Professional Documents
Culture Documents
Laboratory
Protocols in
Fungal Biology
Current Methods in Fungal Biology
Second Edition
Fungal Biology
Series Editors
Vijai Kumar Gupta
Center for Safe and Improved Food &
Biorefining and Advanced Materials Research Center
SRUC
Edinburgh, Scotland, UK
Maria G. Tuohy
School of Natural Sciences
National University of Ireland Galway
Galway, Ireland
About the Series
Fungal biology has an integral role to play in the development of the biotechnology
and biomedical sectors. It has become a subject of increasing importance as new
fungi and their associated biomolecules are identified. The interaction between fungi
and their environment is central to many natural processes that occur in the
biosphere. The hosts and habitats of these eukaryotic microorganisms are very
diverse; fungi are present in every ecosystem on Earth. The fungal kingdom is
equally diverse, consisting of seven different known phyla. Yet detailed knowledge
is limited to relatively few species. The relationship between fungi and humans
has been characterized by the juxtaposed viewpoints of fungi as infectious agents of
much dread and their exploitation as highly versatile systems for a range of
economically important biotechnological applications. Understanding the biology
of different fungi in diverse ecosystems as well as their interactions with living and
non-living is essential to underpin effective and innovative technological
developments. This series will provide a detailed compendium of methods and
information used to investigate different aspects of mycology, including fungal
biology and biochemistry, genetics, phylogenetics, genomics, proteomics, molecular
enzymology, and biotechnological applications in a manner that reflects the many
recent developments of relevance to researchers and scientists investigating the
Kingdom Fungi. Rapid screening techniques based on screening specific regions in
the DNA of fungi have been used in species comparison and identification, and are
now being extended across fungal phyla. The majorities of fungi are multicellular
eukaryotic systems and therefore may be excellent model systems by which to
answer fundamental biological questions. A greater understanding of the cell
biology of these versatile eukaryotes will underpin efforts to engineer certain fungal
species to provide novel cell factories for production of proteins for pharmaceutical
applications. Renewed interest in all aspects of the biology and biotechnology of fungi
may also enable the development of “one pot” microbial cell factories to meet
consumer energy needs in the 21st century. To realize this potential and to truly
understand the diversity and biology of these eukaryotes, continued development of
scientific tools and techniques is essential. As a professional reference, this series
will be very helpful to all people who work with fungi and should be useful both to
academic institutions and research teams, as well as to teachers, and graduate and
postgraduate students with its information on the continuous developments in
fungal biology with the publication of each volume.
Laboratory Protocols
in Fungal Biology
Current Methods in Fungal Biology
Second Edition
Editors
Vijai Kumar Gupta Maria Tuohy
Center for Safe and Improved Food & Department of Biochemistry
Biorefining and Advanced Materials National University of Ireland Galway
Research Center Galway, Ireland
SRUC
Edinburgh, Scotland, UK
© The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Nature Switzerland
AG 2013, 2022
Originally published under Vijai Kumar Gupta, Maria G. Tuohy, Manimaran Ayyachamy, Kevin
M. Turner, and Anthonia O’Donovan, Laboratory Protocols in Fungal Biology: Current Methods in
Fungal Biology
This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether
the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of
illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and
transmission or information storage and retrieval, electronic adaptation, computer software, or by
similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication
does not imply, even in the absence of a specific statement, that such names are exempt from the relevant
protective laws and regulations and therefore free for general use.
The publisher, the authors, and the editors are safe to assume that the advice and information in this
book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or
the editors give a warranty, expressed or implied, with respect to the material contained herein or for any
errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional
claims in published maps and institutional affiliations.
This Springer imprint is published by the registered company Springer Nature Switzerland AG
The registered company address is: Gewerbestrasse 11, 6330 Cham, Switzerland
Contents
v
vi Contents
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 255
Chapter 1
Various Methods of Long-Term
Preservation of Fungal Cultures in
All-Russian Collection of Microorganisms
(VKM)
Contents
1.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2
1.2 Cryopreservation of Filamentous Fungi . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3
1.3 Freeze-Drying of Filamentous Fungi . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4
1.4 Drying in Sterile Soil of Filamentous Fungi . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4
1.5 Drying of Filamentous Fungi on Silica Gel . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5
1.6 Protocols . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20
1.7 Protocol of Drying on Silica Gel . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20
1.7.1 Preparation of Sterile Silica Gel and Ampoules . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20
1.7.2 Preparation of Cryoprotectant: 10% (v/v) Glycerol . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20
1.7.3 Preparation of Cultures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20
1.7.4 Silica Gel Inoculation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21
1.7.5 Filling of Vials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21
1.7.6 Control of Viability . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21
Annexies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22
Annex 1: Fields Attributes in the Table «Database Preservation Methods» . . . . . . . . . . . . . . 22
Annex 2: Maximal Preservation Times for VKM Fungal Species . . . . . . . . . . . . . . . . . . . . . . . . 22
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 66
1.1 Introduction
Microorganisms are fundamental materials for scientific and practical studies. Cul-
ture collections (biological resource centers) play a primary role in the stable
preservation and long-term storage of microbial resources and ensure regular access
to well-documented strains after a long time from their isolation for scientific or
biotechnological use [32, 33].
Various methods of preservation of fungal cultures have been reported [13, 25,
29]. Freeze-drying (lyophilization) and cryopreservation methods are utilized for
thousands of fungal strains in microbial collections all over the world [7, 12, 27].
Nevertheless, it is clear that the fungal strains of different species vary in the ability
to survive after long-time storage preservation under laboratory conditions. Some of
them are very difficult to maintain ex situ, whereas others could be easily and
successfully preserved alive by using almost any conservation technique.
Storage methods for filamentous fungi result from the type and degree of spor-
ulation. Spore-forming strains (as opposed to nonsporulating strains) can be
effectively freeze-dried. Both types can be frozen and stored for long periods in
liquid nitrogen or in a low-temperature refrigerator. The experience of long-term
preservation of fungal strains shows that the duration of storage directly depends not
only on the choice of the method but also on the laboratory protocol and temperature
of subsequent cultures storage.
This chapter presents the methods of cryopreservation, freeze-drying, drying on
silica gel, and preservation in sterile soil that are utilized in VKM fungal collection,
accompanied by data on maximal storage time registered. The methods take into
consideration the special features of cultures preserved as well as the equipment
used.
VKM fungal collection (All-Russian Collection of Microorganisms, Russia) was
established in 1955 and has a long-term experience in the preservation and storage of
fungal cultures. Collection of filamentous fungi is currently composed of approxi-
mately 7000 strains (590 genera, 1600 species) belonging to species of the kingdoms
Chromista (Oomycota) and Fungi (zygomycetous, ascomycetous and basidiomyce-
tous fungi).
All the information on preservation methods for each VKM fungal strain is
presented in the MS Access database. It keeps curated data on the strain numbers,
preservation dates as well as inspection dates in various methods, and other technical
information. Fields in the database table are presented in Annex 1. For operational
analysis of these data, we use MS Access requests – «FunPreservEnd»,
«FunPreserv_Times», «FunPreserv_MaxTimes». The maximal preservation time
is calculated automatically; the latest results (25.11.2019) are presented in Annex 2.
Preserved for many years fungi of various taxa retain their ability to produce
different substances suitable as a material for industry and medicine. For instance,
the zygomycetous fungus Cunninghamella japonica VKM F-1204D was found to
be a promising lipid producer for biodiesel production [22]. Fungi of the genus
Penicillium, which are supported in the collection for more than 40 years (VKM
1 Various Methods of Long-erm Preservation of Fungal Cultures 3
F-325, VKM F-691, VKM F-1823), are able to synthesize active compounds with
diverse structures [10]. Aspergillus brasiliensis VKM F-1119, which was accepted
by VKM 52 years ago, engaged in the vital process of biotransformation of
artemisinin, uncial medicine for the treatment of tropical malaria [34]. Recently
published data on the assessment of the effect of freeze-drying and long-term storage
on the biotechnological potential of Aspergillus section Nigri strains show
maintaining of biotechnological properties after preservation [19].
According to published data, the fast cooling rates followed by storage in liquid
nitrogen at -196 C allow secure and long-term preservation of some fungal cultures
[21]. However, the ability to resist damage by freezing and warming differs consid-
erably among genera/species and depends on their particular features (presence and
type of sporulation, chemical composition of cytoplasmic membrane and cell wall,
physiological state, etc.). Selection of optimal cryoprotectants, rates of cooling, and
warming has enabled increasing the number and diversity of taxa preserved by this
method [24, 28].
More than 75% filamentous fungi of VKM are stored using various cryopreser-
vation protocols. Cultures with abundant sexual and nonsexual sporulation usually
were preserved by using fast cooling rates followed by storage either in liquid
nitrogen or in ultralow temperature freezers at 70 C.
It was noticed that some cultures of zygomycetous fungi belonging to the genera
Mortierella, Basidiobolus, Coemansia, and Entomophthora do not survive the
ultrarapid freezing procedure even if they have abundant sporulation. Successful
preservation of such strains was achieved by modification of the cryopreservation
regime, for example, using slow programmed freezing. The same method was used
either for nonsporulating fungi (basidiomycetous fungi) or zoosporeforming former
fungi (Chromista, Oomycota).
According to our data, some parts of strains of Oomycota (20%), basidiomyce-
tous fungi (4%), zygomycetous fungi (1%), and ascomycetous fungi (1%) did not
survive cryopreservation at all freezing regimes and modification applied [9]. The
strains most difficult to maintain belong to genera Dictyuchus and Phytophthora and
to some species of Achlya and Saprolegnia. Similar situations have also been seen
with some species of basidiomycetous fungi (Suillus, Amanita, Dictyophora,
Mutinus, etc.). They are usually maintained by subculturing and preservation
under mineral oil.
It has been suggested that those microbial cultures that are able to survive the
freezing and a short storage will permanently stay in the vital state after any length of
storage [20]. According to our data, this is not quite true: some strains of Achlya
colorata, Achlya intricata, Clitocybe odora, Choanephora conjuncta, Conidiobolus
thromboides, Kickxella alabastrina, Phanerochaete sanguinea, Rhodocollybia
butyracea, and Saprolegnia terrestris have lost their ability to grow after 5–7
4 S. M. Ozerskaya et al.
years of storage in liquid nitrogen, although they were in the viable state after 24 h of
storage. The reason is not yet known. Nevertheless, the viability test showed that
representatives of 311 species of fungi remain alive after 20–30 years of storage
(Annex 2).
The cooling equipment being used in VKM is storage tanks “Bioproducts-0.5”
with a capacity of 500 liters of liquid nitrogen and ultralow temperature freezers
( 80 C, Sanyo, Japan).
This simple and popular method for the preservation of fungi was applied at the
beginning of the twentieth century [18]. Species of Aspergillus and Penicillium can
be maintained by this way more effectively than other micromycetes. According to
T.P. Suprun [31] who investigated the preservation of 78 Penicillium species (more
than 1000 strains) in sterile soil for 7–10 years, the best preserved strains were
representatives of Assymmetrica section. Less effectively preserved species were
Biverticillata-Symmetrica, and the lowest effectiveness was observed with strains of
the section Monoverticillata.
This method is also efficient for preservation of some human, animal, and plant
pathogens with retaining their virulence [21]. For example, Alternaria japonica (syn.
1 Various Methods of Long-erm Preservation of Fungal Cultures 5
Table 1.1 Drying of VKM fungal cultures on silica gel (storage time)
Storage time at
different temperature
(years)
Number 12 70
No. Name of species of strains 5 С C
C
1 Absidia caerulea Bainier 1889 4 13,98 8,84 29,95
2 Absidia cuneospora G.F. Orr et Plunkett 1959 1 1,21 1,21 30,57
3 Absidia cylindrospora Hagem 1908 2 16,15 11,79 30,02
4 Absidia glauca Hagem 1908 4 10,77 7,78 29,95
5 Absidia repens van Tieghem 1878 1 1,07 1,07 29,44
6 Absidia spinosa Lendner 1907 1 1,66 1,09 30,00
7 Acrophialophora fusispora (S.B. Saksena 1953) 1 32,24 22,34 32,24
Samson 1970
8 Actinomucor elegans (Eidam 1884) C.R. Benjamin 7 15,52 11,34 30,04
et Hesseltine 1957
9 Albifimbria verrucaria (Albertini et Schweinitz 1 11,05 11,05 32,41
1805) L. Lombard et Crous 2016
10 Alternaria alternata (Fries 1832) Keissler 1912 5 10,98 8,66 31,61
11 Alternaria atra (Preuss 1852) Woudenberg et Crous 4 31,81 13,31 31,87
2013
12 Alternaria botrytis (Preuss 1851) Woudenberg et 9 25,40 11,32 32,11
Crous 2013
13 Alternaria brassicicola (Schweinitz 1832) Wiltshire 1 21,75 10,36 31,68
1947
14 Alternaria chartarum Preuss 1848 4 26,64 10,07 31,97
15 Alternaria consortialis (Thuemen 1876) Groves et 3 9,63 8,25 32,25
Hughes 1953
16 Alternaria japonica Yoshii 1941 1 6,96 3,04 32,26
17 Alternaria macrospora Zimmermann 1904 2 5,47 1,63 31,97
18 Alternaria multirostrata E.G. Simmons et C.R. 1 1,30 6,18 31,56
Jackson 1968
19 Alternaria oudemansii (E.G. Simmons 1967) 1 1,00 4,89 31,26
Woudenberg et Crous 2013
20 Alternaria radicina Meier et al. 1922 1 5,88 2,84 32,32
21 Alternaria solani Sorauer 1896 1 1,19 3,21 31,91
22 Alternaria tenuissima (Kunze 1818) Wiltshire 1933 1 22,35 10,91 32,26
23 Amerosporium concinnum Petrak 1953 1 31,26 9,91 31,26
24 Ampelomyces artemisiae (Voglino 1905) Rudakov 1 10,61 6,64 31,95
1979
25 Ampelomyces heraclei (Dejeva 1967) Rudakov 1979 1 10,61 10,61 31,97
26 Ampelomyces humuli (Fautrey 1890) Rudakov 1979 1 31,99 10,61 31,95
27 Ampelomyces polygoni (Potebnia 1907) Rudakov 1 0,72 2,51 22,56
1979
28 Ampelomyces ulicis (Adams 1907) Rudakov 1979 1 22,03 10,61 31,95
29 Ampelomyces uncinulae (Fautrey 1893) Rudakov 1 21,69 1,35 31,62
1979
(continued)
1 Various Methods of Long-erm Preservation of Fungal Cultures 7
The analysis of the results testifies that this method has proved very successful for
the storage of most of the investigated fungi within 3–7 years (Table 1.2).
Where it is desired to keep and constantly to renew cultures within 1–2 years, a
temperature of 5 C is perfectly applicable. More than 97% of the studied
zygomycetous fungi and 94% of ascomycetous fungi were viable after storage.
For long-term (more than 10 years) storage, however, this temperature is not reliable,
since the viability of fungi in both groups is reduced to 57% and 55 % respectively.
A temperature of 12 C is least favorable for long storage. Only 60% of
zygomycetous fungi and 35% of ascomycetous fungi stored at such a temperature
were viable after 10 years. After 17–20 years viability decreased to 10–13% and 4%,
respectively (Fig. 1.1). Among zygomycetous fungi representatives of the classes
Mortierellomycetes, Entomophthoromycetes, and Kickxellomycetes lost their vitality
most rapidly at these temperatures. After 17 years of storage, their viability
decreased to 0–4%. In contrast, the strains from the psychrotolerant species
Helicostylum elegans and Thamnostylum piriforme and thermotolerant species
Rhizomucor pusillus remained steady. Among dark-colored anamorphic ascomyce-
tous fungi the best viability at temperature 12 C after 20 years was found in strains
of the genera Acrophialophora, Alternaria, Coniothyrium, Gonytrichum,
Hormoconis, Paraconiothyrium, and Phialophora. After 30 years, only 1 strain
(Hormoconis resinae) was viable.
Table 1.2 Viability (%) of different taxa of VKM fungi after long-term preservation (30 years) at various temperatures on silica gel
Viability (%) after long-term preservation at different temperature ( C)
1–2 year 3–7 year Near 10 year Near 20 year Near 30 yearr
Subkindom Division Class 5 12 70 5 12 70 5 12 70 5 12 70 5 12 70
Dikarya Ascomycota Dothideomycetes (27 98 99 100 83 86 97 64 41 96 38 4 95 23 0 93
genera, 77 species, 144
strains)
Eurotiomycetes (7 gen- 91 96 100 65 74 100 39 35 91 22 13 91 9 4 91
era, 12 species, 22
strains)
Insertae Sedis (6 genera, 89 100 100 67 56 100 22 11 89 11 11 67 11 0 56
9 species, 9 strains)
Leotiomycetes (5 gen- 81 89 93 48 63 85 30 19 67 4 0 63 4 0 63
era, 13 species, 27
strains)
Ascomycetes (1 genus, 100 100 100 100 100 100 100 100 100 0 0 100 0 0 100
1 species, 1 strains)
Saccharomycetes (1 100 100 100 100 100 100 100 0 100 0 0 100 0 0 100
genus, 1 species, 1
strain)
Sordariomycetes (32 94 100 100 75 68 99 55 34 93 39 1 92 23 0 91
genera, 51 species, 87
strains)
Mucoromyceta Mortierellomycota Mortierellomycetes (1 78 86 100 41 53 96 17 16 94 4 4 74 0 0 74
genus, 18 species, 27
strains)
Mucoromycota Mucoromycetes (28 99 97 100 89 92 100 79 68 99 63 63 98 7 1 98
genera, 89 species, 280
strains)
(continued)
Table 1.2 (continued)
Viability (%) after long-term preservation at different temperature ( C)
1–2 year 3–7 year Near 10 year Near 20 year Near 30 yearr
Subkindom Division Class 5 12 70 5 12 70 5 12 70 5 12 70 5 12 70
Umbelopsidomycetes (1 100 100 100 100 96 100 94 61 100 74 74 100 11 6 100
genus, 5 species, 18
strains)
Zoopagomyceta Entomophthoro- Entomophthoromycetes 67 67 67 22 33 67 0 22 67 0 0 67 0 0 67
mycota (2 genera, 3 species, 3
strains)
Kickxellomycota Kickxellomycetes (2 100 100 100 50 50 100 17 17 100 0 0 100 0 0 50
genera, 2 species, 2
strains)
Zoopagomycota Zoopagomycetes (1 100 100 100 100 100 100 100 100 100 100 100 100 0 0 100
genus, 1 species, 1
strain)
1 Various Methods of Long-erm Preservation of Fungal Cultures 19
100
90
80
70
Viability (%)
60
50 5°С
40
-12°С
30
20 -70°С
10
0
1-2 3-7 near 10 near 20 near 30
Time (year)
Fig. 1.1 The long-term preservation of zygomycetous fungi on silica gel at different temperatures
100
90
80
70
Viability (%)
60
5°С
50
-12°С
40
-70°С
30
20
10
0
1-2 3-7 near 10 near 20 near 30
Time (year)
Fig. 1.2 The long-term preservation of ascomycetous fungi on silica gel at different temperatures
The most acceptable temperature for the storage of mycelial fungi is the temper-
ature 70 C. In these conditions after 30 years of storage, 90% of strains were
viable (Fig. 1.1).
The advantages of storing mycelial fungi at different temperatures on silica gel
are obvious. On one hand, this method is so simple that the storage at 5 C and 12
C can be carried out for the most part in poorly equipped laboratories. On the other
hand, the presence of a low-temperature refrigerator ( 70 C) means it is possible to
support large numbers of cultures in a small area. The advantages of this method are
also a minimum of preparatory work, the rapid reconstituted part of the stored
20 S. M. Ozerskaya et al.
1.6 Protocols
• Silica gel is pre-dried and sterilized by dry heat for 3 h at a temperature of 160 C,
conducting careful control of sterility.
• Plastic ampoules (Nunc) (3 for each culture) are labeled and sterilized by
autoclaving, at 121 C for 20 min.
• Sterile silica gel that has been washed with a concentration of cobalt chloride is
placed in the ampoules to indicate the humidity. The cobalt chloride is deep blue
when dry and turns pink when wet.
• A sterile cotton ball is placed on top of the indicator.
• Grow sporulating fungal cultures on slant agar under optimal growth conditions
and on suitable mediums (www.vkm.ru).
• Wash off spores from agar surface with 5 mL of cool sterile 10% glycerol.
• Titer of spores’ suspension should be not less than 106 spores/mL.
1 Various Methods of Long-erm Preservation of Fungal Cultures 21
• Add 75–100 silica gel granules (40 grade, 9–16 mesh) in a sterile Petri dish.
• Add 1 mL spore suspension to sterile and dry silica gel.
• Shake the Petri dish with the granules.
• Put the Petri dish in desiccator and store in the refrigerator 12 h at 4–7 C.
• Add silica gel granules with fungal spores (20–25 pieces) to 3 plastic ampoules
with a sterile spoon.
• Place cryovials in the boxes and transfer them to the refrigerators (5 and 12 C)
and the ultralow temperature freezer ( 70 C).
Annexies
Code Counter
EntryDate Date/Time
Method Text
Col Text
Strain Numerical
dep Text
pat Text
Curator Text
Dubl-cart Text
Dubl fond Text
Dubl fond new Text
Ampules Numerical
Data Date/Time
Result Text
Data2 Date/Time
Result2 Text
Days Numerical
Year Numerical
Comments Text
Data3 Date/Time
Result3 Text
Data4 Date/Time
Result4 Text
Data5 Date/Time
Result5 Text
EditDate Date/Time
Protector Text
Programm Text
Location Text
Type Text
(continued)
Cryopreservation Freeze-drying Soil
Number of Max storage Number of Max storage Number of Max storage
No. Name of species strains time (years) strains time (years) strains time (years)
33 Acremonium kiliense Gruetz 1925 4 22.13 4 26.11 2 0.09
34 Acremonium lichenicola W. Gams 1971 1 24.26
35 Acremonium murorum (Corda 1839) W. Gams 1971 11 5.74
36 Acremonium persicinum (Nicot 1958) W. Gams 1971 2 19.37 2 43.88 1 26.53
37 Acremonium polychromum (J.F.H. Beyma 1928) W. Gams 1971 5 29.82 5 35.47 3 0.09
38 Acremonium rutilum W. Gams 1971 1 8.02 1 19.10
39 Acremonium salmoneum W. Gams et Lodha 1975 4 2.70
40 Acremonium sclerotigenum (Moreau et R. Moreau 1941 ex Valenta 1948) W. 3 20.23 3 36.56 2 3.73
Gams 1971
41 Acremonium strictum W. Gams 1971 19 19.81 24 39.59 17 9.71
42 Acremonium tubakii W. Gams 1971 2 31.23
43 Acrophialophora fusispora (S.B. Saksena 1953) Samson 1970 1 17.49 1 30.36
44 Acrostalagmus albus Preuss 1851 1 19.59 1 32.45 1 3.51
45 Acrostalagmus luteoalbus (Link 1809) Zare et al. 2004 12 19.35 12 37.43 5 13.56
46 Acrothecium robustum J.C. Gilman et E.V. Abbott 1927 1 19.30 1 31.30 1 25.73
47 Actinomucor elegans (Eidam 1884) C.R. Benjamin et Hesseltine 1957 5 13.17 7 42.07 7 50.21
48 Agaricus arvensis Schaeffer 1774 1 20.04
49 Agaricus bisporus (J. Lange 1926) Imbach 1946 35 26.07
50 Agaricus squarrosus Oeder 1770 1 23.59
51 Albifimbria verrucaria (Albertini et Schweinitz 1805) L. Lombard et Crous 3 19.83 3 48.27 1 2.57
2016
52 Albonectria rigidiuscula (Berkeley et Broome 1875) Rossman et Samuels 1 19.85 1 34.34 1 7.45
1999
53 Alternaria alternariae (Cooke 1871) Woudenberg et Crous 2013 2 20.53 2 32.26
54 Alternaria alternata (Fries 1832) Keissler 1912 13 19.30 43 48.71
55 Alternaria atra (Preuss 1852) Woudenberg et Crous 2013 9 19.60 13 48.35 1 8.34
56 Alternaria botrytis (Preuss 1851) Woudenberg et Crous 2013 12 19.56 19 48.41 1 35.79
57 Alternaria brassicae (Berkeley 1836) Saccardo 1880 4 19.78 3 0.50
58 Alternaria brassicicola (Schweinitz 1832) Wiltshire 1947 6 19.28 7 43.57
59 Alternaria chartarum Preuss 1848 8 19.46 22 45.05
60 Alternaria cheiranthi (Libert 1827) P.C. Bolle 1924 1 19.79 1 19.67
61 Alternaria consortialis (Thuemen 1876) Groves et Hughes 1953 4 19.49 4 45.05
62 1 19.79
Alternaria cucumerina (Ellis et Everhart 1895) J.A. Elliott 1917 var.
cucumerina
63 Alternaria dauci (J.G. Kuehn 1855) J.W. Groves et Skolko 1944 5 19.79
64 Alternaria dianthicola Neergaard 1945 1 19.78
65 Alternaria geophila Daszewska 1912 1 12.56
66 Alternaria godetiae (Neergaard 1933) Neergaard 1945 1 12.56
67 Alternaria grandis E.G. Simmons 2000 1 1.74
68 Alternaria japonica Yoshii 1941 3 19.32 3 27.64
69 Alternaria leucanthemi Nelen 1962 1 19.78 1 24.95
70 Alternaria macrospora Zimmermann 1904 2 12.56 2 30.03
71 Alternaria multirostrata E.G. Simmons et C.R. Jackson 1968 1 17.80 1 11.28
72 Alternaria nobilis (Vize 1877) E.G. Simmons 2002 1 19.78
73 Alternaria oudemansii (E.G. Simmons 1967) Woudenberg et Crous 2013 2 19.32 1 42.78
74 Alternaria radicina Meier et al. 1922 2 17.60 2 38.20
75 Alternaria silybi Gannibal 2011 3 1.97
76 Alternaria simmonsii Gannibal 2011 2 1.97
77 Alternaria solani Sorauer 1896 6 19.78 4 30.40
78 Alternaria tenuissima (Kunze 1818) Wiltshire 1933 6 26.81
79 Alternariaster helianthi (Hansford 1943) E.G. Simmons 2007 2 7.12
80 Amanita citrina (Schaeffer 1762) Persoon 1797 1 17.92
81 Amauroascus aureus (Eidam 1887) Arx 1971 1 6.18 1 33.15
82 Amblyosporium botrytis Fresenius 1863 2 15.34 2 31.28 2 12.18
83 Amerosporium concinnum Petrak 1953 1 19.54 1 47.12
84 Ampelomyces artemisiae (Voglino 1905) Rudakov 1979 1 12.58 1 11.42
85 Ampelomyces heraclei (Dejeva 1967) Rudakov 1979 1 12.18 1 13.21
86 Ampelomyces humuli (Fautrey 1890) Rudakov 1979 1 16.55
87 Ampelomyces polygoni (Potebnia 1907) Rudakov 1979 2 12.28 2 34.50
88 Ampelomyces quercinus (Sydow 1915) Rudakov 1979 2 0.02
89 Ampelomyces quisqualis Cesati 1852 1 12.58 1 29.31
90 Ampelomyces ulicis (Adams 1907) Rudakov 1979 1 12.38 2 29.15
91 Ampelomyces uncinulae (Fautrey 1893) Rudakov 1979 1 12.58 1 40.64
92 Antrodia sinuosa (Fries 1821) P. Karsten 1881 1 8.16
93 Apenidiella antarctica Ivanushkina et al. 2019 1 7.34
94 Apenidiella strumelloidea (Milko et Dunaev 1986) W. Quaedvlieg et P.W. 1 29.09
Crous 2014
(continued)
Cryopreservation Freeze-drying Soil
Number of Max storage Number of Max storage Number of Max storage
No. Name of species strains time (years) strains time (years) strains time (years)
95 Aphanoascus fulvescens (Cooke 1879) Apinis 1968 1 20.42 1 43.15 1 21.16
96 Aphanocladium album (Preuss 1848) W. Gams 1971 4 17.73 4 27.66
97 Aphanomyces helicoides Minden 1915 1 33.22
98 Apiospora montagnei Saccardo 1875 1 9.90
99 Aplanes treleaseanus (Humphrey 1893) Coker 1927 1 15.93
100 Aposphaeria caespitosa (Fuckel 1869) Jaczewski 1917 1 19.21 1 36.11
101 Arachniotus aurantiacus (Kamyschko 1967) Arx 1971 1 43.59 1 21.16
102 Arcticomyces warmingii (Rostrup 1888) Savile 1959 1 24.47 1 1.64
103 Armillaria cepistipes Velenovsky 1920 6 13.55
104 Armillaria lutea Gillet 1874 5 23.45
105 Armillaria mellea (Vahl 1790) P. Kummer 1871 5 33.22
106 Arthrinium arundinis (Corda 1838) Dyko et Sutton 1981 3 12.58 12 24.70
107 Arthrinium phaeospermum (Corda 1837) M.B. Ellis 1965 2 13.34
108 Arthrinium saccharicola F. Stevens 1917 1 16.91
109 Arthrinium sphaerospermum Fuckel 1874 1 19.21 3 47.40 1 3.85
110 Arthrobotrys arthrobotryoides (Berlese 1888) J. Lindau 1907 1 19.32 1 3.91
111 Arthrobotrys cladodes Drechsler 1937 2 15.74 2 23.73 2 7.77
112 Arthrobotrys conoides Drechsler 1937 4 19.32 4 9.44 3 13.48
113 Arthrobotrys longa Mekhtieva 1973 1 10.65 1 9.96 1 0.53
114 Arthrobotrys longispora Preuss 1853 1 25.39 1 3.91
115 Arthrobotrys oligospora Fresenius 1850 6 27.60 7 24.76 7 7.81
116 Arthrobotrys oviformis Soprunov 1958 1 2.40 1 0.19
117 Arthrobotrys robusta Duddington 1951 1 19.41 1 31.56 1 7.99
118 Arthrobotrys superba Corda 1839 7 26.36 7 26.32 7 3.91
119 Ascochyta cucumeris Fautrey et Roumeguere 1891 2 20.34 2 27.91
120 Ascochyta malvicola Saccardo 1878 1 19.22 1 11.74
121 Ascochyta pisi Libert 1830 3 19.45 1 44.50 1 8.67
122 Ascochyta viciae Libert 1837 1 20.31 1 26.76
123 Ascotricha chartarum Berkeley 1838 1 18.97 1 10.75
124 Aspergillus aculeatus Iizuka 1953 7 18.19 2 0.35
125 Aspergillus alliaceus Thom et Church 1926 6 41.09 5 30.10
126 Aspergillus amylovorus Panasenko 1964 ex Samson 1979 1 12.47 1 27.12 1 27.64
127 Aspergillus asperescens Stolk 1954 2 9.95 2 0.50
128 Aspergillus aureolatus Muntanola-Cvetkovic et Bata 1964 1 37.60 1 9.58
129 Aspergillus aureoterreus Samson et al. 2011 1 33.83 1 33.41
130 Aspergillus awamori Nakazawa 1915 13 45.82 13 37.03
131 Aspergillus awamori Nakazawa 1915 var. fumeus Nakazawa et al. 1936 1 17.96 1 30.17
132 Aspergillus brasiliensis Varga et al. 2007 2 36.25 2 22.13
133 Aspergillus brunneouniseriatus Suj. Singh et B.K. Bakshi 1961 1 21.90
134 Aspergillus caespitosus Raper et Thom 1944 2 30.61 2 19.26
135 Aspergillus calidoustus Varga et al. 2008 7 20.53
136 Aspergillus candidus Link 1809 11 39.94 6 46.75
137 Aspergillus carbonarius (Bainier 1880) Thom 1916 2 40.31 2 25.81
138 Aspergillus carneus (van Tieghem 1877) Blochwitz in Thom and Raper 1945 5 39.44 2 30.62
139 Aspergillus clavatus Desmazieres 1834 10 44.38 9 46.84
140 Aspergillus crustosus Raper et Fennell 1965 1 0.15
141 Aspergillus duricaulis Raper et Fennell 1965 1 21.55 1 21.92
142 Aspergillus echinulatus (Delacroix 1893) Thom et Church 1926 1 9.60 1 38.16
143 Aspergillus ficuum (Reichardt 1867) Thom et Currie 1916 2 15.58 1 20.92
144 Aspergillus fischeri Wehmer 1907 7 38.87 6 47.71
145 Aspergillus flavipes (Bainier et R. Sartory 1911) Thom et Church 1926 8 41.10 7 20.90
146 Aspergillus flavus Link 1809 16 41.63 12 46.87
147 Aspergillus flavus Link 1809 var. columnaris Raper et Fennell 1965 1 32.17 1 37.25
148 Aspergillus foetidus Thom et Raper 1945 2 30.88 2 27.21
149 Aspergillus fumigatus Fresenius 1863 15 44.89 10 46.83
150 Aspergillus giganteus Wehmer 1901 3 42.69 3 35.55
151 Aspergillus gorakhpurensis Kamal et Bhargava 1969 1 0.12
152 Aspergillus hennebergii Blochwitz 1935 1 6.46 1 0.14
153 Aspergillus heteromorphus Batista et H. Maia 1957 1 27.48 1 3.35
154 Aspergillus insuetus (Bainier 1908) Thom et Church 1929 1 15.90 1 37.09
155 Aspergillus janus Raper et Thom 1944 2 36.04 2 46.78
156 Aspergillus japonicus Saito 1906 10 34.48 8 32.73
157 Aspergillus kanagawaensis Nehira 1951 2 39.62 2 42.25
158 Aspergillus melleus Yukawa 1911 4 39.08 4 20.75
159 Aspergillus neoafricanus Samson et al. 2011 1 36.34 1 33.42
160 Aspergillus neoniveus Samson et al. 2011 1 0.37
161 Aspergillus nidulans (Eidam 1883) G. Winter 1884 13 48.25 9 47.04
(continued)
Cryopreservation Freeze-drying Soil
Number of Max storage Number of Max storage Number of Max storage
No. Name of species strains time (years) strains time (years) strains time (years)
162 Aspergillus niger van Tieghem 1867 109 44.57 30 46.83
163 Aspergillus niveus Blochwitz 1929 6 37.67 4 37.78
164 Aspergillus nomius Kurtzman et al. 1987 2 0.07
165 Aspergillus nutans McLennan et Ducker 1954 2 46.76 2 37.38
166 Aspergillus ochraceus G. Wilhelm 1877 21 43.70 16 36.29
167 Aspergillus oryzae (Ahlburg 1878) E. Cohn 1884 25 43.68 19 42.05
168 Aspergillus oryzae (Ahlburg 1878) E. Cohn 1884 var. effusus (Tiraboschi 1 34.42 1 9.58
1908) Y. Ohara 1951
169 Aspergillus pallidus Kamyschko 1963 1 12.47 1 18.59 1 48.04
170 Aspergillus parasiticus Speare 1912 2 3.30
171 Aspergillus parvulus G. Smith 1961 1 46.73 1 30.34
172 Aspergillus penicilliformis Kamyschko 1963 1 38.97 1 28.21
173 Aspergillus penicillioides Spegazzini 1896 1 6.90 3 5.91
174 Aspergillus phoenicis (Corda 1840) Thom et Currie 1916 5 32.96 1 7.66
175 Aspergillus proliferans G. Smith 1943 1 10.75 1 11.13
176 Aspergillus pseudodeflectus Samson et Mouchacca 1975 1 36.19 1 38.11
177 Aspergillus puniceus Kwon-Chung et Fennell 1965 3 31.40 1 4.32
178 Aspergillus quadrilineatus Thom et Raper 1939 3 39.84 3 30.07
179 Aspergillus raperi Stolk et J.A. Meyer 1957 2 0.37
180 Aspergillus repens (Corda 1842) Saccardo 1882 11 47.00 11 46.92
181 Aspergillus restrictus G. Smith 1931 1 24.65 1 24.65
182 Aspergillus rugulosus Thom et Raper 1939 5 37.90 5 37.05
183 Aspergillus sclerotiorum G.A. Huber 1933 5 31.55 3 30.64
184 Aspergillus silvaticus Fennell et Raper 1955 1 36.62 1 33.75
185 Aspergillus sojae Sakaguchi et K. Yamada ex Murakami 1971 1 37.49 1 36.16
186 Aspergillus stellatus Curzi 1934 2 36.15 2 37.24
187 Aspergillus subsessilis Raper et Fennell 1965 1 12.44 2 46.65 1 26.30
188 Aspergillus sulphureus (Fresenius 1863) Wehmer 1901 3 40.12 1 42.08
189 Aspergillus sydowii (Bainier et R. Sartory 1913) Thom et Church 1926 30 38.84 7 46.83
190 Aspergillus tamarii Kita 1913 3 38.72 1 42.06
191 Aspergillus terreus Thom 1918 8 6.68 28 47.42 25 47.04
192 Aspergillus terricola Marchal et É.J. Marchal 1893 3 36.09 3 46.84
193 Aspergillus terricola Marchal et É.J. Marchal 1893 var. americanus Marchal 1 33.83 1 7.34
et É.J. Marchal 1921
194 Aspergillus tubingensis Mosseray 1934 1 12.64 1 0.19
195 Aspergillus umbrosus Bainier et R. Sartory 1912 1 13.10 1 0.23
196 Aspergillus unguis (Weill et L. Gaudin 1919) Dodge 1935 3 12.47 5 41.10 5 42.25
197 Aspergillus ustus (Bainier 1881) Thom et Church 1926 17 42.48 13 46.82
198 Aspergillus varians Wehmer 1897 1 18.57 1 25.81
199 Aspergillus versicolor (Vuillemin 1903) Tiraboschi 1908 46 42.57 12 46.87
200 Aspergillus viridinutans Ducker et Thrower 1954 2 28.31 1 47.20
201 Aspergillus wentii Wehmer 1896 12 40.01 6 27.64
202 Asterosporium orientale Melnik 1988 1 0.07
203 Athelia rolfsii (Curzi 1932) C.C. Tu et Kimbrough 1978 1 19.30
204 Aureobasidium melanogenum (Hermanides-Nijhof 1977) Zalar et al. 2014 9 46.31 2 12.60
205 Aureobasidium microstictum (Bubak 1907) W.B. Cooke 1962 1 19.85 3 35.55
206 Aureobasidium pullulans (de Bary 1866) G. Arnaud 1918 14 20.22 29 47.98 3 5.00
207 Backusella circina J.J. Ellis et Hesseltine 1969 2 23.57 2 44.37
208 Backusella indica (Baijal et B.S. Mehrotra 1965) G. Walther et de Hoog 1 20.66 1 25.49 1 20.12
2013
209 Backusella lamprospora (Lendner 1908) Benny et R.K. Benjamin 1975 2 25.41 4 39.34 3 8.78
210 Backusella oblongielliptica (H. Naganishi et al. ex Pidoplichko et Milko 1 20.62 1 34.63
1971) G. Walther et de Hoog 2013
211 Backusella recurva (E.E. Butler 1952) G. Walther et de Hoog 2013 1 25.31 1 19.65
212 Backusella tuberculispora (Schipper 1978) G. Walther et de Hoog 2013 1 25.31 1 36.53
213 Backusella variabilis (A.K. Sarbhoy 1965) G. Walther et de Hoog 2013 1 19.59 1 46.64 1 19.25
214 Basidiobolus magnus Drechsler 1964 1 20.06
215 Basidiobolus meristosporus Drechsler 1955 1 20.21
216 Beauveria bassiana (Balsamo-Crivelli 1835) Vuillemin 1912 12 29.66 14 46.45 12 22.79
217 Beauveria brongniartii (Saccardo 1892) Petch 1926 6 19.50 6 33.01 5 10.92
218 Beauveria caledonica Bissett et Widden 1988 1 3.00 1 0.70
219 Beauveria felina (De Candolle 1815) J.W. Carmichael 1980 1 13.51 1 0.60
220 Benjaminiella poitrasii (R.K. Benjamin 1960) Arx 1981 2 19.56 2 38.65 2 46.30
221 Berkeleyomyces basicola (Berkeley et Broome 1850) W.J. Nel et al. 2017 2 19.51 2 39.60
222 Bionectria ochroleuca (Schweinitz 1832) Schroers et Samuels 1997 1 26.61
223 Bipolaris australiensis (M.B. Ellis 1971) Tsuda et Ueyama 1981 6 19.30 14 49.80 2 8.53
224 Bipolaris bicolor (Mitra 1931) Shoemaker 1959 1 24.97
(continued)
Cryopreservation Freeze-drying Soil
Number of Max storage Number of Max storage Number of Max storage
No. Name of species strains time (years) strains time (years) strains time (years)
225 Bipolaris cynodontis (Marignoni 1909) Shoemaker 1959 4 19.12 4 49.79 1 8.43
226 Bipolaris sorokiniana (Saccardo 1890) Shoemaker 1959 4 19.35 8 49.80
227 Bipolaris spicifera (Bainier 1908) Subramanian 1971 1 23.92
228 Bipolaris victoriae (F. Meehan et H.C. Murphy 1946) Shoemaker 1959 1 17.47 1 26.99
229 Biscogniauxia nummularia (Bulliard 1790) Kuntze 1891 1 19.32 1 7.17 1 0.10
230 Bispora antennata (Persoon 1801) E.W. Mason 1953 2 19.16 3 27.07
231 Bispora betulina (Corda 1838) S. Hughes 1958 2 17.45 2 34.55
232 Bispora effusa Peck 1891 1 20.22 1 15.09
233 Bjerkandera adusta (Willdenow 1787) P. Karsten 1879 7 8.31
234 Blakeslea trispora Thaxter 1914 14 26.15 16 48.52 7 11.74
235 Blumeriella jaapii (Rehm 1907) Arx 1961 1 8.61 1 9.62
236 Boeremia hedericola (Durieu et Montagne 1855) Aveskamp et al. 2010 1 4.61
237 Boeremia lycopersici (Cooke 1885) Aveskamp et al. 2010 1 14.02
238 Botryodiplodia malorum (Berkeley 1836) Petrak et Sydow 1926 1 20.00
239 Botryosphaeria rhodina (Berkeley et M.A. Curtis 1889) Arx 1970 1 19.98 1 26.19 1 0.12
240 Botryosporium longibrachiatum (Oudemans 1890) Maire 1903 2 21.41
241 Botryotinia narcissicola (P.H. Gregory 1941) N.F. Buchwald 1949 1 18.96 1 28.02 1 0.11
242 Botryotinia polyblastis (P.H. Gregory 1938) N.F. Buchwald 1949 1 27.67
243 Botryotrichum piluliferum Saccardo et Marchal 1885 6 19.23 7 48.07
244 Botryotrichum verrucosum (Pugh et al. 1964) X. Wei Wang et Houbraken 1 17.82
2018
245 Botryoxylon geniculatum (Corda 1839) Ciferri 1962 1 17.71 1 28.41
246 Botrytis aclada Fresenius 1850 2 19.30 2 37.80
247 Botrytis anthophila Bondartsev 1913 2 19.20 2 40.66
248 Botrytis bifurcata J.H. Miller et al. 1958 1 6.88
249 Botrytis cinerea Persoon 1794 14 19.23 24 37.74
250 Botrytis convallariae (Klebahn 1930) Ondrej 1972 ex Boerema et Hamers 3 15.32 3 15.42
1988
251 Botrytis convoluta Whetzel et Drayton 1932 2 19.23 2 47.64
252 Botrytis fabae Sardina 1929 1 19.12
253 Botrytis galanthina (Berkeley et Broome 1873) Saccardo 1886 1 19.23 1 27.67
254 Botrytis gladiolorum Timmermans 1941 2 19.30 2 38.79
255 Botrytis hyacinthi Westerdijk et J.F.H. Beyma 1928 1 19.20
256 Botrytis lutescens Saccardo et Roumeguere 1882 1 19.20
257 Botrytis squamosa J.C. Walker 1925 1 19.33
258 Botrytis tulipae (Libert 1830) Lind 1913 1 19.50 1 13.16
259 Bovista pusilla (Batsch 1789) Persoon 1801 1 16.61
260 Brachysporium nigrum (Link 1824) S. Hughes 1958 1 20.58 1 26.08
261 Burgoa anomala (Hotson 1912) Goidanich 1937 1 8.98
262 Byssochlamys nivea Westling 1909 2 19.44 2 36.44 2 44.03
263 Cadophora fastigiata Lagerberg et Melin 1928 6 19.41 7 28.68
264 Cadophora luteo-olivacea (J.F.H. Beyma 1940) T.C. Harrington et McNew 3 0.54
2003
265 Cadophora malorum (Kidd et Beaumont 1924) W. Gams 2000 7 19.76 9 45.39
266 Cadophora melinii Nannfeldt 1934 1 19.49 5 45.37
267 Calcarisporium arbuscula Preuss 1851 4 1.99 5 28.45
268 Calcarisporium griseum Spegazzini 1902 3 17.70 3 27.88
269 Celosporium sp. 1 6.56
270 Cephalotrichum gorgonifer (Bainier 1907) Sandoval-Denis et al. 2016 1 17.70 1 27.05
271 Cephalotrichum microsporum (Saccardo 1878) P.M. Kirk 1984 3 11.54
272 Cephalotrichum purpureofuscum (Schweinitz 1832) S. Hughes 1 19.39 2 31.05
273 Cephalotrichum stemonitis (Persoon 1801) Nees 1809 4 19.41 10 36.99 1 5.68
274 Ceratellopsis equiseticola (Boudier 1917) Corner 1950 1 23.34
275 Ceratocystis adiposa (E.J. Butler 1906) C. Moreau 1952 1 0.10
276 Ceratocystis paradoxa (Dade 1928) C. Moreau 1952 2 19.85 2 40.51 2 26.12
277 Ceratocystis pilifera (Fries 1822) C. Moreau 1952 2 18.86 2 39.58
278 Cercospora armoraciae Saccardo 1876 1 20.34 1 17.87 1 0.53
279 Cercospora beticola Saccardo 1876 2 25.47
280 Cercospora carotae (Passerini 1887) Kaznowski et Siemaszko 1929 1 20.34 1 23.40
281 Cercospora rosicola Passerini 1875 1 16.67 1 22.04
282 Cercospora violae Saccardo 1876 1 23.85
283 Ceriporiopsis gilvescens (Bresadola 1908) Domanski 1963 1 12.58
284 Cerrena unicolor (Bulliard 1788) Murrill 1903 1 12.58
285 Chaetocladium brefeldii van Tieghem et G. Le Monnier 1873 2 17.59 2 38.59 2 16.98
286 Chaetocladium jonesii (Berkeley et Broome 1854) Fresenius 1863 1 23.67 1 27.42
287 Chaetocytostroma sp. 1 20.53
288 Chaetomidium pilosum (C. Booth et Shipton 1966) Arx 1975 1 14.46 1 43.99 1 24.33
289 Chaetomium amesii Sergeeva 1965 1 19.28 1 31.01 1 24.33
(continued)
Cryopreservation Freeze-drying Soil
Number of Max storage Number of Max storage Number of Max storage
No. Name of species strains time (years) strains time (years) strains time (years)
290 Chaetomium angustispirale Sergeeva 1956 1 19.28 1 43.64 1 23.33
291 Chaetomium aureum Chivers 1912 2 20.51 1 42.33 2 23.86
292 Chaetomium brasiliense Bat. et Pontual 1948 1 38.87
293 Chaetomium crispatum (Fuckel) Fuckel 1870 1 20.04
294 Chaetomium elatum Kunze 1817 3 20.51 3 43.64 3 24.33
295 Chaetomium fieberi Corda 1837 1 32.08 1 11.25
296 Chaetomium funicola Cooke 1873 1 19.28 1 26.15 1 0.72
297 Chaetomium globosum Kunze 1817 11 19.44 21 48.45 14 28.00
298 Chaetomium homopilatum Omvik 1953 1 19.33 2 35.37 2 0.32
299 Chaetomium indicum Corda 1840 1 19.28 2 42.28 1 23.47
300 Chaetomium megalocarpum Bainier 1910 2 19.28 2 43.64 2 23.47
301 Chaetomium nozdrenkoae Sergeeva 1961 1 18.87 1 35.25 1 0.11
302 Chaetomium perlucidum Sergeeva 1956 1 19.28 1 35.29 1 0.27
303 Chaetomium seminis-citrulli Sergeeva 1956 1 25.68 1 43.67 1 0.11
304 Chaetomium spirale Zopf 1881 1 19.28 1 37.32
305 Chaetomium subaffine Sergeeva 1961 1 19.28 1 35.29 1 23.47
306 Chaetomium subspirilliferum Sergeeva 1960 1 20.42 1 25.61 1 22.62
307 Chaetomium trilaterale Chivers 1912 1 11.80
308 Chaunopycnis alba W. Gams 1979 1 2.01
309 Chloridium caesium (Nees et T. Nees 1818) Réblová et Seifert 2016 1 27.64
310 Chloridium virescens (Persoon 1797) W. Gams et Holubova-Jechova 1976 1 19.67 1 30.31
var. caudigerum (Hoehnel 1903) W. Gams et Holubova-Jechova 1976
311 Chlorophyllum rhacodes (Vittadini 1835) Vellinga 2002 1 12.02
312 Choanephora conjuncta Couch 1925 1 3.78
313 Choanephora cucurbitarum (Berkeley et Ravenel 1875) Thaxter 1903 1 20.21 1 20.93
314 Choanephora infundibulifera (Currey 1873) Saccardo 1891 1 25.41 1 33.99
315 Chondrostereum purpureum (Persoon 1794) Pouzar 1959 1 20.10
316 Chordomyces antarcticus Bilanenko et al. 2015 6 8.00
317 Chromelosporium fulvum (Link 1824) McGinty et al. 1975 2 1.88 2 18.07
318 Chrysonilia sitophila (Montagne 1843) Arx 1981 1 43.95 1 22.14
319 Chrysosporium keratinophilum D. Frey 1959 ex J.W. Carmichael 1962 2 9.57 2 32.84 1 5.95
320 Chrysosporium lobatum Scharapov 1978 1 38.25 1 29.86
321 Chrysosporium lucknowense Garg 1966 6 5.62 6 22.03
322 Chrysosporium merdarium (Link 1818 ex Greville 1823) J.W. Carmichael 3 11.87 4 25.63 1 35.73
1962
323 Chrysosporium queenslandicum Apinis et R.G. Rees 1976 2 31.45 2 38.32 2 31.26
324 Chrysosporium tropicum J.W. Carmichael 1962 3 9.10 3 37.15 2 25.87
325 Chrysosporium undulatum P. Vidal et al. 1999 3 20.41 4 42.69 3 35.66
326 Circinella muscae (Sorokin 1870) Berlese et de Toni 1888 4 22.71 5 43.04 5 47.39
327 Circinella umbellata van Tieghem et G. Le Monnier 1873 1 19.68 1 40.08 1 37.94
328 Cistella sp. 2 1.87
329 Cladobotryum dendroides (Bulliard 1791) W. Gams et Hoozemans 1970 3 26.47 3 38.61 1 3.20
330 Cladobotryum multiseptatum de Hoog 1978 1 16.25
331 Cladobotryum varium Nees 1817 5 21.79 7 43.99 5 7.73
332 Cladobotryum verticillatum (Link 1809) S. Hughes 1958 2 43.99
333 Cladophialophora chaetospira (Grove 1886) Crous et Arzanlou 2007 1 33.14
334 Cladosporium aecidiicola Thuemen 1876 1 19.20 1 26.20
335 Cladosporium allicinum (Fries 1817: Fries 1832) Bensch et al. 2012 1 33.11
336 Cladosporium antarcticum K. Schubert et al. 2007 1 7.32
337 Cladosporium brevicompactum Pidoplichko et Deniak 1941 2 34.24
338 Cladosporium cladosporioides (Fresenius 1850) G.A. de Vries 1952 4 19.53 56 47.50 4 6.72
339 Cladosporium colocasiae Sawada 1916 1 19.35 1 19.16
340 Cladosporium cucumerinum Ellis et Arthur 1889 1 48.92
341 Cladosporium elegantulum Pidoplichko et Deniak 1938 2 26.47 1 7.58
342 Cladosporium gossypiicola Pidoplichko et Deniak 1941 2 34.83
343 Cladosporium halotolerans Zalar et al. 2007 2 28.46
344 Cladosporium herbarum (Persoon 1794) Link 1816 19 19.35 101 47.52 10 5.76
345 Cladosporium lycoperdinum Cooke 1883 1 41.76
346 Cladosporium macrocarpum Preuss 1848 4 19.01 5 47.72
347 Cladosporium pseudocladosporioides Bensch et al. 2010 1 23.56
348 Cladosporium sphaerospermum Penzig 1882 7 19.30 22 47.50 2 14.36
349 Cladosporium straminicola Pidoplichko et Deniak 1938 1 26.05
350 Cladosporium transchelii Pidoplichko et Deniak 1938 1 13.10
351 Clathrus archeri (Berkeley 1859) Dring 1980 1 1.65
352 Clavariadelphus pistillaris (Linnaeus 1753) Donk 1933 1 19.70
353 Claviceps paspali F. Stevens et J.G. Hall 1910 3 18.95
354 Claviceps purpurea (Fries 1823) Tulasne 1853 3 26.36 7 25.22
(continued)
Cryopreservation Freeze-drying Soil
Number of Max storage Number of Max storage Number of Max storage
No. Name of species strains time (years) strains time (years) strains time (years)
355 Clitocybe odora (Bulliard 1784) P. Kummer 1871 1 0.01
356 Clonostachys byssicola Schroers 2001 2 3.67
357 Clonostachys rosea (Link 1816) Schroers et al. 1999 f. catenulata (J.C. 8 20.68 8 34.61 3 19.96
Gilman et E.V. Abbott 1927) Schroers 2001
358 Clonostachys rosea (Link 1816) Schroers et al. 1999 f. rosea 17 19.47 18 42.09 16 15.09
359 Clonostachys solani (Harting 1846) Schroers et W. Gams 2001 2 1.65
360 Clonostachys solani (Harting 1846) Schroers et W. Gams 2001 f. nigrovirens 2 32.42 1 4.92
(J.F.H.Beyma 1931) Schroers 2001
361 Coemansia aciculifera Linder 1943 1 21.05
362 Cokeromyces recurvatus Poitras 1950 3 24.14 3 42.75 3 22.74
363 Colletoconis aecidiophila (Spegazzini 1886) de Hoog et al. 1978 1 16.87 1 30.04
364 Colletotrichum coccodes (Wallroth 1833) S. Hughes 1958 4 20.10
365 Colletotrichum dematium (Persoon 1801) Grove 1918 1 6.08
366 Colletotrichum gloeosporioides (Penzig 1882) Penzig et Saccardo 1884 2 19.33 4 37.54
367 Colletotrichum musae (Berkeley et M.A. Curtis 1874) Arx 1957 1 19.32 1 24.90
368 Colpoma quercinum (Persoon 1796) Wallroth 1823 1 37.71
369 Conidiobolus coronatus (Costantin 1897) Batko 1964 4 15.93
370 Conidiobolus thromboides Drechsler 1953 2 6.78
371 Coniochaeta verticillata (van Emden 1973) Dania García et al. 2006 1 18.96 1 39.44 1 0.10
372 Coniophora puteana (Schumacher 1803) P. Karsten 1868 4 12.02
373 Coniothyrium concentricum (Desmazieres 1840) Saccardo 1878 1 19.01 1 12.63
374 Coniothyrium hellebori Cooke et Massee 1886 1 17.70 1 27.85
375 Coniothyrium rosarum Cooke et Harkness 1882 2 19.40 2 16.28
376 Coniothyrium wernsdorffiae Laubert 1905 1 19.01 1 20.34
377 Coprinellus disseminatus (Persoon 1801) J.E. Lange 1938 1 32.89
378 Coprinellus ephemerus (Bulliard 1786) Redhead et al. 2001 1 32.87
379 Coprinellus micaceus (Bulliard 1785) Vilgalys et al. 2001 3 32.83
380 Coprinellus radians (Desmazieres 1828) Vilgalys et al. 2001 1 32.83
381 Coprinopsis atramentaria (Bulliard 1783) Redhead et al. 2001 2 32.83
382 Coprinopsis gonophylla (Quélet 1884) Redhead et al. 2001 2 22.97
383 Coprinopsis kimurae (Hongo et Aoki 1966) Redhead et al. 2001 1 7.92
384 Coprinus comatus (O.F. Mueller 1780) Persoon 1797 2 32.83
385 Coprinus domesticus (Bolton 1788) Gray 1821 1 27.36
386 Coprinus sterquilinus (Fries 1821) Fries 1838 2 32.87
387 Coriolopsis trogii (Berkeley 1850) Domanski 1974 1 34.10
388 Coriolus sp. 1 19.42
389 Cortinarius bulbosus Gray 1821 1 22.97
390 Cortinarius caperatus (Persoon 1796) Fries 1838 1 23.53
391 Corynascella inaequalis (Pidoplichko et al. 1973) Arx 1975 1 18.95 1 42.84 1 27.97
392 Corynascus sepedonium (C.W. Emmons 1932) Arx 1973 1 20.42 1 39.91 1 21.16
393 Cosmospora arxii (W. Gams 1971) Gräfenhan et Schroers 2011 1 16.01 1 35.44 1 0.53
394 Cosmospora berkeleyana (P. Karsten 1891) Gräfenhan et al. 2011 8 24.26 1 21.27
395 Cosmospora lavitskiae (Zhdanova 1966) Gräfenhan et Seifert 2011 1 4.33 1 30.12 1 0.09
396 Crassicarpon hotsonii Koukol 2016 1 13.43
397 Cryphonectria parasitica (Murrill 1906) M.E. Barr 1978 5 19.35 5 41.47 1 0.19
398 Cryptococcus depauperatus (Petch 1932) Boekhout et al. 2015 1 23.96
399 Cunninghamella blakesleeana Lendner 1927 3 14.1 2 13.81
400 Cunninghamella echinulata (Thaxter 1891) Thaxter ex Blakeslee1905 13 25.18 15 42.96 12 49.77
401 Cunninghamella homothallica Kominami et Tubaki 1952 1 20.08
402 Cunninghamella japonica (Saito 1905) Pidoplichko et Milko 1971 6 25.18 7 37.02 6 35.84
403 Cunninghamella vesiculosa P.C. Misra 1966 1 21.95
404 Curvularia clavata B.L. Jain 1962 1 13.68
405 Curvularia comoriensis Bouriquet et Jauffret 1955 ex M.B. Ellis 1966 1 17.80 1 26.87
406 Curvularia fallax Boedijn 1933 1 13.60
407 Curvularia geniculata (Tracy et Earle 1896) Boedijn 1933 4 19.30 5 45.17
408 Curvularia inaequalis (Shear 1907) Boedijn 1933 5 19.76 6 28.20 1 4.33
409 Curvularia kusanoi (Y. Nisikado 1928) Manamgoda et al. 2014 1 18.74
410 Curvularia lunata (Wakker 1898) Boedijn 1933 6 19.35 9 44.30
411 Curvularia nodulosa (Saccardo 1886) Manamgoda et al. 2014 1 23.88
412 Curvularia protuberata Nelson et Hodges 1965 1 13.50
413 Cyathus olla (Batsch 1783) Persoon 1801 1 14.05
414 Cylindrium cordae Grove 1886 1 27.86 1 3.49
415 Cylindrocarpon album (Saccardo 1877) Wollenweber 1917 1 17.67 1 34.66 1 3.51
416 Cylindrocarpon chlamydospora Schischkina et Tzanava 1973 1 19.97 1 18.49
417 Cylindrocarpon congoense J.A. Meyer 1958 1 19.56 1 28.46 1 2.49
418 Cylindrocarpon destructans (Zinssmeister 1918) Scholten 1964 6 15.66 12 21.12 2 2.43
419 Cylindrocarpon didymum (Hartig 1846) Wollenweber 1926 2 19.56 3 21.12
420 Cylindrocarpon gracile Bugnicourt 1939 3 29.09 3 1.25 1 3.07
(continued)
Cryopreservation Freeze-drying Soil
Number of Max storage Number of Max storage Number of Max storage
No. Name of species strains time (years) strains time (years) strains time (years)
421 Cylindrocarpon heteronema (Berkeley et Broome 1865) Wollenweber 1916 3 19.53 4 28.67 1 2.49
422 Cylindrocarpon lucidum C. Booth 1966 1 20.70
423 Cylindrocarpon obtusisporum (Cooke et Harkness 1884) Wollenweber 1926 1 25.95 1 18.94 1 2.45
424 Cylindrocarpon peronosporae (Fautrey et Lambotte 1896) Rudakov 1981 1 37.38 1 0.08
425 Cylindrocarpon tenue Bugnicourt 1939 1 3.81
426 Cylindrocephalum stellatum (Harz 1871) Saccardo 1886 1 12.09 1 38.72 1 3.20
427 Cylindrophora alba Bonorden 1851 1 19.78
428 Cylindrophora hoffmannii Daszewska 1912 1 17.73 1 28.06 1 5.65
429 Cytospora sp. 1 1.21
430 Dacrymyces stillatus Nees 1816 1 6.62
431 Dactylaria acerosa Matsushima 1975 1 0.77
432 Dactylaria dimorphospora Veenbaas-Rijks 1973 1 16.10 1 23.58
433 Dactylellina asthenopaga (Drechsler 1937) M. Scholler et al.1999 1 19.30 1 0.08
434 Daedalea quercina (Linnaeus 1753) Persoon 1801 2 34.05
435 Daedaleopsis confragosa (Bolton 1791) J. Schröter 1888 var. confragosa 1 10.36
436 Dematioscypha delicata (Berkeley et Broome 1859) Hosoya 2014 1 19.38 1 26.79
437 Dendrodochium toxicum Pidoplichko et Bilai 1947 1 19.33 1 28.29 1 4.79
438 Dendrostilbella macrospora W. Bally 1917 1 7.72 1 14.23 1 4.92
439 Dendrostilbella mycophila (Persoon 1822) Seifert 1985 1 37.05 1 2.89
440 Dendryphion nanum (Nees 1816) S. Hughes 1958 1 24.14 1 0.53
441 Dendryphion penicillatum (Corda 1838) Fries 1846 1 24.88 2 3.44
442 Dichobotrys sp. 1 19.28 1 18.88
443 Dichotomomyces cejpii (Milko 1964) D.B. Scott 1970 1 18.96 1 19.72 1 23.17
444 Dictyostelium discoideum (Bosc 1811) E. Fischer 1888 1 5.75 1 24.44
445 Dictyuchus monosporus Leitgeb 1870 2 12.57
446 Dicyma ampullifera Boulanger 1897 1 19.21 1 12.36
447 Dicyma olivacea (Emoto et Tubaki 1970) Arx 1982 1 19.40 1 48.10
448 Dicyma ovalispora (S. Hughes 1951) Arx 1982 1 6.69 1 12.32
449 Didymella glomerata (Corda 1840) Q. Chen et L. Cai 2015 11 19.47 8 46.45
450 Didymella musae (P. Joly 1961) Q. Chen et L. Cai 2015 4 19.59
451 Didymella pinodella (L.K. Jones 1927) Q. Chen et L. Cai 2015 1 20.54
452 Didymella pinodes (Berkeley et A. Bloxam 1861) Petrak 1924 1 19.22 1 22.41
453 Didymella pomorum (Thümen 1879) Q. Chen et L. Cai 2015 4 19.56 4 46.45
454 Didymopsis helvellae (Corda 1854) Saccardo et Marchall 1885 1 28.44 1 2.73
455 Dimargaris bacillispora R.K. Benjamin 1959 1 19.37 1 8.30
456 Dinemasporium strigosum (Persoon 1801) Saccardo 1881 1 17.80 1 20.15
457 Diplocladium majus Bonorden 1851 2 21.84 2 38.61 2 2.84
458 Diplocladium penicilloides Saccardo 1886 2 27.21 2 3.73
459 Diplodina acerina (Passerini 1875) B. Sutton 1980 1 6.56
460 Dipodascopsis tothii (Zsolt 1963) L.R. Batra et Millner 1978 1 42.60 1 0.10
461 Dipodascopsis uninucleata (Biggs 1937) L.R. Batra et Millner 1978 var. 2 4.03 2 42.60
uninucleata
462 Dipodascus aggregatus Francke-Grosmann 1952 2 18.88 2 42.63 2 0.10
463 Dipodascus armillariae W. Gams 1983 1 19.62 1 15.67
464 Discula brunneotingens E.I. Meyer 1953 1 20.32 1 29.45
465 Discula pinicola (Naumov 1926) Petrak 1927 var. mammosa Lagerberg et al. 1 19.33 1 39.74
1927
466 Dispira cornuta van Tieghem 1875 1 21.05
467 Dissoacremoniella silvatica Kirilenko 1970 1 28.88 1 22.90
468 Dothiora prunorum (Dennis et Buhagiar 1973) Crous 2016 1 16.93 1 27.42
469 Drechmeria coniospora (Drechsler 1941) W. Gams et H.-B. Jansson 1985 1 13.88 1 22.04
470 Drechslera avenacea (M.A. Curtis ex Cooke 1889) Shoemaker 1959 2 37.32
471 Drechslera campanulata (Leveille 1841) B. Sutton 1976 3 19.38 2 23.17
472 Drechslera poae (Baudys 1916) Shoemaker 1962 1 33.87
473 Duddingtonia flagrans (Duddington 1949) R.C. Cooke 1969 1 19.32 1 18.30 1 2.49
474 Echinobotryum rubrum Sorokin ex Jaczewski 1917 1 25.93 1 0.08
475 Eladia saccula (E. Dale 1926) G. Smith 1961 1 20.56 1 44.21
476 Emericellopsis alkalina Bilanenko et Georgieva 2013 3 7.77
477 Emericellopsis donezkii Beliakova 1974 7 20.48 7 46.22 6 0.09
478 Emericellopsis glabra (J.F.H. Beyma 1940) Backus et Orpurt 1961 1 19.33 3 46.54
479 Emericellopsis humicola (Cain 1956) Gilman 1956 1 19.33 1 48.87 1 23.47
480 Emericellopsis maritima Beliakova 1970 1 14.88 1 17.90
481 Emericellopsis minima Stolk 1955 10 20.42 10 46.48 9 22.75
482 Emericellopsis pallida Beliakova 1974 1 20.44 1 49.00 1 23.10
483 Emericellopsis robusta van Emden et W. Gams 1971 2 44.91
484 Emericellopsis terricola J.F.H. Beyma 1940 1 19.33 1 49.00 1 0.10
485 Engyodontium album (Limber 1940) de Hoog 1978 2 23.78 3 18.23
(continued)
Cryopreservation Freeze-drying Soil
Number of Max storage Number of Max storage Number of Max storage
No. Name of species strains time (years) strains time (years) strains time (years)
486 Entomophthora dipterigena (Thaxter 1888) Saccardo et Traverso 1891 1 26.20
487 Entomophthora thaxteriana I.M. Hall et J. Bell 1963 5 23.20
488 Entyloma gaillardianum Vanky 1982 1 12.35 1 18.84
489 Epicoccum nigrum Link 1815 5 19.81 11 35.51
490 Epicoccum sorghinum (Saccardo 1878) Aveskamp et al. 2010 4 3.29
491 Epithyrium obscurum (Passerini 1885) Saccardo 1931 1 11.05
492 Eremascus fertilis Stoppel 1907 1 18.86 1 5.73
493 Eremothecium ashbyi Guilliermond 1935 5 17.32
494 Eremothecium gossypii (S.F. Ashby et W. Nowell 1926) Kurtzman 1995 2 16.33
495 Eupenicillium pinetorum Stolk 1968 1 0.10
496 Eurotium amstelodami L. Mangin 1909 16 43.08 9 46.64
497 Eurotium chevalieri L. Mangin 1909 8 42.86 5 46.87
498 Eurotium halophilicum C.M. Christensen et al. 1959 1 28.92 1 0.10
499 Eurotium herbariorum (F.H. Wiggers 1780) Link 1809 1 18.88 18 37.95 1 21.57
500 Eurotium rubrum Jos. König et al. 1901 7 43.26 6 37.41
501 Eurotium tonophilum Ohtsuki 1962 1 20.01 1 39.91 1 19.77
502 Eutypa sp. 1 0.04 1 2.69
503 Evlachovaea kintrischica B. Borisov et Tarasov 1999 1 15.54
504 Exobasidium bisporum Sawada ex Ezuka 1991 1 23.62 1 1.64
505 Exobasidium karstenii Saccardo et Trotter 1912 1 23.62
506 Exobasidium myrtilli Siegmund 1879 1 19.46 1 1.64
507 Exobasidium pachysporum Nannfeldt 1981 1 2.04
508 Exobasidium vaccinii (Fuckel 1861) Woronin 1867 2 23.62 2 1.81
509 Exophiala castellanii Iwatsu et al. 1984 2 20.40 2 23.19
510 Exophiala heteromorpha (Nannfeldt 1934) de Hoog et Haase 2003 1 19.54 1 21.63
511 Exophiala lecanii-corni (Benedek et Specht 1933) Haase et de Hoog 1999 1 18.56
512 Exophiala moniliae de Hoog 1977 1 18.56
513 Exophiala salmonis J.W. Carmichael 1966 1 17.78 1 10.32
514 Exophiala xenobiotica de Hoog et al. 2006 3 2.11
515 Exserohilum pedicellatum (A.W. Henry 1924) K.J. Leonard et Suggs 1974 1 19.48 1 40.52
516 Exserohilum rostratum (Drechsler 1923) K.J. Leonard et Suggs 1974 1 18.33
517 Farlowiella carmichaeliana (Berkeley 1836) Saccardo 1891 1 26.00 1 3.49
518 Farrowia seminuda (L.M. Ames 1949) D. Hawksworth 1975 1 38.09
519 Fennellomyces linderi (Hesseltine et Fennell 1955) Benny et R.K. Benjamin 1 19.64 1 15.02 1 29.69
1975
520 Fibroporia vaillantii (de Candolle 1815) Parmasto 1968 1 20.10
521 Flammulina velutipes (Curtis 1782) Singer 1951 6 34.05
522 Fomes fomentarius (Linnaeus 1753) J.J. Kickx 1867 4 34.14
523 Fomitopsis pinicola (Swartz 1810) P. Karsten 1881 8 20.04 1 0.99
524 Fomitopsis rosea (Albertini et Schweinitz 1805) P. Karsten 1881 1 20.10
525 Fonsecaea pedrosoi (Brumpt 1922) Negroni 1936 1 19.72 1 39.24
526 Fulvia fulva (Cooke 1883) Ciferri 1954 3 19.01 3 22.51
527 Fusarium agaricorum Sarrazin 1887 1 17.67 1 27.21 1 2.62
528 Fusarium aquaeductuum (Rabenhorst et Radlkofer 1861) Lagerheim et 3 0.19 2 33.19 2 2.52
Rabenhorst 1891
529 Fusarium aquaeductuum (Rabenhorst et Radlkofer 1861) Lagerheim et 1 23.04 1 5.64
Rabenhorst 1891 var. medium Wollenweber 1931
530 Fusarium arthrosporioides Sherbakoff 1915 1 13.96 1 21.18
531 Fusarium avenaceum (Fries 1832) Saccardo 1886 4 19.99 3 44.73 3 14.34
532 Fusarium avenaceum (Fries 1832) Saccardo 1886 var. herbarum (Corda 1 26.39 1 2.90
1839) Saccardo 1886
533 Fusarium cerealis (Cooke 1878) Saccardo 1886 1 2.21 1 26.52
534 Fusarium chlamydosporum Wollenweber et Reinking 1925 2 29.57
535 Fusarium concolor Reinking 1935 1 1.88 2 16.36
536 Fusarium culmorum (W.G. Smith 1884) Saccardo 1895 3 17.67 3 32.72 3 11.43
537 Fusarium decemcellulare Brick 1908 2 19.50 2 44.40 2 11.93
538 Fusarium epistroma (Hoehnel 1909) C. Booth 1971 2 32.43 2 3.04
539 Fusarium equiseti (Corda 1838) Saccardo 1886 5 19.28 7 44.85 3 26.61
540 Fusarium expansum Schlechtendal 1824 1 29.47 1 2.68
541 Fusarium fujikuroi Nirenberg 1976 1 7.65 1 39.07 1 24.70
542 Fusarium graminearum Schwabe 1839 4 15.66 4 35.19 3 3.98
543 Fusarium graminearum Schwabe 1839 f. oxalis 1 38.91 1 7.09
544 Fusarium heterosporum Nees et T. Nees 1818 3 31.04 1 7.09
545 Fusarium heterosporum Nees et T. Nees 1818 var. pucciniophilum Saccardo 1 17.73 1 23.19 1 2.62
et Sydow 1899
546 Fusarium incarnatum (Roberge 1849) Saccardo 1886 4 16.56 4 28.98 4 2.97
547 Fusarium javanicum Koorders 1907 2 13.36 2 35.60 2 7.90
548 Fusarium lateritium Nees 1816 7 20.47 8 39.14 4 21.85
(continued)
Cryopreservation Freeze-drying Soil
Number of Max storage Number of Max storage Number of Max storage
No. Name of species strains time (years) strains time (years) strains time (years)
549 Fusarium merismoides Corda 1838 3 17.90 3 33.20 1 3.64
550 Fusarium oxysporum Schlechtendal 1824 14 31.06 28 38.36 7 24.51
551 Fusarium oxysporum Schlechtendal 1824 f. sp. batatas (G.F. Atkinson 1892) 1 18.10 1 25.21
W.C. Snyder et H.N. Hansen 1940
552 Fusarium oxysporum Schlechtendal 1824 f. sp. conglutinans W.C. Snyder et 2 23.35 1 25.52
H.N. Hansen 1940
553 Fusarium oxysporum Schlechtendal 1824 f. sp. lycopersici W.C. Snyder et 2 29.35 2 23.85
H.N. Hansen 1940
554 Fusarium oxysporum Schlechtendal 1824 f. sp. vasinfectum W.C. Snyder et 1 25.04 1 26.69
H.N. Hansen 1940
555 Fusarium poae (Peck 1903) Wollenweber 1913 3 17.81 4 45.15 3 12.68
556 Fusarium redolens Wollenweber 1913 3 21.67 3 21.54
557 Fusarium sambucinum Fuckel 1863 11 7.69 9 37.19 7 13.96
558 Fusarium sambucinum Fuckel 1863 var. ossicola (Berkeley et M.A.Curtis 1 11.59 1 0.73
1875) Bilai 1955
559 Fusarium sarcochroum (Desmazieres 1850) Saccardo 1879 1 4.99 1 21.31 1 2.90
560 Fusarium solani (Martius 1842) Saccardo 1881 12 16.16 23 34.24 10 16.90
561 Fusarium sporotrichioides Sherbakoff 1915 6 17.73 6 47.20 6 18.61
562 Fusarium tricinctum (Corda 1838) Saccardo 1886 7 17.47 7 37.16 4 4.75
563 Fusarium ventricosum Appel et Wollenweber 1913 3 29.13 2 12.68
564 Fusarium verticillioides (Saccardo 1881) Nirenberg 1976 25 30.64 26 42.97 23 28.25
565 Fusarium viride (Lechmere 1912) Wollenweber 1917 1 17.67 1 23.96 1 2.62
566 Fusarium wolgense Rodigin 1942 1 37.26 1 3.04
567 Fusicladium peltigericola Crous et Diederich 2010 1 2.12
568 Fusicladium pomi (Fries 1825) Lind 1913 1 19.82
569 Fusicoccum castaneum Saccardo 1882 1 11.21
570 Fusicolla epistroma (Höhn. 1909) Gräfenhan and Seifert 2011 1 3.70
571 Gabarnaudia betae (Delacroix 1897) Samson et W. Gams 1974 2 11.05 3 33.00
572 Gaeumannomyces caricis J. Walker 1980 1 5.62
573 Gaeumannomyces graminis (Saccardo 1875) Arx et D.L. Olivier 1952 var. 1 25.68
graminis
574 Galactomyces geotrichum (E.E. Butler et L.J. Petersen 1972) Redhead et 3 45.89 3 3.45
Malloch 1977
575 Galactomyces reessii (van der Walt 1959) Redhead et Malloch 1977 1 19.27 1 46.16 1 3.45
576 Ganoderma lipsiense (Batsch 1786) G.F. Atkinson 1908 3 17.39
577 Ganoderma lucidum (Curtis 1781) P. Karsten 1881 1 9.55
578 Geastrum fimbriatum Fries 1829 1 16.63
579 Geomyces asperulatus Sigler et J.W. Carmichael 1976 1 8.54
580 Geomyces pannorum (Link 1824) Sigler et J.W. Carmichael 1976 38 20.25 166 39.85 8 3.20
581 Geosmithia lavendula (Raper et Fennell 1948) Pitt 1980 1 44.17 1 5.31
582 Geosmithia namyslowskii (K.M. Zalessky 1927) Pitt 1980 1 43.86 1 22.92
583 Geotrichum amycelicum Redaelli et Ciferri 1935 1 18.86 1 11.15
584 Geotrichum bipunctatum Rolland et Fautrey 1894 1 38.59 1 2.90
585 Geotrichum candidum Link 1809 24 31.24 42 45.14 15 2.90
586 Geotrichum fragrans (Berkhout 1923) Morenz 1960 ex Morenz 1964 4 16.13 4 31.67 1 10.53
587 Geotrichum klebahnii (Stautz 1931) Morenz 1964 3 19.79 3 29.62
588 Gibberella fujikuroi (Sawada 1917) Wollenweber 1931 3 19.32 3 26.87 3 30.36
589 Gibberella zeae (Schweinitz 1821) Petch 1936 2 19.77 3 16.40 1 6.20
590 Gibellula pulchra Cavara 1894 1 6.13
591 Gibellulopsis nigrescens (Pethybridge 1919) Zare et al. 2007 6 41.27 6 13.62
592 Gilbertella persicaria (E.D. Eddy 1925) Hesseltine 1960 1 11.41 1 27.13 1 37.52
593 Gilmaniella humicola G.L. Barron 1964 2 13.68
594 Gliocephalotrichum bulbilium J.J. Ellis et Hesseltine 1962 1 15.86
595 Gliocladiopsis tenuis (Bugnicourt 1939) Crous et M.J. Wingfeld 1993 1 14.46
596 Gliocladium album (Preuss 1851) Petch 1926 2 26.90 2 2.49
597 Gliocladium ammoniphilum Pidoplichko et Bilai 1953 1 19.26 1 28.55 1 9.57
598 Gliocladium aurifilum (W. Gerard 1874) Seifert et al. 1985 1 0.54 1 14.41
599 Gliocladium cholodnyi Pidoplichko 1931 2 16.15 2 26.27 2 9.13
600 Gliocladium comtus Rudakov 1981 1 7.81 1 30.99 1 3.73
601 Gliocladium viride Matruchot 1893 4 32.23 1 3.32
602 Gliomastix cerealis (P. Karsten 1887) C.H. Dickinson 1968 2 19.22 2 36.53 1 10.70
603 Gliomastix inflata C.H. Dickinson 1968 2 23.17 2 3.22
604 Gliomastix luzulae (Fuckel 1870) E.W. Mason 1953 ex S. Hughes 1958 2 6.22 3 29.44 3 2.74
605 Gliomastix murorum (Corda 1838) S. Hughes 1958 var. felina (Marchal 5 30.42 6 44.79 4 9.25
1895) S. Hughes 1958
606 Gliomastix murorum (Corda 1838) S. Hughes 1958 var. murorum 10 30.71 9 33.64 6 14.07
607 Gloeophyllum odoratum (Wulfen 1788) Imazeki 1943 1 23.78
608 Gloeophyllum sepiarium (Wulfen 1786) P. Karsten 1882 5 34.14
609 Gongronella butleri (Lendner 1926) Peyronel et Dal Vesko 1955 6 24.55 6 32.12 3 5.42
(continued)
Cryopreservation Freeze-drying Soil
Number of Max storage Number of Max storage Number of Max storage
No. Name of species strains time (years) strains time (years) strains time (years)
610 Gongronella lacrispora Hesseltine et J.J. Ellis 1961 1 15.38 1 27.66
611 Gonytrichum macrocladum (Saccardo 1880) S. Hughes 1951 3 17.68 4 30.36
612 Graphium penicillioides Corda 1837 1 18.14
613 Graphium putredinis (Corda 1839) S. Hughes 1958 1 23.88
614 Grifola frondosa (Dickson 1785) Gray 1821 2 12.58
615 Guepiniopsis buccina (Persoon 1801) L.L. Kennedy 1959 1 25.88
616 Gymnoascus reessii Baranetzky 1872 1 36.56 1 3.35
617 Gymnopilus sapineus (Fries 1821) Murrill 1912 1 22.97
618 Gymnostellatospora japonica Udagawa 1993 1 2.30
619 Hansfordia pulvinata (Berkeley et M.A. Curtis 1875) S. Hughes 1958 2 19.44 2 26.42
620 Hansfordia triumfettae (Hahsford 1943) S. Hughes 1952 1 27.00
621 Haplotrichum capitatum (Link 1809) Link 1824 2 30.60 2 30.56 2 25.26
622 Hapsidospora milkoi Beliakova 1975 1 2.27 1 34.82 1 23.86
623 Harposporium lilliputanum Dixon 1952 1 19.30 1 21.69
624 Harposporium sinense C.Y. Wang et K.Q. Zhang 2007 1 20.85
625 Harzia acremonioides (Harz 1871) Costantin 1888 4 19.49 4 45.20
626 Hebeloma versipelle (Fries 1838) Gillet 1876 1 22.96 1 6.77
627 Helicodendron tubulosum (Riess 1853) Linder 1929 1 19.31 1 11.44
628 Helicostylum elegans Corda 1842 1 17.59 1 44.19 1 15.39
629 Helicostylum pulchrum (Preuss 1851) Pidoplichko et Milko 1971 2 25.41 2 27.11 2 38.98
630 Helminthosporium solani Durieu et Montagne 1849 1 19.61 1 9.56
631 Hemicarpenteles ornatum (Subramanian 1972) Arx 1974 1 39.58 1 5.09
632 Hericium coralloides (Scopoli 1772) Persoon 1794 4 32.55
633 Hericium erinaceus (Bulliard 1781) Persoon 1797 4 25.07
634 Hesseltinella vesiculosa H.P. Upadhyay 1970 1 21.26 1 40.75
635 Heterobasidion annosum (Fries 1821) Brefeld 1888 1 20.10
636 Hirsutella thompsonii F.E. Fischer 1950 1 15.26
637 Holwaya mucida (Schulzer 1860) Korf et Abawi 1971 var. mucida 1 2.30
638 Hormiactis alba Preuss 1851 1 23.26 1 2.73
639 Hormoconis resinae (Lindau 1906) Arx et G.A. de Vries 1973 12 19.49 12 47.50 2 17.28
640 Hormonema macrosporum L. Voronin 1986 1 19.81 1 26.36
641 Humicola fuscoatra Traaen 1914 3 28.79 4 32.96 1 33.60
642 Humicola grisea Traaen 1914 var. thermoidea Cooney et Emerson 1964 1 11.62
643 Humicola insolens Cooney et R. Emerson 1964 1 16.82
644 Hydnoporia tabacina (Sowerby 1797) V. Spirin et al. 2019 1 19.56
645 Hyphopichia burtonii (Boidin et al. 1964) Arx et Van der Walt 1976 1 38.10
646 Hyphozyma sanguinea (C. Ramirez 1952) de Hoog et M.T. Smith 1981 1 28.74 1 20.45
647 Hyphozyma variabilis de Hoog et M.T. Smith 1981 2 19.30
648 Hyphozyma variabilis de Hoog et M.T. Smith 1981 var. odora de Hoog et M. 1 21.64
T. Smith 1981
649 Hyphozyma variabilis de Hoog et M.T. Smith 1981 var. variabilis 1 20.45
650 Hypomyces ochraceus (Persoon 1801) Tulasne et C. Tulasne 1865 3 22.53
651 Inocutis dryophila (Berkeley 1904) Fiasson et Niemelä 1984 1 20.73
652 Inonotus obliquus (Acharius ex Persoon 1801) Pilat 1942 2 34.08
653 Inonotus rheades (Persoon 1825) Bondartsev et Singer 1941 2 15.29
654 Irpex lacteus (Fries 1818) Fries 1828 1 12.40
655 Isaria farinosa (Holmskjold 1781) Fries 1832 7 20.34 8 35.81 3 18.38
656 Isaria fumosorosea Wize 1904 6 21.44 6 43.70 1 2.32
657 Isaria javanica (Friedrichs et Bally 1923) Samson et Hywel-Jones 2005 1 6.21
658 Isaria tenuipes Peck 1879 1 6.84
659 Juxtiphoma eupyrena (Saccardo 1879) Valenzuela-Lopez et al. 2017 3 17.62
660 Kickxella alabastrina Coemans 1862 1 6.69 1 6.46
661 Kuehneromyces lignicola (Peck 1872) Redhead 1984 1 23.50
662 Kuehneromyces mutabilis (Schaeffer 1774) Singer et A.H. Smith 1946 6 24.26
663 Laccaria bicolor (Maire 1937) P.D. Orton 1960 1 14.95
664 Laccaria laccata (Scopoli 1772) Cooke 1884 2 22.96
665 Lactarius helvus (Fries 1821) Fries 1838 1 24.01
666 Laetiporus sulphureus (Bulliard 1789) Murrill 1920 6 19.99 1 8.56
667 Lasiodiplodia theobromae Patouillard 1892) Griffon et Maublanc 1909 1 7.36 1 17.95
668 Lecanicillium dimorphum (J.D. Chen 1985) Zare et W. Gams 2001 2 38.36
669 Lecanicillium fungicola (Preuss 1851) Zare et W. Gams 2008 3 20.40 3 39.64
670 Lecanicillium fusisporum (W. Gams 1971) Zare et W. Gams 2001 1 25.03
671 Lecanicillium lecanii (Zimmermann 1898) Zare et W. Gams 2001 4 19.84 4 39.18 1 4.47
672 Lecanicillium longisporum (Petch 1925) Zare et W. Gams 2001 1 19.26 1 37.00 1 2.54
673 Lecanicillium muscarium (Petch 1931) Zare et W. Gams 2001 14 22.33 15 36.34 3 4.97
674 Lecanicillium psalliotae (Treschew 1941) Zare et W. Gams 2001 6 20.44 7 36.72
675 Leccinum scabrum (Bulliard 1783) Gray 1821 1 12.08
(continued)
Cryopreservation Freeze-drying Soil
Number of Max storage Number of Max storage Number of Max storage
No. Name of species strains time (years) strains time (years) strains time (years)
676 Lecythophora decumbens (J.F.H. Beyma 1942) E. Weber et al. 2002 1 20.40 1 38.10
677 Lecythophora fasciculata (J.F.H. Beyma 1939) E. Weber et al. 2002 1 20.40 1 42.03
678 Lecythophora hoffmannii (J.F.H. Beyma 1939) W. Gams et McGinnis 1983 3 20.52 5 42.40
679 Lecythophora mutabilis (J.F.H. Beyma 1944) W. Gams et McGinnis 1983 1 20.40 4 45.70
680 Lentinula edodes (Berkeley 1878) Pegler 1976 5 26.21
681 Lentinus sulcatus Berkeley 1845 1 12.13
682 Lentinus tigrinus (Bulliard 1782) Fries 1825 3 20.98
683 Lenzites betulina (Linnaeus 1753) Fries 1838 3 13.47
684 Lepista luscina (Fries 1818) Singer 1951 1 0.21
685 Lepista nuda (Bulliard 1790) Cooke 1871 1 1.82
686 Leptobacillium leptobactrum (W. Gams 1971) Zare et W. Gams 2016 2 3.35 2 21.46
687 Leptographium lundbergii Lagerberg et Melin 1927 1 11.42
688 Leptosphaeria coniothyrium (Fuckel 1870) Saccardo 1875 1 18.96 1 6.03
689 Leucoagaricus leucothites (Vittadini 1835) Wasser 1977 1 3.04
690 Leucoagaricus nympharum (Kalchbrenner 1873) Bon 1977 1 12.07
691 Leuconeurospora pulcherrima (G. Winter 1876) Malloch et Cain 1970 1 0.54
692 Lichtheimia blakesleeana (Lendner 1924) Kerst. Hoffmann et al. 2009 4 28.53 4 44.36 4 48.92
693 Lichtheimia corymbifera (Cohn 1884) Vuillemin 1903 12 23.06 18 40.93 18 50.21
694 Lichtheimia hyalospora (Saito 1906) Kerst. Hoffmann et al. 2009 1 19.38 1 19.04 1 29.82
695 Linderina pennispora Raper et Fennell 1952 1 11.78 1 46.29
696 Lobosporangium transversale (Malloch) M. Blackwell et Benny 2004 1 7.17
697 Lycoperdon perlatum Persoon 1796 1 21.10
698 Lycoperdon pyriforme Schaeffer 1774 2 20.04
699 Macrolepiota mastoidea (Fries 1821) Singer 1951 1 12.20
700 Macrolepiota procera (Scopoli 1772) Singer 1948 1 12.32
701 Macrophoma mantegazziana (Penzig 1882) Berlese et Voglino 1886 1 0.97 1 26.65
702 Magnusiomyces magnusii (F. Ludwig 1886) Redhead et Malloch 1977 1 31.43 1 0.11
703 Malbranchea flavorosea Sigler et J.W. Carmichael 1976 1 7.19
704 Mammaria echinobotryoides Cesati 1854 1 1.99
705 Marasmius oreades (Bolton 1792) Fries 1836 1 34.16
706 Mariannaea elegans (Corda 1838) Samson 1974 6 31.50 6 45.32 4 9.56
707 Melanconium apiocarpum Link 1825 2 18.22 1 24.70
708 Melanconium bicolor Nees 1817 1 24.70
709 Melanocarpus albomyces (Cooney et R. Emerson 1964) Arx 1975 2 18.61 2 34.85
710 Melanospora betae Panasenko 1938 1 4.07 1 44.99 1 22.75
711 Melanospora damnosa (Saccardo 1895) Lindau 1897 2 29.97 2 22.29
712 Melanospora phaseoli Roll-Hansen 1948 1 0.12 1 45.85
713 Memnoniella echinata (Rivolta 1884) Galloway 1933 2 20.54 3 32.39
714 Menispora ciliata Corda 1837 1 19.25 1 45.78
715 Menispora tortuosa Corda 1839 1 9.82
716 Merimbla ingelheimense (J.F.H. Beyma 1942) Pitt 1980 2 36.14 1 22.89
717 Metarhizium anisopliae (Metschnikoff 1879) Sorokin 1883 6 19.56 6 32.32 4 15.82
718 Microascus cirrosus Curzi 1930 1 19.32
719 Microascus trigonosporus C.W. Emmons et B.O. Dodge var. terreus 1 20.42 1 36.69 1 21.16
Kamyschko 1966
720 Microbotryum silenes-inflatae (de Candolle 1815 ex Liro 1924) G. Deml et 2 26.41 2 19.05
Oberwinkler 1982
721 Microbotryum vinosum (Tulasne et C. Tulasne 1847) Denchev 1994 1 23.70 1 19.05
722 Microbotryum violaceum (Persoon 1797) G. Deml et Oberwinkler 1982 2 21.38 2 19.05
723 Microdiplodia pruni Diedicke 1914 1 19.90 1 9.94
724 Microdochium nivale (Fries 1825) Samuels et I.C. Hallett 1983 1 6.04 1 31.05 1 23.41
725 Microsphaeropsis olivacea (Bonorden 1869) Höhnell 1917 1 19.40 1 12.05
726 Mirandina corticola G. Arnaud 1952 ex Matsushima 1975 1 19.27 1 31.46
727 Monascus floridanus P.F. Cannon et E.L. Barnard 1987 1 6.75
728 Monilia brunnea J.C. Gilman et E.V. Abbott 1927 1 15.22 1 27.24
729 Monilia diversispora J.F.H. Beyma 1933 1 15.22 1 35.69
730 Monilia medoacensis (Saccardo 1913) J.F.H. Beyma 1933 1 28.21
731 Monilia megalospora (Berkeley et M.A. Curtis 1869) Saccardo 1886 1 26.72 1 22.73
732 Moniliella suaveolens (Lindner 1895 ex Lindner 1906) Arx 1972 var. nigra 4 15.42 4 23.99
(Burri et Staub 1909) de Hoog 1979
733 Moniliella suaveolens (Lindner 1895 ex Lindner 1906) Arx 1972 var. 1 18.97 1 35.38
suaveolens
734 Monilinia fructigena (Aderhold et Ruhland 1905) Honey 1936 2 20.03
735 Monochaetia concentrica (Berkeley et Broome 1874) Saccardo et D. 1 9.21
Saccardo 1906
736 Monochaetia dimorphospora T. Yokoyama 1975 1 24.55
737 Monochaetia karstenii (Corda 1839) Nag Raj 1985 3 13.39
738 Monocillium dimorphosporum W. Gams 1971 2 27.09
(continued)
Cryopreservation Freeze-drying Soil
Number of Max storage Number of Max storage Number of Max storage
No. Name of species strains time (years) strains time (years) strains time (years)
739 Monocillium indicum S.B. Saksena 1955 1 16.32 2 15.10
740 Monocillium nordinii (Bourchier 1961) W. Gams 1971 1 19.84 2 22.59
741 Monocillium tenue W. Gams 1971 2 24.20 1 0.53
742 Monodictys paradoxa (Corda 1938) S. Hughes 1958 1 17.68 1 11.72
743 Monosporium meliolicola Spegazzini 1910 1 23.10
744 Mortierella alliacea Linnemann 1953 1 13.86
745 Mortierella alpina Peyronel 1913 5 21.33 3 43.35 2 27.46
746 Mortierella ambigua B.S. Mehrotra 1963 1 11.73 1 35.99
747 Mortierella angusta Linnemann 1969 1 23.44
748 Mortierella beljakovae Milko 1973 1 3.79
749 Mortierella bisporalis (Thaxter 1914) Bjoerling 1936 2 13.09 2 2.74
750 Mortierella capitata Marchal 1891 1 21.26 1 35.16 1 13.30
751 Mortierella dichotoma Linnemann 1936 ex W. Gams 1977 1 22.23 1 25.53 1 1.08
752 Mortierella elasson Sideris et G.E. Paxton 1929 2 10.95 2 5.88
753 Mortierella elongata Linnemann 1941 2 28.89 5 4.40
754 Mortierella exigua Linnemann 1941 3 34.07 3 36.68
755 Mortierella gamsii Milko 1974 7 18.90
756 Mortierella gemmifera M. Ellis 1940 3 23.25 5 25.48 2 21.69
757 Mortierella globalpina W. Gams et Veenbaas-Rijks 1976 1 13.86
758 Mortierella globulifera O. Rostrup 1916 3 33.28 1 2.76 2 41.39
759 Mortierella horticola Linnemann 1941 2 32.84
760 Mortierella humilis Linnemann 1936 ex W. Gams 1977 5 14.00
761 Mortierella hyalina (Harz 1871) W. Gams 1970 var. hyalina 3 23.57 2 31.26 3 1.08
762 Mortierella jenkinii (A.L. Smith 1898) Naumov 1935 3 13.28 2 36.62
763 Mortierella lignicola (G.W. Martin 1937) W. Gams et R. Moreau 1959 1 13.97 1 45.23 1 23.94
764 Mortierella minutissima van Tieghem 1878 4 34.13 3 14.31 1 1.02
765 Mortierella mutabilis Linnemann 1941 2 22.07 2 14.53
766 Mortierella nigrescens van Tieghem 1878 1 18.26
767 Mortierella oligospora Bjoerling 1936 1 27.05 1 2.52 1 1.08
768 Mortierella parvispora Linnemann 1941 6 33.99 5 27.66 4 22.30
769 Mortierella polycephala Coemans 1863 1 24.88
770 Mortierella pulchella Linnemann 1941 1 23.24 1 25.48
771 Mortierella pusilla Oudemans 1902 1 33.99 1 25.11
772 Mortierella reticulata van Tieghem et G. Le Monnier 1873 1 6.98 1 45.16 1 45.75
773 Mortierella sarnyensis Milko 1973 1 13.86
774 Mortierella sclerotiella Milko 1967 1 22.97
775 Mortierella strangulata van Tieghem 1875 1 3.79 1 25.26
776 Mortierella stylospora Dixon-Stewart 1932 1 19.96 1 27.89 1 34.43
777 Mortierella turficola Y. Ling 1930 1 11.03
778 Mortierella verticillata Linnemann 1941 8 23.25 8 39.71 4 24.60
779 Mortierella zonata Linnemann 1936 ex W. Gams 1977 1 13.96 1 5.09
780 Mortierella zychae Linnemann 1941 5 26.76 5 31.68 3 20.46
781 Mucobasispora tarikii Moustafa et Abdul-Wahid 1990 1 23.92
782 Mucor abundans Povah 1917 1 24.09 1 29.37 1 5.99
783 Mucor aligarensis B.S. Mehrotra et B.R. Mehrotra 1969 1 23.28
784 Mucor amphibiorum Shipper 1978 1 15.38 1 27.73 1 0.58
785 Mucor bacilliformis Hesseltine 1954 1 20.55 1 28.79
786 Mucor bainieri B.S. Mehrotra et Baijal 1963 1 20.70 1 32.41
787 Mucor circinelloides van Tieghem 1875 var. circinelloides 15 25.31 17 44.90 14 45.75
788 Mucor circinelloides van Tieghem 1875 var. janssenii (Lendner 1907) 6 22.62 7 44.93 6 49.10
Schipper 1976
789 Mucor circinelloides van Tieghem 1875 var. lusitanicus (Bruderlein 1916) 6 25.18 8 44.18 7 28.44
Schipper 1976
790 Mucor durus G. Walther et de Hoog 2013 1 19.68 1 42.97 1 37.90
791 Mucor exponens (Burgeff 1924) G. Walther et de Hoog 2013 4 25.41 4 30.87
792 Mucor flavus Bainier 1903 19 28.49 19 47.04 16 26.71
793 Mucor fragilis Bainier 1884 1 24.09 1 37.17 1 30.73
794 Mucor fuscus Bainier 1903 3 20.68 3 45.03 3 32.05
795 Mucor genevensis Lendner 1908 4 25.31 4 37.18
796 Mucor griseocyanus Hagem 1908 3 25.41 3 38.26 3 24.30
797 Mucor guilliermondii Nadson et Philippow 1925 1 24.48 1 37.53 1 30.03
798 Mucor heterogamus Vuillemin 1903 1 27.33 1 1.66
799 Mucor hiemalis Wehmer 1903 var. corticolus (Hagem 1910) Schipper 1973 3 20.71 3 43.93 2 9.59
800 Mucor hiemalis Wehmer 1903 var. hiemalis 18 33.53 19 46.92 14 45.95
801 Mucor hiemalis Wehmer 1903 var. silvaticus (Hagem 1908) Schipper 1973 3 20.56 3 38.71 3 2.61
802 Mucor inaequisporus Dade 1937 1 19.64 1 39.72 1 0.10
803 Mucor indicus Lendner 1930 3 33.53 3 40.30 3 47.89
(continued)
Cryopreservation Freeze-drying Soil
Number of Max storage Number of Max storage Number of Max storage
No. Name of species strains time (years) strains time (years) strains time (years)
804 Mucor laxorrhizus Y. Ling 1930 5 19.59 5 31.36 5 20.52
805 Mucor luteus Linnemann 1936 2 19.66 2 41.88 2 16.22
806 Mucor megaolocarpus G. Walther et de Hoog 2013 1 19.75 1 9.93
807 Mucor microsporus Namyslowski 1910 1 19.57 1 28.08
808 Mucor moelleri (Vuillemin 1903) Lendner 1908 5 23.57 5 47.23 5 14.60
809 Mucor mousanensis Baijal et B.S. Mehrotra 1966 1 19.70 1 45.34 1 24.54
810 Mucor mucedo Linnaeus 1753 9 25.41 9 46.64 7 29.90
811 Mucor odoratus Treschew 1940 2 25.31 2 16.18
812 Mucor piriformis A. Fischer 1892 5 25.41 5 35.21
813 Mucor plasmaticus van Tieghem 1875 1 19.68 1 44.21 1 5.23
814 Mucor plumbeus Bonorden 1864 11 24.15 18 40.64 16 49.99
815 Mucor psychrophilus Milko 1971 1 25.41 1 14.88
816 Mucor racemosus Fresenius 1850 var. chibinensis (Neophytova 1955) 2 11.86 4 40.59 3 34.29
Schipper 1976
817 Mucor racemosus Fresenius 1850 var. racemosus 23 24.25 34 43.94 29 50.21
818 Mucor racemosus Fresenius 1850 var. sphaerosporus (Hagem 1908) 3 25.41 3 44.91 3 47.36
Schipper 1970
819 Mucor ramosissimus Samoutsevitch 1927 1 19.64 1 17.67
820 Mucor saturninus Hagem 1910 1 20.72 1 35.92 1 8.11
821 Mucor sinensis Milko et Beliakova 1971 2 21.24 2 36.82 2 33.55
822 Mucor strictus Hagem 1908 2 24.09 2 32.51 2 8.38
823 Mucor ucrainicus Milko 1971 1 23.18 1 25.68
824 Mucor zonatus Milko 1967 2 19.75 2 27.40 1 5.69
825 Mucor zychae Baijal et B.S. Mehrotra 1965 var. zychae 2 25.31 2 44.13
826 Mutinus caninus (Hudson 1778) Fries 1849 1 13.37
827 Myceliophthora fergusii (Klopotek 1974) Oorschot 1977 2 7.38
828 Myceliophthora lutea Costantin 1892 1 34.75 1 3.73
829 Myceliophthora thermophila (Apinis 1962) van Oorschot 1977 3 20.51 3 20.37 2 19.25
830 Mycena epipterygia (Scopoli 1772) Gray 1821 1 12.20
831 Mycena pura (Persoon 1794) P. Kummer 1871 1 34.16
832 Mycogone cervina Ditmar 1817 1 19.86
833 Mycogone nigra (Morgan 1895) C.N. Jensen 1912 4 19.54 4 47.62
834 Mycogone rosea Link 1809 4 19.38 4 38.41
835 Mycosticta cytosporicola Frolov 1968 2 17.68 2 37.24
836 Mycotypha africana R.O. Novak et Backus 1963 1 21.41
837 Mycotypha indica P.M. Kirk et Benny 1985 1 22.42
838 Myrothecium sp. 2 19.19 2 43.47
839 Myxotrichum setosum (Eidam 1882) G.F. Orr et Plunkett 1963 2 38.43
840 Myxotrichum stipitatum (Eidam 1882) G.F. Orr et Kuehn 1963 1 4.07 1 45.26
841 Nadsoniella nigra Issatschenko 1914 var. hesuelica Lyakh et Ruban 1970 1 18.86 1 12.62
842 Nakataea sigmoidea (Cavara 1889) Hara 1939 1 19.31
843 Nectria cosmariospora Cesati et de Notaris 1863 2 18.95 2 35.78 2 3.45
844 Nectria inventa Pethybridge 1919 1 27.90 1 3.49
845 Nematogonum mycophilum (Saccardo 1886) Rogerson et W. Gams 1981 1 21.73 1 20.12
846 Neoantrodia serialis (Fries 1821) Audet 2017 1 17.47
847 Neocamarosporium betae (Berlese 1888) Ariyawansa et K.D. Hyde 2015 2 19.33 2 34.74
848 Neocosmospora vasinfecta E.F. Smith 1899 var. africana (von Arx 1955) 2 20.10 2 48.22
Cannon et D. Hawksworth 1984
849 Neonectria galligena (Bresadola 1901) Rossman et Samuels 1999 1 18.96
850 Neoscytalidium dimidiatum (Penzig 1887) Crous et Slippers 2006 1 19.40
851 Neottiospora caricina (Desmazieres 1836) Hoehnel 1924 1 31.07
852 Neovossia setariae (Ling 1945) Yu et Lou 1962 1 19.41
853 Neurospora crassa Shear et B.O. Dodge 1927 71 18.95 77 44.92 9 23.18
854 Neurospora sitophila Shear et B.O. Dodge 1927 4 19.44 4 42.28 4 22.14
855 Neurospora toroi F.L. Tai 1935 1 18.97 1 41.71 1 21.16
856 Newbya pascuicola M.C. Vick et M.W. Dick 2002 1 20.71
857 Niesslia exilis (Albertini et Schweinitz 1805) G. Winter 1885 1 18.96 1 7.35 1 4.37
858 Nigrospora gorlenkoana Novobranova 1972 2 19.47 2 39.55
859 Nigrospora gossypii Jaczewski 1929 1 17.47 1 33.25
860 Nigrospora oryzae (Berkeley et Broome 1873) Petch 1924 4 42.86 1 35.79
861 Nodulisporium verrucosum (J.F.H. Beyma 1929) G. Smith 1954 1 19.72
862 Nomuraea rileyi (Farlow 1883) Samson 1974 1 9.85 1 12.70
863 Ochrocladosporium elatum (Harz 1871) Crous et U. Braun 2007 1 12.58 1 27.80 1 7.91
864 Ochroconis constricta (E.V. Abbott 1927) de Hoog et Arx 1973 1 18.32
865 Oedocephalum sp. 1 15.56 1 28.99 1 15.98
866 Oidiodendron cereale (Thuemen 1880) G.L. Barron 1962 5 0.18 4 28.60
867 Oidiodendron echinulatum G.L. Barron 1962 2 19.58 2 31.49
868 Oidiodendron griseum Robak 1934 2 13.34
(continued)
Cryopreservation Freeze-drying Soil
Number of Max storage Number of Max storage Number of Max storage
No. Name of species strains time (years) strains time (years) strains time (years)
869 Oidiodendron periconioides Morrall 1968 1 1.79
870 Oidiodendron sulphureoochraceum 1 1.95
871 Oidiodendron truncatum G.L. Barron 1962 3 8.70
872 Olpitrichum sp. 1 20.47 1 19.95 1 2.49
873 Oospora nicotianae Pezzolato 1899 1 19.77 1 29.63 1 2.89
874 Oospora oryzae Ferraris 1902 1 19.95 1 1.05 1 2.90
875 Oospora sajanica Ogarkov 1979 1 16.12 1 25.73
876 Oospora sulphurea (Preuss 1852) Saccardo et Voglino 1886 1 28.81 1 19.34
877 Oospora sulphurella (Saccardo et Roumeguere 1881) Saccardo 1886 1 19.56 1 26.34
878 Oospora tenuis (P. Maze 1910) Berkhout 1923 1 31.12 1 30.92 1 0.09
879 Oospora variabilis (Lindner 1898) J. Lindau 1907 1 19.86 1 14.69
880 Ophiostoma piceae (Münch 1907) Sydow et P. Sydow 1919 2 22.04
881 Ovadendron sulphureo-ochraceum (J.F.H. Beyma 1933) Sigler et J.W. 1 19.79 1 43.59
Carmichael 1976
882 Paecilomyces borysthenicus B.A. Borisov et Tarasov 1997 2 5.07 2 12.90
883 Paecilomyces carneus (Duche et R. Heim 1931 ) A.H.S. Brown et G. Smith 2 4.41 2 8.12 2 0.21
1957
884 Paecilomyces fulvus Stolk et Samson 1971 1 5.53
885 Paecilomyces inflatus (Burnside 1927) J.W. Carmichael 1962 3 8.19
886 Paecilomyces marquandii (Massee 1898) S. Hughes 1951 4 19.56 5 44.40 3 21.91
887 Paecilomyces penicillatus (Höhnel 1904) Samson 1974 1 5.44
888 Paecilomyces suffultus (Petch 1944) Samson 1974 1 6.10
889 Paecilomyces variotii Bainier 1907 20 19.41 30 45.44 16 47.90
890 Paecilomyces zollerniae Stolk et Samson 1971 1 12.37 1 12.56
891 Panus conchatus (Bulliard 1787) Fries 1838 1 23.84
892 Papulaspora biformospora Kirilenko 1971 1 19.64 1 20.69
893 Paraconiothyrium fuckelii (Saccardo 1878) Verkley et Gruyter 2012 1 9.65
894 Paraconiothyrium sporulosum (W. Gams et Domsch 1969) Verkley 2004 2 19.40 2 16.28
895 Paradendryphiella salina (G.K. Sutherland 1916) Woudenberg et Crous 4 10.24
2013
896 Paramyrothecium roridum (Tode 1790) L. Lombard et Crous 2016 3 19.49 4 45.17
897 Paraphoma fimeti (Brunaud 1889) Gruyter et al. 2010 6 2.11
898 Parasitella parasitica (Bainier 1884) Sydow 1903 2 33.43 2 46.09
899 Penicillium adametzii K.M. Zalessky 1927 4 40.39 4 45.81
900 Penicillium albicans Bainier 1907 2 22.03 2 37.14
901 Penicillium albidum Sopp 1912 1 4.99 1 0.95
902 Penicillium alicantinum C. Ramirez et A.T. Martinez 1980 1 38.03 1 12.20
903 Penicillium anatolicum Stolk 1968 1 33.19 1 15.32
904 Penicillium aragonense C. Ramirez et A.T. Martinez 1981 1 38.03 1 12.20
905 Penicillium arenicola Chalabuda 1950 1 22.92 1 26.18
906 Penicillium atramentosum Thom 1910 1 21.02 1 2.56
907 Penicillium aurantioflammiferum C. Ramirez et al. 1980 1 27.31 1 12.20
908 Penicillium aurantiogriseum Dierckx 1901 9 20.52 62 44.47 36 42.96
909 Penicillium bilaiae Chalabuda 1950 1 43.15 1 18.52
910 Penicillium brevicompactum Dierckx 1901 6 20.50 23 45.39 15 18.10
911 Penicillium brunneum Udagawa 1959 1 37.98 1 12.07
912 Penicillium camemberti Thom 1906 11 42.00 10 24.37
913 Penicillium canescens Sopp 1912 31 20.50 60 47.85 44 49.17
914 Penicillium capsulatum Raper et Fennell 1948 2 19.51 3 44.92 3 28.71
915 Penicillium castellonense C. Ramirez et A.T. Martinez 1981 1 38.03 1 12.20
916 Penicillium chermesinum Biourge 1923 4 42.92 4 45.97
917 Penicillium chrysogenum Thom 1910 17 18.95 96 45.01 53 55.63
918 Penicillium cinerascens Biourge 1923 1 41.75 1 28.22
919 Penicillium citreonigrum Dierckx 1901 3 18.95 13 43.65 10 46.51
920 Penicillium citrinum Thom 1910 9 18.31 27 45.08 17 33.21
921 Penicillium commune Thom 1910 10 2.52 23 44.45 22 38.12
922 Penicillium coprophilum (Berkeley et M.A. Curtis 1868) Seifert et Samson 2 0.98
1986
923 Penicillium cordubense C. Ramirez et A.T. Martinez 1981 1 38.01 1 12.20
924 Penicillium corylophilum Dierckx 1901 3 28.97 2 15.77
925 Penicillium crustosum Thom 1930 31 45.20 10 47.85
926 Penicillium cyaneum (Bainier et R. Sartory 1913) Biourge 1923 ex Thom 1 44.58 1 9.56
1930
927 Penicillium daleae K.M. Zalessky 1927 1 2.27 2 29.98 1 22.64
928 Penicillium decumbens Thom 1910 4 18.08 17 43.07 8 37.99
929 Penicillium dierckxii Biourge 1923 2 18.31 7 44.77 7 28.88
930 Penicillium digitatum (Persoon 1801) Saccardo 1881 3 44.23 3 21.28
931 Penicillium diversum Raper et Fennell 1948 3 40.50 1 38.07
(continued)
Cryopreservation Freeze-drying Soil
Number of Max storage Number of Max storage Number of Max storage
No. Name of species strains time (years) strains time (years) strains time (years)
932 Penicillium dodgei Pitt 1980 1 27.75 1 12.58
933 Penicillium duclauxii Delacroix 1892 7 44.65 7 32.90
934 Penicillium expansum Link 1809 27 42.88 7 41.58
935 Penicillium fagi A.T. Martinez et C. Ramirez 1978 1 38.05 1 12.07
936 Penicillium fellutanum Biourge 1923 3 1.96 1 1.15
937 Penicillium funiculosum Thom 1910 5 20.50 14 44.53 9 38.16
938 Penicillium glabrum (Wehmer 1893) Westling 1911 23 40.77 9 31.15
939 Penicillium gladioli Machacek 1928 2 20.46 2 36.75 2 7.91
940 Penicillium glaucum Link 1805 1 20.52 1 44.50 1 48.00
941 Penicillium grancanariae C. Ramirez et al. 1978 1 38.05 1 5.70
942 Penicillium granulatum Bainier 1905 17 45.20 5 21.61
943 Penicillium griseofulvum Dierckx 1901 11 43.90 8 43.32
944 Penicillium herqueri Bainier et R. Sartory 1912 4 45.41 4 28.33
945 Penicillium hirayamae Udagawa 1959 1 20.37 1 20.18
946 Penicillium hirsutum Dierckx 1901 var. hirsutum 1 2.77 1 5.41
947 Penicillium hispanicum C. Ramirez et al. 1978 1 38.05 1 12.07
948 Penicillium humuli J.F.H. Beyma 1937 1 44.47 1 47.94
949 Penicillium ilerdanum C. Ramirez et al. 1980 1 26.66 1 12.20
950 Penicillium indonesiae Pitt 1980 2 38.31 2 37.22
951 Penicillium inflatum Stolk et Malla 1971 2 2.95 1 0.15
952 Penicillium insectivorum (Sopp 1912) Biourge 1923 1 44.21 1 38.19
953 Penicillium islandicum Sopp 1912 1 2.23 3 33.12 3 23.12
954 Penicillium italicum Wehmer 1894 3 39.11 3 22.63
955 Penicillium janczewskii K.M. Zalessky 1927 13 44.47 8 47.96
956 Penicillium jensenii K.M. Zalessky 1927 9 47.35 8 43.44
957 Penicillium lagena (Delitsch 1943) Stolk et Samson 1983 3 19.46 4 39.10 4 25.92
958 Penicillium lanosum Westling 1911 3 44.45 3 38.02
959 Penicillium lapidosum Raper et Fennell 1948 5 44.45 4 42.21
960 Penicillium lehmanii Pitt 1980 2 40.41 2 47.99
961 Penicillium lineatum Pitt 1980 1 10.51 1 11.55
962 Penicillium lividum Westling 1911 15 38.20 1 15.33
963 Penicillium malacaense C. Ramirez et A.T. Martinez 1980 1 38.01 1 12.20
964 Penicillium martensii Biourge 1923 var. moldavicum Solovei 1975 1 2.27 1 20.16 1 10.71
965 Penicillium megasporum Orpurt et Fennell 1955 3 20.18 2 20.34
966 Penicillium melanoconidium Dierckx 1901 2 12.89 2 0.10
967 Penicillium melinii Thom 1930 1 3.99 6 41.94 4 37.14
968 Penicillium miczynskii K.M. Zalessky 1927 1 4.02 7 43.38 6 47.84
969 Penicillium minioluteum Dierckx 1901 37 38.03 2 12.20
970 Penicillium mirabile Beliakova et Milko 1972 1 36.90 1 9.56
971 Penicillium multicolor Grigorieva-Manoilova et Poradielova 1915 1 42.24 1 20.77
972 Penicillium multicolor Novobranova 1972 1 12.94 1 15.09
973 Penicillium murcianum C. Ramirez et A.T. Martinez 1981 1 31.98 1 32.01
974 Penicillium nalgiovense Laxa 1932 7 9.24 7 0.08
975 Penicillium novae-zeelandiae J.F.H. Beyma 1940 5 44.78 5 9.70
976 Penicillium ochrochloron Biourge 1923 7 44.30 5 26.52
977 Penicillium olivicolor Pitt 1980 1 0.32
978 Penicillium olsonii Bainier et R. Sartory 1912 2 0.95
979 Penicillium onobense C. Ramirez et A.T. Martinez 1981 1 38.05 1 12.20
980 Penicillium ovetense C. Ramirez et A.T. Martinez 1981 1 38.03 1 12.20
981 Penicillium oxalicum Currie et Thom 1915 6 38.05 6 38.11
982 Penicillium palitans Westling 1911 9 9.63 4 0.25
983 Penicillium palmense C. Ramirez et al. 1978 1 38.05 1 12.20
984 Penicillium paxilli Bainier 1907 3 19.51 8 44.47 7 18.52
985 Penicillium phoeniceum J.F.H. Beyma 1933 4 44.92 4 15.02
986 Penicillium piceum Raper et Fennell 1948 1 20.55 3 41.96 3 47.78
987 Penicillium pinophilum Thom 1910 3 37.80 2 32.70
988 Penicillium polonicum K.M. Zalessky 1927 6 6.49 6 0.08
989 Penicillium purpurogenum Stoll 1904 19 46.91 9 50.92
990 Penicillium quercetorum Baghdadi 1968 1 4.06 1 44.72 1 38.26
991 Penicillium raistrickii G. Smith 1933 5 36.68 3 20.13
992 Penicillium resticulosum Birkinshaw et al. 1942 1 26.72 1 44.28
993 Penicillium restrictum J.C. Gilman et E.V. Abbott 1927 2 18.31 14 44.23 8 38.51
994 Penicillium roqueforti Thom 1906 7 3.99 16 45.00 15 43.04
995 Penicillium roseopurpureum Dierckx 1901 8 44.69 5 28.62
996 Penicillium rubrum Stoll 1904 5 20.50 13 45.08 13 43.02
997 Penicillium rugulosum Thom 1910 3 28.56 23 44.08 17 43.08
998 Penicillium sclerotiorum J.F.H. Beyma 1937 7 42.22 7 34.33
(continued)
Cryopreservation Freeze-drying Soil
Number of Max storage Number of Max storage Number of Max storage
No. Name of species strains time (years) strains time (years) strains time (years)
999 Penicillium severskii Schechovtsov 1981 1 11.10 1 5.72
1000 Penicillium simplicissimum (Oudemans 1903) Thom 1930 3 18.31 26 45.25 19 47.55
1001 Penicillium solitum Westling 1911 13 18.00 15 44.01 15 38.32
1002 Penicillium spinulosum Thom 1910 6 4.02 25 43.47 17 46.00
1003 Penicillium terraconense C. Ramirez et A.T. Martinez 1980 1 38.04 1 2.55
1004 Penicillium thomii Maire 1917 4 2.27 9 42.32 9 36.25
1005 Penicillium thymicola Frisvad et Samson 2004 1 6.41 1 0.31
1006 Penicillium turbatum Westling 1911 1 28.44 1 43.16
1007 Penicillium turolense C. Ramirez et A.T. Martinez 1981 1 38.04 1 12.20
1008 Penicillium umbonatum Sopp 1912 1 32.95
1009 Penicillium valentinum C. Ramirez et A.T. Martinez 1980 1 38.03 1 12.20
1010 Penicillium vanbeymae Pitt 1980 1 42.32 1 7.00
1011 Penicillium variabile Sopp 1912 37 42.19 17 42.68
1012 Penicillium vasconiae C. Ramirez et A.T. Martinez 1980 1 37.93 1 12.20
1013 Penicillium velutinum J.F.H. Beyma 1935 11 44.65 10 38.52
1014 Penicillium verrucosum Dierckx 1901 6 0.58 18 42.32 9 32.75
1015 Penicillium verruculosum Peyronel 1913 14 18.08 23 42.33 13 28.85
1016 Penicillium vinaceum J.C. Gilman et E.V. Abbott 1927 4 44.59 4 43.16
1017 Penicillium viridicatum Westling 1911 5 6.06 1 0.09
1018 Penicillium vulpinum (Cooke et Massee 1888) Seifert et Samson 1985 10 44.53 10 42.56
1019 Penicillium waksmanii K.M. Zalessky 1927 1 2.27 10 44.57 4 47.96
1020 Penicillium westlingii K.M. Zalessky 1927 1 29.52 1 21.65
1021 Penicillium zacinthae C. Ramírez et A.T. Martínez 1981 1 26.64 1 12.20
1022 Penidiella sp. 5 2.10
1023 Perenniporia medulla-panis (Jacquin 1778) Donk 1967 1 18.55
1024 Periconia igniaria E.W. Mason et M.B. Ellis 1953 1 9.90
1025 Periconia macrospinosa Lefebvre et Aar.G. Johnson 1949 2 19.49 2 28.22
1026 Periconiella cocoes M.B. Ellis 1967 1 18.12
1027 Pestalotia pezizoides de Notaris 1841 2 19.86 2 39.30
1028 Pestalotiopsis guepinii (Desmazieres 1840) Steyaert 1949 6 10.76
1029 Pestalotiopsis sydowiana (Bresadola 1895) B. Sutton 1961 1 19.29
1030 Petriella sordida (Zukal 1890) G.L. Barron et J.C. Gilman 1961 1 10.23
1031 Phacidium lacerum Fries 1818 1 0.33
1032 Phaeococcomyces nigricans (Rich et Stern 1958) de Hoog 1979 1 23.58 1 0.53
1033 Phaeoisaria triseptata Holubova-Jechova 1988 1 18.69
1034 Phaeosphaeria sp. 1 1.56
1035 Phallus hadriani Ventenat 1798 1 29.07
1036 Phallus impudicus Linnaeus 1753 var. togatus (Kalchbrenner 1883) 3 21.77
Costantin et L.M. Dufour 1895
1037 Phanerochaete sanguinea (Fries 1828) Pouzar 1973 1 3.25
1038 Phellinus igniarius (Linnaeus 1753) Quelet 1886 6 21.17
1039 Phellinus lundellii Niemelae 1972 3 20.02
1040 Phellinus populicola Niemelae 1975 3 27.22
1041 Phialophora atrovirens (J.F.H. Beyma 1935) Schol-Schwarz 1970 1 20.40 1 28.65
1042 Phialophora bubakii (Laxa 1930) Schol-Schwarz 1970 2 20.42 10 36.70
1043 Phialophora cyclaminis J.F.H. Beyma 1942 2 6.36
1044 Phialophora lagerbergii (Melin et Nannfeldt 1934) Conant 1937 1 19.38 1 13.60
1045 Phialophora melinii (Nannfeldt 1934) Conant 1937 13 5.86
1046 Phialophora verrucosa Medlar 1915 1 19.76 1 19.52
1047 Phlebia ochraceofulva (Bourdot et Galzin 1911) Donk 1957 1 16.82
1048 Phlebia rufa (Persoon 1801) M.P. Christiansen 1960 1 14.95
1049 Phlebia tremellosa (Schrader 1794) Nakasone et Burdsall 1984 2 19.68
1050 Phlebiopsis gigantea (Fries 1815) Juelich 1978 3 20.04
1051 Pholiota adiposa (Batsch 1786) P. Kummer 1871 1 20.10
1052 Pholiota aurivella (Batsch 1786) P. Kummer 1871 1 19.72
1053 Pholiota lenta (Persoon 1801) Singer 1951 2 14.04
1054 Pholiota microspora (Berkeley 1850) Saccardo 1887 1 8.08
1055 Phoma herbarum Westendorp 1852 5 4.99
1056 Phoma leveillei Boerema et G.J. Bollen 1975 4 13.49
1057 Phoma lingam (Tode 1791) Desmazieres 1849 4 19.59
1058 Phomatospora sp. 1 18.86 1 26.61
1059 Phomopsis castanea (Saccardo 1879) Petrak 1921 1 11.21
1060 Phomopsis castaneae Moriondo 1963 1 11.10
1061 Phomopsis helianthi Muntanola-Cvetcovic et al. 1981 1 8.26 1 5.68
1062 Phycomyces blakesleeanus Burgeff 1925 8 24.13 8 31.79 2 1.51
1063 Phycomyces nitens (C. Agardh 1823) Kunze 1823 2 23.06 2 43.00 1 0.34
1064 Phyllosticta castaneae Ellis et Everhart 1894 1 11.05
(continued)
Cryopreservation Freeze-drying Soil
Number of Max storage Number of Max storage Number of Max storage
No. Name of species strains time (years) strains time (years) strains time (years)
1065 Phyllosticta pucciniospila C. Massalongo 1900 1 11.45 1 23.98
1066 Phytophthora cactorum (Lebert et Cohn 1870) J. Schroeter 1886 1 17.05
1067 Phytophthora capsici Leonian 1922 2 28.12
1068 Phytophthora cinnamomi Rands 1922 4 18.78
1069 Phytophthora cryptogea Pethybridge et Lafferty 1919 1 18.03
1070 Phytophthora drechsleri Tucker 1931 3 26.22
1071 Phytophthora megasperma Drechsler 1931 1 0.19
1072 Pidoplitchkoviella terricola Kirilenko 1975 1 20.22 1 42.69
1073 Piedraia hortae Fonseca et Leao 1928 2 19.35 1 34.74 1 23.85
1074 Piedraia hortae Fonseca et Leao 1928 var. paraguayensis Fonseca et Leao 1 32.46 1 0.11
1928
1075 Piedraia sarmentoi M.J. Pereira 1930 1 19.35 1 25.02 1 21.46
1076 Pilaira anomala (Cesati 1851) J. Schroeter 1886 1 26.00 1 1.11
1077 Pilaira caucasica Milko 1970 1 24.12 1 16.20
1078 Pilaira moreaui Y. Ling 1926 1 23.57 1 27.53
1079 Pilobolus crystallinus (F.H. Wiggers 1780) Tode 1784 1 15.64
1080 Pilobolus longipes van Tieghem 1878 1 3.68 1 15.64
1081 Pilobolus umbonatus Buller 1934 1 15.65
1082 Piptoporus betulinus (Bulliard 1788) P. Karsten 1881 3 26.12
1083 Pirella circinans Bainier 1882 2 24.09 1 46.10 1 14.40
1084 Pirella circinans Bainier 1882 var. volgogradensis (Milko 1974) Benny et 1 37.71
Schipper 1988
1085 Pirella naumovii (Milko 1970) Benny et Schipper 1992 1 19.32 1 15.35 1 46.87
1086 Pithoascus schumacheri (E.C. Hansen 1877) Arx 1973 1 0.32
1087 Plectosphaerella cucumerina (Lindfors 1919) W. Gams 1968 1 20.79 1 39.44
1088 Plenodomus tracheiphila (Petri 1929) Gruyter et al. 2013 1 12.56
1089 Pleotrichocladium opacum (Corda 1837) Hernández-Restrepo et al. 2017 3 19.43 4 32.79
1090 Pleurocytospora sp. 1 7.59
1091 Pleurodesmospora coccorum (Petch 1924) Samson et al. 1980 1 28.25
1092 Pleurophoma cava (Schulzer 1871) Boerema 1996 3 19.81 3 44.72
1093 Pleurotus cornucopiae (Paulet 1793) Rolland 1910 1 20.02
1094 Pleurotus eryngii (De Candolle 1815) Quelet 1872 1 18.92
1095 Pleurotus ostreatus (Jacquin 1774) P. Kummer 1871 70 34.08
1096 Pleurotus pulmonarius (Fries 1821) Quelet 1872 4 8.16
1097 Pochonia bulbillosa (W. Gams et Malla 1988) Zare et W. Gams 2001 5 19.99 7 28.36 2 2.72
1098 Pochonia chlamydosporia (Goddard 1913) Zare et W. Gams 2001 7 19.47 7 31.72
1099 Poitrasia circinans (H. Naganishi et N. Kawakami 1955) P.M. Kirk 1984 1 20.08 1 44.36
1100 Polycephalomyces tomentosus (Schrad. 1799) Seifert 1985 1 19.54 1 40.41 1 1.55
1101 Polyporus ciliatus Fries 1815 1 10.36
1102 Polyporus tomentosus Fries 1821 1 9.07
1103 Polyscytalum pustulans (M.N. Owen et Wakefield 1919) M.B. Ellis 1976 1 15.57 1 38.53
1104 Porodaedalea pini (Brotero 1804) Murrill 1905 1 22.97
1105 Preussia fleischhakii (Auerswald 1866) Cain 1961 1 43.78 1 23.47
1106 Protomyces macrosporus Unger 1834 1 19.01
1107 Pseudallescheria boydii (Shear 1922) McGinnis et al. 1982 3 20.28 3 44.50 2 22.75
1108 Pseudallescheria ellipsoidea (Arx et Fassatiova 1973) McGinnis et al. 1982 1 42.46 1 23.42
1109 Pseudeurotium bakeri C. Booth 1961 1 20.48 1 43.04
1110 Pseudeurotium desertorum Mouchacca 1971 1 18.88 1 41.28
1111 Pseudeurotium hygrophilum (Sogonov et al. 2005) Minnis et D.L. Lindner 9 1.67
2013
1112 Pseudeurotium ovale Stolk 1955 var. milkoi Beliakova 1969 2 44.73
1113 Pseudeurotium ovale Stolk 1955 var. ovale 3 34.44 1 45.50 1 0.11
1114 Pseudeurotium zonatum J.F.H. Beyma 1937 9 20.42 20 44.28 10 24.97
1115 Pseudogymnoascus caucasicus Cejp et Milko 1966 1 29.35 1 39.38 1 25.13
1116 Pseudogymnoascus roseus Raillo 1929 2 22.61 5 47.77
1117 Puccinia adoxae R. Hedwig 1805 1 19.60 1 19.05
1118 Puccinia bupleuri (Opiz 1852) F. Rudolphi 1829 1 19.60 1 1.84
1119 Puccinia punctiformis (F. Strauss 1811) Roehling 1813 1 23.64 1 19.05
1120 Purpureocillium lilacinum (Thom 1910) Luangsa-ard et al. 2011 16 22.80 28 44.55 17 19.37
1121 Pycnidiella resinae (Ehrenberg 1818) Hoehnel 1915 1 25.43
1122 Pycnoporus cinnabarinus (Jacquin 1776) P. Karsten 1881 2 23.74
1123 Pyrenochaeta sp. 1 6.54
1124 Pyrenophora biseptata (Saccardo et Roumeguere 1881) Crous 2013 1 19.30 1 33.34 1 4.33
1125 Pyrenophora triseptata (Drechsler 1923) Rossman et K.D. Hyde 2015 1 4.24
1126 Pyricularia grisea Saccardo 1880 3 19.85 1 13.76
1127 Pyronema omphalodes (Bulliard 1791) Fuckel 1870 1 18.96 1 17.28
1128 Pythium heterothallicum W.A. Campbell et F.F. Hendrix 1968 2 33.45
1129 Pythium intermedium de Bary 1881 1 6.50
(continued)
Cryopreservation Freeze-drying Soil
Number of Max storage Number of Max storage Number of Max storage
No. Name of species strains time (years) strains time (years) strains time (years)
1130 Pythium irregulare Buisman 1927 2 33.47
1131 Pythium mamillatum Meurs 1928 1 17.05
1132 Pythium oedichilum Drechsler 1930 1 33.28
1133 Pythium paroecandrum Drechsler 1930 1 33.58
1134 Pythium spinosum Sawada 1926 1 0.15
1135 Pythium sylvaticum W.A. Campbell et F.F. Hendrix 1967 2 20.59
1136 Quambalaria cyanescens (de Hoog et G.A. de Vries 1973) Z.W. de Beer et 3 6.48
al. 2006
1137 Radiomyces embreei R.K. Benjamin 1960 2 44.93 2 46.27
1138 Radiomyces spectabilis Embree 1959 1 25.31 1 39.17 1 24.89
1139 Remotididymella destructiva (Plowright 1881) Valenzuela-Lopez et al. 2017 3 16.86
1140 Rhinocladiella atrovirens Nannfeldt 1934 3 17.70 5 13.39
1141 Rhinotrichum aureum Cooke et Massee 1889 1 28.38
1142 Rhinotrichum lanosum Cooke 1871 1 19.47 1 21.52
1143 Rhizoctonia solani J.G. Kuehn 1858 22 20.04 1 5.53 4 21.24
1144 Rhizoctonia tuliparum (Klebahn 1905) Whetzel et J.M. Arthur 1924 1 14.94
1145 Rhizomucor miehei (Cooney et R. Emerson 1964) Schipper 1978 1 19.68 1 26.51 1 46.10
1146 Rhizomucor pusillus (Lindt 1886) Schipper 1978 4 19.70 4 43.33 4 43.99
1147 Rhizomucor tauricus (Milko et Schkurenko 1970) Schipper 1978 2 19.64 2 45.07 2 24.69
1148 Rhizopus arrhizus A. Fischer 1892 23 20.72 26 45.19 25 50.01
1149 Rhizopus microsporus van Tieghem 1875 var. chinensis (Saito 1904) 5 20.77 5 45.28 5 48.43
Schipper et Stalpers 1984
1150 Rhizopus microsporus van Tieghem 1875 var. microsporus 8 20.75 11 39.38 10 49.99
1151 Rhizopus microsporus van Tieghem 1875 var. oligosporus (Saito 1905) 2 12.43 2 44.83 2 49.50
Schipper et Stalpers 1984
1152 Rhizopus microsporus van Tieghem 1875 var. rhizopodiformis (Cohn 1884) 4 15.00 3 12.48
Schipper et Stalpers 1984
1153 Rhizopus stolonifer (Ehrenberg 1818) Vuillemin 1902 var. stolonifer 20 24.15 24 45.19 19 50.21
1154 Rhodocollybia butyracea (Bulliard 1792) Lennox 1979 1 2.82
1155 Robillarda sessilis (Saccardo 1878) Saccardo 1880 1 18.99
1156 Rosellinia mammiformis (Persoon 1801) Cesati et de Notaris 1863 1 19.28 1 31.68
1157 Russula aurora (Krombholz 1836) Bresadola 1892 1 19.40
1158 Russula decolorans (Fries 1821) Fries 1838 1 34.23
1159 Russula grisea (Batsch 1786) Fries 1838 1 34.03
1160 Saksenaea vasiformis S.B. Saksena 1953 1 27.79
1161 Saprochaete gigas (Smit et L. Meyer 1928) de Hoog et M.T. Smith 2004 1 19.87 1 43.67 1 0.12
1162 Saprolegnia asterophora de Bary 1860 1 15.20
1163 Saprolegnia blelhamensis (M.W. Dick 1969) Milko 1979 3 13.34
1164 Saprolegnia ferax (Gruithuisen 1821) Nees 1843 2 13.81
1165 Saprolegnia litoralis Coker 1923 1 13.10
1166 Saprolegnia mixta de Bary 1883 1 0.17
1167 Saprolegnia terrestris Cookson 1937 ex R.L. Seymour 1970 1 0.17
1168 Saprolegnia unispora (Coker et Couch 1923) R.L. Seymour 1970 2 0.17
1169 Sarocladium strictum (W. Gams 1971) Summerbell 2011 4 19.91 4 26.96 2 23.67
1170 Schizophyllum commune Fries 1815 4 34.08
1171 Sclerotinia borealis Bubák et Vleugel 1917 19 3.85
1172 Sclerotinia nivalis I. Saito 1997 25 3.85
1173 Sclerotinia ricini G.H. Godfrey 1919 1 18.97 1 27.35 1 0.11
1174 Sclerotinia sclerotiorum (Libert 1837) de Bary 1884 2 31.23
1175 Scopulariopsis acremonium (Saccardo 1882) Bainier 1907 (Thom 1910) 1 19.33 1 23.60 1 4.86
Thom 1930
1176 Scopulariopsis asperula (Saccardo 1882) S. Hughes 1958 1 19.26 1 39.91 1 18.38
1177 Scopulariopsis brevicaulis (Saccardo 1882) Bainier 1907 15 20.49 17 48.08 12 46.09
1178 Scopulariopsis brumptii Salvanet-Duval 1935 3 15.25 4 21.54 1 3.33
1179 Scopulariopsis coprophila (Cooke et Massee 1887) W. Gams 1971 1 31.33
1180 Scopulariopsis croci J.F.H. Beyma 1944 1 35.42 1 23.92
1181 Scopulariopsis flava (Sopp 1912) F.J. Morton et G. Smith 1963 (Thom 1910) 1 19.30 1 23.56 1 20.68
Thom 1930
1182 Scopulariopsis halophilica Tubaki 1973 1 28.84
1183 Scopulariopsis koningii (Oudemans 1902) Vuuillemin 1911 1 30.89
1184 Scytalidium terminale G.V. Rao et de Hoog 1975 1 19.50 1 29.45
1185 Seimatosporium pestalozzioides (Saccardo 1884) B. Sutton 1975 1 9.19
1186 Sepedonium macrosporum Saccardo et Cavara 1900 1 39.83 1 25.33
1187 Septoria lycopersici Spegazzini 1881 1 17.25
1188 Septoria rosarum Westendorp 1851 19.42
1189 Serpula lacrymans (Wulfen 1781) J. Schroeter 1885 2 20.11
1190 Simplicillium lamellicola (F.E.W. Smith 1924) Zare et W. Gams 2001 4 19.57 4 24.26
1191 Simplicillium obclavatum (W. Gams 1984) Zare et W. Gams 2001 1 3.83
(continued)
Cryopreservation Freeze-drying Soil
Number of Max storage Number of Max storage Number of Max storage
No. Name of species strains time (years) strains time (years) strains time (years)
1192 Sistotrema brinkmannii (Bresadola 1903) J. Eriksson 1948 1 0.16
1193 Sordaria fimicola (Roberge ex Desmazières 1849) Cesati et de Notaris 1863 2 19.37 2 43.76 2 23.47
1194 Sorosporium saponariae F. Rudolphi 1830 1 17.70
1195 Spadicesporium acrosporum V.N. Borisova et Dvoinos 1982 1 19.43 1 43.13
1196 Spadicesporium acrosporum-majus V.N. Borisova et Dvoinos 1982 1 19.43 1 11.45
1197 Spadicesporium bifurcatum V.N. Borisova et Dvoinos 1982 1 19.43 1 19.24
1198 Spadicesporium bifurcatum-majus V.N. Borisova et Dvoinos 1982 1 19.43 1 13.52
1199 Spadicesporium copiosum V.N. Borisova et Dvoinos 1982 1 19.43 1 32.34
1200 Spadicesporium persistens V.N. Borisova et Dvoinos 1982 1 19.43 1 40.85
1201 Spadicesporium ramosum V.N. Borisova et Dvoinos 1982 1 19.78 1 43.13
1202 Sparassis crispa (Wulfen 1781) Fries 1821 1 7.49
1203 Sphaceloma sp. 1 23.55
1204 Sphaeropsis sapinea (Fries 1823) Dyko et B. Sutton 1980 2 19.90
1205 Sphaerostilbella aureonitens (Tulasne et C. Tulasne 1865) Seifert et al. 1985 1 22.34
1206 Sphaerostilbella penicillioides (Corda 1840) Rossman et al. 2015 6 19.19 6 34.71 2 3.20
1207 Sporocadus lichenicola Corda 1839 1 10.24
1208 Sporodiniopsis dichotoma van Hoehnel 1903 1 15.90 1 15.95 1 10.80
1209 Sporormiella australis (Spegazzini 1887) S.I. Ahmed et Cain 1972 1 2.41 1 5.07
1210 Sporormiella intermedia (Auerswald 1868) S.I. Ahmed et Cain ex Kobayasi 1 38.09
1969
1211 Sporothrix fungorum de Hoog et G.A. de Vries 1973 1 1.94
1212 Sporotrichum aeruginosum Schweinitz 1886 var. microsporum Karsten 1 32.35
1905
1213 Sporotrichum bombycinum (Corda 1839) Rabenhorst 1844 3 19.31 3 29.59 2 35.25
1214 Sporotrichum gorlenkoanum Kuritzina et Sizova 1967 1 23.64 1 20.27
1215 Sporotrichum laxum Nees 1816 1 19.31 1 26.27
1216 Sporotrichum mycophilum Link 1818 1 27.68
1217 Sporotrichum pruinosum J.C. Gilman et E.V. Abbott 1927 7 19.82 13 42.71 5 35.05
1218 Sporotrichum roseolum Oudemans et Beijerinck 1903 1 15.20 1 26.16 1 2.28
1219 Stachybotrys chartarum (Ehrenberg 1818) S. Hughes 1958 10 19.32 14 48.10 2 9.56
1220 Stachybotrys cylindrospora C.N. Jensen 1912 1 29.41
1221 Stachylidium variabile Schulzer et Saccardo 1884 1 1.59
1222 Stagonospora paludosa (Saccardo et Spegazzini 1879) Saccardo 1884 1 19.90
1223 Stagonosporopsis hortensis (Saccardo et Malbranche 1882) Petrak 1921 1 20.34 1 27.54
1224 Stagonosporopsis trachelii (Allescher 1895) Aveskamp et al. 2010 1 20.34
1225 Stemphyliomma sp. 1 26.05 1 35.79
1226 Stemphylium botryosum Wallroth 1833 1 17.06 1 23.43
1227 Stemphylium sarciniforme (Cavara 1890) Wiltshire 1938 3 17.80 3 25.45
1228 Stenocarpella maydis (Berkeley 1847) B. Sutton 1980 1 21.31 1 11.57
1229 Stephanoma sp. 1 16.24 1 16.03
1230 Stereum hirsutum (Willdenow 1787) Persoon 1800 3 20.04
1231 Stereum sanguinolentum (Albertini et Schweinitz 1805) Fries 1838 1 23.21
1232 Stilbella bulbicola Hennings 1905 1 19.46 1 44.40
1233 Stilbotulasnella conidiophora Bandoni et Oberwinkler 1982 1 23.91
1234 Striaticonidium brachysporum (Nicot 1961) L. Lombard et Crous 2016 1 12.92 1 18.96
1235 Striaticonidium cinctum (Corda 1842) L. Lombard et Crous 2016 1 19.30 1 28.18
1236 Strobilomyces strobilaceus (Scopoli 1770) Berkeley 1851 1 26.53
1237 Stropharia rugosoannulata Farlow ex Murrill 1922 1 12.21
1238 Syncephalastrum racemosum Cohn ex J. Schroeter 1886 12 19.75 12 42.96 12 50.78
1239 Syncephalis cornu van Tieghem et G. Le Monnier 1873 1 46.84 1 45.50
1240 Syncephalis nodosa van Tieghem 1875 1 24.13 1 23.87 1 32.34
1241 Taeniolella aquatilis (Woronichin 1925) Milko 1985 1 19.33 1 31.75
1242 Talaromyces emersonii Stolk 1965 1 30.14 1 37.44
1243 Talaromyces flavus (Kloecker 1902) Stolk et Samson 1972 2 18.08 4 43.58 4 46.02
1244 Talaromyces luteus (Zukal 1889) C.R. Benjamin 1955 9 43.25 9 36.49
1245 Talaromyces stipitatus (Thom 1935) C.R. Benjamin 1955 2 33.85 2 33.96
1246 Talaromyces thermophilus Stolk 1965 1 31.21 1 1.25
1247 Talaromyces ucrainicus Udagawa 1966 2 18.08 3 44.17 3 36.26
1248 Talaromyces wortmannii (Kloecker 1903) C.R. Benjamin 1955 3 22.58 3 12.07
1249 Taphrina bergeniae Döbbeler 1979 1 19.01 1 10.22
1250 Taphrina betulina Rostrup 1883 1 13.27
1251 Taphrina carnea Johanson 1886 1 8.12
1252 Taphrina coerulescens Lindquist et Wright 1 13.25
1253 Taphrina flavorubra W.W. Ray 1939 1 13.27
1254 Taphrina pruni (Fuckel 1861) Tulasne 1866 1 19.01
1255 Taphrina purpurascens B.L. Robinson 1887 1 13.27 1 8.72
1256 Taphrina robinsoniana Giesenhagen 1892 1 13.25
1257 Taphrina sadebeckii Johanson 1885 1 13.25
(continued)
Cryopreservation Freeze-drying Soil
Number of Max storage Number of Max storage Number of Max storage
No. Name of species strains time (years) strains time (years) strains time (years)
1258 Taphrina tosquinetii (Westendorp 1861) Tulasne 1866 1 18.91 1 9.59
1259 Tapinella panuoides (Batsch 1783) E.-J. Gilbert 1931 2 7.02
1260 Teberdinia hygrophila Sogonov et al. 2005 1 4.67
1261 Tetraploa aristata Berkeley et Broome 1850 1 30.33
1262 Thamnidium elegans Link 1809 3 17.72 3 40.96 3 33.55
1263 Thamnostylum piriforme (Bainier 1880) Arx et H.P. Upadhyay 1970 4 24.14 4 37.27 4 48.92
1264 Thelebolus microsporus (Berkeley et Broome 1865) Kimbrough 1967 3 6.54
1265 Thelebolus polysporus (P. Karsten 1871) Otani et Kanzawa 1970 1 20.60 2 33.25
1266 Thermomyces ibadanensis Apinis et Eggins 1966 2 28.76
1267 Thielavia appendiculata Srivastava et al. 1966 1 46.06
1268 Thielavia hyrcaniae Nicot 1961 1 4.06 1 42.75
1269 Thielavia inaequalis Pidoplichko et al. 1973 2 4.07 2 45.58 2 0.10
1270 Thielavia ovispora Pidoplichko et al. 1973 3 19.33 3 43.57 3 24.15
1271 Thielavia terrestris (Apinis 1963) Malloch et Cain 1972 1 20.52 1 12.62
1272 Thielavia terricola (J.C. Gilman et E.V. Abbott 1927) Emmons 1930 5 19.24 5 43.99 5 24.81
1273 Thyrostroma carpophilum (Leveille 1843) B. Sutton 1997 1 19.92
1274 Thysanophora canadensis Stolk et Hennebert 1968 1 17.70 1 7.31
1275 Thysanophora penicillioides (Roumeguere 1890) W.B. Kendrick 1961 6 19.21 6 32.25
1276 Tilachlidium pinnatum Preuss 1851 1 29.01
1277 Tilletia laevis J.G. Kühn 1873 1 23.91 1 19.05
1278 Tilletiopsis albescens Gokhale 1972 1 16.41 1 20.08
1279 Tilletiopsis washingtonensis Nyland 1950 3 28.64 3 29.65
1280 Tolypocladium cylindrosporum W. Gams 1971 5 20.73 5 36.11 1 5.13
1281 Tolypocladium geodes W. Gams 1971 6 13.72 6 13.67
1282 Tolypocladium inflatum W. Gams 1971 9 19.28 13 35.21 2 0.09
1283 Tolypocladium microsporum (Jaap 1916) Bissett 1983 1 3.92
1284 Torula ligniperda (Willkomm 1866) Saccardo 1906 1 12.49 1 30.12
1285 Trametes gibbosa (Persoon 1795) Fries 1838 1 23.84
1286 Trametes hirsuta (Wulfen 1788) Lloyd 1924 5 26.58
1287 Trametes ochracea (Persoon 1794) Gilbertson et Ryvarden 1987 1 8.25
1288 Trametes pubescens (Schumacher 1803) Pilat 1939 3 34.10
1289 Trametes versicolor (Linnaeus 1753) Lloyd 1920 10 34.10
1290 Trametes zonatella Ryvarden 1978 1 0.41
1291 Tricellula aquatica J. Webster 1959 1 16.22 1 29.30
1292 Tricellula aurantiaca (Haskins 1958) Arx 1970 1 31.01 1 34.22
1293 Trichaptum abietinum (Dickson 1793) Ryvarden 1972 2 25.23
1294 Trichocladium asperum Harz 1871 2 19.56 2 47.73
1295 Trichocladium griseum (Traaen 1914) X. Wei Wang et Houbraken 2018 2 19.30 7 48.38
1296 Trichocladium nigrospermum (Schweinitz 1832) X. Wei Wang et 3 17.78 3 32.27 1 35.79
Houbraken 2018
1297 Trichoderma asperellum Samuels et al. 1999 2 7.71 1 8.48
1298 Trichoderma atroviride P. Karsten 1892 5 20.24 9 46.30 4 30.59
1299 Trichoderma aureoviride Rifai 1969 4 19.82 4 41.99 4 29.94
1300 Trichoderma citrinoviride Bissett 1984 3 1.92
1301 Trichoderma deliquescens (Sopp 1912) Jaklitsch 2011 1 21.12 1 12.36
1302 Trichoderma flavofuscum (J.H. Miller et al. 1957) Bissett 1991 1 25.05 1 0.09
1303 Trichoderma ghanense Yoshim. Doi et al. 1987 1 25.05 1 0.09
1304 Trichoderma hamatum (Bonorden 1851) Bainier 1906 1 20.36 1 25.62 1 10.01
1305 Trichoderma harzianum Rifai 1969 24 19.96 32 45.53 12 12.42
1306 Trichoderma koningii Oudemans 1902 4 19.82 4 42.75 4 35.83
1307 Trichoderma lignorum (Tode 1790) Harz 1872 1 2.99
1308 Trichoderma longibrachiatum Rifai 1969 16 21.37 22 46.32 9 37.65
1309 Trichoderma polysporum (Link 1816) Rifai 1969 4 19.99 4 46.07 3 3.56
1310 Trichoderma pseudokoningii Rifai 1969 8 19.81 9 45.02 8 38.35
1311 Trichoderma reesei E.G. Simmons 1968 6 19.82 6 36.31 5 35.98
1312 Trichoderma saturnisporum Hammill 1970 2 0.54 2 25.05 1 4.92
1313 Trichoderma virens (J.H. Miller et al. 1957) Arx 1987 2 18.70 3 44.87 2 18.38
1314 Trichoderma viride Persoon 1794 13 20.47 12 40.53 11 29.81
1315 Trichoderma viride Persoon 1794 var. kizhanicum Krapivina 1975 1 32.63 1 8.12
1316 Trichoderma viridescens (A.S. Horne et H.S. Williamson 1923) Jaklitsch et 5 26.99 4 26.87
Samuels 2006
1317 Trichosporiella cerebriformis (G.A. de Vries et Kleine-Natrop) W. Gams 2 19.59 3 19.22
1971
1318 Trichosporon dulcitum (Berkhout 1923) Weijman 1979 1 27.05
1319 Trichosporum herbarum Jaap 1916 1 0.54 1 27.82 1 3.73
1320 Trichothecium roseum (Persoon 1794) Link 1809 12 20.43 13 47.13 9 10.41
1321 Tritirachium oryzae (Vincens 1910) de Hoog 1972 5 17.67 5 45.93 4 3.38
(continued)
Cryopreservation Freeze-drying Soil
Number of Max storage Number of Max storage Number of Max storage
No. Name of species strains time (years) strains time (years) strains time (years)
1322 Tropicoporus linteus (Berkeley et M.A. Curtis 1858) L.W. Zhou et Y.C. Dai 1 22.97
2015
1323 Truncatella angustata (Persoon 1801) S. Hughes 1958 3 19.47 4 46.76
1324 Tympanosporium parasiticum W. Gams 1974 1 18.61 1 35.89 1 0.53
1325 Ugola praticola (Pidoplichko 1950) Stalpers 1984 1 30.96 1 8.47
1326 Umbelopsis isabellina (Oudemans 1902) W. Gams 2003 7 23.57 8 42.26 7 47.18
1327 Umbelopsis longicollis (Dixon-Stewart 1932) Y.N. Wang et al. 2015 4 19.43 4 38.84 4 50.23
1328 Umbelopsis nana (Linnemann 1941) Arx 1984 3 24.12 2 35.21 2 27.28
1329 Umbelopsis ramanniana (Moeller 1903) W. Gams 2003 11 19.43 11 40.99 11 50.21
1330 Umbelopsis vinacea (Dixon-Stewart 1932) Arx 1984 3 24.73 3 39.93 3 34.51
1331 Ustilago avenae (Persoon 1801) Rostrup 1890 1 18.51 1 1.64
1332 Ustilago cordae Liro 1924 1 19.56 1 1.84
1333 Ustilago cynodontis (Passerini 1870) Hennings 1893 1 21.45 1 18.84
1334 Ustilago filiformis (Schrank 1793) Rostrup 1890 1 9.34 1 18.84
1335 Ustilago hordei (Persoon 1801) Lagerheim 1889 1 12.32 1 18.84
1336 Ustilago maydis (de Candolle 1815) Corda 1842 2 13.39
1337 Valsa sordida Nitschke 1870 1 17.51
1338 Venturia tremulae Aderhold 1897 1 2.11
1339 Verticillium albo-atrum Reinke et Berthold 1879 3 19.33 3 29.00 3 5.02
1340 Verticillium bulbillosum W. Gams et Malla 1971 4 29.29
1341 Verticillium candidulum W. Gams et Malla 1971 1 29.62
1342 Verticillium cellulose W. Gams et Malla 1971 1 9.19
1343 Verticillium dahliae Klebahn 1913 4 19.37 4 43.73 4 13.62
1344 Verticillium epiphytum Hansford 1943 1 38.28
1345 Verticillium fumosum Seman 1968 1 19.27 1 31.86 1 4.74
1346 Verticillium lecanii (Zimmermann 1898) Viegas 1939 6 19.37 13 39.89 4 3.33
1347 Verticillium longisporum (C. Stark 1961) Karapapa et al. 1997 1 2.97
1348 Verticillium psalliotae Treschew 1941 1 24.57
1349 Verticillium tenerum Nees 1816 2 24.68
1350 Verticillium tricorpus I. Isaac 1953 2 19.33 2 37.17 2 7.30
1351 Verticillium villosum Rudakov 1981 1 41.45
1352 Verticillium zaregamsianum Inderbitzin et al. 2011 7 20.76 7 35.67 5 6.53
1353 Viennotidia humicola (Samson et W. Gams 1974) P.F. Cannon et D. 1 27.31 1 27.65
Hawksworth 1982
1354 Volutella ciliata (Albertini et Schweinitz 1805) Fries 1832 2 19.84 2 21.53
1355 Volutella roseola Cooke 1872 1 21.38 1 15.43
1356 Wallemia sebi (Fries 1832) Arx 1970 3 19.60 2 15.96
1357 Wallrothiella subiculosa Hoehnel 1912 1 21.53
1358 Wardomyces anomalus Brooks et Hansford 1923 1 13.50
1359 Westerdykella dispersa (Clum 1955) Cejp et Milko 1964 1 19.35 1 34.61 1 25.11
1360 Westerdykella multispora (Saito et Minoura ex Cain 1961) Cejp et Milko 1 3.99 1 43.57 1 23.47
1964
1361 Xeromyces bisporus L.R. Fraser 1953 1 18.86 1 15.48 1 0.21
1362 Xylobolus frustulatus (Persoon 1801) Boidin 1958 1 20.01
1363 Zasmidium biverticillatum (Arzanlou et P.W. Crous 2007) S.I.R. Videira et 1 25.54
P.W. Crous 2017
1364 Zygosporium echinosporum Bunting et E.W. Mason 1941 1 19.56 1 36.47 1 1.00
1365 Zymoseptoria passerinii (Saccardo 1884) Quaedvlieg et Crous 2011 1 1.74
1366 Zymoseptoria pseudotritici B. McDonald et al. 2012 1 6.45
66 S. M. Ozerskaya et al.
References
1. Abd-Elsalam KA, Yassin MA, Moslem MA, Bahkali AH, de Wit Pierre JGM, McKenzie EHC,
Stephenson SL, Cai L, Hyde KD (2010) Culture collections, the new herbaria for fungal
pathogens. Fungal Divers 45:21–32. https://doi.org/10.1007/s13225-010-0063-z
2. Atkinson RG (1953) Survival and pathogenicity of Alternaria raphani after five years in dried
soil cultures. Can J Bot 31:542–546
3. Ayala-Zermeno M, Gallou A, Berlanga-Padilla AM, Andrade-Michel GY, Rodriguez-
Rodriguez JC, Arredondo-Bernal HC, Montesinos-Matias R (2017) Viability, purity, and
genetic stability of entomopathogenic fungi species using different preservation methods.
Fungal Biol 121(11):920–928. https://doi.org/10.1016/j.funbio.2017.07.007
4. Bayat Z, Hassanshahian M, Cappello S (2015) Immobilization of microbes for bioremediation
of crude oil polluted environments: a mini review. Open Microbiol J 9:48–54. https://doi.org/
10.2174/1874285801509010048
5. Costa CP, Ferreira MC (1991) Preservation of microorganisms. Rev Microbiol 22(3):263–268
6. De Freitas A, Araújo MGBA, Hendges EA, Campos de Azevedo AG, de Olivero Lima DM,
Silva da Cruz I, da Costa Mendonça M, Diniz LEC (2014) Viability of Metarhizium anisopliae
(Metschn.) Sorok. conidia preserved in packages containing silica gel. BMC Proc 8(4):128.
https://doi.org/10.1186/1753-6561-8-S4-P128
7. Guidelines for the establishment and operation of collections of cultures of microorganisms. 3rd
ed. WFCC; 2010. 19p. http://www.wfcc.info/pdf/Guidelines_e.pdf
8. Hine RB (1962) Saprophytic growth of Fusarium oxysporum f. niveum in soil. Phytopathology
52:840–845
9. Ivanushkina NE, Kochkina GA, Eremina SS, Ozerskaya SM (2010) Experience in using
modern methods of long-term preservation of VKM fungi. Mikol Phytopathol 44:19–30. (In
Russian)
10. Kozlovskii AG, Zhelifonova VP, Antipova TV (2013) Fungi of the genus Penicillium as
producers of physiologically active compounds (Review). Appl Biochem Microbiol (Moscow)
49:1–10. https://doi.org/10.1134/S0003683813010092
11. Milosevic MB, Medic-Pap SS, Ignatov MV, Petrovic DN (2007) Lyophilization as a method for
pathogens long term preservation. Proc Natl Sci Matica Srska Novi Sad 113:203–210
12. Nakasone KK, Peterson SW, Jong S-C (2004) Preservation and distribution of fungal cultures.
In: Mueller GM et al (eds) Biodiversity of fungi. Inventory and monitoring methods. Elsevier/
Academic Press, Amsterdam, pp 37–47
13. OECD best practice guidelines for biological resource centers. OECD; 2007. 115p. http://www.
oecd.org/science/emerging-tech/38777417.pdf
14. Onions AHS (1983) Preservation of fungi. In: Smith JE, Berry DR, Kristiansen B (eds) The
filamentous fungi, Fungal technology, vol 4. Edward Arnold, London, pp 373–390
15. Ozerskaya SM, Ivanushkina NE, Kochkina GA, Eremina SS, Vasilenko AN, Chigineva NI
(2013) Long-term preservation of fungal cultures in All-Russian Collection of Microorganisms
(VKM): protocols and results. In: Gupta V, Tuohy M, Ayyachamy M, Turner K, O’Donovan A
(eds) Laboratory protocols in fungal biology: current methods in fungal biology, Fungal
biology. Springer, New York, pp 17–65
16. Perez-Garcıa A, Mingorance E, Rivera ME, Del Pino D, Romero D, Tores JA, De Vicente A
(2006) Long-term preservation of Podosphaera fusca using silica gel. J Phytopathol 154:190–
192. https://doi.org/10.1111/j.1439-0434.2006.01086.x
17. Perkins DD (1962) Preservation of Neurospora stock cultures with anhydrous silica gel. Can J
Microbiol 8:591–594
18. Raper KB, Fennell DI (1965) The genus Aspergillus. Williams and Wilkins, Baltimore, p 686
19. Rodriguez R, Santos C, Simões MF, Soares C, Santos C, Lima N (2019) Polyphasic, including
MALDI-TOF MS, evaluation of freeze-drying long-term preservation on Aspergillus (section
Nigri) strains. Microorganisms 7:291. https://doi.org/10.3390/microorganisms7090291
1 Various Methods of Long-erm Preservation of Fungal Cultures 67
20. Ryan MJ, Smith D, Jeffries P (2000) A decision-based key to determine the most appropriate
protocol for the preservation of fungi. World J Microbiol Biotechnol 16:183–186
21. Ryan MJ, Smith D (2007) Cryopreservation and freeze-drying of fungi employing centrifugal
and shelf freeze-drying. In: Day JG (ed) Methods in molecular biology, vol 368. Humana Press,
Totowa, pp 127–140
22. Sergeeva YE, Galanina LA, Andrianova DA, Feofilova EP (2008) Lipids of Filamentous fungi
as a material for producing biodiesel fuel. Appl Biochem Microbiol (Moscow) 44:523–527.
https://doi.org/10.1134/S0003683808050128
23. Shearer BL, Zeyen RJ, Ooka JJ (1974) Storage and behavior in soil of Septoria species isolated
from cereals. Phytopathology 64:163–167
24. Sidyakina TM (1988) Methods of preservation of microorganisms. In: Veprintzev BN (ed)
Konservatziya geneticheskikh resursov. ONTI NTZBI AN USSR, Pushchino, p 59. (In
Russian)
25. Smith D (1988) Culture and preservation. In: Hawksworth DL, Kirsop BE (eds) Living
resources for biotechnology. Filamentous fungi. Cambridge University Press, Cambridge, pp
75–99
26. Smith D (1993) Long-term preservation of test strains (fungus). Int Biodeterior Biodegradation
31:227–230
27. Smith D, Onions AHS (1994) The preservation and maintenance of living fungi, 2nd edn. CAB
International, Wallingford, p 132
28. Smith D, Thomas VE (1998) Cryogenic light microscopy and the development of cooling
protocols for the cryopreservation of filamentous fungi. World J Microbiol Biotechnol 14:49–
57
29. Stacey GN, Day JG (2007) Long-term ex situ conservation of biological resources and the role
of biological resource centers. In: Day JG, Stacey GN (eds) Methods in molecular biology, vol
368. Humana Press, Totowa, pp 1–14. https://doi.org/10.1007/978-1-59745-362-2_1
30. Sundari SK, Adholeya A (1999) Freeze-drying vegetative mycelium of Laccaria fraterna and
its subsequent regeneration. Biotechnol Tech 13:491–495
31. Suprun TP (1965) Preservation of microscopic fungi in sterile soil. Mikrobiologiya 34:539–
545. (In Russian)
32. Vekeman B, Heylen K (2015) Preservation of microbial pure cultures and mixed communities.
In: McGenity TJ, Timmis KN, Nogales B (eds) Hydrocarbon and lipid microbiology protocols,
Springer protocols handbooks. Springer, Berlin/Heidelberg, pp 299–315. https://doi.org/10.
1007/8623_2015_51
33. Wu L, Sun Q, Desmeth P, Sugawara H, McCluskey K, Smith D, Vasilenko A, Lima N, Ohkuma
M, Robert V, Zhou Y, Li J, Fan G, Ingsriswang S, Ozerskaya S, Ma J (2017) World data centre
for microorganisms: an information infrastructure for the exploration and utilization of micro-
bial strains preserved worldwide. Nucleic Acids Res 45(D1):D611–D618. https://doi.org/10.
1093/nar/gkw903
34. Zhan Y, Liu H, Wu Y, Wei P, Chen Z, Williamson JS (2015) Biotransformation of artemisinin
by Aspergillus niger. Appl Microbiol Biotechnol 99:3443–3446. https://doi.org/10.1007/
s00253-015-6464-x
Chapter 2
Sabouraud Agar and Other Fungal
Growth Media
Contents
2.1 Sabouraud Dextrose Agar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70
2.1.1 History . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70
2.1.2 Theory . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70
2.1.3 Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 71
2.1.4 Method of Sabouraud Agar Preparation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 72
2.1.5 Methods of Inoculation and Incubation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74
2.1.6 Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74
2.2 Potato Dextrose Agar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75
2.2.1 History . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75
2.2.2 Theory . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76
2.2.3 Methods of Preparation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76
2.2.4 Methods of Inoculation and Incubation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 78
2.2.5 Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 78
2.3 Bird Seed Agar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79
2.3.1 History . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79
2.3.2 Theory . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79
2.3.3 Methods of Preparation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80
2.3.4 Method of Inoculation and Incubation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81
2.3.5 Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81
2.4 Dermatophyte Test Medium . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81
2.4.1 History . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81
2.4.2 Theory . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 82
2.4.3 Method of Preparation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 82
2.4.4 Methods of Inoculation and Incubation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83
T. Acharya
Department of Microbiology and Immunology, Patan Academy of Health Sciences, Lalitpur,
Nepal
e-mail: tankeshwaracharya@pahs.edu.np
J. Hare (*)
Department of Biology & Chemistry, Morehead State University, Morehead, KY, USA
e-mail: jm.hare@moreheadstate.edu
2.4.5 Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83
2.5 Safety Notes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 84
2.6 Additional Fungal Growth Media . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 84
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 85
2.1.1 History
2.1.2 Theory
Sabouraud agar is a selective medium that is formulated to allow the growth of fungi
and inhibit the growth of bacteria. The available means of inhibiting bacterial growth
in Sabouraud’s pre-antibiotic era was via an acidic medium (pH 5.6). Currently, the
addition of antibiotics or antimicrobials to the acidic medium is used to inhibit
2 Sabouraud Agar and Other Fungal Growth Media 71
2.1.3 Materials
Sabouraud agar can be either made from individual ingredients (see Tables 2.1 and
2.2), purchased either as a dehydrated powder that must be dissolved in water,
autoclaved, and dispensed, or as a prepared medium that can be purchased in a
tube, plate, or broth form from a variety of commercial sources. Various antimicro-
bials can be added to either the original recipe (Sabouraud agar) or Sabouraud agar,
Modified/Emmons (see Table 2.2).
Table 2.1 Ingredients for Sabouraud agar and Sabouraud agar (Emmons)
Ingredient Sabouraud agar (per liter) Sabouraud agar (Emmons) (per liter)
Pancreatic digest of casein 10 g 10 g
Glucose 40 g 20 g
Agar 15–20 g 15–20 g
72 T. Acharya and J. Hare
5. Cool to ~45–50 C (roughly until one can support the flask underneath with an
ungloved hand). If the antimicrobials chloramphenicol or cycloheximide are to be
added, aseptically add them at this point and swirl medium gently (see
Sect. 2.1.4.3).
6. Pour into Petri dishes or tubes and leave them at room temperature (15–30 C)
overnight to solidify and dry. When pouring plates, fill each Petri dish with at
least 25 mL of medium to allow for medium dehydration during the longer
incubation period required for fungi. If preparing tubes, slant the rack of covered
tubes immediately after pouring in a slant tube rack, either at a 5 or 20 slant.
7. Store all media at 4 C, regardless of whether they contain antimicrobials.
Either Sabouraud agar or its Emmons version can be made more selective by adding
antimicrobials (see Table 2.2). Antimicrobials commonly used are the
aminoglycoside gentamicin, which inhibits gram-negative bacteria, chlorampheni-
col, which inhibits a wide range of gram-positive and gram-negative bacteria, and
cycloheximide, which inhibits primarily saprophytic fungi, but not dermatophytes or
yeasts [6, 7]. Chloramphenicol and gentamicin are used at 50 mg L1 and cyclo-
heximide at 0.5 g L1 (See Table 2.2) [8]. Chloramphenicol and cycloheximide
should only be added after the media has been autoclaved and then cooled to
~45–50 C (See step 5 in Sect. 2.1.4.1). Gentamicin may be added to the medium
ingredients before autoclaving.
74 T. Acharya and J. Hare
Lecithin and Tween 80 are added to Sabouraud agar (Table 2.2) that is used in
monitoring environmental surfaces that may have been treated with antiseptics and
quaternary ammonium compounds, as these additives neutralize the cleaning com-
pounds [9]. Sterile olive oil can be spread on the surface of Sabouraud agar plates to
grow lipophilic Malassezia species [10].
Sabouraud agar plates can be inoculated by streaking for isolation, as with standard
bacteriological media, by exposing the medium to ambient air, or by tamping clinical
sample material (e.g., hair, skin scrapings) onto the surface of the agar medium.
When growing cultures in tubes, the caps should be screwed on loosely to admit air,
as dermatophytes and most molds are obligate aerobes. Isolation of fungi is
performed on plates, while slants are primarily used for maintaining pure, or stock,
cultures once isolated. If using selective Sabouraud media, a control plate/tube
without antimicrobials should also be inoculated for comparison. Typically, molds
are incubated at room temperature or slightly warmer (25–30 C), yeasts are
incubated at 28–30 C or both 30 C and 37 C if suspected to be dimorphic fungi.
Incubation times will vary, from approximately 2 days for the growth of yeast
colonies such as Malasezzia to 2–4 weeks for growth of dermatophytes or dimorphic
fungi such as Histoplasma capsulatum. Indeed, the incubation time required to
acquire fungal growth is one diagnostic indicator used to identify or confirm fungal
species. Dermatophytes, in particular, show characteristic incubation times ranging
from 5–7 days (some Epidermophyton or Microsporum species) to 3–4 weeks for
some Trichophyton species [11]. Cultures should be examined twice weekly and be
held for 4–6 weeks before being reported as negative if infection by systemic agents
such as Histoplasma, Blastomyces, or Coccidioides species is suspected.
2.1.6 Results
Table 2.3 Expected growth of various microbes on Sabouraud agar containing antimicrobials
Microbe Growth on SAB + CAMa Growth on SAB + CHXb
Candida albicans Yes Yes
Cryptococcus neoformans Yes No
Aspergillus Niger Yes No
Trichophyton mentagrophytes Yes Yes
Microsporum audouinii Yes Yes
Blastomyces dermatitidis Yes (mold phase at 25 C) Yes (mold phase at 25 C)
No (yeast phase at 37 C) No (yeast phase at 37 C)
Histoplasma capsulatum Yes (mold phase at 25 C) Yes (mold phase at 25 C)
No (yeast phase at 37 C) No (yeast phase at 37 C)
Rhizopus spp. Yes No
Sporothrix schenckii Yes Yes
Penicillium roquefortii Yes No
Escherichia coli No No
a
SAB + CAM ¼ Sabouraud agar plus chloramphenicol
b
SAB + CHX ¼ Sabouraud agar plus cycloheximide
Mold morphology should be observed on both the top (obverse) and bottom
(reverse) surfaces, as differences can be seen on each surface.
Variation from lot to lot as well as between commercial vendors of Sabouraud
agar can significantly impact the qualitative and quantitative growth of fungi. One
study comparing five different commercial preparations of Sabouraud glucose agar
observed significant differences in the quantitation of yeasts as well as the color of
Aspergillus colonies; however, the dermatophytes yielded reliably similar appear-
ances on the five media sources tested [13].
2.2.1 History
The use of potato extract as a growth source in fungal media was published by
New Zealand mycologist Ross Beever in 1970 [14], as part of a detailed study into
the most efficacious component of potatoes as a growth medium. After analysis of
the carbon, nitrogen, mineral salts, and other growth factor components of the potato
extract medium, it was concluded that no one component was responsible for the
stimulation of the growth of fungi.
76 T. Acharya and J. Hare
2.2.2 Theory
Table 2.5 Ingredients for Potato Dextrose Agar (commercial and manual)
Potato Dextrose Agar (commercial) Potato Dextrose Agar (manual)
Ingredient (g/L) (g/L)
Potato extract* 4g –
Potato infusion – 200 g
Dextrose 20 g 20 g
Agar 15 g 15 g
Final pH at 5.6 0.2 5.6 0.2
25 C
*4 g of potato extract is equivalent to infusion from 200 g of potatoes
6. Pour into Petri dishes or tubes and leave at room temperature overnight to solidify
and dry. When pouring plates, fill each Petri dish with at least 25 mL of medium
to allow for medium dehydration during the longer incubation period required for
fungi. If preparing tubes, slant the rack of covered tubes immediately after
pouring in a slant tube rack, either at 5 or 20 slant.
7. Store prepared media away from direct light at 4 C to 8 C with the medium side
uppermost to prevent excessive accumulation of moisture on the agar surface.
Under these conditions, this medium has a shelf life of 12 weeks.
After checking for correct pH, color, depth, and sterility, the following organisms are
used to determine the growth performance of the completed medium: Candida
albicans ATCC 14053 and Aspergillus niger ATCC 16404 will each produce
growth on this medium.
1. For yeast and mold counts in foods, a standard pour plate technique should be
used, and the pH of the medium should be adjusted to approximately 3.5 with
sterile tartaric aid.
2. For the cultivation and maintenance of pure cultures, tubed slants are used. They
should be inoculated and incubated the same as a plated medium, below.
3. For other specimen processing, streak the specimen onto the medium with a
sterile inoculating loop to obtain isolated colonies.
4. Plates can be incubated at various temperatures, depending on the application
(molds typically use a lower temperature such as room temperature 20–25 C
while yeasts may require 25–30 C) in an inverted position (agar side up) with
increased humidity.
5. Cultures should be examined daily for fungal growth, with extended time periods
up to at least one week for lower temperature incubations and several days for
higher temperature incubations.
2.2.5 Results
After sufficient incubation culture plates should show isolated colonies in streaked
areas and confluent growth in areas of heavy inoculation. Yeasts will grow as creamy
to white colonies. Molds will grow as filamentous colonies of various colors. Further
2 Sabouraud Agar and Other Fungal Growth Media 79
microscopic examination and biochemical testing are required to identify the genus
and species of the isolate.
The number of yeast or mold present in the particular test sample is determined by
counting the colonies in pour plates and multiplying with the applicable dilution
factor.
2.3.1 History
2.3.2 Theory
Bird Seed Agar is a selective and differential medium for the isolation of Crypto-
coccus neoformans from clinical specimens and differentiation of it from other
microbes. The use of Bird Seed Agar as the primary culture medium for sputum
and urine specimens from AIDS patients increases sensitivity for C. neoformans
[24]. Cryptococcus neoformans produces dark colonies on this agar, unlike Candida
albicans, which produces white colonies. C. neoformans is the only yeast known to
produce this pigmentation [25].
The extract of Guizotia abyssinica seeds contains caffeic acid
(3, 4-dihydroxycinnamic acid, an o-diphenol). Phenoloxidase enzyme produced by
C. neoformans uses caffeic acid as a substrate and produces melanin. Melanin is
absorbed by the yeast cell wall, yielding tan to reddish-brown pigmentation. It is also
known as the phenoloxidase test.
Glucose is the energy source in the medium. Cryptococcus species use creatinine
as their sole source of nitrogen [22]. Creatinine also enhances the melanization of
some strains of C. neoformans. Agar is the solidifying agent. Chloramphenicol
improves the recovery of Cryptococus species from specimens containing mixed
flora by selecting against bacterial growth.
80 T. Acharya and J. Hare
After checking for correct pH, color, depth, and sterility, the following organisms are
used to determine the growth performance of the completed medium: Cryptococcus
neoformans ATCC 32045 will produce brown to black pigmented colony growth on
this medium. Escherichia coli ATCC 25922 serves as a negative control, being
partial to completely inhibited in its growth on Bird Seed Agar.
1. Streak the specimen onto the medium with a sterile inoculating loop to obtain
isolated colonies.
2. Incubate the plates at 25–30 C in an inverted position (agar side up) with
increased humidity.
3. Cultures should be examined at least daily for fungal growth and should be held
for up to 4 weeks before being reported as negative.
After inoculation of the clinical specimen, and periodically examined for brown-
colored, mucoid colonies, which later turn black or brown in the case of the genus
Cryptococcus.
2.3.5 Results
Plates inoculated with suspected samples are observed after incubation at 25–30 C
for 2 weeks. The presence of golden brown to black pigmented smooth or mucoid
colonies is indicative of Cryptococcus neoformans. Other species like Cryptococcus
laurentii, Saccharomyces cerevisiae, etc., produce non-pigmented colonies, and
Candida species appear as white colonies. However, pigmented colonies arising
on Bird Seed Agar should be also grown on a non-differential medium such as
Sabouraud dextrose agar to rule out a naturally pigmented strain or species [19].
2.4.1 History
2.4.2 Theory
Follow steps 1–5 listed in Sect. 2.1.4.1 Standard Preparation. After cooling the
sterilized media, add the appropriate antimicrobials for DTM (Table 2.7) and pour
them into plates or tubes.
There is a modification of DTM, called dermatophyte isolation medium DIM
[28], which uses the pH indicator dye bromocresol purple in place of phenol red, as
well as penicillin and streptomycin as its antibiotics. It also uses cycloheximide, at
4 g L1, which is eight times the amount found in DTM. However, at its
recommended incubation temperature of 37 C (but not a lower temperature of
30 C), high false-negative rates for common Trichophyton species were noted,
perhaps due to the high levels of cycloheximide [29]. Furthermore, the dimorphic
fungus Coccidioides immitis grew as a white mold at 37 C that resembled the
hallmark dermatophyte appearance, thereby constituting a false-positive issue with
this medium [29]. Consequently, this medium formulation, as published, is not the
most useful for presumptive identification of dermatophyte infections.
Suitable samples for DTM inoculation include hair, nails, and skin scrapings. Clean
the skin or body surface with alcohol before using a new toothbrush or other small
brush to obtain a surface sample. Bringing the medium to room temperature helps
facilitate more rapid fungal growth. Follow the instructions listed in Sect. 2.1.5. Lay
the sample firmly on top of, but not into, the medium.
Loosely capped, inoculated tubes or plates should be incubated at room temper-
ature or around 25 C, and should be evaluated for red medium color change daily,
up to 10–14 days.
2.4.5 Results
Fungi often produce spores that are easily dispersed into the laboratory upon the
opening of plates.
Plates should be incubated with the lid on the top (as opposed to the typical
practice of inverting microbiological plates for incubation) to avoid spreading spores
when the plates are opened. After growth, plates should be wrapped in Parafilm to
maintain them securely closed for storage and transport. Plate or tube cultures should
be opened only within a class II biological safety cabinet to avoid contamination of
laboratory spaces with fungal spores, possible infection of individuals by pathogenic
fungi, or induction of allergic responses. See Chap. 1 for detailed procedures and
guidelines.
Because the growth of large numbers of fungi can pose a potential infection
hazard, measures must also be taken to prevent infection of laboratory researchers.
Note that some fungi are biosafety level one (BSL-1) while most are BSL-2
[30]. The American Society for Microbiology strongly recommends that environ-
mental enrichment experiments should only be performed in BSL-2 laboratories
[31]. The following precautions apply to the use of any fungal medium:
1. Soil, water, and other materials directly obtained from the environment that
typically contain infectious organisms should be handled according to the bio-
safety level of that infectious agent.
2. Cultures of enriched microorganisms derived from environmental samples should
be handled using BSL-2 precautions.
3. Mixed, enriched, or pure cultures of microorganisms from environmental samples
with a significant probability of containing infectious agents should be manipu-
lated in a Class II biosafety cabinet if available.
4. Researchers should be aware of working in regions with endemic fungi capable of
causing systemic infections and should avoid environmental isolations.
Some safe (BSL-1) fungi for student experimentation and handling include the
molds Penicillium camemberti and P. roqueforti (used in making cheeses), Rhizopus
stolonifor (used in making tempeh), Aspergillus species (except A. fumigatus and
A. flavus), the yeasts Saccharomyces cerevisiae, Rhodotorula rubrum, and Neuros-
pora crassa.
Table 2.8 Other commonly used fungal isolation and growth media
Culture
Media Essential ingredients Intended use
Inhibitory Tryptone, beef extract, yeast extract, Recovery of fungi from specimens that
Mold agar starch, dextrin, chloramphenicol, contain bacterial microbiota
(IMA) gentamicin, and saline buffer
(continued)
2 Sabouraud Agar and Other Fungal Growth Media 85
References
1. Raymond Sabouraud (1896) La question des teignes. In: Annales de Dermatologie 3rd series
VII. p. 87–135. (3; vol. 7)
2. Raymond Sabouraud (1896) Recherche des milieux de culture propres a la différenciation des
espèces trichophytiques a grosse spore. In: Les trichophyties Humaines. Masson et Cie, Paris,
pp 49–55
3. Odds FC (1991) Sabouraud(‘s) agar. J Med Vet Mycol 29:355–359
4. Emmons CW, Binford CH, Utz JP, Kwon-Chung KJ (1977) Culture media. In: medical
mycology, 3rd edn. Lea & Febiger, Philadelphia
5. Jarrett L, Sonnenwirth AC (1980) Gradwohl’s and parasitic infections, 7th edn. American
Public Health Association, Washington, DC
6. McDonough ES, Ajello L, Georg LK, Brinkman S (1960 Jan 1) In vitro effects of antibiotics on
yeast phase of Blastomyces dermatitidis and other fungi. J Lab Clin Med 55(1):116–119
7. Lorian V (2005) Antibiotics in laboratory medicine. Lippincott, Williams & Wilkins, Baltimore
8. Hungerford LL, Campbell CL, Smith AR (1998) Veterinary mycology lab manual. Iowa State
University Press, Ames
9. Curry AS, Graf JG, McEwen GN Jr (1993) CFTA microbiology guidelines. The Costmetic,
Toiletry and Fragrane Association, Washington, DC
10. Kwon-Chung KJ, Bennett JE (1992) Infections caused by Malassezia species. In: Medical
mycology. Lea and Febiger, Philadelphia, pp 70–182
11. Robert R, Pihet M (2008 Dec) Conventional methods for the diagnosis of dermatophytosis.
Mycopathologia 166(5–6):295–306
12. Georg LK, Camp LB (1957 Aug) Routine nutritional tests for the identification of dermato-
phytes. J Bacteriol 74(2):113–121
86 T. Acharya and J. Hare
13. Brun S, Bouchara JP, Bocquel A, Basile AM, Contet-Audonneau N, Chabasse D (2001 Oct)
Evaluation of five commercial Sabouraud gentamicin-chloramphenicol agar media. Eur J Clin
Microbiol Infect Dis 20(10):718–723
14. Beever RE, Bollard EG (1970) The nature of the stimulation of fungal growth by potato extract.
J Gen Microbiol 60:273–279
15. US Food and Drug Administration (2019) Bacteriological Analytical Manual [Internet].
AOAC; [cited 2019 Aug 14]. Available from: https://www.fda.gov/food/laboratory-methods-
food/bacteriological-analytical-manual-bam
16. Association of Official Analytical Chemists (2012) Official methods of analysis, Report No.:
19. AOAC, Washington, DC
17. American Public Health Assocation2 Standard methods for the examination of dairy products,
22nd edn. APHA, 2012, Washington, DC
18. APHA (2001) Technical committee on microbiological methods for foods. Compendium of
methods for the microbiological examination of foods, 4th edn. Washington, DC, APHA
19. MacFaddin JF (1985) Media for isolation-cultivation-identification-maintenance of medical
bacteria [Internet]. Williams and Wilkins, Baltimore (Md.). Available from: http://lib.ugent.
be/catalog/rug01:000079718
20. Griffith GW, Easton G, Detheridge A, Roderick K, Edwards A, Worgan H et al (2007 Dec 1)
Copper deficiency in potato dextrose agar causes reduced pigmentation in cultures of various
fungi. FEMS Microbiol Lett 276:165–171
21. Staib F (1962) Cryptococcus neoformans and Guizotia abyssinica (syn. G. oleifera D.C.).
(Colour reaction for Cr. Neoformans.). Zeitschrift fur Hygiene und Infektionskrankheiten
148(5):466–475
22. Shields AB, Ajello L (1966 Jan 14) Medium for selective isolation of Cryptococcus
neoformans. Science 151(3707):208–209
23. Staib F, Seibold M, Antweiler E, Fröhlich B (1989 Sep 1) Staib agar supplemented with a triple
antibiotic combination for the detection of Cryptococcus neoformans in clinical specimens:
Staib-agar mit einer Dreifach-Antibiotika-Kombination für den Nachweis von Cryptococcus
neoformans in klinischem Untersuchungsmaterial. Mycoses 32(9):448–454
24. Denning DW, Stevens DA, Hamilton JR (1990 Nov) Comparison of Guizotia abyssinica seed
extract (birdseed) agar with conventional media for selective identification of Cryptococcus
neoformans in patients with acquired immunodeficiency syndrome. J Clin Microbiol 28(11):
2565–2567
25. Warren NG, Hazen KC (1999) Candida, Cryptococcus and other yeasts of medical
importance. In: Manual of clinical microbiology, 7th edn. American Society for Microbiology,
Washington, DC, pp 1184–1199
26. Paliwal DK, Randhawa HS (1978 Apr) Evaluation of a simplified Guizotia abyssinica seed
medium for differentiation of Cryptococcus neoformans. J Clin Microbiol 7(4):346–348
27. Taplin D, Zaias N, Rebell G, Blank H (1969 Feb) Isolation and recognition of dermatophytes on
a new medium (DTM). Arch Dermatol 99(2):203–209
28. Salkin IF, Padhye AA, Kemna ME (1997 Oct) A new medium for the presumptive identification
of dermatophytes. J Clin Microbiol 35(10):2660–2662
29. Gromadzki S, Ramani R, Chaturvedi V (2003 Jan 1) Evaluation of new medium for identifi-
cation of dermatophytes and primary dimorphic pathogens. J Clin Microbiol 41(1):467
30. Centers for Disease Control and Prevention (2009) Section VIII-B: Fungal agents. In: Biosafety
in Microbiological and Biomedical Laboratories (BMBL) [Internet], 5th edn, pp 170–181.
Available from: http://www.cdc.gov/biosafety/publications/bmbl5/BMBL.pdf
31. Emmert EAB (2013) ASM task committee on laboratory biosafety. Biosafety guidelines for
handling microorganisms in the teaching laboratory: Development and rationale. J Microbiol
Biol Educ 14(1):78–83
Chapter 3
Fluorescence In Situ Hybridization
of Uncultured Zoosporic Fungi
Contents
3.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87
3.2 Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89
3.3 Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89
3.3.1 Classical FISH Probing (See Note 3) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89
3.3.2 CARD-FISH Probing (See Note 7) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 90
3.4 Notes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 90
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93
3.1 Introduction
3.2 Materials
3.3 Methods
3.3.1 Classical FISH Probing (See Note 3)
3.4 Notes
good accessibility for FISH probing. There were two mismatches in the middle of
the probe with sequences of Chytridiales species (cf. 12), which did not result in
loss of positive signal. Chyt1061 was designed in silico for targeting fungal
species in the order Chytridiales, i.e. the largest order of the division
Chytridiomycota (chytrids) mainly represented by phytoplanktonic parasites in
aquatic environments [12]. The design was based on the alignment of rDNA
sequences of Chytridiales obtained from GenBank, together with 106 sequences
derived from18S rDNA PCR surveys of freshwater picoeukaryotes conducted in
French Lakes Pavin, Godivelle, and Aydat [12]. Distinct rDNA sequence unique
to target organisms was localized and imported in Primer3 software (http://
fokker.wi.mit.edu/primer3/input.htm) in order to design a probe with a size
between 18 and 27 bases, probe melting temperature (Tm) between 57 C and
63 C, and GC percentage at about 50%. The probe was analyzed for potential
complementarities, and no dimers or hairpins were found using Netprimer soft-
ware (http://www.premierbiosoft.com/netprimer/netprlaunch/netprlaunch.html).
The probe was commercially synthesized by MWG-biotech Company (Germany)
and labelled with the fluorochrome Cy3 for classical FISH or application to
environmental samples using the CARD-FISH approach [12].
2. In the case you design your one probe because of the increasing availability of
sequences in the database, hybridization stringency should be tested and validated
using appropriate positive and negative cultures, before application to natural
samples. In the absence of laboratory cultures, our probe Chyt1061 was evaluated
from an adaptation of an alternative approach called clone-FISH, known from
prokaryotes [23]. This approach is based on the genetic modification of a clone of
Escherichia coli by inserting a plasmid vector containing the target rDNA
sequence. In our adaptation of the approach, cells of E. coli clone BL21 star
were genetically transformed by a inserting plasmid vector containing rDNA
sequence from several different target fungal cells. Specific plasmid inserts came
from freshwater lake surveys of picoeukaryote 18S rDNA and fungal 18S-ITS
rDNA as well (cf. 12).
3. The specificity of the designed probe should be checked both in silico by using a
basic local alignment search tool (e.g. BLAST) [24] and in vivo by screening
clone libraries with classical FISH (the clone-FISH approach can be used here). In
our case, clones containing rRNA gene inserts from different eukaryotes closely
related to microorganisms of interest and negative controls as well were FISH-
targeted following the protocol described in this chapter (i.e. with 30% formam-
ide in the hybridization buffer). In addition, the in vivo transcription of the 18S
rRNA gene insert was induced with IPTG (1 mM) for 1 h. The designed probe or
its reverse complement probe was used, depending on the orientation of insertion
into the vector, i.e. 30 ! 50 or 50 ! 30 way downstream the T7 promoter (cf. 12).
4. In vivo tests using the clone-FISH approach yield the best fluorescence signal
when hybridization was performed at 30% formamide concentration in the
hybridization buffer. Assuming an increase of the effective hybridization tem-
perature of 0.5 C per 1% of added formamide, the melting temperature (Tm) of
the probe Chyt1061 was experimentally calculated at 61 C [12].
92 T. Sime-Ngando et al.
5. This protocol is suitable for cultures and enriched cultures (i.e. concentrates of
targeted zoosporic organisms during host blooms) (cf. 12). However, the FISH
resolution for fungal images and species identification based on sporangium
features is poor, compared to the calcofluor approach which is more appropriate
for the identification of zoosporic organisms [14]. In addition, the
Cy3-monolabelled FISH probing of natural samples clearly showed that the
fluorescence of targeted chytrid zoospores may be quite similar to the
autofluorescence from natural picoautotrophs. That is why CARD-FISH is
more appropriate for environmental samples.
6. For natural waters, the appropriate volume depends on the trophic status of the
natural waters, whether the sampling period corresponds to a bloom period, and
on the nature of the phytoplankton species. Zoosporic parasites are much more
abundant when large-size phytoplankton hosts such as diatoms or filamentous
cyanobacteria develop [5, 14]. In oligotrophic waters, concentration of natural
samples could be required before harvesting targeted organisms onto polycar-
bonate filters [15].
7. One filter corresponding to one sampling time point can be cut in pieces before
hybridization when several probes are used.
8. The mounting medium should not be fluorescent and will minimize the fading of
fluorochromes. An example of mountant is a solution composed of 50% glycerol,
50% phosphate-buffered saline (0.05 M Na2HPO4, 0.85% NaCl, pH 7.5), and
0.1% p-phenylenediamine (made fresh daily from a frozen 10% aqueous stock
solution; Sigma-Aldrich, St. Louis, MO, USA).
9. The CARD-FISH protocol is suitable for natural samples, primarily in oligotro-
phic waters where its application improves the detection and the recognition of
chytrid, because of the enhanced signal conferred by HRP-labelled probes,
compared to monolabelled oligonucleotides. In addition, the choice of fluorescein
as a stain (emission in the green spectrum at 520 nm) significantly reduces the
interference from natural fluorescence of autotrophic organisms, thereby
preventing the use of the deductive approach based on double counting of the
same sample, i.e. with and without hybridization [25]. However, similar to the
simple FISH approach, the CARD-FISH resolution for fungal images and species
identification based on sporangium features is poor, compared to the calcofluor
approach which is more appropriate for the identification of zoosporic
organisms [14].
Acknowledgements MJ and SR were supported by PhD Fellowships from the Grand Duché du
Luxembourg (Ministry of Culture, High School, and Research) and from the French Ministère de la
Recherche et de la Technologie (MRT), respectively. This study receives grant-aided support from
the French ANR Programme Blanc # ANR 07 BLAN 0370 titled DREP: Diversity and Roles of
Eumycetes in the Pelagos.
3 Fluorescence In Situ Hybridization of Uncultured Zoosporic Fungi 93
References
18. Schönhuber W, Zarda B, Eix S, Rippka R, Herdman M, Ludwig W, Amann R (1999) In situ
identification of cyanobacteria with horseradish peroxidase-labeled, rRNA targeted oligonucle-
otide probes. Appl Environ Microbiol 65:1259–1267
19. Schmidt B, Chao J, Zhu Z, DeBiasio RL, Fisher G (1997) Signal amplification in the detection
of single-copy DNA and RNA by enzyme-catalyzed deposition (CARD) of the novel fluores-
cent reporter substrate Cy3.29-tyramide. J Histochem Cytochem 45:365–373
20. Not F, Simon N, Biegala IC, Vaulot D (2002) Application of fluorescent in situ hybridization
coupled with tyramide signal amplification (FISH-TSA) to assess eukaryotic picoplankton
composition. Aquat Microb Ecol 28:157–166
21. Pernthaler J, Glöckner FO, Schönhuber W, Amann R (2001) Fluorescence in situ hybridization
(FISH) with rRNA-targeted oligonucleotide probe. Methods Microbiol 30:207–226
22. Behrens S, Rühland C, Inácio J, Huber H, Fonseca Á, Spencer-Martins I, Fuchs BM, Amann R
(2003) In situ accessibility of small-subunit rRNA of members of the domains bacteria, archaea,
and Eucarya to Cy3-labeled oligonucleotide probes. Appl Environ Microbiol 69:1748–1758
23. Schramm A, Fuchs BM, Nielsen JL, Tonolla M, Stahl DA (2002) Fluorescence in situ
hybridization of 16S rRNA gene clones (Clone-FISH) for probe validation and screening of
clone libraries. Environ Microbiol 4:713–720
24. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang A, Miller W, Lipman DJ (1997)
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res 25:3389–3402
25. Lefèvre E, Carrias J-F, Bardot C, Amblard C, Sime-Ngando T (2005) A preliminary study of
heterotrophic picoflagellates using oligonucleotidic probes in Lake Pavin. Hydrobiologia
55:61–67
Chapter 4
Technique for Identifying and Counting
Infective Chytrid Sporangia Using
the Chitinaceous Fluorochrome Calcofluor
White
Contents
4.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 95
4.2 Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 97
4.3 Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 98
4.3.1 Concentrations of Cells (See Note 1) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 98
4.3.2 Preparation of Calcofluor Stock Solution . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 98
4.3.3 Staining and Visualization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 98
4.4 Notes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 100
4.1 Introduction
Fungal infections are recurrent in aquatic ecosystems [1, 2]. The most described
aquatic fungi in freshwater ecosystems belong to Chytridiomycota (or chytrids).
Chytrids infect a wide variety of hosts, including fish, eggs, zooplankton, and other
aquatic fungi but especially phytoplankton. Typical phytoplankton hosts include
prokaryotes and eukaryotes, primarily large-size diatoms and filamentous species
[3]. Associated chytrids are external eucarpic parasites which produce a specialized
rhizoidal system within host cells, i.e. the diet conveying system that leads to the
formation of the chitinous fruit bodies: the sporangium. This parasitic stage produces
[34, 35]. In contrast to FITC, CFW penetrates into infected host cells and is more
efficient for the observation of the complete rhizoidal system of parasites (Fig. 4.1),
i.e. a pertinent criterion for chytrid identification [4, 10, 11].
The main objective of this chapter is to provide, in a simplified step-by-step
format, a routine protocol based on size fractionation of pelagic samples and the use
of the fluorochrome calcofluor white for diagnosing, identifying, and counting
chitinous fungal parasites (i.e. sporangia of chytrids) within phytoplanktonic com-
munities [3], together with practical advice on how to apply the method.
4.2 Materials
1. 25 μm nylon filter
2. 0.2 μm filters
3. High-performance concentration/diafiltration system. As an example, we use the
system Amicon model DC 10LA (Epernon, France) equipped with a reusable
hollow fibre cartridge (0.2 μm cutoff, surface area of 0.45 m2).
4. 36% Formaldehyde.
5. Calcofluor white (C40H44N12O10S2 fluorescent brightener 28; Sigma catalog
no. F3543).
6. 10 N NaOH
7. Balance.
8. Distilled water.
9. 15 ml and 0.2 ml tubes
10. Glass slides and coverslips.
11. Epifluorescence microscope equipped with appropriate UV filter sets and
Neofluar objective lens (optional).
98 T. Sime-Ngando et al.
4.3 Methods
1. Pass the sample (ca. 20 L) through the 25 μm pore size nylon filter (see Note 2).
2. Collect large phytoplankton cells in the >25 μm size fraction by washing the filter
with 40 mL of 0.2 μm filtered natural sample.
3. Fix the concentrate sample with formaldehyde (2% final conc.), before staining
and analysis.
4. Concentrate nanoplanktonic cells in the <25 μm size fraction (i.e. the 20 L filtrate)
ca 20x by ultrafiltration to a volume of approximately 1 L, entry pressure 0.9 bar.
5. Fix about 180 mL of the ultrafiltrate retentate with formaldehyde (2% final conc.),
before staining and analysis.
1. In the dark, stain aliquots (about 200 μl) of concentrated and fixed materials by
adding 1–2.5% (vol/vol) of CFW stock solution directly in solution for 10 min.
2. Mount drop (5–10 μl) of the stained samples between glass slides and coverslips
for observations and counting.
3. In a dark room, examine the slides under an epifluorescence microscope equipped
with an appropriate set of filters and objective lenses. Shift between white and UV
light to visualize and determine parasites and phytoplankton cells, and check the
viability of the host cell, e.g. presence of chloroplast.
4. Applied a standard procedure for microscopic counting (see Notes 3 and 4).
4 Technique for Identifying and Counting Infective Chytrid Sporangia Using. . . 99
4.4 Notes
identification based on phenotypic features and viability of the host cell, through
the integrity of cell wall and the presence of chloroplasts, which are fundamental
parameters to assess the intensity of the disease. We consider this protocol as an
optimal for the diagnosis and quantitative assessment of phytoplanktonic chytrid
infections in natural samples. Finally, the approach was designed to freeze-
conserved particulate DNA samples for quantifying the propagule stages
(i.e. zoospores) of chytrids via FISH targeting of specific rRNA oligonucleotide
probes (see Chap. 3).
3. To estimate the infectivity parameters of ecological interest in the phytoplankton
population, several algorithms are used according to the formula proposed by
Bush et al. [37]. These parameters include the prevalence of infection (Pr), i.e. the
proportion of individuals in a given the phytoplankton population having one or
more sporangia or rhizoids, expressed as Pr (%) ¼ [(Ni/N) 100], where Ni is
the number of infected host cells and N the total number of host cells. The second
parameter is the mean intensity of infection (I), calculated as I ¼ Np/Ni where Np
is the number of parasites and Ni is the number of infected individuals within a
host population.
4. We propose a third parameter concerning the prevalence of infection of cells in
colonial (or filamentous) species (PrCF). PrCF (%) ¼ [(Ni/N) 100] where Ni is
the number of infected host cells in parasitized colonies (or filaments) and N the
total number of parasitized host colonies (or filaments).
References
9. Van Donk E, Ringelberg J (1983) The effect of fungal parasitism on the succession of diatoms
in Lake Maarsseveen I (The Netherlands). Freshw Biol 13:241–251
10. Canter HM (1950) Fungal parasites of the phytoplankton. I Studies on British chytrids X. Ann
Bot 14:263–289
11. Canter HM, Lund JWG (1951) Studies on plankton parasites. III Examples of the interaction
between parasitism and other factors determining the growth of diatoms. Ann Bot 15:359–371
12. Ingold CT (1940) Endocoenobium Eudorinae gen et sp. nov., a chytridiaceous fungus parasit-
izing Eudorina elegans ehrenb. New Phytol 39:97–103
13. Huber-Pestalozzi G (1944) Chytridium Oocystidis (spec. nova?) ein Parasit auf Oocystis
lacustris Chodat. Aquat Sci 10:117–120
14. Canter HM (1953) Annotated list of British aquatic chytrids. Trans Brit Mycol Soc 36:278–303
15. Canter HM, Lund JWG (1969) The parasitism of planktonic desmids by fungi. Osterr Bot Z
116:351–377
16. Beakes GW, Canter HM, Jaworski GHM (1992) Comparative ultrastructural ontogeny of
zoosporangia of Zygorhizidium affluens and Z. planktonicum, chytrid parasites of the diatom
Asterionella formosa. Mycol Res 96:1047–1059
17. Beakes GW, Canter HM, Jaworski GHM (1992) Ultrastructural study of operculation (dis-
charge apparatus) and zoospore discharge in zoosporangia of Zygorhizidium affluens and
Z. planktonicum, chytrid parasites of the diatom Asterionella formosa. Mycol Res
96:1060–1067
18. Beakes GW, Canter HM, Jaworski GHM (1993) Sporangium differentiation and zoospore fine-
structure of the chytrid Rhizophydium planktonicum, a fungal parasite of Asterionella formosa.
Mycol Res 97:1059–1074
19. Powell MJ (1978) Phylogenetic implications of the microbody-lipid globule complex in
zoosporic fungi. Biosystems 10:167–180
20. Barr DJS (1992) Evolution and kingdoms of organisms from the perspective of a mycologist.
Mycologia 84:1–11
21. Cook WRI (1932) An account of some uncommon British species of the Chytridiales found in
algae. New Phytol 31:133–144
22. Reynolds N (1940) Seasonal variations in Staurastrum paradoxum eyen. New Phytol 39:86–89
23. Canter HM, Lund JWG (1948) Studies on plankton parasites. I Fluctuations in the numbers of
Asterionella formosa Hass in relation to fungal epidemics. New Phytol 47:238–261
24. Canter HM, Lund JWG (1953) Studies on plankton parasites. II The parasitism of diatoms with
special reference to lakes in the English Lake District. Trans Brit Mycol Soc 36:13–37
25. Canter HM (1972) A guide to the fungi occurring on planktonic blue-green algae. In:
Desikachary TV (ed) Taxonomy and biology of blue-green algae. University of Madras,
Chennai, pp 145–159
26. Pongratz E (1966) De quelques champignons parasites d’organismes planctoniques du Léman.
Aquat Sci 28:104–132
27. Gleason FH, Kagami M, Lefevre E, Sime-Ngando T (2008) The ecology of chytrids in aquatic
ecosystems: roles in food web dynamics. Fungal Biol Rev 22:17–25
28. De Bruin A, Ibelings BW, Kagami M, Mooij WM, van Donk E (2008) Adaptation of the fungal
parasite Zygorhizidium planktonicum during 200 generations of growth on homogeneous and
heterogeneous populations of its host, the diatom Asterionella formosa. J Eukaryot Microbiol
55:69–74
29. Rasconi S, Jobard M, Sime-Ngando T (2011) Parasitic fungi of phytoplankton: ecological roles
and implications for microbial food webs. Aquat Microb Ecol 62:123–137
30. Masclaux M, Bec A, Kagami M, Perga ME, Sime-Ngando T, Desvilettes C, Bourdier G (2011)
Food quality of anemophilous plant pollen for freshwater zooplankton. Limnol Oceanogr
56:939–946
31. Gleason FH, Kagami M, Marano AV, Sime-Ngando T (2009) Fungal zoospores are valuable
food resources in aquatic ecosystems. Inoculum 60:1–3
102 T. Sime-Ngando et al.
32. Kagami M, von Elert E, Ibelings BW, de Bruin A, van Donk E (2007) The parasitic chytrid,
Zygorhizidium facilitates the growth of the cladoceran zooplankter, daphnia in cultures of the
inedible alga. Asterionella Proc Biol Sci 274:1561–1566
33. Muller U, Sengbush P (1983) Visualization of aquatic fungi (Chytridiales) parasitizing on algae
by means of induced fluorescence. Archiv Hydrobiol 97:471–485
34. Hageage GJ, Harrington BJ (1984) Use of calcofluor white in clinical mycology. Lab Med
15:109–112
35. Harrington BJ, Hageage GJ (2003) Calcofluor white: a review of its uses and application in
clinacal micology and parasitology. Lab Med 34:361–367
36. Utermöhl H (1958) Zur Vervollkommung der quantitative phytoplankton Methodik. Mitt Int
Verein Limnol 9:1–38
37. Bush AO, Lafferty KD, Lotz JM, Shostak AW (1997) Parasitology meets ecology on its own
terms: Margolis et al revisited. J Parasitol 83:575–583
Chapter 5
Assessment of Host Immune Responses
to Fungal Pathogens
Huilin Su, Chunxiao Li, Jiande Han, Clement K. M. Tsui, and Min Zhu
Contents
5.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 104
5.2 Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 105
5.2.1 Analysis of the Fungal Burden . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 105
5.2.2 Isolation of the Immune System Organs, Infected Organs, and Immune Cells . 106
5.2.3 Detection and Quantification of Immune Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 110
5.2.4 Detection and Quantification of Cytokines . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 112
5.3 Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 114
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 114
H. Su (*)
Department of Dermatology, The First Affiliated Hospital of Zhongshan University,
Guangzhou, China
Department of Dermatology, Huashan Hospital, Fudan University, Shanghai, China
C. Li
Department of Radiation Oncology, Peking University Third Hospital, Beijing, China
J. Han
Department of Dermatology, The First Affiliated Hospital of Zhongshan University,
Guangzhou, China
C. K. M. Tsui (*)
Department of Pathology, Sidra Medicine, Doha, Qatar
Department of Pathology and Laboratory Medicine, Weill Cornell Medicine-Qatar, Doha, Qatar
Division of Infectious Diseases, Faculty of Medicine, University of British Columbia,
Vancouver, Canada
M. Zhu
Department of Dermatology, Huashan Hospital, Fudan University, Shanghai, China
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2022 103
V. K. Gupta, M. Tuohy (eds.), Laboratory Protocols in Fungal Biology, Fungal
Biology, https://doi.org/10.1007/978-3-030-83749-5_5
104 H. Su et al.
5.1 Introduction
5.2 Methods
Fungal burden is an important parameter that reflects the ability of the host to
eliminate the pathogen. In general, the colony-forming unit (CFU) per unit weight
of infected organ or tissue is calculated; for bronchoalveolar lavage fluid (BALF),
CFU per unit of volume is calculated instead. CFU detection is more suitable to
quantify yeast than filamentous fungi since the number of yeast colonies is simpler to
estimate. Nowadays, the quantitative polymerase chain reaction (qPCR) approach is
commonly used to determine the fungal burden. qPCR assays targeting the 18S
rRNA gene [13] and FKS gene [14] in A. fumigatus have been frequently reported in
recent research. Here are two protocols for determining the fungal burden in infected
animals.
5.2.1.1 CFU
1. Remove the infected organ/tissue from the infected hosts in sterile condition.
Weigh the infected samples in 1.5 ml Eppendorf tubes.
2. Homogenize the tissue in saline (e.g. unilateral lung in 2 ml saline). Sterile mortar
and pestle are conventional tools (precaution: grind the organs first before adding
saline), but homogenizers with glass beads at 4 C in 10–20 Hz/s for 30s in the
5 ml sterile tubes with a screw top are recommended for a larger number of
samples. (precaution: reduce or increase the grinding time according to the
sample types until the tissue is completely homogenized).
3. Dilute the homogenate with saline and plate onto Sabouraud dextrose agar (SDA,
Difco, NJ, US) plates in duplicate. A serial diluting concentration (such as 1:10,
1:100, 1:1000) is recommended (30–300 CFU/plate).
4. Count the CFU on the SDA of different dilution ratios after incubation at 35 C
for 48 h.
5. Calculate the fungal burden in the infected organ/tissue (CFU/g).
Table 5.1 Sequences of primers and probe targeting the 18S rDNA of A. fumigatus [13]
Primer name Sequence
Sense amplification primer 5’-GGCCCTTAAATAGCCCGGT-3’
Antisense amplification primer 5’-TGAGCCGATAGTCCCCCTAA-3’
Hybridization probe 5’-FAM-AGCCAGCGGCCCGCAAATG-TAMRA-3’
The immune system organs consist of the central and peripheral immune organs
[15]. Hematopoietic stem cells proliferate and differentiate into B lymphocyte and T
lymphocyte in the central immune organs and are transferred to the peripheral
immune organs [16, 17]. Peripheral immune organs include blood circulation and
lymphatic circulation, which are interconnected into a network and supply the area
where immune cells aggregate and immune responses occur [18, 19]. To investigate
the immune responses in the hosts, it is important to separate the immune organs and
immune cells from the hosts. The size and status of organs and constitution of
immune cells in the organs could reflect the immune responses in local or general
infection after fungi invasion [20, 21]. If the separated immune cells need to be
cultured for further experiment, all the procedures should be performed in sterile
condition. Here, we use the mouse model as an example to show the process of
immune organs separation.
5 Assessment of Host Immune Responses to Fungal Pathogens 107
5.2.2.1 Thymus
The thymus is an organ in the central immune system for cytogenesis, differentia-
tion, and maturation of different T cells [22]. The thymus consists of thymus cells
and thymus stromal cells, and stromal cells include thymus epithelial cells, macro-
phages, dendritic cells, and fibroblasts. Thymus epithelial cells secrete thymosin and
thymulin, which activates the function of immune cells [23].
1. After euthanasia is performed, disinfect the mice’s skin on the chest and
abdomen.
2. After dissection, cut and lift the ribs and sternum. The thymus of mice is located
in the anterior superior thorax. The white lobes above the heart are the thymus.
3. Remove the thymus and put it in the complete medium (DMEM or RPMI1640,
10% fetal bovine serum (FBS), 100 U/ml penicillin, 100 μg/ml streptomycin
sulfate) (Gibco, MA, US) or PBS buffer (1%FBS + 2 mM EDTA) (Gibco, MA,
US) for further experiment.
5.2.2.3 Spleen
The spleen is the largest peripheral immune organ in the body, which accounts for
25% of the total lymphoid tissue in the whole body. It contains a large number of
lymphocytes and macrophages and is the center of cellular immunity and humoral
immunity [27]. It also filters the blood of pathogens and abnormal cells and works as
a hemopoietic organ during embryonic development [28].
108 H. Su et al.
Lymph nodes (LNs) are filters of lymphatic fluid and supply sites where T and B
lymphocytes migrate, proliferate, and differentiate into immune effector cells after
being stimulated by antigens [29]. In fungal infection, it performs the function of
filtering, killing, and clearing pathogens [30].
The LNs are easy to isolate and commonly used in research and mainly include
cervical, axillary, inguinal, and mesenteric LNs [31, 32]. The superficial cervical
LNs are located on the superficial and lateral sides of the left and right submandib-
ular glands, often surrounded by adipose tissue. Axillary LNs are located in the
adipose tissue of the axilla. Inguinal LNs are located in the left and right gluteus
muscles lacuna. Mesenteric lymph nodes are located in mesenteric adipose tissue.
During infection, the draining lymph nodes of the infected site would be larger than
the normal ones and easy to see and separate. Remove the lymph nodes and put them
in a complete medium or PBS for further experiment.
5.2.2.5 Blood
Blood cells are derived from the hematopoietic pluripotent stem cells in the bone
marrow [33]. Neutrophils, eosinophils, basophils, monocytes, and lymphocytes are
the main immune cells in the blood. Neutrophils play an important role in the
prevention of invasive fungal infections [34]. Peripheral blood mononuclear cells
(PBMCs) are indispensable in immunological diagnostics and research. PBMCs
include lymphocytes (T cells, B cells) and monocytes in blood. A few methods for
isolation of PBMCs are available, among which density centrifugation using a
commercial kit is frequently used. The procedures could be referred to references
or kit instructions [35, 36]. The number and function of these immune cells in blood
determine the results of infection and are considered as the indicator for evaluating
the infectious status of the host. Here, we only describe the protocol for whole blood
cells isolation.
1. Collect blood in tubes containing heparin for cells separation.
2. Centrifuge at 4 C at 500 g for 5 min, and the supernatant is discarded.
3. Collect the cells for erythrocyte lysis following the session 2.8.4–2.8.7.
5 Assessment of Host Immune Responses to Fungal Pathogens 109
The contents of BALF include the immune cells and immunological materials
[37]. During fungal infection in the lung, the constitution and number of immune
cells, level of cytokines, and CFU could reflect the level of immune responses in
infected lung [38]. CFU in BALF could also be used as a sign of fungal burden. CFU
per unit of volume is calculated. Galactomannan in BALF could be used in the
diagnosis of pulmonary aspergillosis [39, 40].
1. The airway contents are recovered by the instillation and retrieval of 1 ml of
sterile PBS through a tracheotomy tube. Cells are collected by a total of 3 lavages
and pooled.
2. Centrifuge at 1500 rpm for 5 min at 4 C. After centrifugation, the supernatant is
used for biochemical and immunological tests for the pulmonary infection model.
3. Resuspend the cells in complete medium. Centrifuge at 1500 rpm at 4 C for
5 min.
4. Perform gentle operations in the whole process. If there are erythrocytes in the
cells, collect the cells for erythrocyte lysis following 2.8.4–2.8.7.
In fungal infection, the immune cells migrate to the infected organs. Analyzing the
immune cells in infected organs or cytokines in tissue homogenate can reflect the
degree of inflammation and the immune responses after infection.
Here, we use a lung tissue sample to illustrate the methods for tissue digestion.
Adjust the constitution of digestion buffer according to the types of tissue or
organ [41].
1. Wash the lung sample with sterile PBS to remove the blood on the surface of the
organ. Dissect the tissue into small pieces with ophthalmic scissors.
2. Transfer the unilateral lung tissue into the tube containing 2 mL digestion buffer
(1.7 ml DMEM+0.2 ml FBS + 100ul 10 mg/ml collagenase IV + 4 μl 0.05 mg/μl
DNase) (ThermoFisher Scientific, MA, US).
3. Incubate the tube for 30 min at 37 C, mixing at 260 r/min in the shaker. The
parameters for enzymatic digestion vary with tissue pieces size and enzymatic
activity.
4. Collect the digested lung tissue and filtrate with 100 μm-pore-size screens.
5. Centrifuge the filtrated cell suspension at 1500 rpm for 5 min.
6. Discard the supernatant. Resuspend the cells in a complete medium for erythro-
cyte lysis.
110 H. Su et al.
For the immune solid organs isolated in 2.1–2.4, they need to be processed in the
immune cell suspension for further experiment especially in the flow cytometry. For
the immune organs with a rich blood supply, erythrocyte lysis needs to be performed
before further study of the immune cells. Blood cells, BALF cells, and bone marrow
can be directly used for erythrocyte lysis and start from 2.8.4 [42].
1. Weigh the immune organs (spleen, LNs, thymus) in Eppendorf tubes after
dissection of the euthanized animals.
2. Grind the immune organs using the blunt end of the syringe.
3. Filter the cells through a 100 μm-pore-size screen to separate the cells from the
connective tissue.
4. Add Tris-NH4Cl (tris(hydroxymethyl)aminomethane-ammonium chloride)
erythrocyte lysis buffer (3.735 g NH4Cl, 1.3 g Tris in 500 ml ddH2O) into the
cells to lyse the erythrocytes. Volumes are adjusted for different cells (e.g. 5 times
the volume for normal immune organs; 10 times volume for blood cells).
5. Wash the cells with a complete medium, and centrifuge and resuspend the cells in
the complete medium.
6. If the erythrocyte lysis process is incomplete, repeat steps 4 and 5 again.
7. Resuspend the cells in a complete medium for cell counting and flow cytometry.
5.2.2.9 Histology
some immune cells have different surface markers in humans and animals. Here is a
list of common markers for innate and adaptive immune cells (Table 5.3).
1. Choose the suitable surface marker for targeting immune cells and design the
multicolor plan.
2. Measure and add about 106 cells in the Eppendorf tube.
3. Preincubate cell suspension with purified CD16/CD32 mAb ( 1 μg/million cells
in 100 μl) (BD, NJ, US) at 4 C for 5 min or dilute the antibodies in PBS
containing 2% bovine serum albumin (BSA) to reduce Fc receptor-mediated
binding.
4. Add 50 μl antibodies for staining. Cells are stained for 30 min at 4 C and
protected from light.
5. Centrifuge at 1500 rpm for 5 min at 4 C.
6. Wash the cells with PBS, and centrifuge and resuspend the cells in 1 mL PBS
containing 0.1% BSA.
7. Perform the flow cytometry in a few hours according to the protocol published
before [48] or the protocol provided by the flow cytometer.
8. Fix the cells in paraformaldehyde if they are detected in a timely manner. Keep
the samples in the dark after fixation.
9. Analyze the flow cytometry data using FlowJo (BD, New York, USA) or other
software package.
112 H. Su et al.
1. Weigh the immune organs. Prepare blood sample or cell suspension for erythro-
cyte lysis. Resuspend the cells in a complete medium in 2.1.
2. Count the cells using a hemocytometer or automated cell counting instrument.
3. Calculate the number of cells per organ or volume of blood.
4. Calculate the number of specific immune cells using the total number and the
percentages generated from flow cytometry.
Cytokines are small molecular proteins with extensive biological activities, and they
work together as a network in the innate and adaptive immunity systems in fungal
infection [49, 50]. Cytokines are usually protein or polypeptide molecules which
have antigenicity. Based on the high specificity of the antigen-antibody reaction,
immunoassays are the most common methods for detecting cytokines. The common
methods include flow cytometry, enzyme-linked immunosorbent assay (ELISA),
radioimmunoassay (RIA), enzyme-linked immunospot assay (ELISPOT), and
Western blot.
5.2.4.2 ELISA
ELISA is a qualitative or quantitative test that uses antibodies to bind and measure a
molecule of interest. It remains the method of primary choice and one of the most
widely used methods for detecting cytokines for its specificity and simplicity in
many laboratories.
1. Select the antigen-coated plates and enzyme (take horseradish peroxidase (HRP)
as an example).
2. Add 100 μL of standards and samples (select appropriate dilution ratio) to wells.
Incubate the samples at room temperature for 2 h.
3. Discard the solutions from wells.
4. Wash the plates four times.
5. Add 100 μL HRP enzyme-labeled antibody to wells and incubate at room
temperature for 30 min to 1 h according to the manufacturer’s instructions.
6. Discard the solutions from wells.
7. Wash the plates four times.
8. Add 100 μL chromogenic substrate to wells.
9. Develop the plate at room temperature in the dark for 30 min.
10. Add 100 μL stop solution to wells.
11. Evaluate the results in 30 min after stopping the reaction. Read the plates at
450 nm and 550 nm. Subtract 550 nm values from 450 nm values to correct for
optical imperfections in the microplate.
12. Calculate the results according to the standard curve.
There are other methods important in immunological research not covered in this
chapter. Several traditional methods including radioimmunoassay (RIA), enzyme-
linked immunospot assay (ELISPOT), and Western blot are commonly used for
cytokine detection. Most of these methods are based on antigen/antibody reaction;
the antibodies are incorporated with a radioisotope or biotin-labelled secondary
antibody for detection. Molecular methods are also used for cytokine detection
through the gene probes of cytokines to detect the expression level. The detection
methods include Northern blot, real-time PCR, and in situ hybridization.
With the advent of novel technologies in laboratory diagnosis, multiple cytokine
detection methods have been developed recently, such as flow cytometry and
electrochemiluminescence. Based on flow cytometry platform, technologies such
as cytometric bead array (CBA) [51], FlowCytomix, LEGENDplex, and Luminex
Assay have been developed. Briefly, fluorescent microbeads are coated with specific
antibodies. When the beads are mixed with the biological sample, biomolecular
binding interaction occurs between the specific antibodies and cytokines antigens,
the binding activity/analyst can be detected by signals generated by means of flow
cytometry. In the electrochemiluminescence assay, electrochemistry-induced
114 H. Su et al.
5.3 Summary
The interaction between the host and fungus pathogens are complicated; human
hosts having different immune status may lead to contrasting clinical outcome. Early
diagnosis and treatment contribute to the prognosis of fungal infections. Better
understanding of antifungal immune response contributes to the improvement of
diagnosis and therapy of fungal infections. The protocols described above are
fundamental and useful in immunological research.
References
14. Vallor AC, Kirkpatrick WR, Najvar LK et al (2008) Assessment of aspergillus fumigatus
burden in pulmonary tissue of Guinea pigs by quantitative PCR, galactomannan enzyme
immunoassay, and quantitative culture. Antimicrob Agents Chemother 52(7):2593–2598
15. Parkin J, Cohen B (2001) An overview of the immune system. Lancet (London, England) 357
(9270):1777–1789
16. Wilson A, Trumpp A (2006) Bone-marrow haematopoietic-stem-cell niches. Nat Rev Immunol
6(2):93–106
17. Höfer T, Rodewald HR (2018) Differentiation-based model of hematopoietic stem cell func-
tions and lineage pathways. Blood 132(11):1106–1113
18. Hasenberg M, Stegemann-Koniszewski S, Gunzer M (2013) Cellular immune reactions in the
lung. Immunol Rev 251(1):189–214
19. Holt PG, Strickland DH, Wikström ME, Jahnsen FL (2008) Regulation of immunological
homeostasis in the respiratory tract. Nat Rev Immunol 8(2):142–152
20. Salazar F, Brown GD (2018) Antifungal innate immunity: a perspective from the last 10 years. J
Innate Immun 10(5–6):373–397
21. Drummond RA, Lionakis MS (2019) Organ-specific mechanisms linking innate and adaptive
antifungal immunity. Semin Cell Dev Biol 89:78–90
22. Kurd N, Robey EA (2016) T-cell selection in the thymus: a spatial and temporal perspective.
Immunol Rev 271(1):114–126
23. Thapa P, Farber DL (2019) The role of the thymus in the immune response. Thorac Surg Clin 29
(2):123–131
24. Morrison SJ, Scadden DT (2014) The bone marrow niche for haematopoietic stem cells. Nature
505(7483):327–334
25. Assouvie A, Daley-Bauer LP, Rousselet G (2018) Growing murine bone marrow-derived
macrophages. Methods Mol Biol (Clifton, NJ) 1784:29–33
26. Manzanero S (2012) Generation of mouse bone marrow-derived macrophages. Methods Mol
Biol (Clifton, NJ) 844:177–181
27. Bronte V, Pittet MJ (2013) The spleen in local and systemic regulation of immunity. Immunity
39(5):806–818
28. Lewis SM, Williams A, Eisenbarth SC (2019) Structure and function of the immune system in
the spleen. Sci Immunol 4(33):eaau6085
29. Butler J, Sawtell A, Jarrett S et al (2016) Imaging immunity in lymph nodes: past, present and
future. Adv Exp Med Biol 915:329–346
30. Bogoslowski A, Kubes P (2018) Lymph nodes: the unrecognized barrier against pathogens.
ACS Infect Dis 4(8):1158–1161
31. Turner VM, Mabbott NA (2017) Structural and functional changes to lymph nodes in ageing
mice. Immunology 151(2):239–247
32. Matheu MP, Parker I, Cahalan MD (2007) Dissection and 2-photon imaging of peripheral
lymph nodes in mice. J Visu Exp 7:265
33. Lim WF, Inoue-Yokoo T, Tan KS, Lai MI, Sugiyama D (2013) Hematopoietic cell differenti-
ation from embryonic and induced pluripotent stem cells. Stem Cell Res Ther 4(3):71
34. Cunha C, Kurzai O, Löffler J, Aversa F, Romani L, Carvalho A (2014) Neutrophil responses to
aspergillosis: new roles for old players. Mycopathologia 178(5–6):387–393
35. Grievink HW, Luisman T, Kluft C, Moerland M, Malone KE (2016) Comparison of three
isolation techniques for human peripheral blood mononuclear cells: cell recovery and viability,
population composition, and cell functionality. Biopreservation Biobanking 14(5):410–415
36. Riedhammer C, Halbritter D, Weissert R (2016) Peripheral blood mononuclear cells: isolation,
freezing, thawing, and culture. Methods Mol Biol (Clifton, NJ) 1304:53–61
37. Lee SH, Sung JY, Yong D et al (2016) Characterization of microbiome in bronchoalveolar
lavage fluid of patients with lung cancer comparing with benign mass like lesions. Lung Cancer
(Amsterdam, Netherlands) 102:89–95
116 H. Su et al.
38. Avni T, Levy I, Sprecher H, Yahav D, Leibovici L, Paul M (2012) Diagnostic accuracy of PCR
alone compared to galactomannan in bronchoalveolar lavage fluid for diagnosis of invasive
pulmonary aspergillosis: a systematic review. J Clin Microbiol 50(11):3652–3658
39. Lai G, Zeng C, Mo J, Song WD, Xu P (2020) Diagnostic value of galactomannan in
Bronchoalveolar lavage fluid for chronic respiratory disease with pulmonary aspergillosis. J
Clin Microbiol 58(3):e01308-19
40. Jenks JD, Prattes J, Frank J et al (2020) Performance of the Bronchoalveolar lavage fluid
aspergillus galactomannan lateral flow assay with cube reader for diagnosis of invasive pulmo-
nary aspergillosis: a multicenter cohort study. Clin Infect Dis. https://doi.org/10.1093/cid/
ciaa1281
41. Reichard A, Asosingh K (2019) Best practices for preparing a single cell suspension from solid
tissues for flow cytometry. Cytometry A 95(2):219–226
42. Chow S, Hedley D, Grom P, Magari R, Jacobberger JW, Shankey TV (2005) Whole blood
fixation and permeabilization protocol with red blood cell lysis for flow cytometry of intracel-
lular phosphorylated epitopes in leukocyte subpopulations. Cytometry A 67(1):4–17
43. Feldman AT, Wolfe D (2014) Tissue processing and hematoxylin and eosin staining. Methods
Mol Biol (Clifton, NJ) 1180:31–43
44. Reza Kermanshahi T, Rhatigan R (2010) Comparison between PAS and GMS stains for the
diagnosis of onychomycosis. J Cutan Pathol 37(10):1041–1044
45. Roden AC, Schuetz AN (2017) Histopathology of fungal diseases of the lung. Semin Diagn
Pathol 34(6):530–549
46. Ramos-Vara JA (2017) Principles and methods of immunohistochemistry. Methods Mol Biol
(Clifton, NJ) 1641:115–128
47. McKinnon KM (2018) Flow cytometry: an overview. Curr Protoc Immunol 120:5.1.1–5.1.11
48. Maciorowski Z, Chattopadhyay PK, Jain P (2017) Basic multicolor flow cytometry. Curr Protoc
Immunol 117:5.4.1–5.4.38
49. Sparber F, LeibundGut-Landmann S (2019) Interleukin-17 in antifungal immunity. Pathogens
(Basel, Switzerland) 8(2):54
50. Sambatakou H, Pravica V, Hutchinson IV, Denning DW (2006) Cytokine profiling of pulmo-
nary aspergillosis. Int J Immunogenet 33(4):297–302
51. Castillo L, MacCallum DM (2012) Cytokine measurement using cytometric bead arrays.
Methods Mol Biol (Clifton, NJ) 845:425–434
52. Abdullah MAA, Wang J (2019) Ultrasimple single-cell detection of multiple cytokines by a
Nanowell Chip integrated with encoded microarrays. ACS Sensors 4(9):2296–2302
53. Goepfert J (2020) Comparison of bead-based fluorescence versus planar
Electrochemiluminescence multiplex immunoassays for measuring cytokines in human plasma.
Front Immunol 11:572634
Chapter 6
Recent Advances in Applications of Support
Vector Machines in Fungal Biology
Contents
6.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 118
6.1.1 Support Vector Machine . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 118
6.2 Domain Features . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 119
6.3 Review of Some Recent Fungal Bioinformatics Applications Using SVM . . . . . . . . . . . . . 120
6.3.1 Haar Wavelets Features for Fungal Disease Detection in Maize Leaves . . . . . . . 120
6.3.2 Quality Detection of Pomegranate Fruit Infected with Fungal Disease . . . . . . . . 121
6.3.3 Support Vector Machines Enabled Fungal Rust Disease Detection in Pea Plant
(Pisam Sativam) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 122
6.3.4 Volatomic Visualization for Fungal Infection Detection on Storage Jasmine . 122
6.3.5 Hyperspectral Imaging Enabled Electronic Nose for Fungal Contamination
Identification in Strawberries . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 123
6.3.6 Rapid Discrimination of Fungal Species by the Colony Fingerprinting . . . . . . . 124
6.3.7 SVM Classifier Based Grape Leaf Disease Detection . . . . . . . . . . . . . . . . . . . . . . . . . . 124
6.3.8 Hyphae Detection in Fungal Keratitis Images . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 125
6.3.9 Plant Diseases Classification Using SVM and ANN (Artificial Neural Network) 126
6.3.10 A Hybrid Combination of Multiple SVM Classifiers for Automatic
Recognition of the Damages and Symptoms on Plant Leaves . . . . . . . . . . . . . . . . . 126
6.3.11 Machine Learning of Protein Interactions in Fungal Secretory Pathways . . . . . . 127
6.3.12 Fungal Adhesins and Adhesin Like Proteins Predictions . . . . . . . . . . . . . . . . . . . . . . . 127
6.3.13 Computational Prediction of Antifungal Peptides . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 128
6.3.14 A Novel Method of Annotation of Antifungal Peptides Based on Distributed
Representation of Protein Sequences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 129
6.3.15 Identification of Antifungal Using Distributed Representation of Sequences . . 130
S. Modak
Life Sciences and Healthcare Unit, Persistent Systems Inc., Santa Clara, CA, USA
A. Lahorkar
Center for Modelling and Simulation, Savitri Bai Phule Pune University, Pune, India
J. Valadi (*)
Department of Computer Science, Flame University, Pune, India
e-mail: jayaraman.vk@flame.edu.in
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2022 117
V. K. Gupta, M. Tuohy (eds.), Laboratory Protocols in Fungal Biology, Fungal
Biology, https://doi.org/10.1007/978-3-030-83749-5_6
118 S. Modak et al.
6.1 Introduction
Machine learning has recently been employed successfully in fungal biology. The
methodologies used include both supervised and unsupervised learning. Supervised
learning employs prior domain knowledge to build models. The models built can be
used to derive information for new examples. Classification and regression form
major supervisory learning paradigms used in fungal biology. Unsupervised learn-
ing, on the other hand, is used to discover structured information without prior
domain knowledge. Several classification and regression algorithms are available in
machine learning which is routinely employed for quick and low-cost acquisition of
invaluable information. Support Vector Machines is a valuable classification and
regression tool employed in different fields of science and engineering for high-
performance prediction tasks. Support Vector Machines have been used profusely in
a fungal domain for the identification of plant diseases, characterization of fungal
keratitis, and other fungal infections. Support Vector Machines have also been
successfully used to predict potential antifungal peptides. In this chapter, after a
brief discussion on SVM, we will be discussing various case studies where SVM has
been used in fungal biology. Apart from that, we have also presented our own
unpublished work on the prediction of antifungal peptides. This is based on a recent
method on the distributed representation of protein sequences which has been used
for extracting embedding vectors using unsupervised learning. The informative
embedding vectors are further employed as input attributes to SVM classifier to
find whether a given peptide sequence has antifungal activity or not.
Fig. 6.1 Cartoon of SVM as a maximum margin classifier. Examples on the margin are Support
Vectors
transforms the examples to a higher dimensional attribute space. After this, SVM
employs a linear maximum margin classifier to separate these classes of sequences.
Further, it reduces complexity by defining different kernel functions. These include
RBF, Polynomial, Gaussian, and Neural network kernels. These are domain-
dependent kernels like mismatch kernel, Fischer kernel, and string kernels. Detailed
discussions on the working of the SVM algorithm along with diverse types of the
algorithm have been provided in Modak et al. [2].
Several classes of domain features are extracted for predictions and classifications.
These include sequence-based features, image-based features, and spectral features.
Sequence-based features include (1) amino acid frequencies, (2) dipeptide &
tripeptide, and higher-order K-mer frequencies; (3) Physiochemical properties
(4) Position specific Scoring Matrix (PSSM) profile-based attributes (5) Pseudo-
amino acid composition-based features etc. Image-based features include pixel-
based features, shape descriptors, frequency domain-based features like wavelet
features, and other descriptors extracted from leaf images and solid phase
microextraction/gas chromatography-mass spectrometry (SPME/GC-MS) based
volatility markers. Once the features are extracted, feature selection algorithms can
120 S. Modak et al.
be employed for the identification of the most informative features. Feature selection
algorithms include filter, wrapper, and embedded methods. A detailed discussion of
diverse types of feature selection algorithms has been provided in Modak et al. [2].
In this section, we outline few important problems in bioinformatics where SVM has
been applied with interesting results on many real-world fungal biology case studies.
Agriculture is the most vital part of the economy of any of the countries in the world.
That is why the diseases which affect the agricultural crops are serious concerns
since they affect the economy of the country. One of the most common crops
cultivated throughout the globe is maize. The importance of this crop is not only
limited to being food for humans and cattle, it is also the source of a lot of
commercial products like baby corn, corn starch, and corn oil. Thus, the research
community has been exploring the avenues to detect such diseases in maize crops in
the preliminary stages to minimize the loss. From the range of the diseases affecting
maize crops, Desai et al., proposed an image-based method to detect diseases in
maize plants [3].
For this study, the authors targeted fungal diseases along with common rust and
northern leaf blight in the maize leaf. The very first step was the collection of images,
which was carefully executed by making sure that all the images collected over the
period are consistent. This was achieved by capturing images; all pictures are taken
at 11:00 AM and by keeping a consistent distance of two feet from the leaves. The
final dataset of images consisted of 200 images, which were distributed in the
following categories (a) 50 healthy, (b) 50 common rust, (c) 50 northern leaf blight,
and (d) 50 images with both diseases present in it. All these images were
preprocessed to make sure that the illumination is uniform throughout all the images.
Once the images were converted to RGB colour space, red, blue, and green channels
were separated for feature extraction. The first-order histogram features were con-
sidered for this study which are estimated properties of individual pixel values by
ignoring the spatial interaction between image pixels [4]. One important aspect of
image analysis is texture analysis, which was incorporated in this work by wavelet
representation. The wavelet transformation for feature extraction involves Haar
transform [5]. Haar wavelet is applied to RGB images to obtain horizontal, vertical,
and diagonal coefficients. Later, Gray-Level Co-occurrence Matrix (GLCM) is
6 Recent Advances in Applications of Support Vector Machines in Fungal Biology 121
constructed in two directions (0 and 90 ) for each of the coefficients. Finally, k-NN
and SVM classifiers were employed for classification. k-NN yielded the highest
accuracy of 85% for k ¼ 5 and while SVM-based classification yielded 88% of
accuracy.
The hazards of fungal infections are not only restricted to common crops like maize
but also some varieties of fruits that are well known and widely consumed for their
known benefits. Pomegranate fruit is one such example because of its several health-
promoting effects including positive effects on the cardiovascular system, human
immune system, menopausal complaints, and diabetes mellitus [6]. Like most crops,
the harvest and transportation of these fruits involve the risk of contamination of
pathogenic fungi. Alternaria specie or Aspergillus specie is known which infects
pomegranate throughout all its stages of life, from the early stage of ripeness through
its development [7, 8].
Even with current advances in technologies, a lot of time and effort will be needed
to develop a non-destructive quality assessment of Alternaria fungi. To address this
problem, Rafiee S. et al., worked on developing a non-destructive, inexpensive, and
fast technique to evaluate the quality of pomegranate [9]. Metal Oxide Semiconduc-
tor (MOS) biosensors were employed using linear and non-linear methods for
quality assessment. In this elaborative work, sampling was done using 60 Pomegran-
ates of the ‘Robab’ genotype, which were similar in shape and size. These samples
were classified into different amounts of Alternaria specie infection, ranging from
0%, 25%, 50%, 75%, and 100%. The methods which were employed for linear and
non-linear analysis methods for detection were (a.) Back Propagation Neural Net-
work (BPNN), (b.) Discriminant Analysis (LDA), and (c.) Support Vector Machine
(SVM). Finally, the results from each different method were compared with each
other. In this study, authors concluded that 100% detection accuracy between
healthy and infected samples was achieved by the LDA method, by using only
two MOS sensors. Back Propagation Neural Network proved to be the most efficient
prediction method with an accuracy of 100% in the detecting of 0%, 25%, 50%,
75%, and 100% infected pomegranates. In this comparison study, the BPNN method
performed better than LDA and SVM analysis, in terms of accuracy, in detecting
fungal infestation in various stages. The authors concluded that this technique can be
reliably used to effectively evaluate the quality of the pomegranate with high
precision.
122 S. Modak et al.
Fungal contamination in grains can not only affect the economy but also can cause
danger to human health since some fungal strains such as Aspergillus can produce
harmful mycotoxins [20–24]. Siripatrawan U. et al., with the aim of preventing
infected rice from entering the food chain by detecting the fungal infection in rice at
an early stage [25]. In this study, the detection unit, i.e. the electronic nose when
coupled with chemometrics, proved to be a fast and non-destructive detection
method for fungal contamination in Jasmine brown rice grain. For the prediction
model, the source of data was the artificially infected Jasmine brown rice, which was
6 Recent Advances in Applications of Support Vector Machines in Fungal Biology 123
E-nose coupled with hyperspectral imaging (HSI) was also used by Tu K. et al. to
show a non-destructive method for detection of quality and microbial content of
strawberries during decay [26]. The spectral data and images of strawberries were
acquired using a lab-scale visible/near-infrared HSI system. In the proposed method,
PCA was employed to reduce the dataset dimensionality and for extracting features
from the HSI and E-nose data.
First, the aroma, spatial, and spectral information was acquired by HSI and
E-nose during the decay of strawberries. Multivariate calibration models were
developed using the sensor and spectral signals to detect fungal contaminations in
strawberries. For the development of calibration models, E-nose and HSI data was
integrated for improving the decay detection of strawberries. In this study, one of the
important conclusions was the correlation between the interior compositions of the
fungi-infected strawberries and changes in exterior appearances was highly signif-
icant. Colony-forming units were found with a correlation coefficient value of 0.925
and root mean square error of 0.38. In conclusion, the authors recorded and
124 S. Modak et al.
recommended that the two sensing techniques can be combined for the detection of
the quality of strawberries.
India is one of the major producers of grapes, which adds up to the agro-economy of
the country. The annually major percentage of this important crop is affected by the
diseases due to microbial infections; thus, technological solutions aiding the increase
in the yield of this crop has been one of the focused areas of the research. Plant
diseases are mostly caused to leaves by attacks of viruses, fungi, and bacteria. As
discussed in the above examples, one simple approach is to find the disease in the
6 Recent Advances in Applications of Support Vector Machines in Fungal Biology 125
early stage, so that necessary control steps could be taken to minimize the hazard.
There are several successful studies proving the use of image processing to effi-
ciently detect and classify leaf diseases in plants [30]. Yadav et al. worked on the
same approach, using image processing coupled with SVM to detect and classify
diseases in grape leaves [31].
For this study, the images data of healthy leaves were combined and leaves
infected by Powdery Mildew and Downy Mildew. In such a method, it is important
to preprocess the image data to filter any noise in the background and suppress
distortions to make all images consistent. After preprocessing, the authors performed
image segmentation by separating images into homogenous regions as per certain
features. K-means clustering was employed for image segmentation. Clustering
methods group similar data from large sets of data into much smaller clusters.
Once the diseased region in the leaves is detected using segmentation by K-means
clustering, colour, and texture features were extracted. Total nine texture features
were considered for this study, namely; (a) contrast, (b) uniformity, (c) maximum
probability, (d) homogeneity, (e) diagonal variance, (f) difference variance,
(g) entropy, (h) inverse difference, (i) and nine colour features. Finally, Linear
Support Vector Machine (LSVM) was employed for the classification of leaf
diseases. Classification accuracy of 88.89% was achieved for examined diseases.
Some fungal organisms also cause infection in the human cornea and that results in
conditions like Fungal Keratitis [32]. This inflammatory infection can cause blind-
ness in most cases, thus accurately diagnosing Fungal Keratitis is critical [33]. Fungal
Keratitis can be clinically diagnosed by methods like microscopic examination of
cornea scrapings, slit-lamp examination, polymerase chain reaction (PCR), tissue
biopsy, fungal culture, and confocal microscopy [34]. Out of all these techniques,
confocal microscopy is based on the optical imaging approach, where hyphae
detection can be done by analyzing the cornea images from confocal microscopy.
The challenging part is to accurately find the abnormal cornea images with hyphae
from the normal cornea images with nerves. To address this issue, Ren J. et al.,
proposed a novel method to aid physicians in diagnosing this condition by automat-
ically detecting hyphae after processing images from confocal microscopy [35].
The method is composed of two important steps: (a) classification of texture in the
input images and (b) detection of hyphae. Adaptive robust binary pattern (ARBP) is
evolved as a contrast stretching algorithm and is sub-regional in character. This
method is used to extract the texture features from the images, which are eventually
fed into the SVM classification model to classify between abnormal and normal
images. In the downstream pipeline, the targets are further enhanced by binarization,
where hyphae detection was achieved by a line segment detector algorithm. Finally,
the severity of infection is quantitatively evaluated by the hyphal density. The
126 S. Modak et al.
authors were able to show the effectiveness of improvement of the AMBP in the
extraction of texture features from images.
With the advent of computational techniques, there has been a sudden increase in its
application in areas of agriculture and horticulture. In simple words, the computa-
tional techniques are explored to develop a decision support system which can be
used as an expert system for decision making for agricultural yield or plant protec-
tion. Byadgi AS. et al. showed a study where colour and texture features were used
to build a classification model to recognize diseases in plants [36]. The method
proposed by authors in this work starts with acquisition of images, followed by
preprocessing the images, features extraction and selection, and finally building the
classification model.
Because most of plant diseases are caused by five factors, namely: (a) viral,
(b) fungal, (c) bacterial, (d) nematodes, and (e) deficiency [37], authors used
900 sample images as test data. This set consisted of 150 images for each category
mentioned above, and 150 images from normal plants which were not affected, thus
resulting in six classification categories. In the work, colour and texture features
were extracted, where colour features were based on RGB and HSI colour models,
while the texture features were based on Gray level cooccurrence matrices (GLCM)
[38, 39]. For classification, authors used studied the behaviour of SVM and ANN in
the context of the suitability of classifiers by employing ANN-based classifiers using
multilayer feed-forward with back propagation and SVM based classifiers for
recognizing plant disease in the images. In this comparative study, SVM yielded
maximum accuracy of 98% using joint colour and texture features, showing that
SVM classifiers are more suitable for the identification and classification of plant
diseases that affect agricultural and horticulture crops.
Benazoun A. et al. described in their work how image recognition was addressed to
automatically recognize the disease symptoms and damages in plant leaves using a
hybrid combination of three SVM classifiers [40]. The proposed system was based
on the serial combination of two classifiers, which is used in parallel with an
individual classifier [41].
6 Recent Advances in Applications of Support Vector Machines in Fungal Biology 127
In the work, the test dataset consisting of images were composed of two catego-
ries; symptoms of three fungal diseases namely, (a) Early blight, (b) Late blight, and
(c) Powdery mildew and damage by three pest insects namely, (d) Leaf miners,
(e) Thrips, and (f) Tuta abosluta. To improve the quality of the data, images were
preprocessed, which included filtering and resizing. This is a crucial step for efficient
segmentation and analysis, which are further steps in the proposed method. In the
feature extraction step, segmented images were represented as the feature vector.
Texture, colour, and shape of plant leaves were features included in this study to
classify damage and symptoms in the image data. The serial architecture handled the
colour-based classification of images. It dealt with the damages and/or symptoms,
taking into consideration the similarity or nearest colour belonging to the same class.
While the second classifier further classified similar colours based on texture and
shape. In this comparative study, an overall recognition rate of 93.9% was achieved,
which was better than other existing methods. In conclusion, the authors recorded
that the proposed method can easily overcome the classification problems by other
methods and it can be strategically used for phytosanitary and diagnosis for recog-
nition of infected plants using image data.
The cell surface interacts with the outside environment, which is important to carry
out cellular functions. This interaction involves macromolecules such as Adhesins.
They are present in a wide variety of microorganisms such as fungi, bacteria etc. The
key role of adhesins is to help adhesion of pathogens to host cells, which is followed
128 S. Modak et al.
by colonization of the microorganisms in the hosts. One of the most significant roles
played by adhesins includes the formation of a biofilm, which acts as a defensive
shield against hazardous surroundings and aids in prolonging the infection
[43]. Identification and characterization of fungal adhesins have been explored less
in contrast with bacterial adhesins. Insights on sequence characterization of the
fungal adhesins might open new avenues to understand the process where they
play a critical role in pathogenesis. Thus, research efforts are directed towards
exploring computational methods to develop a rapid and effective approach to
characterize and find fungal adhesins.
Nath A. proposed a method to accurately predict the fungal adhesins [44]. His
work also includes the identification of consensus molecular signatures present in
fungal adhesins. Dataset for this study consisted of 75 fungal adhesins and
341 non-adhesin protein sequences, which were processed to extract sequence-
based and evolutionary features. These features include Amino acid composition
(AAC), Dipeptide counts (DPC), Property group composition (PGC), Physicochem-
ical-2-grams (P2G), Atomic composition (ATC), Physicochemical properties (PCP)
and features based on evolutionary information. In this comparative study, different
algorithms were employed to find the best performing machine learning algorithms
which can effectively predict adhesin protein. These methods include (a) Naïve
Bayes, (b) SVM with Sequential minimization optimization implemented with
Poly-K, RBF, and PuK kernels, (c) Bagging with REPTree, (d) Real Adaboost,
and (e) Adaboost with decision stumps. The author noted that the SVM kernel-based
approaches viz., RBF, PuK, and SMO-PolyK, performed better than other algo-
rithms. Based on the leave, one outperformance measure accuracy of 94.9% was
obtained on cross validation procedure and a validation set accuracy was achieved
up to 98.0%.
Most of the living organisms show innate shield immunity gotten during lifecycle
and its strength depends on serval factors. In humans, patients with weak immunity
are prone to fungal infections, which can lead to dreadful consequences. Invasive
fungal infections cause high morbidity and mortalities. Despite tremendous
advances in the field of antibiotics research, Candida, Aspergillus, Pneumocystis,
and Cryptococcus spp. [45] cause more than a million deaths every year [46]. To
combat the twin problems of fungal infections and drug resistance, peptide-based
therapeutics are actively under consideration. Antimicrobial peptide-based therapeu-
tics have gained momentum in recent years with several formulations available in the
market. For fungal infections, more specific actions can be expected from antifungal
peptides. It is thus contingent to focus research on the discovery of novel antifungal
peptides with high activity.
Employing machine learning based methods is a cost-effective way of identifi-
cation of antifungal peptides. Several methods have been developed in the past for
6 Recent Advances in Applications of Support Vector Machines in Fungal Biology 129
One of the methods in classical Natural Language Processing (NLP) in text mining
jobs is to convert the text into frequency vectors. While this is quite successful, it has
its own drawbacks. This representation is unable to capture the meaning of the words
under a given context, as all vectors are orthogonal to each other. The introduction of
distributed representation of words has introduced a revolutionary change in text
mining. The main idea being the meaning of a word under a given context is given
by surrounding words that often occur close to it. In this method, a dense represen-
tation of words of a predetermined size is created to capture the meaning of the word
and words with similar meanings will appear closely in a higher dimensional
embedding space. An extremely popular algorithm knowns skip-gram model by
Mikilov et al. [48] is the front runner of the distributed representation of words. The
idea behind skip-gram representation is to predict the context words surrounding it
by using the word as input in a shallow network. Using this unsupervised learning,
embedding vectors of certain dimensions can be created for a large vocabulary of
words. The most informative embedding vectors are obtained the prediction loss.
Asgari and Mofrad [49] first applied the word2vec model for distributed represen-
tations annotating protein sequences and named it as ProtVec (Protein Vectors)
model. They first extracted embedding vectors from the entire SWISSPROT exper-
imentally verified list of sequences using the skip-gram model. They used these
embedding vectors for handling multiple protein annotation tasks. They reported
excellent accuracy. This method uses only sequence information and achieves
superior performance.
130 S. Modak et al.
As a first step, the complete set of experimentally verified sequences are first
converted to K sets of shifted non-overlapping K-grams. The skip-gram embedding
model is then used to learn the embeddings with a setting like that of Asgari and
Mofrad [49]. We employed word sizes of three and five and a context size of 25 to
build the unsupervised learning model to create embedding vectors; the size created
varied from 100 to 500 vectors. We used the same dataset used by Agrawal et al. [47]
which has 1168 antifungal peptides as positive dataset obtained from the DRAMP
database and 1168 antimicrobial peptides other than antifungal as negative dataset
obtained from the DRAMP database. We used the embedding vectors specific to the
training set as input to the SVM classifier and built the training model. The training
model was used to validate a set of test sequences having 291 antifungal peptides as
positive dataset obtained from DRAMP database and 291 antimicrobial peptides
other than antifungal as negative dataset obtained from DRAMP database.
Our results show that the ProtVec model with a vector size of three hundred,
K-mer word size of three and context vector size of 25 achieved particularly reliable
performance with 86% validation accuracy. Our results show that the distributed
representation of Antifungal peptides is a very efficient way of robust annotation of
antifungal peptides.
The below table enlists all the examples that illustrate the use of SVM in Fungal
bioinformatics:
In this chapter, we have discussed in detail the utility in the usefulness of SVM in
fungal biology. We have highlighted the robustness of the algorithm in several
predictions and case studies. These include among others recognition of damage
and disease symptoms in plant leaves, detection of fungal infections, and contami-
nations in fruits prediction of antifungal peptides etc. In these recent applications, it
is evident that SVM has performed very well and can be used as a reliable and robust
paradigm not only in fungal biology but also in other bioinformatics applications.
References
1. Vapnik VN (1999) An overview of statistical learning theory. IEEE Trans Neural Netw 10(5):
988–999
2. Modak S, Sharma S, Prabhakar P, Yadav A, Jayaraman VK (2013) Application of support
vector machines in fungal genome and proteome annotation. In: Laboratory protocols in fungal
biology. Springer, New York, pp 565–577
3. Deshapande AS, Giraddi SG, Karibasappa KG, Desai SD (2019) Fungal disease detection in
maize leaves using Haar wavelet features. In: Information and communication technology for
intelligent systems. Springer, Singapore, pp 275–286
4. Giraddi S, Gadwal S, Pujari J (2016) Abnormality detection in retinal images using Haar
wavelet and first order features. In: 2016 2nd international conference on applied and theoretical
computing and communication technology (iCATccT). IEEE, pp 657–661
5. Subramanya SR, Sabharwal C (2001) Performance evaluation of hybrid coding of images using
wavelet transform and predictive coding. In: Proceedings fourth international conference on
computational intelligence and multimedia applications. ICCIMA 2001. IEEE, pp 426–431
6. Czieczor L, Bentkamp C, Damerow L, Blanke M (2018) Non-invasive determination of the
quality of pomegranate fruit. Postharvest Biol Technol 136:74–79
7. Zarei A, Zamani Z, Fattahi R, Salami A, Mousavi A (2016) Analysis of the phenylpropanoid
enzyme activities and products in the soft-and hard-seeded pomegranate genotypes during fruit
development. Int J Fruit Sci 16(3):242–258
8. Elhariry HM, Khiralla GM, Gherbawy Y, Abd ElRahman H (2016) Natural occurrence of
Alternaria toxins in pomegranate fruit and the influence of some technological processing on
their levels in juice. Acta Aliment 45(3):380–389
9. Nouri B, Mohtasebi SS, Rafiee S (2020) Quality detection of pomegranate fruit infected with
fungal disease. Int J Food Prop 23(1):9–21
10. Singh RA, De RK, Chaudhary RG (2004) Influence of spray time of mancozeb on pea rust
caused by Uromyces viciae-fabae. Indian J Agric Sci (India) 74:502–504
11. Sabrol H, Kumar S (2015) Recent studies of image and soft computing techniques for plant
disease recognition and classification. Int J Comput Appl 126(1):44–55
12. Padmavathi K (2012) Investigation and monitoring for leaves disease detection and evaluation
using image processing. Int Res J Eng Sci Technol Innov 1(3):66–70
13. Hahn F (2009) Actual pathogen detection: sensors and algorithms-a review. Algorithms 2(1):
301–338
14. Gottschalk R, Burgos-Artizzu XP, Ribeiro A, Pajares G, Miralles AS (2010) Real-time image
processing for the guidance of a small agricultural field inspection vehicle. Int J Intell Syst
Technol Appl 8(1–4):434–443
6 Recent Advances in Applications of Support Vector Machines in Fungal Biology 135
15. Patil JK, Kumar R (2011) Advances in image processing for detection of plant diseases. J Adv
Bioinforma Appl Res 2(2):135–141
16. Sannakki SS, Rajpurohit VS, Nargund VB, Kumar RA, Yallur PS (2011) A hybrid intelligent
system for automated pomegranate disease detection and grading. Int J Mach Intell 3(2):36–44
17. Kailey KS, Sahdra GS (2012) Content-based image retrieval (CBIR) for identifying image
based plant disease. Int J Comput Technol Appl 3(3):1099–1104
18. Singh K, Kumar S, Kaur P (2019) Support vector machine classifier based detection of fungal
rust disease in Pea Plant (Pisam sativam). Int J Inf Technol 11(3):485–492
19. Sangeetha J, Thangadurai D (2013) Staining techniques and biochemical methods for the
identification of fungi. In: Laboratory protocols in fungal biology. Springer, New York, pp
237–257
20. Pitt JI, Hocking AD (2009) Fungi and food spoilage, vol 519. Springer, New York
21. Savi GD, Piacentini KC, Rocha LO, Carnielli-Queiroz L, Furtado BG, Scussel R, Zanoni ET,
Machado-de-Ávila RA, Corrêa B, Angioletto E (2018) Incidence of toxigenic fungi and
zearalenone in rice grains from Brazil. Int J Food Microbiol 270:5–13
22. Combet E, Henderson J, Eastwood DC, Burton KS (2006) Eight-carbon volatiles in mushrooms
and fungi: properties, analysis, and biosynthesis. Mycoscience 47(6):317–326
23. Sim JH, Tian F, Jung SY, Auh JH, Chun HS (2018) Multiplex polymerase chain reaction assays
for the detection of the zearalenone chemotype of Fusarium species in white and brown rice. Int
J Food Microbiol 269:120–127
24. Xing F, Liu X, Wang L, Selvaraj JN, Jin N, Wang Y, Zhao Y, Liu Y (2017) Distribution and
variation of fungi and major mycotoxins in pre-and post-nature drying maize in North China
Plain. Food Control 80:244–251
25. Jiarpinijnun A, Osako K, Siripatrawan U (2020) Visualization of volatomic profiles for early
detection of fungal infection on storage Jasmine brown rice using electronic nose coupled with
chemometrics. Measurement 157:107561
26. Liu Q, Sun K, Zhao N, Yang J, Zhang Y, Ma C, Pan L, Tu K (2019) Information fusion of
hyperspectral imaging and electronic nose for evaluation of fungal contamination in straw-
berries during decay. Postharvest Biol Technol 153:152–160
27. Maeda Y, Sugiyama Y, Lim TK, Harada M, Yoshino T, Matsunaga T, Tanaka T (2019) Rapid
discrimination of fungal species by the colony fingerprinting. Biosens Bioelectron 146:111747
28. Maeda Y, Dobashi H, Sugiyama Y, Saeki T, Lim TK, Harada M, Matsunaga T, Yoshino T,
Tanaka T (2017) Colony fingerprint for discrimination of microbial species based on lensless
imaging of microcolonies. PLoS One 12(4):e0174723
29. Tanaka T, Kogiso A, Maeda Y, Matsunaga T (2019, May) Colony fingerprinting—a novel
method for discrimination of food-contaminating microorganisms based on bioimage
informatics. In: 2019 IEEE international symposium on circuits and systems (ISCAS). IEEE,
pp 1–5
30. Naikwadi S, Amoda N (2013) Advances in image processing for detection of plant diseases. Int
J Appl Innov Eng Manag 2(11):405
31. Padol PB, Yadav AA (2016) SVM classifier based grape leaf disease detection. In: 2016
conference on advances in signal processing (CASP). IEEE, pp 175–179
32. Xie L, Zhong W, Shi W, Sun S (2006) Spectrum of fungal keratitis in North China. Ophthal-
mology 113(11):1943–1948
33. Li M, Zhang L (2008) Research advance of fungal keratitis. Int J Ophthalmol-Chi 8:385–387
34. Belliappa S, Hade J, Kim S, Ayres BD, Chu DS (2010) Surgical outcomes in cases of contact
lens-related fusarium keratitis. Eye Contact Lens 36(4):190–194
35. Wu X, Qiu Q, Liu Z, Zhao Y, Zhang B, Zhang Y, Wu X, Ren J (2018) Hyphae detection in
fungal keratitis images with adaptive robust binary pattern. IEEE Access 6:13449–13460
36. Pujari D, Yakkundimath R, Byadgi AS (2016) SVM and ANN based classification of plant
diseases using feature reduction technique. IJIMAI 3(7):6–14
136 S. Modak et al.
37. Pujari JD, Yakkundimath R, Byadgi AS (2013) Automatic fungal disease detection based on
wavelet feature extraction and PCA analysis in commercial crops. Int J Image Graph Signal
Proc 6(1):24–31
38. Gonzalez RC, Woods RE, Eddins SL (2004) Digital image processing using MATLAB.
Pearson Education India
39. Sonka M, Hlavac V, Boyle R (2014) Image processing, analysis, and machine vision. Cengage
Learning
40. El Massi I, Es-saady Y, El Yassa M, Mammass D, Benazoun A (2016) A hybrid combination of
multiple SVM classifiers for automatic recognition of the damages and symptoms on plant
leaves. In: International conference on image and signal processing. Springer, Cham, pp 40–50
41. Woźniak M, Graña M, Corchado E (2014) A survey of multiple classifier systems as hybrid
systems. Inf Fusion 16:3–17
42. Karan B, Mahapatra S, Sahu SS. Prediction of protein interactions in rice and blast fungus using
Machine Learning. In 2019 International Conference on Information Technology (ICIT) 2019
Dec 19 (pp. 33–36). IEEE.
43. Dranginis AM, Rauceo JM, Coronado JE, Lipke PN (2007) A biochemical guide to yeast
adhesins: glycoproteins for social and antisocial occasions. Microbiol Mol Biol Rev 71(2):
282–294
44. Nath A (2019) Prediction and molecular insights into fungal adhesins and adhesin like proteins.
Comput Biol Chem 80:333–340
45. Sanglard D (2016) Emerging threats in antifungal-resistant fungal pathogens. Front Med 3:11
46. Brown GD, Denning DW, Gow NA, Levitz SM, Netea MG, White TC (2012) Hidden killers:
human fungal infections. Sci Transl Med 4:165rv13
47. Agrawal P, Bhalla S, Chaudhary K, Kumar R, Sharma M, Raghava GP (2018) In silico
approach for prediction of antifungal peptides. Front Microbiol 9:323
48. Mikolov T, Sutskever I, Chen K, Corrado GS, Dean J (2013) Distributed representations of
words and phrases and their compositionality. In: Advances in neural information processing
systems. Springer, Berlin/New York, pp 3111–3119
49. Asgari E, Mofrad MR (2015) Continuous distributed representation of biological sequences for
deep proteomics and genomics. PLoS One 10(11):e0141287
Chapter 7
Real-Time Quantitative PCR Assay
for the Assessment of Uncultured Zoosporic
Fungi
Contents
7.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 137
7.2 Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 139
7.3 Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 140
7.3.1 DNA Extraction and Purification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 140
7.3.2 Real-Time qPCR Assays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 140
7.4 Notes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 141
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 143
7.1 Introduction
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2022 137
V. K. Gupta, M. Tuohy (eds.), Laboratory Protocols in Fungal Biology, Fungal
Biology, https://doi.org/10.1007/978-3-030-83749-5_7
138 T. Sime-Ngando and M. Jobard
7.2 Materials
7.3 Methods
Collect zoosporic organisms onto 0.6 μm pore size polycarbonate filters (after the
removal of the algal host by prefiltration when only zoospores are targeted) (see Note
2).
1. For cell disruption, incubate the filters in 560 μl of a buffer containing 1% SDS
and 1 mg.ml1 proteinase K in TE buffer for 1 h at 37 C in a water bath (see
Notes 3 and 4).
2. For DNA purification, use the silica-membrane columns provided with the
NucleoSpin Plant kit® (Macherey-Nagel), following the instructions from the
manufacturer (see Note 4).
3. Visualized the integrity and yield of the extracted genomic DNA in a 1% agarose
gel stained with 0.3 μg ml1 of ethidium bromide solution (Sigma), using a UV
transilluminator and a photograph. For this, (i) heat (45 s using a microwave
oven) a mixture of agarose in 1x TBE buffer, (ii) leave it to cool on the bench for
5 min down to about 60 C before adding ethidium bromide (i.e., to avoid vapor
formation), (iii) mix and pour into suitable gel grey with a comb and leave to set
for at least 30 min, (iv) remove the comb and submerge the gel to 2–5 mm depth
in an electrophoresis tank containing 1x TBE buffer, (v) transfer DNA sample
aliquots (i.e., 2 volumes of sample and 1 volume of loading buffer), marker, and
the serial dilution of 5–10 ng of calf thymus DNA (Sigma) to the wells of the
agarose gel, and (vi) start the electrophoresis migration for about 30 min at 100 V.
4. Calculate DNA extract concentrations from dilutions of calf thymus DNA
(Sigma), using a standard curve of calf thymus DNA versus band intensity.
7.4 Notes
3. Other enzymes such as lyticase can be used for cell disruption, with no significant
difference compared to proteinase K. However, the one-step proteinase K yields a
higher amount of genomic DNA than the lyticase method and has a better
reproducibility. Physical disruption procedures such as sonication or thermal
shocks (i.e., freezing in liquid nitrogen and thawing) are to be avoided because
of the possible degradation of DNA.
4. A standard phenol–chloroform purification procedure can also be used, but when
the genomic DNA extracts are used as templates in PCR reactions, the DNA
purification method using the commercial kit gave significantly better results
(based on Ct, the threshold cycle during PCR when the level of fluorescence gives
signal over the background and is in the linear portion of the amplified curve) than
the phenol–chloroform method. Consequently, the DNA extraction method using
Proteinase K and the commercial kit was selected and considered the best overall.
5. In the case of novel designed primers (see Note 1) for uncultured fungi, DNA
from both positive and negative plasmids and different mixtures (e.g., 5%, 10%,
25%, and 50% of the positive plasmids) will be used for the optimization of the
conditions (annealing temperature, cycling), cross-reactivity, the detection limit
(using serial tenfold dilutions of the positive plasmids, see Note 7), and the
amplification efficiency of the qPCR essays which should be at least 80%. Poor
primer quality is the leading cause of poor PCR efficiency. In this case, the PCR
amplification curve usually reaches a plateau early, and the final fluorescence
intensity is significantly lower than that of most other PCRs. This problem may be
solved with resynthesized primers.
6. The initial concentration of target 18S rDNA (copies.ml1) in environmental
samples can be calculated using the formula: [(a/b) x c] / d, where a is the 18S
rDNA copy number estimated by qPCR, b is the volume of environmental
genomic DNA added in the qPCR reaction, c is the volume into which the
environmental genomic DNA was resuspended at the end of the DNA extraction,
and d is the volume of sample filtered from which environmental DNA was
extracted.
7. In the absence of cultures, plasmids used in qPCR to construct standard curves
and to optimize qPCR reactions come from genetic libraries constructed during
previous environmental surveys [2]. Briefly, the complete 18S rRNA gene was
amplified from environmental genomic DNA extracts using the universal eukary-
ote primers 1f and 1520r. An aliquot of PCR products was cloned using the
TOPO-TA cloning kit (Invitrogen) following the manufacturer’s recommenda-
tions. The plasmid containing the insert of interest was extracted with
NucleoSpin® plasmid extraction kit (Macherey Nagel) following the manufac-
turer’s recommendations. The 18S rRNA gene was sequenced from plasmid
products by the MWG Biotech services using M13 universal primers [M13rev
(29) and M13uni (21)]. Phylogenetic affiliation of sequences acquired was
established using neighbor joining and Bayesian methods. In our case, positive
plasmids contain insert affiliated to target chytrid (i.e., Rhizophidiales species)
and displaying less than 2 mismatches with primers F-Chyt and R-Chyt
sequences (see Note 1). The plasmid PFB11AU2004 (Genbank accession number
7 Real-Time Quantitative PCR Assay for the Assessment of Uncultured. . . 143
DQ244014) was selected to construct the standard curve required for qPCR.
Linearized plasmids were produced from supercoiled plasmids by digestion
with restriction endonuclease one-time cutting into the vector sequence. Linear
plasmid DNA concentration can be determined by measuring the absorbance at
260 nm (A260) in a spectrophotometer.
Acknowledgements MJ was supported by a Ph.D. Fellowship from the Grand Duché du Luxem-
bourg (Ministry of Culture, High School, and Research). This study receives grant-aided support
from the French ANR Programme Blanc # ANR 07 BLAN 0370 titled DREP: Diversity and Roles
of Eumycetes in the Pelagos.
References
13. Niquil N, Kagami M, Urabe J, Christaki U, Viscogliosi E, Sime-Ngando T (2011) Potential role
of fungi in plankton food web functioning and stability: a simulation analysis based on Lake
Biwa inverse model. In: Sime-Ngando T, Niquil N (eds) Disregarded microbial diversity and
ecological potentials in aquatic systems. Springer, Heidelberg, pp 65–79
14. Lefèvre E, Carrias J-F, Bardot C, Amblard C, Sime-Ngando T (2005) A preliminary study of
heterotrophic picoflagellates using oligonucleotidic probes in Lake Pavin. Hydrobiologia
55:61–67
15. Lefèvre E, Jobard M, Venisse JS, Bec A, Kagami M, Amblard C, Sime-Ngando T (2010)
Development of a real-time PCR essay for quantitative assessment of uncultured freshwater
zoosporic fungi. J Microbiol Method 81:69–76
16. Moter A, Göbel UB (2000) Fluoresence in situ hybridization (FISH) for direct visualization of
microorganisms. J Microbiol Method 41:85–112
17. Mayura AM, Seena S, Barlocher F (2008) Q-RT-PCR for assessing Archaea, Bacteria, and
Fungi during leaf decomposition in a stream. Microb Ecol 56:467–473
18. Bates ST, Garcia-Pichel F (2009) A culture-independant study of free-living fungi in biological
soil crusts of the Colorado plateau: their diversity and relative contribution to microbial
biomass. Environ Microbiol 11:56–67
19. Zhu F, Massana R, Not F, Marie D, Vaulot D (2005) Mapping of picoeukaryotes in marine
ecosystems with quantitative PCR of the 18S rRNA gene. FEMS Microbiol Ecol 52:79–92
Chapter 8
Assays for the Quantification of Antioxidant
Enzymes in Fungi
Contents
8.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 146
8.2 Materials and Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 147
8.2.1 Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 147
8.3 Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 147
8.3.1 Fungal Tissue Homogenization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 147
8.4 Protein Quantification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 148
8.5 Antioxidant Enzymes Related to the Decomposition of ROS . . . . . . . . . . . . . . . . . . . . . . . . . . . 149
8.5.1 Catalase (CAT) Activity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 149
8.5.2 Peroxidases (Px) Activity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 150
8.5.3 Superoxide Dismutase (SOD) Activity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 151
8.6 Thiol Redox State Related Enzymes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 152
8.6.1 Glutathione-S-Transferase (GST) Activity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 152
8.6.2 Glutathione Reductase (GR) Activity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 153
8.6.3 Glutathione Peroxidase (GP) Activity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 154
8.6.4 Glucose-6-Phosphate Dehydrogenase (G6PD) Activity . . . . . . . . . . . . . . . . . . . . . . . . . . 155
8.7 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 156
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 157
K. Grintzalis (*)
School of Biotechnology, Dublin City University, Dublin, Republic of Ireland
e-mail: konstantinos.gkrintzalis@dcu.ie
I. Papapostolou · C. D. Georgiou
Department of Biology, Section of Genetics, Cell Biology and Development, University of
Patras, Patras, Greece
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2022 145
V. K. Gupta, M. Tuohy (eds.), Laboratory Protocols in Fungal Biology, Fungal
Biology, https://doi.org/10.1007/978-3-030-83749-5_8
146 K. Grintzalis et al.
8.1 Introduction
.-
2O2 + 2H+ SOD O2 + H2O2
2H2O2 CAT O2 + H2O
H2O2 + Proton donor PX H2O + Proton acceptor
H2O2 + GSH GP H2O + GSSG
NAD(P)H + 2H+ + GSSG GR NAD(P)+ + 2GSH
G6P + NAD(P)+ G6PD NAD(P)H + 2H+ + Lactone
Xenobiotic + GSH GST Xenobiotic-GSH
Fig. 8.1 Reactions catalyzed by antioxidant enzymes. SOD: superoxide dismutase, CAT:
catalase, PX: peroxidase, GP: glutathione peroxidase, GR: glutathione reductase, G6PD: glucose-
6-phosphate dehydrogenase, GST: glutathione-S-transferase
8.2.1 Materials
8.3 Methods
chelators, such as EDTA (at 1 mM) and protease inhibitors (e.g., 0.5 mM
phenylmethylsulfonyl fluoride; PMSF), are also potential precautions for the pres-
ervation of the samples to avoid artificial oxidation. A phosphate (50 mM) buffer,
pH 7.2, supplemented with the aforementioned is a preferable homogenization
buffer. Furthermore, hard fungal tissues contain rigid cell walls and are preferably
first homogenized in liquid nitrogen (e.g., using a mortar and a pestle) to generate a
fine powder form. Following, phosphate buffer is added, and the tissues are homog-
enized on ice using a Potter-Elvehjem type glass-glass or a Teflon homogenizer or
any other mechanical disruption available. The crude homogenate obtained needs to
be cleaned from cellular debris by centrifugation at 20,000 g for 10 min at 4 C, and
the clear supernatant is collected for analysis. At this step, it is possible to concen-
trate proteins by precipitation. In this case, proteins are precipitated in their native
(functional) form with ammonium sulfate by bringing the clear supernatant to 90%
ammonium sulfate (by dissolving solid ammonium sulfate) and incubating overnight
at 0 C. Proteins are precipitated by centrifugation at 20,000 g for 10 min at 4 C and
solubilized in a minimum volume of buffer or water. If needed, ammonium sulfate
can be removed by dialysis in another step.
Homogenization buffer: 50 mM Νa2ΗPO4, 1 mM EDTA, 500 μM PMSF, 0.5%
ethanol, pH 7.2: Dissolve 0.73 g Νa2ΗPO4.2H2O, 0.03 g EDTA, in 80 ml
ddH2O and adjust pH to 7.2. Dissolve 7 mg PMSF in 0.4 ml ethanol and add it
to the phosphate buffer solution.
The assay is based on the electrostatic reaction of proteins with the Coomassie
Brilliant Blue G-250 (CBB) reagent and is presented in a rapid sensitive microplate
method [6].
2 M HCl: Dilute the 37% (or 12 M) HCl six-fold with ddH2O, by mixing 250 ml
ddH2O with 50 ml 12 M HCl under stirring.
CBB: Dissolve 60 mg CBB in 100 ml 2 M HCl. After stirring for 40 min, centrifuge
at 20,000 g for 5 min at room temperature or alternatively, filter under vacuum or
with a syringe to remove any undissolved dye particulates. This solution is stable
for 2 months kept light-protected.
CBB:2 M HCl (1:1): Prepare fresh by mixing 1 volume of CBB with 1 volume of
2 M HCl.
Bovine serum albumin (BSA): Prepare a stock of 1 mg BSA/ml ddH2O and dilute
with ddH2O to 20 μg BSA/ml. Prepare a series of dilutions of standards for the
linear standard curve according to Table 8.1.
Samples (and standards, Table 8.1) are assayed for protein concentration
according to Table 8.2.
8 Assays for the Quantification of Antioxidant Enzymes in Fungi 149
3 O2 1
O2
RF*
O2.-
==SOD
Dred Dox (500 nm)
hv
hv
1
RF RF*
Fig. 8.2 Mechanism of SOD-inhibited reduction of oxidized o-dianisidine and light apparatus used
when volumes are scaled up for cuvettes
Incubate at room temperature for 15 min and measure absorbance at 560 nm.
Express the standard curve in moles of oxidized o-dianisidine acid in 200 μl sample
volume.
For analyzing samples, use end point kinetics (at 15 minutes’ incubation) follow-
ing Table 8.6.
Incubate at room temperature for 15 min and measure absorbance at 560 nm.
Calculate the moles of oxidized o-dianisidine using the corresponding standard
curve and following calculate the rate. The final result will be expressed as a rate
per mg protein of the sample.
to allow you to perform kinetics and monitor even small changes in the linear part
of your spectrophotometer).
Analyse samples by continuous kinetics for the decomposition of NAD(P)H
following Table 8.10.
Incubate at room temperature and measure absorbance at 340 nm with continuous
kinetics to calculate the rate. The final result will be expressed as a rate per mg
protein of the sample.
8.7 Conclusions
Acknowledgments This work was financially supported by the internal funds of Dublin City
University and the Greek Ministry of Education, University of Patras, Greece.
8 Assays for the Quantification of Antioxidant Enzymes in Fungi 157
References
1. Halliwell B (2006) Reactive species and antioxidants. Redox biology is a fundamental theme of
aerobic life. Plant Physiol 141:312–322
2. Georgiou CD, Patsoukis N, Papapostolou I, Zervoudakis G (2006) Sclerotial metamorphosis in
filamentous fungi is induced by oxidative stress. Integr Comp Biol 46:691–712
3. Halliwell B, Gutteridge CMJ (1999) Free radicals in biology and medicine. Oxford University
Press, Oxford
4. Mccord JM, Fridovich I (1969) Superoxide dismutase. An enzymic function for erythrocuprein
(hemocuprein). J Biol Chem 244:6049–6055
5. Barondeau DP, Kassmann CJ, Bruns CK, Tainer JA, Getzoff ED (2004) Nickel superoxide
dismutase structure and mechanism. Biochemistry 43:8038–8047
6. Grintzalis K, Georgiou CD, Schneider YJ (2015) An accurate and sensitive Coomassie brilliant
blue G-250-based assay for protein determination. Anal Biochem 480:28–30
7. Blum J, Fridovich I (1983) Superoxide, hydrogen peroxide, and oxygen toxicity in two free-
living nematode species. Arch Biochem Biophys 222:35–43
8. Misra HP, Fridovich I (1977) Superoxide dismutase: a photochemical augmentation assay.
Arch Biochem Biophys 181:308–312
9. Oster G, Bellin JS, Holmstrom B (1962) Photochemistry of riboflavin. Experientia 18:249–253
10. Mannervik B, Guthenberg C (1981) Glutathione transferase (human placenta). Methods
Enzymol 77:231–235
11. Tang SS, Lin CC, Chang GG (1996) Metal-catalyzed oxidation and cleavage of octopus
glutathione transferase by the cu(II)-ascorbate system. Free Radic Biol Med 21:955–964
12. Massey V, Williams CH Jr (1965) On the reaction mechanism of yeast glutathione reductase. J
Biol Chem 240:4470–4480
13. Munkres KD, Rana RS, Goldstein E (1984) Genetically determined conidial longevity is
positively correlated with superoxide dismutase, catalase, glutathione peroxidase, cytochrome
c peroxidase, and ascorbate free radical reductase activities in Neurospora crassa. Mech Ageing
Dev 24:83–100
14. Worthington K, Worthington V (2011) Glucose-6-phosphate dehydrogenase [Online].
Worthington Biochemical Corporation. Available: http://www.worthington-biochem.com/
pap/default.html
15. Papapostolou I, Sideri M, Georgiou CD (2014) Cell proliferating and differentiating role of
H2O2 in Sclerotium rolfsii and Sclerotinia sclerotiorum. Microbiol Res 169:527–532
16. Papapostolou I, Georgiou CD (2010a) Hydrogen peroxide is involved in the sclerotial differ-
entiation of filamentous phytopathogenic fungi. J Appl Microbiol 109:1929–1936
17. Papapostolou I, Georgiou CD (2010b) Superoxide radical is involved in the sclerotial differ-
entiation of filamentous phytopathogenic fungi: identification of a fungal xanthine oxidase.
Fungal Biol 114:387–395
18. Papapostolou I, Georgiou CD (2010c) Superoxide radical induces sclerotial differentiation in
filamentous phytopathogenic fungi: a superoxide dismutase mimetics study. Microbiology 156:
960–966
19. Patsoukis N, Georgiou DC (2008b) Thiol redox state and related enzymes in sclerotium-
forming filamentous phytopathogenic fungi. Mycol Res 112:602–610
20. Patsoukis N, Georgiou CD (2008a) Thiol redox state and oxidative stress affect sclerotial
differentiation of the phytopathogenic fungi Sclerotium rolfsii and Sclerotinia sclerotiorum. J
Appl Microbiol 104:42–50
Chapter 9
Cellulomics of Live Yeast by Advanced
and Correlative Microscopy
Contents
9.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 159
9.2 Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 161
9.3 Experimental Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 162
9.3.1 Preparing Coverslips . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 162
9.3.2 Sample Preparation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 163
9.3.3 Pros and Cons of Immobilisation Techniques . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 164
9.4 Imaging Modes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 165
9.4.1 Imaging Fixed Cells in QI Mode . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 165
9.4.2 Imaging Live Cells in QI Mode . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 168
9.4.3 Tracking Dynamic Processes in QI Mode . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 169
9.4.4 Correlative AFM-QI-LSCM Live Cell Imaging . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 169
9.5 AFM QI Mode Image/Data Processing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 172
9.5.1 AFM Image Processing and Overlay . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 172
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 172
9.1 Introduction
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2022 159
V. K. Gupta, M. Tuohy (eds.), Laboratory Protocols in Fungal Biology, Fungal
Biology, https://doi.org/10.1007/978-3-030-83749-5_9
160 Z. Shahina et al.
AFM is capable of acquiring surface images with nanometer (nm) scale resolution
or any type of physical interaction between a sharp tip and a surface, for example,
mapping interaction forces from a few pN to hundreds of nN for probing single
molecule interactions to overall cellular mechanics, respectively. Ultrastructure,
roughness, viscoelasticity and macromolecular interaction forces measured by
AFM are informative parameters that describe biological characteristics and pro-
cesses such as cell morphology, adhesion, transport and motility, and signalling
[1–4].
Traditional modes of AFM data collection are tricky for challenging samples with
steep edges, as well as those that are fragile, soft, sticky, or loosely attached to the
surface [5, 6]. Recently developed AFM operating modes, like Quantitative Imag-
ing™ (QI), enables not only the study of sample surface architecture with nm-scale
resolution, but also the mapping mechanical and adhesive properties of a sample in
situ. QI uses pN forces to quickly image immobilised samples at high resolution,
resulting in force-curve data at each pixel that can be analysed by any model [7]. The
major advantage of QI is that it does not impart any lateral forces on the sample and
provides precise force control during scanning, preserving the integrity of soft
biological samples. QI also allows for kinetic studies on difficult biological samples
and is not limited by either sample geometry or environment. Any standard cantile-
ver can be used for QI. Very sensitive samples (i.e. biological cells) or the detection
of small interaction forces requires a low spring constant (0.01–0.6 N/m) cantilever.
In comparison with AFM imaging, QI can record up to 512 512 (262144) QI force
curves, which contain much more information than only surface topography. The
force curves can be further analysed to obtain additional information, for example,
stiffness, using the Heinrich Hertz formulated theory [8] or any other appropriate
model. Decreasing either the pixel resolution or imaging area reduces the time per
image, which enables the study of dynamic processes.
Recently, correlative AFM-QI and laser scanning confocal microscopy (LSCM)
has been used to develop a multiplexed assay of living cells (bacteria, fungi, human)
in response to a common herbicide, with broad application to other xenobiotics. In
addition to determining surface architecture, AFM in QI mode probes surfaces
biochemistry and cellular mechanics, while LSCM is a window into the cell to
simultaneously track fluorescently tagged macromolecules, as many as can be
optically separated. Thus, correlative AFM-QI-LSCM generates multiplexed data
for the extensive characterisation of specimens ranging from single molecules or
nanoparticles to living cells [9–11].
Sample preparation for AFM is governed by a combination of overall cell
morphology and cell wall surface characteristics. The dimorphic fungus
C. albicans, able to grow both as fission yeast and filamentous (hyphal) cells, is an
opportunistic pathogen, whereas the budding yeast, Saccharomyces cerevisiae, has
been domesticated for culinary uses (i.e. brewing and baking) [12]. We have
previously detailed methods for imaging Aspergillus nidulans hyphal cells [13], so
this chapter will focus on the fission yeast form of C. albicans and budding yeast
form of S. cerevisiae.
9 Cellulomics of Live Yeast by Advanced and Correlative Microscopy 161
S. cerevisiae is one of the most highly studied organisms based on its role in food
production, and the detailed research on its cell wall became the basis for cell wall
models of other yeast such as C. albicans [14]. Similar to S. cerevisiae, the cell wall
of C. albicans consists of three main components: mannoproteins (~ 39%),
β-glucans (~ 59%), and chitin (~ 2%), to which external cell wall proteins (CWPs)
are attached. The cell walls contribute to a highly dynamic molecular architecture,
which is continuously remodelled in response to cell surface interactions. Moreover,
the cell wall surface is decorated with homogenously dispersed mannoproteins
called adhesins that play pivotal roles in cell communication, adhesion and microbial
infection. Various factors such as cell wall stress, temperature variation, exposure to
antifungal agents, host interaction, and biofilm formation can alter the cell’s adhe-
sive properties [15–19].
This chapter will detail the methods required to successfully acquire AFM-QI and
AFM-QI-LSCM data for Candida and S. cerevisiae, including sample preparation
techniques and imaging.
9.2 Materials
Unless otherwise specified, all solvents and acids were reagent grade.
Acetone (HPLC Grade, Fisher Scientific).
Cantilever Probes for QI™-AFM (AppNano Hydra4V-100NG, spring constant
0.039–0.184 N/m, resonance frequency 31–58 kHz; Bruker MLCT probes, spring
constant 0.01–0.6 N/m, resonance frequencies 7–125 kHz; nanosensors qp-BioAC,
spring constant 0.06–0.3 N/m, resonance frequencies 30–90 kHz).
Cell-Tak (corning).
Deionised water (18 MΩ NanoPure water).
Glass coverslips (22 mm x 22 mm, Fisher Scientific for fixed cells; 18 mm x 18 mm,
Carl Zeiss™ cover glasses, high performance for live cells).
Hydrochloric acid (HCl) (EMD Millipore).
Hydrogen peroxide 30 wt % in H2O (H2O2, Sigma-Aldrich).
Kim wipes (Kimberly Clark).
Methanol (HPLC Grade, Fisher Scientific).
PDMS stamps (Laboratory for Analysis and Architecture of Systems) [20].
Petri dish (100 mm x 15 mm, VWR International).
Phosphate Buffered Saline (0.01 M PBS, Sigma Aldrich).
Sodium bicarbonate (Fisher Scientific).
Sodium hydroxide (Caledon laboratories).
Sulphuric acid (H2SO4) (Caledon laboratories).
PLL (Poly-L-lysine) (Sigma Aldrich).
Triton-X 100 (Sigma Aldrich).
YPD (Yeast, Peptone, Dextrose) medium (Sigma Aldrich).
162 Z. Shahina et al.
The methods described below detail the preparation of materials required for
immobilising fixed and live cells, which is crucial for successful AFM imaging.
Poly-L-Lysine (PLL)
1. Make a 1:10 dilution of the PLL solution (1 part PLL to 9 parts deionised water).
2. Add 200 μl PLL onto the coverslip.
3. Incubate at room temperature for 30 min.
4. Wash twice with 200 μl deionised water.
5. Place the coverslip in a dust-free container and dry in a fume hood for 10 min or
let dry overnight (O/N) if convenient.
Cell-Tak
Coverslips were coated with Cell-Tak with a procedure slightly modified from
Louise Meyer et al. [21]
1. Prepare a solution of Cell-Tak by mixing 3.5 μl of Cell-Tak with 140 μl of buffer
(NaOH (1 M) and NaHCO3 (0.1 M pH 8)).
2. Spread 40 μl of the Cell-Tak solution onto a clean coverslip and incubate for
30 min at room temperature.
9 Cellulomics of Live Yeast by Advanced and Correlative Microscopy 163
3. Wash 3 with deionised water (0.2–0.5 mL, depending on coverslip size) and
air dry.
Coated coverslips can be stored for up to 2 weeks at 4 C in a desiccator.
Samples can first be fixed or imaged live, but both require immobilisation.
Live cell imaging requires immobilisation, and here, we describe two such methods
using biochemical [20] and physical methods [22], respectively.
1. Culture cells in YPD media overnight at 30 C in a shaker.
2. Dilute the culture to an OD600 of 0.2 in pre-warmed YPD and incubate at 30 C
with shaking until it reaches exponential phase (OD600 ¼ 1).
3. Continue to prepare samples as per 9.3.2.2.1 or 9.3.2.2.2
1. Using a scalpel, cut a small section of the PDMS stamp containing the pattern
multi-patterned PDMS stamp and place it onto a clean glass microscope slide
with the pattern side up.
2. Place an O-ring on the slide to secure the PDMS stamp and pipette approximately
100 μL of cell culture onto the PDMS stamp so it covers the entire stamp.
3. To capture cells in the PDMS wells, manually drag a coverslip across the PDMS
stamp, ideally with an advancing and receding contact angle of approximately
164 Z. Shahina et al.
96 and 84 degrees respectively [23], pulling the droplet of the cell suspension
along with the stamp several times.
4. Check to see if cells have entered the wells under a bright-field microscope at
400 resolution.
5. Once the wells contain cells, add phosphate buffered saline (PBS) or 1:1 YPD:
PBS to cover the entire stamp and proceed to liquid AFM (Fig. 9.1b).
A circular hole (18 mm) was cut at the bottom of a 100 X 15 mm polystyrene Petri
dish and sealed with a Zeiss high precision coverslip using epoxy resin. The
coverslip was pre-cleaned [22] and then coated with Cell-Tak as described in
9.3.1.2.2.
1. Add 500 μl of the culture to Cell-Tak coated coverslip attached to the polystyrene
Petri dish, as described above, and incubate at 30 C for 30 min in the dark.
2. Rinse with filtered (0.2 um filter) and pre-warmed 1:1 diluted YPD: PBS (0.01 M,
pH 7) and add 500 μL of the same solution for imaging and maintained at 30 C
prior to use).
4. Place the Petri dish with the sample in a heated AFM sample holder maintained at
30 C.
Since AFM is a surface scanning technique, live cells must first be immobilised on
solid substrates prior to imaging, using methods such as those outlined above [20].
PLL and Cell-Tak both biochemically immobilise cells onto a surface of choice.
PLL coating effectively immobilises both live and fixed cells of bacteria and fungi,
and it is less expensive than other methods. PLL works through electrostatic
interactions between the cationic (Poly-L-Lys+) thin film on a substrate which
creates a positively charged surface that attracts negatively charged microbes. The
method works well with highly charged cells, but the interaction is easily reversible
by shear forces during sample rinses or liquid imaging [23, 24]. Furthermore, PLL is
antimicrobial and directly hinders bacterial cell division and physiology, especially
when used at higher concentrations [14, 25] which can sometimes induce cell death
[11]. So based on all of the above considerations, we only use PLL for fixed cells.
For live cells, we have found Cell-Tak to be the better alternative since it
non-specifically attaches yeast and bacteria to glass surfaces. Cell-Tak is a formula-
tion of the polyphenolic proteins extracted from the marine mussel Mytilus edulis,
the key components of the glue secreted that allows the mussel to anchor itself to
solid structures in its natural environment [21].
9 Cellulomics of Live Yeast by Advanced and Correlative Microscopy 165
PDMS stamps are an efficient way of physically immobilising cells and other
samples by convective or capillary deposition as described above for live cell
imaging [23]. The surface layer of the PDMS pattern needs to be sufficiently thin
so that cells are not trapped too deeply, which would prevent the AFM tip from
reaching the sample and preclude imaging [18, 26].
Immobilisation techniques are not limited to those we describe above, and other
methods exist including the use of optical tweezers and coating with gelatin [20].
Gelatin-coated surfaces used to immobilize cells can bias AFM images through
adhering to the AFM tips [20] or by coating the sample and changing its topography
[16, 24]. Optical tweezers can be used to accurately trap cells in 3D by focusing a
laser to a single diffraction-limited location [16, 24], however, these cells are easily
detached in comparison to those immobilised on glass surfaces [20, 27]. Furthermore,
the laser used for optical tweezers can damage cells [16, 24].
1. Turn on the AFM, followed by the AFM imaging software on the computer
connected to the AFM.
2. Place the coverslip with the sample to be imaged on the microscope slide and
secure it on both sides using tape, and mount the slide onto the AFM stage
(Fig. 9.1a).
3. Use the CCD camera or optical microscope to locate the specimen.
4. Once the specimen has been located, place the AFM head on the sample stage.
5. Using the z-stepper motors, bring the AFM cantilever within a few hundred
micrometres of the sample surface.
Caution: If the tip hits the sample surface, the cantilever will likely break
166 Z. Shahina et al.
6. Align the laser onto the cantilever portion directly above the AFM tip and
optimize to get the maximum sum signal (>1 V) on the four-quadrant photode-
tector. In general, a higher sum indicates a good feedback signal from the
cantilever.
7. Adjust the lateral and vertical deflection and if needed, the mirror, to bring the
laser to the centre of the photodiode.
8. Approach the cantilever to the surface, using the automatic approach. Retract the
cantilever by approximately 10–20 μm and calibrate the AFM tip position
against the sample using the direct overlay optical calibration.
Note: Following tip-sample calibration (optical overlay), it is important to
only move the sample in x and y directions, rather than the AFM head, which
would render the calibration void and would require recalibration of the sample
position in relation to the tip
9 Cellulomics of Live Yeast by Advanced and Correlative Microscopy 167
Fig. 9.2 QI™ images of C. albicans cell surface, adhesion and elasticity. (a, b) height images
(10 μm 10 μm, 128 128 pixels) of whole fixed cells deposited on PLL-coated coverslips, for (a)
untreated cells and (b) those treated with cinnamon bark essential (CNB) oils at 0.5 MIC
(62.5 μg/ml). High-resolution QI AFM images recorded (128 128 pixels) on a 1 μm2 area
(white boxed squares) on the top of cells reveal (f) increased surface roughness, (g) altered adhesion
patterns and (h) greater viscoelasticity for treated compared to (b, c, d) untreated cells, respectively
1. Insert a Petri dish heater designed to hold a polystyrene Petri dish and connect it
to the controller.
2. Turn on the controller and set it to the desired temperature.
3. Place the polystyrene Petri dish containing the sample onto the AFM stage and
secure both sides using the steel clamps (Fig. 9.1c).
4. Using the CCD camera or optical microscope, locate the specimen using a low
magnification objective such as 10–20 .
5. Slowly and carefully put one drop of the imaging media onto the cantilever glass
block mount, tilt the mount, and allow the drop to slowly cover the cantilever.
6. Place the AFM head into the sample stage.
7. Using the z-stepper motors, carefully lower the AFM cantilever until the drop on
the cantilever surface fuses with the sample imaging media.
Caution: Again, avoid touching the sample surface, which could break the
cantilever
8. Once the cantilever is under liquid and within a few hundred microns of sample
surfaces, align the laser onto the cantilever portion directly above the AFM tip to
optimize the sum (>1).
9. When switching from air to liquid the mirror needs to be adjusted to account for
the refraction of the laser as it passes through the liquid–glass interface.
10. Calibrate the tip position and sample using the optical overlay according
to 9.4.1.
11. Determine the precise location of the cells using fast force mapping (Fig. 9.3),
switch to QI mode, set imaging parameters, and begin imaging (Fig. 9.4) as
described in 9.4.1.
Note: Live cells can be AFM or QI-AFM [26] imaged using cells
immobilised in PDMS stamps (see Sect. 9.3.2.2.2) under PBS, 1:1 PBS/YPD
or YPD media, by following steps 4–11 above. If the exact density and viscosity
of the media are unknown, use water and the Sader method [27] to determine the
spring constant.
Fig. 9.3 AFM images of Candida albicans array on a PDMS stamp. (a) 2-dimensional AFM
height image on 10 10 PDMS wells, corresponding (b) elasticity and (c) adhesion maps. Taken
from [20]
9 Cellulomics of Live Yeast by Advanced and Correlative Microscopy 169
When the pixel resolution is reduced and z-length and speed are optimised, it is
possible to study dynamic processes on the order of minutes using QI mode. Short
cantilevers, with a low spring constant (0.06–0.3 N/m) and a high resonant fre-
quency (30–90 kHz), allow a high z-speed and reduced acquisition times.
It is imperative that samples are well immobilised, including both the cells and the
substrate, so the PDMS stamp itself was glued to the glass substrate. This particular
method has been used to examine changes to the S. cerevisiae cell wall in response to
enzymatic degradation (Fig. 9.4).
1. Immobilize the PDMS stamp on a glass slide using epoxy resin.
2. Grow and immobilize cells in PDMS stamps according to 9.3.2.2.2.
3. Glue the imaging ring to the glass slide around the PDMS stamp and add 1.5 mL
of the desired medium (see Fig. 9.1b).
4. Follow steps 4–11 in Sect. 9.4.2.
Fig. 9.4 AFM QI images a S. cerevisiae cell as (a) height, (b) surface topography as pixel
difference, and (c) viscoelasticity at high resolution. The sequence of changes in (d) height, (e)
pixel difference, and (f) elasticity maps at 0, 16, and 29 min exposure to lyticase show dramatic
changes to the surface properties
Fig. 9.5 AFM-QI-LSCM schematic illustration of the inverted LSCM objective focused onto the
sample from below, with the AFM cantilever and tip imaging from above. The live sample is firmly
immobilised to a Cell-Tak coated coverslip mounted in a Petri dish (left). Image of living Candida
albicans AFM-QI™ surface topography (middle), and overlay for AFM-QI™-LSCM confocal data
(right) that were simultaneously collected. In addition to surface ultrastructure, shown on the right is
the localisation of tubulin2-GFP (Tub2-GFP, green) and histone protein B-RFP (Htb-RFP, purple).
(Adapted from [11])
10. Calibrate the AFM tip position in x-y using the direct overlay and bring the
AFM tip into feedback mode (9.4.2).
11. Select a desired location on the sample for imaging and determine the precise
location using force mapping (9.4.2).
Note: It is important to select a cell which is immobile, has a height in an
expected range and shows bright fluorescence signals in the expected regions of
the cell. It is also important to have cells sparsely distributed since overcrowding
negatively affects imaging quality.
12. LSCM imaging parameters need to be adjusted prior to initiation of the
AFM-QI scan.
Note: It is important not to change any confocal parameters that will move
large components such as filters and lasers, which will cause large noise and
could cause the AFM tip to crash into the surface during imaging. The best
practice to collect an LSCM image directly prior to and after the AFM scan to
ensure similar results during simultaneous scanning.
13. For multicolour LSCM imaging, select a suitable excitation wavelength for each
fluorophore that will prevent bleed [11].
14. LSCM imaging is much faster than AFM-QI, therefore it is possible to obtain
multiple LSCM scans during QI imaging, provided LSCM settings are not
changed during imaging.
Note: With the advent of high-speed AFM, it is possible to better match the
data collection speeds of AFM and LSCM.
15. Since LSCM has a much wider field of view than AFM, match, as much as
possible, AFM and LSCM image resolution and size to vastly simplify image
overlay (Fig. 9.5).
172 Z. Shahina et al.
1. Using the JPK data processing software retrieve QI force curves at each pixel of
the raster scan.
2. Select a single reference force curve in the middle of the specimen and define the
operations for batch processing such as spring constant, sensitivity, baseline
correction, tip-sample separation, then measure the adhesion and apply the
Hertz or other appropriate model to estimate the Young’s modulus.
3. Apply the same processing parameters for all force curves in the image using the
batch processing module.
4. Batch process all force curves and export to excel, plot the data using Origin and
use the Gaussian distribution to place a fit on the histograms, or use a statistical
analysis package (i.e. GraphPad Prism).
5. Determine the surface roughness by selecting 200 200 nm squares at the centre
of the specimen using the QI™ height images.
1. Process images using the data processing software (DPS), ImageJ or photoshop,
for adjusting brightness and contrast, for which the former allows roughness and
subunit measurements.
2. Multi-colour LSCM images should be processed using linear unmixing to sepa-
rate different channels, along with other downstream analyses, including intensity
measurements and particle counts.
3. AFM-QI and LSCM images collected at the same time with similar resolution
parameters for the same specimen at the same position can be manually overlaid
using Photoshop or ImageJ.
Note: In the majority of cases, LSCM images need to be digitally enlarged to
correspond with the higher resolution AFM height image.
References
1. Elter P, Weihe T, Lange R, Gimsa J, Beck U (2011) The influence of topographic microstruc-
tures on the initial adhesion of L929 fibroblasts studied by single-cell force spectroscopy. Eur
Biophys J 40(3):317–327
2. Docheva D, Padula D, Schieker M, Clausen-Schaumann H (2010) Effect of collagen I and
fibronectin on the adhesion, elasticity and cytoskeletal organization of prostate cancer cells.
Biochem Biophys Res Commun 402(2):361–366
9 Cellulomics of Live Yeast by Advanced and Correlative Microscopy 173
3. Engler AJ, Sen S, Sweeney HL, Discher DE (2006) Matrix elasticity directs stem cell lineage
specification. Cell 126(4):677–689
4. Kirmse R, Otto H, Ludwig T (2011) Interdependency of cell adhesion, force generation and
extracellular proteolysis in matrix remodeling. J Cell Sci 124(11):1857–1866
5. Gadegaard N (2006) Atomic force microscopy in biology: technology and techniques. Biotech
Histochem 81(2–3):87–97
6. Braga PC, Ricci D (2004) Atomic force microscopy: biomedical methods and applications.
Springer Science & Business Media
7. Smolyakov G, Formosa-Dague C, Severac C, Duval RE, Dague E (2016) High speed inden-
tation measures by FV, QI and QNM introduce a new understanding of bionanomechanical
experiments. Micron 85:8–14
8. Hertz H (1992) On the contact of rigid elastic solids and hardness. Wiley
9. Horton MA, Pelling AE, Haupt BJ (2006) Intergrated confocal and scanning probe microscopy
for biomedical research. The Scientific World Journal 6:1609–1618
10. Kassies R et al (2005) Combined AFM and confocal fluorescence microscope for applications
in bio-nanotechnology. J Microsc 217(1):109–116
11. Bhat SV, Sultana T, Körnig A, McGrath S, Shahina Z, Dahms TES (2018) Correlative atomic
force microscopy quantitative imaging-laser scanning confocal microscopy quantifies the
impact of stressors on live cells in real-time. Sci Rep 8(1):8305
12. Marques WL, Vijayendran Raghavendran AKG, Stambuk BU (2016) Sucrose and Saccharo-
myces cerevisiae: a relationship most sweet. FEMS Yeast Res 16(1):fov107
13. Biplab TESD, Paul C, Ma H, Snook LA (2008) High-resolution imaging and force spectroscopy
of fungal hyphal cells by atomic force microscopy. Micron 39(4):349–361
14. Klis K, Groot FM, Hellingwerf PD (2001) Molecular organization of the cell wall of Candida
albicans. Med Mycol 39(1):1–8
15. Shahina Z, Amira E-G, Jessica MM, Malcolm W, Taranum S, Tanya DES (2018)
Cinnamomum zeylanicum bark essential oil induces cell wall remodelling and spindle defects
in Candida albicans. Fungal Biol Biotechnol 5:3
16. Daniel R, Richard AC, John EEJ (1986) Adherence of Candida species to host tissues and
plastic surfaces. Rev Infect Dis 8(1):73–85
17. Miyake Y, Tsunoda T, Minagi S, Akagawa Y, Tsuru H, Suginaka H (1990) Antifungal drugs
affect adherence of Candida albicans to acrylic surfaces by changing the zeta-potential of fungal
cells. FEMS Microbiol Lett 69(3):211–214
18. Costa-Orlandi CB et al (2017) Fungal biofilms and polymicrobial diseases. J Fungi 3:22
19. Samaranayake LP, MacFarlane TW (1982) Factors affecting the in-vitro adherence of the fungal
oral pathogen candida albicans to epithelial cells on human origin. Arch Oral Biol 27(10):
869–873
20. Formosa C, Pillet F, Schiavone M, Duval RE, Ressier L, Dague E (2015) Generation of living
cell arrays for atomic force microscopy studies. Nat Protoc 10(1):199
21. Meyer RL, Zhou X, Tang L, Arpanaei A, Kingshott P, Besenbacher F (2010) Immobilisation of
living bacteria for AFM imaging under physiological conditions. Ultramicroscopy 110(11):
1349–1357
22. Bhat SV, Booth SC, Vantomme EA, Afroj S, Yost CK, Dahms TE (2015) Oxidative stress and
metabolic perturbations in Escherichia coli exposed to sublethal levels of
2, 4-dichlorophenoxyacetic acid. Chemosphere 135:453–461
23. Dague E, Jauvert E, Laplatine L, Viallet B, Thibault C, Ressier L (2011) Assembly of live
micro-organisms on microstructured PDMS stamps by convective/capillary deposition for
AFM bio-experiments. Nanotechnology 22(39):395102
174 Z. Shahina et al.
24. Elbourne A, Chapman J, Gelmi A, Cozzolino D, Crawford RJ, Truong VK (2019) Bacterial-
nanostructure interactions: the role of cell elasticity and adhesion forces. J Colloid Interface Sci
546:192–210
25. Colville K, Topmkins N, Rutenberg AD, Jericho MH (2010) Effects of poly(l-lysine) substrates
on attached Escherichia coli bacteria. Am Chem Soc 26(4):2639–2644
26. Chopinet L, Formosa C, Rols MP, Duval RE, Dague E (2013) Imaging living cells surface and
quantifying its properties at high resolution using AFM in QI™ mode. Micron 48:26–33
27. Castelain M, Pignon F, Piau J-M, Magnin A, Mercier-Bonin M, Schmitz P (2007) Removal
forces and adhesion properties of Saccharomyces cerevisiae on glass substrates probed by
optical tweezer. J Chem Phys 127(13):10B602
Chapter 10
Molecular Taxonomy and Multigene
Phylogeny of Filamentous Fungi
Contents
10.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 176
10.2 Fungal Genomic DNA Extraction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 184
10.2.1 Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 186
10.2.2 Method . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 186
10.3 Agarose Gel Electrophoresis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 187
10.3.1 Material . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 188
10.3.2 Method . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 188
10.4 Selection of Gene Target and Their Amplification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 194
10.4.1 Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 194
10.4.2 Method . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 194
10.5 PCR Product Purification and Quantification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 195
10.6 DNA Sequencing (Sanger Method) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 196
10.6.1 Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 197
10.6.2 Method . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 197
10.7 Perform Sequencing PCR in Thermal Cycler Using Following Conditions . . . . . . . . . . . 198
10.7.1 Purification of Sequencing PCR Product . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 198
10.8 Sequence Editing, Analysis, and Identification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 198
10.8.1 Basic Local Alignment Search Tool (BLAST) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 199
10.8.2 MycoBank Database Search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 199
10.8.3 UNITE Database Search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 200
10.8.4 Method . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 200
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2022 175
V. K. Gupta, M. Tuohy (eds.), Laboratory Protocols in Fungal Biology, Fungal
Biology, https://doi.org/10.1007/978-3-030-83749-5_10
176 N. Mehta et al.
10.1 Introduction
The second largest kingdom “Fungi” includes rusts, yeasts, mildews, molds,
oomycetes, and smuts. They are generally classified into four types:
Chytridiomycota, Zygomycota, Ascomycota, and Basidiomycota; however, they
have recently been reclassified as into nine phylum-level clades: Opisthosporidia,
Chytridiomycota, Neocallimastigomycota, Blastocladiomycota, Zoopagomycota,
Mucoromycota, Glomeromycota, Basidiomycota, and Ascomycota [104]. It has
been reviewed that the estimated number of species comprise of 2.2–3.8 million
with only 3%, named on the basis of data acquired from environmental fungi DNA
sequences [105]. Hence, to identify fungi at species level is the fundamental
approach for researcher to carry any type of study, be it basic or applied. Most of
the studies on plant pathogens start from identification of the pathogen and then to
find its cure as it can have economical effect on commercial scale [57, 98]. The
pathogenic behaviour of fungi is not only limited to plants; they can also infect,
human health. Various fungal infections and diseases require the specific identifica-
tion of causal agent before its treatment [11, 73]. The recognition of fungi from the
positive aspect is also very important as their vast industrial application increases the
need to discover more efficient species for commercial purposes.
The initial morphological basis of fungal classification basically applies only for
the cultivable fungus at laboratory scale. They are observed, macro-morphologically
(colony characteristics), micro-morphologically (spore characteristics) [81] and on
the basis of life cycle [32] (e.g. pleomorphic fungi) which can occur in both forms,
i.e. anamorph (asexual form) and teleomorph (sexual form). These dual life forms of
fungi had followed a dual nomenclature system according to Article 59 of ICBN
(International Code of Botanical Nomenclature), thus creating more confusion while
working on them. The recent amendment in Article 59 (at 18th International
Botanical Conference in Melbourne), implied effectively from 1 January 2013, states
the rule of “one fungus – one name” irrespective of its alternative life forms (mitotic
or meiotic). Then there comes polyphyletic genera (same genus appearing at differ-
ent clades or places in phylogenetic tree) which have either lost some characteristics
which resemble to one ancestor or gained some characters resembling another
ancestor, for example, Mycosphaerella was earlier considered as a genus for 30 dif-
ferent anamorphic genera [23, 38], but the sequence data of 28S nuclear rRNA made
it clear that it is an assembly of various genera belonging to different families
[20, 23]. Thus, as much as it is important to study any fungi residing at vast
environmental conditions, morphologically, it is difficult to completely rely on
10 Molecular Taxonomy and Multigene Phylogeny of Filamentous Fungi 177
them; therefore, the need of molecular approach is utmost for accuracy. Various new
molecular tools have been developed in last few decades, which allow efficient
evolutionary inferences, wherein one or more gene sequences can be used for
accurate fungal species identification. In general, the first level molecular identifi-
cation involves single-gene sequence-based identification, and for a reliable phylo-
genetic placement in fungal tree of life, multigene-based phylogenetic approach is
employed to define and recognize new fungal species.
In the 1980s, the initial molecular approach for phylogenetic study used poly-
merase chain reaction (PCR) of nuclear internal transcribed spacer sequences (ITS)
region of ribosomal DNA (rDNA) [28]. These sequences are consensus regions and
occur in long tandem repeats, and the universal primers could be designed for fungi
[97]. The nuclear ribosomal RNA (rRNA) gene is divided into smaller subunit (18S
or SSU) and larger subunit (28S or LSU) with two internal transcribed spacers (ITS1
and ITS2) between them linked by 5.8S region (Fig. 10.1). The 18S region helps to
narrow down the classification from kingdom level to phyla including phyla, class,
order, and family if the primer pair employed is NS1–NS4 [97], whereas LSU region
resolves intermediate level of taxonomy, i.e. family and genera with primer pair
LROR-LR6 [72, 94]. For species level identification, ITS is the most appropriate
region as this portion, though transcribed it does not code for any protein, hence
more prone to evolutionary mutation. It not only discriminates interspecific but also
helps in detecting intraspecific variations if studied combinatorial with hyper-
variable domains of LSU (D1/D2 domain) in some group of fungi [79].
Buée had found 1000 molecular taxonomic operational units based on approxi-
mately 30,000 reads for ITS1 region from pyrosequencing 4 grams of forest soil
sample [17]. Schoch has also mentioned that approximately 172,000 ITS region
sequences have been deposited to GenBank including 25,000 genera and 15,500
species. These studies highlight the general acceptance and wide utility of ITS region
for fungal identification. Unfortunately, this region has limitation when there are
huge numbers of species for a particular genus (Fusarium, Aspergillus, Penicillium,
etc.) [4, 49, 75, 79, 82, 87] or for cryptic species.
This drawback changes into advantage when we incorporate protein-coding
genes (secondary molecular markers) along with ITS, i.e. multigene approach for
superior resolution. The combined analysis of two or combination of more than two
genes or even whole genome has become very popular in molecular phylogenetic
studies [25]. These approaches yield unequivocal results [47]. Combined gene
analyses, in support with morphological information, resolves the conflicts arose
178 N. Mehta et al.
from single-gene analyses and enhances phylogenetic resolution [30]. The leverage
of using these additional gene markers (1) include faster evolving intronic region
than ITS [28], (2) provide better resolution at the level of higher taxonomy [80],
(3) occur in single copy, therefore prone to less mutations, and (4) include easy
understanding of homology and converging aspect [10, 27]. Now the question arises,
which protein coding genes should be used? Assembling the Fungal Tree of Life, a
National Science Foundation project, which has supported extensive studies on
fungal systematics using protein coding genes and designing molecular phylogeny
in the field of systematic and taxonomy [13, 34, 43, 53, 80]. The genetic markers are
RPB1 and RPB2 (RNA polymerase – largest and second largest subunit) [15, 50, 70,
88], tef1 (translational elongation factor 1-alpha) [71], tub2/BenA (beta-tubulin)
[29, 60], and MCM7 (mini chromosome maintenance protein), which provides
superior resolution in association with other genes, e.g. with LSU for Ascomycota
members [2, 68]. In some lineages of Eurotiales (includes genus Aspergillusand
Penicillium), species level identification involves CaM/cal (calmodulin) gene along
with tef1, RPB2, tub2/BenA, and RPB1. Visagie and colleagues have recommended
the use of RPB2 or CaM genes to avoid any ambiguity based on gene tub2/BenA for
Penicillium spp. [95]. Similarly, for molecular phylogeny of Aspergillus sp., CaM
gene is recommended, but RPB2 and tub2/BenA are also preferred and can be used
for classification [75]. Torbati suggested the use of CaM, tef1, tub2, and RPB2
secondary markers along with ITS and LSU to resolve the phylogenetic study of
Fusarium spp., which exhibit immense morphological plasticity [92]. A detailed list
of commonly used gene targets/markers has been given in Table 10.1, which is an
easy guide to select the right gene targets/markers for some specific fungal genera.
In order to determine phylogenetic relationship, DNA sequences of different
fungi can be aligned and compared to establish variability among themselves and
with ancestors. This data is generally represented as “phylogenetic/relationship tree”
where the branch’s length and position explain the similarity and distant resem-
blance between different fungi. The variation at the intra- and inter-specific levels for
a specific locus can be used for identification among all the closely related species,
thus giving a possibility to make a decisive prediction regarding new species
[74]. However, nowadays a molecular method using several appropriate gene
targets/markers instead of only one, has made the phylogenetic study more authen-
ticated to describe particular unknown species [47]. This method facilitates compar-
isons with already present taxonomic information of related species.
Initially, the use of phylogenetic trees was solely in the field of systematics and
taxonomy to depict the relation among species. But nowadays, the advent of DNA
sequencing technology it can be applied to all the branches of biology. Phylogeny
has also explained the relationships between paralogues of gene family along with
evolutionary and epidemiological dynamics of pathogens and histories of
populations, etc. [100]. The methods required for phylogenetic analysis, includes
parsimony, likelihood distance, and Bayesian methods. The detailed information
about these methods is vast and very exhaustive that cannot be accommodated at one
place; however, some basic information regarding phylogeny has been mentioned in
the pretext of phylogenetic tree construction section of this chapter.
Table 10.1 Gene targets/molecular markers for different fungi and their respective primer pairs and sequences
Genes for Primer name
molecular
S. N. Genus of Fungi phylogeny Forward primer (Primer Sequence 50 -30 ) Reverse primer (Primer Sequence 50 -30 ) References
1. Alternaria ITS V9G: TTACGTCCCTGCCCTTTGTA ITS4: TCCTCCGCTTATTGATATGC [99]
GAPDH gpd1: CAACGGCTTCGGTCGCATTG gpd2: GCCAAGCAGTTGGTTGTGC
RPB2 RPB2-5F2: GGGGWGAYCAGAAGAAGGC fRPB2-7cR: CCCATRGCTTGYTTRCCCAT
OPA10-2 OPA10-2L: TCGCAGTAAGACACATTCTACG OPA10-2R: GATTCGCAGCAGGGAAACTA
Alt a 1 Alt-for: ATGCAGTTCACCACCATCGC Alt-rev: ACGAGGGTGAYGTAGGCGTC
endoPG PG3: TACCATGGTTCTTTCCGA PG2b: GAGAATTCRCARTCRTCYTGRTT
TEF1-α EF1-728F: CATCGAGAAGTTCGAGAAGG EF1-986R: TACTTGAAGGAACCCTTACC
2. Aspergillus β-tubulin Bt2a: GGTAACCAAATCGGTGCTGCTTTC Bt2b: ACCCTCAGTGTAGTGACCCTTGGC [85]
ITS ITS1: TCCGTAGGTGAACCTGCGG ITS4: TCCTCCGCTTATTGATATGC
TEF1-α 983F: GCYCCYGGHCAYCGTGAYTT 2218R: ATGACACCRACRGCRACRGTYTGYAT
Calmodulin CF1L: GCCGACTCTTTGACYGARGAR CF4: TTTYTGCATCATRAGYTGGAC
CF1M: AGGCCGAYTCTYTGACYGA cmd6: TTTYTGCATCATRAGYTGGAC
cmd5: CCGAGTACAAGGAGGCCTTC
RPB2 fRPB2-5F: GAYGAYMGWGATCAYTTYGG fRPB2-7CR: CCCATRGCTTGYTTRCCCAT
3. Bipolaris GAPDH gpd1: CAACGGCTTCGGTCGCATTG gpd2: GCCAAGCAGTTGGTTGTGC [54]
TEF1-α 983F: GCYCCYGGHCAYCGTGAYTT 2218R: ATGACACCRACRGCRACRGTYTGYAT
ITS ITS1: TCCGTAGGTGAACCTGCGG ITS4: TCCTCCGCTTATTGATATGC
4. Botryosphaeria TEF1-α EF1-728F: CATCGAGAAGTTCGAGAAGG EF1-986R: TACTTGAAGGAACCCTTACC [45, 67]
ITS ITS5:GGAAGTAAAAGTCGTAACAAGG ITS4: TCCTCCGCTTATTGATATGC
5. Botrytis GAPDH G3PDHfor: ATTGACATCGTCGCTGTCAACGA G3PDHrev: ACCCCACTCGTTGTCGTACCA [102]
HSP60 HSP60for: CAACAATTGAGATTTGCCCACAAG HSP60rev: GATGGATCCAGTGGTACCGAGCAT
RPB2 RPB2for: GATGATCGTGATCATTTCGG RPB2rev: CCCATAGCTTGCTTACCCAT
6. Cercospora GAPDH Gpd1-LM: ATTGGCCGCATCGTCTTCCGCAA Gpd2-LM: CCCACTCGTTGTCGTACCA [7]
β-tubulin BT1-F: GTCCWCACCGCCCCTGAT BT1-R: CTTGTTRCCRGAAGCCTRTGS
(continued)
Table 10.1 (continued)
Genes for Primer name
molecular
S. N. Genus of Fungi phylogeny Forward primer (Primer Sequence 50 -30 ) Reverse primer (Primer Sequence 50 -30 ) References
Calmodulin CAL-228F: GAGTTCAAGGAGGCCTTCTCCC CAL-737R: CATCTTTCTGGCCATCATGG
RPB2 fRPB2-7cF: ATGGGYAARCAAGCYATGGG fRPB2-11aR: GCRTGGATCTTRTCRTCSACC
7. Colletotrichum ApMAT AM-F: TCATTCTACGTATGTGCCCG AM-R: CCAGAAATACACCGAACTTGC [22, 84,
ITS ITS-1F: CTTGGTCATTTAGAGGAAGTAA ITS4: TCCTCCGCTTATTGATATGC 96]
GAPDH GDF: GCCGTCAACGACCCCTTCATTGA GDR: GGGTGGAGTCGTACTTGAGCATGT
Actin ACT-512F: ATGTGCAAGGCCGGTTTCGC ACT-783R: TACGAGTCCTTCTGGCCCAT
HIS-3 CYLH3F: AGGTCCACTGGTGGCAAG CYLH3R: AGCTGGATGTCCTTGGACTG
β-tubulin T1: AACATGCGTGAGATTGTAAGT T2: TAGTGACCCTTGGCCCAGTTG
CHS-1 CHS-79F: TGGGGCAAGGATGCTTGGAAGAAG CHS-345R: TGGAAGAACCATCTGTGAGAGTTG
8. Cordyceps SSU NS1: GTAGTCATATGCTTGTCTC NS4: CTTCCGTCAATTCCTTTAAG [90]
LSU LR0R: ACCCGCTGAACTTAAGC LR5: TCCTGAGGGAAACTTCG
TEF1-α 983F: GCYCCYGGHCAYCGTGAYTT 2218R: ATGACACCRACRGCRACRGTYTGYAT
RPB1 CRPB1: CCWGGYTTYATCAAGAARGT RPB1C: CCNGCDATNTCRTTRTCCATRTA
RPB2 fRPB2-5F: GAYGAYMGWGATCAYTTYGG fRPB2-7cR: CCCATRGCTTGYTTRCCCAT
β-tubulin T12: AACAACTGGGCCAAGGGTCAC T22: TCTGGATGTTGTTGGGAATCC
mt ATP6 ATP6C1A: AGAWCAATTYGAARTRAGAG ATPC2A: ACAAAYACTTGWGCTTGKATWAAI
GC
9. Curvularia GAPDH GPD1: CAACGGCTTCGGTCGCATTG GPD2: GCCAAGCAGTTGGTTGTGC [45]
TEF1-α 983F: GCYCCYGGHCAYCGTGAYTT 2218R: ATGACACCRACRGCRACRGTYTGYAT
ITS ITS5:GGAAGTAAAAGTCGTAACAAGG ITS4: TCCTCCGCTTATTGATATGC
10. Diaporthe ITS ITS5:GGAAGTAAAAGTCGTAACAAGG ITS4: TCCTCCGCTTATTGATATGC [39]
TEF1-α EF1-728F: CATCGAGAAGTTCGAGAAGG EF1-986R: TACTTGAAGGAACCCTTACC
Calmodulin CAL-228F: GAGTTCAAGGAGGCCTTCTCCC CAL-737R: CATCTTTCTGGCCATCATGG
HIS CYLH3F: AGGTCCACTGGTGGCAAG H3-1b: GCGGGCGAGCTGGATGTCCTT
β-tubulin Bt2a: GGTAACCAAATCGGTGCTGCTTTC Bt2b: ACCCTCAGTGTAGTGACCCTTGGC
11. Fusarium RPB2 5F2: GGGGWGAYCAGAAGAAGGC 7cR: CCCATRGCTTGYTTRCCCAT [44, 52]
7cF: ATGGGYAARCAAGCYATGGG 11aR: GCRTGGATCTTRTCRTCSACC
RPB1 Fa: CAYAARGARTCYATGATGGGWC G2R: GTCATYTGDGTDGCDGGYTCDCC
Calmodulin Cal228F: GAGTTCAAGGAGGCCTTCTCCC CAL2Rd: TGRTCNGCCTCDCGGATCATCTC
TEF1-α ef1: ATGGGTAAGGA(A/G)GACAAGAC ef2: GGA(G/A)GTACCAGT(G/C)ATCATGTT
β-tubulin T1: AACATGCGTGAGATTGTAAGT CYLTUB1R: AGTTGTCGGGACGGAAGAG
12. Lasiodiplodia ITS ITS5:GGAAGTAAAAGTCGTAACAAGG ITS4: TCCTCCGCTTATTGATATGC [44]
β-tubulin Bt2a: GGT AAC CAA ATC GGT GCT GCT TTC Bt2b: ACCCTCAGTGTAGTGACCCTTGGC
TEF1-α EF1-728F: CATCGAGAAGTTCGAGAAGG EF1-986R: TACTTGAAGGAACCCTTACC
13. Macrophomina β-tubulin T1: AACATGCGTGAGATTGTAAGT CYLTUB1R: AGTTGTCGGGACGGAAGAG [44]
Calmodulin CAL-228F: GAGTTCAAGGAGGCCTTCTCCC CAL-737R: CATCTTTCTGGCCATCATGG
ITS ITS5:GGAAGTAAAAGTCGTAACAAGG ITS4: TCCTCCGCTTATTGATATGC
TEF1-α EF1-728F: CATCGAGAAGTTCGAGAAGG EF2: GGA(G/A)GTACCAGT(G/C)ATCATGTT
Actin ACT-512F: ATGTGCAAGGCCGGT ACT-783R: TACGAGTCCTTCTGG
14. Magnaporthe ITS ITS5:GGAAGTAAAAGTCGTAACAAGG ITS4: TCCTCCGCTTATTGATATGC [103]
LSU LS1: GTACCCGCTGAACTTAAGC LR5: TCCTGAGGGAAACTTCG
SSU SR1R: TACCTGGTTGATQCTGCCAGT SR7: GTTCAACTACGAGCTTTTTAA
MCM7 MCM7-709: ACIMGIGTITCVGAYGTHAARCC MCM7-
1348: GAYTTDGCIACICCIGGRTCWCCCAT
TEF1-α EF1-983F: GCYCCYGGHCAYCGTGAYTT EF1-
2218R: ATGACACCRACRGCRACRGTYTGYAT
RPB1 RPB1-Af: GARTGYCCDGGDCAYTTYGG RPB1-Cr: CCNGCDATNTCRTTRTCCATRTA
15. Metarhizium TEF1-α 983F: GCYCCYGGHCAYCGTGAYTT 2218R: ATGACACCRACRGCRACRGTYTGYAT [46]
RPB1 CRPB1: CCWGGYTTYATCAAGAARGT RPB1C: CCNGCDATNTCRTTRTCCATRTA
RPB2 fRPB2-5F: GAYGAYMGWGATCAYTTYGG fRPB2-7cR: CCCATRGCTTGYTTRCCCAT
β-tubulin T12: AACAACTGGGCCAAGGGTCAC T22: TCTGGATGTTGTTGGGAATCC
16. Mucor ITS ITS1: TCCGTAGGTGAACCTGCGG ITS4: TCCTCCGCTTATTGATATGC [33]
(continued)
Table 10.1 (continued)
Genes for Primer name
molecular
S. N. Genus of Fungi phylogeny Forward primer (Primer Sequence 50 -30 ) Reverse primer (Primer Sequence 50 -30 ) References
LSU LR0R: ACCCGCTGAACTTAAGC LR5: TCCTGAGGGAAACTTCG
MCM7 Mcm7-709for: ACIMGIGTITCVGAYGTHAARCC Mcm7-1348rev: GAYTTDGCIACICCIGGRTCWC
CCAT
RPB1 RPB1-Af: GARTGYCCDGGDCAYTTYGG RPB1-Cr: CCNGCDATNTCRTTRTCCATRTA
17. Mycospaerella LSU LSU1Fd: GRATCAGGTAGGRATACCCG LR5: TCCTGAGGGAAACTTCG [93]
ITS V9G: TTACGTCCCTGCCCTTTGTA ITS4: TCCTCCGCTTATTGATATGC
RPB2 fRPB2-5F: GAYGAYMGWGATCAYTTYGG fRPB2-7cR: CCCATRGCTTGYTTRCCCAT
18. Penicillium ITS ITS1F: TCCGTAGGTGAACCTGCGG ITS4: TCCTCCGCTTATTGATATGC [95]
Calmodulin CF1: GCCGACTCTTGACTGAA CF4: TTTYTGCATCATRAGYTGGAC
β-tubulin Bt2a: GGTAACCAAATCGGTGCTGCTTTC Bt2b: ACCCTCAGTGTAGTGACCCTTGGC
RPB2 RPB2-5F_Eur: GAYGAYCGKGAYCAYTTCGG RPB2-7CR_Eur: CCCATRGCYTGYTTRCCCAT
19. Phytophthora LSU LROR-O: ACCCGCTGAACTYAAGC LR6-O: CGCCAGACGAGCTTACC [39]
LSUFint: CKTTGACGAAATGGAGCGAT LSURint: TTTCCACACCCTAACACTTGC
β-tubulin Btub_F1: GCCAAGTTCTGGGAGGTCATC Btub_R1A: CCTGGTACTGCTGGTAYTCMGA
COX II FM35: CAGAACCTTGGCAATTAGG Phy10b: GCAAAAGCACTAAAAATTAAATATAA
nad9 Nad9-F: TACAACAAGAATTAATGAGAAC Nad9-R: GTTAAAATTTGTACTACTAACAT
20. Pseudocercospora TEF1-α EF1-728F: CATCGAGAAGTTCGAGAAGG EF-2: GG(G/A)GTACCAGT(G/C)ATCATGTT [21]
Actin ACT-512F: ATGTGCAAGGCCGGTTTCGC ACT-2Rd: TACGAGTCCTTCTGGCCCAT
ITS ITS5: GGAAGTAAAAGTCGTAACAAGG ITS4: TCCTCCGCTTATTGATATGC
LSU LSU1Fd: GRATCAGGTAGGRATACCCG LR5: TCCTGAGGGAAACTTCG
21. Puccinia LSU Rust28SF: TTTTAAGACCTCAAATCAGGTG LR5: TCCTGAGGGAAACTTCG [3]
SSU RustNS2-F: GGGAGGTAGTGACMATAAATAAC NS6: GCATCACAGACCTGTTATTGCCTC
AATG
COX III CO3F1: TCAGTATGTTATTTTAACGATGTAG CO3R1: TCCTCATCAGTAAACACTAATA
22. Pythium ITS ITS1: TCCGTAGGTGAACCTGCGG ITS4: TCCTCCGCTTATTGATATGC [39]
COX II FM58: CCACAAATTTCACTACATTGA FM66: TAGGATTTCAAGATCCTGC
23. Rhizopus ITS V9G: TTACGTCCCTGCCCTTTGTA LS266: GCATTCCCAAACAACTCGACTC [26]
Actin Act-1: TGGGACGATATGGAIAAIATCTGGCA Act-
4ra: TCITCGTATTCTTGCTTIGAIATCCACAT
TEF1-α MEF-4: ATGACACCRACAGCGACGGTTTG MEF-10: GTTGTCATCGGTCACGTCGATTC
RPB1 RPB1-Af: GARTGYCCDGGDCAYTTYGG RPB1-Cr: CCNGCDATNTCRTTRTCCATRTA
24. Sclerotinia ITS ITS1: TCCGTAGGTGAACCTGCGC ITS4: TCCTCCGCTTATTGATATGC [83]
β-tubulin β-tubulin F: GGTAACCAAATCGGTGCTGCTTTC β-tubulin R: ACCCTCAGTGTAGTGACCCTTGGC
25. Sporothrix LSU LR3: CCG TGT TTC AAG ACG GG LR5: TCCTGAGGGAAACTTCG [24]
ITS ITS1F: CTTGGTCATTTAGAGGAAGTAA ITS4: TCCTCCGCTTATTGATATGC
β-tubulin T10: ACGATAGGTTCACCTCCAGAC Bt2b: ACCCTCAGTGTAGTGACCCTTGGC
Calmodulin CL1: GA(GA)T(AT)CAAGGAGGCCTTCTC CL2a: TTTTTGCATCATGAGTTGGAC
26. Talaromyces RPB2 fRPB2-5f: GAYGAYMGWGATCAYTTYGG fRPB2-7cR: CCCATRGCTTGYTTRCCCAT [101]
β-tubulin Bt2a: GGTAACCAAATCGGTGCTGCTTTC Bt2b: ACCCTCAGTGTAGTGACCCTTGGC
ITS V9G: TTACGTCCCTGCCCTTTGTA LS266: GCATTCCCAAACAACTCGACTC
27. Trichoderma RPB2 fRPB2-5f: GAYGAYMGWGATCAYTTYGG fRPB2-7cR: CCCATRGCTTGYTTRCCCAT [42]
TEF1-α EF1-728F: CATCGAGAAGTTCGAGAAGG TEF1LLErev: AACTTGCAGGCAATGTGG
acl1 acl1-230up: AGCCCGATCAGCTCATCAAG acl1-1220low: CCTGGCAGCAAGATCVAGGAAG
T
28. Verticilium Actin VActF: TAATTCACAATGGAGGGTAGG VActR: GTAAGGATACCACGCTTGG [40, 44]
TEF1-α VEFf: AACGTCGTCGTCATCGGCCACG VEFr: CCACGCTCACGCTCGGCCTT
GAPDH VGPDf2: GGCATCAACGGTTTCGGCC VGPDr: GTAGGAGTGGACGGTGGTCATGAG
TS VTs3f: GCGCTGCAAGGCCGAGAAC VTs3r: GCGGAACGAGACGGCCTCC
ITS ITS5: GGAAGTAAAAGTCGTAACAAGG ITS4: TCCTCCGCTTATTGATATGC
184 N. Mehta et al.
There has always been a requirement of putting all the essential information and
protocols for fungal molecular taxonomy and phylogeny in one place; therefore, we
assembled all the required protocols starting from fungal DNA isolation, list of
recommended gene targets for fungal identification and phylogeny, their primer
names, sequences and PCR cycling conditions, PCR product purification, and
DNA sequencing in this chapter. Considering the vast number of fungi, we have
enlisted the gene targets/markers for limited number of fungi, which are the common
and important fungal pathogens. Many times, it becomes difficult to get the correct
PCR cycling conditions for different gene targets/markers and for which one has to
check multiple back references; therefore, we have also enlisted the primer pair
names, their sequences, and their PCR cycling conditions. We have also briefed
about sequence editing and analysis. Sometimes, erroneous DNA sequences in
NCBI nucleotide database lead to the misidentification of fungi; therefore, to
cross-check and confirm the identity of the fungi, some additional well authenticated
databases are also described, which can be used for molecular identification of fungi
in addition to NCBI BLASTn. An outline about the construction of phylogenetic tree
using MEGA7 has been described. Though there are many advanced tools like
RAxML and Mr. Bayes available for constructing the phylogenetic trees, however,
MEGA7 has been given because of ease of constructing a phylogenetic tree.
Especially for the beginners in the field, a chart for the entire work flow has also
been given for easy understanding of all the different steps required to perform the
phylogenetic analysis of fungi (Fig. 10.2). Further, the methods, materials, and
protocols vary among the different laboratories; therefore, the same can be twisted
or modified depending upon the availability of reagents, chemicals, and equipment.
There are various extraction methods available for fungi, and the choice of method
used for DNA extraction depends on the availability of equipments and nature of
fungal samples from which DNA is to be isolated. Total genomic DNA can be
isolated from fungal specimen by various physical methods like crushing in liquid
nitrogen, bead beating in homogenizer, and use of some cell wall degrading enzymes
with detergents like sodium dodecyl sulphate (SDS) and Cetyltrimethyl ammonium
bromide (CTAB). Unfortunately, sometimes few methods can lead to shearing of
DNA or can be hazardous and laborious (grinding pathogenic fungi in an open
mortar and pestle, or handling multiple fungal isolates). Therefore, a closed DNA
isolation system is always preferred, wherein one can isolate DNA from multiple
fungi simultaneously, thereby enabling high throughput DNA extraction. One such
method has been outlined in the following protocol section. Researchers also use
DNA extraction kits. Most popular kits are DNeasy 96 Plant Kit (Qiagen), Qiagen
MOBIO Laboratories, FastDNA SPIN Kit (MP Biomedicals), and Epicentre’s
MasterPure™ Yeast DNA Purification Kit to isolate genomic DNA from a broad
range of fungi. Specific protocols are provided with each kit for researcher.
10 Molecular Taxonomy and Multigene Phylogeny of Filamentous Fungi 185
Fig. 10.2 A flow-chart of various steps towards molecular phylogenetic analysis of fungi
186 N. Mehta et al.
The basic criteria for the selection of a suitable DNA isolation method include
(1) efficient DNA extraction, (2) good quantity of DNA, (3) removal of contami-
nants, (4) purity and quality of DNA, and (5) possibility of high throughput.
Ultraviolet absorbance is mostly used to determine the purity of DNA. For a good-
quality DNA, the quantitative ratio of absorbance at 260 nm and 280 nm (A260/
A280) must be 1.8. If this ratio is less than 1.8, it indicates the DNA sample has
protein contamination or has impurity of an organic solvent such as phenol, and if
the ratio is more than 1.8, it indicates the DNA sample has RNA contamination. The
quantification of dsDNA should be assessed by Qubit fluorometer analysis, while
A260/A280 can be determined by NanoDrop spectrophotometer. Quality of DNA
can also be assessed by visualization on agarose gel. A rapid and high throughput
fungal DNA extraction protocol is mentioned below [1].
10.2.1 Materials
10.2.2 Method
1. Scrape 300 mg of mycelia from agar plate or from the culture broth by filtering it
through a 10–15 ml syringe containing some glass wool that will allow the
fungal mass retaining in syringe and let the broth to pass through, and then
10 Molecular Taxonomy and Multigene Phylogeny of Filamentous Fungi 187
transfer the fungal mass into a screw capped tube containing ceramic pestle and
some fine glass beads.
2. Add 1 ml lysis buffer and homogenize twice for 60s at 6 M/S.
3. Centrifuge the homogenized mycelia at 12,000 rpm for 15 min at room temper-
ature (RT), and then transfer the supernatant in a fresh 1.5 ml Eppendorf tube.
4. Add equal volume of phenol-chloroform-isoamyl alcohol (PCI) and shake well
(at least 30 times). Centrifuge for 10 min at 10,000 rpm at RT; separate upper
aqueous layer in new 1.5 ml Eppendorf tube.
5. If any haziness or pigment persists then repeat the PCI treatment.
6. Add equal volume of Isopropanol and keep at 20 C for 20 min.
7. Centrifuge for 10 min at 10,000 rpm at 4 C. Remove supernatant and wash the
pellet using 500 μL of 70% ethanol.
8. Again centrifuge at 10,000 rpm for 5 min at 4 C. Remove supernatant and
air dry the pellet.
9. Dissolve the pellet in 50–70 μL of 1X TE buffer.
10. Add 1 μL of RNaseA (10 mg/ml) and incubate it at 37 C for 30 min.
11. 2 μL of genomic DNA is subjected to 0.8% agarose gel electrophoresis (refer
agarose gel electrophoresis protocol).
12. Observe the gel under UV trans-illuminator gel documentation system.
13. Determination of quantity and quality of the isolated DNA can be done by
NanoDrop spectrophotometer and Qubit fluorometer.
Concentration of agarose gel (%) Range of linear DNA Molecules (kb) for separation
0.6 1–20
0.8 0.5–10
1.2 0.4–6
1.5 0.2–3
2.0 0.1–2
188 N. Mehta et al.
10.3.1 Material
1. Gel electrophoretic unit including buffer tank, casting tray, gel cassette and comb
2. Voltage supplier
3. Running Buffer:
(a) TAE (1 L – 242 g Tris base, 57.1 ml glacial acetic acid, 100 ml 0.5 M EDTA
of pH 8)
(b) TBE (1 L – 242 g Tris base, 137.5 ml boric acid, 100 ml 0.5 M EDTA of
pH 8)
4. Agarose
5. Conical flask
6. Ethidium bromide
7. Hot plate or microwave oven
8. Gel loading dye (6X- 1.5 g Ficoll400, 25 mg Xylene cyanol FF, 25 mg
bromophenol blue – 10 ml dH2O)
9. Gel documentation system (make Syngene, Biorad, etc.)
10.3.2 Method
1. Prepare 100 ml 0.5X Tris Borate EDTA/Tris Acetate EDTA (TBE/TAE) buffer
of pH 8 in distilled water in a conical flask.
2. Weigh 0.8gm (for DNA, i.e. 0.8%)/1.2–1.5 gm (for PCR product, i.e. 1.2–1.5%)
of agarose and add 100 ml of 0.5 X TBE/TAE buffer.
3. Keep it in microwave oven or on hot plate for 5–10 min to melt the gel.
4. Take the gel solution from oven or hot plate and allow it to cool (~60 C).
5. Add 2–4 μL ethidium bromide (EtBr) of 10 mg/mL concentration and mix
properly (EtBr is a well-known and widely used fluorescent dye used to
visualize the DNA/RNA under UV light).
6. Assemble the gel caster with casting tray, comb and pour the gel. Let the agarose
gel solidify for approx. 20–30 min.
7. Place the gel casting tray in electrophoretic chamber filled with running buffer
(0.5X TBE/TAE, same as the gel preparation buffer).
8. Remove the comb and place the gel along with casting tray in the electrophoretic
chamber.
9. Connect both the electrodes, switch on the current and allow the gel to run at
70–100 V for 20–30 min.
10. After 30 min, take out the gel from the electrophoretic chamber and observe it
under UV transilluminator or in a gel documentation system.
Note: If the DNA bands are bright and sharp, it indicates that the quantity and
quality of DNA is good, but if a smear has been seen on gel, it indicates
degradation of DNA (quantity and quality of DNA is poor).
Table 10.2 PCR conditions of different gene targets and their respective primer pairs
10
No.
Name of gene Initial Final of
S. N. target Primer pair/set denaturation Denaturation Annealing Extension extension cycles References
1. Internal V9G/ITS4 94 C – 5 min 94 C – 30 s 48 C – 30 s 72 C – 90 s 72 C – 7 min 35 [37, 97]
Transcribed ITS1/ITS4 95 C – 5 min 95 C – 30 s 50 C – 30 s 72 C – 1 min 72 C – 7 min 30
Spacer region ITS5/ITS4 95 C – 5 min 95 C – 30 s 50 C – 30 s 72 C – 1 min 72 C – 7 min 30
of the rRNA
ITS-1F/ITS4 95 C – 5 min 95 C – 30 s 50 C – 30 s 72 C – 1 min 72 C – 7 min 30
(ITS)
2. Large Subunit LROR/LR6 95 C – 3 min 95 C – 1 min 53 C – 1 min 72 C – 2 min 72 C – 7 min 35 [94]
of the rRNA LROR/LR5 94 C – 5 min 94 C – 1 min 52 C – 30s 72 C – 1 min 72 C – 7 min 35
(LSU, 28S) LSUFint/ 94 C – 5 min 94 C – 1 min 52 C – 30s 72 C – 1 min 72 C – 7 min 35 [14]
LSURint
LSU1Fd/ LR5 94 C – 3 min 94 C – 30 s 52 C – 30s 72 C – 45 s 72 C – 5 min 35 [23, 94]
LS1/LR5 95 C – 2 min 95 C – 1 min 57 C – 1 min 72 C – 1 min 72 C – 10 min 35 [72]
LR3/LR5 94 C – 5 min 94 C – 1 min 52 C – 30s 72 C – 1 min 72 C – 7 min 35 [94]
Rust28SF/ 94 C – 5 min 94 C – 1 min 55 C – 30s 72 C – 1 min 72 C – 7 min 35 [8]
LR5
NL1/NL4 94 C – 5 min 94 C – 1 min 52 C – 30s 72 C – 1 min 72 C – 7 min 35 [48]
3. Small Subunit NS1/NS4 94 C – 5 min 94 C – 1 min 51 C – 30s 72 C – 1 min 72 C – 7 min 35 [89]
of the rRNA RustNS2-F/ 94 C – 5 min 94 C – 1 min 55 C – 30s 72 C – 1 min 72 C – 7 min 35 [8]
(SSU, 18S) NS6
SR1R/SR7 35 [94]
Molecular Taxonomy and Multigene Phylogeny of Filamentous Fungi
No.
Name of gene Initial Final of
S. N. target Primer pair/set denaturation Denaturation Annealing Extension extension cycles References
Fa/G2R 94 C – 5 min 94 C – 1 min 45 C – 30 s 72 C – 1 min 72 C – 7 min 35 [65]
RPB1-Af/ 95 C – 2 min 95 C – 1 min 57 C – 1 min 72 C – 1 min 72 C – 10 min 35 [15, 88]
RPB1-Cr
RBP1-F1843/ 94 C – 5 min 94 C – 30 s 51 C – 30 s 72 C – 1 min 72 C – 10 min 5 [76]
RPB1-R3096a 94 C – 30 s 49 C – 30 s 72 C – 1 min 5
94 C – 30 s 47 C – 30 s 72 C – 1 min 30
5. Second largest RPB2-5F2/ 94 C – 90 s 94 C – 30 s 55 C – 90 s 68 C – 90 s 68 C – 5 min 40 [64]
subunit of RNA RPB2-7cR
polymerase II RPB2for/ 94 C – 5 min 94 C – 30 s 55 C – 30 s 72 C – 90 s 72 C – 10 min 35 [86]
(RPB2) RPB2rev
RPB2-7cF/ 94 C – 5 min 94 C – 1 min 37 C – 35 s (1 72 C-1 min 72 C – 10 min 30 [51]
RPB2-11aRa every 5 s to 72 )
bRPB2-6F/ 94 C – 4 min 94 C – 1 min 51 C – 1 min 72 C – 1 min 72 C – 8 min 36
gRPB2-6R
6. Beta-tubulin Bt2a/Bt2b 94 C – 5 min 94 C – 1 min 58 C-1 min 72 C-1 min 72 C – 7 min 32 [29]
(β-tub) BT1-F/BT1-R 94 C – 3 min 94 C – 30 s 56 C – 30 s 72 C – 45 s 72 C – 5 min 40 [7]
T1/T2 95 C – 4 min 95 C – 30 s 55 C – 30 s 72 C – 45 s 72 C – 7 min 40 [61]
T12/T22 94 C – 5 min 94 C – 1 min 52 C – 30 s 72 C – 2 min 72 C – 7 min 35 [90]
T1/ 94 C – 2 min 94 C – 1 min 55 C – 30 s 72 C – 1 min 72 C – 10 min 35 [22, 61]
CYLTUB1R
Btub_F1/ 95 C – 3 min 95 C – 1 min 60 C – 1 min 72 C – 2 min 72 C – 5 min 35 [14]
Btub_R1A
T10/Bt2b 96 C – 30s 94 C – 1 min 58 C – 1 min 72 C – 1 min 72 C – 5 min 32 [29, 61]
N. Mehta et al.
10
(continued)
Table 10.2 (continued)
192
No.
Name of gene Initial Final of
S. N. target Primer pair/set denaturation Denaturation Annealing Extension extension cycles References
10. HSP60 HSP60for/ 94 C – 5 min 94 C – 30s 55 C – 30 s 72 C – 90 s 72 C – 10 min 35 [86]
HSP60rev
11. GAPDH GPD1/GPD2 94 C – 5 min 94 C – 30s 48 C – 30s 72 C – 90s 72 C – 7 min 35 [9]
G3PDHfor/ 94 C – 5 min 94 C – 30s 64 C – 30s 72 C – 90s 72 C – 10 min 35 [86]
G3PDHrev
Gpd1-LM/ 94 C – 5 min 94 C – 45 s 53 C – 45 s 72 C – 90s 72 C – 5 min 40 [7]
Gpd2-LM
GDF/GDR 95 C – 4 min 95 C – 30 s 60 C – 30 s 72 C – 45 s 72 C – 7 min 35 [91]
VGPDf2/ 94 C – 2 min 94 C – 10 s 56 C – 20 s 72 C – 1 min 72 C – 7 min 32 [40]
VGPDr
12. Calmodulin CF1/CF4 94 C – 5 min 94 C – 45 s 55 C – 45 s 72 C-1 min 72 C – 7 min 35 [66]
(CaM) CF1L/CF4 96 C – 2 min 96 C – 30 s 51 C – 30 s 72 C – 90s 72 C – 5 min 42
CF1M/CF4 96 C – 2 min 96 C – 30 s 51 C – 30 s 72 C – 90s 72 C – 5 min 42
Cal228F/ 95 C – 8 min 95 C – 15 s 55 C – 20 s 72 C-1 min 72 C – 5 min 35 [18]
CAL2Rd
cmd5/cmd6 96 C – 2 min 96 C – 30 s 51 C – 30 s 72 C – 90s 72 C – 5 min 42 [35]
Cal228F/ 94 C – 2 min 94 C – 1 min 55 C – 30 s 72 C-1 min 72 C – 10 min 35 [18]
Cal737R
CL1/CL2a 95 C – 5 min 95 C – 30 s 55 C – 30 s 72 C-1 min 72 C – 8 min 35 [63]
13. Mini chromo- MCM7–709/ 94 C – 94 C – 45 s 56 C – 50 s 72 C-1 min 72 C – 5 min 38 [78]
some mainte- MCM7–1348 10 min
nance
protein(MCM7)
N. Mehta et al.
10
OPA10-2R
25. Endo PG PG3/PG2b 94 C – 5 min 94 C – 30s 50 C – 30 s 72 C – 30 s 72 C – 7 min 40
a
Touchdown PCR conditions
193
194 N. Mehta et al.
Selection of gene target is very crucial step in the fungal molecular taxonomy and
phylogeny. Most common DNA markers proposed for molecular identification and
phylogeny of fungi are the nuclear ITS region of the ribosomal RNA gene. We have
enlisted the suitable gene targets/markers which can be used for specific fungal
genera and/or species level identification, their respective primer pair, primer
sequences, and PCR cycling conditions (Tables 10.1 and 10.2). We have provided
this information for few selected fungi, and for the non-listed fungi, the researchers
are advised to find out the recommended gene targets/markers by following the
recent literature on the same.
10.4.1 Materials
10.4.2 Method
The steps for PCR amplification are as described below. The total volume can either
be 25 or 50 μL.
1. Thaw all the PCR reagents completely on ice before use. (Make sure the reagents
were kept at 20 C).
2. Prepare PCR reaction mix in a thin-walled 0.2 mL PCR tubes for 25/50 μL
reaction volume.
3. All the PCR reagents can be added in the following order: water, buffer, dNTPs,
forward and reverse primers, Taq DNA polymerase and DNA template, or if one
has PCR master-mix, then the order should be water, master-mix
(e.g. EmeraldAmp GT PCR Master Mix, Takara), both primers and DNA
template.
10 Molecular Taxonomy and Multigene Phylogeny of Filamentous Fungi 195
4. Gently pipette the reaction mixture to allow good mixing and give short spin to
settle down the reagents.
5. Prepare positive and negative control reactions with and without template DNA
of known size, respectively along with test sample. (Note: positive control
confirms that all PCR reagents are working properly, whereas negative control
confirms that there is contamination in reagents which will result into false band).
Note: If one wants to perform a greater number of PCR reactions, then it is
recommended to first prepare a PCR master mix, except the reagents which are to
be varied. (e.g., DNA template). For all the PCR related information (Primer
name and sequences, PCR conditions), refer Tables 10.1 and 10.2.
6. 2 μL of PCR product is subjected to 1.2% agarose gel electrophoresis (refer
agarose gel electrophoresis protocol).
7. Observe the gel under UV transilluminator gel documentation system.
DNA sequencing is the process to determine the order of nucleotides in a given DNA
molecule. The first-generation sequencing approach emerged in the 1970s, which
included the Maxam-Gilbert method and the Sanger method (or dideoxy method),
discovered by English biochemist Frederick Sanger. Eventually, Sanger method
became the more commonly employed technique among these two approaches
because it is a rapid and easy method for DNA sequencing. This conventional
chain-termination approach requires a single-stranded DNA template, a primer,
DNA polymerase, dNTPs, and modified di-deoxynucleotide triphosphates
(ddNTPs), the latter of which plays a key role in terminating DNA strand elongation.
These chain-terminating ddNTPs lack a 3’-OH group, which is required for
phosphodiester bond formation between two consecutive nucleotides; hence, the
moment it gets incorporated into newly synthesised strand it halts the extension of
DNA [77]. The ddNTPs are fluorescently labelled for detection in automated
sequencing machines. The protocol mentioned here is of Applied Biosystems –
BigDye™ Terminator v3.1 cycle sequencing kit.
The direct approach of cycle sequencing of amplified and purified PCR products
depends on two factors, i.e. source material (type and amount) and contamination
like proteins, RNA or chromosomal DNA, excess primers, dNTPs, enzyme, residual
salts along with some organic chemicals like phenol and chloroform. Before pro-
ceeding with sequencing, the critical requirement is to quantify the purified DNA
and calculate A260/280 ratios (A260/280 ¼ 1.8–2.0). The optimum concentrations
of DNA template are mentioned below:
Recommended DNA Quantities
10.6.1 Materials
10.6.2 Method
1. Thaw all the reagents of the BigDye Terminator v3.1 cycle sequencing kit and
primers completely (place on ice).
Note: Prevent dye terminators to light exposure.
2. Vortex and centrifuge briefly the tubes for 3–4 s to collect all tube contents at
bottom.
3. Add components in 0.2 ml thin-walled tube to prepare reaction mix as
indicated below:
S. N. Reagents Volume
1. 5X sequencing buffer 2 μL
2. Primer (primer of interest) 0.6 μL
3. BigDye terminator 3.1 1.2 μL
4. Template-purified PCR product (10-50 ng depend on length of template, refer 1 μL
recommended DNA quantities)
5. Sterile dH2O 1 μL
6. Total 10 μL
Note: One can use BDT 3.1 ready mix (3–4 μL) that has sequencing buffer also, so no need to add
sequencing buffer separately
198 N. Mehta et al.
Once the DNA sequences are generated, the most important task is to ensure the
quality of the DNA sequences. Different tools like Finch TV and Chromas Lite can
be used to visualize the DNA sequence in the form of electropherogram. Both these
tools are freely available to download. Another important point is that one should try
10 Molecular Taxonomy and Multigene Phylogeny of Filamentous Fungi 199
to get full length DNA sequence of any given gene target/marker. If the sequence
length is short, one should sequence both the strands of the DNA and make a
consensus sequence to get the full-length sequence of the gene. Usually the quality
scores of the initial and last few bases (20–30) in a given DNA sequence are not
always up to the mark; therefore, while performing similarity searches, these few
bases should not be considered.
10.8.4 Method
Phylogenetic trees can be constructed using DNA sequences of closely related fungi
and various computational phylogenetic methods. The basic and simple method of
tree construction is distance-based method including neighbour joining and
UPGMA method, which performs multiple sequence alignment using ClustalW
method and calculate genetic distances. The most common tree construction method
is character-based: include maximum parsimony that involves an inherent model of
evolution (i.e. parsimony), and maximum likelihood which is an advanced
method that uses Bayesian scheme and applies a precise open model of evolution.
Identification of a most favourable phylogenetic tree is non-parametric; therefore,
the optimization and combination of these methods are required to identify a best
possible and optimal phylogenetic tree, while building trees bootstrapping is
followed. A bootstrap is a statistical method for assessing phylogenetic tree where
the bootstrap value represents that out of 100 how many times the same specific
branch is observed when repeating the phylogenetic tree reconstruction from the
same set of data.
10. Once the tree is constructed the session of tree can be saved as MTS file.
11. Post-construction, various modifications can be done in the tree.
12. The tree can be obtained as JPEG image/PDF file along with the caption.
References
1. Aamir S, Sutar S, Singh SK, Baghela A (2015) A rapid and efficient method of fungal genomic
DNA extraction, suitable for PCR based molecular methods. Plant Pathol Quar 5:74–81.
https://doi.org/10.5943/ppq/5/2/6
2. Aguileta G, Marthey S, Chiapello H et al (2008) Assessing the performance of single-copy
genes for recovering robust phylogenies. Syst Biol. https://doi.org/10.1080/
10635150802306527
3. Aime MC, Bell CD, Wilson AW (2018) Deconstructing the evolutionary complexity between
rust fungi (Pucciniales) and their plant hosts. Stud Mycol. https://doi.org/10.1016/j.simyco.
2018.02.002
4. Al-Hatmi AMS, Van Den Ende AHGG, Stielow JB et al (2016) Evaluation of two novel
barcodes for species recognition of opportunistic pathogens in fusarium. Fungal Biol. https://
doi.org/10.1016/j.funbio.2015.08.006
5. Alastruey-Izquierdo A, Hoffmann K, De Hoog GS et al (2010) Species recognition and
clinical relevance of the zygomycetous genus Lichtheimia (syn. Absidia pro parte,
Mycocladus). J Clin Microbiol. https://doi.org/10.1128/JCM.01744-09
6. Andrew M, Peever TL, Pryor BM (2009) An expanded multilocus phylogeny does not resolve
morphological species within the small-spored Alternaria species complex. Mycologia. https://
doi.org/10.3852/08-135
7. Bakhshi M, Arzanlou M, Babai-ahari A et al (2018) Novel primers improve species delimi-
tation in Cercospora. IMA Fungus. https://doi.org/10.5598/imafungus.2018.09.02.06
8. Beenken L, Zoller S, Berndt R (2012) Rust fungi on Annonaceae II: the genus Dasyspora
Berk. & M.A. Curtis. Mycologia. https://doi.org/10.3852/11-068
9. Berbee ML, Pirseyedi M, Hubbard S (1999) Cochliobolus phylogenetics and the origin of
known, highly virulent pathogens, inferred from ITS and glyceraldehyde-3-phosphate dehy-
drogenase gene sequences. Mycologia. https://doi.org/10.2307/3761627
10. Berbee ML, Taylor JW (2001) Fungal molecular evolution: gene trees and geologic time. In:
Systematics and evolution. Springer-Verlag, Berlin
11. Bialek R, González GM, Begerow D, Zelck UE (2005) Coccidioidomycosis and blastomyco-
sis: advances in molecular diagnosis. FEMS Immunol Med Microbiol 45(3):355–360
12. Biswas SK, Yokoyama K, Nishimura K, Miyaji M (2001) Molecular phylogenetics of the
genus Rhodotorula and related basidiomycetous yeasts inferred from the mitochondrial cyto-
chrome b gene. Int J Syst Evol Microbiol. https://doi.org/10.1099/00207713-51-3-1191
13. Blackwell M, Hibbett DS, Taylor JW, Spatafora JW (2006) Research coordination networks: a
phylogeny for kingdom fungi (deep hypha). Mycologia. https://doi.org/10.3852/mycologia.
98.6.829
14. Blair JE, Coffey MD, Park SY et al (2008) A multi-locus phylogeny for Phytophthora utilizing
markers derived from complete genome sequences. Fungal Genet Biol. https://doi.org/10.
1016/j.fgb.2007.10.010
15. Brandon Matheny P, Liu YJ, Ammirati JF, Hall BD (2002) Using RPB1 sequences to improve
phylogenetic inference among mushrooms (Inocybe, Agaricales). Am J Bot 89(4):688–698
16. Bridge PD, Roberts PJ, Spooner BM, Panchal G (2003) On the unreliability of published DNA
sequences. New Phytol. https://doi.org/10.1046/j.1469-8137.2003.00861.x
10 Molecular Taxonomy and Multigene Phylogeny of Filamentous Fungi 203
17. Buée M, Reich M, Murat C et al (2009) 454 pyrosequencing analyses of forest soils reveal an
unexpectedly high fungal diversity. New Phytol. https://doi.org/10.1111/j.1469-8137.2009.
03003.x
18. Carbone I, Kohn LM (1999) A method for designing primer sets for speciation studies in
filamentous ascomycetes. Mycologia. https://doi.org/10.2307/3761358
19. Castlebury LA, Rossman AY, Sung GH et al (2004) Multigene phylogeny reveals new lineage
for Stachybotrys chartarum, the indoor air fungus. Mycol Res. https://doi.org/10.1017/
S0953756204000607
20. Crous PW, Braun U, Groenewald JZ (2007) Mycosphaerella is polyphyletic. Stud Mycol.
https://doi.org/10.3114/sim.2007.58.01
21. Crous PW, Braun U, Hunter GC et al (2013) Phylogenetic lineages in Pseudocercospora. Stud
Mycol. https://doi.org/10.3114/sim0005
22. Crous PW, Groenewald JZ, Risède JM et al (2004) Calonectria species and their
Cylindrocladium anamorphs: species with sphaeropedunculate vesicles. Stud Mycol 50:
415–430
23. Crous PW, Summerell BA, Carnegie AJ et al (2009) Unravelling Mycosphaerella: do you
believe in genera? Persoonia Mol Phylogeny Evol Fungi. https://doi.org/10.3767/
003158509X479487
24. de Beer ZW, Duong TA, Wingfield MJ (2016) The divorce of Sporothrix and Ophiostoma:
solution to a problematic relationship. Stud Mycol. https://doi.org/10.1016/j.simyco.2016.
07.001
25. Devulder G, de Montclos MP, Flandrois JP (2005) A multigene approach to phylogenetic
analysis using the genus Mycobacterium as a model. Int J Syst Evol Microbiol. https://doi.org/
10.1099/ijs.0.63222-0
26. Dolatabadi S, de Hoog GS, Meis JF, Walther G (2014) Species boundaries and nomenclature
of Rhizopus arrhizus (syn. R. oryzae). Mycoses. https://doi.org/10.1111/myc.12228
27. Einax E, Voigt K (2003) Oligonucleotide primers for the universal amplification of β-tubulin
genes facilitate phylogenetic analyses in the regnum fungi. Org Divers Evol. https://doi.org/10.
1078/1439-6092-00069
28. Geiser DM (2004) Practical molecular taxonomy of fungi. In: Advances in fungal biotech-
nology for industry, agriculture, and medicine, pp 3–14
29. Glass NL, Donaldson GC (1995) Development of primer sets designed for use with the PCR to
amplify conserved genes from filamentous ascomycetes. Appl Environ Microbiol 61(4):
1323–1330
30. Gontcharov AA, Marin B, Melkonian M (2004) Are combined analyses better than single gene
phylogenies? A case study using SSU rDNA and rbcL sequence comparisons in the
Zygnematophyceae (Streptophyta). Mol Biol Evol. https://doi.org/10.1093/molbev/msh052
31. Gräfenhan T, Schroers HJ, Nirenberg HI, Seifert KA (2011) An overview of the taxonomy,
phylogeny, and typification of nectriaceous fungi in Cosmospora, Acremonium, Fusarium,
Stilbella, and Volutella. Stud Mycol. https://doi.org/10.3114/sim.2011.68.04
32. Hawksworth DL (2004) (183-187) Limitation of dual nomenclature for pleomorphic fungi.
Taxon. https://doi.org/10.2307/4135654
33. Hermet A, Méheust D, Mounier J et al (2012) Molecular systematics in the genus Mucor with
special regards to species encountered in cheese. Fungal Biol. https://doi.org/10.1016/j.funbio.
2012.04.002
34. Hibbett DS, Binder M, Bischoff JF et al (2007) A higher-level phylogenetic classification of
the fungi. Mycol Res. https://doi.org/10.1016/j.mycres.2007.03.004
35. Hong SB, Cho HS, Shin HD et al (2006) Novel Neosartorya species isolated from soil in
Korea. Int J Syst Evol Microbiol. https://doi.org/10.1099/ijs.0.63980-0
36. Hong SG, Cramer RA, Lawrence CB, Pryor BM (2005) Alt a 1 allergen homologs from
Alternaria and related taxa: analysis of phylogenetic content and secondary structure. Fungal
Genet Biol. https://doi.org/10.1016/j.fgb.2004.10.009
204 N. Mehta et al.
37. Hoog GS, Ende AHGG (1998) Molecular diagnostics of clinical strains of filamentous
Basidiomycetes. Mycoses. https://doi.org/10.1111/j.1439-0507.1998.tb00321.x
38. Hunter GC, Wingfield BD, Crous PW, Wingfield MJ (2006) A multi-gene phylogeny for
species of Mycosphaerella occurring on Eucalyptus leaves. Stud Mycol. https://doi.org/10.
3114/sim.55.1.147
39. Hyde KD, Nilsson RH, Alias SA et al (2014) One stop shop: backbones trees for important
phytopathogenic genera: I (2014). Fungal Divers. https://doi.org/10.1007/s13225-014-0298-1
40. Inderbitzin P, Bostock RM, Davis RM et al (2011) Phylogenetics and taxonomy of the fungal
vascular wilt pathogen Verticillium, with the descriptions of five new species. PLoS One.
https://doi.org/10.1371/journal.pone.0028341
41. Jaklitsch WM, Komon M, Kubicek CP, Druzhinina IS (2005) Hypocrea voglmayrii sp. nov.
from the Austrian Alps represents a new phylogenetic clade in Hypocrea/Trichoderma.
Mycologia. https://doi.org/10.3852/mycologia.97.6.1365
42. Jaklitsch WM, Voglmayr H (2015) Biodiversity of Trichoderma (Hypocreaceae) in Southern
Europe and Macaronesia. Stud Mycol. https://doi.org/10.1016/j.simyco.2014.11.001
43. James TY, Kauff F, Schoch CL et al (2006) Reconstructing the early evolution of fungi using a
six-gene phylogeny. Nature. https://doi.org/10.1038/nature05110
44. Jayawardena RS et al (2019b) One stop shop III: taxonomic update with molecular phylogeny
for important phytopathogenic genera: 51–75 (2019). Fungal Divers 103:87–218
45. Jayawardena RS, Hyde KD, Jeewon R et al (2019a) One stop shop II: taxonomic update with
molecular phylogeny for important phytopathogenic genera: 26–50 (2019). Fungal Divers.
https://doi.org/10.1007/s13225-019-00418-5
46. Kepler RM, Humber RA, Bischoff JF, Rehner SA (2014) Clarification of generic and species
boundaries for Metarhizium and related fungi through multigene phylogenetics. Mycologia.
https://doi.org/10.3852/13-319
47. Kolbert CP, Persing DH (1999) Ribosomal DNA sequencing as a tool for identification of
bacterial pathogens. Curr Opin Microbiol. https://doi.org/10.1016/S1369-5274(99)80052-6
48. Kurtzman CP, Robnett CJ (1997) Identification of clinically important ascomycetous yeasts
based on nucleotide divergence in the 50 end of the large-subunit (26S) ribosomal DNA gene. J
Clin Microbiol 35(5):1216–1223
49. Lieckfeldt E, Seifert KA (2000) An evaluation of the use of ITS sequences in the taxonomy of
the Hypocreales. Stud Mycol 45:35–44
50. Liu YJ, Hall BD (2004) Body plan evolution of ascomycetes, as inferred from an RNA
polymerase II phylogeny. Proc Natl Acad Sci U S A. https://doi.org/10.1073/pnas.
0400938101
51. Liu YJ, Whelen S, Hall BD (1999) Phylogenetic relationships among ascomycetes: evidence
from an RNA polymerse II subunit. Mol Biol Evol. https://doi.org/10.1093/oxfordjournals.
molbev.a026092
52. Lombard L, Sandoval-Denis M, Lamprecht SC, Crous PW (2018) Epitypification of Fusarium
oxysporum – clearing the taxonomic chaos. Persoonia – Mol Phylogeny Evol Fungi. https://
doi.org/10.3767/persoonia.2019.43.01
53. Lutzoni F, Kauff F, Cox CJ et al (2004) Assembling the fungal tree of life: Progress,
classification, and evolution of subcellular traits. Am J Bot 91(10):1446–1480
54. Manamgoda DS, Rossman AY, Castlebury LA et al (2014) The genus Bipolaris. Stud Mycol.
https://doi.org/10.1016/j.simyco.2014.10.002
55. Martin FN (2000) Phylogenetic relationships among some Pythium species inferred from
sequence analysis of the mitochondrially encoded cytochrome oxidase II gene. Mycologia.
https://doi.org/10.2307/3761428
56. Martin FN, Blair JE, Coffey MD (2014) A combined mitochondrial and nuclear multilocus
phylogeny of the genus Phytophthora. Fungal Genet Biol. https://doi.org/10.1016/j.fgb.2014.
02.006
10 Molecular Taxonomy and Multigene Phylogeny of Filamentous Fungi 205
57. McNeil M, Roberts AMI, Cockerell V, Mulholland V (2004) Real-time PCR assay for
quantification of Tilletia caries contamination of UK wheat seed. Plant Pathol. https://doi.
org/10.1111/j.1365-3059.2004.01094.x
58. Nilsson RH, Larsson KH, Taylor AFS et al (2019) The UNITE database for molecular
identification of fungi: handling dark taxa and parallel taxonomic classifications. Nucleic
Acids Res. https://doi.org/10.1093/nar/gky1022
59. Nilsson RH, Ryberg M, Kristiansson E et al (2006) Taxonomic reliability of DNA sequences
in public sequences databases: a fungal perspective. PLoS One. https://doi.org/10.1371/
journal.pone.0000059
60. O’Donnell K, Cigelnik E (1997) Two divergent intragenomic rDNA ITS2 types within a
monophyletic lineage of the fungus Fusarium are nonorthologous. Mol Phylogenet Evol.
https://doi.org/10.1006/mpev.1996.0376
61. O’Donnell K, Kistlerr HC, Cigelnik E, Ploetz RC (1998) Multiple evolutionary origins of the
fungus causing panama disease of banana: concordant evidence from nuclear and mitochon-
drial gene genealogies. Proc Natl Acad Sci U S A. https://doi.org/10.1073/pnas.95.5.2044
62. O’Donnell K, Lutzoni FM, Ward TJ, Benny GL (2001) Evolutionary relationships among
mucoralean fungi (Zygomycota): evidence for family polyphyly on a large scale. Mycologia.
https://doi.org/10.2307/3761650
63. O’Donnell K, Nirenberg HI, Aoki T, Cigelnik E (2000) A multigene phylogeny of the
Gibberella fujikuroi species complex: detection of additional phylogenetically distinct species.
Mycoscience. https://doi.org/10.1007/BF02464387
64. O’Donnell K, Sarver BAJ, Brandt M et al (2007) Phylogenetic diversity and microsphere
array-based genotyping of human pathogenic fusaria, including isolates from the multistate
contact lens-associated U.S. keratitis outbreaks of 2005 and 2006. J Clin Microbiol. https://doi.
org/10.1128/JCM.00533-07
65. O’Donnell K, Sutton DA, Rinaldi MG et al (2010) Internet-accessible DNA sequence database
for identifying fusaria from human and animal infections. J Clin Microbiol. https://doi.org/10.
1128/JCM.00989-10
66. Peterson SW (2004) Multilocus DNA sequence analysis shows that Penicillium biourgeianum
is a distinct species closely related to P. brevicompactum and P. olsonii. Mycol Res. https://
doi.org/10.1017/S0953756204009761
67. Phillips AJL, Alves A, Abdollahzadeh J et al (2013) The Botryosphaeriaceae: genera and
species known from culture. Stud Mycol. https://doi.org/10.3114/sim0021
68. Raja H, Schoch CL, Hustad V et al (2011) Testing the phylogenetic utility of MCM7 in the
Ascomycota. MycoKeys. https://doi.org/10.3897/mycokeys.1.1966
69. Raja HA, Miller AN, Pearce CJ, Oberlies NH (2017) Fungal identification using molecular
tools: a primer for the natural products research community. J Nat Prod 80(3):756–770
70. Reeb V, Lutzoni F, Roux C (2004) Contribution of RPB2 to multilocus phylogenetic studies of
the euascomycetes (Pezizomycotina, Fungi) with special emphasis on the lichen-forming
Acarosporaceae and evolution of polyspory. Mol Phylogenet Evol. https://doi.org/10.1016/j.
ympev.2004.04.012
71. Rehner SA, Buckley E (2005) A Beauveria phylogeny inferred from nuclear ITS and EF1-α
sequences: evidence for cryptic diversification and links to Cordyceps teleomorphs.
Mycologia 97(1):84–98
72. Rehner SA, Samuels GJ (1995) Molecular systematics of the Hypocreales: a teleomorph gene
phylogeny and the status of their anamorphs. Can J Bot. https://doi.org/10.1139/b95-327
73. Rickerts V, Just-Nübling G, Konrad F et al (2006) Diagnosis of invasive aspergillosis and
mucormycosis in immunocompromised patients by seminested PCR assay of tissue samples.
Eur J Clin Microbiol Infect Dis. https://doi.org/10.1007/s10096-005-0078-7
74. Rintoul TL, Eggertson QA, Lévesque CA (2012) Multigene phylogenetic analyses to delimit
new species in fungal plant pathogens. Methods Mol Biol. https://doi.org/10.1007/978-1-
61779-501-5_34
206 N. Mehta et al.
75. Samson RA, Visagie CM, Houbraken J et al (2014) Phylogeny, identification and nomencla-
ture of the genus Aspergillus. Stud Mycol. https://doi.org/10.1016/j.simyco.2014.07.004
76. Samson RA, Yilmaz N, Houbraken J et al (2011) Phylogeny and nomenclature of the genus
Talaromyces and taxa accommodatedin Penicillium subgenus Biverticillium. Stud Mycol.
https://doi.org/10.3114/sim.2011.70.04
77. Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors.
Proc Natl Acad Sci U S A. https://doi.org/10.1073/pnas.74.12.5463
78. Schmitt I, Crespo A, Divakar PK et al (2009) New primers for promising single-copy genes in
fungal phylogenetics and systematics. Persoonia Mol Phylogeny Evol Fungi. https://doi.org/
10.3767/003158509X470602
79. Schoch CL, Seifert KA, Huhndorf S et al (2012) Nuclear ribosomal internal transcribed spacer
(ITS) region as a universal DNA barcode marker for Fungi. Proc Natl Acad Sci U S A. https://
doi.org/10.1073/pnas.1117018109
80. Schoch CL, Sung GH, López-Giráldez F et al (2009) The ascomycota tree of life: a phylum-
wide phylogeny clarifies the origin and evolution of fundamental reproductive and ecological
traits. Syst Biol. https://doi.org/10.1093/sysbio/syp020
81. Seifert KA, Rossman AY (2010) How to describe a new fungal species. IMA Fungus. https://
doi.org/10.5598/imafungus.2010.01.02.02
82. Seifert KA, Samson RA, DeWaard JR et al (2007) Prospects for fungus identification using
CO1 DNA barcodes, with Penicillium as a test case. Proc Natl Acad Sci U S A. https://doi.org/
10.1073/pnas.0611691104
83. Shi YX, Xie XW, Song JW et al (2016) First report of Sclerotinia rot on Andrographis
paniculata in China. Can J Plant Pathol
84. Silva DN, Talhinhas P, Várzea V et al (2012) Application of the Apn2/MAT locus to improve
the systematics of the Colletotrichum gloeosporioides complex: an example from coffee (
Coffea spp.) hosts. Mycologia. https://doi.org/10.3852/11-145
85. Sklenář F, Jurjević ZP et al (2017) Phylogeny of xerophilic aspergilli (subgenus Aspergillus)
and taxonomic revision of section Restricti. Stud Mycol. https://doi.org/10.1016/j.simyco.
2017.09.002
86. Staats M, Van Baarlen P, Van Kan JAL (2005) Molecular phylogeny of the plant pathogenic
genus Botrytis and the evolution of host specificity. Mol Biol Evol. https://doi.org/10.1093/
molbev/msi020
87. Stielow JB, Lévesque CA, Seifert KA et al (2015) One fungus, which genes? Development
and assessment of universal primers for potential secondary fungal DNA barcodes. Persoonia
Mol Phylogeny Evol Fungi. https://doi.org/10.3767/003158515X689135
88. Stiller JW, Hall BD (1997) The origin of red algae: implications for plastid evolution. Proc
Natl Acad Sci U S A. https://doi.org/10.1073/pnas.94.9.4520
89. Sung GH, Spatafora JW, Zare R, et al (2001) A revision of Verticillium sect. Prostrata.
II. Phylogenetic analyses of SSU and LSU nuclear rDNa sequences from anamorphs and
teleomorphs of the Clavicipitaceae ). Nov Hedwigia
90. Sung GH, Sung JM, Hywel-Jones NL, Spatafora JW (2007) A multi-gene phylogeny of
Clavicipitaceae (Ascomycota, Fungi): identification of localized incongruence using a com-
binational bootstrap approach. Mol Phylogenet Evol. https://doi.org/10.1016/j.ympev.2007.
03.011
91. Templeton MD, Rikkerink EHA, Solon SL, Crowhurst RN (1992) Cloning and molecular
characterization of the glyceraldehyde-3-phosphate dehydrogenase-encoding gene and cDNA
from the plant pathogenic fungus Glomerella cingulata. Gene. https://doi.org/10.1016/0378-
1119(92)90055-T
92. Torbati M, Arzanlou M, Sandoval-Denis M, Crous PW (2019) Multigene phylogeny reveals
new fungicolous species in the Fusarium tricinctum species complex and novel hosts in the
genus Fusarium from Iran. Mycol Prog. https://doi.org/10.1007/s11557-018-1422-5
93. Videira SIR, Groenewald JZ, Nakashima C et al (2017) Mycosphaerellaceae – chaos or
clarity? Stud Mycol. https://doi.org/10.1016/j.simyco.2017.09.003
10 Molecular Taxonomy and Multigene Phylogeny of Filamentous Fungi 207
94. Vilgalys R, Hester M (1990) Rapid genetic identification and mapping of enzymatically
amplified ribosomal DNA from several Cryptococcus species. J Bacteriol. https://doi.org/10.
1128/jb.172.8.4238-4246.1990
95. Visagie CM, Houbraken J, Frisvad JC et al (2014) Identification and nomenclature of the
genus Penicillium. Stud Mycol. https://doi.org/10.1016/j.simyco.2014.09.001
96. Weir BS, Johnston PR, Damm U (2012) The Colletotrichum gloeosporioides species complex.
Stud Mycol 73:115–180. https://doi.org/10.3114/sim0011
97. White TJ, Bruns S, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal
ribosomal RNA genes for phylogenetics. PCR Protoc A Guid to Methods Appl:315–322.
https://doi.org/10.1016/b978-0-12-372180-8.50042-1
98. Wingfield MJ, Slippers B, Roux J, Wingfield BD (2001) Worldwide movement of exotic
forest fungi. Especially in the tropics and the southern hemisphere. Bioscience. https://doi.org/
10.1641/0006-3568(2001)051[0134:wmoeff]2.0.co;2
99. Woudenberg JHC, Truter M, Groenewald JZ, Crous PW (2014) Large-spored Alternaria
pathogens in section Porri disentangled. Stud Mycol. https://doi.org/10.1016/j.simyco.2014.
07.003
100. Yang Z, Rannala B (2012) Molecular phylogenetics: principles and practice. Nat Rev Genet
13(5):303–314
101. Yilmaz N, Visagie CM, Houbraken J et al (2014) Polyphasic taxonomy of the genus
Talaromyces. Stud Mycol. https://doi.org/10.1016/j.simyco.2014.08.001
102. Zhang J, Yang H, Yu QY et al (2016) Botrytis pyriformis sp. nov., a novel and likely
saprophytic species of Botrytis. Mycologia. https://doi.org/10.3852/15-340
103. Zhang N, Zhao S, Shen Q (2011) A six-gene phylogeny reveals the evolution of mode of
infection in the rice blast fungus and allied species. Mycologia. https://doi.org/10.3852/11-022
104. Tedersoo L, Sánchez-Ramírez S, Kõljalg U et al (2018) High-level classification of the Fungi
and a tool for evolutionary ecological analyses. Fungal divers 90(1):135-59. https://doi.org/
10.1007/s13225-018-0401-0
105. Hawksworth DL, Lücking R (2017) Fungal diversity revisited: 2.2 to 3.8 million species.
Microbiology spectrum 5(4):5-4. https://doi.org/10.1128/microbiolspec.FUNK-0052-2016
Chapter 11
Fluorochrome-Based Methods for Fungal
Sample Examination
Contents
11.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 210
11.2 Sample Preparation to Observe Fungi Nuclei and Chromosome . . . . . . . . . . . . . . . . . . . . . . 211
11.3 DAPI Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 212
11.3.1 Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 212
11.3.2 Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 213
11.3.3 Culture Block on Inverted Microscope . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 213
11.3.4 Slide and Coverslip Preparation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 214
11.4 Culture Block on Inverted Microscope and Propidium Iodide in Nuclei Marking . . . 215
11.4.1 Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 215
11.4.2 Method . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 215
11.5 Sample Preparation to Observe Fungi Chromosome . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 216
11.5.1 Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 216
11.5.2 Method . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 217
11.6 Sample Preparation to Observe Fungi Cell-Wall . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 218
11.7 Calcofluor White Staining . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 218
11.7.1 Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 218
11.8 AlexaFluor 488® WGA Conjugate Staining . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 218
11.8.1 Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 219
11.8.2 Method . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 220
11.9 Reactive Oxygen Species (ROS) in Fungi . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 220
11.9.1 Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 221
11.9.2 Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 221
11.10 Fungi Cellular Death Studies with Propidium Iodide . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 222
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2022 209
V. K. Gupta, M. Tuohy (eds.), Laboratory Protocols in Fungal Biology, Fungal
Biology, https://doi.org/10.1007/978-3-030-83749-5_11
210 S. I. Moreira et al.
11.1 Introduction
others such as Cercospora spp. produce fluorescent phytotoxins. Other studies types
are conducted by inducing fluorescence in the samples. This may occur through the
use of fluorochromes, immunofluorescence techniques, nucleic acids hybridization,
and molecular markers. Fluorochromes are molecules capable of specifically binding
to cellular components by inducing their fluorescence under the excitation of certain
wavelengths. These components can be the fungal cell wall, nuclei, chromosomes,
mitochondria, and others. Other fluorochromes may indicate physiological aspects,
such as cell death, accumulation of reactive oxygen species, or evidence of defense
reactions in plant tissues colonized by fungi. Immunofluorescence, also called
immunostaining, is a technique where fluorescent molecules are attached to anti-
bodies corresponding to antigens to which they will be located. Nucleic acid
hybridization, called FISH (fluorescent in situ hybridization), allows the use of
nucleic acid probes attached to fluorescent molecules. These probes are complemen-
tary to target sequences, which can identify specific regions on chromosomes, the
expression of certain genes by mRNAs, or specific groups of organisms using
regions of phylogenetically important DNA. One of the most commonly used
molecular markers is fluorescent proteins such as GFP (green fluorescent protein).
By genetic transformation, the fluorescent markers genes are associated with the
genes whose products will be localized. Thus, the expressed proteins are localized
through the fluorescent protein anchored.
In this chapter, protocols for fluorescence microscopy will be discussed in studies
on fungi using only fluorochromes or autofluorescence of structures for localization
techniques.
All following procedures were done at the Electron Microscopy and Ultrastruc-
tural Analysis Lab at Federal University of Lavras, using an inverted
Epi-Fluorescence Zeiss Axio Z.1 and an inverted Laser Confocal Zeiss LSM780
Observer Z.1 and Zen 2012 software.
Ascomycota fungi have the characteristic of maintaining monocariotic state but may
present some dicariotic cells throughout the intermediary processes of their repro-
duction, such as plasmogamy and karyogamy. In the case of Basidiomycota, they
may have different phases throughout their life cycle, monocariotic or even
dicariotic (Fig. 11.1e). Basidiomycota may present multinucleate cells, as basidia
before nuclei migration to the basidiospores, and the in certain Rhizoctonia hyphae
(Fig. 11.1f). These nuclear dynamics processes can be studied using fluorescence
markers, such as DAPI, one of the most used. Often, DAPI is used associated with
immunofluorescence and hybridization techniques, for proteins or DNA sequences
specific localization in nuclei. Other fluorescent nuclei dyes can be used, such as
SyBrGreen and Propidium Iodide (in the case of living cells).
212 S. I. Moreira et al.
Fig. 11.1 Fungi nuclei and chromosome observations by fluorochrome-based methods. (a) Posi-
tioning of DAPI drops above coverslip coupled in an inverted microscope. (b) Sampling of
Rhizoctonia solani colony growth in SNA media. (c) Transferring of colony fragment to the dye.
(d) Vacuum pump linked to a hermetically sealed recipient. Laser scanning confocal micrographs of
Rhizoctonia solani from binucleated (e) and multinucleated lineages (f) marked with DAPI;
Rhizoctonia sp. nuclei marked with Propidium Iodide (g); and Colletotrichum chromosome at
metaphase observation by germ tube burst method using DAPI (h)
Materials to prepare fungi for EFM or LSM observation. The necessary materials
can vary depending on the protocol used.
11.3.1 Materials
11.3.2 Methods
The methods presented below are for marking filamentous fungi nuclei, and varia-
tions will be presented and discussed.
Firstly, we will show a quick preparation to observe nuclei in fungi (Fig. 11.1e, f)
using an inverted microscope (EFM or LSM) as made by Melo et al. [17].
1. Put a previously cleaned large coverslip (e.g. 24 40 mm) on an inverted
microscope stage. In case of immersion objective using, drop firstly the appro-
priated immersion liquid on the objective lens before that.
2. Put 10 μL of DAPI-VectaShield mounting media above the coverslip
(Fig. 11.1a). In case of many samples working, use a marker pen to delimitate
and identify spots with around 0.5 0.5 cm where each sample will be placed.
Avoid the coverslip corners, where the objective lens does not reach. Develop it
in a room with diffuse light, or as dark as possible.
3. Take colony fragments with around 0.5 0.5 cm with a scalpel (Fig. 11.1b),
choosing the region of interest using a stereomicroscope, if needed. The use of
clear media like SNA allows better light transmission. Besides, it favors the fungi
sporulation and reduces the aerial mycelia growth rate. The colony fragments
may be fresh or fixed.
4. Transfer the upside-down colony fragment above the DAPI drop. The mycelia
should be in contact with the dye (Fig. 11.1c).
214 S. I. Moreira et al.
5. Leave it in the dark for 5–20 min. The incubation time will depend on the fungus
species. The thinner cell wall species as well as the younger mycelia usually need
less time to mark the nuclei. Some thicker cell wall species demand incubation
with vacuum for dye infiltration. This can be done using a vacuum pump linked to
a hermetically sealed container (Fig. 11.1d). In these cases, it is recommended to
use younger cultures and colony border regions.
6. Observe in inverted EFM or LSM.
If the LSM is equipped with a detector like T-PMT, the bright-field images
acquired overlaid with fluorescent nuclei may dispense the need of other fluoro-
chromes for fungi cell walls marking, such as Calcofluor White. Sometimes, DAPI
colors well the cell walls also. Once the LSM is not equipped for bright field images,
the Calcofluor White use is recommended. For this, the DAPI needs to be applied
before and directly in the culture fragment. After this, 10 μL of the 0.01% (p/v)
Calcofluor White (Fluorescent brightener 28, Sigma, CAS-4404-43-7) prepared in
0.01 M potassium phosphate buffer solution (PBS) pH 7.2 are positioned above
coverslip, as described in step 2. Follow, the colony fragment DAPI-treated should
be positioned upside-down above the Calcofluor drop and incubate for around
20 min in darkness before observation. The excitation/emission parameters are the
same used for DAPI in EFM or LSM.
Below is a procedure to observe fungi nuclei using slide and coverslip (vertical or
inverted microscope, EFM or LSM):
1. Put 10 μL of DAPI- VectaShield mounting media above a previously cleaned
slide.
2. Sample fungi structures from fresh or fixed cultures using a needle previously
cleaned with alcohol and flamed. Choose the region of interest using a stereo-
scopic microscope, if needed. In this case, the DAPI fluorescence signal in slides
prepared with fixed structures may persist for weeks, if slides kept in the
refrigerator, in darkness.
3. Transfer the specimens to DAPI drop.
4. Cover the drop with specimen with coverslip and seal with nail polish or other
coverslip sealants.
5. Leave it in the dark for 5–20 min. The time may vary, as discussed above. A
vacuum step may be required.
6. Observe in a vertical or inverted microscope, EFM or LSM.
11 Fluorochrome-Based Methods for Fungal Sample Examination 215
Propidium Iodide can be used as a fungi nuclei marker in the case of living cells
(Fig. 11.1g). After the cell death, the fluorochrome passes through the nuclear
envelope and occupies the cytosol, marking the entire cell. Thus, this marker is
important in cellular death studies, as will be discussed later.
11.4.1 Materials
11.4.2 Method
3. Take colony fragments with around 0.5 0.5 cm with a scalpel, choosing the
region of interest using a stereoscopic microscope, if needed. The colony frag-
ments should be fresh.
4. Transfer the upside-down colony fragment above the PIWS drop. The mycelia
should be in contact with the dye.
5. Leave it in the dark for 15–20 min.
6. Observe in inverted EFM or LSM.
11.5.1 Materials
11.5.2 Method
The following method was refined by Gonçalves [11], adapted from Taga et al. [24],
to observe chromosomes from Colletotrichum species.
1. Growth of fungi in PDA at 22 C in darkness. After sporulation, the conidia
suspension is acquired with mili-Q water and scraping and collected with an
automatic pipette.
2. The suspension is filtered with miracloth 40 μm filter and centrifuged within
microtubes at 3000–3500 g for 5 min.
3. After centrifugation, the supernatant should be discarded and the pellet washed
with sterile water twice. Resuspend the pellet in a nutrient medium and adjust
the concentration to 2 to 3 106 conidia.mL1 using a Neubauer chamber.
4. The previously autoclaved slides are treated with poly-L-lysine solution and
marking a rectangle on the slide with the rubber glue.
5. Pipetting 450–600 μL conidia solution into the rectangle marked with the rubber
glue on the face of the poly-L-lysine slide.
6. Place the slides in a humid camera and incubate them in the dark at 22 C.
Monitor the germination after 6 h of incubation using a light microscope,
prolong the incubation time if necessary.
7. Remove the liquid excess from the slide surface without drying out completely.
8. Add 400–600 μL of the nutrient medium containing thiabendazole (TBZ) at the
final concentration of 50 μg.mL1 to stop mitosis during metaphase.
9. Incubate the slide at 22 C in the dark for 2–3 h, then remove the TBZ solution
using an automatic pipette and remove the rubber glue using tweezers.
10. Slowly immerse the slide in mili-Q water to wash off excess TBZ that may still
be present on the blade and remove excess water using a filter paper, but still
leaving the slide moist.
11. Dry the slide by passing it over a flame quickly, without letting it dry completely
or overheating the slide.
12. Add 20–25 μL of the propidium iodide 1 μg.mL1 on the slide surface and wait
15 min. After, immerse the slide in sterile water to remove the dye excess.
218 S. I. Moreira et al.
13. Add 15–20 μL of the VectaShield mounting medium with DAPI and incubate in
the dark for 10–15 min and then seal the slide with coverslip and nail polish.
14. Observe in EFM or LSM.
The DAPI-VectaShield mounting media may be used instead of the DAPI and
VectaShield mounting media separated.
The fungi cell wall staining with fluorochromes is very important in many studies,
such as during infection processes in plant tissues, delimitating the septa during the
nuclei dynamic studies, and associated with other methods, such as immunolabeling
or hybridization. Calcofluor White is a commonly used dye for glucans, as the fungi
chitin and the plant cellulose. On the other hand, AlexaFluor 488® WGA Conjugate
(Alexa488-WGA) marks exclusively fungi. Thus, fungi-plant interaction can be
studied with both used together, Alexa488-WGA to dye fungi and Calcofluor
marking plant tissues, as will be discussed later.
This fluorochrome dyes the fungi cell wall (Fig. 11.2a) usually with a short time
incubation, around 10–30 min, depending on species and cell type. The procedure
below was performed with a 7-days-old Pyricularia oryzae colony.
11.7.1 Materials
The necessary materials can vary depending on the protocol used. The samples can
be mounted in slide-coverslip with fungal structures in 0.01 mg.mL1 CalcoFluor in
a vertical microscope or with culture block facing-dawn above 10 μL of 0.01 mg.
mL1 CalcoFluor in large coverslip on an inverted microscope, as discussed in
DAPI methods. The excitation and emission conditions are also similar.
Alexa488-WGA labels the fungi cell wall (Fig. 11.2b) and the time incubation may
vary depending on species and cell type. Another very important point is that some
fungi with thick conidia cell walls such as Pyricularia and Alternaria require a
11 Fluorochrome-Based Methods for Fungal Sample Examination 219
Fig. 11.2 Fungi structures were fluorochrome-stained. (a–b) Fungi cell wall dyed with CalcoFluor
White (a) and AlexaFluor488–WGA (b). (c) Reactive oxygen species labeled with DCF-DA. (d–e)
Cellular-death observation using Iodide Propidium for conidia of filamentous fungi (d) and yeasts
(e). (f) Live-dead test for yeasts and bacteria using Iodide Propidium for dead (red) and Syto9 for
living cells (green)
vacuum-infiltration step for 20 min to efficient dyeing [13]. Fungus with thin cell
walls such as Fusarium can be marked without vacuum step. The method shown was
made with common bean leaves infected with fungus.
11.8.1 Materials
11.8.2 Method
Reactive oxygen species (ROS) are ubiquitous in fungi living cells, with high
damaging potential but are also essential for gene expression signaling and devel-
opment in several biological processes [14] such as the programmed cellular death
[10]. One way to study the ROS dynamics is using the 20 ,70 -Dichlorofluorescein
diacetate (DCF-DA) fluorochrome. DCF-DA dyes several ROS, as hydrogen per-
oxide (H2O2), peroxyl (ROO•), hydroxyl (HO•), peroxynitrite anion (ONOO-) and
nitric oxide (•NO), and it’s useful for assessing various stress types in plants, such as
osmotic, thermal, and by pathogen infection [2, 13, 19, 29]. Another fluorochrome
variant, H2DCFDA, was important to understanding the ROS role during rice blast
pathogenesis [6]. The strobilurin resistance in Alternaria alternata is caused by a
non-synonymous mutation that changes the cytochrome b product, replacing a
glycine by an alanine at the condon 143 (G143A mutation) [5]. Resistant strains
remain with low DCF-DA signal when cultivated in PDA media plus high concen-
tration fungicide (Fig. 11.2e), while the wild type presents a high signal (not shown).
11 Fluorochrome-Based Methods for Fungal Sample Examination 221
11.9.1 Materials
11.9.2 Methods
Experiments with cellular death marking of fungi can help to characterize pheno-
types in many contexts, such as confirming the fungicide activity of a control
product, instead fungistaticity. Another possible subject is the the programmed cell
death (PCD), which may occur during the sexual and asexual reproduction, in some
infection processes for phytopathogenic fungi, and in the non-self-recognition
mechanism heterokaryon incompatibility (HI) [10]. The strobilurin resistance
of Alternaria alternata is caused by the G143A change in cytochrome b [5], and
low mortality of conidia when cultivated in PDA media plus high fungicide con-
centration (Fig. 11.2d). Other assay was for yeast mortality observation during a
fermentation process (Fig. 11.2f). The cell-death marker used was Propidium
iodide [8].
11.10.1 Materials
11.10.2 Methods
The methods presented below are for filamentous fungi or yeast cell-death marking,
and variations will be considered.
The methods presented below are for yeasts and bacteria, and variations will be
considered. In Fig. 11.2f, observation of yeasts and bacteria from a probiotic product
was analyzed. The following protocol was developed based on Stiefel et al. [23] and
Batista et al. [1].
11.11.1 Materials
11.11.2 Method
(Fig. 11.2f). If the Syto9 is not available, it may be done using only the Propidium
iodide, merging the red channel with the bright field image (Fig. 11.2d).
Below, a protocol for staining plant tissues with Calcofluor White and fungi with
Alexa488 WGA. Before the staining steps, a clarification protocol was develop
based on Warner et al. [26] and Minker et al. [18]. Common bean leaves infected
with phytopathogenic fungus were used (Fig. 11.3).
11.12.1 Materials
Fig. 11.3 Fungi-Plant interactions. Common bean leaf surface before (a) and after (b) clarifying
treatment. (c–g) Common bean colonized superficially by fungi. Plant tissue dyed with CalcoFluor
and fungi marked with AlexaFluor 488 – WGA. (c) 2D overlay of blue and green channels from
98 focal plans within 30 μm range in Z-axis using the maximum intensity projection method. (d–e)
2D of separated channels. (f–g) 3D software reconstruction from focal plans acquired
11.12.2 Methods
6. After 4 days in clarifying mix at 10 C and darkness, wash with PBS, and
incubate in a new clarifying mix for 4 days.
7. Wash with PBS, and add 100 μL Alexa488–WGA 10 μg.mL1.
8. Wrap the Elisa plate with aluminum foil and keep it at vacuum (Fig. 11.1d) for
1 h.
9. Add 80 μL of CalcoFluor 0.01 mg.mL1 and incubate for 10 min at the
darkness.
10. Put a previously cleaned large coverslip on an inverted microscope stage. In case
of immersion objective using, drop firstly the appropriated immersion liquid on
the objective lens before that.
11. Put the leaf fragment above the coverslip with the region of interesting
facing down.
12. Place a glass piece above the sample (to minimize the irregular topography of
the sample).
13. Observe in inverted LSM.
14. In this assay, the z-stack method was used to capture 98 focal plans within
30 μm ranges in Z-axis, to obtain the 2D with the maximum intensity method
and the 3D reconstruction, using the Zen software (Carl Zeiss).
The clarifying protocol showed was for leaf tissues. Adjustments are needed
depending on the tissue type and the plant species, changing the incubation time. For
example, the common bean pods can be clarified with 20 days in KOH 10% and
15 days in clarifying mix, changing the solutions every 5 days of incubation.
The importance of the clarification step is the high amount of autofluorescent
compounds such as cell wall components, phenols, and alkaloids [21]. Thus, many
protocols have been developing to minimize these fluorescence signals and optimize
the specific fluorescent label [18, 25, 26]. The transparency increasing in plant
tissues improves the three-dimensional structures imaging quality, especially valu-
able during the investigation of plant–fungi interactions, once it provides better
fluorochrome infiltration, photon and or laser penetration, and so high quality of
fluorescence signal [18]. Other clarification protocol with very satisfactory results
was developed by Ursage et al. [25] which uses the ClearSee solution [xylitol 10%
(w/v); sodium deoxycholate 15% (w/v); urea 25% (w/v)] in the clarification and for
fluorochromes preparing. The ClearSee method also has the advantage of allowing
the fluorescent proteins such as GFP and m-Cherry observation in plant tissues even
after treatment. In cases where the sample preparation evolves alcohol gradients, for
embedding and microtome cutting, clarification is not necessary. And, for sure, for
non-autofluorescent samples.
Fungi-plant interactions fluorochrome-based studies can be made using other
dyes combinations. Ha et al. [13] observed the wheat tissues colonization by
Pyricularia graminis-tritici using Alexa488-WGA and Fusarium graminearum
genetically transformed for GFP expression. In both cases, the fixed plant tissues
were dyed with Propidium iodide. The plant cell wall marker, pontamine fast scarlet
(S4B), is specific for cellulose and may be used combined with other fluorochromes,
such as aniline blue, which label callose [7].
228 S. I. Moreira et al.
The plant resistance factors against phytopathogens are divided into biochemical and
structural, preformed or postformed. Through histochemical analysis, some struc-
tural resistance components such as callose, lignin, and cuticle, and biochemical, as
ROS, can be evaluated by microscopy techniques. Then, callose and lignin protocols
are shown.
The callose polymer (β-1,3-glucan) is a plant cell wall component and may plant
defense responses, and their deposition may increase in response to infections or
resistance-inducing agents [7, 16]. Aniline blue is the fluorochrome used in callose
deposition studies, such as in papillae observation [7]. Figure 11.4a shown callose
deposition marked with aniline blue in tangerine leaf.
11.14.1 Materials
Fig. 11.4 (a) Callose deposition in tangerine leaf observed with Aniline blue fluorochrome. (b)
Lignin localization in Eucalyptus cambial region using Auramine-O
11 Fluorochrome-Based Methods for Fungal Sample Examination 229
11.14.2 Method
1. Take the clarified leaf fragment and incubate samples within Elisa plate wells in
80 μL Aniline blue 0.1 mg.mL1.
2. Wrap the Elisa plate with aluminum foil and keep it at vacuum for 1 h.
3. Incubate overnight at around 25 C.
4. Wash with PBS.
5. Transfer the abaxial side to a large coverslip supported in the microscope stage.
6. Place the glass piece on a sample.
7. Observe with EFM or LSM the leaf surface (In the case of LSM, paradermic
examination is possible).
11.15.1 Materials
11.15.2 Method
1. Take the slides with sections and apply around 5 μL of Auramine-O 1.0 mg.mL1
to cover all sample areas.
2. Incubate in darkness for 20–40 min.
3. Wash gentlly with PBS.
4. Cover with coverslip and seal.
5. Observe in an inverted or vertical microscope, EFM or LSM.
11.17.1 Materials
Fig. 11.5 (a) Autofluorescence of Hemileia vastatrix pustules in coffee leaves. (b)
Autofluorescence of cercosporin crystals produced by Cercoscopa coffeicola in MEA
3. Dissecting scissor.
4. Tweezer.
5. Large coverslips (e.g. 24 40 mm).
6. Inverted EFM or LSM.
7. For EFM, a filter cube that works near 488 ηm excitation and 520 ηm emission
(ex. Filter cube Zeiss #38 HE).
8. For LSM, excitation with 488 ηm laser line and emission filter with 490–560 ηm
range. An LCI Plan-Neofluar 25/0.8 Imm Korr DIC M27 objective was used,
with 512 512 resolution.
11.17.2 Method
11.18.1 Materials
11.18.2 Method
References
1. Batista NN, Ramos CL, Pires JF, Moreira SI, Alves E, Dias DR, Schwan RF (2019) Nondairy
ice cream based on fermented yam (Dioscorea sp.). Food Sci Nutr 7:1899–1907
2. Beneloujaephajri E, Costa A, L’Haridon F, M’etraux J, Binda M (2013) Production of reactive
oxygen species and wound-induced resistance in Arabidopsis thaliana against Botrytis cinerea
are preceded and depend on a burst of calcium. BMC Plant Biol 13:160–169
3. Bhuiyan et al (2009) Role of lignification in plant defense. Plant Signal Behav 4(2):158–159
4. Crous PW, Verkley GJM, Groenwald JZ, Samson RA (2009) Fungal biodiversity. CBS-KNAW
Fungal Biodiversity Centre, Utrecht
5. Duba A, Goriewa K, Wachowska U, Wiwart M (2018) Alternaria alternata (Fr.) Keissl with
mutation G143A in the Cyt b gene is the source of a difficult-to-control allergen. Environ Sci
Pollut Res 25:469–478
6. Egan MJ, Wang Z, Jones MA, Smirnoff N, Talbot NJ (2007) Generation of reactive oxygen
species by fungal NADPH oxidases is required for rice blast disease. PNAS 104:11772–11777
7. Eggert D, Naumann M, Reimer R, Voigt CA (2014) Nanoscale glucan polymer network causes
pathogen resistance. Nat Sci Rep 4:1–6
8. Firstencel H, Butt TM, Carruthers R (1990) A fluorescence microscopy method for determining
viability of entomophthoralean fungal spores. J Invertebr Pathol 55:258–264
9. Garmaroodi HS, Taga M (2007) Duplication of a conditionally dispensable chromossome
carryng Pea Pathogenicity (PEP) gene clusters in Nectria haematococca. Am Phytopathol
Soc 20:1495–1504
10. Gonçalves AP, Heller J, Daskalov A, Videira A, Glass NL (2017) Regulated forms of cell death
in fungi. Front Microbiol 8:1–20
11. Gonçalves PRC (2016) Cariotipagem de linhagens de Colletotrichum lindemuthianum e
Glomerella spp. isoladas de lesões de antracnose no feijoeiro. Tese de Doutorado em Genética
e Melhoramento de Plantas. Universidade Federal de Lavras
12. Gunasinghe N, You PM, Cawthray GR, Barbetti MJ (2016) Cercosporin from
Pseudocercosporella capsellae and its critical role in white leaf spot development. Plant Dis
100:1521–1531
13. Ha X, Koopmann B, Tiedmann A (2016) Wheat blast and fusarium head blight display
contrasting interaction patterns on ears of wheat genotypes differing in resistance. Phytopathol-
ogy 106:270–281
14. Heller J, Tudzynski P (2011) Reactive oxygen species in phytopathogenic fungi: signaling,
development, and disease. Annu Rev Phytopathol 49:369–390
15. Knaus H, Blab GA, Veluw GJV, Gerritsen HC, Wosten HAB et al (2013) Label-free fluores-
cence microscopy in fungi. Fungal Biol Rev 27:60–66
16. Llorens E, Fernaández-Crespo E, Vicedo B, Lapeña L, García-Agustín P (2013) Enhancement
of the citrus immune system provides effective resistance against Alternaria brown spot disease.
J Plant Physiol 170:146–154
17. Melo MP, Matos KS, Moreira SI, Silva FF, Conceição GH, Nechet KL et al (2018) Two new
Ceratobasidium species causing white thread blight on tropical plants in Brazil. Trop Plant
Pathol 43:559–571
18. Minker KR, Biedrzycki ML, Kolagunda A, Rhein S, Perina FJ, Jacobs SS et al (2016)
Semiautomated confocal imaging of fungal pathogenesis on plants: microscopic analysis of
macroscopic specimens. Microsc Res Tech 81:141–152
19. Ortega-Villasante C, Burén S, Barón-Sola A, Matínez F, Hernández LE (2016) In vivo ROS and
redox potential fluorescent detection in plants: present approaches and future perspectives.
Methods 109:92–104
20. Pawley JB (1995) Handbook of biological confocal microscopy. Plenum Press, New York
21. Roshchina VV (2012) Vital autofluorescence: application to the study of plant living cells. Int J
Spectrosc 2012:1–14
234 S. I. Moreira et al.
22. Souza MT, Lima JT, Assis CO, Soares BC, Lima LC, Moreira SI (2019) Distribuição espacial
da lignina na parede celular da madeira de Eucalyptus grandis. Scientia Forestalis 47:1–6
23. Stiefel P, Schmidt-Emrich S, Maniura-Weber K, Ren Q (2015) Critical aspects of using
bacterial cell viability assays with the fluorophores SYTO9 and propidium iodide. BMC
Microbiol 15:1–9
24. Taga M, Murata M, Saito H (1998) Comparison of different karyotyping methods in filamen-
tous ascomycetes – a case study of Nectria haematococca. Mycol Res 102:1355–1364
25. Ursage R, Andersen TG, Marhavy P, Geldner N (2018) A protocol for combining fluorescent
proteins with histological stains for diverse cell wall components. Plant J 93:399–412
26. Warner CA, Biedrzycki ML, Jacobs SS, Wisser RJ, Caplan JL, Sherrier J (2014) An optical
clearing technique for plant tissues allowing deep imaging and compatible with fluorescence
microscopy. Plant Physiol 166:1684–1687
27. Webster J, Weber R (2007) Introduction to fungi. Cambridge University Press, New York
28. Wieloch W (2006) Chromossome visualisation in filamentous fungi. J Microbiol Methods 67:
1–8
29. Zeng L, Zhou J, Li B, Xing D (2015) A high-sensitivity optical device for the early monitoring
of plant pathogen attack via the in vivo detection of ROS bursts. Front Plant Sci 6:1–8
30. Zhang L, Dickinson M (2001) Fluorescence from rust fungi: a simple and effective method to
monitor the dynamics of fungal growth in planta. Physiol Mol Plant Pathol 59:137–141
31. Zizka Z, Gabriel J (2011) Autofluorescence of the fungus Morchella conica var. rigida. Folia
Microbiol 56:166–169
Chapter 12
Yeast Isolation Methods from Specialized
Habitats
Contents
12.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 235
12.2 Common Materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 239
12.3 Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 240
12.4 Yeast Isolation Protocols from Natural Habitats . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 240
12.4.1 Rumen Fluid/Digesta . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 240
12.4.2 Insect Gut (Termite/Beetle) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 242
12.4.3 Hot Spring . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 243
12.4.4 Flower . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 245
12.4.5 Nectar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 245
12.4.6 Rotten Wood . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 246
12.5 Yeast Isolation Protocols from Anthropogenic Habitats . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 247
12.5.1 Compost . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 247
12.5.2 Molasses . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 249
12.5.3 Press Mud . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 250
12.5.4 Distillery Effluent/Spent Wash . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 251
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 252
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2022 235
V. K. Gupta, M. Tuohy (eds.), Laboratory Protocols in Fungal Biology, Fungal
Biology, https://doi.org/10.1007/978-3-030-83749-5_12
236 R. Avchar et al.
12.1 Introduction
Yeasts are a unicellular heterogeneous group of fungi which were first observed
under a microscope by Antonie Van Leeuwenhoek in 1680 and successfully isolated
for the first time by Louis Pasteur in the late 1860s. Since 1865, yeast research has
undergone significant progress with respect to their distribution, isolation and
characterization. Currently, more than 1500 yeast species have been reported from
all over the world, which comprise of only 1% of the actual diversity while the
remaining still needs to be explored [18]. Yeasts are ubiquitous in nature and have
been isolated from aquatic, atmospheric and terrestrial habitats. While some species
can be found in great numbers in different habitats, others may be restricted
geographically to only a few specialized habitats; suggesting that the overall yeast
distribution is not uniform.
It would seem that the distribution of yeasts would not be affected by geograph-
ical barriers since they can be dispersed by air currents [34], organismal vectors,
plant material as epiphytes or endophytes. But actually, distinct yeast species occur
in different regions and seasons. Studies on yeasts associated with beetles,
drosophilids, bees, and ephemeral flowers disprove the fact that yeasts are ubiquitous
[13, 19, 34]. The yeast diversity of common habitats like soil, plants and other
terrestrial habitats has been thoroughly explored since the isolation techniques are
easily available and well described [29, 34]. In contrast, the isolation techniques for
the less exploited niches (Fig. 12.1) like rumen, insect gut, hot spring, rotten wood,
flowers, nectar and other anthropogenic habitats like compost, molasses, distillery
wastes etc. are rather cumbersome and not elaborately outlined, since the procedures
vary greatly depending on the yeast density, the volume and shape of the source
[25]. The correlation between yeasts and the habitats that they occupy is determined
by the overall intrinsic factors (chemical, physical and physiological), availability of
nutrients, beneficial interactions with other organisms, and the presence of
competitors.
In the past decade, several novel yeasts have been isolated from natural habitats
which are not fully exploited; one such niche is insect gut [1, 36, 37]. The insect gut
has become increasingly recognized as an important source for the isolation of new
ascomycetous and basidiomycetous yeast taxa. The major purpose for the yeast-
insect association is that the yeasts provide essential amino acids, vitamins, sterols
and allelochemicals to attract the insect dispersers for targeted dispersal to a fresh
environment [4]. Such associations are believed to have promoted fungal diversity
and the expansion of insects into nutrient-poor substrates [37]. Several novel yeasts
have been isolated from the gut of beetles. Likewise, the gut of termites has also been
explored for novel yeasts, which produce valuable enzymes and can degrade xylan
and/or ferment xylose [1] to ethanol. These properties can be exploited in industries
for the sustainable production of ethanol or valuable enzymes. The gut of termites
and other wood-feeding insects can be considered as natural mini bioreactors with
the understudied microbiome, therefore, we have provided a detailed protocol for
isolation of such industrially important yeasts from the termite gut.
12 Yeast Isolation Methods from Specialized Habitats 237
In a similar manner, yeasts play a mutualistic role in the rumen of cattle and other
ruminants. The rumen is an anaerobic, cellulose and hemicellulose-rich habitat,
which harbours many microbes including bacteria, protozoa, filamentous fungi
and yeasts [10]. Yeasts isolated from rumen digesta can grow at elevated tempera-
tures since the temperature of rumen itself is 39.6 1 C. There are few reports of
yeasts isolated from the rumen of sheep, bovine, cattle and musk oxen [8, 21,
22]. The exact role of yeasts in the rumen is unclear but it is proposed that they
act as probiotics to prevent various diseases in ruminants and stimulate the growth
and activity of various fibrolytic ruminal bacteria by providing proteins, vitamins
and other growth factors [24, 33]. Since the rumen is also a less explored niche, a
protocol for rumen yeast isolation is given in this chapter.
There are some ‘wood-feeding yeasts’ found on rotting wood, which is a nutrient-
rich substrate for yeast populations. This niche has recently received attention after
isolation of xylose-fermenting yeasts from rotting wood in Brazilian forests and a
novel yeast capable of arabitol production was reported [6, 17]. The hemicellulosic
238 R. Avchar et al.
fraction of wood is broken down to simpler monomers by the yeasts’ enzymes. The
hydrolytic abilities of the enzymes secreted by these yeasts are of great significance
to biotechnological industries, therefore. a brief protocol for yeast isolation from
rotting wood has also been given.
Another interesting niche for obtaining novel or rare yeasts is the flower or floral
nectar. There are many publications on the properties and characteristics of nectar,
but very little is known regarding its role as a natural habitat for micro-organisms,
especially yeasts. The presence of yeasts in the nectar of flowers is well known but
very little effort has been taken for the isolation of yeasts and studying their role in
compositional changes of nectar fluid [16, 43]. It is possible that the yeasts
inhabiting nectars of angiosperms play a significant role as intermediate agents in
plant-pollinator signalling by the production of volatile compounds by fermentation
of available sugars [16, 43]. It is suggested that some osmophilic species can be
found in nectar since it contains high levels of sugars, and this trait can be beneficial
from a biotechnological point of view.
Some extreme environments have been established as niches for various species
of yeasts capable of enduring harsh conditions [34]. One such naturally occurring
habitat is the hot spring which harbours thermotolerant and thermophilic yeasts.
Novel thermotolerant yeasts have been reported from hot springs [38] which can be
used for high-temperature fermentations to produce ethanol. Enzymes like
β-galactosidase, cellulase and lipases produced by thermotolerant/thermophilic
yeasts are expected to have thermal tolerance, which is one of the most desirable
properties of an enzyme to be used for industrial applications [12]. A detailed
protocol for the isolation of yeasts from hot springs has been provided in this
chapter.
Besides the naturally existing habitats, there are a number of anthropogenic
sources from which yeasts can be recovered. Urbanization and human activities
have created multiple ecological or functional niches for specific yeast populations.
One such artificial habitat is compost. Composting is an aerobic process which
involves the microbial conversion of complex organic compounds into their simpler
forms [31]. As a habitat rich in carbohydrates and phenolics, composts harbour a
variety of microbes including yeasts that have the ability to utilize C5 and C6 sugars
and are tolerant to high temperatures and low pH [9, 14]. In the past decade, most
research on composts has been focused on their ecological and functional biodiver-
sity. Very few studies have been undertaken to explore yeast diversity from com-
posts despite being one of the rarest and unexplored habitats [9]. Yeasts isolated
from composts might be possible candidates for fermentation in biofuel or
bioethanol industries.
The yeast biota of carbon-rich substrates like residual juice, molasses and press
mud from sugar cane/beet in sugar industries has not been delved into completely.
Press mud is also a type of waste which is rich in lignocellulosic material, obtained
after ethanol production from molasses and is usually burnt or discarded by most
distilleries. Few yeasts of the genera Saccharomyces, Schizosaccharomyces and
Torulaspora have been reported from this niche [5, 39, 40]. Molasses from sugar
cane and agave are used as the starting material for the production of ethanol or other
12 Yeast Isolation Methods from Specialized Habitats 239
distilled spirits [11, 20] and the waste generated (residual molasses and press mud)
can possibly harbour high sugar-tolerant or osmophilic microbes, especially yeasts
[15, 26, 40]. Isolation of such indigenous yeasts and their employment in fermen-
tation industries can increase the efficiency of ethanol production from molasses
[7]. Protocols for yeast isolation from press mud and molasses have been provided.
Much like molasses, distillery waste also constitutes a very rich ecosystem in
which varied yeast species can flourish and carry out fermentation spontaneously.
The yeast community thrives on residual sugars and other by-products generated
after the distillation process to produce ethanol from grape pomace. Very few
surveys have been carried out to study the yeast diversity from distillery waste
[41, 42]. More recently, distillery waste has also been found to be a potential reserve
for novel thermotolerant yeasts [3]. Such yeasts once successfully isolated and
characterised can be of interest in the field of biotechnology for efficient production
of ethanol from lignocellulosic biomass [27].
The above mentioned natural or anthropogenic ecosystems are all reservoirs of
rare and novel yeasts that can significantly contribute to the sustainable advancement
of biotechnological research across the globe. Yeast diversity of such specialised
habitats has not been completely exploited as a consequence of insufficient knowl-
edge or unavailability of detailed step-by-step isolation protocols. The current
chapter presents a comprehensive compilation of available methods that have been
suitably modified to successfully isolate yeasts from specialized and less explored
habitats like rumen, rotting wood, insect gut, flower/floral nectar, hot spring, com-
post, molasses/press mud and distillery waste (Fig. 12.1). We aim to provide a
complete set of methods as a reference for researchers who are interested in
exploring yeast biota from rare ecosystems.
16. Incubator
17. Laminar air flow cabinet
18. Measuring cylinders (500 ml
19. Micropipettes (P20, P200 & P1000)
20. Milli-Q water
21. Penicillin (HiMedia)
22. Petri-plates (90 mm)
23. pH meter,
24. Plastic bags (600 1000 or 1000 1600 size)
25. Plastic containers (500 and 1000 ml)
26. Refrigerated centrifuge
27. Refrigerator (4 C)
28. Screw-cap glass bottles (500 ml & 1000 ml)
29. Shaker Incubator
30. Streptomycin (HiMedia)
31. Weighing balance
32. Yeast Extract Peptone Dextrose (YEPD) agar plates, (10 g l1 yeast extract, 20 g
l1 mycological peptone, 20 g l1 dextrose, 20 g l1 agar; pH 5.0)
12.3 Methods
12.4.1.2 Protocol
(c) Select different yeast colonies after observation of morphology under a DIC
microscope and pick them anaerobically in the presence of N2 gas.
(d) Subculture these colonies on aerobic (YEPD plate) and anaerobic media
(serum roll bottles).
8. Anaerobic isolation on liquid media (enrichment):
(a) Inoculate 3 ml of homogenized rumen suspension in a 120 ml glass serum
bottle containing 30 ml of YEPD and PD broth with 0.1 ml resazurin (0.1%),
1 g l1 L-Cys-HCl and antibiotics as mentioned above.
(b) Incubate all serum bottles at 39.6 1 C and 30 1 C separately for
12–24 h at 150 rpm or until considerable growth has been obtained.
(c) Inoculate 100 μl of the above culture broth into serum bottles containing
YEPD media with antibiotics.
(d) Incubate all serum bottles at 39.6 1 C and 30 1 C separately for
24–72 h.
(e) Select morphologically distinct yeasts by observing under microscope and
subculture on aerobic (YEPD plate) and anaerobic media (roll bottles).
9. Preserve purified yeasts in 15% glycerol at 80 C and in liquid nitrogen
(196 C) until further use.
12.4.2.1 Materials
12.4.2.2 Protocol
1. Collect 15–30 live termites/beetles from rotting wood logs, soil, bark of trees and
transfer them to the laboratory at ambient conditions.
(Note: Dead termites/beetles are difficult to dissect and affect the gut micro-flora,
therefore, it is important to keep the insects alive until dissection)
12 Yeast Isolation Methods from Specialized Habitats 243
2. Surface-disinfect the insect body using 95% ethanol for 2 min and then rinse with
sterile distilled water.
3. Dissect and remove the gut from the insect under a stereomicroscope using
dissection needles/forceps and transfer the gut into a separate tube for crushing
in 0.9% sterile saline solution.
4. Pass the gut suspension through a 2 or 5 ml syringe twice to macerate the gut
contents.
5. Direct isolation on solid media:
(a) Spread 100 μl of the crushed suspension onto YEPD and YNB + xylose plate
containing antibiotics (100 μg ml1 streptomycin, 100 μg ml1 ampicillin
and 25 μg ml1chloramphenicol).
(Note: Do not autoclave YNB+ xylose medium; sterilize by filtration)
(b) Incubate all plates at 25–27 C for 24–96 h and observe frequently for growth
of yeast colonies.
6. Enrichment in liquid media:
(a) Inoculate 1 ml of gut suspension into 10 ml of YEPD and YNB + xylose
media in 50 ml flasks, each containing antibiotics (100 μg ml1 streptomycin,
100 μg ml1 ampicillin and 25 μg ml1chloramphenicol).
(b) Incubate all flasks at 25–30 C for 24–48 h at 150 rpm.
(c) After observing considerable growth, spread 100 μl of the culture broth on
YEPD and YNB + xylose plates containing antibiotics and incubate at
25–30 C for 24–72 h.
7. Select well-separated, morphologically different yeast colonies and streak on agar
plates (YEPD and YNB + xylose) to obtain purified cultures.
8. Preserve purified yeasts in 15% glycerol at 80 C and in liquid nitrogen
(196 C) until further use.
12.4.3.2 Protocol
12.4.4 Flower
12.4.4.1 Materials
12.4.4.2 Protocol
12.4.5 Nectar
12.4.5.1 Materials
12.4.5.2 Protocol
12.4.6.2 Protocol
12.5.1 Compost
12.5.1.1 Materials
12.5.1.2 Protocol
12.5.2 Molasses
12.5.2.1 Materials
12.5.2.2 Protocol
12.5.3.2 Protocol
7. Examine well-separated yeasts under the microscope and subculture them on agar
plates (YMA, YEPD, and SCBMM) to obtain purified cultures.
8. Preserve purified yeasts in 15% glycerol at 80 C and in liquid nitrogen
(196 C) until further use.
12.5.4.2 Protocol
[3]
1. Collect approximately 500 ml of effluent from distillery units associated with
sugar industries and transfer it to the laboratory immediately under aseptic
conditions.
2. Dilute the distillery effluent ten times with 0.9% saline solution prior to enrich-
ment and isolation experiments.
3. Direct isolation on solid media:
(a) Spread 100 μl of the diluted suspension on YMA and YEPD agar plates
containing antibiotics (100 μg ml1 streptomycin, 100 μg ml1 ampicillin
and 25 μg ml1chloramphenicol).
(b) Incubate the plates at 30 C for 24–96 h or until observation of yeast colonies.
(Note: Prepare serial dilutions (e.g. 104, 105) in case of overgrowth of
yeasts and repeat direct isolation)
4. Enrichment in liquid media:
(a) Inoculate 10 ml of diluted distillery effluent suspension into 100 ml of YMA
and YEPD media containing antibiotics (200 μg ml1 streptomycin,
200 μg ml1 ampicillin and 25 μg ml1chloramphenicol).
(b) Incubate the flasks at 30 C for 12–18 h at 150 rpm.
(c) Spread 100 μl of the above culture broth on YEPD plates and incubate at
30 C for 24–72 h.
5. Pick well-separated yeast colonies and subculture on YMA and YEPD media
plates to obtain pure yeast cultures.
252 R. Avchar et al.
6. Select morphologically different yeasts and streak them on YMA and YEPD agar
plates.
7. Preserve purified yeasts in 15% glycerol at 80 C and in liquid nitrogen
(196 C) until further use.
References
19. Lachance MA et al (2001) Biogeography of the yeasts of ephemeral flowers and their insects.
FEMS Yeast Res. https://doi.org/10.1016/S1567-1356(00)00003-9
20. Lappe-Oliveras P et al (2008) Yeasts associated with the production of Mexican alcoholic
nondistilled and distilled Agave beverages. FEMS Yeast Res. https://doi.org/10.1111/j.
1567-1364.2008.00430.x
21. Lund A (1974) Yeasts and moulds in the bovine rumen. J Gen Microbiol. https://doi.org/10.
1099/00221287-81-2-453
22. Lund A (1980) Yeasts in the rumen contents of musk oxen. J Gen Microbiol. https://doi.org/10.
1099/00221287-121-1-273
23. Miller TL, Wolin MJ (1974) A serum bottle modification of the Hungate technique for
cultivating obligate anaerobes. Appl Microbiol 27(5):985–987
24. Moya D et al (2018) Effects of live yeast (Saccharomyces cerevisiae) and type of cereal on
rumen microbial fermentation in a dual flow continuous culture fermentation system. J Anim
Physiol Anim Nutr. https://doi.org/10.1111/jpn.12975
25. Nagahama T (2006) Yeast biodiversity in freshwater, marine and deep-sea environments. In:
Biodiversity and ecophysiology of yeasts. https://doi.org/10.1007/3-540-30985-3_12
26. Nurhayati N et al (2018) Isolation and identification of Osmophilic yeasts isolated from
molasses sugarcane as bioethanol starter. https://doi.org/10.2991/fanres-18.2018.46
27. Pandey AK et al (2019) Evaluation of divergent yeast genera for fermentation-associated
stresses and identification of a robust sugarcane distillery waste isolate Saccharomyces
cerevisiae NGY10 for lignocellulosic ethanol production in SHF and SSF. Biotechnol Biofuels.
https://doi.org/10.1186/s13068-019-1379-x
28. Phaff HJ, Starmer WT (1980) Specificity of natural habitats for yeasts and yeast-like
organisms. In: Biological and activities of yeasts, pp 79–101
29. Phaff HJ, S. W. (1987) In: Rose JHAH (ed) Yeasts associated with plants, insects and soil, vol
1. Academic Press, London
30. Rasappan K, Kumar A, Santhosh P (2015) Studies on sugarcane pressmud and distillery waste
as a biofertilizer through composting. Int J Chem Sci 13(3):1333–1344
31. Ryckeboer J et al (2003) A survey of bacteria and fungi occurring during composting and self-
heating processes. Ann Microbiol 53(4):349–410
32. Saluja P, Prasad GS (2008) Candida ruelliae sp. nov., a novel yeast species isolated from
flowers of Ruellia sp. (Acanthaceae). FEMS Yeast Res. https://doi.org/10.1111/j.1567-1364.
2008.00372.x
33. Sirisan V et al (2013) Isolation, identification and growth determination of lactic acid-utilizing
yeasts from the ruminal fluid of dairy cattle. Lett Appl Microbiol. https://doi.org/10.1111/lam.
12078
34. Starmer WT, Lachance MA (2011) Yeast ecology. In: The yeasts. https://doi.org/10.1016/
B978-0-444-52149-1.00006-9
35. Suh SO et al (2005) The beetle gut: a hyperdiverse source of novel yeasts. Mycol Res. https://
doi.org/10.1017/S0953756205002388
36. Suh SO, Blackwell M (2004) Three new beetle-associated yeast species in the Pichia
guilliermondii clade. FEMS Yeast Res. https://doi.org/10.1016/j.femsyr.2004.06.001
37. Suh SO, Blackwell M (2005) Four new yeasts in the Candida mesenterica clade associated with
basidiocarp-feeding beetles. Mycologia. https://doi.org/10.3852/mycologia.97.1.167
38. Takashima M et al (2009) Cryptococcus tepidarius sp. nov., a thermotolerant yeast species
isolated from a stream from a hotspring area in Japan. Int J Syst Evol Microbiol. https://doi.org/
10.1099/ijs.0.004515-0
39. Tikka C et al (2013) Isolation and characterization of ethanol tolerant yeast strains.
Bioinformation. https://doi.org/10.6026/97320630009421
254 R. Avchar et al.
40. Tokuoka K et al (1985) Identification of yeasts isolated from high-sugar foods. J Gen Appl
Microbiol. https://doi.org/10.2323/jgam.31.411
41. Úbeda J et al (2014) Biodiversity of non-saccharomyces yeasts in distilleries of the La Mancha
region (Spain). FEMS Yeast Res. https://doi.org/10.1111/1567-1364.12152
42. Úbeda JF et al (2016) Genetic and phenotypic characterization of Saccharomyces spp. strains
isolated in distillery plants. FEMS Yeast Res. https://doi.org/10.1093/femsyr/fow035
43. de Vega C et al (2017) Flowers as a reservoir of yeast diversity: description of Wickerhamiella
nectarea f.a. sp. nov., and Wickerhamiella natalensis f.a. sp. nov. from South African flowers
and pollinators, and transfer of related Candida species to the genus Wickerhamiella as. FEMS
Yeast Res. https://doi.org/10.1093/femsyr/fox054
Index
A imaging modes
Adaptive robust binary pattern (ARBP), 125 fixed cells, QI mode, 165–167
Agarose gel electrophoresis, 187, 188 live cells, QI mode, 168
AlexaFluor 488® WGA Conjugate Staining, quantitative imaging (QI) mode, 165
218–220 tracking dynamic processes, QI mode,
Amino acid composition (AAC), 128 169, 170
Antifungal peptides, 118, 128, 130 immobilisation techniques, 164, 165
Antioxidant enzymes LSCM, 160
cellular antioxidant defense materials, 161
mechanisms, 146 morphology and ultrastructural properties,
and endogenous antioxidants, 146 159
quantification in fungi (see Quantification of operating modes, 160
antioxidant enzymes) physical interaction, 160
scavenging H2O2, 146 physicochemical properties, 159
Artificial neural network (ANN), 126 QI mode image/data processing, 172
Ascomycetes, 19 S. cerevisiae, 161
Aspergillus, 122 sample preparation
Aspergillus brasiliensis, 2 biochemical trapping, 164, 166
Aspergillus nidulans, 160 fixed samples, 163
Atomic composition (ATC), 128 live cell imaging, 163
Atomic force microscopy (AFM) PDMS stamp, 163, 164
AFM-QI, 160 Autofluorescence, 230, 231
AFM-QI-LSCM live cell imaging, 169,
171, 172
biological characteristics and processes, 160 B
biological interfaces, 159 Back propagation neural network (BPNN), 121
biological response, 159 Basic Local Alignment Search Tool
C. albicans, 161 (BLAST), 200
cell morphology, 160 Basidiomycota, 210
cellular mechanics, 160 Basophils, 108
cell wall surface, 161 Bayesian methods, 142
experimental methods Biosafety level one (BSL-1), 84
coating coverslips, 162, 163 Bird seed agar
preparing coverslips, 162 glucose, 79
factors, 161 history, 79
© The Author(s), under exclusive license to Springer Nature Switzerland AG 2022 255
V. K. Gupta, M. Tuohy (eds.), Laboratory Protocols in Fungal Biology, Fungal
Biology, https://doi.org/10.1007/978-3-030-83749-5
256 Index
Ribosomal RNA (rRNA) gene cluster, 177 Sodium dodecyl sulphate (SDS), 89
Root mean square error (RMSE), 123 Solid phase microextraction/gas
Rotten wood, 236, 246, 247 chromatography-mass spectrometry
Rumen, 236, 237, 239–242 (SPME/GC-MS), 119, 123
Spleen, 107
Sporangia, 87–90, 96, 97, 99, 100
S 18S rDNA, 142
Sabouraud agar 18S rRNA gene, 142
additives, 72 Standard phenol–chloroform purification
antibiotics/antimicrobials, 70 procedure, 142
antimicrobials, 72, 74 Sterile soil, 2, 4, 21
casein, 71 Streptomycin, 107
chloramphenicol, 74 Superoxide dismutase (SOD), 146, 147, 151,
commercial preparations, 75 152, 156
cycloheximide, 74 Supervised learning, 118
dermatophytes, 70 Support vector machines (SVM)
DTM, 81, 83 adhesins, 127, 128
fungal isolation, 85 ANN, 126
fungal media, 70 antifungal peptides, 118, 128, 129
fungal medium, 84 classification, 118
fungi, 84 colony fingerprinting, 124
glucose, 71 domain features, 119
growth media, 85 electronic nose, 123
growth of bacteria, 70 fungal adhesins, 127, 128
growth of fungi, 70 fungal bioinformatics, 130–133
ingredients, 71 fungal disease, 121
Malassezia species, 70 fungal infection detection, 122, 123
materials, 71, 72 fungal Keratitis images, 125
method grape leaf disease detection, 124, 125
incubation, 74 kernel functions, 119
inoculation, 74 machine learning, 118
modification preparation, 73 maize leaf, 120
standard preparation, 72, 73 maximum margin classifier, 119
variations, 73, 74 Pea Plant (Pisam sativam), 122
microbes, 75 peptide sequences, 118
modification, 70 plant leaves, 126, 127
mold morphology, 71, 75 protein interactions, 127
peptones, 71 quality detection, 121
plates, 84 regression algorithms, 118
Saccharomyces cerevisiae, 160 supervised learning, 118
Sanger method, 197 unsupervised learning, 118
Scavenging H2O2, 146
Selection of gene target
DNA markers, 195 T
in fungal molecular taxonomy and Thymus, 107
phylogeny, 195 Trichophyton species, 74
gene targets/molecular markers, 179–183
materials, 195
methods, 195, 196 U
PCR conditions and their respective primer Uncultured environmental fungi, 137
pairs, 189–194 Uncultured zoosporic fungi
steps for PCR amplification, 195 molecular approaches, 138
Silica gel, 4, 5, 16 plasmids, 142
Index 261
Z
W Zoospores, 137, 138, 141
Western blot, 113 Zoosporic forms, 137
Wood-feeding yeasts, 237 Zoosporic fungi, 138
CARD-FISH protocol, 92
CARD-FISH resolution, 92
Y Chyt1061, 91
Yeast, 160, 161, 165, 166 Chytridiales, 91
Yeast isolation methods Chytridiomycota, 91
from anthropogenic habitats chytrids, 87
compost, 247, 248 environmental samples, 91, 92
distillery effluent/spent wash, 251, 252 Escherichia coli, 91
molasses, 249 fluorescein, 92
press mud, 250 fluorochromes, 92
carbon-rich substrates, 238 hybridization method, 88
common materials, 239, 240 hybridization temperature, 91
composting, 238 identification and quantitative
diversity, 239 assessment, 88
enzymes, 238 materials, 89
flower, 238 methods, 89, 90
geographical barriers, 236 microbial food web dynamics, 88
insect gut, 236 microorganisms, 87
natural/anthropogenic ecosystems, 239 molecular surveys, 87
from natural habitats organisms, 91
flower, 245 phytoplankton, 87, 92
hot spring, 243, 244 protocol, 92
insect gut, 242, 243 rRNA gene, 91
nectar, 245, 246 simulation analysis, 88
rotten wood, 246, 247 sporangia, 88
rumen fluid/digesta, 240–242 Zygomycetous fungi, 3, 19