.
Calculate the variance, standard deviation and coefficient
of variation as follows:
10.5 Procedure
N ∑ x2 – (∑ x)2
Variance =
Either the whole working sample (10.5.2), N(N – 1)
or replicates of pure seed from the working sample,
or replicates from a representative fraction of the submit- where
ted sample (10.5.3) x = weight of each replicate in grams
must be used. N = number of replicates
Σ = sum of
Standard deviation s = √Variance
s
Coefficient of variation = × 100
The working sample must be the entire pure seed frac- x Chapter 10: Weight determination
tion of a purity analysis carried out in accordance with
Chapter 3: The Purity Analysis of the ISTA Rules, or pure where x = mean weight of 100 seeds
seed taken from a representative fraction of the submitted
sample. A change of the moisture content of the working If the coefficient of variation does not exceed 6.0 for
sample must be avoided as far as possible by storing the chaffy grass seeds, or 4.0 for other seeds, the result of
working samples before testing only for short periods and the determination can be calculated. ISTA does not define
in moisture proof containers. grass seeds as a group.

Chapter 10: Weight determination International Rules for Seed Testing
If the coefficient of variation exceeds whichever of 10.7 Reporting results

these limits is appropriate, count and weigh a further
eight replicates and calculate the standard deviation for The result of a weight determination test must be reported
the 16 replicates. Discard any replicate that diverges from under ‘Other determinations’ to the number of decimal
the mean by more than twice the standard deviation as places used in the determination (10.5.3).
calculated. The method used (‘Counting the entire working sam-
ple’ or ‘Counting replicates’) and the result as calcu-
lated according to 10.6 must be reported under ‘Other
10.6 Calculation and expression of Determinations’.
results
If counting is by machine, calculate the weight of 1000
seeds from the weight of the whole working sample.
If counting is by replicate, from the eight or more
weights of 100-seed replicates, calculate the average
weight of 1000 seeds.
The result must be expressed to the number of decimal
places used in the determination (10.5.3).
Chapter 10: Weight determination

International Rules for Seed Testing Chapter 11: Testing coated seeds
Chapter 11: Testing coated seeds
11.1 Object Note: the numbering in this Chapter refers to the appro-
priate paragraphs of the other Chapters in the Rules, e.g.
The object is to gain reproducible information as to the 11.3.2.1 cross references Chapter 11 to Chapter 3.2.1.
planting value of seeds coated in non-seed materials
which have been applied in a way which makes positive
identification of all individual seeds and inert matter as 11.2 Sampling
described in Chapter 3 impracticable without destroying
the structure(s) presented for testing. For this purpose, 11.2.5 Procedures
techniques and definitions are prescribed where those de-
scribed in the appropriate chapter are not directly applica- 11.2.5.1 Procedures for sampling a seed lot
ble. A wide range of materials may be used to coat seeds
as individuals in discrete units as in pellets or spaced in 11.2.5.1.2 Sampling intensity
strips or sheets. However, treated seeds are not covered
and should be tested according to the methods prescribed Sampling the lot of seed pellets should be done accord-
in other chapters. When specific instructions are not given, ing to the intensity appropriate to the particular lot, as
those in the appropriate chapter must be followed. Where laid down in Chapter 2. Sampling the lot of seed tapes
reference is made to seed pellets the rules also apply to should be done by taking packets or (from reels) pieces of
encrusted seed and seed granules, and where to seed tapes, tape at random, analogously following the prescriptions
to seed mats. of 2.5.1.2, provided that packets or reels containing up to
2 000 000 (20 units of 100 000) seeds may be combined
as a basic unit and therefore are to be considered as one
11.1.1 Definitions container.
Seed pellets More or less spherical units developed for

precision sowing, usually incorporating a single seed 11.2.5.1.3–1.6 Drawing and disposal of submitted
with the size and shape of the seed no longer readily sample
evident. The pellet, in addition to the pelleting mate-
rial, may contain pesticides, dyes or other additives. As submitted samples of coated seeds normally contain
Encrusted seed Units more or less retaining the shape fewer seeds than corresponding samples of uncoated
of the seed with the size and weight changed to a seeds, special care is necessary in drawing the sample
greater or lesser extent. The encrusting material may to ensure that it is representative of the lot. Precautions
contain pesticides, fungicides, dyes or other additives. are necessary to avoid damage to or change in the pellets
Seed granules Units more or less cylindrical, includ- or seed tape during drawing, handling and transport, and
ing types with more than one seed joined together. The samples must be submitted in suitable containers.
granule, in addition to the granulating material, may
contain pesticides, dyes or other additives.
Seed tapes Narrow bands of material, such as paper or 11.2.5.2 Procedure for obtaining the working Chapter 11: Testing coated seeds
other degradable material, with seeds spaced random- sample
ly, in groups or in a single row.
Seed mats Broad sheets of material, such as paper or For pelleted seeds use one of the dividers described in
other degradable material, with seeds placed in rows, 2.5.2.2.1. However, the distance of fall must never exceed
groups or at random throughout the sheets. 250 mm. For seed tapes take pieces of tape at random, to
Seed treatment See 2.2.11. Seeds which have received provide sufficient seeds for the test.
seed treatment must still be tested according to the
methods prescribed in other chapters.

Chapter 11: Testing coated seeds International Rules for Seed Testing
11.2.5.2.1 Minimum size of working sample 11.2.5.4.4 Submitted sample
Working samples must contain not less than the number Submitted samples must contain not less than the number
of pellets or seeds indicated in column 3 of Tables 11A of pellets or seeds indicated in column 2 of Tables 11A and
and 11B. If a smaller sample is used the actual number 11B. If a smaller sample is used the following statement
of pellets or seeds in the sample must be reported on the must be inserted on the certificate: ‘The sample submitted
ISTA Certificate. contained only .... pellets (seeds) and is not in accordance
with the International Rules for Seed Testing.’
Table 11A. Sample sizes of pelleted seeds in number of
pellets. Note: this table is a copy of Table 2B Part 1
11.3 Purity analysis
Determinations Submitted Working
samples not samples not
less than less than 11.3.1 Object
1 2 3
A purity analysis in the strict sense (i.e. of the seeds inside
Purity analysis (including verifica- 2 500 2 500
tion of species)
the pellets and tapes) is not obligatory though, if requested
Weight determination 2 500 Pure pellet by the applicant, a purity analysis on depelleted seeds or
fraction seed removed from tape may be carried out in accordance
Germination 2 500 400 with Chapter 3 of the International Rules for Seed Test-
Determination of other seeds 10 000 7 500 ing (see also 11.3.5.3). Separations for pelleted seed are
Determination of other seeds 25 000 25 000 defined in 11.3.2 but for taped seed no separation is made.
(encrusted seeds and seed
granules)
Size grading 5 000 1 000
11.3.2 Definitions for pelleted seed
Table 11B. Sample sizes of seed tapes in number of 11.3.2.1 Pure pellets
seeds. Note: this table is a copy of Table 2B Part 2
Pure pellets must include:
Determinations Submitted Working
samples not samples not
less than less than a) Entire pellets regardless of whether or not they contain
seed,
1 2 3
Verification of species 300 100
b) Broken and damaged pellets in which more than half
Purity analysis (if required) 2 500 2 500
the surface of the seed is covered by pelleting material,
Determination of other seeds 10 000 7 500 except when it is obvious that either the seed is not of
the species stated by the applicant (11.3.2.2.b), or there
is no seed present (see 11.3.2.3.b).
11.2.5.4 Conditions for issuing Orange
International Seed Lot Certificates
11.3.2.2 Unpelleted seed
11.2.5.4.1 Seed lot size

Unpelleted seed must include:
Providing there is satisfactory evidence that the lot is rea-
sonably homogeneous, the maximum weight of lot may a) Free seeds of any species,
be as great as the maximum weight of lot for which sam-
pling procedures are prescribed in Chapter 2, subject to b) Broken pellets containing a seed that is recognisably
the tolerance of 5 %. not of the species stated by the applicant,
The maximum number of seeds that a lot of seed pel-
lets, seed granules, seed tapes or seed mats may contain is c) Broken pellets containing seed recognisable as being
1 000 000 000 (10 000 units of 100 000), except that the of the species stated by the applicant but not included
weight of the lot, including the coating material, may not in the pure pellets fraction.
exceed 42 000 kg (40 000 kg plus 5 %).

11.3.2.3 Inert matter on two subsamples of at least half this number each inde-
pendently drawn. The working sample (or each subsam-
Inert matter must include: ple) must be weighed in grams to the minimum number of
decimal places necessary to calculate the percentage of its
a) Loose pelleting material, component parts to one decimal place (see 3.5.1).
b) Broken pellets in which it is obvious that there is no

seed, 11.3.5.2 Separation
c) Any other material defined as inert matter in 3.2.3 of The working sample of pellets (or subsample) after weigh-
Chapter 3. ing must be separated into its components as defined in
11.3.2.
11.3.3 General principles

11.3.5.3 Procedures for purity tests on
The working sample of pellets is separated into the fol- depelleted seeds and seeds removed from
lowing three components: pure pellets, unpelleted seed tapes
and inert matter, and the percentage of each part is deter-
mined by weight. When a purity test on depelleted seeds is to be undertaken
All species of seed and each kind of inert matter pre- at the request of the applicant, the working sample of not
sent must be identified as far as possible and, if required less than 2500 pellets is depelleted by shaking in fine mesh
for reporting, its percentage by weight determined. sieves immersed in water. A sieve of 1.00 mm mesh above
a sieve of 0.5 mm is recommended. The pelleting material
is dispersed in the water, and the remaining seed material
11.3.4 Verification of species is dried overnight in a warm dry place on moisture-ab-
sorbing material e.g. filter paper. After drying, the material
In order to check that the seed in the pellets is largely of must be subjected to a purity analysis in accordance with
the species stated by the applicant, it is obligatory to re- Chapter 3. The component parts (pure seed, other seeds
move the pelleting material from 100 pellets taken from and inert matter) must be reported as percentages of their
the pure pellet fraction of the purity test and determine total weight, ignoring the pelleting material. The percent-
the species of each seed. The pelleting material may be age of pelleting material must be reported separately only
washed off or removed in the dry state. Similarly 100 on request.
seeds must be removed from tapes and the identity of each When a purity test on seeds removed from tapes is re-
seed determined. quested, the tape material of the working sample with pa-
For taped seed, depending on the material the tape per tapes is cautiously separated and stripped off. Water-
is made of, strip off or dissolve away the tape so that soluble tape material is moistened until the seeds come
100 seeds can be examined. When the seeds in the tape free. When pelleted seeds are found in the tapes, follow
are also pelleted, remove the pelleting material as indi- the procedure in the paragraph above. The moistened
cated above. seeds must be dried and the freed seed material must be
subjected to a purity test as above. The component parts
(pure seed, other seeds and inert matter) must be report- Chapter 11: Testing coated seeds
11.3.5 Procedure ed as percentages of their total weight ignoring the tape
material.
11.3.5.1 Working sample The results of these tests are to be reported under ‘Oth-
er Determinations’ and endorsed “weight of .... material
For pellets the purity analysis must be made on a working excluded”.
sample taken from the submitted sample in accordance
with 11.2.5.2. The size of the working sample must be that
indicated in column 3 of Table 11A. The analysis may be
made on one working sample of this number of pellets or

11.3.6 Calculation and expression of – Purity of seeds removed from tapes. The component
results parts (pure seed, other seeds, and inert matter) may be
reported as percentages of their total weight, ignoring
The percentage by weight of each of the component parts the tape material. The result of this test is to be re-
(11.3.3) must be calculated to one decimal place. The per- ported: ‘weight of … material excluded’.
centage of seed of any particular unpelleted species or of
any particular kind of inert matter need not be calculat-
ed except as required by 3.7. Percentages must be based 11.4 Determination of number of
on the sum of the weights of the components, not on the other seeds
original weight of the working sample, but the sum of the
weights of the components must be compared to the origi-
nal weight as a check against loss of material or other er- 11.4.1 Object
ror. If a duplicate analysis is made of two half-working
samples, the difference must not exceed the tolerance be- This determination to estimate the number of seeds of oth-
tween duplicate analyses given in Table 3C, column 3 or er species is carried out only at the request of the applicant.
4. If the difference is in excess of the tolerance, employ
the procedure laid down in 3.6.
11.4.2 Definitions
11.3.7 Reporting results In determining the number of other seeds, the definition
prescribed in 3.2 must be observed. Other seeds refer to
The result of a purity test on coated seeds must be reported species other than that of the pure seed as defined in 3.2.1.
as follows:
– Following the species name, the words ‘seed pellets’, 11.4.3 General principles
‘encrusted seeds’, ‘seed granules’, ‘seed tapes’ or
‘seed mats’, as applicable, must be clearly entered. The determination is made by a count of seeds of the spe-
– The results must be reported to one decimal place, and cies (or groups of species) designated by the applicant,
the percentage of all components must total 100 %. and the result is expressed as a number of seeds found in
Components amounting to less than 0.05 % must be the weight and approximate numbers of pellets examined
reported as ‘Trace’ or ‘TR’ (for ‘Trace’). or for tapes in the length of tape (or area of mat) examined.
– In the case of pelleted seeds only, the percentages of
pure pelleted seeds, inert matter and unpelleted seeds
must be reported in the spaces provided for ‘Pure 11.4.5 Procedure
seeds’, ‘Inert matter’, and ‘Other seeds’, respectively.
– The name and number of the seeds of each species 11.4.5.1 Working sample
found in the examination of the 100 seeds removed
from the pellets or tapes must be reported under ‘Other The working sample must be not less than that prescribed
determinations’. in column 3 of Tables 11A and B. The working sample of
pellets may be divided into two subsamples.
Upon request, the following information may be reported

under ‘Other determinations’ as follows:
11.4.5.2 Determination
– Purity test on depelleted seeds. The component parts
(pure seed, other seeds and inert matter) may be re- The pelleting material and/or tape material must be re-
ported as percentages of their total weight, ignoring moved as described in 11.3.5.3, but drying is not obligato-
the pelleting material. ry. The working sample is searched either for seeds of all
The percentage of pelleting material must be reported other species or of certain designated species, as required
separately only on request. The result of this test is to by the applicant.
be reported: ‘weight of … material excluded”.

11.4.6 Calculation and expression of 11.5.2 Definitions

results
Evaluation of seedlings as normal or abnormal must be in
The result is expressed as the number of seeds belonging accordance with Chapter 5. A pellet is regarded as having
to each designated species or category found in the actual germinated if it produces at least one normal seedling of
weight and approximate number of pelleted seeds exam- the species stated by the sender. Seedlings that are obvi-
ined and for seed tapes the length of tape (or area of mat) ously not of the species stated by the sender, even if nor-
examined. In addition the number per unit weight, per unit mal for their species, are not included in the germination
length or per unit area (e.g. per kilogram, per metre or per figure but their number must be reported separately.
square metre) may be calculated. To decide whether two
determinations, made in the same laboratory or in differ-
ent laboratories are significantly different, use Table 4A. 11.5.3 General principles
The two samples compared must be of approximately the
same weight, length or area. Germination tests on pelleted seeds must be made with
pellets from the pure pellet fraction of a purity test. The
pellets must be placed on the substrate in the condition
11.4.7 Reporting results in which they are received (e.g. without rinsing or soak-
ing). Germination tests on seed tapes are made on the tape
The result of a determination of other seeds by number on without removing the seeds from the tape material or in
coated seeds must be reported as follows: any way pre-treating the tape.
– Following the species name, the words ‘seed pellets’,
‘seed mats’, as applicable, must be clearly entered. 11.5.4 Growing media
– Under ‘Other determinations’, the actual weight (or
length of tape, or area of mat) and approximate num- Paper, sand, organic growing media and in certain situa-
ber of pelleted seeds examined must be entered, to- tions soil are permissible as substrates. For pelleted seed,
gether with the scientific name and number of seeds of the use of pleated paper is recommended. For seed tapes,
each species sought and found in this weight, length or a between paper method using upright rolled towels is
area. recommended.
Specifications and characteristics of growing media
Upon request, the result may in addition be expressed in for germination tests are indicated in Chapter 5, 5.4.
some other way, such as number of seeds per kilogram,
per metre or per square metre.
11.5.5 Apparatus
Types of germination apparatus and counting equipment
11.5 The germination test should be used as described in 5.5.
11.5.1 Object
11.5.6 Procedure
To determine the percentage by number of normal seed-
lings as defined in 5.2.4 of the kind of seed of which the 11.5.6.1 Working sample Chapter 11: Testing coated seeds
sample purports to be, using pellets from the pure pel-
let fraction or tape without removing the seeds from the The pure pellets must be well mixed and 400 pellets count-
tape material. An additional germination test on pure seed ed at random in replicates of 100. The working sample
taken out of the pellets or tape may be carried out at the from seed tapes must consist of randomly taken pieces of
request of the sender or as a check on a test of pellets or tape to make up four replicates of at least 100 seeds each.
tapes, but care must be taken that the covering material
is removed in such a way as not to affect the germination
capacity of the seeds.

11.5.6.2 Test conditions Pure pellets may not produce any seedlings at the end
of the test period. These pellets “without seedlings” can
Methods, substrates, temperatures, light conditions and be evaluated as:
special treatments as described in Chapter 5 and pre-
scribed for particular species in Table 5A should be used. Hard seeds: when ungerminated pellets include hard
Where substrates prescribed in Table 5A are found not to seeds (see 5.2.10)
give satisfactory results, pleated paper should be used for
pellets and a between paper method for tapes. Fresh seeds: when ungerminated pellets include fresh
seeds (see 5.2.10)
11.5.6.2.2 Moisture and aeration Dead seeds: when ungerminated pellets include inert
matter, no seed or ungerminated other seeds, not de-
The water supply may be varied according to the pelleting tected as such prior the germination test. They can also
material and the kind of seed so as to achieve optimum include dead seeds for the species stated.
conditions for germination. If pelleting material adheres
to the cotyledons, water may be sprayed cautiously on to
the seedlings at the time of counting. 11.5.6.6 Multiple seed structures
Multiple seed structures may occur in pellets or in tapes

11.5.6.3 Special treatments for breaking or more than one seed may be found in a pellet. In either
dormancy case these must be tested as single seeds. The result of
the test indicates the percentage of structures or pellets
When fresh or hard ungerminated seeds remain at the end which have produced at least one normal seedling. Pellets
of the test period (see 5.6.3 and 5.6.5.3), a retest may be or seeds in tapes producing two or more such seedlings are
made using one of the special treatments indicated in Ta- counted and their number recorded.
ble 5A. When pellets are tested for monogermity the numbers
of pellets which have produced either one, two or more
than two normal seedlings are determined in the germina-
11.5.6.4 Duration of the test tion test and each is expressed as a percentage of the total
number of pellets producing at least one normal seedling.
Extension beyond the period prescribed in 5.6.4 may be
necessary. However, slow germination may be an indica-
tion that test conditions are not optimum and a germina- 11.5.7 Calculation and expression of
tion test of seeds removed from the covering material may results
be made as a check.
Results are expressed as percentage by number. In addi-
tion, for taped seeds the total length of tape (or area of
11.5.6.5 Evaluation mat) used in the germination test is measured and the total
number of normal seedlings is noted. From these data the
Evaluation of seedlings as normal or abnormal must be number of normal seedlings per metre (or square metre)
in accordance with Chapter 5. Abnormality may on occa- is calculated.

sion be due to the pelleting or tape material and when this When seedlings that are not from the species stated
is suspected a retest must be carried out in sand, organic by the applicant are found at the end of the germination
growing media or soil of good quality in accordance with test, their number must be counted and subtracted from
5.6.5. the total of the five categories normal seedlings, abnormal
Normal or abnormal seedlings that are obviously not seedlings, hard seeds, fresh seeds and dead seeds.
of the species stated by the sender must be counted sepa- This new total must be taken as the basis for the cal-
rately, and excluded from the calculation. culation of the percentages using simple proportional
calculation.

11.5.8 Reporting results 11.6.5 Procedure
The result of a germination test on coated seeds must be Coated seed units (seed pellets, encrusted seeds or seed
reported as follows: granules): Four replicates of 100 coated seed units
– Following the species name, the words ‘seed pellets’, are washed to remove the coating mass. Depending on
‘encrusted seeds’, ‘seed granules’, ‘seed tapes’ or the consistency of the coating mass, it may be neces-
‘seed mats’, as applicable, must be clearly entered in sary to agitate, whilst soaking, to release seeds from
the space provided. the coating. The duration of the washing should not
– The percentage of pellets or seed in tapes with nor- take longer than the premoistening period prescribed
mal seedlings, with abnormal seedlings and without in Table 6A. The number of seeds determined in each
seedlings. replicate of 100 coated seed units (of the species stated
– The duration of the test. by the applicant) must be reported as an average of
all four replicates. If there are more than 100 seeds in
The following additional information must also be report- each replicate of coated seed units, only 100 seeds per
ed under ‘Other determinations’: replicate will be used for tetrazolium testing. Coated
– The method used for the germination test. units without seeds (e.g. empty pellets) are deemed to
– For seed tapes or mats: the number of normal seed- be non-viable seeds. The test procedure of the washed,
lings per metre of tape or square metre of mat. uncoated seeds then continues with the premoistening
or, if the total premoistening time is achieved, with the
Seedlings that are obviously not of the species stated by preparation for the staining step as prescribed in Table
the applicant, even if otherwise normal, must not be in- 6A.
cluded in the germination result, but their number must be
reported separately under ‘Other determinations’. Seed tapes: The number of seeds (of the species stated by
the applicant) per metre must be detected and reported.
To complete the test, 400 seeds must be extracted from
11.6 The tetrazolium test the seed tape. The test procedure then continues with
the premoistening step as prescribed in Table 6A.
11.6.1 Object
Seed mats: The number of seeds (of the species stated
The objects are the same as defined in 6.1. by the applicant) per seed mat must be determined and
reported (in large seed mats the number of seeds per
square metre). To complete the test, 400 seeds must be
11.6.2 Definitions extracted from the seed mats. The test procedure then
continues with the premoistening step as prescribed in
The definitions are the same as described in 6.2. Table 6A.
11.6.3 General principles 11.6.6 Calculation, expression of results

and tolerances
The general principles are the same as described in 6.3.
The same criteria are valid as prescribed in 6.6. Chapter 11: Testing coated seeds
11.6.4 Reagents
The reagents are the same as prescribed in 6.4.

11.6.7 Reporting results 11.10 Weight determination and

size grading of pelleted seed
The result of a tetrazolium test on coated seeds must be
reported as follows: Because of the technical requirements of precision drilling,
– Following the species name, the words ‘seed pellets’, weight determination or size grading may be necessary.
‘seed mats’, as applicable, must be clearly entered.
11.10.1 Object
The following additional information must be reported
under ‘Other determinations’: The object is to determine the weight per 1000 pellets and/
– The statement ‘Number of seeds (of the species stated or size grading of the sample as submitted.
by the applicant) included in 100 seed pellets’ (or ‘en-
crusted seeds’, or ‘seed granules’);
– or the statement ‘Number of seeds (of the species 11.10.2 Principles
stated by the applicant) included in one metre of seed
tape’; For a weight determination, the number of pellets in a
– or the statement ‘Number of seeds (of the species stat- weighed quantity of pure pellets is counted and the weight
ed by the applicant) included in one seed mat or in one per 1000 calculated. For size determination, a sample of
square metre of seed mat’. the size specified in Chapter 16 is screened as specified
– The statement ‘Tetrazolium test: …% were viable’ and the percentage of each screening fraction determined.
must be entered.
– In cases where the testing procedure deviates from that
prescribed in Table 6A, any deviating procedure must 11.10.3 Apparatus
also be reported. The only areas where variations from
procedures given in Table 6A are permitted are for For weight determination, a suitable counting machine or
premoistening time, tetrazolium concentration, stain- counting equipment for germination tests may be used.
ing temperature and staining time. For precise guid- For size determination, a suitable screening machine is
ance about the limitation of the variations permitted, used.
see 6.5.
– If individual seeds are tested at the end of the germi-
nation test, the result must be reported in accordance 11.10.4–6 Procedure
with 5.9.
For weight determination, follow the procedure prescribed
In addition, in the case of species of Fabaceae, one of the in Chapter 10 sections 10.4 to 10.6. For size determina-
following, and only one, must be reported: tion, follow the procedure prescribed in Chapter 16.
either (in cases where the percentage of the viability of

hard seed is not determined) ‘Tetrazolium test: ...% of
seeds were viable, ...% of hard seeds found in the test’;
or (in cases where the percentage of the viability of hard

seed is determined) ‘Tetrazolium test: ...% of seeds
were viable, ...% of hard seeds included in the percent-
age of viable seed’.

International Rules for Seed Testing Chapter 12: Excised embryo test for viability
Chapter 12: Excised embryo test for viability
12.1 Object to provide sufficient seed to replace those embryos that

might be injured during the excision process.
The object of the excised embryo test is to determine The number of replicates (e.g. 4 × 100 or 8 × 50) is
promptly the viability of certain kinds of seeds which dependent on the embryo size and the container in which
germinate slowly or show dormancy under the methods they are placed.
described in Chapter 5: The germination test of the ISTA
Rules, to such an extent that a complete germination test
(including pretreatment) requires more than 60 days. 12.5.2 Preparation
Species requiring mechanical or chemical scarification of

12.2 Definitions the seed coat must be given the appropriate treatment be-
fore soaking. The hard pericarp or endocarp surrounding
The test is not valid for previously germinated seeds and some fruits must be removed.
must not be applied to submitted samples which contain
any dry germinated seeds. The result of the test may be
reported on an ISTA Certificate only if the details of the 12.5.3 Soaking
method for the kind of seed concerned are described in the
specific directions that follow. The seeds are soaked in tap water for 24–96 h, depend-
ing on rate of imbibition. The water temperature should
not exceed 25 °C, and the water should be changed twice
12.3 General principles daily to retard the growth of fungi or bacteria and the ac-
cumulation of seed exudates.
Embryos are excised and incubated under prescribed con-
ditions for 5 to 14 days. Viable embryos either remain firm
and fresh or show evidence of growth (e.g. expansion, 12.5.4 Excision
elongation or greening) or growth and differentiation (e.g.
radicle and lateral root formation; and epicotyl and first Embryos are excised from soaked seed with the aid of a
leaf formation). Non-viable embryos show signs of decay. scalpel or razor blade and should be kept moist throughout
the operation. Axenic (moderately ‘aseptic’) conditions
are provided by cleaning the instruments and working
12.4 Apparatus area with a 70 % ethanol solution. Those seeds damaged

by excision should be discarded and each replaced by one
Scalpels, dissecting needles, moist paper and other equip- of the extra seeds of the working sample (12.5.1). When
ment that would be needed for a germination test are seeds in one of the following categories are found they
required. should be included in the calculation of the percentage of
seeds with viable embryos (see 12.6 below):
a) Empty fruits or embryoless seeds.
12.5 Procedure b) Fruits or seeds with embryos that have been seri-
ously injured by insects or extraction and cleaning
12.5.1 Working sample procedures.
c) Fruits or seeds with embryos that are badly discol-
The test is performed on 400 pure seeds. At least 425–450 oured, decayed or dead.
seeds should be drawn from either the pure seed fraction d) Embryos with badly deformed cotyledons.
of the purity test carried out as prescribed in Chapter 3,
or from a representative fraction of the submitted sample

Chapter 12: Excised embryo test for viability International Rules for Seed Testing
12.5.5 Incubation 12.7 Reporting results

The embryos should be placed on moistened filter or blot- The result of an excised embryo test must be reported un-
ting paper in Petri dishes, plastic boxes or the Jacobsen der ‘Other determinations’ as follows: ‘Excised embryo
apparatus. They should be incubated at a constant 20– test: …… % of seeds had viable embryos.’
25 °C for up to 14 days with at least eight hours of light Further details may be given at the discretion of the
daily. The entire working sample should start incubation seed testing laboratory, e.g. percentages of seeds that were
at the same time and decayed embryos, or those with vis- empty, insect-damaged or physically damaged.
ible fungal mycelia, should be discarded daily.
If heavy mould infection develops, a retest must be
made. The seeds or fruits should be soaked in a 5 % sodi- 12.8 Specific directions
um hypochlorite solution for 15 minutes and then washed
thoroughly with water before excision. 12.8.1 Acer spp. excluding A. negundo
and A. palmatum
12.5.6 Evaluation Soak fruits in water for 24–48 h. Remove pericarp and
wing. Resoak seeds for 24–72 h. Slit the testa in the region
Embryos mechanically damaged by excision can be dis- of the cotyledons opposite the radicle (by means of dis-
tinguished from non-viable embryos by the localised dissecting needle, manicure scissors or scalpel), and remove
coloration of the tissue after 24 h incubation. Where exci- the testa. If the testa adheres to the embryo, resoak for
sion damage makes evaluation difficult, a retest should be 1–2 h after scraping off an area of testa.
performed after further practice in the excision technique.
The following categories are considered viable:
a) embryos remaining firm, slightly enlarged and either 12.8.2 Euonymus spp.
white (e.g. most species), green (e.g. Acer pseudopla-
tanus) or yellow according to species. Soak fruit for 24 h and remove the pulpy arils. Soak seed
b) embryos with one or more cotyledons exhibiting in water for 48–72 h until fully imbibed. To excise the em-
growth or greening. bryo, cut the seed coat and endosperm lengthwise and pull
c) developing embryos (which may grow into seedlings). apart using a fingernail and scalpel. Remove the embryo
d) embryos of conifers that exhibit curvature of the with the scalpel blade.
hypocotyl.
e) embryos characterised by localised discoloration of in-
jured tissue due to excision damage. 12.8.3 Fraxinus spp.
The following categories are considered non-viable: Soak fruit for 24 h and remove wing and pericarp. Soak
a) embryos which rapidly develop severe mould and de- seed for 24–48 h until fully imbibed. To excise the em-
teriorate or decay; bryo, hold the seed in place with the index fingernail. Cut
b) embryos exhibiting extreme brown or black discolora- through the seed coat and endosperm of the seed longi-
tion, and off-grey colour or white, watery appearance. tudinally, taking care not to damage the embryo. Resoak
the seed for 24 h. The embryo may be removed by pulling
apart the seed coat and endosperm with the fingernail and
12.6 Calculation and expression of scalpel blade.
results
The viability percentage is based on the total number of
fruit or seeds tested, rather than on the number of embryos
excised. Seeds in the five categories in 12.5.6 (1) a, b, c,
d and e must be included in the total for each replicate.
The final viability percentage is determined by dividing
the number of viable embryos by the total number of seeds
included in the test and multiplying by 100.

International Rules for Seed Testing Chapter 12: Excised embryo test for viability
12.8.4 Malus spp. and Pyrus spp. The seed should be soaked in water for 48–96 h, depend-
ing on the rate of imbibition.
Soak the seeds in water for 72–96 h. Cut the hard outer To excise the embryo, the seed should be held between
seed coat and the inner seed coat longitudinally with a the thumb and index finger, with the flat side facing up-
scalpel. The seed coats may then be removed by prying ward and with the radicle tip pointed toward the palm of
them apart with the fingernail of the index finger and a the hand. With a sharp instrument, make a small cut above
scalpel blade. the radicle tip and lift up this part of the seed coat. The
seed coat must then be loosened on both edges of the seed.
The seed must be held firmly to prevent the cotyledons
12.8.5 Pinus monticola, P. peuce and P. from coming apart. In the process of extracting the em-
strobus bryo from the seed coat, the remnants of the nucellus and
endosperm will also be removed.
Soak the seed in water for 24–48 h. Hold the seed with
the fingernail of the index finger and cut the seed coat and
‘endosperm’ (strictly megagametophyte) lengthwise from 12.8.8 Pyrus spp.: see Malus spp.
one end to the other and pry apart, exposing the embryo.
The scalpel tip may be inserted into the megagametophyte, 12.8.9 Sorbus spp.
under the embryo, and the embryo may then be lifted out.
Soak the seed in water for 24–48 h. Cut the seed coat lon-
gitudinally along one side. To excise the embryo, pry the
12.8.6 Pinus cembra, P. coulteri, P. seed coat apart with a fingernail and a scalpel.
heldreichii, P. jeffreyi, P. koraiensis and
P. parviflora
12.8.10 Tilia spp.
Soak the seed in water for 48–72 h. Hold the seed between
the index finger and thumb. Split the seed coat along the Remove pericarp either dry (T. cordata) or after overnight
suture at the radicle end with a scalpel by tilting the tip soaking (T. platyphyllos). Soak or re-soak overnight. Re-
of the blade into the seed and remove the seed coat. The move testa and piece of endosperm covering the cotyledon
‘endosperm’ (strictly megagametophyte) containing the tip. Gently squeeze the sides to split open the endosperm
embryo should then be soaked in water until fully im- and reveal the radicle and hypocotyl. If the upper part of
bibed, split longitudinally with a scalpel and the embryo the endosperm cannot be lifted off easily on the needle
removed. blade, remove part of it carefully without damaging the
embryo and replace the seed in water. The edges of the
cotyledons may be embedded in the endosperm and a re-
12.8.7 Prunus spp. soak for a few hours can make extraction easier.

The seed must be removed from the stony endocarp by
means of an instrument designed to permit breaking the
stone without crushing the seeds, e.g. a nutcracker or vice.
a) Prunus avium, P. besseyi, P. mahaleb, P. padus, P.

serotina, P. virginiana and other Prunus of similar
size:
Place scalpel tip into the suture of the stone at the radi-
cle end. Tilt scalpel inwards and apply pressure un-
til endocarp begins to split. Twist scalpel tip slightly
opening endocarp. The endocarp may more readily be
removed if softened by a 24–48 h water soak.
b) Prunus armeniaca, P. persica and other Prunus of
similar size:
Place the blade of a heavy scalpel in the ventral suture
of the endocarp and strike the back of the blade with a
hammer, opening the stone. Discard and replace seeds
where the seed coat has been damaged by extraction.

International Rules for Seed Testing Chapter 13: Testing seeds by weighed replicates
Chapter 13: Testing seeds by weighed replicates
13.1 Object The reasons for this are varied, for example:
– a purity test may be impossible, owing to the seed and
The object of the weighed replicate test is to determine the inert matter being indistinguishable by eye alone, e.g.
maximum germination potential of a seed lot. This can be most Eucalyptus;
used to compare the quality of different seed lots and also – a purity test may be impractical, because although the
estimate field planting value. seed and inert matter are just about distinguishable, the
inert matter constitutes such a large proportion of the
seed lot that a purity test is too costly to perform in
13.2 Definitions relation to the value of the seed, e.g. some Eucalyptus
and most Betula;
The definitions given in Chapter 5: The Germination Test – the majority of the seed lots may have high percent-
of the ISTA Rules, to define germination, normal and ab- ages of empty seed, making it likely that the unequal
normal seedlings, etc. also apply to Chapter 13. distribution of full and empty seed between germina-
tion replicates will bias the number of potential germi-
nants before the germination test has been started, e.g.
13.3 General principles most Eucalyptus, Betula and Chloris;
– any combination of the above.
For weighed replicate tests, the aim is to test a weight of
material containing approximately 400 seed units. The ac-
tual weight of seed tested is a much smaller fraction of 13.4 Apparatus
the lot than the total amount normally tested in purity and
germination tests. Extreme care must therefore be taken Suitable germination media, materials and equipment as
to ensure that truly representative submitted and working defined in Chapter 5 should also be used for testing in
samples are drawn. Because of the difficulties of carrying Chapter 13.
out a purity analysis, when testing by weighed replicates a
purity test is not normally performed unless requested by
the applicant. Nevertheless, the full size of the working 13.5 Procedure
sample for purity analysis specified in Table 2A must still
be examined for authentication of species and removal 13.5.1 Submitted and working samples

of readily identifiable seeds of other species. The name
and number of such other seeds found, together with the The minimum weights of the submitted and working sam-
weight examined, must be reported. ples must be those prescribed in Table 2A. Samples must
In cases where determination of other seeds by number be drawn in accordance with the methods referred to in
is requested, the requirements of Chapter 4 apply. 2.5.
Four replicates of the prescribed weight are drawn
from the working sample by an approved sampling meth-
od. The replicates are planted on or in the substrate, and 13.5.2 Physical examination of the
germinated under the temperature conditions and for the working sample
length of time prescribed in Tables 13A and 13B; only
the numbers of normal and abnormal seedlings produced For Eucalyptus and Betula the whole working sample
are recorded. The result is reported as the number of nor- must be examined in order to determine that the seeds are
mal seedlings produced by the weight of seed material of the species stated by the sender and in order to identify
examined. as far as possible any other seeds contaminating the seed
The weighed replicate test is restricted to the tree spe- lot.
cies listed in Table 13A and non-tree species listed in Table
13B. In these species, measurements of purity percentage,
thousand pure seed weight and/or germination percentage
are impossible or impractical.

Chapter 13: Testing seeds by weighed replicates International Rules for Seed Testing
13.5.3 Obtaining the weighed replicates 13.6 Calculation and expression of

results
The weight of material to be tested in each replicate is
given in Tables 13A and 13B, column 6. These weights The result for the no prechill test is obtained by adding
have been derived from pure seed data so as to give ap- together the four individual replicate no prechill results. It
proximately 100 pure seeds per replicate. If it appears that is expressed as the number of normal seedlings in the total
there are too few or too many seed units in each replicate, weight of seed tested.
the procedure in 13.5.4 should be followed. The prechill test results are calculated and expressed
The working sample should be subsampled by an ap- similarly.
proved method (e.g. hand-halving, spoon, mechanical To check the reliability of a test result, the sum of the
divider) to obtain four replicates of approximately the numbers of seeds germinated in the four replicates is cal-
weight required, to be weighed to the accuracy described culated and compared with Table 13C.
in 3.5.1.
13.7 Reporting results

13.5.4 Germination tests
The result of a weighed replicates test must be reported in
The substrates, temperatures, light conditions and special the space provided as follows:
treatments for overcoming dormancy must be the same as
those permitted in Chapter 5. The conditions to be used for – The result of the purity test (if requested), in the spaces
individual species are prescribed in Tables 13A and 13B. provided for purity tests.
Where prechill and no prechill tests are prescribed, eight – ‘N’ must be entered in all the spaces provided for re-
weighed replicates should be drawn as described in 13.5.3 porting the percentages of the components of the ger-
above and four selected at random for the prechill test. If mination tests.
time and/or space permits, all eight replicates should be
set to germinate at the same time. The following additional information must also be report-
The material in each replicate should be spread uni- ed under ‘Other determinations’:
formly on the appropriate moist substrate. If during the – average weight of four replicates;
preparation of the replicates, or at any other time during – average number of normal seedlings in four replicates;
the course of the germination test it is clear that the num- – number of normal seedlings per kilogram;
ber of seed units is significantly less than 100 per replicate, – other information as specified in 1.5.2.6 and 5.9.
then the test must be repeated using replicates of greater
weight. If, on the other hand, it appears that the number of Upon request, other seeds found to be present in the
seed units per replicate is significantly greater than the de- weighed replicates may be reported, giving the scientific
sired 100 seeds, then each replicate may be split into two name(s) and number(s) of seeds found.
or more parts and spread evenly between the appropriate
number of substrates. Each part of the replicate should be
carefully identified, kept close together and assessed as 13.8 Tables of germination
though they were one replicate (see 5.8). The duration of methods for specific species
the test and the day of first assessment for individual spe-
cies are given in Table 13A. Seedlings should be evalu- Tables 13A and B indicate permissible substrates, tem-
ated in accordance with 5.2.5–5.2.8. peratures, duration, weight of replicate and additional
At the termination of the test, no attempt need be made directions, including recommended special treatments for
to categorise the remaining seeds into empty, hard, fresh dormant samples, for tree species (Table 13A) and non-
and ungerminated. However, if the germination of the tree species (Table 13B).
seeds is slow and uneven, and if the analyst has any other For certain species indicated in column 7, a ‘double
reason for suspecting that dormancy is present, the test test’ (with and without prechilling) is mandatory.
should be repeated after a suitable treatment (see 5.6.3). Results of the tests can only be relied upon if the differ-
ence between the highest and lowest total replicate count
is within acceptable limits. The tolerances to be used for
tests on weighed replicates are to be found in Table 13C.

International Rules for Seed Testing Chapter 13: Testing seeds by weighed replicates
Table 13A. Germination methods for tree species
Species Substrate Temperature* First Final Weight Additional directions incl. recommendations for
(°C) count count of repli- breaking dormancy
(d) (d) cate (g)
1 2 3 4 5 6 7
Betula pendula TP 20<=>30 7 21 0.10 Double test: no prechill and prechill 21 d at
4 °C
Betula pubescens TP 20<=>30 7 21 0.10
Corymbia citriodora TS 25 5 14 0.50
Corymbia ficifolia TP 20 5 14 1.00
Corymbia maculata TP 25 5 14 0.50
Eucalyptus astringens TP 20 5 15 0.50
Eucalyptus botryoides TP 25 5 15 0.10
Eucalyptus bridgesiana TP 25 5 14 0.25
Eucalyptus camaldulensis TP 30 3 14 0.10
Eucalyptus cinerea TP 30 3 14 0.25
Eucalyptus cladocalyx TP 20 5 14 0.50
Eucalyptus cloeziana TS 25 14 21 0.50
Eucalyptus cypellocarpa TP 25 5 14 0.25
Eucalyptus dalrympleana TP 25 5 14 0.25
Eucalyptus deanei TP 20 5 21 0.10
Eucalyptus deglupta TS 35 5 14 0.10
Eucalyptus delegatensis TP 20 3 14 0.50 Prechill 28 d at 3–5 °C
Eucalyptus elata TP 15 10 21 0.50
Eucalyptus fastigata TP 15 10 21 0.50
Eucalyptus glaucescens TP 20 7 21 0.50 Double test: no prechill and prechill 21 d at
3–5 °C
Eucalyptus globulus TP 25 5 14 1.00
Eucalyptus grandis TP 25 (20<=>30) 5 14 0.10
Eucalyptus gunnii TP 20 7 28 0.10
Eucalyptus largiflorens TP 35 3 14 0.10
Eucalyptus leucoxylon TP 25 5 14 0.25
Eucalyptus TP 15 10 28 0.50
macrorrhyncha
Eucalyptus mannifera TP 25 5 14 0.10

Eucalyptus melliodora TP 25 5 14 0.25
Eucalyptus microtheca TS 30 3 14 0.10
Eucalyptus moluccana TP 30 3 14 0.25
Eucalyptus muelleriana TP 15 10 21 1.00
Eucalyptus nitens TP 20 7 21 0.25 Double test: no prechill and prechill 21 d at
3–5 °C
Eucalyptus pauciflora TP 15 10 21 1.00
Eucalyptus pilularis TP 25 5 14 1.00
Eucalyptus polybractea TP 15 10 21 0.10
Eucalyptus radiata TP 20 5 14 0.50
Eucalyptus regnans TP 15 10 21 0.25
Eucalyptus resinifera TS 25 5 21 0.25
Eucalyptus robusta TP 20 7 14 0.10
Eucalyptus rudis TP 35 3 14 0.10
Eucalyptus saligna TP 25 5 14 0.10
Eucalyptus sideroxylon TP 20 5 14 0.25
Eucalyptus sieberi TP 25 5 14 0.50
Eucalyptus smithii TP 20 5 14 0.25
Eucalyptus tereticormis TP 30 3 14 0.10
Eucalyptus viminalis TP 25 5 14 0.25
TP = top of paper; TS = top of sand
*The symbols ‘<=>’ indicate alternating temperature regimes. 1st temperature: 16 hours; 2nd temperature: 8 hours

Chapter 13: Testing seeds by weighed replicates International Rules for Seed Testing
Table 13B. Germination methods for non-tree species
Species Sub- Temperature* First Final Weight of Additional directions incl.recommendations

strate (°C) count (d) count (d) replicate (g) for breaking dormancy
1 2 3 4 5 6 7
Chloris gayana TP 20<=>35; 20<=>30 5 14 0.25 KNO3; light; prechill
13.9 Tolerance tables Table 13C. Maximum tolerated range between replicates
Table 13C, based on the Poisson distribution, indicates the Number of normal seedlings in Maximum
the total weight of seeds tested range
maximum range (i.e. maximum difference between the
highest and the lowest) in germination data tolerable be- 1 2
tween weighed replicates, allowing for random variation > 0–6 4

at 0.05 probability. To find the maximum tolerated range, > 7–10 6
calculate the sum of the numbers of normal seedlings in > 11–14 8
> 15–18 9
the four replicates. Locate the sum in column 1 of the table
> 19–22 11
and read off the maximum tolerated range in column 2.
> 23–26 12
> 27–30 13
> 31–38 14
> 39–50 15
> 51–56 16
> 57–62 17
> 63–70 18
> 71–82 19
> 83–90 20
> 91–102 21
>103–112 22
>113–122 23
>123–134 24
>135–146 25
>147–160 26
>161–174 27
>175–188 28
>189–202 29
>203–216 30
>217–230 31
>231–244 32
>245–256 33
>257–270 34
>271–288 35
>289–302 36
>303–321 37
>322–338 38
>339–358 39
>359–378 40
>379–402 41
>403–420 42
>421–438 43
>439–460 44
>460 45

International Rules for Seed Testing Chapter 14: X-ray test
Chapter 14: X-ray test
14.1 Object age. When the film or paper is processed, a visible image
of varying shades of light and dark is formed. Several fac-
The objects of X-radiography are: tors can affect the quality of the X-ray image.
– to provide a quick, non-destructive method of differ- The voltage, measured in kilovolts (kV), is the meas-
entiating between filled, empty, insect-damaged and ure of potential between the electrodes within the X-ray
physically damaged seed from the morphological tube. An increase in voltage will produce shorter-wave-
characteristics evident on an X-radiograph; length X-rays. The voltage affects the contrast of the
– to create a permanent photographic record of the pro- image; a lower voltage improves the resolution, while a
portions of filled, empty, insect-damaged and physi- higher voltage reduces the density difference.
cally damaged seeds in a sample. The electric current applied to the tube is measured in
milliamperes (mA). Increasing the current increases the
Further information on the X-ray test may be found in the number of X-rays produced in a given time. The current
ISTA Tree and Shrub Seed Handbook. influences the density, but not the contrast of the image. A
high current will overexpose (darken) the image.
The exposure time is the time during which the speci-
14.2 Definitions men is exposed to X-rays for making the radiograph.
There is an interaction between exposure time and current,
14.2.1 Radiograph so exposures should be expressed in milliampere-seconds
(mAs) or milliampere-minutes (mA ∙ min). Changing the
A radiograph is an image on photosensitive film or paper exposure time alters the density of the image. To retain
that is formed when an object is placed between the film the same image quality, any increase in exposure time
or paper and an X-ray source. Photographic processing requires a proportional decrease in current. For example,
converts a latent image to one that is visible. an exposure of 100 mAs obtained with a tube current of
5 mA and an exposure time of 20 s produces the same im-
age density as an exposure made at 10 mA for 10 s.
14.2.2 X-rays The distance between the focal spot (or target) and the
film surface is the focus-film distance (FFD). An increase
X-rays are electromagnetic waves in the electromagnetic in the FFD decreases the intensity of the radiation accord-
spectrum travelling at the speed of light, but with variable ing to the inverse square law. Thus, doubling the FFD re-
wavelengths (1/10 000 to 1/100 000 of that of light). High-energy quires four times the exposure to achieve the same degree
(shorter wavelength) X-rays are more suitable for large of image density on the film or paper.
and/or dense objects. Low-energy (longer wavelength) X- The distance between the object and the film surface
rays are suitable for small objects such as seeds. (OFD) affects the image quality. The greater the distance,
the poorer the image, as details will be less distinct. If fine
detail is necessary, the seeds may be placed directly on the
14.3 General principles film surface, although in routine work the film is usually
kept in a carrier or envelope to make handling easier.
Seeds are placed between a low-energy X-ray source and It is possible to use contrast agents that differentially
photosensitive film or paper. The various types of seed tis- permeate the subject, making some parts more radio-
sue absorb the X-rays to varying extents, depending on graphically dense than others in order to enhance certain
their thickness and/or density. The sensitive photographic characteristics of the image.
emulsion is excited to varying degrees, depending on the
amount of radiation it receives, thus creating a latent im-

Chapter 14: X-ray test International Rules for Seed Testing
14.4 Apparatus 14.5.2 Evaluating the image
The following apparatus is necessary: Seeds are classified according to the internal anatomy re-
– X-ray machine; vealed by the radiograph as:
– X-ray film or paper;
– developer for film or paper; filled: fruit or seed containing all tissues essential for
– holder for film; germination;
– holder for seeds. empty: fruit or seed containing less than 50 % of seed
tissue;
insect-damaged: fruit or seed containing insects, insect
14.5 Procedures larvae or frass, or showing other evidence of insect
damage affecting the ability of the seed to germinate;
14.5.1 Loading the film, preparing the physically damaged: filled fruit or seed with the coat
seed and developing the image outline cracked or broken.
1. Load film/paper in cassettes or holder, or use prepack-

aged film/paper. 14.6 Calculations and expression
2. The test is performed on four replicates of 100 seeds, of results
each drawn at random from the pure seed fraction
(they may be the same seeds as those used for the ger- Results are expressed as percentages of filled, empty, in-
mination test). sect-damaged, or physically damaged seeds.
3. Spread the seeds (with or without a holder) evenly on
top of the film or paper.
4. Place lead letters or other X-ray-opaque marking de- 14.7 Reporting results
vices on the film or paper to identify the sample.
5. Make the exposure. Individual X-ray machines will The results of an X-ray test must be reported under ‘Other
require different exposure time and voltage settings determinations’ as percentages of filled, empty, insect-
to produce the best image. Settings will also vary for damaged or physically damaged seeds, as follows:
different species. For the best results, a time-voltage- ‘X-ray test results:
exposure series should be made whenever new mate- …… % filled;
rial or a different machine is used. …… % empty;
6. D
evelop the film or paper. Paper is usually developed …… % insect-damaged;
in instant processors, which produce a print within a …… % physically damaged’.
few seconds. Film must be developed in a darkroom.

International Rules for Seed Testing Chapter 15: Seed vigour testing
Chapter 15: Seed vigour testing
15.1 Object 15.2.3 Acceptable germination
The object of a seed vigour test is to provide information A seed lot of acceptable germination is one which, in the
about the planting value in a wide range of environments absence of seed dormancy, has an acceptable standard ger-
and/or the storage potential of seed lots. The test provides mination level for that species.
additional information to the standard germination test
(see Chapter 5) to assist in the differentiation of seed lots
of acceptable germination. 15.2.4 Additional definitions
Seedling emergence the emergence through the soil or

15.2 Definitions other planting medium of a young plant developing
from the embryo of the seed
15.2.1 Seed vigour Seedling performance the ability of a seedling to
emerge from the soil or other medium and develop into
Seed vigour is the sum of those properties that determine a normal plant
the activity and performance of seed lots of acceptable Total germinated seeds the sum of the proportion of
germination in a wide range of environments. seedlings classified as normal and abnormal at the end
Seed vigour is not a single measurable property, but of a controlled deterioration (CD) germination test
is a concept describing several characteristics associated conducted under the conditions and within the period
with the following aspects of seed lot performance: specified in Chapter 5, Table 5A
– rate and uniformity of seed germination and seedling
growth;
– emergence ability of seeds under unfavourable envi- 15.3 General principles
ronmental conditions;
– performance after storage, particularly the retention of A vigour test assesses, either directly or indirectly, the
the ability to germinate. physiological and physical basis of potential seed lot per-
formance in a wide range of environments, and provides
A vigorous seed lot is one that is potentially able to per- a more sensitive differentiation between seed lots of ac-
form well even under environmental conditions which are ceptable germination than does the germination test. Such
not optimal for the species. information can be used to make informed decisions re-
garding the value of different seed lots.
Vigour tests are able to provide:
15.2.2 Seed vigour test – a more sensitive index of seed quality than the stand-
ard germination test;
A seed vigour test is either a direct or an indirect analyti- – a consistent ranking of seed lots of acceptable germi-
cal procedure to evaluate the vigour of a seed lot under nation in terms of their potential physiological and
standardised conditions. physical quality; Chapter 15: Seed vigour testing
– information on emergence and storage potential of
a) Direct tests reproduce environmental stresses or other seed lots to plan marketing strategy.
conditions in the laboratory, and the percentage and/or
rate of seedling emergence are recorded. An important source of information on seed vigour is the
b) Indirect tests measure other characteristics of the seed current ISTA Handbook of Vigour Test Methods. Compi-
that have proved to be associated with some aspect of lation of this handbook is continuing as vigour tests are
seedling performance. added and as vigour testing methodology is standardised.
See also: the current Association of Official Seed Analysts
Seed Vigor Testing Handbook and the Proceedings of the
ISTA Seed Vigour Testing Seminar held in Copenhagen,
Denmark in 1995.

Chapter 15: Seed vigour testing International Rules for Seed Testing
Vigour test methods are species specific and require 15.5.3 Test conditions
suitable equipment, the use of control samples and experi-
ence of the analyst. The expectation that a seed analyst can Methodology for each test is prescriptive, and no other
infrequently analyse an isolated sample to establish a level methodology may be used if an ISTA Certificate is issued.
of vigour is unrealistic. Uniformity can be best achieved
by working for a period of time alongside another analyst
experienced in the use of the method. Training of analysts 15.5.4 Control samples
may be more important than the exact agreement in details
of procedure. All vigour tests require rigid control of test conditions
The following ISTA vigour tests have completed and, where specified, should include a control seed sam-
validation: ple to provide internal quality control of vigour test uni-
formity. Variability in control seed sample results provides
Conductivity test: Cicer arietinum (Kabuli type), Gly- an indication of slight fluctuations in test conditions (e.g.
cine max, Phaseolus vulgaris, Pisum sativum (garden changes in temperature or seed moisture) which can sig-
peas only, excluding petit-pois varieties), Raphanus nificantly affect the reliability of results. Specific guide-
sativus lines for the seed lot selection, storage and handling of
control samples are described in the ISTA Handbook of
Accelerated ageing test: Glycine max Vigour Test Methods.
Controlled deterioration test: Brassica spp.

15.6 Calculation and expression of
Radicle emergence test: Zea mays, Brassica napus (oil- results
seed rape, Argentine canola), Raphanus sativus
Results are expressed in different formats for different
Tetrazolium vigour test: Glycine max vigour tests, as shown in 15.8.
Detailed methods are given in 15.8.

15.7 Reporting of results
15.4 Apparatus The result is reported on an ISTA Certificate under ‘Other
Determinations’, using the procedure described in 15.8.
Permissible apparatus, substrates, temperatures, seed The results must be accompanied by a statement of the
moisture contents, test duration and additional directions test method used, including specific variables (time, tem-
are provided in 15.8. perature, seed moisture) when appropriate.
15.5 Procedures 15.8 Detailed methods

15.5.1 Working sample 15.8.1 Conductivity test
The required number of seeds and replicates (see 15.8) 15.8.1.1 Principle
must be taken at random from the pure seed fraction (see

3.2.1) of the sample. Measurement of the electrical conductivity of leachates
provides an assessment of the extent of electrolyte leakage
from plant tissues. Conductivity measurement of the soak
15.5.2 General directions water in which a bulk sample of seeds has been steeped
gives an estimate of seed vigour. Seed lots with high elec-
Different vigour test methods (direct and indirect) are de- trolyte leakage, i.e. high leachate conductivity, are con-
scribed under three general categories: physiological, bio- sidered to have low vigour, whilst those with low leakage
chemical and ageing tests. The tests in 15.8 have been rig- (low conductivity) are considered to have high vigour.
orously evaluated through recognised protocols, including
extensive comparative testing and many comparisons of
seed lot performance for the species listed.

15.8.1.2 Scope and field of application Germinator, incubator or walk-in room: a constant
temperature of 20 ±2 °C is required.
The conductivity test offers a vigour test for Cicer ari-
etinum (Kabuli type), Glycine max, Phaseolus vulgaris, Moisture content test facilities: moisture content tests
Pisum sativum (garden peas only) and Raphanus sativus are conducted according to Chapter 9.
which relates to the field emergence potential of seed lots.
The test does not apply to field peas or the so-called ‘petit-
pois’ varieties of garden peas (Pisum sativum). 15.8.1.4 Preparation of the sample
Submitted seed lots may have been treated with fungi-
cide. Various sources of fungicide preparations with dif- Adjust seed moisture content as follows if specified in Ta-
ferent purity levels are commercially available and some ble 15A.
fungicides may possess additives that may significantly Determine the moisture content of the submitted sam-
alter conductivity results. Thus, caution must be exercised ple according to Chapter 9. If the moisture content is be-
when using the conductivity test for treated seeds. low 10.0 % or above 14.0 %, it must be adjusted to be-
tween 10.0 and 14.0 %, although it is not necessary for
the moisture content of all samples to be the same within
15.8.1.3 Apparatus this range. To adjust the seed moisture content, mix the
fraction of pure seed thoroughly and draw randomly a
Conductivity meter: a direct-reading meter using AC subsample of at least 200 seeds. In the case of a moisture
or DC current, with a dip cell that has a cell constant content below 10.0 %, raise the moisture content by plac-
of 1.0, is suitable. The meter specifications should ining each weighed subsample between moist cloths (paper
clude a conductivity range of 0–1999 µS cm-1, a reso- towels) until it reaches a weight equivalent to a moisture
lution of at least 0.1 µS cm-1, an accuracy of ±1 % and content between 10.0 and 14.0 %. Experience indicates
a temperature range of 20–25 °C. that to raise the moisture content of pea seeds with an
initial moisture content of 7 % to a moisture content of
Containers: as specified in Table 15 A, the base diameter 10.0 or 14.0 % takes approximately 3 or 7 h, respectively.
must provide adequate water depth to immerse all the These times should be taken as a guide only, as the actual
seeds and the dip cell. Cleanliness is important, and times will depend on the extent to which the cloths sur-
all containers must be washed thoroughly and rinsed rounding the seeds have been moistened.
twice with deionised or distilled water before use. In the case of a moisture content above 14.0 %, reduce
the moisture content by placing the weighed subsample
Water: deionised water or distilled water should be used. in an oven at 30 °C until it reaches a weight equivalent
The conductivity of the deionised or distilled water to a moisture content between 10.0 and 14.0 %. Experi-
must be measured and must not exceed 5 µS cm-1 at ence indicates that seeds with an initial moisture content
20 °C. The water used for testing must be at 20 ±2 °C of around 15 % take 1 h to reach 14.0 %, and 5–6 h to
before use. reach 10.0 %, when dried in this way. When the initial

Table 15A. Conditions for the conductivity test carried out on different species
Species Containers to be used Sample size Seed moisture Water Temperature Soak
content volume time
15A.1
Cicer arietinum (Kabuli type) Erlenmeyer flasks 4 weighed repli- Adjust to 250 mL 20 °C 24 h
Glycine max or beakers, capac- cates of 50 seeds 10–14 %
Phaseolus vulgaris ity 400–500 mL with
Pisum sativum (garden peas only, a base diameter of
excluding petit-pois varieties) 80 mm (±5 mm)
15A.2
Raphanus sativus Tubes 7–8 cm high 4 weighed repli- No 40 mL 20 °C 17 h
with a diameter of 4 cm cates of 100 seeds adjustment

seed moisture content is approximately 16 %, it takes 15.8.1.5.2 Checking the cleanliness of equipment
1–2 h drying to reach 14.0 %, and 8–10 h to reach 10.0 %.
The range of seed weights for the subsamples that will Each testing day, select at random 2 out of every 10 con-
give moisture contents from 10.0 and 14.0 % can be calcu- tainers to be used, add the required volume (Table 15A)
lated for both methods using the following equation: of deionised or distilled water of known conductivity and
which has been maintained at 20 ±2 °C, and read the con-
Weight of subsample at 10.0 or 14.0 % mc = ductivity. If the conductivity of the water in the contain-
ers is higher than 5 µS cm–1, thoroughly rewash the dip
(100 – initial mc) cell and all containers to be used that day in deionised or
(initial weight) ∙
(100 – desired seed mc*) distilled water. Retest the conductivity of another speci-
fied volume of deionised or distilled water in a further 2
mc = moisture content out of every 10 randomly selected containers. Repeat the
process if necessary, until the readings are not higher than
*The desired moisture content will be either 10.0 or 5 µS cm–1.
14.0 %.
When the subsample has reached a weight equivalent to 15.8.1.5.3 Checking the temperature
a moisture content between 10.0 and 14.0 %, it should
be sealed in a moisture-proof container, such as an alu- Proceed with conductivity testing only if the records for
minium foil packet or polythene bag, and held for 12–18 h the temperature of the germinator, incubator or walk-in-
at 5–10 °C to allow the moisture content to equilibrate room, and water show that the required temperature of
throughout the seed. 20 ±2 °C is being achieved.
15.8.1.5 Checking equipment and materials 15.8.1.6 Conductivity measurement
15.8.1.5.1 Calibrating the dip cell 15.8.1.6.1 Preparing the test samples
Prior to use, calibrate the conductivity meter using trace- Count four replicates of seeds as specified in Table 15A,
able standard solutions. At least two solutions should be each drawn at random from either the pure seed fraction
used, one with a conductivity less than 100 µS cm–1 and directly or, if seed moisture content has been adjusted,
one with a conductivity between 1000 and 1500 µS cm–1. from the subsample with the adjusted moisture content.
Note that calibration of the meter using these solutions is Weigh the replicates to two decimal places (0.01 g).
carried out at 25 °C, which is possible when using a meter
with the specifications in 15.8.1.3. If the reading is incor-
rect, the calibration must be repeated and, if necessary, the 15.8.1.6.2 Preparing the containers
meter adjusted or repaired.
Alternatively, calibrate the conductivity meter using a For each sample to be tested, prepare four containers and
potassium chloride solution made up in the testing labora- add the required volume of water (Table 15A). Cover all
tory, if this can be achieved with the accuracy required. containers to prevent contamination and equilibrate to
Dissolve 0.745 g of pure, dry analytical grade potassium 20 ±2 °C for 18–24 h prior to placing the seeds in the
chloride (dried at 150 °C for 1 h and cooled in a desicca- water. Include two control containers with each test run,
tor before weighing) in deionised water to make 1 L of containing only deionised or distilled water.
0.01 M KCl solution. In this solution, the meter should
read between 1273 and 1278 µS cm–1 at 20 °C. If the read-
ing is out of range, the calibration test should be repeated
and, if necessary, the meter adjusted or repaired. Conduc-
tivity meters that are out of calibration must not be used
for the conductivity test.

15.8.1.6.3 Soaking the seeds If hard seeds are observed during testing, they should be
removed after the conductivity test and their number re-
Place each weighed replicate into a prepared container. corded. They should then be surface dried and weighed,
Gently swirl each container to ensure that all seeds are and their weight subtracted from the initial weight of the
completely immersed. Cover each container with, for ex- 50-seed replicate.
ample, aluminium foil or cling film, prior to placing at
20 ±2 °C for the required time (Table 15A). Label each
container with the start time. The number of containers 15.8.1.6.6 Accounting for the conductivity of the
started at one time must not exceed the number of evalu- original water source
ations for conductivity that can be made within 15 min-
utes of the conclusion of the soak period (usually 10 to 12 Measure the conductivity of one control container. Any
containers). increase in conductivity above 5 µS cm-1 indicates a po-
tential problem with the cleanliness of the dip cell. Re-
wash the dip cell and measure the conductivity of the
15.8.1.6.4 Preparing for the conductivity readings other control container. If this also indicates an increase
in conductivity, there is a problem with the dip cell, and
Turn on the conductivity meter prior to testing; note that conductivity measurements cannot be made until this has
instructions for each meter may specify a minimum warm- been satisfactorily cleaned. Most conductivity meters pro-
up period. Add sufficient deionised or distilled water to vide instructions for cleaning the dip cell. Where the con-
cover the conductivity cell to each of two containers for ductivity of the second control container does not show an
rinsing the conductivity cell between each measurement. increase above 5 µS cm-1, this value, or the mean of the
two controls if neither has increased, represents the back-
ground conductivity, which should be subtracted from the
15.8.1.6.5 Measuring the conductivity of the solution values already recorded for each replicate container.
Measure the conductivity of the soak solution at the end of

the soak period (Table 15A). Mix the leachate using one of 15.8.1.7 Calculation and expression of results
the following methods:
The conductivity per gram of seed weight for each repli-
a) Gently swirl the container (with seeds) for 10–15 s to cate is calculated after accounting for the background con-
ensure thorough mixing of the leachate, remove the ductivity of the original water (see above), and the aver-
covering of the container, and immerse the dip cell age of the four replicates provides the seed lot test result.
into the solution without filtration. Do not place the Thus for each replicate:
cell directly onto the seeds.
Conductivity reading (μS cm–1) – background reading
b) Stir the seeds and solution gently with a plastic spatula =
Weight of replicate (g)
before measuring the conductivity as above. The spat-
ula should be rinsed twice using water between each Conductivity (μS cm–1 g–1)
reading and dried on a clean paper towel.
For species in Table 15A.1
c)
Transfer the contents of the container to another Chapter 15: Seed vigour testing
container by pouring the seeds plus soak water into If the mean conductivity of the four replicates differs by
a nylon sieve. The cleanliness of the container used more than the tolerance value (see Table 15C) for that
for transfer should have been checked before use (see conductivity, the lot must be retested. If the second result
section 15.8.1.5.2). Pass the soak water back over the is compatible with the first (i.e. the difference does not
seeds into the original container and immerse the dip exceed the tolerance indicated in Table 15D), the average
cell in the solution. After measuring the conductivity of the two tests must be reported.
of a subsample, rinse both the dip cell and the nylon When a test on a seed lot is repeated within a labora-
sieve twice using water, and dry by blotting on a clean tory, the tolerance values that indicate acceptable repeat-
paper towel prior to testing the next subsample. ability are shown in Table 15D. Tolerances for conductiv-
ity tests completed on different submitted samples and in
Once the leachate has been mixed, take several measure- different laboratories, are shown in Table 15E.
ments of the conductivity until a stable value is obtained.

For species in Table 15A.2 content, along with the high temperature, causes rapid
seed ageing. High vigour seed lots will withstand these
Calculate the variance, standard deviation and coefficient extreme stress conditions and age more slowly than low
of variation as follows: vigour seed lots. Thus, after AA, high vigour lots retain a
high germination, whilst that of low vigour lots is reduced.
N ∑ x2 – (∑ x)2
Variance =
N(N – 1)
15.8.2.2 Scope and field of application
where
x = conductivity of each replicate in μS cm–1 g–1 The accelerated ageing test provides a vigour test for Gly-
N = number of replicates cine max which relates to both field emergence and stor-
Σ = sum of age potential.
Standard deviation s = √Variance Seeds to be aged should not be treated with fungicide(s)
if possible. However, if seeds are marketed with fungicide
s treatment, treated seeds may be tested.
x
where x = mean conductivity of the sample 15.8.2.3 Apparatus
If the coefficient of variation does not exceed 9.0, the Balance: analytical balance capable of weighing to the
replicates are acceptable. If the coefficient of variation is nearest 0.001 g
greater than 9.0, the test must be repeated.
When two tests are performed in different laboratories: Plastic AA box: A plastic box (11.0 × 11.0 × 3.5 cm,
maximum tolerance value for two test results = length × width × depth) with a lid, into which is
mean conductivity reading × 0.3326 placed a plastic or wire tray with a 10.0 × 10.0 × 3.0
cm (length × width × depth) mesh screen. The pore
size of the mesh screen should be 1.16 ±0.01 mm ×
15.8.1.8 Reporting results 1.63 ±0.01 mm, i.e. ~1.89 mm2. These trays can be
purchased commercially or constructed according to
The result of a seed vigour test using the conductivity test the guidelines provided by Elliot (1982), Association
method must be reported under ‘Other determinations’ as of Official Seed Analysts Newsletter 56 (3), 61–64.
follows:
– The result must be expressed in μS cm-1 g-1 to the near- Bottle-top dispensette: Volume range from 0–100 mL,
est 0.1 μS cm-1 g-1. for dispensing 40 mL water from a standard screw-
– The seed moisture content before the test must be re- neck bottle into plastic AA boxes, or a 50 mL gradu-
ported. Where the moisture content has been adjusted ated cylinder, if dispensette is not available.
before the test, both the initial moisture content and the
calculated moisture content after adjustment must be Ageing chamber: An ageing chamber capable of main-
reported. taining a constant temperature of 41 ±0.3 °C must be
– The results must be accompanied by a statement of the used. A water-jacketed ageing chamber is recommend-
specific variables used in the test (soaking time and ed. Place a plastic or stainless steel pan in the base of
temperature). the chamber and fill with water to maintain relative

humidity during ageing. Laboratory room temperature
must be controlled with air conditioning in tropical
15.8.2 Accelerated ageing (AA) test for climates.
Glycine max
Water: deionised or distilled
15.8.2.1 Principle
Moisture content test facilities: Moisture content tests
The accelerated ageing (AA) stress test exposes seeds for are conducted according to Chapter 9.
short periods to high temperature and high relative humid-
ity (≈ 95 %). During the test, the seeds absorb moisture Germination test facilities: Germination tests are con-
from the humid environment and the raised seed moisture ducted according to Chapter 5.

15.8.2.4 Preparation of the sample 15.8.2.5.2 Cleanliness of equipment
Determine the moisture content of the submitted sample To prevent fungal contamination prior to each testing run,
according to Chapter 9. If the moisture content is below thoroughly wash the plastic AA boxes and screen trays
10.0 % or above 14.0 %, it must be adjusted to between in a 1 % (10 000 ppm) sodium hypochlorite solution, or
10.0 and 14.0 %, although it is not necessary for the mois- wash in a commercial dish washer and dry after each use.
ture content of all samples to be the same within this The interior of the ageing chamber including trays should
range. After adjustment of the seed moisture content, mix also be washed, at least twice a year, with a sodium hy-
the fraction of pure seed thoroughly and draw randomly a pochlorite solution.
subsample of at least 42 g.
In the case of a moisture content below 10.0 %, raise
the moisture content by placing each weighed subsample 15.8.2.6 Accelerated ageing procedure
between moist cloths (paper towels) or in a high humid-
ity environment until it reaches a weight equivalent to a 15.8.2.6.1 Preparing the plastic AA boxes and seed
moisture content between 10.0 and 14.0 %. sample
In the case of a moisture content above 14.0 %, reduce
the moisture content by placing the weighed subsample in Place 40 ±1.0 mL of deionised or distilled water in each
an oven at 30 °C until it reaches a weight equivalent to a plastic AA box and insert a dry screen tray, being care-
moisture content between 10.0 and 14.0 %. ful not to splash water onto the screen. Weigh a Glycine
The range of seed weights for the subsamples that will max seed sample of 42 ±0.5 g and place on the surface of
give moisture contents from 10.0 and 14.0 % can be calcu- the screen tray. Seeds should be only one layer deep to
lated for both methods using the following equation: ensure even uptake of moisture from the humid environ-
ment. Place a lid (do not seal edges) on each plastic AA
Weight of subsample at 10.0 or 14.0 % mc = box. The plastic boxes with seeds should be placed on a
shelf from the ageing chamber, allowing an air space of
(100 – initial mc) approximately 2.5 cm between plastic AA boxes to assure
(initial weight) ∙
(100 – desired seed mc*) temperature uniformity. Two plastic AA boxes with 42 g
of seeds in each should be used to obtain at least 200 seeds
mc = moisture content for testing of larger seeded Glycine max cultivars. Include
*The desired moisture content will be either 10.0 or one or more Glycine max control samples with each test.
14.0 %.
When the subsample has reached a weight equivalent to 15.8.2.6.2 Ageing the seed
a moisture content between 10.0 and 14.0 %, it should
be sealed in a moisture-proof container, such as an alu- Place the shelves holding the plastic AA boxes contain-
minium foil packet or polythene bag, and held for 12–18 h ing the seeds into the ageing chamber, being careful not
at 5–10 °C, to allow the moisture content to equilibrate to splash water onto the screen surface during handling.
throughout the seed. If several samples are tested in the same run they should
all be placed in the ageing chamber at the same time and
the door closed. Record the time and date when the plastic
15.8.2.5 Checking equipment and materials boxes with seeds are placed in the ageing chamber. The Chapter 15: Seed vigour testing
72 h ageing period starts with the placement of the shelves
15.8.2.5.1 Checking the temperature in the ageing into the ageing chamber. The ageing chamber door should
chamber not be opened during the 72 h ageing period. After the
temperature recovers to 41 ±0.3 °C, it should be moni-
Precisely calibrate the temperature of the ageing cham- tored continuously during ageing to be certain that it re-
ber at 41 ±0.3 °C using a thermometer approved by the mains at that level. Shelves containing plastic AA boxes
National Institute of Standards and Testing (NIST) for with seed should be removed from the ageing chamber at
your country. Proceed with AA testing only if the records 72 h (±15 min).
show that the required temperature of 41 ±0.3 °C has been
achieved and maintained for at least two days.

When ageing tests are initiated for many seed lots in – Results are expressed as a percentage, calculated to
several ageing chambers on the same day, seed samples the nearest whole number (5.8.1) of normal seedlings,
should be set up at approximately one or two hour inter- abnormal seedlings, hard seeds, fresh seeds and dead
vals, between ageing chambers. This will allow adequate seeds. If the result for any of these categories is found
time for the germination tests for each group of samples to to be zero, it must be reported as ‘0’.
be set up immediately after the ageing period. – The seed moisture content before the test must be re-
At the conclusion of the ageing period, but prior to ported. Where the moisture content has been adjusted
setting up the germination test, immediately weigh the before the test, both the initial moisture content and the
imbibed seed in the control sample. If the imbibed seed calculated moisture content after adjustment must be
weight is lower than 52 g or higher than 55 g, the test reported.
results may not be accurate and the samples of that run – The results must be accompanied by a statement of
should be retested. the specific variables used in the test (seed weight per
AA box both before and after ageing, ageing time and
temperature).
15.8.2.6.3 Testing for germination
Set up a germination test using four 50-seed replicates 15.8.3 Controlled deterioration test for
for each sample within 1 h after removal from the age- Brassica spp.
ing chamber. The testing conditions for the standard ger-
mination test for Glycine max seed are those outlined in 15.8.3.1 Principle
Chapter 5. If 400 seeds per sample are required for the
germination test, two subsamples of 42 g seeds must be The controlled deterioration (CD) test exposes seeds to a
aged in two plastic AA boxes. high temperature while at a specified and constant raised
seed moisture content. These conditions cause seeds to de-
teriorate, or age, rapidly. The moisture content of a seed
15.8.2.7 Calculation and expression of results sample is raised before the seeds are placed at the raised
temperature, thus ensuring that all samples tested are ex-
Calculate the average AA germination percentage accord- posed to a predetermined degree of deterioration during
ing to Chapter 5 by combining two of the 50-seed repli- the test. High vigour seeds retain a high germination after
cates to one 100-seed replicate. If the two 100-seed rep- deterioration, while the germination of low vigour seeds
licates differ by more than the maximum tolerance value is reduced.
for AA germination shown in Table 15F, the seed lot must
be re-tested. If the second result is compatible with the
first (i.e. the difference does not exceed the tolerance in- 15.8.3.2 Scope
dicated in Table 15G), the average of the two tests must
be reported. The CD test provides a vigour test for Brassica species
When an AA test on the same seed lot is repeated in the which relates to both field emergence and storage poten-
same laboratory, the tolerance values that indicate accept- tial. This test has not been validated on treated seed. Seed
able maximum range between the two tests are shown in treatments may affect the performance of the method.
Table 15G. Tolerances for AA tests completed on different
submitted samples and in different laboratories are shown
in Table 15H. 15.8.3.3 Apparatus
Water bath: This must have a temperature range to in-

15.8.2.8 Reporting results clude 45 °C and be accurate to ±0.5 °C. Alternatively,
an incubator giving the same degree of accuracy could
The result of a seed vigour test using the AA method must be used. A water bath maintains the required tempera-
be reported under ‘Other determinations’ as follows: ture more uniformly when a number of tests are being

conducted. If an incubator is used, care must be taken If the conductivity test is used to assess deterioration
to ensure that there are no differences in tempera- in 15.8.3.4.3:
ture within it, especially when many tests are being
conducted. Water: deionised water or distilled water as described in
Analytical balance: capable of weighing to the nearest 15.8.1.3
0.0001 g Conductivity meter: as described in 15.8.1.3
Aluminium foil packets: Suitable for holding 100 seeds Containers (beakers or flasks): the containers should
in a single layer, with at least 3 cm space above the have a base diameter of 50 mm (±5 mm) and provide
seeds after the packet is sealed. Packets approximately adequate water depth to immerse all the seeds and the
5–6 cm deep and 7–10 cm wide are suitable. Packets dip cell.
must be impermeable to moisture once sealed. A range
of packets are available, but example specifications
are: paper (white kraft 60 g) covered by aluminium 15.8.3.4 Controlled deterioration procedure
foil of 8 µm and polyethylene film of 40 µm.
Packet sealer: Any instrument capable of producing a 15.8.3.4.1 Raising and equilibration of seed moisture
watertight seal to the foil packets is suitable. content
Refrigerator or cooled incubator: capable of maintain-
ing 7 ±2 °C Determine the initial moisture content of the submitted
Moisture content test facilities: Moisture content tests sample according to Chapter 9 of the ISTA Rules. This is
are conducted according to Chapter 9 of the ISTA subsequently referred to as the initial seed moisture con-
Rules. tent (SMC).
Raise the SMC following one of the two alternative
If filter paper method is used in 15.8.3.4.1: methods described below.
Filter paper or germination paper: e.g. as used in the Filter paper method
germination test
Containers: to hold seeds and filter or germination pa- To adjust the seed moisture content, mix the fraction of
pers during the procedure of raising the seed moisture pure seed thoroughly and draw randomly four replicates
content. A range of dishes or containers may be suit- of at least 100 seeds. Weigh each replicate to four decimal
able, e.g. 9 cm Petri dishes, germination boxes. places. Raise the seed moisture content of each replicate
to 20 %. The weight of seed at this moisture content is
If added water, rolled method is used in 15.8.3.4.1: calculated as:
Laboratory tube roller: capable of 30 revolutions per Weight of replicate at 20 % mc =

minute
Glass vials: with sealable top (100 – initial seed mc)
(initial seed weight) ∙
Micropipettes: capacity and accuracy determined by the (100 – desired seed mc*)
weight/volume of water to be added, as shown below:
*i.e. 80
Water weight (mg) Micropipette Accuracy (µL) mc = moisture content
or volume (µL) capacity (µL)
<200 200 1
Calculate the required weight to four decimal places. The
>200 1000 5
acceptable required weight is then correct to three decimal
places.
If the CD germination test is used to assess deteriora- Place each of the four replicates to imbibe on a moist
tion in 15.8.3.4.3: germination/filter paper, placed in a suitable container.
There should be no free water on the surface of the paper.
Germination test facilities: Germination tests are con- If 9 cm germination papers are used, 3–4 mL water per
ducted using the methods and test conditions described paper usually gives a moist but not wet paper. Use the
in Chapter 5 of the ISTA Rules. same volume of water for a standard amount of paper on
each test occasion.

Weigh seeds regularly to determine when they reach 15.8.3.4.3 Testing for response to deterioration
the required moisture content. Weighing must be accurate
and correct to three decimal places. Seeds may begin to Testing for the response to deterioration should be done
reach the required moisture content after 1.25–1.5 h de- within 30 min of removing the seeds from the water bath,
pending on the seed lot, laboratory temperature and rela- using the deteriorated seed and either of the two following
tive humidity. methods.
Once seeds have reached the required weight, place
each replicate immediately into an aluminium foil packet. a) CD germination test
The seeds can lose moisture rapidly at this stage, so speed
is essential. Flatten the packets with the edge of the hand Set up a CD germination test using 100 seeds from each
to remove air, and heat-seal the packets approximately 3 replicate packet. The seeds may be divided into subrep-
cm above the level of the seeds. licates for the germination test. The germination condi-
Place the sealed packets at 7 ±2 °C for 24 h. tions for a CD germination test are the same as those out-
lined for the standard germination test for Brassica spp. in
Added water, rolled method Chapter 5 of the ISTA Rules.
Draw a sample of approximately 500 seeds from the pure b) Conductivity test
seed fraction and weigh to four decimal places. Calculate
the required weight of the sample at 20 % moisture con- Set up a conductivity test following the general directions
tent to four decimal places as described for the filter paper in 15.8.1.5 and 15.8.1.6.
method. The acceptable required weight is then correct to Count four replicates of 100 seeds, each drawn at ran-
three decimal places. dom from the deteriorated seed sample. Weigh the repli-
The volume of water required to raise the seed mois- cates to two decimal places (0.01 g).
ture content of the sample to 20 % is calculated as: Add the 4 weighed replicates of 100 seeds to contain-
ers holding 50 mL distilled/deionised water and imbibe
Volume of water required (μL) = for 16 h ±15 min at 20 ±2 °C.
Calculated weight of sample at 20 % mc – initial seed Place each weighed replicate into a container holding
weight 50 mL distilled/deionised water. Gently swirl each con-
tainer to ensure that all seeds are completely immersed.
Place the weighed seed sample into a glass vial, add the Cover each container with, e.g. aluminium foil or cling
required volume of water correct to three decimal places film, prior to placing at 20 ±2 °C for 16 h. Label the first
and seal the glass vial. Place the glass vial on a tube roller container/replicate of each sample with the start time. The
and roll at 30 revolutions per minute and 8 ±2 °C over- number of containers started at one time must not exceed
night. Reweigh each sample to calculate the raised SMC the number of evaluations for conductivity that can be
and to ensure it is 20 ±0.5 % before packaging seeds into made within 15 minutes of the conclusion of a 16 h soak
an aluminium foil packet. Flatten the packets with the period (usually 10 to 12 containers).
edge of the hand to remove air, and heat-seal the packets
approximately 3 cm above the level of the seeds.
15.8.3.5 Calculation and expression of results
15.8.3.4.2 Deterioration of the seed Express the results in accordance with the method used in
15.8.3.4.3.
Place the four replicate packets of each seed lot into a wa-
ter bath at 45 °C for 24 h ±15 min. When the packets have a) CD germination test
been removed from the water bath, cool the seeds within
the packets by placing the packets under cold running wa- The total germinated percentage (normal plus abnormal
ter for 5 min. seedlings) and percentage of normal seedlings are noted
in each replicate. The result of the CD test is calculated as
the average of the four 100-seed replicates, as described
for the standard germination test in Chapter 5. Both the
total germinated percentage and the percentage of normal
seedlings are reported.

b) Conductivity test after CD a) CD germination test
Measure the conductivity of the leachate for each replicate – Results are expressed as a percentage, calculated to the
at the end of the 16 h ±15 min soak period following the nearest whole number (5.8.1), and stated as ‘Total ger-
directions in 15.8.1.6.5. minated seeds (normal plus abnormal seedlings) … %’
The conductivity per gram of seed weight for each and ‘Normal seedlings … %’. If the result for either of
replicate is calculated after accounting for the background these is found to be zero, it must be reported as ‘0’.
conductivity of the original water (see 15.8.1.6.6), and the – The results must be accompanied by a statement of the
average of the four replicates provides the seed lot test specific variables used in the test (method used to raise
result. For each replicate: seed moisture content, raised seed moisture content,
deterioration period and temperature).
Conductivity reading (μS cm–1) – background reading
= b) Conductivity test after deterioration
Weight of replicate (g)
Conductivity (μS cm–1 g–1) – The result must be expressed in μS cm–1 g–1 to the near-
est 0.1 μS cm–1 g–1.
Then calculate the variance, standard deviation and coef- – The results must be accompanied by a statement of the
ficient of variation as follows: specific variables used during deterioration (method
used to raise seed moisture content, raised seed mois-
N ∑ x2 – (∑ x)2 ture content, deterioration period and temperature) and
Variance =
N(N – 1) in the conductivity test (soaking time and temperature).
where
x = conductivity of each replicate in μS cm–1 g–1 15.8.4 Radicle emergence (RE) test
N = number of replicates
Σ = sum of 15.8.4.1 Principle
Standard deviation s = √Variance
A slower rate of germination is an early physiological
s expression of seed ageing, the major cause of reduced
x vigour. The rate of germination of all validated species
listed in 15.3 is accurately reflected in a single count of
where x = mean conductivity of the sample radicle emergence early in germination and this single
count relates closely to other expressions of the rate of
If the coefficient of variation does not exceed 10.0, the germination. High counts of radicle emergence early in
replicates are acceptable. If the coefficient of variation is germination are indicative of high seed vigour; low counts
greater than 10.0, the test must be repeated. indicate low seed vigour.
When two tests are performed in different laboratories:
maximum tolerance value for two test results =
mean conductivity reading × 0.3326 15.8.4.2 Scope
The RE test provides a vigour test which relates to field Chapter 15: Seed vigour testing
15.8.3.6 Reporting results emergence for the species listed in 15.3.
The result of a seed vigour test using the controlled dete-

rioration test method must be reported under ‘Other deter- 15.8.4.3 Apparatus
minations’ as follows for the two alternative methods of
assessing deterioration in 15.8.3.4.3. Paper growing media: as used in a germination test
(Chapter 5.4.3.1) and specified in Table 15B.
Plastic bags or containers: to prevent drying out during
the test.
Germination test facilities: to maintain the prescribed
temperature (Table 15B).

15.8.4.4 Radicle emergence test procedure 15.8.4.5 Calculation and expression of results
15.8.4.4.1 Setting up the radicle emergence test Record the number of seeds that have produced a radicle
for each replicate. The criterion for radicle emergence in
The test must be set up using the media and conditions each species is defined in Table 15B.
described in Table 15B, following the normal procedure in The number of seeds showing radicle emergence in
your laboratory for a germination test using the prescribed each replicate is converted into a percentage for each
medium. A control seed lot must be included with each replicate.
test. Calculate the average radicle emergence percentage. If
necessary combine seed replicates to 100-seed replicates
according to Chapter 5. Where two 100-seed replicates
15.8.4.4.2 Temperature for the test differ by more than the maximum tolerance value for radi-
cle emergence shown in Table 15I, the seed lot must be
The radicle emergence test must be conducted at the tem- re-tested. If the second test result is compatible with the
perature prescribed for the species in Table 15B. Tempera- first (i.e. the difference does not exceed the tolerance in-
ture is the most important potential variable in the test, dicated in Table 15J), the average of the two tests must be
and each seed lot must be transferred to the test tempera- reported.
ture within 15 minutes after being set to germinate. Moni-
toring of temperature is desirable and rotation of seed lots
and replicates is advised at time intervals of 24 h. 15.8.4.6 Reporting results
The result of a seed vigour test using the radicle emer-

15.8.4.4.3 Timing of radicle emergence counts gence test must be reported under ‘Other Determinations’
as follows:
The timing of radicle emergence counts depends on the – Results are reported as a percentage of seeds with
species (Table 15B). emerged radicles calculated to the nearest whole num-
ber (5.8.1). If the result is found to be nil, it must be
entered as ‘0’.
temperature used for the test and the time of the radicle
emergence counts in hours, e.g. ‘Radicle emergence
test 90 % with emerged radicles after 66 h at 20 °C.’
Table 15B. Specific conditions for the radicle emergence test procedures
Species Germination Replication Germination Criterion of radicle emergence Timing of radicle emer-
medium temperature gence count
Brassica napus Pleated 2 replicates 20 ±1 °C Appearance of a radicle after breaking 30 h ±15 min
(oilseed rape, papers of 100 seeds through the seed coat. Seeds in which
Argentine the seed coat has split, but no radicle
canola) has emerged, must not be included.
Raphanus Top of 4 replicates 20 ±1 °C Production of 2 mm radicle 48 h ±15 min
sativus paper of 50 seeds
Zea mays Paper 8 replicates 20 ±1 °C Production of 2 mm radicle 66 h ±15 min at 20 ±1 °C
towels of 25 seeds or 13 ±1 °C 144 h ±1 h at 13 ±1 °C

15.8.5 Tetrazolium vigour test 15.8.5.4.3 Staining the seeds
15.8.5.1 Principle Place the intact imbibed seeds in a 0.1 % 2,3,5-tri

phenyl tetrazolium chloride solution in the dark for 3 h
The principle of using the topographical tetrazolium test to at 35 ±2 °C. The seeds should be completely immersed in
indicate vigour differences between seed lots is the same the staining solution.
as when using the test to estimate seed viability (Chapter
6). The test uses a colourless solution of 2,3,5-triphenyl
tetrazolium chloride as an indicator to reveal the reduc- 15.8.5.4.4 Preparation of the seeds for evaluation
tion processes that occur during respiration in living cells,
through the hydrogenation of the 2,3,5-triphenyl tetrazo- Decant the tetrazolium solution and rinse the seeds with
lium chloride by dehydrogenase enzymes. This results in water. The seeds should then be kept submerged in water
the production of the red, stable and non-diffusible com- during the evaluation to avoid dehydration and discolora-
pound formazan in living cells. It is therefore possible to tion. Remove the seed coat by hand and expose the em-
distinguish red-coloured living parts of the seed from dead bryo by cutting carefully down the middle of the cotyle-
ones, and assessment of detailed differences in the loca- dons, and the hypocotyl axis with a sharp blade.
tion, colour and intensity of the staining allows the identi-
fication of seeds that are either vigorous or non-vigorous.
15.8.5.4.5 Evaluation
15.8.5.2 Scope and field of application The main aim of the tetrazolium vigour test is to identify
vigorous and non-vigorous seeds.
The tetrazolium vigour test provides a vigour test for Examine each seed and classify into different catego-
Glycine max which relates to field emergence. ries of vigorous seed (A, B or C) according to the colour,
tissue turgidity and the location (extension and depth) of
damaged areas on the seed (Fig. 15.1). Other staining pat-
15.8.5.3 Reagent terns (Fig. 15.5) reveal non-vigorous seed.
An aqueous solution of 2,3,5-triphenyl tetrazolium chlo- Category A: completely turgid and stained seed of a nor-
ride salt is made up following the directions in 6.4.1. The mal pink colour (Fig. 15.2).
concentration used is 0.1 %. Category B: presence of minor area of red colour, un-
stained, flaccid or necrotic tissues with limited exten-
sion and superficial depth localised at any site of the
15.8.5.4 Procedures seed (including embryo axis and joining area on the
embryo axis and the cotyledons)(Figs 15.1, 15.3).
15.8.5.4.1 Working samples Category C: presence of major or multiple areas of red
colour, unstained, flaccid or necrotic tissues extending
A test is carried out on two replicates of 100 pure seeds from ⅓ to the whole of the cotyledon area at the dis-
drawn at random from a representative sample of the sub- tal end of the cotyledon(s), and a depth from ½ of the
mitted sample. cotyledon to entire cotyledon (Figs 15.1, 15.4).
Other staining: non-vigorous seeds (Figs 15.5a-l). Chapter 15: Seed vigour testing
15.8.5.4.2 Preparation and treatment of the seed
Allow seeds to imbibe overnight for 16–18 h between

rolled filter paper at 20 ±2 °C placed within sealed plas-
tic bags to avoid evaporation. If imbibition is incom-
plete, seeds should be imbibed in water for 30–60 min at
20 ±2 °C to complete additional imbibition. Hard seeds
may be present at the end of the imbibition period. These
seeds must be incised at the cotyledonary area opposite
the embryo. The hard seeds should then be imbibed over-
night for 16–18 h between rolled filter paper at 20 ±2 °C.

Extension Depth
Limited Superficial
Superficial
Limited
1/3 of the ½ cotyledon

area
3/3 of the
area Entire cotyledon
Figure 15.1. Definitions of damaged areas on the seed.
Figure 15.2. Vigorous seed, Category A. a External view

shows uniform pink staining. b Internal view shows brilliant
white surrounded by pink area.
Figure 15.3. Vigorous seeds: Category B. The majority of the cotyledon is pink. Grey areas represent minor areas of red
staining, unstained, flaccid or necrotic tissues with limited extension and superficial depth.

a b c d
Figure 15.4. Vigorous seeds, Category C. Cotyledons mainly pink; cross-hatched areas represent major or multiple ar-
eas of red staining, unstained, flaccid or necrotic tissues with an extension of ⅓ of the cotyledon area (a–c) to 3/3 (d) of
the cotyledon area at the distal end of the cotyledon(s), and a depth of ½ of the cotyledon to the entire cotyledon.
a b c d e f
g h i j k l
Figure 15.5. Non-vigorous seeds, other staining. a Radicle with tissues up to ⅓ deteriorated, unstained or lost. b Joining
area between embryo axis and cotyledons with deteriorated red tissues. c Cotyledons with tissues up to ½ deteriorated,
unstained or lost. d Cotyledons with tissues up to ¼ deep deteriorated or unstained. e Cotyledon with tissues up to ¾ de-
teriorated, unstained or lost. f Radicle with more than ⅓ of deteriorated, unstained or lost tissues. g Joining area embryo
axis-cotyledons unstained. h plumule deteriorated or lost. i Cotyledons with more than ½ deteriorated, unstained or lost
tissues. j Cotyledons with more than ¼ deep deterioration or unstained tissues. k Cotyledon with more than ¾ deterio- Chapter 15: Seed vigour testing
rated, unstained or lost tissues. l Entire seed unstained.

15.8.5.5 Calculation, expression of results and The tolerances take into account the experimental er-
tolerances ror between laboratories participating in comparative tests
completed by the Vigour Committee 1998–2001.
Calculate the vigour of each replicate as the sum of seeds Table 15F indicates the maximum range (i.e. differ-
in the three categories A, B and C and, express as a per- ence between highest and lowest) in germination per-
centage of the whole sample. The mean of the two repli- centage tolerable between replicates in a germination test
cates is expressed as the TZ vigour (%). If the two 100- following accelerated ageing. To find the maximum toler-
seed replicates differ by more than the tolerance value ated range in any case, calculate the average percentage,
shown in Table 15K, the seed lot must be re-tested. to the nearest whole number, of the two replicates (form
100 seed replicates by combining two subreplicates of 50
seeds). Locate the average in column 1 or 2 of the table
15.8.5.6 Reporting results and read off the maximum tolerated range opposite in col-
umn 3.
The result of a seed vigour test using the tetrazolium Table 15G indicates the tolerances for the germination
method must be reported under ‘Other determinations’. percentage after accelerated ageing when tests are made
Results are expressed as a percentage, calculated to the on the same sample in the same laboratory. To determine
nearest whole number of vigorous seeds, e.g.: “Tetrazo- if the two tests are compatible, calculate the average per-
lium vigour tests using 0.1 % tetrazolium solution for 3 h centage of the two test results to the nearest whole number
at 35 °C: 90 % vigorous seeds.” and locate this in column 1 or 2 of the table. The tests are
compatible if the difference between the percentage ob-
tained in the two tests does not exceed the tolerance given
15.9 Tolerance tables in column 3.
Table 15H gives tolerances for the germination per-
Table 15C indicates the maximum range (i.e. difference centage after accelerated ageing when tests are made in
between highest and lowest) in conductivity reading that different laboratories. To determine if tests are compat-
is tolerable between replicates. To find the maximum tol- ible, calculate the average percentage of the test results to
erated range in any case, calculate the average conductiv- the nearest whole number and locate this in columns 1 or 2
ity from the four replicates. Locate the average in column of the table. The tests are compatible if the difference be-
1 or 2 of the table and read off the maximum tolerated tween the percentages does not exceed the tolerance given
range in column 3. in column 3.
The tolerances take into account the experimental er- Table 15I gives tolerances between highest and lowest
ror between laboratories participating in comparative tests radicle emergence of two replicates of 100 seeds in one
completed by the Vigour Committee 1998–2001. radicle emergence test.
Table 15D indicates the maximum difference in con- Table 15J gives tolerances between results of two
ductivity readings that is tolerable between tests complet- radicle emergence tests of 200 seeds on the same or a dif-
ed on the same sample in the same laboratory. To deter- ferent submitted sample when tests are made in the same
mine if the two tests are compatible, calculate the average laboratory.
of the two test results and locate this in columns 1 or 2 of Table 15K gives tolerances between highest and low-
the table. The tests are compatible if the difference be- est vigour percentages of replicates in one tetrazolium
tween the conductivity readings in the two tests does not vigour test for two replicates of 100 seeds.
exceed the tolerance given in column 3.
The tolerances take into account the experimental er-

ror between laboratories participating in comparative tests
completed by the Vigour Committee 1998–2001.
Table 15E gives the maximum difference in conduc-
tivity reading that is tolerable when tests are completed in
different laboratories. To determine if the tests are com-
patible, calculate the average of the test results and locate
this in columns 1 or 2 of the table. The tests are compat-
ible if the difference between the conductivity readings
does not exceed the tolerance given in column 3.

Table 15C. Maximum tolerated range between four repli- Table 15D. Tolerances for two conductivity tests on the
cates within a conductivity test (5 % significance level). same submitted sample when tests are made in the same
laboratory (two-way test at 5 % significance level).
Average conductivity (µS cm–1 g–1) Maximum range
(µS cm-1 g-1) Average conductivity (µS cm-1 g-1) Maximum range
from to
from to (µS cm-1 g-1)
1 2 3
1 2 3
10 10.9 3.1 10 10.9 2.0
11 11.9 3.3
11 11.9 2.1
12 12.9 3.6
12 12.9 2.3
13 13.9 3.8
13 13.9 2.4
14 14.9 4.1
14 14.9 2.5
15 15.9 4.3
15 15.9 2.7
16 16.9 4.6
17 17.9 4.8 16 16.9 2.8
18 18.9 5.1 17 17.9 3.0
19 19.9 5.3 18 18.9 3.1
20 20.9 5.5 19 19.9 3.2
21 21.9 5.8 20 20.9 3.4
22 22.9 6.0 21 21.9 3.5
23 23.9 6.3 22 22.9 3.7
24 24.9 6.5 23 23.9 3.8
25 25.9 6.8 24 24.9 4.0
26 26.9 7.0 25 25.9 4.1
27 27.9 7.3 26 26.9 4.2
28 28.9 7.5 27 27.9 4.4
29 29.9 7.8 28 28.9 4.5
30 30.9 8.0 29 29.9 4.7
31 31.9 8.3 30 30.9 4.8
32 32.9 8.5
31 31.9 4.9
33 33.9 8.8
32 32.9 5.1
34 34.9 9.0
33 33.9 5.2
35 35.9 9.3
34 34.9 5.4
36 36.9 9.5
37 37.9 9.8 35 35.9 5.5
38 38.9 10.0 36 36.9 5.6
39 39.9 10.3 37 37.9 5.8
40 40.9 10.5 38 38.9 5.9
41 41.9 10.8 39 39.9 6.1
42 42.9 11.0 40 40.9 6.2
43 43.9 11.3 41 41.9 6.4
44 44.9 11.5 42 42.9 6.5
45 45.9 11.8 43 43.9 6.6
46 46.9 12.0 44 44.9 6.8
47 47.9 12.3 45 45.9 6.9 Chapter 15: Seed vigour testing
48 48.9 12.5 46 46.9 7.1
49 49.9 12.8 47 47.9 7.2
50 50.9 13.0 48 48.9 7.3
51 51.9 13.3 49 49.9 7.5
52 52.9 13.5
50 50.9 7.6
53 53.9 13.8
51 51.9 7.8
52 52.9 7.9
53 53.9 8.0

Table 15E. Tolerances for conductivity tests on different Table 15F. Maximum tolerated range between two repli-
submitted samples when tests are made in different labo- cates of 100 seeds in one accelerated ageing germination
ratories (two-way test at 5 % significance level) test (two way test at 2.5 % significance level). The toler-
ances are extracted from Table G1, column L, in Miles
Average conductivity (µS cm-1 g-1) Maximum range
(1963)
from to (µS cm-1 g-1)
1 2 3 Average germination percentage Maximum range
10 10.9 3.6
from to
11 11.9 3.8
1 2 3
12 12.9 4.0
13 13.9 4.2 99 2 –*
14 14.9 4.4 98 3 –*
15 15.9 4.6 96–97 4–5 6
95 6 7
16 16.9 4.8
93–94 7–8 8
17 17.9 5.0
90–92 9–11 9
18 18.9 5.2
88–89 12–13 10
19 19.9 5.4
84–87 14–17 11
20 20.9 5.6
80–83 18–21 12
21 21.9 5.8 76–79 22–25 13
22 22.9 6.0 69–75 26–32 14
23 23.9 6.2 55–68 33–46 15
24 24.9 6.4 51–54 47–50 16
25 25.9 6.6
* cannot be tested
26 26.9 6.8
27 27.9 7.0 Table 15G. Tolerance for two accelerated ageing tests on
28 28.9 7.2 the same submitted sample when tests are made in the
29 29.9 7.4
same laboratory each on 200 seeds (two-way test at 5 %
30 30.9 7.7
significance level).
31 31.9 7.9
32 32.9 8.1 Average germination percentage Maximum range
33 33.9 8.3
from to
34 34.9 8.5
35 35.9 8.7 1 2 3
36 36.9 8.9 99 2 –*
37 37.9 9.1 98 3 –*
38 38.9 9.3 97 4 6
39 39.9 9.5 96 5 7
40 40.9 9.7 95 6 8
41 41.9 9.9 93–94 7–8 9
42 42.9 10.1 91–92 9–10 10
43 43.9 10.3 89–90 11–12 11
44 44.9 10.5 86–88 13–15 12
45 45.9 10.7 83–85 16–18 13
46 46.9 10.9 79–82 19–22 14

47 47.9 11.1 74–78 23–27 15
48 48.9 11.3 68–73 28–33 16
49 49.9 11.5 55–67 34–46 17
50 50.9 11.8 51–54 47–50 18
51 51.9 12.0 * cannot be tested
52 52.9 12.2
53 53.9 12.4

Table 15H. Tolerance for accelerated ageing tests on dif- Table 15J. Tolerances between results of two radicle
ferent submitted samples when tests are made in differ- emergence tests of 200 seeds on the same or a different
ent laboratories each on 200 seeds (two-way test at 5 % submitted sample when tests are made in the same labo-
significance level) ratory (two-way test at the 2.5 % significance level). Note:
this table is a copy of Table 5C Part 2
Average germination percentage Maximum range
from to Average radicle emergence of 2 tests Tolerance
1 2 3 51–100 % 0–50 %
99 2 –* 99 2 2
98 3 –* 98 3 3
97 4 –* 96–97 4–5 4
95–96 5–6 8 94–95 6–7 5
94 7 9 91–93 8–10 6
92–93 8–9 10 87–90 11–14 7
90–91 10–11 11 82–86 15–19 8
88–89 12–13 12 75–81 20–26 9
85–87 14–16 13 64–74 27–37 10
82–84 17–19 14 51–63 38–50 11
79–81 20–22 15
74–78 23–27 16
68–73 28–33 17 Table 15K. Tolerances between highest and lowest vigour
57–67 34–44 18 percentages of replicates in one tetrazolium vigour test
51–56 45–50 19 (two-way test at the 5.0 % significance level), 2 replicates
of 100 seeds. Extracted from column K of Table G1, Miles,
* cannot be tested
S. R. (1963), Handbook of Tolerances and of Measures
of Precision for Seed Testing. Proceedings of the Interna-
Table 15I. Tolerances between highest and lowest radicle tional Seed Testing Association, 28 (3)
emergence of two replicates of 100 seeds in one radicle
emergence test (two-way test at the 2.5 % significance Average vigour percentage of test Tolerance
level). Note: this table is a copy of Table 5B Part 2 51–100 % 0–50 %
99 2 3
Average radicle emergence of test Tolerance 98 3 4
51–100 % 0–50 % 96–97 4–5 5
99 2 4 95 6 6
98 3 5 92–94 7–9 7
96–97 4–5 6 90–91 10–11 8
95 6 7 86–89 12–15 9
93–94 7–8 8 82–85 16–19 10
77–81 20–24 11
90–92 9–11 9
70–76 25–31 12
88–89 12–13 10
55–69 32–46 13
84–87 14–17 11
51–54 47–50 14
81–83 18–20 12 Chapter 15: Seed vigour testing
76–80 21–25 13
69–75 26–32 14
55–68 33–46 15
51–54 47–50 16

International Rules for Seed Testing Chapter 16: Rules for size and grading of seeds
Chapter 16: Rules for size and grading of seeds
16.1 For Beta seeds and pelleted

seeds
The control of size grading is carried out on a sample
weighing at least 250 g, or for pelleted seeds, a sample
consisting of the number of seeds indicated in Table 2B
Part 1. The sample must be sent to the testing laboratory
in an airtight container. Two working samples of about
50 g (not less than 45 g and not more than 55 g) each are
used. For pelleted seeds, two working samples of about
1000 seeds each are used. Each sample is subjected to a
screening analysis.
The following round-hole screens must be used*:
– One screen with a hole diameter 0.25 mm smaller
than the lower nominal value of the seed size,
– One set of screens which divides the stated seeds size
range into quarter-millimetre fractions,
– One screen with a hole diameter 0.25 mm larger than
the upper nominal value of the seed size.
The screening fractions (including the portion passing

through the lowest screen) are weighed (two decimal
places). The weights of the fractions are expressed as
percentages (one decimal place) of the total weight. The
average of the values for each of the two working sam-
ples represents the results of the analysis, provided that
the difference between the sums of the percentages within
the nominal grading limits does not exceed 1.5 %. If this
tolerance is exceeded, a further sample of 50 g or 1000
pelleted seeds (and if necessary a fourth sample) must be
Chapter 16: Rules for size and grading of seeds

analysed.
The result of a screening analysis test for size and
grading of seeds must be reported under ‘Other determi-
nations’ as the average of two screening analyses falling
within the permitted tolerance limits.
* The ‘Bonn’ Screening apparatus, developed by the In-

stitut für Landtechnik, Bonn, (Germany), with the req-
uisite round-hole screens and automatic switch-gear for
the regular interruption of the reciprocations may be
used. The amplitude should be between ±45 and 50 mm.
For pelleted seed the screening time is one minute and
for unpelleted seed three minutes.

International Rules for Seed Testing Chapter 17: Bulk containers
Chapter 17: Rules for the issue of Orange International

Seed Lot Certificates on seed lots exceeding the
maximum lot size prescribed in Table 2A being
transported loose in bulk containers
17.1 Object 17.4 Procedure

The object of these rules is to facilitate the trading of seeds Lots of up to the maximum weight prescribed in Table
loose in bulk containers thus allowing for full utilisation 2A, which it is intended to place in the bulk container(s),
of the space available in the containers. At the same time must be officially sampled, sealed and tested according to
they provide for maintaining the position of the Orange the Rules and an Orange International Seed Lot Certificate
International Seed Lot Certificate as a trading document. issued for each of the lots. The results for each attribute re-
ported on the Certificates must then be compared using the
appropriate tolerance table included in this appendix and
17.2 Field of application only those lots showing no significant difference for all
reported attributes may be bulked. Calculate the straight
These rules may only be applied to the species listed in average of the results of the lots to be combined. Then
17.7 below. take the difference of the maximum and minimum values
among all component lots (R = Xmax – Xmin). Now find
the calculated straight average in ‘The average of all lots’
17.3 Principle column. Read off the relevant maximum tolerated value
(RT) from the column (N = . . . ) for the number of lots
Any number of whole seed lots (N = number of seed lots involved. Compare this maximum tolerated value (RT)
being combined) on which Orange International Seed with R. If R < RT for all three attributes, then the lots are
Lot Certificates have already been issued may be com- compatible and may be combined. If, however, R > RT
bined loose in one or two sealable and identifiable bulk for one or more attributes, the lots are incompatible and
container(s) providing the results for the attributes re- may not be combined. The purpose of this procedure is
ported on the existing Certificates are not significantly to avoid heterogeneity of compound seed lots. Only ISTA
different from each other as determined by the tolerance Certificate test results on samples obtained of the size pre-
tables included in 17.8. The destruction of the identity of scribed by the Rules for all seed characteristics tested are
the original lots and their combining in the bulk container to be used.
must be supervised by a person authorised to carry out The accepted whole seed lots are then broken open
sampling for the issue of Orange International Seed Lot and the seed placed loose in the bulk container(s) in the
Certificates. The authorised person must be present dur- presence of an authorised person. The authorised per-
ing all steps of the combination of the seed lots including son must then label and seal the container(s) and report
the sealing of the bulk container(s). On receipt of the nec- to the accredited laboratory issuing the bulk container(s)
essary information the appropriate accredited laboratory Certificate the official identification of the container(s)
will issue a new Orange International Seed Lot Certificate and any other relevant facts such as the actual weights of
showing the weighted average of the results for the attrib- seed put in the container(s). The identification of the bulk
Chapter 17: Bulk containers
utes reported on the Certificates representing the constitu- container(s) must be different from those used to identify
ent lots and other information as designated in 17.6 below. the constituent lots.
Seed lots to be used to form the compound lot must be
of the same cultivar. Germination tests of component lots
must have germination completion dates within a period
of not greater than 60 days.

Chapter 17: Bulk containers International Rules for Seed Testing
Table 17.1. Example of the calculation of a weighted average
Lot 1 Lot 2 Lot 3 Totals Weighted average

Lot sizes (kg) 10 000 7 000 2 500 19 500
Multiplication factor 0.513 0.359 0.128
Germination (%) 91 87 92
Proportional value 46.683 31.233 11.776 89.692 90 %
Purity (%) 99.4 99.1 99.3
Proportional value 50.9922 35.5769 12.7104 99.2795 99.3 %
Other seed count 5 2 7
Proportional value 2.565 0.718 0.896 4.179 4
17.5 Calculation and expression of b) Under ‘Other determinations’, list the test number,
results date of sampling and date test concluded of all constit-
uent lots together with the statement: ‘The test results
The weighted average result for each attribute is calcu- reported represent the weighted average of the results
lated and reported with the degree of accuracy prescribed reported on these certificates which were not signifi-
in the rules for that attribute. During calculation, use one cantly different from each other.’
decimal place beyond that reported and adjust following
the normal rounding procedures. For the number count
tests, all species recorded must be reported, and average 17.7 Species for which these rules
figures below one must be reported as 1. apply
These rules apply only to species of the Poaceae and Fa-
Weighted average calculation baceae listed in Table 2A Part 1 with a maximum lot size
in Table 2A of 10 000 kg.
Consider the weights of the individual component lots and
sum these. Divide each in turn by the total and express to
3 decimal places; let this be called the multiplication fac- 17.8 Tolerance tables
tor for each lot. Consider the attribute measures individu-
ally for each lot in turn. Multiply each by the multiplica- Tolerance tables to be used for compatibility tests on ISTA
tion factor for each lot to obtain ‘proportional values’ for certified seed lots to be combined to form compound lots
each attribute for each lot. Sum the proportional values exceeding 10 000 kg.
for all lots for each attribute. Round each total to obtain
a weighted average for each attribute applying rounding
rules for place numbers (see Table 17.1).
17.6 Reporting results

The result of a weighted average test performed on seed
lots, as described in Chapter 17, must be reported in the
normal way, except that:

a) across the date of sampling, date sample received,
date test concluded and test number boxes insert the
statement: ‘Seed loose in bulk container(s) – see under
Other determinations.’

Table 17.2. Tolerances for purity percentages deviation of component lots at 1 % significance level
Average of all lots Number of lots being blended Average of all lots Number of lots being blended
2 3 4 5 6 7 8 9 10 2 3 4 5 6 7 8 9 10
99.9 0.1 0.2 0.3 0.3 0.3 0.3 0.3 0.3 0.3 0.3 83.0–83.9 16.1–17.0 2.7 3.1 3.3 3.5 3.6 3.7 3.7 3.8 3.9
99.8 0.2 0.3 0.4 0.4 0.4 0.4 0.4 0.4 0.5 0.5 82.0–82.9 17.1–18.0 2.8 3.2 3.4 3.5 3.7 3.7 3.8 3.9 4.0
99.7 0.3 0.4 0.5 0.5 0.5 0.5 0.5 0.5 0.6 0.6 81.0–81.9 18.1–19.0 2.9 3.2 3.5 3.6 3.7 3.8 3.9 4.0 4.0
99.6 0.4 0.5 0.5 0.6 0.6 0.6 0.6 0.6 0.6 0.7 80.0–80.9 19.1–20.0 2.9 3.3 3.5 3.7 3.8 3.9 4.0 4.0 4.1
99.5 0.5 0.5 0.6 0.6 0.6 0.7 0.7 0.7 0.7 0.7 79.0–79.9 20.1–21.0 3.0 3.4 3.6 3.7 3.9 4.0 4.1 4.1 4.2
99.4 0.6 0.6 0.6 0.7 0.7 0.7 0.8 0.8 0.8 0.8 78.0–78.9 21.1–22.0 3.0 3.4 3.6 3.8 3.9 4.0 4.1 4.2 4.3
99.3 0.7 0.6 0.7 0.7 0.8 0.8 0.8 0.8 0.8 0.9 77.0–77.9 22.1–23.0 3.1 3.5 3.7 3.9 4.0 4.1 4.2 4.3 4.3
99.2 0.8 0.6 0.7 0.8 0.8 0.8 0.9 0.9 0.9 0.9 76.0–76.9 23.1–24.0 3.1 3.5 3.8 3.9 4.1 4.2 4.3 4.3 4.4
99.1 0.9 0.7 0.8 0.8 0.9 0.9 0.9 0.9 1.0 1.0 75.0–75.9 24.1–25.0 3.2 3.6 3.8 4.0 4.1 4.2 4.3 4.4 4.5
99.0 1.0 0.7 0.8 0.9 0.9 0.9 1.0 1.0 1.0 1.0 74.0–74.9 25.1–26.0 3.2 3.6 3.9 4.0 4.2 4.3 4.4 4.5 4.5
98.5–98.9 1.1–1.5 0.9 1.0 1.1 1.1 1.2 1.2 1.2 1.2 1.3 73.0–73.9 26.1–27.0 3.2 3.7 3.9 4.1 4.2 4.3 4.4 4.5 4.6
98.0–98.4 1.6–2.0 1.0 1.2 1.2 1.3 1.3 1.4 1.4 1.4 1.4 72.0–72.9 27.1–28.0 3.3 3.7 4.0 4.1 4.3 4.4 4.5 4.6 4.6
97.5–97.9 2.1–2.5 1.1 1.3 1.4 1.4 1.5 1.5 1.6 1.6 1.6 71.0–71.9 28.1–29.0 3.3 3.7 4.0 4.2 4.3 4.4 4.5 4.6 4.7
97.0–97.4 2.6–3.0 1.2 1.4 1.5 1.6 1.6 1.7 1.7 1.7 1.8 70.0–70.9 29.1–30.0 3.3 3.8 4.0 4.2 4.4 4.5 4.6 4.7 4.7
96.5–96.9 3.1–3.5 1.3 1.5 1.6 1.7 1.7 1.8 1.8 1.8 1.9 69.0–69.9 30.1–31.0 3.4 3.8 4.1 4.3 4.4 4.5 4.6 4.7 4.8
96.0–96.4 3.6–4.0 1.4 1.6 1.7 1.8 1.9 1.9 2.0 2.0 2.0 68.0–68.9 31.1–32.0 3.4 3.8 4.1 4.3 4.4 4.6 4.7 4.7 4.8
95.5–95.9 4.1–4.5 1.5 1.7 1.8 1.9 2.0 2.0 2.1 2.1 2.1 67.0–67.9 32.1–33.0 3.4 3.9 4.1 4.3 4.5 4.6 4.7 4.8 4.9
95.0–95.4 4.6–5.0 1.6 1.8 1.9 2.0 2.1 2.1 2.2 2.2 2.2 66.0–66.9 33.1–34.0 3.4 3.9 4.2 4.4 4.5 4.6 4.7 4.8 4.9
94.5–94.9 5.1–5.5 1.7 1.9 2.0 2.1 2.2 2.2 2.3 2.3 2.4 65.0–65.9 34.1–35.0 3.5 3.9 4.2 4.4 4.5 4.7 4.8 4.8 4.9
94.0–94.4 5.6–6.0 1.7 2.0 2.1 2.2 2.3 2.3 2.4 2.4 2.5 64.0–64.9 35.1–36.0 3.5 4.0 4.2 4.4 4.6 4.7 4.8 4.9 5.0
93.5–93.9 6.1–6.5 1.8 2.0 2.2 2.3 2.3 2.4 2.5 2.5 2.5 63.0–63.9 36.1–37.0 3.5 4.0 4.2 4.4 4.6 4.7 4.8 4.9 5.0
93.0–93.4 6.6–7.0 1.9 2.1 2.2 2.3 2.4 2.5 2.5 2.6 2.6 62.0–62.9 37.1–38.0 3.5 4.0 4.3 4.5 4.6 4.7 4.8 4.9 5.0
92.5–92.9 7.1–7.5 1.9 2.2 2.3 2.4 2.5 2.6 2.6 2.7 2.7 61.0–61.9 38.1–39.0 3.6 4.0 4.3 4.5 4.6 4.8 4.9 5.0 5.0
92.0–92.4 7.6–8.0 2.0 2.2 2.4 2.5 2.6 2.6 2.7 2.8 2.8 60.0–60.9 39.1–40.0 3.6 4.0 4.3 4.5 4.7 4.8 4.9 5.0 5.1
91.5–91.9 8.1–8.5 2.0 2.3 2.5 2.6 2.7 2.7 2.8 2.8 2.9 59.0–59.9 40.1–41.0 3.6 4.1 4.3 4.5 4.7 4.8 4.9 5.0 5.1
91.0–91.4 8.6–9.0 2.1 2.4 2.5 2.6 2.7 2.8 2.9 2.9 3.0 58.0–58.9 41.1–42.0 3.6 4.1 4.3 4.5 4.7 4.8 4.9 5.0 5.1
90.5–90.9 9.1–9.5 2.1 2.4 2.6 2.7 2.8 2.9 2.9 3.0 3.0 57.0–57.9 42.1–43.0 3.6 4.1 4.4 4.6 4.7 4.8 4.9 5.0 5.1
90.0–90.4 9.6–10.0 2.2 2.5 2.6 2.8 2.9 2.9 3.0 3.0 3.1 56.0–56.9 43.1–44.0 3.6 4.1 4.4 4.6 4.7 4.8 5.0 5.0 5.1
89.0–89.9 10.1–11.0 2.3 2.6 2.8 2.9 3.0 3.1 3.1 3.2 3.2 55.0–55.9 44.1–45.0 3.6 4.1 4.4 4.6 4.7 4.9 5.0 5.1 5.1
88.0–88.9 11.1–12.0 2.4 2.7 2.9 3.0 3.1 3.2 3.2 3.3 3.4 54.0–54.9 45.1–46.0 3.6 4.1 4.4 4.6 4.7 4.9 5.0 5.1 5.1
87.0–87.9 12.1–13.0 2.4 2.8 3.0 3.1 3.2 3.3 3.4 3.4 3.5 53.0–53.9 46.1–47.0 3.6 4.1 4.4 4.6 4.8 4.9 5.0 5.1 5.2
86.0–86.9 13.1–14.0 2.5 2.9 3.1 3.2 3.2 3.4 3.5 3.5 3.6 52.0–52.9 47.1–48.0 3.6 4.1 4.4 4.6 4.8 4.9 5.0 5.1 5.2
85.0–85.9 14.1–15.0 2.6 2.9 3.1 3.3 3.4 3.5 3.6 3.6 3.7 51.0–51.9 48.1–49.0 3.6 4.1 4.4 4.6 4.8 4.9 5.0 5.1 5.2
84.0–84.9 15.1–16.0 2.7 3.0 3.2 3.4 3.5 3.6 3.7 3.7 3.8 50.0–50.9 49.1–50.0 3.6 4.1 4.4 4.6 4.9 4.9 5.0 5.1 5.2

Chapter 17: Bulk containers International Rules for Seed Testing
Table 17.3. Tolerances for germination percentages deviation of component lots at 1 % significance level
Average of all Number of lots being blended Average of all Number of lots being blended
lots lots
2 3 4 5 6 7 8 9 10 2 3 4 5 6 7 8 9 10
99 1 2 2 2 2 2 2 2 3 3 74 26 8 9 10 10 10 11 11 11 11
98 2 3 3 3 3 3 3 3 4 4 73 27 8 9 10 10 11 11 11 11 11
97 3 3 4 4 4 4 4 4 4 4 72 28 8 9 10 10 11 11 11 11 12
96 4 4 4 4 5 5 5 5 5 5 71 29 8 9 10 10 11 11 11 12 12
95 5 4 4 5 5 5 5 5 6 6 70 30 8 9 10 11 11 11 11 12 12
94 6 4 5 5 5 6 6 6 6 6 69 31 8 10 10 11 11 11 12 12 12
93 7 5 5 6 6 6 6 6 6 7 68 32 8 10 10 11 11 11 12 12 12
92 8 5 6 6 6 6 7 7 7 7 67 33 9 10 10 11 11 11 12 12 12
91 9 5 6 6 7 7 7 7 7 7 66 34 9 10 10 11 11 12 12 12 12
90 10 5 6 7 7 7 7 7 8 8 65 35 9 10 10 11 11 12 12 12 12
89 11 6 6 7 7 7 8 8 8 8 64 36 9 10 11 11 11 12 12 12 12
88 12 6 7 7 7 8 8 8 8 8 63 37 9 10 11 11 11 12 12 12 12
87 13 6 7 7 8 8 8 8 9 9 62 38 9 10 11 11 12 12 12 12 13
86 14 6 7 8 8 8 8 9 9 9 61 39 9 10 11 11 12 12 12 12 13
85 15 6 7 8 8 8 9 9 9 9 60 40 9 10 11 11 12 12 12 12 13
84 16 7 8 8 8 9 9 9 9 9 59 41 9 10 11 11 12 12 12 12 13
83 17 7 8 8 9 9 9 9 10 10 58 42 9 10 11 11 12 12 12 13 13
82 18 7 8 8 9 9 9 10 10 10 57 43 9 10 11 11 12 12 12 13 13
81 19 7 8 9 9 9 10 10 10 10 56 44 9 10 11 11 12 12 12 13 13
80 20 7 8 9 9 10 10 10 10 10 55 45 9 10 11 11 12 12 12 13 13
79 21 7 8 9 9 10 10 10 10 11 54 46 9 10 11 11 12 12 12 13 13
78 22 8 9 9 10 10 10 10 11 11 53 47 9 10 11 11 12 12 12 13 13
77 23 8 9 9 10 10 10 10 11 11 52 48 9 10 11 11 12 12 12 13 13
76 24 8 9 9 10 10 10 11 11 11 51 49 9 10 11 11 12 12 12 13 13
75 25 8 9 10 10 10 11 11 11 11 50 50 9 10 11 11 12 12 12 13 13

Table 17.4. Tolerances for other seed counts deviation of component lots at 1 % significance level
Average of Number of lots being blended Average of Number of lots being blended
all lots all lots
2 3 4 5 6 7 8 9 10 2 3 4 5 6 7 8 9 10
1 4 4 4 5 5 5 5 5 5 34 21 24 26 27 28 28 29 30 30
2 5 6 6 7 7 7 7 7 7 35 22 24 26 27 28 29 30 30 31
3 6 7 8 8 8 8 9 9 9 36 22 25 26 28 29 29 30 30 31
4 7 8 9 9 10 10 10 10 10 37 22 25 27 28 29 30 30 31 31
5 8 9 10 10 11 11 11 11 12 38 22 25 27 28 29 30 31 31 32
6 9 10 11 11 12 12 12 12 13 39 23 26 27 29 30 30 31 32 32
7 10 11 12 12 13 13 13 13 14 40 23 26 27 29 30 31 32 32 33
8 10 12 12 13 13 14 14 14 15 41 23 26 28 29 30 31 32 33 33
9 11 12 13 14 14 15 15 15 15 42 24 27 29 30 31 32 32 33 33
10 12 13 14 15 15 15 16 16 16 43 24 27 29 30 31 32 33 33 34
11 12 14 15 15 16 16 17 17 17 44 24 27 29 31 32 32 33 34 34
12 13 14 15 16 16 17 17 18 18 45 24 28 30 31 32 33 33 34 35
13 13 15 16 17 17 18 18 18 19 46 25 28 30 31 32 33 34 34 35
14 14 15 16 17 18 18 19 19 19 47 25 28 30 32 33 33 34 35 35
15 14 16 17 18 18 19 19 20 20 48 25 29 30 32 33 34 35 35 36
16 15 16 18 18 19 20 20 20 21 49 25 29 31 32 33 34 35 36 36
17 15 17 18 19 20 20 21 21 21 50 26 29 31 33 34 35 35 36 36
18 15 17 19 20 20 21 21 22 22 51 26 29 31 33 34 35 36 36 37
19 16 18 19 20 21 21 22 22 22 52 26 30 32 33 34 35 36 37 37
20 16 18 20 21 21 22 22 23 23 53 26 30 32 33 35 36 36 37 38
21 17 19 20 21 22 22 23 23 24 54 27 30 32 34 35 36 37 37 38
22 17 19 21 22 22 23 23 24 24 55 27 31 33 34 35 36 37 38 38
23 17 20 21 22 23 23 24 24 25 56 27 31 33 34 36 37 37 38 39
24 18 20 22 23 23 24 24 25 25 57 27 31 33 35 36 37 38 38 39
25 18 21 22 23 24 24 25 25 26 58 28 31 34 35 36 37 38 39 39
26 19 21 22 23 24 25 25 26 26 59 28 32 34 35 37 37 38 39 40
27 19 21 23 24 25 25 26 26 27 60 28 32 34 36 37 38 39 39 40
28 19 22 23 24 25 26 26 27 27 61 28 32 34 36 37 38 39 40 40
29 20 22 24 25 26 26 27 27 28 62 29 32 35 36 37 38 39 40 41
30 20 23 24 25 26 27 27 28 28 63 29 33 35 37 38 39 40 40 41
31 20 23 24 26 27 27 28 28 29 64 29 33 35 37 38 39 40 41 41
32 21 23 25 26 27 28 28 29 29 65 29 33 35 37 38 39 40 41 42
33 21 24 25 26 27 28 29 29 30

International Rules for Seed Testing Chapter 18: Seed mixture analysis
Chapter 18: Seed mixture analysis
18.1 Object If it is difficult or impossible to distinguish between

coated seeds of different species, then the species are com-
The objects of seed mixture analyses are: bined in one mixture component.
– to determine the composition of a seed mixture as
corresponding to the component declaration by using 18.3 Sampling
methods according to Chapter 3; and
– to provide pure seed of mixture components for fur- As only Blue International Seed Sample Certificates can
ther seed quality tests. be issued for seed mixtures, sampling from the mixture lot
is not covered by the ISTA Rules.
This chapter contains procedures to determine the seed
mixture composition and details for testing seed quality of 18.3.1 Size of the submitted sample
seed mixtures by other tests. When specific instructions
are not given for other tests in this Chapter, then the ap- The submitted sample from a seed mixture must contain
propriate Chapter of the ISTA Rules must be followed. at least 25 000 seed units. The weight of the submitted
The results of tests on seed mixture samples can only be sample can be determined using either method:
reported on a Blue International Seed Sample Certificate – ‘exact method’ on the basis of the declared mixture
(see 1.2.2, 1.5.2.20 and 18.8). composition by using thousand seed weights (18.7) or
the sample sizes given in Column 3 of Table 2A for
the declared species (also see the Excel spreadsheet
18.2 Definitions ‘Testing Seed Mixtures’ on the ISTA website in the
Technical Committee documents to calculate submit-
Seed mixture is a quantity of seed that contains seed of ted sample weights);
two or more species by declaration of the applicant. – ‘quick method’ using the greatest weight given in col-
For issuing a Blue International Seed Sample Certifi- umn 3 of Table 2A for a declared species of the seed
cate for a seed mixture, at least two of the declared species mixture.
must be listed in Table 2A of the ISTA Rules and it must
not be difficult or impossible to distinguish between these 18.3.2 Sample reduction
two species (see 3.5.2.4). Seeds of declared species not
listed in Table 2A belong to the other seed fraction (see For sample reduction, methods according to 2.5.2.2.1 may
18.4). be used, but not the centrifugal divider (2.5.2.2.1c). The
Mixture composition is the composition of the seed mix- hand halving method (2.5.2.2.4) may only be used, if the
ture given in percentage of mixture components by weight other methods do not work and if this method is allowed
or by number of seed or inert material. for at least one of the declared species. Dimensions of
Mixture component is a component of a seed mixture equipment should be suitable for the largest seeds accord-
that contains seed of one or more species or inert material. ing to the declaration of the seed mixture.
A mixture component is:
– seed (including coated seed) of one species including Chapter 18: Seed mixture analysis
seed of two or more varieties of the same species (see 18.4 Purity and composition
3.2.1); analysis
– seed of two or more species, if it is difficult or impos-
sible to distinguish between the species (see 3.5.2.4); Seeds of species not declared by the applicant as mixture
or component and seeds of declared species that are not list-
– inert material according to the declaration of the mixed in Table 2A are classified as ‘other seeds’. Inert mate-
ture composition, e.g. in form of additives to improve rial not declared by the applicant as mixture component is
sowability. classified as ‘inert matter’. The pure seed assessment must
follow the appropriate pure seed definition (PSD) of each
The component parts ‘other seed’ and ‘inert matter’ of a species provided in Chapter 3.
purity analysis according to Chapter 3 are not regarded
as mixture components and are not part of the mixture
composition.

Chapter 18: Seed mixture analysis International Rules for Seed Testing
18.4.1 Working sample 18.6 Germination test, seed

viability test, seed vigour test and
The purity analysis must be made on a working sam-
ple taken from the submitted sample in accordance with other tests using replicates of 100
18.3.2. The size of the working sample must be a weight seeds
estimated to contain at least 2 500 seed units.
The weight of the working sample can be determined us- For mixture components representing 5 % or more of the
ing either method: seed mixture, according to the declared mixture composi-
– ‘exact method’ on the basis of the declared mixture tion, as many replicates of 100 pure seeds are tested as
composition by using the thousand seed weights pure seeds are available from the purity test sample of
(18.7) or the sample sizes given in Column 4 of 2 500 seeds. Maximum numbers of seeds per test are given
Table 2A for the declared species (also see the Excel in the appropriate Chapter. If fewer than 100 seeds are
spreadsheet ‘Testing Seed Mixtures’ on the ISTA available, all seeds are used.
website in the Technical Committee documents to For mixture components representing less than 5 % of
calculate submitted sample weights). the seed mixture, according to the declared mixture com-
– ‘quick method’ the greatest weight given in Column position, tests are not carried out except on the specific
4 of Table 2A for a declared species of the seed request of the applicant.
mixture.
18.4.2 Separation 18.7 Weight determination

The working sample is separated into the fractions ‘pure The thousand seed weight determination for mixture com-
seed’, ‘other seed’, ‘inert matter’ and, if applicable, ‘inert ponents does not follow Chapter 10 but is determined by
material according to declaration’. counting the number and determining the weight of all
The pure seed fraction includes seeds of those species pure seeds of a mixture component. The thousand seed
that are declared by the applicant as mixture components weight is calculated using the weight and number of seeds
and that are listed in Table 2A. The pure seed fraction is of each component.
further separated into the declared species with methods Note: If the applicant intends to use the reported results
according to 3.5.2. When it is difficult or impossible to for verification of mixture composition, the thousand
distinguish between declared species (see 3.5.2.4), the seed weight of all seed mixture components must be
species are combined into one mixture component. determined and reported.
If applicable, the inert material in the working sample
is separated into ‘inert material according to declaration’
and ‘inert matter’ with methods according to 3.5.2. Each 18.8 Reporting results
component part of the purity analysis and each mixture
component must be weighed according to 3.5.1. The results of tests on seed mixtures can only be report-
The uniform blowing method must not be used for ed on a Blue International Seed Sample Certificate (see
seed mixtures, but the blower can be used as a tool to aid 1.2.2).
the purity analysis. For the species tested, ‘Seed mixture’ together with the
mixture composition according to the declaration of the
applicant, must be entered.

18.5 Determination of other seeds
by number
18.8.1 Purity and component analysis
The size of the working sample for a complete or limited
test must be a weight estimated to contain 25 000 seed The results of the purity analysis are reported according
units, i.e. ten times the size of the purity working sample to Chapter 3.
as determined according to 18.4.1. The actual weight of sample examined to the minimum
number of decimal places indicated in Table 4.1 must be
reported under ‘Other determinations’, i.e. ‘Purity and
composition analysis: … g of seed examined.’
The mixture composition is reported under ‘Other deter-

minations’ in one of the following formats, as requested
by the applicant:

International Rules for Seed Testing Chapter 18: Seed mixture analysis
1. The percentage by weight of the pure seeds of the whole number. The number of seeds tested is also report-
mixture components using the total weight of the pure ed. Tolerances as described in the appropriate Chapters
seed fraction. In addition, if applicable, the percentage are applied to tests of 400, 300, 200 and 100 seeds.
by weight of the ‘inert material according to declara- When fewer than 100 seeds are tested, the actual num-
tion’ referred to the sum of the weights of all mixture ber of seeds in each category (e.g. normal seedlings or
components (pure seeds and inert material according viable seeds) is reported, together with the total number
to declaration) must be given to one decimal place un- of seeds tested.
der ‘Other determinations’. The method used in the test must be reported on the
2. The percentage by weight of mixture components, certificate according to the appropriate Chapter for each
pure seeds or inert material according to declaration component species tested.
using the sum of the weights of the pure seed fraction
and the declared inert material. 18.8.4 Weight determination
3. The percentage by number of the pure seeds of the
mixture components using the total number of seeds The results as calculated according to 18.7 must be re-
of the pure seed fraction. ported under ‘Other determinations’.
In addition, if applicable, the percentage by weight of the
‘inert material according to declaration’ using the sum of
the weights of all mixture components must be given to
one decimal place under ‘Other determinations’.
18.8.2 Determination of other seeds by

number
The results of a determination of other seeds by number
on a seed mixture must be reported according to 4.7.
18.8.3 Germination, seed viability, seed

vigour and other tests using replicates of
100 seeds
Test results are reported only for those species for which
methods are given in the appropriate Chapter of the ISTA
Rules. The results of these tests must be reported under
‘Other determinations’.
Germination test results are not reported in the ‘Ger-
mination’ section of the certificate (an ‘N’ must be entered
there), but under ‘Other determinations’. When 100 or
more seeds are tested, the percentage results of the test for
each mixture component tested are reported to the nearest

International Rules for Seed Testing Chapter 19: Testing for seeds of GMOs
Chapter 19: Testing for seeds of genetically modified

organisms
19.1 Object 19.2.5 GMO event
The object of this chapter is to give guidelines to detect, A GMO event is a single transformation act that results in
quantify or confirm the presence of GMO seeds in seed the integration of a new trait at a unique site in the plant
lots. genome, giving rise to a transgenic plant and subsequently
These guidelines can be applied to testing adventitious incorporated into new varieties.
presence (AP) of genetically modified organisms (GMOs)
and GMO trait purity testing.
19.2.6 GMO trait
19.2 Definitions A GMO trait is a novel phenotypic character, added by ge-

netic engineering to an organism and often derived from
19.2.1 Adventitious presence another species.
Adventitious presence (AP) in seeds refers to the unin-

tentional and incidental presence of foreign material in a 19.2.7 Limit of detection
seed lot. This may happen during production, harvesting,
storage or marketing. The limit of detection is the smallest amount of target
analyte that has been demonstrated to be detected with a
given level of confidence. This limit must be verified by
Chapter 19: Testing for seeds of genetically modified organisms

19.2.2 Analyte the laboratory.
An analyte is a substance or chemical constituent that is of

interest in an analytical procedure. 19.2.8 Limit of quantification
The limit of quantification is the smallest amount of target

19.2.3 Certified reference material analyte that has been demonstrated to be reliably meas-
ured with acceptable levels of accuracy and precision.
Certified reference material is reference material which This limit must be verified by the laboratory.
has been characterised metrologically for a specific prop-
erty by an official body. Such material is accompanied by
a document attesting to the value of that property, its as- 19.2.9 Performance-based approach
sociated uncertainty and its metrological traceability.
The performance-based approach (PBA) is an approach
to testing in which individual laboratories can choose the
19.2.4 Genetically modified organism test method, as long as the method has been validated as fit
for purpose and complies to given performance standards.
A genetically modified organism (GMO) is any living or-
ganism that possesses a novel combination of genetic ma-
terial obtained through the use of modern biotechnology.

Chapter 19: Testing for seeds of GMOs International Rules for Seed Testing
19.2.10 Proficiency test This chapter describes testing for adventitious pres-
ence of GM seeds and GMO trait purity. Currently there is
A proficiency test is a standardised test or series of tests no universal threshold for GM seeds in conventional seed
that assesses the ability of a laboratory or an individual lots, or of regulated GM seed in deregulated GM seed, or a
operator to carry out a particular method. specified level of GMO purity in a seed lot; the establish-
ment of reliable methods for the detection, identification
and quantification of GMO content is therefore very im-
19.2.11 Seed bulk portant. Different technologies, strategies and methods for
GMO testing are continuously evolving and new methods
The seed bulk is the whole working sample that is pre- being developed. The quality of these test results depends
pared at one time (e.g. grinding, DNA or protein extrac- much more on methodology, equipment and training than
tion) and analysed (e.g. end-point PCR, ELISA, real-time in other classical seed testing methods. This makes the
PCR). standardisation of GMO testing very difficult. The ISTA
approach has targeted the uniformity in GMO testing re-
sults, not by the uniformity in testing methodology, but
19.2.12 Seed group by using a performance-based approach (PBA). The PBA
requires that laboratories demonstrate that the GMO de-
A seed group is one of the portions of the working sample tection, identification or quantification methods that they
that is separately prepared (e.g. grinding, DNA or protein are using on seed samples for reporting results on ISTA
extraction) and analysed (e.g. end-point PCR, ELISA, Certificates meet acceptable standards set by ISTA. These
real-time PCR) when using the group testing approach. standards include, among others, sampling, testing and re-
porting. In order for a laboratory to be recognised as ISTA
accredited for GMO testing, it will need to ensure that
19.2.13 Transgenic documented evidence of validation and reliability of the
laboratory is available to the ISTA auditors. The evidence
Transgenesis is the process of introducing a foreign ge- must include:
netic construct – called a transgene – into a living organ- – performance data based on seed samples for the event
ism so that the organism will exhibit a new property and and species for which the laboratory is seeking ISTA
transmit that property to its offspring. The organisms and accreditation, and
lines containing transgenes are referred to as transgenic. – participation in an ISTA GMO proficiency test includ-
Cisgenesis occurs by the same process, but using genes ing the specific event and species, if available.
from the same species.
This requirement will ensure the reliability of the analy-
sis and the final test result reported on the ISTA Certifi-
19.2.14 Reference material cate. The PBA gives seed testing laboratories the choice
to use different technological approaches, e.g. bioassays,
According to ISO Guide 30, reference material is: “ma- protein-based methods and DNA-based methods.
terial, sufficiently homogeneous and stable with respect For further information, see the ISTA Principles
to one or more specified properties, which has been es- and Conditions for Laboratory Accreditation under the
tablished to be fit for its intended use in a measurement Performance Based Approach (see www.seedtest.org/
process”. It can also be classified according to its use, accred-docs).
for instance “calibrants/calibrators” or “quality control Generally, GMO tests that are used to assess GMO
materials”. trait purity are identical to the tests used for testing for AP
of GM seeds. However, there are differences in the testing
steps as well as in the objectives. This chapter addresses
19.3 General principles these distinctions whenever they apply.
The ISTA strategy regarding methods for the detection,

identification and quantification of genetically modified
seeds in conventional seed lots is available on the ISTA
web site at www.seedtest.org/gmopp.

19.4 Procedure quantitative question, e.g. “How much GM seed is there in

a seed lot?” can be answered by using either a quantitative
Adventitious presence of GMO testing and GMO trait pu- test (see 19.5.1.3) or a group-testing approach (Remund
rity testing are “two sides of the same coin”; both applica- et al., 2001), also known as the semi-quantitative method
tions make use of the same tests, and follow a very similar (which relies on qualitative tests of seed groups). Another
work flow (Fig. 1). The expected results differ in the two classification that applies only to DNA-based methods is
applications. In GMO AP testing, most of the time the ex- in relation to the specificity of the method, as described
pected outcome is “not detected” or a low estimate of the further in section 19.4.1.
proportion of GMO present. In GMO trait purity testing, Both AP GMO testing and GMO trait purity testing
the expected result is the quantification of a high percent- can be performed on individual seeds or on seed bulks,
age of presence of the specified trait. although each application will require a different sam-
The methods used for these analyses can be classified pling and testing scheme. Seed bulk testing is more com-
and characterised in a number of ways. According to the mon in AP GMO testing, where the detection target is a
level at which the analysis occurs, tests can be conducted transgenic protein or a DNA segment. GMO trait purity
at the DNA level (19.5.1), protein level (19.5.2) or organ- tests are usually performed on a representative sample of
ism level, as in bioassays (19.5.3). individual seeds or seedlings, and target the GMO trait
The appropriate approach to GMO testing is chosen or, similarly, the protein or the DNA. However, when per-
according to the question which the test is attempting to formed on seed bulks, the test is performed at the DNA
answer (see Fig. 1). A qualitative question, e.g. “Is there level to detect the absence of transgenic DNA, and targets
any GM seed in the sample?” can be answered by apply- the uninterrupted insertion site (Battistini and Noli, 2009).
ing a qualitative test (see 19.5.1.2 and 19.5.2.2), while a

Seed lot
Submitted sample
Adventitious
GMO trait purity
presence GMO
Testing objective
Quantitative Qualitative Quantitative
testing testing testing
Single seeds Seed groups Bulked seeds Bulked seeds Bulked seeds Seed groups Single seeds Working sample
Grinding
Bioassays Bioassays
Analyte isolation
Testing process
Analysis
Data collection and processing
Reporting
Figure 1. The different approaches to GMO testing and corresponding workflows.

19.4.1 Sample size 19.4.3 Test conditions
Chapter 2: Sampling gives definitions of various sample Tests must be carried out under conditions of the ISTA
types, including primary, composite, submitted and work- Accreditation Standard quality framework. This includes,
ing samples, as well as guidelines for obtaining seed lot but is not limited to the following:
samples that represent the properties of the seed lot. These – Analysts involved in this testing must have the doc-
definitions and guidelines apply also to GMO testing. The umented skills and training in the corresponding
working sample is the portion of the submitted sample procedures.
that is actually tested by the testing method (as defined – All equipment must be appropriate to the techniques
in Chapter 2). The size of the working sample depends on used. Scheduled maintenance, verification, and cali-
given threshold requirements, the method capability and bration of the instrumentation used must be carried
the degree of required statistical confidence, and can be out.
determined using appropriate statistical tools (e.g. Seed- – The spatial arrangements and organisation of the test-
Calc (19.6.3)). The sample submitted to the laboratory ing area must prevent contamination.
must therefore be at least the size of the working sample, – Reagents of appropriate grade and certified reference
but more realistically larger than the working sample. For materials (when available) must be used.
more information regarding sampling, see Chapter 2. – Appropriate controls must be used to validate the test-
The sizes of seed bulks and groups must be consistent ing results.
with the performance of the analytical method in terms of
limit of detection, in order to allow the detection of even
one GM seed. For quantitative methods, if a laboratory 19.5 Testing approaches
aims at quantifying the presence of a single seed in the
working sample then the size of the sample must be con- 19.5.1 DNA-based methods
sistent with the limit of quantification.
19.5.1.1 General principles of DNA-based
testing
19.4.2 Personnel and equipment

DNA-based testing requires a series of steps which can be
Many of the procedures used for GMO testing are com- carried out by different laboratory personnel and which
posed of several stages (e.g. seed planting or grinding, should all show evidence of validation and being fit for
DNA or protein extraction, detection of the target analyte, purpose for the testing being carried out. The steps are the
and reporting of results) which can be carried out by dif- following:
ferent personnel in the laboratory (see Figure 1). The labo- – examination of the seed sample;
ratory must show that personnel are adequately trained in – grinding of the seed to produce a homogenous matrix;
the procedures that they are carrying out, and that they un- – subsampling and DNA extraction;
derstand the overall workflow of the procedures and their – DNA amplification;
contribution to that workflow. Each part of the workflow – detection of the amplified DNA.
and the equipment must be adequately validated, verified
or calibrated before use. Because of the amplification step, it is important that the
Appropriate equipment and facilities must be provided laboratory ensures adequate protection against contami-
for the use of the chosen methods. For biomolecular as- nation by seed dust, extracted DNA or amplified DNA
says (DNA and protein), apparatus for grinding and ana- for each tested sample. Appropriate control samples (e.g.
lyte extraction are necessary, as well as equipment dedi- environmental, blank or negative controls) must be used.
cated to the detection of the target analyte. If available, it is recommended to use certified reference
For DNA-based detection, it is important to prevent materials.
contamination, and the use of separate rooms for certain In the case of methods using the polymerase chain re-
manipulations is preferred. action (PCR), several types of testing can be done that will
For protein-based detection, care must be taken to differ in the level of selectivity and specificity.
avoid degradation of the matrix and the extracted analyte. – In GMO screening, primers are chosen that amplify
For bioassays, care must be taken to ensure the provi- individual genetic elements frequently found in a num-
sion of controlled germination conditions adequate to al- ber of different GMO events. The detection of such
low the expression of the trait. targets suggests the presence of GMO, but does not
represent by itself conclusive evidence.

– In construct-specific PCR, the primers are chosen such 19.5.1.4 Other technologies
that the amplification target spans genetic elements not
usually combined in nature, providing a strong indica- The descriptions in section 19.5.1 apply to technologies
tion of the presence of a GMO event that includes that (primer and probe sets, methods and equipment used for
construct. amplification and detection as well as for quantification)
– In event-specific testing, the primers are designed to that are widely used in laboratories carrying out GMO
detect the unique integration site of a specific trans- testing.
formation event. Thus, a positive result is indicative of Other methods are currently being developed for use
the presence of that particular event. in GMO detection. Use of these methods can also be in-
cluded in ISTA’s PBA as long as the laboratory develops
Whatever the type of method selected and its origin, in- and maintains adequate validation data for the methods
ternally developed or publicly available, its performance used.
must be evaluated according to the PBA requirements and
following the procedures as directed by the ISTA GMO
Committee. 19.5.2 Protein-based methods
19.5.2.1 General principles of protein-based

19.5.1.2 End-point qualitative PCR testing
In end-point PCR, the standard steps of PCR are carried In order to detect single proteins in seeds, the seeds need
out, with detection of PCR products at the end of the pro- to be ground and extracted with a suitable buffer. The de-
cess. This detection step can be the electrophoresis of the tection of proteins using an immunoassay in a complex
amplified DNA molecules on gel or the measurement of mixture such as that obtained by extraction of seed powder
fluorescence associated with the PCR reaction. With elec- requires a number of precautions. The detectable protein
trophoresis, the test is scored as positive if a band of the content may vary due to the protein itself, the extraction
appropriate size is observed on the gel, and negative if no process and buffer and the type of seed used. Particular

band is observed. With fluorescence detection, the test is difficulties are well known (e.g. oil content of oilseed
scored by comparison to the fluorescence measurement of rape, gossypol in cotton seeds, varietal differences, seed
appropriate positive and negative control samples. maturity, seed moisture) and the laboratory should have
validated the extraction and detection methods for each
seed matrix by spike and recovery tests (see GMO Meth-
19.5.1.3 Real-time PCR od Handbook). Proteins are generally rapidly degraded.
The extraction should be carried out at room temperature,
During real-time PCR, DNA amplification activates fluo- or below, and after extraction the mixture should be used
rochromes attached to the primers or probes. This activa- quickly or stored at low temperature. When using com-
tion can be measured in real time and can give an estimate mercial lateral flow strip tests (19.5.2.2) or ELISA kits
of the number of DNA molecules being amplified in each (19.5.2.3), it is important to refer to the assay conditions
cycle. as defined by the test kit suppliers. Moreover, these as-
DNA amplification can also be measured by activa- say conditions must be internally validated in the labora-
tion of intercalating fluorescent dyes. In this case, special tory conditions, systematically include positive and nega-
attention to false-positive results must be paid, since the tive controls in each test and follow the ISTA Principles
activation of intercalating dyes can be associated with am- and Conditions for Laboratory Accreditation under the
plification of non-specific PCR products. Performance Based Approach. (see www.seedtest.org/
Real-time PCR can be qualitative or quantitative. accred-docs)
In qualitative real-time PCR tests, the test is scored It is not recommended to use protein-based tests for
positive if fluorescence above the defined baseline is de- quantification of GMO, as the variations in sample type
tected before a given PCR cycle (usually set by amplifica- (e.g. germplasm, seed maturity) and in extraction and de-
tion of a known GMO control DNA). tection methods can result in target protein content varia-
In quantitative real-time PCR tests, the assay is de- tion in the protein extract and cause difficulty in estimating
signed to quantify the target against a standard curve the GMO content. Protein detection is not always event-
produced from reference material. The experimental set- specific, as several events may contain the same protein
up and reporting of results must follow accepted statisti- (e.g. NK603/MON88017; MON810/Bt11), but the careful
cally sound methods such as those suggested in the GMO use of multiple methods may allow a good indication of
Handbook. which event is being detected.

19.5.2.2 Lateral flow strip test 19.6 Calculation and expression of

results
The lateral flow strip test consists of an immunoassay in
which globulins or antibodies are immobilised on a capil-
lary paper. The strip is dipped into the protein extract. The 19.6.1 Consideration of the testing
presence of the target protein (the antigen) is represented objective
by the appearance of at least two bands, a negative result
only by a control band. The result can be scored only if the The applicant must clearly state the specific testing ob-
control band is visible. A maximum time of reading must jective, as this is critical in defining the testing approach
be defined to avoid false-positive scoring, due to unspe- and in calculating and expressing results. Possible testing
cific staining which can occur after a long reaction time. objectives include:
– reporting the presence or absence of a GMO in the
seed lot;
19.5.2.3 Enzyme-linked immunosorbent assay – estimating the proportion of the GMO present in the
seed lot with the associated measurement uncertainty.
The enzyme-linked immunosorbent assay (ELISA) is a
sensitive immunoassay that uses an enzyme linked to an The methods described in 19.5 produce either qualitative,
antibody or antigen as a marker for the detection of the i.e., detected (GM trait observed) or not detected (GM trait
specific trait protein through a colorimetric reaction. not observed), or quantitative results. Both types of results
can be statistically analysed to meet the testing objective,
but the data analysis methods and associated calculation
19.5.3 Bioassays tools differ.
To assess for the presence of two or more stacked
19.5.3.1 General principles of bioassays events in the same seed, testing individual seed is the ap-
propriate approach. When seed are tested in bulk, the pres-
Bioassays are tests based on visual assessment of phe- ence of stacked events cannot be demonstrated. However,
notypic effects of treatments on seeds or seedlings. The some statistical tools such as the one proposed by ISTA in
most common use of bioassays is to determine the pres- SeedCalc Stack9 can estimate the percentage of seeds that
ence of seed which carries herbicide-resistance traits. In could have two or three stacked events.
this case the seeds or seedlings are exposed to herbicide,
and the expected effect on the plant is lack of normal de-
velopment when the seeds do not contain the herbicide- 19.6.2 Units of measurement
resistance trait. All seeds or plants that continue to ger-
minate or grow normally are scored as positive for the The calculation and expression of results depend on the
GMO trait. The appropriate concentration of herbicide testing objectives, testing methods and the associated units
must be determined per crop and growth stage. It is im- of measurement. The aim or request of the applicant will
portant to consider that bioassays determine the presence need to be carefully considered. In order to cope with the
of a GMO trait, but cannot determine the presence of any different objectives and circumstances where quantifica-
specific event, as in many crops multiple events exist with tion of seeds with GMO traits is required, and in concord-
the same herbicide-resistant phenotype. Therefore, in such ance with the PBA, it is acceptable to report quantitative
cases herbicide bioassays can only be used to screen for test results using any one of the following units:
the presence of GMO, but cannot detect the presence of a
particular event. a) % in number of seeds: the estimate of the percentage
of GM seeds in the seed lot. In addition to individual
testing, the percentage in number of seeds is the unit to
19.5.3.2 Scoring of GMO presence be used when a group testing approach is chosen; e.g.
with SeedCalc (see 19.6.3).
Standardised methods of scoring and analysing the results
for the herbicide testing should be in place. This should b) % in mass of seeds: the estimate of the percentage of
include statistical considerations of the numbers of seeds GMO content by mass. This unit should be used when
used and scored. a standard curve is prepared using certified reference
The result must take into consideration the germina- material certified by % mass (g/kg).
tion percentage.

c) % DNA copies: the estimate of the percentage of GMO – the limit of quantification of the method (when testing
content by number of copies. This unit should be used seed bulk with a quantitative method)
when a standard curve is prepared using certified refer-
ence material certified by % DNA copies.
19.7.1 Qualitative test results
All these three units are acceptable for preparing ISTA
Certificates for reporting results by accredited laborato- Suggested phrases for reporting the detection of test tar-
ries. The acceptance of more than one unit can avoid rais- gets depending upon the result are as follows:
ing the difficult question of converting factors. A simple
mechanical conversion between units is complex or even a) If the test target(s) was(were) not detected: ‘The test
impossible. target was not detected.’
Whatever the unit used to express results, the resulting
GM estimate should be methodologically meaningful, that b) If the test target(s) was (were) detected: ‘The test tar-
is, a laboratory using quantitative real-time PCR should get was detected.’
not report a value that is lower than its validated limit of
quantification.
Moreover, in quantitative real-time PCR, results 19.7.2 Quantitative results obtained by
should be biologically meaningful. The lab should pay at- multiple qualitative tests of individuals
tention to results that are lower than 1 divided by the size or groups of seeds or seedlings
of the working sample.
Results should be reported relative to the percentage of
seeds or seedlings showing the test target specified by the
19.6.3 ISTA tools for calculation of applicant. The total number of seeds tested, the number
results of groups, and the number of seeds per group must be re-
ported. Suggested phrases for reporting such results de-
Remund et al. (2001) and Laffont et al. (2005) provided pending upon the result are as follows:

statistical tools for qualitative and quantitative testing
methods which are implemented in the SeedCalc MS Ex- a) If the test target(s) was (were) not detected: ‘The test
cel workbook (available on the ISTA web site). target(s) was (were) not detected.’
b) If the test target(s) was (were) detected: ‘The % of

19.7 Reporting results seeds in the lot with the test target(s) was determined
to be …%, with a 95 % confidence interval of […%,
The result of a genetically modified organism test must be …%].’
reported under ‘Other determinations’ as follows: or
– the request of the applicant; ‘For the test target(s) specified by the applicant, the
– the name and scope (with reference to the target) of the seed lot meets the specification of ...% (maximum or
method(s) used; minimum) with …% confidence.’
– a description of the working sample (e.g. pure seed
fraction, inert matter present, other seeds present, If the results do not show evidence that the seed lot meets
washed seed); a given specification with some confidence, then the ap-
– the number of seeds in the working sample; plicant will report the point estimate with the 95 % confi-
– a description and the source of the reference material dence interval.
used (e.g. certified reference material, provider);
– the limit of detection of the method (when testing seed
groups or seed bulk);

19.7.3 Quantitative measurements of 19.8 References

GMO in bulk samples
Battistini E. & Noli E. (2009). Real-time quantification of
Results should be reported relative to the percentage of wild-type contaminants in glyphosate tolerant soybean.
the test target specified by the applicant by mass or num- BMC Biotechnology 9, 16.
ber of DNA copies. The testing plan (e.g. number of rep- Laffont J.-L., Remund, K.M., Wright, D.L., Simpson R.D.
licate seed samples, number of replicate flour samples per & Gregoire S. (2005). Testing for adventitious presence
seed sample, number of extracts per flour sample, number of transgenic material in conventional seed or grain
of replicate measurements per extract) must be indicated. lots using quantitative laboratory methods: statistical
Required phrases for reporting depending upon the re- procedures and their implementation. Seed Science
sults are as follows: Research 15, 197–204.
Remund, K.M., Dixon D.A., Wright D.L. & Holden L.R.
a) If the test target was not detected (no signal or below (2001). Statistical considerations in seed purity testing
the limit of detection): ‘The test target was not detect- for transgenic traits. Seed Science Research 11, 101–
ed at a level above the limit of detection.’ 119.
SeedCalc: http://www.seedtest.org/stats-tools (last veri-
b) If the test target was detected at a level above the limit fied 2014-11-10)
of detection and below the limit of quantification: ‘The
test target was detected at a level below the limit of
quantification of the method used.’
c) If seeds showing the test target were found at a level

above the limit of quantification: ‘The test target(s)
percentage in the seed lot was determined to be …%
by mass or number of copies, with a 95 % confidence
interval of […%, …%]‘
or
‘For the test target(s) specified by the applicant, the
seed lot meets the specification of ...% (maximum or
minimum) by mass or number of copies with …%
confidence.’
If the results do not show evidence that the seed lot meets
a given specification with some confidence, then the ap-
dence interval.

ISTA Rules 2018

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

ISTA Rules 2018

Uploaded by

Copyright:

Available Formats

International Rules for Seed Testing, Full Issue i–19-8 (298)

International Rules for

Introduction to the ISTA Rules

Including changes and editorial corrections adopted at the

Effective from 1 January 2018

Note on the use of the translations

©2018 International Seed Testing Association (ISTA)

Online ISSN 2310-3655

ii Effective 1 January 2018

1.5.2.12 Moisture content ........................................ 1-9 2.2.13 Coated seeds ..................................................... 2-2

Effective 1 January 2018 iii

2.4 Apparatus .................................................................. 2-2 2.9.1.4 Use of Table 2D ......................................... 2-36

2.9.1 The H value test ............................................... 2-34

iv Effective 1 January 2018

5.6.3.4 Disinfection of the seed ............................. 5-14

Effective 1 January 2018 v

5.6.5.2 Multigerm seed units ................................. 5-15 7.2.3 Seed treatment .................................................... 7-1

7.2 Definitions ................................................................ 7-1 8.9.1.3 Procedure ..................................................... 8-6

vi Effective 1 January 2018

8.9.1.3.3 Electrophoresis ...................................... 8-6 8.9.6.5 Extraction ................................................... 8-17

8.9.6.1 Principle ..................................................... 8-17 8.10.3.3.1 Reaction components ........................ 8-24

Effective 1 January 2018 vii

8.11.1 Cereals ............................................................ 8-25 9.2.1.5.2 Calibration sample ................................ 9-9

9.2.1.5 Procedures ................................................... 9-9 11.2.5.4.1 Seed lot size ....................................... 11-2

viii Effective 1 January 2018

Effective 1 January 2018 ix

14.7 Reporting results ................................................... 14-2 15.8.2.8 Reporting results ...................................... 15-8

15.8.2.6.2 Ageing the seed ................................. 15-7 17.5 Calculation and expression of results ................... 17-2

x Effective 1 January 2018

17.8 Tolerance tables .................................................... 17-2 19.5.2.3 Enzyme-linked immunosorbent assay ..... 19-6

Chapter 19: Testing for seeds of genetically modified

19.5.2.1 General principles of protein-based

Effective 1 January 2018 xi

Preface to the 2018 Edition of the ISTA Rules

Preface to the 2018 Edition of the ISTA Rules

Effective 1 January 2018 xiii

Changes to the ISTA Rules for 2018

Chapter 3 Chapter 13

xiv Effective 1 January 2018

Introduction to the ISTA Rules

vide internationally accepted test methods for various at-

Effective 1 January 2018 I-1

Further information on the ISTA Method Validation should be submitted.

I-2 Effective 1 January 2018

4. Validated germination test methods. The methods I-2.3 Other proposals

Introduction to the ISTA Rules

Effective 1 January 2018 I-3

Form 1: Proposal for inclusion of new species in the ISTA Rules

1. Scientific name of proposed species

2. Lot and sample weights

(Information as it should appear in Table 2A)

Species Maximum weight of Minimum submitted Minimum working samples (g)

3. Pure Seed Definition

Genus Family PSD number Chaffiness

No existing definition covers this species:

Distinguishing characteristics of this species:

I-4 Effective 1 January 2018

4. Validated germination test method(s)

(Information as it should appear in Table 5A)

Species Prescriptions for: Additional directions incl. recommendations

5. Validated tetrazolium test procedure

(Information as it should appear in Table 6A)

Species Pretreatment: Preparation Staining Optimum Preparation Permitted non- Remarks

(If no existing drawings apply, attach if available)

8. Validated varietal identification method (attach separate sheet, if necessary)

10. Other countries or laboratories testing the proposed species:

– In cases where the testing procedure deviates from that

d) whether an authentic standard sample or a standard

– the limit of detection of the method (when testing seed

2.5.4.2.2 Approval – ensuring that the testing is done by an ISTA-accredited

– the decision of approval of the seed company (produc- new containers.